701 Besendorfer and Mlinarec.vp Acta Bot. Croat. 72 (1), 1–12, 2013 CODEN: ABCRA 25 ISSN 0365–0588 eISSN 1847-8476 Retention of relict satellite DNA sequences in Anemone (Ranunculaceae) VI[NJA BESENDORFER, JELENA MLINAREC* Faculty of Science, University of Zagreb, Division of Biology, Department of Molecular Biology, Horvatovac 102a, HR-10000 Zagreb, Croatia Abstract – Satellite DNA is a genomic component present in virtually all eukaryotic orga- nisms. The turnover of highly repetitive satellite DNA is an important element in genome organization and evolution in plants. Here we study the presence, physical distribution and abundance of the satellite DNA family AhTR1 in Anemone. Twenty-two Anemone acces- sions were analyzed by PCR to assess the presence of AhTR1, while fluorescence in situ hybridization and Southern hybridization were used to determine the abundance and genomic distribution of AhTR1. The AhTR1 repeat unit was PCR-amplified only in eight phylogenetically related European Anemone taxa of the Anemone section. FISH signal with AhTR1 probe was visible only in A. hortensis and A. pavonina, showing localization of AhTR1 in the regions of interstitial heterochromatin in both species. The absence of a FISH signal in the six other taxa as well as weak signal after Southern hybridization sug- gest that in these species AhTR1 family appears as relict sequences. Thus, the data pre- sented here support the »library hypothesis« for AhTR1 satellite evolution in Anemone. Similar species-specific satellite DNA profiles in A. hortensis and A. pavonina support the treatment of A. hortensis and A. pavonina as one species, i.e. A. hortensis s.l. Keywords: Anemone, FISH, library hypothesis, satellite DNA Abbreviations: FISH – fluorescence in situ hybridization, satDNA – satellite DNA Introduction The genus Anemone s.str. consists of approximately 150 species (TAMURA 1995), mainly distributed in the Northern Hemisphere. The ancestry, phylogenetic differentiation and sys- tematic classification of Anemone have been debated for years. To advance the knowledge of the phylogenetic relationships within Anemone, considerable efforts based on DNA-ana- lytical approach have been applied successfully and provided new insights into interspecific relationships (HOOT et al. 1994, EHRENDORFER and SAMUEL 2001, SCHUETTPELZ et al. 2002, ACTA BOT. CROAT. 72 (1), 2013 1 * Corresponding author, e-mail: jelena@biol.pmf.hr Copyright® 2013 by Acta Botanica Croatica, the Faculty of Science, University of Zagreb. All rights reserved. 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:22 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees EHRENDORFER et al. 2009, MEYER et al. 2010). HOOT et al. (1994) and MEYER et al. (2010) suggest that Hepatica, Knowltonia and Pulsatilla as well as the South American genera Oreithales and Barneoudia should be subsumed within the Anemone s. lat and propose a preliminary classification that recognizes two subgenera (Anemonidium and Anemone), seven sections, and 12 informal subsection groupings. The European Anemone taxa belong to the Anemone section, with only one exception, A. narcissifolia, which belongs to the Anemonidium section. The Coronaria group is the largest in the Anemone section, compris- ing all the Mediterranean and American tuberous Anemone. Anemone species were considered favourable plant material in cytogenetic studies be- cause of chromosomal polymorphism, different ploidy levels, as well as variation in DNA content among species (BÖCHNER 1945, HEIMBURGER 1959, ROTHFELS et al. 1966, BAUM- BERGER 1970, MLINAREC et al. 2006, MLINAREC et al. 2012a, MLINAREC et al. 2012b). Fol- lowing the discovery of differential staining methods such as C-banding in the 1970s, Anemone again became a subject of interest due to the high quantities of heterochromatin and variation in distribution among species (MARKS 1974, MARKS and SCHWEIZER 1974). The greatest variations in