[{"id": "abc-1006", "words": "6189", "extension": ".pdf", "flesch": "52", "author": "Kabas, Eva; Batanjski, Vera; Glasnovic, Peter; Vicic, Drazen; Tanaskovic, Aljosa; Kuzmanovic, Nevena; Lakusic, Dmitar; Sinzar Sekulic, Jasmina", "title": "Towards detecting bioclimatic niche \u2013 species distribution modelling in four maple species (Acer spp.)", "date": "2014", "keywords": "acta; bioclimatic; bot; croat; data; distribution; pseudoplatanus; serbia; species", "summary": "Journal of Arachnology 36, 574\u2013582. AUSTIN, M. P., 2002: Spatial prediction of species distribution: an interface between eco- logica theory and statistical modelling. Predicting species distribution: offering more than simple habitat models.", "mime": "application/pdf"}, {"id": "abc-1008", "words": "4750", "extension": ".pdf", "flesch": "65", "author": "Kocic, Aleksandra; Horvatic, Janja; Jelaska, Sven D", "title": "Distribution and morphological variations of invasive macrophytes Elodea nuttallii (Planch.) H. St. John and Elodea canadensis Michx in Croatia", "date": "2014", "keywords": "canadensis; croatia; elodea; leaf; leaves; length; nuttallii; species", "summary": "E. canadensis E. nuttallii Statistics Leaf width at the mid-point (mm) 2.05\u00b10.22 (1.83\u20132.38) 1.14\u00b10.27 (0.63\u20131.64) t = 6.602 P < 0.001 Leaf length (mm) 7.22\u00b11.38 (5.64\u20139.61) 10.45\u00b12.11 (7.62\u201314.01) t = \u20134.449 P < 0.001 Width/length ratio 0.29\u00b10.06 (0.24\u20130.40) 0.11\u00b10.03 (0.09\u20130.17) t = 7.039 P < 0.001 Leaf width 0.5 mm below the tip (mm) 1.22\u00b10.17 (1.03\u20131.51) 0.50\u00b10.09 (0.33\u20130.72) t = 8.152 P < 0.001 Angle at the leaf apex (\u00b0) 54.34\u00b13.49 (50.89\u201360.35) 28.31\u00b13.55 (19.92\u201333.97) t = 10.814 P < 0.001 Internode length (mm) 58.65\u00b18.11 (38.35\u201381.78) 52.64\u00b118.64 (29.52\u201387.43) t = 0.405 P = 0.692 After its estab- lishment, E. nuttallii begins to spread to the eastern and northern part of the drainage chan- nel network from 2006\u20132009.", "mime": "application/pdf"}, {"id": "abc-101", "words": "4156", "extension": ".pdf", "flesch": "60", "author": "Williams, David M.", "title": "Araphid Diatom Classification and The \"Absolute Standard\"", "date": "2009", "keywords": "genus; licmophora; node; species; sub; tree", "summary": "Since that time a few more papers have appeared on 'araphid' diatom phylogeny, particularly from a molecular perspective (SATO et al. 2008a, 2008b, MEDLIN et al. 2008a, 2008b). A contribution of some significance is MEDLIN et al. (2008b), as it presents a large quantity of data and proposes one of the first trees of relationships to include a good num- ber of the diverse 'araphid' diatoms.", "mime": "application/pdf"}, {"id": "abc-102", "words": "4169", "extension": ".pdf", "flesch": "60", "author": "Gladenkov, Andrey Yurievich", "title": "Fossil diatom flora from the marine Paleogene stratigraphic key section of Northeast Kamchatka, Russia", "date": "2009", "keywords": "alugivayam; diatom; formation; gladenkov; oligocene; p p", "summary": "Two diatom assemblages of different ages are recognized in different parts of the 900 m-thick Alugivayam Formation. Conclusions The Alugivayam Formation of the Il\u2019pinskii Peninsula stratigraphic section, northeast Kamchatka, contains Oligocene marine diatom assemblages of moderate to poor preserva- tion and low abundance.", "mime": "application/pdf"}, {"id": "abc-1021", "words": "5453", "extension": ".pdf", "flesch": "54", "author": "Vujcic, Valerija; Radic Brkanac, Sandra", "title": "Physiological and biochemical responses of Fibigia triquetra (DC.) Boiss. to osmotic stress", "date": "2014", "keywords": "aldrich; content; mannitol; peg; period; plant; sigma; stress; triquetra; water", "summary": "FAROOQ, M., WAHID, A., KOBAYASHI, N., FUJITA, D., BASRA, S. M. A., 2009: Plant drought stress: effects, mechanisms and management. Boiss. to osmotic stress VALERIJA VUJ\u010cI\u0106*, SANDRA RADI\u0106 BRKANAC Department of Biology, Faculty of Science, University of Zagreb, Rooseveltov trg 6, HR-10000 Zagreb, Croatia Abstract \u2013 Water defi cit in the soil leads to osmotic stress in plants.", "mime": "application/pdf"}, {"id": "abc-1039", "words": "6043", "extension": ".pdf", "flesch": "63", "author": "Khan, Sami U.; Din, Jalal U.; Qayyum, Abdul; Jaan, Noor E.; Jenks, Matthew A.", "title": "Heat tolerance indicators in Pakistani wheat (Triticum aestivum L.) genotypes", "date": "2015", "keywords": "anthesis; as-2002; genotypes; grain; growth; heat; heat stress; plant; proline; signifi; stage; stress; yield", "summary": "Thus, there is a dire need for the development of heat tolerant wheat genotypes through a breeding program for cultivation under heat stress environments like those prevailing in Pakistan. Keywords: anthesis, grain yield, heat stress, membrane stability index, milky seed stage, proline, soluble proteins, Triticum aestivum L., wheat Introduction High temperature is a major problem in fi eld cropping systems world-wide, with unex- pected spatial and temporal variations causing reduced plant growth and productivity (PAR- ENT et al. 2010).", "mime": "application/pdf"}, {"id": "abc-104", "words": "6151", "extension": ".pdf", "flesch": "59", "author": "Pite, Danielle P.; Lane, Kelly A.; Hermann, Anna K.; Spaulding, Sarah A.; Finney, Bruce P.", "title": "Historical abundance and morphology of Didymosphenia species in Naknek Lake, Alaska", "date": "2009", "keywords": "abundance; didymosphenia; footpole; geminata; headpole; lake; naknek; river", "summary": "The second objective of this paper is to examine the morphology of D. geminata cells preserved in sediments dating to 800 years B.P. and compare valve shape to modern, bloom-forming populations of D. geminata from around the world. 2. Mean, standard deviation and number of D. geminata valves measured for valve length, width, footpole width, footpole constriction, headpole width, and headpole constriction (all in mm) for Naknek Lake, Matap\u00e9dia River (Qu\u00e9bec), Popo Agie River (Wyoming), Blue River (Colorado) and Waiau River (New Zealand).", "mime": "application/pdf"}, {"id": "abc-105", "words": "4380", "extension": ".pdf", "flesch": "60", "author": "Hernandez-Becerril, David U.; Moreno-Guti\u00c3\u00a9rrez, Sara P.; Bar\u00c3\u00b3n-Campis, Sof\u00c3\u00ada A.", "title": "Morphological variability of the planktonic diatom Thalassiosira delicatula Ostenfeld emend. Hasle from the Mexican Pacific, in culture conditions", "date": "2009", "keywords": "cells; fig; figs; fultoportulae; hasle; processes; species; thalassiosira; valve", "summary": "HARRIS, A. S. D., MEDLIN, L. K., LEWIS, J., JONES, K. J., 1995: Thalassiosira species (Bacil- lariophyceae) from a Scottish sea-loch. Thalassiosira species from the southern Gulf of Mexco.", "mime": "application/pdf"}, {"id": "abc-1060", "words": "2526", "extension": ".pdf", "flesch": "71", "author": "Hrusevar, Dario; Mitic, Bozena; Sandev, Dubravka; Alegro, Antun", "title": "Echinochloa colona (L.) Link (Poaceae), a new species in the flora of Croatia", "date": "2015", "keywords": "colona; croatia; echinochloa; medvednica; species; zagreb", "summary": "Determination key for Echinochloa species in Croatia 1. Taxonomy and distribution of Echinochloa species with special ref- erence of their occurrence as weeds of rice.", "mime": "application/pdf"}, {"id": "abc-1061", "words": "11820", "extension": ".pdf", "flesch": "61", "author": "Catoni, Rosangela; Gratani, Loretta; Sartori, Francesco; Varone, Laura; Granata, Mirko Umberto", "title": "Carbon gain optimization in five broadleaf deciduous trees in response to light variation within the crown: correlations among morphological, anatomical and physiological leaf traits", "date": "2015", "keywords": "alba; chl; crown; et al; forest; leaf; light; plasticity; robur; shade; shade leaves; species; sun; sun leaves; sun shade; thickness; tree", "summary": "Among the considered species, A. campestre and C. avellana sun leaves were closer to shade leaf behavior and P. alba shade leaves were closer to sun leaf behavior. The relationship between canopy structure and the spa- tial distribution of light availability differs between primary and secondary growth forests (NICOTRA et al. 1999) and light availability in the understory is frequently associated with regeneration processes and the long-term survival of forest tree species (WOODS 2000).", "mime": "application/pdf"}, {"id": "abc-1065", "words": "4217", "extension": ".pdf", "flesch": "63", "author": "Magrini, Sara; Scoppola, Anna", "title": "Variability of pollen aperture heteromorphism in annual pansies (Viola Section Melanium)", "date": "2015", "keywords": "aperturate; grains; owers; pollen; species; viola", "summary": "Still, 4-ap- erturate pollen grains were also observed by other authors (ERDTMAN 1952, DAJOZ et al. 1995, ESPEUT 1999). For each species, microphotographs of pollen grains were taken using a digital camera, Fujifi lm FinePix S2980.", "mime": "application/pdf"}, {"id": "abc-1066", "words": "9473", "extension": ".pdf", "flesch": "59", "author": "Chakraborty, Koushik; Singh, Amrit L.; Kalariya, Kuldeep A.; Goswami, Nisha; Zala, Pratap V.", "title": "Physiological responses of peanut (Arachis hypogaea L.) cultivars to water deficit stress: status of oxidative stress and antioxidant enzyme activities", "date": "2015", "keywords": "activity; chlorophyll; cit; cit stress; content; cultivars; defi; defi cit; peanut; pod; stage; stress; water; water defi", "summary": "74 (1), 123\u2013142, 2015 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Physiological responses of peanut (Arachis hypogaea L.) cultivars to water defi cit stress: status of oxidative stress and antioxidant enzyme activities KOUSHIK CHAKRABORTY*, AMRIT L. SINGH, KULDEEP A. KALARIYA, NISHA GOSWAMI, PRATAP V. ZALA Directorate of Groundnut Research (ICAR), Junagadh \u2013 362001, Gujarat, India Abstract \u2013 From a fi eld experiment, the changes in oxidative stress and antioxidant en- zyme activities were studied in six Spanish peanut cultivars subjected to 25\u221230 days of water defi cit stress at two different stages: pegging and pod development stages. Chlorophyll a/b ratio increased under water defi cit stress in most of the cultivars suggesting a greater damage to chlorophyll b rather than an increase in chlorophyll a content.", "mime": "application/pdf"}, {"id": "abc-1087", "words": "3965", "extension": ".pdf", "flesch": "57", "author": "Brana, Slavko; Vukovic, Nina; Kaligaric, Mitja", "title": "Least adder\u2019s-tongue (Ophioglossum lusitanicum L.) in Croatia \u2013 distribution, ecology and conservation", "date": "2014", "keywords": "acta; croatia; istria; localities; lusitanicum; ophioglossum; ora; pula; species", "summary": "For this reason, O. lusitanicum was overlooked and listed as extinct in the fi rst complete index of the Croatian fl ora (HR\u0160AK 1994) and the fi rst Red Book of plant species of the Republic of Croatia (MARKOVI\u0106 1994). O. lusitanicum is a cosmopolite species, widely distrib- uted in Europe in the Mediterranean/Western European part (CLAUSEN 1938, JALAS and SUOMINEN 1972, DERRICK et al. 1987, AKEROYD 1993).", "mime": "application/pdf"}, {"id": "abc-110", "words": "2596", "extension": ".pdf", "flesch": "59", "author": "Enache, Mihaela D.; Potapova, Marina", "title": "A new species of Sellaphora (Sellaphoraceae) from Hannaberry Lake, Arkansas, U.S.A.", "date": "2009", "keywords": "diatom; figs; lake; sellaphora; species; valve", "summary": "Sellaphora species with fine striation, such as Sellaphora wallacei (Reimer) POTAPOVA M. G., PONADER, K. C., 2008: New species and combinations in the diatom genus Sellaphora (Sellaphoraceae) from southeastern United States.", "mime": "application/pdf"}, {"id": "abc-112", "words": "9278", "extension": ".pdf", "flesch": "60", "author": "Morales, Eduardo A.; Fernandez, Erika; Kociolek, J. Patrick", "title": "Epilithic diatoms (Bacillariophyta) from cloud forest and alpine Epilithic diatoms (Bacillariophyta) from cloud forest and alpine streams in Bolivia, South America 3: diatoms from Sehuencas, Carrasco National Park, Department of Cochabamba", "date": "2009", "keywords": "achnanthidium; apices; area; bertalot; croat; diatoms; gomphonema; k\u00fctzing; lange; morales; raphe; sehuencas; species; striae; taxa; valve", "summary": "Notice clear central area in raphe valve and the ab- sence of such an area in the rapheless valve. Sometimes clear in raphe valve, but often with shortened or even complete striae.", "mime": "application/pdf"}, {"id": "abc-1120", "words": "8577", "extension": ".pdf", "flesch": "64", "author": "Kolodziejek, Jeremi; Glinska, Slawa; Michlewska, Sylwia", "title": "Seasonal leaf dimorphism in Potentilla argentea L. var. tenuiloba (Jord.) Sw. (Rosaceae)", "date": "2015", "keywords": "acta; area; argentea; autumn; chloroplast; density; leaf; leaves; potentilla; summer; summer leaves; thickness", "summary": "From the primary data the following variables were derived: 1) dissection index (DI) according to KINCAID and SCHNEIDER (1983), MCLELLAN (1993, 2000): DI = perimeter/[2\u221aarea \u00d7 p], 2) leaf mass area (LMA, mg mm\u20132; leaf dry mass per one-sided leaf area), and 3) leaf density (LD, mg mm\u20133; leaf dry mass per leaf volume [leaf area \u00d7 leaf thickness]). Key words: leaf dimorphism, leaf structure, leaf mass area, Potentilla argentea *", "mime": "application/pdf"}, {"id": "abc-113", "words": "4805", "extension": ".pdf", "flesch": "59", "author": "Srajer, Johannes; Majlis, Burhanuddin J.; Gebeshuber, Ille C.", "title": "Microfluidic simulation of a colonial diatom chain reveals oscillatory movement", "date": "2009", "keywords": "cells; chain; diatom; direction; flow; fluid; forces; gaps; model", "summary": "Forces acting on model diatom cells numbered from A1 to A10 for incoming flow condi- tions of 0.01 m s\u20131 in the positive x-direction. The reason for this is that the solution for the forces in the x-direction is trivial: the whole chain of model diatoms accelerates in the direction of the flow.", "mime": "application/pdf"}, {"id": "abc-1136", "words": "5659", "extension": ".pdf", "flesch": "61", "author": "Safaei, Masoumeh; Sheidai, Masoud; Alijanpoor, Behnaz; Noormohammadi, Zahra", "title": "Species delimitation and genetic diversity analysis in Salvia with the use of ISSR molecular markers", "date": "2016", "keywords": "analysis; hsbu; hypoleuca; issr; length; salvia; salvia species; species; structure", "summary": "Salvia species are herbaceous, suffruticose or shrubby perennials, rarely biennial or annual, often strongly aromat- ic. In addition, Salvia species are grown in parks and gardens as ornamental plants (\u00d6zdemir and Senel 1999).", "mime": "application/pdf"}, {"id": "abc-114", "words": "4162", "extension": ".pdf", "flesch": "58", "author": "Stachura-Suchoples, Katarzyna; Jahn, Regine", "title": "Middle Miocene record of Pliocaenicus changbaiense sp nov. from Changbai (Jilin Province, China)", "date": "2009", "keywords": "costae; face; fultoportulae; mantle; pliocaenicus; stachura; suchoples; valve", "summary": "In P. changbaiense the number of costae in 10 mm is similar to P. cathayanus and P. jilinensis, and in the lowest range to P. omarensis. This character differentiates P. omarensis from P. changbaiense.", "mime": "application/pdf"}, {"id": "abc-1140", "words": "2817", "extension": ".pdf", "flesch": "63", "author": "Kir\u00e1ly, Gergely; Alegro, Antun", "title": "Re-evaluation of the Panicum capillare complex (Poaceae) in Croatia", "date": "2015", "keywords": "capillare; complex; croatia; mtb; panicum; riparium; species", "summary": "The paper presents a new key for the determination of Croatian species of the com- plex and anticipates the invasion of P. riparium in the sub-Mediterranean regions of the Balkan Peninsula. Her- barium revisions of the P. capillare complex have shown that P. riparium is not a new invader but an overlooked, long-established taxon in central Europe, and, in some parts of the synanthropic European range, is more abundant than P. capillare s. str.", "mime": "application/pdf"}, {"id": "abc-1148", "words": "4597", "extension": ".pdf", "flesch": "65", "author": "Karaismailoglu, Mehmet Cengiz", "title": "Morphological and anatomical features of seeds of Turkish Romulea taxa (Iridaceae) and their taxonomic significance", "date": "2015", "keywords": "characters; romulea; seeds; species; tab; taxa; testa; turkey", "summary": "Cross section structures of Turkish Romulea seeds; 1: overall appearance; anticlinal cell types: 2: fl at cell (R7), 3: crushed cell (R2, R3, R4, R5 and R6), 4: undulated cell (R1), types of embryo, 5: oval (R4 and R5), 6: prolonged (R1, R6 and R7), 7: globular (R2 and R3); for taxa abbreviations see Tab. 1; e \u2013 embryo, en \u2013 endosperm, sr \u2013 storage reserve, t \u2013 testa, ec \u2013 epidermal cells of testa, fc \u2013 fl at cell, ph \u2013 phytomelan layer, cc \u2013 crushed cell, uc \u2013 undu- lated cell; white scale bars = 100 \u03bcm, black scale bars = 50 \u03bcm. 74 (1), 31\u201341, 2015 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 Morphological and anatomical features of seeds of Turkish Romulea taxa (Iridaceae) and their taxonomic signifi cance MEHMET CENG\u0130Z KARA\u0130SMA\u0130LO\u011eLU Istanbul University, Faculty of Science, Department of Biology, 034116 Istanbul, Turkey", "mime": "application/pdf"}, {"id": "abc-1149", "words": "2464", "extension": ".pdf", "flesch": "66", "author": "Bogdanovic, Sandro; Ljubicic, Ivica; Clementi, Moreno", "title": "Aegilops uniaristata Vis. (Poaceae): typification and occurrence in Croatia", "date": "2015", "keywords": "aegilops; croatia; flora; herbarium; istria; pad; species; uniaristata", "summary": "(Poaceae): typifi cation and occurrence in Croatia SANDRO BOGDANOVI\u01061*, IVICA LJUBI\u010cI\u01061, MORENO CLEMENTI2 1 University of Zagreb, Faculty of Agriculture, Department of Agricultural Botany, Sveto\u0161imunska 25, 10000 Zagreb, Croatia 2 University of Padova, Department of Biology, Via Ugo Bassi 58 B, 35131 Padova, Italy Abstract \u2013 After 88 years, occurrence of Aegilops uniaristata Vis. (Poaceae) in Croatian fl ora was confi rmed and its distribution is supplemented by new localities. Present distribution of Aegilops uniaristata Vis. in Croatia (\u25b2 literature data, \u25cf herbarium data).", "mime": "application/pdf"}, {"id": "abc-115", "words": "5682", "extension": ".pdf", "flesch": "51", "author": "Yang, Hong; Flower, Roger J.; Battarbee, Richard W.", "title": "Influence of environmental and spatial variables on the distribution of surface sediment diatoms in an upland loch, Scotland", "date": "2009", "keywords": "analysis; diatom; distribution; environmental; lake; loch; sediment; species; surface; variables; variation; water", "summary": "Spatial variables [(principal coordinates of neighbour matrices (PCNM 1 and PCNM3) positively correlated with redundancy analysis axis 2], indicated that spatial variables, ignored in former studies, are a further influence on diatom distribution. Spatial distribution of surface sediment diatom concentrations (103 valves DW mg\u20131) in the Round Loch of Glenhead in April 2007.", "mime": "application/pdf"}, {"id": "abc-1156", "words": "365", "extension": ".pdf", "flesch": "48", "author": "Salopek Sondi, Branka", "title": "A word from the new Editor in Chief", "date": "2014", "keywords": "editor", "summary": "OPCE-STR.vp A word from the new Editor-in-Chief Dear authors, readers, and friends of Acta Botanica Croatica First of all, I want to express my thanks to the Editorial Board of Acta Botanica Croatica for its vote of confidence by appointing me the new Editor-in-Chief of the jour- nal. Acta Botanica Croatica has been fortunate to have had an outstanding editor over the last fifteen years, and I gratefully acknowledge my immediate predecessor, Professor Damir Vili~i}, for having established and maintained a particularly high standard of editorship.", "mime": "application/pdf"}, {"id": "abc-116", "words": "7283", "extension": ".pdf", "flesch": "65", "author": "Manoylov, Kalina M.; Ognjanova-Rumenova, Nadja; Stevenson, Robert J.", "title": "Morphotype variations in subfossil diatom species of Aulacoseira in 24 Michigan Lakes, USA", "date": "2009", "keywords": "areolae; aulacoseira; camburn; diatom; figs; lake; mantle; sediments; siver; species; valve", "summary": "In: LAST, W. M. and J. P. SMOL (eds), Tracking environmental change using lake sediments, 1: Basin analysis, coring, and chronological techniques, 73\u2013105. Taxonomy, phylogeny, and paleoecology of Eoseira wilsonii gen. et sp. nov., (Bacillariophyceae: Aulacoseiraceae) from lake sediments at Horsefly, British Columbia, Canada.", "mime": "application/pdf"}, {"id": "abc-1163", "words": "6447", "extension": ".pdf", "flesch": "54", "author": "K\u00f3kai, Zsuzsanna; B\u00e1csi, Istv\u00e1n; T\u00f6r\u00f6k, P\u00e9ter; Buczk\u00f3, Krisztina; T-Krasznai, Eniko; Balogh, Csaba; T\u00f3thm\u00e9r\u00e9sz, B\u00e9la; B-B\u00e9res, Vikt\u00f3ria", "title": "Halophilic diatom taxa are sensitive indicators of even short term changes in lowland lotic systems", "date": "2015", "keywords": "autumn; changes; class; classes; diatom; et al; halophilic; nitzschia; number; size; taxa; taxa number", "summary": "H-1476 Hungary Abstract \u2013 The occurrence and spread of halophilic diatom taxa in freshwater lotic eco- systems are infl uenced both by natural processes and anthropogenic pollution. The relationship among halophilic diatom taxa composition and environmental factors dis- played by a detrended correspondence analysis (DCA).", "mime": "application/pdf"}, {"id": "abc-1164", "words": "4800", "extension": ".pdf", "flesch": "62", "author": "B-B\u00e9res, Vikt\u00f3ria; B\u00e1csi, Istv\u00e1n; T-Krasznai, Eniko; K\u00f3kai, Zsuzsanna; Buczk\u00f3, Krisztina", "title": "First report of Navicula jakovljevicii Hustedt (Bacillariophyta) from Hungary: distribution, comparative morphology and a related species", "date": "2015", "keywords": "diatom; distribution; fig; jakovljevicii; navicula; raphe; species; valve", "summary": "H-1476 Hungary Abstract \u2013 In Hungary Navicula jakovljevicii was fi rstly recorded in biofi lm of Elodea nut- tallii in 2005 in an oxbow of the catchment area of the River Danube. Results In Hungary Navicula jakovljevicii was fi rst recorded in autumn of 2005 in an oxbow at \u00c1sv\u00e1nyr\u00e1r\u00f3 (Fig. 1).", "mime": "application/pdf"}, {"id": "abc-1165", "words": "2816", "extension": ".pdf", "flesch": "67", "author": "K\u00f6v\u00e9r, Csilla; Korponai, J\u00e1nos; Harangi, S\u00e1ndor; Buczk\u00f3, Krisztina", "title": "A new European record of Diadesmis fukushimae and its transference to Humidophila genus (Bacillariophyta)", "date": "2015", "keywords": "bertalot; diadesmis; diatom; figs; fukushimae; humidophila; lange; valve", "summary": "74 (2), 245\u2013252, 2015 CODEN: ABCRA 25 ISSN 0365-0588 eISSN 1847-8476 DOI: 10.1515/botcro-2015-0020 A new European record of Diadesmis fukushimae and its transference to Humidophila genus (Bacillariophyta) CSILLA K\u00d6V\u00c9R1, J\u00c1NOS KORPONAI1, S\u00c1NDOR HARANGI2, KRISZTINA BUCZK\u00d33* 1 University of West Hungary, Faculty of Natural Science, K\u00e1rolyi G\u00e1sp\u00e1r t\u00e9r 4. H-9700 Szombathely, Hungary (kover.csilla@ttk.nyme.hu) 2 University of Debrecen, Faculty of Natural Science, Egyetem t\u00e9r 1. H-4032 Debrecen, Hungary 3 Department of Botany, Hungarian Natural History Museum, K\u00f6nyves K\u00e1lm\u00e1n krt. 40. Locations and some chemical parameters of the lakes where Humidophila fukushimae was found.", "mime": "application/pdf"}, {"id": "abc-1171", "words": "9661", "extension": ".pdf", "flesch": "60", "author": "Dre\u00dfler, Mirko; Verweij, Geurt; Kistenich, Sonja; Kahlert, Maria; Werner, Petra", "title": "Applied use of taxonomy: lessons learned from the first German intercalibration exercise for benthic diatoms", "date": "2015", "keywords": "bertalot; cation; fig; identifi; lake; lange; participants; placentula; species; valves", "summary": "In the Lake Krossinsee sample the three auditors identifi ed N. cryptotenella with 5.9\u2013 10.0% (average 8.3%) (Fig. As two auditors and most participants unambiguously identifi ed N. reichardtiana and no auditor and only fi ve participants identifi ed N. caterva, we could assume that the latter are misidentifi cations.", "mime": "application/pdf"}, {"id": "abc-1172", "words": "7584", "extension": ".pdf", "flesch": "59", "author": "Kociolek, John Patrick; Williams, David M.", "title": "How to define a diatom genus? Notes on the creation and recognition of taxa, and a call for revisionary studies of diatoms", "date": "2015", "keywords": "characters; diatom; genera; genus; groups; kociolek; new; species; taxa", "summary": "DIATOM GENUS: A REVISION ACTA BOT. DIATOM GENUS: A REVISION ACTA BOT.", "mime": "application/pdf"}, {"id": "abc-1174", "words": "5866", "extension": ".pdf", "flesch": "59", "author": "Kahlert, Maria; Savatijevic Rasic, Ivana", "title": "Similar small-scale variation of diatom assemblages on different substrates in a mesotrophic stream", "date": "2015", "keywords": "assemblages; diatom; plants; sampling; scale; stones; stream; substrates; taxa; variation", "summary": "Spatial scale variation The impact of the fi xed factor substrate and the random factors dm- and cm- scale on the variation of the diatom indices was assessed by calculating coeffi cients of variance (CV%) for each sampled scale (cm-scale n = 5, dm-scale n = 5) for the diatom indices and for the number of taxa and the diversity of both substrates. Differences in diatom assemblages scraped from plants (submerged macrophytes and mosses) with replicates at different spatial scales.", "mime": "application/pdf"}, {"id": "abc-1175", "words": "5644", "extension": ".pdf", "flesch": "60", "author": "Krizmanic, Jelena; Ilic, Marija; Vidakovic, Danijela; Subakov Simic, Gordana; Petrovic, Jelena; Cvetanovic, Katarina", "title": "Diatoms of the Dojkinci River (Stara Planina Nature Park, Serbia)", "date": "2015", "keywords": "bertalot; diatoms; dojkinci; ehrenberg; eunotia; figs; grunow; k\u00fctzing; lange; navicula; river; serbia; species", "summary": "Lowe et al. Cocconeis pediculus Ehrenberg Humidophila ingeae (Van de Vijver) Key words: Brachysira intermedia, Chamaepinnularia mediocris, Diatomella balfouri- ana, diatoms, distribution, Dojkinci River, Navicula tridentula.", "mime": "application/pdf"}, {"id": "abc-1177", "words": "5352", "extension": ".pdf", "flesch": "56", "author": "Dedic, Anita; Plenkovic-Moraj, Andjelka; Kralj Borojevic, Koraljka; Hafner, Dubravka", "title": "The first report on periphytic diatoms on artificial and natural substrate in the karstic spring Bunica, Bosnia and Herzegovina", "date": "2015", "keywords": "artifi; bertalot; bunica; cial; diatoms; ehrenberg; k\u00fctzing; spring; substrate; taxa; water", "summary": "Discussion This paper presents research of periphytic diatoms sampled from natural substrate and artifi cial substrate in Bunica Spring. Use of artifi cial substrates (glass slides) for quantifi cation of periphyton was recom- mended by WAHL and MARK (1999), ALBAY and AKCAALAN (2003), LIBORIUSSEN (2005) who consider them more favorable for experimental growth than natural substrates.", "mime": "application/pdf"}, {"id": "abc-1178", "words": "7640", "extension": ".pdf", "flesch": "58", "author": "Nenadovic, Tina; Sarcevic, Tena; Cizmek, Hrvoje; Godrijan, Jelena; Maric Pfannkuchen, Danijela; Pfannkuchen, Martin; Ljubesic, Zrinka", "title": "Development of periphytic diatoms on different artificial substrates in the Eastern Adriatic Sea", "date": "2015", "keywords": "abundance; artifi; biofi; cells; cial; cm\u20132; diatoms; iron; marine; periphyton; spp; substrates; surface; \u00d7 \u00d7", "summary": "The high abundance of the diatom Cylindrotheca closterium on wood substrate greatly contributed to the high overall abundance of diatoms on wood. High dia- tom abundance on the bottom side of wood substrate could be attributed to wood being a nutrient source for the periphyton community, as mentioned before.", "mime": "application/pdf"}, {"id": "abc-1182", "words": "6631", "extension": ".pdf", "flesch": "53", "author": "Mejdandzic, Maja; Ljubesic, Zrinka; Ivankovic, Tomislav; Pfannkuchen, Martin; Godrijan, Jelena; Maric Pfannkuchen, Daniela; Hrenovic, Jasna", "title": "Colonization of diatoms and bacteria on artificial substrates in the sea", "date": "2015", "keywords": "abundance; acta; adriatic; bacteria; biofi; cells; diatoms; exposure; plates; surface", "summary": "Further, these interactions appear to initialize the formation of diatom biofi lms and aggregates, as has been shown with marine microbial communities. Such biofi lm formation, also known as fouling, is a complex multi- stage process and not yet thoroughly investigated.", "mime": "application/pdf"}, {"id": "abc-1183", "words": "5567", "extension": ".pdf", "flesch": "60", "author": "Bosak, Suncica; Gligora Udovic, Marija; Sarno, Diana", "title": "The morphological study of Chaetoceros wighamii Brightwell (Chaetocerotaceae, Bacillariophyta) from Lake Vrana, Croatia", "date": "2015", "keywords": "amanita; chaetoceros; et al; freshwater; lake; setae; species; valve; vrana; wighamii", "summary": "Spines adorning setae in C. wighamii are tightly arranged around the axis and appear slightly longer and more silicifi ed compared to the spines present in other species, as, for example, Chaetoceros curvisetus or C. lauderi (KOOISTRA et al. 2010, EVENSEN and HASLE 1975).The details on chloroplast number, shape and position have not been known previ- ously in Chaetoceros wighamii syn C. amanita, as the previous observations were based mostly on cleaned material (KACZMARSKA et al. 1985, SANCHEZ CASTILLO et al. 1992). SANCHEZ CASTILLO et al. (1992) discussed the identity of C. wighamii in relation with the taxa traditionally associated to it, i.e. C. amanita, C. bottnicus, C. biconcavum and C. cap- sicum.", "mime": "application/pdf"}, {"id": "abc-1185", "words": "5088", "extension": ".pdf", "flesch": "64", "author": "Ognjanova-Rumenova, Nadja Georgieva; Pip\u00edk, Radovan", "title": "Stratigraphic and taxonomic significance of siliceous microfossils collected from the Turiec Basin, Western Carpathians (Slovakia)", "date": "2015", "keywords": "acta; alveolophora; basin; diatom; jouseana; miocene; moisseeva; species; staurosirella; turiec", "summary": "Many of them are concerned with the inventory, de- scription and typifi cation of various diatom species from raw materials, housed in different European diatom collections: Ehrenberg (Berlin), Pantocsek (Budapest), Hustedt (Bremer- haven), Grunow (Vienna), etc. Neogene non-marine diatoms for this area were documented and illustrated by early work- ers (EHRENBERG 1854, GRUNOW 1882, PANTOCSEK 1892, 1905).", "mime": "application/pdf"}, {"id": "abc-119", "words": "5469", "extension": ".pdf", "flesch": "59", "author": "Rusanov, Alexander G.; Stanislavskaya, Elena V.; Acs, Eva", "title": "Distribution of periphytic diatoms in the rivers of the Lake Ladoga basin (Northwestern Russia)", "date": "2009", "keywords": "basin; conductivity; diatom; k\u00fctz; ladoga; lake; phosphorus; rivers; southern; species; sub; var", "summary": "On the basis of geology and river water chemistry, the Lake Ladoga basin could be separated into two main parts, the northern and the southern sub-basin. Keywords: Diatom, periphyton, distribution, gradient, eutrophication, Lake Ladoga, Russia Introduction Periphytic diatoms are excellent indicators of ecological condition of rivers and streams, because of their ability to respond rapidly to changes in nutrient concentrations.", "mime": "application/pdf"}, {"id": "abc-1191", "words": "4339", "extension": ".pdf", "flesch": "52", "author": "Malesevic, Nikola; Ciglenecki, Irena; Bura-Nakic, Elvira; Caric, Marina; Dupcic, Iris; Hrustic, Enis; Vilicic, Damir; Ljubesic, Zrinka", "title": "Diatoms in an extreme euxinic environment (Rogoznica Lake, eastern Adriatic coast)", "date": "2015", "keywords": "ciglene\u010dki; conditions; et al; lake; phytoplankton; rogoznica; species", "summary": "Mixing of water layers is marked by arrows, months are denoted by abbreviations: J for January, A for April, J for July and O for October. Surface water could be well oxygenated (oxygen saturation up to 300%), while hypoxia/ anoxia occurs in the bottom water layer (STIPANI\u010cEV and BRANICA 1996, CIGLENE\u010cKI et al. 1998, 2005, 2013).", "mime": "application/pdf"}, {"id": "abc-1199", "words": "5477", "extension": ".pdf", "flesch": "58", "author": "Bolgovics, \u00c1gnes; \u00c1cs, \u00c9va; V\u00e1rb\u00edr\u00f3, G\u00e1bor; Kiss, Tiham\u00e9r Keve; Borics, G\u00e1bor", "title": "Diatom composition of the rheoplankton in a rhithral river system", "date": "2015", "keywords": "acta; borics; diversity; kiss; phytoplankton; rivers; species; water", "summary": "An elementary, structural analysis of river phytoplankton. The potamoplankton of large rivers has been extensively studied (KISS 1987, KISS and GENKAL 1996, REYNOLDS and DESCY 1996, KISS et al. 2002, KISS and \u00c1CS 2009), but the phytoplankton of the upper river segments has received much less atten- tion.", "mime": "application/pdf"}, {"id": "abc-12", "words": "4946", "extension": ".pdf", "flesch": "51", "author": "Lincy, Adinkudik K.; Remashree, Azhimala B.; Sasikumar, Bhaskaran", "title": "Indirect and direct somatic embryogenesis from aerial stem explants of ginger (Zingiber officinale Rosc.)", "date": "2009", "keywords": "callus; embryogenesis; embryos; explants; ginger; l\u20131; medium; shoot; stem", "summary": "The desiccated calli produced white friable calli which turned embryogenic and then produced somatic embryos in a medium containing 2 mg L\u20131 benzyl amino purine. Induction of somatic embryos from ovary explants of ginger and its regeneration were de- scribed by NIRMAL BABU et al. (1996).", "mime": "application/pdf"}, {"id": "abc-120", "words": "6469", "extension": ".pdf", "flesch": "61", "author": "Rovira, Laia Torres; Trobajo, Rosa Pujadas; Ibanez, Carles Marta", "title": "Periphytic diatom community in a Mediterranean salt wedge estuary: the Ebro Estuary (NE Iberian Peninsula)", "date": "2009", "keywords": "community; diatom; ebro; estuary; fig; october; river; salt; water; wedge", "summary": "Several investigations had used artifi- cial substrata to study periphytic diatom communities in estuaries and other transitional systems (MCINTIRE and OVERTON 1971; MCINTIRE 1973, 1978; MOORE and MCINTIRE 1977; LAI 2001; TROBAJO et al. 2004; NAYAR et al. 2005). LAI, S. D., 2001: An ecological study of brackish water diatom community in wetlands, near the Tseng-Wen estuary, in southwestern Taiwan.", "mime": "application/pdf"}, {"id": "abc-1209", "words": "9235", "extension": ".pdf", "flesch": "61", "author": "Mogna, Marcella; Cantonati, Marco; Andreucci, Flora; Berta, Graziella; Miserere, Luca", "title": "Diatom communities and vegetation of springs in the south-western Alps", "date": "2015", "keywords": "acta; alps; bertalot; bot; cantonati; carbonate; croat; diatom; fig; lange; species; springs; taxa; vegetation; water", "summary": "Discussion Our study extended and improved knowledge gained on spring diatom communities in the south-eastern Alps to the south-western Alps, and added several further useful observa- tions. Characteristic spring taxa (crenophiles) were present.", "mime": "application/pdf"}, {"id": "abc-1225", "words": "2427", "extension": ".pdf", "flesch": "59", "author": "Prlic, Dragan", "title": "Small-flowered bittercress, Cardamine parviflora L. (Brassicaceae), a new species of the Croatian flora", "date": "2015", "keywords": "area; cardamine; croatia; flora; ora; parvifl; species", "summary": "The small-fl owered bittercress, Cardamine parvifl ora L., occurs in numerous European countries, but is absent from certain parts of the Balkan Peninsula (JALAS and SUOMINEN 1994, MARHOLD 1995). The location of Cardamine parvifl ora L. (black dot) within the area of Slatina (Croatia). CARDAMINE PARVIFLORA IN CROATIA ACTA BOT.", "mime": "application/pdf"}, {"id": "abc-1236", "words": "8010", "extension": ".pdf", "flesch": "66", "author": "Andric, Andrijana; Rat, Milica; Zoric, Lana; Lukovic, Jadranka", "title": "Anatomical characteristics of two Ornithogalum L. (Hyacinthaceae) taxa from Serbia and Hungary and their taxonomic implication", "date": "2016", "keywords": "cells; characters; cross; divergens; leaf; ornithogalum; scapus; section; taxa; tissue; umbellatum", "summary": "O. divergens was de- scribed as a subspecies of O. umbellatum in both of them. Adaxial side is smooth while the abaxial has 6\u20138 or 8\u201310 more or less prominent ribs, in O. umbellatum and O. divergens, respectively.", "mime": "application/pdf"}, {"id": "abc-124", "words": "4276", "extension": ".pdf", "flesch": "70", "author": "Binzet, R\u00c4\u00b1za; Akcin, Oznur E.", "title": "Nutlet size, shape and surface ornamentation in 14 Onosma species (Boraginaceae)", "date": "2009", "keywords": "nutlet; onosma; species; type", "summary": "The colour of the nutlets is brown in O. sintenisii, O. intertextum and O. bourgaei; gray-pale brown in O. papillosum, O. mer- sinana, O. briquetii and O. riedliana; pale brownish in O. ambigens and O. rascheyanum; pale gray in O. bulbotrichum; gray in O. lycaonicum; reddish brown in O. caerulescens; gray brown in O. angustissimum and O. giganteum. Most species of Onosma have the type 4 nutlet surface, such as O. papillosum, O. lycaonicum, O. caerulescens, O. rascheyanum, O. mersinana and O. riedliana.", "mime": "application/pdf"}, {"id": "abc-125", "words": "6165", "extension": ".pdf", "flesch": "59", "author": "Klein, Georgia; Kaczmarska, Irena; Ehrman, James M.", "title": "The diatom Chaetoceros in ships ballast waters survivorship of stowaways", "date": "2009", "keywords": "ballast; cells; chaetoceros; diatom; hargraves; resting; samples; species; spores; water", "summary": "Our findings contribute to the assessment of the ef- fectiveness of ballast water treatment via water exchange, and serve to evaluate the diver- sity of diatom vegetative cells and spores transported in ballast water tanks. We found ballast water cell densities comparable to that found in one sample from the receiving port of Vancouver, where a bloom of one Chaetoceros species produced 2.7 x 103 viable cells L\u20131 and 87 spores L\u20131.", "mime": "application/pdf"}, {"id": "abc-1261", "words": "5604", "extension": ".pdf", "flesch": "57", "author": "Zebec, Marko; Idzojtic, Marilena; Satovic, Zlatko; Poljak, Igor; Liber, Zlatko", "title": "Alive and kicking, or, living on borrowed time? \u2013 Microsatellite diversity in natural populations of the endangered Ulmus minor Mill. sensu latissimo from Croatia", "date": "2016", "keywords": "croatia; diversity; eld; elm; loci; nin; populations; signifi; ulmus; values; zagreb", "summary": "As elm populations in Croatia do not demonstrate a statistically signifi cant deviation from HW equilibrium, it could be claimed that the danger of the appearance of inbreeding within observed populations is relatively small. The aim of this research was to assess the level of ge- netic diversity between and within the fi eld elm populations in Croatia, and thus determine the degree of the negative impact of DED on the biodiversity of the species.", "mime": "application/pdf"}, {"id": "abc-1264", "words": "2391", "extension": ".pdf", "flesch": "64", "author": "Stesevic, Danijela; Berg, Christian", "title": "Botrychium matricariifolium, a new fern species for the flora of Montenegro", "date": "2015", "keywords": "botrychium; european; matricariifolium; montenegro; species", "summary": "These species are clearly distinguished by the lamina, which is in B. matricariifolium 2-pinnatifi d, while in B. lunaria it is 1-pinnate with trapezoid to fl abellate pinnae. \u00c5ngstr., B. lunaria (L.) Sw., B. matricariifolium (D\u00f6ll) A. Braun ex W. D. J. Koch, B. multifi dum (S. G. Gmel.)", "mime": "application/pdf"}, {"id": "abc-127", "words": "5579", "extension": ".pdf", "flesch": "53", "author": "Bosak, Suncica; Buric, Zrinka; Djakovac, Tamara; Vilicic, Damir", "title": "Seasonal distribution of plankton diatoms in Lim Bay, northeastern Adriatic Sea", "date": "2009", "keywords": "adriatic; bay; diatoms; distribution; et al; lim; nov; phytoplankton; sea; spp; vili^i; year", "summary": "1. Location of the sampling stations in Lim Bay, north east Adriatic Sea, visited from March 2002 to November 2007. 68 (2), 351\u2013365, 2009 CODEN: ABCRA25 ISSN 0365\u20130588 Seasonal distribution of plankton diatoms in Lim Bay, northeastern Adriatic Sea SUN^ICA BOSAK1*, ZRINKA BURI]1, TAMARA DJAKOVAC2, DAMIR VILI^I]1 1", "mime": "application/pdf"}, {"id": "abc-1273", "words": "5083", "extension": ".pdf", "flesch": "61", "author": "Aykurt, Candan; Deniz, Ismail G\u00f6khan; Sari Yol, Duygu; Vural, Mecit; S\u00fcmb\u00fcl, H\u00fcseyin", "title": "Resurrection of Ornithogalum brevipedicellatum (Asparagaceae) with morphological and molecular data", "date": "2016", "keywords": "aykurt; brevipedicellatum; gazi; mountain; oligophyllum; ornithogalum; pamphylicum; species; turkey", "summary": "Although O. pamphylicum was placed in a different branch, it was the closest species to O. brevipedicellatum while O. oligophyl- lum and O. pyrenaicum species were positioned in another group. When Ornithogalum brevipedicellatum, O. pamphylicum and O. oligohyllum species are evaluated with respect to the infl orescence type and length of the ped- icels, it is seen that the specimens of O. brevipedicellatum are distinct; distinguished from the other species by the lack of pedicels, or the presence of very short pedicels- either during fl owering or fruiting periods.", "mime": "application/pdf"}, {"id": "abc-1275", "words": "1385", "extension": ".pdf", "flesch": "58", "author": "Juretic, Biserka", "title": "Botanical Garden of the Faculty of Science, University of Zagreb 125th Anniversary Celebration (1889\u20132014)", "date": "2014", "keywords": "botanical; garden; university; zagreb", "summary": "With the help of their teach- ers and Garden staff, children from the nearby school and kindergarten sow and plant their own fl owers and vegetables, and nurture them during the season until the autumn harvest. The members of the European Botanic Gardens Consortium (EBGC), national representatives of botanical gardens from EU countries, Switzerland and Norway, meet in our Garden for the fi rst time in June.", "mime": "application/pdf"}, {"id": "abc-128", "words": "1384", "extension": ".pdf", "flesch": "65", "author": "Kolodziejek, Jeremi", "title": "Potentilla x aurulenta Gremli (Rosaceae), a nothospecies new to Poland", "date": "2009", "keywords": "aurulenta; hairs; potentilla", "summary": "Keywords: Potentilla \u00b4aurulenta, taxonomy, Poland Introduction During an expedition to Wzg\u00f3rza Trzebnickie, Poland, in May 2004, the author found specimens of Potentilla that differ from the congeners in Poland. Methods Morphological features of the species Potentilla \u00b4aurulenta were described and com- pared with those of P. heptaphylla L. and P. tabernaemontani (Tab. 1).", "mime": "application/pdf"}, {"id": "abc-129", "words": "7563", "extension": ".pdf", "flesch": "44", "author": "Flower, Roger J.; Ryves, David B.", "title": "Diatom preservation: differential preservation of sedimentary diatoms in two saline lakes", "date": "2009", "keywords": "core; diatom; dissolution; et al; fig; index; lake; preservation; ryves; sediment", "summary": "This seems to indicate that, al- though high salinity is inimical to diatom valve preservation (cf. Aspects of diatom preservation are explored in two markedly different saline lakes (one in North America and one in Egypt) and observations are used to make some initial inferences about diatom preservation.", "mime": "application/pdf"}, {"id": "abc-1292", "words": "7750", "extension": ".pdf", "flesch": "64", "author": "Rachana, Kaitheri Edathil; Naganeeswaran, Sudalaimuthu Asari; Fayas, Thayale Purayil; Thomas, Regi Jacob; Rajesh, Muliyar Krishna", "title": "Cloning, characterization and expression analysis of NBS-LRR-type resistance gene analogues (RGAs) in coconut", "date": "2016", "keywords": "coconut; disease; domain; fig; gene; lrr; motifs; nbs; palm; pcr; plant; protein; region; resistance; rgas; rnbs; sequences; structure", "summary": "Ellis, J., Dodds, P., Pyror, T., 2000: Structure, function and evolu- tion of plant disease resistance genes. Shivaramakrishnan, S., Seetharama, N., 2001: Identifi cation and isolation of disease resistance genes in crop plants.", "mime": "application/pdf"}, {"id": "abc-1294", "words": "14243", "extension": ".pdf", "flesch": "86", "author": "Nowak, Arkadiusz; Nowak, Sylwia; Nobis, Marcin", "title": "Spring weed communities of rice agrocoenoses in central Nepal", "date": "2016", "keywords": "association; central; communities; cover; elds; nepal; nowak; phytocoenoses; plant; plots; rice; species; tab; vegetation; water; weed", "summary": "Rice fi elds are still recognized globally as well as in southern Asia as important refuges for many wetland and water species. Data and analyses During the study, in May 2013, 108 vegetation relev\u00e9s were collected in rice fi elds in central Nepal (Fig. 1).", "mime": "application/pdf"}, {"id": "abc-130", "words": "3165", "extension": ".pdf", "flesch": "67", "author": "Yoshitake, Sakiko; Fukushima, Hiroshi; Kimura, Tsutomu; Lepskaya, Ekatarina V.; Ko-Bayashi, Tuyako", "title": "Variability of the pennatae diatom Gomphonema ventricosum Gregory from far eastern lakes", "date": "2009", "keywords": "baikal; h\u00f6vsg\u00f6l; kurilskoye; lake; specimens; type; valve; ventricosum", "summary": "We classified the specimens into five types with respect to valve outline; (1) type A (type form of Gomphonema ventricosum), (2) type B (Lake Baikal type), (3) type C (Lake Karluk type), (4) type D (Gomphoneis septa type) and (5) type E (G. ventricosum f. curta type). Yokosuka, Kanagawa, Japan 2 Institute of Phycology, 2-3-10 Uraga Kanagawa, Japan 3 Kamchatka Institute for Fisheries Research and Oceanography, Peteropavlovsk-Kamchatsky, Russia, 683000 The present study examined by light microscope the morphological variations of 625 specimens of Gomphonema ventricosum Gregory collected from Lake H\u00f6vsg\u00f6l (Mongo- lia), Lake Baikal (Russia) and Lake Kurilskoye (Kamchatka, Russia).", "mime": "application/pdf"}, {"id": "abc-1318", "words": "11771", "extension": ".pdf", "flesch": "59", "author": "Lai, Giuseppina Grazia; Padedda, Bachisio Mario; Wetzel, Carlos Eduardo; Lugli\u00e8, Antonella; Sechi, Nicola; Ector, Luc", "title": "Epilithic diatom assemblages and environmental quality of the Su Gologone karst spring (centraleastern Sardinia, Italy)", "date": "2016", "keywords": "bertalot; cantonati; dell\u2019uomo; diatom; gologone; karst; lange; l\u20131; meso; navicula; oligo; quality; sardinia; species; spring; taxa; water", "summary": "The diatom fl ora of karst springs, for example, has been ex- plored only occasionally (Dell\u2019Uomo 1990), despite these aquatic ecosystems are particularly important for the Medi- terranean area (Civita 2008). Some studies have emphasized the importance of gaining a greater knowledge and understanding of the biocenoses and ecolo- gical dynamics of karst springs in Sardinia, also considering the signifi cant potential vulnerability of these ecosystems (De Waele and Murgia 2001, De Waele 2003).", "mime": "application/pdf"}, {"id": "abc-132", "words": "4085", "extension": ".pdf", "flesch": "57", "author": "Stilinovic, Bozidar; Hrenovic, Jasna", "title": "Plate method for counting the proteolytic sulphide-producing bacteria", "date": "2009", "keywords": "bacteria; cfu; isa; pca; pspb; samples; sim", "summary": "The composition of PCA medium was (in g L\u20131 of distilled water): peptone bacteriological (Biolife) 5.0; proteose peptone (Biolife) 5.0; L-cysteine (Fluka) 0.25; NaCl (Kemika) 5.0; ammonium iron (III) citrate (Sigma-Aldrich) 1.0; K2HPO4 (Kemika) 0.3; agar (Biolife) 15.0; pH 7.4\u00b10.2. 58 ACTA BOT. The composition of ISA medium was (in g L\u20131 of distilled water): tryptone 10.0; sodium sulphite 0.5; iron (III) citrate 0.5; agar 15.0;", "mime": "application/pdf"}, {"id": "abc-1331", "words": "3286", "extension": ".pdf", "flesch": "70", "author": "Bartolucci, Fabrizio; Conti, Fabio", "title": "Alyssum desertorum Stapf (Brassicaceae) new for the Italian Flora", "date": "2016", "keywords": "alyssum; bartolucci; conti; desertorum; dudley; italy; peruzzi", "summary": "La Cona, in- colti al margine stradale, 860 m, 20 April 2013, F. Conti s.n. (APP n. 55194); loc. Alyssum desertorum: a \u2013 infl orescence, b \u2013 raceme whit gla brous silicles and caducous sepals (Photo by: a \u2013 F. Conti, b \u2013 F. Bartolucci).", "mime": "application/pdf"}, {"id": "abc-1343", "words": "2738", "extension": ".pdf", "flesch": "70", "author": "Stinca, Adriano; Galasso, Gabriele; Banfi, Enrico", "title": "First Italian record of Paspalum notatum Fl\u00fcgg\u00e9 (Poaceae) and its typification", "date": "2016", "keywords": "notatum; paspalum", "summary": "Keywords: alien species, invasiveness, phytoremediation, vascular fl ora * Corresponding author, e-mail: adriano.stinca@unina.it Introduction The genus Paspalum L. (Poaceae) comprises about 330 species (Zuloaga and Morrone 2005) and is chiefl y distrib- uted in tropical and temperate regions of America (Zuloaga et al. 2003). References Allen, C. M., Hall, D. W., 2002: 25.26 Paspalum L.", "mime": "application/pdf"}, {"id": "abc-1346", "words": "5721", "extension": ".pdf", "flesch": "61", "author": "Denisow, Bozena; Anton, Sebastian; Wrzesien, Ma?gorzata", "title": "Morphology of Anemone sylvestris L. flower (Ranunculaceae)", "date": "2016", "keywords": "acta; anemone; denisow; grains; ower; pollen; pollination; ranunculaceae; species; sylvestris", "summary": "L. fl ower (Ranunculaceae) The odourless perianth, absence of nectar, scarcity of pollen (approximately 200 000 pollen grains per fl ower) and its traits \u2013 small size (axis P = 18.52 \u00b1 1.0 \u03bcm; E = 16.59 \u00b1 0.9 \u03bcm), lack of balsam on the exine surface, starch accumulation in more than 95% of pollen grains correspond to the specialization in anemophily.", "mime": "application/pdf"}, {"id": "abc-1353", "words": "14513", "extension": ".pdf", "flesch": "80", "author": "Nowak, Arkadiusz; Nowak, Sylwia; Nobis, Marcin; Nobis, Agnieszka", "title": "Dwarf shrub vegetation of rock ledges and clefts in the Pamir Alai Mountains (Middle Asia: Tajikistan)", "date": "2016", "keywords": "acta; alai; asia; communities; dwarf; mts; nobis; nowak; pamir; plant; plots; ranges; rock; species; tajikistan; vegetation; western", "summary": "The paper is a part of our survey on rock vegetation in Tajikistan with the fi nal intention of building up the syn- taxonomical system of all types of rupicolous environments within the country. 