abc: A Pathfinder

This is a computer-generated pathfinder created against the Distant Reader study called abc.

Each Distant Reader study carrel is composed of many individual items. Each item is bibliographically described with author, title, date, summary, and keyword values. Below is a list of the items' most signficant keywords as well as lists of the items themselves. Purpusing the content of this pathfinder provides the student, researcher, or scholar with one way to get their heads around the scope of the carrel. The keywords include:

Plant; Stress; Acta; Flora; Vegetation; Plants; Water; Croatia; Taxa; Diatom; Leaf; Profile; Cells; Growth; Soil; Leaves; Pollen; Activity; Populations; Germination; Salt; Communities; Subsp; Valve; Analysis; Diversity; Seed; Lake; Seeds; Montenegro; Var; Cell; Croat; Tab; Mediterranean; Distribution; Length; River; Chlorophyll; Turkey; Acid; Figs; Zagreb; Diatoms; Drought; Salinity; Phytoplankton; L–1; Community; Roots; Temperature; Surface; Adriatic; Chromosome; Dna; Fungi; Genus; Type; Samples; Italy; Trichomes; Croatian; Traits; Iamonico; Fruit; Professor; Potentilla; Sequences; Association; Habitats; Bosnia; Hairs; Book; Markers; Brullo; A.s.l; Mts; Poland; Width; Slovenia; Min; Onion; Majus; Suppl; Science; Dubrovnik; Carex; Mericarp; Park; Romania; Čarni; Verticillata; Varieties; Editor; Notatum; Bbc; Bilgineri; Cedricola; Phaeothamnos; Chlf; Caucasus; Carthaginensis

Depending on how this pathfinder was created, many of the bibliographic sections will include elaborations on the meaning(s) of the given keywords. These elaborations were generated by feeding the items' summaries to a large langauge model and asking the model to address the question, "What is X?", where "X" is the keyword. The result will be a few sentences of elaboration. Be forewarned. The elaborations are often plausible, but they should not be take as truth. Instead, they should be taken as points for consideration.

• Physiological and biochemical responses of Fibigia triquetra (DC.) Boiss. to osmotic stress by Vujcic, Valerija; Radic Brkanac, Sandra (2014) - FAROOQ, M., WAHID, A., KOBAYASHI, N., FUJITA, D., BASRA, S. M. A., 2009: Plant drought stress: effects, mechanisms and management. Boiss. to osmotic stress VALERIJA VUJČIĆ*, SANDRA RADIĆ BRKANAC Department of Biology, Faculty of Science, University of Zagreb, Rooseveltov trg 6, HR-10000 Zagreb, Croatia Abstract – Water defi cit in the soil leads to osmotic stress in plants. Keywords: aldrich; content; mannitol; peg; period; plant; sigma; stress; triquetra; water
• Heat tolerance indicators in Pakistani wheat (Triticum aestivum L.) genotypes by Khan, Sami U.; Din, Jalal U.; Qayyum, Abdul; Jaan, Noor E.; Jenks, Matthew A. (2015) - Thus, there is a dire need for the development of heat tolerant wheat genotypes through a breeding program for cultivation under heat stress environments like those prevailing in Pakistan. Keywords: anthesis, grain yield, heat stress, membrane stability index, milky seed stage, proline, soluble proteins, Triticum aestivum L., wheat Introduction High temperature is a major problem in fi eld cropping systems world-wide, with unex- pected spatial and temporal variations causing reduced plant growth and productivity (PAR- ENT et al. 2010). Keywords: anthesis; as-2002; genotypes; grain; growth; heat; heat stress; plant; proline; signifi; stage; stress; yield
• Cloning, characterization and expression analysis of NBS-LRR-type resistance gene analogues (RGAs) in coconut by Rachana, Kaitheri Edathil; Naganeeswaran, Sudalaimuthu Asari; Fayas, Thayale Purayil; Thomas, Regi Jacob; Rajesh, Muliyar Krishna (2016) - Ellis, J., Dodds, P., Pyror, T., 2000: Structure, function and evolu- tion of plant disease resistance genes. Shivaramakrishnan, S., Seetharama, N., 2001: Identifi cation and isolation of disease resistance genes in crop plants. Keywords: coconut; disease; domain; fig; gene; lrr; motifs; nbs; palm; pcr; plant; protein; region; resistance; rgas; rnbs; sequences; structure
• Spring weed communities of rice agrocoenoses in central Nepal by Nowak, Arkadiusz; Nowak, Sylwia; Nobis, Marcin (2016) - Rice fi elds are still recognized globally as well as in southern Asia as important refuges for many wetland and water species. Data and analyses During the study, in May 2013, 108 vegetation relevés were collected in rice fi elds in central Nepal (Fig. 1). Keywords: association; central; communities; cover; elds; nepal; nowak; phytocoenoses; plant; plots; rice; species; tab; vegetation; water; weed
• Dwarf shrub vegetation of rock ledges and clefts in the Pamir Alai Mountains (Middle Asia: Tajikistan) by Nowak, Arkadiusz; Nowak, Sylwia; Nobis, Marcin; Nobis, Agnieszka (2016) - The paper is a part of our survey on rock vegetation in Tajikistan with the fi nal intention of building up the syn- taxonomical system of all types of rupicolous environments within the country. 75 (1), 2016 on typical rock vegetation (Asplenietea trichomanis) have been presented in recent years, still little is known regard- ing the scree and talus vegetation or the transitional micro- habitats of much eroded rocks or stabile screes (Nowak et al. 2014a, 2014b, 2014c). Keywords: acta; alai; asia; communities; dwarf; mts; nobis; nowak; pamir; plant; plots; ranges; rock; species; tajikistan; vegetation; western
• Physiological responses of two halophytic grass species under drought stress environment by Siddiqui, Zamin Shaheed; Shahid, Huda; Cho, Jung-Il; Park, Sung-Han; Ryu, Tae-Hun; Park, Soo-Chul (2016) - 75 (1), 31–38, 2016 CODEN: ABCRA 25 DOI: 10.1515/botcro-2016-0018 ISSN 0365-0588 eISSN 1847-8476 Physiological responses of two halophytic grass species under drought stress environment Zamin Shaheed Siddiqui1*, Huda Shahid1, Jung-Il Cho2*, Sung-Han Park2, Tae-Hun Ryu2, Soo-Chul Park2 1 Stress Physiology Lab., Department of Botany, University of Karachi, Karachi – 75270, Pakistan 2 National Academy of Agricultural Sciences, Rural Development Administration, Suwon 441-707, Republic of Korea Abstract – The physiological responses of two halophytic grass species, Halopyrum mucronatum (L.) Staph. and Cenchrus ciliaris (L.), under drought stress were evaluated. Results were discussed in relation to comparative physiological performance and antioxidant enzymes activity of both halophytic grasses under drought stress. Keywords: ciliaris; content; drought; drought stress; mucronatum; plant; species; stress; water
• Selenium induced selenocysteine methyltransferase gene expression and antioxidant enzyme activities in Astragalus chrysochlorus by Cakir, Ozgur; Turgut Kara, Neslihan; Ari, Sule (2016) - These results show that an increase of SMT gene expression led to a rise in APX and POX, but a suppression of CAT and GR enzymes activities in Astragalus chrysochlorus. We used qPCR to measure SMT gene expression. Keywords: activity; astragalus; callus; chrysochlorus; expression; gene; plant; selenium; smt
• Pollen morphology and the flower visitors of Chaerophyllum coloratum L. (Apiaceae) by Macukanovic-Jocic, Marina; Stesevic, Danijela; Rancic, Dragana; Dajic Stevanovic, Zora (2017) - By determining the spectrum of pollen types in honey and calculating the relative frequency of C. coloratum as the respective per- centage with respect to the total number of pollen grains, it would be possible to confi rm or deny the attractiveness of this species to honeybees. In a polar view, C. coloratum grains are triangular, as in the three above-mentioned pollen types, whereas in an equato- rial view, inner and outer contour of both, colpial and meso- colpial sides, is concave without any sexine extension above the endoapertures, as has been observed in C. hirsu- tum pollen type. Keywords: apiaceae; chaerophyllum; coloratum; fig; grains; journal; ower; plant; pollen; species; type; visitors
• Five new alien species in the flora of Montenegro: Coreopsis tinctoria Nutt., Ipomoea indica (Burm.) Merr., Lupinus × regalis Bergmans, Physalis angulata L., and Solidago canadensis L. and new possible threats to the biodiversity by Stesevic, Danijela; Bubanja, Nada (2017) - This paper presents a supplement to the national list of alien plant species in Montenegro as well as to the general distribution of the mentioned aliens in SE Europe. Acknowledgements Authors would like to thank F. Essl, B. Beckmann, J., Jogan, M, Lešnik, V. Vladimirov, G. Fried, F. Verloove, M. Rat, V. Matevski for valuable help with the literature and information on alien plant species and Snežana Bulajić for improving our use of English. Keywords: alien; flora; montenegro; new; ora; physalis; plant; species
• The effect of agricultural landscape type on field margin flora in south eastern Poland by Wrzesien, Malgorzata Beata; Denisow, Bozena (2016) - This is consistent with a study conducted in Mediterranean region (Bassa et al. 2011) or Finland (Tarmi et al. 2009) and indicates the essentiality of fi eld margins as hotspots of plant species richness in agricultural landscape, irrespective of geographic regions, climatic types or fl ora history. Our results confi rm the fi ndings that fi eld margins are useful for the conservation of biodiversity in the agricultur- al landscape, as well as for plant species currently consid- ered rare, threatened or endangered. Keywords: diversity; eld; eld margins; fi eld; habitats; landscape; margins; ora; plant; poland; species; type
• Long-term abandonment of croplands in the sub-Mediterranean climate does not lead per se to the recovery of the semi-natural herb communities deemed worthy of conservation in the EU Habitats Directive by Troiani, Natalia; Tardella, Federico Maria; Malatesta, Luca; Corazza, Marcello; Ferrari, Carlo; Catorci, Andrea (2016) - This is consistent with previous research, which showed that in the sub-Mediterranean climate, landforms are key factors in determining plant species and communi- ties distribution (Arévalo et al. 2012, Burrascano et al. 2013, Catorci et al. 2014b). Moreover, altitude and land form (Burrascano et al. 2013), soil features (Catorci and Gatti 2010), land use history (Catorci et al. 2011a) and disturbance type and intensity (Peco et al. 2006, de Bello et al. 2007, Kramberger and Kaligarič 2008, Catorci et al. 2012, Ribeiro et al. 2012) have proved to be crucial factors in determining grassland species composition. Keywords: abandonment; communities; cover; grasslands; group; indicator; mean; plant; soil; species; t3.1; t3.2; tab; values; vegetation
• Micropropagation of the narrow endemic Hladnikia pastinacifolia (Apiaceae) by Ambrozic-Dolinsek, Jana; Ciringer, Terezija; Kaligaric, Mitja (2016) - Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests. Further studies on this species will focus on other specifi c biotechnological tools successfully used in several programs of plant conservation, like assessment of the de- gree of genetic variability of plants in culture and introduc- tion of techniques for long-term storage at low tempera- tures. Keywords: bap; culture; growth; iba; medium; pastinacifolia; plant; seeds; shoots
• Early spring flora of the Sub-Pannonic steppic grassland (NATURA 2000 site) in Bilje, northeast Croatia by Zuna Pfeiffer, Tanja; Spoljaric Maronic, Dubravka; Zahirovic, Vanda; Stevic, Filip; Zjalic, Milorad; Kajan, Katarina; Ozimec, Sinisa; Mihaljevic, Melita (2016) - H 5 Geranium sanguineum L. H 1 Geranium dissectum L. T 8 Lamiaceae Ajuga genevensis L. H 5 Lamium purpureum L. T 2 Mentha aquatica L. H 5 Salvia pratensis L. H 2 Thymus pulegioides L. Ch 2 Glechoma hederacea L. H 5 Oleaceae Syringa vulgaris L. N 7 Papaveraceae Papaver dubium L. T 8 Papaver rhoeas L. T 5 Plantaginaceae Plantago lanceolata L. H 5 Plantago media L. H 5 Polygalaceae Polygala comosa Schkuhr H 5 Polygonaceae Rumex acetosa L. subsp. In the early List of taxa Life form Choro- logical types Threat levels Viola tricolor L. T 5 Viola odorata L. H 2 LILIATAE Amaryllidaceae Allium sphaerocephalon L. subsp. Keywords: bilje; croatia; grassland; l. h; ora; plant; species; steppe; subsp; taxa
• Micromorphological, anatomical and cytogenetical studies in endemic Crepis macropus Boiss. & Heldr. (Asteraceae) from Turkey by Inceer, Huseyin; Kalmuk, Nursen Aksu; Imamoglu, Kemal Vehbi; Duman, Ozge; Hayirlioglu-Ayaz, Sema; Arslan, Gokhan (2016) - Crepis macropus is an endemic species that belongs to section Berinia (Babcock 1947a, b, Enke 2009). Crepis macropus exhibits clos- er similarities to its Balkan relatives, C. turcica and C. al- banica, than to those of Anatolia, but it is more like C. turcica based on its habit, involucres, fl orets and achenes (Babcock 1947b). Keywords: achene; anatomy; chromosome; crepis; enke; inceer; macropus; plant; species
• The effect of biostimulant and fertilizer on “low input” lettuce production by Dudas, Slavica; Sola, Ivana; Sladonja, Barbara; Erhatic, Renata; Ban, Dean; Poljuha, Danijela (2016) - During frost, all variants of lettuce treatments and the control variants were additionally protected with agrotextile (17 g m–2). Compared to the result of Premuzic et al. (2001) who found that N or biosta- bilised compost fertilization does not change lettuce vita- min C content, we found that Megagreen fertilizer increased vitamin C content in lettuce and in this term suggest it as a better choice for lettuce treatment. Keywords: bio; content; control; effect; lettuce; mass; megagreen; nitrate; plant; s-90; signifi; treatment; yield
• Influence of soil traits on polyphenols level in Moltkia petraea (Tratt.) Griseb. (Boraginaceae) by Kremer, Dario; Jurisic Grubesic, Renata; Ballian, Dalibor; Stesevic, Danijela; Kosalec, Ivan; Vukovic Rodriguez, Jadranka; Vukobratovic, Marija; Srecec, Sinisa (2016) - A negative correlation was found between soil phosphorus content and total phenols content in leaves and stems, and with the total phenolic acids content in fl owers. Phenolic compound content was higher in leaves than in fl owers or stems. Keywords: compounds; content; leaves; owers; petraea; phenolic; plant; populations; soil; stems; total
• Effects of biodynamic production on growth and essential oil content in basil by Dudas, Slavica; Poljuha, Danijela; Sola, Ivana; Segula, Sabina; Varga, Sanja; Sladonja, Barbara (2016) - Sweet basil essential oil is used in medicine, for aromatherapy, and the cosmetic and food industries (Pu- tievsky and Galambosi 1999), and as an insecticide (Ume- rie et al. 1998, Keita et al. 2001, Pascual-Villalobos and Ballesta-Acosta 2003). Sweet basil (Ocimum basilicum L.) is the most widely grown Ocimum species in the world for the fresh market, but also for essential oil production (Zheljazkov et al. 2008). Keywords: basil; basilicum; cultivars; date; leaf; oil; plant; production; sowing; species
• Chemical composition and antifungal potential of medicinal plants against seedborne mycoflora of eggplant (Solanum melongena L.) by Ashiq, Bushra; Chohan, Sobia; Perveen, Rashida; Abid, Muhammad; Abid Mehmood, Mirza (2017) - A potentially useful substitute for expensive and possibly toxic fungicides could befound in plant extracts (Joseph et al. 2008). Although use of plant extracts is less laborious, more economical and more eco-friendly than that of fungicides, it is still not popular among stakeholders. Keywords: avus; camaldulensis; concentration; extract; growth; oxysporum; plant; seed; stolonifer
• Aquatic plant Trapa natans L. as bioindicator of trace metal contamination in a freshwater lake (Skadar Lake, Montenegro) by Petrovic, Dragana; Jancic, Dejan; Furdek, Martina; Mikac, Nevenka; Krivokapic, Sladjana (2016) - In order to evaluate possible ecotoxic effect of metal concentrations in sedi- ments we compared the measured concentrations with the most frequently used sediment quality criteria for freshwa- ter sediment (MacDonald at al. 2000), which defi ne TEC (threshold level concentration) as a lower limit below which toxic effect is not probable, and PEC (probable effect concentration) as an upper limit above which toxicity to aquatic organisms can be expected (On-line Suppl. A long way ahead: understanding and engineering plant metal accumulation Trends in Plant Science 7, 308–315. Keywords: concentrations; fig; lake; locations; metals; plant; root; sediment; stem
• Genetic analysis of microsatellite markers for salt stress in two contrasting maize parental lines and their RIL population by Yumurtaci, Aysen; Sipahi, Hulya; Zhao, Li (2017) - Ribosome biogenesis protein 1e-94 Not suitable for primer design – ZM14-AI855164 (AT)5/ P Z. mays Unknown protein 4e-08 GTGCAGAGACGGACAGCGAGT TTTTGAGTTTTGCCGGAGTGG 346 ZM14-AI855182 (AT)6/ P Z. mays Glyceraldehyde-3- dehydrogenase 1e-47 CGACTCCCAACAGGAAATGGA GTCGCCTGGTACGACAACGAG 349 ZM14-AI855214 (TA)5/ P Z. mays Unknown protein 5e-61 TGGATCGAAGCAACTCGCACT CAACAGCGTCAAGAGCGTCAA 310 ZM14-AI855258 (TC)13/ P- (TA)3, (CACAG)6/ IP Z. mays Unknown protein 3e-19 GAGATAGGCGAGGAAGGTGAG ATCGTCATCATTCGAGCAGAG 180 ZM14-AI855272 (AGG)6/ P Z. mays Putative MYB binding protein 2e-43 GACCTCAACCTCGACCTCTG GGCTTCGTTCACTTCATCTTG 275 ZM14-AI855286 (CTG)9/ P Z. mays Unknown protein 3e-34 CCCTCTCTTTTCTCAGCCCTA ATCCAGAGGACGAGGGTTTT 288 ZM14-AI855336 (CGC)5/ P Z. mays Hypothetical protein 2e-28 GAGAAGCCGAGAACAGTAGCA CACGAGGCAGAGTCGTAGTTT 365 ZM14-AI855352 (GC)5/ P- (CGC)6, (CGA)3/ IP Z. mays Hypothetical protein 8e-11 CGAGAGCGCCATTAGAAGTCG TTTTGTGGAACGAAGCGATGG 401 ZM14-AI855361 (ACC)9,(TA)5/ P Z. mays Unknown protein 2e-47 GACCTGGAGTGGTGGTTC GATGGGATACAAATACAATAC 481 ZM14-AI649556 (CTG)5/ P Z. mays Lysin decarboxylase 3e-07 CCGGGTTTTGGACTTTGGAGA TGTTGTGGCTCTTTGCCTGTG 301 ZM14-AI861145 (TT)5,(GTC)5/ P Z. mays Not suitable for primer design – ZM14-Contig68* (AT)5/ P Z. mays Aquaporin plasma membran protein 1e-32 AAACAGGGAGTCTTCTTCTTAAC AAACAGGGAGTCTTCTTCTTAAC 382 ZM14-Contig79 (CG)5/ P Z. mays Unknown protein 3e-166 Not suitable for primer design – ZM14-Contig106* (TT)6/ P Z. mays Hypothetical protein 1e-48 GCCCATATTACATACAAAAG CAACAAGAAGGTTTATTCTG 708 ZM14-Contig114 (GG)5/ P Z. mays Unknown protein 5e-48 TGGACCAAACATCGGTTGAGC GAATGGAAGGAAGAGGGGTGGT 530 ZM14-Contig119 (ACA)5,(CCA)6/ P(CCG)5,(CCA)3/IP Z. mays Hypothetical protein 6e-39 TGGCCCCACCTGATGAAATAA GGAGTGGAGGCGGAGGATCT 615 ZM14-AI649544 (TA)3,(TGGA)5/ IP Z. mays Oxin transporter protein 1e-81 CGATGCCGAAAACCCATTCTT GCATCTGCTCGTGGAGGAAAA 303 ZM14-AI649556 (CTG)5/ P Z. mays Lysin decarboxylase 3e-07 Not suitable for primer design – ZM14-AI855154 (GAG)3,(CTG)5/ IP Z. mays Hypothetical protein 0.002 TGGTCCTGCTGCTTCTCTTGC CAAACGGTCCACCTCCACCTC 316 ZM14-AI855158 (AT)5/ P Z. mays Keywords: est; et al; maize; mapping; markers; mays; plant; protein; repeats; salt; sequence; ssr; z. mays; zm13; zm14
• Ecological, floristic and functional analysis of zonal forest vegetation in Bosnia and Herzegovina by Stupar, Vladimir; Carni, Andraž (2016) - Using data from Bosnia and Herzegovina, this study aimed to reveal whether macro-climate is indeed the most important factor determining the existence of zonal forest plant communities (ZFPC). Zonal forest plant communities in Bosnia and Herzegovina. Keywords: analysis; b&h; bosnia; communities; community; ecological; et al; fig; forests; herzegovina; plant; quercus; species; tab; vegetation; zfpcs; zonal
• Relation between plant species diversity and landscape variables in Central-European dry grassland fragments and their successional derivates by Pausic, Igor; Ivajnsic, Danijel; Kaligaric, Mitja; Pipenbaher, Natasa (2017) - 76 (2), 111–119, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0001 ISSN 0365-0588 eISSN 1847-8476 Relation between plant species diversity and landscape variables in Central-European dry grassland fragments and their successional derivates Igor Paušič, Danijel Ivajnšič, Mitja Kaligarič, Nataša Pipenbaher Biology Department, Faculty of Natural Sciences and Mathematics, University of Maribor, Koroška c. 160, SI-2000 Maribor, Slovenia Abstract – A systematic field survey of an area of 843 ha in the traditional Central-European agricultural landscape of Goričko Nature Park in Slovenia revealed 80 fragments of dry semi-natural grasslands. Our results show that fragment size does not affect plant species diversity. Keywords: alpha; area; diversity; fragments; grassland; groups; habitat; landscape; plant; plant species; species; species diversity; twinspan
• Allium cepa root meristem cells under osmotic (sorbitol) and salt (NaCl) stress in vitro by Kielkowska, Agnieszka (2017) - 76 (2), 146–153, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0009 ISSN 0365-0588 eISSN 1847-8476 Allium cepa root meristem cells under osmotic (sorbitol) and salt (NaCl) stress in vitro Agnieszka Kiełkowska Institute of Plant Biology and Biotechnology, Faculty of Biotechnology and Horticulture, University of Agriculture in Krakow, Al. 29-Listopada 54, 31-425 Krakow, Poland Abstract – The effects of various concentrations of sorbitol (100, 200 and 360 mM) and NaCl (100, 200 and 300 mM) on root meristem cells of in vitro-cultured Allium cepa L. were analyzed after 10 and 20 days. Af- ter the 10-day treatment, root meristem cells of plants grown on medium supplemented with 100 mM of sorbitol were 16% smaller than control cells during the same period of time, while after 20 days of exposure cells were 28% smaller. Keywords: cells; control; meristem; nacl; onion; osmotic; plant; root; salt; sorbitol; stress
• Comparative analysis of secondary metabolites and antioxidant capacity in vitro of different natural populations of Globularia spp. by Friscic, Maja; Maslo, Semir; Garic, Rade; Males, Zeljan; Hazler Pilepic, Kroata (2018) - Maja Friščić1*, Semir Maslo2, Rade Garić3, Željan Maleš1, Kroata Hazler Pilepić 1 1 Department of Pharmaceutical Botany, Faculty of Pharmacy and Biochemistry, University of Zagreb, Zagreb, Croatia 2 Lundåkerskolan, Gislaved, Sweden 3 Institute for Marine and Coastal Research, University of Dubrovnik, Dubrovnik, Croatia Abstract – Total phenolic, flavonoid, condensed tannin and iridoid content, as well as antioxidant capacity in vi- tro, were determined spectrophotometrically in methanolic extracts of different plant parts of the Mediterranean medicinal plant Globularia alypum L. and three widespread European species of the same genus: G. cordifolia L., G. meridionalis (Podp.) A two- way analysis of variance (ANOVA) followed by the Bonfer- roni post-hoc test was carried out on averaged results for plant parts of each species, to determine significant differ- ences among the same plant parts of different species and different plant parts of the same species. Keywords: alypum; antioxidant; content; cordifolia; et al; globularia; metabolites; parts; phenolic; plant; species
• Media composition affects seed dormancy, apical dominance and phenolic profile of Knautia sarajevensis (Dipsacaceae), Bosnian endemic by Karalija, Erna; Cavar Zeljkovic, Sanja; Tarkowski, Petr; Muratovic, Edina; Paric, Adisa (2018) - Decapita- tion was relatively successful as a tool for apical dominance suppression in K. sarajevensis shoot cultures. Establishment of the shoot cultures and apical dominance suppression Roots were removed from all germinated seedlings prior to cultivation on shoot culture media. Keywords: acid; dominance; germination; kinetin; l–1; media; mg l–1; phenolic; plant; sarajevensis; shoots
• Archaeobotanical components of grave goods in prehistoric tumuli 6 and 7 at the archaeological site of Kaptol-Gradci, near Požega (Croatia) by Sostaric, Renata; Potrebica, Hrvoje; Hrsak, Jelena; Marekovic, Sara (2017) - Tumuli at archaeological site of Kaptol-Gradci investigated during the excavation campaign: a) tumulus 6, b) an element of a belt set of iron and bronze and c) bronze strap dividers from horse gear from tumulus 6; d) tumulus 7, e) chamber of tumulus 7 with the posi- tion of the pot, f) pot covered with two small bowls; it was used as an urn. Overview of finds (total number and percentage) of indi- vidual plant families within the group of cereals from tumuli at archaeological site Kaptol-Gradci: a) tumulus 6, b) tumulus 7. a b ŠOŠTARIĆ R., POTREBICA H., HRŠAK J., ESSERT S. 190 ACTA BOT. Keywords: burial; finds; gradci; grave; kaptol; plant; potrebica; remains; samples; site; tumuli; tumulus
• Identification and expression profiling of flax (Linum usitatissimum L.) polyamine oxidase genes in response to stimuli by Eom, Seung Hee; Lee, Jae Kook; Kim, Dong-Ho; Kim, Heekyu; Jang, Keum-Il; Ryu, Hojin; Hyun, Tae Kyung (2018) - Taken together, our genome-wide analysis of PAO genes and expression profiling of these genes provide the first step toward the functional dissection of LuPAOs. In order to iden- tify PAO genes, sequences of PAOs from Arabidopsis and rice were analyzed using BLASTp against all scaffold se- quences of flax. Keywords: analysis; cell; expression; fig; flax; genes; lupao; paos; plant; polyamine
• Salicylic acid-induced germination, biochemical and developmental alterations in rye (Secale cereale L.) by Yanik, Fatma; Ayturk, Ozlem; Cetinbas-Genc, Aslihan; Vardar, Filiz (2018) - Numerous re- searches indicated that SA content increases under various types of oxidative stress conditions in plants (Larkindale and Knight 2002, War et al. 2011). This situation can be explained by SA treatment stimulating plant growth by stimulating mitotic activity (Shakirova et al. 2003). Keywords: acid; activity; control; growth; plant; salicylic; stress; µm sa
• The impact of special-temporal changes in flora attributes and pollen availability on insect visitors in Lamiaceae species by Jachula, Jacek; Wrzesien, Malgorzata; Strzalkowska-Abramek, Monika; Denisow, Bozena (2018) - The percentage of plant species in bloom at each study point was established based on the cover of plant species in particular transects (n = 5 per habitat). Results Nectar and pollen yielding plants The total number of plant species found was 185, of which 151 species (81.6%) were identified as visited by in- sects (On-line Suppl. Keywords: abundance; denisow; flowering; flowers; grassland; habitat; insect; lamiaceae; plant; pollen; railway; species; visitors
• The flora and vegetation of the NE Mediterranean islet with centuries-long human influences by Jasprica, Nenad; Dolina, Katija; Milovic, Milenko (2018) - ex Westhoff et al. 1946 Artemisietea vulgaris Lohmeyer et al. in Tx. Celesti-Grapow, L., Bassi, L., Brundu, G., Camarda, I., Carli, E., D’Auria, G., et al., 2016: Plant invasions on small Mediterra- nean islands: An overview. Keywords: adriatic; br.-bl; croatian; et al; flora; islands; islet; jasprica; mediterranean; milović; nikolić; plant; species; taxa; vegetation; vrnik
• Genetic structure of populations of several endangered and endemic Dianthus species revealed by microsatellite markers by Butiuc-Keul, Anca; Craciunas, Cornelia; Goia, Irina; Farkas, Anca; Jarda, Liliana; Cristea, Victoria (2018) - The individuals belonging to D. henteri species showed the particular allele d and the allele v which was present in D. cal- lizonus as well. Allelic patterns across Dianthus species indi- cate that the mean number of different alleles was highest in D. glacialis ssp. Keywords: alleles; callizonus; dianthus; dianthus species; diversity; et al; plant; populations; romania; species
• Subalpine vegetation in Giresun Mountains (Turkey) by Huseyinova, Rena; Yalcin, Erkan (2018) - 1. Dendrogram of vegetation plots (50 plots and 160 species) of the Giresun Mountains. In the first studies, Turkish au- thors (Düzenli 1988, Kılınç and Karakaya 1992, Vural 1996) recorded a number of vegetation plots from different alpine and subalpine communities. Keywords: alpine; festucetum; mountains; plant; quézel; slopes; soil; species; study; subalpine; turkey; vegetation
• Morfologija biljaka. Razvoj, grada i uloga biljnih tkiva, organa i organskih sustava by Toni Nikolic 2017 by Skvorc, Zeljko (2017) - In the chapter Anatomy Basics, he presents plant tissues involved in the formation of plant organs. For that reason, there is a need for quality, comprehensive books that will give an overview of all as- pects of plant morphology. Keywords: morphology; organs; plant
• IN MEMORIAM Professor Kroata Hazler Pilepic (1968-2017) by Friscic, Maja (2018) - 77 (1), 2018 S3 In memoriam Professor Kroata Hazler Pilepić (1968–2017) Professor Kroata Hazler Pilepić, PhD, a Croatian scientist and full professor employed at the Faculty of Pharmacy and Bio- chemistry, University of Zagreb, died on September 1, 2017. Hazler Pilepić, K., Comps, B., Šugar, I., Šolić, E., 1999: Genetic variability of the Croatian beechwoods. Keywords: hazler; hazler pilepić; maleš; pilepić; plant; university; zagreb
• Expression of small GTPases in the roots and nodules of Medicago truncatula cv. Jemalong by Memon, Abdul Razaque; Schwager, Christiane Katja; Niehaus, Karsten (2019) - Keywords: gene expression, Medicago truncatula, root nodules, small GTP-binding proteins * Corresponding author, e-mail: armemon@usak.edu.tr, abdulrezzak.memon@gmail.com Introduction Intracellular membrane trafficking plays a major role in plant growth and development including root hair forma- tion, rhizobium infection process and nodule formation in legumes (Oldroyd and Downie 2008). The RT-qPCR experiments showed that indeed our previously identified transcript (homologues to A. thaliana Rop7 and A8IK57_MedtrRop 8) is predomi- nantly expressed in root nodules (Fig. 3c), indicating its role in nodule biogenesis. Keywords: et al; expression; gtp; infection; medicago; nodules; plant; proteins; rhizobium; roots; truncatula
• Effects of exogenous nitric oxide on cadmium toxicity in black poplar (Populus nigra): physiological approaches by Cikili, Yakup; Kulac, Semsettin; Samet, Halil; Filiz, Ertugrul (2019) - In comparison with control, Cu concentrations in root were increased 100 and 500 µM Cd treatments while the incre- ments in leaf Cu concentration were found significantly with only 500 µM Cd treatments. Cd concentrations increased in leaves, bark, and roots at Cd treatments, whereas Cd + SNP applications had alleviative effects on Cd exposures, except for leaves. Keywords: bark; cadmium; et al; exposure; leaves; levels; nigra; plant; poplar; roots; snp; treatments
• Nectar and pollen production of Helianthus tuberosus L. – an exotic plant with invasiveness potential by Denisow, Bozena; Tymoszuk, Karolina; Dmitruk, Marta (2019) - We assume that the UHI environmen- tal conditions (higher temperature, lower humidity) impact- ed on plant species phenotypic traits and impaired the num- ber of developed disc florets and inflorescences. The variability in the nectar amount produced in flowers is quite common and has been report- ed among plant species, plant populations or even among individual flowers (Nicolson and Thornburg 2007, Denis- ow et al. 2014). Keywords: acta; denisow; disc; florets; insect; nectar; plant; pollen; production; rural; species; tuberosus
• Variation in morpho-physiological, biochemical and molecular responses of two Eucalyptus species under short-term water stress by Amrutha, Sivanantham; Muneera Parveen, Abdul Bari; Muthupandi, Muthusamy; Sivakumar, Veerasamy; Nautiyal, Raman; Ghosh Dasgupta, Modhumita (2019) - Concurrently, reduction in plant growth (Chaves et al. 2003, Bedon et al. 2012), photosynthesis (Warren et al. 2007) and hormone production (Granda et al. 2011) have also been re- ported during water stress conditions. Hence, reduction in leaf area during water stress condition is a response in all eucalypt species as reported in E. globu- lus (Costa e Silva et al. 2004, Maseda and Fernández 2016), E. camaldulensis (Lemcoff et al. 2002, Maseda and Fernán- dez 2016) and E. microtheca (Susiluoto and Berninger 2007). Keywords: condition; content; drought; ec226; et al; eucalyptus; globulus; leaf; parameters; plant; response; species; stress; temperature; tolerance; water; water stress
• The effect of salinity gradient and heavy metal pollution on arbuscular mycorrhizal fungal community structure in some Algerian wetlands by Sidhoum, Warda; Bahi, Kheira; Fortas, Zohra (2020) - In addition, nickel and zinc concentrations in DM and LT soils in the present study are homogeneous and vary only slightly. The results showed that 72.72% of plant species exhibit an association within arbuscular mycorrhizas (AM), and 36.36% a dual association between AM and dark septate endophytes (DSE). Keywords: amf; colonization; diversity; dse; et al; frequency; fungal; fungi; index; metal; mycorrhizal; number; plant; pollution; root; salinity; sites; soil; species; total; wetland
• Coastal sand dune vegetation of Velika plaža (Montenegro) by Stesevic, Danijela; Kuzmic, Filip; Milanovic, Djordjije; Stanisic-Vujacic, Milica; Silc, Urban (2020) - We made a phytosociolog- ical study of sandy beach vegetation comprising both dunal and wetland areas to provide a comprehensive survey of sand dune vegetation and habitat typology of Velika plaža. The aim of our study was to make a comprehensive sur- vey of sand dune vegetation of the largest sand beach system in Eastern Adriatic with own field work and literature data, 44 ACTA BOT. Keywords: adriatic; beach; br.-bl; classification; coastal; communities; dunes; et al; habitat; montenegro; plant; plaža; relevés; sand; species; stands; vegetation; velika; šilc
• Somatic embryogenesis as a tool for virus elimination in Croatian indigenous grapevine varieties by Malenica, Nenad; Jagic, Mateja; Pavletic, Bruno; Bauer, Natasa; Voncina, Darko; Zdunic, Goran; Leljak Levanic, Dunja (2020) - For example, the productive life of vineyards infected by Grapevine fanleaf virus (GFLV) is 15–20 years shorter than would otherwise be expected (Andret-Link et al. 2004) and the grapes, must and wine have lower sug- ar concentration and increased overall acidity, causing eco- nomic losses of 80% (Andret-Link et al. 2004), or even 100% (Raski et al. 1983). RT-PCR analysis of Grapevine leafroll-associated viruses (GLRaV-1, GLRaV-2 and GLRaV-3), Arabis mosaic virus (ArMV), Grapevine fleck virus (GFkV) and Grapevine fanleaf virus (GFLV) in ‘Babica’ (E) and ‘Plavac mali’ (F). Keywords: cultivars; elimination; embryogenesis; embryos; et al; fig; gflv; grapevine; mali; plant; plavac; vinifera; virus; viruses; vitis
• Chemical and morphological diversity among wild populations of Hypericum aviculariifolium Jaub. et Spach subsp. depilatum (Freyn et Bornm.) N. Robson var. depilatum by Cirak, Cuneyt; Özcan, Aysel; Yurteri, Emine; Kurt, Dursun; Seyis, Fatih (2020) - heterogeneity of Hypericum plants from different origins is reported to influence the pharmacological activity of plant extracts significantly and to pose a great risk to the standard- ization of final Hypericum-derived products (Costa et al. 2016). Hypericum plants are categorized generally by three types of secretory structures namely, translucent glands, black or dark nodules and secretory canals (Kimáková et al. 2018). Keywords: aviculariifolium; depilatum; et al; hyperforin; hypericin; hypericum; leaf; perforatum; plant; populations; species
• An ecophysiological study of some coastal dune species of Zemmouri El Bahri (Algeria) by Rabhi, Sadjia; Djebbar, Réda; Belkebir, Aicha (2021) - Melo Júnior, J.C.F., Boeger, M.R.T., 2016: Leaf traits and plastic potential of plant species in a light-edaphic gradient from restinga in southern Brazil. Based on the high- est levels of total phenols, flavonoids and anthocyanins as well as high contents of photosynthetic pigments, M. tricus- pidata can be classified as “homoiochlorophyllous” plant. Keywords: area; content; creticus; g–1; leaf; maritima; plant; species; water
• Phytosociological study of submontane genistoid scrub communities from the Southeastern Balkans by Kunev, Georgi Iliev; Tzonev, Rossen; Tsiripidis, Ioannis; Pachedjieva, Kalina (2020) - 1. Cluster dendrogram of Genista lydia communities. Physiognomy of Genista lydia communities: a – Diantho pinifolii-Genistetum lydiae, b – Romuleo graecae-Genistetum lydiae, c – Galio flavescentis-Genistetum lydiae, d – Genista lydia-Satureja pilosa community. Keywords: association; balkan; bulgaria; communities; distribution; et al; genista; genista lydia; genistetum; greece; group; kunev; lydia; lydia communities; mediterranean; plant; sofia; species; ssp; tzonev; vegetation
• Allelopathic potential of Ficus retusa L. leaf litter on understory vegetation in urban gardens by Hassan, Mahmoud Omar; Mohamed, Howida Yacoup; Aboellil, Ayman Hassan (2021) - 80 (2), 131–139, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2021-013 ISSN 0365-0588 eISSN 1847-8476 Allelopathic potential of Ficus retusa L. leaf litter on understory vegetation in urban gardens Mahmoud Omar Hassan, Howida Yacoup Mohamed*, Ayman Hassan Aboellil Beni-Suef University, Faculty of Science, Department of Botany and Microbiology, 62511 Beni-Suef, Egypt Abstract – Pruning Ficus trees in urban green spaces may lead to the accumulation and spread of their leaf litter on the understory vegetation. This study was conducted to evaluate the allelopathic effect of Ficus retusa L. leaf litter on the understory species in urban gardens. Keywords: compounds; cover; ficus; germination; growth; hassan; leaf; litter; plant; potential; retusa; soil; species; understory
• Morphological and genetic diversity of Senecio vulgaris L. (Asteraceae) in Iran by Ebadi, Mostafa; Eftekharian, Rosa (2021) - However, the ef- fects of some factors in plant population genetic diversity remain unclear and more investigations have to be done. Morphometric and ISSR based variabil- ity analysis to elucidate population genetic structure in Sene- cio glaucus L. (Asteraceae: Senecioneae). Keywords: analysis; characters; diversity; length; plant; populations; senecio; vulgaris
• Silver nanoparticles affect germination and photosynthesis in tobacco seedlings by Biba, Renata; Tkalec, Mirta; Cvjetko, Petra; Peharec Štefanić, Petra; Šikić, Sandra; Pavoković, Dubravko; Balen, Biljana (2021) - Results AgNPs stability in culture media The results of the stability analyses obtained by spectro- photometric absorbance measurements of 150 µM AgNPs in solid and liquid half strength MS media are presented in Fig. V ZA - vi ol ax an th in , z ea xa nt hi n an d an th er ax an tin (x an th op hy ll cy cl e po ol ), ch l a /b - ch lo ro ph yl l a /b , c ar /c hl - ca ro te no id s/ ch lo ro ph yl l, V ZA /c hl - V ZA / c hl or op hy ll. V al ue s a re th e m ea ns ± st an da rd er ro r o f t hr ee d iff er en t e xp er im en ts , e ac h w ith th re e r ep lic as . Keywords: agno3; agnps; concentrations; control; effects; et al; exposure; germination; growth; medium; nanoparticles; plant; seedlings; silver; tobacco; treatments
• Expression of genes for selected plant aminoacyl-tRNA synthetases in the abiotic stress by Baranašić, Jurica; Mihalak, Anita; Gruić-Sovulj, Ita; Bauer, Nataša; Rokov-Plavec, Jasmina (2021) - Furthermore, plant aaRSs may participate directly in plant stress responses through their noncanonical activities. Participation of aaRSs in plant stress responses is poorly characterized. Keywords: asprs; cysrs; et al; expression; gene; levels; plant; protein; serrs; stress; synthetase; transcription; trna
• The Spiridion Brusina Medal for 2019 has been awarded to German plant biologist Professor Jutta Ludwig-Müller by Salopek Sondi, Branka (2020) - Campanella, J. J., Olajide, A. F., Magnus, V., Ludwig-Müller, J., 2004: A novel auxin conjugate hy- drolase from wheat with substrate specificity for longer side-chain auxin amide conjugates. B Joint scientific publications by Professor Jutte Ludwig- Müller and Croatian scientists: 1. Keywords: auxin; croatian; ludwig; müller; plant; professor
• Emergence of a new salt-tolerant alien grass along roadsides? Occurrence of Diplachne fusca subsp. fascicularis (Poaceae) in Hungary by Süveges , Kristóf ; Molnár V, Attila; Mesterházy , Attila; Tüdősné Budai , Júlia ; Fekete, Réka (2021) - These factors act in synergy, favour- ing the spread of alien plant species, since native species are usually less able to adapt to the altered, anthropogenic con- ditions at roadsides (Greenberg et al. 1997). In the case of plant species producing lightweight seeds, dispersal may be facilitated by the air turbulence caused by cars (von der Lippe et al. 2013), but seeds may also travel long distances in mud attached to cars (Clifford 1959, Ross 1986, Schmidt 1989, Zwaenepoel et al. 2006, Ansong and Pickering 2013). Keywords: diplachne; fascicularis; fusca; germination; hungary; plant; road; salt; species; subsp
• Physiology and biochemistry of leaf bleaching in prematurely aging maple (Acer saccharinum L.) trees: I. Hydrogen peroxide level, antioxidative responses and photosynthetic pigments by Uzarevic, Zvonimir; Stolfa, Ivna; Paradikovic, Nada; Cesar, Vera; Lepedus, Hrvoje (2011) - The specific activities of APX were 1.82 ± 0.45 DA min–1 mg–1 proteins in green leaves and 0.78 ± 0.21 DA min–1 mg–1 proteins in bleached leaves. The enzyme specific activities of APX, GPOD, CAT and SOD in green leaves were almost twice those in bleached leaves. Keywords: bleached; chlorophyll; green; h2o2; hydrogen; leaves; level; peroxide; plant
• Development of an optimum proliferation medium via the graph kernel statistical analysis method for genetically stable in vitro propagation of endemic Thymus cilicicus (Turkey) by Kaya, Ergun; Balci, Mehmet Ali ; Akguller , Omer; Galatali , Selin ; Yeniocak , Sevil ; Mercan , Taner; Guldag , Sevinc; Ozkaya , Damla Ekin; Ozturk , Bilge ; Celik, Onur; Aktay, Irem (2021) - A survey on graph kernels. A – Meristem regeneration of Thymus cilicicus, B – shoot forming and rooting on optimum medium composition deter- mined via graph kernel multiple propagation index, C – acclimatized T. cilicicus seedlings to greenhouse conditions. Keywords: charcoal; cilicicus; culture; g l–1; graph; kernel; l–1; m g; medium; plant; propagation
• Response of Bacillus cereus on Zea mays under different doses of zinc sulphate by Shahzad, Asim; Qin, Mingzhou; Nazir, Mudassar; Shakoor, Abdul; Billah, Mohtism; Zaib, Gul (2021) - Preparation of heavy metal solution Three different concentrations of Zn solution (20, 40 and 60 mg kg–1) for maize plant treatments were prepared in pure distilled water by dissolving zinc sulfate (ZnSO4). Zinc (Zn) is an essential micronu- trient and it promotes plant growth and development but a higher concentration of the metal causes reduction in plant growth. Keywords: cereus; control; kg–1; maize; plant; seeds; soil; treatments; zinc; znso4
• Synanthropic vegetation: pattern of various disturbances on life history traits by Å ilc, Urban (2010) - On the other hand, perennials and phanerophytes are more com- mon in semi-natural vegetation and have a C-strategy. This is particularly evident for semi-natural vegetation and vegetation of villages. Keywords: analysis; composition; differences; disturbance; habitats; land; life; plant; species; traits; type; variables; vegetation
• Species introductions through coconut fibre: Dactyloctenium aegyptium and Glinus oppositifolius, new records for the Balearic Islands, Spain by Cerrato, Marcello Dante; Ribas-Serra, Arnau; Cardona, Carles; Gil, Lorenzo (2021) - Keywords: Balearic Islands, coconut fibre, exotic species, substrate, plant invasions Introduction Allochthonous species are recognized as one of the main threats worldwide to biodiversity. When collected, herbarium vouchers were deposited in the Public Herbarium of the University of the Balearic Islands. Keywords: balearic; islands; plant; species; university
• Application of phytohormones as attenuators of salt stress in Tropaeolum majus L. (Tropaeolaceae) by da Silva, Toshik Iarley; Dias, Marlon Gomes; Grossi, José Antônio Saraiva; Ribeiro, Wellington Souto; de Moraes, Paulo José; de Araújo, Fernanda Ferreira; Barbosa, José Geraldo (2022) - Severe salt stress and moderate salt stress decreased sto- matal conductance (gs), net photosynthesis (A) and transpi- ration (E) of T. majus plants in relation to the control. Dar, T.A., Uddin, M., Khan, M. M. A., Hakeem, K.R., Jaleel, H. 2015: Jasmonates counter plant stress: a review. Keywords: acid; application; cytokinin; et al; growth; leaf; majus; mass; phytohormones; plant; polyamine; salt; salt stress; stress
• In memoriam of Dr. Volker Magnus by Iskrić, Sonja; Jelaska, Sibila; Kojić-Prodić, Biserka; Laćan, Goran; LjubeÅ¡ić, Nikola; Wrischer, Mercedes; Salopek Sondi, Branka (2010) - His MSc thesis, completed in 1971, dealt with the isola- tion of indole-3-methanol from pea seedlings, a metabolite of indole -3-acetic acid (IAA) (MAGNUS et al. 1971). Synthesis of the -D-glucosyl es- ter of [carbonyl-13C]-indole-3-acetic acid. Keywords: acta; auxin; magnus; plant; volker
• Effects of selected groundwater chemical traits on a salt marsh community by Kilinc, Mahmut; Kutbay, Hamdi Guray; Yalcin, Erkan; Bilgin, Ali; Avci, Kenan; Topaloglu, Solmaz Gencoglu (2011) - References ABD EL-GHANI, M. M., 2000a: ABD EL-GHANI, M. M., 2000b: Keywords: groundwater; journal; marsh; plant; salinity; salt; soil; species; vegetation
• An Asphodelus ramosus dominated plant community in Montenegro: fringe or grassland? by Stanišić-Vujačić, Milica; Stešević , Danijela; Hadžiablahović , Sead ; Caković , Danka ; Šilc, Urban (2022) - Asphodelus ramosus, Anemone hortensis, Carlina corymbosa and Hypochoeris radicata, which are considered to be character species by Biondi et al. (2016), are also very frequent in grassland vegetation of Bromo erecti-Chrysopogonetum grylli. (and Asphodelus ramosus in particular) has become very intensive in recent years, especially in the western and central Mediterranean (Allegrezza et al. 2015, Biondi et al. 2016, 2017). Keywords: asphodelus; biondi; bromo; chrysopogonetum; communities; community; et al; grasslands; grylli; mediterranean; montenegro; plant; ramosi; ramosus; species; subsp; vegetation
• Physiological responses of resistant and susceptible pepper plants to exogenous proline application under Phytophthora capsici stress by Koç, Esra (2022) - Although P. capsici application generally induced an increase in the amount of anthocy- anin and flavonoids in the CM-334 cultivar compared to the control group, the highest values were obtained upon appli- cations of both Pro concentrations + P. capsici (P < 0.05) (Tab. 1). Therefore, the increase in the chlorophyll a and b content in peppers exposed to P. capsici stress can be at- tributed to the stimulation of chlorophyll biosynthesis or inhibition of its degradation and the more efficient removal of stress-induced increased ROS by Pro. Keywords: application; capsici; content; cultivar; dpi; increase; p. capsici; plant; pro; stress
• Determination of salt tolerance levels and genetic relationships of Vicia sativa cultivars using gene targeted functional markers by Tiryaki, Iskender; Isidogru, Nuray (2022) - Overall, the results of this study dem- onstrate that gene specific primers related to salt tolerance in plants could be used to discriminate the salt tolerant and salt sensitive cultivars at germination stage as well as to de- termine intraspecific genetic diversity if a higher number of salt tolerance related genes are used as GTFMs. This study concluded that the cultivars determined to be salt tolerant and sensitive at germination stage distributed into three main clades determined by UPGMA analysis while the GTFMs associated with salt tolerance successfully determined the genetic relationships of common vetch cultivars. Keywords: analysis; cultivars; gene; germination; markers; plant; rate; salt; salt tolerance; sativa; stress; tolerance; vetch; vicia
• The relationship between biodiversity and the biomass of grasslands in the Zagreb area (NW Croatia) by Justić, Marta; Jelaska, Sven (2022) - Neophytes are represented by two species: Anthyllis vulneraria L. and Lolium multiflorum Lam. Invasive alien taxa are also represented by two species: Erigeron annuus (L.) Desf. Keywords: area; biomass; diversity; grasslands; localities; locality; number; plant; plots; species; taxa; values; vegetation
• Exogenous arginine treatment additively enhances growth and tolerance of Salicornia europaea seedlings under salinity by Shakhsi-Dastgahian, Fereshteh ; Valizadeh, Jafar ; Cheniany, Monireh ; Einali, Alireza (2022) - Changes in enzyme activities in Arg-treated seedlings during salt treatment The activities of APX, POX and PPO in S. europaea seedlings were negatively changed by salt treatments (Fig. 4). Despite some studies on salt stress and the role of Arg in its tolerance (Nejadalimoradi et al. 2014, Ramadan et al. 2019), there is no report on the possible effects of this amino acid on salt stress tolerance in Salicornia. Keywords: arg; effect; europaea; growth; nacl; plant; salinity; salt; seedlings; stress; tolerance; treatment
• First record of Sida rhombifolia L. (Malvaceae) for Italian flora: taxonomical and ecological investigation by Cambria, Salvatore ; Crisafulli, Alessandro; Giusso del Galdo, Gianpietro; Picone, Rosa Maria; Soldano, Adriano ; Sciandrello, Saverio; Tavilla, Gianmarco (2022) - Distribution map of Sida rhombifolia L. (Malvaceae) in Peloritani in Sicily, Italy. to S. rhombifolia L., showing leaves with an indumentum of minute sessile stellate hairs, and serrate margins at the apex, as well as dehiscent mericarps provided with 2 prominent apical awns. Following this classification, the genus Sida L. falls within the tribe Malveae J. Presl belonging to the Malvoideae Bur- nett subfamily. Keywords: alien; flora; italy; malvaceae; new; plant; rhombifolia; sicily; sida; species
• Effects of exogenous NO on the growth and photosynthetic fluorescence characteristics of ryegrass seedlings under B[a]P stress by Li, Yue; Ma, Junqiang; Wang, Yu; Xu, Sunan; Jiang, Lei; Zhang, Lihong; Hou, Wei (2023) - The foliar application of 200 μmol L–1 SNP showed more pronounced results than that of the other three concentrations of SNP treatments on ryegrass plants under B[a]P stress. Effect of exogenous NO on photosynthetic pigment contents of ryegrass under B[a]P stress The chlorophyll a, chlorophyll b, and total chlorophyll contents of the ryegrass under 30 μmol L–1 B[a]P stress dras- tically decreased (P < 0.05) and the carotenoid content de- clined but not radically compared with the control (Fig. 2). Keywords: b[a]p; b[a]p stress; chlorophyll; growth; l–1; parameters; plant; ryegrass; snp; stress; μmol
• First record of alien naturalized populations of the crop Cucurbita moschata (Cucurbitaceae) in Spain, with remarks on typification status by Juan, Ana; Moreno, Joaquín; Terrones, Alejandro (2023) - C. ficifolia C. maxima C. moschata C. pepo Habit Perennial Annual Annual Annual Leaves Lobed Not lobed/ shallowly lobed Not lobed/ shallowly lobed Shallowly to deeply lobed Segment leaves Rounded Rounded Acute Acute Indument With short glandular hairs Stiff-haired/ hispid Soft-haired Spiculate Sepals Linear, apex non- broadened Linear, apex non- broadened Linear or with apex often broadened like leaves Linear, apex non- broadened Seed color Dark brown to black Orange or white Tan to brown Pale tan Fruit peduncle Ribbed, moderately broadened at attachment Cylindrical, non- broadened at attachment Ribbed, at attachment widely broadened (flat) Ribbed, slightly, broadened at attachment JUAN A., MORENO J., TERRONES A. 30 ACTA BOT. Consequently, the presence of C. moschata populations along the basin of the River Vinalopó, and their subsequent propagation over the years, would be nowadays considered as autonomous and well established, and not directly bound to any current agri- cultural activity. Keywords: alien; area; cucurbita; flora; fruit; leaves; moschata; plant; populations; river; spain; species; vinalopó
• Pollination patterns of flora and vegetation in northern Croatia with reference to Apis mellifera by Stančić, Zvjezdana; Fiket, Željka (2023) - Plant species useful for Apis mellifera The European honey bee plays a very important role in the pollination of plant species. Overall, 54% of plant species useful to European honey bees were found, 51% of which provide pollen and 47% nectar. Keywords: croatia; flora; forest; habitat; honey; insect; modes; plant; plant species; pollination; pollinators; species; vegetation; wind
• Effect of excess boron on growth, membrane stability, and functional groups of tomato seedlings: Boron toxicity and tomato seedling growth by Radi, Abeer A.; Salam, Hussein Kh.; Hamada, Afaf M.; Farghaly, Fatma A. (2023) - However, EB levels raised the peak intensity of 825.45 cm–1 relative to control. 3A-C, the membrane damage was more severe as EB levels in the medium increased. Keywords: boron; cell; chl; cm–1; et al; growth; peak; plant; seedlings; tomato; toxicity
• Pollen morphology and flower visitors of Leiotulus aureus (Sm.) Pimenov & Ostr. (Apiaceae) by Mačukanović-Jocić, Marina; Stešević, Danijela; Rančić, Dragana; Šundić, Miloje (2023) - According to this classification, pollen grains of L. aureus in the current study should fit into type 5. Unlike Zych (2006) who did not observe any honey bee on Heracleum sphondylium, L. aureus flowers were very frequently visited, which is in line with the findings of other authors who pointed out the importance of honey bees in pollinating umbellifers (Langenberger and Davis 2002b, Davila and Wardle 2002). Keywords: apiaceae; aureus; bee; fig; grains; honey; plant; pollen; pollination; species; visitors
• Sugar beet cells’ cellular and extracellular events taking place in response to drought and salinity by Pavoković, Dubravko; Horvatić, Anita; Tomljanović, Ingrid; Balen, Biljana; Krsnik-Rasol, Marijana (2023) - Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. We applied a proteomic approach to analyze and com- pare the effect of salt and mannitol on the expression profile of sugar beet proteins. Keywords: acta; analysis; beet; cell; drought; et al; expression; fig; https://doi; ions; mannitol; nacl; plant; proteins; response; salt; salt stress; stress; sugar
• Nitric oxide alleviates mercury toxicity by changing physiological and biochemical pathways in maize (Zea mays L.) seedlings by Esim, Nevzat; Karaman, Aykut; Atıcı, Okkes (2024) - Con- versely, exposure to Hg increased H2O2 content by 44% and the O2 .– content by 8% compared to the control (Tab. 3). Hg-treated plants. Keywords: antioxidant; content; control; maize; oxide; plant; seedlings; snp; stress; toxicity
• Effects of hormopriming and pretreatment with gibberellic acid on fenugreek (Trigonella foenum-graecum L.) seed germination by Gueridi, Sabrina; Boucelha, Lilya; Abrous-Belbachir, Ouzna; Djebbar, Réda (2024) - Our study highlights the role of priming and im- bibition in improving seed germination. Keywords: hormopriming, germination, gibberellic acid, radicle, reactive oxygen species, Trigonella foenum- graecum Introduction Plant production and productivity are strongly deter- mined by seed germination, which is a critical step in the life cycle of higher plants (Cheng and Bradford 1999). Keywords: acid; activity; antioxidant; control; et al; fenugreek; germination; gibberellic; hormopriming; hydropriming; imbibition; plant; radicles; ros; seed; treatments
• Changes in grassland vegetation on the island of Plavnik (Croatia) over 100 years by Terzi, Massimo; Jasprica, Nenad (2024) - The specific vulnerability of plant biodiversity and vegetation on Mediterranean islands in the face of glob- al change. 83 (2), 119-134, 2024 CODEN: ABCRA 25 DOI 10.37427/botcro-2024-014 ISSN 0365-0588 eISSN 1847-8476 Changes in grassland vegetation on the island of Plavnik (Croatia) over 100 years Massimo Terzi1*, Nenad Jasprica2 1 Institute of Bioscience and Bioresources (IBBR), National Council of Research (CNR), via Amendola 165/A, IT-70126, Bari, Italy 2 University of Dubrovnik, Institute for Marine and Coastal Research, Kneza Damjana Jude 12, HR-20000 Dubrovnik, Croatia Abstract – The changes in the grassland vegetation that have occurred over the last almost 100 years on the northeastern Adriatic island of Plavnik (Croatia) were studied. Keywords: acta; bulbosae; croatia; festuco; grylli; helichrysetum; horvatić; island; italici; lat; officinalis; plant; plavnik; rel; relevés; species; taxa; terzi; valesiacae; vegetation
• Trehalose-induced metabolic responses in basil (Ocimum basilicum) seedlings under salt treatment by Karamzehi, Ramazan; Einali, Alireza (2024) - References Abdallah, M. M. S., El Sebai, T. N., Ramadan, A. A. E. M., El-Bassiouny, H. M. S., 2020: Physiological and biochemical role of proline, trehalose, and compost on enhancing salinity tolerance of quinoa plant. 2.26 ± 0.43e 78.35 ± 4.49cd 25 -Tre 1.99 ± 0.31ab 0.31 ± 0.03b 0.52 ± 0.01b 0.10 ± 0.01b 3.83 ± 0.62bc 3.21 ± 0.21d 73.41 ± 4.20d +Tre 1.12 ± 0.25c 0.26 ± 0.04bc 0.25 ± 0.05de 0.06 ± 0.01c 4.61 ± 0.91b 4.66 ± 0.82b 77.67 ± 4.90cd 50 -Tre 2.29 ± 0.31a 0.32 ± 0.02b 0.43 ± 0.06c 0.12 ± 0.01a 5.29 ± 0.09b 2.74 ± 0.30e 81.09 ± 0.31c +Tre 1.64 ± 0.14b 0.16 ± 0.03de 0.27 ± 0.03d 0.06 ± 0.02c 6.19 ± 0.79b 2.80 ± 0.55e 83.65 ± 2.26c 100 -Tre 1.71 ± 0.21b 0.24 ± 0.04c 0.41 ± 0.08c 0.09 ± 0.01b 4.28 ± 0.91c 2.52 ± 0.28e 76.00 ± 4.75cd +Tre 1.38 ± 0.15b 0.29 ± 0.05bc 0.23 ± 0.02e 0.06 ± 0.00c 6.03 ± 0.60b 4.79 ± 0.94b 83.31 ± 1.57bc 150 -Tre 1.10 ± 0.04c 0.13 ± 0.02e 0.30 ± 0.01d 0.07 ± 0.01c 3.73 ± 0.20c 1.84 ± 0.02f 73.13 ± 1.41d +Tre 1.01 ± 0.04c 0.08 ± 0.01f 0.11 ± 0.02f 0.02 ± 0.00d 9.56 ± 0.96a 3.86 ± 0.39c 89.47 ± 1.11a Fig. Keywords: accumulation; activity; basil; chl; content; et al; growth; plant; proline; salinity; salt; seedlings; stress; sugars; tolerance; total; tre; treatment; trehalose
• Combined application of rutin and silicon sustains maize seedlings osmotic stress tolerance by improving photosynthetic capacity and chlorophyll metabolism by Sezgin Muslu, Asiye; Altuntaş, Cansu; Altansambar, Namuun; Demiralay, Mehmet; Kadıoğlu, Asim (2025) - https://doi. org/10.1621/nrs.01012 Bradford, M. M., 1976: A rapid and sensitive method for the quan- titation of microgram quantities of protein utilizing the prin- ciple of protein–dye binding. https://doi. org/10.1023/A:1023064328384 Chaves, M. M., Maroco, J. P., Pereira, J. S., 2003: Keywords: activity; application; chlase; chlorophyll; et al; expression; maize; peg; plant; rubisco; rut; rut+si; rutin; seedlings; silicon; stress
• Indications of programmed cell death in wheat roots upon exposure to silver nanoparticles by Yanık, Fatma; Vardar, Filiz (2025) - This study is the first to examine AgNP- induced PCD in wheat root cells. 2. Nucleus morphology in control wheat root cells (a) and after 15 days of exposure to 0.5 (b), 1 (c), 5 (d), 10 (e), and 20 mg L–1 of AgNPs (f). Keywords: activity; agnps; cell; control; death; dna; et al; expression; l–1; mg l–1; pcd; plant; roots; silver; wheat
• Connecting the dots: Epigenetics, ABA, and plant stress tolerance by Grgić, Miran; Vitko, Sandra; Drmić, Josipa; Leljak-Levanić, Dunja (2025) - Complex mechanisms such as DNA methylation, especially via the de novo pathway, and histone tail modifications such as methylation, acetylation, phosphorylation, ubiquitination, and SUMOylation are involved in plant stress responses. Keywords: ABA, DNA methylation, histone modifications, histone variants, plant stress response, RdDM, small non-coding RNA Introduction Changing and often extreme environmental conditions are the main cause of abiotic stress and pose a major chal- lenge to plant survival. Keywords: aba; arabidopsis; cell; chromatin; complex; dna; drought; epigenetic; et al; expression; genes; heat; histone; methylation; plant; plant stress; protein; rddm; regulation; response; rna; role; stress; tolerance
• Additional data on the ongoing naturalization of the non-native woody plant Duranta erecta (Verbenaceae) in Sicily, Italy by Pasta, Salvatore; Lo Cascio, Pietro; Badalamenti, Emilio (2025) - Re- trieved March 10, 2024 from http://www.plantsoftheworl- donline.org/ Pretto, F., Celesti-Grapow, L., Carli, E., Brundu, G., Blasi, C., 2012: Determinants of non-native plant species richness and composition across small Mediterranean islands. A second update to the checklist­of­the­vascular­flora­alien­to­Italy.­Plant­Biosystems,­ https://doi.org/10.1080/11263504.2024.2320129 Guarino, R., Chytrý, M., Attorre, F., Landucci, F., Marcenò, C., 2021: Alien plant invasions in Mediterranean habitats: an as- sessment for Sicily. Keywords: duranta; erecta; islands; pasta; plant; sicily; species
• Retrodunal dry grassland vegetation in the hinterland of Velika Plaža (Montenegro) by Stesevic, Danijela; Stanišić-Vujačić, Milica; Milanović, Đorđije; Šilc, Urban (2025) - The hierarchical cluster analysis was performed on a data- set comprising 224 relevés (47 original ones and 177 from the literature or unpublished of dry grassland communities (different substrata) from Montengro and Croatia), by PC- ORD 4 (McCune and Mefford 1999) incorporated in JUICE 7.0 software package (Tichý 2002). Diagnostic, constant, and dominant species of the ret- rodunal communities from Velika Plaža were identified on the smaller dataset (47 relevés), while diagnostic species of the major Clusters (I-V) of dry grassland communities (dif- ferent substrata) from Montenegro and Croatia and dry ret- rodunal communities (on sandy soil) from Velika Plaža were identified on the large dataset (224 relevés). Keywords: acta; association; campestris; cluster; communities; community; dune; fig; grassland; hinterland; jonii; line; liu; montenegro; plant; plaža; relevés; retrodunal; sand; species; stanišić; stešević; suppl; vegetation; velika; vulpietum
• Physiological and molecular response of Brassica rapa to moderate and extreme heat by Tokić, Mirta; Tkalec, Mirta; Vitko, Sandra; Salopek-Sondi, Branka; Ludwig-Müller, Jutta; Bauer, Nataša (2025) - Seedlings were photographed (A) and analyzed 7 days after the start of heat stress treatments. The molecular basis of heat stress responses in plants. Keywords: aba; brassica; et al; exposure; fig; germination; growth; heat; heat stress; plant; rapa; seedlings; stress; temperature
• Professor Emerita Marijana Krsnik Rasol - an appreciation on the occasion of her eightieth birthday by Balen, Biljana (2025) - Krsnik Rasol, M., Čipčić, H., Hagège, D., 1999: Isoes- terases related to cell differentiation in plant tissue culture. 84 (1), 2025 111 Social News Professor Emerita Marijana Krsnik Rasol – an appreciation on the occasion of her eightieth birthday Professor Emerita Marijana Krsnik-Rasol is a distin- guished Croatian biologist, known for her extensive research into plant molecular biology and proteomics. Keywords: biology; krsnik; plant; rasol
• Ecological conditions, flora and vegetation of a large doline in the Mecsek Mountains (South Hungary) by Batori, Zoltan; Galle, Robert; Erdos, Laszlo; Kormoczi, Laszlo (2011) - nodosum (Schur), 39 – Convallaria majalis L., 40 – Iris graminea L., 41 – Glechoma hirsuta W. et K., 42 – Ajuga reptans L., 43 – Clinopodium vulgare L., 44 – Taraxacum officinale Weber ex Wiggers, 45 – Sorbus torminalis (L.) Cr., 46 – Luzula luzuloides (Lam.) Numbers on the right indi- cate plant species as follows: 1 – Fraxinus excelsior L., 2 – Cardamine bulbifera (L.) Crantz, 3 – Allium ursinum L., 4 – Tilia tomentosa Moench, 5 – Arum maculatum L., 6 – Asarum europaeum L., 7 – Hedera helix L., 8 – Alliaria petiolata (M. B.) Cavara et Grande, 9 – Galium aparine L., 10 – Veronica hederifolia L., 11 – Helleborus odorus W. et K., 12 – Viola reichenbachiana Jord., 13 – Acer platanoides L., 14 – Acer campestre L., 15 – Fraxinus ornus L., 16 – Stellaria holostea L., 17 – Carex pilosa Scop., 18 – Melica uniflora Retz., 19 – Keywords: acta; air; analysis; doline; hungary; mecsek; north; pattern; plant; slope; south; species; transect; vegetation
• Effect of supplemental Ca2+ on NaCl-stressed castor plants (Ricinus communis L.) by Joshi, Seema V.; Patel, Neha T.; Pandey, Indu B.; Pandey, Amar Nath (2012) - Salinity significantly retarded seed germination and plant growth, but the deleterious effects of NaCl on seed germination were ameliorated and plant growth was restored with Ca2+ supply at the critical level (1:0.25 Na+/Ca2+ ratio) to salinised soil. Supply of Ca2+ above the critical level further retarded seed germination and plant growth due to the increased soil salinity. Keywords: ca2; content; growth; na+/ca2; plant; ratio; roots; salinity; soil; tissues; water
• Protein glycosylation in sugar beet cell line can be influenced by DNA hyper- and hypomethylating agents by Pavokovic, Dubravko; Krsnik-Rasol, Marijana (2012) - However, it is not known whether using agents that change the DNAmethylation level in plant cells will change protein glycosylation, as it does in animal cells. This suggested that hypermethylation and hypomethylation of genomic DNA in sugar beet cells affect protein glycosylation patterns and cellular meta- bolism, possibly in a mechanism similar to that existing in animal cells. Keywords: activity; beet; cells; changes; dna; glycosylation; methylation; plant; protein; sugar
• Floristic analysis of a high-speed railway embankment in a Mediterranean landscape by Filibeck, Goffredo; Cornelini, Paolo; Petrella, Paolo (2012) - T Euri-Mediterranean St Lactuca serriola L. H(b) Eurasiatic Lathyrus clymenum L. T Steno-Mediterranean St Lathyrus pratensis L. H Eurasiatic M-A Lathyrus sylvestris L. H Eurasiatic T-G Laurus nobilis L. P Steno-Mediterranean Qi Lavatera punctata All. T Euri-Mediterranean St Cercis siliquastrum L. P Eurasiatic Q-F Chenopodium album L. T Cosmopolitan St Chondrilla juncea L. H Eurasiatic Chrozophora tinctoria (L.) Juss. Keywords: acta; alien; bot; brom; communities; cornelini; cosmopolitan; croat; embankment; eurasiatic; euri; flora; h(b; l. h; l. p; l. t; lazio; mediterranean; plant; railway; species; steno; t euri; vegetation
• Plant Cell Compartments - Selected Topics. B. Schoefs (ed.) 2008. Research Signpost (Kerala, India). by Keresztes, Aron (2012) - Rather than offering a classical systematic coverage of plant cell compartments, this book includes chapters focused on emerging, debated, or new areas. The next chapter (»Cell wall changes during strawberry fruit ripening«, by G. A. Marti- nez) describes an applied and rather specific study about the highly dynamic changes that plant cell walls can undergo during fruit maturation. Keywords: cell; plant
• Spatial and temporal plant phenological niche differentiation in the Wadi Degla desert ecosystem (Egypt) by Hegazy, Ahmad; Alatar, Abdelrahman A.; Lovett-Doust, Jon; El-Adawy, Hosam A. (2012) - Plant species belonging to different life forms in particular phenological groups exhib- ited similar phenological niches. Phenology – environment relationship The environmental variables representing different phenological groups all over the year are shown in table 3. Keywords: a. a.; desert; flowering; group; phenological; phenology; plant; populations; rainfall; species; spring; temperature; wadi
• Augmentation of major isoflavones in Glycine max L. through elicitor mediated approach by Saini, Ramesh K; Akitha Devi, Muthu K; Parvatam, Giridhar; Ravishankar, Gokare A (2013) - However, soybean isoflavones are potent antioxidants and free radical scavengers, as shown by several reports (LEE et al. 2002, LIN and LAI 2006, BOUE et al. 2008, SAKTHIVELU et al. 2008, AKITHA DEVI et al. 2009). Abstract – Isoflavone content in soybean seeds was enhanced by the elicitor-mediated ap- proach under field conditions through the floral application of abiotic elicitors-salicylic acid, methyl jasmonate and biotic elicitors-Aspergillus niger and Rhizopus oligosporus. Keywords: content; et al; food; isoflavone; plant; seeds; soybean; total
• Salt stress tolerance in cowpea is poorly related to the ability to cope with oxidative stress by Praxedes, Sidney Carlos; DaMatta, Fábio Murillo; Lacerda, Claudivan Feitosa de; Prisco, José Tarquinio; Gomes-Filho, Enéas (2014) - We ana- lyzed the long-term effects of salt stress on oxidative damage and protection against reactive oxygen species in both leaves and roots of a salt-tolerant (Pitiúba) and a salt-sensi- tive (TVu) cowpea cultivar. We also hypothesized that leaves and roots display different antioxi- dative abilities to cope with salt stress. Keywords: apx; cat; leaves; plant; praxedes; profile; salt; stress; tolerance
• Vascular flora of spoil heaps after hard coal mining in Trzebinia (S Poland): effect of substratum properties. by Woch, Marcin Wiktor; Radwanska, Magdalena; Stefanowitz, Anna M. (2013) - Hu M Hemi Zooch Ranunculus acris 3 D, Hu H R Au Ranunculus bulbosus 1 Mx T A Au Vicia cracca 71 Mx, Hu H R Au Viola arvensis 5 Mx, D, Hu T A Zooch Viola riviniana 1 Hu H R Zooch Tab. Keywords: acta; area; coal; d h; flora; h r; hu h; kg–1; mx h; plant; r zooch; species; substratum; zooch
• Assessment of macro-micro elements accumulation capabilities of Elodea nuttallii under gradient redox statuses with elevated NH4-N concentration by Zaman, Tanjeena; Asaeda, Takashi (2014) - Parameters Control 2.5 ppm NH4-N 10 ppm NH4-N Oxic Reduced Highly reduced Oxic Reduced Highly reduced Chla 2.9 ± 0.1 3.2 ± 0.2 1.7 ± 0.2* 1.4 ± 0.2** 2.7 ± 0.1 1.2 ± 0.1** 1.0 ± 0.0*** Chlb 1.4 ± 0.1 1.7 ± 0.2 1.1 ± 0.2* 1.0 ± 0.0** 1.3 ± 0.2 1.0 ± 0.1** 0.9 ± 0.1** Carotenoid 1.1 ± 0.0 1.3 ± 0.2 0.9 ± 0.0* 0.5 ± 0.1** 0.9 ± 0.1* 0.3 ± 0.0** 0.0 ± 0.0*** Fv/Fm 0.7 ± 0.0 0.8 ± 0.0 0.6 ± 0.0 0.5 ± 0.0* 0.7 ± 0.0 0.5 ± 0.0* 0.4 ± 0.0* 10.1 ± 3.1b 4.2 ± 0.5c 3.1 ± 0.2cd K 14.3 ± 4.6a 13.9 ± 4.1a 4.9 ± 1.6c 4.2 ± 1.1 c 12.6 ± 4.8a 4.2 ± 1.0 c 3.6 ± 0.8 cd S 2.3 ± 1.1c 2.6 ± 0.8c 3.9 ± 1.2bc 4.0 ± 1.2bc 2.7 ± 1.0c 3.3 ± 0.8c Keywords: concentration; conditions; elements; elodea; metal; nh4; nuttallii; oxic; plant; ppm; profile; redox; sediment; treatments; zaman
• Role of antioxidant enzyme responses and phytochelatins in tolerance strategies of Alhagi camelthorn growing on copper mine by Boojar, Masoud Mashadi Akbar; Tavakoli, Zahra (2010) - Molecular mechanisms of plant metal tolerance and homeostasis. Care was taken to collect plant species samples from both zones while they were in growth period. Keywords: copper; enzyme; leaves; levels; metal; plant; roots; soil; species; zone
• Phenotyping of rice in salt stress environment using high-throughput infrared imaging by Siddiqui, Zamin S; Cho, Jung-Il; Park, Sung-Han; Kwon, Taek-Ryoun; Ahn, Byung-Ok; Lee, Gang-Seob; Jeong, Mi-Jeong; Kim, Kyung-Whan; Lee, Seong-Kon; Park, Soo-Chul (2014) - Likewise, the roots of salt stress plants also showed sig- nificant variations in color. It was observed that stomatal conductance (R2 = –0.618) and relative water content (R2 = –0.852) were significantly negatively correlated with average plant temperature (thermal images), while dark-adapted quantum yield (Fv/Fm, R2 = –0.325) and performance index (R2 = –0.315) were not consistent with plant temperature. Keywords: control; et al; leaf; plant; salt; siddiqui; stress; temperature; water
• Distribution patterns and floristic analysis of the Colymbada tauromenitana (Guss.) Holub populations in Sicily (Italy) by Sciandrello, Saverio; D'Agostino, Sonia (2014) - Two indexes were chosen to estimate diversity: (1) species richness (SR), i.e., the total number of plant species recorded in a sample plot, and (2) Shannon-Wiener’s diversity in- dex (H’). Plant Biosystems 142, 302–304. SCHRÖTER, D., CRAMER, W., LEEMANS, R., PRENTICE, I. C., ARAÚJO, M. B., ARNELL, N. W., BONDEAU, A., BUGMANN, H., CARTER, T. R., GRACIA, C. A. et al., 2005: Ecosystem service supply and vulnerabilità to global change in Europe. Keywords: area; brullo; colymbada; conservation; diversity; mediterranean; monte; plant; sciandrello; sicily; species; tauromenitana
• Is drought altering plant populations in the mountainous region of Northeastern Mexico? by García, Jaime F; Jurado, Enrique (2015) - For the mountain vegetation of Northeastern México there are no studies examining the effects of drought on plant survival, and little is known about what factors affect the probability of mortality in woody plants during a severe drought. Two major hypotheses were tested: (1) morta- lity among species differs due to species-specifi c responses and to genetic variability in re- sistance to stressors, and (2) between populations, plant survival varies throughout the eco- system due to environments that are more or less stressful. Keywords: cembroides; drought; fig; mortality; plant; santaclarensis; soil; species; survival
• Effect of water stress and potassium application on plant growth, osmolytes and grain yield of Brassica varieties by Ali, Murad; Bakht, Jehan; Daraz Khan, Gul (2014) - Water stress induces a signifi cant decrease in metabolic factors such as decrease in chlorophyll content and enhanced accumu- * Corresponding author, e-mail: jehanbakht@yahoo.co.uk Copyright® 2014 by Acta Botanica Croatica, the Faculty of Science, University of Zagreb. BISWAS et al. (1992) reported increased sugar and starch content of sugarcane, tomatoes and potatoes under water stress. Keywords: application; content; drought; ha–1; irrigation; plant; potassium; proline; shoot; stress; water
• Plant diversity and chemical soil composition of rocky pastures in relation to the sheep grazing intensity on the northern Adriatic islands (Croatia) by Ljubicic, Ivica; Britvec, Mihaela; Jelaska, Sven D.; Husnjak, Stjepan (2014) - This paper correlated abundance patterns of the fl ora on rocky pastures with the values of the chemical composition of the soil resulting from the degree of sheep grazing intensity. The aim of the present study was to compare the composition of the fl oras on the rocky pastures of the northern Adriatic islands of Pag, Krk and Cres, to determine the dependence of the fl oristic composition on the chemical composition of the soil resulting from the degree of sheep grazing intensity, and to determine the optimal grazing pressure, an essential factor in the maintenance of plant diversity. Keywords: diversity; grazing; grazing intensity; intensity; islands; pastures; plant; plots; sheep; sheep grazing; soil; species; study; taxa