heterochromatin amount and distribution on chromosomes are found among the members of the Coronaria group (MLINAREC et al. 2012b). Satellite DNA (satDNA) is highly repetitive, non-coding and organized into long arrays composed of thousands to millions of tandemly arranged units. These arrays form constitu- tive heterochromatin (UGARKOVI] and PLOHL 2002). Different satDNA sequences can coex- ist in genomes, forming what has been defined as a library of satDNAs (FRY and SALSER 1977, ME[TROVI] et al. 1998). Despite well-recognized roles of telomeric and centromeric satDNAs in the stabilization of chromosome ends and in cell division, their overall biologi- cal significance remains unclear (CSINK and HENIKOFF 1998). Since satDNA evolves through evolutionary processes as predicted by the molecular drive model (DOVER 1986), DNA turnover usually leads to a high interspecific divergence and low intraspecific variation. The balance, persisting between satellite homogenization and persistence of satellite variants, could generate sufficient sequence divergence to cause reproductive isolation between intraspecific lineages, ultimately leading to speciation. The AhTR1 satDNA monomer is an AT-rich sequence of 560 bp; this satDNA sequence constitutes about 0.14% of the A. hortensis genome, roughly about 3.05×104 copies (MLINAREC et al. 2009). The same authors only found evidence of AhTR1 in A. hortensis; the absence of Southern hybridization signals was found in other relatives tested. Here we characterize the presence, genomic distribution and abundance of the AhTR1 in 22 species of Anemone using PCR, fluorescence in situ hybridization (FISH) and Southern hybridiza- tion. Our goals were to: i) evaluate the phylogenetic signal of satDNA family in a genus and ii) gain an insight into the karyotype and genome evolution of Anemone using satDNA markers. Materials and methods Plant material Information on all plant taxa used in this study is given in table 1. Plants were grown in pots in the Botanical Garden of University of Zagreb. All species were identified by mor- phological and karyological characteristics. For karyological studies, actively growing 2 ACTA BOT. CROAT. 72 (1), 2013 BESENDORFER V., MLINAREC J. 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:22 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees root-tip meristems were pretreated with 0.05% colchicine (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) for 4 h at RT, fixed in a solution of ethanol and acetic acid (3:1) for 24 h at –20 °C, and stored in 70% ethanol at –20 °C until use. For cloning as well as for Southern hybridization, high quality genomic DNA was isolated from young leaves using the Qiagen mini kit (GmbH, Hilden, Germany) according to manufacturer's instructions. ACTA BOT. CROAT. 72 (1), 2013 3 SATELLITE-DNA EVOLUTION IN ANEMONE Tab. 1. Species and accessions used in this study. The sectional classification is according to MEYER et al. (2010). Positive (+) and negative (–) PCR amplifications of the AhTR1 of the analysed accessions are also reported. Taxon Accession No. Origin and/or Source Section PCR Anemone apennina L. 1446B Dizdarica (Montenegro), Anemone + Anemone blanda Schott et Kotschy 12418 BG University of Vienna (Austria) Anemone + Anemone coronaria L. 1725H Anecor, Esdraelo Plain, Tel Shiron, 25 km SE of Haifa (Israel) Anemone + Anemone hortensis L. 8216R Island of Hvar (Croatia) Anemone + Anemone palmata L. 12434 Morgion, Marseille (France) Anemone + Anemone pavonina Lam. 12724 Bogdanci, Plajurci (Macedonia) Anemone + Anemone ranunculoides L. 289 Delibatska pe{~ara (Serbia) Anemone + Anemone sylvestris L. 1451B ^u~erje, Medvednica (Croatia) Anemone + Anemone parviflora Michx. 20081630 RBG Edinburgh (UK) Anemone – Anemone obtusiloba D. Don 19861079 RBG Edinburgh (UK) Homalocarpus – Anemone demissa Hook et Thomson 19910632 Upper Mo Chu Dist. (Bhutan), RBG Edinburgh (UK) Homalocarpus – Anemone rivularis Buch.