[{"id": "ahs-10101", "words": "4988", "extension": ".pdf", "flesch": "58", "author": "Lemes Ternus, Fernando; Neumann Silva, Vanessa; Mendes Milanesi, Paola; Tortelli, Brenda ", "title": "Kale seed priming with red seaweed biostimulant", "date": "2021", "keywords": "biostimulant; doses; germination; growth; kale; length; plant; priming; root; seaweed; seed; seedling; solieria", "summary": "BEWLEY J.D., BRADFORD K., HIRLHORST H., NONOGAKI H., 2013 \u00ad Seeds: Physiology of development, germination and dormancy. Furthermore, it should be noted that gib\u00ad berellins stimulate the synthesis and production of hydrolases, especially alpha\u00adamylase, resulting in seed germination (Miransari and Smith, 2014).", "mime": "application/pdf"}, {"id": "ahs-10158", "words": "3220", "extension": ".pdf", "flesch": "65", "author": "Kim, Jin-Ho; Oh, Hye Jin; Kim, Sang Yong; Suh, Gang Uk", "title": "Influence of 6-benzylaminopurine spray time after pinching on growth and flowering of Veronica dahurica Steven", "date": "2021", "keywords": "application; control; flowering; length; mg\u00b7l\u00ad1; pinching; plant; sdp", "summary": "2 \u00ad Flowering characteristics of V. dahurica with pinching and BA spray application. Both pinching and BA foliar spray application can promote branch production by controlling apical dominance through cytokinin signaling (Barbier et al., 2017; Kieber and Schaller, 2018).", "mime": "application/pdf"}, {"id": "ahs-10193", "words": "4598", "extension": ".pdf", "flesch": "64", "author": "Ndereyimana, Assinapol; Waweru, Bancy Waithila ; Kagiraneza, Boniface; Niyokuri, Arstide Nshuti ; Rukundo, Placide; Hagenimana, Gregoire ", "title": "Effect of vine and fruit pruning on yield attributes of two watermelon (Citrullus lanatus) cultivars", "date": "2021", "keywords": "2017a; cultivars; fruit; plant; pruning; season; vine; watermelon; yield", "summary": "A similar trend was recorded at Karama site except that the fruit yield per plant and per hectare for plants which were pruned to three vines with one fruit reduced dur\u00ad ing season 2017B as compared to season 2017A. The highest number of fruits per plant, fruit weight, fruit yield per plant and per hectare was recorded in \u2018Julie F1\u2019 compared to \u2018Sugar baby\u2019 at both sites and during both seasons. A similar trend was observed in fruit yield per hectare.", "mime": "application/pdf"}, {"id": "ahs-10277", "words": "6917", "extension": ".pdf", "flesch": "50", "author": "Toscano, S.; Branca, F.; Ferrante, Antonio; Romano, D.", "title": "Zucchini squash production in conventional and organic cultivation systems", "date": "2021", "keywords": "biolchim; cultivation; food; fruit; ha\u00ad1; l ha\u00ad1; organic; production; quality; s.p.a; sci; squash; systems; yield; zucchini", "summary": "Organic cultivation system The zucchini squash cultivation was performed following the procedures described in EU n. 834/2007 and 889/2008. The fertigation was carried out with the addition of NOV@ (15 L ha\u00ad1), Bio Energy\u00ae VEG (20 L ha\u00ad1), with Glibor Ca (7 L ha\u00ad1), and Mg sulphate (20 kg ha\u00ad1); Foliar application was performed with a solution con\u00ad taining NOV@ (15 L ha\u00ad1), Bio Energy\u00ae VEG (20 L ha\u00ad 1), Fylloton (1.5 L ha\u00ad1), Folicist\u00ae (1 L ha\u00ad1), Cremalga Table 1 \u00ad Cultivation procedures (inputs) of the organic and conventional systems per hectare of squash cultivation Cultivation procedures (inputs) Cultivation systems Organic Conventional Land use (m2) 10.000 10.000 Mean yield (Mg) 43.2 46.4 Irrigation PE irrigation hoses (m) 6667 6667 Submersible electric pump SHANKTY, QF 106/9 + pump motor HP 50 8\u2019\u2019(h) 45 45 Water (m3) 2100 2100 Fruit harvesting (h) 19 19 Machinery Harrowing (h) 8 8 Tillers (h) 8 8 Fertilizer spreader (h) 5 5 Spreading plastic mulching (h) 16 16 Soil tillage (h) 15 15 Spreading plastic tunnel coverage (h) 98 98 Plastic maintenance 28 28 Toscano et al. \u2010 Conventional and organic zucchini Squash 199 Manual weed control was carried out as described for organic cultivation system (Fig. 1).", "mime": "application/pdf"}, {"id": "ahs-10346", "words": "6280", "extension": ".pdf", "flesch": "59", "author": "Feyissa, Tileye", "title": "Prospects for improvement of Plectranthus edulis (Vatke) Agnew: A high potential food security crop", "date": "2021", "keywords": "crop; diversity; edulis; ethiopia; farmers; food; medium; p. edulis; plant; plectranthus; potato; research; shoot; starch; tuber", "summary": "There is enormous untapped potential in Ethiopia to exploit the rich and diverse plant genetic resour\u00ad ces of underutilized root and tuber crops including P. edulis. Prospects of biotechnology for improvement of P. edulis In addition to the shortage of seed tubers and the poor storability of the tubers, systemic diseases, viru\u00ad ses, viroids and mycoplasma as well as several patho\u00ad genic bacteria are the most devastating root and tuber crops including P. edulis, in terms of yield loss 324 Adv.", "mime": "application/pdf"}, {"id": "ahs-10414", "words": "6714", "extension": ".pdf", "flesch": "63", "author": "Mohammadnia, Saber; Haghighi, Maryam", "title": "'Momordica charantia\u2019 introducing a new rootstock for grafted cucumber under low-temperature stress ", "date": "2021", "keywords": "charantia; cucumber; effect; et al; fig; fruit; grafting; momordica; plant; rma; rmo; rootstock; temperature", "summary": "Some of the studies have used different rootstocks for cucumbers under different stresses showing better growth rate for grafted plants under stress conditions compared to non\u00adgrafted ones like: heavy metal absorption (Rouphael et al., 2008; Kumar et al. , 2015), low soil temperatures (Tachibana, 1982), salinity (Huang et al., 2010), improve NaCl and CaCl2 tolerance in Cucumber (Colla et al., 2013), Al toxicity in cucumber (Rouphael et al., 2016). Hole\u00adinsertion grafting was used and grafted plants were transferred to a recovery greenhouse with high relative humidity.", "mime": "application/pdf"}, {"id": "ahs-10449", "words": "5887", "extension": ".pdf", "flesch": "59", "author": "dos Santos Pereira, Ivan; Grecco da Silva Porto, Fabiane; Eduardo Corr\u00eaa Antunes, Luis; Diniz Campos, \u00c2ngela ", "title": "Phytoprotective film for resistance induction, growth, and yield of organic strawberries", "date": "2022", "keywords": "activity; anthracnose; chitosan; chi\u00adpyro\u00adfilm; concentration; cultivars; effect; et al; extract; fig; growth; k2hpo4; l\u00ad1; plant; resistance; strawberry; yield", "summary": "VAN DEN BROEK L.A.M., KNOOP R.J.I., KAPPEN F.H.J., BOERIU C.G., 2015 \u00ad Chitosan films and blends for pack\u2010 aging material. REUVENI R., DOR G., RAVIV M., REUVENI M., TUZUN S., 2000 \u00ad Systemic resistance against Sphaerotheca fulig\u00ad inea in cucumber plants exposed to phosphate in hydroponics system, and its control by foliar spray of mono\u2010potassium phosphate.", "mime": "application/pdf"}, {"id": "ahs-10523", "words": "4816", "extension": ".pdf", "flesch": "55", "author": "Oyetunde, Oyeboade Adebiyi; Olayiwola, Muyideen Oluseyi; Osho, Beatrice Toyin", "title": "Genetic diversity and trait profiles of some Amaranthus genotypes", "date": "2021", "keywords": "accessions; amaranthus; biomass; index; leaves; number; plant; root; state; stem; traits; weight", "summary": "Amaranthus accessions were evaluated in 2018 and 2019 to investigate the extent of genotypic diversity among the amaranth accessions and their trait profiles. 1 \u00ad Principal component loading pattern of six traits of Amaranthus accessions.", "mime": "application/pdf"}, {"id": "ahs-10536", "words": "5344", "extension": ".pdf", "flesch": "56", "author": "Kivrak Kiran, Secil; Galatali, Selin; Yeniocak, Sevil; Ozkaya, Damla Ekin; Mercan, Taner; Guldag, Sevinc; Celik, Onur; Abdul Ghafoor, Naeem; Kaya, Eergun", "title": "Investigation of modified WPM medium for the best meristem proliferation of Corylus avellana L.", "date": "2021", "keywords": "avellana; corylus; culture; et al; fe\u00adeddha; hazelnut; kaya; medium; meristem; plant; production; shoot; wpm", "summary": "In addition to the continuous production thro\u00ad ughout the year by obtaining thousands of plants with the same form and characteristics as the mother plant in a short time by micropropagation method from plant tissue cultures; superior species resistant to factors such as drought, salinity, acidity, and/or cold can also be produced. Different techniques in plant tissue culture can be used such as shoot tip culture by transferring the shoot tips with growth cone including meristematic doom to in vitro environment, bud node culture by transferring the axillary or apical buds of the shoots to aseptic conditions, meristem culture by transfer\u00ad ring meristem from the meristematic region to the nutrient medium with the help of a stereomicrosco\u00ad pe, embryo culture by taking the embryo from the seed template or from the seed and transferring it to the germination medium (Ahmad and Anis, 2007; Usha et al., 2007).", "mime": "application/pdf"}, {"id": "ahs-10628", "words": "4911", "extension": ".pdf", "flesch": "64", "author": "Jokari, Sakineh; Shekafandeh, Akhtar", "title": "Effect of harvest time and fruit size on seed germination and seedlings growth of sour orange and Mexican lime under in vitro conditions", "date": "2021", "keywords": "citrus; days; flowering; fruits; germination; growth; harvest; lime; orange; seed; sour; time", "summary": "Based on fruit growth curve the time of fruit harvest affected seed germination (percent\u00ad age and rate) and seedling growth (stem and root length, fresh and dry weight of stems, roots and leaves). In vitro seedling growth indices Fruit harvest time in both citrus species had a sig\u00ad nificant effect on seed growth indices (stem length, Fig.", "mime": "application/pdf"}, {"id": "ahs-10630", "words": "9281", "extension": ".pdf", "flesch": "58", "author": "Comparini, Diego ; Taiti, Cosimo; Lanza, Matteo; Vita, Federico; Pandolfi, Camilla; Luti, Simone; Spinelli, F.; Pazzagli, Luigia; Mancuso, Stefano", "title": "Comparison of wild and domesticated hot peppers fruit: volatile emissions, pungency and protein profiles", "date": "2021", "keywords": "analysis; annuum; baccatum; c. annuum; capsaicin; capsicum; chacoense; compounds; data; et al; fragment; fruits; genus; h3o; identification; mass; no+; pepper; reagent; sci; species; table; taiti; vocs", "summary": "Moscone et al., 2007; Ince et al., 2009; Sudr\u00e9 et al., 2010) and the current system for classifications involved genus, species, variety, pod type and culti\u00ad vars (Bosland and Votava, 2012). Furthermore, the characterization and evaluation of the species belonging to the genus Capsicum are particularly interesting for breeders, gene banks, because of the large genetic variability available (Guzm\u00e1n et al., 2005; Sudr\u00e9 et al., 2006; Ince et al., 2009).", "mime": "application/pdf"}, {"id": "ahs-10641", "words": "8060", "extension": ".pdf", "flesch": "61", "author": "Ashour, Hossam Ahmed; Esmail, Sanaa E.A.; El- Attar, Asmaa", "title": "Responses of different quality parameters of Chia to arbuscular mycorrhiza and plant growth regulator", "date": "2021", "keywords": "absence; amf; application; chia; et al; fungi; growth; increase; naa; oil; pgrs; plant; plant growth; ppm; presence; salvia; sci; seeds; total; yield", "summary": "Plant growth regulators (PGRs) have been defined as one of the major factors affecting plants growth and their primary and secondary metabolites, NAA is an organic compound that is synthetic plant hor\u00ad mone in the auxin family. BAYDAR H., ERDAL I., 2004 \u00ad Effect of plant growth regula\u2010 tors on leaf quality of Oregano (Origanum onites).", "mime": "application/pdf"}, {"id": "ahs-10660", "words": "5571", "extension": ".pdf", "flesch": "60", "author": "Povilonis, Ignacio; Arena, Miriam Elisabet; Radice, Silvia", "title": "Hexachlamys edulis (Berg) Kausel & Legrand, \u201cubajay\u201d, a native fruit species from South America", "date": "2021", "keywords": "argentina; berg; brazil; cruz; edulis; et al; eugenia; food; fruit; gonz\u00e1lez; hexachlamys; hexachlamys edulis; legrand; myrcianthes; myrtaceae; south; species; uruguay", "summary": "A more exhaustive observation allowed determining that this species is phanerophytes \u00ad by the aerial loca\u00ad tion of its buds (Raunkiaer, 1934) \u00ad and deciduous with concomitant foliar renewal and that apparently low temperatures accelerate defoliation (Gonz\u00e1lez, 2003). APEL M.A., SOBRAL M., MENUT C., BASSIERE J.M., ZUANAZZI J.\u00c1., SCHAPOVAL E.E.S., 2005 \u00ad Volatil consti\u2010 tuents of four Hexachlamys species growing in South Brazil.", "mime": "application/pdf"}, {"id": "ahs-10706", "words": "9694", "extension": ".pdf", "flesch": "56", "author": "Silva, Suzanna de Sousa ; Alves, Patr\u00edcia Costa dos Santos ; Coutinho, Denise Fernandes ; Luz, T\u00e1ssio R\u00f4mulo Silva Ara\u00fajo; Fontoura, Guilherme Martins Gomes ; Berretta, Andresa Aparecida ; Gon\u00e7alves Maciel, Marcia Cristina", "title": "Punica granatum L. extract contributes to phytopathogens control and enhances Eruca vesicaria (L.) Cav. germination in vitro and in vivo", "date": "2021", "keywords": "activity; bacteria; campestris; carotovorum; concentration; control; et al; extract; fig; fruit; granatum; hydroalcoholic; peel; plant; pomegranate; punica; seedlings; seeds; subsp; treatment; vesicaria", "summary": "Seedlings infected and treated with Punica granatum L. hydroalcoholic extract (Pp) (500 \u00b5g/mL); E) Seedlings infected and treated with P. granatum L. hydroalcoholic extract (Pp) (250 \u00b5g/mL); F) Seedlings infected and treated with association between P. granatum L. hydroalcoholic extract (Pp) (500 \u00b5g/mL) and streptomycin sulfate. The potential of the extract for natural control of X. campestris pv. campestris as an sustain\u00ad able alternative for treatment of vegetable seeds was assayed.", "mime": "application/pdf"}, {"id": "ahs-10714", "words": "3497", "extension": ".pdf", "flesch": "66", "author": "Musabyisoni, Aloys; Waweru, B.; Nishizawa, T.", "title": "Effect of salt stress by \u201consen\u201d water on plant growth and fruit quality of tomato cv. Reika in pot soil", "date": "2021", "keywords": "fruit; onsen; plant; salinity; salt; stress; tomato; water", "summary": "Tomato fruits are rich in min\u00ad erals, vitamins, essential amino acids, sugars and dietary fibres and thus contribute to a healthy, well\u00adbalanced diet. The majority of tomato fruits produced are consumed in processed form such as peeled tomato (whole or diced), juices, sauce and ketchup, whose manufacture often requires peel removal (Shankara et al., 2005; Rock et al., 2012).", "mime": "application/pdf"}, {"id": "ahs-10740", "words": "7259", "extension": ".pdf", "flesch": "63", "author": "Kaur, Avninder; Sharma, Sucheta; Singh, Navprem ", "title": "Biochemical changes in pear fruits during storage at ambient conditions", "date": "2021", "keywords": "activity; conditions; content; cultivars; das; days; enzymes; et al; fig; fruits; pear; punjab; storage; sucrose", "summary": "Kaur et al. \u2010 Ripening of pear fruits during storage 295 interval with penetrometer (Model No. Kaur et al. \u2010 Ripening of pear fruits during storage 297 Carbohydrate composition and Sucrose metabolizing enzymes Reducing sugars increased up to 3 DAS in \u2018PN\u2019 and 6 DAS in \u2018PB\u2019 fruits and then declined during advanced storage period (Fig.", "mime": "application/pdf"}, {"id": "ahs-10850", "words": "7082", "extension": ".pdf", "flesch": "58", "author": "Behnam, Habibeh; Feizi, Hassan; Alipanah, Masoud", "title": "Alleviation the effects of salinity stress using titanium dioxide nano and bulk particles in Echinacea seeds and seedlings", "date": "2021", "keywords": "bar; dioxide; echinacea; germination; length; nanoparticles; salinity; salinity stress; seed; seedling; stress; titanium; titanium dioxide", "summary": "Res., 146(1): 101\u00ad 106. GOHARI G., MOHAMMADI A., AKBARI A., PANAHIRAD S., DADPOUR M.R., FOTOPOULOS V., KIMURA S., 2020 \u00ad Titanium dioxide nanoparticles (TiO2 NPs) promote growth and ameliorate salinity stress effects on essen\u2010 tial oil profile and biochemical attributes of Dracocephalum moldavica. The results reported in Table 3 show that Echinacea had the highest germination percentage at the level of zero and salinity stress \u00ad3 bar, but with increasing salinity stress, the germination percentage decreased significantly.", "mime": "application/pdf"}, {"id": "ahs-10854", "words": "2215", "extension": ".pdf", "flesch": "50", "author": "Lyakh, Viktor; Soroka, Anatoliy", "title": "Artificial medium for in vitro pollen germination of some ornamental Linum species", "date": "2021", "keywords": "germination; linum; peg; pollen; species; sucrose", "summary": "Figure 2 demonstrates pollen germination pattern on a media with PEG of different molecular weight and sucrose, showing the proportion of pollen grains with normal and burst pollen tubes. A medium, consisting of boric acid, calcium chloride and sucrose as osmotic agent is commonly used for pollen germination of different species.", "mime": "application/pdf"}, {"id": "ahs-10914", "words": "5749", "extension": ".pdf", "flesch": "58", "author": "Alabboud, Michael ; Kalantari , Siamak ; Soltani, Forouzandeh ", "title": "Postharvest performance interpretation and storage temperature optimization in some newly introduced melon hybrids", "date": "2022", "keywords": "analysis; changes; firmness; fruit; hybrids; loss; melon; postharvest; storage; temperature; tss; weight", "summary": "WU Z., TU M., YANG X., XU J., YU Z., 2020 \u00ad Effect of cutting and storage temperature on sucrose and organic acids metabolism in postharvest melon fruit. However, all the studied hybrids showed signifi\u00ad cant colour changes after 10 days in cold storage and under all temperature except for \u2018Cm\u00adUTKHA\u2019 which showed significant colour changes only after 20 days in storage and under higher storage temperature (>5\u00b0C).", "mime": "application/pdf"}, {"id": "ahs-10983", "words": "4687", "extension": ".pdf", "flesch": "53", "author": "Ferreira Cavalcante, Daniele ; Pradi Vendruscolo, Eduardo; Seleguini, Alexsander ; de Castro Seron, C\u00e1ssio; Costa, Edilson; Leandro Pires, Larissa", "title": "Reflective benches for improving lighting in residential basil cultivation", "date": "2021", "keywords": "basil; cultivation; development; growth; laminate; light; mesh; plants; radiation; red; weight; white", "summary": "KAMI C., LORRAIN S., HORNITSCHEK P., FANKHAUSER C., 2010 \u00ad Light\u2010regulated plant growth and development. The bright white and red laminate covers positively influence environmental condi\u00ad tions, increasing the reflectance of photosynthetically active radiation, and the development of basil plants in conditions of greater shading.", "mime": "application/pdf"}, {"id": "ahs-11437", "words": "8676", "extension": ".pdf", "flesch": "61", "author": "Smith, Tracy-Ann; V\u00e1squez-Mart\u00ednez, Juan; Mellado-Mojica, Erika; Vaidya, Kisan; Lopez, Mercedes; Benkeblia, Noureddine", "title": "Profiling of primary metabolites of Averrhoa carambola, Spondias dulcis and Syzygium malaccense fruits revealed underpinning markers during \u201con-tree\u201d maturation and ripening stages", "date": "2022", "keywords": "acid; analysis; carambola; development; et al; fructose; fruits; glucose; june; june plum; malic; maturation; metabolites; n.d; otaheite; plum; ripening; sci; stages; sucrose; sugars; total", "summary": "There is almost no work reporting on the compo\u00ad sition of June plum fruit during maturation and ripen\u00ad ing except from the one of Benkeblia and L\u00f3pez (2015). Other scattered studies reported on the vari\u00ad ation of sugars and organic acids in June plum fruit but at a specific stage.", "mime": "application/pdf"}, {"id": "ahs-11517", "words": "7352", "extension": ".pdf", "flesch": "63", "author": "Taufique, Tropa ; Nishizawa, Takashi ; Roy, Tuhin Suvra ; Meiko, Kikuchi ; Chakraborty, Rajesh ; Mostofa, Maruf; Nara, Kazuhiro ", "title": "Histological and physiological changes of potato starch derived from seed and TPS (true potato seed) grown tubers under different cold storage duration", "date": "2021", "keywords": "content; degradation; et al; fig; granule; lady; potato; potato starch; rosetta; seed; size; starch; starch granule; storage; sugar; surface; tps; tps\u00ad1; tuber", "summary": "JOHNSTON F., URBAS B. KHANZADA G., 1968 \u00ad Effect of storage on the size distribution and amylose/amy, lopectin ratio in potato starch granules. Sci., 2021 35(4): 371\u00ad381 DOI: 10.36253/ahsc\u00ad11517 Histological and physiological changes of potato starch derived from seed and TPS (True Potato Seed) grown tubers under different cold storage duration T. Taufique 1, 2, T. Nishizawa 1, T.S. Roy 2, K. Meiko 1, R. Chakraborty 2, M. Mostofa 3 (*), K. Nara 1 1 Department of Bioproduction, Faculty of Agriculture, Yamagata University, 1\u201023 Wakaba Machi, Tsuruoka 997\u20108555, Yamagata, Japan.", "mime": "application/pdf"}, {"id": "ahs-11519", "words": "4650", "extension": ".pdf", "flesch": "62", "author": "Lowe, Gail; Shepherd, Mervyn; Rose, Terry; Raymond, Carolyn", "title": "Strigolactone analogue GR24 reduces axillary bud out break and growth in tea tree, Melaleuca alternifolia (Maiden & Betche) Cheel", "date": "2021", "keywords": "auxin; bud; buds; control; gr24; node; plants; shoot; tea; tree", "summary": "BALLA J., KALOUSEK P., REINOHL V., FRIML J., PROCHAZKA S. 2011 \u00ad Competitive canalization of PIN\u2010dependent auxin flow from axillary bud controls pea bud out\u2010 growth. 3. Results Effects of GR24 on axillary bud growth in tea tree Rates of bud release over a 21 day time course exper\u2010 iment Treatment effect was significant at each of the 9 days counts were undertaken (p<0.05) (Fig. 2).", "mime": "application/pdf"}, {"id": "ahs-11568", "words": "6996", "extension": ".pdf", "flesch": "68", "author": "Wu, X.; Wang, L.; Roh, Mark", "title": "Reduction of leaf tip burns of Ornithogalum dubium by controlling the temperature during bulb storage and greenhouse forcing to produce quality plants", "date": "2022", "keywords": "bulbs; leaf; leaves; ltb; plants; ppm; st\u00ada; st\u00adb; st\u00adc; tip", "summary": "Three criteria were established to determine the quality of O. dubium plants. The objectives of this research were to produce quality potted O. dubium plants by reducing the inci\u00ad dence of LTB, accelerating flowering while ensuring the maximum number of flower buds, and desirable morphologies as influenced by temperature treat\u00ad ment during the bulb handling and greenhouse forc\u00ad ing stages to establish the optimum temperature regimes that reduce the incidence of LTB, and accel\u00ad erate flowering with desirable morphologies.", "mime": "application/pdf"}, {"id": "ahs-11825", "words": "6078", "extension": ".pdf", "flesch": "54", "author": "Sota, Valbona; Benelli, Carla ; \u00c7uko, Brunilda ; Kongjika, Efigkeni ", "title": "Effect of a double phase culture system and activated charcoal on in vitro propagation of Malus sylvestris (L.) Mill.", "date": "2021", "keywords": "apple; charcoal; culture; dps; et al; liquid; l\u00ad1; medium; micropropagation; number; plant; rooting; roots; shoots; system", "summary": "JOVA M.C., KOSKY R.G., CUELLAR E.E., 2011 \u00ad Effect of liq\u2010 uid media culture systems on yam plant growth (Dioscorea alata L. \u2018Pacala Duclos\u2019). COUSELO J.L., VARELA P., REY M., 2006 \u00ad Effect of benzyla\u2010 denine concentration and double\u2010phase culture system on in vitro multiplication of adult Albari plants.", "mime": "application/pdf"}, {"id": "ahs-12015", "words": "5758", "extension": ".pdf", "flesch": "63", "author": "Bayat, Hassan; Shafie, Fatemeh ; Shahraki, Basireh ", "title": "Salinity effects on growth, chlorophyll content, total phenols, and antioxidant activity in Salvia lavandulifolia Vahl.", "date": "2022", "keywords": "chlorophyll; content; effects; et al; growth; lavandulifolia; leaf; plant; salinity; salinity stress; salt; salvia; stress; total; water", "summary": "Salinity stress reduces cell divi\u00ad Fig. 2 \u00ad Effects of salinity stress on the leaf total phenolic and fla\u00ad vonoid content in S. lavandulifolia. Valifard et al. (2019) reported that photosyn\u00ad thetic pigments in Salvia mirzayanii leaves were decreased by increasing salinity stress.", "mime": "application/pdf"}, {"id": "ahs-12041", "words": "7764", "extension": ".pdf", "flesch": "62", "author": "Dorostkar, Maryam; Moradinezhad, Farid ", "title": "Postharvest quality responses of pomegranate fruit (cv. Shishe-kab) to ethanol, sodium bicarbonate dips and modified atmosphere packaging", "date": "2022", "keywords": "antioxidant; color; control; decay; effect; et al; ethanol; etoh; food; fruit; packaging; pomegranate; postharvest; quality; sci; storage; treatment; tss", "summary": "Abstract: Pomegranate fruit is very popular due to its high commercial impor\u00ad tance and health benefits. This experiment aimed to evaluate the sensory qual\u00ad ity, color, and biochemical properties (TSS, TA, TSS/TA, anthocyanin content and total antioxidant capacity) of pomegranate fruit under post\u00adharvest treat\u00ad ments, included ethanol (EtOH), sodium bicarbonate (SBC), and different pack\u00ad aging.", "mime": "application/pdf"}, {"id": "ahs-12062", "words": "6072", "extension": ".pdf", "flesch": "68", "author": "Kamimaeda, Hiroki; Yoshida, Yuki; Tamaki, Kaito; Ichihara, Masato; Akutsu, Masako", "title": "Effect of far-red light applied at the end of the day in red and green leaf lettuce cultivars grown under two types of white LED", "date": "2023", "keywords": "cultivars; green; irradiation; leaf; leaf weight; lettuce; light; red; stem; weight; white", "summary": "For red lettuce cultivars, the scatter diagram of the types of LEDs and each cultivar for the first (Z1) and second main components (Z2) showed that the fresh total weight, fresh leaf weight, stem weight, root weight, and dry total weight in \u2018Red wave\u2019, \u2018Bancyu sun bright\u2019, \u2018Sun bright\u2019, \u2018Fancy red\u2019, \u2018Red fire\u2019, \u2018Sun Marino\u2019 and \u2018Calbee red\u2019 grown under White A + FR was higher (Fig. 2). On the other hand, under White B irradia\u00ad tion, fresh total weight and fresh leaf weight were increased in only \u2018Bancyu sun bright\u2019 and \u2018Sun bright\u2019 of red lettuce cultivars and in \u2018Summer green\u2019 and \u2018Yakiniku lettuce\u2019 of green lettuce cultivars on the treatment FR LED.", "mime": "application/pdf"}, {"id": "ahs-12185", "words": "9711", "extension": ".pdf", "flesch": "62", "author": "Oraee, Atiyeh; Shoor, Mahmoud; Oraee, Toktam; Tehranifar, Ali; Nemati, Hossein", "title": "Organic amendments role in reducing drought stress in Alcea Rosea L.", "date": "2022", "keywords": "activity; amendments; application; chlorophyll; content; drought; drought stress; effects; et al; fig; growth; hollyhock; increase; leaf; leaves; manure; nitrogen; phosphorus; plant; potassium; rice; sci; soil; stress; total; water; weight", "summary": "Some studies documented the reduced element transfer in plants under soil drought stress (Liu et al., 2018; Qi et al., 2019). With increasing drought stress from 80 to 40% FC, the plant\u02bcs RWC decreased.", "mime": "application/pdf"}, {"id": "ahs-12192", "words": "4537", "extension": ".pdf", "flesch": "49", "author": "Menegatti, Renata Diana; Lima, Marcos Aur\u00e9lio C.; Souza, Aline G.; Smiderle, Oscar Jos\u00e9; Bianchi, Valmor Jo\u00e3o", "title": "Contrasting aspects of the physical and physiological dormancy shown by seeds from different peach rootstocks", "date": "2022", "keywords": "days; endocarp; germination; seeds; souza; stratification", "summary": "At the end of the germination test (at 90 days), the percentage of seed germination was determined, with germinated seeds considered as those that pre\u00ad sented radicle protrusion of at least two millimeters (MAPA, 2009). This fac\u00ad tor could compromise seed germination due to the difficulty of the embryo to overcome such a barrier during initial stages of the germination process when imbibition of water is critical.", "mime": "application/pdf"}, {"id": "ahs-12222", "words": "3970", "extension": ".pdf", "flesch": "66", "author": "Mirshekari , Amin ; Madani, Babak", "title": "Decreasing postharvest chilling injury of guava fruit by using melatonin treatment", "date": "2022", "keywords": "activity; fruit; guava; injury; melatonin; storage; treatment", "summary": "Sci., 2022 36(1): 37\u00ad42 DOI: 10.36253/ahsc\u00ad12222 Decreasing postharvest chilling injury of guava fruit by using melatonin treatment A. Mirshekari 1 (*), B. Madani 2 1 Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Yasouj, Yasuj, Iran. 2 Horticulture Crops Research Department, Natural Resources Research and Education Center of Hormozgan, AREEO, Bandar Abbas, Iran. Also, results indicated that chill\u00ad ing injury of guava fruit by using melatonin decreased through increasing integrity of membrane and reducing phospholipase D and lipoxygenase activity.", "mime": "application/pdf"}, {"id": "ahs-12275", "words": "5563", "extension": ".pdf", "flesch": "60", "author": "Aloo, Maurine; Opiyo, Arnold Mathew ; Saidi, Mwanarusi ", "title": "Maintaining postharvest quality of bell pepper (Capsicum annuum L. cv. California Wonder) using cactus (Opuntia stricta L.) mucilage coating", "date": "2022", "keywords": "acid; ascorbic; bell; cactus; cactus mucilage; coating; content; fruit; life; loss; mucilage; pepper; shelf; weight", "summary": "3. Results Effect of cactus mucilage coating on fresh weight loss and shelf life of bell pepper fruit Cactus mucilage treatments significantly reduced fresh weight loss of bell pepper fruits from 3 DAH (days after harvest) to the end of storage (Fig. 1). Effect of cactus mucilage coating on total soluble solids of bell pepper fruit Cactus mucilage coating had a significant effect on total soluble solids (TSS) content of bell pepper fruit from 3 DAH through the end of storage (Fig. 3).", "mime": "application/pdf"}, {"id": "ahs-12290", "words": "12019", "extension": ".pdf", "flesch": "59", "author": "Tutu, Abhaya Kumar Sahu; Guddun, Swikruti Sonali Kar; Kumari, Punam; Dey, Surjendu Kumar Dey", "title": "An overview of Betel vine (Piper Betle L.): Nutritional, pharmacological and economical promising natural reservoir", "date": "2022", "keywords": "acid; activities; activity; adv; antioxidant; betel; betel leaf; betel leaves; betel vine; betle; betle l.; cancer; coastal; cultivation; essential; et al; extract; food; india; inter; leaf; leaves; medicine; nutritional; odisha; oil; paan; piper; piper betle; plant; potential; pradhan; properties; res; review; role; rot; sci; vine; water", "summary": "(Haider et al., 2013). After that, the leaves are distributed in local markets or transferred to other towns (Haider et al., 2013).", "mime": "application/pdf"}, {"id": "ahs-12341", "words": "6873", "extension": ".pdf", "flesch": "65", "author": "Utama, Nafi Ananda; Pranata, Iin Anggi ; Pramesi, Putrika Citta", "title": "Maintaining physicochemical and sensory properties of guava var. Getas Merah using alginate and Cyclea barbata leaveas powder as edible coating", "date": "2022", "keywords": "acid; alginate; cblp; coating; days; firmness; fruit; guava; results; samples; sci; solids; storage; study; sugar; total", "summary": "The analysis of firmness, total soluble solids, total reducing sugar, total titratable acidity and organoleptic tests were conducted to evaluate the quality of guava fruits stored for 20 d at 14\u00b0C. In summary longer quality retention of guava fruits was found after the addition of CBLP in alginate\u00adbased edible coating.", "mime": "application/pdf"}, {"id": "ahs-12347", "words": "2900", "extension": ".pdf", "flesch": "57", "author": "Park, Seo Young; Joung, Young Hee; Suh, Jeung Keun; Roh, Mark", "title": "Evaluation of Hemerocallis germplasm using single nucleotide polymorphisms of nrITS and chloroplast interspacer region", "date": "2022", "keywords": "c c; flowering; hemerocallis; i\u00ad2; korea; minor; nrits; species", "summary": "Materials and Methods The nocturnal flowering species Hemerocallis thunbergii, H. minor, H. lilioasphodelus, and H. citri\u2010 na, and the day flowering species H. hongdoensis M.G. Chung & S.S. Kang, H. vespertina H. Hara, H. dumortierii C. Morren and hybrid \u2018Stella de Oro\u2019 were collected from Korea (K), China (C), United Kingdom (UK), United States of America (UA) and Germany (GE) (Table 1). Four noctur\u00ad nal flowering species, H. citrina, H. thunbergii, H. minor, and H. lilioasphodelus were collected including Korea, and compared with day flowering species that included H. vespertina and H. hongdoensis.", "mime": "application/pdf"}, {"id": "ahs-12403", "words": "5042", "extension": ".pdf", "flesch": "57", "author": "Tofanelli, Mauro B.D.; Cuquel, Francine Lorena; D\u2019angelo, Jessica Welinski de Oliveira; Medeiros, Jos\u00e9 Gilberto Sousa", "title": "Postharvest application of calcium chloride and 1-methylcyclopropene for quality conservation on organic ripe fig", "date": "2022", "keywords": "1\u00admcp; cacl2; calcium; days; et al; figs; fruit; maturation; postharvest; quality; storage", "summary": "Although fig tree cultivation has the potential to escalate, some pro\u00ad duction bottlenecks have inhibited this expansion, such as lack of com\u00ad mercial cultivars, unfamiliarly about ripe fig as excellent fruit for food from consumers, relative high price of ripe figs in the market, inefficient fresh ripe fig distribution and difficult to conserve quality of ripe figs after (*) Corresponding author: mbrasildt@ufpr.br Citation: TOFANELLI M.B.D., CUQUEL F.L., DE O. D\u2019ANGELO J.W., MEDEIROS J.G.S., 2022 \u00ad Postharvest appli\u2010 cation of calcium chloride and 1\u2010methylcyclopro\u2010 pene for quality conservation on organic ripe fig. The calcium chloride solution applied at 4% improves firmness and promotes soluble solid stabi\u00ad lization of ripe figs stored for 6 days in a refrigerator, whereas 1\u00adMCP treatment at a dose of 10 \u03bcg l\u00ad1 does not contribute for maintaining postharvest quality of ripe fig, nor its shelf life.", "mime": "application/pdf"}, {"id": "ahs-12444", "words": "6779", "extension": ".pdf", "flesch": "56", "author": "Maniriho, Festus", "title": "Flower differentiation and fruiting dynamics in olive trees (Olea europaea): Eco-physiological analysis in the Mediterranean basin", "date": "2022", "keywords": "bearing; cultivars; et al; europaea; factors; flowers; fruit; hermaphrodite; mediterranean; olea; olive; pistil; plant; pollen; sci; set; staminate; trees", "summary": "The formation of functional staminate rather than entirely functional hermaphrodite flowers throughout development is one of the primary factors determining the fruit set\u00ad ting level of olive flowers (Reale et al., 2009). Although various studies have been done on the dif\u00ad ferentiation process of olive flowers, there have been very few specialised investigations to document and compare biological flower development and fruit set research among cultivars in this area.", "mime": "application/pdf"}, {"id": "ahs-12450", "words": "4848", "extension": ".pdf", "flesch": "59", "author": "Raei, Yaghoub; Ghahremani, Roghaye ; Ghassemi, Saeid; Shafagh-Kolvanagh, Jalil ", "title": "Effect of chemical and biological fertilizers on the morphology and yield of safflower and soybean under monoculture and intercropping", "date": "2022", "keywords": "fertilizer; grain; grain number; intercropping; nitrogen; number; plant; safflower; soil; soybean; yield", "summary": "Similarly, the means of head number per plant and grain number per head in safflower plants and also 100 grains weight in soybean plants were increased in inter\u00ad cropped patterns compared with pure cultivation (Table 3). Traits Grain number per plant Biological yield (kg/ha) Grain yield (kg/ha) Safflower 100% urea fertilizer 252 b 8831 b 3358 b 100% biofertilizer 255.4 b 9194 ab 3359 b 50% Urea + 50% biofertilizer 296.6 a 10430 a 4284 a Soybean Traits Leaf number per plant Biological yield (kg/ha) Grain yield (kg/ha) 100% urea fertilizer 10.73 b 4122 b 1706 b Urea + biofertilizer 12.95 a 4839 a 2115 a 124 Adv.", "mime": "application/pdf"}, {"id": "ahs-12488", "words": "4963", "extension": ".pdf", "flesch": "52", "author": "Titouh, Khayreddine; Hadj Moussa, Khadidja; Boufis, Nazim; Khelifi, Lakhdar", "title": "Impact of cultural conditions on germination of olive (Olea europaea L.) somatic embryos and plantlets development from the Algerian cultivar Chemlal", "date": "2022", "keywords": "culture; embryogenesis; embryos; germination; l\u00ad1; medium; olive; plants; shoots", "summary": "However, few works have been done about the ger\u00ad mination conditions of olive somatic embryos (Mazri et al., 2020) Discussion and Conclusions Germination of somatic embryos Germination of olive somatic embryos was fre\u00ad quently achieved on media based on the chemical formulations OM and MS with a reduced concentra\u00ad tion of mineral salts, similar to those used for the cul\u00ad ture of zygotic embryos (S\u00e1nchez\u00adRomero, 2019).", "mime": "application/pdf"}, {"id": "ahs-12535", "words": "7070", "extension": ".pdf", "flesch": "62", "author": "Cano Reinoso, Diego Mauricio; Renaldy Tamalea , Rafi; Wibowo, Condro", "title": "Physicochemical characteristic and internal browning of pineapple as affected by calcium and gibberellic acid dipping application", "date": "2022", "keywords": "acid; browning; calcium; content; dipping; et al; fruit; minutes; paull; pineapple; postharvest; treatment", "summary": "Fructose (%) Sucrose (%) Studied factors (single and interaction effect) Treatment \u00ad \u00ad \u00ad \u00ad \u00ad \u00ad Dipping time \u00ad \u00ad \u00ad \u00ad \u00ad \u00ad Treatment x Dipping time \u00ad \u00ad \u00ad \u00ad \u00ad \u00ad Mean values (Treatment vs. Dipping time)", "mime": "application/pdf"}, {"id": "ahs-12552", "words": "7393", "extension": ".pdf", "flesch": "60", "author": "Balbino dos Santos, Pietros Andr\u00e9; de Carvalho, Luiz Gonsaga; Schwerz, Felipe; Buono da Silva Batista, Victor ; Ussi Monti, Cassio Augusto", "title": "Economic viability and development of radish (Raphanus sativus L.) under different soil water tensions and mulching types", "date": "2022", "keywords": "abc; analysis; area; cost; crop; growth; irrigation; leaf; mulching; plant; production; radish; root; soil; total; variable; water; yield", "summary": "Inputs and Labor represent, on average, 47% of total production costs. Average total operating cost (TOC) and average total cost (ATC) were calculated in unit terms in the economic analysis.", "mime": "application/pdf"}, {"id": "ahs-12574", "words": "7000", "extension": ".pdf", "flesch": "63", "author": "Anyaoha, Chriatian Okechukwu; Oyetunde, O. A.; Oguntolu, O.O.", "title": "Diallel analysis of selected yield-contributing traits in Okra [Abelmoschus esculentus (L.) Moench]", "date": "2022", "keywords": "effects; gca; hybrids; ik11; iwo nla; ld88; nh47\u00ad4 \u00d7; nla; nof; number; okra; plant; sca; traits; \u00d7 clemson; \u00d7 iwo", "summary": "LD88 \u00d7 Iwo Nla and Clemson \u00d7 Iwo Nla. \u00d7 Iwo Nla 51.00 b\u00ade 74.75 b\u00ade 12.25 a 13.61 a 2.72 dc 2.25 cd 9.50 c 68.50 de 60.00 c 5.00 h Clemson \u00d7 Iwo Nla 48.25 ef 75.50 b\u00ade 4.00 e 6.74 d 2.93 dc 2.00 de 13.00 a 30.50 f 42.50 e 7.75 def Source DF DTF PH NOF LNT FWT PL INL NOS THS NOR Rep (Environment) 2 ** NS ** NS NS NS NS NS NS NS Environment (E) 1 ** NS ** NS NS NS NS NS NS NS Genotype (G) 14 ** ** ** ** ** ** ** ** ** ** G\u00d7E 14 NS NS NS NS NS NS NS NS NS * Error 28 NS NS NS NS NS NS NS NS NS NS R\u00adSquared 0.86 0.71 0.82 0.84 0.72 0.92 0.88 0.94 0.95 0.95 Anyaoha et al. \u2010 Diallel analysis of yield\u2010contributing traits in Okra 101 Table 2", "mime": "application/pdf"}, {"id": "ahs-12801", "words": "5029", "extension": ".pdf", "flesch": "61", "author": "Poudel, Sarita; Aryal, Pratik; Basnet, Manoj", "title": "Effect of different packaging materials on shelf life and postharvest quality of tomato (Lycopersicum esculentum var. Srijana)", "date": "2022", "keywords": "color; fruits; life; loss; packaging; shelf; storage; tomato; tomatoes; weight", "summary": "Total soluble solids (\u00b0Brix) To determine the total soluble solids, tomato fruit was squeezed and a few drops of juice were added onto the prism plate of the refractometer (ERMA INC\u00ad JAPAN) and TSS (\u00b0Brix) was recorded. Due to low O2, high CO2, or the suitable combi\u00ad nation of these two gases, there could be retardation of color change in tomato fruits (Kidd and West, 1930).", "mime": "application/pdf"}, {"id": "ahs-12816", "words": "4617", "extension": ".pdf", "flesch": "62", "author": "Ichwan, Budiyati; Eliyanti, Eliyanti; Irianto, Irianto; Zulkarnain, Zulkarnain", "title": "Combining humic acid with NPK fertilizer improved growth and yield of chili pepper in dry season", "date": "2022", "keywords": "acid; application; chili; content; fertilizer; growth; humic; leaf; npk; plant; soil; yield", "summary": "Humic acid/NPK pH C\u00adorganic (%) N\u00adtotal (%) P (ppm) K (cmol+/kg) Water content (%) 100% HA 6.09 1.55 0.22 104.50 0.06 7.70 75% HA/25% NPK 6.02 1.45 0.29 124.80 0.19 7.56 50% HA/50% NPK 5.47 1.28 0.28 152.30 0.47 7.61 25% HA/75% NPK 5.52 1.20 0.24 144.70 0.62 7.67 100% NPK 5.32 1.22 0.23 227.30 1.07 7.50 Table 2 \u00ad The effect of different ratios of humic acid (HA)/NPK on soil chemical properties Ichwan et al. \u2010 Humic acid and NPK fertilizers improved growth and yield of chili pepper 279 chili plants compared with mixture of humic acid/NPK during the one growth season of this research. Sci., 2022 36(4): 275\u00ad281 DOI: 10.36253/ahsc\u00ad12816 Combining humic acid with NPK fertilizer improved growth and yield of chili pepper in dry season B. Ichwan, E. Eliyanti, I. Irianto, Z. Zulkarnain (*) Department of Agroecotechnology, Faculty of Agriculture, University of Jambi, Indonesia.", "mime": "application/pdf"}, {"id": "ahs-12818", "words": "2649", "extension": ".pdf", "flesch": "62", "author": "Arbelet-Bonnin, Delphine; Cang\u00e9mi, Sylvie; Laurenti, Patrik; Bouteau, Fran\u00e7ois", "title": "Observation of unexpected neo like-fruit development from Cakile maritima calli", "date": "2022", "keywords": "ben; cakile; calli; et al; fruit; maritima; plant", "summary": "These observations raise the hope to develop an in vitro model to study parthenocarpic fruit development. Even if the role of ethylene still appeared unclear (Sharif et al., 2022), ethylene responses could also lead to parthenocarpic fruit development (Pandolfini, 2009).", "mime": "application/pdf"}, {"id": "ahs-12934", "words": "6183", "extension": ".pdf", "flesch": "59", "author": "Oduntan, Adebusola; Oyetunde, Oyeboade; Shobo, Bolatito; Bodunde, Goke", "title": "Effect of harvest maturity stage and ripening remediation agents on the shelf life and biochemical quality attributes of tomato (Solanum lycopersicon) fruits", "date": "2022", "keywords": "1\u00admcp; fruits; kmno4; life; ripening; shelf; shelf life; tomato", "summary": "Abstract: Tomato fruit is highly perishable because of the characteristic high rate of ethylene production and respiration during ripening. The effects of ripening remediation agents on shelf life and biochemical quality attributes were evaluated on tomato fruits harvested at three maturity stages (breaker, turning and full\u00adripe).", "mime": "application/pdf"}, {"id": "ahs-12937", "words": "3732", "extension": ".pdf", "flesch": "60", "author": "Silva, Edgard Henrique Costa; Versuti, Jonathan ; Braz, Leila Trevisan", "title": "Grafting compatibility between Okra cultivars and root-knot nematode resistant Kenaf", "date": "2022", "keywords": "cultivars; flower; grafting; height; kenaf; number; okra; production", "summary": "The objective was to study the compatibil\u00ad ity of kenaf as rootstock with okra cultivars. These results confirm the compatibility with Table 2 \u00ad Analysis of variance and test of comparison of means of vegetative variables of okra cultivars and seedling production modali\u00ad ties NS, **, * not significant or significant at 1 or 5% probability.", "mime": "application/pdf"}, {"id": "ahs-12938", "words": "7295", "extension": ".pdf", "flesch": "63", "author": "Ashour, Hossam Ahmed; Esmail, S.E.A.; El-Attar, A.B.", "title": "Effect of different nitrogen forms and bio-treatments on the growth and seed yield of downy safflower (Carthamus lanatus)", "date": "2023", "keywords": "2020; ammonium; content; control; effect; et al; forms; growth; leaves; mean; nitrogen; oil; plant; sci; seeds; sulfate; vermicompost; viride; weight; yield", "summary": "\u00ad Plants, 11(22): 1\u00ad14. \u00ad Plants, 9(1): 22.", "mime": "application/pdf"}, {"id": "ahs-12966", "words": "6732", "extension": ".pdf", "flesch": "56", "author": "Hata, Naoki; Kawamura, M.", "title": "Effect of continuous lighting on the growth and leaf chemical components of Artemisia princeps grown hydroponically in a plant factory condition", "date": "2023", "keywords": "acid; chlorogenic; content; cultivation; growth; hata; leaf; leaves; light; mugwort; nutrient; photoperiod; plant; polyphenol; solution; weight", "summary": "The Hata and Kawamura \u2010 Response of hydroponic Japanese mugwort to continuous lighting 181 internode shortening under fluorescent light is advantageous for producing young leaves of Japanese mugwort plants because of the low plant heights in the multi\u00adshelf cultivation system used in plant factories. To procure young leaves in demand on a year\u00adround basis by hydroponic production in fully artificial light\u00ad type plant factories, we investigated whether 24\u00adh photoperiod, known to enhance some beneficial constituents, could improve the growth and chemical constituents of Japanese mugwort plants grown hydroponically in a plant facto\u00ad ry condition.", "mime": "application/pdf"}, {"id": "ahs-12981", "words": "5369", "extension": ".pdf", "flesch": "55", "author": "Moro\u0219an, Ioana-Claudia; Iv\u0103nescu, L\u0103cr\u0103mioara Carmen; Mih\u0103\u0219an, Marius; Olaru, \u0218tefan Mih\u0103i\u021b\u0103; Zamfirache, Maria-Magdalena", "title": "Biological effects of some Colchicum autumnale L. extracts on tissue development of two varieties of Ocimum basilicum L.", "date": "2022", "keywords": "autumnale; basil; basilicum; bulb; buz\u0103u; colchicine; epicotyl; extract; fig; flower; hairs; leaf; plantlets; treatment", "summary": "The treatment with C. autumnale extracts did not affect biochemical and physiological indices of the photosynthetic apparatus of treated basil plantlets. Morphological observations of treated plantlets The macromorphological differences in leaves\u2019 shape and stem development that were observed between variants of treated O. basilicum plantlets of both varieties were photographed.", "mime": "application/pdf"}, {"id": "ahs-13044", "words": "7880", "extension": ".pdf", "flesch": "60", "author": "Abshahi, Maliheh; Zarei , Hossein; Zahedi, Bahman; Garc\u00eda-Morote , Francisco Antonio; Rezaei Nejad , Abdolhossein ", "title": "Secondary metabolite changes in Maymars juniper cuttings (Juniperus sabina) under different treatments of propagation (IBA, substrate and harvest time of cutting)", "date": "2022", "keywords": "acid; antioxidant; cuttings; et al; fig; iba; juniperus; plant; ppm; propagation; rooting; sabina; season; stem; substrate; treatments", "summary": "Season \u00ad \u00ad \u00ad \u00ad <0.0001 Substrate x Season \u00ad \u00ad \u00ad \u00ad <0.0001 Fig. STUEPP C.A., RUFFELLATO\u00adRIBAS K.C., MACANH\u00c3O G., FRAGOSO R., RICKLI H.C., 2014 \u00ad Rooting of Juniperus chinensis var.", "mime": "application/pdf"}, {"id": "ahs-13045", "words": "7794", "extension": ".pdf", "flesch": "56", "author": "Chehade, Ali ; Chalak, Lamis; Merheb, Joe; Elbitar, Ahmad; Rmeily, Elie; Madi, Nagham; Massaad, Mark", "title": "Genetic and ampelographic characterization of grapevine accessions maintained in the Lebanese national collection", "date": "2022", "keywords": "accessions; analysis; asouad; berry; bunch; collection; cultivars; descriptors; diversity; et al; germplasm; grapevine; issr; leaf; length; medium; souri; table", "summary": "\u00ad low (11) \u00ad medium (7) \u00ad high (4) Prostrate hairs on main veins on upper side Absent (40) \u00ad present (3) Density of prostrate hairs on petiole None or very low (38) \u00ad low (1) \u00ad medium (2) \u00ad high (2) Opening of petiole sinus Wide open (13) \u00ad open (26) \u00ad closed (3) \u00ad overlapping (1) Leaf Length Short (13) \u00ad medium (30) Bunch weight Very low (4) \u00ad low (13) \u00ad medium (13) \u00ad high (8) \u00ad very high (5) Bunch length Short (3) \u00ad medium (6) \u00ad long (26) \u00ad very long (8) Bunch width Narrow (13) \u00ad medium (21) \u00ad wide (8) \u00ad very wide (1)", "mime": "application/pdf"}, {"id": "ahs-13349", "words": "7625", "extension": ".pdf", "flesch": "63", "author": "Jamali, Babak; Amin, Hosein", "title": "Comparison of 18 Iranian caprifig cultivars based on some morphological and biochemical parameters ", "date": "2022", "keywords": "abc; acid; caprifig; concentration; cultivars; et al; fig; g\u00ad1; jamali; leaf; ngm; plant; sci; weight", "summary": "This was in agreement with previous studies on different fig cultivars (Anac et al., 1982; Aksoy et al., 1987; Askin et al., 1998; Hakerlerler et al., 1998; Bougiouklis et al., 2020). \u00ad Plants, 10(118): 1\u00ad24.", "mime": "application/pdf"}, {"id": "ahs-13352", "words": "5946", "extension": ".pdf", "flesch": "57", "author": "Chiomento, Jos\u00e9 Lu\u00eds Trevizan; Filippi, D\u00e9bora ; Krasnievicz, Gustavo Mulinari ; De Paula, Jo\u00e3o Eduardo Carniel ; Fornari, Michele ; Trentin, Thomas dos Santos", "title": "Arbuscular mycorrhizal fungi potentiate the root system and the quality of goldenberry fruits", "date": "2022", "keywords": "amf; arbuscular; chiomento; community; cultivation; et al; fig; fruits; fungi; goldenberry; mycorrhizal; plants; production; quality; root; sci; system", "summary": "The more fine roots there are in mycorrhizal plants, the better their acquisition of water and nutrients (Chiomento et al., 2021), as these roots are the ones that most acquire and use the available resources in the plant growth medium (Costa et al., 2019). G. intraradices had a greater ability to infect plant roots than the mycorrhizal community and R. clarus (Fig. 2A).", "mime": "application/pdf"}, {"id": "ahs-13499", "words": "7929", "extension": ".pdf", "flesch": "62", "author": "Rastgoo, Sasan; Bemani, Fatemeh; Nooryazdan, Hamidreza; Izadi , Mahmood", "title": "Improving fruit set and yield of tissue cultured date palm cv. Berhi by using a combined pollination technique", "date": "2023", "keywords": "bunch; date; et al; fruit; khalal; palm; pollen; pollination; seed; set; sources; tamar; treatment; weight; zahedi", "summary": "Key words: Abnormal fruit set, metaxenia, parthenocarpic fruits, Phoenix dactylifera L., pollen source. Pollen sources affected fruit set and some seed characteristics significantly.", "mime": "application/pdf"}, {"id": "ahs-13558", "words": "7201", "extension": ".pdf", "flesch": "60", "author": "Pataraico Junior, Vicente; Fernandes Junior, Flavio; Roggia Zanuzo, Marcio; da Silva Campos, Rene Arnoux; da Silva Ponce, Franciely; de Carvalho Campos Botelho, Silvia; Vieira da Silva, Ivone; Antunes, Darley Tiago; Pereira do Nascimento, Maria Shirlyane; Seabra Junior, Santino", "title": "Yield performance and nutritional quality of tomato hybrids in response to protected environments during the Amazonian summer", "date": "2024", "keywords": "cultivation; ds0060; environment; fruit; hybrids; mean; tomato; trucker; yield", "summary": "SCARANO A., OLIVIERI F., GERARDI C., LISO M., CHIESA M., CHIEPPA M., FRUSCIANTE L., BARONE A., SANTINO A., RIGANO M.M., 2020 \u00ad Selection of tomato landraces with high fruit yield and nutritional quality under ele\u2010 vated temperatures. For high tomato yields under high temperatures, thermos tolerant hybrids must be used.", "mime": "application/pdf"}, {"id": "ahs-13591", "words": "7172", "extension": ".pdf", "flesch": "49", "author": "Khakipour, Nazanin; Torkashvand, Ali Mohammadi; Ahmadi, Abbas; Weisany, Weria", "title": "Prediction of chamomile essential oil yield (Matricaria chamomilla L.) by physicochemical characteristics of soil", "date": "2023", "keywords": "chamomile; data; et al; function; growth; input; model; mohammadi; network; neural; oil yield; plant; potassium; sci; series; soil; test; torkashvand; training; variables; yield", "summary": "This issue is important in terms of land suitability, identify areas susceptible to chamomile cultivation and planning for essential oil yields. The essential oil yield was expressed Table 1 \u00ad Statistics of data set for estimation of essential oil percentage and essential oil yield OM= Organic Matter; CCE= Calcium carbonate equivalent.", "mime": "application/pdf"}, {"id": "ahs-13608", "words": "6358", "extension": ".pdf", "flesch": "61", "author": "Cano-Reinoso, Diego Mauricio; Wibowo, Condro", "title": "Impact of exogenous pre and postharvest salicylic acid applications on MD2 pineapple quality", "date": "2023", "keywords": "acid; chen; content; et al; fruit; pineapple; postharvest; pre; quality; storage; treatments", "summary": "Previous studies in pineapple fruit demonstrated that postharvest SA treatments (in solutions with concentrations between 5 and 9 mM), reduced the internal browning severity and translucency occur\u00ad rence without affecting the total soluble solids (TSS) and total acidity (TA) negatively (Lu et al., 2010, 2011; Cano\u00adReinoso et al., 2022 b). However, despite the previous information described currently, there are no sufficient studies on pineapple fruit that document the impact of SA, especially complementing postharvest with prehar\u00ad vest applications.", "mime": "application/pdf"}, {"id": "ahs-13616", "words": "4823", "extension": ".pdf", "flesch": "54", "author": "Guti\u00e9rrez, Agustina; Monz\u00f3n, Paula; Micheletto, Sandra; Marinangeli, Pablo", "title": "Reproductive biology of Sphaeralcea species with ornamental interest", "date": "2024", "keywords": "crosses; flowers; pollen; receptivity; s. australis; s. bonariensis; s. crispa; s. mendocina; species; sphaeralcea; stigma; viability", "summary": "The highest values were recorded at 2:00 PM for S. aus\u2010 tralis (99%), S. bonariensis (99%) and S. crispa (98%), with no statistically significant differences between Table 2 \u00ad Combinations of interspecific reciprocal and intraspe\u00ad cific crosses that originated the hybrid and sibling off\u00ad spring, respectively Female parent (\u2640) x Male parent (\u2642) Interspecific reciprocal crosses S. australis S. crispa S. australis S. mendocina S. australis S. bonariensis S. bonariensis S. crispa S. bonariensis S. australis S. bonariensis S. mendocina S. crispa S. australis S. crispa S. mendocina S. crispa S. bonariensis S. mendocina S. crispa S. mendocina S. australis S. mendocina S. bonariensis Intraspecific crosses S. australis S. australis S. bonariensis S. bonariensis S. crispa S. crispa S. mendocina S. mendocina Guti\u00e9rrez et al. \u2010 Reproductive biology of Sphaeralcea species 349 them, and at 4:00 PM for S. mendocina (99%). The objective of this work was to know the viability of pollen, stigma receptivity, type of pollination and combining ability of four Sphaeralcea species (S. australis, S. bonariensis, S. crispa and S. mendocina), with the aim to develop new ornamental varieties.", "mime": "application/pdf"}, {"id": "ahs-13659", "words": "3834", "extension": ".pdf", "flesch": "69", "author": "Yuri, Jos\u00e9 Antonio; Palma, Miguel; Sep\u00falveda, \u00c1lvaro; S\u00e1nchez-Contreras, Javier; Moya, Mariana", "title": "Use of the biostimulant Retard Cherry\u00ae as a strategy to delay blooming period in sweet cherry trees", "date": "2024", "keywords": "bloom; cherry; delay; fruit; regina; retard; set; sweetheart; trees", "summary": "Sci., 2023 37(4): 427\u00ad432 DOI: 10.36253/ahsc\u00ad13659 Use of the biostimulant Retard Cherry\u00ae as a strategy to delay blooming period in sweet cherry trees J.A. Sweet cherry trees cv.", "mime": "application/pdf"}, {"id": "ahs-13749", "words": "5447", "extension": ".pdf", "flesch": "56", "author": "Soleimani, Asghar; Rabiei, Vali; Hassani, Darab; Mozaffari, Mohammad Reza; Dastjerdi, Raana", "title": "Yield related traits in some Persian walnut cultivars: Analysis of genetic and genetic by environment interaction", "date": "2024", "keywords": "cultivars; fruit; kernel; nut; sca; set; traits; walnut; weight; yield", "summary": "2 \u00ad Mean comparisons of the effect of the cultivar and year \u00d7 cultivar on fruit weight (a), kernel percent (b), fruit set (c), number of fruits on SCA (d), fruit weight on scaffold cross area (SCA) (e), and kernel weight on SCA (f) using Duncan multiple range test for genotypes and Least Significant Difference (LSD) test for interaction of year \u00d7 cultivar. ARJI I., 2018 \u00ad Stability analysis of fruit yield of some olive cultivars in semi\u2010arid environmental condition.", "mime": "application/pdf"}, {"id": "ahs-13753", "words": "8459", "extension": ".pdf", "flesch": "62", "author": "Abou Dahab, T.A.M.; Ashour, Hossam Ahmed; Saber, M.M.H.", "title": "Exogenous application of biostimulators alleviates water deficient stress on Azadirachta indica plants", "date": "2022", "keywords": "application; bio\u00adstimulators; brassinolide; brs; chitosan; cht; content; control; data; days; drought; effect; et al; growth; intervals; irrigation; level; plants; ppm; proline; sci; stress; treatments; water", "summary": "As shown from data listed in Table 5 irrigation intervals, bio\u00adstimulators treatment and interaction effects had significant influence on pigments content (chlorophyll a, b, carotenoids and Table 3 \u00ad Plant height, fresh and dry weight of shoots and fresh and dry weight of roots of Azadirachta indica as affected by the interac\u00ad tions between irrigation intervals and bio\u00adstimulators treatments (mean of two seasons) CHT (1) = chitosan at 50 ppm, CHT (2) = chitosan at 100 ppm, CHT (3) = chitosan 200 ppm, BRs (1) Mean of the three pots repre\u00ad senting the field capacity was found to be 1350 g, equivalent to 1350 cm3 of water/pot (1.35 L /pot) (Abd\u00adElmoneim et al., 2018).", "mime": "application/pdf"}, {"id": "ahs-13824", "words": "6039", "extension": ".pdf", "flesch": "54", "author": "Gales, Oliver; Jones, Joanna ; Swarts, Nigel", "title": "An analysis on the impacts of cryogenic freezing on raspberry quality", "date": "2022", "keywords": "acidity; et al; fig; food; freezing; frozen; fruit; hue; quality; raspberries; raspberry; storage; tss; variety", "summary": "Gonz\u00e1lez et al. (2002) found that berry variety, harvest timing and quality at har\u00ad vest are critical factors influencing the impact freez\u00ad ing has on raspberry fruit quality. 3 \u00ad TSS (%) (a), pH (b), Titratable acidity (c) and Hue (d) for both the conventional (grey bars) and cryogenic (black bars) methods of freezing raspberries.", "mime": "application/pdf"}, {"id": "ahs-13827", "words": "6292", "extension": ".pdf", "flesch": "65", "author": "Bondarenko, Pavlo; Alekseeva, Olha; Senin, Volodymyr; Kondratenko, Petro", "title": "Pruning terms and techniques affect vigour and flower formation of Ukrainian sweet cherry cultivars", "date": "2023", "keywords": "cherry; cultivars; krupnoplidna; length; number; pruning; severity; shoots; trees; ukraine; vigour", "summary": "Abstract: Excessive tree vigour and late entrance into full production, inherent to sweet cherry trees, are major challenges in the intensive cultivation of this crop. Different agronomic techniques can be used in order to reduce the vigour of sweet cherry trees.", "mime": "application/pdf"}, {"id": "ahs-13838", "words": "4565", "extension": ".pdf", "flesch": "61", "author": "Cefola, Maria; Capotorto, Imperatrice; Lippolis, Vincenzo ; Cervellieri, Salvatore; Damascelli, Anna; Cozzolino, Rosaria; De Giulio, Beatrice; Pace, Bernardo", "title": "CO2 modified atmosphere packaging: stress condition or treatment to preserve fruit and vegetable quality? ", "date": "2023", "keywords": "co2; grapes; kpa; kpa\u00adco2; kpa\u00ado2; quality; respiration; storage; table; treatment", "summary": "In each trial, the effect of high CO2 treatment on quali\u00ad ty parameters was observed during cold storage. On the contrary the use of high CO2 concentrations (>20 kPa) in the MA mixture (1 kPa\u00adO2 + 20 kPa\u00adCO2) increased the value of RR resulting more than a 2\u00adfold higher than Fresh sam\u00ad ple.", "mime": "application/pdf"}, {"id": "ahs-13849", "words": "7220", "extension": ".pdf", "flesch": "63", "author": "Silveira Gomez, Ana Cecilia; Rivera Marchant, Luis; Escalona Contreras, Victor Hugo", "title": "The Response of hydroponic baby lettuce to UV-B radiation exposure during the growing period", "date": "2023", "keywords": "differences; et al; fig; harvest; kristine; kristine rz; leaf; lettuce; plant; radiation; second; uv\u00adb; values; versa\u00ef", "summary": "Nevertheless, UV\u00adB radiation doses applied to each cv. UV\u00adC radiation and much of UV\u00adB radiation (wavelengths less than 290 nm) do not reach the earth.", "mime": "application/pdf"}, {"id": "ahs-13850", "words": "6138", "extension": ".pdf", "flesch": "61", "author": "Cirillo, Aurora; Magri, Anna; Petriccione, Milena; Di Vaio, Claudio", "title": "Effects of cold storage on quality parameters and nutraceutical compounds of pomegranate fruits (cv. Acco)", "date": "2023", "keywords": "cold; content; days; et al; fruit; harvest; juice; pomegranate; quality; sci; storage", "summary": "According to a similar study on \u2018Mollar\u2019 pomegranate after only 7 days of storage at 4\u00b0C, the TSS content is reduced about 11% (Gil et al., 1996), while Artes et al. (2000 b) showed a significant reduction in the acidity of pomegranate fruit juice in cv. Sci., 2023 37(1): 15\u00ad23 DOI: 10.36253/ahsc\u00ad13850 Effects of cold storage on quality para\u00ad meters and nutraceutical compounds of pomegranate fruits (cv. Acco) A. Cirillo 1 (*), A. Magri 2, 3, M. Petriccione 2, C. Di Vaio 1 1 Department of Agricultural Sciences, University of Naples Federico II, Via Universit\u00e0, 100, 80055 Portici (NA), Italy.", "mime": "application/pdf"}, {"id": "ahs-13856", "words": "2736", "extension": ".pdf", "flesch": "53", "author": "Corvino, Antonia; Romaniello, Roberto; Palumbo, Michela; Ricci, Ilde; Cefola, Maria; Pelosi, Sergio; Pace, Bernardo", "title": "Image analysis to predict the maturity index of strawberries", "date": "2023", "keywords": "analysis; class; colour; fruit; harvest; image; maturity; red; strawberries", "summary": "Image analysis (IA) has proven to be a successful contactless tool in fruit and vegetables quality assessment. Corvino et al. \u2010 Image analysis for ripeness evaluation of strawberry 85 with 24 known colour stains was placed in the cam\u00ad era\u2019s FOV as a chromatic reference.", "mime": "application/pdf"}, {"id": "ahs-13857", "words": "5623", "extension": ".pdf", "flesch": "63", "author": "Marchioni, Ilaria; Najar, Basma; Copetta, Andrea; Ferri, Benedetta; Ruffoni, Barbara; Pistelli, Luisa; Pistelli, Laura", "title": "Phytonutritional and aromatic profiles of Tulbaghia simmleri Beauv. edible flowers during cold storage", "date": "2023", "keywords": "activity; compounds; days; et al; flowers; food; sci; simmleri; storage; tulbaghia", "summary": "Fresh flowers Marchioni et al. \u2010 Changes of T. simmleri edible flowers during cold storage 27 were considered as control (T0). Marchioni et al. \u2010 Changes of T. simmleri edible flowers during cold storage 29 ously observed also in other EFs stored at low tem\u00ad perature, but the regulatory mechanisms in flowers are still under debate (Shvarts et al., 1997; Landi et al., 2015; Marchioni et al., 2020 b).", "mime": "application/pdf"}, {"id": "ahs-13870", "words": "3233", "extension": ".pdf", "flesch": "54", "author": "Battisti, Luca; Caldera, Fabrizio; Hoti, Gjylije; Trotta, Francesco; Devecchi, Marco", "title": "Nanosponges and CPPU for shelf-life prolongation of cut carnations", "date": "2023", "keywords": "1\u00admcp; cdnss; cppu; cut; flowers; nanosponges", "summary": "Materials and Methods In the coming sections, the following will be reported: a scoping review on the use of nanosponges in floriculture; a first trial of the use of CPPU and nanosponges on cut flower carnation. SEGLIE L., MARTINA K., DEVECCHI M., ROGGERO C., TROT\u00ad TA F., SCARIOT V., 2011 b \u00ad \u03b2\u2010Cyclodextrin\u2010based nanosponges as carriers for 1\u2010MCP in extending the postharvest longevity of carnation cut flowers: an eval\u2010 uation of different degrees of cross\u2010linking.", "mime": "application/pdf"}, {"id": "ahs-13872", "words": "4373", "extension": ".pdf", "flesch": "65", "author": "Guccione, Eugenia; Allegra, Alessio; Farina, Vittorio; Inglese, Paolo; Sortino, Giuseppe", "title": "Use of xanthan gum and calcium ascorbate to prolong cv. Butirra pear slices shelf life during storage", "date": "2023", "keywords": "asc; butirra; content; ctr; day; fruit; gum; pear; slices; storage; treatments; xanthan", "summary": "Butirra fruit slices at 0 time and after for 3, 5, 7, 10 days of storage at 5\u00b0C At each sampling date, different letters indicate significative differences between treatments. Butirra fruit slices at 0 time and after for 3, 5, 7, 10 days of storage at 5\u00b0C.", "mime": "application/pdf"}, {"id": "ahs-13895", "words": "7357", "extension": ".pdf", "flesch": "60", "author": "Dalleh, Maya; Borjac, Jamilah; Younes, Ghassan; Choueiri, Elia; Chehade, Ali; Elbitar, Ahmad", "title": "In vitro propagation and microtuberization of potato (Solanum tuberosum L.) Spunta variety in Lebanon", "date": "2023", "keywords": "25\u00b12; average; bap; culture; days; effect; growth; medium; mg.l\u00ad1; microtubers; night; number; plant; potato; sucrose", "summary": "The induction and develop\u2010 ment of potato microtubers in vitro on media free of growth regulating substances. \u2010 Annals Bot., 63(6): 663\u00ad 674. B., AYYOUBI Z., JAWDAT D., 2000 \u00ad The effect of gamma irradiation on potato microtuber production in vitro.", "mime": "application/pdf"}, {"id": "ahs-13899", "words": "6983", "extension": ".pdf", "flesch": "49", "author": "Amodio, Marialuisa; Attolico, Giovanni; Bonelli, Lucia; Cefola, Maria; Fazayeli, Hassan; Montesano, Francesco; Pace, Bernardo; Palumbo, Michela; Serio, Francesco; Stasi, Antonio; Colelli, Giancarlo", "title": "Sustaining low-impact practices in horticulture through non-destructive approach to provide more information on fresh produce history and quality: the SUS&LOW project", "date": "2023", "keywords": "amodio; cultivation; cvs; et al; food; leaves; pace; products; project; quality; rocket; soilless; use; water", "summary": "Abstract: The general aim of the project SUS&LOW is to increase the sustainabil\u00ad ity of fresh produce by testing and implementing low\u00adinput agricultural practices (LIP) with positive impact on product quality with the support of non\u00addestructive (ND) tools for real\u00adtime quality assessment and for product discrimination. The general aim of the project is to increase the amount of sustainably\u00adproduced food by testing and implementing low\u00adinput agricultural practices with positive impact on product quality with the support of non\u00addestructive tools for real\u00adtime quality assess\u00ad ment and product discrimination, which may inspire new marketing strategies to better support the added value of the products and increase incomes of potential users.", "mime": "application/pdf"}, {"id": "ahs-13902", "words": "7471", "extension": ".pdf", "flesch": "59", "author": "Bonora, Alessandro; Venturoli, Anna; Venturi, Melissa; Boini, Alexandra; Corelli Grappadelli, Luca", "title": "Fruit maturity and antioxidant activity affecting superficial scald development in \u2018Abate F\u00e9tel\u2019 pears", "date": "2023", "keywords": "antioxidant; apple; content; development; et al; fig; fruit; f\u00e9tel; harvest; index; maturity; months; pears; postharvest; quality; scald; sci; storage", "summary": "Res., 25: 587\u00ad592. WHITAKER B., 2004 \u00ad Oxidative stress and superficial scald of apple fruit. Bonora et al. \u2010 Maturity and antioxidants affecting \u2018Abate F\u00e9tel\u2019 storage 7 before decreasing notably again.", "mime": "application/pdf"}, {"id": "ahs-13908", "words": "4916", "extension": ".pdf", "flesch": "55", "author": "de Chiara, Maria Lucia Valeria; De Simone, Nicola; Spano, Giuseppe; Amodio, Maria Luisa; Colelli, Giancarlo ", "title": "Effect of microwave mild heat treatment on postharvest quality of table grapes", "date": "2023", "keywords": "appearance; food; grape; microwave; packaging; product; quality; samples; sci; storage; table; temperature; time; treatment", "summary": "Hortic., 232: 175\u00ad183. SISQUELLA M., VIN\u0303AS I., TEIXIDO\u0301 N., PICOUET P., USALL J., 2013 \u00ad Continuous microwave treatment to control postharvest brown rot in stone fruit. To date, a small number of studies deals with the use of microwave treatment on fresh produce (Karabulut and Baykal, 2002; Zhang et al., 2004, 2006; Sisquella et al., 2013), showing its efficiency in prolonging postharvest life of peaches, in which microwave inhibited growth of inoculated pathogens after 2 minutes, being also effective in controlling endoge\u00ad nous microflora with a very low decay incidence.", "mime": "application/pdf"}, {"id": "ahs-13910", "words": "4512", "extension": ".pdf", "flesch": "53", "author": "Allegra, Maria; Ferlito, Filippo; Torrisi, Biagio; Trovato, Sara; Cicciarello, Giuseppe; Strano, Maria Concetta", "title": "Quality of cold stored lemon fruit from orchards consociated to ancient olive trees", "date": "2023", "keywords": "cold; fig; fruits; irrigation; lemon; management; olive; peel; quality; storage", "summary": "The extension of the availability to market of high quality fruit, in a period of shortage such as the summer season, would allow to obtain the maximum economic profit for the growers. Key words: Agroecology, agroforestry, cold storage, consociation, lemon fruit, postharvest quality.", "mime": "application/pdf"}, {"id": "ahs-13911", "words": "2763", "extension": ".pdf", "flesch": "48", "author": "Benalia, Souraya; Calogero, Vittorio; Anello, Matteo; Zimbalatti, Giuseppe; Bernardi, Bruno", "title": "Application of computer vision systems for assessing bergamot fruit external features", "date": "2023", "keywords": "analysis; bergamot; cci; citrus; colour; computer; fruit; image", "summary": "Bergamot fruit RGB images were taken using a laboratory inspection chamber equipped with a lighting system and a digital camera Nikon D5200 directly connected to a personal computer, to enable remote image acquisition. Several studies dealt with the use of computer vision systems for cit\u00ad rus fruit quality assessment or grading (Cubero et al., 2014; Lorente et al., 2015; Zhang et al., 2020; Riccioli et al., 2021; Zhang et al., 2022), but up to now, no one regarded bergamot fruits.", "mime": "application/pdf"}, {"id": "ahs-13913", "words": "7639", "extension": ".pdf", "flesch": "58", "author": "AYDI BEN ABDALLAH, Rania; Chikh-Rouhou, Hela; Jabnoun-Khiareddine, Hayfa; Daami-Remadi, Mejda", "title": "Pumpkins (Cucurbita spp.) diversity and their associated microbiota", "date": "2024", "keywords": "accessions; c. maxima; community; cucurbita; dpp; et al; fruit; growth; maxima; plant; pumpkins; rhizosphere; sampling; soil; spp; times; trichoderma; weight; yield", "summary": "Soil microbial communities play key roles in plant development and health (Philippot et al., 2013; Adam et al., 2018). LARKIN R.P., HONEYCUTT C.W., 2006 \u00ad Effect of different 3\u2010 year cropping systems on soil microbial communities and Rhizoctonia diseases of potato.", "mime": "application/pdf"}, {"id": "ahs-13919", "words": "5503", "extension": ".pdf", "flesch": "57", "author": "Al-Hassanavi, H.R.; Rostami Tobnag, Ghader; Shokri, R.", "title": "Application of essential oils and optimizing storage conditions for control of postharvest diseases in apple", "date": "2023", "keywords": "apple; basil; conditions; control; decay; effect; ethylene; fruits; oils; peppermint; postharvest; production; storage; study; treatment", "summary": "Table 2 \u00ad Multiple linear regression of PBD data for postharvest controlling of apple decay caused by Penicillium expansum using three independent sources including basil essential oil, peppermint essential oils, and storage conditions Model B\u00adcoefficient t\u00advalue p\u00advalue Confidence (%) A B C A B C A B C A B C Intercept 53.642 48.155 46.49 8.642 9.392 9.962 1.32E\u00ad04* 5.4E\u00ad06* 4.8\u00ad01* 99.99* 99.99* 99.9* X1 30.458 24.971 23.306 4.542 5.292 5.862 0.175001 0.80123 0.16471 \u00ad \u00ad \u00ad X2 \u00ad10.254 \u00ad11.741 \u00ad7.406 \u00ad1.254 \u00ad0.504 0.066 0.163501 0.17999 0.29019 \u00ad \u00ad \u00ad X3 \u00ad12.429 \u00ad8.916 \u00ad6.581 \u00ad1.429 \u00ad0.679 \u00ad0.109 0.192001 0.14872 0.41567 \u00ad \u00ad \u00ad X4 \u00ad5.398 \u00ad6.885 \u00ad8.55 4.398 5.148 5.718 0.180501 0.29746 0.54115 \u00ad \u00ad \u00ad X5 34.783 29.296 27.631 1.217 1.967 2.537 0.0194* 0.0362* 0.0402* 98.06* 96.38* 95.98* X6 20.854 15.367 13.702 2.146 2.896 3.466 0.0249* 0.0102* 0.0313* 97.51* 98.98* 96.87* X7 15.16 9.673 8.008 2.84 3.59 4.16 0.0342* 0.0199* 0.0146* 96.58* 98.01* 98.54* X8 18.243 12.756 11.091 6.757 7.507 8.077 0.0322* 0.0168* 0.0497* 96.78* 98.32* 95.03* Al\u2010Hassanavi et al. \u2010 Essential oils to control postharvest diseases 153 mint), we analyzed the rate of the ethylene produc\u00ad tion for 56 days. Many other studies have showed that essential oils are promising to control posthar\u00ad vest decay in fruit and vegetables, however, the question of this study is to (1) find the best concen\u00ad tration in which essential oil could act, and (2) to determine the best environmental conditions of the storage place in which essential oils applied.", "mime": "application/pdf"}, {"id": "ahs-13943", "words": "4963", "extension": ".pdf", "flesch": "59", "author": "Vanoli, Maristella; Cortellino, Giovanna; Picchi, Valentina; Buccheri, Marina; Grassi, Maurizio; Lovati, Fabio; Marinoni, Laura; Levoni, Pietro; Torricelli, Alessandro; Spinelli, Lorenzo", "title": "Non-destructive determination of ripening in melon fruit using time-resolved spectroscopy", "date": "2023", "keywords": "carotenoid; color; content; et al; ethylene; firmness; fruit; juiciness; melons; peel; pulp; trs", "summary": "Sci., 2023 37(1): 75\u00ad82 DOI: 10.36253/ahsc\u00ad13943 Non\u00addestructive determination of ripening in melon fruit using time\u00adresolved spectroscopy M. Vanoli 1 (*), G. Cortellino 1, V. Picchi 1, M. Buccheri 1, M. Grassi 1, F. Lovati 1, L. Marinoni 1, P. Levoni 2, A. Torricelli 2, 3, L. Spinelli 3 1 Consiglio per la Ricerca in Agricoltura e l\u2019Analisi dell\u2019Economia Agraria, Centro di Ricerca Ingegneria e Trasformazioni Agroalimentari (CREA\u2010 IT), Via G. Venezian, 26, 20123 Milano, Italy. 