• Physiological responses of peanut (Arachis hypogaea L.) cultivars to water deficit stress: status of oxidative stress and antioxidant enzyme activities by Chakraborty, Koushik; Singh, Amrit L.; Kalariya, Kuldeep A.; Goswami, Nisha; Zala, Pratap V. (2015) - 74 (1), 123–142, 2015 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Physiological responses of peanut (Arachis hypogaea L.) cultivars to water defi cit stress: status of oxidative stress and antioxidant enzyme activities KOUSHIK CHAKRABORTY*, AMRIT L. SINGH, KULDEEP A. KALARIYA, NISHA GOSWAMI, PRATAP V. ZALA Directorate of Groundnut Research (ICAR), Junagadh – 362001, Gujarat, India Abstract – From a fi eld experiment, the changes in oxidative stress and antioxidant en- zyme activities were studied in six Spanish peanut cultivars subjected to 25−30 days of water defi cit stress at two different stages: pegging and pod development stages. Chlorophyll a/b ratio increased under water defi cit stress in most of the cultivars suggesting a greater damage to chlorophyll b rather than an increase in chlorophyll a content. Keywords: activity; chlorophyll; cit; cit stress; content; cultivars; defi; defi cit; peanut; pod; stage; stress; water; water defi
• Response of dihaploid tobacco roots on salt stress by Marcek, Tihana; Vidakovic-Cifrek, Zeljka; Tkalec, Mirta; Jezic, Marin; Curkovic-Perica, Mirna (2016) - In such conditions the possibility of cell dehydration is increased due to diffi culty in the acquisi- tion of water by plant roots. In all to- bacco lines roots of control plants were fi brous and thick, 3.5–5 cm long, with lateral branches, while plants exposed to 100 mM NaCl had shorter roots (1–2.5 cm). Keywords: 239k; activity; dh10; hybrid; lines; nacl; proline; roots; salinity; salt; stress; tobacco
• Physiological responses of crop plants against Trichoderma harzianum in saline environment by Yasmeen, Roomana; Siddiqui, Zamin Shaheed (2017) - Treatment of seeds with Trichoderma improved plant growth and Th-treated plants exhibited substantial physiological adjustment in a saline environment compared to Th-untreated plants. 2. Effect of Trichoderma harzianum seed treatment on seedling growth of maize (Zea mays L.) var. Keywords: b c; c d; harzianum; maize; plants; rice; salt; stress; trichoderma
• The ameliorative effects of 24-epibrassinolide on shoot organogenesis inhibition occurring under NaCl-stressed conditions in cultures of cotyledon and hypocotyl explants of tomato (Lycopersicon esculentum Mill.) by Yilmaz Gokdogan, Emel; Burun, Betul (2017) - Abstract – In this study, possible effects of 24-epibrassinolide (24-epiBL) pretreatment against NaCl stress were investigated using in vitro shoot organogenesis from cotyledon and hypocotyl explants in M-28 tomato hybrid cultivar. It was determined that the regeneration percentage as well as the shoot number/explant, the shoot length and the leaf number/shoot derived from both explants suffered NaCl stress after 30 days. Keywords: epibl; explants; hypocotyl; mm nacl; nacl; shoot; stress
• Physiological performance of sunflower genotypes under combined salt and drought stress environment by Umar, Muhammad; Siddiqui, Zamin Shaheed (2018) - Plants are frequently exposed to many extremes such as drought stress, low/high temperature, salt stress, flooding stress, and heavy metal toxicity while growing in nature. It was reported that in drought stress, plant growth retardation is linked with pho- tosynthesis, respiration, and nutrient metabolism. Keywords: chlorophyll; content; drought; genotypes; h2o2; plants; proline; s.28111; salt; sf0049; stress; stresses; sunflower; water
• Modulation of arsenic-induced oxidative stress and protein metabolism by diphenyleneiodonium, 24-epibrassinolide and proline in Glycine max L. by Chandrakar, Vibhuti; Dubey, Amit; Sahu, Keshavkant (2018) - The present study was intended to exam- ine the comparative ameliorative effects of diphenyleneiodonium (DPI), 24-epibrassinolide (EBL) and proline (Pro) on As-stress in Glycine max L. Seeds of Glycine max L. were subjected to As (100 µM) singly, and together with DPI (10 µM), EBL (0.5 µM) or Pro (10 mM), for five days, and were then analyzed. Therefore, in order to ex- plore the possibility of whether the ROS scavengers viz DPI, EBL or Pro, could be used to alleviate As-induced oxidative injury, the present study was aimed at examining the com- parative effects of DPI, EBL and Pro on growth and devel- opment, As accumulation, tissue viability, oxidative stress markers (electrolyte leakage, ROS, MDA, HNE, endogenous Pro and total sugar), total protein and its oxidized products (PCO, PrOOH, Amadori and Maillard reaction products and MDA-/HNE-protein adducts), activities of protease and proteasome, and responses of antioxidant enzymes in As- stressed Glycine max L. Materials and methods Seed collection, treatments and germination assessment Fresh seeds of Glycine max L. were collected from the farmers of Kabirdham (N22°01', E81°23', 353 MSL), 110 km to the south of Raipur. Keywords: arsenic; chandrakar; dpi; ebl; et al; glycine; glycine max; max; max l.; min; pro; protein; stress
• Physiological and growth responses of sour cherry (Prunus cerasus L.) plants subjected to short-term salinity stress by Papadakis, Ioannis E; Veneti, Georgia; Chatzissavvidis, Christos; Therios, Ioannis (2018) - According to Tattini et al. (1995), the maintenance of plant growth and PAPADAKIS I. E., VENETI G., CHATZISSAVVIDIS C., THERIOS I. 198 ACTA BOT. Therefore, the current study aimed to investigate the growth and physiological re- sponses (plant growth, chlorophyll concentration, water re- lations and nutrient status) of the well-known sour cherry genotype CAB-6P, which is widely used as a rootstock for both sour and sweet cherry cultivars, under salt stress. Keywords: fig; growth; leaves; nacl; plants; root; salinity; stress
• Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum by Kisa, Dursun (2019) - Hossain, Z., Komatsu, S., 2012: Contribution of proteomic stud- ies towards understanding plant heavy metal stress response. 78 (1), 9–16, 2019 CODEN: ABCRA 25 DOI: 10.2478/botcro-2018-0023 ISSN 0365-0588 eISSN 1847-8476 Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum Dursun Kısa Bartın University, Faculty of Science, Department of Molecular Biology and Genetics, 74110, Bartın, Turkey Abstract – The expression of stress related-genes against adverse environmental conditions has essential importance for plants. Keywords: chelating; content; expression; gene; leaves; metal; p5cs1; pcs; plants; ppm; proline; stress; tomato
• Optimizing irrigation and determining the most sensitive development stage to drought in barley (Hordeum vulgare L.) in a semi-arid environment by Romdhane, Leila; Dal Ferro, Nicola; Slama, Amor; Radhouane, Leila (2020) - However, significant differ- ences in water deficit stages were observed between till- ering (37.0, on average) and both elongation and heading (17.2, on average). Under- standing the response of crop development stages to water deficit stress provides an opportunity for optimizing irrigation. Keywords: barley; days; deficit stress; heading; leaf; potential; soil; stage; stress; tillering; varieties; water; water deficit
• The synergistic effects of hydro and hormone priming on seed germination, antioxidant activity and cadmium tolerance in borage by Sheikhzadeh, Parisa; Zare, Nasser; Mahmoudi, Fatemeh (2021) - On the oth- er hand, under both non-stress and cadmium stress condi- tions, the activity of catalase and peroxidase enzymes in seedlings obtained from primed seeds was significantly higher than that of seedlings from non-primed seeds (Fig. In borage, the proline con- tent of seedlings from primed seeds was significantly high- er than that of seedlings obtained from non-primed seeds, but the amount of increase in proline content varied from a 1.06 to a 1.45-fold change depending on cadmium stress level and seed priming treatments (Fig. 7). Keywords: borage; cadmium; cadmium stress; germination; hormone; hormone priming; hydro; l–1; priming; seed; seedling; stress
• Plant development, gas exchanges and pigments of Mesosphaerum suaveolens submitted to osmoconditioning and saline stress by Figueiredo, Francisco Romário Andrade; Nóbrega, Jackson Silva; Fátima, Reynaldo Teodoro de; Silva, Toshik Iarley da; Nascimento, Rodrigo Garcia da Silva; Lopes, Maria de Fátima de Queiroz; Dias, Thiago Jardelino; Bruno, Riselane de Lucena Alcântara (2021) - Irrigation water of electrical conduc- tivity above 3.2 dS m–1 caused reductions in chlorophyll a, b and total contents in M. suaveolens plants. Irrigation water with elec- trical conductivity above 3.2 dS m–1 caused reductions in chlorophyll a, b and total contents in M. suaveolens plants. Keywords: chlorophyll; irrigation; plants; saline; salinity; stress; suaveolens; water
• Transgenerational stress memory in Arabidopsis thaliana (L.) Heynh.: antioxidative enzymes and HSP70 by Ćuk, Katarina; Gogala, Marko; Tkalec, Mirta; Vidaković-Cifrek, Željka (2010) - In order to minimize the effects of UV irradiation plants activate different physiological responses, such as the biosynthesis of protecting compounds (STAPLETON 1992), the reactive oxygen species (ROS) scavenging system (XU et al. 2008) and DNA re- pair mechanisms (MOLINIER et al. 2005). The Journal of Biological Chemistry 279, 779–787. DAT, J., VANDENABEELE, S., VRANOVÁ, E., VAN MONTAGU, M., INZÉ, D., VAN BREUSEGEM, F., 2000: Dual action of the active oxygen species during plant stress responses. Keywords: activity; control; generation; hsp70; irradiation; m–2; plants; progeny; stress
• Effect of moderate heat stress on Arabidopsis thaliana with modified BPMs expression by Vitko, Sandra; Vidaković-Cifrek, Željka; Bauer, Nataša; Leljak-Levanić, Dunja (2022) - 81 (2), 140–148, 2022 CODEN: ABCRA 25 DOI: 10.37427/botcro-2022-011 ISSN 0365-0588 eISSN 1847-8476 Effect of moderate heat stress on Arabidopsis thaliana with modified BPMs expression Sandra Vitko, Nataša Bauer, Dunja Leljak-Levanić, Željka Vidaković-Cifrek* University of Zagreb, Faculty of Science, Department of Biology, Rooseveltov trg 6, 10000 Zagreb, Croatia Abstract – The aim of this research was to investigate the oxidative stress response of Arabidopsis with modified BPMs expression to moderate heat stress. Keywords: activity; amir; arabidopsis; bpm; content; heat; oebpm1; seedlings; stress; time; type; wild
• Acer velutinum Bioss. (velvet maple) seedlings are more tolerant to water deficit than Alnus subcordata C.A. Mey. (Caucasian alder) seedlings by Ravanbakhsh, Mokarram; Babakhani, Babak; Ghasemnezhad, Mahmood; Serpooshan, Fariba; Biglouie, Mohamad Hassan (2023) - SLA showed an increasing trend in A. velutinum under drought stress treatments. Farooq, M., Wahid, A., Kobayashi, N., Fujita, D., Basra, S. M. A., 2009: Plant drought stress: Effects, mechanisms and mana- gement. Keywords: a. subcordata; a. velutinum; biomass; chl; content; drought; drought stress; et al; leaf; rwc; seedlings; species; stress; treatments; water
• Mitigation of cadmium toxicity stress by magnetopriming during germination of soybean by Vyas, Anjali; Kataria, Sunita; Prajapati, Rajkumar; Jain, Meeta (2024) - Soybean seeds were magnetoprimed with static magnetic field (SMF) strength of 200 mT for 1 hour before germination. Based on previous studies, soybean seeds were treated with 200 mT of SMF for an hour (Kataria et al. 2020). Keywords: cadmium; cdcl2; et al; germination; growth; seedlings; seeds; soybean; soybean seedlings; stress; toxicity; unprimed
• Effects of acetic acid treatment on growth and pigment contents in barley by Temel, Aslihan; Kösesakal, Taylan (2024) - Because AA is a precursor of acetyl-CoA, an essential molecule of carbohydrate metabolism, we decided to inves- tigate how AA treatment affects sugar contents in roots. In conclusion, even at low concentrations, AA treatment can induce dramatic and persistent changes in non-stressed plants that endure even after AA is removed. Keywords: aa treatment; acid; concentrations; content; day; effects; et al; plants; stress; treatment
• Sulfur deficiency reduces the thermotolerance of Heliotropium thermophilum to high temperatures by İmamoğlu, Ece Nisa; Sağlam, Aykut; Kadıoğlu, Asim (2025) - The high temperature treatment resulted in an increase in the fresh weight of plants in FN medium, while in 0.30 and 0.15 mM sulfate grown plants it was re- duced by 39% and 20%, respectively, compared to respective values obtained at 25 °C. In our study, H. thermophilum plants were exposed to two distinct sulfate concentrations to evaluate the impact of sulfur deficiency on their response to high temperatures in vermiculite media with Hoagland nutrient solution. Keywords: activity; content; deficiency; expression; heat; medium; mm sulfate; plants; stress; sulfate media; sulfur; temperature; ° c
• Effects of double stress on antioxidant enzyme activity in Vigna radiata (L.) Wilczek by Siddiqui, Zamin Shaheed (2013) - KeyWord: Antioxidant, catalase, enzyme activity, glutathione reductase, guaiacol per- oxidase, scorbate peroxidase, seedling, stress, superoxide dismutase, Vigna radiata Abbreviations: APX – ascorbate peroxidase, CAT – catalase, GPX – guaiacol peroxidase, GR – glutathione reductase, ROS – reactive oxygen species, SOD – superoxide dismutase Introduction Environmental stress factors like drought, temperature, high salinity and heavy metals are the major constraint that limit plant growth and productivity, by disturbing the intra- cellular water balance. TATIANA, Z., YAMASHITA, K., MATSUMOTO, H., 1999: Iron deficiency Induced changes in ascorbate content and enzyme activities related to ascorbate metabolism in cucumber root. Keywords: activities; activity; antioxidant; environment; enzyme; lead; nacl; peroxidase; stress
• Oxidative stress and antioxidant indices of marine alga Porphyra vietnamensis by Pise, Navnath M.; Gaikwad, Dattatry K.; Jagtap, Tanaji G. (2013) - Induction of oxidative stress biomarkers associated with heavy metal stress in Fontinalis antipyretica Hedw. The alphabetical letters (a, b, c) mark significant difference at p < 0.05. Antioxidant defence systems In the present study, CAT activity was significantly higher in the sample from Dona Paula and Malvan, further indicating metal stress increasing the formation rate of H2O2 (Fig. 2B). Keywords: antioxidant; dona; h2o2; marine; metal; paula; stress; vietnamensis
• Regulation of growth and some key physiological processes in salt-stressed maize (Zea mays L.) plants by exogenous application of asparagine and glycerol by Kaya, Cengiz; Aydemir, Salih; Sonmez, Osman; Ashraf, Muhammed; Dikilitas, Murat (2013) - ASHRAF, M., 2009: Biotechnological approach of improving plant salt tolerance using anti- oxidants as markers. Glycerol was more effective than aspara- gine in improving salinity tolerance of maize plants in terms of growth and physiological attributes measured in the present study. Keywords: asparagine; glycerol; growth; kaya; maize; maize plants; plants; profile; salt; stress
• Chlorophylls content and photosynthetic efficiency in two sour cherry (Prunus cerasus L.) genotypes under drought stress by Viljevac, Marija; Dugalic, Krunoslav; Mihaljevic, Ines; Šimic, Domagoj; Sudar, Rezica; Jurkovic, Zorica; Lepeduš, Hrvoje (2013) - By con- trast, electron transport per active reaction center (ET0/RC) was significantly lowered in drought treatment leaves of genotype Kelleris 16 while the same parameter in drought treat- ment leaves of genotype OS remain unchanged (Fig. 4C). Genotype / parameter Kelleris 16 OS t p(t) t p(t) ABS/RC –4.39 *** –4.15 *** TR0/RC –0.72 ns –2.84 ** ET0/RC 15.70 *** –0.17 ns DI0/RC –4.02 ** –2.97 ** sorption (ABS/RC) and dissipation (DI0/RC) of light energy per active reaction centre were significantly higher in drought treated leaves than in control leaves of both genotypes (Fig. 4A and D). Keywords: cherry; chlorophyll; control; drought; genotypes; kelleris; leaves; reaction; stress; water
• Leaf rolling reduces photosynthetic loss in maize under severe drought by Saglam, Aykut; Kadioglu, Asim; Demiralay, Mehmet; Terzi, Rabiye (2014) - In conclusion, leaves were rolled in drought tolerant maize cultivars later than in sensi- tive cultivars under drought stress. Drought stress and artifi cial pre- vention of leaf rolling (PLR) were applied at grain fi lling stage for 30 days. Keywords: batem; control; cultivars; drought; fold; leaf; maize; photosynthesis; plr; rolling; rubisco; stress; water

