ACTA BOT. CROAT. 78 (1), 2019 9 Acta Bot. Croat. 78 (1), 9–16, 2019 CODEN: ABCRA 25 DOI: 10.2478/botcro-2018-0023 ISSN 0365-0588 eISSN 1847-8476 Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum Dursun Kısa Bartın University, Faculty of Science, Department of Molecular Biology and Genetics, 74110, Bartın, Turkey Abstract – The expression of stress related-genes against adverse environmental conditions has essential importance for plants. This study, using RT-qPCR, determined the expression of P5CS and PCS genes to investigate their roles in the leaves of tomato plants grown under heavy metal conditions. The expression of the PCS1 gene is significantly induced under such conditions. Transcript expression of P5CS1, a gene responsible for proline synthesis, changed depending on heavy metal doses; treatments of Cu (20 and 50 ppm), Cd and Pb (10 and 20 ppm) remarkably increased P5CS1 expres- sion. However, the P5CS1 gene expression at 10 ppm dose of Cu and 50 ppm doses of Pb and Cd was not significantly different from that in control plants. The metal-chelating potency of the extract of tomato leaves exposed to Pb and Cd was higher than that of untreated plants. The proline content as assessed in the leaves of stressed plants was significantly increased by applications of 10 and 20 ppm of Cd and Pb, and high doses of Cu. In addition, the results showed that the proline content had a positive correlation with the P5CS1 gene expression in tomato leaves under application of these tree heavy metals and that there was a positive relation between the PCS1 gene expression and metal-chelating ability of Cd-stressed plants. Keywords: gene expression, heavy metal, metal chelating activity, phytochelatin synthase gene (PCS), pyrroline-5-carboxylate synthetase gene Corresponding author, e-mail: drsn57@hotmail.com Introduction Plants sustain their lives under varying external condi- tions and they respond to environmental stimuli by syn- thesizing amino acids and peptides such as proline, phy- tochelatins (PCs), and metallothioneins (MTs) (Chen et al. 1997). Heavy metals are major environmental pollutants for plants, and their accumulation of them in agricultural areas influences the growth, development, and productivity of the plants. Although plants need to some heavy metals such as Cu, Zn and Mn for various biochemical pathways, which aid in their growth and development, the excesses quantities of these metals and the presence of other non-essential heavy metals such as Cd and Pb reduce the plant life and degrade yield quality. Heavy metals can interact with thioyl and histi- dyl groups of proteins, induce the production of reactive ox- ygen species (ROS) production, which and eventually causes the toxicity in plants (Sharma and Dietz 2009, Nagajyoti et al. 2010). The accumulation of heavy metals changes the plant’s molecular, biochemical and physiological responses and plants have developed advanced mechanisms to with- stand the abiotic stress factors. Plant defense mechanisms in response to heavy metal toxicity include immobilization, exclusion, chelation, compartmentalization and synthesis of stress proteins (Toppi and Gabbrielli 1999, Lee et al. 2002, Rellán-Álvarez et al. 2006, Hossain and Komatsu 2012). The overexpression of metal-binding proteins, such as PCs and MTs increases the metal-binding ability and toler- ance in plants. These proteins are enzymatically derived and synthesized when plant exposed to metal ions (Mejáre and Bülow 2001). The potential toxicity of heavy metals requires rigorous control to maintain the cell homeostasis by chela- tion of metal ions with PCs which represent one of the gen- eral mechanisms and tolerance. PCs are post-translationally synthesized cytosol proteins. PCs are cysteine-rich and com- prise the amino acids glutamine, cysteine, and glycine, and PCs are particularly synthesized in response to heavy metals, including Cd, Cu, Ni, Pb, and Zn. PCs have the general struc- ture (ɣ-glutamylcysteinyl)n-glycine (n = 2–11) and are syn- thesized from reduced glutathione (GSH) by the enzymatic reaction of phytochelatin synthase (PCS) (Cazalé and Cle- mens 2001, Gupta et al. 2004, Shen et al. 2010, Shanmugaraj et al. 2013, Tripathi et al. 2013). Moreover, PCs biosynthetic pathway is regulated by a series of mechanisms one of which KISA D. 10 ACTA BOT. CROAT. 78 (1), 2019 is the regulation of GSH biosynthesis and PCs biosynthesis has been correlated with the expression of GSH (Ben Ammar et al. 2008). Glutathione is synthesized from its constituent amino acids — cysteine, glycine, and glutamate — catalyzing ɣ-glutamylcysteine synthase (ɣ-ECS) and glutathione syn- thase (GS). The PC synthase (PCS) catalyzes the conversion of glutathione (GSH) into phytochelatin (Mejáre and Bülow 2001). Metal-chelating potency of plants indicates the ability of chelating compounds to bind the metal ions; this ability is dependent on the amount of phytochelatins and metallo- thioneins, unique phenolic structure of plants and location of the hydroxyl groups in the plant phenolic compounds (Wang et al. 2009, Flora and Pachauri 2010, Tito et al. 2011). The adaptation of plants to abiotic stress is achieved by the synthesis of the compatible solutes, such as proline and osmotin. Proline accumulation is considered