75 (1), 2016 on typical rock vegetation (Asplenietea trichomanis) have been presented in recent years, still little is known regard- ing the scree and talus vegetation or the transitional micro- habitats of much eroded rocks or stabile screes (Nowak et al. 2014a, 2014b, 2014c).", "mime": "application/pdf"}, {"id": "abc-1355", "words": "6493", "extension": ".pdf", "flesch": "62", "author": "Siddiqui, Zamin Shaheed; Shahid, Huda; Cho, Jung-Il; Park, Sung-Han; Ryu, Tae-Hun; Park, Soo-Chul", "title": "Physiological responses of two halophytic grass species under drought stress environment", "date": "2016", "keywords": "ciliaris; content; drought; drought stress; mucronatum; plant; species; stress; water", "summary": "75 (1), 31\u201338, 2016 CODEN: ABCRA 25 DOI: 10.1515/botcro-2016-0018 ISSN 0365-0588 eISSN 1847-8476 Physiological responses of two halophytic grass species under drought stress environment Zamin Shaheed Siddiqui1*, Huda Shahid1, Jung-Il Cho2*, Sung-Han Park2, Tae-Hun Ryu2, Soo-Chul Park2 1 Stress Physiology Lab., Department of Botany, University of Karachi, Karachi \u2013 75270, Pakistan 2 National Academy of Agricultural Sciences, Rural Development Administration, Suwon 441-707, Republic of Korea Abstract \u2013 The physiological responses of two halophytic grass species, Halopyrum mucronatum (L.) Staph. and Cenchrus ciliaris (L.), under drought stress were evaluated. Results were discussed in relation to comparative physiological performance and antioxidant enzymes activity of both halophytic grasses under drought stress.", "mime": "application/pdf"}, {"id": "abc-1373", "words": "6336", "extension": ".pdf", "flesch": "54", "author": "Savkovic, Zeljko; Stupar, Milos; Ljaljevic Grbic, Milica; Vukojevic, Jelena", "title": "Comparison of anti-Aspergillus activity of Origanum vulgare L. essential oil and commercial biocide based on silver ions and hydrogen peroxide", "date": "2016", "keywords": "activity; aspergillus; biocide; et al; s003; sanosil; vulgare", "summary": "Castellano, J. J., Shafi i, S. M., Ko, F., Donate, G., Wright, T. E., Mannari, R. J., Payne, W. G., Smith, D. J. et al., 2007: Com- parative evaluation of silver-containing antimicrobial dress- ings and drugs. As a result of O. vulgare EO activity, morpho- physiological changes in A. fl avus were showed by Souza et al. (2010).", "mime": "application/pdf"}, {"id": "abc-1375", "words": "4537", "extension": ".pdf", "flesch": "57", "author": "Cakir, Ozgur; Turgut Kara, Neslihan; Ari, Sule", "title": "Selenium induced selenocysteine methyltransferase gene expression and antioxidant enzyme activities in Astragalus chrysochlorus", "date": "2016", "keywords": "activity; astragalus; callus; chrysochlorus; expression; gene; plant; selenium; smt", "summary": "These results show that an increase of SMT gene expression led to a rise in APX and POX, but a suppression of CAT and GR enzymes activities in Astragalus chrysochlorus. We used qPCR to measure SMT gene expression.", "mime": "application/pdf"}, {"id": "abc-1382", "words": "16864", "extension": ".pdf", "flesch": "90", "author": "Terzi, Massimo; D\u2019Amico, Franceso S.", "title": "Dry grasslands of Hippocrepido glaucae-Stipion austroitalicae in the Pollino Massif (Calabria, Italy)", "date": "2016", "keywords": "austroitalica; biondi; hippocrepido; italy; l. +; mediterranean; south; stipetum; stipion; subsp; terzi; vegetation", "summary": "Snogerup & B. Snogerup (+), Campanula erinus L. (+), Carduus nutans L. subsp. capitatum (+), Teucrium chamaedrys L. (+), Tragopogon porrifolius L. (+), Trifolium campestre Schreber (+), Trifolium scabrum L. subsp.", "mime": "application/pdf"}, {"id": "abc-1387", "words": "4167", "extension": ".pdf", "flesch": "55", "author": "Pavlovkin, J\u00e1n; Fiala, Roderik; Ciamporov\u00e1, Milada; Martinka, Michal; Repka, Vladim\u00edr", "title": "Impact of nickel on grapevine (Vitis vinifera L.) root plasma membrane, ROS generation, and cell viability", "date": "2016", "keywords": "cells; grapevine; l\u20131; membrane; mmol; ni2; roots", "summary": "The root epidermal cells being in direct contact with the environment are more sensitive comparing to the internal root tissues as shown in our previous re- search on grapevine root cells exposed to cadmium (Fiala et al. 2015). The time course of hydro- gen peroxide accumulation in grapevine root cells treated with 5 mmol L\u20131 Ni demonstrated that the highest hydrogen peroxide production occurred mainly after 180 min (Figs. 6A, B).", "mime": "application/pdf"}, {"id": "abc-141", "words": "6555", "extension": ".pdf", "flesch": "60", "author": "Fanuko, Neda; Valcic, Marko", "title": "Phytoplankton composition and biomass of the northern-Adriatic lagoon of Stella Maris, Croatia", "date": "2009", "keywords": "acta; adriatic; carbon; cell; croat; fanuko; ju l; lagoon; maris; phytoplankton; species; stella; volume", "summary": "The lagoons of the northwest Adriatic coast have been studied with much attention for over two centuries (NARDO 1847, NINNI 1906, BABI] 1911, KIESSELBACH,1936, BRUNETTI et al.1983, OREL et al. 2001, COVELLI et al. 2005), particularly with respect to lagoon phytoplankton (VATOVA1940, 1961; MARCHESONI 1954; TOLOMIO 1982; TOLOMIO and BULLO 2001; FACCA et al. 2002, 2003; SOCAL et al. 2006). Location of Stella Maris lagoon with sampling site U:\\ACTA BOTANICA\\Acta-Botan 1-09\\Fanuko.vp 16.", "mime": "application/pdf"}, {"id": "abc-1427", "words": "7136", "extension": ".pdf", "flesch": "59", "author": "Golob, Aleksandra; Germ, Mateja; Kreft, Ivan; Zelnik, Igor; Kristan, Ur\u0161ka; Stibilj, Vekoslava", "title": "Selenium uptake and Se compounds in Se-treated buckwheat", "date": "2016", "keywords": "activity; buckwheat; content; et al; germ; hybrid; kreft; plants; seeds; selenium; tartary", "summary": "For each taxon and treatment one sample of plants (10\u201315 plants) was taken for determi- nation of Se content and Se speciation. We weighed 0.2 g of a lyophilized sample into a Tefl on tube and Se content was determined in three aliquots.", "mime": "application/pdf"}, {"id": "abc-1429", "words": "6238", "extension": ".pdf", "flesch": "57", "author": "Macukanovic-Jocic, Marina; Stesevic, Danijela; Rancic, Dragana; Dajic Stevanovic, Zora", "title": "Pollen morphology and the flower visitors of Chaerophyllum coloratum L. (Apiaceae)", "date": "2017", "keywords": "apiaceae; chaerophyllum; coloratum; fig; grains; journal; ower; plant; pollen; species; type; visitors", "summary": "By determining the spectrum of pollen types in honey and calculating the relative frequency of C. coloratum as the respective per- centage with respect to the total number of pollen grains, it would be possible to confi rm or deny the attractiveness of this species to honeybees. In a polar view, C. coloratum grains are triangular, as in the three above-mentioned pollen types, whereas in an equato- rial view, inner and outer contour of both, colpial and meso- colpial sides, is concave without any sexine extension above the endoapertures, as has been observed in C. hirsu- tum pollen type.", "mime": "application/pdf"}, {"id": "abc-1440", "words": "4376", "extension": ".pdf", "flesch": "65", "author": "Stesevic, Danijela; Bubanja, Nada", "title": "Five new alien species in the flora of Montenegro: Coreopsis tinctoria Nutt., Ipomoea indica (Burm.) Merr., Lupinus \u00d7 regalis Bergmans, Physalis angulata L., and Solidago canadensis L. and new possible threats to the biodiversity", "date": "2017", "keywords": "alien; flora; montenegro; new; ora; physalis; plant; species", "summary": "This paper presents a supplement to the national list of alien plant species in Montenegro as well as to the general distribution of the mentioned aliens in SE Europe. Acknowledgements Authors would like to thank F. Essl, B. Beckmann, J., Jogan, M, Le\u0161nik, V. Vladimirov, G. Fried, F. Verloove, M. Rat, V. Matevski for valuable help with the literature and information on alien plant species and Sne\u017eana Bulaji\u0107 for improving our use of English.", "mime": "application/pdf"}, {"id": "abc-1451", "words": "6908", "extension": ".pdf", "flesch": "54", "author": "Wrzesien, Malgorzata Beata; Denisow, Bozena", "title": "The effect of agricultural landscape type on field margin flora in south eastern Poland", "date": "2016", "keywords": "diversity; eld; eld margins; fi eld; habitats; landscape; margins; ora; plant; poland; species; type", "summary": "This is consistent with a study conducted in Mediterranean region (Bassa et al. 2011) or Finland (Tarmi et al. 2009) and indicates the essentiality of fi eld margins as hotspots of plant species richness in agricultural landscape, irrespective of geographic regions, climatic types or fl ora history. Our results confi rm the fi ndings that fi eld margins are useful for the conservation of biodiversity in the agricultur- al landscape, as well as for plant species currently consid- ered rare, threatened or endangered.", "mime": "application/pdf"}, {"id": "abc-1464", "words": "7109", "extension": ".pdf", "flesch": "63", "author": "Grozeva, Neli Hristova; Gerdzhikova, Mariya Asenova; Pavlov, Dimitar; Panayotova, Galia; Todorova, Mima", "title": "Morphological variability of the Bulgarian endemic Betonica bulgarica Degen et Neic. (Lamiaceae) from Sinite Kamani Natural Park, Eastern Balkan Range", "date": "2016", "keywords": "betonica; bulgarica; glandular; leaf; leaves; length; populations; species; surface; traits; trichomes; variability; width", "summary": "Data about the state of B. bulgarica populations on the territory of Balkan Range are contained in the management plans of the Central Bal- kan National Park (Yankov et al. 2001) and Sinite Kamani Natural Park (Grozeva et al. 2004). Indumentum and morphology of generative organs had taxonomic signifi cance for distinguishing B. bulgarica from the other species in the genus, including the species that were morphologically most similar to it \u2013 Betonica offi cinalis L. Keywords: Betonica bulgarica, morphology populations, variations * Corresponding author, e-mail: grozeva@uni-sz.bg Introduction Endemic plants are an emblematic symbol of the Bul- garian fl ora and one of the most sensitive and vulnerable units in the country\u2019s nature ecosystems (Anchev 2011).", "mime": "application/pdf"}, {"id": "abc-1469", "words": "4012", "extension": ".pdf", "flesch": "53", "author": "Yankova-Tsvetkova, Elina Petrova; Yurukova-Grancharova, Petka; Baldjiev, Georgi; Vitkova, Antonina", "title": "Embryological features, pollen and seed viability of Arnica montana (Asteraceae) \u2013 a threatened endemic species in Europe", "date": "2016", "keywords": "arnica; asteraceae; embryo; fig; montana; pollen; seed; species; study; viability", "summary": "Pollen of Arnica montana analyzed by acetocarmine test: A) mature pollen grains without acetocarmine staining, B) viable pollen grains, stained in red, C) tricolporate viable pollen grain, stained in red, D) unviable, unstained pollen grain. Pollen and seed viability After acetocarmine staining, the cytoplasm and nuclei of viable pollen grains were stained in red while unviable, empty and shrunken pollen grains remain unstained (Figs.", "mime": "application/pdf"}, {"id": "abc-1483", "words": "5741", "extension": ".pdf", "flesch": "55", "author": "Sheidai, Masoud; Tabasi, Melica; Mehrabian, Mohammad-Reza; Koohdar, Fahimeh; Ghasemzadeh-Baraki, Somayeh; Noormohammadi, Zahra", "title": "Species delimitation and relationship in Crocus L. (Iridaceae)", "date": "2018", "keywords": "crocus; crocus species; diversity; flow; gene; issr; populations; sativus; species; structure", "summary": "Hickory: a package for anal- ysis of population genetic data V1.0. Crocus species have horticultural, medicinal and pharmacological importance.", "mime": "application/pdf"}, {"id": "abc-1484", "words": "8947", "extension": ".pdf", "flesch": "53", "author": "Troiani, Natalia; Tardella, Federico Maria; Malatesta, Luca; Corazza, Marcello; Ferrari, Carlo; Catorci, Andrea", "title": "Long-term abandonment of croplands in the sub-Mediterranean climate does not lead per se to the recovery of the semi-natural herb communities deemed worthy of conservation in the EU Habitats Directive", "date": "2016", "keywords": "abandonment; communities; cover; grasslands; group; indicator; mean; plant; soil; species; t3.1; t3.2; tab; values; vegetation", "summary": "This is consistent with previous research, which showed that in the sub-Mediterranean climate, landforms are key factors in determining plant species and communi- ties distribution (Ar\u00e9valo et al. 2012, Burrascano et al. 2013, Catorci et al. 2014b). Moreover, altitude and land form (Burrascano et al. 2013), soil features (Catorci and Gatti 2010), land use history (Catorci et al. 2011a) and disturbance type and intensity (Peco et al. 2006, de Bello et al. 2007, Kramberger and Kaligari\u010d 2008, Catorci et al. 2012, Ribeiro et al. 2012) have proved to be crucial factors in determining grassland species composition.", "mime": "application/pdf"}, {"id": "abc-15", "words": "1390", "extension": ".pdf", "flesch": "65", "author": "Kolodziejek, Jeremi", "title": "A new nothospecies in the genus Potentilla L. (Rosaceae)", "date": "2009", "keywords": "hairs; potentilla", "summary": "P. \u00b4gabarae resembles P. leucopolitana in having dense tomentum and leaves with 5\u20137 leaflets. Leaflets of P. \u00b4 gabarae are covered with straight and crispate hairs mixed with imperfectly stellate hairs which make the leaves sparsely sericeous hairy; the imperfectly stellate hairs (\u00bbZackenhaare\u00ab) consist of up to 7 not identi- cally long arms (Fig. 3 A, B).", "mime": "application/pdf"}, {"id": "abc-150", "words": "6694", "extension": ".pdf", "flesch": "71", "author": "Kahraman, Ahmet; Dogan, Musa", "title": "A comparative study on the two species of the genus Salvia L. sect. Aethiopis Bentham (Labiatae) from East Anatolia, Turkey", "date": "2010", "keywords": "cells; epidermis; fig; length; limbata; palaestina; s. limbata; salvia; size; species", "summary": "In this paper for the first time we give descriptions of S. limbata and S. palaestina, their comparative root, stem, leaf and petiole anatomy, palynology and nutlet micromorphology. Materials and methods Specimens of S. limbata and S. palaestina were collected from six localities in Turkey (Tab. 1, Fig. 1).", "mime": "application/pdf"}, {"id": "abc-1516", "words": "7362", "extension": ".pdf", "flesch": "59", "author": "Ambrozic-Dolinsek, Jana; Ciringer, Terezija; Kaligaric, Mitja", "title": "Micropropagation of the narrow endemic Hladnikia pastinacifolia (Apiaceae)", "date": "2016", "keywords": "bap; culture; growth; iba; medium; pastinacifolia; plant; seeds; shoots", "summary": "Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests. Further studies on this species will focus on other specifi c biotechnological tools successfully used in several programs of plant conservation, like assessment of the de- gree of genetic variability of plants in culture and introduc- tion of techniques for long-term storage at low tempera- tures.", "mime": "application/pdf"}, {"id": "abc-1518", "words": "2891", "extension": ".pdf", "flesch": "67", "author": "Borak Martan, Valentina; Sostaric, Renata", "title": "Phytolacca acinosa Roxb. (Phytolaccaceae), a new alien species in the Croatian flora", "date": "2016", "keywords": "acinosa; alien; croatia; esculenta; phytolacca; plants; species", "summary": "As the taxonomical status of the species Ph. acinosa and Ph. esculenta is still a matter of discussion (Webb and Akeroyd 1964, Clement 1982, Tab. 1), we consider both opinions in the analysis of specimens found in Vara\u017edin. Something similar was noticed in Belgium where collections of the Ph. acinosa group are usually more or less intermediate between Ph. acinosa and Ph. esculenta: infl orescence axes are often scabrid-glandu- lar (as in Ph. acinosa)", "mime": "application/pdf"}, {"id": "abc-1570", "words": "4934", "extension": ".pdf", "flesch": "62", "author": "Zuna Pfeiffer, Tanja; Spoljaric Maronic, Dubravka; Zahirovic, Vanda; Stevic, Filip; Zjalic, Milorad; Kajan, Katarina; Ozimec, Sinisa; Mihaljevic, Melita", "title": "Early spring flora of the Sub-Pannonic steppic grassland (NATURA 2000 site) in Bilje, northeast Croatia", "date": "2016", "keywords": "bilje; croatia; grassland; l. h; ora; plant; species; steppe; subsp; taxa", "summary": "H 5 Geranium sanguineum L. H 1 Geranium dissectum L. T 8 Lamiaceae Ajuga genevensis L. H 5 Lamium purpureum L. T 2 Mentha aquatica L. H 5 Salvia pratensis L. H 2 Thymus pulegioides L. Ch 2 Glechoma hederacea L. H 5 Oleaceae Syringa vulgaris L. N 7 Papaveraceae Papaver dubium L. T 8 Papaver rhoeas L. T 5 Plantaginaceae Plantago lanceolata L. H 5 Plantago media L. H 5 Polygalaceae Polygala comosa Schkuhr H 5 Polygonaceae Rumex acetosa L. subsp. In the early List of taxa Life form Choro- logical types Threat levels Viola tricolor L. T 5 Viola odorata L. H 2 LILIATAE Amaryllidaceae Allium sphaerocephalon L. subsp.", "mime": "application/pdf"}, {"id": "abc-1577", "words": "5129", "extension": ".pdf", "flesch": "63", "author": "Inceer, Huseyin; Kalmuk, Nursen Aksu; Imamoglu, Kemal Vehbi; Duman, Ozge; Hayirlioglu-Ayaz, Sema; Arslan, Gokhan", "title": "Micromorphological, anatomical and cytogenetical studies in endemic Crepis macropus Boiss. & Heldr. (Asteraceae) from Turkey", "date": "2016", "keywords": "achene; anatomy; chromosome; crepis; enke; inceer; macropus; plant; species", "summary": "Crepis macropus is an endemic species that belongs to section Berinia (Babcock 1947a, b, Enke 2009). Crepis macropus exhibits clos- er similarities to its Balkan relatives, C. turcica and C. al- banica, than to those of Anatolia, but it is more like C. turcica based on its habit, involucres, fl orets and achenes (Babcock 1947b).", "mime": "application/pdf"}, {"id": "abc-1578", "words": "5918", "extension": ".pdf", "flesch": "56", "author": "Jakovljevic, Olga; Popovic, Sladana S.; Vidakovic, Danijela P.; Stojanovic, Katarina Z.; Krizmanic, Jelena Z.", "title": "The application of benthic diatoms in water quality assessment (Mlava River, Serbia)", "date": "2016", "keywords": "assessment; diatom; index; indices; mlava; quality; river; serbia; status; taxa; values; water", "summary": "Water quality as- sessment of the DTD hydrosystem by diatom indices. Based on the average values of the pollution sensitivity index (IPS), commission for economical community metric (CEE) and biological diatom index (IBD), the water of the Mlava River belonged to water class I during all three seasons.", "mime": "application/pdf"}, {"id": "abc-1582", "words": "911", "extension": ".pdf", "flesch": "49", "author": "Ljubesic, Zrinka", "title": "A word from the Guest Editor", "date": "2015", "keywords": "symposium; university; zagreb", "summary": "At the opening ceremony the partici- pants were welcomed with opening remarks by Dean Amir Hamzi\u0107, Faculty of Science, Univer- sity of Zagreb, Rector Aleksa Bjeli\u0161, University of Zagreb, Sta\u0161a Skenzi\u0107, Head of the Offi ce for International Cooperation at Ministry of Science, Education and Sports of the Republic of Croa- tia and the Mayor of Zagreb Milan Bandi\u0107. The 8th CEDM was organized by Croatian Bo- tanical Society and held from April 10 to April 13, 2014, at the University of Zagreb.", "mime": "application/pdf"}, {"id": "abc-1583", "words": "1316", "extension": ".pdf", "flesch": "54", "author": "Surina, Bostjan", "title": "Book review: Endemi u Hrvatskoj flori by Toni Nikolic, Milenko Milovic, Sandro Bogdanovic and Nenad Jasprica", "date": "2015", "keywords": "authors; book; croatia; subsp; taxa", "summary": "Nevertheless, according to the given criteria and biogeographic analyses, authors thoroughly and in painstaking detail have described 155 (40%) endemic taxa out of 384 (7.6% of the total fl oristic inventory of the country) occurring in Croatia, while 53 (14%) taxa are mentioned in less detail. The present book has taken a step further, trying to thoroughly present and elucidate the phenomenon of Adriatic endemism on a much larger geographical scale, dealing with taxa of limited distribution ranges occurring also or exclusively in Croatia.", "mime": "application/pdf"}, {"id": "abc-1586", "words": "6162", "extension": ".pdf", "flesch": "60", "author": "Dudas, Slavica; Sola, Ivana; Sladonja, Barbara; Erhatic, Renata; Ban, Dean; Poljuha, Danijela", "title": "The effect of biostimulant and fertilizer on \u201clow input\u201d lettuce production", "date": "2016", "keywords": "bio; content; control; effect; lettuce; mass; megagreen; nitrate; plant; s-90; signifi; treatment; yield", "summary": "During frost, all variants of lettuce treatments and the control variants were additionally protected with agrotextile (17 g m\u20132). Compared to the result of Premuzic et al. (2001) who found that N or biosta- bilised compost fertilization does not change lettuce vita- min C content, we found that Megagreen fertilizer increased vitamin C content in lettuce and in this term suggest it as a better choice for lettuce treatment.", "mime": "application/pdf"}, {"id": "abc-1593", "words": "4029", "extension": ".pdf", "flesch": "56", "author": "Marekovic, Sara; Sostaric, Renata", "title": "A comparison of the influences of flotation and wet sieving on certain carbonized legume and cereal remains", "date": "2016", "keywords": "lentil; otation; remains; sieving; species; water; wet", "summary": "Key words: carbonized plant remains, cereals, fl otation, legumes, wet sieving * 75 (1), 2016 145 Wright (2005) concluded that the results of archaeobo- tanical analysis depend on fl otation sample size, how the sample is measured and processed and how well the plant material within the sample withstands the rigors of fl ota- tion.", "mime": "application/pdf"}, {"id": "abc-1595", "words": "4479", "extension": ".pdf", "flesch": "58", "author": "Kremer, Dario; Jurisic Grubesic, Renata; Ballian, Dalibor; Stesevic, Danijela; Kosalec, Ivan; Vukovic Rodriguez, Jadranka; Vukobratovic, Marija; Srecec, Sinisa", "title": "Influence of soil traits on polyphenols level in Moltkia petraea (Tratt.) Griseb. (Boraginaceae)", "date": "2016", "keywords": "compounds; content; leaves; owers; petraea; phenolic; plant; populations; soil; stems; total", "summary": "A negative correlation was found between soil phosphorus content and total phenols content in leaves and stems, and with the total phenolic acids content in fl owers. Phenolic compound content was higher in leaves than in fl owers or stems.", "mime": "application/pdf"}, {"id": "abc-1609", "words": "6682", "extension": ".pdf", "flesch": "69", "author": "Buzurovic, Uro\u0161; Bogdanovic, Sandro; Niketic, Marjan; Tomovic, Gordana", "title": "Goniolimon dalmaticum Rchb. f. and G. tataricum (L.) Boiss. (Plumbaginaceae) in the Croatian flora and their distribution in the Balkan Peninsula", "date": "2016", "keywords": "beou; boiss; buzurovi\u0107; coll./det; dalmaticum; distribution; flora; goniolimon; mgrs; populations; records; rev; species; sub; tataricum", "summary": "To confi rm the iden- tity of G. tataricum as a new species, morphometric study and multivariate statistical analysis were per- formed on the data from four Croatian populations of G. dalmaticum and G. tataricum. The chorological analyses included herbarium specimens of G. dalmaticum and G. tataricum from the following herbaria collections:", "mime": "application/pdf"}, {"id": "abc-1616", "words": "2770", "extension": ".pdf", "flesch": "64", "author": "Vukojevic, Mara; Vitasovic Kosic, Ivana; Alegro, Antun; Lakusic, Dmitar; Bogdanovic, Sandro", "title": "Cardamine fialae Fritsch (Brassicaceae) a new species in Croatian flora", "date": "2016", "keywords": "alae; cardamine; croatian; ku\u010dera; species", "summary": "Morphologically, C. fi alae is similar to the Serbian endemic C. serbica with which it shares following characteristics: auricules at the base of lower cauline leaves, stem and rosette leaves bipinnate, margin of leafl ets serrate with hairy main stem and sepals, although it differs in having bigger petals and sepals, longer fi laments and 1\u20132 lateral stems. C. fi alae grows on lower altitudes in rocky ground within the vegetation of forest fringes of the sub-Mediterranean zone.", "mime": "application/pdf"}, {"id": "abc-1618", "words": "3723", "extension": ".pdf", "flesch": "57", "author": "Kaya, Ergun; Vatansever, Recep; Filiz, Ertugrul", "title": "Assessment of the genetic relationship of Turkish olives (Olea europaea subsp. europaea) cultivars based on cpDNA trnL-F regions", "date": "2018", "keywords": "cultivars; europaea; olea; olive; sequences; subsp; trnl", "summary": "Pairwise-comparison of Turkish olive cultivars In order to have insights about the genetic relationships of Turkish olives, pairwise similarity and difference com- parisons of trnL-F sequences were conducted. Materials and methods Plant materials and genomic DNA isolation Seven cultivated Turkish olive cultivars (O. europaea sub- sp. europaea var.", "mime": "application/pdf"}, {"id": "abc-1621", "words": "2345", "extension": ".pdf", "flesch": "65", "author": "Strgulc Kraj\u0161ek, Simona; Accetto, Marko; Jogan, Nejc", "title": "Myosotis refracta Boiss. (Boraginaceae), an unexpected forget-me-not in the Slovene flora", "date": "2016", "keywords": "accetto; grau; myosotis; refracta; slovenia; species", "summary": "During the revision, an unexpected species, M. refracta Boiss., was identifi ed. M. refracta is morphologically distinct, but easily con- fused with other small Myosotis species.", "mime": "application/pdf"}, {"id": "abc-1622", "words": "4529", "extension": ".pdf", "flesch": "61", "author": "Dudas, Slavica; Poljuha, Danijela; Sola, Ivana; Segula, Sabina; Varga, Sanja; Sladonja, Barbara", "title": "Effects of biodynamic production on growth and essential oil content in basil", "date": "2016", "keywords": "basil; basilicum; cultivars; date; leaf; oil; plant; production; sowing; species", "summary": "Sweet basil essential oil is used in medicine, for aromatherapy, and the cosmetic and food industries (Pu- tievsky and Galambosi 1999), and as an insecticide (Ume- rie et al. 1998, Keita et al. 2001, Pascual-Villalobos and Ballesta-Acosta 2003). Sweet basil (Ocimum basilicum L.) is the most widely grown Ocimum species in the world for the fresh market, but also for essential oil production (Zheljazkov et al. 2008).", "mime": "application/pdf"}, {"id": "abc-1623", "words": "2528", "extension": ".pdf", "flesch": "66", "author": "Yousefi, Hossein; Amirahmadi, Atefe; Naderi, Reza; Atri, Morteza", "title": "Chromosome numbers and karyotype features of Phlomis olivieri Benth. (Lamiaceae) from Iran", "date": "2018", "keywords": "accessions; chromosome; olivieri; phlomis; species", "summary": "Our observations as well as comparison of photomi- crographs obtained from previous reports also showed that Phlomis chromosomes are the largest among species of the Lamiaceae genera such as Callicarpa L., Salvia L., Scutellaria L., Sideritis L., Stachys L., Teucrium L. and Thymus L. (Jalas 1948, Bo\u015fcaiu et al. 1998, Yildiz and G\u00fccel 2006, Yang et al. 2009, Martin et al. 2011, Contreras and Ruter 2011, Javadi et al. 2011). (Lamiaceae) from Iran Hossein Yousefi1, Atefe Amirahmadi2, Reza Naderi2*, Morteza Atri1 1 Department of Biology, Faculty of Sciences, Bu-Ali Sina University, Hamedan, Iran 2 School of Biology and Institute of Biological Science, Damghan University, Damghan, 36716-41167, Iran Abstract \u2013 Chromosome numbers were determined in ten accessions of Phlomis olivieri Benth.", "mime": "application/pdf"}, {"id": "abc-1635", "words": "5165", "extension": ".pdf", "flesch": "63", "author": "Marcek, Tihana; Vidakovic-Cifrek, Zeljka; Tkalec, Mirta; Jezic, Marin; Curkovic-Perica, Mirna", "title": "Response of dihaploid tobacco roots on salt stress", "date": "2016", "keywords": "239k; activity; dh10; hybrid; lines; nacl; proline; roots; salinity; salt; stress; tobacco", "summary": "In such conditions the possibility of cell dehydration is increased due to diffi culty in the acquisi- tion of water by plant roots. In all to- bacco lines roots of control plants were fi brous and thick, 3.5\u20135 cm long, with lateral branches, while plants exposed to 100 mM NaCl had shorter roots (1\u20132.5 cm).", "mime": "application/pdf"}, {"id": "abc-1637", "words": "6355", "extension": ".pdf", "flesch": "57", "author": "Ashiq, Bushra; Chohan, Sobia; Perveen, Rashida; Abid, Muhammad; Abid Mehmood, Mirza", "title": "Chemical composition and antifungal potential of medicinal plants against seedborne mycoflora of eggplant (Solanum melongena L.)", "date": "2017", "keywords": "avus; camaldulensis; concentration; extract; growth; oxysporum; plant; seed; stolonifer", "summary": "A potentially useful substitute for expensive and possibly toxic fungicides could befound in plant extracts (Joseph et al. 2008). Although use of plant extracts is less laborious, more economical and more eco-friendly than that of fungicides, it is still not popular among stakeholders.", "mime": "application/pdf"}, {"id": "abc-1647", "words": "5682", "extension": ".pdf", "flesch": "57", "author": "Petrovic, Dragana; Jancic, Dejan; Furdek, Martina; Mikac, Nevenka; Krivokapic, Sladjana", "title": "Aquatic plant Trapa natans L. as bioindicator of trace metal contamination in a freshwater lake (Skadar Lake, Montenegro)", "date": "2016", "keywords": "concentrations; fig; lake; locations; metals; plant; root; sediment; stem", "summary": "In order to evaluate possible ecotoxic effect of metal concentrations in sedi- ments we compared the measured concentrations with the most frequently used sediment quality criteria for freshwa- ter sediment (MacDonald at al. 2000), which defi ne TEC (threshold level concentration) as a lower limit below which toxic effect is not probable, and PEC (probable effect concentration) as an upper limit above which toxicity to aquatic organisms can be expected (On-line Suppl. A long way ahead: understanding and engineering plant metal accumulation Trends in Plant Science 7, 308\u2013315.", "mime": "application/pdf"}, {"id": "abc-1650", "words": "4012", "extension": ".pdf", "flesch": "64", "author": "Pliszko, Artur; Jazwa, Malgorzata", "title": "Floristic composition of vegetation in habitats suitable for Erigeron \u00d7 huelsenii (Asteraceae)", "date": "2017", "keywords": "grass; habitats; legume; species", "summary": "Spontaneously occurring hybrids between alien and native plants have been well-documented (Vil\u00e0 et al. 2000, Daehler and Carino 2001, Bleeker et al. 2007, Lehman et al. 2014, Stace et al. 2015), and according to Py\u0161ek et al. (2004) they must be understood as alien plant species. This can be explained by the fact that in the early stages of secondary succession, abandoned sand and gravel pits are readily colonized by various plant species typical of ruderal, grassland and meadow communities (\u0158ehounkov\u00e1 and Prach 2006).", "mime": "application/pdf"}, {"id": "abc-1651", "words": "5785", "extension": ".pdf", "flesch": "61", "author": "Tusek, Martina; Curman, Marcela; Babic, Marija; Tkalec, Mirta", "title": "Photochemical efficiency, content of photosynthetic pigments and phenolic compounds in different pitcher parts of Sarracenia hybrids", "date": "2016", "keywords": "chlorophyll; content; hybrid; operculum; parts; pitcher; sarracenia; tube; wing", "summary": "Also, pitcher parts with extrafl oral nectaries have a lower amount of photosynthetic pigments (Ellison and Farnsworth 2005). Analysis of pitcher parts of hybrid A showed a signifi cant decrease of Fv/F0 in the pitcher-tube upper part and operculum compared to the wing.", "mime": "application/pdf"}, {"id": "abc-1652", "words": "2403", "extension": ".pdf", "flesch": "63", "author": "Vulevic, Anja; Dragicevic, Snezana; Petrovic, Danka", "title": "Two moss species from Mt Durmitor new to the bryophyte flora of Montenegro", "date": "2017", "keywords": "cirrata; durmitor; hedw; montenegro; mosses; obtusifolium; species", "summary": "Minjevi\u0107, D., 1996: The natural landscape of Durmitor, In: Lje- \u0161evi\u0107, M. (ed.), The nature of National Park Durmitor, Special editions, Volume 8, 285\u2013299. Papp, B., Erzeberger, P., 2010: Contributions to the bryophyte flo- ra of Durmitor National Park, Montenegro.", "mime": "application/pdf"}, {"id": "abc-1657", "words": "3741", "extension": ".pdf", "flesch": "59", "author": "Sabovljevic, Marko S.; Segarra-Moragues, Jose Gabriel; Puche, Felisa; Vujicic, Milorad; Cogoni, Annalena; Sabovljevic, Aneta", "title": "An eco-physiological and biotechnological approach to conservation of the world-wide rare and endangered aquatic liverwort Riella helicophylla (Bory et Mont.) Mont.", "date": "2016", "keywords": "dormancy; germination; helicophylla; l\u20131; media; mg l\u20131; riella; spores; water", "summary": "Culture media assays Spore germination rate and the effects of different culture media in an axenic culture establishment, as well as propagation proce- dures of R. helicophylla, were tested.", "mime": "application/pdf"}, {"id": "abc-1659", "words": "5421", "extension": ".pdf", "flesch": "59", "author": "Maslac, Ana; Maslac, Maja; Tkalec, Mirta", "title": "The impact of cadmium on photosynthetic performance and secondary metabolites in the lichens Parmelia sulcata, Flavoparmelia caperata and Evernia prunastri", "date": "2016", "keywords": "acid; caperata; days; exposure; lichens; metabolites; metal; min; sulcata", "summary": "Photosynthetica 43, 379\u2013393. Loppi, S., Frati, L., Paoli, V., Bigagli, V., Rossetti, C., Bruscoli, C., Corsini, A., 2004: Biodiversity of epiphytic lichens and heavy metal contents of Flavoparmelia caperata thalli as indi- cators of temporal variations of air pollution in the town of Montecantini Terme (central Italy). In the last 20 years, chlorophyll fl uorescence measure- ments were successfully employed in various lichen studies investigating heavy metal pollution (Ba\u010dkor et al 2010, Ka- rakoti et al. 2014, Paoli et al. 2015a).", "mime": "application/pdf"}, {"id": "abc-1673", "words": "6466", "extension": ".pdf", "flesch": "58", "author": "Yumurtaci, Aysen; Sipahi, Hulya; Zhao, Li", "title": "Genetic analysis of microsatellite markers for salt stress in two contrasting maize parental lines and their RIL population", "date": "2017", "keywords": "est; et al; maize; mapping; markers; mays; plant; protein; repeats; salt; sequence; ssr; z. mays; zm13; zm14", "summary": "Ribosome biogenesis protein 1e-94 Not suitable for primer design \u2013 ZM14-AI855164 (AT)5/ P Z. mays Unknown protein 4e-08 GTGCAGAGACGGACAGCGAGT TTTTGAGTTTTGCCGGAGTGG 346 ZM14-AI855182 (AT)6/ P Z. mays Glyceraldehyde-3- dehydrogenase 1e-47 CGACTCCCAACAGGAAATGGA GTCGCCTGGTACGACAACGAG 349 ZM14-AI855214 (TA)5/ P Z. mays Unknown protein 5e-61 TGGATCGAAGCAACTCGCACT CAACAGCGTCAAGAGCGTCAA 310 ZM14-AI855258 (TC)13/ P- (TA)3, (CACAG)6/ IP Z. mays Unknown protein 3e-19 GAGATAGGCGAGGAAGGTGAG ATCGTCATCATTCGAGCAGAG 180 ZM14-AI855272 (AGG)6/ P Z. mays Putative MYB binding protein 2e-43 GACCTCAACCTCGACCTCTG GGCTTCGTTCACTTCATCTTG 275 ZM14-AI855286 (CTG)9/ P Z. mays Unknown protein 3e-34 CCCTCTCTTTTCTCAGCCCTA ATCCAGAGGACGAGGGTTTT 288 ZM14-AI855336 (CGC)5/ P Z. mays Hypothetical protein 2e-28 GAGAAGCCGAGAACAGTAGCA CACGAGGCAGAGTCGTAGTTT 365 ZM14-AI855352 (GC)5/ P- (CGC)6, (CGA)3/ IP Z. mays Hypothetical protein 8e-11 CGAGAGCGCCATTAGAAGTCG TTTTGTGGAACGAAGCGATGG 401 ZM14-AI855361 (ACC)9,(TA)5/ P Z. mays Unknown protein 2e-47 GACCTGGAGTGGTGGTTC GATGGGATACAAATACAATAC 481 ZM14-AI649556 (CTG)5/ P Z. mays Lysin decarboxylase 3e-07 CCGGGTTTTGGACTTTGGAGA TGTTGTGGCTCTTTGCCTGTG 301 ZM14-AI861145 (TT)5,(GTC)5/ P Z. mays Not suitable for primer design \u2013 ZM14-Contig68* (AT)5/ P Z. mays Aquaporin plasma membran protein 1e-32 AAACAGGGAGTCTTCTTCTTAAC AAACAGGGAGTCTTCTTCTTAAC 382 ZM14-Contig79 (CG)5/ P Z. mays Unknown protein 3e-166 Not suitable for primer design \u2013 ZM14-Contig106* (TT)6/ P Z. mays Hypothetical protein 1e-48 GCCCATATTACATACAAAAG CAACAAGAAGGTTTATTCTG 708 ZM14-Contig114 (GG)5/ P Z. mays Unknown protein 5e-48 TGGACCAAACATCGGTTGAGC GAATGGAAGGAAGAGGGGTGGT 530 ZM14-Contig119 (ACA)5,(CCA)6/ P(CCG)5,(CCA)3/IP Z. mays Hypothetical protein 6e-39 TGGCCCCACCTGATGAAATAA GGAGTGGAGGCGGAGGATCT 615 ZM14-AI649544 (TA)3,(TGGA)5/ IP Z. mays Oxin transporter protein 1e-81 CGATGCCGAAAACCCATTCTT GCATCTGCTCGTGGAGGAAAA 303 ZM14-AI649556 (CTG)5/ P Z. mays Lysin decarboxylase 3e-07 Not suitable for primer design \u2013 ZM14-AI855154 (GAG)3,(CTG)5/ IP Z. mays Hypothetical protein 0.002 TGGTCCTGCTGCTTCTCTTGC CAAACGGTCCACCTCCACCTC 316 ZM14-AI855158 (AT)5/ P Z. mays", "mime": "application/pdf"}, {"id": "abc-1677", "words": "9267", "extension": ".pdf", "flesch": "63", "author": "Stupar, Vladimir; Carni, Andra\u017e", "title": "Ecological, floristic and functional analysis of zonal forest vegetation in Bosnia and Herzegovina", "date": "2016", "keywords": "analysis; b&h; bosnia; communities; community; ecological; et al; fig; forests; herzegovina; plant; quercus; species; tab; vegetation; zfpcs; zonal", "summary": "Using data from Bosnia and Herzegovina, this study aimed to reveal whether macro-climate is indeed the most important factor determining the existence of zonal forest plant communities (ZFPC). Zonal forest plant communities in Bosnia and Herzegovina.", "mime": "application/pdf"}, {"id": "abc-1679", "words": "7617", "extension": ".pdf", "flesch": "52", "author": "Bosiacka, Beata; Wieclaw, Helena; Marciniuk, Pawel; Podlasinski, Marek", "title": "Distribution of Taraxacum microspecies along soil property gradients in salt and brackish meadows on the Polish Baltic coast", "date": "2019", "keywords": "baltic; coast; content; dandelion; grasslands; meadows; microspecies; polish; salinity; salt; section; soil; taraxacum", "summary": "Relationships between the presence of individual dandelion microspecies (for 6 microspecies oc- curring in more than 2 plots only) and soil parameters as well as between the number of dandelion microspecies per plot and soil parameters were examined using Spearman\u2019s rank correlation test (STATISTICA StatSoft v. 10.0). 1. Results of Spearman\u2019s rank correlation test between the number and occurrence of Taraxacum microspecies and soil parameters, * denotes p < 0.05, ECe \u2013 electrolytic conductivity.", "mime": "application/pdf"}, {"id": "abc-1687", "words": "7024", "extension": ".pdf", "flesch": "61", "author": "Yasmeen, Roomana; Siddiqui, Zamin Shaheed", "title": "Physiological responses of crop plants against Trichoderma harzianum in saline environment", "date": "2017", "keywords": "b c; c d; harzianum; maize; plants; rice; salt; stress; trichoderma", "summary": "Treatment of seeds with Trichoderma improved plant growth and Th-treated plants exhibited substantial physiological adjustment in a saline environment compared to Th-untreated plants. 2. Effect of Trichoderma harzianum seed treatment on seedling growth of maize (Zea mays L.) var.", "mime": "application/pdf"}, {"id": "abc-1693", "words": "1969", "extension": ".pdf", "flesch": "60", "author": "Pliszko, Artur", "title": "Erigeron acris L. subsp. angulosus (Gaudin) Vacc. (Asteraceae), a new taxon in the flora of Poland", "date": "2018", "keywords": "acris; acris subsp; angulosus; erigeron; poland; subsp", "summary": "One of the most reliable diagnostic charac- ters that allows E. acris subsp. acris, E. acris subsp.", "mime": "application/pdf"}, {"id": "abc-1694", "words": "3573", "extension": ".pdf", "flesch": "68", "author": "Purger, Dragica; Kovacic, Sanja; Csiky, Janos", "title": "Bouch\u00e9\u2019s star of Bethlehem, Ornithogalum boucheanum (Kunth) Asch. (Hyacinthaceae), a new species in flora of Croatia", "date": "2017", "keywords": "boucheanum; croatia; flora; hungary; nikoli\u0107; nutans; ornithogalum; species", "summary": "According to the results of Bednorz and Czarna (2008) seeds of O. boucheanum and O. nutans, two closely related and morphologically very similar species, are practically undistinguishable. The chromosome numbers of O. boucheanum have been determined as 2n=56 (basic chromosome number x= 8), while the chromosome numbers of O. nutans are deter- mined as 2n=14 and 2n=35 (basic chromosome number x= 7) (Dalg\u0131c and Ozhatay 1997, Dalg\u0131c et al. 2009).", "mime": "application/pdf"}, {"id": "abc-1695", "words": "3126", "extension": ".pdf", "flesch": "54", "author": "Lepedus, Hrvoje; Jakopec, Mario; Antunovic Dunic, Jasenka; Krizmanic, Goran; Osmanovic, Sanida; Cesar, Vera", "title": "Temperature dependent chlorophylls accumulation and photosystem II assembly during etioplast to chloroplast transition in sunflower cotyledons", "date": "2017", "keywords": "chl; chlorophyll; cotyledons; greening; psii", "summary": "The main goal of our study was to detect the impact of different temperatures on chlorophyll biosynthesis and the maximum quantum yield of PSII (Fv/Fm). There- fore, we investigated the greening processes in etiolated sunfl ower cotyledons (Helianthus annuus L.) grown at different temperatures (10, 20 and 30 \u00b0C) during 24 h.", "mime": "application/pdf"}, {"id": "abc-1701", "words": "1664", "extension": ".pdf", "flesch": "50", "author": "Vilicic, Damir; Sirotic, Grozdana", "title": "Acta Botanica Croatica: editorial activity and scientometric analysis for the period 1998\u20132014", "date": "2016", "keywords": "acta; botanica; croatica; journal; period", "summary": "Since 2011 the number of libraries in Europe and North America where Acta Botanica Croatica content is disseminated increased to 624, i.e. 256 libraries in North America (according to ELU- NA 2016) and 368 in Europe (according to IGeLU 2016). 75 (1), 2016 S1 Social news Acta Botanica Croatica: editorial activity and scientometric analysis for the period 1998\u20132014 Damir Vili\u010di\u0107, Grozdana Siroti\u0107 University of Zagreb, Faculty of Science, Department of Biology, Rooseveltov trg 6, 10000 Zagreb, Croatia Abstract \u2013 An editorial report concerning and scientometric analysis of papers published in the journal Acta botanica croatica for the period from 1998 to 2014 is presented.", "mime": "application/pdf"}, {"id": "abc-1702", "words": "2502", "extension": ".pdf", "flesch": "59", "author": "Vukovic, Nina; Segota, Vedran; Alegro, Antun; Sedlar, Zorana", "title": "Rare plants of threatened habitats \u2013 the Croatian case of Corrigiola litoralis L. (Caryophyllaceae)", "date": "2018", "keywords": "corrigiola; croatia; flora; habitats; litoralis; species; trinajsti\u0107", "summary": "Keywords: endangered habitats, IUCN, Mediterranean temporary ponds, Molat * Corresponding author, e-mail: vedran.segota@biol.pmf.hr Introduction According to Flora Europaea, the genus Corrigiola is rep- resented in Europe by two species: C. litoralis L. (with two subspecies, C. litoralis L. ssp. litoralis and C. litoralis L. ssp. telephiifolia (Pourr.)", "mime": "application/pdf"}, {"id": "abc-1704", "words": "3169", "extension": ".pdf", "flesch": "66", "author": "Oskay, Dilek", "title": "A morphological study on the dioecious endemic Erodium somanum H. Pesmen (Geraniaceae), critically endangered in Turkey", "date": "2017", "keywords": "erodium; mericarp; somanum", "summary": "Keywords: dioecious plant, endangered endemic plant, Erodium somanum, fl ower morphology, micromor- phology. General appearance of Erodium somanum in nature.", "mime": "application/pdf"}, {"id": "abc-1706", "words": "6708", "extension": ".pdf", "flesch": "64", "author": "Tekin, Mehmet; Martin, Esra", "title": "Morphology, anatomy and karyology of endangered Turkish endemic Physoptychis haussknechtii Bornm. (Brassicaceae) from Central Anatolia", "date": "2017", "keywords": "cells; chromosome; haussknechtii; leaf; leaves; physoptychis; pollen; species; study", "summary": "The chromosome number of P. haussknechtii was defi ned to be 2n=16. The karyotype formula of P. haussknechtii consists of fi ve metacentric chromosome pairs and three submetacentric chromosome pairs.", "mime": "application/pdf"}, {"id": "abc-1710", "words": "7004", "extension": ".pdf", "flesch": "55", "author": "Pausic, Igor; Ivajnsic, Danijel; Kaligaric, Mitja; Pipenbaher, Natasa", "title": "Relation between plant species diversity and landscape variables in Central-European dry grassland fragments and their successional derivates", "date": "2017", "keywords": "alpha; area; diversity; fragments; grassland; groups; habitat; landscape; plant; plant species; species; species diversity; twinspan", "summary": "76 (2), 111\u2013119, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0001 ISSN 0365-0588 eISSN 1847-8476 Relation between plant species diversity and landscape variables in Central-European dry grassland fragments and their successional derivates Igor Pau\u0161i\u010d, Danijel Ivajn\u0161i\u010d, Mitja Kaligari\u010d, Nata\u0161a Pipenbaher Biology Department, Faculty of Natural Sciences and Mathematics, University of Maribor, Koro\u0161ka c. 160, SI-2000 Maribor, Slovenia Abstract \u2013 A systematic field survey of an area of 843 ha in the traditional Central-European agricultural landscape of Gori\u010dko Nature Park in Slovenia revealed 80 fragments of dry semi-natural grasslands. Our results show that fragment size does not affect plant species diversity.", "mime": "application/pdf"}, {"id": "abc-1716", "words": "3967", "extension": ".pdf", "flesch": "59", "author": "Sumathi, Murugan; Ramasamy, Yasodha", "title": "Microsatellite allele length variations in inter-specific hybrids of Eucalyptus", "date": "2017", "keywords": "alleles; dna; repeat; sequence; species; ssr; t c", "summary": "All the DNA sequences of SSR locus along with the source SSR sequence and E. grandis genomic region harbouring SSR were aligned using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/) to identify the structural variations in microsatellites. Original microsatellite sequence of Eg61 (EU699745.1) and E. grandis genome sequence showed compound SSR (GAA) (GAT) repeats.", "mime": "application/pdf"}, {"id": "abc-1719", "words": "6590", "extension": ".pdf", "flesch": "68", "author": "Dere, Saban; Aytas Akcin, Tulay", "title": "Anatomical and micromorphological properties of some Tanacetum L. (Asteraceae) taxa from Turkey and their systematic implications", "date": "2017", "keywords": "asteraceae; cells; leaf; species; stem; tab; tanacetum; taxa; trichomes; vulgare", "summary": "Scanning electron micrographs (SEM) of trichomes of studied Tanacetum L. taxa: (A) eglandular trichomes on leaf of T. macrophyllum, (B) eglandular trichomes on phyllaries of T. mac\u00ad rophyllum, (C) glandular trichomes on the lower surface of leaf of T. macrophyllum, (D) glandular trichomes on phyllaries of T. parthenium, (E) glandular trichomes on the lower surface of leaf of T. poteriifolium, (F) glandular trichomes on the lower surface of leaf of T. vulgare. Scanning electron micrographs (SEM) of cypselas of stud- ied Tanacetum L. taxa: (A) T. macrophyllum, (B) T. parthenium, (C) T. poteriifolium, (D) T. vulgare.", "mime": "application/pdf"}, {"id": "abc-1721", "words": "4576", "extension": ".pdf", "flesch": "57", "author": "Yilmaz Gokdogan, Emel; Burun, Betul", "title": "The ameliorative effects of 24-epibrassinolide on shoot organogenesis inhibition occurring under NaCl-stressed conditions in cultures of cotyledon and hypocotyl explants of tomato (Lycopersicon esculentum Mill.)", "date": "2017", "keywords": "epibl; explants; hypocotyl; mm nacl; nacl; shoot; stress", "summary": "Abstract \u2013 In this study, possible effects of 24-epibrassinolide (24-epiBL) pretreatment against NaCl stress were investigated using in vitro shoot organogenesis from cotyledon and hypocotyl explants in M-28 tomato hybrid cultivar. It was determined that the regeneration percentage as well as the shoot number/explant, the shoot length and the leaf number/shoot derived from both explants suffered NaCl stress after 30 days.", "mime": "application/pdf"}, {"id": "abc-1724", "words": "6475", "extension": ".pdf", "flesch": "59", "author": "Weryszko-Chmielewska, Elzbieta; Chwil, Miroslawa", "title": "Structure of floral nectaries in Aesculus hippocastanum L.", "date": "2017", "keywords": "aesculus; cells; chmielewska; figs; fl owers; hippocastanum; nectaries; nectary; owers; secretion; structure", "summary": "76 (1), 41\u201348, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2016-0049 ISSN 0365-0588 eISSN 1847-8476 Structure of fl oral nectaries in Aesculus hippocastanum L. El\u017cbieta Weryszko-Chmielewska, Miros\u0142awa Chwil* University of Life Sciences in Lublin, Faculty of Horticulture and Landscape Architecture Department of Botany, Lublin, Poland Abstract \u2013 Representatives of the family Sapindaceae exhibit high morphological diversity of the nectary structure. The present paper shows for the fi rst time the results of micromorphological, anatomical, and ultra- structural analyses of fl oral nectaries in Aesculus hippocastanum.", "mime": "application/pdf"}, {"id": "abc-1725", "words": "5897", "extension": ".pdf", "flesch": "54", "author": "Anzlovar, Sabina; Likar, Matevz; Dolenc Koce, Jasna", "title": "Antifungal potential of thyme essential oil as a preservative for storage of wheat seeds", "date": "2017", "keywords": "essential; germination; grain; growth; infection; oil; seed; sterilization; thyme; treatment; wheat; wheat grain", "summary": "Essential oil treatment of wheat grain In the present study, two types of wheat (Triticum aes- tivum L.) grain were used: conventionally grown grain obtained from the Agricultural Institute of Slovenia (T. aes- tivum cv. The effects of the seed type, prior sterilization, essential oil treatments, and essen- tial oil concentrations on the fungal infection rates and the germination rates of the wheat grain were tested using mul- tiway-ANOVA, with the level of signifi cance set at p<0.05.", "mime": "application/pdf"}, {"id": "abc-1730", "words": "4750", "extension": ".pdf", "flesch": "52", "author": "Vannini, Andrea; Paoli, Luca; Nicolardi, Valentina; Di Lella, Luigi Antonello; Loppi, Stefano", "title": "Seasonal variations in intracellular trace element content and physiological parameters in the lichen Evernia prunastri transplanted to an urban environment", "date": "2017", "keywords": "cell; content; elements; lichen; loppi; pollution; trace", "summary": "Further investigation is necessary to shed light on the role of intracellular trace element content in lichens, in or- der to allow comparison of these data with other biomoni- toring studies and get an insight into the ecophysiological effects of air pollution. Intracellular trace element (Al, As, Ba, Cd, Ce, Cr, Cu, Fe, Mn, Ni, Pb, Pd, Sb, Zn) concentrations were determined by inductively coupled plasma mass spectrometry (ICP- MS, Perkin- Elmer Sciex 6100) and expressed on a dry weight basis.", "mime": "application/pdf"}, {"id": "abc-1742", "words": "4178", "extension": ".pdf", "flesch": "56", "author": "Abbasi, Shabnam; Afsharzadeh, Saeed; Saeidi, Hojjatollah", "title": "Genetic diversity of Potamogeton pectinatus L. in Iran as revealed by ISSR markers", "date": "2017", "keywords": "accessions; diversity; iran; issr; pectinatus; pot; potamogeton; river; species", "summary": "76 (2), 177\u2013182, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0008 ISSN 0365-0588 eISSN 1847-8476 Genetic diversity of Potamogeton pectinatus L. in Iran as revealed by ISSR markers Shabnam Abbasi1, Saeed Afsharzadeh2*, Hojjatollah Saeidi3 Department of Biology, University of Isfahan, 81746-73441, Isfahan, Iran Abstract \u2013 Potamogeton pectinatus L. is a widespread aquatic species distributed widely in aquatic ecosys- tems of Iran. Analysis of molecular variance (AMO- VA) was performed to calculate the proportion of intra-ac- cession and inter-accession genetic diversity using Genalex 6.5 software.", "mime": "application/pdf"}, {"id": "abc-1743", "words": "9895", "extension": ".pdf", "flesch": "65", "author": "Verloove, Filip", "title": "New xenophytes from the Canary Islands (Gran Canaria and Tenerife; Spain)", "date": "2017", "keywords": "barranco; barranco de; canaria; canary; canary islands; cruz; flora; gran; gran canaria; individuals; islands; new; riverbed; species; tenerife; verloove", "summary": "(Araliaceae) Tenerife: Buenavista del Norte, Golf Court (W-side), epi- phyte on Phoenix, 30.06.2014, F. Verloove 10884 (BR); Torviscas, close to barranco Colon, epiphyte on Phoenix, 31.10.2014, F. Verloove s.c.; Las Galletas, TEN-BEL, epi- phyte on Phoenix, 11.06.2015, F. Verloove s.c.; Playa de Las Am\u00e9ricas, Fa\u00f1abe, Hotel Riu, epiphyte on Phoenix, 15.06.2015, F. Verloove s.c. coriacea, Playa Paraiso, barranco de Las Galgas, June 2014 (photo F. Verloove).", "mime": "application/pdf"}, {"id": "abc-1745", "words": "3404", "extension": ".pdf", "flesch": "63", "author": "Segota, Vedran; Hrsak, Vladimir; Alegro, Antun", "title": "Long time no see \u2013 rediscovery of peculiar ephemeral fern Anogramma leptophylla (L.) Link in Croatia", "date": "2017", "keywords": "anogramma; croatia; der; flora; island; leptophylla; mediterranean; mljet; species", "summary": "In order to avoid its competitors, A. leptophylla fi nishes its short life- cycle at the end of spring when ephemeral mosses, liver- worts and minute seed plants start to inhabit the unhostile surfaces. The establishment of A. leptophylla on the western part of the island of Mljet may be attributable to certain favourable environmental conditions, but essentially to higher air and soil hu- midity.", "mime": "application/pdf"}, {"id": "abc-1752", "words": "6566", "extension": ".pdf", "flesch": "61", "author": "Kielkowska, Agnieszka", "title": "Allium