2 Politecnico di Milano, Dipartimento di Fisica, Piazza Leonardo da Vinci, 32, 20133 Milano, Italy. G\u00d3MEZ\u00adGARC\u00cdA R., CAMPOS D.A., AGUILAR C.N., MADUREIRA A.R., PINTADO M., 2020 \u00ad Valorization of melon fruit (Cucumis melo L.) by\u2010products: Phytochemical and biofunctional properties with emphasis on recent trends and advances.", "mime": "application/pdf"}, {"id": "ahs-13944", "words": "8226", "extension": ".pdf", "flesch": "66", "author": "Dinega, T.M.; Haile, A.; Beshir, Hussien Mohammed", "title": "Improving onion productivity and producer income through nitrogen management", "date": "2023", "keywords": "application; bulb; bulb yield; dry; et al; growth; ha\u00ad1; ha\u00ad1 n; kg ha\u00ad1; nitrogen; onion; rate; times; total; weight; yield", "summary": "The frequency of N application affects the produc\u00ad tivity of onions (Grant et al., 2012). Increased leaf length at three times N applications could be due to increased recovery of N by onions and decreased N loss (Ali and Ceyhan, 2001).", "mime": "application/pdf"}, {"id": "ahs-13998", "words": "5253", "extension": ".pdf", "flesch": "60", "author": "Castellani, Maria; Bonetti, Daniele; Antonetti, Maurizio; Prisa, Domenico; Burchi, Gianluca; Nin, Stefania", "title": "Treated sediment as substrate component of three containerized ornamental species: effects on marketable and qualitative traits", "date": "2023", "keywords": "calla; flowers; growing; lmix; media; ornamental; plant; pmix; protea; sediment; species; water", "summary": "Eng., 81: 146\u00ad157. FASCELLA G., 2015 \u00ad Growing substrates alternative to peat for ornamental plants, pp. 5% of the entire national agricultural production, which derives for about 75% from potted plants and nurseries (trees and shrubs) and for the remainder from fresh cut flowers and foliages (Martorana, 2021).", "mime": "application/pdf"}, {"id": "ahs-14018", "words": "4214", "extension": ".pdf", "flesch": "51", "author": "Souza, Aline das Gra\u00e7as; Smiderle, Oscar Jos\u00e9", "title": "Container volume and doses of maximum technical efficiency of controlled-release fertilizer on the morphological quality of Cordia alliodora seedlings in Roraima", "date": "2023", "keywords": "alliodora; container; cordia; crf; doses; fertilizer; l\u00ad1; seedlings; smiderle; volume", "summary": "Abstract The objective of this study was to determine the correlation between the morphological characteristics of Cordia alliodora seedlings produced as a function of container volume and controlled\u00adrelease fertilizer (CRF) doses under nursery conditions in Northern Amazon. In turn, the 1.8 L container led to the largest stem diameter (3.95 mm) of Cordia alliodora seedlings at the DMTE of 5.38 g L\u00ad1 of CRF (Fig. 1B).", "mime": "application/pdf"}, {"id": "ahs-14019", "words": "7948", "extension": ".pdf", "flesch": "62", "author": "Prakash, Reema; Jokhan, Anjeela; Gopalan, Romila; Singh, Ranjila; Prasad, Abhineshwar", "title": "Physiological performance and fruit quality of noni (Morinda citrifolia L.) cultivated in different agro-climatic zones of Fiji", "date": "2024", "keywords": "antioxidant; content; cultivation; fruit; growth; mean; noni; plants; properties; rainfall; sci; soil; stress; table; temperature; total; water; wet; zone", "summary": "\u00ad Plants (Basel), 10: 118. \u00ad Fruits, 70: 325\u00ad332. MAHANTESH P.S., HIREMATH J.S., LOKESH C.H., RAVI Y., SAMEER HUSSAIN M.D., POOJA M.R., 2018 \u00ad Noni a wonder plant (therapeutic properties): a review.", "mime": "application/pdf"}, {"id": "ahs-14098", "words": "7105", "extension": ".pdf", "flesch": "60", "author": "Barakat, Hafsa; Draie, Rida", "title": "Evaluation of viability and germination of pollen grains of three local caprifig cultivars and their effect on some characteristics of fig fruits (Ficus carica L.)", "date": "2024", "keywords": "azraq; bunduqi; caprifig; cultivar; fig; fruit; germination; media; medium; panjani; percentage; pollen", "summary": "Fig pollen is carried by the fig wasp (Blastophaga psenes L.) that develops with the fig tree (Kjellberg et al., 1987). The measurements were taken after 24 h, 48 h, and 72 h. These three pollinators were used to pollinate three varieties of edible figs (white Satehi, Safrawi, and Habashi) to study the effect of pollen source on the productive characteristics of edible fig fruits.", "mime": "application/pdf"}, {"id": "ahs-14103", "words": "3826", "extension": ".pdf", "flesch": "63", "author": "Buglia , Luca", "title": "Sanitization system in Horticultural Sector", "date": "2023", "keywords": "air; et al; food; ionny; plasma; room; storage; test; use", "summary": "First test done in cold room containing radish (Cicorium intybus) using a Ionny 400; Second test done in cold room containing table grape (Vitis vinifera, cv. Italia) with Ionny 400; Third test done in a cold warehouse (CE.DI.OR, Zelo Buon Persico, Lodi, Italy). Inside this cold ware\u00ad house three different areas were tested (cold rooms, processing, and shipping rooms) using ionizers mod DUCT as compared to control (without ionizer).", "mime": "application/pdf"}, {"id": "ahs-14148", "words": "8568", "extension": ".pdf", "flesch": "62", "author": "Asadi Zargh Abad, Mehri; Shekafandeh, Akhtar", "title": "In vitro salt stress tolerance of \u2018Sahand\u2019 cultivar grafted on two wild almond rootstocks: An evaluation of physiological and biochemical traits between rootstocks", "date": "2024", "keywords": "activity; almond; arjan; badamkohi; combination; et al; grafting; growth; nacl; plant; rootstock; sahand; sahand\u2019/arjan; salinity; salt; scion; shoot; stress; tolerance; water", "summary": "\u00ad Plants, 9: 1783. J. Bot., 105: 306\u00ad312. VIVES\u00adPERISV., G\u00d3MEZ\u00adCADENAS A., P\u00c9REZ\u00adCLEMENTE R.M., 2017 \u00ad Citrus plants exude proline and phytohor\u2010 mones under abiotic stress conditions.", "mime": "application/pdf"}, {"id": "ahs-14158", "words": "6093", "extension": ".pdf", "flesch": "65", "author": "Muhie, Seid Hussen; Yimer, Hussen Seid", "title": "Growth and yield performance of carrot (Daucus carota L.) as influenced by plant population density under irrigation condition", "date": "2023", "keywords": "carrot; density; distance; et al; growth; leaf; plant; root; row; spacing; yield", "summary": "In general, carrot plants grown with a narrower row distance tended to mature faster than those grown with wider spacing. The fastest time to reach maturity for carrot plants (73.3 days) was observed with a spacing of 10 x 5 cm, while the slowest time (134.3 days) was observed with a spacing of 20 x 15 cm, followed by a spacing of 20 x 10 cm (121.3 days) (Table 1).", "mime": "application/pdf"}, {"id": "ahs-14173", "words": "4982", "extension": ".pdf", "flesch": "61", "author": "Teodoro, Adenir; Lemos de Carvalho, H\u00e9lio Wilson; de Barros, In\u00e1cio; Marques de Carvalho, Luciana; Girardi, Eduardo Augusto; Sampaio Passos, Orlando; dos Santos Soares Filho, Walter", "title": "Superior sweet oranges for varietal diversification of tropical rainfed orchards: Superior sweet oranges ", "date": "2023", "keywords": "brazil; carvalho; fruit; lima; orange; pera; ratio; rubi; valencia; yield", "summary": "\u2018Kona\u2019 trees excelled in yield performance associated with bulk canopy, precocity, sweet fruit with intermediate acidity, and high vitamin C contents in spite of proneness to alternate yields and low ratio (maturity index). \u2018Valencia Montemorelos\u2019 and \u2018Rubi\u2019 trees, in turn, had high yield perfor\u00ad mances coupled with intermediate canopies, sweet fruit, intermediate acidity (\u2018Rubi\u2019) and vitamin C contents, low propensity for yield fluctuation (\u2018Valencia Montemorelos\u2019), and high precocity (\u2018Rubi\u2019), albeit low ratio.", "mime": "application/pdf"}, {"id": "ahs-14180", "words": "6635", "extension": ".pdf", "flesch": "54", "author": "Salam\u00e9, Elige; Brizzolara, Stefano; Rodriguez, Marta; Iob, Matteo; Tonutti, Pietro; Ruperti, Benedetto", "title": "Ethanol fermentation- and ethylene physiology-related gene expression profiles in Red Delicious apples stored under variable hypoxic conditions and protocols", "date": "2023", "keywords": "0.8ox; apples; atmosphere; dia; ethanol; ethylene; expression; fruit; gene; levels; oxygen; red; samples; sh2; storage; time", "summary": "The imposed extreme hypoxic conditions induce selective responses of apple tissues starting from the modulation of gene expression involved in particular in primary metabolism and hormone (mainly ethylene) physiology (Cukrov et al., 2019). Statistical analysis For gene expression, data analysis was performed on six replicates (3 biological x 2 technical replicates).", "mime": "application/pdf"}, {"id": "ahs-14247", "words": "9755", "extension": ".pdf", "flesch": "68", "author": "Sarhan, Atef M.Z.; Heikal, Amaal A.M.; Saadawy, Faisal M.; Noor El-Deen, Tarek M. ; Abd Elkareem, Marie Kawther", "title": "Effect of some chemical and natural preservative solutions on vase life, water relations and some chemical composition of Dianthus caryophyllus L. cut flowers", "date": "2023", "keywords": "8\u00adhqs; acid; aoa; boric; carnation; cut; effect; flowers; ppm; pulsing; solutions; sucrose; vase; water", "summary": "This approach can help enhance the antimicrobial efficacy and ove\u00ad rall performance of natural extracts as preservatives in cut flower solutions. Comparing to the control treatment (DW), it was evident that all combined treatments involving both pulsing and holding solutions led to a substantial improvement in the vase life of cut carnation flowers.", "mime": "application/pdf"}, {"id": "ahs-14258", "words": "5079", "extension": ".pdf", "flesch": "55", "author": "Ghiselli, Lisetta; Bonetti, Daniele; Prisa, Domenico; Nin, Stefania; Burchi, Gianluca", "title": "Application of antiperspirants to improve the condition of ornamental plants subject to medium- and long-distance transport in refrigerated container", "date": "2023", "keywords": "antiperspirants; control; fig; leaves; mda; plants; privet; species; storage; transport; weeks", "summary": "The use of biodegradable film was inadequate to protect plant quality during long\u00addistance shipments. Only MDA was significant\u00ad ly affected by plant treatment with antiperspirants.", "mime": "application/pdf"}, {"id": "ahs-14261", "words": "10102", "extension": ".pdf", "flesch": "57", "author": "Etefa, Obse Fikiru; Forsido, Sirawdink Fikreyesus; Tola, Yetenayet B.", "title": "Inhibition of bleaching of stored red hot pepper through appropriate postharvest technologies and practices", "date": "2024", "keywords": "activity; annuum; blanching; capsicum; carotenoids; chilli; colour; content; drying; effect; et al; food; j. food; loss; materials; methods; months; packaging; pepper; pepper colour; powder; quality; red; sci; storage; technol; temperature; water", "summary": "ARIMBOOR R., NATARAJAN R.B., MENON K.R., CHAN\u00ad DRASEKHAR L.P., AMOORKOTH V., 2015 \u00ad Red pepper (Capsicum annuum) carotenoids as a source of natural food colors: analysis and stability \u2010 a review. The studies also revealed that the maturity stage has a significant impact on red pepper colour, with Candida red paprika having higher total carotenoids, b*, and L* values than Candida yellow paprika (Kim et al., 2015).", "mime": "application/pdf"}, {"id": "ahs-14381", "words": "12189", "extension": ".pdf", "flesch": "63", "author": "Al-Madhagi, Isam", "title": "The habit of strawberry flowering is the key for runner propagation, where the photoperiod is the main environmental factor - A review", "date": "2024", "keywords": "chilling; cultivars; development; effect; et al; everbearing; flowering; fragaria; ga3; growth; hortic; number; photoperiod; plants; production; runner; sci; storage; strawberries; strawberry; strawberry cultivars; temperature", "summary": "Within this context, the primary goal of this paper is to present an overview of the factors that influence strawberry runner yield. Discussion and Conclusions The formation of strawberry runners was influ\u00ad enced by the interaction of genetic (cultivars), envi\u00ad ronmental (photoperiod, temperature, chilling hours or cold storage), and internal (hormones and carbo\u00ad hydrate) factors.", "mime": "application/pdf"}, {"id": "ahs-14410", "words": "7823", "extension": ".pdf", "flesch": "63", "author": "Muhie, Seid Hussen; Worku, Solomon; Masrie, Biruk", "title": "Shelf-life and post-harvest quality of tomato (Lycopesicon esculentum Mill.) varieties to different packaging materials at Mersa, North Wollo, Ethiopia", "date": "2024", "keywords": "c c; fruits; life; loss; materials; packaging; polyethylene; quality; red; roma; storage; tomato; varieties; variety; weight", "summary": "With this context in mind, the goal of this study was to evaluate the impact of packaging material on the quality and shelf life of tomato fruit varieties after harvest. At the end of storage, NPPB with Roma VF and Woyno varieties had a substantially (100%) larger decay loss of tomato fruits.", "mime": "application/pdf"}, {"id": "ahs-14544", "words": "9056", "extension": ".pdf", "flesch": "59", "author": "Benjelloun, Jalila; Bouzroud, Sarah; Zaid, Younes; Guedira, Abdelkarim; Smouni, Abdelaziz", "title": "Warm stratification combined with organic manure application enhances seed germination and improves Cycas revoluta growth and development", "date": "2024", "keywords": "activity; chlorophyll; cycas; development; effect; embryos; et al; germination; growth; horse; length; manure; nitrogen; plant; presence; revoluta; root; sci; seed; sheep; soil", "summary": "\u00ad Plants, 11(23): 3354. BEWLEY J.D., BLACK M., 2013 \u00ad Seeds: physiology of devel\u2010 opment and germination.", "mime": "application/pdf"}, {"id": "ahs-14582", "words": "4160", "extension": ".pdf", "flesch": "58", "author": "KABIRI, GHIZLANE; Hernandez, Francisca; LACHKHAM, Fatima Zahra; HANINE, Hafida", "title": "Inter-annual and genotypic variation of morphological and physicochemical characters in moroccan loquat (Eriobotrya Japonica Lindl.)", "date": "2024", "keywords": "effect; error; fruit; genotype; leaf; length; loquat; seed; traits; weight; year", "summary": "\u00ad Fruits, 61(1): 407\u00ad418. METEOBLEU, 2024 \u00ad Changement climatique Berkane. Regarding the effects of Source of variation ddl Mean square F\u00adValue Pr>F Fruit Fruit weight Genotype 34 1746.70 22.03 <.0001 Year 1 512.50 6.47 0.0112 Genotype \u00d7 year 34 472.97 5.97 <.0001 Error 630 79.27 Geometric diameter of the fruit Genotype 34 495.17 2 0.0008 Year 1 84.38 0.34 0.5593 Genotype \u00d7 year 34 308.47 1.25 0.1608 Error 630 247.26 Sphericity index of the fruit Genotype 34 0.06 17.09 <.0001 Year 1 0.0006 0.17 0.6763 Genotype \u00d7 year 34 0.01 3.09 <.0001 Error 630 0.003 Fruit surface Genotype 34 1573.73 24.28 <.0001 Year 1 218.49 3.73 0.0668 Genotype \u00d7 year 34 13125.09 5.96 <.0001 Error 630 64.81 Fruit Volume Genotype 34 1682.73 22.39 <.0001 Year 1 198.99 2.65 0.1042 Genotype \u00d7 year 34 421.05 5.60 <.0001 Error 630 75.14 Weight of the flesh Genotype 34 877.43 19.18 <.0001 Year 1 65.57 1.43 0.2318 Genotype \u00d7 year 34 218.82 4.78 <.0001 Error 452 45.74 Flesh ratio Genotype 34 0.01 6.81 <.0001 Year 1 0.02 14.20 0.0002 Genotype \u00d7 year 34 0.008 5.03 <.0001 Error 452 0.001 Seed Average weight of the seed Genotype 34 2.13 5.95 <.0001 Year 1 5.43 15.18 0.0001 Genotype \u00d7 year 34 1.31 3.68 <.0001 Error 451 0.35 Geometric diameter of the seed Genotype 34 20.00 1.26 0.1563 Year 1 54.60 3.43 0.0647 Genotype \u00d7 year 34 12.21 0.77 0.8266 Error 455 15.91 Sphericity index of the seed Genotype 34 0.031 1.12 0.3 Year 1 0.017 0.62 0.4332 Genotype \u00d7 year 34 0.022 0.80 0.7823 Error 455 0.028 Seed surface Genotype 34 9.57 6.66 <.0001 Source of variation ddl Mean square F\u00adValue Pr>F Year 1 89.07 61.94 <.0001 Genotype \u00d7 year 34 3.83 2.67 <.0001", "mime": "application/pdf"}, {"id": "ahs-14608", "words": "3093", "extension": ".pdf", "flesch": "61", "author": "Lyakh, Viktor; Soroka, Anatoly", "title": "New mutations of flower shape in Nigella damascena L., its pleiotropic effects and patterns of inheritance", "date": "2023", "keywords": "damascena; flower; mutant; nigella; plant; sepals; shape; type", "summary": "Sepals reduced in length (\u201cshs2\u201d) in crosses with the single flower line of wild type (with non\u00adreduced sepals) were inherited in a monogenic recessive pat\u00ad Table 1 \u00ad F2 segregation for sepal shape and floral morph in cross of single flower, elongated sepals (wild type) and double flower, oval sepals (mutant type) plants in N. damascena Fig. As noted above, both mutations caused a partial reduction in the size of sepals of Nigella flowers.", "mime": "application/pdf"}, {"id": "ahs-14691", "words": "9860", "extension": ".pdf", "flesch": "59", "author": "Moradinezhad, Farid; Ranjbar, Azam", "title": "Efficacy of active and passive modified atmosphere packaging on quality preservation and storage life of pomegranate fruit and arils: A review", "date": "2024", "keywords": "arils; atmosphere; belay; co2; effect; et al; food; fruit; injury; kpa; life; loss; low; map; moradinezhad; packaging; pomegranate; postharvest; quality; sci; shelf; storage; technol; wonderful", "summary": "Moradinezhad and Ranjbar \u2010 Efficacy of MAP on the shelf life of pomegranate fruit and arils 85 MAP) based on the physiology of the product, envi\u00ad ronmental conditions and the properties of the pack\u00ad aging materials has a significant effect in reducing respiratory activity and increasing the shelf life (Opara et al., 2015; Opara et al., 2017; Belay et al., 2018; Dorostkar and Moradinezhad, 2022). High CO2 reduces the microbial load of fruit by penetrat\u00ad ing the microbial membrane, changing intracellular pH or forming carbonic acid, which has bacteriostat\u00ad ic effects (Zhang et al., 2013 b; Banda et al., 2015; Belay et al., 2017 b; Ranjbari et al., 2018; Van de Velde et al . , 2019, 2020; Moradinezhad and Dorostkar, 2020).", "mime": "application/pdf"}, {"id": "ahs-14732", "words": "8613", "extension": ".pdf", "flesch": "55", "author": "Oraee, Atiyeh; Tehranifar, Ali; Ghorbani, Zahra; Sayyad-Amin, Pegah", "title": "Potassium silicate enhances drought tolerance of Bellis perennis by improving antioxidant activity and osmotic regulators", "date": "2024", "keywords": "activity; antioxidant; application; conditions; content; control; drought; drought stress; effect; et al; increase; mm potassium; plants; potassium; potassium silicate; silicate; silicon; stress; water", "summary": "\u00ad Plants, 7(2): 28. \u00ad Plants, 7: 41. GUAN G., WANG Y., CHENG H., JIANG Z., FEI J., 2015 \u00ad Physiological and biochemical response to drought stress in the leaves of Aegiceras corniculatum and Kandelia obovata.", "mime": "application/pdf"}, {"id": "ahs-14786", "words": "7352", "extension": ".pdf", "flesch": "61", "author": "Tiznado-Hern\u00e1ndez, Mart\u00edn Ernesto; Gardea-Bejar, Alfonso Antero; S\u00e1nchez-Estrada, Alberto; Orozco-Avitia, Jes\u00fas Antonio; Ojeda-Contreras, Angel Javier; Troncoso-Rojas, Rosalba; Melendrez-Amavizca, Rodrigo", "title": "\u201cHurdley technologies\u201d utilized to improve postharvest life of asparagus spears (Asparagus officinalis L.)", "date": "2024", "keywords": "asparagus; changes; color; days; et al; gamma; irradiation; metabolic; postharvest; potential; quality; rate; sci; spears; storage; table; uv\u00adc; water", "summary": "However, other methods for fresh produce preservation known as \u201cHurdley tech\u00ad nologies\u201d are available now (Arvanitoyannis et al., 2009), including cold plasma (Jia et al., 2022), UV\u00adC irradiation (Haro\u00adMaza and Guerrero\u00adBeltr\u00e1n, 2013) and gamma ray irradiation (Prakash and Ornelas\u00adPaz, 2019). The osmometer was calibrated with standards of 100, 290, and 1000 mg kg\u00ad1 NaCl solution and the results of molality were converted to an osmotic potential with the Van\u2019t Hoff equation, where \u03a8s = CiRT (Jia et al., 2020).", "mime": "application/pdf"}, {"id": "ahs-14920", "words": "4463", "extension": ".pdf", "flesch": "54", "author": "Nazarian, Ramin; Nasiri Mahalati, Mehdi; Sahabi, Hossein; Feizi, Hassan", "title": "Comparison quality parameters of saffron (Crocus sativus L.) produced in Herat, Afghanistan and Torbat Heydarieh, Iran", "date": "2024", "keywords": "afghanistan; crocin; herat; heydarieh; iran; picrocrocin; quality; regions; saffron; safranal; torbat", "summary": "In another study, it has been stated that soil acidity in the range of neutral to slightly alkaline has a positive correlation with saffron quality (Gresta et al., 2008). \u00ad Iranian J. Biol., 25(3): 423\u00ad429. VALLE GARCIA\u00adRODRIGUEZ M., SERRANO\u00adD\u00cdAZ J.S., TARANTILIS P.A., LO\u0301PEZ\u00adCO\u0301RCOLES H., CARMONA M., ALONSO G.L., 2014 \u00ad Determination of saffron quality by high\u2010performance liquid chromatography.", "mime": "application/pdf"}, {"id": "ahs-14940", "words": "6878", "extension": ".pdf", "flesch": "61", "author": "Susilawati, Susilawati; Irmawati, Irmawati; Harun, Muhammad Umar; Ichwan, Budiyati", "title": "Shallot cultivation in tropical climate ecosystems using floating and non-floating systems with different doses of cow manure", "date": "2024", "keywords": "application; bulb; conventional; cow; cow manure; cultivation; farming; growth; leaf; manure; shallot; system; ton", "summary": "1B) systems with various doses of cow manure \u00ad showed differences in growth and yield. \u00ad Plants, 10(5): 1\u00ad15.", "mime": "application/pdf"}, {"id": "ahs-14952", "words": "11951", "extension": ".pdf", "flesch": "48", "author": "Shamsudin, Nor Amirah; Sathiya Seelan, Jaya Seelan; Gansau, Jualang Azlan; Rusdi, Nor Azizun", "title": "A review: Molecular identification of orchid mycorrhiza", "date": "2024", "keywords": "analysis; dendrobium; development; dna; ecol; et al; extraction; fungal; fungi; fungus; germination; identification; its1; its4; mccormick; methods; mycorrhizal; mycorrhizal fungi; new; orchid; orchid mycorrhizal; plant; primer; sci; seed; seed germination; sequencing; species; study; tulasnella", "summary": "The classification of orchid fungus is determined by the existence or absence of functional pelotons within cortical cells, leading to the categorization of orchid mycorrhizal fungi (OMF) or orchid non\u00admycorrhizal fungi (ONF) Orchid mycorrhizal fungi are often highly specific, meaning that they can only form partnerships with certain orchid species, and vice versa.", "mime": "application/pdf"}, {"id": "ahs-14965", "words": "5938", "extension": ".pdf", "flesch": "57", "author": "Muhie, Seid Hussen; Akele, Fatuma; Yeshiwas, Tadele", "title": "Phenological and yield response of primed carrot (Daucus carota L) seeds under deficit irrigation ", "date": "2024", "keywords": "carrot; crop; days; emergence; germination; interval; irrigation; priming; root; sci; seed; seedling; total; treatment; water; yield", "summary": "Abstract: Seedling emergence and stand establishment of carrot seeds are often slow and erratic which results in low productivity. Thus, it\u2019s of paramount impor\u00ad tance to examine the different priming techniques to enhance the quality of carrot seeds.", "mime": "application/pdf"}, {"id": "ahs-14997", "words": "6004", "extension": ".pdf", "flesch": "64", "author": "Richardson, Matthew; Arlotta, Caitlin; Monroe-Lord, Lillie", "title": "Influence of ground cover and tunnels on production of Red Russian kale in urban gardes", "date": "2024", "keywords": "agriculture; black; cover; garden; ground; kale; mulch; plastic; plots; production; sites; soil; straw; treatments; tunnel; urban; yield", "summary": "We investigated black plastic and straw mulch compared to bare soil cover in low tunnels at 10 urban garden sites and in low tunnels within a high tunnel in the USA to ascertain the influence on yield and nutrients of Red Russian kale, soil temperature, air temperature, weed pressure, and aphid abundance. Kale had low yield in garden sites, likely because the outside envi\u00ad ronment was too cold for low tunnels to gain and retain heat.", "mime": "application/pdf"}, {"id": "ahs-15033", "words": "10743", "extension": ".pdf", "flesch": "57", "author": "Wise, Kimber; Selby-Pham, Jamie; Simovich, Tomer; Gill, Harsharn", "title": "A biostimulant complex comprising molasses, Aloe vera extract, and fish-hydrolysate enhances yield, aroma, and functional food value of strawberry fruit", "date": "2024", "keywords": "aloe; analysis; antioxidant; aroma; biostimulant; changes; colour; complex; content; control; et al; extract; fig; food; fruit; growth; increase; leaf; measures; molasses; plant; quality; sci; strawberry; strawberry fruit; total; treatment; vera; water; yield", "summary": "The biostimulant effects associated with application Wise et al. \u2010 Biostimulant complex improves strawberry quality 49 of Aloe vera extracts are varied, including increased propagation efficiency and growth of Populus tree clones (El Sherif, 2017), eucalyptus tissue cultures (Hendi, 2021), and grape vine cuttings (Uddin et al., 2020), improved growth, biomass, and oil content of sweet basil (Hamouda et al., 2012), increased growth, yield, oil content, and nutritional content of caraway (Khater et al., 2020), improved growth and chlorophyl content of fenugreek (Al\u00adYasiri et al., 2021), increased leaf growth and terpene content in lavender (El Sherif et al., 2020), enhanced fruit yield and nutritional content of okra (Hemalatha et al., 2018 a, b), and dose\u00addependent positive and nega\u00ad tive effects on cereal germination (Bali\u010devi\u0107 et al., 2018). Wise et al. \u2010 Biostimulant complex improves strawberry quality 53 colour measures L*, a*, and b* (Table S4).", "mime": "application/pdf"}, {"id": "ahs-15047", "words": "10629", "extension": ".pdf", "flesch": "56", "author": "Hasrianda, E.F.; Setiarto, R. Haryo Bimo; Davis, La Ode Muhammad Muchdar; Poerba, Yuyu Suryasari", "title": "Future prospects and challenges in developing saline-tolerant banana", "date": "2024", "keywords": "accessions; banana; breeding; conditions; cultivars; development; diversity; drought; et al; gamma; gene; musa; plant; protein; research; saline; salinity; salt; sci; stress; technology; tolerance; transformation; transgenic; wang", "summary": "This review article will describe current knowledge of biodiversity and various biological responses when banana plants are exposed to saline stress. Developing banana plants with improved salinity tolerance is crucial to ensure food security, especially in regions prone to stress.", "mime": "application/pdf"}, {"id": "ahs-15064", "words": "8571", "extension": ".pdf", "flesch": "55", "author": "Taiti, Cosimo; Guardigli, Giorgia; Babbini, Simone; Marone, Elettra; Masi, Elisa; Comparini, Diego; Mancuso, Stefano", "title": "Characterization of Italian honeys: integrating volatile and physico-chemical data", "date": "2023", "keywords": "acacia; analysis; beekeeper; chestnut; citrus; content; data; et al; hmf; honey; honey samples; linden; multifloral; origin; samples; values", "summary": "Honey samples from different flowers, including acacia, chestnut, citrus, linden, and multifloral, were collected and investigated. Honey samples were prepared by placing 0.5 g in 10 mL of H2O (1:20), mixing for 12\u00ad24h, then filtering and diluting 1:1 using the same solution as the mobile phase.", "mime": "application/pdf"}, {"id": "ahs-15253", "words": "7042", "extension": ".pdf", "flesch": "45", "author": "T\u00fct\u00fcnc\u00fc, Mehmet; Dalda \u015eekerci, Akife; D\u00f6nmez, Dicle; \u0130zg\u00fc, Tolga; Isak, Musab Abdukadir; \u015eim\u015fek, \u00d6zhan", "title": "Plant biostimulants in ornamentals: Enhancing growth and stress tolerance", "date": "2024", "keywords": "application; biostimulants; development; effects; et al; growth; increase; nutrient; ornamental; plant; plant biostimulants; plant growth; production; quality; root; sci; stress; tolerance; yield", "summary": "Key words: Abiotic stresses, bioactivators, growth stimulation, ornamental plants, plant biostimulants, stress tolerance. Plant biostimulants, also called bioactivators, are becoming increasingly well\u00adliked in the agricultural sector due to their capacity to boost a plant\u2019s growth rate and increase its resistance to stress.", "mime": "application/pdf"}, {"id": "ahs-15354", "words": "4803", "extension": ".pdf", "flesch": "58", "author": "Cavi\u00e3o, Helen Corso; Russi, Alessandra; Schwambach, Jos\u00e9li", "title": "Biocontrol of Fusarium spp. in vitro and in vine cuttings using Bacillus sp. F62", "date": "2024", "keywords": "bacillus; compounds; control; cuttings; et al; f62; fusarium; grapevine; growth; plant; spp", "summary": "Ziedan et al., 2011; Cruz et al., 2014; Abdullah et al., 2015; Markakis et al., 2017; Ghuffar et al., 2018; Reveglia et al., 2018; Akg\u00fcl and Ahio\u011flu, 2019). Nevertheless, the inoculation of this same bacterium by soil drenching in cuttings of \u2018SO4\u2019 improved plant development by increasing the length of the primary shoot, the number of nodes in the primary shoot, and the total number of nodes (Russi et al., 2020).", "mime": "application/pdf"}, {"id": "ahs-15528", "words": "6120", "extension": ".pdf", "flesch": "51", "author": "Tini, Etik Wukir; Widodo, Pudji; Sugiyono; Ulinnuha, Zulfa", "title": "Assessment of genetic parameters and heritability of Dendrobium species section Spatulata native to Indonesia", "date": "2024", "keywords": "dendrobium; diversity; flower; leaf; length; orchid; petal; plant; sepal; shape; species; traits; variability; width", "summary": "The potential for improvement through direct selection was indicated by high heritability with high genetic variability flower stalk length, length of inflorescence, flower arrangement length, flower length, flower width, dorsal sepal width, lateral sepal width, petal length, petal width, labellum length, labellum width, number of florets. High genetic diversity in plants reflects substantial genetic variation, signifying numerous genetic differences between individual plants.", "mime": "application/pdf"}, {"id": "ahs-15535", "words": "9199", "extension": ".pdf", "flesch": "65", "author": "Brengi, S.H.; Abouelsaad, Ibrahim; Mahdy, R.M.; Khadr, A.A.", "title": "Field evaluation of biostimulants on growth, flowering, yield, and quality of snap beans in subtropical environment", "date": "2024", "keywords": "6\u00adba; application; bean; control; et al; growth; ksi; number; plant; pods; ppm; ppm tria; sci; seasons; snap; tria; weight; yield", "summary": "Although previous studies have examined the individual impacts of these elicitors on plant growth, a comprehensive investigation into their effects specifically on snap bean plants remains lacking. \u00ad Plants, 7(3): 54.", "mime": "application/pdf"}, {"id": "ahs-15659", "words": "5267", "extension": ".pdf", "flesch": "57", "author": "mokhtarnejad, Lachin; Farzanehj, Mohsen", "title": "The effect of thymol and carvacrol rich-plant essential oils on controlling postharvest decay molds in orange fruit ", "date": "2024", "keywords": "activity; antifungal; carvacrol; compounds; eos; essential; fruit; fungi; oils; thymol", "summary": "PLOTTO A., ROBERTS D., ROBERTS R.G., 2003 \u2010 Evaluation of plant essential oils as natural postharvest disease control of tomato (Lycopersicon esculentum). According to GC\u00ad MS analysis, the major compounds of T. danensis essential oil were thymol (65.5%) and alpha\u00adterpinene (11.9%) whereas T. vulgaris was rich in thymol (59%) and p\u00adcymene (15.6%).", "mime": "application/pdf"}, {"id": "ahs-15664", "words": "9579", "extension": ".pdf", "flesch": "56", "author": "El-Nashar, Yasser", "title": "Morphological and molecular characterization of some Chrysanthemum (Dendranthema grandiflora) cultivars", "date": "2024", "keywords": "abrun; chrysanthemum; chrysanthemum cultivars; crystal; crystal red; cultivars; diversity; et al; inflorescence; kodiack; leaf; length; markers; number; pink; plant; red; sci; ssr; weight; white; yellow", "summary": "The mean values of the leaf area of one leaf 10 cm from the plant height did show significant differences among plant cultivars in both seasons (Table 4 and Fig. 2). Other quality parameters such as inflorescence diameter and ray floret length were found to be optimal in Kodiack, Crystal White, Crystal Pink, Coca Bleach, and Crystal Yellow cultivars.", "mime": "application/pdf"}, {"id": "ahs-15671", "words": "7036", "extension": ".pdf", "flesch": "60", "author": "Ghassemi-Golezani, Kazem; Abdoli, Soheila", "title": "Salicylic acid and iron-oxide nanoparticles improved the growth and productivity of ajowan under salt stress", "date": "2024", "keywords": "ajowan; fe2o3\u00adnps; foliar; growth; plant; root; salinity; salt; seed; shoot; stress; treatments; yield", "summary": "\u00ad Plants, 9: 1574. RASHEED F., ANJUM N.A., MASOOD A., SOFO A., KHAN N.A., 2020 \u00ad The key roles of salicylic acid and sulfur in plant salinity stress tolerance.", "mime": "application/pdf"}, {"id": "ahs-15691", "words": "8461", "extension": ".pdf", "flesch": "60", "author": "Ponteras, John; Quisil, John Donald; Salas, Felix", "title": "Pigment composition and physico-chemical characteristics of Bittergourd (Momordica charantia L. cv. Jadeite) during postharvest period as influenced by illumination colors", "date": "2024", "keywords": "bittergourd; blue; chlorophyll; content; et al; fruits; gourd; leds; light; loss; postharvest; quality; red; salas; sci; shelf\u00adlife; storage; treatments; weight; white; yellowing", "summary": "Taiti et al., 2017) and can help prolong its shelf\u00adlife (Salas et al., 2015). For example, bittergourd fruits can be stored for up to five days under ambient conditions without ripening, yellowing, or losing their bitterness (Salas et al., 2015; Prajapati et al. , 2021 a).", "mime": "application/pdf"}, {"id": "ahs-15711", "words": "4782", "extension": ".pdf", "flesch": "52", "author": "Abravesh, Z.; Iranbakhsh, A.; Mirzaie-Nodoushan, Hossein; Ebadi, M.; Oraghi Ardebili, Z.", "title": "Effects of foliar application of two forms of selenium on anatomic features of Thymus daenensis Celak", "date": "2024", "keywords": "diameter; effects; epidermis; leaf; nanoparticles; plant; ppm; root; selenium; species; thickness; treatments", "summary": "Exogenous application of selenium treatments was conducted on the plantlets, as follows: three concentrations of selenium nanoparticles (2, 4, and 8 ppm of NanoSe), and sodium selenate as the bulk form (2, 4, and 8 ppm of SoSe), along with distilled water as a control for the experiment, were applied on the plantlets by 6 times foliar spraying with intervals of two weeks, starting at four leave stage of the plantlets based on a completely randomized design, with five replications. Abstract: To investigate selenium effects on anatomic features of Thymus daenensis, three concentrations of bulk and nanoparticles of the element (2, 4 and 8 ppm) along with distilled water, as a control, were sprayed on foliar of young seedlings of the plant species for six times with 2 weeks intervals.", "mime": "application/pdf"}, {"id": "ahs-15769", "words": "3758", "extension": ".pdf", "flesch": "53", "author": "Tran, Thanh Thang; Le, Thi Thuy Tien; Nguyen, Hoang Phuc", "title": "Effectiveness of KMnO4 and activated carbon on the quality and storage properties of mango fruit ", "date": "2024", "keywords": "carbon; ethylene; fruit; kmno4; life; mango; mangoes; quality; weight", "summary": "TRAN T.T., LE T.T.T., NGUYEN H.P., 2024 \u00ad Effectiveness of KMnO4 and activated carbon on the quality and storage properties of mango fruit. Therefore, the objective of this research is to assess the effectiveness of potassium permanganate and activated carbon treatments on various quality parameters of postharvest Cat Hoa Loc mango.", "mime": "application/pdf"}, {"id": "ahs-15798", "words": "9535", "extension": ".pdf", "flesch": "57", "author": "Thakur, Vandana; Kumar, Pardeep; Sharma, Sunny", "title": "Insight to the conventional and biotechnological approaches in tomato on potato grafting (Pomato): A review ", "date": "2025", "keywords": "combination; development; et al; fruit; fusion; genes; grafted; grafting; grafts; growth; hortic; hybrids; kumar; plant; potato; quality; rootstock; scion; sharma; somatic; thakur; thakur et; tomato; tomato plant; tuber; yield", "summary": "There is a significant improvement in growth and yield attributes in grafted tomato plants between BARI tomato\u00ad11 (scion) and two potato rootstocks, namely Asterix and Cardinal (Arefin et al., 2019) YASINOK A.E., SAHIN F.I., EYIDOGAN F., MUSTAFA K., ANDHABERAL M., 2009 \u00ad Grafting tomato plant on tobacco plant and its effect on tomato plant yield and nicotine content.", "mime": "application/pdf"}, {"id": "ahs-16080", "words": "4678", "extension": ".pdf", "flesch": "59", "author": "Purnima Paramanik; Nirmalya Banerjee; Subrata Raha; Dipak Kumar Kar", "title": "An efficient nutrient medium for asymbiotic seed germination and in vitro plant generation of Vanda tessellata (Roxb.) Hook. ex G. Don", "date": "2025", "keywords": "0.00\u00b10.00; banana; charcoal; formation; germination; media; medium; orchids; plant; seed; tessellata", "summary": "KUNDSON L., 1946 \u00ad A new nutrient solution for the germination of orchid seeds. Sci., 2024 38(4): 363\u00ad370 DOI: 10.36253/ahsc\u00ad16080 https://oaj.fupress.net/index.php/ahs An efficient nutrient medium for asymbiotic seed germination and in vitro plant generation of Vanda tessellata (Roxb.)", "mime": "application/pdf"}, {"id": "ahs-16106", "words": "4717", "extension": ".pdf", "flesch": "55", "author": "Shamsi, Siti Mariam; El Pebrian, Darius; Mustaffha, Samihah; Sulaiman, Hamdam; Zahari, M.K.; Ghazali, Nurul Aisyah Adilah", "title": "Lettuce postharvest quality: Affordable packaging and storage durations", "date": "2025", "keywords": "chlorophyll; content; lettuce; loss; materials; newspaper; packaging; plastic; quality; storage; weight", "summary": "This type of plastic is specifically designed for packaging vegetables and fruits, and it is commonly used by the farmers for lettuce packaging. Building on these findings, this study addresses a critical gap in understanding the role of effective and affordable packaging materials in maintaining lettuce quality during storage, with practical implications for small\u00adscale lettuce farmers.", "mime": "application/pdf"}, {"id": "ahs-16128", "words": "4277", "extension": ".pdf", "flesch": "66", "author": "Ghimire, Nishes; Sapkota, Puja; Poudel, Pragya; Sapkota, R.; Dahal, Kishor Chandra", "title": "Pruning date and hydrogen cyanamide effects on growth and yield of grapevine var. Cabernet Sauvignon", "date": "2024", "keywords": "application; budburst; buds; cyanamide; effect; grapevine; hydrogen; nepal; pruning; treatments; vines", "summary": "c 9.93\u00b13.38 bc 8.48\u00b13.02 b 1.91\u00b11.29 a 3.36\u00b11.71 a 6.97 2.161 ** D46 12.43\u00b13.63 c 11.1\u00b13.78 bc 9.69\u00b13.46 b 2.12\u00b11.54 a 4.25\u00b12.27 a 7.92 2.510 ** D49 13.79\u00b14.04 c 11.98\u00b14.13 bc 10.58\u00b13.93 b 2.31\u00b11.8 a 4.87\u00b12.62a 8.13 3.017 ** D51 15.1\u00b14.56 b 12.76\u00b14.53 b 12.57\u00b14.52 b 2.50\u00b12.03 a 5.49\u00b13.02 a 9.70 3.525 ** D55 16.09\u00b15 b 13.82\u00b15.02 b 13.61\u00b15.02 b 2.69\u00b12.28 a 6.21\u00b13.49 a 10.48 3.725 ** D59 16.9\u00b15.28 b 14.72\u00b15.32 b 14.63\u00b15.35 b 2.87\u00b12.5 a 6.97\u00b13.97 a 11.21 4.140 ** D65 18.33\u00b15.74 b 16.26\u00b15.92 b 16.00\u00b15.86 b 3.05\u00b12.75 a 7.83\u00b14.52 a 12.25 5.081 ** D69 19.69\u00b16.27 b 17.65\u00b16.46 b 17.53\u00b16.46 b 3.21\u00b12.98 a 8.62\u00b15.06 a 13.29 5.679 ** Table 3 \u00ad Effect of pruning date followed by HC application on number of days to 1st and 50% budburst, Dhading, Nepal, 2021 Mean with the same letter(s) within the column do not differ significantly by DMRT at 5%. \u00ad Effect of different timing of pruning followed by HC appli\u00ad cation on observed fruitfulness.", "mime": "application/pdf"}, {"id": "ahs-16177", "words": "10873", "extension": ".pdf", "flesch": "69", "author": "Razzak, M. Abdur; Asaduzzaman, Md.; Asao, Toshiki", "title": "Titanium based electro-degradation of nutrient solution and green light improve autotoxicity, growth and yield of lettuce grown in recycled hydroponics", "date": "2025", "keywords": "culture; green; leds; lettuce; light; nutrient; plant; solutions; yield", "summary": "In non\u00adrecycle system, culture solutions fully drain out to start next culture after harvesting of first culture. However, in commercial cultivation, reuse of culture solutions negatively affects the yield of crop.", "mime": "application/pdf"}, {"id": "ahs-16233", "words": "5131", "extension": ".pdf", "flesch": "59", "author": "Muda, Strayker Ali; Lakitan, Benyamin; Ramadhani, Fitri; Juwinda", "title": "Butterhead lettuce growth under shallow water tables and its recovery on tropical urban ecosystem", "date": "2025", "keywords": "area; butterhead; growth; leaf; lettuce; recovery; substrate; surface; table; water; wt1; wt2; wt3", "summary": "Meanwhile, in other plants, such as tomato plants, 5 cm and 10 cm below media surface, did not reduce leaf growth rate, specific leaf weight, and leaf water content (Meihana et al., 2017). Sci., 2024 38(4): 327\u00ad337 DOI: 10.36253/ahsc\u00ad16233 https://oaj.fupress.net/index.php/ahs Butterhead lettuce growth under shallow water tables and its recovery on tropical urban ecosystem S.A. Muda 1, B. Lakitan 1, 2 (*), F. Ramadhani 1, Juwinda 1 1 College of Agriculture, Universitas Sriwijaya, Indralaya 30662, Indonesia.", "mime": "application/pdf"}, {"id": "ahs-16275", "words": "7781", "extension": ".pdf", "flesch": "60", "author": "Elbitar, A.; Chehade, A.; Kanj, F.; Yahfoufi, Suzanne", "title": "In vitro propagation and shootlets assessment for drought and salinity tolerance of traditional accessions of potato ", "date": "2025", "keywords": "accessions; height; leaves; l\u00ad1; number; plant; potato; roots; shootlets; stress; ta1; ta2; ta3; tal; temperature; tolerance; water", "summary": "The effect of culture medium on the multiplication rate and height of potato shootlets is illustrated in figure 4. These observations demonstrate that the greatest tolerance under both high and low temperature conditions was exhibited by TA1 potato accession, with TA3 showing the next highest tolerance at high temperature.", "mime": "application/pdf"}, {"id": "ahs-16385", "words": "7568", "extension": ".pdf", "flesch": "59", "author": "Hussen, Jemal Seid; Muhie, S.H.", "title": "Interaction between sowing date and mulching is important for better growth and productivity of carrot in a weather-vulnerable area of Ethiopia", "date": "2025", "keywords": "carrot; date; growth; july; mulching; rate; root; root yield; sawdust; soil; sowing; sowing date; weed; yield", "summary": "For this reason, this study focused on implementing management practices such as proper sowing dates and mulching to minimize adverse effects on root yield and suppress weed growth. LAVANYA A.V.N., VANI V.S., REDDY P.S.S., CHAITANYA K., 2017 \u00ad Effect of sowing dates and spacing on growth and root yield of radish cv.", "mime": "application/pdf"}, {"id": "ahs-16549", "words": "6931", "extension": ".pdf", "flesch": "42", "author": "Hussen, Jemal Seid; Ahmed, Gebeyaw E.", "title": "Role of vertical farming for sustainable urban horticulture: A review", "date": "2025", "keywords": "agriculture; crops; cultivation; farming; food; growth; horticulture; hydroponics; land; plants; population; production; security; soil; systems; urban; vegetables; vertical; water", "summary": "Urban food security hinges on factors such as food availability, accessibility, and quality, all of which stand to benefit from the implementation of urban vertical farming techniques. The absence of soil in vertical farming systems generally prevents weed growth, reducing labor costs in this aspect.", "mime": "application/pdf"}, {"id": "ahs-16590", "words": "6324", "extension": ".pdf", "flesch": "58", "author": "Puccinelli, Martina; Maggini, Rita; Pardossi, Alberto; Incrocci, Luca", "title": "Continuous lighting improves the leaf quality of sweet basil (Ocimum basilicum L.) grown in a controlled environment", "date": "2025", "keywords": "basil; concentration; d\u00ad1; et al; growth; leaf; light; lighting; m\u00ad2; nitrate; photoperiod; plant; quality; sci; \u00b5mol", "summary": "VELEZ\u00adRAMIREZ A.I., VAN IEPEREN W., VREUGDENHIL D., MILLENAAR F.F., 2011 \u00ad Plants under continuous light. \u00ad Plants, 10: 1\u00ad14.", "mime": "application/pdf"}, {"id": "ahs-16663", "words": "5602", "extension": ".pdf", "flesch": "56", "author": "Cruz, Maria Angel; Alcasid, Carolyn; Balendres, Mark Angelo", "title": "Endophytic Luteibacter yeojuensis strains stimulate banana plant growth", "date": "2025", "keywords": "bacteria; banana; control; endophytes; et al; grand; isolates; luteibacter; nain; plant; strains; study; yeojuensis", "summary": "K\u00d6BERL M., DITA M., MARTINUZ A., STAVER C., BERG G., 2015 \u00ad Agroforestry leads to shifts within the gammaproteobacterial microbiome of banana plants cultivated in Central America. JOHANSEN J.E., BINNERUP S.J., KROER N., MOLBAK L., 2005 \u00ad Luteibacter rhizovicinus gen. nov., sp. nov., a yellow\u2010pigmented gammaproteobacterium isolated from the rhizosphere of barley (Hordeum vulgare L.).", "mime": "application/pdf"}, {"id": "ahs-16693", "words": "18025", "extension": ".pdf", "flesch": "64", "author": "Al-madhagi, Isam; Arraf, Elham", "title": "Evaluation of salinity tolerance of Yemeni chilli pepper genotypes during gemination by using different statistically models ", "date": "2025", "keywords": "chilli; d 0; et al; genotypes; germination; grp; levels; mgt; nacl; salinity; salt; sensitivity; ssi; stress; table; tolerance; values", "summary": "The degree of genotype tolerance to salinity depends on inherent resistance mechanisms, including metabolic responses activated during salt stress (Horuz et al. , 2022). All factors examined, including salinity stress levels, genotype, and their interaction, had highly significant effects on the germination percentage (GrP) of chilli genotypes (p<0.001).", "mime": "application/pdf"}, {"id": "ahs-16747", "words": "8192", "extension": ".pdf", "flesch": "44", "author": "Mart\u00ednez-Villag\u00f3mez , Mercedes; Barrientos-Priego, Alejandro Facundo; Mascorro-Gallardo , Jos\u00e9 Oscar; Iturriaga , Gabriel; Esp\u00edndola-Barquera, Mar\u00eda de la Cruz", "title": "Effect of auxins on the rooting of the avocado rootstock 'Duke 7'", "date": "2025", "keywords": "acid; auxin; avocado; callus; concentration; development; duke; et al; formation; iaa; iba; naa; percentage; plant; propagation; quality; root; rooting; rootstock; shoots; type", "summary": "Synthetic auxins like indole\u00ad3\u00adbutyric acid (IBA) and 1\u00adnaphthaleneacetic acid (NAA) serve as the primary regulators of adventitious root formation through complex interactions that modulate metabolic, transport, and signaling processes (Lakehal and Bellini, 2019). These outcomes are analyzed through three critical lenses: Their physiological implications for adventitious root formation, practical applications for commercial clonal propagation systems, and comparative relevance to established literature in avocado propagation.", "mime": "application/pdf"}, {"id": "ahs-16755", "words": "7086", "extension": ".pdf", "flesch": "56", "author": "da Silveira, Jo\u00e3o Vitor Melquiades; dos Santos, Erich Cristian Pereira; dos Santos, Lucas Pereira; de Freitas, Carla Francisco; de Arruda, Rodolfo Fioruci; Garcia, Robson Henrique Pedroso; Gorni, Pedro Henrique", "title": "Glucose exogenous increases biochemical and physiological responses in Beta vulgaris L.", "date": "2025", "keywords": "acid; activity; antioxidant; application; beet; chlorophyll; compounds; concentrations; control; et al; fig; glc; glucose; growth; l\u00ad1; mmol; plants; standard", "summary": "The current investigation evaluated the effect of glucose (0, 5, 10, 20, and 30 mmol L\u00ad1) on beet plants 10 days after transplantation. Materials and Methods Experimental location and plant material The experiment was conducted using beet plants in pots inside a greenhouse on a wooden bench, kept open sky, covered by shading which provided 50% of solar radiation located at the Escola Superior de Agronomia de Paragua\u00e7u Paulista (ESAPP), Brazil (22\u00b041\u201976\u201d S, 50\u00b058\u201933\u201d W).", "mime": "application/pdf"}, {"id": "ahs-16774", "words": "8666", "extension": ".pdf", "flesch": "60", "author": "Mendoza, Mariecris Rizalyn; Laurena, Antonio; Diaz, Maria Genaleen; Ocampo, Eureka Teresa; Laude , Tonette; Lalusin, Antonio", "title": "Association analysis of intragenic molecular markers related to fiber quality and tensile strength of abaca (Musa textilis Nee)", "date": "2025", "keywords": "abaca; accessions; analysis; association; cellulose; cotton; development; et al; expansin; fiber; genes; markers; percent; plant; protein; quality; sci; ssr; strength; study; tensile; traits; wall", "summary": "Its accumulation in fiber cells during growth is also responsible for the development of cotton fiber cells (Zhang et al., 2017). \u00ad Genes, 10(7): 555. DING A., MAROWA P., KONG Y., 2016 \u00ad Genome\u2010wide identification of the expansin gene family in tobacco (Nicotiana tabacum).", "mime": "application/pdf"}, {"id": "ahs-16803", "words": "8618", "extension": ".pdf", "flesch": "59", "author": "saparso, saparso; Sudarmaji, Arief; Bachtiar Musthafa, Muhammad; Tini, Etik Wukir; Pramana Putra, Fajrin; Raditya Kurniawan, Rifqi", "title": "Physiological tolerance of shallot varieties to airborne salinity in coastal sandy soils", "date": "2025", "keywords": "bali; bima; brebes; chlorophyll; clump; cm\u00ad1; data; et al; growth; karet; land; plant; proline; salinity; salinity stress; sci; shallot; stomatal; stress; tolerance; varieties; variety; weight; yield", "summary": "\u00ad Plants, 10(2): 243. Tolerance shallot variety on airborne salinity 157 has an escape response shown in fresh bulb weight per clump which is higher than Bima Brebes, although Bima Brebes is higher in the number of bulbs per clump due to the defense response from airborne salinity stress (Fig. 7).", "mime": "application/pdf"}, {"id": "ahs-16960", "words": "6261", "extension": ".pdf", "flesch": "57", "author": "Waldo, Benjamin; Arlotta, Caitlin G.; Richardson , Matthew", "title": "Preliminary evaluation of nematode community responses to ground covers in jute leaf cultivation", "date": "2025", "keywords": "abundance; bongers; community; compost; cover; diversity; effects; et al; ground; jute; leaf; nematode; plant; plots; soil; straw; study; treatments", "summary": "FENGJUAN P.A.N., XIAOZENG H.A.N., NA L.I., JUN Y.A.N., YANLI X.U., 2020 \u00ad Effect of organic amendment amount on soil nematode community structure and metabolic footprints in soybean phase of a soybean\u2010 maize rotation on molli\u2010sols. These results suggest ground covers can influence soil nematode communities in jute leaf production.", "mime": "application/pdf"}, {"id": "ahs-16964", "words": "6258", "extension": ".pdf", "flesch": "51", "author": "Thathsarani, Dilki; Tikirikumari, Thilakshi; Priyadarshan, Asha Ishani Sri; Herath, Harshini; Senanayake, Priyanganie", "title": "Phytochemical evaluation of selected Phalaenopsis cultivars", "date": "2025", "keywords": "chlorophyll; content; cultivars; extracts; flowers; gold; leaves; phalaenopsis; plant; roots", "summary": "These findings provide valuable insights into the floral coloration and the phytochemical richness of vegetative parts in Phalaenopsis cultivars. These striking patterns and colors increase the aesthetic value of Phalaenopsis cultivars, capturing the attention of consumers and expanding their market appeal.", "mime": "application/pdf"}, {"id": "ahs-17150", "words": "10388", "extension": ".pdf", "flesch": "60", "author": "Elashwah, Mahmoud Abd-elfatah; Noor El-Deen, Tarek; Bazaraa, Walid Mohamed Said", "title": "Improving drought tolerance of Leucophyllum frutescens through the application of paclobutrazol and cycopcel plant growth regulators", "date": "2025", "keywords": "ccc; cycocel; drought; growth; irrigation; levels; p.c; paclobutrazol; pbz; plant; ppm; root; season; stress; tolerance; water; weight", "summary": "Water irrigation levels 100% P.C. 1.88 a 0.51 a 27.14 a 0.97 c 75% P.C. 1.74 b 0.39 c 23.82 b 1.24 b 50% P.C. 1.52 c 0.49 b 19.15 c 1.70 a Growth retardants Control 1.38 g 0.51 a 21.30 e 1.08 g PBZ 50 ppm 1.58 f 0.49 b 22.00 d 1.13 f PBZ 100 ppm 1.68 e 0.49 b 22.82 c 1.26 d PBZ 150 ppm 1.80 c 0.46 c 24.21 b 1.39 c CCC 1000 ppm 1.73 d 0.45 c 22.58 cd 1.24 e CCC 2000 ppm 1.85 b 0.44 d 23.92 b 1.42 b CCC 3000 ppm 1.98 a 0.41 e 26.75 a 1.62 a Table 10 \u00ad Effect of water irrigation levels and two plant growth retardants on chemical composition analysis of Leucophyllum frutescens during the second season 2023 Adv. Different concentrations of PBZ at 50, 100 and 150 ppm and CCC at 1000, 2000 and 3000 ppm were combined with 100, 75 and 50% pot capacity (P.C.) irrigation water levels, and some morphological, chemical and tolerance indices were examined.", "mime": "application/pdf"}, {"id": "ahs-17201", "words": "5407", "extension": ".pdf", "flesch": "63", "author": "Rida, Magd el Din F.; Taha, Asmaa M.", "title": "Enhance the longevity and aesthetic appeal of Anthurium andraeanum cv. Fire cut leaves by using some natural components", "date": "2025", "keywords": "anthurium; experiment; gum; leaf; leaves; oil; rh oil; rosehip; vase; weight", "summary": "Abstract: This experiment was conducted to examine the effects of rosehip oil (Rh oil), Arabic gum (AG), and chitosan (CS) on the vase life and quality of Anthurium andraeanum cv. Seven treatments were applied: tap water (control), Rh oil (2% or 4%), Rh oil (2% or 4%) + AG (5%), and Rh oil (2% or 4%) + AG (5%) +", "mime": "application/pdf"}, {"id": "ahs-17221", "words": "6686", "extension": ".pdf", "flesch": "54", "author": "Ayarna, Alex Williams; Tsukagoshi, Satoru; Sintim, Henry Ofosuhene; Ulzen, Jacob; Amissah, J. Naalamle; Bukari, Musa; Poku, Samuel Aduse; Takagaki, Michiko; Lu, Na; Adjei-Nsiah, Samuel; Nkansah, George Oduro", "title": "Effect of partial-extreme root restriction and nutrient solution concentration on the performance of hydroponically grown tomato", "date": "2025", "keywords": "concentration; et al; fruit; growth; nsc; nutrient; plant; restriction; root; root restriction; solution; standard; tomato; water; yield", "summary": "Table 2 \u00ad Morphological response of tomato to partial\u00adextreme root restriction and nutrient solution concentration at 74 days after transplanting Nutrient solution concentration Root restriction Plant height (cm) ISMAIL M.R., NOOR K.M., 1996 \u00ad Growth, water relations and physiological processes of starfruit plants under root growth restriction.", "mime": "application/pdf"}, {"id": "ahs-17232", "words": "6332", "extension": ".pdf", "flesch": "65", "author": "DAO, Jonas Patrick; Kouakou, Camille; Cherif, Mamadou; Yeo, Katienapariga Tayourou; Guinagui, N\u2019doua Bertrand; Mbo, Kacou Antoine Alban; KOUAKOU, Kouakou Laurent", "title": "Exploring grafting to propagate and conserve Garcinia kola a vulnerable species in C\u00f4te d\u2019Ivoire: Vegetative propagation of Garcinia kola by grafting", "date": "2025", "keywords": "cleft; days; garcinia; grafting; grafts; kola; month; rate; recovery; rootstock; success; technique; time", "summary": "The lowest values of graft success rate were observed in the month of August. The highest percentages of graft success (38.75\u00b12.71% and 55.83\u00b15.42%) were obtained when the grafts were unwrapped at 29 DAG on 36\u00ad and 12\u00admonth\u00adold rootstocks, respectively.", "mime": "application/pdf"}, {"id": "ahs-17277", "words": "7716", "extension": ".pdf", "flesch": "53", "author": "Dev, Rahul; Hedau, N.K.; Santhiya, S.; Pal, R.S.; Paschapur, Amit; Kant, Lakshmi", "title": "Agro-morphological characterization of Indian garlic (Allium sativum L.) germplasm under mid hill of Northwest Himalaya", "date": "2025", "keywords": "abts; allium; analysis; bulb; clove; diversity; dpph; et al; frap; garlic; genotypes; indian; leaf; plant; sci; solution; total; traits; weight", "summary": "TY 32.50 175.67 105.67 3.09 899.52 29.99 28.38 Plant weight (g) PW 8.00 52.67 23.99 0.87 71.52 8.46 35.25 TSS (\u00b0Brix) TSS 16.16 43.90 38.27 0.46 19.77 4.45 11.62 Total Polyphenols (mg GAE/g) TPP 0.30 1.25 0.51 0.02 0.02 0.15 29.90 DPPH (% Inhibition) DPPH 10.08 49.23 27.49 1.01 96.64 9.83 35.76 ABTS (% Inhibition) ABTS 31.65 83.42 62.14 0.60 33.62 5.80 9.33 TAA (mM Trolox equivalent/g DW) TAA 12.71 66.43 25.74 0.66 41.32 6.43 24.97 FRAP Vale (mM FeSo4 equivalent/g FRAP 95.04 269.32 154.13 3.38 1074.06 32.77 21.26 Total carbohydrate (%) TCA 14.39 28.81 21.42 0.35 11.76 3.43 16.01 Dev et al. \u2010 Genetic diversity analysis in Indian garlic 143 distinctive leaf traits such as leaf length (VGS\u00ad96), leaf width (VGS\u00ad43), leaf number (VGS\u00ad95), and several yield\u00adrelated traits such as bulb weight (VGS\u00ad96, VGS\u00ad 105, Swarna\u00ad9) and total yield (VGS\u00ad39). Karthikeyan et al., 1989).", "mime": "application/pdf"}, {"id": "ahs-17292", "words": "6807", "extension": ".pdf", "flesch": "65", "author": "Amin, Rifat Shahinara; Md. Rukunuzzaman; Ahmed, Maruf; Khatun, Mst. Ananya; Rahman, Md. Atikur; Saroare, M.G.; Islam, Md Tariqul", "title": "Impact of chitosan-aloe vera gel with coconut oil coating on postharvest quality and antioxidant of \u2018Gopalbhog\u2019 mango at ambient storage", "date": "2025", "keywords": "activity; aloe; antioxidant; chitosan; coatings; control; days; et al; fruit; gel; g\u00ad1; mango; postharvest; quality; sci; storage; vera", "summary": "Therefore, maintaining mango fruit quality and extending post\u00ad harvest life requires effective strategies. CTS+AVG significantly maintained the firmness of mango fruits.", "mime": "application/pdf"}, {"id": "ahs-17508", "words": "5280", "extension": ".pdf", "flesch": "52", "author": "Zaiful, Zilda Khaerani; Faried, Muhammad; Syam'un, Elkawakib; Mantja, Katriani; Putri, Remi Widana; Jalil, Abdul; Wijaya, Padil; Cennawati, Cennawati", "title": "Effect of boron priming on germination traits of shallot (Allium ascalonicum L.)", "date": "2025", "keywords": "boron; et al; germination; germination time; growth; parameters; priming; seed; seedling; shallot; time", "summary": "Discussion and Conclusions Seed priming is a crucial technique in agriculture aimed at enhancing seed germination and seedling establishment under various stress conditions. Kaya and Ergin (2023), in a study conducted on Carthamus tinctorius seeds, also observed a linear increase in germination index with higher boron concentrations, reinforcing boron\u2019s beneficial effects on seed germination.", "mime": "application/pdf"}, {"id": "ahs-17532", "words": "5429", "extension": ".pdf", "flesch": "52", "author": "Trujillo, Heiber Andres; Assis de Oliveira, Francisco Canind\u00e9; Villegas Lobos, Cristian Marcelo; da Silva, Marcelo; Gomes-Junior, Francisco Guilhien", "title": "Digital and multivariate analysis of lettuce seed vigor: Impact of hydropriming on physiological potential", "date": "2025", "keywords": "analysis; genotype; hydropriming; index; length; manova; multivariate; sci; seed; seed vigor; seedling; treatment; uniformity; variables; vigor", "summary": "These findings underscore the utility of digital image analysis combined with multivariate statistical methods for the accurate assessment of seed vigor, thereby improving seed\u00adlot classification and informing decision\u00admaking in lettuce production systems. The use of the Seed Vigor Imaging System (SVIS\u00ae), developed by Sako et al. (2001), has been widely adopted to quantify seed vigor in various species, including soybean, corn, melon, sweet corn, castor bean, peanut, okra, common bean, eggplant, tomato, cotton, and sunflower (Hoffmaster et al., 2003; Marcos\u00adFilho et al., 2006; Marchi et al., 2011; Alvarenga et al., 2013; Caldeira et al., 2014; Gomes\u00ad Junior et al. , 2014; Rocha et al. , 2015).", "mime": "application/pdf"}, {"id": "ahs-17811", "words": "7962", "extension": ".pdf", "flesch": "54", "author": "Nasrin, T.A.A.; Rahman, Md. Atiq; Arfin, Most.; Afroz, Mafruha; Naznin, Most. Tahera; Molla, Mohammad Mainuddin; Sabuz, Ashfak Ahmed; Matin, Md. A.; Islam, Khandakar R.", "title": "Comparative evaluation of Aloe vera and chitosan edible coatings on shelf life and quality of strawberries during cold storage", "date": "2025", "keywords": "acid; aloe; avg; cacl\u2082; chitosan; coating; et al; fruit; loss; postharvest; quality; shelf; storage; strawberries; strawberry; vera", "summary": "HASSAN H.S., EL\u00adHEFNY M., GHONEIM I.M., EL\u00adLAHOT M.S.R.A., AKRAMI M., AL\u00adHUQAIL A.A., ALI H.M., ABD\u00ad ELKADER D.Y., 2022 \u00ad Assessing the use of AVG alone and in combination with lemongrass essential oil as a coating material for strawberry fruits: HPLC and EDX analyses. Biol., 10: 549\u00ad565. SHAFIQUE M., RASHID M., ULLAH S., RAJWANA I.A., NAZ A., RAZZAQ K., HUSSAIN M., ABDELGAWAD M.A., EL\u00ad GHORAB A.H., GHONEIM M.M., SHAKER M.E., IMRAN M., JBAWI E.A., 2023 \u00ad Quality and shelf l ife of strawberry fruit as affected by edible coating by moringa leaf extract, Aloe vera gel, oxalic acid, and ascorbic acid.", "mime": "application/pdf"}, {"id": "ahs-18140", "words": "6986", "extension": ".pdf", "flesch": "31", "author": "Prisa, Domenico; Jamal, Aftab", "title": "Achillea millefolium L.: A Comprehensive review of its phytochemistry and pharmacological properties", "date": "2025", "keywords": "achillea; achillea millefolium; activity; antioxidant; effects; et al; extracts; flavonoids; millefolium; oils; phytochemical; plant; properties; skin; studies; use; yarrow", "summary": "Abstract: Achillea millefolium L., commonly known as yarrow, is a perennial herb traditionally used in various cultures for its therapeutic properties. Citation: PRISA D., JAMAL A., 2025 \u00ad Achillea millefolium L.: A comprehensive review of its phytochemistry and pharmacological properties.", "mime": "application/pdf"}, {"id": "ahs-18395", "words": "2973", "extension": ".pdf", "flesch": "51", "author": "Arabi, M.I.E.; Jawhar, M.", "title": "Cultural and genetic evaluation of Cochliobolus sativus during successive passages through suscepible barley", "date": "2014", "keywords": "barley; cochliobolus; generations; isolates; pt1; pt4; sativus; virulence", "summary": "Although the production of conidia is expected to produce genetically identical clones, the high rate of ap- pearance of new races with the ability to infect previously resistant varieties of barley suggests that C. sativus may have high mutation rates in avirulence genes, which deter- mine race (Kumar et al., 2002). However, in the case of the host-specific toxin pro- duced by C. sativus, the fungus which incites SB of bar- ley, the toxin will produce all the symptoms characteristic of the disease; sensitivity to the toxin is correlated with susceptibility to the pathogen and toxin production by the pathogen is directly related to its ability to cause disease (Kumar et al., 2002).", "mime": "application/pdf"}, {"id": "ahs-18396", "words": "3020", "extension": ".pdf", "flesch": "64", "author": "Sharma, S.; Kumar, K.; Kumar, A.", "title": "Genetic divergence studies regarding different growth and foliage characters of walnut (Juglans regia L.) germplasm", "date": "2014", "keywords": "accessions; cluster; h.p; india; mean; plant; walnut", "summary": "Information about the extent of genetic divergence is critical for the improve- ment of any crop in order to have heterotic responses and desirable segregants. Furthermore, information on the nature and degree of genetic divergence present in the collected germplasm could help for further improvement through hybridization.", "mime": "application/pdf"}, {"id": "ahs-18397", "words": "2967", "extension": ".pdf", "flesch": "56", "author": "Bakri, Y. Bakri; Jawhar, M.; Arabi, M.I.E.", "title": "Enzymatic activity of the endoohytic Fusarium species strains isolated from wheat", "date": "2014", "keywords": "activity; enzymes; fusarium; production; protein; spp; strains", "summary": "Statistical analysis All the experiments were performed in triplicate and the means were analyzed statistically with the analysis of variance (Anonymous, 1988) using the STAT-ITCF com- puter package to test for differences in enzyme production among Fusarium spp. strains. One unit of enzyme activity (IU) was defined as the amount of enzyme that released 1 \u03bcmol of glucose per ml per minute.", "mime": "application/pdf"}, {"id": "ahs-18399", "words": "6252", "extension": ".pdf", "flesch": "57", "author": "Hiramatsu, T.; Terry, L.A.; Kadono, T.; Kawano, Tomonori", "title": "Impact of UV irradiation in leaves, fruits and suspension-cultured cells of Micro-Tom, tomato", "date": "2014", "keywords": "cell; culture; death; et al; expression; fig; fruits; gene; irradiation; kawano; leaves; plant; suspension", "summary": "For instance, exposure of fruit tissue slices of zucchini squash to low dose UV-C Impact of UV irradiation in leaves, fruits and suspension-cultured cells of Micro-Tom, tomato T. Hiramatsu,1 L.A. Terry,2 T. Kadono,1 T. Kawano1,3,4 The intensities of UV-A and UV-C were moni- tored with UV meters (UVX-25, UVP Inc., Upland, CA; YK-34UV, Lutoron Electronic Enterprise Co., Ltd., Taipei, Taiwan) and the intensity of UV-A and UV-C applied to the surfaces of plant materials were adjusted to 2.2 mW cm-2, therefore the doses of UV irradiation were controlled by al- tering the length of irradiation time.", "mime": "application/pdf"}, {"id": "ahs-18400", "words": "3681", "extension": ".pdf", "flesch": "56", "author": "Shahkoomahally, Shirin; Ramezanian, A.", "title": "Analytical statistical interpretation of relationship between different parameters of kiwifruit (Actinidia deliciosa cv. Hayward) during cold storage", "date": "2014", "keywords": "antioxidant; compounds; correlation; food; kiwifruit; phenolic; storage; taa; total; tpc", "summary": "Parameters, such as total phenolic compounds (TPC), color (L*, hue, chroma), total antioxidant activity (TAA) and ascorbic acid (AA) content, were evaluated at harvest and every 15 days during fruit storage at 0\u00baC and 90% \u00b1 5 RH. Key words: ascorbic acid, correlation, kiwifruit, total antioxidant activity, total phenolic compounds.", "mime": "application/pdf"}, {"id": "ahs-18401", "words": "5477", "extension": ".pdf", "flesch": "52", "author": "Saour, G.; Ismail, H.; Jassem, I.; Tamer, S.", "title": "Biorational insecticides against the potato tuber moth (Lepidoptera: Gelechiidae) on stored potatoes", "date": "2014", "keywords": "benzoate; chromafenozide; control; eggs; emamectin; insecticides; journal; larvae; lepidoptera; operculella; potato; spinosad; tubers", "summary": "The re- sidual activity of spinosad and emamectin benzoate used at 216 and 15 mg/L remained unchanged (zero F 1 adults Table 1 - Mean (\u00b1SE) hatchability of potato tuber moth eggs of two age groups treated topically with spinosad, emamectin benzoate, and chromafe- nozide insecticides Insecticides Chemical group Active ingredient mg/l % of hatched eggs (z) 1-1.5 day old egg 4-4.5 days old egg (y) Control - 91.9\u00b14.2Aa 94.1\u00b13.9Aa Spinosad Spinosyns 72 12.7\u00b13.9Ac 15.8\u00b13.8Ac (Spintor\u00ae 2 SC, 240 mg/ml) 144 P. operculella eggs aged 1-1.5 and 4-4.5 days deposit- ed on the oviposition support were dipped for 30 s in three different concentrations 72, 144, 216 ml/L and 5, 10, 15 mg/L for spinosad and emamectin benzoate, respective- ly (0.3, 0.6, 0.9 ml/L of Spintor and 0.1, 0.2 and 0.3 g/L of Proclaim); while chromafenozide was applied at two concentrations of 37.5 and 75 mg/L (0.75 and 1.5 ml/L of Matric).", "mime": "application/pdf"}, {"id": "ahs-18402", "words": "9125", "extension": ".pdf", "flesch": "68", "author": "Yusuf, L.M.", "title": "Growth Studies in Mangosteen (Garcinia mangostana L.). II. Activation of seedling growth in Mangosteen using Arbuscular Mycorrhizal Fungi and Azospirillum", "date": "2014", "keywords": "ab az; abcd; azospirillum; content; fungi; g.f; g.m; glomus; growth; plants; root; ssp; treatments", "summary": "ESTRADA-LUNA A.A., DAVIES F.T. Jr., EGILLA J.N., 2000 - Mycorrhizal fungi enhancement of growth and gas exchange of micropropagated guava plantlets (Psidium guajava L.) during ex vitro acclimatization and plant establishment. - Mycorrhiza, 10: 1-8. 