as an adap- tive role in response to environmental stresses and this ac- cumulation relies mainly upon the increased synthesis and reduced degradation (Verbruggen and Hermans 2008). Pro- line has important roles in protecting the cellular homeosta- sis from stress-induced damage (Li et al. 2015). Plants have two different precursors involved in proline biosynthesis - glutamate (Glu) and ornithine (Orn). The Glu pathway usu- ally occurs in the cytosol and chloroplast under the abiotic stress, whereas the Orn pathway is associated with seed- ling development. Proline is synthesized from glutamate via GSA (glutamate-semialdehyde) and P5C (Δ1-pyrroline-5- carboxylate); the first reaction is catalyzed to GSA by P5CS (Δ1 -pyrroline-5- carboxylate synthetase) and it spontane- ously converted to P5C. Then, P5C is reduced to proline by P5CR (Δ1 -pyrroline-5-carboxylate reductase) (Verbrug- gen and Hermans 2008, Wang et al. 2015). The P5CS activity regulates the generation of proline in the biosynthetic path- way, which is controlled by the P5CS transcription. The P5CS gene has two copies: P5CS1 and P5CS2. The P5CS1 gene is believed to be ubiquitously expressed in both vegetative and reproductive organs and is induced by stress, whereas PC5S2 is preferentially expressed in mature plants and in response to incompatible interactions (Turchetto-Zolet et al. 2009). Environmental stress to plants is a global concern and leads to product loss by causing the injuries in plants. Al- though several molecular studies on have been done to study abiotic stress in plants, such as Arabidopsis, tomato, bean, rice, and chickpea, many studies are intensively focused on the biochemical and physiological parameters, particularly antioxidant enzymes and total phenolic content (Gupta et al. 2004, Mattioli et al. 2009, Tripathi et al. 2013, Chen et al. 2016, Singh et al. 2016). In the current study, to understand the molecular basis of Solanum lycopersicum under the heavy metals stress, the expression analysis of two selected genes (PCS and P5CS) encoding the key enzymes responsible for phytochelatin and proline biosynthesis respectively are in- vestigated in the leaves of tomato exposed to different doses of Cd, Cu, and Pb. In addition, the proline content which is considered the main index under abiotic stress, and metal- chelating capacity depending on the hydroxyl groups in che- lating compounds were determined in the leaves of tomato cultivated in heavy metal-polluted boxes. Materials and methods Plant material and growth conditions The cultivars of tomato (Solanum lycopersicum cv. Çiko F1) provided by the Agricultural Faculty of Gaziosmanpa- sa University were cultivated in plastic boxes containing an 11-kg mixture of peat and garden soil (1:1) under unheat- ed glasshouse conditions. The entire experiment was per- formed as a randomized plot design with 16:8 photoperiod, 25 ± 2 °C, and N (150 ppm), P (80 ppm), K (100 ppm) and B (20 ppm) were applied in sufficient quantities for growth and development. The characteristics of plant soil were pH 7.65, Mg = 6.86 ppm, Ca = 55.25 ppm, Fe = 10.83 ppb, Mn = 417.35 ppb, Zn = 79.26 ppb, Cu = 30.55 ppb, Pb = 12.13 ppb, and Cd = 0.95 ppb. After the plants had sufficiently grown in approximately 3 weeks, the exposure concentra- tions of Cd, Cu and Pb from CdCl2, CuSO4, and Pb(NO3)2 as sources were 10, 20 and 50 ppm (mg kg–1). The applica- tion of heavy metals was performed three times with an in- terval of 2 days and this addition was done as a single dose to the pots containing soil, in the early hours of the day. The leaves of tomato were harvested for sampling two weeks af- ter the treatments, and these samples of tomato were kept at –80 °C until RNA isolation and analysis of proline and metal- chelating capacity. Three biological replicates were used for analysis of these assays. Isolation of total RNA and RT-qPCR analysis Tomato leaves were ground into fine powder in liquid N2; the tissue powder obtained was used for RNA extrac- tion. The total RNA was extracted by using the Plant RNA Mini-Preps Kit with the EZ-10 spin column according to the manufacturer’s protocols (Bio Basic, Ontario, Canada). The obtained RNA was dissolved in RNA-free water, and RNA concentration was then quantified by using a µDrop plate (Thermo Scientific, Forssa, Finland). The first-strand cDNA was synthesized from the isolated total RNA; the relative ex- pression levels of the selected genes of tomato were detected by quantitative real-time PCR (RT-qPCR) with the one-step QuantiTect SYBR Green RT-PCR kit (Qiagen) according to the manufacturers’ protocols. The capillary tubes comprised the master mix 10 μL, primers 2 × 2 μL, RT mix 0.3 μL, and template RNA 3 μL; the reaction volume was brought up to 20 μL with RNase-free water. The QuantiTect SYBR Green RT-PCR master mix was included in pre-optimized ROX as the passive reference dye for fluorescence normalization. The genes sequences for PCS and P5CS were obtained from the NCBI (http://www.ncbi.nlm.nih.gov/nucleotide) data- bank and they also were verified by the SOL Genomics Net- work (http://solgenomics.net/feature/17933775/details) us- ing previous studies (Ouziad et al. 2005; Sangu et al. 2015). Gene-specific primers were designed by using the Primer3 software (version 4.0) based on the NCBI GenBank and the % GC and Tm values of primers were checked with an oli- gonucleotide properties calculator (http://www.basic.north- western.edu/biotools/oligocalc.html). The following primers were used: PCS1 for 5ˈ– TGCTAGCATTTGTTGCCAAG –3ˈ PHYTOCHELATIN AND PROLINE-RELATED GENES IN TOMATO IN HEAVY METAL STRESS ACTA BOT. CROAT. 