item: #1 of 390 id: abc-1008 author: Kocic, Aleksandra; Horvatic, Janja; Jelaska, Sven D title: Distribution and morphological variations of invasive macrophytes Elodea nuttallii (Planch.) H. St. John and Elodea canadensis Michx in Croatia date: 2014-10-06 words: 4750 flesch: 65 summary: High water levels are responsible for the linear spreading direction of E. nuttallii, E. nuttallii and E. canadensis show a wide range of morphological variation, which is characteristic of successful invaders. The most reliable morphologi- cal characters distinguishing E. nuttallii and E. canadensis are leaf width 0.5 mm below the tip and the angle at the apex. keywords: canadensis; croatia; elodea; leaf; leaves; length; nuttallii; species cache: abc-1008.pdf plain text: abc-1008.txt item: #2 of 390 id: abc-101 author: Williams, David M. title: Araphid Diatom Classification and The "Absolute Standard" date: 2009-10-21 words: 4159 flesch: 60 summary: However, several branches in the tree have monophyletic groups that include some species of Licmophora and could be named if one so desired: nodes 3, 6, 7, and 9, of which only one can be Licmophora s.s., the group that in- cludes its type, Licmophora argentescens C.A. Agardh. Since that time a few more papers have appeared on 'araphid' diatom phylogeny, particularly from a molecular perspective (SATO et al. 2008a, 2008b, MEDLIN et al. 2008a, 2008b). keywords: genus; licmophora; node; species; sub; tree cache: abc-101.pdf plain text: abc-101.txt item: #3 of 390 id: abc-102 author: Gladenkov, Andrey Yurievich title: Fossil diatom flora from the marine Paleogene stratigraphic key section of Northeast Kamchatka, Russia date: 2009-10-21 words: 4174 flesch: 59 summary: Conclusions The Alugivayam Formation of the Il’pinskii Peninsula stratigraphic section, northeast Kamchatka, contains Oligocene marine diatom assemblages of moderate to poor preserva- tion and low abundance. Above a base of the Alugivayam formation (m) 7 50 105 145 180 215 260 300 335 370 410 450 490 520 550 585 620 655 695 730 760 795 840 880 Sample #GIN- 70/ 44 43 3 4 42 5 19 18 41 14 40 13 17a 17 16 39 15 6 7 12 11 8 9 10 Relative abundance F VR R VR R R R R R VR R R R R R VR R VR R VR VR R VR VR Preservation p p p p m p p p p p p p p p p p p p Pyxilla sp. 1 Rhabdonema sp. 1 Sceptroneis sp. 1 Stellarima microtrias (Ehrenberg) Hasle et Sims 1 1 1 Stephanopyxis grunowii keywords: alugivayam; diatom; formation; gladenkov; oligocene cache: abc-102.pdf plain text: abc-102.txt item: #4 of 390 id: abc-1021 author: Vujcic, Valerija; Radic Brkanac, Sandra title: Physiological and biochemical responses of Fibigia triquetra (DC.) Boiss. to osmotic stress date: 2014-10-06 words: 5453 flesch: 56 summary: Plant drought stress: effects, mechanisms and management. to osmotic stress VALERIJA VUJČIĆ*, SANDRA RADIĆ BRKANAC Department of Biology, Faculty of Science, University of Zagreb, Rooseveltov trg 6, HR-10000 Zagreb, Croatia Abstract – Water defi cit in the soil leads to osmotic stress in plants. keywords: aldrich; content; mannitol; peg; period; plant; sigma; stress; triquetra; water cache: abc-1021.pdf plain text: abc-1021.txt item: #5 of 390 id: abc-1039 author: Khan, Sami U.; Din, Jalal U.; Qayyum, Abdul; Jaan, Noor E.; Jenks, Matthew A. title: Heat tolerance indicators in Pakistani wheat (Triticum aestivum L.) genotypes date: 2015-04-01 words: 6047 flesch: 64 summary: Keywords: anthesis, grain yield, heat stress, membrane stability index, milky seed stage, proline, soluble proteins, Triticum aestivum L., wheat Introduction High temperature is a major problem in fi eld cropping systems world-wide, with unex- pected spatial and temporal variations causing reduced plant growth and productivity (PAR- ENT et al. 2010). Therefore, an urgent need exists to develop wheat cultivars which are bet- ter able to withstand heat stress during later growth stages, or else mature earlier to escape the heat stress typically occurring later in the growing season. keywords: anthesis; as-2002; genotypes; grain; growth; heat; heat stress; plant; proline; signifi; stage; stress; yield cache: abc-1039.pdf plain text: abc-1039.txt item: #6 of 390 id: abc-104 author: Pite, Danielle P.; Lane, Kelly A.; Hermann, Anna K.; Spaulding, Sarah A.; Finney, Bruce P. title: Historical abundance and morphology of Didymosphenia species in Naknek Lake, Alaska date: 2009-10-21 words: 6152 flesch: 60 summary: The second objective of this paper is to examine the morphology of D. geminata cells preserved in sediments dating to 800 years B.P. and compare valve shape to modern, bloom-forming populations of D. geminata from around the world. Mean, standard deviation and number of D. geminata valves measured for valve length, width, footpole width, footpole constriction, headpole width, and headpole constriction (all in mm) for Naknek Lake, Matapédia River (Québec), Popo Agie River (Wyoming), Blue River (Colorado) and Waiau River (New Zealand). keywords: abundance; didymosphenia; footpole; geminata; headpole; lake; naknek; river cache: abc-104.pdf plain text: abc-104.txt item: #7 of 390 id: abc-105 author: Hernandez-Becerril, David U.; Moreno-Gutiérrez, Sara P.; Barón-Campis, Sofía A. title: Morphological variability of the planktonic diatom Thalassiosira delicatula Ostenfeld emend. Hasle from the Mexican Pacific, in culture conditions date: 2009-10-21 words: 4386 flesch: 59 summary: Thalassiosira species (Bacil- lariophyceae) from a Scottish sea-loch. Thalassiosira species from the southern Gulf of Mexco. keywords: cells; fig; figs; fultoportulae; hasle; marginal; processes; species; thalassiosira; valve cache: abc-105.pdf plain text: abc-105.txt item: #8 of 390 id: abc-1060 author: Hrusevar, Dario; Mitic, Bozena; Sandev, Dubravka; Alegro, Antun title: Echinochloa colona (L.) Link (Poaceae), a new species in the flora of Croatia date: 2015-04-01 words: 2526 flesch: 72 summary: Determination key for Echinochloa species in Croatia 1. Taxonomy and distribution of Echinochloa species with special ref- erence of their occurrence as weeds of rice. keywords: colona; croatia; echinochloa; medvednica; species; zagreb cache: abc-1060.pdf plain text: abc-1060.txt item: #9 of 390 id: abc-1061 author: Catoni, Rosangela; Gratani, Loretta; Sartori, Francesco; Varone, Laura; Granata, Mirko Umberto title: Carbon gain optimization in five broadleaf deciduous trees in response to light variation within the crown: correlations among morphological, anatomical and physiological leaf traits date: 2015-04-01 words: 11820 flesch: 63 summary: Among the considered species, A. campestre and C. avellana sun leaves were closer to shade leaf behavior and P. alba shade leaves were closer to sun leaf behavior. The relationship between canopy structure and the spa- tial distribution of light availability differs between primary and secondary growth forests (NICOTRA et al. 1999) and light availability in the understory is frequently associated with regeneration processes and the long-term survival of forest tree species (WOODS 2000). keywords: alba; chl; crown; et al; forest; leaf; light; plasticity; robur; shade; shade leaves; species; sun; sun leaves; sun shade; thickness cache: abc-1061.pdf plain text: abc-1061.txt item: #10 of 390 id: abc-1065 author: Magrini, Sara; Scoppola, Anna title: Variability of pollen aperture heteromorphism in annual pansies (Viola Section Melanium) date: 2015-04-01 words: 4217 flesch: 64 summary: Generally, 4- or 5-aperturate pollen grains represent more than 85% and very often more than 95% (TILL- BOTTRAUD et al. 1999). Still, 4-ap- erturate pollen grains were also observed by other authors (ERDTMAN 1952, DAJOZ et al. 1995, ESPEUT 1999). keywords: aperturate; grains; owers; pollen; species; viola cache: abc-1065.pdf plain text: abc-1065.txt item: #11 of 390 id: abc-1066 author: Chakraborty, Koushik; Singh, Amrit L.; Kalariya, Kuldeep A.; Goswami, Nisha; Zala, Pratap V. title: Physiological responses of peanut (Arachis hypogaea L.) cultivars to water deficit stress: status of oxidative stress and antioxidant enzyme activities date: 2015-04-01 words: 9486 flesch: 58 summary: The present study has shown higher activities of these enzymes under water stress, especially in tolerant cultivars, which is a desirable trait that may be associated with water defi cit stress tolerance in peanut. ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Physiological responses of peanut (Arachis hypogaea L.) cultivars to water defi cit stress: status of oxidative stress and antioxidant enzyme activities KOUSHIK CHAKRABORTY*, AMRIT L. SINGH, KULDEEP A. KALARIYA, NISHA GOSWAMI, PRATAP V. ZALA Directorate of Groundnut Research (ICAR), Junagadh – 362001, Gujarat, India Abstract – From a fi eld experiment, the changes in oxidative stress and antioxidant en- zyme activities were studied in six Spanish peanut cultivars subjected to 25−30 days of water defi cit stress at two different stages: pegging and pod development stages. keywords: activity; chlorophyll; cit; cit stress; content; cultivars; defi; defi cit; peanut; pegging; plants; pod; stage; stress; water; water defi cache: abc-1066.pdf plain text: abc-1066.txt item: #12 of 390 id: abc-1087 author: Brana, Slavko; Vukovic, Nina; Kaligaric, Mitja title: Least adder’s-tongue (Ophioglossum lusitanicum L.) in Croatia – distribution, ecology and conservation date: 2014-10-06 words: 3965 flesch: 58 summary: Altogether four species of Ophioglossum are registered in the European fl ora (DERRICK et al. 1987, AKEROYD 1993), three of them in Croatia and Istria: the adder’s-tongue (Ophioglossum vulgatum L.), least adder’s-tongue (O. lusitanicum L.) and small adder’s- tongue (O. azoricum Presl) (HRŠAK 1994, NIKOLIĆ and TOPIĆ 2005, BRANA and REŠETNIK * Corresponding author, e-mail: nina.vukovic@biol.pmf.hr Copyright® 2014 by Acta Botanica Croatica, the Faculty of Science, University of Zagreb. In addition, the composition of other species indi- cates that the largest populations of least adder’s-tongue are found in anthropogenically in- fl uenced, heterogeneous habitats, mostly transitions between pasture and garrigue vegeta- tion. keywords: acta; croatia; istria; localities; lusitanicum; ophioglossum; ora; pula; species cache: abc-1087.pdf plain text: abc-1087.txt item: #13 of 390 id: abc-110 author: Enache, Mihaela D.; Potapova, Marina title: A new species of Sellaphora (Sellaphoraceae) from Hannaberry Lake, Arkansas, U.S.A. date: 2009-10-21 words: 2598 flesch: 60 summary: Sellaphora species with fine striation, such as Sellaphora wallacei (Reimer) Potapova et Ponader (POTAPOVA and PONADER 2008: 172, Fig. 1) and S. rioplatensis Metzeltin, Lange-Bertalot et Garcia-Rodríguez (METZELTIN et al. 2005: 212, Pl. 67, Figs. 13–27) have already been reported from the Americas. Results Sellaphora pulchra Enache et keywords: diatom; figs; lake; sellaphora; species; valve cache: abc-110.pdf plain text: abc-110.txt item: #14 of 390 id: abc-112 author: Morales, Eduardo A.; Fernandez, Erika; Kociolek, J. Patrick title: Epilithic diatoms (Bacillariophyta) from cloud forest and alpine Epilithic diatoms (Bacillariophyta) from cloud forest and alpine streams in Bolivia, South America 3: diatoms from Sehuencas, Carrasco National Park, Department of Cochabamba date: 2009-10-21 words: 9280 flesch: 62 summary: Distal ends never reach valve apex and deflect markedly in the same direction and stop at valve face clear perimeter, never reaching the mantle. Notice clear central area in raphe valve and the ab- sence of such an area in the rapheless valve. keywords: achnanthidium; apices; area; bertalot; color; croat; diatoms; gomphonema; kützing; lange; morales; raphe; sehuencas; species; striae; taxa; valve cache: abc-112.pdf plain text: abc-112.txt item: #15 of 390 id: abc-113 author: Srajer, Johannes; Majlis, Burhanuddin J.; Gebeshuber, Ille C. title: Microfluidic simulation of a colonial diatom chain reveals oscillatory movement date: 2009-10-21 words: 4809 flesch: 59 summary: Forces acting on model diatom cells numbered from A1 to A10 for incoming flow condi- tions of 0.01 m s–1 in the positive x-direction. Keywords: Diatom chain, fluid dynamics, hydroelastics, nutrient uptake, computer simu- lation ACTA BOT. keywords: cells; chain; diatom; direction; flow; fluid; forces; gaps; gebeshuber; model cache: abc-113.pdf plain text: abc-113.txt item: #16 of 390 id: abc-1136 author: Safaei, Masoumeh; Sheidai, Masoud; Alijanpoor, Behnaz; Noormohammadi, Zahra title: Species delimitation and genetic diversity analysis in Salvia with the use of ISSR molecular markers date: 2016-04-01 words: 5659 flesch: 62 summary: Salvia species are herbaceous, suffruticose or shrubby perennials, rarely biennial or annual, often strongly aromat- ic. In addition, Salvia species are grown in parks and gardens as ornamental plants (Özdemir and Senel 1999). keywords: analysis; hsbu; issr; length; molecular; salvia; salvia species; species; structure cache: abc-1136.pdf plain text: abc-1136.txt item: #17 of 390 id: abc-114 author: Stachura-Suchoples, Katarzyna; Jahn, Regine title: Middle Miocene record of Pliocaenicus changbaiense sp nov. from Changbai (Jilin Province, China) date: 2009-10-21 words: 4155 flesch: 58 summary: The population from Changbai belongs to the group of Pliocaenicus species possessing complex alveolae, such as P. cathayanus Wang, P. jilinensis Wang and P. omarensis (Kuptsova) Stachura-S. et Khursevich. In this study, we focus on a middle Miocene population of Pliocaenicus species from China. keywords: costae; face; fultoportulae; mantle; pliocaenicus; species; stachura; suchoples; valve cache: abc-114.pdf plain text: abc-114.txt item: #18 of 390 id: abc-1140 author: Király, Gergely; Alegro, Antun title: Re-evaluation of the Panicum capillare complex (Poaceae) in Croatia date: 2015-04-01 words: 2817 flesch: 63 summary: The paper presents a new key for the determination of Croatian species of the com- plex and anticipates the invasion of P. riparium in the sub-Mediterranean regions of the Balkan Peninsula. Whereas SCHOLZ (2002) emphasized that P. riparium and P. barbipulvinatum Nash are not conspecifi c, the exhaustive study of AMARELL (2013a, b) showed that the names are probably synonymous. keywords: capillare; complex; croatia; mtb; panicum; riparium; species cache: abc-1140.pdf plain text: abc-1140.txt item: #19 of 390 id: abc-1148 author: Karaismailoglu, Mehmet Cengiz title: Morphological and anatomical features of seeds of Turkish Romulea taxa (Iridaceae) and their taxonomic significance date: 2015-04-01 words: 4612 flesch: 64 summary: Cross section structures of Turkish Romulea seeds; 1: overall appearance; anticlinal cell types: 2: fl at cell (R7), 3: crushed cell (R2, R3, R4, R5 and R6), 4: undulated cell (R1), types of embryo, 5: oval (R4 and R5), 6: prolonged (R1, R6 and R7), 7: globular (R2 and R3); for taxa abbreviations see Tab. 1; e – embryo, en – endosperm, sr – storage reserve, t – testa, ec – epidermal cells of testa, fc – fl at cell, ph – phytomelan layer, cc – crushed cell, uc – undu- lated cell; white scale bars = 100 μm, black scale bars = 50 μm. Fig. Turkey Abstract – This paper reports on the assessment of morphological (macro and micro) and anatomical characters of seeds of Romulea taxa distributed in Turkey with the use of one- way analysis of variance, cluster analysis and principal component analysis. keywords: characters; romulea; seeds; species; tab; taxa; testa; turkey; turkish cache: abc-1148.pdf plain text: abc-1148.txt item: #20 of 390 id: abc-1149 author: Bogdanovic, Sandro; Ljubicic, Ivica; Clementi, Moreno title: Aegilops uniaristata Vis. (Poaceae): typification and occurrence in Croatia date: 2015-04-01 words: 2464 flesch: 66 summary: Promontore, 06.1893, C. Marchesetti (ZA14870); Istra, okolica mjesta Bale, uz cestu, 30.05.2012, S. Bogdanović & I. Ljubičić (ZAGR33401); Istra, Premantura, Rt Ka- menjak, 30.05.2013, S. Bogdanović & I. Ljubičić (ZAGR33402); Hrvatska, Istra, Gornji Kamenjak, Rt Bumbište-Crvene stine, suhi travnjak, 30.05.2012, S. Bogdanović & I. Ljubičić (ZAGR31701); Hrvatska, Istra, Krnica, 28.05.2014, I. Vitasović Kosić & M. Brit- vec (ZAGR36459); Isola di Lesina, Dalmazia, s.d., Anonymous coll. In herbidis circa Zara, s.d., R. de Visiani (W-Rchb. 1889-0251356); keywords: aegilops; croatia; flora; herbarium; istria; pad; species; uniaristata cache: abc-1149.pdf plain text: abc-1149.txt item: #21 of 390 id: abc-115 author: Yang, Hong; Flower, Roger J.; Battarbee, Richard W. title: Influence of environmental and spatial variables on the distribution of surface sediment diatoms in an upland loch, Scotland date: 2009-10-21 words: 5681 flesch: 52 summary: Spatial variables [(principal coordinates of neighbour matrices (PCNM 1 and PCNM3) positively correlated with redundancy analysis axis 2], indicated that spatial variables, ignored in former studies, are a further influence on diatom distribution. Spatial distribution of surface sediment diatom concentrations (103 valves DW mg–1) in the Round Loch of Glenhead in April 2007. keywords: analysis; diatom; distribution; lake; loch; par; sediment; species; surface; variables; variation; water cache: abc-115.pdf plain text: abc-115.txt item: #22 of 390 id: abc-1156 author: Salopek Sondi, Branka title: A word from the new Editor in Chief date: 2014-04-17 words: 365 flesch: 48 summary: OPCE-STR.vp A word from the new Editor-in-Chief Dear authors, readers, and friends of Acta Botanica Croatica First of all, I want to express my thanks to the Editorial Board of Acta Botanica Croatica for its vote of confidence by appointing me the new Editor-in-Chief of the jour- nal. Acta Botanica Croatica has been fortunate to have had an outstanding editor over the last fifteen years, and I gratefully acknowledge my immediate predecessor, Professor Damir Vili~i}, for having established and maintained a particularly high standard of editorship. keywords: editor cache: abc-1156.pdf plain text: abc-1156.txt item: #23 of 390 id: abc-116 author: Manoylov, Kalina M.; Ognjanova-Rumenova, Nadja; Stevenson, Robert J. title: Morphotype variations in subfossil diatom species of Aulacoseira in 24 Michigan Lakes, USA date: 2009-10-21 words: 7288 flesch: 65 summary: In: LAST, W. M. and J. P. SMOL (eds), Tracking environmental change using lake sediments, 1: Basin analysis, coring, and chronological techniques, 73–105. Taxonomy, phylogeny, and paleoecology of Eoseira wilsonii gen. et sp. nov., (Bacillariophyceae: Aulacoseiraceae) from lake sediments at Horsefly, British Columbia, Canada. keywords: aulacoseira; camburn; diatom; figs; lake; mantle; sediments; siver; species; valve cache: abc-116.pdf plain text: abc-116.txt item: #24 of 390 id: abc-1163 author: Kókai, Zsuzsanna; Bácsi, István; Török, Péter; Buczkó, Krisztina; T-Krasznai, Eniko; Balogh, Csaba; Tóthmérész, Béla; B-Béres, Viktória title: Halophilic diatom taxa are sensitive indicators of even short term changes in lowland lotic systems date: 2015-10-01 words: 6441 flesch: 54 summary: H-1476 Hungary Abstract – The occurrence and spread of halophilic diatom taxa in freshwater lotic eco- systems are infl uenced both by natural processes and anthropogenic pollution. Halophilic diatom taxa correlating positively with chloride and hydrogen carbonate concen- tration. keywords: autumn; changes; class; classes; diatom; diatom taxa; et al; nitzschia; number; size; spring; taxa; taxa number cache: abc-1163.pdf plain text: abc-1163.txt item: #25 of 390 id: abc-1164 author: B-Béres, Viktória; Bácsi, István; T-Krasznai, Eniko; Kókai, Zsuzsanna; Buczkó, Krisztina title: First report of Navicula jakovljevicii Hustedt (Bacillariophyta) from Hungary: distribution, comparative morphology and a related species date: 2015-10-01 words: 4800 flesch: 62 summary: Details of Navicula lucida valves. H-1476 Hungary Abstract – In Hungary Navicula jakovljevicii was fi rstly recorded in biofi lm of Elodea nut- tallii in 2005 in an oxbow of the catchment area of the River Danube. keywords: diatom; distribution; fig; jakovljevicii; navicula; raphe; species; valve cache: abc-1164.pdf plain text: abc-1164.txt item: #26 of 390 id: abc-1165 author: Kövér, Csilla; Korponai, János; Harangi, Sándor; Buczkó, Krisztina title: A new European record of Diadesmis fukushimae and its transference to Humidophila genus (Bacillariophyta) date: 2015-10-01 words: 2816 flesch: 66 summary: 2. Humidophila fukushimae: scanning electron micrograph (SEM), external valve view; valve face and open bands (A); details of the central area with central pores that are entirely fl anked by de- pressions (B), note relief–like patches in the area between raphe and areolae; details of apices with the simple raphe ends (C), note ridge of silica at the junction of valve face and mantle; en- tire frustule (D). Locations and some chemical parameters of the lakes where Humidophila fukushimae was found. keywords: bertalot; diadesmis; diatom; figs; fukushimae; humidophila; lange; valve cache: abc-1165.pdf plain text: abc-1165.txt item: #27 of 390 id: abc-1171 author: Dreßler, Mirko; Verweij, Geurt; Kistenich, Sonja; Kahlert, Maria; Werner, Petra title: Applied use of taxonomy: lessons learned from the first German intercalibration exercise for benthic diatoms date: 2015-10-01 words: 9661 flesch: 60 summary: In the Lake Krossinsee sample the three auditors identifi ed N. cryptotenella with 5.9– 10.0% (average 8.3%) (Fig. 3B), while 33 of the 37 participants detected N. cryptotenella with 1.4–8.9% (average: 5.4%) (Fig. 3B). Similarly, the results of auditor no. 40, who solely identifi ed N. cf. cryptotenella, emphasize the taxonomic problems within the N. cryptotenella and N. cryptotenelloides- group. keywords: bertalot; cation; fig; identifi; lake; lange; participants; placentula; species; striae; valves cache: abc-1171.pdf plain text: abc-1171.txt item: #28 of 390 id: abc-1172 author: Kociolek, John Patrick; Williams, David M. title: How to define a diatom genus? Notes on the creation and recognition of taxa, and a call for revisionary studies of diatoms date: 2015-10-01 words: 7584 flesch: 59 summary: Many diatom genus names in everyday use have never had a systematic revision; the same is true for many higher levels of classifi ca- tion. DIATOM GENUS: keywords: characters; diatom; genera; genus; groups; kociolek; new; species; taxa cache: abc-1172.pdf plain text: abc-1172.txt item: #29 of 390 id: abc-1174 author: Kahlert, Maria; Savatijevic Rasic, Ivana title: Similar small-scale variation of diatom assemblages on different substrates in a mesotrophic stream date: 2015-10-01 words: 5868 flesch: 60 summary: Differences in diatom assemblages scraped from plants (submerged macrophytes and mosses) with replicates at different spatial scales. 4. Differences in diatom assemblages scraped from stones (left) and plants (right, submerged macrophytes and mosses) with replicates at different spatial scales. keywords: assemblages; diatom; plants; sampling; scale; scale variation; stones; stream; substrates; taxa; variation cache: abc-1174.pdf plain text: abc-1174.txt item: #30 of 390 id: abc-1175 author: Krizmanic, Jelena; Ilic, Marija; Vidakovic, Danijela; Subakov Simic, Gordana; Petrovic, Jelena; Cvetanovic, Katarina title: Diatoms of the Dojkinci River (Stara Planina Nature Park, Serbia) date: 2015-10-01 words: 5644 flesch: 61 summary: Key words: Brachysira intermedia, Chamaepinnularia mediocris, Diatomella balfouri- ana, diatoms, distribution, Dojkinci River, Navicula tridentula. The substrate through the longest part of the Dojkinci River runs is red fi ne-grained sandstone, whose color comes from the large amount of Fe2O3 and is extremely rich in quartz sand (ANDJELKOVIĆ 1958), as opposed to most of rivers in Serbia, which have their beds made dominantly of carbonate (MARKOVIĆ 1980). keywords: bertalot; diatoms; dojkinci; ehrenberg; eunotia; figs; grunow; krammer; kützing; lange; navicula; river; serbia; species cache: abc-1175.pdf plain text: abc-1175.txt item: #31 of 390 id: abc-1177 author: Dedic, Anita; Plenkovic-Moraj, Andjelka; Kralj Borojevic, Koraljka; Hafner, Dubravka title: The first report on periphytic diatoms on artificial and natural substrate in the karstic spring Bunica, Bosnia and Herzegovina date: 2015-09-29 words: 5352 flesch: 56 summary: Use of artifi cial substrates (glass slides) for quantifi cation of periphyton was recom- mended by WAHL and MARK (1999), ALBAY and AKCAALAN (2003), LIBORIUSSEN (2005) who consider them more favorable for experimental growth than natural substrates. Achnanthidium exiguum, Achnanthidium minutissimum, Amphora pedicu- lus, Cymbopleura amphicephala and Surirella minuta were recorded in all samples of natural substrate and Gomphonema minutum in artifi cial substrate samples. keywords: artifi; bertalot; bunica; cial; diatoms; ehrenberg; kützing; lange; spring; substrate; taxa; water cache: abc-1177.pdf plain text: abc-1177.txt item: #32 of 390 id: abc-1178 author: Nenadovic, Tina; Sarcevic, Tena; Cizmek, Hrvoje; Godrijan, Jelena; Maric Pfannkuchen, Danijela; Pfannkuchen, Martin; Ljubesic, Zrinka title: Development of periphytic diatoms on different artificial substrates in the Eastern Adriatic Sea date: 2015-10-01 words: 7640 flesch: 59 summary: Key words: Adriatic Sea, anthropogenic materials, artifi cial substrates, diatoms, fouling, marine litter, periphyton Introduction Anthropogenic solid materials often end up in the marine environment and are com- monly known as marine litter. Since dia- toms form the bulk of initial colonizing biomass on immersed substrates, researchers have used artifi cial substrates to understand the preference of diatoms for a certain substrate (RO- DRIGUES and BICUDO 2001, DANILOV and EKELUND 2002, TANK and DODDS 2003, TOWNSEND and GELL 2005). keywords: abundance; artifi; biofi; cells; cells cm–2; cial; cm–2; diatoms; iron; marine; spp; substrates; surface; × × cache: abc-1178.pdf plain text: abc-1178.txt item: #33 of 390 id: abc-1182 author: Mejdandzic, Maja; Ljubesic, Zrinka; Ivankovic, Tomislav; Pfannkuchen, Martin; Godrijan, Jelena; Maric Pfannkuchen, Daniela; Hrenovic, Jasna title: Colonization of diatoms and bacteria on artificial substrates in the sea date: 2015-10-01 words: 6631 flesch: 57 summary: Further, these interactions appear to initialize the formation of diatom biofi lms and aggregates, as has been shown with marine microbial communities. For biofi lm analyses, the fouling was investigated using selective agar plates, epifl uores- cence, light and electronic microscopy, as well as high performance liquid chromatogra- phy (HPLC) pigment analysis. keywords: abundance; acta; bacteria; biofi; biofi lm; cells; diatoms; exposure; plates; surface cache: abc-1182.pdf plain text: abc-1182.txt item: #34 of 390 id: abc-1183 author: Bosak, Suncica; Gligora Udovic, Marija; Sarno, Diana title: The morphological study of Chaetoceros wighamii Brightwell (Chaetocerotaceae, Bacillariophyta) from Lake Vrana, Croatia date: 2015-10-01 words: 5567 flesch: 61 summary: SANCHEZ CASTILLO et al. (1992) discussed the identity of C. wighamii in relation with the taxa traditionally associated to it, i.e. C. amanita, C. bottnicus, C. biconcavum and C. cap- sicum. C. amanita (KACZMARSKA et al. 1985, RUSHFORTH and JOHANSEN 1986), but was not described in C. wighamii from Lake Chica (SANCHEZ CASTILLO et al. 1992) where apparently only terminal valves were observed by electron microscopy. keywords: amanita; chaetoceros; et al; freshwater; lake; morphology; setae; species; valve; vrana; wighamii cache: abc-1183.pdf plain text: abc-1183.txt item: #35 of 390 id: abc-119 author: Rusanov, Alexander G.; Stanislavskaya, Elena V.; Acs, Eva title: Distribution of periphytic diatoms in the rivers of the Lake Ladoga basin (Northwestern Russia) date: 2009-10-21 words: 5475 flesch: 59 summary: Keywords: Diatom, periphyton, distribution, gradient, eutrophication, Lake Ladoga, Russia Introduction Periphytic diatoms are excellent indicators of ecological condition of rivers and streams, because of their ability to respond rapidly to changes in nutrient concentrations. The rivers flowing into Lake Ladoga on the northern and eastern coasts (Burnaya, Khiitolan, Iijoki, Mijnola, Yanis, Uksun, Tulema, Vidlitsa, Tuloksa, Olonka, Svir) belong to the northern sub-basin, while rivers of the west- ern, southern and southeastern coasts (Avloga, Morje, Lava, Volkhov, Syas, Pasha, Oyat,) belong to the southern sub-basin (Fig. 1). keywords: basin; conductivity; diatom; kütz; ladoga; lake; phosphorus; rivers; southern; species; sub; var cache: abc-119.pdf plain text: abc-119.txt item: #36 of 390 id: abc-1191 author: Malesevic, Nikola; Ciglenecki, Irena; Bura-Nakic, Elvira; Caric, Marina; Dupcic, Iris; Hrustic, Enis; Vilicic, Damir; Ljubesic, Zrinka title: Diatoms in an extreme euxinic environment (Rogoznica Lake, eastern Adriatic coast) date: 2015-10-01 words: 4339 flesch: 54 summary: The maxima of species abundances in the lake are in the same order of magnitude as maxima of species abundances in other coastal regions of the eastern Adriatic Sea (CETINIĆ et al. 2006, VILIČIĆ et al. 2009, BOSAK et al. 2009, BUŽANČIĆ et al. 2012, MARIĆ et al. 2012, VIDJAK et al. 2012, GODRIJAN et al. 2013). The diatom composition is characterized by low species diversity and high single species abundance (up to 107 cells L–1). keywords: ciglenečki; conditions; et al; lake; phytoplankton; rogoznica; species cache: abc-1191.pdf plain text: abc-1191.txt item: #37 of 390 id: abc-1199 author: Bolgovics, Ágnes; Ács, Éva; Várbíró, Gábor; Kiss, Tihamér Keve; Borics, Gábor title: Diatom composition of the rheoplankton in a rhithral river system date: 2015-10-01 words: 5479 flesch: 60 summary: An elementary, structural analysis of river phytoplankton. Although the phytoplankton in rhithral rivers is infl u- enced by stochastic events, our results reveal that geographical and hydromorphological characteristics of the rivers and coverage of macrophytes can also play role in shaping the composition and diversity of the phytoplankton. keywords: acta; borics; diversity; kiss; phytoplankton; rivers; species; water cache: abc-1199.pdf plain text: abc-1199.txt item: #38 of 390 id: abc-12 author: Lincy, Adinkudik K.; Remashree, Azhimala B.; Sasikumar, Bhaskaran title: Indirect and direct somatic embryogenesis from aerial stem explants of ginger (Zingiber officinale Rosc.) date: 2009-10-21 words: 4960 flesch: 52 summary: Jamaica, 100% of cultures produced somatic embryos by 30–35 days of culturing and in the var. Varada, only 50% of cultures resulted in somatic embryo induction after 45 days of cultur- ing. The desiccated calli produced white friable calli which turned embryogenic and then produced somatic embryos in a medium containing 2 mg L–1 benzyl amino purine. keywords: callus; embryogenesis; embryos; explants; ginger; medium; shoot; somatic; stem cache: abc-12.pdf plain text: abc-12.txt item: #39 of 390 id: abc-120 author: Rovira, Laia Torres; Trobajo, Rosa Pujadas; Ibanez, Carles Marta title: Periphytic diatom community in a Mediterranean salt wedge estuary: the Ebro Estuary (NE Iberian Peninsula) date: 2009-10-21 words: 6473 flesch: 61 summary: An ecological study of brackish water diatom community in wetlands, near the Tseng-Wen estuary, in southwestern Taiwan. Several investigations had used artifi- cial substrata to study periphytic diatom communities in estuaries and other transitional systems (MCINTIRE and OVERTON 1971; MCINTIRE 1973, 1978; MOORE and MCINTIRE 1977; LAI 2001; TROBAJO et al. 2004; NAYAR et al. 2005). keywords: community; diatom; ebro; estuary; fig; october; river; salt; water; wedge cache: abc-120.pdf plain text: abc-120.txt item: #40 of 390 id: abc-1225 author: Prlic, Dragan title: Small-flowered bittercress, Cardamine parviflora L. (Brassicaceae), a new species of the Croatian flora date: 2015-04-01 words: 2427 flesch: 62 summary: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Short communication Small-fl owered bittercress, Cardamine parvifl ora L. (Brassicaceae), a new species of the Croatian fl ora DRAGAN PRLIĆ* Donji Meljani 92C, HR-33520 Slatina, Croatia Abstract – Cardamine parvifl ora L. was discovered in April 2014 during the study of vascular fl ora and habitats in the area of Slatina (Slavonia region). keywords: area; cardamine; croatia; flora; ora; parvifl; species cache: abc-1225.pdf plain text: abc-1225.txt item: #41 of 390 id: abc-1236 author: Andric, Andrijana; Rat, Milica; Zoric, Lana; Lukovic, Jadranka title: Anatomical characteristics of two Ornithogalum L. (Hyacinthaceae) taxa from Serbia and Hungary and their taxonomic implication date: 2016-04-01 words: 8165 flesch: 65 summary: ISSN 0365-0588 eISSN 1847-8476 Anatomical characteristics of two Ornithogalum L. (Hyacinthaceae) taxa from Serbia and Hungary and their taxonomic implication Andrijana M. Andrić*, Milica M. Rat, Lana N. Zorić, Jadranka Ž. Luković Department of Biology and Ecology, Faculty of Science, University of Novi Sad, Trg Dositeja Obradovića 2, 21000 Novi Sad, Serbia Abstract – Anatomical characters of two morphologically similar Ornithogalum taxa, O. umbellatum and O. divergens, were investigated. O. divergens was de- scribed as a subspecies of O. umbellatum in both of them. keywords: cells; cross; divergens; leaf; ornithogalum; scapus; tissue; umbellatum cache: abc-1236.pdf plain text: abc-1236.txt item: #42 of 390 id: abc-124 author: Binzet, Rıza; Akcin, Oznur E. title: Nutlet size, shape and surface ornamentation in 14 Onosma species (Boraginaceae) date: 2009-10-21 words: 4430 flesch: 72 summary: The colour of the nutlets is brown in O. sintenisii, O. intertextum and O. bourgaei; gray-pale brown in O. papillosum, O. mer- sinana, O. briquetii and O. riedliana; pale brownish in O. ambigens and O. rascheyanum; pale gray in O. bulbotrichum; gray in O. lycaonicum; reddish brown in O. caerulescens; gray brown in O. angustissimum and O. giganteum. O. bulbotrichum has type 5. O.sintenisii, O. papillosum and O. bulbotrichum belong to the subsection Haplotricha. keywords: e e; e n; m e; type cache: abc-124.pdf plain text: abc-124.txt item: #43 of 390 id: abc-125 author: Klein, Georgia; Kaczmarska, Irena; Ehrman, James M. title: The diatom Chaetoceros in ships ballast waters survivorship of stowaways date: 2009-10-21 words: 6168 flesch: 59 summary: calcitrans were found in ballast water samples arriving in Vancouver, while our extensive literature search shows them reported thus far only from the EC. We found ballast water cell densities comparable to that found in one sample from the receiving port of Vancouver, where a bloom of one Chaetoceros species produced 2.7 x 103 viable cells L–1 and 87 spores L–1. keywords: ballast; ballast water; cells; chaetoceros; diatom; hargraves; samples; species; spores; vegetative; water cache: abc-125.pdf plain text: abc-125.txt item: #44 of 390 id: abc-1261 author: Zebec, Marko; Idzojtic, Marilena; Satovic, Zlatko; Poljak, Igor; Liber, Zlatko title: Alive and kicking, or, living on borrowed time? – Microsatellite diversity in natural populations of the endangered Ulmus minor Mill. sensu latissimo from Croatia date: 2016-04-01 words: 5604 flesch: 57 summary: As elm populations in Croatia do not demonstrate a statistically signifi cant deviation from HW equilibrium, it could be claimed that the danger of the appearance of inbreeding within observed populations is relatively small. Source, repeat motifs, size ranges, number of alleles (Na), observed (Ho) and expected heterozygosity (He) and polymorphic in- formation content (PIC) for fi ve microsatellite loci used in fi ve Ulmus populations (n = 96). keywords: croatia; diversity; eld; elm; loci; nin; populations; signifi; ulmus; values; zagreb cache: abc-1261.pdf plain text: abc-1261.txt item: #45 of 390 id: abc-1264 author: Stesevic, Danijela; Berg, Christian title: Botrychium matricariifolium, a new fern species for the flora of Montenegro date: 2015-04-01 words: 2391 flesch: 64 summary: According to the Analytical Flora of Yugoslavia (MAYER and HORVATIĆ 1967), in the fl oras of neighboring countries following Botrychium species were recorded: B. simplex (in Herzegovina) and B. multifi dum (Serbia); thus both species could be expected in the fl ora of Montenegro. In narrow sense the genus contains 30 species (HAUK et al. 2003, DAUPHIN et al. 2014), distributed throughout Europe, North America, Asia, Australia, Africa (Atlas Mountains), the Pacifi c Islands, New Zealand, and Patagonia (South Ameri- ca) (MAYER and HORVATIĆ 1967, ELLIS 2014). keywords: botrychium; european; matricariifolium; montenegro; species cache: abc-1264.pdf plain text: abc-1264.txt item: #46 of 390 id: abc-127 author: Bosak, Suncica; Buric, Zrinka; Djakovac, Tamara; Vilicic, Damir title: Seasonal distribution of plankton diatoms in Lim Bay, northeastern Adriatic Sea date: 2009-10-21 words: 5587 flesch: 54 summary: Location of the sampling stations in Lim Bay, north east Adriatic Sea, visited from March 2002 to November 2007. A de- tailed taxonomic analysis showed a more or less similar composition of plankton diatoms recorded in both Lim Bay and north east Adriatic Sea, with some differences. keywords: adriatic; bay; diatoms; distribution; et al; lim; nov; phytoplankton; sea; spp; vili^i; year cache: abc-127.pdf plain text: abc-127.txt item: #47 of 390 id: abc-1273 author: Aykurt, Candan; Deniz, Ismail Gökhan; Sari Yol, Duygu; Vural, Mecit; Sümbül, Hüseyin title: Resurrection of Ornithogalum brevipedicellatum (Asparagaceae) with morphological and molecular data date: 2016-04-01 words: 5083 flesch: 62 summary: Although O. pamphylicum was placed in a different branch, it was the closest species to O. brevipedicellatum while O. oligophyl- lum and O. pyrenaicum species were positioned in another group. Features O. brevipedicellatum O. oligophyllum O. pamphylicum Scape length (cm) 3–12 (borne at ground level) keywords: aykurt; brevipedicellatum; gazi; mountain; oligophyllum; ornithogalum; ornithogalum brevipedicellatum; pamphylicum; species; turkey cache: abc-1273.pdf plain text: abc-1273.txt item: #48 of 390 id: abc-1275 author: Juretic, Biserka title: Botanical Garden of the Faculty of Science, University of Zagreb 125th Anniversary Celebration (1889–2014) date: 2014-10-06 words: 1385 flesch: 59 summary: The members of the European Botanic Gardens Consortium (EBGC), national representatives of botanical gardens from EU countries, Switzerland and Norway, meet in our Garden for the fi rst time in June. 73 (2), S1–S4, 2014 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Botanical Garden of the Faculty of Science, University of Zagreb 125th Anniversary Celebration (1889–2014) The oldest university botanical garden in Croatia, the Botanical Garden of the Faculty of Science, University of Zagreb, this year, through a variety of events, celebrates 125 years of continuous work. keywords: botanical; garden; university; zagreb cache: abc-1275.pdf plain text: abc-1275.txt item: #49 of 390 id: abc-128 author: Kolodziejek, Jeremi title: Potentilla x aurulenta Gremli (Rosaceae), a nothospecies new to Poland date: 2009-10-21 words: 1385 flesch: 66 summary: Character P. heptaphylla P. tabernaemontani Potentilla ´aurulenta Stems with slender stock; lateral flowering stems up to 40 cm with numerous procumbent woody stems freely rooting at the