• Towards detecting bioclimatic niche – species distribution modelling in four maple species (Acer spp.) by Kabas, Eva; Batanjski, Vera; Glasnovic, Peter; Vicic, Drazen; Tanaskovic, Aljosa; Kuzmanovic, Nevena; Lakusic, Dmitar; Sinzar Sekulic, Jasmina (2014) - Journal of Arachnology 36, 574–582. AUSTIN, M. P., 2002: Spatial prediction of species distribution: an interface between eco- logica theory and statistical modelling. Predicting species distribution: offering more than simple habitat models. Keywords: acta; bioclimatic; bot; croat; data; distribution; pseudoplatanus; serbia; species
• Least adder’s-tongue (Ophioglossum lusitanicum L.) in Croatia – distribution, ecology and conservation by Brana, Slavko; Vukovic, Nina; Kaligaric, Mitja (2014) - For this reason, O. lusitanicum was overlooked and listed as extinct in the fi rst complete index of the Croatian fl ora (HRŠAK 1994) and the fi rst Red Book of plant species of the Republic of Croatia (MARKOVIĆ 1994). O. lusitanicum is a cosmopolite species, widely distrib- uted in Europe in the Mediterranean/Western European part (CLAUSEN 1938, JALAS and SUOMINEN 1972, DERRICK et al. 1987, AKEROYD 1993). Keywords: acta; croatia; istria; localities; lusitanicum; ophioglossum; ora; pula; species
• Seasonal leaf dimorphism in Potentilla argentea L. var. tenuiloba (Jord.) Sw. (Rosaceae) by Kolodziejek, Jeremi; Glinska, Slawa; Michlewska, Sylwia (2015) - From the primary data the following variables were derived: 1) dissection index (DI) according to KINCAID and SCHNEIDER (1983), MCLELLAN (1993, 2000): DI = perimeter/[2√area × p], 2) leaf mass area (LMA, mg mm–2; leaf dry mass per one-sided leaf area), and 3) leaf density (LD, mg mm–3; leaf dry mass per leaf volume [leaf area × leaf thickness]). Key words: leaf dimorphism, leaf structure, leaf mass area, Potentilla argentea * Keywords: acta; area; argentea; autumn; chloroplast; density; leaf; leaves; potentilla; summer; summer leaves; thickness
• Colonization of diatoms and bacteria on artificial substrates in the sea by Mejdandzic, Maja; Ljubesic, Zrinka; Ivankovic, Tomislav; Pfannkuchen, Martin; Godrijan, Jelena; Maric Pfannkuchen, Daniela; Hrenovic, Jasna (2015) - Further, these interactions appear to initialize the formation of diatom biofi lms and aggregates, as has been shown with marine microbial communities. Such biofi lm formation, also known as fouling, is a complex multi- stage process and not yet thoroughly investigated. Keywords: abundance; acta; adriatic; bacteria; biofi; cells; diatoms; exposure; plates; surface
• Stratigraphic and taxonomic significance of siliceous microfossils collected from the Turiec Basin, Western Carpathians (Slovakia) by Ognjanova-Rumenova, Nadja Georgieva; Pipík, Radovan (2015) - Many of them are concerned with the inventory, de- scription and typifi cation of various diatom species from raw materials, housed in different European diatom collections: Ehrenberg (Berlin), Pantocsek (Budapest), Hustedt (Bremer- haven), Grunow (Vienna), etc. Neogene non-marine diatoms for this area were documented and illustrated by early work- ers (EHRENBERG 1854, GRUNOW 1882, PANTOCSEK 1892, 1905). Keywords: acta; alveolophora; basin; diatom; jouseana; miocene; moisseeva; species; staurosirella; turiec
• Diatom composition of the rheoplankton in a rhithral river system by Bolgovics, Ágnes; Ács, Éva; Várbíró, Gábor; Kiss, Tihamér Keve; Borics, Gábor (2015) - An elementary, structural analysis of river phytoplankton. The potamoplankton of large rivers has been extensively studied (KISS 1987, KISS and GENKAL 1996, REYNOLDS and DESCY 1996, KISS et al. 2002, KISS and ÁCS 2009), but the phytoplankton of the upper river segments has received much less atten- tion. Keywords: acta; borics; diversity; kiss; phytoplankton; rivers; species; water
• Diatom communities and vegetation of springs in the south-western Alps by Mogna, Marcella; Cantonati, Marco; Andreucci, Flora; Berta, Graziella; Miserere, Luca (2015) - Discussion Our study extended and improved knowledge gained on spring diatom communities in the south-eastern Alps to the south-western Alps, and added several further useful observa- tions. Characteristic spring taxa (crenophiles) were present. Keywords: acta; alps; bertalot; bot; cantonati; carbonate; croat; diatom; fig; lange; species; springs; taxa; vegetation; water
• Morphology of Anemone sylvestris L. flower (Ranunculaceae) by Denisow, Bozena; Anton, Sebastian; Wrzesien, Ma?gorzata (2016) - L. fl ower (Ranunculaceae) The odourless perianth, absence of nectar, scarcity of pollen (approximately 200 000 pollen grains per fl ower) and its traits – small size (axis P = 18.52 ± 1.0 μm; E = 16.59 ± 0.9 μm), lack of balsam on the exine surface, starch accumulation in more than 95% of pollen grains correspond to the specialization in anemophily. Keywords: acta; anemone; denisow; grains; ower; pollen; pollination; ranunculaceae; species; sylvestris
• Phytoplankton composition and biomass of the northern-Adriatic lagoon of Stella Maris, Croatia by Fanuko, Neda; Valcic, Marko (2009) - The lagoons of the northwest Adriatic coast have been studied with much attention for over two centuries (NARDO 1847, NINNI 1906, BABI] 1911, KIESSELBACH,1936, BRUNETTI et al.1983, OREL et al. 2001, COVELLI et al. 2005), particularly with respect to lagoon phytoplankton (VATOVA1940, 1961; MARCHESONI 1954; TOLOMIO 1982; TOLOMIO and BULLO 2001; FACCA et al. 2002, 2003; SOCAL et al. 2006). Location of Stella Maris lagoon with sampling site U:\ACTA BOTANICA\Acta-Botan 1-09\Fanuko.vp 16. Keywords: acta; adriatic; carbon; cell; croat; fanuko; ju l; lagoon; maris; phytoplankton; species; stella; volume
• Acta Botanica Croatica: editorial activity and scientometric analysis for the period 1998–2014 by Vilicic, Damir; Sirotic, Grozdana (2016) - Since 2011 the number of libraries in Europe and North America where Acta Botanica Croatica content is disseminated increased to 624, i.e. 256 libraries in North America (according to ELU- NA 2016) and 368 in Europe (according to IGeLU 2016). 75 (1), 2016 S1 Social news Acta Botanica Croatica: editorial activity and scientometric analysis for the period 1998–2014 Damir Viličić, Grozdana Sirotić University of Zagreb, Faculty of Science, Department of Biology, Rooseveltov trg 6, 10000 Zagreb, Croatia Abstract – An editorial report concerning and scientometric analysis of papers published in the journal Acta botanica croatica for the period from 1998 to 2014 is presented. Keywords: acta; botanica; croatica; journal; period
• Vegetation of Croatia: Phytosociological classification of the high-rank syntaxa by Skvorc, Zeljko; Jasprica, Nenad; Alegro, Antun; Kovacic, Sanja; Franjic, Jozo; Krstonosic, Daniel; Vranesa, Ana; Carni, Andraz (2017) - For example, forest vegetation was investigated and documented to a greater extent. The first reviews of forest vegetation appeared in the works of Hor- vat (1937, 1938), and since then many comprehensive re- views have been published (e.g. Rauš et al. 1992, Vukelić et al. 2008, Vukelić 2012). Keywords: acta; atlantic; belts; boreal; bot; br.-bl; calcareous; central; communities; conserv; croatia; et al; et tx; eunis; europe; european; forests; grasslands; habitats; herb; herb vegetation; horvat; horvatić; low; mediterranean; montane; mucina; mucina et; nemoral; nom; nutrient; oak; oberd; passarge; prevlašću; propos; regions; rivas; sandy; scrub; soils; southern; subalpine; syn; temperate; tlima; travnjaci; trinajstić; vegetacija; vegetation; visokih; western; zajednice; zeleni; zone; čarni; šikare; šume
• In memoriam Ana Zlata Štefanac (1935-2019) by Škoric, Dijana (2019) - Profes- sor A. Z. Štefanac was not only an author published in but also served on the editorial board of Acta Botanica Croatica from 1982 until 2008. When Prof. Miličić started gather- ing a team of young collaborators for his pioneering work on plant viruses, she was the first to join in as early as in 1959. Keywords: acta; botanica; croatica; miličić; virus; štefanac
• Preface from the New Editor-in-Chief by Jasprica, Nenad (2020) - In 2019, I accepted the role of editor-in-chief for Acta Botanica Croatica after my 10-year term within the Editorial Board as the subject editor in phycology and vegetation ecology. High quality standards and modern scientific content should be a permanent editorial goal in order for the success of Acta Botanica Croatica to be maintained. Keywords: acta
• Preface by Jasprica, Nenad (2009) - The 20th International Diatom Symposium thus would be convened in Dubrovnik in September 2008. listopad 2009 11:34:49 Color profile: Disabled Composite 150 lpi at 45 degrees I express my sincere thanks to all our sponsors: the Croatian Ministry of Science, Edu- cation, and Sports; the City of Dubrovnik; the Croatian Environmental Protection and En- ergy Efficiency Fund; Dubrovnik Airport Ltd.; Koeltz Scientific Books, Koenigstein, Ger- many; and Fluid Imaging Technologies, Yarmouth, Maine (USA); and, of course, the Institute for Marine and Coastal Research of the University of Dubrovnik. Keywords: acta; diatoms; dubrovnik; marine; symposium; university
• Lichen flora of Zumberak-Samoborsko gorje Nature Park, NW Croatia by Partl, Anamarija (2011) - Gray D Platismatia glauca (L.) W. L. Culb. 2, 6, 7, 8 Anaptychia ciliaris (L.) Körb. Keywords: ach; acta; area; croatia; hoffm; lichens; nyl; species
• Cyanobacteria of thermal spring at Pancharevo, Sofia, Bulgaria by Lukavsky, Jaromir; Furnadzhieva, Sevdalina; Pilarski, Plamen (2011) - Mastigocladus laminosus was indentified from other hot springs: Kaziczene, Ravno Pole, Zheleznitza, in Sofia basin, Strelcza near , Gradeshnitza, in the Sandanski basin (LU- KAVSKÝ et al., not published). Turichia et al. 2009 (syn. Keywords: acta; cells; cyanobacteria; et al; laminosus; mastigocladus; phormidium; plate; species; springs; thermalis
• Phytoplankton composition and abundance assessment in the Nador lagoon (Mediterranean coast of Morocco) by El Madani, Faid; Chiaar, Abderrahim; Chafi, Abdelhafid (2011) - Balech – – + + – – – – – – + 3 Alexandrium margalefi Balech – – – – – – – – – + + 4 Alexandrium minutum Halim + + + + + + + + + + + 5 Alexandrium pseudogonyaulax (Biecheler) Horiguchi ex Yuki et Fukuyo – + + – – + – + + + + 6 Alexandrium sp. – – – – – – – – + – + 7 Alexandrium tamarense (Lebour) E.Balech – – – – – – + – – – – 8 Amphidinium sp. – – – + + – – – – – – 9 Amphidoma caudata Halldal + + + + + + + + + + + 10 Amylax sp. – – – + – – – – – – – 11 Archaeperidinium sp. – – – – – – – – – – + 12 Coolia monotis Meunier + + + – – – + + – + + 13 Cyst Alexandrium minutum – – – + + + – + + + – 14 Cyst of dinoflagellates + + + – – + + + + + + 15 Dinophysis caudata Saville–Kent – + – – – – + + + + + 16 Dinophysis contracta (Kofoid et Skogsberg) Balech – – – – – – – – – – + 17 Dinophysis diegensis Kofoid – – – – – – – – – – + 18 Dinophysis exigua Kofoid and Skogsberg – – + – – – – – + + + 19 Dinophysis rapa (Stein) Balech – – – – – – – – – – + 20 Dinophysis rotundata Claparède et Lachmann – – – – – – – – – – + 21 Dinophysis sacculus Stein + + + + + + + + + + + 22 Dinophysis sp. – – – – – – – – – – + 23 Diplopelta asymetrica (Mangin) Lindermann – – – – + – – + – – – 24 Diplopelta steinii (T. H. Abé) E. Balech – – – – – – – – – – + 25 Diplopeltopsis minor Pavillard – + – – – – – – – – + 26 Diplopeltopsis sp. – + – – – – – – – – – 27 Diplopsalis sp. + + + – + + + + + + + 28 Diplopsalopsis bomba (Stein ex Jörgensen) J. D. Dodge et S. Toriumi – – – – – – – – + – – Tab. 70 (2), 2011 EL MADANI F., CHIAAR A., CHAFI A. Stations 1 2 3 4 5 6 7 8 9 10 11 29 Diplopsalopsis sp. – – – – – – – – – + – 30 Ensciculifera sp. + + + + – + + + + – + 31 Ensiculifera angulata E. Balech – – – – – – – – – + – 32 Ensiculifera angulata E. Balech – – – – – – – – – – + 33 Gambierdiscus toxicus Adachi and Fukuyo + – – – – – – – – – – 34 Goniodoma polyedricum (Pouchet) Jörgensen – – + – – – – – – + + 35 Gonyaulax dicantha (Meunier) Schiller – – + + + + + + + – + 36 Gonyaulax digitale (Pouchet) Kofoid + – – + – + + + – + + 37 Gonyaulax grindleyi Reinecke – – – – – – – + – – + 38 Gonyaulax polygramma Stein – – – – – + – – + + + 39 Gonyaulax sousae Balech + + + + + + + + + + + 40 Gonyaulax spinifera (Claparède et Lachmann) Keywords: acta; balech; bot; chaetoceros; croat; ehrenberg; gómez; lagoon; lópez; moreira; nador; neoceratium; phytoplankton; protoperidinium; stations
• Celebrating the eightieth birthday of Professor Peter Sitte by Devide, Zvonimir (2010) - In the name of all our Croatian colleagues and the Editorial Board of the Acta Botanica Croatica, Zvonimir Devidé Journal papers, congress proceedings papers, books and book chapters SITTE, P., 1953: SITTE, P., 1954: Keywords: acta; biologie; biology; cell; der; des; die; evolution; feinbau; für; hrsg; sitte; und; verlag; von
• Marine benthic diatoms from the Adriatic Sea (NE Mediterranean): review of investigations and checklist with updated nomenclature by Car, Ana; Kaleli, Aydin (2025) - Gyrosigma fasciola (Ehrenberg) J. W. Griffith & Henfrey [N] Gyrosigma lineare (Grunow) Cleve [N] Gyrosigma macrum (W.Smith) J.W.Griffith & Henfrey [N, S] Gyrosigma prolongatum (W.Smith) J.W.Griffith & Henfrey [N] Gyrosigma scalproides (Rabenhorst) Cleve [M] Gyrosigma strigilis (W.Smith) J.W.Griffin & Henfrey [N] Gyrosigma wansbeckii (Donkin) Cleve [N] Halamphora acutiuscula (Kützing) Levkov* Halamphora borealis (Kützing) Levkov [M] Halamphora coffeiformis (C. Agardh) Levkov* Halamphora costata (W.Smith) Levkov* Halamphora cuneata (Cleve) Levkov [M, S] Halamphora cymbifera (Gregory) Levkov [M] Halamphora exigua (W.Gregory) Levkov [M, S] Halamphora granulata (Gregory) Levkov [M, S] Halamphora holsatica (Hustedt) Levkov [M] Halamphora hyalina (Kützing) Rimet & R.Jahn* Halamphora hybrida (Grunow) Levkov [M] Halamphora interrupta (Heiden) Levkov [M] Halamphora kolbei (Aleem) Álvarez-Blanco & S.Blanco [M, S] Halamphora lineata (Gregory) Levkov [M] Halamphora luciae (Cholnoky) Levkov [M, S] Halamphora pseudoholsatica (T.Nagumo & H.Kobayashi) J.G.Stepanek & Kociolek [M, S] Halamphora pseudohyalina (Simonsen) J.G.Stepanek & Kociolek [M, S] Halamphora staurophora (Juhlin-Dannfelt) Álvarez-Blanco & S.Blanco [S] Actinocyclus splendens J.Rattray [M] Actinocyclus subtilis (W. Gregory) Ralfs [M, S] Actinoneis lorenziana (Grunow) Mereschkowsky Keywords: acta; adriatic; adriatic sea; amphora; bertalot; car; cibic; cleve; coastal; cocconeis; communities; community; composition; d.g.mann; diatoms; diploneis; distribution; ehrenberg; et al; grunow; halamphora; hustedt; kaleli; kützing; lange; licmophora; marine; mastogloia; mediterranean; mediterranean sea; metzeltin; navicula; nitzschia; northern; research; sea; species; studies; study; substrates; taxa; var; w.gregory; w.smith; witkowski
• Professor Nikola Ljubesic on the occasion of his seventieth birthday by Prebeg, Tatjana; Fulgosi, Hrvoje; Wrischer, Mercedes (2010) - Identification of turnip mosaic virus in Tropaeolum majus L. Acta Botanica Croatica 34, 33–42. MILI^I], D., [TEFANAC, Z., LJUBE[I], N., 1975: Biologia, Bratislava 56, 605–610. LJUBE[I], N., WRISCHER, M., PREBEG, T., BRKI], D., 2001: Carotenoid-bearing structures in fruit chromoplasts of Solanum capsicastrum Link. Keywords: acta; acta botanica; botanica; chromoplasts; croatica; ljube[i; prebeg; professor; wrischer
• The Croatian National Diatom Collection – an overview and future challenges by Ljubešić, Zrinka; Jurina, Dunja; Pavlović, Tin; Živolić, Mario; Levkov, Zlatko; Mucko, Maja; Bosak, Sunčica; Gligora Udovič, Marija (2025) - https://doi.org/10.1080/09670262.2019.16283 07 Mann, D. G., Droop, S. J. M., 1996: 3. Biodiversity, biogeography and conservation of diatoms. References Adl, S. M., Bass, D., Lane, C. E., Lukeš, J., Schoch, C. L., Smirnov, A., Agatha, S., Berney, C., Brown, M. W., Burki, F., Cárdenas, P., Čepička, I., Chistyakova, L., del Campo, J., Dunthorn, M., Edvardsen, B., Eglit, Y., Guillou, L., Hampl, V., Heiss, A. A., Hoppenrath, M., James, T. Y., Karnkowska, A., Karpov, S., Kim, E., Kolisko, M., Kudryavtsev, A., Lahr, D. J. G., Lara, E., Le Gall, L., Lynn, D. H., Mann, D. G., Massana, R., Mitchell, E. A. D., Morrow, C., Park, J. S., Pawlowski, J. W., Powell, M. J., Richter, D. J., Rueckert, S., Shadwick, L., Shimano, S., Spiegel, F. W., Torruella, G., Youssef, N., Zlatogursky, V., Zhang, Q., 2019: Revisions to the classification, nomencla- ture, and diversity of eukaryotes. Keywords: acta; adriatic; bosak; collection; croatia; diatom; et al; figs; gligora; levkov; marine; material; micrograph; mucko; phytoplankton; research; sea; sem; species; udovič; valve; view
• Foreword by the Editors-in-Chief by Tkalec, Mirta; Jasprica, Nenad (2025) - Acta Botanica Croatica Nenad Jasprica Mirta Tkalec Editors-in-Chief Today, Acta Botanica Croatica attracts contributions from authors across the globe, fostering a diverse and inter- disciplinary approach to botanical research. Keywords: acta; journal
• Southeastern-Alpine endemic Leontodon hispidus subsp. brumatii (Cichoriaceae) in the Sava valley (central Slovenia) by Dakskobler, Igor; Seliskar, Andrej; Vres, Branko (2012) - Rhinanthus minor E1 . . + + . 6 40 Plantago major E1 . . . . . . . Keywords: acta; alpine; bank; bot; botanica\acta; brumatii; color; croat; dakskobler; dakskobler_verzija-10.vp; degrees; e2a; endemic; hispidus; leontodon; lpi; number; profile; relevé; riparian; river; rocks; salix; sava; slovenia; species; subsp; tab; u:\acta; valley; vre
• Classification of mesic grasslands and their transitions of South Transdanubia (Hungary) by Lengyel, Attila; Purger, Dragica; Csiky, Janos (2012) - KOVÁCS, J. A., 1994: Meadow associations of the Kõszeg Mts. and Kõszeg-hegyalja. It is also worth mentioning that Pastinaco–Arrhenatheretum is characterised by generalist meadow species, which are common on drying wet meadows and other dynamic types, thus the species composition of Pastinaco–Arrhenatheretum can easily appear on various sites. Keywords: acta; classification; croat; group; hungarian; hungary; lengyel; meadows; mesic; nutrient; relevés; species; stands; values; vegetation
• Centric diatoms of large rivers and tributaries in Hungary: morphology and biogeographic distribution by Kiss, Keve; Klee, Rolf; Ector, Luc; Acs, Eva (2012) - Some freshwater and brackish water species of the diatom genus Thalassiosira Cleve. According to BUDZYÑSKA and WOJTAL (2011), the limited number of citations of this centric diatom may be related to its misidentification or confusion with other Cyclotella species; they observed it in the plankton of the eutrophic-hypertrophic Rusa�ka Lake (Western Poland) and proposed the new combination Puncticulata balatonis (Pantocsek) Wojtal et Budzyñska. Keywords: acta; areolae; bot; centric; croat; cyclotella; diameter; diatoms; fig; fultoportulae; hungarian; kiss; mantle; marginal; pores; rivers; running; satellite; species; valve; valve face; view; waters
• Recent distribution of the Euro-Siberian-sub-Mediterranean species Elatine alsinastrum L. (Elatinaceae) by Popiela, Agnieszka; Lysko, Andrzej; Molnár V., Attila (2013) - Philcox, Cyperus fuscus L., Plantago major L. s.l., Gnaphalium uliginosum L., Eleocharis acicularis (L.) Roem. In: CASTROVIEJO, S. (ed.), Flora Iberica, 3. Real Jardín Botánico, Consejo Superior de Investigaciones Científicas, Madrid. COUTINHO, A. X. P., 1939: Flora de Portugal: plantas vasculares, 2. Bertrand, Lisboa. Keywords: acta; alsinastrum; data; des; distribution; elatine; europe; flora; locations; plants; popiela; species
• Cryoseston of the Pirin Mountains, Bulgaria by Cepak, Vladislav; Lukavsky, Jaromir (2013) - Identification of astaxanthin diglucoside diesters from snow alga Chlamydomonas nivalis by liquid chromatography – atmospheric pressure chemical ionization mass spectrometry. Rhizophydium acuforme has been observed several times, as common parasites of moving Chlamydomonas cells (LETCHER and POWELL 2012, LUKAVSKÝ 1970). Keywords: acta; cells; chloromonas; cryoseston; figs; hoham; lukavský; mountains; nivalis; pirin; snow
• Colchicum cupanii Guss. subsp. glossophyllum (Heldr.) Rouy, Datura innoxia Mill. and Eclipta prostrata (L.) L., new floristic records in Montenegro and western Balkan by Cakovic, Danka; Stesevic, Danijela; Vuksanovic, Snezana; Tan, Kit (2014) - In addition to Eclipta L. numerous adventive species were present, indicating a strong anthropogenic influence at this site: Conyza canadensis, Paspalum paspalodes (Michx) Scribner, Euphorbia maculata L., Sporobolus poirettii (R. et S.) Hitchc, Oenothera biennis L., Xanthium italicum Moretti, Aster squamatus (Spreng) Hieron. Acta Botanica Croatica 41, 155–170. HOLM, L. G., PLUCKNETT, D. L., PANCHO, J. V., HERBERGER, J. P. 1977: Keywords: acta; beach; cakovic; datura; flora; long; montenegro; profile; species; ulcinj
• Early spring ephemeral therophytic non-nitrophilous grasslands as a habitat of various species of Romulea in the southern Balkans by Carni, Andraž; Matevski, Vlado; Silc, Urban; Custerevska, Renata (2014) - Contribution to the kariological knowledge of Mediterranean Romulea species (Iridaceae). Relevés of such communities further to the south have not been published but similar therophytic communities of olive grove grassland show 65 % of Mediterranean species (^ARNI and MATEVSKI 2005). Keywords: acta; al.vp; bot; botanica\acta; carni; cmyk; color; communities; croat; esetg; fig; grasslands; mediterranean; precipitation; printer; profile; romulea; species; spring; ssp; u:\acta; vegetation
• New insights into the anatomy of an endemic Hladnikia pastinacifolia Rchb. by Sajna, Nina; Sustar–Vozlic, Jelka; Kaligaric, Mitja (2014) - The distribu- tion of vascular elements within H. pastinacifolia roots shows the annual formation of dis- tinct growth rings, which could be used for the method described by DIETZ and ULLMANN (1997) to estimate a specimen’s age. Discussion The new insight into H. pastinacifolia anatomy gave interesting new results which could help us to interpret the survival ability and fi tness constraints of this rare taxon. Keywords: acta; anatomy; ducts; fig; hladnikia; pastinacifolia; pollen; species; uorescence; šajna
• Phytoplankton composition of the Ebro River estuary, Spain by Perez, Maria del Carmen; Maidana, Nora Irene; Comas, Augusto (2009) - Silva et al. Koliella cf. COMAS GONZÁLEZ A., PÉREZ BALIERO, M. C., GONZÁLEZ DEL RÍO RAMS, J., 2006: Pedia- strum willei nom. Keywords: 09\perez.vp; acta; bot; color; croat; ebro; estuary; fig; grunow; kützing; lpi; phytoplankton; profile; river; round; species; var
• The influence of selected factors on the distribution of epilithic diatoms in a torrential river the Kamniška Bistrica (Slovenia) by Toman, Mihael Jozef; Groselj, Ana Marjetka; Zelnik, Igor (2014) - The highest number of diatom species (40) was found in summer samples (A), and the lowest (34) in winter (M) samples. (A) distribution of the samples along the environmental variables, where sites are represented with numbers (1–5) and seasons/months with letters (M – March, J – July, A – August); (B) distribution of diatom species present in at least three samples are shown: Ach bia – Achnan- thes biasolettiana, Ach min – Achnanthes minutissima, Amp ped – Amphora pediculus, Coc ped – Cocconeis pediculus, Coc pla – Cocconeis placentula, Cym aff – Cymbella affi nis, Cym min – Cymbella minuta, Cym sil – Cymbella silesiaca, Cym sin – Cymbella sinuata, Dia mon – Diatoma moniliformis, Dia vul – Diatoma vulgaris, Fra arc – Fragilaria arcus, Fra cap – Fragilaria capucina, Fra con – Fragilaria construens, Fra uln – Fragilaria ulna, Gom ang – Gomphonema angustatum, Gom oli – Gomphonema olivaceum, Gom par – Gompho- nema parvulum, Gom pum – Gomphonema pumilum, Mel var – Melosira varians, Mer cir – Meridion circulare, Nav ato – Navicula atomus, Nav crt – Navicula cryptotenella, Nav gre – Navicula gregaria, Nav lan – Navicula lanceolata, Nav men – Navicula menisculus, Nav tri – Navicula tripunctata, Nit dis – Nitzschia dissipata, Nit fon – Nitzschia fonticola, Nit pal – Nitzschia palea. Keywords: acta; conductivity; diatom; diversity; factors; river; samples; species; tab; taxa; temperature; variables; water

• Aegilops uniaristata Vis. (Poaceae): typification and occurrence in Croatia by Bogdanovic, Sandro; Ljubicic, Ivica; Clementi, Moreno (2015) - (Poaceae): typifi cation and occurrence in Croatia SANDRO BOGDANOVIĆ1*, IVICA LJUBIČIĆ1, MORENO CLEMENTI2 1 University of Zagreb, Faculty of Agriculture, Department of Agricultural Botany, Svetošimunska 25, 10000 Zagreb, Croatia 2 University of Padova, Department of Biology, Via Ugo Bassi 58 B, 35131 Padova, Italy Abstract – After 88 years, occurrence of Aegilops uniaristata Vis. (Poaceae) in Croatian fl ora was confi rmed and its distribution is supplemented by new localities. Present distribution of Aegilops uniaristata Vis. in Croatia (▲ literature data, ● herbarium data). Keywords: aegilops; croatia; flora; herbarium; istria; pad; species; uniaristata
• Small-flowered bittercress, Cardamine parviflora L. (Brassicaceae), a new species of the Croatian flora by Prlic, Dragan (2015) - The small-fl owered bittercress, Cardamine parvifl ora L., occurs in numerous European countries, but is absent from certain parts of the Balkan Peninsula (JALAS and SUOMINEN 1994, MARHOLD 1995). The location of Cardamine parvifl ora L. (black dot) within the area of Slatina (Croatia). CARDAMINE PARVIFLORA IN CROATIA ACTA BOT. Keywords: area; cardamine; croatia; flora; ora; parvifl; species
• Goniolimon dalmaticum Rchb. f. and G. tataricum (L.) Boiss. (Plumbaginaceae) in the Croatian flora and their distribution in the Balkan Peninsula by Buzurovic, Uroš; Bogdanovic, Sandro; Niketic, Marjan; Tomovic, Gordana (2016) - To confi rm the iden- tity of G. tataricum as a new species, morphometric study and multivariate statistical analysis were per- formed on the data from four Croatian populations of G. dalmaticum and G. tataricum. The chorological analyses included herbarium specimens of G. dalmaticum and G. tataricum from the following herbaria collections: Keywords: beou; boiss; buzurović; coll./det; dalmaticum; distribution; flora; goniolimon; mgrs; populations; records; rev; species; sub; tataricum
• Bouché’s star of Bethlehem, Ornithogalum boucheanum (Kunth) Asch. (Hyacinthaceae), a new species in flora of Croatia by Purger, Dragica; Kovacic, Sanja; Csiky, Janos (2017) - According to the results of Bednorz and Czarna (2008) seeds of O. boucheanum and O. nutans, two closely related and morphologically very similar species, are practically undistinguishable. The chromosome numbers of O. boucheanum have been determined as 2n=56 (basic chromosome number x= 8), while the chromosome numbers of O. nutans are deter- mined as 2n=14 and 2n=35 (basic chromosome number x= 7) (Dalgıc and Ozhatay 1997, Dalgıc et al. 2009). Keywords: boucheanum; croatia; flora; hungary; nikolić; nutans; ornithogalum; species
• Rare plants of threatened habitats – the Croatian case of Corrigiola litoralis L. (Caryophyllaceae) by Vukovic, Nina; Segota, Vedran; Alegro, Antun; Sedlar, Zorana (2018) - Keywords: endangered habitats, IUCN, Mediterranean temporary ponds, Molat * Corresponding author, e-mail: vedran.segota@biol.pmf.hr Introduction According to Flora Europaea, the genus Corrigiola is rep- resented in Europe by two species: C. litoralis L. (with two subspecies, C. litoralis L. ssp. litoralis and C. litoralis L. ssp. telephiifolia (Pourr.) Keywords: corrigiola; croatia; flora; habitats; litoralis; species; trinajstić
• New xenophytes from the Canary Islands (Gran Canaria and Tenerife; Spain) by Verloove, Filip (2017) - (Araliaceae) Tenerife: Buenavista del Norte, Golf Court (W-side), epi- phyte on Phoenix, 30.06.2014, F. Verloove 10884 (BR); Torviscas, close to barranco Colon, epiphyte on Phoenix, 31.10.2014, F. Verloove s.c.; Las Galletas, TEN-BEL, epi- phyte on Phoenix, 11.06.2015, F. Verloove s.c.; Playa de Las Américas, Fañabe, Hotel Riu, epiphyte on Phoenix, 15.06.2015, F. Verloove s.c. coriacea, Playa Paraiso, barranco de Las Galgas, June 2014 (photo F. Verloove). Keywords: barranco; barranco de; canaria; canary; canary islands; cruz; flora; gran; gran canaria; individuals; islands; new; riverbed; species; tenerife; verloove
• Long time no see – rediscovery of peculiar ephemeral fern Anogramma leptophylla (L.) Link in Croatia by Segota, Vedran; Hrsak, Vladimir; Alegro, Antun (2017) - In order to avoid its competitors, A. leptophylla fi nishes its short life- cycle at the end of spring when ephemeral mosses, liver- worts and minute seed plants start to inhabit the unhostile surfaces. The establishment of A. leptophylla on the western part of the island of Mljet may be attributable to certain favourable environmental conditions, but essentially to higher air and soil hu- midity. Keywords: anogramma; croatia; der; flora; island; leptophylla; mediterranean; mljet; species
• Galium divaricatum Pourr. ex Lam. (Rubiaceae) – a new species for the flora of Ukraine by Novák, Pavel; Zukal, Dominik (2018) - Besides G. divaricatum, two other spe- cies of this group occur in Central Europe, G. parisiense and G. tenuissimum. This paper focuses on G. divaricatum which was discovered in the Za- karpatska Region (W Ukraine) as a new plant for the Ukrai- nian flora in June 2016. Keywords: divaricatum; flora; galium; region; species; ukraine
• Resurrection of the regionally extinct taxon in Croatia – the case of Ammophila arenaria (L.) Link (Poaceae) by Bogdanovic, Sandro; Segota, Vedran; Alegro, Antun (2018) - 1 1 Melica ciliata L. . Scirpus holoschoenus L. . Keywords: ammophila; arenaria; arundinacea; flora; link; subsp
• Glaux maritima L. (Primulaceae), a new plant species in SE Europe by Alegro, Antun; Segota, Vedran; Koletic, Nikola; Vukovic, Nina; Vilovic, Tihana; Rimac, Anja (2019) - This is the first record of G. maritima in SE Europe, and the third record in the Mediterranean, apart from in Spain and the Asian part of Turkey. In Europe, G. maritima is distributed on the Atlantic, Baltic and Arctic coasts, and very locally in the Western Mediterrane- an. Keywords: flora; glaux; maritima; population; river; species
• Poa jubata (Poaceae), a rare Balkan species, first record for the Italian flora by Brullo, Salvatore; Brullo, Cristian; Cambria, Salvatore; Giusso del Galdo, Gianpietro; Minissale, Pietro; Salmeri, Cristina; Beccarisi, Leonardo; Veronico, Giuseppe; Tomaselli, Valeria (2019) - 78 (2), 2019 153 As far as karyology is concerned, Poa jubata shows a dip- loid chromosome complement with 2n = 14, not common among Poa species, which are usually high and variably poly- ploid (Joshi et al. 2017). Habitat and ecology – In Apulia Poa jubata is very rare and occurs in temporary ponds, within cork oak woodlands on silty-sandy soils at an altitude of 50 m (Fig. 3). Keywords: flora; glume; jubata; lemma; length; ovate; poa; poa jubata; species
• An analysis of research into urban flora and vegetation in Southeast Europe by Jovanović, Slobodan; Glišić, Milan (2021) - A search of these databases was conducted using the following keywords: urban flora, urban vegetation, urban plants, urban plant species, urban plant communities, urban forests, ruderal flora, ruderal vegetation, wall flora and wall vegetation, in combination with names of the coun- tries (Albania, Bosnia and Herzegovina, Bulgaria, Croatia, Greece, Montenegro, North Macedonia, Romania, Slovenia, Serbia and Kosovo) and cities (at least 15 cities with the larg- est population of each country) of Southeast Europe. 80 (1), 74–81, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2021-004 ISSN 0365-0588 eISSN 1847-8476 An analysis of research into urban flora and vegetation in Southeast Europe Slobodan Jovanović1*, Milan Glišić1,2 1 University of Belgrade, Faculty of Biology, Institute of Botany and Botanical Garden, Belgrade 11000, Serbia 2 Academy of Applied Studies Šabac, Šabac 15000, Serbia Abstract – In the last two decades, the number of research articles focused on urban ecosystems in Europe has in- creased significantly. Keywords: articles; cities; et al; europe; flora; research; southeast; species; studies; urban; vegetation
• Ornithogalum sibthorpii Greuter (Asparagaceae), a species overlooked in Croatia by Rat, Milica; Bogdanović, Sandro (2021) - Comparative morpho-anatomical and cytotaxonomical studies of Ornithogalum species that belong to the group of small plants (overall length up to 10 cm) with hypogeal scape, including O. sibthorpii, have been done to clearly de- scribe morphologically similar species in the area of Turkey and the Balkan Peninsula (Zahariadi 1962, 1965, 1977, Spe- ta 1990, 2000). The first report confirmed that O. sibthorpii is widespread along the eastern Adriatic coast, reaching the inland Dinaric region too. Keywords: chromosome; croatia; distribution; fig; flora; herbarium; ornithogalum; rat; sibthorpii; smith; species
• Carex phyllostachys (Cyperaceae), a new species in Croatia by Terlević, Ana; Koopman, Jacob; Więcław , Helena; Rešetnik, Ivana; Bogdanović, Sandro (2021) - The habitat and ecology of C. phyllostachys in the Croatian flora is presented, and morphological similarities with allied species (C. distachya and C. illegitima) are discussed. The Global Carex Group (2016) shows that C. phyllostachys is closely related to C. il- * Keywords: carex; croatia; flora; koopman; mosor; phyllostachys; s.n; species
• First record of a naturalized population of the tropical Colocasia esculenta (Araceae) in Italy, and clarifications about its occurrence in southeastern Europe by Iamonico, Duilio (2021) - Acknowledgements Thanks are due to G. Bacchetta and L. Podda (Univer- sity of Cagliari, Sardinia region, Italy), L. Bernardo (Uni- versity of Cosenza, Calabria region, Italy), S. Bogdanović (University of Zagreb, Croatia), I. Camarda (University of Sassari, Sardinia region, Italy), G. Domina (University of Palermo, Sicily region, Italy), N. Kuzmanović (University of Belgrad, Serbia), S. Malso (Gislaved, Sweden), V. Matevsky (Ss. 18. 1832 ≡ Arum esculentum L., Sp. Keywords: alien; colocasia; esculenta; europe; flora; iamonico; italy; population; schott; species; university
• Bromus diandrus (Poaceae), an addition to the Bulgarian flora by Kunev, Georgi Iliev (2021) - Retrieved November 21, 2020 from https://www.gbif.org/species/2703760 Georgiev, T., 1963: Bromus L. Bromus L. In: Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M., Webb, D.A., (eds.), Flora Europaea, vol. 5, 182–189. Keywords: bromus; diandrus; flora; species
• Toni Nikolić – Flora Croatica: Vaskularna flora Republike Hrvatske, vols. 1-4 (2019-2020) by Škvorc, Željko (2021) - For that reason, there is a need for quality, comprehensive work that will give an over- view and evaluation of vascular plant taxa of this area. In addition, it brings modern scientific knowledge from vari- ous botanical disciplines about vascular plants growing in Croatia. Keywords: book; croatia; flora
• Lepidium oblongum (Brassicaceae) appeared on Hungarian railways: the beginning of a wider European conquest? by Schmidt, Dávid; Mesterházy, Attila; Csiky, János (2022) - Of these, 7 are alien taxa: L. bonariense L., L. densiflorum Schrad., L. neglectum Thell., L. oblongum Small, L. virginicum L. are American adventive, L. sativum is native to Northeast Africa and Asia Minor, while L. africanum is an African flora element (De Carvalho e Vasconcellos et al. 1993, Sîrbu and Oprea 2011, Kaplan et al. 2018). 81 (1), 2022 45 In Hungary, we observed its occurrences within the wid- er environment of railway stations. Keywords: flora; hungary; lepidium; oblongum; railway; shehbaz; small; species; states
• The accelerated spread of a neophyte introduced to Europe long ago - First occurrence of Sporobolus indicus (Poaceae) in Hungary by Bauer, Norbert; Verloove, Filip (2023) - with the exception of S. indicus (L.) R.Br. Although S. indicus is the oldest intro- duced Sporobolus species in Europe, the proliferating num- ber of new observations (Niketić 1998, Glasnović and Jogan 2009, Celesti-Grapow et al. 2010, Lauber et al. 2018, Perić et al. 2013, Eichberger et al. 2015, Pachschwöll et al. 2016, Amarell and Himpel 2020) testifies its accelerating spread. Keywords: et al; europe; flora; france; hungary; indicus; s. indicus; species; sporobolus; spread
• The taxonomy and distribution of algae in the thermal springs of Türkiye by Öztürk, Sevilay; Kurt, Oguz (2024) - However, they can survive in deserts, moist soils and stones, thermal springs, snow at the poles, and in all condi- tions with very little moisture. Thermal springs, in particu- lar, are extreme ecosystems for algae. Keywords: algae; anagnostidis; chemical; flora; komárek; springs; taxa
• Isoëtes gymnocarpa and Utricularia × neglecta – new taxa for Montenegro by Romanov, Roman E.; Dragićević, Snežana; Troia, Angelo (2024) - Assessing the influence of environmental parameters on aquatic plants of ponds in the hinterland of Long Beach in Montenegro. 83 (2), 176-178, 2024 CODEN: ABCRA 25 DOI 10.37427/botcro-2024-011 ISSN 0365-0588 eISSN 1847-8476 Short communication Isoëtes gymnocarpa and Utricularia × neglecta – new taxa for Montenegro Roman E. Romanov1*, Snežana Dragićević2, Angelo Troia3 1 Komarov Botanical Institute of the Russian Academy of Sciences, Professora Popova 2, 197022 St. Petersburg, Russia 2 Montenegrin Academy of Sciences and Arts, Rista Stijovića 5, 81000 Podgorica, Montenegro 3 Dipartimento STEBICEF, Università degli Studi di Palermo, via Archirafi 38, 90123 Palermo, Italy Abstract – One lycophyte genus and species (Isoëtes gymnocarpa), and one aquatic magnoliophyte species (Utricularia × neglecta) new for the flora of Montenegro are reported. Keywords: flora; gymnocarpa; isoëtes; montenegro; species; troia
• Pimpinella tragium Vill. subsp. lithophila (Schischk.) Tutin (Apiaceae), a new taxon in Croatian flora by Bogdanovic, Sandro; Ruscic, Mirko (2011) - titanophila) of this group under the name of P. tragium, while suggesting treating P. tragium subsp. Some authors (TUTIN 1968 a, b; MATTHEWS 1972; ENGSTRAND 1987; BRULLO and BRULLO 2009) distinguish several subspecies within this group: P. tragium subsp. Keywords: flora; island; lithophila; pimpinella; subsp; tragium; tutin
• Rapid spread of the Mediterranean glycophyte Catapodium rigidum in Hungary by Bauer, Norbert; Csiky, János; Mesterházy, Attila; Wolf, Mátyás; Schmidt, Dávid (2025) - https://doi.org/10.1111/jvs.13168 Tutin, T. G., Heywood, V. H., Burges, N. A., Moore, D. M., Val- entine, D. H., Walters, S. M., Webb, D. A. (eds.), 1980: Flora Europaea. https://doi.org/10.1080/15324982.2018.1427640 Tichý, L., Axmanová, I., Dengler, J., Guarino, R., Jansen, F., Mi- dolo, G., Nobis, M. P., van Meerbeek, K., Aćić, S., Attorre, F., Bergmeier, E., Biurrun, I., Bonari, G., Bruelheide, H., Cam- pos, J. A., Čarni, A., Chiarucci, A., Ćuk, M., Ćušterevska, M., Didukh, Y., Dítě, D., Dítě, Z., Dziuba, T., Fanelli, G., Fernán- dez-Pascual, E., Garbolino, E., Gavilán, R. G., Gégout, J.-C., Graf, U., Güler, B., Hájek, M., Hennekens, S. M., Jandt, U., Jašková, A., Jiménez-Alfaro, B., Julve, P., Kambach, S., Karg- er, D. N., Karrer, G., Kavgacı, A., Knollová, I., Kuzemko, A., Küzmič, F., Landucci, F., Lengyel, A., Lenoir, J., Marcenò, C., Keywords: catapodium; flora; hungary; rigidum; road; schmidt; species
• Stachys ocymastrum (Lamiaceae) – a new plant species in Croatia by Purger, Dragica; Purger, Jenő J.; Pandža, Marija; Jasprica, Nenad (2025) - Morales, R., Pardo de Santayana, M., 2010: Stachys L. A new infrageneric classification of Stachys L. Notes from the Royal Botanic Garden, Edinburgh 38, 65–96. Keywords: croatia; flora; island; ocymastrum; stachys
• In memoriam Prof Dr. Ernest Mayer by Zupančić, Mitja; Gogala, Nada (2010) - lithopolitanicum E. Mayer, subsp. Jahrbuch des Vereins zum Schutze der Alpenpflanzen und -Tiere 25, 136–144. MAYER, E., 1963: Pedicularis julica E. Mayer spec. Keywords: ernest; flora; ljubljana; mayer; profile
• Shift of the western boundary of the distribution area of Micromeria cristata (Hampe) Griseb. and Steptorhamphus tuberosus (Jacq.) Grossh. by Petrovic, Danka; Stesevic, Danijela (2011) - In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALEN- TINE, D. H., WALTERS, S. M., WEBB, D. A., (eds.), Flora Europaea 3, 163–167. In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALENTINE, D. H., WALTERS, S. M., WEBB, D. A., (eds.), Flora Europea 3, 167–170. Keywords: cristata; distribution; flora; micromeria; montenegro; rumija; steptorhamphus
• Where does Sedum cepaea L. (Crassulaceae) – one of the rarest species of Croatian flora – really grow? by Sapic, Irena; Segota, Vedran; Alegro, Antun (2012) - On both finding spots (Moslava~ka gora and Zrinska gora, respectively), S. cepaea grows in vegetation belt dominated by sessile oak. On Nikolino brdo S. cepaea was collected three times: by Schlosser in 1871, by Vukotinovi} in 1882 and by Rossi in 1888 (data from ZA). Keywords: brdo; cepaea; croatia; finding; flora; forest; gora; moslava; sedum; species; zrinska
• Ammi visnaga (L.) Lam. (Apiaceae), a new taxon in Croatian flora by Ruscic, Mirko; Nikolic, Toni (2011) - Key words: Ammi visnaga, flora, neophyte, island Bra~, Croatia Introduction The genus Ammi L. (Apiaceae) contains about 25 species. Specimens of the genus Ammi L. were collected, but these plants did not match the description of the already known Ammi majus (DOMAC 1994). Keywords: ammi; bra~; croatian; flora; species; visnaga
• A note on Pteris vittata L. (Pteridaceae) in Montenegro by Gutermann, Walter (2012) - W. Pamplin, London. HOOKER, W. J., BAKER, J. G., 1868: Synopsis filicum, a synopsis of all known ferns. HOOKER, W. J., 1858: Species filicum, being descriptions of the known ferns, 2. Keywords: flora; herbarium; pteris; university; vittata
• The orchid Ophrys speculum Link (Orchidaceae) in Croatia by Vukovic, Nina; Tommasoni, Annalisa; D’Onofrio, Tancredi (2013) - Results Three individuals of Ophrys speculum ssp. Keywords: Ophrys speculum, orchid, Rt Kamenjak, Istria, Croatia Introduction In Croatian flora the genus Ophrys is present with 67 taxa, the largest genus in terms of number of taxa from the Orchidaceae family (HR[AK 2000, BOGDANOVI] 2004, NIKOLI] 2012). Keywords: ciliata; croatia; delforge; flora; ophrys; profile; species; speculum
• Herbaceous periwinkle, Vinca herbacea Waldst. et Kit. 1799 (Apocynaceae), a new species of the Croatian flora by Csiky, János; Purger, Dragica (2013) - Since V. herbacea was included neither in the handbooks for plant identification nor in the current Croatian Flora Database, a new key for the determination of Vinca L. species of Croatia is presented herein. Monitoring of plant species along the Drava river and the Hungarian-Croatian border. Keywords: croatia; flora; herbacea; hungarian; hungary; plants; species; vinca