162 GERDEMANN J.W., 1968 - Vesicular-arbuscular mycorrhiza and plant growth. The greatest number of new flushes/year was recorded in treatment plants inoculated with G.f. (10 g) + SSP (10 g), G.m.", "mime": "application/pdf"}, {"id": "ahs-18406", "words": "10301", "extension": ".pdf", "flesch": "58", "author": "Asao, T.; Asaduzzaman, Md.; Mondal, F. Md.", "title": "Horticultural Research in Japan. Production of vegetables and ornamentals in hydroponics, constraints and control measures", "date": "2014", "keywords": "acid; asao; asao et; autotoxicity; crop; cucumber; culture; effects; et al; exudates; fruit; growth; hydroponics; nutrient; plants; production; root; sci; soil; solution; yield", "summary": "Hydroponic culture technique has the ability to trap and isolate the chemicals released through plant roots. It is inevitable that reduced K supply will inhibit plant growth and yield.", "mime": "application/pdf"}, {"id": "ahs-18407", "words": "4007", "extension": ".pdf", "flesch": "58", "author": "Shibuya, T.; Kanayama, Y.", "title": "Flowering response to blue light and its molecular mechanisms in Arabidopsis and horticultural plants", "date": "2014", "keywords": "arabidopsis; day; et al; expression; flowering; light; plant", "summary": "ZTL and LKP2, belong- ing to the LOV domain of blue light receptors contain- ing FKF1, are required for suppressing the degradation of CIB1 protein by blue light (Liu et al., 2013 a). How- ever, studies have not focused on the effects of blue light on flowering; blue light could also be important in timing of flowering.", "mime": "application/pdf"}, {"id": "ahs-18408", "words": "4401", "extension": ".pdf", "flesch": "59", "author": "Adam, A.; Idris, I.; Ayyoubi, Z.", "title": "In vitro Pseudomonas putida BTP1-induced systemic resistance in grapevine rootstocks against Phylloxera (Daktulosphaira vitifoliae)", "date": "2013", "keywords": "b41; btp1; et al; grapevine; phylloxera; plants; putida; resistance; rootstocks; ru140", "summary": "In vitro culture of grapevine plants For in vitro culture of grapevine plants, we used a proto- col described by Makee et al. (2010). BTP1 impacted negatively on the ability of phylloxera to develop, indicating an increase in grapevine resistance and tolerance toward this pest in bacteria-treated plants.", "mime": "application/pdf"}, {"id": "ahs-18409", "words": "2403", "extension": ".pdf", "flesch": "59", "author": "Hosseini, H.R.; Chehrazi, M.; Dehkourdi, E.H.; Hosseini, M.", "title": "Application of anatase nanoparticles (TiO2) on strawberry seed germination (Fragaria ananassa L.)", "date": "2013", "keywords": "anatase; effect; germination; growth; length; nano; seed; strawberry", "summary": "On the other hand, Lin and Xing (2007) studied the positive effects of suspensions of nanoparticles on seed germination and root growth of six different crop species Limited studies have been done on the effects of nanoparticles on crops and thus, we decided to investigate the phytotoxicity or positive effects of different concen- trations of nano-TiO 2 on seed germination and seedling growth of strawberry.", "mime": "application/pdf"}, {"id": "ahs-18410", "words": "8736", "extension": ".pdf", "flesch": "72", "author": "Vazquez, A.; Sanchez, E.; van Baren, C.; Frezza, D.", "title": "Agronomic performance and essential oil composition of Ocimum basilicum L.: Effect of genotype and date of harvest", "date": "2013", "keywords": "e l; e r; g e; g f; g h; g r; h r; n t; p e; p g; r c; t e; w e; w t", "summary": "Key words: green basil, purple basil, soilless culture, volatile oils, yield. The data from the present study contrast with a crop 168 grown in optimum season, as reported by some authors for green basil with values between 64.44 and 110.33 g.plant-1 (Benito and Chiesa, 2000; Carrasco et al., 2007) and fresh weights of 57.84 g.plant-1 and 41.50 g.plant-1 for purple basil (Krizaj, 2010).", "mime": "application/pdf"}, {"id": "ahs-18411", "words": "3143", "extension": ".pdf", "flesch": "53", "author": "Wani, R.A.; Sheema, S.; Malik, T.H.; Geelani, S.; Bashir, S.; Dar, N.A.; Prasad, V.M.", "title": "Impact of integrated nutrient management on growth, yield and quality of strawberry (Fragaria x annanassa Duch.) cultivation in India", "date": "2013", "keywords": "fertilizers; fruits; india; management; nutrient; plant; strawberry; treatment; yield", "summary": "Also fruit yield per plant was highest (482.6 g/plant=26.81 tons/ha) with treat- ment T 4 and lowest with treatment T 5 (351.5 g/plant=19.55 149 tons/ha); treatment T 4 showed 37.14% superiority over treatment T 5 in fruit yield tons/ha. Treatment T 4 produced 2.5 mean flower buds/plant more than T 1 (control) whereas in the number of fruits/plant, treatment T 4 produced 5.75 aver- age number of fruits more than treatment T 1 with greater length/diameter ratio of 1.43, compared to 1.25 for treat- ment T 1 .", "mime": "application/pdf"}, {"id": "ahs-18412", "words": "4601", "extension": ".pdf", "flesch": "59", "author": "Corbino, G.B.; S\u00e1nchez, G.; Gonz\u00e1lez, J.; Murray, R.E.; Gabilondo, J.; Valentini, G.H.; Arroyo, L.E.", "title": "Pre and post-harvest management affects functional quality of peach (Prunus persica L.) cv. Flavorcrest", "date": "2013", "keywords": "antioxidant; capacity; flesh; fruit; heat; phenolic; total; treatments", "summary": "Fruit phenolic compounds are relevant in terms of qual- ity, as they have a role in visual appearance (pigmentation and browning), taste (astringency), and health-promoting properties (free-radical scavengers) Treatment without fertilization produced the highest antioxidant capacity in fruit flesh while the fruit skin showed no significant differences between treatments.", "mime": "application/pdf"}, {"id": "ahs-18414", "words": "5621", "extension": ".pdf", "flesch": "63", "author": "Ahmad, M.S.; Thakur, K.S.; Siddiqui, M.W.", "title": "Postharvest treatments for preserving quality of \u2018Kinnow\u2019 fruit under different storage conditions", "date": "2013", "keywords": "conditions; fruits; kinnow; storage; temperature; treatments", "summary": "Among the fruits kept at ambient tem- perature, the highest mean TSS contents (14.04\u00b0B) were re- corded in T 11 (control), whereas the lowest mean TSS con- tents (12.84\u00b0B) were found in treatment T 4 (100% Sta-Fresh 960), which was closely followed by T 10 and T 5 , respective- ly. Maximum juice contents (43.51%) were recorded in treatment T 10 followed by T 5 and T 4 , in comparison to the control fruits which yielded only 40.05 percent at 60 days storage.", "mime": "application/pdf"}, {"id": "ahs-18415", "words": "6893", "extension": ".pdf", "flesch": "60", "author": "Javanmardi, J.; Rahemi, M.; Nasirzadeh, M.", "title": "Post-storage quality and physiological responses of tomato fruits treated with polyamines", "date": "2013", "keywords": "chilling; days; fruit; injury; spd; storage; table; temperature; tomato", "summary": "An experiment was arranged to study the effects of exogenous PA application Post-storage quality and physiological responses of tomato fruits treated with polyamines J. Javanmardi(1), M. Rahemi, M. Nasirzadeh Department of Horticultural Sciences, College of Agriculture, Shiraz University, Shiraz, Iran. Sci., 2013 27(4): 173-181 (1) Corresponding author: javanm@shirazu.ac.ir Received for publication 4 January 2014 Accepted for publication 7 March 2014 174 on the level of chilling injury, ripening, shelf life and some quality factors of tomato fruit (as a model plant) after a pe- riod of low temperature storage.", "mime": "application/pdf"}, {"id": "ahs-18417", "words": "446", "extension": ".pdf", "flesch": "59", "author": "Ferrini, F.", "title": "Book review", "date": "2013", "keywords": "care; gardens", "summary": "The author of this interesting volume has, for some time, worked with historic gardens in Germany and has asked the important question of how to define professional, sustainable and lasting care of historic gardens and how to put it into practice. Michael Rohde, director of the garden of the Prussion Castles and Parks of Berlin-Brandenburg Foundation, to- gether with a team of four other authors, has created an important base not only for under- standing historic gardens but also for future research about caring for and preserving them.", "mime": "application/pdf"}, {"id": "ahs-18418", "words": "383", "extension": ".pdf", "flesch": "51", "author": "Tempesta, G.", "title": "System application and the availability of vine germplasm", "date": "2013", "keywords": "vine", "summary": "While they are linked to tradition, innovation is necessary to respond to new lifestyles and preferences that reward typologies that are often based on new varietal ranges and clones. However, the economic commitment necessary to sustain public research bodies in their quest for new genetic material is hard to come by and the spread of already available initial and basic material is not always optimal.", "mime": "application/pdf"}, {"id": "ahs-18420", "words": "753", "extension": ".pdf", "flesch": "46", "author": "Bandinelli, R.; Pagano, M.", "title": "The evolution of clonal heritage registry available at TOS.CO.VIT.", "date": "2013", "keywords": "material; selection; tuscany", "summary": "Public interest in the genetic material obtained from clonal selection activities stimulated the creation (on 24th March 1977) of a center for premultiplication of grapevine material, thanks to an agreement signed between the Region of Tus- cany and the University of Pisa. The Council Directive 68/193/EEC of 9 April 1968 (concerning the marketing of material for vegetative propagation of vines) and subsequently the Presidential Decree of 24 December 1969 (n.1164) entitled \u201cproduction and marketing of vine pre-multiplication material\u201d gave a positive impulse to promote clonal selection activity.", "mime": "application/pdf"}, {"id": "ahs-18421", "words": "665", "extension": ".pdf", "flesch": "53", "author": "Storchi, P.; Giannetti, F.; Valentini, P.; Bazzo, I.; Angelini, E.", "title": "Sanitary and agronomic selection of Tuscan germplasm to improve wine production", "date": "2013", "keywords": "selection", "summary": "Still other clones will be ready soon for application to the Ministry of Agriculture once agronomic observations and sanitary checks are complete. Since the protocol for the selection of a clone demands a long period of time, one of the next objectives will be to re- duce the time needed to secure clone registration in the National Catalogue.", "mime": "application/pdf"}, {"id": "ahs-18425", "words": "519", "extension": ".pdf", "flesch": "57", "author": "Mannini, F.; Nervo, L.", "title": "Innovative techniques for pre-multiplication of grapevine clones: the CE.PRE.MA.VI. experience", "date": "2013", "keywords": "material; phytoplasma", "summary": "untitled 99 Innovative techniques for pre-multiplication of grapevine clones: the CE.PRE.MA.VI. experience F. Mannini*, L. Nervo** * Istituto di Virologia Vegetale, CNR Unit\u00e0 di Grugliasco, Via Leonardo da Vinci 44, 10095, Grugliasco (TO), f.mannini@ivv.cnr.it. The \u201cinitial material\u201d collected from the primary sources is then used to establish mother plant vineyards (MPV) suitable for the production of \u2018basic\u2019 material.", "mime": "application/pdf"}, {"id": "ahs-18426", "words": "630", "extension": ".pdf", "flesch": "45", "author": "Malossini, U.; Gretter, L.", "title": "Preservation and premultiplication of selected grape material in Trentino: collaboration between FEM- S. Michele all\u2019Adige and Trentino Grape-Nurseries AVIT-Consortium", "date": "2013", "keywords": "avit; fem; material", "summary": "1.5 hectares of vineyards, obtained with FEM selections but commercially classified in the \u201cstandard\u201d category, is also under FEM control. All the operations are carefully recorded as required for genuine traceability of nursery materials and as a guarantee in the subsequent stages of propagation.", "mime": "application/pdf"}, {"id": "ahs-18427", "words": "475", "extension": ".pdf", "flesch": "51", "author": "Dallavalle, E.; Triolo, E.", "title": "Propagation of endangered grapevine cultivars: some reasons to recover and protect this patrimony", "date": "2013", "keywords": "plants; vines", "summary": "These are not singular examples of the use of old vines from the pre-phylloxera period. In addition, another interesting application for old grapevines may derive from their use as ornamental plants, as suggested by some examples within the monastery of S. Maria Maddalena in Bologna or in the Olivetani cloister of the church of S. Maria in Regola in Imola.", "mime": "application/pdf"}, {"id": "ahs-18428", "words": "1293", "extension": ".pdf", "flesch": "61", "author": "Ferroni, G.; Scalabrelli, G.; Di Collalto, G.", "title": "Characteristics of recent released clones selected by DiSAAA-A in Tuscan Coast line premultiplied by TOS.CO.VIT", "date": "2013", "keywords": "average; bud; medium; population", "summary": "Straw yellow wine, good structure, floral and fruity, palatable, sapid, with slightly bitter final, suitable for short aging. Straw yellow wine with notes of ripe fruit, citrus and spicy Mediterranean (very pronounced).", "mime": "application/pdf"}, {"id": "ahs-18429", "words": "653", "extension": ".pdf", "flesch": "55", "author": "Bornice, M.; Ferroni, G.; Scalabrelli, G.", "title": "Updated knowledge of the vine rootstocks", "date": "2013", "keywords": "rootstocks; scalabrelli", "summary": "Currently, in Italy there are 39 varieties of vine rootstock recognized on the National Register of Grapevine Varieties (agg. In fact, we need of new rootstocks able to adapt to environmental stresses caused by climate change in progress (mainly droughts and changes in the distribution of rainfall) and/or linked to new growing environments which have restricting factors for the vines.", "mime": "application/pdf"}, {"id": "ahs-18430", "words": "746", "extension": ".pdf", "flesch": "45", "author": "Navacchi, O.; Zuccarelli, G.", "title": "Micropropagation in viticulture: twenty years of experience", "date": "2013", "keywords": "juvenile; plants", "summary": "With careful attention to the selection of soil for mother plant fields and suitable preventative measures, it is possible to keep this pathogen under control. Today it is increasingly difficult to keep mother plants healthy in open fields and a reduction of their useful period with frequent renewal can be predicted for the future.", "mime": "application/pdf"}, {"id": "ahs-18431", "words": "742", "extension": ".pdf", "flesch": "32", "author": "D'Onofrio, C.", "title": "State of the art in grapevine variety and clone identification through polymorphism in DNA molecular markers", "date": "2013", "keywords": "clones; identification", "summary": "In this context, as a support for the classic methods of varietal identification through morphological characters, DNA molecular markers are of fundamental importance. DNA molecular markers seem more stable, making it possible to combine AFLP with other markers such as SAMPL (Selective Amplification of Microsatellite Polymorfic Loci), M-AFLP (microsatellites amplified fragment length poly- morphism) and S-SAP (Sequenze-Specific Amplification Polymorfism).", "mime": "application/pdf"}, {"id": "ahs-18433", "words": "1057", "extension": ".pdf", "flesch": "41", "author": "Faggioli, F.; Anaclerio, F.; Angelini, E.; Antonelli, M.G.; Bertazzon, N.; Bianchi, G.; Bianchedi, P.; Bianco, P.A.; Botti, S.; Bragagna, P.; Cardoni, M.; Casati, P.; Credi, R.; De Luca, E.; Durante, G.; Gianinazzi, G.; Gambino, G.; Gualandri, V.; Luison, D.; Luvisi, A.; Malossini, U.; Mannini, F.; Saldarelli, P.; Terlizzi, F.; Triolo, E.; Trisciuzzi, N.; Barba, M.", "title": "Harmonization and validation of diagnostic protocols for the detection of grapevine viruses covered by phytosanitary rules", "date": "2013", "keywords": "elisa; grapevine; italy; multiplex", "summary": "100/100/96% 83/58/89% 10-1 98% 82% GVB Multiplex 100% 100% 100% 10-2 100% 100% ELISA \u2013 A/B/S 86/nt/nt% 100% 92% 100 (2-2) 100% 85% GLRaV 1 Multiplex 74 % 100 % 94 % 10-2 100% 70 % ELISA \u2013 A/B/S 89/94/96% 100% 93/96/98% 10-2 100% 92% GLRaV 2 Multiplex 84% 98% 85% 10-2 95% 83% ELISA \u2013 A/B/S 86/67/87% 100% 93/96/98% 100 (2-2) 93% 84% GLRaV 3 Multiplex 100 % 93 % 95 % 10-3 100% 100 % ELISA \u2013 A/B/S 81/90/97% 100% 84/92/97% 10-3 100% 94% A= Agritest; B= Bioreba; S= Sediag. A/B/S 90/90/30% 100% 92/92/46% 10-1 98% 88% GVA Multiplex 96 % 99 % 98 % 10-2 100% 94 % ELISA \u2013 A/B/S 77/45/87%", "mime": "application/pdf"}, {"id": "ahs-18434", "words": "497", "extension": ".pdf", "flesch": "48", "author": "Lucchetta, G.; Bevilacqua, G.; Colla, C.; Di Marco, S.; Falconi, R.; Frausin, C.; Mirandola, R.; Mordenti, G.; Sartori, E.; Angelini, E.", "title": "Prevention and control strategies against Agrobacterium vitis in grapevine multiplication material", "date": "2013", "keywords": "vitis", "summary": "Hot water treatments, unfortunately, are completely ineffective in obtaining bacterium-free rootlings (Lucchetta et al., 2013), while initial analyses of soils and mother plants in the Verona area have been encouraging; cleaning trials with acidic water and Virkon need further study. Agrobacterium vitis is the etiological agent of grapevine crown gall disease, an abnormal tissue growth occurring mostly in the basal part of the trunk.", "mime": "application/pdf"}, {"id": "ahs-18435", "words": "1206", "extension": ".pdf", "flesch": "42", "author": "Luvisi, A.", "title": "How information technology can support regulations and best practices for the management of health status of grapevine and product safety", "date": "2013", "keywords": "food; health; management; plant; technology", "summary": "With regards to food plants, the implementation of IT solutions to trace the plant-to-food chain seems to be possible only in fruit trees, including grapevine, due to the difficulties in labeling and/or tracking herbaceous plants. This link is promoted by the European Food Safety Authority (EFSA), the agency that provides scientific advice and communication on existing and emerging risks associated with the food chain and the Authority\u2019s work covers all matters with a direct or indirect impact on food safety, including plant protection and plant health as included in the general objective and mission of the EFSA.", "mime": "application/pdf"}, {"id": "ahs-18436", "words": "464", "extension": ".pdf", "flesch": "50", "author": "Mannini, F.; Gribaudo, I.", "title": "RFID microchips as a tool for traceability in grapevine nurseries: pre- and post-grafting implants", "date": "2013", "keywords": "grapevine; microchips", "summary": "propaga- tion materials: grafted cuttings (a) and grafted rootlings (b), subjected or not to hot water treatment (50 \u00b0C for 45 min). In grapevine nurseries, the storage of data in a field log is an essential step in the plant production process.", "mime": "application/pdf"}, {"id": "ahs-18437", "words": "1420", "extension": ".pdf", "flesch": "42", "author": "Scalabrelli, G.; Toffanin, A.", "title": "Competitiveness of the wine sector: considerations on future scenarios", "date": "2013", "keywords": "research; scalabrelli; wine", "summary": "What is certain is that enlargement of the European Community to the East and the lack of restrictions on the spread of viticulture in new emerging countries (Latin America, South Africa and Oceania), will pose competition problems on traditionally wine countries such as Italy and France which will fight fiercely to defend the current position revenue linked to the prestige of wine-growing areas. For productive diversification, there is currently a clear differentiation between traditional varieties and the advent of new varieties obtained by genetic improvements.", "mime": "application/pdf"}, {"id": "ahs-18438", "words": "5221", "extension": ".pdf", "flesch": "61", "author": "Caruso, G.; Carputo, D.; Conti, S.; Borrelli, C.; Maddaluno, P.; Frusciante, L.", "title": "Effect of mulching and plant density on out-of-season organic potato growth, yield and quality", "date": "2013", "keywords": "autumn; crop; density; mulching; plant; potato; production; seed; summer; tubers; yield", "summary": "As a quality indicator of potato tubers, the dry residue was not significantly affected by mulching or by plant density (Table 4). These contrasting results suggest that the actual ascorbate content of potato tubers may result from an interaction of multiple factors.", "mime": "application/pdf"}, {"id": "ahs-18439", "words": "3269", "extension": ".pdf", "flesch": "61", "author": "Javanmardi, J.; Emami, S.", "title": "Application of sucrose on tomato seedlings improves transplant quality, crop establishment, cold and dark hardiness", "date": "2013", "keywords": "application; field; leaf; production; quality; root; seedlings; storage; sucrose; survival; tomato; transplant", "summary": "The present study was undertaken to investigate effects of su- crose application on tomato transplants, as a commercially important vegetable established from transplants, and evalu- ate effects on increasing chilling resistance and other traits under field conditions. SMITH P.G., ZINK F.W., 1951 - Effect of sucrose foliage sprays on tomato transplants.", "mime": "application/pdf"}, {"id": "ahs-18440", "words": "3902", "extension": ".pdf", "flesch": "58", "author": "Hikosaka, Y.; Kanechi, M.; Uno, Y.", "title": "A novel aeroponic technique using dry-fog spray fertigation to grow leaf lettuce (Lactuca sativa L. var. crispa) with water-saving hydroponics", "date": "2014", "keywords": "culture; dry; fog; growth; hydroponic; leaves; nutrient; roots; water; weeks", "summary": "Furthermore, root growth in most vegetable crops is expected to increase under the aerobic conditions of the rhizosphere environment because there is no solid phase and less liquid phase com- pared to the physical composition of soil or any other rooting media (Hillel and David, 1988; Cherif et al., 1997). For dry-fog culture, root growth was encouraged and root hair significantly developed to catch the foggy nutrient solution efficiently.", "mime": "application/pdf"}, {"id": "ahs-18441", "words": "4503", "extension": ".pdf", "flesch": "54", "author": "Pompeiano, A.; Volterrani, M.; Guglielminetti, L.", "title": "Physiological responses of C4 grasses to prolonged heat stress", "date": "2013", "keywords": "bermudagrass; control; differences; exposure; heat; plant; species; stress; temperature; zoysiagrass", "summary": "C 4 grasses are best adapted to the transition, warm-arid, and warm-humid climatic zones and usually have the ability to acquire thermotol- erance by exposure to acute heat stresses (DiPaola and Beard, 1992). Abstract: C4 grasses are best adapted to the transition, warm-arid, and warm-humid climatic zones and have the ability to acquire thermotolerance by exposure to acute heat stress.", "mime": "application/pdf"}, {"id": "ahs-18442", "words": "3187", "extension": ".pdf", "flesch": "58", "author": "Hoyo, Y.; Fujiwara, K.; Hoshino, Y.", "title": "Effects of different wavelengths of LED light on pollen germination and direction of pollen tube elongation in Cyrtanthus mackenii", "date": "2014", "keywords": "direction; elongation; germination; light; pollen; pollen tube; tube", "summary": "Pollen tube elongation is of one of the fastest grow- ing plant cell types. In vitro, the effects of light wavelength on pollen ger- mination or pollen tube elongation have been studied in Pinus roxburghii (Dhawan and Malik, 1981): pollen tube growth decreased in white light compared to the dark, and increased in red light, although this was counteracted by far red light.", "mime": "application/pdf"}, {"id": "ahs-18443", "words": "1138", "extension": ".pdf", "flesch": "58", "author": "none", "title": "Book reviews", "date": "2013", "keywords": "book; field; volume", "summary": "As explained on the back cover of the book: \u201cthe term medicinal plants defines a large group of plant species that have been used in pharmaceutical laboratories, but in a broader sense also includes plants for aromas, cosmetics, dyes, biocides and other agricultural purposes\u201d. The various contributions - in English and in French - that make up the volume are enriched with images from the period that have been carefully assembled by highly re- garded international experts in the field of landscape history, stimulating the debate sur- rounding the concept of scared landscapes.", "mime": "application/pdf"}, {"id": "ahs-18445", "words": "10544", "extension": ".pdf", "flesch": "56", "author": "Viti, R.; Bartolini, S.; Andreini, L.", "title": "Apricot flower bud dormancy: main morphological, anatomical and physiological features related to winter climate influence", "date": "2013", "keywords": "acta; apricot; bartolini; bud; buds; changes; chilling; cultivars; development; dormancy; endodormancy; et al; flower; growth; horticulturae; peach; plant; prunus; release; stage; temperatures; viti; winter", "summary": "Key words: budbreak, climate, endodormancy process, Prunus armeniaca L. Abstract: This review examines recent advances regarding flower bud dormancy in apricot, focusing on biological, ana- tomical, and physiological processes which occur during the induction and depth of dormancy. Bud dormancy starts with the perception by the plant of rest-signals under the influence of short and cool days; this process finishes after an accumulation of chill- ing temperatures.", "mime": "application/pdf"}, {"id": "ahs-18447", "words": "5060", "extension": ".pdf", "flesch": "68", "author": "Qrunfleh, I.M.; Read, P.E.", "title": "Delaying bud break in \u2018Edelweiss\u2019 grapevines to avoid spring frost injury by NAA and vegetable oil applications", "date": "2013", "keywords": "break; bud; clusters; naa; number; oil; pruning; table; treatment", "summary": "Delaying bud break is an approach to avoid spring frost damage. Sci., 37: 653-654. NIGOND J., 1960 - Delaying bud break in vines by the use of \u03b1-naphthaleneacetic acid and defense against frost. - Compt.", "mime": "application/pdf"}, {"id": "ahs-18448", "words": "5533", "extension": ".pdf", "flesch": "67", "author": "Takemura, Y.; Tamura, F.", "title": "Bud dormancy in Japanese pear", "date": "2013", "keywords": "breaking; bud; budbreak; buds; chilling; days; endodormancy; et al; hort; induction; japanese; pear; plant; sci", "summary": "Table 3 - Chilling requirement for breaking leaf bud endodormancy in Pyrus plants evaluated by the seasonal changes in percent leaf budbreak (Takemura et al., 2013) As a result in the experi- ment, it was cleared that temperature of 5oC was effective for inducing bud endodormancy in the cuttings, whereas a temperature of 15oC was ineffective (Fig. 2) (Takemura et al., 2011).", "mime": "application/pdf"}, {"id": "ahs-18449", "words": "7830", "extension": ".pdf", "flesch": "62", "author": "Bonhomme, M.; Lacointe, A.; Rageau, R.", "title": "Evidence for non-occurrence of node-to-node or stem-to-bud transfer of chilling temperature signal for dormancy release", "date": "2013", "keywords": "break; bud; buds; chilling; endodormancy; experiment; low; node; pcu; release; signal; temperature; treatment; trees", "summary": "The local response permits analysis of the intra-canopy heterogeneity of bud break and the possible relationship between bud status and intra-canopy heterogeneity of bud temperature. Surprisingly, to date no experimental study at bud level has used chilling tem- perature, although it is undoubtedly the main natural factor driving bud endodormancy release at bud level.", "mime": "application/pdf"}, {"id": "ahs-18450", "words": "8585", "extension": ".pdf", "flesch": "58", "author": "Fracchiolla, M.; Caramia, D.; Lasorella, C.; Montemurro, P.", "title": "Ground cover management strategies in an Apulian oil-producing olive grove: agronomic and ecological assessment proposals", "date": "2013", "keywords": "cover; crop; flora; ground; management; olive; plots; species; table; treatment; tri; values; weed; year", "summary": "X X X X X X X X Briza maxima L. + Bromus sterilis L. X X X X X X X X X X X X Calendula arvensis L. X X X X X X X X Capsella bursa-pastoris (L.) Medicus X X X X X Catapodium rigidum (L.) Hubbard + + + + Cerinthe major L. + Chrysanthemum segetum L. X X X X X X X X X X X X Convolvulus arvensis L. X X X X X X Conyza canadensis (L.) Cronq. + + + + Geranium molle L. + + + + + Heliotropium erupaeum L. X X X X X X X X Hippocrepis unisiliquosa L. + Hordeum murinum L. X X X X X X X X X X X X Lactuca serriola L. + Lamium purpureum L. X Lolium rigidum Gaudin X X X X X X X X X X X X Lotus ornithopodioides L. + + Malva sylvestris L. X X X X X X X X X X X X Medicago hispida Gaertner X X X X X X X X X X X X Melilotus indica (L.) All.", "mime": "application/pdf"}, {"id": "ahs-18451", "words": "5577", "extension": ".pdf", "flesch": "70", "author": "Khuder, A.; Ahmad, M.; Hasan, R.; Saour, G.", "title": "Trace and minor elements in bee honeys produced in Syria", "date": "2013", "keywords": "ag e; e di; honey; li nk; nk ag", "summary": "Zn Cu Rb Mn Cr Sr Ni Ti Ca K 0 30 60 90 120 Li nk ag e di st an ce Fig. 4 - Dendrogram of 11 analyzed elements in different types of honey samples (root square of dat treated by the linkage method with Euclidean distance as measure of similarity) AZEREDO L., DA C., AZEREDO M.A.A., DE SOUZA S.R., DUTRA V.M.L., 2003 - Protein contents and physicochemi- 60 cal properties in honey samples of Apis mellifera of different floral origins.", "mime": "application/pdf"}, {"id": "ahs-18452", "words": "2710", "extension": ".pdf", "flesch": "63", "author": "Kumar, A.; Sharma, N.", "title": "Protandrous-protogynous dimorphism in indigenous selections from North Western India and some exotic cultivars of Persian walnut (Juglans regia L.)", "date": "2013", "keywords": "akhrot; cultivars; dichogamy; plant; protandrous; walnut; year", "summary": "Although Juglans regia cultivars are self fertile, but low yields in walnut is a cause of concern which is mainly attributed to inadequate pollination resulting from pistil- late flower abscission (PFA) and adverse climatic con- ditions during pollen shedding and stigma receptivity. Solding Selection, Gobind, ACO 38853 Solding Selection Plant No. 32, KX Giant Luxmi Akhrot Plant No. 32, Solding Selection, KX Giant, ACO 38853", "mime": "application/pdf"}, {"id": "ahs-18453", "words": "4596", "extension": ".pdf", "flesch": "56", "author": "Adekpe, D.I.; Shebayan, J.A.Y.; Shinggu, C.P.; Aliyu, L.", "title": "Screening of herbicides for weed control, growth and yield of irrigated onion (Allium cepa L.) in tropical Savanna climate", "date": "2013", "keywords": "bulb; control; fbshw; hoe; weed", "summary": "Weed interference was observed to be more devastating than insect (Thrips tabaci) infesta- tions on onion dry bulb yield (Ghosheh and Al-Shannag, 2000). Weed dry weight The untreated control had significantly (P\u2264M0.05) higher weed dry weight than all the other treatments ex- cept for oxadiazon at 4 and 6 l/ha in 2006/2007 and for the combined mean (Table 4).", "mime": "application/pdf"}, {"id": "ahs-18454", "words": "5842", "extension": ".pdf", "flesch": "65", "author": "De Moraes, M.R.; Daiuto, \u00c9.R.; Vietes, R.L.; Cardoso, N.C.; Smith, R.E.", "title": "Effect of active modified atmospheres on the quality of non-astringent persimmons (Caqui Giombo) D. kaki Thunb. when stored under refrigerated conditions", "date": "2013", "keywords": "4%o; astringent; atmospheres; averages; days; et al; fruits; giombo; persimmons; storage; tannins", "summary": "This is in agreement with data reported by Chitarra and Chitarra (2005) who reported that the change in color is associated with ripening, which is a standard attribute for determining fruit quality. On the other hand, the Brazilian caqui cultivar called \u2018Giombo\u2019 is very productive and matures late, with fruits being picked from March to the end of May (Martins and Pereira, 1989).", "mime": "application/pdf"}, {"id": "ahs-18455", "words": "4927", "extension": ".pdf", "flesch": "67", "author": "Salehi, M.R.; Salehi, H.", "title": "Comparison of tall fescue (Festuca arundinacea Schreb.) and common bermudagrass (Cynodon dactylon [L.] Pers.) turfgrasses and their seed mixtures", "date": "2013", "keywords": "bermudagrass; fall; fescue; root; seed; sowing; spring; weight", "summary": "Total fresh and dry weight Maximum total weights were found among treatments composed of higher percentages of tall fescue seeds; with Table 5 - Effects of different seed mixtures and sowing times on some biological characteristics of the turfgrasses used Sowing season Treatment number Total dry weight (g) Chloropyll index after winter** Chlorophyll index after summer** Visual quality after summer Visual quality after winter Spring 1 29.53 cd* 2.10 cd 9.38 ab 8.25 ab 8.00 a-d 2 29.99 cd 2.07 cd 9.41 a 7.75 a-d 7.75 a-e 3 28.40 de 2.07 cd 9.47 a 8.37 ab 8.12 a-d 4 31.99 bcd 2.28 abc 9.05 b 8.37 ab 8.12 a-d 5 31.89 bcd 1.94 def 8.60 c 8.87 a 8.37 abc 6 25.35 ef 1.74 fg 8.27 cde 8.37 ab 7.00 b-f 7 22.64 fg 1.41 h 8.00 ef 8.00 ab 6.37 def 8 20.97 gh 1.07 i 7.79 fg 7.12 b-e 6.00 efg 9 17.67 hi 0.74 j 7.54 gh 6.62 cde 5.25 fg 10 12.73 hi 0.45 k 7.29 hij 7.12 b-e 2.87 hi 11 10.19 kl 0.09 l 7.04 j 7.75 a-d 0.00 k 12 17.90 hi 1.61 gh 8.19 de 8.62 a 8.87 a Average 23.27 A 1.47 B 8.34 A 7.93 A 6.39 A Fall 1 35.17 ab 2.24 bc 9.32 ab 8.50 a 8.37 abc 2 34.74 ab 2.47 a 9.36 ab 8.50 a 8.50 abc 3 36.12 a 2.37 ab 9.30 ab 8.87 a 8.75 ab 4 32.84 abc 2.32 ab 8.60 c 8.50 a 8.12 a-d 5 29.84 cd 2.00 de 8.41 cd 7.87 abc 7.87 a-d 6 20.74 gh 1.79 efg 8.06 def 6.25 ef 6.75 c-f 7 19.20 ghi 1.52 h 7.83 fg 5.87 efg 5.37 fg 8 15.38 ij 1.05 i 7.53 gh 5.00 fgh 4.50 gh 9 10.39 kl 0.84 j 7.39 hi 4.87 gh 1.87 ij 10 8.34 l 0.35 k 7.16 ij 4.37 h 1.00 jk 11 7.38 l 0.03 l 6.54 k 6.50 de 0.00 k 12 20.03 gh 1.82 ef 8.22 de 8.78 a 9.00 a Average 22.51 B 1.57 A 8.14 B 6.99 B 5.84 B * Introduction There are four main methods to establish turfgrasses from seeds: monoculture, seed blend, seed mixture and overseeding.", "mime": "application/pdf"}, {"id": "ahs-18456", "words": "640", "extension": ".pdf", "flesch": "63", "author": "none", "title": "Book reviews", "date": "2013", "keywords": "book; work", "summary": "In this 35th volume in the \u201cGiardini e Paesaggio\u201d series Maria Chiara Zerbi, in her pre- sentation, underlines that the book is the result of many years of enthusiastic work and that through it the reader can appreciate these \u201carchitecturally secret places that were found in what were once private gardens but are now part of public lands, neglected and in need of restoratotion and consolidation to restore the original quality\u201d. Breda M.A. Giardini e Paesaggio, Vol. 35.", "mime": "application/pdf"}, {"id": "ahs-18458", "words": "4959", "extension": ".pdf", "flesch": "59", "author": "Watanabe, S.; Matsubara, Y.-I.", "title": "Cross-protection against anthracnose with heat stress, antioxidative changes and proteomic analysis in mycorrhizal cyclamen", "date": "2014", "keywords": "activity; amf; anthracnose; cyclamen; heat; mycorrhizal; plants; shs; spots; stress", "summary": "In this experiment, mycorrhizal cyclamen plants also showed resistance to anthracnose even under the shock heat stress condition. Additionally, several investiga- tors have reported a higher resistance of mycorrhizal plants to biotic and abiotic stresses (Garmendia et al., 2006 ; Wu et al., 2006; Li et al., 2010).", "mime": "application/pdf"}, {"id": "ahs-18459", "words": "3495", "extension": ".pdf", "flesch": "57", "author": "Iwato, M.; Kosaza, M.; Takeuchi, Y.; Matsumoto, M.; Inada, M.; Ozaki, Y.; Okubo, H.", "title": "Stem blight resistance of Asparagus kiusianus and its hybrid with A. officinalis", "date": "2014", "keywords": "asparagus; disease; hybrids; interspecific; kiusianus; officinalis; resistance; stem", "summary": "The resistance of interspecific hybrids between A. officinalis and A. kiusianus was mostly intermediate, but some individuals had strong resistance equivalent to A. kiusianus. The results suggest that it is possible to introduce the resistance of A. kiusianus to stem blight into A. officinalis through interspecific hybridization for further Asparagus breeding.", "mime": "application/pdf"}, {"id": "ahs-18460", "words": "4168", "extension": ".pdf", "flesch": "54", "author": "Shishido, M.", "title": "Black root rot caused by Diaporthe sclerotioides threatens cucurbit cultivation in Japan", "date": "2014", "keywords": "cucumber; disease; dna; et al; root; sclerotioides; shishido; soil; species", "summary": "To control black root rot of cucurbits, solarization with a combination of soil fumigants such as chloropicrin has been widely applied in greenhouses, especially in warmer climate regions (Kobayashi et al., 1997). Because these pseudo-sclerotia are commonly observed on diseased roots as well, they are likely the primary in- ocula of black root rot of cucurbit crops.", "mime": "application/pdf"}, {"id": "ahs-18461", "words": "5798", "extension": ".pdf", "flesch": "69", "author": "Yamashita, H.; Mochioka, R.", "title": "Wild grape germplasms in Japan", "date": "2014", "keywords": "ficifolia; grapes; japan; native; species; table; var; vitis; yamabudou", "summary": "Nevertheless, the importance of wild grapes as genetic resource for grape breeding has gradually been recognized because some wild grapes show superior traits towards global warming in terms of sustainable berry pro- duction under hot and humid conditions. This paper describes the identification and classifica- tion of wild grapes native to Japan.", "mime": "application/pdf"}, {"id": "ahs-18462", "words": "3150", "extension": ".pdf", "flesch": "57", "author": "Park, B.-J.; Ono, K.; Yoshinami, Y.; Miyazaki, Y.", "title": "Physiological effects of orange essential oil inhalation in humans", "date": "2014", "keywords": "air; effects; inhalation; odor; oil; orange", "summary": "The present paper reports an indoor experiment con- ducted in humans to determine the physiological effects of the odor of orange essential oil by measuring HRV, blood pressure, and pulse rate before and during inha- lation of orange essential oil and comparing the values with those obtained before and during inhalation of fresh air (control). Abstract: This study was conducted to clarify the physiological and psychological effects of the odor of orange essential oil in humans.", "mime": "application/pdf"}, {"id": "ahs-18463", "words": "2646", "extension": ".pdf", "flesch": "64", "author": "Yuki, M.; Matsumoto, D.; Ikeda, K.; Taira, S.", "title": "Effects of wound treatments to flower organs on fruit set, development, and quality in sweet cherry (Prunus avium L.)", "date": "2014", "keywords": "cherry; flower; fruit; organs; removal; wounding", "summary": "Fruit development was observed by measuring fruit di- ameter twice per week from 29 May when fruit set was first established. 3 - The effects of wounding of flower organs on fruit development in \u2018Satohnishiki\u2019 sweet cherry.", "mime": "application/pdf"}, {"id": "ahs-18464", "words": "4341", "extension": ".pdf", "flesch": "66", "author": "Nakamura, I.; Takahashi, H.; Sato, Y.-I.", "title": "Diversity and breeding of flowering cherry in Japan", "date": "2014", "keywords": "cherry; cultivars; edo; fig; flowering; japan; somei; species; trees; yoshino", "summary": "\u2018Somei-yoshino\u2019 (Iketani et al., 2006), comprises more than 80-90% of flowering cherry trees planted in parks, and along roads and rivers across Japan, except in Okinawa and Hokkaido Islands. These results suggest that flowering cherry trees around the Bell Tower were de- veloped by artificial hybridizations between Edohigan and Oshimazakura, and that there were sufficient genetic resources to develop \u2018Somei-yoshino\u2019 and \u2018Komatsu- otome.\u2019", "mime": "application/pdf"}, {"id": "ahs-18465", "words": "3655", "extension": ".pdf", "flesch": "55", "author": "Yamamoto, Y.; Hoshino, Y.; Masago, H.; Kawano, Tomonori", "title": "Attempt for postharvest ripening of immature fruits of Haskap (Lonicera caerulea L. var. emphyllocalyx Nakai), an emerging fruit in Northern Japan", "date": "2014", "keywords": "acid; berries; color; fig; haskap; japan; postharvest; samples; storage", "summary": "It is conclusive that haskap berries can be harvested at premature stage if postharvest maturation was allowed during storage and/or transportation to the markets. The present study aims to contribute to the documenta- tion, designing a novel harvesting strategy based on the rip- ening physiology of haskap berries, which could be readily automated with minimal efforts.", "mime": "application/pdf"}, {"id": "ahs-2933", "words": "7266", "extension": ".pdf", "flesch": "64", "author": "Sharma, G.; Sharma, N.", "title": "Pollen characteristics, pollination behaviour and pollinizer compatibility of some exotic and indigenous almond [Prunus dulcis (Miller) D.A. Webb] genotypes", "date": "2013", "keywords": "almond; ati ble; ba se; ble co; co mp; fruit; mp ati; pollen; pollination; set", "summary": "Likewise, the study of Drake styles revealed that pollen tubes reached the base after 72 hr of pollination with Merced and Waris whereas with other cultivars it reached after 96 hr. Overall, it generally took three to five days for pollen tubes to reach the base of the pistil in otherwise compatible pollination.", "mime": "application/pdf"}, {"id": "ahs-2934", "words": "4455", "extension": ".pdf", "flesch": "55", "author": "Makee, H.; Tafesh, N.; Idris, I.", "title": "Radiation-induced chromosomal aberrations in grape Phylloxera", "date": "2013", "keywords": "chromosomes; dose; embryos; grape; irradiation; length; metaphase; nymphs; phylloxera", "summary": "To study the effect of different doses of gamma irra- diation on phylloxera chromosomes, 24 to 36-hr-old embryos were examined at each tested dose, and it was found that the chromosomes of all tested embryos of irradiated phylloxera had aberrations, regardless of dose. When low doses were applied, a small portion of irradiated nymphs successfully com- pleted development and produced matured females, survival which was due to the holokinetic nature of phylloxera chromosomes.", "mime": "application/pdf"}, {"id": "ahs-2935", "words": "3646", "extension": ".pdf", "flesch": "56", "author": "Lenzi, A.; Baldi, A.; Tesi, R.", "title": "Growing spinach in a floating system with different volumes of aerated or non-aerated nutrient solution", "date": "2013", "keywords": "nitrate; nutrient; oxygen; solution; summer; system; volume", "summary": "References ALBERICI A., QUATTRINI E., PENATI M., MARTINETTI L., GALLINA P.M., FERRANTE A., SCHIAVI M., 2008 - Effect of the reduction of nutrient solution concentration on leafy veg- etables quality grown in floating system. In the present work spinach was grown in sum- mer and autumn in a floating system in different volumes (252, 126 and 60 l per m2 of cultivated area) of aerat- ed or non aerated nutrient solution.", "mime": "application/pdf"}, {"id": "ahs-2936", "words": "4256", "extension": ".pdf", "flesch": "61", "author": "Goren, A.; Alkalia-Tuvia, S.; Perzelan, Y.; Aharon, Z.; Fallik, E.", "title": "Photoselective shade nets reducing postharvest decay development in pepper fruits", "date": "2013", "keywords": "alternaria; fruit; light; nets; pearl; pepper; quality; red; shade; shade nets", "summary": "Pepper cultivar \u2018Romans\u2019 grown in a semi arid region under 35% pearl and yellow shade nets significantly main- tained better pepper fruit quality after 16 days at 7\u00b0C plus three days at 20\u00b0C, mainly by reducing decay inci- dence during two consecutive years (2008 and 2009), compared to commercial black and red nets. Other studies have suggested differential effects of photoselective screens and shade nets on pest infes- tation and vector-borne viral diseases (Ben-Yakir et al., 2008).", "mime": "application/pdf"}, {"id": "ahs-2937", "words": "4227", "extension": ".pdf", "flesch": "65", "author": "Dalal, R.P.S.; Thakur, A.", "title": "Fibrous root distribution in Pineapple orange trees under semi- arid irrigated ecosystem", "date": "2013", "keywords": "citrange; cleopatra; depth; distance; lemon; length; root; soil; troyer", "summary": "Even a single root- stock-scion combination may differ in root distribution with a change in climatic condition. Therefore depth of irriga- tion and placement of fertilizer based on root distribution should be rootstock specific and deep ploughing should be avoided.", "mime": "application/pdf"}, {"id": "ahs-2938", "words": "4236", "extension": ".pdf", "flesch": "62", "author": "Masi, E.; Boselli, M.", "title": "Foliar application of molybdenum: effects on yield quality of the grapevine Sangiovese (Vitis vinifera L.)", "date": "2013", "keywords": "fig; fruit; harvest; molybdenum; mox3; nitrogen; plants; treatment; veraison; vines", "summary": "Mo treatment in early flowering; Mox3= Mo treatments in early flow- ering, early fruit set and early veraison. Mo treatment in early flowering; Mox3= Mo treat- ments in early flowering, early fruit set and early veraison.", "mime": "application/pdf"}, {"id": "ahs-2939", "words": "5010", "extension": ".pdf", "flesch": "55", "author": "Benelli, C.; Previati, A.; De Carlo, A.; Lambardi, M.", "title": "Shoot-tips vitrification protocol for red chicory (Cichorium intybus L.) lines", "date": "2013", "keywords": "chicory; chioggia; cryopreservation; medium; plant; pvs2; rosso; shoot; survival; tips; vitrification", "summary": "In order to choose the longest possible exposure time of shoot tips to the vitrifica- tion solution while avoiding toxic effects, shoot tips were exposed to PVS2 for 30, 60, 90 or 120 min and evaluated for shoot tip survival. This result high- lights the importance of incubation time with vitrifica- tion solution for shoot tip survival.", "mime": "application/pdf"}, {"id": "ahs-2940", "words": "8964", "extension": ".pdf", "flesch": "69", "author": "Ravi, V.; Ravindran, C.S.; Suja, G.; George, James; Nedunzhiyan, M.; Byju, G.; Naskar, S.K.", "title": "Crop physiology of elephant foot yam (Amorphophallus paeoniifolius (Dennst. Nicolson)", "date": "2013", "keywords": "amorphophallus; corm; corm yield; crops; elephant; et al; foot; growth; ha-1; planting; sen; size; yam; yield", "summary": "However, N and K had significant interactive effects on corm growth (corm bulking rate), mean corm weight per plant and corm yield per ha and this appears to be mainly due to N (Mukhopadhayay and Sen, 1986). Plant growth and corm yield is influenced by the size of planting material (corms/cormels/corm pieces), plant spacing, nutrient management and water availability.", "mime": "application/pdf"}, {"id": "ahs-2941", "words": "2501", "extension": ".pdf", "flesch": "66", "author": "Kanwar, M.S.", "title": "Performance of tomato under greenhouse and open field conditions in the trans-Himalayan region of India", "date": "2013", "keywords": "conditions; field; polyhouse; tomato", "summary": "404.23 169.18 181.52 149.05 188.93 29.87 44.39 13.79 22.80 30.55 16.16 17.57 74.44 30.60 28.69 47.13 37.80 75.64 89.44 79.74 94.56 88.61 85.32 64.00 72.73 66.67 73.91 53.85 65.83 Genotype Table 4 - Percent improvement in tomato performance under polyhouse versus open conditions for economic characters trans-Himalyan Ladakh region for tomato cultivation. There- fore, tomato cultivation under protected conditions is advised for Ladakh growing conditions, employing specif- ic polyhouse-responsive varieties.", "mime": "application/pdf"}, {"id": "ahs-2942", "words": "2327", "extension": ".pdf", "flesch": "50", "author": ", ", "title": "Book reviews", "date": "2013", "keywords": "anthocyanins; book; landscape; new; plant; rossore; san; work", "summary": "The volume, which contains an ample list of bibliographic references and numerous illustrations in black and white and in color, is an important addition to the vast literature on the evolution of historical landscapes not only from a scientific and techni- cal profile but also from an historical and cultural point of view. Plant colours are attracting not only because they provide spectacular views of nature, but also for their functional roles.", "mime": "application/pdf"}, {"id": "ahs-2943", "words": "4036", "extension": ".pdf", "flesch": "53", "author": "Daiuto, E.R.; Fumes, J.G.F.; Vieites, R.L.; Cabia, N.C.; De Castro, R.S.D.", "title": "Antioxidant capacity and phenolic total content in 'Fuerte' avocado submitted to hydrothermal treatment", "date": "2013", "keywords": "antioxidant; avocado; capacity; content; day; fruit; min; phenolic; storage; total; treatment", "summary": "Key words: antioxidant capacity, bioactive compounds, Persea americana Mill., refrigeration. The percentage of antioxidant capacity of the control and the hydrothermally-treated samples for 5 and 10 min increased during storage.", "mime": "application/pdf"}, {"id": "ahs-2944", "words": "7208", "extension": ".pdf", "flesch": "55", "author": "Caruso, G.; Conti, S.; La Rocca, P.", "title": "Influence of crop cycle and nitrogen manure form on yield and nitrate content of leafy, hypocotyl and fruit vegetables", "date": "2013", "keywords": "autumn; content; control; crop; cycle; fertilization; fertilizer; kg\u00b7ha-1; mineral; nitrate; nitrate content; nitrogen; plant; radish; spring; winter; yield", "summary": "The effects of these treatments were evaluated in terms of yield and nitrate content in the edible organs. In lettuce, nitrate content can be reduced by distributing a part of the whole nitrogen supply as ammonia form, without changing the overall yield results (van der Boon et al., 1990) while in endive the exclusively ammonia form allows for no nitrate heads (Elia and Santamaria, 1997).", "mime": "application/pdf"}, {"id": "ahs-2945", "words": "6357", "extension": ".pdf", "flesch": "64", "author": "R\u00edos-Mesa, D.; Pereira-Lorenzo, S.; Gonz\u00e1lez-D\u00edaz, A.J.; Hern\u00e1ndez-Gonz\u00e1lez, J.Z.; Gonz\u00e1lez-Diaz, E.; Gal\u00e1n Sa\u00faco, V.", "title": "The status of chestnut cultivation and utilization in the Canary Islands", "date": "2013", "keywords": "canarias; chestnut; cultivation; de tenerife; island; las; lorenzo; palma; pereira; santa; spain; tenerife; trees; wood", "summary": "Coci- nando con casta\u00f1as de Tenerife. Morphological and molecular marker (SSRs) studies have shown a great variability within the local population of chestnut trees in the Canaries.", "mime": "application/pdf"}, {"id": "ahs-2946", "words": "4241", "extension": ".pdf", "flesch": "56", "author": "Mugnai, S.; Al-Debei, H.S.", "title": "Growth reduction in root-restricted tomato plants is linked to photosynthetic impairment and starch accumulation in the leaves", "date": "2013", "keywords": "fig; growth; leaf; leaves; plants; restriction; root; water", "summary": "CARMI A., HESKETH J.D., ENOS W.T., PETERS D.B., 1983 - Interrelationships between shoot growth and photosynthesis, as affected by root growth restriction. - Photosynthetica, 17(2): 240-245. Abstract: The mechanisms responsible for reduced shoot growth due to restricted root growth is still not fully understood.", "mime": "application/pdf"}, {"id": "ahs-2947", "words": "4091", "extension": ".pdf", "flesch": "61", "author": "Kaul, A.; Kumar, S.; Ghani, M.", "title": "In vitro mutagenesis and detection of variability among radiomutants of chrysanthemum using RAPD", "date": "2013", "keywords": "chrysanthemum; control; flower; gamma; number; plant; rapd; shoots; variants", "summary": "Gy of gamma irradiation was the most effective in inducing muta- tions in flower colour through direct in vitro mutagenesis. Flower diameter and flower colour The variation in flower diameter between the control and the variants was statistically not significant (Tables 2 and 3).", "mime": "application/pdf"}, {"id": "ahs-2948", "words": "8396", "extension": ".pdf", "flesch": "61", "author": "Masmoudi-Charfi, C.; Masmoudi, M.; Ben Mechlia, N.", "title": "Root distribution in young olive trees (Olea europaea cv. Ch\u00e9toui) and agronomic application", "date": "2013", "keywords": "area; canopy; irrigation; olive; ratio; root; soil; system; trees; trunk; water; year", "summary": "This section propo- ses a methodological approach to determine irrigation requirements of young olive trees and how the water supply can be linked to the development of the canopy and root system during the first years of cultivation when ground cover and root system are incompletely developed. For each tree, three measurements were carried out for both direc- tions at different distances from trunk; the first observation was made at 0.4 m, the second at 0.8 m and the third at 1.2 m. Table 5 - Average root densities (Dr, cm cm-3) determined for trees aged one to six years Dr (cm cm-3) 2 3 4 5 6 0.067 0.079 0.196 0.075 0.133 0.303 1 Table 6 - The overall length of root system (Lr, km) for trees aged one to six years", "mime": "application/pdf"}, {"id": "ahs-2949", "words": "950", "extension": ".pdf", "flesch": "59", "author": ", ", "title": "Book reviews", "date": "2013", "keywords": "degli; dell\u2019olio; olive; soil", "summary": "La chimica dell\u2019olio da olive (Chemistry of olive oil) (G. Lercker); 2. Normativa sui requisiti chimici, fisici e organolettici degli oli di oliva (Regulatory requirements on chemical, physical and organoleptic characteristics of olive oil) (L. Conte); 3. I contaminanti e la filiera produttiva degli oli di oliva (Contaminants and the olive oil production process) (L. Conte, S. Moret, G. Purcaro, T. Populin, A. Ermacora, and M. Marega); 4. Caratteristiche chimi- co-fisiche dell\u2019oliva e dell\u2019olio con riferimenti alle cultivar pi\u00f9 diffuse (Physical and chemical characteristics of olive and oil with reference to the most cultivated cultivars) (G. Panelli);", "mime": "application/pdf"}, {"id": "ahs-2950", "words": "9710", "extension": ".pdf", "flesch": "53", "author": "Giulivo, C.", "title": "Basic considerations about pruning of deciduous fruit trees", "date": "2013", "keywords": "architecture; axes; axis; branches; canopy; development; fig; fruit; growth; orchard; organs; plant; pruning; reproductive; root; shoots; system; tree", "summary": "Pruning is the basic tool to manipulate fruit tree archi- tecture and behaviour in order to achieve economically sound crop yield and fruit quality. Key words: architecture, correlate function, fruit trees, growth, pruning.", "mime": "application/pdf"}, {"id": "ahs-2951", "words": "5489", "extension": ".pdf", "flesch": "65", "author": "Di Lorenzo, R.; Gambino, C.; Scafidi, P.", "title": "Summer pruning in table grape", "date": "2013", "keywords": "berry; cluster; dokoozlian; et al; fruit; girdling; grape; seedless; set; shoot; table; thinning", "summary": "CPPU applied at fruit set increased berry weight, diameter and length, while CPPU applied at fruit softening had no signifi- cant effect on berry growth. - Studies on the environmentally controlled stomatal transpiration in grape vines.", "mime": "application/pdf"}, {"id": "ahs-2952", "words": "8787", "extension": ".pdf", "flesch": "58", "author": "Palliotti, A.; Poni, S.", "title": "Traditional and innovative summer pruning techniques for vineyard management", "date": "2013", "keywords": "berry; canopy; cluster; composition; et al; fruit; grape; leaf; removal; sangiovese; shoot; thinning; vine; wine; yield", "summary": "It has to be kept in mind that early leaf removal is specif- ically recommended in highly productive vineyards which often present heavy, thick bunches very susceptible to rot. If early leaf removal is chosen, the primary regulation for crop restriction is via a decrease in fruit set with or without a significant reduction in berry size.", "mime": "application/pdf"}, {"id": "ahs-2953", "words": "4369", "extension": ".pdf", "flesch": "68", "author": "Choi, S.T.; Park, D.S.; Hong, K.P.; Kang, S.M.", "title": "Summer pruning effect on tree growth and fruit production of persimmon", "date": "2013", "keywords": "choi; fruit; growth; persimmon; pruning; summer; tree", "summary": "However, removal of shoots during growing sea- son involves the loss of functional leaf surface, which may lead to reduced tree development and fruit growth. Lower water consumption and thus improved water status during the growing season af- ter summer pruning could benefit fruit growth and relieve the potential detriment due to carbohydrate shortage in apple (Li et al., 2003) and peach (Lopez et al., 2006).", "mime": "application/pdf"}, {"id": "ahs-2954", "words": "6277", "extension": ".pdf", "flesch": "62", "author": "Neri, D.; Massetani, F.", "title": "Spring and summer pruning in Apricot and Peach orchards", "date": "2013", "keywords": "flower; fruit; growth; peach; pruning; shoot; spring; summer; varieties; vase; winter", "summary": "Late summer pruning becomes important in the third to fourth year to cut the central leader and to open the centre of the vase. In modern peach orchards, late summer pruning is widely diffused as a common practice to manage light distribution and carbon alloca- tion and finally shoot quality.", "mime": "application/pdf"}, {"id": "ahs-2955", "words": "3959", "extension": ".pdf", "flesch": "71", "author": "Mizutani, F.", "title": "Summer pruning for maintaining slender spindle bush type of peach trees grafted on vigorous rootstocks", "date": "2013", "keywords": "fruit; peach; pruning; shoot; summer; trees; winter", "summary": "Summer shoot heading back and shading experiments in the pot showed that shading reduced the number of regenerated shoots and flower bud formation and delayed flower blooming in the following year. Shoot regeneration and flower bud formation after summer shoot heading back A. Objectives Because of apical dominant nature of shoots, the termi- nal shoot grows well, which retards the growth of lateral shoots.", "mime": "application/pdf"}, {"id": "ahs-2956", "words": "3692", "extension": ".pdf", "flesch": "61", "author": "Intrigliolo, F.; Roccuzzo, G.", "title": "Modern trends of Citrus pruning in Italy", "date": "2013", "keywords": "citrus; fig; fruit; growth; intrigliolo; potatura; pruning; trees", "summary": "Pruning of young trees It is essential to take care of citrus trees during the juvenile stage to obtain a balanced scaffold with three to four principal branches developing at 30-50 cm from the collar (Fig. 1). If citrus trees are correctly managed in the nursery (cut back or headed)", "mime": "application/pdf"}, {"id": "ahs-2957", "words": "3741", "extension": ".pdf", "flesch": "69", "author": "Mika, A.; Buler, Z.", "title": "Intensive plum orchard with summer training and pruning", "date": "2013", "keywords": "cultivars; influence; planting; spacing; trees; year", "summary": "Table 2 - Influence of cultivars and spacing on tree growth expressed by tree height in the fourth year from planting (2008) Influence of cultivars Tree height (m) \u2018Cacanska Rana\u2019 3.08 b \u2018Cacanska Najbolja\u2019 3.26 b \u2018Cacanska Lepotica\u2019 3.20 b \u2018Diana\u2019 3.44 b \u2018Katinka\u2019 2.50 a \u2018Silvia\u2019 3.62 c Influence of spacing (m) 4 x 1.5 3.20 a 4 x 2.0 3.17 a 4 x 2.5 3.20 a Different letters indicate significant differences separately for cultivars and spacing at P=0.05. For this purpose new methods of summer training and pruning were intro- duced to plum trees.", "mime": "application/pdf"}, {"id": "ahs-2958", "words": "5142", "extension": ".pdf", "flesch": "60", "author": "Cooley, D.R.; Autio, W.R.", "title": "Summer pruning of apple: impacts on disease management", "date": "2013", "keywords": "apple; blight; canopy; disease; fire; fruit; management; plant; pruning; scab; summer; sutton; trees", "summary": "However, summer pruning can have impacts on apple diseases, because it alters canopy microclimate, can remove diseased tissue, improves deposition of fun- gicides and other chemicals, and in altering tree physiol- ogy may change resistance to disease. Of the few studies that have investigated interactions between summer pruning and apple diseases, most were done on semi-dwarf trees, and very few have looked at high-density systems.", "mime": "application/pdf"}, {"id": "ahs-2959", "words": "2784", "extension": ".pdf", "flesch": "66", "author": "Abu-Hammour, K.A.; Wittmann, D.", "title": "Seed contents of Coriandrum sativum in Jordan Valley", "date": "2013", "keywords": "acid; content; coriandrum; jordan; oil; petroselinic; sativum; seeds", "summary": "Coriandrum sativum plantation Coriandrum sativum seeds, obtained from local mar- kets (landraces), were planted at locations A and B on 5 November 2007. Lin- naeus (1780) reported that C. sativum also occurs as a weed in cereals.", "mime": "application/pdf"}, {"id": "ahs-2960", "words": "8369", "extension": ".pdf", "flesch": "59", "author": "Abu-Hammour, K.A.; Wittmann, D.", "title": "Pollination of Nigella sativa L. (Ranunculaceae) in Jordan Valley to improve seed set", "date": "2013", "keywords": "anthers; cross; flowers; hand; number; plant; pollen; pollination; sativa; seed; self; set; stigma; treatments", "summary": "Many authors are interested in common type of pollination as cross, open and self pollination, but through our research I have been devoted all our efforts to point out some thing out of tra- ditional efforts such as delayed self pollination. In order to check forced self pollination on the same hermaphrodite flower, flowers were bagged till the last day of the male stage.", "mime": "application/pdf"}, {"id": "ahs-2961", "words": "5951", "extension": ".pdf", "flesch": "62", "author": "Adjei-Frimpong, P.; Ofosu-Anim, J.; Norman, J.C.", "title": "Disbudding effects on growth analysis of Celosia (Celosia cristata)", "date": "2013", "keywords": "area; carmine; control; disbudding; experiment; flower; growth; leaf; planting; plants; rate; weeks", "summary": "The optimal LAI obtained for disbudded plants in celosia is between 2 and 2.5. Similarly, Law-Ogbomo and Egharevba (2008) reported that abscis- sion with plant growth of the lower leaves in tomato cau- ses a decrease in NAR.", "mime": "application/pdf"}, {"id": "ahs-2962", "words": "5463", "extension": ".pdf", "flesch": "64", "author": "Fini, A.; Ferrini, F.", "title": "Effects of mulching with compost on growth and physiology of Acer campestre L. and Carpinus betulus L.", "date": "2013", "keywords": "effects; growth; leaf; mulching; plants; soil; species; temperature; treatments; year", "summary": "In absence of irrigation and natural rainfall, the higher value measured in mulched soil provides further confirmation of the effectiveness of mulching to reduce evaporation: after 30 days of drought, soil was very dry Fig. Key words: chlorophyll fluorescence, leaf gas exchange, mulching, soil respiration, soil temperature, SPAD.", "mime": "application/pdf"}, {"id": "ahs-2963", "words": "5642", "extension": ".pdf", "flesch": "77", "author": "Dogra, B.S.; Kanwar, M.S.", "title": "Selecting parents for developing superior hybrids in cucumber (Cucumis sativus L.)", "date": "2013", "keywords": "k-90", "summary": "-0.531* -0.031 0.014* -4.917* -0.217* -0.055* 1.048* EC173934 8.167* 1.633* 8.517* -0.390* 0.191* 0.037* 0.011* 7.417* -0.617* -0.346* 0.144 K-75 0.733* 0.733* 1.017* -0.050* 0.320* -0.004 0.017* 10.083* -0.017 0.024* 1.084* LC-11 6.600* 0.633* 6.583* 0.388* 0.136* -0.022 0.007* 32.750* -0.783* -0.089* 0.604* LC-40 9.800* 2.067* 9.950* -0.225* -0.008* 0.029* 0.005* -8.417* -1.283* -0.379* -0.593* Gyn1 -10.733* -2.100* -0.053* 0.693* EC173934 7.642* 1.192* 7.867* -0.592* 0.196* 0.065* 0.014* -5.342* -0.858* -0.384* 0.489* K-75 2.908* 0.792* 1.100* -0.025 0.309* -0.013 -0.010* 8.825* -0.258* 0.058* 0.869* LC-11 2.875* 1.325* 6.300* 0.495* 0.083* -0.028* -0.0001 30.825* -1.092* -0.125* 0.513 LC-40 5.675* 2.358* 7.900* -0.148* 0.083* 0.045* -0.0007", "mime": "application/pdf"}, {"id": "ahs-2964", "words": "5660", "extension": ".pdf", "flesch": "60", "author": "Rinaldelli, E.; Bandinelli, R.; Pagano, M.", "title": "Short- and long-term effect of sulphite on sucrose transport in grapevine (Vitis vinifera L.) leaves. An electrophysiological study", "date": "2013", "keywords": "depolarization; dioxide; effects; fig; leaf; leaves; light; membrane; physiol; plant; solution; sucrose; sulphite; transport", "summary": "Effects of sulphur dioxide were also found on the stomatal apparate of Vitis labrusca L. cv. This response is comparable, as cause and effect, to the one caused by permeant weak acids (Marr\u00e8 et al., 1983; Rinaldelli and Bandinelli, 1999).", "mime": "application/pdf"}, {"id": "ahs-2965", "words": "4453", "extension": ".pdf", "flesch": "55", "author": "Al-Debei, H.S.; Mugnai, S.", "title": "Starch accumulation in the leaves of root-restricted pepper affects plant growth by a feedback-inhibition of the photosynthesis", "date": "2013", "keywords": "experiment; fig; growth; leaf; plants; restriction; root; water", "summary": "However, contradictory results are reported as to which of these factors plays a significant role in the re- sponse of aerial plant parts to restricted root growth, with strong differences between species. Our results suggest that the role of the leaves as sink organs may increase when root growth is extremely lim- ited by volume restriction and a relatively larger amount of carbohydrate may accumulate in the canopy.", "mime": "application/pdf"}, {"id": "ahs-2966", "words": "3198", "extension": ".pdf", "flesch": "62", "author": "El-Sabagh, A.S.; Barakat, M.N.; Genaidy, E.A.