nodes; lateral flowering stems not more than 10 cm high with slender stock; lateral flowering stems up to 30–40 cm Leaflets ovate-lanceolate, dentate or creneate-dentate cuneate-oblanceolate, dentate or cuneate- -dentate ovate-lanceolate, dentate Stipules stipules of basal leaves ovate- -lanceolate, acute stipules of basal leaves linear to linear-triangular stipules of basal leaves lanceolate, acute Hairiness hairs on stems and leaves with soft hairs borne on minute tubercles at base, and shorter, often reddish multicellular glandular hairs hairiness consisting of simple curved hairs only hairiness consisting of mixture of simple curved and straight hairs borne on minute tubercles at base Sepals ovate-lanceolate; epicalyx segments linear-lanceolate, as long as or shorter than sepals ovate, epicalyx segments lanceolate, obtuse, much shorter than sepals ovate, epicalyx segments lanceolate, obtuse, shorter than sepals Petals 5–7 mm 6–10 mm 5–10 mm U:\ACTA BOTANICA\Acta-Botan 1-09\Kolodziejek2.vp 17. ABCRA 25 Short communication ISSN 0365–0588 Potentilla ´ aurulenta Gremli (Rosaceae), a nothospecies new to Poland JEREMI KOLV ODZIEJEK* Department of Geobotany and Plant Ecology, University of LV ódzb, Banacha 12/16, 90-237 LV ódzb, Poland Potentilla ´aurulenta Gremli (= P. heptaphylla keywords: aurulenta; hairs; potentilla cache: abc-128.pdf plain text: abc-128.txt item: #50 of 390 id: abc-129 author: Flower, Roger J.; Ryves, David B. title: Diatom preservation: differential preservation of sedimentary diatoms in two saline lakes date: 2009-10-21 words: 7568 flesch: 45 summary: This seems to indicate that, al- though high salinity is inimical to diatom valve preservation (cf. Diatom preservation: differential preservation of sedi- mentary diatoms in two saline lakes ROGER J. FLOWER1*, DAVID B. RYVES2 1 Environmental Change Research Centre, Department of Geography, University College London, Gower Street, London WC1E 6BT, UK 2 Department of Geography, Loughborough University, Loughborough LE11 3TU, UK keywords: core; diatom; dissolution; et al; fig; index; lake; preservation; ryves; sediment cache: abc-129.pdf plain text: abc-129.txt item: #51 of 390 id: abc-1294 author: Nowak, Arkadiusz; Nowak, Sylwia; Nobis, Marcin title: Spring weed communities of rice agrocoenoses in central Nepal date: 2016-04-01 words: 14338 flesch: 91 summary: Species richness, Shannon diversity index, cover of herb layer, water depth and altitudinal distribution of rice fi eld communities in central Nepal. Key words: anthropogenic habitats, Oryzetea sativae, rice fi elds, segetal communities * keywords: communities; cover; elds; nepal; nowak; plant; rice; species; vegetation; water; weed cache: abc-1294.pdf plain text: abc-1294.txt item: #52 of 390 id: abc-130 author: Yoshitake, Sakiko; Fukushima, Hiroshi; Kimura, Tsutomu; Lepskaya, Ekatarina V.; Ko-Bayashi, Tuyako title: Variability of the pennatae diatom Gomphonema ventricosum Gregory from far eastern lakes date: 2009-10-21 words: 3182 flesch: 66 summary: We classified the specimens into five types with respect to valve outline; (1) type A (type form of Gomphonema ventricosum), (2) type B (Lake Baikal type), (3) type C (Lake Karluk type), (4) type D (Gomphoneis septa type) and (5) type E (G. ventricosum f. curta type). The present study examined by light microscope the morphological variations of 625 specimens of Gomphonema ventricosum Gregory collected from Lake Hövsgöl (Mongo- lia), Lake Baikal (Russia) and Lake Kurilskoye (Kamchatka, Russia). keywords: baikal; hövsgöl; kurilskoye; lake; specimens; type; ventricosum cache: abc-130.pdf plain text: abc-130.txt item: #53 of 390 id: abc-1318 author: Lai, Giuseppina Grazia; Padedda, Bachisio Mario; Wetzel, Carlos Eduardo; Lugliè, Antonella; Sechi, Nicola; Ector, Luc title: Epilithic diatom assemblages and environmental quality of the Su Gologone karst spring (centraleastern Sardinia, Italy) date: 2016-04-01 words: 11771 flesch: 60 summary: * * Caloneis fontinalis (Grunow) Cleve-Euler X f – – – – – – Caloneis lancettula (Schulz) Lange-Bertalot & Witkowski X – – – – – – Campylodiscus hibernicus Ehrenberg X * Cocconeis euglypta Ehrenberg X X r – ak ot-h o-α oligo-eu 2 Cocconeis neothumensis Krammer X V akb – o – – Cocconeis placentula sensu lato Ehrenberg X X f – ak ot x-β oligo-meso 2 Cocconeis placentula var. Grunow X X * n oe o oligo – Encyonema vulgare Krammer X V – – – – – Eolimna minima (Grunow) Lange-Bertalot X r * keywords: bertalot; cantonati; dell’uomo; diatom; gologone; karst; lange; l–1; meso; navicula; oligo; quality; sardinia; species; spring; taxa; total; water cache: abc-1318.pdf plain text: abc-1318.txt item: #54 of 390 id: abc-132 author: Stilinovic, Bozidar; Hrenovic, Jasna title: Plate method for counting the proteolytic sulphide-producing bacteria date: 2009-10-21 words: 4112 flesch: 58 summary: The composition of PCA medium was (in g L –1 of distilled water): peptone bacteriological (Biolife) 5.0; proteose peptone (Biolife) 5.0; L-cysteine (Fluka) 0.25; NaCl (Kemika) 5.0; ammonium iron (III) citrate (Sigma-Aldrich) 1.0; K2HPO4 (Kemika) 0.3; agar (Biolife) 15.0; pH 7.4±0.2. Namely, the concentration of dissolved oxygen was higher in water samples (6.9–9.1 mg O2 L –1 ), while the sediment samples were anoxic (0.3–2.0 mg O2 L –1 ). keywords: bacteria; cfu; isa; pca; pspb; samples; sim cache: abc-132.pdf plain text: abc-132.txt item: #55 of 390 id: abc-1331 author: Bartolucci, Fabrizio; Conti, Fabio title: Alyssum desertorum Stapf (Brassicaceae) new for the Italian Flora date: 2016-04-01 words: 3286 flesch: 70 summary: Alyssum desertorum: a – infl orescence, b – raceme whit gla brous silicles and caducous sepals (Photo by: a – F. Conti, b – F. Bartolucci). da Fonte Ve- dice lungo la strada sterrata per Filetto (Barisciano, L’Aquila), incolto arido, 1200 m, 20 April 2013, F. Conti s.n. keywords: alyssum; bartolucci; conti; desertorum; dudley; italy; peruzzi cache: abc-1331.pdf plain text: abc-1331.txt item: #56 of 390 id: abc-1343 author: Stinca, Adriano; Galasso, Gabriele; Banfi, Enrico title: First Italian record of Paspalum notatum Flüggé (Poaceae) and its typification date: 2016-04-01 words: 2738 flesch: 70 summary: Corresponding author, e-mail: adriano.stinca@unina.it Introduction The genus Paspalum L. (Poaceae) comprises about 330 species (Zuloaga and Morrone 2005) and is chiefl y distrib- uted in tropical and temperate regions of America (Zuloaga et al. 2003). References Allen, C. M., Hall, D. W., 2002: 25.26 Paspalum L. keywords: notatum; paspalum cache: abc-1343.pdf plain text: abc-1343.txt item: #57 of 390 id: abc-1346 author: Denisow, Bozena; Anton, Sebastian; Wrzesien, Ma?gorzata title: Morphology of Anemone sylvestris L. flower (Ranunculaceae) date: 2016-04-01 words: 5721 flesch: 61 summary: The number of receptive stigmas was counted for each individual fl ower (n = 9 fl owers per consecutive day of anthesis) under a binocular microscope (NIKON SMZ-2B). The odourless perianth, absence of nectar, scarcity of pollen (approximately 200 000 pollen grains per fl ower) and its traits – small size (axis P = 18.52 ± 1.0 μm; E = 16.59 ± 0.9 μm), lack of balsam on the exine surface, starch accumulation in more than 95% of pollen grains correspond to the specialization in anemophily. keywords: acta; anemone; denisow; fl ower; grains; ower; pollen; pollination; ranunculaceae; species; sylvestris cache: abc-1346.pdf plain text: abc-1346.txt item: #58 of 390 id: abc-1353 author: Nowak, Arkadiusz; Nowak, Sylwia; Nobis, Marcin; Nobis, Agnieszka title: Dwarf shrub vegetation of rock ledges and clefts in the Pamir Alai Mountains (Middle Asia: Tajikistan) date: 2016-04-01 words: 14576 flesch: 86 summary: The paper is a part of our survey on rock vegetation in Tajikistan with the fi nal intention of building up the syn- taxonomical system of all types of rupicolous environments within the country. Typical- ly for rock crevice vegetation, moss species also contribute to the sampled plots, however with very low frequency. keywords: alai; asia; communities; dwarf; mts; nobis; nowak; pamir; plant; ranges; rock; species; tajikistan; vegetation; western cache: abc-1353.pdf plain text: abc-1353.txt item: #59 of 390 id: abc-1355 author: Siddiqui, Zamin Shaheed; Shahid, Huda; Cho, Jung-Il; Park, Sung-Han; Ryu, Tae-Hun; Park, Soo-Chul title: Physiological responses of two halophytic grass species under drought stress environment date: 2016-04-01 words: 6503 flesch: 62 summary: 75 (1), 31–38, 2016 CODEN: ABCRA 25 DOI: 10.1515/botcro-2016-0018 ISSN 0365-0588 eISSN 1847-8476 Physiological responses of two halophytic grass species under drought stress environment Zamin Shaheed Siddiqui1*, Huda Shahid1, Jung-Il Cho2*, Sung-Han Park2, Tae-Hun Ryu2, Soo-Chul Park2 1 Stress Physiology Lab., Department of Botany, University of Karachi, Karachi – 75270, Pakistan 2 National Academy of Agricultural Sciences, Rural Development Administration, Suwon 441-707, Republic of Korea Abstract – The physiological responses of two halophytic grass species, Halopyrum mucronatum (L.) Staph. and Cenchrus ciliaris (L.), under drought stress were evaluated. Results were discussed in relation to comparative physiological performance and antioxidant enzymes activity of both halophytic grasses under drought stress. keywords: ciliaris; content; drought; drought stress; mucronatum; plant; species; stress; water cache: abc-1355.pdf plain text: abc-1355.txt item: #60 of 390 id: abc-1373 author: Savkovic, Zeljko; Stupar, Milos; Ljaljevic Grbic, Milica; Vukojevic, Jelena title: Comparison of anti-Aspergillus activity of Origanum vulgare L. essential oil and commercial biocide based on silver ions and hydrogen peroxide date: 2016-04-01 words: 6336 flesch: 55 summary: As a result of O. vulgare EO activity, morpho- physiological changes in A. fl avus were showed by Souza et al. The strong antifungal activity of O. vulgare essential oil can be attributed to its high content of some phenolic com- pounds, mostly carvacrol and thymol (Viuda-Martos et al. 2007, Clef et al. 2013). keywords: activity; antifungal; aspergillus; biocide; et al; s003; sanosil; sect; vulgare cache: abc-1373.pdf plain text: abc-1373.txt item: #61 of 390 id: abc-1375 author: Cakir, Ozgur; Turgut Kara, Neslihan; Ari, Sule title: Selenium induced selenocysteine methyltransferase gene expression and antioxidant enzyme activities in Astragalus chrysochlorus date: 2016-04-01 words: 4537 flesch: 57 summary: These results show that an increase of SMT gene expression led to a rise in APX and POX, but a suppression of CAT and GR enzymes activities in Astragalus chrysochlorus. We used qPCR to measure SMT gene expression. keywords: activity; astragalus; callus; chrysochlorus; expression; gene; plant; selenium; smt cache: abc-1375.pdf plain text: abc-1375.txt item: #62 of 390 id: abc-1382 author: Terzi, Massimo; D’Amico, Franceso S. title: Dry grasslands of Hippocrepido glaucae-Stipion austroitalicae in the Pollino Massif (Calabria, Italy) date: 2016-04-01 words: 17044 flesch: 92 summary: Actually, the syntaxo- nomic position of Hippocrepido-Stipion raised one more time the question on the relationship between grassland vegetation of the Italian Peninsula and the western Balkans, after it has been debated for nearly 40 years (Lakušić 1969, Horvat et al. 1974, Bonin 1978, Royer 1991, Biondi et al. 1995, Fanelli et al. 2001, Terzi et al. 2010, Biondi and Galdenzi 2012, Terzi and Di Pietro 2013, Di Pietro and Wa- gensommer 2014, Biondi et al. 2014a). Tzvelev (1), Seseli tortuosum L. (1), Aira caryophyllea L. (+), Anagallis arvensis L. (+), Anisantha madritensis (L.) Nevski (+), Anthyllis vulneraria L. (+), Asterolinon linum-stellatum (L.) Duby (+), Avena barbata Link (+), Bellardia trixago (L.) keywords: austroitalica; biondi; hippocrepido; italy; mediterranean; stipetum; stipion; subsp; terzi; vegetation cache: abc-1382.pdf plain text: abc-1382.txt item: #63 of 390 id: abc-1387 author: Pavlovkin, Ján; Fiala, Roderik; Ciamporová, Milada; Martinka, Michal; Repka, Vladimír title: Impact of nickel on grapevine (Vitis vinifera L.) root plasma membrane, ROS generation, and cell viability date: 2016-04-01 words: 4167 flesch: 56 summary: The root epidermal cells being in direct contact with the environment are more sensitive comparing to the internal root tissues as shown in our previous re- search on grapevine root cells exposed to cadmium (Fiala et al. 2015). The time course of hydro- gen peroxide accumulation in grapevine root cells treated with 5 mmol L–1 Ni demonstrated that the highest hydrogen peroxide production occurred mainly after 180 min (Figs. 6A, B). keywords: cells; grapevine; l–1; membrane; mmol; ni2; plant; roots cache: abc-1387.pdf plain text: abc-1387.txt item: #64 of 390 id: abc-141 author: Fanuko, Neda; Valcic, Marko title: Phytoplankton composition and biomass of the northern-Adriatic lagoon of Stella Maris, Croatia date: 2009-10-21 words: 6650 flesch: 62 summary: al.1983, OREL et al. 2001, COVELLI et al. 2005), particularly with respect to lagoon phytoplankton (VATOVA 1940, 1961; MARCHESONI 1954; TOLOMIO 1982; TOLOMIO and BULLO 2001; FACCA et al. 2002, 2003; SOCAL et al. 2006). Location of Stella Maris lagoon with sampling site U:\ACTA BOTANICA\Acta-Botan 1-09\Fanuko.vp 16. keywords: adriatic; carbon; cell; fanuko; ju l; ju n; lagoon; maris; phytoplankton; species; stella; volume cache: abc-141.pdf plain text: abc-141.txt item: #65 of 390 id: abc-1427 author: Golob, Aleksandra; Germ, Mateja; Kreft, Ivan; Zelnik, Igor; Kristan, Urška; Stibilj, Vekoslava title: Selenium uptake and Se compounds in Se-treated buckwheat date: 2016-04-01 words: 7136 flesch: 59 summary: For each taxon and treatment one sample of plants (10–15 plants) was taken for determi- nation of Se content and Se speciation. We weighed 0.2 g of a lyophilized sample into a Tefl on tube and Se content was determined in three aliquots. keywords: activity; buckwheat; content; et al; germ; hybrid; kreft; plants; seeds; selenium; tartary cache: abc-1427.pdf plain text: abc-1427.txt item: #66 of 390 id: abc-1440 author: Stesevic, Danijela; Bubanja, Nada title: Five new alien species in the flora of Montenegro: Coreopsis tinctoria Nutt., Ipomoea indica (Burm.) Merr., Lupinus × regalis Bergmans, Physalis angulata L., and Solidago canadensis L. and new possible threats to the biodiversity date: 2017-04-01 words: 4376 flesch: 65 summary: This paper presents a supplement to the national list of alien plant species in Montenegro as well as to the general distribution of the mentioned aliens in SE Europe. Material and methods Plant material of fi ve new alien species for the fl ora of Montenegro was collected during fi eld investigations of the coastal and central part of the country, in the period from August 2013 to October 2014. Acknowledgements Authors would like to thank F. Essl, B. Beckmann, J., Jogan, M, Lešnik, V. Vladimirov, G. Fried, F. Verloove, M. Rat, V. Matevski for valuable help with the literature and information on alien plant species and Snežana Bulajić for improving our use of English. keywords: alien; flora; montenegro; new; ora; physalis; plant; species cache: abc-1440.pdf plain text: abc-1440.txt item: #67 of 390 id: abc-1451 author: Wrzesien, Malgorzata Beata; Denisow, Bozena title: The effect of agricultural landscape type on field margin flora in south eastern Poland date: 2016-10-01 words: 6908 flesch: 55 summary: This is consistent with a study conducted in Mediterranean region (Bassa et al. 2011) or Finland (Tarmi et al. 2009) and indicates the essentiality of fi eld margins as hotspots of plant species richness in agricultural landscape, irrespective of geographic regions, climatic types or fl ora history. Notwithstanding their positive impact on general spe- cies richness, fi eld margin habitats also create corridors for migration of alien-invasive species. keywords: diversity; eld; eld margins; fi eld; habitats; landscape; margins; ora; plant; poland; species; type cache: abc-1451.pdf plain text: abc-1451.txt item: #68 of 390 id: abc-1464 author: Grozeva, Neli Hristova; Gerdzhikova, Mariya Asenova; Pavlov, Dimitar; Panayotova, Galia; Todorova, Mima title: Morphological variability of the Bulgarian endemic Betonica bulgarica Degen et Neic. (Lamiaceae) from Sinite Kamani Natural Park, Eastern Balkan Range date: 2016-04-01 words: 7109 flesch: 63 summary: Data about the state of B. bulgarica populations on the territory of Balkan Range are contained in the management plans of the Central Bal- kan National Park (Yankov et al. 2001) and Sinite Kamani Natural Park (Grozeva et al. 2004). Indumentum and morphology of generative organs had taxonomic signifi cance for distinguishing B. bulgarica from the other species in the genus, including the species that were morphologically most similar to it – Betonica offi cinalis L. Keywords: Betonica bulgarica, morphology populations, variations * Corresponding author, e-mail: grozeva@uni-sz.bg Introduction Endemic plants are an emblematic symbol of the Bul- garian fl ora and one of the most sensitive and vulnerable units in the country’s nature ecosystems (Anchev 2011). keywords: betonica; bulgarica; glandular; leaf; leaves; length; populations; species; surface; traits; trichomes; variability; width cache: abc-1464.pdf plain text: abc-1464.txt item: #69 of 390 id: abc-1469 author: Yankova-Tsvetkova, Elina Petrova; Yurukova-Grancharova, Petka; Baldjiev, Georgi; Vitkova, Antonina title: Embryological features, pollen and seed viability of Arnica montana (Asteraceae) – a threatened endemic species in Europe date: 2016-04-01 words: 4012 flesch: 53 summary: Pollen of Arnica montana analyzed by acetocarmine test: A) mature pollen grains without acetocarmine staining, B) viable pollen grains, stained in red, C) tricolporate viable pollen grain, stained in red, D) unviable, unstained pollen grain. Corresponding author, e-mail: e_jankova@abv.bg; e_jankova@mail.bg Introduction Arnica montana L. is a rosette-forming perennial plant of the family Asteraceae Dum., subfamily Asteroideae, tribe Madieae (Noyes 2007). keywords: acta; arnica; asteraceae; embryo; fig; montana; pollen; seed; species; study; viability cache: abc-1469.pdf plain text: abc-1469.txt item: #70 of 390 id: abc-1483 author: Sheidai, Masoud; Tabasi, Melica; Mehrabian, Mohammad-Reza; Koohdar, Fahimeh; Ghasemzadeh-Baraki, Somayeh; Noormohammadi, Zahra title: Species delimitation and relationship in Crocus L. (Iridaceae) date: 2018-04-01 words: 5741 flesch: 54 summary: Evolution 59, 1633–1638. Holsinger, K. E., Lewis, P. O., 2003: Hickory: a package for anal- ysis of population genetic data V1.0. Population genetic software for teaching and research. keywords: crocus; crocus species; diversity; flow; gene; issr; molecular; populations; sativus; species; structure cache: abc-1483.pdf plain text: abc-1483.txt item: #71 of 390 id: abc-1484 author: Troiani, Natalia; Tardella, Federico Maria; Malatesta, Luca; Corazza, Marcello; Ferrari, Carlo; Catorci, Andrea title: Long-term abandonment of croplands in the sub-Mediterranean climate does not lead per se to the recovery of the semi-natural herb communities deemed worthy of conservation in the EU Habitats Directive date: 2016-10-01 words: 8947 flesch: 54 summary: This is consistent with previous research, which showed that in the sub-Mediterranean climate, landforms are key factors in determining plant species and communi- ties distribution (Arévalo et al. 2012, Burrascano et al. 2013, Catorci et al. 2014b). Thus, we expected that in former cropland (abandoned nearly 20 years ago and previously ploughed every year) dynamic processes would lead to the formation of herba- ceous communities with different species composition de- pending on the different abiotic conditions, but these proc- esses are not suffi cient per se to transform abandoned crops into semi-natural grassland communities included in Annex I of the Habitats Directive. keywords: abandonment; communities; cover; et al; grasslands; group; indicator; mean; plant; soil; species; t3.1; t3.2; tab; values; vegetation cache: abc-1484.pdf plain text: abc-1484.txt item: #72 of 390 id: abc-15 author: Kolodziejek, Jeremi title: A new nothospecies in the genus Potentilla L. (Rosaceae) date: 2009-10-21 words: 1392 flesch: 66 summary: Material and methods After a morphological study, literature searches (WOLF 1908, SZAFER and PAWLV OWSKI 1955, SOJÁK J. 1995, GERSTBERGER 2002, KURTTO et al. 2004) and examination of many species, the author concluded that it represents a new nothospecies, a hybrid of P. leucopolitana P. J. Müll. and P. incana P. Gertner, B. Meyer et Scherb. Results and discussion Potentilla ´gabarae Kolodziejek, nothosp. nova = P. leucopolitana P. J. Müll. keywords: hairs; potentilla cache: abc-15.pdf plain text: abc-15.txt item: #73 of 390 id: abc-150 author: Kahraman, Ahmet; Dogan, Musa title: A comparative study on the two species of the genus Salvia L. sect. Aethiopis Bentham (Labiatae) from East Anatolia, Turkey date: 2010-04-15 words: 6726 flesch: 71 summary: S. limbata S. palaestina Width (mm) Length (mm) Width (mm) Length (mm) Min. – Max. Parameter S. limbata S. palaestina Sand (%) 43.9–46.6 23.0–42.8 Silt (%) 25.9–30.5 31.3–38.2 Clay (%) 22.9–30.2 25.9–38.8 Texture Clayey-loamy and loamy Clay loam and loamy pH 7.56–7.93 7.60–7.82 Organic matter (%) 2.07–2.10 0.44–2.04 Total salt (%) 0.014–0.016 0.006–0.026 Total CaCO3 (%) keywords: cells; epidermis; fig; length; limbata; palaestina; s. limbata; salvia; size; species cache: abc-150.pdf plain text: abc-150.txt item: #74 of 390 id: abc-1516 author: Ambrozic-Dolinsek, Jana; Ciringer, Terezija; Kaligaric, Mitja title: Micropropagation of the narrow endemic Hladnikia pastinacifolia (Apiaceae) date: 2016-10-01 words: 7362 flesch: 61 summary: Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests. Further studies on this species will focus on other specifi c biotechnological tools successfully used in several programs of plant conservation, like assessment of the de- gree of genetic variability of plants in culture and introduc- tion of techniques for long-term storage at low tempera- tures. keywords: bap; conservation; culture; growth; iba; medium; pastinacifolia; plant; seeds; shoots; species cache: abc-1516.pdf plain text: abc-1516.txt item: #75 of 390 id: abc-1518 author: Borak Martan, Valentina; Sostaric, Renata title: Phytolacca acinosa Roxb. (Phytolaccaceae), a new alien species in the Croatian flora date: 2016-10-01 words: 2891 flesch: 67 summary: Ac- cording to Webb and Akeroyd (1964) the name Ph. acinosa is a synonym of the species Ph. esculenta, while for Clem- ent (1982) there are the clearly separate species, Ph. acino- sa and Ph. esculenta (Tab. 1). Something similar was noticed in Belgium where collections of the Ph. acinosa group are usually more or less intermediate between Ph. acinosa and Ph. esculenta: keywords: acinosa; alien; croatia; esculenta; phytolacca; plants; species cache: abc-1518.pdf plain text: abc-1518.txt item: #76 of 390 id: abc-1570 author: Zuna Pfeiffer, Tanja; Spoljaric Maronic, Dubravka; Zahirovic, Vanda; Stevic, Filip; Zjalic, Milorad; Kajan, Katarina; Ozimec, Sinisa; Mihaljevic, Melita title: Early spring flora of the Sub-Pannonic steppic grassland (NATURA 2000 site) in Bilje, northeast Croatia date: 2016-10-01 words: 4934 flesch: 63 summary: G 5 Orchidaceae Orchis morio L. G 2 NT Poaceae Anthoxanthum odoratum L. H 5 Apera spica-venti (L.) Moench H 1 Aristolochiaceae Aristolochia clematitis L. H 4 Asteraceae Achillea millefolium L. H 5 Ambrosia artemisiifolia L. * keywords: bilje; croatia; grassland; l. h; ora; plant; species; steppe; subsp; taxa cache: abc-1570.pdf plain text: abc-1570.txt item: #77 of 390 id: abc-1577 author: Inceer, Huseyin; Kalmuk, Nursen Aksu; Imamoglu, Kemal Vehbi; Duman, Ozge; Hayirlioglu-Ayaz, Sema; Arslan, Gokhan title: Micromorphological, anatomical and cytogenetical studies in endemic Crepis macropus Boiss. & Heldr. (Asteraceae) from Turkey date: 2016-10-01 words: 5129 flesch: 63 summary: Crepis macropus is an endemic species that belongs to section Berinia (Babcock 1947a, b, Enke 2009). Crepis macropus exhibits clos- er similarities to its Balkan relatives, C. turcica and C. al- banica, than to those of Anatolia, but it is more like C. turcica based on its habit, involucres, fl orets and achenes (Babcock 1947b). keywords: achene; anatomy; chromosome; crepis; enke; inceer; macropus; plant; species; style cache: abc-1577.pdf plain text: abc-1577.txt item: #78 of 390 id: abc-1578 author: Jakovljevic, Olga; Popovic, Sladana S.; Vidakovic, Danijela P.; Stojanovic, Katarina Z.; Krizmanic, Jelena Z. title: The application of benthic diatoms in water quality assessment (Mlava River, Serbia) date: 2016-10-01 words: 5918 flesch: 56 summary: Diatom indices and water quality The values of the fi ve diatom indices used indicated a similar ecological status of the water at the studied sites. DCA showed good correlation between all these three taxa and higher oxygen level, but also with higher water hardness. keywords: assessment; diatom; index; indices; mlava; quality; river; serbia; status; taxa; values; water cache: abc-1578.pdf plain text: abc-1578.txt item: #79 of 390 id: abc-1582 author: Ljubesic, Zrinka title: A word from the Guest Editor date: 2015-10-01 words: 911 flesch: 49 summary: At the opening ceremony the partici- pants were welcomed with opening remarks by Dean Amir Hamzić, Faculty of Science, Univer- sity of Zagreb, Rector Aleksa Bjeliš, University of Zagreb, Staša Skenzić, Head of the Offi ce for International Cooperation at Ministry of Science, Education and Sports of the Republic of Croa- tia and the Mayor of Zagreb Milan Bandić. Zrinka Ljubešić Chair of the 8th Central European Diatom Meeting Guest Editor of Acta Botanica Croatica 74(2)2015 Zagreb, August 2015 keywords: symposium; university; zagreb cache: abc-1582.pdf plain text: abc-1582.txt item: #80 of 390 id: abc-1583 author: Surina, Bostjan title: Book review: Endemi u Hrvatskoj flori by Toni Nikolic, Milenko Milovic, Sandro Bogdanovic and Nenad Jasprica date: 2015-10-01 words: 1316 flesch: 55 summary: Nevertheless, according to the given criteria and biogeographic analyses, authors thoroughly and in painstaking detail have described 155 (40%) endemic taxa out of 384 (7.6% of the total fl oristic inventory of the country) occurring in Croatia, while 53 (14%) taxa are mentioned in less detail. The present book has taken a step further, trying to thoroughly present and elucidate the phenomenon of Adriatic endemism on a much larger geographical scale, dealing with taxa of limited distribution ranges occurring also or exclusively in Croatia. keywords: authors; book; croatia; endemic; subsp; taxa cache: abc-1583.pdf plain text: abc-1583.txt item: #81 of 390 id: abc-1586 author: Dudas, Slavica; Sola, Ivana; Sladonja, Barbara; Erhatic, Renata; Ban, Dean; Poljuha, Danijela title: The effect of biostimulant and fertilizer on “low input” lettuce production date: 2016-10-01 words: 6160 flesch: 60 summary: During frost, all variants of lettuce treatments and the control variants were additionally protected with agrotextile (17 g m–2). Compared to the result of Premuzic et al. (2001) who found that N or biosta- bilised compost fertilization does not change lettuce vita- min C content, we found that Megagreen fertilizer increased vitamin C content in lettuce and in this term suggest it as a better choice for lettuce treatment. keywords: bio; chlorophyll; content; control; effect; lettuce; mass; megagreen; nitrate; plant; s-90; signifi; treatment; yield cache: abc-1586.pdf plain text: abc-1586.txt item: #82 of 390 id: abc-1593 author: Marekovic, Sara; Sostaric, Renata title: A comparison of the influences of flotation and wet sieving on certain carbonized legume and cereal remains date: 2016-04-01 words: 4029 flesch: 57 summary: ISSN 0365-0588 eISSN 1847-8476 A comparison of the infl uences of fl otation and wet sieving on certain carbonized legume and cereal remains Sara Mareković*, Renata Šoštarić Department of Biology, Faculty of Science, University of Zagreb, Marulićev trg 20/2, HR-10000 Zagreb, Croatia Abstract – In order to determine the infl uence of recovery techniques with water (fl otation and wet sieving) on carbonized plant remains, a certain amount of wheat, barley, millet, horsebean and lentil macrofossils from archaeological sites was taken and treated with water. Key words: carbonized plant remains, cereals, fl otation, legumes, wet sieving * keywords: lentil; otation; plant; remains; sieving; species; water; wet cache: abc-1593.pdf plain text: abc-1593.txt item: #83 of 390 id: abc-1595 author: Kremer, Dario; Jurisic Grubesic, Renata; Ballian, Dalibor; Stesevic, Danijela; Kosalec, Ivan; Vukovic Rodriguez, Jadranka; Vukobratovic, Marija; Srecec, Sinisa title: Influence of soil traits on polyphenols level in Moltkia petraea (Tratt.) Griseb. (Boraginaceae) date: 2016-10-01 words: 4479 flesch: 59 summary: A negative correlation was found between soil phosphorus content and total phenols content in leaves and stems, and with the total phenolic acids content in fl owers. Phenolic compound content was higher in leaves than in fl owers or stems. keywords: compounds; content; leaves; owers; petraea; phenolic; plant; populations; soil; stems; total cache: abc-1595.pdf plain text: abc-1595.txt item: #84 of 390 id: abc-1616 author: Vukojevic, Mara; Vitasovic Kosic, Ivana; Alegro, Antun; Lakusic, Dmitar; Bogdanovic, Sandro title: Cardamine fialae Fritsch (Brassicaceae) a new species in Croatian flora date: 2016-10-01 words: 2770 flesch: 66 summary: Morphologically, C. fi alae is similar to the Serbian endemic C. serbica with which it shares following characteristics: auricules at the base of lower cauline leaves, stem and rosette leaves bipinnate, margin of leafl ets serrate with hairy main stem and sepals, although it differs in having bigger petals and sepals, longer fi laments and 1–2 lateral stems. C. fi alae grows on lower altitudes in rocky ground within the vegetation of forest fringes of the sub-Mediterranean zone. keywords: alae; cardamine; croatian; kučera; species cache: abc-1616.pdf plain text: abc-1616.txt item: #85 of 390 id: abc-1618 author: Kaya, Ergun; Vatansever, Recep; Filiz, Ertugrul title: Assessment of the genetic relationship of Turkish olives (Olea europaea subsp. europaea) cultivars based on cpDNA trnL-F regions date: 2018-04-01 words: 3723 flesch: 57 summary: To analyze the conservancy or divergency degrees in Turkish olive cultivars, sequenc- es were multiply aligned (Fig. 1). The nucleotide diversity and parsimony informative sites in Turkish olive cultivars were found to be low. keywords: cultivars; europaea; olea; olive; regions; sequences; subsp; trnl cache: abc-1618.pdf plain text: abc-1618.txt item: #86 of 390 id: abc-1621 author: Strgulc Krajšek, Simona; Accetto, Marko; Jogan, Nejc title: Myosotis refracta Boiss. (Boraginaceae), an unexpected forget-me-not in the Slovene flora date: 2016-10-01 words: 2345 flesch: 65 summary: M. refracta is morphologically distinct, but easily con- fused with other small Myosotis species. Phylogenetically (based on ITS), M. refracta has a basal position relative to a clade containing most of the Eurasian Myosotis species (Wink- worth et al. 2002), but poor resolution and plastid marker incongruencies would need more sampling. keywords: accetto; grau; myosotis; refracta; slovenia; species cache: abc-1621.pdf plain text: abc-1621.txt item: #87 of 390 id: abc-1622 author: Dudas, Slavica; Poljuha, Danijela; Sola, Ivana; Segula, Sabina; Varga, Sanja; Sladonja, Barbara title: Effects of biodynamic production on growth and essential oil content in basil date: 2016-10-01 words: 4529 flesch: 60 summary: Sweet basil essential oil is used in medicine, for aromatherapy, and the cosmetic and food industries (Pu- tievsky and Galambosi 1999), and as an insecticide (Ume- rie et al. 1998, Keita et al. 2001, Pascual-Villalobos and Ballesta-Acosta 2003). ISSN 0365-0588 eISSN 1847-8476 Effects of biodynamic production on growth and essential oil content in basil Slavica Dudaš1, Danijela Poljuha2*, Ivana Šola3, Sabina Šegula4, Sanja Varga1, Barbara Sladonja2 1 Polytechnic of Rijeka, Agricultural Department, Poreč, Karla Huguesa 6, Poreč, Croatia 2 Institute of Agriculture and Tourism, Karla Huguesa 8, Poreč, Croatia 3 Department of Biology, Faculty of Science, University of Zagreb, Horvatovac 102a, Zagreb, Croatia 4 Biotechnical Centre Naklo, Strahinj 99, Naklo, Slovenia Abstract – The effects of a biodynamic sowing calendar on the growth (plant height, fresh herb yield, nodes number) and quality (percentage of leaf mass, essential oil content) of three basil species, Ocimum america- num L., Ocimum × hybrida and Ocimum basilicum L., represented by the cultivars ‘Rosso’ and ‘Eco Geno- vese’, were tested. keywords: basil; basilicum; content; cultivars; date; leaf; oil; plant; production; sowing; species cache: abc-1622.pdf plain text: abc-1622.txt item: #88 of 390 id: abc-1623 author: Yousefi, Hossein; Amirahmadi, Atefe; Naderi, Reza; Atri, Morteza title: Chromosome numbers and karyotype features of Phlomis olivieri Benth. (Lamiaceae) from Iran date: 2018-04-01 words: 2528 flesch: 66 summary: Our observations as well as comparison of photomi- crographs obtained from previous reports also showed that Phlomis chromosomes are the largest among species of the Lamiaceae genera such as Callicarpa L., Salvia L., Scutellaria L., Sideritis L., Stachys L., Teucrium L. and Thymus L. (Jalas 1948, Boşcaiu et al. 1998, Yildiz and Gücel 2006, Yang et al. 2009, Martin et al. 2011, Contreras and Ruter 2011, Javadi et al. 2011). (Lamiaceae) from Iran Hossein Yousefi1, Atefe Amirahmadi2, Reza Naderi2*, Morteza Atri1 1 Department of Biology, Faculty of Sciences, Bu-Ali Sina University, Hamedan, Iran 2 School of Biology and Institute of Biological Science, Damghan University, Damghan, 36716-41167, Iran Abstract – Chromosome numbers were determined in ten accessions of Phlomis olivieri Benth. keywords: accessions; chromosome; olivieri; phlomis; species cache: abc-1623.pdf plain text: abc-1623.txt item: #89 of 390 id: abc-1635 author: Marcek, Tihana; Vidakovic-Cifrek, Zeljka; Tkalec, Mirta; Jezic, Marin; Curkovic-Perica, Mirna title: Response of dihaploid tobacco roots on salt stress date: 2016-04-01 words: 5165 flesch: 62 summary: In such conditions the possibility of cell dehydration is increased due to diffi culty in the acquisi- tion of water by plant roots. Numbers 0, 100 and 200 follow- ing names of tobacco lines (DH10, 207B, 238C and 239K) represent concentrations of NaCl – 0, 100 and 200 mM, respectively. keywords: 239k; activity; dh10; hybrid; lines; nacl; proline; roots; salinity; salt; stress; tobacco cache: abc-1635.pdf plain text: abc-1635.txt item: #90 of 390 id: abc-1637 author: Ashiq, Bushra; Chohan, Sobia; Perveen, Rashida; Abid, Muhammad; Abid Mehmood, Mirza title: Chemical composition and antifungal potential of medicinal plants against seedborne mycoflora of eggplant (Solanum melongena L.) date: 2017-04-01 words: 6354 flesch: 57 summary: A potentially useful substitute for expensive and possibly toxic fungicides could befound in plant extracts (Joseph et al. 2008). Although use of plant extracts is less laborious, more economical and more eco-friendly than that of fungicides, it is still not popular among stakeholders. keywords: avus; camaldulensis; concentration; extract; growth; oxysporum; plant; seed; stolonifer cache: abc-1637.pdf plain text: abc-1637.txt item: #91 of 390 id: abc-1647 author: Petrovic, Dragana; Jancic, Dejan; Furdek, Martina; Mikac, Nevenka; Krivokapic, Sladjana title: Aquatic plant Trapa natans L. as bioindicator of trace metal contamination in a freshwater lake (Skadar Lake, Montenegro) date: 2016-10-01 words: 5682 flesch: 59 summary: In order to evaluate possible ecotoxic effect of metal concentrations in sedi- ments we compared the measured concentrations with the most frequently used sediment quality criteria for freshwa- ter sediment (MacDonald at al. 2000), which defi ne TEC (threshold level concentration) as a lower limit below which toxic effect is not probable, and PEC (probable effect concentration) as an upper limit above which toxicity to aquatic organisms can be expected (On-line Suppl. However, Trapa natans showed the highest bioconcentration factors from sediment to root for Cd and Cr, thus further indicating that it may be a promising biondicator for metal contamination in the Ska- dar Lake. Acknowledgement Financial supports from the Ministries of Science and Education of Croatia and Montenegro within the bilateral collaboration, as well as from the Croatian Science Founda- tion under the project »Transport and chemodynamics of trace elements in freshwater and coastal sedimentary sys- tems« (HRZZ- 7555) are gratefully acknowledged. keywords: concentrations; fig; lake; locations; metals; plant; root; sediment; trapa cache: abc-1647.pdf plain text: abc-1647.txt item: #92 of 390 id: abc-1650 author: Pliszko, Artur; Jazwa, Malgorzata title: Floristic composition of vegetation in habitats suitable for Erigeron × huelsenii (Asteraceae) date: 2017-04-01 words: 4012 flesch: 64 summary: Spontaneously occurring hybrids between alien and native plants have been well-documented (Vilà et al. 2000, Daehler and Carino 2001, Bleeker et al. 2007, Lehman et al. 2014, Stace et al. 2015), and according to Pyšek et al. (2004) they must be understood as alien plant species. This can be explained by the fact that in the early stages of secondary succession, abandoned sand and gravel pits are readily colonized by various plant species typical of ruderal, grassland and meadow communities (Řehounková and Prach 2006). keywords: grass; habitats; legume; species cache: abc-1650.pdf plain text: abc-1650.txt item: #93 of 390 id: abc-1651 author: Tusek, Martina; Curman, Marcela; Babic, Marija; Tkalec, Mirta title: Photochemical efficiency, content of photosynthetic pigments and phenolic compounds in different pitcher parts of Sarracenia hybrids date: 2016-10-01 words: 5790 flesch: 62 summary: Also, pitcher parts with extrafl oral nectaries have a lower amount of photosynthetic pigments (Ellison and Farnsworth 2005). Analysis of pitcher parts of hybrid A showed a signifi cant decrease of Fv/F0 in the pitcher-tube upper part and operculum compared to the wing. keywords: chlorophyll; content; hybrid; operculum; parts; pitcher; sarracenia; tube; wing cache: abc-1651.pdf plain text: abc-1651.txt item: #94 of 390 id: abc-1652 author: Vulevic, Anja; Dragicevic, Snezana; Petrovic, Danka title: Two moss species from Mt Durmitor new to the bryophyte flora of Montenegro date: 2017-10-01 words: 2403 flesch: 64 summary: Ros, R.M.,, Mazimpaka, V., Abou-Salama, U., Aleffi, M., Block- eel, T.L., Brugués, M., Cros, R.M., Dia, M.G., Dirkse, G.M., Draper, I., El-Saadawi, W., Erdağ, A., Ganeva, A., Gabriel, R., Gonzáles-Mancebo, J. M., Granger, C., Herrnstadt, I., Hugon- not, V., Khalil, K., Kürschner, H., Losada-Lima, A., Luis, L., Mifsud, S., Privitera, M., Puglisi, M., Sabovljević, M., Sérgio, C., Shabbara, H. M., Sim-Sim, M., Sotiaux, A., Tacchi, R., Van derpoorten, A., Werner, O., 2013: The natural landscape of Durmitor, In: Lje- šević, M. (ed.), The nature of National Park