• Dry grasslands of Hippocrepido glaucae-Stipion austroitalicae in the Pollino Massif (Calabria, Italy) by Terzi, Massimo; D’Amico, Franceso S. (2016) - Snogerup & B. Snogerup (+), Campanula erinus L. (+), Carduus nutans L. subsp. capitatum (+), Teucrium chamaedrys L. (+), Tragopogon porrifolius L. (+), Trifolium campestre Schreber (+), Trifolium scabrum L. subsp. Keywords: austroitalica; biondi; hippocrepido; italy; l. +; mediterranean; south; stipetum; stipion; subsp; terzi; vegetation
• Diversity and gradients of vegetation of Sivrihisar Mountains (Eskisehir-Turkey) by Balpinar, Neslihan; Kavgaci, Ali; Bingol, M. Umit; Ketenoglu, Osman (2018) - Dominant species: Astraga- lus microcephalus Cluster 4: Astragalus angustifolius ssp. pallida, Arabis nova, Astragalus angustifolius ssp. Keywords: akman; anatolia; angustifolius; area; ass; astragalus; communities; community; forest; hoc; ketenoğlu; loco; mountains; sivrihisar; species; ssp; steppe; study; tab; turkey; var; vegetation
• Phytosociology and biodiversity patterns of annual wetland communities of Pyriatynskyi National Nature Park (Poltava Oblast, Ukraine) by Kovalenko, Oleksii; Kalista, Mariia (2019) - Results Annual wetland communities of Pyriatynskyi National Nature Park are presented by 1 order, 4 alliances and 7 as- sociations: The variability of moisture is very important factor for annual wetland communities. Keywords: analysis; associations; communities; cyperetum; isoëto; juncetea; juncetum; nano; species; syntaxa; vegetation; wetland
• Rocky coastal vegetation of the class Crithmo-Staticetea in the south-east of Italy by Tomaselli, Valeria; Terzi, Massimo (2019) - Fanelli et al. 2004, Biondi et al. 2014). Many phyto- sociological surveys have been carried out along the Apulian coast, on both sandy and rocky shores (e.g., Cristofolini et al. 1967, Curti and Lorenzoni 1968, Corbetta 1970, Caniglia et al. 1984, Géhu et al. 1984, Corbetta et al. 1989, Bartolo et al. 1992, Brullo and De Marco 1989, Mariotti et al. 1992, Beccarisi et al. 2003, Biondi et al. 2006, Corbetta et al. 2006, Biondi and Casavecchia 2010, Tomaselli et al. 2011, Pirone 2014, Sciandrello and Tomaselli 2014). Keywords: biondi; brullo; cluster; communities; crithmo; et al; fig; italy; limonietum; limonio; relevés; species; staticetea; tab; vegetation
• Aristida oligantha – a new alien species on the eastern Adriatic coast by Stesevic, Danijela; Milanović , Đorđije ; Stanišić-Vujačić, Milica ; Šilc, Urban (2021) - Keywords: Aristida oligantha community, invasive species, northeastern Mediterranean, sandy beach, south Montenegro Introduction Genus Aristida L. is one of the exotic grasses in the European flora. Within its native area of distribution, which includes North America, Aristida oligantha grows on waste or bare ground, old fields and dry hills (Allred 1986). Keywords: 2019/10/06; aristida; montenegro; oligantha; rel; species; vegetation
• In memoriam Zorana Sedlar (1980-2020) by Alegro, Antun (2021) - 1 Zorana in field research near Barać caves in spring 2020. She was involved in projects related to research into vegetation ecology and the biogeography of flora and vegetation of Croatia. Keywords: research; vegetation
• Syntaxonomical and ecological diversity of the class Polygono-Poetea annuae in Bulgaria by Vassilev, Kiril Veselinov; Nazarov, Momchil; Mardari, Constantin; Grigorov, Borislav; Georgiev, Stoyan; Genova, Beloslava; Velev, Nikolay (2022) - Ac- cording to Čarni and Mucina (1998), the major factors enhancing the variability of trampled vegetation include lo- cal floristic pools (mass effect) and the enrichment of tram- pled habitats by encroaching alien plant species. Field sampling and data analysis In Bulgaria 175 vegetation plots (relevés) presenting trampled vegetation, were sampled during the 2017-2020 period following the Braun-Blanquet approach (Westhoff and van der Maarel 1973). Keywords: agg; annuae; areas; arenastri; association; bulgaria; class; communities; composition; et al; polygonetum; polygonetum arenastri; polygono; species; vegetation
• The Thirty-ninth Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE) was held in Dubrovnik, Croatia (May 4-7, 2022) by Jasprica, Nenad (2022) - 81 (2), 2022 S11 Social news The Thirty-ninth Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE) was held in Dubrovnik, Croatia (May 4-7, 2022) Participants of the 39th Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE), Dubrovnik, Croatia, May 4-7, 2022 during the botanical field excursion on the Pelješac Peninsula (Photo: I. Brautović). Keywords: dubrovnik; meeting; vegetation
• Local-scale changes in plant community composition following succession of oak-hornbeam forest after grassland abandonment by Jelinčić, Antun; Perčin, Aleksandra; Zgorelec, Željka; Papković, Dora (2023) - The approximately estimated age of the stud- ied successional stages following hay-pasture abandonment was as follows: successional grasslands (2–5 years), shrub stages (5–15 years), Populus tremula L. stage (15–30 years), and oak-hornbeam stage (> 30 years). 2. Non-metric multidimensional scaling ordination (NMDS) of successional stages based on community composition differences obtained by Bray-Curtis dissimilarities. Keywords: area; forest; hay; sanguinea; species; stage; study; succession; vegetation
• Post-fire succession of black pine (Pinus nigra) forest vegetation under different fire regimes by Keleş, Emine Seda; Kavgaci, Ali (2025) - Physiognomy of black pine forests before and after fire: a – surface fire, b – post-fire regeneration, c – black pine forest with dense underground layer, d – crown fire, e – black pine forest with Cistus laurifolius, f – crown fire with oak coppice after fire, g – Pteridium aquilinum vegetation after crown fire. Black pine forests are one of the ecosystems that are most affected by changing fire regimes. Keywords: black; crown; et al; fire; forests; mediterranean; nigra; pine; pine forests; pinus; seed; species; subsp; surface; trees; vegetation
• Population structure of woody plants in the arid cloud forests of Dhofar, southern Oman by El-Sheikh, Mohamed abd El-Raouf (2013) - This type of study can provide a basis for the development of a management plan to support the conservation and sustainable use of forest vegetation in an arid region. In cloud forests, for example, cloud condensation in fog-affected escarpment mountain slopes and fog precipitation during the summer season create a niche for moist woodland vegetation within the surrounding desert. Keywords: acacia; bed; cloud; dhofar; distribution; forest; hill; oman; population; profile; size; species; trees; vegetation; wadi
• Vegetation spatial heterogeneity in a hyper arid Biosphere Reserve area in north Africa by Shaltout, Kamal H.; Sheded, Mohamed Gabr; Salem, Ashraf I. (2010) - On the other hand, it is also a diagnostic study to evaluate the recent situation of Wadi Allaqi vegetation in comparison with the previous studies (e.g. SPRINGUEL et al. 1991, ALI et al. 1997). 3. Biological spectrum of Wadi Allaqi vegetation. Keywords: acacia; allaqi; cluster; desert; egypt; si+s; soil; species; tortilis; vegetation; wadi
• Heaths with dwarf ericaceous shrubs and Alpine juniper (Juniperus alpina) in the Dinaric Alps: A nomenclatorial and synsystematic re-appraisal by Surina, Bostjan (2013) - 72 (1), 113–132, 2013 CODEN: ABCRA25 ISSN 0365–0588 eISSN 1847-8476 Heaths with dwarf ericaceous shrubs and Alpine juniper (Juniperus alpina) in the Dinaric Alps: A nomenclatorial and synsystematic re-appraisal BO[TJAN SURINA1, 2,* 1 University of Primorska, Faculty of Mathematics, Natural Sciences and Information Technologies, Glagolja{ka 8, SI-6000 Koper, Slovenia 2 Natural History Museum Rijeka, Lorenzov prolaz 1, 51000 Rijeka, Croatia Abstract – The ecology and phytosociology of north-western Dinaric heaths of the associ- ation Rhododendro hirsuti-Juniperetum alpinae Horvat ex Horvat et al. 1974 nom. in Meier et Br.-Bl. 1934; Berberido creticae-Juniperion foetidissimae Brullo et al. 2001; Keywords: alps; dinaric; et al; hirsuti; horvat; juniperetum; laku{i; nom; profile; stands; surina; u m; vegetation
• Transitions between community complexes: a case study analysing gradients through mountain ridges in South Hungary by Erdos, Laszlo; Zalatnai, Marta; Batori, Zoltan; Kormoczi, Laszlo (2014) - Community Ecology 10, 75–80. VAN DER MAAREL, E., 1976: On the establishment of plant community boundaries. In the profile, vegetation boundaries appear as peaks. Keywords: boundaries; case; community; erdos; msw; peaks; profile; species; vegetation; widths; window
• Floodplain forest communities along the Mura River (NE Slovenia) by Kosir, Petra; Carni, Andraz; Marinsek, Aleksander; Silc, Urban (2013) - Zonation of forest vegetation can also be evidenced in a response curve of the main edifiers of plant communities (Fig. 7a) on the gradient of DCS. Response curve of main edifiers of plant communities in the gradient of DMS on the other hand proved the already established fact that DMS is not an underlying gradient for the zonation of forest vegetation. Keywords: floodplain; forests; kosir; mura; profile; river; species; stream; vegetation
• Stipetum novakii ass. nova – a new association of serpentine rocky grassland vegetation (Halacsyetalia sendtneri) in Serbia by Kabas, Eva; Alegro, Antun; Kuzmanovic, Nevena; Jakovljevic, Ksenija; Vukojicic, Snezana; Lakusic, Dmitar (2013) - However, such a situation enables the development of a certain number of endemic serpentine species such as Stipa novakii, Halacsya sendtneri (Boiss.) Abstract – Phytosociological characteristics of grassland communities above serpentines (order Halacsyetalia sendtneri H. Ritter-Studni~ka 1970) in Serbia, are analyzed accord- ing to Braun-Blanquet methodology. Keywords: a.s.l; communities; community; kabas; kabas et; novakii; profile; serbia; serpentine; species; vegetation
• Succession rates and patterns twelve years after land use abandonment in the estuary of river Aliakmon, N. Greece by Xystrakis, Fotios; Theodoropoulos, Kostantinos; Eleftheriadou, Eleni; Samaras, Dimitrios A.; Damianidis, Christos; Papadopoulos, Theodoros (2014) - The land-use abandonment in an area in the estuary of the River Aliakmon, N. Greece, provides an opportunity to study medium-term rates and patterns during the first twelve years of vegetation succession. In such special environments, the distinct abiotic conditions control the patterns of vegetation succession (ANDERSON 2007). Keywords: changes; group; plots; profile; rates; species; succession; taxa; values; vegetation; xystrakis; xystrakis et; years

• Similar small-scale variation of diatom assemblages on different substrates in a mesotrophic stream by Kahlert, Maria; Savatijevic Rasic, Ivana (2015) - Spatial scale variation The impact of the fi xed factor substrate and the random factors dm- and cm- scale on the variation of the diatom indices was assessed by calculating coeffi cients of variance (CV%) for each sampled scale (cm-scale n = 5, dm-scale n = 5) for the diatom indices and for the number of taxa and the diversity of both substrates. Differences in diatom assemblages scraped from plants (submerged macrophytes and mosses) with replicates at different spatial scales. Keywords: assemblages; diatom; plants; sampling; scale; stones; stream; substrates; taxa; variation
• Selenium uptake and Se compounds in Se-treated buckwheat by Golob, Aleksandra; Germ, Mateja; Kreft, Ivan; Zelnik, Igor; Kristan, Urška; Stibilj, Vekoslava (2016) - For each taxon and treatment one sample of plants (10–15 plants) was taken for determi- nation of Se content and Se speciation. We weighed 0.2 g of a lyophilized sample into a Tefl on tube and Se content was determined in three aliquots. Keywords: activity; buckwheat; content; et al; germ; hybrid; kreft; plants; seeds; selenium; tartary
• Phytolacca acinosa Roxb. (Phytolaccaceae), a new alien species in the Croatian flora by Borak Martan, Valentina; Sostaric, Renata (2016) - As the taxonomical status of the species Ph. acinosa and Ph. esculenta is still a matter of discussion (Webb and Akeroyd 1964, Clement 1982, Tab. 1), we consider both opinions in the analysis of specimens found in Varaždin. Something similar was noticed in Belgium where collections of the Ph. acinosa group are usually more or less intermediate between Ph. acinosa and Ph. esculenta: infl orescence axes are often scabrid-glandu- lar (as in Ph. acinosa) Keywords: acinosa; alien; croatia; esculenta; phytolacca; plants; species
• In vitro multiplication, micromorphological studies and ex vitro rooting of Hybanthus enneaspermus (L.) F. Muell. – a rare medicinal plant by Shekhawat, Mahipal S; M., Manokari (2018) - Micromorphological studies of Hybanthus enneaspermus: venation pattern in leaves of in vitro shoots (A); and field plant (B); stomatal pattern in leaves of in vitro shoots (C), and field plant (D); and trichomes in leaves of in vitro shoots (E), and field plant (F). Subramoniam, A., Madhavachandran, V., Gangaprasad, V., 2013: Medicinal plants in the treatment of arthritis. Keywords: enneaspermus; et al; field; hybanthus; medium; plantlets; plants; rooting; shoots
• Effects of carrageenan as elicitor to stimulate defense responses of basil against Cuscuta campestris Yunck by Mousavi, Effat Ahmadi; Kalantari, Khosrow Manochehri; Nasibi, Fatemeh; Oloumi, Hakimeh (2018) - Because carrageenans are non-toxic biodegradable, non-polluting and non-hazard- ous to humans, animals and birds, they can be recommended as natural biostimulators for the protection of plants against parasitic C. campestris plants. Infestation percentage of C. campestris For analysis of defense against C. campestris invasion and measuring of infestation of basil plants by C. campestris, the percentage of C. campestris tight coupling (its haustorium penetration) to basil shoot was determined 14 days after the infection. Keywords: activity; basil; basil plants; campestris; carrageenan; content; control; cuscuta; defense; et al; growth; host; plants
• Bryophytes and heavy metals: a review by Stankovic, Jelena D.; Sabovljevic, Aneta D.; Sabovljevic, Marko S. (2018) - Although men have used heavy metals for thousands of years (Järup 2003), reckless human behaviour, associated with urbaniza- tion and industrial development, drastically altered the pre- vious distribution and geochemical cycles of heavy metal (Singh et al. 2011). 77 (2), 109–118, 2018 CODEN: ABCRA 25 DOI: 10.2478/botcro-2018-0014 ISSN 0365-0588 eISSN 1847-8476 Review Bryophytes and heavy metals: a review Jelena D. Stanković, Aneta D. Sabovljević, Marko S. Sabovljević* Institute of Botany and Botanical Garden, Faculty of Biology, University of Belgrade, Takovska 43, 11000 Belgrade, Serbia Abstract – Bryophytes, a group of terrestrial plants widely used in biomonitoring, are reviewed for their relation to heavy metals. Keywords: bryophytes; cell; concentrations; effects; environment; et al; metals; moss; plants; pollution; species; uptake
• Evaluation of trace elements and particulate matter deposition on plant foliage exposed to vehicular pollution by Tak, Aasawari A.; Kakde, Umesh B (2019) - Thousands of vehicles such as cars, bikes, trucks, and tractors continuously pass through this area, which is a source of high level of heavy metals pollution. Heavy metal pollution is a significant environmental issue as these metals are like- ly to have toxic effects with increased concentration or ac- cumulation in plants. Keywords: accumulation; air; dust; ficus; kg–1; metals; plants; pollution
• Analysis of Hypericum accessions by DNA fingerprinting and flow cytometry by Butiuc Keul, Anca; Coste, Ana; Budahn, Holger; Dunemann, Frank; Farkas, Anca; Postolache, Dragos; Klocke, Evelyn (2022) - Chromosome number in root tips of different Hypericum accessions (Hp - H. perforatum, Hu – H. umbellatum, Hm – H. maculatum, Hh – H. hircinum). Additionally, a combined marker analysis, based on inter-simple se- quence repeats (ISSR) and sequence related amplified polymorphism (SRAP), was conducted to gain a better under- standing of diversity especially within the accessions of H. perforatum. Keywords: accessions; analysis; botanical; content; dna; garden; hypericum; issr; maculatum; perforatum; plants; size; species; srap
• Detrimental effect of quercetin on phytoplasma-infected Catharanthus roseus (L.) G. Don shoots grown in vitro by Ćurković-Perica, Mirna; Ježić, Marin (2010) - Twenty-four infected C. roseus shoots per treatment, positive control (untreated infected shoots on the medium with BA), non-infected treated shoots, and negative control (non-infected shoots 156 ACTA BOT. However, stunting was even more pronounced in quercetin-treated than in non-treated infected plants, moreover leaf browning and appearance of black spots on the leaf edges appeared on quercetin treated plants. Keywords: effect; medium; pcr; phytoplasma; plants; quercetin; shoots
• Lehrbuch der Botanik Textbook of Botany, Founded by E. Strasburger, F. Noll, H. Schenck and A. F. W. Schimper. 36th edition, revised by A. Bresinsky, C. Korner, J. W. Kadereit, G. Neuhaus and U. Sonnewald by Devide, Zvonimir (2010) - [5] In this section all as- pects of plant metabolism are presented and explained: energetics of metabolism, economy of minerals and water, photosynthesis (light reactions and the path of carbon, the assimila- 150 ACTA BOT. In the second part of the book, the main aspects of plant physiology are presented: me- tabolism, growth and development, movements and allelophysiology. Keywords: book; botany; edition; plants; strasburger; textbook
• Aluminum accumulation and tolerance in four Amaranthus species by Nazari, Fatemeh; Hajiboland, Roghieh; Salehi-Lisar, Seyed-Yahya; Kahneh, Ehsan; Moradi, Aioub; Poschenrieder, Charlotte (2023) - Low and high Al treatment levels were applied in both short- and long-term experiments with a special emphasis on the root growth and morphology pa- rameters as indicators of plant Al response. Al accumulator species have primarily been found in the acidic soils of the humid tropics, which are covered by savannahs and tropical rain forests. Keywords: accumulation; amaranthus; biomass; concentrations; cruentus; et al; fig; growth; length; plants; retroflexus; root; species; tricolor
• Comparative effects of 4-Cl-IAA and kinetin on photosynthesis, nitrogen metabolism and yield of black cumin (Nigella sativa L.) by Shah, Shoukat Hussain (2011) - Biochemistry and physiology of plants hormones. Control plants were sprayed with double distilled water only. Keywords: 10–6; activity; control; iaa; kinetin; physiology; plants; treatment
• New hosts and diagnostic characteristics of Orobanche crenata (Orobanchaceae) in Egypt by Mohamed, Ibrahim Abd el-wahab; Hassan, Mona; Aboulela, Mostafa (2024) - In this regard and to help to identify O. crenata plants accurately, we record information on its parasitism on seven new host plant species (Ammi majus, Arctotis fastuosa, Callistephus chinensis, Carthamus tinctorius, Lactuca serriola, Melilotus indicus, and Tropaeolum majus L.), and provide a full description of morphological characteristics diagnostic to the species, supported by vouchers and images for verification. Results of our study on the vegetative and reproductive parts of O. crenata plants infecting the seven plant species were, in general, consistent with previ- ous reports. Keywords: broomrape; corolla; crenata; et al; fig; majus; o. crenata; orobanche; plants; species
• First record of the woody Melaleuca williamsii s.l. (Myrtaceae) out of its native range by Iamonico, Duilio; Nicolella, Gianluca (2024) - Wilson, P. G., O’Brien, M. M., Heslewood, M. M., Quinn, C. J., 2005: Relationships within Myrtaceae sensu lato based on a matK phylogeny. https://doi.org/10.7320/FlMedit28.145 Gallardo, B., Bacher, S., Bradley, B., Comín, F. A., Gallien, L., Je- schke, J. M., Sorte, C. J. B., Vilà, M., 2019: InvasiBES: under- standing and managing the impacts of Invasive alien species on biodiversity and ecosystem services. Keywords: craven; melaleuca; plants; species; williamsii
• Construction of the Arabidopsis isogenic lines containing dually localized protein TROL only in the inner chloroplast envelope membrane by Vojta, Lea; Fulgosi, Hrvoje; Tomašić Paić, Ana; Dumančić, Ena (2025) - Arabidopsis thaliana (L.) ecotype Columbia (Col-0) plants, or wild-type (WT); TROL knock-out plants (KO), that do not accumulate protein TROL due to the T-DNA insertion into the gene At4g01050 (SAIL_27_B04, obtained from NASC) The phenotype of Arabidopsis plants that contain protein TROL only in the inner envelope membrane of chloroplasts (TROL-IE plants). Keywords: anti; arabidopsis; chloroplast; envelope; fig; lines; membrane; plants; pretrol; protein; thylakoid; trol; vojta
• Micropropagation and optimisation of in vitro production of the rare and threatened moss Entosthodon pulchellus (Funariaceae) by Ćosić, Marija V.; Božović, Djordje P.; Ignatov, Michael S.; Ignatova, Elena A.; Vujičić, Milorad M.; Sabovljević, Aneta D.; Sabovljević, Marko S. (2025) - https://doi.org/10.1111/j.1095-8339.1990.tb00899.x Ćosić, M. V., Sabovljević, M. S., Papp, B., Giba, Z. S., Šinžar- Sekulić, J. B., Sabovljević, A. D., Vujičić, M. M., 2022: Micro- propagation of rare bryo-halophyte Hennediella heimii. Retrieved May 18, 2024 from https://www.iucnredlist.org/spe- cies/85841585/87794990 Jadranin, B. Z., Ćosić, M. V., Božović, Đ. P., Vujičić, M. M., Igna- tov, M. S., Ignatova, E. A., Sabovljević, A. D., Sabovljević, M. S., 2023: Keywords: bap; development; fig; growth; knop; media; medium; plants; pulchellus; sabovljević; species
• Impact of riparian trees shade on aquatic plant abundance in conservation islands by Ali, Magdi M.; Hassan, Samar A.; Shaheen, Abdel-Samei M. (2011) - ALI, M. M., MAGEED, A. A., Heikal, M., 2007: Importance of aquatic macrophyte for inver- tebrate diversity in large subtropical reservoir. In the present study, riparian Acacia nilotica trees provided natural shading limiting the growth of submerged aquatic plants, otherwise difficult to manage. Keywords: demersum; islands; light; macrophytes; management; plants; riparian; shaded; sites; trees; water; zones
• Natural occurrence of Cucumber mosaic virus infecting water mint (Mentha aquatica) in Antalya and Konya, Turkey by Sevik, Mehmet Ali (2012) - o ujak 2012 14:49:12 Color profile: Disabled Composite 150 lpi at 45 degrees CLARK, M. R., ADAMS, A. M., 1977: Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. Acta Horticulture 234, 371–378. YILMAZ, M. A., BALOGLU, S., ÖZASLAN, M., GÜLDÜR, M. E., 1995: Plant viruses detected in horticultural crops in the GAP region (in Turish). Keywords: cmv; cucumber; mint; mosaic; plants; virus
• New localities of the subendemic species Berberis croatica, Teucrium arduini and Micromeria croatica in the Dinaric Alps by Kremer, Dario; Randic, Marko; Kosalec, Ivan; Brkljacic, Ana; Lukac, Gordan; Krusic, Irena; Ballian, Dalibor; Bogunic, Faruk; Karlovic, Ksenija (2011) - Based on altitude (840 m a.s.l.) and habitat conditions, this population of Berberis L. connects the B. croatica population on Vi{evica with B. vulgaris population in Li~ko polje. Berberis L. Keywords: a.s.l; arduini; berberis; croatica; habitat; micromeria; plants; rocks; species; teucrium
• Host range and host choice of Cuscuta species in Hungary by Barath, Kornel; Csiky, Janos (2012) - BABINGTON, C. C., 1843: Note on a supposed New British Cuscuta. In the cases of C. epithymum and C. campestris they found that the number of host species was positively correlated with the size of the parasites. Keywords: baráth; cuscuta; dodders; epithymum; europaea; host; host species; hungarian; plants; species
• Comparative study of in vitro, ex vitro and in vivo grown plants of Arnica montana - polyphenols and free radical scavenging activity by Nikolova, Milena; Petrova, Mariya; Zayova, Ely; Vitkova, Antonina; Evstatieva, Ljuba (2013) - Plant extracts were diluted to a concentration of 1 mg mL–1, and aliquots of 0.5 mL were mixed with 2.5 mL of Folin–Ciocalteu reagent (previously diluted 10-fold with distilled wa- ter) and 2 mL of Na2CO3 (6%). The amount of flavonoids in plant extracts in rutin equivalents (RE) was calculated by the following formula: C = Absample × mcontrol × 10 / Abcontrol Keywords: activity; antioxidant; content; extracts; flavonoids; montana; nikolova; plants; samples; vivo
• Changes of photosynthesis and carbon metabolism in Typha angustifolia L grown in conditions of nitrate nitrogen overload by Chikov, Vladimir I; Isaeva, Elvira V; Ratushnyak, Anna A; Tarasov, Oleg Yu; Trushin, Maxim V (2012) - 71 (2), 2012 CHIKOV V. I., ISAEVA E. V., RATUSHNYAK A. A., TARASOV O. Y., ABRAMOVA K. I., TRUSHIN M. V. phyte was presented as g of dried substance per 1 m2. 71 (2), 2012 CHIKOV V. I., ISAEVA E. V., RATUSHNYAK A. A., TARASOV O. Y., ABRAMOVA K. I., TRUSHIN M. V. Fig. Keywords: angustifolia; nitrate; nitrogen; plants; ratushnyak
• Proline enhances antioxidative enzyme activity, photosynthesis and yield of Cicer arietinum L. exposed to cadmium stress by Hayat, Shamsul; Hayat, Qaiser; Alyemeni, Mohammed Naseer; Ahmad, Aquil (2013) - The foliar treatment of proline resulted in the alleviation of the adverse effects generated by metal exposure, which was expressed in terms of the increase in plant growth. All the parameters studied followed a similar trend at both the sampling stages; however, the magnitude of the data for these parameters was higher at 90 DAS, and therefore, the data obtained at this stage of plant growth are presented in the present study. Keywords: cadmium; control; hayat; plants; proline; soil
• Growth and photosynthesis of Lemna minor L. exposed to different light conditions and sucrose supplies by Vidakovic-Cifrek, Željka; Soric, Sonja; Babic, Marija (2013) - The influence of light spectral distribution and intensity on plant growth rate and photosynthesis was proved a long time ago. Plant growth is dependent not only on the composition of nutrient media but also on chamber conditions – tempera- ture, photoperiod and light quality. Keywords: duckweed; g l–1; growth; lemna; light; l–1; mmol; plants; sucrose
• Antioxydant response to biotic and abiotic inducers for the resistance against Fusarium wilt disease in eggplant (Solanum melongena L.) by Altinok, Hacer Handan; Dikilitas, Murat (2014) - H2O2 from a potential oxidative cross-linking of the cell wall at the plant cell surface has been previously reported to be a characteristic response of plant cells to microbial elicitors or challenge with an avirulent pathogen (GRANT and LOAKE 2000). The current study with FOM on Fomg-inoculated plants also showed that the activation of plant resistance might possibly activate the genes that might in turn provide valuable in- formation concerning fungal resistance mechanisms by using nonpathogenic Fusarium oxysporum formae speciales on eggplant. Keywords: accumulation; altinok; asm; disease; eggplant; fom; fomg; fusarium; h2o2; pathogen; plants; profile; resistance
• PCR detection assay for sex determination in papaya using SCAR marker by Chaturvedi, Kanupriya; Bommisetty, Padmakar; Pattanaik, Arpita; Chinnaiyan, Vasugi; Ramachandra, Dinesh Makki; Chennareddy, Aswath (2014) - In the present study the W11 SCAR marker validated in the cultivars of Carica papaya and Visconcella caulifl ora, am- plifi ed a discriminating band in hermaphrodites and male papaya plants, but not in females, (Figs. 1 a, b). Traditionally, the propagation of papaya plants is through seeds, which would give rise to a population of generally 1:3 for male to female. Keywords: female; hermaphrodite; male; papaya; plants; sex
• Responses of wheat (Triticum aestivum L.) and maize (Zea mays L.) plants to cadmium toxicity in relation to magnesium nutrition by Nikolic, Nataša; Borisev, Milan; Pajevic, Slobodanka; Zupunski, Milan; Topic, Mirjana; Arsenov, Danijela (2014) - Control Cd Cd–Mg T. aestivum Chlorophyll a (mg g-1 DW) 13.83 ± 0.77 a 7.76 ± 0.80 b (56) 7.32 ± 0.03 b (53) Chlorophyll b (mg g-1 DW) 3.80 ± 0.17 a 2.87 ± 0.34 ab (76) 2.26 ± 0.08 b (59) Carotenoids (mg g-1 DW) 3.82 ± 0.18 a 2.43 ± 0.26 b (64) 2.30 ± 0.02 b (60) Negative effect of Cd on photosynthetic activity was more pronounced in T. aestivum than in Z. mays plants. Keywords: activity; aestivum; cadmium; concentration; leaves; mays; plants; roots; z. mays

• Influence of environmental and spatial variables on the distribution of surface sediment diatoms in an upland loch, Scotland by Yang, Hong; Flower, Roger J.; Battarbee, Richard W. (2009) - Spatial variables [(principal coordinates of neighbour matrices (PCNM 1 and PCNM3) positively correlated with redundancy analysis axis 2], indicated that spatial variables, ignored in former studies, are a further influence on diatom distribution. Spatial distribution of surface sediment diatom concentrations (103 valves DW mg–1) in the Round Loch of Glenhead in April 2007. Keywords: analysis; diatom; distribution; environmental; lake; loch; sediment; species; surface; variables; variation; water
• The first report on periphytic diatoms on artificial and natural substrate in the karstic spring Bunica, Bosnia and Herzegovina by Dedic, Anita; Plenkovic-Moraj, Andjelka; Kralj Borojevic, Koraljka; Hafner, Dubravka (2015) - Discussion This paper presents research of periphytic diatoms sampled from natural substrate and artifi cial substrate in Bunica Spring. Use of artifi cial substrates (glass slides) for quantifi cation of periphyton was recom- mended by WAHL and MARK (1999), ALBAY and AKCAALAN (2003), LIBORIUSSEN (2005) who consider them more favorable for experimental growth than natural substrates. Keywords: artifi; bertalot; bunica; cial; diatoms; ehrenberg; kützing; spring; substrate; taxa; water
• Periphytic diatom community in a Mediterranean salt wedge estuary: the Ebro Estuary (NE Iberian Peninsula) by Rovira, Laia Torres; Trobajo, Rosa Pujadas; Ibanez, Carles Marta (2009) - Several investigations had used artifi- cial substrata to study periphytic diatom communities in estuaries and other transitional systems (MCINTIRE and OVERTON 1971; MCINTIRE 1973, 1978; MOORE and MCINTIRE 1977; LAI 2001; TROBAJO et al. 2004; NAYAR et al. 2005). LAI, S. D., 2001: An ecological study of brackish water diatom community in wetlands, near the Tseng-Wen estuary, in southwestern Taiwan. Keywords: community; diatom; ebro; estuary; fig; october; river; salt; water; wedge
• The diatom Chaetoceros in ships ballast waters survivorship of stowaways by Klein, Georgia; Kaczmarska, Irena; Ehrman, James M. (2009) - Our findings contribute to the assessment of the ef- fectiveness of ballast water treatment via water exchange, and serve to evaluate the diver- sity of diatom vegetative cells and spores transported in ballast water tanks. We found ballast water cell densities comparable to that found in one sample from the receiving port of Vancouver, where a bloom of one Chaetoceros species produced 2.7 x 103 viable cells L–1 and 87 spores L–1. Keywords: ballast; cells; chaetoceros; diatom; hargraves; resting; samples; species; spores; water
• Epilithic diatom assemblages and environmental quality of the Su Gologone karst spring (centraleastern Sardinia, Italy) by Lai, Giuseppina Grazia; Padedda, Bachisio Mario; Wetzel, Carlos Eduardo; Lugliè, Antonella; Sechi, Nicola; Ector, Luc (2016) - The diatom fl ora of karst springs, for example, has been ex- plored only occasionally (Dell’Uomo 1990), despite these aquatic ecosystems are particularly important for the Medi- terranean area (Civita 2008). Some studies have emphasized the importance of gaining a greater knowledge and understanding of the biocenoses and ecolo- gical dynamics of karst springs in Sardinia, also considering the signifi cant potential vulnerability of these ecosystems (De Waele and Murgia 2001, De Waele 2003). Keywords: bertalot; cantonati; dell’uomo; diatom; gologone; karst; lange; l–1; meso; navicula; oligo; quality; sardinia; species; spring; taxa; water
• The application of benthic diatoms in water quality assessment (Mlava River, Serbia) by Jakovljevic, Olga; Popovic, Sladana S.; Vidakovic, Danijela P.; Stojanovic, Katarina Z.; Krizmanic, Jelena Z. (2016) - Water quality as- sessment of the DTD hydrosystem by diatom indices. Based on the average values of the pollution sensitivity index (IPS), commission for economical community metric (CEE) and biological diatom index (IBD), the water of the Mlava River belonged to water class I during all three seasons. Keywords: assessment; diatom; index; indices; mlava; quality; river; serbia; status; taxa; values; water
• A comparison of the influences of flotation and wet sieving on certain carbonized legume and cereal remains by Marekovic, Sara; Sostaric, Renata (2016) - Key words: carbonized plant remains, cereals, fl otation, legumes, wet sieving * 75 (1), 2016 145 Wright (2005) concluded that the results of archaeobo- tanical analysis depend on fl otation sample size, how the sample is measured and processed and how well the plant material within the sample withstands the rigors of fl ota- tion. Keywords: lentil; otation; remains; sieving; species; water; wet
• An eco-physiological and biotechnological approach to conservation of the world-wide rare and endangered aquatic liverwort Riella helicophylla (Bory et Mont.) Mont. by Sabovljevic, Marko S.; Segarra-Moragues, Jose Gabriel; Puche, Felisa; Vujicic, Milorad; Cogoni, Annalena; Sabovljevic, Aneta (2016) - Culture media assays Spore germination rate and the effects of different culture media in an axenic culture establishment, as well as propagation proce- dures of R. helicophylla, were tested. Keywords: dormancy; germination; helicophylla; l–1; media; mg l–1; riella; spores; water
• Do benthic diatom assemblages reflect abiotic typology: a case study of Croatian streams and rivers by Kralj Borojevic, Koraljka; Gligora Udovic, Marija; Zutinic, Petar; Varbiro, Gabor; Plenkovic-Moraj, Andjelka (2017) - Analysis of variance revealed statistically signifi - cant differences (p<0.05) among SOM groups concerning ammonia, nitrates and total phosphorus. Grouping of similar sites, although placed into different abiotic types, makes SOM groups with its corresponding representative species an easy tool for water quality assessment and description of reference assemblage. Keywords: analysis; assemblages; bertalot; carbonate; diatom; groups; grunow; kützing; lange; quality; som; species; streams; types; variables; water
• Screening for drought resistance during germination of modern and old Iberian wheat cultivars by Pavia, Ivo; Rocha, Luis; Moutinho-Pereira, Jose; Lima-Brito, Jose; Correia, Carlos (2019) - Germination parameters in wheat cultivars on drought stress. Singh, P., Ibrahim, H.M., Flury, M., Schillinger, W.F., Knappen- berger, T., 2013: Critical water potentials for germination of wheat cultivars in the dryland Northwest USA. Keywords: cultivars; germination; mestiço; water; wheat
• Phenolic profiles of quince (Cydonia oblonga Mill.) leaf extracts obtained by different extraction methods by Persic, Martina; Veberic, Robert; Mikulic-Petkovsek, Maja (2019) - Most of the beneficial properties of quince leaf extracts may be assigned to their high content of phenolic compounds, particularly tannins. Phenolic profiles of quince leaf extracts differed among the extraction solvents and time of extraction. Keywords: dec; decoction; extraction; extracts; leaves; material; phenolic; quince; water
• Alien water lettuce (Pistia stratiotes L.) outcompeted native macrophytes and altered the ecological conditions of a Sava oxbow lake (SE Slovenia) by Jaklic, Martina; Koren, Spela; Jogan, Nejc (2020) - Water temperature was correlated significantly with number of water lettuce plants (rs = 0.583, P < 0.05), fresh (rs = 0.550, P < 0.05) and dry biomass (rs = 0.532, P < 0.05), while no correlation was found between ion concentrations and number of plants, fresh or dry biomass of water let- tuce (P > 0.05). In that period, colonized sections (~94% of the oxbow lake) were completely covered with water lettuce, and the only reservoirs of indige- nous macrophyte species were the non-colonized areas (6%). Keywords: biomass; colonized; lake; lettuce; macrophytes; oxbow; oxbow lake; section; species; stratiotes; water
• Growth inhibition of the toxic cyanobacterium Cylindrospermopsis raciborskii by extremely low-frequency electromagnetic fields by Mohamed, Zakaria; Ali, Fadel; Abdel-Lateef, Medahat; Hosny, Asmaa (2020) - The results revealed that the highest growth inhibition of Cylindrospermopsis occurred upon exposure to 0.7 Hz QAMW for 30 min. ELF-EMF-exposed cultures exhibited a marked decrease in cell number, chlorophyll-a content and activity of antioxidant enzymes compared to control cultures, and this effect increased with the prolongation of exposure time. Subsamples of treat- ed and control cultures were collected after 4, 24 and 48 h for antioxidant enzyme activities and after 24 and 48 h for analysis of cell number and chlorophyll-a. Keywords: cell; control; cultures; electromagnetic; elf; et al; exposure; frequency; growth; incubation; raciborskii; water
• Biodiversity and seasonal distribution of benthic diatom assemblages as an indicator of water quality of small karstic river in Bosnia and Herzegovina by Dedić, Anita ; Hafner , Dubravka; Antunović , Ana; Kamberović , Jasmina ; Stanić-Koštroman, Svjetlana ; Kelly, Martyn G. (2021) - The concentrations of physical and chemical parameters should mean that the Bunica River can support high ecological status (Tab. 5), so the reason for this mismatch needs to be explored. Physical and chemical analyses showed low concentrations of nutrients, good oxygenation, typical pH for carbonate bed/origin and generally oligotrophic conditions and high ecological status. Keywords: bertalot; bunica; diatom; ehrenberg; gomphonema; grunow; index; indices; kützing; lange; river; samples; spring; status; taxa; values; water
• Phytoplankton metrics for trophic and ecological status assessment of a natural karstic lake by Šimunović, Maja; Kulaš, Antonija; Žutinić, Petar; Goreta, Gordana; Gligora Udovič, Marija (2022) - Lake ecological status based on HLPI index and nitrate concentration However, in 2019 the Croatian water man- agement agency and partners decided to classify the eco- logical quality of natural lakes using the Hungarian classi- fication method for lake phytoplankton assessment, which was intercalibrated for the lakes within the EC-GIG (Borics et al. 2018), with some adaptations from the MED-GIG (de Hoyos et al. 2014). Keywords: april; assessment; biomass; chl; depth; group; june; lake; lake visovac; phytoplankton; samples; september; status; trophic; visovac; water
• Ecological assessment of wetland ecosystems of northern Kazakhstan on the basis of hydrochemistry and algal biodiversity by Barinova, Sophia S.; Nevo, Eibi; Bragina, Tatiana M. (2011) - acuminatum 11, 20 P-B – st es b i alf k 97 Gomphonema acuminatum var. 34 P-B – st es b i alf k 150 Tryblionella gracilis W. Sm. 5, 17, 20, 23, 29 B – – – – – – k 151 Tryblionella hungarica (Grun.) Keywords: alf; alf k; b temp; barinova; bot; croat; diversity; ehrb; ind; kazakhstan; kütz; lakes; salinity; species; str; water
• Epiphytic metazoans on emergent macrophytes in oxbow lakes of the Krapina River, Croatia: differences related to plant species and limnological conditions by Spoljar, Marija; Fressl, Jelena; Drazina, Tvrtko; Meseljevic, Matija; Grcic, Zlatko (2012) - Results of correlations suggested decreasing AFDMe amount at higher epiphytic metazoan density and diversity, especially caused by higher rotifers density. Algal biomass (Chl a) did not oscillate significantly in macrophyte epiphyton during the investigated period (Fig. 3b). Keywords: density; diversity; epiphyton; et al; iris; lakes; macrophytes; metazoans; poljar; shallow; species; water
• Oligotrophy: the forgotten end of an ecological spectrum by Kociolek, John P.; Stoermer, Eugene F. (2009) - A coded checklist and ecological indi- cator values of freshwater diatoms from the Netherlands. 68 (2), 2009 467 OLIGOTROPHY: THE FORGOTTEN END OF AN ECOLOGICAL SPECTRUM U:\ACTA BOTANICA\Acta-Botan 2-09\Kociolek.vp 6. listopad 2009 13:47:59 Color profile: Disabled Composite 150 lpi at 45 degrees A further innovation of LANGE-BERTALOT (1996) as applied to diatoms was the creation of a »red list« of diatom species that are rare and indicative of clean (oligotrophic) condi- tions. Keywords: diatoms; freshwater; oligotrophy; species; systems; water