cepa root meristem cells under osmotic (sorbitol) and salt (NaCl) stress in vitro", "date": "2017", "keywords": "cells; control; meristem; nacl; onion; osmotic; plant; root; salt; sorbitol; stress", "summary": "76 (2), 146\u2013153, 2017 CODEN: ABCRA 25 DOI: 10.1515/botcro-2017-0009 ISSN 0365-0588 eISSN 1847-8476 Allium cepa root meristem cells under osmotic (sorbitol) and salt (NaCl) stress in vitro Agnieszka Kie\u0142kowska Institute of Plant Biology and Biotechnology, Faculty of Biotechnology and Horticulture, University of Agriculture in Krakow, Al. 29-Listopada 54, 31-425 Krakow, Poland Abstract \u2013 The effects of various concentrations of sorbitol (100, 200 and 360 mM) and NaCl (100, 200 and 300 mM) on root meristem cells of in vitro-cultured Allium cepa L. were analyzed after 10 and 20 days. Af- ter the 10-day treatment, root meristem cells of plants grown on medium supplemented with 100 mM of sorbitol were 16% smaller than control cells during the same period of time, while after 20 days of exposure cells were 28% smaller.", "mime": "application/pdf"}, {"id": "abc-1754", "words": "8093", "extension": ".pdf", "flesch": "56", "author": "Balpinar, Neslihan; Kavgaci, Ali; Bingol, M. Umit; Ketenoglu, Osman", "title": "Diversity and gradients of vegetation of Sivrihisar Mountains (Eskisehir-Turkey)", "date": "2018", "keywords": "akman; anatolia; angustifolius; area; ass; astragalus; communities; community; forest; hoc; keteno\u011flu; loco; mountains; sivrihisar; species; ssp; steppe; study; tab; turkey; var; vegetation", "summary": "Dominant species: Astraga- lus microcephalus Cluster 4: Astragalus angustifolius ssp. pallida, Arabis nova, Astragalus angustifolius ssp.", "mime": "application/pdf"}, {"id": "abc-18", "words": "3635", "extension": ".pdf", "flesch": "61", "author": "Wrischer, Mercedes; Prebeg, Tatjana; Magnus, Volker; Ljubesic, Nikola", "title": "Unusual thylakoid structures appearing during degradation of the photosynthetic apparatus in chloroplasts", "date": "2009", "keywords": "bleaching; degradation; grana; leaves; ljube[i; plastids; thylakoids; wrischer", "summary": "Membrane coils and cup-shaped membrane stacks were found in bleaching leaves of quite different plants. The first type of degradation is characterized by coiling of single thylakoids and by cup-shape stacking of grana thylakoids.", "mime": "application/pdf"}, {"id": "abc-1800", "words": "7876", "extension": ".pdf", "flesch": "54", "author": "Kralj Borojevic, Koraljka; Gligora Udovic, Marija; Zutinic, Petar; Varbiro, Gabor; Plenkovic-Moraj, Andjelka", "title": "Do benthic diatom assemblages reflect abiotic typology: a case study of Croatian streams and rivers", "date": "2017", "keywords": "analysis; assemblages; bertalot; carbonate; diatom; groups; grunow; k\u00fctzing; lange; quality; som; species; streams; types; variables; water", "summary": "Analysis of variance revealed statistically signifi - cant differences (p<0.05) among SOM groups concerning ammonia, nitrates and total phosphorus. Grouping of similar sites, although placed into different abiotic types, makes SOM groups with its corresponding representative species an easy tool for water quality assessment and description of reference assemblage.", "mime": "application/pdf"}, {"id": "abc-1803", "words": "4372", "extension": ".pdf", "flesch": "65", "author": "Gunes, Fatma; Meric, Ciler", "title": "Morphological, anatomical and karyological investigations of the Turkish endemic species Lathyrus woronowii Bornm. (Fabaceae)", "date": "2017", "keywords": "g\u00fcne\u015f; lathyrus; species; turkey; woronowii", "summary": "Et Noe, L. inconspicuus L., L. setifolius L.) growing in Tur- key. Stems of L. maritimus Bigel, L. pratensis, L. sylvestris L. (Metcalfe and Chalk 1950), L. latifolius L. (Krstic et al. 2002), L. hir- sutus L. and L. sativus L. (Mantar et al. 2003) contain wings.", "mime": "application/pdf"}, {"id": "abc-1820", "words": "7061", "extension": ".pdf", "flesch": "56", "author": "Friscic, Maja; Maslo, Semir; Garic, Rade; Males, Zeljan; Hazler Pilepic, Kroata", "title": "Comparative analysis of secondary metabolites and antioxidant capacity in vitro of different natural populations of Globularia spp.", "date": "2018", "keywords": "alypum; antioxidant; content; cordifolia; et al; globularia; metabolites; parts; phenolic; plant; species", "summary": "Maja Fri\u0161\u010di\u01071*, Semir Maslo2, Rade Gari\u01073, \u017deljan Male\u01611, Kroata Hazler Pilepi\u0107 1 1 Department of Pharmaceutical Botany, Faculty of Pharmacy and Biochemistry, University of Zagreb, Zagreb, Croatia 2 Lund\u00e5kerskolan, Gislaved, Sweden 3 Institute for Marine and Coastal Research, University of Dubrovnik, Dubrovnik, Croatia Abstract \u2013 Total phenolic, flavonoid, condensed tannin and iridoid content, as well as antioxidant capacity in vi- tro, were determined spectrophotometrically in methanolic extracts of different plant parts of the Mediterranean medicinal plant Globularia alypum L. and three widespread European species of the same genus: G. cordifolia L., G. meridionalis (Podp.) A two- way analysis of variance (ANOVA) followed by the Bonfer- roni post-hoc test was carried out on averaged results for plant parts of each species, to determine significant differ- ences among the same plant parts of different species and different plant parts of the same species.", "mime": "application/pdf"}, {"id": "abc-1821", "words": "7702", "extension": ".pdf", "flesch": "55", "author": "Karalija, Erna; Cavar Zeljkovic, Sanja; Tarkowski, Petr; Muratovic, Edina; Paric, Adisa", "title": "Media composition affects seed dormancy, apical dominance and phenolic profile of Knautia sarajevensis (Dipsacaceae), Bosnian endemic", "date": "2018", "keywords": "acid; dominance; germination; kinetin; l\u20131; media; mg l\u20131; phenolic; plant; sarajevensis; shoots", "summary": "Decapita- tion was relatively successful as a tool for apical dominance suppression in K. sarajevensis shoot cultures. Establishment of the shoot cultures and apical dominance suppression Roots were removed from all germinated seedlings prior to cultivation on shoot culture media.", "mime": "application/pdf"}, {"id": "abc-1825", "words": "5537", "extension": ".pdf", "flesch": "65", "author": "Sostaric, Renata; Potrebica, Hrvoje; Hrsak, Jelena; Marekovic, Sara", "title": "Archaeobotanical components of grave goods in prehistoric tumuli 6 and 7 at the archaeological site of Kaptol-Gradci, near Po\u017eega (Croatia)", "date": "2017", "keywords": "burial; finds; gradci; grave; kaptol; plant; potrebica; remains; samples; site; tumuli; tumulus", "summary": "Tumuli at archaeological site of Kaptol-Gradci investigated during the excavation campaign: a) tumulus 6, b) an element of a belt set of iron and bronze and c) bronze strap dividers from horse gear from tumulus 6; d) tumulus 7, e) chamber of tumulus 7 with the posi- tion of the pot, f) pot covered with two small bowls; it was used as an urn. Overview of finds (total number and percentage) of indi- vidual plant families within the group of cereals from tumuli at archaeological site Kaptol-Gradci: a) tumulus 6, b) tumulus 7. a b \u0160O\u0160TARI\u0106 R., POTREBICA H., HR\u0160AK J., ESSERT S. 190 ACTA BOT.", "mime": "application/pdf"}, {"id": "abc-183", "words": "3462", "extension": ".pdf", "flesch": "64", "author": "Gunes, Fatma; Cirpici, Ali", "title": "Pollen Moprhology of Turkey species from the section Cicercula (Medic) Gren. & Godr. (genus Lathyrus, Fabaceae) in the Thrace region (Turkey-in-Europe)", "date": "2010", "keywords": "acetolysis; colpus; lathyrus; pollen; reticulate; wodehouse", "summary": "pilosus C. C. Townsend, L. cicera L. and L. hirsutus L. Pollen morphology of some Lathyrus species (L. undulatus Boiss., L. sylvestris L., L. ochrus (L.) DC.) of Istanbul area (In Tukish).", "mime": "application/pdf"}, {"id": "abc-1839", "words": "2413", "extension": ".pdf", "flesch": "66", "author": "Chinan, Vasilica Claudiu", "title": "Occurrence of the sexual morph of Erysiphe macleayae on Chelidonium majus in Romania", "date": "2018", "keywords": "erysiphe; macleayae; majus; mildew; powdery", "summary": "Key words: greater celandine, powdery mildew, chasmothecia, ITS * Corresponding author, e-mail: vasilechinan@yahoo.com Introduction thecia) were also found in Germany in 2014 (Braun 2014) and Slovakia in 2014 and 2015 (Pastir\u010d\u00e1kov\u00e1 et al. 2016). Besides these hosts, it was also reported as causal agent of powdery mildew on Macleaya microcarpa (Maxim.)", "mime": "application/pdf"}, {"id": "abc-185", "words": "2248", "extension": ".pdf", "flesch": "68", "author": "Pujadas-Salva\u00a0, Antonio J.; Munoz Garmendia, J. Felix", "title": "Orobanche pseudorosmarina A. Pujadas & Munoz Garm. sp. nov. (Orobanchaceae) from the eastern Mediterranean region", "date": "2010", "keywords": "beck; hairs; orobanche; rosmarina; stenosiphon", "summary": "Results Description of the new species The Croatian plants that were previously identified as O. rosmarina Beck belong to an unnamed taxon other than that of the Iberian ones and are described as the following new species here: 2 ACTA BOT. [identified by Beck as Orobanche rosmarina Beck =O. mutelii var.", "mime": "application/pdf"}, {"id": "abc-186", "words": "3665", "extension": ".pdf", "flesch": "69", "author": "Ozimec, Sini\u00c5\u00a1a; Bo\u00c5\u00a1kovi\u00c4\u2021, Ivica; Florijan\u00c4\u008di\u00c4\u2021, Tihomir; Jelki\u00c4\u2021, Dinko; Opa\u00c4\u008dak, An\u00c4\u2018elko; Pu\u00c5\u00a1kadija, Zlatko; Labak, Irena", "title": "Contribution to the lichen flora of Risnjak National Park (Croatia)", "date": "2010", "keywords": "abies; acer; ach; area; croatia; fagus; lichen; park; pseudoplatanus; risnjak; species; sylvatica", "summary": "Lichens growth on 16 various substrates, among which the deciduous trees, Acer pseudoplatanus and Fagus sylvatica dominate. The most frequent phorophytes are Acer pseudoplatanus, which supports 36 species, Fagus sylvatica with 26 species, Pru- nus spp.", "mime": "application/pdf"}, {"id": "abc-1888", "words": "3640", "extension": ".pdf", "flesch": "56", "author": "Eom, Seung Hee; Lee, Jae Kook; Kim, Dong-Ho; Kim, Heekyu; Jang, Keum-Il; Ryu, Hojin; Hyun, Tae Kyung", "title": "Identification and expression profiling of flax (Linum usitatissimum L.) polyamine oxidase genes in response to stimuli", "date": "2018", "keywords": "analysis; cell; expression; fig; flax; genes; lupao; paos; plant; polyamine", "summary": "Taken together, our genome-wide analysis of PAO genes and expression profiling of these genes provide the first step toward the functional dissection of LuPAOs. In order to iden- tify PAO genes, sequences of PAOs from Arabidopsis and rice were analyzed using BLASTp against all scaffold se- quences of flax.", "mime": "application/pdf"}, {"id": "abc-1889", "words": "5668", "extension": ".pdf", "flesch": "67", "author": "Iamonico, Duilio", "title": "Nomenclatural notes on some annual mallows (Malvaceae)", "date": "2018", "keywords": "africana; iamonico; lavatera; lavatera trimestris; lectotype; malva; miergues; moschata; punctata; species; trimestris; var", "summary": "Maire, L. punctata All., and L. trimestris L. are traditionally placed in Lavatera sect. Key words: Lavatera, lectotypification, Malva, neotypification, new combination * Corresponding author, e-mail: d.iamonico@yahoo.it Introduction Molecular studies on the Malva alliance (Ray 1995, Es- cobar et al. 2009) showed that the traditional separation of the genera Malva L. and Lavatera L., based mainly on the de- gree of fusion of the epicalyx bracts, is artificial and cannot be maintained, while the taxonomic signicance of the fruit morphology was emphasized.", "mime": "application/pdf"}, {"id": "abc-1896", "words": "2134", "extension": ".pdf", "flesch": "64", "author": "Gottschlich, G\u00fcnter; Scafidi, Filippo; Di Gristina, Emilio", "title": "Hieracium pollinense (Asteraceae), an endemic species to the Pollino National Park (Southern Italy) rediscovered", "date": "2017", "keywords": "hieracium; national; park; pollinense; pollino; species; zahn", "summary": "Beyond that it was a younger homonym to H. rigoanum Zahn 1902. So far, the presence of H. pollinense in Italy was known from the type specimens only.", "mime": "application/pdf"}, {"id": "abc-1901", "words": "5984", "extension": ".pdf", "flesch": "58", "author": "Shekhawat, Mahipal S; M., Manokari", "title": "In vitro multiplication, micromorphological studies and ex vitro rooting of Hybanthus enneaspermus (L.) F. Muell. \u2013 a rare medicinal plant", "date": "2018", "keywords": "enneaspermus; et al; field; hybanthus; medium; plantlets; plants; rooting; shoots", "summary": "Micromorphological studies of Hybanthus enneaspermus: venation pattern in leaves of in vitro shoots (A); and field plant (B); stomatal pattern in leaves of in vitro shoots (C), and field plant (D); and trichomes in leaves of in vitro shoots (E), and field plant (F). Subramoniam, A., Madhavachandran, V., Gangaprasad, V., 2013: Medicinal plants in the treatment of arthritis.", "mime": "application/pdf"}, {"id": "abc-1910", "words": "868", "extension": ".pdf", "flesch": "45", "author": "Bogdanovic, Sandro; Jogan, Nejc", "title": "A Word from the Guest Editors", "date": "2016", "keywords": "bbc; congress; rijeka", "summary": "At the end, in the name of Organizers of 6th BBC, we can all thank the participants for shaping up a pleasant, informative and fruitful congress with an exchange of up-to-date results from various fi elds of botany. And fi nally, but not the least, we have to thank the organizing consortium of local organizers: Rijeka Natural History Mu- seum and the University of Rijeka, which offered us a comfortable space in their campus, and the active members of the two botanical associations Croatian Botanical Society (HBoD) and Botanical Society of Slovenia (BDS).", "mime": "application/pdf"}, {"id": "abc-1912", "words": "6585", "extension": ".pdf", "flesch": "60", "author": "Umar, Muhammad; Siddiqui, Zamin Shaheed", "title": "Physiological performance of sunflower genotypes under combined salt and drought stress environment", "date": "2018", "keywords": "chlorophyll; content; drought; genotypes; h2o2; plants; proline; s.28111; salt; sf0049; stress; stresses; sunflower; water", "summary": "Plants are frequently exposed to many extremes such as drought stress, low/high temperature, salt stress, flooding stress, and heavy metal toxicity while growing in nature. It was reported that in drought stress, plant growth retardation is linked with pho- tosynthesis, respiration, and nutrient metabolism.", "mime": "application/pdf"}, {"id": "abc-1919", "words": "4986", "extension": ".pdf", "flesch": "57", "author": "Yanik, Fatma; Ayturk, Ozlem; Cetinbas-Genc, Aslihan; Vardar, Filiz", "title": "Salicylic acid-induced germination, biochemical and developmental alterations in rye (Secale cereale L.)", "date": "2018", "keywords": "acid; activity; control; growth; plant; salicylic; stress; \u00b5m sa", "summary": "Numerous re- searches indicated that SA content increases under various types of oxidative stress conditions in plants (Larkindale and Knight 2002, War et al. 2011). This situation can be explained by SA treatment stimulating plant growth by stimulating mitotic activity (Shakirova et al. 2003).", "mime": "application/pdf"}, {"id": "abc-1927", "words": "9747", "extension": ".pdf", "flesch": "56", "author": "Chandrakar, Vibhuti; Dubey, Amit; Sahu, Keshavkant", "title": "Modulation of arsenic-induced oxidative stress and protein metabolism by diphenyleneiodonium, 24-epibrassinolide and proline in Glycine max L.", "date": "2018", "keywords": "arsenic; chandrakar; dpi; ebl; et al; glycine; glycine max; max; max l.; min; pro; protein; stress", "summary": "The present study was intended to exam- ine the comparative ameliorative effects of diphenyleneiodonium (DPI), 24-epibrassinolide (EBL) and proline (Pro) on As-stress in Glycine max L. Seeds of Glycine max L. were subjected to As (100 \u00b5M) singly, and together with DPI (10 \u00b5M), EBL (0.5 \u00b5M) or Pro (10 mM), for five days, and were then analyzed. Therefore, in order to ex- plore the possibility of whether the ROS scavengers viz DPI, EBL or Pro, could be used to alleviate As-induced oxidative injury, the present study was aimed at examining the com- parative effects of DPI, EBL and Pro on growth and devel- opment, As accumulation, tissue viability, oxidative stress markers (electrolyte leakage, ROS, MDA, HNE, endogenous Pro and total sugar), total protein and its oxidized products (PCO, PrOOH, Amadori and Maillard reaction products and MDA-/HNE-protein adducts), activities of protease and proteasome, and responses of antioxidant enzymes in As- stressed Glycine max L. Materials and methods Seed collection, treatments and germination assessment Fresh seeds of Glycine max L. were collected from the farmers of Kabirdham (N22\u00b001', E81\u00b023', 353 MSL), 110 km to the south of Raipur.", "mime": "application/pdf"}, {"id": "abc-193", "words": "5537", "extension": ".pdf", "flesch": "61", "author": "Saheed, Sefiu Adekilekun; Jonsson, Lisbeth M.V.; Botha, Christiaan E.J.", "title": "Russian wheat aphid causes greater reduction in phloem transport capacity of barley leaves than bird cherry-oat aphid.", "date": "2010", "keywords": "aphid; bca; botha; feeding; leaves; phloem; rwa; transport", "summary": "2H, J) to a much greater extent than observed in BCA infested leaves (Figs. NIELSEN et al. (1990) have reported the dis- ruption of assimilate transport when the Potato leafhopper (Empoasca fabae) feeds on Medicago sativa (alfalfa).", "mime": "application/pdf"}, {"id": "abc-1930", "words": "9214", "extension": ".pdf", "flesch": "59", "author": "Jachula, Jacek; Wrzesien, Malgorzata; Strzalkowska-Abramek, Monika; Denisow, Bozena", "title": "The impact of special-temporal changes in flora attributes and pollen availability on insect visitors in Lamiaceae species", "date": "2018", "keywords": "abundance; denisow; flowering; flowers; grassland; habitat; insect; lamiaceae; plant; pollen; railway; species; visitors", "summary": "The percentage of plant species in bloom at each study point was established based on the cover of plant species in particular transects (n = 5 per habitat). Results Nectar and pollen yielding plants The total number of plant species found was 185, of which 151 species (81.6%) were identified as visited by in- sects (On-line Suppl.", "mime": "application/pdf"}, {"id": "abc-1935", "words": "7071", "extension": ".pdf", "flesch": "56", "author": "Mousavi, Effat Ahmadi; Kalantari, Khosrow Manochehri; Nasibi, Fatemeh; Oloumi, Hakimeh", "title": "Effects of carrageenan as elicitor to stimulate defense responses of basil against Cuscuta campestris Yunck", "date": "2018", "keywords": "activity; basil; basil plants; campestris; carrageenan; content; control; cuscuta; defense; et al; growth; host; plants", "summary": "Because carrageenans are non-toxic biodegradable, non-polluting and non-hazard- ous to humans, animals and birds, they can be recommended as natural biostimulators for the protection of plants against parasitic C. campestris plants. Infestation percentage of C. campestris For analysis of defense against C. campestris invasion and measuring of infestation of basil plants by C. campestris, the percentage of C. campestris tight coupling (its haustorium penetration) to basil shoot was determined 14 days after the infection.", "mime": "application/pdf"}, {"id": "abc-1945", "words": "5387", "extension": ".pdf", "flesch": "58", "author": "Emami-Tabatabaei, Samane Sadat; Larijani, Kambiz; Mehregan, Iraj", "title": "Application and limitation of molecular data and essential oil content in identification of Leutea elbursensis Mozaff in northern Iran", "date": "2018", "keywords": "elbursensis; et al; ferula; iran; leutea; oils; petiolaris; pimenov; populations; species", "summary": "We also aim to study the possible cor- relation between the genetic structure and the essential oil profile of L. elbursensis populations collected from different localities in northern Iran (Tehran province), using GC/MS and AFLP fingerprinting techniques. Journal of Essential Oil Research 16, 143\u2013144. Mehregan, I., Ghannadi, A., 2013: Essential oil analysis of Haussknechtia elymaitica Boiss fruits, an endemic plant from Iran.", "mime": "application/pdf"}, {"id": "abc-1949", "words": "6524", "extension": ".pdf", "flesch": "62", "author": "Jasprica, Nenad; Dolina, Katija; Milovic, Milenko", "title": "The flora and vegetation of the NE Mediterranean islet with centuries-long human influences", "date": "2018", "keywords": "adriatic; br.-bl; croatian; et al; flora; islands; islet; jasprica; mediterranean; milovi\u0107; nikoli\u0107; plant; species; taxa; vegetation; vrnik", "summary": "ex Westhoff et al. 1946 Artemisietea vulgaris Lohmeyer et al. in Tx. Celesti-Grapow, L., Bassi, L., Brundu, G., Camarda, I., Carli, E., D\u2019Auria, G., et al., 2016: Plant invasions on small Mediterra- nean islands: An overview.", "mime": "application/pdf"}, {"id": "abc-1953", "words": "2197", "extension": ".pdf", "flesch": "62", "author": "Nov\u00e1k, Pavel; Zukal, Dominik", "title": "Galium divaricatum Pourr. ex Lam. (Rubiaceae) \u2013 a new species for the flora of Ukraine", "date": "2018", "keywords": "divaricatum; flora; galium; region; species; ukraine", "summary": "Besides G. divaricatum, two other spe- cies of this group occur in Central Europe, G. parisiense and G. tenuissimum. This paper focuses on G. divaricatum which was discovered in the Za- karpatska Region (W Ukraine) as a new plant for the Ukrai- nian flora in June 2016.", "mime": "application/pdf"}, {"id": "abc-1968", "words": "2575", "extension": ".pdf", "flesch": "67", "author": "Iamonico, Duilio; El Mokni, Ridha", "title": "A new addition to the alien flora of Tunisia, Amaranthus spinosus L. (Amaranthaceae s.l.), with notes on A. diacanthus Raf.", "date": "2019", "keywords": "amaranthaceae; amaranthus; iamonico; species; spinosus", "summary": "Keywords: alien species, Amaranthus, neophyte, typification * Corresponding author, e-mail: d.iamonico@yahoo.it Introduction The genus Amaranthus L. (Amaranthaceae Juss.) Amaranthus L.", "mime": "application/pdf"}, {"id": "abc-1973", "words": "6668", "extension": ".pdf", "flesch": "63", "author": "Animasaun, David Adedayo; Oyedeji, Stephen; Olorunmaiye, Kehinde Stephen; Azeez, Musibau A; Tijani, Idowu Abdulfatah; Morakinyo, Joseph Akintade", "title": "Morpho-chemical divergence and fatty acid profile of shea tree seeds (Vitellaria paradoxa) collected from different locations in Kwara State, Nigeria", "date": "2019", "keywords": "acid; butter; fatty; fruit; journal; kosubosu; locations; nigeria; nut; oil; paradoxa; seed; shea; tree", "summary": "78 (1), 17\u201324, 2019 CODEN: ABCRA 25 DOI: 10.2478/botcro-2019-0002 ISSN 0365-0588 eISSN 1847-8476 Morpho-chemical divergence and fatty acid profile of shea tree seeds (Vitellaria paradoxa) collected from different locations in Kwara State, Nigeria David Adedayo Animasaun1*, Stephen Oyedeji1, Kehinde Stephen Olorunmaiye1, Musibau A. Azeez2*, Idowu Abdulfatah Tijani3, Joseph Akintade Morakinyo1 1 Department of Plant Biology, Faculty of Life Sciences, University of Ilorin, Ilorin, Kwara State, Nigeria 2 Department of Pure and Applied Biology, Ladoke Akintola University of Technology, Ogbomoso, Oyo State, Nigeria 3 Department of Chemical Engineering, University of Ilorin, Ilorin, Kwara State, Nigeria Abstract \u2013 The present study characterizes seed-related traits, phytochemical, physiochemical parameters and fatty acid profile of shea (Vitellaria paradoxa) seeds collected from the Kosubosu, Fufu and Sare areas of Kwara State, Nigeria to determine the effects of microclimate on seed morphology, biochemical and oil constituents. Morphological seed related characters of shea tree seeds collected from different locations in Kwara State, Nigeria: (a) Kosubosu, Baruten, (b) Fufu, Ilorin West, (c) Sare, Ifelodun.", "mime": "application/pdf"}, {"id": "abc-1977", "words": "4646", "extension": ".pdf", "flesch": "57", "author": "Palmai, Tamas; Szabo, Beata; Hubai, Katalin Eszter; Padisak, Judit", "title": "Photosynthetic performance of two freshwater red algal species", "date": "2018", "keywords": "bangia; batrachospermum; light; m\u20132; rhodophyta; species; temperature; \u00b5mol", "summary": "Ps values of Bangia were calculated only at 5 and 10 \u00b0C because at higher temperatures photoinhibition was not ob- served, and the obtained data were similar to PB max. At higher temperatures a slow decrease was observed in the Ik values.", "mime": "application/pdf"}, {"id": "abc-1986", "words": "2914", "extension": ".pdf", "flesch": "67", "author": "Zare, Golshan; Ozudogru, Baris; Ergan, Gokhan; Tavsanoglu, Cagatay", "title": "Taxonomic notes on the genus Chaenorhinum (Plantaginaceae) in Turkey", "date": "2018", "keywords": "calyx; chaenorhinum; davis; gerense; leaves; rubrifolium; seeds; species; turkey", "summary": "Characters C. rubrifolium C. gerense Height (cm) 4-22 2.5-12 (25) Basal leaves Leaves subsessile, ovate to ovate-oblong Leaves petiolate, elliptic-ovate Basal leave size (mm) 7-25 \u00d7 5-11 8-12 \u00d7 3-4 Pedicels (mm) 5-15, erect 3-10, ascending Flower Erect Patent Corolla colour White with violet upper lip Cream with red batch in upper lip Corolla size (mm) 8.5-10.5 5-7(9) In this study, the accuracy of the taxonomic status of this species, which was initially reported by P.H. Davis as C. rubrifolium from south eastern Turkey, is discussed and the typical representatives of C. rubrifolium were collected for the first time for Turkey from Mu\u011fla province, southwestern Anatolia.", "mime": "application/pdf"}, {"id": "abc-1987", "words": "4145", "extension": ".pdf", "flesch": "59", "author": "Papadakis, Ioannis E; Veneti, Georgia; Chatzissavvidis, Christos; Therios, Ioannis", "title": "Physiological and growth responses of sour cherry (Prunus cerasus L.) plants subjected to short-term salinity stress", "date": "2018", "keywords": "fig; growth; leaves; nacl; plants; root; salinity; stress", "summary": "According to Tattini et al. (1995), the maintenance of plant growth and PAPADAKIS I. E., VENETI G., CHATZISSAVVIDIS C., THERIOS I. 198 ACTA BOT. Therefore, the current study aimed to investigate the growth and physiological re- sponses (plant growth, chlorophyll concentration, water re- lations and nutrient status) of the well-known sour cherry genotype CAB-6P, which is widely used as a rootstock for both sour and sweet cherry cultivars, under salt stress.", "mime": "application/pdf"}, {"id": "abc-1995", "words": "2724", "extension": ".pdf", "flesch": "65", "author": "Bogdanovic, Sandro; Segota, Vedran; Alegro, Antun", "title": "Resurrection of the regionally extinct taxon in Croatia \u2013 the case of Ammophila arenaria (L.) Link (Poaceae)", "date": "2018", "keywords": "ammophila; arenaria; arundinacea; flora; link; subsp", "summary": "1 1 Melica ciliata L. . Scirpus holoschoenus L. .", "mime": "application/pdf"}, {"id": "abc-200", "words": "4866", "extension": ".pdf", "flesch": "69", "author": "Makbul, Serdar; T\u00c3\u00bcrkmen, Zafer; Co\u00c5\u0178kun\u00c3\u00a7elebi, Kamil; Beyazo\u00c4\u0178lu, Osman", "title": "Morfometric study on Scorzonera L. taxa (Asteraceae) from northeast Anatolia", "date": "2010", "keywords": "bayburt; cana; characters; cluster; makbul; otus; scorzonera; study; taxa", "summary": "S. cana is said to be close to S. laciniata ssp. laciniata (CHAMBERLAIN 1975), but our results from UPGMA do not support this view and show that S. cana is more closely related to S. armeniaca (Fig. 2).", "mime": "application/pdf"}, {"id": "abc-2000", "words": "6510", "extension": ".pdf", "flesch": "57", "author": "Butiuc-Keul, Anca; Craciunas, Cornelia; Goia, Irina; Farkas, Anca; Jarda, Liliana; Cristea, Victoria", "title": "Genetic structure of populations of several endangered and endemic Dianthus species revealed by microsatellite markers", "date": "2018", "keywords": "alleles; callizonus; dianthus; dianthus species; diversity; et al; plant; populations; romania; species", "summary": "The individuals belonging to D. henteri species showed the particular allele d and the allele v which was present in D. cal- lizonus as well. Allelic patterns across Dianthus species indi- cate that the mean number of different alleles was highest in D. glacialis ssp.", "mime": "application/pdf"}, {"id": "abc-2001", "words": "6673", "extension": ".pdf", "flesch": "73", "author": "Tavakkoli, Zahra; Assadi, Mostafa", "title": "A taxonomic revision of the genus Glaucium (Papaveraceae) in Iran", "date": "2019", "keywords": "glabrous; glaucium; hairs; iran; petals; sepals; siliquae; species; suppl; var; young", "summary": "Sepals 0.5\u20134 cm long; petals 1\u20134.5 cm long; fruiting pedi- cels exceeding the leaves subtending them ......................... .......................................................................G. grandiflorum Sepals and petals 1.5\u20133 cm long; fruiting pedicels shorter than the leaves subtending them ..............G. corniculatum 4. One of the diagnostic characteristics of G. corniculatum is fruiting pedicels that are shorter than their subtended leaves while a reported speci- men in Flora Iranica (Farahbakhsh 5956; deposited in IRAN herbarium) has fruiting pedicels longer than their subtended leaves as G. grandiflorum.", "mime": "application/pdf"}, {"id": "abc-2009", "words": "6624", "extension": ".pdf", "flesch": "58", "author": "Huseyinova, Rena; Yalcin, Erkan", "title": "Subalpine vegetation in Giresun Mountains (Turkey)", "date": "2018", "keywords": "alpine; festucetum; mountains; plant; qu\u00e9zel; slopes; soil; species; study; subalpine; turkey; vegetation", "summary": "1. Dendrogram of vegetation plots (50 plots and 160 species) of the Giresun Mountains. In the first studies, Turkish au- thors (D\u00fczenli 1988, K\u0131l\u0131n\u00e7 and Karakaya 1992, Vural 1996) recorded a number of vegetation plots from different alpine and subalpine communities.", "mime": "application/pdf"}, {"id": "abc-2022", "words": "7606", "extension": ".pdf", "flesch": "54", "author": "Notarte, Kin Israel; Yaguchi, Takashi; Suganuma, Keisuke; dela Cruz, Thomas Edison", "title": "Antibacterial, cytotoxic and trypanocidal activities of marine-derived fungi isolated from Philippine macroalgae and seagrasses", "date": "2018", "keywords": "aspergillus; bioactive; broth; culture; extracts; fumigatus; fungi; marine; mdf; ml\u20131; salt; tubingensis", "summary": "Key words: bioactivity, fungal natural products, marine fungi, Philippines Abbreviations: ASW \u2013 artificial seawater; DMSO \u2013 dimethyl sulfoxide; MDF \u2013 marine-derived fungi; MEA \u2013 malt extract agar; MEAS \u2013 malt extract agar with marine salt; MEB \u2013 malt extract broth; MEBS \u2013 malt extract broth with marine salt; PDB \u2013 potato dextrose broth; PDBS \u2013 potato dextrose broth with marine salt; ZOI \u2013 zone of inhi- bition * Corresponding authors, e-mails: kinotarte@gmail.com, tedelacruz@ust.edu.ph Introduction The ocean has vast biological resources, accounting for more than eighty percent of total world biodiversity, which makes it a reservoir for many kinds of organisms, including marine-derived fungi (Bugni and Ireland 2004). 77 (2), 2018 149 to their taxonomic and metabolic diversity, marine organ- isms including marine fungi are now considered ideal sourc- es of new secondary metabolites (Schulz et al. 2008).", "mime": "application/pdf"}, {"id": "abc-2029", "words": "9245", "extension": ".pdf", "flesch": "54", "author": "Stankovic, Jelena D.; Sabovljevic, Aneta D.; Sabovljevic, Marko S.", "title": "Bryophytes and heavy metals: a review", "date": "2018", "keywords": "bryophytes; cell; concentrations; effects; environment; et al; metals; moss; plants; pollution; species; uptake", "summary": "Although men have used heavy metals for thousands of years (J\u00e4rup 2003), reckless human behaviour, associated with urbaniza- tion and industrial development, drastically altered the pre- vious distribution and geochemical cycles of heavy metal (Singh et al. 2011). 77 (2), 109\u2013118, 2018 CODEN: ABCRA 25 DOI: 10.2478/botcro-2018-0014 ISSN 0365-0588 eISSN 1847-8476 Review Bryophytes and heavy metals: a review Jelena D. Stankovi\u0107, Aneta D. Sabovljevi\u0107, Marko S. Sabovljevi\u0107* Institute of Botany and Botanical Garden, Faculty of Biology, University of Belgrade, Takovska 43, 11000 Belgrade, Serbia Abstract \u2013 Bryophytes, a group of terrestrial plants widely used in biomonitoring, are reviewed for their relation to heavy metals.", "mime": "application/pdf"}, {"id": "abc-2040", "words": "7506", "extension": ".pdf", "flesch": "57", "author": "Jemelkov\u00e1, Michaela; Kitner, Miloslav; Kr\u00edstkov\u00e1, Eva; Dolezalov\u00e1, Ivana; Lebeda, Ales", "title": "Genetic variability and distance between Lactuca serriola L. populations from Sweden and Slovenia assessed by SSR and AFLP markers", "date": "2018", "keywords": "aflp; dole\u017ealov\u00e1; et al; lactuca; lactuca serriola; lebeda; lettuce; populations; samples; serriola; sweden", "summary": "Two primary morphological forms are recognized with- in L. serriola L. based on cauline leaf-shape variability; the pinnatifid-leaved form L. serriola L. f. serriola, and the un- lobed-leaved form L. serriola L. f. integrifolia (S.F. Gray) S.D. Prince et R. N. Carter. 1. Microsatellite (SSR) loci used to assess genetic variability in Lactuca sativa L. and L. serriola L.; NA \u2013 number of alleles; PIC \u2013 allelic polymorphic information content.", "mime": "application/pdf"}, {"id": "abc-2053", "words": "19000", "extension": ".pdf", "flesch": "47", "author": "Skvorc, Zeljko; Jasprica, Nenad; Alegro, Antun; Kovacic, Sanja; Franjic, Jozo; Krstonosic, Daniel; Vranesa, Ana; Carni, Andraz", "title": "Vegetation of Croatia: Phytosociological classification of the high-rank syntaxa", "date": "2017", "keywords": "acta; atlantic; belts; boreal; bot; br.-bl; calcareous; central; communities; conserv; croatia; et al; et tx; eunis; europe; european; forests; grasslands; habitats; herb; herb vegetation; horvat; horvati\u0107; low; mediterranean; montane; mucina; mucina et; nemoral; nom; nutrient; oak; oberd; passarge; prevla\u0161\u0107u; propos; regions; rivas; sandy; scrub; soils; southern; subalpine; syn; temperate; tlima; travnjaci; trinajsti\u0107; vegetacija; vegetation; visokih; western; zajednice; zeleni; zone; \u010darni; \u0161ikare; \u0161ume", "summary": "For example, forest vegetation was investigated and documented to a greater extent. The first reviews of forest vegetation appeared in the works of Hor- vat (1937, 1938), and since then many comprehensive re- views have been published (e.g. Rau\u0161 et al. 1992, Vukeli\u0107 et al. 2008, Vukeli\u0107 2012).", "mime": "application/pdf"}, {"id": "abc-2064", "words": "4163", "extension": ".pdf", "flesch": "51", "author": "Kumar, Puneet; Rana, Pawan Kumar; Singhal, Vijay Kumar; Singh, Harminder; Kholia, Bhupendra Singh", "title": "Chromosome count, meiotic abnormalities and pollen sterility in Lahaul Sweetvetch (Hedysarum astragaloides Benth. ex Baker, Fabaceae), an endemic and threatened species from India", "date": "2018", "keywords": "chromatin; chromosome; india; number; pmcs; pollen; species", "summary": "All these anomalies are highly pernicious to reproduc- tive success of such species. So it is suggested here that such species must be considered at priority during con- servation programmes of Himalayan plants.", "mime": "application/pdf"}, {"id": "abc-2116", "words": "11776", "extension": ".pdf", "flesch": "53", "author": "Kamberovic, Jasmina; Plenkovic-Moraj, Andelka; Kralj Borojevic, Koraljka; Gligora Udovic, Marija; Zutinic, Petar; Hafner, Dubravka; Cantonati, Marco", "title": "Algal assemblages in springs of different lithologies (ophiolites vs. limestone) of the Konjuh Mountain (Bosnia and Herzegovina)", "date": "2019", "keywords": "achnanthidium; assemblages; bertalot; bertalot et; bosnia; cantonati; cantonati et; diatom; et al; gomphonema; grunow; krammer; k\u00fctzing; lange; navicula; ophiolites; species; springs; substrata; taxa; values", "summary": "Due to the high heterogeneity of spring habitats, in order to preserve spring species diversity of Mt. Konjuh the conservation of springs as a group of habitats is required, and not only the protection of individual spring sites. Keywords: biodiversity, diatoms, cyanobacteria, springs, geological substratum, ecological preferences, trophic status * Corresponding author, e-mail: jasmina.kamberovic@untz.ba Introduction The importance of spring habitats as biodiversity hotspots and refugia for biodiversity conservation (Cantonati et al. 2012a, Taxb\u00f6ck et al. 2017) has been emphasized by the de- scription of a large number of rare and endangered algal spe- cies (Sabater and Roca 1990, 1992, Cantonati 1998, Werum 2001, Poul\u00ed\u010dkov\u00e1 et al. 2005, Nascimbene et al. 2011).", "mime": "application/pdf"}, {"id": "abc-2128", "words": "7011", "extension": ".pdf", "flesch": "56", "author": "Kisa, Dursun", "title": "Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum", "date": "2019", "keywords": "chelating; content; expression; gene; leaves; metal; p5cs1; pcs; plants; ppm; proline; stress; tomato", "summary": "Hossain, Z., Komatsu, S., 2012: Contribution of proteomic stud- ies towards understanding plant heavy metal stress response. 78 (1), 9\u201316, 2019 CODEN: ABCRA 25 DOI: 10.2478/botcro-2018-0023 ISSN 0365-0588 eISSN 1847-8476 Responses of phytochelatin and proline-related genes expression associated with heavy metal stress in Solanum lycopersicum Dursun K\u0131sa Bart\u0131n University, Faculty of Science, Department of Molecular Biology and Genetics, 74110, Bart\u0131n, Turkey Abstract \u2013 The expression of stress related-genes against adverse environmental conditions has essential importance for plants.", "mime": "application/pdf"}, {"id": "abc-2158", "words": "2305", "extension": ".pdf", "flesch": "62", "author": "Alegro, Antun; Segota, Vedran; Koletic, Nikola; Vukovic, Nina; Vilovic, Tihana; Rimac, Anja", "title": "Glaux maritima L. (Primulaceae), a new plant species in SE Europe", "date": "2019", "keywords": "flora; glaux; maritima; population; river; species", "summary": "This is the first record of G. maritima in SE Europe, and the third record in the Mediterranean, apart from in Spain and the Asian part of Turkey. In Europe, G. maritima is distributed on the Atlantic, Baltic and Arctic coasts, and very locally in the Western Mediterrane- an.", "mime": "application/pdf"}, {"id": "abc-2175", "words": "1112", "extension": ".pdf", "flesch": "52", "author": "Skvorc, Zeljko", "title": "Morfologija biljaka. Razvoj, grada i uloga biljnih tkiva, organa i organskih sustava by Toni Nikolic 2017", "date": "2017", "keywords": "morphology; organs; plant", "summary": "In the chapter Anatomy Basics, he presents plant tissues involved in the formation of plant organs. For that reason, there is a need for quality, comprehensive books that will give an overview of all as- pects of plant morphology.", "mime": "application/pdf"}, {"id": "abc-2180", "words": "2792", "extension": ".pdf", "flesch": "66", "author": "Riaz, Sana; Abid, Rubina; Ali, Syed Abid; Munir, Iqra; Qaiser, Muhammad", "title": "Morphology and seed protein profile for a new species of the genus Cleome L. (Cleomaceae) from Pakistan", "date": "2019", "keywords": "brachycarpa; cleome; fig; karachi; new; seeds; species; viscosa", "summary": "The observations were based on 5-10 specimens of C. brachycarpa, C. viscosa, and the new taxon. Cleome karachiensis S. Riaz, R. Abid and M. Qaiser: habit (A), flower (B), seed (C), type specimen (F); C. brachycarpa: seed (D), C. viscosa: seed (E). RIAZ S., ABID R., ALI S. A., MUNIR I., QAISER M. 104 ACTA BOT.", "mime": "application/pdf"}, {"id": "abc-2185", "words": "7658", "extension": ".pdf", "flesch": "55", "author": "Batalha, Marco Antonio; Custerevska, Renata; Matevski, Vlado", "title": "Climatic drivers of dry grassland phylogenetic diversity in the Republic of Macedonia", "date": "2019", "keywords": "bio; climate; community; diversity; et al; macedonia; mean; species; temperature", "summary": "Since our data was non-normally distributed, heteroscedastic, and with outliers, instead of applying ordinary least square regression, we applied robust regression (Huber and Ron- chetti 2009), with phylogenetic species richness as response variable, the six climatic variables as explanatory ones, and the bisquare algorithm as the weighting function. When regressing phylogenetic species richness against the climatic variables, we found positive relationships with isothermality and an- nual precipitation and negative relationships with mean tem- perature of the driest quarter and precipitation seasonality (Tab. 1).", "mime": "application/pdf"}, {"id": "abc-2186", "words": "1989", "extension": ".pdf", "flesch": "70", "author": "Maslo, Semir", "title": "Setaria adhaerens (Forssk.) Chiov. (Poaceae), a new alien species in the Croatian flora", "date": "2019", "keywords": "adhaerens; setaria; species; spikelets; verticillata", "summary": "Wang et al (2009) pointed out that diploid counts for S. verticillata are most likely misidentified S. adhaerens plants. Morrone, O., Aliscioni, S. S., Veldkamp, J. F., Pensiero, J. F., Zu- loaga, F. O., Kellogg, E. A., 2014: Revision of the Old World species of Setaria (Poaceae: Panicoideae: Paniceae).", "mime": "application/pdf"}, {"id": "abc-222", "words": "5422", "extension": ".pdf", "flesch": "60", "author": "Vafadar, Mahnaz; Attar, Farideh; Maroofi, Hosein", "title": "Trichome micromorphology in drupe of Amygdalus L. (Rosaceae) from Iran", "date": "2010", "keywords": "amygdalus; browicz; indumentum; iran; khatamsaz; lycioides; pericarp; species; trichomes; var", "summary": "Among those, three spe- cies including A. haussknechtii, A. elaeagnifolia and A. reticulata, are endemic species for the flora of Iran (BROWICZ 1969, KHATAMSAZ 1992). Pericarp indumentum heterogeneity is observed in the last closely related species of this subgroup including A. elaeagnifolia and A. reticulata.", "mime": "application/pdf"}, {"id": "abc-2232", "words": "807", "extension": ".pdf", "flesch": "56", "author": "Kovacic, Sanja", "title": "\u201cLost Worlds of Archaic Gardens\u201d \u2013 2018 Exhibition in Botanical Garden of the Faculty of Science, University of Zagreb", "date": "2018", "keywords": "garden; zagreb", "summary": "Exhibition logo \u201cFlora Palaeozoica\u201d by Dr Vanja Stamenkovi\u0107, Senior Garden Curator; B) Whisk fern (Psilotum nudum (L.) P. Beauv.) from Zagreb Botanical Garden collection (courtesy of the Botanical Garden of E\u00f6tv\u00f6s University, Budapest). Zagreb Botanical Garden holds several species of this ancient family; F) The maidenhair tree (Ginkgo biloba L.) is the single living descendant of the Ginkgoaceae family of gymnosperms, which appeared in the Mesozoic.", "mime": "application/pdf"}, {"id": "abc-2272", "words": "2820", "extension": ".pdf", "flesch": "57", "author": "Friscic, Maja", "title": "IN MEMORIAM Professor Kroata Hazler Pilepic (1968-2017)", "date": "2018", "keywords": "hazler; hazler pilepi\u0107; male\u0161; pilepi\u0107; plant; university; zagreb", "summary": "77 (1), 2018 S3 In memoriam Professor Kroata Hazler Pilepi\u0107 (1968\u20132017) Professor Kroata Hazler Pilepi\u0107, PhD, a Croatian scientist and full professor employed at the Faculty of Pharmacy and Bio- chemistry, University of Zagreb, died on September 1, 2017. Hazler Pilepi\u0107, K., Comps, B., \u0160ugar, I., \u0160oli\u0107, E., 1999: Genetic variability of the Croatian beechwoods.", "mime": "application/pdf"}, {"id": "abc-2282", "words": "6513", "extension": ".pdf", "flesch": "55", "author": "Djafri-Bouallag, Linda; Ourari, Malika; Sahnoune, Mohamed", "title": "A cytogenetic and pollen study of annual Medicago species from Soummam Valley (Northeastern of Algeria)", "date": "2019", "keywords": "chromosome; cytomixis; et al; laciniata; lesins; littoralis; medicago; pollen; polymorpha; species; truncatula; viability", "summary": "Souza, M. M., Pereira, T. N. S., 2011: Meiotic behavior in wild and domesticated species of Passiflora. Materials and methods Eight annual species, namely M. truncatula Gaertn., M. littoralis Rohde ex Lois., M. intertexta (L.) Miller, M. ciliaris (L.) Krocker, M. arabica (L.) Huds., M. polymorpha L., M. laciniata (L.) Miller and M. minima (L.) Bart. were sampled from wild populations of the Soummam Valley and neigh- borhoods (Northeastern Algeria).", "mime": "application/pdf"}, {"id": "abc-2289", "words": "4872", "extension": ".pdf", "flesch": "49", "author": "Kovalenko, Oleksii; Kalista, Mariia", "title": "Phytosociology and biodiversity patterns of annual wetland communities of Pyriatynskyi National Nature Park (Poltava Oblast, Ukraine)", "date": "2019", "keywords": "analysis; associations; communities; cyperetum; iso\u00ebto; juncetea; juncetum; nano; species; syntaxa; vegetation; wetland", "summary": "Results Annual wetland communities of Pyriatynskyi National Nature Park are presented by 1 order, 4 alliances and 7 as- sociations: The variability of moisture is very important factor for annual wetland communities.", "mime": "application/pdf"}, {"id": "abc-2317", "words": "8014", "extension": ".pdf", "flesch": "59", "author": "Tomaselli, Valeria; Terzi, Massimo", "title": "Rocky coastal vegetation of the class Crithmo-Staticetea in the south-east of Italy", "date": "2019", "keywords": "biondi; brullo; cluster; communities; crithmo; et al; fig; italy; limonietum; limonio; relev\u00e9s; species; staticetea; tab; vegetation", "summary": "Fanelli et al. 2004, Biondi et al. 2014). Many phyto- sociological surveys have been carried out along the Apulian coast, on both sandy and rocky shores (e.g., Cristofolini et al. 1967, Curti and Lorenzoni 1968, Corbetta 1970, Caniglia et al. 1984, G\u00e9hu et al. 1984, Corbetta et al. 1989, Bartolo et al. 1992, Brullo and De Marco 1989, Mariotti et al. 1992, Beccarisi et al. 2003, Biondi et al. 2006, Corbetta et al. 2006, Biondi and Casavecchia 2010, Tomaselli et al. 2011, Pirone 2014, Sciandrello and Tomaselli 2014).", "mime": "application/pdf"}, {"id": "abc-2327", "words": "6089", "extension": ".pdf", "flesch": "57", "author": "Memon, Abdul Razaque; Schwager, Christiane Katja; Niehaus, Karsten", "title": "Expression of small GTPases in the roots and nodules of Medicago truncatula cv. Jemalong", "date": "2019", "keywords": "et al; expression; gtp; infection; medicago; nodules; plant; proteins; rhizobium; roots; truncatula", "summary": "Keywords: gene expression, Medicago truncatula, root nodules, small GTP-binding proteins * Corresponding author, e-mail: armemon@usak.edu.tr, abdulrezzak.memon@gmail.com Introduction Intracellular membrane trafficking plays a major role in plant growth and development including root hair forma- tion, rhizobium infection process and nodule formation in legumes (Oldroyd and Downie 2008). The RT-qPCR experiments showed that indeed our previously identified transcript (homologues to A. thaliana Rop7 and A8IK57_MedtrRop 8) is predomi- nantly expressed in root nodules (Fig. 3c), indicating its role in nodule biogenesis.", "mime": "application/pdf"}, {"id": "abc-2337", "words": "3840", "extension": ".pdf", "flesch": "65", "author": "Pavia, Ivo; Rocha, Luis; Moutinho-Pereira, Jose; Lima-Brito, Jose; Correia, Carlos", "title": "Screening for drought resistance during germination of modern and old Iberian wheat cultivars", "date": "2019", "keywords": "cultivars; germination; mesti\u00e7o; water; wheat", "summary": "Germination parameters in wheat cultivars on drought stress. Singh, P., Ibrahim, H.M., Flury, M., Schillinger, W.F., Knappen- berger, T., 2013: Critical water potentials for germination of wheat cultivars in the dryland Northwest USA.", "mime": "application/pdf"}, {"id": "abc-235", "words": "2233", "extension": ".pdf", "flesch": "63", "author": "Ko\u00c5\u201aodziejek, Jeremi", "title": "Multilocus genomic associations among selected taxa of genus Potentilla (Rosaceae) in Poland using RAPD analysis", "date": "2010", "keywords": "achenes; intermedia; potentilla; subarenaria", "summary": "P. subarenaria is commonly interpreted as an apomictic species possibly of relatively recent hybrid origin from P. tabernaemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb. SEM analyses allowed distinguishing two morphological types of seed coats pattern: ruminate-reticulate sculpture due to well pre- served epidermal cells in P. subarenaria and tuberculate sculpture in P. intermedia.", "mime": "application/pdf"}, {"id": "abc-2394", "words": "4247", "extension": ".pdf", "flesch": "55", "author": "Persic, Martina; Veberic, Robert; Mikulic-Petkovsek, Maja", "title": "Phenolic profiles of quince (Cydonia oblonga Mill.) leaf extracts obtained by different extraction methods", "date": "2019", "keywords": "dec; decoction; extraction; extracts; leaves; material; phenolic; quince; water", "summary": "Most of the beneficial properties of quince leaf extracts may be assigned to their high content of phenolic compounds, particularly tannins. Phenolic profiles of quince leaf extracts differed among the extraction solvents and time of extraction.", "mime": "application/pdf"}, {"id": "abc-2427", "words": "3407", "extension": ".pdf", "flesch": "60", "author": "Gokturk, Ramazan Suleyman; Dusen, Olcay; Kaya, Ergun; Gurcan, Betul; Sarpkaya, Uygar", "title": "A new variety of Plocama calabrica (Rubiaceae) from Denizli (Turkey) confirmed by morphological and molecular ISSR markers", "date": "2019", "keywords": "alba; calabrica; calabrica var; issr; markers; plocama; plocama calabrica; turkey; var; variety", "summary": "It is closely related to P. calabrica var. While the normal color of P. calabrica var.", "mime": "application/pdf"}, {"id": "abc-2443", "words": "6912", "extension": ".pdf", "flesch": "55", "author": "Sajna, Nina; Sipek, Mirjana; Sustar-Vozlic, Jelka; Kaligaric, Mitja", "title": "Germination behavior of the extremely rare Hladnikia pastinacifolia Rchb. (Apiaceae) \u2013 a Pleistocene in situ survivor", "date": "2019", "keywords": "baskin; days; embryo; germination; hladnikia; pastinacifolia; seedlings; seeds; soil; species; umbel; \u0161ajna", "summary": "The temperature sequence of the colder period that H. pastinacifolia seeds received in nature was 20/15 \u00b0C (52 days), 10/5 \u00b0C (40 days), 5/0 \u00b0C (65 days), 10/0 \u00b0C (45 days), 15/5 \u00b0C (21 days). At the time of disper- sal, the embryo of H. pastinacifolia seeds measured about 0.4 mm and needed to reach the critical length for germination (Fig. 1).", "mime": "application/pdf"}, {"id": "abc-2454", "words": "7363", "extension": ".pdf", "flesch": "60", "author": "Cikili, Yakup; Kulac, Semsettin; Samet, Halil; Filiz, Ertugrul", "title": "Effects of exogenous nitric oxide on cadmium toxicity in black poplar (Populus nigra): physiological approaches", "date": "2019", "keywords": "bark; cadmium; et al; exposure; leaves; levels; nigra; plant; poplar; roots; snp; treatments", "summary": "In comparison with control, Cu concentrations in root were increased 100 and 500 \u00b5M Cd treatments while the incre- ments in leaf Cu concentration were found significantly with only 500 \u00b5M Cd treatments. Cd concentrations increased in leaves, bark, and roots at Cd treatments, whereas Cd + SNP applications had alleviative effects on Cd exposures, except for leaves.", "mime": "application/pdf"}, {"id": "abc-248", "words": "5303", "extension": ".pdf", "flesch": "57", "author": "Ko\u00c5\u201aodziejek, Jeremi; Cieslikowski, Tomasz; Sakowicz, Tomasz", "title": "Multilocus genomic associations among selected taxa of genus Potentilla (Rosaceae) in Poland using RAPD analysis", "date": "2010", "keywords": "collinae; p. argentea; p. collina; p. incana; p. subsect; p. tabernaemontani; p. thyrsiflora; potentilla; rapd; species; subsect", "summary": "(P. taber- naemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb.). (P. tabernaemontani Ascherson and P. incana P. Gaertner, B. Meyer et Scherb.) within P. subgen.", "mime": "application/pdf"}, {"id": "abc-2510", "words": "6053", "extension": ".pdf", "flesch": "63", "author": "Denisow, Bozena; Tymoszuk, Karolina; Dmitruk, Marta", "title": "Nectar and pollen production of Helianthus tuberosus L. \u2013 an exotic plant with invasiveness potential", "date": "2019", "keywords": "acta; denisow; disc; florets; insect; nectar; plant; pollen; production; rural; species; tuberosus", "summary": "We assume that the UHI environmen- tal conditions (higher temperature, lower humidity) impact- ed on plant species phenotypic traits and impaired the num- ber of developed disc florets and inflorescences. The variability in the nectar amount produced in flowers is quite common and has been report- ed among plant species, plant populations or even among individual flowers (Nicolson and Thornburg 2007, Denis- ow et al. 2014).", "mime": "application/pdf"}, {"id": "abc-2538", "words": "8363", "extension": ".pdf", "flesch": "55", "author": "Amrutha, Sivanantham; Muneera Parveen, Abdul Bari; Muthupandi, Muthusamy; Sivakumar, Veerasamy; Nautiyal, Raman; Ghosh Dasgupta, Modhumita", "title": "Variation in morpho-physiological, biochemical and molecular responses of two Eucalyptus species under short-term water stress", "date": "2019", "keywords": "condition; content; drought; ec226; et al; eucalyptus; globulus; leaf; parameters; plant; response; species; stress; temperature; tolerance; water; water stress", "summary": "Concurrently, reduction in plant growth (Chaves et al. 2003, Bedon et al. 2012), photosynthesis (Warren et al. 2007) and hormone production (Granda et al. 2011) have also been re- ported during water stress conditions. Hence, reduction in leaf area during water stress condition is a response in all eucalypt species as reported in E. globu- lus (Costa e Silva et al. 2004, Maseda and Fern\u00e1ndez 2016), E. camaldulensis (Lemcoff et al. 2002, Maseda and Fern\u00e1n- dez 2016) and E. microtheca (Susiluoto and Berninger 2007).", "mime": "application/pdf"}, {"id": "abc-2541", "words": "829", "extension": ".pdf", "flesch": "50", "author": "Ljubesic, Zrinka", "title": "The Beauty in Detail, Transformation and Structure \u2013 Adriatic Coccolithophores", "date": "2019", "keywords": "arts; university; zagreb", "summary": "This research study was a collaboration between Uppsala University, Uni- versity of Oslo, Faculty of Science (University of Zagreb) and the Rudjer Bo\u0161kovi\u0107 Institute. 