-Ham. 28070 Himalaya (Nepal), RBG Kew (UK) Rivularidium – Anemone hupehensis Lemoine 28069 Sichuan, Huangtuliang Hills (China), RBG Kew (UK) Rivularidium – Anemone tomentosa (Maxim.) C.'Pei 28071 RBG Kew (UK) Rivularidium – Anemone canadensis L. 28068 South Dakota (USA), RBG Kew (UK) Anemonidium – Anemone narcissiflora L. 1864L Baden-Würtemburg, German Alps near Beuron (Germany), BG University of Zagreb (Croatia) Homalocarpus – Anemone baldensis L. 698G Vácrátót (Hungary), Anemone – Anemone trifolia L. 562 Botanical Garden of the University of Zagreb Anemone – Anemone cylindrica A. Gray 6559B Chemnitz (Germany) Anemone – Anemone multifida Poir. 1247 Chemnitz (Germany) Anemone – Anemone nemorosa L. 558 Dubravkin put, Zagreb (Croatia) Anemone – Anemone virginiana L. 11838B Quebec, Country Deux-Montaignes (Canada) Anemone – 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:22 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees PCR amplification and cloning PCR amplifications of the satDNA family AhTR1 were carried out in a 50 mL reaction mixture containing 10 ng template DNA, 0.4 mM of each primer, 200 mM dNTPs, 2.5 U GoTaq® DNA Polymerase and corresponding 1X (1.5 mM MgCl2) Green Reaction Buffer (Promega Cor., Madison, USA), using the primer pairs AhTR1-1 (5'GTGTGAGGTATA- ACACACTGT 3') and AhTR1-2 (5' TAGTGTTGTGGAATACACATC 3'). After an initial denaturing step at 94 °C for 3 min, the amplification was carried out in 30 cycles consisting of denaturation at 94 °C for 1 min, annealing at 54 °C for 10 sec and primer extension at 72 °C for 1 min with final extension at 72 °C for 20 min. Cloning and transformation procedure were carried out using the InsTAcloneTM PCR Cloning Kit (Fermentas GmbH, Germany) or pGEM®-T Easy Vector System (Promega, USA) according to the manufacturer's instruc- tions. Sequencing was carried out by Macrogen Inc. (Seoul, Korea). Sequence alignment and phylogenetic analysis The number of AhTR1 clones by Anemone taxa is indicated in table 2. AhTR1 clones of A. hortensis (EU769127-EU769132) were taken from MLINAREC et al. (2009). All se- quences obtained in this study are the result of cloning and are deposited in GeneBank under the accession numbers: A. ranunculoides AhTR1 (KC148493- KC148496), A. apennina AhTR1 (KC148497-KC148500), A. sylvestris AhTR1 (KC148501-KC148502), A. corona- ria AhTR1 (KC148503-KC148505), A. blanda AhTR1 (KC148506-KC148509), A. pal- mata AhTR1 (KC148510-KC148514), A. pavonina AhTR1 (KC148515-KC148520). Se- quences were aligned with Clustal X v1.81 (THOMPSON et al. 1997). The evolutionary history was inferred using the Neighbor-Joining method (SAITOU and NEI 1987). The evolutionary distances were computed using the Kimura 2-parameter model (KIMURA 1980) and are in the units of the number of base substitutions per site. The analysis involved 34 nucleotide sequences. All positions containing gaps and missing data were eliminated. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Evolutionary analyses were con- ducted in MEGA5 (TAMURA et al. 2011). 4 ACTA BOT. CROAT. 72 (1), 2013 BESENDORFER V., MLINAREC J. Tab. 2. Features of AhTR1 sequences by Anemone species. Taxa Sequence number Sequence length AT % Polymorphic sites Anemone apennina 4 490–494 66 104 A. blanda 4 455–458 67 41 A. coronaria 3 457–492 65 106 A. hortensis 6 489–485 68 163 A. palmata 5 385–495 67 100 A. pavonina 6 492–496 69 139 A. ranunculoides 4 488–495 66 84 A. sylvestris 2 496 67 67 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:22 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees Chromosome preparation and fluorescence in situ hybridization Chromosome preparations for FISH are described in MLINAREC et al. (2006). FISH ex- periments were done according to MLINAREC et al. (2012b). The probes Apav2AhTR1 and Abla3AhTR were directly labelled with Cy3-dCTP (Amersham, GE Healthcare, Little Chalfont, Buckinghamshire, UK) by using a nick-translation kit according to the manufac- turer's instructions (Roche Diagnostics GmbH, Mannheim, Germany). After overnight hy- bridization, slides were given a stringent wash in 1 X SSC. These stringency conditions al- lowed the target sequences of approx. 