Durmitor, Special editions, Volume 8, 285–299. keywords: cirrata; durmitor; hedw; montenegro; mosses; obtusifolium; species cache: abc-1652.pdf plain text: abc-1652.txt item: #95 of 390 id: abc-1657 author: Sabovljevic, Marko S.; Segarra-Moragues, Jose Gabriel; Puche, Felisa; Vujicic, Milorad; Cogoni, Annalena; Sabovljevic, Aneta title: An eco-physiological and biotechnological approach to conservation of the world-wide rare and endangered aquatic liverwort Riella helicophylla (Bory et Mont.) Mont. date: 2016-10-01 words: 3741 flesch: 59 summary: Two phase system (solid and liquid) culture media were developed for the purpose of achieving fully developed ga- metophytes. Spore germination rate and the effects of different culture media in an axenic culture establishment, as well as propagation proce- dures of R. helicophylla, were tested. keywords: dormancy; germination; helicophylla; l–1; media; mg l–1; riella; spores; water cache: abc-1657.pdf plain text: abc-1657.txt item: #96 of 390 id: abc-1659 author: Maslac, Ana; Maslac, Maja; Tkalec, Mirta title: The impact of cadmium on photosynthetic performance and secondary metabolites in the lichens Parmelia sulcata, Flavoparmelia caperata and Evernia prunastri date: 2016-10-01 words: 5413 flesch: 60 summary: The identifi cation of lichen metabolites was made by comparing retention times in combination with UV spec- tral data with known chromatographic data (Feige et al. 1993, Huneck and Yoshimura 1996). It seems that although our knowledge about the importance of lichen metabolites has increased in the last few years, their biological roles and interactions have not yet been entirely understood. keywords: acid; caperata; days; exposure; lichens; metabolites; metal; min; sulcata cache: abc-1659.pdf plain text: abc-1659.txt item: #97 of 390 id: abc-1673 author: Yumurtaci, Aysen; Sipahi, Hulya; Zhao, Li title: Genetic analysis of microsatellite markers for salt stress in two contrasting maize parental lines and their RIL population date: 2017-04-01 words: 6466 flesch: 58 summary: Sequence ID Motifs/Repeat Type Organism Protein E-value Primer pairs (5’-3’) Product size (bp) ZM14-Contig13 (GT)6/ P-(GCG)6, (CG)3/ IP Z. mays Putative ring zinc fi nger protein 7e-38 ATACATTTTTACGTCCAC GTTTCGTTTGGAGGGTGTCTT 214 ZM14-Contig24* (CA)6/ P Z. mays Unknown protein 3e-26 TTTGTCCAATCAAGCGAGATA TTGTGTCCGTGCAAATTGGTG 488 ZM14-Contig27* (TA)9,(AC)3/ IP Z. mays Jacalin like lectin protein 3e-93 CGGTAGCGAAAATACAGT TCCATCTCCTTCATCTACATC 504 ZM14-Contig53 (CCG)6/ P Z. mays Unknown protein 3e-140 Not suitable for primer design – ZM14-Contig68* (AT)5/ P Z. mays Aquaporin plasma membran protein 1e-32 AAACAGGGAGTCTTCTTCTTAAC AAACAGGGAGTCTTCTTCTTAAC 382 ZM14-Contig79 (CG)5/ P Z. mays Unknown protein 3e-166 Not suitable for primer design – ZM14-Contig106* (TT)6/ P Z. mays Hypothetical protein 1e-48 GCCCATATTACATACAAAAG CAACAAGAAGGTTTATTCTG 708 ZM14-Contig114 (GG)5/ P Z. mays Unknown protein 5e-48 TGGACCAAACATCGGTTGAGC GAATGGAAGGAAGAGGGGTGGT 530 ZM14-Contig119 (ACA)5,(CCA)6/ P(CCG)5,(CCA)3/IP Z. mays Hypothetical protein 6e-39 TGGCCCCACCTGATGAAATAA GGAGTGGAGGCGGAGGATCT 615 ZM14-AI649544 (TA)3,(TGGA)5/ IP Z. mays Oxin transporter protein 1e-81 CGATGCCGAAAACCCATTCTT GCATCTGCTCGTGGAGGAAAA 303 ZM14-AI649556 (CTG)5/ P Z. mays Lysin decarboxylase 3e-07 Not suitable for primer design – ZM14-AI855154 (GAG)3,(CTG)5/ IP Z. mays Hypothetical protein 0.002 TGGTCCTGCTGCTTCTCTTGC CAAACGGTCCACCTCCACCTC 316 ZM14-AI855158 (AT)5/ P Z. mays Ribosome biogenesis protein 1e-94 Not suitable for primer design – ZM14-AI855164 (AT)5/ P Z. mays Unknown protein 4e-08 GTGCAGAGACGGACAGCGAGT TTTTGAGTTTTGCCGGAGTGG 346 ZM14-AI855182 (AT)6/ P Z. mays Glyceraldehyde-3- dehydrogenase 1e-47 CGACTCCCAACAGGAAATGGA GTCGCCTGGTACGACAACGAG 349 ZM14-AI855214 (TA)5/ P Z. mays Unknown protein 5e-61 TGGATCGAAGCAACTCGCACT CAACAGCGTCAAGAGCGTCAA 310 ZM14-AI855258 (TC)13/ P- (TA)3, (CACAG)6/ IP Z. mays Unknown protein 3e-19 GAGATAGGCGAGGAAGGTGAG ATCGTCATCATTCGAGCAGAG 180 ZM14-AI855272 (AGG)6/ P Z. mays Putative MYB binding protein 2e-43 GACCTCAACCTCGACCTCTG GGCTTCGTTCACTTCATCTTG 275 ZM14-AI855286 (CTG)9/ P Z. mays Unknown protein 3e-34 CCCTCTCTTTTCTCAGCCCTA ATCCAGAGGACGAGGGTTTT 288 ZM14-AI855336 (CGC)5/ P Z. mays Hypothetical protein 2e-28 GAGAAGCCGAGAACAGTAGCA CACGAGGCAGAGTCGTAGTTT 365 ZM14-AI855352 (GC)5/ P- (CGC)6, (CGA)3/ IP Z. mays Hypothetical protein 8e-11 CGAGAGCGCCATTAGAAGTCG TTTTGTGGAACGAAGCGATGG 401 ZM14-AI855361 (ACC)9,(TA)5/ P Z. mays Unknown protein 2e-47 GACCTGGAGTGGTGGTTC GATGGGATACAAATACAATAC 481 ZM14-AI649556 (CTG)5/ P Z. mays Lysin decarboxylase 3e-07 CCGGGTTTTGGACTTTGGAGA TGTTGTGGCTCTTTGCCTGTG 301 ZM14-AI861145 (TT)5,(GTC)5/ P Z. mays Unknown protein 4e-56 TTGTTTTTGCCTTTCCTTGAA TGCTGTACCCAAATCCTTCTG 447 ZM14-AI857227 (GCC)6/ P Z. mays putative cytochrome P450 superfamily protein 5e-43 GCCGTGCCAACTTTTAATTTC CTGGAGGTGGAAGGAGAGG 367 ZM14-AI855418 (AG)5/ P Z. mays Putative phototroph- ic-responsive NPH3 family 0.082 GCCTGCCTGTCCATCAATCAA CATCCACCTCCCACCCAGAAC 242 ZM14- AI857233 (ATG)6/ P Z. mays Protein transport protein sec31-like ATCTGCACCTCAACCTGAATG ATTGGATGGTTCTTGTGTTGG 236 YUMURTACI A., SİPAHİ H., ZHAO L. 60 ACTA BOT. (GAG)5,(ACG)4/IP Z. mays Chlorophyll ab binding protein 1e-107 AGTATCCCCTTTTTACACTGG CGTCGTCGTCGTTGTT 941 ZM13-Contig136 (AA)6/ P Z. mays Putative Glutation peroxidase 2e-97 CATACAGAAAGGGCGAAACA ACACGCTTCAAGGCTGAGTA 501 ZM13-Contig148 (ACCA)5/ P Z. mays Putative Protein kinase 1e-18 AAATATACGGCCCCAAGAAAA CAAGCAAGATCGGTGGAAAC 327 ZM13-Contig175 (CCA)7/ P-(TA)5/ P Z. mays keywords: est; et al; maize; mapping; markers; mays; p z.; plant; protein; repeats; salt; sequence; ssr; z. mays; zm13; zm14 cache: abc-1673.pdf plain text: abc-1673.txt item: #98 of 390 id: abc-1677 author: Stupar, Vladimir; Carni, Andraž title: Ecological, floristic and functional analysis of zonal forest vegetation in Bosnia and Herzegovina date: 2016-04-01 words: 9360 flesch: 64 summary: Using data from Bosnia and Herzegovina, this study aimed to reveal whether macro-climate is indeed the most important factor determining the existence of zonal forest plant communities (ZFPC). Zonal forest plant communities in Bosnia and Herzegovina. keywords: analysis; b&h; bosnia; communities; community; ecological; et al; fig; forests; herzegovina; plant; quercus; species; tab; vegetation; zfpcs; zonal cache: abc-1677.pdf plain text: abc-1677.txt item: #99 of 390 id: abc-1679 author: Bosiacka, Beata; Wieclaw, Helena; Marciniuk, Pawel; Podlasinski, Marek title: Distribution of Taraxacum microspecies along soil property gradients in salt and brackish meadows on the Polish Baltic coast date: 2019-04-01 words: 7617 flesch: 53 summary: Relationships between the presence of individual dandelion microspecies (for 6 microspecies oc- curring in more than 2 plots only) and soil parameters as well as between the number of dandelion microspecies per plot and soil parameters were examined using Spearman’s rank correlation test (STATISTICA StatSoft v. 10.0). Results of Spearman’s rank correlation test between the number and occurrence of Taraxacum microspecies and soil parameters, keywords: baltic; coastal; content; dandelion; dandelion microspecies; grasslands; meadows; microspecies; polish; salinity; salt; section; soil; taraxacum cache: abc-1679.pdf plain text: abc-1679.txt item: #100 of 390 id: abc-1687 author: Yasmeen, Roomana; Siddiqui, Zamin Shaheed title: Physiological responses of crop plants against Trichoderma harzianum in saline environment date: 2017-10-01 words: 7040 flesch: 62 summary: Plant Sciences 163, 1037–1046. Sheng, M., Tang, M., Chan, H., Yang, B., Zhang, F., Huang, Y., 2008: Influence of Arbuscular mycorrhizae on photosynthesis and water status of maize plants under salt stress. ISSN 0365-0588 eISSN 1847-8476 Physiological responses of crop plants against Trichoderma harzianum in saline environment Roomana Yasmeen, Zamin Shaheed Siddiqui* Stress Physiology Phenomics Centre, Department of Botany, University of Karachi, Karachi 75270, Pakistan Abstract – The physiological response of crop plants against Trichoderma harzianum (Th-6) in a saline habi- tat was studied. keywords: b c; harzianum; maize; plants; rice; saline; salinity; salt; stress; trichoderma cache: abc-1687.pdf plain text: abc-1687.txt item: #101 of 390 id: abc-1693 author: Pliszko, Artur title: Erigeron acris L. subsp. angulosus (Gaudin) Vacc. (Asteraceae), a new taxon in the flora of Poland date: 2018-04-01 words: 1969 flesch: 60 summary: One of the most reliable diagnostic charac- ters that allows E. acris subsp. acris, E. acris subsp. keywords: acris; acris subsp; angulosus; erigeron; poland; subsp cache: abc-1693.pdf plain text: abc-1693.txt item: #102 of 390 id: abc-1694 author: Purger, Dragica; Kovacic, Sanja; Csiky, Janos title: Bouché’s star of Bethlehem, Ornithogalum boucheanum (Kunth) Asch. (Hyacinthaceae), a new species in flora of Croatia date: 2017-10-01 words: 3573 flesch: 69 summary: In this paper we present a short morphological description of O. boucheanum and diagnostic morphological characters for differentiation from the related O. nutans L. We suggested O. boucheanum be evaluated as a critically endangered (CR) species of the Croatian flora, considering the small number of indi- viduals and the small extension of its population. keywords: boucheanum; croatia; flora; hungary; nikolić; nutans; ornithogalum; species cache: abc-1694.pdf plain text: abc-1694.txt item: #103 of 390 id: abc-1695 author: Lepedus, Hrvoje; Jakopec, Mario; Antunovic Dunic, Jasenka; Krizmanic, Goran; Osmanovic, Sanida; Cesar, Vera title: Temperature dependent chlorophylls accumulation and photosystem II assembly during etioplast to chloroplast transition in sunflower cotyledons date: 2017-04-01 words: 3126 flesch: 57 summary: Also, we en- deavored to evaluate the effects of greening temperature and short-term application of increased irradiation on the effective quantum yield of PSII (ΔF/F’m) and its capacity for non photochemical quenching (NPQ) as very important protective process against photoinhibition. The aim of our study was to investigate the dynamics of chlorophyll a and b accumulation as well as PSII effi ciency during greening process in etiolated sunfl ower cotyledons exposed to the different temperatures (10, 20, 30 °C). keywords: chl; chlorophyll; cotyledons; greening; psii cache: abc-1695.pdf plain text: abc-1695.txt item: #104 of 390 id: abc-1701 author: Vilicic, Damir; Sirotic, Grozdana title: Acta Botanica Croatica: editorial activity and scientometric analysis for the period 1998–2014 date: 2016-04-10 words: 1664 flesch: 51 summary: Since 2011 the number of libraries in Europe and North America where Acta Botanica Croatica content is disseminated increased to 624, i.e. 256 libraries in North America (according to ELU- NA 2016) and 368 in Europe (according to IGeLU 2016). 75 (1), 2016 S1 Social news Acta Botanica Croatica: editorial activity and scientometric analysis for the period 1998–2014 Damir Viličić, Grozdana Sirotić University of Zagreb, Faculty of Science, Department of Biology, Rooseveltov trg 6, 10000 Zagreb, Croatia Abstract – An editorial report concerning and scientometric analysis of papers published in the journal Acta botanica croatica for the period from 1998 to 2014 is presented. keywords: acta; botanica; croatica; journal; period cache: abc-1701.pdf plain text: abc-1701.txt item: #105 of 390 id: abc-1702 author: Vukovic, Nina; Segota, Vedran; Alegro, Antun; Sedlar, Zorana title: Rare plants of threatened habitats – the Croatian case of Corrigiola litoralis L. (Caryophyllaceae) date: 2018-04-01 words: 2502 flesch: 60 summary: Keywords: endangered habitats, IUCN, Mediterranean temporary ponds, Molat * Corresponding author, e-mail: vedran.segota@biol.pmf.hr Introduction According to Flora Europaea, the genus Corrigiola is rep- resented in Europe by two species: C. litoralis L. (with two subspecies, C. litoralis L. ssp. According to the Croatian checklist, C. litoralis, and a typical subspecies (C. litoralis L. ssp. litoralis) have so far been registered in Croatia (Nikolić 2016). keywords: corrigiola; croatia; flora; habitats; litoralis; species cache: abc-1702.pdf plain text: abc-1702.txt item: #106 of 390 id: abc-1704 author: Oskay, Dilek title: A morphological study on the dioecious endemic Erodium somanum H. Pesmen (Geraniaceae), critically endangered in Turkey date: 2017-04-01 words: 3169 flesch: 66 summary: Keywords: dioecious plant, endangered endemic plant, Erodium somanum, fl ower morphology, micromor- phology. General appearance of Erodium somanum in nature. keywords: erodium; mericarp; somanum cache: abc-1704.pdf plain text: abc-1704.txt item: #107 of 390 id: abc-1710 author: Pausic, Igor; Ivajnsic, Danijel; Kaligaric, Mitja; Pipenbaher, Natasa title: Relation between plant species diversity and landscape variables in Central-European dry grassland fragments and their successional derivates date: 2017-10-01 words: 7004 flesch: 55 summary: ISSN 0365-0588 eISSN 1847-8476 Relation between plant species diversity and landscape variables in Central-European dry grassland fragments and their successional derivates Igor Paušič, Danijel Ivajnšič, Mitja Kaligarič, Nataša Pipenbaher Biology Department, Faculty of Natural Sciences and Mathematics, University of Maribor, Koroška c. 160, SI-2000 Maribor, Slovenia Abstract – A systematic field survey of an area of 843 ha in the traditional Central-European agricultural landscape of Goričko Nature Park in Slovenia revealed 80 fragments of dry semi-natural grasslands. Our results show that fragment size does not affect plant species diversity. keywords: alpha; area; diversity; dry; fragments; grassland; groups; habitat; landscape; plant; plant species; species; species diversity; twinspan cache: abc-1710.pdf plain text: abc-1710.txt item: #108 of 390 id: abc-1716 author: Sumathi, Murugan; Ramasamy, Yasodha title: Microsatellite allele length variations in inter-specific hybrids of Eucalyptus date: 2017-04-01 words: 3999 flesch: 60 summary: BMC Evolutionary Biology 8, 138. Barthe S., Gugerli F., Barkley N. A., Maggia L., Cardi C., Scotti I., 2012: Always look on both sides: phylogenetic information conveyed by simple sequence repeat allele sequences. All the DNA sequences of SSR locus along with the source SSR sequence and E. grandis genomic region harbouring SSR were aligned using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/) to identify the structural variations in microsatellites. keywords: alleles; dna; repeat; sequence; species; ssr; t c cache: abc-1716.pdf plain text: abc-1716.txt item: #109 of 390 id: abc-1719 author: Dere, Saban; Aytas Akcin, Tulay title: Anatomical and micromorphological properties of some Tanacetum L. (Asteraceae) taxa from Turkey and their systematic implications date: 2017-10-01 words: 6598 flesch: 68 summary: Grierson and T. vulgare L. were examined by light microscopy and scanning electron microscopy. Akcin, T. A., Akcin, A., 2010: Morphological and anatomical char acteristics and taxonomical significance of achene micro- morphology of endemic Achillea phrygia Boiss& Bal. and A. gypsicola Hub-Mor. keywords: asteraceae; cells; glandular; leaf; species; stem; tanacetum; taxa; trichomes; vulgare cache: abc-1719.pdf plain text: abc-1719.txt item: #110 of 390 id: abc-1725 author: Anzlovar, Sabina; Likar, Matevz; Dolenc Koce, Jasna title: Antifungal potential of thyme essential oil as a preservative for storage of wheat seeds date: 2017-04-01 words: 5904 flesch: 56 summary: Essential oil treatment of wheat grain In the present study, two types of wheat (Triticum aes- tivum L.) grain were used: conventionally grown grain obtained from the Agricultural Institute of Slovenia (T. aes- tivum cv. The effects of the seed type, prior sterilization, essential oil treatments, and essen- tial oil concentrations on the fungal infection rates and the germination rates of the wheat grain were tested using mul- tiway-ANOVA, with the level of signifi cance set at p<0.05. keywords: fungal; germination; grain; growth; indirect; infection; oil; seed; sterilization; thyme; treatment; wheat; wheat grain cache: abc-1725.pdf plain text: abc-1725.txt item: #111 of 390 id: abc-1730 author: Vannini, Andrea; Paoli, Luca; Nicolardi, Valentina; Di Lella, Luigi Antonello; Loppi, Stefano title: Seasonal variations in intracellular trace element content and physiological parameters in the lichen Evernia prunastri transplanted to an urban environment date: 2017-10-01 words: 4750 flesch: 52 summary: Further investigation is necessary to shed light on the role of intracellular trace element content in lichens, in or- der to allow comparison of these data with other biomoni- toring studies and get an insight into the ecophysiological effects of air pollution. Correlation analysis did not show any sig- nificant relationship between intracellular trace elements and physiological parameters (data not shown). keywords: content; elements; environment; intracellular; lichen; loppi; pollution cache: abc-1730.pdf plain text: abc-1730.txt item: #112 of 390 id: abc-1742 author: Abbasi, Shabnam; Afsharzadeh, Saeed; Saeidi, Hojjatollah title: Genetic diversity of Potamogeton pectinatus L. in Iran as revealed by ISSR markers date: 2017-10-01 words: 4178 flesch: 56 summary: 0365-0588 eISSN 1847-8476 Genetic diversity of Potamogeton pectinatus L. in Iran as revealed by ISSR markers Shabnam Abbasi1, Saeed Afsharzadeh2*, Hojjatollah Saeidi3 Department of Biology, University of Isfahan, 81746-73441, Isfahan, Iran Abstract – Potamogeton pectinatus L. is a widespread aquatic species distributed widely in aquatic ecosys- tems of Iran. Key words: genetic diversity, Iran, ISSR, Potamogeton pectinatus, Potamogetonaceae * Corresponding author, e-mail: s.afshar@sci.ui.ac.ir Introduction Potamogeton L. (Potamogetonaceae) comprises about 100 species and 50 interspecific hybrids worldwide (Wieg- leb 1988, Sculthorpe 1967), 14 species of which occur in Iran (Dinarvand 2009, 2011, Abbasi et al. 2015). keywords: accessions; diversity; iran; issr; pectinatus; pot; potamogeton; river; species cache: abc-1742.pdf plain text: abc-1742.txt item: #113 of 390 id: abc-1743 author: Verloove, Filip title: New xenophytes from the Canary Islands (Gran Canaria and Tenerife; Spain) date: 2017-10-01 words: 9895 flesch: 66 summary: Tenerife: Buenavista del Norte, Golf Court (W-side), epi- phyte on Phoenix, 30.06.2014, F. Verloove 10884 (BR); Torviscas, close to barranco Colon, epiphyte on Phoenix, 31.10.2014, F. Verloove s.c.; Las Galletas, TEN-BEL, epi- phyte on Phoenix, 11.06.2015, F. Verloove s.c.; Playa de Las Américas, Fañabe, Hotel Riu, epiphyte on Phoenix, 15.06.2015, F. Verloove s.c. Tejina, barranco de Los Aguas de Dios, damp area, near artificial pond, five individuals, 27.06.2014, F. Verloove 10856 (BR, ORT); La Cuesta (La Laguna), bar- ranco de Santos, dry gravelly riverbed, 28.06.2014, F. Ver- loove 10899 (BR); La Laguna, barranco de Santos E of TF- 13, gravelly riverbed, frequent, 03.07.2014, F. Verloove VeRlOOVe f. 126 ACTA BOT. keywords: barranco; canaria; canary; cruz; flora; gran; gran canaria; individuals; islands; las; native; new; riverbed; species; tenerife; verloove cache: abc-1743.pdf plain text: abc-1743.txt item: #114 of 390 id: abc-1745 author: Segota, Vedran; Hrsak, Vladimir; Alegro, Antun title: Long time no see – rediscovery of peculiar ephemeral fern Anogramma leptophylla (L.) Link in Croatia date: 2017-04-01 words: 3404 flesch: 63 summary: In order to avoid its competitors, A. leptophylla fi nishes its short life- cycle at the end of spring when ephemeral mosses, liver- worts and minute seed plants start to inhabit the unhostile surfaces. The establishment of A. leptophylla on the western part of the island of Mljet may be attributable to certain favourable environmental conditions, but essentially to higher air and soil hu- midity. keywords: anogramma; croatia; der; flora; island; leptophylla; mediterranean; mljet; species cache: abc-1745.pdf plain text: abc-1745.txt item: #115 of 390 id: abc-1752 author: Kielkowska, Agnieszka title: Allium cepa root meristem cells under osmotic (sorbitol) and salt (NaCl) stress in vitro date: 2017-10-03 words: 6568 flesch: 62 summary: 76 (2), 146–153, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0009 ISSN 0365-0588 eISSN 1847-8476 Allium cepa root meristem cells under osmotic (sorbitol) and salt (NaCl) stress in vitro Agnieszka Kiełkowska Institute of Plant Biology and Biotechnology, Faculty of Biotechnology and Horticulture, University of Agriculture in Krakow, Al. 29-Listopada 54, 31-425 Krakow, Poland Abstract – The effects of various concentrations of sorbitol (100, 200 and 360 mM) and NaCl (100, 200 and 300 mM) on root meristem cells of in vitro-cultured Allium cepa L. were analyzed after 10 and 20 days. The nuclear volume of root meristem cells exposed to 200 mM of sorbitol for 20 days was approxi- mately 20% smaller than that of control cells. keywords: cells; control; meristem; nacl; nuclear; onion; osmotic; root; salt; sorbitol; stress cache: abc-1752.pdf plain text: abc-1752.txt item: #116 of 390 id: abc-1754 author: Balpinar, Neslihan; Kavgaci, Ali; Bingol, M. Umit; Ketenoglu, Osman title: Diversity and gradients of vegetation of Sivrihisar Mountains (Eskisehir-Turkey) date: 2018-04-01 words: 8093 flesch: 58 summary: 77 (1), 2018 19 tion but also by degraded shrub and forest vegetation. While seven of these clusters represent steppe vegetation, the other two clus- ters represent the scrub and forest vegetation in the study ar- ea. keywords: akman; anatolia; angustifolius; area; ass; astragalus; communities; community; forest; hoc; ketenoğlu; loco; mountains; species; ssp; steppe; study; tab; var; vegetation cache: abc-1754.pdf plain text: abc-1754.txt item: #117 of 390 id: abc-1800 author: Kralj Borojevic, Koraljka; Gligora Udovic, Marija; Zutinic, Petar; Varbiro, Gabor; Plenkovic-Moraj, Andjelka title: Do benthic diatom assemblages reflect abiotic typology: a case study of Croatian streams and rivers date: 2017-04-01 words: 7870 flesch: 55 summary: Analysis of variance revealed statistically signifi - cant differences (p<0.05) among SOM groups concerning ammonia, nitrates and total phosphorus. Grouping of similar sites, although placed into different abiotic types, makes SOM groups with its corresponding representative species an easy tool for water quality assessment and description of reference assemblage. keywords: 0.001; analysis; assemblages; bertalot; carbonate; diatom; groups; grunow; kützing; lange; quality; som; species; streams; types; typology; variables; water cache: abc-1800.pdf plain text: abc-1800.txt item: #118 of 390 id: abc-1803 author: Gunes, Fatma; Meric, Ciler title: Morphological, anatomical and karyological investigations of the Turkish endemic species Lathyrus woronowii Bornm. (Fabaceae) date: 2017-10-01 words: 4372 flesch: 65 summary: Et Noe, L. inconspicuus L., L. setifolius L.) growing in Tur- key. L. setifolius L.; and lavender in L. inconspicuus L. and L. tau- ricola. keywords: güneş; lathyrus; species; turkey; woronowii; şahin cache: abc-1803.pdf plain text: abc-1803.txt item: #119 of 390 id: abc-1820 author: Friscic, Maja; Maslo, Semir; Garic, Rade; Males, Zeljan; Hazler Pilepic, Kroata title: Comparative analysis of secondary metabolites and antioxidant capacity in vitro of different natural populations of Globularia spp. date: 2018-04-01 words: 7061 flesch: 56 summary: Maja Friščić1*, Semir Maslo2, Rade Garić3, Željan Maleš1, Kroata Hazler Pilepić 1 1 Department of Pharmaceutical Botany, Faculty of Pharmacy and Biochemistry, University of Zagreb, Zagreb, Croatia 2 Lundåkerskolan, Gislaved, Sweden 3 Institute for Marine and Coastal Research, University of Dubrovnik, Dubrovnik, Croatia Abstract – Total phenolic, flavonoid, condensed tannin and iridoid content, as well as antioxidant capacity in vi- tro, were determined spectrophotometrically in methanolic extracts of different plant parts of the Mediterranean medicinal plant Globularia alypum L. and three widespread European species of the same genus: G. cordifolia L., G. meridionalis (Podp.) A two- way analysis of variance (ANOVA) followed by the Bonfer- roni post-hoc test was carried out on averaged results for plant parts of each species, to determine significant differ- ences among the same plant parts of different species and different plant parts of the same species. keywords: alypum; antioxidant; content; et al; globularia; metabolites; parts; phenolic; plant; species cache: abc-1820.pdf plain text: abc-1820.txt item: #120 of 390 id: abc-1821 author: Karalija, Erna; Cavar Zeljkovic, Sanja; Tarkowski, Petr; Muratovic, Edina; Paric, Adisa title: Media composition affects seed dormancy, apical dominance and phenolic profile of Knautia sarajevensis (Dipsacaceae), Bosnian endemic date: 2018-04-01 words: 7702 flesch: 55 summary: In: Withers L, Alderson PG (eds.), Plant tissue culture and its agricultural applications, 167–174. Establishment of the shoot cultures and apical dominance suppression Roots were removed from all germinated seedlings prior to cultivation on shoot culture media. keywords: acid; culture; dominance; germination; kinetin; knautia; l–1; media; mg l–1; plant; sarajevensis; shoots cache: abc-1821.pdf plain text: abc-1821.txt item: #121 of 390 id: abc-183 author: Gunes, Fatma; Cirpici, Ali title: Pollen Moprhology of Turkey species from the section Cicercula (Medic) Gren. & Godr. (genus Lathyrus, Fabaceae) in the Thrace region (Turkey-in-Europe) date: 2010-04-15 words: 3469 flesch: 65 summary: We examined the pollen morphology of four taxa from the Cicercula section of Lathyrus, grown in the Thrace region (European Turkey), including L. annuus L., L. gorgoni Parl. pilosus C. C. Townsend, L. cicera L. and L. hirsutus L. keywords: acetolysis; colpus; lathyrus; pollen; reticulate; wodehouse cache: abc-183.pdf plain text: abc-183.txt item: #122 of 390 id: abc-1839 author: Chinan, Vasilica Claudiu title: Occurrence of the sexual morph of Erysiphe macleayae on Chelidonium majus in Romania date: 2018-10-01 words: 2413 flesch: 67 summary: Besides these hosts, it was also reported as causal agent of powdery mildew on Macleaya microcarpa (Maxim.) Later, Pastirčáková and Pastirčák (2013) confirmed on the basis of morphological characteris- tics that the anamorph of the C. majus powdery mildew in the Czech Republic and Slovakia is caused by a Pseudoidium spe- cies. keywords: erysiphe; et al; macleayae; majus; mildew; powdery cache: abc-1839.pdf plain text: abc-1839.txt item: #123 of 390 id: abc-185 author: Pujadas-Salva , Antonio J.; Munoz Garmendia, J. Felix title: Orobanche pseudorosmarina A. Pujadas & Munoz Garm. sp. nov. (Orobanchaceae) from the eastern Mediterranean region date: 2010-04-15 words: 2249 flesch: 68 summary: Results Description of the new species The Croatian plants that were previously identified as O. rosmarina Beck belong to an unnamed taxon other than that of the Iberian ones and are described as the following new species here: 2 ACTA BOT. I, Fig. 13(1) (1890) p.p. = O. rosmarina Beck in Ginzberger, Oesterr. keywords: beck; hairs; orobanche; rosmarina; stenosiphon cache: abc-185.pdf plain text: abc-185.txt item: #124 of 390 id: abc-186 author: Ozimec, SiniÅ¡a; BoÅ¡ković, Ivica; Florijančić, Tihomir; Jelkić, Dinko; Opačak, AnÄ‘elko; PuÅ¡kadija, Zlatko; Labak, Irena title: Contribution to the lichen flora of Risnjak National Park (Croatia) date: 2010-04-15 words: 3669 flesch: 70 summary: The most frequent phorophytes are Acer pseudoplatanus, which supports 36 species, Fagus sylvatica with 26 species, Pru- nus spp. Therefore, Acer pseudoplatanus and Fagus sylvatica are the common main trees supporting the lichens in the study area, as they are in Sne`nik and Javorniki in Slovenia (PRÜGGER 2005). keywords: abies; acer; ach; croatia; fagus; lichen; national; park; pseudoplatanus; risnjak; species; sylvatica cache: abc-186.pdf plain text: abc-186.txt item: #125 of 390 id: abc-1888 author: Eom, Seung Hee; Lee, Jae Kook; Kim, Dong-Ho; Kim, Heekyu; Jang, Keum-Il; Ryu, Hojin; Hyun, Tae Kyung title: Identification and expression profiling of flax (Linum usitatissimum L.) polyamine oxidase genes in response to stimuli date: 2018-03-26 words: 3640 flesch: 55 summary: An in-depth analysis of LuPAO gene expression patterns under different stress conditions suggested that LuPAO should be involved in the MeJA-mediated biological activities. Thus, they have been implicated in a range of fundamental cellular processes, in- cluding the regulation of gene expression, translation, cell proliferation, cell growth, differentiation, modulation of cell signaling, membrane stabilization, and modulation of ion-channel function and stability (Kusano et al. 2008, Ji- ménez-Bremont et al. 2014, Minocha et al. 2014, Tiburcio et al. 2014). keywords: analysis; cell; expression; fig; flax; genes; lupao; paos; plant; polyamine cache: abc-1888.pdf plain text: abc-1888.txt item: #126 of 390 id: abc-1889 author: Iamonico, Duilio title: Nomenclatural notes on some annual mallows (Malvaceae) date: 2018-04-01 words: 5668 flesch: 67 summary: The annual mallows Lavatera maroccana (Batt. & Trab.) Maire, L. punctata All., and L. trimestris L. are traditionally placed in Lavatera sect. The name Stegia lavatera was published by Candolle (1805: 856) citing as synonym Lavatera trimestris L. Can- dolle’s name is, therefore, a new, superfluous and illegitimate name according to Arts. keywords: africana; iamonico; lavatera; lavatera trimestris; lectotype; malva; miergues; moschata; punctata; species; trimestris; trimestris var; var cache: abc-1889.pdf plain text: abc-1889.txt item: #127 of 390 id: abc-1896 author: Gottschlich, Günter; Scafidi, Filippo; Di Gristina, Emilio title: Hieracium pollinense (Asteraceae), an endemic species to the Pollino National Park (Southern Italy) rediscovered date: 2017-04-01 words: 2134 flesch: 65 summary: Beyond that it was a younger homonym to H. rigoanum Zahn 1902. So far, the presence of H. pollinense in Italy was known from the type specimens only. keywords: hieracium; national; park; pollinense; pollino; species; zahn cache: abc-1896.pdf plain text: abc-1896.txt item: #128 of 390 id: abc-1901 author: Shekhawat, Mahipal S; M., Manokari title: In vitro multiplication, micromorphological studies and ex vitro rooting of Hybanthus enneaspermus (L.) F. Muell. – a rare medicinal plant date: 2018-04-01 words: 5984 flesch: 59 summary: 3. Micromorphological studies of Hybanthus enneaspermus: venation pattern in leaves of in vitro shoots (A); and field plant (B); stomatal pattern in leaves of in vitro shoots (C), and field plant (D); and trichomes in leaves of in vitro shoots (E), and field plant (F). Mucilaginous cells were also ob- served in field transferred plants but these were totally absent in the in vitro grown plantlets. keywords: enneaspermus; et al; field; hybanthus; medium; plantlets; rooting; shoots cache: abc-1901.pdf plain text: abc-1901.txt item: #129 of 390 id: abc-1910 author: Bogdanovic, Sandro; Jogan, Nejc title: A Word from the Guest Editors date: 2016-10-01 words: 868 flesch: 46 summary: And fi nally, but not the least, we have to thank the organizing consortium of local organizers: Rijeka Natural History Mu- seum and the University of Rijeka, which offered us a comfortable space in their campus, and the active members of the two botanical associations Croatian Botanical Society (HBoD) and Botanical Society of Slovenia (BDS). At the end, in the name of Organizers of 6th BBC, we can all thank the participants for shaping up a pleasant, informative and fruitful congress with an exchange of up-to-date results from various fi elds of botany. keywords: botanical; congress; rijeka cache: abc-1910.pdf plain text: abc-1910.txt item: #130 of 390 id: abc-1912 author: Umar, Muhammad; Siddiqui, Zamin Shaheed title: Physiological performance of sunflower genotypes under combined salt and drought stress environment date: 2018-04-01 words: 6585 flesch: 60 summary: Plants are frequently exposed to many extremes such as drought stress, low/high temperature, salt stress, flooding stress, and heavy metal toxicity while growing in nature. It was reported that in drought stress, plant growth retardation is linked with pho- tosynthesis, respiration, and nutrient metabolism. keywords: chlorophyll; content; drought; genotypes; h2o2; plants; proline; s.28111; salt; sf0049; stress; stresses; sunflower; water cache: abc-1912.pdf plain text: abc-1912.txt item: #131 of 390 id: abc-1919 author: Yanik, Fatma; Ayturk, Ozlem; Cetinbas-Genc, Aslihan; Vardar, Filiz title: Salicylic acid-induced germination, biochemical and developmental alterations in rye (Secale cereale L.) date: 2018-04-01 words: 4981 flesch: 57 summary: Numerous re- searches indicated that SA content increases under various types of oxidative stress conditions in plants (Larkindale and Knight 2002, War et al. 2011). To assess the oxidative stress after SA application hy- drogen peroxide (H2O2) content and some antioxidant en- zyme activities were evaluated after 15 days. keywords: acid; activity; control; growth; h2o2; plant; stress; µm sa cache: abc-1919.pdf plain text: abc-1919.txt item: #132 of 390 id: abc-1927 author: Chandrakar, Vibhuti; Dubey, Amit; Sahu, Keshavkant title: Modulation of arsenic-induced oxidative stress and protein metabolism by diphenyleneiodonium, 24-epibrassinolide and proline in Glycine max L. date: 2018-04-01 words: 9744 flesch: 56 summary: On the other hand, in protec- tive treatments, exogenous DPI, EBL or Pro, more precisely Pro, maintained the vitality of Glycine max L. radicles, up to a large extent, even under As-stress. The present study was intended to exam- ine the comparative ameliorative effects of diphenyleneiodonium (DPI), 24-epibrassinolide (EBL) and proline (Pro) on As-stress in Glycine max L. Seeds of Glycine max L. were subjected to As (100 µM) singly, and together with DPI (10 µM), EBL (0.5 µM) or Pro (10 mM), for five days, and were then analyzed. keywords: arsenic; chandrakar; dpi; ebl; et al; glycine; glycine max; max; max l.; min; pro; protein; stress cache: abc-1927.pdf plain text: abc-1927.txt item: #133 of 390 id: abc-193 author: Saheed, Sefiu Adekilekun; Jonsson, Lisbeth M.V.; Botha, Christiaan E.J. title: Russian wheat aphid causes greater reduction in phloem transport capacity of barley leaves than bird cherry-oat aphid. date: 2010-04-15 words: 5542 flesch: 61 summary: Croat. 69 (1), 7–18, 2010 CODEN: ABCRA 25 ISSN 0365–0588 Russian wheat aphid causes greater reduction in phloem transport capacity of barley leaves than bird cherry-oat aphid. These two studies provide back- ground information concerning the reduction of phloem transport capacity during aphid feeding. keywords: aphid; bca; botha; feeding; leaves; phloem; rwa; transport cache: abc-193.pdf plain text: abc-193.txt item: #134 of 390 id: abc-1930 author: Jachula, Jacek; Wrzesien, Malgorzata; Strzalkowska-Abramek, Monika; Denisow, Bozena title: The impact of special-temporal changes in flora attributes and pollen availability on insect visitors in Lamiaceae species date: 2018-10-01 words: 9214 flesch: 59 summary: The percentage of plant species in bloom at each study point was established based on the cover of plant species in particular transects (n = 5 per habitat). The total number of plant species found was 185, of which 151 species (81.6%) were identified as visited by in- sects (On-line Suppl. keywords: abundance; denisow; dry; flowering; flowers; grassland; habitat; insect; lamiaceae; plant; pollen; railway; species; visitors cache: abc-1930.pdf plain text: abc-1930.txt item: #135 of 390 id: abc-1935 author: Mousavi, Effat Ahmadi; Kalantari, Khosrow Manochehri; Nasibi, Fatemeh; Oloumi, Hakimeh title: Effects of carrageenan as elicitor to stimulate defense responses of basil against Cuscuta campestris Yunck date: 2018-04-01 words: 7071 flesch: 56 summary: Because carrageenans are non-toxic biodegradable, non-polluting and non-hazard- ous to humans, animals and birds, they can be recommended as natural biostimulators for the protection of plants against parasitic C. campestris plants. For analysis of defense against C. campestris invasion and measuring of infestation of basil plants by C. campestris, the percentage of C. campestris tight coupling (its haustorium penetration) to basil shoot was determined 14 days after the infection. keywords: activity; basil; basil plants; campestris; carrageenan; content; control; cuscuta; defense; et al; growth; host; journal; plants cache: abc-1935.pdf plain text: abc-1935.txt item: #136 of 390 id: abc-1945 author: Emami-Tabatabaei, Samane Sadat; Larijani, Kambiz; Mehregan, Iraj title: Application and limitation of molecular data and essential oil content in identification of Leutea elbursensis Mozaff in northern Iran date: 2018-10-01 words: 5382 flesch: 59 summary: We also aim to study the possible cor- relation between the genetic structure and the essential oil profile of L. elbursensis populations collected from different localities in northern Iran (Tehran province), using GC/MS and AFLP fingerprinting techniques. The genus Leutea Pimenov be- longs to the “Ferula group” including Ferula L., Dorema L. and Leutea (Kurzyna-Młynik et al. 2008). keywords: elbursensis; et al; ferula; iran; leutea; oils; petiolaris; pimenov; populations; species cache: abc-1945.pdf plain text: abc-1945.txt item: #137 of 390 id: abc-1949 author: Jasprica, Nenad; Dolina, Katija; Milovic, Milenko title: The flora and vegetation of the NE Mediterranean islet with centuries-long human influences date: 2018-10-01 words: 6524 flesch: 62 summary: The rocky shores are home to the Limonietum anfracti plant association, characterised by Limonium dictyophorum, a species endemic to the southern coast of the eastern Adri- atic (Nikolić et al. 2015), which forms dense low-spreading formations that colonise the cracks in the rocks. et Vagge in Biondi et al. 2014 Pistacio lentisci-Pinion halepensis Biondi, Blasi, Galden- zi, Pesaresi et Vagge in Biondi et al. 2014 Pistacio lentisci-Pinetum halepensis De Marco, Veri et Ca- neva 1984 Querco ilicis-Pinetum halepensis Loisel 1971 keywords: adriatic; br.