78 (1), 2019 S1 Social news \u201cThe Beauty in Detail, Transformation and Structure \u2013 Adriatic Coccolithophores\u201d The exhibition \u201cThe Beauty in Detail, Transformation and Structure \u2013 Adriatic Coccolithophores\u201d, organized by the Academy of Fine Arts, University of Zagreb and the Cro- atian Botanical Society is a synergy between science and art that brings together scientists and artists, professors and stu- dents, modern technology and various artistic techniques.", "mime": "application/pdf"}, {"id": "abc-2545", "words": "1606", "extension": ".pdf", "flesch": "57", "author": "Jasprica, Nenad", "title": "Professor emeritus Ljudevit Ilijanic: an appreciation on the occasion of his ninetieth birthday", "date": "2019", "keywords": "croatian; ilijani\u0107; professor", "summary": "The purely scientific work of Professor Ljudevit Ilijani\u0107 has been oriented to the flora and vegetation of Croatia. A lists and analysis of the scientific papers authored by Professor Ljudevit Ilijani\u0107 have previously been published in the Acta Botanica Croatica (Markovi\u0107 1993, Regula and Regula 2000).", "mime": "application/pdf"}, {"id": "abc-2558", "words": "1056", "extension": ".pdf", "flesch": "57", "author": "Ljubesic, Zrinka", "title": "Celebrating 70th birtday of Professor emeritus Damir Vilicic", "date": "2019", "keywords": "adriatic; science; vilic\u030ci\u0107", "summary": "Professor Vilic\u030ci\u0107 has started his scientific career in the In- stitute of Oceanography and Fisheries in Dubrovnik in 1975 where he has achieved his position of senior scientist in 1991. Professor Vilic\u030ci\u0107 was principal investigator of projects of the Ministry of Science of the Republic of Croatia and was collaborator on international projects and research in the Adriatic Sea (RV Knorr, DOLCEVITA project).", "mime": "application/pdf"}, {"id": "abc-2564", "words": "5508", "extension": ".pdf", "flesch": "65", "author": "Brullo, Salvatore; Brullo, Cristian; Cambria, Salvatore; Giusso del Galdo, Gianpietro; Minissale, Pietro; Salmeri, Cristina; Beccarisi, Leonardo; Veronico, Giuseppe; Tomaselli, Valeria", "title": "Poa jubata (Poaceae), a rare Balkan species, first record for the Italian flora", "date": "2019", "keywords": "flora; glume; jubata; lemma; length; ovate; poa; poa jubata; species", "summary": "78 (2), 2019 153 As far as karyology is concerned, Poa jubata shows a dip- loid chromosome complement with 2n = 14, not common among Poa species, which are usually high and variably poly- ploid (Joshi et al. 2017). Habitat and ecology \u2013 In Apulia Poa jubata is very rare and occurs in temporary ponds, within cork oak woodlands on silty-sandy soils at an altitude of 50 m (Fig. 3).", "mime": "application/pdf"}, {"id": "abc-2594", "words": "10294", "extension": ".pdf", "flesch": "59", "author": "Sidhoum, Warda; Bahi, Kheira; Fortas, Zohra", "title": "The effect of salinity gradient and heavy metal pollution on arbuscular mycorrhizal fungal community structure in some Algerian wetlands", "date": "2020", "keywords": "amf; colonization; diversity; dse; et al; frequency; fungal; fungi; index; metal; mycorrhizal; number; plant; pollution; root; salinity; sites; soil; species; total; wetland", "summary": "In addition, nickel and zinc concentrations in DM and LT soils in the present study are homogeneous and vary only slightly. The results showed that 72.72% of plant species exhibit an association within arbuscular mycorrhizas (AM), and 36.36% a dual association between AM and dark septate endophytes (DSE).", "mime": "application/pdf"}, {"id": "abc-2612", "words": "3714", "extension": ".pdf", "flesch": "59", "author": "Tak, Aasawari A.; Kakde, Umesh B", "title": "Evaluation of trace elements and particulate matter deposition on plant foliage exposed to vehicular pollution", "date": "2019", "keywords": "accumulation; air; dust; ficus; kg\u20131; metals; plants; pollution", "summary": "Thousands of vehicles such as cars, bikes, trucks, and tractors continuously pass through this area, which is a source of high level of heavy metals pollution. Heavy metal pollution is a significant environmental issue as these metals are like- ly to have toxic effects with increased concentration or ac- cumulation in plants.", "mime": "application/pdf"}, {"id": "abc-2632", "words": "8214", "extension": ".pdf", "flesch": "60", "author": "Stesevic, Danijela; Kuzmic, Filip; Milanovic, Djordjije; Stanisic-Vujacic, Milica; Silc, Urban", "title": "Coastal sand dune vegetation of Velika pla\u00c5\u00bea (Montenegro)", "date": "2020", "keywords": "adriatic; beach; br.-bl; classification; coastal; communities; dunes; et al; habitat; montenegro; plant; pla\u017ea; relev\u00e9s; sand; species; stands; vegetation; velika; \u0161ilc", "summary": "We made a phytosociolog- ical study of sandy beach vegetation comprising both dunal and wetland areas to provide a comprehensive survey of sand dune vegetation and habitat typology of Velika pla\u017ea. The aim of our study was to make a comprehensive sur- vey of sand dune vegetation of the largest sand beach system in Eastern Adriatic with own field work and literature data, 44 ACTA BOT.", "mime": "application/pdf"}, {"id": "abc-2634", "words": "2130", "extension": ".pdf", "flesch": "61", "author": "\u0160koric, Dijana", "title": "In memoriam Ana Zlata \u0160tefanac (1935-2019)", "date": "2019", "keywords": "acta; botanica; croatica; mili\u010di\u0107; virus; \u0161tefanac", "summary": "Profes- sor A. Z. \u0160tefanac was not only an author published in but also served on the editorial board of Acta Botanica Croatica from 1982 until 2008. When Prof. Mili\u010di\u0107 started gather- ing a team of young collaborators for his pioneering work on plant viruses, she was the first to join in as early as in 1959.", "mime": "application/pdf"}, {"id": "abc-2651", "words": "9224", "extension": ".pdf", "flesch": "57", "author": "Di Pietro, Romeo; Di Marzio, Piera; Antonecchia, Gaby; Conte, Antonio Luca; Fortini, Paola", "title": "Preliminary characterization of the Quercus pubescens complex in southern Italy using molecular markers", "date": "2020", "keywords": "alleles; et al; heterozygosity; individuals; italy; loci; number; oak; oaks; populations; pubescens; quercus; species", "summary": "Acknowledgments The authors wish to acknowledge G. Vendramin for his critical discussion of the preliminary results of the paper and P. Medagli, G. Misano, G. Silletti, V. Viscosi, R.P. Wagensom- mer for their help in collecting oak populations. It is very probable that during the climatic oscillations that took place during the Quater- nary, environmental situations favorable to the development of mixed forests of Q. robur and Q. pubescens s.l. were cre- ated several times with consequent hybridization or intro- gression between these two species.", "mime": "application/pdf"}, {"id": "abc-2667", "words": "2053", "extension": ".pdf", "flesch": "66", "author": "Stesevic, Danijela; Andic, Branko; Stanisic-Vujacic, Milica", "title": "Physcomitrium eurystomum Sendtn., new moss species in the bryophyte flora of Montenegro", "date": "2020", "keywords": "eurystomum; list; montenegro; red", "summary": "A revised Red List of bryophytes in Britain. Ku\u010dera, J., V\u00e1\u0148a, J., 2003: Check- and Red List of bryophytes of the Czech Republic.", "mime": "application/pdf"}, {"id": "abc-2682", "words": "7135", "extension": ".pdf", "flesch": "55", "author": "Malenica, Nenad; Jagic, Mateja; Pavletic, Bruno; Bauer, Natasa; Voncina, Darko; Zdunic, Goran; Leljak Levanic, Dunja", "title": "Somatic embryogenesis as a tool for virus elimination in Croatian indigenous grapevine varieties", "date": "2020", "keywords": "cultivars; elimination; embryogenesis; embryos; et al; fig; gflv; grapevine; mali; plant; plavac; vinifera; virus; viruses; vitis", "summary": "For example, the productive life of vineyards infected by Grapevine fanleaf virus (GFLV) is 15\u201320 years shorter than would otherwise be expected (Andret-Link et al. 2004) and the grapes, must and wine have lower sug- ar concentration and increased overall acidity, causing eco- nomic losses of 80% (Andret-Link et al. 2004), or even 100% (Raski et al. 1983). RT-PCR analysis of Grapevine leafroll-associated viruses (GLRaV-1, GLRaV-2 and GLRaV-3), Arabis mosaic virus (ArMV), Grapevine fleck virus (GFkV) and Grapevine fanleaf virus (GFLV) in \u2018Babica\u2019 (E) and \u2018Plavac mali\u2019 (F).", "mime": "application/pdf"}, {"id": "abc-2685", "words": "7849", "extension": ".pdf", "flesch": "59", "author": "Senica, Mateja; Stampar, Franci; Erci\u00c5\u0178li, Sezai; Sladonja, Barbara; Poljuha, Danijela; Mikulic Petkovsek, Maja", "title": "The impact of drying on bioactive compounds of blue honeysuckle berries (Lonicera caerulea var. edulis Turcz. ex Herder)", "date": "2020", "keywords": "acid; berries; compounds; content; drying; et al; food; fruit; heating; honeysuckle; honeysuckle berries; temperature; time; \u00b0 c", "summary": "Half of one gram of dried berries from each drying treatment was ex- tracted with 5 ml of 2% meta-phosphoric acid. Our study showed that dried berries had the same losses at 40 \u00b0C as at 75 \u00b0C, which confirms that heat treatment in itself negatively affects the cyanidin content.", "mime": "application/pdf"}, {"id": "abc-2691", "words": "4626", "extension": ".pdf", "flesch": "60", "author": "Kaya, Ergun; Galatali, Selin; Souza, Fernanda Vidigal Duarte; Santos-Serejo, Janay Almeida", "title": "Influence of dehydration on cryopreservation of Musa spp. germplasm", "date": "2020", "keywords": "acuminata; content; cryopreservation; dehydration; germination; moisture; musa; seeds; spp", "summary": "This capability can be lost during seed germination. Vineesh, P.S., Skaria, R., Mukunthakumar, S., Padmesh, P., Decruse, S.W., 2015: Seed germination and cryostorage of Musa acumi- nata ssp.", "mime": "application/pdf"}, {"id": "abc-2697", "words": "6663", "extension": ".pdf", "flesch": "66", "author": "Karahan, Faruk", "title": "Morphology, anatomy, palynology and achene micromorphology of Bellis L. (Asteraceae) species from Turkey", "date": "2020", "keywords": "a.s.l; annua; b. annua; b. perennis; b. sylvestris; bellis; fig; hmku; morphology; pollen; species; turkey", "summary": "Materials and methods The materials of this study includes 22 specimens be- longing to 3 populations of B. annua, 102 specimens be- longing to 15 populations of B. perennis and 32 specimens belonging to 4 populations of B. sylvestris that were collected from 22 different localities in Turkey during their flowering and fruiting time, between 2014 and 2016 (Tab. 1). Roots of B. perennis and B. sylvestris are perennial while root of B. annua is annual.", "mime": "application/pdf"}, {"id": "abc-2698", "words": "6825", "extension": ".pdf", "flesch": "58", "author": "Romdhane, Leila; Dal Ferro, Nicola; Slama, Amor; Radhouane, Leila", "title": "Optimizing irrigation and determining the most sensitive development stage to drought in barley (Hordeum vulgare L.) in a semi-arid environment", "date": "2020", "keywords": "barley; days; deficit stress; heading; leaf; potential; soil; stage; stress; tillering; varieties; water; water deficit", "summary": "However, significant differ- ences in water deficit stages were observed between till- ering (37.0, on average) and both elongation and heading (17.2, on average). Under- standing the response of crop development stages to water deficit stress provides an opportunity for optimizing irrigation.", "mime": "application/pdf"}, {"id": "abc-2702", "words": "406", "extension": ".pdf", "flesch": "51", "author": "Jasprica, Nenad", "title": "The Sixth Croatian Botanical Symposium, held in Zagreb, Croatia (August 30\u2013September 1, 2019)", "date": "2019", "keywords": "croatian; zagreb", "summary": "Professor Nenad Jasprica Croatian Botanical Society, President Participants of the Sixth Croatian Botanical Symposium, Zagreb, Croatia (August 30\u2013September 1, 2019). Oral presentations by the Croatian Phycology Section were or- ganized within the 7th European Phycological Congress led by Professor Zrinka Ljube\u0161i\u0107 and the Croatian Botanical Society (Zagreb, August 25\u201330, 2019).", "mime": "application/pdf"}, {"id": "abc-2704", "words": "2707", "extension": ".pdf", "flesch": "77", "author": "Yetisen, Kadriye; Y\u00c4\u00b1ld\u00c4\u00b1r\u00c4\u00b1m, Hasan; Ozdemir, Canan", "title": "A comparative anatomical study of the genus Puschkinia Adams in Turkey", "date": "2020", "keywords": "bilgineri; peshmenii; puschkinia; scilloides; species", "summary": "Although the stem vascular bundles were arranged in two rows in P. peshmenii, they can observed in three rows in P. scilloides and P. bilgineri. In P. scilloides, 23\u201329 collateral vascular bundles with thick- walled cells were arranged in 3 rings, while in P. bilgineri there were 16\u201320 vascular bundles arranged in 3 rings, and in P. peshmenii, there were 14\u201317 vascular bundles arranged in two rings.", "mime": "application/pdf"}, {"id": "abc-2707", "words": "5932", "extension": ".pdf", "flesch": "63", "author": "Jaklic, Martina; Koren, Spela; Jogan, Nejc", "title": "Alien water lettuce (Pistia stratiotes L.) outcompeted native macrophytes and altered the ecological conditions of a Sava oxbow lake (SE Slovenia)", "date": "2020", "keywords": "biomass; colonized; lake; lettuce; macrophytes; oxbow; oxbow lake; section; species; stratiotes; water", "summary": "Water temperature was correlated significantly with number of water lettuce plants (rs = 0.583, P < 0.05), fresh (rs = 0.550, P < 0.05) and dry biomass (rs = 0.532, P < 0.05), while no correlation was found between ion concentrations and number of plants, fresh or dry biomass of water let- tuce (P > 0.05). In that period, colonized sections (~94% of the oxbow lake) were completely covered with water lettuce, and the only reservoirs of indige- nous macrophyte species were the non-colonized areas (6%).", "mime": "application/pdf"}, {"id": "abc-2713", "words": "792", "extension": ".pdf", "flesch": "48", "author": "Ljubesic, Zrinka", "title": "The Seventh European Phycological Congress held in Croatia in August 2019", "date": "2019", "keywords": "epc7; fig; zagreb", "summary": "An invited lecture on \u201cChange of climate and occurrence of extremes\u201c by Mirko Orli\u0107, member of Croatian Academy of Sciences and Arts and professor at the Faculty of Science, University of Zagreb, discussed topics associated with climate change and the more frequent occurrence of weather extremes. 2. EPC7 participants presented their research in 163 oral and 243 poster presentations.", "mime": "application/pdf"}, {"id": "abc-272", "words": "4606", "extension": ".pdf", "flesch": "51", "author": "Manilal, Aseer; Sujith, Sugathan; Sabarathnam, Balu; Kiran, George S.; Selvin, Joseph; Shakir, Chippu; Lipton, Aaron P.", "title": "Biological activity of red alga Laurencia brandenii", "date": "2011", "keywords": "acid; activity; brandenii; fraction; laurencia; marine", "summary": "To this day, information regarding biological activities of flora and fauna from the southwest coastline of India (Kollam coast) remains scanty. o ujak 2011 16:13:51 Color profile: Disabled Composite 150 lpi at 45 degrees ed for biological activities (data not shown).", "mime": "application/pdf"}, {"id": "abc-2721", "words": "7222", "extension": ".pdf", "flesch": "49", "author": "Ghosh Dasgupta, Modhumita; Parveen, Abdul Bari Muneera; Lakshmanan, Divya", "title": "Validation of variants using cost effective high-resolution melting (HRM) analysis predicted from target re-sequencing in Eucalyptus", "date": "2020", "keywords": "analysis; curve; dna; et al; eucalyptus; fig; genotyping; hrm; hybrids; melting; parents; resolution; sequence; sequencing; snp; t c; true&cauthor_uid=15338605", "summary": "The advantages of HRM analysis include reduced risk of cross contami- nation and decreased analytical time. To our knowledge, no reports on the use of HRM analysis for confirmation of vari- ants (SNPs/ InDels/ SSRs) are reported in forest tree species, including Eucalyptus.", "mime": "application/pdf"}, {"id": "abc-2738", "words": "7434", "extension": ".pdf", "flesch": "51", "author": "Cirak, Cuneyt; \u00c3\u2013zcan, Aysel; Yurteri, Emine; Kurt, Dursun; Seyis, Fatih", "title": "Chemical and morphological diversity among wild populations of Hypericum aviculariifolium Jaub. et Spach subsp. depilatum (Freyn et Bornm.) N. Robson var. depilatum", "date": "2020", "keywords": "aviculariifolium; depilatum; et al; hyperforin; hypericin; hypericum; leaf; perforatum; plant; populations; species", "summary": "heterogeneity of Hypericum plants from different origins is reported to influence the pharmacological activity of plant extracts significantly and to pose a great risk to the standard- ization of final Hypericum-derived products (Costa et al. 2016). Hypericum plants are categorized generally by three types of secretory structures namely, translucent glands, black or dark nodules and secretory canals (Kim\u00e1kov\u00e1 et al. 2018).", "mime": "application/pdf"}, {"id": "abc-2745", "words": "5725", "extension": ".pdf", "flesch": "58", "author": "Rabhi, Sadjia; Djebbar, R\u00e9da; Belkebir, Aicha", "title": "An ecophysiological study of some coastal dune species of Zemmouri El Bahri (Algeria)", "date": "2021", "keywords": "area; content; creticus; g\u20131; leaf; maritima; plant; species; water", "summary": "Melo J\u00fanior, J.C.F., Boeger, M.R.T., 2016: Leaf traits and plastic potential of plant species in a light-edaphic gradient from restinga in southern Brazil. Based on the high- est levels of total phenols, flavonoids and anthocyanins as well as high contents of photosynthetic pigments, M. tricus- pidata can be classified as \u201chomoiochlorophyllous\u201d plant.", "mime": "application/pdf"}, {"id": "abc-2755", "words": "1197", "extension": ".pdf", "flesch": "41", "author": "Choi, Jong-il; Park, Seo-jeong", "title": "De novo transcriptome analysis of high growth rate Pyropia yezoensis (Bangiales, Rhodophyta) mutant with high utilization of nitrogen", "date": "2020", "keywords": "line; mutant; pyropia; suppl; yezoensis", "summary": "Bases (total) Avg. length (bp) GC (%) Reads (no.) % of raw data GC (%) List of differentially expressed genes in Pyropia yezoensis mutant (Py2K) related to the Shikimate pathway.", "mime": "application/pdf"}, {"id": "abc-2761", "words": "3240", "extension": ".pdf", "flesch": "48", "author": "Zammit, Gabrielle; Schembri, Sarah; Fenech, Mark", "title": "Phototrophic biofilms and microbial mats from the marine littoral of the central Mediterranean", "date": "2021", "keywords": "biofilms; communities; fig; filaments; mats; microorganisms; rock", "summary": "80 (1), 112\u2013116, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2020-031 ISSN 0365-0588 eISSN 1847-8476 Short communication Phototrophic biofilms and microbial mats from the marine littoral of the central Mediterranean Gabrielle Zammit1,2*, Sarah Schembri1,2, Mark Fenech1,2 1 Laboratory of Applied Phycology, Centre for Molecular Medicine and Biobanking, University of Malta, Msida, Malta 2 Microbiology Lab, Department of Biology, Faculty of Science, University of Malta Abstract \u2013 Phototrophic biofilm and microbial mat communities grow along the rocky coastline of the Maltese is- lands. In submerged areas, such as undisturbed rock pools, these progressively formed green or brown compact biofilms, some of which thickened over the spring to form microbial mats via the production of more extensive EPS layers.", "mime": "application/pdf"}, {"id": "abc-2764", "words": "193", "extension": ".pdf", "flesch": "71", "author": "Kolda, Anamarija; Ljube\u0161i\u0107, Zrinka; Gavrilovi\u0107, Ana; Jug-Dujakovi\u0107, Jurica; Pikelj, Kristina; Kapetanovi\u0107, Damir", "title": "Metabarcoding Cyanobacteria in coastal waters and sediment in central and southern Adriatic Sea", "date": "2020", "keywords": "croat", "summary": "Leaf labels are automatically assigned by SILVA database (black letters), or NCBI GenBank database BLAST search hit results (blue letters). 1. Cladogram displaying grouping of 100 cyanobacterial ASVs, with addition of multi value bar chart of sample frequencies in different ASVs (CA \u2013 central Adriatic, SA \u2013 southern Adriatic, Aquaculture \u2013 site type under the influence of fish farms, Control \u2013 control site type; \u00e0 - sea water sample type, O \u2013 sediment sample type).", "mime": "application/pdf"}, {"id": "abc-2776", "words": "10378", "extension": ".pdf", "flesch": "58", "author": "Kunev, Georgi Iliev; Tzonev, Rossen; Tsiripidis, Ioannis; Pachedjieva, Kalina", "title": "Phytosociological study of submontane genistoid scrub communities from the Southeastern Balkans", "date": "2020", "keywords": "association; balkan; bulgaria; communities; distribution; et al; genista; genista lydia; genistetum; greece; group; kunev; lydia; lydia communities; mediterranean; plant; sofia; species; ssp; tzonev; vegetation", "summary": "1. Cluster dendrogram of Genista lydia communities. Physiognomy of Genista lydia communities: a \u2013 Diantho pinifolii-Genistetum lydiae, b \u2013 Romuleo graecae-Genistetum lydiae, c \u2013 Galio flavescentis-Genistetum lydiae, d \u2013 Genista lydia-Satureja pilosa community.", "mime": "application/pdf"}, {"id": "abc-2781", "words": "4445", "extension": ".pdf", "flesch": "64", "author": "G\u00fclery\u00fcz , G\u00fcrcan ; K\u0131rm\u0131z\u0131 , Serap; Arslan, H\u00fclya ; G\u00fclery\u00fcz, Elif", "title": "Breaking of dormancy in the narrow endemic Jasione supina Sieber subsp. supina (Campanulaceae) with small seeds that do not need light to germinate", "date": "2021", "keywords": "chilling; dark; germination; light; moist; seeds; species; supina", "summary": "Many researches have recently been focused on the effect of global climate change on alpine plant species as their phenology, seed germination, seedling establishment, and distribution areas are negatively affected (for details see Brice\u00f1o et al. 2015, Gim\u00e9nez-Benavides et al. 2018). Light requirement for seed germination especially small size seeds is an important parameter for evaluating the ger- mination properties of plants (Fenner and Thompson 2005).", "mime": "application/pdf"}, {"id": "abc-2789", "words": "7010", "extension": ".pdf", "flesch": "58", "author": "Hassan, Mahmoud Omar; Mohamed, Howida Yacoup; Aboellil, Ayman Hassan", "title": "Allelopathic potential of Ficus retusa L. leaf litter on understory vegetation in urban gardens", "date": "2021", "keywords": "compounds; cover; ficus; germination; growth; hassan; leaf; litter; plant; potential; retusa; soil; species; understory", "summary": "80 (2), 131\u2013139, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2021-013 ISSN 0365-0588 eISSN 1847-8476 Allelopathic potential of Ficus retusa L. leaf litter on understory vegetation in urban gardens Mahmoud Omar Hassan, Howida Yacoup Mohamed*, Ayman Hassan Aboellil Beni-Suef University, Faculty of Science, Department of Botany and Microbiology, 62511 Beni-Suef, Egypt Abstract \u2013 Pruning Ficus trees in urban green spaces may lead to the accumulation and spread of their leaf litter on the understory vegetation. This study was conducted to evaluate the allelopathic effect of Ficus retusa L. leaf litter on the understory species in urban gardens.", "mime": "application/pdf"}, {"id": "abc-279", "words": "3064", "extension": ".pdf", "flesch": "59", "author": "Oke, Samson Olajide; Eyitayo, Damilola Lanre; ", "title": "Growth and yield response of cowpea (Vigna unguiculata L. Walp.) to soils from different fallow physiognomies in the rainforest zone of Nigeria", "date": "2010", "keywords": "cowpea; fallow; growth; panicum; seedlings; soil; unguiculata; vigna", "summary": "Seedlings of cowpea were grown from seeds on soil samples collected from the four different fallow statuses (Panicum maximum-dominated fallow soil, Chromolaena odorata-dominated fallow soil, Tithonia spp.-dominated fallow soil and bush fallow soil that contains many herbaceous plant species) in plastic containers each having fifteen replicates. The results were used to deduce the best type of fallow soil for cowpea cultivation.", "mime": "application/pdf"}, {"id": "abc-2805", "words": "476", "extension": ".pdf", "flesch": "52", "author": "Jasprica, Nenad", "title": "Thirty-ninth EADSVE Meeting will be held in Dubrovnik, Croatia, in 2021", "date": "2020", "keywords": "dubrovnik; meeting", "summary": "The society organises meetings every second year. ex A. Bol\u00f2s et O. de Bol\u00f2s in A. Bol\u00f2s y Vayreda 1950.", "mime": "application/pdf"}, {"id": "abc-2806", "words": "6935", "extension": ".pdf", "flesch": "51", "author": "Sheikhzadeh, Parisa; Zare, Nasser; Mahmoudi, Fatemeh", "title": "The synergistic effects of hydro and hormone priming on seed germination, antioxidant activity and cadmium tolerance in borage", "date": "2021", "keywords": "borage; cadmium; cadmium stress; germination; hormone; hormone priming; hydro; l\u20131; priming; seed; seedling; stress", "summary": "On the oth- er hand, under both non-stress and cadmium stress condi- tions, the activity of catalase and peroxidase enzymes in seedlings obtained from primed seeds was significantly higher than that of seedlings from non-primed seeds (Fig. In borage, the proline con- tent of seedlings from primed seeds was significantly high- er than that of seedlings obtained from non-primed seeds, but the amount of increase in proline content varied from a 1.06 to a 1.45-fold change depending on cadmium stress level and seed priming treatments (Fig. 7).", "mime": "application/pdf"}, {"id": "abc-2807", "words": "296", "extension": ".pdf", "flesch": "61", "author": "Jasprica, Nenad", "title": "Preface from the New Editor-in-Chief", "date": "2020", "keywords": "acta", "summary": "In 2019, I accepted the role of editor-in-chief for Acta Botanica Croatica after my 10-year term within the Editorial Board as the subject editor in phycology and vegetation ecology. High quality standards and modern scientific content should be a permanent editorial goal in order for the success of Acta Botanica Croatica to be maintained.", "mime": "application/pdf"}, {"id": "abc-2810", "words": "3561", "extension": ".pdf", "flesch": "55", "author": "Figueiredo, Francisco Rom\u00e1rio Andrade; N\u00f3brega, Jackson Silva; F\u00e1tima, Reynaldo Teodoro de; Silva, Toshik Iarley da; Nascimento, Rodrigo Garcia da Silva; Lopes, Maria de F\u00e1tima de Queiroz; Dias, Thiago Jardelino; Bruno, Riselane de Lucena Alc\u00e2ntara", "title": "Plant development, gas exchanges and pigments of Mesosphaerum suaveolens submitted to osmoconditioning and saline stress", "date": "2021", "keywords": "chlorophyll; irrigation; plants; saline; salinity; stress; suaveolens; water", "summary": "Irrigation water of electrical conduc- tivity above 3.2 dS m\u20131 caused reductions in chlorophyll a, b and total contents in M. suaveolens plants. Irrigation water with elec- trical conductivity above 3.2 dS m\u20131 caused reductions in chlorophyll a, b and total contents in M. suaveolens plants.", "mime": "application/pdf"}, {"id": "abc-282", "words": "6028", "extension": ".pdf", "flesch": "69", "author": "Binzet, R\u00c4\u00b1za; Kandemir, Irfan; Orcan, Nermin", "title": "Palynological classification of Onosma L. (Boraginaceae) species from east Mediterranean region in Turkey", "date": "2010", "keywords": "c o; c t; min; o t", "summary": "For example O. stenoloba Hausskn.ex Riedl and O. mersinana Riedl, Binzet et Orcan are very close to each other and pollen shape can help to distinguish these two species. 2. \u2013 continued Species A P E plg plt clg clt ex i ect/end t O. riedliana M 16.32 12.72 2.79 3.59 12.61 3.26 0.41 0.65 0.66 7.75 SD 0.55 0.39 0.44 0.43 0.73 0.26 0.05 0.07 0.33 Min\u2013Max 15\u201317 12\u201313.5 2\u20133.5 2.5\u20134.5 11.5\u201313.5 2.5\u20133.5 0.3\u20130.5 0.5\u20130.8 7\u20138 O. roussaei M 14.84 10.5 2.79 2.82 10.71 2.45 1 0.51 2 5.96 SD 0.51 0.44 0.27 0.27 0.33 0.2 0.16 0.07 0.24 Min\u2013Max 13\u201316 9\u201311.5", "mime": "application/pdf"}, {"id": "abc-2829", "words": "6907", "extension": ".pdf", "flesch": "53", "author": "Mohamed, Zakaria; Ali, Fadel; Abdel-Lateef, Medahat; Hosny, Asmaa", "title": "Growth inhibition of the toxic cyanobacterium Cylindrospermopsis raciborskii by extremely low-frequency electromagnetic fields", "date": "2020", "keywords": "cell; control; cultures; electromagnetic; elf; et al; exposure; frequency; growth; incubation; raciborskii; water", "summary": "The results revealed that the highest growth inhibition of Cylindrospermopsis occurred upon exposure to 0.7 Hz QAMW for 30 min. ELF-EMF-exposed cultures exhibited a marked decrease in cell number, chlorophyll-a content and activity of antioxidant enzymes compared to control cultures, and this effect increased with the prolongation of exposure time. Subsamples of treat- ed and control cultures were collected after 4, 24 and 48 h for antioxidant enzyme activities and after 24 and 48 h for analysis of cell number and chlorophyll-a.", "mime": "application/pdf"}, {"id": "abc-2831", "words": "3888", "extension": ".pdf", "flesch": "50", "author": "Ebadi, Mostafa; Eftekharian, Rosa", "title": "Morphological and genetic diversity of Senecio vulgaris L. (Asteraceae) in Iran", "date": "2021", "keywords": "analysis; characters; diversity; length; plant; populations; senecio; vulgaris", "summary": "However, the ef- fects of some factors in plant population genetic diversity remain unclear and more investigations have to be done. Morphometric and ISSR based variabil- ity analysis to elucidate population genetic structure in Sene- cio glaucus L. (Asteraceae: Senecioneae).", "mime": "application/pdf"}, {"id": "abc-2835", "words": "4718", "extension": ".pdf", "flesch": "56", "author": "Zbilji\u0107, Milo\u0161; Laku\u0161i\u0107, Branislava; Mar\u010deti\u0107, Mirjana; Bogdanovi\u0107, Sandro; Laku\u0161i\u0107, Dmitar", "title": "Morphological and chemical evidence of Teucrium \u00d7 rohlenae K. Mal\u00fd (Lamiaceae), a new hybrid in Croatia", "date": "2021", "keywords": "analysis; croatia; hybrid; laku\u0161i\u0107; montanum; polium; species; t. polium; teucrium", "summary": "Given that T. reuticum is considered a heterotypic synonym of T. montanum (Eur+Med 2006), T. \u00d7 bogoutdinove can also be treated as a hybrid between T. montanum and T. polium. All analyses confirm the separation of two species, T. polium and T. montanum, and reveal the intermediate position of the putative hybrid.", "mime": "application/pdf"}, {"id": "abc-2836", "words": "3836", "extension": ".pdf", "flesch": "64", "author": "Kremer, Dario; Ko\u0161ir, Iztok Jo\u017ee; Poto\u010dnik, Tanja; Rogulj, Nikolina; Na\u010dinovic, Karla; Randi\u0107, Marko; Sre\u010dec, Sini\u0161a; Juri\u0161i\u0107 Grube\u0161i\u0107, Renata", "title": "Phenolic compounds in two subspecies of Drypis spinosa L. (Caryophyllaceae) in Croatia", "date": "2021", "keywords": "acid; compounds; content; d. spinosa; jacquiniana; phenolic; spinosa; spinosa subsp; subsp", "summary": "spinosa and D. spinosa subsp. The aim of this study is to gain an insight into the con- tent of phenolic compounds in D. spinosa subsp.", "mime": "application/pdf"}, {"id": "abc-2854", "words": "5927", "extension": ".pdf", "flesch": "54", "author": "Jovanovi\u0107, Slobodan; Gli\u0161i\u0107, Milan", "title": "An analysis of research into urban flora and vegetation in Southeast Europe", "date": "2021", "keywords": "articles; cities; et al; europe; flora; research; southeast; species; studies; urban; vegetation", "summary": "A search of these databases was conducted using the following keywords: urban flora, urban vegetation, urban plants, urban plant species, urban plant communities, urban forests, ruderal flora, ruderal vegetation, wall flora and wall vegetation, in combination with names of the coun- tries (Albania, Bosnia and Herzegovina, Bulgaria, Croatia, Greece, Montenegro, North Macedonia, Romania, Slovenia, Serbia and Kosovo) and cities (at least 15 cities with the larg- est population of each country) of Southeast Europe. 80 (1), 74\u201381, 2021 CODEN: ABCRA 25 DOI: 10.37427/botcro-2021-004 ISSN 0365-0588 eISSN 1847-8476 An analysis of research into urban flora and vegetation in Southeast Europe Slobodan Jovanovi\u01071*, Milan Gli\u0161i\u01071,2 1 University of Belgrade, Faculty of Biology, Institute of Botany and Botanical Garden, Belgrade 11000, Serbia 2 Academy of Applied Studies \u0160abac, \u0160abac 15000, Serbia Abstract \u2013 In the last two decades, the number of research articles focused on urban ecosystems in Europe has in- creased significantly.", "mime": "application/pdf"}, {"id": "abc-2864", "words": "4597", "extension": ".pdf", "flesch": "63", "author": "Rat, Milica; Bogdanovi\u0107, Sandro", "title": "Ornithogalum sibthorpii Greuter (Asparagaceae), a species overlooked in Croatia", "date": "2021", "keywords": "chromosome; croatia; distribution; fig; flora; herbarium; ornithogalum; rat; sibthorpii; smith; species", "summary": "Comparative morpho-anatomical and cytotaxonomical studies of Ornithogalum species that belong to the group of small plants (overall length up to 10 cm) with hypogeal scape, including O. sibthorpii, have been done to clearly de- scribe morphologically similar species in the area of Turkey and the Balkan Peninsula (Zahariadi 1962, 1965, 1977, Spe- ta 1990, 2000). The first report confirmed that O. sibthorpii is widespread along the eastern Adriatic coast, reaching the inland Dinaric region too.", "mime": "application/pdf"}, {"id": "abc-287", "words": "4049", "extension": ".pdf", "flesch": "66", "author": "Krivokapic, Sladjana; Stankovic, Zivko; Vuksanovic, Nenad", "title": "Seasonal variations of phytoplankton biomass and environmental conditions in the inner Boka Kotorska Bay (eastern Adriatic Sea)", "date": "2009", "keywords": "bay; chlorophyll; fig; mmol; phytoplankton", "summary": "4. Temporal (a) and spatial (b) distribution of mean oxygen concentration value in the inner part of Boka Kotorska Bay. travanj 2009 11:31:23 Color profile: Disabled Composite 150 lpi at 45 degrees spatial and temporal changes in physicochemical parameters and phytoplankton abun- dance and biomass (chlorophyll a concentrations) in the inner part of Boka Kotorska Bay.", "mime": "application/pdf"}, {"id": "abc-2879", "words": "5992", "extension": ".pdf", "flesch": "65", "author": "Tekin, Mehmet; Akdere, \u015eeyda", "title": "Anatomical investigations of the Turkish critically endangered species: Achillea sivasica \u00c7elik et Akpulat (Asteraceae)", "date": "2021", "keywords": "achillea; akcin; asteraceae; cells; endodermis; epidermis; gypsicola; leaf; sivasica; stem", "summary": "While most of the root volume in A. sivasica is filled by the cortex parenchyma, in A. phrygia and A. gypsicola it is filled by the secondary xylem (Akcin and Akcin 2010). In the stem anatomy of A. sivasica, the presence of unilay- ered epidermis with abundant non-glandular hairs and la- mellar collenchyma at the corners are features similar to those found in A. phrygia and A. gypsicola.", "mime": "application/pdf"}, {"id": "abc-288", "words": "6213", "extension": ".pdf", "flesch": "66", "author": "Pereira, Tamara; Coelho, Cileide M. M.; Bogo, Amauri; Guidolin, Altamir F.; Miquelluti, David J.", "title": "Diversity in common bean landraces from south Brazil", "date": "2009", "keywords": "bean; common; genotypes; landraces; phaseolin; protein; seed; type", "summary": "Results have been published for common bean seed development with evidence that phytate synthesis has regulation points with MIPS (myo-inositol-3-phosphate synthase) enzyme. We thank Dr Heloisa Torres da Silva (EMBRAPA-CNPAF, Brazil) that provided bean seed samples used as con- trols of phaseolin type.", "mime": "application/pdf"}, {"id": "abc-2880", "words": "4016", "extension": ".pdf", "flesch": "69", "author": "Terlevi\u0107, Ana; Koopman, Jacob; Wi\u0119c\u0142aw , Helena; Re\u0161etnik, Ivana; Bogdanovi\u0107, Sandro", "title": "Carex phyllostachys (Cyperaceae), a new species in Croatia", "date": "2021", "keywords": "carex; croatia; flora; koopman; mosor; phyllostachys; s.n; species", "summary": "The habitat and ecology of C. phyllostachys in the Croatian flora is presented, and morphological similarities with allied species (C. distachya and C. illegitima) are discussed. The Global Carex Group (2016) shows that C. phyllostachys is closely related to C. il- *", "mime": "application/pdf"}, {"id": "abc-2883", "words": "9474", "extension": ".pdf", "flesch": "54", "author": "Biba, Renata; Tkalec, Mirta; Cvjetko, Petra; Peharec \u0160tefani\u0107, Petra; \u0160iki\u0107, Sandra; Pavokovi\u0107, Dubravko; Balen, Biljana", "title": "Silver nanoparticles affect germination and photosynthesis in tobacco seedlings", "date": "2021", "keywords": "agno3; agnps; concentrations; control; effects; et al; exposure; germination; growth; medium; nanoparticles; plant; seedlings; silver; tobacco; treatments", "summary": "Results AgNPs stability in culture media The results of the stability analyses obtained by spectro- photometric absorbance measurements of 150 \u00b5M AgNPs in solid and liquid half strength MS media are presented in Fig. V ZA - vi ol ax an th in , z ea xa nt hi n an d an th er ax an tin (x an th op hy ll cy cl e po ol ), ch l a /b - ch lo ro ph yl l a /b , c ar /c hl - ca ro te no id s/ ch lo ro ph yl l, V ZA /c hl - V ZA / c hl or op hy ll. V al ue s a re th e m ea ns \u00b1 st an da rd er ro r o f t hr ee d iff er en t e xp er im en ts , e ac h w ith th re e r ep lic as .", "mime": "application/pdf"}, {"id": "abc-289", "words": "2377", "extension": ".pdf", "flesch": "60", "author": "Devide, Zvonimir", "title": "James G. Ogg, Gabi Ogg, Felix M. Gradstein \"The Concise Geologic Time Scale\"", "date": "2009", "keywords": "book; earth; fig; period; scale; time", "summary": "travanj 2009 13:12:17 Color profile: Disabled Composite 150 lpi at 45 degrees The text of the book is perfect in any regard, being accompanied by many illustrations of the highest quality: drawings, photographs, in the chapters 4 to 15 predominantly photo- graphs and profiles of GSSP-localities as well as time scales containing also regional sub- divisions, and in the last columns, details about Biostratigraphy, Magnetic stratigraphy, Cycle- and Stable- isotope stratigraphy, Eustatic stratigraphy (Sea level changes) etc. (see Fig. 4). Each of the chapters 4 to 15 treats one Period of the Phanerozoic Eon (see Contents) and contains, according to the schedule mentioned in the Introduction, the following sections: History and base of the treated Period; International subdivisions of the Period; Selected aspects of the Period\u2019s stratigraphy; Numerical time scale (current status / GTS 04, correc- tions \u2013or:/current status and future developments; Acknowledgments \u2013 Further reading -Selected on-line references.", "mime": "application/pdf"}, {"id": "abc-2895", "words": "5599", "extension": ".pdf", "flesch": "63", "author": "Raycheva, Tsvetanka ; Stoyanov, Kiril ; Naimov, Samir; Apostolova-Kuzova, Elena", "title": "Crocus adamioides (Iridaceae) in the Bulgarian flora", "date": "2021", "keywords": "adamioides; bulgaria; crocus; et al; fig; harpke; randjeloviciorum; species; width", "summary": "The values were processed using basic statistical analysis \u2013 mean, standard deviation, maximum and minimum, and compared with the data for C. randjeloviciorum (Harpke et al. 2017). The measured anatomical characters are listed in Tab. 2 and compared with those of C. randjeloviciorum (Harpke et al. 2017).", "mime": "application/pdf"}, {"id": "abc-290", "words": "1485", "extension": ".pdf", "flesch": "48", "author": "Jasprica, Nenad", "title": "Preface", "date": "2009", "keywords": "acta; diatoms; dubrovnik; marine; symposium; university", "summary": "The 20th International Diatom Symposium thus would be convened in Dubrovnik in September 2008. listopad 2009 11:34:49 Color profile: Disabled Composite 150 lpi at 45 degrees I express my sincere thanks to all our sponsors: the Croatian Ministry of Science, Edu- cation, and Sports; the City of Dubrovnik; the Croatian Environmental Protection and En- ergy Efficiency Fund; Dubrovnik Airport Ltd.; Koeltz Scientific Books, Koenigstein, Ger- many; and Fluid Imaging Technologies, Yarmouth, Maine (USA); and, of course, the Institute for Marine and Coastal Research of the University of Dubrovnik.", "mime": "application/pdf"}, {"id": "abc-2902", "words": "6522", "extension": ".pdf", "flesch": "57", "author": "Barana\u0161i\u0107, Jurica; Mihalak, Anita; Grui\u0107-Sovulj, Ita; Bauer, Nata\u0161a; Rokov-Plavec, Jasmina", "title": "Expression of genes for selected plant aminoacyl-tRNA synthetases in the abiotic stress", "date": "2021", "keywords": "asprs; cysrs; et al; expression; gene; levels; plant; protein; serrs; stress; synthetase; transcription; trna", "summary": "Furthermore, plant aaRSs may participate directly in plant stress responses through their noncanonical activities. Participation of aaRSs in plant stress responses is poorly characterized.", "mime": "application/pdf"}, {"id": "abc-2913", "words": "10040", "extension": ".pdf", "flesch": "77", "author": "Ero\u011flu , H\u00fcseyin ; Cengiz Karaismailo\u011flu, Mehmet; Pinar , S\u00fcleyman Mesut; Fidan , Mehmet", "title": "Seed micromorphology and anatomy of 36 Muscari (Asparagaceae) taxa from Turkey with notes on their systematic importance", "date": "2021", "keywords": "lls; muscari; seed; taxa", "summary": "While M. atillae, M. latifolium, M. microstomum and M. armeniacum taxa are among the taxa belonging to Botryanthus subgenus, M. mirum and M. caucasicum taxa are located between Leopoldia taxa. While M. erdalii and M. racemosum have the largest seeds, M. macbeathianum has the smallest seeds (Tab. 2, On-line Suppl.", "mime": "application/pdf"}, {"id": "abc-2929", "words": "1767", "extension": ".pdf", "flesch": "55", "author": "Salopek Sondi, Branka", "title": "The Spiridion Brusina Medal for 2019 has been awarded to German plant biologist Professor Jutta Ludwig-M\u00c3\u00bcller", "date": "2020", "keywords": "auxin; croatian; ludwig; m\u00fcller; plant; professor", "summary": "Campanella, J. J., Olajide, A. F., Magnus, V., Ludwig-M\u00fcller, J., 2004: A novel auxin conjugate hy- drolase from wheat with substrate specificity for longer side-chain auxin amide conjugates. B Joint scientific publications by Professor Jutte Ludwig- M\u00fcller and Croatian scientists: 1.", "mime": "application/pdf"}, {"id": "abc-293", "words": "4352", "extension": ".pdf", "flesch": "61", "author": "Oziegbe, Matthew; Faluyi, Julius Olaoye; Oluwaranti, Abimbola", "title": "Effect of seed age and soil texture on germination of some Ludwigia species (Onagraceae) in Nigeria.", "date": "2010", "keywords": "germination; ludwigia; media; month; percentage; seeds; soil; species; var", "summary": "Seed germination in Ludwigia was greatly influenced by seed age and soil type. It has been reported that the capacity of seed germination in Ludwigia species is not known (RUAUX et al. 2009).", "mime": "application/pdf"}, {"id": "abc-2941", "words": "4054", "extension": ".pdf", "flesch": "62", "author": "S\u00fcveges , Krist\u00f3f ; Moln\u00e1r V, Attila; Mesterh\u00e1zy , Attila; T\u00fcd\u0151sn\u00e9 Budai , J\u00falia ; Fekete, R\u00e9ka ", "title": "Emergence of a new salt-tolerant alien grass along roadsides? Occurrence of Diplachne fusca subsp. fascicularis (Poaceae) in Hungary", "date": "2021", "keywords": "diplachne; fascicularis; fusca; germination; hungary; plant; road; salt; species; subsp", "summary": "These factors act in synergy, favour- ing the spread of alien plant species, since native species are usually less able to adapt to the altered, anthropogenic con- ditions at roadsides (Greenberg et al. 1997). In the case of plant species producing lightweight seeds, dispersal may be facilitated by the air turbulence caused by cars (von der Lippe et al. 2013), but seeds may also travel long distances in mud attached to cars (Clifford 1959, Ross 1986, Schmidt 1989, Zwaenepoel et al. 2006, Ansong and Pickering 2013).", "mime": "application/pdf"}, {"id": "abc-2956", "words": "8275", "extension": ".pdf", "flesch": "56", "author": "Dedi\u0107, Anita ; Hafner , Dubravka; Antunovi\u0107 , Ana; Kamberovi\u0107 , Jasmina ; Stani\u0107-Ko\u0161troman, Svjetlana ; Kelly, Martyn G.", "title": "Biodiversity and seasonal distribution of benthic diatom assemblages as an indicator of water quality of small karstic river in Bosnia and Herzegovina", "date": "2021", "keywords": "bertalot; bunica; diatom; ehrenberg; gomphonema; grunow; index; indices; k\u00fctzing; lange; river; samples; spring; status; taxa; values; water", "summary": "The concentrations of physical and chemical parameters should mean that the Bunica River can support high ecological status (Tab. 5), so the reason for this mismatch needs to be explored. Physical and chemical analyses showed low concentrations of nutrients, good oxygenation, typical pH for carbonate bed/origin and generally oligotrophic conditions and high ecological status.", "mime": "application/pdf"}, {"id": "abc-298", "words": "3367", "extension": ".pdf", "flesch": "69", "author": "Partl, Anamarija", "title": "Lichen flora of Zumberak-Samoborsko gorje Nature Park, NW Croatia", "date": "2011", "keywords": "ach; acta; area; croatia; hoffm; lichens; nyl; species", "summary": "Gray D Platismatia glauca (L.) W. L. Culb. 2, 6, 7, 8 Anaptychia ciliaris (L.) K\u00f6rb.", "mime": "application/pdf"}, {"id": "abc-300", "words": "3614", "extension": ".pdf", "flesch": "67", "author": "Lukavsky, Jaromir; Cep\u00c3\u00a1k, Vladislav", "title": "Cryoseston in Stara Planina (Balkan) Mountains, Bulgaria", "date": "2010", "keywords": "chloromonas; cryoseston; lukavsk\u00fd; mts; nivalis; planina; snow; stara", "summary": "\u00d8EZANKA, T., NEDBALOV\u00c1, L., SIGLER, K., CEP\u00c1K, V., 2007: Identification of astaxanthin diglucoside diesters from snow alga Chlamydomonas nivalis by liquid chromatografy \u2013 atmospheric pressure chemical ionization mass spectrometry. Cryoseston of snow fields in the Stara Planina Mountains, collected in May 2009.", "mime": "application/pdf"}, {"id": "abc-3008", "words": "1873", "extension": ".pdf", "flesch": "70", "author": "Stesevic, Danijela; Milanovi\u0107 , \u0110or\u0111ije ; Stani\u0161i\u0107-Vuja\u010di\u0107, Milica ; \u0160ilc, Urban ", "title": "Aristida oligantha \u2013 a new alien species on the eastern Adriatic coast", "date": "2021", "keywords": "2019/10/06; aristida; montenegro; oligantha; rel; species; vegetation", "summary": "Keywords: Aristida oligantha community, invasive species, northeastern Mediterranean, sandy beach, south Montenegro Introduction Genus Aristida L. is one of the exotic grasses in the European flora. Within its native area of distribution, which includes North America, Aristida oligantha grows on waste or bare ground, old fields and dry hills (Allred 1986).", "mime": "application/pdf"}, {"id": "abc-301", "words": "6766", "extension": ".pdf", "flesch": "67", "author": "Rizzi Longo, Loredana; Pizzulin Sauli, Marialuisa", "title": "Flowering phenology and airborne pollen occurrence of Corylus and Castanea in Trieste (Italy), 1991-2004", "date": "2010", "keywords": "castanea; corylus; flowering; longo; mean; pollen; rizzi; season; trieste", "summary": "2. Flowering and pollen seasons of Corylus in Trieste at station TS1 (1991\u20132004). EMBERLIN, J., DETANDT, M., GEHRIG, R., J\u00c4GER, S., NOLARD, N., RANTIO-LEHTIM\u00c4KI, A., 2002: Responses in the start of Betula (birch) pollen seasons to recent changes in spring temperatures across Europe.", "mime": "application/pdf"}, {"id": "abc-3013", "words": "1418", "extension": ".pdf", "flesch": "65", "author": "Alegro, Antun", "title": "Zlatko Pavleti\u0107 (1920-1981) - on the 100th anniversary of his birthday", "date": "2020", "keywords": "pavleti\u0107; professor; research; sabovljevi\u0107; science; zagreb", "summary": "79 (2), 2020 S Social news Zlatko Pavleti\u0107 (1920-1981) \u2013 on the 100th anniversary of his birthday Professor Zlatko Pavleti\u0107 (April 4, 1920 \u2013 March 19, 1981) was a milestone person for biology in Croatia in the second half of 20th century. Professor Zlatko Pavleti\u0107 with his colleagues and associates before the fieldtrip (second half of 1970-ies).", "mime": "application/pdf"}, {"id": "abc-304", "words": "4172", "extension": ".pdf", "flesch": "57", "author": "Kri\u00c5\u00benik, Bojana; Pavokovi\u00c4\u2021, Dubravko", "title": "Enhancement of betanin yield in transformed cells of sugar beet (Beta vulgaris L.)", "date": "2010", "keywords": "beet; betanin; cell; et al; medium; production; suc; yield", "summary": "Sugar beet cells, transformed by a wild strain B6S3 of Agrobacterium tume- faciens, strongly produce betanin and could be a stable production source. We transformed sugar beet cells by infecting leaf fragments with wild strain B6S3 of Agrobacterium tumefaciens.", "mime": "application/pdf"}, {"id": "abc-310", "words": "5367", "extension": ".pdf", "flesch": "57", "author": "Uzarevic, Zvonimir; Stolfa, Ivna; Paradikovic, Nada; Cesar, Vera; Lepedus, Hrvoje", "title": "Physiology and biochemistry of leaf bleaching in prematurely aging maple (Acer saccharinum L.) trees: I. Hydrogen peroxide level, antioxidative responses and photosynthetic pigments", "date": "2011", "keywords": "bleached; chlorophyll; green; h2o2; hydrogen; leaves; level; peroxide; plant", "summary": "The specific activities of APX were 1.82 \u00b1 0.45 DA min\u20131 mg\u20131 proteins in green leaves and 0.78 \u00b1 0.21 DA min\u20131 mg\u20131 proteins in bleached leaves. The enzyme specific activities of APX, GPOD, CAT and SOD in green leaves were almost twice those in bleached leaves.", "mime": "application/pdf"}, {"id": "abc-311", "words": "6265", "extension": ".pdf", "flesch": "59", "author": "Lepedus, Hrvoje; Begovic, Lidija; Mlinaric, Selma; Simic, Domagoj; Uzarevic, Zvonimir; Stolfa, Ivna; Paradikovic, Nada; Jurkovic, Vlatka; Cesar, Vera", "title": "Physiology and biochemistry of leaf bleaching in prematurely aging maple (Acer saccharinum L.) trees. II. Functional and molecular adjustment of PSII.", "date": "2011", "keywords": "bleached; chlorophyll; et al; fluorescence; green; leaves; maple; psii; reaction; tab", "summary": "Also, bleached leaves had lower levels of chlorophyll a, chlorophyll b, total carotenoids and Fv/Fm value (maximum quantum yield of photosystem II) than green leaves. Results Total chlorophyll (Chl a+b) concentration, protochlorophyllide (PChl) concentration and total chlorophyll to protochlorophyllide ratio in green leaves were significantly higher (72 %) than in bleached leaves (Tab. 2).", "mime": "application/pdf"}, {"id": "abc-3129", "words": "6119", "extension": ".pdf", "flesch": "58", "author": "Bartolo, Angela G.; Zammit, Gabrielle; Russell, Hannah; Peters, Akira F.; K\u00fcpper , Frithjof C.", "title": "DNA barcoding of marine algae from Malta: new records from the central Mediterranean", "date": "2021", "keywords": "algae; coi; dna; et al; identity; malta; marine; peters; phaeophyceae; rbcl; sequences; sinuosa; spacer; species; tab", "summary": "The rbcL (Tab. 5: 194 bp) and RuBisCO spacer (Tab. 5: 189 bp) provided 100% and 97.4% identity, respectively, to the published C. sinuosa sequence with Gen- Bank accession number AF385839 (Cho et al. 2001), and the species identification was determined with a high level of confidence. Species name Strain Marker Length (bp) % Identity % Cover Accession Species name and locality Colpomenia sinuosa MT17-059 rbcL 194 100 100 AF385839 Colpomenia sinuosa, Korea, Cho et al. 2001 Colpomenia sinuosa MT17- 059 spacer 189 97.4 100 AF385839 Colpomenia sinuosa, Korea, Cho et al. 2001 Colpomenia sp. MT17- 059 COI 538 97.3 95 KF281125 C. sinuosa, Australia, McDevit & Saunders, 2017 Sphacelaria sp. MT17- 026 COI 608 99.3 99 LM994971 Sphacelaria sp., Greece, Peters et al. 2015 Hecatonema terminale MT17- 068 COI 633 100 98 LM995391 H. maculans, Greece, Peters et al. 2015 Hecatonema terminale MT17- 068 rbcL 1403 99.9 100 AF207802 Hecatonema sp., unpublished Hecatonema terminale MT17- 068 spacer 207 99.5 99 AF207802 Hecatonema sp., unpublished Schizocladia ischiensis MT17- 100 rbcL 1006 99.8 100 MN996275 Schizocladia ischiensis, Italy, Rizouli et al. 2020 Schizocladia ischiensis MT17- 100 spacer 82 100 100 MN996275 Schizocladia ischiensis, Italy, Rizouli et al. 2020", "mime": "application/pdf"}, {"id": "abc-313", "words": "6424", "extension": ".pdf", "flesch": "60", "author": "Turkis, Sevda; \u00c3\u2013zbucak, Tugba Bayrak", "title": "Foliar resorption and chlorophyll content in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient in Turkey", "date": "2010", "keywords": "chl; chlorophyll; concentrations; content; creticus; gradient; leaf; nutrient; resorption; species", "summary": "However, P resorption efficiency was higher at 670 m. C. creticus in- dividuals effectively used nitrogen at low elevations, whilst phosphorus was effectively used at high elevations. 