56% homology to remain hybridized (SCHWARZ- ACHER and HESLOP-HARRISON 2000). The preparations were mounted in Dako Fluorescent Mounting Medium (Dako North America, Inc., CA93013, USA) and stored at 4 °C. Signals were visualized and photographs captured on an Olympus BX51 microscope, equipped with a highly sensitive Olympus DP70 digital camera. An average of 10 well-spread metaphases was analyzed for each individual. Two individuals per taxa were analyzed. Southern hybridization Southern hybridization analyses were performed using Gene Images AlkPhos Direct Labelling and Detection System (Amersham, GE Healthcare, UK). Genomic DNA (gDNA) (1.6 mg) was digested over night with EcoRV (New England Biolabs, Ipswich, USA). Di- gested gDNA was loaded per lane on a 1% (w/v) agarose gel and electrophoretically sepa- rated for several hours at 100 V. DNA was blotted onto a positively charged nylon mem- brane (Roche, Basel, Switzerland) for one hour by using the Model 785 Vacuum Blotter (Biorad, Hercules, USA). Crosslinking was performed for 3 min (0.24 J cm–2) on an UVlink CL508M crosslinker (Uvitec, Cambridge, UK). The membrane was prehybridized for half hour and hybridized over night at 55 °C using the probe Apav2AhTR. Subsequently, the membrane was washed at 55 °C and room temperature according to manufacturer's instruc- tions. Results PCR amplification of the AhTR1 satellite family in Anemone To detect the presence of AhTR1 satDNA family we performed PCR amplification in Anemone. The AhTR1 repeat unit was amplified in 8 of 22 Anemone taxa. All eight species in which the AhTR1 was amplified were phylogenetically related, belonging to the Ane- mone section. Six of the eight taxa were members of the Mediterranean group Coronaria (A. apennina, A. blanda, A. pavonina, A. palmata, A. hortensis and A. coronaria). Surprisingly, AhTR1 was amplified in A. sylvestris and A. ranunculoides, members of the Multifida and Nemorosa groups, respectively, but not in their closest relatives. As expected, successful PCR amplification usually resulted in a ladder pattern of products (data not shown), sug- gesting that the AhTR1 family exhibits a tandem repeat organization in the genome. Sequence analysis To investigate diversity of AhTR1 satDNA family in Anemone we have sequenced a total of 32 monomeric repeats of the AhTR1 family belonging to a total of eight species of the genus Anemone. Table 2 details for each species the number of repeat analyses, ACTA BOT. CROAT. 72 (1), 2013 5 SATELLITE-DNA EVOLUTION IN ANEMONE 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:22 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees monomer length, base composition and polymorphism. The Anemone AhTR1 was 385–496 bp and 65–69% in A+T content. The number of polymorphic sites ranged from 41–163, being the lowest in A. blanda and the highest in A. hortensis. Percentage similarity across all 32 AhTR1 sequences ranges from 53–99%. Previously we found that AhTR1 satellite monomer of A. hortensis contains a pentanucletide sequence (CAAAA) that may have consequence for chromatin packing and sequence homogeneity (MLINAREC et al. 2009). Here we have found this motif in 26 out of 32 cloned AhTR1 sequences. Phylogenetic analysis To evaluate the phylogenetic signal of satDNA family in a genus we performed analyses with AhTR1 sequences as molecular markers. Un-rooted Neighbor-Joining tree showed 6 ACTA BOT. CROAT. 