-E.", "title": "Towards in vitro selection studies for salinity tolerance in Canino apricot cultivar. Effect of gamma irradiation on in vitro mutation and selection for salt-tolerance", "date": "2013", "keywords": "apricot; culture; gamma; irradiation; medium; mutation; salt; shoot; vitro", "summary": "3. Results and Discussion Effect of gamma irradiation on in vitro apricot culture The basic requirement for effective use of mutation in- duction in plant breeding programs is the analysis of ra- dio sensitivity of the explant material (Walther and Sauer, 262 1986). The explants were aseptically excised and placed in Jar containing 50-60 ml of culture medium.", "mime": "application/pdf"}, {"id": "ahs-2967", "words": "3225", "extension": ".pdf", "flesch": "59", "author": "Karam, F.; Massaad, R.; Skaf, S.; Breidy, J.; Rouphael, Y.", "title": "Potato response to potassium application rates and timing under semi-arid conditions", "date": "2013", "keywords": "application; grade; potassium; potato; rates; tuber; yield", "summary": "In 2004 when averaged over K application rates, large and medium grade tubers and aggregated tuber yield were 120%, 22%, and 12% greater, respectively, with K application at tuber bulking than at tuber initiation. In 2004 when averaged over K application rates, large and medium grade tubers and aggregated tuber yield were 120%, 22%, and 12% greater, respectively, with K appli- cation at tuber bulking than at tuber initiation.", "mime": "application/pdf"}, {"id": "ahs-2968", "words": "9708", "extension": ".pdf", "flesch": "54", "author": "Dhungel, J.; Bhattarai, S.P.; Midmore, D.J.", "title": "Aerated water irrigation (oxygation) benefits to pineapple yield, water use efficiency and crop health", "date": "2013", "keywords": "control; crop; fruit; irrigation; leaf; oxygation; pineapple; plant; ratoon; root; soil; table; total; treatments; use; water; yield", "summary": "Fig. 2 - Mazzei air injector installed in a pressurised irrigation line close to the plot for air injection into irrigation water for oxygation (top), and the first year crop at fruit development stage (b) being marked for destructive sampling. Phytophthora infestation in the oxygation (3% of plants) was significantly reduced compared to the control (4.9%), and without irrigation treatment (10.5%) suggesting that reasonable management of Phytophthora, which is one of the major pathological problems for pineapple production in Australia and elsewhere, can be addressed through aerated water irrigation.", "mime": "application/pdf"}, {"id": "ahs-2969", "words": "3214", "extension": ".pdf", "flesch": "61", "author": "Lenzi, A.; Baldi, A.; Nannicini, M.; Pardini, A.; Tesi, R.", "title": "Effects of trinexapae-ethyl on stoloon development in potted Patriot bermudagrass", "date": "2013", "keywords": "a.i; bermudagrass; growth; ha-1; length; number; plants; stolon", "summary": "In our experiment, a TE rate of at least 0.2 kg a.i. ha-1 was needed for a significant decrease of stolon length in Patriot bermudagrass (Fig. 1). The effectiveness of trinexapac-ethyl (TE) in controlling bermudagrass growth is reported by many authors (John- son, 1994, 1997; Fagerness and Yelverton, 1999; Lowe and Whitwell, 1999; Fagerness and Yelverton, 2000; Fagerness et al., 2002; Bunnel et al., 2005; McCullough et al., 2005; Baldwin et al., 2006; McCullough et al., 2007; Baldi et al., 2010).", "mime": "application/pdf"}, {"id": "ahs-2970", "words": "3115", "extension": ".pdf", "flesch": "63", "author": "Aghdaei, M.; Salehi, H.; Sarmast, M.K.", "title": "Effects of silver nanoparticles on Tecomella undulate (Roxh.) Seem. Micropropagation", "date": "2013", "keywords": "explants; l-1; medium; snps; undulata", "summary": "Plant tissue culture is one of the most important steps in genetic transformation and plant biotechnology studies to produce plantlets from stock plants as a rapid and efficient procedure throughout the year (Giri et al., 2004; Sarmast et al., 2009). Abstract: Plant tissue culture is a reliable tool for conservation and multiplication of many plants, including medicinal plants.", "mime": "application/pdf"}, {"id": "ahs-2971", "words": "4863", "extension": ".pdf", "flesch": "63", "author": "Measham, P.F.; Bound, S.A.; Gracie, A.J.; Wilson, S.J.", "title": "Crop load manipulation and fruit cracking in sweet cherry (Prunus avium L.)", "date": "2013", "keywords": "cracking; crop; crop load; fruit; incidence; load; total; trials", "summary": "Key words: fruit crop load, incidence of cracking, sweet cherry. The aim of this five-year study was to investigate the relationship between fruit crop load and incidence of cracking.", "mime": "application/pdf"}, {"id": "ahs-2972", "words": "4904", "extension": ".pdf", "flesch": "58", "author": "Colantuono, F.; Amodio, M.L.; Piazzolla, F.; Colelli, G.", "title": "Influence of quality attributes of early, intermediate and late peach varieties on suitability for fresh-convenience products", "date": "2013", "keywords": "cultivars; fruit; group; maturing; peach; quality; tss; varieties", "summary": "Results obtained in the present study on peach fruits were in accordance with this theory since peach fruit cultivars (\u2018Honey Kist\u2019, \u2018Lidy Star\u2019, \u2018Stark Red Gold\u2019, \u2018Baby Gold7\u2019) with high dry matter content showed a higher value of TSS and were also preferred for sweetness by panelists during sensorial tests. Based on the \u2018Redhaven\u2019 peach maturing date, peach fruits were divided into three groups: early maturing (Group A), middle maturing (Group B) and late maturing (Group C), as shown in Table 1.", "mime": "application/pdf"}, {"id": "ahs-2973", "words": "3250", "extension": ".pdf", "flesch": "45", "author": "Luvisi, A.; Panattoni, A.; Bandinelli, R.; Rinaldelli, E.; Pagano, M.; Triolo, E.", "title": "Propagative material of grapevine: RFID technology for supporting traceability of \"basic\" and \"certified\" material along the wine production chain", "date": "2013", "keywords": "analysis; chain; data; grapevine; information; material; plants; production; rfid; traceability", "summary": "3. Results Requirement analysis and microchip tests The objectives for traceability of requirement analysis were: to record genetic links among plant categories; to record mandatory or voluntary assays; to identify struc- tures or people involved in plant production and resulting wine; and to use an identification system which relies on RFID codes associated with electronic identity cards (Lu- visi et al., 2010 a). PORTO S.M.C., ARCIDIACONO C., CASCONE G., 2011 - Developing integrated computer-based information sys- tems for certified plant traceability: Case study of Ital- ian citrus-plant nursery chain.", "mime": "application/pdf"}, {"id": "ahs-2974", "words": "2066", "extension": ".pdf", "flesch": "56", "author": ", ", "title": "Book reviews", "date": "2013", "keywords": "del; italy; olive; text; water; work", "summary": "ESPERIENZE E TEORIE IN ITALIA E IN INGHIL- TERRA NELL\u2019OTTOCENTO (TERRITORIES OF WATER: They are the fourth volume of the work on the Mantuan Lanscape presented by Accademia Nazionale Virgiliana di Scienze, Lettere, e Arti and edit by Leo S. Olschki.", "mime": "application/pdf"}, {"id": "ahs-2975", "words": "5522", "extension": ".pdf", "flesch": "58", "author": "Caruso, G.; Villari, G.; Borrelli, C.; Russo, G.", "title": "Effects of crop method and harvest seasons on yield and quality of green asparagus under tunnel in southern Italy", "date": "2013", "keywords": "asparagus; crop; days; g-1; harvest; method; spear; spring; summer; yield", "summary": "Summer spears showed higher values of optical residue, glucose, fructose, vitamin C and some mineral nutrients; instead, spring spears attained lower nitrate and average fibre content. Asparagus annual double harvest revealed economically interesting results, but the profits are strictly related to the prices of summer spears, which were evidently higher in summer than in spring in the three years of research.", "mime": "application/pdf"}, {"id": "ahs-2976", "words": "13486", "extension": ".pdf", "flesch": "56", "author": "Nin, S.; Ferri, A.; Sacchetti, P.; Giordani, E.", "title": "Pear resistance to psilla (Cacopsylla pyri L.): A review", "date": "2013", "keywords": "adults; bell; cacopsylla; civolani; control; cultivars; eggs; entomol; et al; feeding; fruit; homoptera; horton; host; leaf; leaves; nymphs; pasqualini; pear; pear psylla; plant; psylla; psyllidae; pyri; pyricola; pyrus; resistance; romania; usa", "summary": "Effectiveness of yellow sticky- board traps have been examined by several authors and seasonality of the catch and flight activity of pear psylla (C. pyricola) according to weather conditions have been reported (Krysan and Horton, 1991; Horton, 1994; Civo- lani and Pasqualini, 2003; Erler, 2004), as well as diur- nal difference (Horton, 1993) and intraorchard changes in distribution associated with leaf fall (Horton et al., 1993). Control measures are directed specifically at controlling pear psylla and require accurate and timely information about insect densities in the orchard.", "mime": "application/pdf"}, {"id": "ahs-2977", "words": "3998", "extension": ".pdf", "flesch": "56", "author": "Adam, A.; Makee, H.; Idris, I.", "title": "The influence of a non-pathogenic pseudomonas patida strain BTP1 on reproductive and dvelopment of grape phylloxera", "date": "2013", "keywords": "duration; phylloxera; pieces; putida; root; soaking", "summary": "Our current study indi- cates that the developmental time was significantly shorter on treated root pieces soaked for 15 hr (Fig. 2). 3. Results Effect of bacterial treated roots on phylloxera Table 1 shows that when root pieces were treated with P. putida, the percentage of emerged matured females was significantly affected compared to the control (F=84.69; df=15, 64; P<0.05).", "mime": "application/pdf"}, {"id": "ahs-2978", "words": "4474", "extension": ".pdf", "flesch": "52", "author": "Piazzolla, F.; Amodio, M.L.; Rinaldi, R.; Raimo, F.; Colelli, G.", "title": "Effect of type of fertilization and maturity on quality of fresh-cut red and yellow peppers (Capsicum annuum L.)", "date": "2013", "keywords": "acid; fertilization; maturity; nss; peppers; quality; stage", "summary": "Most of the differences observed at harvest were main- tained during storage for yellow peppers. For yellow peppers, no signifi- cant differences in firmness were observed.", "mime": "application/pdf"}, {"id": "ahs-2979", "words": "2968", "extension": ".pdf", "flesch": "60", "author": "Kumar, A.; Ahad, I.", "title": "Growth, yield and fruit quality of strawberry under protected cultivation in South Kashmir", "date": "2013", "keywords": "chandler; cultivars; maximum; number; plant; strawberry", "summary": "The pooled data of two consecutive years shown in Table 1 reveal that \u2018Chandler\u2019 had maximum plant spread (27.43 cm) which was statistically at par with \u2018Catskill\u2019 (25.49 Table 1 - Growth and flowering characters of strawberry cultivars under polyhouse Cultivar Plant spread (cm) No. of runners/ plant Runners length (cm) Days taken first flower to produce Duration of flowering Number of flower/ plant Catskill 25.49 ef 7.09 ef 81.94 f 106 def 50.86 ab 26.92 e Chandler 27.43 f 8.54 h 82.59 fg 101 bc 56.79 d 27.23 f Confutura 24.18 cde 6.11 d 89.78 h 99 ab 53.92 bcd 20.93 ab Gorella 25.44 def 5.67 bc 75.40 de 103 cd 51.12 abc 21.90 bc Pajaro 21.75 ab 4.89 a 67.58 b 105 de 49.39 a 20.48 a Selva 23.08 bcd 5.44 b 73.95 cd 116 h 47.82 a 21.84 bc Tioga 20.19 a 7.35 fg 70.42 bc 97 a 55.49 cd 25.64 d Fern 22.35 abc 6.93 e 60.92 a 110 g 48.91 a 21.45 bc Mean 23.74 6.50 75.32 104.6 51.79 23.31 CD 0.05 2.40 0.29 3.70 3.84 4.43 0.99 Fig. Maximum reducing sugar (6.27 %) and total sugar (8.09%) were observed in \u2018Catskill\u2019 which was the highest Table 2 - Yield and fruiting characters of strawberry cultivars under polyhouse Cultivar Number of berries/ plant Berry set (%) Yield/plot (kg) Berry weight (g) Berry length (cm) Berry breadth (cm)", "mime": "application/pdf"}, {"id": "ahs-2980", "words": "5091", "extension": ".pdf", "flesch": "45", "author": "Crespan, M.; Armanni, A.; Da Rold, G.; De Nardi, B.; Gardiman, M.; Migliaro, D.; Soligo, S.; Storchi, P.", "title": "\u2018Verdello\u2019, \u2018Verdicchio\u2019 and \u2018Verduschia\u2019: an example of integrated multidisciplinary study to clarify grapevine cultivar identity", "date": "2013", "keywords": "comparison; data; green; italy; low; medium; short; table; varieties; verdello; verdicchio; verduschia", "summary": "Organ OIV Code 2009 Description Verdello Verdicchio Verduschia present study Cartechini and Moretti, 1989 present study Bruni, 1962 present study Breviglieri and Casini, 1965 sh oo t 002 young shoot: distribution of anthocyanin coloration on prostrate hairs of the shoot tip absent absent absent absent absent piping 003 young shoot: intensity of anthocyanin coloration on prostrate hairs of the shoot tip none or very low none or very low none or very low none or very low none or very low low 004 young shoot: density of pros- trate hairs on the shoot tip medium very high medium very high medium medium or very high 006 attitude semi-erect semi-erect semi-erect semi-erect semi-erect semi-erect 007 colour of the dorsal side of internodes green and red green and red green and red green and red green green 008 colour of the ventral side of internodes green and red green and red green and red green and red green and red green and red 009 colour of the dorsal side of nodes green and red green and red green and red green and red green green 010 colour of the ventral side of nodes green and red or red green green and red or red green and red green and red green and red 013 density of prostrate hairs on nodes low none or very low low none or very low low low 015_2 intensity of anthocyanin coloration on the bud scales weak weak weak nr weak nr 016 number of consecutive tendrils 2 or less 2 or less 2 or less 2 or less 2 or less 2 or less 95 Organ OIV Code 2009 Description Verdello Verdicchio Verduschia present study Cartechini and Moretti, 1989 present study Bruni, 1962 present study Breviglieri and Casini, 1965 yo un g le af 051 colour of upper side of blade (4th leaf) green / bronze / yellow green green / yellow green / bronze green / yellow green 053 density of prostrate hairs be- tween main veins on lower side of blade (4th leaf) high very high high very high high very high 055 density of prostrate hairs on main veins on lower side of blade (4th leaf) low low low nr low nr m at ur e le af 065 size of blade medium-small* medium medium* medium medium-small* medium-small 067 shape of blade wedge-shaped or pentagonal* circular wedge-shaped or pentagonal* circular or pen- tagonal wedge-shaped or pentagonal* pentagonal 068 number of lobes five or three five five five or three five five or three 069 colour of the upper side of the blade between medium green and dark green medium green between medium green and dark green between medium green and dark green between medium green and dark green dark green 070 area of anthocyanin col- oration of main veins on upper side of blade absent absent absent absent absent absent 071 area of anthocyanin col- oration of main veins on lower side of blade absent absent absent absent absent absent 073 undulation of blade between main or lateral veins present present present present present present 074 profile of blade in cross section involute, V-shaped or twisted V-shaped involute, V- shaped or twisted flat or twisted involute, V- shaped or twisted flat or twisted 075 blistering of upper side of blade medium weak medium medium medium nr 076 shape of teeth mixture between straight and convex sides one side concave, one side convex mixture between straight and convex sides mixture between straight and convex sides mixture between straight and convex sides both sides convex 078 length of teeth compared with their width short short short short short short 079 degree of opening/overlap- ping petiole sinus overlapped strongly over- lapped overlapped closed or over- lapped overlapped overlapped 084 density of prostrate hairs between main veins on lower side of blade medium medium high very high medium very high 086 density of prostrate hairs on main veins on lower side of blade low low low high low nr 090 density of prostrate hairs on petiole low none or very low low none or very low low none or very low 093 length of petiole compared to length of middle vein (N1) shorter than N1 longer than N1 equal to N1 nr equal to N1 nr 601 length of vein N1 short* nr medium* nr short* nr 602 length of vein N2 medium* nr medium* nr medium* nr 603 length of vein N3 medium* nr medium* nr medium* nr 604 length of vein N4 very long* nr very long* nr very long* nr w oo dy sh oo t 101 cross section circular or elliptic circular circular or elliptic circular or elliptic circular or elliptic circular or el- liptic 103 main colour brownish brownish brownish between brown- ish and grey brownish brownish in flo re sc en ce 151 flower: sexual organs hermaphrodite hermaphrodite hermaphrodite hermaphrodite hermaphrodite hermaphrodite 152 insertion of 1st inflores- cence 3rd and 4th node 3rd and 4th node 3rd and 4th node 3rd and 4th node 3rd and 4th node 3rd and 4th node 153 number of inflorescences per shoot 1.1 to 2 1.1 to 2 1.1 to 2 1.1 to 2 1.1 to 2 1.1 to 2 96 Organ OIV Code 2009 Description Verdello Verdicchio Verduschia present study Cartechini and Moretti, 1989 present study Bruni, 1962 present study Breviglieri and Casini, 1965 bu nc h 202 length medium-long medium medium-long medium-long medium-long long 204 density dense very dense dense dense or medium dense medium 206 length of peduncle short very short short medium short short 208 shape conical / funnel shaped / cylindrical conical conical / funnel shaped / cylindri- cal conical or cylin- drical-conical conical / funnel shaped / cylindri- cal conical 209 number of wings of the primary bunch 1-2/3-4 with wings 1-2/3-4 wings with wings 1-2/3-4 with wings be rr y 220 length medium medium medium medium between me- dium and short short 222 uniformity of size uniform uniform uniform uniform uniform uniform 223 shape globose globose globose globose globose globose 225 colour of skin yellow yellow yellow yellow yellow yellow 227 bloom medium medium medium medium medium medium 228 thickness of skin thin thick thin thin thin thick 229 hilum visible visible visible visible visible visible 241 formation of seeds complete complete complete complete complete complete ve ge ta tio n 306 autumn coloration of leaves yellow yellow yellow yellow yellow yellow 351 vigour of shoot growth medium-strong medium medium-strong medium-strong medium-strong medium-strong 352 growth of lateral shoots weak weak weak medium weak weak 353 length of internodes medium long long medium-long medium medium 354 diameter of internodes medium small medium medium medium medium With regard to the descriptions from the literature, most of the 57 OIV descriptors we used were retrieved.", "mime": "application/pdf"}, {"id": "ahs-2981", "words": "6752", "extension": ".pdf", "flesch": "56", "author": "Giordani, E.; Petrucci, W.A.; Morelli, D.; Ferri, A.", "title": "Production of strawberries (Fragaria x ananassa Duch.) in mountain areas: a comparative evaluation of two june-bearing cultivars", "date": "2013", "keywords": "crop; cultivars; effect; elsanta; field; fruits; location; marmolada; onebor; strawberry", "summary": "Abstract: Two uniferous strawberry cultivars, \u2018Marmolada\u00aeOnebor\u2019 and \u2018Elsanta\u2019, were tested in three experimental fields located at 1,200 m asl; phenological phases and fruit quality of first and second season crops were compared. RADAJEWSKA B., DEJWOR-BOROWIAK I., 2002 - Re- fractometric and sensory evaluation of strawberry fruits and their shelf life during storage.", "mime": "application/pdf"}, {"id": "ahs-2982", "words": "635", "extension": ".pdf", "flesch": "55", "author": ", ", "title": "Book review", "date": "2013", "keywords": "book; gardens; peppers", "summary": "(The systematic importance of literary conclusions in terms of garden culture) Even though difficulties exist with pepper taxonomy, the book pres- ents a good introduction where all disputes are clearly elucidated and discussed.", "mime": "application/pdf"}, {"id": "ahs-2983", "words": "11025", "extension": ".pdf", "flesch": "57", "author": "Yusuf, L.M.; Kurien, S.", "title": "Preliminary studies on selection indices for activating seedling growth in mangosteen (Garcinia mangostana L.)", "date": "2012", "keywords": "age; age group; characters; fruit; fruit characters; group; index; number; seed; seed characters; seed index; seedling; seedling characters; seedling index", "summary": "Seed characters Observations on seed weight, seed length, seed thick- ness at centre, seed volume, seed specific gravity, number of seeds per fruit, number of seedlings per seed, number of ungerminated seeds, number of seeds producing one seedling, number of seeds producing two or more than two seedlings (Table 2), number of days taken to germination, and germination rate were recorded based on ISTA guide- lines (ISTA, 2003). Seed character The seeds were extracted from the pulp and the weight of individual seeds in fruits was measured using an elec- tronic balance; the average seed weight was expressed in grams.", "mime": "application/pdf"}, {"id": "ahs-2984", "words": "5373", "extension": ".pdf", "flesch": "65", "author": "Shekafandeh, A.; Hojati, S.", "title": "In vitro drought effects on morphological and physiological indices of two fig (Ficus carica L.) cultivars", "date": "2012", "keywords": "content; cultivars; drought; leaf; peg; plant; proline; sabz; siah; stress; water", "summary": "Fig. 1 - Changes in leaf water content (RWC) and ion leakage in two fig cultivars: \u2018Sabz\u2019 (a) and \u2018Siah\u2019 (b). Water shortage is the main characteristic of agricul- ture in Mediterranean regions, inducing water stress dur- ing spring and summer.", "mime": "application/pdf"}, {"id": "ahs-2985", "words": "7394", "extension": ".pdf", "flesch": "56", "author": "Masmoudi Charfi, C.", "title": "Quantitative analysis of soil water content in young drip-irrigated olive orchards", "date": "2012", "keywords": "content; irrigation; masmoudi; measurements; olive; root; soil; soil water; tree; values; water; year", "summary": "Soil water content was measured by using a time domain reflectometer (TDR) and a neutron probe calibrated by concur- rently measuring soil water content gravimetrically. Gravimetry is amongst the devices used to reliably measure soil water content (Hv) in the field.", "mime": "application/pdf"}, {"id": "ahs-2986", "words": "2013", "extension": ".pdf", "flesch": "54", "author": "Rizzo, D.; Stefani, L.; Paoli, M.; Triolo, Enrico; Panattoni, A.; Luvisi, Andrea", "title": "The sustainability of old grapevine mother plants in relation to new mandatory diagnostic tests for virus control", "date": "2012", "keywords": "glrav-3; grapevine; plants; virus; viruses", "summary": "In any case, the virologic status of uncertified grapevine in Tuscany indicates the presence of grapevine viruses and related vectors, underlining the importance of periodic verifications in grapevine nurseries to guarantee the high- est health standards of plant production and to help reduce The sustainability of old grapevine mother plants in relation to new mandatory diagnostic tests for virus control D. Rizzo*, L. Stefani*, M. Paoli*, E. Triolo**, A. Panattoni**, A. Luvisi**(1) * Servizio Fitosanitario Regionale, servizi agro ambientale di vigilanza e controllo, Regione Toscana, Via dei Fiori, 8, 51010 Pescia (PT), Italy. References ANDRET-LINK P., FUCHS M., 2005 - Transmission specificity of plant viruses by vectors.", "mime": "application/pdf"}, {"id": "ahs-2987", "words": "4951", "extension": ".pdf", "flesch": "55", "author": "Javanmardi, J.; Ghorbani, E.", "title": "Effects of chicken manure and vermicompost teas on herb yield, secondary metabolites and antioxidant activity of lemon basil (Ocimum x citriodorum Vis.)", "date": "2012", "keywords": "activity; antioxidant; basil; cmt; compost; content; lemon; manure; oil; plants; soil; tea; total; vct", "summary": "Our data are in agreement with a previous work that found a higher essential oil percentage in ba- Table 3 - Effect of different dilutions of chicken manure tea (CMT) and vermicompost tea (VCT) on plant height, number of leaves, lateral branches and flowers, shoot fresh and dry weight and leaf chlorophyll content of lemon basil plants Treatment Plant height (cm) Conclusions The findings of this study indicate that fertilization with chicken manure and vermicompost organic teas im- proves herbal and essential oil yields as well as antioxida- tive agents such as total phenolics in lemon basil plants.", "mime": "application/pdf"}, {"id": "ahs-2988", "words": "3803", "extension": ".pdf", "flesch": "63", "author": "Dutta, P.; Majumder, D.", "title": "Influence of bagging on fruit quality and mineral composition of Himsagar mango grown in new alluvial zones of West Bengal", "date": "2012", "keywords": "bagged; bagging; content; control; days; fruit; harvest; mango; set; stages", "summary": "Key words: fruit bagging, fruit quality mineral composition, Himsagar mango. The unbagged fruits Table 2 - Effect of fruit bagging with polyethylene on length (cm) of fruit at different stages of harvest Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 35 10.75 12.75 13.91 45 10.30 11.50 12.28 55 10.06 11.35 11.94 65 9.95 11.12 11.82 Control 9.40 10.92 11.32 SEm \u00b1 0.425 0.414 0.380 LSD (P = 0.05) 1.241 ns 1.144 Table 3 - Effect of fruit bagging with polyethylene on diameter (cm) of fruit at different stages of harvest Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 35 7.77 8.00 8.43 45 7.33 7.71 8.25 55 7.19 7.70 7.95 65 7.05 7.44 7.94 Control 6.91 7.25 7.68 SEm \u00b1 0.172 0.210 0.211 LSD (P = 0.05) 0.521 0.591 0.610 Table 4 - Effect of fruit bagging on total soluble solids (\u00b0Brix) content of ripe mango fruit Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 45 9.90 12.20 15.40 55 10.05 13.50 17.30 65 10.40 14.30 17.85 Control 11.90 15.30 16.25 SEm \u00b1 0.161 0.072 0.051 LSD (P = 0.05) 0.483 0.219 0.153 Table 5 - Effect of fruit bagging on total soluble sugar (% of fresh weight) content of ripe mango fruit Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 35 4.42 6.85 11.81 45 4.77 6.85 12.57 55 5.02 7.52 13.69 65 5.50 7.81 13.82 Control 6.20 7.97 12.83 SEm \u00b1 0.129 0.061 0.051 LSD (P = 0.05) 0.391 0.180 0.158 Table 6 - Effect of fruit bagging on titratable acid (% malic acid) con- tent of ripe mango fruit Bagging (days after fruit set)", "mime": "application/pdf"}, {"id": "ahs-2989", "words": "10360", "extension": ".pdf", "flesch": "53", "author": "Marone, Elettra; Fiorino, Piero", "title": "Oleiculture in progress", "date": "2012", "keywords": "areas; buds; characteristics; cultivars; cultivation; europaea; fiorino; growing; growth; italy; marone; new; oil; olea; olive; plant; species; temperature", "summary": "The use of olive oil in the diet came later in this plant\u2019s history, around the first half of the 2nd millennium B.C., when use of this product spread via sea routes first from the eastern Mediterranean and Aegean Sea toward Greece, then thanks to the Phoenicians along the coast of Africa toward the west as far as (and beyond) the Pillars of Hercules. In Europe, olive oil acquired new importance through the Christian religion, and for which substitutes were not possible (e.g. for illumination of altars, anointing of the sick, use of plant oils during Lent or other periods of ab- stinence from foods of animal origin).", "mime": "application/pdf"}, {"id": "ahs-2990", "words": "2272", "extension": ".pdf", "flesch": "58", "author": "Di Vaio, Claudio; Marallo, N.; Nocerino, S.; Famiani, F.", "title": "Mechanical harvesting of oil olives by trunk shaker with a reversed umbrella interceptor", "date": "2012", "keywords": "cultivars; harvesting; olive; ortice; ortolana; shaker; trunk", "summary": "This result highlights the importance of a good yield/tree in determin- ing high work productivity and therefore the economic convenience of using machines for olive harvesting (Fami- ani et al., 1998). - Horticultural Reviews, 38: 83-147. TOMBESI A., 1990 - Physiological and mechanical advances in olive harvesting.", "mime": "application/pdf"}, {"id": "ahs-2991", "words": "4981", "extension": ".pdf", "flesch": "64", "author": "Makee, H.; Idris, I.; Hussian, K.", "title": "Factors influencing mating incidence and reproduction in codling moth Cydia pomonella L. (Lepidoptera: Tortricidae)", "date": "2012", "keywords": "age; effect; fecundity; females; fertility; group; lepidoptera; mating; number; pomonella; weight", "summary": "Effect of sex ratio on mating ability When C. pomonella females were confined with one or three males for 24 h, they mated only once. Effect of female multiple mating on fecundity and fertility When C. pomonella females were exposed to newly emerged males for seven successive days (group 2 fe- males), 18% of them mated once, more than half mated twice or three times and 18% mated four or five times (Table 4).", "mime": "application/pdf"}, {"id": "ahs-2992", "words": "4080", "extension": ".pdf", "flesch": "54", "author": "Svobodov\u00e1, Eva; Pandolfi, Camilla; Hl\u00e1sn\u00e1 \u010cepkov\u00e1, P.; Mancuso, Stefano", "title": "Discrimination of grapevine varieties cultivated in the Czech Republic by Artificial Neural Networks", "date": "2012", "keywords": "analysis; berry; chasselas; fractal; grapevine; leaf; network; riesling; varieties; variety; vitis", "summary": "Discrimination of grapevine varieties cultivated in the Czech Republic by Artificial Neural Networks E. Svobodov\u00e1*(1), C. Pandolfi**, P. Hl\u00e1sn\u00e1 \u010cepkov\u00e1*, S. Mancuso** * Department of Crop Sciences and Agroforestry in Tropics and Subtropics, Faculty of Tropical Agri- Science, Czech University of Life Sciences Prague, Czech Republic. MORAVCOV\u00e1 K., BAR\u00e1NEK M., PIDRA M., 2004 - The use of RAPD markers for differentiation of grapevine varieties registered in the Czech Republic. - Horticultural Science (Prague), 31 (3): 96-101.", "mime": "application/pdf"}, {"id": "ahs-2993", "words": "4637", "extension": ".pdf", "flesch": "66", "author": "Fujita, E.; Vieites, R.L.; Daiuto, \u00c9.R.; Smith, R.E.", "title": "Refrigerated storage of the fruits of the buriti (Mauritia flexuosa L.)", "date": "2014", "keywords": "ambient; buriti; day; days; fatty; fruits; storage", "summary": "Abstract: The objective of this study was to evaluate different storage conditions to maximize the shelf-life of buriti fruits; under ambient conditions the fruits last only 2-3 days. Buriti fruits were stored refrigerated at 10, 12 and 15oC with 85\u00b15% relative humidity, and at room temperature (23\u00b15\u00b0C) and 60\u00b15% relative humidity.", "mime": "application/pdf"}, {"id": "ahs-2994", "words": "4207", "extension": ".pdf", "flesch": "60", "author": "Idris, I.; Arabi, M.I.E.", "title": "The relationship between grape phylloxera and Fusarium root infection", "date": "2014", "keywords": "fungi; grape; infection; phylloxera; plant; roots; solani; sy7", "summary": "Key words: Fusarium ssp., grape phylloxera, grape root. Omer et al. (2002) reported that the ability of grape phylloxera to exploit grape roots increased in the absence of fungal pathogens and indicated that phylloxera on infected roots developed more slowly, and had substantially reduced survival and reproduction rates.", "mime": "application/pdf"}, {"id": "ahs-2995", "words": "2862", "extension": ".pdf", "flesch": "65", "author": "Eshghi, S.; Bahadoran, M.; Salehi, H.", "title": "Growth of tall fescue (Festuca arundinacea Schreb.) seedling sown in soil mixed with nitrogen and natural zeolite", "date": "2014", "keywords": "content; mixture; mowing; nitrogen; soil; weight; zeolite", "summary": "The object of the present study was to investigate the effects on tall fescue growth of applying different amounts of natural zeolite and nitrogen to growth medium. Abstract: To determine the interaction of nitrogen and natural zeolite in culture medium on the vegetative growth of tall fescue (Festuca arundinacea Schreb.)", "mime": "application/pdf"}, {"id": "ahs-2996", "words": "2358", "extension": ".pdf", "flesch": "63", "author": "Abubaker, S.; Qrunfleh, I.; Hasan, M.", "title": "Effect of different types of mulches on 'Newton' tomato yields and fruit cracking under plastic greenhouse conditions", "date": "2014", "keywords": "mulch; plastic; tomato; types; yields", "summary": "Results of this study clearly showed that mulching improves total tomato yields under greenhouse conditions. Different mulch types showed significant ef- fects on early, medium, late, and total yields/ha of the tomato fruits.", "mime": "application/pdf"}, {"id": "ahs-2997", "words": "4612", "extension": ".pdf", "flesch": "60", "author": "Magni, S.; Gaetani, Monica; Grossi, N.; Caturegli, L.; La Bella, S.; Leto, C.; Virga, G.; Tuttolomondo, T.; Lulli, F.; Volterrani, M.", "title": "Bernudagrass adaptation in the mediterranean climate: phenotypic traits of 44 accessions", "date": "2014", "keywords": "bermudagrass; cm-2; colour; density; dwarf; green; hybrid; pisa; tif; types", "summary": "The most dense improved type was Wintergreen (2.3 shoots cm-2), hybrid type values ranged from 1.7 shoots cm-2 (Patriot) to 3.8 shoots cm-2 (Tif 00-1), while the most dense dwarf type was Miniverde with 5.1 shoots cm-2. Dwarf and hybrid types yielded the best aesthetic characteristics.", "mime": "application/pdf"}, {"id": "ahs-2998", "words": "6168", "extension": ".pdf", "flesch": "54", "author": "Javanmardi, J.; Zarei, M.; Saei, M.", "title": "Influence of arbuscular mycorrhizal fungi on physiology and fruit quality of Pepino (Solanum muricatum Ait.) in vermicompost amended medium", "date": "2014", "keywords": "amf; days; effects; etunicatum; fruit; growth; mycorrhizal; number; pepino; plants; soil; table; vermicompost; versiforme", "summary": "An increased fruit dry matter percentage in AMF plants has been attrib- uted to improved water and nutrient uptake/translocation, higher photosynthesis (Vamerali et al., 2003), and also to the pattern of dry matter distribution in inoculated plants, which pointed to a role of AMF in carbon partitioning (Mena-Violante et al., 2006). Vermicompost as an organic fertilizer provides some essential nutrients for supporting plant growth compared with chemical fertilizers.", "mime": "application/pdf"}, {"id": "ahs-2999", "words": "4088", "extension": ".pdf", "flesch": "64", "author": "Ben Hamed, I.; Biligui, B.; Arbelet-Bonnin, D.; Abdelly, C.; Ben Hamed, K.; Bouteau, Fran\u00e7ois", "title": "Establishment of a cell suspension culture of the halophyte Cakile maritima", "date": "2014", "keywords": "cakile; cell; culture; et al; fig; growth; maritima; plant; salinity; suspension", "summary": "The present paper reports initiation of C. maritima cell suspension cultures from callus obtained from aerial parts of seedlings. Suspension culture cells offer an in vitro system that is widely used in plant biology as a convenient tool to inves- tigate a wide range of phenomena.", "mime": "application/pdf"}, {"id": "ahs-3000", "words": "3294", "extension": ".pdf", "flesch": "63", "author": "Manuchehri, R.; Salehi, H.; Jowkar, A.", "title": "Biochemical and physiological adjustments in common bermudagrass (Cynodon dactylon [L.] Pers.) and tall fescue (Festuca arundinacea Schreb.) under low temperature stress", "date": "2014", "keywords": "activity; bermudagrass; fescue; plants; proline; stress; temperature", "summary": "The main objective of the present study was to investi- gate the effects of low temperature stress on biochemical and physiological responses of tall fescue and common bermudagrass. Key words: Antioxidant enzymes activity, common Bermudagrass, low temperature stress, tall fescue, Turfgrasses.", "mime": "application/pdf"}, {"id": "ahs-3001", "words": "9050", "extension": ".pdf", "flesch": "66", "author": "Suzuki, M.; Jasinski, M.; Martinoia, E.; Nakabayashi, R.; Suzuki, M; Saito, K.; Shiratake, K.", "title": "Molecular cloning and characterization of ABCG/PDR-type ABC transporter in grape berry skin", "date": "2014", "keywords": "b c; c g; et al; grape; plant; resveratrol; size; transporters; v vp; vvabcg44", "summary": "In plants, full-size ABCG transporters have been reported to transport phytoalexins (Banasiak et al., 2013), abscisic acid (ABA) (Kang et al., 2010), strigolactone (Kretzschmar et al., 2012), and other compounds. Other close homologues transport different com- pounds; AtABCG40 (AAF71978) (Kang et al., 2010) and PaPDR1 (JQ292812) (Kretzschmar et al., 2012) transport ABA and strigolactone, respectively.", "mime": "application/pdf"}, {"id": "ahs-3002", "words": "4250", "extension": ".pdf", "flesch": "47", "author": "Ito-Inaba, Y.", "title": "Thermogenesis in skunk cabbage (Symplocarpus renifolius): New insights from the ultrastructure and gene expression profiles", "date": "2014", "keywords": "female; floral; inaba; ito; male; plant; renifolius; stage; thermogenesis", "summary": "ITO-INABA Y., MASUKO H., WATANABE M., INABA T., 2012 b - Isolation and gene expression analysis of a papain- type cysteine protease in thermogenic skunk cabbage (Symp- locarpus renifolius). In a well-known thermogenic plant, Sauromatum guttatum (voodoo lily), ultrastructural changes in the inflorescence during the transition from the pre- to post-thermogenic stages were extensively studied, and clear details of mitochondrial morphology were obtained (Sku- batz et al., 1993).", "mime": "application/pdf"}, {"id": "ahs-3003", "words": "2930", "extension": ".pdf", "flesch": "63", "author": "Matsumoto, T.; Yoshimatsu, K.; Kawahara, N.; Yamamoto, S.-I.; Niino, T.", "title": "Development of in vitro propagation by node culture and cryopreservation by V-Cryo-plate method for Perilla frutescens", "date": "2014", "keywords": "cryo; cryopreservation; perilla; plant; plate; shoot", "summary": "Fig. 2 - Procedure of V-Cryo-plate for cryopreservation of Perilla shoot tips. The cryo-plate with shoot tips was osmo-protected with LS solution and dehy- drated in PVS2 for 20 min at 25\u00b0C prior to immersion into liquid nitrogen.", "mime": "application/pdf"}, {"id": "ahs-3004", "words": "3906", "extension": ".pdf", "flesch": "57", "author": "Nishizawa, T.", "title": "Present status and future outlook of plant factories in Japan", "date": "2014", "keywords": "agriculture; coast; factory; farmland; fig; japan; light; plant; production", "summary": "Introduction Highly systematized greenhouses for plant growth are called plant factories (PF) in Japan, and they have been rapidly increasing in recent years (Kobayashi, 2010; Non- ami, 2010). Key words: environment control, fluorescent light, LED, lettuce, organic electroluminescence, plant factory, strawberry.", "mime": "application/pdf"}, {"id": "ahs-3005", "words": "3632", "extension": ".pdf", "flesch": "63", "author": "Joung, D.; Song, C.; Ikei, H.; Okuda, T.; Igarashi, M.; Koizumi, H.; Park, B.J.; Yamaguchi, T.; Takagaki, M.; Miyazaki, Y.", "title": "Physiological and psychological effects of olfactory stimulation with D-limonene", "date": "2014", "keywords": "et al; forest; limonene; miyazaki; olfactory; park; park et", "summary": "In subjective evaluations, it was reported that people feel more \u201ccomfortable,\u201d \u201csoothed,\u201d and \u201cnatu- ral\u201d when experiencing a forest environment (Park et al., 2007; Tsunetsugu et al., 2007; Park et al., 2008; Lee et al., 2009; Park et al., 2009; Lee et al., 2011; Park et al., 2011; Tsunetsugu et al., 2013; Lee et al., 2014), and that the \u201ctension-anxiety,\u201d \u201cdepression,\u201d \u201canger-hostility,\u201d \u201cfa- tigue,\u201d \u201cconfusion,\u201d and \u201cvigor\u201d of the mood state profile (McNair and Lorr, 1964; McNair et al., 1992; Yokoyama, 2005) improved (Li et al., 2008 a, b, c; Park et al., 2010; Lee et al., 2011; Park et al., 2011; Tsunetsugu et al., 2013; Lee et al., 2014). Park et al., 2008; Lee et al., 2009; Park et al., 2009; Park et al., 2010; Lee et al., 2011; Park et al., 2012; Tsunetsugu et al., 2013; Lee et al., 2014); de- crease cerebral blood flow in the prefrontal cortex (Park et al., 2007); and decrease salivary cortisol concentration of stress hormone (Tsunetsugu et al., 2007; Park et al., 2007; Park et al., 2008; Lee et al., 2009; Park et al., 2010).", "mime": "application/pdf"}, {"id": "ahs-3006", "words": "3130", "extension": ".pdf", "flesch": "62", "author": "Nagano, Y.; Inafuku-Teramoto, S.; Hashimoto, M.; Mimura, T.; Matsumoto, R.; Yamamoto, M.", "title": "Characterization of chloroplast matK sequences of Citrus tachibana and Citrus depressa, two indigenous species in Japan", "date": "2014", "keywords": "accessions; citrus; depressa; japan; shiikuwasha; tachibana; tanaka; tree", "summary": "The results indicate that C. tachibana, C. nippokoreana, and C. depressa accessions can be classified into two types: type A, all sixteen C. tachibana and six C. depressa; type B, eleven C. depressa and one C. nippokoreana. Compared to C. tachibana, C. depressa is considered to be adapted to a warmer climate; the former is usually used as an ornamental for gardens and its fruit is inedible.", "mime": "application/pdf"}, {"id": "ahs-3007", "words": "3264", "extension": ".pdf", "flesch": "56", "author": "Sawada, H.; Komatsu, S.; Tamaoki, M.; Kohno, Y.", "title": "Potential marker proteins for ozone-induced yield reduction in rice", "date": "2018", "keywords": "cpn-60; cultivars; exposure; grain; levels; ozone; ppb; rice; stress; yield", "summary": "Kubo et al. (2011) reported that during ozone stress, sakuranetin, a flavonone in the phytoalexin family, ap- pears to serve as a molecular marker of the stress response. Key words: grain yield, ozone stress, protein markers, 60-kDa chaperonin.", "mime": "application/pdf"}, {"id": "ahs-3008", "words": "4445", "extension": ".pdf", "flesch": "67", "author": "Tsukagoshi, S.; Kuroda, K.; Hohjo, M.; Ikegami, F.; Kunisaki, N.; Hanamura, T.; Yamada, K.; Hagiwara, T.", "title": "Evaluation of local eggplant cultivars in terms of the suitability as materials for 'Yakuzen' dishes", "date": "2014", "keywords": "acid; amino; content; cultivars; eggplant; fruit; japan; purple; yakuzen", "summary": "The polyphenol content was calculated from a Table 2 - Evaluation of the taste of eggplant cultivars by sensory test (z) Fruit shape Cultivar Aroma \u00a0 Softness Juiciness Sweetness Bitterness Astringency \u00a0 \u00a0 Good Grassy \u00a0 Pericarp Flesh \u00a0 \u00a0 \u00a0 & Acridity Small, Round De (y) 0 (x) 0 -1 0 0 0 1 1 Table 3 - Evaluation of the taste of eggplant cultivars by taste sensor (z) Fruit shape Cultivar Bitter-", "mime": "application/pdf"}, {"id": "ahs-3009", "words": "3876", "extension": ".pdf", "flesch": "59", "author": "Ikei, H.; Song, C.; Igarashi, M.; Namekawa, T.; Miyazaki, Y.", "title": "Physiological and psychological relaxing effects of visual stimulation with foliage plants in high school students", "date": "2014", "keywords": "activity; condition; control; dracaena; min; plants; rate", "summary": "Introduction Recent studies have focused on the physiological relax- ing effects of the natural environment (Park et al., 2009; 2012). It has been reported that staying in a forest environ- ment enhances parasympathetic nervous activity (Park et al., 2012; Tsunetsugu et al., 2013), suppresses sympathetic nervous activity (Park et al., 2012; Tsunetsugu et al., 2013; Lee et al., 2014), decreases blood pressure and pulse rate (Park and Mattson, 2009; Park et al., 2012), and decreases cortisol concentration (Park et al., 2012).", "mime": "application/pdf"}, {"id": "ahs-3010", "words": "5981", "extension": ".pdf", "flesch": "65", "author": "Yamamoto, M.", "title": "Progress on studies for seedless breeding of citrus in Japan", "date": "2014", "keywords": "breeding; citrus; cultivars; hort; japan; sci; seedless; sterility", "summary": "MATSUMOTO R., OKUDAI N., OIYAMA I., TAKAHARA T., YAMAMOTO M., ASADA K., ISHIUCHI D., MURATA H., 1991 - New citrus cultivar \u2018Tsunokaori\u2019. OKUDAI N., MATSUMOTO R., OIYAMA I., TAKAHARA T., ASADA K., YAMAMOTO M., ISHIUCHI D., MURATA H., 1991 - New citrus cultivar \u2018Seiho\u2019.", "mime": "application/pdf"}, {"id": "ahs-3011", "words": "7187", "extension": ".pdf", "flesch": "67", "author": "Watanabe, G.; Ishibashi, Y.; Iwaya-Inoue, M.", "title": "Ontogenetic changes of the water status and accumulated soluble compounds in developing and ripening mume (Prunus mume) fruit measured by 1H-NMR analysis", "date": "2015", "keywords": "changes; fig; fruit; mume; nmr; pericarp; plant; relaxation; ripening; seed; stage; tissues; values; water", "summary": "Rinshu) fruit tissues were examined by measuring the physical states of cell-associated water in the fruit tissues with developing and ripening using 1H-NMR spec- troscopy. 3. Results Histochemical characteristics of fruit tissues with ripening Mume fruit are characterized by four stages (Fig.", "mime": "application/pdf"}, {"id": "ahs-3012", "words": "2514", "extension": ".pdf", "flesch": "54", "author": "Hosseinpour, A.; Seifi, Esmaeil; Javadi, D.; Ramezanpour, Seyedeh", "title": "A preliminary study on pollen compatibility of some hazelnut cultivars in Iran", "date": "2015", "keywords": "cultivars; hazelnut; pashmine; pollen; pollination; set", "summary": "Most hazelnut culti- vars are self-incompatible; self- and cross-incompatibili- ty in hazelnut cultivars are widespread phenomena which are of the sporophytic type (Germain, 1994). Pollen incompatibility is a major problem among hazelnut cultivars and can result in considerable crop loss in hazelnut orchards.", "mime": "application/pdf"}, {"id": "ahs-3013", "words": "4473", "extension": ".pdf", "flesch": "67", "author": "Nakamura, I.; Takahashi, H.; Ohta, S.; Moriizumi, T.; Hanashiro, Y.; Sato, Y.-I.; Mill, M.", "title": "Origin of Prunus x yedoenins 'Somei-yoshino' based on sequence analysis of PolA1 gene", "date": "2015", "keywords": "dna; exon; intron; pendula; pola1; prunus; sequences; somei; species; yoshino", "summary": "To reveal the origin of \u2018Somei-yoshino,\u2019 we analyzed sequences of intron 19 and exon 20 of PolA1, a single-copy nuclear gene encoding the largest subunit of RNA polymerase I. One of two exon 20 sequences found in \u2018Somei-yoshino\u2019 was the same as that of P. pendula, whereas the other sequence was shared with several taxa in seven wild species, including P. jamasakura and P. lannesiana. A to- tal of 42 individuals of nine wild species native to Japan (Table 1) were analyzed; P. apetala (three individuals), P. incisa (four), P. nipponica (four), P. jamasakura (eight), P. sargentii (two), P. verecunda (four), P. lannesiana (three), P. maximowiczii (three), and P. pendula (six), and three alien wild species, P. campanulata (two), P. cerasoides (two), and P. pseudo-cerasus (one) (Table 1).", "mime": "application/pdf"}, {"id": "ahs-3014", "words": "4044", "extension": ".pdf", "flesch": "53", "author": "La Zazzera, M.; Amodio, Maria Luisa; Colelli, Giancarlo", "title": "Designing a modified atmosphere packaging (MAP) for fresh-cut artichokes", "date": "2015", "keywords": "acid; atmosphere; cut; micro; packaging; pla; quality; samples", "summary": "Finally, artichokes were cut into quarters and closed in active modified atmosphere packaging (MAP) with the initial gas composition of 5% O 2 +10% CO 2 using a Tecnovac packaging machine (Mod. For samples stored in PP+PA MF2 and PP MF2 gas evolution showed the same trend: the O 2 level decreased in the first hours, due to the high respiration rate of cut artichokes, reaching a steady state at 12% and 10% respectively for PP+PA MF2 and PP MF2; CO 2 concentration increased slightly for both films, reaching a steady state at 11.5% for PP+PA MF2 and 12.5 for PP MF2.", "mime": "application/pdf"}, {"id": "ahs-3015", "words": "4883", "extension": ".pdf", "flesch": "59", "author": "Bellincontro, A.; Valentini, Massimiliano; Forniti, Roberto; Mencarelli, Fabio", "title": "Innovative application of NIR-AOTF and MRI to study water behaviour in cut flower", "date": "2015", "keywords": "basal; content; cut; dry; flowers; loss; mri; nir; water", "summary": "Significant correlation results for weight loss and water content ( R2 in calibration = 0.98 for estimated % of water loss and 0.96 for % of water content; R2cv MRI measure- ments were performed on flower sections at time 0, after 3 and 12 days.", "mime": "application/pdf"}, {"id": "ahs-3016", "words": "2588", "extension": ".pdf", "flesch": "58", "author": "Arabi, M.I.E.; Al-Shehadah, E.; Jawhar, M.", "title": "A simple approach to assess common root rot severity incidence data in wheat", "date": "2015", "keywords": "crr; incidence; rot; severity; wheat", "summary": "However, CRR severity increased linearly as incidence increased in both Triticum durum and T. aestivum wheat. In this extreme situation, I was equal to S for wheat CRR reaction.", "mime": "application/pdf"}, {"id": "ahs-3017", "words": "2997", "extension": ".pdf", "flesch": "56", "author": "Noriyasu, A.; Furukawa, H.; Kikuchi, A.; Takaichi, H.; Bouteau, Fran\u00e7ois; Li, X.; Nishihama, Syouhei; Yoshizuka, K.; Kawano, Tomonori", "title": "Use of liquefied cold temperature dimethyl ether for extraction of pigments from fresh vegetable tissues", "date": "2015", "keywords": "dme; extraction; fig; peel; pigments; spinach; squash", "summary": "Recently, an industrial use of liquefied DME was reported for rapid removal of water from sub-bituminous coal without any heating process (Kanda and Makino, 2010). This approach encourages us to testify the performance of liquefied DME in de-watering of biomaterials including watery horticul- tural crops.", "mime": "application/pdf"}, {"id": "ahs-3018", "words": "4672", "extension": ".pdf", "flesch": "59", "author": "Seppoloni, Irene; Staglian\u00f2, Nicolina; Cecchi, S.; Argenti, Giovanni", "title": "Performance of warm-season turfgrasses in an area of central Italy", "date": "2015", "keywords": "cynodon; dormancy; italy; paspalum; quality; season; species; turf; turfgrass; winter", "summary": "Key words: Bermudagrass, ground cover, growing season, turf quality, weeds. C. dactylon demonstrated good and constant soil coverage and it was more satisfactory than other species, whereas Z. japonica displayed the typical behavior of this species, attaining optimal values at the end of the growing season of the second year (S5).", "mime": "application/pdf"}, {"id": "ahs-3019", "words": "4156", "extension": ".pdf", "flesch": "54", "author": "Kawano, Tomonori", "title": "Pteridophytes as active components in gardening, agricultural and horticultural ecosystems in Japan", "date": "2015", "keywords": "equisetum; ferns; fig; gardening; gardens; japanese; kawano; plants; pteris; species", "summary": "Japanese names ending with -goke or -koke are conventionally given to moss spe- cies, despite the fact that these species are taxonomical members of ferns. (Psilotaceae; Japanese name: Matsubaran) belonging to the class Psi- lotopsida has long been utilized in Japanese gardening landscapes.", "mime": "application/pdf"}, {"id": "ahs-3020", "words": "2644", "extension": ".pdf", "flesch": "56", "author": "Galgano, Fernanda; Caruso, M.C.; Condelli, N.; Stassano, S; Favati, F.", "title": "Application of ozone in fresh-cut iceberg lettuce refrigeration", "date": "2015", "keywords": "control; cut; food; lettuce; ozone; storage; treatment", "summary": "Several studies have focused on the effect of ozone treatment on the safety and quality of iceberg lettuce (Rico et al., 2006; Yuk et al., 2006; Hassenberg et al., 2007). A con- trol sample was stored at 4\u00b0C without ozone treatment.", "mime": "application/pdf"}, {"id": "ahs-3021", "words": "6849", "extension": ".pdf", "flesch": "59", "author": "Vanoli, Maristella; Grassi, M.; Buccheri, M.; Rizzolo, A.", "title": "Influence of edible coating on postharvest physiology ana quality of honeydew melon fruit (Cucumis melo L. inodorus)", "date": "2015", "keywords": "coating; control; days; ethane; ethylene; food; fruit; levels; loss; melons; quality; storage", "summary": "69 Vanoli et al., Edible coatings and quality of melon fruit All three fermentative metabolites dramatically increased in F1 fruit already after 6 days at 13\u00b0C (Fig. 1), increased further up to d9, showing a slight but not significant increase up to d13, with the exception of acetaldehyde which did not change from d9 to d13. 