69 (2), 275\u2013290, 2010 CODEN: ABCRA25 ISSN 0365\u20130588 Foliar resorption and chlorophyll content in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient in Turkey SEVDA TURKIS, TUGBA OZBUCAK* Department of Biology, Faculty of Arts and Sciences, Ordu University, 52750 Ordu, Turkey Foliar nitrogen and phosphorus dynamics, leaf resorption efficiency, proficiency, chang- ing of chlorophyll a/b proportions in leaves of Cistus creticus L. (Cistaceae) along an elevational gradient (sea level-30 m, middle-670 m, high-880 m) were investigated.", "mime": "application/pdf"}, {"id": "abc-3137", "words": "8136", "extension": ".pdf", "flesch": "60", "author": "Kaya, Ergun; Balci, Mehmet Ali ; Akguller , Omer; Galatali , Selin ; Yeniocak , Sevil ; Mercan , Taner; Guldag , Sevinc; Ozkaya , Damla Ekin; Ozturk , Bilge ; Celik, Onur; Aktay, Irem", "title": "Development of an optimum proliferation medium via the graph kernel statistical analysis method for genetically stable in vitro propagation of endemic Thymus cilicicus (Turkey)", "date": "2021", "keywords": "charcoal; cilicicus; culture; g l\u20131; graph; kernel; l\u20131; m g; medium; plant; propagation", "summary": "A survey on graph kernels. A \u2013 Meristem regeneration of Thymus cilicicus, B \u2013 shoot forming and rooting on optimum medium composition deter- mined via graph kernel multiple propagation index, C \u2013 acclimatized T. cilicicus seedlings to greenhouse conditions.", "mime": "application/pdf"}, {"id": "abc-3139", "words": "6596", "extension": ".pdf", "flesch": "60", "author": "Shahzad, Asim; Qin, Mingzhou; Nazir, Mudassar; Shakoor, Abdul; Billah, Mohtism; Zaib, Gul", "title": "Response of Bacillus cereus on Zea mays under different doses of zinc sulphate", "date": "2021", "keywords": "cereus; control; kg\u20131; maize; plant; seeds; soil; treatments; zinc; znso4", "summary": "Preparation of heavy metal solution Three different concentrations of Zn solution (20, 40 and 60 mg kg\u20131) for maize plant treatments were prepared in pure distilled water by dissolving zinc sulfate (ZnSO4). Zinc (Zn) is an essential micronu- trient and it promotes plant growth and development but a higher concentration of the metal causes reduction in plant growth.", "mime": "application/pdf"}, {"id": "abc-315", "words": "5382", "extension": ".pdf", "flesch": "67", "author": "Vukovic, Nina; Brana, Slavko; Mitic, Bozena", "title": "Orchid diversity of the cape of Kamenjak (Istria, Croatia)", "date": "2011", "keywords": "croatia; fig; kamenjak; ophrys; orchis; perko; serapias; species; ssp; taxa; taxon", "summary": "Relative frequency of orchid species and subspecies on Rt Kamenjak is shown on figure 21, and also in table 2, which shows that they can be grouped, almost equally, into two groups based on their abundance (1) abundant/frequent and (2) rare/extremely rare species. Chorological spectrum of orchid species and subspecies recorded on \u00bbRt Kamenjak\u00ab. Fig.", "mime": "application/pdf"}, {"id": "abc-3154", "words": "4693", "extension": ".pdf", "flesch": "64", "author": "Iamonico, Duilio", "title": "First record of a naturalized population of the tropical Colocasia esculenta (Araceae) in Italy, and clarifications about its occurrence in southeastern Europe", "date": "2021", "keywords": "alien; colocasia; esculenta; europe; flora; iamonico; italy; population; schott; species; university", "summary": "Acknowledgements Thanks are due to G. Bacchetta and L. Podda (Univer- sity of Cagliari, Sardinia region, Italy), L. Bernardo (Uni- versity of Cosenza, Calabria region, Italy), S. Bogdanovi\u0107 (University of Zagreb, Croatia), I. Camarda (University of Sassari, Sardinia region, Italy), G. Domina (University of Palermo, Sicily region, Italy), N. Kuzmanovi\u0107 (University of Belgrad, Serbia), S. Malso (Gislaved, Sweden), V. Matevsky (Ss. 18. 1832 \u2261 Arum esculentum L., Sp.", "mime": "application/pdf"}, {"id": "abc-318", "words": "5025", "extension": ".pdf", "flesch": "53", "author": "\u00c5\u00a0ilc, Urban", "title": "Synanthropic vegetation: pattern of various disturbances on life history traits", "date": "2010", "keywords": "analysis; composition; differences; disturbance; habitats; land; life; plant; species; traits; type; variables; vegetation", "summary": "On the other hand, perennials and phanerophytes are more com- mon in semi-natural vegetation and have a C-strategy. This is particularly evident for semi-natural vegetation and vegetation of villages.", "mime": "application/pdf"}, {"id": "abc-3184", "words": "1121", "extension": ".pdf", "flesch": "53", "author": "Gligora Udovi\u010d, Marija; Ljube\u0161i\u0107, Zrinka", "title": "The Croatian National Diatom Collection", "date": "2021", "keywords": "collection; croatia; diatom; new", "summary": "Equal interest in the study of diatoms in Croatia has been shown by scientists today, who have recently described a significant number of new species (Gligora et al. 2009, Mejdand\u017ei\u0107 et al. 2017, 2018, Gligora Udovi\u010d et al. 2018, Ca- put Mihali\u0107 et al. 2019, Majewska et al. 2019, 2020, Al- Handal et al. 2020, Mucko et al. 2020, Van de Vijver et al. 2020). 2. Croatian National Diatom Collection logo by Nikola Koleti\u0107.", "mime": "application/pdf"}, {"id": "abc-3187", "words": "1550", "extension": ".pdf", "flesch": "59", "author": "Kunev, Georgi Iliev", "title": "Bromus diandrus (Poaceae), an addition to the Bulgarian flora", "date": "2021", "keywords": "bromus; diandrus; flora; species", "summary": "Retrieved November 21, 2020 from https://www.gbif.org/species/2703760 Georgiev, T., 1963: Bromus L. Bromus L. In: Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M., Webb, D.A., (eds.), Flora Europaea, vol. 5, 182\u2013189.", "mime": "application/pdf"}, {"id": "abc-319", "words": "2881", "extension": ".pdf", "flesch": "58", "author": "Bosabalidis, Artemios M.", "title": "Wall protuberance formation and function in secreting salt glands of Tamarix aphylla L.", "date": "2010", "keywords": "cells; fig; glands; microvacuoles; protuberances; salt; wall", "summary": "In the middle pair of secretory cells, wall protuberances are not re- stricted to the periphery of the cells but often extend deep into the innermost cytoplasmic region (Fig. 2 A). At the region of the pro- tuberance (pr), many vesicles (vs) and converging microtubules (mt) appear; C \u2013 Active dictyosomes (ds) during the stage of protuberance formation; D \u2013 Endoplasmic reticulum ele- ments (er) and mitochondria (m) in the vicinity or in contact with wall protuberances; E \u2013 Numerous microvacuoles (mv) accumulated along the apical wall protuberances in the up- per pair of secretory cells.", "mime": "application/pdf"}, {"id": "abc-3195", "words": "604", "extension": ".pdf", "flesch": "58", "author": "Alegro, Antun", "title": "In memoriam Zorana Sedlar (1980-2020)", "date": "2021", "keywords": "research; vegetation", "summary": "1 Zorana in field research near Bara\u0107 caves in spring 2020. She was involved in projects related to research into vegetation ecology and the biogeography of flora and vegetation of Croatia.", "mime": "application/pdf"}, {"id": "abc-3199", "words": "1711", "extension": ".pdf", "flesch": "64", "author": "Cerrato, Marcello Dante; Ribas-Serra, Arnau; Cardona, Carles; Gil, Lorenzo", "title": "Species introductions through coconut fibre: Dactyloctenium aegyptium and Glinus oppositifolius, new records for the Balearic Islands, Spain", "date": "2021", "keywords": "balearic; islands; plant; species; university", "summary": "Keywords: Balearic Islands, coconut fibre, exotic species, substrate, plant invasions Introduction Allochthonous species are recognized as one of the main threats worldwide to biodiversity. When collected, herbarium vouchers were deposited in the Public Herbarium of the University of the Balearic Islands.", "mime": "application/pdf"}, {"id": "abc-320", "words": "6970", "extension": ".pdf", "flesch": "59", "author": "Lukavsky, Jaromir; Furnadzhieva, Sevdalina; Pilarski, Plamen", "title": "Cyanobacteria of thermal spring at Pancharevo, Sofia, Bulgaria", "date": "2011", "keywords": "acta; cells; cyanobacteria; et al; laminosus; mastigocladus; phormidium; plate; species; springs; thermalis", "summary": "Mastigocladus laminosus was indentified from other hot springs: Kaziczene, Ravno Pole, Zheleznitza, in Sofia basin, Strelcza near , Gradeshnitza, in the Sandanski basin (LU- KAVSK\u00dd et al., not published). Turichia et al. 2009 (syn.", "mime": "application/pdf"}, {"id": "abc-3204", "words": "7132", "extension": ".pdf", "flesch": "56", "author": "Butiuc Keul, Anca; Coste, Ana; Budahn, Holger; Dunemann, Frank; Farkas, Anca; Postolache, Dragos; Klocke, Evelyn", "title": "Analysis of Hypericum accessions by DNA fingerprinting and flow cytometry", "date": "2022", "keywords": "accessions; analysis; botanical; content; dna; garden; hypericum; issr; maculatum; perforatum; plants; size; species; srap", "summary": "Chromosome number in root tips of different Hypericum accessions (Hp - H. perforatum, Hu \u2013 H. umbellatum, Hm \u2013 H. maculatum, Hh \u2013 H. hircinum). Additionally, a combined marker analysis, based on inter-simple se- quence repeats (ISSR) and sequence related amplified polymorphism (SRAP), was conducted to gain a better under- standing of diversity especially within the accessions of H. perforatum.", "mime": "application/pdf"}, {"id": "abc-3206", "words": "6508", "extension": ".pdf", "flesch": "55", "author": "da Silva, Toshik Iarley; Dias, Marlon Gomes; Grossi, Jos\u00e9 Ant\u00f4nio Saraiva; Ribeiro, Wellington Souto; de Moraes, Paulo Jos\u00e9; de Ara\u00fajo, Fernanda Ferreira; Barbosa, Jos\u00e9 Geraldo", "title": "Application of phytohormones as attenuators of salt stress in Tropaeolum majus L. (Tropaeolaceae)", "date": "2022", "keywords": "acid; application; cytokinin; et al; growth; leaf; majus; mass; phytohormones; plant; polyamine; salt; salt stress; stress", "summary": "Severe salt stress and moderate salt stress decreased sto- matal conductance (gs), net photosynthesis (A) and transpi- ration (E) of T. majus plants in relation to the control. Dar, T.A., Uddin, M., Khan, M. M. A., Hakeem, K.R., Jaleel, H. 2015: Jasmonates counter plant stress: a review.", "mime": "application/pdf"}, {"id": "abc-322", "words": "6951", "extension": ".pdf", "flesch": "57", "author": "El Madani, Faid; Chiaar, Abderrahim; Chafi, Abdelhafid", "title": "Phytoplankton composition and abundance assessment in the Nador lagoon (Mediterranean coast of Morocco)", "date": "2011", "keywords": "acta; balech; bot; chaetoceros; croat; ehrenberg; g\u00f3mez; lagoon; l\u00f3pez; moreira; nador; neoceratium; phytoplankton; protoperidinium; stations", "summary": "Balech \u2013 \u2013 + + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 3 Alexandrium margalefi Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + + 4 Alexandrium minutum Halim + + + + + + + + + + + 5 Alexandrium pseudogonyaulax (Biecheler) Horiguchi ex Yuki et Fukuyo \u2013 + + \u2013 \u2013 + \u2013 + + + + 6 Alexandrium sp. \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 + 7 Alexandrium tamarense (Lebour) E.Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 \u2013 \u2013 \u2013 8 Amphidinium sp. \u2013 \u2013 \u2013 + + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 9 Amphidoma caudata Halldal + + + + + + + + + + + 10 Amylax sp. \u2013 \u2013 \u2013 + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 11 Archaeperidinium sp. \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 12 Coolia monotis Meunier + + + \u2013 \u2013 \u2013 + + \u2013 + + 13 Cyst Alexandrium minutum \u2013 \u2013 \u2013 + + + \u2013 + + + \u2013 14 Cyst of dinoflagellates + + + \u2013 \u2013 + + + + + + 15 Dinophysis caudata Saville\u2013Kent \u2013 + \u2013 \u2013 \u2013 \u2013 + + + + + 16 Dinophysis contracta (Kofoid et Skogsberg) Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 17 Dinophysis diegensis Kofoid \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 18 Dinophysis exigua Kofoid and Skogsberg \u2013 \u2013 + \u2013 \u2013 \u2013 \u2013 \u2013 + + + 19 Dinophysis rapa (Stein) Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 20 Dinophysis rotundata Clapar\u00e8de et Lachmann \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 21 Dinophysis sacculus Stein + + + + + + + + + + + 22 Dinophysis sp. \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 23 Diplopelta asymetrica (Mangin) Lindermann \u2013 \u2013 \u2013 \u2013 + \u2013 \u2013 + \u2013 \u2013 \u2013 24 Diplopelta steinii (T. H. Ab\u00e9) E. Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 25 Diplopeltopsis minor Pavillard \u2013 + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 26 Diplopeltopsis sp. \u2013 + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 27 Diplopsalis sp. + + + \u2013 + + + + + + + 28 Diplopsalopsis bomba (Stein ex J\u00f6rgensen) J. D. Dodge et S. Toriumi \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 \u2013 Tab. 70 (2), 2011 EL MADANI F., CHIAAR A., CHAFI A. Stations 1 2 3 4 5 6 7 8 9 10 11 29 Diplopsalopsis sp. \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 30 Ensciculifera sp. + + + + \u2013 + + + + \u2013 + 31 Ensiculifera angulata E. Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 32 Ensiculifera angulata E. Balech \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + 33 Gambierdiscus toxicus Adachi and Fukuyo + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 34 Goniodoma polyedricum (Pouchet) J\u00f6rgensen \u2013 \u2013 + \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + + 35 Gonyaulax dicantha (Meunier) Schiller \u2013 \u2013 + + + + + + + \u2013 + 36 Gonyaulax digitale (Pouchet) Kofoid + \u2013 \u2013 + \u2013 + + + \u2013 + + 37 Gonyaulax grindleyi Reinecke \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 \u2013 + 38 Gonyaulax polygramma Stein \u2013 \u2013 \u2013 \u2013 \u2013 + \u2013 \u2013 + + + 39 Gonyaulax sousae Balech + + + + + + + + + + + 40 Gonyaulax spinifera (Clapar\u00e8de et Lachmann)", "mime": "application/pdf"}, {"id": "abc-3220", "words": "4047", "extension": ".pdf", "flesch": "63", "author": "Liu, Qi; Wu , Han ; Li, Yan-Ling; Kociolek , John Patrick", "title": "One new species of Cymbella C.A. Agardh (Bacillariophyta) from high altitude lakes in the Hengduan Mountains of Southwest China", "date": "2021", "keywords": "china; cymbella; diatom; kociolek; krammer; kulikovskiy; luoyulanae; species; striae; valve", "summary": "Results Taxonomy Class Bacillariophyceae Haeckel 1878 Subclass Bacillariophycidae D.G. Mann in Round et al. 1990 Order Cymbellales D.G. Mann in Round et al. 1990 Family Cymbellaceae Greville 1833 Genus Cymbella C.A.Agardh 1830 Cymbella luoyulanae Y.Li sp. nov. Fig. Karthickia verestigmata gen. et. sp.", "mime": "application/pdf"}, {"id": "abc-323", "words": "3853", "extension": ".pdf", "flesch": "59", "author": "Iskri\u00c4\u2021, Sonja; Jelaska, Sibila; Koji\u00c4\u2021-Prodi\u00c4\u2021, Biserka; La\u00c4\u2021an, Goran; Ljube\u00c5\u00a1i\u00c4\u2021, Nikola; Wrischer, Mercedes; Salopek Sondi, Branka", "title": "In memoriam of Dr. Volker Magnus", "date": "2010", "keywords": "acta; auxin; magnus; plant; volker", "summary": "His MSc thesis, completed in 1971, dealt with the isola- tion of indole-3-methanol from pea seedlings, a metabolite of indole -3-acetic acid (IAA) (MAGNUS et al. 1971). Synthesis of the -D-glucosyl es- ter of [carbonyl-13C]-indole-3-acetic acid.", "mime": "application/pdf"}, {"id": "abc-3257", "words": "7036", "extension": ".pdf", "flesch": "62", "author": "\u00d6zdener K\u00f6mpe, Yasemin; Akin Mutlu, Vildan ; \u00d6zko\u00e7 , \u0130brahim ; Demiray , Sevim ", "title": "Fungal diversity and ex vitro symbiotic germination of Serapias vomeracea (Orchidaceae) ", "date": "2022", "keywords": "et al; fungi; germination; isolates; orchid; rhizoctonia; roots; seeds; soil; svl; tulasnella; vomeracea", "summary": "In this context, ex vitro symbiotic seed germination and seedling growth of orchid seeds may be convenient and advanta- geous. There are very few studies on ex vitro germination and seedling development of orchid seeds to date and they are about epiphytic orchids (Quay et al. 1995, Aewsakul et al. 2013).", "mime": "application/pdf"}, {"id": "abc-3258", "words": "4541", "extension": ".pdf", "flesch": "63", "author": "Iamonico, Duilio", "title": "Habrosia (Caryophyllaceae) a monotypic genus endemic to Western Asia: morphological and molecular remarks", "date": "2021", "keywords": "arenaria; caryophyllaceae; dillenberger; fenzl; genus; habrosia; iamonico; kadereit; minuartia; sabulina; ser; spinuliflora", "summary": "Habrosia spinuliflora Fenzl. Retrieved Janu- ary 30, 2021 from http://sweetgum.nybg.org/science/ih/ Tropicos, 2021: Habrosia spinuliflora Fenzl. - Tropicos.org.", "mime": "application/pdf"}, {"id": "abc-326", "words": "4721", "extension": ".pdf", "flesch": "60", "author": "Kilinc, Mahmut; Kutbay, Hamdi Guray; Yalcin, Erkan; Bilgin, Ali; Avci, Kenan; Topaloglu, Solmaz Gencoglu", "title": "Effects of selected groundwater chemical traits on a salt marsh community", "date": "2011", "keywords": "groundwater; journal; marsh; plant; salinity; salt; soil; species; vegetation", "summary": "References ABD EL-GHANI, M. M., 2000a: ABD EL-GHANI, M. M., 2000b:", "mime": "application/pdf"}, {"id": "abc-3280", "words": "7483", "extension": ".pdf", "flesch": "68", "author": "Stani\u0161i\u0107-Vuja\u010di\u0107, Milica; Ste\u0161evi\u0107 , Danijela; Had\u017eiablahovi\u0107 , Sead ; Cakovi\u0107 , Danka ; \u0160ilc, Urban ", "title": "An Asphodelus ramosus dominated plant community in Montenegro: fringe or grassland?", "date": "2022", "keywords": "asphodelus; biondi; bromo; chrysopogonetum; communities; community; et al; grasslands; grylli; mediterranean; montenegro; plant; ramosi; ramosus; species; subsp; vegetation", "summary": "Asphodelus ramosus, Anemone hortensis, Carlina corymbosa and Hypochoeris radicata, which are considered to be character species by Biondi et al. (2016), are also very frequent in grassland vegetation of Bromo erecti-Chrysopogonetum grylli. (and Asphodelus ramosus in particular) has become very intensive in recent years, especially in the western and central Mediterranean (Allegrezza et al. 2015, Biondi et al. 2016, 2017).", "mime": "application/pdf"}, {"id": "abc-3284", "words": "2516", "extension": ".pdf", "flesch": "60", "author": "Ste\u0161evi\u0107, Danijela; Milanovi\u0107, \u0110or\u0111ije; Stani\u0161i\u0107-Vuja\u010di\u0107, Milica ; \u0160ilc, Urban", "title": "New records of Salicornia s.l. in Montenegro and Bosnia and Hercegovina", "date": "2022", "keywords": "arthrocaulon; bosnia; macrostachyum; montenegro; perennis; procumbens; rel; salicornia", "summary": "All three taxa were recorded in the abandoned basins of Tivat Saline in Montenegro, while S. perennis was also found in the Klek Peninsula in Bosnia and Herzegovina. Accord- ing to the literature sources (Kutle\u0161a and Laku\u0161i\u0107 1964, Kaligari\u010d and \u0160kornik 2007, Kaligari\u010d et al. 2008, Ste\u0161evi\u0107 and Cakovi\u0107 2013, Barina et al. 2018, Nikoli\u0107 2020), the fol- lowing glasswort species/aggregates have been reported along the eastern Adriatic coast (SVN \u2013 Slovenia, HRV \u2013 Croatia, BIH \u2013 Bosnia and Hercegovina, MNE \u2013 Montenegro, ALB \u2013 Albania): Arthrocaulon macrostachyum (SVN, HRV, BIH, ALB), Salicornia fruticosa (SVN, HRV, BIH, MNE, ALB), S. perennis (HRV, ALB), Salicornia europaea aggr.", "mime": "application/pdf"}, {"id": "abc-330", "words": "2153", "extension": ".pdf", "flesch": "64", "author": "Inceer, Huseyin", "title": "Achene slime content in some taxa of Matricaria L. (Asteraceae)", "date": "2011", "keywords": "blue; chamomilla; kreitschitz; matricaria; slime; var", "summary": "70 (1), 109\u2013114, 2011 CODEN: ABCRA25 ISSN 0365\u20130588 Achene slime content in some taxa of Matricaria L. (Asteraceae) HUSEYIN INCEER* Karadeniz Technical University, Faculty of Science, Department of Biology, 61080 Trabzon, Turkey Abstract \u2013 The achenes of Matricaria aurea and two varieties of M. chamomilla (var. chamomilla and var. recutita) have slime cells on the surface and they are characterized by slime envelope formation during hydration. The present results confirm that slime cells on the sur- face of the pericarp produce the slime.", "mime": "application/pdf"}, {"id": "abc-3306", "words": "8035", "extension": ".pdf", "flesch": "62", "author": "Vassilev, Kiril Veselinov; Nazarov, Momchil; Mardari, Constantin; Grigorov, Borislav; Georgiev, Stoyan; Genova, Beloslava; Velev, Nikolay", "title": "Syntaxonomical and ecological diversity of the class Polygono-Poetea annuae in Bulgaria", "date": "2022", "keywords": "agg; annuae; areas; arenastri; association; bulgaria; class; communities; composition; et al; polygonetum; polygonetum arenastri; polygono; species; vegetation", "summary": "Ac- cording to \u010carni and Mucina (1998), the major factors enhancing the variability of trampled vegetation include lo- cal floristic pools (mass effect) and the enrichment of tram- pled habitats by encroaching alien plant species. Field sampling and data analysis In Bulgaria 175 vegetation plots (relev\u00e9s) presenting trampled vegetation, were sampled during the 2017-2020 period following the Braun-Blanquet approach (Westhoff and van der Maarel 1973).", "mime": "application/pdf"}, {"id": "abc-3309", "words": "12812", "extension": ".pdf", "flesch": "63", "author": "Ko\u00e7, Esra", "title": "Physiological responses of resistant and susceptible pepper plants to exogenous proline application under Phytophthora capsici stress", "date": "2022", "keywords": "application; capsici; content; cultivar; dpi; increase; p. capsici; plant; pro; stress", "summary": "Although P. capsici application generally induced an increase in the amount of anthocy- anin and flavonoids in the CM-334 cultivar compared to the control group, the highest values were obtained upon appli- cations of both Pro concentrations + P. capsici (P < 0.05) (Tab. 1). Therefore, the increase in the chlorophyll a and b content in peppers exposed to P. capsici stress can be at- tributed to the stimulation of chlorophyll biosynthesis or inhibition of its degradation and the more efficient removal of stress-induced increased ROS by Pro.", "mime": "application/pdf"}, {"id": "abc-3327", "words": "5030", "extension": ".pdf", "flesch": "59", "author": "Gavrilovi\u0107, Milan; Jana\u0107kovi\u0107, Pedja", "title": "Micromorphology of endemic Centaurea glaberrima subsp. divergens (Asteraceae)", "date": "2022", "keywords": "asteraceae; centaurea; et al; fig; glaberrima; glandular; species; surface; trichomes", "summary": "However, there are a few novel studies that eval- uate the pollen morphology of Centaurea species (\u00d6zler et al. 2009, Shabestari et al. 2013, Baser et al. 2019). Rahiminejad et al. (2010) noted that the type and density of leaf and stem epi- dermal indumentum were of particular taxonomic value for Centaurea species.", "mime": "application/pdf"}, {"id": "abc-3330", "words": "6182", "extension": ".pdf", "flesch": "57", "author": "Tiryaki, Iskender; Isidogru, Nuray ", "title": "Determination of salt tolerance levels and genetic relationships of Vicia sativa cultivars using gene targeted functional markers", "date": "2022", "keywords": "analysis; cultivars; gene; germination; markers; plant; rate; salt; salt tolerance; sativa; stress; tolerance; vetch; vicia", "summary": "Overall, the results of this study dem- onstrate that gene specific primers related to salt tolerance in plants could be used to discriminate the salt tolerant and salt sensitive cultivars at germination stage as well as to de- termine intraspecific genetic diversity if a higher number of salt tolerance related genes are used as GTFMs. This study concluded that the cultivars determined to be salt tolerant and sensitive at germination stage distributed into three main clades determined by UPGMA analysis while the GTFMs associated with salt tolerance successfully determined the genetic relationships of common vetch cultivars.", "mime": "application/pdf"}, {"id": "abc-3337", "words": "3961", "extension": ".pdf", "flesch": "60", "author": "Aires Souza, Jos\u00e9 Thyago; Silva Ara\u00fajo, Jucilene ; dos Santos F\u00e9lix, Evaldo ; de C\u00e1ssia Alves, Rita ; de Oliveira Filho, Tarc\u00edsio Jos\u00e9 ; Cunha de Lira, Elder ", "title": "Gas exchange in genotypes of Nopalea cochenillifera in different seasons and evaluations times: Gas exchange in genotypes of Nopalea cochenillifera Salm-Dyckin ", "date": "2022", "keywords": "baiana; cactus; co2; fig; forage; mi\u00fada; rainy; season; varieties", "summary": "Keywords: Brazil, Cactaceae, CO2 uptake, forage cactus, semi-arid, xerophilus Introduction The forage basis of cattle-raising in the Brazilian semi- arid region is constituted by plants native to the Caatinga associated with the cultivation of exotic species. Discussion The remarkable adaptability of forage cactus in environ- ments with rainfall restrictions, associated with crassula- ceous acid metabolism, characterized by nocturnal stomatal opening, enables this plant to become the most cultivated xerophilic species in Brazil.", "mime": "application/pdf"}, {"id": "abc-334", "words": "3423", "extension": ".pdf", "flesch": "54", "author": "\u00c4\u2020urkovi\u00c4\u2021-Perica, Mirna; Je\u00c5\u00bei\u00c4\u2021, Marin", "title": "Detrimental effect of quercetin on phytoplasma-infected Catharanthus roseus (L.) G. Don shoots grown in vitro", "date": "2010", "keywords": "effect; medium; pcr; phytoplasma; plants; quercetin; shoots", "summary": "Twenty-four infected C. roseus shoots per treatment, positive control (untreated infected shoots on the medium with BA), non-infected treated shoots, and negative control (non-infected shoots 156 ACTA BOT. However, stunting was even more pronounced in quercetin-treated than in non-treated infected plants, moreover leaf browning and appearance of black spots on the leaf edges appeared on quercetin treated plants.", "mime": "application/pdf"}, {"id": "abc-3348", "words": "6638", "extension": ".pdf", "flesch": "75", "author": "Aykurt, Candan; \u00c7\u0131ngay, Bur\u00e7in; S\u00fcmb\u00fcl, H\u00fcseyin; G\u00fclben, Mertcan; Cabi, Evren; \u00d6z, Zeynep", "title": "Festuca albomontana (Poaceae), a new chasmophytic fescue from the Western Taurus Mountains (Antalya, Turkey)", "date": "2022", "keywords": "aykurt; festuca; group; leaf; poaceae; species; turkey", "summary": "Fuente, V., Ort\u00fa\u00f1ez, E., 1998: Biosistem\u00e1tica de la secci\u00f3n Festuca del g\u00e9nero Festuca L. Poaceae) en la Pen\u00ednsula Ib\u00e9rica. Keywords: anatomy, Festuca, morphology, new species, taxonomy, Turkey Introduction The grass family (Poaceae), with about 12,000 species and 780 genera, ranks as the second largest monocot fam- ily and the fifth largest plant family in the world (Clayton and Renvoize 1986, Kellogg 2015, Christenhusz and Byng 2016, Soreng et al. 2017).", "mime": "application/pdf"}, {"id": "abc-3353", "words": "5957", "extension": ".pdf", "flesch": "66", "author": "Tekin, Mehmet", "title": "A morphological, anatomical and palynological study of Aethionema lepidioides (Brassicaceae) - an endangered species endemic to Turkey", "date": "2022", "keywords": "aethionema; brassicaceae; cell; epidermis; fig; lepidioides; pollen; seed; species; study", "summary": "\u0130nceo\u011flu and Karamustafa (1977) studied the pollen properties of Ae. arabicum and Ae. armenum with a light microscope. At\u00e7eken et al. (2016) studied the pollens of Ae. arabicum, Ae. cordatum, Ae. karamanicum and Ae. armenum.", "mime": "application/pdf"}, {"id": "abc-336", "words": "7541", "extension": ".pdf", "flesch": "53", "author": "\u0106uk, Katarina; Gogala, Marko; Tkalec, Mirta; Vidakovi\u0107-Cifrek, \u017deljka", "title": "Transgenerational stress memory in Arabidopsis thaliana (L.) Heynh.: antioxidative enzymes and HSP70", "date": "2010", "keywords": "activity; control; generation; hsp70; irradiation; m\u20132; plants; progeny; stress", "summary": "In order to minimize the effects of UV irradiation plants activate different physiological responses, such as the biosynthesis of protecting compounds (STAPLETON 1992), the reactive oxygen species (ROS) scavenging system (XU et al. 2008) and DNA re- pair mechanisms (MOLINIER et al. 2005). The Journal of Biological Chemistry 279, 779\u2013787. DAT, J., VANDENABEELE, S., VRANOV\u00c1, E., VAN MONTAGU, M., INZ\u00c9, D., VAN BREUSEGEM, F., 2000: Dual action of the active oxygen species during plant stress responses.", "mime": "application/pdf"}, {"id": "abc-3365", "words": "784", "extension": ".pdf", "flesch": "66", "author": "\u0160kvorc, \u017deljko", "title": "Toni Nikoli\u0107 \u2013 Flora Croatica: Vaskularna flora Republike Hrvatske, vols. 1-4 (2019-2020)", "date": "2021", "keywords": "book; croatia; flora", "summary": "For that reason, there is a need for quality, comprehensive work that will give an over- view and evaluation of vascular plant taxa of this area. In addition, it brings modern scientific knowledge from vari- ous botanical disciplines about vascular plants growing in Croatia.", "mime": "application/pdf"}, {"id": "abc-3373", "words": "6425", "extension": ".pdf", "flesch": "70", "author": "Schmidt, D\u00e1vid; Mesterh\u00e1zy, Attila; Csiky, J\u00e1nos", "title": "Lepidium oblongum (Brassicaceae) appeared on Hungarian railways: the beginning of a wider European conquest?", "date": "2022", "keywords": "flora; hungary; lepidium; oblongum; railway; shehbaz; small; species; states", "summary": "Of these, 7 are alien taxa: L. bonariense L., L. densiflorum Schrad., L. neglectum Thell., L. oblongum Small, L. virginicum L. are American adventive, L. sativum is native to Northeast Africa and Asia Minor, while L. africanum is an African flora element (De Carvalho e Vasconcellos et al. 1993, S\u00eerbu and Oprea 2011, Kaplan et al. 2018). 81 (1), 2022 45 In Hungary, we observed its occurrences within the wid- er environment of railway stations.", "mime": "application/pdf"}, {"id": "abc-3388", "words": "523", "extension": ".pdf", "flesch": "40", "author": "Plenkovi\u0107-Moraj, An\u0111elka", "title": "Dubravka Hafner and Anita Dedi\u0107 \u2013 Diatoms of the Adriatic Sea Basin in Bosnia and Herzegovina", "date": "2021", "keywords": "bosnia; diatoms", "summary": "It was written as a result of the sci- entific work of Professor Dubravka Hafner, who has devot- ed her whole life and work to the study of cyanobacteria and algae, with a special interest in diatoms. Compiling a definitive list of diatoms from Bosnia and Herzegovina involves considerable scien- tific effort, and I am sure that both authors will acknowledge that knowledge of freshwater habitats is still incomplete and there is much to learn.", "mime": "application/pdf"}, {"id": "abc-3420", "words": "5609", "extension": ".pdf", "flesch": "66", "author": "Mart\u00edn-Bravo, Santiago; Ben\u00edtez-Ben\u00edtez, Carmen; M\u00edguez-R\u00edos, M\u00f3nica; Meco, Marjol; Jim\u00e9nez-Mej\u00edas, Pedro", "title": "Chorological notes of Carex L. (Cyperaceae) for the Flora of the Balkans, with emphasis in Albania", "date": "2022", "keywords": "albania; ben\u00edtez; c. ben\u00edtez; carex; jim\u00e9nez; mart\u00edn; mej\u00edas; m\u00edguez; species", "summary": "In the Balkans, C. agastachys has been confirmed from Bulgaria, Greece, European Turkey, Serbia and Slovenia, and C. pendula from Croatia, Greece, Montenegro and Slovenia (M\u00edguez et al. 2018). Finally, recent Albanian checklists and floras include C. pendula s.l. without taking into account the potential pres- ence of C. agastachys (Vangjeli 2015, Pils 2016, Barina et al. 2018).", "mime": "application/pdf"}, {"id": "abc-3422", "words": "6443", "extension": ".pdf", "flesch": "62", "author": "Karaismailo\u011flu, Mehmet; \u0130nal, Beh\u00e7et; Erol, Osman", "title": "A systematic study of Thlaspi s.l. taxa in the sections Nomisma, Thlaspi and Pterotropis from Turkey based on fruit morphological and molecular data", "date": "2022", "keywords": "data; fruit; genus; karaismailo\u011flu; meyer; obcordate; oval; region; reticulate; species; taxa; thlaspi; turkey", "summary": "81 (2), 2022 203 formed by T. perfoliatum taxa, the length of the petals in the outer segment is equal to those of the inner segment, while in T. annuum the petals in the outer segment are longer than in the inner segment (Karaismailo\u011flu 2018). T. ochroleucum, T. cariense, T. densiflorum, T. violascens, T. tatianae, T. cataonicum and T. syriacum taxa are included in the C3 cluster.", "mime": "application/pdf"}, {"id": "abc-3435", "words": "7886", "extension": ".pdf", "flesch": "58", "author": "Justi\u0107, Marta; Jelaska, Sven", "title": "The relationship between biodiversity and the biomass of grasslands in the Zagreb area (NW Croatia)", "date": "2022", "keywords": "area; biomass; diversity; grasslands; localities; locality; number; plant; plots; species; taxa; values; vegetation", "summary": "Neophytes are represented by two species: Anthyllis vulneraria L. and Lolium multiflorum Lam. Invasive alien taxa are also represented by two species: Erigeron annuus (L.) Desf.", "mime": "application/pdf"}, {"id": "abc-3463", "words": "7856", "extension": ".pdf", "flesch": "49", "author": "\u0160imunovi\u0107, Maja; Kula\u0161, Antonija; \u017dutini\u0107, Petar; Goreta, Gordana; Gligora Udovi\u010d, Marija", "title": "Phytoplankton metrics for trophic and ecological status assessment of a natural karstic lake", "date": "2022", "keywords": "april; assessment; biomass; chl; depth; group; june; lake; lake visovac; phytoplankton; samples; september; status; trophic; visovac; water", "summary": "Lake ecological status based on HLPI index and nitrate concentration However, in 2019 the Croatian water man- agement agency and partners decided to classify the eco- logical quality of natural lakes using the Hungarian classi- fication method for lake phytoplankton assessment, which was intercalibrated for the lakes within the EC-GIG (Borics et al. 2018), with some adaptations from the MED-GIG (de Hoyos et al. 2014).", "mime": "application/pdf"}, {"id": "abc-3468", "words": "5998", "extension": ".pdf", "flesch": "56", "author": "Shakhsi-Dastgahian, Fereshteh ; Valizadeh, Jafar ; Cheniany, Monireh ; Einali, Alireza", "title": "Exogenous arginine treatment additively enhances growth and tolerance of Salicornia europaea seedlings under salinity", "date": "2022", "keywords": "arg; effect; europaea; growth; nacl; plant; salinity; salt; seedlings; stress; tolerance; treatment", "summary": "Changes in enzyme activities in Arg-treated seedlings during salt treatment The activities of APX, POX and PPO in S. europaea seedlings were negatively changed by salt treatments (Fig. 4). Despite some studies on salt stress and the role of Arg in its tolerance (Nejadalimoradi et al. 2014, Ramadan et al. 2019), there is no report on the possible effects of this amino acid on salt stress tolerance in Salicornia.", "mime": "application/pdf"}, {"id": "abc-3472", "words": "7558", "extension": ".pdf", "flesch": "56", "author": "Vitko, Sandra; Vidakovi\u0107-Cifrek, \u017deljka; Bauer, Nata\u0161a; Leljak-Levani\u0107, Dunja", "title": "Effect of moderate heat stress on Arabidopsis thaliana with modified BPMs expression", "date": "2022", "keywords": "activity; amir; arabidopsis; bpm; content; heat; oebpm1; seedlings; stress; time; type; wild", "summary": "81 (2), 140\u2013148, 2022 CODEN: ABCRA 25 DOI: 10.37427/botcro-2022-011 ISSN 0365-0588 eISSN 1847-8476 Effect of moderate heat stress on Arabidopsis thaliana with modified BPMs expression Sandra Vitko, Nata\u0161a Bauer, Dunja Leljak-Levani\u0107, \u017deljka Vidakovi\u0107-Cifrek* University of Zagreb, Faculty of Science, Department of Biology, Rooseveltov trg 6, 10000 Zagreb, Croatia Abstract \u2013 The aim of this research was to investigate the oxidative stress response of Arabidopsis with modified BPMs expression to moderate heat stress.", "mime": "application/pdf"}, {"id": "abc-3501", "words": "5893", "extension": ".pdf", "flesch": "55", "author": "Boubetra, Kenza; Amirouche, Nabila; Amirouche, Rachid", "title": "Morpho-anatomical diversity of five species of the genus Asparagus (Asparagaceae) from Algeria: Genus Asparagus in Algeria", "date": "2022", "keywords": "acutifolius; algeria; asparagus; cells; cladodes; fig; genus; horridus; officinalis; populations; species", "summary": "Cir- cular sections have also been observed in Asparagus species from Bulgaria such as A. tenuifolius Lam., and A. acutifolius (Raycheva and Stojanov 2013). Genetic diversity among Asparagus species using morphological characteristics and RAPD markers in Paki- stan.", "mime": "application/pdf"}, {"id": "abc-351", "words": "2506", "extension": ".pdf", "flesch": "54", "author": "Devide, Zvonimir", "title": "Lehrbuch der Botanik Textbook of Botany, Founded by E. Strasburger, F. Noll, H. Schenck and A. F. W. Schimper. 36th edition, revised by A. Bresinsky, C. Korner, J. W. Kadereit, G. Neuhaus and U. Sonnewald", "date": "2010", "keywords": "book; botany; edition; plants; strasburger; textbook", "summary": "[5] In this section all as- pects of plant metabolism are presented and explained: energetics of metabolism, economy of minerals and water, photosynthesis (light reactions and the path of carbon, the assimila- 150 ACTA BOT. In the second part of the book, the main aspects of plant physiology are presented: me- tabolism, growth and development, movements and allelophysiology.", "mime": "application/pdf"}, {"id": "abc-3514", "words": "6187", "extension": ".pdf", "flesch": "66", "author": "Brullo, Salvatore; Brullo, Cristian; Tavilla, Gianmarco; Cambria, Salvatore; Minissale, Pietro; Sciandrello, Saverio; Giusso del Galdo, Gianpietro; Siracusa, Giuseppe; Del Guacchio, Emanuele", "title": "About the occurrence of Elatine macropoda and E. gussonei (Elatinaceae) in Sicily and lectotypification of their names", "date": "2022", "keywords": "brullo; elatine; gussonei; lampedusa; macropoda; s.n; seed; sicily; sommier; species", "summary": "In fact, based on our observations, E. gussonei (Lampedusa and Malta) is morphologically distinct from the typical E. macropoda of the Hyblaean territory, especially on account of the petals (equalling or slightly longer than sepals), while in E. macropoda petals are always very reduced (Fig. 7). 1J-K), in our opinion, cannot be attributed to E. gussonei but rather to E. macropoda, showing flowers with petals subequal to sepals.", "mime": "application/pdf"}, {"id": "abc-3516", "words": "5596", "extension": ".pdf", "flesch": "61", "author": "Elkordy, Ahmed; Osman , Ahmed K.; O. Badry, Mohamed", "title": "Seed and pollen morphology and numerical analysis of Tephrosia Pers. (Fabaceae) and their taxonomic significance", "date": "2022", "keywords": "apollinea; fig; nubica; pollen; purpurea; quartiniana; seed; taxa; tephrosia; uniflora", "summary": "Based on UPGMA clustering analysis and PCA, three main clades were recognized: Clade A comprising T. kassasii, clade B comprising T. apollinea, T. purpurea, T. quartiniana, and T. uniflora, and clade C comprising T. nubica. T. apollinea (A\u2013C), T. nubica (D\u2013F), T. purpurea (G\u2013I), T. quartiniana (J\u2013L), T. uniflora (M\u2013O), T. kassasii (P\u2013R).", "mime": "application/pdf"}, {"id": "abc-3519", "words": "4301", "extension": ".pdf", "flesch": "59", "author": "\u0160oljan, Dubravka", "title": "In Memoriam, Sister Edita Marija \u0160oli\u0107 Ph.D. (1946 \u2013 2021)", "date": "2022", "keywords": "biokovo; biology; edita; m.e; makarska; marija; nature; science; sister; \u0161oli\u0107", "summary": "Most of the proceedings from the mentioned confer- ences were published in the journal Acta Biocovica, whose editor-in-chief was Jure Radi\u0107, with Sister Edita \u0160oli\u0107 being his first assistant. From 1997 to 2001 Edita \u0160oli\u0107 was the editor of the journal.", "mime": "application/pdf"}, {"id": "abc-352", "words": "4091", "extension": ".pdf", "flesch": "64", "author": "Devide, Zvonimir", "title": "Celebrating the eightieth birthday of Professor Peter Sitte", "date": "2010", "keywords": "acta; biologie; biology; cell; der; des; die; evolution; feinbau; f\u00fcr; hrsg; sitte; und; verlag; von", "summary": "In the name of all our Croatian colleagues and the Editorial Board of the Acta Botanica Croatica, Zvonimir Devid\u00e9 Journal papers, congress proceedings papers, books and book chapters SITTE, P., 1953: SITTE, P., 1954:", "mime": "application/pdf"}, {"id": "abc-3521", "words": "5404", "extension": ".pdf", "flesch": "66", "author": "Cambria, Salvatore ; Crisafulli, Alessandro; Giusso del Galdo, Gianpietro; Picone, Rosa Maria; Soldano, Adriano ; Sciandrello, Saverio; Tavilla, Gianmarco", "title": "First record of Sida rhombifolia L. (Malvaceae) for Italian flora: taxonomical and ecological investigation", "date": "2022", "keywords": "alien; flora; italy; malvaceae; new; plant; rhombifolia; sicily; sida; species", "summary": "Distribution map of Sida rhombifolia L. (Malvaceae) in Peloritani in Sicily, Italy. to S. rhombifolia L., showing leaves with an indumentum of minute sessile stellate hairs, and serrate margins at the apex, as well as dehiscent mericarps provided with 2 prominent apical awns. Following this classification, the genus Sida L. falls within the tribe Malveae J. Presl belonging to the Malvoideae Bur- nett subfamily.", "mime": "application/pdf"}, {"id": "abc-3526", "words": "4372", "extension": ".pdf", "flesch": "56", "author": "Iamonico, Duilio; Wolf, Marion; Sciuto, Katia; Sfriso, Adriano; Argenti, Carlo", "title": "Blitum venetum (Chenopodiaceae), a new species from north-eastern Dolomites (Italian Eastern Alps)", "date": "2022", "keywords": "blitum; bonus; henricus; iamonico; new; region; species; trnl; venetum; vs.", "summary": "Morphological comparison among Blitum bonus-henricus, B. californicum, and B. venetum. On the basis of the percent identity matrices obtained with MUSCLE (Figs. 1c, 1d), the nucleotide divergences cal- culated between the Blitum sp. specimen from Belluno and each of the other recognized Blitum species ranged from 0.40% (Blitum sp. vs. B. bonus-henricus) to 4.37% (Blitum sp. vs. B. californicum) for the nucleotide ITS marker and from 0.86% (Blitum sp. vs. B. bonus-henricus) to 3.70% ( Blitum sp. vs. B. petiolare) for the plastid trnL-F marker.", "mime": "application/pdf"}, {"id": "abc-353", "words": "4324", "extension": ".pdf", "flesch": "52", "author": "Vardar, Filiz; Unal, Meral", "title": "Cytochemical and ultrastructural observations of anthers and pollen grains in Lathyrus undulatus Boiss.", "date": "2011", "keywords": "anther; cells; development; lathyrus; microspore; pollen; stage; tapetum; undulatus; wall", "summary": "Abbreviations: PMC \u2013 pollen mother cell, PAS \u2013 periodic acid-Schiff Introduction Microsporogenesis and pollen grain development have been a focus of interest since generative reproduction in plants depends on pollen structure and function. The present paper provides research on anther and pollen grain development in Lathyrus undulatus, by the application of light, fluorescence and electron microscopy.", "mime": "application/pdf"}, {"id": "abc-3557", "words": "3983", "extension": ".pdf", "flesch": "65", "author": "\u0160kvorc, Zeljko; Krstono\u0161i\u0107, Daniel", "title": "In memoriam Jozo Franji\u0107 (1966-2021)", "date": "2022", "keywords": "croatia; franji\u0107; hrvatskoj; krstono\u0161i\u0107; quercus; trinajsti\u0107; \u0161kvorc; \u0161umarski", "summary": "\u0160kvorc \u017d., Sever, K., Franji\u0107, J., Krstono\u0161i\u0107, D., Poljak, M., 2012: Intenzitet fotosinteze i vegetativni rast hrasta lu\u017enjaka (Quercus robur L.) u pokusnom nasadu. Jasprica, N., \u0160kvorc, \u017d., Dolina, K., Ru\u0161\u010di\u0107, M., Kova\u010di\u0107, S., Franji\u0107 J., 2015: Composition and ecology of the Quercus coc- cifera L. communities along the eastern Adriatic coast (NE Mediterranean).", "mime": "application/pdf"}, {"id": "abc-3561", "words": "5504", "extension": ".pdf", "flesch": "55", "author": "Li, Yue; Ma, Junqiang; Wang, Yu; Xu, Sunan; Jiang, Lei; Zhang, Lihong; Hou, Wei", "title": "Effects of exogenous NO on the growth and photosynthetic fluorescence characteristics of ryegrass seedlings under B[a]P stress", "date": "2023", "keywords": "b[a]p; b[a]p stress; chlorophyll; growth; l\u20131; parameters; plant; ryegrass; snp; stress; \u03bcmol", "summary": "The foliar application of 200 \u03bcmol L\u20131 SNP showed more pronounced results than that of the other three concentrations of SNP treatments on ryegrass plants under B[a]P stress. Effect of exogenous NO on photosynthetic pigment contents of ryegrass under B[a]P stress The chlorophyll a, chlorophyll b, and total chlorophyll contents of the ryegrass under 30 \u03bcmol L\u20131 B[a]P stress dras- tically decreased (P < 0.05) and the carotenoid content de- clined but not radically compared with the control (Fig. 2).", "mime": "application/pdf"}, {"id": "abc-3563", "words": "4182", "extension": ".pdf", "flesch": "63", "author": "Hamzao\u011flu, Ergin; Kano\u011flu, Salih Sercan; Aksoy, Necmi", "title": "Dianthus nezahatiae (Caryophyllaceae), a new species from Northwest Turkey", "date": "2022", "keywords": "apex; calyx; caryophyllaceae; dianthus; epicalyx; hamzao\u011flu; nezahatiae; scales; species; turkey", "summary": "Results Dianthus nezahatiae Hamzao\u011flu, sp. nov. (sect. Dianthus nezahatiae Hamzao\u011flu.", "mime": "application/pdf"}, {"id": "abc-3564", "words": "8658", "extension": ".pdf", "flesch": "59", "author": "Ravanbakhsh, Mokarram; Babakhani, Babak; Ghasemnezhad, Mahmood; Serpooshan, Fariba; Biglouie, Mohamad Hassan", "title": "Acer velutinum Bioss. (velvet maple) seedlings are more tolerant to water deficit than Alnus subcordata C.A. Mey. (Caucasian alder) seedlings", "date": "2023", "keywords": "a. subcordata; a. velutinum; biomass; chl; content; drought; drought stress; et al; leaf; rwc; seedlings; species; stress; treatments; water", "summary": "SLA showed an increasing trend in A. velutinum under drought stress treatments. Farooq, M., Wahid, A., Kobayashi, N., Fujita, D., Basra, S. M. A., 2009: Plant drought stress: Effects, mechanisms and mana- gement.", "mime": "application/pdf"}, {"id": "abc-3576", "words": "4533", "extension": ".pdf", "flesch": "64", "author": "Bauer, Norbert; Verloove, Filip", "title": "The accelerated spread of a neophyte introduced to Europe long ago - First occurrence of Sporobolus indicus (Poaceae) in Hungary", "date": "2023", "keywords": "et al; europe; flora; france; hungary; indicus; s. indicus; species; sporobolus; spread", "summary": "with the exception of S. indicus (L.) R.Br. Although S. indicus is the oldest intro- duced Sporobolus species in Europe, the proliferating num- ber of new observations (Niketi\u0107 1998, Glasnovi\u0107 and Jogan 2009, Celesti-Grapow et al. 2010, Lauber et al. 2018, Peri\u0107 et al. 2013, Eichberger et al. 2015, Pachschw\u00f6ll et al. 2016, Amarell and Himpel 2020) testifies its accelerating spread.", "mime": "application/pdf"}, {"id": "abc-359", "words": "5067", "extension": ".pdf", "flesch": "67", "author": "Turkmen, Necattin; Duzenli, Atabay", "title": "Early post-fire changes of Pinus brutia forests in the Amanos Mountains (Turkey)", "date": "2011", "keywords": "area; brutia; fire; mediterranean; p g; pinus; post; soil; species; turkey; year", "summary": "Kuhn Hypolepidaceae Ge P G + + + + Rhus coriaria L. Anacardiaceae Ph P G \u2013 \u2013 \u2013 + Senecio vernalis Waldst. Rubiaceae Ch P VG \u2013 \u2013 + + Asplenium adiantum-nigrum L. Aspleniaceae H P G \u2013 \u2013 \u2013 + Brachypodium pinnatum (L.) P. Beauv.", "mime": "application/pdf"}, {"id": "abc-3619", "words": "6847", "extension": ".pdf", "flesch": "73", "author": "G\u00fcnayd\u0131n, Sinem; Aykurt, Candan", "title": "Taxonomic importance of leaf anatomical characters for the genus Alopecurus L. (Poaceae)", "date": "2023", "keywords": "adaxial; alopecurus; cells; characters; leaf; number; sclerenchyma; species", "summary": "Although numerous studies conducted on the morphology of the genus Alopecurus can be found (e.g., Do\u011fan 1997, 1999, Soreng et al. 2007, Boudko 2014), there are limited studies conducted on the importance of leaf an- atomical characters for Alopecurus species in the taxonomy of this genus. 