• Distribution and morphological variations of invasive macrophytes Elodea nuttallii (Planch.) H. St. John and Elodea canadensis Michx in Croatia by Kocic, Aleksandra; Horvatic, Janja; Jelaska, Sven D (2014) - E. canadensis E. nuttallii Statistics Leaf width at the mid-point (mm) 2.05±0.22 (1.83–2.38) 1.14±0.27 (0.63–1.64) t = 6.602 P < 0.001 Leaf length (mm) 7.22±1.38 (5.64–9.61) 10.45±2.11 (7.62–14.01) t = –4.449 P < 0.001 Width/length ratio 0.29±0.06 (0.24–0.40) 0.11±0.03 (0.09–0.17) t = 7.039 P < 0.001 Leaf width 0.5 mm below the tip (mm) 1.22±0.17 (1.03–1.51) 0.50±0.09 (0.33–0.72) t = 8.152 P < 0.001 Angle at the leaf apex (°) 54.34±3.49 (50.89–60.35) 28.31±3.55 (19.92–33.97) t = 10.814 P < 0.001 Internode length (mm) 58.65±8.11 (38.35–81.78) 52.64±18.64 (29.52–87.43) t = 0.405 P = 0.692 After its estab- lishment, E. nuttallii begins to spread to the eastern and northern part of the drainage chan- nel network from 2006–2009. Keywords: canadensis; croatia; elodea; leaf; leaves; length; nuttallii; species
• Echinochloa colona (L.) Link (Poaceae), a new species in the flora of Croatia by Hrusevar, Dario; Mitic, Bozena; Sandev, Dubravka; Alegro, Antun (2015) - Determination key for Echinochloa species in Croatia 1. Taxonomy and distribution of Echinochloa species with special ref- erence of their occurrence as weeds of rice. Keywords: colona; croatia; echinochloa; medvednica; species; zagreb
• Re-evaluation of the Panicum capillare complex (Poaceae) in Croatia by Király, Gergely; Alegro, Antun (2015) - The paper presents a new key for the determination of Croatian species of the com- plex and anticipates the invasion of P. riparium in the sub-Mediterranean regions of the Balkan Peninsula. Her- barium revisions of the P. capillare complex have shown that P. riparium is not a new invader but an overlooked, long-established taxon in central Europe, and, in some parts of the synanthropic European range, is more abundant than P. capillare s. str. Keywords: capillare; complex; croatia; mtb; panicum; riparium; species
• Alive and kicking, or, living on borrowed time? – Microsatellite diversity in natural populations of the endangered Ulmus minor Mill. sensu latissimo from Croatia by Zebec, Marko; Idzojtic, Marilena; Satovic, Zlatko; Poljak, Igor; Liber, Zlatko (2016) - As elm populations in Croatia do not demonstrate a statistically signifi cant deviation from HW equilibrium, it could be claimed that the danger of the appearance of inbreeding within observed populations is relatively small. The aim of this research was to assess the level of ge- netic diversity between and within the fi eld elm populations in Croatia, and thus determine the degree of the negative impact of DED on the biodiversity of the species. Keywords: croatia; diversity; eld; elm; loci; nin; populations; signifi; ulmus; values; zagreb
• Book review: Endemi u Hrvatskoj flori by Toni Nikolic, Milenko Milovic, Sandro Bogdanovic and Nenad Jasprica by Surina, Bostjan (2015) - Nevertheless, according to the given criteria and biogeographic analyses, authors thoroughly and in painstaking detail have described 155 (40%) endemic taxa out of 384 (7.6% of the total fl oristic inventory of the country) occurring in Croatia, while 53 (14%) taxa are mentioned in less detail. The present book has taken a step further, trying to thoroughly present and elucidate the phenomenon of Adriatic endemism on a much larger geographical scale, dealing with taxa of limited distribution ranges occurring also or exclusively in Croatia. Keywords: authors; book; croatia; subsp; taxa
• Contribution to the lichen flora of Risnjak National Park (Croatia) by Ozimec, SiniÅ¡a; BoÅ¡ković, Ivica; Florijančić, Tihomir; Jelkić, Dinko; Opačak, AnÄ‘elko; PuÅ¡kadija, Zlatko; Labak, Irena (2010) - Lichens growth on 16 various substrates, among which the deciduous trees, Acer pseudoplatanus and Fagus sylvatica dominate. The most frequent phorophytes are Acer pseudoplatanus, which supports 36 species, Fagus sylvatica with 26 species, Pru- nus spp. Keywords: abies; acer; ach; area; croatia; fagus; lichen; park; pseudoplatanus; risnjak; species; sylvatica
• Morphological and chemical evidence of Teucrium × rohlenae K. Malý (Lamiaceae), a new hybrid in Croatia by Zbiljić, Miloš; Lakušić, Branislava; Marčetić, Mirjana; Bogdanović, Sandro; Lakušić, Dmitar (2021) - Given that T. reuticum is considered a heterotypic synonym of T. montanum (Eur+Med 2006), T. × bogoutdinove can also be treated as a hybrid between T. montanum and T. polium. All analyses confirm the separation of two species, T. polium and T. montanum, and reveal the intermediate position of the putative hybrid. Keywords: analysis; croatia; hybrid; lakušić; montanum; polium; species; t. polium; teucrium
• Orchid diversity of the cape of Kamenjak (Istria, Croatia) by Vukovic, Nina; Brana, Slavko; Mitic, Bozena (2011) - Relative frequency of orchid species and subspecies on Rt Kamenjak is shown on figure 21, and also in table 2, which shows that they can be grouped, almost equally, into two groups based on their abundance (1) abundant/frequent and (2) rare/extremely rare species. Chorological spectrum of orchid species and subspecies recorded on »Rt Kamenjak«. Fig. Keywords: croatia; fig; kamenjak; ophrys; orchis; perko; serapias; species; ssp; taxa; taxon
• The Croatian National Diatom Collection by Gligora Udovič, Marija; Ljubešić, Zrinka (2021) - Equal interest in the study of diatoms in Croatia has been shown by scientists today, who have recently described a significant number of new species (Gligora et al. 2009, Mejdandžić et al. 2017, 2018, Gligora Udovič et al. 2018, Ca- put Mihalić et al. 2019, Majewska et al. 2019, 2020, Al- Handal et al. 2020, Mucko et al. 2020, Van de Vijver et al. 2020). 2. Croatian National Diatom Collection logo by Nikola Koletić. Keywords: collection; croatia; diatom; new
• In memoriam Jozo Franjić (1966-2021) by Škvorc, Zeljko; Krstonošić, Daniel (2022) - Škvorc Ž., Sever, K., Franjić, J., Krstonošić, D., Poljak, M., 2012: Intenzitet fotosinteze i vegetativni rast hrasta lužnjaka (Quercus robur L.) u pokusnom nasadu. Jasprica, N., Škvorc, Ž., Dolina, K., Ruščić, M., Kovačić, S., Franjić J., 2015: Composition and ecology of the Quercus coc- cifera L. communities along the eastern Adriatic coast (NE Mediterranean). Keywords: croatia; franjić; hrvatskoj; krstonošić; quercus; trinajstić; škvorc; šumarski
• Past, present and future of an alien fungus Clathrus archeri in Croatia by Jelaska, Sven; Levačić, Damjana (2025) - Despite this, data about C. archeri in Croatia in the scientific literature are very scarce. To fill the current gap on the presence and distribu- tion of C. archeri in Croatia, we collected reliable available data on its presence, analysed several environmental factors (climate, soil acidity, topography) on those localities, and developed habitat suitability models using Maxent software. Keywords: archeri; c. archeri; clathrus; croatia; data; fungi; fungus; habitat; models; suitability
• Distribution, ecology and variability of Galanthus reginae-olgae Orph. along the northern limit of its Balkan distribution (Croatia) by Šegota, Vedran; Jovanović , Filip; Ilić, Bariša; Doboš, Marko; Bučar, Marija; Rimac, Anja (2025) - Bartolucci, F., Peruzzi, L., Galasso, G., Albano, A., Alessandrini, A., Ardenghi, N. M. G., Astuti, G., Bacchetta, G., Ballelli, S., Banfi, E., Barberis, G., Bernardo, L., Bouvet, D., Bovio, M., Cecchi, L., Di Pietro, R., Domina, G., Fascetti, S., Fenu, G., Festi, F., Foggi, B., Gallo, L., Gottschlich, G., Gubellini, L., Iamonico, D., Iberite, M., Jiménez-Mejías, P., Lattanzi, E., Marchetti, D., Martinetto, E., Masin, R. R., Medagli, P., Pas- salacqua, N. G., Peccenini, S., Pennesi, R., Pierini, B., Poldini, L., Prosser, F., Raimondo, F. M., Roma-Marzio, F., Rosati, L., Santangelo, A., Scoppola, A., Scortegagna, S., Selvaggi, A., Selvi, F., Soldano, A., Stinca, A., Wagensommer, R. P., Wil- halm, T., Conti, F., 2018: An updated checklist of the vascular flora native to Italy. vernalis, morphology, taxo- nomy, transitional habitats Introduction The genus Galanthus L. (Amaryllidaceae) comprises 23 species of bulbous, petaloid monocots native to Europe, Asia Minor, and the Near East (Davis 1999, 2001, Zubov and Davis 2012, Tan et al. 2014, Zubov et al. 2019, Timukhin and Tuniyev 2022). Keywords: croatia; davis; flowering; g. reginae; galanthus; olgae; populations; reginae; species
• Grapevine yellows affecting Croatian autochthonous grapevine cultivar 'Grk' by Jezic, Marin; Karoglan Kontic, Jasminka; Preiner, Darko; Maletic, Edi; Curkovic-Perica, Mirna (2013) - MUSETTI, R., 2008: Managment and ecology of phytoplasma diseases of grapevine and fruit crops. Grk population with those grapevine-as- sociated viruses tested for is much lower than the average for grapevine cultivars in Dalmatia,which reaches about 90% of virus-infected vines (KAROGLAN KONTI] et al. 2009). Keywords: 16sri; croatia; grapevine; grk; phytoplasma
• Muhlenbergia schreberi J. F. Gmel (Poaceae), a new naturalized species in Croatia by Jogan, Nejc (2014) - In Northeast Spain, where M. schreberi populations have persisted for more than 70 years, it is reported to grow in river banks, wet and ruderal plac- es (PYKE 2008). The primary distribution of M. schreberi is in the eastern part of North America, from central Mexico to south-east Canada, and South America southwards to North Argentina. Keywords: croatia; jogan; muhlenbergia; north; schreberi; species

• Epilithic diatoms (Bacillariophyta) from cloud forest and alpine Epilithic diatoms (Bacillariophyta) from cloud forest and alpine streams in Bolivia, South America 3: diatoms from Sehuencas, Carrasco National Park, Department of Cochabamba by Morales, Eduardo A.; Fernandez, Erika; Kociolek, J. Patrick (2009) - Notice clear central area in raphe valve and the ab- sence of such an area in the rapheless valve. Sometimes clear in raphe valve, but often with shortened or even complete striae. Keywords: achnanthidium; apices; area; bertalot; croat; diatoms; gomphonema; kützing; lange; morales; raphe; sehuencas; species; striae; taxa; valve
• Morphological and anatomical features of seeds of Turkish Romulea taxa (Iridaceae) and their taxonomic significance by Karaismailoglu, Mehmet Cengiz (2015) - Cross section structures of Turkish Romulea seeds; 1: overall appearance; anticlinal cell types: 2: fl at cell (R7), 3: crushed cell (R2, R3, R4, R5 and R6), 4: undulated cell (R1), types of embryo, 5: oval (R4 and R5), 6: prolonged (R1, R6 and R7), 7: globular (R2 and R3); for taxa abbreviations see Tab. 1; e – embryo, en – endosperm, sr – storage reserve, t – testa, ec – epidermal cells of testa, fc – fl at cell, ph – phytomelan layer, cc – crushed cell, uc – undu- lated cell; white scale bars = 100 μm, black scale bars = 50 μm. 74 (1), 31–41, 2015 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Morphological and anatomical features of seeds of Turkish Romulea taxa (Iridaceae) and their taxonomic signifi cance MEHMET CENGİZ KARAİSMAİLOĞLU Istanbul University, Faculty of Science, Department of Biology, 034116 Istanbul, Turkey Keywords: characters; romulea; seeds; species; tab; taxa; testa; turkey
• Halophilic diatom taxa are sensitive indicators of even short term changes in lowland lotic systems by Kókai, Zsuzsanna; Bácsi, István; Török, Péter; Buczkó, Krisztina; T-Krasznai, Eniko; Balogh, Csaba; Tóthmérész, Béla; B-Béres, Viktória (2015) - H-1476 Hungary Abstract – The occurrence and spread of halophilic diatom taxa in freshwater lotic eco- systems are infl uenced both by natural processes and anthropogenic pollution. The relationship among halophilic diatom taxa composition and environmental factors dis- played by a detrended correspondence analysis (DCA). Keywords: autumn; changes; class; classes; diatom; et al; halophilic; nitzschia; number; size; taxa; taxa number
• How to define a diatom genus? Notes on the creation and recognition of taxa, and a call for revisionary studies of diatoms by Kociolek, John Patrick; Williams, David M. (2015) - DIATOM GENUS: A REVISION ACTA BOT. DIATOM GENUS: A REVISION ACTA BOT. Keywords: characters; diatom; genera; genus; groups; kociolek; new; species; taxa
• Anatomical characteristics of two Ornithogalum L. (Hyacinthaceae) taxa from Serbia and Hungary and their taxonomic implication by Andric, Andrijana; Rat, Milica; Zoric, Lana; Lukovic, Jadranka (2016) - O. divergens was de- scribed as a subspecies of O. umbellatum in both of them. Adaxial side is smooth while the abaxial has 6–8 or 8–10 more or less prominent ribs, in O. umbellatum and O. divergens, respectively. Keywords: cells; characters; cross; divergens; leaf; ornithogalum; scapus; section; taxa; tissue; umbellatum
• Anatomical and micromorphological properties of some Tanacetum L. (Asteraceae) taxa from Turkey and their systematic implications by Dere, Saban; Aytas Akcin, Tulay (2017) - Scanning electron micrographs (SEM) of trichomes of studied Tanacetum L. taxa: (A) eglandular trichomes on leaf of T. macrophyllum, (B) eglandular trichomes on phyllaries of T. mac­ rophyllum, (C) glandular trichomes on the lower surface of leaf of T. macrophyllum, (D) glandular trichomes on phyllaries of T. parthenium, (E) glandular trichomes on the lower surface of leaf of T. poteriifolium, (F) glandular trichomes on the lower surface of leaf of T. vulgare. Scanning electron micrographs (SEM) of cypselas of stud- ied Tanacetum L. taxa: (A) T. macrophyllum, (B) T. parthenium, (C) T. poteriifolium, (D) T. vulgare. Keywords: asteraceae; cells; leaf; species; stem; tab; tanacetum; taxa; trichomes; vulgare
• Morfometric study on Scorzonera L. taxa (Asteraceae) from northeast Anatolia by Makbul, Serdar; Türkmen, Zafer; CoÅŸkunçelebi, Kamil; BeyazoÄŸlu, Osman (2010) - S. cana is said to be close to S. laciniata ssp. laciniata (CHAMBERLAIN 1975), but our results from UPGMA do not support this view and show that S. cana is more closely related to S. armeniaca (Fig. 2). Keywords: bayburt; cana; characters; cluster; makbul; otus; scorzonera; study; taxa
• Algal assemblages in springs of different lithologies (ophiolites vs. limestone) of the Konjuh Mountain (Bosnia and Herzegovina) by Kamberovic, Jasmina; Plenkovic-Moraj, Andelka; Kralj Borojevic, Koraljka; Gligora Udovic, Marija; Zutinic, Petar; Hafner, Dubravka; Cantonati, Marco (2019) - Due to the high heterogeneity of spring habitats, in order to preserve spring species diversity of Mt. Konjuh the conservation of springs as a group of habitats is required, and not only the protection of individual spring sites. Keywords: biodiversity, diatoms, cyanobacteria, springs, geological substratum, ecological preferences, trophic status * Corresponding author, e-mail: jasmina.kamberovic@untz.ba Introduction The importance of spring habitats as biodiversity hotspots and refugia for biodiversity conservation (Cantonati et al. 2012a, Taxböck et al. 2017) has been emphasized by the de- scription of a large number of rare and endangered algal spe- cies (Sabater and Roca 1990, 1992, Cantonati 1998, Werum 2001, Poulíčková et al. 2005, Nascimbene et al. 2011). Keywords: achnanthidium; assemblages; bertalot; bertalot et; bosnia; cantonati; cantonati et; diatom; et al; gomphonema; grunow; krammer; kützing; lange; navicula; ophiolites; species; springs; substrata; taxa; values
• Seed micromorphology and anatomy of 36 Muscari (Asparagaceae) taxa from Turkey with notes on their systematic importance by Eroğlu , Hüseyin ; Cengiz Karaismailoğlu, Mehmet; Pinar , Süleyman Mesut; Fidan , Mehmet (2021) - While M. atillae, M. latifolium, M. microstomum and M. armeniacum taxa are among the taxa belonging to Botryanthus subgenus, M. mirum and M. caucasicum taxa are located between Leopoldia taxa. While M. erdalii and M. racemosum have the largest seeds, M. macbeathianum has the smallest seeds (Tab. 2, On-line Suppl. Keywords: lls; muscari; seed; taxa
• A systematic study of Thlaspi s.l. taxa in the sections Nomisma, Thlaspi and Pterotropis from Turkey based on fruit morphological and molecular data by Karaismailoğlu, Mehmet; İnal, Behçet; Erol, Osman (2022) - 81 (2), 2022 203 formed by T. perfoliatum taxa, the length of the petals in the outer segment is equal to those of the inner segment, while in T. annuum the petals in the outer segment are longer than in the inner segment (Karaismailoğlu 2018). T. ochroleucum, T. cariense, T. densiflorum, T. violascens, T. tatianae, T. cataonicum and T. syriacum taxa are included in the C3 cluster. Keywords: data; fruit; genus; karaismailoğlu; meyer; obcordate; oval; region; reticulate; species; taxa; thlaspi; turkey
• Seed and pollen morphology and numerical analysis of Tephrosia Pers. (Fabaceae) and their taxonomic significance by Elkordy, Ahmed; Osman , Ahmed K.; O. Badry, Mohamed (2022) - Based on UPGMA clustering analysis and PCA, three main clades were recognized: Clade A comprising T. kassasii, clade B comprising T. apollinea, T. purpurea, T. quartiniana, and T. uniflora, and clade C comprising T. nubica. T. apollinea (A–C), T. nubica (D–F), T. purpurea (G–I), T. quartiniana (J–L), T. uniflora (M–O), T. kassasii (P–R). Keywords: apollinea; fig; nubica; pollen; purpurea; quartiniana; seed; taxa; tephrosia; uniflora
• Does palynotaxonomy contribute to the systematics of the genus? The section Multicaulia of the genus Hedysarum (Fabaceae) example in Türkiye by Yilmaz Çitak, Burcu (2024) - The section Multicaulia of the genus Hedysarum (Fabaceae) example in Türkiye Burcu Yilmaz Çitak University of Selçuk, Faculty of Science, Department of Biology, 42130 Konya, Türkiye Abstract – The purpose of the current work was to assess the systematic and taxonomic significance of the pollen morphological characteristics of the Multicaulia section of Hedysarum species found throughout Türkiye using scanning electron microscopy (SEM) and light microscopy (LM) techniques. Additionally, the micro- morphological (pollen, fruit, and seed) characteristics can contribute to the discrimination of Hedysarum species, es- pecially the pollen grains and muri size. Keywords: genus; hedysarum; multicaulia; pollen; species; subsp; taxa; varium
• Seed morphological diversity of Egyptian Allium L. (Amaryllidaceae) and its taxonomic significance by Nour, Iman H.; Osman, Ahmed K.; Hamdy, Rim S.; El Garf, Ibrahim A. (2025) - tourneuxii; and A. trifoliatum of A. sect. The taxonomic significance of the quantitative and qualitative traits of Allium seeds has been studied. Keywords: a. sect; allium; area; cell; fig; length; seed; species; taxa; traits; undulation; wall
• Ecology and niche assembly of Campanula tommasiniana, a narrow endemic of Mt Ucka (Liburnian karst, northwestern Adriatic) by Surina, Bostjan; Martincic, Andrej (2014) - In number and coverage of vascular plant taxa, hemicryptophytes com- pletely prevail and represent more than a half of all registered vascular plant taxa (D%=46.4– 89.2), followed by phanerophytes (18%, D%=1.4–38.5), geophytes (15%, D%=2.6–12.3), therophytes (5%, D%=0–13.3) and chamaephytes (3%, D%=0–27.8). 4. – continued Association SjC CfC SaC Subassociation S G C Variant M S S M Pla str Plasteurhynchium striatulum 11 2 6 1 . Keywords: b o; c c; c m; c o; c r; c s; c t; campanula; cfc; e c; e e; e n; e r; l e; l t; m s; n d; o l; o t; profile; r o; r p; r t; s s; s u; surina; tab; taxa; tommasiniana; u r; var
• What is in a name? Diatom classification should reflect systematic relationships. by Cox, Eileen J. (2009) - Annotated list of new diatom taxa described by Horst Lange-Bertalot until the year 2000. � If new taxa group with members of an existing higher taxon, but exhibit characters not previously recorded for the higher taxon, be prepared to modify the diagnosis of the latter. Keywords: characters; classification; cox; diatom; genera; genus; species; taxa

• Fossil diatom flora from the marine Paleogene stratigraphic key section of Northeast Kamchatka, Russia by Gladenkov, Andrey Yurievich (2009) - Two diatom assemblages of different ages are recognized in different parts of the 900 m-thick Alugivayam Formation. Conclusions The Alugivayam Formation of the Il’pinskii Peninsula stratigraphic section, northeast Kamchatka, contains Oligocene marine diatom assemblages of moderate to poor preserva- tion and low abundance. Keywords: alugivayam; diatom; formation; gladenkov; oligocene; p p
• A new species of Sellaphora (Sellaphoraceae) from Hannaberry Lake, Arkansas, U.S.A. by Enache, Mihaela D.; Potapova, Marina (2009) - Sellaphora species with fine striation, such as Sellaphora wallacei (Reimer) POTAPOVA M. G., PONADER, K. C., 2008: New species and combinations in the diatom genus Sellaphora (Sellaphoraceae) from southeastern United States. Keywords: diatom; figs; lake; sellaphora; species; valve
• Microfluidic simulation of a colonial diatom chain reveals oscillatory movement by Srajer, Johannes; Majlis, Burhanuddin J.; Gebeshuber, Ille C. (2009) - Forces acting on model diatom cells numbered from A1 to A10 for incoming flow condi- tions of 0.01 m s–1 in the positive x-direction. The reason for this is that the solution for the forces in the x-direction is trivial: the whole chain of model diatoms accelerates in the direction of the flow. Keywords: cells; chain; diatom; direction; flow; fluid; forces; gaps; model
• Morphotype variations in subfossil diatom species of Aulacoseira in 24 Michigan Lakes, USA by Manoylov, Kalina M.; Ognjanova-Rumenova, Nadja; Stevenson, Robert J. (2009) - In: LAST, W. M. and J. P. SMOL (eds), Tracking environmental change using lake sediments, 1: Basin analysis, coring, and chronological techniques, 73–105. Taxonomy, phylogeny, and paleoecology of Eoseira wilsonii gen. et sp. nov., (Bacillariophyceae: Aulacoseiraceae) from lake sediments at Horsefly, British Columbia, Canada. Keywords: areolae; aulacoseira; camburn; diatom; figs; lake; mantle; sediments; siver; species; valve
• First report of Navicula jakovljevicii Hustedt (Bacillariophyta) from Hungary: distribution, comparative morphology and a related species by B-Béres, Viktória; Bácsi, István; T-Krasznai, Eniko; Kókai, Zsuzsanna; Buczkó, Krisztina (2015) - H-1476 Hungary Abstract – In Hungary Navicula jakovljevicii was fi rstly recorded in biofi lm of Elodea nut- tallii in 2005 in an oxbow of the catchment area of the River Danube. Results In Hungary Navicula jakovljevicii was fi rst recorded in autumn of 2005 in an oxbow at Ásványráró (Fig. 1). Keywords: diatom; distribution; fig; jakovljevicii; navicula; raphe; species; valve
• A new European record of Diadesmis fukushimae and its transference to Humidophila genus (Bacillariophyta) by Kövér, Csilla; Korponai, János; Harangi, Sándor; Buczkó, Krisztina (2015) - 74 (2), 245–252, 2015 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 DOI: 10.1515/botcro-2015-0020 A new European record of Diadesmis fukushimae and its transference to Humidophila genus (Bacillariophyta) CSILLA KÖVÉR1, JÁNOS KORPONAI1, SÁNDOR HARANGI2, KRISZTINA BUCZKÓ3* 1 University of West Hungary, Faculty of Natural Science, Károlyi Gáspár tér 4. H-9700 Szombathely, Hungary (kover.csilla@ttk.nyme.hu) 2 University of Debrecen, Faculty of Natural Science, Egyetem tér 1. H-4032 Debrecen, Hungary 3 Department of Botany, Hungarian Natural History Museum, Könyves Kálmán krt. 40. Locations and some chemical parameters of the lakes where Humidophila fukushimae was found. Keywords: bertalot; diadesmis; diatom; figs; fukushimae; humidophila; lange; valve
• Distribution of periphytic diatoms in the rivers of the Lake Ladoga basin (Northwestern Russia) by Rusanov, Alexander G.; Stanislavskaya, Elena V.; Acs, Eva (2009) - On the basis of geology and river water chemistry, the Lake Ladoga basin could be separated into two main parts, the northern and the southern sub-basin. Keywords: Diatom, periphyton, distribution, gradient, eutrophication, Lake Ladoga, Russia Introduction Periphytic diatoms are excellent indicators of ecological condition of rivers and streams, because of their ability to respond rapidly to changes in nutrient concentrations. Keywords: basin; conductivity; diatom; kütz; ladoga; lake; phosphorus; rivers; southern; species; sub; var
• Diatom preservation: differential preservation of sedimentary diatoms in two saline lakes by Flower, Roger J.; Ryves, David B. (2009) - This seems to indicate that, al- though high salinity is inimical to diatom valve preservation (cf. Aspects of diatom preservation are explored in two markedly different saline lakes (one in North America and one in Egypt) and observations are used to make some initial inferences about diatom preservation. Keywords: core; diatom; dissolution; et al; fig; index; lake; preservation; ryves; sediment
• One new species of Cymbella C.A. Agardh (Bacillariophyta) from high altitude lakes in the Hengduan Mountains of Southwest China by Liu, Qi; Wu , Han ; Li, Yan-Ling; Kociolek , John Patrick (2021) - Results Taxonomy Class Bacillariophyceae Haeckel 1878 Subclass Bacillariophycidae D.G. Mann in Round et al. 1990 Order Cymbellales D.G. Mann in Round et al. 1990 Family Cymbellaceae Greville 1833 Genus Cymbella C.A.Agardh 1830 Cymbella luoyulanae Y.Li sp. nov. Fig. Karthickia verestigmata gen. et. sp. Keywords: china; cymbella; diatom; kociolek; krammer; kulikovskiy; luoyulanae; species; striae; valve
• Placoneis modaomensis sp. nov. (Bacillariophyta; Cymbellaceae), a new species from Guangdong Province, China by Li, Yu-Jie; Guo, Ji-Shu; Ni, Hong-Ping; Huang, Ying-Yan; Kociolek, John Patrick; Li, Yan-Ling (2023) - Placoneis species are prevalent in freshwater bodies, in- cluding alkaline waters, mesotrophic and oligotrophic con- ditions (Cox 1987, Fujita and Ohtsuka 2005, Bruder and Medlin 2007, Kezlya et al. 2021). Keywords: diatoms, morphology, new species, Placoneis, taxonomy Introduction The genus Placoneis Mereschkowsky was erected by Mereschkowsky in 1903 for a group of species showing a single chloroplast with a central bridge and lateral lobes (Mereschkowsky 1903). Keywords: areolae; bertalot; china; diatom; et al; lange; placoneis; raphe; species
• Cymbella stomachsis sp. nov. (Bacillariophyta; Cymbellaceae), a new species from Guangdong Province, China by Zhao, Yi-Han; Guo, Ji-Shu; Tang, Zheng-Bin; Zhang, Yun; Huang, Shao-Feng; Kociolek, John Patrick; Li, Yan-Ling (2025) - nov. (Bacillariophyta; Cymbellaceae), a new species from Guangdong Province, China Yi-Han Zhao1, Ji-Shu Guo1, Zheng-Bin Tang1, Yun Zhang2, Shao-Feng Huang3*, John Patrick Kociolek4, Yan-Ling Li1* 1 Yunnan University, School of Ecology and Environmental Science, Institute for Ecological, Research and Pollution Control of Plateau Lakes, Kunming 650500, P. R. China 2 Hubei Normal University, College of Life Sciences, Huangshi 435002, P. R. China 3 Center for Ecology and Environment Monitoring and Research, Administration for Pearl River, Basin-South China Sea Ecology and Environment, Ministry of Ecology and Environment, Guangzhou 510611, P. R. China 4 University of Colorado, Museum of Natural History and Department of Ecology and Evolutionary Biology, Boulder, Colorado-80309, USA Abstract – A new diatom species from the genus Cymbella C. Agardh is described from samples collected during a survey of freshwater diatoms from Modaomen Channel, Guangdong Province, China. Keywords: China, Cymbellaceae, diatom, morphology, Pearl River, taxonomy Introduction The diatom genus Cymbella C. Agardh was established almost 200 years ago (Agardh 1830), with C. cymbiformis C. Agardh (1830) chosen later as the type species of the ge- nus (Håkansson and Ross 1984). Keywords: china; cymbella; diatom; ends; et al; fig; province; species; stomachsis; valve
• Influence of environmental and spatial factors on the distribution of surface sediment diatoms in Chaohu Lake, southeast China by Chen, Xu; Yang, Xiangdong; Dong, Xuhui; Liu, Enfeng (2012) - The original coordi- nate values were z-score transformed and these standard coordinates were used to create the dataset of spatial variables derived from PCNM using the program Spacemaker2 (BORCARD and LEGENDRE 2004). Spatial variables PCNM1 and PCNM2 were calculated and both of them were included in the later analysis. Keywords: analysis; diatom; distribution; lake; spatial; species; variables

• Carbon gain optimization in five broadleaf deciduous trees in response to light variation within the crown: correlations among morphological, anatomical and physiological leaf traits by Catoni, Rosangela; Gratani, Loretta; Sartori, Francesco; Varone, Laura; Granata, Mirko Umberto (2015) - Among the considered species, A. campestre and C. avellana sun leaves were closer to shade leaf behavior and P. alba shade leaves were closer to sun leaf behavior. The relationship between canopy structure and the spa- tial distribution of light availability differs between primary and secondary growth forests (NICOTRA et al. 1999) and light availability in the understory is frequently associated with regeneration processes and the long-term survival of forest tree species (WOODS 2000). Keywords: alba; chl; crown; et al; forest; leaf; light; plasticity; robur; shade; shade leaves; species; sun; sun leaves; sun shade; thickness; tree
• Morphological variability of the Bulgarian endemic Betonica bulgarica Degen et Neic. (Lamiaceae) from Sinite Kamani Natural Park, Eastern Balkan Range by Grozeva, Neli Hristova; Gerdzhikova, Mariya Asenova; Pavlov, Dimitar; Panayotova, Galia; Todorova, Mima (2016) - Data about the state of B. bulgarica populations on the territory of Balkan Range are contained in the management plans of the Central Bal- kan National Park (Yankov et al. 2001) and Sinite Kamani Natural Park (Grozeva et al. 2004). Indumentum and morphology of generative organs had taxonomic signifi cance for distinguishing B. bulgarica from the other species in the genus, including the species that were morphologically most similar to it – Betonica offi cinalis L. Keywords: Betonica bulgarica, morphology populations, variations * Corresponding author, e-mail: grozeva@uni-sz.bg Introduction Endemic plants are an emblematic symbol of the Bul- garian fl ora and one of the most sensitive and vulnerable units in the country’s nature ecosystems (Anchev 2011). Keywords: betonica; bulgarica; glandular; leaf; leaves; length; populations; species; surface; traits; trichomes; variability; width
• Morphology, anatomy and karyology of endangered Turkish endemic Physoptychis haussknechtii Bornm. (Brassicaceae) from Central Anatolia by Tekin, Mehmet; Martin, Esra (2017) - The chromosome number of P. haussknechtii was defi ned to be 2n=16. The karyotype formula of P. haussknechtii consists of fi ve metacentric chromosome pairs and three submetacentric chromosome pairs. Keywords: cells; chromosome; haussknechtii; leaf; leaves; physoptychis; pollen; species; study
• Anatomical investigations of the Turkish critically endangered species: Achillea sivasica Çelik et Akpulat (Asteraceae) by Tekin, Mehmet; Akdere, Şeyda (2021) - While most of the root volume in A. sivasica is filled by the cortex parenchyma, in A. phrygia and A. gypsicola it is filled by the secondary xylem (Akcin and Akcin 2010). In the stem anatomy of A. sivasica, the presence of unilay- ered epidermis with abundant non-glandular hairs and la- mellar collenchyma at the corners are features similar to those found in A. phrygia and A. gypsicola. Keywords: achillea; akcin; asteraceae; cells; endodermis; epidermis; gypsicola; leaf; sivasica; stem
• Foliar resorption and chlorophyll content in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient in Turkey by Turkis, Sevda; Özbucak, Tugba Bayrak (2010) - However, P resorption efficiency was higher at 670 m. C. creticus in- dividuals effectively used nitrogen at low elevations, whilst phosphorus was effectively used at high elevations. 69 (2), 275–290, 2010 CODEN: ABCRA25 ISSN 0365–0588 Foliar resorption and chlorophyll content in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient in Turkey SEVDA TURKIS, TUGBA OZBUCAK* Department of Biology, Faculty of Arts and Sciences, Ordu University, 52750 Ordu, Turkey Foliar nitrogen and phosphorus dynamics, leaf resorption efficiency, proficiency, chang- ing of chlorophyll a/b proportions in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient (sea level-30 m, middle-670 m, high-880 m) were investigated. Keywords: chl; chlorophyll; concentrations; content; creticus; gradient; leaf; nutrient; resorption; species
• Festuca albomontana (Poaceae), a new chasmophytic fescue from the Western Taurus Mountains (Antalya, Turkey) by Aykurt, Candan; Çıngay, Burçin; Sümbül, Hüseyin; Gülben, Mertcan; Cabi, Evren; Öz, Zeynep (2022) - Fuente, V., Ortúñez, E., 1998: Biosistemática de la sección Festuca del género Festuca L. Poaceae) en la Península Ibérica. Keywords: anatomy, Festuca, morphology, new species, taxonomy, Turkey Introduction The grass family (Poaceae), with about 12,000 species and 780 genera, ranks as the second largest monocot fam- ily and the fifth largest plant family in the world (Clayton and Renvoize 1986, Kellogg 2015, Christenhusz and Byng 2016, Soreng et al. 2017). Keywords: aykurt; festuca; group; leaf; poaceae; species; turkey
• Taxonomic importance of leaf anatomical characters for the genus Alopecurus L. (Poaceae) by Günaydın, Sinem; Aykurt, Candan (2023) - Although numerous studies conducted on the morphology of the genus Alopecurus can be found (e.g., Doğan 1997, 1999, Soreng et al. 2007, Boudko 2014), there are limited studies conducted on the importance of leaf an- atomical characters for Alopecurus species in the taxonomy of this genus. 3. Unweighted pair group method with arithmetic mean (UPGMA) dendrogram created according to the Gower similarity index by using anatomical character matrix of Alopecurus species studied (see Tab. 2). Keywords: adaxial; alopecurus; cells; characters; leaf; number; sclerenchyma; species
• The anatomy, micromorphology, and essential oils of the Turkish endemic and endangered species Alchemilla orduensis by Akçin, Öznur Ergen; ÖZBUCAK, Tuğba; ÖZTÜRK, Şükran; Uzunömeroğlu, Hüseyin Ümit (2025) - Scripta Scientifica Pharma- ceutica 5, 22–33. Dubel, N., Grytsyk, L., Kovaleva, A., Grytsyk, A., Kоshovyi, О., 2022: Research in components of essential oils from flowers and leaves of the genus Alchemilla L. species. https://doi. org/10.1051/dst/2010035 Grytsyk, L. M., Tuchak, N. I., Grytsyk, A. R., Melnyk, M. V., Shumska, N. V., 2019: Морфолого-анатомічне дослідження видів приворотня, Що зростають в західному регіоні (Morpho anatomical investigation of Alchemilla L. species of western region of Ukraine). Keywords: alchemilla; cells; epidermis; et al; leaf; leaves; orduensis; parenchyma; parts; petiole; species; stem; surface
• Leaf morphological variability of Pyrus spinosa and Crataegus monogyna and their potential hybridization by Vidaković, Antonio; Šatović, Zlatko; Liber, Zlatko; Jurica, Marko; Poljak, Igor (2025) - These few individu- als from P. spinosa populations, with unusual, hawthorn- like leaves indicate possible hybridization between these two genera (Fig. 3). However, C. monogyna popu- lations were somewhat better differentiated than those of P. spinosa, which is also supported by weak genetic differen- tiation of P. spinosa populations in the area (Vidaković et al. 2024). Keywords: analysis; crataegus; leaf; leaves; monogyna; populations; pyrus; species; spinosa; traits; variability
• Flavonoid composition and localization in trichomes and leaves of Degenia velebitica (Brassicaceae) by Stamenković, Vanja; Tkalec, Mirta (2025) - t – trichome, tb – trichome branch, ts – trichome stalk, tw – trichome cell wall, e – epidermis, bc – basal epidermal trichome cell, i – inclusions in the trichome lumen, s – stomata, pp – palisade parenchyma, sp – spongy parenchyma, cv – central vascular vessel. Histochemical visualization of flavonoids in Degenia velebitica trichomes and leaf tissues by confocal laser scanning micros- copy: the trichome in bright field (A1), the secondary fluorescence of flavonoids inside the trichome in pseudo-green color after the overlapping of seven separate micrographs that were obtained by scanning at different depths (A2), and an overlapping image of the previous two (A3); cross-section of a leaf first excited for autofluorescence of chlorophyll and visualized in pseudo-red color (B1), then excited at 488 nm after incubation with “Naturstoff” reagent, and monitoring the secondary fluorescence of flavonoids visualized in pseudo-green color (B2) and after overlapping the images of the two channels (B3). Keywords: brassicaceae; cells; degenia; fig; flavonoids; fluorescence; kaempferol; leaf; leaves; quercetin; trichomes; velebitica
• Amino acids through developmental stages of sunflower leaves by Roy, Nayan; Laskar, Subrata; Barik, Anandamay (2013) - Key words: amino acids, Helianthus annuus, sunflower Introduction Studies in plant-insect interactions have mainly concentrated on the effects of insect performance of plant secondary metabolites or nutritive compounds (SCHOONHOVEN et al. 2005). The balance of amino acids that constitute plant proteins differs from that of insects and deficiency in even one essential amino acid in a herbivore diet may cause an unbalanced nitrogen metabolism in insects (BERENBAUM 1995). Keywords: acids; amino; amino acids; content; leaf; leaves; roy; sunflower
• Leaf and stem anatomy in eight Hypericum species (Clusiaceae) by Perrone, Rosaria; De Rosa, Paolo; De Castro, Olga; Colombo, Paolo (2013) - The species are mostly mesophytes (H. perforatum, H. perfoliatum, H. pubescens, H. androsaemum, H. hircinum), but there are also meso-hygrophytes such as H. tetrapterum, and xerophytes and xero-halophytes such as H. triquetrifolium and H. aegypticum respec- tively. Stem anatomy From a morphological point of view the stem presents: in hemicryptophyte scapose spe- cies, lignified and prostrate at the base, briefly creeping, in H. perforatum and H. perfo- liatum respectively; lignified creeping with ascending branches in H. pubescens; prostrate then erect, ligneous in H. tetrapterum and H. triquetrifolium, in the latter strongly branching (PIGNATTI 1982). Keywords: adaxial; bars; cells; fig; hypericum; leaf; perforatum; scale; secretory; species; stem; surface; type
• Compounds of the methanolic leaf extract as chemotaxonomic markers for the Campanula pyramidalis complex (Campanulaceae) by Jankovic, Ivana Blagoje; Drobac, Milica M.; Lakusic, Dmitar V. (2014) - EDDIE, W. M. M., SHULKINA, T., GASKIN, J., HABERLE, R. C., JANSEN, R. K., 2003: Phytochemistry 56, 631–636. CUPIDO, C. N., EDDIE, W. M. M., TIEDT, L. R., 2011: Systematic and ecological signifi cance of seed coat morphology in South African Campanulaceae sensu stricto. Keywords: campanula; complex; extract; lakušić; leaf; ora; pyramidalis

