item: #1 of 594
          id: ahs-10101
      author: Lemes Ternus, Fernando; Neumann Silva, Vanessa; Mendes Milanesi, Paola; Tortelli, Brenda 
       title: Kale seed priming with red seaweed biostimulant
        date: 2021
       words: 4988
      flesch: 58
     summary: BEWLEY J.D., BRADFORD K., HIRLHORST H., NONOGAKI H., 2013 ­ Seeds: Physiology of development, germination and dormancy. Furthermore, it should be noted that gib­ berellins stimulate the synthesis and production of hydrolases, especially alpha­amylase, resulting in seed germination (Miransari and Smith, 2014).
    keywords: biostimulant; doses; germination; growth; kale; length; plant; priming; root; seaweed; seed; seedling; solieria
       cache: ahs-10101.pdf
  plain text: ahs-10101.txt

        item: #2 of 594
          id: ahs-10158
      author: Kim, Jin-Ho; Oh, Hye Jin; Kim, Sang Yong; Suh, Gang Uk
       title: Influence of 6-benzylaminopurine spray time after pinching on growth and flowering of Veronica dahurica Steven
        date: 2021
       words: 3220
      flesch: 65
     summary: 2 ­ Flowering characteristics of V. dahurica with pinching and BA spray application. Both pinching and BA foliar spray application can promote branch production by controlling apical dominance through cytokinin signaling (Barbier et al., 2017; Kieber and Schaller, 2018).
    keywords: application; control; flowering; length; mg·l­1; pinching; plant; sdp
       cache: ahs-10158.pdf
  plain text: ahs-10158.txt

        item: #3 of 594
          id: ahs-10193
      author: Ndereyimana, Assinapol; Waweru, Bancy Waithila ; Kagiraneza, Boniface; Niyokuri, Arstide Nshuti ; Rukundo, Placide; Hagenimana, Gregoire 
       title: Effect of vine and fruit pruning on yield attributes of two watermelon (Citrullus lanatus) cultivars
        date: 2021
       words: 4598
      flesch: 64
     summary: A similar trend was recorded at Karama site except that the fruit yield per plant and per hectare for plants which were pruned to three vines with one fruit reduced dur­ ing season 2017B as compared to season 2017A. The highest number of fruits per plant, fruit weight, fruit yield per plant and per hectare was recorded in ‘Julie F1’ compared to ‘Sugar baby’ at both sites and during both seasons. A similar trend was observed in fruit yield per hectare.
    keywords: 2017a; cultivars; fruit; plant; pruning; season; vine; watermelon; yield
       cache: ahs-10193.pdf
  plain text: ahs-10193.txt

        item: #4 of 594
          id: ahs-10277
      author: Toscano, S.; Branca, F.; Ferrante, Antonio; Romano, D.
       title: Zucchini squash production in conventional and organic cultivation systems
        date: 2021
       words: 6917
      flesch: 50
     summary: Organic cultivation system The zucchini squash cultivation was performed following the procedures described in EU n. 834/2007 and 889/2008. The fertigation was carried out with the addition of NOV@ (15 L ha­1), Bio Energy® VEG (20 L ha­1), with Glibor Ca (7 L ha­1), and Mg sulphate (20 kg ha­1); Foliar application was performed with a solution con­ taining NOV@ (15 L ha­1), Bio Energy® VEG (20 L ha­ 1), Fylloton (1.5 L ha­1), Folicist® (1 L ha­1), Cremalga Table 1 ­ Cultivation procedures (inputs) of the organic and conventional systems per hectare of squash cultivation Cultivation procedures (inputs) Cultivation systems Organic Conventional Land use (m2) 10.000 10.000 Mean yield (Mg) 43.2 46.4 Irrigation PE irrigation hoses (m) 6667 6667 Submersible electric pump SHANKTY, QF 106/9 + pump motor HP 50 8’’(h) 45 45 Water (m3) 2100 2100 Fruit harvesting (h) 19 19 Machinery Harrowing (h) 8 8 Tillers (h) 8 8 Fertilizer spreader (h) 5 5 Spreading plastic mulching (h) 16 16 Soil tillage (h) 15 15 Spreading plastic tunnel coverage (h) 98 98 Plastic maintenance 28 28 Toscano et al. ‐ Conventional and organic zucchini Squash 199 Manual weed control was carried out as described for organic cultivation system (Fig. 1).
    keywords: biolchim; cultivation; food; fruit; ha­1; l ha­1; organic; production; quality; s.p.a; sci; squash; systems; yield; zucchini
       cache: ahs-10277.pdf
  plain text: ahs-10277.txt

        item: #5 of 594
          id: ahs-10346
      author: Feyissa, Tileye
       title: Prospects for improvement of Plectranthus edulis (Vatke) Agnew: A high potential food security crop
        date: 2021
       words: 6280
      flesch: 59
     summary: There is enormous untapped potential in Ethiopia to exploit the rich and diverse plant genetic resour­ ces of underutilized root and tuber crops including P. edulis. Prospects of biotechnology for improvement of P. edulis In addition to the shortage of seed tubers and the poor storability of the tubers, systemic diseases, viru­ ses, viroids and mycoplasma as well as several patho­ genic bacteria are the most devastating root and tuber crops including P. edulis, in terms of yield loss 324 Adv.
    keywords: crop; diversity; edulis; ethiopia; farmers; food; medium; p. edulis; plant; plectranthus; potato; research; shoot; starch; tuber
       cache: ahs-10346.pdf
  plain text: ahs-10346.txt

        item: #6 of 594
          id: ahs-10414
      author: Mohammadnia, Saber; Haghighi, Maryam
       title: 'Momordica charantia’ introducing a new rootstock for grafted cucumber under low-temperature stress 
        date: 2021
       words: 6714
      flesch: 63
     summary: Some of the studies have used different rootstocks for cucumbers under different stresses showing better growth rate for grafted plants under stress conditions compared to non­grafted ones like: heavy metal absorption (Rouphael et al., 2008; Kumar et al. , 2015), low soil temperatures (Tachibana, 1982), salinity (Huang et al., 2010), improve NaCl and CaCl2 tolerance in Cucumber (Colla et al., 2013), Al toxicity in cucumber (Rouphael et al., 2016). Hole­insertion grafting was used and grafted plants were transferred to a recovery greenhouse with high relative humidity.
    keywords: charantia; cucumber; effect; et al; fig; fruit; grafting; momordica; plant; rma; rmo; rootstock; temperature
       cache: ahs-10414.pdf
  plain text: ahs-10414.txt

        item: #7 of 594
          id: ahs-10449
      author: dos Santos Pereira, Ivan; Grecco da Silva Porto, Fabiane; Eduardo Corrêa Antunes, Luis; Diniz Campos, Ângela 
       title: Phytoprotective film for resistance induction, growth, and yield of organic strawberries
        date: 2022
       words: 5887
      flesch: 59
     summary: VAN DEN BROEK L.A.M., KNOOP R.J.I., KAPPEN F.H.J., BOERIU C.G., 2015 ­ Chitosan films and blends for pack‐ aging material. REUVENI R., DOR G., RAVIV M., REUVENI M., TUZUN S., 2000 ­ Systemic resistance against Sphaerotheca fulig­ inea in cucumber plants exposed to phosphate in hydroponics system, and its control by foliar spray of mono‐potassium phosphate.
    keywords: activity; anthracnose; chitosan; chi­pyro­film; concentration; cultivars; effect; et al; extract; fig; growth; k2hpo4; l­1; plant; resistance; strawberry; yield
       cache: ahs-10449.pdf
  plain text: ahs-10449.txt

        item: #8 of 594
          id: ahs-10523
      author: Oyetunde, Oyeboade Adebiyi; Olayiwola, Muyideen Oluseyi; Osho, Beatrice Toyin
       title: Genetic diversity and trait profiles of some Amaranthus genotypes
        date: 2021
       words: 4816
      flesch: 55
     summary: Amaranthus accessions were evaluated in 2018 and 2019 to investigate the extent of genotypic diversity among the amaranth accessions and their trait profiles. 1 ­ Principal component loading pattern of six traits of Amaranthus accessions.
    keywords: accessions; amaranthus; biomass; index; leaves; number; plant; root; state; stem; traits; weight
       cache: ahs-10523.pdf
  plain text: ahs-10523.txt

        item: #9 of 594
          id: ahs-10536
      author: Kivrak Kiran, Secil; Galatali, Selin; Yeniocak, Sevil; Ozkaya, Damla Ekin; Mercan, Taner; Guldag, Sevinc; Celik, Onur; Abdul Ghafoor, Naeem; Kaya, Eergun
       title: Investigation of modified WPM medium for the best meristem proliferation of Corylus avellana L.
        date: 2021
       words: 5344
      flesch: 56
     summary: In addition to the continuous production thro­ ughout the year by obtaining thousands of plants with the same form and characteristics as the mother plant in a short time by micropropagation method from plant tissue cultures; superior species resistant to factors such as drought, salinity, acidity, and/or cold can also be produced. Different techniques in plant tissue culture can be used such as shoot tip culture by transferring the shoot tips with growth cone including meristematic doom to in vitro environment, bud node culture by transferring the axillary or apical buds of the shoots to aseptic conditions, meristem culture by transfer­ ring meristem from the meristematic region to the nutrient medium with the help of a stereomicrosco­ pe, embryo culture by taking the embryo from the seed template or from the seed and transferring it to the germination medium (Ahmad and Anis, 2007; Usha et al., 2007).
    keywords: avellana; corylus; culture; et al; fe­eddha; hazelnut; kaya; medium; meristem; plant; production; shoot; wpm
       cache: ahs-10536.pdf
  plain text: ahs-10536.txt

        item: #10 of 594
          id: ahs-10628
      author: Jokari, Sakineh; Shekafandeh, Akhtar
       title: Effect of harvest time and fruit size on seed germination and seedlings growth of sour orange and Mexican lime under in vitro conditions
        date: 2021
       words: 4911
      flesch: 64
     summary: Based on fruit growth curve the time of fruit harvest affected seed germination (percent­ age and rate) and seedling growth (stem and root length, fresh and dry weight of stems, roots and leaves). In vitro seedling growth indices Fruit harvest time in both citrus species had a sig­ nificant effect on seed growth indices (stem length, Fig.
    keywords: citrus; days; flowering; fruits; germination; growth; harvest; lime; orange; seed; sour; time
       cache: ahs-10628.pdf
  plain text: ahs-10628.txt

        item: #11 of 594
          id: ahs-10630
      author: Comparini, Diego ; Taiti, Cosimo; Lanza, Matteo; Vita, Federico; Pandolfi, Camilla; Luti, Simone; Spinelli, F.; Pazzagli, Luigia; Mancuso, Stefano
       title: Comparison of wild and domesticated hot peppers fruit: volatile emissions, pungency and protein profiles
        date: 2021
       words: 9281
      flesch: 58
     summary: Moscone et al., 2007; Ince et al., 2009; Sudré et al., 2010) and the current system for classifications involved genus, species, variety, pod type and culti­ vars (Bosland and Votava, 2012). Furthermore, the characterization and evaluation of the species belonging to the genus Capsicum are particularly interesting for breeders, gene banks, because of the large genetic variability available (Guzmán et al., 2005; Sudré et al., 2006; Ince et al., 2009).
    keywords: analysis; annuum; baccatum; c. annuum; capsaicin; capsicum; chacoense; compounds; data; et al; fragment; fruits; genus; h3o; identification; mass; no+; pepper; reagent; sci; species; table; taiti; vocs
       cache: ahs-10630.pdf
  plain text: ahs-10630.txt

        item: #12 of 594
          id: ahs-10641
      author: Ashour, Hossam Ahmed; Esmail, Sanaa E.A.; El- Attar, Asmaa
       title: Responses of different quality parameters of Chia to arbuscular mycorrhiza and plant growth regulator
        date: 2021
       words: 8060
      flesch: 61
     summary: Plant growth regulators (PGRs) have been defined as one of the major factors affecting plants growth and their primary and secondary metabolites, NAA is an organic compound that is synthetic plant hor­ mone in the auxin family. BAYDAR H., ERDAL I., 2004 ­ Effect of plant growth regula‐ tors on leaf quality of Oregano (Origanum onites).
    keywords: absence; amf; application; chia; et al; fungi; growth; increase; naa; oil; pgrs; plant; plant growth; ppm; presence; salvia; sci; seeds; total; yield
       cache: ahs-10641.pdf
  plain text: ahs-10641.txt

        item: #13 of 594
          id: ahs-10660
      author: Povilonis, Ignacio; Arena, Miriam Elisabet; Radice, Silvia
       title: Hexachlamys edulis (Berg) Kausel & Legrand, “ubajay”, a native fruit species from South America
        date: 2021
       words: 5571
      flesch: 60
     summary: A more exhaustive observation allowed determining that this species is phanerophytes ­ by the aerial loca­ tion of its buds (Raunkiaer, 1934) ­ and deciduous with concomitant foliar renewal and that apparently low temperatures accelerate defoliation (González, 2003). APEL M.A., SOBRAL M., MENUT C., BASSIERE J.M., ZUANAZZI J.Á., SCHAPOVAL E.E.S., 2005 ­ Volatil consti‐ tuents of four Hexachlamys species growing in South Brazil.
    keywords: argentina; berg; brazil; cruz; edulis; et al; eugenia; food; fruit; gonzález; hexachlamys; hexachlamys edulis; legrand; myrcianthes; myrtaceae; south; species; uruguay
       cache: ahs-10660.pdf
  plain text: ahs-10660.txt

        item: #14 of 594
          id: ahs-10706
      author: Silva, Suzanna de Sousa ; Alves, Patrícia Costa dos Santos ; Coutinho, Denise Fernandes ; Luz, Tássio Rômulo Silva Araújo; Fontoura, Guilherme Martins Gomes ; Berretta, Andresa Aparecida ; Gonçalves Maciel, Marcia Cristina
       title: Punica granatum L. extract contributes to phytopathogens control and enhances Eruca vesicaria (L.) Cav. germination in vitro and in vivo
        date: 2021
       words: 9694
      flesch: 56
     summary: Seedlings infected and treated with Punica granatum L. hydroalcoholic extract (Pp) (500 µg/mL); E) Seedlings infected and treated with P. granatum L. hydroalcoholic extract (Pp) (250 µg/mL); F) Seedlings infected and treated with association between P. granatum L. hydroalcoholic extract (Pp) (500 µg/mL) and streptomycin sulfate. The potential of the extract for natural control of X. campestris pv. campestris as an sustain­ able alternative for treatment of vegetable seeds was assayed.
    keywords: activity; bacteria; campestris; carotovorum; concentration; control; et al; extract; fig; fruit; granatum; hydroalcoholic; peel; plant; pomegranate; punica; seedlings; seeds; subsp; treatment; vesicaria
       cache: ahs-10706.pdf
  plain text: ahs-10706.txt

        item: #15 of 594
          id: ahs-10714
      author: Musabyisoni, Aloys; Waweru, B.; Nishizawa, T.
       title: Effect of salt stress by “onsen” water on plant growth and fruit quality of tomato cv. Reika in pot soil
        date: 2021
       words: 3497
      flesch: 66
     summary: Tomato fruits are rich in min­ erals, vitamins, essential amino acids, sugars and dietary fibres and thus contribute to a healthy, well­balanced diet. The majority of tomato fruits produced are consumed in processed form such as peeled tomato (whole or diced), juices, sauce and ketchup, whose manufacture often requires peel removal (Shankara et al., 2005; Rock et al., 2012).
    keywords: fruit; onsen; plant; salinity; salt; stress; tomato; water
       cache: ahs-10714.pdf
  plain text: ahs-10714.txt

        item: #16 of 594
          id: ahs-10740
      author: Kaur, Avninder; Sharma, Sucheta; Singh, Navprem 
       title: Biochemical changes in pear fruits during storage at ambient conditions
        date: 2021
       words: 7259
      flesch: 63
     summary: Kaur et al. ‐ Ripening of pear fruits during storage 295 interval with penetrometer (Model No. Kaur et al. ‐ Ripening of pear fruits during storage 297 Carbohydrate composition and Sucrose metabolizing enzymes Reducing sugars increased up to 3 DAS in ‘PN’ and 6 DAS in ‘PB’ fruits and then declined during advanced storage period (Fig.
    keywords: activity; conditions; content; cultivars; das; days; enzymes; et al; fig; fruits; pear; punjab; storage; sucrose
       cache: ahs-10740.pdf
  plain text: ahs-10740.txt

        item: #17 of 594
          id: ahs-10850
      author: Behnam, Habibeh; Feizi, Hassan; Alipanah, Masoud
       title: Alleviation the effects of salinity stress using titanium dioxide nano and bulk particles in Echinacea seeds and seedlings
        date: 2021
       words: 7082
      flesch: 58
     summary: Res., 146(1): 101­ 106. GOHARI G., MOHAMMADI A., AKBARI A., PANAHIRAD S., DADPOUR M.R., FOTOPOULOS V., KIMURA S., 2020 ­ Titanium dioxide nanoparticles (TiO2 NPs) promote growth and ameliorate salinity stress effects on essen‐ tial oil profile and biochemical attributes of Dracocephalum moldavica. The results reported in Table 3 show that Echinacea had the highest germination percentage at the level of zero and salinity stress ­3 bar, but with increasing salinity stress, the germination percentage decreased significantly.
    keywords: bar; dioxide; echinacea; germination; length; nanoparticles; salinity; salinity stress; seed; seedling; stress; titanium; titanium dioxide
       cache: ahs-10850.pdf
  plain text: ahs-10850.txt

        item: #18 of 594
          id: ahs-10854
      author: Lyakh, Viktor; Soroka, Anatoliy
       title: Artificial medium for in vitro pollen germination of some ornamental Linum species
        date: 2021
       words: 2215
      flesch: 50
     summary: Figure 2 demonstrates pollen germination pattern on a media with PEG of different molecular weight and sucrose, showing the proportion of pollen grains with normal and burst pollen tubes. A medium, consisting of boric acid, calcium chloride and sucrose as osmotic agent is commonly used for pollen germination of different species.
    keywords: germination; linum; peg; pollen; species; sucrose
       cache: ahs-10854.pdf
  plain text: ahs-10854.txt

        item: #19 of 594
          id: ahs-10914
      author: Alabboud, Michael ; Kalantari , Siamak ; Soltani, Forouzandeh 
       title: Postharvest performance interpretation and storage temperature optimization in some newly introduced melon hybrids
        date: 2022
       words: 5749
      flesch: 58
     summary: WU Z., TU M., YANG X., XU J., YU Z., 2020 ­ Effect of cutting and storage temperature on sucrose and organic acids metabolism in postharvest melon fruit. However, all the studied hybrids showed signifi­ cant colour changes after 10 days in cold storage and under all temperature except for ‘Cm­UTKHA’ which showed significant colour changes only after 20 days in storage and under higher storage temperature (>5°C).
    keywords: analysis; changes; firmness; fruit; hybrids; loss; melon; postharvest; storage; temperature; tss; weight
       cache: ahs-10914.pdf
  plain text: ahs-10914.txt

        item: #20 of 594
          id: ahs-10983
      author: Ferreira Cavalcante, Daniele ; Pradi Vendruscolo, Eduardo; Seleguini, Alexsander ; de Castro Seron, Cássio; Costa, Edilson; Leandro Pires, Larissa
       title: Reflective benches for improving lighting in residential basil cultivation
        date: 2021
       words: 4687
      flesch: 53
     summary: KAMI C., LORRAIN S., HORNITSCHEK P., FANKHAUSER C., 2010 ­ Light‐regulated plant growth and development. The bright white and red laminate covers positively influence environmental condi­ tions, increasing the reflectance of photosynthetically active radiation, and the development of basil plants in conditions of greater shading.
    keywords: basil; cultivation; development; growth; laminate; light; mesh; plants; radiation; red; weight; white
       cache: ahs-10983.pdf
  plain text: ahs-10983.txt

        item: #21 of 594
          id: ahs-11437
      author: Smith, Tracy-Ann; Vásquez-Martínez, Juan; Mellado-Mojica, Erika; Vaidya, Kisan; Lopez, Mercedes; Benkeblia, Noureddine
       title: Profiling of primary metabolites of Averrhoa carambola, Spondias dulcis and Syzygium malaccense fruits revealed underpinning markers during “on-tree” maturation and ripening stages
        date: 2022
       words: 8676
      flesch: 61
     summary: There is almost no work reporting on the compo­ sition of June plum fruit during maturation and ripen­ ing except from the one of Benkeblia and López (2015). Other scattered studies reported on the vari­ ation of sugars and organic acids in June plum fruit but at a specific stage.
    keywords: acid; analysis; carambola; development; et al; fructose; fruits; glucose; june; june plum; malic; maturation; metabolites; n.d; otaheite; plum; ripening; sci; stages; sucrose; sugars; total
       cache: ahs-11437.pdf
  plain text: ahs-11437.txt

        item: #22 of 594
          id: ahs-11517
      author: Taufique, Tropa ; Nishizawa, Takashi ; Roy, Tuhin Suvra ; Meiko, Kikuchi ; Chakraborty, Rajesh ; Mostofa, Maruf; Nara, Kazuhiro 
       title: Histological and physiological changes of potato starch derived from seed and TPS (true potato seed) grown tubers under different cold storage duration
        date: 2021
       words: 7352
      flesch: 63
     summary: JOHNSTON F., URBAS B. KHANZADA G., 1968 ­ Effect of storage on the size distribution and amylose/amy, lopectin ratio in potato starch granules. Sci., 2021 35(4): 371­381 DOI: 10.36253/ahsc­11517 Histological and physiological changes of potato starch derived from seed and TPS (True Potato Seed) grown tubers under different cold storage duration T. Taufique 1, 2, T. Nishizawa 1, T.S. Roy 2, K. Meiko 1, R. Chakraborty 2, M. Mostofa 3 (*), K. Nara 1 1 Department of Bioproduction, Faculty of Agriculture, Yamagata University, 1‐23 Wakaba Machi, Tsuruoka 997‐8555, Yamagata, Japan.
    keywords: content; degradation; et al; fig; granule; lady; potato; potato starch; rosetta; seed; size; starch; starch granule; storage; sugar; surface; tps; tps­1; tuber
       cache: ahs-11517.pdf
  plain text: ahs-11517.txt

        item: #23 of 594
          id: ahs-11519
      author: Lowe, Gail; Shepherd, Mervyn; Rose, Terry; Raymond, Carolyn
       title: Strigolactone analogue GR24 reduces axillary bud out break and growth in tea tree, Melaleuca alternifolia (Maiden & Betche) Cheel
        date: 2021
       words: 4650
      flesch: 62
     summary: BALLA J., KALOUSEK P., REINOHL V., FRIML J., PROCHAZKA S. 2011 ­ Competitive canalization of PIN‐dependent auxin flow from axillary bud controls pea bud out‐ growth. 3. Results Effects of GR24 on axillary bud growth in tea tree Rates of bud release over a 21 day time course exper‐ iment Treatment effect was significant at each of the 9 days counts were undertaken (p<0.05) (Fig. 2).
    keywords: auxin; bud; buds; control; gr24; node; plants; shoot; tea; tree
       cache: ahs-11519.pdf
  plain text: ahs-11519.txt

        item: #24 of 594
          id: ahs-11568
      author: Wu, X.; Wang, L.; Roh, Mark
       title: Reduction of leaf tip burns of Ornithogalum dubium by controlling the temperature during bulb storage and greenhouse forcing to produce quality plants
        date: 2022
       words: 6996
      flesch: 68
     summary: Three criteria were established to determine the quality of O. dubium plants. The objectives of this research were to produce quality potted O. dubium plants by reducing the inci­ dence of LTB, accelerating flowering while ensuring the maximum number of flower buds, and desirable morphologies as influenced by temperature treat­ ment during the bulb handling and greenhouse forc­ ing stages to establish the optimum temperature regimes that reduce the incidence of LTB, and accel­ erate flowering with desirable morphologies.
    keywords: bulbs; leaf; leaves; ltb; plants; ppm; st­a; st­b; st­c; tip
       cache: ahs-11568.pdf
  plain text: ahs-11568.txt

        item: #25 of 594
          id: ahs-11825
      author: Sota, Valbona; Benelli, Carla ; Çuko, Brunilda ; Kongjika, Efigkeni 
       title: Effect of a double phase culture system and activated charcoal on in vitro propagation of Malus sylvestris (L.) Mill.
        date: 2021
       words: 6078
      flesch: 54
     summary: JOVA M.C., KOSKY R.G., CUELLAR E.E., 2011 ­ Effect of liq‐ uid media culture systems on yam plant growth (Dioscorea alata L. ‘Pacala Duclos’). COUSELO J.L., VARELA P., REY M., 2006 ­ Effect of benzyla‐ denine concentration and double‐phase culture system on in vitro multiplication of adult Albari plants.
    keywords: apple; charcoal; culture; dps; et al; liquid; l­1; medium; micropropagation; number; plant; rooting; roots; shoots; system
       cache: ahs-11825.pdf
  plain text: ahs-11825.txt

        item: #26 of 594
          id: ahs-12015
      author: Bayat, Hassan; Shafie, Fatemeh ; Shahraki, Basireh 
       title: Salinity effects on growth, chlorophyll content, total phenols, and antioxidant activity in Salvia lavandulifolia Vahl.
        date: 2022
       words: 5758
      flesch: 63
     summary: Salinity stress reduces cell divi­ Fig. 2 ­ Effects of salinity stress on the leaf total phenolic and fla­ vonoid content in S. lavandulifolia. Valifard et al. (2019) reported that photosyn­ thetic pigments in Salvia mirzayanii leaves were decreased by increasing salinity stress.
    keywords: chlorophyll; content; effects; et al; growth; lavandulifolia; leaf; plant; salinity; salinity stress; salt; salvia; stress; total; water
       cache: ahs-12015.pdf
  plain text: ahs-12015.txt

        item: #27 of 594
          id: ahs-12041
      author: Dorostkar, Maryam; Moradinezhad, Farid 
       title: Postharvest quality responses of pomegranate fruit (cv. Shishe-kab) to ethanol, sodium bicarbonate dips and modified atmosphere packaging
        date: 2022
       words: 7764
      flesch: 62
     summary: Abstract: Pomegranate fruit is very popular due to its high commercial impor­ tance and health benefits. This experiment aimed to evaluate the sensory qual­ ity, color, and biochemical properties (TSS, TA, TSS/TA, anthocyanin content and total antioxidant capacity) of pomegranate fruit under post­harvest treat­ ments, included ethanol (EtOH), sodium bicarbonate (SBC), and different pack­ aging.
    keywords: antioxidant; color; control; decay; effect; et al; ethanol; etoh; food; fruit; packaging; pomegranate; postharvest; quality; sci; storage; treatment; tss
       cache: ahs-12041.pdf
  plain text: ahs-12041.txt

        item: #28 of 594
          id: ahs-12062
      author: Kamimaeda, Hiroki; Yoshida, Yuki; Tamaki, Kaito; Ichihara, Masato; Akutsu, Masako
       title: Effect of far-red light applied at the end of the day in red and green leaf lettuce cultivars grown under two types of white LED
        date: 2023
       words: 6072
      flesch: 68
     summary: For red lettuce cultivars, the scatter diagram of the types of LEDs and each cultivar for the first (Z1) and second main components (Z2) showed that the fresh total weight, fresh leaf weight, stem weight, root weight, and dry total weight in ‘Red wave’, ‘Bancyu sun bright’, ‘Sun bright’, ‘Fancy red’, ‘Red fire’, ‘Sun Marino’ and ‘Calbee red’ grown under White A + FR was higher (Fig. 2). On the other hand, under White B irradia­ tion, fresh total weight and fresh leaf weight were increased in only ‘Bancyu sun bright’ and ‘Sun bright’ of red lettuce cultivars and in ‘Summer green’ and ‘Yakiniku lettuce’ of green lettuce cultivars on the treatment FR LED.
    keywords: cultivars; green; irradiation; leaf; leaf weight; lettuce; light; red; stem; weight; white
       cache: ahs-12062.pdf
  plain text: ahs-12062.txt

        item: #29 of 594
          id: ahs-12185
      author: Oraee, Atiyeh; Shoor, Mahmoud; Oraee, Toktam; Tehranifar, Ali; Nemati, Hossein
       title: Organic amendments role in reducing drought stress in Alcea Rosea L.
        date: 2022
       words: 9711
      flesch: 62
     summary: Some studies documented the reduced element transfer in plants under soil drought stress (Liu et al., 2018; Qi et al., 2019). With increasing drought stress from 80 to 40% FC, the plantʼs RWC decreased.
    keywords: activity; amendments; application; chlorophyll; content; drought; drought stress; effects; et al; fig; growth; hollyhock; increase; leaf; leaves; manure; nitrogen; phosphorus; plant; potassium; rice; sci; soil; stress; total; water; weight
       cache: ahs-12185.pdf
  plain text: ahs-12185.txt

        item: #30 of 594
          id: ahs-12192
      author: Menegatti, Renata Diana; Lima, Marcos Aurélio C.; Souza, Aline G.; Smiderle, Oscar José; Bianchi, Valmor João
       title: Contrasting aspects of the physical and physiological dormancy shown by seeds from different peach rootstocks
        date: 2022
       words: 4537
      flesch: 49
     summary: At the end of the germination test (at 90 days), the percentage of seed germination was determined, with germinated seeds considered as those that pre­ sented radicle protrusion of at least two millimeters (MAPA, 2009). This fac­ tor could compromise seed germination due to the difficulty of the embryo to overcome such a barrier during initial stages of the germination process when imbibition of water is critical.
    keywords: days; endocarp; germination; seeds; souza; stratification
       cache: ahs-12192.pdf
  plain text: ahs-12192.txt

        item: #31 of 594
          id: ahs-12222
      author: Mirshekari , Amin ; Madani, Babak
       title: Decreasing postharvest chilling injury of guava fruit by using melatonin treatment
        date: 2022
       words: 3970
      flesch: 66
     summary: Sci., 2022 36(1): 37­42 DOI: 10.36253/ahsc­12222 Decreasing postharvest chilling injury of guava fruit by using melatonin treatment A. Mirshekari 1 (*), B. Madani 2 1 Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Yasouj, Yasuj, Iran. 2 Horticulture Crops Research Department, Natural Resources Research and Education Center of Hormozgan, AREEO, Bandar Abbas, Iran. Also, results indicated that chill­ ing injury of guava fruit by using melatonin decreased through increasing integrity of membrane and reducing phospholipase D and lipoxygenase activity.
    keywords: activity; fruit; guava; injury; melatonin; storage; treatment
       cache: ahs-12222.pdf
  plain text: ahs-12222.txt

        item: #32 of 594
          id: ahs-12275
      author: Aloo, Maurine; Opiyo, Arnold Mathew ; Saidi, Mwanarusi 
       title: Maintaining postharvest quality of bell pepper (Capsicum annuum L. cv. California Wonder) using cactus (Opuntia stricta L.) mucilage coating
        date: 2022
       words: 5563
      flesch: 60
     summary: 3. Results Effect of cactus mucilage coating on fresh weight loss and shelf life of bell pepper fruit Cactus mucilage treatments significantly reduced fresh weight loss of bell pepper fruits from 3 DAH (days after harvest) to the end of storage (Fig. 1). Effect of cactus mucilage coating on total soluble solids of bell pepper fruit Cactus mucilage coating had a significant effect on total soluble solids (TSS) content of bell pepper fruit from 3 DAH through the end of storage (Fig. 3).
    keywords: acid; ascorbic; bell; cactus; cactus mucilage; coating; content; fruit; life; loss; mucilage; pepper; shelf; weight
       cache: ahs-12275.pdf
  plain text: ahs-12275.txt

        item: #33 of 594
          id: ahs-12290
      author: Tutu, Abhaya Kumar Sahu; Guddun, Swikruti Sonali Kar; Kumari, Punam; Dey, Surjendu Kumar Dey
       title: An overview of Betel vine (Piper Betle L.): Nutritional, pharmacological and economical promising natural reservoir
        date: 2022
       words: 12019
      flesch: 59
     summary: (Haider et al., 2013). After that, the leaves are distributed in local markets or transferred to other towns (Haider et al., 2013).
    keywords: acid; activities; activity; adv; antioxidant; betel; betel leaf; betel leaves; betel vine; betle; betle l.; cancer; coastal; cultivation; essential; et al; extract; food; india; inter; leaf; leaves; medicine; nutritional; odisha; oil; paan; piper; piper betle; plant; potential; pradhan; properties; res; review; role; rot; sci; vine; water
       cache: ahs-12290.pdf
  plain text: ahs-12290.txt

        item: #34 of 594
          id: ahs-12341
      author: Utama, Nafi Ananda; Pranata, Iin Anggi ; Pramesi, Putrika Citta
       title: Maintaining physicochemical and sensory properties of guava var. Getas Merah using alginate and Cyclea barbata leaveas powder as edible coating
        date: 2022
       words: 6873
      flesch: 65
     summary: The analysis of firmness, total soluble solids, total reducing sugar, total titratable acidity and organoleptic tests were conducted to evaluate the quality of guava fruits stored for 20 d at 14°C. In summary longer quality retention of guava fruits was found after the addition of CBLP in alginate­based edible coating.
    keywords: acid; alginate; cblp; coating; days; firmness; fruit; guava; results; samples; sci; solids; storage; study; sugar; total
       cache: ahs-12341.pdf
  plain text: ahs-12341.txt

        item: #35 of 594
          id: ahs-12347
      author: Park, Seo Young; Joung, Young Hee; Suh, Jeung Keun; Roh, Mark
       title: Evaluation of Hemerocallis germplasm using single nucleotide polymorphisms of nrITS and chloroplast interspacer region
        date: 2022
       words: 2900
      flesch: 57
     summary: Materials and Methods The nocturnal flowering species Hemerocallis thunbergii, H. minor, H. lilioasphodelus, and H. citri‐ na, and the day flowering species H. hongdoensis M.G. Chung & S.S. Kang, H. vespertina H. Hara, H. dumortierii C. Morren and hybrid ‘Stella de Oro’ were collected from Korea (K), China (C), United Kingdom (UK), United States of America (UA) and Germany (GE) (Table 1). Four noctur­ nal flowering species, H. citrina, H. thunbergii, H. minor, and H. lilioasphodelus were collected including Korea, and compared with day flowering species that included H. vespertina and H. hongdoensis.
    keywords: c c; flowering; hemerocallis; i­2; korea; minor; nrits; species
       cache: ahs-12347.pdf
  plain text: ahs-12347.txt

        item: #36 of 594
          id: ahs-12403
      author: Tofanelli, Mauro B.D.; Cuquel, Francine Lorena; D’angelo, Jessica Welinski de Oliveira; Medeiros, José Gilberto Sousa
       title: Postharvest application of calcium chloride and 1-methylcyclopropene for quality conservation on organic ripe fig
        date: 2022
       words: 5042
      flesch: 57
     summary: Although fig tree cultivation has the potential to escalate, some pro­ duction bottlenecks have inhibited this expansion, such as lack of com­ mercial cultivars, unfamiliarly about ripe fig as excellent fruit for food from consumers, relative high price of ripe figs in the market, inefficient fresh ripe fig distribution and difficult to conserve quality of ripe figs after (*) Corresponding author: mbrasildt@ufpr.br Citation: TOFANELLI M.B.D., CUQUEL F.L., DE O. D’ANGELO J.W., MEDEIROS J.G.S., 2022 ­ Postharvest appli‐ cation of calcium chloride and 1‐methylcyclopro‐ pene for quality conservation on organic ripe fig. The calcium chloride solution applied at 4% improves firmness and promotes soluble solid stabi­ lization of ripe figs stored for 6 days in a refrigerator, whereas 1­MCP treatment at a dose of 10 μg l­1 does not contribute for maintaining postharvest quality of ripe fig, nor its shelf life.
    keywords: 1­mcp; cacl2; calcium; days; et al; figs; fruit; maturation; postharvest; quality; storage
       cache: ahs-12403.pdf
  plain text: ahs-12403.txt

        item: #37 of 594
          id: ahs-12444
      author: Maniriho, Festus
       title: Flower differentiation and fruiting dynamics in olive trees (Olea europaea): Eco-physiological analysis in the Mediterranean basin
        date: 2022
       words: 6779
      flesch: 56
     summary: The formation of functional staminate rather than entirely functional hermaphrodite flowers throughout development is one of the primary factors determining the fruit set­ ting level of olive flowers (Reale et al., 2009). Although various studies have been done on the dif­ ferentiation process of olive flowers, there have been very few specialised investigations to document and compare biological flower development and fruit set research among cultivars in this area.
    keywords: bearing; cultivars; et al; europaea; factors; flowers; fruit; hermaphrodite; mediterranean; olea; olive; pistil; plant; pollen; sci; set; staminate; trees
       cache: ahs-12444.pdf
  plain text: ahs-12444.txt

        item: #38 of 594
          id: ahs-12450
      author: Raei, Yaghoub; Ghahremani, Roghaye ; Ghassemi, Saeid; Shafagh-Kolvanagh, Jalil 
       title: Effect of chemical and biological fertilizers on the morphology and yield of safflower and soybean under monoculture and intercropping
        date: 2022
       words: 4848
      flesch: 59
     summary: Similarly, the means of head number per plant and grain number per head in safflower plants and also 100 grains weight in soybean plants were increased in inter­ cropped patterns compared with pure cultivation (Table 3). Traits Grain number per plant Biological yield (kg/ha) Grain yield (kg/ha) Safflower 100% urea fertilizer 252 b 8831 b 3358 b 100% biofertilizer 255.4 b 9194 ab 3359 b 50% Urea + 50% biofertilizer 296.6 a 10430 a 4284 a Soybean Traits Leaf number per plant Biological yield (kg/ha) Grain yield (kg/ha) 100% urea fertilizer 10.73 b 4122 b 1706 b Urea + biofertilizer 12.95 a 4839 a 2115 a 124 Adv.
    keywords: fertilizer; grain; grain number; intercropping; nitrogen; number; plant; safflower; soil; soybean; yield
       cache: ahs-12450.pdf
  plain text: ahs-12450.txt

        item: #39 of 594
          id: ahs-12488
      author: Titouh, Khayreddine; Hadj Moussa, Khadidja; Boufis, Nazim; Khelifi, Lakhdar
       title: Impact of cultural conditions on germination of olive (Olea europaea L.) somatic embryos and plantlets development from the Algerian cultivar Chemlal
        date: 2022
       words: 4963
      flesch: 52
     summary: However, few works have been done about the ger­ mination conditions of olive somatic embryos (Mazri et al., 2020) Discussion and Conclusions Germination of somatic embryos Germination of olive somatic embryos was fre­ quently achieved on media based on the chemical formulations OM and MS with a reduced concentra­ tion of mineral salts, similar to those used for the cul­ ture of zygotic embryos (Sánchez­Romero, 2019).
    keywords: culture; embryogenesis; embryos; germination; l­1; medium; olive; plants; shoots
       cache: ahs-12488.pdf
  plain text: ahs-12488.txt

        item: #40 of 594
          id: ahs-12535
      author: Cano Reinoso, Diego Mauricio; Renaldy Tamalea , Rafi; Wibowo, Condro
       title: Physicochemical characteristic and internal browning of pineapple as affected by calcium and gibberellic acid dipping application
        date: 2022
       words: 7070
      flesch: 62
     summary: Fructose (%) Sucrose (%) Studied factors (single and interaction effect) Treatment ­ ­ ­ ­ ­ ­ Dipping time ­ ­ ­ ­ ­ ­ Treatment x Dipping time ­ ­ ­ ­ ­ ­ Mean values (Treatment vs. Dipping time)
    keywords: acid; browning; calcium; content; dipping; et al; fruit; minutes; paull; pineapple; postharvest; treatment
       cache: ahs-12535.pdf
  plain text: ahs-12535.txt

        item: #41 of 594
          id: ahs-12552
      author: Balbino dos Santos, Pietros André; de Carvalho, Luiz Gonsaga; Schwerz, Felipe; Buono da Silva Batista, Victor ; Ussi Monti, Cassio Augusto
       title: Economic viability and development of radish (Raphanus sativus L.) under different soil water tensions and mulching types
        date: 2022
       words: 7393
      flesch: 60
     summary: Inputs and Labor represent, on average, 47% of total production costs. Average total operating cost (TOC) and average total cost (ATC) were calculated in unit terms in the economic analysis.
    keywords: abc; analysis; area; cost; crop; growth; irrigation; leaf; mulching; plant; production; radish; root; soil; total; variable; water; yield
       cache: ahs-12552.pdf
  plain text: ahs-12552.txt

        item: #42 of 594
          id: ahs-12574
      author: Anyaoha, Chriatian Okechukwu; Oyetunde, O. A.; Oguntolu, O.O.
       title: Diallel analysis of selected yield-contributing traits in Okra [Abelmoschus esculentus (L.) Moench]
        date: 2022
       words: 7000
      flesch: 63
     summary: LD88 × Iwo Nla and Clemson × Iwo Nla. × Iwo Nla 51.00 b­e 74.75 b­e 12.25 a 13.61 a 2.72 dc 2.25 cd 9.50 c 68.50 de 60.00 c 5.00 h Clemson × Iwo Nla 48.25 ef 75.50 b­e 4.00 e 6.74 d 2.93 dc 2.00 de 13.00 a 30.50 f 42.50 e 7.75 def Source DF DTF PH NOF LNT FWT PL INL NOS THS NOR Rep (Environment) 2 ** NS ** NS NS NS NS NS NS NS Environment (E) 1 ** NS ** NS NS NS NS NS NS NS Genotype (G) 14 ** ** ** ** ** ** ** ** ** ** G×E 14 NS NS NS NS NS NS NS NS NS * Error 28 NS NS NS NS NS NS NS NS NS NS R­Squared 0.86 0.71 0.82 0.84 0.72 0.92 0.88 0.94 0.95 0.95 Anyaoha et al. ‐ Diallel analysis of yield‐contributing traits in Okra 101 Table 2
    keywords: effects; gca; hybrids; ik11; iwo nla; ld88; nh47­4 ×; nla; nof; number; okra; plant; sca; traits; × clemson; × iwo
       cache: ahs-12574.pdf
  plain text: ahs-12574.txt

        item: #43 of 594
          id: ahs-12801
      author: Poudel, Sarita; Aryal, Pratik; Basnet, Manoj
       title: Effect of different packaging materials on shelf life and postharvest quality of tomato (Lycopersicum esculentum var. Srijana)
        date: 2022
       words: 5029
      flesch: 61
     summary: Total soluble solids (°Brix) To determine the total soluble solids, tomato fruit was squeezed and a few drops of juice were added onto the prism plate of the refractometer (ERMA INC­ JAPAN) and TSS (°Brix) was recorded. Due to low O2, high CO2, or the suitable combi­ nation of these two gases, there could be retardation of color change in tomato fruits (Kidd and West, 1930).
    keywords: color; fruits; life; loss; packaging; shelf; storage; tomato; tomatoes; weight
       cache: ahs-12801.pdf
  plain text: ahs-12801.txt

        item: #44 of 594
          id: ahs-12816
      author: Ichwan, Budiyati; Eliyanti, Eliyanti; Irianto, Irianto; Zulkarnain, Zulkarnain
       title: Combining humic acid with NPK fertilizer improved growth and yield of chili pepper in dry season
        date: 2022
       words: 4617
      flesch: 62
     summary: Humic acid/NPK pH C­organic (%) N­total (%) P (ppm) K (cmol+/kg) Water content (%) 100% HA 6.09 1.55 0.22 104.50 0.06 7.70 75% HA/25% NPK 6.02 1.45 0.29 124.80 0.19 7.56 50% HA/50% NPK 5.47 1.28 0.28 152.30 0.47 7.61 25% HA/75% NPK 5.52 1.20 0.24 144.70 0.62 7.67 100% NPK 5.32 1.22 0.23 227.30 1.07 7.50 Table 2 ­ The effect of different ratios of humic acid (HA)/NPK on soil chemical properties Ichwan et al. ‐ Humic acid and NPK fertilizers improved growth and yield of chili pepper 279 chili plants compared with mixture of humic acid/NPK during the one growth season of this research. Sci., 2022 36(4): 275­281 DOI: 10.36253/ahsc­12816 Combining humic acid with NPK fertilizer improved growth and yield of chili pepper in dry season B. Ichwan, E. Eliyanti, I. Irianto, Z. Zulkarnain (*) Department of Agroecotechnology, Faculty of Agriculture, University of Jambi, Indonesia.
    keywords: acid; application; chili; content; fertilizer; growth; humic; leaf; npk; plant; soil; yield
       cache: ahs-12816.pdf
  plain text: ahs-12816.txt

        item: #45 of 594
          id: ahs-12818
      author: Arbelet-Bonnin, Delphine; Cangémi, Sylvie; Laurenti, Patrik; Bouteau, François
       title: Observation of unexpected neo like-fruit development from Cakile maritima calli
        date: 2022
       words: 2649
      flesch: 62
     summary: These observations raise the hope to develop an in vitro model to study parthenocarpic fruit development. Even if the role of ethylene still appeared unclear (Sharif et al., 2022), ethylene responses could also lead to parthenocarpic fruit development (Pandolfini, 2009).
    keywords: ben; cakile; calli; et al; fruit; maritima; plant
       cache: ahs-12818.pdf
  plain text: ahs-12818.txt

        item: #46 of 594
          id: ahs-12934
      author: Oduntan, Adebusola; Oyetunde, Oyeboade; Shobo, Bolatito; Bodunde, Goke
       title: Effect of harvest maturity stage and ripening remediation agents on the shelf life and biochemical quality attributes of tomato (Solanum lycopersicon) fruits
        date: 2022
       words: 6183
      flesch: 59
     summary: Abstract: Tomato fruit is highly perishable because of the characteristic high rate of ethylene production and respiration during ripening. The effects of ripening remediation agents on shelf life and biochemical quality attributes were evaluated on tomato fruits harvested at three maturity stages (breaker, turning and full­ripe).
    keywords: 1­mcp; fruits; kmno4; life; ripening; shelf; shelf life; tomato
       cache: ahs-12934.pdf
  plain text: ahs-12934.txt

        item: #47 of 594
          id: ahs-12937
      author: Silva, Edgard Henrique Costa; Versuti, Jonathan ; Braz, Leila Trevisan
       title: Grafting compatibility between Okra cultivars and root-knot nematode resistant Kenaf
        date: 2022
       words: 3732
      flesch: 60
     summary: The objective was to study the compatibil­ ity of kenaf as rootstock with okra cultivars. These results confirm the compatibility with Table 2 ­ Analysis of variance and test of comparison of means of vegetative variables of okra cultivars and seedling production modali­ ties NS, **, * not significant or significant at 1 or 5% probability.
    keywords: cultivars; flower; grafting; height; kenaf; number; okra; production
       cache: ahs-12937.pdf
  plain text: ahs-12937.txt

        item: #48 of 594
          id: ahs-12938
      author: Ashour, Hossam Ahmed; Esmail, S.E.A.; El-Attar, A.B.
       title: Effect of different nitrogen forms and bio-treatments on the growth and seed yield of downy safflower (Carthamus lanatus)
        date: 2023
       words: 7295
      flesch: 63
     summary: ­ Plants, 11(22): 1­14. ­ Plants, 9(1): 22.
    keywords: 2020; ammonium; content; control; effect; et al; forms; growth; leaves; mean; nitrogen; oil; plant; sci; seeds; sulfate; vermicompost; viride; weight; yield
       cache: ahs-12938.pdf
  plain text: ahs-12938.txt

        item: #49 of 594
          id: ahs-12966
      author: Hata, Naoki; Kawamura, M.
       title: Effect of continuous lighting on the growth and leaf chemical components of Artemisia princeps grown hydroponically in a plant factory condition
        date: 2023
       words: 6732
      flesch: 56
     summary: The Hata and Kawamura ‐ Response of hydroponic Japanese mugwort to continuous lighting 181 internode shortening under fluorescent light is advantageous for producing young leaves of Japanese mugwort plants because of the low plant heights in the multi­shelf cultivation system used in plant factories. To procure young leaves in demand on a year­round basis by hydroponic production in fully artificial light­ type plant factories, we investigated whether 24­h photoperiod, known to enhance some beneficial constituents, could improve the growth and chemical constituents of Japanese mugwort plants grown hydroponically in a plant facto­ ry condition.
    keywords: acid; chlorogenic; content; cultivation; growth; hata; leaf; leaves; light; mugwort; nutrient; photoperiod; plant; polyphenol; solution; weight
       cache: ahs-12966.pdf
  plain text: ahs-12966.txt

        item: #50 of 594
          id: ahs-12981
      author: Moroșan, Ioana-Claudia; Ivănescu, Lăcrămioara Carmen; Mihășan, Marius; Olaru, Ștefan Mihăiță; Zamfirache, Maria-Magdalena
       title: Biological effects of some Colchicum autumnale L. extracts on tissue development of two varieties of Ocimum basilicum L.
        date: 2022
       words: 5369
      flesch: 55
     summary: The treatment with C. autumnale extracts did not affect biochemical and physiological indices of the photosynthetic apparatus of treated basil plantlets. Morphological observations of treated plantlets The macromorphological differences in leaves’ shape and stem development that were observed between variants of treated O. basilicum plantlets of both varieties were photographed.
    keywords: autumnale; basil; basilicum; bulb; buzău; colchicine; epicotyl; extract; fig; flower; hairs; leaf; plantlets; treatment
       cache: ahs-12981.pdf
  plain text: ahs-12981.txt

        item: #51 of 594
          id: ahs-13044
      author: Abshahi, Maliheh; Zarei , Hossein; Zahedi, Bahman; García-Morote , Francisco Antonio; Rezaei Nejad , Abdolhossein 
       title: Secondary metabolite changes in Maymars juniper cuttings (Juniperus sabina) under different treatments of propagation (IBA, substrate and harvest time of cutting)
        date: 2022
       words: 7880
      flesch: 60
     summary: Season ­ ­ ­ ­ <0.0001 Substrate x Season ­ ­ ­ ­ <0.0001 Fig. STUEPP C.A., RUFFELLATO­RIBAS K.C., MACANHÃO G., FRAGOSO R., RICKLI H.C., 2014 ­ Rooting of Juniperus chinensis var.
    keywords: acid; antioxidant; cuttings; et al; fig; iba; juniperus; plant; ppm; propagation; rooting; sabina; season; stem; substrate; treatments
       cache: ahs-13044.pdf
  plain text: ahs-13044.txt

        item: #52 of 594
          id: ahs-13045
      author: Chehade, Ali ; Chalak, Lamis; Merheb, Joe; Elbitar, Ahmad; Rmeily, Elie; Madi, Nagham; Massaad, Mark
       title: Genetic and ampelographic characterization of grapevine accessions maintained in the Lebanese national collection
        date: 2022
       words: 7794
      flesch: 56
     summary: ­ low (11) ­ medium (7) ­ high (4) Prostrate hairs on main veins on upper side Absent (40) ­ present (3) Density of prostrate hairs on petiole None or very low (38) ­ low (1) ­ medium (2) ­ high (2) Opening of petiole sinus Wide open (13) ­ open (26) ­ closed (3) ­ overlapping (1) Leaf Length Short (13) ­ medium (30) Bunch weight Very low (4) ­ low (13) ­ medium (13) ­ high (8) ­ very high (5) Bunch length Short (3) ­ medium (6) ­ long (26) ­ very long (8) Bunch width Narrow (13) ­ medium (21) ­ wide (8) ­ very wide (1)
    keywords: accessions; analysis; asouad; berry; bunch; collection; cultivars; descriptors; diversity; et al; germplasm; grapevine; issr; leaf; length; medium; souri; table
       cache: ahs-13045.pdf
  plain text: ahs-13045.txt

        item: #53 of 594
          id: ahs-13349
      author: Jamali, Babak; Amin, Hosein
       title: Comparison of 18 Iranian caprifig cultivars based on some morphological and biochemical parameters 
        date: 2022
       words: 7625
      flesch: 63
     summary: This was in agreement with previous studies on different fig cultivars (Anac et al., 1982; Aksoy et al., 1987; Askin et al., 1998; Hakerlerler et al., 1998; Bougiouklis et al., 2020). ­ Plants, 10(118): 1­24.
    keywords: abc; acid; caprifig; concentration; cultivars; et al; fig; g­1; jamali; leaf; ngm; plant; sci; weight
       cache: ahs-13349.pdf
  plain text: ahs-13349.txt

        item: #54 of 594
          id: ahs-13352
      author: Chiomento, José Luís Trevizan; Filippi, Débora ; Krasnievicz, Gustavo Mulinari ; De Paula, João Eduardo Carniel ; Fornari, Michele ; Trentin, Thomas dos Santos
       title: Arbuscular mycorrhizal fungi potentiate the root system and the quality of goldenberry fruits
        date: 2022
       words: 5946
      flesch: 57
     summary: The more fine roots there are in mycorrhizal plants, the better their acquisition of water and nutrients (Chiomento et al., 2021), as these roots are the ones that most acquire and use the available resources in the plant growth medium (Costa et al., 2019). G. intraradices had a greater ability to infect plant roots than the mycorrhizal community and R. clarus (Fig. 2A).
    keywords: amf; arbuscular; chiomento; community; cultivation; et al; fig; fruits; fungi; goldenberry; mycorrhizal; plants; production; quality; root; sci; system
       cache: ahs-13352.pdf
  plain text: ahs-13352.txt

        item: #55 of 594
          id: ahs-13499
      author: Rastgoo, Sasan; Bemani, Fatemeh; Nooryazdan, Hamidreza; Izadi , Mahmood
       title: Improving fruit set and yield of tissue cultured date palm cv. Berhi by using a combined pollination technique
        date: 2023
       words: 7929
      flesch: 62
     summary: Key words: Abnormal fruit set, metaxenia, parthenocarpic fruits, Phoenix dactylifera L., pollen source. Pollen sources affected fruit set and some seed characteristics significantly.
    keywords: bunch; date; et al; fruit; khalal; palm; pollen; pollination; seed; set; sources; tamar; treatment; weight; zahedi
       cache: ahs-13499.pdf
  plain text: ahs-13499.txt

        item: #56 of 594
          id: ahs-13558
      author: Pataraico Junior, Vicente; Fernandes Junior, Flavio; Roggia Zanuzo, Marcio; da Silva Campos, Rene Arnoux; da Silva Ponce, Franciely; de Carvalho Campos Botelho, Silvia; Vieira da Silva, Ivone; Antunes, Darley Tiago; Pereira do Nascimento, Maria Shirlyane; Seabra Junior, Santino
       title: Yield performance and nutritional quality of tomato hybrids in response to protected environments during the Amazonian summer
        date: 2024
       words: 7201
      flesch: 60
     summary: SCARANO A., OLIVIERI F., GERARDI C., LISO M., CHIESA M., CHIEPPA M., FRUSCIANTE L., BARONE A., SANTINO A., RIGANO M.M., 2020 ­ Selection of tomato landraces with high fruit yield and nutritional quality under ele‐ vated temperatures. For high tomato yields under high temperatures, thermos tolerant hybrids must be used.
    keywords: cultivation; ds0060; environment; fruit; hybrids; mean; tomato; trucker; yield
       cache: ahs-13558.pdf
  plain text: ahs-13558.txt

        item: #57 of 594
          id: ahs-13591
      author: Khakipour, Nazanin; Torkashvand, Ali Mohammadi; Ahmadi, Abbas; Weisany, Weria
       title: Prediction of chamomile essential oil yield (Matricaria chamomilla L.) by physicochemical characteristics of soil
        date: 2023
       words: 7172
      flesch: 49
     summary: This issue is important in terms of land suitability, identify areas susceptible to chamomile cultivation and planning for essential oil yields. The essential oil yield was expressed Table 1 ­ Statistics of data set for estimation of essential oil percentage and essential oil yield OM= Organic Matter; CCE= Calcium carbonate equivalent.
    keywords: chamomile; data; et al; function; growth; input; model; mohammadi; network; neural; oil yield; plant; potassium; sci; series; soil; test; torkashvand; training; variables; yield
       cache: ahs-13591.pdf
  plain text: ahs-13591.txt

        item: #58 of 594
          id: ahs-13608
      author: Cano-Reinoso, Diego Mauricio; Wibowo, Condro
       title: Impact of exogenous pre and postharvest salicylic acid applications on MD2 pineapple quality
        date: 2023
       words: 6358
      flesch: 61
     summary: Previous studies in pineapple fruit demonstrated that postharvest SA treatments (in solutions with concentrations between 5 and 9 mM), reduced the internal browning severity and translucency occur­ rence without affecting the total soluble solids (TSS) and total acidity (TA) negatively (Lu et al., 2010, 2011; Cano­Reinoso et al., 2022 b). However, despite the previous information described currently, there are no sufficient studies on pineapple fruit that document the impact of SA, especially complementing postharvest with prehar­ vest applications.
    keywords: acid; chen; content; et al; fruit; pineapple; postharvest; pre; quality; storage; treatments
       cache: ahs-13608.pdf
  plain text: ahs-13608.txt

        item: #59 of 594
          id: ahs-13616
      author: Gutiérrez, Agustina; Monzón, Paula; Micheletto, Sandra; Marinangeli, Pablo
       title: Reproductive biology of Sphaeralcea species with ornamental interest
        date: 2024
       words: 4823
      flesch: 54
     summary: The highest values were recorded at 2:00 PM for S. aus‐ tralis (99%), S. bonariensis (99%) and S. crispa (98%), with no statistically significant differences between Table 2 ­ Combinations of interspecific reciprocal and intraspe­ cific crosses that originated the hybrid and sibling off­ spring, respectively Female parent (♀) x Male parent (♂) Interspecific reciprocal crosses S. australis S. crispa S. australis S. mendocina S. australis S. bonariensis S. bonariensis S. crispa S. bonariensis S. australis S. bonariensis S. mendocina S. crispa S. australis S. crispa S. mendocina S. crispa S. bonariensis S. mendocina S. crispa S. mendocina S. australis S. mendocina S. bonariensis Intraspecific crosses S. australis S. australis S. bonariensis S. bonariensis S. crispa S. crispa S. mendocina S. mendocina Gutiérrez et al. ‐ Reproductive biology of Sphaeralcea species 349 them, and at 4:00 PM for S. mendocina (99%). The objective of this work was to know the viability of pollen, stigma receptivity, type of pollination and combining ability of four Sphaeralcea species (S. australis, S. bonariensis, S. crispa and S. mendocina), with the aim to develop new ornamental varieties.
    keywords: crosses; flowers; pollen; receptivity; s. australis; s. bonariensis; s. crispa; s. mendocina; species; sphaeralcea; stigma; viability
       cache: ahs-13616.pdf
  plain text: ahs-13616.txt

        item: #60 of 594
          id: ahs-13659
      author: Yuri, José Antonio; Palma, Miguel; Sepúlveda, Álvaro; Sánchez-Contreras, Javier; Moya, Mariana
       title: Use of the biostimulant Retard Cherry® as a strategy to delay blooming period in sweet cherry trees
        date: 2024
       words: 3834
      flesch: 69
     summary: Sci., 2023 37(4): 427­432 DOI: 10.36253/ahsc­13659 Use of the biostimulant Retard Cherry® as a strategy to delay blooming period in sweet cherry trees J.A. Sweet cherry trees cv.
    keywords: bloom; cherry; delay; fruit; regina; retard; set; sweetheart; trees
       cache: ahs-13659.pdf
  plain text: ahs-13659.txt

        item: #61 of 594
          id: ahs-13749
      author: Soleimani, Asghar; Rabiei, Vali; Hassani, Darab; Mozaffari, Mohammad Reza; Dastjerdi, Raana
       title: Yield related traits in some Persian walnut cultivars: Analysis of genetic and genetic by environment interaction
        date: 2024
       words: 5447
      flesch: 56
     summary: 2 ­ Mean comparisons of the effect of the cultivar and year × cultivar on fruit weight (a), kernel percent (b), fruit set (c), number of fruits on SCA (d), fruit weight on scaffold cross area (SCA) (e), and kernel weight on SCA (f) using Duncan multiple range test for genotypes and Least Significant Difference (LSD) test for interaction of year × cultivar. ARJI I., 2018 ­ Stability analysis of fruit yield of some olive cultivars in semi‐arid environmental condition.
    keywords: cultivars; fruit; kernel; nut; sca; set; traits; walnut; weight; yield
       cache: ahs-13749.pdf
  plain text: ahs-13749.txt

        item: #62 of 594
          id: ahs-13753
      author: Abou Dahab, T.A.M.; Ashour, Hossam Ahmed; Saber, M.M.H.
       title: Exogenous application of biostimulators alleviates water deficient stress on Azadirachta indica plants
        date: 2022
       words: 8459
      flesch: 62
     summary: As shown from data listed in Table 5 irrigation intervals, bio­stimulators treatment and interaction effects had significant influence on pigments content (chlorophyll a, b, carotenoids and Table 3 ­ Plant height, fresh and dry weight of shoots and fresh and dry weight of roots of Azadirachta indica as affected by the interac­ tions between irrigation intervals and bio­stimulators treatments (mean of two seasons) CHT (1) = chitosan at 50 ppm, CHT (2) = chitosan at 100 ppm, CHT (3) = chitosan 200 ppm, BRs (1) Mean of the three pots repre­ senting the field capacity was found to be 1350 g, equivalent to 1350 cm3 of water/pot (1.35 L /pot) (Abd­Elmoneim et al., 2018).
    keywords: application; bio­stimulators; brassinolide; brs; chitosan; cht; content; control; data; days; drought; effect; et al; growth; intervals; irrigation; level; plants; ppm; proline; sci; stress; treatments; water
       cache: ahs-13753.pdf
  plain text: ahs-13753.txt

        item: #63 of 594
          id: ahs-13824
      author: Gales, Oliver; Jones, Joanna ; Swarts, Nigel
       title: An analysis on the impacts of cryogenic freezing on raspberry quality
        date: 2022
       words: 6039
      flesch: 54
     summary: González et al. (2002) found that berry variety, harvest timing and quality at har­ vest are critical factors influencing the impact freez­ ing has on raspberry fruit quality. 3 ­ TSS (%) (a), pH (b), Titratable acidity (c) and Hue (d) for both the conventional (grey bars) and cryogenic (black bars) methods of freezing raspberries.
    keywords: acidity; et al; fig; food; freezing; frozen; fruit; hue; quality; raspberries; raspberry; storage; tss; variety
       cache: ahs-13824.pdf
  plain text: ahs-13824.txt

        item: #64 of 594
          id: ahs-13827
      author: Bondarenko, Pavlo; Alekseeva, Olha; Senin, Volodymyr; Kondratenko, Petro
       title: Pruning terms and techniques affect vigour and flower formation of Ukrainian sweet cherry cultivars
        date: 2023
       words: 6292
      flesch: 65
     summary: Abstract: Excessive tree vigour and late entrance into full production, inherent to sweet cherry trees, are major challenges in the intensive cultivation of this crop. Different agronomic techniques can be used in order to reduce the vigour of sweet cherry trees.
    keywords: cherry; cultivars; krupnoplidna; length; number; pruning; severity; shoots; trees; ukraine; vigour
       cache: ahs-13827.pdf
  plain text: ahs-13827.txt

        item: #65 of 594
          id: ahs-13838
      author: Cefola, Maria; Capotorto, Imperatrice; Lippolis, Vincenzo ; Cervellieri, Salvatore; Damascelli, Anna; Cozzolino, Rosaria; De Giulio, Beatrice; Pace, Bernardo
       title: CO2 modified atmosphere packaging: stress condition or treatment to preserve fruit and vegetable quality? 
        date: 2023
       words: 4565
      flesch: 61
     summary: In each trial, the effect of high CO2 treatment on quali­ ty parameters was observed during cold storage. On the contrary the use of high CO2 concentrations (>20 kPa) in the MA mixture (1 kPa­O2 + 20 kPa­CO2) increased the value of RR resulting more than a 2­fold higher than Fresh sam­ ple.
    keywords: co2; grapes; kpa; kpa­co2; kpa­o2; quality; respiration; storage; table; treatment
       cache: ahs-13838.pdf
  plain text: ahs-13838.txt

        item: #66 of 594
          id: ahs-13849
      author: Silveira Gomez, Ana Cecilia; Rivera Marchant, Luis; Escalona Contreras, Victor Hugo
       title: The Response of hydroponic baby lettuce to UV-B radiation exposure during the growing period
        date: 2023
       words: 7220
      flesch: 63
     summary: Nevertheless, UV­B radiation doses applied to each cv. UV­C radiation and much of UV­B radiation (wavelengths less than 290 nm) do not reach the earth.
    keywords: differences; et al; fig; harvest; kristine; kristine rz; leaf; lettuce; plant; radiation; second; uv­b; values; versaï
       cache: ahs-13849.pdf
  plain text: ahs-13849.txt

        item: #67 of 594
          id: ahs-13850
      author: Cirillo, Aurora; Magri, Anna; Petriccione, Milena; Di Vaio, Claudio
       title: Effects of cold storage on quality parameters and nutraceutical compounds of pomegranate fruits (cv. Acco)
        date: 2023
       words: 6138
      flesch: 61
     summary: According to a similar study on ‘Mollar’ pomegranate after only 7 days of storage at 4°C, the TSS content is reduced about 11% (Gil et al., 1996), while Artes et al. (2000 b) showed a significant reduction in the acidity of pomegranate fruit juice in cv. Sci., 2023 37(1): 15­23 DOI: 10.36253/ahsc­13850 Effects of cold storage on quality para­ meters and nutraceutical compounds of pomegranate fruits (cv. Acco) A. Cirillo 1 (*), A. Magri 2, 3, M. Petriccione 2, C. Di Vaio 1 1 Department of Agricultural Sciences, University of Naples Federico II, Via Università, 100, 80055 Portici (NA), Italy.
    keywords: cold; content; days; et al; fruit; harvest; juice; pomegranate; quality; sci; storage
       cache: ahs-13850.pdf
  plain text: ahs-13850.txt

        item: #68 of 594
          id: ahs-13856
      author: Corvino, Antonia; Romaniello, Roberto; Palumbo, Michela; Ricci, Ilde; Cefola, Maria; Pelosi, Sergio; Pace, Bernardo
       title: Image analysis to predict the maturity index of strawberries
        date: 2023
       words: 2736
      flesch: 53
     summary: Image analysis (IA) has proven to be a successful contactless tool in fruit and vegetables quality assessment. Corvino et al. ‐ Image analysis for ripeness evaluation of strawberry 85 with 24 known colour stains was placed in the cam­ era’s FOV as a chromatic reference.
    keywords: analysis; class; colour; fruit; harvest; image; maturity; red; strawberries
       cache: ahs-13856.pdf
  plain text: ahs-13856.txt

        item: #69 of 594
          id: ahs-13857
      author: Marchioni, Ilaria; Najar, Basma; Copetta, Andrea; Ferri, Benedetta; Ruffoni, Barbara; Pistelli, Luisa; Pistelli, Laura
       title: Phytonutritional and aromatic profiles of Tulbaghia simmleri Beauv. edible flowers during cold storage
        date: 2023
       words: 5623
      flesch: 63
     summary: Fresh flowers Marchioni et al. ‐ Changes of T. simmleri edible flowers during cold storage 27 were considered as control (T0). Marchioni et al. ‐ Changes of T. simmleri edible flowers during cold storage 29 ously observed also in other EFs stored at low tem­ perature, but the regulatory mechanisms in flowers are still under debate (Shvarts et al., 1997; Landi et al., 2015; Marchioni et al., 2020 b).
    keywords: activity; compounds; days; et al; flowers; food; sci; simmleri; storage; tulbaghia
       cache: ahs-13857.pdf
  plain text: ahs-13857.txt

        item: #70 of 594
          id: ahs-13870
      author: Battisti, Luca; Caldera, Fabrizio; Hoti, Gjylije; Trotta, Francesco; Devecchi, Marco
       title: Nanosponges and CPPU for shelf-life prolongation of cut carnations
        date: 2023
       words: 3233
      flesch: 54
     summary: Materials and Methods In the coming sections, the following will be reported: a scoping review on the use of nanosponges in floriculture; a first trial of the use of CPPU and nanosponges on cut flower carnation. SEGLIE L., MARTINA K., DEVECCHI M., ROGGERO C., TROT­ TA F., SCARIOT V., 2011 b ­ β‐Cyclodextrin‐based nanosponges as carriers for 1‐MCP in extending the postharvest longevity of carnation cut flowers: an eval‐ uation of different degrees of cross‐linking.
    keywords: 1­mcp; cdnss; cppu; cut; flowers; nanosponges
       cache: ahs-13870.pdf
  plain text: ahs-13870.txt

        item: #71 of 594
          id: ahs-13872
      author: Guccione, Eugenia; Allegra, Alessio; Farina, Vittorio; Inglese, Paolo; Sortino, Giuseppe
       title: Use of xanthan gum and calcium ascorbate to prolong cv. Butirra pear slices shelf life during storage
        date: 2023
       words: 4373
      flesch: 65
     summary: Butirra fruit slices at 0 time and after for 3, 5, 7, 10 days of storage at 5°C At each sampling date, different letters indicate significative differences between treatments. Butirra fruit slices at 0 time and after for 3, 5, 7, 10 days of storage at 5°C.
    keywords: asc; butirra; content; ctr; day; fruit; gum; pear; slices; storage; treatments; xanthan
       cache: ahs-13872.pdf
  plain text: ahs-13872.txt

        item: #72 of 594
          id: ahs-13895
      author: Dalleh, Maya; Borjac, Jamilah; Younes, Ghassan; Choueiri, Elia; Chehade, Ali; Elbitar, Ahmad
       title: In vitro propagation and microtuberization of potato (Solanum tuberosum L.) Spunta variety in Lebanon
        date: 2023
       words: 7357
      flesch: 60
     summary: The induction and develop‐ ment of potato microtubers in vitro on media free of growth regulating substances. ‐ Annals Bot., 63(6): 663­ 674. B., AYYOUBI Z., JAWDAT D., 2000 ­ The effect of gamma irradiation on potato microtuber production in vitro.
    keywords: 25±2; average; bap; culture; days; effect; growth; medium; mg.l­1; microtubers; night; number; plant; potato; sucrose
       cache: ahs-13895.pdf
  plain text: ahs-13895.txt

        item: #73 of 594
          id: ahs-13899
      author: Amodio, Marialuisa; Attolico, Giovanni; Bonelli, Lucia; Cefola, Maria; Fazayeli, Hassan; Montesano, Francesco; Pace, Bernardo; Palumbo, Michela; Serio, Francesco; Stasi, Antonio; Colelli, Giancarlo
       title: Sustaining low-impact practices in horticulture through non-destructive approach to provide more information on fresh produce history and quality: the SUS&LOW project
        date: 2023
       words: 6983
      flesch: 49
     summary: Abstract: The general aim of the project SUS&LOW is to increase the sustainabil­ ity of fresh produce by testing and implementing low­input agricultural practices (LIP) with positive impact on product quality with the support of non­destructive (ND) tools for real­time quality assessment and for product discrimination. The general aim of the project is to increase the amount of sustainably­produced food by testing and implementing low­input agricultural practices with positive impact on product quality with the support of non­destructive tools for real­time quality assess­ ment and product discrimination, which may inspire new marketing strategies to better support the added value of the products and increase incomes of potential users.
    keywords: amodio; cultivation; cvs; et al; food; leaves; pace; products; project; quality; rocket; soilless; use; water
       cache: ahs-13899.pdf
  plain text: ahs-13899.txt