78 (1), 2019 11 were considered significant at p < 0.05. The relations among the proline content, P5CS1 expression, PCS1 expression and metal-chelating activity in the leaves of tomato in response to heavy metal stress was analyzed with bivariate (Pearson’s) correlation using the individual values of the results. Results The effect of heavy metals on the PCS1 gene expression in the leaves of tomato plants exposed to the different con- centrations of Cu, Cd, and Pb is shown in Fig. 1. Compared with control plants, the leaves of treated plants showed sig- nificantly higher accumulation of PCS1 transcript due to the heavy metal treatment (p < 0.05). The most evident expres- sions were observed in plants given the high doses of heavy metals, with the highest expression observed in the plant ex- posed to 50 ppm of Pb. Moreover, Cd and Pb which are not essential for plant development, induced the expression of PCS1 more than Cu did. The transcript level of P5CS1 in the leaves of tomato sub- jected to Cu, Cd, and Pb varied with depending on the heavy metals and their doses (Fig. 2). The application of Cu to the plants through soil growth medium increased the expres- sion of P5CS1 at the 20 and 50 ppm; however, the expres- sion was not significantly different from that in controls at the low dose of Cu (10 ppm) (p < 0.05). The expression level of the P5CS1 gene significantly increased with the applica- (forward), 5ˈ– ACGTAGGGACCAGAACATCG -3ˈ (reverse); P5CS1: 5ˈ CTGTTGTGGCTCGAGCTGAT –3ˈ (forward), 5ˈ– GACGACCAACACCTACAGCA -3ˈ(reverse) and Actin 5ˈ– GGGATGGAGAAGTTTGGTGGTGG-3ˈ (forward), 5ˈ– CTTCGACCAAGGGATGGTGTAGC-3ˈ(reverse). These nu- cleotide sequences have been deposited in the EMBL nucleo- tide sequence database under accession numbers AW154892 and, AY897574 for PCS1 and P5CS1, respectively. The quantitative real-time PCR (RT-qPCR) was per- formed in triplicate on a Light-Cycler 1.5 PCR machine (Roche) under the following conditions of the Qiagen pro- tocols with minor modifications: the reverse transcription step 20 min at 50 °C, the PCR initial activation step 15 min at 95 °C, followed by 50 cycles, denaturation 15 s at 94 °C, annealing 30 s at 54 °C, extension 30 s at 72 °C, cooling 20 s at 40 °C. The fold expression of target genes was normal- ized with actin as an internal control. The relative transcript expression levels of the selected genes were quantified using the 2−ΔΔCT method (Livak and Schmittgen 2001). Determination of proline content The free proline content was estimated using with the ninhydrin reaction (Bates et al. 1973). The tomato leaves were crushed into liquid N2, homogenized with 4 mL 3% (w/v) sulfosalicylic acid, and the solution was then filtered with filter paper. The filtrate (1 mL) was reacted with 1 mL of acid-ninhydrin and 1 mL of glacial acetic acid in the test tubes for 1 h at 100 °C, and the reaction was stopped by us- ing ice bath. The reaction mixture was extracted with toluene (2 mL), and the absorbance of the chromophore was read at 520 nm. The proline content was calculated using the cali- bration curve obtained from pure proline and expressed as mg g–1 FW. Metal-chelating ability assay The metal-chelating capacity of the leaf extract was de- termined by the previously described ferrous ion chelating assay (Hsu et al. 2003). Tomato leaves (2 g) were grounded into liquid N2, extracted with 10 mL of methanol-chloroform (4:1), and the obtained homogenates were sonicated in the ultrasonic bath for 30 min at ambient temperature. The fil- tered extract (120 µL) was dissolved in methanol and mixed with 50 µL of 2 mM FeCl2, and 200 µL of 5 mM ferrozine. After the vortexing, the mixture was incubated for 10 min at room temperature and then the absorbance was measured at 562 nm. The metal-chelating capacity was calculated by us- ing the following equation with EDTA as the control: Chelating capacity (%) = [1 – (A562 nm, sample/A562 nm, control)] × 100. Statistical analysis Data analysis was conducted with one-way analysis vari- ance, followed by Duncan multiple tests (SPSS 20.0) to detect- ed the differences between control and treated groups. Stan- dard deviation was calculated by using the results of the 2−ΔΔCT method. The results are presented as mean ± SD. Differences Fig. 1. The expression level of PCS1 in leaves of tomato subjected to 0, 10, 20, 50 ppm of CuSO4 (A), Pb(NO3)2 (B) and CdCl2 (C). The gene expression was normalized with the housekeeping actin transcript. Bars represent means values ± SD from independent experiments (n = 3). Values with the different letters indicate sig- nificant difference between means at p ≤ 0.05. Fig. 2. The expression level of P5CS1 in leaves of tomato subjected to 0, 10, 20, 50 ppm of CuSO4 (A), Pb(NO3)2 (B) and CdCl2 (C). The gene expression was normalized with the housekeeping actin transcript. Bars represent means values ± SD from independent experiments (n = 3). Values with the different letters indicate sig- nificant difference between means at p ≤ 0.05. R el at iv e ex pr es si on R el at iv e ex pr es si on Copper doses (ppm) Lead doses (ppm) Cadmium doses (ppm) Copper doses (ppm) Lead doses (ppm) Cadmium doses (ppm) 3 2 1 0 6 4 2 0 5 4 3 2 1 0 5 4 3 2 1 0 4 3 2 1 0 0 10 20 50 0 10 20 50 0 10 20 50 5 4 3 2 1 0 A a b b c B a b b c C a b c c 0 10 20 50 0 10 20 50 0 10 20 50 A a a c b B a b b a C a c b a KISA D. 12 ACTA BOT. CROAT. 