-bl; croatian; et al; flora; islands; islet; jasprica; mediterranean; milović; plant; species; taxa; vegetation; vrnik cache: abc-1949.pdf plain text: abc-1949.txt item: #138 of 390 id: abc-1953 author: Novák, Pavel; Zukal, Dominik title: Galium divaricatum Pourr. ex Lam. (Rubiaceae) – a new species for the flora of Ukraine date: 2018-10-01 words: 2197 flesch: 63 summary: Besides G. divaricatum, two other spe- cies of this group occur in Central Europe, G. parisiense and G. tenuissimum. This paper focuses on G. divaricatum which was discovered in the Za- karpatska Region (W Ukraine) as a new plant for the Ukrai- nian flora in June 2016. keywords: divaricatum; flora; galium; region; species; ukraine cache: abc-1953.pdf plain text: abc-1953.txt item: #139 of 390 id: abc-1968 author: Iamonico, Duilio; El Mokni, Ridha title: A new addition to the alien flora of Tunisia, Amaranthus spinosus L. (Amaranthaceae s.l.), with notes on A. diacanthus Raf. date: 2019-04-01 words: 2575 flesch: 68 summary: N° 207, Avenue Avicenna, Monastir-5000, Tunisia Abstract – Amaranthus spinosus L. (Amaranthaceae s.l.), a species native to the Neotropics, has been found in four localities (Bizerta, Bir Bouregba, Hammamet, and Nabeul) of N. Tunisia. According to Mosyakin and Robert- son (1996: 278), Amaranthus spinosus L. is the only species belonging to Amaranthus subg. keywords: amaranthaceae; amaranthus; iamonico; species; spinosus cache: abc-1968.pdf plain text: abc-1968.txt item: #140 of 390 id: abc-1973 author: Animasaun, David Adedayo; Oyedeji, Stephen; Olorunmaiye, Kehinde Stephen; Azeez, Musibau A; Tijani, Idowu Abdulfatah; Morakinyo, Joseph Akintade title: Morpho-chemical divergence and fatty acid profile of shea tree seeds (Vitellaria paradoxa) collected from different locations in Kwara State, Nigeria date: 2019-04-01 words: 6668 flesch: 63 summary: Seed oil was extracted for phytochemical constituents, physicochemical properties, and fatty acid profiling by gas chromatography equipped with mass spectrometry (GC/MS). Proximate composition, extraction, characteriza- tion and comparative assessment of coconut (Cocos nucifera) and melon (Colocynthis citrullus) seeds and seed oils. keywords: acid; butter; fatty; fruit; journal; kosubosu; locations; nigeria; nut; oil; seed; shea; tree cache: abc-1973.pdf plain text: abc-1973.txt item: #141 of 390 id: abc-1977 author: Palmai, Tamas; Szabo, Beata; Hubai, Katalin Eszter; Padisak, Judit title: Photosynthetic performance of two freshwater red algal species date: 2018-10-01 words: 4634 flesch: 57 summary: At higher temperatures a slow decrease was observed in the Ik values. In comparison to ecophysiological data of species oth- er than Rhodophyta, it is apparent that most species have photosynthesis maxima at higher temperature (e.g. Üveges et al. 2012, Pálmai et al. 2013, Lengyel et al. 2015, Pálmai et al. 2016) than these two Rhodophyta populations. keywords: bangia; batrachospermum; light; m–2; photosynthetic; rhodophyta; species; temperature; µmol cache: abc-1977.pdf plain text: abc-1977.txt item: #142 of 390 id: abc-1986 author: Zare, Golshan; Ozudogru, Baris; Ergan, Gokhan; Tavsanoglu, Cagatay title: Taxonomic notes on the genus Chaenorhinum (Plantaginaceae) in Turkey date: 2018-10-01 words: 2914 flesch: 67 summary: In this study, the accuracy of the taxonomic status of this species, which was initially reported by P.H. Davis as C. rubrifolium from south eastern Turkey, is discussed and the typical representatives of C. rubrifolium were collected for the first time for Turkey from Muğla province, southwestern Anatolia. Therefore, C. rubrifolium is introduced here as a new re- cord for the Flora of Turkey. keywords: calyx; chaenorhinum; davis; gerense; leaves; rubrifolium; seeds; species; turkey cache: abc-1986.pdf plain text: abc-1986.txt item: #143 of 390 id: abc-1987 author: Papadakis, Ioannis E; Veneti, Georgia; Chatzissavvidis, Christos; Therios, Ioannis title: Physiological and growth responses of sour cherry (Prunus cerasus L.) plants subjected to short-term salinity stress date: 2018-10-01 words: 4145 flesch: 59 summary: According to Tattini et al. (1995), the maintenance of plant growth and PAPADAKIS I. E., VENETI G., CHATZISSAVVIDIS C., THERIOS I. 198 ACTA BOT. Therefore, the current study aimed to investigate the growth and physiological re- sponses (plant growth, chlorophyll concentration, water re- lations and nutrient status) of the well-known sour cherry genotype CAB-6P, which is widely used as a rootstock for both sour and sweet cherry cultivars, under salt stress. keywords: fig; growth; leaves; nacl; plants; root; salinity; stress cache: abc-1987.pdf plain text: abc-1987.txt item: #144 of 390 id: abc-1995 author: Bogdanovic, Sandro; Segota, Vedran; Alegro, Antun title: Resurrection of the regionally extinct taxon in Croatia – the case of Ammophila arenaria (L.) Link (Poaceae) date: 2018-10-01 words: 2724 flesch: 66 summary: Clematis flammula L. At the locality Kraljičina plaža it grows in typical psammophytic vegetation (Fig. 3) with some other very rare psammophylous taxa of the Croatian flora: Cyperus capita- tus Vand., Phleum arenarium L., Stachys maritima Gouan, Elytrigia juncea (L.) keywords: ammophila; arenaria; arundinacea; flora; link; subsp cache: abc-1995.pdf plain text: abc-1995.txt item: #145 of 390 id: abc-200 author: Makbul, Serdar; Türkmen, Zafer; CoÅŸkunçelebi, Kamil; BeyazoÄŸlu, Osman title: Morfometric study on Scorzonera L. taxa (Asteraceae) from northeast Anatolia date: 2010-10-22 words: 4869 flesch: 70 summary: S. cana is said to be close to S. laciniata ssp. This situation might be explained as follows; S. laciniata prefers dry habitats and is characterized by an entire leaf and S. cana prefers humid habitats and is characterized by a compound leaf. keywords: bayburt; cana; characters; cluster; makbul; otus; scorzonera; study; taxa cache: abc-200.pdf plain text: abc-200.txt item: #146 of 390 id: abc-2000 author: Butiuc-Keul, Anca; Craciunas, Cornelia; Goia, Irina; Farkas, Anca; Jarda, Liliana; Cristea, Victoria title: Genetic structure of populations of several endangered and endemic Dianthus species revealed by microsatellite markers date: 2018-10-01 words: 6512 flesch: 57 summary: The individuals belonging to D. henteri species showed the particular allele d and the allele v which was present in D. cal- lizonus as well. Over 100 species of Dianthus species occur in Europe, and more than 70 are endemic (Valente et al. 2010). keywords: alleles; callizonus; dianthus; dianthus species; diversity; endemic; et al; plant; populations; romania; species cache: abc-2000.pdf plain text: abc-2000.txt item: #147 of 390 id: abc-2009 author: Huseyinova, Rena; Yalcin, Erkan title: Subalpine vegetation in Giresun Mountains (Turkey) date: 2018-10-01 words: 6624 flesch: 58 summary: Etzold et al. (2016) reported that altitude, slope and aspect were also the main topographical factors and formed different syntaxa in subalpine and alpine grassland vegetation in the northeastern Greater Caucasus of Azerbaijan. Cannone, N., Sgorbati, S., Guglielmin, M., 2007: Unexpected impacts of climate change on alpine vegetation. keywords: alpine; festucetum; mountains; plant; quézel; slopes; soil; species; study; subalpine; turkey; vegetation cache: abc-2009.pdf plain text: abc-2009.txt item: #148 of 390 id: abc-2022 author: Notarte, Kin Israel; Yaguchi, Takashi; Suganuma, Keisuke; dela Cruz, Thomas Edison title: Antibacterial, cytotoxic and trypanocidal activities of marine-derived fungi isolated from Philippine macroalgae and seagrasses date: 2018-10-01 words: 7606 flesch: 54 summary: Zhan, J., Gunaherath, G. M. K. B., Wijeratne, E. M. K., Gunatilaka, A. A. L., 2007: Our study therefore showed that salinity may influence the bioactivities of some species of MDF. Key words: bioactivity, fungal natural products, marine fungi, Philippines Abbreviations: ASW – artificial seawater; DMSO – dimethyl sulfoxide; MDF – marine-derived fungi; MEA – malt extract agar; MEAS – malt extract agar with marine salt; MEB – malt extract broth; MEBS – malt extract broth with marine salt; PDB – potato dextrose broth; PDBS – potato dextrose broth with marine salt; ZOI – zone of inhi- bition * keywords: aspergillus; bioactive; broth; culture; extracts; fumigatus; fungi; marine; mdf; ml–1; salt; tubingensis cache: abc-2022.pdf plain text: abc-2022.txt item: #149 of 390 id: abc-2029 author: Stankovic, Jelena D.; Sabovljevic, Aneta D.; Sabovljevic, Marko S. title: Bryophytes and heavy metals: a review date: 2018-10-01 words: 9245 flesch: 54 summary: Although men have used heavy metals for thousands of years (Järup 2003), reckless human behaviour, associated with urbaniza- tion and industrial development, drastically altered the pre- vious distribution and geochemical cycles of heavy metal (Singh et al. 2011). ISSN 0365-0588 eISSN 1847-8476 Review Bryophytes and heavy metals: a review Jelena D. Stanković, Aneta D. Sabovljević, Marko S. Sabovljević* Institute of Botany and Botanical Garden, Faculty of Biology, University of Belgrade, Takovska 43, 11000 Belgrade, Serbia Abstract – Bryophytes, a group of terrestrial plants widely used in biomonitoring, are reviewed for their relation to heavy metals. keywords: 2005; bryophytes; cell; concentrations; effects; environment; et al; metals; moss; plants; pollution; species; uptake cache: abc-2029.pdf plain text: abc-2029.txt item: #150 of 390 id: abc-2040 author: Jemelková, Michaela; Kitner, Miloslav; Krístková, Eva; Dolezalová, Ivana; Lebeda, Ales title: Genetic variability and distance between Lactuca serriola L. populations from Sweden and Slovenia assessed by SSR and AFLP markers date: 2018-10-01 words: 7506 flesch: 57 summary: Two primary morphological forms are recognized with- in L. serriola L. based on cauline leaf-shape variability; the pinnatifid-leaved form L. serriola L. f. serriola, and the un- lobed-leaved form L. serriola L. f. integrifolia (S.F. Gray) S.D. Prince et R. N. Carter. Microsatellite (SSR) loci used to assess genetic variability in Lactuca sativa L. and L. serriola L.; NA – number of alleles; PIC – allelic polymorphic information content. keywords: aflp; doležalová; et al; lactuca; lactuca serriola; lebeda; lettuce; populations; samples; serriola; sweden cache: abc-2040.pdf plain text: abc-2040.txt item: #151 of 390 id: abc-2053 author: Skvorc, Zeljko; Jasprica, Nenad; Alegro, Antun; Kovacic, Sanja; Franjic, Jozo; Krstonosic, Daniel; Vranesa, Ana; Carni, Andraz title: Vegetation of Croatia: Phytosociological classification of the high-rank syntaxa date: 2017-10-01 words: 19000 flesch: 49 summary: For example, forest vegetation was investigated and documented to a greater extent. The first reviews of forest vegetation appeared in the works of Hor- vat (1937, 1938), and since then many comprehensive re- views have been published (e.g. Rauš et al. 1992, Vukelić et al. 2008, Vukelić 2012). keywords: acta; atlantic; belts; boreal; bot; br.-bl; central; central europe; communities; conserv; croatia; et al; et tx; eunis; europe; european; forests; grasslands; habitats; herb; herb vegetation; horvat; horvatić; mediterranean; montane; mucina; mucina et; nemoral; nom; nutrient; oak; oberd; passarge; prevlašću; propos; regions; rivas; ruderalne; scrub; soils; southern; subalpine; syn; temperate; temperate europe; thermophilous; tlima; travnjaci; trinajstić; vegetacija; vegetation; visokih; western; zajednice; zeleni; zone; čarni; šikare; škvorc; šume cache: abc-2053.pdf plain text: abc-2053.txt item: #152 of 390 id: abc-2116 author: Kamberovic, Jasmina; Plenkovic-Moraj, Andelka; Kralj Borojevic, Koraljka; Gligora Udovic, Marija; Zutinic, Petar; Hafner, Dubravka; Cantonati, Marco title: Algal assemblages in springs of different lithologies (ophiolites vs. limestone) of the Konjuh Mountain (Bosnia and Herzegovina) date: 2019-04-01 words: 11776 flesch: 55 summary: Studies on algae in Bosnia and Herzegovina date back to the late 19th century and the early 20th century (Protić 1897, 1899, 1901, 1908, Gutwinski 1899, Beck 1928), whereas the first detailed stud- ies on diatoms were carried out in the framework of a wider study of diatom assemblages in several lakes and springs of ALGAE IN SPRINGS OF DIFFERENT LITHOLOGY ACTA BOT. Results Environmental variables Ecomorphological characteristics of springs, including spring names with short spring codes, location, shading, ve- locity and discharge are described in On-line Suppl. keywords: achnanthidium; algal; assemblages; bertalot; bertalot et; bosnia; cantonati; diatom; et al; gomphonema; grunow; krammer; kützing; lange; navicula; nitzschia; ophiolites; species; springs; substrata; taxa; values cache: abc-2116.pdf plain text: abc-2116.txt item: #153 of 390 id: abc-2128 author: Kisa, Dursun title: Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum date: 2019-04-01 words: 7013 flesch: 57 summary: Plant Physiology and Biochemistry 56, 79–96. Hossain, Z., Komatsu, S., 2012: Contribution of proteomic stud- ies towards understanding plant heavy metal stress response. ISSN 0365-0588 eISSN 1847-8476 Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum Dursun Kısa Bartın University, Faculty of Science, Department of Molecular Biology and Genetics, 74110, keywords: chelating; content; expression; gene; leaves; metal; p5cs1; plants; ppm; proline; stress; tomato cache: abc-2128.pdf plain text: abc-2128.txt item: #154 of 390 id: abc-2175 author: Skvorc, Zeljko title: Morfologija biljaka. Razvoj, grada i uloga biljnih tkiva, organa i organskih sustava by Toni Nikolic 2017 date: 2017-10-06 words: 1112 flesch: 52 summary: In the chapter Anatomy Basics, he presents plant tissues involved in the formation of plant organs. For that reason, there is a need for quality, comprehensive books that will give an overview of all as- pects of plant morphology. keywords: morphology; organs; plant cache: abc-2175.pdf plain text: abc-2175.txt item: #155 of 390 id: abc-2180 author: Riaz, Sana; Abid, Rubina; Ali, Syed Abid; Munir, Iqra; Qaiser, Muhammad title: Morphology and seed protein profile for a new species of the genus Cleome L. (Cleomaceae) from Pakistan date: 2019-04-01 words: 2792 flesch: 67 summary: The observations were based on 5-10 specimens of C. brachycarpa, C. viscosa, and the new taxon. Cleome karachiensis S. Riaz, R. Abid and M. Qaiser: habit (A), flower (B), seed (C), type specimen (F); C. brachycarpa: seed (D), C. viscosa: seed (E). keywords: cleome; fig; new; oblong; seeds; species; viscosa cache: abc-2180.pdf plain text: abc-2180.txt item: #156 of 390 id: abc-2185 author: Batalha, Marco Antonio; Custerevska, Renata; Matevski, Vlado title: Climatic drivers of dry grassland phylogenetic diversity in the Republic of Macedonia date: 2019-04-01 words: 7658 flesch: 57 summary: When regressing phylogenetic species richness against the climatic variables, we found positive relationships with isothermality and an- nual precipitation and negative relationships with mean tem- perature of the driest quarter and precipitation seasonality (Tab. 1). As a matter of fact, the amount of evolutionary history in Macedonian dry grass- land communities, as measured by phylogenetic species rich- ness, decreased towards drier and more seasonal climatic conditions. keywords: bio; climate; community; diversity; dry; et al; macedonia; species; temperature cache: abc-2185.pdf plain text: abc-2185.txt item: #157 of 390 id: abc-2186 author: Maslo, Semir title: Setaria adhaerens (Forssk.) Chiov. (Poaceae), a new alien species in the Croatian flora date: 2019-04-01 words: 1989 flesch: 71 summary: Among European species, S. adhaerens is most similar to S. verticillata, which is native in most of Europe (Valdés and Scholz 2009). According to Valdés and Scholz (2009) the S. verticilla- ta complex presently contains three species: S. adhaerens, S. verticillata and S. verticilliformis. keywords: adhaerens; setaria; species; spikelets; verticillata cache: abc-2186.pdf plain text: abc-2186.txt item: #158 of 390 id: abc-222 author: Vafadar, Mahnaz; Attar, Farideh; Maroofi, Hosein title: Trichome micromorphology in drupe of Amygdalus L. (Rosaceae) from Iran date: 2010-04-15 words: 5427 flesch: 61 summary: Two varieties of A. lycioides showed different portions of trichomes as fol- lows: in A. lycioides var. Two varieties of A. lycioides exhibit significant difference. keywords: amygdalus; indumentum; iran; khatamsaz; lycioides; pericarp; species; trichomes; var cache: abc-222.pdf plain text: abc-222.txt item: #159 of 390 id: abc-2232 author: Kovacic, Sanja title: “Lost Worlds of Archaic Gardens” – 2018 Exhibition in Botanical Garden of the Faculty of Science, University of Zagreb date: 2018-04-11 words: 807 flesch: 57 summary: from Zagreb Botanical Garden collection (courtesy of the Botanical Garden of Eötvös University, Budapest). Zagreb Botanical Garden holds several species of this ancient family; F) The maidenhair tree (Ginkgo biloba L.) is the single living descendant of the Ginkgoaceae family of gymnosperms, which appeared in the Mesozoic. keywords: botanical; garden cache: abc-2232.pdf plain text: abc-2232.txt item: #160 of 390 id: abc-2272 author: Friscic, Maja title: IN MEMORIAM Professor Kroata Hazler Pilepic (1968-2017) date: 2018-04-11 words: 2820 flesch: 58 summary: Silvae Genetica 46, 229–236. Hazler Pilepić, K., Comps, B., Šugar, I., Šolić, E., 1999: Maleš, Ž., Plazibat, M., Hazler Pilepić, K., Cetina Čižmek, B., 2001: Istraživanje aminokiselinskog sastava drače (Paliurus spina- christi Mill.). keywords: faculty; hazler; hazler pilepić; maleš; plant; university; zagreb cache: abc-2272.pdf plain text: abc-2272.txt item: #161 of 390 id: abc-2282 author: Djafri-Bouallag, Linda; Ourari, Malika; Sahnoune, Mohamed title: A cytogenetic and pollen study of annual Medicago species from Soummam Valley (Northeastern of Algeria) date: 2019-03-28 words: 6513 flesch: 56 summary: Souza, M. M., Pereira, T. N. S., 2011: Acta Botanica Malacitana 37, 93–102. Baptista-Giacomelli, F. R., Pagliarini, M. S., Almeida, J. L., 2000: Meiotic behavior in several Brazilian oat cultivars (Avena sa- tiva L.). keywords: chromosome; cytomixis; et al; lesins; littoralis; m. laciniata; medicago; pollen; polymorpha; species; truncatula; viability cache: abc-2282.pdf plain text: abc-2282.txt item: #162 of 390 id: abc-2289 author: Kovalenko, Oleksii; Kalista, Mariia title: Phytosociology and biodiversity patterns of annual wetland communities of Pyriatynskyi National Nature Park (Poltava Oblast, Ukraine) date: 2019-10-01 words: 4874 flesch: 50 summary: Results Annual wetland communities of Pyriatynskyi National Nature Park are presented by 1 order, 4 alliances and 7 as- sociations: Cl. The variability of moisture is very important factor for annual wetland communities. keywords: analysis; associations; communities; cyperetum; isoëto; juncetea; juncetum; nano; species; syntaxa; vegetation; wetland cache: abc-2289.pdf plain text: abc-2289.txt item: #163 of 390 id: abc-2317 author: Tomaselli, Valeria; Terzi, Massimo title: Rocky coastal vegetation of the class Crithmo-Staticetea in the south-east of Italy date: 2019-04-01 words: 8014 flesch: 59 summary: Biondi et al. 2014). Biondi (in: Biondi et al. 2013) described the new association ‘Senecioni bicoloris-He- lichrysetum litorei’ (cf art. keywords: biondi; brullo; class; cluster; communities; crithmo; et al; fig; italy; limonietum; limonio; relevés; species; staticetea; tab; vegetation cache: abc-2317.pdf plain text: abc-2317.txt item: #164 of 390 id: abc-2327 author: Memon, Abdul Razaque; Schwager, Christiane Katja; Niehaus, Karsten title: Expression of small GTPases in the roots and nodules of Medicago truncatula cv. Jemalong date: 2019-04-01 words: 6089 flesch: 57 summary: Keywords: gene expression, Medicago truncatula, root nodules, small GTP-binding proteins * Corresponding author, e-mail: armemon@usak.edu.tr, abdulrezzak.memon@gmail.com Introduction Intracellular membrane trafficking plays a major role in plant growth and development including root hair forma- tion, rhizobium infection process and nodule formation in legumes (Oldroyd and Downie 2008). The RT-qPCR experiments showed that indeed our previously identified transcript (homologues to A. thaliana Rop7 and A8IK57_MedtrRop 8) is predomi- nantly expressed in root nodules (Fig. 3c), indicating its role in nodule biogenesis. keywords: binding; et al; expression; gtp; infection; medicago; nodules; plant; proteins; rhizobium; roots; truncatula cache: abc-2327.pdf plain text: abc-2327.txt item: #165 of 390 id: abc-2337 author: Pavia, Ivo; Rocha, Luis; Moutinho-Pereira, Jose; Lima-Brito, Jose; Correia, Carlos title: Screening for drought resistance during germination of modern and old Iberian wheat cultivars date: 2019-10-01 words: 3840 flesch: 67 summary: Germination parameters in wheat cultivars on drought stress. Singh, P., Ibrahim, H.M., Flury, M., Schillinger, W.F., Knappen- berger, T., 2013: Critical water potentials for germination of wheat cultivars in the dryland Northwest USA. keywords: cultivars; germination; mestiço; water; wheat cache: abc-2337.pdf plain text: abc-2337.txt item: #166 of 390 id: abc-235 author: KoÅ‚odziejek, Jeremi title: Multilocus genomic associations among selected taxa of genus Potentilla (Rosaceae) in Poland using RAPD analysis date: 2010-04-15 words: 2234 flesch: 64 summary: According to my measurements the lengths of achenes P. intermedia, 1.19 mm, were similar to those de- scribed by SOJÁK (1995) and ANDENBERG (1994), 0.8–1.3 mm. SEM analyses allowed distinguishing two morphological types of seed coats pattern: ruminate-reticulate sculpture due to well pre- served epidermal cells in P. subarenaria and tuberculate sculpture in P. intermedia. keywords: achenes; intermedia; potentilla; species; subarenaria cache: abc-235.pdf plain text: abc-235.txt item: #167 of 390 id: abc-2394 author: Persic, Martina; Veberic, Robert; Mikulic-Petkovsek, Maja title: Phenolic profiles of quince (Cydonia oblonga Mill.) leaf extracts obtained by different extraction methods date: 2019-10-01 words: 4247 flesch: 55 summary: In conclusion, our results demonstrate the poor effi- ciency of ultrasound assisted extraction for the extraction of quince leaf phenolic compounds compared to other ex- amined methods. The flavonol profile in various quince leaf extracts; ultra- sound extraction in water (H2O US), ultrasound extraction in ethanol (EtOH US), water maceration (Mac H2O), ethanolic mac- erate (Mac EtOH), water infusion (Inf ), decoction of dry mate- rial (Dec D) and decoction of fresh material (Dec F). keywords: dec; decoction; extraction; extracts; leaves; material; phenolic; quince; water cache: abc-2394.pdf plain text: abc-2394.txt item: #168 of 390 id: abc-2427 author: Gokturk, Ramazan Suleyman; Dusen, Olcay; Kaya, Ergun; Gurcan, Betul; Sarpkaya, Uygar title: A new variety of Plocama calabrica (Rubiaceae) from Denizli (Turkey) confirmed by morphological and molecular ISSR markers date: 2019-10-01 words: 3407 flesch: 60 summary: A general view of Plocama calabrica var. ISSR primer sequences and GenBank accessions numbers (Martins-Lopes et al. 2009, Smykal et al. 2011) used in molecular phylogenetic analysis of Plocama calabrica var. keywords: alba; calabrica; calabrica var; issr; molecular; plocama; plocama calabrica; turkey; var; variety cache: abc-2427.pdf plain text: abc-2427.txt item: #169 of 390 id: abc-2443 author: Sajna, Nina; Sipek, Mirjana; Sustar-Vozlic, Jelka; Kaligaric, Mitja title: Germination behavior of the extremely rare Hladnikia pastinacifolia Rchb. (Apiaceae) – a Pleistocene in situ survivor date: 2019-10-01 words: 6912 flesch: 55 summary: for main umbel seeds and 13% for lateral umbel seeds bur- ied in the stone wall. The germination rate for main umbel seeds was 96%, and 80% for lateral umbel seeds. keywords: baskin; days; embryo; germination; hladnikia; pastinacifolia; seedlings; seeds; soil; species; umbel; šajna cache: abc-2443.pdf plain text: abc-2443.txt item: #170 of 390 id: abc-2454 author: Cikili, Yakup; Kulac, Semsettin; Samet, Halil; Filiz, Ertugrul title: Effects of exogenous nitric oxide on cadmium toxicity in black poplar (Populus nigra): physiological approaches date: 2019-10-01 words: 7363 flesch: 61 summary: In comparison with control, Cu concentrations in root were increased 100 and 500 µM Cd treatments while the incre- ments in leaf Cu concentration were found significantly with only 500 µM Cd treatments. Cd concentrations increased in leaves, bark, and roots at Cd treatments, whereas Cd + SNP applications had alleviative effects on Cd exposures, except for leaves. keywords: bark; cadmium; cd exposure; exposure; leaves; levels; nigra; plant; poplar; roots; snp; treatments; µm cd cache: abc-2454.pdf plain text: abc-2454.txt item: #171 of 390 id: abc-248 author: KoÅ‚odziejek, Jeremi; Cieslikowski, Tomasz; Sakowicz, Tomasz title: Multilocus genomic associations among selected taxa of genus Potentilla (Rosaceae) in Poland using RAPD analysis date: 2010-04-15 words: 5309 flesch: 57 summary: (P. taber- naemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb.). (P. tabernaemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb.) within P. subgen. keywords: collinae; p. argentea; p. collina; p. incana; p. leucopolitana; p. subsect; p. tabernaemontani; p. thyrsiflora; potentilla; rapd; species cache: abc-248.pdf plain text: abc-248.txt item: #172 of 390 id: abc-2510 author: Denisow, Bozena; Tymoszuk, Karolina; Dmitruk, Marta title: Nectar and pollen production of Helianthus tuberosus L. – an exotic plant with invasiveness potential date: 2019-10-01 words: 6053 flesch: 63 summary: We assume that the UHI environmen- tal conditions (higher temperature, lower humidity) impact- ed on plant species phenotypic traits and impaired the num- ber of developed disc florets and inflorescences. The variability in the nectar amount produced in flowers is quite common and has been report- ed among plant species, plant populations or even among individual flowers (Nicolson and Thornburg 2007, Denis- ow et al. 2014). keywords: acta; denisow; disc; florets; insect; nectar; plant; pollen; production; species; tuberosus; urban cache: abc-2510.pdf plain text: abc-2510.txt item: #173 of 390 id: abc-2538 author: Amrutha, Sivanantham; Muneera Parveen, Abdul Bari; Muthupandi, Muthusamy; Sivakumar, Veerasamy; Nautiyal, Raman; Ghosh Dasgupta, Modhumita title: Variation in morpho-physiological, biochemical and molecular responses of two Eucalyptus species under short-term water stress date: 2019-10-01 words: 8363 flesch: 55 summary: Concurrently, reduction in plant growth (Chaves et al. 2003, Bedon et al. 2012), photosynthesis (Warren et al. 2007) and hormone production (Granda et al. 2011) have also been re- ported during water stress conditions. Hence, reduction in leaf area during water stress condition is a response in all eucalypt species as reported in E. globu- lus (Costa e Silva et al. 2004, Maseda and Fernández 2016), E. camaldulensis (Lemcoff et al. 2002, Maseda and Fernán- dez 2016) and E. microtheca (Susiluoto and Berninger 2007). keywords: condition; content; drought; ec226; et al; eucalyptus; globulus; leaf; plant; response; species; stress; temperature; tolerance; water; water stress cache: abc-2538.pdf plain text: abc-2538.txt item: #174 of 390 id: abc-2545 author: Jasprica, Nenad title: Professor emeritus Ljudevit Ilijanic: an appreciation on the occasion of his ninetieth birthday date: 2019-04-01 words: 1606 flesch: 57 summary: The purely scientific work of Professor Ljudevit Ilijanić has been oriented to the flora and vegetation of Croatia. A lists and analysis of the scientific papers authored by Professor Ljudevit Ilijanić have previously been published in the Acta Botanica Croatica (Marković 1993, Regula and Regula 2000). keywords: croatian; ilijanić; professor cache: abc-2545.pdf plain text: abc-2545.txt item: #175 of 390 id: abc-2558 author: Ljubesic, Zrinka title: Celebrating 70th birtday of Professor emeritus Damir Vilicic date: 2019-03-28 words: 1056 flesch: 57 summary: On this important birthday, we wish professor Viličić many happy returns, to stay positive and active, to keep the good health and vital strength that is such an inspiration to us all. Professor Viličić has started his scientific career in the In- stitute of Oceanography and Fisheries in Dubrovnik in 1975 where he has achieved his position of senior scientist in 1991. keywords: adriatic; science; viličić cache: abc-2558.pdf plain text: abc-2558.txt item: #176 of 390 id: abc-2594 author: Sidhoum, Warda; Bahi, Kheira; Fortas, Zohra title: The effect of salinity gradient and heavy metal pollution on arbuscular mycorrhizal fungal community structure in some Algerian wetlands date: 2020-03-31 words: 10295 flesch: 60 summary: The results showed that 72.72% of plant species exhibit an association within arbuscular mycorrhizas (AM), and 36.36% a dual association between AM and dark septate endophytes (DSE). Abundances of plant species in the wetlands Dayet Morsli and Telamine Lake, Algeria, and their accession numbers at the Plant Ecology Laboratory Herbarium of the University Oran 1 Ahmed Ben Bella, Oran, Algeria. keywords: amf; diversity; dse; et al; frequency; fungal; fungi; index; metal; mycorrhizal; number; plant; pollution; root; salinity; sites; soil; species; wetland cache: abc-2594.pdf plain text: abc-2594.txt item: #177 of 390 id: abc-2612 author: Tak, Aasawari A.; Kakde, Umesh B title: Evaluation of trace elements and particulate matter deposition on plant foliage exposed to vehicular pollution date: 2019-10-01 words: 3714 flesch: 60 summary: Thousands of vehicles such as cars, bikes, trucks, and tractors continuously pass through this area, which is a source of high level of heavy metals pollution. Heavy metal pollution is a significant environmental issue as these metals are like- ly to have toxic effects with increased concentration or ac- cumulation in plants. keywords: accumulation; air; dust; ficus; kg–1; metals; plants; pollution cache: abc-2612.pdf plain text: abc-2612.txt item: #178 of 390 id: abc-2632 author: Stesevic, Danijela; Kuzmic, Filip; Milanovic, Djordjije; Stanisic-Vujacic, Milica; Silc, Urban title: Coastal sand dune vegetation of Velika plaža (Montenegro) date: 2020-03-31 words: 8214 flesch: 61 summary: We made a phytosociolog- ical study of sandy beach vegetation comprising both dunal and wetland areas to provide a comprehensive survey of sand dune vegetation and habitat typology of Velika plaža. The aim of our study was to make a comprehensive sur- vey of sand dune vegetation of the largest sand beach system in Eastern Adriatic with own field work and literature data, 44 ACTA BOT. keywords: adriatic; beach; br.-bl; classification; coastal; communities; dunes; et al; habitat; montenegro; plant; plaža; relevés; sand; species; stands; vegetation; velika; šilc cache: abc-2632.pdf plain text: abc-2632.txt item: #179 of 390 id: abc-2634 author: Škoric, Dijana title: In memoriam Ana Zlata Štefanac (1935-2019) date: 2019-10-01 words: 2130 flesch: 59 summary: When Prof. Miličić started gather- ing a team of young collaborators for his pioneering work on plant viruses, she was the first to join in as early as in 1959. The paper on cell inclusions of Holmes’ ribgrass virus (Miličić et al., 1969) falls into the same category of papers drawing very much international attention as one of the early stud- ies describing pathogenic effects of plant viruses at the cel- lular level. keywords: acta; botanica; croatica; miličić; virus; štefanac cache: abc-2634.pdf plain text: abc-2634.txt item: #180 of 390 id: abc-2651 author: Di Pietro, Romeo; Di Marzio, Piera; Antonecchia, Gaby; Conte, Antonio Luca; Fortini, Paola title: Preliminary characterization of the Quercus pubescens complex in southern Italy using molecular markers date: 2020-03-31 words: 9224 flesch: 57 summary: Individuals from 24 pubescent oak populations were sampled and each tree was genotyped at 11 polymorphic microsatellite markers. In the present study plant ma- terial from the same pubescent oak populations was used to analyze their genetic diversity, structure and gene flow. keywords: alleles; et al; heterozygosity; individuals; italy; loci; number; oak; oaks; populations; pubescens; quercus; region; species cache: abc-2651.pdf plain text: abc-2651.txt item: #181 of 390 id: abc-2667 author: Stesevic, Danijela; Andic, Branko; Stanisic-Vujacic, Milica title: Physcomitrium eurystomum Sendtn., new moss species in the bryophyte flora of Montenegro date: 2020-03-31 words: 2053 flesch: 67 summary: So far the species has been reported in 22 European countries (Papp et al. 2013, ECCB 2016), while in 15 it has a defined status category: Endangered in Great Britain (Hodgetts 2011) and Hungary (Papp et al. 2010); Highly Endangered in Austria (ECCB 2016); Vulnerable in Ger- many (ECCB 2016), the Czech Republic (Kučera and Váňa 2003), Slovakia (Šoltés et al. 2002), Switzerland (BAFU 2011), and Estonia (Ingerpuu et al. 2018); Threatened in Belarus (Maslovsky 2005), Belgium (ECCB 2016), Bulgaria, Romania and Turkey (Sabovljević et al. 2001); In the Balkan peninsula, the species is reported in Serbia (Papp et al. 2013), Bulgaria, and Slovenia (Sabovljević et al. 2008), but due to the presence of similar habitat types in other parts of the peninsula, new records are expected. keywords: eurystomum; list; montenegro; red; species cache: abc-2667.pdf plain text: abc-2667.txt item: #182 of 390 id: abc-2682 author: Malenica, Nenad; Jagic, Mateja; Pavletic, Bruno; Bauer, Natasa; Voncina, Darko; Zdunic, Goran; Leljak Levanic, Dunja title: Somatic embryogenesis as a tool for virus elimination in Croatian indigenous grapevine varieties date: 2020-03-31 words: 7135 flesch: 55 summary: For example, the productive life of vineyards infected by Grapevine fanleaf virus (GFLV) is 15–20 years shorter than would otherwise be expected (Andret-Link et al. 2004) and the grapes, must and wine have lower sug- ar concentration and increased overall acidity, causing eco- nomic losses of 80% (Andret-Link et al. 2004), or even 100% (Raski et al. 1983). RT-PCR analysis of Grapevine leafroll-associated viruses (GLRaV-1, GLRaV-2 and GLRaV-3), Arabis mosaic virus (ArMV), Grapevine fleck virus (GFkV) and Grapevine fanleaf virus (GFLV) in ‘Babica’ (E) and ‘Plavac mali’ (F). keywords: cultivars; elimination; embryogenesis; embryos; et al; fig; gflv; grapevine; mali; plant; plavac; somatic; vinifera; virus; viruses; vitis cache: abc-2682.pdf plain text: abc-2682.txt item: #183 of 390 id: abc-2685 author: Senica, Mateja; Stampar, Franci; ErciÅŸli, Sezai; Sladonja, Barbara; Poljuha, Danijela; Mikulic Petkovsek, Maja title: The impact of drying on bioactive compounds of blue honeysuckle berries (Lonicera caerulea var. edulis Turcz. ex Herder) date: 2020-03-31 words: 7855 flesch: 60 summary: Half of one gram of dried honeysuckle berries was extracted with 10 ml of double-distilled water. For other treatments, one gram of dried honeysuckle berries was extracted with 10 ml of methanol containing 3% formic acid. keywords: acid; berries; blue; compounds; content; drying; et al; food; fruit; heating; honeysuckle; honeysuckle berries; temperature; time; ° c cache: abc-2685.pdf plain text: abc-2685.txt item: #184 of 390 id: abc-2691 author: Kaya, Ergun; Galatali, Selin; Souza, Fernanda Vidigal Duarte; Santos-Serejo, Janay Almeida title: Influence of dehydration on cryopreservation of Musa spp. germplasm date: 2020-10-01 words: 4626 flesch: 62 summary: seed germination: A – M. acumi- nata ssp. This capability can be lost during seed germination. keywords: acuminata; content; cryopreservation; dehydration; germination; moisture; musa; seeds; spp cache: abc-2691.pdf plain text: abc-2691.txt item: #185 of 390 id: abc-2698 author: Romdhane, Leila; Dal Ferro, Nicola; Slama, Amor; Radhouane, Leila title: Optimizing irrigation and determining the most sensitive development stage to drought in barley (Hordeum vulgare L.) in a semi-arid environment date: 2020-03-31 words: 6824 flesch: 59 summary: However, significant differ- ences in water deficit stages were observed between till- ering (37.0, on average) and both elongation and heading (17.2, on average). Under- standing the response of crop development stages to water deficit stress provides an opportunity for optimizing irrigation. keywords: barley; deficit stress; dry; heading; leaf; potential; soil; stage; stress; tillering; varieties; water; water deficit cache: abc-2698.pdf plain text: abc-2698.txt item: #186 of 390 id: abc-2702 author: Jasprica, Nenad title: The Sixth Croatian Botanical Symposium, held in Zagreb, Croatia (August 30–September 1, 2019) date: 2019-10-01 words: 406 flesch: 51 summary: Professor Nenad Jasprica Croatian Botanical Society, President Participants of the Sixth Croatian Botanical Symposium, Zagreb, Croatia (August 30–September 1, 2019). Alongside Croatian authors, scientists from other countries (Austria, Albania, Hungary, Kosovo, Serbia, Slovenia and the United Kingdom) also participated. keywords: botanical; croatian cache: abc-2702.pdf plain text: abc-2702.txt item: #187 of 390 id: abc-272 author: Manilal, Aseer; Sujith, Sugathan; Sabarathnam, Balu; Kiran, George S.; Selvin, Joseph; Shakir, Chippu; Lipton, Aaron P. title: Biological activity of red alga Laurencia brandenii date: 2011-04-07 words: 4608 flesch: 52 summary: To this day, information regarding biological activities of flora and fauna from the southwest coastline of India (Kollam coast) remains scanty. o ujak 2011 16:13:51 Color profile: Disabled Composite 150 lpi at 45 degrees ed for biological activities (data not shown). keywords: acid; activity; algal; brandenii; fraction; laurencia; marine; study cache: abc-272.pdf plain text: abc-272.txt item: #188 of 390 id: abc-2721 author: Ghosh Dasgupta, Modhumita; Parveen, Abdul Bari Muneera; Lakshmanan, Divya title: Validation of variants using cost effective high-resolution melting (HRM) analysis predicted from target re-sequencing in Eucalyptus date: 2020-09-24 words: 7227 flesch: 49 summary: The advantages of HRM analysis include reduced risk of cross contami- nation and decreased analytical time. To our knowledge, no reports on the use of HRM analysis for confirmation of vari- ants (SNPs/ InDels/ SSRs) are reported in forest tree species, including Eucalyptus. keywords: analysis; curve; dna; et al; eucalyptus; fig; genotyping; hrm; hybrids; melting; parents; resolution; sequence; sequencing; snp; true&cauthor_uid=15338605 cache: abc-2721.pdf plain text: abc-2721.txt item: #189 of 390 id: abc-2738 author: Cirak, Cuneyt; Özcan, Aysel; Yurteri, Emine; Kurt, Dursun; Seyis, Fatih title: Chemical and morphological diversity among wild populations of Hypericum aviculariifolium Jaub. et Spach subsp. depilatum (Freyn et Bornm.) N. Robson var. depilatum date: 2020-03-31 words: 7434 flesch: 52 summary: Hypericum plants are categorized generally by three types of secretory structures namely, translucent glands, black or dark nodules and secretory canals (Kimáková et al. 2018). Sirvent, T., Walker, L., Vance, N., Donna, G., 2002: Variation in hy- pericins from wild populations of Hypericum perforatum L. in the Pasific Northwest of the U.S.A. Economic Botany 56, 41–49. keywords: aviculariifolium; depilatum; et al; hyperforin; hypericin; hypericum; leaf; perforatum; plant; populations; species cache: abc-2738.pdf plain text: abc-2738.txt item: #190 of 390 id: abc-2745 author: Rabhi, Sadjia; Djebbar, Réda; Belkebir, Aicha title: An ecophysiological study of some coastal dune species of Zemmouri El Bahri (Algeria) date: 2021-03-31 words: 5725 flesch: 60 summary: Leaf traits and plastic potential of plant species in a light-edaphic gradient from restinga in southern Brazil. Based on the high- est levels of total phenols, flavonoids and anthocyanins as well as high contents of photosynthetic pigments, M. tricus- pidata can be classified as “homoiochlorophyllous” plant. keywords: area; content; creticus; g–1; leaf; maritima; plant; species; total; tricuspidata; water cache: abc-2745.pdf plain text: abc-2745.txt item: #191 of 390 id: abc-2755 author: Choi, Jong-il; Park, Seo-jeong title: De novo transcriptome analysis of high growth rate Pyropia yezoensis (Bangiales, Rhodophyta) mutant with high utilization of nitrogen date: 2020-09-24 words: 1197 flesch: 40 summary: List of upregulated genes in mutant Pyropia yezoensis (Py2K) annotated as ‘antioxidant’. Summary statistics of raw and clean reads in Pyropia yezoensis wild type (PyWT) and mutant (Py2K). keywords: line; mutant; py2k; pyropia; suppl; yezoensis cache: abc-2755.pdf plain text: abc-2755.txt item: #192 of 390 id: abc-2761 author: Zammit, Gabrielle; Schembri, Sarah; Fenech, Mark title: Phototrophic biofilms and microbial mats from the marine littoral of the central Mediterranean date: 2021-03-31 words: 3240 flesch: 49 summary: 80 (1), 112–116, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2020-031 ISSN 0365-0588 eISSN 1847-8476 Short communication Phototrophic biofilms and microbial mats from the marine littoral of the central Mediterranean Gabrielle Zammit1,2*, Sarah Schembri1,2, Mark Fenech1,2 1 Laboratory of Applied Phycology, Centre for Molecular Medicine and Biobanking, University of Malta, Msida, Malta 2 Microbiology Lab, Department of Biology, Faculty of Science, University of Malta Abstract – Phototrophic biofilm and microbial mat communities grow along the rocky coastline of the Maltese is- lands. In submerged areas, such as undisturbed rock pools, these progressively formed green or brown compact biofilms, some of which thickened over the spring to form microbial mats via the production of more extensive EPS layers. keywords: biofilms; communities; fig; filaments; mats; microbial; microorganisms; phototrophic cache: abc-2761.pdf plain text: abc-2761.txt item: #193 of 390 id: abc-2764 author: Kolda, Anamarija; Ljubešić, Zrinka; Gavrilović, Ana; Jug-Dujaković, Jurica; Pikelj, Kristina; Kapetanović, Damir title: Metabarcoding Cyanobacteria in coastal waters and sediment in central and southern Adriatic Sea date: 2020-09-24 words: 193 flesch: 70 summary: Cladogram displaying grouping of 100 cyanobacterial ASVs, with addition of multi value bar chart of sample frequencies in different ASVs (CA – central Adriatic, SA – southern Adriatic, Aquaculture – site type under the influence of fish farms, Control – control site type; à - sea water sample type, O – sediment sample type). Leaf labels are automatically assigned by SILVA database (black letters), or NCBI GenBank database BLAST search hit results (blue letters). keywords: croat cache: abc-2764.pdf plain text: abc-2764.txt item: #194 of 390 id: abc-2781 author: Güleryüz , Gürcan ; Kırmızı , Serap; Arslan, Hülya ; Güleryüz, Elif title: Breaking of dormancy in the narrow endemic Jasione supina Sieber subsp. supina (Campanulaceae) with small seeds that do not need light to germinate date: 2021-03-31 words: 4445 flesch: 65 summary: Many researches have recently been focused on the effect of global climate change on alpine plant species as their phenology, seed germination, seedling establishment, and distribution areas are negatively affected (for details see Briceño et al. 2015, Giménez-Benavides et al. 2018). Light requirement for seed germination especially small size seeds is an important parameter for evaluating the ger- mination properties of plants (Fenner and Thompson 2005). keywords: chilling; dark; germination; light; moist; seeds; species; supina cache: abc-2781.pdf plain text: abc-2781.txt item: #195 of 390 id: abc-2789 author: Hassan, Mahmoud Omar; Mohamed, Howida Yacoup; Aboellil, Ayman Hassan title: Allelopathic potential of Ficus retusa L. leaf litter on understory vegetation in urban gardens date: 2021-10-01 words: 7009 flesch: 58 summary: Croat. 