id	sid	tid	token	lemma	pos
ahs-12347	1	1	impaginato	impaginato	PROPN
ahs-12347	1	2	247	247	NUM
ahs-12347	1	3	adv	adv	PROPN
ahs-12347	1	4	.	.	PUNCT
ahs-12347	1	5	hort	hort	PROPN
ahs-12347	1	6	.	.	PUNCT
ahs-12347	2	1	sci	sci	PROPN
ahs-12347	2	2	.	.	PROPN
ahs-12347	2	3	,	,	PUNCT
ahs-12347	2	4	2022	2022	NUM
ahs-12347	2	5	36(3	36(3	NUM
ahs-12347	2	6	):	):	PUNCT
ahs-12347	2	7	247­251	247­251	NUM
ahs-12347	2	8	doi	doi	NOUN
ahs-12347	2	9	:	:	PUNCT
ahs-12347	2	10	10.36253	10.36253	NUM
ahs-12347	2	11	/	/	SYM
ahs-12347	2	12	ahsc­12347	ahsc­12347	ADJ
ahs-12347	2	13	evaluation	evaluation	NOUN
ahs-12347	2	14	of	of	ADP
ahs-12347	2	15	hemerocallis	hemerocalli	NOUN
ahs-12347	2	16	germplasm	germplasm	NOUN
ahs-12347	2	17	using	use	VERB
ahs-12347	2	18	single	single	ADJ
ahs-12347	2	19	nucleotide	nucleotide	ADJ
ahs-12347	2	20	polymorphisms	polymorphism	NOUN
ahs-12347	2	21	of	of	ADP
ahs-12347	2	22	nrits	nrit	NOUN
ahs-12347	2	23	and	and	CCONJ
ahs-12347	2	24	chloroplast	chloroplast	ADJ
ahs-12347	2	25	interspacer	interspacer	NOUN
ahs-12347	2	26	region	region	NOUN
ahs-12347	2	27	s.y	s.y	PROPN
ahs-12347	2	28	.	.	PROPN
ahs-12347	2	29	park	park	PROPN
ahs-12347	2	30	1	1	NUM
ahs-12347	2	31	,	,	PUNCT
ahs-12347	2	32	y.h	y.h	PROPN
ahs-12347	2	33	.	.	PROPN
ahs-12347	2	34	joung	joung	PROPN
ahs-12347	2	35	1	1	NUM
ahs-12347	2	36	,	,	PUNCT
ahs-12347	2	37	j.k	j.k	PROPN
ahs-12347	2	38	.	.	PROPN
ahs-12347	2	39	suh	suh	PROPN
ahs-12347	2	40	2	2	NUM
ahs-12347	2	41	,	,	PUNCT
ahs-12347	2	42	m.s	m.s	PROPN
ahs-12347	2	43	.	.	PROPN
ahs-12347	2	44	roh	roh	PROPN
ahs-12347	2	45	2	2	NUM
ahs-12347	2	46	,	,	PUNCT
ahs-12347	2	47	3	3	NUM
ahs-12347	2	48	(	(	PUNCT
ahs-12347	2	49	*	*	NOUN
ahs-12347	2	50	)	)	PUNCT
ahs-12347	2	51	1	1	NUM
ahs-12347	2	52	school	school	NOUN
ahs-12347	2	53	of	of	ADP
ahs-12347	2	54	biological	biological	ADJ
ahs-12347	2	55	sciences	science	NOUN
ahs-12347	2	56	and	and	CCONJ
ahs-12347	2	57	technology	technology	NOUN
ahs-12347	2	58	,	,	PUNCT
ahs-12347	2	59	chonnam	chonnam	PROPN
ahs-12347	2	60	national	national	PROPN
ahs-12347	2	61	university	university	PROPN
ahs-12347	2	62	,	,	PUNCT
ahs-12347	2	63	500‐757	500‐757	PROPN
ahs-12347	2	64	gwangju	gwangju	NOUN
ahs-12347	2	65	,	,	PUNCT
ahs-12347	2	66	korea	korea	PROPN
ahs-12347	2	67	.	.	PUNCT
ahs-12347	3	1	2	2	NUM
ahs-12347	3	2	department	department	NOUN