71 Vanoli et al., Edible coatings and quality of melon fruit The quality of fruits and vegetables depends on their internal O 2 and CO 2 concentrations which in turn are af- fected by the environmental concentrations of these gases (Hagenmaier, 2005).", "mime": "application/pdf"}, {"id": "ahs-3022", "words": "6632", "extension": ".pdf", "flesch": "54", "author": "Laus, M.N.; Soccio, M.; Giovannini, D.; Caboni, E.; Quacquarelli, I.; Maltoni, M.L.; Scossa, F.; Condello, E.; Pastore, D.", "title": "Assessment of antioxidant activity of carotenoid-enriched extracts from peach fruits using the new LOX/RNO method", "date": "2015", "keywords": "absorbance; antioxidant; bleaching; carotenoid; et al; extract; lox; method; pastore; peach; rno; trolox; white", "summary": "Since carotenoid extracts reconstituted in sodium borate buffer containing 0.4 \u00b5L Tween 80/\u00b5g carotenoids were analyzed, all LOX/RNO measurements were carried out in the presence of a constant volume (0.5 \u00b5L/mL) of Tween 80 in the assay mixture. The LOX/RNO reaction was measured both in the absence (control) and presence of carotenoid extract (or \u00b1-6-hydroxy-2,5,7,8- tetramethylchromane-2-carboxylic acid, Trolox, used as a standard antioxidant).", "mime": "application/pdf"}, {"id": "ahs-3023", "words": "9758", "extension": ".pdf", "flesch": "61", "author": "Vanoli, M.; Grassi, M.; Bianchi, G.; Buccheri, M.; Rizzolo, Anna", "title": "\u2018Conference\u2019 and \u2018Abb\u00e9 F\u00e9tel\u2019 pears treated with 1-methylcyclopropene: physiological and quality implications of initial low oxygen stress and controlled atmosphere storage", "date": "2015", "keywords": "abb\u00e9; abb\u00e9 f\u00e9tel; conference; control; ctol; fruit; f\u00e9tel; life; mcp; pears; scald; shelf; storage; weeks", "summary": "Food Chem., 55: 5267-5276 VANOLI M., ECCHER ZERBINI P., GRASSI M., RIZZOLO A., 2010 a - Ethylene production and quality in 1-methylcyclo- propene treated Abb\u00e9 F\u00e9tel pears after storage in dynamically controlled atmosphere. ZOFFOLI J.P., 1994. - Pear fruit scald: a physiologic disorder involving \u03b1-farnesene, conjugated trienes and \u03b1-tocopherol.", "mime": "application/pdf"}, {"id": "ahs-3024", "words": "4201", "extension": ".pdf", "flesch": "59", "author": "Strano, Maria Concetta; Di Silvestro, S.; Coniglione, M.; Magnano San Lio, R.", "title": "Decay control of cold stored Citrus clementina Hort. ex Tan. fruit by pre- and postharvest application of potassium phosphite", "date": "2015", "keywords": "citrus; control; decay; fruit; mould; phosphite; postharvest; potassium; treatments; water", "summary": "Potassium phosphite treatments, before harvest and in pre-postharvest combination, significantly reduced chilling injury and aging with respect to water control. At commercial maturity, fruits were harvested from treated plants and placed into plastic boxes (one box per plant), each containing 50 fruits, with the exception of potassium phosphite treatments (two boxes per plant), in order to use the extra fruit for the postharvest treatment.", "mime": "application/pdf"}, {"id": "ahs-3025", "words": "3813", "extension": ".pdf", "flesch": "63", "author": "Bulgari, Roberta; Negri, M.; Ferrante, A.", "title": "Evaluation of postharvest storage and treatments in cut ruscus foliage", "date": "2015", "keywords": "branches; chlorophyll; cut; foliage; glycerol; life; storage; tdz; vase", "summary": "The vase life of cut foliage is usually longer than cut flowers, but it may become shorter when they are stored for long periods. Storage methods, wet or dry, affect the vase life of cut foliage (Ferrante et al., 2002 a) and play a crucial role for preserving quality: it is impor- tant, in particular, to delay the symptoms of leaf senes- cence considering that the intensity of leaf color is the most important quality parameter (Pacifici et al., 2007) and closely associated with the marketability of orna- mental cut foliage.", "mime": "application/pdf"}, {"id": "ahs-3026", "words": "5217", "extension": ".pdf", "flesch": "64", "author": "Nuzzi, M.; Grassi, M.; Sartori, A.; Terlizzi, M.; Buccheri, Marina", "title": "Postharvest changes in quality characteristics, antioxidant activity and bioactive compounds of peach and nectarine cultivars [Prunus persica (L.) Batsch]", "date": "2015", "keywords": "color; cultivars; ethanol; flesh; life; nectarine; peach; peaches; shelf", "summary": "Other authors also showed a significant increase in TAA in several nectarine cultivars after refrigerated storage (seven days at 2\u00b0C) while the increase was not significant or there was a decrease in peaches (Di Vaio et al., 2001, 2008). CRISOSTO C.H., CRISOSTO G.M., 2005 - Relationship be- tween ripe soluble solids concentration (RSSC) and consum- er acceptance of high and low acid melting flesh peach and nectarine (Prunus persica (L.) Batsch) cultivars. - Posthar- vest Biol.", "mime": "application/pdf"}, {"id": "ahs-3027", "words": "3407", "extension": ".pdf", "flesch": "65", "author": "Caser, M.; Seglie, L.; Bizioli, R.; Scariot, Valentina", "title": "Ethylene and the postharvest performance of cut camellia flowering branches", "date": "2015", "keywords": "branches; camellia; cut; ethylene; flower; mcp; postharvest", "summary": "For this reason the use of camellia as cut flower has been restricted to situations where longevity is not especially important, even if the deep and bright green foliage with a high num- ber of flower buds make camellias potentially appreciated also as cut flowering branches. In the 1950\u2019s considerable efforts were made to find treatments to extend camellia cut flower vase life by Cothran (1958).", "mime": "application/pdf"}, {"id": "ahs-3028", "words": "2765", "extension": ".pdf", "flesch": "58", "author": "Capodilupo, M.; Stipic, M.; Venezia, Accursio", "title": "Soilless cultivation of cherry tomato with gutter subirrigationn and reused substrate", "date": "2015", "keywords": "soilless; substrate; tomato; venezia", "summary": "Regarding aqueous extracts, pH values were lower in the upper layer: in pots with fresh substrate pH was 6.9 for the bottom and 5.9 for the top layer; in reused substrate, the average value was 6.5 for the bottom and 6.3 for the top. The results obtained in this experiment reveal no significant dif- ferences in production and fruit quality between plants grown on fresh substrate and those grown on reused substrate (marketable yield was 5.4 kg m-2 vs 5.3 kg m-2, respectively).", "mime": "application/pdf"}, {"id": "ahs-3029", "words": "5065", "extension": ".pdf", "flesch": "57", "author": "Molinu, Maria Giovanna; Dore, A.; D'hallewin, G.", "title": "Effect of short heat treatments with a sodium bicarbonate solution on storability of the yellow germoplasm plum 'Meloni'", "date": "2015", "keywords": "fruit; sbc; smp; storage; treatments; water", "summary": "References CHENA Z., ZHUB C., 2011 - Combined effects of aqueous chlorine dioxide and ultrasonic treatments on postharvest storage quality of plum fruit (Prunus salicina L.). Weight loss and appearance Weight loss during storage and SMP ranged between 2 and 4% for control fruit.", "mime": "application/pdf"}, {"id": "ahs-3030", "words": "5523", "extension": ".pdf", "flesch": "60", "author": "Palma, Amedeo; Schirra, Mario; D'Aquino, S.", "title": "Effect of film packaging and storage temperature on physical and chemical changes in fresh-cut green asparagus", "date": "2015", "keywords": "asparagus; changes; days; film; packaging; samples; spears; storage", "summary": "Fig. 1 - Influence of film packaging (Film 1, Omnifilm PVC film; Film 2, Bolphane BX polyolefinic film) and storage conditions on in- package CO 2 (A), O 2 (B) and ethylene levels (C). A slight increase in TSS Fig. 3 - Effect of film packaging (Control, un-packaged; Film 1, Omnifilm PVC film; Film 2, Bolphane BX polyolefinic film) and storage conditions (2\u00b0C and 10\u00b0C) on cutting force (F max) and force displacement (L at F max) in green asparagus during 21 days of storage at 7.5 cm (A and C) and 15 cm (B and D) of the tip.", "mime": "application/pdf"}, {"id": "ahs-3031", "words": "3177", "extension": ".pdf", "flesch": "60", "author": "D'Aquino, Salvatore; Palma, Amedeo; Satta, D.; De Pau, L.; Schirra, Mario", "title": "Influence of azoxystrobin dip treatments on postharvest decay of second-crop fig (Ficus carica) fruits from Sardinian germoplasm", "date": "2015", "keywords": "azo; days; decay; fruit; treatments", "summary": "Key words: azoxystrobin, cold storage, fig fruit, fig decay, postharvest treatment. Proper postharvest technologies, such as precooling, film-wrapping, and conditioning in modified atmosphere environment are shown to extend the keeping quality of fig fruit (Turk, 1989; Piga et al., 1995, 1998; D\u2019Aquino et al., 1998, 2003).", "mime": "application/pdf"}, {"id": "ahs-3032", "words": "4396", "extension": ".pdf", "flesch": "41", "author": "Bancarella, S.; Altamore, Luca; Valdesi, V.; Chironi, S.; Ingrassia, M.", "title": "Importance of food labeling as a mean of information and traceability according to consumers", "date": "2015", "keywords": "attributes; consumer; data; food; information; labels; product; profile; quality; scaling; traceability", "summary": "Therefore the objective of this study is: (1) categorize profiles of consumers according to the importance given to various information patterns shown on food labeling; (2) discover consumer behaviors when making a purchasing decision based on food information they require in the label; (3) discover consumer profiles with re- gards to food quality and the use QR Code to acquire further information about food products. The purpose of this study was to determine what infor- mation, of that possibly provided on the labels of food prod- ucts, consumers are particularly interested in knowing and what information consumers are looking for as added value as a guarantee of food quality and safety, e.g. traceability, absence of GMO, organic production, etc.", "mime": "application/pdf"}, {"id": "ahs-3033", "words": "1934", "extension": ".pdf", "flesch": "61", "author": "Liguori, G.; Sortino, Giuseppe; De Pasquale, C.; Inglese, Paolo", "title": "Effects of modified atmosphere packaging on quality parameters of minimally processed table grape during cold storage", "date": "2015", "keywords": "days; life; red; storage; table", "summary": "Table grape is a non-climacteric fruit with a low rate of physiological activity that is very sensitive to water loss and fungal infection (Botrytis cinerea) during postharvest handling and cold storage. TSS content did not significantly change (P<0.05) in \u2018Red Globe\u2019 table grapes wrapped with PP (passive MAP) at the end of the shelf-life (Fig. 1B), while a significant in- crease (P<0.05) in TSS was found in table grapes packaged in both active PET1 and PET2 (active MAP), with an in- crease of 4% and 6% at the end of the shelf-life (Fig. 1B).", "mime": "application/pdf"}, {"id": "ahs-3034", "words": "4593", "extension": ".pdf", "flesch": "62", "author": "Kakuei, F.; Salehi, H.", "title": "Factors affecting in vitro propagation of Dracaena sanderiana Sander ex Mast. cultivars. I. Sterilization, explant browning, and shoot proliferation", "date": "2015", "keywords": "explants; l-1; mg l-1; naa", "summary": "Shoot proliferation rate in horizontal and vertical ex- plants: variegated cultivar Table 7 shows the difference between the proliferation rate of horizontally and vertically cultured explants of D. sanderiana \u2018Variegated\u2019 after 60 days of deployment with the concentrations of 1, 2, 3, 4 and 5 mg l-1 BA, and 0.25 and 0.5 mg l-1 NAA. Fig. 1 - Rate of shoot proliferation in Dracaena \u2018Green\u2019 cultured horizon- tally on 1/2 MS medium with mg l-1 BA and 0.25 mg l-1 NAA- 40 days after culture (left) and 60 days after culture (right).", "mime": "application/pdf"}, {"id": "ahs-3035", "words": "3137", "extension": ".pdf", "flesch": "68", "author": "Kakuei, F.; Salehi, H.", "title": "Factors affecting in vitro propagation of Dracaena sanderiana Sander ex Mast. cultivars. II. MS salt strengths, subculturing times, rooting and acclimatization", "date": "2015", "keywords": "l-1; length; number", "summary": "The current status of plant tissue culture, pp. 1-22. - Plant tissue culture: Applications and limitation.", "mime": "application/pdf"}, {"id": "ahs-3036", "words": "3670", "extension": ".pdf", "flesch": "56", "author": "Jangali Baygi, M.; Alizadeh, M.; Ghaderifar, F.; Sharifani, M.", "title": "Dormancy removal in pistachio nut: Influences of Hydrogen Cyanamid (Dormex\u00ae) as compared to ordinary seed chemical pre-treatments", "date": "2015", "keywords": "dormancy; germination; hcn; kno; pistachio; seed", "summary": "Abstract: Seed germination is considered an important phenological stage of plant growth during which the viable, non- dormant embryos develop into seedlings under favorable conditions. In the present study, efficacy of Hydrogen Cyanamid (HCN, Dormex\u00ae) on seed germination of two cultivated pistachio varieties (Abasali, Shahpasand) were studied and the results were compared to ordinary ingredients, namely gibberellic acid (GA3) and KNO3.", "mime": "application/pdf"}, {"id": "ahs-3037", "words": "2213", "extension": ".pdf", "flesch": "55", "author": "Bakri, Y; Akeed, Y.; Ouda, R.; Al-Domani, Th.; Arabi, M.I.E.; Jawhar, M.", "title": "Lipase production by Fusarium culmorum in solid state fermentation", "date": "2015", "keywords": "activity; culmorum; enzyme; fermentation; lipase; production", "summary": "Since the effect of carbon sources on lipase production by the fungus F. culmorum has not been investigated so far, a study toward this aim was con- ducted on the new F. culmorum strain SY6 cultured under solid state fermentation (SSF). In the present study, lipase production by Fusarium culmorum SY6 was investigated under solid-state fermentation (SSF).", "mime": "application/pdf"}, {"id": "ahs-3038", "words": "5007", "extension": ".pdf", "flesch": "55", "author": "Rinaldi, L.M.R.; Leva, Annarita; D'Acqui, L.P.", "title": "Influence of seed provenance on the propagation of Picea abies (L.) Karst", "date": "2015", "keywords": "abies; embryos; emergence; fiemme; growth; medium; picea; provenance; seedlings; seeds; substrate; val", "summary": "At provenance level, strong relationships are gener- Influence of seed provenance on the propagation of Picea abies (L.) Karst L.M.R. Rinaldi \u00b9, A. Leva \u00b9 (*), L.P. D\u2019Acqui \u00b2 \u00b9 Istituto per la Valorizzazione del Legno e delle Specie Arboree, Consiglio Nazionale delle Ricerche, Via Madonna del Piano, 10, 50019 Sesto Fiorentino (FI), Italy. Therefore, the aim of this study was to assess the in- fluence of seed provenance on emergence and seedling growth of Picea and, as an ancillary purpose, to evaluate if an increase of the amount of organic matter (dust manure) in the growing media compared to that commonly used can improve or affect the emergence and seedling growth of Picea seeds of different provenance.", "mime": "application/pdf"}, {"id": "ahs-3039", "words": "4991", "extension": ".pdf", "flesch": "53", "author": "Ranjbar, A.; Ahmadi, N.", "title": "Effects of 1-MCP and ethylene on antioxidant enzymes activity and postharvest physio-biochemical characterics of cut carnation flower cv. Fortune", "date": "2015", "keywords": "activity; carnation; cut; enzyme; ethylene; flowers; life; mcp; postharvest; senescence; superoxide; vase", "summary": "The effect of 1-MCP on protecting chlorophyll content is a result of ethylene action and consequently in- hibition of ethylene biosynthesis, which is considered the Fig. In accordance with the present results, 1-MCP treatment at all concentrations decreased ethylene biosynthesis which was followed by reduction of chlorophyll destruction com- pared to control plants (Asil et al., 2013) (Fig. 3).", "mime": "application/pdf"}, {"id": "ahs-3040", "words": "7040", "extension": ".pdf", "flesch": "58", "author": "Golubkina, N.A.; Nadezhkin, S.M.; Agafonov, A.F.; Kosheleva, O.V.; Molchanova, A.V.; Russo, Girolamo; Cuciniello, A.; Caruso, Gianluca", "title": "Seed oil content, fatty acids composition and antioxidant properties as affected by genotype in Allium cepa L. and perennial onion species", "date": "2015", "keywords": "acids; allium; cepa; content; fatty; oil; onion; seeds", "summary": "In this respect, the inhibitory effect of Seed oil content, fatty acids composition and antioxidant properties as affected by genotype in Allium cepa L. and perennial onion species N.A. Golubkina1 (*), S.M. Nadezhkin1, A.F. Agafonov1, O.V. Kosheleva2, A.V. Molchanova1, G. Russo3, A. Cuciniello3, G. Caruso3 1 Agrochemical research center, All-Russian institute of vegetable breeding and seeds production, Select- sionnaya 14, 143080 Moscow region, Odintsovo district, VNIISSOK, Russia. 2 Laboratory of vitamins and mineral compounds, Institute of nutrition, Ustinsky pr. 2/14, 119480 Mos- cow, Russia. 3 Department of Agricultural Sciences, Naples University Federico II, via Universit\u00e0 100, 80055 Portici (NA), Italy. 201 Golubkina et al., Seed oil content as affected by genotype in onion Selenium concentration in onion seeds varied greatly (108-476 and 112-261 \u00b5g\u00b7kg-1 in perennial onions and Al- lium cepa respectively), giving the highest coefficient of variation (25% in A. cepa and 37% in perennial onions); the lowest CV was recorded for the oil content (9.2 and 11.2% in A. cepa and in perennial species seeds respec- tively).", "mime": "application/pdf"}, {"id": "ahs-3041", "words": "3995", "extension": ".pdf", "flesch": "59", "author": "Luvisi, Andrea; Rinaldelli, Enrico; Panattoni, A.", "title": "Effects of extracellular K+ on grapevine membrane potential as influenced by the antiviral mycophenolic acid. An electrophysiological study", "date": "2015", "keywords": "membrane; mpa; panattoni; potential", "summary": "MPA interference was concentration-dependent and at the lower concentration MPA did not interfere with the effect on membrane potential induced by K+. In terms of metabolic dependence of MPA action in plant cells, antiviral drug translocation across membranes was linked to the free energy available in a proton elec- trochemical potential difference (Luvisi et al., 2012 b).", "mime": "application/pdf"}, {"id": "ahs-3042", "words": "3080", "extension": ".pdf", "flesch": "53", "author": "Lavee, Shimon", "title": "Alternate bearing in olive initiated by abiotic induction leading to biotic responses", "date": "2015", "keywords": "bearing; fig; fruit; lavee; olive; reproductive", "summary": "As olive fruit is initi- ated and develops from buds on shoots grown during the previous year, a reduction of vegetative shoot elongation and inhibition of lateral shoot out growth due to fruit de- velopment has a major effect on the general number of buds and thus on the potential reproductive buds in par- ticular. Abstract: Alternate bearing of olive trees is one of the most troublesome characteristics of this commodity, impacting its economy due to labor distribution, fruit and oil availability, oil mill capacity and marketing.", "mime": "application/pdf"}, {"id": "ahs-3043", "words": "3270", "extension": ".pdf", "flesch": "58", "author": "Iwase, J.; Sato, Y.; Comparini, Diego; Masi, Elisa; Mancuso, Stefano; Kawano, Tomonori", "title": "Non-invasive acoustic sensing of tuberous roots of sweet potato (Ipomoea batatas) growing belowground", "date": "2015", "keywords": "fig; frequency; plant; potato; roots; sand; sensing; signal; sound; vegetables", "summary": "In order to introduce such root veg- etables in \u201cplant factories\u201d, it is necessary to monitor the belowground properties and processes where plant roots take place, mainly spatial occupation by the growing root system and changes in water, salts, and other elements that can influence productivity and functioning of the soil ecosystem. (2012 a, b) who suggested that the growing tips of plant roots could be attracted by acoustic signals with specific spectra raging between 200 and 400 Hz, if plant roots were continuously exposed to the sound stimulus.", "mime": "application/pdf"}, {"id": "ahs-3044", "words": "6318", "extension": ".pdf", "flesch": "63", "author": "Sivakumar, R.; Srividhya, S.", "title": "Impact of drought on flowering, yield and quality parameters in diverse genotypes of tomato (Solanum lycopersicum L.)", "date": "2016", "keywords": "content; cpe; cpe ratio; drought; fruit; genotypes; plant; stress; water; yield", "summary": "From perusal of the results obtained for SPAD value, soluble protein, SPS activity, fruit characters, lycopene, ascorbic acid, TSS and yield, it can be inferred that genotypes LE 114, LE 57, LE 118, and LE 27 performed better under drought conditions and can be categorized as drought tolerant genotypes compared to genotypes LE 1 and LE 125, drought susceptible ones. Comparing the irrigation treatments, plants that received 1.0 IW/CPE ratio recorded higher fruit yield than 0.5 IW/CPE ratio (Fig. 2).", "mime": "application/pdf"}, {"id": "ahs-3045", "words": "5220", "extension": ".pdf", "flesch": "59", "author": "Saleh, B.", "title": "DNA changes in cotton (Gossypium hirsutum L.) under salt stress as revealed by RAPD marker", "date": "2016", "keywords": "bands; changes; cotton; dna; nacl; nd nd; rapd; salt; stress; varieties", "summary": "DNA changes induced by NaCl treatment using RAPD marker as described by loss or appearance of new bands (number and size) under salt stress compared to their respective controls for each variety separately Primer name N78 DE22 DP50 A118 Total poly- morphic bandsC T C T C T C T OPA02 9 8 9 9 \u208b (4) 400, 650, 1800 & 2500 (3) 650, 800 & 2500 (2) 1800 & 2500 (2) 1800 & 2500 16 \u208a (2) 600 & 1500 (3) 500, 600 & 900 ND ND OPA04 3 3 3 3 \u208b ND ND ND ND 5 \u208a (3) 400, 500 & 1000 (2) 400 & 500 ND ND OPB05 5 5 4 5 \u208b (4) 450, 650, 1000 & 2000 (3) 450, 1000 & 2000 (1) 900 (1) 2000 14 \u208a (3) 500, 700 & 1100 (2) 500 & 1100 ND ND OPB17 7 9 8 8 \u208b (5) 600, 700, 1100, 1200 & 1800 (4) 350, 800, 1500 & 1800 ND (5) 400, 600, 800, 1000 & 1800 20 \u208a (2) 400 & 650 (2) 700 & 1100 ND (2) 450 & 750 OPC08 4 5 5 4 \u208b (2) 1850 & 1900 (1) 1200 (1) 1850 ND 10 \u208a (2) 300 & 900 (2) 1350 & 1900 ND (2) 1850 & 1900 OPC13 6 6 5 5 \u208b (1) 1000 (2) 500 & 1000 ND ND 12 \u208a (5) 300, 800, 900, 1100 & 1350 (4) 300, 1100, 1350 & 1500 ND ND OPD08 4 3 4 3 \u208b (2) 450 & 700 (2) 450 & 750 (1) 900 (2) 450 & 800 15 \u208a (2) 650 & 1350 (4) 500, 600, 800 & 1350 (1) 800 (1) 600 OPD20 6 4 2 2 \u208b (4) 650, 850, 1100 & 1850 (3) 700, 900 & 1350 (1) 800 (1) 300 13 \u208a (1) 1350 (1) 800 (1) 300 (1) 200 OPE07 8 8 8 8 \u208b (5) 1000, 1300, 1800, 2300 & 3000 (1) 1800 ND ND 7 \u208a (1) 1100 ND ND ND OPE15 5 4 6 6 \u208b (1) 200 (2) 800 & 1800 ND ND 8 \u208a (4) 800,1300, 1500 & 1800 (1)1500 ND ND OPG11 3 3 3 3 \u208b ND ND ND ND 2 \u208a (1) 600 (1) 600 ND ND OPJ01 7 6 7 7 \u208b (5) 400, 600, 850, 1200 & 2000 (3) 400, 600 & 850 ND (2) 600 & 2000 20 \u208a (4) 350, 500, 950 & 1800 (4) 350, 500, 950 & 1800 ND (2) 500 & 800 OPJ07 3 4 2 3 \u208b (3) 500, 800 & 1600 (4) 300, 500, 700 & 1600 (2) 550 & 1350 (1) 1100 21 \u208a (3) 700, 900 & 1200 (3) 550, 1000 & 1200 (2) 450 & 1600 (3) 450, 550 & 650 to be continuedT(-) loss bands, (+) gains bands, (ND) no differences. Moreover, salt stress causes nuclear deforma- tion and subsequent nuclear degradation (Katsuhara and Kawaski, 1996).", "mime": "application/pdf"}, {"id": "ahs-3046", "words": "4791", "extension": ".pdf", "flesch": "60", "author": "Giro, A.; Ciappellano, S.; Ferrante, A.", "title": "Vegetable production using a simplified hydroponics system inside City of Dead (Cairo)", "date": "2016", "keywords": "areas; fig; food; fruits; plants; production; security; substrate; tomato", "summary": "COHEN M.J., GARRETT J.L., 2010 - The food price crisis and urban food (in) security. Growing cities, growing food: Urban agriculture on the policy agenda.", "mime": "application/pdf"}, {"id": "ahs-3047", "words": "4185", "extension": ".pdf", "flesch": "55", "author": "Radice, S.; Arena, M.", "title": "Characterization and evaluation of Berberis microphylla G. Forst pollen grains", "date": "2016", "keywords": "arena; berberis; fig; genotypes; germination; grains; microphylla; pollen; species; viability", "summary": "Characterization of pollen grains is an important step for programs of genetic resource conservation and improvement, complementing basic studies of biological data that characterize genotypes (de Castro Nunes et al., 2012). The objective of this research was to describe the morphology and anatomy of pollen grains of Berberis microphylla G. Forst genotypes growing spontaneously on the island of Tierra del Fuego (Argentina), and evaluate their vitality and germination.", "mime": "application/pdf"}, {"id": "ahs-3048", "words": "5184", "extension": ".pdf", "flesch": "52", "author": "Shahsavar, A.R.; Refahi, A.; Zarei, M.; Aslmoshtaghi, E.", "title": "Analysis of the effects of Glomus etunicatum fungi and Pseudomonas fluorescence bacteria symbiosis on some morphological and physiological characteristics of Mexican lime (Citrus aurantifolia L.) under drought stress conditions", "date": "2016", "keywords": "bacteria; drought; etunicatum; fungi; irrigation; leaf; plant; pseudomonas; stress; water", "summary": "Inoculation with Pseudomonas species, led to moderation of drought stress effects, improvement of plant growth and increase of proline, soluble sugars and amino acids production, explaining their effectiveness in absorbing water and nutrients from the soil (Wu et al., 2008). Sci., 2016 30(1): 39-45 DOI: 10.13128/ahs-18700 Analysis of the effects of Glomus etunicatum fungi and Pseudomonas fluorescence bacteria symbiosis on some morphological and physiological characteristics of Mexican lime (Citrus aurantifolia L.) under drought stress conditions A.R. Shahsavar 1 (*), A. Refahi 1, M. Zarei 2, E. Aslmoshtaghi 1 1 Department of Horticultural Science, College of Agriculture, Shiraz University, Shiraz, Iran. 2 Department of Soil Science, College of Agriculture, Shiraz University, Shiraz, Iran.", "mime": "application/pdf"}, {"id": "ahs-3049", "words": "3994", "extension": ".pdf", "flesch": "61", "author": "Adam, A.; Idris, I.; Khalil, N.; Houssian, K.", "title": "Induced resistance in potato plants by a non-pathogenic Pseudomonas putida BTP1 against potato tuber moth (Phthorimaea operculella Zeller)", "date": "2016", "keywords": "btp1; et al; larvae; moth; plants; potato; pupae; putida; resistance; tuber", "summary": "Sci., 2016 30(1): 47-52 DOI: 10.13128/ahs-18701 Induced resistance in potato plants by a non-pathogenic Pseudomonas putida BTP1 against potato tuber moth (Phthorimaea operculella Zeller) A. Adam (*), I. Idris, N. Khalil, K. Houssian Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria (AECS), P.O. Box 6091, Damascus, Syria. In this study, we investigated induced resistance in potato plants against potato tuber moth (Phthorimaea operculella Zeller) by non-pathogenic P. putida BTP1.", "mime": "application/pdf"}, {"id": "ahs-3050", "words": "2349", "extension": ".pdf", "flesch": "50", "author": "Luvisi, A.; Rizzo, D.; Stefani, L.; Panattoni, A.; Materazzi, A.", "title": "Occurrence of viruses in Calla and Peruvian lily in Tuscan nurseries and evidence of new viral records in Italy", "date": "2016", "keywords": "alstroemeria; lily; mosaic; plants; virus; viruses", "summary": "Table 3 - Sequence of isolates of Zantedeschia mild mosaic virus and Lily mottle virus isolate detected in Italy Zantedeschia mild mosaic virus isolate 2079 polyprotein gene, partial cds (GenBank: KF156666) TCATTGAGTACCAACCCCAACAGTCCGATCTGTTTAATACTCGCGCGTCACAAACCCAATTCAATAATTGGTATGATGCGATCAAAAATGAG- TATGGGGTTGATGATAGTCAGATGCAGAGAATCATGAATGGCTTCATGGTGTGGTGTCTCGAGAATGGGACATCACCAAACATAAATGGCGTGTGGGT- TATGATGGATGGGGATGAACAAGTAGAATTTCCACTAAAACCAATGGTGGAGAATGCCAAGCCTACGCTGCGTCAAATAATGCACCACTTTTCAGACG- CAGCCGAGGCTTACATTGAACTTAGGAATGCCGCTGCCCCATATATGCCTAGATATGGGTTGCTGCGGAACTTAAGAGACAGAGGTCTAGCACGCTTCG- CATTCGACTTCTATGAAGTCACTTCAAAGACACCAGATCGTGCTAGAGAAGCTGTAGCGCAGATGAAGGCAGCAGCGCTAAACAATGTTTCCACAAG- GATGTTTGGATTGGATGGAAATATTGCAACTGCCACGGAGAACACTGAAAGGCACACTGCTAAGGATGTAAGTCCGAGCATGCACTCGCTACTCGG- GATCTCAGCCTTGCAGTAAAGGAGCTGGAAACAGCCCACAGTTATTGTCTTGCGATAGGGTTTAAATAGCCGTACTATTGTCGTTGCTAGATGTTG- CAGTGTGGGCCTCCCACCTTAAGGTTTATCAGTGTGGCTTTCCACCTAGTTCCTTACATTGCGCATAGTATGTGT Lily mottle virus isolate 2409 coat protein gene, partial cds (GenBank: KF156662.1) TGCTGGGGCCTCTAGCTCCACACAAACGAGTCGCCCAACACGTCCAGAGATTGCCGCGGTCGATGTAGCACCACAACAGAGCTCTGAGGCTA- GAGTGCGTGATCGTGATGTTGATGCTGGCACCGTGGGAACATACCAAATCCCTCGACTGAAAGCACTGGCAACAAAGATTAACGTACCCAAGGT- CAAGGGGCGAACAATAGTGAACACTGGGCACCTTGTGAACTACAACCCAGACCAAACAGATATTTCAAATACAAGGTCAACCCAGAAGCAATTTGA- GACCTGGCATAACGCTGTGAAAGATGAGTATGGTCTCAACGACGAGAGTATGGCTCTCGCAATGAATGGTCTGATGGTTTGGTGCATAGAGAATGG- Res., 11: 173-188. PARK T.H., HAN I.S., KIM J.B., 2010 - Review on the devel- opment of virus resistant plants in Alstroemeria.", "mime": "application/pdf"}, {"id": "ahs-3051", "words": "5578", "extension": ".pdf", "flesch": "55", "author": "Hara, A.; Takaichi, H.; Murata, Y.; Sakata, R.; Hara, Y.; Iwase, J.; Comparini, D.; Suzuki, T.; Kawano, T.", "title": "Optical evaluation of the shading properties of climbing fern Lygodium japonicum used as thermal buffering green wall plant", "date": "2016", "keywords": "building; canopy; climbing; fig; green; heat; japonicum; leaves; light; lygodium; plant; walls", "summary": "In the Hibikino campus of the University of Kitakyushu (Wakamatsu-ku, Kitakyushu, Japan; 33\u02da 53\u201924\u2019\u2019 North latitude, 130\u02da 42\u2019 49\u2019\u2019 East longitude), semi-wildly propagating L. japonicum plants (Fig. (F) Even though it came after, L. japonicum plants are growing on the concrete wall by rapidly covering over the pre-exist- ing vines of Ficus pumila L. Plants were found on Hibikino campus of the University of Kitakyushu, Wakamatsu-ward, Kitakyushu, Japan (A-E), and a private garden in Miyazaki Prefecture, Japan (F).", "mime": "application/pdf"}, {"id": "ahs-3052", "words": "4673", "extension": ".pdf", "flesch": "66", "author": "Mortazavi, S.N.; Bagheri, F.; Bahadoran, M.", "title": "Some characteristics of tuberose as affected by pre-harvest application of calcium chloride and gibberillic acid", "date": "2016", "keywords": "acid; cacl2; cut; effect; flowers; gibberellic; l-1; ml l-1; tuberose; water", "summary": "Treatment with gibberellic acid has also been shown to enhance postharvest life and quality of gerbera cut flowers. Abstract: In the present study the effect of gibberellic acid (GA3) and calcium chloride (CaCl2) sprays (0, 150, 300 and 450 ml L-1), applied 25 and 15 days before harvesting, on physiological and morphological characteristics of tuberose \u2018Pearl Double\u2019 was studied.", "mime": "application/pdf"}, {"id": "ahs-3053", "words": "3133", "extension": ".pdf", "flesch": "57", "author": "Liciulli, A.; Nisi, R.; Pal, S.; Laera, A.M.; Creti, P.; Chiechi, A.", "title": "Photo-oxidation of ethylene over mesoporous Tio2/Sio2 catalysts", "date": "2016", "keywords": "anatase; area; ethylene; oxidation; phase; samples; silica; sio2; surface; tio2", "summary": "Licciulli et al. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts 77 3. Licciulli et al. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts 79 4.", "mime": "application/pdf"}, {"id": "ahs-3054", "words": "2986", "extension": ".pdf", "flesch": "60", "author": "Dutta, P.; Das, K.; Patel, A.", "title": "Influence of organics, inorganic and biofertilizers on growth, fruit quality, and soil characters of Himsagar mango grown in new alluvial zone of west Bengala, india", "date": "2016", "keywords": "biofertilizer; fruit; inorganic; mango; plant; quality; soil", "summary": "Organic farming is currently gaining gradual momentum worldwide with growing awareness of health and environmental issues in agriculture and consumers demanding the production of organic fruit, thus offering an attrac- tive source of rural income. Fruit qualities are being dete- riorated through the use of chemical fertilizers (Huyskens-Keil and Schreiner, 2003).", "mime": "application/pdf"}, {"id": "ahs-3055", "words": "5368", "extension": ".pdf", "flesch": "64", "author": "Esmaeili, S.; Salehi, H.", "title": "Kentucky bluegrass (Poa pratensis L.) silicon-treated turfgrass tolerance to short- and long-term salinity condition", "date": "2016", "keywords": "content; effects; et al; levels; liang; m-1; plant; salinity; salt; shoot; silicon; stress; tolerance; water", "summary": "Sci., 2016 30(2): 87-94 88 heavy metals (Yeo et al., 1999; Zwieniecki et al., 2001; Gao et al., 2004; Liang et al., 2005 a, b; Wang et al., 2005; Guo et al., 2007; Liang et al., 2007). Furthermore, it improves the activity of antioxidant enzymes, reducing the damage of reactive oxygen species (ROS) (Liang, 1999; Liang et al., 2003; Zhu et al., 2004) and reduces Na+ root uptake, alleviating specif- ic ion effects (Epstein, 2001; Gong et al., 2003; Liang et al., 2003).", "mime": "application/pdf"}, {"id": "ahs-3056", "words": "5566", "extension": ".pdf", "flesch": "65", "author": "Al-Safadi, B.; Nakar, M.", "title": "Ultrastructural changes in potato (Solanum tuberosum) under NaCl mediated salinity stress in vitro", "date": "2016", "keywords": "cells; crystals; et al; leaves; naringin; plants; potato; salinity; salt; stress; trichomes; type", "summary": "Discussion and Conclusions In this study we found that potato plants treated with low concentrations of salinity (50 and 100 mM) went into the osmotic stage. It is unclear, from our work, how naringin was synthesized and accumulated in the tis- sues of potato plants treated with NaCl.", "mime": "application/pdf"}, {"id": "ahs-3057", "words": "4740", "extension": ".pdf", "flesch": "60", "author": "Soufi, S.; Ben Hamed, K.; Arbaoui, M.; Elbey, N.; Rezgui, S.; Abdely, C.; Bettaeib, T.", "title": "Effect of H2O2 pretreatment on the response of two seashore paspalum (Paspalum vaginatum Sw.) cultivars (Salam and Seaspray) to cold stress", "date": "2016", "keywords": "content; exposure; fig; h2o2; paspalum; plants; salam; seashore; seaspray; stress; vaginatum", "summary": "Cold stress exposure reduced the DW of pretreated cultivar Salam compared to the control with no significant difference observed between pretreated and untreated \u2018Seaspray\u2019 (p>0.05). Chemical pretreatment and cold stress exposure altered relative density of Peroxydase isoforms Peroxidase activity was assessed on polyacry- lamide gel to distinguish the different POD isoforms, and to quantify their activities using image j soft- ware.", "mime": "application/pdf"}, {"id": "ahs-3058", "words": "5523", "extension": ".pdf", "flesch": "55", "author": "Khorsha, S.; Alizadeh, M.; Mashayekhi, K.", "title": "The usefulness of apricot gum as an organic additive in grapevine tissue culture media", "date": "2016", "keywords": "apricot; apricot gum; callus; culture; grapevine; growth; gum; media; plant; stevia; tissue; vitro", "summary": "However, further studies are needed to exploit plant derived gums as an alternative carbon source in plant tissue culture media. LLUVERAS-TENORIO A., MAZUREK J., RESTIVO A., COLOM- BINI M.P., BONADUCE I., 2012 - Analysis of plant gums and saccharide materials in paint samples: comparison of GC-MS analytical procedures and databases.", "mime": "application/pdf"}, {"id": "ahs-3059", "words": "5531", "extension": ".pdf", "flesch": "60", "author": "Ibrahim, M.", "title": "Arbuscular mycorrhizal isolate and phosphogypsum effects on growth and nutrients acquisition of cotton (Gossypium hirsutum L.)", "date": "2017", "keywords": "amf; compost; cotton; et al; growth; inoculation; mycorrhizal; phosphogypsum; plants; soil", "summary": "Sci., 2016 30(3): 121-128 122 ents by AMF plants in combination with PG has been reported (Al-Karaki and Al-Omoush, 2002; Bai et al., 2011). The plants showed the highest number of bolls when PG/compost mixture was added to AMF plants (T6).", "mime": "application/pdf"}, {"id": "ahs-3060", "words": "3764", "extension": ".pdf", "flesch": "60", "author": "Shahcheraghi, S.T.; Shekafandeh, A.", "title": "Micropropagation of three endemic and endangered fig (Ficus carica L.) genotypes", "date": "2017", "keywords": "fig; l-1; medium; number; shoot", "summary": "In \u2018Bargchenari\u2019 genotype, the results showed dif- ferent concentration of Kn had no significant effect on shoots number (Fig. 2 A), although with adding Kn in culture media, shoot number increased. Previous reportes, on Ficus shoot proliferation with implica- tion of BA and 2ip in culture media, showed BA achieved better than 2ip on shoot proliferation on Ficus benjamina (Rzepka-Plevnes and Kurek, 2000) and Ficus anastasia (Al Malki and Elmeer, 2010).", "mime": "application/pdf"}, {"id": "ahs-3061", "words": "3648", "extension": ".pdf", "flesch": "56", "author": "Luvisi, A.; Rinaldelli, E.", "title": "Insight on trans-plasma membrane behavior of virus-infected plant cells", "date": "2017", "keywords": "et al; infection; membrane; panattoni; plant; plasma; trans; virus", "summary": "The complex of results obtained in this research highlights, first of all, that membrane elec- trical response of the tested antiviral drugs is sup- ported by the metabolism of plant cell, and no differences in \u0394 RAWyLER A., ARPAGAUS S., BRAENDLE R., 2002 - Impact of oxygen stress and energy availability on membrane sta- bility of plant cells.", "mime": "application/pdf"}, {"id": "ahs-3062", "words": "6884", "extension": ".pdf", "flesch": "62", "author": "Adamipour, N.; Salehi, H.; Khosh-khui, M.", "title": "Morpho-physiological alteration in common bermudagrass [Cynodon dactylon (L.) Pers.] subjected to limited irrigation and light condition", "date": "2017", "keywords": "bermudagrass; capacity; content; drought; field; ldl; light; photoperiod; root; sdl; shoot; stress; table; treatments; weight", "summary": "In a research, the resistances to low light stress in both bermudagrass and paspalum have been examined and it was con- cluded that resistance to low light stress in the pas- palum is more than bermudagrass (Jiang et al., 2004). Xu et al. (2010) investigated the effect of nitric oxide and sodium nitroprusside in tall fescue under high light stress and concluded that using sodium nitroprusside reduces enzyme activity of SOD, CAT and APX, but using nitric oxide increases the activity of mentioned enzymes.", "mime": "application/pdf"}, {"id": "ahs-3063", "words": "5223", "extension": ".pdf", "flesch": "57", "author": "Javanmardi, J.; Akbari, N.", "title": "Salicylic acid at different plant growth stages affects secondary metabolites and phisico-chemical parameters of greenhouse tomato", "date": "2017", "keywords": "acid; activity; antioxidant; application; effect; et al; fruit; fruiting; plant; salicylic; tomato; total", "summary": "JAVAHERI M., MASHAYEKHI K., DADKHAH A., ZAKER TAVALLAEE F., 2012 - Effects of salicylic acid on yield and quality characters of tomato fruit (Lycopersicum esculentum Mill.). - Int. Abstract: Most of the researches on Salicylic acid (SA) have focused on postharvest application or acquiring stress resis- tance, while studies on its effect on plant growth, secondary metabolites and fruit quality are limited.", "mime": "application/pdf"}, {"id": "ahs-3064", "words": "2911", "extension": ".pdf", "flesch": "59", "author": "Hosseini, M.S.; Zahedi, S.M.; Fakhar, Z.", "title": "Pre-storage putrescine treatment maintains quality and prolongs postharvest life of Musa acuminata L.", "date": "2017", "keywords": "effect; fruit; musa; putrescine; ripening; storage", "summary": "Weight loss, fruit softening, skin color changes, TSS, pH, the activity of PPO and PG increased during fruit ripening but the rate of changes was significantly slowed in putrescine treated fruits. As shown in figure 1B irrespective of treatments, fruit firmness decreased significantly over storage but putrescine treated fruits were observed firmer, and especially 2 mM putrescine treatments was more effective than others in keeping the firmness.", "mime": "application/pdf"}, {"id": "ahs-3065", "words": "6695", "extension": ".pdf", "flesch": "62", "author": "Chand, R.R.; Jokhan, A.D.; Gopalan, R.D.", "title": "Bioactivity of selected essential oils from medicinal plants found in Fiji against the Spiralling whiteflies (Aleurodicus dispersus Russell)", "date": "2017", "keywords": "activity; chemical; citratus; composition; compounds; effect; et al; fumigant; hortensis; koenigii; odorata; oils; plants; repellent; tenuiflorum; whiteflies", "summary": "Natural pesticides such as plant essential oil can represent an alternative in the crop protection (Coats, 1994; Isman, 2000; Koul et al., 2008). ISMAN M.B., MACHIAL C.M., 2006 - Pesticides based on plant essential oils: from traditional practice to commer- cialization, pp. 29-44. -", "mime": "application/pdf"}, {"id": "ahs-3066", "words": "4619", "extension": ".pdf", "flesch": "58", "author": "Ceccarelli, D.; Talento, C.; Sartori, A.; Terlizzi, M.; Caboni, E.; Carbone, K.", "title": "Comparative characterization of fruit quality, phenols and antioxidant activity of de-pigmented \u201cGhiaccio\u201d and white flesh peaches", "date": "2017", "keywords": "antioxidant; content; cultivars; data; flesh; fruit; genotypes; ghiaccio; peaches; quality; series; white", "summary": "Significant differences were accepted at p<0.05 and represented by different letters on the column, within the cultivars or within the groups (\u201cGhiaccio\u201d series and white flesh cultivars). Significant differences were accepted at p<0.05 and represented by dif- ferent letters on the column, within the cultivars or within the groups (\u201cGhiaccio\u201d series and white flesh cultivars).", "mime": "application/pdf"}, {"id": "ahs-3067", "words": "7541", "extension": ".pdf", "flesch": "62", "author": "Baninaiem, E.; Mirzaaliandastjerdi, A.M.; Rastegar, S.; Abbaszade, Kh.", "title": "Effect of pre- and postharvest salicylic acid treatment on quality characteristics of tomato during cold storage", "date": "2017", "keywords": "acid; control; effect; et al; fruits; injury; postharvest; pre; quality; salicylic; sci; set; storage; tomato; treatments", "summary": "Therefore, the aim of this article was to appraise the effects of pre and postharvest SA application to maintain the qualitative characteristics of tomato fruits at cold storage and increase the postharvest life of the tomato fruit. Chilling injury and electrolyte leakage Our results showed that CI increased during stor- age, but applying different concentrations of SA could significantly (P<0.01) affect chilling injury index in tomato fruit.", "mime": "application/pdf"}, {"id": "ahs-3068", "words": "1152", "extension": ".pdf", "flesch": "33", "author": "Massai, Rossano", "title": "Foreword", "date": "2017", "keywords": "country; issue; species", "summary": "These conditions thus suggest the presence of genes that can resist extreme climatic conditions, which may be a key to the future adaptation of fruit tree species grown in temperate climates to the progressive and unstoppable changes that climate changes are causing. It is easy to imagine what kind of genetic variability has been able to generate through these exchanges which allowed the spread, throughout the rest of the globe, of fruit species which today are some of the most cultivated worldwide.", "mime": "application/pdf"}, {"id": "ahs-3069", "words": "5513", "extension": ".pdf", "flesch": "42", "author": "Masini, G.; Giordani, E.", "title": "From traditional orchards to advanced fruitculture: establishing the bases of commercial horticulture in Afghanistan", "date": "2017", "keywords": "afghanistan; agriculture; collection; development; fruit; horticulture; land; national; nuts; phdp; production; sector; varieties", "summary": "The national collection of fruits and nuts of Afghanistan After the surveys of 2006-2008 in the most impor- tant areas of fruit production when the best and most \u201cprofitable\u201d varieties were chosen together with fruit growers (who were recognized as \u201ccustodi- al\u201d of the in situ selected accessions), an in situ col- lection formed of over 850 accessions was defined. Abstract: The Afghan economy is based essentially on the primary sector and, namely, on fruit production.", "mime": "application/pdf"}, {"id": "ahs-3070", "words": "6551", "extension": ".pdf", "flesch": "49", "author": "Giordani, E.; Berti, M.; Yaqubi, M.R.", "title": "Phenotypic characterisation of almond accessions collected in Afghanistan", "date": "2017", "keywords": "accessions; afghanistan; almond; collection; colour; flower; fruit; kernel; kunduz; leaf; low; market; medium; sattarbai; shape; value", "summary": "SORKHEH K., SHIRAN B., KHODAMBASHI M., MORADI H., GRADZIEL T.M., MART\u00cdNEZ P., 2010 - Correlations between quantitative tree and fruit almond traits and their implications for breeding. Sci., 2016 30(4): 207-216 DOI: 10.13128/ahs-20346 Phenotypic characterisation of almond accessions collected in Afghanistan E. Giordani 1 (*), M. Berti 2, M. Rauf Yaqubi 3 1 Dipartimento di Scienze delle Produzioni Agroforestali e dell\u2019Ambiente, Universit\u00e0 degli Studi di Firenze, Viale delle Idee, 30, 50019 Sesto Fiorentino (FI), Italy.", "mime": "application/pdf"}, {"id": "ahs-3071", "words": "4629", "extension": ".pdf", "flesch": "48", "author": "Cullen, G.J.; Samadi, G.R.; Zarghon, A.H.; Yaqubi, M.R.", "title": "Implications of investigating pollination and cross compatibility in the almond varieties of Afghanistan", "date": "2017", "keywords": "afghanistan; almond; cross; pollination; sattarbai; trials; varieties; variety", "summary": "Future work is provide information on the recom- mended combinations, to demonstrate the impor- Cullen et al. - Ramifications of investigations into pollination and cross compatibility of almond varieties in Afghanistan 223 tance of pollination with bees, to ensure orchard growers understand the importance of planting mix- tures of varieties, and taking remedial measures where they have single variety orchards. The Carmel flowered much later than other varieties, including Nonpareil.", "mime": "application/pdf"}, {"id": "ahs-3072", "words": "3512", "extension": ".pdf", "flesch": "50", "author": "Giordani, E.; Berti, M.; Yaqubi, M.R.; Stanikzai, S.; Amad, A.; Zadran, B.; Saeedi, A.; Ghous, M.", "title": "Selected pomegranate germplasm from Afghanistan: morphological variability and relationship among collected accessions", "date": "2017", "keywords": "accessions; afghanistan; bedana; fruit; granatum; pomegranate; punica; varieties", "summary": "Such accessions Variable Mean Range CV (%) Standard deviation Leaf - Total length (mm) 68.4 52.6-86.2 11.5 7.9 Leaf - Blade length (mm) 63.2 48.0-78.5 11.5 7.3 Leaf - Blade width (mm) 20.7 16.2-26.7 11.7 2.4 Flower - Petal length (mm) 26.1 19.2-30.8 9.1 2.4 Flower - Petal width (mm) 19.9 14.3-30.2 13.4 2.7 Flower - Length of calyx (mm) 38.5 29.5-46.7 10.2 3.9 Flower- Width of calyx (mm) 13.8 9.1-24.3 14.4 2.0 Fruit - Equatorial diameter (mm) 84.5 64.9-99.2 8.1 6.8 Fruit - Diameter of calyx (mm) 21.1 11.6-35.3 19.6 4.1 Fruit - Height without calyx (mm) 76.4 56.7-94.0 8.8 6.7 Fruit - Calyx height (mm) 23.2 14.8-34.6 18.6 4.3 Fruit - Total weight (g) 309.3 134.8-490.1 24.3 75.1 Fruit - Weight of non edible part (g) 144.6 76.6-323.1 31.7 45.8 Fruit - Edible/Total weight (%) 53.8 18.7-70.8 13.5 7.3 Seed - Weight (g) 0.3 0.2-0.4 18.8 0.1 Seed - Length (g) 10.3 8.0-13.6 8.9 0.9 Seed - Width (mm) 6.8 4.9-8.4 12.2 0.8 Table 1 - Mean values, ranges and coefficients of variation for 17 quantitative traits of pomegranate accessions of the National Fruit and Nuts Collection of Afghanistan Giordani et al. - Afghanistan selected pomegranate germplasm. CALISKAN O., BAYAZIT S., 2013 - Morpho-pomological and chemical diversity of pomegranate accessions grown in Eastern Mediterranean Region of Turkey. - J. Agr.", "mime": "application/pdf"}, {"id": "ahs-3073", "words": "4238", "extension": ".pdf", "flesch": "58", "author": "Valori, F.; Ahkbari, A.; Yaqubi, M.R.; Enayat, N.; Azizi, F.; Wali Adel, M.", "title": "Introduction of determination of optimum harvest date in Afghanistan. Sweet cherry: a case study", "date": "2017", "keywords": "afghanistan; burlat; cherry; color; date; fruit; harvest; horticulture; maturity; quality; red", "summary": "This study was conducted to evaluate OHD through physical and chemical measurements of fruit quality as a maturity index for estimating proper harvest time of Burlat cherries, in Kabul. Introduction During the last decades, after over ten years of reconstruction projects, Afghanistan horticulture has grown to the pre-war level.", "mime": "application/pdf"}, {"id": "ahs-3074", "words": "7136", "extension": ".pdf", "flesch": "54", "author": "Rehman, S.; Ahmad, J.; Lanzoni, C.; Rubies Antonel, C.; Ratti, C.", "title": "The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the private Mother Stock Nurseries: a virus survey", "date": "2017", "keywords": "aclsv; afghanistan; central; citrus; collection; elisa; herat; isolates; material; north; plant; samples; south; virus; viruses", "summary": "It is well known that data regarding the presence and spread of different plant viruses are important for individual countries, their neighbours, and for the whole agricultural community where different virus- es can be spread by vegetative propagation via plant material. Key words: germplasm, plant pathology, virus disease.", "mime": "application/pdf"}, {"id": "ahs-3075", "words": "2202", "extension": ".pdf", "flesch": "-44", "author": ", ", "title": "Author Index", "date": "2017", "keywords": "afghanistan; paspalum; plant; quality; stress", "summary": "Some characteristics of tuberose as affect- ed by pre-harvest application of calcium chloride and gibberellic acid, 69 mURATA y. - Optical evaluation of the shading properties of climbing fern Lygodium japonicum used as a thermal buffering green wall plant, 59 NAKAR m. - Ultrastructural changes in potato (Solanum tuberosum) under NaCl mediated salinity stress in vitro, 95 NISI R. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts, 75 PAl S. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts, 75 PANATTONI A. - Occurrence of viruses in Calla and Peruvian lily in Tuscan nurseries and evidence of new viral records in Italy, 53 PATEl A. - Influence of organics, inorganic and biofertilizers on growth, fruit quality, and soil characters of Himsagar mango grown in new alluvial zone of West Bengal, India, 81 RADICE S. - Characterization and evaluation of Berberis microphylla G. Forst pollen grains, 31 RASTEGAR S. - Effect of pre- and postharvest salicylic acid treatment on quality characteristics of tomato during 251 cold storage, 183 RATTI C. - The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the pri- vate mother Stock Nurseries: a virus survey, 239 REFAHI A. - Analysis of the effects of Glomus etunicatum fungi and Pseudomonas fluorescence bacteria symbio- sis on some morphological and physiological character- istics of mexican lime (Citrus aurantifolia l.) under drought stress conditions, 39 REHmAN S. - The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the pri- vate mother Stock Nurseries: a virus survey, 239 REzGUI S. - Effect of H2O2 pretreatment on the response of two seashore paspalum (Paspalum vaginatum Sw.) [Cynodon dactylon (l.) Pers.] subjected to limited irrigation and light condition, 141 SAmADI G.R. - Implications of investigating pollination and cross compatibil ity in the almond varieties of Afghanistan, 217 SARTORI A. - Comparative characterization of fruit quality, phenols and antioxidant activity of de-pigmented \u201cGhiaccio\u201d and white flesh peaches, 175 SHAHCHERAGHI S.T. - micropropagation of three endemic and endangered fig (Ficus carica l.) genotypes, 129 SHAHSAVAR A.R. - Analysis of the effects of Glomus etunica- tum fungi and Pseudomonas fluorescence bacteria sym- biosis on some morphological and physiological charac- teristics of mexican lime (Citrus aurantifolia l.) under drought stress conditions, 39 SHEKAFANDEH A. - micropropagation of three endemic and endangered fig (Ficus carica l.) genotypes, 129 SIVAKUmAR R. - Impact of drought on flowering, yield and quality parameters in diverse genotypes of tomato (Solanum lycopersicum l.), 3 SOUFI S. - Effect of H2O2 pretreatment on the response of two seashore paspalum (Paspalum vaginatum Sw.)", "mime": "application/pdf"}, {"id": "ahs-3076", "words": "1546", "extension": ".pdf", "flesch": "-56", "author": ", ", "title": "Subject Index", "date": "2017", "keywords": "almond; phytosanitary; potato; status; tomato; whiteflies", "summary": "see SUBJECT INDEX Banana Climateric fruits, 75, 159 Ethylene production, 159 Putrescine treatment, 159 Quality, 159 Ripening process, 159 Shelf life, 159 Barberry Germination, 31 Pollen grains Pollen size, 31 Pollen viability, 31 Berberis microphylla G. Forst see Barberry Bermudagrass Antioxidative, 141 Irrigation, 141 Morpho-physiological alteration, 141 Photoperiod, 141 Turfgrass, 141 Biocontrol Potato, 47 Biofertilizers Mango, 81 Breeding Almond, 217 Building thermal control Japanese climbing fern, 59 \u2018Burlat\u2019 Sweet cherry, 231 Calla lily New viral evidence, 53 RT-PCR tests, 53 Tuscan nurseries, 53 Viruses occurrence, 53 Callus culture Carrot, 111 Grapevine, 111 Stevia, 111 Cananga odorata Spiralling whiteflies, 165 Carbon source Carrot, 111 Grapevine, 111 Stevia, 111 253 Bermudagrass Daucus carota L. see Carrot Decay Tomato, 183 De-pigmented cultivar Peach, 175 DNA changes Cotton, 13 Drought Tomato, 3 Drought deficit Mexican lime, 39 Endangered genotypes Fig, 129 Environmental measurements Japanese climbing fern, 59 Essential oils Spiralling whiteflies, 165 Ethylene Climateric fruits, 75 Tuberose, 69 Ethylene production Banana, 159 Euodia hortensis Spiralling whiteflies, 165 Explant Fig, 129 Ficus carica L. see Fig Fig Endangered genotypes, 129 Explant, 129 Micropropagation, 129 Rooting, 129 Shoot proliferation, 129 Single node, 129 Flavanone glycoside Potato, 95 Flavonoids Tomato, 151 Flower abscission Tomato, 3 Food security Tomato, 23 Growth Cotton, 121 Growth characters Mango, 81 Harvest date Sweet cherry, 231 Heavy metals Tomato, 23 High ethylene production Climateric fruits, 75 \u2018Himsagar\u2019 Mango, 81 Histological analysis Potato, 95 Hydrogen peroxide treatment Seashore paspalum, 103 Hydroponic system Tomato, 23 Imcopatibility groups Almond, 217 Inorganic manure Mango, 81 Ion fluxes Grapevine, 135 Tobacco, 135 Irrigation Bermudagrass, 141 Japanese climbing fern Building thermal control, 59 Environmental measurements, 59 Green roof, 59 Green wall, 59 Roof top garder, 59 Urban agriculture, 59 Kentucky bluegrass Chlorophyll content, 87 Proline content, 87 Salt stress, 87 Silicon treatments, 87 Turfgrass, 87 Kernel Almond, 207 Leaf water potential Mexican lime, 39 Liquid-crystal template Climateric fruits, 75 Fruitculture Afghanistan special issue, 197 Germplasm, 197 Plant nursery, 197 Traditional orchard, 197 Fumigant toxicity Spiralling whiteflies, 165 Gaseous phase photocatalysis Climateric fruits, 75 GC-MS test Spiralling whiteflies, 165 Genetic resources Almond, 207 Genome template stability Cotton, 13 Germination Barberry, see Apple Mangifera indica L. see Mango Mango Biofertilizers, 81 Growth characters, 81 \u2018Himsagar\u2019, 81 Inorganic manure, 81 Organic manure, 81 Quality, 81 Shelf life, 81 Soil microbial population, 81 Maturity index Sweet cherry, 231 Mexican lime Chlorophyll content, 39 Drought deficit, 39 Glomus etunicatum, 39 Leaf water potential, 39 Pseudomonas fluorescence, 39 Micro elements Tomato, 23 Micropropagation Fig, 129 Middle East Tomato, 23 Mineral nutrients Cotton, 121 Mixed oxides Climateric fruits, 75 Modified storage environment Climateric fruits, 75 Morphological variability Pomegranate, 225 Morpho-physiological alteration Bermudagrass, 141 Mother stock nurseries Phytosanitary status, 239 Phytochemicals Peach, 175 Phytosanitary status Aghanistan special issue, 239 Almond, 239 Apple, 239 Apricot, 239 Germplasm, 239 Grapevine, 239 Mother stock nurseries, 239 Peach, 239 Pear, 239 Plum, 239 Sweet cherry, 239 Virus disease, 239 Plant nursery Fruitculture, 197 Plant resistance Potato, 47 Plant-virus interaction Grapevine, 135 Tobacco, 135 Plum Phytosanitary status, 239 Poa pratensis L. see", "mime": "application/pdf"}, {"id": "ahs-3077", "words": "4470", "extension": ".pdf", "flesch": "56", "author": "Harris, M.; Llorens, M.C.; Frezza, D.", "title": "A calcium lactate treatment at harvest, growing system and refrigerated modified atmosphere can affect strawberry's 'Camaraosa' postharvest quality?", "date": "2017", "keywords": "calcium; days; fruits; lactate; postharvest; quality; soil; storage; strawberry; temperatures; treatment", "summary": "Technol., 43: 381-392. SHAFIEE M., TAGHAVI T.S., BABALAR M., 2010 - Addition of salicylic acid to nutrient solution combined with postharvest treatments (hot water, salicylic acid, and calcium dipping) improved postharvest fruit quality of strawberry. Could an immersion in calci- um allow an increase in storage temperature, main- taining fruit quality?", "mime": "application/pdf"}, {"id": "ahs-3078", "words": "3577", "extension": ".pdf", "flesch": "66", "author": "Hosseini, M.S.; Fakhar, Z.; Babalar, M.; Askari, M.A.", "title": "Effect of pre-harvest putrescine treatment on quality and postharvest life of pear cv. Spadona", "date": "2017", "keywords": "et al; fruit; life; pear; postharvest; putrescine; storage", "summary": "Moreover, the storage life and marketability of putrescine treated fruits were prolonged by decreas- ing decay incidence. It is suggested that polyamines maintain fruit firmness by their cross-linkage to the pectin substances carboxyl groups in the cell wall and lead to strengthening of cell wall and consequently decreasing cell wall degrading enzymes activities of pectin methyl esterase (PME), pectin esterase (PE) and polygalactouronase (PG) (Valero et al., 2002).", "mime": "application/pdf"}, {"id": "ahs-3079", "words": "3569", "extension": ".pdf", "flesch": "59", "author": "Ghassemi-Golezani, K.; Ghassemi, S.; Yaghoubian, I.", "title": "Improving oil and flavonoid contents of milk thistle under water stress by salicylic acid", "date": "2017", "keywords": "acid; ghassemi; golezani; oil; plant; seed; stress; water; yield", "summary": "Water stress reduced plant biomass, seeds per plant, 1000 seeds weight, seed yield, harvest index, oil percentage and consequently oil yield of milk this- tle. Water availability may influence physiological and biochemi- cal properties and seed yield of this medicinal plant.", "mime": "application/pdf"}, {"id": "ahs-3080", "words": "4336", "extension": ".pdf", "flesch": "61", "author": "Morano, G.; Amalfitano, C.; Sellitto, M.; Cuciniello, A.; Maiello, R.; Caruso, G.", "title": "Effects of nutritive solution electrical conductivity and plant density on growth, yield and quality of sweet basil grown in gullies by subirrigation", "date": "2017", "keywords": "basil; density; leaves; nutritive; plants; pot; quality; solution; yield", "summary": "Contrastingly, in previous research (Tesi et al., 1995) a decreasing trend of nitrate accumula- tion as a function of plant density increase was reported. Soilless growing of this crop is a current farm strategy and the quality targets are affected by nutritive solution as well as by plants density per pot.", "mime": "application/pdf"}, {"id": "ahs-3081", "words": "5600", "extension": ".pdf", "flesch": "60", "author": "Hadian-Delijou, M.; Esna-Ashari, M.; Sarikhani, H.", "title": "Effect of pre- and post-harvest salicylic acid treatments on quality and antioxidant Properties of 'Red Delicious' apples during cold storage", "date": "2017", "keywords": "acid; antioxidant; apples; et al; fruit; harvest; post; salicylic; storage; treatment", "summary": "GARMING H., 2014 - Apple. - www.agribenchmark.org. GERANSAYEH M., SEPAHVAND S., ABDOSSI V., 2015 - Extending post-harvest longevity and improving quality of strawberry (Fragaria ananasa Duch cv. Gaviota) fruit by post-harvest salicylic acid treatment. SHAFIEE M., TAGHAVI T.S., BABALAR M., 2010 - Addition of salicylic acid to nutrient solution combined with post- harvest treatments (hot water, salicylic acid, and calci- um dipping) improved post-harvest fruit quality of strawberry.", "mime": "application/pdf"}, {"id": "ahs-3082", "words": "3526", "extension": ".pdf", "flesch": "64", "author": "Radice, S.; Arena, M.", "title": "Flower anatomy related to blooming development of Berberis microphylla G. Forst Berberida microphylla G. Forst (berberidaceae)", "date": "2017", "keywords": "arena; berberis; fig; flower; forst; microphylla; nectar; pollen; radice; stigma", "summary": "Sci., 2017 31(1): 39-44 DOI: 10.13128/ahs-20724 Flower anatomy related to blooming development of Berberis microphylla G. Forst (Berberidaceae) S. Radice, M. Arena Department of Plant Physiology, Facultad de Agronom\u00eda y Ciencias Agroalimentarias UM-CONICET, Machado 914, Lab. 501, B1708EOH, Mor\u00f3n. Abstract: Berberis microphylla G. Forst. is a Patagonian native shrub commonly named \u201ccalafate\u201d, which has a growing economic potential due to its dark blue berries that are consumed fresh, as jams and preserves, and are used for the pro- duction of soft drinks and ice cream.", "mime": "application/pdf"}, {"id": "ahs-3083", "words": "4642", "extension": ".pdf", "flesch": "55", "author": "Venturieri, G.A.; Nesi, B.; Lazzereschi, S.; Pecchioli, S.; Burchi, G.", "title": "Development of pollination and in vitro germination techniques to improve the hybridization in Hydrangea spp.", "date": "2017", "keywords": "cut; disinfection; fruits; germination; hydrangea; macrophylla; pollination; ppm; seeds; systems", "summary": "Since most Hydrangea seeds are so small (diameter of 0.5 mm) and hybrid seeds production is usually low (0-5 seeds/fruit), so, the development of a successful in vitro method for Hydrangea seed germination would be an important tool for breeding programs. To increase seed germination, Greer and Rinehart (2010) have developed an in vitro method for cultiva- tion and assay of H. macrophylla (Thunb.)", "mime": "application/pdf"}, {"id": "ahs-3084", "words": "5076", "extension": ".pdf", "flesch": "59", "author": "Rahemi, M.; Karimi, S.; Sedaghat, S.; Ali Rostami, A.", "title": "Physiological responses of olive cultivars to salinity stress", "date": "2017", "keywords": "content; cultivars; leaf; mean; olive; salinity; stress; water", "summary": "Using the data collected at the start and the end of salinity stress treatments, the rate of these changes was calculated. The tolerance of olive cultivars are different to salinity stress (Therios and Misopolinos, 1988; Perica et al., 2004; Chartzoulakis, 2005).", "mime": "application/pdf"}, {"id": "ahs-3085", "words": "7513", "extension": ".pdf", "flesch": "57", "author": "Urban Krajnc, A.; Rakun, J.; Berk, P.; Ivancic, A.", "title": "The impact of fruit temperature dynamics on heat stress tolerance of selected oil pumpkin genotypes", "date": "2017", "keywords": "argyrosperma; cucurbita; et al; exocarp; fig; fruits; heat; moschata; oil; oil pumpkin; pepo; pumpkin; temperatures", "summary": "Darker colours are gen- erally associated with higher fruit temperatures. argyrosperma, Cucurbita moschata, Cucurbita okeechobeensis, Cucurbita pepo, fruit temperatures.", "mime": "application/pdf"}, {"id": "ahs-3086", "words": "562", "extension": ".pdf", "flesch": "35", "author": "Alpi, A.", "title": "Foreword", "date": "2017", "keywords": "metabolism; metabolites", "summary": "Harborne\u2019s work has called for experimentation on all other classes of secondary metabolites, alkaloids, non\u00adprotein amino acids, glucosinolates, lectins, terpenes, steroids, tannins, flavonoids, phenylpropanoids, lignins, coumarin, waxes, etc. The plant\u2019s specific organization has led it to produce a large amount of secondary metabolites and probably selective pressure has left those molecules capable of conferring specific benefits to the plant: defense role against animal, fungal and bacterial parasites, but also those molecules that allow to establish relationships between plants of the same species or between different species.", "mime": "application/pdf"}, {"id": "ahs-3087", "words": "5764", "extension": ".pdf", "flesch": "53", "author": "Bartolini, S.; Viti, R.; Ducci, E.", "title": "Chemical characterization and sensory analysis by blind and visually impaired people of local peach varieties", "date": "2017", "keywords": "analysis; antioxidant; content; dolfo; food; fruit; mora; peach; quality; tss; varieties; year", "summary": "CHOI D.G., YOU D.H., KIM H.G., RYU J., 2003 - Effect of rainfall interception on soil moisture, tree sap flow, and fruit quality in peach (Prunus persica) . - Acta Horticulturae, 620: 197-202. Biotechnol., 49: 85-89. LARIBI A.I., PALOU L., INTRIGLIOLO D.S., NORTES P.A., ROJAS-ARGUDO C., 2013 - Effect of sustained and regu- lated deficit irrigation on fruit quality of pomegranate cv.", "mime": "application/pdf"}, {"id": "ahs-3088", "words": "2437", "extension": ".pdf", "flesch": "56", "author": "Romani, A.; Pinelli, P.; Moschini, V.; Heimler, D.", "title": "Seeds and oil polyphenol content of sunflower (Helianthus annuus L.) grown with different agricultural management", "date": "2017", "keywords": "acid; content; management; oil; organic; polyphenols; sunflower", "summary": "Sunflowers prove to be a protein source of great interest for human nutrition; moreover, the residues originating from oil extrac- tion are rich in phenolic antioxidants, which account for 1-4% of the total mass with chlorogenic acid being the predominant component (Weisz et al., 2009). The main phenolic compounds present in both the kernel and hull besides chlorogenic acid are caffeic acid and caf- feoylquinic derivatives.", "mime": "application/pdf"}, {"id": "ahs-3089", "words": "4982", "extension": ".pdf", "flesch": "60", "author": "Masi, E.; Caparrotta, S.; Taiti, C.; Ieri, F.; Fiume, P.; Moselhy, N.; Mancuso, S.; Romani, A.", "title": "Characterization of volatile compounds in Mentha spicata L. dried leaves", "date": "2017", "keywords": "compounds; dried; et al; leaves; mass; ptr; spearmint; taiti; tof", "summary": "Tentative identification Protonated chemical formula Signal intensity (ppbv) Compound (% on the total) References 27.022 Acetylene C 2 H 3 + 22.9 \u00b1 6.4 1.11 Vita et al. (2015) 31.018 Formaldehyde CH 3 O+ 56.3 \u00b1 5.2 2.79 Kushch et al. (2008) 39.022 Isoprene fragment C 3 H 3 + 15.7 \u00b1 2.2 0.74 Maleknia et al. (2007) 41.038 Alkyl fragment C 3 H 5 + 111.3 \u00b1 12.7 5.81 Vita et al. (2015) 43.018 Alkyl fragment C 2 H 3 O+ 58.7 \u00b1 21.5 2.9 Vita et al. (2015) 43.054 Alkyl fragment (propene) C 3 H 7 + 56.3 \u00b1 5.2 2.66 Taiti et al. (2017) 45.033 Acetaldehyde C 2 H 5 O+ 13.5 \u00b1 6.8 0.77 Taiti et al. (2016) 53.04 Cyclobutadiene C 4 H 5 + 37.3 \u00b1 0.1 1.83 Vita et al. (2015) 55.055 C 4 aldehydes fragment C 4 H 7 + 40.3 \u00b1 5.1 1.98 Taiti et al. (2017) 57.033 Alkyl Fragment (2-hexenal) C 3 H 5 O+ 8.0 \u00b1 2.4 0.38 Brilli et al. (2011) 57.07 Alkyl fragment (Hexanol/valeric acid) C 4 H 9 + 19.8 \u00b1 0.2 0.97 Aprea et al. (2015) 59.049 Propanal, acetone C 3 H 7 O+ 57.4 \u00b1 17.2 2.7 Taiti et al. Sci., 2017 31(2): 89-95 92 reported in Materials and Methods section, the detected VOCs were integrated with the fragmenta- tion patterns of each compound (Maleknia et al., 2007; Kim et al., 2009; Brilli et al., 2011) and with the results of the GC-MS-based profile.", "mime": "application/pdf"}, {"id": "ahs-3090", "words": "5999", "extension": ".pdf", "flesch": "58", "author": "Jamali, B.; Bonyanpour, A.R.", "title": "Evaluation of adaptability potentials in seven iranian pomegranate cultivars based on comparison of physiological characteristics and leaf minearl composition", "date": "2017", "keywords": "comparison; concentration; content; cultivars; fars; g-1; leaf; plant; pomegranate; rnf; stress; tolerance; total; water", "summary": "Previous investigations indicate varied levels of toler- ance to abiotic stress conditions such as drought and salinity among different pomegranate cultivars (Tabatabaei and Sarkhosh, 2006; Okhovatian- Ardakani et al., 2010; Ibrahim, 2016) because abiotic stress tolerance is a complex parameter and depends on both genetical and physiological properties. Significant differences were found among studied pomegranate cultivars for concentrations of leaf potassium, calcium magnesium, sodium and Iron concentrations.", "mime": "application/pdf"}, {"id": "ahs-3091", "words": "4729", "extension": ".pdf", "flesch": "54", "author": "Tripodi, P.; Francese, G.; Mennella, G.", "title": "Rocket salad: crop description, bioactive compounds and breeding perspectives", "date": "2017", "keywords": "accessions; compounds; diplotaxis; eruca; et al; glucosinolates; plant; rocket; salad; sativa; species; subsp; tenuifolia", "summary": "Several species, mainly belonging to the genus Eruca and Diplotaxis, are widely cultivated and recog- nized as rocket salad. Rocket salad is a plant member of the Brassicaceae family whose name encloses species of the Eruca and Diplotaxis genera characterized by leaves with peculiar pungent taste and strong flavour.", "mime": "application/pdf"}, {"id": "ahs-3092", "words": "2791", "extension": ".pdf", "flesch": "52", "author": "Del Carratore, R.; Podda, A.; Maserti, B.E.", "title": "Fungal colonization improved growth and modulated the expression of myrosinase in black cabbage", "date": "2017", "keywords": "black; cabbage; colonization; expression; growth; indica; plants", "summary": "Picture of the plants after one week from the inoculation (A); Biomass weight (mg) or shoot length (mm), at 0, 1 and 3 weeks after P. indica colonization (B).Values are the mean of ten independent experiments for each condition (control or inoculated) \u00b1SD. Although P. indica colonization improves plant growth and resistance to abiotic stress (Sun et al., 2010), a negative impact on defence response path- way might increase the susceptibility of colonized black cabbage against biotic stress.", "mime": "application/pdf"}, {"id": "ahs-3093", "words": "6279", "extension": ".pdf", "flesch": "62", "author": "Taiti, C.; Caparrotta, S.; Mancuso, S.; Masi, E.", "title": "Morpho-chemical and aroma investigations on autochthonous and highly-prized sweet cherry varieties grown in Tuscany", "date": "2017", "keywords": "aroma; chemical; cherry; compounds; cultivars; et al; ferrovia; fragment; fruit; nello; varieties; vocs", "summary": "Indeed, as it has been observed elsewhere for sweet cherry fruits (Crisosto et al., 2003; Garcia-Montiel et al., 2010) the increase in TSS/TA ratio during ripening process is due to the higher increase in TSS than the increase in TA. This allowed to drawing some further interesting consideration and to better appreciate the differ- ences between aroma profiles of sweet cherry fruits belonging to different cultivars (Fig. 2).", "mime": "application/pdf"}, {"id": "ahs-3094", "words": "5702", "extension": ".pdf", "flesch": "56", "author": "Refahi, A.; Shahsavar, A.R.", "title": "Effects of salinity stress on certain morphological traits and antioxidant enzymes of two Carica papaya cultivars in hydroponic culture", "date": "2017", "keywords": "activity; cultivars; difference; levels; plant; proline; salinity; salinity levels; salt; stress; treatment; weight", "summary": "Introduction The ability of plants to tolerate salinity stress is facilitated by a series of biochemical pathways which maintain or absorb water, protect plants chloroplast function and sustain an ionic balance. Salinity stress in soil or water, especially in hot, arid regions, could limit plant growth and reduce its yield (Koca et al., 2007).", "mime": "application/pdf"}, {"id": "ahs-3095", "words": "4236", "extension": ".pdf", "flesch": "54", "author": "Ieri, F.; Cecchi, L.; Vignolini, P.; Belcaro, M.F.; Romani, A.", "title": "HPLC/DAD, GC/MS and GC/GC/TOF analysis of Lemon balm (Melissa officinalis L.) sample as standarlized raw material for food and nutraceutical uses", "date": "2017", "keywords": "acid; analysis; balm; citral; compounds; hplc; lemon; melissa; officinalis; sample", "summary": "In the first step of GC-MS analy- sis, HS-SPME-GC-MS was selected as the most suit- able technique to recover and analyze the highest number of Volatile Organic Compounds (VOCs) in Melissa officinalis L. samples. KONG W.J., ZHAO Y.L., XIAO X.H., JIN C., LI Z.L., 2009 - Quantitative and chemical fingerprint analysis for qual- ity control of Rhizoma coptidischinensis based on UPLC-PAD combined with chemometrics methods.", "mime": "application/pdf"}, {"id": "ahs-3096", "words": "4018", "extension": ".pdf", "flesch": "60", "author": "Melito, S.; D'Amelia, V.; Garramone, R.; Villano, C.; Carputo, D.", "title": "Tuber yield and processing traits of potato advanced selections", "date": "2017", "keywords": "chipping; clones; potato; processing; short; storage; tuber; varieties; yield", "summary": "overall, the number of potato varieties cultivated for processing purposes is increasing and more than 50% of potato yield is driven to food industries. MAlone J.G., MittoVA V., rAtCliFFe r.G., KruGer n.J., 2006 - The response of carbohydrate metabolism in potato tubers to low temperature.", "mime": "application/pdf"}, {"id": "ahs-3097", "words": "4774", "extension": ".pdf", "flesch": "59", "author": "Amirinejad, A.