        item: #74 of 594
          id: ahs-13902
      author: Bonora, Alessandro; Venturoli, Anna; Venturi, Melissa; Boini, Alexandra; Corelli Grappadelli, Luca
       title: Fruit maturity and antioxidant activity affecting superficial scald development in ‘Abate Fétel’ pears
        date: 2023
       words: 7471
      flesch: 59
     summary: Res., 25: 587­592. WHITAKER B., 2004 ­ Oxidative stress and superficial scald of apple fruit. Bonora et al. ‐ Maturity and antioxidants affecting ‘Abate Fétel’ storage 7 before decreasing notably again.
    keywords: antioxidant; apple; content; development; et al; fig; fruit; fétel; harvest; index; maturity; months; pears; postharvest; quality; scald; sci; storage
       cache: ahs-13902.pdf
  plain text: ahs-13902.txt

        item: #75 of 594
          id: ahs-13908
      author: de Chiara, Maria Lucia Valeria; De Simone, Nicola; Spano, Giuseppe; Amodio, Maria Luisa; Colelli, Giancarlo 
       title: Effect of microwave mild heat treatment on postharvest quality of table grapes
        date: 2023
       words: 4916
      flesch: 55
     summary: Hortic., 232: 175­183. SISQUELLA M., VIÑAS I., TEIXIDÓ N., PICOUET P., USALL J., 2013 ­ Continuous microwave treatment to control postharvest brown rot in stone fruit. To date, a small number of studies deals with the use of microwave treatment on fresh produce (Karabulut and Baykal, 2002; Zhang et al., 2004, 2006; Sisquella et al., 2013), showing its efficiency in prolonging postharvest life of peaches, in which microwave inhibited growth of inoculated pathogens after 2 minutes, being also effective in controlling endoge­ nous microflora with a very low decay incidence.
    keywords: appearance; food; grape; microwave; packaging; product; quality; samples; sci; storage; table; temperature; time; treatment
       cache: ahs-13908.pdf
  plain text: ahs-13908.txt

        item: #76 of 594
          id: ahs-13910
      author: Allegra, Maria; Ferlito, Filippo; Torrisi, Biagio; Trovato, Sara; Cicciarello, Giuseppe; Strano, Maria Concetta
       title: Quality of cold stored lemon fruit from orchards consociated to ancient olive trees
        date: 2023
       words: 4512
      flesch: 53
     summary: The extension of the availability to market of high quality fruit, in a period of shortage such as the summer season, would allow to obtain the maximum economic profit for the growers. Key words: Agroecology, agroforestry, cold storage, consociation, lemon fruit, postharvest quality.
    keywords: cold; fig; fruits; irrigation; lemon; management; olive; peel; quality; storage
       cache: ahs-13910.pdf
  plain text: ahs-13910.txt

        item: #77 of 594
          id: ahs-13911
      author: Benalia, Souraya; Calogero, Vittorio; Anello, Matteo; Zimbalatti, Giuseppe; Bernardi, Bruno
       title: Application of computer vision systems for assessing bergamot fruit external features
        date: 2023
       words: 2763
      flesch: 48
     summary: Bergamot fruit RGB images were taken using a laboratory inspection chamber equipped with a lighting system and a digital camera Nikon D5200 directly connected to a personal computer, to enable remote image acquisition. Several studies dealt with the use of computer vision systems for cit­ rus fruit quality assessment or grading (Cubero et al., 2014; Lorente et al., 2015; Zhang et al., 2020; Riccioli et al., 2021; Zhang et al., 2022), but up to now, no one regarded bergamot fruits.
    keywords: analysis; bergamot; cci; citrus; colour; computer; fruit; image
       cache: ahs-13911.pdf
  plain text: ahs-13911.txt

        item: #78 of 594
          id: ahs-13913
      author: AYDI BEN ABDALLAH, Rania; Chikh-Rouhou, Hela; Jabnoun-Khiareddine, Hayfa; Daami-Remadi, Mejda
       title: Pumpkins (Cucurbita spp.) diversity and their associated microbiota
        date: 2024
       words: 7639
      flesch: 58
     summary: Soil microbial communities play key roles in plant development and health (Philippot et al., 2013; Adam et al., 2018). LARKIN R.P., HONEYCUTT C.W., 2006 ­ Effect of different 3‐ year cropping systems on soil microbial communities and Rhizoctonia diseases of potato.
    keywords: accessions; c. maxima; community; cucurbita; dpp; et al; fruit; growth; maxima; plant; pumpkins; rhizosphere; sampling; soil; spp; times; trichoderma; weight; yield
       cache: ahs-13913.pdf
  plain text: ahs-13913.txt

        item: #79 of 594
          id: ahs-13919
      author: Al-Hassanavi, H.R.; Rostami Tobnag, Ghader; Shokri, R.
       title: Application of essential oils and optimizing storage conditions for control of postharvest diseases in apple
        date: 2023
       words: 5503
      flesch: 57
     summary: Table 2 ­ Multiple linear regression of PBD data for postharvest controlling of apple decay caused by Penicillium expansum using three independent sources including basil essential oil, peppermint essential oils, and storage conditions Model B­coefficient t­value p­value Confidence (%) A B C A B C A B C A B C Intercept 53.642 48.155 46.49 8.642 9.392 9.962 1.32E­04* 5.4E­06* 4.8­01* 99.99* 99.99* 99.9* X1 30.458 24.971 23.306 4.542 5.292 5.862 0.175001 0.80123 0.16471 ­ ­ ­ X2 ­10.254 ­11.741 ­7.406 ­1.254 ­0.504 0.066 0.163501 0.17999 0.29019 ­ ­ ­ X3 ­12.429 ­8.916 ­6.581 ­1.429 ­0.679 ­0.109 0.192001 0.14872 0.41567 ­ ­ ­ X4 ­5.398 ­6.885 ­8.55 4.398 5.148 5.718 0.180501 0.29746 0.54115 ­ ­ ­ X5 34.783 29.296 27.631 1.217 1.967 2.537 0.0194* 0.0362* 0.0402* 98.06* 96.38* 95.98* X6 20.854 15.367 13.702 2.146 2.896 3.466 0.0249* 0.0102* 0.0313* 97.51* 98.98* 96.87* X7 15.16 9.673 8.008 2.84 3.59 4.16 0.0342* 0.0199* 0.0146* 96.58* 98.01* 98.54* X8 18.243 12.756 11.091 6.757 7.507 8.077 0.0322* 0.0168* 0.0497* 96.78* 98.32* 95.03* Al‐Hassanavi et al. ‐ Essential oils to control postharvest diseases 153 mint), we analyzed the rate of the ethylene produc­ tion for 56 days. Many other studies have showed that essential oils are promising to control posthar­ vest decay in fruit and vegetables, however, the question of this study is to (1) find the best concen­ tration in which essential oil could act, and (2) to determine the best environmental conditions of the storage place in which essential oils applied.
    keywords: apple; basil; conditions; control; decay; effect; ethylene; fruits; oils; peppermint; postharvest; production; storage; study; treatment
       cache: ahs-13919.pdf
  plain text: ahs-13919.txt

        item: #80 of 594
          id: ahs-13943
      author: Vanoli, Maristella; Cortellino, Giovanna; Picchi, Valentina; Buccheri, Marina; Grassi, Maurizio; Lovati, Fabio; Marinoni, Laura; Levoni, Pietro; Torricelli, Alessandro; Spinelli, Lorenzo
       title: Non-destructive determination of ripening in melon fruit using time-resolved spectroscopy
        date: 2023
       words: 4963
      flesch: 59
     summary: Sci., 2023 37(1): 75­82 DOI: 10.36253/ahsc­13943 Non­destructive determination of ripening in melon fruit using time­resolved spectroscopy M. Vanoli 1 (*), G. Cortellino 1, V. Picchi 1, M. Buccheri 1, M. Grassi 1, F. Lovati 1, L. Marinoni 1, P. Levoni 2, A. Torricelli 2, 3, L. Spinelli 3 1 Consiglio per la Ricerca in Agricoltura e l’Analisi dell’Economia Agraria, Centro di Ricerca Ingegneria e Trasformazioni Agroalimentari (CREA‐ IT), Via G. Venezian, 26, 20123 Milano, Italy. 2 Politecnico di Milano, Dipartimento di Fisica, Piazza Leonardo da Vinci, 32, 20133 Milano, Italy. GÓMEZ­GARCÍA R., CAMPOS D.A., AGUILAR C.N., MADUREIRA A.R., PINTADO M., 2020 ­ Valorization of melon fruit (Cucumis melo L.) by‐products: Phytochemical and biofunctional properties with emphasis on recent trends and advances.
    keywords: carotenoid; color; content; et al; ethylene; firmness; fruit; juiciness; melons; peel; pulp; trs
       cache: ahs-13943.pdf
  plain text: ahs-13943.txt

        item: #81 of 594
          id: ahs-13944
      author: Dinega, T.M.; Haile, A.; Beshir, Hussien Mohammed
       title: Improving onion productivity and producer income through nitrogen management
        date: 2023
       words: 8226
      flesch: 66
     summary: The frequency of N application affects the produc­ tivity of onions (Grant et al., 2012). Increased leaf length at three times N applications could be due to increased recovery of N by onions and decreased N loss (Ali and Ceyhan, 2001).
    keywords: application; bulb; bulb yield; dry; et al; growth; ha­1; ha­1 n; kg ha­1; nitrogen; onion; rate; times; total; weight; yield
       cache: ahs-13944.pdf
  plain text: ahs-13944.txt

        item: #82 of 594
          id: ahs-13998
      author: Castellani, Maria; Bonetti, Daniele; Antonetti, Maurizio; Prisa, Domenico; Burchi, Gianluca; Nin, Stefania
       title: Treated sediment as substrate component of three containerized ornamental species: effects on marketable and qualitative traits
        date: 2023
       words: 5253
      flesch: 60
     summary: Eng., 81: 146­157. FASCELLA G., 2015 ­ Growing substrates alternative to peat for ornamental plants, pp. 5% of the entire national agricultural production, which derives for about 75% from potted plants and nurseries (trees and shrubs) and for the remainder from fresh cut flowers and foliages (Martorana, 2021).
    keywords: calla; flowers; growing; lmix; media; ornamental; plant; pmix; protea; sediment; species; water
       cache: ahs-13998.pdf
  plain text: ahs-13998.txt

        item: #83 of 594
          id: ahs-14018
      author: Souza, Aline das Graças; Smiderle, Oscar José
       title: Container volume and doses of maximum technical efficiency of controlled-release fertilizer on the morphological quality of Cordia alliodora seedlings in Roraima
        date: 2023
       words: 4214
      flesch: 51
     summary: Abstract The objective of this study was to determine the correlation between the morphological characteristics of Cordia alliodora seedlings produced as a function of container volume and controlled­release fertilizer (CRF) doses under nursery conditions in Northern Amazon. In turn, the 1.8 L container led to the largest stem diameter (3.95 mm) of Cordia alliodora seedlings at the DMTE of 5.38 g L­1 of CRF (Fig. 1B).
    keywords: alliodora; container; cordia; crf; doses; fertilizer; l­1; seedlings; smiderle; volume
       cache: ahs-14018.pdf
  plain text: ahs-14018.txt

        item: #84 of 594
          id: ahs-14019
      author: Prakash, Reema; Jokhan, Anjeela; Gopalan, Romila; Singh, Ranjila; Prasad, Abhineshwar
       title: Physiological performance and fruit quality of noni (Morinda citrifolia L.) cultivated in different agro-climatic zones of Fiji
        date: 2024
       words: 7948
      flesch: 62
     summary: ­ Plants (Basel), 10: 118. ­ Fruits, 70: 325­332. MAHANTESH P.S., HIREMATH J.S., LOKESH C.H., RAVI Y., SAMEER HUSSAIN M.D., POOJA M.R., 2018 ­ Noni a wonder plant (therapeutic properties): a review.
    keywords: antioxidant; content; cultivation; fruit; growth; mean; noni; plants; properties; rainfall; sci; soil; stress; table; temperature; total; water; wet; zone
       cache: ahs-14019.pdf
  plain text: ahs-14019.txt

        item: #85 of 594
          id: ahs-14098
      author: Barakat, Hafsa; Draie, Rida
       title: Evaluation of viability and germination of pollen grains of three local caprifig cultivars and their effect on some characteristics of fig fruits (Ficus carica L.)
        date: 2024
       words: 7105
      flesch: 60
     summary: Fig pollen is carried by the fig wasp (Blastophaga psenes L.) that develops with the fig tree (Kjellberg et al., 1987). The measurements were taken after 24 h, 48 h, and 72 h. These three pollinators were used to pollinate three varieties of edible figs (white Satehi, Safrawi, and Habashi) to study the effect of pollen source on the productive characteristics of edible fig fruits.
    keywords: azraq; bunduqi; caprifig; cultivar; fig; fruit; germination; media; medium; panjani; percentage; pollen
       cache: ahs-14098.pdf
  plain text: ahs-14098.txt

        item: #86 of 594
          id: ahs-14103
      author: Buglia , Luca
       title: Sanitization system in Horticultural Sector
        date: 2023
       words: 3826
      flesch: 63
     summary: First test done in cold room containing radish (Cicorium intybus) using a Ionny 400; Second test done in cold room containing table grape (Vitis vinifera, cv. Italia) with Ionny 400; Third test done in a cold warehouse (CE.DI.OR, Zelo Buon Persico, Lodi, Italy). Inside this cold ware­ house three different areas were tested (cold rooms, processing, and shipping rooms) using ionizers mod DUCT as compared to control (without ionizer).
    keywords: air; et al; food; ionny; plasma; room; storage; test; use
       cache: ahs-14103.pdf
  plain text: ahs-14103.txt

        item: #87 of 594
          id: ahs-14148
      author: Asadi Zargh Abad, Mehri; Shekafandeh, Akhtar
       title: In vitro salt stress tolerance of ‘Sahand’ cultivar grafted on two wild almond rootstocks: An evaluation of physiological and biochemical traits between rootstocks
        date: 2024
       words: 8568
      flesch: 62
     summary: ­ Plants, 9: 1783. J. Bot., 105: 306­312. VIVES­PERISV., GÓMEZ­CADENAS A., PÉREZ­CLEMENTE R.M., 2017 ­ Citrus plants exude proline and phytohor‐ mones under abiotic stress conditions.
    keywords: activity; almond; arjan; badamkohi; combination; et al; grafting; growth; nacl; plant; rootstock; sahand; sahand’/arjan; salinity; salt; scion; shoot; stress; tolerance; water
       cache: ahs-14148.pdf
  plain text: ahs-14148.txt

        item: #88 of 594
          id: ahs-14158
      author: Muhie, Seid Hussen; Yimer, Hussen Seid
       title: Growth and yield performance of carrot (Daucus carota L.) as influenced by plant population density under irrigation condition
        date: 2023
       words: 6093
      flesch: 65
     summary: In general, carrot plants grown with a narrower row distance tended to mature faster than those grown with wider spacing. The fastest time to reach maturity for carrot plants (73.3 days) was observed with a spacing of 10 x 5 cm, while the slowest time (134.3 days) was observed with a spacing of 20 x 15 cm, followed by a spacing of 20 x 10 cm (121.3 days) (Table 1).
    keywords: carrot; density; distance; et al; growth; leaf; plant; root; row; spacing; yield
       cache: ahs-14158.pdf
  plain text: ahs-14158.txt

        item: #89 of 594
          id: ahs-14173
      author: Teodoro, Adenir; Lemos de Carvalho, Hélio Wilson; de Barros, Inácio; Marques de Carvalho, Luciana; Girardi, Eduardo Augusto; Sampaio Passos, Orlando; dos Santos Soares Filho, Walter
       title: Superior sweet oranges for varietal diversification of tropical rainfed orchards: Superior sweet oranges 
        date: 2023
       words: 4982
      flesch: 61
     summary: ‘Kona’ trees excelled in yield performance associated with bulk canopy, precocity, sweet fruit with intermediate acidity, and high vitamin C contents in spite of proneness to alternate yields and low ratio (maturity index). ‘Valencia Montemorelos’ and ‘Rubi’ trees, in turn, had high yield perfor­ mances coupled with intermediate canopies, sweet fruit, intermediate acidity (‘Rubi’) and vitamin C contents, low propensity for yield fluctuation (‘Valencia Montemorelos’), and high precocity (‘Rubi’), albeit low ratio.
    keywords: brazil; carvalho; fruit; lima; orange; pera; ratio; rubi; valencia; yield
       cache: ahs-14173.pdf
  plain text: ahs-14173.txt

        item: #90 of 594
          id: ahs-14180
      author: Salamé, Elige; Brizzolara, Stefano; Rodriguez, Marta; Iob, Matteo; Tonutti, Pietro; Ruperti, Benedetto
       title: Ethanol fermentation- and ethylene physiology-related gene expression profiles in Red Delicious apples stored under variable hypoxic conditions and protocols
        date: 2023
       words: 6635
      flesch: 54
     summary: The imposed extreme hypoxic conditions induce selective responses of apple tissues starting from the modulation of gene expression involved in particular in primary metabolism and hormone (mainly ethylene) physiology (Cukrov et al., 2019). Statistical analysis For gene expression, data analysis was performed on six replicates (3 biological x 2 technical replicates).
    keywords: 0.8ox; apples; atmosphere; dia; ethanol; ethylene; expression; fruit; gene; levels; oxygen; red; samples; sh2; storage; time
       cache: ahs-14180.pdf
  plain text: ahs-14180.txt

        item: #91 of 594
          id: ahs-14247
      author: Sarhan, Atef M.Z.; Heikal, Amaal A.M.; Saadawy, Faisal M.; Noor El-Deen, Tarek M. ; Abd Elkareem, Marie Kawther
       title: Effect of some chemical and natural preservative solutions on vase life, water relations and some chemical composition of Dianthus caryophyllus L. cut flowers
        date: 2023
       words: 9755
      flesch: 68
     summary: This approach can help enhance the antimicrobial efficacy and ove­ rall performance of natural extracts as preservatives in cut flower solutions. Comparing to the control treatment (DW), it was evident that all combined treatments involving both pulsing and holding solutions led to a substantial improvement in the vase life of cut carnation flowers.
    keywords: 8­hqs; acid; aoa; boric; carnation; cut; effect; flowers; ppm; pulsing; solutions; sucrose; vase; water
       cache: ahs-14247.pdf
  plain text: ahs-14247.txt

        item: #92 of 594
          id: ahs-14258
      author: Ghiselli, Lisetta; Bonetti, Daniele; Prisa, Domenico; Nin, Stefania; Burchi, Gianluca
       title: Application of antiperspirants to improve the condition of ornamental plants subject to medium- and long-distance transport in refrigerated container
        date: 2023
       words: 5079
      flesch: 55
     summary: The use of biodegradable film was inadequate to protect plant quality during long­distance shipments. Only MDA was significant­ ly affected by plant treatment with antiperspirants.
    keywords: antiperspirants; control; fig; leaves; mda; plants; privet; species; storage; transport; weeks
       cache: ahs-14258.pdf
  plain text: ahs-14258.txt

        item: #93 of 594
          id: ahs-14261
      author: Etefa, Obse Fikiru; Forsido, Sirawdink Fikreyesus; Tola, Yetenayet B.
       title: Inhibition of bleaching of stored red hot pepper through appropriate postharvest technologies and practices
        date: 2024
       words: 10102
      flesch: 57
     summary: ARIMBOOR R., NATARAJAN R.B., MENON K.R., CHAN­ DRASEKHAR L.P., AMOORKOTH V., 2015 ­ Red pepper (Capsicum annuum) carotenoids as a source of natural food colors: analysis and stability ‐ a review. The studies also revealed that the maturity stage has a significant impact on red pepper colour, with Candida red paprika having higher total carotenoids, b*, and L* values than Candida yellow paprika (Kim et al., 2015).
    keywords: activity; annuum; blanching; capsicum; carotenoids; chilli; colour; content; drying; effect; et al; food; j. food; loss; materials; methods; months; packaging; pepper; pepper colour; powder; quality; red; sci; storage; technol; temperature; water
       cache: ahs-14261.pdf
  plain text: ahs-14261.txt

        item: #94 of 594
          id: ahs-14381
      author: Al-Madhagi, Isam
       title: The habit of strawberry flowering is the key for runner propagation, where the photoperiod is the main environmental factor - A review
        date: 2024
       words: 12189
      flesch: 63
     summary: Within this context, the primary goal of this paper is to present an overview of the factors that influence strawberry runner yield. Discussion and Conclusions The formation of strawberry runners was influ­ enced by the interaction of genetic (cultivars), envi­ ronmental (photoperiod, temperature, chilling hours or cold storage), and internal (hormones and carbo­ hydrate) factors.
    keywords: chilling; cultivars; development; effect; et al; everbearing; flowering; fragaria; ga3; growth; hortic; number; photoperiod; plants; production; runner; sci; storage; strawberries; strawberry; strawberry cultivars; temperature
       cache: ahs-14381.pdf
  plain text: ahs-14381.txt

        item: #95 of 594
          id: ahs-14410
      author: Muhie, Seid Hussen; Worku, Solomon; Masrie, Biruk
       title: Shelf-life and post-harvest quality of tomato (Lycopesicon esculentum Mill.) varieties to different packaging materials at Mersa, North Wollo, Ethiopia
        date: 2024
       words: 7823
      flesch: 63
     summary: With this context in mind, the goal of this study was to evaluate the impact of packaging material on the quality and shelf life of tomato fruit varieties after harvest. At the end of storage, NPPB with Roma VF and Woyno varieties had a substantially (100%) larger decay loss of tomato fruits.
    keywords: c c; fruits; life; loss; materials; packaging; polyethylene; quality; red; roma; storage; tomato; varieties; variety; weight
       cache: ahs-14410.pdf
  plain text: ahs-14410.txt

        item: #96 of 594
          id: ahs-14544
      author: Benjelloun, Jalila; Bouzroud, Sarah; Zaid, Younes; Guedira, Abdelkarim; Smouni, Abdelaziz
       title: Warm stratification combined with organic manure application enhances seed germination and improves Cycas revoluta growth and development
        date: 2024
       words: 9056
      flesch: 59
     summary: ­ Plants, 11(23): 3354. BEWLEY J.D., BLACK M., 2013 ­ Seeds: physiology of devel‐ opment and germination.
    keywords: activity; chlorophyll; cycas; development; effect; embryos; et al; germination; growth; horse; length; manure; nitrogen; plant; presence; revoluta; root; sci; seed; sheep; soil
       cache: ahs-14544.pdf
  plain text: ahs-14544.txt

        item: #97 of 594
          id: ahs-14582
      author: KABIRI, GHIZLANE; Hernandez, Francisca; LACHKHAM, Fatima Zahra; HANINE, Hafida
       title: Inter-annual and genotypic variation of morphological and physicochemical characters in moroccan loquat (Eriobotrya Japonica Lindl.)
        date: 2024
       words: 4160
      flesch: 58
     summary: ­ Fruits, 61(1): 407­418. METEOBLEU, 2024 ­ Changement climatique Berkane. Regarding the effects of Source of variation ddl Mean square F­Value Pr>F Fruit Fruit weight Genotype 34 1746.70 22.03 <.0001 Year 1 512.50 6.47 0.0112 Genotype × year 34 472.97 5.97 <.0001 Error 630 79.27 Geometric diameter of the fruit Genotype 34 495.17 2 0.0008 Year 1 84.38 0.34 0.5593 Genotype × year 34 308.47 1.25 0.1608 Error 630 247.26 Sphericity index of the fruit Genotype 34 0.06 17.09 <.0001 Year 1 0.0006 0.17 0.6763 Genotype × year 34 0.01 3.09 <.0001 Error 630 0.003 Fruit surface Genotype 34 1573.73 24.28 <.0001 Year 1 218.49 3.73 0.0668 Genotype × year 34 13125.09 5.96 <.0001 Error 630 64.81 Fruit Volume Genotype 34 1682.73 22.39 <.0001 Year 1 198.99 2.65 0.1042 Genotype × year 34 421.05 5.60 <.0001 Error 630 75.14 Weight of the flesh Genotype 34 877.43 19.18 <.0001 Year 1 65.57 1.43 0.2318 Genotype × year 34 218.82 4.78 <.0001 Error 452 45.74 Flesh ratio Genotype 34 0.01 6.81 <.0001 Year 1 0.02 14.20 0.0002 Genotype × year 34 0.008 5.03 <.0001 Error 452 0.001 Seed Average weight of the seed Genotype 34 2.13 5.95 <.0001 Year 1 5.43 15.18 0.0001 Genotype × year 34 1.31 3.68 <.0001 Error 451 0.35 Geometric diameter of the seed Genotype 34 20.00 1.26 0.1563 Year 1 54.60 3.43 0.0647 Genotype × year 34 12.21 0.77 0.8266 Error 455 15.91 Sphericity index of the seed Genotype 34 0.031 1.12 0.3 Year 1 0.017 0.62 0.4332 Genotype × year 34 0.022 0.80 0.7823 Error 455 0.028 Seed surface Genotype 34 9.57 6.66 <.0001 Source of variation ddl Mean square F­Value Pr>F Year 1 89.07 61.94 <.0001 Genotype × year 34 3.83 2.67 <.0001
    keywords: effect; error; fruit; genotype; leaf; length; loquat; seed; traits; weight; year
       cache: ahs-14582.pdf
  plain text: ahs-14582.txt

        item: #98 of 594
          id: ahs-14608
      author: Lyakh, Viktor; Soroka, Anatoly
       title: New mutations of flower shape in Nigella damascena L., its pleiotropic effects and patterns of inheritance
        date: 2023
       words: 3093
      flesch: 61
     summary: Sepals reduced in length (“shs2”) in crosses with the single flower line of wild type (with non­reduced sepals) were inherited in a monogenic recessive pat­ Table 1 ­ F2 segregation for sepal shape and floral morph in cross of single flower, elongated sepals (wild type) and double flower, oval sepals (mutant type) plants in N. damascena Fig. As noted above, both mutations caused a partial reduction in the size of sepals of Nigella flowers.
    keywords: damascena; flower; mutant; nigella; plant; sepals; shape; type
       cache: ahs-14608.pdf
  plain text: ahs-14608.txt

        item: #99 of 594
          id: ahs-14691
      author: Moradinezhad, Farid; Ranjbar, Azam
       title: Efficacy of active and passive modified atmosphere packaging on quality preservation and storage life of pomegranate fruit and arils: A review
        date: 2024
       words: 9860
      flesch: 59
     summary: Moradinezhad and Ranjbar ‐ Efficacy of MAP on the shelf life of pomegranate fruit and arils 85 MAP) based on the physiology of the product, envi­ ronmental conditions and the properties of the pack­ aging materials has a significant effect in reducing respiratory activity and increasing the shelf life (Opara et al., 2015; Opara et al., 2017; Belay et al., 2018; Dorostkar and Moradinezhad, 2022). High CO2 reduces the microbial load of fruit by penetrat­ ing the microbial membrane, changing intracellular pH or forming carbonic acid, which has bacteriostat­ ic effects (Zhang et al., 2013 b; Banda et al., 2015; Belay et al., 2017 b; Ranjbari et al., 2018; Van de Velde et al . , 2019, 2020; Moradinezhad and Dorostkar, 2020).
    keywords: arils; atmosphere; belay; co2; effect; et al; food; fruit; injury; kpa; life; loss; low; map; moradinezhad; packaging; pomegranate; postharvest; quality; sci; shelf; storage; technol; wonderful
       cache: ahs-14691.pdf
  plain text: ahs-14691.txt

        item: #100 of 594
          id: ahs-14732
      author: Oraee, Atiyeh; Tehranifar, Ali; Ghorbani, Zahra; Sayyad-Amin, Pegah
       title: Potassium silicate enhances drought tolerance of Bellis perennis by improving antioxidant activity and osmotic regulators
        date: 2024
       words: 8613
      flesch: 55
     summary: ­ Plants, 7(2): 28. ­ Plants, 7: 41. GUAN G., WANG Y., CHENG H., JIANG Z., FEI J., 2015 ­ Physiological and biochemical response to drought stress in the leaves of Aegiceras corniculatum and Kandelia obovata.
    keywords: activity; antioxidant; application; conditions; content; control; drought; drought stress; effect; et al; increase; mm potassium; plants; potassium; potassium silicate; silicate; silicon; stress; water
       cache: ahs-14732.pdf
  plain text: ahs-14732.txt

        item: #101 of 594
          id: ahs-14786
      author: Tiznado-Hernández, Martín Ernesto; Gardea-Bejar, Alfonso Antero; Sánchez-Estrada, Alberto; Orozco-Avitia, Jesús Antonio; Ojeda-Contreras, Angel Javier; Troncoso-Rojas, Rosalba; Melendrez-Amavizca, Rodrigo
       title: “Hurdley technologies” utilized to improve postharvest life of asparagus spears (Asparagus officinalis L.)
        date: 2024
       words: 7352
      flesch: 61
     summary: However, other methods for fresh produce preservation known as “Hurdley tech­ nologies” are available now (Arvanitoyannis et al., 2009), including cold plasma (Jia et al., 2022), UV­C irradiation (Haro­Maza and Guerrero­Beltrán, 2013) and gamma ray irradiation (Prakash and Ornelas­Paz, 2019). The osmometer was calibrated with standards of 100, 290, and 1000 mg kg­1 NaCl solution and the results of molality were converted to an osmotic potential with the Van’t Hoff equation, where Ψs = CiRT (Jia et al., 2020).
    keywords: asparagus; changes; color; days; et al; gamma; irradiation; metabolic; postharvest; potential; quality; rate; sci; spears; storage; table; uv­c; water
       cache: ahs-14786.pdf
  plain text: ahs-14786.txt

        item: #102 of 594
          id: ahs-14920
      author: Nazarian, Ramin; Nasiri Mahalati, Mehdi; Sahabi, Hossein; Feizi, Hassan
       title: Comparison quality parameters of saffron (Crocus sativus L.) produced in Herat, Afghanistan and Torbat Heydarieh, Iran
        date: 2024
       words: 4463
      flesch: 54
     summary: In another study, it has been stated that soil acidity in the range of neutral to slightly alkaline has a positive correlation with saffron quality (Gresta et al., 2008). ­ Iranian J. Biol., 25(3): 423­429. VALLE GARCIA­RODRIGUEZ M., SERRANO­DÍAZ J.S., TARANTILIS P.A., LÓPEZ­CÓRCOLES H., CARMONA M., ALONSO G.L., 2014 ­ Determination of saffron quality by high‐performance liquid chromatography.
    keywords: afghanistan; crocin; herat; heydarieh; iran; picrocrocin; quality; regions; saffron; safranal; torbat
       cache: ahs-14920.pdf
  plain text: ahs-14920.txt

        item: #103 of 594
          id: ahs-14940
      author: Susilawati, Susilawati; Irmawati, Irmawati; Harun, Muhammad Umar; Ichwan, Budiyati
       title: Shallot cultivation in tropical climate ecosystems using floating and non-floating systems with different doses of cow manure
        date: 2024
       words: 6878
      flesch: 61
     summary: 1B) systems with various doses of cow manure ­ showed differences in growth and yield. ­ Plants, 10(5): 1­15.
    keywords: application; bulb; conventional; cow; cow manure; cultivation; farming; growth; leaf; manure; shallot; system; ton
       cache: ahs-14940.pdf
  plain text: ahs-14940.txt

        item: #104 of 594
          id: ahs-14952
      author: Shamsudin, Nor Amirah; Sathiya Seelan, Jaya Seelan; Gansau, Jualang Azlan; Rusdi, Nor Azizun
       title: A review: Molecular identification of orchid mycorrhiza
        date: 2024
       words: 11951
      flesch: 48
     summary: The classification of orchid fungus is determined by the existence or absence of functional pelotons within cortical cells, leading to the categorization of orchid mycorrhizal fungi (OMF) or orchid non­mycorrhizal fungi (ONF) Orchid mycorrhizal fungi are often highly specific, meaning that they can only form partnerships with certain orchid species, and vice versa.
    keywords: analysis; dendrobium; development; dna; ecol; et al; extraction; fungal; fungi; fungus; germination; identification; its1; its4; mccormick; methods; mycorrhizal; mycorrhizal fungi; new; orchid; orchid mycorrhizal; plant; primer; sci; seed; seed germination; sequencing; species; study; tulasnella
       cache: ahs-14952.pdf
  plain text: ahs-14952.txt

        item: #105 of 594
          id: ahs-14965
      author: Muhie, Seid Hussen; Akele, Fatuma; Yeshiwas, Tadele
       title: Phenological and yield response of primed carrot (Daucus carota L) seeds under deficit irrigation 
        date: 2024
       words: 5938
      flesch: 57
     summary: Abstract: Seedling emergence and stand establishment of carrot seeds are often slow and erratic which results in low productivity. Thus, it’s of paramount impor­ tance to examine the different priming techniques to enhance the quality of carrot seeds.
    keywords: carrot; crop; days; emergence; germination; interval; irrigation; priming; root; sci; seed; seedling; total; treatment; water; yield
       cache: ahs-14965.pdf
  plain text: ahs-14965.txt

        item: #106 of 594
          id: ahs-14997
      author: Richardson, Matthew; Arlotta, Caitlin; Monroe-Lord, Lillie
       title: Influence of ground cover and tunnels on production of Red Russian kale in urban gardes
        date: 2024
       words: 6004
      flesch: 64
     summary: We investigated black plastic and straw mulch compared to bare soil cover in low tunnels at 10 urban garden sites and in low tunnels within a high tunnel in the USA to ascertain the influence on yield and nutrients of Red Russian kale, soil temperature, air temperature, weed pressure, and aphid abundance. Kale had low yield in garden sites, likely because the outside envi­ ronment was too cold for low tunnels to gain and retain heat.
    keywords: agriculture; black; cover; garden; ground; kale; mulch; plastic; plots; production; sites; soil; straw; treatments; tunnel; urban; yield
       cache: ahs-14997.pdf
  plain text: ahs-14997.txt

        item: #107 of 594
          id: ahs-15033
      author: Wise, Kimber; Selby-Pham, Jamie; Simovich, Tomer; Gill, Harsharn
       title: A biostimulant complex comprising molasses, Aloe vera extract, and fish-hydrolysate enhances yield, aroma, and functional food value of strawberry fruit
        date: 2024
       words: 10743
      flesch: 57
     summary: The biostimulant effects associated with application Wise et al. ‐ Biostimulant complex improves strawberry quality 49 of Aloe vera extracts are varied, including increased propagation efficiency and growth of Populus tree clones (El Sherif, 2017), eucalyptus tissue cultures (Hendi, 2021), and grape vine cuttings (Uddin et al., 2020), improved growth, biomass, and oil content of sweet basil (Hamouda et al., 2012), increased growth, yield, oil content, and nutritional content of caraway (Khater et al., 2020), improved growth and chlorophyl content of fenugreek (Al­Yasiri et al., 2021), increased leaf growth and terpene content in lavender (El Sherif et al., 2020), enhanced fruit yield and nutritional content of okra (Hemalatha et al., 2018 a, b), and dose­dependent positive and nega­ tive effects on cereal germination (Baličević et al., 2018). Wise et al. ‐ Biostimulant complex improves strawberry quality 53 colour measures L*, a*, and b* (Table S4).
    keywords: aloe; analysis; antioxidant; aroma; biostimulant; changes; colour; complex; content; control; et al; extract; fig; food; fruit; growth; increase; leaf; measures; molasses; plant; quality; sci; strawberry; strawberry fruit; total; treatment; vera; water; yield
       cache: ahs-15033.pdf
  plain text: ahs-15033.txt

        item: #108 of 594
          id: ahs-15047
      author: Hasrianda, E.F.; Setiarto, R. Haryo Bimo; Davis, La Ode Muhammad Muchdar; Poerba, Yuyu Suryasari
       title: Future prospects and challenges in developing saline-tolerant banana
        date: 2024
       words: 10629
      flesch: 56
     summary: This review article will describe current knowledge of biodiversity and various biological responses when banana plants are exposed to saline stress. Developing banana plants with improved salinity tolerance is crucial to ensure food security, especially in regions prone to stress.
    keywords: accessions; banana; breeding; conditions; cultivars; development; diversity; drought; et al; gamma; gene; musa; plant; protein; research; saline; salinity; salt; sci; stress; technology; tolerance; transformation; transgenic; wang
       cache: ahs-15047.pdf
  plain text: ahs-15047.txt

        item: #109 of 594
          id: ahs-15064
      author: Taiti, Cosimo; Guardigli, Giorgia; Babbini, Simone; Marone, Elettra; Masi, Elisa; Comparini, Diego; Mancuso, Stefano
       title: Characterization of Italian honeys: integrating volatile and physico-chemical data
        date: 2023
       words: 8571
      flesch: 55
     summary: Honey samples from different flowers, including acacia, chestnut, citrus, linden, and multifloral, were collected and investigated. Honey samples were prepared by placing 0.5 g in 10 mL of H2O (1:20), mixing for 12­24h, then filtering and diluting 1:1 using the same solution as the mobile phase.
    keywords: acacia; analysis; beekeeper; chestnut; citrus; content; data; et al; hmf; honey; honey samples; linden; multifloral; origin; samples; values
       cache: ahs-15064.pdf
  plain text: ahs-15064.txt

        item: #110 of 594
          id: ahs-15253
      author: Tütüncü, Mehmet; Dalda Şekerci, Akife; Dönmez, Dicle; İzgü, Tolga; Isak, Musab Abdukadir; Şimşek, Özhan
       title: Plant biostimulants in ornamentals: Enhancing growth and stress tolerance
        date: 2024
       words: 7042
      flesch: 45
     summary: Key words: Abiotic stresses, bioactivators, growth stimulation, ornamental plants, plant biostimulants, stress tolerance. Plant biostimulants, also called bioactivators, are becoming increasingly well­liked in the agricultural sector due to their capacity to boost a plant’s growth rate and increase its resistance to stress.
    keywords: application; biostimulants; development; effects; et al; growth; increase; nutrient; ornamental; plant; plant biostimulants; plant growth; production; quality; root; sci; stress; tolerance; yield
       cache: ahs-15253.pdf
  plain text: ahs-15253.txt

        item: #111 of 594
          id: ahs-15354
      author: Cavião, Helen Corso; Russi, Alessandra; Schwambach, Joséli
       title: Biocontrol of Fusarium spp. in vitro and in vine cuttings using Bacillus sp. F62
        date: 2024
       words: 4803
      flesch: 58
     summary: Ziedan et al., 2011; Cruz et al., 2014; Abdullah et al., 2015; Markakis et al., 2017; Ghuffar et al., 2018; Reveglia et al., 2018; Akgül and Ahioğlu, 2019). Nevertheless, the inoculation of this same bacterium by soil drenching in cuttings of ‘SO4’ improved plant development by increasing the length of the primary shoot, the number of nodes in the primary shoot, and the total number of nodes (Russi et al., 2020).
    keywords: bacillus; compounds; control; cuttings; et al; f62; fusarium; grapevine; growth; plant; spp
       cache: ahs-15354.pdf
  plain text: ahs-15354.txt

        item: #112 of 594
          id: ahs-15528
      author: Tini, Etik Wukir; Widodo, Pudji; Sugiyono; Ulinnuha, Zulfa
       title: Assessment of genetic parameters and heritability of Dendrobium species section Spatulata native to Indonesia
        date: 2024
       words: 6120
      flesch: 51
     summary: The potential for improvement through direct selection was indicated by high heritability with high genetic variability flower stalk length, length of inflorescence, flower arrangement length, flower length, flower width, dorsal sepal width, lateral sepal width, petal length, petal width, labellum length, labellum width, number of florets. High genetic diversity in plants reflects substantial genetic variation, signifying numerous genetic differences between individual plants.
    keywords: dendrobium; diversity; flower; leaf; length; orchid; petal; plant; sepal; shape; species; traits; variability; width
       cache: ahs-15528.pdf
  plain text: ahs-15528.txt

        item: #113 of 594
          id: ahs-15535
      author: Brengi, S.H.; Abouelsaad, Ibrahim; Mahdy, R.M.; Khadr, A.A.
       title: Field evaluation of biostimulants on growth, flowering, yield, and quality of snap beans in subtropical environment
        date: 2024
       words: 9199
      flesch: 65
     summary: Although previous studies have examined the individual impacts of these elicitors on plant growth, a comprehensive investigation into their effects specifically on snap bean plants remains lacking. ­ Plants, 7(3): 54.
    keywords: 6­ba; application; bean; control; et al; growth; ksi; number; plant; pods; ppm; ppm tria; sci; seasons; snap; tria; weight; yield
       cache: ahs-15535.pdf
  plain text: ahs-15535.txt

        item: #114 of 594
          id: ahs-15659
      author: mokhtarnejad, Lachin; Farzanehj, Mohsen
       title: The effect of thymol and carvacrol rich-plant essential oils on controlling postharvest decay molds in orange fruit 
        date: 2024
       words: 5267
      flesch: 57
     summary: PLOTTO A., ROBERTS D., ROBERTS R.G., 2003 ‐ Evaluation of plant essential oils as natural postharvest disease control of tomato (Lycopersicon esculentum). According to GC­ MS analysis, the major compounds of T. danensis essential oil were thymol (65.5%) and alpha­terpinene (11.9%) whereas T. vulgaris was rich in thymol (59%) and p­cymene (15.6%).
    keywords: activity; antifungal; carvacrol; compounds; eos; essential; fruit; fungi; oils; thymol
       cache: ahs-15659.pdf
  plain text: ahs-15659.txt

        item: #115 of 594
          id: ahs-15664
      author: El-Nashar, Yasser
       title: Morphological and molecular characterization of some Chrysanthemum (Dendranthema grandiflora) cultivars
        date: 2024
       words: 9579
      flesch: 56
     summary: The mean values of the leaf area of one leaf 10 cm from the plant height did show significant differences among plant cultivars in both seasons (Table 4 and Fig. 2). Other quality parameters such as inflorescence diameter and ray floret length were found to be optimal in Kodiack, Crystal White, Crystal Pink, Coca Bleach, and Crystal Yellow cultivars.
    keywords: abrun; chrysanthemum; chrysanthemum cultivars; crystal; crystal red; cultivars; diversity; et al; inflorescence; kodiack; leaf; length; markers; number; pink; plant; red; sci; ssr; weight; white; yellow
       cache: ahs-15664.pdf
  plain text: ahs-15664.txt

        item: #116 of 594
          id: ahs-15671
      author: Ghassemi-Golezani, Kazem; Abdoli, Soheila
       title: Salicylic acid and iron-oxide nanoparticles improved the growth and productivity of ajowan under salt stress
        date: 2024
       words: 7036
      flesch: 60
     summary: ­ Plants, 9: 1574. RASHEED F., ANJUM N.A., MASOOD A., SOFO A., KHAN N.A., 2020 ­ The key roles of salicylic acid and sulfur in plant salinity stress tolerance.
    keywords: ajowan; fe2o3­nps; foliar; growth; plant; root; salinity; salt; seed; shoot; stress; treatments; yield
       cache: ahs-15671.pdf
  plain text: ahs-15671.txt

        item: #117 of 594
          id: ahs-15691
      author: Ponteras, John; Quisil, John Donald; Salas, Felix
       title: Pigment composition and physico-chemical characteristics of Bittergourd (Momordica charantia L. cv. Jadeite) during postharvest period as influenced by illumination colors
        date: 2024
       words: 8461
      flesch: 60
     summary: Taiti et al., 2017) and can help prolong its shelf­life (Salas et al., 2015). For example, bittergourd fruits can be stored for up to five days under ambient conditions without ripening, yellowing, or losing their bitterness (Salas et al., 2015; Prajapati et al. , 2021 a).
    keywords: bittergourd; blue; chlorophyll; content; et al; fruits; gourd; leds; light; loss; postharvest; quality; red; salas; sci; shelf­life; storage; treatments; weight; white; yellowing
       cache: ahs-15691.pdf
  plain text: ahs-15691.txt

        item: #118 of 594
          id: ahs-15711
      author: Abravesh, Z.; Iranbakhsh, A.; Mirzaie-Nodoushan, Hossein; Ebadi, M.; Oraghi Ardebili, Z.
       title: Effects of foliar application of two forms of selenium on anatomic features of Thymus daenensis Celak
        date: 2024
       words: 4782
      flesch: 52
     summary: Exogenous application of selenium treatments was conducted on the plantlets, as follows: three concentrations of selenium nanoparticles (2, 4, and 8 ppm of NanoSe), and sodium selenate as the bulk form (2, 4, and 8 ppm of SoSe), along with distilled water as a control for the experiment, were applied on the plantlets by 6 times foliar spraying with intervals of two weeks, starting at four leave stage of the plantlets based on a completely randomized design, with five replications. Abstract: To investigate selenium effects on anatomic features of Thymus daenensis, three concentrations of bulk and nanoparticles of the element (2, 4 and 8 ppm) along with distilled water, as a control, were sprayed on foliar of young seedlings of the plant species for six times with 2 weeks intervals.
    keywords: diameter; effects; epidermis; leaf; nanoparticles; plant; ppm; root; selenium; species; thickness; treatments
       cache: ahs-15711.pdf
  plain text: ahs-15711.txt

        item: #119 of 594
          id: ahs-15769
      author: Tran, Thanh Thang; Le, Thi Thuy Tien; Nguyen, Hoang Phuc
       title: Effectiveness of KMnO4 and activated carbon on the quality and storage properties of mango fruit 
        date: 2024
       words: 3758
      flesch: 53
     summary: TRAN T.T., LE T.T.T., NGUYEN H.P., 2024 ­ Effectiveness of KMnO4 and activated carbon on the quality and storage properties of mango fruit. Therefore, the objective of this research is to assess the effectiveness of potassium permanganate and activated carbon treatments on various quality parameters of postharvest Cat Hoa Loc mango.
    keywords: carbon; ethylene; fruit; kmno4; life; mango; mangoes; quality; weight
       cache: ahs-15769.pdf
  plain text: ahs-15769.txt

        item: #120 of 594
          id: ahs-15798
      author: Thakur, Vandana; Kumar, Pardeep; Sharma, Sunny
       title: Insight to the conventional and biotechnological approaches in tomato on potato grafting (Pomato): A review 
        date: 2025
       words: 9535
      flesch: 57
     summary: There is a significant improvement in growth and yield attributes in grafted tomato plants between BARI tomato­11 (scion) and two potato rootstocks, namely Asterix and Cardinal (Arefin et al., 2019) YASINOK A.E., SAHIN F.I., EYIDOGAN F., MUSTAFA K., ANDHABERAL M., 2009 ­ Grafting tomato plant on tobacco plant and its effect on tomato plant yield and nicotine content.
    keywords: combination; development; et al; fruit; fusion; genes; grafted; grafting; grafts; growth; hortic; hybrids; kumar; plant; potato; quality; rootstock; scion; sharma; somatic; thakur; thakur et; tomato; tomato plant; tuber; yield
       cache: ahs-15798.pdf
  plain text: ahs-15798.txt

        item: #121 of 594
          id: ahs-16080
      author: Purnima Paramanik; Nirmalya Banerjee; Subrata Raha; Dipak Kumar Kar
       title: An efficient nutrient medium for asymbiotic seed germination and in vitro plant generation of Vanda tessellata (Roxb.) Hook. ex G. Don
        date: 2025
       words: 4678
      flesch: 59
     summary: KUNDSON L., 1946 ­ A new nutrient solution for the germination of orchid seeds. Sci., 2024 38(4): 363­370 DOI: 10.36253/ahsc­16080 https://oaj.fupress.net/index.php/ahs An efficient nutrient medium for asymbiotic seed germination and in vitro plant generation of Vanda tessellata (Roxb.)
    keywords: 0.00±0.00; banana; charcoal; formation; germination; media; medium; orchids; plant; seed; tessellata
       cache: ahs-16080.pdf
  plain text: ahs-16080.txt

        item: #122 of 594
          id: ahs-16106
      author: Shamsi, Siti Mariam; El Pebrian, Darius; Mustaffha, Samihah; Sulaiman, Hamdam; Zahari, M.K.; Ghazali, Nurul Aisyah Adilah
       title: Lettuce postharvest quality: Affordable packaging and storage durations
        date: 2025
       words: 4717
      flesch: 55
     summary: This type of plastic is specifically designed for packaging vegetables and fruits, and it is commonly used by the farmers for lettuce packaging. Building on these findings, this study addresses a critical gap in understanding the role of effective and affordable packaging materials in maintaining lettuce quality during storage, with practical implications for small­scale lettuce farmers.
    keywords: chlorophyll; content; lettuce; loss; materials; newspaper; packaging; plastic; quality; storage; weight
       cache: ahs-16106.pdf
  plain text: ahs-16106.txt

        item: #123 of 594
          id: ahs-16128
      author: Ghimire, Nishes; Sapkota, Puja; Poudel, Pragya; Sapkota, R.; Dahal, Kishor Chandra
       title: Pruning date and hydrogen cyanamide effects on growth and yield of grapevine var. Cabernet Sauvignon
        date: 2024
       words: 4277
      flesch: 66
     summary: c 9.93±3.38 bc 8.48±3.02 b 1.91±1.29 a 3.36±1.71 a 6.97 2.161 ** D46 12.43±3.63 c 11.1±3.78 bc 9.69±3.46 b 2.12±1.54 a 4.25±2.27 a 7.92 2.510 ** D49 13.79±4.04 c 11.98±4.13 bc 10.58±3.93 b 2.31±1.8 a 4.87±2.62a 8.13 3.017 ** D51 15.1±4.56 b 12.76±4.53 b 12.57±4.52 b 2.50±2.03 a 5.49±3.02 a 9.70 3.525 ** D55 16.09±5 b 13.82±5.02 b 13.61±5.02 b 2.69±2.28 a 6.21±3.49 a 10.48 3.725 ** D59 16.9±5.28 b 14.72±5.32 b 14.63±5.35 b 2.87±2.5 a 6.97±3.97 a 11.21 4.140 ** D65 18.33±5.74 b 16.26±5.92 b 16.00±5.86 b 3.05±2.75 a 7.83±4.52 a 12.25 5.081 ** D69 19.69±6.27 b 17.65±6.46 b 17.53±6.46 b 3.21±2.98 a 8.62±5.06 a 13.29 5.679 ** Table 3 ­ Effect of pruning date followed by HC application on number of days to 1st and 50% budburst, Dhading, Nepal, 2021 Mean with the same letter(s) within the column do not differ significantly by DMRT at 5%. ­ Effect of different timing of pruning followed by HC appli­ cation on observed fruitfulness.
    keywords: application; budburst; buds; cyanamide; effect; grapevine; hydrogen; nepal; pruning; treatments; vines
       cache: ahs-16128.pdf
  plain text: ahs-16128.txt

        item: #124 of 594
          id: ahs-16177
      author: Razzak, M. Abdur; Asaduzzaman, Md.; Asao, Toshiki
       title: Titanium based electro-degradation of nutrient solution and green light improve autotoxicity, growth and yield of lettuce grown in recycled hydroponics
        date: 2025
       words: 10873
      flesch: 69
     summary: In non­recycle system, culture solutions fully drain out to start next culture after harvesting of first culture. However, in commercial cultivation, reuse of culture solutions negatively affects the yield of crop.
    keywords: culture; green; leds; lettuce; light; nutrient; plant; solutions; yield
       cache: ahs-16177.pdf
  plain text: ahs-16177.txt

        item: #125 of 594
          id: ahs-16233
      author: Muda, Strayker Ali; Lakitan, Benyamin; Ramadhani, Fitri; Juwinda
       title: Butterhead lettuce growth under shallow water tables and its recovery on tropical urban ecosystem
        date: 2025
       words: 5131
      flesch: 59
     summary: Meanwhile, in other plants, such as tomato plants, 5 cm and 10 cm below media surface, did not reduce leaf growth rate, specific leaf weight, and leaf water content (Meihana et al., 2017). Sci., 2024 38(4): 327­337 DOI: 10.36253/ahsc­16233 https://oaj.fupress.net/index.php/ahs Butterhead lettuce growth under shallow water tables and its recovery on tropical urban ecosystem S.A. Muda 1, B. Lakitan 1, 2 (*), F. Ramadhani 1, Juwinda 1 1 College of Agriculture, Universitas Sriwijaya, Indralaya 30662, Indonesia.
    keywords: area; butterhead; growth; leaf; lettuce; recovery; substrate; surface; table; water; wt1; wt2; wt3
       cache: ahs-16233.pdf
  plain text: ahs-16233.txt

        item: #126 of 594
          id: ahs-16275
      author: Elbitar, A.; Chehade, A.; Kanj, F.; Yahfoufi, Suzanne
       title: In vitro propagation and shootlets assessment for drought and salinity tolerance of traditional accessions of potato 
        date: 2025
       words: 7781
      flesch: 60
     summary: The effect of culture medium on the multiplication rate and height of potato shootlets is illustrated in figure 4. These observations demonstrate that the greatest tolerance under both high and low temperature conditions was exhibited by TA1 potato accession, with TA3 showing the next highest tolerance at high temperature.
    keywords: accessions; height; leaves; l­1; number; plant; potato; roots; shootlets; stress; ta1; ta2; ta3; tal; temperature; tolerance; water
       cache: ahs-16275.pdf
  plain text: ahs-16275.txt

        item: #127 of 594
          id: ahs-16385
      author: Hussen, Jemal Seid; Muhie, S.H.
       title: Interaction between sowing date and mulching is important for better growth and productivity of carrot in a weather-vulnerable area of Ethiopia
        date: 2025
       words: 7568
      flesch: 59
     summary: For this reason, this study focused on implementing management practices such as proper sowing dates and mulching to minimize adverse effects on root yield and suppress weed growth. LAVANYA A.V.N., VANI V.S., REDDY P.S.S., CHAITANYA K., 2017 ­ Effect of sowing dates and spacing on growth and root yield of radish cv.
    keywords: carrot; date; growth; july; mulching; rate; root; root yield; sawdust; soil; sowing; sowing date; weed; yield
       cache: ahs-16385.pdf
  plain text: ahs-16385.txt

        item: #128 of 594
          id: ahs-16549
      author: Hussen, Jemal Seid; Ahmed, Gebeyaw E.
       title: Role of vertical farming for sustainable urban horticulture: A review
        date: 2025
       words: 6931
      flesch: 42
     summary: Urban food security hinges on factors such as food availability, accessibility, and quality, all of which stand to benefit from the implementation of urban vertical farming techniques. The absence of soil in vertical farming systems generally prevents weed growth, reducing labor costs in this aspect.
    keywords: agriculture; crops; cultivation; farming; food; growth; horticulture; hydroponics; land; plants; population; production; security; soil; systems; urban; vegetables; vertical; water
       cache: ahs-16549.pdf
  plain text: ahs-16549.txt

        item: #129 of 594
          id: ahs-16590
      author: Puccinelli, Martina; Maggini, Rita; Pardossi, Alberto; Incrocci, Luca
       title: Continuous lighting improves the leaf quality of sweet basil (Ocimum basilicum L.) grown in a controlled environment
        date: 2025
       words: 6324
      flesch: 58
     summary: VELEZ­RAMIREZ A.I., VAN IEPEREN W., VREUGDENHIL D., MILLENAAR F.F., 2011 ­ Plants under continuous light. ­ Plants, 10: 1­14.
    keywords: basil; concentration; d­1; et al; growth; leaf; light; lighting; m­2; nitrate; photoperiod; plant; quality; sci; µmol
       cache: ahs-16590.pdf
  plain text: ahs-16590.txt

        item: #130 of 594
          id: ahs-16663
      author: Cruz, Maria Angel; Alcasid, Carolyn; Balendres, Mark Angelo
       title: Endophytic Luteibacter yeojuensis strains stimulate banana plant growth
        date: 2025
       words: 5602
      flesch: 56
     summary: KÖBERL M., DITA M., MARTINUZ A., STAVER C., BERG G., 2015 ­ Agroforestry leads to shifts within the gammaproteobacterial microbiome of banana plants cultivated in Central America. JOHANSEN J.E., BINNERUP S.J., KROER N., MOLBAK L., 2005 ­ Luteibacter rhizovicinus gen. nov., sp. nov., a yellow‐pigmented gammaproteobacterium isolated from the rhizosphere of barley (Hordeum vulgare L.).
    keywords: bacteria; banana; control; endophytes; et al; grand; isolates; luteibacter; nain; plant; strains; study; yeojuensis
       cache: ahs-16663.pdf
  plain text: ahs-16663.txt

        item: #131 of 594
          id: ahs-16693
      author: Al-madhagi, Isam; Arraf, Elham
       title: Evaluation of salinity tolerance of Yemeni chilli pepper genotypes during gemination by using different statistically models 
        date: 2025
       words: 18025
      flesch: 64
     summary: The degree of genotype tolerance to salinity depends on inherent resistance mechanisms, including metabolic responses activated during salt stress (Horuz et al. , 2022). All factors examined, including salinity stress levels, genotype, and their interaction, had highly significant effects on the germination percentage (GrP) of chilli genotypes (p<0.001).
    keywords: chilli; d 0; et al; genotypes; germination; grp; levels; mgt; nacl; salinity; salt; sensitivity; ssi; stress; table; tolerance; values
       cache: ahs-16693.pdf
  plain text: ahs-16693.txt

        item: #132 of 594
          id: ahs-16747
      author: Martínez-Villagómez , Mercedes; Barrientos-Priego, Alejandro Facundo; Mascorro-Gallardo , José Oscar; Iturriaga , Gabriel; Espíndola-Barquera, María de la Cruz
       title: Effect of auxins on the rooting of the avocado rootstock 'Duke 7'
        date: 2025
       words: 8192
      flesch: 44
     summary: Synthetic auxins like indole­3­butyric acid (IBA) and 1­naphthaleneacetic acid (NAA) serve as the primary regulators of adventitious root formation through complex interactions that modulate metabolic, transport, and signaling processes (Lakehal and Bellini, 2019). These outcomes are analyzed through three critical lenses: Their physiological implications for adventitious root formation, practical applications for commercial clonal propagation systems, and comparative relevance to established literature in avocado propagation.
    keywords: acid; auxin; avocado; callus; concentration; development; duke; et al; formation; iaa; iba; naa; percentage; plant; propagation; quality; root; rooting; rootstock; shoots; type
       cache: ahs-16747.pdf
  plain text: ahs-16747.txt

        item: #133 of 594
          id: ahs-16755
      author: da Silveira, João Vitor Melquiades; dos Santos, Erich Cristian Pereira; dos Santos, Lucas Pereira; de Freitas, Carla Francisco; de Arruda, Rodolfo Fioruci; Garcia, Robson Henrique Pedroso; Gorni, Pedro Henrique
       title: Glucose exogenous increases biochemical and physiological responses in Beta vulgaris L.
        date: 2025
       words: 7086
      flesch: 56
     summary: The current investigation evaluated the effect of glucose (0, 5, 10, 20, and 30 mmol L­1) on beet plants 10 days after transplantation. Materials and Methods Experimental location and plant material The experiment was conducted using beet plants in pots inside a greenhouse on a wooden bench, kept open sky, covered by shading which provided 50% of solar radiation located at the Escola Superior de Agronomia de Paraguaçu Paulista (ESAPP), Brazil (22°41’76” S, 50°58’33” W).
    keywords: acid; activity; antioxidant; application; beet; chlorophyll; compounds; concentrations; control; et al; fig; glc; glucose; growth; l­1; mmol; plants; standard
       cache: ahs-16755.pdf
  plain text: ahs-16755.txt

        item: #134 of 594
          id: ahs-16774
      author: Mendoza, Mariecris Rizalyn; Laurena, Antonio; Diaz, Maria Genaleen; Ocampo, Eureka Teresa; Laude , Tonette; Lalusin, Antonio
       title: Association analysis of intragenic molecular markers related to fiber quality and tensile strength of abaca (Musa textilis Nee)
        date: 2025
       words: 8666
      flesch: 60
     summary: Its accumulation in fiber cells during growth is also responsible for the development of cotton fiber cells (Zhang et al., 2017). ­ Genes, 10(7): 555. DING A., MAROWA P., KONG Y., 2016 ­ Genome‐wide identification of the expansin gene family in tobacco (Nicotiana tabacum).
    keywords: abaca; accessions; analysis; association; cellulose; cotton; development; et al; expansin; fiber; genes; markers; percent; plant; protein; quality; sci; ssr; strength; study; tensile; traits; wall
       cache: ahs-16774.pdf
  plain text: ahs-16774.txt

        item: #135 of 594
          id: ahs-16803
      author: saparso, saparso; Sudarmaji, Arief; Bachtiar Musthafa, Muhammad; Tini, Etik Wukir; Pramana Putra, Fajrin; Raditya Kurniawan, Rifqi
       title: Physiological tolerance of shallot varieties to airborne salinity in coastal sandy soils
        date: 2025
       words: 8618
      flesch: 59
     summary: ­ Plants, 10(2): 243. Tolerance shallot variety on airborne salinity 157 has an escape response shown in fresh bulb weight per clump which is higher than Bima Brebes, although Bima Brebes is higher in the number of bulbs per clump due to the defense response from airborne salinity stress (Fig. 7).
    keywords: bali; bima; brebes; chlorophyll; clump; cm­1; data; et al; growth; karet; land; plant; proline; salinity; salinity stress; sci; shallot; stomatal; stress; tolerance; varieties; variety; weight; yield
       cache: ahs-16803.pdf
  plain text: ahs-16803.txt

        item: #136 of 594
          id: ahs-16960
      author: Waldo, Benjamin; Arlotta, Caitlin G.; Richardson , Matthew
       title: Preliminary evaluation of nematode community responses to ground covers in jute leaf cultivation
        date: 2025
       words: 6261
      flesch: 57
     summary: FENGJUAN P.A.N., XIAOZENG H.A.N., NA L.I., JUN Y.A.N., YANLI X.U., 2020 ­ Effect of organic amendment amount on soil nematode community structure and metabolic footprints in soybean phase of a soybean‐ maize rotation on molli‐sols. These results suggest ground covers can influence soil nematode communities in jute leaf production.
    keywords: abundance; bongers; community; compost; cover; diversity; effects; et al; ground; jute; leaf; nematode; plant; plots; soil; straw; study; treatments
       cache: ahs-16960.pdf
  plain text: ahs-16960.txt

        item: #137 of 594
          id: ahs-16964
      author: Thathsarani, Dilki; Tikirikumari, Thilakshi; Priyadarshan, Asha Ishani Sri; Herath, Harshini; Senanayake, Priyanganie
       title: Phytochemical evaluation of selected Phalaenopsis cultivars
        date: 2025
       words: 6258
      flesch: 51
     summary: These findings provide valuable insights into the floral coloration and the phytochemical richness of vegetative parts in Phalaenopsis cultivars. These striking patterns and colors increase the aesthetic value of Phalaenopsis cultivars, capturing the attention of consumers and expanding their market appeal.
    keywords: chlorophyll; content; cultivars; extracts; flowers; gold; leaves; phalaenopsis; plant; roots
       cache: ahs-16964.pdf
  plain text: ahs-16964.txt

        item: #138 of 594
          id: ahs-17150
      author: Elashwah, Mahmoud Abd-elfatah; Noor El-Deen, Tarek; Bazaraa, Walid Mohamed Said
       title: Improving drought tolerance of Leucophyllum frutescens through the application of paclobutrazol and cycopcel plant growth regulators
        date: 2025
       words: 10388
      flesch: 60
     summary: Water irrigation levels 100% P.C. 1.88 a 0.51 a 27.14 a 0.97 c 75% P.C. 1.74 b 0.39 c 23.82 b 1.24 b 50% P.C. 1.52 c 0.49 b 19.15 c 1.70 a Growth retardants Control 1.38 g 0.51 a 21.30 e 1.08 g PBZ 50 ppm 1.58 f 0.49 b 22.00 d 1.13 f PBZ 100 ppm 1.68 e 0.49 b 22.82 c 1.26 d PBZ 150 ppm 1.80 c 0.46 c 24.21 b 1.39 c CCC 1000 ppm 1.73 d 0.45 c 22.58 cd 1.24 e CCC 2000 ppm 1.85 b 0.44 d 23.92 b 1.42 b CCC 3000 ppm 1.98 a 0.41 e 26.75 a 1.62 a Table 10 ­ Effect of water irrigation levels and two plant growth retardants on chemical composition analysis of Leucophyllum frutescens during the second season 2023 Adv. Different concentrations of PBZ at 50, 100 and 150 ppm and CCC at 1000, 2000 and 3000 ppm were combined with 100, 75 and 50% pot capacity (P.C.) irrigation water levels, and some morphological, chemical and tolerance indices were examined.
    keywords: ccc; cycocel; drought; growth; irrigation; levels; p.c; paclobutrazol; pbz; plant; ppm; root; season; stress; tolerance; water; weight
       cache: ahs-17150.pdf
  plain text: ahs-17150.txt

        item: #139 of 594
          id: ahs-17201
      author: Rida, Magd el Din F.; Taha, Asmaa M.
       title: Enhance the longevity and aesthetic appeal of Anthurium andraeanum cv. Fire cut leaves by using some natural components
        date: 2025
       words: 5407
      flesch: 63
     summary: Abstract: This experiment was conducted to examine the effects of rosehip oil (Rh oil), Arabic gum (AG), and chitosan (CS) on the vase life and quality of Anthurium andraeanum cv. Seven treatments were applied: tap water (control), Rh oil (2% or 4%), Rh oil (2% or 4%) + AG (5%), and Rh oil (2% or 4%) + AG (5%) +
    keywords: anthurium; experiment; gum; leaf; leaves; oil; rh oil; rosehip; vase; weight
       cache: ahs-17201.pdf
  plain text: ahs-17201.txt

        item: #140 of 594
          id: ahs-17221
      author: Ayarna, Alex Williams; Tsukagoshi, Satoru; Sintim, Henry Ofosuhene; Ulzen, Jacob; Amissah, J. Naalamle; Bukari, Musa; Poku, Samuel Aduse; Takagaki, Michiko; Lu, Na; Adjei-Nsiah, Samuel; Nkansah, George Oduro
       title: Effect of partial-extreme root restriction and nutrient solution concentration on the performance of hydroponically grown tomato
        date: 2025
       words: 6686
      flesch: 54
     summary: Table 2 ­ Morphological response of tomato to partial­extreme root restriction and nutrient solution concentration at 74 days after transplanting Nutrient solution concentration Root restriction Plant height (cm) ISMAIL M.R., NOOR K.M., 1996 ­ Growth, water relations and physiological processes of starfruit plants under root growth restriction.
    keywords: concentration; et al; fruit; growth; nsc; nutrient; plant; restriction; root; root restriction; solution; standard; tomato; water; yield
       cache: ahs-17221.pdf
  plain text: ahs-17221.txt

        item: #141 of 594
          id: ahs-17232
      author: DAO, Jonas Patrick; Kouakou, Camille; Cherif, Mamadou; Yeo, Katienapariga Tayourou; Guinagui, N’doua Bertrand; Mbo, Kacou Antoine Alban; KOUAKOU, Kouakou Laurent
       title: Exploring grafting to propagate and conserve Garcinia kola a vulnerable species in Côte d’Ivoire: Vegetative propagation of Garcinia kola by grafting
        date: 2025
       words: 6332
      flesch: 65
     summary: The lowest values of graft success rate were observed in the month of August. The highest percentages of graft success (38.75±2.71% and 55.83±5.42%) were obtained when the grafts were unwrapped at 29 DAG on 36­ and 12­month­old rootstocks, respectively.
    keywords: cleft; days; garcinia; grafting; grafts; kola; month; rate; recovery; rootstock; success; technique; time
       cache: ahs-17232.pdf
  plain text: ahs-17232.txt

        item: #142 of 594
          id: ahs-17277
      author: Dev, Rahul; Hedau, N.K.; Santhiya, S.; Pal, R.S.; Paschapur, Amit; Kant, Lakshmi
       title: Agro-morphological characterization of Indian garlic (Allium sativum L.) germplasm under mid hill of Northwest Himalaya
        date: 2025
       words: 7716
      flesch: 53
     summary: TY 32.50 175.67 105.67 3.09 899.52 29.99 28.38 Plant weight (g) PW 8.00 52.67 23.99 0.87 71.52 8.46 35.25 TSS (°Brix) TSS 16.16 43.90 38.27 0.46 19.77 4.45 11.62 Total Polyphenols (mg GAE/g) TPP 0.30 1.25 0.51 0.02 0.02 0.15 29.90 DPPH (% Inhibition) DPPH 10.08 49.23 27.49 1.01 96.64 9.83 35.76 ABTS (% Inhibition) ABTS 31.65 83.42 62.14 0.60 33.62 5.80 9.33 TAA (mM Trolox equivalent/g DW) TAA 12.71 66.43 25.74 0.66 41.32 6.43 24.97 FRAP Vale (mM FeSo4 equivalent/g FRAP 95.04 269.32 154.13 3.38 1074.06 32.77 21.26 Total carbohydrate (%) TCA 14.39 28.81 21.42 0.35 11.76 3.43 16.01 Dev et al. ‐ Genetic diversity analysis in Indian garlic 143 distinctive leaf traits such as leaf length (VGS­96), leaf width (VGS­43), leaf number (VGS­95), and several yield­related traits such as bulb weight (VGS­96, VGS­ 105, Swarna­9) and total yield (VGS­39). Karthikeyan et al., 1989).
    keywords: abts; allium; analysis; bulb; clove; diversity; dpph; et al; frap; garlic; genotypes; indian; leaf; plant; sci; solution; total; traits; weight
       cache: ahs-17277.pdf
  plain text: ahs-17277.txt

        item: #143 of 594
          id: ahs-17292
      author: Amin, Rifat Shahinara; Md. Rukunuzzaman; Ahmed, Maruf; Khatun, Mst. Ananya; Rahman, Md. Atikur; Saroare, M.G.; Islam, Md Tariqul
       title: Impact of chitosan-aloe vera gel with coconut oil coating on postharvest quality and antioxidant of ‘Gopalbhog’ mango at ambient storage
        date: 2025
       words: 6807
      flesch: 65
     summary: Therefore, maintaining mango fruit quality and extending post­ harvest life requires effective strategies. CTS+AVG significantly maintained the firmness of mango fruits.
    keywords: activity; aloe; antioxidant; chitosan; coatings; control; days; et al; fruit; gel; g­1; mango; postharvest; quality; sci; storage; vera
       cache: ahs-17292.pdf
  plain text: ahs-17292.txt

        item: #144 of 594
          id: ahs-17508
      author: Zaiful, Zilda Khaerani; Faried, Muhammad; Syam'un, Elkawakib; Mantja, Katriani; Putri, Remi Widana; Jalil, Abdul; Wijaya, Padil; Cennawati, Cennawati
       title: Effect of boron priming on germination traits of shallot (Allium ascalonicum L.)
        date: 2025
       words: 5280
      flesch: 52
     summary: Discussion and Conclusions Seed priming is a crucial technique in agriculture aimed at enhancing seed germination and seedling establishment under various stress conditions. Kaya and Ergin (2023), in a study conducted on Carthamus tinctorius seeds, also observed a linear increase in germination index with higher boron concentrations, reinforcing boron’s beneficial effects on seed germination.
    keywords: boron; et al; germination; germination time; growth; parameters; priming; seed; seedling; shallot; time
       cache: ahs-17508.pdf
  plain text: ahs-17508.txt