72 (1), 2013 BESENDORFER V., MLINAREC J. Clade I Clade II A p a lA h T R -3 A p a v A h T R -4A sy lA h T R -1 A al tA h T R -3 Ap a v Ah TR -2 A p al A hT R- 4 A r an A h T R- 3 A h TR -2 9 A c o rA h T R- 1 A c orA hT R-3 A pa vA hTR -3 A a peA hT R-2 A a p e A h T R -3 A p a v A h T R -6 A a p e A h T R -4 A p a lA h T R -5 A p a v A h T R -5 A h T R -3 4 A h T R -1 7 A h TR -1 6 As yl Ah TR -2 Ah TR - 3 3 A a p eAh TR- 1 A p al A h TR -2 A p al A h TR -6 A p avAh T R- 1 A ranA hT R- 1 A ra n A h T R -4 A ra n A h T R -2A h T R -2 2 A b la A h T R - 2 A b la A h T R -4 A c o rA h T R -2 A b la A h T R -1 AblaAhTR -3 0 .0 2 Fig. 1. Phylogenetic relationships among cloned AhTR1 sequences of A. apennina (AapeAhTR1), A. blanda (AblaAhTR1), A. coronaria (AcorAhTR1), A. hortensis (AhTR1), A. palmata (ApalAhTR1), A. pavonina (ApavAhTR1), A. ranunculoides (AranAhTR1) and A. sylvestris (AsylAhTR1). 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:23 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees separation of sequences into two slightly divergent clades: I and II. The sequences originat- ing from A. coronaria, A. sylvestris, A. apennina, A. palmata, A. hortensis, A. ranunculoides and A. pavonina fell within the two distinct clades I and II, while those from A. blanda fell only within clade II (Fig. 1). In both clades the sequences are intermingled. The only exception is A. blanda which showed a clear separation within clade II. Interestingly, one clone of A. coronaria associated with those of A. blanda. For more detailed phylogenetic analyses, more clones should be isolated from each individual. FISH in Anemone Clone Apav2AhTR1 was used as a probe to determine the chromosomal position of AhTR1 satDNA family in the Anemone taxa in which AhTR1 was PCR-amplified. The only exception was A. blanda in which clone Abla3AhTR was used as a probe as this species proved to have a distinctive AhTR1 family. The AhTR1 sequences were either completely lacking or predominantly localized at the intercalary DAPI-positive heterochromatic re- gions of chromosomes. Clear FISH signals were visible only in A. hortensis and A. pavonina (Fig. 2), while negative in situ results were obtained in the karyotypes of other six species in which the AhTR1 was PCR-amplified (data not shown). Southern blot analysis To determine the abundance and organization of AhTR1 isolated from A. hortensis within different species of Anemone, clone Apav2AhTR1 was hybridized to EcoRV- -digested genomic DNA of A. apennina, A. blanda, A. coronaria, A. hortensis, A. palmata, A. pavonina, A. ranunculoides and A. sylvestris (Fig. 3). In accordance with the FISH experiments, only A. hortensis and A. pavonina exhibited a strong ladder-like hybridization signal of similar intensity, suggesting that in these two species satDNA family AhTR1 is highly abundant and represented by a similar copy number. In the lanes of the six other species, the hybridization signal was hardly visible suggesting that in these species AhTR1 is present only as minor repeats. ACTA BOT. CROAT. 72 (1), 2013 7 SATELLITE-DNA EVOLUTION IN ANEMONE Fig. 2. FISH on mitotic chromosomes of Anemone hortensis (a) and A. pavonina (b) with labelled Apav2JME probe (in red). Bar = 10 µm. 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:27 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees Discussion Distribution of satDNA family AhTR1 is in agreement with phylogeny: the AhTR1 satDNA family is PCR-amplified in the European members of the Anemone section. By contrast, the phylogenetic tree of AhTR1 sequences is not congruent with the phylogeny of these species based on other markers. Using atpB-rbcL spacer region and ITS data MEYER et al. (2010) demonstrated that Anemone section contains three major clades: a basal clade composed of the members of the Baldensis group; a second clade composed of the members of the Nemorosa and Multifida groups; and a third clade including all tuberous Medi- terranean and American Anemone of the Coronaria group. In contrast, the tree based on AhTR1 sequences shows an intermixture of sequences originating from the members of the Coronaria, Nemorosa and Multifida groups with slight divergence of sequences into two clades. The