3. Unweighted pair group method with arithmetic mean (UPGMA) dendrogram created according to the Gower similarity index by using anatomical character matrix of Alopecurus species studied (see Tab. 2).", "mime": "application/pdf"}, {"id": "abc-3634", "words": "6661", "extension": ".pdf", "flesch": "61", "author": "Ezer, T\u00fclay; Alata\u02dbs, Mevl\u00fct; Batan, Nevzat; Erata, H\u00fcseyin", "title": "The epiphytic bryophyte succession of Buxus sempervirens forests in F\u0131rt\u0131na Valley, Rize (North T\u00fcrkiye)", "date": "2023", "keywords": "boxwood; bryophyte; community; cortico; crispa; f\u0131rt\u0131na; life; middle; sempervirens; species; trees; valley; zones", "summary": "Epiphytic bryophyte communities The A1 community was named Exsertotheca crispa- Isothecium alopecuroides due to the frequency, constancy and, dominancy of these species within the lower-base community. Ezer, T., 2017: Epiphytic bryophyte communities and succession on Platanus orientalis trees in Kad\u0131nc\u0131k Valley (Mersin/Tur- key).", "mime": "application/pdf"}, {"id": "abc-3644", "words": "5559", "extension": ".pdf", "flesch": "56", "author": "Juan, Ana; Moreno, Joaqu\u00edn; Terrones, Alejandro", "title": "First record of alien naturalized populations of the crop Cucurbita moschata (Cucurbitaceae) in Spain, with remarks on typification status", "date": "2023", "keywords": "alien; area; cucurbita; flora; fruit; leaves; moschata; plant; populations; river; spain; species; vinalop\u00f3", "summary": "C. ficifolia C. maxima C. moschata C. pepo Habit Perennial Annual Annual Annual Leaves Lobed Not lobed/ shallowly lobed Not lobed/ shallowly lobed Shallowly to deeply lobed Segment leaves Rounded Rounded Acute Acute Indument With short glandular hairs Stiff-haired/ hispid Soft-haired Spiculate Sepals Linear, apex non- broadened Linear, apex non- broadened Linear or with apex often broadened like leaves Linear, apex non- broadened Seed color Dark brown to black Orange or white Tan to brown Pale tan Fruit peduncle Ribbed, moderately broadened at attachment Cylindrical, non- broadened at attachment Ribbed, at attachment widely broadened (flat) Ribbed, slightly, broadened at attachment JUAN A., MORENO J., TERRONES A. 30 ACTA BOT. Consequently, the presence of C. moschata populations along the basin of the River Vinalop\u00f3, and their subsequent propagation over the years, would be nowadays considered as autonomous and well established, and not directly bound to any current agri- cultural activity.", "mime": "application/pdf"}, {"id": "abc-3647", "words": "1969", "extension": ".pdf", "flesch": "63", "author": "Pantovi\u0107, Jovana; Grdovi\u0107, Svetlana; Sabovljevi\u0107, Marko", "title": "New bryophyte taxa for Bosnia and Herzegovina", "date": "2023", "keywords": "bosnia; bryophyte; herzegovina; leg; site", "summary": "Ellis, L.T, Alatas, M., Alvaro Alba, W.R, Charry Giraldo, A.M., Amatov, V., Batan, N., Becerra Infante, D.A, Burghardt, M., Czernyadjeva, I.V., Kuzmina, E.Y., Doroshina, G.Y., Erata, H., Garilleti, R., Gradstein, S.R., Jukoinene, I., Karaman Erkul, S., Keksin, A., Ezer, T., Lara, F., Draper, I., Maksimov, A.I., Mammandova, A.V., Natcheva, R., Nemeth, C., Pantovi\u0107, J., Sabovljevi\u0107, M. S., Papp, B., Poponessi, S., Cogoni, A., Porley, R.D., Reiner-Drehvald, M.E., Schafer- Verwimp, A., Schmotzer, A., Segota, V., Alegro, A., Rimac, A., Stefanut, S., Szurdoki, E., Vilk, E.F., Virchenko, V.M., Bijlsma, R.J., Callaghan, D.A., 2021b: New national and regional bryophyte records, 67. 82 (1), 80\u201382, 2023 CODEN: ABCRA 25 DOI: 10.37427/botcro-2022-026 ISSN 0365-0588 eISSN 1847-8476 Short communication New bryophyte taxa for Bosnia and Herzegovina Jovana P. Pantovi\u01071*, Svetlana N. Grdovi\u01072, Marko S. Sabovljevi\u01071,3 1 University of Belgrade, Faculty of Biology, Institute of Botany and Botanical Garden, Takovska 43, 11000 Belgrade, Serbia 2 University of Belgrade, Faculty of Veterinary Medicine, Bulevar oslobo\u0111enja 18, 11000 Belgrade, Serbia 3 Pavol Jozef \u0160af\u00e1rik University, Institute of Biology and Ecology, Faculty of Science Department of Botany, M\u00e1nesova 23, 040 01 Ko\u0161ice, Slovakia Abstract \u2013 Bosnia and Herzegovina has a long history of bryophyte flora research.", "mime": "application/pdf"}, {"id": "abc-3655", "words": "683", "extension": ".pdf", "flesch": "61", "author": "Jasprica, Nenad", "title": "The Thirty-ninth Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE) was held in Dubrovnik, Croatia (May 4-7, 2022)", "date": "2022", "keywords": "dubrovnik; meeting; vegetation", "summary": "81 (2), 2022 S11 Social news The Thirty-ninth Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE) was held in Dubrovnik, Croatia (May 4-7, 2022) Participants of the 39th Meeting of the Eastern Alpine and Dinaric Society for Vegetation Ecology (EADSVE), Dubrovnik, Croatia, May 4-7, 2022 during the botanical field excursion on the Pelje\u0161ac Peninsula (Photo: I. Brautovi\u0107).", "mime": "application/pdf"}, {"id": "abc-3656", "words": "8160", "extension": ".pdf", "flesch": "56", "author": "Stan\u010di\u0107, Zvjezdana; Fiket, \u017deljka", "title": "Pollination patterns of flora and vegetation in northern Croatia with reference to Apis mellifera", "date": "2023", "keywords": "croatia; flora; forest; habitat; honey; insect; modes; plant; plant species; pollination; pollinators; species; vegetation; wind", "summary": "Plant species useful for Apis mellifera The European honey bee plays a very important role in the pollination of plant species. Overall, 54% of plant species useful to European honey bees were found, 51% of which provide pollen and 47% nectar.", "mime": "application/pdf"}, {"id": "abc-3658", "words": "5990", "extension": ".pdf", "flesch": "63", "author": "Radi, Abeer A.; Salam, Hussein Kh.; Hamada, Afaf M.; Farghaly, Fatma A.", "title": "Effect of excess boron on growth, membrane stability, and functional groups of tomato seedlings: Boron toxicity and tomato seedling growth", "date": "2023", "keywords": "boron; cell; chl; cm\u20131; et al; growth; peak; plant; seedlings; tomato; toxicity", "summary": "However, EB levels raised the peak intensity of 825.45 cm\u20131 relative to control. 3A-C, the membrane damage was more severe as EB levels in the medium increased.", "mime": "application/pdf"}, {"id": "abc-3659", "words": "4651", "extension": ".pdf", "flesch": "58", "author": "Ma\u010dukanovi\u0107-Joci\u0107, Marina; Ste\u0161evi\u0107, Danijela; Ran\u010di\u0107, Dragana; \u0160undi\u0107, Miloje", "title": "Pollen morphology and flower visitors of Leiotulus aureus (Sm.) Pimenov & Ostr. (Apiaceae)", "date": "2023", "keywords": "apiaceae; aureus; bee; fig; grains; honey; plant; pollen; pollination; species; visitors", "summary": "According to this classification, pollen grains of L. aureus in the current study should fit into type 5. Unlike Zych (2006) who did not observe any honey bee on Heracleum sphondylium, L. aureus flowers were very frequently visited, which is in line with the findings of other authors who pointed out the importance of honey bees in pollinating umbellifers (Langenberger and Davis 2002b, Davila and Wardle 2002).", "mime": "application/pdf"}, {"id": "abc-372", "words": "2946", "extension": ".pdf", "flesch": "60", "author": "Srecec, Sinisa; Zechner Krpan, Vesna; Marag, Sanja; Spoljaric, Igor; Kvaternjak, Ivka; Mrsic, Goran", "title": "Morphogenesis, volume and number of hop (Humulus lupulus L.) glandular trichomes, and their influence alpha acids in fresh bracts of hop cones", "date": "2011", "keywords": "bracts; fig; hop; morphogenesis; peltate; phase; trichomes", "summary": "Volume of glandular trichome during the different phases of morphogenesis varied from 0.25 \u00b4 10\u20132 mm3 in phase 1, to 1.95 \u00b4 10\u20132 mm3 in phase 5. In this research, positive Spearman's rank order correla- tions were found between the average number of glandular trichomes and content of a-acids as well as between the average volume of glandular trichomes and content of a-acids.", "mime": "application/pdf"}, {"id": "abc-3746", "words": "6578", "extension": ".pdf", "flesch": "60", "author": "AYTAR, Erdi Can; \u00d6zdener K\u00f6mpe, Yasemin", "title": "Effect of different substrates on in vitro symbiotic seed germination for soilless production of Anacamptis laxiflora orchid", "date": "2023", "keywords": "et al; germination; laxiflora; leaves; medium; mom; orchid; seed; substrates; sucrose; vitro", "summary": "Against these threats, seedling production by in vitro and ex vitro symbiotic seed germination with compat- ible fungi seems to be a very favourable method for the propagation and reintroduction success of temperate or- chids (Aewsakul et al. 2013, Mutlu and K\u00f6mpe 2021, Deniz et al. 2022). Ex vitro symbiotic seed germination After determining that the most effective substrate for total germination and seedling growth in in vitro conditions was young hazelnut leaves, this substrate was also used in ex vitro germination medium.", "mime": "application/pdf"}, {"id": "abc-3747", "words": "7632", "extension": ".pdf", "flesch": "58", "author": "Nazari, Fatemeh; Hajiboland, Roghieh; Salehi-Lisar, Seyed-Yahya; Kahneh, Ehsan; Moradi, Aioub; Poschenrieder, Charlotte", "title": "Aluminum accumulation and tolerance in four Amaranthus species", "date": "2023", "keywords": "accumulation; amaranthus; biomass; concentrations; cruentus; et al; fig; growth; length; plants; retroflexus; root; species; tricolor", "summary": "Low and high Al treatment levels were applied in both short- and long-term experiments with a special emphasis on the root growth and morphology pa- rameters as indicators of plant Al response. Al accumulator species have primarily been found in the acidic soils of the humid tropics, which are covered by savannahs and tropical rain forests.", "mime": "application/pdf"}, {"id": "abc-3758", "words": "6903", "extension": ".pdf", "flesch": "67", "author": "Li, Yu-Jie; Guo, Ji-Shu; Ni, Hong-Ping; Huang, Ying-Yan; Kociolek, John Patrick; Li, Yan-Ling", "title": "Placoneis modaomensis sp. nov. (Bacillariophyta; Cymbellaceae), a new species from Guangdong Province, China", "date": "2023", "keywords": "areolae; bertalot; china; diatom; et al; lange; placoneis; raphe; species", "summary": "Placoneis species are prevalent in freshwater bodies, in- cluding alkaline waters, mesotrophic and oligotrophic con- ditions (Cox 1987, Fujita and Ohtsuka 2005, Bruder and Medlin 2007, Kezlya et al. 2021). Keywords: diatoms, morphology, new species, Placoneis, taxonomy Introduction The genus Placoneis Mereschkowsky was erected by Mereschkowsky in 1903 for a group of species showing a single chloroplast with a central bridge and lateral lobes (Mereschkowsky 1903).", "mime": "application/pdf"}, {"id": "abc-3761", "words": "5458", "extension": ".pdf", "flesch": "66", "author": "\u00d6zt\u00fcrk, Sevilay; Kurt, Oguz", "title": "The taxonomy and distribution of algae in the thermal springs of T\u00fcrkiye", "date": "2024", "keywords": "algae; anagnostidis; chemical; flora; kom\u00e1rek; springs; taxa", "summary": "However, they can survive in deserts, moist soils and stones, thermal springs, snow at the poles, and in all condi- tions with very little moisture. Thermal springs, in particu- lar, are extreme ecosystems for algae.", "mime": "application/pdf"}, {"id": "abc-3762", "words": "1003", "extension": ".pdf", "flesch": "62", "author": "Arag\u00f3n, Gregorio; Mart\u00ednez, Isabel", "title": "First record of Diplotomma cedricola in the eastern Mediterranean ", "date": "2023", "keywords": "cedricola; diplotomma; species; werner", "summary": "This lichen species was found near I\u00e9rapreta on decorticated Cupressus sempervirens L. and Pinus brutia Ten. A \u2013 Decorticated trunk of Cupressus sempervirens L., 1174 m a.s.l., Crete, is a typical habitat of Diplotomma cedricola (Werner) Etayo.", "mime": "application/pdf"}, {"id": "abc-3769", "words": "1669", "extension": ".pdf", "flesch": "50", "author": "Jasprica, Nenad; Terzi, Massimo", "title": "The new association Pimpinello lithophilae-Centaureetum lovricii (Crithmo-Staticetea) from the island of Vis (southern Croatia)", "date": "2023", "keywords": "association; bogdanovi\u0107; centaurea; lovricii; pimpinello", "summary": "Many of them inhabit halophytic and chasmophytic coastal and subcoastal habitats within rare plant communities (Terzi et al. 2020). Although \u0160kvorc et al. (2017) were the first to recognize the occurrence of the Helichrysetalia italici in Croatia, this order was widely described and documented for the first time for the eastern Adriatic by Terzi et al. (2020).", "mime": "application/pdf"}, {"id": "abc-3774", "words": "5598", "extension": ".pdf", "flesch": "57", "author": "Bilonozhko, Yuliia; Krupodorova, Tetjana; Rabokon, Anastasiia; Postovoitova, Anastasiia; Kalafat, Lubov; Pirko, Yaroslav; Blume, Yaroslav", "title": "In vitro cultivation and biocontrol potential of Botryosphaeria visci against European mistletoe (Viscum album L.)", "date": "2023", "keywords": "album; b. visci; et al; fungus; growth; media; mistletoe; varga; visci; viscum", "summary": "To our knowledge, this is the first time that SDA and SDB media have been used for the isolation and cultivation of B. visci, and that the effect of different liquid media on B. visci growth has been evaluated by mycelial dry weight. The morphology of the vegetative mycelium and growth of B. visci varied depending on the media used.", "mime": "application/pdf"}, {"id": "abc-3775", "words": "2569", "extension": ".pdf", "flesch": "57", "author": "Sramk\u00f3, G\u00e1bor; Tak\u00e1cs, Attila; Moln\u00e1r V., Attila; Popiela, Agnieszka; Luk\u00e1cs, Bal\u00e1zs Andr\u00e1s", "title": "Data on species plasticity and stable characters have an overall importance in identification keys: comments on Brullo et al. (2022) article", "date": "2023", "keywords": "brullo; elatine; et al", "summary": "If Brullo et al. (2022) were to consider the role of seed morphological characters in the genus and take into account the numerous publica- tions that discuss the plastic nature of vegetative and floral characters (Moln\u00e1r et al. 2014, 2015, Sramk\u00f3 et al. 2016, Tak\u00e1cs et al. 2017, \u0141ysko et al. 2022) as well as the phyloge- netic results (Sramk\u00f3 et al. 2016, Razifard et al. 2017) in greater detail, they might find it easier to accept the pres- ence of E. gussonei in Sicily and other Mediterranean areas. Given our findings, along with the previous reports by Sramk\u00f3 et al. (2016) and Tak\u00e1cs et al. (2017), which were also cited by Brullo et al. (2022), it is possible that hybridisation in this genus may be more com- mon than accepted.", "mime": "application/pdf"}, {"id": "abc-3781", "words": "4005", "extension": ".pdf", "flesch": "76", "author": "Hamzao\u011flu, Ergin", "title": "Astragalus nallihanicus (sect. Caprini, Fabaceae), a new species from T\u00fcrkiye", "date": "2024", "keywords": "a.s.l; astragalus; claw; fig; glabrous; hairy; new; species; t\u00fcrkiye", "summary": "mm long, blade 11\u221213 mm long, auricle c. 1 mm long, blade 8\u221215 mm long, auricle 2.5\u22123 mm long,", "mime": "application/pdf"}, {"id": "abc-3785", "words": "2540", "extension": ".pdf", "flesch": "54", "author": "Jelin\u010di\u0107, Antun; Per\u010din, Aleksandra; Zgorelec, \u017deljka; Papkovi\u0107, Dora", "title": "Local-scale changes in plant community composition following succession of oak-hornbeam forest after grassland abandonment", "date": "2023", "keywords": "area; forest; hay; sanguinea; species; stage; study; succession; vegetation", "summary": "The approximately estimated age of the stud- ied successional stages following hay-pasture abandonment was as follows: successional grasslands (2\u20135 years), shrub stages (5\u201315 years), Populus tremula L. stage (15\u201330 years), and oak-hornbeam stage (> 30 years). 2. Non-metric multidimensional scaling ordination (NMDS) of successional stages based on community composition differences obtained by Bray-Curtis dissimilarities.", "mime": "application/pdf"}, {"id": "abc-3796", "words": "11084", "extension": ".pdf", "flesch": "52", "author": "Pavokovi\u0107, Dubravko; Horvati\u0107, Anita; Tomljanovi\u0107, Ingrid; Balen, Biljana; Krsnik-Rasol, Marijana", "title": "Sugar beet cells\u2019 cellular and extracellular events taking place in response to drought and salinity", "date": "2023", "keywords": "acta; analysis; beet; cell; drought; et al; expression; fig; https://doi; ions; mannitol; nacl; plant; proteins; response; salt; salt stress; stress; sugar", "summary": "Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. We applied a proteomic approach to analyze and com- pare the effect of salt and mannitol on the expression profile of sugar beet proteins.", "mime": "application/pdf"}, {"id": "abc-380", "words": "3438", "extension": ".pdf", "flesch": "60", "author": "Shah, Shoukat Hussain", "title": "Comparative effects of 4-Cl-IAA and kinetin on photosynthesis, nitrogen metabolism and yield of black cumin (Nigella sativa L.)", "date": "2011", "keywords": "10\u20136; activity; control; iaa; kinetin; physiology; plants; treatment", "summary": "Biochemistry and physiology of plants hormones. Control plants were sprayed with double distilled water only.", "mime": "application/pdf"}, {"id": "abc-3801", "words": "2701", "extension": ".pdf", "flesch": "61", "author": "Teofilovski, Aco", "title": "A new subspecies of Cephalaria pastricensis D\u00f6rfl. & Hayek (Dipsacaceae) from North Macedonia", "date": "2023", "keywords": "cephalaria; macedonia; north; pastricensis; pastricensis subsp; subsp; teofilovski", "summary": "They represent the southernmost points in the dis- tributional range of C. pastricensis s.l., situated significant- ly closer to the localities of C. pastricensis subsp. These characteristics are rather uniform in the recorded populations, with none of the col- lected individuals or ca 30 examined in the field matching or approaching C. pastricensis subsp.", "mime": "application/pdf"}, {"id": "abc-3806", "words": "6148", "extension": ".pdf", "flesch": "64", "author": "Mohamed, Ibrahim Abd el-wahab; Hassan, Mona; Aboulela, Mostafa", "title": "New hosts and diagnostic characteristics of Orobanche crenata (Orobanchaceae) in Egypt", "date": "2024", "keywords": "broomrape; corolla; crenata; et al; fig; majus; o. crenata; orobanche; plants; species", "summary": "In this regard and to help to identify O. crenata plants accurately, we record information on its parasitism on seven new host plant species (Ammi majus, Arctotis fastuosa, Callistephus chinensis, Carthamus tinctorius, Lactuca serriola, Melilotus indicus, and Tropaeolum majus L.), and provide a full description of morphological characteristics diagnostic to the species, supported by vouchers and images for verification. Results of our study on the vegetative and reproductive parts of O. crenata plants infecting the seven plant species were, in general, consistent with previ- ous reports.", "mime": "application/pdf"}, {"id": "abc-3811", "words": "1956", "extension": ".pdf", "flesch": "57", "author": "Paskovi\u0107, Nika; Dup\u010di\u0107-Radi\u0107, Iris", "title": "First record of the dinoflagellate Tripos rotundatus in the Adriatic Sea", "date": "2023", "keywords": "adriatic; g\u00f3mez; phytoplankton; rotundatus; sea; species; tripos", "summary": "Materials and methods Sampling was conducted on July 17, 2021 at the Lokrum coastal station, near Dubrovnik (southern Adriatic Sea, 42\u00b037\u201921\u201d N, 18\u00b006\u201905\u201dE) (Fig. 1). Dinoflagellate species Tripos digitatus (Sch\u00fctt) G\u00f3mez (A, B)", "mime": "application/pdf"}, {"id": "abc-3831", "words": "9855", "extension": ".pdf", "flesch": "58", "author": "Vidakovi\u0107, Antonio; \u0160atovi\u0107, Zlatko; Tumpa, Katarina; Id\u017eojti\u0107, Marilena; Bari\u0161i\u0107, Andrija; Poljak, Igor", "title": "Secondary sexual dimorphism and morphological diversity in two allopatric juniper species: Juniperus oxycedrus and J. deltoides", "date": "2024", "keywords": "cone; deltoides; et al; juniperus; needle; needle length; needle traits; oxycedrus; population; sex; species; taxon; traits", "summary": "https://doi.org/10.1007/s10021-008-9135-2 Midgley, J. J., 2010: Causes of secondary sexual differences in plants \u2014 Evidence from extreme leaf dimorphism in Leucadendron (Proteaceae). https://doi. org/10.1111/j.1654-1103.2011.01269.x Sanchez-Salguero, R., Camarero, J. J., 2020:", "mime": "application/pdf"}, {"id": "abc-3842", "words": "7078", "extension": ".pdf", "flesch": "60", "author": "Esim, Nevzat; Karaman, Aykut; At\u0131c\u0131, Okkes", "title": "Nitric oxide alleviates mercury toxicity by changing physiological and biochemical pathways in maize (Zea mays L.) seedlings", "date": "2024", "keywords": "antioxidant; content; control; maize; oxide; plant; seedlings; snp; stress; toxicity", "summary": "Con- versely, exposure to Hg increased H2O2 content by 44% and the O2 .\u2013 content by 8% compared to the control (Tab. 3). Hg-treated plants.", "mime": "application/pdf"}, {"id": "abc-3843", "words": "6394", "extension": ".pdf", "flesch": "63", "author": "Ak\u00e7in, \u00d6znur Ergen; \u00d6ZBUCAK, Tu\u011fba; \u00d6ZT\u00dcRK, \u015e\u00fckran; Uzun\u00f6mero\u011flu, H\u00fcseyin \u00dcmit", "title": "The anatomy, micromorphology, and essential oils of the Turkish endemic and endangered species Alchemilla orduensis", "date": "2025", "keywords": "alchemilla; cells; epidermis; et al; leaf; leaves; orduensis; parenchyma; parts; petiole; species; stem; surface", "summary": "Scripta Scientifica Pharma- ceutica 5, 22\u201333. Dubel, N., Grytsyk, L., Kovaleva, A., Grytsyk, A., K\u043eshovyi, \u041e., 2022: Research in components of essential oils from flowers and leaves of the genus Alchemilla L. species. https://doi. org/10.1051/dst/2010035 Grytsyk, L. M., Tuchak, N. I., Grytsyk, A. R., Melnyk, M. V., Shumska, N. V., 2019: \u041c\u043e\u0440\u0444\u043e\u043b\u043e\u0433\u043e-\u0430\u043d\u0430\u0442\u043e\u043c\u0456\u0447\u043d\u0435 \u0434\u043e\u0441\u043b\u0456\u0434\u0436\u0435\u043d\u043d\u044f \u0432\u0438\u0434\u0456\u0432 \u043f\u0440\u0438\u0432\u043e\u0440\u043e\u0442\u043d\u044f, \u0429\u043e \u0437\u0440\u043e\u0441\u0442\u0430\u044e\u0442\u044c \u0432 \u0437\u0430\u0445\u0456\u0434\u043d\u043e\u043c\u0443 \u0440\u0435\u0433\u0456\u043e\u043d\u0456 (Morpho anatomical investigation of Alchemilla L. species of western region of Ukraine).", "mime": "application/pdf"}, {"id": "abc-3850", "words": "2814", "extension": ".pdf", "flesch": "53", "author": "Iamonico, Duilio; Nicolella, Gianluca", "title": "First record of the woody Melaleuca williamsii s.l. (Myrtaceae) out of its native range", "date": "2024", "keywords": "craven; melaleuca; plants; species; williamsii", "summary": "Wilson, P. G., O\u2019Brien, M. M., Heslewood, M. M., Quinn, C. J., 2005: Relationships within Myrtaceae sensu lato based on a matK phylogeny. https://doi.org/10.7320/FlMedit28.145 Gallardo, B., Bacher, S., Bradley, B., Com\u00edn, F. A., Gallien, L., Je- schke, J. M., Sorte, C. J. B., Vil\u00e0, M., 2019: InvasiBES: under- standing and managing the impacts of Invasive alien species on biodiversity and ecosystem services.", "mime": "application/pdf"}, {"id": "abc-3869", "words": "1778", "extension": ".pdf", "flesch": "58", "author": "Romanov, Roman E.; Dragi\u0107evi\u0107, Sne\u017eana; Troia, Angelo", "title": "Iso\u00ebtes gymnocarpa and Utricularia \u00d7 neglecta \u2013 new taxa for Montenegro", "date": "2024", "keywords": "flora; gymnocarpa; iso\u00ebtes; montenegro; species; troia", "summary": "Assessing the influence of environmental parameters on aquatic plants of ponds in the hinterland of Long Beach in Montenegro. 83 (2), 176-178, 2024 CODEN: ABCRA 25 DOI 10.37427/botcro-2024-011 ISSN 0365-0588 eISSN 1847-8476 Short communication Iso\u00ebtes gymnocarpa and Utricularia \u00d7 neglecta \u2013 new taxa for Montenegro Roman E. Romanov1*, Sne\u017eana Dragi\u0107evi\u01072, Angelo Troia3 1 Komarov Botanical Institute of the Russian Academy of Sciences, Professora Popova 2, 197022 St. Petersburg, Russia 2 Montenegrin Academy of Sciences and Arts, Rista Stijovi\u0107a 5, 81000 Podgorica, Montenegro 3 Dipartimento STEBICEF, Universit\u00e0 degli Studi di Palermo, via Archirafi 38, 90123 Palermo, Italy Abstract \u2013 One lycophyte genus and species (Iso\u00ebtes gymnocarpa), and one aquatic magnoliophyte species (Utricularia \u00d7 neglecta) new for the flora of Montenegro are reported.", "mime": "application/pdf"}, {"id": "abc-3870", "words": "8936", "extension": ".pdf", "flesch": "55", "author": "Vyas, Anjali; Kataria, Sunita; Prajapati, Rajkumar; Jain, Meeta", "title": "Mitigation of cadmium toxicity stress by magnetopriming during germination of soybean", "date": "2024", "keywords": "cadmium; cdcl2; et al; germination; growth; seedlings; seeds; soybean; soybean seedlings; stress; toxicity; unprimed", "summary": "Soybean seeds were magnetoprimed with static magnetic field (SMF) strength of 200 mT for 1 hour before germination. Based on previous studies, soybean seeds were treated with 200 mT of SMF for an hour (Kataria et al. 2020).", "mime": "application/pdf"}, {"id": "abc-3876", "words": "6940", "extension": ".pdf", "flesch": "51", "author": "Gueridi, Sabrina; Boucelha, Lilya; Abrous-Belbachir, Ouzna; Djebbar, R\u00e9da", "title": "Effects of hormopriming and pretreatment with gibberellic acid on fenugreek (Trigonella foenum-graecum L.) seed germination", "date": "2024", "keywords": "acid; activity; antioxidant; control; et al; fenugreek; germination; gibberellic; hormopriming; hydropriming; imbibition; plant; radicles; ros; seed; treatments", "summary": "Our study highlights the role of priming and im- bibition in improving seed germination. Keywords: hormopriming, germination, gibberellic acid, radicle, reactive oxygen species, Trigonella foenum- graecum Introduction Plant production and productivity are strongly deter- mined by seed germination, which is a critical step in the life cycle of higher plants (Cheng and Bradford 1999).", "mime": "application/pdf"}, {"id": "abc-3918", "words": "6574", "extension": ".pdf", "flesch": "60", "author": "Temel, Aslihan; K\u00f6sesakal, Taylan", "title": "Effects of acetic acid treatment on growth and pigment contents in barley", "date": "2024", "keywords": "aa treatment; acid; concentrations; content; day; effects; et al; plants; stress; treatment", "summary": "Because AA is a precursor of acetyl-CoA, an essential molecule of carbohydrate metabolism, we decided to inves- tigate how AA treatment affects sugar contents in roots. In conclusion, even at low concentrations, AA treatment can induce dramatic and persistent changes in non-stressed plants that endure even after AA is removed.", "mime": "application/pdf"}, {"id": "abc-3921", "words": "6231", "extension": ".pdf", "flesch": "67", "author": "Taia, Wafaa Kamal; Hamdy, Rim Samir; Abd El-Maged, Amany Mohamed", "title": "Morpho-palynological assessment of the genus Terminalia L. (Combretaceae) in Egypt", "date": "2024", "keywords": "exine; ornamentation; pollen; shape; species; terminalia", "summary": "83 (2), 2024 dimorphic species were represented by T. bellirica, T. brownii, T. chebula, T. laxiflora, T. myriocarpa and T. sericea; indi- cating that they have two distinct pollen shapes, sizes, apertures, and even exine ornamentation within the pollen grains that are gathered from the same flower. In the equatorial view, they were spheroidal (T. bellirica, T. bentzoe, T. chebula, T. mantaly and T. sericea), subprolate (T. arjuna, T. bellirica, T. brownii, T. chebula, T. laxiflora, T. muelleri, T. myriocarpa and T. sericea) and prolate (T. brownii, T. catappa, T. laxiflora and T. myriocarpa).", "mime": "application/pdf"}, {"id": "abc-3932", "words": "11518", "extension": ".pdf", "flesch": "61", "author": "Terzi, Massimo; Jasprica, Nenad", "title": "Changes in grassland vegetation on the island of Plavnik (Croatia) over 100 years", "date": "2024", "keywords": "acta; bulbosae; croatia; festuco; grylli; helichrysetum; horvati\u0107; island; italici; lat; officinalis; plant; plavnik; rel; relev\u00e9s; species; taxa; terzi; valesiacae; vegetation", "summary": "The specific vulnerability of plant biodiversity and vegetation on Mediterranean islands in the face of glob- al change. 83 (2), 119-134, 2024 CODEN: ABCRA 25 DOI 10.37427/botcro-2024-014 ISSN 0365-0588 eISSN 1847-8476 Changes in grassland vegetation on the island of Plavnik (Croatia) over 100 years Massimo Terzi1*, Nenad Jasprica2 1 Institute of Bioscience and Bioresources (IBBR), National Council of Research (CNR), via Amendola 165/A, IT-70126, Bari, Italy 2 University of Dubrovnik, Institute for Marine and Coastal Research, Kneza Damjana Jude 12, HR-20000 Dubrovnik, Croatia Abstract \u2013 The changes in the grassland vegetation that have occurred over the last almost 100 years on the northeastern Adriatic island of Plavnik (Croatia) were studied.", "mime": "application/pdf"}, {"id": "abc-3940", "words": "4138", "extension": ".pdf", "flesch": "58", "author": "Yilmaz \u00c7itak, Burcu", "title": "Does palynotaxonomy contribute to the systematics of the genus? The section Multicaulia of the genus Hedysarum (Fabaceae) example in T\u00fcrkiye", "date": "2024", "keywords": "genus; hedysarum; multicaulia; pollen; species; subsp; taxa; varium", "summary": "The section Multicaulia of the genus Hedysarum (Fabaceae) example in T\u00fcrkiye Burcu Yilmaz \u00c7itak University of Sel\u00e7uk, Faculty of Science, Department of Biology, 42130 Konya, T\u00fcrkiye Abstract \u2013 The purpose of the current work was to assess the systematic and taxonomic significance of the pollen morphological characteristics of the Multicaulia section of Hedysarum species found throughout T\u00fcrkiye using scanning electron microscopy (SEM) and light microscopy (LM) techniques. Additionally, the micro- morphological (pollen, fruit, and seed) characteristics can contribute to the discrimination of Hedysarum species, es- pecially the pollen grains and muri size.", "mime": "application/pdf"}, {"id": "abc-3957", "words": "5159", "extension": ".pdf", "flesch": "67", "author": "Zhao, Yi-Han; Guo, Ji-Shu; Tang, Zheng-Bin; Zhang, Yun; Huang, Shao-Feng; Kociolek, John Patrick; Li, Yan-Ling", "title": "Cymbella stomachsis sp. nov. (Bacillariophyta; Cymbellaceae), a new species from Guangdong Province, China", "date": "2025", "keywords": "china; cymbella; diatom; ends; et al; fig; province; species; stomachsis; valve", "summary": "nov. (Bacillariophyta; Cymbellaceae), a new species from Guangdong Province, China Yi-Han Zhao1, Ji-Shu Guo1, Zheng-Bin Tang1, Yun Zhang2, Shao-Feng Huang3*, John Patrick Kociolek4, Yan-Ling Li1* 1 Yunnan University, School of Ecology and Environmental Science, Institute for Ecological, Research and Pollution Control of Plateau Lakes, Kunming 650500, P. R. China 2 Hubei Normal University, College of Life Sciences, Huangshi 435002, P. R. China 3 Center for Ecology and Environment Monitoring and Research, Administration for Pearl River, Basin-South China Sea Ecology and Environment, Ministry of Ecology and Environment, Guangzhou 510611, P. R. China 4 University of Colorado, Museum of Natural History and Department of Ecology and Evolutionary Biology, Boulder, Colorado-80309, USA Abstract \u2013 A new diatom species from the genus Cymbella C. Agardh is described from samples collected during a survey of freshwater diatoms from Modaomen Channel, Guangdong Province, China. Keywords: China, Cymbellaceae, diatom, morphology, Pearl River, taxonomy Introduction The diatom genus Cymbella C. Agardh was established almost 200 years ago (Agardh 1830), with C. cymbiformis C. Agardh (1830) chosen later as the type species of the ge- nus (H\u00e5kansson and Ross 1984).", "mime": "application/pdf"}, {"id": "abc-3969", "words": "10107", "extension": ".pdf", "flesch": "57", "author": "Karamzehi, Ramazan; Einali, Alireza", "title": "Trehalose-induced metabolic responses in basil (Ocimum basilicum) seedlings under salt treatment", "date": "2024", "keywords": "accumulation; activity; basil; chl; content; et al; growth; plant; proline; salinity; salt; seedlings; stress; sugars; tolerance; total; tre; treatment; trehalose", "summary": "References Abdallah, M. M. S., El Sebai, T. N., Ramadan, A. A. E. M., El-Bassiouny, H. M. S., 2020: Physiological and biochemical role of proline, trehalose, and compost on enhancing salinity tolerance of quinoa plant. 2.26 \u00b1 0.43e 78.35 \u00b1 4.49cd 25 -Tre 1.99 \u00b1 0.31ab 0.31 \u00b1 0.03b 0.52 \u00b1 0.01b 0.10 \u00b1 0.01b 3.83 \u00b1 0.62bc 3.21 \u00b1 0.21d 73.41 \u00b1 4.20d +Tre 1.12 \u00b1 0.25c 0.26 \u00b1 0.04bc 0.25 \u00b1 0.05de 0.06 \u00b1 0.01c 4.61 \u00b1 0.91b 4.66 \u00b1 0.82b 77.67 \u00b1 4.90cd 50 -Tre 2.29 \u00b1 0.31a 0.32 \u00b1 0.02b 0.43 \u00b1 0.06c 0.12 \u00b1 0.01a 5.29 \u00b1 0.09b 2.74 \u00b1 0.30e 81.09 \u00b1 0.31c +Tre 1.64 \u00b1 0.14b 0.16 \u00b1 0.03de 0.27 \u00b1 0.03d 0.06 \u00b1 0.02c 6.19 \u00b1 0.79b 2.80 \u00b1 0.55e 83.65 \u00b1 2.26c 100 -Tre 1.71 \u00b1 0.21b 0.24 \u00b1 0.04c 0.41 \u00b1 0.08c 0.09 \u00b1 0.01b 4.28 \u00b1 0.91c 2.52 \u00b1 0.28e 76.00 \u00b1 4.75cd +Tre 1.38 \u00b1 0.15b 0.29 \u00b1 0.05bc 0.23 \u00b1 0.02e 0.06 \u00b1 0.00c 6.03 \u00b1 0.60b 4.79 \u00b1 0.94b 83.31 \u00b1 1.57bc 150 -Tre 1.10 \u00b1 0.04c 0.13 \u00b1 0.02e 0.30 \u00b1 0.01d 0.07 \u00b1 0.01c 3.73 \u00b1 0.20c 1.84 \u00b1 0.02f 73.13 \u00b1 1.41d +Tre 1.01 \u00b1 0.04c 0.08 \u00b1 0.01f 0.11 \u00b1 0.02f 0.02 \u00b1 0.00d 9.56 \u00b1 0.96a 3.86 \u00b1 0.39c 89.47 \u00b1 1.11a Fig.", "mime": "application/pdf"}, {"id": "abc-397", "words": "2455", "extension": ".pdf", "flesch": "69", "author": "Bogdanovic, Sandro; Ruscic, Mirko", "title": "Pimpinella tragium Vill. subsp. lithophila (Schischk.) Tutin (Apiaceae), a new taxon in Croatian flora", "date": "2011", "keywords": "flora; island; lithophila; pimpinella; subsp; tragium; tutin", "summary": "titanophila) of this group under the name of P. tragium, while suggesting treating P. tragium subsp. Some authors (TUTIN 1968 a, b; MATTHEWS 1972; ENGSTRAND 1987; BRULLO and BRULLO 2009) distinguish several subspecies within this group: P. tragium subsp.", "mime": "application/pdf"}, {"id": "abc-3977", "words": "7132", "extension": ".pdf", "flesch": "49", "author": "Bahadornejad Velashedi, Razieh; Kelij, Sedigheh; Jafari, Naser", "title": "Overcoming seed dormancy and improving germination of Convolvulus persicus, an endangered coastal plant in north of Iran", "date": "2025", "keywords": "baskin; dormancy; ga3; germination; percentage; persicus; sari; scarification; seed; stratification; treatments", "summary": "The next critical step in identifying seed dormancy is to assess seed germination across varying temperature condi- tions (Baskin and Baskin 1998). 2. Effect of temperature on seed germination of Convolvulus persicus from two localities in the Mazandaran province of Iran.", "mime": "application/pdf"}, {"id": "abc-3980", "words": "7227", "extension": ".pdf", "flesch": "62", "author": "Nour, Iman H.; Osman, Ahmed K.; Hamdy, Rim S.; El Garf, Ibrahim A.", "title": "Seed morphological diversity of Egyptian Allium L. (Amaryllidaceae) and its taxonomic significance", "date": "2025", "keywords": "a. sect; allium; area; cell; fig; length; seed; species; taxa; traits; undulation; wall", "summary": "tourneuxii; and A. trifoliatum of A. sect. The taxonomic significance of the quantitative and qualitative traits of Allium seeds has been studied.", "mime": "application/pdf"}, {"id": "abc-3981", "words": "3751", "extension": ".pdf", "flesch": "56", "author": "Terzi, Massimo; Jasprica, Nenad; \u010carni, Andra\u017e; Matevski, Vlado; Bergmeier, Erwin; Theurillat, Jean-Paul", "title": "Nomenclature of the Balkan alliance Romuleion graecae (Poetea bulbosae)", "date": "2024", "keywords": "alliance; bulbosae; et al; oberdorfer; poetum; romuleion; timoleontis; \u010darni", "summary": "A second association, Romuleo graecae-Poetum bulbo- sae, was also validly published by \u010carni et al. (2014) and classified in the Romuleion. Two relev\u00e9s containing Poa bulbosa together with Stipa capensis (= S. tortilis) were published by \u010carni et al. (2014) among the relev\u00e9s of the Romuleo graecae-Poetum bulbosae (relev\u00e9s 14 and 20, Table 1).", "mime": "application/pdf"}, {"id": "abc-4001", "words": "3275", "extension": ".pdf", "flesch": "62", "author": "Bauer, Norbert; Csiky, J\u00e1nos; Mesterh\u00e1zy, Attila; Wolf, M\u00e1ty\u00e1s; Schmidt, D\u00e1vid", "title": "Rapid spread of the Mediterranean glycophyte Catapodium rigidum in Hungary", "date": "2025", "keywords": "catapodium; flora; hungary; rigidum; road; schmidt; species", "summary": "https://doi.org/10.1111/jvs.13168 Tutin, T. G., Heywood, V. H., Burges, N. A., Moore, D. M., Val- entine, D. H., Walters, S. M., Webb, D. A. (eds.), 1980: Flora Europaea. https://doi.org/10.1080/15324982.2018.1427640 Tich\u00fd, L., Axmanov\u00e1, I., Dengler, J., Guarino, R., Jansen, F., Mi- dolo, G., Nobis, M. P., van Meerbeek, K., A\u0107i\u0107, S., Attorre, F., Bergmeier, E., Biurrun, I., Bonari, G., Bruelheide, H., Cam- pos, J. A., \u010carni, A., Chiarucci, A., \u0106uk, M., \u0106u\u0161terevska, M., Didukh, Y., D\u00edt\u011b, D., D\u00edt\u011b, Z., Dziuba, T., Fanelli, G., Fern\u00e1n- dez-Pascual, E., Garbolino, E., Gavil\u00e1n, R. G., G\u00e9gout, J.-C., Graf, U., G\u00fcler, B., H\u00e1jek, M., Hennekens, S. M., Jandt, U., Ja\u0161kov\u00e1, A., Jim\u00e9nez-Alfaro, B., Julve, P., Kambach, S., Karg- er, D. N., Karrer, G., Kavgac\u0131, A., Knollov\u00e1, I., Kuzemko, A., K\u00fczmi\u010d, F., Landucci, F., Lengyel, A., Lenoir, J., Marcen\u00f2, C.,", "mime": "application/pdf"}, {"id": "abc-4002", "words": "2265", "extension": ".pdf", "flesch": "65", "author": "Koopman, Jacob; Wi\u0119c\u0142aw, Helena; Bogdanovic, Sandro; Denchev, Teodor T.", "title": "Carex distachya (Cyperaceae) with both subspecies in Europe", "date": "2025", "keywords": "carex; distachya; distachya var; material; nilsson; phyllostachioidea; var", "summary": "distachya and C. distachya var. phyllostachioidea \u00d6.Nilsson. As C. distachya var.", "mime": "application/pdf"}, {"id": "abc-4003", "words": "9244", "extension": ".pdf", "flesch": "50", "author": "Sezgin Muslu, Asiye; Altunta\u015f, Cansu; Altansambar, Namuun; Demiralay, Mehmet; Kad\u0131o\u011flu, Asim", "title": "Combined application of rutin and silicon sustains maize seedlings osmotic stress tolerance by improving photosynthetic capacity and chlorophyll metabolism", "date": "2025", "keywords": "activity; application; chlase; chlorophyll; et al; expression; maize; peg; plant; rubisco; rut; rut+si; rutin; seedlings; silicon; stress", "summary": "https://doi. org/10.1621/nrs.01012 Bradford, M. M., 1976: A rapid and sensitive method for the quan- titation of microgram quantities of protein utilizing the prin- ciple of protein\u2013dye binding. https://doi. org/10.1023/A:1023064328384 Chaves, M. M., Maroco, J. P., Pereira, J. S., 2003:", "mime": "application/pdf"}, {"id": "abc-4008", "words": "8393", "extension": ".pdf", "flesch": "54", "author": "Vidakovi\u0107, Antonio; Matija\u0161evi\u0107, Sandi; Tumpa, Katarina; Poljak, Igor", "title": "Leaf phenotypic plasticity of European ash (Fraxinus excelsior) at its northern range in Dinaric Alps", "date": "2025", "keywords": "ash; european; excelsior; fraxinus; la1; leaflet; length; populations; species; terminal; traits; variability", "summary": "However, this research revealed no influ- ence of geographical or bioclimatic distances on morphological variability, which indicates that the rockiness and soil are most likely two predominant factors in shaping the phenotypic plasticity of European ash populations. The K-means method was applied to detect phenotypic structure and define the number of K-groups that best explained the morphological variation of European ash populations.", "mime": "application/pdf"}, {"id": "abc-4013", "words": "6583", "extension": ".pdf", "flesch": "51", "author": "Kartal, Ciler", "title": "Reproductive biology of Centaurea kilaea (Asteraceae, Cardueae) \u2013 an endemic species from T\u00fcrkiye", "date": "2025", "keywords": "asteraceae; cells; centaurea; development; embryo; et al; fig; kilaea; pollen; stage; tapetum; wall", "summary": "In the tetrad stage, tapetum cells react weakly to PAS. However, contrary to the oth- er wall layers, the cytoplasm of tapetum cells becomes rich in protein content starting from the tetrad stage (Fig. 3D).", "mime": "application/pdf"}, {"id": "abc-4022", "words": "7027", "extension": ".pdf", "flesch": "52", "author": "Yan\u0131k, Fatma; Vardar, Filiz", "title": "Indications of programmed cell death in wheat roots upon exposure to silver nanoparticles", "date": "2025", "keywords": "activity; agnps; cell; control; death; dna; et al; expression; l\u20131; mg l\u20131; pcd; plant; roots; silver; wheat", "summary": "This study is the first to examine AgNP- induced PCD in wheat root cells. 2. Nucleus morphology in control wheat root cells (a) and after 15 days of exposure to 0.5 (b), 1 (c), 5 (d), 10 (e), and 20 mg L\u20131 of AgNPs (f).", "mime": "application/pdf"}, {"id": "abc-4026", "words": "8084", "extension": ".pdf", "flesch": "57", "author": "Vojta, Lea; Fulgosi, Hrvoje; Toma\u0161i\u0107 Pai\u0107, Ana; Duman\u010di\u0107, Ena", "title": "Construction of the Arabidopsis isogenic lines containing dually localized protein TROL only in the inner chloroplast envelope membrane", "date": "2025", "keywords": "anti; arabidopsis; chloroplast; envelope; fig; lines; membrane; plants; pretrol; protein; thylakoid; trol; vojta", "summary": "Arabidopsis thaliana (L.) ecotype Columbia (Col-0) plants, or wild-type (WT); TROL knock-out plants (KO), that do not accumulate protein TROL due to the T-DNA insertion into the gene At4g01050 (SAIL_27_B04, obtained from NASC) The phenotype of Arabidopsis plants that contain protein TROL only in the inner envelope membrane of chloroplasts (TROL-IE plants).", "mime": "application/pdf"}, {"id": "abc-4028", "words": "947", "extension": ".pdf", "flesch": "62", "author": "Arag\u00f3n, Gregorio; Negr\u00f3n Garc\u00eda, Valerie; Gim\u00e9nez, Gil Fernando", "title": "First record of the Pisutiella phaeothamnos in the western Mediterranean", "date": "2025", "keywords": "phaeothamnos; pisutiella", "summary": "Localities of sampling: Spain: Ciudad Real province, Ballesteros de Calatrava, la Conejera, 38\u00b048'0.2''N, 3\u00b056'20.5''W, 830 m a.s.l., among mosses on volcanic rocks, G. Arag\u00f3n & G. F. Gim\u00e9nez, n\u00b0 1566, November 16, 2023, MACB. The species was discovered among mosses on volcanic rocks in the Spanish Central Volcanic Region.", "mime": "application/pdf"}, {"id": "abc-4029", "words": "15121", "extension": ".pdf", "flesch": "54", "author": "Grgi\u0107, Miran; Vitko, Sandra; Drmi\u0107, Josipa; Leljak-Levani\u0107, Dunja", "title": "Connecting the dots: Epigenetics, ABA, and plant stress tolerance", "date": "2025", "keywords": "aba; arabidopsis; cell; chromatin; complex; dna; drought; epigenetic; et al; expression; genes; heat; histone; methylation; plant; plant stress; protein; rddm; regulation; response; rna; role; stress; tolerance", "summary": "Complex mechanisms such as DNA methylation, especially via the de novo pathway, and histone tail modifications such as methylation, acetylation, phosphorylation, ubiquitination, and SUMOylation are involved in plant stress responses. Keywords: ABA, DNA methylation, histone modifications, histone variants, plant stress response, RdDM, small non-coding RNA Introduction Changing and often extreme environmental conditions are the main cause of abiotic stress and pose a major chal- lenge to plant survival.", "mime": "application/pdf"}, {"id": "abc-4037", "words": "4306", "extension": ".pdf", "flesch": "48", "author": "Pasta, Salvatore; Lo Cascio, Pietro; Badalamenti, Emilio", "title": "Additional data on the ongoing naturalization of the non-native woody plant Duranta erecta (Verbenaceae) in Sicily, Italy", "date": "2025", "keywords": "duranta; erecta; islands; pasta; plant; sicily; species", "summary": "Re- trieved March 10, 2024 from http://www.plantsoftheworl- donline.org/ Pretto, F., Celesti-Grapow, L., Carli, E., Brundu, G., Blasi, C., 2012: Determinants of non-native plant species richness and composition across small Mediterranean islands. A second update to the checklist\u00adof\u00adthe\u00advascular\u00adflora\u00adalien\u00adto\u00adItaly.\u00adPlant\u00adBiosystems,\u00ad https://doi.org/10.1080/11263504.2024.2320129 Guarino, R., Chytr\u00fd, M., Attorre, F., Landucci, F., Marcen\u00f2, C., 2021: Alien plant invasions in Mediterranean habitats: an as- sessment for Sicily.", "mime": "application/pdf"}, {"id": "abc-4039", "words": "20590", "extension": ".pdf", "flesch": "50", "author": "Car, Ana; Kaleli, Aydin", "title": "Marine benthic diatoms from the Adriatic Sea (NE Mediterranean): review of investigations and checklist with updated nomenclature", "date": "2025", "keywords": "acta; adriatic; adriatic sea; amphora; bertalot; car; cibic; cleve; coastal; cocconeis; communities; community; composition; d.g.mann; diatoms; diploneis; distribution; ehrenberg; et al; grunow; halamphora; hustedt; kaleli; k\u00fctzing; lange; licmophora; marine; mastogloia; mediterranean; mediterranean sea; metzeltin; navicula; nitzschia; northern; research; sea; species; studies; study; substrates; taxa; var; w.gregory; w.smith; witkowski", "summary": "Gyrosigma fasciola (Ehrenberg) J. W. Griffith & Henfrey [N] Gyrosigma lineare (Grunow) Cleve [N] Gyrosigma macrum (W.Smith) J.W.Griffith & Henfrey [N, S] Gyrosigma prolongatum (W.Smith) J.W.Griffith & Henfrey [N] Gyrosigma scalproides (Rabenhorst) Cleve [M] Gyrosigma strigilis (W.Smith) J.W.Griffin & Henfrey [N] Gyrosigma wansbeckii (Donkin) Cleve [N] Halamphora acutiuscula (K\u00fctzing) Levkov* Halamphora borealis (K\u00fctzing) Levkov [M] Halamphora coffeiformis (C. Agardh) Levkov* Halamphora costata (W.Smith) Levkov* Halamphora cuneata (Cleve) Levkov [M, S] Halamphora cymbifera (Gregory) Levkov [M] Halamphora exigua (W.Gregory) Levkov [M, S] Halamphora granulata (Gregory) Levkov [M, S] Halamphora holsatica (Hustedt) Levkov [M] Halamphora hyalina (K\u00fctzing) Rimet & R.Jahn* Halamphora hybrida (Grunow) Levkov [M] Halamphora interrupta (Heiden) Levkov [M] Halamphora kolbei (Aleem) \u00c1lvarez-Blanco & S.Blanco [M, S] Halamphora lineata (Gregory) Levkov [M] Halamphora luciae (Cholnoky) Levkov [M, S] Halamphora pseudoholsatica (T.Nagumo & H.Kobayashi) J.G.Stepanek & Kociolek [M, S] Halamphora pseudohyalina (Simonsen) J.G.Stepanek & Kociolek [M, S] Halamphora staurophora (Juhlin-Dannfelt) \u00c1lvarez-Blanco & S.Blanco [S] Actinocyclus splendens J.Rattray [M] Actinocyclus subtilis (W. Gregory) Ralfs [M, S] Actinoneis lorenziana (Grunow) Mereschkowsky", "mime": "application/pdf"}, {"id": "abc-4062", "words": "8800", "extension": ".pdf", "flesch": "59", "author": "\u0130mamo\u011flu, Ece Nisa; Sa\u011flam, Aykut; Kad\u0131o\u011flu, Asim", "title": "Sulfur deficiency reduces the thermotolerance of Heliotropium thermophilum to high temperatures", "date": "2025", "keywords": "activity; content; deficiency; expression; heat; medium; mm sulfate; plants; stress; sulfate media; sulfur; temperature; \u00b0 c", "summary": "The high temperature treatment resulted in an increase in the fresh weight of plants in FN medium, while in 0.30 and 0.15 mM sulfate grown plants it was re- duced by 39% and 20%, respectively, compared to respective values obtained at 25 \u00b0C. In our study, H. thermophilum plants were exposed to two distinct sulfate concentrations to evaluate the impact of sulfur deficiency on their response to high temperatures in vermiculite media with Hoagland nutrient solution.", "mime": "application/pdf"}, {"id": "abc-4069", "words": "6464", "extension": ".pdf", "flesch": "58", "author": "Jelaska, Sven; Leva\u010di\u0107, Damjana", "title": "Past, present and future of an alien fungus Clathrus archeri in Croatia", "date": "2025", "keywords": "archeri; c. archeri; clathrus; croatia; data; fungi; fungus; habitat; models; suitability", "summary": "Despite this, data about C. archeri in Croatia in the scientific literature are very scarce. To fill the current gap on the presence and distribu- tion of C. archeri in Croatia, we collected reliable available data on its presence, analysed several environmental factors (climate, soil acidity, topography) on those localities, and developed habitat suitability models using Maxent software.", "mime": "application/pdf"}, {"id": "abc-4071", "words": "5796", "extension": ".pdf", "flesch": "59", "author": "\u0160egota, Vedran; Jovanovi\u0107 , Filip; Ili\u0107, Bari\u0161a; Dobo\u0161, Marko; Bu\u010dar, Marija; Rimac, Anja", "title": "Distribution, ecology and variability of Galanthus reginae-olgae Orph. along the northern limit of its Balkan distribution (Croatia)", "date": "2025", "keywords": "croatia; davis; flowering; g. reginae; galanthus; olgae; populations; reginae; species", "summary": "Bartolucci, F., Peruzzi, L., Galasso, G., Albano, A., Alessandrini, A., Ardenghi, N. M. G., Astuti, G., Bacchetta, G., Ballelli, S., Banfi, E., Barberis, G., Bernardo, L., Bouvet, D., Bovio, M., Cecchi, L., Di Pietro, R., Domina, G., Fascetti, S., Fenu, G., Festi, F., Foggi, B., Gallo, L., Gottschlich, G., Gubellini, L., Iamonico, D., Iberite, M., Jim\u00e9nez-Mej\u00edas, P., Lattanzi, E., Marchetti, D., Martinetto, E., Masin, R. R., Medagli, P., Pas- salacqua, N. G., Peccenini, S., Pennesi, R., Pierini, B., Poldini, L., Prosser, F., Raimondo, F. M., Roma-Marzio, F., Rosati, L., Santangelo, A., Scoppola, A., Scortegagna, S., Selvaggi, A., Selvi, F., Soldano, A., Stinca, A., Wagensommer, R. P., Wil- halm, T., Conti, F., 2018: An updated checklist of the vascular flora native to Italy. vernalis, morphology, taxo- nomy, transitional habitats Introduction The genus Galanthus L. (Amaryllidaceae) comprises 23 species of bulbous, petaloid monocots native to Europe, Asia Minor, and the Near East (Davis 1999, 2001, Zubov and Davis 2012, Tan et al. 2014, Zubov et al. 2019, Timukhin and Tuniyev 2022).", "mime": "application/pdf"}, {"id": "abc-4076", "words": "6920", "extension": ".pdf", "flesch": "56", "author": "\u0106osi\u0107, Marija V.; Bo\u017eovi\u0107, Djordje P.; Ignatov, Michael S.; Ignatova, Elena A.; Vuji\u010di\u0107, Milorad M.; Sabovljevi\u0107, Aneta D.; Sabovljevi\u0107, Marko S.", "title": "Micropropagation and optimisation of in vitro production of the rare and threatened moss Entosthodon pulchellus (Funariaceae)", "date": "2025", "keywords": "bap; development; fig; growth; knop; media; medium; plants; pulchellus; sabovljevi\u0107; species", "summary": "https://doi.org/10.1111/j.1095-8339.1990.tb00899.x \u0106osi\u0107, M. V., Sabovljevi\u0107, M. S., Papp, B., Giba, Z. S., \u0160in\u017ear- Sekuli\u0107, J. B., Sabovljevi\u0107, A. D., Vuji\u010di\u0107, M. M., 2022: Micro- propagation of rare bryo-halophyte Hennediella heimii. Retrieved May 18, 2024 from https://www.iucnredlist.org/spe- cies/85841585/87794990 Jadranin, B. Z., \u0106osi\u0107, M. V., Bo\u017eovi\u0107, \u0110. P., Vuji\u010di\u0107, M. M., Igna- tov, M. S., Ignatova, E. A., Sabovljevi\u0107, A. D., Sabovljevi\u0107, M. S., 2023:", "mime": "application/pdf"}, {"id": "abc-408", "words": "6433", "extension": ".pdf", "flesch": "61", "author": "Buyukkartal, Hatice N.; Kahraman, Ahmet; Colgecen, Hatice; Dogan, Musa; Karabacak, Ersin", "title": "Mericarp micromorphology and anatomy of Salvia hedgeana Donmez, S. huberi Hedge and S. rosifolia Sm. (section Salvia Hedge, Lamiaceae)", "date": "2011", "keywords": "cells; hedgeana; huberi; lamiaceae; mericarp; mucilage; rosifolia; s. huberi; salvia; species", "summary": "In S. huberi and S. rosifolia mucilage was formed after the first half hour of wetting, but in S. hedgeana the time taken was longer than one hour. Character S. hedgeana S. huberi S. rosifolia p Tukey\u2019s HSD test Mericarp length (mm) 3.66 \u00b1 0.37 [3.70] (3.12\u20134.36) 2.90 \u00b1 0.27", "mime": "application/pdf"}, {"id": "abc-4084", "words": "9583", "extension": ".pdf", "flesch": "61", "author": "Kele\u015f, Emine Seda; Kavgaci, Ali", "title": "Post-fire succession of black pine (Pinus nigra) forest vegetation under different fire regimes", "date": "2025", "keywords": "black; crown; et al; fire; forests; mediterranean; nigra; pine; pine forests; pinus; seed; species; subsp; surface; trees; vegetation", "summary": "Physiognomy of black pine forests before and after fire: a \u2013 surface fire, b \u2013 post-fire regeneration, c \u2013 black pine forest with dense underground layer, d \u2013 crown fire, e \u2013 black pine forest with Cistus laurifolius, f \u2013 crown fire with oak coppice after fire, g \u2013 Pteridium aquilinum vegetation after crown fire. Black pine forests are one of the ecosystems that are most affected by changing fire regimes.", "mime": "application/pdf"}, {"id": "abc-4088", "words": "579", "extension": ".pdf", "flesch": "56", "author": "Salopek Sondi, Branka", "title": "Chlorophyll a fluorescence measurements in Croatia \u2022 the first twenty years", "date": "2024", "keywords": "chlf; research", "summary": "This monograph, pub- lished in English, is thus a tribute to twenty years of the ap- plication of ChlF methods in biology and agronomy in the Republic of Croatia. In Croatia, the pioneering work in ChlF research began in the Department of Biology of the Josip Juraj Strossmayer University of Osijek.", "mime": "application/pdf"}, {"id": "abc-409", "words": "6787", "extension": ".pdf", "flesch": "59", "author": "Ali, Magdi M.; Hassan, Samar A.; Shaheen, Abdel-Samei M.", "title": "Impact of riparian trees shade on aquatic plant abundance in conservation islands", "date": "2011", "keywords": "demersum; islands; light; macrophytes; management; plants; riparian; shaded; sites; trees; water; zones", "summary": "ALI, M. M., MAGEED, A. A., Heikal, M., 2007: Importance of aquatic macrophyte for inver- tebrate diversity in large subtropical reservoir. In the present study, riparian Acacia nilotica trees provided natural shading limiting the growth of submerged aquatic plants, otherwise difficult to manage.", "mime": "application/pdf"}, {"id": "abc-4093", "words": "2464", "extension": ".pdf", "flesch": "55", "author": "Nov\u00e1k, Pavel; Tara\u0161ka, Vojt\u011bch; Kaln\u00edkov\u00e1, Veronika; Hubatka, Petr; Rohel, Jaroslav; Fayvush, George", "title": "Stellaria ruderalis (Caryophyllaceae) in the Caucasus, new records and species habitat preferences", "date": "2025", "keywords": "caucasus; georgia; lep\u0161\u00ed; ruderalis; species; stellaria", "summary": "Mucina, L., B\u00fcltman, H., Dierssen, K., Theurillat, J.