ahs-12347	3	3	of	of	ADP
ahs-12347	3	4	environmental	environmental	ADJ
ahs-12347	3	5	horticulture	horticulture	NOUN
ahs-12347	3	6	,	,	PUNCT
ahs-12347	3	7	college	college	NOUN
ahs-12347	3	8	of	of	ADP
ahs-12347	3	9	bioresource	bioresource	PROPN
ahs-12347	3	10	science	science	NOUN
ahs-12347	3	11	,	,	PUNCT
ahs-12347	3	12	dankook	dankook	NOUN
ahs-12347	3	13	university	university	PROPN
ahs-12347	3	14	,	,	PUNCT
ahs-12347	3	15	cheonan	cheonan	PROPN
ahs-12347	3	16	,	,	PUNCT
ahs-12347	3	17	330‐714	330‐714	NUM
ahs-12347	3	18	chungnam	chungnam	NOUN
ahs-12347	3	19	,	,	PUNCT
ahs-12347	3	20	korea	korea	PROPN
ahs-12347	3	21	.	.	PUNCT
ahs-12347	4	1	3	3	NUM
ahs-12347	4	2	current	current	ADJ
ahs-12347	4	3	address	address	NOUN
ahs-12347	4	4	:	:	PUNCT
ahs-12347	4	5	the	the	DET
ahs-12347	4	6	institute	institute	NOUN
ahs-12347	4	7	of	of	ADP
ahs-12347	4	8	natural	natural	ADJ
ahs-12347	4	9	resource	resource	NOUN
ahs-12347	4	10	development	development	NOUN
ahs-12347	4	11	,	,	PUNCT
ahs-12347	4	12	mokpo	mokpo	PROPN
ahs-12347	4	13	national	national	PROPN
ahs-12347	4	14	university	university	PROPN
ahs-12347	4	15	,	,	PUNCT
ahs-12347	4	16	muan	muan	PROPN
ahs-12347	4	17	,	,	PUNCT
ahs-12347	4	18	58554	58554	NUM
ahs-12347	4	19	jeonnam	jeonnam	PROPN
ahs-12347	4	20	,	,	PUNCT
ahs-12347	4	21	korea	korea	PROPN
ahs-12347	4	22	.	.	PUNCT
ahs-12347	5	1	key	key	ADJ
ahs-12347	5	2	words	word	NOUN
ahs-12347	5	3	:	:	PUNCT
ahs-12347	5	4	daylily	daylily	ADJ
ahs-12347	5	5	,	,	PUNCT
ahs-12347	5	6	haplotype	haplotype	NOUN
ahs-12347	5	7	,	,	PUNCT
ahs-12347	5	8	nocturnal	nocturnal	ADJ
ahs-12347	5	9	flowering	flowering	NOUN
ahs-12347	5	10	,	,	PUNCT
ahs-12347	5	11	polymerase	polymerase	NOUN
ahs-12347	5	12	chain	chain	NOUN
ahs-12347	5	13	reaction	reaction	NOUN
ahs-12347	5	14	,	,	PUNCT
ahs-12347	5	15	sequence	sequence	NOUN
ahs-12347	5	16	analysis	analysis	NOUN
ahs-12347	5	17	.	.	PUNCT
ahs-12347	6	1	abstract	abstract	ADJ
ahs-12347	6	2	:	:	PUNCT
ahs-12347	6	3	this	this	DET
ahs-12347	6	4	study	study	NOUN
ahs-12347	6	5	was	be	AUX
ahs-12347	6	6	initiated	initiate	VERB
ahs-12347	6	7	to	to	PART
ahs-12347	6	8	distinguish	distinguish	VERB
ahs-12347	6	9	nocturnal	nocturnal	ADJ
ahs-12347	6	10	(	(	PUNCT
ahs-12347	6	11	night	night	NOUN
ahs-12347	6	12	)	)	PUNCT
ahs-12347	6	13	flowering	flower	VERB
ahs-12347	6	14	hemerocallis	hemerocalli	NOUN