lack of species-specific clustering can be partly explained by divergence of sequences in the ancestors of the species analyzed. However, it is possible that deeper sampling of sequences, within each species, might produce sub-trees that are more repre- sentative of species relationships. In the AhTR1 tree, the only exception is A. blanda, which shows low intra-individual nucleotide diversity and clear separation from the other Anemone taxa in which AhTR1 was amplified. The phylogenetic position of A. blanda has been debated for years. In the tree based on atpB-rbcL spacer region and ITS data A. blanda has a basal position to all anemones of the Anemone section. Thus, the position of A. blanda in the AhTR1 tree agrees with the position based on other molecular markers suggesting that although similar morphological characteristics and geographic distribution unite A. blanda with other Mediterranean anemones in the Coronaria group, this species underwent different evolu- tionary pathways than the other Mediterranean tuberous Anemone from the Coronaria group. The DNA library model proposed by FRY and SALSER (1977) hypothesized that closely related species share a set of satellite DNA families (satDNA library) differing in copy number and sequence divergence (UGARKOVI] and PLOHL 2002). As a consequence of the 8 ACTA BOT. CROAT. 72 (1), 2013 BESENDORFER V., MLINAREC J. Fig. 3. Genomic restriction digests (A) and Southern blotting analyses (B) of Anemone apennina (1), A. blanda (2), A. coronaria (3), A. hortensis (4), A. palmata (5), A. pavonina (6), A. ranun- culoides (7) and A. sylvestris (8) with restriction endonuclease EcoRV and probed with clone Apav2AhTR1. M – marker, bp – base pairs. 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:29 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees amplification of a particular satDNA family in a species, this satDNA becomes highly abundant, while the others are present only as minor repeats. This leads to species-specific profiles (UGARKOVI] and PLOHL 2002). In Anemone we have found a support for this hypothesis. The presence of AhTR1 in all Mediterranean anemones as well as in the representatives of the other two groups of the Anemone section (the Multifida and Nemo- rosa groups) suggests that this family was present in the common ancestor of the Anemone section. However, the highly dynamic nature of satDNA turnover resulted in considerable fluctuation in satellite copy number. In A. hortensis and A. pavonina it became highly abundant, while in other members it stayed only as minor repeats, even in the close relative A. coronaria. Furthermore, the AbS1 satDNA family constitutes the major fraction of A. blanda interstitial AT-rich heterochromatin, about 2 % of its genome, while in sister species A. apennina the family is present as minor repeats (HAGEMANN et al. 1993). These two satellite DNA families, AhTR1 and AbS1, are highly divergent (<35% similarity) suggest- ing that in A. hortensis and A. blanda different satDNA families were amplified and became abundant. This further supports the »satDNA library« hypothesis. Besides, it is worth mentioning that in the six species where AhTR1 was present in lower numbers, a ladder PCR pattern was still recovered. The tandem arrangement might be important for maintain- ing the identity of these repeats via homogenization mechanisms. There are, to our knowl- edge, few empirical examples for the »satDNA library« hypothesis in plants (KOUKALOVA et al. 2010, QUESADA DEL BOSQUE et al. 2011). The Mediterranean anemones are mostly diploids (except for A. palmata in which the autotetraploid 2n=4x=32 populations are reported, MÉDAIL et al. 2002). The experimental hybrids between A. coronaria, A. palmata and A. hortensis exhibit meiotic asyndesis and are completely sterile (MAÏA and VENARD 1976). As repetitive sequences constitute the major fraction of the genome, it is reasonable to suggest that these are