78 (1), 2019 they are known to respond to stress by synthesizing various molecules and compounds. The synthesis of proline and PCs are considered as a metabolic response of plants when sub- jected to the heavy metal stress, and several genes respon- sible for their synthesis are induced by environmental stim- uli. The genes associated with a the plant’s response to stress may lead to a series of biochemical and physiological chang- es (Zhang et al. 2005, Goel et al. 2010, Patade et al. 2013). In this current study, the transcript expression patterns of PCS1 and P5CS1 genes, proline content, and metal che- lating potency were investigated in leaves of tomato plants when grown under heavy metal-containing soil. The results of the present study indicated that the transcript expression of PCS1 is obviously stimulated in the leaves of tomato cul- tivated in the Cu, Cd and Pb-containing soils. The increases varied with heavy metals and their doses; Pb treatment at 50 ppm resulted in a strong increase in the transcript expression of PCS1 compared with control plants. Treatment with Cu, tion of Pb and Cd except for the expression at 50 ppm of Pb and Cd, which showed expression not significantly different from that in the controls. The free proline content in tomato leaves varied with the application of heavy metals, and these results are shown in Fig. 3. The proline content in the leaf extract significantly in- creased with the addition of 10 and 20 ppm of Pb and Cd, but significantly decreased at high doses (50 ppm) (p < 0.05). The maximum increase in proline content relative to controls was seen with 10 ppm doses of Pb. However, compared to con- trol plants, 20 ppm and 50 ppm of Cu increased and 10 ppm of Cu decreased the proline content in the leaves of tomato. The metal-chelating potency of tomato leaves is shown in Fig. 4. The metal-chelating activity was higher in plants cul- tivated in Pb and Cd-containing soils than in control plants (p < 0.05). However, the leaf extracts of tomato grown in Cu- containing medium showed different chelating potency; the plants grown in soil containing 10 ppm of Cu showed lower chelating ability than control plants; however, those grown in soils containing 50 ppm of Cu showed higher activity than control plants. The proline content is indicated to have a positive cor- relation with P5CS1 transcript expression when the tomato plant is subjected to the three heavy metals (Tab. 1). The met- al-chelating activity has a positive correlation with the PCS1 transcript expression under the Cd application. Moreover, the metal-chelating activity has a positive correlation with proline content under Cu and Pb treatments. In addition, P5CS1 transcript expression and the metal-chelating poten- cy were positively correlated in the leaves of tomato plants grown in the Pb containing soil (Tab. 1). Discussion Plants have been exposed to the different biotic and abi- otic stresses because of changing of environmental condi- tions, and they respond to these situations with several com- plex physiological, biochemical and molecular mechanisms for survival, growth, and productivity. The responses of the plants to environmental stresses are quite sophisticated, and Fig. 3. The free proline content in leaves of tomato subjected to 0, 10, 20, 50 ppm of CuSO4 (A), Pb(NO3)2 (B) and CdCl2 (C). Bars represent means values ± SD from independent experiments (n = 3). Values with the different letters indicate significant difference between means at p ≤ 0.05. Fig. 4. The metal chelating activity of the leaves extract of tomato subjected to 0, 10, 20, 50 ppm of CuSO4 (A), Pb(NO3)2 (B) and CdCl2 (C). Bars represent means values ± SD from independent experiments (n = 3). Values with the different letters indicate sig- nificant difference between means at p ≤ 0.05. Tab. 1. Correlation coefficients (R values) among the proline, tran- script levels of P5CS1 and PCS1 genes, and metal chelating activity in the leaves of tomato under treatments with Cu, Pb, and Cd. Cor- relation is significant at the 0.01 (**) and 0.05 (*) level (2-tailed). Applications P5CS1 PCS1 Proline Metal- chelating Copper P5CS1 1 PCS1 0.161 1 Proline 0.689* –0.250 1 Metal- chelating 0.378 0.187 0.884** 1 Lead P5CS1 1 PCS1 –0.169 1 Proline 0.854** –0.338 1 Metal- chelating 0.733** 0.400 0.717** 1 Cadmium P5CS1 1 PCS1 0.137 1 Proline 0.645* –0.132 1 Metal- chelating 0.201 0.976** 0.064 1 C on te nt o f p ro lin e (m g g –1 F W ) Copper doses (ppm) Lead doses (ppm) Cadmium doses (ppm) 0 10 20 50 0 10 20 50 0 10 20 50 Copper doses (ppm) Lead doses (ppm) Cadmium doses (ppm) 0 10 20 50 0 10 20 50 0 10 20 50 M et al c he la ti ng c ap ac it y (% )300 225 150 75 0 750 600 450 300 150 0 375 300 225 150 75 0 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 A b a c bc B b d c a C b c c a A b a b c a B c b b C a b c bc PHYTOCHELATIN AND PROLINE-RELATED GENES IN TOMATO IN HEAVY METAL STRESS ACTA BOT. CROAT. 