80 (2), 131–139, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2021-013 ISSN 0365-0588 eISSN 1847-8476 Allelopathic potential of Ficus retusa L. leaf litter on understory vegetation in urban gardens Mahmoud Omar Hassan, Howida Yacoup Mohamed*, Ayman Hassan Aboellil Beni-Suef University, Faculty of Science, Department of Botany and Microbiology, 62511 Beni-Suef, Egypt Abstract – Pruning Ficus trees in urban green spaces may lead to the accumulation and spread of their leaf litter on the understory vegetation. This study was conducted to evaluate the allelopathic effect of Ficus retusa L. leaf litter on the understory species in urban gardens. keywords: allelopathic; compounds; cover; ficus; germination; growth; hassan; leaf; litter; plant; potential; retusa; soil; species cache: abc-2789.pdf plain text: abc-2789.txt item: #196 of 390 id: abc-279 author: Oke, Samson Olajide; Eyitayo, Damilola Lanre; title: Growth and yield response of cowpea (Vigna unguiculata L. Walp.) to soils from different fallow physiognomies in the rainforest zone of Nigeria date: 2010-10-22 words: 3068 flesch: 59 summary: The results were used to deduce the best type of fallow soil for cowpea cultivation. Key words: Growth, yield, fallow soil, Vigna unguiculata, physiognomy, rainforest, Nigeria Introduction Cowpea (Vigna unguiculata L. Walp.) is a legume grown under rain-fed conditions in the tropics (SANGAKKARA 1998). keywords: cowpea; fallow; growth; panicum; seedlings; soil; unguiculata; vigna cache: abc-279.pdf plain text: abc-279.txt item: #197 of 390 id: abc-2805 author: Jasprica, Nenad title: Thirty-ninth EADSVE Meeting will be held in Dubrovnik, Croatia, in 2021 date: 2020-03-31 words: 476 flesch: 52 summary: The society organises meetings every second year. 79 (1), 2020 S1 Social news Thirty-ninth EADSVE Meeting will be held in Dubrovnik, Croatia, in 2021. keywords: dubrovnik; meeting cache: abc-2805.pdf plain text: abc-2805.txt item: #198 of 390 id: abc-2806 author: Sheikhzadeh, Parisa; Zare, Nasser; Mahmoudi, Fatemeh title: The synergistic effects of hydro and hormone priming on seed germination, antioxidant activity and cadmium tolerance in borage date: 2021-03-31 words: 6936 flesch: 51 summary: Among the seed priming treatments, combined hydro and hormone seed priming improved borage seed germination and seedling growth under stressful environments. Seed priming led to a significant increase in the germination percentage and rate, seedling dry weight and length, seedling vigor indices, as well as the catalase and peroxidase activity of borage seedlings under both cadmium stress and non-stress conditions. keywords: borage; cadmium; cadmium stress; germination; hormone; hormone priming; hydro; l–1; priming; seed; seed priming; stress cache: abc-2806.pdf plain text: abc-2806.txt item: #199 of 390 id: abc-2807 author: Jasprica, Nenad title: Preface from the New Editor-in-Chief date: 2020-03-31 words: 296 flesch: 60 summary: 79 (1), 2020 1 Preface from the New Editor-in-Chief In 2019, I accepted the role of editor-in-chief for Acta Botanica Croatica after my 10-year term within the Editorial Board as the subject editor in phycology and vegetation ecology. High quality standards and modern scientific content should be a permanent editorial goal in order for the success of Acta Botanica Croatica to be maintained. keywords: acta cache: abc-2807.pdf plain text: abc-2807.txt item: #200 of 390 id: abc-2810 author: Figueiredo, Francisco Romário Andrade; Nóbrega, Jackson Silva; Fátima, Reynaldo Teodoro de; Silva, Toshik Iarley da; Nascimento, Rodrigo Garcia da Silva; Lopes, Maria de Fátima de Queiroz; Dias, Thiago Jardelino; Bruno, Riselane de Lucena Alcântara title: Plant development, gas exchanges and pigments of Mesosphaerum suaveolens submitted to osmoconditioning and saline stress date: 2021-03-31 words: 3561 flesch: 56 summary: Thus, the aim of the present work was to evaluate the ef- fect of salinity stress and osmotic conditioning of seeds on the biomass accumulation, gas exchanges and chlorophyll pigments in M. suaveolens plants. Irrigation water of electrical conduc- tivity above 3.2 dS m–1 caused reductions in chlorophyll a, b and total contents in M. suaveolens plants. keywords: chlorophyll; irrigation; plants; saline; salinity; stress; suaveolens; water cache: abc-2810.pdf plain text: abc-2810.txt item: #201 of 390 id: abc-282 author: Binzet, Rıza; Kandemir, Irfan; Orcan, Nermin title: Palynological classification of Onosma L. (Boraginaceae) species from east Mediterranean region in Turkey date: 2010-10-22 words: 6022 flesch: 73 summary: 10–13 O. lycaonica M 20.31 16.8 2.26 9.01 15.75 3.12 1.07 0.25 8.76 SD 1.09 0.65 0.32 0.77 0.8 0.31 0.13 0.54 Min–Max 17–22 15–18 1.6 –3 7.5–10.5 15–16 2.5–4 0.9–1.2 7–10 O. mersinana M 16.1 13.14 1.02 7.01 14.23 3.06 0.77 0.5 7.07 SD 0.78 0.72 0.2 0.79 0.87 0.3 0.08 0.5 Min–Max 14–17 Tab. 2. – continued Species A P E plg plt clg clt ex i ect/end t O. riedliana M 16.32 12.72 2.79 3.59 12.61 3.26 0.41 0.65 0.66 7.75 SD 0.55 0.39 0.44 0.43 0.73 0.26 0.05 0.07 0.33 Min–Max 15–17 12–13.5 2–3.5 2.5–4.5 11.5–13.5 2.5–3.5 0.3–0.5 0.5–0.8 7–8 O. roussaei M 14.84 10.5 2.79 2.82 10.71 2.45 1 0.51 2 5.96 SD 0.51 0.44 0.27 0.27 0.33 0.2 0.16 0.07 0.24 Min–Max 13–16 9–11.5 2–3 2–3 10–11 2–3 0.8–1.2 0.4–0.6 5.5–6 O. rutila M 14.88 10.68 2.66 2.78 12.98 2.3 0.43 0.67 0.33 5.68 SD 0.58 0.45 0.18 0.27 0.43 0.28 0.07 0.08 0.27 keywords: b o; max; min; o l; o t cache: abc-282.pdf plain text: abc-282.txt item: #202 of 390 id: abc-2829 author: Mohamed, Zakaria; Ali, Fadel; Abdel-Lateef, Medahat; Hosny, Asmaa title: Growth inhibition of the toxic cyanobacterium Cylindrospermopsis raciborskii by extremely low-frequency electromagnetic fields date: 2020-09-24 words: 6911 flesch: 52 summary: Furthermore, increased activities of CAT and POD en- zymes in C. raciborskii cells exposed to the electromagnetic field during the first 24 hours incubation period in com- parison to control, provide evidence that ELF-EMF induces oxidative stress and promotes the formation of ROS. The results revealed that the highest growth inhibition of Cylindrospermopsis occurred upon exposure to 0.7 Hz QAMW for 30 min. ELF-EMF-exposed cultures exhibited a marked decrease in cell number, chlorophyll-a content and activity of antioxidant enzymes compared to control cultures, and this effect increased with the prolongation of exposure time. keywords: cell; control; cultures; cyanobacteria; electromagnetic; elf; et al; exposure; frequency; growth; incubation; raciborskii; water cache: abc-2829.pdf plain text: abc-2829.txt item: #203 of 390 id: abc-2831 author: Ebadi, Mostafa; Eftekharian, Rosa title: Morphological and genetic diversity of Senecio vulgaris L. (Asteraceae) in Iran date: 2021-10-01 words: 3888 flesch: 50 summary: However, the ef- fects of some factors in plant population genetic diversity remain unclear and more investigations have to be done. Morphometric and ISSR based variabil- ity analysis to elucidate population genetic structure in Sene- cio glaucus L. (Asteraceae: Senecioneae). keywords: analysis; characters; diversity; length; plant; populations; senecio; vulgaris cache: abc-2831.pdf plain text: abc-2831.txt item: #204 of 390 id: abc-2836 author: Kremer, Dario; Košir, Iztok Jože; Potočnik, Tanja; Rogulj, Nikolina; Načinovic, Karla; Randić, Marko; Srečec, Siniša; Jurišić Grubešić, Renata title: Phenolic compounds in two subspecies of Drypis spinosa L. (Caryophyllaceae) in Croatia date: 2021-03-31 words: 3838 flesch: 64 summary: spinosa and D. spinosa subsp. The aim of this study is to gain an insight into the con- tent of phenolic compounds in D. spinosa subsp. keywords: acid; compounds; content; d. spinosa; jacquiniana; leaves; spinosa; spinosa subsp cache: abc-2836.pdf plain text: abc-2836.txt item: #205 of 390 id: abc-2846 author: Tunca, Hatice; Hödük , Kübra ; Köçkar , Feray; Doğru , Ali; Ongun Sevindik, Tuğba title: Effects of two synthetic pyrethroids on Arthrospira platensis Gomont growth and antioxidant parameters date: 2021-10-01 words: 5910 flesch: 58 summary: Sáenz et al. (2012) found that Cyp concentrations causing algicidal effects, and there- by inhibitory effects of GR enzyme activity due to oxidative stress damage on P. subcapitata. Teisseire and Vernet (2001) supported the conclusion that GR enzyme activity was related to the APX enzyme ac- tivity. keywords: activity; concentrations; content; cyp; cypermethrin; dlm; enzyme; et al; growth; ml–1; platensis; proline cache: abc-2846.pdf plain text: abc-2846.txt item: #206 of 390 id: abc-2854 author: Jovanović, Slobodan; Glišić, Milan title: An analysis of research into urban flora and vegetation in Southeast Europe date: 2021-03-31 words: 5927 flesch: 54 summary: A search of these databases was conducted using the following keywords: urban flora, urban vegetation, urban plants, urban plant species, urban plant communities, urban forests, ruderal flora, ruderal vegetation, wall flora and wall vegetation, in combination with names of the coun- tries (Albania, Bosnia and Herzegovina, Bulgaria, Croatia, Greece, Montenegro, North Macedonia, Romania, Slovenia, Serbia and Kosovo) and cities (at least 15 cities with the larg- est population of each country) of Southeast Europe. In addition to studies employ- ing the floristic and phytosociological approaches, studies based on the application of remote sensing technology in research on urban vegetation from the aspect of landscape ecology were also taken into consideration. keywords: articles; cities; et al; europe; flora; research; southeast; species; studies; urban; vegetation cache: abc-2854.pdf plain text: abc-2854.txt item: #207 of 390 id: abc-2864 author: Rat, Milica; Bogdanović, Sandro title: Ornithogalum sibthorpii Greuter (Asparagaceae), a species overlooked in Croatia date: 2021-03-31 words: 4597 flesch: 63 summary: Cytological review by Cullen and Ratter (1967), with doubtful discussion on plant material, reported three main cytotypes for O. sibthorpii ‒ O. sigmoideum group, in the region from Caucasus to Italy, with numerous aloploid se- ries reported from different sources (2n = 12, 16, 17, 18, 19, 20, 28). Comparative morpho-anatomical and cytotaxonomical studies of Ornithogalum species that belong to the group of small plants (overall length up to 10 cm) with hypogeal scape, including O. sibthorpii, have been done to clearly de- scribe morphologically similar species in the area of Turkey and the Balkan Peninsula (Zahariadi 1962, 1965, 1977, Spe- ta 1990, 2000). keywords: chromosome; croatia; distribution; fig; flora; herbarium; ornithogalum; rat; sibthorpii; smith; species cache: abc-2864.pdf plain text: abc-2864.txt item: #208 of 390 id: abc-287 author: Krivokapic, Sladjana; Stankovic, Zivko; Vuksanovic, Nenad title: Seasonal variations of phytoplankton biomass and environmental conditions in the inner Boka Kotorska Bay (eastern Adriatic Sea) date: 2009-10-13 words: 4065 flesch: 67 summary: In summer, the inner part of Boka Kotorska Bay is characterized by low concentrations of nutrients, high light transparency and absence of phytoplankton blooms, which suggests summer oligotrophication, as in other eastern Adriatic nutrient enriched environments (SVENSEN et al. 2007, VILI^I] et al, 2008). 4. Temporal (a) and spatial (b) distribution of mean oxygen concentration value in the inner part of Boka Kotorska Bay. keywords: bay; fig; mmol; phytoplankton cache: abc-287.pdf plain text: abc-287.txt item: #209 of 390 id: abc-288 author: Pereira, Tamara; Coelho, Cileide M. M.; Bogo, Amauri; Guidolin, Altamir F.; Miquelluti, David J. title: Diversity in common bean landraces from south Brazil date: 2009-10-13 words: 6229 flesch: 66 summary: Results have been published for common bean seed development with evidence that phytate synthesis has regulation points with MIPS (myo-inositol-3-phosphate synthase) enzyme. We thank Dr Heloisa Torres da Silva (EMBRAPA-CNPAF, Brazil) that provided bean seed samples used as con- trols of phaseolin type. keywords: bean; genotypes; landraces; phaseolin; protein; seed; type cache: abc-288.pdf plain text: abc-288.txt item: #210 of 390 id: abc-2883 author: Biba, Renata; Tkalec, Mirta; Cvjetko, Petra; Peharec Štefanić, Petra; Šikić, Sandra; Pavoković, Dubravko; Balen, Biljana title: Silver nanoparticles affect germination and photosynthesis in tobacco seedlings date: 2021-11-29 words: 9489 flesch: 54 summary: Moreover, seedlings ex- posed to higher AgNP concentrations (100 and 150 µM) had reduced carotenoid/chlorophyll ratio compared to seedlings treated with corresponding concentrations of AgNO3. Compared to control, chlorophyll a/b ratio was decreased after treatments with lower AgNP concentrations (25, 50 and 75 µM) as well as with the 50 µM AgNO3 (Tab. 2). keywords: agno3; agnps; concentrations; control; effects; et al; exposure; germination; growth; medium; nanoparticles; plant; seedlings; silver; tobacco; treatments cache: abc-2883.pdf plain text: abc-2883.txt item: #211 of 390 id: abc-289 author: Devide, Zvonimir title: James G. Ogg, Gabi Ogg, Felix M. Gradstein "The Concise Geologic Time Scale" date: 2009-10-13 words: 2384 flesch: 60 summary: Fig. 1 – geologic time scale (p. ii). travanj 2009 13:12:17 Color profile: Disabled Composite 150 lpi at 45 degrees The text of the book is perfect in any regard, being accompanied by many illustrations of the highest quality: drawings, photographs, in the chapters 4 to 15 predominantly photo- graphs and profiles of GSSP-localities as well as time scales containing also regional sub- divisions, and in the last columns, details about Biostratigraphy, Magnetic stratigraphy, Cycle- and Stable- isotope stratigraphy, Eustatic stratigraphy (Sea level changes) etc. keywords: book; earth; fig; period; scale; time cache: abc-289.pdf plain text: abc-289.txt item: #212 of 390 id: abc-290 author: Jasprica, Nenad title: Preface date: 2009-10-21 words: 1488 flesch: 48 summary: Nenad Jasprica Chair, 20th International Diatom Symposium The Guest Editor of Acta Botanica Croatica 68(2) 2009 Dubrovnik, October 2009 182 ACTA BOT. The 20th International Diatom Symposium thus would be convened in Dubrovnik in September 2008. keywords: acta; diatom; dubrovnik; marine; symposium; university cache: abc-290.pdf plain text: abc-290.txt item: #213 of 390 id: abc-2902 author: Baranašić, Jurica; Mihalak, Anita; Gruić-Sovulj, Ita; Bauer, Nataša; Rokov-Plavec, Jasmina title: Expression of genes for selected plant aminoacyl-tRNA synthetases in the abiotic stress date: 2021-03-31 words: 6551 flesch: 57 summary: Furthermore, plant aaRSs may participate directly in plant stress responses through their noncanonical activities. Participation of aaRSs in plant stress responses is poorly characterized. keywords: asprs; cysrs; et al; expression; gene; levels; plant; protein; serrs; stress; synthetase; transcription; translation; trna cache: abc-2902.pdf plain text: abc-2902.txt item: #214 of 390 id: abc-2913 author: Eroğlu , Hüseyin ; Cengiz Karaismailoğlu, Mehmet; Pinar , Süleyman Mesut; Fidan , Mehmet title: Seed micromorphology and anatomy of 36 Muscari (Asparagaceae) taxa from Turkey with notes on their systematic importance date: 2021-10-01 words: 10148 flesch: 77 summary: Testa characters such as the structures of the epidermis and subepidermis, thickness of the testa, and the presence or absence of crystals are fairly effective and beneficial in discri- minating almost all of the studied taxa, especially in the pairs of closely correlated taxa M. macrocarpum-M. racemosum, M. caucasicum-M. weissii, M. coeleste-M. azureum, and M.  aucheri-M. armeniacum. In the subgenus Pseudomuscari, M. coeleste and M. azureum taxa are very similar in terms of population appearance, flowers and fruit capsule characteristics; however, they are distinct- ly different in terms of seed ornamentation types: ruminate and scalariform, respectively. keywords: muscari; seed; taxa; unclear cache: abc-2913.pdf plain text: abc-2913.txt item: #215 of 390 id: abc-2929 author: Salopek Sondi, Branka title: The Spiridion Brusina Medal for 2019 has been awarded to German plant biologist Professor Jutta Ludwig-Müller date: 2020-03-31 words: 1767 flesch: 56 summary: Campanella, J. J., Olajide, A. F., Magnus, V., Ludwig-Müller, J., 2004: A novel auxin conjugate hy- drolase from wheat with substrate specificity for longer side-chain auxin amide conjugates. B Joint scientific publications by Professor Jutte Ludwig- Müller and Croatian scientists: 1. keywords: auxin; croatian; ludwig; müller; plant; professor cache: abc-2929.pdf plain text: abc-2929.txt item: #216 of 390 id: abc-293 author: Oziegbe, Matthew; Faluyi, Julius Olaoye; Oluwaranti, Abimbola title: Effect of seed age and soil texture on germination of some Ludwigia species (Onagraceae) in Nigeria. date: 2010-10-22 words: 4355 flesch: 61 summary: Seed germination in Ludwigia was greatly influenced by seed age and soil type. It has been reported that the capacity of seed germination in Ludwigia species is not known (RUAUX et al. 2009). keywords: germination; ludwigia; media; month; percentage; seeds; soil; species; var cache: abc-293.pdf plain text: abc-293.txt item: #217 of 390 id: abc-2941 author: Süveges , Kristóf ; Molnár V, Attila; Mesterházy , Attila; Tüdősné Budai , Júlia ; Fekete, Réka title: Emergence of a new salt-tolerant alien grass along roadsides? Occurrence of Diplachne fusca subsp. fascicularis (Poaceae) in Hungary date: 2021-10-01 words: 4055 flesch: 62 summary: These factors act in synergy, favour- ing the spread of alien plant species, since native species are usually less able to adapt to the altered, anthropogenic con- ditions at roadsides (Greenberg et al. 1997). In the case of plant species producing lightweight seeds, dispersal may be facilitated by the air turbulence caused by cars (von der Lippe et al. 2013), but seeds may also travel long distances in mud attached to cars (Clifford 1959, Ross 1986, Schmidt 1989, Zwaenepoel et al. 2006, Ansong and Pickering 2013). keywords: diplachne; fascicularis; fusca; germination; hungary; plant; road; salt; species; subsp cache: abc-2941.pdf plain text: abc-2941.txt item: #218 of 390 id: abc-2956 author: Dedić, Anita ; Hafner , Dubravka; Antunović , Ana; Kamberović , Jasmina ; Stanić-Koštroman, Svjetlana ; Kelly, Martyn G. title: Biodiversity and seasonal distribution of benthic diatom assemblages as an indicator of water quality of small karstic river in Bosnia and Herzegovina date: 2021-10-01 words: 8268 flesch: 56 summary: The concentrations of physical and chemical parameters should mean that the Bunica River can support high ecological status (Tab. 5), so the reason for this mismatch needs to be explored. Physical and chemical analyses showed low concentrations of nutrients, good oxygenation, typical pH for carbonate bed/origin and generally oligotrophic conditions and high ecological status. keywords: bunica; diatom; diversity; ehrenberg; gomphonema; grunow; index; indices; kützing; lange; river; samples; spring; status; taxa; values; water cache: abc-2956.pdf plain text: abc-2956.txt item: #219 of 390 id: abc-298 author: Partl, Anamarija title: Lichen flora of Zumberak-Samoborsko gorje Nature Park, NW Croatia date: 2011-04-11 words: 3368 flesch: 70 summary: E Aspicilia calcarea (L.) E, G Cladonia fimbriata (L.) keywords: ach; acta; area; croatia; hoffm; lichens; nyl; species cache: abc-298.pdf plain text: abc-298.txt item: #220 of 390 id: abc-300 author: Lukavsky, Jaromir; Cepák, Vladislav title: Cryoseston in Stara Planina (Balkan) Mountains, Bulgaria date: 2010-10-22 words: 3620 flesch: 68 summary: Cryoseston of snow fields in the Stara Planina Mountains, collected in May 2009. The only living diatom species was Hantzschia amphioxys (Figs. 30–32) from snow fields 2 and 3. ACTA BOT. keywords: chloromonas; cryoseston; lukavský; mts; nivalis; planina; snow; species; stara cache: abc-300.pdf plain text: abc-300.txt item: #221 of 390 id: abc-3008 author: Stesevic, Danijela; Milanović , Đorđije ; Stanišić-Vujačić, Milica ; Šilc, Urban title: Aristida oligantha – a new alien species on the eastern Adriatic coast date: 2021-10-01 words: 1879 flesch: 71 summary: Keywords: Aristida oligantha community, invasive species, northeastern Mediterranean, sandy beach, south Montenegro Introduction Genus Aristida L. is one of the exotic grasses in the European flora. Croat. 80 (2), 217–220, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2021-019 ISSN 0365-0588 eISSN 1847-8476 Short communication Aristida oligantha – a new alien species on the eastern Adriatic coast Danijela Stešević1*, Đorđije Milanović2, Milica Stanišić-Vujačić1, Urban Šilc3 1 University of Montenegro, Faculty of Natural Sciences and Mathematics, Džordža Vašingtona bb, 81000 Podgorica, Montenegro 2 University of Banja Luka, Faculty of Forestry, S. Stepanovića 75a, 78000 keywords: aristida; montenegro; oligantha; rel; species; vegetation cache: abc-3008.pdf plain text: abc-3008.txt item: #222 of 390 id: abc-301 author: Rizzi Longo, Loredana; Pizzulin Sauli, Marialuisa title: Flowering phenology and airborne pollen occurrence of Corylus and Castanea in Trieste (Italy), 1991-2004 date: 2010-10-22 words: 6766 flesch: 69 summary: Biometeorological characterization of the winter in north-west Spain based on Alnus pollen flowering. Castanea flowering and pollen seasons in Trieste (1991–2004). keywords: castanea; corylus; flowering; longo; mean; pollen; rizzi; season; trieste cache: abc-301.pdf plain text: abc-301.txt item: #223 of 390 id: abc-3013 author: Alegro, Antun title: Zlatko Pavletić (1920-1981) - on the 100th anniversary of his birthday date: 2020-09-24 words: 1418 flesch: 66 summary: Professor Zlatko Pavletić with his colleagues and associates before the fieldtrip (second half of 1970-ies). Prof. dr. Zlatko Pavletić (1920– 1981). keywords: pavletić; professor; research; sabovljević; science; zagreb cache: abc-3013.pdf plain text: abc-3013.txt item: #224 of 390 id: abc-304 author: Križnik, Bojana; Pavoković, Dubravko title: Enhancement of betanin yield in transformed cells of sugar beet (Beta vulgaris L.) date: 2010-10-22 words: 4176 flesch: 57 summary: Sugar beet cells, transformed by a wild strain B6S3 of Agrobacterium tume- faciens, strongly produce betanin and could be a stable production source. We transformed sugar beet cells by infecting leaf fragments with wild strain B6S3 of Agrobacterium tumefaciens. keywords: beet; betanin; cell; et al; medium; production; suc; yield cache: abc-304.pdf plain text: abc-304.txt item: #225 of 390 id: abc-310 author: Uzarevic, Zvonimir; Stolfa, Ivna; Paradikovic, Nada; Cesar, Vera; Lepedus, Hrvoje title: Physiology and biochemistry of leaf bleaching in prematurely aging maple (Acer saccharinum L.) trees: I. Hydrogen peroxide level, antioxidative responses and photosynthetic pigments date: 2011-10-05 words: 5372 flesch: 59 summary: [TOLFA I., PARA\IKOVI] N., CESAR V., LEPEDU[ H. U:\ACTA BOTANICA\Acta-Botan 2-11\Uzarevic et al.vp 8. rujan 2011 15:46:42 Color profile: Disabled Composite 150 lpi at 45 degrees Results Hydrogen peroxide level in green leaves was 39.94 ± 2.96 nmol g–1 DM, while in bleached leaves it was 45.99 ± 6.42 nmol g–1 DM (Fig. 2). So, the amount of AA in bleached leaves was 65.69% of the value in green leaves. keywords: chlorophyll; green; h2o2; hydrogen; leaves; level; peroxide; plant cache: abc-310.pdf plain text: abc-310.txt item: #226 of 390 id: abc-311 author: Lepedus, Hrvoje; Begovic, Lidija; Mlinaric, Selma; Simic, Domagoj; Uzarevic, Zvonimir; Stolfa, Ivna; Paradikovic, Nada; Jurkovic, Vlatka; Cesar, Vera title: Physiology and biochemistry of leaf bleaching in prematurely aging maple (Acer saccharinum L.) trees. II. Functional and molecular adjustment of PSII. date: 2011-10-05 words: 6276 flesch: 62 summary: Also, bleached leaves had lower levels of chlorophyll a, chlorophyll b, total carotenoids and Fv/Fm value (maximum quantum yield of photosystem II) than green leaves. Results Total chlorophyll (Chl a+b) concentration, protochlorophyllide (PChl) concentration and total chlorophyll to protochlorophyllide ratio in green leaves were significantly higher (72 %) than in bleached leaves (Tab. 2). keywords: acer; chlorophyll; fluorescence; green; leaves; maple; psii; reaction; saccharinum; tab cache: abc-311.pdf plain text: abc-311.txt item: #227 of 390 id: abc-3129 author: Bartolo, Angela G.; Zammit, Gabrielle; Russell, Hannah; Peters, Akira F.; Küpper , Frithjof C. title: DNA barcoding of marine algae from Malta: new records from the central Mediterranean date: 2021-10-01 words: 6120 flesch: 58 summary: For the Phaeophyceae, our results confirm that the RuBisCO spacer is more variable than rbcL (Tab. 5) and that this spacer, in combination with other biomarkers, such as cox2-3, could be used to study intraspecific groups in bio- geographic studies (Cho et al. 2007). Primer pairs Initial Amplification (temperature in °C) Final extension Reference Cycles Denaturation Annealing Elongation 1 and 2 4 min at 94 38 1 min at 94 30 s at 50 1 min at 72 7 min at 72 Lane et al. 2007 1 and 3 1 min at 94 35 1 min at 94 1.5 min at 50 1 min at 72 5 min at 72 Peña et al. 2015 4 and 5 3 min at 95 30 30 s at 95 30 s at 55 2 min at 72 7 min at 72 Muñoz 2016 6 and 7 3 min at 95 30 30 s at 95 30 s at 55 1 min at 72 7 min at 72 Muñoz 2016 Tab. 4. keywords: algae; coi; dna; et al; identity; malta; marine; peters; phaeophyceae; rbcl; sequences; sinuosa; spacer; species; tab cache: abc-3129.pdf plain text: abc-3129.txt item: #228 of 390 id: abc-313 author: Turkis, Sevda; Özbucak, Tugba Bayrak title: Foliar resorption and chlorophyll content in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient in Turkey date: 2010-10-22 words: 6428 flesch: 61 summary: However, P resorption efficiency was higher at 670 m. C. creticus in- dividuals effectively used nitrogen at low elevations, whilst phosphorus was effectively used at high elevations. Croat. 69 (2), 275–290, 2010 CODEN: ABCRA 25 ISSN 0365–0588 Foliar resorption and chlorophyll content in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient in Turkey SEVDA TURKIS, TUGBA OZBUCAK* Department of Biology, Faculty of Arts and Sciences, Ordu University, 52750 Ordu, Turkey Foliar nitrogen and phosphorus dynamics, leaf resorption efficiency, proficiency, chang- ing of chlorophyll a/b proportions in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient (sea level-30 m, middle-670 m, high-880 m) were investigated. keywords: chl; chlorophyll; concentrations; content; creticus; gradient; leaf; leaves; nutrient; resorption; species cache: abc-313.pdf plain text: abc-313.txt item: #229 of 390 id: abc-3139 author: Shahzad, Asim; Qin, Mingzhou; Nazir, Mudassar; Shakoor, Abdul; Billah, Mohtism; Zaib, Gul title: Response of Bacillus cereus on Zea mays under different doses of zinc sulphate date: 2021-10-01 words: 6627 flesch: 61 summary: Preparation of heavy metal solution Three different concentrations of Zn solution (20, 40 and 60 mg kg–1) for maize plant treatments were prepared in pure distilled water by dissolving zinc sulfate (ZnSO4). The present study was aimed to evaluate the response of Bacillus cereus on maize plants at different concentrations of ZnSO4 (20, 40 and 60 mg kg–1) amended in the soil under pot experiment conditions. keywords: cereus; control; kg–1; plant; seeds; soil; treatments; zinc; znso4 cache: abc-3139.pdf plain text: abc-3139.txt item: #230 of 390 id: abc-315 author: Vukovic, Nina; Brana, Slavko; Mitic, Bozena title: Orchid diversity of the cape of Kamenjak (Istria, Croatia) date: 2011-04-11 words: 5383 flesch: 68 summary: In order to expand the knowledge about plant distribution and improve the conserva- tion of this Important landscape, we highly recommend mapping in high resolution for other plant species of Rt Kamenjak, especially for rare, endemic and endangered plants. Relative frequency of orchid species and subspecies on Rt Kamenjak is shown on figure 21, and also in table 2, which shows that they can be grouped, almost equally, into two groups based on their abundance (1) abundant/frequent and (2) rare/extremely rare species. keywords: croatia; fig; kamenjak; ophrys; orchis; perko; serapias; species; ssp; taxa; taxon cache: abc-315.pdf plain text: abc-315.txt item: #231 of 390 id: abc-318 author: Å ilc, Urban title: Synanthropic vegetation: pattern of various disturbances on life history traits date: 2010-10-22 words: 5030 flesch: 55 summary: On the other hand, perennials and phanerophytes are more com- mon in semi-natural vegetation and have a C-strategy. This is particularly evident for semi-natural vegetation and vegetation of villages. keywords: analysis; composition; croat; differences; disturbance; habitats; land; life; plant; ruderal; species; traits; type; variables; vegetation cache: abc-318.pdf plain text: abc-318.txt item: #232 of 390 id: abc-3184 author: Gligora Udovič, Marija; Ljubešić, Zrinka title: The Croatian National Diatom Collection date: 2021-03-31 words: 1121 flesch: 55 summary: Croatian National Diatom Collection logo by Nikola Koletić. Equal interest in the study of diatoms in Croatia has been shown by scientists today, who have recently described a significant number of new species (Gligora et al. 2009, Mejdandžić et al. 2017, 2018, Gligora Udovič et al. 2018, Ca- put Mihalić et al. 2019, Majewska et al. 2019, 2020, Al- Handal et al. 2020, Mucko et al. 2020, Van de Vijver et al. 2020). keywords: collection; croatia; diatom; new cache: abc-3184.pdf plain text: abc-3184.txt item: #233 of 390 id: abc-3187 author: Kunev, Georgi Iliev title: Bromus diandrus (Poaceae), an addition to the Bulgarian flora date: 2021-10-01 words: 1552 flesch: 60 summary: Three taxa from the sec- tion, B. sterilis L., B. madritensis L. and B. tectorum L. have previously been confirmed from Bulgaria (Georgiev 1963, Assyov and Petrova 2012). Bromus L. keywords: bromus; bulgarian; diandrus; flora; species cache: abc-3187.pdf plain text: abc-3187.txt item: #234 of 390 id: abc-319 author: Bosabalidis, Artemios M. title: Wall protuberance formation and function in secreting salt glands of Tamarix aphylla L. date: 2010-10-22 words: 2882 flesch: 59 summary: In the middle pair of secretory cells, wall protuberances are not re- stricted to the periphery of the cells but often extend deep into the innermost cytoplasmic region (Fig. 2 A). At the region of the pro- tuberance (pr), many vesicles (vs) and converging microtubules (mt) appear; C – Active dictyosomes (ds) during the stage of protuberance formation; D – Endoplasmic reticulum ele- ments (er) and mitochondria (m) in the vicinity or in contact with wall protuberances; E – Numerous microvacuoles (mv) accumulated along the apical wall protuberances in the up- per pair of secretory cells. keywords: cells; fig; glands; protuberances; salt; secretory; wall cache: abc-319.pdf plain text: abc-319.txt item: #235 of 390 id: abc-3195 author: Alegro, Antun title: In memoriam Zorana Sedlar (1980-2020) date: 2021-03-31 words: 604 flesch: 59 summary: She was involved in projects related to research into vegetation ecology and the biogeography of flora and vegetation of Croatia. 