-P., Dengler, J., \u010carni, A., \u0160umberov\u00e1, K., Raus, T., Di Pietro, R., Gavil\u00e1n Garcia, R., Chytr\u00fd, M., Iakushenko, D., Schamin\u00e9e, J. H. J., Bergmeier, E., Santos Guerra, A., Dani\u00ebls, F. J. A., Ermakov, N., Valachovi\u010d, M., Pignatti, S., Rodwell, J. S., Pallas, J., Cape- lo, J., Weber, H. E., Lysenko, T., Solomeshch, A., Dimopoulos, P., Aguiar, C., Freitag, H., Hennekens, S. M., Tich\u00fd, L., 2016: Vegetation of Europe: Our knowledge of the global distribution of S. ruderalis is still far from com- plete.", "mime": "application/pdf"}, {"id": "abc-4096", "words": "6400", "extension": ".pdf", "flesch": "57", "author": "Vidakovi\u0107, Antonio; \u0160atovi\u0107, Zlatko; Liber, Zlatko; Jurica, Marko; Poljak, Igor", "title": "Leaf morphological variability of Pyrus spinosa and Crataegus monogyna and their potential hybridization", "date": "2025", "keywords": "analysis; crataegus; leaf; leaves; monogyna; populations; pyrus; species; spinosa; traits; variability", "summary": "These few individu- als from P. spinosa populations, with unusual, hawthorn- like leaves indicate possible hybridization between these two genera (Fig. 3). However, C. monogyna popu- lations were somewhat better differentiated than those of P. spinosa, which is also supported by weak genetic differen- tiation of P. spinosa populations in the area (Vidakovi\u0107 et al. 2024).", "mime": "application/pdf"}, {"id": "abc-41", "words": "4469", "extension": ".pdf", "flesch": "63", "author": "Sheidai, Masoud; Habibi, Meysam; Azizian, Dina; Khatamsaz, Mahboobeh", "title": "Cytology and palynology of the Clematis L. species (Ranunculaceae) in Iran", "date": "2009", "keywords": "chromosome; clematis; orientalis; population; species", "summary": "TOWNSEND, C. C., EVANS, G., 1980: Clematis. In: TOWNSEND, C. C. (ed.), Flora of Iraq 4, 743\u2013750.", "mime": "application/pdf"}, {"id": "abc-410", "words": "4688", "extension": ".pdf", "flesch": "59", "author": "Prebeg, Tatjana; Fulgosi, Hrvoje; Wrischer, Mercedes", "title": "Professor Nikola Ljubesic on the occasion of his seventieth birthday", "date": "2010", "keywords": "acta; acta botanica; botanica; chromoplasts; croatica; ljube[i; prebeg; professor; wrischer", "summary": "Identification of turnip mosaic virus in Tropaeolum majus L. Acta Botanica Croatica 34, 33\u201342. MILI^I], D., [TEFANAC, Z., LJUBE[I], N., 1975: Biologia, Bratislava 56, 605\u2013610. LJUBE[I], N., WRISCHER, M., PREBEG, T., BRKI], D., 2001: Carotenoid-bearing structures in fruit chromoplasts of Solanum capsicastrum Link.", "mime": "application/pdf"}, {"id": "abc-4103", "words": "11541", "extension": ".pdf", "flesch": "53", "author": "Ljube\u0161i\u0107, Zrinka; Jurina, Dunja; Pavlovi\u0107, Tin; \u017divoli\u0107, Mario; Levkov, Zlatko; Mucko, Maja; Bosak, Sun\u010dica; Gligora Udovi\u010d, Marija", "title": "The Croatian National Diatom Collection \u2013 an overview and future challenges", "date": "2025", "keywords": "acta; adriatic; bosak; collection; croatia; diatom; et al; figs; gligora; levkov; marine; material; micrograph; mucko; phytoplankton; research; sea; sem; species; udovi\u010d; valve; view", "summary": "https://doi.org/10.1080/09670262.2019.16283 07 Mann, D. G., Droop, S. J. M., 1996: 3. Biodiversity, biogeography and conservation of diatoms. References Adl, S. M., Bass, D., Lane, C. E., Luke\u0161, J., Schoch, C. L., Smirnov, A., Agatha, S., Berney, C., Brown, M. W., Burki, F., C\u00e1rdenas, P., \u010cepi\u010dka, I., Chistyakova, L., del Campo, J., Dunthorn, M., Edvardsen, B., Eglit, Y., Guillou, L., Hampl, V., Heiss, A. A., Hoppenrath, M., James, T. Y., Karnkowska, A., Karpov, S., Kim, E., Kolisko, M., Kudryavtsev, A., Lahr, D. J. G., Lara, E., Le Gall, L., Lynn, D. H., Mann, D. G., Massana, R., Mitchell, E. A. D., Morrow, C., Park, J. S., Pawlowski, J. W., Powell, M. J., Richter, D. J., Rueckert, S., Shadwick, L., Shimano, S., Spiegel, F. W., Torruella, G., Youssef, N., Zlatogursky, V., Zhang, Q., 2019: Revisions to the classification, nomencla- ture, and diversity of eukaryotes.", "mime": "application/pdf"}, {"id": "abc-4111", "words": "2309", "extension": ".pdf", "flesch": "62", "author": "Purger, Dragica; Purger, Jen\u0151 J.; Pand\u017ea, Marija; Jasprica, Nenad", "title": "Stachys ocymastrum (Lamiaceae) \u2013 a new plant species in Croatia", "date": "2025", "keywords": "croatia; flora; island; ocymastrum; stachys", "summary": "Morales, R., Pardo de Santayana, M., 2010: Stachys L. A new infrageneric classification of Stachys L. Notes from the Royal Botanic Garden, Edinburgh 38, 65\u201396.", "mime": "application/pdf"}, {"id": "abc-4137", "words": "13752", "extension": ".pdf", "flesch": "79", "author": "Stesevic, Danijela; Stani\u0161i\u0107-Vuja\u010di\u0107, Milica; Milanovi\u0107, \u0110or\u0111ije; \u0160ilc, Urban", "title": "Retrodunal dry grassland vegetation in the hinterland of Velika Pla\u017ea (Montenegro)", "date": "2025", "keywords": "acta; association; campestris; cluster; communities; community; dune; fig; grassland; hinterland; jonii; line; liu; montenegro; plant; pla\u017ea; relev\u00e9s; retrodunal; sand; species; stani\u0161i\u0107; ste\u0161evi\u0107; suppl; vegetation; velika; vulpietum", "summary": "The hierarchical cluster analysis was performed on a data- set comprising 224 relev\u00e9s (47 original ones and 177 from the literature or unpublished of dry grassland communities (different substrata) from Montengro and Croatia), by PC- ORD 4 (McCune and Mefford 1999) incorporated in JUICE 7.0 software package (Tich\u00fd 2002). Diagnostic, constant, and dominant species of the ret- rodunal communities from Velika Pla\u017ea were identified on the smaller dataset (47 relev\u00e9s), while diagnostic species of the major Clusters (I-V) of dry grassland communities (dif- ferent substrata) from Montenegro and Croatia and dry ret- rodunal communities (on sandy soil) from Velika Pla\u017ea were identified on the large dataset (224 relev\u00e9s).", "mime": "application/pdf"}, {"id": "abc-4160", "words": "746", "extension": ".pdf", "flesch": "43", "author": "\u0160kvorc, \u017deljko", "title": "In Memoriam Ivo Trinajsti\u0107 (1933-2024)", "date": "2025", "keywords": "professor; trinajsti\u0107", "summary": "Professor Trinajsti\u0107 was also deeply involved in the taxonomic study of plant species, particularly through his Professor Ivo Trinajsti\u0107 (1933\u20132024) IN MEMORIAM 114 ACTA BOT. Born on October 27, 1933, in Sisak, Professor Trinajsti\u0107 completed his degree in agronomy at the Faculty of Agriculture and Forestry, University of Zagreb, in 1958.", "mime": "application/pdf"}, {"id": "abc-417", "words": "1842", "extension": ".pdf", "flesch": "68", "author": "Zupan\u00c4\u008di\u00c4\u2021, Mitja; Gogala, Nada", "title": "In memoriam Prof Dr. Ernest Mayer", "date": "2010", "keywords": "ernest; flora; ljubljana; mayer; profile", "summary": "lithopolitanicum E. Mayer, subsp. Jahrbuch des Vereins zum Schutze der Alpenpflanzen und -Tiere 25, 136\u2013144. MAYER, E., 1963: Pedicularis julica E. Mayer spec.", "mime": "application/pdf"}, {"id": "abc-4174", "words": "8300", "extension": ".pdf", "flesch": "54", "author": "Toki\u0107, Mirta; Tkalec, Mirta; Vitko, Sandra; Salopek-Sondi, Branka; Ludwig-M\u00fcller, Jutta; Bauer, Nata\u0161a", "title": "Physiological and molecular response of Brassica rapa to moderate and extreme heat", "date": "2025", "keywords": "aba; brassica; et al; exposure; fig; germination; growth; heat; heat stress; plant; rapa; seedlings; stress; temperature", "summary": "Seedlings were photographed (A) and analyzed 7 days after the start of heat stress treatments. The molecular basis of heat stress responses in plants.", "mime": "application/pdf"}, {"id": "abc-4214", "words": "2002", "extension": ".pdf", "flesch": "60", "author": "Kova\u010di\u0107, Sanja; Stamenkovi\u0107, Vanja", "title": "The 2024 anniversaries of the Botanical Garden, University of Zagreb, Faculty of Science", "date": "2025", "keywords": "botanical; garden; heinz; professor; zagreb", "summary": "In the front row, the guests of honour (left-right): Biserka Jureti\u0107 MSc, retired Gar- den manager; Professor Mirko Planini\u0107, Dean of the Faculty of Science; Dr Ljerka Regula-Bevilacqua, retired Garden manager; Ms Roberta Gazibari\u0107, Professor Heinz\u2019s great-granddaughter. (photo: Mirna Kirin). The bust representing Professor Heinz in his prime, for he was only 28 years old when he founded the Garden, was selected in a school com- petition from a dozen models made by pupils at the School of Applied Arts and Design in Zagreb.", "mime": "application/pdf"}, {"id": "abc-4232", "words": "1335", "extension": ".pdf", "flesch": "54", "author": "Balen, Biljana", "title": "Professor Emerita Marijana Krsnik Rasol - an appreciation on the occasion of her eightieth birthday", "date": "2025", "keywords": "biology; krsnik; plant; rasol", "summary": "Krsnik Rasol, M., \u010cip\u010di\u0107, H., Hag\u00e8ge, D., 1999: Isoes- terases related to cell differentiation in plant tissue culture. 84 (1), 2025 111 Social News Professor Emerita Marijana Krsnik Rasol \u2013 an appreciation on the occasion of her eightieth birthday Professor Emerita Marijana Krsnik-Rasol is a distin- guished Croatian biologist, known for her extensive research into plant molecular biology and proteomics.", "mime": "application/pdf"}, {"id": "abc-4244", "words": "6107", "extension": ".pdf", "flesch": "54", "author": "Stamenkovi\u0107, Vanja; Tkalec, Mirta", "title": "Flavonoid composition and localization in trichomes and leaves of Degenia velebitica (Brassicaceae)", "date": "2025", "keywords": "brassicaceae; cells; degenia; fig; flavonoids; fluorescence; kaempferol; leaf; leaves; quercetin; trichomes; velebitica", "summary": "t \u2013 trichome, tb \u2013 trichome branch, ts \u2013 trichome stalk, tw \u2013 trichome cell wall, e \u2013 epidermis, bc \u2013 basal epidermal trichome cell, i \u2013 inclusions in the trichome lumen, s \u2013 stomata, pp \u2013 palisade parenchyma, sp \u2013 spongy parenchyma, cv \u2013 central vascular vessel. Histochemical visualization of flavonoids in Degenia velebitica trichomes and leaf tissues by confocal laser scanning micros- copy: the trichome in bright field (A1), the secondary fluorescence of flavonoids inside the trichome in pseudo-green color after the overlapping of seven separate micrographs that were obtained by scanning at different depths (A2), and an overlapping image of the previous two (A3); cross-section of a leaf first excited for autofluorescence of chlorophyll and visualized in pseudo-red color (B1), then excited at 488 nm after incubation with \u201cNaturstoff\u201d reagent, and monitoring the secondary fluorescence of flavonoids visualized in pseudo-green color (B2) and after overlapping the images of the two channels (B3).", "mime": "application/pdf"}, {"id": "abc-425", "words": "2231", "extension": ".pdf", "flesch": "55", "author": "Gomez, Fernando", "title": "Diversity and distribution of the dinoflagellates Brachidinium, Asterodinium and Microceratium (Brachidiniales, Dinophyceae) in the open Mediterranean Sea", "date": "2011", "keywords": "asterodinium; brachidinium; karenia; mediterranean; microceratium; sea", "summary": "70 (2), 209\u2013214, 2011 CODEN: ABCRA25 ISSN 0365-0588 Diversity and distribution of the dinoflagellates Brachidinium, Asterodinium and Microceratium (Brachidiniales, Dinophyceae) in the open Mediterranean Sea FERNANDO G\u00d3MEZ* Instituto Cavanilles de Biodiversidad y Biolog\u00eda Evolutiva, Universidad de Valencia, PO Box 22085, 46071 Valencia, Spain Microceratium was found below 100 m in the eastern Mediterranean Sea, with the highest abundance of 8 cells L\u20131 at 125 m depth, in the Levantine Basin.", "mime": "application/pdf"}, {"id": "abc-428", "words": "3634", "extension": ".pdf", "flesch": "64", "author": "Petrovic, Danka; Stesevic, Danijela", "title": "Shift of the western boundary of the distribution area of Micromeria cristata (Hampe) Griseb. and Steptorhamphus tuberosus (Jacq.) Grossh.", "date": "2011", "keywords": "cristata; distribution; flora; micromeria; montenegro; rumija; steptorhamphus", "summary": "In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALEN- TINE, D. H., WALTERS, S. M., WEBB, D. A., (eds.), Flora Europaea 3, 163\u2013167. In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALENTINE, D. H., WALTERS, S. M., WEBB, D. A., (eds.), Flora Europea 3, 167\u2013170.", "mime": "application/pdf"}, {"id": "abc-429", "words": "4123", "extension": ".pdf", "flesch": "68", "author": "Sapic, Irena; Segota, Vedran; Alegro, Antun", "title": "Where does Sedum cepaea L. (Crassulaceae) \u2013 one of the rarest species of Croatian flora \u2013 really grow?", "date": "2012", "keywords": "brdo; cepaea; croatia; finding; flora; forest; gora; moslava; sedum; species; zrinska", "summary": "On both finding spots (Moslava~ka gora and Zrinska gora, respectively), S. cepaea grows in vegetation belt dominated by sessile oak. On Nikolino brdo S. cepaea was collected three times: by Schlosser in 1871, by Vukotinovi} in 1882 and by Rossi in 1888 (data from ZA).", "mime": "application/pdf"}, {"id": "abc-431", "words": "12064", "extension": ".pdf", "flesch": "67", "author": "Barinova, Sophia S.; Nevo, Eibi; Bragina, Tatiana M.", "title": "Ecological assessment of wetland ecosystems of northern Kazakhstan on the basis of hydrochemistry and algal biodiversity", "date": "2011", "keywords": "alf; alf k; b temp; barinova; bot; croat; diversity; ehrb; ind; kazakhstan; k\u00fctz; lakes; salinity; species; str; water", "summary": "acuminatum 11, 20 P-B \u2013 st es b i alf k 97 Gomphonema acuminatum var. 34 P-B \u2013 st es b i alf k 150 Tryblionella gracilis W. Sm. 5, 17, 20, 23, 29 B \u2013 \u2013 \u2013 \u2013 \u2013 \u2013 k 151 Tryblionella hungarica (Grun.)", "mime": "application/pdf"}, {"id": "abc-432", "words": "3818", "extension": ".pdf", "flesch": "69", "author": "Karlovic, Ksenija; Kremer, Dario; Jurisic Grubjesic, Renata; Popovic, Zvjezdana", "title": "Fruit and seed traits of Berberis croatica Horvat and Berberis vulgaris L.", "date": "2012", "keywords": "croatica; fruit; vulgaris; width", "summary": "o ujak 2012 11:25:01 Color profile: Disabled Composite 150 lpi at 45 degrees intraspecies variability for seed traits was something higher than for fruit traits. Berberis croatica had the following dimen- sions of fruits (seeds): length 7.28\u20137.88 (4.57\u20135.03) mm; width 3.85\u20133.99 (width 1: 2.06\u20132.20; width 2: 1.44\u20131.63) mm; weight 0.065\u20130.078 (0.0116\u20130.0134) g. Dimensions of B. vulgaris fruits (seeds) were: length 10.20\u201311.29 (5.71\u20136.24) mm; width 5.29\u20135.83 (width 1: 2.40\u20132.71; width 2: 1.60\u20131.98) mm; weight 0.1602\u20130.2199 (0.0146\u20130.0235) g. The fruit shape of both species was similar and the length/width ratio was 1.91\u20132.04 in B. croatica and 1.77\u20132.07 in B. vulgaris.", "mime": "application/pdf"}, {"id": "abc-433", "words": "3523", "extension": ".pdf", "flesch": "57", "author": "Batori, Zoltan; Galle, Robert; Erdos, Laszlo; Kormoczi, Laszlo", "title": "Ecological conditions, flora and vegetation of a large doline in the Mecsek Mountains (South Hungary)", "date": "2011", "keywords": "acta; air; analysis; doline; hungary; mecsek; north; pattern; plant; slope; south; species; transect; vegetation", "summary": "nodosum (Schur), 39 \u2013 Convallaria majalis L., 40 \u2013 Iris graminea L., 41 \u2013 Glechoma hirsuta W. et K., 42 \u2013 Ajuga reptans L., 43 \u2013 Clinopodium vulgare L., 44 \u2013 Taraxacum officinale Weber ex Wiggers, 45 \u2013 Sorbus torminalis (L.) Cr., 46 \u2013 Luzula luzuloides (Lam.) Numbers on the right indi- cate plant species as follows: 1 \u2013 Fraxinus excelsior L., 2 \u2013 Cardamine bulbifera (L.) Crantz, 3 \u2013 Allium ursinum L., 4 \u2013 Tilia tomentosa Moench, 5 \u2013 Arum maculatum L., 6 \u2013 Asarum europaeum L., 7 \u2013 Hedera helix L., 8 \u2013 Alliaria petiolata (M. B.) Cavara et Grande, 9 \u2013 Galium aparine L., 10 \u2013 Veronica hederifolia L., 11 \u2013 Helleborus odorus W. et K., 12 \u2013 Viola reichenbachiana Jord., 13 \u2013 Acer platanoides L., 14 \u2013 Acer campestre L., 15 \u2013 Fraxinus ornus L., 16 \u2013 Stellaria holostea L., 17 \u2013 Carex pilosa Scop., 18 \u2013 Melica uniflora Retz., 19 \u2013", "mime": "application/pdf"}, {"id": "abc-434", "words": "8066", "extension": ".pdf", "flesch": "67", "author": "Jamzad, Ziba; Panahi, Parisa; Pourmajidian, Mohammad R.; Fallah, Ashgar; Pourhashemi, Mehdi", "title": "Foliar epidermis morphology in Quercus (subgenus Quercus, section Quercus) in Iran", "date": "2012", "keywords": "boissieri; fig; infectoria subsp; iran; q. infectoria; quercus; species; stomata; subsp; surface; trichomes; var", "summary": "71 (1), 95\u2013113, 2012 CODEN: ABCRA25 ISSN 0365\u20130588 eISSN 1847-8476 Foliar epidermis morphology in Quercus (subgenus Quercus, section Quercus) in Iran PARISA PANAHI1, 2, ZIBA JAMZAD2*, MOHAMMAD R. POURMAJIDIAN1, ASGHAR FALLAH1, MEHDI POURHASHEMI3 1 Department of Forestry, Sari Agricultural Sciences and Natural Resources University, P.O.Box: 737, Sari, Iran 2 Botany Research Division, Research Institute of Forests and Rangelands of Iran, P.O.Box: 013185-116, Tehran, Iran 3 Forest Research Division, Research Institute of Forests and Rangelands of Iran, P.O.Box: 13185-116, Tehran, Iran Abstract \u2013 The foliar morphology of trichomes, epicuticular waxes and stomata in Quercus cedrorum, Q. infectoria subsp. pedunculiflora (F), Q. cedrorum (G), Q. infectoria subsp.", "mime": "application/pdf"}, {"id": "abc-436", "words": "2919", "extension": ".pdf", "flesch": "61", "author": "Sevik, Mehmet Ali", "title": "Natural occurrence of Cucumber mosaic virus infecting water mint (Mentha aquatica) in Antalya and Konya, Turkey", "date": "2012", "keywords": "cmv; cucumber; mint; mosaic; plants; virus", "summary": "o ujak 2012 14:49:12 Color profile: Disabled Composite 150 lpi at 45 degrees CLARK, M. R., ADAMS, A. M., 1977: Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. Acta Horticulture 234, 371\u2013378. YILMAZ, M. A., BALOGLU, S., \u00d6ZASLAN, M., G\u00dcLD\u00dcR, M. E., 1995: Plant viruses detected in horticultural crops in the GAP region (in Turish).", "mime": "application/pdf"}, {"id": "abc-4373", "words": "599", "extension": ".pdf", "flesch": "37", "author": "Tkalec, Mirta; Jasprica, Nenad", "title": "Foreword by the Editors-in-Chief", "date": "2025", "keywords": "acta; journal", "summary": "Acta Botanica Croatica Nenad Jasprica Mirta Tkalec Editors-in-Chief Today, Acta Botanica Croatica attracts contributions from authors across the globe, fostering a diverse and inter- disciplinary approach to botanical research.", "mime": "application/pdf"}, {"id": "abc-439", "words": "5957", "extension": ".pdf", "flesch": "66", "author": "Kremer, Dario; Randic, Marko; Kosalec, Ivan; Brkljacic, Ana; Lukac, Gordan; Krusic, Irena; Ballian, Dalibor; Bogunic, Faruk; Karlovic, Ksenija", "title": "New localities of the subendemic species Berberis croatica, Teucrium arduini and Micromeria croatica in the Dinaric Alps", "date": "2011", "keywords": "a.s.l; arduini; berberis; croatica; habitat; micromeria; plants; rocks; species; teucrium", "summary": "Based on altitude (840 m a.s.l.) and habitat conditions, this population of Berberis L. connects the B. croatica population on Vi{evica with B. vulgaris population in Li~ko polje. Berberis L.", "mime": "application/pdf"}, {"id": "abc-441", "words": "4813", "extension": ".pdf", "flesch": "67", "author": "Cseresnyes, Imre; Szecsy, Orsolya; Csontos, Peter", "title": "Fire risk in Austrian pine (Pinus nigra) plantations under various temperature and wind conditions", "date": "2011", "keywords": "age; drought; fire; forest; ros; speed; temperature; wind; years", "summary": "That the fre- quency of forest fires has been increasing in recent decades was demonstrated world-wide (NIKLASSON and GRANSTR\u00d6M 2000, HARTLEY 2002, PALIK et al. 2002, MUZY et al. 2008). The dryness of the litter and the vegetation has a considerable influence on the scale of fire risk, such that the frequency and scale of forest fires increase during dry years (VIEGAS et al. 1990, 1992, GRANSTR\u00d6M 1993, SWETNAM 1993).", "mime": "application/pdf"}, {"id": "abc-457", "words": "13238", "extension": ".pdf", "flesch": "74", "author": "Dakskobler, Igor; Seliskar, Andrej; Vres, Branko", "title": "Southeastern-Alpine endemic Leontodon hispidus subsp. brumatii (Cichoriaceae) in the Sava valley (central Slovenia)", "date": "2012", "keywords": "acta; alpine; bank; bot; botanica\\acta; brumatii; color; croat; dakskobler; dakskobler_verzija-10.vp; degrees; e2a; endemic; hispidus; leontodon; lpi; number; profile; relev\u00e9; riparian; river; rocks; salix; sava; slovenia; species; subsp; tab; u:\\acta; valley; vre", "summary": "Rhinanthus minor E1 . . + + . 6 40 Plantago major E1 . . . . . . .", "mime": "application/pdf"}, {"id": "abc-463", "words": "6004", "extension": ".pdf", "flesch": "62", "author": "Barath, Kornel; Csiky, Janos", "title": "Host range and host choice of Cuscuta species in Hungary", "date": "2012", "keywords": "bar\u00e1th; cuscuta; dodders; epithymum; europaea; host; host species; hungarian; plants; species", "summary": "BABINGTON, C. C., 1843: Note on a supposed New British Cuscuta. In the cases of C. epithymum and C. campestris they found that the number of host species was positively correlated with the size of the parasites.", "mime": "application/pdf"}, {"id": "abc-464", "words": "7708", "extension": ".pdf", "flesch": "55", "author": "Lengyel, Attila; Purger, Dragica; Csiky, Janos", "title": "Classification of mesic grasslands and their transitions of South Transdanubia (Hungary)", "date": "2012", "keywords": "acta; classification; croat; group; hungarian; hungary; lengyel; meadows; mesic; nutrient; relev\u00e9s; species; stands; values; vegetation", "summary": "KOV\u00c1CS, J. A., 1994: Meadow associations of the K\u00f5szeg Mts. and K\u00f5szeg-hegyalja. It is also worth mentioning that Pastinaco\u2013Arrhenatheretum is characterised by generalist meadow species, which are common on drying wet meadows and other dynamic types, thus the species composition of Pastinaco\u2013Arrhenatheretum can easily appear on various sites.", "mime": "application/pdf"}, {"id": "abc-467", "words": "9630", "extension": ".pdf", "flesch": "67", "author": "Joshi, Seema V.; Patel, Neha T.; Pandey, Indu B.; Pandey, Amar Nath", "title": "Effect of supplemental Ca2+ on NaCl-stressed castor plants (Ricinus communis L.)", "date": "2012", "keywords": "ca2; content; growth; na+/ca2; plant; ratio; roots; salinity; soil; tissues; water", "summary": "Salinity significantly retarded seed germination and plant growth, but the deleterious effects of NaCl on seed germination were ameliorated and plant growth was restored with Ca2+ supply at the critical level (1:0.25 Na+/Ca2+ ratio) to salinised soil. Supply of Ca2+ above the critical level further retarded seed germination and plant growth due to the increased soil salinity.", "mime": "application/pdf"}, {"id": "abc-468", "words": "2072", "extension": ".pdf", "flesch": "63", "author": "Ruscic, Mirko; Nikolic, Toni", "title": "Ammi visnaga (L.) Lam. (Apiaceae), a new taxon in Croatian flora", "date": "2011", "keywords": "ammi; bra~; croatian; flora; species; visnaga", "summary": "Key words: Ammi visnaga, flora, neophyte, island Bra~, Croatia Introduction The genus Ammi L. (Apiaceae) contains about 25 species. Specimens of the genus Ammi L. were collected, but these plants did not match the description of the already known Ammi majus (DOMAC 1994).", "mime": "application/pdf"}, {"id": "abc-469", "words": "5189", "extension": ".pdf", "flesch": "54", "author": "Pavokovic, Dubravko; Krsnik-Rasol, Marijana", "title": "Protein glycosylation in sugar beet cell line can be influenced by DNA hyper- and hypomethylating agents", "date": "2012", "keywords": "activity; beet; cells; changes; dna; glycosylation; methylation; plant; protein; sugar", "summary": "However, it is not known whether using agents that change the DNAmethylation level in plant cells will change protein glycosylation, as it does in animal cells. This suggested that hypermethylation and hypomethylation of genomic DNA in sugar beet cells affect protein glycosylation patterns and cellular meta- bolism, possibly in a mechanism similar to that existing in animal cells.", "mime": "application/pdf"}, {"id": "abc-474", "words": "4668", "extension": ".pdf", "flesch": "55", "author": "Kakde, Umesh B.; Kakde, Hemalata U.", "title": "Incidence of post-harvest disease and airborne fungal spores in a vegetable market", "date": "2012", "keywords": "air; alternaria; aspergillus; cladosporium; fungi; fusarium; kakde; market; penicillium; species; spores; vegetables; \ufffd \ufffd", "summary": "Samples of fresh as well as previously infected or rotten vegetables (cabbage, beans, onion, potato, tomato) were collected in pre-sterilized polythene bags from the same mar- ket to examine post-harvest fungi. Aerospora of Bangalore city market and its relation to oc- currence of market diseases.", "mime": "application/pdf"}, {"id": "abc-481", "words": "2997", "extension": ".pdf", "flesch": "55", "author": "Harris, D James; Faria, Miguel A.; Visnevchi - Necrasov, Tatiana; Tavares De Sousa, Manuel; Nunes, Eugenia", "title": "The correct phylogenetic position of Lotus conimbricensis Brot. (Leguminosae, Loteae) based on nuclear ribosomal ITS sequences", "date": "2012", "keywords": "conimbricensis; lotus; sequences; species; subbiflorus", "summary": "The aim of this study was to sequence several individuals of both L. subbiflorus and L. conimbricensis to resolve their phylogenetic relationship, and to look for some other possi- ble examples of discordance in previous studies by examination of sequence data available for different Lotus species. Crit- ical reexamination of previously published data indicates that several other similar errors may exist for other Lotus species, and these should be checked before taxonomic conclu- sions are made.", "mime": "application/pdf"}, {"id": "abc-484", "words": "1388", "extension": ".pdf", "flesch": "52", "author": "Kovacic, Sanja; Stamenkovic, Vanja Nikola", "title": "First National Week of Croatian Botanical Gardens and Arboreta (May 30 \u00e2\u20ac\u201c June 4, 2011)", "date": "2011", "keywords": "arboreta; botanical; croatian; gardens", "summary": "The First National Week of Croatian Botanical Gardens and Arboreta, organized at 12 locations, was visited by more than two thousand people. U:\\ACTA BOTANICA\\Acta-Botan 2-11\\social news Kovacic.vp 15. rujan 2011 11:53:27 Color profile: Disabled Composite 150 lpi at 45 degrees The next National Week of Croatian Botanical Gardens and Arboreta will be organised from Monday 14th to Saturday 19th of May, 2012.", "mime": "application/pdf"}, {"id": "abc-487", "words": "8188", "extension": ".pdf", "flesch": "61", "author": "Priyadharsini, Perumalsamy; Pandey, Radha Raman; Muthukumar, Thangavelu", "title": "Arbuscular mycorrhizal and dark septate fungal associations in shallot (Allium cepa L. var. aggregatum) under conventional agriculture", "date": "2012", "keywords": "amf; colonization; dse; et al; fungi; mycorrhizal; onion; root; soil; spore", "summary": "Aseptate inter or intracellular, linear or coiled fungal hyphae accompanied with arbuscules or arbusculate coils were used to designate AMF colonization. AMF colonization was characterized by the formation of an appresso- rium on the root surface (Fig. 1a).", "mime": "application/pdf"}, {"id": "abc-488", "words": "5061", "extension": ".pdf", "flesch": "63", "author": "Cseresnyes, Imre; Csontos, Peter", "title": "Soil seed bank of the invasive Robinia pseudoacacia in planted Pinus nigra stands", "date": "2012", "keywords": "bank; black; density; layer; locust; pine; pseudoacacia; robinia; seed; seed bank; soil; stands; tree", "summary": "If this applies for black locust, then the ratio of viable seeds in the lower soil layer compared to the total amount of soil seed bank should be increased under older tree individuals. 2. Average densities of soil seed bank in the upper (0\u20136 cm) and lower (6\u201312 cm) soil layers under Robinia pseudoacacia trees growing in Pinus nigra stands, in Hungary.", "mime": "application/pdf"}, {"id": "abc-498", "words": "3089", "extension": ".pdf", "flesch": "54", "author": "Thangavelu, Muthukumar; Prabha, Kandasamy", "title": "Fungal associations in gametophytes and young sporophytic roots of the fern Nephrolepis exaltata", "date": "2012", "keywords": "exaltata; fern; fungal; fungi; gametophytes; roots; sporophytes", "summary": "Gametophytes and young sporophytes growing on different substrates were invariably colonized by septate endophytic fungi. Gametophytes and young sporophytes of Nephrolepis exaltata.", "mime": "application/pdf"}, {"id": "abc-499", "words": "1191", "extension": ".pdf", "flesch": "60", "author": "Gutermann, Walter", "title": "A note on Pteris vittata L. (Pteridaceae) in Montenegro", "date": "2012", "keywords": "flora; herbarium; pteris; university; vittata", "summary": "W. Pamplin, London. HOOKER, W. J., BAKER, J. G., 1868: Synopsis filicum, a synopsis of all known ferns. HOOKER, W. J., 1858: Species filicum, being descriptions of the known ferns, 2.", "mime": "application/pdf"}, {"id": "abc-50", "words": "8445", "extension": ".pdf", "flesch": "60", "author": "Heneidy, Selim Z.; Halmy, Marwa Waseem", "title": "The nutritive value and role of Panicum turgidum Forssk. in the arid ecosystems of the Egyptian desert", "date": "2009", "keywords": "content; crude; desert; energy; nutritive; populations; protein; regions; sandy; soil; tab; turgidum; value; variation", "summary": "Description of the sampling sites from which P. turgidum populations were collected, the relative accessibility of the above-ground parts and the relative abundance of P. turgidum in each site (*cc= very common, c; common). In the pres- ent study, Ca/P ratio ranged from 3.36 in P. turgidum populations collected from Wady El-Natrun to 5.71 in those of South Sinai; this low Ca/P ratio gives a further reason for the introduction of P. turgidum as a natural forage plant in the western Mediterranean region.", "mime": "application/pdf"}, {"id": "abc-507", "words": "4081", "extension": ".pdf", "flesch": "84", "author": "Kasom, Gordana; Karadelev, Mitko", "title": "Survey of the family Russulaceae (Agaricomycetes, Fungi) in Montenegro", "date": "2012", "keywords": "exs; f.m.m.c; had@i; kasom; lactarius; m.n.f; montenegro; peri; ref; russula", "summary": "F.M.M.C., M.N.F. \u2022 Lactarius picinus Fr. Ref.: HAD@I] (1995: 23), KARAD@I] (1995: 84\u201385), PERI] and PERI] (1996a: 154, 1997a: 61). The first data on the family Russulaceae Lotsy were provided at the close of the 20th cen- tury (TORTI] 1974, 1988; HAD@I] 1995; KARAD@I] 1995; PERI] and PERI] 1995, 1996a, b, c, 1997a, b, 1998a, b, 1999a, b).", "mime": "application/pdf"}, {"id": "abc-510", "words": "8311", "extension": ".pdf", "flesch": "51", "author": "Filibeck, Goffredo; Cornelini, Paolo; Petrella, Paolo", "title": "Floristic analysis of a high-speed railway embankment in a Mediterranean landscape", "date": "2012", "keywords": "acta; alien; bot; brom; communities; cornelini; cosmopolitan; croat; embankment; eurasiatic; euri; flora; h(b; l. h; l. p; l. t; lazio; mediterranean; plant; railway; species; steno; t euri; vegetation", "summary": "T Euri-Mediterranean St Lactuca serriola L. H(b) Eurasiatic Lathyrus clymenum L. T Steno-Mediterranean St Lathyrus pratensis L. H Eurasiatic M-A Lathyrus sylvestris L. H Eurasiatic T-G Laurus nobilis L. P Steno-Mediterranean Qi Lavatera punctata All. T Euri-Mediterranean St Cercis siliquastrum L. P Eurasiatic Q-F Chenopodium album L. T Cosmopolitan St Chondrilla juncea L. H Eurasiatic Chrozophora tinctoria (L.) Juss.", "mime": "application/pdf"}, {"id": "abc-511", "words": "1006", "extension": ".pdf", "flesch": "50", "author": "Keresztes, Aron", "title": "Plant Cell Compartments - Selected Topics. B. Schoefs (ed.) 2008. Research Signpost (Kerala, India).", "date": "2012", "keywords": "cell; plant", "summary": "Rather than offering a classical systematic coverage of plant cell compartments, this book includes chapters focused on emerging, debated, or new areas. The next chapter (\u00bbCell wall changes during strawberry fruit ripening\u00ab, by G. A. Marti- nez) describes an applied and rather specific study about the highly dynamic changes that plant cell walls can undergo during fruit maturation.", "mime": "application/pdf"}, {"id": "abc-529", "words": "5576", "extension": ".pdf", "flesch": "57", "author": "Muhamad, Zia-Ul-Haq; Cavar, Sanja; Qayum, Mughal; Khan, Inamullah; Ahmad, Shakeel", "title": "Chemical composition and antioxidant potential of Acacia leucophloea Roxb.", "date": "2013", "keywords": "acacia; acid; antioxidant; haq; leucophloea; pakistan; pods; profile; seeds; zia", "summary": "Extraction The plant material (Acacia leucophloea seeds, leaves, flower and pods) was air-dried in shade and crushed to coarse powder separately with help of pestle and mortar. Protein fractions Seeds (%) Pods (%) Albumins 9.67 \u00b1 0.39 5.18 \u00b1 0.89 Globulins 13.01 \u00b1 1.27 6.12 \u00b1 0.25 Prolamines 1.21 \u00b1 0.54 1.09 \u00b1 0.46 Glutelins 2.32 \u00b1 1.08 2.03 \u00b1 0.77 Tab.", "mime": "application/pdf"}, {"id": "abc-533", "words": "4341", "extension": ".pdf", "flesch": "53", "author": "Chen, Xu; Yang, Xiangdong; Dong, Xuhui; Liu, Enfeng", "title": "Influence of environmental and spatial factors on the distribution of surface sediment diatoms in Chaohu Lake, southeast China", "date": "2012", "keywords": "analysis; diatom; distribution; lake; spatial; species; variables", "summary": "The original coordi- nate values were z-score transformed and these standard coordinates were used to create the dataset of spatial variables derived from PCNM using the program Spacemaker2 (BORCARD and LEGENDRE 2004). Spatial variables PCNM1 and PCNM2 were calculated and both of them were included in the later analysis.", "mime": "application/pdf"}, {"id": "abc-534", "words": "7176", "extension": ".pdf", "flesch": "58", "author": "El-Sheikh, Mohamed abd El-Raouf", "title": "Population structure of woody plants in the arid cloud forests of Dhofar, southern Oman", "date": "2013", "keywords": "acacia; bed; cloud; dhofar; distribution; forest; hill; oman; population; profile; size; species; trees; vegetation; wadi", "summary": "This type of study can provide a basis for the development of a management plan to support the conservation and sustainable use of forest vegetation in an arid region. In cloud forests, for example, cloud condensation in fog-affected escarpment mountain slopes and fog precipitation during the summer season create a niche for moist woodland vegetation within the surrounding desert.", "mime": "application/pdf"}, {"id": "abc-536", "words": "6194", "extension": ".pdf", "flesch": "53", "author": "Spoljar, Marija; Fressl, Jelena; Drazina, Tvrtko; Meseljevic, Matija; Grcic, Zlatko", "title": "Epiphytic metazoans on emergent macrophytes in oxbow lakes of the Krapina River, Croatia: differences related to plant species and limnological conditions", "date": "2012", "keywords": "density; diversity; epiphyton; et al; iris; lakes; macrophytes; metazoans; poljar; shallow; species; water", "summary": "Results of correlations suggested decreasing AFDMe amount at higher epiphytic metazoan density and diversity, especially caused by higher rotifers density. Algal biomass (Chl a) did not oscillate significantly in macrophyte epiphyton during the investigated period (Fig. 3b).", "mime": "application/pdf"}, {"id": "abc-54", "words": "7401", "extension": ".pdf", "flesch": "69", "author": "Shaltout, Kamal H.; Sheded, Mohamed Gabr; Salem, Ashraf I.", "title": "Vegetation spatial heterogeneity in a hyper arid Biosphere Reserve area in north Africa", "date": "2010", "keywords": "acacia; allaqi; cluster; desert; egypt; si+s; soil; species; tortilis; vegetation; wadi", "summary": "On the other hand, it is also a diagnostic study to evaluate the recent situation of Wadi Allaqi vegetation in comparison with the previous studies (e.g. SPRINGUEL et al. 1991, ALI et al. 1997). 3. Biological spectrum of Wadi Allaqi vegetation.", "mime": "application/pdf"}, {"id": "abc-540", "words": "19645", "extension": ".pdf", "flesch": "64", "author": "Kiss, Keve; Klee, Rolf; Ector, Luc; Acs, Eva", "title": "Centric diatoms of large rivers and tributaries in Hungary: morphology and biogeographic distribution", "date": "2012", "keywords": "acta; areolae; bot; centric; croat; cyclotella; diameter; diatoms; fig; fultoportulae; hungarian; kiss; mantle; marginal; pores; rivers; running; satellite; species; valve; valve face; view; waters", "summary": "Some freshwater and brackish water species of the diatom genus Thalassiosira Cleve. According to BUDZY\u00d1SKA and WOJTAL (2011), the limited number of citations of this centric diatom may be related to its misidentification or confusion with other Cyclotella species; they observed it in the plankton of the eutrophic-hypertrophic Rusa\ufffdka Lake (Western Poland) and proposed the new combination Puncticulata balatonis (Pantocsek) Wojtal et Budzy\u00f1ska.", "mime": "application/pdf"}, {"id": "abc-542", "words": "5065", "extension": ".pdf", "flesch": "57", "author": "Nikolova, Milena; Petrova, Mariya; Zayova, Ely; Vitkova, Antonina; Evstatieva, Ljuba", "title": "Comparative study of in vitro, ex vitro and in vivo grown plants of Arnica montana - polyphenols and free radical scavenging activity", "date": "2013", "keywords": "activity; antioxidant; content; extracts; flavonoids; montana; nikolova; plants; samples; vivo", "summary": "Plant extracts were diluted to a concentration of 1 mg mL\u20131, and aliquots of 0.5 mL were mixed with 2.5 mL of Folin\u2013Ciocalteu reagent (previously diluted 10-fold with distilled wa- ter) and 2 mL of Na2CO3 (6%). The amount of flavonoids in plant extracts in rutin equivalents (RE) was calculated by the following formula: C = Absample \u00d7 mcontrol \u00d7 10 / Abcontrol", "mime": "application/pdf"}, {"id": "abc-543", "words": "3164", "extension": ".pdf", "flesch": "51", "author": "Chikov, Vladimir I; Isaeva, Elvira V; Ratushnyak, Anna A; Tarasov, Oleg Yu; Trushin, Maxim V", "title": "Changes of photosynthesis and carbon metabolism in Typha angustifolia L grown in conditions of nitrate nitrogen overload", "date": "2012", "keywords": "angustifolia; nitrate; nitrogen; plants; ratushnyak", "summary": "71 (2), 2012 CHIKOV V. I., ISAEVA E. V., RATUSHNYAK A. A., TARASOV O. Y., ABRAMOVA K. I., TRUSHIN M. V. phyte was presented as g of dried substance per 1 m2. 71 (2), 2012 CHIKOV V. I., ISAEVA E. V., RATUSHNYAK A. A., TARASOV O. Y., ABRAMOVA K. I., TRUSHIN M. V. Fig.", "mime": "application/pdf"}, {"id": "abc-544", "words": "4509", "extension": ".pdf", "flesch": "64", "author": "Vizintin, Liliana; Kosovel, Vera; Feoli Chiapella, Laura; Bohanec, Borut", "title": "Genetic characterization of Genista sericea Wulfen (Cytiseae - Fabaceae) as revealed by nuclear DNA content and ITS nrDNA region analysis", "date": "2012", "keywords": "accessions; content; dna; feoli; genista; italy; rigida; sericea; sericea var; species; var", "summary": "The variation in nuclear DNA content of G. sericea var. Determination of nuclear DNA content by flow cytometry The relative and absolute value of DNA content was assessed by flow cytometry using Trifolium pratense L. as standard.", "mime": "application/pdf"}, {"id": "abc-545", "words": "2598", "extension": ".pdf", "flesch": "62", "author": "Bozac, Romano; Siric, Ivan; Kos, Ivica", "title": "Tuber donnagotto, a new winter truffle species from Istria, Croatia", "date": "2012", "keywords": "bodies; brown; donnagotto; fruit; species; truffles; tuber", "summary": "Tuber donnagotto is substantially different from all known species of black truffles. [IRI]*, IVICA KOS University of Zagreb Faculty of Agriculture, Sveto{imunska 25, 10000 Zagreb, Croatia Abstract \u2013 Tuber donnagotto is a new winter black truffle belonging to the order Pezizales and the family Tuberaceae.", "mime": "application/pdf"}, {"id": "abc-546", "words": "2124", "extension": ".pdf", "flesch": "70", "author": "Dragicevic, Snezana; Papp, Beata; Erzberger, Peter", "title": "Distribution of Buxbaumia viridis (Moug. ex Lam. et DC.) Brid. ex Moug. et Nestl. (Bryophyta) in Montenegro", "date": "2012", "keywords": "buxbaumia; leg; montenegro; mts; papp; viridis", "summary": "It includes 8 mountainous regions: the Bjelasica Mts, Durmitor Mts, Hajla Mts, Komovi Mts, Ljubi{nja Mts, Prokletije Mts, Sinjajevina Mts and Visitor Mts (Fig. 1). Durmitor Mountain, Durmitor National Park, around Crno jezero lake at @abljak, 43\u00b008'52,0'' N, 19\u00b005'48,0'' E, ca 1400 m, conifer forest, on decaying trunk, leg.", "mime": "application/pdf"}, {"id": "abc-554", "words": "11576", "extension": ".pdf", "flesch": "75", "author": "Surina, Bostjan", "title": "Heaths with dwarf ericaceous shrubs and Alpine juniper (Juniperus alpina) in the Dinaric Alps: A nomenclatorial and synsystematic re-appraisal", "date": "2013", "keywords": "alps; dinaric; et al; hirsuti; horvat; juniperetum; laku{i; nom; profile; stands; surina; u m; vegetation", "summary": "72 (1), 113\u2013132, 2013 CODEN: ABCRA25 ISSN 0365\u20130588 eISSN 1847-8476 Heaths with dwarf ericaceous shrubs and Alpine juniper (Juniperus alpina) in the Dinaric Alps: A nomenclatorial and synsystematic re-appraisal BO[TJAN SURINA1, 2,* 1 University of Primorska, Faculty of Mathematics, Natural Sciences and Information Technologies, Glagolja{ka 8, SI-6000 Koper, Slovenia 2 Natural History Museum Rijeka, Lorenzov prolaz 1, 51000 Rijeka, Croatia Abstract \u2013 The ecology and phytosociology of north-western Dinaric heaths of the associ- ation Rhododendro hirsuti-Juniperetum alpinae Horvat ex Horvat et al. 1974 nom. in Meier et Br.-Bl. 1934; Berberido creticae-Juniperion foetidissimae Brullo et al. 2001;", "mime": "application/pdf"}, {"id": "abc-563", "words": "7209", "extension": ".pdf", "flesch": "53", "author": "Hegazy, Ahmad; Alatar, Abdelrahman A.; Lovett-Doust, Jon; El-Adawy, Hosam A.", "title": "Spatial and temporal plant phenological niche differentiation in the Wadi Degla desert ecosystem (Egypt)", "date": "2012", "keywords": "a. a.; desert; flowering; group; phenological; phenology; plant; populations; rainfall; species; spring; temperature; wadi", "summary": "Plant species belonging to different life forms in particular phenological groups exhib- ited similar phenological niches. Phenology \u2013 environment relationship The environmental variables representing different phenological groups all over the year are shown in table 3.", "mime": "application/pdf"}, {"id": "abc-571", "words": "5856", "extension": ".pdf", "flesch": "60", "author": "Rijal Leblad, Benlahcen; Lundholm, Nina; Goux, Didier; Veron, Benoit; Sagou, Regia; Taleb, Hamid; Nhhala, Hassan; Er-Raioui, Hassan", "title": "Pseudo-nitzschia Peragallo (Bacillariophyceae) diversity and domoic acid accumulation in tuberculate cockles and sweet clams in M\u2019diq Bay, Morocco", "date": "2013", "keywords": "acid; bay; et al; lebland; profile; pseudo; rijal; shellfish; species", "summary": "PAN, Y., MICHAEL, L. P., MARK, B., MOELLER, P. D. R., QUAY DORTCH, POWELL, C. L., DOUCETTE, G. J., 2001: The composition of Pseudo-nitzschia species varied greatly during the year (Fig. 4).", "mime": "application/pdf"}, {"id": "abc-577", "words": "5060", "extension": ".pdf", "flesch": "66", "author": "Popiela, Agnieszka; Lysko, Andrzej; Moln\u00e1r V., Attila", "title": "Recent distribution of the Euro-Siberian-sub-Mediterranean species Elatine alsinastrum L. (Elatinaceae)", "date": "2013", "keywords": "acta; alsinastrum; data; des; distribution; elatine; europe; flora; locations; plants; popiela; species", "summary": "Philcox, Cyperus fuscus L., Plantago major L. s.l., Gnaphalium uliginosum L., Eleocharis acicularis (L.) Roem. In: CASTROVIEJO, S. (ed.), Flora Iberica, 3. Real Jard\u00edn Bot\u00e1nico, Consejo Superior de Investigaciones Cient\u00edficas, Madrid. COUTINHO, A. X. P., 1939: Flora de Portugal: plantas vasculares, 2. Bertrand, Lisboa.", "mime": "application/pdf"}, {"id": "abc-579", "words": "1805", "extension": ".pdf", "flesch": "60", "author": "Iamonico, Duilio; Panitsa, Maria", "title": "Lectotypification of the Linnaean name Bryonia cretica (Cucurbitaceae)", "date": "2013", "keywords": "bryonia; cretica; cucurbitaceae; iamonico", "summary": "Authors\u2019 field data were used for the description of the plant communities in which B. cretica participates while for the habitat types, the codes and description of the European Nature Information System (EUNIS 2012) and those of Annex I of the Council Directive 92/43/EEC (EUR25 2003) were also used. None of these references include an illustration of B. cretica.", "mime": "application/pdf"}, {"id": "abc-582", "words": "5593", "extension": ".pdf", "flesch": "63", "author": "Roy, Nayan; Laskar, Subrata; Barik, Anandamay", "title": "Amino acids through developmental stages of sunflower leaves", "date": "2013", "keywords": "acids; amino; amino acids; content; leaf; leaves; roy; sunflower", "summary": "Key words: amino acids, Helianthus annuus, sunflower Introduction Studies in plant-insect interactions have mainly concentrated on the effects of insect performance of plant secondary metabolites or nutritive compounds (SCHOONHOVEN et al. 2005). The balance of amino acids that constitute plant proteins differs from that of insects and deficiency in even one essential amino acid in a herbivore diet may cause an unbalanced nitrogen metabolism in insects (BERENBAUM 1995).", "mime": "application/pdf"}, {"id": "abc-591", "words": "6971", "extension": ".pdf", "flesch": "60", "author": "Koukoulakis, Prodromos; Chatzissavvidis, Christos; Papadopoulos, Aristotelis; Pontikis, Dimitrios", "title": "Interactions between leaf macro, micronutrients and soil properties in pistachio (Pistacia vera L.) orchards", "date": "2013", "keywords": "interactions; nutrients; pistachio; soil", "summary": "Percent elemental contribution values by the interactions among i) soil properties and leaf nutrients, ii) leaf nutrients, iii) soil properties and soil nutrients, and iv) soil nutrients. Studying these results, the following may be concluded: the interactions between soil nutrients and soil properties play a significant role in supplying or decreasing the soil available plant nutrients, and therefore, they determine to a great extent the level of soil fertility.", "mime": "application/pdf"}, {"id": "abc-600", "words": "9182", "extension": ".pdf", "flesch": "63", "author": "Grozeva, Neli Hristova; Cvetanova, Yanka G.", "title": "Karyological and morphological variations within the genus Dysphania (Chenopodiaceae) in Bulgaria", "date": "2013", "keywords": "botrys; chenopodium; chromosome; cvetanova; dysphania; genus; grozeva; length; populations; profile; species", "summary": "Microphotographs of the metaphase plate of Dysphania species: A \u2013 D. multifida (popula- tion No 105) \u2013 2n = 36; B \u2013 D. multifida (No 40) \u2013 2n = 36. \u2013 Scale bars = 10 mm. Percentage of the interpopulation variation in the overall morphological variation for each character in Dysphania Character No Species D. botrys D. pumilio D. ambrosioides D. multifida 1 37.7 30.1 66.0 43.2 2 29.2 45.7 47.7 29.2 3 65.1 47.6 43.4 64.5 4 46.4 70.9 38.1 49.9 5 69.1 32.2 48.0 61.1 6 61.8 51.3 31.1 37.0 7 66.5 46.1 68.0 53.9 8 67.7 55.8 40.2 57.3 9 45.1 66.3 74.6 57.9 10 76.6 65.3 71.1 48.7 11 69.3 0.0 59.4 50.6 12 52.1 55.7 62.3 55.7 13 66.5 50.9 62.9 52.9 14 55.7 59.0 64.9 38.2 15 78.9 52.7 55.7 0.0 16 33.1 56.8 59.9 0.0 17 41.6 59.5 85.1 61.4 18 57.0 56.2 94.0 63.0", "mime": "application/pdf"}, {"id": "abc-603", "words": "6582", "extension": ".pdf", "flesch": "62", "author": "Erdos, Laszlo; Zalatnai, Marta; Batori, Zoltan; Kormoczi, Laszlo", "title": "Transitions between community complexes: a case study analysing gradients through mountain ridges in South Hungary", "date": "2014", "keywords": "boundaries; case; community; erdos; msw; peaks; profile; species; vegetation; widths; window", "summary": "Community Ecology 10, 75\u201380. VAN DER MAAREL, E., 1976: On the establishment of plant community boundaries. In the profile, vegetation boundaries appear as peaks.", "mime": "application/pdf"}, {"id": "abc-608", "words": "16031", "extension": ".pdf", "flesch": "96", "author": "Kosir, Petra; Carni, Andraz; Marinsek, Aleksander; Silc, Urban", "title": "Floodplain forest communities along the Mura River (NE Slovenia)", "date": "2013", "keywords": "floodplain; forests; kosir; mura; profile; river; species; stream; vegetation", "summary": "Zonation of forest vegetation can also be evidenced in a response curve of the main edifiers of plant communities (Fig. 7a) on the gradient of DCS. Response curve of main edifiers of plant communities in the gradient of DMS on the other hand proved the already established fact that DMS is not an underlying gradient for the zonation of forest vegetation.", "mime": "application/pdf"}, {"id": "abc-611", "words": "5474", "extension": ".pdf", "flesch": "59", "author": "Siddiqui, Zamin Shaheed", "title": "Effects of double stress on antioxidant enzyme activity in Vigna radiata (L.) Wilczek", "date": "2013", "keywords": "activities; activity; antioxidant; environment; enzyme; lead; nacl; peroxidase; stress", "summary": "KeyWord: Antioxidant, catalase, enzyme activity, glutathione reductase, guaiacol per- oxidase, scorbate peroxidase, seedling, stress, superoxide dismutase, Vigna radiata Abbreviations: APX \u2013 ascorbate peroxidase, CAT \u2013 catalase, GPX \u2013 guaiacol peroxidase, GR \u2013 glutathione reductase, ROS \u2013 reactive oxygen species, SOD \u2013 superoxide dismutase Introduction Environmental stress factors like drought, temperature, high salinity and heavy metals are the major constraint that limit plant growth and productivity, by disturbing the intra- cellular water balance. TATIANA, Z., YAMASHITA, K., MATSUMOTO, H., 1999: Iron deficiency Induced changes in ascorbate content and enzyme activities related to ascorbate metabolism in cucumber root.", "mime": "application/pdf"}, {"id": "abc-625", "words": "5004", "extension": ".pdf", "flesch": "51", "author": "Pise, Navnath M.; Gaikwad, Dattatry K.; Jagtap, Tanaji G.", "title": "Oxidative stress and antioxidant indices of marine alga Porphyra vietnamensis", "date": "2013", "keywords": "antioxidant; dona; h2o2; marine; metal; paula; stress; vietnamensis", "summary": "Induction