78 (1), 2019 13 an essential element for plant growth and development, in- duced the transcript expression of PCS1, albeit only margin- ally compared with the other two non-essential elements. It was observed that the leaf extract of tomato plants grown in Pb and Cd-containing soils exhibited the higher metal che- lating ability than control plants; however, the Cu influence on the chelating potency of leaves was dose-specific, with highest activity observed at 50 ppm of Cu compared to plants grown unpolluted soils. A study on Lycopersicon esculentum reported that after the tomato plants were exposed to differ- ent concentrations of CdCl2, PCS1 transcript expression was improved in both leaves and roots, and mRNA accumula- tion of PCS1 was significantly higher in roots than in leaves. However, no expression changed was observed in leaves and roots under any concentration of CuSO4 treatment (Hui et al. 2010). It was stated that in the leaves of tomato, the content of PCs increased on treatment of 1, 5 and 10 µM Cd, but it decreased at higher concentrations. In addition, the level of PCs increased in the roots of tomato, and the production of PCs was higher in roots than leaves (Ben Ammar et al. 2008). The content of PCs in the leaves of Solanum nigrum linearly enhanced with the increasing Cd concentrations (10, 25, 50 and 100 µg g–1), whereas the content of PCs in the leaves of S. melongena increased under the Cd exposures of 25 µg g–1 and evidently declined obviously at higher concentrations (Sun et al. 2007). The PCS1 transcript expression in rice cultivars in response to arsenite showed that compared to the control plants, the transcript expression was significantly increased in the roots of the tolerant cultivar but not in the sensitive cultivar. PCS activity showed an important positive correla- tion with total PC, and PCS activity PC2, PC3, PC4 increased on treatment with arsenite (Tripathi et al. 2013, Begum et al. 2016). PCS transcript expression was reportedly induced with increasing doses of CdCl2 in Brassica cultivars (Shan- mugaraj et al. 2013). A study performed on the roots of Al- lium sativum L. stated that PCS1 transcript expression was significantly induced by Cd, As, and heat shock not by Cu and salt stress. However, in a study Cu induced evident accu- mulation of mRNA transcript of PCS1 in the leaves of garlic seedlings (Zhang et al. 2005). In addition, RT-qPCR analysis showed no significant change in PCS1 transcript expression in roots of Alfalfa in respond to CdCl2 and K2SiO3 stresses (Kabir et al. 2016). Another study on metal stress noted that Cd and As rapidly increased the formation of PCs in the roots, but other metals, such as Cu, Zn, Co, and Ni, did not induce any such change. However, none of these metals ini- tiated any evident production of PCs in the leaves of chick- pea (Gupta et al. 2004). PCs are the primary binding pep- tides involved in chelating heavy metal ions in plants (Guo et al. 2008). In the current study, the transcriptional profile of PCS1 was investigated in the leaves of tomato subjected to Cu, Cd, and Pb, and the expression of PCS1 was induced by these heavy metals. It is considered that plants increase their HM-binding capacity through chelators to avoid the harmful effect of HM by synthesizing various metal-binding peptides/proteins to withstand heavy metal stress. It has been suggested that one of the possible detoxification and toler- ance mechanism is tight control of metal ions, and the ex- pression of the PCS gene and the accumulation of PCs may play a general role in metal homeostasis (Cazalé and Clem- ens 2001, Begum et al. 2016). The results of proline content and gene expression of P5CS1, a gene responsible for proline synthesis in the pres- ent study indicated comparable induction by the application of all heavy metals, except for the induction obtained with 10 ppm doses of Cu and 50 ppm doses of Cd; however, the level of increase did not occur likewise in the leaves of tomato. The application of Pb and Cd at 10 and 20 ppm doses resulted in clear increases of P5CS1 transcript expression, and Cu at 20 and 50 ppm increased the expression of P5CS1 gene in leaves. Further, compared with untreated plants, no signifi- cant change was observed in plants treated with a high dose (50 ppm) of Pb and Cd. Compared with the control plants, the free proline content was increased in treated plants by adding 10 ppm and 20 ppm concentrations of Pb and Cd in plant growth medium; the application of 20 ppm and 50 ppm doses of Cu moderately increased free proline content in leaf samples. Heavy metal applications, other than men- tioned above, decreased the content of proline content when compared with control plants. A previous study showed that Cd-induced stress increased the proline content in leaves of tomato treated with 0.2 and 1 mM CdCl2 (Gratao et al. 2012). The concentration of free proline in S. melongena reportedly reached the highest level when plants were treated with 10, 25 and 50 µg g–1 Cd and declined to the level of control when plants were exposed to the highest Cd doses (100 µg g–1) (Sun et al. 2007). A previous study on Lycopersicon esculentum