ahs-12347	6	15	species	specie	NOUN
ahs-12347	6	16	from	from	ADP
ahs-12347	6	17	day	day	NOUN
ahs-12347	6	18	flowering	flower	VERB
ahs-12347	6	19	species	specie	NOUN
ahs-12347	6	20	based	base	VERB
ahs-12347	6	21	on	on	ADP
ahs-12347	6	22	the	the	DET
ahs-12347	6	23	single	single	ADJ
ahs-12347	6	24	nucleotide	nucleotide	NOUN
ahs-12347	6	25	polymorphisms	polymorphism	NOUN
ahs-12347	6	26	(	(	PUNCT
ahs-12347	6	27	snps	snps	PROPN
ahs-12347	6	28	)	)	PUNCT
ahs-12347	6	29	of	of	ADP
ahs-12347	6	30	nuclear	nuclear	ADJ
ahs-12347	6	31	internal	internal	ADJ
ahs-12347	6	32	transcribed	transcribe	VERB
ahs-12347	6	33	spacers	spacer	NOUN
ahs-12347	6	34	1	1	NUM
ahs-12347	6	35	,	,	PUNCT
ahs-12347	6	36	2	2	NUM
ahs-12347	6	37	in	in	ADP
ahs-12347	6	38	a	a	DET
ahs-12347	6	39	riboso­	riboso­	ADJ
ahs-12347	6	40	mal	mal	ADJ
ahs-12347	6	41	rna	rna	NOUN
ahs-12347	6	42	gene	gene	NOUN
ahs-12347	6	43	(	(	PUNCT
ahs-12347	6	44	nrits	nrit	NOUN
ahs-12347	6	45	)	)	PUNCT
ahs-12347	6	46	and	and	CCONJ
ahs-12347	6	47	a	a	DET
ahs-12347	6	48	chloroplast	chloroplast	NOUN
ahs-12347	6	49	interspacer	interspacer	NOUN
ahs-12347	6	50	region	region	NOUN
ahs-12347	6	51	(	(	PUNCT
ahs-12347	6	52	cpis	cpis	PROPN
ahs-12347	6	53	)	)	PUNCT
ahs-12347	6	54	.	.	PUNCT
ahs-12347	7	1	four	four	NUM
ahs-12347	7	2	noctur­	noctur­	ADJ
ahs-12347	7	3	nal	nal	ADJ
ahs-12347	7	4	flowering	flower	VERB
ahs-12347	7	5	species	specie	NOUN
ahs-12347	7	6	,	,	PUNCT
ahs-12347	7	7	h.	h.	PROPN
ahs-12347	7	8	citrina	citrina	PROPN
ahs-12347	7	9	,	,	PUNCT
ahs-12347	7	10	h.	h.	PROPN
ahs-12347	7	11	thunbergii	thunbergii	PROPN
ahs-12347	7	12	,	,	PUNCT
ahs-12347	7	13	h.	h.	PROPN
ahs-12347	7	14	minor	minor	PROPN
ahs-12347	7	15	,	,	PUNCT
ahs-12347	7	16	and	and	CCONJ
ahs-12347	7	17	h.	h.	PROPN
ahs-12347	7	18	lilioasphodelus	lilioasphodelus	PROPN
ahs-12347	7	19	were	be	AUX
ahs-12347	7	20	collected	collect	VERB
ahs-12347	7	21	including	include	VERB
ahs-12347	7	22	korea	korea	PROPN
ahs-12347	7	23	,	,	PUNCT
ahs-12347	7	24	and	and	CCONJ
ahs-12347	7	25	compared	compare	VERB
ahs-12347	7	26	with	with	ADP
ahs-12347	7	27	day	day	NOUN
ahs-12347	7	28	flowering	flower	VERB
ahs-12347	7	29	species	specie	NOUN
ahs-12347	7	30	that	that	PRON
ahs-12347	7	31	included	include	VERB
ahs-12347	7	32	h.	h.	PROPN
ahs-12347	7	33	vespertina	vespertina	PROPN
ahs-12347	7	34	and	and	CCONJ