-A.; Sayyari, M.; Ghanbari, F.; Kordi, S.", "title": "Salicylic acid improves salinity-alkalinity tolerance in pepper (Capsicum annuum L.)", "date": "2017", "keywords": "acid; et al; growth; pepper; plants; proline; salicylic; salt; stress; stresses", "summary": "Results showed that SS and AS imposed negative effects on pepper plant growth and productivity. Conclusions in summary, our study clearly showed that saline and alkaline stresses as two types of abiotic stresses, have negative effects on pepper plant growth and productivity.", "mime": "application/pdf"}, {"id": "ahs-3098", "words": "7029", "extension": ".pdf", "flesch": "55", "author": "Mujib, A.; Ali, M.; Tonk, D.; Zafar, N.", "title": "Nuclear 2C DNA and genome size analysis in somatic embryo regenerated gladiolus plants using flow cytometry", "date": "2017", "keywords": "bap; callus; dna; embryo; embryogenesis; et al; flow; gladiolus; maturation; medium; naa; plant", "summary": "Nuclear homogenate of juvenile leaves from naturally grown and somatic embryo regenerated plants were used for flow cytometry and the obtained results are pre- sented in figure 3. The 2C nuclear DNA content values of both the two sources are nearly the same that suggests no major alteration in genome size in embryo regenerated plants when compared with corm derived gladiolus.", "mime": "application/pdf"}, {"id": "ahs-3099", "words": "4785", "extension": ".pdf", "flesch": "63", "author": "Sepehrtaj, A.; Shahsavar, A.R.", "title": "Uniform and virus-free citrus rootstocks production via nucellus culture", "date": "2017", "keywords": "citrus; culture; lime; medium; mg l-1; nucellus; orange; shoots", "summary": "The highest rooting rate for Mexican lime was in culture medium containing 0.5 mg l-1 IBA and for bitter orange, it was the culture medium containing 1 mg l-1 IBA. Rooting of the gener- ated shoots have been reported differently consider- ing used genotype, culture medium and IBA concen- tration (Chaturvedi and Mitra, 1974;", "mime": "application/pdf"}, {"id": "ahs-3100", "words": "4324", "extension": ".pdf", "flesch": "61", "author": "Mohamedova, M.", "title": "Field evaluation of three biopesticides for control of the raspberry cane midge, Resseliella thobaldi (Barnes) in Bulgaria", "date": "2017", "keywords": "cane; control; larvae; midge; neemazal; number; raspberry; subtilis; theobaldi", "summary": "For instance, use of products based on entomopathogenic bacteria, Bacillus thuringiensis (Bt) and Streptomyces avermi- tilis against raspberry midge blight have been report- ed (Shternshis et al., 2002). Table 1 - efficacy of three biopesticides using against raspberry midge cane in Bogdanovo Means within each column followed by the same letter are not significantly different, duncan\u2019s test (p<0.05).", "mime": "application/pdf"}, {"id": "ahs-3101", "words": "5420", "extension": ".pdf", "flesch": "63", "author": "Asheri, M.; Sharifani, M.M.; Kiani, G.", "title": "An examination into the effects of frozen storage of olive fruit on extracted olive oils", "date": "2017", "keywords": "acid; content; fatty; freezing; fruits; oil; oils; olive; quality; storage", "summary": "Oil derived from frozen olive fruit is not of inferior quality to non-frozen fruit in the production of olive oil. Olive oil consumption is increasing throughout the world, even in countries that traditionally have not used olive oil.", "mime": "application/pdf"}, {"id": "ahs-3102", "words": "3008", "extension": ".pdf", "flesch": "58", "author": "Sakr, N.", "title": "Aggressiveness of four Fusarium head blight species on wheat cultivars", "date": "2017", "keywords": "cultivars; fusarium; head; isolates; species; wheat", "summary": "Sci., 2017 31(3): 199-203 DOI: 10.13128/ahs-20585 Aggressiveness of four Fusarium head blight species on wheat cultivars N. Sakr Department of Agriculture, Atomic Energy Commission of Syria, P.O. Box 6091, Damascus, Syria. Two aggressiveness criteria: diseased-head severity (DHS, Fusarium infection) and disease development (DD, Fusarium spread) were visually estimated as percentage of heads showing Fusarium symptoms in wheat cultivars at the soft dough stage.", "mime": "application/pdf"}, {"id": "ahs-3103", "words": "6837", "extension": ".pdf", "flesch": "62", "author": "Golabadi, M.; Golkar, P.; Eghtedari, A.-R.", "title": "Effect of different physio-chemical factors on sex expression and fruit yield in green-house cucumber", "date": "2017", "keywords": "agno3; chemical; cucumber; flower; flowering; fruit; growth; leaf; male; number; ppm; sex; stage", "summary": "** NS NS * NS NS CH \u00d7LGS 10 * ** NS NS NS NS NS NS NS SP\u00d7LGS 2 NS NS NS NS * NS NS NS NS S\u00d7CH\u00d7SP 5 NS NS NS NS NS NS NS NS NS S\u00d7CH\u00d7LGS 10 ** ** NS ** * NS NS NS NS CH\u00d7SP\u00d7LGS 10 NS NS NS NS NS NS * NS NS S\u00d7SP\u00d7LGS 2 NS NS NS NS * NS NS NS NS S\u00d7CHSP\u00d7LGS 10 NS NS NS NS NS NS NS NS NS Residual 140 NS NS NS NS NS NS NS NS NS Golabadi et al. - Effect of different physio-chemical factors on sex expression and fruit yield in greenhouse cucumber 209 showed that important traits related to change of sex expression such as days to male flowering, node number of first male flower, and number of male flower more affected by different interactions in con- trast to vegetative and yield related traits. In the two chemical treatments at high- er concentration, double spraying caused increasing of male flower number, although differences between one and two spraying in low concentrations of chemical agents was not significant.", "mime": "application/pdf"}, {"id": "ahs-3104", "words": "4300", "extension": ".pdf", "flesch": "62", "author": "Ciurli, A.; Huarancca Reyes, T.; Guglielminetti, L.", "title": "Commercial advantages on basil architecture by ultraviolet-B irradiation", "date": "2017", "keywords": "basil; control; cultivars; days; fig; growth; plants; radiation; treatment", "summary": "For instance, plant species grown in Mediterranean and Tropical environments and/or at high altitudes have developed defensive mechanisms to protect them- selves against UV radiation (Zheljazkov et al., 2008). DEL CORSO G., LERCARI B., 1997 - Use of UV radiation for control of height and conditioning of tomato trans- plants (Lycopersicon esculentum Mill.).", "mime": "application/pdf"}, {"id": "ahs-3105", "words": "4787", "extension": ".pdf", "flesch": "65", "author": "Negro, C.; De Bellis, L.; Sabella, E.; Nutricati, E.; Luvisi, A.; Miceli, A.", "title": "Detection of not allowed food-coloring additives (copper chlorophyllin; copper-sulphate) in green table olives sold on the Italian market", "date": "2017", "keywords": "addition; chlorophyll; copper; e141ii; food; green; n.r; olives; samples; table", "summary": "Negro et al. - Detection of not allowed food-coloring additives in green table olives in italian market 233 FODALE A.S., MULE R., TAGLIAVIA M., TUCCI A., 2007 - The processing of green olives using the \u201cCastelvetrano\u201d method. Sci., 2017 31(4): 225-233 DOI: 10.13128/ahs-20814 Detection of not allowed food-coloring additives (copper chlorophyllin, copper- sulphate) in green table olives sold on the Italian market C. Negro, L. De Bellis, E. Sabella, E. Nutricati, A. Luvisi, A. Miceli Dipartimento di Scienze e", "mime": "application/pdf"}, {"id": "ahs-3106", "words": "3698", "extension": ".pdf", "flesch": "59", "author": "Kopta, T.; Antal, M.; Jurica, M.; Volkova, J.; Pokluda, R.", "title": "The Influence of synthetic strigolactones and plant extracts on the morphological parameters of onion (Allium cepa)", "date": "2017", "keywords": "fenyl; influence; leaf; length; mixture; parameters; plant; strigolactones", "summary": "These seeds can be stimulated by preparations containing strigolactones obtained from plant roots showing effects already in extremely low concentra- tions: for example, a concentration less than 10-10 mol l-1 is sufficient to stimulate the germination of parasitic plants (Humphrey et al., 2006). Sci., 2017 31(4): 235-240 dOI: 10.13128/ahs-20517 The Influence of synthetic strigolactones and plant extracts on the morphological parameters of onion (Allium cepa) T. Kopta 1 (*), M. Antal 2, M. Jurica 1, J. Volkov\u00e1 2, R. Pokluda 1 1 Department of Vegetable Growing and Floriculture, Faculty of Horticulture, Mendel University Brno, Brno, Czech Republic.", "mime": "application/pdf"}, {"id": "ahs-3107", "words": "4676", "extension": ".pdf", "flesch": "59", "author": "Dolkar, T.; Sharma, M.K.; Kumar, A.; Mir, M.S.; Hussanin, S.", "title": "Genetic variability and correlation studies in grapes (Vitis vinifera L.) in Leh District of Jammu and Kashmir", "date": "2017", "keywords": "berry; bunch; grape; length; number; weight; yield", "summary": "keeping in view the economic importance of grapes and to boost its cultivation in the Leh District, the present investigation was carried out to generate the vital information on the existing germplasm of grape vine in the Leh district and selec- tion of elite clones for further multiplication and dis- tribution among the farmers. 2. To preserve the current genetic pool and to use it judiciously, it is necessary to evaluate the extent of this diversity by identification and distinc- tion of grape accessions, as well as the determination of genetic relationship between local cultivars and wild relatives (Negrul, 1973).", "mime": "application/pdf"}, {"id": "ahs-3108", "words": "5324", "extension": ".pdf", "flesch": "60", "author": "Qrunfleh, I.M.; Ammari, T.G.; Abu-Romman, S.", "title": "\u2018Superior Seedless\u2019 grafted on three selected grapevine rootstocks grown on calcareous soil under diluted brackish water irrigation. I. Growth performances", "date": "2017", "keywords": "41b; irrigation; leaf; m-1; p1103; rootstocks; salinity; seedless; soil; water", "summary": "Three levels of irrigation water salinity, in terms of electrical con- ductivity (EC), were applied: 1.5, 3.0 and 5.0 dS m-1 in addition to the 0.8 dS m-1 control. Sci., 2017 31(4): 249-256 256 GOLAn R., SAGI M., PASTERnAK D., 2005 - Effects of timing and duration of brackish irrigation water on fruit yield and quality of late summer melons.", "mime": "application/pdf"}, {"id": "ahs-3109", "words": "5720", "extension": ".pdf", "flesch": "54", "author": "Schwerz, F.; Sgarbossa, J.; Olivoto, T.; Elli, E.; Aguiar, A.; Caron, B.; Schmidt, D.", "title": "Solar radiation levels modify the growth traits and bromatological composition of Cichorium intybus", "date": "2017", "keywords": "area; chicory; chlorophyll; content; efficiency; growth; leaf; leaves; levels; light; plants; radiation; radiation levels; use", "summary": "Therefore, solar radiation levels may modify the biomass accumulation and bromatological composition. Schwerz et al. - Solar radiation levels modify the growth traits of Cichorium intybus 261 plants growing under reduced radiation availability (50% and 70%) presented respectively 51.6% and 40.1% higher radiation use efficiency than those growing under 100% of solar radiation level.", "mime": "application/pdf"}, {"id": "ahs-3110", "words": "3714", "extension": ".pdf", "flesch": "62", "author": "Pallavi, B.; Nivas, S.K.; D'Souza, L.; Ganapathi, T.R.; Hegde, S.", "title": "Gamma rays induced variations in seed germination, growth and phenotypic characteristics of Zinnia elegans var. Dreamland", "date": "2017", "keywords": "colour; elegans; flower; gamma; germination; height; plant; seedlings; seeds; zinnia", "summary": "A higher frequency of flower colour mutation was observed in 100Gy. Induced plant mutations in the genomics era.", "mime": "application/pdf"}, {"id": "ahs-3111", "words": "4009", "extension": ".pdf", "flesch": "54", "author": "Qrunfleh, I.M.; Abu-Romman, S.; Ammari, T.G.", "title": "\u2018Superior Seedless\u2019 grapevine grafted on three rootstocks grown on calcare- ous soil under diluted brackish water irrigation. II. Expression of antioxidant genes", "date": "2017", "keywords": "antioxidant; expression; irrigation; plant; response; rootstocks; salinity; salt; seedless; stress; water", "summary": "Three levels of irrigation water salinity; in terms of electrical conductivity (EC), were applied: 1.5, 3.0 and 5.0 dS m-1 in addition to the 0.8 dS m-1 control. Most knowledge on molecular mechanisms involved in plant salt responses and adaptation has been derived from analyses of the glycophytic mod- els Arabidopsis thaliana and rice.", "mime": "application/pdf"}, {"id": "ahs-3112", "words": "5349", "extension": ".pdf", "flesch": "56", "author": "Dadashpour, A.; Shekafandeh, A.; Oladi, R.", "title": "Anatomical and morphological changes in scion of some olive grafting combinations under water deficit", "date": "2017", "keywords": "deficit; drought; graft; growth; olive; rootstocks; scion; stress; trees; vessel; water; xylem; zard", "summary": "Abstract: Effects of water stress deficit were studied on xylem anatomical fea- tures and some growth parameters among six olive grafting combinations; Amygdalifolia/Arbequina (Am/Ar), Amygdalifolia/Koroneiki (Am/Ko), Amygdalifolia/Zard (Am/Z), Conservallia/Koroneiki (Co/Ko), Conservallia/Zard (Co/Z) and Conservallia/Arbequina (Co/Ar) of about three-year-old olive trees (Olea europaea L.) under greenhouse conditions. Morphological parameters In order to evaluate the growth indices of grafted plants under the period of water stress deficit, main stem length growth (SL) was calculated based on a difference between the stem length above graft union at the beginning and at the end of the drought period.", "mime": "application/pdf"}, {"id": "ahs-3113", "words": "4147", "extension": ".pdf", "flesch": "55", "author": "Cirillo, C.; Russo, R.; Famiani, F.; Di Vaio, C.", "title": "Investigation on rooting ability of twenty olive cultivars from Southern Italy", "date": "2017", "keywords": "autumn; cultivars; cuttings; number; olive; rate; rooting; spring; treatment", "summary": "Taking this background into considera- tion, the main aim of this study was to assess the rooting ability of olive cuttings obtained from twenty autochthonous olive cultivars of the Campania Region, by using different combinations of auxin treatments (NAA and NAD), times of collection of cuttings (spring and autumn) and portions of shoots to prepare the cuttings (basal, middle or apical). \u00d7 TS NS Table 1 - Analysis of variance for cultivars, hormonal rooting treatments, time of sampling and their interactions on rooting rate of olive cuttings Adv.", "mime": "application/pdf"}, {"id": "ahs-3114", "words": "5778", "extension": ".pdf", "flesch": "59", "author": "Abedi Gheshlaghi, E.; Rabiei, V.; Ghasemi, M.; Fattahi, J.; Razavi, F.", "title": "Phenolic metabolism and antioxidant activity during endodormancy of Kiwifruit buds", "date": "2017", "keywords": "activity; antioxidant; buds; capacity; cultivars; endodormancy; enzyme; et al; fig; genotypes; kiwifruit; phenol", "summary": "During bud endodormancy, there is no visible growth, but physiological changes in respiration, growth regulators, carbohydrate metabolism, the amount of water, and other com- pounds occur, influencing bud endodormancy control (Ben mohamed et al., 2010). the duration of bud endodormancy was different in the cultivars and genotypes.", "mime": "application/pdf"}, {"id": "ahs-3115", "words": "3861", "extension": ".pdf", "flesch": "60", "author": "Pardini, A.; Massolino, F.; Grassi, C.", "title": "Opuntia ficus-indica (L.) Mill. growing in soil and containers for urban agriculture in developing areas", "date": "2017", "keywords": "agriculture; average; cladodes; ficus; food; indica; opuntia; pear; pots; soil; tires", "summary": "COHEN M.J, GARRET J.L., 2009 - The food price crisis and urban food (in)security. - International Institute for Environment and Development, IIED, London, UK, pp. 39. Urban agriculture and horticulture can contribute to the avail- ability of fresh foods, officinal and medicinal plants, but the little availability of irrigation and surface to destine for cropping suggest the convenience of little water consuming species, with little needs of soil fertility and that can be eaten entirely.", "mime": "application/pdf"}, {"id": "ahs-3116", "words": "10361", "extension": ".pdf", "flesch": "52", "author": "Chand, R.R.; Jokhan, A.D.; Gopalan, R.D.", "title": "A mini-review of essential oils in the South Pacific and their insecticidal properties", "date": "2017", "keywords": "activities; activity; aedes; aegypti; anopheles; coleoptera; compounds; control; effects; et al; extracts; family; fever; food; insecticidal; insecticidal activity; insects; isman; larvicidal; leaf; leaves; mosquito; oils; pacific; plants; properties; res; sci; seed; south; species; stomach; toxicity", "summary": "(Dambolena et al., 2016). Octopamine exerts the effects through octopamine-1 and octopamine-2 receptors through- out their union with G-protein-coupled receptors (Dambolena et al., 2016).", "mime": "application/pdf"}, {"id": "ahs-3117", "words": "5950", "extension": ".pdf", "flesch": "58", "author": "Taiti, C.; Marone, E.", "title": "EVOO or not EVOO? A new precise and simple analytical tool to discriminate extra virgin olive oils", "date": "2017", "keywords": "analysis; compounds; evoo; italy; oil; oils; olive; panel; ptr; samples; test; tof; virgin", "summary": "Starting from this result, the aim of the current work was to develop and to test a fast analytical method that combines efficiency, accuracy and reliability for a rapid screening and quantification of volatile com- pounds in olive oil samples. 1 - Schematic representation of oil samples analyses and classification using the PTR-ToF-MS.", "mime": "application/pdf"}, {"id": "ahs-3118", "words": "6911", "extension": ".pdf", "flesch": "61", "author": "Kamiab, Fereshteh", "title": "24-Epibrassinolide improves some physiological disorders in pistachio cultivars", "date": "2017", "keywords": "application; brassinosteroides; control; cultivars; fruit; growth; hormone; pistachio; plant; year; yield", "summary": "The objective of the study was to evaluate the effect of 24-epibrassinolid on quantitative and qualitative traits of pistachio fruit. Vardhini and Rao (1998) showed the relation- ship between increased growth and DNA, RNA and protein synthesis in peanut.", "mime": "application/pdf"}, {"id": "ahs-3119", "words": "3316", "extension": ".pdf", "flesch": "62", "author": "Akutsu, Masako", "title": "Storage conditions of soft X-ray irradiated pollen for producing seedless watermelons", "date": "2018", "keywords": "days; fruit; pollen; storage; vacuum; watermelon", "summary": "The viability of watermelon pollen stored under vacuum or O2 at 25\u00b0C decreased during storage to levels that make O2 and vacuum conditions unac- ceptable as atmospheric media for pollen storage (Table 1). Among the organic solvents, ethyl acetate and ethyl ether were the most suitable for watermel- on pollen storage (Shimizu, 1983).", "mime": "application/pdf"}, {"id": "ahs-3120", "words": "5019", "extension": ".pdf", "flesch": "59", "author": "Bolandnazar, Sahebali; Sharghi, Ali; Naghdi Badi, Hassanali; Mehrafarin, Ali; Sarikhani, Mohammadreza", "title": "The impact of Sinorhizobium meliloti and Pseudomonas fluorescens on growth, seed yield and biochemical product of fenugreek under water deficit stress", "date": "2017", "keywords": "content; fenugreek; growth; meliloti; pgpr; plant; shoot; soil; stress; water; yield", "summary": "Abstract: Bacteria that colonize plant roots and promote plant growth are referred to as plant growth-promoting rhizobacteria (PGPR). kARLIDAG H., eSITkeN A., TURAN m., SAHIN f., 2007 - Effects of root inoculation of plant growth promoting rhi- Adv.", "mime": "application/pdf"}, {"id": "ahs-3121", "words": "2796", "extension": ".pdf", "flesch": "60", "author": "Imani, Ali; Shamili, Mansoore", "title": "Phenology and pomology of almond\u2019s cultivars and genotypes using multivariate analysis", "date": "2017", "keywords": "almond; kernel; length; nut; thickness; traits; weight; width", "summary": "Besides, it has been reported that almond nut length and thickness, and kernel length have significant correlations with kernel length, moreover kernel width have most positive effect on kernel weight (Spiegel-Roy and Kochba, 1981; Kester et al., 1977). To estimate kernel weight, kernel variables had less R square (0.61) than nut variables (0.94).", "mime": "application/pdf"}, {"id": "ahs-3122", "words": "5281", "extension": ".pdf", "flesch": "56", "author": "Razavi, Farhang; Hajilou, Jafar; Aghdam, Morteza Soleimani", "title": "Salicylic acid treatment of peach trees maintains nutritional quality of fruits during cold storage", "date": "2017", "keywords": "acid; activity; antioxidant; days; fruits; peach; postharvest; quality; storage", "summary": "Maintaining firm- ness in peach fruits treated with SA may be result of directly inhibition of cell wall degradation enzymes activity, indirectly decreasing ethylene production, and also higher firmness in peach fruit treated with SA could be attributed to endogenous SA accumula- tion which lead to lower LOX activity and ROS accu- mulation. SA enhance antioxidant systems activity by avoiding and/or scavenging ROS, which led to decrease oxida- tive stress during peach fruits ripening and ultimately maintain postharvest quality by prevention of adverse effects of ROS on fruits quality. 4.", "mime": "application/pdf"}, {"id": "ahs-3123", "words": "4792", "extension": ".pdf", "flesch": "55", "author": "Souri, Mohammad Kazem; Dehnavard, Sara", "title": "Tomato plant growth, leaf nutrient concentrations and fruit quality under nitrogen foliar applications", "date": "2017", "keywords": "ammonium; application; foliar; fruit; leaf; nitrate; nitrogen; plants; sulfate; tomato; urea", "summary": "This can be due to stress condi- tions induced by foliar ammonium spray and less hydraulic conductance of plant tissues (Souri and Roemheld, 2009). SPAD value as a chlorophyll concentration index of plants were high- est in ammonium sulfate treated plants (Table 1), and there was no significant effects among other treatments.", "mime": "application/pdf"}, {"id": "ahs-3124", "words": "7578", "extension": ".pdf", "flesch": "60", "author": "Hapsari, Dhika; Poerwanto, Roedhy; Sopandie, Didy; Santosa, Edi", "title": "Partial root-zone irrigation effects on growth, metabolism and calcium status of Mangosteen seedling (Garcinia mangostana L.)", "date": "2018", "keywords": "calcium; content; control; drought; irrigation; leaf; leaves; mangosteen; plant; pr1; pr3; root; soil; stress; treatment; water; zone", "summary": "Zimmerman (1978) stat- ed that turgor potential is partially or fully main- tained by osmoregulation during water stress by a reduction in the outflow of water from the cell. Previous studies by Sofo et al. (2005) and Aganchich et al. (2007) have reported up- regulation of the antioxidant defense system in young olive plants subjected to different degrees of water stress.", "mime": "application/pdf"}, {"id": "ahs-3125", "words": "6255", "extension": ".pdf", "flesch": "62", "author": "Salehi Salmi, Mohamareza; Falehi Hoseini, M.; Heidari, M.; Daneshvar, M.H.", "title": "Extending vase life of cut rose (Rosa hybrida L.) cv. Bacara by essential oils", "date": "2018", "keywords": "activity; control; cut; essential; et al; flowers; life; oils; persicum; rose; spicata; vase; vulgaris; water", "summary": "The water lose was affected by treat- ments and essential oils increased water retaining capacity compared to control treatment (without essential oil). Sci., 2018 32(1): 61-69 66 mum diameter was observed with flowers kept in 100 \u00b5l.l-1 M. spicata essential oil vase solution (Fig. 1).", "mime": "application/pdf"}, {"id": "ahs-3126", "words": "5195", "extension": ".pdf", "flesch": "57", "author": "Adesina, Jacobs; Rajashekar, Yallappa", "title": "Phytochemical composition and insecticidal potentials of some plant aqueous extracts in suppressing Podagrica spp. (Coleoptera: Chrysomelidae) Infestation on Okra (Abelmoschus esculentus L. Moench)", "date": "2018", "keywords": "coccineus; das; extracts; insect; leaves; okra; plant; podagrica; procera; schweinfurthii; spp; wap", "summary": "infestation The utilization of plant aqueous extracts to sup- press Podagrica spp. Plant extracts often consist of complex mixtures of bioactive constituents which may act as antifeedants, disturb insect growth, development and inhibit oviposition (Gerard and Ruf, 1991; Emimal Victoria, 2010).", "mime": "application/pdf"}, {"id": "ahs-3127", "words": "8903", "extension": ".pdf", "flesch": "61", "author": "Jawdat, Dana; Allaf, A.W.; Taher, N.; Al-Zier, A.; Morsel, N.; Ajii, Z.; Al-Safadi, B.", "title": "Cotton flowering behavior, fiber traits and gene expression under water-shortage stress", "date": "2018", "keywords": "aleppo; control; cotton; cultivars; data; deir al; drought; et al; expression; fiber; flowering; gene; irrigation; jawdat; plants; quality; samples; sci; stress; temperature; water; zour", "summary": "6 - (A) TGA thermograms of cotton fibers in presence of nitrogen. (B) DSC thermograms of cotton fibers in pre- sence of nitrogen.", "mime": "application/pdf"}, {"id": "ahs-3128", "words": "6832", "extension": ".pdf", "flesch": "60", "author": "Hossain, Md.Mokter; Disha, Ribed; Rahim, Md.", "title": "Physio-morphological variations of pummelo genotype (Citrus grandis L. Osbeck)", "date": "2018", "keywords": "breadth; fruit; genotype; number; plant; seeds; weight; wing", "summary": "Correlation coefficient study indicated that leaf length, breadth, petiole wing length, fruit weight, weight of non-edible portion, seed weight, seed number/fruit had positive and highly significant association with leaf breadth, petiole wing breadth, weight of non-edible portion, pulp thick- ness, total weight of seeds/fruit and number of fruits/plant, respectively. In respect of path analysis, leaf breadth, petiole wing length, fruit weight, average weight of seed, %TSS, seed number/fruit had positive direct effect on fruits/plant indicating its importance as a selection criteria.", "mime": "application/pdf"}, {"id": "ahs-3129", "words": "4369", "extension": ".pdf", "flesch": "63", "author": "Taiti, Cosimo; Giordani, Edgardo; Palm, Emily; Petrucci, Antonio William; Bennati, Giuseppe; Gestri, Giovanni; Marone, Elettra; Azzarello, Elisa; Mancuso, Stefano", "title": "Volatile compounds from different fruit parts of two cultivars of Cydonia oblonga", "date": "2018", "keywords": "accession; compounds; cydonia; et al; fruit; quince; samples; taiti; tuscan; vocs; wranja", "summary": "In this work, carpometric, chemometric and spectrophotometric measurements were performed on quince fruits. The identification of the different peel color of quince fruits was assessed using a minolta Cr-200 Chroma-meter (minolta, ramsey, nJ, uSA) according to the Hunter scale, as previously described by Taiti et al. (2017 b).", "mime": "application/pdf"}, {"id": "ahs-3130", "words": "16284", "extension": ".pdf", "flesch": "53", "author": "Shah, Uzma; Mir, Javid; Ahmed, Nazeer; Zaid, Abbu; Jan, Sumira; Fazili, Khalid; Wani, Shabir", "title": "Bio-techniques for improvement of qualitative and quantitative traits in walnut (Juglans regia)", "date": "2017", "keywords": "acid; activity; analysis; anti; antioxidant; breeding; cancer; characterization; cultivars; diversity; et al; extract; food; genotypes; hort; identification; india; issr; juglans; juglans regia; leaves; markers; persian; phenolic; plant; potential; rapd; regia; regia l.; res; review; sci; shah; species; ssr; study; traits; walnut", "summary": "Antioxidant activity Several research reports demonstrated antioxi- dant activity of ethyl acetate, butanol, ether and aqueous methanol extract of walnut kernels, husks and leaves as evaluated by DPPH radical scavenging assay and lipid oxidation inhibition by \u03b2-carotene linoleate (Oliveira et al., 2008; Pereira et al., 2008; Carvalho et al., 2010; Rahimipanah et al., 2010; Table 4 - Description of walnut as phytochemical and its activity against diverse pathogens Walnut Part used Target cell/ pathogen Activity Reference Juglans regia Bark Staphylococcus aureus, E. coli Antibacterial Farooqui et al., 2015 Juglans regia Bark Candida albicans, Candida glabrata, and Candida parapsilosis strains Antifungal Noumi et al., 2010 Juglans regia Kernels MCF-7 (estrogen receptor positive breast adenocarcinoma), KB (oral and mouth), HepG-2 (liver), Caco2 (colon), and WRL-68 (liver) Walnut flavonoids have not been extensively analyzed, however, English walnut leaf was subjected to vigorous chromatographic eval- uation (Pereira et al., 2007).", "mime": "application/pdf"}, {"id": "ahs-3131", "words": "3742", "extension": ".pdf", "flesch": "58", "author": "Niyokuri, Aristide; Nyalala, Samuel; Mwangi, Mariam", "title": "Residual effects of bioslurry and amino acids plant biostimulant on carnation (Dianthus caryophyllus L.) flower quality.", "date": "2017", "keywords": "bioslurry; biostimulant; carnation; effect; flower; length; plant; quality; sci; stalk", "summary": "Carnations plants that had received 2.0, 2.5 and 3.0 L of plant biostimulant had significantly longer flower stalks and significantly thinner flower stalks compared to the control (Table 2). Four levels of bioslurry: 0, 0.125, 0.25 and 0.5 L m-2 were applied in the main plots while four levels of plant biostimulant: 0, 2.0, 2.5 and 3.0 L ha-1 were used in the sub-plots.", "mime": "application/pdf"}, {"id": "ahs-3132", "words": "3210", "extension": ".pdf", "flesch": "59", "author": "Taiti, Cosimo; Redwan, Mirvat; Marone, Elettra; Atzori, Giulia; Azzarello, Elisa; Mancuso, Stefano", "title": "Comparative analysis of Volatile Compounds (potential aromatic ability) in the fruit of 15 olive Italian cultivars", "date": "2018", "keywords": "compounds; cultivars; fruits; oil; olive; vocs", "summary": "Key words: olive fruits, PTR-ToF-MS, volatile organic compounds (VOCs). In particular, VOCs emission is linked to the destruction of the cell structure of olive fruits which activates a specific chain of enzymatic reaction (LOX cascade)", "mime": "application/pdf"}, {"id": "ahs-3133", "words": "3287", "extension": ".pdf", "flesch": "56", "author": "Sabbatini, Leonardo; Taiti, Cosimo; Redwan, Mirvat; Azzarello, Elisa; Marone, Elettra; Mancuso, Stefano", "title": "Monitoring in real time the changes in VOCS emission in sunflower and extra virgin olive oil upon heating by PTR-TOF-MS", "date": "2018", "keywords": "compounds; oil; oils; olive", "summary": "Oil samples were analyzed at two points: Room tem- perature (25\u00b0C) and at 180\u00b0C. The aims of this study are (1) to test the PTR-ToF- MS as a sampling system for the detection of the released compounds from not heated olive and sun- flower oils and to compare with heated oils at their smoking point (180\u00b0C); (2) to monitor and evaluate in real-time the VOCs emitted from different oils, upon the heating from 25\u00b0C to 180\u00b0C, to understand the dynamic of oxidation phenomena.", "mime": "application/pdf"}, {"id": "ahs-3134", "words": "7661", "extension": ".pdf", "flesch": "60", "author": "Akbari, M.; Salehi, Hassan", "title": "Biochemical and physiological evaluations of common bermudagrass [Cynodon dactylon (L.) Pers.] Iranian accessions under cold stress", "date": "2018", "keywords": "accessions; activity; bermudagrass; color; content; f.w; proline; protein; quality; stress", "summary": "The maxi- mum peroxidase activity at -15\u00b0C was observed in Naein accession and the second rank was belonged to common bermudagrass accession collected from Taft. These patterns of physiological variations within common bermudagrass accessions might be due to different genetic background because of various ploidy levels, cross pollination, genetic overlap, germplasm exchange and gene flow.", "mime": "application/pdf"}, {"id": "ahs-3135", "words": "4665", "extension": ".pdf", "flesch": "58", "author": "Tanari, Yulinda; Efendi, Darda; Poerwanto, Roedy; Sopandie, Didy; Suketi, ketty", "title": "Application of calcium to decrease yellow sap contamination at different positions of Garcinia mangostana L.", "date": "2018", "keywords": "aryl; contamination; fruit; light; sap; sector; tree; yellow", "summary": "Sci., 2018 32(2): 169-175 doi: 10.13128/ahs-22018 Application of calcium to decrease yellow sap contamination at different positions of Garcinia mangostana L. Y. Tanari 1 (*), D. Efendi 1, 2, R. Poerwanto 1, 2, D. Sopandie1, K. Suketi 1 1 Department of Agronomy and Horticulture, Faculty of Agriculture, Bogor Agricultural University, 16144 Bogor, West Java, Indonesia. Abstract: The present research aimed at studying the effects of Ca application, through soil fertilization, on yellow sap contamination based on the position of the fruits on the canopy of the tree.", "mime": "application/pdf"}, {"id": "ahs-3136", "words": "4507", "extension": ".pdf", "flesch": "63", "author": "Mahmoudi Meimand, Mohammad; Shamshiri, Mohammad; Roosta, Hamid; Khan, E.U.", "title": "Poultry manure application time and pistachio (Pistacia vera L.) trees", "date": "2018", "keywords": "application; december; january; manure; march; mid; october; parts; pistachio; poultry; week", "summary": "Nut proteins percent was also enhanced by the application of poultry manure in all treatment versus control (Table 3), but maximum value for nut protein percent was observed at mid- March (Mm) application (19.63%) followed by the last week of January (19.5%) and in poultry manures divided into four parts and used in last weeks of October, December, January and mid-March (19.2%) with no significant differences (Table 3). The experiment consisted of seven different poultry manure application time, including poultry manure application as one time in 1) last week of October 2) last week of December 3) last week of January 4) mid-March and dividing into two parts and use in fall or in winter, dividing into four parts and use in dormant seasons (fall and winter).", "mime": "application/pdf"}, {"id": "ahs-3137", "words": "4349", "extension": ".pdf", "flesch": "65", "author": "Shafiee-Masouleh, Seyedeh-Somaye", "title": "Effects of nano-silver pulsing, calcium sulfate and gibberellin on an antioxidant molecule and vase life of cut gerbera flowers", "date": "2018", "keywords": "cut; et al; flavonoid; flowers; gerbera; life; treatments; vase; vase life", "summary": "Liu et al. (2009 a) and L\u00fc et al. (2010) observed that NS pulse treatments extended vase life of the cut gerbera and the rose flowers. Introduction Gerberas (Gerbera jamesonii) are well-known flowers for the variety of their colors, and are popular in the world flower trade (Liu et al., 2009 a; Solgi et al., 2009).", "mime": "application/pdf"}, {"id": "ahs-3138", "words": "7797", "extension": ".pdf", "flesch": "65", "author": "Kassu, Kassaye; Dawit, Habte; Wubengeda, Admasu; Almaz, Admasu; Asrat, Mekonnen", "title": "Yield and yield components of coriander under different sowing dates and seed rates in tropical environment", "date": "2018", "keywords": "biomass; coriander; date; fruit; ha-1; july; kulumsa; robe; sagure; seed; sowing; yield", "summary": "These results corroborate the findings of Carrubba et al. (2006), who reported a highly signifi- cant dependence of coriander yields on precipitation during its growing period with linear correlation coef- ficient of 0.93. Nowak and Szemplinski (2014) also reported the significant influence of temporal varia- tions on coriander yield and yield attributes.", "mime": "application/pdf"}, {"id": "ahs-3139", "words": "5792", "extension": ".pdf", "flesch": "68", "author": "Rezaie Baghbidi, Omid; Jowkar, Abolfazl", "title": "Micropropagation of dwarf schefflera [Schefflera arboricola (Hayata) Merr.] via direct shoot regeneration", "date": "2018", "keywords": "capella; charlotte; cultivars; gold; l-1; length; luseane; plant; schefflera; shoot", "summary": "BRUNNER I., ECHEGARAY A., RUBLUO A., 1995 - Isolation and characterization of bacterial contaminants from Dieffenbachia amoena Bull, Anthurium andreanum Linden and Spathiphyllum sp. shoot cultured in vitro. The other cultivars\u2019 shoot length were significantly lower.", "mime": "application/pdf"}, {"id": "ahs-3140", "words": "5254", "extension": ".pdf", "flesch": "64", "author": "Sayyad-Amin, Pegah; Davarynejad, Gholamhossein; Abedy, Bahram", "title": "The effect of polyamines and SICS on the compatibility, fertility and yield indices of apple cv. Golden Delicious", "date": "2018", "keywords": "et al; fruit; pollen; polyamines; self; set; sics; spd; spm; yield", "summary": "In addition, regarding fruit yield, foliar application of Mn alone showed signifi- cant increase in fruit yield of sweet oranges due to its effect on increasing the number of fruit/tree as well as fruit average weight (Hasani et al., 2012). TAVAKOLI K., RAHEMI M., 2014 - Effect of Polyamines, 2, 4- D, Isopropyl Ester and Naphthalene Acetamide on improving fruit yield and quality of date (Phoenix dactylifera L.).", "mime": "application/pdf"}, {"id": "ahs-3141", "words": "4230", "extension": ".pdf", "flesch": "61", "author": "Schneider, Julia; Thiesen, Leonardo; Engroff, Thaise; Holz, Ezequiel; Alt\u00edssimo, Bruna", "title": "Growth analysis of lettuce under different substrate compositions", "date": "2018", "keywords": "area; compound; dat; growth; leaf; leaves; lettuce; plantmax; plants; substrate", "summary": "Introduction lettuce (Lactuca sativa l.) is one of the most consumed vegetables in the world (gomes et al., 2008), due to its taste, nutritional quality and low price (teodoro et al., 2016). this rate tends to be higher at the beginning of the development of the crop due to lower self- shading (gondim et al., 2008).", "mime": "application/pdf"}, {"id": "ahs-3142", "words": "6033", "extension": ".pdf", "flesch": "61", "author": "Hosseini, Hamid; Chehrazi, M.; Nabati Ahmadi, D.; Mahmoodi Sorestani, M.", "title": "Colchicine-induced autotetraploidy and altered plant cytogenetic and morpho-physiological traits in Catharanthus roseus (L.) G. Don", "date": "2018", "keywords": "colchicine; diameter; diploid; et al; leaf; length; number; plants; polyploidy; root; roseus; size; stomata; tetraploid", "summary": "As shown above, the number of chloroplasts in stomata guard cells of tetraploid plants was two folds greater than those in diploid plants. Chromosome number, length and diameter of stomata and chloroplast number in stomata of guard cells increased with increased ploidy level, whereas the numbers of stomata decreased from 390 to 177 mm2 in tetraploid plants.", "mime": "application/pdf"}, {"id": "ahs-3143", "words": "6889", "extension": ".pdf", "flesch": "52", "author": "Ali, M.; Mujib, Abdul; Zafar, N.; Tonk, D.", "title": "Somatic embryogenesis, biochemical alterations and synthetic seed development in two varieties of coriander (Coriandrum sativum L.)", "date": "2018", "keywords": "callus; co-1; conversion; embryogenesis; embryos; induction; medium; plant; seeds; synthetic; tissue", "summary": "Somatic embryos started to differentiate on the same 2,4-D added medium but the numbers of somatic embryos were more in RS (63.0 embryos per culture) compared to Co-1 (51.0 embryos per culture). Somatic embryos were encapsulated in various alginate and calcium chloride (CaCl2) solutions and were kept in different temperature regimes for varied periods.", "mime": "application/pdf"}, {"id": "ahs-3144", "words": "12712", "extension": ".pdf", "flesch": "61", "author": "Momenpour, Ali; Imani, Ali", "title": "Evaluation of salinity tolerance in fourteen selected pistachio (Pistacia vera L.) cultivars", "date": "2018", "keywords": "0.00\u00b10.0; b b; c c; chlorophyll; control; cultivars; h d; leaves; level; pistachio; plants; q c; results; salinity; salinity level; stress; y b", "summary": "Cultivar Treatments Cell membrane injury (%) Relative ionic leakage (%) Relative water content (%) Khanjari Control - 37.70\u00b10.010 m-o 85.25\u00b10.64 a A 2.98\u00b11.28 w-y 39.14\u00b10.008 k-o 84.16\u00b10.46 a-b B 8.09\u00b10.91 t-u 44.34\u00b10.005 i-o 81.31\u00b10.51 b C 23.09\u00b13.10 k-m 51.75\u00b10.019 d-k 77.60\u00b10.62 c D 46.47\u00b10.70 b 64.42\u00b10.004 a-c 70.36\u00b11.04 f Akbari Control - 38.05\u00b10.007 l-o 85.08\u00b10.40 a A 0.83\u00b11.21 x-y 38.41\u00b10.016 l-o 84.52\u00b10.60 a-b B 5.27\u00b11.07 u-w 42.30\u00b10.006 j-o 82.90\u00b10.60 a-b C 16.37\u00b11.78 o-q 45.96\u00b10.011 g-o 82.08\u00b10.68 a-b D 27.83\u00b12.18 h-i 50.09\u00b10.013 d-k 80.22\u00b10.56 b Ghazvini Control - 35.62\u00b10.013 o 83.19\u00b10.57 a-b A 0.42\u00b10.19 y 36.59\u00b10.006 m-o 82.98\u00b10.64 a-b B 2.67\u00b12.28 x-y 38.37\u00b10.014 l-o 81.58\u00b10.42 b C 5.89\u00b12.81 u-w 39.73\u00b10.018 k-o 80.88\u00b10.36 b D 16.17\u00b10.62 o-q 45.50\u00b10.16 g-o 78.95\u00b10.45 b-c Italiaie Control - 40.85\u00b10.012 j-o 84.43\u00b10.35 a-b A 0.75\u00b10.79 x-y 40.88\u00b10.005 m-n C 1.02\u00b10.03 s 0.32\u00b10.01 k-n 0.70\u00b10.01 j-l 47.22\u00b11.48 p-r D 0.73\u00b10.02 y-z 0.25\u00b10.01 r-s 0.49\u00b10.01 u-v 40.00\u00b11.87 y-z Sabs", "mime": "application/pdf"}, {"id": "ahs-3145", "words": "5472", "extension": ".pdf", "flesch": "56", "author": "Souri, Mohammad Kazem; Aslani, Maryam", "title": "Beneficial effects of foliar application of organic chelate fertilizers on French bean production under field conditions in a calcarous soil", "date": "2018", "keywords": "amino; application; fertilizers; foliar; growth; organic; plant; pod; soil; souri", "summary": "In conclusion, foliar application of organic chelate fertilizers resulted in higher plant growth under cal- careous soil conditions. The results showed that plant growth, pod yield (79%) and pod quality were improved by application of chelate fertilizers.", "mime": "application/pdf"}, {"id": "ahs-3146", "words": "5279", "extension": ".pdf", "flesch": "58", "author": "Esmaeili, S.; Salehi, Hassan; Khosh-Khui, M.", "title": "Direct and indirect in vitro plant regeneration of two commercial cultivars of perennial ryegrass", "date": "2018", "keywords": "2,4; callus; cultivars; culture; induction; l-1; medium; meristem; plant; regeneration; ryegrass", "summary": "Plant regeneration rate was defined as the percentage of callus that had regenerated shoots. As shown in figure 2, \u02bbGrassland\u02bc has higher regenera- tion rate (~13%) than \u02bbNuman\u02bc. Incidentally, maltose had not notably effect on plant regeneration percent- age in both cultivars lonely but ABA concentrations showed significant effects on plant regeneration rate (Fig. 2).", "mime": "application/pdf"}, {"id": "ahs-3147", "words": "3988", "extension": ".pdf", "flesch": "66", "author": "Rizzo, Domenico; Materazzi, Alberto; Stefani, L.; Panattoni, Alessandra; Pierro, Roberto; Marchi, Guido; Cinelli, Tamara; De Bellis, Luigi; Luvisi, Andrea", "title": "The monitoring program of grapevine phytoplasmas in Tuscany (Italy): results of a four year survey", "date": "2018", "keywords": "east; fig; monitoring; north; samples; tuscany; west", "summary": "Unfortunately, infected samples were found in many different vineyards, thus 23 novel foci were detected, most of them in Lucca (15), but a consistent number (6) in Pistoia, the eastern district of North West territory (Table 2). Additional observations on FD monitoring A comparison between FD findings in 2012 and 2015 in Lucca district of North West territory (where FD findings were numerous) were reported (Fig. 2 c) and pathogen spread seems to be directed towards the South Eastern territories.", "mime": "application/pdf"}, {"id": "ahs-3148", "words": "4129", "extension": ".pdf", "flesch": "57", "author": "Dorneles, Ahos Odin; Pereira, Aline; Possebom, Gessieli; Sasso, Victoria; Rossato, Liana; Tabaldi, Luciane", "title": "Growth of potato genotypes under different silicon concentrations", "date": "2018", "keywords": "concentrations; et al; genotypes; growth; increase; leaf; plants; potato; silicon; weight", "summary": "The presence of Si in the growth medium signifi- cantly influenced on shoot length of potato geno- types (Fig. 1C), where there was significant differ- ence between Si concentrations and control (without Si). For the SMIJ319-7 genotype, Si concentrations (0.5 and 5.0 mM) promoted an increase in the pro- duction of stem dry weight compared to control (Fig. 2B).", "mime": "application/pdf"}, {"id": "ahs-3149", "words": "6646", "extension": ".pdf", "flesch": "56", "author": "Azadshahraki, Farzad; Jamshidi, B.; Mohebbi, S.", "title": "Postharvest melatonin treatment reduces chilling injury and enhances antioxidant capacity of tomato fruit during cold storage", "date": "2018", "keywords": "antioxidant; chilling; content; et al; fruit; h2o2; injury; melatonin; postharvest; ripening; storage; tomato; treatment; zhang", "summary": "Azadshahraki et al. - Postharvest melatonin treatment in tomato fruit during cold storage 309 ZHAO D.Y., SHEN L., FAN B., LIU K.L., YU M.M., ZHENG Y., DING Y., SHENG J.P., 2009 - Physiological and genetic properties of tomato fruits from 2 cultivars differing in chilling tolerance at cold storage.- Food Chem., 74: 348-352. Symptoms of tomato fruit chilling injury were manifested as surface pitting and large green patches or blotchy yellow areas resulting from loss of full red color development ability (Wang, 1993).", "mime": "application/pdf"}, {"id": "ahs-3150", "words": "5305", "extension": ".pdf", "flesch": "60", "author": "Di Stasio, Emilio; Rouphael, Youssef; Raimondi, Giampaolo; El-Nakhel, Christophe; De Pascale, Stefania", "title": "Postharvest performance of cut rose cv. Lovely Red as affected by osmoprotectant and antitraspirant compounds", "date": "2018", "keywords": "acid; baba; control; cut; flowers; leaf; life; plant; proline; rose; stems; stress; vase; water", "summary": "The decline in stem water conductivity, is one of the main reasons for impaired water balance, as well as water stress is the most common reason for reduced cut roses vase life (Halevy, 1976; Joyce and Jones, 1992). Materials and Methods Plant material and growth conditions Two experiments were carried out in order to assess the effects of exogenous applications of L- Proline (Experiment 1) or antitranspirants [specifical- ly: an active compound film forming (pinolene) and a stomatal closure inducing active compound \u03b2- aminobutyric acid ; Experiment 2] on water control in cut stems of rose plants (Rosa spp.", "mime": "application/pdf"}, {"id": "ahs-3151", "words": "4175", "extension": ".pdf", "flesch": "62", "author": "Fran\u00e7a, Christiane; Santos, Mirelle; Ribeiro, Wellington; Cecon, Paulo; Finger, Fernando", "title": "Shelf life of iceberg lettuce affected by hydro cooling and temperature of storage", "date": "2018", "keywords": "cooling; hydro; leaves; lettuce; life; shelf; storage; water", "summary": "Similar results were found for hydro cooled butter lettuce heads, peppermint and coriander leaves, which also had higher relative Fig. 2 - Accumulated fresh weight loss of iceberg lettuce 'Lucy Brown' submitted to the following treatments: T1) The increased shelf life of hydro cooled lettuce was determined by the higher leaf rel- ative water content of hydro cooled lettuce (Table 1).", "mime": "application/pdf"}, {"id": "ahs-3152", "words": "6768", "extension": ".pdf", "flesch": "50", "author": "De Corato, Ugo; Salimbeni, Rocco; De Pretis, Agostino", "title": "Evaluation of an alternative mean for controlling postharvest Rhizopus rot of strawberries", "date": "2018", "keywords": "activity; control; digitata; extract; fruit; g l-1; incubation; mycelia; postharvest; rot; strawberries; time", "summary": "1 - Suppressive effect of Laminaria digitata raw extract (A), and soluble extracts by hexane (B) and ethanol (C), on Rhizopus stolonifer mycelia growth inhibition index (MGI%). 2 - Suppressive effect of Laminaria digitata raw extract (A), and soluble extracts by hexane (B) and ethanol (C), on Rhizopus stolonifer sporangia germination suppression index (SG%).", "mime": "application/pdf"}, {"id": "ahs-3153", "words": "5012", "extension": ".pdf", "flesch": "60", "author": "Spinardi, Anna; Mignani, Ilaria", "title": "Ascorbic acid content and senescence in blueberry (Vaccinium corymbosum L.) during storage.", "date": "2018", "keywords": "acid; ascorbic; atmosphere; blueberry; co2; content; control; days; fruit; kpa; storage; values", "summary": "4 - Changes in blueberry ascorbic acid content during cold storage (0\u00b0C) in different atmosphere regimes (Air; CA1= 4 kPa O2 and 10 kPa CO2; CA2= 2 kPa O2 and 9 kPa CO2). ZHOU Q., MA C., CHENG S., WEI B., LIU X., JI S., 2014 - Changes in antioxidative metabolism accompanying pitting development in stored blueberry fruit.", "mime": "application/pdf"}, {"id": "ahs-3154", "words": "5401", "extension": ".pdf", "flesch": "54", "author": "Vanoli, Maristella; Lovati, Fabio; Grassi, Maurizio; Buccheri, Marina; Zanella, Angelo; Cattaneo, Tiziana; Rizzolo, Anna", "title": "Water spectral pattern as a marker for studying apple sensory texture", "date": "2018", "keywords": "apples; braeburn; crispy; fruit; gala; juicy; kanzi; mealy; texture; water", "summary": "Thus, when an aqueous system, such as apple fruit, is measured by near infrared (NIR) spectroscopy, the light absorbance reflects the water vibrations and the con- tribution (concentration and structure) of the other molecules interacting with water. The aim of this work was to evaluate the feasibili- ty of Aquaphotomics to study the texture sensory profiles of apple fruit belonging to three cultivars having different texture characteristics.", "mime": "application/pdf"}, {"id": "ahs-3155", "words": "6427", "extension": ".pdf", "flesch": "56", "author": "Pace, Bernardo; Capotorto, Imperatrice; Gonnella, Maria; Baruzzi, Federico; Cefola, Maria", "title": "Influence of soil and soilless agricultural growing system on postharvest quality of three ready-to-use multi-leaf lettuce cultivars", "date": "2018", "keywords": "activity; ammonium; antioxidant; content; cultivars; ezra; lettuce; postharvest; quality; soilless; storage; system; total", "summary": "Results of the present study showed that soilless growing system can positively affect qualitative and microbiologi- cal parameter of lettuces studied, and it can be considered a good soilless growing technique in order to obtain high quality multi-leaf lettuces for ready- to-use industry. Sci., 2018 32(3): 353-362 354 baby- and multi-leaf have been developed recently as high quality lettuce varieties for the ready-to-use market.", "mime": "application/pdf"}, {"id": "ahs-3156", "words": "4669", "extension": ".pdf", "flesch": "63", "author": "Mirjalili, S.A.; Kavoosi, B.; peyro, Yusef", "title": "Assessment of vase life and postharvest quality of cut rose (Rosa hybrida cv. Angelina) flowers by application of cumin (Cuminum cyminum L.) essential oil and 8-hydroxyquinoline sulfate", "date": "2018", "keywords": "cumin; cut; flowers; hqs; hydroxyquinoline; life; mg\u00b7l-1; oil; postharvest; rose; sulfate; vase", "summary": "Thwala et al. (2013) used cumin essential oil for decreasing degradation and ves- sel boring in orchids resulted in delay of senescence. Treatments were 8-hydroxyquinoline sulfate (8-HQS) at four level (0, 200, 400 and 600 mg\u00b7L-1) and cumin essential oil at three level (0, 100, 150 mg\u00b7L-1) in three measuring time (1st day, 8th day and 16th day) after treatment.", "mime": "application/pdf"}, {"id": "ahs-3157", "words": "4570", "extension": ".pdf", "flesch": "60", "author": "Cocetta, Giacomo; Ferrante, Antonio", "title": "Postharvest application of hydrogen peroxide and salicylic acid differently affects the quality and vase life of cut rose (Rosa hybrida L.) petals and leaves", "date": "2018", "keywords": "acid; chlorophyll; cut; days; flowers; h2o2; leaves; life; petals; plant; rose; vase", "summary": "After 7 days of vase life 73.33% of untreated roses were not marketable anymore, while the percentage was lower in response to treatments (47.06% in SA and 25.53% in H2O2). After 4 days of vase life, SA allowed maintaining high- er levels of anthocyanins in petals compared to H2O2 and to controls.", "mime": "application/pdf"}, {"id": "ahs-3158", "words": "6052", "extension": ".pdf", "flesch": "56", "author": "De Sio, F.; Rapacciuolo, M.; De Giorgi, A.; Trifir\u00f2, A.; Giuliano, B.; Vitobello, L.; Cuciniello, A.; Caruso, Gianluca", "title": "Yield, quality and antioxidants of peeled tomato as affected by genotype and industrial processing in southern Italy", "date": "2018", "keywords": "abbundo; et al; fruits; hybrids; italy; processing; quality; sci; solids; tomato; umex; weight; yield", "summary": "Other authors (Majkowska-Godomska et al., 2008) record- ed a total solids content of tomato fruits ranging from 3.83 to 7.00%. Campos et al. (2006) and Kader et al. (1987) reported that values of soluble solids below 4.5% are considered low for industrial tomatoes; in this respect, Turhan and Seniz (2009) found this quality indicator ranging between 5.0 to 5.5 % in processing tomato fruits and in other studies (Cramer et al., 2001; De Pascale et al., 2001) soluble solids values of tomato fruits ranged from 4 to 6%.", "mime": "application/pdf"}, {"id": "ahs-3159", "words": "6979", "extension": ".pdf", "flesch": "62", "author": "Javadpour, Sedigheh; Golestani, Atefeh; Rastegar, Somayeh; Dastjer, Majid", "title": "Postharvest control of Aspergillus niger in mangos by means of essential oils", "date": "2018", "keywords": "control; eos; essential; fruits; mirzayanii; niger; officinalis; oil; persica; postharvest; rosmarinus; salvia; storage; thymus; vulgaris", "summary": "KUMAR A., SHUKLA R., SINGH P., PRASAD C.S., DUBEY N.K., 2008 - Assessment of Thymus vulgaris L. essential oil as a safe botanical preservative against post harvest fun- gal infestation of food commodities. After 3 weeks of storage, the firmness of control fruits was around 3.06 kg/cm2, while the treated fruits were sig- nificantly firmer (P<0.05).", "mime": "application/pdf"}, {"id": "ahs-3160", "words": "5574", "extension": ".pdf", "flesch": "61", "author": "Cortellino, G.; De Vecchi, P.; Lo Scalzo, R.; Ughini, V.; Granelli, G.; Buccheri, Marina", "title": "Ready-to-eat raspberries: qualitative and nutraceutical characteristics during shelf-life", "date": "2018", "keywords": "acid; content; et al; fruit; glen; heritage; life; raspberries; raspberry; shelf; tulameen", "summary": "Materials and Methods Raw material Investigations were carried out on raspberry fruits of three different cultivars picked at commercial maturity: \u2018Heritage\u2019 and \u2018Glen Magna\u2019, grown at the fruit experimental centre of Milan University (Italy) and \u2018Tulameen\u2019, grown at the experimental compara- tive field for berry fruits of the Catholic University of Piacenza (Italy). Chemical and physical analyses Chemical and physical analyses were carried out on six samples (100 g each) of raspberry fruits per treatment at harvest (raw material) and after 3, 6 and 8 days of storage at 3\u00b0C.", "mime": "application/pdf"}, {"id": "ahs-3161", "words": "9996", "extension": ".pdf", "flesch": "60", "author": "Vanoli, Maristella; Grassi, Maurizio; Spinelli, Lorenzo; Torricelli, Alessandro; Rizzolo, Anna", "title": "Quality and nutraceutical properties of mango fruit: influence of cultivar and biological age assessed by Time\u2010resolved Reflectance Spectroscopy", "date": "2018", "keywords": "acid; carotenoids; class; color; content; cultivar; et al; fruit; haden; mangoes; maturity; palmer; pulp; total; tpc; trans; trs; viol; \u00b5a540", "summary": "The present work aimed at evaluating the levels of antioxidants and antioxidant capacity in the pulp of two cultivars of Brazilian mangoes in relation to fruit maturity class assigned according to the \u00b5a540 value, along with selected quality parameters. Sci., 2018 32(3): 407-420 DOI: 10.13128/ahs-22856 Quality and nutraceutical properties of mango fruit: influence of cultivar and biological age assessed by Time\u2010resolved Reflectance Spectroscopy M. Vanoli 1, M. Grassi 1, L. Spinelli 2, A. Torricelli 2, 3, A. Rizzolo 1 (*) 1 Consiglio per la ricerca in agricoltura e l\u2019analisi dell\u2019economia agraria, Centro di ricerca Ingegneria e Trasformazioni Agroalimentari (CREA- IT), sede di Milano, Via G. Venezian, 26, 20133 Milano, Italy. 2 Istituto di Fotonica e Nanotecnologie, Consiglio Nazionale delle Ricerche (IFN-CNR), Piazza L. da Vinci, 32, 20133 Milano, Italy.", "mime": "application/pdf"}, {"id": "ahs-3162", "words": "7873", "extension": ".pdf", "flesch": "55", "author": "Kazemzadeh-Beneh, Hashem; Samsampour, Davood; Zarbakhsh, Saeedeh", "title": "Biochemical, physiological changes and antioxidant responses of cut gladiolus flower 'White Prosperity' induced by nitric oxide", "date": "2018", "keywords": "activity; antioxidant; control; cut; days; flowers; gladiolus; life; prosperity; snp; vase; vase life; white", "summary": "White Prosperity cut flower is likely to be associated with many parameters, particularly fresh weight content, water uptake, enzymatic or non- enzymatic antioxidant activities, membrane stability and lipid peroxidation. Furthermore, the prolong vase life of White Prosperity flowers can be strongly associated with increasing in TSP and inhibiting from its degrada- tion in flower petals during vase life.", "mime": "application/pdf"}, {"id": "ahs-3163", "words": "6797", "extension": ".pdf", "flesch": "57", "author": "Solomon, Mulugheta; Piazzolla, Francesca; De Chiara, Maria Lucia Valeria; Amodio, Maria Luisa; Colelli, Giancarlo", "title": "Effect of wounding intensity on physiological and quality changes of strawberry fruit", "date": "2018", "keywords": "acid; content; cut; cutting; day; effect; fresh; fruit; increase; intensity; kg-1; phenolic; rate; respiration; storage; wounding", "summary": "Therefore, the main objective of the present study was to determine the effect of wounding intensity, on physiological and quality changes of fresh strawberry fruit, with a particular focus on the respiration rate and nutritional com- pounds. For this reason strawberries are one of the richest fruits in term of antioxidant capacity (Cordenunsi et al., 2002; Pertuzatti and Barcia, 2015).", "mime": "application/pdf"}, {"id": "ahs-3164", "words": "4195", "extension": ".pdf", "flesch": "53", "author": "Ianni, Andrea; Marone, Elettra; Martino, Camillo; Cichelli, Angelo; Martino, Giuseppe", "title": "Effects of ozonation on the phenolic fraction of olive oil mill wastewater (OOMW): a study case", "date": "2018", "keywords": "germination; mill; oil; olive; oomw; ozonation; ozone; phenolic; seeds; water", "summary": "Extraction of phenolic compounds from OOMW The recovery of OOMW phenolic compounds was performed according to the procedure reported by Dammak et al. (2016) with slight modifications. 3. Results Chemical effects of OOMW ozonation Following the ozonation of OOMW, a simple and efficient extraction of phenolic component from each sample was obtained by using ethyl acetate, allowing to analyze in an accurate way the total phenolic con- tent, the antioxidant activity and relative quantities of two biophenols of particular interest: hydroxyty- rosol and tyrosol.", "mime": "application/pdf"}, {"id": "ahs-3165", "words": "5389", "extension": ".pdf", "flesch": "59", "author": "Barzegar, Taher; Heidaryan, N.; Lofti, H.; Ghahremani, Z.", "title": "Yield, fruit quality and physiological responses of melon cv. Khatooni under deficit irrigation", "date": "2018", "keywords": "content; deficit; et al; fruit; irrigation; melon; plant; quality; stress; treatments; water; yield", "summary": "Although deficit irrigation reduce crop yield, may be able to save a significant amount of irrigation water (Sharma et al., 2014). WUE is the relation between yield and the quanti- ty of irrigation water (Zeng et al., 2009).", "mime": "application/pdf"}, {"id": "ahs-3166", "words": "7246", "extension": ".pdf", "flesch": "63", "author": "Emami, S.; Nemati, Seyed Hossein; Azizi, M.; Mobli, M.", "title": "Combining ability and gene action of some tomato genotypes under low light condition", "date": "2018", "keywords": "ability; additive; combining; days; effects; fruit; genotypes; light; number; plant; ripening; sca; tomato; weight; yield", "summary": "Sources of variation Degree of Freedom Total yield per plant (Kg) Average of fruit weight (g) Fruit number per plant Days to first flower Days to ripening Light (L) 1 16.69 ** 14654.49 ** 913.52 359.53 ** 5.43 error A 4 0.74 261.6 140.91 0.61 8.8 Genotypes (G) 41 2.05 ** 1944.73 ** 1593.50 ** 34.74 ** 23.38 ** G\u00d7L 41 0.17 ** 146.54 ** 96.24 ** 2.50 ** 3.99 error B 164 0.07 34.01 18.33 0.97 2.81 Table 4 - Compound analysis of variance for combining ability over two environments for yield, yield components and earliness of F1 hybrids with their reciprocals developed via a 7\u00d77 full diallel cross and estimates of heritability in broad and narrow senses as well as heterosis * Significant at P<0.05 level, ** Significant at P<0.01 level. Sources of variation Degree of Freedom Total yield per plant (Kg) Average of fruit weight (g) Fruits number per plant Days to first flower Days to ripening GCA 6 1.28 ** 3343.91 ** 2063.32 ** 54.66 ** 23.20 ** SCA 14 1.35 ** 430.82 ** 644.60 ** 9.55 ** 8.68 ** REC 21 0.07 ** 23.00 ** 17.79 ** 0.62 * 2.80 ** GCA\u00d7L 6 0.14 ** 120.47 ** 70.33 ** 2.86 ** 1.95 SCA\u00d7L 14 0.06 ** 53.49 ** 42.07 ** 0.94 ** 1.68 * REC\u00d7L 21 0.03 25.29 * 14.49 ** 0.19 0.92 error 164 0.02 11.34 6.11 0.32 0.94 Variance components \u03c32g - 0.06 166.63 102.86 2.72 1.11 \u03c32s - 0.33 104.87 159.62 2.31 1.94 \u03c32r - 0.01 2.92 2.92 0.07 0.47 \u03c32g/ \u03c32s - 0.19 1.59 0.64 1.18 0.57 \u03c32gl - 0.01 10.91 6.42 0.25 0.1 \u03c32sl - 0.02 21.08 17.98 0.31 0.37 \u03c32rl - 0 6.98 4.19 -0.07 -0.01 H2", "mime": "application/pdf"}, {"id": "ahs-3167", "words": "4690", "extension": ".pdf", "flesch": "60", "author": "Semarayani, Cokorda; Aziz, Sandra; Melati, Maya", "title": "Essential oil production of Murraya paniculata (L.) Jack at different harvest times", "date": "2018", "keywords": "anthesis; compounds; day; flower; harvesting; oil; oils; paniculata; times", "summary": "comparing among flower stages, it was found that anthesis flowers harvested at 05.00- 07.00 Am had the highest percentage of essential oils. M. paniculata flowers were collected at three different flower ages, comprised of two days before anthesis, one day before anthesis and the day of anthesis (blooming).", "mime": "application/pdf"}, {"id": "ahs-3168", "words": "4167", "extension": ".pdf", "flesch": "64", "author": "Nazemi Rafi, Z.; Salehi, Hassan", "title": "Factor affecting in vitro propagation of some genotypes of Himalayan cedar [Cedrus deodara (Roxb. ex Lamb) G. Don.]", "date": "2018", "keywords": "cedrus; culture; deodara; explants; genotypes; medium; proliferation; shoot; tdz", "summary": "In the first phase, the effect of different growth regulators on axillary shoot proliferation of four genotypes was fig. Axillary shoot proliferation on WPM medium containing 0.8 \u03bcM TDZ and 2 \u03bcM NAA (after 4 weeks); (C) Elongation of axillary bud on EM medium after 90 days.", "mime": "application/pdf"}, {"id": "ahs-3169", "words": "4750", "extension": ".pdf", "flesch": "60", "author": "Khorram, Fereshteh; Ramezanian, Asghar; Saharkhiz, Mohammad Jamal", "title": "In vitro activity of some essential oils against Penicillium digitatum", "date": "2018", "keywords": "cinnamon; citrus; digitatum; eos; growth; oils; postharvest; savory; summer", "summary": "The positive effect of the volatile components of citrus fruit essential oils on P. digitatum and italicum growth has been reported (Caccioni et al., 1998). CACCioni D.r., GUizzArDi M., BionDi D.M., renDA A., rUBerTo G., 1998 - Relationship between volatile com- ponents of citrus fruit essential oils and antimicrobial action on Penicill ium digitatum and Penicill ium italicum. - int.", "mime": "application/pdf"}, {"id": "ahs-3170", "words": "4338", "extension": ".pdf", "flesch": "59", "author": "Mubarak, Ibrahim; Hamdan, Altayeb", "title": "Onion crop response to different irrigation and N-fertilizer levels in dry Mediterranean region", "date": "2018", "keywords": "bulb; crop; deficit; fertilizer; irrigation; levels; onion; water; yield", "summary": "3 - Response of onion crop water productivity (WP) to irri- gation levels. Irrigation water applied and water productivity With no rainfall received during both growing sea- sons (Table 1), large water amounts were applied to meet the high crop water demand.", "mime": "application/pdf"}, {"id": "ahs-3171", "words": "5304", "extension": ".pdf", "flesch": "59", "author": "El-Mergawi, Ragab; El-Desoki, E.R.", "title": "Allelopathic activities of celery extract and its fractions against Corchorus olitorius, Echinochloa crusgalli and Portulaca oleracea weeds", "date": "2018", "keywords": "acid; celery; crusgalli; effect; extract; germination; growth; l-1; oleracea; olitorius; seeds", "summary": "Effect of celery extract and its fraction on growth of weeds Data presented Table 5 revealed that spraying aqueous celery extract and its fractions did not pro- duce any significant effect on growth of two-weeks old of either C. olitorius, or E. crusgalli or P. oleracea weeds. Phenolic acids in aqueous celery extract at a con- centration 20 g l-1 were hydrolyzed with sodium hydroxide (McKeehen et al., 1999) and subjected to HPLC analysis.", "mime": "application/pdf"}, {"id": "ahs-3172", "words": "3189", "extension": ".pdf", "flesch": "54", "author": "Bakhtshahi-Dizgahi, Zahra; Alizadeh, Mahdi; Seifi, Esmaeil; Javadi, Davood; Hosseinpour, Abdollah", "title": "Effects of cold stratification and chemical treatments on seed germination in four hazelnut cultivars", "date": "2018", "keywords": "cultivars; effect; fig; germination; hazelnut; percentage; seed; stratification; treatments", "summary": "Sci., 2018 32(4): 511-516 doi: 10.13128/ahs-20537 Effects of cold stratification and chemical treatments on seed germination in four hazelnut cultivars Z. Bakhtshahi-Dizgahi 1, M. Alizadeh 1 (*), E. Seifi 1, D. Javadi 2, A. Hosseinpour 1 1 Gorgan University of Agricultural Sciences and Natural Resources, Faculty of Plant Production, Department of Horticulture, Gorgan, Iran. Seed germination is a main step in plant life cycle, and is influenced by various biotic and abiotic factors (Yuan and Wysocka-diller, 2006).", "mime": "application/pdf"}, {"id": "ahs-3173", "words": "5353", "extension": ".pdf", "flesch": "60", "author": "Arji, Isa", "title": "Stability analysis of fruit yield of some olive cultivars in semi-arid environmental condition", "date": "2018", "keywords": "ammi; analysis; bearing; cultivars; fruit; genotype; interaction; konservolia; olive; regression; stability; table; years; yield", "summary": "Based on yield cluster analysis olive cultivars were classified into three categories. Abstract: This study was conducted to evaluate yield stability of 12 Iranian and foreign olive cultivars in Dalaho Olive Research Station during 2006-2008.", "mime": "application/pdf"}, {"id": "ahs-3174", "words": "6253", "extension": ".pdf", "flesch": "48", "author": "Benaissa, Asmaa; Djebbar, R.; Abderrahmani, A.", "title": "Diversity of plant growth promoting Rhizobacteria of Rhus Tripartitus in arid soil of Algeria (Ahaggar) and their physiological properties under abiotic stresses", "date": "2018", "keywords": "bacillus; fixation; growth; hcn; isolates; nitrogen; nitrogen fixation; pgpr; phosphate; plant; production; rhizobacteria; rhizosphere; siderophores; solubilization; strains", "summary": "Sci., 2018 32(4): 525-534 DOI: 10.13128/ahs-22424 Diversity of plant growth promoting Rhizobacteria of Rhus tripartitus in arid soil of Algeria (Ahaggar) and their physio- logical properties under abiotic stresses A. Benaissa 1, 3 (*), R. Djebbar (1), A. Abderrahmani (2) 1 Laboratory of Plant Physiology, Department of Biology and Physiology of Organisms, Faculty of Biological Sciences, University of Sciences and Technologies of Houari Boumediene - El-Alia, BP 16011 Bab Ezzouar, Algiers, Algeria. Key words: abiotic stresses, Ahaggar, plant growth promoting Rhizobacteria, Rhus tripartitus.", "mime": "application/pdf"}, {"id": "ahs-3175", "words": "3435", "extension": ".pdf", "flesch": "58", "author": "Melo, Raphael; Jorge, Mar\u00e7al; Botrel, Neide; Boiteux, Leonardo", "title": "Effect of a novel hydrogel amendment and seedling plugs volume on the quality of ornamental/miniature tomato", "date": "2018", "keywords": "amendment; cm\u00b3; fruits; hydrogel; ornamental; plant; plugs; tomato; volume", "summary": "However, studies investigating the effects of hydrogel (H) application on ornamental plants are scarce and limited (Ljubojevi\u0107 et al., 2017). Key words: copolymer, pot plant, Solanum lycopersicum L., transplants.", "mime": "application/pdf"}, {"id": "ahs-3176", "words": "4891", "extension": ".pdf", "flesch": "53", "author": "Golubkina, Nadezhda; Kekina, Helene; Engalichev, Mezar; Antoshkina, Marina; Nadezhkin, Sergey; Caruso, Gianluca", "title": "Yield, quality, antioxidants and mineral nutrients of Physalis angulata L. and Physalis pubescens L. fruits as affected by genotype under organic management", "date": "2018", "keywords": "angulata; content; cultivar; fruits; physalis; pubescens; quality; research; rossip; taste; zolotaya", "summary": "Physalis