of oxidative stress biomarkers associated with heavy metal stress in Fontinalis antipyretica Hedw. The alphabetical letters (a, b, c) mark significant difference at p < 0.05. Antioxidant defence systems In the present study, CAT activity was significantly higher in the sample from Dona Paula and Malvan, further indicating metal stress increasing the formation rate of H2O2 (Fig. 2B).", "mime": "application/pdf"}, {"id": "abc-626", "words": "6637", "extension": ".pdf", "flesch": "59", "author": "Kaya, Cengiz; Aydemir, Salih; Sonmez, Osman; Ashraf, Muhammed; Dikilitas, Murat", "title": "Regulation of growth and some key physiological processes in salt-stressed maize (Zea mays L.) plants by exogenous application of asparagine and glycerol", "date": "2013", "keywords": "asparagine; glycerol; growth; kaya; maize; maize plants; plants; profile; salt; stress", "summary": "ASHRAF, M., 2009: Biotechnological approach of improving plant salt tolerance using anti- oxidants as markers. Glycerol was more effective than aspara- gine in improving salinity tolerance of maize plants in terms of growth and physiological attributes measured in the present study.", "mime": "application/pdf"}, {"id": "abc-635", "words": "7147", "extension": ".pdf", "flesch": "67", "author": "Kabas, Eva; Alegro, Antun; Kuzmanovic, Nevena; Jakovljevic, Ksenija; Vukojicic, Snezana; Lakusic, Dmitar", "title": "Stipetum novakii ass. nova \u2013 a new association of serpentine rocky grassland vegetation (Halacsyetalia sendtneri) in Serbia", "date": "2013", "keywords": "a.s.l; communities; community; kabas; kabas et; novakii; profile; serbia; serpentine; species; vegetation", "summary": "However, such a situation enables the development of a certain number of endemic serpentine species such as Stipa novakii, Halacsya sendtneri (Boiss.) Abstract \u2013 Phytosociological characteristics of grassland communities above serpentines (order Halacsyetalia sendtneri H. Ritter-Studni~ka 1970) in Serbia, are analyzed accord- ing to Braun-Blanquet methodology.", "mime": "application/pdf"}, {"id": "abc-642", "words": "5682", "extension": ".pdf", "flesch": "55", "author": "Saini, Ramesh K; Akitha Devi, Muthu K; Parvatam, Giridhar; Ravishankar, Gokare A", "title": "Augmentation of major isoflavones in Glycine max L. through elicitor mediated approach", "date": "2013", "keywords": "content; et al; food; isoflavone; plant; seeds; soybean; total", "summary": "However, soybean isoflavones are potent antioxidants and free radical scavengers, as shown by several reports (LEE et al. 2002, LIN and LAI 2006, BOUE et al. 2008, SAKTHIVELU et al. 2008, AKITHA DEVI et al. 2009). Abstract \u2013 Isoflavone content in soybean seeds was enhanced by the elicitor-mediated ap- proach under field conditions through the floral application of abiotic elicitors-salicylic acid, methyl jasmonate and biotic elicitors-Aspergillus niger and Rhizopus oligosporus.", "mime": "application/pdf"}, {"id": "abc-647", "words": "2857", "extension": ".pdf", "flesch": "65", "author": "Vukovic, Nina; Tommasoni, Annalisa; D\u2019Onofrio, Tancredi", "title": "The orchid Ophrys speculum Link (Orchidaceae) in Croatia", "date": "2013", "keywords": "ciliata; croatia; delforge; flora; ophrys; profile; species; speculum", "summary": "Results Three individuals of Ophrys speculum ssp. Keywords: Ophrys speculum, orchid, Rt Kamenjak, Istria, Croatia Introduction In Croatian flora the genus Ophrys is present with 67 taxa, the largest genus in terms of number of taxa from the Orchidaceae family (HR[AK 2000, BOGDANOVI] 2004, NIKOLI] 2012).", "mime": "application/pdf"}, {"id": "abc-677", "words": "15847", "extension": ".pdf", "flesch": "80", "author": "Di Pietro, Romeo; Wagensommer, Robert Philipp", "title": "A new Sesleria juncifolia association from south-eastern Italy and its position in the amphi-Adriatic biogeographical context", "date": "2014", "keywords": "communities; e e; e n; e r; e t; gargano; grasslands; italy; juncifolia; pietro; profile; r o; sesleria; seslerietum; southern; species; stipo; subsp; t r", "summary": "Conclusion The description of Stipo austroitalicae-Seslerietum juncifoliae is a step towards filling a gap in the phytosociological knowledge of the Apulian vegetational pattern and in defining the syntaxonomical and distributional framework of Sesleria juncifolia communities in Peninsular Italy. Due to the relict and scattered distribution of Sesleria juncifolia in Apulia region, the variances in species composition amongst the different subassociations are mainly influenced by local factors.", "mime": "application/pdf"}, {"id": "abc-681", "words": "7397", "extension": ".pdf", "flesch": "55", "author": "Perrone, Rosaria; De Rosa, Paolo; De Castro, Olga; Colombo, Paolo", "title": "Leaf and stem anatomy in eight Hypericum species (Clusiaceae)", "date": "2013", "keywords": "adaxial; bars; cells; fig; hypericum; leaf; perforatum; scale; secretory; species; stem; surface; type", "summary": "The species are mostly mesophytes (H. perforatum, H. perfoliatum, H. pubescens, H. androsaemum, H. hircinum), but there are also meso-hygrophytes such as H. tetrapterum, and xerophytes and xero-halophytes such as H. triquetrifolium and H. aegypticum respec- tively. Stem anatomy From a morphological point of view the stem presents: in hemicryptophyte scapose spe- cies, lignified and prostrate at the base, briefly creeping, in H. perforatum and H. perfo- liatum respectively; lignified creeping with ascending branches in H. pubescens; prostrate then erect, ligneous in H. tetrapterum and H. triquetrifolium, in the latter strongly branching (PIGNATTI 1982).", "mime": "application/pdf"}, {"id": "abc-692", "words": "5632", "extension": ".pdf", "flesch": "54", "author": "Luca, Alessia; Belusci, Francesca; Pellegrino, Giuseppe", "title": "Interactions with mycorrhizal fungi in two closely related hybridizing orchid species", "date": "2014", "keywords": "et al; fungi; italica; luca; luca et; mycorrhizal; orchis; profile; species", "summary": "From the beginning of 2000, a large number of orchid mycorrhizal has been identified directly from orchid roots, tubers and rhizomes through molecular biology techniques (SHEFFERSON et al. 2007, STOCKINGER et al. 2010, JACQUEMYN et al. 2011a). Interestingly, 30% of orchid species shows non-rewarding flowers (RENNER 2005), attracting pollinators by generalized food deception, mimicry or sexual deception (JERSAKOVA et al. 2006).", "mime": "application/pdf"}, {"id": "abc-700", "words": "2771", "extension": ".pdf", "flesch": "65", "author": "Kalinka, Anna; Misfud, Stephen; Popiela, Agnieszka; Achrem, Magdalena", "title": "Chromosome number of Elatine gussonei (Sommier) Brullo (Elatinaceae) and its distribution on the Maltese islands", "date": "2014", "keywords": "chromosome; elatine; gussonei; kalinka; number; sommier; species", "summary": "Key words: Elatine gussonei, chromosome number, phytogeography Introduction Elatinaceae Dum. is a small cosmopolitan family of herbaceous aquatic and semi-aqua- tic plants and terrestrial shrubs composed of two genera, i.e. Elatine L., comprising about 15\u201320 taxa, and occurring in areas of moderate temperatures in both hemispheres, and Bergia L., with about 25 species occurring mostly in tropical areas of the Old World, primarily in Africa, and also in Australia (TUCKER 1986, LEACH 1989). The number of chromosomes in Elatine gussonei was not previously reported, in contrast to the unequivocal results of chromosome number for other species of the Elatine genus.", "mime": "application/pdf"}, {"id": "abc-701", "words": "5095", "extension": ".pdf", "flesch": "55", "author": "Besendorfer, Visnja; Mlinarec, Jelena", "title": "Retention of relict satellite DNA sequences in Anemone (Ranunculaceae)", "date": "2013", "keywords": "ahtr1; anemone; besendorfer; blanda; dna; hortensis; mlinarec; pavonina; profile; satdna; satellite; sequences; species", "summary": "EHRENDORFER, F., ZIMAN, S. N., K\u00d6NIG, C., KEENER, C. S., DUTTON, B. E., TSARENKO, O. N., BULAKH, E. V., BOSCAIU, M., M\u00c9DAIL, F., K\u00c4STNER A., 2009: Taxonomic revision, phy- logenetics and transcontinental distribution of Anemone section Anemone (Ranuncula- ceae). Features of AhTR1 sequences by Anemone species.", "mime": "application/pdf"}, {"id": "abc-703", "words": "5047", "extension": ".pdf", "flesch": "60", "author": "Hayat, Shamsul; Hayat, Qaiser; Alyemeni, Mohammed Naseer; Ahmad, Aquil", "title": "Proline enhances antioxidative enzyme activity, photosynthesis and yield of Cicer arietinum L. exposed to cadmium stress", "date": "2013", "keywords": "cadmium; control; hayat; plants; proline; soil", "summary": "The foliar treatment of proline resulted in the alleviation of the adverse effects generated by metal exposure, which was expressed in terms of the increase in plant growth. All the parameters studied followed a similar trend at both the sampling stages; however, the magnitude of the data for these parameters was higher at 90 DAS, and therefore, the data obtained at this stage of plant growth are presented in the present study.", "mime": "application/pdf"}, {"id": "abc-708", "words": "5178", "extension": ".pdf", "flesch": "60", "author": "Praxedes, Sidney Carlos; DaMatta, F\u00e1bio Murillo; Lacerda, Claudivan Feitosa de; Prisco, Jos\u00e9 Tarquinio; Gomes-Filho, En\u00e9as", "title": "Salt stress tolerance in cowpea is poorly related to the ability to cope with oxidative stress", "date": "2014", "keywords": "apx; cat; leaves; plant; praxedes; profile; salt; stress; tolerance", "summary": "We ana- lyzed the long-term effects of salt stress on oxidative damage and protection against reactive oxygen species in both leaves and roots of a salt-tolerant (Piti\u00faba) and a salt-sensi- tive (TVu) cowpea cultivar. We also hypothesized that leaves and roots display different antioxi- dative abilities to cope with salt stress.", "mime": "application/pdf"}, {"id": "abc-710", "words": "5674", "extension": ".pdf", "flesch": "66", "author": "Hu, Zhuju; Li, Yanling; Metzeltin, Ditmar", "title": "Three new species of Cymbella (Bacillariophyta) from high altitude lakes, China", "date": "2013", "keywords": "area; cymbella; fig; krammer; lake; raphe; species; striae; valve", "summary": "The internal view of C. heihainensis and C. shudunensis should be supplemented in future study. The most similar taxon is C. modicepunctata: it has larger valve size, bigger central area, and more striae in 10 mm, distinguishing it from C. heihainensis.", "mime": "application/pdf"}, {"id": "abc-722", "words": "6694", "extension": ".pdf", "flesch": "53", "author": "Viljevac, Marija; Dugalic, Krunoslav; Mihaljevic, Ines; \u0160imic, Domagoj; Sudar, Rezica; Jurkovic, Zorica; Lepedu\u0161, Hrvoje", "title": "Chlorophylls content and photosynthetic efficiency in two sour cherry (Prunus cerasus L.) genotypes under drought stress", "date": "2013", "keywords": "cherry; chlorophyll; control; drought; genotypes; kelleris; leaves; reaction; stress; water", "summary": "By con- trast, electron transport per active reaction center (ET0/RC) was significantly lowered in drought treatment leaves of genotype Kelleris 16 while the same parameter in drought treat- ment leaves of genotype OS remain unchanged (Fig. 4C). Genotype / parameter Kelleris 16 OS t p(t) t p(t) ABS/RC \u20134.39 *** \u20134.15 *** TR0/RC \u20130.72 ns \u20132.84 ** ET0/RC 15.70 *** \u20130.17 ns DI0/RC \u20134.02 ** \u20132.97 ** sorption (ABS/RC) and dissipation (DI0/RC) of light energy per active reaction centre were significantly higher in drought treated leaves than in control leaves of both genotypes (Fig. 4A and D).", "mime": "application/pdf"}, {"id": "abc-730", "words": "4550", "extension": ".pdf", "flesch": "61", "author": "Vidakovic-Cifrek, \u017deljka; Soric, Sonja; Babic, Marija", "title": "Growth and photosynthesis of Lemna minor L. exposed to different light conditions and sucrose supplies", "date": "2013", "keywords": "duckweed; g l\u20131; growth; lemna; light; l\u20131; mmol; plants; sucrose", "summary": "The influence of light spectral distribution and intensity on plant growth rate and photosynthesis was proved a long time ago. Plant growth is dependent not only on the composition of nutrient media but also on chamber conditions \u2013 tempera- ture, photoperiod and light quality.", "mime": "application/pdf"}, {"id": "abc-741", "words": "7185", "extension": ".pdf", "flesch": "61", "author": "Muniappan, Vellaisamy; Muthukumar, Thangavelu", "title": "Influence of crop species and edaphic factors on the distribution and abundance of Trichoderma in Alfisol soils of southern India", "date": "2014", "keywords": "abundance; factors; fungal; koningii; muniappan; populations; profile; soil; species; trichoderma", "summary": "The abundance of soil fungi ranged be- tween 7.0 \u00d7 103 and 13.6 \u00d7 103 colony forming units (cfus) per gram of dry soil. Compendium of soil fungi.", "mime": "application/pdf"}, {"id": "abc-742", "words": "8494", "extension": ".pdf", "flesch": "59", "author": "Kristkova, Eva; Lebeda, Ales; Novotna, Alzbeta; Dolezalova, Ivana; Berka, Tomas", "title": "Morphological variation of Lactuca serriola L. achenes as a function of their geographic origin", "date": "2014", "keywords": "achene; body; dispersal; et al; lactuca; length; pappus; populations; profile; serriola; slovenia; species; sweden", "summary": "The first compilation of data on morphological parameters of L. serriola achenes was presented by NOVOTN\u00c1 et al. (2011) where achene parameters from 50 populations of prick- ly lettuce from the Czech Republic, Germany, the Netherlands and the United Kingdom ACTA BOT. NOVOTN\u00c1 et al. (2011) also showed that with increasing latitude, i.e. from south to north, L. serriola achenes were longer, narrower, with fewer ribs, and longer beaks.", "mime": "application/pdf"}, {"id": "abc-745", "words": "8468", "extension": ".pdf", "flesch": "63", "author": "Woch, Marcin Wiktor; Radwanska, Magdalena; Stefanowitz, Anna M.", "title": "Vascular flora of spoil heaps after hard coal mining in Trzebinia (S Poland): effect of substratum properties.", "date": "2013", "keywords": "acta; area; coal; d h; flora; h r; hu h; kg\u20131; mx h; plant; r zooch; species; substratum; zooch", "summary": "Hu M Hemi Zooch Ranunculus acris 3 D, Hu H R Au Ranunculus bulbosus 1 Mx T A Au Vicia cracca 71 Mx, Hu H R Au Viola arvensis 5 Mx, D, Hu T A Zooch Viola riviniana 1 Hu H R Zooch Tab.", "mime": "application/pdf"}, {"id": "abc-746", "words": "5050", "extension": ".pdf", "flesch": "58", "author": "Sajna, Nina; Regvar, Marjana; Kaligaric, Simona; \u0160kvorc, \u017deljko; Kaligaric, Mitja; Kaligaric, Mitja", "title": "Germination characteristics of Salicornia patula Duval-Jouve, S. emerici Duval-Jouve, and S. veneta Pign. et Lausi and their occurrence in Croatia", "date": "2013", "keywords": "emerici; germination; patula; s. emerici; s. veneta; salicornia; seeds; species; veneta", "summary": "[%] Conditions: dH2O Salinity (340 mM NaCl) S. emerici S. veneta S. patula S. emerici S. veneta S. patula 1 7.5/2.5 2.5/0 5/0 5/0 0/0 0/0 2 17.5/7.5 20/7.5 5/0 7.5/0 7.5/0 0/0 3 20/10 30/10 30/0 7.5/0 10/0 5/0 4 22.5/10 35/12.5 90/0 7.5/0 10/0 10/0 5 22.5/10 35/12.5 90/0 7.5/0 10/0 10/0 6 25/20 40/15 95/0 7.5/0 10/0 10/0 7 25/30 47.5/30 100/5 7.5/0 10/0 25/5 8 27.5/32.5 50/32.5 100/5 7.5 20/0 25/5 9 37.5/50 52.5/57.5 100/5 12.5 20/0 25/5 10 37.5/50 52.5/57.5 100/5 12.5 20/0 25/5 11 40/50 52.5/57.5 100/5 12.5 22.5/2.5 25/5 12 40/52.5 52.5/60 100/5 12.5 22.5/2.5 30/5 13 40/52.5 52.5/60 100/5 12.5 22.5/2.5 30/5 14 40/55 52.5/60 100/5 15 22.5/2.5 30/5 15 40/57.5 52.5/65 100/5 15 22.5/2.5 30/5 16 40/57.5 52.5/67.5 100/5 15 22.5/2.5 30/5 17 40/57.5 52.5/67.5 100/5 15 22.5/2.5 30/5 18 40/57.5 55.5/70 100/5 15 22.5/2.5 30/5 in saline conditions (Fig. 2c). In: WEBB, D. A. (Ed.), Flora Europea, 1. Cambridge Uni- versity Press, London. BEER, S. S., BEER, A. S., SOKOLOFF, D. D., 2010: Flower and inflorescence development in Salicornia (Chenopodiaceae).", "mime": "application/pdf"}, {"id": "abc-754", "words": "6854", "extension": ".pdf", "flesch": "53", "author": "Altinok, Hacer Handan; Dikilitas, Murat", "title": "Antioxydant response to biotic and abiotic inducers for the resistance against Fusarium wilt disease in eggplant (Solanum melongena L.)", "date": "2014", "keywords": "accumulation; altinok; asm; disease; eggplant; fom; fomg; fusarium; h2o2; pathogen; plants; profile; resistance", "summary": "H2O2 from a potential oxidative cross-linking of the cell wall at the plant cell surface has been previously reported to be a characteristic response of plant cells to microbial elicitors or challenge with an avirulent pathogen (GRANT and LOAKE 2000). The current study with FOM on Fomg-inoculated plants also showed that the activation of plant resistance might possibly activate the genes that might in turn provide valuable in- formation concerning fungal resistance mechanisms by using nonpathogenic Fusarium oxysporum formae speciales on eggplant.", "mime": "application/pdf"}, {"id": "abc-755", "words": "5887", "extension": ".pdf", "flesch": "61", "author": "Saeidi Mehrvarz, Shahryar; Yousefi, Narjes; Mohammadi, Maryam; Marcussen, Thomas", "title": "Pollen studies in the genus Viola (Violaceae) from Iran", "date": "2014", "keywords": "iran; pollen; section; species; viola", "summary": "The two Iranian species of Section Spathulidium are morphologically similar but can be easily separated using palynological characters: V. pachyrrhiza has perforate exine (Fig. 4D), whilst V. spathulata has granulate exine ornamentation (Figs. 4E\u2013F). Previously these species, i.e.. V. pachyrrhiza and V. spathulata were included in section Plagiostigma subsection Patellares (as section", "mime": "application/pdf"}, {"id": "abc-759", "words": "2981", "extension": ".pdf", "flesch": "71", "author": "Csiky, J\u00e1nos; Purger, Dragica", "title": "Herbaceous periwinkle, Vinca herbacea Waldst. et Kit. 1799 (Apocynaceae), a new species of the Croatian flora", "date": "2013", "keywords": "croatia; flora; herbacea; hungarian; hungary; plants; species; vinca", "summary": "Since V. herbacea was included neither in the handbooks for plant identification nor in the current Croatian Flora Database, a new key for the determination of Vinca L. species of Croatia is presented herein. Monitoring of plant species along the Drava river and the Hungarian-Croatian border.", "mime": "application/pdf"}, {"id": "abc-76", "words": "5394", "extension": ".pdf", "flesch": "65", "author": "Ozkan, Mustafa; Aktas, Kamuran; Ozdemir, Canan; Guerin, Greg", "title": "Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey", "date": "2009", "keywords": "lamiaceae; mericarps; salvia; species; subsp; verticillata", "summary": "ZHOU, S. L., PAN, K. Y., HONG, D. Y., 1997: 68 (1), 105\u2013115, 2009 CODEN: ABCRA25 ISSN 0365\u20130588 Nutlet morphology and its taxonomic utility in Salvia (Lamiaceae: Mentheae) from Turkey MUSTAFA \u00d6ZKAN 1, K\u00c2MURAN AKTASz2*, CANAN \u00d6ZDEMIR 2, GREG GUERIN 3 1 Ahi Evran University, Faculty of Art and Science, Department of Biology, Kirsehir, Turkey 2 Celal Bayar University, Faculty of Art and Science, Department of Biology, Manisa, Turkey 3 Western Australian Herbarium, Department of Environment and Conservation, Adelaide, Australia The nutlet (mericarp) morphology of 12 Salvia L. (Lamiaceae: sub-family Nepetoideae: tribe Mentheae: sub-tribe Salviinae) taxa from Turkey, including five endemic taxa, was examined using scanning electron microscopy: Salvia bracteata Banks et Sol., S. cadmica Boiss., S. blepharoclaena Hedge et Hub.-Mor., S. cryptantha Montbret et Aucher ex Bentham, S. aethiopis L, S. ceratophylla L., S. candidissima Vahl subsp.", "mime": "application/pdf"}, {"id": "abc-762", "words": "2093", "extension": ".pdf", "flesch": "51", "author": "T.E, Sheeja; Kizhakayil, Dhanya; Sheeja, Thotten E.; Sasikumar, Bhaskaran; Bhat, Alanghar I.; Parthasarathy, Villlupanoor A.", "title": "Novel polymorphic microsatellite markers from turmeric, Curcuma longa L. (Zingiberaceae)", "date": "2013", "keywords": "cumisat; markers; microsatellite; turmeric", "summary": "Na D GenBank accession numberReverse primer (5'\u20133') CuMiSat -19 CATGCAAATGGAAATTGACAC (AC)16 (AT)6 65 204\u2013154 8 0.67 HQ154119 TGATAAATTGACACATGGCAGTC CuMiSat -20 CGATACGAGTCCATCTCTTCG (AC)6 65 158\u2013148 8 0.64 HQ154120 CCTTGCTTTGGTGGCTAGAG CuMiSat -21 TCATTCAAAGTCCGATGGAA (AAG)9 62 164\u2013146 6 0.67 HM438970 TTCGAGTGCAGAAGGAGAATTA CuMiSat -22 AATTTATTAGCCCGGACCAC (CTT)10 64 158\u2013122 7 0.67 HM438971 AAGAAAGTGAGTAGAAACCAAAGC CuMiSat -23 CGTGGAAGGTGAGTTTGAC (AAG)4 65 165\u2013132 3 0.66 HM438972 CAGAAGGGAACTGAGATGG CuMiSat -24 AGGTATTCTACTCGACCAAG (AAC)10 58 141\u2013123 4 0.60 HM438973 AAATTCATATAGCCCCATC CuMiSat -25 TACATGAGAAACAACAAAGCCC (AAC)7 65 146\u2013140 3 0.60 HM438974 AGTTAGCCAAGTCCCAATTTAGC CuMiSat -26 CATTCCGATGAATTGTATG (AAC)9 58 208\u2013188 5 0.61 HM438975 GCAGTTGTTTTGCTTCAG CuMiSat -27 TATAGATAGCCATGCTGAAG (AC)8 63 121\u2013111 4 0.25 HM438976 CCATTTTAGTTCATTACGTG CuMiSat -28 TTCAACTTCTCCTCGCTCAG (AAG)7(GAT)5 65 160\u2013139 7 0.67 HM438977 GCAAGGTCTGCATCTATTTCTC CuMiSat -29 GTGGTATCCCCATGAAGAGC (AAG)10 65 177\u2013150 8 0.67 HM438978 ATGACCAAGCCCTTTCACC 410 A C T A B O T .C R O A T .72 (2),2013 S E N A N S.,K IZ H A K A Y IL D .,S H E E JA T .E .,S A SIK U M A R B .,B H A T A .I.,P A R T H A SA R A T H Y V .A . This limited availability warrants the need to expand the existing repertoire of microsatellite markers for future studies aiming at better estimation of genetic variability for the effective conservation of the genetic resources of turmeric.", "mime": "application/pdf"}, {"id": "abc-785", "words": "1276", "extension": ".pdf", "flesch": "53", "author": "Kovacic, Sanja", "title": "Second Week of Croatian Botanical Gardens and Arboreta (May 14 -19, 2012)", "date": "2013", "keywords": "botanical; garden; kovacic; profile", "summary": "Sanja Kova~i} Croatian Botanical Society \u2013 Section of Botanical Gardens and Arboreta, De- partment of Botany and Botanical Garden, Division of Biology, Faculty of Science, University of Zagreb, Maruli}ev trg 9a, HR \u2013 10000 Zagreb, Croatia E-mail: sanja.kovacic@biol.pmf.hr S4 ACTA BOT. 72 (1), S1\u2013S4, 2013 CODEN: ABCRA25 ISSN 0365\u20130588 eISSN 1847-8476 Second Week of Croatian Botanical Gardens and Arboreta (May 14\u201319, 2012)", "mime": "application/pdf"}, {"id": "abc-796", "words": "3328", "extension": ".pdf", "flesch": "61", "author": "Jezic, Marin; Karoglan Kontic, Jasminka; Preiner, Darko; Maletic, Edi; Curkovic-Perica, Mirna", "title": "Grapevine yellows affecting Croatian autochthonous grapevine cultivar 'Grk'", "date": "2013", "keywords": "16sri; croatia; grapevine; grk; phytoplasma", "summary": "MUSETTI, R., 2008: Managment and ecology of phytoplasma diseases of grapevine and fruit crops. Grk population with those grapevine-as- sociated viruses tested for is much lower than the average for grapevine cultivars in Dalmatia,which reaches about 90% of virus-infected vines (KAROGLAN KONTI] et al. 2009).", "mime": "application/pdf"}, {"id": "abc-806", "words": "8725", "extension": ".pdf", "flesch": "58", "author": "Zaman, Tanjeena; Asaeda, Takashi", "title": "Assessment of macro-micro elements accumulation capabilities of Elodea nuttallii under gradient redox statuses with elevated NH4-N concentration", "date": "2014", "keywords": "concentration; conditions; elements; elodea; metal; nh4; nuttallii; oxic; plant; ppm; profile; redox; sediment; treatments; zaman", "summary": "Parameters Control 2.5 ppm NH4-N 10 ppm NH4-N Oxic Reduced Highly reduced Oxic Reduced Highly reduced Chla 2.9 \u00b1 0.1 3.2 \u00b1 0.2 1.7 \u00b1 0.2* 1.4 \u00b1 0.2** 2.7 \u00b1 0.1 1.2 \u00b1 0.1** 1.0 \u00b1 0.0*** Chlb 1.4 \u00b1 0.1 1.7 \u00b1 0.2 1.1 \u00b1 0.2* 1.0 \u00b1 0.0** 1.3 \u00b1 0.2 1.0 \u00b1 0.1** 0.9 \u00b1 0.1** Carotenoid 1.1 \u00b1 0.0 1.3 \u00b1 0.2 0.9 \u00b1 0.0* 0.5 \u00b1 0.1** 0.9 \u00b1 0.1* 0.3 \u00b1 0.0** 0.0 \u00b1 0.0*** Fv/Fm 0.7 \u00b1 0.0 0.8 \u00b1 0.0 0.6 \u00b1 0.0 0.5 \u00b1 0.0* 0.7 \u00b1 0.0 0.5 \u00b1 0.0* 0.4 \u00b1 0.0* 10.1 \u00b1 3.1b 4.2 \u00b1 0.5c 3.1 \u00b1 0.2cd K 14.3 \u00b1 4.6a 13.9 \u00b1 4.1a 4.9 \u00b1 1.6c 4.2 \u00b1 1.1 c 12.6 \u00b1 4.8a 4.2 \u00b1 1.0 c 3.6 \u00b1 0.8 cd S 2.3 \u00b1 1.1c 2.6 \u00b1 0.8c 3.9 \u00b1 1.2bc 4.0 \u00b1 1.2bc 2.7 \u00b1 1.0c 3.3 \u00b1 0.8c", "mime": "application/pdf"}, {"id": "abc-808", "words": "3729", "extension": ".pdf", "flesch": "67", "author": "Mayrhofer, Helmut; Drescher, Anton; Ste\u0161evic, Danijela; Bilovitz, Peter Othmar", "title": "Lichenized fungi of the chestnut grove in Livari (Rumija, Montenegro)", "date": "2013", "keywords": "ach; bilovitz; chestnut; fungi; lichen; mayrhofer; montenegro; species", "summary": "et P. James X X X Flavoparmelia caperata (L.) Hale X X X X X Fuscopannaria mediterranea (C. Tav.) Moberg X X X Phlyctis argena (Spreng.)", "mime": "application/pdf"}, {"id": "abc-81", "words": "3453", "extension": ".pdf", "flesch": "67", "author": "Tanaka, Hiroyuki; Nagumo, Tamotsu", "title": "Two new Mesodictyopsis species, M. akitaensis sp. nov. and M. miyatanus sp. nov., from a Late Miocene to Pliocene freshwater sediment, Japan", "date": "2009", "keywords": "face; fig; figs; mantle; mesodictyopsis; valve", "summary": "33 \u2013 de- tailed view of valve face showing opening of valve face fultoportula (large arrow), openings of two mantle fultoportulae (small arrows) and opening of rimoportula (arrowhead). 19 \u2013 oblique view of figure 18 showing opening of valve face fultoportula (arrow), opening of rimoportula (arrowhead).", "mime": "application/pdf"}, {"id": "abc-811", "words": "4181", "extension": ".pdf", "flesch": "64", "author": "Cepak, Vladislav; Lukavsky, Jaromir", "title": "Cryoseston of the Pirin Mountains, Bulgaria", "date": "2013", "keywords": "acta; cells; chloromonas; cryoseston; figs; hoham; lukavsk\u00fd; mountains; nivalis; pirin; snow", "summary": "Identification of astaxanthin diglucoside diesters from snow alga Chlamydomonas nivalis by liquid chromatography \u2013 atmospheric pressure chemical ionization mass spectrometry. Rhizophydium acuforme has been observed several times, as common parasites of moving Chlamydomonas cells (LETCHER and POWELL 2012, LUKAVSK\u00dd 1970).", "mime": "application/pdf"}, {"id": "abc-812", "words": "7112", "extension": ".pdf", "flesch": "54", "author": "Xystrakis, Fotios; Theodoropoulos, Kostantinos; Eleftheriadou, Eleni; Samaras, Dimitrios A.; Damianidis, Christos; Papadopoulos, Theodoros", "title": "Succession rates and patterns twelve years after land use abandonment in the estuary of river Aliakmon, N. Greece", "date": "2014", "keywords": "changes; group; plots; profile; rates; species; succession; taxa; values; vegetation; xystrakis; xystrakis et; years", "summary": "The land-use abandonment in an area in the estuary of the River Aliakmon, N. Greece, provides an opportunity to study medium-term rates and patterns during the first twelve years of vegetation succession. In such special environments, the distinct abiotic conditions control the patterns of vegetation succession (ANDERSON 2007).", "mime": "application/pdf"}, {"id": "abc-815", "words": "16095", "extension": ".pdf", "flesch": "66", "author": "Surina, Bostjan; Martincic, Andrej", "title": "Ecology and niche assembly of Campanula tommasiniana, a narrow endemic of Mt Ucka (Liburnian karst, northwestern Adriatic)", "date": "2014", "keywords": "b o; c c; c m; c o; c r; c s; c t; campanula; cfc; e c; e e; e n; e r; l e; l t; m s; n d; o l; o t; profile; r o; r p; r t; s s; s u; surina; tab; taxa; tommasiniana; u r; var", "summary": "In number and coverage of vascular plant taxa, hemicryptophytes com- pletely prevail and represent more than a half of all registered vascular plant taxa (D%=46.4\u2013 89.2), followed by phanerophytes (18%, D%=1.4\u201338.5), geophytes (15%, D%=2.6\u201312.3), therophytes (5%, D%=0\u201313.3) and chamaephytes (3%, D%=0\u201327.8). 4. \u2013 continued Association SjC CfC SaC Subassociation S G C Variant M S S M Pla str Plasteurhynchium striatulum 11 2 6 1 .", "mime": "application/pdf"}, {"id": "abc-816", "words": "4563", "extension": ".pdf", "flesch": "65", "author": "Cakovic, Danka; Stesevic, Danijela; Vuksanovic, Snezana; Tan, Kit", "title": "Colchicum cupanii Guss. subsp. glossophyllum (Heldr.) Rouy, Datura innoxia Mill. and Eclipta prostrata (L.) L., new floristic records in Montenegro and western Balkan", "date": "2014", "keywords": "acta; beach; cakovic; datura; flora; long; montenegro; profile; species; ulcinj", "summary": "In addition to Eclipta L. numerous adventive species were present, indicating a strong anthropogenic influence at this site: Conyza canadensis, Paspalum paspalodes (Michx) Scribner, Euphorbia maculata L., Sporobolus poirettii (R. et S.) Hitchc, Oenothera biennis L., Xanthium italicum Moretti, Aster squamatus (Spreng) Hieron. Acta Botanica Croatica 41, 155\u2013170. HOLM, L. G., PLUCKNETT, D. L., PANCHO, J. V., HERBERGER, J. P. 1977:", "mime": "application/pdf"}, {"id": "abc-818", "words": "5308", "extension": ".pdf", "flesch": "58", "author": "Puizina, Jasna", "title": "Shallots in Croatia \u2013 genetics, morphology and nomenclature", "date": "2013", "keywords": "a. cepa; allium; cepa; cornutum; onion; puizina; shallot; triploid", "summary": "The shallot A. \u00d7 proliferum represents a hybrid between the two closely related species, A. cepa and A. fistulosum L. The third form of shallot, A. \u00d7 cornutum is a still incompletely understood triploid hybrid between A. cepa and one or two closely related Allium species, whose identity has not been fully elucidated.", "mime": "application/pdf"}, {"id": "abc-82", "words": "6273", "extension": ".pdf", "flesch": "48", "author": "Cox, Eileen J.", "title": "What is in a name? Diatom classification should reflect systematic relationships.", "date": "2009", "keywords": "characters; classification; cox; diatom; genera; genus; species; taxa", "summary": "Annotated list of new diatom taxa described by Horst Lange-Bertalot until the year 2000. \ufffd If new taxa group with members of an existing higher taxon, but exhibit characters not previously recorded for the higher taxon, be prepared to modify the diagnosis of the latter.", "mime": "application/pdf"}, {"id": "abc-821", "words": "11114", "extension": ".pdf", "flesch": "73", "author": "Carni, Andra\u017e; Matevski, Vlado; Silc, Urban; Custerevska, Renata", "title": "Early spring ephemeral therophytic non-nitrophilous grasslands as a habitat of various species of Romulea in the southern Balkans", "date": "2014", "keywords": "acta; al.vp; bot; botanica\\acta; carni; cmyk; color; communities; croat; esetg; fig; grasslands; mediterranean; precipitation; printer; profile; romulea; species; spring; ssp; u:\\acta; vegetation", "summary": "Contribution to the kariological knowledge of Mediterranean Romulea species (Iridaceae). Relev\u00e9s of such communities further to the south have not been published but similar therophytic communities of olive grove grassland show 65 % of Mediterranean species (^ARNI and MATEVSKI 2005).", "mime": "application/pdf"}, {"id": "abc-828", "words": "4183", "extension": ".pdf", "flesch": "58", "author": "Sajna, Nina; Sustar\u2013Vozlic, Jelka; Kaligaric, Mitja", "title": "New insights into the anatomy of an endemic Hladnikia pastinacifolia Rchb.", "date": "2014", "keywords": "acta; anatomy; ducts; fig; hladnikia; pastinacifolia; pollen; species; uorescence; \u0161ajna", "summary": "The distribu- tion of vascular elements within H. pastinacifolia roots shows the annual formation of dis- tinct growth rings, which could be used for the method described by DIETZ and ULLMANN (1997) to estimate a specimen\u2019s age. Discussion The new insight into H. pastinacifolia anatomy gave interesting new results which could help us to interpret the survival ability and fi tness constraints of this rare taxon.", "mime": "application/pdf"}, {"id": "abc-83", "words": "7734", "extension": ".pdf", "flesch": "58", "author": "Boojar, Masoud Mashadi Akbar; Tavakoli, Zahra", "title": "Role of antioxidant enzyme responses and phytochelatins in tolerance strategies of Alhagi camelthorn growing on copper mine", "date": "2010", "keywords": "copper; enzyme; leaves; levels; metal; plant; roots; soil; species; zone", "summary": "Molecular mechanisms of plant metal tolerance and homeostasis. Care was taken to collect plant species samples from both zones while they were in growth period.", "mime": "application/pdf"}, {"id": "abc-84", "words": "6068", "extension": ".pdf", "flesch": "62", "author": "Perez, Maria del Carmen; Maidana, Nora Irene; Comas, Augusto", "title": "Phytoplankton composition of the Ebro River estuary, Spain", "date": "2009", "keywords": "09\\perez.vp; acta; bot; color; croat; ebro; estuary; fig; grunow; k\u00fctzing; lpi; phytoplankton; profile; river; round; species; var", "summary": "Silva et al. Koliella cf. COMAS GONZ\u00c1LEZ A., P\u00c9REZ BALIERO, M. C., GONZ\u00c1LEZ DEL R\u00cdO RAMS, J., 2006: Pedia- strum willei nom.", "mime": "application/pdf"}, {"id": "abc-840", "words": "3946", "extension": ".pdf", "flesch": "62", "author": "Chaturvedi, Kanupriya; Bommisetty, Padmakar; Pattanaik, Arpita; Chinnaiyan, Vasugi; Ramachandra, Dinesh Makki; Chennareddy, Aswath", "title": "PCR detection assay for sex determination in papaya using SCAR marker", "date": "2014", "keywords": "female; hermaphrodite; male; papaya; plants; sex", "summary": "In the present study the W11 SCAR marker validated in the cultivars of Carica papaya and Visconcella caulifl ora, am- plifi ed a discriminating band in hermaphrodites and male papaya plants, but not in females, (Figs. 1 a, b). Traditionally, the propagation of papaya plants is through seeds, which would give rise to a population of generally 1:3 for male to female.", "mime": "application/pdf"}, {"id": "abc-845", "words": "3746", "extension": ".pdf", "flesch": "66", "author": "Iberite, Mauro; Iamonico, Duilio", "title": "Manihot grahamii Hook. (Euphorbiaceae), a new alien species for the Eurasian area with nomenclatural, taxonomical, morphological and ecological notes", "date": "2015", "keywords": "carthaginensis; grahamii; manihot; species", "summary": "In: TUTIN, T. G., HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALENTINE, D. H., WALTERS, S. M., WEBB, D. E. (eds.), Flora Europaea, 2, 211\u2013 226. This is the second record in Europe for the genus and the fi rst of M. grahamii for the Eurasian area.", "mime": "application/pdf"}, {"id": "abc-856", "words": "4872", "extension": ".pdf", "flesch": "58", "author": "Siddiqui, Zamin S; Cho, Jung-Il; Park, Sung-Han; Kwon, Taek-Ryoun; Ahn, Byung-Ok; Lee, Gang-Seob; Jeong, Mi-Jeong; Kim, Kyung-Whan; Lee, Seong-Kon; Park, Soo-Chul", "title": "Phenotyping of rice in salt stress environment using high-throughput infrared imaging", "date": "2014", "keywords": "control; et al; leaf; plant; salt; siddiqui; stress; temperature; water", "summary": "Likewise, the roots of salt stress plants also showed sig- nificant variations in color. It was observed that stomatal conductance (R2 = \u20130.618) and relative water content (R2 = \u20130.852) were significantly negatively correlated with average plant temperature (thermal images), while dark-adapted quantum yield (Fv/Fm, R2 = \u20130.325) and performance index (R2 = \u20130.315) were not consistent with plant temperature.", "mime": "application/pdf"}, {"id": "abc-860", "words": "5104", "extension": ".pdf", "flesch": "67", "author": "Czarnota, Pawel; Hernik, Emil", "title": "Some peltigericolous microlichens from southern Poland", "date": "2014", "keywords": "atpol; e. hernik; hernik; leg; lichens; peltigera; poland; res; species; thallus", "summary": "Their localities are mapped (Fig. 1) according to the Atpol grid square system (ZAJ C 1978) modified by CIE\ufffdLI\ufffdSKI and FA\ufffdTYNOWICZ (1993). CIE\ufffdLI\ufffdSKI, S., FA\ufffdTYNOWICZ, W., 1993:", "mime": "application/pdf"}, {"id": "abc-878", "words": "5850", "extension": ".pdf", "flesch": "65", "author": "Hussain, Iqbal; Wahid, Abdul; Rasheed, Rizwan; Akram, Hafiz Muhammad", "title": "Seasonal differences in growth, photosynthetic pigments and gas exchange properties in glass-house grown maize (Zea mays)", "date": "2014", "keywords": "agatti-2002; autumn; chl; conditions; cultivars; growth; maize; sadaf; spring; stage", "summary": "Materials and methods Source of maize seed, treatment and plant growth conditions Seeds of selected maize (Zea mays L.) cultivars Sadaf (heat-tolerant) and Agatti-2002 (heat-sensitive) were obtained from the Maize and Millets Research Institute (MMRI), EFFECT OF GREENHOUSE CONDITIONS ON TWO MAIZE CULTIVARS ACTA BOT. From these changes in the chlorophyll concentrations, it can be deduced that the sensitivity of Chl-b to GH condition is mainly responsible for the yellowing of leaves, particularly in spring grown plant.", "mime": "application/pdf"}, {"id": "abc-88", "words": "4638", "extension": ".pdf", "flesch": "63", "author": "Harper, Margaret A.; Patterson, John E.; Harper, John F.", "title": "New diatom taxa from the world\u00e2\u20ac\u2122s first marine Bioblitz held in New Zealand: Skeletomastus a new genus, Skeletomastus coelatus nov. comb. and Pleurosigma inscriptura a new species", "date": "2009", "keywords": "coelatus; fig; figs; inscriptura; new; pleurosigma; raphe; skeletomastus; species; striae", "summary": "Pleurosigma inscriptura valves range from 70\u2013110 mm (based on 22 valves) with a length to width ratio of c. 5 (range 4.2 to 6.3). This revealed Pleurosigma valves on the slides and allowed their darkfield colour to be recorded.", "mime": "application/pdf"}, {"id": "abc-921", "words": "3278", "extension": ".pdf", "flesch": "53", "author": "Chatzissavvidis, Christos; Antonopoulou, Chrysovalantou; Therios, Ioannis; Dimassi, Kortessa", "title": "Responses of trifoliate orange (Poncirus trifoliata (L.) Raf.) to continuously and gradually increasing NaCl concentration", "date": "2014", "keywords": "concentration; et al; explants; nacl; salinity; treatments", "summary": "Calcium concentration in explants presented a lower increase in the treatments with gradual transfer than in those with a continuous exposure to high NaCl concentration in the nutrient medium. This discrepancy found in proliferated explants, lacking a root system, could be related to differences in the diffusion rates of mineral nutrients in the culture medium with high NaCl concentrations (PEREZ-TORNERO et al. 2009).", "mime": "application/pdf"}, {"id": "abc-922", "words": "3970", "extension": ".pdf", "flesch": "51", "author": "Tintino, Saulo R.; Souza, Celestina E.S.; Guedes, Glaucia M.M.; Costa, Jacqueline I.V.; Duarte, Francisco M.; Chaves, Maria Celia O.; Silva, Viviane A.; Pessoa, Hillzeth L.; Lima, Micheline A.; Garcia, Carlos A.; Coutinho, Henrique", "title": "Modulatory antimicrobial activity of Piper arboretum extracts (Zingiberaceae)", "date": "2014", "keywords": "activity; antibiotic; extract; piper; profile; tintino", "summary": "Toxicon 20, 247\u2013252. JAVADPOUR, M. M., JUBAN, M. M., LO, W. C., BISHOP, S. M., ALBERTY, J. B., COWELL, S. W., 1996: De novo antimicrobial peptides with low mammalian cell toxicity. 73 (1), 2014 TINTINO S. R., SOUZA C. E. S., GUEDES G. M. M., COSTA J. I. V., DUARTE F. M. et al.", "mime": "application/pdf"}, {"id": "abc-923", "words": "9908", "extension": ".pdf", "flesch": "87", "author": "Ben Cheikh Affene, Zohra; Haouala, Faouzi; Harzallah-Skhiri, Fethia", "title": "Morphometric variation and taxonomic identification of thirteen wild rose populations from Tunisia", "date": "2015", "keywords": "accessions; leafl; length", "summary": "belonging to Synstylae section and R. canina L., R. agrestis Savi., R. micrantha Smith. Nevertheless, this accession may be a hybrid, specifi c to the Tunisian region, of R. canina L. and R. villosa.", "mime": "application/pdf"}, {"id": "abc-926", "words": "2875", "extension": ".pdf", "flesch": "65", "author": "Jogan, Nejc", "title": "Muhlenbergia schreberi J. F. Gmel (Poaceae), a new naturalized species in Croatia", "date": "2014", "keywords": "croatia; jogan; muhlenbergia; north; schreberi; species", "summary": "In Northeast Spain, where M. schreberi populations have persisted for more than 70 years, it is reported to grow in river banks, wet and ruderal plac- es (PYKE 2008). The primary distribution of M. schreberi is in the eastern part of North America, from central Mexico to south-east Canada, and South America southwards to North Argentina.", "mime": "application/pdf"}, {"id": "abc-93", "words": "3528", "extension": ".pdf", "flesch": "50", "author": "Kociolek, John P.; Stoermer, Eugene F.", "title": "Oligotrophy: the forgotten end of an ecological spectrum", "date": "2009", "keywords": "diatoms; freshwater; oligotrophy; species; systems; water", "summary": "A coded checklist and ecological indi- cator values of freshwater diatoms from the Netherlands. 68 (2), 2009 467 OLIGOTROPHY: THE FORGOTTEN END OF AN ECOLOGICAL SPECTRUM U:\\ACTA BOTANICA\\Acta-Botan 2-09\\Kociolek.vp 6. listopad 2009 13:47:59 Color profile: Disabled Composite 150 lpi at 45 degrees A further innovation of LANGE-BERTALOT (1996) as applied to diatoms was the creation of a \u00bbred list\u00ab of diatom species that are rare and indicative of clean (oligotrophic) condi- tions.", "mime": "application/pdf"}, {"id": "abc-930", "words": "3018", "extension": ".pdf", "flesch": "63", "author": "Chinan, Vasilica Claudiu; Fusu, Lucian; Manzu, Ciprian Claudiu", "title": "First record of Inocutis tamaricis in Romania with comments on its cultural characteristics", "date": "2015", "keywords": "inocutis; romania; species; tamaricis", "summary": "74 (1), 2015 Molecular analysis The identical ITS sequences obtained from the basidioma and cultured mycelium con- fi rmed that observations were made on I. tamaricis mycelium and not on a contaminant species. LARKIN, M. A., BLACKSHIELDS, G., BROWN, N. P., CHENNA, R., MCGETTIGAN, P. A., MCWIL- LIAM, H., VALENTIN, F., WALLACE, I. M., WILM, A., LOPEZ, R., THOMPSON, J. D., GIBSON, T. INOCUTIS TAMARICIS IN ROMANIA ACTA BOT.", "mime": "application/pdf"}, {"id": "abc-931", "words": "6674", "extension": ".pdf", "flesch": "56", "author": "Sciandrello, Saverio; D'Agostino, Sonia", "title": "Distribution patterns and floristic analysis of the Colymbada tauromenitana (Guss.) Holub populations in Sicily (Italy)", "date": "2014", "keywords": "area; brullo; colymbada; conservation; diversity; mediterranean; monte; plant; sciandrello; sicily; species; tauromenitana", "summary": "Two indexes were chosen to estimate diversity: (1) species richness (SR), i.e., the total number of plant species recorded in a sample plot, and (2) Shannon-Wiener\u2019s diversity in- dex (H\u2019). Plant Biosystems 142, 302\u2013304. SCHR\u00d6TER, D., CRAMER, W., LEEMANS, R., PRENTICE, I. C., ARA\u00daJO, M. B., ARNELL, N. W., BONDEAU, A., BUGMANN, H., CARTER, T. R., GRACIA, C. A. et al., 2005: Ecosystem service supply and vulnerabilit\u00e0 to global change in Europe.", "mime": "application/pdf"}, {"id": "abc-935", "words": "4414", "extension": ".pdf", "flesch": "66", "author": "Dural, H\u00fcseyin; Yilmaz \u00c7itak, Burcu", "title": "Morphology and anatomy of Hedysarum pannosum (Boiss.) Boiss. (Fabaceae)", "date": "2015", "keywords": "cells; fig; hedysarum; leafl; pannosum; pollen", "summary": "H. pannosum pollen are tricolpate, prolate, circular in polar view and elliptical-elongated in equatorial view and ornamentation reticulate. Later, PON- ERT (1973) reported H. pannosum as H. pogonocarpum Boiss. subsp.", "mime": "application/pdf"}, {"id": "abc-939", "words": "6478", "extension": ".pdf", "flesch": "62", "author": "Garc\u00eda, Jaime F; Jurado, Enrique", "title": "Is drought altering plant populations in the mountainous region of Northeastern Mexico?", "date": "2015", "keywords": "cembroides; drought; fig; mortality; plant; santaclarensis; soil; species; survival", "summary": "For the mountain vegetation of Northeastern M\u00e9xico there are no studies examining the effects of drought on plant survival, and little is known about what factors affect the probability of mortality in woody plants during a severe drought. Two major hypotheses were tested: (1) morta- lity among species differs due to species-specifi c responses and to genetic variability in re- sistance to stressors, and (2) between populations, plant survival varies throughout the eco- system due to environments that are more or less stressful.", "mime": "application/pdf"}, {"id": "abc-94", "words": "4621", "extension": ".pdf", "flesch": "58", "author": "Mann, David G.; Stickle, Alan J.", "title": "Cytological characteristics of the Sellaphoraceae", "date": "2009", "keywords": "chloroplast; fallacia; figs; mann; pyrenoid; sellaphora; species", "summary": "Fallacia chloroplasts are more variable than those of Sellaphora but always differ fundamentally from the valve-appressed chloroplasts of the unrelated but superficially similar genus Lyrella. 68 (2), 2009 MANN D. G., STICKLE A. J. U:\\ACTA BOTANICA\\Acta-Botan 2-09\\Mann.vp 5. listopad 2009 15:23:30 Color profile: Disabled Composite 150 lpi at 45 degrees uoles is displaced towards the corner of the cell opposite the pyrenoid (Figs. 7, 12).", "mime": "application/pdf"}, {"id": "abc-940", "words": "6908", "extension": ".pdf", "flesch": "58", "author": "Ali, Murad; Bakht, Jehan; Daraz Khan, Gul", "title": "Effect of water stress and potassium application on plant growth, osmolytes and grain yield of Brassica varieties", "date": "2014", "keywords": "application; content; drought; ha\u20131; irrigation; plant; potassium; proline; shoot; stress; water", "summary": "Water stress induces a signifi cant decrease in metabolic factors such as decrease in chlorophyll content and enhanced accumu- * Corresponding author, e-mail: jehanbakht@yahoo.co.uk Copyright\u00ae 2014 by Acta Botanica Croatica, the Faculty of Science, University of Zagreb. BISWAS et al. (1992) reported increased sugar and starch content of sugarcane, tomatoes and potatoes under water stress.", "mime": "application/pdf"}, {"id": "abc-943", "words": "9210", "extension": ".pdf", "flesch": "67", "author": "Saglam, Aykut; Kadioglu, Asim; Demiralay, Mehmet; Terzi, Rabiye", "title": "Leaf rolling reduces photosynthetic loss in maize under severe drought", "date": "2014", "keywords": "batem; control; cultivars; drought; fold; leaf; maize; photosynthesis; plr; rolling; rubisco; stress; water", "summary": "In conclusion, leaves were rolled in drought tolerant maize cultivars later than in sensi- tive cultivars under drought stress. Drought stress and artifi cial pre- vention of leaf rolling (PLR) were applied at grain fi lling stage for 30 days.", "mime": "application/pdf"}, {"id": "abc-96", "words": "5080", "extension": ".pdf", "flesch": "63", "author": "Edlund, Mark B.; Shinneman, Avery L.C.; Levkov, Zlatko", "title": "Diatom biodiversity in Mongolia: A new amphoroid diatom from saline lakes in western Mongolia, Amphora soninkhishigae sp. nov.", "date": "2009", "keywords": "amphora; cleve; dorsal; edlund; fig; lakes; levkov; mongolia; raphe; shinneman; soninkhishigae; valve", "summary": "In most Halamphora species, the proximal raphe endings terminate in- ternally with fused central helictoglossae, except in A. chilensis (SALAet al. 2007), whereas in Amphora sensu stricto (i.e. subgenus Amphora Cleve) each raphe branch terminates with separate central helictoglossae (see KRAMMER 1980). NAGUMO, T., 2003: Taxonomic studies of the subgenus Amphora Cleve of the genus Am- phora (Bacillariophyceae) in Japan.", "mime": "application/pdf"}, {"id": "abc-963", "words": "4384", "extension": ".pdf", "flesch": "63", "author": "Jankovic, Ivana Blagoje; Drobac, Milica M.; Lakusic, Dmitar V.", "title": "Compounds of the methanolic leaf extract as chemotaxonomic markers for the Campanula pyramidalis complex (Campanulaceae)", "date": "2014", "keywords": "campanula; complex; extract; laku\u0161i\u0107; leaf; ora; pyramidalis", "summary": "EDDIE, W. M. M., SHULKINA, T., GASKIN, J., HABERLE, R. C., JANSEN, R. K., 2003: Phytochemistry 56, 631\u2013636. CUPIDO, C. N., EDDIE, W. M. M., TIEDT, L. R., 2011: Systematic and ecological signifi cance of seed coat morphology in South African Campanulaceae sensu stricto.", "mime": "application/pdf"}, {"id": "abc-964", "words": "7863", "extension": ".pdf", "flesch": "59", "author": "Toman, Mihael Jozef; Groselj, Ana Marjetka; Zelnik, Igor", "title": "The influence of selected factors on the distribution of epilithic diatoms in a torrential river the Kamni\u0161ka Bistrica (Slovenia)", "date": "2014", "keywords": "acta; conductivity; diatom; diversity; factors; river; samples; species; tab; taxa; temperature; variables; water", "summary": "The highest number of diatom species (40) was found in summer samples (A), and the lowest (34) in winter (M) samples. (A) distribution of the samples along the environmental variables, where sites are represented with numbers (1\u20135) and seasons/months with letters (M \u2013 March, J \u2013 July, A \u2013 August); (B) distribution of diatom species present in at least three samples are shown: Ach bia \u2013 Achnan- thes biasolettiana, Ach min \u2013 Achnanthes minutissima, Amp ped \u2013 Amphora pediculus, Coc ped \u2013 Cocconeis pediculus, Coc pla \u2013 Cocconeis placentula, Cym aff \u2013 Cymbella affi nis, Cym min \u2013 Cymbella minuta, Cym sil \u2013 Cymbella silesiaca, Cym sin \u2013 Cymbella sinuata, Dia mon \u2013 Diatoma moniliformis, Dia vul \u2013 Diatoma vulgaris, Fra arc \u2013 Fragilaria arcus, Fra cap \u2013 Fragilaria capucina, Fra con \u2013 Fragilaria construens, Fra uln \u2013 Fragilaria ulna, Gom ang \u2013 Gomphonema angustatum, Gom oli \u2013 Gomphonema olivaceum, Gom par \u2013 Gompho- nema parvulum, Gom pum \u2013 Gomphonema pumilum, Mel var \u2013 Melosira varians, Mer cir \u2013 Meridion circulare, Nav ato \u2013 Navicula atomus, Nav crt \u2013 Navicula cryptotenella, Nav gre \u2013 Navicula gregaria, Nav lan \u2013 Navicula lanceolata, Nav men \u2013 Navicula menisculus, Nav tri \u2013 Navicula tripunctata, Nit dis \u2013 Nitzschia dissipata, Nit fon \u2013 Nitzschia fonticola, Nit pal \u2013 Nitzschia palea.", "mime": "application/pdf"}, {"id": "abc-980", "words": "8113", "extension": ".pdf", "flesch": "58", "author": "Nikolic, Nata\u0161a; Borisev, Milan; Pajevic, Slobodanka; Zupunski, Milan; Topic, Mirjana; Arsenov, Danijela", "title": "Responses of wheat (Triticum aestivum L.) and maize (Zea mays L.) plants to cadmium toxicity in relation to magnesium nutrition", "date": "2014", "keywords": "activity; aestivum; cadmium; concentration; leaves; mays; plants; roots; z. mays", "summary": "Control Cd Cd\u2013Mg T. aestivum Chlorophyll a (mg g-1 DW) 13.83 \u00b1 0.77 a 7.76 \u00b1 0.80 b (56) 7.32 \u00b1 0.03 b (53) Chlorophyll b (mg g-1 DW) 3.80 \u00b1 0.17 a 2.87 \u00b1 0.34 ab (76) 2.26 \u00b1 0.08 b (59) Carotenoids (mg g-1 DW) 3.82 \u00b1 0.18 a 2.43 \u00b1 0.26 b (64) 2.30 \u00b1 0.02 b (60) Negative effect of Cd on photosynthetic activity was more pronounced in T. aestivum than in Z. mays plants.", "mime": "application/pdf"}, {"id": "abc-992", "words": "8217", "extension": ".pdf", "flesch": "56", "author": "Ljubicic, Ivica; Britvec, Mihaela; Jelaska, Sven D.; Husnjak, Stjepan", "title": "Plant diversity and chemical soil composition of rocky pastures in relation to the sheep grazing intensity on the northern Adriatic islands (Croatia)", "date": "2014", "keywords": "diversity; grazing; grazing intensity; intensity; islands; pastures; plant; plots; sheep; sheep grazing; soil; species; study; taxa", "summary": "This paper correlated abundance patterns of the fl ora on rocky pastures with the values of the chemical composition of the soil resulting from the degree of sheep grazing intensity. The aim of the present study was to compare the composition of the fl oras on the rocky pastures of the northern Adriatic islands of Pag, Krk and Cres, to determine the dependence of the fl oristic composition on the chemical composition of the soil resulting from the degree of sheep grazing intensity, and to determine the optimal grazing pressure, an essential factor in the maintenance of plant diversity.", "mime": "application/pdf"}]