ahs-12347	7	35	h.	h.	PROPN
ahs-12347	7	36	hongdoensis	hongdoensis	PROPN
ahs-12347	7	37	.	.	PUNCT
ahs-12347	8	1	based	base	VERB
ahs-12347	8	2	on	on	ADP
ahs-12347	8	3	the	the	DET
ahs-12347	8	4	haplotypes	haplotype	NOUN
ahs-12347	8	5	of	of	ADP
ahs-12347	8	6	nrits	nrit	NOUN
ahs-12347	8	7	and	and	CCONJ
ahs-12347	8	8	cpis	cpis	ADJ
ahs-12347	8	9	,	,	PUNCT
ahs-12347	8	10	nocturnal	nocturnal	ADJ
ahs-12347	8	11	species	specie	NOUN
ahs-12347	8	12	can	can	AUX
ahs-12347	8	13	not	not	PART
ahs-12347	8	14	be	be	AUX
ahs-12347	8	15	distinguished	distinguish	VERB
ahs-12347	8	16	from	from	ADP
ahs-12347	8	17	day	day	NOUN
ahs-12347	8	18	flowering	flower	VERB
ahs-12347	8	19	species	specie	NOUN
ahs-12347	8	20	.	.	PUNCT
ahs-12347	9	1	discrepancies	discrepancy	NOUN
ahs-12347	9	2	in	in	ADP
ahs-12347	9	3	flowering	flowering	NOUN
ahs-12347	9	4	time	time	NOUN
ahs-12347	9	5	and	and	CCONJ
ahs-12347	9	6	haplotypes	haplotype	NOUN
ahs-12347	9	7	among	among	ADP
ahs-12347	9	8	h.	h.	PROPN
ahs-12347	9	9	minor	minor	ADJ
ahs-12347	9	10	accessions	accession	NOUN
ahs-12347	9	11	sug­	sug­	NOUN
ahs-12347	9	12	gest	gest	VERB
ahs-12347	9	13	that	that	SCONJ
ahs-12347	9	14	more	more	ADJ
ahs-12347	9	15	germplasm	germplasm	NOUN
ahs-12347	9	16	with	with	ADP
ahs-12347	9	17	diverse	diverse	ADJ
ahs-12347	9	18	geographic	geographic	ADJ
ahs-12347	9	19	origins	origin	NOUN
ahs-12347	9	20	should	should	AUX
ahs-12347	9	21	be	be	AUX
ahs-12347	9	22	evaluated	evaluate	VERB
ahs-12347	9	23	and	and	CCONJ
ahs-12347	9	24	identification	identification	NOUN
ahs-12347	9	25	of	of	ADP
ahs-12347	9	26	other	other	ADJ
ahs-12347	9	27	genes	gene	NOUN
ahs-12347	9	28	is	be	AUX
ahs-12347	9	29	required	require	VERB
ahs-12347	9	30	to	to	PART
ahs-12347	9	31	effectively	effectively	ADV
ahs-12347	9	32	distinguish	distinguish	VERB
ahs-12347	9	33	nocturnal	nocturnal	ADJ
ahs-12347	9	34	species	specie	NOUN
ahs-12347	9	35	from	from	ADP
ahs-12347	9	36	day	day	NOUN
ahs-12347	9	37	flowering	flower	VERB
ahs-12347	9	38	species	specie	NOUN
ahs-12347	9	39	.	.	PUNCT
ahs-12347	10	1	1	1	X
ahs-12347	10	2	.	.	X
ahs-12347	10	3	introduction	introduction	NOUN
ahs-12347	10	4	there	there	PRON
ahs-12347	10	5	are	be	VERB
ahs-12347	10	6	about	about	ADP
ahs-12347	10	7	15­26	15­26	NUM
ahs-12347	10	8	species	specie	NOUN
ahs-12347	10	9	/	/	SYM
ahs-12347	10	10	varieties	variety	NOUN