reported that the expression of P5CS gene significantly in- creased on 2 h of cold exposure in transgenic tomato; how- ever, in response to a 24-h exposure, the expression level of P5CS decreased to significantly lower levels than in the con- trol plants. However, in wild type tomato plants subjected to 2 or 24 h of cold stress, the expression of P5CS was signifi- cantly reduced as compared to that in the untreated control plants. In addition, the proline content in the same work reduced significantly in the wild type plant on 2 and 24-h cold exposure, while the proline accumulation was signifi- cantly higher in transgenic tomato plants exposed to cold for 2 h than untreated plants or those exposed for 24 h (Pa- tade et al. 2013). The transcript pattern of P5CS1 of barley genotypes was mainly up-regulated in response to drought stress at all exposures (Guo et al. 2009). It was stated that the P5CS gene was up-regulated in the heat tolerant tomato gen- otypes CLN1621L (at the mature stage) and CLN5915-93D (at the meiosis stage) whereas it was down-regulated in the heat-sensitive genotypes CA4 and CLN2498E (Sangu et al. 2015). In addition, it was indicated that the proline content increased in tomato exposed to different stress conditions, such as NaCl stress, cold stress and nutrient deficit (Claussen 2005, Zhao et al. 2009, Goel et al. 2010, Singh et al. 2016). The transcript expression of the P5CS1 gene was slightly increased under the low salt stress (100 mM) and it was significantly in- duced by higher salt doses (200 and 300 mM); however, the gene expression reduced again slightly at 400 mM NaCl in the KISA D. 14 ACTA BOT. CROAT. 78 (1), 2019 leaves of Kosteletzkya virginica. The proline content remark- ably increased in roots, leaves and stems after the NaCl stress (Wang et al. 2015). Another study reported that compared to control plants, in leaves of Nicotiana benthamiana, water deficit and CuSO4 increased the gene expression of P5CS and proline content; however, the water deficit was more re- sponsible than Cu for the increases in P5CS gene expression and proline accumulation (Ku et al. 2012). The accumulation of stress metabolites, such as proline, is induced by adverse environmental conditions, and proline content varies with the plant species and varieties (Verbruggen and Hermans 2008). In the current study, P5CS1 transcript expression and the free proline content were examined, and levels of P5CS1 and proline fluctuated according to heavy metal concentra- tions. However, it can be interpreted from the results that P5CS1 transcript expression and the proline content gener- ally increased except for when the plants were grown under high doses of heavy metals. The gene expression analysis of P5CS1 revealed differential transcript regulation in the leaves of tomato on heavy metal exposures. Proline has been con- sidered an important osmo-protectant, and it can play a criti- cal role in adapting to abiotic stress by increasing the osmotic potential of cells. Plants alter the transcriptional pattern of stress-responsive genes, such as the P5CS gen involved in the synthesis of functional amino acid and peptides, such as proline (Chen et al. 2010). Proline accumulates in various plants in response to en- vironmental stress, and its accumulation can affect stress tol- erance in multiple ways. Proline has various roles, such as that of a protective molecule as an osmolyte or a molecu- lar chaperone as well as an antioxidant molecule working as ROS scavenger; it supports to the maintenance of redox balance by contributing to the reductions of free radicals. Although proline accumulation is usually considered as a response to stress conditions, it is assumed that the accumu- lation can change depending on the plant species (Szabados and Savoure 2009). The production of metal-PC complexes is the evidence of plant metal tolerance, and PC synthesis is considered as a protective mechanism used by plants to pro- tects heavy metal-sensitive enzymes (Citterio et al. 2003). In this study, the expression of genes associated with proline and PC was examined, and it is indicated that the expression of P5CS1 has positive correlation with free proline content under heavy metal stress. In addition, there was a positive correlation between the data of PCS1 gene and metal-chelat- ing activity in the leaves of tomato exposed to Cd. This study also revealed a strong correlation between metal-chelating potency and proline content in Cu and Pb applications. It has been previously found that free proline chelates Cd ions in plant tissues and converts them into non-toxic Cd-pro- line complexes (Sharma et al. 1998). The lack of correlation between PCS1 and metal-chelating activity for Pb and Cu applications could be compensated by proline, since metal- chelating potency and proline showed a strong correlation for these treatments. Besides the upregulation of PCS1 in all treatments, proline could play a role as a potential metal che- lator for plants growing under to Cu and Pb presence, thus protecting them from deleterious effects. Plants have responded to biotic and abiotic stress fac- tors with a series of mechanisms through the transcriptional regulation of stress responsive, regulatory, and effector genes (Patade et al. 2013). By