        item: #145 of 594
          id: ahs-17532
      author: Trujillo, Heiber Andres; Assis de Oliveira, Francisco Canindé; Villegas Lobos, Cristian Marcelo; da Silva, Marcelo; Gomes-Junior, Francisco Guilhien
       title: Digital and multivariate analysis of lettuce seed vigor: Impact of hydropriming on physiological potential
        date: 2025
       words: 5429
      flesch: 52
     summary: These findings underscore the utility of digital image analysis combined with multivariate statistical methods for the accurate assessment of seed vigor, thereby improving seed­lot classification and informing decision­making in lettuce production systems. The use of the Seed Vigor Imaging System (SVIS®), developed by Sako et al. (2001), has been widely adopted to quantify seed vigor in various species, including soybean, corn, melon, sweet corn, castor bean, peanut, okra, common bean, eggplant, tomato, cotton, and sunflower (Hoffmaster et al., 2003; Marcos­Filho et al., 2006; Marchi et al., 2011; Alvarenga et al., 2013; Caldeira et al., 2014; Gomes­ Junior et al. , 2014; Rocha et al. , 2015).
    keywords: analysis; genotype; hydropriming; index; length; manova; multivariate; sci; seed; seed vigor; seedling; treatment; uniformity; variables; vigor
       cache: ahs-17532.pdf
  plain text: ahs-17532.txt

        item: #146 of 594
          id: ahs-17811
      author: Nasrin, T.A.A.; Rahman, Md. Atiq; Arfin, Most.; Afroz, Mafruha; Naznin, Most. Tahera; Molla, Mohammad Mainuddin; Sabuz, Ashfak Ahmed; Matin, Md. A.; Islam, Khandakar R.
       title: Comparative evaluation of Aloe vera and chitosan edible coatings on shelf life and quality of strawberries during cold storage
        date: 2025
       words: 7962
      flesch: 54
     summary: HASSAN H.S., EL­HEFNY M., GHONEIM I.M., EL­LAHOT M.S.R.A., AKRAMI M., AL­HUQAIL A.A., ALI H.M., ABD­ ELKADER D.Y., 2022 ­ Assessing the use of AVG alone and in combination with lemongrass essential oil as a coating material for strawberry fruits: HPLC and EDX analyses. Biol., 10: 549­565. SHAFIQUE M., RASHID M., ULLAH S., RAJWANA I.A., NAZ A., RAZZAQ K., HUSSAIN M., ABDELGAWAD M.A., EL­ GHORAB A.H., GHONEIM M.M., SHAKER M.E., IMRAN M., JBAWI E.A., 2023 ­ Quality and shelf l ife of strawberry fruit as affected by edible coating by moringa leaf extract, Aloe vera gel, oxalic acid, and ascorbic acid.
    keywords: acid; aloe; avg; cacl₂; chitosan; coating; et al; fruit; loss; postharvest; quality; shelf; storage; strawberries; strawberry; vera
       cache: ahs-17811.pdf
  plain text: ahs-17811.txt

        item: #147 of 594
          id: ahs-18140
      author: Prisa, Domenico; Jamal, Aftab
       title: Achillea millefolium L.: A Comprehensive review of its phytochemistry and pharmacological properties
        date: 2025
       words: 6986
      flesch: 31
     summary: Abstract: Achillea millefolium L., commonly known as yarrow, is a perennial herb traditionally used in various cultures for its therapeutic properties. Citation: PRISA D., JAMAL A., 2025 ­ Achillea millefolium L.: A comprehensive review of its phytochemistry and pharmacological properties.
    keywords: achillea; achillea millefolium; activity; antioxidant; effects; et al; extracts; flavonoids; millefolium; oils; phytochemical; plant; properties; skin; studies; use; yarrow
       cache: ahs-18140.pdf
  plain text: ahs-18140.txt

        item: #148 of 594
          id: ahs-18395
      author: Arabi, M.I.E.; Jawhar, M.
       title: Cultural and genetic evaluation of Cochliobolus sativus during successive passages through suscepible barley
        date: 2014
       words: 2973
      flesch: 51
     summary: Although the production of conidia is expected to produce genetically identical clones, the high rate of ap- pearance of new races with the ability to infect previously resistant varieties of barley suggests that C. sativus may have high mutation rates in avirulence genes, which deter- mine race (Kumar et al., 2002). However, in the case of the host-specific toxin pro- duced by C. sativus, the fungus which incites SB of bar- ley, the toxin will produce all the symptoms characteristic of the disease; sensitivity to the toxin is correlated with susceptibility to the pathogen and toxin production by the pathogen is directly related to its ability to cause disease (Kumar et al., 2002).
    keywords: barley; cochliobolus; generations; isolates; pt1; pt4; sativus; virulence
       cache: ahs-18395.pdf
  plain text: ahs-18395.txt

        item: #149 of 594
          id: ahs-18396
      author: Sharma, S.; Kumar, K.; Kumar, A.
       title: Genetic divergence studies regarding different growth and foliage characters of walnut (Juglans regia L.) germplasm
        date: 2014
       words: 3020
      flesch: 64
     summary: Information about the extent of genetic divergence is critical for the improve- ment of any crop in order to have heterotic responses and desirable segregants. Furthermore, information on the nature and degree of genetic divergence present in the collected germplasm could help for further improvement through hybridization.
    keywords: accessions; cluster; h.p; india; mean; plant; walnut
       cache: ahs-18396.pdf
  plain text: ahs-18396.txt

        item: #150 of 594
          id: ahs-18397
      author: Bakri, Y. Bakri; Jawhar, M.; Arabi, M.I.E.
       title: Enzymatic activity of the endoohytic Fusarium species strains isolated from wheat
        date: 2014
       words: 2967
      flesch: 56
     summary: Statistical analysis All the experiments were performed in triplicate and the means were analyzed statistically with the analysis of variance (Anonymous, 1988) using the STAT-ITCF com- puter package to test for differences in enzyme production among Fusarium spp. strains. One unit of enzyme activity (IU) was defined as the amount of enzyme that released 1 μmol of glucose per ml per minute.
    keywords: activity; enzymes; fusarium; production; protein; spp; strains
       cache: ahs-18397.pdf
  plain text: ahs-18397.txt

        item: #151 of 594
          id: ahs-18399
      author: Hiramatsu, T.; Terry, L.A.; Kadono, T.; Kawano, Tomonori
       title: Impact of UV irradiation in leaves, fruits and suspension-cultured cells of Micro-Tom, tomato
        date: 2014
       words: 6252
      flesch: 57
     summary: For instance, exposure of fruit tissue slices of zucchini squash to low dose UV-C Impact of UV irradiation in leaves, fruits and suspension-cultured cells of Micro-Tom, tomato T. Hiramatsu,1 L.A. Terry,2 T. Kadono,1 T. Kawano1,3,4 The intensities of UV-A and UV-C were moni- tored with UV meters (UVX-25, UVP Inc., Upland, CA; YK-34UV, Lutoron Electronic Enterprise Co., Ltd., Taipei, Taiwan) and the intensity of UV-A and UV-C applied to the surfaces of plant materials were adjusted to 2.2 mW cm-2, therefore the doses of UV irradiation were controlled by al- tering the length of irradiation time.
    keywords: cell; culture; death; et al; expression; fig; fruits; gene; irradiation; kawano; leaves; plant; suspension
       cache: ahs-18399.pdf
  plain text: ahs-18399.txt

        item: #152 of 594
          id: ahs-18400
      author: Shahkoomahally, Shirin; Ramezanian, A.
       title: Analytical statistical interpretation of relationship between different parameters of kiwifruit (Actinidia deliciosa cv. Hayward) during cold storage
        date: 2014
       words: 3681
      flesch: 56
     summary: Parameters, such as total phenolic compounds (TPC), color (L*, hue, chroma), total antioxidant activity (TAA) and ascorbic acid (AA) content, were evaluated at harvest and every 15 days during fruit storage at 0ºC and 90% ± 5 RH. Key words: ascorbic acid, correlation, kiwifruit, total antioxidant activity, total phenolic compounds.
    keywords: antioxidant; compounds; correlation; food; kiwifruit; phenolic; storage; taa; total; tpc
       cache: ahs-18400.pdf
  plain text: ahs-18400.txt

        item: #153 of 594
          id: ahs-18401
      author: Saour, G.; Ismail, H.; Jassem, I.; Tamer, S.
       title: Biorational insecticides against the potato tuber moth (Lepidoptera: Gelechiidae) on stored potatoes
        date: 2014
       words: 5477
      flesch: 52
     summary: The re- sidual activity of spinosad and emamectin benzoate used at 216 and 15 mg/L remained unchanged (zero F 1 adults Table 1 - Mean (±SE) hatchability of potato tuber moth eggs of two age groups treated topically with spinosad, emamectin benzoate, and chromafe- nozide insecticides Insecticides Chemical group Active ingredient mg/l % of hatched eggs (z) 1-1.5 day old egg 4-4.5 days old egg (y) Control - 91.9±4.2Aa 94.1±3.9Aa Spinosad Spinosyns 72 12.7±3.9Ac 15.8±3.8Ac (Spintor® 2 SC, 240 mg/ml) 144 P. operculella eggs aged 1-1.5 and 4-4.5 days deposit- ed on the oviposition support were dipped for 30 s in three different concentrations 72, 144, 216 ml/L and 5, 10, 15 mg/L for spinosad and emamectin benzoate, respective- ly (0.3, 0.6, 0.9 ml/L of Spintor and 0.1, 0.2 and 0.3 g/L of Proclaim); while chromafenozide was applied at two concentrations of 37.5 and 75 mg/L (0.75 and 1.5 ml/L of Matric).
    keywords: benzoate; chromafenozide; control; eggs; emamectin; insecticides; journal; larvae; lepidoptera; operculella; potato; spinosad; tubers
       cache: ahs-18401.pdf
  plain text: ahs-18401.txt

        item: #154 of 594
          id: ahs-18402
      author: Yusuf, L.M.
       title: Growth Studies in Mangosteen (Garcinia mangostana L.). II. Activation of seedling growth in Mangosteen using Arbuscular Mycorrhizal Fungi and Azospirillum
        date: 2014
       words: 9125
      flesch: 68
     summary: ESTRADA-LUNA A.A., DAVIES F.T. Jr., EGILLA J.N., 2000 - Mycorrhizal fungi enhancement of growth and gas exchange of micropropagated guava plantlets (Psidium guajava L.) during ex vitro acclimatization and plant establishment. - Mycorrhiza, 10: 1-8. 162 GERDEMANN J.W., 1968 - Vesicular-arbuscular mycorrhiza and plant growth. The greatest number of new flushes/year was recorded in treatment plants inoculated with G.f. (10 g) + SSP (10 g), G.m.
    keywords: ab az; abcd; azospirillum; content; fungi; g.f; g.m; glomus; growth; plants; root; ssp; treatments
       cache: ahs-18402.pdf
  plain text: ahs-18402.txt

        item: #155 of 594
          id: ahs-18406
      author: Asao, T.; Asaduzzaman, Md.; Mondal, F. Md.
       title: Horticultural Research in Japan. Production of vegetables and ornamentals in hydroponics, constraints and control measures
        date: 2014
       words: 10301
      flesch: 58
     summary: Hydroponic culture technique has the ability to trap and isolate the chemicals released through plant roots. It is inevitable that reduced K supply will inhibit plant growth and yield.
    keywords: acid; asao; asao et; autotoxicity; crop; cucumber; culture; effects; et al; exudates; fruit; growth; hydroponics; nutrient; plants; production; root; sci; soil; solution; yield
       cache: ahs-18406.pdf
  plain text: ahs-18406.txt

        item: #156 of 594
          id: ahs-18407
      author: Shibuya, T.; Kanayama, Y.
       title: Flowering response to blue light and its molecular mechanisms in Arabidopsis and horticultural plants
        date: 2014
       words: 4007
      flesch: 58
     summary: ZTL and LKP2, belong- ing to the LOV domain of blue light receptors contain- ing FKF1, are required for suppressing the degradation of CIB1 protein by blue light (Liu et al., 2013 a). How- ever, studies have not focused on the effects of blue light on flowering; blue light could also be important in timing of flowering.
    keywords: arabidopsis; day; et al; expression; flowering; light; plant
       cache: ahs-18407.pdf
  plain text: ahs-18407.txt

        item: #157 of 594
          id: ahs-18408
      author: Adam, A.; Idris, I.; Ayyoubi, Z.
       title: In vitro Pseudomonas putida BTP1-induced systemic resistance in grapevine rootstocks against Phylloxera (Daktulosphaira vitifoliae)
        date: 2013
       words: 4401
      flesch: 59
     summary: In vitro culture of grapevine plants For in vitro culture of grapevine plants, we used a proto- col described by Makee et al. (2010). BTP1 impacted negatively on the ability of phylloxera to develop, indicating an increase in grapevine resistance and tolerance toward this pest in bacteria-treated plants.
    keywords: b41; btp1; et al; grapevine; phylloxera; plants; putida; resistance; rootstocks; ru140
       cache: ahs-18408.pdf
  plain text: ahs-18408.txt

        item: #158 of 594
          id: ahs-18409
      author: Hosseini, H.R.; Chehrazi, M.; Dehkourdi, E.H.; Hosseini, M.
       title: Application of anatase nanoparticles (TiO2) on strawberry seed germination (Fragaria ananassa L.)
        date: 2013
       words: 2403
      flesch: 59
     summary: On the other hand, Lin and Xing (2007) studied the positive effects of suspensions of nanoparticles on seed germination and root growth of six different crop species Limited studies have been done on the effects of nanoparticles on crops and thus, we decided to investigate the phytotoxicity or positive effects of different concen- trations of nano-TiO 2 on seed germination and seedling growth of strawberry.
    keywords: anatase; effect; germination; growth; length; nano; seed; strawberry
       cache: ahs-18409.pdf
  plain text: ahs-18409.txt

        item: #159 of 594
          id: ahs-18410
      author: Vazquez, A.; Sanchez, E.; van Baren, C.; Frezza, D.
       title: Agronomic performance and essential oil composition of Ocimum basilicum L.: Effect of genotype and date of harvest
        date: 2013
       words: 8736
      flesch: 72
     summary: Key words: green basil, purple basil, soilless culture, volatile oils, yield. The data from the present study contrast with a crop 168 grown in optimum season, as reported by some authors for green basil with values between 64.44 and 110.33 g.plant-1 (Benito and Chiesa, 2000; Carrasco et al., 2007) and fresh weights of 57.84 g.plant-1 and 41.50 g.plant-1 for purple basil (Krizaj, 2010).
    keywords: e l; e r; g e; g f; g h; g r; h r; n t; p e; p g; r c; t e; w e; w t
       cache: ahs-18410.pdf
  plain text: ahs-18410.txt

        item: #160 of 594
          id: ahs-18411
      author: Wani, R.A.; Sheema, S.; Malik, T.H.; Geelani, S.; Bashir, S.; Dar, N.A.; Prasad, V.M.
       title: Impact of integrated nutrient management on growth, yield and quality of strawberry (Fragaria x annanassa Duch.) cultivation in India
        date: 2013
       words: 3143
      flesch: 53
     summary: Also fruit yield per plant was highest (482.6 g/plant=26.81 tons/ha) with treat- ment T 4 and lowest with treatment T 5 (351.5 g/plant=19.55 149 tons/ha); treatment T 4 showed 37.14% superiority over treatment T 5 in fruit yield tons/ha. Treatment T 4 produced 2.5 mean flower buds/plant more than T 1 (control) whereas in the number of fruits/plant, treatment T 4 produced 5.75 aver- age number of fruits more than treatment T 1 with greater length/diameter ratio of 1.43, compared to 1.25 for treat- ment T 1 .
    keywords: fertilizers; fruits; india; management; nutrient; plant; strawberry; treatment; yield
       cache: ahs-18411.pdf
  plain text: ahs-18411.txt

        item: #161 of 594
          id: ahs-18412
      author: Corbino, G.B.; Sánchez, G.; González, J.; Murray, R.E.; Gabilondo, J.; Valentini, G.H.; Arroyo, L.E.
       title: Pre and post-harvest management affects functional quality of peach (Prunus persica L.) cv. Flavorcrest
        date: 2013
       words: 4601
      flesch: 59
     summary: Fruit phenolic compounds are relevant in terms of qual- ity, as they have a role in visual appearance (pigmentation and browning), taste (astringency), and health-promoting properties (free-radical scavengers) Treatment without fertilization produced the highest antioxidant capacity in fruit flesh while the fruit skin showed no significant differences between treatments.
    keywords: antioxidant; capacity; flesh; fruit; heat; phenolic; total; treatments
       cache: ahs-18412.pdf
  plain text: ahs-18412.txt

        item: #162 of 594
          id: ahs-18414
      author: Ahmad, M.S.; Thakur, K.S.; Siddiqui, M.W.
       title: Postharvest treatments for preserving quality of ‘Kinnow’ fruit under different storage conditions
        date: 2013
       words: 5621
      flesch: 63
     summary: Among the fruits kept at ambient tem- perature, the highest mean TSS contents (14.04°B) were re- corded in T 11 (control), whereas the lowest mean TSS con- tents (12.84°B) were found in treatment T 4 (100% Sta-Fresh 960), which was closely followed by T 10 and T 5 , respective- ly. Maximum juice contents (43.51%) were recorded in treatment T 10 followed by T 5 and T 4 , in comparison to the control fruits which yielded only 40.05 percent at 60 days storage.
    keywords: conditions; fruits; kinnow; storage; temperature; treatments
       cache: ahs-18414.pdf
  plain text: ahs-18414.txt

        item: #163 of 594
          id: ahs-18415
      author: Javanmardi, J.; Rahemi, M.; Nasirzadeh, M.
       title: Post-storage quality and physiological responses of tomato fruits treated with polyamines
        date: 2013
       words: 6893
      flesch: 60
     summary: An experiment was arranged to study the effects of exogenous PA application Post-storage quality and physiological responses of tomato fruits treated with polyamines J. Javanmardi(1), M. Rahemi, M. Nasirzadeh Department of Horticultural Sciences, College of Agriculture, Shiraz University, Shiraz, Iran. Sci., 2013 27(4): 173-181 (1) Corresponding author: javanm@shirazu.ac.ir Received for publication 4 January 2014 Accepted for publication 7 March 2014 174 on the level of chilling injury, ripening, shelf life and some quality factors of tomato fruit (as a model plant) after a pe- riod of low temperature storage.
    keywords: chilling; days; fruit; injury; spd; storage; table; temperature; tomato
       cache: ahs-18415.pdf
  plain text: ahs-18415.txt

        item: #164 of 594
          id: ahs-18417
      author: Ferrini, F.
       title: Book review
        date: 2013
       words: 446
      flesch: 59
     summary: The author of this interesting volume has, for some time, worked with historic gardens in Germany and has asked the important question of how to define professional, sustainable and lasting care of historic gardens and how to put it into practice. Michael Rohde, director of the garden of the Prussion Castles and Parks of Berlin-Brandenburg Foundation, to- gether with a team of four other authors, has created an important base not only for under- standing historic gardens but also for future research about caring for and preserving them.
    keywords: care; gardens
       cache: ahs-18417.pdf
  plain text: ahs-18417.txt

        item: #165 of 594
          id: ahs-18418
      author: Tempesta, G.
       title: System application and the availability of vine germplasm
        date: 2013
       words: 383
      flesch: 51
     summary: While they are linked to tradition, innovation is necessary to respond to new lifestyles and preferences that reward typologies that are often based on new varietal ranges and clones. However, the economic commitment necessary to sustain public research bodies in their quest for new genetic material is hard to come by and the spread of already available initial and basic material is not always optimal.
    keywords: vine
       cache: ahs-18418.pdf
  plain text: ahs-18418.txt

        item: #166 of 594
          id: ahs-18420
      author: Bandinelli, R.; Pagano, M.
       title: The evolution of clonal heritage registry available at TOS.CO.VIT.
        date: 2013
       words: 753
      flesch: 46
     summary: Public interest in the genetic material obtained from clonal selection activities stimulated the creation (on 24th March 1977) of a center for premultiplication of grapevine material, thanks to an agreement signed between the Region of Tus- cany and the University of Pisa. The Council Directive 68/193/EEC of 9 April 1968 (concerning the marketing of material for vegetative propagation of vines) and subsequently the Presidential Decree of 24 December 1969 (n.1164) entitled “production and marketing of vine pre-multiplication material” gave a positive impulse to promote clonal selection activity.
    keywords: material; selection; tuscany
       cache: ahs-18420.pdf
  plain text: ahs-18420.txt

        item: #167 of 594
          id: ahs-18421
      author: Storchi, P.; Giannetti, F.; Valentini, P.; Bazzo, I.; Angelini, E.
       title: Sanitary and agronomic selection of Tuscan germplasm to improve wine production
        date: 2013
       words: 665
      flesch: 53
     summary: Still other clones will be ready soon for application to the Ministry of Agriculture once agronomic observations and sanitary checks are complete. Since the protocol for the selection of a clone demands a long period of time, one of the next objectives will be to re- duce the time needed to secure clone registration in the National Catalogue.
    keywords: selection
       cache: ahs-18421.pdf
  plain text: ahs-18421.txt

        item: #168 of 594
          id: ahs-18425
      author: Mannini, F.; Nervo, L.
       title: Innovative techniques for pre-multiplication of grapevine clones: the CE.PRE.MA.VI. experience
        date: 2013
       words: 519
      flesch: 57
     summary: untitled 99 Innovative techniques for pre-multiplication of grapevine clones: the CE.PRE.MA.VI. experience F. Mannini*, L. Nervo** * Istituto di Virologia Vegetale, CNR Unità di Grugliasco, Via Leonardo da Vinci 44, 10095, Grugliasco (TO), f.mannini@ivv.cnr.it. The “initial material” collected from the primary sources is then used to establish mother plant vineyards (MPV) suitable for the production of ‘basic’ material.
    keywords: material; phytoplasma
       cache: ahs-18425.pdf
  plain text: ahs-18425.txt

        item: #169 of 594
          id: ahs-18426
      author: Malossini, U.; Gretter, L.
       title: Preservation and premultiplication of selected grape material in Trentino: collaboration between FEM- S. Michele all’Adige and Trentino Grape-Nurseries AVIT-Consortium
        date: 2013
       words: 630
      flesch: 45
     summary: 1.5 hectares of vineyards, obtained with FEM selections but commercially classified in the “standard” category, is also under FEM control. All the operations are carefully recorded as required for genuine traceability of nursery materials and as a guarantee in the subsequent stages of propagation.
    keywords: avit; fem; material
       cache: ahs-18426.pdf
  plain text: ahs-18426.txt

        item: #170 of 594
          id: ahs-18427
      author: Dallavalle, E.; Triolo, E.
       title: Propagation of endangered grapevine cultivars: some reasons to recover and protect this patrimony
        date: 2013
       words: 475
      flesch: 51
     summary: These are not singular examples of the use of old vines from the pre-phylloxera period. In addition, another interesting application for old grapevines may derive from their use as ornamental plants, as suggested by some examples within the monastery of S. Maria Maddalena in Bologna or in the Olivetani cloister of the church of S. Maria in Regola in Imola.
    keywords: plants; vines
       cache: ahs-18427.pdf
  plain text: ahs-18427.txt

        item: #171 of 594
          id: ahs-18428
      author: Ferroni, G.; Scalabrelli, G.; Di Collalto, G.
       title: Characteristics of recent released clones selected by DiSAAA-A in Tuscan Coast line premultiplied by TOS.CO.VIT
        date: 2013
       words: 1293
      flesch: 61
     summary: Straw yellow wine, good structure, floral and fruity, palatable, sapid, with slightly bitter final, suitable for short aging. Straw yellow wine with notes of ripe fruit, citrus and spicy Mediterranean (very pronounced).
    keywords: average; bud; medium; population
       cache: ahs-18428.pdf
  plain text: ahs-18428.txt

        item: #172 of 594
          id: ahs-18429
      author: Bornice, M.; Ferroni, G.; Scalabrelli, G.
       title: Updated knowledge of the vine rootstocks
        date: 2013
       words: 653
      flesch: 55
     summary: Currently, in Italy there are 39 varieties of vine rootstock recognized on the National Register of Grapevine Varieties (agg. In fact, we need of new rootstocks able to adapt to environmental stresses caused by climate change in progress (mainly droughts and changes in the distribution of rainfall) and/or linked to new growing environments which have restricting factors for the vines.
    keywords: rootstocks; scalabrelli
       cache: ahs-18429.pdf
  plain text: ahs-18429.txt

        item: #173 of 594
          id: ahs-18430
      author: Navacchi, O.; Zuccarelli, G.
       title: Micropropagation in viticulture: twenty years of experience
        date: 2013
       words: 746
      flesch: 45
     summary: With careful attention to the selection of soil for mother plant fields and suitable preventative measures, it is possible to keep this pathogen under control. Today it is increasingly difficult to keep mother plants healthy in open fields and a reduction of their useful period with frequent renewal can be predicted for the future.
    keywords: juvenile; plants
       cache: ahs-18430.pdf
  plain text: ahs-18430.txt

        item: #174 of 594
          id: ahs-18431
      author: D'Onofrio, C.
       title: State of the art in grapevine variety and clone identification through polymorphism in DNA molecular markers
        date: 2013
       words: 742
      flesch: 32
     summary: In this context, as a support for the classic methods of varietal identification through morphological characters, DNA molecular markers are of fundamental importance. DNA molecular markers seem more stable, making it possible to combine AFLP with other markers such as SAMPL (Selective Amplification of Microsatellite Polymorfic Loci), M-AFLP (microsatellites amplified fragment length poly- morphism) and S-SAP (Sequenze-Specific Amplification Polymorfism).
    keywords: clones; identification
       cache: ahs-18431.pdf
  plain text: ahs-18431.txt

        item: #175 of 594
          id: ahs-18433
      author: Faggioli, F.; Anaclerio, F.; Angelini, E.; Antonelli, M.G.; Bertazzon, N.; Bianchi, G.; Bianchedi, P.; Bianco, P.A.; Botti, S.; Bragagna, P.; Cardoni, M.; Casati, P.; Credi, R.; De Luca, E.; Durante, G.; Gianinazzi, G.; Gambino, G.; Gualandri, V.; Luison, D.; Luvisi, A.; Malossini, U.; Mannini, F.; Saldarelli, P.; Terlizzi, F.; Triolo, E.; Trisciuzzi, N.; Barba, M.
       title: Harmonization and validation of diagnostic protocols for the detection of grapevine viruses covered by phytosanitary rules
        date: 2013
       words: 1057
      flesch: 41
     summary: 100/100/96% 83/58/89% 10-1 98% 82% GVB Multiplex 100% 100% 100% 10-2 100% 100% ELISA – A/B/S 86/nt/nt% 100% 92% 100 (2-2) 100% 85% GLRaV 1 Multiplex 74 % 100 % 94 % 10-2 100% 70 % ELISA – A/B/S 89/94/96% 100% 93/96/98% 10-2 100% 92% GLRaV 2 Multiplex 84% 98% 85% 10-2 95% 83% ELISA – A/B/S 86/67/87% 100% 93/96/98% 100 (2-2) 93% 84% GLRaV 3 Multiplex 100 % 93 % 95 % 10-3 100% 100 % ELISA – A/B/S 81/90/97% 100% 84/92/97% 10-3 100% 94% A= Agritest; B= Bioreba; S= Sediag. A/B/S 90/90/30% 100% 92/92/46% 10-1 98% 88% GVA Multiplex 96 % 99 % 98 % 10-2 100% 94 % ELISA – A/B/S 77/45/87%
    keywords: elisa; grapevine; italy; multiplex
       cache: ahs-18433.pdf
  plain text: ahs-18433.txt

        item: #176 of 594
          id: ahs-18434
      author: Lucchetta, G.; Bevilacqua, G.; Colla, C.; Di Marco, S.; Falconi, R.; Frausin, C.; Mirandola, R.; Mordenti, G.; Sartori, E.; Angelini, E.
       title: Prevention and control strategies against Agrobacterium vitis in grapevine multiplication material
        date: 2013
       words: 497
      flesch: 48
     summary: Hot water treatments, unfortunately, are completely ineffective in obtaining bacterium-free rootlings (Lucchetta et al., 2013), while initial analyses of soils and mother plants in the Verona area have been encouraging; cleaning trials with acidic water and Virkon need further study. Agrobacterium vitis is the etiological agent of grapevine crown gall disease, an abnormal tissue growth occurring mostly in the basal part of the trunk.
    keywords: vitis
       cache: ahs-18434.pdf
  plain text: ahs-18434.txt

        item: #177 of 594
          id: ahs-18435
      author: Luvisi, A.
       title: How information technology can support regulations and best practices for the management of health status of grapevine and product safety
        date: 2013
       words: 1206
      flesch: 42
     summary: With regards to food plants, the implementation of IT solutions to trace the plant-to-food chain seems to be possible only in fruit trees, including grapevine, due to the difficulties in labeling and/or tracking herbaceous plants. This link is promoted by the European Food Safety Authority (EFSA), the agency that provides scientific advice and communication on existing and emerging risks associated with the food chain and the Authority’s work covers all matters with a direct or indirect impact on food safety, including plant protection and plant health as included in the general objective and mission of the EFSA.
    keywords: food; health; management; plant; technology
       cache: ahs-18435.pdf
  plain text: ahs-18435.txt

        item: #178 of 594
          id: ahs-18436
      author: Mannini, F.; Gribaudo, I.
       title: RFID microchips as a tool for traceability in grapevine nurseries: pre- and post-grafting implants
        date: 2013
       words: 464
      flesch: 50
     summary: propaga- tion materials: grafted cuttings (a) and grafted rootlings (b), subjected or not to hot water treatment (50 °C for 45 min). In grapevine nurseries, the storage of data in a field log is an essential step in the plant production process.
    keywords: grapevine; microchips
       cache: ahs-18436.pdf
  plain text: ahs-18436.txt

        item: #179 of 594
          id: ahs-18437
      author: Scalabrelli, G.; Toffanin, A.
       title: Competitiveness of the wine sector: considerations on future scenarios
        date: 2013
       words: 1420
      flesch: 42
     summary: What is certain is that enlargement of the European Community to the East and the lack of restrictions on the spread of viticulture in new emerging countries (Latin America, South Africa and Oceania), will pose competition problems on traditionally wine countries such as Italy and France which will fight fiercely to defend the current position revenue linked to the prestige of wine-growing areas. For productive diversification, there is currently a clear differentiation between traditional varieties and the advent of new varieties obtained by genetic improvements.
    keywords: research; scalabrelli; wine
       cache: ahs-18437.pdf
  plain text: ahs-18437.txt

        item: #180 of 594
          id: ahs-18438
      author: Caruso, G.; Carputo, D.; Conti, S.; Borrelli, C.; Maddaluno, P.; Frusciante, L.
       title: Effect of mulching and plant density on out-of-season organic potato growth, yield and quality
        date: 2013
       words: 5221
      flesch: 61
     summary: As a quality indicator of potato tubers, the dry residue was not significantly affected by mulching or by plant density (Table 4). These contrasting results suggest that the actual ascorbate content of potato tubers may result from an interaction of multiple factors.
    keywords: autumn; crop; density; mulching; plant; potato; production; seed; summer; tubers; yield
       cache: ahs-18438.pdf
  plain text: ahs-18438.txt

        item: #181 of 594
          id: ahs-18439
      author: Javanmardi, J.; Emami, S.
       title: Application of sucrose on tomato seedlings improves transplant quality, crop establishment, cold and dark hardiness
        date: 2013
       words: 3269
      flesch: 61
     summary: The present study was undertaken to investigate effects of su- crose application on tomato transplants, as a commercially important vegetable established from transplants, and evalu- ate effects on increasing chilling resistance and other traits under field conditions. SMITH P.G., ZINK F.W., 1951 - Effect of sucrose foliage sprays on tomato transplants.
    keywords: application; field; leaf; production; quality; root; seedlings; storage; sucrose; survival; tomato; transplant
       cache: ahs-18439.pdf
  plain text: ahs-18439.txt

        item: #182 of 594
          id: ahs-18440
      author: Hikosaka, Y.; Kanechi, M.; Uno, Y.
       title: A novel aeroponic technique using dry-fog spray fertigation to grow leaf lettuce (Lactuca sativa L. var. crispa) with water-saving hydroponics
        date: 2014
       words: 3902
      flesch: 58
     summary: Furthermore, root growth in most vegetable crops is expected to increase under the aerobic conditions of the rhizosphere environment because there is no solid phase and less liquid phase com- pared to the physical composition of soil or any other rooting media (Hillel and David, 1988; Cherif et al., 1997). For dry-fog culture, root growth was encouraged and root hair significantly developed to catch the foggy nutrient solution efficiently.
    keywords: culture; dry; fog; growth; hydroponic; leaves; nutrient; roots; water; weeks
       cache: ahs-18440.pdf
  plain text: ahs-18440.txt

        item: #183 of 594
          id: ahs-18441
      author: Pompeiano, A.; Volterrani, M.; Guglielminetti, L.
       title: Physiological responses of C4 grasses to prolonged heat stress
        date: 2013
       words: 4503
      flesch: 54
     summary: C 4 grasses are best adapted to the transition, warm-arid, and warm-humid climatic zones and usually have the ability to acquire thermotol- erance by exposure to acute heat stresses (DiPaola and Beard, 1992). Abstract: C4 grasses are best adapted to the transition, warm-arid, and warm-humid climatic zones and have the ability to acquire thermotolerance by exposure to acute heat stress.
    keywords: bermudagrass; control; differences; exposure; heat; plant; species; stress; temperature; zoysiagrass
       cache: ahs-18441.pdf
  plain text: ahs-18441.txt

        item: #184 of 594
          id: ahs-18442
      author: Hoyo, Y.; Fujiwara, K.; Hoshino, Y.
       title: Effects of different wavelengths of LED light on pollen germination and direction of pollen tube elongation in Cyrtanthus mackenii
        date: 2014
       words: 3187
      flesch: 58
     summary: Pollen tube elongation is of one of the fastest grow- ing plant cell types. In vitro, the effects of light wavelength on pollen ger- mination or pollen tube elongation have been studied in Pinus roxburghii (Dhawan and Malik, 1981): pollen tube growth decreased in white light compared to the dark, and increased in red light, although this was counteracted by far red light.
    keywords: direction; elongation; germination; light; pollen; pollen tube; tube
       cache: ahs-18442.pdf
  plain text: ahs-18442.txt

        item: #185 of 594
          id: ahs-18443
      author: none
       title: Book reviews
        date: 2013
       words: 1138
      flesch: 58
     summary: As explained on the back cover of the book: “the term medicinal plants defines a large group of plant species that have been used in pharmaceutical laboratories, but in a broader sense also includes plants for aromas, cosmetics, dyes, biocides and other agricultural purposes”. The various contributions - in English and in French - that make up the volume are enriched with images from the period that have been carefully assembled by highly re- garded international experts in the field of landscape history, stimulating the debate sur- rounding the concept of scared landscapes.
    keywords: book; field; volume
       cache: ahs-18443.pdf
  plain text: ahs-18443.txt

        item: #186 of 594
          id: ahs-18445
      author: Viti, R.; Bartolini, S.; Andreini, L.
       title: Apricot flower bud dormancy: main morphological, anatomical and physiological features related to winter climate influence
        date: 2013
       words: 10544
      flesch: 56
     summary: Key words: budbreak, climate, endodormancy process, Prunus armeniaca L. Abstract: This review examines recent advances regarding flower bud dormancy in apricot, focusing on biological, ana- tomical, and physiological processes which occur during the induction and depth of dormancy. Bud dormancy starts with the perception by the plant of rest-signals under the influence of short and cool days; this process finishes after an accumulation of chill- ing temperatures.
    keywords: acta; apricot; bartolini; bud; buds; changes; chilling; cultivars; development; dormancy; endodormancy; et al; flower; growth; horticulturae; peach; plant; prunus; release; stage; temperatures; viti; winter
       cache: ahs-18445.pdf
  plain text: ahs-18445.txt

        item: #187 of 594
          id: ahs-18447
      author: Qrunfleh, I.M.; Read, P.E.
       title: Delaying bud break in ‘Edelweiss’ grapevines to avoid spring frost injury by NAA and vegetable oil applications
        date: 2013
       words: 5060
      flesch: 68
     summary: Delaying bud break is an approach to avoid spring frost damage. Sci., 37: 653-654. NIGOND J., 1960 - Delaying bud break in vines by the use of α-naphthaleneacetic acid and defense against frost. - Compt.
    keywords: break; bud; clusters; naa; number; oil; pruning; table; treatment
       cache: ahs-18447.pdf
  plain text: ahs-18447.txt

        item: #188 of 594
          id: ahs-18448
      author: Takemura, Y.; Tamura, F.
       title: Bud dormancy in Japanese pear
        date: 2013
       words: 5533
      flesch: 67
     summary: Table 3 - Chilling requirement for breaking leaf bud endodormancy in Pyrus plants evaluated by the seasonal changes in percent leaf budbreak (Takemura et al., 2013) As a result in the experi- ment, it was cleared that temperature of 5oC was effective for inducing bud endodormancy in the cuttings, whereas a temperature of 15oC was ineffective (Fig. 2) (Takemura et al., 2011).
    keywords: breaking; bud; budbreak; buds; chilling; days; endodormancy; et al; hort; induction; japanese; pear; plant; sci
       cache: ahs-18448.pdf
  plain text: ahs-18448.txt

        item: #189 of 594
          id: ahs-18449
      author: Bonhomme, M.; Lacointe, A.; Rageau, R.
       title: Evidence for non-occurrence of node-to-node or stem-to-bud transfer of chilling temperature signal for dormancy release
        date: 2013
       words: 7830
      flesch: 62
     summary: The local response permits analysis of the intra-canopy heterogeneity of bud break and the possible relationship between bud status and intra-canopy heterogeneity of bud temperature. Surprisingly, to date no experimental study at bud level has used chilling tem- perature, although it is undoubtedly the main natural factor driving bud endodormancy release at bud level.
    keywords: break; bud; buds; chilling; endodormancy; experiment; low; node; pcu; release; signal; temperature; treatment; trees
       cache: ahs-18449.pdf
  plain text: ahs-18449.txt

        item: #190 of 594
          id: ahs-18450
      author: Fracchiolla, M.; Caramia, D.; Lasorella, C.; Montemurro, P.
       title: Ground cover management strategies in an Apulian oil-producing olive grove: agronomic and ecological assessment proposals
        date: 2013
       words: 8585
      flesch: 58
     summary: X X X X X X X X Briza maxima L. + Bromus sterilis L. X X X X X X X X X X X X Calendula arvensis L. X X X X X X X X Capsella bursa-pastoris (L.) Medicus X X X X X Catapodium rigidum (L.) Hubbard + + + + Cerinthe major L. + Chrysanthemum segetum L. X X X X X X X X X X X X Convolvulus arvensis L. X X X X X X Conyza canadensis (L.) Cronq. + + + + Geranium molle L. + + + + + Heliotropium erupaeum L. X X X X X X X X Hippocrepis unisiliquosa L. + Hordeum murinum L. X X X X X X X X X X X X Lactuca serriola L. + Lamium purpureum L. X Lolium rigidum Gaudin X X X X X X X X X X X X Lotus ornithopodioides L. + + Malva sylvestris L. X X X X X X X X X X X X Medicago hispida Gaertner X X X X X X X X X X X X Melilotus indica (L.) All.
    keywords: cover; crop; flora; ground; management; olive; plots; species; table; treatment; tri; values; weed; year
       cache: ahs-18450.pdf
  plain text: ahs-18450.txt

        item: #191 of 594
          id: ahs-18451
      author: Khuder, A.; Ahmad, M.; Hasan, R.; Saour, G.
       title: Trace and minor elements in bee honeys produced in Syria
        date: 2013
       words: 5577
      flesch: 70
     summary: Zn Cu Rb Mn Cr Sr Ni Ti Ca K 0 30 60 90 120 Li nk ag e di st an ce Fig. 4 - Dendrogram of 11 analyzed elements in different types of honey samples (root square of dat treated by the linkage method with Euclidean distance as measure of similarity) AZEREDO L., DA C., AZEREDO M.A.A., DE SOUZA S.R., DUTRA V.M.L., 2003 - Protein contents and physicochemi- 60 cal properties in honey samples of Apis mellifera of different floral origins.
    keywords: ag e; e di; honey; li nk; nk ag
       cache: ahs-18451.pdf
  plain text: ahs-18451.txt

        item: #192 of 594
          id: ahs-18452
      author: Kumar, A.; Sharma, N.
       title: Protandrous-protogynous dimorphism in indigenous selections from North Western India and some exotic cultivars of Persian walnut (Juglans regia L.)
        date: 2013
       words: 2710
      flesch: 63
     summary: Although Juglans regia cultivars are self fertile, but low yields in walnut is a cause of concern which is mainly attributed to inadequate pollination resulting from pistil- late flower abscission (PFA) and adverse climatic con- ditions during pollen shedding and stigma receptivity. Solding Selection, Gobind, ACO 38853 Solding Selection Plant No. 32, KX Giant Luxmi Akhrot Plant No. 32, Solding Selection, KX Giant, ACO 38853
    keywords: akhrot; cultivars; dichogamy; plant; protandrous; walnut; year
       cache: ahs-18452.pdf
  plain text: ahs-18452.txt

        item: #193 of 594
          id: ahs-18453
      author: Adekpe, D.I.; Shebayan, J.A.Y.; Shinggu, C.P.; Aliyu, L.
       title: Screening of herbicides for weed control, growth and yield of irrigated onion (Allium cepa L.) in tropical Savanna climate
        date: 2013
       words: 4596
      flesch: 56
     summary: Weed interference was observed to be more devastating than insect (Thrips tabaci) infesta- tions on onion dry bulb yield (Ghosheh and Al-Shannag, 2000). Weed dry weight The untreated control had significantly (P≤M0.05) higher weed dry weight than all the other treatments ex- cept for oxadiazon at 4 and 6 l/ha in 2006/2007 and for the combined mean (Table 4).
    keywords: bulb; control; fbshw; hoe; weed
       cache: ahs-18453.pdf
  plain text: ahs-18453.txt

        item: #194 of 594
          id: ahs-18454
      author: De Moraes, M.R.; Daiuto, É.R.; Vietes, R.L.; Cardoso, N.C.; Smith, R.E.
       title: Effect of active modified atmospheres on the quality of non-astringent persimmons (Caqui Giombo) D. kaki Thunb. when stored under refrigerated conditions
        date: 2013
       words: 5842
      flesch: 65
     summary: This is in agreement with data reported by Chitarra and Chitarra (2005) who reported that the change in color is associated with ripening, which is a standard attribute for determining fruit quality. On the other hand, the Brazilian caqui cultivar called ‘Giombo’ is very productive and matures late, with fruits being picked from March to the end of May (Martins and Pereira, 1989).
    keywords: 4%o; astringent; atmospheres; averages; days; et al; fruits; giombo; persimmons; storage; tannins
       cache: ahs-18454.pdf
  plain text: ahs-18454.txt

        item: #195 of 594
          id: ahs-18455
      author: Salehi, M.R.; Salehi, H.
       title: Comparison of tall fescue (Festuca arundinacea Schreb.) and common bermudagrass (Cynodon dactylon [L.] Pers.) turfgrasses and their seed mixtures
        date: 2013
       words: 4927
      flesch: 67
     summary: Total fresh and dry weight Maximum total weights were found among treatments composed of higher percentages of tall fescue seeds; with Table 5 - Effects of different seed mixtures and sowing times on some biological characteristics of the turfgrasses used Sowing season Treatment number Total dry weight (g) Chloropyll index after winter** Chlorophyll index after summer** Visual quality after summer Visual quality after winter Spring 1 29.53 cd* 2.10 cd 9.38 ab 8.25 ab 8.00 a-d 2 29.99 cd 2.07 cd 9.41 a 7.75 a-d 7.75 a-e 3 28.40 de 2.07 cd 9.47 a 8.37 ab 8.12 a-d 4 31.99 bcd 2.28 abc 9.05 b 8.37 ab 8.12 a-d 5 31.89 bcd 1.94 def 8.60 c 8.87 a 8.37 abc 6 25.35 ef 1.74 fg 8.27 cde 8.37 ab 7.00 b-f 7 22.64 fg 1.41 h 8.00 ef 8.00 ab 6.37 def 8 20.97 gh 1.07 i 7.79 fg 7.12 b-e 6.00 efg 9 17.67 hi 0.74 j 7.54 gh 6.62 cde 5.25 fg 10 12.73 hi 0.45 k 7.29 hij 7.12 b-e 2.87 hi 11 10.19 kl 0.09 l 7.04 j 7.75 a-d 0.00 k 12 17.90 hi 1.61 gh 8.19 de 8.62 a 8.87 a Average 23.27 A 1.47 B 8.34 A 7.93 A 6.39 A Fall 1 35.17 ab 2.24 bc 9.32 ab 8.50 a 8.37 abc 2 34.74 ab 2.47 a 9.36 ab 8.50 a 8.50 abc 3 36.12 a 2.37 ab 9.30 ab 8.87 a 8.75 ab 4 32.84 abc 2.32 ab 8.60 c 8.50 a 8.12 a-d 5 29.84 cd 2.00 de 8.41 cd 7.87 abc 7.87 a-d 6 20.74 gh 1.79 efg 8.06 def 6.25 ef 6.75 c-f 7 19.20 ghi 1.52 h 7.83 fg 5.87 efg 5.37 fg 8 15.38 ij 1.05 i 7.53 gh 5.00 fgh 4.50 gh 9 10.39 kl 0.84 j 7.39 hi 4.87 gh 1.87 ij 10 8.34 l 0.35 k 7.16 ij 4.37 h 1.00 jk 11 7.38 l 0.03 l 6.54 k 6.50 de 0.00 k 12 20.03 gh 1.82 ef 8.22 de 8.78 a 9.00 a Average 22.51 B 1.57 A 8.14 B 6.99 B 5.84 B * Introduction There are four main methods to establish turfgrasses from seeds: monoculture, seed blend, seed mixture and overseeding.
    keywords: bermudagrass; fall; fescue; root; seed; sowing; spring; weight
       cache: ahs-18455.pdf
  plain text: ahs-18455.txt

        item: #196 of 594
          id: ahs-18456
      author: none
       title: Book reviews
        date: 2013
       words: 640
      flesch: 63
     summary: In this 35th volume in the “Giardini e Paesaggio” series Maria Chiara Zerbi, in her pre- sentation, underlines that the book is the result of many years of enthusiastic work and that through it the reader can appreciate these “architecturally secret places that were found in what were once private gardens but are now part of public lands, neglected and in need of restoratotion and consolidation to restore the original quality”. Breda M.A. Giardini e Paesaggio, Vol. 35.
    keywords: book; work
       cache: ahs-18456.pdf
  plain text: ahs-18456.txt

        item: #197 of 594
          id: ahs-18458
      author: Watanabe, S.; Matsubara, Y.-I.
       title: Cross-protection against anthracnose with heat stress, antioxidative changes and proteomic analysis in mycorrhizal cyclamen
        date: 2014
       words: 4959
      flesch: 59
     summary: In this experiment, mycorrhizal cyclamen plants also showed resistance to anthracnose even under the shock heat stress condition. Additionally, several investiga- tors have reported a higher resistance of mycorrhizal plants to biotic and abiotic stresses (Garmendia et al., 2006 ; Wu et al., 2006; Li et al., 2010).
    keywords: activity; amf; anthracnose; cyclamen; heat; mycorrhizal; plants; shs; spots; stress
       cache: ahs-18458.pdf
  plain text: ahs-18458.txt

        item: #198 of 594
          id: ahs-18459
      author: Iwato, M.; Kosaza, M.; Takeuchi, Y.; Matsumoto, M.; Inada, M.; Ozaki, Y.; Okubo, H.
       title: Stem blight resistance of Asparagus kiusianus and its hybrid with A. officinalis
        date: 2014
       words: 3495
      flesch: 57
     summary: The resistance of interspecific hybrids between A. officinalis and A. kiusianus was mostly intermediate, but some individuals had strong resistance equivalent to A. kiusianus. The results suggest that it is possible to introduce the resistance of A. kiusianus to stem blight into A. officinalis through interspecific hybridization for further Asparagus breeding.
    keywords: asparagus; disease; hybrids; interspecific; kiusianus; officinalis; resistance; stem
       cache: ahs-18459.pdf
  plain text: ahs-18459.txt

        item: #199 of 594
          id: ahs-18460
      author: Shishido, M.
       title: Black root rot caused by Diaporthe sclerotioides threatens cucurbit cultivation in Japan
        date: 2014
       words: 4168
      flesch: 54
     summary: To control black root rot of cucurbits, solarization with a combination of soil fumigants such as chloropicrin has been widely applied in greenhouses, especially in warmer climate regions (Kobayashi et al., 1997). Because these pseudo-sclerotia are commonly observed on diseased roots as well, they are likely the primary in- ocula of black root rot of cucurbit crops.
    keywords: cucumber; disease; dna; et al; root; sclerotioides; shishido; soil; species
       cache: ahs-18460.pdf
  plain text: ahs-18460.txt

        item: #200 of 594
          id: ahs-18461
      author: Yamashita, H.; Mochioka, R.
       title: Wild grape germplasms in Japan
        date: 2014
       words: 5798
      flesch: 69
     summary: Nevertheless, the importance of wild grapes as genetic resource for grape breeding has gradually been recognized because some wild grapes show superior traits towards global warming in terms of sustainable berry pro- duction under hot and humid conditions. This paper describes the identification and classifica- tion of wild grapes native to Japan.
    keywords: ficifolia; grapes; japan; native; species; table; var; vitis; yamabudou
       cache: ahs-18461.pdf
  plain text: ahs-18461.txt

        item: #201 of 594
          id: ahs-18462
      author: Park, B.-J.; Ono, K.; Yoshinami, Y.; Miyazaki, Y.
       title: Physiological effects of orange essential oil inhalation in humans
        date: 2014
       words: 3150
      flesch: 57
     summary: The present paper reports an indoor experiment con- ducted in humans to determine the physiological effects of the odor of orange essential oil by measuring HRV, blood pressure, and pulse rate before and during inha- lation of orange essential oil and comparing the values with those obtained before and during inhalation of fresh air (control). Abstract: This study was conducted to clarify the physiological and psychological effects of the odor of orange essential oil in humans.
    keywords: air; effects; inhalation; odor; oil; orange
       cache: ahs-18462.pdf
  plain text: ahs-18462.txt

        item: #202 of 594
          id: ahs-18463
      author: Yuki, M.; Matsumoto, D.; Ikeda, K.; Taira, S.
       title: Effects of wound treatments to flower organs on fruit set, development, and quality in sweet cherry (Prunus avium L.)
        date: 2014
       words: 2646
      flesch: 64
     summary: Fruit development was observed by measuring fruit di- ameter twice per week from 29 May when fruit set was first established. 3 - The effects of wounding of flower organs on fruit development in ‘Satohnishiki’ sweet cherry.
    keywords: cherry; flower; fruit; organs; removal; wounding
       cache: ahs-18463.pdf
  plain text: ahs-18463.txt

        item: #203 of 594
          id: ahs-18464
      author: Nakamura, I.; Takahashi, H.; Sato, Y.-I.
       title: Diversity and breeding of flowering cherry in Japan
        date: 2014
       words: 4341
      flesch: 66
     summary: ‘Somei-yoshino’ (Iketani et al., 2006), comprises more than 80-90% of flowering cherry trees planted in parks, and along roads and rivers across Japan, except in Okinawa and Hokkaido Islands. These results suggest that flowering cherry trees around the Bell Tower were de- veloped by artificial hybridizations between Edohigan and Oshimazakura, and that there were sufficient genetic resources to develop ‘Somei-yoshino’ and ‘Komatsu- otome.’
    keywords: cherry; cultivars; edo; fig; flowering; japan; somei; species; trees; yoshino
       cache: ahs-18464.pdf
  plain text: ahs-18464.txt

        item: #204 of 594
          id: ahs-18465
      author: Yamamoto, Y.; Hoshino, Y.; Masago, H.; Kawano, Tomonori
       title: Attempt for postharvest ripening of immature fruits of Haskap (Lonicera caerulea L. var. emphyllocalyx Nakai), an emerging fruit in Northern Japan
        date: 2014
       words: 3655
      flesch: 55
     summary: It is conclusive that haskap berries can be harvested at premature stage if postharvest maturation was allowed during storage and/or transportation to the markets. The present study aims to contribute to the documenta- tion, designing a novel harvesting strategy based on the rip- ening physiology of haskap berries, which could be readily automated with minimal efforts.
    keywords: acid; berries; color; fig; haskap; japan; postharvest; samples; storage
       cache: ahs-18465.pdf
  plain text: ahs-18465.txt

        item: #205 of 594
          id: ahs-2933
      author: Sharma, G.; Sharma, N.
       title: Pollen characteristics, pollination behaviour and pollinizer compatibility of some exotic and indigenous almond [Prunus dulcis (Miller) D.A. Webb] genotypes
        date: 2013
       words: 7266
      flesch: 64
     summary: Likewise, the study of Drake styles revealed that pollen tubes reached the base after 72 hr of pollination with Merced and Waris whereas with other cultivars it reached after 96 hr. Overall, it generally took three to five days for pollen tubes to reach the base of the pistil in otherwise compatible pollination.
    keywords: almond; ati ble; ba se; ble co; co mp; fruit; mp ati; pollen; pollination; set
       cache: ahs-2933.pdf
  plain text: ahs-2933.txt

        item: #206 of 594
          id: ahs-2934
      author: Makee, H.; Tafesh, N.; Idris, I.
       title: Radiation-induced chromosomal aberrations in grape Phylloxera
        date: 2013
       words: 4455
      flesch: 55
     summary: To study the effect of different doses of gamma irra- diation on phylloxera chromosomes, 24 to 36-hr-old embryos were examined at each tested dose, and it was found that the chromosomes of all tested embryos of irradiated phylloxera had aberrations, regardless of dose. When low doses were applied, a small portion of irradiated nymphs successfully com- pleted development and produced matured females, survival which was due to the holokinetic nature of phylloxera chromosomes.
    keywords: chromosomes; dose; embryos; grape; irradiation; length; metaphase; nymphs; phylloxera
       cache: ahs-2934.pdf
  plain text: ahs-2934.txt

        item: #207 of 594
          id: ahs-2935
      author: Lenzi, A.; Baldi, A.; Tesi, R.
       title: Growing spinach in a floating system with different volumes of aerated or non-aerated nutrient solution
        date: 2013
       words: 3646
      flesch: 56
     summary: References ALBERICI A., QUATTRINI E., PENATI M., MARTINETTI L., GALLINA P.M., FERRANTE A., SCHIAVI M., 2008 - Effect of the reduction of nutrient solution concentration on leafy veg- etables quality grown in floating system. In the present work spinach was grown in sum- mer and autumn in a floating system in different volumes (252, 126 and 60 l per m2 of cultivated area) of aerat- ed or non aerated nutrient solution.
    keywords: nitrate; nutrient; oxygen; solution; summer; system; volume
       cache: ahs-2935.pdf
  plain text: ahs-2935.txt

        item: #208 of 594
          id: ahs-2936
      author: Goren, A.; Alkalia-Tuvia, S.; Perzelan, Y.; Aharon, Z.; Fallik, E.
       title: Photoselective shade nets reducing postharvest decay development in pepper fruits
        date: 2013
       words: 4256
      flesch: 61
     summary: Pepper cultivar ‘Romans’ grown in a semi arid region under 35% pearl and yellow shade nets significantly main- tained better pepper fruit quality after 16 days at 7°C plus three days at 20°C, mainly by reducing decay inci- dence during two consecutive years (2008 and 2009), compared to commercial black and red nets. Other studies have suggested differential effects of photoselective screens and shade nets on pest infes- tation and vector-borne viral diseases (Ben-Yakir et al., 2008).
    keywords: alternaria; fruit; light; nets; pearl; pepper; quality; red; shade; shade nets
       cache: ahs-2936.pdf
  plain text: ahs-2936.txt

        item: #209 of 594
          id: ahs-2937
      author: Dalal, R.P.S.; Thakur, A.
       title: Fibrous root distribution in Pineapple orange trees under semi- arid irrigated ecosystem
        date: 2013
       words: 4227
      flesch: 65
     summary: Even a single root- stock-scion combination may differ in root distribution with a change in climatic condition. Therefore depth of irriga- tion and placement of fertilizer based on root distribution should be rootstock specific and deep ploughing should be avoided.
    keywords: citrange; cleopatra; depth; distance; lemon; length; root; soil; troyer
       cache: ahs-2937.pdf
  plain text: ahs-2937.txt

        item: #210 of 594
          id: ahs-2938
      author: Masi, E.; Boselli, M.
       title: Foliar application of molybdenum: effects on yield quality of the grapevine Sangiovese (Vitis vinifera L.)
        date: 2013
       words: 4236
      flesch: 62
     summary: Mo treatment in early flowering; Mox3= Mo treatments in early flow- ering, early fruit set and early veraison. Mo treatment in early flowering; Mox3= Mo treat- ments in early flowering, early fruit set and early veraison.
    keywords: fig; fruit; harvest; molybdenum; mox3; nitrogen; plants; treatment; veraison; vines
       cache: ahs-2938.pdf
  plain text: ahs-2938.txt

        item: #211 of 594
          id: ahs-2939
      author: Benelli, C.; Previati, A.; De Carlo, A.; Lambardi, M.
       title: Shoot-tips vitrification protocol for red chicory (Cichorium intybus L.) lines
        date: 2013
       words: 5010
      flesch: 55
     summary: In order to choose the longest possible exposure time of shoot tips to the vitrifica- tion solution while avoiding toxic effects, shoot tips were exposed to PVS2 for 30, 60, 90 or 120 min and evaluated for shoot tip survival. This result high- lights the importance of incubation time with vitrifica- tion solution for shoot tip survival.
    keywords: chicory; chioggia; cryopreservation; medium; plant; pvs2; rosso; shoot; survival; tips; vitrification
       cache: ahs-2939.pdf
  plain text: ahs-2939.txt

        item: #212 of 594
          id: ahs-2940
      author: Ravi, V.; Ravindran, C.S.; Suja, G.; George, James; Nedunzhiyan, M.; Byju, G.; Naskar, S.K.
       title: Crop physiology of elephant foot yam (Amorphophallus paeoniifolius (Dennst. Nicolson)
        date: 2013
       words: 8964
      flesch: 69
     summary: However, N and K had significant interactive effects on corm growth (corm bulking rate), mean corm weight per plant and corm yield per ha and this appears to be mainly due to N (Mukhopadhayay and Sen, 1986). Plant growth and corm yield is influenced by the size of planting material (corms/cormels/corm pieces), plant spacing, nutrient management and water availability.
    keywords: amorphophallus; corm; corm yield; crops; elephant; et al; foot; growth; ha-1; planting; sen; size; yam; yield
       cache: ahs-2940.pdf
  plain text: ahs-2940.txt

        item: #213 of 594
          id: ahs-2941
      author: Kanwar, M.S.
       title: Performance of tomato under greenhouse and open field conditions in the trans-Himalayan region of India
        date: 2013
       words: 2501
      flesch: 66
     summary: 404.23 169.18 181.52 149.05 188.93 29.87 44.39 13.79 22.80 30.55 16.16 17.57 74.44 30.60 28.69 47.13 37.80 75.64 89.44 79.74 94.56 88.61 85.32 64.00 72.73 66.67 73.91 53.85 65.83 Genotype Table 4 - Percent improvement in tomato performance under polyhouse versus open conditions for economic characters trans-Himalyan Ladakh region for tomato cultivation. There- fore, tomato cultivation under protected conditions is advised for Ladakh growing conditions, employing specif- ic polyhouse-responsive varieties.
    keywords: conditions; field; polyhouse; tomato
       cache: ahs-2941.pdf
  plain text: ahs-2941.txt

        item: #214 of 594
          id: ahs-2942
      author: , 
       title: Book reviews
        date: 2013
       words: 2327
      flesch: 50
     summary: The volume, which contains an ample list of bibliographic references and numerous illustrations in black and white and in color, is an important addition to the vast literature on the evolution of historical landscapes not only from a scientific and techni- cal profile but also from an historical and cultural point of view. Plant colours are attracting not only because they provide spectacular views of nature, but also for their functional roles.
    keywords: anthocyanins; book; landscape; new; plant; rossore; san; work
       cache: ahs-2942.pdf
  plain text: ahs-2942.txt

        item: #215 of 594
          id: ahs-2943
      author: Daiuto, E.R.; Fumes, J.G.F.; Vieites, R.L.; Cabia, N.C.; De Castro, R.S.D.
       title: Antioxidant capacity and phenolic total content in 'Fuerte' avocado submitted to hydrothermal treatment
        date: 2013
       words: 4036
      flesch: 53
     summary: Key words: antioxidant capacity, bioactive compounds, Persea americana Mill., refrigeration. The percentage of antioxidant capacity of the control and the hydrothermally-treated samples for 5 and 10 min increased during storage.
    keywords: antioxidant; avocado; capacity; content; day; fruit; min; phenolic; storage; total; treatment
       cache: ahs-2943.pdf
  plain text: ahs-2943.txt

        item: #216 of 594
          id: ahs-2944
      author: Caruso, G.; Conti, S.; La Rocca, P.
       title: Influence of crop cycle and nitrogen manure form on yield and nitrate content of leafy, hypocotyl and fruit vegetables
        date: 2013
       words: 7208
      flesch: 55
     summary: The effects of these treatments were evaluated in terms of yield and nitrate content in the edible organs. In lettuce, nitrate content can be reduced by distributing a part of the whole nitrogen supply as ammonia form, without changing the overall yield results (van der Boon et al., 1990) while in endive the exclusively ammonia form allows for no nitrate heads (Elia and Santamaria, 1997).
    keywords: autumn; content; control; crop; cycle; fertilization; fertilizer; kg·ha-1; mineral; nitrate; nitrate content; nitrogen; plant; radish; spring; winter; yield
       cache: ahs-2944.pdf
  plain text: ahs-2944.txt

        item: #217 of 594
          id: ahs-2945
      author: Ríos-Mesa, D.; Pereira-Lorenzo, S.; González-Díaz, A.J.; Hernández-González, J.Z.; González-Diaz, E.; Galán Saúco, V.
       title: The status of chestnut cultivation and utilization in the Canary Islands
        date: 2013
       words: 6357
      flesch: 64
     summary: Coci- nando con castañas de Tenerife. Morphological and molecular marker (SSRs) studies have shown a great variability within the local population of chestnut trees in the Canaries.
    keywords: canarias; chestnut; cultivation; de tenerife; island; las; lorenzo; palma; pereira; santa; spain; tenerife; trees; wood
       cache: ahs-2945.pdf
  plain text: ahs-2945.txt

        item: #218 of 594
          id: ahs-2946
      author: Mugnai, S.; Al-Debei, H.S.
       title: Growth reduction in root-restricted tomato plants is linked to photosynthetic impairment and starch accumulation in the leaves
        date: 2013
       words: 4241
      flesch: 56
     summary: CARMI A., HESKETH J.D., ENOS W.T., PETERS D.B., 1983 - Interrelationships between shoot growth and photosynthesis, as affected by root growth restriction. - Photosynthetica, 17(2): 240-245. Abstract: The mechanisms responsible for reduced shoot growth due to restricted root growth is still not fully understood.
    keywords: fig; growth; leaf; leaves; plants; restriction; root; water
       cache: ahs-2946.pdf
  plain text: ahs-2946.txt

        item: #219 of 594
          id: ahs-2947
      author: Kaul, A.; Kumar, S.; Ghani, M.
       title: In vitro mutagenesis and detection of variability among radiomutants of chrysanthemum using RAPD
        date: 2013
       words: 4091
      flesch: 61
     summary: Gy of gamma irradiation was the most effective in inducing muta- tions in flower colour through direct in vitro mutagenesis. Flower diameter and flower colour The variation in flower diameter between the control and the variants was statistically not significant (Tables 2 and 3).
    keywords: chrysanthemum; control; flower; gamma; number; plant; rapd; shoots; variants
       cache: ahs-2947.pdf
  plain text: ahs-2947.txt

        item: #220 of 594
          id: ahs-2948
      author: Masmoudi-Charfi, C.; Masmoudi, M.; Ben Mechlia, N.
       title: Root distribution in young olive trees (Olea europaea cv. Chétoui) and agronomic application
        date: 2013
       words: 8396
      flesch: 61
     summary: This section propo- ses a methodological approach to determine irrigation requirements of young olive trees and how the water supply can be linked to the development of the canopy and root system during the first years of cultivation when ground cover and root system are incompletely developed. For each tree, three measurements were carried out for both direc- tions at different distances from trunk; the first observation was made at 0.4 m, the second at 0.8 m and the third at 1.2 m. Table 5 - Average root densities (Dr, cm cm-3) determined for trees aged one to six years Dr (cm cm-3) 2 3 4 5 6 0.067 0.079 0.196 0.075 0.133 0.303 1 Table 6 - The overall length of root system (Lr, km) for trees aged one to six years
    keywords: area; canopy; irrigation; olive; ratio; root; soil; system; trees; trunk; water; year
       cache: ahs-2948.pdf
  plain text: ahs-2948.txt

        item: #221 of 594
          id: ahs-2949
      author: , 
       title: Book reviews
        date: 2013
       words: 950
      flesch: 59
     summary: La chimica dell’olio da olive (Chemistry of olive oil) (G. Lercker); 2. Normativa sui requisiti chimici, fisici e organolettici degli oli di oliva (Regulatory requirements on chemical, physical and organoleptic characteristics of olive oil) (L. Conte); 3. I contaminanti e la filiera produttiva degli oli di oliva (Contaminants and the olive oil production process) (L. Conte, S. Moret, G. Purcaro, T. Populin, A. Ermacora, and M. Marega); 4. Caratteristiche chimi- co-fisiche dell’oliva e dell’olio con riferimenti alle cultivar più diffuse (Physical and chemical characteristics of olive and oil with reference to the most cultivated cultivars) (G. Panelli);
    keywords: degli; dell’olio; olive; soil
       cache: ahs-2949.pdf
  plain text: ahs-2949.txt

        item: #222 of 594
          id: ahs-2950
      author: Giulivo, C.
       title: Basic considerations about pruning of deciduous fruit trees
        date: 2013
       words: 9710
      flesch: 53
     summary: Pruning is the basic tool to manipulate fruit tree archi- tecture and behaviour in order to achieve economically sound crop yield and fruit quality. Key words: architecture, correlate function, fruit trees, growth, pruning.
    keywords: architecture; axes; axis; branches; canopy; development; fig; fruit; growth; orchard; organs; plant; pruning; reproductive; root; shoots; system; tree
       cache: ahs-2950.pdf
  plain text: ahs-2950.txt

        item: #223 of 594
          id: ahs-2951
      author: Di Lorenzo, R.; Gambino, C.; Scafidi, P.
       title: Summer pruning in table grape
        date: 2013
       words: 5489
      flesch: 65
     summary: CPPU applied at fruit set increased berry weight, diameter and length, while CPPU applied at fruit softening had no signifi- cant effect on berry growth. - Studies on the environmentally controlled stomatal transpiration in grape vines.
    keywords: berry; cluster; dokoozlian; et al; fruit; girdling; grape; seedless; set; shoot; table; thinning
       cache: ahs-2951.pdf
  plain text: ahs-2951.txt

        item: #224 of 594
          id: ahs-2952
      author: Palliotti, A.; Poni, S.
       title: Traditional and innovative summer pruning techniques for vineyard management
        date: 2013
       words: 8787
      flesch: 58
     summary: It has to be kept in mind that early leaf removal is specif- ically recommended in highly productive vineyards which often present heavy, thick bunches very susceptible to rot. If early leaf removal is chosen, the primary regulation for crop restriction is via a decrease in fruit set with or without a significant reduction in berry size.
    keywords: berry; canopy; cluster; composition; et al; fruit; grape; leaf; removal; sangiovese; shoot; thinning; vine; wine; yield
       cache: ahs-2952.pdf
  plain text: ahs-2952.txt

        item: #225 of 594
          id: ahs-2953
      author: Choi, S.T.; Park, D.S.; Hong, K.P.; Kang, S.M.
       title: Summer pruning effect on tree growth and fruit production of persimmon
        date: 2013
       words: 4369
      flesch: 68
     summary: However, removal of shoots during growing sea- son involves the loss of functional leaf surface, which may lead to reduced tree development and fruit growth. Lower water consumption and thus improved water status during the growing season af- ter summer pruning could benefit fruit growth and relieve the potential detriment due to carbohydrate shortage in apple (Li et al., 2003) and peach (Lopez et al., 2006).
    keywords: choi; fruit; growth; persimmon; pruning; summer; tree
       cache: ahs-2953.pdf
  plain text: ahs-2953.txt

        item: #226 of 594
          id: ahs-2954
      author: Neri, D.; Massetani, F.
       title: Spring and summer pruning in Apricot and Peach orchards
        date: 2013
       words: 6277
      flesch: 62
     summary: Late summer pruning becomes important in the third to fourth year to cut the central leader and to open the centre of the vase. In modern peach orchards, late summer pruning is widely diffused as a common practice to manage light distribution and carbon alloca- tion and finally shoot quality.
    keywords: flower; fruit; growth; peach; pruning; shoot; spring; summer; varieties; vase; winter
       cache: ahs-2954.pdf
  plain text: ahs-2954.txt

        item: #227 of 594
          id: ahs-2955
      author: Mizutani, F.
       title: Summer pruning for maintaining slender spindle bush type of peach trees grafted on vigorous rootstocks
        date: 2013
       words: 3959
      flesch: 71
     summary: Summer shoot heading back and shading experiments in the pot showed that shading reduced the number of regenerated shoots and flower bud formation and delayed flower blooming in the following year. Shoot regeneration and flower bud formation after summer shoot heading back A. Objectives Because of apical dominant nature of shoots, the termi- nal shoot grows well, which retards the growth of lateral shoots.
    keywords: fruit; peach; pruning; shoot; summer; trees; winter
       cache: ahs-2955.pdf
  plain text: ahs-2955.txt

        item: #228 of 594
          id: ahs-2956
      author: Intrigliolo, F.; Roccuzzo, G.
       title: Modern trends of Citrus pruning in Italy
        date: 2013
       words: 3692
      flesch: 61
     summary: Pruning of young trees It is essential to take care of citrus trees during the juvenile stage to obtain a balanced scaffold with three to four principal branches developing at 30-50 cm from the collar (Fig. 1). If citrus trees are correctly managed in the nursery (cut back or headed)
    keywords: citrus; fig; fruit; growth; intrigliolo; potatura; pruning; trees
       cache: ahs-2956.pdf
  plain text: ahs-2956.txt

        item: #229 of 594
          id: ahs-2957
      author: Mika, A.; Buler, Z.
       title: Intensive plum orchard with summer training and pruning
        date: 2013
       words: 3741
      flesch: 69
     summary: Table 2 - Influence of cultivars and spacing on tree growth expressed by tree height in the fourth year from planting (2008) Influence of cultivars Tree height (m) ‘Cacanska Rana’ 3.08 b ‘Cacanska Najbolja’ 3.26 b ‘Cacanska Lepotica’ 3.20 b ‘Diana’ 3.44 b ‘Katinka’ 2.50 a ‘Silvia’ 3.62 c Influence of spacing (m) 4 x 1.5 3.20 a 4 x 2.0 3.17 a 4 x 2.5 3.20 a Different letters indicate significant differences separately for cultivars and spacing at P=0.05. For this purpose new methods of summer training and pruning were intro- duced to plum trees.
    keywords: cultivars; influence; planting; spacing; trees; year
       cache: ahs-2957.pdf
  plain text: ahs-2957.txt