ahs-12347	10	11	in	in	ADP
ahs-12347	10	12	the	the	DET
ahs-12347	10	13	genus	genus	ADJ
ahs-12347	10	14	hemerocallis	hemerocallis	NOUN
ahs-12347	10	15	(	(	PUNCT
ahs-12347	10	16	usda	usda	NOUN
ahs-12347	10	17	,	,	PUNCT
ahs-12347	10	18	ars	ar	NOUN
ahs-12347	10	19	,	,	PUNCT
ahs-12347	10	20	national	national	ADJ
ahs-12347	10	21	genetic	genetic	ADJ
ahs-12347	10	22	resources	resource	NOUN
ahs-12347	10	23	program	program	NOUN
ahs-12347	10	24	,	,	PUNCT
ahs-12347	10	25	2015	2015	NUM
ahs-12347	10	26	)	)	PUNCT
ahs-12347	10	27	.	.	PUNCT
ahs-12347	11	1	using	use	VERB
ahs-12347	11	2	amplified	amplify	VERB
ahs-12347	11	3	fragment	fragment	ADJ
ahs-12347	11	4	length	length	NOUN
ahs-12347	11	5	polymorphisms	polymorphism	NOUN
ahs-12347	11	6	(	(	PUNCT
ahs-12347	11	7	aflp	aflp	NOUN
ahs-12347	11	8	)	)	PUNCT
ahs-12347	11	9	markers	marker	NOUN
ahs-12347	11	10	,	,	PUNCT
ahs-12347	11	11	h.	h.	PROPN
ahs-12347	11	12	fulva	fulva	PROPN
ahs-12347	11	13	l.	l.	PROPN
ahs-12347	11	14	were	be	AUX
ahs-12347	11	15	grouped	group	VERB
ahs-12347	11	16	separately	separately	ADV
ahs-12347	11	17	from	from	ADP
ahs-12347	11	18	the	the	DET
ahs-12347	11	19	nocturnal	nocturnal	ADJ
ahs-12347	11	20	species	specie	NOUN
ahs-12347	11	21	h.	h.	PROPN
ahs-12347	11	22	thunbergii	thunbergii	PROPN
ahs-12347	11	23	baker	baker	PROPN
ahs-12347	11	24	and	and	CCONJ
ahs-12347	11	25	h.	h.	PROPN
ahs-12347	11	26	lilioas‐	lilioas‐	ADJ
ahs-12347	11	27	phodelus	phodelus	PROPN
ahs-12347	11	28	l.	l.	PROPN
ahs-12347	11	29	,	,	PUNCT
ahs-12347	11	30	while	while	SCONJ
ahs-12347	11	31	nocturnal	nocturnal	ADJ
ahs-12347	11	32	h.	h.	NOUN
ahs-12347	11	33	minor	minor	ADJ
ahs-12347	11	34	mill	mill	NOUN
ahs-12347	11	35	.	.	PUNCT
ahs-12347	12	1	and	and	CCONJ
ahs-12347	12	2	h.	h.	PROPN
ahs-12347	12	3	citrina	citrina	PROPN
ahs-12347	12	4	baroni	baroni	PROPN
ahs-12347	12	5	,	,	PUNCT
ahs-12347	12	6	were	be	AUX
ahs-12347	12	7	grouped	group	VERB
ahs-12347	12	8	together	together	ADV
ahs-12347	12	9	in	in	ADP
ahs-12347	12	10	a	a	DET
ahs-12347	12	11	different	different	ADJ
ahs-12347	12	12	sub­cluster	sub­cluster	NOUN
ahs-12347	12	13	(	(	PUNCT
ahs-12347	12	14	tomkins	tomkin	NOUN
ahs-12347	12	15	et	et	NOUN
ahs-12347	12	16	al	al	PROPN
ahs-12347	12	17	.	.	PROPN
ahs-12347	12	18	,	,	PUNCT
ahs-12347	12	19	2001	2001	NUM
ahs-12347	12	20	)	)	PUNCT
ahs-12347	12	21	.	.	PUNCT