• Chemical composition and antioxidant potential of Acacia leucophloea Roxb. by Muhamad, Zia-Ul-Haq; Cavar, Sanja; Qayum, Mughal; Khan, Inamullah; Ahmad, Shakeel (2013) - Extraction The plant material (Acacia leucophloea seeds, leaves, flower and pods) was air-dried in shade and crushed to coarse powder separately with help of pestle and mortar. Protein fractions Seeds (%) Pods (%) Albumins 9.67 ± 0.39 5.18 ± 0.89 Globulins 13.01 ± 1.27 6.12 ± 0.25 Prolamines 1.21 ± 0.54 1.09 ± 0.46 Glutelins 2.32 ± 1.08 2.03 ± 0.77 Tab. Keywords: acacia; acid; antioxidant; haq; leucophloea; pakistan; pods; profile; seeds; zia
• Pseudo-nitzschia Peragallo (Bacillariophyceae) diversity and domoic acid accumulation in tuberculate cockles and sweet clams in M’diq Bay, Morocco by Rijal Leblad, Benlahcen; Lundholm, Nina; Goux, Didier; Veron, Benoit; Sagou, Regia; Taleb, Hamid; Nhhala, Hassan; Er-Raioui, Hassan (2013) - PAN, Y., MICHAEL, L. P., MARK, B., MOELLER, P. D. R., QUAY DORTCH, POWELL, C. L., DOUCETTE, G. J., 2001: The composition of Pseudo-nitzschia species varied greatly during the year (Fig. 4). Keywords: acid; bay; et al; lebland; profile; pseudo; rijal; shellfish; species
• Karyological and morphological variations within the genus Dysphania (Chenopodiaceae) in Bulgaria by Grozeva, Neli Hristova; Cvetanova, Yanka G. (2013) - Microphotographs of the metaphase plate of Dysphania species: A – D. multifida (popula- tion No 105) – 2n = 36; B – D. multifida (No 40) – 2n = 36. – Scale bars = 10 mm. Percentage of the interpopulation variation in the overall morphological variation for each character in Dysphania Character No Species D. botrys D. pumilio D. ambrosioides D. multifida 1 37.7 30.1 66.0 43.2 2 29.2 45.7 47.7 29.2 3 65.1 47.6 43.4 64.5 4 46.4 70.9 38.1 49.9 5 69.1 32.2 48.0 61.1 6 61.8 51.3 31.1 37.0 7 66.5 46.1 68.0 53.9 8 67.7 55.8 40.2 57.3 9 45.1 66.3 74.6 57.9 10 76.6 65.3 71.1 48.7 11 69.3 0.0 59.4 50.6 12 52.1 55.7 62.3 55.7 13 66.5 50.9 62.9 52.9 14 55.7 59.0 64.9 38.2 15 78.9 52.7 55.7 0.0 16 33.1 56.8 59.9 0.0 17 41.6 59.5 85.1 61.4 18 57.0 56.2 94.0 63.0 Keywords: botrys; chenopodium; chromosome; cvetanova; dysphania; genus; grozeva; length; populations; profile; species
• A new Sesleria juncifolia association from south-eastern Italy and its position in the amphi-Adriatic biogeographical context by Di Pietro, Romeo; Wagensommer, Robert Philipp (2014) - Conclusion The description of Stipo austroitalicae-Seslerietum juncifoliae is a step towards filling a gap in the phytosociological knowledge of the Apulian vegetational pattern and in defining the syntaxonomical and distributional framework of Sesleria juncifolia communities in Peninsular Italy. Due to the relict and scattered distribution of Sesleria juncifolia in Apulia region, the variances in species composition amongst the different subassociations are mainly influenced by local factors. Keywords: communities; e e; e n; e r; e t; gargano; grasslands; italy; juncifolia; pietro; profile; r o; sesleria; seslerietum; southern; species; stipo; subsp; t r
• Interactions with mycorrhizal fungi in two closely related hybridizing orchid species by Luca, Alessia; Belusci, Francesca; Pellegrino, Giuseppe (2014) - From the beginning of 2000, a large number of orchid mycorrhizal has been identified directly from orchid roots, tubers and rhizomes through molecular biology techniques (SHEFFERSON et al. 2007, STOCKINGER et al. 2010, JACQUEMYN et al. 2011a). Interestingly, 30% of orchid species shows non-rewarding flowers (RENNER 2005), attracting pollinators by generalized food deception, mimicry or sexual deception (JERSAKOVA et al. 2006). Keywords: et al; fungi; italica; luca; luca et; mycorrhizal; orchis; profile; species
• Retention of relict satellite DNA sequences in Anemone (Ranunculaceae) by Besendorfer, Visnja; Mlinarec, Jelena (2013) - EHRENDORFER, F., ZIMAN, S. N., KÖNIG, C., KEENER, C. S., DUTTON, B. E., TSARENKO, O. N., BULAKH, E. V., BOSCAIU, M., MÉDAIL, F., KÄSTNER A., 2009: Taxonomic revision, phy- logenetics and transcontinental distribution of Anemone section Anemone (Ranuncula- ceae). Features of AhTR1 sequences by Anemone species. Keywords: ahtr1; anemone; besendorfer; blanda; dna; hortensis; mlinarec; pavonina; profile; satdna; satellite; sequences; species
• Influence of crop species and edaphic factors on the distribution and abundance of Trichoderma in Alfisol soils of southern India by Muniappan, Vellaisamy; Muthukumar, Thangavelu (2014) - The abundance of soil fungi ranged be- tween 7.0 × 103 and 13.6 × 103 colony forming units (cfus) per gram of dry soil. Compendium of soil fungi. Keywords: abundance; factors; fungal; koningii; muniappan; populations; profile; soil; species; trichoderma
• Morphological variation of Lactuca serriola L. achenes as a function of their geographic origin by Kristkova, Eva; Lebeda, Ales; Novotna, Alzbeta; Dolezalova, Ivana; Berka, Tomas (2014) - The first compilation of data on morphological parameters of L. serriola achenes was presented by NOVOTNÁ et al. (2011) where achene parameters from 50 populations of prick- ly lettuce from the Czech Republic, Germany, the Netherlands and the United Kingdom ACTA BOT. NOVOTNÁ et al. (2011) also showed that with increasing latitude, i.e. from south to north, L. serriola achenes were longer, narrower, with fewer ribs, and longer beaks. Keywords: achene; body; dispersal; et al; lactuca; length; pappus; populations; profile; serriola; slovenia; species; sweden
• Second Week of Croatian Botanical Gardens and Arboreta (May 14 -19, 2012) by Kovacic, Sanja (2013) - Sanja Kova~i} Croatian Botanical Society – Section of Botanical Gardens and Arboreta, De- partment of Botany and Botanical Garden, Division of Biology, Faculty of Science, University of Zagreb, Maruli}ev trg 9a, HR – 10000 Zagreb, Croatia E-mail: sanja.kovacic@biol.pmf.hr S4 ACTA BOT. 72 (1), S1–S4, 2013 CODEN: ABCRA25 ISSN 0365–0588 eISSN 1847-8476 Second Week of Croatian Botanical Gardens and Arboreta (May 14–19, 2012) Keywords: botanical; garden; kovacic; profile
• Modulatory antimicrobial activity of Piper arboretum extracts (Zingiberaceae) by Tintino, Saulo R.; Souza, Celestina E.S.; Guedes, Glaucia M.M.; Costa, Jacqueline I.V.; Duarte, Francisco M.; Chaves, Maria Celia O.; Silva, Viviane A.; Pessoa, Hillzeth L.; Lima, Micheline A.; Garcia, Carlos A.; Coutinho, Henrique (2014) - Toxicon 20, 247–252. JAVADPOUR, M. M., JUBAN, M. M., LO, W. C., BISHOP, S. M., ALBERTY, J. B., COWELL, S. W., 1996: De novo antimicrobial peptides with low mammalian cell toxicity. 73 (1), 2014 TINTINO S. R., SOUZA C. E. S., GUEDES G. M. M., COSTA J. I. V., DUARTE F. M. et al. Keywords: activity; antibiotic; extract; piper; profile; tintino

• Morphological variability of the planktonic diatom Thalassiosira delicatula Ostenfeld emend. Hasle from the Mexican Pacific, in culture conditions by Hernandez-Becerril, David U.; Moreno-Gutiérrez, Sara P.; Barón-Campis, Sofía A. (2009) - HARRIS, A. S. D., MEDLIN, L. K., LEWIS, J., JONES, K. J., 1995: Thalassiosira species (Bacil- lariophyceae) from a Scottish sea-loch. Thalassiosira species from the southern Gulf of Mexco. Keywords: cells; fig; figs; fultoportulae; hasle; processes; species; thalassiosira; valve
• Development of periphytic diatoms on different artificial substrates in the Eastern Adriatic Sea by Nenadovic, Tina; Sarcevic, Tena; Cizmek, Hrvoje; Godrijan, Jelena; Maric Pfannkuchen, Danijela; Pfannkuchen, Martin; Ljubesic, Zrinka (2015) - The high abundance of the diatom Cylindrotheca closterium on wood substrate greatly contributed to the high overall abundance of diatoms on wood. High dia- tom abundance on the bottom side of wood substrate could be attributed to wood being a nutrient source for the periphyton community, as mentioned before. Keywords: abundance; artifi; biofi; cells; cial; cm–2; diatoms; iron; marine; periphyton; spp; substrates; surface; × ×
• Impact of nickel on grapevine (Vitis vinifera L.) root plasma membrane, ROS generation, and cell viability by Pavlovkin, Ján; Fiala, Roderik; Ciamporová, Milada; Martinka, Michal; Repka, Vladimír (2016) - The root epidermal cells being in direct contact with the environment are more sensitive comparing to the internal root tissues as shown in our previous re- search on grapevine root cells exposed to cadmium (Fiala et al. 2015). The time course of hydro- gen peroxide accumulation in grapevine root cells treated with 5 mmol L–1 Ni demonstrated that the highest hydrogen peroxide production occurred mainly after 180 min (Figs. 6A, B). Keywords: cells; grapevine; l–1; membrane; mmol; ni2; roots
• A comparative study on the two species of the genus Salvia L. sect. Aethiopis Bentham (Labiatae) from East Anatolia, Turkey by Kahraman, Ahmet; Dogan, Musa (2010) - In this paper for the first time we give descriptions of S. limbata and S. palaestina, their comparative root, stem, leaf and petiole anatomy, palynology and nutlet micromorphology. Materials and methods Specimens of S. limbata and S. palaestina were collected from six localities in Turkey (Tab. 1, Fig. 1). Keywords: cells; epidermis; fig; length; limbata; palaestina; s. limbata; salvia; size; species
• Structure of floral nectaries in Aesculus hippocastanum L. by Weryszko-Chmielewska, Elzbieta; Chwil, Miroslawa (2017) - 76 (1), 41–48, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2016-0049 ISSN 0365-0588 eISSN 1847-8476 Structure of fl oral nectaries in Aesculus hippocastanum L. Elżbieta Weryszko-Chmielewska, Mirosława Chwil* University of Life Sciences in Lublin, Faculty of Horticulture and Landscape Architecture Department of Botany, Lublin, Poland Abstract – Representatives of the family Sapindaceae exhibit high morphological diversity of the nectary structure. The present paper shows for the fi rst time the results of micromorphological, anatomical, and ultra- structural analyses of fl oral nectaries in Aesculus hippocastanum. Keywords: aesculus; cells; chmielewska; figs; fl owers; hippocastanum; nectaries; nectary; owers; secretion; structure
• Wall protuberance formation and function in secreting salt glands of Tamarix aphylla L. by Bosabalidis, Artemios M. (2010) - In the middle pair of secretory cells, wall protuberances are not re- stricted to the periphery of the cells but often extend deep into the innermost cytoplasmic region (Fig. 2 A). At the region of the pro- tuberance (pr), many vesicles (vs) and converging microtubules (mt) appear; C – Active dictyosomes (ds) during the stage of protuberance formation; D – Endoplasmic reticulum ele- ments (er) and mitochondria (m) in the vicinity or in contact with wall protuberances; E – Numerous microvacuoles (mv) accumulated along the apical wall protuberances in the up- per pair of secretory cells. Keywords: cells; fig; glands; microvacuoles; protuberances; salt; wall
• Morpho-anatomical diversity of five species of the genus Asparagus (Asparagaceae) from Algeria: Genus Asparagus in Algeria by Boubetra, Kenza; Amirouche, Nabila; Amirouche, Rachid (2022) - Cir- cular sections have also been observed in Asparagus species from Bulgaria such as A. tenuifolius Lam., and A. acutifolius (Raycheva and Stojanov 2013). Genetic diversity among Asparagus species using morphological characteristics and RAPD markers in Paki- stan. Keywords: acutifolius; algeria; asparagus; cells; cladodes; fig; genus; horridus; officinalis; populations; species
• Cytochemical and ultrastructural observations of anthers and pollen grains in Lathyrus undulatus Boiss. by Vardar, Filiz; Unal, Meral (2011) - Abbreviations: PMC – pollen mother cell, PAS – periodic acid-Schiff Introduction Microsporogenesis and pollen grain development have been a focus of interest since generative reproduction in plants depends on pollen structure and function. The present paper provides research on anther and pollen grain development in Lathyrus undulatus, by the application of light, fluorescence and electron microscopy. Keywords: anther; cells; development; lathyrus; microspore; pollen; stage; tapetum; undulatus; wall
• Reproductive biology of Centaurea kilaea (Asteraceae, Cardueae) – an endemic species from Türkiye by Kartal, Ciler (2025) - In the tetrad stage, tapetum cells react weakly to PAS. However, contrary to the oth- er wall layers, the cytoplasm of tapetum cells becomes rich in protein content starting from the tetrad stage (Fig. 3D). Keywords: asteraceae; cells; centaurea; development; embryo; et al; fig; kilaea; pollen; stage; tapetum; wall
• Mericarp micromorphology and anatomy of Salvia hedgeana Donmez, S. huberi Hedge and S. rosifolia Sm. (section Salvia Hedge, Lamiaceae) by Buyukkartal, Hatice N.; Kahraman, Ahmet; Colgecen, Hatice; Dogan, Musa; Karabacak, Ersin (2011) - In S. huberi and S. rosifolia mucilage was formed after the first half hour of wetting, but in S. hedgeana the time taken was longer than one hour. Character S. hedgeana S. huberi S. rosifolia p Tukey’s HSD test Mericarp length (mm) 3.66 ± 0.37 [3.70] (3.12–4.36) 2.90 ± 0.27 Keywords: cells; hedgeana; huberi; lamiaceae; mericarp; mucilage; rosifolia; s. huberi; salvia; species
• Morphology and anatomy of Hedysarum pannosum (Boiss.) Boiss. (Fabaceae) by Dural, Hüseyin; Yilmaz Çitak, Burcu (2015) - H. pannosum pollen are tricolpate, prolate, circular in polar view and elliptical-elongated in equatorial view and ornamentation reticulate. Later, PON- ERT (1973) reported H. pannosum as H. pogonocarpum Boiss. subsp. Keywords: cells; fig; hedysarum; leafl; pannosum; pollen

• Antifungal potential of thyme essential oil as a preservative for storage of wheat seeds by Anzlovar, Sabina; Likar, Matevz; Dolenc Koce, Jasna (2017) - Essential oil treatment of wheat grain In the present study, two types of wheat (Triticum aes- tivum L.) grain were used: conventionally grown grain obtained from the Agricultural Institute of Slovenia (T. aes- tivum cv. The effects of the seed type, prior sterilization, essential oil treatments, and essen- tial oil concentrations on the fungal infection rates and the germination rates of the wheat grain were tested using mul- tiway-ANOVA, with the level of signifi cance set at p<0.05. Keywords: essential; germination; grain; growth; infection; oil; seed; sterilization; thyme; treatment; wheat; wheat grain
• Growth and yield response of cowpea (Vigna unguiculata L. Walp.) to soils from different fallow physiognomies in the rainforest zone of Nigeria by Oke, Samson Olajide; Eyitayo, Damilola Lanre; (2010) - Seedlings of cowpea were grown from seeds on soil samples collected from the four different fallow statuses (Panicum maximum-dominated fallow soil, Chromolaena odorata-dominated fallow soil, Tithonia spp.-dominated fallow soil and bush fallow soil that contains many herbaceous plant species) in plastic containers each having fifteen replicates. The results were used to deduce the best type of fallow soil for cowpea cultivation. Keywords: cowpea; fallow; growth; panicum; seedlings; soil; unguiculata; vigna
• In vitro cultivation and biocontrol potential of Botryosphaeria visci against European mistletoe (Viscum album L.) by Bilonozhko, Yuliia; Krupodorova, Tetjana; Rabokon, Anastasiia; Postovoitova, Anastasiia; Kalafat, Lubov; Pirko, Yaroslav; Blume, Yaroslav (2023) - To our knowledge, this is the first time that SDA and SDB media have been used for the isolation and cultivation of B. visci, and that the effect of different liquid media on B. visci growth has been evaluated by mycelial dry weight. The morphology of the vegetative mycelium and growth of B. visci varied depending on the media used. Keywords: album; b. visci; et al; fungus; growth; media; mistletoe; varga; visci; viscum
• Seasonal differences in growth, photosynthetic pigments and gas exchange properties in glass-house grown maize (Zea mays) by Hussain, Iqbal; Wahid, Abdul; Rasheed, Rizwan; Akram, Hafiz Muhammad (2014) - Materials and methods Source of maize seed, treatment and plant growth conditions Seeds of selected maize (Zea mays L.) cultivars Sadaf (heat-tolerant) and Agatti-2002 (heat-sensitive) were obtained from the Maize and Millets Research Institute (MMRI), EFFECT OF GREENHOUSE CONDITIONS ON TWO MAIZE CULTIVARS ACTA BOT. From these changes in the chlorophyll concentrations, it can be deduced that the sensitivity of Chl-b to GH condition is mainly responsible for the yellowing of leaves, particularly in spring grown plant. Keywords: agatti-2002; autumn; chl; conditions; cultivars; growth; maize; sadaf; spring; stage

• Distribution of Taraxacum microspecies along soil property gradients in salt and brackish meadows on the Polish Baltic coast by Bosiacka, Beata; Wieclaw, Helena; Marciniuk, Pawel; Podlasinski, Marek (2019) - Relationships between the presence of individual dandelion microspecies (for 6 microspecies oc- curring in more than 2 plots only) and soil parameters as well as between the number of dandelion microspecies per plot and soil parameters were examined using Spearman’s rank correlation test (STATISTICA StatSoft v. 10.0). 1. Results of Spearman’s rank correlation test between the number and occurrence of Taraxacum microspecies and soil parameters, * denotes p < 0.05, ECe – electrolytic conductivity. Keywords: baltic; coast; content; dandelion; grasslands; meadows; microspecies; polish; salinity; salt; section; soil; taraxacum
• Germination behavior of the extremely rare Hladnikia pastinacifolia Rchb. (Apiaceae) – a Pleistocene in situ survivor by Sajna, Nina; Sipek, Mirjana; Sustar-Vozlic, Jelka; Kaligaric, Mitja (2019) - The temperature sequence of the colder period that H. pastinacifolia seeds received in nature was 20/15 °C (52 days), 10/5 °C (40 days), 5/0 °C (65 days), 10/0 °C (45 days), 15/5 °C (21 days). At the time of disper- sal, the embryo of H. pastinacifolia seeds measured about 0.4 mm and needed to reach the critical length for germination (Fig. 1). Keywords: baskin; days; embryo; germination; hladnikia; pastinacifolia; seedlings; seeds; soil; species; umbel; šajna
• Effect of seed age and soil texture on germination of some Ludwigia species (Onagraceae) in Nigeria. by Oziegbe, Matthew; Faluyi, Julius Olaoye; Oluwaranti, Abimbola (2010) - Seed germination in Ludwigia was greatly influenced by seed age and soil type. It has been reported that the capacity of seed germination in Ludwigia species is not known (RUAUX et al. 2009). Keywords: germination; ludwigia; media; month; percentage; seeds; soil; species; var
• Fungal diversity and ex vitro symbiotic germination of Serapias vomeracea (Orchidaceae) by Özdener Kömpe, Yasemin; Akin Mutlu, Vildan ; Özkoç , İbrahim ; Demiray , Sevim (2022) - In this context, ex vitro symbiotic seed germination and seedling growth of orchid seeds may be convenient and advanta- geous. There are very few studies on ex vitro germination and seedling development of orchid seeds to date and they are about epiphytic orchids (Quay et al. 1995, Aewsakul et al. 2013). Keywords: et al; fungi; germination; isolates; orchid; rhizoctonia; roots; seeds; soil; svl; tulasnella; vomeracea
• Early post-fire changes of Pinus brutia forests in the Amanos Mountains (Turkey) by Turkmen, Necattin; Duzenli, Atabay (2011) - Kuhn Hypolepidaceae Ge P G + + + + Rhus coriaria L. Anacardiaceae Ph P G – – – + Senecio vernalis Waldst. Rubiaceae Ch P VG – – + + Asplenium adiantum-nigrum L. Aspleniaceae H P G – – – + Brachypodium pinnatum (L.) P. Beauv. Keywords: area; brutia; fire; mediterranean; p g; pinus; post; soil; species; turkey; year
• Arbuscular mycorrhizal and dark septate fungal associations in shallot (Allium cepa L. var. aggregatum) under conventional agriculture by Priyadharsini, Perumalsamy; Pandey, Radha Raman; Muthukumar, Thangavelu (2012) - Aseptate inter or intracellular, linear or coiled fungal hyphae accompanied with arbuscules or arbusculate coils were used to designate AMF colonization. AMF colonization was characterized by the formation of an appresso- rium on the root surface (Fig. 1a). Keywords: amf; colonization; dse; et al; fungi; mycorrhizal; onion; root; soil; spore
• Soil seed bank of the invasive Robinia pseudoacacia in planted Pinus nigra stands by Cseresnyes, Imre; Csontos, Peter (2012) - If this applies for black locust, then the ratio of viable seeds in the lower soil layer compared to the total amount of soil seed bank should be increased under older tree individuals. 2. Average densities of soil seed bank in the upper (0–6 cm) and lower (6–12 cm) soil layers under Robinia pseudoacacia trees growing in Pinus nigra stands, in Hungary. Keywords: bank; black; density; layer; locust; pine; pseudoacacia; robinia; seed; seed bank; soil; stands; tree
• The nutritive value and role of Panicum turgidum Forssk. in the arid ecosystems of the Egyptian desert by Heneidy, Selim Z.; Halmy, Marwa Waseem (2009) - Description of the sampling sites from which P. turgidum populations were collected, the relative accessibility of the above-ground parts and the relative abundance of P. turgidum in each site (*cc= very common, c; common). In the pres- ent study, Ca/P ratio ranged from 3.36 in P. turgidum populations collected from Wady El-Natrun to 5.71 in those of South Sinai; this low Ca/P ratio gives a further reason for the introduction of P. turgidum as a natural forage plant in the western Mediterranean region. Keywords: content; crude; desert; energy; nutritive; populations; protein; regions; sandy; soil; tab; turgidum; value; variation
• Interactions between leaf macro, micronutrients and soil properties in pistachio (Pistacia vera L.) orchards by Koukoulakis, Prodromos; Chatzissavvidis, Christos; Papadopoulos, Aristotelis; Pontikis, Dimitrios (2013) - Percent elemental contribution values by the interactions among i) soil properties and leaf nutrients, ii) leaf nutrients, iii) soil properties and soil nutrients, and iv) soil nutrients. Studying these results, the following may be concluded: the interactions between soil nutrients and soil properties play a significant role in supplying or decreasing the soil available plant nutrients, and therefore, they determine to a great extent the level of soil fertility. Keywords: interactions; nutrients; pistachio; soil

• Unusual thylakoid structures appearing during degradation of the photosynthetic apparatus in chloroplasts by Wrischer, Mercedes; Prebeg, Tatjana; Magnus, Volker; Ljubesic, Nikola (2009) - Membrane coils and cup-shaped membrane stacks were found in bleaching leaves of quite different plants. The first type of degradation is characterized by coiling of single thylakoids and by cup-shape stacking of grana thylakoids. Keywords: bleaching; degradation; grana; leaves; ljube[i; plastids; thylakoids; wrischer
• Russian wheat aphid causes greater reduction in phloem transport capacity of barley leaves than bird cherry-oat aphid. by Saheed, Sefiu Adekilekun; Jonsson, Lisbeth M.V.; Botha, Christiaan E.J. (2010) - 2H, J) to a much greater extent than observed in BCA infested leaves (Figs. NIELSEN et al. (1990) have reported the dis- ruption of assimilate transport when the Potato leafhopper (Empoasca fabae) feeds on Medicago sativa (alfalfa). Keywords: aphid; bca; botha; feeding; leaves; phloem; rwa; transport
• Taxonomic notes on the genus Chaenorhinum (Plantaginaceae) in Turkey by Zare, Golshan; Ozudogru, Baris; Ergan, Gokhan; Tavsanoglu, Cagatay (2018) - Characters C. rubrifolium C. gerense Height (cm) 4-22 2.5-12 (25) Basal leaves Leaves subsessile, ovate to ovate-oblong Leaves petiolate, elliptic-ovate Basal leave size (mm) 7-25 × 5-11 8-12 × 3-4 Pedicels (mm) 5-15, erect 3-10, ascending Flower Erect Patent Corolla colour White with violet upper lip Cream with red batch in upper lip Corolla size (mm) 8.5-10.5 5-7(9) In this study, the accuracy of the taxonomic status of this species, which was initially reported by P.H. Davis as C. rubrifolium from south eastern Turkey, is discussed and the typical representatives of C. rubrifolium were collected for the first time for Turkey from Muğla province, southwestern Anatolia. Keywords: calyx; chaenorhinum; davis; gerense; leaves; rubrifolium; seeds; species; turkey
• Physiology and biochemistry of leaf bleaching in prematurely aging maple (Acer saccharinum L.) trees. II. Functional and molecular adjustment of PSII. by Lepedus, Hrvoje; Begovic, Lidija; Mlinaric, Selma; Simic, Domagoj; Uzarevic, Zvonimir; Stolfa, Ivna; Paradikovic, Nada; Jurkovic, Vlatka; Cesar, Vera (2011) - Also, bleached leaves had lower levels of chlorophyll a, chlorophyll b, total carotenoids and Fv/Fm value (maximum quantum yield of photosystem II) than green leaves. Results Total chlorophyll (Chl a+b) concentration, protochlorophyllide (PChl) concentration and total chlorophyll to protochlorophyllide ratio in green leaves were significantly higher (72 %) than in bleached leaves (Tab. 2). Keywords: bleached; chlorophyll; et al; fluorescence; green; leaves; maple; psii; reaction; tab
• Effect of different substrates on in vitro symbiotic seed germination for soilless production of Anacamptis laxiflora orchid by AYTAR, Erdi Can; Özdener Kömpe, Yasemin (2023) - Against these threats, seedling production by in vitro and ex vitro symbiotic seed germination with compat- ible fungi seems to be a very favourable method for the propagation and reintroduction success of temperate or- chids (Aewsakul et al. 2013, Mutlu and Kömpe 2021, Deniz et al. 2022). Ex vitro symbiotic seed germination After determining that the most effective substrate for total germination and seedling growth in in vitro conditions was young hazelnut leaves, this substrate was also used in ex vitro germination medium. Keywords: et al; germination; laxiflora; leaves; medium; mom; orchid; seed; substrates; sucrose; vitro

• Variability of pollen aperture heteromorphism in annual pansies (Viola Section Melanium) by Magrini, Sara; Scoppola, Anna (2015) - Still, 4-ap- erturate pollen grains were also observed by other authors (ERDTMAN 1952, DAJOZ et al. 1995, ESPEUT 1999). For each species, microphotographs of pollen grains were taken using a digital camera, Fujifi lm FinePix S2980. Keywords: aperturate; grains; owers; pollen; species; viola
• Embryological features, pollen and seed viability of Arnica montana (Asteraceae) – a threatened endemic species in Europe by Yankova-Tsvetkova, Elina Petrova; Yurukova-Grancharova, Petka; Baldjiev, Georgi; Vitkova, Antonina (2016) - Pollen of Arnica montana analyzed by acetocarmine test: A) mature pollen grains without acetocarmine staining, B) viable pollen grains, stained in red, C) tricolporate viable pollen grain, stained in red, D) unviable, unstained pollen grain. Pollen and seed viability After acetocarmine staining, the cytoplasm and nuclei of viable pollen grains were stained in red while unviable, empty and shrunken pollen grains remain unstained (Figs. Keywords: arnica; asteraceae; embryo; fig; montana; pollen; seed; species; study; viability
• Pollen Moprhology of Turkey species from the section Cicercula (Medic) Gren. & Godr. (genus Lathyrus, Fabaceae) in the Thrace region (Turkey-in-Europe) by Gunes, Fatma; Cirpici, Ali (2010) - pilosus C. C. Townsend, L. cicera L. and L. hirsutus L. Pollen morphology of some Lathyrus species (L. undulatus Boiss., L. sylvestris L., L. ochrus (L.) DC.) of Istanbul area (In Tukish). Keywords: acetolysis; colpus; lathyrus; pollen; reticulate; wodehouse
• Chromosome count, meiotic abnormalities and pollen sterility in Lahaul Sweetvetch (Hedysarum astragaloides Benth. ex Baker, Fabaceae), an endemic and threatened species from India by Kumar, Puneet; Rana, Pawan Kumar; Singhal, Vijay Kumar; Singh, Harminder; Kholia, Bhupendra Singh (2018) - All these anomalies are highly pernicious to reproduc- tive success of such species. So it is suggested here that such species must be considered at priority during con- servation programmes of Himalayan plants. Keywords: chromatin; chromosome; india; number; pmcs; pollen; species
• A cytogenetic and pollen study of annual Medicago species from Soummam Valley (Northeastern of Algeria) by Djafri-Bouallag, Linda; Ourari, Malika; Sahnoune, Mohamed (2019) - Souza, M. M., Pereira, T. N. S., 2011: Meiotic behavior in wild and domesticated species of Passiflora. Materials and methods Eight annual species, namely M. truncatula Gaertn., M. littoralis Rohde ex Lois., M. intertexta (L.) Miller, M. ciliaris (L.) Krocker, M. arabica (L.) Huds., M. polymorpha L., M. laciniata (L.) Miller and M. minima (L.) Bart. were sampled from wild populations of the Soummam Valley and neigh- borhoods (Northeastern Algeria). Keywords: chromosome; cytomixis; et al; laciniata; lesins; littoralis; medicago; pollen; polymorpha; species; truncatula; viability
• Morphology, anatomy, palynology and achene micromorphology of Bellis L. (Asteraceae) species from Turkey by Karahan, Faruk (2020) - Materials and methods The materials of this study includes 22 specimens be- longing to 3 populations of B. annua, 102 specimens be- longing to 15 populations of B. perennis and 32 specimens belonging to 4 populations of B. sylvestris that were collected from 22 different localities in Turkey during their flowering and fruiting time, between 2014 and 2016 (Tab. 1). Roots of B. perennis and B. sylvestris are perennial while root of B. annua is annual. Keywords: a.s.l; annua; b. annua; b. perennis; b. sylvestris; bellis; fig; hmku; morphology; pollen; species; turkey
• Flowering phenology and airborne pollen occurrence of Corylus and Castanea in Trieste (Italy), 1991-2004 by Rizzi Longo, Loredana; Pizzulin Sauli, Marialuisa (2010) - 2. Flowering and pollen seasons of Corylus in Trieste at station TS1 (1991–2004). EMBERLIN, J., DETANDT, M., GEHRIG, R., JÄGER, S., NOLARD, N., RANTIO-LEHTIMÄKI, A., 2002: Responses in the start of Betula (birch) pollen seasons to recent changes in spring temperatures across Europe. Keywords: castanea; corylus; flowering; longo; mean; pollen; rizzi; season; trieste
• A morphological, anatomical and palynological study of Aethionema lepidioides (Brassicaceae) - an endangered species endemic to Turkey by Tekin, Mehmet (2022) - İnceoğlu and Karamustafa (1977) studied the pollen properties of Ae. arabicum and Ae. armenum with a light microscope. Atçeken et al. (2016) studied the pollens of Ae. arabicum, Ae. cordatum, Ae. karamanicum and Ae. armenum. Keywords: aethionema; brassicaceae; cell; epidermis; fig; lepidioides; pollen; seed; species; study
• Morpho-palynological assessment of the genus Terminalia L. (Combretaceae) in Egypt by Taia, Wafaa Kamal; Hamdy, Rim Samir; Abd El-Maged, Amany Mohamed (2024) - 83 (2), 2024 dimorphic species were represented by T. bellirica, T. brownii, T. chebula, T. laxiflora, T. myriocarpa and T. sericea; indi- cating that they have two distinct pollen shapes, sizes, apertures, and even exine ornamentation within the pollen grains that are gathered from the same flower. In the equatorial view, they were spheroidal (T. bellirica, T. bentzoe, T. chebula, T. mantaly and T. sericea), subprolate (T. arjuna, T. bellirica, T. brownii, T. chebula, T. laxiflora, T. muelleri, T. myriocarpa and T. sericea) and prolate (T. brownii, T. catappa, T. laxiflora and T. myriocarpa). Keywords: exine; ornamentation; pollen; shape; species; terminalia
• Pollen studies in the genus Viola (Violaceae) from Iran by Saeidi Mehrvarz, Shahryar; Yousefi, Narjes; Mohammadi, Maryam; Marcussen, Thomas (2014) - The two Iranian species of Section Spathulidium are morphologically similar but can be easily separated using palynological characters: V. pachyrrhiza has perforate exine (Fig. 4D), whilst V. spathulata has granulate exine ornamentation (Figs. 4E–F). Previously these species, i.e.. V. pachyrrhiza and V. spathulata were included in section Plagiostigma subsection Patellares (as section Keywords: iran; pollen; section; species; viola

• Comparison of anti-Aspergillus activity of Origanum vulgare L. essential oil and commercial biocide based on silver ions and hydrogen peroxide by Savkovic, Zeljko; Stupar, Milos; Ljaljevic Grbic, Milica; Vukojevic, Jelena (2016) - Castellano, J. J., Shafi i, S. M., Ko, F., Donate, G., Wright, T. E., Mannari, R. J., Payne, W. G., Smith, D. J. et al., 2007: Com- parative evaluation of silver-containing antimicrobial dress- ings and drugs. As a result of O. vulgare EO activity, morpho- physiological changes in A. fl avus were showed by Souza et al. (2010). Keywords: activity; aspergillus; biocide; et al; s003; sanosil; vulgare
• Biological activity of red alga Laurencia brandenii by Manilal, Aseer; Sujith, Sugathan; Sabarathnam, Balu; Kiran, George S.; Selvin, Joseph; Shakir, Chippu; Lipton, Aaron P. (2011) - To this day, information regarding biological activities of flora and fauna from the southwest coastline of India (Kollam coast) remains scanty. o ujak 2011 16:13:51 Color profile: Disabled Composite 150 lpi at 45 degrees ed for biological activities (data not shown). Keywords: acid; activity; brandenii; fraction; laurencia; marine

• Species delimitation and relationship in Crocus L. (Iridaceae) by Sheidai, Masoud; Tabasi, Melica; Mehrabian, Mohammad-Reza; Koohdar, Fahimeh; Ghasemzadeh-Baraki, Somayeh; Noormohammadi, Zahra (2018) - Hickory: a package for anal- ysis of population genetic data V1.0. Crocus species have horticultural, medicinal and pharmacological importance. Keywords: crocus; crocus species; diversity; flow; gene; issr; populations; sativus; species; structure
• Application and limitation of molecular data and essential oil content in identification of Leutea elbursensis Mozaff in northern Iran by Emami-Tabatabaei, Samane Sadat; Larijani, Kambiz; Mehregan, Iraj (2018) - We also aim to study the possible cor- relation between the genetic structure and the essential oil profile of L. elbursensis populations collected from different localities in northern Iran (Tehran province), using GC/MS and AFLP fingerprinting techniques. Journal of Essential Oil Research 16, 143–144. Mehregan, I., Ghannadi, A., 2013: Essential oil analysis of Haussknechtia elymaitica Boiss fruits, an endemic plant from Iran. Keywords: elbursensis; et al; ferula; iran; leutea; oils; petiolaris; pimenov; populations; species
• Genetic variability and distance between Lactuca serriola L. populations from Sweden and Slovenia assessed by SSR and AFLP markers by Jemelková, Michaela; Kitner, Miloslav; Krístková, Eva; Dolezalová, Ivana; Lebeda, Ales (2018) - Two primary morphological forms are recognized with- in L. serriola L. based on cauline leaf-shape variability; the pinnatifid-leaved form L. serriola L. f. serriola, and the un- lobed-leaved form L. serriola L. f. integrifolia (S.F. Gray) S.D. Prince et R. N. Carter. 1. Microsatellite (SSR) loci used to assess genetic variability in Lactuca sativa L. and L. serriola L.; NA – number of alleles; PIC – allelic polymorphic information content. Keywords: aflp; doležalová; et al; lactuca; lactuca serriola; lebeda; lettuce; populations; samples; serriola; sweden
• Preliminary characterization of the Quercus pubescens complex in southern Italy using molecular markers by Di Pietro, Romeo; Di Marzio, Piera; Antonecchia, Gaby; Conte, Antonio Luca; Fortini, Paola (2020) - Acknowledgments The authors wish to acknowledge G. Vendramin for his critical discussion of the preliminary results of the paper and P. Medagli, G. Misano, G. Silletti, V. Viscosi, R.P. Wagensom- mer for their help in collecting oak populations. It is very probable that during the climatic oscillations that took place during the Quater- nary, environmental situations favorable to the development of mixed forests of Q. robur and Q. pubescens s.l. were cre- ated several times with consequent hybridization or intro- gression between these two species. Keywords: alleles; et al; heterozygosity; individuals; italy; loci; number; oak; oaks; populations; pubescens; quercus; species
• Leaf phenotypic plasticity of European ash (Fraxinus excelsior) at its northern range in Dinaric Alps by Vidaković, Antonio; Matijašević, Sandi; Tumpa, Katarina; Poljak, Igor (2025) - However, this research revealed no influ- ence of geographical or bioclimatic distances on morphological variability, which indicates that the rockiness and soil are most likely two predominant factors in shaping the phenotypic plasticity of European ash populations. The K-means method was applied to detect phenotypic structure and define the number of K-groups that best explained the morphological variation of European ash populations. Keywords: ash; european; excelsior; fraxinus; la1; leaflet; length; populations; species; terminal; traits; variability

• Influence of dehydration on cryopreservation of Musa spp. germplasm by Kaya, Ergun; Galatali, Selin; Souza, Fernanda Vidigal Duarte; Santos-Serejo, Janay Almeida (2020) - This capability can be lost during seed germination. Vineesh, P.S., Skaria, R., Mukunthakumar, S., Padmesh, P., Decruse, S.W., 2015: Seed germination and cryostorage of Musa acumi- nata ssp. Keywords: acuminata; content; cryopreservation; dehydration; germination; moisture; musa; seeds; spp
• Breaking of dormancy in the narrow endemic Jasione supina Sieber subsp. supina (Campanulaceae) with small seeds that do not need light to germinate by Güleryüz , Gürcan ; Kırmızı , Serap; Arslan, Hülya ; Güleryüz, Elif (2021) - Many researches have recently been focused on the effect of global climate change on alpine plant species as their phenology, seed germination, seedling establishment, and distribution areas are negatively affected (for details see Briceño et al. 2015, Giménez-Benavides et al. 2018). Light requirement for seed germination especially small size seeds is an important parameter for evaluating the ger- mination properties of plants (Fenner and Thompson 2005). Keywords: chilling; dark; germination; light; moist; seeds; species; supina
• Overcoming seed dormancy and improving germination of Convolvulus persicus, an endangered coastal plant in north of Iran by Bahadornejad Velashedi, Razieh; Kelij, Sedigheh; Jafari, Naser (2025) - The next critical step in identifying seed dormancy is to assess seed germination across varying temperature condi- tions (Baskin and Baskin 1998). 2. Effect of temperature on seed germination of Convolvulus persicus from two localities in the Mazandaran province of Iran. Keywords: baskin; dormancy; ga3; germination; percentage; persicus; sari; scarification; seed; stratification; treatments
• Germination characteristics of Salicornia patula Duval-Jouve, S. emerici Duval-Jouve, and S. veneta Pign. et Lausi and their occurrence in Croatia by Sajna, Nina; Regvar, Marjana; Kaligaric, Simona; Škvorc, Željko; Kaligaric, Mitja; Kaligaric, Mitja (2013) - [%] Conditions: dH2O Salinity (340 mM NaCl) S. emerici S. veneta S. patula S. emerici S. veneta S. patula 1 7.5/2.5 2.5/0 5/0 5/0 0/0 0/0 2 17.5/7.5 20/7.5 5/0 7.5/0 7.5/0 0/0 3 20/10 30/10 30/0 7.5/0 10/0 5/0 4 22.5/10 35/12.5 90/0 7.5/0 10/0 10/0 5 22.5/10 35/12.5 90/0 7.5/0 10/0 10/0 6 25/20 40/15 95/0 7.5/0 10/0 10/0 7 25/30 47.5/30 100/5 7.5/0 10/0 25/5 8 27.5/32.5 50/32.5 100/5 7.5 20/0 25/5 9 37.5/50 52.5/57.5 100/5 12.5 20/0 25/5 10 37.5/50 52.5/57.5 100/5 12.5 20/0 25/5 11 40/50 52.5/57.5 100/5 12.5 22.5/2.5 25/5 12 40/52.5 52.5/60 100/5 12.5 22.5/2.5 30/5 13 40/52.5 52.5/60 100/5 12.5 22.5/2.5 30/5 14 40/55 52.5/60 100/5 15 22.5/2.5 30/5 15 40/57.5 52.5/65 100/5 15 22.5/2.5 30/5 16 40/57.5 52.5/67.5 100/5 15 22.5/2.5 30/5 17 40/57.5 52.5/67.5 100/5 15 22.5/2.5 30/5 18 40/57.5 55.5/70 100/5 15 22.5/2.5 30/5 in saline conditions (Fig. 2c). In: WEBB, D. A. (Ed.), Flora Europea, 1. Cambridge Uni- versity Press, London. BEER, S. S., BEER, A. S., SOKOLOFF, D. D., 2010: Flower and inflorescence development in Salicornia (Chenopodiaceae). Keywords: emerici; germination; patula; s. emerici; s. veneta; salicornia; seeds; species; veneta

• Antibacterial, cytotoxic and trypanocidal activities of marine-derived fungi isolated from Philippine macroalgae and seagrasses by Notarte, Kin Israel; Yaguchi, Takashi; Suganuma, Keisuke; dela Cruz, Thomas Edison (2018) - Key words: bioactivity, fungal natural products, marine fungi, Philippines Abbreviations: ASW – artificial seawater; DMSO – dimethyl sulfoxide; MDF – marine-derived fungi; MEA – malt extract agar; MEAS – malt extract agar with marine salt; MEB – malt extract broth; MEBS – malt extract broth with marine salt; PDB – potato dextrose broth; PDBS – potato dextrose broth with marine salt; ZOI – zone of inhi- bition * Corresponding authors, e-mails: kinotarte@gmail.com, tedelacruz@ust.edu.ph Introduction The ocean has vast biological resources, accounting for more than eighty percent of total world biodiversity, which makes it a reservoir for many kinds of organisms, including marine-derived fungi (Bugni and Ireland 2004). 77 (2), 2018 149 to their taxonomic and metabolic diversity, marine organ- isms including marine fungi are now considered ideal sourc- es of new secondary metabolites (Schulz et al. 2008). Keywords: aspergillus; bioactive; broth; culture; extracts; fumigatus; fungi; marine; mdf; ml–1; salt; tubingensis

• Phototrophic biofilms and microbial mats from the marine littoral of the central Mediterranean by Zammit, Gabrielle; Schembri, Sarah; Fenech, Mark (2021) - 80 (1), 112–116, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2020-031 ISSN 0365-0588 eISSN 1847-8476 Short communication Phototrophic biofilms and microbial mats from the marine littoral of the central Mediterranean Gabrielle Zammit1,2*, Sarah Schembri1,2, Mark Fenech1,2 1 Laboratory of Applied Phycology, Centre for Molecular Medicine and Biobanking, University of Malta, Msida, Malta 2 Microbiology Lab, Department of Biology, Faculty of Science, University of Malta Abstract – Phototrophic biofilm and microbial mat communities grow along the rocky coastline of the Maltese is- lands. In submerged areas, such as undisturbed rock pools, these progressively formed green or brown compact biofilms, some of which thickened over the spring to form microbial mats via the production of more extensive EPS layers. Keywords: biofilms; communities; fig; filaments; mats; microorganisms; rock