        item: #230 of 594
          id: ahs-2958
      author: Cooley, D.R.; Autio, W.R.
       title: Summer pruning of apple: impacts on disease management
        date: 2013
       words: 5142
      flesch: 60
     summary: However, summer pruning can have impacts on apple diseases, because it alters canopy microclimate, can remove diseased tissue, improves deposition of fun- gicides and other chemicals, and in altering tree physiol- ogy may change resistance to disease. Of the few studies that have investigated interactions between summer pruning and apple diseases, most were done on semi-dwarf trees, and very few have looked at high-density systems.
    keywords: apple; blight; canopy; disease; fire; fruit; management; plant; pruning; scab; summer; sutton; trees
       cache: ahs-2958.pdf
  plain text: ahs-2958.txt

        item: #231 of 594
          id: ahs-2959
      author: Abu-Hammour, K.A.; Wittmann, D.
       title: Seed contents of Coriandrum sativum in Jordan Valley
        date: 2013
       words: 2784
      flesch: 66
     summary: Coriandrum sativum plantation Coriandrum sativum seeds, obtained from local mar- kets (landraces), were planted at locations A and B on 5 November 2007. Lin- naeus (1780) reported that C. sativum also occurs as a weed in cereals.
    keywords: acid; content; coriandrum; jordan; oil; petroselinic; sativum; seeds
       cache: ahs-2959.pdf
  plain text: ahs-2959.txt

        item: #232 of 594
          id: ahs-2960
      author: Abu-Hammour, K.A.; Wittmann, D.
       title: Pollination of Nigella sativa L. (Ranunculaceae) in Jordan Valley to improve seed set
        date: 2013
       words: 8369
      flesch: 59
     summary: Many authors are interested in common type of pollination as cross, open and self pollination, but through our research I have been devoted all our efforts to point out some thing out of tra- ditional efforts such as delayed self pollination. In order to check forced self pollination on the same hermaphrodite flower, flowers were bagged till the last day of the male stage.
    keywords: anthers; cross; flowers; hand; number; plant; pollen; pollination; sativa; seed; self; set; stigma; treatments
       cache: ahs-2960.pdf
  plain text: ahs-2960.txt

        item: #233 of 594
          id: ahs-2961
      author: Adjei-Frimpong, P.; Ofosu-Anim, J.; Norman, J.C.
       title: Disbudding effects on growth analysis of Celosia (Celosia cristata)
        date: 2013
       words: 5951
      flesch: 62
     summary: The optimal LAI obtained for disbudded plants in celosia is between 2 and 2.5. Similarly, Law-Ogbomo and Egharevba (2008) reported that abscis- sion with plant growth of the lower leaves in tomato cau- ses a decrease in NAR.
    keywords: area; carmine; control; disbudding; experiment; flower; growth; leaf; planting; plants; rate; weeks
       cache: ahs-2961.pdf
  plain text: ahs-2961.txt

        item: #234 of 594
          id: ahs-2962
      author: Fini, A.; Ferrini, F.
       title: Effects of mulching with compost on growth and physiology of Acer campestre L. and Carpinus betulus L.
        date: 2013
       words: 5463
      flesch: 64
     summary: In absence of irrigation and natural rainfall, the higher value measured in mulched soil provides further confirmation of the effectiveness of mulching to reduce evaporation: after 30 days of drought, soil was very dry Fig. Key words: chlorophyll fluorescence, leaf gas exchange, mulching, soil respiration, soil temperature, SPAD.
    keywords: effects; growth; leaf; mulching; plants; soil; species; temperature; treatments; year
       cache: ahs-2962.pdf
  plain text: ahs-2962.txt

        item: #235 of 594
          id: ahs-2963
      author: Dogra, B.S.; Kanwar, M.S.
       title: Selecting parents for developing superior hybrids in cucumber (Cucumis sativus L.)
        date: 2013
       words: 5642
      flesch: 77
     summary: -0.531* -0.031 0.014* -4.917* -0.217* -0.055* 1.048* EC173934 8.167* 1.633* 8.517* -0.390* 0.191* 0.037* 0.011* 7.417* -0.617* -0.346* 0.144 K-75 0.733* 0.733* 1.017* -0.050* 0.320* -0.004 0.017* 10.083* -0.017 0.024* 1.084* LC-11 6.600* 0.633* 6.583* 0.388* 0.136* -0.022 0.007* 32.750* -0.783* -0.089* 0.604* LC-40 9.800* 2.067* 9.950* -0.225* -0.008* 0.029* 0.005* -8.417* -1.283* -0.379* -0.593* Gyn1 -10.733* -2.100* -0.053* 0.693* EC173934 7.642* 1.192* 7.867* -0.592* 0.196* 0.065* 0.014* -5.342* -0.858* -0.384* 0.489* K-75 2.908* 0.792* 1.100* -0.025 0.309* -0.013 -0.010* 8.825* -0.258* 0.058* 0.869* LC-11 2.875* 1.325* 6.300* 0.495* 0.083* -0.028* -0.0001 30.825* -1.092* -0.125* 0.513 LC-40 5.675* 2.358* 7.900* -0.148* 0.083* 0.045* -0.0007
    keywords: k-90
       cache: ahs-2963.pdf
  plain text: ahs-2963.txt

        item: #236 of 594
          id: ahs-2964
      author: Rinaldelli, E.; Bandinelli, R.; Pagano, M.
       title: Short- and long-term effect of sulphite on sucrose transport in grapevine (Vitis vinifera L.) leaves. An electrophysiological study
        date: 2013
       words: 5660
      flesch: 60
     summary: Effects of sulphur dioxide were also found on the stomatal apparate of Vitis labrusca L. cv. This response is comparable, as cause and effect, to the one caused by permeant weak acids (Marrè et al., 1983; Rinaldelli and Bandinelli, 1999).
    keywords: depolarization; dioxide; effects; fig; leaf; leaves; light; membrane; physiol; plant; solution; sucrose; sulphite; transport
       cache: ahs-2964.pdf
  plain text: ahs-2964.txt

        item: #237 of 594
          id: ahs-2965
      author: Al-Debei, H.S.; Mugnai, S.
       title: Starch accumulation in the leaves of root-restricted pepper affects plant growth by a feedback-inhibition of the photosynthesis
        date: 2013
       words: 4453
      flesch: 55
     summary: However, contradictory results are reported as to which of these factors plays a significant role in the re- sponse of aerial plant parts to restricted root growth, with strong differences between species. Our results suggest that the role of the leaves as sink organs may increase when root growth is extremely lim- ited by volume restriction and a relatively larger amount of carbohydrate may accumulate in the canopy.
    keywords: experiment; fig; growth; leaf; plants; restriction; root; water
       cache: ahs-2965.pdf
  plain text: ahs-2965.txt

        item: #238 of 594
          id: ahs-2966
      author: El-Sabagh, A.S.; Barakat, M.N.; Genaidy, E.A.-E.
       title: Towards in vitro selection studies for salinity tolerance in Canino apricot cultivar. Effect of gamma irradiation on in vitro mutation and selection for salt-tolerance
        date: 2013
       words: 3198
      flesch: 62
     summary: 3. Results and Discussion Effect of gamma irradiation on in vitro apricot culture The basic requirement for effective use of mutation in- duction in plant breeding programs is the analysis of ra- dio sensitivity of the explant material (Walther and Sauer, 262 1986). The explants were aseptically excised and placed in Jar containing 50-60 ml of culture medium.
    keywords: apricot; culture; gamma; irradiation; medium; mutation; salt; shoot; vitro
       cache: ahs-2966.pdf
  plain text: ahs-2966.txt

        item: #239 of 594
          id: ahs-2967
      author: Karam, F.; Massaad, R.; Skaf, S.; Breidy, J.; Rouphael, Y.
       title: Potato response to potassium application rates and timing under semi-arid conditions
        date: 2013
       words: 3225
      flesch: 59
     summary: In 2004 when averaged over K application rates, large and medium grade tubers and aggregated tuber yield were 120%, 22%, and 12% greater, respectively, with K application at tuber bulking than at tuber initiation. In 2004 when averaged over K application rates, large and medium grade tubers and aggregated tuber yield were 120%, 22%, and 12% greater, respectively, with K appli- cation at tuber bulking than at tuber initiation.
    keywords: application; grade; potassium; potato; rates; tuber; yield
       cache: ahs-2967.pdf
  plain text: ahs-2967.txt

        item: #240 of 594
          id: ahs-2968
      author: Dhungel, J.; Bhattarai, S.P.; Midmore, D.J.
       title: Aerated water irrigation (oxygation) benefits to pineapple yield, water use efficiency and crop health
        date: 2013
       words: 9708
      flesch: 54
     summary: Fig. 2 - Mazzei air injector installed in a pressurised irrigation line close to the plot for air injection into irrigation water for oxygation (top), and the first year crop at fruit development stage (b) being marked for destructive sampling. Phytophthora infestation in the oxygation (3% of plants) was significantly reduced compared to the control (4.9%), and without irrigation treatment (10.5%) suggesting that reasonable management of Phytophthora, which is one of the major pathological problems for pineapple production in Australia and elsewhere, can be addressed through aerated water irrigation.
    keywords: control; crop; fruit; irrigation; leaf; oxygation; pineapple; plant; ratoon; root; soil; table; total; treatments; use; water; yield
       cache: ahs-2968.pdf
  plain text: ahs-2968.txt

        item: #241 of 594
          id: ahs-2969
      author: Lenzi, A.; Baldi, A.; Nannicini, M.; Pardini, A.; Tesi, R.
       title: Effects of trinexapae-ethyl on stoloon development in potted Patriot bermudagrass
        date: 2013
       words: 3214
      flesch: 61
     summary: In our experiment, a TE rate of at least 0.2 kg a.i. ha-1 was needed for a significant decrease of stolon length in Patriot bermudagrass (Fig. 1). The effectiveness of trinexapac-ethyl (TE) in controlling bermudagrass growth is reported by many authors (John- son, 1994, 1997; Fagerness and Yelverton, 1999; Lowe and Whitwell, 1999; Fagerness and Yelverton, 2000; Fagerness et al., 2002; Bunnel et al., 2005; McCullough et al., 2005; Baldwin et al., 2006; McCullough et al., 2007; Baldi et al., 2010).
    keywords: a.i; bermudagrass; growth; ha-1; length; number; plants; stolon
       cache: ahs-2969.pdf
  plain text: ahs-2969.txt

        item: #242 of 594
          id: ahs-2970
      author: Aghdaei, M.; Salehi, H.; Sarmast, M.K.
       title: Effects of silver nanoparticles on Tecomella undulate (Roxh.) Seem. Micropropagation
        date: 2013
       words: 3115
      flesch: 63
     summary: Plant tissue culture is one of the most important steps in genetic transformation and plant biotechnology studies to produce plantlets from stock plants as a rapid and efficient procedure throughout the year (Giri et al., 2004; Sarmast et al., 2009). Abstract: Plant tissue culture is a reliable tool for conservation and multiplication of many plants, including medicinal plants.
    keywords: explants; l-1; medium; snps; undulata
       cache: ahs-2970.pdf
  plain text: ahs-2970.txt

        item: #243 of 594
          id: ahs-2971
      author: Measham, P.F.; Bound, S.A.; Gracie, A.J.; Wilson, S.J.
       title: Crop load manipulation and fruit cracking in sweet cherry (Prunus avium L.)
        date: 2013
       words: 4863
      flesch: 63
     summary: Key words: fruit crop load, incidence of cracking, sweet cherry. The aim of this five-year study was to investigate the relationship between fruit crop load and incidence of cracking.
    keywords: cracking; crop; crop load; fruit; incidence; load; total; trials
       cache: ahs-2971.pdf
  plain text: ahs-2971.txt

        item: #244 of 594
          id: ahs-2972
      author: Colantuono, F.; Amodio, M.L.; Piazzolla, F.; Colelli, G.
       title: Influence of quality attributes of early, intermediate and late peach varieties on suitability for fresh-convenience products
        date: 2013
       words: 4904
      flesch: 58
     summary: Results obtained in the present study on peach fruits were in accordance with this theory since peach fruit cultivars (‘Honey Kist’, ‘Lidy Star’, ‘Stark Red Gold’, ‘Baby Gold7’) with high dry matter content showed a higher value of TSS and were also preferred for sweetness by panelists during sensorial tests. Based on the ‘Redhaven’ peach maturing date, peach fruits were divided into three groups: early maturing (Group A), middle maturing (Group B) and late maturing (Group C), as shown in Table 1.
    keywords: cultivars; fruit; group; maturing; peach; quality; tss; varieties
       cache: ahs-2972.pdf
  plain text: ahs-2972.txt

        item: #245 of 594
          id: ahs-2973
      author: Luvisi, A.; Panattoni, A.; Bandinelli, R.; Rinaldelli, E.; Pagano, M.; Triolo, E.
       title: Propagative material of grapevine: RFID technology for supporting traceability of "basic" and "certified" material along the wine production chain
        date: 2013
       words: 3250
      flesch: 45
     summary: 3. Results Requirement analysis and microchip tests The objectives for traceability of requirement analysis were: to record genetic links among plant categories; to record mandatory or voluntary assays; to identify struc- tures or people involved in plant production and resulting wine; and to use an identification system which relies on RFID codes associated with electronic identity cards (Lu- visi et al., 2010 a). PORTO S.M.C., ARCIDIACONO C., CASCONE G., 2011 - Developing integrated computer-based information sys- tems for certified plant traceability: Case study of Ital- ian citrus-plant nursery chain.
    keywords: analysis; chain; data; grapevine; information; material; plants; production; rfid; traceability
       cache: ahs-2973.pdf
  plain text: ahs-2973.txt

        item: #246 of 594
          id: ahs-2974
      author: , 
       title: Book reviews
        date: 2013
       words: 2066
      flesch: 56
     summary: ESPERIENZE E TEORIE IN ITALIA E IN INGHIL- TERRA NELL’OTTOCENTO (TERRITORIES OF WATER: They are the fourth volume of the work on the Mantuan Lanscape presented by Accademia Nazionale Virgiliana di Scienze, Lettere, e Arti and edit by Leo S. Olschki.
    keywords: del; italy; olive; text; water; work
       cache: ahs-2974.pdf
  plain text: ahs-2974.txt

        item: #247 of 594
          id: ahs-2975
      author: Caruso, G.; Villari, G.; Borrelli, C.; Russo, G.
       title: Effects of crop method and harvest seasons on yield and quality of green asparagus under tunnel in southern Italy
        date: 2013
       words: 5522
      flesch: 58
     summary: Summer spears showed higher values of optical residue, glucose, fructose, vitamin C and some mineral nutrients; instead, spring spears attained lower nitrate and average fibre content. Asparagus annual double harvest revealed economically interesting results, but the profits are strictly related to the prices of summer spears, which were evidently higher in summer than in spring in the three years of research.
    keywords: asparagus; crop; days; g-1; harvest; method; spear; spring; summer; yield
       cache: ahs-2975.pdf
  plain text: ahs-2975.txt

        item: #248 of 594
          id: ahs-2976
      author: Nin, S.; Ferri, A.; Sacchetti, P.; Giordani, E.
       title: Pear resistance to psilla (Cacopsylla pyri L.): A review
        date: 2013
       words: 13486
      flesch: 56
     summary: Effectiveness of yellow sticky- board traps have been examined by several authors and seasonality of the catch and flight activity of pear psylla (C. pyricola) according to weather conditions have been reported (Krysan and Horton, 1991; Horton, 1994; Civo- lani and Pasqualini, 2003; Erler, 2004), as well as diur- nal difference (Horton, 1993) and intraorchard changes in distribution associated with leaf fall (Horton et al., 1993). Control measures are directed specifically at controlling pear psylla and require accurate and timely information about insect densities in the orchard.
    keywords: adults; bell; cacopsylla; civolani; control; cultivars; eggs; entomol; et al; feeding; fruit; homoptera; horton; host; leaf; leaves; nymphs; pasqualini; pear; pear psylla; plant; psylla; psyllidae; pyri; pyricola; pyrus; resistance; romania; usa
       cache: ahs-2976.pdf
  plain text: ahs-2976.txt

        item: #249 of 594
          id: ahs-2977
      author: Adam, A.; Makee, H.; Idris, I.
       title: The influence of a non-pathogenic pseudomonas patida strain BTP1 on reproductive and dvelopment of grape phylloxera
        date: 2013
       words: 3998
      flesch: 56
     summary: Our current study indi- cates that the developmental time was significantly shorter on treated root pieces soaked for 15 hr (Fig. 2). 3. Results Effect of bacterial treated roots on phylloxera Table 1 shows that when root pieces were treated with P. putida, the percentage of emerged matured females was significantly affected compared to the control (F=84.69; df=15, 64; P<0.05).
    keywords: duration; phylloxera; pieces; putida; root; soaking
       cache: ahs-2977.pdf
  plain text: ahs-2977.txt

        item: #250 of 594
          id: ahs-2978
      author: Piazzolla, F.; Amodio, M.L.; Rinaldi, R.; Raimo, F.; Colelli, G.
       title: Effect of type of fertilization and maturity on quality of fresh-cut red and yellow peppers (Capsicum annuum L.)
        date: 2013
       words: 4474
      flesch: 52
     summary: Most of the differences observed at harvest were main- tained during storage for yellow peppers. For yellow peppers, no signifi- cant differences in firmness were observed.
    keywords: acid; fertilization; maturity; nss; peppers; quality; stage
       cache: ahs-2978.pdf
  plain text: ahs-2978.txt

        item: #251 of 594
          id: ahs-2979
      author: Kumar, A.; Ahad, I.
       title: Growth, yield and fruit quality of strawberry under protected cultivation in South Kashmir
        date: 2013
       words: 2968
      flesch: 60
     summary: The pooled data of two consecutive years shown in Table 1 reveal that ‘Chandler’ had maximum plant spread (27.43 cm) which was statistically at par with ‘Catskill’ (25.49 Table 1 - Growth and flowering characters of strawberry cultivars under polyhouse Cultivar Plant spread (cm) No. of runners/ plant Runners length (cm) Days taken first flower to produce Duration of flowering Number of flower/ plant Catskill 25.49 ef 7.09 ef 81.94 f 106 def 50.86 ab 26.92 e Chandler 27.43 f 8.54 h 82.59 fg 101 bc 56.79 d 27.23 f Confutura 24.18 cde 6.11 d 89.78 h 99 ab 53.92 bcd 20.93 ab Gorella 25.44 def 5.67 bc 75.40 de 103 cd 51.12 abc 21.90 bc Pajaro 21.75 ab 4.89 a 67.58 b 105 de 49.39 a 20.48 a Selva 23.08 bcd 5.44 b 73.95 cd 116 h 47.82 a 21.84 bc Tioga 20.19 a 7.35 fg 70.42 bc 97 a 55.49 cd 25.64 d Fern 22.35 abc 6.93 e 60.92 a 110 g 48.91 a 21.45 bc Mean 23.74 6.50 75.32 104.6 51.79 23.31 CD 0.05 2.40 0.29 3.70 3.84 4.43 0.99 Fig. Maximum reducing sugar (6.27 %) and total sugar (8.09%) were observed in ‘Catskill’ which was the highest Table 2 - Yield and fruiting characters of strawberry cultivars under polyhouse Cultivar Number of berries/ plant Berry set (%) Yield/plot (kg) Berry weight (g) Berry length (cm) Berry breadth (cm)
    keywords: chandler; cultivars; maximum; number; plant; strawberry
       cache: ahs-2979.pdf
  plain text: ahs-2979.txt

        item: #252 of 594
          id: ahs-2980
      author: Crespan, M.; Armanni, A.; Da Rold, G.; De Nardi, B.; Gardiman, M.; Migliaro, D.; Soligo, S.; Storchi, P.
       title: ‘Verdello’, ‘Verdicchio’ and ‘Verduschia’: an example of integrated multidisciplinary study to clarify grapevine cultivar identity
        date: 2013
       words: 5091
      flesch: 45
     summary: Organ OIV Code 2009 Description Verdello Verdicchio Verduschia present study Cartechini and Moretti, 1989 present study Bruni, 1962 present study Breviglieri and Casini, 1965 sh oo t 002 young shoot: distribution of anthocyanin coloration on prostrate hairs of the shoot tip absent absent absent absent absent piping 003 young shoot: intensity of anthocyanin coloration on prostrate hairs of the shoot tip none or very low none or very low none or very low none or very low none or very low low 004 young shoot: density of pros- trate hairs on the shoot tip medium very high medium very high medium medium or very high 006 attitude semi-erect semi-erect semi-erect semi-erect semi-erect semi-erect 007 colour of the dorsal side of internodes green and red green and red green and red green and red green green 008 colour of the ventral side of internodes green and red green and red green and red green and red green and red green and red 009 colour of the dorsal side of nodes green and red green and red green and red green and red green green 010 colour of the ventral side of nodes green and red or red green green and red or red green and red green and red green and red 013 density of prostrate hairs on nodes low none or very low low none or very low low low 015_2 intensity of anthocyanin coloration on the bud scales weak weak weak nr weak nr 016 number of consecutive tendrils 2 or less 2 or less 2 or less 2 or less 2 or less 2 or less 95 Organ OIV Code 2009 Description Verdello Verdicchio Verduschia present study Cartechini and Moretti, 1989 present study Bruni, 1962 present study Breviglieri and Casini, 1965 yo un g le af 051 colour of upper side of blade (4th leaf) green / bronze / yellow green green / yellow green / bronze green / yellow green 053 density of prostrate hairs be- tween main veins on lower side of blade (4th leaf) high very high high very high high very high 055 density of prostrate hairs on main veins on lower side of blade (4th leaf) low low low nr low nr m at ur e le af 065 size of blade medium-small* medium medium* medium medium-small* medium-small 067 shape of blade wedge-shaped or pentagonal* circular wedge-shaped or pentagonal* circular or pen- tagonal wedge-shaped or pentagonal* pentagonal 068 number of lobes five or three five five five or three five five or three 069 colour of the upper side of the blade between medium green and dark green medium green between medium green and dark green between medium green and dark green between medium green and dark green dark green 070 area of anthocyanin col- oration of main veins on upper side of blade absent absent absent absent absent absent 071 area of anthocyanin col- oration of main veins on lower side of blade absent absent absent absent absent absent 073 undulation of blade between main or lateral veins present present present present present present 074 profile of blade in cross section involute, V-shaped or twisted V-shaped involute, V- shaped or twisted flat or twisted involute, V- shaped or twisted flat or twisted 075 blistering of upper side of blade medium weak medium medium medium nr 076 shape of teeth mixture between straight and convex sides one side concave, one side convex mixture between straight and convex sides mixture between straight and convex sides mixture between straight and convex sides both sides convex 078 length of teeth compared with their width short short short short short short 079 degree of opening/overlap- ping petiole sinus overlapped strongly over- lapped overlapped closed or over- lapped overlapped overlapped 084 density of prostrate hairs between main veins on lower side of blade medium medium high very high medium very high 086 density of prostrate hairs on main veins on lower side of blade low low low high low nr 090 density of prostrate hairs on petiole low none or very low low none or very low low none or very low 093 length of petiole compared to length of middle vein (N1) shorter than N1 longer than N1 equal to N1 nr equal to N1 nr 601 length of vein N1 short* nr medium* nr short* nr 602 length of vein N2 medium* nr medium* nr medium* nr 603 length of vein N3 medium* nr medium* nr medium* nr 604 length of vein N4 very long* nr very long* nr very long* nr w oo dy sh oo t 101 cross section circular or elliptic circular circular or elliptic circular or elliptic circular or elliptic circular or el- liptic 103 main colour brownish brownish brownish between brown- ish and grey brownish brownish in flo re sc en ce 151 flower: sexual organs hermaphrodite hermaphrodite hermaphrodite hermaphrodite hermaphrodite hermaphrodite 152 insertion of 1st inflores- cence 3rd and 4th node 3rd and 4th node 3rd and 4th node 3rd and 4th node 3rd and 4th node 3rd and 4th node 153 number of inflorescences per shoot 1.1 to 2 1.1 to 2 1.1 to 2 1.1 to 2 1.1 to 2 1.1 to 2 96 Organ OIV Code 2009 Description Verdello Verdicchio Verduschia present study Cartechini and Moretti, 1989 present study Bruni, 1962 present study Breviglieri and Casini, 1965 bu nc h 202 length medium-long medium medium-long medium-long medium-long long 204 density dense very dense dense dense or medium dense medium 206 length of peduncle short very short short medium short short 208 shape conical / funnel shaped / cylindrical conical conical / funnel shaped / cylindri- cal conical or cylin- drical-conical conical / funnel shaped / cylindri- cal conical 209 number of wings of the primary bunch 1-2/3-4 with wings 1-2/3-4 wings with wings 1-2/3-4 with wings be rr y 220 length medium medium medium medium between me- dium and short short 222 uniformity of size uniform uniform uniform uniform uniform uniform 223 shape globose globose globose globose globose globose 225 colour of skin yellow yellow yellow yellow yellow yellow 227 bloom medium medium medium medium medium medium 228 thickness of skin thin thick thin thin thin thick 229 hilum visible visible visible visible visible visible 241 formation of seeds complete complete complete complete complete complete ve ge ta tio n 306 autumn coloration of leaves yellow yellow yellow yellow yellow yellow 351 vigour of shoot growth medium-strong medium medium-strong medium-strong medium-strong medium-strong 352 growth of lateral shoots weak weak weak medium weak weak 353 length of internodes medium long long medium-long medium medium 354 diameter of internodes medium small medium medium medium medium With regard to the descriptions from the literature, most of the 57 OIV descriptors we used were retrieved.
    keywords: comparison; data; green; italy; low; medium; short; table; varieties; verdello; verdicchio; verduschia
       cache: ahs-2980.pdf
  plain text: ahs-2980.txt

        item: #253 of 594
          id: ahs-2981
      author: Giordani, E.; Petrucci, W.A.; Morelli, D.; Ferri, A.
       title: Production of strawberries (Fragaria x ananassa Duch.) in mountain areas: a comparative evaluation of two june-bearing cultivars
        date: 2013
       words: 6752
      flesch: 56
     summary: Abstract: Two uniferous strawberry cultivars, ‘Marmolada®Onebor’ and ‘Elsanta’, were tested in three experimental fields located at 1,200 m asl; phenological phases and fruit quality of first and second season crops were compared. RADAJEWSKA B., DEJWOR-BOROWIAK I., 2002 - Re- fractometric and sensory evaluation of strawberry fruits and their shelf life during storage.
    keywords: crop; cultivars; effect; elsanta; field; fruits; location; marmolada; onebor; strawberry
       cache: ahs-2981.pdf
  plain text: ahs-2981.txt

        item: #254 of 594
          id: ahs-2982
      author: , 
       title: Book review
        date: 2013
       words: 635
      flesch: 55
     summary: (The systematic importance of literary conclusions in terms of garden culture) Even though difficulties exist with pepper taxonomy, the book pres- ents a good introduction where all disputes are clearly elucidated and discussed.
    keywords: book; gardens; peppers
       cache: ahs-2982.pdf
  plain text: ahs-2982.txt

        item: #255 of 594
          id: ahs-2983
      author: Yusuf, L.M.; Kurien, S.
       title: Preliminary studies on selection indices for activating seedling growth in mangosteen (Garcinia mangostana L.)
        date: 2012
       words: 11025
      flesch: 57
     summary: Seed characters Observations on seed weight, seed length, seed thick- ness at centre, seed volume, seed specific gravity, number of seeds per fruit, number of seedlings per seed, number of ungerminated seeds, number of seeds producing one seedling, number of seeds producing two or more than two seedlings (Table 2), number of days taken to germination, and germination rate were recorded based on ISTA guide- lines (ISTA, 2003). Seed character The seeds were extracted from the pulp and the weight of individual seeds in fruits was measured using an elec- tronic balance; the average seed weight was expressed in grams.
    keywords: age; age group; characters; fruit; fruit characters; group; index; number; seed; seed characters; seed index; seedling; seedling characters; seedling index
       cache: ahs-2983.pdf
  plain text: ahs-2983.txt

        item: #256 of 594
          id: ahs-2984
      author: Shekafandeh, A.; Hojati, S.
       title: In vitro drought effects on morphological and physiological indices of two fig (Ficus carica L.) cultivars
        date: 2012
       words: 5373
      flesch: 65
     summary: Fig. 1 - Changes in leaf water content (RWC) and ion leakage in two fig cultivars: ‘Sabz’ (a) and ‘Siah’ (b). Water shortage is the main characteristic of agricul- ture in Mediterranean regions, inducing water stress dur- ing spring and summer.
    keywords: content; cultivars; drought; leaf; peg; plant; proline; sabz; siah; stress; water
       cache: ahs-2984.pdf
  plain text: ahs-2984.txt

        item: #257 of 594
          id: ahs-2985
      author: Masmoudi Charfi, C.
       title: Quantitative analysis of soil water content in young drip-irrigated olive orchards
        date: 2012
       words: 7394
      flesch: 56
     summary: Soil water content was measured by using a time domain reflectometer (TDR) and a neutron probe calibrated by concur- rently measuring soil water content gravimetrically. Gravimetry is amongst the devices used to reliably measure soil water content (Hv) in the field.
    keywords: content; irrigation; masmoudi; measurements; olive; root; soil; soil water; tree; values; water; year
       cache: ahs-2985.pdf
  plain text: ahs-2985.txt

        item: #258 of 594
          id: ahs-2986
      author: Rizzo, D.; Stefani, L.; Paoli, M.; Triolo, Enrico; Panattoni, A.; Luvisi, Andrea
       title: The sustainability of old grapevine mother plants in relation to new mandatory diagnostic tests for virus control
        date: 2012
       words: 2013
      flesch: 54
     summary: In any case, the virologic status of uncertified grapevine in Tuscany indicates the presence of grapevine viruses and related vectors, underlining the importance of periodic verifications in grapevine nurseries to guarantee the high- est health standards of plant production and to help reduce The sustainability of old grapevine mother plants in relation to new mandatory diagnostic tests for virus control D. Rizzo*, L. Stefani*, M. Paoli*, E. Triolo**, A. Panattoni**, A. Luvisi**(1) * Servizio Fitosanitario Regionale, servizi agro ambientale di vigilanza e controllo, Regione Toscana, Via dei Fiori, 8, 51010 Pescia (PT), Italy. References ANDRET-LINK P., FUCHS M., 2005 - Transmission specificity of plant viruses by vectors.
    keywords: glrav-3; grapevine; plants; virus; viruses
       cache: ahs-2986.pdf
  plain text: ahs-2986.txt

        item: #259 of 594
          id: ahs-2987
      author: Javanmardi, J.; Ghorbani, E.
       title: Effects of chicken manure and vermicompost teas on herb yield, secondary metabolites and antioxidant activity of lemon basil (Ocimum x citriodorum Vis.)
        date: 2012
       words: 4951
      flesch: 55
     summary: Our data are in agreement with a previous work that found a higher essential oil percentage in ba- Table 3 - Effect of different dilutions of chicken manure tea (CMT) and vermicompost tea (VCT) on plant height, number of leaves, lateral branches and flowers, shoot fresh and dry weight and leaf chlorophyll content of lemon basil plants Treatment Plant height (cm) Conclusions The findings of this study indicate that fertilization with chicken manure and vermicompost organic teas im- proves herbal and essential oil yields as well as antioxida- tive agents such as total phenolics in lemon basil plants.
    keywords: activity; antioxidant; basil; cmt; compost; content; lemon; manure; oil; plants; soil; tea; total; vct
       cache: ahs-2987.pdf
  plain text: ahs-2987.txt

        item: #260 of 594
          id: ahs-2988
      author: Dutta, P.; Majumder, D.
       title: Influence of bagging on fruit quality and mineral composition of Himsagar mango grown in new alluvial zones of West Bengal
        date: 2012
       words: 3803
      flesch: 63
     summary: Key words: fruit bagging, fruit quality mineral composition, Himsagar mango. The unbagged fruits Table 2 - Effect of fruit bagging with polyethylene on length (cm) of fruit at different stages of harvest Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 35 10.75 12.75 13.91 45 10.30 11.50 12.28 55 10.06 11.35 11.94 65 9.95 11.12 11.82 Control 9.40 10.92 11.32 SEm ± 0.425 0.414 0.380 LSD (P = 0.05) 1.241 ns 1.144 Table 3 - Effect of fruit bagging with polyethylene on diameter (cm) of fruit at different stages of harvest Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 35 7.77 8.00 8.43 45 7.33 7.71 8.25 55 7.19 7.70 7.95 65 7.05 7.44 7.94 Control 6.91 7.25 7.68 SEm ± 0.172 0.210 0.211 LSD (P = 0.05) 0.521 0.591 0.610 Table 4 - Effect of fruit bagging on total soluble solids (°Brix) content of ripe mango fruit Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 45 9.90 12.20 15.40 55 10.05 13.50 17.30 65 10.40 14.30 17.85 Control 11.90 15.30 16.25 SEm ± 0.161 0.072 0.051 LSD (P = 0.05) 0.483 0.219 0.153 Table 5 - Effect of fruit bagging on total soluble sugar (% of fresh weight) content of ripe mango fruit Bagging (days after fruit set) Stages of fruit harvest (days after fruit set) 75 85 90 35 4.42 6.85 11.81 45 4.77 6.85 12.57 55 5.02 7.52 13.69 65 5.50 7.81 13.82 Control 6.20 7.97 12.83 SEm ± 0.129 0.061 0.051 LSD (P = 0.05) 0.391 0.180 0.158 Table 6 - Effect of fruit bagging on titratable acid (% malic acid) con- tent of ripe mango fruit Bagging (days after fruit set)
    keywords: bagged; bagging; content; control; days; fruit; harvest; mango; set; stages
       cache: ahs-2988.pdf
  plain text: ahs-2988.txt

        item: #261 of 594
          id: ahs-2989
      author: Marone, Elettra; Fiorino, Piero
       title: Oleiculture in progress
        date: 2012
       words: 10360
      flesch: 53
     summary: The use of olive oil in the diet came later in this plant’s history, around the first half of the 2nd millennium B.C., when use of this product spread via sea routes first from the eastern Mediterranean and Aegean Sea toward Greece, then thanks to the Phoenicians along the coast of Africa toward the west as far as (and beyond) the Pillars of Hercules. In Europe, olive oil acquired new importance through the Christian religion, and for which substitutes were not possible (e.g. for illumination of altars, anointing of the sick, use of plant oils during Lent or other periods of ab- stinence from foods of animal origin).
    keywords: areas; buds; characteristics; cultivars; cultivation; europaea; fiorino; growing; growth; italy; marone; new; oil; olea; olive; plant; species; temperature
       cache: ahs-2989.pdf
  plain text: ahs-2989.txt

        item: #262 of 594
          id: ahs-2990
      author: Di Vaio, Claudio; Marallo, N.; Nocerino, S.; Famiani, F.
       title: Mechanical harvesting of oil olives by trunk shaker with a reversed umbrella interceptor
        date: 2012
       words: 2272
      flesch: 58
     summary: This result highlights the importance of a good yield/tree in determin- ing high work productivity and therefore the economic convenience of using machines for olive harvesting (Fami- ani et al., 1998). - Horticultural Reviews, 38: 83-147. TOMBESI A., 1990 - Physiological and mechanical advances in olive harvesting.
    keywords: cultivars; harvesting; olive; ortice; ortolana; shaker; trunk
       cache: ahs-2990.pdf
  plain text: ahs-2990.txt

        item: #263 of 594
          id: ahs-2991
      author: Makee, H.; Idris, I.; Hussian, K.
       title: Factors influencing mating incidence and reproduction in codling moth Cydia pomonella L. (Lepidoptera: Tortricidae)
        date: 2012
       words: 4981
      flesch: 64
     summary: Effect of sex ratio on mating ability When C. pomonella females were confined with one or three males for 24 h, they mated only once. Effect of female multiple mating on fecundity and fertility When C. pomonella females were exposed to newly emerged males for seven successive days (group 2 fe- males), 18% of them mated once, more than half mated twice or three times and 18% mated four or five times (Table 4).
    keywords: age; effect; fecundity; females; fertility; group; lepidoptera; mating; number; pomonella; weight
       cache: ahs-2991.pdf
  plain text: ahs-2991.txt

        item: #264 of 594
          id: ahs-2992
      author: Svobodová, Eva; Pandolfi, Camilla; Hlásná Čepková, P.; Mancuso, Stefano
       title: Discrimination of grapevine varieties cultivated in the Czech Republic by Artificial Neural Networks
        date: 2012
       words: 4080
      flesch: 54
     summary: Discrimination of grapevine varieties cultivated in the Czech Republic by Artificial Neural Networks E. Svobodová*(1), C. Pandolfi**, P. Hlásná Čepková*, S. Mancuso** * Department of Crop Sciences and Agroforestry in Tropics and Subtropics, Faculty of Tropical Agri- Science, Czech University of Life Sciences Prague, Czech Republic. MORAVCOVá K., BARáNEK M., PIDRA M., 2004 - The use of RAPD markers for differentiation of grapevine varieties registered in the Czech Republic. - Horticultural Science (Prague), 31 (3): 96-101.
    keywords: analysis; berry; chasselas; fractal; grapevine; leaf; network; riesling; varieties; variety; vitis
       cache: ahs-2992.pdf
  plain text: ahs-2992.txt

        item: #265 of 594
          id: ahs-2993
      author: Fujita, E.; Vieites, R.L.; Daiuto, É.R.; Smith, R.E.
       title: Refrigerated storage of the fruits of the buriti (Mauritia flexuosa L.)
        date: 2014
       words: 4637
      flesch: 66
     summary: Abstract: The objective of this study was to evaluate different storage conditions to maximize the shelf-life of buriti fruits; under ambient conditions the fruits last only 2-3 days. Buriti fruits were stored refrigerated at 10, 12 and 15oC with 85±5% relative humidity, and at room temperature (23±5°C) and 60±5% relative humidity.
    keywords: ambient; buriti; day; days; fatty; fruits; storage
       cache: ahs-2993.pdf
  plain text: ahs-2993.txt

        item: #266 of 594
          id: ahs-2994
      author: Idris, I.; Arabi, M.I.E.
       title: The relationship between grape phylloxera and Fusarium root infection
        date: 2014
       words: 4207
      flesch: 60
     summary: Key words: Fusarium ssp., grape phylloxera, grape root. Omer et al. (2002) reported that the ability of grape phylloxera to exploit grape roots increased in the absence of fungal pathogens and indicated that phylloxera on infected roots developed more slowly, and had substantially reduced survival and reproduction rates.
    keywords: fungi; grape; infection; phylloxera; plant; roots; solani; sy7
       cache: ahs-2994.pdf
  plain text: ahs-2994.txt

        item: #267 of 594
          id: ahs-2995
      author: Eshghi, S.; Bahadoran, M.; Salehi, H.
       title: Growth of tall fescue (Festuca arundinacea Schreb.) seedling sown in soil mixed with nitrogen and natural zeolite
        date: 2014
       words: 2862
      flesch: 65
     summary: The object of the present study was to investigate the effects on tall fescue growth of applying different amounts of natural zeolite and nitrogen to growth medium. Abstract: To determine the interaction of nitrogen and natural zeolite in culture medium on the vegetative growth of tall fescue (Festuca arundinacea Schreb.)
    keywords: content; mixture; mowing; nitrogen; soil; weight; zeolite
       cache: ahs-2995.pdf
  plain text: ahs-2995.txt

        item: #268 of 594
          id: ahs-2996
      author: Abubaker, S.; Qrunfleh, I.; Hasan, M.
       title: Effect of different types of mulches on 'Newton' tomato yields and fruit cracking under plastic greenhouse conditions
        date: 2014
       words: 2358
      flesch: 63
     summary: Results of this study clearly showed that mulching improves total tomato yields under greenhouse conditions. Different mulch types showed significant ef- fects on early, medium, late, and total yields/ha of the tomato fruits.
    keywords: mulch; plastic; tomato; types; yields
       cache: ahs-2996.pdf
  plain text: ahs-2996.txt

        item: #269 of 594
          id: ahs-2997
      author: Magni, S.; Gaetani, Monica; Grossi, N.; Caturegli, L.; La Bella, S.; Leto, C.; Virga, G.; Tuttolomondo, T.; Lulli, F.; Volterrani, M.
       title: Bernudagrass adaptation in the mediterranean climate: phenotypic traits of 44 accessions
        date: 2014
       words: 4612
      flesch: 60
     summary: The most dense improved type was Wintergreen (2.3 shoots cm-2), hybrid type values ranged from 1.7 shoots cm-2 (Patriot) to 3.8 shoots cm-2 (Tif 00-1), while the most dense dwarf type was Miniverde with 5.1 shoots cm-2. Dwarf and hybrid types yielded the best aesthetic characteristics.
    keywords: bermudagrass; cm-2; colour; density; dwarf; green; hybrid; pisa; tif; types
       cache: ahs-2997.pdf
  plain text: ahs-2997.txt

        item: #270 of 594
          id: ahs-2998
      author: Javanmardi, J.; Zarei, M.; Saei, M.
       title: Influence of arbuscular mycorrhizal fungi on physiology and fruit quality of Pepino (Solanum muricatum Ait.) in vermicompost amended medium
        date: 2014
       words: 6168
      flesch: 54
     summary: An increased fruit dry matter percentage in AMF plants has been attrib- uted to improved water and nutrient uptake/translocation, higher photosynthesis (Vamerali et al., 2003), and also to the pattern of dry matter distribution in inoculated plants, which pointed to a role of AMF in carbon partitioning (Mena-Violante et al., 2006). Vermicompost as an organic fertilizer provides some essential nutrients for supporting plant growth compared with chemical fertilizers.
    keywords: amf; days; effects; etunicatum; fruit; growth; mycorrhizal; number; pepino; plants; soil; table; vermicompost; versiforme
       cache: ahs-2998.pdf
  plain text: ahs-2998.txt

        item: #271 of 594
          id: ahs-2999
      author: Ben Hamed, I.; Biligui, B.; Arbelet-Bonnin, D.; Abdelly, C.; Ben Hamed, K.; Bouteau, François
       title: Establishment of a cell suspension culture of the halophyte Cakile maritima
        date: 2014
       words: 4088
      flesch: 64
     summary: The present paper reports initiation of C. maritima cell suspension cultures from callus obtained from aerial parts of seedlings. Suspension culture cells offer an in vitro system that is widely used in plant biology as a convenient tool to inves- tigate a wide range of phenomena.
    keywords: cakile; cell; culture; et al; fig; growth; maritima; plant; salinity; suspension
       cache: ahs-2999.pdf
  plain text: ahs-2999.txt

        item: #272 of 594
          id: ahs-3000
      author: Manuchehri, R.; Salehi, H.; Jowkar, A.
       title: Biochemical and physiological adjustments in common bermudagrass (Cynodon dactylon [L.] Pers.) and tall fescue (Festuca arundinacea Schreb.) under low temperature stress
        date: 2014
       words: 3294
      flesch: 63
     summary: The main objective of the present study was to investi- gate the effects of low temperature stress on biochemical and physiological responses of tall fescue and common bermudagrass. Key words: Antioxidant enzymes activity, common Bermudagrass, low temperature stress, tall fescue, Turfgrasses.
    keywords: activity; bermudagrass; fescue; plants; proline; stress; temperature
       cache: ahs-3000.pdf
  plain text: ahs-3000.txt

        item: #273 of 594
          id: ahs-3001
      author: Suzuki, M.; Jasinski, M.; Martinoia, E.; Nakabayashi, R.; Suzuki, M; Saito, K.; Shiratake, K.
       title: Molecular cloning and characterization of ABCG/PDR-type ABC transporter in grape berry skin
        date: 2014
       words: 9050
      flesch: 66
     summary: In plants, full-size ABCG transporters have been reported to transport phytoalexins (Banasiak et al., 2013), abscisic acid (ABA) (Kang et al., 2010), strigolactone (Kretzschmar et al., 2012), and other compounds. Other close homologues transport different com- pounds; AtABCG40 (AAF71978) (Kang et al., 2010) and PaPDR1 (JQ292812) (Kretzschmar et al., 2012) transport ABA and strigolactone, respectively.
    keywords: b c; c g; et al; grape; plant; resveratrol; size; transporters; v vp; vvabcg44
       cache: ahs-3001.pdf
  plain text: ahs-3001.txt

        item: #274 of 594
          id: ahs-3002
      author: Ito-Inaba, Y.
       title: Thermogenesis in skunk cabbage (Symplocarpus renifolius): New insights from the ultrastructure and gene expression profiles
        date: 2014
       words: 4250
      flesch: 47
     summary: ITO-INABA Y., MASUKO H., WATANABE M., INABA T., 2012 b - Isolation and gene expression analysis of a papain- type cysteine protease in thermogenic skunk cabbage (Symp- locarpus renifolius). In a well-known thermogenic plant, Sauromatum guttatum (voodoo lily), ultrastructural changes in the inflorescence during the transition from the pre- to post-thermogenic stages were extensively studied, and clear details of mitochondrial morphology were obtained (Sku- batz et al., 1993).
    keywords: female; floral; inaba; ito; male; plant; renifolius; stage; thermogenesis
       cache: ahs-3002.pdf
  plain text: ahs-3002.txt

        item: #275 of 594
          id: ahs-3003
      author: Matsumoto, T.; Yoshimatsu, K.; Kawahara, N.; Yamamoto, S.-I.; Niino, T.
       title: Development of in vitro propagation by node culture and cryopreservation by V-Cryo-plate method for Perilla frutescens
        date: 2014
       words: 2930
      flesch: 63
     summary: Fig. 2 - Procedure of V-Cryo-plate for cryopreservation of Perilla shoot tips. The cryo-plate with shoot tips was osmo-protected with LS solution and dehy- drated in PVS2 for 20 min at 25°C prior to immersion into liquid nitrogen.
    keywords: cryo; cryopreservation; perilla; plant; plate; shoot
       cache: ahs-3003.pdf
  plain text: ahs-3003.txt

        item: #276 of 594
          id: ahs-3004
      author: Nishizawa, T.
       title: Present status and future outlook of plant factories in Japan
        date: 2014
       words: 3906
      flesch: 57
     summary: Introduction Highly systematized greenhouses for plant growth are called plant factories (PF) in Japan, and they have been rapidly increasing in recent years (Kobayashi, 2010; Non- ami, 2010). Key words: environment control, fluorescent light, LED, lettuce, organic electroluminescence, plant factory, strawberry.
    keywords: agriculture; coast; factory; farmland; fig; japan; light; plant; production
       cache: ahs-3004.pdf
  plain text: ahs-3004.txt

        item: #277 of 594
          id: ahs-3005
      author: Joung, D.; Song, C.; Ikei, H.; Okuda, T.; Igarashi, M.; Koizumi, H.; Park, B.J.; Yamaguchi, T.; Takagaki, M.; Miyazaki, Y.
       title: Physiological and psychological effects of olfactory stimulation with D-limonene
        date: 2014
       words: 3632
      flesch: 63
     summary: In subjective evaluations, it was reported that people feel more “comfortable,” “soothed,” and “natu- ral” when experiencing a forest environment (Park et al., 2007; Tsunetsugu et al., 2007; Park et al., 2008; Lee et al., 2009; Park et al., 2009; Lee et al., 2011; Park et al., 2011; Tsunetsugu et al., 2013; Lee et al., 2014), and that the “tension-anxiety,” “depression,” “anger-hostility,” “fa- tigue,” “confusion,” and “vigor” of the mood state profile (McNair and Lorr, 1964; McNair et al., 1992; Yokoyama, 2005) improved (Li et al., 2008 a, b, c; Park et al., 2010; Lee et al., 2011; Park et al., 2011; Tsunetsugu et al., 2013; Lee et al., 2014). Park et al., 2008; Lee et al., 2009; Park et al., 2009; Park et al., 2010; Lee et al., 2011; Park et al., 2012; Tsunetsugu et al., 2013; Lee et al., 2014); de- crease cerebral blood flow in the prefrontal cortex (Park et al., 2007); and decrease salivary cortisol concentration of stress hormone (Tsunetsugu et al., 2007; Park et al., 2007; Park et al., 2008; Lee et al., 2009; Park et al., 2010).
    keywords: et al; forest; limonene; miyazaki; olfactory; park; park et
       cache: ahs-3005.pdf
  plain text: ahs-3005.txt

        item: #278 of 594
          id: ahs-3006
      author: Nagano, Y.; Inafuku-Teramoto, S.; Hashimoto, M.; Mimura, T.; Matsumoto, R.; Yamamoto, M.
       title: Characterization of chloroplast matK sequences of Citrus tachibana and Citrus depressa, two indigenous species in Japan
        date: 2014
       words: 3130
      flesch: 62
     summary: The results indicate that C. tachibana, C. nippokoreana, and C. depressa accessions can be classified into two types: type A, all sixteen C. tachibana and six C. depressa; type B, eleven C. depressa and one C. nippokoreana. Compared to C. tachibana, C. depressa is considered to be adapted to a warmer climate; the former is usually used as an ornamental for gardens and its fruit is inedible.
    keywords: accessions; citrus; depressa; japan; shiikuwasha; tachibana; tanaka; tree
       cache: ahs-3006.pdf
  plain text: ahs-3006.txt

        item: #279 of 594
          id: ahs-3007
      author: Sawada, H.; Komatsu, S.; Tamaoki, M.; Kohno, Y.
       title: Potential marker proteins for ozone-induced yield reduction in rice
        date: 2018
       words: 3264
      flesch: 56
     summary: Kubo et al. (2011) reported that during ozone stress, sakuranetin, a flavonone in the phytoalexin family, ap- pears to serve as a molecular marker of the stress response. Key words: grain yield, ozone stress, protein markers, 60-kDa chaperonin.
    keywords: cpn-60; cultivars; exposure; grain; levels; ozone; ppb; rice; stress; yield
       cache: ahs-3007.pdf
  plain text: ahs-3007.txt

        item: #280 of 594
          id: ahs-3008
      author: Tsukagoshi, S.; Kuroda, K.; Hohjo, M.; Ikegami, F.; Kunisaki, N.; Hanamura, T.; Yamada, K.; Hagiwara, T.
       title: Evaluation of local eggplant cultivars in terms of the suitability as materials for 'Yakuzen' dishes
        date: 2014
       words: 4445
      flesch: 67
     summary: The polyphenol content was calculated from a Table 2 - Evaluation of the taste of eggplant cultivars by sensory test (z) Fruit shape Cultivar Aroma   Softness Juiciness Sweetness Bitterness Astringency     Good Grassy   Pericarp Flesh       & Acridity Small, Round De (y) 0 (x) 0 -1 0 0 0 1 1 Table 3 - Evaluation of the taste of eggplant cultivars by taste sensor (z) Fruit shape Cultivar Bitter-
    keywords: acid; amino; content; cultivars; eggplant; fruit; japan; purple; yakuzen
       cache: ahs-3008.pdf
  plain text: ahs-3008.txt

        item: #281 of 594
          id: ahs-3009
      author: Ikei, H.; Song, C.; Igarashi, M.; Namekawa, T.; Miyazaki, Y.
       title: Physiological and psychological relaxing effects of visual stimulation with foliage plants in high school students
        date: 2014
       words: 3876
      flesch: 59
     summary: Introduction Recent studies have focused on the physiological relax- ing effects of the natural environment (Park et al., 2009; 2012). It has been reported that staying in a forest environ- ment enhances parasympathetic nervous activity (Park et al., 2012; Tsunetsugu et al., 2013), suppresses sympathetic nervous activity (Park et al., 2012; Tsunetsugu et al., 2013; Lee et al., 2014), decreases blood pressure and pulse rate (Park and Mattson, 2009; Park et al., 2012), and decreases cortisol concentration (Park et al., 2012).
    keywords: activity; condition; control; dracaena; min; plants; rate
       cache: ahs-3009.pdf
  plain text: ahs-3009.txt

        item: #282 of 594
          id: ahs-3010
      author: Yamamoto, M.
       title: Progress on studies for seedless breeding of citrus in Japan
        date: 2014
       words: 5981
      flesch: 65
     summary: MATSUMOTO R., OKUDAI N., OIYAMA I., TAKAHARA T., YAMAMOTO M., ASADA K., ISHIUCHI D., MURATA H., 1991 - New citrus cultivar ‘Tsunokaori’. OKUDAI N., MATSUMOTO R., OIYAMA I., TAKAHARA T., ASADA K., YAMAMOTO M., ISHIUCHI D., MURATA H., 1991 - New citrus cultivar ‘Seiho’.
    keywords: breeding; citrus; cultivars; hort; japan; sci; seedless; sterility
       cache: ahs-3010.pdf
  plain text: ahs-3010.txt

        item: #283 of 594
          id: ahs-3011
      author: Watanabe, G.; Ishibashi, Y.; Iwaya-Inoue, M.
       title: Ontogenetic changes of the water status and accumulated soluble compounds in developing and ripening mume (Prunus mume) fruit measured by 1H-NMR analysis
        date: 2015
       words: 7187
      flesch: 67
     summary: Rinshu) fruit tissues were examined by measuring the physical states of cell-associated water in the fruit tissues with developing and ripening using 1H-NMR spec- troscopy. 3. Results Histochemical characteristics of fruit tissues with ripening Mume fruit are characterized by four stages (Fig.
    keywords: changes; fig; fruit; mume; nmr; pericarp; plant; relaxation; ripening; seed; stage; tissues; values; water
       cache: ahs-3011.pdf
  plain text: ahs-3011.txt

        item: #284 of 594
          id: ahs-3012
      author: Hosseinpour, A.; Seifi, Esmaeil; Javadi, D.; Ramezanpour, Seyedeh
       title: A preliminary study on pollen compatibility of some hazelnut cultivars in Iran
        date: 2015
       words: 2514
      flesch: 54
     summary: Most hazelnut culti- vars are self-incompatible; self- and cross-incompatibili- ty in hazelnut cultivars are widespread phenomena which are of the sporophytic type (Germain, 1994). Pollen incompatibility is a major problem among hazelnut cultivars and can result in considerable crop loss in hazelnut orchards.
    keywords: cultivars; hazelnut; pashmine; pollen; pollination; set
       cache: ahs-3012.pdf
  plain text: ahs-3012.txt

        item: #285 of 594
          id: ahs-3013
      author: Nakamura, I.; Takahashi, H.; Ohta, S.; Moriizumi, T.; Hanashiro, Y.; Sato, Y.-I.; Mill, M.
       title: Origin of Prunus x yedoenins 'Somei-yoshino' based on sequence analysis of PolA1 gene
        date: 2015
       words: 4473
      flesch: 67
     summary: To reveal the origin of ‘Somei-yoshino,’ we analyzed sequences of intron 19 and exon 20 of PolA1, a single-copy nuclear gene encoding the largest subunit of RNA polymerase I. One of two exon 20 sequences found in ‘Somei-yoshino’ was the same as that of P. pendula, whereas the other sequence was shared with several taxa in seven wild species, including P. jamasakura and P. lannesiana. A to- tal of 42 individuals of nine wild species native to Japan (Table 1) were analyzed; P. apetala (three individuals), P. incisa (four), P. nipponica (four), P. jamasakura (eight), P. sargentii (two), P. verecunda (four), P. lannesiana (three), P. maximowiczii (three), and P. pendula (six), and three alien wild species, P. campanulata (two), P. cerasoides (two), and P. pseudo-cerasus (one) (Table 1).
    keywords: dna; exon; intron; pendula; pola1; prunus; sequences; somei; species; yoshino
       cache: ahs-3013.pdf
  plain text: ahs-3013.txt

        item: #286 of 594
          id: ahs-3014
      author: La Zazzera, M.; Amodio, Maria Luisa; Colelli, Giancarlo
       title: Designing a modified atmosphere packaging (MAP) for fresh-cut artichokes
        date: 2015
       words: 4044
      flesch: 53
     summary: Finally, artichokes were cut into quarters and closed in active modified atmosphere packaging (MAP) with the initial gas composition of 5% O 2 +10% CO 2 using a Tecnovac packaging machine (Mod. For samples stored in PP+PA MF2 and PP MF2 gas evolution showed the same trend: the O 2 level decreased in the first hours, due to the high respiration rate of cut artichokes, reaching a steady state at 12% and 10% respectively for PP+PA MF2 and PP MF2; CO 2 concentration increased slightly for both films, reaching a steady state at 11.5% for PP+PA MF2 and 12.5 for PP MF2.
    keywords: acid; atmosphere; cut; micro; packaging; pla; quality; samples
       cache: ahs-3014.pdf
  plain text: ahs-3014.txt

        item: #287 of 594
          id: ahs-3015
      author: Bellincontro, A.; Valentini, Massimiliano; Forniti, Roberto; Mencarelli, Fabio
       title: Innovative application of NIR-AOTF and MRI to study water behaviour in cut flower
        date: 2015
       words: 4883
      flesch: 59
     summary: Significant correlation results for weight loss and water content ( R2 in calibration = 0.98 for estimated % of water loss and 0.96 for % of water content; R2cv MRI measure- ments were performed on flower sections at time 0, after 3 and 12 days.
    keywords: basal; content; cut; dry; flowers; loss; mri; nir; water
       cache: ahs-3015.pdf
  plain text: ahs-3015.txt

        item: #288 of 594
          id: ahs-3016
      author: Arabi, M.I.E.; Al-Shehadah, E.; Jawhar, M.
       title: A simple approach to assess common root rot severity incidence data in wheat
        date: 2015
       words: 2588
      flesch: 58
     summary: However, CRR severity increased linearly as incidence increased in both Triticum durum and T. aestivum wheat. In this extreme situation, I was equal to S for wheat CRR reaction.
    keywords: crr; incidence; rot; severity; wheat
       cache: ahs-3016.pdf
  plain text: ahs-3016.txt

        item: #289 of 594
          id: ahs-3017
      author: Noriyasu, A.; Furukawa, H.; Kikuchi, A.; Takaichi, H.; Bouteau, François; Li, X.; Nishihama, Syouhei; Yoshizuka, K.; Kawano, Tomonori
       title: Use of liquefied cold temperature dimethyl ether for extraction of pigments from fresh vegetable tissues
        date: 2015
       words: 2997
      flesch: 56
     summary: Recently, an industrial use of liquefied DME was reported for rapid removal of water from sub-bituminous coal without any heating process (Kanda and Makino, 2010). This approach encourages us to testify the performance of liquefied DME in de-watering of biomaterials including watery horticul- tural crops.
    keywords: dme; extraction; fig; peel; pigments; spinach; squash
       cache: ahs-3017.pdf
  plain text: ahs-3017.txt

        item: #290 of 594
          id: ahs-3018
      author: Seppoloni, Irene; Staglianò, Nicolina; Cecchi, S.; Argenti, Giovanni
       title: Performance of warm-season turfgrasses in an area of central Italy
        date: 2015
       words: 4672
      flesch: 59
     summary: Key words: Bermudagrass, ground cover, growing season, turf quality, weeds. C. dactylon demonstrated good and constant soil coverage and it was more satisfactory than other species, whereas Z. japonica displayed the typical behavior of this species, attaining optimal values at the end of the growing season of the second year (S5).
    keywords: cynodon; dormancy; italy; paspalum; quality; season; species; turf; turfgrass; winter
       cache: ahs-3018.pdf
  plain text: ahs-3018.txt

        item: #291 of 594
          id: ahs-3019
      author: Kawano, Tomonori
       title: Pteridophytes as active components in gardening, agricultural and horticultural ecosystems in Japan
        date: 2015
       words: 4156
      flesch: 54
     summary: Japanese names ending with -goke or -koke are conventionally given to moss spe- cies, despite the fact that these species are taxonomical members of ferns. (Psilotaceae; Japanese name: Matsubaran) belonging to the class Psi- lotopsida has long been utilized in Japanese gardening landscapes.
    keywords: equisetum; ferns; fig; gardening; gardens; japanese; kawano; plants; pteris; species
       cache: ahs-3019.pdf
  plain text: ahs-3019.txt

        item: #292 of 594
          id: ahs-3020
      author: Galgano, Fernanda; Caruso, M.C.; Condelli, N.; Stassano, S; Favati, F.
       title: Application of ozone in fresh-cut iceberg lettuce refrigeration
        date: 2015
       words: 2644
      flesch: 56
     summary: Several studies have focused on the effect of ozone treatment on the safety and quality of iceberg lettuce (Rico et al., 2006; Yuk et al., 2006; Hassenberg et al., 2007). A con- trol sample was stored at 4°C without ozone treatment.
    keywords: control; cut; food; lettuce; ozone; storage; treatment
       cache: ahs-3020.pdf
  plain text: ahs-3020.txt

        item: #293 of 594
          id: ahs-3021
      author: Vanoli, Maristella; Grassi, M.; Buccheri, M.; Rizzolo, A.
       title: Influence of edible coating on postharvest physiology ana quality of honeydew melon fruit (Cucumis melo L. inodorus)
        date: 2015
       words: 6849
      flesch: 59
     summary: 69 Vanoli et al., Edible coatings and quality of melon fruit All three fermentative metabolites dramatically increased in F1 fruit already after 6 days at 13°C (Fig. 1), increased further up to d9, showing a slight but not significant increase up to d13, with the exception of acetaldehyde which did not change from d9 to d13. 71 Vanoli et al., Edible coatings and quality of melon fruit The quality of fruits and vegetables depends on their internal O 2 and CO 2 concentrations which in turn are af- fected by the environmental concentrations of these gases (Hagenmaier, 2005).
    keywords: coating; control; days; ethane; ethylene; food; fruit; levels; loss; melons; quality; storage
       cache: ahs-3021.pdf
  plain text: ahs-3021.txt

        item: #294 of 594
          id: ahs-3022
      author: Laus, M.N.; Soccio, M.; Giovannini, D.; Caboni, E.; Quacquarelli, I.; Maltoni, M.L.; Scossa, F.; Condello, E.; Pastore, D.
       title: Assessment of antioxidant activity of carotenoid-enriched extracts from peach fruits using the new LOX/RNO method
        date: 2015
       words: 6632
      flesch: 54
     summary: Since carotenoid extracts reconstituted in sodium borate buffer containing 0.4 µL Tween 80/µg carotenoids were analyzed, all LOX/RNO measurements were carried out in the presence of a constant volume (0.5 µL/mL) of Tween 80 in the assay mixture. The LOX/RNO reaction was measured both in the absence (control) and presence of carotenoid extract (or ±-6-hydroxy-2,5,7,8- tetramethylchromane-2-carboxylic acid, Trolox, used as a standard antioxidant).
    keywords: absorbance; antioxidant; bleaching; carotenoid; et al; extract; lox; method; pastore; peach; rno; trolox; white
       cache: ahs-3022.pdf
  plain text: ahs-3022.txt

        item: #295 of 594
          id: ahs-3023
      author: Vanoli, M.; Grassi, M.; Bianchi, G.; Buccheri, M.; Rizzolo, Anna
       title: ‘Conference’ and ‘Abbé Fétel’ pears treated with 1-methylcyclopropene: physiological and quality implications of initial low oxygen stress and controlled atmosphere storage
        date: 2015
       words: 9758
      flesch: 61
     summary: Food Chem., 55: 5267-5276 VANOLI M., ECCHER ZERBINI P., GRASSI M., RIZZOLO A., 2010 a - Ethylene production and quality in 1-methylcyclo- propene treated Abbé Fétel pears after storage in dynamically controlled atmosphere. ZOFFOLI J.P., 1994. - Pear fruit scald: a physiologic disorder involving α-farnesene, conjugated trienes and α-tocopherol.
    keywords: abbé; abbé fétel; conference; control; ctol; fruit; fétel; life; mcp; pears; scald; shelf; storage; weeks
       cache: ahs-3023.pdf
  plain text: ahs-3023.txt

        item: #296 of 594
          id: ahs-3024
      author: Strano, Maria Concetta; Di Silvestro, S.; Coniglione, M.; Magnano San Lio, R.
       title: Decay control of cold stored Citrus clementina Hort. ex Tan. fruit by pre- and postharvest application of potassium phosphite
        date: 2015
       words: 4201
      flesch: 59
     summary: Potassium phosphite treatments, before harvest and in pre-postharvest combination, significantly reduced chilling injury and aging with respect to water control. At commercial maturity, fruits were harvested from treated plants and placed into plastic boxes (one box per plant), each containing 50 fruits, with the exception of potassium phosphite treatments (two boxes per plant), in order to use the extra fruit for the postharvest treatment.
    keywords: citrus; control; decay; fruit; mould; phosphite; postharvest; potassium; treatments; water
       cache: ahs-3024.pdf
  plain text: ahs-3024.txt

        item: #297 of 594
          id: ahs-3025
      author: Bulgari, Roberta; Negri, M.; Ferrante, A.
       title: Evaluation of postharvest storage and treatments in cut ruscus foliage
        date: 2015
       words: 3813
      flesch: 63
     summary: The vase life of cut foliage is usually longer than cut flowers, but it may become shorter when they are stored for long periods. Storage methods, wet or dry, affect the vase life of cut foliage (Ferrante et al., 2002 a) and play a crucial role for preserving quality: it is impor- tant, in particular, to delay the symptoms of leaf senes- cence considering that the intensity of leaf color is the most important quality parameter (Pacifici et al., 2007) and closely associated with the marketability of orna- mental cut foliage.
    keywords: branches; chlorophyll; cut; foliage; glycerol; life; storage; tdz; vase
       cache: ahs-3025.pdf
  plain text: ahs-3025.txt

        item: #298 of 594
          id: ahs-3026
      author: Nuzzi, M.; Grassi, M.; Sartori, A.; Terlizzi, M.; Buccheri, Marina
       title: Postharvest changes in quality characteristics, antioxidant activity and bioactive compounds of peach and nectarine cultivars [Prunus persica (L.) Batsch]
        date: 2015
       words: 5217
      flesch: 64
     summary: Other authors also showed a significant increase in TAA in several nectarine cultivars after refrigerated storage (seven days at 2°C) while the increase was not significant or there was a decrease in peaches (Di Vaio et al., 2001, 2008). CRISOSTO C.H., CRISOSTO G.M., 2005 - Relationship be- tween ripe soluble solids concentration (RSSC) and consum- er acceptance of high and low acid melting flesh peach and nectarine (Prunus persica (L.) Batsch) cultivars. - Posthar- vest Biol.
    keywords: color; cultivars; ethanol; flesh; life; nectarine; peach; peaches; shelf
       cache: ahs-3026.pdf
  plain text: ahs-3026.txt

        item: #299 of 594
          id: ahs-3027
      author: Caser, M.; Seglie, L.; Bizioli, R.; Scariot, Valentina
       title: Ethylene and the postharvest performance of cut camellia flowering branches
        date: 2015
       words: 3407
      flesch: 65
     summary: For this reason the use of camellia as cut flower has been restricted to situations where longevity is not especially important, even if the deep and bright green foliage with a high num- ber of flower buds make camellias potentially appreciated also as cut flowering branches. In the 1950’s considerable efforts were made to find treatments to extend camellia cut flower vase life by Cothran (1958).
    keywords: branches; camellia; cut; ethylene; flower; mcp; postharvest
       cache: ahs-3027.pdf
  plain text: ahs-3027.txt

        item: #300 of 594
          id: ahs-3028
      author: Capodilupo, M.; Stipic, M.; Venezia, Accursio
       title: Soilless cultivation of cherry tomato with gutter subirrigationn and reused substrate
        date: 2015
       words: 2765
      flesch: 58
     summary: Regarding aqueous extracts, pH values were lower in the upper layer: in pots with fresh substrate pH was 6.9 for the bottom and 5.9 for the top layer; in reused substrate, the average value was 6.5 for the bottom and 6.3 for the top. The results obtained in this experiment reveal no significant dif- ferences in production and fruit quality between plants grown on fresh substrate and those grown on reused substrate (marketable yield was 5.4 kg m-2 vs 5.3 kg m-2, respectively).
    keywords: soilless; substrate; tomato; venezia
       cache: ahs-3028.pdf
  plain text: ahs-3028.txt

        item: #301 of 594
          id: ahs-3029
      author: Molinu, Maria Giovanna; Dore, A.; D'hallewin, G.
       title: Effect of short heat treatments with a sodium bicarbonate solution on storability of the yellow germoplasm plum 'Meloni'
        date: 2015
       words: 5065
      flesch: 57
     summary: References CHENA Z., ZHUB C., 2011 - Combined effects of aqueous chlorine dioxide and ultrasonic treatments on postharvest storage quality of plum fruit (Prunus salicina L.). Weight loss and appearance Weight loss during storage and SMP ranged between 2 and 4% for control fruit.
    keywords: fruit; sbc; smp; storage; treatments; water
       cache: ahs-3029.pdf
  plain text: ahs-3029.txt

        item: #302 of 594
          id: ahs-3030
      author: Palma, Amedeo; Schirra, Mario; D'Aquino, S.
       title: Effect of film packaging and storage temperature on physical and chemical changes in fresh-cut green asparagus
        date: 2015
       words: 5523
      flesch: 60
     summary: Fig. 1 - Influence of film packaging (Film 1, Omnifilm PVC film; Film 2, Bolphane BX polyolefinic film) and storage conditions on in- package CO 2 (A), O 2 (B) and ethylene levels (C). A slight increase in TSS Fig. 3 - Effect of film packaging (Control, un-packaged; Film 1, Omnifilm PVC film; Film 2, Bolphane BX polyolefinic film) and storage conditions (2°C and 10°C) on cutting force (F max) and force displacement (L at F max) in green asparagus during 21 days of storage at 7.5 cm (A and C) and 15 cm (B and D) of the tip.
    keywords: asparagus; changes; days; film; packaging; samples; spears; storage
       cache: ahs-3030.pdf
  plain text: ahs-3030.txt

        item: #303 of 594
          id: ahs-3031
      author: D'Aquino, Salvatore; Palma, Amedeo; Satta, D.; De Pau, L.; Schirra, Mario
       title: Influence of azoxystrobin dip treatments on postharvest decay of second-crop fig (Ficus carica) fruits from Sardinian germoplasm
        date: 2015
       words: 3177
      flesch: 60
     summary: Key words: azoxystrobin, cold storage, fig fruit, fig decay, postharvest treatment. Proper postharvest technologies, such as precooling, film-wrapping, and conditioning in modified atmosphere environment are shown to extend the keeping quality of fig fruit (Turk, 1989; Piga et al., 1995, 1998; D’Aquino et al., 1998, 2003).
    keywords: azo; days; decay; fruit; treatments
       cache: ahs-3031.pdf
  plain text: ahs-3031.txt

        item: #304 of 594
          id: ahs-3032
      author: Bancarella, S.; Altamore, Luca; Valdesi, V.; Chironi, S.; Ingrassia, M.
       title: Importance of food labeling as a mean of information and traceability according to consumers
        date: 2015
       words: 4396
      flesch: 41
     summary: Therefore the objective of this study is: (1) categorize profiles of consumers according to the importance given to various information patterns shown on food labeling; (2) discover consumer behaviors when making a purchasing decision based on food information they require in the label; (3) discover consumer profiles with re- gards to food quality and the use QR Code to acquire further information about food products. The purpose of this study was to determine what infor- mation, of that possibly provided on the labels of food prod- ucts, consumers are particularly interested in knowing and what information consumers are looking for as added value as a guarantee of food quality and safety, e.g. traceability, absence of GMO, organic production, etc.
    keywords: attributes; consumer; data; food; information; labels; product; profile; quality; scaling; traceability
       cache: ahs-3032.pdf
  plain text: ahs-3032.txt