ahs-12347	13	1	the	the	DET
ahs-12347	13	2	flowers	flower	NOUN
ahs-12347	13	3	of	of	ADP
ahs-12347	13	4	nocturnal	nocturnal	ADJ
ahs-12347	13	5	hemerocallis	hemerocalli	NOUN
ahs-12347	13	6	open	open	ADJ
ahs-12347	13	7	late	late	ADV
ahs-12347	13	8	in	in	ADP
ahs-12347	13	9	the	the	DET
ahs-12347	13	10	afternoon	afternoon	NOUN
ahs-12347	13	11	and	and	CCONJ
ahs-12347	13	12	wither	wither	VERB
ahs-12347	13	13	the	the	DET
ahs-12347	13	14	next	next	ADJ
ahs-12347	13	15	morning	morning	NOUN
ahs-12347	13	16	(	(	PUNCT
ahs-12347	13	17	fig	fig	NOUN
ahs-12347	13	18	.	.	NOUN
ahs-12347	14	1	1	1	NUM
ahs-12347	14	2	)	)	PUNCT
ahs-12347	14	3	(	(	PUNCT
ahs-12347	14	4	chen	chen	PROPN
ahs-12347	14	5	and	and	CCONJ
ahs-12347	14	6	noguchi	noguchi	PROPN
ahs-12347	14	7	,	,	PUNCT
ahs-12347	14	8	2000	2000	NUM
ahs-12347	14	9	)	)	PUNCT
ahs-12347	14	10	.	.	PUNCT
ahs-12347	15	1	however	however	ADV
ahs-12347	15	2	,	,	PUNCT
ahs-12347	15	3	gulia	gulia	PROPN
ahs-12347	15	4	et	et	PROPN
ahs-12347	15	5	al	al	PROPN
ahs-12347	15	6	.	.	PROPN
ahs-12347	16	1	(	(	PUNCT
ahs-12347	16	2	2009	2009	NUM
ahs-12347	16	3	)	)	PUNCT
ahs-12347	16	4	classified	classify	VERB
ahs-12347	16	5	h.	h.	PROPN
ahs-12347	16	6	minor	minor	PROPN
ahs-12347	16	7	as	as	ADP
ahs-12347	16	8	a	a	DET
ahs-12347	16	9	diurnal	diurnal	ADJ
ahs-12347	16	10	species	specie	NOUN
ahs-12347	16	11	rather	rather	ADV
ahs-12347	16	12	than	than	ADP
ahs-12347	16	13	a	a	DET
ahs-12347	16	14	nocturnal	nocturnal	ADJ
ahs-12347	16	15	species	specie	NOUN
ahs-12347	16	16	,	,	PUNCT
ahs-12347	16	17	confirming	confirm	VERB
ahs-12347	16	18	the	the	DET
ahs-12347	16	19	study	study	NOUN
ahs-12347	16	20	by	by	ADP
ahs-12347	16	21	krestova	krestova	PROPN
ahs-12347	16	22	and	and	CCONJ
ahs-12347	16	23	nesterova	nesterova	X
ahs-12347	16	24	(	(	PUNCT
ahs-12347	16	25	2003	2003	NUM
ahs-12347	16	26	)	)	PUNCT
ahs-12347	16	27	that	that	PRON
ahs-12347	16	28	h.	h.	PROPN
ahs-12347	16	29	minor	minor	PROPN
ahs-12347	16	30	flowered	flower	VERB
ahs-12347	16	31	in	in	ADP
ahs-12347	16	32	the	the	DET
ahs-12347	16	33	morning	morning	NOUN
ahs-12347	16	34	under	under	ADP
ahs-12347	16	35	sunny	sunny	ADJ
ahs-12347	16	36	weather	weather	NOUN
ahs-12347	16	37	at	at	ADP
ahs-12347	16	38	>	>	X
ahs-12347	16	39	16	16	NUM
ahs-12347	16	40	°	°	ADP
ahs-12347	16	41	c	c	NOUN
ahs-12347	16	42	and	and	CCONJ
ahs-12347	16	43	with­	with­	PROPN