responsive to maintaining reproductive isolation between the Mediterranean Anemone taxa. On the other hand, experimental hybrids between A. hortensis and A. pavonina exhibit relatively normal meiosis and fertility (MAÏA and VENARD 1976). Considering this and the existence of molecular and morphological similarities between A. hortensis and A. pavonina, EHREN- DORFER et al. (2009) proposed to treat A. hortensis and A. pavonina as one polymorphic species, i.e. A. hortensis s.l. The results of this study showed that A. hortensis and A. pavonina share similar species-specific satDNA profile and thus clearly support the treat- ment of A. hortensis and A. pavonina as one species, i.e. A. hortensis s.l. In summary, the study of AhTR1 satellite DNA in Anemone reveals a complex evolu- tionary history where differential levels of satellite DNA amplification in different lineages, at different evolutionary times, and in different chromosomal places gave rise to sequence variants persisting as »library« (ME[TROVI] et al. 1998). Acknowledgements We thank Darko Mihelj for maintaining the plant material and Avionan Danin, Mare Lisi~kova, Peter Brownless from RBG Edinburgh and Mario Vallejo-Marin for assistance with the collection of plant material. This work was funded by the Ministry of Science, Edu- cation and Sport of the Republic of Croatia, grant no. 119-1191196-1201. ACTA BOT. CROAT. 72 (1), 2013 9 SATELLITE-DNA EVOLUTION IN ANEMONE 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:29 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees References BAUMBERGER, H., 1970: Chromosomenzahlbestimmungen und karyotypanalysen bei den Gattungen Anemone, Hepatica und Pulsatilla. Berichte der Schweizerischen Botani- schen Gesellschaft 80, 17–95. BÖCHNER, T. W., 1945: Meiosis in Anemone apennina with special reference to chiasmata localization. Hereditas 31, 221–231. CSINK, A., HENIKOFF, S., 1998: Something from nothing: the evolution and utility of satellite repeats. Trends in Genetics 14, 200–204. DOVER, G.A., 1986: Molecular drive in multigenes families. How biological novelties arise, spread and are assimilated. Trends in Genetics 168, 159–165. EHRENDORFER, F., SAMUEL, R., 2001: Contributions to a molecular phylogeny and systematics of Anemone and related genera (Ranunculaceae-Anemoninae). Acta Phytotaxonomica Sinica 39, 293–307. EHRENDORFER, F., ZIMAN, S. N., KÖNIG, C., KEENER, C. S., DUTTON, B. E., TSARENKO, O. N., BULAKH, E. V., BOSCAIU, M., MÉDAIL, F., KÄSTNER A., 2009: Taxonomic revision, phy- logenetics and transcontinental distribution of Anemone section Anemone (Ranuncula- ceae). Botanical Journal of the Linnean Society 160, 312–354. FRY, K., SALSER, W., 1977: Nucleotide sequence of Hs-a satellite DNA from kangaroo rat Dipomys ordii and characterization of similar sequences in other rodents. The Cell 12, 1069–1084. HAGEMANN, S., SCHEER, B., SCHWEIZER, D., 1993: Repetitive sequences in the genome of Anemone blanda: Identification of tandem arrays and dispersed repeats. Chromosoma 102, 312–324. HEIMBURGER, M., 1959: Cytotaxonomic studies in the genus Anemone. Canadian Journal of Botany 37, 587–612. HOOT, S. B., REZNICEK, A. A., PALMER, J. D., 1994: Phylogenetic relationships in Anemone (Ranunculaceae) based on morphology and chloroplast DNA. Systematic Botany 19, 169–200. KIMURA, M., 1980: A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111–120. KOUKALOVA, B., MORAES, A. P., RENNY-BYFIELD, S., MATYASEK, R., LEITCH, A. R., KOVARIK, A., 2010: Fall and rise of satellite repeats in allopolyploids of Nicotiana over c. 5 million years. New Phytologist 186, 148–160. MAÏA, N., VENARD, P., 1976: Contribution a l'étude cytotaxonomique d'espèces Méditerra- néennes d'Anemone et de leurs hybrides. Canadian Journal of Genetic and Cytology 18, 151–168. MARKS, G. E., 1974: Giemsa banding of meiotic chromosomes in Anemone blanda L. Chro- mosoma 49, 113–119. MARKS, G. E., SCHWEIZER, D., 1974: Giemsa banding: karyotype differences in some spe- cies of Anemone and in Hepatica nobilis. Chromosoma 44, 405–416. 