• Assessment of the genetic relationship of Turkish olives (Olea europaea subsp. europaea) cultivars based on cpDNA trnL-F regions by Kaya, Ergun; Vatansever, Recep; Filiz, Ertugrul (2018) - Pairwise-comparison of Turkish olive cultivars In order to have insights about the genetic relationships of Turkish olives, pairwise similarity and difference com- parisons of trnL-F sequences were conducted. Materials and methods Plant materials and genomic DNA isolation Seven cultivated Turkish olive cultivars (O. europaea sub- sp. europaea var. Keywords: cultivars; europaea; olea; olive; sequences; subsp; trnl
• Erigeron acris L. subsp. angulosus (Gaudin) Vacc. (Asteraceae), a new taxon in the flora of Poland by Pliszko, Artur (2018) - One of the most reliable diagnostic charac- ters that allows E. acris subsp. acris, E. acris subsp. Keywords: acris; acris subsp; angulosus; erigeron; poland; subsp
• Phenolic compounds in two subspecies of Drypis spinosa L. (Caryophyllaceae) in Croatia by Kremer, Dario; Košir, Iztok Jože; Potočnik, Tanja; Rogulj, Nikolina; Načinovic, Karla; Randić, Marko; Srečec, Siniša; Jurišić Grubešić, Renata (2021) - spinosa and D. spinosa subsp. The aim of this study is to gain an insight into the con- tent of phenolic compounds in D. spinosa subsp. Keywords: acid; compounds; content; d. spinosa; jacquiniana; phenolic; spinosa; spinosa subsp; subsp
• A new subspecies of Cephalaria pastricensis Dörfl. & Hayek (Dipsacaceae) from North Macedonia by Teofilovski, Aco (2023) - They represent the southernmost points in the dis- tributional range of C. pastricensis s.l., situated significant- ly closer to the localities of C. pastricensis subsp. These characteristics are rather uniform in the recorded populations, with none of the col- lected individuals or ca 30 examined in the field matching or approaching C. pastricensis subsp. Keywords: cephalaria; macedonia; north; pastricensis; pastricensis subsp; subsp; teofilovski
• Foliar epidermis morphology in Quercus (subgenus Quercus, section Quercus) in Iran by Jamzad, Ziba; Panahi, Parisa; Pourmajidian, Mohammad R.; Fallah, Ashgar; Pourhashemi, Mehdi (2012) - 71 (1), 95–113, 2012 CODEN: ABCRA25 ISSN 0365–0588 eISSN 1847-8476 Foliar epidermis morphology in Quercus (subgenus Quercus, section Quercus) in Iran PARISA PANAHI1, 2, ZIBA JAMZAD2*, MOHAMMAD R. POURMAJIDIAN1, ASGHAR FALLAH1, MEHDI POURHASHEMI3 1 Department of Forestry, Sari Agricultural Sciences and Natural Resources University, P.O.Box: 737, Sari, Iran 2 Botany Research Division, Research Institute of Forests and Rangelands of Iran, P.O.Box: 013185-116, Tehran, Iran 3 Forest Research Division, Research Institute of Forests and Rangelands of Iran, P.O.Box: 13185-116, Tehran, Iran Abstract – The foliar morphology of trichomes, epicuticular waxes and stomata in Quercus cedrorum, Q. infectoria subsp. pedunculiflora (F), Q. cedrorum (G), Q. infectoria subsp. Keywords: boissieri; fig; infectoria subsp; iran; q. infectoria; quercus; species; stomata; subsp; surface; trichomes; var
• Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey by Ozkan, Mustafa; Aktas, Kamuran; Ozdemir, Canan; Guerin, Greg (2009) - ZHOU, S. L., PAN, K. Y., HONG, D. Y., 1997: 68 (1), 105–115, 2009 CODEN: ABCRA25 ISSN 0365–0588 Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey MUSTAFA ÖZKAN 1, KÂMURAN AKTASz2*, CANAN ÖZDEMIR 2, GREG GUERIN 3 1 Ahi Evran University, Faculty of Art and Science, Department of Biology, Kirsehir, Turkey 2 Celal Bayar University, Faculty of Art and Science, Department of Biology, Manisa, Turkey 3 Western Australian Herbarium, Department of Environment and Conservation, Adelaide, Australia The nutlet (mericarp) morphology of 12 Salvia L. (Lamiaceae: sub-family Nepetoideae: tribe Mentheae: sub-tribe Salviinae) taxa from Turkey, including five endemic taxa, was examined using scanning electron microscopy: Salvia bracteata Banks et Sol., S. cadmica Boiss., S. blepharoclaena Hedge et Hub.-Mor., S. cryptantha Montbret et Aucher ex Bentham, S. aethiopis L, S. ceratophylla L., S. candidissima Vahl subsp. Keywords: lamiaceae; mericarps; salvia; species; subsp; verticillata

• Middle Miocene record of Pliocaenicus changbaiense sp nov. from Changbai (Jilin Province, China) by Stachura-Suchoples, Katarzyna; Jahn, Regine (2009) - In P. changbaiense the number of costae in 10 mm is similar to P. cathayanus and P. jilinensis, and in the lowest range to P. omarensis. This character differentiates P. omarensis from P. changbaiense. Keywords: costae; face; fultoportulae; mantle; pliocaenicus; stachura; suchoples; valve
• The morphological study of Chaetoceros wighamii Brightwell (Chaetocerotaceae, Bacillariophyta) from Lake Vrana, Croatia by Bosak, Suncica; Gligora Udovic, Marija; Sarno, Diana (2015) - Spines adorning setae in C. wighamii are tightly arranged around the axis and appear slightly longer and more silicifi ed compared to the spines present in other species, as, for example, Chaetoceros curvisetus or C. lauderi (KOOISTRA et al. 2010, EVENSEN and HASLE 1975).The details on chloroplast number, shape and position have not been known previ- ously in Chaetoceros wighamii syn C. amanita, as the previous observations were based mostly on cleaned material (KACZMARSKA et al. 1985, SANCHEZ CASTILLO et al. 1992). SANCHEZ CASTILLO et al. (1992) discussed the identity of C. wighamii in relation with the taxa traditionally associated to it, i.e. C. amanita, C. bottnicus, C. biconcavum and C. cap- sicum. Keywords: amanita; chaetoceros; et al; freshwater; lake; setae; species; valve; vrana; wighamii
• Variability of the pennatae diatom Gomphonema ventricosum Gregory from far eastern lakes by Yoshitake, Sakiko; Fukushima, Hiroshi; Kimura, Tsutomu; Lepskaya, Ekatarina V.; Ko-Bayashi, Tuyako (2009) - We classified the specimens into five types with respect to valve outline; (1) type A (type form of Gomphonema ventricosum), (2) type B (Lake Baikal type), (3) type C (Lake Karluk type), (4) type D (Gomphoneis septa type) and (5) type E (G. ventricosum f. curta type). Yokosuka, Kanagawa, Japan 2 Institute of Phycology, 2-3-10 Uraga Kanagawa, Japan 3 Kamchatka Institute for Fisheries Research and Oceanography, Peteropavlovsk-Kamchatsky, Russia, 683000 The present study examined by light microscope the morphological variations of 625 specimens of Gomphonema ventricosum Gregory collected from Lake Hövsgöl (Mongo- lia), Lake Baikal (Russia) and Lake Kurilskoye (Kamchatka, Russia). Keywords: baikal; hövsgöl; kurilskoye; lake; specimens; type; valve; ventricosum
• Three new species of Cymbella (Bacillariophyta) from high altitude lakes, China by Hu, Zhuju; Li, Yanling; Metzeltin, Ditmar (2013) - The internal view of C. heihainensis and C. shudunensis should be supplemented in future study. The most similar taxon is C. modicepunctata: it has larger valve size, bigger central area, and more striae in 10 mm, distinguishing it from C. heihainensis. Keywords: area; cymbella; fig; krammer; lake; raphe; species; striae; valve
• Two new Mesodictyopsis species, M. akitaensis sp. nov. and M. miyatanus sp. nov., from a Late Miocene to Pliocene freshwater sediment, Japan by Tanaka, Hiroyuki; Nagumo, Tamotsu (2009) - 33 – de- tailed view of valve face showing opening of valve face fultoportula (large arrow), openings of two mantle fultoportulae (small arrows) and opening of rimoportula (arrowhead). 19 – oblique view of figure 18 showing opening of valve face fultoportula (arrow), opening of rimoportula (arrowhead). Keywords: face; fig; figs; mantle; mesodictyopsis; valve
• Diatom biodiversity in Mongolia: A new amphoroid diatom from saline lakes in western Mongolia, Amphora soninkhishigae sp. nov. by Edlund, Mark B.; Shinneman, Avery L.C.; Levkov, Zlatko (2009) - In most Halamphora species, the proximal raphe endings terminate in- ternally with fused central helictoglossae, except in A. chilensis (SALAet al. 2007), whereas in Amphora sensu stricto (i.e. subgenus Amphora Cleve) each raphe branch terminates with separate central helictoglossae (see KRAMMER 1980). NAGUMO, T., 2003: Taxonomic studies of the subgenus Amphora Cleve of the genus Am- phora (Bacillariophyceae) in Japan. Keywords: amphora; cleve; dorsal; edlund; fig; lakes; levkov; mongolia; raphe; shinneman; soninkhishigae; valve

• Species delimitation and genetic diversity analysis in Salvia with the use of ISSR molecular markers by Safaei, Masoumeh; Sheidai, Masoud; Alijanpoor, Behnaz; Noormohammadi, Zahra (2016) - Salvia species are herbaceous, suffruticose or shrubby perennials, rarely biennial or annual, often strongly aromat- ic. In addition, Salvia species are grown in parks and gardens as ornamental plants (Özdemir and Senel 1999). Keywords: analysis; hsbu; hypoleuca; issr; length; salvia; salvia species; species; structure
• Validation of variants using cost effective high-resolution melting (HRM) analysis predicted from target re-sequencing in Eucalyptus by Ghosh Dasgupta, Modhumita; Parveen, Abdul Bari Muneera; Lakshmanan, Divya (2020) - The advantages of HRM analysis include reduced risk of cross contami- nation and decreased analytical time. To our knowledge, no reports on the use of HRM analysis for confirmation of vari- ants (SNPs/ InDels/ SSRs) are reported in forest tree species, including Eucalyptus. Keywords: analysis; curve; dna; et al; eucalyptus; fig; genotyping; hrm; hybrids; melting; parents; resolution; sequence; sequencing; snp; t c; true&cauthor_uid=15338605

• Genetic diversity of Potamogeton pectinatus L. in Iran as revealed by ISSR markers by Abbasi, Shabnam; Afsharzadeh, Saeed; Saeidi, Hojjatollah (2017) - 76 (2), 177–182, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0008 ISSN 0365-0588 eISSN 1847-8476 Genetic diversity of Potamogeton pectinatus L. in Iran as revealed by ISSR markers Shabnam Abbasi1, Saeed Afsharzadeh2*, Hojjatollah Saeidi3 Department of Biology, University of Isfahan, 81746-73441, Isfahan, Iran Abstract – Potamogeton pectinatus L. is a widespread aquatic species distributed widely in aquatic ecosys- tems of Iran. Analysis of molecular variance (AMO- VA) was performed to calculate the proportion of intra-ac- cession and inter-accession genetic diversity using Genalex 6.5 software. Keywords: accessions; diversity; iran; issr; pectinatus; pot; potamogeton; river; species
• Climatic drivers of dry grassland phylogenetic diversity in the Republic of Macedonia by Batalha, Marco Antonio; Custerevska, Renata; Matevski, Vlado (2019) - Since our data was non-normally distributed, heteroscedastic, and with outliers, instead of applying ordinary least square regression, we applied robust regression (Huber and Ron- chetti 2009), with phylogenetic species richness as response variable, the six climatic variables as explanatory ones, and the bisquare algorithm as the weighting function. When regressing phylogenetic species richness against the climatic variables, we found positive relationships with isothermality and an- nual precipitation and negative relationships with mean tem- perature of the driest quarter and precipitation seasonality (Tab. 1). Keywords: bio; climate; community; diversity; et al; macedonia; mean; species; temperature

• Morpho-chemical divergence and fatty acid profile of shea tree seeds (Vitellaria paradoxa) collected from different locations in Kwara State, Nigeria by Animasaun, David Adedayo; Oyedeji, Stephen; Olorunmaiye, Kehinde Stephen; Azeez, Musibau A; Tijani, Idowu Abdulfatah; Morakinyo, Joseph Akintade (2019) - 78 (1), 17–24, 2019 CODEN: ABCRA 25 DOI: 10.2478/botcro-2019-0002 ISSN 0365-0588 eISSN 1847-8476 Morpho-chemical divergence and fatty acid profile of shea tree seeds (Vitellaria paradoxa) collected from different locations in Kwara State, Nigeria David Adedayo Animasaun1*, Stephen Oyedeji1, Kehinde Stephen Olorunmaiye1, Musibau A. Azeez2*, Idowu Abdulfatah Tijani3, Joseph Akintade Morakinyo1 1 Department of Plant Biology, Faculty of Life Sciences, University of Ilorin, Ilorin, Kwara State, Nigeria 2 Department of Pure and Applied Biology, Ladoke Akintola University of Technology, Ogbomoso, Oyo State, Nigeria 3 Department of Chemical Engineering, University of Ilorin, Ilorin, Kwara State, Nigeria Abstract – The present study characterizes seed-related traits, phytochemical, physiochemical parameters and fatty acid profile of shea (Vitellaria paradoxa) seeds collected from the Kosubosu, Fufu and Sare areas of Kwara State, Nigeria to determine the effects of microclimate on seed morphology, biochemical and oil constituents. Morphological seed related characters of shea tree seeds collected from different locations in Kwara State, Nigeria: (a) Kosubosu, Baruten, (b) Fufu, Ilorin West, (c) Sare, Ifelodun. Keywords: acid; butter; fatty; fruit; journal; kosubosu; locations; nigeria; nut; oil; paradoxa; seed; shea; tree
• Diversity in common bean landraces from south Brazil by Pereira, Tamara; Coelho, Cileide M. M.; Bogo, Amauri; Guidolin, Altamir F.; Miquelluti, David J. (2009) - Results have been published for common bean seed development with evidence that phytate synthesis has regulation points with MIPS (myo-inositol-3-phosphate synthase) enzyme. We thank Dr Heloisa Torres da Silva (EMBRAPA-CNPAF, Brazil) that provided bean seed samples used as con- trols of phaseolin type. Keywords: bean; common; genotypes; landraces; phaseolin; protein; seed; type
• About the occurrence of Elatine macropoda and E. gussonei (Elatinaceae) in Sicily and lectotypification of their names by Brullo, Salvatore; Brullo, Cristian; Tavilla, Gianmarco; Cambria, Salvatore; Minissale, Pietro; Sciandrello, Saverio; Giusso del Galdo, Gianpietro; Siracusa, Giuseppe; Del Guacchio, Emanuele (2022) - In fact, based on our observations, E. gussonei (Lampedusa and Malta) is morphologically distinct from the typical E. macropoda of the Hyblaean territory, especially on account of the petals (equalling or slightly longer than sepals), while in E. macropoda petals are always very reduced (Fig. 7). 1J-K), in our opinion, cannot be attributed to E. gussonei but rather to E. macropoda, showing flowers with petals subequal to sepals. Keywords: brullo; elatine; gussonei; lampedusa; macropoda; s.n; seed; sicily; sommier; species

• Historical abundance and morphology of Didymosphenia species in Naknek Lake, Alaska by Pite, Danielle P.; Lane, Kelly A.; Hermann, Anna K.; Spaulding, Sarah A.; Finney, Bruce P. (2009) - The second objective of this paper is to examine the morphology of D. geminata cells preserved in sediments dating to 800 years B.P. and compare valve shape to modern, bloom-forming populations of D. geminata from around the world. 2. Mean, standard deviation and number of D. geminata valves measured for valve length, width, footpole width, footpole constriction, headpole width, and headpole constriction (all in mm) for Naknek Lake, Matapédia River (Québec), Popo Agie River (Wyoming), Blue River (Colorado) and Waiau River (New Zealand). Keywords: abundance; didymosphenia; footpole; geminata; headpole; lake; naknek; river
• Applied use of taxonomy: lessons learned from the first German intercalibration exercise for benthic diatoms by Dreßler, Mirko; Verweij, Geurt; Kistenich, Sonja; Kahlert, Maria; Werner, Petra (2015) - In the Lake Krossinsee sample the three auditors identifi ed N. cryptotenella with 5.9– 10.0% (average 8.3%) (Fig. As two auditors and most participants unambiguously identifi ed N. reichardtiana and no auditor and only fi ve participants identifi ed N. caterva, we could assume that the latter are misidentifi cations. Keywords: bertalot; cation; fig; identifi; lake; lange; participants; placentula; species; valves
• Diatoms in an extreme euxinic environment (Rogoznica Lake, eastern Adriatic coast) by Malesevic, Nikola; Ciglenecki, Irena; Bura-Nakic, Elvira; Caric, Marina; Dupcic, Iris; Hrustic, Enis; Vilicic, Damir; Ljubesic, Zrinka (2015) - Mixing of water layers is marked by arrows, months are denoted by abbreviations: J for January, A for April, J for July and O for October. Surface water could be well oxygenated (oxygen saturation up to 300%), while hypoxia/ anoxia occurs in the bottom water layer (STIPANIČEV and BRANICA 1996, CIGLENEČKI et al. 1998, 2005, 2013). Keywords: ciglenečki; conditions; et al; lake; phytoplankton; rogoznica; species

• Morphology and seed protein profile for a new species of the genus Cleome L. (Cleomaceae) from Pakistan by Riaz, Sana; Abid, Rubina; Ali, Syed Abid; Munir, Iqra; Qaiser, Muhammad (2019) - The observations were based on 5-10 specimens of C. brachycarpa, C. viscosa, and the new taxon. Cleome karachiensis S. Riaz, R. Abid and M. Qaiser: habit (A), flower (B), seed (C), type specimen (F); C. brachycarpa: seed (D), C. viscosa: seed (E). RIAZ S., ABID R., ALI S. A., MUNIR I., QAISER M. 104 ACTA BOT. Keywords: brachycarpa; cleome; fig; karachi; new; seeds; species; viscosa

• Botrychium matricariifolium, a new fern species for the flora of Montenegro by Stesevic, Danijela; Berg, Christian (2015) - These species are clearly distinguished by the lamina, which is in B. matricariifolium 2-pinnatifi d, while in B. lunaria it is 1-pinnate with trapezoid to fl abellate pinnae. Ångstr., B. lunaria (L.) Sw., B. matricariifolium (Döll) A. Braun ex W. D. J. Koch, B. multifi dum (S. G. Gmel.) Keywords: botrychium; european; matricariifolium; montenegro; species
• Two moss species from Mt Durmitor new to the bryophyte flora of Montenegro by Vulevic, Anja; Dragicevic, Snezana; Petrovic, Danka (2017) - Minjević, D., 1996: The natural landscape of Durmitor, In: Lje- šević, M. (ed.), The nature of National Park Durmitor, Special editions, Volume 8, 285–299. Papp, B., Erzeberger, P., 2010: Contributions to the bryophyte flo- ra of Durmitor National Park, Montenegro. Keywords: cirrata; durmitor; hedw; montenegro; mosses; obtusifolium; species
• Physcomitrium eurystomum Sendtn., new moss species in the bryophyte flora of Montenegro by Stesevic, Danijela; Andic, Branko; Stanisic-Vujacic, Milica (2020) - A revised Red List of bryophytes in Britain. Kučera, J., Váňa, J., 2003: Check- and Red List of bryophytes of the Czech Republic. Keywords: eurystomum; list; montenegro; red
• New records of Salicornia s.l. in Montenegro and Bosnia and Hercegovina by Stešević, Danijela; Milanović, Đorđije; Stanišić-Vujačić, Milica ; Šilc, Urban (2022) - All three taxa were recorded in the abandoned basins of Tivat Saline in Montenegro, while S. perennis was also found in the Klek Peninsula in Bosnia and Herzegovina. Accord- ing to the literature sources (Kutleša and Lakušić 1964, Kaligarič and Škornik 2007, Kaligarič et al. 2008, Stešević and Caković 2013, Barina et al. 2018, Nikolić 2020), the fol- lowing glasswort species/aggregates have been reported along the eastern Adriatic coast (SVN – Slovenia, HRV – Croatia, BIH – Bosnia and Hercegovina, MNE – Montenegro, ALB – Albania): Arthrocaulon macrostachyum (SVN, HRV, BIH, ALB), Salicornia fruticosa (SVN, HRV, BIH, MNE, ALB), S. perennis (HRV, ALB), Salicornia europaea aggr. Keywords: arthrocaulon; bosnia; macrostachyum; montenegro; perennis; procumbens; rel; salicornia
• Survey of the family Russulaceae (Agaricomycetes, Fungi) in Montenegro by Kasom, Gordana; Karadelev, Mitko (2012) - F.M.M.C., M.N.F. • Lactarius picinus Fr. Ref.: HAD@I] (1995: 23), KARAD@I] (1995: 84–85), PERI] and PERI] (1996a: 154, 1997a: 61). The first data on the family Russulaceae Lotsy were provided at the close of the 20th cen- tury (TORTI] 1974, 1988; HAD@I] 1995; KARAD@I] 1995; PERI] and PERI] 1995, 1996a, b, c, 1997a, b, 1998a, b, 1999a, b). Keywords: exs; f.m.m.c; had@i; kasom; lactarius; m.n.f; montenegro; peri; ref; russula
• Distribution of Buxbaumia viridis (Moug. ex Lam. et DC.) Brid. ex Moug. et Nestl. (Bryophyta) in Montenegro by Dragicevic, Snezana; Papp, Beata; Erzberger, Peter (2012) - It includes 8 mountainous regions: the Bjelasica Mts, Durmitor Mts, Hajla Mts, Komovi Mts, Ljubi{nja Mts, Prokletije Mts, Sinjajevina Mts and Visitor Mts (Fig. 1). Durmitor Mountain, Durmitor National Park, around Crno jezero lake at @abljak, 43°08'52,0'' N, 19°05'48,0'' E, ca 1400 m, conifer forest, on decaying trunk, leg. Keywords: buxbaumia; leg; montenegro; mts; papp; viridis
• Lichenized fungi of the chestnut grove in Livari (Rumija, Montenegro) by Mayrhofer, Helmut; Drescher, Anton; Steševic, Danijela; Bilovitz, Peter Othmar (2013) - et P. James X X X Flavoparmelia caperata (L.) Hale X X X X X Fuscopannaria mediterranea (C. Tav.) Moberg X X X Phlyctis argena (Spreng.) Keywords: ach; bilovitz; chestnut; fungi; lichen; mayrhofer; montenegro; species

• Nomenclatural notes on some annual mallows (Malvaceae) by Iamonico, Duilio (2018) - Maire, L. punctata All., and L. trimestris L. are traditionally placed in Lavatera sect. Key words: Lavatera, lectotypification, Malva, neotypification, new combination * Corresponding author, e-mail: d.iamonico@yahoo.it Introduction Molecular studies on the Malva alliance (Ray 1995, Es- cobar et al. 2009) showed that the traditional separation of the genera Malva L. and Lavatera L., based mainly on the de- gree of fusion of the epicalyx bracts, is artificial and cannot be maintained, while the taxonomic signicance of the fruit morphology was emphasized. Keywords: africana; iamonico; lavatera; lavatera trimestris; lectotype; malva; miergues; moschata; punctata; species; trimestris; var
• A taxonomic revision of the genus Glaucium (Papaveraceae) in Iran by Tavakkoli, Zahra; Assadi, Mostafa (2019) - Sepals 0.5–4 cm long; petals 1–4.5 cm long; fruiting pedi- cels exceeding the leaves subtending them ......................... .......................................................................G. grandiflorum Sepals and petals 1.5–3 cm long; fruiting pedicels shorter than the leaves subtending them ..............G. corniculatum 4. One of the diagnostic characteristics of G. corniculatum is fruiting pedicels that are shorter than their subtended leaves while a reported speci- men in Flora Iranica (Farahbakhsh 5956; deposited in IRAN herbarium) has fruiting pedicels longer than their subtended leaves as G. grandiflorum. Keywords: glabrous; glaucium; hairs; iran; petals; sepals; siliquae; species; suppl; var; young
• Trichome micromorphology in drupe of Amygdalus L. (Rosaceae) from Iran by Vafadar, Mahnaz; Attar, Farideh; Maroofi, Hosein (2010) - Among those, three spe- cies including A. haussknechtii, A. elaeagnifolia and A. reticulata, are endemic species for the flora of Iran (BROWICZ 1969, KHATAMSAZ 1992). Pericarp indumentum heterogeneity is observed in the last closely related species of this subgroup including A. elaeagnifolia and A. reticulata. Keywords: amygdalus; browicz; indumentum; iran; khatamsaz; lycioides; pericarp; species; trichomes; var
• A new variety of Plocama calabrica (Rubiaceae) from Denizli (Turkey) confirmed by morphological and molecular ISSR markers by Gokturk, Ramazan Suleyman; Dusen, Olcay; Kaya, Ergun; Gurcan, Betul; Sarpkaya, Uygar (2019) - It is closely related to P. calabrica var. While the normal color of P. calabrica var. Keywords: alba; calabrica; calabrica var; issr; markers; plocama; plocama calabrica; turkey; var; variety
• Achene slime content in some taxa of Matricaria L. (Asteraceae) by Inceer, Huseyin (2011) - 70 (1), 109–114, 2011 CODEN: ABCRA25 ISSN 0365–0588 Achene slime content in some taxa of Matricaria L. (Asteraceae) HUSEYIN INCEER* Karadeniz Technical University, Faculty of Science, Department of Biology, 61080 Trabzon, Turkey Abstract – The achenes of Matricaria aurea and two varieties of M. chamomilla (var. chamomilla and var. recutita) have slime cells on the surface and they are characterized by slime envelope formation during hydration. The present results confirm that slime cells on the sur- face of the pericarp produce the slime. Keywords: blue; chamomilla; kreitschitz; matricaria; slime; var
• Carex distachya (Cyperaceae) with both subspecies in Europe by Koopman, Jacob; Więcław, Helena; Bogdanovic, Sandro; Denchev, Teodor T. (2025) - distachya and C. distachya var. phyllostachioidea Ö.Nilsson. As C. distachya var. Keywords: carex; distachya; distachya var; material; nilsson; phyllostachioidea; var
• Genetic characterization of Genista sericea Wulfen (Cytiseae - Fabaceae) as revealed by nuclear DNA content and ITS nrDNA region analysis by Vizintin, Liliana; Kosovel, Vera; Feoli Chiapella, Laura; Bohanec, Borut (2012) - The variation in nuclear DNA content of G. sericea var. Determination of nuclear DNA content by flow cytometry The relative and absolute value of DNA content was assessed by flow cytometry using Trifolium pratense L. as standard. Keywords: accessions; content; dna; feoli; genista; italy; rigida; sericea; sericea var; species; var

• Seasonal variations in intracellular trace element content and physiological parameters in the lichen Evernia prunastri transplanted to an urban environment by Vannini, Andrea; Paoli, Luca; Nicolardi, Valentina; Di Lella, Luigi Antonello; Loppi, Stefano (2017) - Further investigation is necessary to shed light on the role of intracellular trace element content in lichens, in or- der to allow comparison of these data with other biomoni- toring studies and get an insight into the ecophysiological effects of air pollution. Intracellular trace element (Al, As, Ba, Cd, Ce, Cr, Cu, Fe, Mn, Ni, Pb, Pd, Sb, Zn) concentrations were determined by inductively coupled plasma mass spectrometry (ICP- MS, Perkin- Elmer Sciex 6100) and expressed on a dry weight basis. Keywords: cell; content; elements; lichen; loppi; pollution; trace
• Enhancement of betanin yield in transformed cells of sugar beet (Beta vulgaris L.) by Križnik, Bojana; Pavoković, Dubravko (2010) - Sugar beet cells, transformed by a wild strain B6S3 of Agrobacterium tume- faciens, strongly produce betanin and could be a stable production source. We transformed sugar beet cells by infecting leaf fragments with wild strain B6S3 of Agrobacterium tumefaciens. Keywords: beet; betanin; cell; et al; medium; production; suc; yield

• Metabarcoding Cyanobacteria in coastal waters and sediment in central and southern Adriatic Sea by Kolda, Anamarija; Ljubešić, Zrinka; Gavrilović, Ana; Jug-Dujaković, Jurica; Pikelj, Kristina; Kapetanović, Damir (2020) - Leaf labels are automatically assigned by SILVA database (black letters), or NCBI GenBank database BLAST search hit results (blue letters). 1. Cladogram displaying grouping of 100 cyanobacterial ASVs, with addition of multi value bar chart of sample frequencies in different ASVs (CA – central Adriatic, SA – southern Adriatic, Aquaculture – site type under the influence of fish farms, Control – control site type; à - sea water sample type, O – sediment sample type). Keywords: croat

• DNA barcoding of marine algae from Malta: new records from the central Mediterranean by Bartolo, Angela G.; Zammit, Gabrielle; Russell, Hannah; Peters, Akira F.; Küpper , Frithjof C. (2021) - The rbcL (Tab. 5: 194 bp) and RuBisCO spacer (Tab. 5: 189 bp) provided 100% and 97.4% identity, respectively, to the published C. sinuosa sequence with Gen- Bank accession number AF385839 (Cho et al. 2001), and the species identification was determined with a high level of confidence. Species name Strain Marker Length (bp) % Identity % Cover Accession Species name and locality Colpomenia sinuosa MT17-059 rbcL 194 100 100 AF385839 Colpomenia sinuosa, Korea, Cho et al. 2001 Colpomenia sinuosa MT17- 059 spacer 189 97.4 100 AF385839 Colpomenia sinuosa, Korea, Cho et al. 2001 Colpomenia sp. MT17- 059 COI 538 97.3 95 KF281125 C. sinuosa, Australia, McDevit & Saunders, 2017 Sphacelaria sp. MT17- 026 COI 608 99.3 99 LM994971 Sphacelaria sp., Greece, Peters et al. 2015 Hecatonema terminale MT17- 068 COI 633 100 98 LM995391 H. maculans, Greece, Peters et al. 2015 Hecatonema terminale MT17- 068 rbcL 1403 99.9 100 AF207802 Hecatonema sp., unpublished Hecatonema terminale MT17- 068 spacer 207 99.5 99 AF207802 Hecatonema sp., unpublished Schizocladia ischiensis MT17- 100 rbcL 1006 99.8 100 MN996275 Schizocladia ischiensis, Italy, Rizouli et al. 2020 Schizocladia ischiensis MT17- 100 spacer 82 100 100 MN996275 Schizocladia ischiensis, Italy, Rizouli et al. 2020 Keywords: algae; coi; dna; et al; identity; malta; marine; peters; phaeophyceae; rbcl; sequences; sinuosa; spacer; species; tab

• Diversity and distribution of the dinoflagellates Brachidinium, Asterodinium and Microceratium (Brachidiniales, Dinophyceae) in the open Mediterranean Sea by Gomez, Fernando (2011) - 70 (2), 209–214, 2011 CODEN: ABCRA25 ISSN 0365-0588 Diversity and distribution of the dinoflagellates Brachidinium, Asterodinium and Microceratium (Brachidiniales, Dinophyceae) in the open Mediterranean Sea FERNANDO GÓMEZ* Instituto Cavanilles de Biodiversidad y Biología Evolutiva, Universidad de Valencia, PO Box 22085, 46071 Valencia, Spain Microceratium was found below 100 m in the eastern Mediterranean Sea, with the highest abundance of 8 cells L–1 at 125 m depth, in the Levantine Basin. Keywords: asterodinium; brachidinium; karenia; mediterranean; microceratium; sea

• Seasonal distribution of plankton diatoms in Lim Bay, northeastern Adriatic Sea by Bosak, Suncica; Buric, Zrinka; Djakovac, Tamara; Vilicic, Damir (2009) - 1. Location of the sampling stations in Lim Bay, north east Adriatic Sea, visited from March 2002 to November 2007. 68 (2), 351–365, 2009 CODEN: ABCRA25 ISSN 0365–0588 Seasonal distribution of plankton diatoms in Lim Bay, northeastern Adriatic Sea SUN^ICA BOSAK1*, ZRINKA BURI]1, TAMARA DJAKOVAC2, DAMIR VILI^I]1 1 Keywords: adriatic; bay; diatoms; distribution; et al; lim; nov; phytoplankton; sea; spp; vili^i; year

• Morphometric variation and taxonomic identification of thirteen wild rose populations from Tunisia by Ben Cheikh Affene, Zohra; Haouala, Faouzi; Harzallah-Skhiri, Fethia (2015) - belonging to Synstylae section and R. canina L., R. agrestis Savi., R. micrantha Smith. Nevertheless, this accession may be a hybrid, specifi c to the Tunisian region, of R. canina L. and R. villosa. Keywords: accessions; leafl; length

• Diatoms of the Dojkinci River (Stara Planina Nature Park, Serbia) by Krizmanic, Jelena; Ilic, Marija; Vidakovic, Danijela; Subakov Simic, Gordana; Petrovic, Jelena; Cvetanovic, Katarina (2015) - Lowe et al. Cocconeis pediculus Ehrenberg Humidophila ingeae (Van de Vijver) Key words: Brachysira intermedia, Chamaepinnularia mediocris, Diatomella balfouri- ana, diatoms, distribution, Dojkinci River, Navicula tridentula. Keywords: bertalot; diatoms; dojkinci; ehrenberg; eunotia; figs; grunow; kützing; lange; navicula; river; serbia; species

• Photochemical efficiency, content of photosynthetic pigments and phenolic compounds in different pitcher parts of Sarracenia hybrids by Tusek, Martina; Curman, Marcela; Babic, Marija; Tkalec, Mirta (2016) - Also, pitcher parts with extrafl oral nectaries have a lower amount of photosynthetic pigments (Ellison and Farnsworth 2005). Analysis of pitcher parts of hybrid A showed a signifi cant decrease of Fv/F0 in the pitcher-tube upper part and operculum compared to the wing. Keywords: chlorophyll; content; hybrid; operculum; parts; pitcher; sarracenia; tube; wing
• Temperature dependent chlorophylls accumulation and photosystem II assembly during etioplast to chloroplast transition in sunflower cotyledons by Lepedus, Hrvoje; Jakopec, Mario; Antunovic Dunic, Jasenka; Krizmanic, Goran; Osmanovic, Sanida; Cesar, Vera (2017) - The main goal of our study was to detect the impact of different temperatures on chlorophyll biosynthesis and the maximum quantum yield of PSII (Fv/Fm). There- fore, we investigated the greening processes in etiolated sunfl ower cotyledons (Helianthus annuus L.) grown at different temperatures (10, 20 and 30 °C) during 24 h. Keywords: chl; chlorophyll; cotyledons; greening; psii
• Seasonal variations of phytoplankton biomass and environmental conditions in the inner Boka Kotorska Bay (eastern Adriatic Sea) by Krivokapic, Sladjana; Stankovic, Zivko; Vuksanovic, Nenad (2009) - 4. Temporal (a) and spatial (b) distribution of mean oxygen concentration value in the inner part of Boka Kotorska Bay. travanj 2009 11:31:23 Color profile: Disabled Composite 150 lpi at 45 degrees spatial and temporal changes in physicochemical parameters and phytoplankton abun- dance and biomass (chlorophyll a concentrations) in the inner part of Boka Kotorska Bay. Keywords: bay; chlorophyll; fig; mmol; phytoplankton

• Resurrection of Ornithogalum brevipedicellatum (Asparagaceae) with morphological and molecular data by Aykurt, Candan; Deniz, Ismail Gökhan; Sari Yol, Duygu; Vural, Mecit; Sümbül, Hüseyin (2016) - Although O. pamphylicum was placed in a different branch, it was the closest species to O. brevipedicellatum while O. oligophyl- lum and O. pyrenaicum species were positioned in another group. When Ornithogalum brevipedicellatum, O. pamphylicum and O. oligohyllum species are evaluated with respect to the infl orescence type and length of the ped- icels, it is seen that the specimens of O. brevipedicellatum are distinct; distinguished from the other species by the lack of pedicels, or the presence of very short pedicels- either during fl owering or fruiting periods. Keywords: aykurt; brevipedicellatum; gazi; mountain; oligophyllum; ornithogalum; pamphylicum; species; turkey
• Morphological, anatomical and karyological investigations of the Turkish endemic species Lathyrus woronowii Bornm. (Fabaceae) by Gunes, Fatma; Meric, Ciler (2017) - Et Noe, L. inconspicuus L., L. setifolius L.) growing in Tur- key. Stems of L. maritimus Bigel, L. pratensis, L. sylvestris L. (Metcalfe and Chalk 1950), L. latifolius L. (Krstic et al. 2002), L. hir- sutus L. and L. sativus L. (Mantar et al. 2003) contain wings. Keywords: güneş; lathyrus; species; turkey; woronowii
• Dianthus nezahatiae (Caryophyllaceae), a new species from Northwest Turkey by Hamzaoğlu, Ergin; Kanoğlu, Salih Sercan; Aksoy, Necmi (2022) - Results Dianthus nezahatiae Hamzaoğlu, sp. nov. (sect. Dianthus nezahatiae Hamzaoğlu. Keywords: apex; calyx; caryophyllaceae; dianthus; epicalyx; hamzaoğlu; nezahatiae; scales; species; turkey

• The impact of cadmium on photosynthetic performance and secondary metabolites in the lichens Parmelia sulcata, Flavoparmelia caperata and Evernia prunastri by Maslac, Ana; Maslac, Maja; Tkalec, Mirta (2016) - Photosynthetica 43, 379–393. Loppi, S., Frati, L., Paoli, V., Bigagli, V., Rossetti, C., Bruscoli, C., Corsini, A., 2004: Biodiversity of epiphytic lichens and heavy metal contents of Flavoparmelia caperata thalli as indi- cators of temporal variations of air pollution in the town of Montecantini Terme (central Italy). In the last 20 years, chlorophyll fl uorescence measure- ments were successfully employed in various lichen studies investigating heavy metal pollution (Bačkor et al 2010, Ka- rakoti et al. 2014, Paoli et al. 2015a). Keywords: acid; caperata; days; exposure; lichens; metabolites; metal; min; sulcata
• The impact of drying on bioactive compounds of blue honeysuckle berries (Lonicera caerulea var. edulis Turcz. ex Herder) by Senica, Mateja; Stampar, Franci; ErciÅŸli, Sezai; Sladonja, Barbara; Poljuha, Danijela; Mikulic Petkovsek, Maja (2020) - Half of one gram of dried berries from each drying treatment was ex- tracted with 5 ml of 2% meta-phosphoric acid. Our study showed that dried berries had the same losses at 40 °C as at 75 °C, which confirms that heat treatment in itself negatively affects the cyanidin content. Keywords: acid; berries; compounds; content; drying; et al; food; fruit; heating; honeysuckle; honeysuckle berries; temperature; time; ° c

• New diatom taxa from the world’s first marine Bioblitz held in New Zealand: Skeletomastus a new genus, Skeletomastus coelatus nov. comb. and Pleurosigma inscriptura a new species by Harper, Margaret A.; Patterson, John E.; Harper, John F. (2009) - Pleurosigma inscriptura valves range from 70–110 mm (based on 22 valves) with a length to width ratio of c. 5 (range 4.2 to 6.3). This revealed Pleurosigma valves on the slides and allowed their darkfield colour to be recorded. Keywords: coelatus; fig; figs; inscriptura; new; pleurosigma; raphe; skeletomastus; species; striae
• Cytological characteristics of the Sellaphoraceae by Mann, David G.; Stickle, Alan J. (2009) - Fallacia chloroplasts are more variable than those of Sellaphora but always differ fundamentally from the valve-appressed chloroplasts of the unrelated but superficially similar genus Lyrella. 68 (2), 2009 MANN D. G., STICKLE A. J. U:\ACTA BOTANICA\Acta-Botan 2-09\Mann.vp 5. listopad 2009 15:23:30 Color profile: Disabled Composite 150 lpi at 45 degrees uoles is displaced towards the corner of the cell opposite the pyrenoid (Figs. 7, 12). Keywords: chloroplast; fallacia; figs; mann; pyrenoid; sellaphora; species

• Botanical Garden of the Faculty of Science, University of Zagreb 125th Anniversary Celebration (1889–2014) by Juretic, Biserka (2014) - With the help of their teach- ers and Garden staff, children from the nearby school and kindergarten sow and plant their own fl owers and vegetables, and nurture them during the season until the autumn harvest. The members of the European Botanic Gardens Consortium (EBGC), national representatives of botanical gardens from EU countries, Switzerland and Norway, meet in our Garden for the fi rst time in June. Keywords: botanical; garden; university; zagreb
• A word from the Guest Editor by Ljubesic, Zrinka (2015) - At the opening ceremony the partici- pants were welcomed with opening remarks by Dean Amir Hamzić, Faculty of Science, Univer- sity of Zagreb, Rector Aleksa Bjeliš, University of Zagreb, Staša Skenzić, Head of the Offi ce for International Cooperation at Ministry of Science, Education and Sports of the Republic of Croa- tia and the Mayor of Zagreb Milan Bandić. The 8th CEDM was organized by Croatian Bo- tanical Society and held from April 10 to April 13, 2014, at the University of Zagreb. Keywords: symposium; university; zagreb
• “Lost Worlds of Archaic Gardens” – 2018 Exhibition in Botanical Garden of the Faculty of Science, University of Zagreb by Kovacic, Sanja (2018) - Exhibition logo “Flora Palaeozoica” by Dr Vanja Stamenković, Senior Garden Curator; B) Whisk fern (Psilotum nudum (L.) P. Beauv.) from Zagreb Botanical Garden collection (courtesy of the Botanical Garden of Eötvös University, Budapest). Zagreb Botanical Garden holds several species of this ancient family; F) The maidenhair tree (Ginkgo biloba L.) is the single living descendant of the Ginkgoaceae family of gymnosperms, which appeared in the Mesozoic. Keywords: garden; zagreb
• The Beauty in Detail, Transformation and Structure – Adriatic Coccolithophores by Ljubesic, Zrinka (2019) - This research study was a collaboration between Uppsala University, Uni- versity of Oslo, Faculty of Science (University of Zagreb) and the Rudjer Bošković Institute. 78 (1), 2019 S1 Social news “The Beauty in Detail, Transformation and Structure – Adriatic Coccolithophores” The exhibition “The Beauty in Detail, Transformation and Structure – Adriatic Coccolithophores”, organized by the Academy of Fine Arts, University of Zagreb and the Cro- atian Botanical Society is a synergy between science and art that brings together scientists and artists, professors and stu- dents, modern technology and various artistic techniques. Keywords: arts; university; zagreb
• The Sixth Croatian Botanical Symposium, held in Zagreb, Croatia (August 30–September 1, 2019) by Jasprica, Nenad (2019) - Professor Nenad Jasprica Croatian Botanical Society, President Participants of the Sixth Croatian Botanical Symposium, Zagreb, Croatia (August 30–September 1, 2019). Oral presentations by the Croatian Phycology Section were or- ganized within the 7th European Phycological Congress led by Professor Zrinka Ljubešić and the Croatian Botanical Society (Zagreb, August 25–30, 2019). Keywords: croatian; zagreb
• The Seventh European Phycological Congress held in Croatia in August 2019 by Ljubesic, Zrinka (2019) - An invited lecture on “Change of climate and occurrence of extremes“ by Mirko Orlić, member of Croatian Academy of Sciences and Arts and professor at the Faculty of Science, University of Zagreb, discussed topics associated with climate change and the more frequent occurrence of weather extremes. 2. EPC7 participants presented their research in 163 oral and 243 poster presentations. Keywords: epc7; fig; zagreb
• Zlatko Pavletić (1920-1981) - on the 100th anniversary of his birthday by Alegro, Antun (2020) - 79 (2), 2020 S Social news Zlatko Pavletić (1920-1981) – on the 100th anniversary of his birthday Professor Zlatko Pavletić (April 4, 1920 – March 19, 1981) was a milestone person for biology in Croatia in the second half of 20th century. Professor Zlatko Pavletić with his colleagues and associates before the fieldtrip (second half of 1970-ies). Keywords: pavletić; professor; research; sabovljević; science; zagreb
• The 2024 anniversaries of the Botanical Garden, University of Zagreb, Faculty of Science by Kovačić, Sanja; Stamenković, Vanja (2025) - In the front row, the guests of honour (left-right): Biserka Juretić MSc, retired Gar- den manager; Professor Mirko Planinić, Dean of the Faculty of Science; Dr Ljerka Regula-Bevilacqua, retired Garden manager; Ms Roberta Gazibarić, Professor Heinz’s great-granddaughter. (photo: Mirna Kirin). The bust representing Professor Heinz in his prime, for he was only 28 years old when he founded the Garden, was selected in a school com- petition from a dozen models made by pupils at the School of Applied Arts and Design in Zagreb. Keywords: botanical; garden; heinz; professor; zagreb

• Dubravka Hafner and Anita Dedić – Diatoms of the Adriatic Sea Basin in Bosnia and Herzegovina by Plenković-Moraj, Anđelka (2021) - It was written as a result of the sci- entific work of Professor Dubravka Hafner, who has devot- ed her whole life and work to the study of cyanobacteria and algae, with a special interest in diatoms. Compiling a definitive list of diatoms from Bosnia and Herzegovina involves considerable scien- tific effort, and I am sure that both authors will acknowledge that knowledge of freshwater habitats is still incomplete and there is much to learn. Keywords: bosnia; diatoms

• Fire risk in Austrian pine (Pinus nigra) plantations under various temperature and wind conditions by Cseresnyes, Imre; Szecsy, Orsolya; Csontos, Peter (2011) - That the fre- quency of forest fires has been increasing in recent decades was demonstrated world-wide (NIKLASSON and GRANSTRÖM 2000, HARTLEY 2002, PALIK et al. 2002, MUZY et al. 2008). The dryness of the litter and the vegetation has a considerable influence on the scale of fire risk, such that the frequency and scale of forest fires increase during dry years (VIEGAS et al. 1990, 1992, GRANSTRÖM 1993, SWETNAM 1993). Keywords: age; drought; fire; forest; ros; speed; temperature; wind; years