ahs-12347	16	44	(	(	PUNCT
ahs-12347	16	45	*	*	NOUN
ahs-12347	16	46	)	)	PUNCT
ahs-12347	16	47	corresponding	correspond	VERB
ahs-12347	16	48	author	author	NOUN
ahs-12347	16	49	:	:	PUNCT
ahs-12347	16	50	marksroh@gmail.com	marksroh@gmail.com	X
ahs-12347	16	51	citation	citation	NOUN
ahs-12347	16	52	:	:	PUNCT
ahs-12347	16	53	park	park	NOUN
ahs-12347	16	54	s.y	s.y	PROPN
ahs-12347	16	55	.	.	PROPN
ahs-12347	16	56	,	,	PUNCT
ahs-12347	16	57	joung	joung	PROPN
ahs-12347	16	58	y.h	y.h	PROPN
ahs-12347	16	59	.	.	PROPN
ahs-12347	16	60	,	,	PUNCT
ahs-12347	16	61	suh	suh	PROPN
ahs-12347	16	62	j.k	j.k	PROPN
ahs-12347	16	63	.	.	PROPN
ahs-12347	16	64	,	,	PUNCT
ahs-12347	16	65	roh	roh	PROPN
ahs-12347	16	66	m.s	m.s	PROPN
ahs-12347	16	67	.	.	PROPN
ahs-12347	16	68	,	,	PUNCT
ahs-12347	16	69	2022	2022	NUM
ahs-12347	16	70	­	­	NUM
ahs-12347	16	71	evaluation	evaluation	NOUN
ahs-12347	16	72	of	of	ADP
ahs-12347	16	73	hemerocallis	hemerocalli	NOUN
ahs-12347	16	74	germpla‐	germpla‐	PROPN
ahs-12347	16	75	sm	sm	VERB
ahs-12347	16	76	using	use	VERB
ahs-12347	16	77	single	single	ADJ
ahs-12347	16	78	nucleotide	nucleotide	ADJ
ahs-12347	16	79	polymorphisms	polymorphism	NOUN
ahs-12347	16	80	of	of	ADP
ahs-12347	16	81	nrits	nrit	NOUN
ahs-12347	16	82	and	and	CCONJ
ahs-12347	16	83	chloroplast	chloroplast	ADJ
ahs-12347	16	84	interspacer	interspacer	NOUN
ahs-12347	16	85	region	region	NOUN
ahs-12347	16	86	.	.	PUNCT
ahs-12347	17	1	­	­	AUX
ahs-12347	17	2	adv	adv	PROPN
ahs-12347	17	3	.	.	PUNCT
ahs-12347	17	4	hort	hort	PROPN
ahs-12347	17	5	.	.	PUNCT
ahs-12347	18	1	sci	sci	PROPN
ahs-12347	18	2	.	.	PROPN
ahs-12347	18	3	,	,	PUNCT
ahs-12347	18	4	36(3	36(3	NUM
ahs-12347	18	5	):	):	PUNCT
ahs-12347	18	6	247­251	247­251	NUM
ahs-12347	18	7	copyright	copyright	NOUN
ahs-12347	18	8	:	:	PUNCT
ahs-12347	18	9	©	©	PROPN
ahs-12347	18	10	2022	2022	NUM
ahs-12347	18	11	park	park	NOUN
ahs-12347	18	12	s.y	s.y	PROPN
ahs-12347	18	13	.	.	PROPN
ahs-12347	18	14	,	,	PUNCT
ahs-12347	18	15	joung	joung	PROPN
ahs-12347	18	16	y.h	y.h	PROPN
ahs-12347	18	17	.	.	PROPN
ahs-12347	18	18	,	,	PUNCT
ahs-12347	18	19	suh	suh	PROPN
ahs-12347	18	20	j.k	j.k	PROPN
ahs-12347	18	21	.	.	PROPN
ahs-12347	18	22	,	,	PUNCT
ahs-12347	18	23	roh	roh	PROPN
ahs-12347	18	24	m.s	m.s	PROPN
ahs-12347	18	25	.	.	PUNCT
ahs-12347	19	1	this	this	PRON
ahs-12347	19	2	is	be	AUX