fruits showed to be a good source of antioxi- dants, K, Mg and P for human beings. Physalis fruit is mostly an exotic product, imported from tropical and subtropical regions, particularly from Central America, where this genus is characterized by the highest biodiversity (Medina-Medrano et al., 2015).", "mime": "application/pdf"}, {"id": "ahs-3177", "words": "4158", "extension": ".pdf", "flesch": "63", "author": "Radice, Silvia; Giordani, Edgardo", "title": "Flower development and pollen vitality of Moringa oleifera Lam. grown in a humid temperate climatic condition", "date": "2018", "keywords": "fig; flowers; grains; miguel; moreno; moringa; oleifera; pollen; san; tucum\u00e1n; viability", "summary": "The main objective of this research was to study flower morphology and anatomy of M. oleifera, as well as microsporogenesis and viability of pollen grains of plants cultivated in Moreno in comparison with those produced in a humid sub-tropical climatic area of Argentina (San Miguel de Tucum\u00e1n). In fact, it is possible to see anthers with pollen grains already formed wrapped in a yellow substance similar to sporopollenin (Fig. 5B).", "mime": "application/pdf"}, {"id": "ahs-3178", "words": "3044", "extension": ".pdf", "flesch": "52", "author": "Cardoso, Jean", "title": "In vitro responses of gerbera (Gerbera jamesonii) cultivars multiplied under different photoperiods", "date": "2018", "keywords": "cardoso; cultivars; gerbera; micropropagation; multiplication; photoperiod; shoots; vitro", "summary": "Sci., 2018 32(4): 557-561 558 (Murashige and Skoog, 1962) added 3% sucrose and Benziladenine (0.5 to 3.0 mg L-1) is the most used for gerbera shoot multiplication (Kanwar and Kumar, 2008; The reduction of photoperiod from 16-h to 12-h resulted in increases in 41.8% to 97.2% of shoot multiplication in all gerbera cultivars.", "mime": "application/pdf"}, {"id": "ahs-3179", "words": "3314", "extension": ".pdf", "flesch": "58", "author": "Acemi, Arda; Avc\u0131 Duman, Yonca; Y\u00fcz\u00fcg\u00fcll\u00fc Karaku\u015f, Yonca; \u00d6zen, Faz\u0131l", "title": "A preliminary investigation on developmental and biochemical responses of Amsonia orientalis to ultraviolet-C irradiation", "date": "2018", "keywords": "activity; amsonia; h2o2; irradiation; min; orientalis; plant", "summary": "UV irradiation may affect growth and meta- bolic processes in plants due to its high quantum energy (Kobashigawa et al., 2011). However, the application of UV irradiation can be hazardous in higher doses.", "mime": "application/pdf"}, {"id": "ahs-3180", "words": "2852", "extension": ".pdf", "flesch": "62", "author": "Casini, Paolo", "title": "Field evaluation of new Kabuli chickpeas lines for the production of canned seeds", "date": "2018", "keywords": "chickpeas; production; seeds; varieties; year", "summary": "Plots were hand-weeded twice (45 and 65 days after emergence Casini - New kabuli chickpeas for canned seeds production 571 [DAE]) during the growth cycle. Casini - New kabuli chickpeas for canned seeds production 573 131: 878-885.", "mime": "application/pdf"}, {"id": "ahs-3181", "words": "6680", "extension": ".pdf", "flesch": "66", "author": "Ghasemi Ghehsareh, Masood; Khosh-Khui, Morteza", "title": "The effect of cutting type, leaf area, leaf number, putrescine and indole-3-Butyric acid on the rooting of Ficus cuttings (Ficus elastica Roxb. ex Hornem.)", "date": "2018", "keywords": "auxin; blade; bud; cuttings; effect; experiment; leaf; leaves; number; rooting; terminal", "summary": "Table 2 - Effect of leaf size, Auxin and Put on root quality (rooting index) of Ficus leaf bud cutting Table 1 - Effect of leaf size, Auxin and Put on root length, root number and root fresh weight of Ficus leaf bud cutting * Means with similar letters (lowercase letters for whole means and capital letters for means of rows and columns) are not significant at 5% level of probability using LSD. In Hibiscus, the maintenance of leaves on cuttings increased rooting (Van Overbeek et al., 1946).", "mime": "application/pdf"}, {"id": "ahs-3182", "words": "5367", "extension": ".pdf", "flesch": "59", "author": "Benaissa, Asmaa; Djebbar, R.; Boucelha, L.", "title": "Eco-physiological and biochemical characterization of Rhus tripartita (Ucria) Grande growing in Algerian Sahara under arid climate", "date": "2018", "keywords": "antioxidant; arid; conditions; content; drought; leaves; plant; proline; rhus; shrub; species; stress; tripartita; water", "summary": "HARRISON M.T., KELMAN W.M., MOORE A.D., EVANS J.R., 2010 - Grazing winter wheat relieves plant water stress and transiently enhances photosynthesis. Moreover, aridity is a natural selection force that influences plant adaptive strategies to water stress (Sayed, 1998).", "mime": "application/pdf"}, {"id": "ahs-3183", "words": "6090", "extension": ".pdf", "flesch": "53", "author": "Galieni, Angelica; Stagnari, Fabio; Pisante, Michele; Platani, Cristiano; Ficcadenti, Nadia", "title": "Biochemical characterization of artichoke (Cynara cardunculus var. scolymus L.) spring genotypes from Marche and Abruzzo regions (Central Italy)", "date": "2018", "keywords": "artichoke; bracts; capitula; et al; g-1; genotypes; globe; receptacle; tfc; tpc", "summary": "Recently, a renewed and growing interest for arti- choke cultivation has been observed worldwide mainly due to its potential uses as functional food: its large immature inflorescences, called capitula or heads, represent a rich source of bioactive com- pounds - including polyphenols with a strong antirad- ical activity (Sch\u00fctz et al., 2004) - inulin, fibres and minerals (Lattanzio et al., 2009; Lombardo et al., 2010; Pandino et al., 2011). Lower antioxi- dant compounds (i.e. polyphenols) is, indeed, consid- ered a qualitative trait required by industry, thanks to the scarce propensity to enzymatic browning phe- nomena after cutting and storage operations (Lattanzio et al., 1994; Lombardo et al., 2010).", "mime": "application/pdf"}, {"id": "ahs-3184", "words": "3744", "extension": ".pdf", "flesch": "60", "author": "Setiawan, Chandra; Utama, Nafi; Pradana, Bintang", "title": "Combination of alginate based edible coating-betel essential oil in extending the shelf life of rose apple cv. Dalhari (Syzygium samarangense)", "date": "2018", "keywords": "alginate; apple; betel; coating; dalhari; food; fruit; oil; rose; storage", "summary": "In conclusion, edible coating treatment with alginate 2.5% and betel essential oil 0.1 % maintained the quality of rose apple cv. Key words: alginate, betel essential oil, edible coating, rose apple cv. Dalhari.", "mime": "application/pdf"}, {"id": "ahs-3185", "words": "7080", "extension": ".pdf", "flesch": "52", "author": "Porto, Alexandre; Wagner J\u00fanior, Am\u00e9rico; Cabral, Vagner; Citadin, Idemir; Zanella, Juliano; Nunes, Isadora; Concei\u00e7\u00e3o, Paulo", "title": "Reflective materials and management practices on the physicochemical and biochemical quality of Merlot grapes", "date": "2018", "keywords": "berries; co2; cycle; film; management; management practices; plant; plastic; practices; quality; raffia; raffia plastic; soil; table; total; use; white", "summary": "Table 1 - Berry drop (%), bunch weight (g), weight of total and individual berries (g), SS (\u00b0Brix), ATT (g of tartaric acid 100 mL-1), pH, SS/TTA ratio, number of berries per bunch, number of bunches, rot berries and bunches (%), production per plant (Kg) of Merlot grapes submitted or not to management practices with or without the use of reflexive films on the soil, in productive cycle 1 of (2009/2010) and productive cycle 2 of (2010/2011) NS= non-significant by the F test. T1= with management practices and no reflexive film; T2= with management practices with reflexive polypropylene white raffia plastic (film 1); T3= with management practices with reflexive metallic raffia plastic (film 2); T4= without manage- ment practices and no reflexive film; T5= without management practices with reflexive polypropylene white raffia plastic (film 1) and (T6) without mana- gement practices with reflexive f metallic raffia plastic (film 2).", "mime": "application/pdf"}, {"id": "ahs-3186", "words": "5681", "extension": ".pdf", "flesch": "62", "author": "Dorneles, Athos Odin; Pereira, Aline; Possebom, Gessieli; Tarouco, Camila; Rossato, Liana; Tabaldi, Luciane", "title": "Ameliorate the cadmium toxicity in Solanum tuberosum L. plants with selenium and silicon application", "date": "2018", "keywords": "cadmium; days; et al; parameters; plants; potato; selenium; silicon; toxicity; treatments", "summary": "Thus, the aim of this work was to test the pos- sibility of using Se or Si as reliever of Cd toxicity in potato plants. For potato plants under experimental conditions used in this study, Si and Se elements proved to be effective in mitigating Cd toxicity.", "mime": "application/pdf"}, {"id": "ahs-3187", "words": "5485", "extension": ".pdf", "flesch": "54", "author": "Aghdam, Maral; HassanPour Asil, Moazzam; Ghasemnezhad, Mahmood; Mousavi Mirkalaei, Seyed Amir Abas", "title": "Effects of pre-harvest applications of different source of calcium on the cell wall fractions and stem bending disorder of Gerbera (Gerbera jamesonii L.) cultivar flowers", "date": "2018", "keywords": "bending; calcium; cell; cultivars; cut; effects; et al; flowers; gerbera; lignin; stem; treatments; water", "summary": "The cell wall materials of the proximal end of flower stem were fractioned following the method of Li et al. (2012). In current research, applying calcium increased calcium concentration in stem of cut flowers.", "mime": "application/pdf"}, {"id": "ahs-3188", "words": "5745", "extension": ".pdf", "flesch": "58", "author": "Ashori, Marjan; Ghasemnezhad, Mahmood; Biglouei, Mohammad Hassan", "title": "Influence of post-v\u00e9raison water deficit on berries yield and quality of three table grape cultivars", "date": "2018", "keywords": "berry; cultivars; deficit; effect; etc; experiment; grape; irrigation; rdi; water; year; yield", "summary": "The effects of regulated deficit irrigation (RDI) on fruit yield and quality of grape cultivars NS= not significant, ** significant at p<0.01, * significant at p<0.05. Sci., 2019 33(1): 67-75 74 ous study, water shortage can strongly influence anthocyanin accumulation in grape cultivars (Ozden et al., 2010; Kyraleou et al., 2016).", "mime": "application/pdf"}, {"id": "ahs-3189", "words": "6636", "extension": ".pdf", "flesch": "59", "author": "Hajnajari, Hassan", "title": "Apple seed stocks affected scion tree vigor and performance based on maternal self(in)compatibility", "date": "2018", "keywords": "apple; azayesh; delicious; growth; length; morabbaei; number; rootstock; scion; seed; shoot; table; year", "summary": "Key words: breeding, dwarfness, genetic purity, inductive effect, Malus \u00d7 domes- tica Borkh., seed rootstock. Abstract: In a breeding program to increase uniformity of apple saplings size, shape and vigor the genetic improvement of seed rootstocks was considered as a key point.", "mime": "application/pdf"}, {"id": "ahs-3190", "words": "5756", "extension": ".pdf", "flesch": "57", "author": "Talhouni, Manar; S\u00f6nmez, Kenan; Kiran, Sevin\u00e7; Beyaz, Ramazan; Yildiz, Mustafa; Ku\u015fvuran, \u015eebnem; Ellialt\u0131o\u011flu, \u015eek\u00fcre \u015eebnem", "title": "Comparison of salinity effects on grafted and non-grafted eggplants in terms of ion accumulation, MDA content and antioxidative enyzme activities", "date": "2018", "keywords": "activity; artvin; combinations; genotypes; k\u00f6ksal; na+; naomi; plants; rootstock; salinity; salt; stress; tolerance", "summary": "AKTA\u015f H., 2002 - Selection and physiological characteriza- tion of pepper for resistance to salinity stress. do\u011fAn M., 2004 - in vivo and in vitro investigation of the effect of salinity stress on some physiological parame- ters and antioxidant enzymes activities in the tomato (lycopersicon sp.).", "mime": "application/pdf"}, {"id": "ahs-3191", "words": "5163", "extension": ".pdf", "flesch": "61", "author": "Ghassemi, Saeid; Zehtab-Salmasi, Saeid; Ghassemi-Golezani, Kazem; Alizadeh-Salteh, Saeideh", "title": "Morphological traits and yield of Ajowan affected by different irrigation intervals and growth regulators", "date": "2018", "keywords": "abscisic; acid; ajowan; fig; ghassemi; growth; irrigation; leaf; number; plant; salicylic; stress; water; yield", "summary": "Salicylic acid is a phenolic compound capable of enhancing plant growth and yield in some plants (Arfan et al., 2007). During plant growth and develop- ment, weeds were controlled by hand as required.", "mime": "application/pdf"}, {"id": "ahs-3192", "words": "4681", "extension": ".pdf", "flesch": "65", "author": "Pourghorban, Masoumeh; Khaghani, Shahab; Azadi, Pejman; Mirzakhani, Abbas; Changizi, Mahdi", "title": "Propagation of Rosa hybrida L. cv. Dolce Vita by stenting and stem cutting methods in response to different concentrations of IBA", "date": "2018", "keywords": "cuttings; iba; number; plants; propagation; rooting; roots; stem; stenting", "summary": "Abstract: This study was conducted to investigate the effect of different con- centrations of Indole-3-butyric acid (IBA) in propagation of Rosa hybrida L. cul- tivar Dolce Vita by stenting (cutting and grafting) and stem cutting methods in greenhouse conditions. Then, the stentings and stem cuttings were cultured in a cocopeat + perlite (in 1:1 ratio) medium under mist system.", "mime": "application/pdf"}, {"id": "ahs-3193", "words": "6544", "extension": ".pdf", "flesch": "59", "author": "Ottanelli, Aleandro; Marone, Elettra; Fiorino, Piero", "title": "A new device to improve the mechanical winter pruning in olive trees hedgerows", "date": "2019", "keywords": "air; arbequina; canopy; east; leaves; olive; pruning; shoots; west", "summary": "Average and standard deviations of raw data related to the four treatment (East air On, East air Off, West air On, and West air Off) for each locality and cultivar were compared; since in this experiment Authors were interested in the evaluation of the effectiveness in the performances of a pruning machine (i.e. kg of production or cm of elongation tree-1, or ha-1), only raw data were submitted to the parametric test, as logarithmic transformation is most suitable to express magnitude discrepancy; for each data set, tests were carried out to evaluate the normality of the distributions, and Levene\u2019s test were performed to evaluate homoscedasticity at 95% con- fidence level. The comparison between manual and mechanical pruning highlight a greater operative speed of the second (Giametta and Zimbalatti, 1997), partially compromised by the decreasing of productivity (Ferguson et al., 2002; Pe\u00e7a et al., 2002).", "mime": "application/pdf"}, {"id": "ahs-3194", "words": "5705", "extension": ".pdf", "flesch": "59", "author": "Chand, Ravneel; Jokhan, Anjeela; Kelera, Railoa", "title": "Spiralling whitefly and its management practices in the South Pacific. A review", "date": "2018", "keywords": "aleurodicus; control; dispersus; hawaii; leaves; management; norris; pacific; pest; plants; russell; south; waterhouse; whiteflies; whitefly", "summary": "It is an effective tool in programmes of Integrated Pest Table 1 - Distribution of Aleurodicus dispersus whiteflies in the Pacific found during the whitefly survey (1996-1997) Aleurodicus dispersus AmS CoI Fij Kos Poh Tru Yap Gua Kir MaI Nau Niu NMI Pal PNG SI FrP Ton Tuv Van WSa Distribution in 1996/7 x x x x x x x x x x x x x x x x x x Exotic x x x x x x x x x x x x x x x x x x Serious Pest potential x x x x x x x x x x x x x x x x x x AmS= American Samoa; CoI= Cook Islands; Fij= Fiji; Kos= Kosrae (FSM); Poh= Pohnpei (FSM); Tru= Truk (FSM); Yap= Yap (FSM); Gua= Guam; Kir= Kiribati; MaI= Marshall Islands; Nau= In this paper, an overview of Spiralling whiteflies and its management practices in the South Pacific will be reviewed.", "mime": "application/pdf"}, {"id": "ahs-3195", "words": "3436", "extension": ".pdf", "flesch": "64", "author": "Hakim, Abdul; Qinyan, Zhu; Khatoon, Mohfeza; Gullo, Safawo", "title": "Impact of partial root-zone drying on growth, yield and quality of tomatoes produced in green house condition", "date": "2018", "keywords": "cdi; fruit; irrigation; plant; prd; tomato; treatment; water; weight", "summary": "The blossom-end rot is a physiological disorder of tomato fruit caused by calci- um deficiency or excessive soil moisture fluctuation which reduce uptake and movement of calcium into the plant (Mathew and Salvadore, 2007). Reduced weight loss in the PRD treated tomatoes during the storage is a positive quality attribute in tomato fruit especially for distant market (Table 2).", "mime": "application/pdf"}, {"id": "ahs-3196", "words": "2622", "extension": ".pdf", "flesch": "62", "author": "Hejazi, Ziaurrahman; Sadat, Mohammad; Karimi, Bahadar; Fawad, Mumtaz; Muneer, Ahmad", "title": "Effects of Packing Materials and Ethanol Concentrations on Removal of Astringency of \u2018Rojo Brillante\u2019 in Room Temperature", "date": "2018", "keywords": "astringency; brillante; ethanol; fruits; persimmon; polyethylene", "summary": "Sci., 53: 278-289. KATO K., 1987 - Large-scale trials for the short term de- astringency in persimmon fruits by ethanol. - J. Jpn. Soc. Fruit firmness was deter- mined for each fruit at two pared equatorial posi- tions after peeled, using a hand-held penetrometer equipped with an 8 mm tip.", "mime": "application/pdf"}, {"id": "ahs-3197", "words": "3645", "extension": ".pdf", "flesch": "58", "author": "Colzi, Ilaria; Marone, Elettra; Magnelli, Susanna; Mancuso, Stefano; Azzarello, Elisa; Taiti, Cosimo", "title": "Kinetics of volatile organic compounds (VOCs) released by roasted Coffee during the first ten days after processing", "date": "2019", "keywords": "arabica; coffee; days; et al; samples; time; vocs", "summary": "Coffee samples from Honduras were very rich in VOCs. Statistical data analysis One-way analyses of variance (ANOVA) was per- Colzi et al. - VOCs kinetic in roasted coffee beans 147 formed to compare the total VOCs content in 4 cof- fee stocks over 10 days; the separation of means was calculated by the Fisher\u2019s least significant difference (LSD) test.", "mime": "application/pdf"}, {"id": "ahs-3198", "words": "5031", "extension": ".pdf", "flesch": "59", "author": "Aliyoun Nazari, Samad; Hajilou, Jafar; Zeinalabedini, Mehrshad; Imani, Ali", "title": "Diversity of morpho-physicochemical traits in Iranian sour cherry genotypes using multivariate analysis", "date": "2018", "keywords": "analysis; cherry; content; cultivars; et al; fruit; genotypes; length; prunus; sour; stone; total; traits", "summary": "Sour cherry fruit is mostly used for industrial preserves (jams, purees, juices and concentrates), while only a small por- tion is assigned to fresh consumption. Sour cherry genotypes had a high vari- ability in traits related to fruit characters such as fruit weight, stone volume, total anthocyanin content and total soluble solid.", "mime": "application/pdf"}, {"id": "ahs-3199", "words": "6731", "extension": ".pdf", "flesch": "61", "author": "Keshavarzi, Maryam; Shekafandeh, Akhtar", "title": "The responses of enzymatic and non-enzymatic antioxidant systems of scion \u200eon different rootstocks under water stress deficit", "date": "2018", "keywords": "acid; chlorophyll; content; cultivars; drought; fig; levels; plant; sabz; scion; siah; stress; torsh; water", "summary": "Plant tolerance to water stress depends on their morphological, physiological and biochemical mechanisms that determine the responses of the plant under stress conditions (Penella et al., 2014). Cell membrane injury The results showed that high levels of water stress increased leaf cell membrane damage in all grafted and non-grafted plants (Fig. 5).", "mime": "application/pdf"}, {"id": "ahs-3200", "words": "4209", "extension": ".pdf", "flesch": "60", "author": "Aalipour, Hamed; Nikbakht, Ali; Etemadi, Nematollah", "title": "Relationship between chlorosis, photosynthesis and the nutrient content of plane trees in the presence of chemical and organic fertilizers", "date": "2019", "keywords": "amf; chlorosis; content; leaf; manure; mycorrhizal; plane; plants; soil; treatments; trees", "summary": "It has been reported that the application of FeSO4 (4-8 kg tree-\u00b9) mixed with manure, cotton seed cake, or other organic substances in 8 to 10 holes in the soil around the crowns of apple trees (Malus sylvestris Mill.) resulted in marked correction of Fe chlorosis (Zheng-Qing and Cang-Zhen, 1982). Sci., 2019 33(2): 171-177 DOI: 10.13128/ahs-23326 Relationship between chlorosis, photo- synthesis and the nutrient content of plane trees in the presence of chemical and organic fertilizers H. Aalipour (*), A. Nikbakht, N. Etemadi Department of Horticulture, College of Agriculture, Isfahan University of Technology, 8415683111 Isfahan, Iran. Key words: mycorrhizal fungi, nutrient acquisition, organic matter, symbiosis, urban trees.", "mime": "application/pdf"}, {"id": "ahs-3201", "words": "4364", "extension": ".pdf", "flesch": "53", "author": "Abdi, Gholamreza; Khush-hkhui, Morteza; Shekafandeh, Akhtar", "title": "Embryogenesis in Valerian (Valeriana officinalis L.) using leaf segments", "date": "2019", "keywords": "culture; embryogenesis; embryos; explants; germination; medium; mg\u00b7l-1; naa; officinalis; plant; valeriana", "summary": "Direct somatic embryogenesis was induced using by half- strength MS medium supplemented with 2,4-D (0.5 mg\u00b7l-1), glutamic acid (100 mg\u00b7l-1), 4% sucrose and 8 g\u00b7l-1 agar. The plant derived from direct somatic embryogenesis usually is unicel- lular in origin and hence genetically uniform.", "mime": "application/pdf"}, {"id": "ahs-3202", "words": "5857", "extension": ".pdf", "flesch": "60", "author": "Hemati, Ebrahim; Salehi salmi, Mohamareza; Daneshvar, Mohamad Hosein; Heidari, Mokhtar", "title": "The roles of sodium nitroprusside, salicylic acid, and methyl jasmonate as hold solutions on vase life of Gerbera jamesonii \u2018Sun Spot\u2019", "date": "2019", "keywords": "concentrations; cut; et al; flowers; gerbera; hold; hqs; life; plant; snp; solutions; vase; water", "summary": "Introduction Vase life and quality are key factors that contribute to the aesthetic and benefits of cut flowers (Mansouri, 2012). The short vase life of most cut flowers is mainly due to the water loss, which is an important physio- logical process that affects the main quality characteristics of cut flowers, such as appearance (Salehi Salmi et al., 2018).", "mime": "application/pdf"}, {"id": "ahs-3203", "words": "5255", "extension": ".pdf", "flesch": "65", "author": "Chiomento, Jos\u00e9 Lu\u00eds; Frizon, Patr\u00edcia; Costa, Rosiani; Trentin, Nicolas; De Nardi, Fabiola; Calvete, Eunice", "title": "Water retention of substrates potentiates the quality of lettuce seedlings", "date": "2019", "keywords": "crh; cultivars; fig; hor; lettuce; morphology; quality; root; seedlings; shoot; substrates; system; table; water", "summary": "This study provides a view of the develop- ment of lettuce seedlings using different substrates to improve the seedlings quality (e.g., increase the growth of shoot biomass and root system) grown in greenhouses. Sci., 2019 33(2): 197-204 DOI: 10.13128/ahs-23599 Water retention of substrates potentiates the quality of lettuce seedlings J.L.T. Chiomento \u00b9 (*), P. Frizon \u00b9, R.C. Costa \u00b9, N.S. Trentin \u00b2, F.S. Nardi \u00b9, E.O.", "mime": "application/pdf"}, {"id": "ahs-3204", "words": "5990", "extension": ".pdf", "flesch": "54", "author": "Ghanei, Mohammadreza; Mohammadi, Morad; Pirdashti, Hemmatollah", "title": "Yield and physiological response of Perilla (Perilla frutescens) under different soil fertility treatments", "date": "2019", "keywords": "acid; activity; application; ardehal; biologic; chemical; fertilizer; humic; mashhad; perilla; plant; yield", "summary": "It also affects the efficiency of fertilizer application, pesticides and herbicides. Also, in the Sansen location, the highest catalase activity was obtained from 200 kg/ha chemical fertilizer and biologic fertilizer application (Fig. 5).", "mime": "application/pdf"}, {"id": "ahs-3205", "words": "7804", "extension": ".pdf", "flesch": "61", "author": "Hatamzadeh, Abdollah; Shafiei-Masouleh, Seyedeh-Somayyeh", "title": "The Use of Organic Nano-Supplements of Fertilizer for Lily Forcing Period", "date": "2019", "keywords": "chitosan; cmc; concentrations; cultivars; effects; et al; field; growth; iron; lily; mncc; nanoparticles; osfs; plant; r\u0103cuciu; sci", "summary": "g 15 50.84\u00b12.73 ab 82.20\u00b12.65 ab 46.02\u00b11.99 efg Navona CMC 0 48.30\u00b12.23 ab 81.20\u00b13.01 ab 59.52\u00b10.31 abcd 2.5 47.60\u00b12.01 b 78.00\u00b11.92 ab 60.16\u00b11.54 abcd 5 50.80\u00b12.00 ab 81.80\u00b11.57 ab 61.60\u00b10.58 abc 10 50.30\u00b11.51 ab 81.90\u00b12.65 ab 61.98\u00b11.15 ab 15 46.20\u00b11.83 ab 76.00\u00b12.07 ab 61.40\u00b11.57 abc MNCC 0 48.30\u00b12.23 ab 81.20\u00b13.02 ab 28.08\u00b10.56 abc 6.80\u00b10.58 abc 116.64\u00b10.24 a 94.60\u00b10.24 a 2.5 26.70\u00b11.09 abcdef 6.40\u00b10.51 abc 122.06\u00b10.51 a 93.60\u00b10.51 a 5 28.40\u00b11.41 ab 6.80\u00b10.37 abc 120.39\u00b10.58 a 93.80\u00b10.58 a 10 27.48\u00b10.88 abcd 6.80\u00b10.37 abc 110.43\u00b10.68 a 93.40\u00b10.68 a 15 31.36\u00b12.06 a 7.00\u00b10.58 abc 119.86\u00b10.81 a 94.40\u00b10.81 a Navona CMC 0 32.90\u00b11.61 a 9.00\u00b10.32 a 82.87\u00b10.68 b 59.40\u00b10.68 b 2.5 30.40\u00b10.53 ab 9.50\u00b10.29 ab 80.02\u00b10.73 b 60.20\u00b10.73 b 5 31.00\u00b12.26 ab 9.20\u00b10.49 a 79.80\u00b10.49 b 59.80\u00b10.49 b 10 31.60\u00b11.35 a 9.00\u00b10.63 a 81.16\u00b10.63 b 59.00\u00b10.63 b 15 29.80\u00b11.11 ab 9.40\u00b10.24", "mime": "application/pdf"}, {"id": "ahs-3206", "words": "4508", "extension": ".pdf", "flesch": "62", "author": "Jorkesh, Abbas; Aminifard, Mohammad hossein", "title": "Foliar applicaton of asparagine and casein on biochemical and morphological attributes of garden cress (Lepidium sativum L.) plants under greenhouse conditions", "date": "2019", "keywords": "amino; application; asn; content; csn; foliar; leaf; nitrogen; plant; stem; weight", "summary": "Amino acids is a well- known biostimulant which has positive influence on plant growth, yield and significantly decrease the damages caused by abiotic stresses (Kowalczyk and Zielony, 2008). During plant growth the greenhouse temperature was 25\u02daC on the day and 15\u00b0C during the nights.", "mime": "application/pdf"}, {"id": "ahs-3207", "words": "5757", "extension": ".pdf", "flesch": "65", "author": "Fontana, Daniele; Becker, Carol; Pinheiro, Marcos; Santos, Jullie dos; Caron, Braulio; Schmidt, Denise", "title": "Impact of light quality on the physiological characteristics of Capsicum chinense seeds", "date": "2019", "keywords": "biq; boyra; et al; germination; growth; leds; light; mass; pepper; plant; qualities; quality; red; root; seeds; yellow", "summary": "DAUD N., FAIZAL A., DANNY GEELEN D., 2013 - Adventitious rooting of Jatropha curcas L. is stimulated by phloroglucinol and by red LED light. - Combinations of blue and red LEDs may promote biomass increase (Gu et al., 2012; Maluta et al., 2013; Da Silva et al., 2016) and increase of the root system (Gu et al., 2012).", "mime": "application/pdf"}, {"id": "ahs-3208", "words": "7016", "extension": ".pdf", "flesch": "67", "author": "Tatari, Maryam; Abdollahi, Hamid; Henareh, Mashhid; Dehqani, Mohsen", "title": "Selection of open pollination progenies in some pear species in order to achieve dwarf and drought tolerant rootstocks", "date": "2019", "keywords": "drought; genotypes; height; khoj; khoj n.; p. communis; p. salicifolia; pear; seedling; species; stress", "summary": "4 - Height of single genotypes in P. communis cv. P. communis is more commonly known as Khoj and is scattered in the forests of the north, West Azarbaijan, Sardasht and Baneh in Kordestan province.", "mime": "application/pdf"}, {"id": "ahs-3209", "words": "3326", "extension": ".pdf", "flesch": "57", "author": "Modarresi, Mostafa; Jalali-Javaran, Mokhtar; Shams-Bakhsh, Masoud; Zeinali, Sirous; Mirzaee, Maliheh", "title": "TuMV as an efficient transient vector for expressing heterologous proteins in Nicotiana tabacum and N. benthamiana", "date": "2019", "keywords": "benthamiana; expression; fig; gfp; plants; protein; tobacco; transient; tumv; vector; virus", "summary": "Florescence microscopy results indicated that TuMV could infect tobacco plants and accumulate GFP protein in plant leaves. Dot-Blot assay (Fig. 4) indicated that GFP protein was recognized by specific antibody and developed brown color in transformed plants and positive con- trol.", "mime": "application/pdf"}, {"id": "ahs-3210", "words": "5547", "extension": ".pdf", "flesch": "54", "author": "Golubkina, Nadezhda; Seredin, Timofei; Antoshkina, Marina; Baranova, Helene; Stoleru, Vasile; Teliban, Gabriel; Caruso, Gianluca", "title": "Effects of crop system and genotype on yield, quality, antioxidants and chemical composition of organically grown leek", "date": "2019", "keywords": "acid; antioxidant; content; crop; leek; porrum; pseudo; selenium; stems", "summary": "Camus 27.1 fg 401.6 cd 786.3 ab 63.1 de 81.4 ab Vesta 24.3 g 345.3 de 855.5 a 68.1 cd 85.4 a Summer breeze 28.0 fg 379.7 de 716.3 b 72.1 bc 72.3 bc Golubkina et al. - Crop system and genotype effects in Allium porrum 267 tion between selenium and polyphenol content was found in wheat (Lachman et al., 2011) and a negative correlation between quercetin and selenium was recorded in A. cepa (Golubkina et al., 2016). Separate plant fortifica- tion with Se and I showed the possibility of mutual stimulation by the two elements (Golubkina et al., 2018 a).", "mime": "application/pdf"}, {"id": "ahs-3211", "words": "7529", "extension": ".pdf", "flesch": "65", "author": "Motaghayer, Mahroo; Azizi, Majid; Teheranifar, Ali", "title": "Nanosilver, salicylic acid and essential oils effects on water relations of gerbera \u2018Rosalin\u2019 cut flowers", "date": "2019", "keywords": "cut; et al; flowers; gerbera; life; mg.l-1; peppermint; stem; thyme; treatment; vase; vase life; water", "summary": "EO increased lisianthus cut flower vase life (Kazemi et al., 2014) and clove EO and water extract increased gerbera \u2018Ecco\u2019 vase life (Ziyaei Movahed et al., 2010). Based on the results of this study, new antimicro- bial agents such as NS, thyme and peppermint EOs had a positive effect on flower vase life and water content.", "mime": "application/pdf"}, {"id": "ahs-3212", "words": "6182", "extension": ".pdf", "flesch": "56", "author": "Antonetti, Maurizio; Nin, Stefania; Burchi, G.", "title": "First insight into Araucaria araucana (Molina) K. Koch under its southernmost European growing condition: a proposed descriptor list for morphological characterization", "date": "2019", "keywords": "araucana; araucaria; araucaria araucana; chile; climate; descriptor; female; fig; pistoia; plants; populations; species; trees; year", "summary": "8 - Habitus variability in Araucaria araucana trees grown in Pistoia\u2019s hinterland in a plain area. Phenology Throughout three-year growing cycles (2015- 2017), the phenological phases (onset of flowering, full bloom, fertilization, fruit ripening and seed pro- duction) of A. araucana trees belonging to 8 putative populations were observed every two weeks from March to June (during the flower maturation), and monthly in the rest of the year.", "mime": "application/pdf"}, {"id": "ahs-3213", "words": "2409", "extension": ".pdf", "flesch": "63", "author": "Tzavara, Stavroula; Darras, Anastatios; Assimakopoulou, Anna", "title": "Tobacco dust waste as an alternative medium to grow geranium (Pelargonium x hortorum) plants", "date": "2019", "keywords": "growth; medium; number; peat; plants; tobacco; waste", "summary": "Plant growth media containing peat (P) + 0, 5, 10, 25 or 50% TD were prepared and tested on geranium plant growth and development. \u201cML Diego\u201d grown in P+5% or P+10% TD maintained similar or higher height, num- ber of leaves, number of inflorescences, net CO2 assimilation and transpiration rates to the control plants (i.e. P+0% TD) (Table 3).", "mime": "application/pdf"}, {"id": "ahs-7363", "words": "7102", "extension": ".pdf", "flesch": "66", "author": "Parmoon, Ghasem; Moosavi, Seyed Amir; Siadat, Seyed Ataollah", "title": "Descriptions of okra seed longevity loss behavior using nonlinear regression models", "date": "2019", "keywords": "aging; data; ecotypes; germination; model; okra; parameter; seed; vigor; weibull", "summary": "In this study, vari- ous nonlinear models, including logistic, Hill, Weibull, Sigmoid, Gompertz and Probit, were applied on seed germination data, obtained from the accelerated aging test of three Iranian okra landraces. Seed germination as the complex physiologically active process is initi- ated with water uptake by dry seeds and completed by radicle protrusion from the seed coat (Bewley and Black, 1994; McDonald and Kwong, 2005).", "mime": "application/pdf"}, {"id": "ahs-7364", "words": "4972", "extension": ".pdf", "flesch": "67", "author": "Dadashpour, Ahmad; Talaie, A.R.; Askari-Sarcheshmeh, M.A.; Gharaghani, A.", "title": "Influence of two training systems on growth, yield and fruit attributes of four apple cultivars grafted onto \u2018M.9\u2019 rootstock", "date": "2019", "keywords": "apple; cultivars; fruit; fuji; system; training; tree; yield", "summary": "GONKIEWICZ A., 2011 - Effect of tree training system on yield and fruit quality of sweet cherry \u2018Kordia\u2019. Sci., 39: 158-163. OZKAN Y., YILDIZ K., KUCUKER E., CEKIC C., OZGEN M., AKCA Y., 2016 - Performance of \u2018Fuji\u2019 apple on M.9 rootstock in different tree training systems for the first five years. - J. Agr.", "mime": "application/pdf"}, {"id": "ahs-7365", "words": "3632", "extension": ".pdf", "flesch": "61", "author": "Idris, I.; Shoaib, A.", "title": "Efficiency of AFLP markers to detect genetic variation in Phthorimaea operculella (Lepidoptera: Gelechiidae) offspring irradiated males", "date": "2019", "keywords": "aflp; analysis; dna; families; males; operculella; potato; samples; sterility; technique", "summary": "Consequently, it is known, that DNA damages caused by irradiated males at 150 Gy are irreversible and randomly inherited to their offspring (Makee and Saour, 2004; Vreysen et al., 2016). DNA extraction and AFLP analysis Six DNA isolation protocols of P. operculella males from adult stage were used to obtain a good quality and quantity of DNA for AFLP analysis (M1:", "mime": "application/pdf"}, {"id": "ahs-7366", "words": "3636", "extension": ".pdf", "flesch": "60", "author": "das Souza, Aline; Smiderle, Oscar Jose; Pedrozo, Cassia Angela", "title": "Long-time storage of Pochota fendleri seeds with different packaging", "date": "2019", "keywords": "fendleri; germination; months; pet; pochota; quality; seeds; smiderle; souza; storage", "summary": "The collected seeds were selected and sorted as to weight (small seeds being those that passed through a 4 mm diameter sieve, having a mean individual weight of 0.027 g; and large seeds, those that were retained in a 4.5 mm diameter sieve, with a mean individual weight of 0.048 g). The germination test was carried out on four replications of 50 seeds, in plastic boxes (gerbox\u00ae) on Souza et al. \u2010 Seeds storage of Pochota fendleri 329 germination paper (germitest\u00ae) moistened with dis- tilled water at 2.5 times the weight of the paper and kept in a germination chamber at 25\u00b12\u00b0C under con- stant light.", "mime": "application/pdf"}, {"id": "ahs-7367", "words": "8295", "extension": ".pdf", "flesch": "56", "author": "Palchetti, Enrico; Calamai, Alessandro; Verdi, Leonardo; Masoni, Alberto; Marini, Lorenzo; Chiaramonti, David", "title": "Preliminary screening of agricultural feedstocks for anaerobic digestion", "date": "2019", "keywords": "biogas; biogas production; biomass; cake; corn; crops; digestion; et al; feedstock; jatropha; milk; oil; olive; pelargonium; production; residues; silage; substrates; whey", "summary": "Abstract: The aim of this study is to evaluate the performances in the early stages of biogas production of various unconventional and low inputs crops, such as: kenaf (Hibiscus cannabinus L.), amaranthus (Amarathus cruentus L.), sorghum (Sorghum bicolor L.), and sunflower (Helianthus annuus L.). The results showed that the use of silage from crops with reduced agronomic requests (kenaf and amaranthus) versus a con- ventional crop (corn) led to comparable, or even better, biogas production per- formances during the initial stages.", "mime": "application/pdf"}, {"id": "ahs-7368", "words": "9787", "extension": ".pdf", "flesch": "64", "author": "Adamipour, Nader; Khosh-Khui, Morteza; Salehi, Hassan; Rho, Hyungmin", "title": "Effect of vermicompost on morphological and physiological performances of pot marigold (Calendula officinalis L.) under salinity conditions", "date": "2019", "keywords": "chlorophyll; conditions; content; effects; et al; growth; leaf; marigold; mean; nacl; plants; pot; proline; salinity; salinity stress; sci; shoot; soil; stress; table; treatments; vermicompost; weight", "summary": "For this purpose, an experiment was conducted to determine the effects of vermicompost on some morphological and physiological characteris- tics of pot marigold under salinity stress conditions. As a conse- quence, plants under salinity stress conditions reduce root efficacy in supplying nutrients and water to other organs.", "mime": "application/pdf"}, {"id": "ahs-7369", "words": "3812", "extension": ".pdf", "flesch": "61", "author": "Rejane do Nascimento, Cassia; Chagas, Edvan Alves; Smiderle, Oscar Jose; De Andrade Sousa, Ataiza; Cardoso Chagas, Pollyana", "title": "Biometry and vigor of seeds of Myrciaria dubia (kunth) McVaugh", "date": "2019", "keywords": "camu; emergence; mean; medium; results; seeds; size; values; weight", "summary": "Wagner Junior et al. (2011) demonstrated that seed size has an effect on the emergence and initial development of jabuticaba seedlings (Plinia cauliflo\u2010 ra), and that large seeds gave seedlings that were more vigorous. The variation in seed size may interfere with their physiological quality, still poorly researched in forest species (Oliveira et al., 2009; Smiderle et al., 2016).", "mime": "application/pdf"}, {"id": "ahs-7370", "words": "5996", "extension": ".pdf", "flesch": "62", "author": "Habimana, Sylvestre; Kalyan Murthy, K.N.; Nanja Reddy, Y.A.; Mudalagiriyappa, Mudalagiriyappa; Vasantha Kumari, R.; Hanumanthappa, D.C.", "title": "Impact of aerobic rice-leafy vegetables intercropping systems on weed management", "date": "2019", "keywords": "equivalent; ha-1; intercropping; leafy; palak; rice; systems; uptake; vegetable; weed; yield", "summary": "The higher nutrients uptake by rice crop and leafy vegetables in intercropping of rice with leafy veg- etable palak might be attributed to minimum crop- weed competition as a result of higher weed smoth- ering efficiency, gave the better control of weeds from initial stages which led to lower weed popula- tion and their dry weight, this helped the crop to grow in weed-free environment and absorb more nutrients from the soil. The total nitrogen (153.78 kg ha-1), phospho- rous (45.27 kg ha-1) and potassium (152.22 kg ha-1) uptake by rice crop at harvest were significantly high- er in intercropping of rice with leafy vegetable palak as compared to sole rice (109.90, 29.49 and 109.25 kg NPK ha-1, respectively).", "mime": "application/pdf"}, {"id": "ahs-7371", "words": "3239", "extension": ".pdf", "flesch": "61", "author": "Vakili, A.N.; Bagheri, Hedayat; Azadi, P.", "title": "Direct shoot regeneration of three Petunia cultivars", "date": "2019", "keywords": "alvan; petunia; regeneration; shoot; tdz", "summary": "Alvan cultivar showed the highest percentage of shoot regeneration (100%) and mean number of shoots per explant (25.33) on MS with 2 mg/l TDZ (Fig. 1 b) and the lowest one (6.61) was belong to Mahalat cultivar on MS with 1 mg/l TDZ. The importance of TDZ on regeneration and shoot induction frequency Table 1 \u00ad Effect of modified MS medium supplemented with different concentration of BA on shoot regeneration from leaf explants of P. hybrid The values represent the mean \u00b1 standard error of three replicates.", "mime": "application/pdf"}, {"id": "ahs-7372", "words": "6326", "extension": ".pdf", "flesch": "61", "author": "Gholamian Jazi, Zohre; Etemadi, Nematollah; Aalipour, Hamed", "title": "The physiological responses of four turfgrass species to drought stress", "date": "2019", "keywords": "activity; cat; content; drought; drought stress; enzyme; mda; plant; pod; proline; rwc; sci; sod; species; stress; water", "summary": "In our experiment, F. arundinacea, with low concentration of MDA in diffe- rent levels of drought stress treatment, showed more tolerance to drought stress. Abstract: Drought stress is one of the most important factors which reduce turfgrass growth and quality in the area with restricted rainfall or irrigation water supply.", "mime": "application/pdf"}, {"id": "ahs-7373", "words": "7668", "extension": ".pdf", "flesch": "54", "author": "Al-Chammaa, M.; Al-Ain, F.; Kurdali, Fawaz", "title": "Effect of salicylic acid on growth, nodulation and N2-fixation in water stressed chickpeas using 15N and 13C", "date": "2019", "keywords": "acid; chickpea; et al; fc1; fc3; fixation; growth; nitrogen; plants; salicylic; soil; stress; water; \u03b413c", "summary": "Available l iterature on the relationships between SA and carbon isotope discrimination is very scarce and, to our knowledge, only in one case, the effect of SA on plant water relationships was studied (Barkosky and Einhellig, 1993). Exogenously supplied SA can improve plant growth under stresses by stimulating the accu- mulation of mineral elements including nitrogen (Gunes et al., 2005; Yildirim et al., 2008).", "mime": "application/pdf"}, {"id": "ahs-7374", "words": "3496", "extension": ".pdf", "flesch": "53", "author": "Gori, Massimo; Pecchioli, Simona; Giordani, Edgardo; Saeedi, Mohammad Aziz; Wafa, Fazal Haq; Biricolti, Stefano", "title": "Barcoding assessment of the Citrus species cultivated in the eastern Afghanistan", "date": "2019", "keywords": "afghanistan; barcoding; citrus; dna; italy; local; primers; samples; sequences; species", "summary": "Discussion and Conclusions The barcoding analysis of the afghan germplasm and Citrus species has been carried out with a set of primers targeting nuclear ribosomal DNA or chloro- plast genes (ITS1 and 2, matK, rbcl and psbA-trnH). Universal primers for PCR amplification, used in the present study have been retrieved in lit- erature (Chen et al., 2010;", "mime": "application/pdf"}, {"id": "ahs-7375", "words": "5476", "extension": ".pdf", "flesch": "62", "author": "Hajivar, Bahareh; Zare-Bavani, Mohammad Reza", "title": "Alleviation of salinity stress by hydrogen peroxide and nitric oxide in tomato plants", "date": "2019", "keywords": "content; et al; fig; growth; h2o2; plants; salinity; salt; sci; snp; stress; tomato; water", "summary": "Salinity stress is known detrimental effect on the overall growth and productivity of plants (Ashraf, 2004) and may inhibit plant growth due to reduction of water uptake by plants (Kaya et al., 2003). The MSI was significantly decreased by 50 and 100 mM NaCl stress, however, plants treated with H2O2 and SNP were less affected by salinity stress compared to water sprayed plants.", "mime": "application/pdf"}, {"id": "ahs-7376", "words": "9892", "extension": ".pdf", "flesch": "60", "author": "Abed, Aicha; Bonhomme, \u00a0M.; Lacointe, G.; Bourgeois, G.", "title": "Climate change effect on the bud break and flowering dates of the apple trees in mountainous and plain regions of Algeria", "date": "2019", "keywords": "apple; average; benchicao; bud; burst; change; chuine; climate; cold; flowering; lakhdar; model; sidi; sigmoid; site; temperatures; units; warming; years", "summary": "Some contrasting tendencies according to sites and periods have been demonstrated: very significant warming at Sidi Lakhdar site in autumn and spring, in particular in October and April, disturbing thus the entrance of the buds in the endodormancy and ecodormancy. It seems that the failure to fulfill the need of cold units at Sidi Lakhdar site has strongly affected the goodness of fit of the classic phenological models, confirming indirectly the existence of more complex physiological processes (not taken in consideration by models), which manifest themselves in limited zones such as Sidi Lakhdar site.", "mime": "application/pdf"}, {"id": "ahs-7377", "words": "4439", "extension": ".pdf", "flesch": "56", "author": "Duarte, Willian Naves; Zanello, Cesar Augusto; Cardoso, Jean Carlos", "title": "Efficient and easy micropropagation of Morus nigra and the influence of natural light on acclimatization", "date": "2019", "keywords": "conditions; culture; greenhouse; growth; l-1; medium; micropropagation; morus; nigra; nodal", "summary": "However, the addition of BA, even at the lowest concentration used in culture media (0.25 mg L-1), negatively affected the quantitative (height of plants and number and width of leaves) (Table 1) as well as qualitative parameters of regenerated shoots, show- ing callus formation at the basal cut ends and yellow- ish leaves (Fig. In most of the protocols related to in vitro micro- propagation of Morus sp., the addition of cytokinins Table 1 - Effects of culture medium with different PGRs on the in vitro development and multiplication of nodal segments of Morus nigra * Multiplication rate referring to the mean number of nodal segments obtained by each segment inoculated in vitro.", "mime": "application/pdf"}, {"id": "ahs-7378", "words": "3517", "extension": ".pdf", "flesch": "54", "author": "Aldahadha, Abdallah M.; Al Sane, Khaldoun; Bataineh, Ahmed; Abu Alloush, Asem; Hammouri, Zayed", "title": "Pollen viability and in vitro germination of six pistachio (Pistacia vera L.) cultivars grown in northern Jordan", "date": "2019", "keywords": "conditions; cultivars; germination; pistachio; pollen; pollen germination; pollen viability; storage; viability", "summary": "In addition, this experiment was performed to find a correlation between in vitro pollen germination and viability, to check effi- ciency of stored pollen and to determine which pis- tachio cultivar could be recommended as best polli- nator. It has been indi- cated that the validity of the in vitro evaluation of pollen germination is a predictor of in vivo behavior (Acar and Kakani, 2010).", "mime": "application/pdf"}, {"id": "ahs-7407", "words": "5125", "extension": ".pdf", "flesch": "56", "author": "Raei, Yaghoub; Sayyadi Ahmadabad, Mehdi ; Ghassemi-Golezani, Kazem ; Ghassemi, Saeid ", "title": "Pinto bean and black mustard responses to bio-fertilizers under intercropping system", "date": "2020", "keywords": "bean; bio\u00adfertilizers; chemical; density; fertilizer; intercropping; inter\u00ad; mustard; pinto; pinto bean; sci; species; urea; yield", "summary": "Source df Mean Square Pinto bean (Phaseolus vulgaris L.) Black mustard (Brassica nigra L.) 100 grains weight Biological yield Grain yield Harvest index 100 grains weight Biological yield Grain yield Harvest index Replication 2 72.94 3680597 1131685 2.03 0.01 1786035 157796 2.60 Cropping pattern 2 79.10 ** 40310058 ** 9924157 ** 0.70 NS 0.01 NS 122550980 ** 1961700 ** 5.77 NS Fertilizer (F) 3 140.98 ** 37336605 ** 9970014 ** 17.55 NS 0.14 * 24340924 ** 832223 ** 2.44 NS C \u00d7 F 6 4.78 NS 989636 NS 236278 NS 6.49 NS 0.17 ** 8957965 NS 11308 NS 6.06 NS Error 22 2.75 559597 133108 10.29 0.04 5045637 21412 3.77 Cv % \u00ad 5.23 16.85 16.27 6.40 4.46 17.12 8.53 14.59 Raei et al. \u2010 Pinto bean and black mustard intercropping and bio\u2010fertilizersn 179 cantly increased the field performance of these plants (Table 3, Fig. 1), followed by bio\u00adfertilizers + 50% chemical fertilizer. Application of bio\u00adfertilizers and chemical fertilizer increased most of the agronomic traits in pinto bean and black mustard plants.", "mime": "application/pdf"}, {"id": "ahs-7411", "words": "6028", "extension": ".pdf", "flesch": "62", "author": "Jadidi, Esmaeil ; Tatari, Maryam; Ghasemnezhad, Mahmoud ; Reza Salemi, Hamid", "title": "The salinity tolerance of pomegranate cultivars: Effects of salt stress on root and leaf mineral content ", "date": "2020", "keywords": "content; cultivars; fig; leaf; pomegranate; root; salinity; salt; sodium; stress; water", "summary": "Water salinity up to 3 dS/m increased slightly roots fresh and dry weight of all cultivars and thereafter decreased. Salinity treatments Four levels of water salinity (control, 3, 6, 9 and 12 dS/m) were used for irrigation of different pome\u00ad granate cultivars (Table 2).", "mime": "application/pdf"}, {"id": "ahs-7415", "words": "9236", "extension": ".pdf", "flesch": "57", "author": "Rahimi Dvin, Sama; Gharaghani, Ali; Pourkhaloee , Ali ", "title": "Genetic diversity, population structure, and relationships among wild and domesticated almond (Prunus spp.) germplasms revealed by ISSR markers", "date": "2020", "keywords": "almond; analysis; bands; diversity; elaeagnifolia; et al; firuzabad; flow; genetic; iran; issr; markers; nourabad; number; plant; populations; primer; prunus; scoparia; shiraz; species; structure; study; wild", "summary": "Materials and Methods Field sampling To detect higher genetic diversity (resulting from cross\u00adpollination in natural habitat of the plant mate\u00ad rials used herein) as well as the feasibility of plant materials collection (seeds instead of leaf samples) we chose to use raised seedling populations instead of natural populations in this study. However, higher genetic diversity was observed in certain individuals and populations of the wild almonds.", "mime": "application/pdf"}, {"id": "ahs-7444", "words": "4764", "extension": ".pdf", "flesch": "62", "author": "Demasi, Sonia; Falla, Nicole Melanie; Caser, Matteo; Scariot, Valentina", "title": "Postharvest aptitude of Begonia semperflorens and Viola cornuta edible flowers", "date": "2020", "keywords": "activity; antioxidant; content; cornuta; et al; flowers; food; plants; plastic; semperflorens", "summary": "Nowadays, edible flowers are horticultural niche products, sold as pot plant or as fresh cut flowers, with increasing appeal for the food industry due to their organoleptic and healthy proper\u00ad ties (Kaisoon et al., 2012; Grzeszczuk et al., 2016; Lu et al., 2016). Edible flowers improve the sensorial qualities of food by adding colour, fragrance, flavour and visual appeal to culinary preparations (Kelley et al., 2001a; Mlcek and Rop, 2011; Koike et al., 2015).", "mime": "application/pdf"}, {"id": "ahs-7491", "words": "8968", "extension": ".pdf", "flesch": "62", "author": "Rashidiani, Nahid ; Nazari, Farzad; Javadi, Taimoor ; Samadi, Saadi", "title": "Comparative postharvest responses of carnation and chrysanthemum to synthesized silver nanoparticles (AgNPs)", "date": "2020", "keywords": "activity; agnps; carnation; chrysanthemum; control; cut; end; et al; ethylene; fig; flowers; life; l\u00ad1; period; petals; stem; vase; water", "summary": "Devecchi et al. (2009) evaluated the effect of nanosponges including anti\u00adethylene molecules, such as 1\u00admethyl\u00ad cyclopropene (1\u00adMCP), 1\u00admethylcyclopentene (1\u00ad MCPt), 2,5\u00adnorbornadiene and AgNO3 on vase life of carnation flowers. Flower diameters in this study were significantly influenced by AgNPs in carnation flowers, butthe effect on chrysanthemum was not significant.", "mime": "application/pdf"}, {"id": "ahs-7493", "words": "6705", "extension": ".pdf", "flesch": "59", "author": "Useche-Carrillo, Nora Virginia; Barrientos-Priego, Alejandro Facundo; N\u00fa\u00f1ez-Col\u00edn, Carlos Alberto; Campos-Rojas, Eduardo; Ayala-Arreola, Juan ", "title": "Stem and leaf anatomical and physiological characteristics of \u2018Col\u00edn V-33\u2019 avocado seedlings", "date": "2021", "keywords": "avocado; characteristics; col\u00edn; conductance; density; et al; fig; group; hort; leaf; plants; stem; variables; vessel; v\u00ad33; xylem", "summary": "The graphic representation of the groups in the first factorial plane showed that the Group 4 is the only one that is isolated from the rest and was very different from the other five groups, with most of its Table 2 \u00ad Groups formed according to the cluster analysis with 89 plants derived from \u2018Col\u00edn V\u00ad33\u2019 avocado seedlings, derived from anatomical and physiological characteristics of stem and leaf Group Seedings clustered Group 1 16, 103, 106, 113, 118, 121, 126, 129, 131, 133, 138, 139, 142, 143, 145, 146, 147, 148, 150, 152, 156 Group 2 1, 73, 110, 112, 137, 141, 144, 157, 159 Group 3 5, 13, 14, 21, 22, 23, 57, 72, 74, 80, 86, 96, 123 Group 4 8, 18, 65, 76, 81, 85, 88, 93, 105, 127, 155, 160, 162 Group 5 3, 7, 10, 17, 19, 28, 32, 33, 41, 52, 56, 77, 78, 79, 82, 111 Group 6 62, 87, 92, 99, 101, 104, 107, 114, 115, 117, 119, 120, 122, 124, 128, 130, 158 Fig. The results could indicate that the plants belong\u00ad Table 5 \u00ad Mahalanobis distance and its significance, from anatomical characteristics of stem and leaf, as well of physiological character\u00ad istics of leaf from 89 \u2018Col\u00edn V\u00ad33\u2019 avocado seedlings Group 1 2 3 4 5 6 1 \u00ad 2 18.20 \u00ad 3 24.83 *** 36.28 *** \u00ad 4 37.84 *** 39.65 *** 55.11 *** \u00ad 5 22.39 *** 34.87 *** 16.52 *** 29.83 *** \u00ad 6 12.92 *** 22.02 *** 16.19 *** 36.78", "mime": "application/pdf"}, {"id": "ahs-7651", "words": "6011", "extension": ".pdf", "flesch": "56", "author": "Jos\u00e9 Smiderle, Oscar; das Gra\u00e7as Souza, Aline; Diane Menegatti, Renata ; de Jesus Silva, Thayane ", "title": "Different substrates for seedling production of Euterpe Oleracea Mart.", "date": "2020", "keywords": "et al; euterpe; growth; manure; mart; oleracea; plant; rice husks; sand; seedlings; soil; substrate; t1 +", "summary": "According to Smiderle et al. (2015), caution is needed when using combinations of burnt rice husks and sand in the composition of plant substrates, since both materials allow high water drainage and may result in water deficiency in the plants, which would compromise the processes of photosynthesis and respiration and consequently the maintenance of cellular elongation, resulting in smaller plant growth (Souza et al., 2020). For Figueiredo et al. (2019), N is an essential element for components of the photosynthetic system, such as the chlorophylls, proteins and enzymes that allow satisfactory rates of carbon assimilation to be main\u00ad tained (Taiz et al., 2017; Figueiredo et al., 2019), and thereby guarantee the production of photoassimi\u00ad lates that drive plant growth.", "mime": "application/pdf"}, {"id": "ahs-7653", "words": "5372", "extension": ".pdf", "flesch": "58", "author": "Ibrahim, Ayman ; Grassi, Maurizio; Lovati, Fabio; Parisi, Bruno; Spinelli, Lorenzo; Torricelli, Alessandro; Rizzolo, Anna; Vanoli, Maristella", "title": "Non-destructive detection of potato tubers internal defects: critical insight on the use of time-resolved spectroscopy", "date": "2020", "keywords": "color; defects; detection; et al; flesh; ibs; potato; potatoes; trs; tubers; vanoli", "summary": "1. Introduction Detecting internal defects (internal brown spot, hollow heart, heat (*) Corresponding author: maristella.vanoli@crea.gov.it Citation: IBRAHIM A., GRASSI M., LOVATI F., PARISI B., SPI\u00ad NELLI L., TORRICELLI A., RIZZOLO A., VANOLI M., 2020 \u00ad Non\u2010destructive detection of potato tubers internal defects: critical insight on the use of time\u2010resolved spectroscopy. Many noninvasive techniques (spectroscopic tech\u00ad niques, computer vision systems, ultrasound meth\u00ad ods) have been investigated to assess internal defects in potato tubers with various performance results depending on the type of defect, as reviewed by Rady and Guyer (2015).", "mime": "application/pdf"}, {"id": "ahs-7666", "words": "6680", "extension": ".pdf", "flesch": "58", "author": "Vanoli, Maristella; Spinelli, Lorenzo; Torricelli, Alessandro; Ibrahim, Ayman; Parisi, Bruno; Lo Scalzo, Roberto; Rizzolo, Anna", "title": "Anthocyanin and carotenoid contents assessed by time-resolved reflectance spectroscopy in potato tubers (Solanum tuberosum L.) with different flesh colors ", "date": "2020", "keywords": "ant; carotenoids; color; content; et al; flesh; food; genotypes; potatoes; purple; red; trs; tubers; yellow", "summary": "Ezekiel et al., 2013; Kaspar et al., 2013; Kita et al., 2013; Lachman et al., 2013; Tierno et al., 2015, 2016; Akyol et al., 2016). The highest ANT content was usually found in dark purple genotypes (Ezekiel et al., 2013; Hejtmankova et al., 2013; Lachman et al., 2012, 2013; Nayak et al., 2011; Tierno et al., 2015, 2016).", "mime": "application/pdf"}, {"id": "ahs-7669", "words": "5742", "extension": ".pdf", "flesch": "59", "author": "Palma, Amedeo; Cicilloni, A.M.; Satta, D.; De Pau, L.; D'Aquino, Salvatore", "title": "Effects of kaolin-based particle film on physiological, nutritional, nutraceuticals parameters and Ceratitis capitata infestations in peach fruit at harvest and after storage", "date": "2020", "keywords": "control; et al; film; fruit; harvest; insecticides; kaolin; medfly; particle; quality; sci; storage; surface; treatments", "summary": "One of these mineral products is the kaolin clay, a fine powder, mainly composed of kaolinite, which, sprayed onto trees as a water suspension, forms a white and thin particle film on leaves and fruit surface (Glenn et al., 1999; Mazor and Erez, 2004). This local protocol followed by grow\u00ad ers relies on frequent treatments in order to main\u00ad tain residue levels of insecticides sufficient to kill medfly adults on fruit surface.", "mime": "application/pdf"}, {"id": "ahs-7725", "words": "5041", "extension": ".pdf", "flesch": "61", "author": "Ghasemi Soloklui, Ali Akbar ; Gharaghani, Ali; Sarkhosh, Ali ", "title": "Variations in tree and fruit characteristics revealed potential dwarfing genotypes within Iran\u2019s pomegranate germplasm", "date": "2020", "keywords": "characteristics; cultivars; density; dwarfing; fruit; ghermez; height; length; malas; pomegranate; poost; torosh; tree", "summary": "INGELS C., GEISEL P.M., UNRUH C.L., 2002 \u00ad Fruit trees: Training and pruning deciduous trees \u00ad University of California, ANR Publications, 8057, pp. The primary iden\u00ad tification of dwarf genotypes should be based on field evaluations of fruit tree cultivars and genotypes.", "mime": "application/pdf"}, {"id": "ahs-7760", "words": "6049", "extension": ".pdf", "flesch": "58", "author": "Buccheri, Marina; Caramanico, Rosita; Ughini, Virginia; Grassi, Maurizio; Vanoli, Maristella", "title": "Watercore in \u2018Pomella Genovese\u2019 apples: quality characteristics and antioxidants", "date": "2020", "keywords": "acid; activity; antioxidant; apples; content; fruit; genovese; increase; orchard; pomella; sci; total; watercore", "summary": "Some authors (Zupan et al., 2016) found a lower phenols content in watercore fruit of the cultivars \u2018Delicious\u2019, \u2018Gloster\u2019 and \u2018Fuji\u2019, which were analysed immediately after harvest. Abstract: The study aimed to evaluate apple fruit affected by watercore by a physical and biochemical point of view and, at the same time, to gain an insight into the mechanisms of the watercore\u00adrelated oxidative stress and browning.", "mime": "application/pdf"}, {"id": "ahs-7767", "words": "5951", "extension": ".pdf", "flesch": "64", "author": "Al-Ashoush, Anfal ; Shibli, Rida; Tahtamouni, Reham ; Al-Qudah, Tamara; Abu-Irarmaileh, Bashaer ", "title": "Enhancement of Pentacyclic Triterpenoids (Betulinic and Oleanolic acids) Production from Callus Cultures of Lantana camara L.", "date": "2020", "keywords": "acid; betulinic; callus; camara; effect; growth; lantana; medium; oleanolic; production; table; weight", "summary": "So, this study was carried out to enhance the possibility of production of betulinic and oleanolic acids in Lantana callus cul\u00ad tures by modifying the culture medium using differ\u00ad ent types and levels of growth regulators, sugars, NaCl, and heavy metals in callus culture media. Key words: elicitation, growth regulators, heavy metals, in vitro, Lantana, Lantana camara L., sugars.", "mime": "application/pdf"}, {"id": "ahs-7770", "words": "6432", "extension": ".pdf", "flesch": "59", "author": "Tadayon, Mohammad saeed; Hosseini, Seyed Mashaallah", "title": "Effect of spread and shallow irrigation wetted area and application of organic mulch on citrus decline amelioration ", "date": "2020", "keywords": "application; area; citrus; compost; content; decline; density; depth; fruit; irrigation; leaf; root; soil; trees; water", "summary": "Experimental factors contained the different per\u00ad centage of irrigation wetted area and decreasing irrigation effective root depth by drip irrigation system at three levels \u00ad W0 (control): 30\u00ad40% with 60 cm effective root depth; W1: 50\u00ad60% with 45 cm effective root depth; W2: 70\u00ad80% with 30 cm effective root depth under tree canopy area and the factor of annu\u00ad al application of compost as organic mulch at two levels \u00ad M0 (control): means no application of compost and M1: application of 80 kg compost under tree canopy area with 10 cm thickness as ground cover, after rotating the top soil at 10 cm depth for all treatments. CASTLE W.S., 1978 \u00ad Citrus root systems: their structure, function, growth, and relationship to tree performance.", "mime": "application/pdf"}, {"id": "ahs-7775", "words": "5984", "extension": ".pdf", "flesch": "57", "author": "Menegatti, Renata; Aline das Gra\u00e7as Souza; Valmor Jo\u00e3o Bianchi", "title": "Different environments and doses of controlled-release fertilizer in peach rootstocks production", "date": "2020", "keywords": "crf; days; diameter; environment; et al; greenhouse; growth; height; matter; peach; plants; production; rootstocks; stem; use", "summary": "All variables exhibited interaction (p <0.05) between the environ\u00ad ment factors and the CRF (Osmocote\u00ae) doses (Table 3), indicating that the study of factor interaction is important to define the best condition to stimulate plant growth and development. The interaction between environmental conditions with the application of fertilizers may con\u00ad tribute to optimize the space for plant production in nursery and to reduce the plant production systems impact on the environment.", "mime": "application/pdf"}, {"id": "ahs-7814", "words": "6969", "extension": ".pdf", "flesch": "59", "author": "Vieira Nascimento, M.; Ribeiro \u00c1vila, Mylla Crysthyan ; Fiori de Abreu-Tarazi, Monita ; Oliveira Nogueira, Ana Paula ; Cardoso Campos, Luiz Fernandes ; dos Reis Nascimento, Abadia ", "title": "Identification of promising tomato breeding lines with determinate growth by selection index", "date": "2020", "keywords": "fruit; index; lines; mock; mulamba; number; plant; pxt\u00ad601; selection; table; tomato; traits; values; yield", "summary": "The constitution of tomato fruits for the industry has been remodeled through genetic improvement, to select cultivars with desirable characteristics for processing. ROSADO L.S.D., SANTOS C.E.M.D, BRUCKNER C.H., NUNES E.S., CRUZ C.D., 2012 \u00ad Simultaneous selection in proge\u2010 nies of yellow passion fruit using selection indices.", "mime": "application/pdf"}, {"id": "ahs-7820", "words": "5472", "extension": ".pdf", "flesch": "59", "author": "Fatahi, Saeid; Khodabakhshzadeh, Alireza ; Rostami Tobnag, Ghader", "title": "Effects of putrescine application in culture medium in improving chamomile (Chamomilla recutita (L.) Rauschert.) tolerance to osmotic stress under in vitro conditions: Putrescine improves tolerance to osmotic stress ", "date": "2020", "keywords": "chamomile; effects; et al; mannitol; medium; oil; plants; putrescine; stress; traits", "summary": "In this study, the effect of osmot\u00ad ic stress created by mannitol under in vitro condi\u00ad tions, the main effect of putrescine on the growth of chamomile, and putrescine effects in ameliorating effects of osmotic stress on chamomile were investi\u00ad gated. Plant stress physiology.", "mime": "application/pdf"}, {"id": "ahs-7822", "words": "4388", "extension": ".pdf", "flesch": "50", "author": "Amodio, Maria Luisa; Colelli, Giancarlo", "title": "Physio-chemical quality attributes of \u2018Italia\u2019 grapes from organic and conventional farming at harvest and during storage", "date": "2020", "keywords": "activity; content; food; grapes; harvest; location; quality; storage", "summary": "Conventional grapes maintained a higher visual quality during storage, resulting after 14 days below the limit of mar\u00ad ketability (score 3) but above the edibility limit (score 2); whereas in one location organic grapes were judged not edible. Conventional grapes maintained a higher visual quality during storage, resulting below the limit of marketability (score 3) but above the edi\u00ad bility limit (score 2) at 14 days, whereas in LOC1 (Taranto) at that time organic grapes were judged not edible (data not shown).", "mime": "application/pdf"}, {"id": "ahs-7835", "words": "6966", "extension": ".pdf", "flesch": "60", "author": "Ndereyimana, Assinapol; Nyalala, Samuel; Murerwa, Patrick; Gaidashova, Svetlana", "title": "Growth, yield and fruit quality of tomato under different integrated management options against Tuta absoluta Meyrick ", "date": "2020", "keywords": "absoluta; azadirachtin; et al; fruit; plant; quality; steinernema; tomato; treatments; tuta; yield", "summary": "To determine the effect of the treatments on tomato fruits yield and quality, analysis of variance was carried out; and the means for significantly different treatments (at P\u22640.05) were separated using Tukey\u2019s honestly sig\u00ad nificant difference test. Since pre\u00adhar\u00ad vest activities are responsible for the development of quality parameters in tomato fruits, any technolo\u00ad gy used to improve its production should also be assessed for its effect on fruit quality.", "mime": "application/pdf"}, {"id": "ahs-7848", "words": "4544", "extension": ".pdf", "flesch": "50", "author": "Machado, Maria de F\u00e1tima Pires da Silva; Neves de Azevedo Fernandes, Vanessa; Aparecida Mangolin, Claudete; Florindo Neves, Andr\u00e9a; Sousa Nogueira, Fabio Cesar; Zeni Neto, Hugo", "title": "Extraction of total protein from shoots of Cereus morphological variants (Cactaceae) for proteomic analysis: Extraction of protein for proteomic analysis", "date": "2020", "keywords": "acetone; analysis; cereus; erect; extraction; method; monstruosus; phenol; plants; protein; shoots; tca; tissues; tortuosus", "summary": "Lane 1 \u00ad \u00ad \u00ad \u00ad \u00ad \u00ad 45 \u00ad 24 Lane 2 \u00ad \u00ad \u00ad 77 \u00ad \u00ad 45 \u00ad 24 Lane 3 \u00ad 145 90 77 \u00ad \u00ad 45 39 \u00ad Lane 4 180 145 90 77 \u00ad \u00ad 45 39 \u00ad Lane 5 \u00ad \u00ad \u00ad \u00ad \u00ad \u00ad 45 \u00ad \u00ad Lane 6 \u00ad 145 90 77 61 \u00ad 45 39 24 Lane7 \u00ad \u00ad \u00ad \u00ad \u00ad \u00ad 45 \u00ad \u00ad Lane 8 \u00ad \u00ad \u00ad \u00ad \u00ad 58 45 \u00ad \u00ad Fernandes et al. \u2010 Extraction of protein for proteomic analysis 239 levels of interfering substances require at least two phenol\u00adcomplexing and two antioxidant agents, while at least four phenol\u00adcomplexing