1 Zorana in field research near Barać caves in spring 2020. keywords: research; vegetation cache: abc-3195.pdf plain text: abc-3195.txt item: #236 of 390 id: abc-3199 author: Cerrato, Marcello Dante; Ribas-Serra, Arnau; Cardona, Carles; Gil, Lorenzo title: Species introductions through coconut fibre: Dactyloctenium aegyptium and Glinus oppositifolius, new records for the Balearic Islands, Spain date: 2021-10-01 words: 1711 flesch: 65 summary: Keywords: Balearic Islands, coconut fibre, exotic species, substrate, plant invasions Introduction Allochthonous species are recognized as one of the main threats worldwide to biodiversity. When collected, herbarium vouchers were deposited in the Public Herbarium of the University of the Balearic Islands. keywords: balearic; islands; plant; species; university cache: abc-3199.pdf plain text: abc-3199.txt item: #237 of 390 id: abc-320 author: Lukavsky, Jaromir; Furnadzhieva, Sevdalina; Pilarski, Plamen title: Cyanobacteria of thermal spring at Pancharevo, Sofia, Bulgaria date: 2011-10-05 words: 6973 flesch: 60 summary: Kaziczene, Ravno Pole, Zheleznitza, in Sofia basin, Strelcza near , Gradeshnitza, in the Sandanski basin (LU- KAVSKÝ et al., not published). In Bulgaria there are more than 850 thermal springs and boreholes (PENTCHEVA et al. 1997). keywords: acta; cells; cyanobacteria; et al; laminosus; mastigocladus; phormidium; plate; species; springs; thermalis; thermophilic cache: abc-320.pdf plain text: abc-320.txt item: #238 of 390 id: abc-3204 author: Butiuc Keul, Anca; Coste, Ana; Budahn, Holger; Dunemann, Frank; Farkas, Anca; Postolache, Dragos; Klocke, Evelyn title: Analysis of Hypericum accessions by DNA fingerprinting and flow cytometry date: 2022-03-30 words: 7131 flesch: 56 summary: Chromosome number in root tips of different Hypericum accessions (Hp - H. perforatum, Hu – H. umbellatum, Hm – H. maculatum, Hh – H. hircinum). * Corresponding author e-mail: ana.coste@icbcluj.ro ACCEPTED, AHEAD OF PRINT VERSION OF THE MANUSCRIPT 81(1), 1st April 2022 Please cite this article as: Butiuc-Keul A, Coste A, Budahn H, Dunemann F, Farkas A, Postolache D, Klocke E: Analysis of Hypericum accessions by DNA fingerprinting and flow cytom- etry. keywords: accessions; analysis; botanical; content; dna; garden; hypericum; issr; maculatum; perforatum; plants; size; species; srap cache: abc-3204.pdf plain text: abc-3204.txt item: #239 of 390 id: abc-322 author: El Madani, Faid; Chiaar, Abderrahim; Chafi, Abdelhafid title: Phytoplankton composition and abundance assessment in the Nador lagoon (Mediterranean coast of Morocco) date: 2011-10-05 words: 6956 flesch: 67 summary: + + 97 Nitzschia ventricosa Kitton + + – – + + + + + + 91 Prorocentrum micans Ehrenberg + keywords: acta; balech +; bot; chaetoceros; croat; ehrenberg; lagoon; lópez; moreira; nador; neoceratium; phytoplankton; protoperidinium; stations cache: abc-322.pdf plain text: abc-322.txt item: #240 of 390 id: abc-3220 author: Liu, Qi; Wu , Han ; Li, Yan-Ling; Kociolek , John Patrick title: One new species of Cymbella C.A. Agardh (Bacillariophyta) from high altitude lakes in the Hengduan Mountains of Southwest China date: 2021-10-01 words: 4047 flesch: 63 summary: Keywords: China, Cymbella, diatom, new species, taxonomy, SEM Introduction Diatoms from the Yunnan plateau have been only cur- sorily studied in the past (Skuja 1937, Zhu and Chen 1994, Li et al. 2007a,b). These are distinct from one an- other in size, shape and other morphological features (Krammer 2002, Jüttner et al. 2010b, Liu et al. 2018). keywords: china; cymbella; diatom; kociolek; krammer; kulikovskiy; species; striae; valve cache: abc-3220.pdf plain text: abc-3220.txt item: #241 of 390 id: abc-323 author: Iskrić, Sonja; Jelaska, Sibila; Kojić-Prodić, Biserka; Laćan, Goran; LjubeÅ¡ić, Nikola; Wrischer, Mercedes; Salopek Sondi, Branka title: In memoriam of Dr. Volker Magnus date: 2010-04-15 words: 3855 flesch: 61 summary: 1. Deuterated IAA with the labels on the ring (MAGNUS et al. 1980). He returned to Michigan State University in 1982, working for three years with Norman Good and Roger Hangarter on IAA-conjugates and their application in tissue cultures (MAGNUS et al. 1992a, b). keywords: acid; acta; auxin; magnus; plant; volker cache: abc-323.pdf plain text: abc-323.txt item: #242 of 390 id: abc-3257 author: Özdener Kömpe, Yasemin; Akin Mutlu, Vildan ; Özkoç , İbrahim ; Demiray , Sevim title: Fungal diversity and ex vitro symbiotic germination of Serapias vomeracea (Orchidaceae) date: 2022-03-30 words: 7038 flesch: 62 summary: and the ex vitro effects of these fungi on seed germination, seedling development and tuber formation were revealed. Although they produce a large number of seeds it is not easy to propagate them in the natural environment by seed germination ( Rasmussen 2002). keywords: fungal; fungi; germination; isolates; orchid; rhizoctonia; roots; seeds; soil; svl; tulasnella; vomeracea cache: abc-3257.pdf plain text: abc-3257.txt item: #243 of 390 id: abc-3258 author: Iamonico, Duilio title: Habrosia (Caryophyllaceae) a monotypic genus endemic to Western Asia: morphological and molecular remarks date: 2021-10-01 words: 4573 flesch: 64 summary: Tropicos (2021) does not list the name Arenaria spinuli- flora, erroneously reporting “Habrosia spinuliflora Fenzl” and citing, as syntypes, a specimen at MO (barcode MO256214, available at http://legacy.tropicos.org/Im- age/59784) collected by T. Kotschy (no. 120) in Aleppo ( Syria) in April 20, 1841. Habrosia spinuliflora Fenzl. keywords: arenaria; caryophyllaceae; dillenberger; fenzl; genus; habrosia; iamonico; kadereit; minuartia; sabulina; ser; spinuliflora cache: abc-3258.pdf plain text: abc-3258.txt item: #244 of 390 id: abc-326 author: Kilinc, Mahmut; Kutbay, Hamdi Guray; Yalcin, Erkan; Bilgin, Ali; Avci, Kenan; Topaloglu, Solmaz Gencoglu title: Effects of selected groundwater chemical traits on a salt marsh community date: 2011-04-11 words: 4728 flesch: 61 summary: References ABD EL-GHANI, M. M., 2000a: ABD EL-GHANI, M. M., 2000b: keywords: groundwater; journal; marsh; plant; salinity; salt; soil; species; vegetation cache: abc-326.pdf plain text: abc-326.txt item: #245 of 390 id: abc-3280 author: Stanišić-Vujačić, Milica; Stešević , Danijela; Hadžiablahović , Sead ; Caković , Danka ; Šilc, Urban title: An Asphodelus ramosus dominated plant community in Montenegro: fringe or grassland? date: 2022-03-30 words: 7486 flesch: 70 summary: In the eastern Adriatic, these communities have been classified within the grassland class Festuco-Brometea, while in the central and western Adriatic, they have been classified as heliophilous edge vegetation of Trifolio-Geranietea sanguinei (Biondi et al. 2014, Allegrezza et al. 2015) or recently into a new class Charybdido pancratii-Asphodeletea ramosi Biondi et al. 2016 (Biondi et al. 2016, 2017). (2014) for other classes and Biondi et al. (2016) for the class Charybdido pancratii- Asphodeletea ramosi. keywords: asphodelus; biondi; bromo; chrysopogonetum; communities; community; et al; grasslands; grylli; mediterranean; montenegro; plant; ramosi; ramosus; species; subsp; vegetation cache: abc-3280.pdf plain text: abc-3280.txt item: #246 of 390 id: abc-3284 author: Stešević, Danijela; Milanović, Đorđije; Stanišić-Vujačić, Milica ; Šilc, Urban title: New records of Salicornia s.l. in Montenegro and Bosnia and Hercegovina date: 2022-03-30 words: 2517 flesch: 60 summary: 81 (1), 117–120, 2022 CODEN: ABCRA 25 DOI: 10.37427/botcro-2022-004 ISSN 0365-0588 eISSN 1847-8476 Short communication New records of Salicornia s.l. in Montenegro and Bosnia and Herzegovina Danijela Stešević1*, Đorđije Milanović2, Milica Stanišić-Vujačić1, Urban Šilc3 1 University of Montenegro, Faculty of Natural Sciences and Mathematics, Džordža Vašingtona bb, 81000 Podgorica, Montenegro 2 University of Banja Luka, Faculty of Forestry, S. Stepanovića 75a, 78000 Banja Luka, Bosnia and Herzegovina 3 Research Centre of the Slovenian Academy of Sciences and Arts - ZRC SAZU, Institute of Biology, Novi Trg 2, 1000 Ljubljana, Slovenia Abstract – Floristic investigations on the eastern part of Adriatic coast in Montenegro and Bosnia and Herzegovina led to the discovery of three glasswort taxa new for the area: Arthrocaulon macrostachyum (Moric.) Keywords: Arthrocaulon macrostachyum, new records, Salicornia perennis, Salicornia procumbens Introduction Due to coexistence in similar ecological environments, representatives of glassworts (Salicornia s.l. (incl. keywords: arthrocaulon; bosnia; macrostachyum; montenegro; perennis; procumbens; rel; salicornia cache: abc-3284.pdf plain text: abc-3284.txt item: #247 of 390 id: abc-330 author: Inceer, Huseyin title: Achene slime content in some taxa of Matricaria L. (Asteraceae) date: 2011-04-11 words: 2154 flesch: 64 summary: The structure of plant slimes. recutita) have slime cells on the surface and they are characterized by slime envelope formation during hydration. keywords: blue; chamomilla; kreitschitz; matricaria; slime; var cache: abc-330.pdf plain text: abc-330.txt item: #248 of 390 id: abc-3309 author: Koç, Esra title: Physiological responses of resistant and susceptible pepper plants to exogenous proline application under Phytophthora capsici stress date: 2022-03-30 words: 12838 flesch: 64 summary: In CM-334 cultivar, the highest increase in DPPH radical scav- enging activity of approximately 84% was recorded after the treatment with 1 mM Pro + P. capsici on the 7th dpi in com- parison to P. capsici application alone. Therefore, the increase in the chlorophyll a and b content in peppers exposed to P. capsici stress can be at- tributed to the stimulation of chlorophyll biosynthesis or inhibition of its degradation and the more efficient removal of stress-induced increased ROS by Pro. keywords: application; capsici; content; cultivar; dpi; p. capsici; plant; pro; stress cache: abc-3309.pdf plain text: abc-3309.txt item: #249 of 390 id: abc-3330 author: Tiryaki, Iskender; Isidogru, Nuray title: Determination of salt tolerance levels and genetic relationships of Vicia sativa cultivars using gene targeted functional markers date: 2022-03-30 words: 6182 flesch: 57 summary: Salt tolerance related genes used as gene targeted functional markers in the study. In this study, we have used the primers for salt tolerance related genes as GTFMs to reveal genetic relationship as well as to determine the possibility of those gene primers to evaluate salt tolerance levels of the common vetch cultivars. keywords: analysis; cultivars; et al; gene; germination; markers; plant; rate; salt; salt tolerance; sativa; stress; tolerance; vetch; vicia cache: abc-3330.pdf plain text: abc-3330.txt item: #250 of 390 id: abc-334 author: Ćurković-Perica, Mirna; Ježić, Marin title: Detrimental effect of quercetin on phytoplasma-infected Catharanthus roseus (L.) G. Don shoots grown in vitro date: 2010-10-22 words: 3424 flesch: 54 summary: The undesirable effect of quercetin treatment, resulting in the stunting of non-infected and infected plants and in in- creased severity of symptoms in infected plants, might be explained by several hypothe- sized mechanisms. P. asteris'-infected C. roseus shoots were grown through three subcultures on media with different quercetin concentrations, molecular analyses using consecutive PCR reac- tions with R16F1/R0 and R16F2n/R2 primer pairs showed the presence of 'Ca. keywords: effect; medium; pcr; phytoplasma; plants; quercetin; roseus; shoots cache: abc-334.pdf plain text: abc-334.txt item: #251 of 390 id: abc-336 author: Ćuk, Katarina; Gogala, Marko; Tkalec, Mirta; Vidaković-Cifrek, Željka title: Transgenerational stress memory in Arabidopsis thaliana (L.) Heynh.: antioxidative enzymes and HSP70 date: 2010-10-22 words: 7557 flesch: 54 summary: In order to minimize the effects of UV irradiation plants activate different physiological responses, such as the biosynthesis of protecting compounds (STAPLETON 1992), the reactive oxygen species (ROS) scavenging system (XU et al. 2008) and DNA re- pair mechanisms (MOLINIER et al. 2005). Dual action of the active oxygen species during plant stress responses. keywords: activity; control; dose; generation; hsp70; irradiation; m–2; plants; progeny; stress cache: abc-336.pdf plain text: abc-336.txt item: #252 of 390 id: abc-3388 author: Plenković-Moraj, Anđelka title: Dubravka Hafner and Anita Dedić – Diatoms of the Adriatic Sea Basin in Bosnia and Herzegovina date: 2021-10-01 words: 523 flesch: 40 summary: 80 (2), 2021 Book Review II Dubravka Hafner and Anita Dedić – Diatoms of the Adriatic Sea Basin in Bosnia and Herzegovina Diatoms – Do we know them well? Compiling a definitive list of diatoms from Bosnia and Herzegovina involves considerable scien- tific effort, and I am sure that both authors will acknowledge that knowledge of freshwater habitats is still incomplete and there is much to learn. keywords: bosnia; diatoms cache: abc-3388.pdf plain text: abc-3388.txt item: #253 of 390 id: abc-3420 author: Martín-Bravo, Santiago; Benítez-Benítez, Carmen; Míguez-Ríos, Mónica; Meco, Marjol; Jiménez-Mejías, Pedro title: Chorological notes of Carex L. (Cyperaceae) for the Flora of the Balkans, with emphasis in Albania date: 2022-03-30 words: 5627 flesch: 67 summary: Our findings include new na- tional species records and/or confirmations for Albania, Montenegro and North Macedonia (C. agastachys, C. atrata, C. curvula, C. demissa, C. hispida, C. parviflora), as well as other interesting records of rare and/or endangered Carex species in Albania (C. castroviejoi, C. myosuroides). Finally, we performed a preliminary assessment of the conservation status of C. atrata and C. parviflora at the national level in Albania following criteria, categories, and guidelines from IUCN (2012a, b). keywords: albania; benítez; c. benítez; carex; jiménez; mejías; míguez; species cache: abc-3420.pdf plain text: abc-3420.txt item: #254 of 390 id: abc-3422 author: Karaismailoğlu, Mehmet; İnal, Behçet; Erol, Osman title: A systematic study of Thlaspi s.l. taxa in the sections Nomisma, Thlaspi and Pterotropis from Turkey based on fruit morphological and molecular data date: 2022-09-30 words: 6465 flesch: 62 summary: 81 (2), 2022 203 formed by T. perfoliatum taxa, the length of the petals in the outer segment is equal to those of the inner segment, while in T. annuum the petals in the outer segment are longer than in the inner segment (Karaismailoğlu 2018). T. ochroleucum, T. cariense, T. densiflorum, T. violascens, T. tatianae, T. cataonicum and T. syriacum taxa are included in the C3 cluster. keywords: data; fruit; genus; karaismailoğlu; meyer; obcordate; oval; region; reticulate; species; taxa; thlaspi; turkey cache: abc-3422.pdf plain text: abc-3422.txt item: #255 of 390 id: abc-3435 author: Justić, Marta; Jelaska, Sven title: The relationship between biodiversity and the biomass of grasslands in the Zagreb area (NW Croatia) date: 2022-09-30 words: 7886 flesch: 59 summary: Such an im- pact resulted in the dominance of several competitive taxa (Centaurea macroptilon Borbás, Lolium perenne L., Medicago sativa L., Trifolium pratense L.), which caused the biomass of plot 5 to be one of the highest measured. Family Taxa Localities and plots Amaryllidaceae Allium sp. 8 Apiaceae Daucus carota L. 4, 4.2, 6, 6.2, 8 Pastinaca sativa L. 2, 2.2, 5, 5.1 Asteraceae Achillea millefolium L. 1, 1.1, 2, 2.2, 3, 4, 4.1, 4.2, 8, 8.2 Artemisia vulgaris L. 3, 3.2 Bellis perennis L. 4, 4.2 Buphthalmum salicifolium L. 1, 1.1, 1.2 Centaurea jacea L. 2, 2.1 Centaurea macroptilon Borbás 2, 2.2, 5, 5.2, 8, 8.2 Centaurea nigrescens Willd. keywords: biomass; diversity; dry; grasslands; locality; number; plant; taxa; values; vegetation cache: abc-3435.pdf plain text: abc-3435.txt item: #256 of 390 id: abc-3468 author: Shakhsi-Dastgahian, Fereshteh ; Valizadeh, Jafar ; Cheniany, Monireh ; Einali, Alireza title: Exogenous arginine treatment additively enhances growth and tolerance of Salicornia europaea seedlings under salinity date: 2022-09-30 words: 5999 flesch: 56 summary: Despite some studies on salt stress and the role of Arg in its tolerance (Nejadalimoradi et al. 2014, Ramadan et al. 2019), there is no report on the possible effects of this amino acid on salt stress tolerance in Salicornia. How- ever, increases in both polyphenols and flavonoids have been reported in plants under salt stress (Lim et al. 2012, Sarker et al. 2019). keywords: arg; effect; europaea; growth; nacl; plant; salinity; salt; seedlings; stress; tolerance; treatment cache: abc-3468.pdf plain text: abc-3468.txt item: #257 of 390 id: abc-3501 author: Boubetra, Kenza; Amirouche, Nabila; Amirouche, Rachid title: Morpho-anatomical diversity of five species of the genus Asparagus (Asparagaceae) from Algeria: Genus Asparagus in Algeria date: 2022-09-30 words: 5894 flesch: 54 summary: Cir- cular sections have also been observed in Asparagus species from Bulgaria such as A. tenuifolius Lam., and A. acutifolius (Raycheva and Stojanov 2013). ABCRA 25 DOI: 10.37427/botcro-2022-014 ISSN 0365-0588 eISSN 1847-8476 Morpho-anatomical diversity of five species of the genus Asparagus (Asparagaceae) from Algeria Kenza Boubetra1*, Nabila Amirouche2, Rachid Amirouche2 1 National Institute of Forest Research, INRF, PO Box 37, Cheraga 16014 Algiers, Algeria 2 University of Sciences and Technology Houari Boumediene, Faculty of Biological Sciences, Laboratory for Biology and Physiology of Organisms, USTHB, Bab Ezzouar, 16111, Algiers, Algeria Abstract – Five species of the genus Asparagus are recognized in the flora of Algeria: A. acutifolius L., A. albus L., A. horridus L., A. officinalis L., and the endemic A. altissimus Munby. keywords: acutifolius; algeria; asparagus; cells; cladodes; fig; genus; horridus; officinalis; populations; species cache: abc-3501.pdf plain text: abc-3501.txt item: #258 of 390 id: abc-351 author: Devide, Zvonimir title: Lehrbuch der Botanik Textbook of Botany, Founded by E. Strasburger, F. Noll, H. Schenck and A. F. W. Schimper. 36th edition, revised by A. Bresinsky, C. Korner, J. W. Kadereit, G. Neuhaus and U. Sonnewald date: 2010-04-15 words: 2506 flesch: 55 summary: This second part begins with the physiology of the metabolism [5] In this section all as- pects of plant metabolism are presented and explained: energetics of metabolism, economy of minerals and water, photosynthesis (light reactions and the path of carbon, the assimila- 150 ACTA BOT. In the second part of the book, the main aspects of plant physiology are presented: me- tabolism, growth and development, movements and allelophysiology. keywords: book; botany; chapter; edition; plants; strasburger; textbook cache: abc-351.pdf plain text: abc-351.txt item: #259 of 390 id: abc-3516 author: Elkordy, Ahmed; Osman , Ahmed K.; O. Badry, Mohamed title: Seed and pollen morphology and numerical analysis of Tephrosia Pers. (Fabaceae) and their taxonomic significance date: 2022-09-30 words: 5612 flesch: 61 summary: Clade A comprising T. kassasii, clade B comprising T. apollinea, T. purpurea, T. quartiniana, and T. uniflora, and clade C comprising T. nubica. T. apollinea (A–C), T. nubica (D–F), T. purpurea (G–I), T. quartiniana (J–L), T. uniflora (M–O), T. kassasii (P–R). keywords: apollinea; fig; nubica; pollen; purpurea; quartiniana; seed; taxa; tephrosia; uniflora cache: abc-3516.pdf plain text: abc-3516.txt item: #260 of 390 id: abc-3519 author: Šoljan, Dubravka title: In Memoriam, Sister Edita Marija Šolić Ph.D. (1946 – 2021) date: 2022-03-30 words: 4301 flesch: 59 summary: Marija Edita Šolić (1946 – 2021). Marija Edita Šolić continuously worked on obtaining new knowledge and skills, occasionally with academician Ernest Mayer (Slovenia), at the Faculty of Science in Sarajevo (Bosnia and Herzegovina), at the Faculty of Science and the Croatian Natural History Museum in Zagreb, and with Čedomil Šilić, PhD, at the National Museum of Bosnia and Herzegovina in Sarajevo. keywords: biokovo; biology; edita; m.e; makarska; marija; nature; science; sister; šolić cache: abc-3519.pdf plain text: abc-3519.txt item: #261 of 390 id: abc-352 author: Devide, Zvonimir title: Celebrating the eightieth birthday of Professor Peter Sitte date: 2010-04-15 words: 4092 flesch: 65 summary: In the name of all our Croatian colleagues and the Editorial Board of the Acta Botanica Croatica, Zvonimir Devidé Journal papers, congress proceedings papers, books and book chapters SITTE, P., 1953: SITTE, H., SITTE, P., 1955: keywords: acta; biologie; biology; cell; der; des; die; evolution; falk; feinbau; für; hrsg; sitte; und; verlag; von cache: abc-352.pdf plain text: abc-352.txt item: #262 of 390 id: abc-353 author: Vardar, Filiz; Unal, Meral title: Cytochemical and ultrastructural observations of anthers and pollen grains in Lathyrus undulatus Boiss. date: 2011-04-11 words: 4325 flesch: 52 summary: Results The anther development of Lathyrus undulatus Boiss. was separated into 5 stages: pre- meiotic stage, tetrad stage, young microspore stage, vacuolated pollen stage and bicellular pollen grain stage. Abbreviations: PMC – pollen mother cell, PAS – periodic acid-Schiff Introduction Microsporogenesis and pollen grain development have been a focus of interest since generative reproduction in plants depends on pollen structure and function. keywords: anther; cells; development; lathyrus; microspore; pollen; stage; tapetal; tapetum; undulatus; wall cache: abc-353.pdf plain text: abc-353.txt item: #263 of 390 id: abc-3557 author: Škvorc, Zeljko; Krstonošić, Daniel title: In memoriam Jozo Franjić (1966-2021) date: 2022-03-30 words: 4000 flesch: 65 summary: Jasprica, N., Škvorc, Ž., Dolina, K., Ruščić, M., Kovačić, S., Franjić J., 2015: Composition and ecology of the Quercus coc- cifera L. communities along the eastern Adriatic coast (NE Mediterranean). Veličina žira kao pokazatelj individualne vari- jabilnosti hrasta lužnjaka (Quercus robur L.). keywords: croatia; franjić; hrvatskoj; krstonošić; quercus; robur; trinajstić; zagreb; škvorc cache: abc-3557.pdf plain text: abc-3557.txt item: #264 of 390 id: abc-3561 author: Li, Yue; Ma, Junqiang; Wang, Yu; Xu, Sunan; Jiang, Lei; Zhang, Lihong; Hou, Wei title: Effects of exogenous NO on the growth and photosynthetic fluorescence characteristics of ryegrass seedlings under B[a]P stress date: 2023-03-31 words: 5507 flesch: 56 summary: B[a]P stress induced the reduction of the aboveground and belowground dry weights, chlorophyll (a, b), the total chlorophyll contents, the carotenoid content, the net photosynthetic rate (Pn), the intercellular carbon dioxide concentration (Ci), the water use efficien- cy (WUE), the photosystem II (PSII) potential activity (Fv/F0), the maximum quantum yield of PSII photochemis- try (Fv/Fm), the steady-state fluorescence yield (Fs), and the non-photochemical quenching (qN), while enhance- ment was recorded in response to the foliar spray of SNP at 200 and 300 μmol L–1 under B[a]P stress. Gray correlation and principal component analyses show that 200 μmol L–1 of SNP more drastically alleviated the damage caused by B[a]P stress than 300 μmol L–1 of SNP. keywords: b[a]p; chlorophyll; fluorescence; growth; l–1; parameters; plant; ryegrass; snp; stress; μmol cache: abc-3561.pdf plain text: abc-3561.txt item: #265 of 390 id: abc-3564 author: Ravanbakhsh, Mokarram; Babakhani, Babak; Ghasemnezhad, Mahmood; Serpooshan, Fariba; Biglouie, Mohamad Hassan title: Acer velutinum Bioss. (velvet maple) seedlings are more tolerant to water deficit than Alnus subcordata C.A. Mey. (Caucasian alder) seedlings date: 2023-03-31 words: 8676 flesch: 60 summary: SLA showed an increasing trend in A. velutinum under drought stress treatments. Plant drought stress: Effects, mechanisms and mana- gement. keywords: a. subcordata; a. velutinum; biomass; chl; content; drought; drought stress; et al; leaf; rwc; seedlings; species; stress; treatments; water cache: abc-3564.pdf plain text: abc-3564.txt item: #266 of 390 id: abc-359 author: Turkmen, Necattin; Duzenli, Atabay title: Early post-fire changes of Pinus brutia forests in the Amanos Mountains (Turkey) date: 2011-04-11 words: 5068 flesch: 70 summary: + + Salvia tomentosa L. Lamiaceae H P G – – + + Smilax aspera L. Liliaceae Ph P VG + Rubiaceae Ch P VG – – + + Asplenium adiantum-nigrum L. Aspleniaceae H P G – – – + Brachypodium pinnatum (L.) P. Beauv. keywords: acta; area; brutia; fire; forest; mediterranean; pinus; post; soil; species; turkey; year cache: abc-359.pdf plain text: abc-359.txt item: #267 of 390 id: abc-3634 author: Ezer, Tülay; Alata˛s, Mevlüt; Batan, Nevzat; Erata, Hüseyin title: The epiphytic bryophyte succession of Buxus sempervirens forests in Fırtına Valley, Rize (North Türkiye) date: 2023-03-31 words: 6661 flesch: 61 summary: The main cluster, A, occurred in lower-base communities and it was character- ized by dominant species E. crispa and H. trichomanoides, co-dominant I. alopecuroides and abundant P. attenuatus and S. flotowianum. Sampling plots from tree zones were defined by 20 × 20 cm2, determined according to species diversity on the living trunks of B. sempervirens. keywords: boxwood; bryophyte; community; cortico; crispa; epiphytic; fırtına; middle; sempervirens; species; trees; valley; zones cache: abc-3634.pdf plain text: abc-3634.txt item: #268 of 390 id: abc-3644 author: Juan, Ana; Moreno, Joaquín; Terrones, Alejandro title: First record of alien naturalized populations of the crop Cucurbita moschata (Cucurbitaceae) in Spain, with remarks on typification status date: 2023-03-31 words: 5559 flesch: 57 summary: The alien status and distribution of C. moschata together with its relatives C. ficifolia, C. pepo and C. maxima are reviewed for the Spanish references. In Europe, the most important cultivated species are C. pepo L., C. maxima Duchesne, C. moschata Duchesne and C. ficifolia Bouché (Teppner 2004, Henning et al. 2017). keywords: alien; area; cucurbita; flora; fruit; leaves; moschata; plant; populations; river; spain; species; vinalopó cache: abc-3644.pdf plain text: abc-3644.txt item: #269 of 390 id: abc-3647 author: Pantović, Jovana; Grdović, Svetlana; Sabovljević, Marko title: New bryophyte taxa for Bosnia and Herzegovina date: 2023-03-31 words: 1970 flesch: 64 summary: Ellis, L.T, Alatas, M., Alvaro Alba, W.R, Charry Giraldo, A.M., Amatov, V., Batan, N., Becerra Infante, D.A, Burghardt, M., Czernyadjeva, I.V., Kuzmina, E.Y., Doroshina, G.Y., Erata, H., Garilleti, R., Gradstein, S.R., Jukoinene, I., Karaman Erkul, S., Keksin, A., Ezer, T., Lara, F., Draper, I., Maksimov, A.I., Mammandova, A.V., Natcheva, R., Nemeth, C., Pantović, J., Sabovljević, M. S., Papp, B., Poponessi, S., Cogoni, A., Porley, R.D., Reiner-Drehvald, M.E., Schafer- Verwimp, A., Schmotzer, A., Segota, V., Alegro, A., Rimac, A., Stefanut, S., Szurdoki, E., Vilk, E.F., Virchenko, V.M., Bijlsma, R.J., Callaghan, D.A., 2021b: References Ellis, L.T., Ah-Peng, C., Aslan, G., Bakalin, V.A., Bergamini, A., Callaghan, D.A., Campisi, P., Raimondo, F.M., Choi, S.S., Csiky, J., Csikyné Radnai, E., Cykowska-Marzencka, B., Czernyadjeva, I.V., Kalinina, Y.M., Afonina, O.M., Domina, G., Drapela, P., Fedosov, V.E., Fuertes, E., Gabriel, R., Kubová, M., Soares Albergaria, I., Gospodinov, G., Natcheva, R., Graulich, A., Hedderson, T., Hernández-Rodríguez, E., Hugonnot, V., Hyun, C.W., Kırmacı, M., Çatak, U., Kubešová, S., Kučera, J., LA Farge, C., Larraín, J., Martin, P., Mufeed, B., Manju, C.N., Rajesh, K.P., Németh, C., Nagy, J., Norhazrina, N., Syazwana, N., O’Leary, S.V., Park, S.J., Peña-Retes, A.P., Rimac, A., Alegro, A., Šegota, V., Koletić, N., Vuković, N., Rosadziński, S., Rosselló, J.A., Sabovljević, M.S., Sabovljević, A. D., Schäfer-Verwimp, A., Sérgio, C., Shkurko, A.V., Shyriaieva, D., Virchenko, V.M., Smoczyk, M., Spitale, D., Srivastava, P., Omar, I., Asthana, A.K., Staniaszek-Kik, M., Cienkowska, A., Ștefănuţ, M.M., Ștefănuţ, S., Tamas, G., Bîrsan, C.C., Nicoară, G.R., Ion, M.C., Pócs, T., Kunev, G., Troeva, E.I., van Rooy, J., Wietrzyk-Pełka, P., Węgrzyn, M.H., Wolski, G.J., Bożyk, D., Cienkowska, A., 2021a: New national and regional bryophyte records, 65. keywords: bosnia; det; herzegovina; leg; site cache: abc-3647.pdf plain text: abc-3647.txt item: #270 of 390 id: abc-3655 author: Jasprica, Nenad title: The Thirty-ninth Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE) was held in Dubrovnik, Croatia (May 4-7, 2022) date: 2022-09-30 words: 683 flesch: 60 summary: 81 (2), 2022 S11 Social news The Thirty-ninth Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE) was held in Dubrovnik, Croatia (May 4-7, 2022) Participants of the 39th Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE), Dubrovnik, Croatia, May 4-7, 2022 during the botanical field excursion on the Pelješac Peninsula (Photo: I. Brautović). keywords: dubrovnik; meeting; vegetation cache: abc-3655.pdf plain text: abc-3655.txt item: #271 of 390 id: abc-3656 author: Stančić, Zvjezdana; Fiket, Željka title: Pollination patterns of flora and vegetation in northern Croatia with reference to Apis mellifera date: 2023-03-31 words: 8165 flesch: 57 summary: Plant species useful for Apis mellifera The European honey bee plays a very important role in the pollination of plant species. Overall, 54% of plant species useful to European honey bees were found, 51% of which provide pollen and 47% nectar. keywords: croatia; flora; forest; habitat; honey; insect; insect pollination; modes; plant; plant species; pollination; pollinators; species; vegetation; wind cache: abc-3656.pdf plain text: abc-3656.txt item: #272 of 390 id: abc-3658 author: Radi, Abeer A.; Salam, Hussein Kh.; Hamada, Afaf M.; Farghaly, Fatma A. title: Effect of excess boron on growth, membrane stability, and functional groups of tomato seedlings: Boron toxicity and tomato seedling growth date: 2023-03-31 words: 5990 flesch: 62 summary: However, EB levels raised the peak intensity of 825.45 cm–1 relative to control. 3A-C, the membrane damage was more severe as EB levels in the medium increased. keywords: boron; bound; chl; cm–1; et al; growth; peak; plant; seedlings; tomato; toxicity cache: abc-3658.pdf plain text: abc-3658.txt item: #273 of 390 id: abc-372 author: Srecec, Sinisa; Zechner Krpan, Vesna; Marag, Sanja; Spoljaric, Igor; Kvaternjak, Ivka; Mrsic, Goran title: Morphogenesis, volume and number of hop (Humulus lupulus L.) glandular trichomes, and their influence alpha acids in fresh bracts of hop cones date: 2011-04-11 words: 2948 flesch: 61 summary: Seven morphological development stages of peltate glandular trichomes are described and the relation between their morpho- genesis and accumulation of secondary metabolites was clarified (SAITO et al. 1995, HIROSAWA et al. o ujak 2011 15:05:36 Color profile: Disabled Composite 150 lpi at 45 degrees Volume of peltate glandular trichomes was calculated by following equation for volume calculation of spheroid bodies: V = 4 3 p · a 2 b a= width (distance between two points on x-axis in mm) b= height (distance between two points on y-axis in mm) keywords: acids; bracts; fig; hop; morphogenesis; peltate; phase; trichomes cache: abc-372.pdf plain text: abc-372.txt item: #274 of 390 id: abc-380 author: Shah, Shoukat Hussain title: Comparative effects of 4-Cl-IAA and kinetin on photosynthesis, nitrogen metabolism and yield of black cumin (Nigella sativa L.) date: 2011-04-11 words: 3443 flesch: 63 summary: Biochemistry and physiology of plants hormones. Control plants were sprayed with double distilled water only. keywords: 10–5; 10–6; activity; control; iaa; kinetin; physiology; plants; treatment cache: abc-380.pdf plain text: abc-380.txt item: #275 of 390 id: abc-397 author: Bogdanovic, Sandro; Ruscic, Mirko title: Pimpinella tragium Vill. subsp. lithophila (Schischk.) Tutin (Apiaceae), a new taxon in Croatian flora date: 2011-04-11 words: 2454 flesch: 70 summary: depressa and P. tragium subsp. titanophila) of this group under the name of P. tragium, while suggesting treating P. tragium subsp. keywords: flora; island; lithophila; pimpinella; subsp; tragium; tutin; vis cache: abc-397.pdf plain text: abc-397.txt item: #276 of 390 id: abc-408 author: Buyukkartal, Hatice N.; Kahraman, Ahmet; Colgecen, Hatice; Dogan, Musa; Karabacak, Ersin title: Mericarp micromorphology and anatomy of Salvia hedgeana Donmez, S. huberi Hedge and S. rosifolia Sm. (section Salvia Hedge, Lamiaceae) date: 2011-04-11 words: 6435 flesch: 62 summary: Mericarp length to width ratio ranges from 1.11 in S. hedgeana to 1.60 in S. huberi. Mericarp shape is mainly ovoid, rarely broadly ovoid in S. hedgeana, and oblong in S. huberi. keywords: cells; hedgeana; huberi; lamiaceae; mericarp; mucilage; rosifolia; s. huberi; salvia; species cache: abc-408.pdf plain text: abc-408.txt item: #277 of 390 id: abc-409 author: Ali, Magdi M.; Hassan, Samar A.; Shaheen, Abdel-Samei M. title: Impact of riparian trees shade on aquatic plant abundance in conservation islands date: 2011-10-05 words: 6794 flesch: 60 summary: In the present study, riparian Acacia nilotica trees provided natural shading limiting the growth of submerged aquatic plants, otherwise difficult to manage. ALI, M. M., Hamad, A., Springuel, I. V., Murphy, K. J., 1995: keywords: demersum; islands; light; macrophytes; management; plants; riparian; shaded; sites; trees; water; zones cache: abc-409.pdf plain text: abc-409.txt item: #278 of 390 id: abc-41 author: Sheidai, Masoud; Habibi, Meysam; Azizian, Dina; Khatamsaz, Mahboobeh title: Cytology and palynology of the Clematis L. species (Ranunculaceae) in Iran date: 2009-10-21 words: 4543 flesch: 65 summary: TOWNSEND, C. C., EVANS, G., 1980: Clematis. In: TOWNSEND, C. C. (ed.), Flora of Iraq 4, 743–750. keywords: clematis; orientalis; species cache: abc-41.pdf plain text: abc-41.txt item: #279 of 390 id: abc-410 author: Prebeg, Tatjana; Fulgosi, Hrvoje; Wrischer, Mercedes title: Professor Nikola Ljubesic on the occasion of his seventieth birthday date: 2010-10-22 words: 4688 flesch: 60 summary: TATJANA PREBEG, HRVOJE FULGOSI, MERCEDES WRISCHER Laboratory for Electron Microscopy, Division of Molecular Biology, Ru|er Bo{kovi} Institute, Bijeni~ka 54, HR-10000 Zagreb, Croatia Scientific papers: LJUBE[I], N., 1968: Protoplasma 66, 369–379. LJUBE[I], N., 1969: keywords: acta; acta botanica; botanica; chromoplasts; croatica; ljube[i; prebeg; professor; wrischer cache: abc-410.pdf plain text: abc-410.txt item: #280 of 390 id: abc-417 author: Zupančić, Mitja; Gogala, Nada title: In memoriam Prof Dr. Ernest Mayer date: 2010-10-22 words: 1843 flesch: 68 summary: Jahrbuch des Vereins zum Schutze der Alpenpflanzen und -Tiere 25, 136–144. MAYER, E., 1963: Pedicularis julica E. Mayer spec. zupancicii K. Micevski et E. Mayer subsp. keywords: ernest; flora; ljubljana; mayer; profile cache: abc-417.pdf plain text: abc-417.txt item: #281 of 390 id: abc-425 author: Gomez, Fernando title: Diversity and distribution of the dinoflagellates Brachidinium, Asterodinium and Microceratium (Brachidiniales, Dinophyceae) in the open Mediterranean Sea date: 2011-10-05 words: 2233 flesch: 55 summary: 70 (2), 209–214, 2011 CODEN: ABCRA 25 ISSN 0365-0588 Diversity and distribution of the dinoflagellates Brachidinium, Asterodinium and Microceratium (Brachidiniales, Dinophyceae) in the open Mediterranean Sea FERNANDO GÓMEZ* Instituto Cavanilles de Biodiversidad y Biología Evolutiva, Universidad de Valencia, PO Box 22085, 46071 Valencia, Spain Abstract – Brachidiniacean dinoflagellates have been investigated in the open waters of the Mediterranean Sea, along a transect from the south of France to the south of Cyprus (20 June–18 July 2008). Microceratium was found below 100 m in the eastern Mediterranean Sea, with the highest abundance of 8 cells L–1 at 125 m depth, in the Levantine Basin. keywords: asterodinium; brachidinium; gómez; karenia; mediterranean; microceratium; sea cache: abc-425.pdf plain text: abc-425.txt item: #282 of 390 id: abc-428 author: Petrovic, Danka; Stesevic, Danijela title: Shift of the western boundary of the distribution area of Micromeria cristata (Hampe) Griseb. and Steptorhamphus tuberosus (Jacq.) Grossh. date: 2011-10-05 words: 3637 flesch: 65 summary: During field investigations of Mt Rumija, two new taxa for the flora of Montenegro were recorded: Micromeria cristata (Hampe) Griseb. Key words: flora, Montenegro, Mt Rumija, Micromeria cristata, Steptorhamphus tuberosus Introduction Rumija is the southernmost part of the Dinaric Alps, the Adriatic coastal mountain chain, extending in a NW-SE direction, situated between Skadar Lake and the Adriatic Sea. keywords: cristata; distribution; flora; micromeria; montenegro; rumija; steptorhamphus cache: abc-428.pdf plain text: abc-428.txt item: #283 of 390 id: abc-429 author: Sapic, Irena; Segota, Vedran; Alegro, Antun title: Where does Sedum cepaea L. (Crassulaceae) – one of the rarest species of Croatian flora – really grow? date: 2012-03-30 words: 4124 flesch: 69 summary: On both finding spots (Moslava~ka gora and Zrinska gora, respectively), S. cepaea grows in vegetation belt dominated by sessile oak. The research in- cluded three areas of Central Croatia – Nikolino brdo in Topusko and Moslava~ka gora, as finding spots already known from literature and herbaria, and Zrinska gora, as a newly dis- covered finding spot of S. cepaea. keywords: cepaea; croatia; finding; flora; forest; gora; moslava; sedum; species; zrinska cache: abc-429.pdf plain text: abc-429.txt item: #284 of 390 id: abc-431 author: Barinova, Sophia S.; Nevo, Eibi; Bragina, Tatiana M. title: Ecological assessment of wetland ecosystems of northern Kazakhstan on the basis of hydrochemistry and algal biodiversity date: 2011-10-05 words: 12081 flesch: 69 summary: 8, 14, 21, 34 P-B – st-str – b i – k 153 Ankistrodesmus falcatus (Corda) Ralfs 20 P-B – st-str b hb – k 154 Ankistrodesmus fusiformis Corda sensu Korsch. 1 P – st-str – – – – k 3 Anabaena flos-aquae (Lyngb.) keywords: alf; alf k; algal; b temp; barinova; diversity; ehrb; es b; ind; kazakhstan; kütz; lakes; salinity; species; str; water cache: abc-431.pdf plain text: abc-431.txt item: #285 of 390 id: abc-432 author: Karlovic, Ksenija; Kremer, Dario; Jurisic Grubjesic, Renata; Popovic, Zvjezdana title: Fruit and seed traits of Berberis croatica Horvat and Berberis vulgaris L. date: 2012-03-30 words: 3824 flesch: 68 summary: o ujak 2012 11:25:01 Color profile: Disabled Composite 150 lpi at 45 degrees intraspecies variability for seed traits was something higher than for fruit traits. (0.0116–0.0134) g. Dimensions of B. vulgaris fruits (seeds) were: length 10.20–11.29 keywords: croatica; fruit; vulgaris; width cache: abc-432.pdf plain text: abc-432.txt item: #286 of 390 id: abc-433 author: Batori, Zoltan; Galle, Robert; Erdos, Laszlo; Kormoczi, Laszlo title: Ecological conditions, flora and vegetation of a large doline in the Mecsek Mountains (South Hungary) date: 2011-10-05 words: 3524 flesch: 57 summary: Numbers on the right indi- cate plant species as follows: 1 – Fraxinus excelsior L., 2 – Cardamine bulbifera (L.) Crantz, 3 – Allium ursinum L., 4 – Tilia tomentosa Moench, 5 – Arum maculatum L., 6 – Asarum europaeum L., 7 – Hedera helix L., 8 – Alliaria petiolata (M. B.) Cavara et Grande, 9 – Galium aparine L., 10 – Veronica hederifolia L., 11 – Helleborus odorus W. et K., 12 – Viola reichenbachiana Jord., 13 – Acer platanoides L., 14 – Acer campestre L., 15 – Fraxinus ornus L., 16 – Stellaria holostea L., 17 – Dactylis polygama Horvátovszky, 20 – Polygonatum multiflorum (L.) All., 21 – Quercus petraea (Mattuschka) Lieblein, 22 – Euphorbia amygdaloides L., 23 – Ligustrum vulgare L., 24 – Rosa arvensis Huds., 25 – Lathyrus vernus (L.) Bernh., 26 – Galium schultesii Vest, 27 – Hepatica nobilis Mill., 28 – Crataegus laevigata (Poir.) keywords: acta; air; analysis; croat; doline; hungary; mecsek; north; pattern; plant; slope; south; species; transect; vegetation cache: abc-433.pdf plain text: abc-433.txt item: #287 of 390 id: abc-434 author: Jamzad, Ziba; Panahi, Parisa; Pourmajidian, Mohammad R.; Fallah, Ashgar; Pourhashemi, Mehdi title: Foliar epidermis morphology in Quercus (subgenus Quercus, section Quercus) in Iran date: 2012-03-30 words: 8249 flesch: 68 summary: Terminology and classification of Quercus trichomes. pedunculiflora Iran: Kurdistan, Baneh-Marivan, Shipaneh-jow, Pirsharif cemetery, 1598 m, Panahi and Pourhashemi 91401 (TARI) Iran: Kurdistan, Baneh-Marivan, Bayan-darreh village, Sheikh musa cemetery, 1736 m, Panahi and Pourhashemi 91401 (TARI) Iran: West Azerbaijan, Urmia, Bardeh- sou, Silvana, Sabeti 30992 (TARI) Transcaucasia, Azerbaijania, dist Keessary, Flora of Ussr, Menitsky (TARI) Q. cedrorum Iran: West Azerbaijan, Mirabad, Molla Allah cemetery, 1425 m, Panahi and Pourhashemi 95052 (TARI) Iran: West Azerbaijan, Sardasht, Djavanchir, No number (NRF) Iran: West Azerbaijan, Mirabad, Khedr-abad village, 1290 m, Panahi and Pourhashemi 95098 (TARI) Q. infectoria subsp. keywords: boissieri; fig; infectoria subsp; iran; number; q. infectoria; quercus; rays; species; stomata; subsp; surface; trichomes; var cache: abc-434.pdf plain text: abc-434.txt item: #288 of 390 id: abc-436 author: Sevik, Mehmet Ali title: Natural occurrence of Cucumber mosaic virus infecting water mint (Mentha aquatica) in Antalya and Konya, Turkey date: 2012-03-30 words: 2920 flesch: 62 summary: Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. Plant viruses detected in horticultural crops in the GAP region (in Turish). keywords: cmv; cucumber; mint; mosaic; plants; virus cache: abc-436.pdf plain text: abc-436.txt item: #289 of 390 id: abc-439 author: Kremer, Dario; Randic, Marko; Kosalec, Ivan; Brkljacic, Ana; Lukac, Gordan; Krusic, Irena; Ballian, Dalibor; Bogunic, Faruk; Karlovic, Ksenija title: New localities of the subendemic species Berberis croatica, Teucrium arduini and Micromeria croatica in the Dinaric Alps date: 2011-10-05 words: 5959 flesch: 67 summary: Teucrium arduini L. is a semi-woody plant from the Lamiaceae family with erect or as- cending stems, ovate leaves and dense inflorescences with small whitish flowers. and habitat conditions, this population of Berberis L. connects the B. croatica population on Vi{evica with B. vulgaris population in Li~ko polje. keywords: a.s.l; arduini; berberis; croatica; habitat; micromeria; plants; rocks; species; teucrium cache: abc-439.pdf plain text: abc-439.txt item: #290 of 390 id: abc-441 author: Cseresnyes, Imre; Szecsy, Orsolya; Csontos, Peter title: Fire risk in Austrian pine (Pinus nigra) plantations under various temperature and wind conditions date: 2011-10-05 words: 4815 flesch: 68 summary: The dryness of the litter and the vegetation has a considerable influence on the scale of fire risk, such that the frequency and scale of forest fires increase during dry years (VIEGAS et al. 1990, 1992, GRANSTRÖM 1993, SWETNAM 1993). That the fre- quency of forest fires has been increasing in recent decades was demonstrated world-wide (NIKLASSON and GRANSTRÖM 2000, HARTLEY 2002, PALIK et al. 2002, MUZY et al. 2008). keywords: age; drought; fire; forest; fuel; ros; temperature; wind; years cache: abc-441.pdf plain text: abc-441.txt item: #291 of 390 id: abc-457 author: Dakskobler, Igor; Seliskar, Andrej; Vres, Branko title: Southeastern-Alpine endemic Leontodon hispidus subsp. brumatii (Cichoriaceae) in the Sava valley (central Slovenia) date: 2012-03-30 words: 13256 flesch: 75 summary: hispidus E1 . brumatii E1 + 2 2 2 2 2 2 2 3 2 2 2 2 1 + 15 100 M Brachythecium rutabulum E0 . keywords: acta; al.ps; alpine; bot; botan; botanica\acta; brumatii; color; composite; croat; dakskobler; dakskobler_verzija-10.vp; degrees; endemic; hispidus; leontodon; lpi; number; profile; relevé; sava; slovenia; species; subsp; ujak; valley; vre cache: abc-457.pdf plain text: abc-457.txt item: #292 of 390 id: abc-463 author: Barath, Kornel; Csiky, Janos title: Host range and host choice of Cuscuta species in Hungary date: 2012-10-10 words: 6003 flesch: 65 summary: In the cases of C. epithymum and C. campestris they found that the number of