        item: #305 of 594
          id: ahs-3033
      author: Liguori, G.; Sortino, Giuseppe; De Pasquale, C.; Inglese, Paolo
       title: Effects of modified atmosphere packaging on quality parameters of minimally processed table grape during cold storage
        date: 2015
       words: 1934
      flesch: 61
     summary: Table grape is a non-climacteric fruit with a low rate of physiological activity that is very sensitive to water loss and fungal infection (Botrytis cinerea) during postharvest handling and cold storage. TSS content did not significantly change (P<0.05) in ‘Red Globe’ table grapes wrapped with PP (passive MAP) at the end of the shelf-life (Fig. 1B), while a significant in- crease (P<0.05) in TSS was found in table grapes packaged in both active PET1 and PET2 (active MAP), with an in- crease of 4% and 6% at the end of the shelf-life (Fig. 1B).
    keywords: days; life; red; storage; table
       cache: ahs-3033.pdf
  plain text: ahs-3033.txt

        item: #306 of 594
          id: ahs-3034
      author: Kakuei, F.; Salehi, H.
       title: Factors affecting in vitro propagation of Dracaena sanderiana Sander ex Mast. cultivars. I. Sterilization, explant browning, and shoot proliferation
        date: 2015
       words: 4593
      flesch: 62
     summary: Shoot proliferation rate in horizontal and vertical ex- plants: variegated cultivar Table 7 shows the difference between the proliferation rate of horizontally and vertically cultured explants of D. sanderiana ‘Variegated’ after 60 days of deployment with the concentrations of 1, 2, 3, 4 and 5 mg l-1 BA, and 0.25 and 0.5 mg l-1 NAA. Fig. 1 - Rate of shoot proliferation in Dracaena ‘Green’ cultured horizon- tally on 1/2 MS medium with mg l-1 BA and 0.25 mg l-1 NAA- 40 days after culture (left) and 60 days after culture (right).
    keywords: explants; l-1; mg l-1; naa
       cache: ahs-3034.pdf
  plain text: ahs-3034.txt

        item: #307 of 594
          id: ahs-3035
      author: Kakuei, F.; Salehi, H.
       title: Factors affecting in vitro propagation of Dracaena sanderiana Sander ex Mast. cultivars. II. MS salt strengths, subculturing times, rooting and acclimatization
        date: 2015
       words: 3137
      flesch: 68
     summary: The current status of plant tissue culture, pp. 1-22. - Plant tissue culture: Applications and limitation.
    keywords: l-1; length; number
       cache: ahs-3035.pdf
  plain text: ahs-3035.txt

        item: #308 of 594
          id: ahs-3036
      author: Jangali Baygi, M.; Alizadeh, M.; Ghaderifar, F.; Sharifani, M.
       title: Dormancy removal in pistachio nut: Influences of Hydrogen Cyanamid (Dormex®) as compared to ordinary seed chemical pre-treatments
        date: 2015
       words: 3670
      flesch: 56
     summary: Abstract: Seed germination is considered an important phenological stage of plant growth during which the viable, non- dormant embryos develop into seedlings under favorable conditions. In the present study, efficacy of Hydrogen Cyanamid (HCN, Dormex®) on seed germination of two cultivated pistachio varieties (Abasali, Shahpasand) were studied and the results were compared to ordinary ingredients, namely gibberellic acid (GA3) and KNO3.
    keywords: dormancy; germination; hcn; kno; pistachio; seed
       cache: ahs-3036.pdf
  plain text: ahs-3036.txt

        item: #309 of 594
          id: ahs-3037
      author: Bakri, Y; Akeed, Y.; Ouda, R.; Al-Domani, Th.; Arabi, M.I.E.; Jawhar, M.
       title: Lipase production by Fusarium culmorum in solid state fermentation
        date: 2015
       words: 2213
      flesch: 55
     summary: Since the effect of carbon sources on lipase production by the fungus F. culmorum has not been investigated so far, a study toward this aim was con- ducted on the new F. culmorum strain SY6 cultured under solid state fermentation (SSF). In the present study, lipase production by Fusarium culmorum SY6 was investigated under solid-state fermentation (SSF).
    keywords: activity; culmorum; enzyme; fermentation; lipase; production
       cache: ahs-3037.pdf
  plain text: ahs-3037.txt

        item: #310 of 594
          id: ahs-3038
      author: Rinaldi, L.M.R.; Leva, Annarita; D'Acqui, L.P.
       title: Influence of seed provenance on the propagation of Picea abies (L.) Karst
        date: 2015
       words: 5007
      flesch: 55
     summary: At provenance level, strong relationships are gener- Influence of seed provenance on the propagation of Picea abies (L.) Karst L.M.R. Rinaldi ¹, A. Leva ¹ (*), L.P. D’Acqui ² ¹ Istituto per la Valorizzazione del Legno e delle Specie Arboree, Consiglio Nazionale delle Ricerche, Via Madonna del Piano, 10, 50019 Sesto Fiorentino (FI), Italy. Therefore, the aim of this study was to assess the in- fluence of seed provenance on emergence and seedling growth of Picea and, as an ancillary purpose, to evaluate if an increase of the amount of organic matter (dust manure) in the growing media compared to that commonly used can improve or affect the emergence and seedling growth of Picea seeds of different provenance.
    keywords: abies; embryos; emergence; fiemme; growth; medium; picea; provenance; seedlings; seeds; substrate; val
       cache: ahs-3038.pdf
  plain text: ahs-3038.txt

        item: #311 of 594
          id: ahs-3039
      author: Ranjbar, A.; Ahmadi, N.
       title: Effects of 1-MCP and ethylene on antioxidant enzymes activity and postharvest physio-biochemical characterics of cut carnation flower cv. Fortune
        date: 2015
       words: 4991
      flesch: 53
     summary: The effect of 1-MCP on protecting chlorophyll content is a result of ethylene action and consequently in- hibition of ethylene biosynthesis, which is considered the Fig. In accordance with the present results, 1-MCP treatment at all concentrations decreased ethylene biosynthesis which was followed by reduction of chlorophyll destruction com- pared to control plants (Asil et al., 2013) (Fig. 3).
    keywords: activity; carnation; cut; enzyme; ethylene; flowers; life; mcp; postharvest; senescence; superoxide; vase
       cache: ahs-3039.pdf
  plain text: ahs-3039.txt

        item: #312 of 594
          id: ahs-3040
      author: Golubkina, N.A.; Nadezhkin, S.M.; Agafonov, A.F.; Kosheleva, O.V.; Molchanova, A.V.; Russo, Girolamo; Cuciniello, A.; Caruso, Gianluca
       title: Seed oil content, fatty acids composition and antioxidant properties as affected by genotype in Allium cepa L. and perennial onion species
        date: 2015
       words: 7040
      flesch: 58
     summary: In this respect, the inhibitory effect of Seed oil content, fatty acids composition and antioxidant properties as affected by genotype in Allium cepa L. and perennial onion species N.A. Golubkina1 (*), S.M. Nadezhkin1, A.F. Agafonov1, O.V. Kosheleva2, A.V. Molchanova1, G. Russo3, A. Cuciniello3, G. Caruso3 1 Agrochemical research center, All-Russian institute of vegetable breeding and seeds production, Select- sionnaya 14, 143080 Moscow region, Odintsovo district, VNIISSOK, Russia. 2 Laboratory of vitamins and mineral compounds, Institute of nutrition, Ustinsky pr. 2/14, 119480 Mos- cow, Russia. 3 Department of Agricultural Sciences, Naples University Federico II, via Università 100, 80055 Portici (NA), Italy. 201 Golubkina et al., Seed oil content as affected by genotype in onion Selenium concentration in onion seeds varied greatly (108-476 and 112-261 µg·kg-1 in perennial onions and Al- lium cepa respectively), giving the highest coefficient of variation (25% in A. cepa and 37% in perennial onions); the lowest CV was recorded for the oil content (9.2 and 11.2% in A. cepa and in perennial species seeds respec- tively).
    keywords: acids; allium; cepa; content; fatty; oil; onion; seeds
       cache: ahs-3040.pdf
  plain text: ahs-3040.txt

        item: #313 of 594
          id: ahs-3041
      author: Luvisi, Andrea; Rinaldelli, Enrico; Panattoni, A.
       title: Effects of extracellular K+ on grapevine membrane potential as influenced by the antiviral mycophenolic acid. An electrophysiological study
        date: 2015
       words: 3995
      flesch: 59
     summary: MPA interference was concentration-dependent and at the lower concentration MPA did not interfere with the effect on membrane potential induced by K+. In terms of metabolic dependence of MPA action in plant cells, antiviral drug translocation across membranes was linked to the free energy available in a proton elec- trochemical potential difference (Luvisi et al., 2012 b).
    keywords: membrane; mpa; panattoni; potential
       cache: ahs-3041.pdf
  plain text: ahs-3041.txt

        item: #314 of 594
          id: ahs-3042
      author: Lavee, Shimon
       title: Alternate bearing in olive initiated by abiotic induction leading to biotic responses
        date: 2015
       words: 3080
      flesch: 53
     summary: As olive fruit is initi- ated and develops from buds on shoots grown during the previous year, a reduction of vegetative shoot elongation and inhibition of lateral shoot out growth due to fruit de- velopment has a major effect on the general number of buds and thus on the potential reproductive buds in par- ticular. Abstract: Alternate bearing of olive trees is one of the most troublesome characteristics of this commodity, impacting its economy due to labor distribution, fruit and oil availability, oil mill capacity and marketing.
    keywords: bearing; fig; fruit; lavee; olive; reproductive
       cache: ahs-3042.pdf
  plain text: ahs-3042.txt

        item: #315 of 594
          id: ahs-3043
      author: Iwase, J.; Sato, Y.; Comparini, Diego; Masi, Elisa; Mancuso, Stefano; Kawano, Tomonori
       title: Non-invasive acoustic sensing of tuberous roots of sweet potato (Ipomoea batatas) growing belowground
        date: 2015
       words: 3270
      flesch: 58
     summary: In order to introduce such root veg- etables in “plant factories”, it is necessary to monitor the belowground properties and processes where plant roots take place, mainly spatial occupation by the growing root system and changes in water, salts, and other elements that can influence productivity and functioning of the soil ecosystem. (2012 a, b) who suggested that the growing tips of plant roots could be attracted by acoustic signals with specific spectra raging between 200 and 400 Hz, if plant roots were continuously exposed to the sound stimulus.
    keywords: fig; frequency; plant; potato; roots; sand; sensing; signal; sound; vegetables
       cache: ahs-3043.pdf
  plain text: ahs-3043.txt

        item: #316 of 594
          id: ahs-3044
      author: Sivakumar, R.; Srividhya, S.
       title: Impact of drought on flowering, yield and quality parameters in diverse genotypes of tomato (Solanum lycopersicum L.)
        date: 2016
       words: 6318
      flesch: 63
     summary: From perusal of the results obtained for SPAD value, soluble protein, SPS activity, fruit characters, lycopene, ascorbic acid, TSS and yield, it can be inferred that genotypes LE 114, LE 57, LE 118, and LE 27 performed better under drought conditions and can be categorized as drought tolerant genotypes compared to genotypes LE 1 and LE 125, drought susceptible ones. Comparing the irrigation treatments, plants that received 1.0 IW/CPE ratio recorded higher fruit yield than 0.5 IW/CPE ratio (Fig. 2).
    keywords: content; cpe; cpe ratio; drought; fruit; genotypes; plant; stress; water; yield
       cache: ahs-3044.pdf
  plain text: ahs-3044.txt

        item: #317 of 594
          id: ahs-3045
      author: Saleh, B.
       title: DNA changes in cotton (Gossypium hirsutum L.) under salt stress as revealed by RAPD marker
        date: 2016
       words: 5220
      flesch: 59
     summary: DNA changes induced by NaCl treatment using RAPD marker as described by loss or appearance of new bands (number and size) under salt stress compared to their respective controls for each variety separately Primer name N78 DE22 DP50 A118 Total poly- morphic bandsC T C T C T C T OPA02 9 8 9 9 ₋ (4) 400, 650, 1800 & 2500 (3) 650, 800 & 2500 (2) 1800 & 2500 (2) 1800 & 2500 16 ₊ (2) 600 & 1500 (3) 500, 600 & 900 ND ND OPA04 3 3 3 3 ₋ ND ND ND ND 5 ₊ (3) 400, 500 & 1000 (2) 400 & 500 ND ND OPB05 5 5 4 5 ₋ (4) 450, 650, 1000 & 2000 (3) 450, 1000 & 2000 (1) 900 (1) 2000 14 ₊ (3) 500, 700 & 1100 (2) 500 & 1100 ND ND OPB17 7 9 8 8 ₋ (5) 600, 700, 1100, 1200 & 1800 (4) 350, 800, 1500 & 1800 ND (5) 400, 600, 800, 1000 & 1800 20 ₊ (2) 400 & 650 (2) 700 & 1100 ND (2) 450 & 750 OPC08 4 5 5 4 ₋ (2) 1850 & 1900 (1) 1200 (1) 1850 ND 10 ₊ (2) 300 & 900 (2) 1350 & 1900 ND (2) 1850 & 1900 OPC13 6 6 5 5 ₋ (1) 1000 (2) 500 & 1000 ND ND 12 ₊ (5) 300, 800, 900, 1100 & 1350 (4) 300, 1100, 1350 & 1500 ND ND OPD08 4 3 4 3 ₋ (2) 450 & 700 (2) 450 & 750 (1) 900 (2) 450 & 800 15 ₊ (2) 650 & 1350 (4) 500, 600, 800 & 1350 (1) 800 (1) 600 OPD20 6 4 2 2 ₋ (4) 650, 850, 1100 & 1850 (3) 700, 900 & 1350 (1) 800 (1) 300 13 ₊ (1) 1350 (1) 800 (1) 300 (1) 200 OPE07 8 8 8 8 ₋ (5) 1000, 1300, 1800, 2300 & 3000 (1) 1800 ND ND 7 ₊ (1) 1100 ND ND ND OPE15 5 4 6 6 ₋ (1) 200 (2) 800 & 1800 ND ND 8 ₊ (4) 800,1300, 1500 & 1800 (1)1500 ND ND OPG11 3 3 3 3 ₋ ND ND ND ND 2 ₊ (1) 600 (1) 600 ND ND OPJ01 7 6 7 7 ₋ (5) 400, 600, 850, 1200 & 2000 (3) 400, 600 & 850 ND (2) 600 & 2000 20 ₊ (4) 350, 500, 950 & 1800 (4) 350, 500, 950 & 1800 ND (2) 500 & 800 OPJ07 3 4 2 3 ₋ (3) 500, 800 & 1600 (4) 300, 500, 700 & 1600 (2) 550 & 1350 (1) 1100 21 ₊ (3) 700, 900 & 1200 (3) 550, 1000 & 1200 (2) 450 & 1600 (3) 450, 550 & 650 to be continuedT(-) loss bands, (+) gains bands, (ND) no differences. Moreover, salt stress causes nuclear deforma- tion and subsequent nuclear degradation (Katsuhara and Kawaski, 1996).
    keywords: bands; changes; cotton; dna; nacl; nd nd; rapd; salt; stress; varieties
       cache: ahs-3045.pdf
  plain text: ahs-3045.txt

        item: #318 of 594
          id: ahs-3046
      author: Giro, A.; Ciappellano, S.; Ferrante, A.
       title: Vegetable production using a simplified hydroponics system inside City of Dead (Cairo)
        date: 2016
       words: 4791
      flesch: 60
     summary: COHEN M.J., GARRETT J.L., 2010 - The food price crisis and urban food (in) security. Growing cities, growing food: Urban agriculture on the policy agenda.
    keywords: areas; fig; food; fruits; plants; production; security; substrate; tomato
       cache: ahs-3046.pdf
  plain text: ahs-3046.txt

        item: #319 of 594
          id: ahs-3047
      author: Radice, S.; Arena, M.
       title: Characterization and evaluation of Berberis microphylla G. Forst pollen grains
        date: 2016
       words: 4185
      flesch: 55
     summary: Characterization of pollen grains is an important step for programs of genetic resource conservation and improvement, complementing basic studies of biological data that characterize genotypes (de Castro Nunes et al., 2012). The objective of this research was to describe the morphology and anatomy of pollen grains of Berberis microphylla G. Forst genotypes growing spontaneously on the island of Tierra del Fuego (Argentina), and evaluate their vitality and germination.
    keywords: arena; berberis; fig; genotypes; germination; grains; microphylla; pollen; species; viability
       cache: ahs-3047.pdf
  plain text: ahs-3047.txt

        item: #320 of 594
          id: ahs-3048
      author: Shahsavar, A.R.; Refahi, A.; Zarei, M.; Aslmoshtaghi, E.
       title: Analysis of the effects of Glomus etunicatum fungi and Pseudomonas fluorescence bacteria symbiosis on some morphological and physiological characteristics of Mexican lime (Citrus aurantifolia L.) under drought stress conditions
        date: 2016
       words: 5184
      flesch: 52
     summary: Inoculation with Pseudomonas species, led to moderation of drought stress effects, improvement of plant growth and increase of proline, soluble sugars and amino acids production, explaining their effectiveness in absorbing water and nutrients from the soil (Wu et al., 2008). Sci., 2016 30(1): 39-45 DOI: 10.13128/ahs-18700 Analysis of the effects of Glomus etunicatum fungi and Pseudomonas fluorescence bacteria symbiosis on some morphological and physiological characteristics of Mexican lime (Citrus aurantifolia L.) under drought stress conditions A.R. Shahsavar 1 (*), A. Refahi 1, M. Zarei 2, E. Aslmoshtaghi 1 1 Department of Horticultural Science, College of Agriculture, Shiraz University, Shiraz, Iran. 2 Department of Soil Science, College of Agriculture, Shiraz University, Shiraz, Iran.
    keywords: bacteria; drought; etunicatum; fungi; irrigation; leaf; plant; pseudomonas; stress; water
       cache: ahs-3048.pdf
  plain text: ahs-3048.txt

        item: #321 of 594
          id: ahs-3049
      author: Adam, A.; Idris, I.; Khalil, N.; Houssian, K.
       title: Induced resistance in potato plants by a non-pathogenic Pseudomonas putida BTP1 against potato tuber moth (Phthorimaea operculella Zeller)
        date: 2016
       words: 3994
      flesch: 61
     summary: Sci., 2016 30(1): 47-52 DOI: 10.13128/ahs-18701 Induced resistance in potato plants by a non-pathogenic Pseudomonas putida BTP1 against potato tuber moth (Phthorimaea operculella Zeller) A. Adam (*), I. Idris, N. Khalil, K. Houssian Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria (AECS), P.O. Box 6091, Damascus, Syria. In this study, we investigated induced resistance in potato plants against potato tuber moth (Phthorimaea operculella Zeller) by non-pathogenic P. putida BTP1.
    keywords: btp1; et al; larvae; moth; plants; potato; pupae; putida; resistance; tuber
       cache: ahs-3049.pdf
  plain text: ahs-3049.txt

        item: #322 of 594
          id: ahs-3050
      author: Luvisi, A.; Rizzo, D.; Stefani, L.; Panattoni, A.; Materazzi, A.
       title: Occurrence of viruses in Calla and Peruvian lily in Tuscan nurseries and evidence of new viral records in Italy
        date: 2016
       words: 2349
      flesch: 50
     summary: Table 3 - Sequence of isolates of Zantedeschia mild mosaic virus and Lily mottle virus isolate detected in Italy Zantedeschia mild mosaic virus isolate 2079 polyprotein gene, partial cds (GenBank: KF156666) TCATTGAGTACCAACCCCAACAGTCCGATCTGTTTAATACTCGCGCGTCACAAACCCAATTCAATAATTGGTATGATGCGATCAAAAATGAG- TATGGGGTTGATGATAGTCAGATGCAGAGAATCATGAATGGCTTCATGGTGTGGTGTCTCGAGAATGGGACATCACCAAACATAAATGGCGTGTGGGT- TATGATGGATGGGGATGAACAAGTAGAATTTCCACTAAAACCAATGGTGGAGAATGCCAAGCCTACGCTGCGTCAAATAATGCACCACTTTTCAGACG- CAGCCGAGGCTTACATTGAACTTAGGAATGCCGCTGCCCCATATATGCCTAGATATGGGTTGCTGCGGAACTTAAGAGACAGAGGTCTAGCACGCTTCG- CATTCGACTTCTATGAAGTCACTTCAAAGACACCAGATCGTGCTAGAGAAGCTGTAGCGCAGATGAAGGCAGCAGCGCTAAACAATGTTTCCACAAG- GATGTTTGGATTGGATGGAAATATTGCAACTGCCACGGAGAACACTGAAAGGCACACTGCTAAGGATGTAAGTCCGAGCATGCACTCGCTACTCGG- GATCTCAGCCTTGCAGTAAAGGAGCTGGAAACAGCCCACAGTTATTGTCTTGCGATAGGGTTTAAATAGCCGTACTATTGTCGTTGCTAGATGTTG- CAGTGTGGGCCTCCCACCTTAAGGTTTATCAGTGTGGCTTTCCACCTAGTTCCTTACATTGCGCATAGTATGTGT Lily mottle virus isolate 2409 coat protein gene, partial cds (GenBank: KF156662.1) TGCTGGGGCCTCTAGCTCCACACAAACGAGTCGCCCAACACGTCCAGAGATTGCCGCGGTCGATGTAGCACCACAACAGAGCTCTGAGGCTA- GAGTGCGTGATCGTGATGTTGATGCTGGCACCGTGGGAACATACCAAATCCCTCGACTGAAAGCACTGGCAACAAAGATTAACGTACCCAAGGT- CAAGGGGCGAACAATAGTGAACACTGGGCACCTTGTGAACTACAACCCAGACCAAACAGATATTTCAAATACAAGGTCAACCCAGAAGCAATTTGA- GACCTGGCATAACGCTGTGAAAGATGAGTATGGTCTCAACGACGAGAGTATGGCTCTCGCAATGAATGGTCTGATGGTTTGGTGCATAGAGAATGG- Res., 11: 173-188. PARK T.H., HAN I.S., KIM J.B., 2010 - Review on the devel- opment of virus resistant plants in Alstroemeria.
    keywords: alstroemeria; lily; mosaic; plants; virus; viruses
       cache: ahs-3050.pdf
  plain text: ahs-3050.txt

        item: #323 of 594
          id: ahs-3051
      author: Hara, A.; Takaichi, H.; Murata, Y.; Sakata, R.; Hara, Y.; Iwase, J.; Comparini, D.; Suzuki, T.; Kawano, T.
       title: Optical evaluation of the shading properties of climbing fern Lygodium japonicum used as thermal buffering green wall plant
        date: 2016
       words: 5578
      flesch: 55
     summary: In the Hibikino campus of the University of Kitakyushu (Wakamatsu-ku, Kitakyushu, Japan; 33˚ 53’24’’ North latitude, 130˚ 42’ 49’’ East longitude), semi-wildly propagating L. japonicum plants (Fig. (F) Even though it came after, L. japonicum plants are growing on the concrete wall by rapidly covering over the pre-exist- ing vines of Ficus pumila L. Plants were found on Hibikino campus of the University of Kitakyushu, Wakamatsu-ward, Kitakyushu, Japan (A-E), and a private garden in Miyazaki Prefecture, Japan (F).
    keywords: building; canopy; climbing; fig; green; heat; japonicum; leaves; light; lygodium; plant; walls
       cache: ahs-3051.pdf
  plain text: ahs-3051.txt

        item: #324 of 594
          id: ahs-3052
      author: Mortazavi, S.N.; Bagheri, F.; Bahadoran, M.
       title: Some characteristics of tuberose as affected by pre-harvest application of calcium chloride and gibberillic acid
        date: 2016
       words: 4673
      flesch: 66
     summary: Treatment with gibberellic acid has also been shown to enhance postharvest life and quality of gerbera cut flowers. Abstract: In the present study the effect of gibberellic acid (GA3) and calcium chloride (CaCl2) sprays (0, 150, 300 and 450 ml L-1), applied 25 and 15 days before harvesting, on physiological and morphological characteristics of tuberose ‘Pearl Double’ was studied.
    keywords: acid; cacl2; cut; effect; flowers; gibberellic; l-1; ml l-1; tuberose; water
       cache: ahs-3052.pdf
  plain text: ahs-3052.txt

        item: #325 of 594
          id: ahs-3053
      author: Liciulli, A.; Nisi, R.; Pal, S.; Laera, A.M.; Creti, P.; Chiechi, A.
       title: Photo-oxidation of ethylene over mesoporous Tio2/Sio2 catalysts
        date: 2016
       words: 3133
      flesch: 57
     summary: Licciulli et al. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts 77 3. Licciulli et al. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts 79 4.
    keywords: anatase; area; ethylene; oxidation; phase; samples; silica; sio2; surface; tio2
       cache: ahs-3053.pdf
  plain text: ahs-3053.txt

        item: #326 of 594
          id: ahs-3054
      author: Dutta, P.; Das, K.; Patel, A.
       title: Influence of organics, inorganic and biofertilizers on growth, fruit quality, and soil characters of Himsagar mango grown in new alluvial zone of west Bengala, india
        date: 2016
       words: 2986
      flesch: 60
     summary: Organic farming is currently gaining gradual momentum worldwide with growing awareness of health and environmental issues in agriculture and consumers demanding the production of organic fruit, thus offering an attrac- tive source of rural income. Fruit qualities are being dete- riorated through the use of chemical fertilizers (Huyskens-Keil and Schreiner, 2003).
    keywords: biofertilizer; fruit; inorganic; mango; plant; quality; soil
       cache: ahs-3054.pdf
  plain text: ahs-3054.txt

        item: #327 of 594
          id: ahs-3055
      author: Esmaeili, S.; Salehi, H.
       title: Kentucky bluegrass (Poa pratensis L.) silicon-treated turfgrass tolerance to short- and long-term salinity condition
        date: 2016
       words: 5368
      flesch: 64
     summary: Sci., 2016 30(2): 87-94 88 heavy metals (Yeo et al., 1999; Zwieniecki et al., 2001; Gao et al., 2004; Liang et al., 2005 a, b; Wang et al., 2005; Guo et al., 2007; Liang et al., 2007). Furthermore, it improves the activity of antioxidant enzymes, reducing the damage of reactive oxygen species (ROS) (Liang, 1999; Liang et al., 2003; Zhu et al., 2004) and reduces Na+ root uptake, alleviating specif- ic ion effects (Epstein, 2001; Gong et al., 2003; Liang et al., 2003).
    keywords: content; effects; et al; levels; liang; m-1; plant; salinity; salt; shoot; silicon; stress; tolerance; water
       cache: ahs-3055.pdf
  plain text: ahs-3055.txt

        item: #328 of 594
          id: ahs-3056
      author: Al-Safadi, B.; Nakar, M.
       title: Ultrastructural changes in potato (Solanum tuberosum) under NaCl mediated salinity stress in vitro
        date: 2016
       words: 5566
      flesch: 65
     summary: Discussion and Conclusions In this study we found that potato plants treated with low concentrations of salinity (50 and 100 mM) went into the osmotic stage. It is unclear, from our work, how naringin was synthesized and accumulated in the tis- sues of potato plants treated with NaCl.
    keywords: cells; crystals; et al; leaves; naringin; plants; potato; salinity; salt; stress; trichomes; type
       cache: ahs-3056.pdf
  plain text: ahs-3056.txt

        item: #329 of 594
          id: ahs-3057
      author: Soufi, S.; Ben Hamed, K.; Arbaoui, M.; Elbey, N.; Rezgui, S.; Abdely, C.; Bettaeib, T.
       title: Effect of H2O2 pretreatment on the response of two seashore paspalum (Paspalum vaginatum Sw.) cultivars (Salam and Seaspray) to cold stress
        date: 2016
       words: 4740
      flesch: 60
     summary: Cold stress exposure reduced the DW of pretreated cultivar Salam compared to the control with no significant difference observed between pretreated and untreated ‘Seaspray’ (p>0.05). Chemical pretreatment and cold stress exposure altered relative density of Peroxydase isoforms Peroxidase activity was assessed on polyacry- lamide gel to distinguish the different POD isoforms, and to quantify their activities using image j soft- ware.
    keywords: content; exposure; fig; h2o2; paspalum; plants; salam; seashore; seaspray; stress; vaginatum
       cache: ahs-3057.pdf
  plain text: ahs-3057.txt

        item: #330 of 594
          id: ahs-3058
      author: Khorsha, S.; Alizadeh, M.; Mashayekhi, K.
       title: The usefulness of apricot gum as an organic additive in grapevine tissue culture media
        date: 2016
       words: 5523
      flesch: 55
     summary: However, further studies are needed to exploit plant derived gums as an alternative carbon source in plant tissue culture media. LLUVERAS-TENORIO A., MAZUREK J., RESTIVO A., COLOM- BINI M.P., BONADUCE I., 2012 - Analysis of plant gums and saccharide materials in paint samples: comparison of GC-MS analytical procedures and databases.
    keywords: apricot; apricot gum; callus; culture; grapevine; growth; gum; media; plant; stevia; tissue; vitro
       cache: ahs-3058.pdf
  plain text: ahs-3058.txt

        item: #331 of 594
          id: ahs-3059
      author: Ibrahim, M.
       title: Arbuscular mycorrhizal isolate and phosphogypsum effects on growth and nutrients acquisition of cotton (Gossypium hirsutum L.)
        date: 2017
       words: 5531
      flesch: 60
     summary: Sci., 2016 30(3): 121-128 122 ents by AMF plants in combination with PG has been reported (Al-Karaki and Al-Omoush, 2002; Bai et al., 2011). The plants showed the highest number of bolls when PG/compost mixture was added to AMF plants (T6).
    keywords: amf; compost; cotton; et al; growth; inoculation; mycorrhizal; phosphogypsum; plants; soil
       cache: ahs-3059.pdf
  plain text: ahs-3059.txt

        item: #332 of 594
          id: ahs-3060
      author: Shahcheraghi, S.T.; Shekafandeh, A.
       title: Micropropagation of three endemic and endangered fig (Ficus carica L.) genotypes
        date: 2017
       words: 3764
      flesch: 60
     summary: In ‘Bargchenari’ genotype, the results showed dif- ferent concentration of Kn had no significant effect on shoots number (Fig. 2 A), although with adding Kn in culture media, shoot number increased. Previous reportes, on Ficus shoot proliferation with implica- tion of BA and 2ip in culture media, showed BA achieved better than 2ip on shoot proliferation on Ficus benjamina (Rzepka-Plevnes and Kurek, 2000) and Ficus anastasia (Al Malki and Elmeer, 2010).
    keywords: fig; l-1; medium; number; shoot
       cache: ahs-3060.pdf
  plain text: ahs-3060.txt

        item: #333 of 594
          id: ahs-3061
      author: Luvisi, A.; Rinaldelli, E.
       title: Insight on trans-plasma membrane behavior of virus-infected plant cells
        date: 2017
       words: 3648
      flesch: 56
     summary: The complex of results obtained in this research highlights, first of all, that membrane elec- trical response of the tested antiviral drugs is sup- ported by the metabolism of plant cell, and no differences in Δ RAWyLER A., ARPAGAUS S., BRAENDLE R., 2002 - Impact of oxygen stress and energy availability on membrane sta- bility of plant cells.
    keywords: et al; infection; membrane; panattoni; plant; plasma; trans; virus
       cache: ahs-3061.pdf
  plain text: ahs-3061.txt

        item: #334 of 594
          id: ahs-3062
      author: Adamipour, N.; Salehi, H.; Khosh-khui, M.
       title: Morpho-physiological alteration in common bermudagrass [Cynodon dactylon (L.) Pers.] subjected to limited irrigation and light condition
        date: 2017
       words: 6884
      flesch: 62
     summary: In a research, the resistances to low light stress in both bermudagrass and paspalum have been examined and it was con- cluded that resistance to low light stress in the pas- palum is more than bermudagrass (Jiang et al., 2004). Xu et al. (2010) investigated the effect of nitric oxide and sodium nitroprusside in tall fescue under high light stress and concluded that using sodium nitroprusside reduces enzyme activity of SOD, CAT and APX, but using nitric oxide increases the activity of mentioned enzymes.
    keywords: bermudagrass; capacity; content; drought; field; ldl; light; photoperiod; root; sdl; shoot; stress; table; treatments; weight
       cache: ahs-3062.pdf
  plain text: ahs-3062.txt

        item: #335 of 594
          id: ahs-3063
      author: Javanmardi, J.; Akbari, N.
       title: Salicylic acid at different plant growth stages affects secondary metabolites and phisico-chemical parameters of greenhouse tomato
        date: 2017
       words: 5223
      flesch: 57
     summary: JAVAHERI M., MASHAYEKHI K., DADKHAH A., ZAKER TAVALLAEE F., 2012 - Effects of salicylic acid on yield and quality characters of tomato fruit (Lycopersicum esculentum Mill.). - Int. Abstract: Most of the researches on Salicylic acid (SA) have focused on postharvest application or acquiring stress resis- tance, while studies on its effect on plant growth, secondary metabolites and fruit quality are limited.
    keywords: acid; activity; antioxidant; application; effect; et al; fruit; fruiting; plant; salicylic; tomato; total
       cache: ahs-3063.pdf
  plain text: ahs-3063.txt

        item: #336 of 594
          id: ahs-3064
      author: Hosseini, M.S.; Zahedi, S.M.; Fakhar, Z.
       title: Pre-storage putrescine treatment maintains quality and prolongs postharvest life of Musa acuminata L.
        date: 2017
       words: 2911
      flesch: 59
     summary: Weight loss, fruit softening, skin color changes, TSS, pH, the activity of PPO and PG increased during fruit ripening but the rate of changes was significantly slowed in putrescine treated fruits. As shown in figure 1B irrespective of treatments, fruit firmness decreased significantly over storage but putrescine treated fruits were observed firmer, and especially 2 mM putrescine treatments was more effective than others in keeping the firmness.
    keywords: effect; fruit; musa; putrescine; ripening; storage
       cache: ahs-3064.pdf
  plain text: ahs-3064.txt

        item: #337 of 594
          id: ahs-3065
      author: Chand, R.R.; Jokhan, A.D.; Gopalan, R.D.
       title: Bioactivity of selected essential oils from medicinal plants found in Fiji against the Spiralling whiteflies (Aleurodicus dispersus Russell)
        date: 2017
       words: 6695
      flesch: 62
     summary: Natural pesticides such as plant essential oil can represent an alternative in the crop protection (Coats, 1994; Isman, 2000; Koul et al., 2008). ISMAN M.B., MACHIAL C.M., 2006 - Pesticides based on plant essential oils: from traditional practice to commer- cialization, pp. 29-44. -
    keywords: activity; chemical; citratus; composition; compounds; effect; et al; fumigant; hortensis; koenigii; odorata; oils; plants; repellent; tenuiflorum; whiteflies
       cache: ahs-3065.pdf
  plain text: ahs-3065.txt

        item: #338 of 594
          id: ahs-3066
      author: Ceccarelli, D.; Talento, C.; Sartori, A.; Terlizzi, M.; Caboni, E.; Carbone, K.
       title: Comparative characterization of fruit quality, phenols and antioxidant activity of de-pigmented “Ghiaccio” and white flesh peaches
        date: 2017
       words: 4619
      flesch: 58
     summary: Significant differences were accepted at p<0.05 and represented by different letters on the column, within the cultivars or within the groups (“Ghiaccio” series and white flesh cultivars). Significant differences were accepted at p<0.05 and represented by dif- ferent letters on the column, within the cultivars or within the groups (“Ghiaccio” series and white flesh cultivars).
    keywords: antioxidant; content; cultivars; data; flesh; fruit; genotypes; ghiaccio; peaches; quality; series; white
       cache: ahs-3066.pdf
  plain text: ahs-3066.txt

        item: #339 of 594
          id: ahs-3067
      author: Baninaiem, E.; Mirzaaliandastjerdi, A.M.; Rastegar, S.; Abbaszade, Kh.
       title: Effect of pre- and postharvest salicylic acid treatment on quality characteristics of tomato during cold storage
        date: 2017
       words: 7541
      flesch: 62
     summary: Therefore, the aim of this article was to appraise the effects of pre and postharvest SA application to maintain the qualitative characteristics of tomato fruits at cold storage and increase the postharvest life of the tomato fruit. Chilling injury and electrolyte leakage Our results showed that CI increased during stor- age, but applying different concentrations of SA could significantly (P<0.01) affect chilling injury index in tomato fruit.
    keywords: acid; control; effect; et al; fruits; injury; postharvest; pre; quality; salicylic; sci; set; storage; tomato; treatments
       cache: ahs-3067.pdf
  plain text: ahs-3067.txt

        item: #340 of 594
          id: ahs-3068
      author: Massai, Rossano
       title: Foreword
        date: 2017
       words: 1152
      flesch: 33
     summary: These conditions thus suggest the presence of genes that can resist extreme climatic conditions, which may be a key to the future adaptation of fruit tree species grown in temperate climates to the progressive and unstoppable changes that climate changes are causing. It is easy to imagine what kind of genetic variability has been able to generate through these exchanges which allowed the spread, throughout the rest of the globe, of fruit species which today are some of the most cultivated worldwide.
    keywords: country; issue; species
       cache: ahs-3068.pdf
  plain text: ahs-3068.txt

        item: #341 of 594
          id: ahs-3069
      author: Masini, G.; Giordani, E.
       title: From traditional orchards to advanced fruitculture: establishing the bases of commercial horticulture in Afghanistan
        date: 2017
       words: 5513
      flesch: 42
     summary: The national collection of fruits and nuts of Afghanistan After the surveys of 2006-2008 in the most impor- tant areas of fruit production when the best and most “profitable” varieties were chosen together with fruit growers (who were recognized as “custodi- al” of the in situ selected accessions), an in situ col- lection formed of over 850 accessions was defined. Abstract: The Afghan economy is based essentially on the primary sector and, namely, on fruit production.
    keywords: afghanistan; agriculture; collection; development; fruit; horticulture; land; national; nuts; phdp; production; sector; varieties
       cache: ahs-3069.pdf
  plain text: ahs-3069.txt

        item: #342 of 594
          id: ahs-3070
      author: Giordani, E.; Berti, M.; Yaqubi, M.R.
       title: Phenotypic characterisation of almond accessions collected in Afghanistan
        date: 2017
       words: 6551
      flesch: 49
     summary: SORKHEH K., SHIRAN B., KHODAMBASHI M., MORADI H., GRADZIEL T.M., MARTÍNEZ P., 2010 - Correlations between quantitative tree and fruit almond traits and their implications for breeding. Sci., 2016 30(4): 207-216 DOI: 10.13128/ahs-20346 Phenotypic characterisation of almond accessions collected in Afghanistan E. Giordani 1 (*), M. Berti 2, M. Rauf Yaqubi 3 1 Dipartimento di Scienze delle Produzioni Agroforestali e dell’Ambiente, Università degli Studi di Firenze, Viale delle Idee, 30, 50019 Sesto Fiorentino (FI), Italy.
    keywords: accessions; afghanistan; almond; collection; colour; flower; fruit; kernel; kunduz; leaf; low; market; medium; sattarbai; shape; value
       cache: ahs-3070.pdf
  plain text: ahs-3070.txt

        item: #343 of 594
          id: ahs-3071
      author: Cullen, G.J.; Samadi, G.R.; Zarghon, A.H.; Yaqubi, M.R.
       title: Implications of investigating pollination and cross compatibility in the almond varieties of Afghanistan
        date: 2017
       words: 4629
      flesch: 48
     summary: Future work is provide information on the recom- mended combinations, to demonstrate the impor- Cullen et al. - Ramifications of investigations into pollination and cross compatibility of almond varieties in Afghanistan 223 tance of pollination with bees, to ensure orchard growers understand the importance of planting mix- tures of varieties, and taking remedial measures where they have single variety orchards. The Carmel flowered much later than other varieties, including Nonpareil.
    keywords: afghanistan; almond; cross; pollination; sattarbai; trials; varieties; variety
       cache: ahs-3071.pdf
  plain text: ahs-3071.txt

        item: #344 of 594
          id: ahs-3072
      author: Giordani, E.; Berti, M.; Yaqubi, M.R.; Stanikzai, S.; Amad, A.; Zadran, B.; Saeedi, A.; Ghous, M.
       title: Selected pomegranate germplasm from Afghanistan: morphological variability and relationship among collected accessions
        date: 2017
       words: 3512
      flesch: 50
     summary: Such accessions Variable Mean Range CV (%) Standard deviation Leaf - Total length (mm) 68.4 52.6-86.2 11.5 7.9 Leaf - Blade length (mm) 63.2 48.0-78.5 11.5 7.3 Leaf - Blade width (mm) 20.7 16.2-26.7 11.7 2.4 Flower - Petal length (mm) 26.1 19.2-30.8 9.1 2.4 Flower - Petal width (mm) 19.9 14.3-30.2 13.4 2.7 Flower - Length of calyx (mm) 38.5 29.5-46.7 10.2 3.9 Flower- Width of calyx (mm) 13.8 9.1-24.3 14.4 2.0 Fruit - Equatorial diameter (mm) 84.5 64.9-99.2 8.1 6.8 Fruit - Diameter of calyx (mm) 21.1 11.6-35.3 19.6 4.1 Fruit - Height without calyx (mm) 76.4 56.7-94.0 8.8 6.7 Fruit - Calyx height (mm) 23.2 14.8-34.6 18.6 4.3 Fruit - Total weight (g) 309.3 134.8-490.1 24.3 75.1 Fruit - Weight of non edible part (g) 144.6 76.6-323.1 31.7 45.8 Fruit - Edible/Total weight (%) 53.8 18.7-70.8 13.5 7.3 Seed - Weight (g) 0.3 0.2-0.4 18.8 0.1 Seed - Length (g) 10.3 8.0-13.6 8.9 0.9 Seed - Width (mm) 6.8 4.9-8.4 12.2 0.8 Table 1 - Mean values, ranges and coefficients of variation for 17 quantitative traits of pomegranate accessions of the National Fruit and Nuts Collection of Afghanistan Giordani et al. - Afghanistan selected pomegranate germplasm. CALISKAN O., BAYAZIT S., 2013 - Morpho-pomological and chemical diversity of pomegranate accessions grown in Eastern Mediterranean Region of Turkey. - J. Agr.
    keywords: accessions; afghanistan; bedana; fruit; granatum; pomegranate; punica; varieties
       cache: ahs-3072.pdf
  plain text: ahs-3072.txt

        item: #345 of 594
          id: ahs-3073
      author: Valori, F.; Ahkbari, A.; Yaqubi, M.R.; Enayat, N.; Azizi, F.; Wali Adel, M.
       title: Introduction of determination of optimum harvest date in Afghanistan. Sweet cherry: a case study
        date: 2017
       words: 4238
      flesch: 58
     summary: This study was conducted to evaluate OHD through physical and chemical measurements of fruit quality as a maturity index for estimating proper harvest time of Burlat cherries, in Kabul. Introduction During the last decades, after over ten years of reconstruction projects, Afghanistan horticulture has grown to the pre-war level.
    keywords: afghanistan; burlat; cherry; color; date; fruit; harvest; horticulture; maturity; quality; red
       cache: ahs-3073.pdf
  plain text: ahs-3073.txt

        item: #346 of 594
          id: ahs-3074
      author: Rehman, S.; Ahmad, J.; Lanzoni, C.; Rubies Antonel, C.; Ratti, C.
       title: The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the private Mother Stock Nurseries: a virus survey
        date: 2017
       words: 7136
      flesch: 54
     summary: It is well known that data regarding the presence and spread of different plant viruses are important for individual countries, their neighbours, and for the whole agricultural community where different virus- es can be spread by vegetative propagation via plant material. Key words: germplasm, plant pathology, virus disease.
    keywords: aclsv; afghanistan; central; citrus; collection; elisa; herat; isolates; material; north; plant; samples; south; virus; viruses
       cache: ahs-3074.pdf
  plain text: ahs-3074.txt

        item: #347 of 594
          id: ahs-3075
      author: , 
       title: Author Index
        date: 2017
       words: 2202
      flesch: -44
     summary: Some characteristics of tuberose as affect- ed by pre-harvest application of calcium chloride and gibberellic acid, 69 mURATA y. - Optical evaluation of the shading properties of climbing fern Lygodium japonicum used as a thermal buffering green wall plant, 59 NAKAR m. - Ultrastructural changes in potato (Solanum tuberosum) under NaCl mediated salinity stress in vitro, 95 NISI R. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts, 75 PAl S. - Photo-oxidation of ethylene over mesoporous TiO2/SiO2 catalysts, 75 PANATTONI A. - Occurrence of viruses in Calla and Peruvian lily in Tuscan nurseries and evidence of new viral records in Italy, 53 PATEl A. - Influence of organics, inorganic and biofertilizers on growth, fruit quality, and soil characters of Himsagar mango grown in new alluvial zone of West Bengal, India, 81 RADICE S. - Characterization and evaluation of Berberis microphylla G. Forst pollen grains, 31 RASTEGAR S. - Effect of pre- and postharvest salicylic acid treatment on quality characteristics of tomato during 251 cold storage, 183 RATTI C. - The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the pri- vate mother Stock Nurseries: a virus survey, 239 REFAHI A. - Analysis of the effects of Glomus etunicatum fungi and Pseudomonas fluorescence bacteria symbio- sis on some morphological and physiological character- istics of mexican lime (Citrus aurantifolia l.) under drought stress conditions, 39 REHmAN S. - The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the pri- vate mother Stock Nurseries: a virus survey, 239 REzGUI S. - Effect of H2O2 pretreatment on the response of two seashore paspalum (Paspalum vaginatum Sw.) [Cynodon dactylon (l.) Pers.] subjected to limited irrigation and light condition, 141 SAmADI G.R. - Implications of investigating pollination and cross compatibil ity in the almond varieties of Afghanistan, 217 SARTORI A. - Comparative characterization of fruit quality, phenols and antioxidant activity of de-pigmented “Ghiaccio” and white flesh peaches, 175 SHAHCHERAGHI S.T. - micropropagation of three endemic and endangered fig (Ficus carica l.) genotypes, 129 SHAHSAVAR A.R. - Analysis of the effects of Glomus etunica- tum fungi and Pseudomonas fluorescence bacteria sym- biosis on some morphological and physiological charac- teristics of mexican lime (Citrus aurantifolia l.) under drought stress conditions, 39 SHEKAFANDEH A. - micropropagation of three endemic and endangered fig (Ficus carica l.) genotypes, 129 SIVAKUmAR R. - Impact of drought on flowering, yield and quality parameters in diverse genotypes of tomato (Solanum lycopersicum l.), 3 SOUFI S. - Effect of H2O2 pretreatment on the response of two seashore paspalum (Paspalum vaginatum Sw.)
    keywords: afghanistan; paspalum; plant; quality; stress
       cache: ahs-3075.pdf
  plain text: ahs-3075.txt

        item: #348 of 594
          id: ahs-3076
      author: , 
       title: Subject Index
        date: 2017
       words: 1546
      flesch: -56
     summary: see SUBJECT INDEX Banana Climateric fruits, 75, 159 Ethylene production, 159 Putrescine treatment, 159 Quality, 159 Ripening process, 159 Shelf life, 159 Barberry Germination, 31 Pollen grains Pollen size, 31 Pollen viability, 31 Berberis microphylla G. Forst see Barberry Bermudagrass Antioxidative, 141 Irrigation, 141 Morpho-physiological alteration, 141 Photoperiod, 141 Turfgrass, 141 Biocontrol Potato, 47 Biofertilizers Mango, 81 Breeding Almond, 217 Building thermal control Japanese climbing fern, 59 ‘Burlat’ Sweet cherry, 231 Calla lily New viral evidence, 53 RT-PCR tests, 53 Tuscan nurseries, 53 Viruses occurrence, 53 Callus culture Carrot, 111 Grapevine, 111 Stevia, 111 Cananga odorata Spiralling whiteflies, 165 Carbon source Carrot, 111 Grapevine, 111 Stevia, 111 253 Bermudagrass Daucus carota L. see Carrot Decay Tomato, 183 De-pigmented cultivar Peach, 175 DNA changes Cotton, 13 Drought Tomato, 3 Drought deficit Mexican lime, 39 Endangered genotypes Fig, 129 Environmental measurements Japanese climbing fern, 59 Essential oils Spiralling whiteflies, 165 Ethylene Climateric fruits, 75 Tuberose, 69 Ethylene production Banana, 159 Euodia hortensis Spiralling whiteflies, 165 Explant Fig, 129 Ficus carica L. see Fig Fig Endangered genotypes, 129 Explant, 129 Micropropagation, 129 Rooting, 129 Shoot proliferation, 129 Single node, 129 Flavanone glycoside Potato, 95 Flavonoids Tomato, 151 Flower abscission Tomato, 3 Food security Tomato, 23 Growth Cotton, 121 Growth characters Mango, 81 Harvest date Sweet cherry, 231 Heavy metals Tomato, 23 High ethylene production Climateric fruits, 75 ‘Himsagar’ Mango, 81 Histological analysis Potato, 95 Hydrogen peroxide treatment Seashore paspalum, 103 Hydroponic system Tomato, 23 Imcopatibility groups Almond, 217 Inorganic manure Mango, 81 Ion fluxes Grapevine, 135 Tobacco, 135 Irrigation Bermudagrass, 141 Japanese climbing fern Building thermal control, 59 Environmental measurements, 59 Green roof, 59 Green wall, 59 Roof top garder, 59 Urban agriculture, 59 Kentucky bluegrass Chlorophyll content, 87 Proline content, 87 Salt stress, 87 Silicon treatments, 87 Turfgrass, 87 Kernel Almond, 207 Leaf water potential Mexican lime, 39 Liquid-crystal template Climateric fruits, 75 Fruitculture Afghanistan special issue, 197 Germplasm, 197 Plant nursery, 197 Traditional orchard, 197 Fumigant toxicity Spiralling whiteflies, 165 Gaseous phase photocatalysis Climateric fruits, 75 GC-MS test Spiralling whiteflies, 165 Genetic resources Almond, 207 Genome template stability Cotton, 13 Germination Barberry, see Apple Mangifera indica L. see Mango Mango Biofertilizers, 81 Growth characters, 81 ‘Himsagar’, 81 Inorganic manure, 81 Organic manure, 81 Quality, 81 Shelf life, 81 Soil microbial population, 81 Maturity index Sweet cherry, 231 Mexican lime Chlorophyll content, 39 Drought deficit, 39 Glomus etunicatum, 39 Leaf water potential, 39 Pseudomonas fluorescence, 39 Micro elements Tomato, 23 Micropropagation Fig, 129 Middle East Tomato, 23 Mineral nutrients Cotton, 121 Mixed oxides Climateric fruits, 75 Modified storage environment Climateric fruits, 75 Morphological variability Pomegranate, 225 Morpho-physiological alteration Bermudagrass, 141 Mother stock nurseries Phytosanitary status, 239 Phytochemicals Peach, 175 Phytosanitary status Aghanistan special issue, 239 Almond, 239 Apple, 239 Apricot, 239 Germplasm, 239 Grapevine, 239 Mother stock nurseries, 239 Peach, 239 Pear, 239 Plum, 239 Sweet cherry, 239 Virus disease, 239 Plant nursery Fruitculture, 197 Plant resistance Potato, 47 Plant-virus interaction Grapevine, 135 Tobacco, 135 Plum Phytosanitary status, 239 Poa pratensis L. see
    keywords: almond; phytosanitary; potato; status; tomato; whiteflies
       cache: ahs-3076.pdf
  plain text: ahs-3076.txt

        item: #349 of 594
          id: ahs-3077
      author: Harris, M.; Llorens, M.C.; Frezza, D.
       title: A calcium lactate treatment at harvest, growing system and refrigerated modified atmosphere can affect strawberry's 'Camaraosa' postharvest quality?
        date: 2017
       words: 4470
      flesch: 56
     summary: Technol., 43: 381-392. SHAFIEE M., TAGHAVI T.S., BABALAR M., 2010 - Addition of salicylic acid to nutrient solution combined with postharvest treatments (hot water, salicylic acid, and calcium dipping) improved postharvest fruit quality of strawberry. Could an immersion in calci- um allow an increase in storage temperature, main- taining fruit quality?
    keywords: calcium; days; fruits; lactate; postharvest; quality; soil; storage; strawberry; temperatures; treatment
       cache: ahs-3077.pdf
  plain text: ahs-3077.txt

        item: #350 of 594
          id: ahs-3078
      author: Hosseini, M.S.; Fakhar, Z.; Babalar, M.; Askari, M.A.
       title: Effect of pre-harvest putrescine treatment on quality and postharvest life of pear cv. Spadona
        date: 2017
       words: 3577
      flesch: 66
     summary: Moreover, the storage life and marketability of putrescine treated fruits were prolonged by decreas- ing decay incidence. It is suggested that polyamines maintain fruit firmness by their cross-linkage to the pectin substances carboxyl groups in the cell wall and lead to strengthening of cell wall and consequently decreasing cell wall degrading enzymes activities of pectin methyl esterase (PME), pectin esterase (PE) and polygalactouronase (PG) (Valero et al., 2002).
    keywords: et al; fruit; life; pear; postharvest; putrescine; storage
       cache: ahs-3078.pdf
  plain text: ahs-3078.txt

        item: #351 of 594
          id: ahs-3079
      author: Ghassemi-Golezani, K.; Ghassemi, S.; Yaghoubian, I.
       title: Improving oil and flavonoid contents of milk thistle under water stress by salicylic acid
        date: 2017
       words: 3569
      flesch: 59
     summary: Water stress reduced plant biomass, seeds per plant, 1000 seeds weight, seed yield, harvest index, oil percentage and consequently oil yield of milk this- tle. Water availability may influence physiological and biochemi- cal properties and seed yield of this medicinal plant.
    keywords: acid; ghassemi; golezani; oil; plant; seed; stress; water; yield
       cache: ahs-3079.pdf
  plain text: ahs-3079.txt

        item: #352 of 594
          id: ahs-3080
      author: Morano, G.; Amalfitano, C.; Sellitto, M.; Cuciniello, A.; Maiello, R.; Caruso, G.
       title: Effects of nutritive solution electrical conductivity and plant density on growth, yield and quality of sweet basil grown in gullies by subirrigation
        date: 2017
       words: 4336
      flesch: 61
     summary: Contrastingly, in previous research (Tesi et al., 1995) a decreasing trend of nitrate accumula- tion as a function of plant density increase was reported. Soilless growing of this crop is a current farm strategy and the quality targets are affected by nutritive solution as well as by plants density per pot.
    keywords: basil; density; leaves; nutritive; plants; pot; quality; solution; yield
       cache: ahs-3080.pdf
  plain text: ahs-3080.txt

        item: #353 of 594
          id: ahs-3081
      author: Hadian-Delijou, M.; Esna-Ashari, M.; Sarikhani, H.
       title: Effect of pre- and post-harvest salicylic acid treatments on quality and antioxidant Properties of 'Red Delicious' apples during cold storage
        date: 2017
       words: 5600
      flesch: 60
     summary: GARMING H., 2014 - Apple. - www.agribenchmark.org. GERANSAYEH M., SEPAHVAND S., ABDOSSI V., 2015 - Extending post-harvest longevity and improving quality of strawberry (Fragaria ananasa Duch cv. Gaviota) fruit by post-harvest salicylic acid treatment. SHAFIEE M., TAGHAVI T.S., BABALAR M., 2010 - Addition of salicylic acid to nutrient solution combined with post- harvest treatments (hot water, salicylic acid, and calci- um dipping) improved post-harvest fruit quality of strawberry.
    keywords: acid; antioxidant; apples; et al; fruit; harvest; post; salicylic; storage; treatment
       cache: ahs-3081.pdf
  plain text: ahs-3081.txt

        item: #354 of 594
          id: ahs-3082
      author: Radice, S.; Arena, M.
       title: Flower anatomy related to blooming development of Berberis microphylla G. Forst Berberida microphylla G. Forst (berberidaceae)
        date: 2017
       words: 3526
      flesch: 64
     summary: Sci., 2017 31(1): 39-44 DOI: 10.13128/ahs-20724 Flower anatomy related to blooming development of Berberis microphylla G. Forst (Berberidaceae) S. Radice, M. Arena Department of Plant Physiology, Facultad de Agronomía y Ciencias Agroalimentarias UM-CONICET, Machado 914, Lab. 501, B1708EOH, Morón. Abstract: Berberis microphylla G. Forst. is a Patagonian native shrub commonly named “calafate”, which has a growing economic potential due to its dark blue berries that are consumed fresh, as jams and preserves, and are used for the pro- duction of soft drinks and ice cream.
    keywords: arena; berberis; fig; flower; forst; microphylla; nectar; pollen; radice; stigma
       cache: ahs-3082.pdf
  plain text: ahs-3082.txt

        item: #355 of 594
          id: ahs-3083
      author: Venturieri, G.A.; Nesi, B.; Lazzereschi, S.; Pecchioli, S.; Burchi, G.
       title: Development of pollination and in vitro germination techniques to improve the hybridization in Hydrangea spp.
        date: 2017
       words: 4642
      flesch: 55
     summary: Since most Hydrangea seeds are so small (diameter of 0.5 mm) and hybrid seeds production is usually low (0-5 seeds/fruit), so, the development of a successful in vitro method for Hydrangea seed germination would be an important tool for breeding programs. To increase seed germination, Greer and Rinehart (2010) have developed an in vitro method for cultiva- tion and assay of H. macrophylla (Thunb.)
    keywords: cut; disinfection; fruits; germination; hydrangea; macrophylla; pollination; ppm; seeds; systems
       cache: ahs-3083.pdf
  plain text: ahs-3083.txt

        item: #356 of 594
          id: ahs-3084
      author: Rahemi, M.; Karimi, S.; Sedaghat, S.; Ali Rostami, A.
       title: Physiological responses of olive cultivars to salinity stress
        date: 2017
       words: 5076
      flesch: 59
     summary: Using the data collected at the start and the end of salinity stress treatments, the rate of these changes was calculated. The tolerance of olive cultivars are different to salinity stress (Therios and Misopolinos, 1988; Perica et al., 2004; Chartzoulakis, 2005).
    keywords: content; cultivars; leaf; mean; olive; salinity; stress; water
       cache: ahs-3084.pdf
  plain text: ahs-3084.txt

        item: #357 of 594
          id: ahs-3085
      author: Urban Krajnc, A.; Rakun, J.; Berk, P.; Ivancic, A.
       title: The impact of fruit temperature dynamics on heat stress tolerance of selected oil pumpkin genotypes
        date: 2017
       words: 7513
      flesch: 57
     summary: Darker colours are gen- erally associated with higher fruit temperatures. argyrosperma, Cucurbita moschata, Cucurbita okeechobeensis, Cucurbita pepo, fruit temperatures.
    keywords: argyrosperma; cucurbita; et al; exocarp; fig; fruits; heat; moschata; oil; oil pumpkin; pepo; pumpkin; temperatures
       cache: ahs-3085.pdf
  plain text: ahs-3085.txt

        item: #358 of 594
          id: ahs-3086
      author: Alpi, A.
       title: Foreword
        date: 2017
       words: 562
      flesch: 35
     summary: Harborne’s work has called for experimentation on all other classes of secondary metabolites, alkaloids, non­protein amino acids, glucosinolates, lectins, terpenes, steroids, tannins, flavonoids, phenylpropanoids, lignins, coumarin, waxes, etc. The plant’s specific organization has led it to produce a large amount of secondary metabolites and probably selective pressure has left those molecules capable of conferring specific benefits to the plant: defense role against animal, fungal and bacterial parasites, but also those molecules that allow to establish relationships between plants of the same species or between different species.
    keywords: metabolism; metabolites
       cache: ahs-3086.pdf
  plain text: ahs-3086.txt

        item: #359 of 594
          id: ahs-3087
      author: Bartolini, S.; Viti, R.; Ducci, E.
       title: Chemical characterization and sensory analysis by blind and visually impaired people of local peach varieties
        date: 2017
       words: 5764
      flesch: 53
     summary: CHOI D.G., YOU D.H., KIM H.G., RYU J., 2003 - Effect of rainfall interception on soil moisture, tree sap flow, and fruit quality in peach (Prunus persica) . - Acta Horticulturae, 620: 197-202. Biotechnol., 49: 85-89. LARIBI A.I., PALOU L., INTRIGLIOLO D.S., NORTES P.A., ROJAS-ARGUDO C., 2013 - Effect of sustained and regu- lated deficit irrigation on fruit quality of pomegranate cv.
    keywords: analysis; antioxidant; content; dolfo; food; fruit; mora; peach; quality; tss; varieties; year
       cache: ahs-3087.pdf
  plain text: ahs-3087.txt

        item: #360 of 594
          id: ahs-3088
      author: Romani, A.; Pinelli, P.; Moschini, V.; Heimler, D.
       title: Seeds and oil polyphenol content of sunflower (Helianthus annuus L.) grown with different agricultural management
        date: 2017
       words: 2437
      flesch: 56
     summary: Sunflowers prove to be a protein source of great interest for human nutrition; moreover, the residues originating from oil extrac- tion are rich in phenolic antioxidants, which account for 1-4% of the total mass with chlorogenic acid being the predominant component (Weisz et al., 2009). The main phenolic compounds present in both the kernel and hull besides chlorogenic acid are caffeic acid and caf- feoylquinic derivatives.
    keywords: acid; content; management; oil; organic; polyphenols; sunflower
       cache: ahs-3088.pdf
  plain text: ahs-3088.txt

        item: #361 of 594
          id: ahs-3089
      author: Masi, E.; Caparrotta, S.; Taiti, C.; Ieri, F.; Fiume, P.; Moselhy, N.; Mancuso, S.; Romani, A.
       title: Characterization of volatile compounds in Mentha spicata L. dried leaves
        date: 2017
       words: 4982
      flesch: 60
     summary: Tentative identification Protonated chemical formula Signal intensity (ppbv) Compound (% on the total) References 27.022 Acetylene C 2 H 3 + 22.9 ± 6.4 1.11 Vita et al. (2015) 31.018 Formaldehyde CH 3 O+ 56.3 ± 5.2 2.79 Kushch et al. (2008) 39.022 Isoprene fragment C 3 H 3 + 15.7 ± 2.2 0.74 Maleknia et al. (2007) 41.038 Alkyl fragment C 3 H 5 + 111.3 ± 12.7 5.81 Vita et al. (2015) 43.018 Alkyl fragment C 2 H 3 O+ 58.7 ± 21.5 2.9 Vita et al. (2015) 43.054 Alkyl fragment (propene) C 3 H 7 + 56.3 ± 5.2 2.66 Taiti et al. (2017) 45.033 Acetaldehyde C 2 H 5 O+ 13.5 ± 6.8 0.77 Taiti et al. (2016) 53.04 Cyclobutadiene C 4 H 5 + 37.3 ± 0.1 1.83 Vita et al. (2015) 55.055 C 4 aldehydes fragment C 4 H 7 + 40.3 ± 5.1 1.98 Taiti et al. (2017) 57.033 Alkyl Fragment (2-hexenal) C 3 H 5 O+ 8.0 ± 2.4 0.38 Brilli et al. (2011) 57.07 Alkyl fragment (Hexanol/valeric acid) C 4 H 9 + 19.8 ± 0.2 0.97 Aprea et al. (2015) 59.049 Propanal, acetone C 3 H 7 O+ 57.4 ± 17.2 2.7 Taiti et al. Sci., 2017 31(2): 89-95 92 reported in Materials and Methods section, the detected VOCs were integrated with the fragmenta- tion patterns of each compound (Maleknia et al., 2007; Kim et al., 2009; Brilli et al., 2011) and with the results of the GC-MS-based profile.
    keywords: compounds; dried; et al; leaves; mass; ptr; spearmint; taiti; tof
       cache: ahs-3089.pdf
  plain text: ahs-3089.txt

        item: #362 of 594
          id: ahs-3090
      author: Jamali, B.; Bonyanpour, A.R.
       title: Evaluation of adaptability potentials in seven iranian pomegranate cultivars based on comparison of physiological characteristics and leaf minearl composition
        date: 2017
       words: 5999
      flesch: 58
     summary: Previous investigations indicate varied levels of toler- ance to abiotic stress conditions such as drought and salinity among different pomegranate cultivars (Tabatabaei and Sarkhosh, 2006; Okhovatian- Ardakani et al., 2010; Ibrahim, 2016) because abiotic stress tolerance is a complex parameter and depends on both genetical and physiological properties. Significant differences were found among studied pomegranate cultivars for concentrations of leaf potassium, calcium magnesium, sodium and Iron concentrations.
    keywords: comparison; concentration; content; cultivars; fars; g-1; leaf; plant; pomegranate; rnf; stress; tolerance; total; water
       cache: ahs-3090.pdf
  plain text: ahs-3090.txt

        item: #363 of 594
          id: ahs-3091
      author: Tripodi, P.; Francese, G.; Mennella, G.
       title: Rocket salad: crop description, bioactive compounds and breeding perspectives
        date: 2017
       words: 4729
      flesch: 54
     summary: Several species, mainly belonging to the genus Eruca and Diplotaxis, are widely cultivated and recog- nized as rocket salad. Rocket salad is a plant member of the Brassicaceae family whose name encloses species of the Eruca and Diplotaxis genera characterized by leaves with peculiar pungent taste and strong flavour.
    keywords: accessions; compounds; diplotaxis; eruca; et al; glucosinolates; plant; rocket; salad; sativa; species; subsp; tenuifolia
       cache: ahs-3091.pdf
  plain text: ahs-3091.txt

        item: #364 of 594
          id: ahs-3092
      author: Del Carratore, R.; Podda, A.; Maserti, B.E.
       title: Fungal colonization improved growth and modulated the expression of myrosinase in black cabbage
        date: 2017
       words: 2791
      flesch: 52
     summary: Picture of the plants after one week from the inoculation (A); Biomass weight (mg) or shoot length (mm), at 0, 1 and 3 weeks after P. indica colonization (B).Values are the mean of ten independent experiments for each condition (control or inoculated) ±SD. Although P. indica colonization improves plant growth and resistance to abiotic stress (Sun et al., 2010), a negative impact on defence response path- way might increase the susceptibility of colonized black cabbage against biotic stress.
    keywords: black; cabbage; colonization; expression; growth; indica; plants
       cache: ahs-3092.pdf
  plain text: ahs-3092.txt

        item: #365 of 594
          id: ahs-3093
      author: Taiti, C.; Caparrotta, S.; Mancuso, S.; Masi, E.
       title: Morpho-chemical and aroma investigations on autochthonous and highly-prized sweet cherry varieties grown in Tuscany
        date: 2017
       words: 6279
      flesch: 62
     summary: Indeed, as it has been observed elsewhere for sweet cherry fruits (Crisosto et al., 2003; Garcia-Montiel et al., 2010) the increase in TSS/TA ratio during ripening process is due to the higher increase in TSS than the increase in TA. This allowed to drawing some further interesting consideration and to better appreciate the differ- ences between aroma profiles of sweet cherry fruits belonging to different cultivars (Fig. 2).
    keywords: aroma; chemical; cherry; compounds; cultivars; et al; ferrovia; fragment; fruit; nello; varieties; vocs
       cache: ahs-3093.pdf
  plain text: ahs-3093.txt

        item: #366 of 594
          id: ahs-3094
      author: Refahi, A.; Shahsavar, A.R.
       title: Effects of salinity stress on certain morphological traits and antioxidant enzymes of two Carica papaya cultivars in hydroponic culture
        date: 2017
       words: 5702
      flesch: 56
     summary: Introduction The ability of plants to tolerate salinity stress is facilitated by a series of biochemical pathways which maintain or absorb water, protect plants chloroplast function and sustain an ionic balance. Salinity stress in soil or water, especially in hot, arid regions, could limit plant growth and reduce its yield (Koca et al., 2007).
    keywords: activity; cultivars; difference; levels; plant; proline; salinity; salinity levels; salt; stress; treatment; weight
       cache: ahs-3094.pdf
  plain text: ahs-3094.txt

        item: #367 of 594
          id: ahs-3095
      author: Ieri, F.; Cecchi, L.; Vignolini, P.; Belcaro, M.F.; Romani, A.
       title: HPLC/DAD, GC/MS and GC/GC/TOF analysis of Lemon balm (Melissa officinalis L.) sample as standarlized raw material for food and nutraceutical uses
        date: 2017
       words: 4236
      flesch: 54
     summary: In the first step of GC-MS analy- sis, HS-SPME-GC-MS was selected as the most suit- able technique to recover and analyze the highest number of Volatile Organic Compounds (VOCs) in Melissa officinalis L. samples. KONG W.J., ZHAO Y.L., XIAO X.H., JIN C., LI Z.L., 2009 - Quantitative and chemical fingerprint analysis for qual- ity control of Rhizoma coptidischinensis based on UPLC-PAD combined with chemometrics methods.
    keywords: acid; analysis; balm; citral; compounds; hplc; lemon; melissa; officinalis; sample
       cache: ahs-3095.pdf
  plain text: ahs-3095.txt

        item: #368 of 594
          id: ahs-3096
      author: Melito, S.; D'Amelia, V.; Garramone, R.; Villano, C.; Carputo, D.
       title: Tuber yield and processing traits of potato advanced selections
        date: 2017
       words: 4018
      flesch: 60
     summary: overall, the number of potato varieties cultivated for processing purposes is increasing and more than 50% of potato yield is driven to food industries. MAlone J.G., MittoVA V., rAtCliFFe r.G., KruGer n.J., 2006 - The response of carbohydrate metabolism in potato tubers to low temperature.
    keywords: chipping; clones; potato; processing; short; storage; tuber; varieties; yield
       cache: ahs-3096.pdf
  plain text: ahs-3096.txt

        item: #369 of 594
          id: ahs-3097
      author: Amirinejad, A.-A.; Sayyari, M.; Ghanbari, F.; Kordi, S.
       title: Salicylic acid improves salinity-alkalinity tolerance in pepper (Capsicum annuum L.)
        date: 2017
       words: 4774
      flesch: 59
     summary: Results showed that SS and AS imposed negative effects on pepper plant growth and productivity. Conclusions in summary, our study clearly showed that saline and alkaline stresses as two types of abiotic stresses, have negative effects on pepper plant growth and productivity.
    keywords: acid; et al; growth; pepper; plants; proline; salicylic; salt; stress; stresses
       cache: ahs-3097.pdf
  plain text: ahs-3097.txt

        item: #370 of 594
          id: ahs-3098
      author: Mujib, A.; Ali, M.; Tonk, D.; Zafar, N.
       title: Nuclear 2C DNA and genome size analysis in somatic embryo regenerated gladiolus plants using flow cytometry
        date: 2017
       words: 7029
      flesch: 55
     summary: Nuclear homogenate of juvenile leaves from naturally grown and somatic embryo regenerated plants were used for flow cytometry and the obtained results are pre- sented in figure 3. The 2C nuclear DNA content values of both the two sources are nearly the same that suggests no major alteration in genome size in embryo regenerated plants when compared with corm derived gladiolus.
    keywords: bap; callus; dna; embryo; embryogenesis; et al; flow; gladiolus; maturation; medium; naa; plant
       cache: ahs-3098.pdf
  plain text: ahs-3098.txt