this study, the gene expressions of PCS1 and P5CS1 related with the PCs and proline content, respectively were investigated in the leaves of tomato under heavy metal stress. To further define and elucidate the re- sponses of plants under stress conditions, the expression of genes and their corresponding enzymes associated with PCs and proline metabolisms, such as P5CR (pyrroline-5-carbox- ylate reductase), P5CDH (P5C dehydrogenase), PDH (Pro dehydrogenase), POX (proline oxidase), ProT (proline trans- porter), ɣ- ECS (ɣ-glutamylcysteine synthetase), and PC syn- thase, should be studied together to reveal the depth of re- sponses in tomato subjected to abiotic stresses, such as heavy metals. Acknowledgements This study was conducted with equipment’s in the pre- vious projects which stocked in Molecular Biology Labora- tory at Gaziosmanpaşa University and by previous project (No: 0315.TGSD.2015) from The Ministry of Science, Indus- try and Technology in The Republic of Turkey. The author thanks to Prof. Dr. Şaban Tekin (Genetic Engineering and Biotechnology Institute, TUBITAK MAM – Turkey) for the supply of some equipment and Prof. Dr. Mahfuz ELMAS- TAS (Department of Chemistry, Gaziosmanpasa Universi- ty – Turkey) for providing helpful comments especially on metal chelating potency. References Bates, L. S., Waldren R. P., Teare, I. D., 1973: Rapid determina- tion of free proline for water-stress studies. Plant and Soil 39, 205–207. Begum, M. C., Islam, M.S., Islam, M., Amin, R., Parvez, M.S., Kabir, A.H., 2016: Biochemical and molecular responses un- derlying differential arsenic tolerance in rice (Oryza sativa L.). Plant Physiology and Biochemistry 104, 266–277. Ben-Ammar, W., Mediouni, C., Tray, B., Ghorbel, M. H., Je- mal, F., 2008: Glutathione and phytochelatin contents in tomato plants exposed to cadmium. Biologia Plantarum 52, 314–320. Cazalé, A. C., Clemens, S., 2001: Arabidopsis thaliana expresses a second functional phytochelatin synthase. FEBS Letters 507, 215–219. Chen, J., Wu, J., Lu, Y., Cao, Y., Zeng, H., Zhang, Z., Wang, L., Wang, S., 2016: Molecular cloning and characterization of a gene encoding the proline transporter protein in common bean (Phaseolus vulgaris L). The Crop Journal 4, 1–7. Chen, J., Zhang, X., Jing, R., Blair, M. W., Mao, X., Wang, S., 2010: Cloning and genetic diversity analysis of a new P5CS gene from common bean (Phaseolus vulgaris L.). Theoretical and Applied Genetics 120, 1393–1404. PHYTOCHELATIN AND PROLINE-RELATED GENES IN TOMATO IN HEAVY METAL STRESS ACTA BOT. CROAT. 78 (1), 2019 15 Chen, J. J., Zhou, J. M., Goldsbrough, P. B., 1997: Characterization of phytochelatin synthase from tomato. Physiologia Planta- rum 101, 165–172. Citterio, S., Santagonistino, A., Fumagalli, P., Prato, N., Ranalli, P., Sgorbati, S., 2003: Heavy metal tolerance and accumula- tion of Cd, Cr and Ni by Cannabis sativa L. Plant and Soil 256, 243–252. Claussen, W., 2005: Proline as a measure of stress in tomato plants. Plant Science 168, 241–248. Flora, S. J. S., Pachauri, V., 2010: Chelation in metal intoxication. International Journal of Environmental Research and Public Health 7, 2745–2788. Goel, D., Singh, A. K., Yadav, V., Babbar, S.B., Bansal, K. C., 2010: Overexpression of osmotin gene confers tolerance to salt and drought stresses in transgenic tomato (Solanum lycopersicum L.). Protoplasma 245, 133–141. Guo, J., Dai, X., Xu, W., Ma, M., 2008: Overexpressing GSH1 and AsPCS1 simultaneously increases the tolerance and accumu- lation of cadmium and arsenic in Arabidopsis thaliana. Che- mosphere 72, 1020–1026. Guo, P., Baum, M., Grando, S., Ceccarelli, S., Bai, G., Li, R., Von Korff, M., Varshney, R. K., Graner, A., Valkoun, J., 2009: Dif- ferentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage. Journal of Experimental Botany 60, 3531–3544. Gupta, D. K., Tohoyama, H., Joho, M., Inouhe, M., 2004: Chang- es in the levels of phytochelatins and related metal-binding peptides in chickpea seedlings exposed to arsenic and differ- ent heavy metal ions. Journal of Plant Research 117, 253–256. Gratao, P. L., Monteiro, C. C., Carvalho, R. F., Tezotto, T., Pipttp, F. A., Peres, L. E. P., Azevedo, R. A., 2012: Biochemical dissection of diageotropica and Never ripe tomato mutants to Cd-stress- ful conditions. Plant Physiology and Biochemistry 56, 79–96. Hossain, Z., Komatsu, S., 2012: Contribution of proteomic stud- ies towards understanding plant heavy metal stress response. Frontiers in Plant Science 3, 310. Hsu, C. L., Chen, W., Weng, Y.M., Tseng, C. Y., 2003: Chemical composition, physical properties, and antioxidant activities of yam flours as affected by different drying methods. Food Chemistry 83, 85–92. Hui, L., Yu, C., You-hong, C., 2010: Cloning of a phytochelatin synthase gene (LePCS1) from tomato seedlings and its expres- sion characteristics under heavy metal stress. Jiangsu Journal of Agricultural Sciences 26, 136–142. Kabir, A. H., Hossain, M. M., Khatun, M. A., Mandal, A., Haider, S. A., 2016: Role of silicon counteracting cadmium toxicity in alfalfa (Medicago sativa L.). Frontiers in Plant Science 7, 1–12. Ku, H. M., Tan, C. W., Su, Y. S., Chiu, C. Y., Chen, C. T., Jan, F. J. 2012: The effect of water deficit and excess copper on proline metabolism in Nicotiana benthamiana. Biologia