• Responses of trifoliate orange (Poncirus trifoliata (L.) Raf.) to continuously and gradually increasing NaCl concentration by Chatzissavvidis, Christos; Antonopoulou, Chrysovalantou; Therios, Ioannis; Dimassi, Kortessa (2014) - Calcium concentration in explants presented a lower increase in the treatments with gradual transfer than in those with a continuous exposure to high NaCl concentration in the nutrient medium. This discrepancy found in proliferated explants, lacking a root system, could be related to differences in the diffusion rates of mineral nutrients in the culture medium with high NaCl concentrations (PEREZ-TORNERO et al. 2009). Keywords: concentration; et al; explants; nacl; salinity; treatments

• First record of the dinoflagellate Tripos rotundatus in the Adriatic Sea by Pasković, Nika; Dupčić-Radić, Iris (2023) - Materials and methods Sampling was conducted on July 17, 2021 at the Lokrum coastal station, near Dubrovnik (southern Adriatic Sea, 42°37’21” N, 18°06’05”E) (Fig. 1). Dinoflagellate species Tripos digitatus (Schütt) Gómez (A, B) Keywords: adriatic; gómez; phytoplankton; rotundatus; sea; species; tripos

• Indirect and direct somatic embryogenesis from aerial stem explants of ginger (Zingiber officinale Rosc.) by Lincy, Adinkudik K.; Remashree, Azhimala B.; Sasikumar, Bhaskaran (2009) - The desiccated calli produced white friable calli which turned embryogenic and then produced somatic embryos in a medium containing 2 mg L–1 benzyl amino purine. Induction of somatic embryos from ovary explants of ginger and its regeneration were de- scribed by NIRMAL BABU et al. (1996). Keywords: callus; embryogenesis; embryos; explants; ginger; l–1; medium; shoot; stem

• The epiphytic bryophyte succession of Buxus sempervirens forests in Fırtına Valley, Rize (North Türkiye) by Ezer, Tülay; Alata˛s, Mevlüt; Batan, Nevzat; Erata, Hüseyin (2023) - Epiphytic bryophyte communities The A1 community was named Exsertotheca crispa- Isothecium alopecuroides due to the frequency, constancy and, dominancy of these species within the lower-base community. Ezer, T., 2017: Epiphytic bryophyte communities and succession on Platanus orientalis trees in Kadıncık Valley (Mersin/Tur- key). Keywords: boxwood; bryophyte; community; cortico; crispa; fırtına; life; middle; sempervirens; species; trees; valley; zones

• Fungal associations in gametophytes and young sporophytic roots of the fern Nephrolepis exaltata by Thangavelu, Muthukumar; Prabha, Kandasamy (2012) - Gametophytes and young sporophytes growing on different substrates were invariably colonized by septate endophytic fungi. Gametophytes and young sporophytes of Nephrolepis exaltata. Keywords: exaltata; fern; fungal; fungi; gametophytes; roots; sporophytes

• Photosynthetic performance of two freshwater red algal species by Palmai, Tamas; Szabo, Beata; Hubai, Katalin Eszter; Padisak, Judit (2018) - Ps values of Bangia were calculated only at 5 and 10 °C because at higher temperatures photoinhibition was not ob- served, and the obtained data were similar to PB max. At higher temperatures a slow decrease was observed in the Ik values. Keywords: bangia; batrachospermum; light; m–2; rhodophyta; species; temperature; µmol

• Micromorphology of endemic Centaurea glaberrima subsp. divergens (Asteraceae) by Gavrilović, Milan; Janaćković, Pedja (2022) - However, there are a few novel studies that eval- uate the pollen morphology of Centaurea species (Özler et al. 2009, Shabestari et al. 2013, Baser et al. 2019). Rahiminejad et al. (2010) noted that the type and density of leaf and stem epi- dermal indumentum were of particular taxonomic value for Centaurea species. Keywords: asteraceae; centaurea; et al; fig; glaberrima; glandular; species; surface; trichomes

• Celebrating 70th birtday of Professor emeritus Damir Vilicic by Ljubesic, Zrinka (2019) - Professor Viličić has started his scientific career in the In- stitute of Oceanography and Fisheries in Dubrovnik in 1975 where he has achieved his position of senior scientist in 1991. Professor Viličić was principal investigator of projects of the Ministry of Science of the Republic of Croatia and was collaborator on international projects and research in the Adriatic Sea (RV Knorr, DOLCEVITA project). Keywords: adriatic; science; viličić

• Chromosome numbers and karyotype features of Phlomis olivieri Benth. (Lamiaceae) from Iran by Yousefi, Hossein; Amirahmadi, Atefe; Naderi, Reza; Atri, Morteza (2018) - Our observations as well as comparison of photomi- crographs obtained from previous reports also showed that Phlomis chromosomes are the largest among species of the Lamiaceae genera such as Callicarpa L., Salvia L., Scutellaria L., Sideritis L., Stachys L., Teucrium L. and Thymus L. (Jalas 1948, Boşcaiu et al. 1998, Yildiz and Gücel 2006, Yang et al. 2009, Martin et al. 2011, Contreras and Ruter 2011, Javadi et al. 2011). (Lamiaceae) from Iran Hossein Yousefi1, Atefe Amirahmadi2, Reza Naderi2*, Morteza Atri1 1 Department of Biology, Faculty of Sciences, Bu-Ali Sina University, Hamedan, Iran 2 School of Biology and Institute of Biological Science, Damghan University, Damghan, 36716-41167, Iran Abstract – Chromosome numbers were determined in ten accessions of Phlomis olivieri Benth. Keywords: accessions; chromosome; olivieri; phlomis; species
• Cytology and palynology of the Clematis L. species (Ranunculaceae) in Iran by Sheidai, Masoud; Habibi, Meysam; Azizian, Dina; Khatamsaz, Mahboobeh (2009) - TOWNSEND, C. C., EVANS, G., 1980: Clematis. In: TOWNSEND, C. C. (ed.), Flora of Iraq 4, 743–750. Keywords: chromosome; clematis; orientalis; population; species
• Chromosome number of Elatine gussonei (Sommier) Brullo (Elatinaceae) and its distribution on the Maltese islands by Kalinka, Anna; Misfud, Stephen; Popiela, Agnieszka; Achrem, Magdalena (2014) - Key words: Elatine gussonei, chromosome number, phytogeography Introduction Elatinaceae Dum. is a small cosmopolitan family of herbaceous aquatic and semi-aqua- tic plants and terrestrial shrubs composed of two genera, i.e. Elatine L., comprising about 15–20 taxa, and occurring in areas of moderate temperatures in both hemispheres, and Bergia L., with about 25 species occurring mostly in tropical areas of the Old World, primarily in Africa, and also in Australia (TUCKER 1986, LEACH 1989). The number of chromosomes in Elatine gussonei was not previously reported, in contrast to the unequivocal results of chromosome number for other species of the Elatine genus. Keywords: chromosome; elatine; gussonei; kalinka; number; sommier; species

• Microsatellite allele length variations in inter-specific hybrids of Eucalyptus by Sumathi, Murugan; Ramasamy, Yasodha (2017) - All the DNA sequences of SSR locus along with the source SSR sequence and E. grandis genomic region harbouring SSR were aligned using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/) to identify the structural variations in microsatellites. Original microsatellite sequence of Eg61 (EU699745.1) and E. grandis genome sequence showed compound SSR (GAA) (GAT) repeats. Keywords: alleles; dna; repeat; sequence; species; ssr; t c

• Incidence of post-harvest disease and airborne fungal spores in a vegetable market by Kakde, Umesh B.; Kakde, Hemalata U. (2012) - Samples of fresh as well as previously infected or rotten vegetables (cabbage, beans, onion, potato, tomato) were collected in pre-sterilized polythene bags from the same mar- ket to examine post-harvest fungi. Aerospora of Bangalore city market and its relation to oc- currence of market diseases. Keywords: air; alternaria; aspergillus; cladosporium; fungi; fusarium; kakde; market; penicillium; species; spores; vegetables; � �

• Araphid Diatom Classification and The "Absolute Standard" by Williams, David M. (2009) - Since that time a few more papers have appeared on 'araphid' diatom phylogeny, particularly from a molecular perspective (SATO et al. 2008a, 2008b, MEDLIN et al. 2008a, 2008b). A contribution of some significance is MEDLIN et al. (2008b), as it presents a large quantity of data and proposes one of the first trees of relationships to include a good num- ber of the diverse 'araphid' diatoms. Keywords: genus; licmophora; node; species; sub; tree
• Habrosia (Caryophyllaceae) a monotypic genus endemic to Western Asia: morphological and molecular remarks by Iamonico, Duilio (2021) - Habrosia spinuliflora Fenzl. Retrieved Janu- ary 30, 2021 from http://sweetgum.nybg.org/science/ih/ Tropicos, 2021: Habrosia spinuliflora Fenzl. - Tropicos.org. Keywords: arenaria; caryophyllaceae; dillenberger; fenzl; genus; habrosia; iamonico; kadereit; minuartia; sabulina; ser; spinuliflora

• Nutlet size, shape and surface ornamentation in 14 Onosma species (Boraginaceae) by Binzet, Rıza; Akcin, Oznur E. (2009) - The colour of the nutlets is brown in O. sintenisii, O. intertextum and O. bourgaei; gray-pale brown in O. papillosum, O. mer- sinana, O. briquetii and O. riedliana; pale brownish in O. ambigens and O. rascheyanum; pale gray in O. bulbotrichum; gray in O. lycaonicum; reddish brown in O. caerulescens; gray brown in O. angustissimum and O. giganteum. Most species of Onosma have the type 4 nutlet surface, such as O. papillosum, O. lycaonicum, O. caerulescens, O. rascheyanum, O. mersinana and O. riedliana. Keywords: nutlet; onosma; species; type

• Plate method for counting the proteolytic sulphide-producing bacteria by Stilinovic, Bozidar; Hrenovic, Jasna (2009) - The composition of PCA medium was (in g L–1 of distilled water): peptone bacteriological (Biolife) 5.0; proteose peptone (Biolife) 5.0; L-cysteine (Fluka) 0.25; NaCl (Kemika) 5.0; ammonium iron (III) citrate (Sigma-Aldrich) 1.0; K2HPO4 (Kemika) 0.3; agar (Biolife) 15.0; pH 7.4±0.2. 58 ACTA BOT. The composition of ISA medium was (in g L–1 of distilled water): tryptone 10.0; sodium sulphite 0.5; iron (III) citrate 0.5; agar 15.0; Keywords: bacteria; cfu; isa; pca; pspb; samples; sim

• Alyssum desertorum Stapf (Brassicaceae) new for the Italian Flora by Bartolucci, Fabrizio; Conti, Fabio (2016) - La Cona, in- colti al margine stradale, 860 m, 20 April 2013, F. Conti s.n. (APP n. 55194); loc. Alyssum desertorum: a – infl orescence, b – raceme whit gla brous silicles and caducous sepals (Photo by: a – F. Conti, b – F. Bartolucci). Keywords: alyssum; bartolucci; conti; desertorum; dudley; italy; peruzzi

• Morphogenesis, volume and number of hop (Humulus lupulus L.) glandular trichomes, and their influence alpha acids in fresh bracts of hop cones by Srecec, Sinisa; Zechner Krpan, Vesna; Marag, Sanja; Spoljaric, Igor; Kvaternjak, Ivka; Mrsic, Goran (2011) - Volume of glandular trichome during the different phases of morphogenesis varied from 0.25 ´ 10–2 mm3 in phase 1, to 1.95 ´ 10–2 mm3 in phase 5. In this research, positive Spearman's rank order correla- tions were found between the average number of glandular trichomes and content of a-acids as well as between the average volume of glandular trichomes and content of a-acids. Keywords: bracts; fig; hop; morphogenesis; peltate; phase; trichomes

• Cardamine fialae Fritsch (Brassicaceae) a new species in Croatian flora by Vukojevic, Mara; Vitasovic Kosic, Ivana; Alegro, Antun; Lakusic, Dmitar; Bogdanovic, Sandro (2016) - Morphologically, C. fi alae is similar to the Serbian endemic C. serbica with which it shares following characteristics: auricules at the base of lower cauline leaves, stem and rosette leaves bipinnate, margin of leafl ets serrate with hairy main stem and sepals, although it differs in having bigger petals and sepals, longer fi laments and 1–2 lateral stems. C. fi alae grows on lower altitudes in rocky ground within the vegetation of forest fringes of the sub-Mediterranean zone. Keywords: alae; cardamine; croatian; kučera; species
• Professor emeritus Ljudevit Ilijanic: an appreciation on the occasion of his ninetieth birthday by Jasprica, Nenad (2019) - The purely scientific work of Professor Ljudevit Ilijanić has been oriented to the flora and vegetation of Croatia. A lists and analysis of the scientific papers authored by Professor Ljudevit Ilijanić have previously been published in the Acta Botanica Croatica (Marković 1993, Regula and Regula 2000). Keywords: croatian; ilijanić; professor
• First National Week of Croatian Botanical Gardens and Arboreta (May 30 – June 4, 2011) by Kovacic, Sanja; Stamenkovic, Vanja Nikola (2011) - The First National Week of Croatian Botanical Gardens and Arboreta, organized at 12 locations, was visited by more than two thousand people. U:\ACTA BOTANICA\Acta-Botan 2-11\social news Kovacic.vp 15. rujan 2011 11:53:27 Color profile: Disabled Composite 150 lpi at 45 degrees The next National Week of Croatian Botanical Gardens and Arboreta will be organised from Monday 14th to Saturday 19th of May, 2012. Keywords: arboreta; botanical; croatian; gardens

• Secondary sexual dimorphism and morphological diversity in two allopatric juniper species: Juniperus oxycedrus and J. deltoides by Vidaković, Antonio; Šatović, Zlatko; Tumpa, Katarina; Idžojtić, Marilena; Barišić, Andrija; Poljak, Igor (2024) - https://doi.org/10.1007/s10021-008-9135-2 Midgley, J. J., 2010: Causes of secondary sexual differences in plants — Evidence from extreme leaf dimorphism in Leucadendron (Proteaceae). https://doi. org/10.1111/j.1654-1103.2011.01269.x Sanchez-Salguero, R., Camarero, J. J., 2020: Keywords: cone; deltoides; et al; juniperus; needle; needle length; needle traits; oxycedrus; population; sex; species; taxon; traits

• A new addition to the alien flora of Tunisia, Amaranthus spinosus L. (Amaranthaceae s.l.), with notes on A. diacanthus Raf. by Iamonico, Duilio; El Mokni, Ridha (2019) - Keywords: alien species, Amaranthus, neophyte, typification * Corresponding author, e-mail: d.iamonico@yahoo.it Introduction The genus Amaranthus L. (Amaranthaceae Juss.) Amaranthus L. Keywords: amaranthaceae; amaranthus; iamonico; species; spinosus
• Blitum venetum (Chenopodiaceae), a new species from north-eastern Dolomites (Italian Eastern Alps) by Iamonico, Duilio; Wolf, Marion; Sciuto, Katia; Sfriso, Adriano; Argenti, Carlo (2022) - Morphological comparison among Blitum bonus-henricus, B. californicum, and B. venetum. On the basis of the percent identity matrices obtained with MUSCLE (Figs. 1c, 1d), the nucleotide divergences cal- culated between the Blitum sp. specimen from Belluno and each of the other recognized Blitum species ranged from 0.40% (Blitum sp. vs. B. bonus-henricus) to 4.37% (Blitum sp. vs. B. californicum) for the nucleotide ITS marker and from 0.86% (Blitum sp. vs. B. bonus-henricus) to 3.70% ( Blitum sp. vs. B. petiolare) for the plastid trnL-F marker. Keywords: blitum; bonus; henricus; iamonico; new; region; species; trnl; venetum; vs.
• Lectotypification of the Linnaean name Bryonia cretica (Cucurbitaceae) by Iamonico, Duilio; Panitsa, Maria (2013) - Authors’ field data were used for the description of the plant communities in which B. cretica participates while for the habitat types, the codes and description of the European Nature Information System (EUNIS 2012) and those of Annex I of the Council Directive 92/43/EEC (EUR25 2003) were also used. None of these references include an illustration of B. cretica. Keywords: bryonia; cretica; cucurbitaceae; iamonico

• Fruit and seed traits of Berberis croatica Horvat and Berberis vulgaris L. by Karlovic, Ksenija; Kremer, Dario; Jurisic Grubjesic, Renata; Popovic, Zvjezdana (2012) - o ujak 2012 11:25:01 Color profile: Disabled Composite 150 lpi at 45 degrees intraspecies variability for seed traits was something higher than for fruit traits. Berberis croatica had the following dimen- sions of fruits (seeds): length 7.28–7.88 (4.57–5.03) mm; width 3.85–3.99 (width 1: 2.06–2.20; width 2: 1.44–1.63) mm; weight 0.065–0.078 (0.0116–0.0134) g. Dimensions of B. vulgaris fruits (seeds) were: length 10.20–11.29 (5.71–6.24) mm; width 5.29–5.83 (width 1: 2.40–2.71; width 2: 1.60–1.98) mm; weight 0.1602–0.2199 (0.0146–0.0235) g. The fruit shape of both species was similar and the length/width ratio was 1.91–2.04 in B. croatica and 1.77–2.07 in B. vulgaris. Keywords: croatica; fruit; vulgaris; width
• Tuber donnagotto, a new winter truffle species from Istria, Croatia by Bozac, Romano; Siric, Ivan; Kos, Ivica (2012) - Tuber donnagotto is substantially different from all known species of black truffles. [IRI]*, IVICA KOS University of Zagreb Faculty of Agriculture, Sveto{imunska 25, 10000 Zagreb, Croatia Abstract – Tuber donnagotto is a new winter black truffle belonging to the order Pezizales and the family Tuberaceae. Keywords: bodies; brown; donnagotto; fruit; species; truffles; tuber

• In Memoriam Ivo Trinajstić (1933-2024) by Škvorc, Željko (2025) - Professor Trinajstić was also deeply involved in the taxonomic study of plant species, particularly through his Professor Ivo Trinajstić (1933–2024) IN MEMORIAM 114 ACTA BOT. Born on October 27, 1933, in Sisak, Professor Trinajstić completed his degree in agronomy at the Faculty of Agriculture and Forestry, University of Zagreb, in 1958. Keywords: professor; trinajstić

• Potentilla x aurulenta Gremli (Rosaceae), a nothospecies new to Poland by Kolodziejek, Jeremi (2009) - Keywords: Potentilla ´aurulenta, taxonomy, Poland Introduction During an expedition to Wzgórza Trzebnickie, Poland, in May 2004, the author found specimens of Potentilla that differ from the congeners in Poland. Methods Morphological features of the species Potentilla ´aurulenta were described and com- pared with those of P. heptaphylla L. and P. tabernaemontani (Tab. 1). Keywords: aurulenta; hairs; potentilla
• A new nothospecies in the genus Potentilla L. (Rosaceae) by Kolodziejek, Jeremi (2009) - P. ´gabarae resembles P. leucopolitana in having dense tomentum and leaves with 5–7 leaflets. Leaflets of P. ´ gabarae are covered with straight and crispate hairs mixed with imperfectly stellate hairs which make the leaves sparsely sericeous hairy; the imperfectly stellate hairs (»Zackenhaare«) consist of up to 7 not identi- cally long arms (Fig. 3 A, B). Keywords: hairs; potentilla
• Multilocus genomic associations among selected taxa of genus Potentilla (Rosaceae) in Poland using RAPD analysis by KoÅ‚odziejek, Jeremi (2010) - P. subarenaria is commonly interpreted as an apomictic species possibly of relatively recent hybrid origin from P. tabernaemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb. SEM analyses allowed distinguishing two morphological types of seed coats pattern: ruminate-reticulate sculpture due to well pre- served epidermal cells in P. subarenaria and tuberculate sculpture in P. intermedia. Keywords: achenes; intermedia; potentilla; subarenaria
• Multilocus genomic associations among selected taxa of genus Potentilla (Rosaceae) in Poland using RAPD analysis by KoÅ‚odziejek, Jeremi; Cieslikowski, Tomasz; Sakowicz, Tomasz (2010) - (P. taber- naemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb.). (P. tabernaemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb.) within P. subgen. Keywords: collinae; p. argentea; p. collina; p. incana; p. subsect; p. tabernaemontani; p. thyrsiflora; potentilla; rapd; species; subsect

• The correct phylogenetic position of Lotus conimbricensis Brot. (Leguminosae, Loteae) based on nuclear ribosomal ITS sequences by Harris, D James; Faria, Miguel A.; Visnevchi - Necrasov, Tatiana; Tavares De Sousa, Manuel; Nunes, Eugenia (2012) - The aim of this study was to sequence several individuals of both L. subbiflorus and L. conimbricensis to resolve their phylogenetic relationship, and to look for some other possi- ble examples of discordance in previous studies by examination of sequence data available for different Lotus species. Crit- ical reexamination of previously published data indicates that several other similar errors may exist for other Lotus species, and these should be checked before taxonomic conclu- sions are made. Keywords: conimbricensis; lotus; sequences; species; subbiflorus

• The new association Pimpinello lithophilae-Centaureetum lovricii (Crithmo-Staticetea) from the island of Vis (southern Croatia) by Jasprica, Nenad; Terzi, Massimo (2023) - Many of them inhabit halophytic and chasmophytic coastal and subcoastal habitats within rare plant communities (Terzi et al. 2020). Although Škvorc et al. (2017) were the first to recognize the occurrence of the Helichrysetalia italici in Croatia, this order was widely described and documented for the first time for the eastern Adriatic by Terzi et al. (2020). Keywords: association; bogdanović; centaurea; lovricii; pimpinello

• Floristic composition of vegetation in habitats suitable for Erigeron × huelsenii (Asteraceae) by Pliszko, Artur; Jazwa, Malgorzata (2017) - Spontaneously occurring hybrids between alien and native plants have been well-documented (Vilà et al. 2000, Daehler and Carino 2001, Bleeker et al. 2007, Lehman et al. 2014, Stace et al. 2015), and according to Pyšek et al. (2004) they must be understood as alien plant species. This can be explained by the fact that in the early stages of secondary succession, abandoned sand and gravel pits are readily colonized by various plant species typical of ruderal, grassland and meadow communities (Řehounková and Prach 2006). Keywords: grass; habitats; legume; species

• New bryophyte taxa for Bosnia and Herzegovina by Pantović, Jovana; Grdović, Svetlana; Sabovljević, Marko (2023) - Ellis, L.T, Alatas, M., Alvaro Alba, W.R, Charry Giraldo, A.M., Amatov, V., Batan, N., Becerra Infante, D.A, Burghardt, M., Czernyadjeva, I.V., Kuzmina, E.Y., Doroshina, G.Y., Erata, H., Garilleti, R., Gradstein, S.R., Jukoinene, I., Karaman Erkul, S., Keksin, A., Ezer, T., Lara, F., Draper, I., Maksimov, A.I., Mammandova, A.V., Natcheva, R., Nemeth, C., Pantović, J., Sabovljević, M. S., Papp, B., Poponessi, S., Cogoni, A., Porley, R.D., Reiner-Drehvald, M.E., Schafer- Verwimp, A., Schmotzer, A., Segota, V., Alegro, A., Rimac, A., Stefanut, S., Szurdoki, E., Vilk, E.F., Virchenko, V.M., Bijlsma, R.J., Callaghan, D.A., 2021b: New national and regional bryophyte records, 67. 82 (1), 80–82, 2023 CODEN: ABCRA 25 DOI: 10.37427/botcro-2022-026 ISSN 0365-0588 eISSN 1847-8476 Short communication New bryophyte taxa for Bosnia and Herzegovina Jovana P. Pantović1*, Svetlana N. Grdović2, Marko S. Sabovljević1,3 1 University of Belgrade, Faculty of Biology, Institute of Botany and Botanical Garden, Takovska 43, 11000 Belgrade, Serbia 2 University of Belgrade, Faculty of Veterinary Medicine, Bulevar oslobođenja 18, 11000 Belgrade, Serbia 3 Pavol Jozef Šafárik University, Institute of Biology and Ecology, Faculty of Science Department of Botany, Mánesova 23, 040 01 Košice, Slovakia Abstract – Bosnia and Herzegovina has a long history of bryophyte flora research. Keywords: bosnia; bryophyte; herzegovina; leg; site

• Orobanche pseudorosmarina A. Pujadas & Munoz Garm. sp. nov. (Orobanchaceae) from the eastern Mediterranean region by Pujadas-Salva , Antonio J.; Munoz Garmendia, J. Felix (2010) - Results Description of the new species The Croatian plants that were previously identified as O. rosmarina Beck belong to an unnamed taxon other than that of the Iberian ones and are described as the following new species here: 2 ACTA BOT. [identified by Beck as Orobanche rosmarina Beck =O. mutelii var. Keywords: beck; hairs; orobanche; rosmarina; stenosiphon

• James G. Ogg, Gabi Ogg, Felix M. Gradstein "The Concise Geologic Time Scale" by Devide, Zvonimir (2009) - travanj 2009 13:12:17 Color profile: Disabled Composite 150 lpi at 45 degrees The text of the book is perfect in any regard, being accompanied by many illustrations of the highest quality: drawings, photographs, in the chapters 4 to 15 predominantly photo- graphs and profiles of GSSP-localities as well as time scales containing also regional sub- divisions, and in the last columns, details about Biostratigraphy, Magnetic stratigraphy, Cycle- and Stable- isotope stratigraphy, Eustatic stratigraphy (Sea level changes) etc. (see Fig. 4). Each of the chapters 4 to 15 treats one Period of the Phanerozoic Eon (see Contents) and contains, according to the schedule mentioned in the Introduction, the following sections: History and base of the treated Period; International subdivisions of the Period; Selected aspects of the Period’s stratigraphy; Numerical time scale (current status / GTS 04, correc- tions –or:/current status and future developments; Acknowledgments – Further reading -Selected on-line references. Keywords: book; earth; fig; period; scale; time

• Novel polymorphic microsatellite markers from turmeric, Curcuma longa L. (Zingiberaceae) by T.E, Sheeja; Kizhakayil, Dhanya; Sheeja, Thotten E.; Sasikumar, Bhaskaran; Bhat, Alanghar I.; Parthasarathy, Villlupanoor A. (2013) - Na D GenBank accession numberReverse primer (5'–3') CuMiSat -19 CATGCAAATGGAAATTGACAC (AC)16 (AT)6 65 204–154 8 0.67 HQ154119 TGATAAATTGACACATGGCAGTC CuMiSat -20 CGATACGAGTCCATCTCTTCG (AC)6 65 158–148 8 0.64 HQ154120 CCTTGCTTTGGTGGCTAGAG CuMiSat -21 TCATTCAAAGTCCGATGGAA (AAG)9 62 164–146 6 0.67 HM438970 TTCGAGTGCAGAAGGAGAATTA CuMiSat -22 AATTTATTAGCCCGGACCAC (CTT)10 64 158–122 7 0.67 HM438971 AAGAAAGTGAGTAGAAACCAAAGC CuMiSat -23 CGTGGAAGGTGAGTTTGAC (AAG)4 65 165–132 3 0.66 HM438972 CAGAAGGGAACTGAGATGG CuMiSat -24 AGGTATTCTACTCGACCAAG (AAC)10 58 141–123 4 0.60 HM438973 AAATTCATATAGCCCCATC CuMiSat -25 TACATGAGAAACAACAAAGCCC (AAC)7 65 146–140 3 0.60 HM438974 AGTTAGCCAAGTCCCAATTTAGC CuMiSat -26 CATTCCGATGAATTGTATG (AAC)9 58 208–188 5 0.61 HM438975 GCAGTTGTTTTGCTTCAG CuMiSat -27 TATAGATAGCCATGCTGAAG (AC)8 63 121–111 4 0.25 HM438976 CCATTTTAGTTCATTACGTG CuMiSat -28 TTCAACTTCTCCTCGCTCAG (AAG)7(GAT)5 65 160–139 7 0.67 HM438977 GCAAGGTCTGCATCTATTTCTC CuMiSat -29 GTGGTATCCCCATGAAGAGC (AAG)10 65 177–150 8 0.67 HM438978 ATGACCAAGCCCTTTCACC 410 A C T A B O T .C R O A T .72 (2),2013 S E N A N S.,K IZ H A K A Y IL D .,S H E E JA T .E .,S A SIK U M A R B .,B H A T A .I.,P A R T H A SA R A T H Y V .A . This limited availability warrants the need to expand the existing repertoire of microsatellite markers for future studies aiming at better estimation of genetic variability for the effective conservation of the genetic resources of turmeric. Keywords: cumisat; markers; microsatellite; turmeric

• Data on species plasticity and stable characters have an overall importance in identification keys: comments on Brullo et al. (2022) article by Sramkó, Gábor; Takács, Attila; Molnár V., Attila; Popiela, Agnieszka; Lukács, Balázs András (2023) - If Brullo et al. (2022) were to consider the role of seed morphological characters in the genus and take into account the numerous publica- tions that discuss the plastic nature of vegetative and floral characters (Molnár et al. 2014, 2015, Sramkó et al. 2016, Takács et al. 2017, Łysko et al. 2022) as well as the phyloge- netic results (Sramkó et al. 2016, Razifard et al. 2017) in greater detail, they might find it easier to accept the pres- ence of E. gussonei in Sicily and other Mediterranean areas. Given our findings, along with the previous reports by Sramkó et al. (2016) and Takács et al. (2017), which were also cited by Brullo et al. (2022), it is possible that hybridisation in this genus may be more com- mon than accepted. Keywords: brullo; elatine; et al

• Astragalus nallihanicus (sect. Caprini, Fabaceae), a new species from Türkiye by Hamzaoğlu, Ergin (2024) - mm long, blade 11−13 mm long, auricle c. 1 mm long, blade 8−15 mm long, auricle 2.5−3 mm long, Keywords: a.s.l; astragalus; claw; fig; glabrous; hairy; new; species; türkiye

• Cryoseston in Stara Planina (Balkan) Mountains, Bulgaria by Lukavsky, Jaromir; Cepák, Vladislav (2010) - ØEZANKA, T., NEDBALOVÁ, L., SIGLER, K., CEPÁK, V., 2007: Identification of astaxanthin diglucoside diesters from snow alga Chlamydomonas nivalis by liquid chromatografy – atmospheric pressure chemical ionization mass spectrometry. Cryoseston of snow fields in the Stara Planina Mountains, collected in May 2009. Keywords: chloromonas; cryoseston; lukavský; mts; nivalis; planina; snow; stara

• Some peltigericolous microlichens from southern Poland by Czarnota, Pawel; Hernik, Emil (2014) - Their localities are mapped (Fig. 1) according to the Atpol grid square system (ZAJ C 1978) modified by CIE�LI�SKI and FA�TYNOWICZ (1993). CIE�LI�SKI, S., FA�TYNOWICZ, W., 1993: Keywords: atpol; e. hernik; hernik; leg; lichens; peltigera; poland; res; species; thallus

• Crocus adamioides (Iridaceae) in the Bulgarian flora by Raycheva, Tsvetanka ; Stoyanov, Kiril ; Naimov, Samir; Apostolova-Kuzova, Elena (2021) - The values were processed using basic statistical analysis – mean, standard deviation, maximum and minimum, and compared with the data for C. randjeloviciorum (Harpke et al. 2017). The measured anatomical characters are listed in Tab. 2 and compared with those of C. randjeloviciorum (Harpke et al. 2017). Keywords: adamioides; bulgaria; crocus; et al; fig; harpke; randjeloviciorum; species; width

• Myosotis refracta Boiss. (Boraginaceae), an unexpected forget-me-not in the Slovene flora by Strgulc Krajšek, Simona; Accetto, Marko; Jogan, Nejc (2016) - During the revision, an unexpected species, M. refracta Boiss., was identifi ed. M. refracta is morphologically distinct, but easily con- fused with other small Myosotis species. Keywords: accetto; grau; myosotis; refracta; slovenia; species

• Palynological classification of Onosma L. (Boraginaceae) species from east Mediterranean region in Turkey by Binzet, Rıza; Kandemir, Irfan; Orcan, Nermin (2010) - For example O. stenoloba Hausskn.ex Riedl and O. mersinana Riedl, Binzet et Orcan are very close to each other and pollen shape can help to distinguish these two species. 2. – continued Species A P E plg plt clg clt ex i ect/end t O. riedliana M 16.32 12.72 2.79 3.59 12.61 3.26 0.41 0.65 0.66 7.75 SD 0.55 0.39 0.44 0.43 0.73 0.26 0.05 0.07 0.33 Min–Max 15–17 12–13.5 2–3.5 2.5–4.5 11.5–13.5 2.5–3.5 0.3–0.5 0.5–0.8 7–8 O. roussaei M 14.84 10.5 2.79 2.82 10.71 2.45 1 0.51 2 5.96 SD 0.51 0.44 0.27 0.27 0.33 0.2 0.16 0.07 0.24 Min–Max 13–16 9–11.5 Keywords: c o; c t; min; o t

• Shallots in Croatia – genetics, morphology and nomenclature by Puizina, Jasna (2013) - The shallot A. × proliferum represents a hybrid between the two closely related species, A. cepa and A. fistulosum L. The third form of shallot, A. × cornutum is a still incompletely understood triploid hybrid between A. cepa and one or two closely related Allium species, whose identity has not been fully elucidated. Keywords: a. cepa; allium; cepa; cornutum; onion; puizina; shallot; triploid

• Occurrence of the sexual morph of Erysiphe macleayae on Chelidonium majus in Romania by Chinan, Vasilica Claudiu (2018) - Key words: greater celandine, powdery mildew, chasmothecia, ITS * Corresponding author, e-mail: vasilechinan@yahoo.com Introduction thecia) were also found in Germany in 2014 (Braun 2014) and Slovakia in 2014 and 2015 (Pastirčáková et al. 2016). Besides these hosts, it was also reported as causal agent of powdery mildew on Macleaya microcarpa (Maxim.) Keywords: erysiphe; macleayae; majus; mildew; powdery

• De novo transcriptome analysis of high growth rate Pyropia yezoensis (Bangiales, Rhodophyta) mutant with high utilization of nitrogen by Choi, Jong-il; Park, Seo-jeong (2020) - Bases (total) Avg. length (bp) GC (%) Reads (no.) % of raw data GC (%) List of differentially expressed genes in Pyropia yezoensis mutant (Py2K) related to the Shikimate pathway. Keywords: line; mutant; pyropia; suppl; yezoensis

• In Memoriam, Sister Edita Marija Šolić Ph.D. (1946 – 2021) by Šoljan, Dubravka (2022) - Most of the proceedings from the mentioned confer- ences were published in the journal Acta Biocovica, whose editor-in-chief was Jure Radić, with Sister Edita Šolić being his first assistant. From 1997 to 2001 Edita Šolić was the editor of the journal. Keywords: biokovo; biology; edita; m.e; makarska; marija; nature; science; sister; šolić

• Thirty-ninth EADSVE Meeting will be held in Dubrovnik, Croatia, in 2021 by Jasprica, Nenad (2020) - The society organises meetings every second year. ex A. Bolòs et O. de Bolòs in A. Bolòs y Vayreda 1950. Keywords: dubrovnik; meeting

• Chorological notes of Carex L. (Cyperaceae) for the Flora of the Balkans, with emphasis in Albania by Martín-Bravo, Santiago; Benítez-Benítez, Carmen; Míguez-Ríos, Mónica; Meco, Marjol; Jiménez-Mejías, Pedro (2022) - In the Balkans, C. agastachys has been confirmed from Bulgaria, Greece, European Turkey, Serbia and Slovenia, and C. pendula from Croatia, Greece, Montenegro and Slovenia (Míguez et al. 2018). Finally, recent Albanian checklists and floras include C. pendula s.l. without taking into account the potential pres- ence of C. agastachys (Vangjeli 2015, Pils 2016, Barina et al. 2018). Keywords: albania; benítez; c. benítez; carex; jiménez; martín; mejías; míguez; species

• A morphological study on the dioecious endemic Erodium somanum H. Pesmen (Geraniaceae), critically endangered in Turkey by Oskay, Dilek (2017) - Keywords: dioecious plant, endangered endemic plant, Erodium somanum, fl ower morphology, micromor- phology. General appearance of Erodium somanum in nature. Keywords: erodium; mericarp; somanum

• Hieracium pollinense (Asteraceae), an endemic species to the Pollino National Park (Southern Italy) rediscovered by Gottschlich, Günter; Scafidi, Filippo; Di Gristina, Emilio (2017) - Beyond that it was a younger homonym to H. rigoanum Zahn 1902. So far, the presence of H. pollinense in Italy was known from the type specimens only. Keywords: hieracium; national; park; pollinense; pollino; species; zahn

• First record of Inocutis tamaricis in Romania with comments on its cultural characteristics by Chinan, Vasilica Claudiu; Fusu, Lucian; Manzu, Ciprian Claudiu (2015) - 74 (1), 2015 Molecular analysis The identical ITS sequences obtained from the basidioma and cultured mycelium con- fi rmed that observations were made on I. tamaricis mycelium and not on a contaminant species. LARKIN, M. A., BLACKSHIELDS, G., BROWN, N. P., CHENNA, R., MCGETTIGAN, P. A., MCWIL- LIAM, H., VALENTIN, F., WALLACE, I. M., WILM, A., LOPEZ, R., THOMPSON, J. D., GIBSON, T. INOCUTIS TAMARICIS IN ROMANIA ACTA BOT. Keywords: inocutis; romania; species; tamaricis

• Nomenclature of the Balkan alliance Romuleion graecae (Poetea bulbosae) by Terzi, Massimo; Jasprica, Nenad; Čarni, Andraž; Matevski, Vlado; Bergmeier, Erwin; Theurillat, Jean-Paul (2024) - A second association, Romuleo graecae-Poetum bulbo- sae, was also validly published by Čarni et al. (2014) and classified in the Romuleion. Two relevés containing Poa bulbosa together with Stipa capensis (= S. tortilis) were published by Čarni et al. (2014) among the relevés of the Romuleo graecae-Poetum bulbosae (relevés 14 and 20, Table 1). Keywords: alliance; bulbosae; et al; oberdorfer; poetum; romuleion; timoleontis; čarni

• Setaria adhaerens (Forssk.) Chiov. (Poaceae), a new alien species in the Croatian flora by Maslo, Semir (2019) - Wang et al (2009) pointed out that diploid counts for S. verticillata are most likely misidentified S. adhaerens plants. Morrone, O., Aliscioni, S. S., Veldkamp, J. F., Pensiero, J. F., Zu- loaga, F. O., Kellogg, E. A., 2014: Revision of the Old World species of Setaria (Poaceae: Panicoideae: Paniceae). Keywords: adhaerens; setaria; species; spikelets; verticillata

• Gas exchange in genotypes of Nopalea cochenillifera in different seasons and evaluations times: Gas exchange in genotypes of Nopalea cochenillifera Salm-Dyckin by Aires Souza, José Thyago; Silva Araújo, Jucilene ; dos Santos Félix, Evaldo ; de Cássia Alves, Rita ; de Oliveira Filho, Tarcísio José ; Cunha de Lira, Elder (2022) - Keywords: Brazil, Cactaceae, CO2 uptake, forage cactus, semi-arid, xerophilus Introduction The forage basis of cattle-raising in the Brazilian semi- arid region is constituted by plants native to the Caatinga associated with the cultivation of exotic species. Discussion The remarkable adaptability of forage cactus in environ- ments with rainfall restrictions, associated with crassula- ceous acid metabolism, characterized by nocturnal stomatal opening, enables this plant to become the most cultivated xerophilic species in Brazil. Keywords: baiana; cactus; co2; fig; forage; miúda; rainy; season; varieties

• A word from the new Editor in Chief by Salopek Sondi, Branka (2014) - OPCE-STR.vp A word from the new Editor-in-Chief Dear authors, readers, and friends of Acta Botanica Croatica First of all, I want to express my thanks to the Editorial Board of Acta Botanica Croatica for its vote of confidence by appointing me the new Editor-in-Chief of the jour- nal. Acta Botanica Croatica has been fortunate to have had an outstanding editor over the last fifteen years, and I gratefully acknowledge my immediate predecessor, Professor Damir Vili~i}, for having established and maintained a particularly high standard of editorship. Keywords: editor

• First Italian record of Paspalum notatum Flüggé (Poaceae) and its typification by Stinca, Adriano; Galasso, Gabriele; Banfi, Enrico (2016) - Keywords: alien species, invasiveness, phytoremediation, vascular fl ora * Corresponding author, e-mail: adriano.stinca@unina.it Introduction The genus Paspalum L. (Poaceae) comprises about 330 species (Zuloaga and Morrone 2005) and is chiefl y distrib- uted in tropical and temperate regions of America (Zuloaga et al. 2003). References Allen, C. M., Hall, D. W., 2002: 25.26 Paspalum L. Keywords: notatum; paspalum

• A Word from the Guest Editors by Bogdanovic, Sandro; Jogan, Nejc (2016) - At the end, in the name of Organizers of 6th BBC, we can all thank the participants for shaping up a pleasant, informative and fruitful congress with an exchange of up-to-date results from various fi elds of botany. And fi nally, but not the least, we have to thank the organizing consortium of local organizers: Rijeka Natural History Mu- seum and the University of Rijeka, which offered us a comfortable space in their campus, and the active members of the two botanical associations Croatian Botanical Society (HBoD) and Botanical Society of Slovenia (BDS). Keywords: bbc; congress; rijeka

• A comparative anatomical study of the genus Puschkinia Adams in Turkey by Yetisen, Kadriye; Yıldırım, Hasan; Ozdemir, Canan (2020) - Although the stem vascular bundles were arranged in two rows in P. peshmenii, they can observed in three rows in P. scilloides and P. bilgineri. In P. scilloides, 23–29 collateral vascular bundles with thick- walled cells were arranged in 3 rings, while in P. bilgineri there were 16–20 vascular bundles arranged in 3 rings, and in P. peshmenii, there were 14–17 vascular bundles arranged in two rings. Keywords: bilgineri; peshmenii; puschkinia; scilloides; species

• First record of Diplotomma cedricola in the eastern Mediterranean by Aragón, Gregorio; Martínez, Isabel (2023) - This lichen species was found near Iérapreta on decorticated Cupressus sempervirens L. and Pinus brutia Ten. A – Decorticated trunk of Cupressus sempervirens L., 1174 m a.s.l., Crete, is a typical habitat of Diplotomma cedricola (Werner) Etayo. Keywords: cedricola; diplotomma; species; werner

• First record of the Pisutiella phaeothamnos in the western Mediterranean by Aragón, Gregorio; Negrón García, Valerie; Giménez, Gil Fernando (2025) - Localities of sampling: Spain: Ciudad Real province, Ballesteros de Calatrava, la Conejera, 38°48'0.2''N, 3°56'20.5''W, 830 m a.s.l., among mosses on volcanic rocks, G. Aragón & G. F. Giménez, n° 1566, November 16, 2023, MACB. The species was discovered among mosses on volcanic rocks in the Spanish Central Volcanic Region. Keywords: phaeothamnos; pisutiella

• Chlorophyll a fluorescence measurements in Croatia • the first twenty years by Salopek Sondi, Branka (2024) - This monograph, pub- lished in English, is thus a tribute to twenty years of the ap- plication of ChlF methods in biology and agronomy in the Republic of Croatia. In Croatia, the pioneering work in ChlF research began in the Department of Biology of the Josip Juraj Strossmayer University of Osijek. Keywords: chlf; research

• Stellaria ruderalis (Caryophyllaceae) in the Caucasus, new records and species habitat preferences by Novák, Pavel; Taraška, Vojtěch; Kalníková, Veronika; Hubatka, Petr; Rohel, Jaroslav; Fayvush, George (2025) - Mucina, L., Bültman, H., Dierssen, K., Theurillat, J.-P., Dengler, J., Čarni, A., Šumberová, K., Raus, T., Di Pietro, R., Gavilán Garcia, R., Chytrý, M., Iakushenko, D., Schaminée, J. H. J., Bergmeier, E., Santos Guerra, A., Daniëls, F. J. A., Ermakov, N., Valachovič, M., Pignatti, S., Rodwell, J. S., Pallas, J., Cape- lo, J., Weber, H. E., Lysenko, T., Solomeshch, A., Dimopoulos, P., Aguiar, C., Freitag, H., Hennekens, S. M., Tichý, L., 2016: Vegetation of Europe: Our knowledge of the global distribution of S. ruderalis is still far from com- plete. Keywords: caucasus; georgia; lepší; ruderalis; species; stellaria

• Manihot grahamii Hook. (Euphorbiaceae), a new alien species for the Eurasian area with nomenclatural, taxonomical, morphological and ecological notes by Iberite, Mauro; Iamonico, Duilio (2015) - In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALENTINE, D. H., WALTERS, S. M., WEBB, D. E. (eds.), Flora Europaea, 2, 211– 226. This is the second record in Europe for the genus and the fi rst of M. grahamii for the Eurasian area. Keywords: carthaginensis; grahamii; manihot; species

Epilogue

For more detail, about this study carrel, see the computed home page. For more detail about study carrels in general, see the read me file.

Created: 2025-12-24