and three antioxi\u00ad dant agents are needed for tissues with high levels of interfering substances. PAVOKOVI\u0106 D., KRI\u017dNIK B., KRSNIK\u00adRASOL M., 2012 \u00ad Evaluation of protein extraction methods for proteomic analysis of non\u2010model recalcitrant plant tissues.", "mime": "application/pdf"}, {"id": "ahs-7855", "words": "4981", "extension": ".pdf", "flesch": "61", "author": "Modesti, Margherita; Shmulevitz, Ron ; Brizzolara, Stefano; Tonutti, Pietro", "title": "Short-term low temperature treatments of harvested wine grapes (cv. Vermentino) affect the volatile organic compound profile of the berries", "date": "2020", "keywords": "aroma; berries; grapes; samples; sci; temperature; tonutti; treatments; wine", "summary": "In addition, these prelimi\u00ad nary results obtained on wine grape berries need to be implemented and compared with the technologi\u00ad cal and organoleptic evaluations of the resulting wines. RIZZINI F.M., BONGHI C., TONUTTI P., 2009 \u00ad Postharvest water loss induces marked changes in transcript profil\u2010 ing in skins of wine grape berries.", "mime": "application/pdf"}, {"id": "ahs-7872", "words": "4733", "extension": ".pdf", "flesch": "58", "author": "Nasiri, Amin; Ahmadi, N.; Movahed, G.", "title": "Effects of 1-MCP and ethylene on preservation of quality and vase life of Alstroemeria (cvs. Hercules and Mayfair) cut flowers", "date": "2020", "keywords": "1\u00admcp; activity; alstroemeria; chlorophyll; cut; ethylene; fig; flowers; hercules; life; l\u00ad1; mayfair; treatment", "summary": "Measurement of ethylene After finishing ethylene treatment three flowers from each treatment were placed in a 1.8 L sealed glass bottle and kept at 20 \u00b1 2\u00b0C for 48 h, same as experimental condition. Endogenous ethylene production Ethylene production was measured 48 hours after ethylene treatments.", "mime": "application/pdf"}, {"id": "ahs-7904", "words": "9783", "extension": ".pdf", "flesch": "64", "author": "Abbasifar, Ahmadreza; Valizadehkaji, Babak; Karimi, Mahdieh; Bagheri, Hosein", "title": "The first report: The effect of garlic extract on rooting \u200eof cuttings of some ornamental plants and fruit trees\u200e", "date": "2020", "keywords": "cherry; concentration; cuttings; extract; garlic; length; number; root; shoot; shoot length", "summary": "In the first section, the use of high garlic extract concentration (50 g/l) in rose cuttings and moderate concentration (25 g/l) in wild privet, poplar, berry, grape, apple, and cherry cuttings had positive impacts. According to the results of ANOVA, the interaction of plant type and garlic extract concentrations led to significant differ\u00ad ences in all shoot\u00adrelated traits at 1% level.", "mime": "application/pdf"}, {"id": "ahs-7908", "words": "7761", "extension": ".pdf", "flesch": "61", "author": "Begh\u00e8, Deborah; Fabbri, Andrea; Petruccelli, Raffaella; Marieschi, M.; Torelli, A.; Ganino, Tommaso", "title": "Morphological and molecular characterization of ancient pomegranate (Punica granatum L.) accessions in Northern Italy", "date": "2020", "keywords": "accessions; analysis; characterization; et al; fruit; germplasm; granatum; italy; markers; me8; pomegranate; punica; red; sci; seed; table; traits; weight", "summary": "Correlation analyses between descriptors to reveal possible relationships were car\u00ad Table 1 \u00ad Punica granatum L. accessions studied, coded (ID) and main qualitative characteristics of their fruit, leaf and flower ID Fruit shape Size Epicarp colour Calyx type Leaf shape Petiol colour Mucro Blade colour Flower petal colour Shape short\u00ad stiled Shape long\u00ad stiled ME1 oblate/rounded\u00ad spheroid large/very large reddish\u00adyel\u00ad low/red semi\u00adclosed/ closed elliptic yellow no yellow red/orange medium bell sinuolate jug ME2 oblate/rounded\u00ad spheroid large/very large reddish\u00adyel\u00ad low/red semi\u00adclosed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME3 oblate/rounded\u00ad spheroid large reddish\u00adyel\u00ad low/red semi\u00adclosed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME4 oblate/rounded\u00ad spheroid large/very large reddish\u00adyel\u00ad low/red semi\u00adclosed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME5 oblate/rounded\u00ad spheroid large/very large reddish\u00adyel\u00ad low/red semi\u00adclosed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME6 oblate/rounded\u00ad spheroid large reddish\u00adyellow semi\u00ad closed/ open elliptic red Sci., 2019 33(4): 581\u00ad592 582 a large genetic pool, represented by over 500 described cultivars throughout the world, and by a wide amount of wild plants, and its germplasm is so far only partially explored (Begh\u00e8 et al., 2016).", "mime": "application/pdf"}, {"id": "ahs-8055", "words": "5037", "extension": ".pdf", "flesch": "55", "author": "Bartolini, Susanna; Orlando, M.; Trivellini, Alice; Venturi, F.; Sanmartin, C.; Taglieri, I.; Macaluso, M.; Zinnai, A.; Mensuali-Sodi, Anna", "title": "The residues of fruit and vegetable processing: from \"waste\" to \"resource\" of natural phytochemical compounds", "date": "2020", "keywords": "antioxidant; apple; compounds; et al; extracts; food; peel; potato; quality; waste; water", "summary": "Dipping treatments were per\u00ad formed comparing usually used preservative media (1% butylated hydroxytoluene \u00ad BHT \u00ad and 1% citric acid \u00ad CA) and novel extracts from potato (P) and apple (A) peels obtained by water (W) and 10% Bartolini et al. \u2010 Potato and apple peel extracts on fresh\u2010cut fruits 37 ethanol (Et). Phenolic content (gallic acid mg/g dry weight) Antioxidant capacity (\u03bcmol TEAC/mL) Apple Peel Water extract 9.25 \u00b1 0.26 0.33 \u00b1 0.03 10% ethanol extract 13.14 \u00b1 0.20 * 0.73\u00b1 0.02 * Potato Peel Water extract 2.92 \u00b1 0.41 0.17 \u00b1 0.02 10% ethanol extract 3.95 \u00b1 0.02 * 0.21 \u00b1 0.01 * Bartolini et al. \u2010 Potato and apple peel extracts on fresh\u2010cut fruits 39 the exception of those are considered as a chilling sensitives (tomato, melon etc.) which must be stored at temperatures of 7\u00ad13\u00b0C.", "mime": "application/pdf"}, {"id": "ahs-8085", "words": "7416", "extension": ".pdf", "flesch": "60", "author": "Brizzolara, Stefano; Modesti, Margherita; Rong, Xiangyi ; Tonutti, Pietro", "title": "Volatile compound and gene expression profiles associated with the storage of two peach fruit varieties differently sensitive to chilling injuries", "date": "2020", "keywords": "cbf; cold; control; et al; expression; fruit; genes; lox; peach; peaches; samples; storage; temperature; weeks", "summary": "Cold storage effects on LOX pathway\u2010related VOCs As general trend, during peach fruit ripening volatile compounds associated with green\u00adnotes, such as C6 aldehydes and alcohols, tend to decrease while the levels of molecules associated with fruity\u00adnotes, such as esters and, in particular, lactones follow an opposite trend (Defilippi et al., 2009; Zhang et al., 2011; Key words: cold storage, C\u00adrepeat\u00adbinding factors, lipoxygenase pathway, Prunus persica, volatile organic compounds.", "mime": "application/pdf"}, {"id": "ahs-8094", "words": "10928", "extension": ".pdf", "flesch": "61", "author": "Waweru, Bancy Waithira; Kilalo, Dora Chao; Kimenju, John Wangai; Rukundo, Placide ; Miano, Douglas Watuku", "title": "Evaluation of hot pepper (Capsicum spp.) genotypes for resistance to viruses and aphids in Rwanda", "date": "2020", "keywords": "00767ppr; abc; aphids; cmv; conditions; diseases; et al; field; genotypes; incidence; local; pepper; pepper genotypes; plant; resistance; rwanda; season; severity; table; virus; viruses", "summary": "However, information on hot pepper genotypes that are resistant to virus infection and vector infestation is not documented in Rwanda. Materials and Methods Reaction of hot pepper genotypes to virus infection and aphid infestation under field conditions Source of seeds A total of 18 hot pepper genotypes that included nine local collections obtained from Rwanda National Genbank, five introduced lines provided by World Vegetable Center, Eastern and Southern Africa\u00ad Tanzania and four commercial varieties from seed companies were evaluated (Table 1).", "mime": "application/pdf"}, {"id": "ahs-8098", "words": "4629", "extension": ".pdf", "flesch": "60", "author": "Vendruscolo, Eduardo Prati ; Rodrigues, Aliny Helo\u00edsa Alc\u00e2ntara; Correia, S\u00e1vio Rosa; Oliveira, Paulo Ricardo; Campos, Luiz Fernandes Cardoso; Seleguini, Alexsander", "title": "Economic analysis of crisp lettuce production in different planting spacing and soil cover", "date": "2020", "keywords": "0.25x0.25; cost; cover; et al; lettuce; planting; plastic; production; soil; spacing; straw; toc; usd", "summary": "The presence of a superficial straw layer is benefi\u00ad cial from the point of view of soil quality mainte\u00ad nance (Cardoso et al., 2012), favoring the develop\u00ad ment of plants of economic interest (Torres et al., 2015; Vendruscolo et al., 2017 a). Materials that are easily accessible to the rural producer, such as straw from grazing, can be used as mulch, replacing other materials such as plastic, for example, which has an effective participation in the costs of producing vegetables (Vendruscolo et al., 2017 b), also representing a source for environmen\u00ad tal contamination (Chang et al., 2013).", "mime": "application/pdf"}, {"id": "ahs-8101", "words": "5722", "extension": ".pdf", "flesch": "66", "author": "Haider, Zeeshan; Ahamad, Niaz; Danish, Subhan; Iqbal, Javed; Arif Ali, Muhammad; Khalid Chaudhry, Usman", "title": "Effect of foliar application of boric acid on fruit quality and yield traits of mango", "date": "2020", "keywords": "acid; application; boric; boron; control; effect; et al; foliar; fruit; mango; plant; quality; sci; soil; weight; yield", "summary": "Scientists have also documented that foliar application of B at different rates enhance mango fruit setting panicle\u00ad1, fruit weight and volume (Zhong and Dong, 2000; Bibi et al., 2019). Application of T3 and T2 did not differ significantly for the average yield of mango fruit as compared to con\u00ad trol.", "mime": "application/pdf"}, {"id": "ahs-8103", "words": "7004", "extension": ".pdf", "flesch": "55", "author": "Her\u00eanio Gon\u00e7alves J\u00fanior, Deurimar; De Melo Rodrigues, Lohaynne; Alves de Santana Filho, Jos\u00e9; Nascimento Lima, Wallysson; Ferreira Alves, Anat\u00e9rcia", "title": "Genetic parameters, correlations and path analysis in cowpea genotypes for yield and agronomic traits grown in Cerrado/Amazon Rainforest ecotone", "date": "2020", "keywords": "analysis; coefficient; correlation; cowpea; et al; genotypes; genotypic; grain; indirect; mass; plant; pod; selection; table; traits; variance; yield", "summary": "In some cases, indirect selection based on correlated response may be more effective and faster than direct selection of the desired trait (Cruz et al., 2014). While for the characteristics SPP and Yield presented RSD equal to 12.24% and 21.86%, there\u00ad fore, they are considered regular values, indicating good experimental precision (Cruz et al., 2014; Ferreira, 2018) (Table 2).", "mime": "application/pdf"}, {"id": "ahs-8107", "words": "5016", "extension": ".pdf", "flesch": "56", "author": "Jorkesh, Abbas; Hamidoghli, Yousef; Olfati, Jamalali; Samizadeh, Habibollah; Bakhshi, Davood", "title": "Genetic variability and relationship among different accessions of Froriepia subpinata Bail (Gijavash) an endangered medicinal plant from Iran revealed by ISSR and IRAP markers", "date": "2021", "keywords": "accessions; conservation; diversity; dna; endemic; et al; information; iran; irap; issr; markers; mean; plant; populations; species; table; variation", "summary": "Breeding, 3: 381\u00ad390. LAIKRE L., 2010 \u00ad Genetic diversity is overlooked in interna\u2010 tional conservation policy implementation. WU C.\u00adJ., CHENG Z.\u00adQ., HUANG X.\u00adQ., YIN S.\u00adH., CAO K.\u00adM., SUN C.\u00adR., 2004 \u00ad Genetic diversity among and within populations of Oryza granulata from Yunnan of China revealed by RAPD and ISSR markers: implications for conservation of the endangered species.", "mime": "application/pdf"}, {"id": "ahs-8109", "words": "5219", "extension": ".pdf", "flesch": "56", "author": "Sabina, S.; Jithesh, Mundaya Narayanan", "title": "Mechanical rubbing of tomato internode influence stem growth, improve tensile strength but negatively impact flavonoid levels", "date": "2020", "keywords": "content; control; fig; flavonoid; growth; height; internode; lignin; plants; stem; strength; stress; tensile; tomato; total", "summary": "The mean total height and internodal length (3rd and 4th internode) of 20 plants were recorded and compared with control plants. 3. Results Effect of internode stress on plant height and intern\u2010 odal length of tomato Application of mild mechanical stimuli in the internodes of treated plants resulted in reduction in plant height whereas control plants showed normal growth characteristics (Fig. 1).", "mime": "application/pdf"}, {"id": "ahs-8110", "words": "6856", "extension": ".pdf", "flesch": "61", "author": "Olagunju, Solomon Oladimeji; Sosanya, O.S.; Oguntade, O.A.; Adewusi, F.M.; Odusanya, O.A.; Nassir, A.L.; Joda, A.O.; Adegoke, A.T.; Banjo, O.B.", "title": "Prostrate or upright growth habit in tomato cultivars: contributory roles of stem diameters and fruit weight under fertilizer application", "date": "2020", "keywords": "cultivars; diameter; fertilizer; fruit; growth; growth habit; habit; plant; rates; soil; stem; tomato; tomato cultivars; variation; yield", "summary": "Identifying tomato cultivars with most upright growth characteristics can prevent scorching and rot\u00ad tenness often associated with tomato fruit at maturi\u00ad ty and could contribute to increased fruit quality and fruit yield and reduce cost of staking in tomato pro\u00ad duction. Sci., 2019 33(4): 465\u00ad474 DOI: 10.13128/ahsc\u00ad8110 Prostrate or upright growth habit in tomato cultivars: contributory roles of stem diameters and fruit weight under fertilizer application S.O. Olagunju 1 (*), O.S. Sosanya 1, O.A. Oguntade 1, K.M. Adewusi 1, O.A. Odusanya 1, A.L. Nassir 1, A.O. Joda 1, A.T. Adegoke 1, O.B. Banjo 2 1 Department of Crop Production, College of Agricultural Sciences, Olabisi Onabanjo University, P.M.B. 0012, Ayetoro Campus, Ayetoro, Ogun State, Nigeria.", "mime": "application/pdf"}, {"id": "ahs-8112", "words": "6070", "extension": ".pdf", "flesch": "67", "author": "Zakizadeh, Sara; Kaviani, Behzad; Hashemabadi, Davood", "title": "Micropropagation of two near threatened orchid. Part 1: Catasetum pileatum cv. Alba", "date": "2020", "keywords": "et al; explants; iba; l\u00ad1; medium; mg l\u00ad1; number; orchid; pgrs; plantlets; plbs; root", "summary": "Different PGRs such as \u0251\u00adnaphthaleneacetic acid (NAA), IBA, 1\u00adphenyl\u00ad3\u00ad(1,2,3\u00adthiadiazol\u00ad5\u00adyl)\u00adurea (TDZ), 6\u00adbenzyle amino purine (BAP), 6\u00adbenzylade\u00ad nine (BA) and Kn have been used for tissue culture of threatened and endangered orchids (Roy et al., 2011; Panwar et al., 2012; Zeng et al., 2012; Baker et al., 2014; Bhattacharyya et al., 2016; Kaviani et al., 2017). This means that the PGRs acted synergistically (Roy et al., 2011).", "mime": "application/pdf"}, {"id": "ahs-8115", "words": "6504", "extension": ".pdf", "flesch": "71", "author": "Mohammadi, Mohsen; Kaviani, Behzad; Sedaghathoor, Shahram", "title": "Micropropagation of two near threatened orchid. Part 2: Phalaenopsis amabilis Blume var. Grandiflora", "date": "2020", "keywords": "a\u00adc; et al; iba; leaf; l\u00ad1 ac; l\u00ad1 iba; l\u00ad1 kn; medium; mg l\u00ad1; number; phalaenopsis; plant; plbs; root", "summary": "5.10\u00b11.539 cd 73.30\u00b110.000 a\u00adc 0.00 2.00 2.20\u00b10.493 fg 2.86\u00b10.503 b\u00ade 1.56\u00b10.153 d\u00adg 4.86\u00b11.358 a\u00adc 4.73\u00b10.400 bcdef 4.53\u00b10.737 cd 90.00\u00b115.275 a 0.00 3.00 2.83\u00b10.208 d\u00adg 2.40\u00b10.208 c\u00adh 2.00\u00b10.100 c\u00ade 3.76\u00b10.416 c 3.30\u00b10.231 hi 7.96\u00b12.166 ab 80.00\u00b110.000 ab 0.10 0.00 2.06\u00b10.200 g 1.83\u00b10.321 f\u00adh 1.66\u00b10.100 c\u00adg 4.80\u00b10.889 a\u00adc 4.20\u00b10.794 b\u00adi (D) Callus formation from the explants cultured in media enriched with different concentrations of IBA and Kn (from left to right: 0.50 mg l\u00ad1 IBA + 3.00 mg l\u00ad1 Kn, con\u00ad trol, 1.00 mg l\u00ad1 IBA + 1.00 mg l\u00ad1 Kn and 0.20 mg l\u00ad1 IBA and 0.50 mg l\u00ad1 Kn).", "mime": "application/pdf"}, {"id": "ahs-8118", "words": "6996", "extension": ".pdf", "flesch": "65", "author": "Otieno, Peter Caleb; Nyalala, S.; Wolukau, J.", "title": "Optimization of biosolids as a substrate for tomato transplant production: Biosolids as an alternative substrate in tomato", "date": "2020", "keywords": "biosolids; compost; et al; growth; leaf; p<0.05; peat; plant; production; rates; root; sci; seedlings; soil; substrate; tomato; transplant; use", "summary": "Separation of tomato transplant roots and shoot was done at the crown level. In concurrence with the pre\u00ad Fig. 7 \u00ad Effect of biosolids on tomato seedling root and shoot dry weight at week 5 after planting.", "mime": "application/pdf"}, {"id": "ahs-8125", "words": "6687", "extension": ".pdf", "flesch": "52", "author": "Steidle Neto, Antonio Jos\u00e9; Lopes, Daniela de Carvalho; Silva, Washington Azev\u00eado da", "title": "Feasibility of Vis/NIR spectroscopy to detect and estimate fungicide residues on intact lettuces", "date": "2020", "keywords": "analysis; concentrations; cs2; data; dithiocarbamate; et al; food; fungicide; kg\u00ad1; leaves; lettuce; model; neto; nir; reflectance; residues; spectroscopy; steidle", "summary": "YIP G., ONLEY J.H., HOWARD S.F., 1971 \u00ad Residues of maneb and ethylenethiourea of field\u2010sprayed lettuce and kale. CALDAS E.D., MIRANDA M.C.C., CONCEI\u00c7\u00c3O M.H., SOUZA L.C.K.R., 2004 \u00ad Dithiocarbamates residues in Brazilian food and the potential risk for consumers.", "mime": "application/pdf"}, {"id": "ahs-8127", "words": "4840", "extension": ".pdf", "flesch": "61", "author": "Aghaye Noroozlo, Yaghoub; Souri, Mohammad Kazem; Delshad, Mojtaba", "title": "Effects of foliar application of glycine and glutamine amino acids on growth and quality of sweet basil", "date": "2020", "keywords": "acids; amino; application; basil; et al; foliar; glutamine; glycine; growth; leaf; mg\u00b7l\u00ad1; plants; souri", "summary": "Amino acids can have stimulation effect on plants growth, and in this respect, it has been shown that application of amino acids can enhance chloro\u00ad phyll content and leaf greenness of plants (Kielland, 1994; Foliar application of amino acids can have benefi\u00ad cial effects on plant growth and production (Sadak et al., 2015; Shams et al., 2016; Hussain et al., 2018; Souri and Aslani, 2018).", "mime": "application/pdf"}, {"id": "ahs-8128", "words": "5507", "extension": ".pdf", "flesch": "63", "author": "Seydi, Shima; Sedaghathoor, Shahram; Kaviani, Behzad", "title": "Plant regeneration by organogenesis from bulbous explants in Fritillaria imperialis L., a wild rare ornamental species at the risk of extinction", "date": "2020", "keywords": "bulbs; fritillaria; imperialis; kin; leaf; l\u00ad1; medium; mg l\u00ad1; naa; number; plant; scales", "summary": "Abstract: Fritillaria imperialis L. (Liliaceae) is a rare and endangered ornamental plant grown in mountain regions and Zagros altitudes, Ilam province, Iran. Fritillaria imperialis L. (crown imperial or tears of Mary) is a perennial plant with high medicinal and ornamental importance (Wang et al., 2005).", "mime": "application/pdf"}, {"id": "ahs-8129", "words": "5429", "extension": ".pdf", "flesch": "64", "author": "Hakim, Abdul; Khatoon, M.; Gullo, S.", "title": "Effect of compost tea and partial root zone drying on tomato productivity and quality", "date": "2020", "keywords": "cdi; compost; content; effect; fruits; irrigation; plant; prd; quality; tea; tomato; water; weight", "summary": "The less visi\u00ad ble chilling injury, decay and faster color changes in PRD treated plants fruit might be due to less water content compared to CDI treated plants fruits. The PRD treated plant\u2019s fruits exhibited better appearance, higher lycopene content, fruit firmness, total soluble solid (TSS), and TSS/titratable acidity (TA) ratio than fruits plants treated with CDI (conventional drip irrigation).", "mime": "application/pdf"}, {"id": "ahs-8131", "words": "6459", "extension": ".pdf", "flesch": "60", "author": "Benbya, Abdellah; Mdarhri Alaoui, Meriem; Gaboun, Fatima; Delporte, Fabienne; Chlyah, Omar; Cherkaoui, Souad", "title": "Vegetative propagation of Argania spinosa (L.) Skeels cuttings: Effects of auxins and genotype", "date": "2020", "keywords": "auxin; concentration; cuttings; development; genotype; growth; iba; length; mgl\u00ad1; number; plant; propagation; rate; rooting; roots; spinosa; sprouting", "summary": "The number of leaves for ASOC1 cuttings \u00ad that received 1000 mgL\u00ad1 NAA is 73% greater than the con\u00ad trol group, while it is 52% higher for the 5000 mgL\u00ad1 IAA application. SINGH S., YADAV S., PATEL P.K., ANSARI S.A., 2011 \u00ad Adventitious rhizogenesis in Bambusa nutans and Bambusa tulda: Influence of seasonal variation, IBA and cutting type.", "mime": "application/pdf"}, {"id": "ahs-8178", "words": "4734", "extension": ".pdf", "flesch": "62", "author": "Mohajer, Z.S.N.; Asil, Moazam Hassanpour; Olfati, J.-A.; Kaledian, M.R.", "title": "Effect of different nutrient solution and irrigation regimes on growth of Lily (LA Hybrid 'Fangio')", "date": "2020", "keywords": "flower; growth; irrigation; leaf; number; nutrient; plant; sci; solution; table; water", "summary": "Sci., 2019 33(4): 529\u00ad535 DOI: 10.13128/ahsc\u00ad8178 Effect of different nutrient solution and irrigation regimes on growth of Lily (LA Hybrid \u2018Fangio\u2018) Z.S.N. Mohajer 1, M.H. Asil 1 (*), J.\u00adA. Olfati 1, M.R. Kaledian 2 1 Department of Horticultural, Faculty of Agricultural Sciences, Guilan University, Rasht, Iran. 2 Department of Water Engineering, Faculty of Agricultural Sciences, Guilan University, Rasht, Iran. In this regard, a greenhouse experiment was carried out to evaluate the effect of different nutrient solution viz.", "mime": "application/pdf"}, {"id": "ahs-8186", "words": "4124", "extension": ".pdf", "flesch": "67", "author": "Abedi Gheshlaghi, Ebrahim", "title": "Effective pollination period and its influence on fruit characteristics of 'Hayward' Kiwifruit", "date": "2020", "keywords": "daa; epp; fruit; hayward; kiwifruit; pollination; seed; set; weight", "summary": "Hayward kiwifruit showed no significant decrement of fruit set and fruit weight within the 4\u00adday and 2\u00adday period, respectively, however, the mean weight of fruit was \u2265 85 g within 4\u00adday. Fruit weight and size were the highest on days 1\u00ad2 after anthesis and reduced for flowers pollinated 3\u00ad4 days after anthesis.", "mime": "application/pdf"}, {"id": "ahs-8187", "words": "6459", "extension": ".pdf", "flesch": "54", "author": "Anjomshoaa, Atefeh; Jafary, Hossein; Hassandokht, Mohammed Reza ; Taheri, Mehdi; Abdossi, Vahid", "title": "Study on relationship between morphological and physiological traits with resistance to rust fungus (Puccinia allii) in Iranian garlic clones", "date": "2020", "keywords": "abc; bulb; clones; garlic; infection; iranian; leaf; number; percentage; resistance; rust; traits; weight", "summary": "Selection of resistant clones from the genetic complex of Iranian local clones is one of the pre\u00ad breeding research priorities of the country in Iran. Due to the commercial, economic and phar\u00ad maceutical\u00adindustrial importance of garlic, the interest in increasing pro\u00ad (*) Corresponding author: mrhassan@ut.ac.ir Citation: ANJOMSHOAA A., JAFARY H., REZA HASSAN\u00ad DOKHT M., TAHERI M., ABDOSSI V., 2019 \u00ad Study on relationship between morphological and phy\u2010 siological traits with resistance to rust fungus (Puccinia allii) in Iranian garlic clones.", "mime": "application/pdf"}, {"id": "ahs-8191", "words": "9524", "extension": ".pdf", "flesch": "65", "author": "Salimpour, Allahdad; Shamili, Mansoore; Dadkhodaie, Ali; Zare, Hamid; Hadadinejad, Mehdi", "title": "Evaluating the salt tolerance of seven fig cultivars (Ficus carica L.)", "date": "2020", "keywords": "anjir\u02bc; area; content; cultivars; et al; fig; fig cultivars; growth; leaf; nitrogen; plant; salinity; salt; sci; siyah\u02bc; stem; stress; table; water", "summary": "The available studies on the response of fig commercial cultivars to different lev\u00ad els of salinity indicated a significant variation in mor\u00ad phological characteristics, growth parameters, physi\u00ad ological behavior, photosynthetic efficiency, gas exchange ratio, product quality, and productivity (Essam et al., 2013; Metwali et al., 2014; Alswalmeh et al., 2015; Zarei et al., 2016, 2017; Soliman and Abd Alhady, 2017). Similar results are available in almond (Momenpour et al., 2018), pista\u00ad chio (Adish et al., 2010) and fig cultivars (Essam et al., 2013\u037e", "mime": "application/pdf"}, {"id": "ahs-8214", "words": "9619", "extension": ".pdf", "flesch": "54", "author": "Arkoub-Djermoune, Lynda; Benmeziane, F.; Madani, K; Boulekbache-Makhlouf, L.", "title": "Optimization of phenolic compounds recovery and in vitro antioxidant activity of Algerian eggplant (Solanum melongena L.)", "date": "2020", "keywords": "acetone; activity; antioxidant; compounds; eggplant; et al; extraction; extracts; food; frp; frsa; min; optimization; phenolic; ratio; solvent; temperature; time; total; tpc; water", "summary": "However, no optimal protocols have been established so far for phenolic extraction from these vegetable. Aqueous alcohols particularly acetone, ethanol and methanol are the most commonly employed in phenolic extraction from botanical materials (Chan et al., 2009).", "mime": "application/pdf"}, {"id": "ahs-8228", "words": "7571", "extension": ".pdf", "flesch": "67", "author": "Bagheri, Sajad; Hassandokht, Mohammad Reza; Mirsoleimani, Abbas; Mousavi, Amir", "title": "Effect of palm leaf biochar on melon plants (Cucumis melo L.) under drought stress conditions", "date": "2020", "keywords": "bcd; biochar; drought; effect; leaf; melon; plant; requirement; root; soil; stress; treatment; use; water; water requirement; weight", "summary": "In this experiment, the proline content decreased with increasing biochar treatments from 0.19 to 0.36 Kg/m2 and the increase of water require\u00ad ment from 60 to 100%, with the lowest amount of proline being related to 0.24 and 0.36 Kg/m2and 100% water requirement. The water use efficiency was calculated as a cor\u00ad relation between plant yield and plant water use dur\u00ad ing the treatment period (Liu et al., 2015).", "mime": "application/pdf"}, {"id": "ahs-8230", "words": "5289", "extension": ".pdf", "flesch": "60", "author": "Russo, Alessio; Speak, Andrew; Dadea, Claudia; Fini, Alessio; Borruso, Luigimaria; Ferrini, Francesco; Zerbe, Stefan", "title": "Influence of different ornamental shrubs on the removal of heavy metals in a stormwater bioretention system", "date": "2020", "keywords": "bioretention; cotoneaster; et al; hypericum; lonicera; metals; plants; removal; species; stormwater; systems; urban; water", "summary": "The lower removal rate could be attributed to leaching of Pb and Cd from the bioretention media as the concentration of heavy metals in the bottom layer increases (Muthanna et al., 2007). Russo et al. \u2010 Influence of ornamental shrubs on the removal of heavy metals 609 tention systems in laboratory (Davis et al., 2003; Kabir et al., 2014; Wang et al., 2017; Muerdter et al., 2018).", "mime": "application/pdf"}, {"id": "ahs-8251", "words": "4846", "extension": ".pdf", "flesch": "68", "author": "Sinumporn , Punpaka ; Narumi-Kawasaki, T.; Fukai, S.", "title": "Development of interspecific hybrids between Habenaria radiata and Habenaria rhodocheila complex", "date": "2020", "keywords": "complex; fig; habenaria; hra; hybrids; radiata; rco; rcy; rhodocheila", "summary": "HRA \u00d7 RCY had only 1 pod set from 11 flow\u00ad ers (9.1%), and the opposite cross RCY \u00d7 HRA had 1 from 3 flowers (33.3%) (Table 1). Both cross combinations of HRA \u00d7 RCY and RCY \u00d7 HRA had poor seed germination (Table 1).", "mime": "application/pdf"}, {"id": "ahs-8252", "words": "9311", "extension": ".pdf", "flesch": "58", "author": "Khani, A.; Barzegar, Taher; Nikbakht, J.; Ghahremani, Z.", "title": "Effect of foliar spray of calcium lactate on the growth, yield and biochemical attribute of lettuce (Lactuca sativa L.) under water deficit stress", "date": "2020", "keywords": "activity; antioxidant; cal; calcium; content; deficit; drought; effect; et al; etc; growth; irrigation; lactate; leaf; leaves; lettuce; plant; sci; stress; values; water; water deficit; yield", "summary": "\u00ad Plant. \u00ad Plant.", "mime": "application/pdf"}, {"id": "ahs-8253", "words": "6678", "extension": ".pdf", "flesch": "62", "author": "Abbasnia Zare, Seyedeh Khadijeh; Sedaghathoor, Shahram; Padasht Dahkaei, Mohammad-Naghi; Hashemabadi, Davood", "title": "The effect of different colored netting on quantitative and qualitative traits of two foliage plant species (Codiaeum variegatum and Aglaonema commutatum)", "date": "2020", "keywords": "commutatum; effect; leaf; nets; netting; plant; plant species; species; table; type", "summary": "According to ANOVA (Table 1), plant growth rate was significantly (p<0.01) affected by shade netting, plant species, and \u2018shade netting \u00d7 plant species\u2019. No netting 25.25 c 3.92 c 13.50 b 23.52 c 1.65 c 2.11 c 0.14 c 14.92 c 6.04 b 72.19 c 6.66 b 0.04 b 1.37 b 0.85 b 0.77 b 9 a Yellow 39.33 a 16.50 a 27.17 a 82.05 a 5.75 a 7.89 a 0.55 a 21.17 a 8.50 a 138.4 a 9.68 a 0.04 b 2.62 b 2.90 a 2.60 a 2 b Red 33.92 b 11.50 b 19.63 ab 50.25 b 3.52 b 4.82 b 0.34 b 19.17 b 7.33 ab 106.5 b 10.33 a 0.10 a 4.77 a 3.09 a 2.94 a 5 ab Green 33.33 b 10.88 b 18.83 ab 45.74 b 3.20 b 3.84 bc 0.27 bc 18.00 b 6.46 b 88.92 bc 8.50 ab 0.03 b 1.20 b 2.77 ab 2.50 a 9 a Abbasnia Zare et al. \u2010 Colored netting effects on foliage of Codiaeum variegatum and Aglaonema commutatum 29 icantly influenced by net type at the p<0.05 level and by plant species at the p<0.01 level, but the interac\u00ad tion of \u2018net type \u00d7 plant species\u2019 was insignificant for this trait (Table 2).", "mime": "application/pdf"}, {"id": "ahs-8254", "words": "3683", "extension": ".pdf", "flesch": "61", "author": "Ilahy, Riadh; Tlili, I.; Rouhou, H.C.; Siddiqui, M.W.; Mishra, P.M.; Kuchi, V.S.; Homa, F.; Hdider, C.; Jebari, H.; Lenucci, Marcello Salvatore", "title": "Determining the main agronomic traits of snake melon (Cucumis melo var. flexuosus L.) fruits as affected by genotypic differences", "date": "2020", "keywords": "breeding; fruits; green; lines; melon; mornagui; plant; snake; traits; yield", "summary": "Snake melon fruits are known all around the world with different trivial names: \u201calficoz\u201d in Spain, \u201ctortarello\u201d or \u201ccetrangolo\u201d in Italy, \u201cfakous\u201d or \u201cfegous\u201d in Arabic Maghreb countries, \u201cagoor\u201d in Soudan, \u201cacur\u201d, \u201ch\u0131tta\u201d or \u201ch\u0131t\u0131\u201d in Turquie, \u201ckakri\u201d in India, \u201curi\u201d in Japan and Armenian cucumber, \u201cyard\u00ad long melon\u201d, \u201cserpent\u00admelon\u201d or \u201cGutah\u201d elsewhere (Solmaz et al., 2016). Snake melon fruits are general\u00ad ly consumed raw at the immature stage of ripening with a preference for straight long and thick green fruits in the Mediterranean region.", "mime": "application/pdf"}, {"id": "ahs-8255", "words": "4931", "extension": ".pdf", "flesch": "60", "author": "Mirshekari, Amin; Madani, Babak; Wall, Marisa; Biggs, Alan R.", "title": "Aloe vera coatings maintain antioxidants of fig (Ficus carica L.) fruit during storage", "date": "2020", "keywords": "acid; activity; aloe; aloe vera; antioxidant; et al; fig; food; fruit; gel; sci; storage; vera; vera gel", "summary": "SOGVAR O.B., SABA M.K., EMAMIFAR A., 2016 \u00ad Aloe vera and ascorbic acid coatings maintain postharvest quality and reduce microbial load of strawberry fruit. Fresh fruits of the well\u00adknown fig (Ficus carica L.) cul\u00ad tivar \u2018Siyah\u2019 were grown in Fars Province, Iran, treated with different concen\u00ad trations of Aloe vera gel prior to being placed into cold storage.", "mime": "application/pdf"}, {"id": "ahs-8283", "words": "7917", "extension": ".pdf", "flesch": "58", "author": "Bonyanpour, Ali Reza; Jamali, Babak", "title": "Seasonal enzymatic and non-enzymatic antioxidant responses in seven Iranian pomegranate cultivars", "date": "2020", "keywords": "acid; activity; antioxidant; chlorophyll; content; cultivars; fall; glutathione; g\u00ad1; leaf; mdg; mms; plant; pomegranate; ssf; stress; summer; zaa", "summary": "IBRAHIM H.I.M., 2016 \u00ad Tolerance of two pomegranates cultivars (Punica granatum L.) to salinity stress under hydroponic culture conditions. Table 1 \u00ad Average day and night temperature and relative humidity in the experiment region at the time of sam\u00ad pling Date of sampling Average day/night temperature (\u00b0C) Relative humidity (%) June 2nd 27/14 45 August 10th 38/25 23 October 10th 27/15 27 Bonyanpour and Jamali \u2010 Seasonal antioxidant responses in Iranian pomegranate cultivars 267 The following parameters were measured in stud\u00ad ied cultivars for two consecutive years and an aver\u00ad age was reported.", "mime": "application/pdf"}, {"id": "ahs-8292", "words": "4522", "extension": ".pdf", "flesch": "53", "author": "Cocetta, Giacomo; Riva, M.; Castelli, G.; Ferrante, Antonio", "title": "New active packaging for improving the shelf life and quality of tomato", "date": "2020", "keywords": "berries; control; days; fig; film; fruits; gas; packaging; quality; storage; temperature; tomato", "summary": "The experiment was conducted on tomato fruits (Solanum lycopersicum L. var. cerasiforme). It is well known that at low temperature the volatiles release from tomato fruits is limited due to the reduced metabolic activity and volatility of the molecules (Spadafora et al., 2019).", "mime": "application/pdf"}, {"id": "ahs-8295", "words": "4841", "extension": ".pdf", "flesch": "62", "author": "Gorni, Pedro Henrique; Cornelissen, Bianca da Silva; Pereira, Andr\u00e9 Apolin\u00e1rio ", "title": "Exogenous salicylic acid and ferulic acid improve growth, phenolic and carotenoid content in tomato", "date": "2021", "keywords": "acid; application; chlorophyll; content; et al; gorni; growth; plants; salicylic; table; tomato; total", "summary": "Exogenous application of SA and FA either alone or in combination (SA + FA) resulted in increases in bio\u00ad mass accumulation and chlorophyll contents in tomato plant; and soluble sugar, total polyphenol, flavonoids, lycopene and \u03b2\u00adcarotene contents in fruits. However, exogenous SA (Kazemi, 2014) and FA (Singh and Deen, 2014) applications were effective in inducing the growth and formation of secondary metabolites in tomato plants.", "mime": "application/pdf"}, {"id": "ahs-8300", "words": "3737", "extension": ".pdf", "flesch": "52", "author": "Ameri, Atefe; Davarynejad, Golam Hossein; Tehranifar, Ali; Moshtaghi, N.", "title": "Cefixime manages internal bacterial contamination during tissue culture operation", "date": "2020", "keywords": "antibiotic; bacterial; cefixime; contamination; culture; growth; l\u00ad1; media; mg l\u00ad1; plant; tissue", "summary": "For this purpose, this investigation was conducted with several experiments to manage bacterial contamination. First, gram test for bacterial contamination related to Pyrus shoots proliferating was conducted.", "mime": "application/pdf"}, {"id": "ahs-8306", "words": "4636", "extension": ".pdf", "flesch": "61", "author": "Paula, Vericia Fernanda Sales de ; Vilvert, Jo\u00e3o Claudio; Ara\u00fajo, N\u00edcolas Oliveira de ; Nascimento, Iarajane Bezerra do; Medeiros, Jose Francismar de; Aroucha, Edna Maria Mendes", "title": "Influence of plant biostimulant and spacing on production and postharvest conservation of watermelons cv. Quetzali", "date": "2020", "keywords": "application; biostimulant; crop; fruits; plant; set; spacing; ssc; storage; watermelon", "summary": "Abstract: The aim of this study was to evaluate the influence of pre\u00adharvest application of plant biostimulant Crop Set\u00ae and different plant spacings on the production attributes and postharvest quality of watermelon \u2018Quetzali\u2019. In this case, the increase on the SSC of watermelon fruits observed during storage can be attributed to the sol\u00ad ubilization of pectins.", "mime": "application/pdf"}, {"id": "ahs-8343", "words": "5928", "extension": ".pdf", "flesch": "63", "author": "Haghighi, Maryam; Zamani, Omid ; Abbey, Lord ", "title": "Growth response nitrogen metabolism of grafted cucumber fertilized with different ratios of nitrate: ammonium fertilizer", "date": "2021", "keywords": "cucumber; effect; grafting; growth; nitrate; no3; no3 \u00ad/nh4; nutrient; plant; ratio; root; rootstock; shoot; \u00ad/nh4", "summary": "GORETA BAN S., \u017dANI\u0106 K., DUMI\u010cI\u0106 G., RASPUDI\u0106 E., VULETIN SELAK G., BAN D., 2014 \u00ad Growth and yield of grafted cucumber in soil infested with root\u2010knot nema\u2010 todes. WANG H., WU L., ZHU Y., TAO Q., 2008 \u00ad Growth, nitrate accumulation, and macro nutrient concentration of pakchoi as affected by external nitrate\u2010n: amino acid\u2010n ratio.", "mime": "application/pdf"}, {"id": "ahs-8354", "words": "6127", "extension": ".pdf", "flesch": "56", "author": "Ichwan, Budiyati; Eliyanti, Eliyanti; Zulkarnain, Zulkarnain", "title": "Influence of biostimulants and media compositions on growth and yield of Capsicum annuum L. under drought stress conditions", "date": "2021", "keywords": "biostimulants; charcoal; chili; citorin; compositions; content; drought; growth; husk; media; media compositions; plants; soil; stress; water", "summary": "Discussion and Conclusions The application of biostimulants on chili pepper grown on different growing media compositions with limited soil water content was found to increased plant growth and yield. Statistical analysis Data were analysed statistically using Analysis of Variance (ANOVA) module (Petersen, 1985) to judge the significance of the effect of biostimulants and growing media compositions.", "mime": "application/pdf"}, {"id": "ahs-8376", "words": "7059", "extension": ".pdf", "flesch": "59", "author": "Kadri, Aline; Saleh, Shoaib; Elbitar, Ahmad; Chehade, Ali", "title": "Genetic diversity assessment of ancient mulberry (Morus spp.) in Lebanon using morphological, chemical and molecular markers (SSR and ISSR)", "date": "2021", "keywords": "abyad; accessions; analysis; color; diversity; fruit; issr; leaf; lebanon; length; markers; morus; mulberry; mwachah; primers; shami; ssr", "summary": "The clustering patterns indicated no loca\u00ad tion nor local name specificity among mulberry accessions. Fruit color of mulberry accessions was diverse: \u2018Abyad\u2019 accessions were white and \u2018Mwachah\u2019 acces\u00ad sions were violet.", "mime": "application/pdf"}, {"id": "ahs-8395", "words": "6225", "extension": ".pdf", "flesch": "63", "author": "Marchioni, Ilaria ; Colla, Lisaura; Pistelli, Laura; Ruffoni, Barbara; Tinivella, Federico; Minuto, Giovanni", "title": "Different growing conditions can modulate metabolites content during post-harvest of Viola cornuta L. edible flowers", "date": "2020", "keywords": "edible; et al; flowers; light; storage; temperature; time; treatment; viola", "summary": "Abstract: Edible flowers are inflorescences traditionally used in various part of the world to enrich sweet and savoury recipes. In Indian and Chinese cultures, edible flowers are used as com\u00ad ponents of medicines based on herbs, in addition to culinary purposes (Wongwattanasathien et al., 2010).", "mime": "application/pdf"}, {"id": "ahs-8401", "words": "7146", "extension": ".pdf", "flesch": "63", "author": "Mubarak, I.", "title": "Improving water productivity and yield of onion crop by combining early planting and straw mulch under different irrigation levels in dry Mediterranea region", "date": "2020", "keywords": "bulb; crop; date; irrigation; level; mulching; onion; planting; soil; straw; water; yield", "summary": "Irrigation water was added 3 times per week. KUMAR S., IMTIYAZ M., KUMAR A., SINGH R., 2007 \u00ad Response of onion (Allium cepa L.) to different levels of irrigation water.", "mime": "application/pdf"}, {"id": "ahs-8402", "words": "5924", "extension": ".pdf", "flesch": "67", "author": "Kim, Ji Hee; Suh, Jeung Keun; Yoon, Seong-Tak; Roh, Mark S.", "title": "Production of seed-propagated compact potted Corylopsis plant in one year", "date": "2020", "keywords": "calvescens; corylopsis; flowering; growth; number; plants; shoots; sinensis; var", "summary": "Suitable species should first be identified and then excessive stem elongation must be controlled using plant growth retardants (Currey and Lopez, 2016), and pinching combined with plant growth retardant treatment (Jeong, 2000). Data collected from 15 plants per treatment were ana\u00ad lyzed by two\u00adway ANOVA with plant growth retar\u00ad dants and concentration as variables.", "mime": "application/pdf"}, {"id": "ahs-8403", "words": "5554", "extension": ".pdf", "flesch": "62", "author": "Shiraishi, Mikio; Asakuma, Hideaki", "title": "Varietal differences in sweetness value and flesh juiciness among persimmon cultivars", "date": "2020", "keywords": "cultivars; flesh; fruit; juiciness; persimmon; ratio; sucrose; sugar; sweetness; value", "summary": "Thus, understanding how varietal differ\u00ad ences influence sugar composition will provide valu\u00ad able information for genetic improvement of the palatability of persimmon fruit in future breeding programs. Cultural practices were con\u00ad Shiraishi and Asakuma \u2010 Sweetness value and flesh juiciness of persimmon fruit 73 formed to Plant materials for yearly variation of sugar composition.", "mime": "application/pdf"}, {"id": "ahs-8404", "words": "8452", "extension": ".pdf", "flesch": "55", "author": "Abdi, Gholamreza; Karami, Lila", "title": "Salicylic acid effects on some physiochemical properties and secondary metabolite accumulation in Mentha piperita L. under water deficit stress", "date": "2020", "keywords": "acid; content; control; deficit; deficit stress; effect; et al; growth; membrane; oil; peppermint; phenolic; plants; salicylic; stress; total; water; water deficit; water stress", "summary": "Karami and Abdi \u2010 Salicylic acid effects on peppermint 89 However, the findings of the present study showed that foliar spray of SA increased grown parameters in non\u00adstress plants while there were no significant effects of SA on water stressed plant. 1. Introduction Peppermint (Mentha piperita L.) is considered as one of the most important medicinal and aromatic herb in the world cultivated in many (*) Corresponding author: abdi@pgu.ac.ir Citation: ABDI G., KARAMI L., 2020 \u00ad Salicylic acid effects on some physiochemical properties and secon\u2010 dary metabolite accumulation in peppermint (Mentha piperita L.) under water deficit stress.", "mime": "application/pdf"}, {"id": "ahs-8405", "words": "7643", "extension": ".pdf", "flesch": "54", "author": "Akbarnejad-Samani, Zahra; Shamili, Mansoore; Samari, Fayezeh", "title": "The toxicity potential of Ag nanoparticles synthesized from Cordia myxa L.", "date": "2020", "keywords": "activity; agnps; chemical; concentration; et al; extract; fig; germination; green; leaf; length; myxa; nanoparticles; plant; root; sci; seeds; silver; synthesis; type", "summary": "\u00ad J. Environ. BURMAN U., SAINI M., KUMAR P., 2013 \u00ad Effect of zinc oxide nanoparticles on growth and antioxidant system of chickpea seedlings.", "mime": "application/pdf"}, {"id": "ahs-8406", "words": "4815", "extension": ".pdf", "flesch": "53", "author": "Rezaei Zafarghandi, Mohammad Saleh; Rahmati-Joneidabad, Mostafa", "title": "Indirect shoot organogenesis and in vitro root formation of Antirrhinum majus L. by using of sodium nitroprusside", "date": "2020", "keywords": "callus; cell; et al; medium; nitroprusside; oxide; plant; regeneration; root; shoot; snp; sodium", "summary": "\u00ad Plant J., 43(6): 849\u00ad860. PAGNUSSAT G.C., LANTERI M.L., LAMATTINA L., 2003 \u00ad Nitric oxide and cyclic GMP are messengers in the indole acetic acid\u2010induced adventitious rooting process. A rapid regeneration pathway for A. majus could be useful for commercial propagation of nursery and cut\u00adflower industries as well as breed\u00ad ing programs (Sheyab et al., 2010).", "mime": "application/pdf"}, {"id": "ahs-8462", "words": "3188", "extension": ".pdf", "flesch": "59", "author": "Benjelloun, Jalila; Taoufyq, Aida; El Abidine Triqui, Zine; Alami, Qamar Lahlimi ; Layachi, Rajaa; Smouni, Abdelaziz; Bouzroud, Sarah; Guedira, Abdelkarim", "title": "Improvement of in vitro germination of Cycas revoluta zygotic embryos using gelrite as gelling agent", "date": "2020", "keywords": "bap; cycas; gelrite; germination; medium; plant; revoluta; shoot", "summary": "(a) shoot induction in SH basal medium, (b, c) shoot regeneration in SH medium supplemented with 0.5 mg of BAP and 0.5 mg of 2iP respectively, (d, e, f) shoot elongation SH, SH+BAP and SH+2iP A high percentage of germination, 73% was obtained with SH medium instead of 27% with MS medium.", "mime": "application/pdf"}, {"id": "ahs-8468", "words": "4326", "extension": ".pdf", "flesch": "59", "author": "Farzane, Akram; Nemati, Hossein; Shoor, Mahmoud ; Ansari, Hossein ", "title": "Foliar application of potassium on antioxidant enzyme activities of tomato plants under drought stress", "date": "2020", "keywords": "application; drought; etc; foliar; growth; kcl; plant; proline; stress; tomato; water; yield", "summary": "The decrease in soil water potential causes alteration in minerals uptake by plant roots and reduc\u00ad tion in leaf expansion under drought stress conditions (Kaminek et al., 1997; Pospisilova et al., 2000). The bottom lines of the reviewed results in this section indicate that under drought stress conditions, yield losses can be minimized by the sufficient supply of K. However, its application effect at tomato growth stages is not well understood yet.", "mime": "application/pdf"}, {"id": "ahs-8492", "words": "3867", "extension": ".pdf", "flesch": "60", "author": "Palumbo, Michela; Capotorto, Imperatrice; Cefola, Maria; Burbaci, Salvatore; Pace, Bernardo", "title": "Modified atmosphere packaging to improve the shelf-life of Goji berries during cold storage", "date": "2020", "keywords": "berries; days; goji; goji berries; pmap; storage; weight", "summary": "To the best of our knowledge, no further studies on the application of modified atmosphere on goji berries are available, so the present study is aimed to evalu\u00ad ate the application of MAP technology to extend the shelf\u00adlife of fresh goji berries. Regarding to dry weight, our data (22.8%\u00b10.3) are in accordance with data reported by Niro et al. (2017) that found a moisture of 77.4% on fresh goji berries, means 22.6% dry weight.", "mime": "application/pdf"}, {"id": "ahs-8494", "words": "6671", "extension": ".pdf", "flesch": "55", "author": "Amuji, Chinedu Felix; Beaumont, Linda Jeanne; Rodriguez, Manuel Eperon", "title": "Simulating the impact of projected West African heatwaves and water stress on the physiology and yield of three tomato varieties", "date": "2020", "keywords": "downloads; felix%20amuji; felix-22; file:///c:/users; heat; manuscript; oregon; plants; roma; spring; stress; tomatoes; treatments; tropic; varieties; water; water stress", "summary": "Ws \u2010 Water stress treatment. PETROZZA A., SANTANIELLO A., SUMMERER S., DI TOM\u00ad MASO G., DI TOMMASO D., PAPARELLI E., PIAGGESI A., PERATA P., CELLINI F., 2014 \u00ad Physiological responses to Megafol\u00ae treatments in tomato plants under drought stress: a phenomic and molecular approach.", "mime": "application/pdf"}, {"id": "ahs-8855", "words": "7565", "extension": ".pdf", "flesch": "64", "author": "Gomes da Silva, Mairton; Suzart Alves, Lucylia; Miler Soares, Tales; Raj Gheyi, Hans; Bione, Maria Augusta Amorim", "title": "Growth, production and water use efficiency of chicory (Cichorium endivia L.) in hydroponic systems using brackish waters", "date": "2020", "keywords": "chicory; dat; dft; ecsol; et al; growth; hydroponic; matter; nft; nutrient; plants; salinity; salt; shoot; silva; solution; stress; system; use; water", "summary": "These results complement other studies which have shown feasibility for the cultivation of dif\u00ad ferent plant species in the DFT system in tubes, such as lettuce (Cova et al., 2017), rocket (Campos J\u00fanior et al., 2018 b), coriander (Silva et al., 2018 a), parsley (Martins et al., 2019 a) and chives (Silva J\u00fanior et al., 2019). \u00ad Plants, 3(4): 458\u00ad475.", "mime": "application/pdf"}, {"id": "ahs-8859", "words": "3337", "extension": ".pdf", "flesch": "73", "author": "Hosomi, Akihiro", "title": "Stable growth inhibition of potted fig (Ficus carica L.) trees by soil sickness", "date": "2020", "keywords": "fig; growth; planting; shoot; soil; trees; year", "summary": "Hosomi \u2010 Damage stability of fig soil sickness 453 peach orchards, Yamada and Ono (1970) observed that the trees grew for 7 years with a constant differ\u00ad ence between with and without sick soil. Shoot growth of 10\u00ad liter potted \u2018Masui Dauphine\u2019 figs was inhibited with sick soil from the 1st year of planting, and a stable dwarfish growth was maintained form the 2nd to 9th years, with only a few trees dying.", "mime": "application/pdf"}, {"id": "ahs-8937", "words": "7220", "extension": ".pdf", "flesch": "39", "author": "Dehghanpour, Sedigheh ; Shamili, Mansoore; Mirzalaiyan-Dastjerdi, Abdolmajid ", "title": "The impact of cumin essential oil on cold stored-radish tubers", "date": "2021", "keywords": "activity; antioxidant; cold; content; cumin; cumin eo; days; et al; food; min\u00ad1g\u00ad1; oil; period; phenol; ppm; radish; radishes; sci; storage; tubers; weight; \u03bcmol", "summary": "\u00ad J. Agric. \u00ad J. Agric.", "mime": "application/pdf"}, {"id": "ahs-8961", "words": "5498", "extension": ".pdf", "flesch": "51", "author": "Zeynalova, Aydan ; Novruzov, Eldar ; Bartolini, Paola ; Brunetti, Cecilia; Maserti, Biancaelena ", "title": "Phenolic fingerprint in wild growing pomegranate fruits from Azerbaijan", "date": "2020", "keywords": "accessions; acid; anthocyanins; azerbaijan; content; derivatives; et al; fig; fruits; juices; phenolic; pomegranate; punicalagin", "summary": "Pomegranate accessions Del\u00ad3,5\u00addiglc (mgL\u00ad1) Cya\u00ad3,5\u00addigl (mgL\u00ad1) Pel\u00ad3,5\u00addigl (mgL\u00ad1) Cya\u00ad3\u00adglc (mgL\u00ad1) Pel\u00ad3\u00adglc (mgL\u00ad1) Cya\u00ad3\u00adpent (mgL\u00ad1) Pg1 75.58 \u00b1 0.46 b 152.6 \u00b1 2.21 a 0.102 \u00b1 0.001 b \u00ad 1.67 \u00b1 0.165 a \u00ad Pg2 114.7 \u00b1 1.85 a 102.3 \u00b1 1.39 b 80.54 \u00b1 1.20 a \u00ad 0.65 \u00b1 0.03 b \u00ad Pg3 \u00ad 7.910 \u00b1 0.30 e \u00ad 10.20 \u00b1 Selection of pomegranate accessions through the phenolic fingerprint The phenolic fingerprint of the juices obtained from the accessions collected in eight different areas of Azerbaijan allowed to select promising wild pomegranate accession particularly rich both in anthocyanins and ellagitannins.", "mime": "application/pdf"}, {"id": "ahs-8966", "words": "7989", "extension": ".pdf", "flesch": "64", "author": "Moazzeni, Mohammad; Reezi, Saeed; Ghasemi Ghehsareh, Masoud", "title": "Growth and chlorophyll fluorescence characteristics of Sinningia speciosa under red, blue and white light-emitting diodes and sunlight", "date": "2020", "keywords": "blue; chlorophyll; et al; fluorescence; growth; leaf; light; lighting; plants; production; quality; red; transplants; treatments; wbr; white", "summary": "Plant., 84: 55\u00ad66. JIAO Y., LAU O.S., DENG X.W., 2007 \u00ad Light\u2010regulated tran\u2010 scriptional networks in higher plants. The OJIP transients were done according to the JIP test (Strasser et al., 2000).", "mime": "application/pdf"}, {"id": "ahs-8982", "words": "3404", "extension": ".pdf", "flesch": "56", "author": "Esmaeilzadeh-Hosseini, Seyyed Alireza; Babaei, G.; Davoodi, S.; Bertaccini, Assunta", "title": "Identification and impact of phytoplasmas associated with greenhouse cucumber phyllody in Iran", "date": "2020", "keywords": "cucumber; disease; greenhouse; iran; phyllody; phytoplasma; plants; salehi", "summary": "Materials and Methods During 2014 to 2018, greenhouse cucumber growing areas of central and west of Iran were sur\u00ad veyed for evaluation of phytoplasma disease pres\u00ad ence. Phytoplasma diseases associated with \u201cstolbur\u201d were present in plant host species adjacent to greenhouses cucumber areas but their role in the epidemiology of the disease needs to be proved.", "mime": "application/pdf"}, {"id": "ahs-9005", "words": "9607", "extension": ".pdf", "flesch": "57", "author": "Samsampour , Davood ; Kazemzadeh-Beneh, Hashem; Damizadeh, Gholam-Reza ; Mirzaei, Zahra ", "title": "Morphological and biochemical classification of Iranian Mango germplasm collection by multivariate analysis: Implications for breeding", "date": "2020", "keywords": "analysis; breeding; cultivars; et al; factor; fiber; fruit; germplasm; leaf; length; mango; mango cultivars; pca; quantitative; sci; stone; table; total; traits; tss; variables; variation; weight", "summary": "In contrast, the highest positive values for PC2 show cultivars with high fruit traits, as shown in figure 2B. Dendrogram using agglomerative hierarchical clus\u2010 tering The dendrogram showed three main groups; the C1 is included of 31 cultivars, the C3 contained of 54 cultivars, and finally the C2 comprised of 4 cultivars (Fig. 3). PC1, which accounted for 15.91% of the total varia\u00ad tion, was strongly associated with fruit traits, such as fruit length, fruit weight, fiber length, stone length, and fruit breadth.", "mime": "application/pdf"}, {"id": "ahs-9212", "words": "7580", "extension": ".pdf", "flesch": "60", "author": "Benbya, Abdellah ; Cherkaoui, Souad; Gaboun, Fatima; Chlyah, Omar; Delporte, Fabienne ; Mdarhri Alaoui, meriemmalaou", "title": "The Clonal propagation of Argania spinosa (L.) skeels: effects of leaf retention, substrate and cutting diameter", "date": "2021", "keywords": "argania; cuttings; diameter; leaf; leaves; length; number; propagation; retention; rooting; roots; spinosa; sprouts; substrate", "summary": "Significant effects of cuttings diameter, leaf retention and rooting substrate on sprouting, rooting and survival ability from A. spinosa semi\u00adhardwood cuttings were observed. The rooting effectiveness in function of cuttings diameter could be explained by different factors (Foster et al., 2000).", "mime": "application/pdf"}, {"id": "ahs-9425", "words": "11383", "extension": ".pdf", "flesch": "62", "author": "Otieno, Peter Caleb; Mulwa, R.M.S.; Otieno Ogweno, J.", "title": "Management of root knot nematodes (Meloidogyne sp.) and enhancing growth yield of greenhouse produced tomatoes by using fresh plant derived soil amendments ", "date": "2020", "keywords": "amendments; biomass; dat; effect; et al; gratissimum; growth; kituensis; lippia; lippia kituensis; meloidogyne; nematodes; ocimum; plant; rates; root; sci; soil; tomato; vatke; yield", "summary": "Effect of fresh plant organic amendments on tissue of greenhouse tomato The different levels of amendments of Lippia and Ocimum soil amendments had significant (P<0.05) influence on tomato plant tissue nutrients. Destructive sampling of tomato plants to determine nematode infestation was conducted 100 DAT.", "mime": "application/pdf"}, {"id": "ahs-9548", "words": "5790", "extension": ".pdf", "flesch": "65", "author": "Madani, Babak; Dastjerdy, Abdolmajid Mirzaalian ; Shahriyari, Ali ", "title": "Improving 'Piyarom' date palm fruit quality with fruit thinning and bunch covering treatments", "date": "2021", "keywords": "bunch; control; covering; date; fruit; kimri; palm; quality; thinning; total; weight", "summary": "The results of this experiment showed that the coverage did not have a significant effect on the per\u00ad centage of Tamar, but date palm fruit thinning in the Kimri and pollination stages significantly increased Tamar percentage of both years (Table 1). Also, the bunch weight was significantly higher in the control as compared to bunch weights that occurred after date palm fruit thinning at the pollination and Kimri stages, for both years (Table 1).", "mime": "application/pdf"}, {"id": "ahs-9609", "words": "4993", "extension": ".pdf", "flesch": "68", "author": "Zare, Fatemeh; Najafi, Gholamhassan; Tavakoli Hashjin, Teimour ; Kermani, Alimashallah M.; Ghiasi, Pedram ", "title": "A new pneumatic harvester for improvement and facilitation the harvesting of the olive fruits", "date": "2021", "keywords": "collector; fruit; harvester; harvesting; nph; olive; pneumatic; system; tree", "summary": "Two methods of harvesting olive fruit, namely, mecha\u00ad nized harvesting with Pneumatic Harvester (PH) and Manual Harvesting (MH) were investigated, which indicated that due to the presence of the collector system, using mechanized harvesting can reduce the fruit damages (Plasquy et al., 2019). The force required to detach them was Zare et al. \u2010 A new pneumatic harvester for olive fruits harvesting 45 measured by a mechanical force gauge.", "mime": "application/pdf"}, {"id": "ahs-9624", "words": "9429", "extension": ".pdf", "flesch": "56", "author": "AYDI BEN ABDALLAH, Rania; Ammar, Nawaim; Ayed, Fakher; Jabnoun-Khiareddine, Hayfa; Daami-Remadi, Mejda", "title": "Single and combined effects of Bacillus spp. and brown seaweed (Sargassum vulgare) extracts as bio-stimulants of eggplant (Solanum melongena L.) growth: Bacillus spp. and Sargassum vulgare extracts as biostimulants of eggplant growth", "date": "2021", "keywords": "amyloliquefaciens; bacillus; compost; control; eggplant; et al; extract; growth; methanolic; plantarum; plants; s. vulgare; seaweed; spp; strains; subsp; sv65; treatment; vulgare; vulgare extract", "summary": "Therefore, research efforts are concentrated on alternative nutrients to improve soil physical, chemical, and biological traits through the application of chimerical organic fertiliz\u00ad ers (Maghfoer et al., 2014) and/or various organic soil amendments such as compost (D\u2019Hose et al., 2012), plant extracts (Bijarniya, 2011), algae (Eyras et al., 2008), and microbial inoculants (Arora et al., 2020). BIJARNIYA D., 2011 \u00ad Soil amendments, plant extracts and plant products for integrated disease management in agricultural crops.", "mime": "application/pdf"}, {"id": "ahs-9663", "words": "5562", "extension": ".pdf", "flesch": "64", "author": "Wukir Tini, Etik; Dwi Haryanto, T.A.; Sakhidin, Sakhidin; Saparso, Saparso", "title": "Endogenous hormone causes flower and fruit drop of wax apple (Syzygium samarangense cv. Citra)", "date": "2021", "keywords": "anthesis; apple; content; development; drop; flower; fruit; fruit development; fruit drop; plant; ppm; retention; starch; wax", "summary": "Sci., 2021 35(1): 53\u00ad60 DOI: 10.36253/ahsc\u00ad9663 Endogenous hormone causes flower and fruit drop of wax apple (Syzygium samarangense cv. Citra) E. Wukir Tini (*), T.A. Dwi Haryanto, Sakhidin, Saparso Agriculture Faculty, Jenderal Soedirman University, Purwokerto, Central Java, Indonesia. Key words: ACC, cytokinins, fruit drop, IAA, GA3, wax apple.", "mime": "application/pdf"}, {"id": "ahs-9681", "words": "3575", "extension": ".pdf", "flesch": "57", "author": "Benjelloun, Jalila; Bouzroud, Sarah; Triqui, Zine El Abidine; Lahlimi Alami, Qamar; Layachi, Rajaa; Smouni, Abdelaziz; Guedira, Abdelkarim", "title": "Warm stratification improves embryos development and seed germination of Cycas revoluta", "date": "2021", "keywords": "cycas; effect; embryos; germination; length; months; revoluta; seeds; stratification; treatments", "summary": "Taken together, these results underlined the beneficial effect of warm stratification on Cycas revoluta seed germination and plant development and proposed a new method to improve seed germination of Cycas revoluta. Abstract: The broad objective of this research is to study the effect of warm stratification on Cycas revoluta zygotic embryos length, seed germination and plant development.", "mime": "application/pdf"}, {"id": "ahs-9689", "words": "8507", "extension": ".pdf", "flesch": "63", "author": "Bammite, Damigou; Matthews, Peter Joseph; Dagnon, Yao Dodzi ; Agbogan, Akou\u00e8th\u00ea; Agre, Paterne; Akintayo, Oluyemi Titilola; Odah, Komi; Dansi, Alexandre; Abberton, Michael; Tozo, Koffi Sodok\u00e8", "title": "Genetic diversity in Colocasia esculenta and Xanthosoma mafaffa in Togo, West Africa", "date": "2021", "keywords": "accessions; africa; alleles; bammite; cocoyam; colocasia; cultivars; dasheen; diversity; esculenta; et al; genetic; loci; matthews; new; species; ssr; table; taro; togo; xanthosoma", "summary": "WADA E., FEYISSA T., TESFAYE K., M\u00dcLLER C.M., GEMEIN\u00ad HOLZER B., 2018 \u00ad Genetic diversity of Ethiopian Xanthosoma sagittifolium (L.) Schott accessions assessed with AFLPs. Table 1 \u00ad Taro: Frequency of major alleles, number of alleles, Nei's genetic diversity, and polymorphism information content (PIC) for 13 primers applied to 26 accessions (Togo collection) Table 2A \u00ad Taro: Statistical measures of genetic diversity in the dasheen and eddoe populations (Togo collection) N = no. accessions (test population), Na = no. of different alleles, Ne = no. of effective alleles, I = Shannon's Information Index, He = Nei\u2019s gene diversity, %P = percentage of polymorphic loci (rounded figures) Locus Freq.", "mime": "application/pdf"}, {"id": "ahs-9764", "words": "5991", "extension": ".pdf", "flesch": "61", "author": "Severino, Vivian; Arias-Sibillotte, Mercedes; Dogliotti, Santiago; Frins, Erna; Gonzalez-Talice, Jaime; Yuri, Jos\u00e9 Antonio", "title": "Climatic and physiological parameters related to the progress and prediction of apple sunburn damage in a neotropical climate", "date": "2020", "keywords": "apple; chlorophyll; cycle; damage; et al; fig; fruit; index; maximum; plant; ratio; reflectance; sci; solovchenko; sunburn", "summary": "Stress adaptation mechanisms of plants, such as chlorophyll reduction (Ballester et al., 2017), dissipa\u00ad tion of excitation energy, increase of solutes of low molecular weight (Wen and Moriguchi, 2015) and changes in pigmentation (Merzlyak et al., 2003) have been previously studied in relation to sunburn in apple fruit. MORALES\u00adQUINTANA L., WAITE J.M., KALCSITS L., TORRES C.A., RAMOS P., 2020 \u00ad Sun injury on apple fruit\u202f: Physiological, biochemical and molecular advances, and future challenges.", "mime": "application/pdf"}, {"id": "ahs-9874", "words": "4585", "extension": ".pdf", "flesch": "57", "author": "Farhadi, H.; Hassanpouraghdam, M.B.; Aazami, Mohammad Ali", "title": "The induction and development of somatic embryos from the in vitro culture of Catharanthus roseus (L.) G. Don", "date": "2021", "keywords": "callus; catharanthus; embryogenesis; embryos; hypocotyl; l\u00ad1; naa; plant; roseus; somatic", "summary": "\u00ad Plants, 9: 3. SINGH R., KHARB P., RANI K., 2011 \u00ad Rapid micropropaga\u2010 tion and callus induction of Catharanthus roseus in vitro different explants. Growth regulators (composition and concen\u00ad tration) and the plant genetic make\u00adup play a role in the success of somatic embryos production.", "mime": "application/pdf"}, {"id": "ahs-9899", "words": "4996", "extension": ".pdf", "flesch": "57", "author": "Jassey, Fatou A.; Babatunde, F.E.; Manneh, F.D.", "title": "Assessment of pesticide residues level in watermelon fruits [Citrullus lanatus (Thunberg) Matsumura and Nakai] in Lower, Central and Upper Badibou Districts in North Bank Region, of the Gambia", "date": "2021", "keywords": "area; farmers; fig; fruits; level; pesticide; research; residue; samples; study; watermelon", "summary": "Sci., 2021 35(2): 119\u00ad127 DOI: 10.36253/ahsc\u00ad9899 Assessment of pesticide residues level in watermelon fruits [Citrullus lanatus In 2016, a total of one hundred and seventy\u00adfour (174) tonnes of watermelon fruits were produced (Department of Planning Agriculture, 2016).", "mime": "application/pdf"}, {"id": "ahs-9923", "words": "6304", "extension": ".pdf", "flesch": "58", "author": "Sikhandakasmita, Panawat; Kataoka, Ikuo; Ogata, Tsuneo; Mochioka, Ryosuke; Beppu, Kenji", "title": "Effect of growth temperature levels on photosynthetic ability and fruit quality of \u2018KU-PP2\u2019, a new low-chill peach cultivar", "date": "2021", "keywords": "chl; fruit; growth; ku\u00adpp2; leaf; leaves; peach; plant; stomatal; temperature; treatment", "summary": "\u00ad Photosynthetica., 51: 163\u00ad190. CENTRITTO M., BRILLI F., FODALE R., LORETO F., 2001 \u00ad Different sensitivity of isoprene emission, respiration and photosynthesis to high growth temperature cou\u2010 pled with drought stress in black poplar (Populus nigra) saplings. Fig. 2 \u00ad SPAD value (A) and chlorophyll content (B) in response to growth temperature treatments.", "mime": "application/pdf"}, {"id": "ahs-9945", "words": "7941", "extension": ".pdf", "flesch": "65", "author": "Mutua, Carol; Ogweno, Joshua; Gesimba, Robert", "title": "Postharvest quality of pepino melon (Solanum muricatum Aiton) as influenced by NPK fertilizer rates, growing environment and storage temperature", "date": "2021", "keywords": "fertilizer; field; fruits; greenhouse; low; npk; npk fertilizer; pepino; plants; room; storage; temperature; tss", "summary": "The high TSS recorded in field grown pepino fruits could be due to high light intensity and thus high photosynthesis leading to more accumulation of sugars in the fruit compared to greenhouse grown fruits where the light intensity was low leading to reduced photosynthesis and hence low accumulation of sugars in the fruits (Beckmann et al., 2006). Greenhouse grown fruits also had a higher PWL compared to field grown fruits in both trials.", "mime": "application/pdf"}, {"id": "ahs-9981", "words": "4419", "extension": ".pdf", "flesch": "58", "author": "Khoulati, Amine; Saalaoui, E.", "title": "Impact of Moroccan Crocus sativus L. tepals, corms, and stigmas extract on growth and photosynthetic pigments in tomato seedling", "date": "2021", "keywords": "application; chlorophyll; content; corms; crocus; extract; plants; saffron; sativus; stigmas; tepals; tomato", "summary": "Many researchers have focused their attention on valuing saffron by\u00adproducts to increase crop profitability, such as floral bio\u00adresidues and (*) Corresponding author: aminekhoulati89@gmail.com Citation: KHOULATI A., SAALAOUI E., 2021 \u00ad Impact of Moroccan Crocus sativus L. tepals, corms, and stigmas extract on growth and photosynthetic pigments in tomato seedling. Discussion and Conclusions The present study\u2019s objective was to valorize the tepals, corms, and stigmas of Crocus sativus L. and take advantage of its bioactive components to use them as a biostimulant alternative to chemicals prod\u00ad ucts.", "mime": "application/pdf"}]