host species was positively correlated with the size of the parasites. BABINGTON, C. C., 1843: keywords: baráth; cuscuta; cuscuta species; dodders; epithymum; europaea; host; host species; hungarian; plants; species cache: abc-463.pdf plain text: abc-463.txt item: #293 of 390 id: abc-464 author: Lengyel, Attila; Purger, Dragica; Csiky, Janos title: Classification of mesic grasslands and their transitions of South Transdanubia (Hungary) date: 2012-03-30 words: 7710 flesch: 56 summary: Meadow associations of the Kõszeg Mts. and Kõszeg-hegyalja. It is also worth mentioning that Pastinaco–Arrhenatheretum is characterised by generalist meadow species, which are common on drying wet meadows and other dynamic types, thus the species composition of Pastinaco–Arrhenatheretum can easily appear on various sites. keywords: acta; arrhenatheretum; classification; composite; group; hungarian; hungary; lengyel; meadows; nutrient; relevés; species; stands; values; vegetation cache: abc-464.pdf plain text: abc-464.txt item: #294 of 390 id: abc-467 author: Joshi, Seema V.; Patel, Neha T.; Pandey, Indu B.; Pandey, Amar Nath title: Effect of supplemental Ca2+ on NaCl-stressed castor plants (Ricinus communis L.) date: 2012-03-30 words: 9651 flesch: 69 summary: Salinity significantly retarded seed germination and plant growth, but the deleterious effects of NaCl on seed germination were ameliorated and plant growth was restored with Ca2+ supply at the critical level (1:0.25 Na+/Ca2+ ratio) to salinised soil. In addition, ionic toxicity and many nutrient interactions in salt-stressed plants can reduce plant growth or damage the plants (MARSCHNER 1995, TAIZ and ZEIGER 2006). keywords: ca2; content; growth; na+/ca2; plant; ratio; roots; salinity; soil; tissues; water cache: abc-467.pdf plain text: abc-467.txt item: #295 of 390 id: abc-468 author: Ruscic, Mirko; Nikolic, Toni title: Ammi visnaga (L.) Lam. (Apiaceae), a new taxon in Croatian flora date: 2011-10-05 words: 2073 flesch: 65 summary: Key words: Ammi visnaga, flora, neophyte, island Bra~, Croatia Introduction The genus Ammi L. (Apiaceae) contains about 25 species. During floristic investigation of the island of Bra~ (central Dalmatia) a new taxon for Croatian flora, Ammi visnaga (L.) Lam. keywords: ammi; croatian; flora; species; visnaga cache: abc-468.pdf plain text: abc-468.txt item: #296 of 390 id: abc-469 author: Pavokovic, Dubravko; Krsnik-Rasol, Marijana title: Protein glycosylation in sugar beet cell line can be influenced by DNA hyper- and hypomethylating agents date: 2012-03-30 words: 5192 flesch: 54 summary: However, it is not known whether using agents that change the DNA methylation level in plant cells will change protein glycosylation, as it does in animal cells. This suggested that hypermethylation and hypomethylation of genomic DNA in sugar beet cells affect protein glycosylation patterns and cellular meta- bolism, possibly in a mechanism similar to that existing in animal cells. keywords: 2,4; activity; beet; cells; changes; dna; glycosylation; methylation; plant; protein; sugar cache: abc-469.pdf plain text: abc-469.txt item: #297 of 390 id: abc-474 author: Kakde, Umesh B.; Kakde, Hemalata U. title: Incidence of post-harvest disease and airborne fungal spores in a vegetable market date: 2012-03-30 words: 4672 flesch: 56 summary: Samples of fresh as well as previously infected or rotten vegetables (cabbage, beans, onion, potato, tomato) were collected in pre-sterilized polythene bags from the same mar- ket to examine post-harvest fungi. Bioaerosols in market environments may have some implications for the health of the people working in there. keywords: air; alternaria; aspergillus; cladosporium; fungal; fungi; fusarium; kakde; market; penicillium; species; spores; vegetables cache: abc-474.pdf plain text: abc-474.txt item: #298 of 390 id: abc-481 author: Harris, D James; Faria, Miguel A.; Visnevchi - Necrasov, Tatiana; Tavares De Sousa, Manuel; Nunes, Eugenia title: The correct phylogenetic position of Lotus conimbricensis Brot. (Leguminosae, Loteae) based on nuclear ribosomal ITS sequences date: 2012-03-30 words: 3003 flesch: 55 summary: The aim of this study was to sequence several individuals of both L. subbiflorus and L. conimbricensis to resolve their phylogenetic relationship, and to look for some other possi- ble examples of discordance in previous studies by examination of sequence data available for different Lotus species. Crit- ical reexamination of previously published data indicates that several other similar errors may exist for other Lotus species, and these should be checked before taxonomic conclu- sions are made. keywords: conimbricensis; lotus; sequences; species; subbiflorus cache: abc-481.pdf plain text: abc-481.txt item: #299 of 390 id: abc-484 author: Kovacic, Sanja; Stamenkovic, Vanja Nikola title: First National Week of Croatian Botanical Gardens and Arboreta (May 30 – June 4, 2011) date: 2011-10-05 words: 1389 flesch: 52 summary: The First National Week of Croatian Botanical Gardens and Arboreta, organized at 12 locations, was visited by more than two thousand people. U:\ACTA BOTANICA\Acta-Botan 2-11\social news Kovacic.vp 15. rujan 2011 11:53:27 Color profile: Disabled Composite 150 lpi at 45 degrees The next National Week of Croatian Botanical Gardens and Arboreta will be organised from Monday 14th to Saturday 19th of May, 2012. keywords: arboreta; botanical; croatian; gardens cache: abc-484.pdf plain text: abc-484.txt item: #300 of 390 id: abc-487 author: Priyadharsini, Perumalsamy; Pandey, Radha Raman; Muthukumar, Thangavelu title: Arbuscular mycorrhizal and dark septate fungal associations in shallot (Allium cepa L. var. aggregatum) under conventional agriculture date: 2012-03-30 words: 8197 flesch: 64 summary: Aseptate inter or intracellular, linear or coiled fungal hyphae accompanied with arbuscules or arbusculate coils were used to designate AMF colonization. AMF colonization was characterized by the formation of an appresso- rium on the root surface (Fig. 1a). keywords: amf; colonization; dse; et al; fields; fungi; mycorrhizal; onion; root; soil; spore cache: abc-487.pdf plain text: abc-487.txt item: #301 of 390 id: abc-488 author: Cseresnyes, Imre; Csontos, Peter title: Soil seed bank of the invasive Robinia pseudoacacia in planted Pinus nigra stands date: 2012-10-04 words: 5065 flesch: 65 summary: If this applies for black locust, then the ratio of viable seeds in the lower soil layer compared to the total amount of soil seed bank should be increased under older tree individuals. Average densities of soil seed bank in the upper (0–6 cm) and lower (6–12 cm) soil layers under Robinia pseudoacacia trees growing in Pinus nigra stands, in Hungary. keywords: bank; density; layer; locust; pine; pseudoacacia; robinia; seed; seed bank; soil; stands; tree cache: abc-488.pdf plain text: abc-488.txt item: #302 of 390 id: abc-498 author: Thangavelu, Muthukumar; Prabha, Kandasamy title: Fungal associations in gametophytes and young sporophytic roots of the fern Nephrolepis exaltata date: 2012-03-30 words: 3090 flesch: 55 summary: Abstract – Information is limited on the presence of endophytic fungal associations in green gametophytes and young sporophytes of extant ferns. We screened chlorophyl- lous gametophytes and young sporophytes of Nephrolepis exaltata (L.) Schott., (Loma- riopsidaceae, Polypodiales) growing naturally on soil, brick and coir for the presence of fungal endophytes. keywords: exaltata; fern; fungal; gametophytes; roots; septate; sporophytes cache: abc-498.pdf plain text: abc-498.txt item: #303 of 390 id: abc-499 author: Gutermann, Walter title: A note on Pteris vittata L. (Pteridaceae) in Montenegro date: 2012-10-04 words: 1192 flesch: 62 summary: Croat. 71 (2), 371–374, 2012 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Short communication A note on Pteris vittata L. (Pteridaceae) in Montenegro WALTER GUTERMANN* Department of Biogeography, Faculty Centre of Biodiversity, University of Vienna, Rennweg 14, A-1030 Vienna, Austria Abstract – Pteris vittata, formerly doubtfully indicated for Dalmatia, is recorded for Montenegro based on a hitherto disregarded collection preserved in the Vienna University herbarium. Repertorium specierum novarum regni vegetabilis 30, 1, 1–1193. HOOKER, W. J., 1858: keywords: flora; herbarium; pteris; university cache: abc-499.pdf plain text: abc-499.txt item: #304 of 390 id: abc-50 author: Heneidy, Selim Z.; Halmy, Marwa Waseem title: The nutritive value and role of Panicum turgidum Forssk. in the arid ecosystems of the Egyptian desert date: 2009-10-21 words: 8462 flesch: 61 summary: Description of the sampling sites from which P. turgidum populations were collected, the relative accessibility of the above-ground parts and the relative abundance of P. turgidum in each site (*cc= very common, c; common). In the pres- ent study, Ca/P ratio ranged from 3.36 in P. turgidum populations collected from Wady El-Natrun to 5.71 in those of South Sinai; this low Ca/P ratio gives a further reason for the introduction of P. turgidum as a natural forage plant in the western Mediterranean region. keywords: coastal; content; desert; energy; populations; protein; regions; sandy; soil; tab; turgidum; value; variation cache: abc-50.pdf plain text: abc-50.txt item: #305 of 390 id: abc-507 author: Kasom, Gordana; Karadelev, Mitko title: Survey of the family Russulaceae (Agaricomycetes, Fungi) in Montenegro date: 2012-10-04 words: 4082 flesch: 83 summary: Exs.: M.N.F. Material examined: 20 July 2009, Mt Hajla, forest of Picea abies, M.N.F. 35/09. Russula amoena Quél. Ref.: HAD@I] (1995: 22), PERI] and PERI] (1995b: 63, 1996a: 154, 1997a: 62, 1998b: 75). = Russula cutefracta Cooke (1) Ref.: HAD@I] (1995: 22 (1) ()), KARAD@I] (1995: 122–123), PERI] and PERI] (1995a: 38–39, 1995b: 63, 1996a: 154, 1996c: 73, 1997a: 62, 1998b: 75, 1999a: 92, 1999b: 52, 2000: 110–111, 2002: 138,?: 38–39), PERI] et al. (2000: 159), KASOM (2004: 25). keywords: exs; f.m.m.c; had@i; kasom; lactarius; m.n.f; montenegro; peri; ref; russula cache: abc-507.pdf plain text: abc-507.txt item: #306 of 390 id: abc-510 author: Filibeck, Goffredo; Cornelini, Paolo; Petrella, Paolo title: Floristic analysis of a high-speed railway embankment in a Mediterranean landscape date: 2012-10-10 words: 8313 flesch: 53 summary: Gray T Eurasiatic Vicia hybrida L. T Euri-Mediterranean Vicia lutea L. T Euri-Mediterranean St Vicia sativa L. T Medit.-Turanic et Th. T Atlantic T-Brom Geranium dissectum L. T Eurasiatic St Geranium molle L. T Eurasiatic St Geranium robertianum L. T Cosmopolitan St Hedera helix L. P Euri-Mediterranean Q-F Hedysarum coronarium L. H Steno-Mediterranean Heliotropium europaeum L. T Euri-Mediterranean St Holcus lanatus L. H Circumboreal M-A Hypericum perforatum L. H Eurasiatic T-G Hypochoeris achyrophorus L. T Steno-Mediterranean Hg Hypochoeris glabra L. T Euri-Mediterranean Hypochoeris radicata L. H Eurasiatic F-B Inula conyza DC. keywords: acta; alien; bot; brom; communities; cornelini; cosmopolitan; croat; element; embankment; eurasiatic; euri; flora; h(b; l. h; l. p; l. t; lazio; mediterranean; plant; railway; species; speed; steno; t euri; vegetation cache: abc-510.pdf plain text: abc-510.txt item: #307 of 390 id: abc-511 author: Keresztes, Aron title: Plant Cell Compartments - Selected Topics. B. Schoefs (ed.) 2008. Research Signpost (Kerala, India). date: 2012-03-30 words: 1006 flesch: 51 summary: Rather than offering a classical systematic coverage of plant cell compartments, this book includes chapters focused on emerging, debated, or new areas. The next chapter (»Cell wall changes during strawberry fruit ripening«, by G. A. Marti- nez) describes an applied and rather specific study about the highly dynamic changes that plant cell walls can undergo during fruit maturation. keywords: cell; plant; review cache: abc-511.pdf plain text: abc-511.txt item: #308 of 390 id: abc-529 author: Muhamad, Zia-Ul-Haq; Cavar, Sanja; Qayum, Mughal; Khan, Inamullah; Ahmad, Shakeel title: Chemical composition and antioxidant potential of Acacia leucophloea Roxb. date: 2013-04-10 words: 5580 flesch: 58 summary: Extraction The plant material (Acacia leucophloea seeds, leaves, flower and pods) was air-dried in shade and crushed to coarse powder separately with help of pestle and mortar. Food Science and Nutrition 42, 213–221. RUBANZA, C. D. K., SHEM, M. N., BAKENGESA, S. S., ICHINOHE, T., FUJIHARA, T., 2007: keywords: acacia; acid; antioxidant; haq; haq et; leucophloea; pods; profile; zia cache: abc-529.pdf plain text: abc-529.txt item: #309 of 390 id: abc-533 author: Chen, Xu; Yang, Xiangdong; Dong, Xuhui; Liu, Enfeng title: Influence of environmental and spatial factors on the distribution of surface sediment diatoms in Chaohu Lake, southeast China date: 2012-10-04 words: 4344 flesch: 54 summary: The original coordi- nate values were z-score transformed and these standard coordinates were used to create the dataset of spatial variables derived from PCNM using the program Spacemaker2 (BORCARD and LEGENDRE 2004). Spatial variables PCNM1 and PCNM2 were calculated and both of them were included in the later analysis. keywords: analysis; diatom; distribution; lake; sediment; species; surface; variables cache: abc-533.pdf plain text: abc-533.txt item: #310 of 390 id: abc-534 author: El-Sheikh, Mohamed abd El-Raouf title: Population structure of woody plants in the arid cloud forests of Dhofar, southern Oman date: 2013-04-10 words: 7177 flesch: 59 summary: This type of study can provide a basis for the development of a management plan to support the conservation and sustainable use of forest vegetation in an arid region. In cloud forests, for example, cloud condensation in fog-affected escarpment mountain slopes and fog precipitation during the summer season create a niche for moist woodland vegetation within the surrounding desert. keywords: acacia; bed; cloud; dhofar; distribution; forest; hill; oman; plant; population; profile; size; species; trees; vegetation; wadi cache: abc-534.pdf plain text: abc-534.txt item: #311 of 390 id: abc-536 author: Spoljar, Marija; Fressl, Jelena; Drazina, Tvrtko; Meseljevic, Matija; Grcic, Zlatko title: Epiphytic metazoans on emergent macrophytes in oxbow lakes of the Krapina River, Croatia: differences related to plant species and limnological conditions date: 2012-03-30 words: 6196 flesch: 55 summary: Results of correlations suggested decreasing AFDMe amount at higher epiphytic metazoan density and diversity, especially caused by higher rotifers density. Mean densities (mean ± SD, nI1,I2,M2=24) of epiphytic metazoans at different habitats I1, I2 and M2. I1 (Ind g–1 DM) I2 (Ind g–1 DM) M2 (Ind g–1 DM) Group Taxa Mean SD Mean SD Mean SD Cladocera Acroperus elongatus (Sars, 1862) 0.2 ± 1 1 ± 4 Alona costata Sars, 1862 38 ± 102 2 ± 4 1 ± 3 Alona rectangula Sars, 1862 10 ± 31 Alona weltneri Keilhack, 1905 1 ± 2 1 ± 4 Bosmina longirostris (O. F. Müller, 1776) keywords: 2007; density; epiphytic; epiphyton; et al; iris; lakes; macrophytes; metazoans; poljar; shallow; species; water cache: abc-536.pdf plain text: abc-536.txt item: #312 of 390 id: abc-54 author: Shaltout, Kamal H.; Sheded, Mohamed Gabr; Salem, Ashraf I. title: Vegetation spatial heterogeneity in a hyper arid Biosphere Reserve area in north Africa date: 2010-04-15 words: 7422 flesch: 69 summary: On the other hand, it is also a diagnostic study to evaluate the recent situation of Wadi Allaqi vegetation in comparison with the previous studies (e.g. SPRINGUEL et al. 1991, ALI et al. 1997). Biological spectrum of Wadi Allaqi vegetation. keywords: 0.0; acacia; allaqi; cluster; desert; egypt; si+s; species; tortilis; vegetation; wadi; z+sa cache: abc-54.pdf plain text: abc-54.txt item: #313 of 390 id: abc-540 author: Kiss, Keve; Klee, Rolf; Ector, Luc; Acs, Eva title: Centric diatoms of large rivers and tributaries in Hungary: morphology and biogeographic distribution date: 2012-10-04 words: 19647 flesch: 65 summary: The external pores of valve face fultoportulae are situated mainly on the elevated part of the undulation (Fig. 6 D). The number of valve face fultoportulae varies between 3 and 22. keywords: acta; areolae; bot; croat; cyclotella; diameter; diatoms; fig; fultoportulae; hungarian; kiss; mantle; marginal; pores; rivers; running; satellite; species; stephanodiscus; valve; valve face; view; waters cache: abc-540.pdf plain text: abc-540.txt item: #314 of 390 id: abc-542 author: Nikolova, Milena; Petrova, Mariya; Zayova, Ely; Vitkova, Antonina; Evstatieva, Ljuba title: Comparative study of in vitro, ex vitro and in vivo grown plants of Arnica montana - polyphenols and free radical scavenging activity date: 2013-04-10 words: 5077 flesch: 58 summary: The amount of flavonoids in plant extracts in rutin equivalents (RE) was calculated by the following formula: C = Absample × mcontrol × 10 / Abcontrol × msample where C is flavonoid content (mg g–1 plant extract) in RE; Absample is the absorption of plant extract solution; Abcontrol is the absorption of standard rutin solution; msample is the weight of plant extract in grams; mcontrol is the weight of rutin in the solution in grams. Plant extracts were diluted to a concentration of 1 mg mL–1, and aliquots of 0.5 mL were mixed with 2.5 mL of Folin–Ciocalteu reagent (previously diluted 10-fold with distilled wa- ter) and 2 mL of Na2CO3 (6%). keywords: activity; content; extracts; flavonoids; montana; nikolova; plants; samples; vitro; vivo cache: abc-542.pdf plain text: abc-542.txt item: #315 of 390 id: abc-543 author: Chikov, Vladimir I; Isaeva, Elvira V; Ratushnyak, Anna A; Tarasov, Oleg Yu; Trushin, Maxim V title: Changes of photosynthesis and carbon metabolism in Typha angustifolia L grown in conditions of nitrate nitrogen overload date: 2012-10-04 words: 3165 flesch: 52 summary: Results It was revealed that T. angustifolia plants showed an activation of production processes under conditions of nitrate overload. Interestingly, increase of nitrate (a basic substrate of inorganic nitrogen for plants) concentration did not result in elevated synthesis of amino acids: previous studies showed that nitrate increases the amount of 14C within amino acids in experiments with terrestrial (BATASHEVA et al. 2007, KHAMIDULLINA et al. 2011) and aquatic plants (RATUSHNYAK et al. 2010). keywords: angustifolia; nitrate; nitrogen; plants; ratushnyak cache: abc-543.pdf plain text: abc-543.txt item: #316 of 390 id: abc-544 author: Vizintin, Liliana; Kosovel, Vera; Feoli Chiapella, Laura; Bohanec, Borut title: Genetic characterization of Genista sericea Wulfen (Cytiseae - Fabaceae) as revealed by nuclear DNA content and ITS nrDNA region analysis date: 2012-10-04 words: 4518 flesch: 64 summary: G. sericea var. sericea, collected at Opicina and Monrupino (Trieste – Italy) and G. sericea var. Staining method Taxon Accession No. plant Average 2C (pg) ± SD PI staining G. sericea var. keywords: accessions; content; dna; feoli; genista; italy; rigida; sericea; sericea var; species; var cache: abc-544.pdf plain text: abc-544.txt item: #317 of 390 id: abc-545 author: Bozac, Romano; Siric, Ivan; Kos, Ivica title: Tuber donnagotto, a new winter truffle species from Istria, Croatia date: 2012-10-04 words: 2599 flesch: 63 summary: Tuber donnagotto is substantially different from all known species of black truffles. [IRI]*, IVICA KOS University of Zagreb Faculty of Agriculture, Sveto{imunska 25, 10000 Zagreb, Croatia Abstract – Tuber donnagotto is a new winter black truffle belonging to the order Pezizales and the family Tuberaceae. keywords: bodies; donnagotto; fruit; species; truffles; tuber cache: abc-545.pdf plain text: abc-545.txt item: #318 of 390 id: abc-546 author: Dragicevic, Snezana; Papp, Beata; Erzberger, Peter title: Distribution of Buxbaumia viridis (Moug. ex Lam. et DC.) Brid. ex Moug. et Nestl. (Bryophyta) in Montenegro date: 2012-10-10 words: 2127 flesch: 70 summary: It includes 8 mountainous regions: the Bjelasica Mts, Durmitor Mts, Hajla Mts, Komovi Mts, Ljubi{nja (Ku~ki Kom) limestone Alpine, moderate-mediter-ranean IPA extensive scree 5 Ljubi{nja Mts 2238 m (Dernja~i{ta) Limestone and silicate Alpine IPA spruce forest, pastures 6 Prokletije Mts 2528 m keywords: buxbaumia; leg; montenegro; mts; papp; viridis cache: abc-546.pdf plain text: abc-546.txt item: #319 of 390 id: abc-554 author: Surina, Bostjan title: Heaths with dwarf ericaceous shrubs and Alpine juniper (Juniperus alpina) in the Dinaric Alps: A nomenclatorial and synsystematic re-appraisal date: 2013-04-10 words: 11774 flesch: 76 summary: he did publish a synoptic table (Tab. 135, col. 1), which, according to Art. 7 (WEBER et al. 2000), is the first valid publication of a name (Definition III) – Rhododendro hirsuti-Juniperetum alpinae Horvat ex Horvat et al. 1974 nom. Although the identification and circumscription together with synecology and synchorology of the heaths in general are more or less simple and straightforward, their floristic affinities, in relation to structure homogeneity and syndynamics, are complicated, which led to the proposal of several syntaxonomic schemes depending on the interpretation of the relationship of the two aspects, focusing either on the flora (e.g. WALLNÖFER 1993a, 1993b), the structure (e.g. HORVAT 1962, HORVAT et al. 1974, THEURILLAT et al. 1995, STANISCI 1997), or both (POLDINI et al. 2004). keywords: dinaric; e c; e n; et al; horvat; juniperetum; laku{i; nom; profile; s e; stands; surina cache: abc-554.pdf plain text: abc-554.txt item: #320 of 390 id: abc-563 author: Hegazy, Ahmad; Alatar, Abdelrahman A.; Lovett-Doust, Jon; El-Adawy, Hosam A. title: Spatial and temporal plant phenological niche differentiation in the Wadi Degla desert ecosystem (Egypt) date: 2012-10-04 words: 7218 flesch: 55 summary: Adaptive phenology is considered an important reproductive strategy in arid deserts, where many plant species effectively 'escape' from drought in one way or another (WARD 2009). Phenology – environment relationship The environmental variables representing different phenological groups all over the year are shown in table 3. keywords: a. a.; desert; flowering; group; phenological; phenology; plant; populations; rainfall; species; spring; temperature; wadi cache: abc-563.pdf plain text: abc-563.txt item: #321 of 390 id: abc-571 author: Rijal Leblad, Benlahcen; Lundholm, Nina; Goux, Didier; Veron, Benoit; Sagou, Regia; Taleb, Hamid; Nhhala, Hassan; Er-Raioui, Hassan title: Pseudo-nitzschia Peragallo (Bacillariophyceae) diversity and domoic acid accumulation in tuberculate cockles and sweet clams in M’diq Bay, Morocco date: 2013-05-02 words: 5860 flesch: 61 summary: Marine Ecology Progress Series 131, 235–243. PAN, Y., MICHAEL, L. P., MARK, B., MOELLER, P. D. R., QUAY DORTCH, POWELL, C. L., DOUCETTE, G. J., 2001: Pseudo-nitzschia sp. cf. pseudodelicatissima a confirmed pro- ACTA BOT. Key words: Diatoms, domoic acid, phytoplankton, Pseudo-nitzschia, shellfish, Morocco ACTA BOT. keywords: acid; et al; lebland; nitzschia; profile; pseudo; rijal; shellfish; species cache: abc-571.pdf plain text: abc-571.txt item: #322 of 390 id: abc-577 author: Popiela, Agnieszka; Lysko, Andrzej; Molnár V., Attila title: Recent distribution of the Euro-Siberian-sub-Mediterranean species Elatine alsinastrum L. (Elatinaceae) date: 2013-10-10 words: 5062 flesch: 68 summary: et Elatine alsinastrum L. dans le marais de Gannedel (Ille-et-Vilaine). ABCRA 25 ISSN 0365–0588 eISSN 1847-8476 DOI: 10.2478/v10184-012-0022-8 Recent distribution of the Euro-Siberian- sub-Mediterranean species Elatine alsinastrum L. (Elatinaceae) AGNIESZKA POPIELA1*, ANDRZEJ £YSKO2, ATTILA MOLNÁR3 1 Department of Botany and Nature Conservation, University of Szczecin, Felczaka 3c, 71-412 Szczecin, Poland 2 Department of Environmental Protection and Management, Western Pomeranian University of Technology, Szczecin, Poland 3 Department of Botany, University of Debrecen, Egyetem sq. 1, 4032 Hungary Abstract – The general distribution of the endangered Euro-Siberian sub-Mediterranean species Elatine alsinastrum L. is provided using literature, web-sources and herbaria dataset. keywords: acta; alsinastrum; data; des; distribution; elatine; europe; flora; plants; popiela; species cache: abc-577.pdf plain text: abc-577.txt item: #323 of 390 id: abc-579 author: Iamonico, Duilio; Panitsa, Maria title: Lectotypification of the Linnaean name Bryonia cretica (Cucurbitaceae) date: 2013-04-10 words: 1806 flesch: 61 summary: Materials and methods The investigation of the typification of the name B. cretica included all the available literature (LINNAEUS 1738, 1753; ROYEN 1740; BAUHIN 1620, 1623, 1651) as well as research of the Linnaean Herbarium (LINN) and the Clifford Herbarium in BM. Authors’ field data were used for the description of the plant communities in which B. cretica participates while for the habitat types, the codes and description of the European Nature Information System (EUNIS 2012) and those of Annex I of the Council Directive 92/43/EEC (EUR25 2003) were also used. keywords: bryonia; cretica; cucurbitaceae; iamonico cache: abc-579.pdf plain text: abc-579.txt item: #324 of 390 id: abc-582 author: Roy, Nayan; Laskar, Subrata; Barik, Anandamay title: Amino acids through developmental stages of sunflower leaves date: 2013-04-10 words: 5601 flesch: 65 summary: The protein-bound amino acid content, i.e., dicarbo- xylic amino acids and hydroxy amino acids, is higher than free amino acid content through- out the developmental stages of sunflower leaves, whereas monocarboxylic amino acids, aro- matic amino acids, heterocyclic amino acids and sulphur containing amino acids are higher in free amino acids, indicating that the roles of free and protein-bound amino acids are both important in the nutrition of herbivores. Key words: amino acids, Helianthus annuus, sunflower Introduction Studies in plant-insect interactions have mainly concentrated on the effects of insect performance of plant secondary metabolites or nutritive compounds (SCHOONHOVEN et al. 2005). keywords: acids; amino; content; leaf; leaves; protein; roy; senescent; sunflower cache: abc-582.pdf plain text: abc-582.txt item: #325 of 390 id: abc-591 author: Koukoulakis, Prodromos; Chatzissavvidis, Christos; Papadopoulos, Aristotelis; Pontikis, Dimitrios title: Interactions between leaf macro, micronutrients and soil properties in pistachio (Pistacia vera L.) orchards date: 2013-10-10 words: 6984 flesch: 62 summary: Percent elemental contribution values by the interactions among i) soil properties and leaf nutrients, ii) leaf nutrients, iii) soil properties and soil nutrients, and iv) soil nutrients. Studying these results, the following may be concluded: the interactions between soil nutrients and soil properties play a significant role in supplying or decreasing the soil available plant nutrients, and therefore, they determine to a great extent the level of soil fertility. keywords: interactions; leaf; nutrients; pistachio; soil cache: abc-591.pdf plain text: abc-591.txt item: #326 of 390 id: abc-600 author: Grozeva, Neli Hristova; Cvetanova, Yanka G. title: Karyological and morphological variations within the genus Dysphania (Chenopodiaceae) in Bulgaria date: 2013-04-10 words: 9184 flesch: 64 summary: Microphotographs of the metaphase plate of Dysphania species: A – D. multifida (popula- tion Percentage of the interpopulation variation in the overall morphological variation for each character in Dysphania Character No Species D. botrys D. pumilio D. ambrosioides D. multifida 1 37.7 30.1 66.0 43.2 2 29.2 45.7 47.7 29.2 3 65.1 47.6 43.4 64.5 4 46.4 70.9 38.1 49.9 5 69.1 32.2 48.0 keywords: botrys; chenopodium; chromosome; cvetanova; dysphania; genus; grozeva; length; populations; profile; species cache: abc-600.pdf plain text: abc-600.txt item: #327 of 390 id: abc-603 author: Erdos, Laszlo; Zalatnai, Marta; Batori, Zoltan; Kormoczi, Laszlo title: Transitions between community complexes: a case study analysing gradients through mountain ridges in South Hungary date: 2014-04-17 words: 6586 flesch: 63 summary: On the establishment of plant community boundaries. In the profile, vegetation boundaries appear as peaks. keywords: boundaries; case; community; erdos; msw; peaks; profile; species; transitional; vegetation; widths; window cache: abc-603.pdf plain text: abc-603.txt item: #328 of 390 id: abc-608 author: Kosir, Petra; Carni, Andraz; Marinsek, Aleksander; Silc, Urban title: Floodplain forest communities along the Mura River (NE Slovenia) date: 2013-04-10 words: 16243 flesch: 99 summary: On the basis of 58 relevés of floodplain forests along the Mura River, the classification of vegetation plots was performed with the Pc-Ord program. Therefore floodplain forests, according to the Habitat Directive, belong among the habitats of the greatest importance for nature protection on the European scale. keywords: floodplain; forests; kosir; mura; profile; river; species; stream cache: abc-608.pdf plain text: abc-608.txt item: #329 of 390 id: abc-611 author: Siddiqui, Zamin Shaheed title: Effects of double stress on antioxidant enzyme activity in Vigna radiata (L.) Wilczek date: 2013-04-10 words: 5485 flesch: 59 summary: KeyWord: Antioxidant, catalase, enzyme activity, glutathione reductase, guaiacol per- oxidase, scorbate peroxidase, seedling, stress, superoxide dismutase, Vigna radiata Abbreviations: APX – ascorbate peroxidase, CAT – catalase, GPX – guaiacol peroxidase, GR – glutathione reductase, ROS – reactive oxygen species, SOD – superoxide dismutase Introduction Environmental stress factors like drought, temperature, high salinity and heavy metals are the major constraint that limit plant growth and productivity, by disturbing the intra- cellular water balance. Iron deficiency Induced changes in ascorbate content and enzyme activities related to ascorbate metabolism in cucumber root. keywords: activities; activity; antioxidant; environment; enzyme; lead; nacl; peroxidase; stress cache: abc-611.pdf plain text: abc-611.txt item: #330 of 390 id: abc-625 author: Pise, Navnath M.; Gaikwad, Dattatry K.; Jagtap, Tanaji G. title: Oxidative stress and antioxidant indices of marine alga Porphyra vietnamensis date: 2013-10-10 words: 5008 flesch: 52 summary: Journal of Phycology 32, 197–211. DAZY, M., MASFARAUD, J. F., FERARD, J. F., 2009: Induction of oxidative stress biomarkers associated with heavy metal stress in Fontinalis antipyretica Hedw. The alphabetical letters (a, b, c) mark significant difference at p < 0.05. Antioxidant defence systems In the present study, CAT activity was significantly higher in the sample from Dona Paula and Malvan, further indicating metal stress increasing the formation rate of H2O2 (Fig. 2B). keywords: antioxidant; dona; h2o2; marine; metal; paula; stress; vietnamensis cache: abc-625.pdf plain text: abc-625.txt item: #331 of 390 id: abc-626 author: Kaya, Cengiz; Aydemir, Salih; Sonmez, Osman; Ashraf, Muhammed; Dikilitas, Murat title: Regulation of growth and some key physiological processes in salt-stressed maize (Zea mays L.) plants by exogenous application of asparagine and glycerol date: 2013-04-10 words: 6642 flesch: 59 summary: Biotechnological approach of improving plant salt tolerance using anti- oxidants as markers. Glycerol was more effective than aspara- gine in improving salinity tolerance of maize plants in terms of growth and physiological attributes measured in the present study. keywords: asparagine; glycerol; growth; kaya; maize; plants; profile; salt; stress cache: abc-626.pdf plain text: abc-626.txt item: #332 of 390 id: abc-635 author: Kabas, Eva; Alegro, Antun; Kuzmanovic, Nevena; Jakovljevic, Ksenija; Vukojicic, Snezana; Lakusic, Dmitar title: Stipetum novakii ass. nova – a new association of serpentine rocky grassland vegetation (Halacsyetalia sendtneri) in Serbia date: 2013-04-10 words: 7257 flesch: 70 summary: However, such a situation enables the development of a certain number of endemic serpentine species such as Stipa novakii, Halacsya sendtneri (Boiss.) Abstract – Phytosociological characteristics of grassland communities above serpentines (order Halacsyetalia sendtneri H. Ritter-Studni~ka 1970) in Serbia, are analyzed accord- ing to Braun-Blanquet methodology. keywords: community; kabas; novakii; profile; s u; serpentine; species; vegetation cache: abc-635.pdf plain text: abc-635.txt item: #333 of 390 id: abc-642 author: Saini, Ramesh K; Akitha Devi, Muthu K; Parvatam, Giridhar; Ravishankar, Gokare A title: Augmentation of major isoflavones in Glycine max L. through elicitor mediated approach date: 2013-10-10 words: 5687 flesch: 56 summary: Abstract – Isoflavone content in soybean seeds was enhanced by the elicitor-mediated ap- proach under field conditions through the floral application of abiotic elicitors-salicylic acid, methyl jasmonate and biotic elicitors-Aspergillus niger and Rhizopus oligosporus. Isoflavone content in soybean seeds (and other soybean tissues) is influenced by biotic and abiotic factors including physical and chemical damages, UV light, low tem- perature, wounding, pathogens and plant microbe interactions as well as elicitor treatment (WEGULO et al. 2005, CALDWELL et al. 2005, ZHANG et al. 2006, PHOMMALTH et al. 2008). keywords: content; et al; food; isoflavone; journal; plant; seeds; soybean cache: abc-642.pdf plain text: abc-642.txt item: #334 of 390 id: abc-647 author: Vukovic, Nina; Tommasoni, Annalisa; D’Onofrio, Tancredi title: The orchid Ophrys speculum Link (Orchidaceae) in Croatia date: 2013-04-10 words: 2860 flesch: 67 summary: Since the plant-pollinator relationship is highly species-specific in the case of Ophrys orchids (PAULUS 2007), the absence or scarce presence of the wasp in the range of Ophrys speculum could prevent or seriously reduce the ability of the orchid to reproduce and therefore close its life-cycle. Keywords: Ophrys speculum, orchid, Rt Kamenjak, Istria, Croatia Introduction In Croatian flora the genus Ophrys is present with 67 taxa, the largest genus in terms of number of taxa from the Orchidaceae family (HR[AK 2000, BOGDANOVI] 2004, NIKOLI] 2012). keywords: croatia; delforge; flora; ophrys; profile; species; speculum; vukovic cache: abc-647.pdf plain text: abc-647.txt item: #335 of 390 id: abc-677 author: Di Pietro, Romeo; Wagensommer, Robert Philipp title: A new Sesleria juncifolia association from south-eastern Italy and its position in the amphi-Adriatic biogeographical context date: 2014-04-20 words: 15946 flesch: 80 summary: Conclusion The description of Stipo austroitalicae-Seslerietum juncifoliae is a step towards filling a gap in the phytosociological knowledge of the Apulian vegetational pattern and in defining the syntaxonomical and distributional framework of Sesleria juncifolia communities in Peninsular Italy. Due to the relict and scattered distribution of Sesleria juncifolia in Apulia region, the variances in species composition amongst the different subassociations are mainly influenced by local factors. keywords: communities; e n; e r; gargano; grasslands; italy; juncifolia; o t; pietro; profile; r o; s o; sesleria; seslerietum; southern; species; stipo; subsp cache: abc-677.pdf plain text: abc-677.txt item: #336 of 390 id: abc-681 author: Perrone, Rosaria; De Rosa, Paolo; De Castro, Olga; Colombo, Paolo title: Leaf and stem anatomy in eight Hypericum species (Clusiaceae) date: 2013-10-10 words: 7410 flesch: 56 summary: H. tetrapterum; G – adaxial surface with isodiametric cells and wide elongated depressions of various shapes; H – abaxial surface with depressions and several anisocytic stomatal complexes (scale bars 100 mm). Stem anatomy From a morphological point of view the stem presents: in hemicryptophyte scapose spe- cies, lignified and prostrate at the base, briefly creeping, in H. perforatum and H. perfo- liatum respectively; lignified creeping with ascending branches in H. pubescens; prostrate then erect, ligneous in H. tetrapterum and H. triquetrifolium, in the latter strongly branching (PIGNATTI 1982). keywords: cells; fig; hypericum; leaf; perforatum; scale; secretory; species; stem; stomata; surface; type cache: abc-681.pdf plain text: abc-681.txt item: #337 of 390 id: abc-692 author: Luca, Alessia; Belusci, Francesca; Pellegrino, Giuseppe title: Interactions with mycorrhizal fungi in two closely related hybridizing orchid species date: 2014-04-20 words: 5636 flesch: 57 summary: First, 75% of mycorrhizal fungi identified belong to Tulasnellaceae, a large, common group of orchid mycorrhizal fungi that have already been recorded in O. anthropophora and O. italica (JACQUEMYN et al. 2011b). Physiology and ecology of orchid mycorrhizal fungi with reference to seedling nutrition. keywords: anthropophora; et al; fungi; italica; luca; mycorrhizal; orchis; profile; species cache: abc-692.pdf plain text: abc-692.txt item: #338 of 390 id: abc-700 author: Kalinka, Anna; Misfud, Stephen; Popiela, Agnieszka; Achrem, Magdalena title: Chromosome number of Elatine gussonei (Sommier) Brullo (Elatinaceae) and its distribution on the Maltese islands date: 2014-04-20 words: 2773 flesch: 66 summary: Key words: Elatine gussonei, chromosome number, phytogeography Introduction Elatinaceae Dum. is a small cosmopolitan family of herbaceous aquatic and semi-aqua- tic plants and terrestrial shrubs composed of two genera, i.e. Elatine L., comprising about 15–20 taxa, and occurring in areas of moderate temperatures in both hemispheres, and Bergia L., with about 25 species occurring mostly in tropical areas of the Old World, primarily in Africa, and also in Australia (TUCKER 1986, LEACH 1989). The number of chromosomes in Elatine gussonei was not previously reported, in contrast to the unequivocal results of chromosome number for other species of the Elatine genus. keywords: chromosome; elatine; gussonei; kalinka; number; sommier cache: abc-700.pdf plain text: abc-700.txt item: #339 of 390 id: abc-701 author: Besendorfer, Visnja; Mlinarec, Jelena title: Retention of relict satellite DNA sequences in Anemone (Ranunculaceae) date: 2013-04-10 words: 5167 flesch: 57 summary: Taxonomic revision, phy- logenetics and transcontinental distribution of Anemone section Anemone (Ranuncula- ceae). Anemone species were considered favourable plant material in cytogenetic studies be- cause of chromosomal polymorphism, different ploidy levels, as well as variation in DNA content among species (BÖCHNER 1945, HEIMBURGER 1959, ROTHFELS et al. 1966, BAUM- BERGER 1970, MLINAREC et al. 2006, MLINAREC et al. 2012a, MLINAREC et al. 2012b). keywords: ahtr1; anemone; besendorfer; blanda; dna; hortensis; mlinarec; pavonina; profile; satdna; satellite; sequences; species cache: abc-701.pdf plain text: abc-701.txt item: #340 of 390 id: abc-703 author: Hayat, Shamsul; Hayat, Qaiser; Alyemeni, Mohammed Naseer; Ahmad, Aquil title: Proline enhances antioxidative enzyme activity, photosynthesis and yield of Cicer arietinum L. exposed to cadmium stress date: 2013-10-10 words: 5054 flesch: 61 summary: The foliar treatment of proline resulted in the alleviation of the adverse effects generated by metal exposure, which was expressed in terms of the increase in plant growth. All the parameters studied followed a similar trend at both the sampling stages; however, the magnitude of the data for these parameters