        item: #371 of 594
          id: ahs-3099
      author: Sepehrtaj, A.; Shahsavar, A.R.
       title: Uniform and virus-free citrus rootstocks production via nucellus culture
        date: 2017
       words: 4785
      flesch: 63
     summary: The highest rooting rate for Mexican lime was in culture medium containing 0.5 mg l-1 IBA and for bitter orange, it was the culture medium containing 1 mg l-1 IBA. Rooting of the gener- ated shoots have been reported differently consider- ing used genotype, culture medium and IBA concen- tration (Chaturvedi and Mitra, 1974;
    keywords: citrus; culture; lime; medium; mg l-1; nucellus; orange; shoots
       cache: ahs-3099.pdf
  plain text: ahs-3099.txt

        item: #372 of 594
          id: ahs-3100
      author: Mohamedova, M.
       title: Field evaluation of three biopesticides for control of the raspberry cane midge, Resseliella thobaldi (Barnes) in Bulgaria
        date: 2017
       words: 4324
      flesch: 61
     summary: For instance, use of products based on entomopathogenic bacteria, Bacillus thuringiensis (Bt) and Streptomyces avermi- tilis against raspberry midge blight have been report- ed (Shternshis et al., 2002). Table 1 - efficacy of three biopesticides using against raspberry midge cane in Bogdanovo Means within each column followed by the same letter are not significantly different, duncan’s test (p<0.05).
    keywords: cane; control; larvae; midge; neemazal; number; raspberry; subtilis; theobaldi
       cache: ahs-3100.pdf
  plain text: ahs-3100.txt

        item: #373 of 594
          id: ahs-3101
      author: Asheri, M.; Sharifani, M.M.; Kiani, G.
       title: An examination into the effects of frozen storage of olive fruit on extracted olive oils
        date: 2017
       words: 5420
      flesch: 63
     summary: Oil derived from frozen olive fruit is not of inferior quality to non-frozen fruit in the production of olive oil. Olive oil consumption is increasing throughout the world, even in countries that traditionally have not used olive oil.
    keywords: acid; content; fatty; freezing; fruits; oil; oils; olive; quality; storage
       cache: ahs-3101.pdf
  plain text: ahs-3101.txt

        item: #374 of 594
          id: ahs-3102
      author: Sakr, N.
       title: Aggressiveness of four Fusarium head blight species on wheat cultivars
        date: 2017
       words: 3008
      flesch: 58
     summary: Sci., 2017 31(3): 199-203 DOI: 10.13128/ahs-20585 Aggressiveness of four Fusarium head blight species on wheat cultivars N. Sakr Department of Agriculture, Atomic Energy Commission of Syria, P.O. Box 6091, Damascus, Syria. Two aggressiveness criteria: diseased-head severity (DHS, Fusarium infection) and disease development (DD, Fusarium spread) were visually estimated as percentage of heads showing Fusarium symptoms in wheat cultivars at the soft dough stage.
    keywords: cultivars; fusarium; head; isolates; species; wheat
       cache: ahs-3102.pdf
  plain text: ahs-3102.txt

        item: #375 of 594
          id: ahs-3103
      author: Golabadi, M.; Golkar, P.; Eghtedari, A.-R.
       title: Effect of different physio-chemical factors on sex expression and fruit yield in green-house cucumber
        date: 2017
       words: 6837
      flesch: 62
     summary: ** NS NS * NS NS CH ×LGS 10 * ** NS NS NS NS NS NS NS SP×LGS 2 NS NS NS NS * NS NS NS NS S×CH×SP 5 NS NS NS NS NS NS NS NS NS S×CH×LGS 10 ** ** NS ** * NS NS NS NS CH×SP×LGS 10 NS NS NS NS NS NS * NS NS S×SP×LGS 2 NS NS NS NS * NS NS NS NS S×CHSP×LGS 10 NS NS NS NS NS NS NS NS NS Residual 140 NS NS NS NS NS NS NS NS NS Golabadi et al. - Effect of different physio-chemical factors on sex expression and fruit yield in greenhouse cucumber 209 showed that important traits related to change of sex expression such as days to male flowering, node number of first male flower, and number of male flower more affected by different interactions in con- trast to vegetative and yield related traits. In the two chemical treatments at high- er concentration, double spraying caused increasing of male flower number, although differences between one and two spraying in low concentrations of chemical agents was not significant.
    keywords: agno3; chemical; cucumber; flower; flowering; fruit; growth; leaf; male; number; ppm; sex; stage
       cache: ahs-3103.pdf
  plain text: ahs-3103.txt

        item: #376 of 594
          id: ahs-3104
      author: Ciurli, A.; Huarancca Reyes, T.; Guglielminetti, L.
       title: Commercial advantages on basil architecture by ultraviolet-B irradiation
        date: 2017
       words: 4300
      flesch: 62
     summary: For instance, plant species grown in Mediterranean and Tropical environments and/or at high altitudes have developed defensive mechanisms to protect them- selves against UV radiation (Zheljazkov et al., 2008). DEL CORSO G., LERCARI B., 1997 - Use of UV radiation for control of height and conditioning of tomato trans- plants (Lycopersicon esculentum Mill.).
    keywords: basil; control; cultivars; days; fig; growth; plants; radiation; treatment
       cache: ahs-3104.pdf
  plain text: ahs-3104.txt

        item: #377 of 594
          id: ahs-3105
      author: Negro, C.; De Bellis, L.; Sabella, E.; Nutricati, E.; Luvisi, A.; Miceli, A.
       title: Detection of not allowed food-coloring additives (copper chlorophyllin; copper-sulphate) in green table olives sold on the Italian market
        date: 2017
       words: 4787
      flesch: 65
     summary: Negro et al. - Detection of not allowed food-coloring additives in green table olives in italian market 233 FODALE A.S., MULE R., TAGLIAVIA M., TUCCI A., 2007 - The processing of green olives using the “Castelvetrano” method. Sci., 2017 31(4): 225-233 DOI: 10.13128/ahs-20814 Detection of not allowed food-coloring additives (copper chlorophyllin, copper- sulphate) in green table olives sold on the Italian market C. Negro, L. De Bellis, E. Sabella, E. Nutricati, A. Luvisi, A. Miceli Dipartimento di Scienze e
    keywords: addition; chlorophyll; copper; e141ii; food; green; n.r; olives; samples; table
       cache: ahs-3105.pdf
  plain text: ahs-3105.txt

        item: #378 of 594
          id: ahs-3106
      author: Kopta, T.; Antal, M.; Jurica, M.; Volkova, J.; Pokluda, R.
       title: The Influence of synthetic strigolactones and plant extracts on the morphological parameters of onion (Allium cepa)
        date: 2017
       words: 3698
      flesch: 59
     summary: These seeds can be stimulated by preparations containing strigolactones obtained from plant roots showing effects already in extremely low concentra- tions: for example, a concentration less than 10-10 mol l-1 is sufficient to stimulate the germination of parasitic plants (Humphrey et al., 2006). Sci., 2017 31(4): 235-240 dOI: 10.13128/ahs-20517 The Influence of synthetic strigolactones and plant extracts on the morphological parameters of onion (Allium cepa) T. Kopta 1 (*), M. Antal 2, M. Jurica 1, J. Volková 2, R. Pokluda 1 1 Department of Vegetable Growing and Floriculture, Faculty of Horticulture, Mendel University Brno, Brno, Czech Republic.
    keywords: fenyl; influence; leaf; length; mixture; parameters; plant; strigolactones
       cache: ahs-3106.pdf
  plain text: ahs-3106.txt

        item: #379 of 594
          id: ahs-3107
      author: Dolkar, T.; Sharma, M.K.; Kumar, A.; Mir, M.S.; Hussanin, S.
       title: Genetic variability and correlation studies in grapes (Vitis vinifera L.) in Leh District of Jammu and Kashmir
        date: 2017
       words: 4676
      flesch: 59
     summary: keeping in view the economic importance of grapes and to boost its cultivation in the Leh District, the present investigation was carried out to generate the vital information on the existing germplasm of grape vine in the Leh district and selec- tion of elite clones for further multiplication and dis- tribution among the farmers. 2. To preserve the current genetic pool and to use it judiciously, it is necessary to evaluate the extent of this diversity by identification and distinc- tion of grape accessions, as well as the determination of genetic relationship between local cultivars and wild relatives (Negrul, 1973).
    keywords: berry; bunch; grape; length; number; weight; yield
       cache: ahs-3107.pdf
  plain text: ahs-3107.txt

        item: #380 of 594
          id: ahs-3108
      author: Qrunfleh, I.M.; Ammari, T.G.; Abu-Romman, S.
       title: ‘Superior Seedless’ grafted on three selected grapevine rootstocks grown on calcareous soil under diluted brackish water irrigation. I. Growth performances
        date: 2017
       words: 5324
      flesch: 60
     summary: Three levels of irrigation water salinity, in terms of electrical con- ductivity (EC), were applied: 1.5, 3.0 and 5.0 dS m-1 in addition to the 0.8 dS m-1 control. Sci., 2017 31(4): 249-256 256 GOLAn R., SAGI M., PASTERnAK D., 2005 - Effects of timing and duration of brackish irrigation water on fruit yield and quality of late summer melons.
    keywords: 41b; irrigation; leaf; m-1; p1103; rootstocks; salinity; seedless; soil; water
       cache: ahs-3108.pdf
  plain text: ahs-3108.txt

        item: #381 of 594
          id: ahs-3109
      author: Schwerz, F.; Sgarbossa, J.; Olivoto, T.; Elli, E.; Aguiar, A.; Caron, B.; Schmidt, D.
       title: Solar radiation levels modify the growth traits and bromatological composition of Cichorium intybus
        date: 2017
       words: 5720
      flesch: 54
     summary: Therefore, solar radiation levels may modify the biomass accumulation and bromatological composition. Schwerz et al. - Solar radiation levels modify the growth traits of Cichorium intybus 261 plants growing under reduced radiation availability (50% and 70%) presented respectively 51.6% and 40.1% higher radiation use efficiency than those growing under 100% of solar radiation level.
    keywords: area; chicory; chlorophyll; content; efficiency; growth; leaf; leaves; levels; light; plants; radiation; radiation levels; use
       cache: ahs-3109.pdf
  plain text: ahs-3109.txt

        item: #382 of 594
          id: ahs-3110
      author: Pallavi, B.; Nivas, S.K.; D'Souza, L.; Ganapathi, T.R.; Hegde, S.
       title: Gamma rays induced variations in seed germination, growth and phenotypic characteristics of Zinnia elegans var. Dreamland
        date: 2017
       words: 3714
      flesch: 62
     summary: A higher frequency of flower colour mutation was observed in 100Gy. Induced plant mutations in the genomics era.
    keywords: colour; elegans; flower; gamma; germination; height; plant; seedlings; seeds; zinnia
       cache: ahs-3110.pdf
  plain text: ahs-3110.txt

        item: #383 of 594
          id: ahs-3111
      author: Qrunfleh, I.M.; Abu-Romman, S.; Ammari, T.G.
       title: ‘Superior Seedless’ grapevine grafted on three rootstocks grown on calcare- ous soil under diluted brackish water irrigation. II. Expression of antioxidant genes
        date: 2017
       words: 4009
      flesch: 54
     summary: Three levels of irrigation water salinity; in terms of electrical conductivity (EC), were applied: 1.5, 3.0 and 5.0 dS m-1 in addition to the 0.8 dS m-1 control. Most knowledge on molecular mechanisms involved in plant salt responses and adaptation has been derived from analyses of the glycophytic mod- els Arabidopsis thaliana and rice.
    keywords: antioxidant; expression; irrigation; plant; response; rootstocks; salinity; salt; seedless; stress; water
       cache: ahs-3111.pdf
  plain text: ahs-3111.txt

        item: #384 of 594
          id: ahs-3112
      author: Dadashpour, A.; Shekafandeh, A.; Oladi, R.
       title: Anatomical and morphological changes in scion of some olive grafting combinations under water deficit
        date: 2017
       words: 5349
      flesch: 56
     summary: Abstract: Effects of water stress deficit were studied on xylem anatomical fea- tures and some growth parameters among six olive grafting combinations; Amygdalifolia/Arbequina (Am/Ar), Amygdalifolia/Koroneiki (Am/Ko), Amygdalifolia/Zard (Am/Z), Conservallia/Koroneiki (Co/Ko), Conservallia/Zard (Co/Z) and Conservallia/Arbequina (Co/Ar) of about three-year-old olive trees (Olea europaea L.) under greenhouse conditions. Morphological parameters In order to evaluate the growth indices of grafted plants under the period of water stress deficit, main stem length growth (SL) was calculated based on a difference between the stem length above graft union at the beginning and at the end of the drought period.
    keywords: deficit; drought; graft; growth; olive; rootstocks; scion; stress; trees; vessel; water; xylem; zard
       cache: ahs-3112.pdf
  plain text: ahs-3112.txt

        item: #385 of 594
          id: ahs-3113
      author: Cirillo, C.; Russo, R.; Famiani, F.; Di Vaio, C.
       title: Investigation on rooting ability of twenty olive cultivars from Southern Italy
        date: 2017
       words: 4147
      flesch: 55
     summary: Taking this background into considera- tion, the main aim of this study was to assess the rooting ability of olive cuttings obtained from twenty autochthonous olive cultivars of the Campania Region, by using different combinations of auxin treatments (NAA and NAD), times of collection of cuttings (spring and autumn) and portions of shoots to prepare the cuttings (basal, middle or apical). × TS NS Table 1 - Analysis of variance for cultivars, hormonal rooting treatments, time of sampling and their interactions on rooting rate of olive cuttings Adv.
    keywords: autumn; cultivars; cuttings; number; olive; rate; rooting; spring; treatment
       cache: ahs-3113.pdf
  plain text: ahs-3113.txt

        item: #386 of 594
          id: ahs-3114
      author: Abedi Gheshlaghi, E.; Rabiei, V.; Ghasemi, M.; Fattahi, J.; Razavi, F.
       title: Phenolic metabolism and antioxidant activity during endodormancy of Kiwifruit buds
        date: 2017
       words: 5778
      flesch: 59
     summary: During bud endodormancy, there is no visible growth, but physiological changes in respiration, growth regulators, carbohydrate metabolism, the amount of water, and other com- pounds occur, influencing bud endodormancy control (Ben mohamed et al., 2010). the duration of bud endodormancy was different in the cultivars and genotypes.
    keywords: activity; antioxidant; buds; capacity; cultivars; endodormancy; enzyme; et al; fig; genotypes; kiwifruit; phenol
       cache: ahs-3114.pdf
  plain text: ahs-3114.txt

        item: #387 of 594
          id: ahs-3115
      author: Pardini, A.; Massolino, F.; Grassi, C.
       title: Opuntia ficus-indica (L.) Mill. growing in soil and containers for urban agriculture in developing areas
        date: 2017
       words: 3861
      flesch: 60
     summary: COHEN M.J, GARRET J.L., 2009 - The food price crisis and urban food (in)security. - International Institute for Environment and Development, IIED, London, UK, pp. 39. Urban agriculture and horticulture can contribute to the avail- ability of fresh foods, officinal and medicinal plants, but the little availability of irrigation and surface to destine for cropping suggest the convenience of little water consuming species, with little needs of soil fertility and that can be eaten entirely.
    keywords: agriculture; average; cladodes; ficus; food; indica; opuntia; pear; pots; soil; tires
       cache: ahs-3115.pdf
  plain text: ahs-3115.txt

        item: #388 of 594
          id: ahs-3116
      author: Chand, R.R.; Jokhan, A.D.; Gopalan, R.D.
       title: A mini-review of essential oils in the South Pacific and their insecticidal properties
        date: 2017
       words: 10361
      flesch: 52
     summary: (Dambolena et al., 2016). Octopamine exerts the effects through octopamine-1 and octopamine-2 receptors through- out their union with G-protein-coupled receptors (Dambolena et al., 2016).
    keywords: activities; activity; aedes; aegypti; anopheles; coleoptera; compounds; control; effects; et al; extracts; family; fever; food; insecticidal; insecticidal activity; insects; isman; larvicidal; leaf; leaves; mosquito; oils; pacific; plants; properties; res; sci; seed; south; species; stomach; toxicity
       cache: ahs-3116.pdf
  plain text: ahs-3116.txt

        item: #389 of 594
          id: ahs-3117
      author: Taiti, C.; Marone, E.
       title: EVOO or not EVOO? A new precise and simple analytical tool to discriminate extra virgin olive oils
        date: 2017
       words: 5950
      flesch: 58
     summary: Starting from this result, the aim of the current work was to develop and to test a fast analytical method that combines efficiency, accuracy and reliability for a rapid screening and quantification of volatile com- pounds in olive oil samples. 1 - Schematic representation of oil samples analyses and classification using the PTR-ToF-MS.
    keywords: analysis; compounds; evoo; italy; oil; oils; olive; panel; ptr; samples; test; tof; virgin
       cache: ahs-3117.pdf
  plain text: ahs-3117.txt

        item: #390 of 594
          id: ahs-3118
      author: Kamiab, Fereshteh
       title: 24-Epibrassinolide improves some physiological disorders in pistachio cultivars
        date: 2017
       words: 6911
      flesch: 61
     summary: The objective of the study was to evaluate the effect of 24-epibrassinolid on quantitative and qualitative traits of pistachio fruit. Vardhini and Rao (1998) showed the relation- ship between increased growth and DNA, RNA and protein synthesis in peanut.
    keywords: application; brassinosteroides; control; cultivars; fruit; growth; hormone; pistachio; plant; year; yield
       cache: ahs-3118.pdf
  plain text: ahs-3118.txt

        item: #391 of 594
          id: ahs-3119
      author: Akutsu, Masako
       title: Storage conditions of soft X-ray irradiated pollen for producing seedless watermelons
        date: 2018
       words: 3316
      flesch: 62
     summary: The viability of watermelon pollen stored under vacuum or O2 at 25°C decreased during storage to levels that make O2 and vacuum conditions unac- ceptable as atmospheric media for pollen storage (Table 1). Among the organic solvents, ethyl acetate and ethyl ether were the most suitable for watermel- on pollen storage (Shimizu, 1983).
    keywords: days; fruit; pollen; storage; vacuum; watermelon
       cache: ahs-3119.pdf
  plain text: ahs-3119.txt

        item: #392 of 594
          id: ahs-3120
      author: Bolandnazar, Sahebali; Sharghi, Ali; Naghdi Badi, Hassanali; Mehrafarin, Ali; Sarikhani, Mohammadreza
       title: The impact of Sinorhizobium meliloti and Pseudomonas fluorescens on growth, seed yield and biochemical product of fenugreek under water deficit stress
        date: 2017
       words: 5019
      flesch: 59
     summary: Abstract: Bacteria that colonize plant roots and promote plant growth are referred to as plant growth-promoting rhizobacteria (PGPR). kARLIDAG H., eSITkeN A., TURAN m., SAHIN f., 2007 - Effects of root inoculation of plant growth promoting rhi- Adv.
    keywords: content; fenugreek; growth; meliloti; pgpr; plant; shoot; soil; stress; water; yield
       cache: ahs-3120.pdf
  plain text: ahs-3120.txt

        item: #393 of 594
          id: ahs-3121
      author: Imani, Ali; Shamili, Mansoore
       title: Phenology and pomology of almond’s cultivars and genotypes using multivariate analysis
        date: 2017
       words: 2796
      flesch: 60
     summary: Besides, it has been reported that almond nut length and thickness, and kernel length have significant correlations with kernel length, moreover kernel width have most positive effect on kernel weight (Spiegel-Roy and Kochba, 1981; Kester et al., 1977). To estimate kernel weight, kernel variables had less R square (0.61) than nut variables (0.94).
    keywords: almond; kernel; length; nut; thickness; traits; weight; width
       cache: ahs-3121.pdf
  plain text: ahs-3121.txt

        item: #394 of 594
          id: ahs-3122
      author: Razavi, Farhang; Hajilou, Jafar; Aghdam, Morteza Soleimani
       title: Salicylic acid treatment of peach trees maintains nutritional quality of fruits during cold storage
        date: 2017
       words: 5281
      flesch: 56
     summary: Maintaining firm- ness in peach fruits treated with SA may be result of directly inhibition of cell wall degradation enzymes activity, indirectly decreasing ethylene production, and also higher firmness in peach fruit treated with SA could be attributed to endogenous SA accumula- tion which lead to lower LOX activity and ROS accu- mulation. SA enhance antioxidant systems activity by avoiding and/or scavenging ROS, which led to decrease oxida- tive stress during peach fruits ripening and ultimately maintain postharvest quality by prevention of adverse effects of ROS on fruits quality. 4.
    keywords: acid; activity; antioxidant; days; fruits; peach; postharvest; quality; storage
       cache: ahs-3122.pdf
  plain text: ahs-3122.txt

        item: #395 of 594
          id: ahs-3123
      author: Souri, Mohammad Kazem; Dehnavard, Sara
       title: Tomato plant growth, leaf nutrient concentrations and fruit quality under nitrogen foliar applications
        date: 2017
       words: 4792
      flesch: 55
     summary: This can be due to stress condi- tions induced by foliar ammonium spray and less hydraulic conductance of plant tissues (Souri and Roemheld, 2009). SPAD value as a chlorophyll concentration index of plants were high- est in ammonium sulfate treated plants (Table 1), and there was no significant effects among other treatments.
    keywords: ammonium; application; foliar; fruit; leaf; nitrate; nitrogen; plants; sulfate; tomato; urea
       cache: ahs-3123.pdf
  plain text: ahs-3123.txt

        item: #396 of 594
          id: ahs-3124
      author: Hapsari, Dhika; Poerwanto, Roedhy; Sopandie, Didy; Santosa, Edi
       title: Partial root-zone irrigation effects on growth, metabolism and calcium status of Mangosteen seedling (Garcinia mangostana L.)
        date: 2018
       words: 7578
      flesch: 60
     summary: Zimmerman (1978) stat- ed that turgor potential is partially or fully main- tained by osmoregulation during water stress by a reduction in the outflow of water from the cell. Previous studies by Sofo et al. (2005) and Aganchich et al. (2007) have reported up- regulation of the antioxidant defense system in young olive plants subjected to different degrees of water stress.
    keywords: calcium; content; control; drought; irrigation; leaf; leaves; mangosteen; plant; pr1; pr3; root; soil; stress; treatment; water; zone
       cache: ahs-3124.pdf
  plain text: ahs-3124.txt

        item: #397 of 594
          id: ahs-3125
      author: Salehi Salmi, Mohamareza; Falehi Hoseini, M.; Heidari, M.; Daneshvar, M.H.
       title: Extending vase life of cut rose (Rosa hybrida L.) cv. Bacara by essential oils
        date: 2018
       words: 6255
      flesch: 62
     summary: The water lose was affected by treat- ments and essential oils increased water retaining capacity compared to control treatment (without essential oil). Sci., 2018 32(1): 61-69 66 mum diameter was observed with flowers kept in 100 µl.l-1 M. spicata essential oil vase solution (Fig. 1).
    keywords: activity; control; cut; essential; et al; flowers; life; oils; persicum; rose; spicata; vase; vulgaris; water
       cache: ahs-3125.pdf
  plain text: ahs-3125.txt

        item: #398 of 594
          id: ahs-3126
      author: Adesina, Jacobs; Rajashekar, Yallappa
       title: Phytochemical composition and insecticidal potentials of some plant aqueous extracts in suppressing Podagrica spp. (Coleoptera: Chrysomelidae) Infestation on Okra (Abelmoschus esculentus L. Moench)
        date: 2018
       words: 5195
      flesch: 57
     summary: infestation The utilization of plant aqueous extracts to sup- press Podagrica spp. Plant extracts often consist of complex mixtures of bioactive constituents which may act as antifeedants, disturb insect growth, development and inhibit oviposition (Gerard and Ruf, 1991; Emimal Victoria, 2010).
    keywords: coccineus; das; extracts; insect; leaves; okra; plant; podagrica; procera; schweinfurthii; spp; wap
       cache: ahs-3126.pdf
  plain text: ahs-3126.txt

        item: #399 of 594
          id: ahs-3127
      author: Jawdat, Dana; Allaf, A.W.; Taher, N.; Al-Zier, A.; Morsel, N.; Ajii, Z.; Al-Safadi, B.
       title: Cotton flowering behavior, fiber traits and gene expression under water-shortage stress
        date: 2018
       words: 8903
      flesch: 61
     summary: 6 - (A) TGA thermograms of cotton fibers in presence of nitrogen. (B) DSC thermograms of cotton fibers in pre- sence of nitrogen.
    keywords: aleppo; control; cotton; cultivars; data; deir al; drought; et al; expression; fiber; flowering; gene; irrigation; jawdat; plants; quality; samples; sci; stress; temperature; water; zour
       cache: ahs-3127.pdf
  plain text: ahs-3127.txt

        item: #400 of 594
          id: ahs-3128
      author: Hossain, Md.Mokter; Disha, Ribed; Rahim, Md.
       title: Physio-morphological variations of pummelo genotype (Citrus grandis L. Osbeck)
        date: 2018
       words: 6832
      flesch: 60
     summary: Correlation coefficient study indicated that leaf length, breadth, petiole wing length, fruit weight, weight of non-edible portion, seed weight, seed number/fruit had positive and highly significant association with leaf breadth, petiole wing breadth, weight of non-edible portion, pulp thick- ness, total weight of seeds/fruit and number of fruits/plant, respectively. In respect of path analysis, leaf breadth, petiole wing length, fruit weight, average weight of seed, %TSS, seed number/fruit had positive direct effect on fruits/plant indicating its importance as a selection criteria.
    keywords: breadth; fruit; genotype; number; plant; seeds; weight; wing
       cache: ahs-3128.pdf
  plain text: ahs-3128.txt

        item: #401 of 594
          id: ahs-3129
      author: Taiti, Cosimo; Giordani, Edgardo; Palm, Emily; Petrucci, Antonio William; Bennati, Giuseppe; Gestri, Giovanni; Marone, Elettra; Azzarello, Elisa; Mancuso, Stefano
       title: Volatile compounds from different fruit parts of two cultivars of Cydonia oblonga
        date: 2018
       words: 4369
      flesch: 63
     summary: In this work, carpometric, chemometric and spectrophotometric measurements were performed on quince fruits. The identification of the different peel color of quince fruits was assessed using a minolta Cr-200 Chroma-meter (minolta, ramsey, nJ, uSA) according to the Hunter scale, as previously described by Taiti et al. (2017 b).
    keywords: accession; compounds; cydonia; et al; fruit; quince; samples; taiti; tuscan; vocs; wranja
       cache: ahs-3129.pdf
  plain text: ahs-3129.txt

        item: #402 of 594
          id: ahs-3130
      author: Shah, Uzma; Mir, Javid; Ahmed, Nazeer; Zaid, Abbu; Jan, Sumira; Fazili, Khalid; Wani, Shabir
       title: Bio-techniques for improvement of qualitative and quantitative traits in walnut (Juglans regia)
        date: 2017
       words: 16284
      flesch: 53
     summary: Antioxidant activity Several research reports demonstrated antioxi- dant activity of ethyl acetate, butanol, ether and aqueous methanol extract of walnut kernels, husks and leaves as evaluated by DPPH radical scavenging assay and lipid oxidation inhibition by β-carotene linoleate (Oliveira et al., 2008; Pereira et al., 2008; Carvalho et al., 2010; Rahimipanah et al., 2010; Table 4 - Description of walnut as phytochemical and its activity against diverse pathogens Walnut Part used Target cell/ pathogen Activity Reference Juglans regia Bark Staphylococcus aureus, E. coli Antibacterial Farooqui et al., 2015 Juglans regia Bark Candida albicans, Candida glabrata, and Candida parapsilosis strains Antifungal Noumi et al., 2010 Juglans regia Kernels MCF-7 (estrogen receptor positive breast adenocarcinoma), KB (oral and mouth), HepG-2 (liver), Caco2 (colon), and WRL-68 (liver) Walnut flavonoids have not been extensively analyzed, however, English walnut leaf was subjected to vigorous chromatographic eval- uation (Pereira et al., 2007).
    keywords: acid; activity; analysis; anti; antioxidant; breeding; cancer; characterization; cultivars; diversity; et al; extract; food; genotypes; hort; identification; india; issr; juglans; juglans regia; leaves; markers; persian; phenolic; plant; potential; rapd; regia; regia l.; res; review; sci; shah; species; ssr; study; traits; walnut
       cache: ahs-3130.pdf
  plain text: ahs-3130.txt

        item: #403 of 594
          id: ahs-3131
      author: Niyokuri, Aristide; Nyalala, Samuel; Mwangi, Mariam
       title: Residual effects of bioslurry and amino acids plant biostimulant on carnation (Dianthus caryophyllus L.) flower quality.
        date: 2017
       words: 3742
      flesch: 58
     summary: Carnations plants that had received 2.0, 2.5 and 3.0 L of plant biostimulant had significantly longer flower stalks and significantly thinner flower stalks compared to the control (Table 2). Four levels of bioslurry: 0, 0.125, 0.25 and 0.5 L m-2 were applied in the main plots while four levels of plant biostimulant: 0, 2.0, 2.5 and 3.0 L ha-1 were used in the sub-plots.
    keywords: bioslurry; biostimulant; carnation; effect; flower; length; plant; quality; sci; stalk
       cache: ahs-3131.pdf
  plain text: ahs-3131.txt

        item: #404 of 594
          id: ahs-3132
      author: Taiti, Cosimo; Redwan, Mirvat; Marone, Elettra; Atzori, Giulia; Azzarello, Elisa; Mancuso, Stefano
       title: Comparative analysis of Volatile Compounds (potential aromatic ability) in the fruit of 15 olive Italian cultivars
        date: 2018
       words: 3210
      flesch: 59
     summary: Key words: olive fruits, PTR-ToF-MS, volatile organic compounds (VOCs). In particular, VOCs emission is linked to the destruction of the cell structure of olive fruits which activates a specific chain of enzymatic reaction (LOX cascade)
    keywords: compounds; cultivars; fruits; oil; olive; vocs
       cache: ahs-3132.pdf
  plain text: ahs-3132.txt

        item: #405 of 594
          id: ahs-3133
      author: Sabbatini, Leonardo; Taiti, Cosimo; Redwan, Mirvat; Azzarello, Elisa; Marone, Elettra; Mancuso, Stefano
       title: Monitoring in real time the changes in VOCS emission in sunflower and extra virgin olive oil upon heating by PTR-TOF-MS
        date: 2018
       words: 3287
      flesch: 56
     summary: Oil samples were analyzed at two points: Room tem- perature (25°C) and at 180°C. The aims of this study are (1) to test the PTR-ToF- MS as a sampling system for the detection of the released compounds from not heated olive and sun- flower oils and to compare with heated oils at their smoking point (180°C); (2) to monitor and evaluate in real-time the VOCs emitted from different oils, upon the heating from 25°C to 180°C, to understand the dynamic of oxidation phenomena.
    keywords: compounds; oil; oils; olive
       cache: ahs-3133.pdf
  plain text: ahs-3133.txt

        item: #406 of 594
          id: ahs-3134
      author: Akbari, M.; Salehi, Hassan
       title: Biochemical and physiological evaluations of common bermudagrass [Cynodon dactylon (L.) Pers.] Iranian accessions under cold stress
        date: 2018
       words: 7661
      flesch: 60
     summary: The maxi- mum peroxidase activity at -15°C was observed in Naein accession and the second rank was belonged to common bermudagrass accession collected from Taft. These patterns of physiological variations within common bermudagrass accessions might be due to different genetic background because of various ploidy levels, cross pollination, genetic overlap, germplasm exchange and gene flow.
    keywords: accessions; activity; bermudagrass; color; content; f.w; proline; protein; quality; stress
       cache: ahs-3134.pdf
  plain text: ahs-3134.txt

        item: #407 of 594
          id: ahs-3135
      author: Tanari, Yulinda; Efendi, Darda; Poerwanto, Roedy; Sopandie, Didy; Suketi, ketty
       title: Application of calcium to decrease yellow sap contamination at different positions of Garcinia mangostana L.
        date: 2018
       words: 4665
      flesch: 58
     summary: Sci., 2018 32(2): 169-175 doi: 10.13128/ahs-22018 Application of calcium to decrease yellow sap contamination at different positions of Garcinia mangostana L. Y. Tanari 1 (*), D. Efendi 1, 2, R. Poerwanto 1, 2, D. Sopandie1, K. Suketi 1 1 Department of Agronomy and Horticulture, Faculty of Agriculture, Bogor Agricultural University, 16144 Bogor, West Java, Indonesia. Abstract: The present research aimed at studying the effects of Ca application, through soil fertilization, on yellow sap contamination based on the position of the fruits on the canopy of the tree.
    keywords: aryl; contamination; fruit; light; sap; sector; tree; yellow
       cache: ahs-3135.pdf
  plain text: ahs-3135.txt

        item: #408 of 594
          id: ahs-3136
      author: Mahmoudi Meimand, Mohammad; Shamshiri, Mohammad; Roosta, Hamid; Khan, E.U.
       title: Poultry manure application time and pistachio (Pistacia vera L.) trees
        date: 2018
       words: 4507
      flesch: 63
     summary: Nut proteins percent was also enhanced by the application of poultry manure in all treatment versus control (Table 3), but maximum value for nut protein percent was observed at mid- March (Mm) application (19.63%) followed by the last week of January (19.5%) and in poultry manures divided into four parts and used in last weeks of October, December, January and mid-March (19.2%) with no significant differences (Table 3). The experiment consisted of seven different poultry manure application time, including poultry manure application as one time in 1) last week of October 2) last week of December 3) last week of January 4) mid-March and dividing into two parts and use in fall or in winter, dividing into four parts and use in dormant seasons (fall and winter).
    keywords: application; december; january; manure; march; mid; october; parts; pistachio; poultry; week
       cache: ahs-3136.pdf
  plain text: ahs-3136.txt

        item: #409 of 594
          id: ahs-3137
      author: Shafiee-Masouleh, Seyedeh-Somaye
       title: Effects of nano-silver pulsing, calcium sulfate and gibberellin on an antioxidant molecule and vase life of cut gerbera flowers
        date: 2018
       words: 4349
      flesch: 65
     summary: Liu et al. (2009 a) and Lü et al. (2010) observed that NS pulse treatments extended vase life of the cut gerbera and the rose flowers. Introduction Gerberas (Gerbera jamesonii) are well-known flowers for the variety of their colors, and are popular in the world flower trade (Liu et al., 2009 a; Solgi et al., 2009).
    keywords: cut; et al; flavonoid; flowers; gerbera; life; treatments; vase; vase life
       cache: ahs-3137.pdf
  plain text: ahs-3137.txt

        item: #410 of 594
          id: ahs-3138
      author: Kassu, Kassaye; Dawit, Habte; Wubengeda, Admasu; Almaz, Admasu; Asrat, Mekonnen
       title: Yield and yield components of coriander under different sowing dates and seed rates in tropical environment
        date: 2018
       words: 7797
      flesch: 65
     summary: These results corroborate the findings of Carrubba et al. (2006), who reported a highly signifi- cant dependence of coriander yields on precipitation during its growing period with linear correlation coef- ficient of 0.93. Nowak and Szemplinski (2014) also reported the significant influence of temporal varia- tions on coriander yield and yield attributes.
    keywords: biomass; coriander; date; fruit; ha-1; july; kulumsa; robe; sagure; seed; sowing; yield
       cache: ahs-3138.pdf
  plain text: ahs-3138.txt

        item: #411 of 594
          id: ahs-3139
      author: Rezaie Baghbidi, Omid; Jowkar, Abolfazl
       title: Micropropagation of dwarf schefflera [Schefflera arboricola (Hayata) Merr.] via direct shoot regeneration
        date: 2018
       words: 5792
      flesch: 68
     summary: BRUNNER I., ECHEGARAY A., RUBLUO A., 1995 - Isolation and characterization of bacterial contaminants from Dieffenbachia amoena Bull, Anthurium andreanum Linden and Spathiphyllum sp. shoot cultured in vitro. The other cultivars’ shoot length were significantly lower.
    keywords: capella; charlotte; cultivars; gold; l-1; length; luseane; plant; schefflera; shoot
       cache: ahs-3139.pdf
  plain text: ahs-3139.txt

        item: #412 of 594
          id: ahs-3140
      author: Sayyad-Amin, Pegah; Davarynejad, Gholamhossein; Abedy, Bahram
       title: The effect of polyamines and SICS on the compatibility, fertility and yield indices of apple cv. Golden Delicious
        date: 2018
       words: 5254
      flesch: 64
     summary: In addition, regarding fruit yield, foliar application of Mn alone showed signifi- cant increase in fruit yield of sweet oranges due to its effect on increasing the number of fruit/tree as well as fruit average weight (Hasani et al., 2012). TAVAKOLI K., RAHEMI M., 2014 - Effect of Polyamines, 2, 4- D, Isopropyl Ester and Naphthalene Acetamide on improving fruit yield and quality of date (Phoenix dactylifera L.).
    keywords: et al; fruit; pollen; polyamines; self; set; sics; spd; spm; yield
       cache: ahs-3140.pdf
  plain text: ahs-3140.txt

        item: #413 of 594
          id: ahs-3141
      author: Schneider, Julia; Thiesen, Leonardo; Engroff, Thaise; Holz, Ezequiel; Altíssimo, Bruna
       title: Growth analysis of lettuce under different substrate compositions
        date: 2018
       words: 4230
      flesch: 61
     summary: Introduction lettuce (Lactuca sativa l.) is one of the most consumed vegetables in the world (gomes et al., 2008), due to its taste, nutritional quality and low price (teodoro et al., 2016). this rate tends to be higher at the beginning of the development of the crop due to lower self- shading (gondim et al., 2008).
    keywords: area; compound; dat; growth; leaf; leaves; lettuce; plantmax; plants; substrate
       cache: ahs-3141.pdf
  plain text: ahs-3141.txt

        item: #414 of 594
          id: ahs-3142
      author: Hosseini, Hamid; Chehrazi, M.; Nabati Ahmadi, D.; Mahmoodi Sorestani, M.
       title: Colchicine-induced autotetraploidy and altered plant cytogenetic and morpho-physiological traits in Catharanthus roseus (L.) G. Don
        date: 2018
       words: 6033
      flesch: 61
     summary: As shown above, the number of chloroplasts in stomata guard cells of tetraploid plants was two folds greater than those in diploid plants. Chromosome number, length and diameter of stomata and chloroplast number in stomata of guard cells increased with increased ploidy level, whereas the numbers of stomata decreased from 390 to 177 mm2 in tetraploid plants.
    keywords: colchicine; diameter; diploid; et al; leaf; length; number; plants; polyploidy; root; roseus; size; stomata; tetraploid
       cache: ahs-3142.pdf
  plain text: ahs-3142.txt

        item: #415 of 594
          id: ahs-3143
      author: Ali, M.; Mujib, Abdul; Zafar, N.; Tonk, D.
       title: Somatic embryogenesis, biochemical alterations and synthetic seed development in two varieties of coriander (Coriandrum sativum L.)
        date: 2018
       words: 6889
      flesch: 52
     summary: Somatic embryos started to differentiate on the same 2,4-D added medium but the numbers of somatic embryos were more in RS (63.0 embryos per culture) compared to Co-1 (51.0 embryos per culture). Somatic embryos were encapsulated in various alginate and calcium chloride (CaCl2) solutions and were kept in different temperature regimes for varied periods.
    keywords: callus; co-1; conversion; embryogenesis; embryos; induction; medium; plant; seeds; synthetic; tissue
       cache: ahs-3143.pdf
  plain text: ahs-3143.txt

        item: #416 of 594
          id: ahs-3144
      author: Momenpour, Ali; Imani, Ali
       title: Evaluation of salinity tolerance in fourteen selected pistachio (Pistacia vera L.) cultivars
        date: 2018
       words: 12712
      flesch: 61
     summary: Cultivar Treatments Cell membrane injury (%) Relative ionic leakage (%) Relative water content (%) Khanjari Control - 37.70±0.010 m-o 85.25±0.64 a A 2.98±1.28 w-y 39.14±0.008 k-o 84.16±0.46 a-b B 8.09±0.91 t-u 44.34±0.005 i-o 81.31±0.51 b C 23.09±3.10 k-m 51.75±0.019 d-k 77.60±0.62 c D 46.47±0.70 b 64.42±0.004 a-c 70.36±1.04 f Akbari Control - 38.05±0.007 l-o 85.08±0.40 a A 0.83±1.21 x-y 38.41±0.016 l-o 84.52±0.60 a-b B 5.27±1.07 u-w 42.30±0.006 j-o 82.90±0.60 a-b C 16.37±1.78 o-q 45.96±0.011 g-o 82.08±0.68 a-b D 27.83±2.18 h-i 50.09±0.013 d-k 80.22±0.56 b Ghazvini Control - 35.62±0.013 o 83.19±0.57 a-b A 0.42±0.19 y 36.59±0.006 m-o 82.98±0.64 a-b B 2.67±2.28 x-y 38.37±0.014 l-o 81.58±0.42 b C 5.89±2.81 u-w 39.73±0.018 k-o 80.88±0.36 b D 16.17±0.62 o-q 45.50±0.16 g-o 78.95±0.45 b-c Italiaie Control - 40.85±0.012 j-o 84.43±0.35 a-b A 0.75±0.79 x-y 40.88±0.005 m-n C 1.02±0.03 s 0.32±0.01 k-n 0.70±0.01 j-l 47.22±1.48 p-r D 0.73±0.02 y-z 0.25±0.01 r-s 0.49±0.01 u-v 40.00±1.87 y-z Sabs
    keywords: 0.00±0.0; b b; c c; chlorophyll; control; cultivars; h d; leaves; level; pistachio; plants; q c; results; salinity; salinity level; stress; y b
       cache: ahs-3144.pdf
  plain text: ahs-3144.txt

        item: #417 of 594
          id: ahs-3145
      author: Souri, Mohammad Kazem; Aslani, Maryam
       title: Beneficial effects of foliar application of organic chelate fertilizers on French bean production under field conditions in a calcarous soil
        date: 2018
       words: 5472
      flesch: 56
     summary: In conclusion, foliar application of organic chelate fertilizers resulted in higher plant growth under cal- careous soil conditions. The results showed that plant growth, pod yield (79%) and pod quality were improved by application of chelate fertilizers.
    keywords: amino; application; fertilizers; foliar; growth; organic; plant; pod; soil; souri
       cache: ahs-3145.pdf
  plain text: ahs-3145.txt

        item: #418 of 594
          id: ahs-3146
      author: Esmaeili, S.; Salehi, Hassan; Khosh-Khui, M.
       title: Direct and indirect in vitro plant regeneration of two commercial cultivars of perennial ryegrass
        date: 2018
       words: 5279
      flesch: 58
     summary: Plant regeneration rate was defined as the percentage of callus that had regenerated shoots. As shown in figure 2, ʻGrasslandʼ has higher regenera- tion rate (~13%) than ʻNumanʼ. Incidentally, maltose had not notably effect on plant regeneration percent- age in both cultivars lonely but ABA concentrations showed significant effects on plant regeneration rate (Fig. 2).
    keywords: 2,4; callus; cultivars; culture; induction; l-1; medium; meristem; plant; regeneration; ryegrass
       cache: ahs-3146.pdf
  plain text: ahs-3146.txt

        item: #419 of 594
          id: ahs-3147
      author: Rizzo, Domenico; Materazzi, Alberto; Stefani, L.; Panattoni, Alessandra; Pierro, Roberto; Marchi, Guido; Cinelli, Tamara; De Bellis, Luigi; Luvisi, Andrea
       title: The monitoring program of grapevine phytoplasmas in Tuscany (Italy): results of a four year survey
        date: 2018
       words: 3988
      flesch: 66
     summary: Unfortunately, infected samples were found in many different vineyards, thus 23 novel foci were detected, most of them in Lucca (15), but a consistent number (6) in Pistoia, the eastern district of North West territory (Table 2). Additional observations on FD monitoring A comparison between FD findings in 2012 and 2015 in Lucca district of North West territory (where FD findings were numerous) were reported (Fig. 2 c) and pathogen spread seems to be directed towards the South Eastern territories.
    keywords: east; fig; monitoring; north; samples; tuscany; west
       cache: ahs-3147.pdf
  plain text: ahs-3147.txt

        item: #420 of 594
          id: ahs-3148
      author: Dorneles, Ahos Odin; Pereira, Aline; Possebom, Gessieli; Sasso, Victoria; Rossato, Liana; Tabaldi, Luciane
       title: Growth of potato genotypes under different silicon concentrations
        date: 2018
       words: 4129
      flesch: 57
     summary: The presence of Si in the growth medium signifi- cantly influenced on shoot length of potato geno- types (Fig. 1C), where there was significant differ- ence between Si concentrations and control (without Si). For the SMIJ319-7 genotype, Si concentrations (0.5 and 5.0 mM) promoted an increase in the pro- duction of stem dry weight compared to control (Fig. 2B).
    keywords: concentrations; et al; genotypes; growth; increase; leaf; plants; potato; silicon; weight
       cache: ahs-3148.pdf
  plain text: ahs-3148.txt

        item: #421 of 594
          id: ahs-3149
      author: Azadshahraki, Farzad; Jamshidi, B.; Mohebbi, S.
       title: Postharvest melatonin treatment reduces chilling injury and enhances antioxidant capacity of tomato fruit during cold storage
        date: 2018
       words: 6646
      flesch: 56
     summary: Azadshahraki et al. - Postharvest melatonin treatment in tomato fruit during cold storage 309 ZHAO D.Y., SHEN L., FAN B., LIU K.L., YU M.M., ZHENG Y., DING Y., SHENG J.P., 2009 - Physiological and genetic properties of tomato fruits from 2 cultivars differing in chilling tolerance at cold storage.- Food Chem., 74: 348-352. Symptoms of tomato fruit chilling injury were manifested as surface pitting and large green patches or blotchy yellow areas resulting from loss of full red color development ability (Wang, 1993).
    keywords: antioxidant; chilling; content; et al; fruit; h2o2; injury; melatonin; postharvest; ripening; storage; tomato; treatment; zhang
       cache: ahs-3149.pdf
  plain text: ahs-3149.txt

        item: #422 of 594
          id: ahs-3150
      author: Di Stasio, Emilio; Rouphael, Youssef; Raimondi, Giampaolo; El-Nakhel, Christophe; De Pascale, Stefania
       title: Postharvest performance of cut rose cv. Lovely Red as affected by osmoprotectant and antitraspirant compounds
        date: 2018
       words: 5305
      flesch: 60
     summary: The decline in stem water conductivity, is one of the main reasons for impaired water balance, as well as water stress is the most common reason for reduced cut roses vase life (Halevy, 1976; Joyce and Jones, 1992). Materials and Methods Plant material and growth conditions Two experiments were carried out in order to assess the effects of exogenous applications of L- Proline (Experiment 1) or antitranspirants [specifical- ly: an active compound film forming (pinolene) and a stomatal closure inducing active compound β- aminobutyric acid ; Experiment 2] on water control in cut stems of rose plants (Rosa spp.
    keywords: acid; baba; control; cut; flowers; leaf; life; plant; proline; rose; stems; stress; vase; water
       cache: ahs-3150.pdf
  plain text: ahs-3150.txt

        item: #423 of 594
          id: ahs-3151
      author: França, Christiane; Santos, Mirelle; Ribeiro, Wellington; Cecon, Paulo; Finger, Fernando
       title: Shelf life of iceberg lettuce affected by hydro cooling and temperature of storage
        date: 2018
       words: 4175
      flesch: 62
     summary: Similar results were found for hydro cooled butter lettuce heads, peppermint and coriander leaves, which also had higher relative Fig. 2 - Accumulated fresh weight loss of iceberg lettuce 'Lucy Brown' submitted to the following treatments: T1) The increased shelf life of hydro cooled lettuce was determined by the higher leaf rel- ative water content of hydro cooled lettuce (Table 1).
    keywords: cooling; hydro; leaves; lettuce; life; shelf; storage; water
       cache: ahs-3151.pdf
  plain text: ahs-3151.txt

        item: #424 of 594
          id: ahs-3152
      author: De Corato, Ugo; Salimbeni, Rocco; De Pretis, Agostino
       title: Evaluation of an alternative mean for controlling postharvest Rhizopus rot of strawberries
        date: 2018
       words: 6768
      flesch: 50
     summary: 1 - Suppressive effect of Laminaria digitata raw extract (A), and soluble extracts by hexane (B) and ethanol (C), on Rhizopus stolonifer mycelia growth inhibition index (MGI%). 2 - Suppressive effect of Laminaria digitata raw extract (A), and soluble extracts by hexane (B) and ethanol (C), on Rhizopus stolonifer sporangia germination suppression index (SG%).
    keywords: activity; control; digitata; extract; fruit; g l-1; incubation; mycelia; postharvest; rot; strawberries; time
       cache: ahs-3152.pdf
  plain text: ahs-3152.txt

        item: #425 of 594
          id: ahs-3153
      author: Spinardi, Anna; Mignani, Ilaria
       title: Ascorbic acid content and senescence in blueberry (Vaccinium corymbosum L.) during storage.
        date: 2018
       words: 5012
      flesch: 60
     summary: 4 - Changes in blueberry ascorbic acid content during cold storage (0°C) in different atmosphere regimes (Air; CA1= 4 kPa O2 and 10 kPa CO2; CA2= 2 kPa O2 and 9 kPa CO2). ZHOU Q., MA C., CHENG S., WEI B., LIU X., JI S., 2014 - Changes in antioxidative metabolism accompanying pitting development in stored blueberry fruit.
    keywords: acid; ascorbic; atmosphere; blueberry; co2; content; control; days; fruit; kpa; storage; values
       cache: ahs-3153.pdf
  plain text: ahs-3153.txt

        item: #426 of 594
          id: ahs-3154
      author: Vanoli, Maristella; Lovati, Fabio; Grassi, Maurizio; Buccheri, Marina; Zanella, Angelo; Cattaneo, Tiziana; Rizzolo, Anna
       title: Water spectral pattern as a marker for studying apple sensory texture
        date: 2018
       words: 5401
      flesch: 54
     summary: Thus, when an aqueous system, such as apple fruit, is measured by near infrared (NIR) spectroscopy, the light absorbance reflects the water vibrations and the con- tribution (concentration and structure) of the other molecules interacting with water. The aim of this work was to evaluate the feasibili- ty of Aquaphotomics to study the texture sensory profiles of apple fruit belonging to three cultivars having different texture characteristics.
    keywords: apples; braeburn; crispy; fruit; gala; juicy; kanzi; mealy; texture; water
       cache: ahs-3154.pdf
  plain text: ahs-3154.txt

        item: #427 of 594
          id: ahs-3155
      author: Pace, Bernardo; Capotorto, Imperatrice; Gonnella, Maria; Baruzzi, Federico; Cefola, Maria
       title: Influence of soil and soilless agricultural growing system on postharvest quality of three ready-to-use multi-leaf lettuce cultivars
        date: 2018
       words: 6427
      flesch: 56
     summary: Results of the present study showed that soilless growing system can positively affect qualitative and microbiologi- cal parameter of lettuces studied, and it can be considered a good soilless growing technique in order to obtain high quality multi-leaf lettuces for ready- to-use industry. Sci., 2018 32(3): 353-362 354 baby- and multi-leaf have been developed recently as high quality lettuce varieties for the ready-to-use market.
    keywords: activity; ammonium; antioxidant; content; cultivars; ezra; lettuce; postharvest; quality; soilless; storage; system; total
       cache: ahs-3155.pdf
  plain text: ahs-3155.txt

        item: #428 of 594
          id: ahs-3156
      author: Mirjalili, S.A.; Kavoosi, B.; peyro, Yusef
       title: Assessment of vase life and postharvest quality of cut rose (Rosa hybrida cv. Angelina) flowers by application of cumin (Cuminum cyminum L.) essential oil and 8-hydroxyquinoline sulfate
        date: 2018
       words: 4669
      flesch: 63
     summary: Thwala et al. (2013) used cumin essential oil for decreasing degradation and ves- sel boring in orchids resulted in delay of senescence. Treatments were 8-hydroxyquinoline sulfate (8-HQS) at four level (0, 200, 400 and 600 mg·L-1) and cumin essential oil at three level (0, 100, 150 mg·L-1) in three measuring time (1st day, 8th day and 16th day) after treatment.
    keywords: cumin; cut; flowers; hqs; hydroxyquinoline; life; mg·l-1; oil; postharvest; rose; sulfate; vase
       cache: ahs-3156.pdf
  plain text: ahs-3156.txt

        item: #429 of 594
          id: ahs-3157
      author: Cocetta, Giacomo; Ferrante, Antonio
       title: Postharvest application of hydrogen peroxide and salicylic acid differently affects the quality and vase life of cut rose (Rosa hybrida L.) petals and leaves
        date: 2018
       words: 4570
      flesch: 60
     summary: After 7 days of vase life 73.33% of untreated roses were not marketable anymore, while the percentage was lower in response to treatments (47.06% in SA and 25.53% in H2O2). After 4 days of vase life, SA allowed maintaining high- er levels of anthocyanins in petals compared to H2O2 and to controls.
    keywords: acid; chlorophyll; cut; days; flowers; h2o2; leaves; life; petals; plant; rose; vase
       cache: ahs-3157.pdf
  plain text: ahs-3157.txt

        item: #430 of 594
          id: ahs-3158
      author: De Sio, F.; Rapacciuolo, M.; De Giorgi, A.; Trifirò, A.; Giuliano, B.; Vitobello, L.; Cuciniello, A.; Caruso, Gianluca
       title: Yield, quality and antioxidants of peeled tomato as affected by genotype and industrial processing in southern Italy
        date: 2018
       words: 6052
      flesch: 56
     summary: Other authors (Majkowska-Godomska et al., 2008) record- ed a total solids content of tomato fruits ranging from 3.83 to 7.00%. Campos et al. (2006) and Kader et al. (1987) reported that values of soluble solids below 4.5% are considered low for industrial tomatoes; in this respect, Turhan and Seniz (2009) found this quality indicator ranging between 5.0 to 5.5 % in processing tomato fruits and in other studies (Cramer et al., 2001; De Pascale et al., 2001) soluble solids values of tomato fruits ranged from 4 to 6%.
    keywords: abbundo; et al; fruits; hybrids; italy; processing; quality; sci; solids; tomato; umex; weight; yield
       cache: ahs-3158.pdf
  plain text: ahs-3158.txt

        item: #431 of 594
          id: ahs-3159
      author: Javadpour, Sedigheh; Golestani, Atefeh; Rastegar, Somayeh; Dastjer, Majid
       title: Postharvest control of Aspergillus niger in mangos by means of essential oils
        date: 2018
       words: 6979
      flesch: 62
     summary: KUMAR A., SHUKLA R., SINGH P., PRASAD C.S., DUBEY N.K., 2008 - Assessment of Thymus vulgaris L. essential oil as a safe botanical preservative against post harvest fun- gal infestation of food commodities. After 3 weeks of storage, the firmness of control fruits was around 3.06 kg/cm2, while the treated fruits were sig- nificantly firmer (P<0.05).
    keywords: control; eos; essential; fruits; mirzayanii; niger; officinalis; oil; persica; postharvest; rosmarinus; salvia; storage; thymus; vulgaris
       cache: ahs-3159.pdf
  plain text: ahs-3159.txt

        item: #432 of 594
          id: ahs-3160
      author: Cortellino, G.; De Vecchi, P.; Lo Scalzo, R.; Ughini, V.; Granelli, G.; Buccheri, Marina
       title: Ready-to-eat raspberries: qualitative and nutraceutical characteristics during shelf-life
        date: 2018
       words: 5574
      flesch: 61
     summary: Materials and Methods Raw material Investigations were carried out on raspberry fruits of three different cultivars picked at commercial maturity: ‘Heritage’ and ‘Glen Magna’, grown at the fruit experimental centre of Milan University (Italy) and ‘Tulameen’, grown at the experimental compara- tive field for berry fruits of the Catholic University of Piacenza (Italy). Chemical and physical analyses Chemical and physical analyses were carried out on six samples (100 g each) of raspberry fruits per treatment at harvest (raw material) and after 3, 6 and 8 days of storage at 3°C.
    keywords: acid; content; et al; fruit; glen; heritage; life; raspberries; raspberry; shelf; tulameen
       cache: ahs-3160.pdf
  plain text: ahs-3160.txt

        item: #433 of 594
          id: ahs-3161
      author: Vanoli, Maristella; Grassi, Maurizio; Spinelli, Lorenzo; Torricelli, Alessandro; Rizzolo, Anna
       title: Quality and nutraceutical properties of mango fruit: influence of cultivar and biological age assessed by Time‐resolved Reflectance Spectroscopy
        date: 2018
       words: 9996
      flesch: 60
     summary: The present work aimed at evaluating the levels of antioxidants and antioxidant capacity in the pulp of two cultivars of Brazilian mangoes in relation to fruit maturity class assigned according to the µa540 value, along with selected quality parameters. Sci., 2018 32(3): 407-420 DOI: 10.13128/ahs-22856 Quality and nutraceutical properties of mango fruit: influence of cultivar and biological age assessed by Time‐resolved Reflectance Spectroscopy M. Vanoli 1, M. Grassi 1, L. Spinelli 2, A. Torricelli 2, 3, A. Rizzolo 1 (*) 1 Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria, Centro di ricerca Ingegneria e Trasformazioni Agroalimentari (CREA- IT), sede di Milano, Via G. Venezian, 26, 20133 Milano, Italy. 2 Istituto di Fotonica e Nanotecnologie, Consiglio Nazionale delle Ricerche (IFN-CNR), Piazza L. da Vinci, 32, 20133 Milano, Italy.
    keywords: acid; carotenoids; class; color; content; cultivar; et al; fruit; haden; mangoes; maturity; palmer; pulp; total; tpc; trans; trs; viol; µa540
       cache: ahs-3161.pdf
  plain text: ahs-3161.txt

        item: #434 of 594
          id: ahs-3162
      author: Kazemzadeh-Beneh, Hashem; Samsampour, Davood; Zarbakhsh, Saeedeh
       title: Biochemical, physiological changes and antioxidant responses of cut gladiolus flower 'White Prosperity' induced by nitric oxide
        date: 2018
       words: 7873
      flesch: 55
     summary: White Prosperity cut flower is likely to be associated with many parameters, particularly fresh weight content, water uptake, enzymatic or non- enzymatic antioxidant activities, membrane stability and lipid peroxidation. Furthermore, the prolong vase life of White Prosperity flowers can be strongly associated with increasing in TSP and inhibiting from its degrada- tion in flower petals during vase life.
    keywords: activity; antioxidant; control; cut; days; flowers; gladiolus; life; prosperity; snp; vase; vase life; white
       cache: ahs-3162.pdf
  plain text: ahs-3162.txt

        item: #435 of 594
          id: ahs-3163
      author: Solomon, Mulugheta; Piazzolla, Francesca; De Chiara, Maria Lucia Valeria; Amodio, Maria Luisa; Colelli, Giancarlo
       title: Effect of wounding intensity on physiological and quality changes of strawberry fruit
        date: 2018
       words: 6797
      flesch: 57
     summary: Therefore, the main objective of the present study was to determine the effect of wounding intensity, on physiological and quality changes of fresh strawberry fruit, with a particular focus on the respiration rate and nutritional com- pounds. For this reason strawberries are one of the richest fruits in term of antioxidant capacity (Cordenunsi et al., 2002; Pertuzatti and Barcia, 2015).
    keywords: acid; content; cut; cutting; day; effect; fresh; fruit; increase; intensity; kg-1; phenolic; rate; respiration; storage; wounding
       cache: ahs-3163.pdf
  plain text: ahs-3163.txt

        item: #436 of 594
          id: ahs-3164
      author: Ianni, Andrea; Marone, Elettra; Martino, Camillo; Cichelli, Angelo; Martino, Giuseppe
       title: Effects of ozonation on the phenolic fraction of olive oil mill wastewater (OOMW): a study case
        date: 2018
       words: 4195
      flesch: 53
     summary: Extraction of phenolic compounds from OOMW The recovery of OOMW phenolic compounds was performed according to the procedure reported by Dammak et al. (2016) with slight modifications. 3. Results Chemical effects of OOMW ozonation Following the ozonation of OOMW, a simple and efficient extraction of phenolic component from each sample was obtained by using ethyl acetate, allowing to analyze in an accurate way the total phenolic con- tent, the antioxidant activity and relative quantities of two biophenols of particular interest: hydroxyty- rosol and tyrosol.
    keywords: germination; mill; oil; olive; oomw; ozonation; ozone; phenolic; seeds; water
       cache: ahs-3164.pdf
  plain text: ahs-3164.txt

        item: #437 of 594
          id: ahs-3165
      author: Barzegar, Taher; Heidaryan, N.; Lofti, H.; Ghahremani, Z.
       title: Yield, fruit quality and physiological responses of melon cv. Khatooni under deficit irrigation
        date: 2018
       words: 5389
      flesch: 59
     summary: Although deficit irrigation reduce crop yield, may be able to save a significant amount of irrigation water (Sharma et al., 2014). WUE is the relation between yield and the quanti- ty of irrigation water (Zeng et al., 2009).
    keywords: content; deficit; et al; fruit; irrigation; melon; plant; quality; stress; treatments; water; yield
       cache: ahs-3165.pdf
  plain text: ahs-3165.txt

        item: #438 of 594
          id: ahs-3166
      author: Emami, S.; Nemati, Seyed Hossein; Azizi, M.; Mobli, M.
       title: Combining ability and gene action of some tomato genotypes under low light condition
        date: 2018
       words: 7246
      flesch: 63
     summary: Sources of variation Degree of Freedom Total yield per plant (Kg) Average of fruit weight (g) Fruit number per plant Days to first flower Days to ripening Light (L) 1 16.69 ** 14654.49 ** 913.52 359.53 ** 5.43 error A 4 0.74 261.6 140.91 0.61 8.8 Genotypes (G) 41 2.05 ** 1944.73 ** 1593.50 ** 34.74 ** 23.38 ** G×L 41 0.17 ** 146.54 ** 96.24 ** 2.50 ** 3.99 error B 164 0.07 34.01 18.33 0.97 2.81 Table 4 - Compound analysis of variance for combining ability over two environments for yield, yield components and earliness of F1 hybrids with their reciprocals developed via a 7×7 full diallel cross and estimates of heritability in broad and narrow senses as well as heterosis * Significant at P<0.05 level, ** Significant at P<0.01 level. Sources of variation Degree of Freedom Total yield per plant (Kg) Average of fruit weight (g) Fruits number per plant Days to first flower Days to ripening GCA 6 1.28 ** 3343.91 ** 2063.32 ** 54.66 ** 23.20 ** SCA 14 1.35 ** 430.82 ** 644.60 ** 9.55 ** 8.68 ** REC 21 0.07 ** 23.00 ** 17.79 ** 0.62 * 2.80 ** GCA×L 6 0.14 ** 120.47 ** 70.33 ** 2.86 ** 1.95 SCA×L 14 0.06 ** 53.49 ** 42.07 ** 0.94 ** 1.68 * REC×L 21 0.03 25.29 * 14.49 ** 0.19 0.92 error 164 0.02 11.34 6.11 0.32 0.94 Variance components σ2g - 0.06 166.63 102.86 2.72 1.11 σ2s - 0.33 104.87 159.62 2.31 1.94 σ2r - 0.01 2.92 2.92 0.07 0.47 σ2g/ σ2s - 0.19 1.59 0.64 1.18 0.57 σ2gl - 0.01 10.91 6.42 0.25 0.1 σ2sl - 0.02 21.08 17.98 0.31 0.37 σ2rl - 0 6.98 4.19 -0.07 -0.01 H2
    keywords: ability; additive; combining; days; effects; fruit; genotypes; light; number; plant; ripening; sca; tomato; weight; yield
       cache: ahs-3166.pdf
  plain text: ahs-3166.txt

        item: #439 of 594
          id: ahs-3167
      author: Semarayani, Cokorda; Aziz, Sandra; Melati, Maya
       title: Essential oil production of Murraya paniculata (L.) Jack at different harvest times
        date: 2018
       words: 4690
      flesch: 60
     summary: comparing among flower stages, it was found that anthesis flowers harvested at 05.00- 07.00 Am had the highest percentage of essential oils. M. paniculata flowers were collected at three different flower ages, comprised of two days before anthesis, one day before anthesis and the day of anthesis (blooming).
    keywords: anthesis; compounds; day; flower; harvesting; oil; oils; paniculata; times
       cache: ahs-3167.pdf
  plain text: ahs-3167.txt

        item: #440 of 594
          id: ahs-3168
      author: Nazemi Rafi, Z.; Salehi, Hassan
       title: Factor affecting in vitro propagation of some genotypes of Himalayan cedar [Cedrus deodara (Roxb. ex Lamb) G. Don.]
        date: 2018
       words: 4167
      flesch: 64
     summary: In the first phase, the effect of different growth regulators on axillary shoot proliferation of four genotypes was fig. Axillary shoot proliferation on WPM medium containing 0.8 μM TDZ and 2 μM NAA (after 4 weeks); (C) Elongation of axillary bud on EM medium after 90 days.
    keywords: cedrus; culture; deodara; explants; genotypes; medium; proliferation; shoot; tdz
       cache: ahs-3168.pdf
  plain text: ahs-3168.txt

        item: #441 of 594
          id: ahs-3169
      author: Khorram, Fereshteh; Ramezanian, Asghar; Saharkhiz, Mohammad Jamal
       title: In vitro activity of some essential oils against Penicillium digitatum
        date: 2018
       words: 4750
      flesch: 60
     summary: The positive effect of the volatile components of citrus fruit essential oils on P. digitatum and italicum growth has been reported (Caccioni et al., 1998). CACCioni D.r., GUizzArDi M., BionDi D.M., renDA A., rUBerTo G., 1998 - Relationship between volatile com- ponents of citrus fruit essential oils and antimicrobial action on Penicill ium digitatum and Penicill ium italicum. - int.
    keywords: cinnamon; citrus; digitatum; eos; growth; oils; postharvest; savory; summer
       cache: ahs-3169.pdf
  plain text: ahs-3169.txt

        item: #442 of 594
          id: ahs-3170
      author: Mubarak, Ibrahim; Hamdan, Altayeb
       title: Onion crop response to different irrigation and N-fertilizer levels in dry Mediterranean region
        date: 2018
       words: 4338
      flesch: 59
     summary: 3 - Response of onion crop water productivity (WP) to irri- gation levels. Irrigation water applied and water productivity With no rainfall received during both growing sea- sons (Table 1), large water amounts were applied to meet the high crop water demand.
    keywords: bulb; crop; deficit; fertilizer; irrigation; levels; onion; water; yield
       cache: ahs-3170.pdf
  plain text: ahs-3170.txt

        item: #443 of 594
          id: ahs-3171
      author: El-Mergawi, Ragab; El-Desoki, E.R.
       title: Allelopathic activities of celery extract and its fractions against Corchorus olitorius, Echinochloa crusgalli and Portulaca oleracea weeds
        date: 2018
       words: 5304
      flesch: 59
     summary: Effect of celery extract and its fraction on growth of weeds Data presented Table 5 revealed that spraying aqueous celery extract and its fractions did not pro- duce any significant effect on growth of two-weeks old of either C. olitorius, or E. crusgalli or P. oleracea weeds. Phenolic acids in aqueous celery extract at a con- centration 20 g l-1 were hydrolyzed with sodium hydroxide (McKeehen et al., 1999) and subjected to HPLC analysis.
    keywords: acid; celery; crusgalli; effect; extract; germination; growth; l-1; oleracea; olitorius; seeds
       cache: ahs-3171.pdf
  plain text: ahs-3171.txt

        item: #444 of 594
          id: ahs-3172
      author: Bakhtshahi-Dizgahi, Zahra; Alizadeh, Mahdi; Seifi, Esmaeil; Javadi, Davood; Hosseinpour, Abdollah
       title: Effects of cold stratification and chemical treatments on seed germination in four hazelnut cultivars
        date: 2018
       words: 3189
      flesch: 54
     summary: Sci., 2018 32(4): 511-516 doi: 10.13128/ahs-20537 Effects of cold stratification and chemical treatments on seed germination in four hazelnut cultivars Z. Bakhtshahi-Dizgahi 1, M. Alizadeh 1 (*), E. Seifi 1, D. Javadi 2, A. Hosseinpour 1 1 Gorgan University of Agricultural Sciences and Natural Resources, Faculty of Plant Production, Department of Horticulture, Gorgan, Iran. Seed germination is a main step in plant life cycle, and is influenced by various biotic and abiotic factors (Yuan and Wysocka-diller, 2006).
    keywords: cultivars; effect; fig; germination; hazelnut; percentage; seed; stratification; treatments
       cache: ahs-3172.pdf
  plain text: ahs-3172.txt

        item: #445 of 594
          id: ahs-3173
      author: Arji, Isa
       title: Stability analysis of fruit yield of some olive cultivars in semi-arid environmental condition
        date: 2018
       words: 5353
      flesch: 60
     summary: Based on yield cluster analysis olive cultivars were classified into three categories. Abstract: This study was conducted to evaluate yield stability of 12 Iranian and foreign olive cultivars in Dalaho Olive Research Station during 2006-2008.
    keywords: ammi; analysis; bearing; cultivars; fruit; genotype; interaction; konservolia; olive; regression; stability; table; years; yield
       cache: ahs-3173.pdf
  plain text: ahs-3173.txt

        item: #446 of 594
          id: ahs-3174
      author: Benaissa, Asmaa; Djebbar, R.; Abderrahmani, A.
       title: Diversity of plant growth promoting Rhizobacteria of Rhus Tripartitus in arid soil of Algeria (Ahaggar) and their physiological properties under abiotic stresses
        date: 2018
       words: 6253
      flesch: 48
     summary: Sci., 2018 32(4): 525-534 DOI: 10.13128/ahs-22424 Diversity of plant growth promoting Rhizobacteria of Rhus tripartitus in arid soil of Algeria (Ahaggar) and their physio- logical properties under abiotic stresses A. Benaissa 1, 3 (*), R. Djebbar (1), A. Abderrahmani (2) 1 Laboratory of Plant Physiology, Department of Biology and Physiology of Organisms, Faculty of Biological Sciences, University of Sciences and Technologies of Houari Boumediene - El-Alia, BP 16011 Bab Ezzouar, Algiers, Algeria. Key words: abiotic stresses, Ahaggar, plant growth promoting Rhizobacteria, Rhus tripartitus.
    keywords: bacillus; fixation; growth; hcn; isolates; nitrogen; nitrogen fixation; pgpr; phosphate; plant; production; rhizobacteria; rhizosphere; siderophores; solubilization; strains
       cache: ahs-3174.pdf
  plain text: ahs-3174.txt

        item: #447 of 594
          id: ahs-3175
      author: Melo, Raphael; Jorge, Marçal; Botrel, Neide; Boiteux, Leonardo
       title: Effect of a novel hydrogel amendment and seedling plugs volume on the quality of ornamental/miniature tomato
        date: 2018
       words: 3435
      flesch: 58
     summary: However, studies investigating the effects of hydrogel (H) application on ornamental plants are scarce and limited (Ljubojević et al., 2017). Key words: copolymer, pot plant, Solanum lycopersicum L., transplants.
    keywords: amendment; cm³; fruits; hydrogel; ornamental; plant; plugs; tomato; volume
       cache: ahs-3175.pdf
  plain text: ahs-3175.txt