10 ACTA BOT. CROAT. 72 (1), 2013 BESENDORFER V., MLINAREC J. 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:29 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees MÉDAIL, F., ZIMAN, S., BOSCAIU, M., RIERA, J., LAMBROU, M., VELA, E., DUTTON, B., EHREN- DORFER, F., 2002: Comparative analysis of biological and ecological differentiation of Anemone palmata L. (Ranunculaceae) in the western Mediterranean (France and Spain): an assessment of rarity and population persistence. Botanical Journal of the Linnean So- ciety 140, 95–114. ME[TROVI], N., PLOHL, M., MRAVINAC, B., UGARKOVI], \., 1998: Evolution of satellite DNAs from the genus Palorus-experimental evidence for the »library« hypothesis. Mo- lecular Biology and Evolution 15, 1062–1068. MEYER, K. M., HOOT, S. B., ARROYO, M. T. K., 2010: Phylogenetic affinities of South American Anemone (Ranunculaceae) including the endemic segregate genera, Barneo- udia and Oreithales. International Journal of Plant Sciences 171, 323–331. MLINAREC, J., CHESTER, M., SILJAK-YAKOVLEV, S., PAPE[, D., BESENDORFER, V., 2009: Mo- lecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae). Chromosome Research 17, 331–343. MLINAREC, J., PAPE[, D., BESENDORFER, V., 2006: Ribosomal, telomeric and heterochroma- tin sequences localization in the karyotype of Anemone hortensis. Botanical Journal of the Linnean Society 150, 177–186. MLINAREC, J., [ATOVI], Z., MALENICA, N., IVAN^I]-BA]E, I., BESENDORFER, V. 2012a: Evo- lution of the tetraploid Anemone multifida (2n = 32) and hexaploid A. baldensis (2n = 48) (Ranunculaceae) was accompanied by rDNA loci loss and intergenomic transloca- tion: evidence for their common genome origin. Annals of Botany 110, 703–712. MLINAREC, J., [ATOVI], Z., MIHELJ, D., MALENICA, N., BESENDORFER, V., 2012b: Cyto- genetic and phylogenetic studies of diploid and polyploid members of tribe Anemoninae (Ranunculaceae). Plant Biology 14, 525–536. QUESADA DEL BOSQUE, M. E., NAVAJAS-PEREZ, R., PANERO, J. L., FERNANDEZ-GONZALEZ, A., GARRIDO-RAMOS, 2011: A satellite DNA evolutionary analysis in the North American endemic diocious plant Rumex hastatulus (Polygonaceae). Genome 54, 253–260. ROTHFELS, K., SEXSMITH, E., HEIMBURGER, M., KRAUSE, M. O., 1966: Chromosome size and DNA content of species of Anemone and related genera (Ranunculaceae). Chromosoma 20, 54–74. SAITOU, N., NEI, M., 1987: The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425. SCHUETTPELZ, E., HOOT, S. B., SAMUEL, R., EHRENDORFER, F., 2002: Multiple origins of Southern hemisphere Anemone (Ranunculaceae) based on plastid and nuclear sequence data. Plant Systematics and Evolution 231, 143–151. SCHWARZACHER, T., HESLOP-HARRISON, J. S., 2000: Practical in situ hybridization. Oxford: Bios. TAMURA, K., PETERSON, D., PETERSON, N., STECHER, G., NEI, M., KUMAR, S., 2011: MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary dis- tance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731– 2739. ACTA BOT. CROAT. 72 (1), 2013 11 SATELLITE-DNA EVOLUTION IN ANEMONE 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:29 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees TAMURA, M., 1995: Angiospermae: Ordnung Ranunculales, Fam. Ranunculaceae, Anemo- neae. In: HIEPKO, P. (ed.), Die Natürlichen Pflanzenfamilien 17a, 4, 324–349. Duncker and Homblot, Berlin. THOMPSON, J. D., GIBSON, T. J., PLEWNIAK, F., JEANMOUGIN, F., HIGGINS, D. G., 1997: CLU- STAL-X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. UGARKOVI], \., PLOHL, M., 2002: Variation in satellite DNA profiles-causes and effects. The EMBO Journal 21, 5955–5959. 12 ACTA BOT. CROAT. 72 (1), 2013 BESENDORFER V., MLINAREC J. 701 Besendorfer and Mlinarec.ps U:\ACTA BOTANICA\Acta-Botan 1-13\701 Besendorfer and Mlinarec.vp 14. o ujak 2013 10:27:29 Color profile: Generic CMYK printer profile Composite 150 lpi at 45 degrees