was higher at 90 DAS, and therefore, the data obtained at this stage of plant growth are presented in the present study. keywords: cadmium; control; hayat; plants; proline; soil cache: abc-703.pdf plain text: abc-703.txt item: #341 of 390 id: abc-708 author: Praxedes, Sidney Carlos; DaMatta, Fábio Murillo; Lacerda, Claudivan Feitosa de; Prisco, José Tarquinio; Gomes-Filho, Enéas title: Salt stress tolerance in cowpea is poorly related to the ability to cope with oxidative stress date: 2014-04-17 words: 5182 flesch: 61 summary: We ana- lyzed the long-term effects of salt stress on oxidative damage and protection against reactive oxygen species in both leaves and roots of a salt-tolerant (Pitiúba) and a salt-sensi- tive (TVu) cowpea cultivar. To the best of our knowledge, only two studies have ex- plored the cowpea’s antioxidative responses to salt stress, either by analyzing only leaves (MAIA et al. 2010) or both leaves and roots (CAVALCANTI et al. 2007), though limited to short-term evaluations without consideration of the duration of exposure of the plants to salt stress. keywords: apx; cat; leaves; mda; praxedes; profile; salt; salt stress; stress cache: abc-708.pdf plain text: abc-708.txt item: #342 of 390 id: abc-710 author: Hu, Zhuju; Li, Yanling; Metzeltin, Ditmar title: Three new species of Cymbella (Bacillariophyta) from high altitude lakes, China date: 2013-10-10 words: 5676 flesch: 66 summary: However, they differ from C. heihainensis in the bigger valve size and smaller central area, also in the central pores (roundish shaped vs expanded drop- as in C. heihainensis). The internal view of C. heihainensis and C. shudunensis should be supplemented in future study. keywords: area; areolae; cymbella; fig; krammer; lake; raphe; species; striae; valve cache: abc-710.pdf plain text: abc-710.txt item: #343 of 390 id: abc-722 author: Viljevac, Marija; Dugalic, Krunoslav; Mihaljevic, Ines; Šimic, Domagoj; Sudar, Rezica; Jurkovic, Zorica; Lepeduš, Hrvoje title: Chlorophylls content and photosynthetic efficiency in two sour cherry (Prunus cerasus L.) genotypes under drought stress date: 2013-10-10 words: 6712 flesch: 55 summary: By con- trast, electron transport per active reaction center (ET0/RC) was significantly lowered in drought treatment leaves of genotype Kelleris 16 while the same parameter in drought treat- ment leaves of genotype OS remain unchanged (Fig. 4C). The aim of our study was to select sour cherry genotypes according to their genetic background as well as drought tolerance and investigate possible mechanisms of drought tolerance through the changes in photosynthetic apparatus (i.e. photosynthetic pigment content) and photosynthesis process assessed through the chlorophyll fluorescence transient. keywords: cherry; chlorophyll; control; drought; genotypes; kelleris; leaves; stress; water cache: abc-722.pdf plain text: abc-722.txt item: #344 of 390 id: abc-730 author: Vidakovic-Cifrek, Željka; Soric, Sonja; Babic, Marija title: Growth and photosynthesis of Lemna minor L. exposed to different light conditions and sucrose supplies date: 2013-10-22 words: 4572 flesch: 62 summary: The influence of light spectral distribution and intensity on plant growth rate and photosynthesis was proved a long time ago. Plant growth is dependent not only on the composition of nutrient media but also on chamber conditions – tempera- ture, photoperiod and light quality. keywords: duckweed; g l–1; growth; lemna; light; l–1; mmol; plants; sucrose cache: abc-730.pdf plain text: abc-730.txt item: #345 of 390 id: abc-741 author: Muniappan, Vellaisamy; Muthukumar, Thangavelu title: Influence of crop species and edaphic factors on the distribution and abundance of Trichoderma in Alfisol soils of southern India date: 2014-04-17 words: 7207 flesch: 66 summary: The abundance of soil fungi ranged be- tween 7.0 × 103 and 13.6 × 103 colony forming units (cfus) per gram of dry soil. Compendium of soil fungi. keywords: abundance; factors; fungal; koningii; muniappan; populations; profile; soil; species; trichoderma cache: abc-741.pdf plain text: abc-741.txt item: #346 of 390 id: abc-742 author: Kristkova, Eva; Lebeda, Ales; Novotna, Alzbeta; Dolezalova, Ivana; Berka, Tomas title: Morphological variation of Lactuca serriola L. achenes as a function of their geographic origin date: 2014-04-17 words: 8497 flesch: 59 summary: The first compilation of data on morphological parameters of L. serriola achenes was presented by NOVOTNÁ et al. (2011) where achene parameters from 50 populations of prick- ly lettuce from the Czech Republic, Germany, the Netherlands and the United Kingdom ACTA BOT. NOVOTNÁ et al. (2011) also showed that with increasing latitude, i.e. from south to north, L. serriola achenes were longer, narrower, with fewer ribs, and longer beaks. keywords: achene; body; dispersal; et al; kristkova; lactuca; length; pappus; populations; profile; serriola; slovenia; sweden cache: abc-742.pdf plain text: abc-742.txt item: #347 of 390 id: abc-745 author: Woch, Marcin Wiktor; Radwanska, Magdalena; Stefanowitz, Anna M. title: Vascular flora of spoil heaps after hard coal mining in Trzebinia (S Poland): effect of substratum properties. date: 2013-10-10 words: 8492 flesch: 62 summary: Poa compressa 105 Mx, Cc, D, Hu H R An Poa nemoralis 1 Hu H R An/Zooch Carpinus betulus 2 Hu M R An Cenaturea jacea 63 Mx, D, Hu H R An Cenaturea stoebe 67 Mx, D H R An Chamaecytisus ratisbonensis 3 Mx Ch/N R Zooch Chamaenerion angustifolium 6 D, Hu, Mx H R An Chamomilla recutita 10 Mx, D, Hu, Cc T keywords: acta; area; coal; content; flora; h r; mining; plant; r zooch; soil; species; substratum; total; zooch cache: abc-745.pdf plain text: abc-745.txt item: #348 of 390 id: abc-746 author: Sajna, Nina; Regvar, Marjana; Kaligaric, Simona; Škvorc, Željko; Kaligaric, Mitja; Kaligaric, Mitja title: Germination characteristics of Salicornia patula Duval-Jouve, S. emerici Duval-Jouve, and S. veneta Pign. et Lausi and their occurrence in Croatia date: 2013-10-10 words: 5045 flesch: 59 summary: Cambridge Uni- versity Press, London. BEER, S. S., BEER, A. S., SOKOLOFF, D. D., 2010: Flower and inflorescence development in Salicornia (Chenopodiaceae). c2 = 7.60, df = 2, p = 0.03), herewith confirming the dimorphism of S. patula seeds. keywords: emerici; germination; patula; s. emerici; s. veneta; salicornia; seeds; species; veneta cache: abc-746.pdf plain text: abc-746.txt item: #349 of 390 id: abc-754 author: Altinok, Hacer Handan; Dikilitas, Murat title: Antioxydant response to biotic and abiotic inducers for the resistance against Fusarium wilt disease in eggplant (Solanum melongena L.) date: 2014-04-17 words: 6859 flesch: 55 summary: H2O2 from a potential oxidative cross-linking of the cell wall at the plant cell surface has been previously reported to be a characteristic response of plant cells to microbial elicitors or challenge with an avirulent pathogen (GRANT and LOAKE 2000). The current study with FOM on Fomg-inoculated plants also showed that the activation of plant resistance might possibly activate the genes that might in turn provide valuable in- formation concerning fungal resistance mechanisms by using nonpathogenic Fusarium oxysporum formae speciales on eggplant. keywords: accumulation; altinok; asm; disease; fom; fomg; fusarium; h2o2; oxysporum; pathogen; plants; profile; resistance cache: abc-754.pdf plain text: abc-754.txt item: #350 of 390 id: abc-755 author: Saeidi Mehrvarz, Shahryar; Yousefi, Narjes; Mohammadi, Maryam; Marcussen, Thomas title: Pollen studies in the genus Viola (Violaceae) from Iran date: 2014-04-20 words: 5903 flesch: 63 summary: Micrographs of pollen grains in Viola pachyrrhiza (A), V. spathulata (B), V. caspia (C), V. reichenbachiana (D–E), V. rupestris (F), V. alba (G), V. odorata (H), V. sintenisii (I). A tetragonal to pentagonal shape in polar view is found in V. arvensis, V. kitaibe- liana, V. modesta, V. occulta and V. tricolor (sect. keywords: iran; pollen; section; species; viola cache: abc-755.pdf plain text: abc-755.txt item: #351 of 390 id: abc-759 author: Csiky, János; Purger, Dragica title: Herbaceous periwinkle, Vinca herbacea Waldst. et Kit. 1799 (Apocynaceae), a new species of the Croatian flora date: 2013-10-10 words: 2984 flesch: 72 summary: Monitoring of plant species along the Drava river and the Hungarian-Croatian border. Since V. herbacea was included neither in the handbooks for plant identification nor in the current Croatian Flora Database, a new key for the determination of Vinca L. species of Croatia is presented herein. keywords: croatia; flora; herbacea; hungarian; hungary; plants; species; vinca cache: abc-759.pdf plain text: abc-759.txt item: #352 of 390 id: abc-76 author: Ozkan, Mustafa; Aktas, Kamuran; Ozdemir, Canan; Guerin, Greg title: Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey date: 2009-10-21 words: 5445 flesch: 65 summary: Monographiae Botanicae 37, 137– 168. ZHOU, S. L., PAN, K. Y., HONG, D. Y., 1997: ABCRA 25 ISSN 0365–0588 Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey MUSTAFA ÖZKAN1, KÂMURAN AKTASz2*, CANAN ÖZDEMIR2, GREG GUERIN3 1 Ahi Evran University, Faculty of Art and Science, Department of Biology, Kirsehir, Turkey 2 Celal Bayar University, Faculty of Art and Science, Department of Biology, Manisa, Turkey 3 Western Australian Herbarium, Department of Environment and Conservation, Adelaide, Australia The nutlet (mericarp) morphology of 12 Salvia L. (Lamiaceae: sub-family Nepetoideae: tribe Mentheae: sub-tribe Salviinae) taxa from Turkey, including five endemic taxa, was examined using scanning electron microscopy: Salvia bracteata Banks et Sol., S. cadmica Boiss., S. blepharoclaena Hedge et Hub.-Mor., S. cryptantha Montbret et Aucher ex Bentham, S. aethiopis L, S. ceratophylla L., S. candidissima Vahl subsp. keywords: mericarps; salvia; species; verticillata cache: abc-76.pdf plain text: abc-76.txt item: #353 of 390 id: abc-762 author: T.E, Sheeja; Kizhakayil, Dhanya; Sheeja, Thotten E.; Sasikumar, Bhaskaran; Bhat, Alanghar I.; Parthasarathy, Villlupanoor A. title: Novel polymorphic microsatellite markers from turmeric, Curcuma longa L. (Zingiberaceae) date: 2013-10-10 words: 2103 flesch: 54 summary: This limited availability warrants the need to expand the existing repertoire of microsatellite markers for future studies aiming at better estimation of genetic variability for the effective conservation of the genetic resources of turmeric. Development and characterization of microsatellite markers for turmeric (Curcuma longa). keywords: cumisat; markers; microsatellite; turmeric cache: abc-762.pdf plain text: abc-762.txt item: #354 of 390 id: abc-785 author: Kovacic, Sanja title: Second Week of Croatian Botanical Gardens and Arboreta (May 14 -19, 2012) date: 2013-04-10 words: 1277 flesch: 54 summary: ABCRA 25 ISSN 0365–0588 eISSN 1847-8476 Second Week of Croatian Botanical Gardens and Arboreta (May 14–19, 2012) Following the successful First Week of Croatian Botanical Gardens and Arboreta, orga- nized at 12 locations across Croatia in late May–early June of 2011, the Croatian Botanical Society with many associates organized the Second Week in the spring of 2012 (May 14–19, 2012). keywords: garden; kovacic; profile; social cache: abc-785.pdf plain text: abc-785.txt item: #355 of 390 id: abc-796 author: Jezic, Marin; Karoglan Kontic, Jasminka; Preiner, Darko; Maletic, Edi; Curkovic-Perica, Mirna title: Grapevine yellows affecting Croatian autochthonous grapevine cultivar 'Grk' date: 2013-10-10 words: 3334 flesch: 62 summary: Molecular detection of phytoplasmas infecting grapevines in Slovenia and Croatia. Materials and methods Samples of leaf main veins were collected in late summer of 2010 at three locations in Croatia where Grk grapevines can be found: production vineyards in Lumbarda on island Kor~ula with 10,023 plants, the National Grapevine Collection in Jazbina near Zagreb (six plants) and a mother vineyard in Ba{tica near Zadar (400 plants) (Fig. 1). keywords: croatia; grapevine; grk; phytoplasma cache: abc-796.pdf plain text: abc-796.txt item: #356 of 390 id: abc-806 author: Zaman, Tanjeena; Asaeda, Takashi title: Assessment of macro-micro elements accumulation capabilities of Elodea nuttallii under gradient redox statuses with elevated NH4-N concentration date: 2014-04-20 words: 8740 flesch: 60 summary: 39.2 ± 9.8a Mg 0.5 ± 0.2d 0.6 ± 0.1d 1.4 ± 0.2c 1.4 ± 0.2c 0.6 ± 0.1d 1.6 ± 0.3b 1.6 ± 0.1b K 0.3 ± 0.0d 0.3 ± 0.0d 0.9 ± 0.2c 0.9 ± 0.1c 0.3 ± 0.0d 23.8 ± 4.2ab 1.9 ± 0.7d 1.5 ± 0.3d 28.7 ± 5.2a 1.9 ± 0.4d 1.7 ± 0.1d keywords: concentration; conditions; elements; elodea; metal; nh4; nuttallii; oxic; plant; ppm; profile; redox; sediment; treatments; zaman cache: abc-806.pdf plain text: abc-806.txt item: #357 of 390 id: abc-808 author: Mayrhofer, Helmut; Drescher, Anton; Steševic, Danijela; Bilovitz, Peter Othmar title: Lichenized fungi of the chestnut grove in Livari (Rumija, Montenegro) date: 2013-10-10 words: 3732 flesch: 68 summary: albescens X X X X X Pertusaria albescens var. X X X X Parmelia sulcata Taylor X X X X X Parmeliella triptophylla (Ach.) keywords: ach; bilovitz; chestnut; fungi; lichen; livari; mayrhofer; montenegro; species cache: abc-808.pdf plain text: abc-808.txt item: #358 of 390 id: abc-81 author: Tanaka, Hiroyuki; Nagumo, Tamotsu title: Two new Mesodictyopsis species, M. akitaensis sp. nov. and M. miyatanus sp. nov., from a Late Miocene to Pliocene freshwater sediment, Japan date: 2009-10-21 words: 3454 flesch: 65 summary: Fig. 33 – de- tailed view of valve face showing opening of valve face fultoportula (large arrow), openings of two mantle fultoportulae (small arrows) and opening of rimoportula (arrowhead). Fig. 19 – oblique view of figure 18 showing opening of valve face fultoportula (arrow), opening of rimoportula (arrowhead). keywords: face; fig; mantle; mesodictyopsis; valve; valve face cache: abc-81.pdf plain text: abc-81.txt item: #359 of 390 id: abc-811 author: Cepak, Vladislav; Lukavsky, Jaromir title: Cryoseston of the Pirin Mountains, Bulgaria date: 2013-10-10 words: 4208 flesch: 65 summary: The cryosestonic alga Chlamydomonas nivalis produces large amounts of the red pigment, astaxanthin, which is an effective UV screen and, as a free radical acceptor, protects cells against photoinhibition (REMIAS et al. 2005, RFEZANKA et al. 2007). In Bulgaria, it was identified for the first time in the Pirin Mountains (KOL 1956) and in the Vitosha Mountains (LUKAVSKÝ et al. 2009). keywords: acta; cells; chloromonas; cryoseston; figs; hoham; lukavský; mountains; nivalis; pirin; snow cache: abc-811.pdf plain text: abc-811.txt item: #360 of 390 id: abc-812 author: Xystrakis, Fotios; Theodoropoulos, Kostantinos; Eleftheriadou, Eleni; Samaras, Dimitrios A.; Damianidis, Christos; Papadopoulos, Theodoros title: Succession rates and patterns twelve years after land use abandonment in the estuary of river Aliakmon, N. Greece date: 2014-04-17 words: 7116 flesch: 56 summary: Abstract – Vegetation succession is a key element for research studying biodiversity losses, effects of climatic change on ecosystems, invasive species and restoration of ecosystems in which human activities have shifted their natural or semi-natural vegetation. The land-use abandonment in an area in the estuary of the River Aliakmon, N. Greece, provides an opportunity to study medium-term rates and patterns during the first twelve years of vegetation succession. keywords: changes; group; plots; profile; rates; species; succession; taxa; values; vegetation; xystrakis; xystrakis et; years cache: abc-812.pdf plain text: abc-812.txt item: #361 of 390 id: abc-815 author: Surina, Bostjan; Martincic, Andrej title: Ecology and niche assembly of Campanula tommasiniana, a narrow endemic of Mt Ucka (Liburnian karst, northwestern Adriatic) date: 2014-04-20 words: 16100 flesch: 66 summary: Synoptic table of chasmophytic syntaxa with Campanula tommasiniana on Mt. U~ka (NW Adriatic) Association SjC CfC SaC Subassociation S G C Variant M S S M Characteristic and differential groups of taxa PPc Cam tom Campanula tommasiniana 100 19 100 12 100 13 100 15 100 14 100 13 100 18 ES Ses jun Sesleria juncifolia Tab. 4. – continued Association SjC CfC SaC Subassociation S G C Variant M S S M VP Hie mur Hieracium murorum . keywords: b o; c o; c t; campanula; e n; e r; l t; m s; n c; n t; n u; o l; o s; o t; p r; p s; profile; r o; r t; s c; s s; s u; surina; t s; tab; taxa; tommasiniana; u r; var; vascular cache: abc-815.pdf plain text: abc-815.txt item: #362 of 390 id: abc-816 author: Cakovic, Danka; Stesevic, Danijela; Vuksanovic, Snezana; Tan, Kit title: Colchicum cupanii Guss. subsp. glossophyllum (Heldr.) Rouy, Datura innoxia Mill. and Eclipta prostrata (L.) L., new floristic records in Montenegro and western Balkan date: 2014-04-20 words: 4569 flesch: 67 summary: In addition to Eclipta L. numerous adventive species were present, indicating a strong anthropogenic influence at this site: Conyza canadensis, Paspalum paspalodes (Michx) Scribner, Euphorbia maculata L., Sporobolus poirettii (R. et S.) Hitchc, Oenothera biennis L., Xanthium italicum Moretti, Aster squamatus (Spreng) Hieron. Acta Botanica Croatica 41, 155–170. HOLM, L. G., PLUCKNETT, D. L., PANCHO, J. V., HERBERGER, J. P. 1977: keywords: acta; beach; cakovic; colchicum; datura; eclipta; flora; long; montenegro; profile; species; ulcinj cache: abc-816.pdf plain text: abc-816.txt item: #363 of 390 id: abc-818 author: Puizina, Jasna title: Shallots in Croatia – genetics, morphology and nomenclature date: 2013-10-10 words: 5315 flesch: 59 summary: The shallot A. × proliferum represents a hybrid between the two closely related species, A. cepa and A. fistulosum L. The third form of shallot, A. × cornutum is a still incompletely understood triploid hybrid between A. cepa and one or two closely related Allium species, whose identity has not been fully elucidated. keywords: a. cepa; allium; cepa; cornutum; onion; puizina; shallot; triploid cache: abc-818.pdf plain text: abc-818.txt item: #364 of 390 id: abc-82 author: Cox, Eileen J. title: What is in a name? Diatom classification should reflect systematic relationships. date: 2009-10-21 words: 6277 flesch: 48 summary: Phycologia 43, 245–270. METZELTIN, D., KUSBER, W.-H. 2001: Annotated list of new diatom taxa described by Horst Lange-Bertalot until the year 2000. If new taxa group with members of an existing higher taxon, but exhibit characters not previously recorded for the higher taxon, be prepared to modify the diagnosis of the latter. keywords: characters; classification; cox; diatom; genera; genus; species; taxa cache: abc-82.pdf plain text: abc-82.txt item: #365 of 390 id: abc-821 author: Carni, Andraž; Matevski, Vlado; Silc, Urban; Custerevska, Renata title: Early spring ephemeral therophytic non-nitrophilous grasslands as a habitat of various species of Romulea in the southern Balkans date: 2014-04-20 words: 11121 flesch: 76 summary: Functional Ecology 26, 740–749. PERUZZI, L., IIRITI, G., FRIGNANI, F., 2011: Contribution to the kariological knowledge of Mediterranean Romulea species (Iridaceae). Relevés of such communities further to the south have not been published but similar therophytic communities of olive grove grassland show 65 % of Mediterranean species (^ARNI and MATEVSKI 2005). keywords: acta; al.ps; al.vp; bot; botanica\acta; carni; cmyk; color; communities; croat; esetg; fig; grasslands; mediterranean; precipitation; printer; profile; romulea; species; spring; ssp; ujak; vegetation cache: abc-821.pdf plain text: abc-821.txt item: #366 of 390 id: abc-828 author: Sajna, Nina; Sustar–Vozlic, Jelka; Kaligaric, Mitja title: New insights into the anatomy of an endemic Hladnikia pastinacifolia Rchb. date: 2014-04-18 words: 4183 flesch: 58 summary: Cross-section of H. pastinacifolia root. The autofl uorescence microscope observations showed the presence of numerous secretory ducts in the secondary phloem of H. pastinacifolia root, emitting bright yellow fl uorescence. keywords: acta; anatomy; ducts; fig; hladnikia; mericarp; pastinacifolia; pollen; species; uorescence; šajna cache: abc-828.pdf plain text: abc-828.txt item: #367 of 390 id: abc-83 author: Boojar, Masoud Mashadi Akbar; Tavakoli, Zahra title: Role of antioxidant enzyme responses and phytochelatins in tolerance strategies of Alhagi camelthorn growing on copper mine date: 2010-04-15 words: 7738 flesch: 59 summary: Molecular mechanisms of plant metal tolerance and homeostasis. Care was taken to collect plant species samples from both zones while they were in growth period. keywords: copper; enzyme; leaves; levels; metal; plant; roots; soil; species; zone cache: abc-83.pdf plain text: abc-83.txt item: #368 of 390 id: abc-84 author: Perez, Maria del Carmen; Maidana, Nora Irene; Comas, Augusto title: Phytoplankton composition of the Ebro River estuary, Spain date: 2009-10-21 words: 6070 flesch: 62 summary: COMAS GONZÁLEZ A., PÉREZ BALIERO, M. C., GONZÁLEZ DEL RÍO RAMS, J., 2006: Pedia- strum willei nom. According to HEGEWALD in BUCHHEIM et al. keywords: acta; bot; botan; color; composite; croat; ebro; estuary; fig; grunow; kützing; phytoplankton; profile; river; round; species; travanj; var cache: abc-84.pdf plain text: abc-84.txt item: #369 of 390 id: abc-840 author: Chaturvedi, Kanupriya; Bommisetty, Padmakar; Pattanaik, Arpita; Chinnaiyan, Vasugi; Ramachandra, Dinesh Makki; Chennareddy, Aswath title: PCR detection assay for sex determination in papaya using SCAR marker date: 2014-04-18 words: 3946 flesch: 62 summary: In the present study the W11 SCAR marker validated in the cultivars of Carica papaya and Visconcella caulifl ora, am- plifi ed a discriminating band in hermaphrodites and male papaya plants, but not in females, (Figs. 1 a, b). Traditionally, the propagation of papaya plants is through seeds, which would give rise to a population of generally 1:3 for male to female. keywords: female; hermaphrodite; male; papaya; plants; sex cache: abc-840.pdf plain text: abc-840.txt item: #370 of 390 id: abc-845 author: Iberite, Mauro; Iamonico, Duilio title: Manihot grahamii Hook. (Euphorbiaceae), a new alien species for the Eurasian area with nomenclatural, taxonomical, morphological and ecological notes date: 2015-04-01 words: 3746 flesch: 67 summary: In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALENTINE, D. H., WALTERS, S. M., WEBB, D. E. (eds.), Flora Europaea, 2, 211– 226. 74 (1), 2015 Manihot carthaginensis is morphologically different from M. grahamii on the basis of the leaves blade shape: M. carthaginensis has leaves lobes deeply pandurate, while M. gra- hamii has entire lobes. keywords: carthaginensis; grahamii; manihot; species cache: abc-845.pdf plain text: abc-845.txt item: #371 of 390 id: abc-856 author: Siddiqui, Zamin S; Cho, Jung-Il; Park, Sung-Han; Kwon, Taek-Ryoun; Ahn, Byung-Ok; Lee, Gang-Seob; Jeong, Mi-Jeong; Kim, Kyung-Whan; Lee, Seong-Kon; Park, Soo-Chul title: Phenotyping of rice in salt stress environment using high-throughput infrared imaging date: 2014-04-18 words: 4877 flesch: 58 summary: Likewise, the roots of salt stress plants also showed sig- nificant variations in color. It was observed that stomatal conductance (R2 = –0.618) and relative water content (R2 = –0.852) were significantly negatively correlated with average plant temperature (thermal images), while dark-adapted quantum yield (Fv/Fm, R 2 = –0.325) and performance index (R2 = –0.315) were not consistent with plant temperature. keywords: control; et al; leaf; plant; salt; siddiqui; stress; temperature; water cache: abc-856.pdf plain text: abc-856.txt item: #372 of 390 id: abc-860 author: Czarnota, Pawel; Hernik, Emil title: Some peltigericolous microlichens from southern Poland date: 2014-04-20 words: 5119 flesch: 68 summary: Scale bars: A, B, C, F, H, I – 1 mm; D, G – 100 mm; E – 10 mm. meantime several new localities of B. pycnidiata in central Poland (�UBEK 2009, 2012) and the Czech Republic (VONDRÁK et al. 2010) have been discovered, but samples inhabiting the thalli of Peltigera species have never been shown to date anywhere. In: LIPNICKI, L. (ed.), Lichen protection – protected lichen species, 119–128. keywords: atpol; e. hernik; hernik; leg; lichens; peltigera; poland; res; species; thallus cache: abc-860.pdf plain text: abc-860.txt item: #373 of 390 id: abc-878 author: Hussain, Iqbal; Wahid, Abdul; Rasheed, Rizwan; Akram, Hafiz Muhammad title: Seasonal differences in growth, photosynthetic pigments and gas exchange properties in glass-house grown maize (Zea mays) date: 2014-10-10 words: 5850 flesch: 66 summary: From these changes in the chlorophyll concentrations, it can be deduced that the sensitivity of Chl-b to GH condition is mainly responsible for the yellowing of leaves, particularly in spring grown plant. The results revealed that the seasons, GH conditions and cultivars had large effects on plant growth and photosynthetic attributes. keywords: agatti-2002; autumn; chl; conditions; cultivars; growth; maize; sadaf; spring; stage cache: abc-878.pdf plain text: abc-878.txt item: #374 of 390 id: abc-88 author: Harper, Margaret A.; Patterson, John E.; Harper, John F. title: New diatom taxa from the world’s first marine Bioblitz held in New Zealand: Skeletomastus a new genus, Skeletomastus coelatus nov. comb. and Pleurosigma inscriptura a new species date: 2009-10-21 words: 4639 flesch: 64 summary: This revealed Pleurosigma valves on the slides and allowed their darkfield colour to be recorded. Pleurosigma inscriptura valves range from 70–110 mm (based on 22 valves) with a length to width ratio of c. 5 (range 4.2 to 6.3). keywords: coelatus; diatom; fig; figs; inscriptura; new; pleurosigma; raphe; skeletomastus; species; striae cache: abc-88.pdf plain text: abc-88.txt item: #375 of 390 id: abc-921 author: Chatzissavvidis, Christos; Antonopoulou, Chrysovalantou; Therios, Ioannis; Dimassi, Kortessa title: Responses of trifoliate orange (Poncirus trifoliata (L.) Raf.) to continuously and gradually increasing NaCl concentration date: 2014-04-20 words: 3280 flesch: 55 summary: , these results suggest that the important deleterious effects in the Poncirus trifoliata explants grown in vitro at increasing NaCl concentration could be due to toxic intracellular levels of saline ions, mainly Cl. Calcium concentration in explants presented a lower increase in the treatments with gradual transfer than in those with a continuous exposure to high NaCl concentration in the nutrient medium. keywords: concentration; et al; explants; nacl; orange; salinity; treatments cache: abc-921.pdf plain text: abc-921.txt item: #376 of 390 id: abc-922 author: Tintino, Saulo R.; Souza, Celestina E.S.; Guedes, Glaucia M.M.; Costa, Jacqueline I.V.; Duarte, Francisco M.; Chaves, Maria Celia O.; Silva, Viviane A.; Pessoa, Hillzeth L.; Lima, Micheline A.; Garcia, Carlos A.; Coutinho, Henrique title: Modulatory antimicrobial activity of Piper arboretum extracts (Zingiberaceae) date: 2014-04-20 words: 3972 flesch: 53 summary: Toxicon 20, 247–252. JAVADPOUR, M. M., JUBAN, M. M., LO, W. C., BISHOP, S. M., ALBERTY, J. B., COWELL, S. W., 1996: 73 (1), 2014 TINTINO S. R., SOUZA C. E. S., GUEDES G. M. M., COSTA J. I. V., keywords: activity; antibiotic; extract; piper; profile; tintino cache: abc-922.pdf plain text: abc-922.txt item: #377 of 390 id: abc-923 author: Ben Cheikh Affene, Zohra; Haouala, Faouzi; Harzallah-Skhiri, Fethia title: Morphometric variation and taxonomic identification of thirteen wild rose populations from Tunisia date: 2015-04-01 words: 9918 flesch: 83 summary: Pr – diameter of prickle’s base, L. Pr – length of prickle, L. Pr. dig – length of prickle’s diagonal. Br, L. Pr. dig, Lft. ser, Nb. keywords: accessions; leafl; length cache: abc-923.pdf plain text: abc-923.txt item: #378 of 390 id: abc-926 author: Jogan, Nejc title: Muhlenbergia schreberi J. F. Gmel (Poaceae), a new naturalized species in Croatia date: 2014-10-06 words: 2875 flesch: 65 summary: Because of the vegetative spread of the many- branched stolons, M. schreberi stands are almost without other plant species. In Croatia M. schreberi can be listed as a naturalized neophyte, most probably not (yet) as an invasive species, but the wider geographical area adjacent to the discovered locality needs to be explored. keywords: croatia; jogan; muhlenbergia; north; schreberi; species cache: abc-926.pdf plain text: abc-926.txt item: #379 of 390 id: abc-93 author: Kociolek, John P.; Stoermer, Eugene F. title: Oligotrophy: the forgotten end of an ecological spectrum date: 2009-10-21 words: 3531 flesch: 51 summary: THE FORGOTTEN END OF AN ECOLOGICAL SPECTRUM U:\ACTA BOTANICA\Acta-Botan 2-09\Kociolek.vp 6. listopad 2009 13:47:59 Color profile: Disabled Composite 150 lpi at 45 degrees A further innovation of LANGE-BERTALOT (1996) as applied to diatoms was the creation of a »red list« of diatom species that are rare and indicative of clean (oligotrophic) condi- tions. To fully assess status of an aquatic environment it may also be advantageous to pay greater attention to the cytology and morphology of diatom species present. keywords: diatoms; freshwater; oligotrophy; species; systems; water cache: abc-93.pdf plain text: abc-93.txt item: #380 of 390 id: abc-930 author: Chinan, Vasilica Claudiu; Fusu, Lucian; Manzu, Ciprian Claudiu title: First record of Inocutis tamaricis in Romania with comments on its cultural characteristics date: 2015-04-01 words: 3018 flesch: 65 summary: 74 (1), 2015 Molecular analysis The identical ITS sequences obtained from the basidioma and cultured mycelium con- fi rmed that observations were made on I. tamaricis mycelium and not on a contaminant species. We noticed that in pure culture it forms swollen hyphae in the aerial mycelium, which have not been reported so far for I. tamaricis. keywords: inocutis; romania; species; tamaricis cache: abc-930.pdf plain text: abc-930.txt item: #381 of 390 id: abc-931 author: Sciandrello, Saverio; D'Agostino, Sonia title: Distribution patterns and floristic analysis of the Colymbada tauromenitana (Guss.) Holub populations in Sicily (Italy) date: 2014-04-18 words: 6679 flesch: 57 summary: Two indexes were chosen to estimate diversity: (1) species richness (SR), i.e., the total number of plant species recorded in a sample plot, and (2) Shannon-Wiener’s diversity in- dex (H’). 73 (2), 2014 391 Plant communities and species diversity In total, 72 species of vascular plants have been recorded on the cliffs of the study area. keywords: area; brullo; colymbada; conservation; diversity; mediterranean; monte; plant; sciandrello; sicily; species; tauromenitana cache: abc-931.pdf plain text: abc-931.txt item: #382 of 390 id: abc-939 author: García, Jaime F; Jurado, Enrique title: Is drought altering plant populations in the mountainous region of Northeastern Mexico? date: 2015-04-01 words: 6477 flesch: 63 summary: For the mountain vegetation of Northeastern México there are no studies examining the effects of drought on plant survival, and little is known about what factors affect the probability of mortality in woody plants during a severe drought. Two major hypotheses were tested: (1) morta- lity among species differs due to species-specifi c responses and to genetic variability in re- sistance to stressors, and (2) between populations, plant survival varies throughout the eco- system due to environments that are more or less stressful. keywords: cembroides; drought; fig; mortality; plant; santaclarensis; soil; species; survival cache: abc-939.pdf plain text: abc-939.txt item: #383 of 390 id: abc-94 author: Mann, David G.; Stickle, Alan J. title: Cytological characteristics of the Sellaphoraceae date: 2009-10-21 words: 4623 flesch: 58 summary: Fallacia chloroplasts are more variable than those of Sellaphora but always differ fundamentally from the valve-appressed chloroplasts of the unrelated but superficially similar genus Lyrella. D.G. Mann (Figs. 1–13): Two optical sections of S. bacillum cells are provided, in girdle and valve views (Figs. 1–7, 8–13, respectively), to fa- cilitate understanding of chloroplast structure in Sellaphoraceae. keywords: chloroplast; fallacia; figs; mann; pyrenoid; sellaphora; species cache: abc-94.pdf plain text: abc-94.txt item: #384 of 390 id: abc-940 author: Ali, Murad; Bakht, Jehan; Daraz Khan, Gul title: Effect of water stress and potassium application on plant growth, osmolytes and grain yield of Brassica varieties date: 2014-10-06 words: 6910 flesch: 59 summary: Water stress induces a signifi cant decrease in metabolic factors such as decrease in chlorophyll content and enhanced accumu- * (1992) reported increased sugar and starch content of sugarcane, tomatoes and potatoes under water stress. keywords: application; content; drought; ha–1; irrigation; plant; potassium; proline; shoot; stress; water cache: abc-940.pdf plain text: abc-940.txt item: #385 of 390 id: abc-943 author: Saglam, Aykut; Kadioglu, Asim; Demiralay, Mehmet; Terzi, Rabiye title: Leaf rolling reduces photosynthetic loss in maize under severe drought date: 2014-10-06 words: 9216 flesch: 67 summary: These results implied that LR was an important and neces- sary mechanism protecting photosynthesis and reducing yield loss under drought stress by maintaining the leaf hydration, preventing loss of the photosynthetic pigments, sustaining the activity of PSII, keeping the stomata open, and conserving the activity of Rubisco. The decrease of grain yield in maize under drought stress has been the subject of recent studies. keywords: batem; control; cultivars; drought; fold; leaf; maize; photosynthesis; plr; rolling; rubisco; stress; water cache: abc-943.pdf plain text: abc-943.txt item: #386 of 390 id: abc-96 author: Edlund, Mark B.; Shinneman, Avery L.C.; Levkov, Zlatko title: Diatom biodiversity in Mongolia: A new amphoroid diatom from saline lakes in western Mongolia, Amphora soninkhishigae sp. nov. date: 2009-10-21 words: 5086 flesch: 63 summary: A new amphoroid diatom from saline lakes in western Mongolia, Amphora soninkhishigae sp. nov. MARK B. EDLUND1*, AVERY L. C. SHINNEMAN2, ZLATKO LEVKOV3 1 St. Croix Watershed Research Station, Science Museum of Minnesota, Marine on St. Croix, Minnesota 55047, USA 2 Department of Geology, University of Minnesota, 310 Pillsbury Dr. SE, Minneapolis, Minnesota 55455, USA 3 Institute of Biology, Faculty of Natural Sciences, Gazi Baba bb, 1000 Skopje, Republic of Macedonia A new Amphora species, Amphora soninkhishigae sp. nov. is described from the saline lakes, Oigon Nuur and Uvs Nuur, in western Mongolia. Amphora soninkhishigae is char- acterized by its small size (valves 12–28 mm long, 2.9–3.8 mm wide), fine ornamentation, and a broad, internally thickened central area on the dorsal side of the valve (dorsal stauros) that branches along the dorsal margin. keywords: amphora; cleve; dorsal; edlund; fig; lakes; levkov; mongolia; raphe; shinneman; soninkhishigae; valve cache: abc-96.pdf plain text: abc-96.txt item: #387 of 390 id: abc-963 author: Jankovic, Ivana Blagoje; Drobac, Milica M.; Lakusic, Dmitar V. title: Compounds of the methanolic leaf extract as chemotaxonomic markers for the Campanula pyramidalis complex (Campanulaceae) date: 2014-10-06 words: 4391 flesch: 62 summary: In addition to the formal names C. pyramidalis, C. versicolor, C. secundifl ora and C. austroadriatica that are registered in the International Plant Names Index (IPNI), in this paper we have used informal names C. »montenegrina« and C. »limensis«. The result of the cluster analysis has shown that two main clusters stand out (Fig. 2): (i) cluster 1 – C. pyramidalis, C. austroadriatica and C. »montenegrina«; (ii) cluster 2 C. secundifl ora, C. »limensis« and C. versicolor. keywords: campanula; complex; extract; lakušić; leaf; ora; pyramidalis cache: abc-963.pdf plain text: abc-963.txt item: #388 of 390 id: abc-964 author: Toman, Mihael Jozef; Groselj, Ana Marjetka; Zelnik, Igor title: The influence of selected factors on the distribution of epilithic diatoms in a torrential river the Kamniška Bistrica (Slovenia) date: 2014-10-10 words: 7879 flesch: 59 summary: The highest number of diatom species (40) was found in summer samples (A), and the lowest (34) in winter (M) samples. (A) distribution of the samples along the environmental variables, where sites are represented with numbers (1–5) and seasons/months with letters (M – March, J – July, A – August); (B) distribution of diatom species present in at least three samples are shown: Ach bia – Achnan- thes biasolettiana, Ach min – Achnanthes minutissima, Amp ped – Amphora pediculus, Coc ped – Cocconeis pediculus, Coc pla – Cocconeis placentula, Cym aff – Cymbella affi nis, Cym min – Cymbella minuta, Cym sil – Cymbella silesiaca, Cym sin – Cymbella sinuata, Dia mon – Diatoma moniliformis, Dia vul – Diatoma vulgaris, Fra arc – Fragilaria arcus, Fra cap – Fragilaria capucina, Fra con – Fragilaria construens, Fra uln – Fragilaria ulna, Gom ang – Gomphonema angustatum, Gom oli – Gomphonema olivaceum, Gom par – Gompho- nema parvulum, Gom pum – Gomphonema pumilum, Mel var – Melosira varians, Mer cir – Meridion circulare, Nav ato – Navicula atomus, Nav crt – Navicula cryptotenella, Nav gre – Navicula gregaria, Nav lan – Navicula lanceolata, Nav men – Navicula menisculus, Nav tri – Navicula tripunctata, Nit dis – Nitzschia dissipata, Nit fon – Nitzschia fonticola, Nit pal – Nitzschia palea. keywords: acta; conductivity; diatom; diversity; environmental; factors; river; samples; species; tab; taxa; temperature; variables; water cache: abc-964.pdf plain text: abc-964.txt item: #389 of 390 id: abc-980 author: Nikolic, Nataša; Borisev, Milan; Pajevic, Slobodanka; Zupunski, Milan; Topic, Mirjana; Arsenov, Danijela title: Responses of wheat (Triticum aestivum L.) and maize (Zea mays L.) plants to cadmium toxicity in relation to magnesium nutrition date: 2014-10-06 words: 8118 flesch: 59 summary: Control Cd Cd–Mg T. aestivum Chlorophyll a (mg g-1 DW) 13.83 ± 0.77 a 7.76 ± 0.80 b (56) 7.32 ± 0.03 b (53) Differences in root Cd accumulation probably results from variability in translocation of the metal between these species. keywords: activity; aestivum; cadmium; concentration; leaves; mays; plants; roots; z. mays cache: abc-980.pdf plain text: abc-980.txt item: #390 of 390 id: abc-992 author: Ljubicic, Ivica; Britvec, Mihaela; Jelaska, Sven D.; Husnjak, Stjepan title: Plant diversity and chemical soil composition of rocky pastures in relation to the sheep grazing intensity on the northern Adriatic islands (Croatia) date: 2014-10-10 words: 8217 flesch: 57 summary: This paper correlated abundance patterns of the fl ora on rocky pastures with the values of the chemical composition of the soil resulting from the degree of sheep grazing intensity. The aim of the present study was to compare the composition of the fl oras on the rocky pastures of the northern Adriatic islands of Pag, Krk and Cres, to determine the dependence of the fl oristic composition on the chemical composition of the soil resulting from the degree of sheep grazing intensity, and to determine the optimal grazing pressure, an essential factor in the maintenance of plant diversity. keywords: diversity; grazing; grazing intensity; intensity; islands; pastures; plant; plots; sheep; sheep grazing; soil; species; study; taxa cache: abc-992.pdf plain text: abc-992.txt