Plantarum 56, 337–343. Lee, S., Moon, J. S., Domier, L. L., Korban, S. S., 2002: Molecu- lar characterization of phytochelatin synthase expression in transgenic Arabidopsis. Plant Physiology and Biochemistry 40, 727–733. Li, C., Shuqiang, W., Lei, H., Yongqiang, Q., Huali, Z., Haibo, X., 2015: Gene cloning and expression of the pyrroline-5-carbox- ylate reductase gene of perennial ryegrass (Lolium perenne). Horticultural Plant Journal 1, 113–120. Livak, K. J., Schmittgen, T. D., 2001: Analysis of relative gene ex- pression data using real-time quantitative PCR. Methods 25, 402–408. Mattioli, R., Falasca, G., Sabatini, S., Altamura, M. M., Costantino, P., Trovato, M., 2009: The proline biosynthetic genes P5CS1 and P5CS2 play overlapping roles in Arabidopsis flower tran- sition but not in embryo development. Physiologia Planta- rum 137, 72–85. Mejáre, M., Bülow, L. 2001: Metal-binding proteins and peptides in bioremediation and phytoremediation of heavy metals. Trends in Biotechnology 19, 67–73. Nagajyoti, P. C., Lee, K. D., Sreekanth, T. V. M., 2010: Heavy met- als, occurrence and toxicity for plants: A review. Environmen- tal Chemistry Letters 8, 199–216. Ouziad, F., Hildebrandt, U., Schmelzer, E., Bothe, H., 2005: Differ- ential gene expressions in arbuscular mycorrhizal-colonized tomato grown under heavy metal stress. Journal of Plant Phys- iology 162, 634–649. Patade, V. Y., Khatri, D., Kumari, M., Grover, A., Mohan, G. S., Ahmed, Z., 2013: Cold tolerance in Osmotin transgenic to- mato (Solanum lycopersicum L.) is associated with modulation in transcript abundance of stress responsive genes. Springer- Plus 2, 117. Rellán-Álvarez, R., Ortega-Villasante, C., Álvarez-Fernández, A., Campo, F. F. D., Hernández, . L. E., 2006: Stress responses of Zea mays to cadmium and mercury. Plant and Soil 279, 41–50. Sangu, E., Tibazarwa, F. I., Nyomora, A., Symonds, R. C., 2015: Expression of genes for the biosynthesis of compatible solutes during pollen development under heat stress in tomato (So- lanum lycopersicum). Journal of Plant Physiology 178, 10–16. Shanmugaraj, B. M., Chandra, H. M., Srinivasan, B., Ramalingam, S., 2013: Cadmium induced physio-biochemical and molecu- lar response in Brassica juncea. International Journal of Phy- toremediation 15, 206–218. Sharma, S. S., Schat, H., Vooıjs, R., 1998: In vitro allevetion of heavy metal-induced enzyme inhibition by proline. Phyto- chemistry 49, 1531–1535. Sharma, S. S., Dietz, K. J., 2009: The relationship between metal toxicity and cellular redox imbalance. Trends in Plant Sci- ence 14, 43–50. Shen, G., Zhu, C., Du, Q., 2010: Genome-wide identification of PHYTOCHELATIN and PHYTOCH _ SYNTH domain-con- taining phytochelatin family from rice. Electronic Journal of Biology 6, 73–79. Singh, M., Singh, V. P., Prasad, S. M., 2016: Responses of photo- synthesis, nitrogen and proline metabolism to salinity stress in Solanum lycopersicum under different levels of nitrogen sup- plementation. Plant Physiology and Biochemistry 109, 72–83. Sun, R. L., Zhou, Q. X., Sun, F. H., Jin, C. X., 2007: Antioxidative defense and proline/phytochelatin accumulation in a newly discovered Cd-hyperaccumulator, Solanum nigrum L. Envi- ronmental and Experimental Botany 60, 468–476. Szabados, L., Savoure, A., 2009: Proline: a multifunctional amino acid. Trends in Plant Science 15, 1–9. Tito, A., Carola, A., Bimonte, M., Barbulova, A., Arciello, S., De Laurentiis, F., Monoli, I., Hill, J., Gibertoni, S., Colucci, G., Apone, F., 2011: A tomato stem cell extract, containing anti- oxidant compounds and metal chelating factors, protects skin cells from heavy metal-induced damages. International Jour- nal of Cosmetic Science 33, 543–552. Toppi, S. D. L., Gabbrielli, R., 1999: Response to cadmium in higher plants. Environmental and Experimental Botany 41, 105–130. Tripathi, P., Tripathi, R. D., Singh, R. P., Dwivedi, S., Chakrabar- ty, D., Trivedi, P.K., Adhikari, B., 2013: Arsenite tolerance in rice (Oryza sativa L.) involves coordinated role of metabolic pathways of thiols and amino acids. Environmental Science and Pollution Research 20, 884–896. Turchetto-Zolet, A. C., Margis-Pinheiro, M., Margis, R., 2009: The evolution of pyrroline-5-carboxylate synthase in plants: a key enzyme in proline synthesis. Molecular Genetics and Genom- ics 281, 87–97. Verbruggen, N., Hermans, C., 2008: Proline accumulation in plants: a review. Amino Acids 35, 753–759. KISA D. 16 ACTA BOT. CROAT. 78 (1), 2019 Wang, H., Tang, X., Wang, H., Shao, H. B., 2015: Proline accu- mulation and metabolism-related genes expression profiles in Kosteletzkya virginica seedlings under salt stress. Frontiers in Plant Science 6, 1–9. Wang, T., Jónsdóttir, R., Ólafsdóttir, G., 2009: Total phenolic com- pounds, radical scavenging and metal chelation of extracts from Icelandic seaweeds. Food Chemistry 116, 240–248. Zhang, H., Xu, W., Guo, J., He, Z., Ma, M., 2005: Coordinated re- sponses of phytochelatins and metallothioneins to heavy met- als in garlic seedlings. Plant Science 169, 1059–1065. Zhao, D. Y., Shen, L., Fan, B., Liu, K. L., Yu, M. M., Zheng, Y., Ding, Y., Sheng, J. P., 2009: Physiological and genetic properties of tomato fruits from 2 cultivars differing in chilling tolerance at cold storage. Journal of Food Science 74, 348–352.