        item: #448 of 594
          id: ahs-3176
      author: Golubkina, Nadezhda; Kekina, Helene; Engalichev, Mezar; Antoshkina, Marina; Nadezhkin, Sergey; Caruso, Gianluca
       title: Yield, quality, antioxidants and mineral nutrients of Physalis angulata L. and Physalis pubescens L. fruits as affected by genotype under organic management
        date: 2018
       words: 4891
      flesch: 53
     summary: Physalis fruits showed to be a good source of antioxi- dants, K, Mg and P for human beings. Physalis fruit is mostly an exotic product, imported from tropical and subtropical regions, particularly from Central America, where this genus is characterized by the highest biodiversity (Medina-Medrano et al., 2015).
    keywords: angulata; content; cultivar; fruits; physalis; pubescens; quality; research; rossip; taste; zolotaya
       cache: ahs-3176.pdf
  plain text: ahs-3176.txt

        item: #449 of 594
          id: ahs-3177
      author: Radice, Silvia; Giordani, Edgardo
       title: Flower development and pollen vitality of Moringa oleifera Lam. grown in a humid temperate climatic condition
        date: 2018
       words: 4158
      flesch: 63
     summary: The main objective of this research was to study flower morphology and anatomy of M. oleifera, as well as microsporogenesis and viability of pollen grains of plants cultivated in Moreno in comparison with those produced in a humid sub-tropical climatic area of Argentina (San Miguel de Tucumán). In fact, it is possible to see anthers with pollen grains already formed wrapped in a yellow substance similar to sporopollenin (Fig. 5B).
    keywords: fig; flowers; grains; miguel; moreno; moringa; oleifera; pollen; san; tucumán; viability
       cache: ahs-3177.pdf
  plain text: ahs-3177.txt

        item: #450 of 594
          id: ahs-3178
      author: Cardoso, Jean
       title: In vitro responses of gerbera (Gerbera jamesonii) cultivars multiplied under different photoperiods
        date: 2018
       words: 3044
      flesch: 52
     summary: Sci., 2018 32(4): 557-561 558 (Murashige and Skoog, 1962) added 3% sucrose and Benziladenine (0.5 to 3.0 mg L-1) is the most used for gerbera shoot multiplication (Kanwar and Kumar, 2008; The reduction of photoperiod from 16-h to 12-h resulted in increases in 41.8% to 97.2% of shoot multiplication in all gerbera cultivars.
    keywords: cardoso; cultivars; gerbera; micropropagation; multiplication; photoperiod; shoots; vitro
       cache: ahs-3178.pdf
  plain text: ahs-3178.txt

        item: #451 of 594
          id: ahs-3179
      author: Acemi, Arda; Avcı Duman, Yonca; Yüzügüllü Karakuş, Yonca; Özen, Fazıl
       title: A preliminary investigation on developmental and biochemical responses of Amsonia orientalis to ultraviolet-C irradiation
        date: 2018
       words: 3314
      flesch: 58
     summary: UV irradiation may affect growth and meta- bolic processes in plants due to its high quantum energy (Kobashigawa et al., 2011). However, the application of UV irradiation can be hazardous in higher doses.
    keywords: activity; amsonia; h2o2; irradiation; min; orientalis; plant
       cache: ahs-3179.pdf
  plain text: ahs-3179.txt

        item: #452 of 594
          id: ahs-3180
      author: Casini, Paolo
       title: Field evaluation of new Kabuli chickpeas lines for the production of canned seeds
        date: 2018
       words: 2852
      flesch: 62
     summary: Plots were hand-weeded twice (45 and 65 days after emergence Casini - New kabuli chickpeas for canned seeds production 571 [DAE]) during the growth cycle. Casini - New kabuli chickpeas for canned seeds production 573 131: 878-885.
    keywords: chickpeas; production; seeds; varieties; year
       cache: ahs-3180.pdf
  plain text: ahs-3180.txt

        item: #453 of 594
          id: ahs-3181
      author: Ghasemi Ghehsareh, Masood; Khosh-Khui, Morteza
       title: The effect of cutting type, leaf area, leaf number, putrescine and indole-3-Butyric acid on the rooting of Ficus cuttings (Ficus elastica Roxb. ex Hornem.)
        date: 2018
       words: 6680
      flesch: 66
     summary: Table 2 - Effect of leaf size, Auxin and Put on root quality (rooting index) of Ficus leaf bud cutting Table 1 - Effect of leaf size, Auxin and Put on root length, root number and root fresh weight of Ficus leaf bud cutting * Means with similar letters (lowercase letters for whole means and capital letters for means of rows and columns) are not significant at 5% level of probability using LSD. In Hibiscus, the maintenance of leaves on cuttings increased rooting (Van Overbeek et al., 1946).
    keywords: auxin; blade; bud; cuttings; effect; experiment; leaf; leaves; number; rooting; terminal
       cache: ahs-3181.pdf
  plain text: ahs-3181.txt

        item: #454 of 594
          id: ahs-3182
      author: Benaissa, Asmaa; Djebbar, R.; Boucelha, L.
       title: Eco-physiological and biochemical characterization of Rhus tripartita (Ucria) Grande growing in Algerian Sahara under arid climate
        date: 2018
       words: 5367
      flesch: 59
     summary: HARRISON M.T., KELMAN W.M., MOORE A.D., EVANS J.R., 2010 - Grazing winter wheat relieves plant water stress and transiently enhances photosynthesis. Moreover, aridity is a natural selection force that influences plant adaptive strategies to water stress (Sayed, 1998).
    keywords: antioxidant; arid; conditions; content; drought; leaves; plant; proline; rhus; shrub; species; stress; tripartita; water
       cache: ahs-3182.pdf
  plain text: ahs-3182.txt

        item: #455 of 594
          id: ahs-3183
      author: Galieni, Angelica; Stagnari, Fabio; Pisante, Michele; Platani, Cristiano; Ficcadenti, Nadia
       title: Biochemical characterization of artichoke (Cynara cardunculus var. scolymus L.) spring genotypes from Marche and Abruzzo regions (Central Italy)
        date: 2018
       words: 6090
      flesch: 53
     summary: Recently, a renewed and growing interest for arti- choke cultivation has been observed worldwide mainly due to its potential uses as functional food: its large immature inflorescences, called capitula or heads, represent a rich source of bioactive com- pounds - including polyphenols with a strong antirad- ical activity (Schütz et al., 2004) - inulin, fibres and minerals (Lattanzio et al., 2009; Lombardo et al., 2010; Pandino et al., 2011). Lower antioxi- dant compounds (i.e. polyphenols) is, indeed, consid- ered a qualitative trait required by industry, thanks to the scarce propensity to enzymatic browning phe- nomena after cutting and storage operations (Lattanzio et al., 1994; Lombardo et al., 2010).
    keywords: artichoke; bracts; capitula; et al; g-1; genotypes; globe; receptacle; tfc; tpc
       cache: ahs-3183.pdf
  plain text: ahs-3183.txt

        item: #456 of 594
          id: ahs-3184
      author: Setiawan, Chandra; Utama, Nafi; Pradana, Bintang
       title: Combination of alginate based edible coating-betel essential oil in extending the shelf life of rose apple cv. Dalhari (Syzygium samarangense)
        date: 2018
       words: 3744
      flesch: 60
     summary: In conclusion, edible coating treatment with alginate 2.5% and betel essential oil 0.1 % maintained the quality of rose apple cv. Key words: alginate, betel essential oil, edible coating, rose apple cv. Dalhari.
    keywords: alginate; apple; betel; coating; dalhari; food; fruit; oil; rose; storage
       cache: ahs-3184.pdf
  plain text: ahs-3184.txt

        item: #457 of 594
          id: ahs-3185
      author: Porto, Alexandre; Wagner Júnior, Américo; Cabral, Vagner; Citadin, Idemir; Zanella, Juliano; Nunes, Isadora; Conceição, Paulo
       title: Reflective materials and management practices on the physicochemical and biochemical quality of Merlot grapes
        date: 2018
       words: 7080
      flesch: 52
     summary: Table 1 - Berry drop (%), bunch weight (g), weight of total and individual berries (g), SS (°Brix), ATT (g of tartaric acid 100 mL-1), pH, SS/TTA ratio, number of berries per bunch, number of bunches, rot berries and bunches (%), production per plant (Kg) of Merlot grapes submitted or not to management practices with or without the use of reflexive films on the soil, in productive cycle 1 of (2009/2010) and productive cycle 2 of (2010/2011) NS= non-significant by the F test. T1= with management practices and no reflexive film; T2= with management practices with reflexive polypropylene white raffia plastic (film 1); T3= with management practices with reflexive metallic raffia plastic (film 2); T4= without manage- ment practices and no reflexive film; T5= without management practices with reflexive polypropylene white raffia plastic (film 1) and (T6) without mana- gement practices with reflexive f metallic raffia plastic (film 2).
    keywords: berries; co2; cycle; film; management; management practices; plant; plastic; practices; quality; raffia; raffia plastic; soil; table; total; use; white
       cache: ahs-3185.pdf
  plain text: ahs-3185.txt

        item: #458 of 594
          id: ahs-3186
      author: Dorneles, Athos Odin; Pereira, Aline; Possebom, Gessieli; Tarouco, Camila; Rossato, Liana; Tabaldi, Luciane
       title: Ameliorate the cadmium toxicity in Solanum tuberosum L. plants with selenium and silicon application
        date: 2018
       words: 5681
      flesch: 62
     summary: Thus, the aim of this work was to test the pos- sibility of using Se or Si as reliever of Cd toxicity in potato plants. For potato plants under experimental conditions used in this study, Si and Se elements proved to be effective in mitigating Cd toxicity.
    keywords: cadmium; days; et al; parameters; plants; potato; selenium; silicon; toxicity; treatments
       cache: ahs-3186.pdf
  plain text: ahs-3186.txt

        item: #459 of 594
          id: ahs-3187
      author: Aghdam, Maral; HassanPour Asil, Moazzam; Ghasemnezhad, Mahmood; Mousavi Mirkalaei, Seyed Amir Abas
       title: Effects of pre-harvest applications of different source of calcium on the cell wall fractions and stem bending disorder of Gerbera (Gerbera jamesonii L.) cultivar flowers
        date: 2018
       words: 5485
      flesch: 54
     summary: The cell wall materials of the proximal end of flower stem were fractioned following the method of Li et al. (2012). In current research, applying calcium increased calcium concentration in stem of cut flowers.
    keywords: bending; calcium; cell; cultivars; cut; effects; et al; flowers; gerbera; lignin; stem; treatments; water
       cache: ahs-3187.pdf
  plain text: ahs-3187.txt

        item: #460 of 594
          id: ahs-3188
      author: Ashori, Marjan; Ghasemnezhad, Mahmood; Biglouei, Mohammad Hassan
       title: Influence of post-véraison water deficit on berries yield and quality of three table grape cultivars
        date: 2018
       words: 5745
      flesch: 58
     summary: The effects of regulated deficit irrigation (RDI) on fruit yield and quality of grape cultivars NS= not significant, ** significant at p<0.01, * significant at p<0.05. Sci., 2019 33(1): 67-75 74 ous study, water shortage can strongly influence anthocyanin accumulation in grape cultivars (Ozden et al., 2010; Kyraleou et al., 2016).
    keywords: berry; cultivars; deficit; effect; etc; experiment; grape; irrigation; rdi; water; year; yield
       cache: ahs-3188.pdf
  plain text: ahs-3188.txt

        item: #461 of 594
          id: ahs-3189
      author: Hajnajari, Hassan
       title: Apple seed stocks affected scion tree vigor and performance based on maternal self(in)compatibility
        date: 2018
       words: 6636
      flesch: 59
     summary: Key words: breeding, dwarfness, genetic purity, inductive effect, Malus × domes- tica Borkh., seed rootstock. Abstract: In a breeding program to increase uniformity of apple saplings size, shape and vigor the genetic improvement of seed rootstocks was considered as a key point.
    keywords: apple; azayesh; delicious; growth; length; morabbaei; number; rootstock; scion; seed; shoot; table; year
       cache: ahs-3189.pdf
  plain text: ahs-3189.txt

        item: #462 of 594
          id: ahs-3190
      author: Talhouni, Manar; Sönmez, Kenan; Kiran, Sevinç; Beyaz, Ramazan; Yildiz, Mustafa; Kuşvuran, Şebnem; Ellialtıoğlu, Şeküre Şebnem
       title: Comparison of salinity effects on grafted and non-grafted eggplants in terms of ion accumulation, MDA content and antioxidative enyzme activities
        date: 2018
       words: 5756
      flesch: 57
     summary: AKTAş H., 2002 - Selection and physiological characteriza- tion of pepper for resistance to salinity stress. doğAn M., 2004 - in vivo and in vitro investigation of the effect of salinity stress on some physiological parame- ters and antioxidant enzymes activities in the tomato (lycopersicon sp.).
    keywords: activity; artvin; combinations; genotypes; köksal; na+; naomi; plants; rootstock; salinity; salt; stress; tolerance
       cache: ahs-3190.pdf
  plain text: ahs-3190.txt

        item: #463 of 594
          id: ahs-3191
      author: Ghassemi, Saeid; Zehtab-Salmasi, Saeid; Ghassemi-Golezani, Kazem; Alizadeh-Salteh, Saeideh
       title: Morphological traits and yield of Ajowan affected by different irrigation intervals and growth regulators
        date: 2018
       words: 5163
      flesch: 61
     summary: Salicylic acid is a phenolic compound capable of enhancing plant growth and yield in some plants (Arfan et al., 2007). During plant growth and develop- ment, weeds were controlled by hand as required.
    keywords: abscisic; acid; ajowan; fig; ghassemi; growth; irrigation; leaf; number; plant; salicylic; stress; water; yield
       cache: ahs-3191.pdf
  plain text: ahs-3191.txt

        item: #464 of 594
          id: ahs-3192
      author: Pourghorban, Masoumeh; Khaghani, Shahab; Azadi, Pejman; Mirzakhani, Abbas; Changizi, Mahdi
       title: Propagation of Rosa hybrida L. cv. Dolce Vita by stenting and stem cutting methods in response to different concentrations of IBA
        date: 2018
       words: 4681
      flesch: 65
     summary: Abstract: This study was conducted to investigate the effect of different con- centrations of Indole-3-butyric acid (IBA) in propagation of Rosa hybrida L. cul- tivar Dolce Vita by stenting (cutting and grafting) and stem cutting methods in greenhouse conditions. Then, the stentings and stem cuttings were cultured in a cocopeat + perlite (in 1:1 ratio) medium under mist system.
    keywords: cuttings; iba; number; plants; propagation; rooting; roots; stem; stenting
       cache: ahs-3192.pdf
  plain text: ahs-3192.txt

        item: #465 of 594
          id: ahs-3193
      author: Ottanelli, Aleandro; Marone, Elettra; Fiorino, Piero
       title: A new device to improve the mechanical winter pruning in olive trees hedgerows
        date: 2019
       words: 6544
      flesch: 59
     summary: Average and standard deviations of raw data related to the four treatment (East air On, East air Off, West air On, and West air Off) for each locality and cultivar were compared; since in this experiment Authors were interested in the evaluation of the effectiveness in the performances of a pruning machine (i.e. kg of production or cm of elongation tree-1, or ha-1), only raw data were submitted to the parametric test, as logarithmic transformation is most suitable to express magnitude discrepancy; for each data set, tests were carried out to evaluate the normality of the distributions, and Levene’s test were performed to evaluate homoscedasticity at 95% con- fidence level. The comparison between manual and mechanical pruning highlight a greater operative speed of the second (Giametta and Zimbalatti, 1997), partially compromised by the decreasing of productivity (Ferguson et al., 2002; Peça et al., 2002).
    keywords: air; arbequina; canopy; east; leaves; olive; pruning; shoots; west
       cache: ahs-3193.pdf
  plain text: ahs-3193.txt

        item: #466 of 594
          id: ahs-3194
      author: Chand, Ravneel; Jokhan, Anjeela; Kelera, Railoa
       title: Spiralling whitefly and its management practices in the South Pacific. A review
        date: 2018
       words: 5705
      flesch: 59
     summary: It is an effective tool in programmes of Integrated Pest Table 1 - Distribution of Aleurodicus dispersus whiteflies in the Pacific found during the whitefly survey (1996-1997) Aleurodicus dispersus AmS CoI Fij Kos Poh Tru Yap Gua Kir MaI Nau Niu NMI Pal PNG SI FrP Ton Tuv Van WSa Distribution in 1996/7 x x x x x x x x x x x x x x x x x x Exotic x x x x x x x x x x x x x x x x x x Serious Pest potential x x x x x x x x x x x x x x x x x x AmS= American Samoa; CoI= Cook Islands; Fij= Fiji; Kos= Kosrae (FSM); Poh= Pohnpei (FSM); Tru= Truk (FSM); Yap= Yap (FSM); Gua= Guam; Kir= Kiribati; MaI= Marshall Islands; Nau= In this paper, an overview of Spiralling whiteflies and its management practices in the South Pacific will be reviewed.
    keywords: aleurodicus; control; dispersus; hawaii; leaves; management; norris; pacific; pest; plants; russell; south; waterhouse; whiteflies; whitefly
       cache: ahs-3194.pdf
  plain text: ahs-3194.txt

        item: #467 of 594
          id: ahs-3195
      author: Hakim, Abdul; Qinyan, Zhu; Khatoon, Mohfeza; Gullo, Safawo
       title: Impact of partial root-zone drying on growth, yield and quality of tomatoes produced in green house condition
        date: 2018
       words: 3436
      flesch: 64
     summary: The blossom-end rot is a physiological disorder of tomato fruit caused by calci- um deficiency or excessive soil moisture fluctuation which reduce uptake and movement of calcium into the plant (Mathew and Salvadore, 2007). Reduced weight loss in the PRD treated tomatoes during the storage is a positive quality attribute in tomato fruit especially for distant market (Table 2).
    keywords: cdi; fruit; irrigation; plant; prd; tomato; treatment; water; weight
       cache: ahs-3195.pdf
  plain text: ahs-3195.txt

        item: #468 of 594
          id: ahs-3196
      author: Hejazi, Ziaurrahman; Sadat, Mohammad; Karimi, Bahadar; Fawad, Mumtaz; Muneer, Ahmad
       title: Effects of Packing Materials and Ethanol Concentrations on Removal of Astringency of ‘Rojo Brillante’ in Room Temperature
        date: 2018
       words: 2622
      flesch: 62
     summary: Sci., 53: 278-289. KATO K., 1987 - Large-scale trials for the short term de- astringency in persimmon fruits by ethanol. - J. Jpn. Soc. Fruit firmness was deter- mined for each fruit at two pared equatorial posi- tions after peeled, using a hand-held penetrometer equipped with an 8 mm tip.
    keywords: astringency; brillante; ethanol; fruits; persimmon; polyethylene
       cache: ahs-3196.pdf
  plain text: ahs-3196.txt

        item: #469 of 594
          id: ahs-3197
      author: Colzi, Ilaria; Marone, Elettra; Magnelli, Susanna; Mancuso, Stefano; Azzarello, Elisa; Taiti, Cosimo
       title: Kinetics of volatile organic compounds (VOCs) released by roasted Coffee during the first ten days after processing
        date: 2019
       words: 3645
      flesch: 58
     summary: Coffee samples from Honduras were very rich in VOCs. Statistical data analysis One-way analyses of variance (ANOVA) was per- Colzi et al. - VOCs kinetic in roasted coffee beans 147 formed to compare the total VOCs content in 4 cof- fee stocks over 10 days; the separation of means was calculated by the Fisher’s least significant difference (LSD) test.
    keywords: arabica; coffee; days; et al; samples; time; vocs
       cache: ahs-3197.pdf
  plain text: ahs-3197.txt

        item: #470 of 594
          id: ahs-3198
      author: Aliyoun Nazari, Samad; Hajilou, Jafar; Zeinalabedini, Mehrshad; Imani, Ali
       title: Diversity of morpho-physicochemical traits in Iranian sour cherry genotypes using multivariate analysis
        date: 2018
       words: 5031
      flesch: 59
     summary: Sour cherry fruit is mostly used for industrial preserves (jams, purees, juices and concentrates), while only a small por- tion is assigned to fresh consumption. Sour cherry genotypes had a high vari- ability in traits related to fruit characters such as fruit weight, stone volume, total anthocyanin content and total soluble solid.
    keywords: analysis; cherry; content; cultivars; et al; fruit; genotypes; length; prunus; sour; stone; total; traits
       cache: ahs-3198.pdf
  plain text: ahs-3198.txt

        item: #471 of 594
          id: ahs-3199
      author: Keshavarzi, Maryam; Shekafandeh, Akhtar
       title: The responses of enzymatic and non-enzymatic antioxidant systems of scion ‎on different rootstocks under water stress deficit
        date: 2018
       words: 6731
      flesch: 61
     summary: Plant tolerance to water stress depends on their morphological, physiological and biochemical mechanisms that determine the responses of the plant under stress conditions (Penella et al., 2014). Cell membrane injury The results showed that high levels of water stress increased leaf cell membrane damage in all grafted and non-grafted plants (Fig. 5).
    keywords: acid; chlorophyll; content; cultivars; drought; fig; levels; plant; sabz; scion; siah; stress; torsh; water
       cache: ahs-3199.pdf
  plain text: ahs-3199.txt

        item: #472 of 594
          id: ahs-3200
      author: Aalipour, Hamed; Nikbakht, Ali; Etemadi, Nematollah
       title: Relationship between chlorosis, photosynthesis and the nutrient content of plane trees in the presence of chemical and organic fertilizers
        date: 2019
       words: 4209
      flesch: 60
     summary: It has been reported that the application of FeSO4 (4-8 kg tree-¹) mixed with manure, cotton seed cake, or other organic substances in 8 to 10 holes in the soil around the crowns of apple trees (Malus sylvestris Mill.) resulted in marked correction of Fe chlorosis (Zheng-Qing and Cang-Zhen, 1982). Sci., 2019 33(2): 171-177 DOI: 10.13128/ahs-23326 Relationship between chlorosis, photo- synthesis and the nutrient content of plane trees in the presence of chemical and organic fertilizers H. Aalipour (*), A. Nikbakht, N. Etemadi Department of Horticulture, College of Agriculture, Isfahan University of Technology, 8415683111 Isfahan, Iran. Key words: mycorrhizal fungi, nutrient acquisition, organic matter, symbiosis, urban trees.
    keywords: amf; chlorosis; content; leaf; manure; mycorrhizal; plane; plants; soil; treatments; trees
       cache: ahs-3200.pdf
  plain text: ahs-3200.txt

        item: #473 of 594
          id: ahs-3201
      author: Abdi, Gholamreza; Khush-hkhui, Morteza; Shekafandeh, Akhtar
       title: Embryogenesis in Valerian (Valeriana officinalis L.) using leaf segments
        date: 2019
       words: 4364
      flesch: 53
     summary: Direct somatic embryogenesis was induced using by half- strength MS medium supplemented with 2,4-D (0.5 mg·l-1), glutamic acid (100 mg·l-1), 4% sucrose and 8 g·l-1 agar. The plant derived from direct somatic embryogenesis usually is unicel- lular in origin and hence genetically uniform.
    keywords: culture; embryogenesis; embryos; explants; germination; medium; mg·l-1; naa; officinalis; plant; valeriana
       cache: ahs-3201.pdf
  plain text: ahs-3201.txt

        item: #474 of 594
          id: ahs-3202
      author: Hemati, Ebrahim; Salehi salmi, Mohamareza; Daneshvar, Mohamad Hosein; Heidari, Mokhtar
       title: The roles of sodium nitroprusside, salicylic acid, and methyl jasmonate as hold solutions on vase life of Gerbera jamesonii ‘Sun Spot’
        date: 2019
       words: 5857
      flesch: 60
     summary: Introduction Vase life and quality are key factors that contribute to the aesthetic and benefits of cut flowers (Mansouri, 2012). The short vase life of most cut flowers is mainly due to the water loss, which is an important physio- logical process that affects the main quality characteristics of cut flowers, such as appearance (Salehi Salmi et al., 2018).
    keywords: concentrations; cut; et al; flowers; gerbera; hold; hqs; life; plant; snp; solutions; vase; water
       cache: ahs-3202.pdf
  plain text: ahs-3202.txt

        item: #475 of 594
          id: ahs-3203
      author: Chiomento, José Luís; Frizon, Patrícia; Costa, Rosiani; Trentin, Nicolas; De Nardi, Fabiola; Calvete, Eunice
       title: Water retention of substrates potentiates the quality of lettuce seedlings
        date: 2019
       words: 5255
      flesch: 65
     summary: This study provides a view of the develop- ment of lettuce seedlings using different substrates to improve the seedlings quality (e.g., increase the growth of shoot biomass and root system) grown in greenhouses. Sci., 2019 33(2): 197-204 DOI: 10.13128/ahs-23599 Water retention of substrates potentiates the quality of lettuce seedlings J.L.T. Chiomento ¹ (*), P. Frizon ¹, R.C. Costa ¹, N.S. Trentin ², F.S. Nardi ¹, E.O.
    keywords: crh; cultivars; fig; hor; lettuce; morphology; quality; root; seedlings; shoot; substrates; system; table; water
       cache: ahs-3203.pdf
  plain text: ahs-3203.txt

        item: #476 of 594
          id: ahs-3204
      author: Ghanei, Mohammadreza; Mohammadi, Morad; Pirdashti, Hemmatollah
       title: Yield and physiological response of Perilla (Perilla frutescens) under different soil fertility treatments
        date: 2019
       words: 5990
      flesch: 54
     summary: It also affects the efficiency of fertilizer application, pesticides and herbicides. Also, in the Sansen location, the highest catalase activity was obtained from 200 kg/ha chemical fertilizer and biologic fertilizer application (Fig. 5).
    keywords: acid; activity; application; ardehal; biologic; chemical; fertilizer; humic; mashhad; perilla; plant; yield
       cache: ahs-3204.pdf
  plain text: ahs-3204.txt

        item: #477 of 594
          id: ahs-3205
      author: Hatamzadeh, Abdollah; Shafiei-Masouleh, Seyedeh-Somayyeh
       title: The Use of Organic Nano-Supplements of Fertilizer for Lily Forcing Period
        date: 2019
       words: 7804
      flesch: 61
     summary: g 15 50.84±2.73 ab 82.20±2.65 ab 46.02±1.99 efg Navona CMC 0 48.30±2.23 ab 81.20±3.01 ab 59.52±0.31 abcd 2.5 47.60±2.01 b 78.00±1.92 ab 60.16±1.54 abcd 5 50.80±2.00 ab 81.80±1.57 ab 61.60±0.58 abc 10 50.30±1.51 ab 81.90±2.65 ab 61.98±1.15 ab 15 46.20±1.83 ab 76.00±2.07 ab 61.40±1.57 abc MNCC 0 48.30±2.23 ab 81.20±3.02 ab 28.08±0.56 abc 6.80±0.58 abc 116.64±0.24 a 94.60±0.24 a 2.5 26.70±1.09 abcdef 6.40±0.51 abc 122.06±0.51 a 93.60±0.51 a 5 28.40±1.41 ab 6.80±0.37 abc 120.39±0.58 a 93.80±0.58 a 10 27.48±0.88 abcd 6.80±0.37 abc 110.43±0.68 a 93.40±0.68 a 15 31.36±2.06 a 7.00±0.58 abc 119.86±0.81 a 94.40±0.81 a Navona CMC 0 32.90±1.61 a 9.00±0.32 a 82.87±0.68 b 59.40±0.68 b 2.5 30.40±0.53 ab 9.50±0.29 ab 80.02±0.73 b 60.20±0.73 b 5 31.00±2.26 ab 9.20±0.49 a 79.80±0.49 b 59.80±0.49 b 10 31.60±1.35 a 9.00±0.63 a 81.16±0.63 b 59.00±0.63 b 15 29.80±1.11 ab 9.40±0.24
    keywords: chitosan; cmc; concentrations; cultivars; effects; et al; field; growth; iron; lily; mncc; nanoparticles; osfs; plant; răcuciu; sci
       cache: ahs-3205.pdf
  plain text: ahs-3205.txt

        item: #478 of 594
          id: ahs-3206
      author: Jorkesh, Abbas; Aminifard, Mohammad hossein
       title: Foliar applicaton of asparagine and casein on biochemical and morphological attributes of garden cress (Lepidium sativum L.) plants under greenhouse conditions
        date: 2019
       words: 4508
      flesch: 62
     summary: Amino acids is a well- known biostimulant which has positive influence on plant growth, yield and significantly decrease the damages caused by abiotic stresses (Kowalczyk and Zielony, 2008). During plant growth the greenhouse temperature was 25˚C on the day and 15°C during the nights.
    keywords: amino; application; asn; content; csn; foliar; leaf; nitrogen; plant; stem; weight
       cache: ahs-3206.pdf
  plain text: ahs-3206.txt

        item: #479 of 594
          id: ahs-3207
      author: Fontana, Daniele; Becker, Carol; Pinheiro, Marcos; Santos, Jullie dos; Caron, Braulio; Schmidt, Denise
       title: Impact of light quality on the physiological characteristics of Capsicum chinense seeds
        date: 2019
       words: 5757
      flesch: 65
     summary: DAUD N., FAIZAL A., DANNY GEELEN D., 2013 - Adventitious rooting of Jatropha curcas L. is stimulated by phloroglucinol and by red LED light. - Combinations of blue and red LEDs may promote biomass increase (Gu et al., 2012; Maluta et al., 2013; Da Silva et al., 2016) and increase of the root system (Gu et al., 2012).
    keywords: biq; boyra; et al; germination; growth; leds; light; mass; pepper; plant; qualities; quality; red; root; seeds; yellow
       cache: ahs-3207.pdf
  plain text: ahs-3207.txt

        item: #480 of 594
          id: ahs-3208
      author: Tatari, Maryam; Abdollahi, Hamid; Henareh, Mashhid; Dehqani, Mohsen
       title: Selection of open pollination progenies in some pear species in order to achieve dwarf and drought tolerant rootstocks
        date: 2019
       words: 7016
      flesch: 67
     summary: 4 - Height of single genotypes in P. communis cv. P. communis is more commonly known as Khoj and is scattered in the forests of the north, West Azarbaijan, Sardasht and Baneh in Kordestan province.
    keywords: drought; genotypes; height; khoj; khoj n.; p. communis; p. salicifolia; pear; seedling; species; stress
       cache: ahs-3208.pdf
  plain text: ahs-3208.txt

        item: #481 of 594
          id: ahs-3209
      author: Modarresi, Mostafa; Jalali-Javaran, Mokhtar; Shams-Bakhsh, Masoud; Zeinali, Sirous; Mirzaee, Maliheh
       title: TuMV as an efficient transient vector for expressing heterologous proteins in Nicotiana tabacum and N. benthamiana
        date: 2019
       words: 3326
      flesch: 57
     summary: Florescence microscopy results indicated that TuMV could infect tobacco plants and accumulate GFP protein in plant leaves. Dot-Blot assay (Fig. 4) indicated that GFP protein was recognized by specific antibody and developed brown color in transformed plants and positive con- trol.
    keywords: benthamiana; expression; fig; gfp; plants; protein; tobacco; transient; tumv; vector; virus
       cache: ahs-3209.pdf
  plain text: ahs-3209.txt

        item: #482 of 594
          id: ahs-3210
      author: Golubkina, Nadezhda; Seredin, Timofei; Antoshkina, Marina; Baranova, Helene; Stoleru, Vasile; Teliban, Gabriel; Caruso, Gianluca
       title: Effects of crop system and genotype on yield, quality, antioxidants and chemical composition of organically grown leek
        date: 2019
       words: 5547
      flesch: 54
     summary: Camus 27.1 fg 401.6 cd 786.3 ab 63.1 de 81.4 ab Vesta 24.3 g 345.3 de 855.5 a 68.1 cd 85.4 a Summer breeze 28.0 fg 379.7 de 716.3 b 72.1 bc 72.3 bc Golubkina et al. - Crop system and genotype effects in Allium porrum 267 tion between selenium and polyphenol content was found in wheat (Lachman et al., 2011) and a negative correlation between quercetin and selenium was recorded in A. cepa (Golubkina et al., 2016). Separate plant fortifica- tion with Se and I showed the possibility of mutual stimulation by the two elements (Golubkina et al., 2018 a).
    keywords: acid; antioxidant; content; crop; leek; porrum; pseudo; selenium; stems
       cache: ahs-3210.pdf
  plain text: ahs-3210.txt

        item: #483 of 594
          id: ahs-3211
      author: Motaghayer, Mahroo; Azizi, Majid; Teheranifar, Ali
       title: Nanosilver, salicylic acid and essential oils effects on water relations of gerbera ‘Rosalin’ cut flowers
        date: 2019
       words: 7529
      flesch: 65
     summary: EO increased lisianthus cut flower vase life (Kazemi et al., 2014) and clove EO and water extract increased gerbera ‘Ecco’ vase life (Ziyaei Movahed et al., 2010). Based on the results of this study, new antimicro- bial agents such as NS, thyme and peppermint EOs had a positive effect on flower vase life and water content.
    keywords: cut; et al; flowers; gerbera; life; mg.l-1; peppermint; stem; thyme; treatment; vase; vase life; water
       cache: ahs-3211.pdf
  plain text: ahs-3211.txt

        item: #484 of 594
          id: ahs-3212
      author: Antonetti, Maurizio; Nin, Stefania; Burchi, G.
       title: First insight into Araucaria araucana (Molina) K. Koch under its southernmost European growing condition: a proposed descriptor list for morphological characterization
        date: 2019
       words: 6182
      flesch: 56
     summary: 8 - Habitus variability in Araucaria araucana trees grown in Pistoia’s hinterland in a plain area. Phenology Throughout three-year growing cycles (2015- 2017), the phenological phases (onset of flowering, full bloom, fertilization, fruit ripening and seed pro- duction) of A. araucana trees belonging to 8 putative populations were observed every two weeks from March to June (during the flower maturation), and monthly in the rest of the year.
    keywords: araucana; araucaria; araucaria araucana; chile; climate; descriptor; female; fig; pistoia; plants; populations; species; trees; year
       cache: ahs-3212.pdf
  plain text: ahs-3212.txt

        item: #485 of 594
          id: ahs-3213
      author: Tzavara, Stavroula; Darras, Anastatios; Assimakopoulou, Anna
       title: Tobacco dust waste as an alternative medium to grow geranium (Pelargonium x hortorum) plants
        date: 2019
       words: 2409
      flesch: 63
     summary: Plant growth media containing peat (P) + 0, 5, 10, 25 or 50% TD were prepared and tested on geranium plant growth and development. “ML Diego” grown in P+5% or P+10% TD maintained similar or higher height, num- ber of leaves, number of inflorescences, net CO2 assimilation and transpiration rates to the control plants (i.e. P+0% TD) (Table 3).
    keywords: growth; medium; number; peat; plants; tobacco; waste
       cache: ahs-3213.pdf
  plain text: ahs-3213.txt

        item: #486 of 594
          id: ahs-7363
      author: Parmoon, Ghasem; Moosavi, Seyed Amir; Siadat, Seyed Ataollah
       title: Descriptions of okra seed longevity loss behavior using nonlinear regression models
        date: 2019
       words: 7102
      flesch: 66
     summary: In this study, vari- ous nonlinear models, including logistic, Hill, Weibull, Sigmoid, Gompertz and Probit, were applied on seed germination data, obtained from the accelerated aging test of three Iranian okra landraces. Seed germination as the complex physiologically active process is initi- ated with water uptake by dry seeds and completed by radicle protrusion from the seed coat (Bewley and Black, 1994; McDonald and Kwong, 2005).
    keywords: aging; data; ecotypes; germination; model; okra; parameter; seed; vigor; weibull
       cache: ahs-7363.pdf
  plain text: ahs-7363.txt

        item: #487 of 594
          id: ahs-7364
      author: Dadashpour, Ahmad; Talaie, A.R.; Askari-Sarcheshmeh, M.A.; Gharaghani, A.
       title: Influence of two training systems on growth, yield and fruit attributes of four apple cultivars grafted onto ‘M.9’ rootstock
        date: 2019
       words: 4972
      flesch: 67
     summary: GONKIEWICZ A., 2011 - Effect of tree training system on yield and fruit quality of sweet cherry ‘Kordia’. Sci., 39: 158-163. OZKAN Y., YILDIZ K., KUCUKER E., CEKIC C., OZGEN M., AKCA Y., 2016 - Performance of ‘Fuji’ apple on M.9 rootstock in different tree training systems for the first five years. - J. Agr.
    keywords: apple; cultivars; fruit; fuji; system; training; tree; yield
       cache: ahs-7364.pdf
  plain text: ahs-7364.txt

        item: #488 of 594
          id: ahs-7365
      author: Idris, I.; Shoaib, A.
       title: Efficiency of AFLP markers to detect genetic variation in Phthorimaea operculella (Lepidoptera: Gelechiidae) offspring irradiated males
        date: 2019
       words: 3632
      flesch: 61
     summary: Consequently, it is known, that DNA damages caused by irradiated males at 150 Gy are irreversible and randomly inherited to their offspring (Makee and Saour, 2004; Vreysen et al., 2016). DNA extraction and AFLP analysis Six DNA isolation protocols of P. operculella males from adult stage were used to obtain a good quality and quantity of DNA for AFLP analysis (M1:
    keywords: aflp; analysis; dna; families; males; operculella; potato; samples; sterility; technique
       cache: ahs-7365.pdf
  plain text: ahs-7365.txt

        item: #489 of 594
          id: ahs-7366
      author: das Souza, Aline; Smiderle, Oscar Jose; Pedrozo, Cassia Angela
       title: Long-time storage of Pochota fendleri seeds with different packaging
        date: 2019
       words: 3636
      flesch: 60
     summary: The collected seeds were selected and sorted as to weight (small seeds being those that passed through a 4 mm diameter sieve, having a mean individual weight of 0.027 g; and large seeds, those that were retained in a 4.5 mm diameter sieve, with a mean individual weight of 0.048 g). The germination test was carried out on four replications of 50 seeds, in plastic boxes (gerbox®) on Souza et al. ‐ Seeds storage of Pochota fendleri 329 germination paper (germitest®) moistened with dis- tilled water at 2.5 times the weight of the paper and kept in a germination chamber at 25±2°C under con- stant light.
    keywords: fendleri; germination; months; pet; pochota; quality; seeds; smiderle; souza; storage
       cache: ahs-7366.pdf
  plain text: ahs-7366.txt

        item: #490 of 594
          id: ahs-7367
      author: Palchetti, Enrico; Calamai, Alessandro; Verdi, Leonardo; Masoni, Alberto; Marini, Lorenzo; Chiaramonti, David
       title: Preliminary screening of agricultural feedstocks for anaerobic digestion
        date: 2019
       words: 8295
      flesch: 56
     summary: Abstract: The aim of this study is to evaluate the performances in the early stages of biogas production of various unconventional and low inputs crops, such as: kenaf (Hibiscus cannabinus L.), amaranthus (Amarathus cruentus L.), sorghum (Sorghum bicolor L.), and sunflower (Helianthus annuus L.). The results showed that the use of silage from crops with reduced agronomic requests (kenaf and amaranthus) versus a con- ventional crop (corn) led to comparable, or even better, biogas production per- formances during the initial stages.
    keywords: biogas; biogas production; biomass; cake; corn; crops; digestion; et al; feedstock; jatropha; milk; oil; olive; pelargonium; production; residues; silage; substrates; whey
       cache: ahs-7367.pdf
  plain text: ahs-7367.txt

        item: #491 of 594
          id: ahs-7368
      author: Adamipour, Nader; Khosh-Khui, Morteza; Salehi, Hassan; Rho, Hyungmin
       title: Effect of vermicompost on morphological and physiological performances of pot marigold (Calendula officinalis L.) under salinity conditions
        date: 2019
       words: 9787
      flesch: 64
     summary: For this purpose, an experiment was conducted to determine the effects of vermicompost on some morphological and physiological characteris- tics of pot marigold under salinity stress conditions. As a conse- quence, plants under salinity stress conditions reduce root efficacy in supplying nutrients and water to other organs.
    keywords: chlorophyll; conditions; content; effects; et al; growth; leaf; marigold; mean; nacl; plants; pot; proline; salinity; salinity stress; sci; shoot; soil; stress; table; treatments; vermicompost; weight
       cache: ahs-7368.pdf
  plain text: ahs-7368.txt

        item: #492 of 594
          id: ahs-7369
      author: Rejane do Nascimento, Cassia; Chagas, Edvan Alves; Smiderle, Oscar Jose; De Andrade Sousa, Ataiza; Cardoso Chagas, Pollyana
       title: Biometry and vigor of seeds of Myrciaria dubia (kunth) McVaugh
        date: 2019
       words: 3812
      flesch: 61
     summary: Wagner Junior et al. (2011) demonstrated that seed size has an effect on the emergence and initial development of jabuticaba seedlings (Plinia cauliflo‐ ra), and that large seeds gave seedlings that were more vigorous. The variation in seed size may interfere with their physiological quality, still poorly researched in forest species (Oliveira et al., 2009; Smiderle et al., 2016).
    keywords: camu; emergence; mean; medium; results; seeds; size; values; weight
       cache: ahs-7369.pdf
  plain text: ahs-7369.txt

        item: #493 of 594
          id: ahs-7370
      author: Habimana, Sylvestre; Kalyan Murthy, K.N.; Nanja Reddy, Y.A.; Mudalagiriyappa, Mudalagiriyappa; Vasantha Kumari, R.; Hanumanthappa, D.C.
       title: Impact of aerobic rice-leafy vegetables intercropping systems on weed management
        date: 2019
       words: 5996
      flesch: 62
     summary: The higher nutrients uptake by rice crop and leafy vegetables in intercropping of rice with leafy veg- etable palak might be attributed to minimum crop- weed competition as a result of higher weed smoth- ering efficiency, gave the better control of weeds from initial stages which led to lower weed popula- tion and their dry weight, this helped the crop to grow in weed-free environment and absorb more nutrients from the soil. The total nitrogen (153.78 kg ha-1), phospho- rous (45.27 kg ha-1) and potassium (152.22 kg ha-1) uptake by rice crop at harvest were significantly high- er in intercropping of rice with leafy vegetable palak as compared to sole rice (109.90, 29.49 and 109.25 kg NPK ha-1, respectively).
    keywords: equivalent; ha-1; intercropping; leafy; palak; rice; systems; uptake; vegetable; weed; yield
       cache: ahs-7370.pdf
  plain text: ahs-7370.txt

        item: #494 of 594
          id: ahs-7371
      author: Vakili, A.N.; Bagheri, Hedayat; Azadi, P.
       title: Direct shoot regeneration of three Petunia cultivars
        date: 2019
       words: 3239
      flesch: 61
     summary: Alvan cultivar showed the highest percentage of shoot regeneration (100%) and mean number of shoots per explant (25.33) on MS with 2 mg/l TDZ (Fig. 1 b) and the lowest one (6.61) was belong to Mahalat cultivar on MS with 1 mg/l TDZ. The importance of TDZ on regeneration and shoot induction frequency Table 1 ­ Effect of modified MS medium supplemented with different concentration of BA on shoot regeneration from leaf explants of P. hybrid The values represent the mean ± standard error of three replicates.
    keywords: alvan; petunia; regeneration; shoot; tdz
       cache: ahs-7371.pdf
  plain text: ahs-7371.txt

        item: #495 of 594
          id: ahs-7372
      author: Gholamian Jazi, Zohre; Etemadi, Nematollah; Aalipour, Hamed
       title: The physiological responses of four turfgrass species to drought stress
        date: 2019
       words: 6326
      flesch: 61
     summary: In our experiment, F. arundinacea, with low concentration of MDA in diffe- rent levels of drought stress treatment, showed more tolerance to drought stress. Abstract: Drought stress is one of the most important factors which reduce turfgrass growth and quality in the area with restricted rainfall or irrigation water supply.
    keywords: activity; cat; content; drought; drought stress; enzyme; mda; plant; pod; proline; rwc; sci; sod; species; stress; water
       cache: ahs-7372.pdf
  plain text: ahs-7372.txt

        item: #496 of 594
          id: ahs-7373
      author: Al-Chammaa, M.; Al-Ain, F.; Kurdali, Fawaz
       title: Effect of salicylic acid on growth, nodulation and N2-fixation in water stressed chickpeas using 15N and 13C
        date: 2019
       words: 7668
      flesch: 54
     summary: Available l iterature on the relationships between SA and carbon isotope discrimination is very scarce and, to our knowledge, only in one case, the effect of SA on plant water relationships was studied (Barkosky and Einhellig, 1993). Exogenously supplied SA can improve plant growth under stresses by stimulating the accu- mulation of mineral elements including nitrogen (Gunes et al., 2005; Yildirim et al., 2008).
    keywords: acid; chickpea; et al; fc1; fc3; fixation; growth; nitrogen; plants; salicylic; soil; stress; water; δ13c
       cache: ahs-7373.pdf
  plain text: ahs-7373.txt

        item: #497 of 594
          id: ahs-7374
      author: Gori, Massimo; Pecchioli, Simona; Giordani, Edgardo; Saeedi, Mohammad Aziz; Wafa, Fazal Haq; Biricolti, Stefano
       title: Barcoding assessment of the Citrus species cultivated in the eastern Afghanistan
        date: 2019
       words: 3496
      flesch: 53
     summary: Discussion and Conclusions The barcoding analysis of the afghan germplasm and Citrus species has been carried out with a set of primers targeting nuclear ribosomal DNA or chloro- plast genes (ITS1 and 2, matK, rbcl and psbA-trnH). Universal primers for PCR amplification, used in the present study have been retrieved in lit- erature (Chen et al., 2010;
    keywords: afghanistan; barcoding; citrus; dna; italy; local; primers; samples; sequences; species
       cache: ahs-7374.pdf
  plain text: ahs-7374.txt

        item: #498 of 594
          id: ahs-7375
      author: Hajivar, Bahareh; Zare-Bavani, Mohammad Reza
       title: Alleviation of salinity stress by hydrogen peroxide and nitric oxide in tomato plants
        date: 2019
       words: 5476
      flesch: 62
     summary: Salinity stress is known detrimental effect on the overall growth and productivity of plants (Ashraf, 2004) and may inhibit plant growth due to reduction of water uptake by plants (Kaya et al., 2003). The MSI was significantly decreased by 50 and 100 mM NaCl stress, however, plants treated with H2O2 and SNP were less affected by salinity stress compared to water sprayed plants.
    keywords: content; et al; fig; growth; h2o2; plants; salinity; salt; sci; snp; stress; tomato; water
       cache: ahs-7375.pdf
  plain text: ahs-7375.txt

        item: #499 of 594
          id: ahs-7376
      author: Abed, Aicha; Bonhomme,  M.; Lacointe, G.; Bourgeois, G.
       title: Climate change effect on the bud break and flowering dates of the apple trees in mountainous and plain regions of Algeria
        date: 2019
       words: 9892
      flesch: 60
     summary: Some contrasting tendencies according to sites and periods have been demonstrated: very significant warming at Sidi Lakhdar site in autumn and spring, in particular in October and April, disturbing thus the entrance of the buds in the endodormancy and ecodormancy. It seems that the failure to fulfill the need of cold units at Sidi Lakhdar site has strongly affected the goodness of fit of the classic phenological models, confirming indirectly the existence of more complex physiological processes (not taken in consideration by models), which manifest themselves in limited zones such as Sidi Lakhdar site.
    keywords: apple; average; benchicao; bud; burst; change; chuine; climate; cold; flowering; lakhdar; model; sidi; sigmoid; site; temperatures; units; warming; years
       cache: ahs-7376.pdf
  plain text: ahs-7376.txt

        item: #500 of 594
          id: ahs-7377
      author: Duarte, Willian Naves; Zanello, Cesar Augusto; Cardoso, Jean Carlos
       title: Efficient and easy micropropagation of Morus nigra and the influence of natural light on acclimatization
        date: 2019
       words: 4439
      flesch: 56
     summary: However, the addition of BA, even at the lowest concentration used in culture media (0.25 mg L-1), negatively affected the quantitative (height of plants and number and width of leaves) (Table 1) as well as qualitative parameters of regenerated shoots, show- ing callus formation at the basal cut ends and yellow- ish leaves (Fig. In most of the protocols related to in vitro micro- propagation of Morus sp., the addition of cytokinins Table 1 - Effects of culture medium with different PGRs on the in vitro development and multiplication of nodal segments of Morus nigra * Multiplication rate referring to the mean number of nodal segments obtained by each segment inoculated in vitro.
    keywords: conditions; culture; greenhouse; growth; l-1; medium; micropropagation; morus; nigra; nodal
       cache: ahs-7377.pdf
  plain text: ahs-7377.txt

        item: #501 of 594
          id: ahs-7378
      author: Aldahadha, Abdallah M.; Al Sane, Khaldoun; Bataineh, Ahmed; Abu Alloush, Asem; Hammouri, Zayed
       title: Pollen viability and in vitro germination of six pistachio (Pistacia vera L.) cultivars grown in northern Jordan
        date: 2019
       words: 3517
      flesch: 54
     summary: In addition, this experiment was performed to find a correlation between in vitro pollen germination and viability, to check effi- ciency of stored pollen and to determine which pis- tachio cultivar could be recommended as best polli- nator. It has been indi- cated that the validity of the in vitro evaluation of pollen germination is a predictor of in vivo behavior (Acar and Kakani, 2010).
    keywords: conditions; cultivars; germination; pistachio; pollen; pollen germination; pollen viability; storage; viability
       cache: ahs-7378.pdf
  plain text: ahs-7378.txt

        item: #502 of 594
          id: ahs-7407
      author: Raei, Yaghoub; Sayyadi Ahmadabad, Mehdi ; Ghassemi-Golezani, Kazem ; Ghassemi, Saeid 
       title: Pinto bean and black mustard responses to bio-fertilizers under intercropping system
        date: 2020
       words: 5125
      flesch: 56
     summary: Source df Mean Square Pinto bean (Phaseolus vulgaris L.) Black mustard (Brassica nigra L.) 100 grains weight Biological yield Grain yield Harvest index 100 grains weight Biological yield Grain yield Harvest index Replication 2 72.94 3680597 1131685 2.03 0.01 1786035 157796 2.60 Cropping pattern 2 79.10 ** 40310058 ** 9924157 ** 0.70 NS 0.01 NS 122550980 ** 1961700 ** 5.77 NS Fertilizer (F) 3 140.98 ** 37336605 ** 9970014 ** 17.55 NS 0.14 * 24340924 ** 832223 ** 2.44 NS C × F 6 4.78 NS 989636 NS 236278 NS 6.49 NS 0.17 ** 8957965 NS 11308 NS 6.06 NS Error 22 2.75 559597 133108 10.29 0.04 5045637 21412 3.77 Cv % ­ 5.23 16.85 16.27 6.40 4.46 17.12 8.53 14.59 Raei et al. ‐ Pinto bean and black mustard intercropping and bio‐fertilizersn 179 cantly increased the field performance of these plants (Table 3, Fig. 1), followed by bio­fertilizers + 50% chemical fertilizer. Application of bio­fertilizers and chemical fertilizer increased most of the agronomic traits in pinto bean and black mustard plants.
    keywords: bean; bio­fertilizers; chemical; density; fertilizer; intercropping; inter­; mustard; pinto; pinto bean; sci; species; urea; yield
       cache: ahs-7407.pdf
  plain text: ahs-7407.txt

        item: #503 of 594
          id: ahs-7411
      author: Jadidi, Esmaeil ; Tatari, Maryam; Ghasemnezhad, Mahmoud ; Reza Salemi, Hamid
       title: The salinity tolerance of pomegranate cultivars: Effects of salt stress on root and leaf mineral content 
        date: 2020
       words: 6028
      flesch: 62
     summary: Water salinity up to 3 dS/m increased slightly roots fresh and dry weight of all cultivars and thereafter decreased. Salinity treatments Four levels of water salinity (control, 3, 6, 9 and 12 dS/m) were used for irrigation of different pome­ granate cultivars (Table 2).
    keywords: content; cultivars; fig; leaf; pomegranate; root; salinity; salt; sodium; stress; water
       cache: ahs-7411.pdf
  plain text: ahs-7411.txt

        item: #504 of 594
          id: ahs-7415
      author: Rahimi Dvin, Sama; Gharaghani, Ali; Pourkhaloee , Ali 
       title: Genetic diversity, population structure, and relationships among wild and domesticated almond (Prunus spp.) germplasms revealed by ISSR markers
        date: 2020
       words: 9236
      flesch: 57
     summary: Materials and Methods Field sampling To detect higher genetic diversity (resulting from cross­pollination in natural habitat of the plant mate­ rials used herein) as well as the feasibility of plant materials collection (seeds instead of leaf samples) we chose to use raised seedling populations instead of natural populations in this study. However, higher genetic diversity was observed in certain individuals and populations of the wild almonds.
    keywords: almond; analysis; bands; diversity; elaeagnifolia; et al; firuzabad; flow; genetic; iran; issr; markers; nourabad; number; plant; populations; primer; prunus; scoparia; shiraz; species; structure; study; wild
       cache: ahs-7415.pdf
  plain text: ahs-7415.txt

        item: #505 of 594
          id: ahs-7444
      author: Demasi, Sonia; Falla, Nicole Melanie; Caser, Matteo; Scariot, Valentina
       title: Postharvest aptitude of Begonia semperflorens and Viola cornuta edible flowers
        date: 2020
       words: 4764
      flesch: 62
     summary: Nowadays, edible flowers are horticultural niche products, sold as pot plant or as fresh cut flowers, with increasing appeal for the food industry due to their organoleptic and healthy proper­ ties (Kaisoon et al., 2012; Grzeszczuk et al., 2016; Lu et al., 2016). Edible flowers improve the sensorial qualities of food by adding colour, fragrance, flavour and visual appeal to culinary preparations (Kelley et al., 2001a; Mlcek and Rop, 2011; Koike et al., 2015).
    keywords: activity; antioxidant; content; cornuta; et al; flowers; food; plants; plastic; semperflorens
       cache: ahs-7444.pdf
  plain text: ahs-7444.txt

        item: #506 of 594
          id: ahs-7491
      author: Rashidiani, Nahid ; Nazari, Farzad; Javadi, Taimoor ; Samadi, Saadi
       title: Comparative postharvest responses of carnation and chrysanthemum to synthesized silver nanoparticles (AgNPs)
        date: 2020
       words: 8968
      flesch: 62
     summary: Devecchi et al. (2009) evaluated the effect of nanosponges including anti­ethylene molecules, such as 1­methyl­ cyclopropene (1­MCP), 1­methylcyclopentene (1­ MCPt), 2,5­norbornadiene and AgNO3 on vase life of carnation flowers. Flower diameters in this study were significantly influenced by AgNPs in carnation flowers, butthe effect on chrysanthemum was not significant.
    keywords: activity; agnps; carnation; chrysanthemum; control; cut; end; et al; ethylene; fig; flowers; life; l­1; period; petals; stem; vase; water
       cache: ahs-7491.pdf
  plain text: ahs-7491.txt

        item: #507 of 594
          id: ahs-7493
      author: Useche-Carrillo, Nora Virginia; Barrientos-Priego, Alejandro Facundo; Núñez-Colín, Carlos Alberto; Campos-Rojas, Eduardo; Ayala-Arreola, Juan 
       title: Stem and leaf anatomical and physiological characteristics of ‘Colín V-33’ avocado seedlings
        date: 2021
       words: 6705
      flesch: 59
     summary: The graphic representation of the groups in the first factorial plane showed that the Group 4 is the only one that is isolated from the rest and was very different from the other five groups, with most of its Table 2 ­ Groups formed according to the cluster analysis with 89 plants derived from ‘Colín V­33’ avocado seedlings, derived from anatomical and physiological characteristics of stem and leaf Group Seedings clustered Group 1 16, 103, 106, 113, 118, 121, 126, 129, 131, 133, 138, 139, 142, 143, 145, 146, 147, 148, 150, 152, 156 Group 2 1, 73, 110, 112, 137, 141, 144, 157, 159 Group 3 5, 13, 14, 21, 22, 23, 57, 72, 74, 80, 86, 96, 123 Group 4 8, 18, 65, 76, 81, 85, 88, 93, 105, 127, 155, 160, 162 Group 5 3, 7, 10, 17, 19, 28, 32, 33, 41, 52, 56, 77, 78, 79, 82, 111 Group 6 62, 87, 92, 99, 101, 104, 107, 114, 115, 117, 119, 120, 122, 124, 128, 130, 158 Fig. The results could indicate that the plants belong­ Table 5 ­ Mahalanobis distance and its significance, from anatomical characteristics of stem and leaf, as well of physiological character­ istics of leaf from 89 ‘Colín V­33’ avocado seedlings Group 1 2 3 4 5 6 1 ­ 2 18.20 ­ 3 24.83 *** 36.28 *** ­ 4 37.84 *** 39.65 *** 55.11 *** ­ 5 22.39 *** 34.87 *** 16.52 *** 29.83 *** ­ 6 12.92 *** 22.02 *** 16.19 *** 36.78
    keywords: avocado; characteristics; colín; conductance; density; et al; fig; group; hort; leaf; plants; stem; variables; vessel; v­33; xylem
       cache: ahs-7493.pdf
  plain text: ahs-7493.txt

        item: #508 of 594
          id: ahs-7651
      author: José Smiderle, Oscar; das Graças Souza, Aline; Diane Menegatti, Renata ; de Jesus Silva, Thayane 
       title: Different substrates for seedling production of Euterpe Oleracea Mart.
        date: 2020
       words: 6011
      flesch: 56
     summary: According to Smiderle et al. (2015), caution is needed when using combinations of burnt rice husks and sand in the composition of plant substrates, since both materials allow high water drainage and may result in water deficiency in the plants, which would compromise the processes of photosynthesis and respiration and consequently the maintenance of cellular elongation, resulting in smaller plant growth (Souza et al., 2020). For Figueiredo et al. (2019), N is an essential element for components of the photosynthetic system, such as the chlorophylls, proteins and enzymes that allow satisfactory rates of carbon assimilation to be main­ tained (Taiz et al., 2017; Figueiredo et al., 2019), and thereby guarantee the production of photoassimi­ lates that drive plant growth.
    keywords: et al; euterpe; growth; manure; mart; oleracea; plant; rice husks; sand; seedlings; soil; substrate; t1 +
       cache: ahs-7651.pdf
  plain text: ahs-7651.txt

        item: #509 of 594
          id: ahs-7653
      author: Ibrahim, Ayman ; Grassi, Maurizio; Lovati, Fabio; Parisi, Bruno; Spinelli, Lorenzo; Torricelli, Alessandro; Rizzolo, Anna; Vanoli, Maristella
       title: Non-destructive detection of potato tubers internal defects: critical insight on the use of time-resolved spectroscopy
        date: 2020
       words: 5372
      flesch: 58
     summary: 1. Introduction Detecting internal defects (internal brown spot, hollow heart, heat (*) Corresponding author: maristella.vanoli@crea.gov.it Citation: IBRAHIM A., GRASSI M., LOVATI F., PARISI B., SPI­ NELLI L., TORRICELLI A., RIZZOLO A., VANOLI M., 2020 ­ Non‐destructive detection of potato tubers internal defects: critical insight on the use of time‐resolved spectroscopy. Many noninvasive techniques (spectroscopic tech­ niques, computer vision systems, ultrasound meth­ ods) have been investigated to assess internal defects in potato tubers with various performance results depending on the type of defect, as reviewed by Rady and Guyer (2015).
    keywords: color; defects; detection; et al; flesh; ibs; potato; potatoes; trs; tubers; vanoli
       cache: ahs-7653.pdf
  plain text: ahs-7653.txt

        item: #510 of 594
          id: ahs-7666
      author: Vanoli, Maristella; Spinelli, Lorenzo; Torricelli, Alessandro; Ibrahim, Ayman; Parisi, Bruno; Lo Scalzo, Roberto; Rizzolo, Anna
       title: Anthocyanin and carotenoid contents assessed by time-resolved reflectance spectroscopy in potato tubers (Solanum tuberosum L.) with different flesh colors 
        date: 2020
       words: 6680
      flesch: 58
     summary: Ezekiel et al., 2013; Kaspar et al., 2013; Kita et al., 2013; Lachman et al., 2013; Tierno et al., 2015, 2016; Akyol et al., 2016). The highest ANT content was usually found in dark purple genotypes (Ezekiel et al., 2013; Hejtmankova et al., 2013; Lachman et al., 2012, 2013; Nayak et al., 2011; Tierno et al., 2015, 2016).
    keywords: ant; carotenoids; color; content; et al; flesh; food; genotypes; potatoes; purple; red; trs; tubers; yellow
       cache: ahs-7666.pdf
  plain text: ahs-7666.txt

        item: #511 of 594
          id: ahs-7669
      author: Palma, Amedeo; Cicilloni, A.M.; Satta, D.; De Pau, L.; D'Aquino, Salvatore
       title: Effects of kaolin-based particle film on physiological, nutritional, nutraceuticals parameters and Ceratitis capitata infestations in peach fruit at harvest and after storage
        date: 2020
       words: 5742
      flesch: 59
     summary: One of these mineral products is the kaolin clay, a fine powder, mainly composed of kaolinite, which, sprayed onto trees as a water suspension, forms a white and thin particle film on leaves and fruit surface (Glenn et al., 1999; Mazor and Erez, 2004). This local protocol followed by grow­ ers relies on frequent treatments in order to main­ tain residue levels of insecticides sufficient to kill medfly adults on fruit surface.
    keywords: control; et al; film; fruit; harvest; insecticides; kaolin; medfly; particle; quality; sci; storage; surface; treatments
       cache: ahs-7669.pdf
  plain text: ahs-7669.txt

        item: #512 of 594
          id: ahs-7725
      author: Ghasemi Soloklui, Ali Akbar ; Gharaghani, Ali; Sarkhosh, Ali 
       title: Variations in tree and fruit characteristics revealed potential dwarfing genotypes within Iran’s pomegranate germplasm
        date: 2020
       words: 5041
      flesch: 61
     summary: INGELS C., GEISEL P.M., UNRUH C.L., 2002 ­ Fruit trees: Training and pruning deciduous trees ­ University of California, ANR Publications, 8057, pp. The primary iden­ tification of dwarf genotypes should be based on field evaluations of fruit tree cultivars and genotypes.
    keywords: characteristics; cultivars; density; dwarfing; fruit; ghermez; height; length; malas; pomegranate; poost; torosh; tree
       cache: ahs-7725.pdf
  plain text: ahs-7725.txt

        item: #513 of 594
          id: ahs-7760
      author: Buccheri, Marina; Caramanico, Rosita; Ughini, Virginia; Grassi, Maurizio; Vanoli, Maristella
       title: Watercore in ‘Pomella Genovese’ apples: quality characteristics and antioxidants
        date: 2020
       words: 6049
      flesch: 58
     summary: Some authors (Zupan et al., 2016) found a lower phenols content in watercore fruit of the cultivars ‘Delicious’, ‘Gloster’ and ‘Fuji’, which were analysed immediately after harvest. Abstract: The study aimed to evaluate apple fruit affected by watercore by a physical and biochemical point of view and, at the same time, to gain an insight into the mechanisms of the watercore­related oxidative stress and browning.
    keywords: acid; activity; antioxidant; apples; content; fruit; genovese; increase; orchard; pomella; sci; total; watercore
       cache: ahs-7760.pdf
  plain text: ahs-7760.txt

        item: #514 of 594
          id: ahs-7767
      author: Al-Ashoush, Anfal ; Shibli, Rida; Tahtamouni, Reham ; Al-Qudah, Tamara; Abu-Irarmaileh, Bashaer 
       title: Enhancement of Pentacyclic Triterpenoids (Betulinic and Oleanolic acids) Production from Callus Cultures of Lantana camara L.
        date: 2020
       words: 5951
      flesch: 64
     summary: So, this study was carried out to enhance the possibility of production of betulinic and oleanolic acids in Lantana callus cul­ tures by modifying the culture medium using differ­ ent types and levels of growth regulators, sugars, NaCl, and heavy metals in callus culture media. Key words: elicitation, growth regulators, heavy metals, in vitro, Lantana, Lantana camara L., sugars.
    keywords: acid; betulinic; callus; camara; effect; growth; lantana; medium; oleanolic; production; table; weight
       cache: ahs-7767.pdf
  plain text: ahs-7767.txt

        item: #515 of 594
          id: ahs-7770
      author: Tadayon, Mohammad saeed; Hosseini, Seyed Mashaallah
       title: Effect of spread and shallow irrigation wetted area and application of organic mulch on citrus decline amelioration 
        date: 2020
       words: 6432
      flesch: 59
     summary: Experimental factors contained the different per­ centage of irrigation wetted area and decreasing irrigation effective root depth by drip irrigation system at three levels ­ W0 (control): 30­40% with 60 cm effective root depth; W1: 50­60% with 45 cm effective root depth; W2: 70­80% with 30 cm effective root depth under tree canopy area and the factor of annu­ al application of compost as organic mulch at two levels ­ M0 (control): means no application of compost and M1: application of 80 kg compost under tree canopy area with 10 cm thickness as ground cover, after rotating the top soil at 10 cm depth for all treatments. CASTLE W.S., 1978 ­ Citrus root systems: their structure, function, growth, and relationship to tree performance.
    keywords: application; area; citrus; compost; content; decline; density; depth; fruit; irrigation; leaf; root; soil; trees; water
       cache: ahs-7770.pdf
  plain text: ahs-7770.txt

        item: #516 of 594
          id: ahs-7775
      author: Menegatti, Renata; Aline das Graças Souza; Valmor João Bianchi
       title: Different environments and doses of controlled-release fertilizer in peach rootstocks production
        date: 2020
       words: 5984
      flesch: 57
     summary: All variables exhibited interaction (p <0.05) between the environ­ ment factors and the CRF (Osmocote®) doses (Table 3), indicating that the study of factor interaction is important to define the best condition to stimulate plant growth and development. The interaction between environmental conditions with the application of fertilizers may con­ tribute to optimize the space for plant production in nursery and to reduce the plant production systems impact on the environment.
    keywords: crf; days; diameter; environment; et al; greenhouse; growth; height; matter; peach; plants; production; rootstocks; stem; use
       cache: ahs-7775.pdf
  plain text: ahs-7775.txt

        item: #517 of 594
          id: ahs-7814
      author: Vieira Nascimento, M.; Ribeiro Ávila, Mylla Crysthyan ; Fiori de Abreu-Tarazi, Monita ; Oliveira Nogueira, Ana Paula ; Cardoso Campos, Luiz Fernandes ; dos Reis Nascimento, Abadia 
       title: Identification of promising tomato breeding lines with determinate growth by selection index
        date: 2020
       words: 6969
      flesch: 59
     summary: The constitution of tomato fruits for the industry has been remodeled through genetic improvement, to select cultivars with desirable characteristics for processing. ROSADO L.S.D., SANTOS C.E.M.D, BRUCKNER C.H., NUNES E.S., CRUZ C.D., 2012 ­ Simultaneous selection in proge‐ nies of yellow passion fruit using selection indices.
    keywords: fruit; index; lines; mock; mulamba; number; plant; pxt­601; selection; table; tomato; traits; values; yield
       cache: ahs-7814.pdf
  plain text: ahs-7814.txt

        item: #518 of 594
          id: ahs-7820
      author: Fatahi, Saeid; Khodabakhshzadeh, Alireza ; Rostami Tobnag, Ghader
       title: Effects of putrescine application in culture medium in improving chamomile (Chamomilla recutita (L.) Rauschert.) tolerance to osmotic stress under in vitro conditions: Putrescine improves tolerance to osmotic stress 
        date: 2020
       words: 5472
      flesch: 59
     summary: In this study, the effect of osmot­ ic stress created by mannitol under in vitro condi­ tions, the main effect of putrescine on the growth of chamomile, and putrescine effects in ameliorating effects of osmotic stress on chamomile were investi­ gated. Plant stress physiology.
    keywords: chamomile; effects; et al; mannitol; medium; oil; plants; putrescine; stress; traits
       cache: ahs-7820.pdf
  plain text: ahs-7820.txt

        item: #519 of 594
          id: ahs-7822
      author: Amodio, Maria Luisa; Colelli, Giancarlo
       title: Physio-chemical quality attributes of ‘Italia’ grapes from organic and conventional farming at harvest and during storage
        date: 2020
       words: 4388
      flesch: 50
     summary: Conventional grapes maintained a higher visual quality during storage, resulting after 14 days below the limit of mar­ ketability (score 3) but above the edibility limit (score 2); whereas in one location organic grapes were judged not edible. Conventional grapes maintained a higher visual quality during storage, resulting below the limit of marketability (score 3) but above the edi­ bility limit (score 2) at 14 days, whereas in LOC1 (Taranto) at that time organic grapes were judged not edible (data not shown).
    keywords: activity; content; food; grapes; harvest; location; quality; storage
       cache: ahs-7822.pdf
  plain text: ahs-7822.txt

        item: #520 of 594
          id: ahs-7835
      author: Ndereyimana, Assinapol; Nyalala, Samuel; Murerwa, Patrick; Gaidashova, Svetlana
       title: Growth, yield and fruit quality of tomato under different integrated management options against Tuta absoluta Meyrick 
        date: 2020
       words: 6966
      flesch: 60
     summary: To determine the effect of the treatments on tomato fruits yield and quality, analysis of variance was carried out; and the means for significantly different treatments (at P≤0.05) were separated using Tukey’s honestly sig­ nificant difference test. Since pre­har­ vest activities are responsible for the development of quality parameters in tomato fruits, any technolo­ gy used to improve its production should also be assessed for its effect on fruit quality.
    keywords: absoluta; azadirachtin; et al; fruit; plant; quality; steinernema; tomato; treatments; tuta; yield
       cache: ahs-7835.pdf
  plain text: ahs-7835.txt

        item: #521 of 594
          id: ahs-7848
      author: Machado, Maria de Fátima Pires da Silva; Neves de Azevedo Fernandes, Vanessa; Aparecida Mangolin, Claudete; Florindo Neves, Andréa; Sousa Nogueira, Fabio Cesar; Zeni Neto, Hugo
       title: Extraction of total protein from shoots of Cereus morphological variants (Cactaceae) for proteomic analysis: Extraction of protein for proteomic analysis
        date: 2020
       words: 4544
      flesch: 50
     summary: Lane 1 ­ ­ ­ ­ ­ ­ 45 ­ 24 Lane 2 ­ ­ ­ 77 ­ ­ 45 ­ 24 Lane 3 ­ 145 90 77 ­ ­ 45 39 ­ Lane 4 180 145 90 77 ­ ­ 45 39 ­ Lane 5 ­ ­ ­ ­ ­ ­ 45 ­ ­ Lane 6 ­ 145 90 77 61 ­ 45 39 24 Lane7 ­ ­ ­ ­ ­ ­ 45 ­ ­ Lane 8 ­ ­ ­ ­ ­ 58 45 ­ ­ Fernandes et al. ‐ Extraction of protein for proteomic analysis 239 levels of interfering substances require at least two phenol­complexing and two antioxidant agents, while at least four phenol­complexing and three antioxi­ dant agents are needed for tissues with high levels of interfering substances. PAVOKOVIĆ D., KRIŽNIK B., KRSNIK­RASOL M., 2012 ­ Evaluation of protein extraction methods for proteomic analysis of non‐model recalcitrant plant tissues.
    keywords: acetone; analysis; cereus; erect; extraction; method; monstruosus; phenol; plants; protein; shoots; tca; tissues; tortuosus
       cache: ahs-7848.pdf
  plain text: ahs-7848.txt

        item: #522 of 594
          id: ahs-7855
      author: Modesti, Margherita; Shmulevitz, Ron ; Brizzolara, Stefano; Tonutti, Pietro
       title: Short-term low temperature treatments of harvested wine grapes (cv. Vermentino) affect the volatile organic compound profile of the berries
        date: 2020
       words: 4981
      flesch: 61
     summary: In addition, these prelimi­ nary results obtained on wine grape berries need to be implemented and compared with the technologi­ cal and organoleptic evaluations of the resulting wines. RIZZINI F.M., BONGHI C., TONUTTI P., 2009 ­ Postharvest water loss induces marked changes in transcript profil‐ ing in skins of wine grape berries.
    keywords: aroma; berries; grapes; samples; sci; temperature; tonutti; treatments; wine
       cache: ahs-7855.pdf
  plain text: ahs-7855.txt

        item: #523 of 594
          id: ahs-7872
      author: Nasiri, Amin; Ahmadi, N.; Movahed, G.
       title: Effects of 1-MCP and ethylene on preservation of quality and vase life of Alstroemeria (cvs. Hercules and Mayfair) cut flowers
        date: 2020
       words: 4733
      flesch: 58
     summary: Measurement of ethylene After finishing ethylene treatment three flowers from each treatment were placed in a 1.8 L sealed glass bottle and kept at 20 ± 2°C for 48 h, same as experimental condition. Endogenous ethylene production Ethylene production was measured 48 hours after ethylene treatments.
    keywords: 1­mcp; activity; alstroemeria; chlorophyll; cut; ethylene; fig; flowers; hercules; life; l­1; mayfair; treatment
       cache: ahs-7872.pdf
  plain text: ahs-7872.txt

        item: #524 of 594
          id: ahs-7904
      author: Abbasifar, Ahmadreza; Valizadehkaji, Babak; Karimi, Mahdieh; Bagheri, Hosein
       title: The first report: The effect of garlic extract on rooting ‎of cuttings of some ornamental plants and fruit trees‎
        date: 2020
       words: 9783
      flesch: 64
     summary: In the first section, the use of high garlic extract concentration (50 g/l) in rose cuttings and moderate concentration (25 g/l) in wild privet, poplar, berry, grape, apple, and cherry cuttings had positive impacts. According to the results of ANOVA, the interaction of plant type and garlic extract concentrations led to significant differ­ ences in all shoot­related traits at 1% level.
    keywords: cherry; concentration; cuttings; extract; garlic; length; number; root; shoot; shoot length
       cache: ahs-7904.pdf
  plain text: ahs-7904.txt

        item: #525 of 594
          id: ahs-7908
      author: Beghè, Deborah; Fabbri, Andrea; Petruccelli, Raffaella; Marieschi, M.; Torelli, A.; Ganino, Tommaso
       title: Morphological and molecular characterization of ancient pomegranate (Punica granatum L.) accessions in Northern Italy
        date: 2020
       words: 7761
      flesch: 61
     summary: Correlation analyses between descriptors to reveal possible relationships were car­ Table 1 ­ Punica granatum L. accessions studied, coded (ID) and main qualitative characteristics of their fruit, leaf and flower ID Fruit shape Size Epicarp colour Calyx type Leaf shape Petiol colour Mucro Blade colour Flower petal colour Shape short­ stiled Shape long­ stiled ME1 oblate/rounded­ spheroid large/very large reddish­yel­ low/red semi­closed/ closed elliptic yellow no yellow red/orange medium bell sinuolate jug ME2 oblate/rounded­ spheroid large/very large reddish­yel­ low/red semi­closed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME3 oblate/rounded­ spheroid large reddish­yel­ low/red semi­closed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME4 oblate/rounded­ spheroid large/very large reddish­yel­ low/red semi­closed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME5 oblate/rounded­ spheroid large/very large reddish­yel­ low/red semi­closed/ closed elliptic red no yellow red/orange medium bell sinuolate jug ME6 oblate/rounded­ spheroid large reddish­yellow semi­ closed/ open elliptic red Sci., 2019 33(4): 581­592 582 a large genetic pool, represented by over 500 described cultivars throughout the world, and by a wide amount of wild plants, and its germplasm is so far only partially explored (Beghè et al., 2016).
    keywords: accessions; analysis; characterization; et al; fruit; germplasm; granatum; italy; markers; me8; pomegranate; punica; red; sci; seed; table; traits; weight
       cache: ahs-7908.pdf
  plain text: ahs-7908.txt

        item: #526 of 594
          id: ahs-8055
      author: Bartolini, Susanna; Orlando, M.; Trivellini, Alice; Venturi, F.; Sanmartin, C.; Taglieri, I.; Macaluso, M.; Zinnai, A.; Mensuali-Sodi, Anna
       title: The residues of fruit and vegetable processing: from "waste" to "resource" of natural phytochemical compounds
        date: 2020
       words: 5037
      flesch: 55
     summary: Dipping treatments were per­ formed comparing usually used preservative media (1% butylated hydroxytoluene ­ BHT ­ and 1% citric acid ­ CA) and novel extracts from potato (P) and apple (A) peels obtained by water (W) and 10% Bartolini et al. ‐ Potato and apple peel extracts on fresh‐cut fruits 37 ethanol (Et). Phenolic content (gallic acid mg/g dry weight) Antioxidant capacity (μmol TEAC/mL) Apple Peel Water extract 9.25 ± 0.26 0.33 ± 0.03 10% ethanol extract 13.14 ± 0.20 * 0.73± 0.02 * Potato Peel Water extract 2.92 ± 0.41 0.17 ± 0.02 10% ethanol extract 3.95 ± 0.02 * 0.21 ± 0.01 * Bartolini et al. ‐ Potato and apple peel extracts on fresh‐cut fruits 39 the exception of those are considered as a chilling sensitives (tomato, melon etc.) which must be stored at temperatures of 7­13°C.
    keywords: antioxidant; apple; compounds; et al; extracts; food; peel; potato; quality; waste; water
       cache: ahs-8055.pdf
  plain text: ahs-8055.txt

        item: #527 of 594
          id: ahs-8085
      author: Brizzolara, Stefano; Modesti, Margherita; Rong, Xiangyi ; Tonutti, Pietro
       title: Volatile compound and gene expression profiles associated with the storage of two peach fruit varieties differently sensitive to chilling injuries
        date: 2020
       words: 7416
      flesch: 60
     summary: Cold storage effects on LOX pathway‐related VOCs As general trend, during peach fruit ripening volatile compounds associated with green­notes, such as C6 aldehydes and alcohols, tend to decrease while the levels of molecules associated with fruity­notes, such as esters and, in particular, lactones follow an opposite trend (Defilippi et al., 2009; Zhang et al., 2011; Key words: cold storage, C­repeat­binding factors, lipoxygenase pathway, Prunus persica, volatile organic compounds.
    keywords: cbf; cold; control; et al; expression; fruit; genes; lox; peach; peaches; samples; storage; temperature; weeks
       cache: ahs-8085.pdf
  plain text: ahs-8085.txt

        item: #528 of 594
          id: ahs-8094
      author: Waweru, Bancy Waithira; Kilalo, Dora Chao; Kimenju, John Wangai; Rukundo, Placide ; Miano, Douglas Watuku
       title: Evaluation of hot pepper (Capsicum spp.) genotypes for resistance to viruses and aphids in Rwanda
        date: 2020
       words: 10928
      flesch: 61
     summary: However, information on hot pepper genotypes that are resistant to virus infection and vector infestation is not documented in Rwanda. Materials and Methods Reaction of hot pepper genotypes to virus infection and aphid infestation under field conditions Source of seeds A total of 18 hot pepper genotypes that included nine local collections obtained from Rwanda National Genbank, five introduced lines provided by World Vegetable Center, Eastern and Southern Africa­ Tanzania and four commercial varieties from seed companies were evaluated (Table 1).
    keywords: 00767ppr; abc; aphids; cmv; conditions; diseases; et al; field; genotypes; incidence; local; pepper; pepper genotypes; plant; resistance; rwanda; season; severity; table; virus; viruses
       cache: ahs-8094.pdf
  plain text: ahs-8094.txt

        item: #529 of 594
          id: ahs-8098
      author: Vendruscolo, Eduardo Prati ; Rodrigues, Aliny Heloísa Alcântara; Correia, Sávio Rosa; Oliveira, Paulo Ricardo; Campos, Luiz Fernandes Cardoso; Seleguini, Alexsander
       title: Economic analysis of crisp lettuce production in different planting spacing and soil cover
        date: 2020
       words: 4629
      flesch: 60
     summary: The presence of a superficial straw layer is benefi­ cial from the point of view of soil quality mainte­ nance (Cardoso et al., 2012), favoring the develop­ ment of plants of economic interest (Torres et al., 2015; Vendruscolo et al., 2017 a). Materials that are easily accessible to the rural producer, such as straw from grazing, can be used as mulch, replacing other materials such as plastic, for example, which has an effective participation in the costs of producing vegetables (Vendruscolo et al., 2017 b), also representing a source for environmen­ tal contamination (Chang et al., 2013).
    keywords: 0.25x0.25; cost; cover; et al; lettuce; planting; plastic; production; soil; spacing; straw; toc; usd
       cache: ahs-8098.pdf
  plain text: ahs-8098.txt

        item: #530 of 594
          id: ahs-8101
      author: Haider, Zeeshan; Ahamad, Niaz; Danish, Subhan; Iqbal, Javed; Arif Ali, Muhammad; Khalid Chaudhry, Usman
       title: Effect of foliar application of boric acid on fruit quality and yield traits of mango
        date: 2020
       words: 5722
      flesch: 66
     summary: Scientists have also documented that foliar application of B at different rates enhance mango fruit setting panicle­1, fruit weight and volume (Zhong and Dong, 2000; Bibi et al., 2019). Application of T3 and T2 did not differ significantly for the average yield of mango fruit as compared to con­ trol.
    keywords: acid; application; boric; boron; control; effect; et al; foliar; fruit; mango; plant; quality; sci; soil; weight; yield
       cache: ahs-8101.pdf
  plain text: ahs-8101.txt

        item: #531 of 594
          id: ahs-8103
      author: Herênio Gonçalves Júnior, Deurimar; De Melo Rodrigues, Lohaynne; Alves de Santana Filho, José; Nascimento Lima, Wallysson; Ferreira Alves, Anatércia
       title: Genetic parameters, correlations and path analysis in cowpea genotypes for yield and agronomic traits grown in Cerrado/Amazon Rainforest ecotone
        date: 2020
       words: 7004
      flesch: 55
     summary: In some cases, indirect selection based on correlated response may be more effective and faster than direct selection of the desired trait (Cruz et al., 2014). While for the characteristics SPP and Yield presented RSD equal to 12.24% and 21.86%, there­ fore, they are considered regular values, indicating good experimental precision (Cruz et al., 2014; Ferreira, 2018) (Table 2).
    keywords: analysis; coefficient; correlation; cowpea; et al; genotypes; genotypic; grain; indirect; mass; plant; pod; selection; table; traits; variance; yield
       cache: ahs-8103.pdf
  plain text: ahs-8103.txt

        item: #532 of 594
          id: ahs-8107
      author: Jorkesh, Abbas; Hamidoghli, Yousef; Olfati, Jamalali; Samizadeh, Habibollah; Bakhshi, Davood
       title: Genetic variability and relationship among different accessions of Froriepia subpinata Bail (Gijavash) an endangered medicinal plant from Iran revealed by ISSR and IRAP markers
        date: 2021
       words: 5016
      flesch: 56
     summary: Breeding, 3: 381­390. LAIKRE L., 2010 ­ Genetic diversity is overlooked in interna‐ tional conservation policy implementation. WU C.­J., CHENG Z.­Q., HUANG X.­Q., YIN S.­H., CAO K.­M., SUN C.­R., 2004 ­ Genetic diversity among and within populations of Oryza granulata from Yunnan of China revealed by RAPD and ISSR markers: implications for conservation of the endangered species.
    keywords: accessions; conservation; diversity; dna; endemic; et al; information; iran; irap; issr; markers; mean; plant; populations; species; table; variation
       cache: ahs-8107.pdf
  plain text: ahs-8107.txt

        item: #533 of 594
          id: ahs-8109
      author: Sabina, S.; Jithesh, Mundaya Narayanan
       title: Mechanical rubbing of tomato internode influence stem growth, improve tensile strength but negatively impact flavonoid levels
        date: 2020
       words: 5219
      flesch: 56
     summary: The mean total height and internodal length (3rd and 4th internode) of 20 plants were recorded and compared with control plants. 3. Results Effect of internode stress on plant height and intern‐ odal length of tomato Application of mild mechanical stimuli in the internodes of treated plants resulted in reduction in plant height whereas control plants showed normal growth characteristics (Fig. 1).
    keywords: content; control; fig; flavonoid; growth; height; internode; lignin; plants; stem; strength; stress; tensile; tomato; total
       cache: ahs-8109.pdf
  plain text: ahs-8109.txt

        item: #534 of 594
          id: ahs-8110
      author: Olagunju, Solomon Oladimeji; Sosanya, O.S.; Oguntade, O.A.; Adewusi, F.M.; Odusanya, O.A.; Nassir, A.L.; Joda, A.O.; Adegoke, A.T.; Banjo, O.B.
       title: Prostrate or upright growth habit in tomato cultivars: contributory roles of stem diameters and fruit weight under fertilizer application
        date: 2020
       words: 6856
      flesch: 61
     summary: Identifying tomato cultivars with most upright growth characteristics can prevent scorching and rot­ tenness often associated with tomato fruit at maturi­ ty and could contribute to increased fruit quality and fruit yield and reduce cost of staking in tomato pro­ duction. Sci., 2019 33(4): 465­474 DOI: 10.13128/ahsc­8110 Prostrate or upright growth habit in tomato cultivars: contributory roles of stem diameters and fruit weight under fertilizer application S.O. Olagunju 1 (*), O.S. Sosanya 1, O.A. Oguntade 1, K.M. Adewusi 1, O.A. Odusanya 1, A.L. Nassir 1, A.O. Joda 1, A.T. Adegoke 1, O.B. Banjo 2 1 Department of Crop Production, College of Agricultural Sciences, Olabisi Onabanjo University, P.M.B. 0012, Ayetoro Campus, Ayetoro, Ogun State, Nigeria.
    keywords: cultivars; diameter; fertilizer; fruit; growth; growth habit; habit; plant; rates; soil; stem; tomato; tomato cultivars; variation; yield
       cache: ahs-8110.pdf
  plain text: ahs-8110.txt

        item: #535 of 594
          id: ahs-8112
      author: Zakizadeh, Sara; Kaviani, Behzad; Hashemabadi, Davood
       title: Micropropagation of two near threatened orchid. Part 1: Catasetum pileatum cv. Alba
        date: 2020
       words: 6070
      flesch: 67
     summary: Different PGRs such as ɑ­naphthaleneacetic acid (NAA), IBA, 1­phenyl­3­(1,2,3­thiadiazol­5­yl)­urea (TDZ), 6­benzyle amino purine (BAP), 6­benzylade­ nine (BA) and Kn have been used for tissue culture of threatened and endangered orchids (Roy et al., 2011; Panwar et al., 2012; Zeng et al., 2012; Baker et al., 2014; Bhattacharyya et al., 2016; Kaviani et al., 2017). This means that the PGRs acted synergistically (Roy et al., 2011).
    keywords: et al; explants; iba; l­1; medium; mg l­1; number; orchid; pgrs; plantlets; plbs; root
       cache: ahs-8112.pdf
  plain text: ahs-8112.txt

        item: #536 of 594
          id: ahs-8115
      author: Mohammadi, Mohsen; Kaviani, Behzad; Sedaghathoor, Shahram
       title: Micropropagation of two near threatened orchid. Part 2: Phalaenopsis amabilis Blume var. Grandiflora
        date: 2020
       words: 6504
      flesch: 71
     summary: 5.10±1.539 cd 73.30±10.000 a­c 0.00 2.00 2.20±0.493 fg 2.86±0.503 b­e 1.56±0.153 d­g 4.86±1.358 a­c 4.73±0.400 bcdef 4.53±0.737 cd 90.00±15.275 a 0.00 3.00 2.83±0.208 d­g 2.40±0.208 c­h 2.00±0.100 c­e 3.76±0.416 c 3.30±0.231 hi 7.96±2.166 ab 80.00±10.000 ab 0.10 0.00 2.06±0.200 g 1.83±0.321 f­h 1.66±0.100 c­g 4.80±0.889 a­c 4.20±0.794 b­i (D) Callus formation from the explants cultured in media enriched with different concentrations of IBA and Kn (from left to right: 0.50 mg l­1 IBA + 3.00 mg l­1 Kn, con­ trol, 1.00 mg l­1 IBA + 1.00 mg l­1 Kn and 0.20 mg l­1 IBA and 0.50 mg l­1 Kn).
    keywords: a­c; et al; iba; leaf; l­1 ac; l­1 iba; l­1 kn; medium; mg l­1; number; phalaenopsis; plant; plbs; root
       cache: ahs-8115.pdf
  plain text: ahs-8115.txt

        item: #537 of 594
          id: ahs-8118
      author: Otieno, Peter Caleb; Nyalala, S.; Wolukau, J.
       title: Optimization of biosolids as a substrate for tomato transplant production: Biosolids as an alternative substrate in tomato
        date: 2020
       words: 6996
      flesch: 65
     summary: Separation of tomato transplant roots and shoot was done at the crown level. In concurrence with the pre­ Fig. 7 ­ Effect of biosolids on tomato seedling root and shoot dry weight at week 5 after planting.
    keywords: biosolids; compost; et al; growth; leaf; p<0.05; peat; plant; production; rates; root; sci; seedlings; soil; substrate; tomato; transplant; use
       cache: ahs-8118.pdf
  plain text: ahs-8118.txt

        item: #538 of 594
          id: ahs-8125
      author: Steidle Neto, Antonio José; Lopes, Daniela de Carvalho; Silva, Washington Azevêdo da
       title: Feasibility of Vis/NIR spectroscopy to detect and estimate fungicide residues on intact lettuces
        date: 2020
       words: 6687
      flesch: 52
     summary: YIP G., ONLEY J.H., HOWARD S.F., 1971 ­ Residues of maneb and ethylenethiourea of field‐sprayed lettuce and kale. CALDAS E.D., MIRANDA M.C.C., CONCEIÇÃO M.H., SOUZA L.C.K.R., 2004 ­ Dithiocarbamates residues in Brazilian food and the potential risk for consumers.
    keywords: analysis; concentrations; cs2; data; dithiocarbamate; et al; food; fungicide; kg­1; leaves; lettuce; model; neto; nir; reflectance; residues; spectroscopy; steidle
       cache: ahs-8125.pdf
  plain text: ahs-8125.txt

        item: #539 of 594
          id: ahs-8127
      author: Aghaye Noroozlo, Yaghoub; Souri, Mohammad Kazem; Delshad, Mojtaba
       title: Effects of foliar application of glycine and glutamine amino acids on growth and quality of sweet basil
        date: 2020
       words: 4840
      flesch: 61
     summary: Amino acids can have stimulation effect on plants growth, and in this respect, it has been shown that application of amino acids can enhance chloro­ phyll content and leaf greenness of plants (Kielland, 1994; Foliar application of amino acids can have benefi­ cial effects on plant growth and production (Sadak et al., 2015; Shams et al., 2016; Hussain et al., 2018; Souri and Aslani, 2018).
    keywords: acids; amino; application; basil; et al; foliar; glutamine; glycine; growth; leaf; mg·l­1; plants; souri
       cache: ahs-8127.pdf
  plain text: ahs-8127.txt

        item: #540 of 594
          id: ahs-8128
      author: Seydi, Shima; Sedaghathoor, Shahram; Kaviani, Behzad
       title: Plant regeneration by organogenesis from bulbous explants in Fritillaria imperialis L., a wild rare ornamental species at the risk of extinction
        date: 2020
       words: 5507
      flesch: 63
     summary: Abstract: Fritillaria imperialis L. (Liliaceae) is a rare and endangered ornamental plant grown in mountain regions and Zagros altitudes, Ilam province, Iran. Fritillaria imperialis L. (crown imperial or tears of Mary) is a perennial plant with high medicinal and ornamental importance (Wang et al., 2005).
    keywords: bulbs; fritillaria; imperialis; kin; leaf; l­1; medium; mg l­1; naa; number; plant; scales
       cache: ahs-8128.pdf
  plain text: ahs-8128.txt

        item: #541 of 594
          id: ahs-8129
      author: Hakim, Abdul; Khatoon, M.; Gullo, S.
       title: Effect of compost tea and partial root zone drying on tomato productivity and quality
        date: 2020
       words: 5429
      flesch: 64
     summary: The less visi­ ble chilling injury, decay and faster color changes in PRD treated plants fruit might be due to less water content compared to CDI treated plants fruits. The PRD treated plant’s fruits exhibited better appearance, higher lycopene content, fruit firmness, total soluble solid (TSS), and TSS/titratable acidity (TA) ratio than fruits plants treated with CDI (conventional drip irrigation).
    keywords: cdi; compost; content; effect; fruits; irrigation; plant; prd; quality; tea; tomato; water; weight
       cache: ahs-8129.pdf
  plain text: ahs-8129.txt

        item: #542 of 594
          id: ahs-8131
      author: Benbya, Abdellah; Mdarhri Alaoui, Meriem; Gaboun, Fatima; Delporte, Fabienne; Chlyah, Omar; Cherkaoui, Souad
       title: Vegetative propagation of Argania spinosa (L.) Skeels cuttings: Effects of auxins and genotype
        date: 2020
       words: 6459
      flesch: 60
     summary: The number of leaves for ASOC1 cuttings ­ that received 1000 mgL­1 NAA is 73% greater than the con­ trol group, while it is 52% higher for the 5000 mgL­1 IAA application. SINGH S., YADAV S., PATEL P.K., ANSARI S.A., 2011 ­ Adventitious rhizogenesis in Bambusa nutans and Bambusa tulda: Influence of seasonal variation, IBA and cutting type.
    keywords: auxin; concentration; cuttings; development; genotype; growth; iba; length; mgl­1; number; plant; propagation; rate; rooting; roots; spinosa; sprouting
       cache: ahs-8131.pdf
  plain text: ahs-8131.txt

        item: #543 of 594
          id: ahs-8178
      author: Mohajer, Z.S.N.; Asil, Moazam Hassanpour; Olfati, J.-A.; Kaledian, M.R.
       title: Effect of different nutrient solution and irrigation regimes on growth of Lily (LA Hybrid 'Fangio')
        date: 2020
       words: 4734
      flesch: 62
     summary: Sci., 2019 33(4): 529­535 DOI: 10.13128/ahsc­8178 Effect of different nutrient solution and irrigation regimes on growth of Lily (LA Hybrid ‘Fangio‘) Z.S.N. Mohajer 1, M.H. Asil 1 (*), J.­A. Olfati 1, M.R. Kaledian 2 1 Department of Horticultural, Faculty of Agricultural Sciences, Guilan University, Rasht, Iran. 2 Department of Water Engineering, Faculty of Agricultural Sciences, Guilan University, Rasht, Iran. In this regard, a greenhouse experiment was carried out to evaluate the effect of different nutrient solution viz.
    keywords: flower; growth; irrigation; leaf; number; nutrient; plant; sci; solution; table; water
       cache: ahs-8178.pdf
  plain text: ahs-8178.txt

        item: #544 of 594
          id: ahs-8186
      author: Abedi Gheshlaghi, Ebrahim
       title: Effective pollination period and its influence on fruit characteristics of 'Hayward' Kiwifruit
        date: 2020
       words: 4124
      flesch: 67
     summary: Hayward kiwifruit showed no significant decrement of fruit set and fruit weight within the 4­day and 2­day period, respectively, however, the mean weight of fruit was ≥ 85 g within 4­day. Fruit weight and size were the highest on days 1­2 after anthesis and reduced for flowers pollinated 3­4 days after anthesis.
    keywords: daa; epp; fruit; hayward; kiwifruit; pollination; seed; set; weight
       cache: ahs-8186.pdf
  plain text: ahs-8186.txt

        item: #545 of 594
          id: ahs-8187
      author: Anjomshoaa, Atefeh; Jafary, Hossein; Hassandokht, Mohammed Reza ; Taheri, Mehdi; Abdossi, Vahid
       title: Study on relationship between morphological and physiological traits with resistance to rust fungus (Puccinia allii) in Iranian garlic clones
        date: 2020
       words: 6459
      flesch: 54
     summary: Selection of resistant clones from the genetic complex of Iranian local clones is one of the pre­ breeding research priorities of the country in Iran. Due to the commercial, economic and phar­ maceutical­industrial importance of garlic, the interest in increasing pro­ (*) Corresponding author: mrhassan@ut.ac.ir Citation: ANJOMSHOAA A., JAFARY H., REZA HASSAN­ DOKHT M., TAHERI M., ABDOSSI V., 2019 ­ Study on relationship between morphological and phy‐ siological traits with resistance to rust fungus (Puccinia allii) in Iranian garlic clones.
    keywords: abc; bulb; clones; garlic; infection; iranian; leaf; number; percentage; resistance; rust; traits; weight
       cache: ahs-8187.pdf
  plain text: ahs-8187.txt

        item: #546 of 594
          id: ahs-8191
      author: Salimpour, Allahdad; Shamili, Mansoore; Dadkhodaie, Ali; Zare, Hamid; Hadadinejad, Mehdi
       title: Evaluating the salt tolerance of seven fig cultivars (Ficus carica L.)
        date: 2020
       words: 9524
      flesch: 65
     summary: The available studies on the response of fig commercial cultivars to different lev­ els of salinity indicated a significant variation in mor­ phological characteristics, growth parameters, physi­ ological behavior, photosynthetic efficiency, gas exchange ratio, product quality, and productivity (Essam et al., 2013; Metwali et al., 2014; Alswalmeh et al., 2015; Zarei et al., 2016, 2017; Soliman and Abd Alhady, 2017). Similar results are available in almond (Momenpour et al., 2018), pista­ chio (Adish et al., 2010) and fig cultivars (Essam et al., 2013;
    keywords: anjirʼ; area; content; cultivars; et al; fig; fig cultivars; growth; leaf; nitrogen; plant; salinity; salt; sci; siyahʼ; stem; stress; table; water
       cache: ahs-8191.pdf
  plain text: ahs-8191.txt

        item: #547 of 594
          id: ahs-8214
      author: Arkoub-Djermoune, Lynda; Benmeziane, F.; Madani, K; Boulekbache-Makhlouf, L.
       title: Optimization of phenolic compounds recovery and in vitro antioxidant activity of Algerian eggplant (Solanum melongena L.)
        date: 2020
       words: 9619
      flesch: 54
     summary: However, no optimal protocols have been established so far for phenolic extraction from these vegetable. Aqueous alcohols particularly acetone, ethanol and methanol are the most commonly employed in phenolic extraction from botanical materials (Chan et al., 2009).
    keywords: acetone; activity; antioxidant; compounds; eggplant; et al; extraction; extracts; food; frp; frsa; min; optimization; phenolic; ratio; solvent; temperature; time; total; tpc; water
       cache: ahs-8214.pdf
  plain text: ahs-8214.txt

        item: #548 of 594
          id: ahs-8228
      author: Bagheri, Sajad; Hassandokht, Mohammad Reza; Mirsoleimani, Abbas; Mousavi, Amir
       title: Effect of palm leaf biochar on melon plants (Cucumis melo L.) under drought stress conditions
        date: 2020
       words: 7571
      flesch: 67
     summary: In this experiment, the proline content decreased with increasing biochar treatments from 0.19 to 0.36 Kg/m2 and the increase of water require­ ment from 60 to 100%, with the lowest amount of proline being related to 0.24 and 0.36 Kg/m2and 100% water requirement. The water use efficiency was calculated as a cor­ relation between plant yield and plant water use dur­ ing the treatment period (Liu et al., 2015).
    keywords: bcd; biochar; drought; effect; leaf; melon; plant; requirement; root; soil; stress; treatment; use; water; water requirement; weight
       cache: ahs-8228.pdf
  plain text: ahs-8228.txt

        item: #549 of 594
          id: ahs-8230
      author: Russo, Alessio; Speak, Andrew; Dadea, Claudia; Fini, Alessio; Borruso, Luigimaria; Ferrini, Francesco; Zerbe, Stefan
       title: Influence of different ornamental shrubs on the removal of heavy metals in a stormwater bioretention system
        date: 2020
       words: 5289
      flesch: 60
     summary: The lower removal rate could be attributed to leaching of Pb and Cd from the bioretention media as the concentration of heavy metals in the bottom layer increases (Muthanna et al., 2007). Russo et al. ‐ Influence of ornamental shrubs on the removal of heavy metals 609 tention systems in laboratory (Davis et al., 2003; Kabir et al., 2014; Wang et al., 2017; Muerdter et al., 2018).
    keywords: bioretention; cotoneaster; et al; hypericum; lonicera; metals; plants; removal; species; stormwater; systems; urban; water
       cache: ahs-8230.pdf
  plain text: ahs-8230.txt

        item: #550 of 594
          id: ahs-8251
      author: Sinumporn , Punpaka ; Narumi-Kawasaki, T.; Fukai, S.
       title: Development of interspecific hybrids between Habenaria radiata and Habenaria rhodocheila complex
        date: 2020
       words: 4846
      flesch: 68
     summary: HRA × RCY had only 1 pod set from 11 flow­ ers (9.1%), and the opposite cross RCY × HRA had 1 from 3 flowers (33.3%) (Table 1). Both cross combinations of HRA × RCY and RCY × HRA had poor seed germination (Table 1).
    keywords: complex; fig; habenaria; hra; hybrids; radiata; rco; rcy; rhodocheila
       cache: ahs-8251.pdf
  plain text: ahs-8251.txt

        item: #551 of 594
          id: ahs-8252
      author: Khani, A.; Barzegar, Taher; Nikbakht, J.; Ghahremani, Z.
       title: Effect of foliar spray of calcium lactate on the growth, yield and biochemical attribute of lettuce (Lactuca sativa L.) under water deficit stress
        date: 2020
       words: 9311
      flesch: 58
     summary: ­ Plant. ­ Plant.
    keywords: activity; antioxidant; cal; calcium; content; deficit; drought; effect; et al; etc; growth; irrigation; lactate; leaf; leaves; lettuce; plant; sci; stress; values; water; water deficit; yield
       cache: ahs-8252.pdf
  plain text: ahs-8252.txt

        item: #552 of 594
          id: ahs-8253
      author: Abbasnia Zare, Seyedeh Khadijeh; Sedaghathoor, Shahram; Padasht Dahkaei, Mohammad-Naghi; Hashemabadi, Davood
       title: The effect of different colored netting on quantitative and qualitative traits of two foliage plant species (Codiaeum variegatum and Aglaonema commutatum)
        date: 2020
       words: 6678
      flesch: 62
     summary: According to ANOVA (Table 1), plant growth rate was significantly (p<0.01) affected by shade netting, plant species, and ‘shade netting × plant species’. No netting 25.25 c 3.92 c 13.50 b 23.52 c 1.65 c 2.11 c 0.14 c 14.92 c 6.04 b 72.19 c 6.66 b 0.04 b 1.37 b 0.85 b 0.77 b 9 a Yellow 39.33 a 16.50 a 27.17 a 82.05 a 5.75 a 7.89 a 0.55 a 21.17 a 8.50 a 138.4 a 9.68 a 0.04 b 2.62 b 2.90 a 2.60 a 2 b Red 33.92 b 11.50 b 19.63 ab 50.25 b 3.52 b 4.82 b 0.34 b 19.17 b 7.33 ab 106.5 b 10.33 a 0.10 a 4.77 a 3.09 a 2.94 a 5 ab Green 33.33 b 10.88 b 18.83 ab 45.74 b 3.20 b 3.84 bc 0.27 bc 18.00 b 6.46 b 88.92 bc 8.50 ab 0.03 b 1.20 b 2.77 ab 2.50 a 9 a Abbasnia Zare et al. ‐ Colored netting effects on foliage of Codiaeum variegatum and Aglaonema commutatum 29 icantly influenced by net type at the p<0.05 level and by plant species at the p<0.01 level, but the interac­ tion of ‘net type × plant species’ was insignificant for this trait (Table 2).
    keywords: commutatum; effect; leaf; nets; netting; plant; plant species; species; table; type
       cache: ahs-8253.pdf
  plain text: ahs-8253.txt

        item: #553 of 594
          id: ahs-8254
      author: Ilahy, Riadh; Tlili, I.; Rouhou, H.C.; Siddiqui, M.W.; Mishra, P.M.; Kuchi, V.S.; Homa, F.; Hdider, C.; Jebari, H.; Lenucci, Marcello Salvatore
       title: Determining the main agronomic traits of snake melon (Cucumis melo var. flexuosus L.) fruits as affected by genotypic differences
        date: 2020
       words: 3683
      flesch: 61
     summary: Snake melon fruits are known all around the world with different trivial names: “alficoz” in Spain, “tortarello” or “cetrangolo” in Italy, “fakous” or “fegous” in Arabic Maghreb countries, “agoor” in Soudan, “acur”, “hıtta” or “hıtı” in Turquie, “kakri” in India, “uri” in Japan and Armenian cucumber, “yard­ long melon”, “serpent­melon” or “Gutah” elsewhere (Solmaz et al., 2016). Snake melon fruits are general­ ly consumed raw at the immature stage of ripening with a preference for straight long and thick green fruits in the Mediterranean region.
    keywords: breeding; fruits; green; lines; melon; mornagui; plant; snake; traits; yield
       cache: ahs-8254.pdf
  plain text: ahs-8254.txt

        item: #554 of 594
          id: ahs-8255
      author: Mirshekari, Amin; Madani, Babak; Wall, Marisa; Biggs, Alan R.
       title: Aloe vera coatings maintain antioxidants of fig (Ficus carica L.) fruit during storage
        date: 2020
       words: 4931
      flesch: 60
     summary: SOGVAR O.B., SABA M.K., EMAMIFAR A., 2016 ­ Aloe vera and ascorbic acid coatings maintain postharvest quality and reduce microbial load of strawberry fruit. Fresh fruits of the well­known fig (Ficus carica L.) cul­ tivar ‘Siyah’ were grown in Fars Province, Iran, treated with different concen­ trations of Aloe vera gel prior to being placed into cold storage.
    keywords: acid; activity; aloe; aloe vera; antioxidant; et al; fig; food; fruit; gel; sci; storage; vera; vera gel
       cache: ahs-8255.pdf
  plain text: ahs-8255.txt

        item: #555 of 594
          id: ahs-8283
      author: Bonyanpour, Ali Reza; Jamali, Babak
       title: Seasonal enzymatic and non-enzymatic antioxidant responses in seven Iranian pomegranate cultivars
        date: 2020
       words: 7917
      flesch: 58
     summary: IBRAHIM H.I.M., 2016 ­ Tolerance of two pomegranates cultivars (Punica granatum L.) to salinity stress under hydroponic culture conditions. Table 1 ­ Average day and night temperature and relative humidity in the experiment region at the time of sam­ pling Date of sampling Average day/night temperature (°C) Relative humidity (%) June 2nd 27/14 45 August 10th 38/25 23 October 10th 27/15 27 Bonyanpour and Jamali ‐ Seasonal antioxidant responses in Iranian pomegranate cultivars 267 The following parameters were measured in stud­ ied cultivars for two consecutive years and an aver­ age was reported.
    keywords: acid; activity; antioxidant; chlorophyll; content; cultivars; fall; glutathione; g­1; leaf; mdg; mms; plant; pomegranate; ssf; stress; summer; zaa
       cache: ahs-8283.pdf
  plain text: ahs-8283.txt

        item: #556 of 594
          id: ahs-8292
      author: Cocetta, Giacomo; Riva, M.; Castelli, G.; Ferrante, Antonio
       title: New active packaging for improving the shelf life and quality of tomato
        date: 2020
       words: 4522
      flesch: 53
     summary: The experiment was conducted on tomato fruits (Solanum lycopersicum L. var. cerasiforme). It is well known that at low temperature the volatiles release from tomato fruits is limited due to the reduced metabolic activity and volatility of the molecules (Spadafora et al., 2019).
    keywords: berries; control; days; fig; film; fruits; gas; packaging; quality; storage; temperature; tomato
       cache: ahs-8292.pdf
  plain text: ahs-8292.txt

        item: #557 of 594
          id: ahs-8295
      author: Gorni, Pedro Henrique; Cornelissen, Bianca da Silva; Pereira, André Apolinário 
       title: Exogenous salicylic acid and ferulic acid improve growth, phenolic and carotenoid content in tomato
        date: 2021
       words: 4841
      flesch: 62
     summary: Exogenous application of SA and FA either alone or in combination (SA + FA) resulted in increases in bio­ mass accumulation and chlorophyll contents in tomato plant; and soluble sugar, total polyphenol, flavonoids, lycopene and β­carotene contents in fruits. However, exogenous SA (Kazemi, 2014) and FA (Singh and Deen, 2014) applications were effective in inducing the growth and formation of secondary metabolites in tomato plants.
    keywords: acid; application; chlorophyll; content; et al; gorni; growth; plants; salicylic; table; tomato; total
       cache: ahs-8295.pdf
  plain text: ahs-8295.txt

        item: #558 of 594
          id: ahs-8300
      author: Ameri, Atefe; Davarynejad, Golam Hossein; Tehranifar, Ali; Moshtaghi, N.
       title: Cefixime manages internal bacterial contamination during tissue culture operation
        date: 2020
       words: 3737
      flesch: 52
     summary: For this purpose, this investigation was conducted with several experiments to manage bacterial contamination. First, gram test for bacterial contamination related to Pyrus shoots proliferating was conducted.
    keywords: antibiotic; bacterial; cefixime; contamination; culture; growth; l­1; media; mg l­1; plant; tissue
       cache: ahs-8300.pdf
  plain text: ahs-8300.txt

        item: #559 of 594
          id: ahs-8306
      author: Paula, Vericia Fernanda Sales de ; Vilvert, João Claudio; Araújo, Nícolas Oliveira de ; Nascimento, Iarajane Bezerra do; Medeiros, Jose Francismar de; Aroucha, Edna Maria Mendes
       title: Influence of plant biostimulant and spacing on production and postharvest conservation of watermelons cv. Quetzali
        date: 2020
       words: 4636
      flesch: 61
     summary: Abstract: The aim of this study was to evaluate the influence of pre­harvest application of plant biostimulant Crop Set® and different plant spacings on the production attributes and postharvest quality of watermelon ‘Quetzali’. In this case, the increase on the SSC of watermelon fruits observed during storage can be attributed to the sol­ ubilization of pectins.
    keywords: application; biostimulant; crop; fruits; plant; set; spacing; ssc; storage; watermelon
       cache: ahs-8306.pdf
  plain text: ahs-8306.txt

        item: #560 of 594
          id: ahs-8343
      author: Haghighi, Maryam; Zamani, Omid ; Abbey, Lord 
       title: Growth response nitrogen metabolism of grafted cucumber fertilized with different ratios of nitrate: ammonium fertilizer
        date: 2021
       words: 5928
      flesch: 63
     summary: GORETA BAN S., ŽANIĆ K., DUMIČIĆ G., RASPUDIĆ E., VULETIN SELAK G., BAN D., 2014 ­ Growth and yield of grafted cucumber in soil infested with root‐knot nema‐ todes. WANG H., WU L., ZHU Y., TAO Q., 2008 ­ Growth, nitrate accumulation, and macro nutrient concentration of pakchoi as affected by external nitrate‐n: amino acid‐n ratio.
    keywords: cucumber; effect; grafting; growth; nitrate; no3; no3 ­/nh4; nutrient; plant; ratio; root; rootstock; shoot; ­/nh4
       cache: ahs-8343.pdf
  plain text: ahs-8343.txt

        item: #561 of 594
          id: ahs-8354
      author: Ichwan, Budiyati; Eliyanti, Eliyanti; Zulkarnain, Zulkarnain
       title: Influence of biostimulants and media compositions on growth and yield of Capsicum annuum L. under drought stress conditions
        date: 2021
       words: 6127
      flesch: 56
     summary: Discussion and Conclusions The application of biostimulants on chili pepper grown on different growing media compositions with limited soil water content was found to increased plant growth and yield. Statistical analysis Data were analysed statistically using Analysis of Variance (ANOVA) module (Petersen, 1985) to judge the significance of the effect of biostimulants and growing media compositions.
    keywords: biostimulants; charcoal; chili; citorin; compositions; content; drought; growth; husk; media; media compositions; plants; soil; stress; water
       cache: ahs-8354.pdf
  plain text: ahs-8354.txt

        item: #562 of 594
          id: ahs-8376
      author: Kadri, Aline; Saleh, Shoaib; Elbitar, Ahmad; Chehade, Ali
       title: Genetic diversity assessment of ancient mulberry (Morus spp.) in Lebanon using morphological, chemical and molecular markers (SSR and ISSR)
        date: 2021
       words: 7059
      flesch: 59
     summary: The clustering patterns indicated no loca­ tion nor local name specificity among mulberry accessions. Fruit color of mulberry accessions was diverse: ‘Abyad’ accessions were white and ‘Mwachah’ acces­ sions were violet.
    keywords: abyad; accessions; analysis; color; diversity; fruit; issr; leaf; lebanon; length; markers; morus; mulberry; mwachah; primers; shami; ssr
       cache: ahs-8376.pdf
  plain text: ahs-8376.txt

        item: #563 of 594
          id: ahs-8395
      author: Marchioni, Ilaria ; Colla, Lisaura; Pistelli, Laura; Ruffoni, Barbara; Tinivella, Federico; Minuto, Giovanni
       title: Different growing conditions can modulate metabolites content during post-harvest of Viola cornuta L. edible flowers
        date: 2020
       words: 6225
      flesch: 63
     summary: Abstract: Edible flowers are inflorescences traditionally used in various part of the world to enrich sweet and savoury recipes. In Indian and Chinese cultures, edible flowers are used as com­ ponents of medicines based on herbs, in addition to culinary purposes (Wongwattanasathien et al., 2010).
    keywords: edible; et al; flowers; light; storage; temperature; time; treatment; viola
       cache: ahs-8395.pdf
  plain text: ahs-8395.txt

        item: #564 of 594
          id: ahs-8401
      author: Mubarak, I.
       title: Improving water productivity and yield of onion crop by combining early planting and straw mulch under different irrigation levels in dry Mediterranea region
        date: 2020
       words: 7146
      flesch: 63
     summary: Irrigation water was added 3 times per week. KUMAR S., IMTIYAZ M., KUMAR A., SINGH R., 2007 ­ Response of onion (Allium cepa L.) to different levels of irrigation water.
    keywords: bulb; crop; date; irrigation; level; mulching; onion; planting; soil; straw; water; yield
       cache: ahs-8401.pdf
  plain text: ahs-8401.txt

        item: #565 of 594
          id: ahs-8402
      author: Kim, Ji Hee; Suh, Jeung Keun; Yoon, Seong-Tak; Roh, Mark S.
       title: Production of seed-propagated compact potted Corylopsis plant in one year
        date: 2020
       words: 5924
      flesch: 67
     summary: Suitable species should first be identified and then excessive stem elongation must be controlled using plant growth retardants (Currey and Lopez, 2016), and pinching combined with plant growth retardant treatment (Jeong, 2000). Data collected from 15 plants per treatment were ana­ lyzed by two­way ANOVA with plant growth retar­ dants and concentration as variables.
    keywords: calvescens; corylopsis; flowering; growth; number; plants; shoots; sinensis; var
       cache: ahs-8402.pdf
  plain text: ahs-8402.txt

        item: #566 of 594
          id: ahs-8403
      author: Shiraishi, Mikio; Asakuma, Hideaki
       title: Varietal differences in sweetness value and flesh juiciness among persimmon cultivars
        date: 2020
       words: 5554
      flesch: 62
     summary: Thus, understanding how varietal differ­ ences influence sugar composition will provide valu­ able information for genetic improvement of the palatability of persimmon fruit in future breeding programs. Cultural practices were con­ Shiraishi and Asakuma ‐ Sweetness value and flesh juiciness of persimmon fruit 73 formed to Plant materials for yearly variation of sugar composition.
    keywords: cultivars; flesh; fruit; juiciness; persimmon; ratio; sucrose; sugar; sweetness; value
       cache: ahs-8403.pdf
  plain text: ahs-8403.txt

        item: #567 of 594
          id: ahs-8404
      author: Abdi, Gholamreza; Karami, Lila
       title: Salicylic acid effects on some physiochemical properties and secondary metabolite accumulation in Mentha piperita L. under water deficit stress
        date: 2020
       words: 8452
      flesch: 55
     summary: Karami and Abdi ‐ Salicylic acid effects on peppermint 89 However, the findings of the present study showed that foliar spray of SA increased grown parameters in non­stress plants while there were no significant effects of SA on water stressed plant. 1. Introduction Peppermint (Mentha piperita L.) is considered as one of the most important medicinal and aromatic herb in the world cultivated in many (*) Corresponding author: abdi@pgu.ac.ir Citation: ABDI G., KARAMI L., 2020 ­ Salicylic acid effects on some physiochemical properties and secon‐ dary metabolite accumulation in peppermint (Mentha piperita L.) under water deficit stress.
    keywords: acid; content; control; deficit; deficit stress; effect; et al; growth; membrane; oil; peppermint; phenolic; plants; salicylic; stress; total; water; water deficit; water stress
       cache: ahs-8404.pdf
  plain text: ahs-8404.txt

        item: #568 of 594
          id: ahs-8405
      author: Akbarnejad-Samani, Zahra; Shamili, Mansoore; Samari, Fayezeh
       title: The toxicity potential of Ag nanoparticles synthesized from Cordia myxa L.
        date: 2020
       words: 7643
      flesch: 54
     summary: ­ J. Environ. BURMAN U., SAINI M., KUMAR P., 2013 ­ Effect of zinc oxide nanoparticles on growth and antioxidant system of chickpea seedlings.
    keywords: activity; agnps; chemical; concentration; et al; extract; fig; germination; green; leaf; length; myxa; nanoparticles; plant; root; sci; seeds; silver; synthesis; type
       cache: ahs-8405.pdf
  plain text: ahs-8405.txt

        item: #569 of 594
          id: ahs-8406
      author: Rezaei Zafarghandi, Mohammad Saleh; Rahmati-Joneidabad, Mostafa
       title: Indirect shoot organogenesis and in vitro root formation of Antirrhinum majus L. by using of sodium nitroprusside
        date: 2020
       words: 4815
      flesch: 53
     summary: ­ Plant J., 43(6): 849­860. PAGNUSSAT G.C., LANTERI M.L., LAMATTINA L., 2003 ­ Nitric oxide and cyclic GMP are messengers in the indole acetic acid‐induced adventitious rooting process. A rapid regeneration pathway for A. majus could be useful for commercial propagation of nursery and cut­flower industries as well as breed­ ing programs (Sheyab et al., 2010).
    keywords: callus; cell; et al; medium; nitroprusside; oxide; plant; regeneration; root; shoot; snp; sodium
       cache: ahs-8406.pdf
  plain text: ahs-8406.txt

        item: #570 of 594
          id: ahs-8462
      author: Benjelloun, Jalila; Taoufyq, Aida; El Abidine Triqui, Zine; Alami, Qamar Lahlimi ; Layachi, Rajaa; Smouni, Abdelaziz; Bouzroud, Sarah; Guedira, Abdelkarim
       title: Improvement of in vitro germination of Cycas revoluta zygotic embryos using gelrite as gelling agent
        date: 2020
       words: 3188
      flesch: 59
     summary: (a) shoot induction in SH basal medium, (b, c) shoot regeneration in SH medium supplemented with 0.5 mg of BAP and 0.5 mg of 2iP respectively, (d, e, f) shoot elongation SH, SH+BAP and SH+2iP A high percentage of germination, 73% was obtained with SH medium instead of 27% with MS medium.
    keywords: bap; cycas; gelrite; germination; medium; plant; revoluta; shoot
       cache: ahs-8462.pdf
  plain text: ahs-8462.txt

        item: #571 of 594
          id: ahs-8468
      author: Farzane, Akram; Nemati, Hossein; Shoor, Mahmoud ; Ansari, Hossein 
       title: Foliar application of potassium on antioxidant enzyme activities of tomato plants under drought stress
        date: 2020
       words: 4326
      flesch: 59
     summary: The decrease in soil water potential causes alteration in minerals uptake by plant roots and reduc­ tion in leaf expansion under drought stress conditions (Kaminek et al., 1997; Pospisilova et al., 2000). The bottom lines of the reviewed results in this section indicate that under drought stress conditions, yield losses can be minimized by the sufficient supply of K. However, its application effect at tomato growth stages is not well understood yet.
    keywords: application; drought; etc; foliar; growth; kcl; plant; proline; stress; tomato; water; yield
       cache: ahs-8468.pdf
  plain text: ahs-8468.txt

        item: #572 of 594
          id: ahs-8492
      author: Palumbo, Michela; Capotorto, Imperatrice; Cefola, Maria; Burbaci, Salvatore; Pace, Bernardo
       title: Modified atmosphere packaging to improve the shelf-life of Goji berries during cold storage
        date: 2020
       words: 3867
      flesch: 60
     summary: To the best of our knowledge, no further studies on the application of modified atmosphere on goji berries are available, so the present study is aimed to evalu­ ate the application of MAP technology to extend the shelf­life of fresh goji berries. Regarding to dry weight, our data (22.8%±0.3) are in accordance with data reported by Niro et al. (2017) that found a moisture of 77.4% on fresh goji berries, means 22.6% dry weight.
    keywords: berries; days; goji; goji berries; pmap; storage; weight
       cache: ahs-8492.pdf
  plain text: ahs-8492.txt

        item: #573 of 594
          id: ahs-8494
      author: Amuji, Chinedu Felix; Beaumont, Linda Jeanne; Rodriguez, Manuel Eperon
       title: Simulating the impact of projected West African heatwaves and water stress on the physiology and yield of three tomato varieties
        date: 2020
       words: 6671
      flesch: 55
     summary: Ws ‐ Water stress treatment. PETROZZA A., SANTANIELLO A., SUMMERER S., DI TOM­ MASO G., DI TOMMASO D., PAPARELLI E., PIAGGESI A., PERATA P., CELLINI F., 2014 ­ Physiological responses to Megafol® treatments in tomato plants under drought stress: a phenomic and molecular approach.
    keywords: downloads; felix%20amuji; felix-22; file:///c:/users; heat; manuscript; oregon; plants; roma; spring; stress; tomatoes; treatments; tropic; varieties; water; water stress
       cache: ahs-8494.pdf
  plain text: ahs-8494.txt

        item: #574 of 594
          id: ahs-8855
      author: Gomes da Silva, Mairton; Suzart Alves, Lucylia; Miler Soares, Tales; Raj Gheyi, Hans; Bione, Maria Augusta Amorim
       title: Growth, production and water use efficiency of chicory (Cichorium endivia L.) in hydroponic systems using brackish waters
        date: 2020
       words: 7565
      flesch: 64
     summary: These results complement other studies which have shown feasibility for the cultivation of dif­ ferent plant species in the DFT system in tubes, such as lettuce (Cova et al., 2017), rocket (Campos Júnior et al., 2018 b), coriander (Silva et al., 2018 a), parsley (Martins et al., 2019 a) and chives (Silva Júnior et al., 2019). ­ Plants, 3(4): 458­475.
    keywords: chicory; dat; dft; ecsol; et al; growth; hydroponic; matter; nft; nutrient; plants; salinity; salt; shoot; silva; solution; stress; system; use; water
       cache: ahs-8855.pdf
  plain text: ahs-8855.txt

        item: #575 of 594
          id: ahs-8859
      author: Hosomi, Akihiro
       title: Stable growth inhibition of potted fig (Ficus carica L.) trees by soil sickness
        date: 2020
       words: 3337
      flesch: 73
     summary: Hosomi ‐ Damage stability of fig soil sickness 453 peach orchards, Yamada and Ono (1970) observed that the trees grew for 7 years with a constant differ­ ence between with and without sick soil. Shoot growth of 10­ liter potted ‘Masui Dauphine’ figs was inhibited with sick soil from the 1st year of planting, and a stable dwarfish growth was maintained form the 2nd to 9th years, with only a few trees dying.
    keywords: fig; growth; planting; shoot; soil; trees; year
       cache: ahs-8859.pdf
  plain text: ahs-8859.txt

        item: #576 of 594
          id: ahs-8937
      author: Dehghanpour, Sedigheh ; Shamili, Mansoore; Mirzalaiyan-Dastjerdi, Abdolmajid 
       title: The impact of cumin essential oil on cold stored-radish tubers
        date: 2021
       words: 7220
      flesch: 39
     summary: ­ J. Agric. ­ J. Agric.
    keywords: activity; antioxidant; cold; content; cumin; cumin eo; days; et al; food; min­1g­1; oil; period; phenol; ppm; radish; radishes; sci; storage; tubers; weight; μmol
       cache: ahs-8937.pdf
  plain text: ahs-8937.txt

        item: #577 of 594
          id: ahs-8961
      author: Zeynalova, Aydan ; Novruzov, Eldar ; Bartolini, Paola ; Brunetti, Cecilia; Maserti, Biancaelena 
       title: Phenolic fingerprint in wild growing pomegranate fruits from Azerbaijan
        date: 2020
       words: 5498
      flesch: 51
     summary: Pomegranate accessions Del­3,5­diglc (mgL­1) Cya­3,5­digl (mgL­1) Pel­3,5­digl (mgL­1) Cya­3­glc (mgL­1) Pel­3­glc (mgL­1) Cya­3­pent (mgL­1) Pg1 75.58 ± 0.46 b 152.6 ± 2.21 a 0.102 ± 0.001 b ­ 1.67 ± 0.165 a ­ Pg2 114.7 ± 1.85 a 102.3 ± 1.39 b 80.54 ± 1.20 a ­ 0.65 ± 0.03 b ­ Pg3 ­ 7.910 ± 0.30 e ­ 10.20 ± Selection of pomegranate accessions through the phenolic fingerprint The phenolic fingerprint of the juices obtained from the accessions collected in eight different areas of Azerbaijan allowed to select promising wild pomegranate accession particularly rich both in anthocyanins and ellagitannins.
    keywords: accessions; acid; anthocyanins; azerbaijan; content; derivatives; et al; fig; fruits; juices; phenolic; pomegranate; punicalagin
       cache: ahs-8961.pdf
  plain text: ahs-8961.txt

        item: #578 of 594
          id: ahs-8966
      author: Moazzeni, Mohammad; Reezi, Saeed; Ghasemi Ghehsareh, Masoud
       title: Growth and chlorophyll fluorescence characteristics of Sinningia speciosa under red, blue and white light-emitting diodes and sunlight
        date: 2020
       words: 7989
      flesch: 64
     summary: Plant., 84: 55­66. JIAO Y., LAU O.S., DENG X.W., 2007 ­ Light‐regulated tran‐ scriptional networks in higher plants. The OJIP transients were done according to the JIP test (Strasser et al., 2000).
    keywords: blue; chlorophyll; et al; fluorescence; growth; leaf; light; lighting; plants; production; quality; red; transplants; treatments; wbr; white
       cache: ahs-8966.pdf
  plain text: ahs-8966.txt

        item: #579 of 594
          id: ahs-8982
      author: Esmaeilzadeh-Hosseini, Seyyed Alireza; Babaei, G.; Davoodi, S.; Bertaccini, Assunta
       title: Identification and impact of phytoplasmas associated with greenhouse cucumber phyllody in Iran
        date: 2020
       words: 3404
      flesch: 56
     summary: Materials and Methods During 2014 to 2018, greenhouse cucumber growing areas of central and west of Iran were sur­ veyed for evaluation of phytoplasma disease pres­ ence. Phytoplasma diseases associated with “stolbur” were present in plant host species adjacent to greenhouses cucumber areas but their role in the epidemiology of the disease needs to be proved.
    keywords: cucumber; disease; greenhouse; iran; phyllody; phytoplasma; plants; salehi
       cache: ahs-8982.pdf
  plain text: ahs-8982.txt

        item: #580 of 594
          id: ahs-9005
      author: Samsampour , Davood ; Kazemzadeh-Beneh, Hashem; Damizadeh, Gholam-Reza ; Mirzaei, Zahra 
       title: Morphological and biochemical classification of Iranian Mango germplasm collection by multivariate analysis: Implications for breeding
        date: 2020
       words: 9607
      flesch: 57
     summary: In contrast, the highest positive values for PC2 show cultivars with high fruit traits, as shown in figure 2B. Dendrogram using agglomerative hierarchical clus‐ tering The dendrogram showed three main groups; the C1 is included of 31 cultivars, the C3 contained of 54 cultivars, and finally the C2 comprised of 4 cultivars (Fig. 3). PC1, which accounted for 15.91% of the total varia­ tion, was strongly associated with fruit traits, such as fruit length, fruit weight, fiber length, stone length, and fruit breadth.
    keywords: analysis; breeding; cultivars; et al; factor; fiber; fruit; germplasm; leaf; length; mango; mango cultivars; pca; quantitative; sci; stone; table; total; traits; tss; variables; variation; weight
       cache: ahs-9005.pdf
  plain text: ahs-9005.txt

        item: #581 of 594
          id: ahs-9212
      author: Benbya, Abdellah ; Cherkaoui, Souad; Gaboun, Fatima; Chlyah, Omar; Delporte, Fabienne ; Mdarhri Alaoui, meriemmalaou
       title: The Clonal propagation of Argania spinosa (L.) skeels: effects of leaf retention, substrate and cutting diameter
        date: 2021
       words: 7580
      flesch: 60
     summary: Significant effects of cuttings diameter, leaf retention and rooting substrate on sprouting, rooting and survival ability from A. spinosa semi­hardwood cuttings were observed. The rooting effectiveness in function of cuttings diameter could be explained by different factors (Foster et al., 2000).
    keywords: argania; cuttings; diameter; leaf; leaves; length; number; propagation; retention; rooting; roots; spinosa; sprouts; substrate
       cache: ahs-9212.pdf
  plain text: ahs-9212.txt

        item: #582 of 594
          id: ahs-9425
      author: Otieno, Peter Caleb; Mulwa, R.M.S.; Otieno Ogweno, J.
       title: Management of root knot nematodes (Meloidogyne sp.) and enhancing growth yield of greenhouse produced tomatoes by using fresh plant derived soil amendments 
        date: 2020
       words: 11383
      flesch: 62
     summary: Effect of fresh plant organic amendments on tissue of greenhouse tomato The different levels of amendments of Lippia and Ocimum soil amendments had significant (P<0.05) influence on tomato plant tissue nutrients. Destructive sampling of tomato plants to determine nematode infestation was conducted 100 DAT.
    keywords: amendments; biomass; dat; effect; et al; gratissimum; growth; kituensis; lippia; lippia kituensis; meloidogyne; nematodes; ocimum; plant; rates; root; sci; soil; tomato; vatke; yield
       cache: ahs-9425.pdf
  plain text: ahs-9425.txt

        item: #583 of 594
          id: ahs-9548
      author: Madani, Babak; Dastjerdy, Abdolmajid Mirzaalian ; Shahriyari, Ali 
       title: Improving 'Piyarom' date palm fruit quality with fruit thinning and bunch covering treatments
        date: 2021
       words: 5790
      flesch: 65
     summary: The results of this experiment showed that the coverage did not have a significant effect on the per­ centage of Tamar, but date palm fruit thinning in the Kimri and pollination stages significantly increased Tamar percentage of both years (Table 1). Also, the bunch weight was significantly higher in the control as compared to bunch weights that occurred after date palm fruit thinning at the pollination and Kimri stages, for both years (Table 1).
    keywords: bunch; control; covering; date; fruit; kimri; palm; quality; thinning; total; weight
       cache: ahs-9548.pdf
  plain text: ahs-9548.txt

        item: #584 of 594
          id: ahs-9609
      author: Zare, Fatemeh; Najafi, Gholamhassan; Tavakoli Hashjin, Teimour ; Kermani, Alimashallah M.; Ghiasi, Pedram 
       title: A new pneumatic harvester for improvement and facilitation the harvesting of the olive fruits
        date: 2021
       words: 4993
      flesch: 68
     summary: Two methods of harvesting olive fruit, namely, mecha­ nized harvesting with Pneumatic Harvester (PH) and Manual Harvesting (MH) were investigated, which indicated that due to the presence of the collector system, using mechanized harvesting can reduce the fruit damages (Plasquy et al., 2019). The force required to detach them was Zare et al. ‐ A new pneumatic harvester for olive fruits harvesting 45 measured by a mechanical force gauge.
    keywords: collector; fruit; harvester; harvesting; nph; olive; pneumatic; system; tree
       cache: ahs-9609.pdf
  plain text: ahs-9609.txt

        item: #585 of 594
          id: ahs-9624
      author: AYDI BEN ABDALLAH, Rania; Ammar, Nawaim; Ayed, Fakher; Jabnoun-Khiareddine, Hayfa; Daami-Remadi, Mejda
       title: Single and combined effects of Bacillus spp. and brown seaweed (Sargassum vulgare) extracts as bio-stimulants of eggplant (Solanum melongena L.) growth: Bacillus spp. and Sargassum vulgare extracts as biostimulants of eggplant growth
        date: 2021
       words: 9429
      flesch: 56
     summary: Therefore, research efforts are concentrated on alternative nutrients to improve soil physical, chemical, and biological traits through the application of chimerical organic fertiliz­ ers (Maghfoer et al., 2014) and/or various organic soil amendments such as compost (D’Hose et al., 2012), plant extracts (Bijarniya, 2011), algae (Eyras et al., 2008), and microbial inoculants (Arora et al., 2020). BIJARNIYA D., 2011 ­ Soil amendments, plant extracts and plant products for integrated disease management in agricultural crops.
    keywords: amyloliquefaciens; bacillus; compost; control; eggplant; et al; extract; growth; methanolic; plantarum; plants; s. vulgare; seaweed; spp; strains; subsp; sv65; treatment; vulgare; vulgare extract
       cache: ahs-9624.pdf
  plain text: ahs-9624.txt

        item: #586 of 594
          id: ahs-9663
      author: Wukir Tini, Etik; Dwi Haryanto, T.A.; Sakhidin, Sakhidin; Saparso, Saparso
       title: Endogenous hormone causes flower and fruit drop of wax apple (Syzygium samarangense cv. Citra)
        date: 2021
       words: 5562
      flesch: 64
     summary: Sci., 2021 35(1): 53­60 DOI: 10.36253/ahsc­9663 Endogenous hormone causes flower and fruit drop of wax apple (Syzygium samarangense cv. Citra) E. Wukir Tini (*), T.A. Dwi Haryanto, Sakhidin, Saparso Agriculture Faculty, Jenderal Soedirman University, Purwokerto, Central Java, Indonesia. Key words: ACC, cytokinins, fruit drop, IAA, GA3, wax apple.
    keywords: anthesis; apple; content; development; drop; flower; fruit; fruit development; fruit drop; plant; ppm; retention; starch; wax
       cache: ahs-9663.pdf
  plain text: ahs-9663.txt

        item: #587 of 594
          id: ahs-9681
      author: Benjelloun, Jalila; Bouzroud, Sarah; Triqui, Zine El Abidine; Lahlimi Alami, Qamar; Layachi, Rajaa; Smouni, Abdelaziz; Guedira, Abdelkarim
       title: Warm stratification improves embryos development and seed germination of Cycas revoluta
        date: 2021
       words: 3575
      flesch: 57
     summary: Taken together, these results underlined the beneficial effect of warm stratification on Cycas revoluta seed germination and plant development and proposed a new method to improve seed germination of Cycas revoluta. Abstract: The broad objective of this research is to study the effect of warm stratification on Cycas revoluta zygotic embryos length, seed germination and plant development.
    keywords: cycas; effect; embryos; germination; length; months; revoluta; seeds; stratification; treatments
       cache: ahs-9681.pdf
  plain text: ahs-9681.txt

        item: #588 of 594
          id: ahs-9689
      author: Bammite, Damigou; Matthews, Peter Joseph; Dagnon, Yao Dodzi ; Agbogan, Akouèthê; Agre, Paterne; Akintayo, Oluyemi Titilola; Odah, Komi; Dansi, Alexandre; Abberton, Michael; Tozo, Koffi Sodokè
       title: Genetic diversity in Colocasia esculenta and Xanthosoma mafaffa in Togo, West Africa
        date: 2021
       words: 8507
      flesch: 63
     summary: WADA E., FEYISSA T., TESFAYE K., MÜLLER C.M., GEMEIN­ HOLZER B., 2018 ­ Genetic diversity of Ethiopian Xanthosoma sagittifolium (L.) Schott accessions assessed with AFLPs. Table 1 ­ Taro: Frequency of major alleles, number of alleles, Nei's genetic diversity, and polymorphism information content (PIC) for 13 primers applied to 26 accessions (Togo collection) Table 2A ­ Taro: Statistical measures of genetic diversity in the dasheen and eddoe populations (Togo collection) N = no. accessions (test population), Na = no. of different alleles, Ne = no. of effective alleles, I = Shannon's Information Index, He = Nei’s gene diversity, %P = percentage of polymorphic loci (rounded figures) Locus Freq.
    keywords: accessions; africa; alleles; bammite; cocoyam; colocasia; cultivars; dasheen; diversity; esculenta; et al; genetic; loci; matthews; new; species; ssr; table; taro; togo; xanthosoma
       cache: ahs-9689.pdf
  plain text: ahs-9689.txt

        item: #589 of 594
          id: ahs-9764
      author: Severino, Vivian; Arias-Sibillotte, Mercedes; Dogliotti, Santiago; Frins, Erna; Gonzalez-Talice, Jaime; Yuri, José Antonio
       title: Climatic and physiological parameters related to the progress and prediction of apple sunburn damage in a neotropical climate
        date: 2020
       words: 5991
      flesch: 61
     summary: Stress adaptation mechanisms of plants, such as chlorophyll reduction (Ballester et al., 2017), dissipa­ tion of excitation energy, increase of solutes of low molecular weight (Wen and Moriguchi, 2015) and changes in pigmentation (Merzlyak et al., 2003) have been previously studied in relation to sunburn in apple fruit. MORALES­QUINTANA L., WAITE J.M., KALCSITS L., TORRES C.A., RAMOS P., 2020 ­ Sun injury on apple fruit : Physiological, biochemical and molecular advances, and future challenges.
    keywords: apple; chlorophyll; cycle; damage; et al; fig; fruit; index; maximum; plant; ratio; reflectance; sci; solovchenko; sunburn
       cache: ahs-9764.pdf
  plain text: ahs-9764.txt

        item: #590 of 594
          id: ahs-9874
      author: Farhadi, H.; Hassanpouraghdam, M.B.; Aazami, Mohammad Ali
       title: The induction and development of somatic embryos from the in vitro culture of Catharanthus roseus (L.) G. Don
        date: 2021
       words: 4585
      flesch: 57
     summary: ­ Plants, 9: 3. SINGH R., KHARB P., RANI K., 2011 ­ Rapid micropropaga‐ tion and callus induction of Catharanthus roseus in vitro different explants. Growth regulators (composition and concen­ tration) and the plant genetic make­up play a role in the success of somatic embryos production.
    keywords: callus; catharanthus; embryogenesis; embryos; hypocotyl; l­1; naa; plant; roseus; somatic
       cache: ahs-9874.pdf
  plain text: ahs-9874.txt

        item: #591 of 594
          id: ahs-9899
      author: Jassey, Fatou A.; Babatunde, F.E.; Manneh, F.D.
       title: Assessment of pesticide residues level in watermelon fruits [Citrullus lanatus (Thunberg) Matsumura and Nakai] in Lower, Central and Upper Badibou Districts in North Bank Region, of the Gambia
        date: 2021
       words: 4996
      flesch: 57
     summary: Sci., 2021 35(2): 119­127 DOI: 10.36253/ahsc­9899 Assessment of pesticide residues level in watermelon fruits [Citrullus lanatus In 2016, a total of one hundred and seventy­four (174) tonnes of watermelon fruits were produced (Department of Planning Agriculture, 2016).
    keywords: area; farmers; fig; fruits; level; pesticide; research; residue; samples; study; watermelon
       cache: ahs-9899.pdf
  plain text: ahs-9899.txt

        item: #592 of 594
          id: ahs-9923
      author: Sikhandakasmita, Panawat; Kataoka, Ikuo; Ogata, Tsuneo; Mochioka, Ryosuke; Beppu, Kenji
       title: Effect of growth temperature levels on photosynthetic ability and fruit quality of ‘KU-PP2’, a new low-chill peach cultivar
        date: 2021
       words: 6304
      flesch: 58
     summary: ­ Photosynthetica., 51: 163­190. CENTRITTO M., BRILLI F., FODALE R., LORETO F., 2001 ­ Different sensitivity of isoprene emission, respiration and photosynthesis to high growth temperature cou‐ pled with drought stress in black poplar (Populus nigra) saplings. Fig. 2 ­ SPAD value (A) and chlorophyll content (B) in response to growth temperature treatments.
    keywords: chl; fruit; growth; ku­pp2; leaf; leaves; peach; plant; stomatal; temperature; treatment
       cache: ahs-9923.pdf
  plain text: ahs-9923.txt

        item: #593 of 594
          id: ahs-9945
      author: Mutua, Carol; Ogweno, Joshua; Gesimba, Robert
       title: Postharvest quality of pepino melon (Solanum muricatum Aiton) as influenced by NPK fertilizer rates, growing environment and storage temperature
        date: 2021
       words: 7941
      flesch: 65
     summary: The high TSS recorded in field grown pepino fruits could be due to high light intensity and thus high photosynthesis leading to more accumulation of sugars in the fruit compared to greenhouse grown fruits where the light intensity was low leading to reduced photosynthesis and hence low accumulation of sugars in the fruits (Beckmann et al., 2006). Greenhouse grown fruits also had a higher PWL compared to field grown fruits in both trials.
    keywords: fertilizer; field; fruits; greenhouse; low; npk; npk fertilizer; pepino; plants; room; storage; temperature; tss
       cache: ahs-9945.pdf
  plain text: ahs-9945.txt

        item: #594 of 594
          id: ahs-9981
      author: Khoulati, Amine; Saalaoui, E.
       title: Impact of Moroccan Crocus sativus L. tepals, corms, and stigmas extract on growth and photosynthetic pigments in tomato seedling
        date: 2021
       words: 4419
      flesch: 58
     summary: Many researchers have focused their attention on valuing saffron by­products to increase crop profitability, such as floral bio­residues and (*) Corresponding author: aminekhoulati89@gmail.com Citation: KHOULATI A., SAALAOUI E., 2021 ­ Impact of Moroccan Crocus sativus L. tepals, corms, and stigmas extract on growth and photosynthetic pigments in tomato seedling. Discussion and Conclusions The present study’s objective was to valorize the tepals, corms, and stigmas of Crocus sativus L. and take advantage of its bioactive components to use them as a biostimulant alternative to chemicals prod­ ucts.
    keywords: application; chlorophyll; content; corms; crocus; extract; plants; saffron; sativus; stigmas; tepals; tomato
       cache: ahs-9981.pdf
  plain text: ahs-9981.txt