ahs-12347	19	3	an	an	DET
ahs-12347	19	4	open	open	ADJ
ahs-12347	19	5	access	access	NOUN
ahs-12347	19	6	,	,	PUNCT
ahs-12347	19	7	peer	peer	NOUN
ahs-12347	19	8	reviewed	review	VERB
ahs-12347	19	9	article	article	NOUN
ahs-12347	19	10	published	publish	VERB
ahs-12347	19	11	by	by	ADP
ahs-12347	19	12	firenze	firenze	PROPN
ahs-12347	19	13	university	university	PROPN
ahs-12347	19	14	press	press	NOUN
ahs-12347	19	15	(	(	PUNCT
ahs-12347	19	16	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-12347	19	17	)	)	PUNCT
ahs-12347	19	18	and	and	CCONJ
ahs-12347	19	19	distributed	distribute	VERB
ahs-12347	19	20	under	under	ADP
ahs-12347	19	21	the	the	DET
ahs-12347	19	22	terms	term	NOUN
ahs-12347	19	23	of	of	ADP
ahs-12347	19	24	the	the	DET
ahs-12347	19	25	creative	creative	ADJ
ahs-12347	19	26	commons	common	NOUN
ahs-12347	19	27	attribution	attribution	NOUN
ahs-12347	19	28	license	license	NOUN
ahs-12347	19	29	,	,	PUNCT
ahs-12347	19	30	which	which	PRON
ahs-12347	19	31	permits	permit	VERB
ahs-12347	19	32	unrestricted	unrestricted	ADJ
ahs-12347	19	33	use	use	NOUN
ahs-12347	19	34	,	,	PUNCT
ahs-12347	19	35	distribution	distribution	NOUN
ahs-12347	19	36	,	,	PUNCT
ahs-12347	19	37	and	and	CCONJ
ahs-12347	19	38	reproduction	reproduction	NOUN
ahs-12347	19	39	in	in	ADP
ahs-12347	19	40	any	any	DET
ahs-12347	19	41	medium	medium	NOUN
ahs-12347	19	42	,	,	PUNCT
ahs-12347	19	43	provided	provide	VERB
ahs-12347	19	44	the	the	DET
ahs-12347	19	45	original	original	ADJ
ahs-12347	19	46	author	author	NOUN
ahs-12347	19	47	and	and	CCONJ
ahs-12347	19	48	source	source	NOUN
ahs-12347	19	49	are	be	AUX
ahs-12347	19	50	credited	credit	VERB
ahs-12347	19	51	.	.	PUNCT
ahs-12347	20	1	data	datum	NOUN
ahs-12347	20	2	availability	availability	NOUN
ahs-12347	20	3	statement	statement	NOUN
ahs-12347	20	4	:	:	PUNCT
ahs-12347	20	5	all	all	DET
ahs-12347	20	6	relevant	relevant	ADJ
ahs-12347	20	7	data	datum	NOUN
ahs-12347	20	8	are	be	AUX
ahs-12347	20	9	within	within	ADP
ahs-12347	20	10	the	the	DET
ahs-12347	20	11	paper	paper	NOUN
ahs-12347	20	12	and	and	CCONJ
ahs-12347	20	13	its	its	PRON
ahs-12347	20	14	supporting	support	VERB
ahs-12347	20	15	information	information	NOUN
ahs-12347	20	16	files	file	NOUN
ahs-12347	20	17	.	.	PUNCT
ahs-12347	21	1	competing	compete	VERB
ahs-12347	21	2	interests	interest	NOUN
ahs-12347	21	3	:	:	PUNCT
ahs-12347	21	4	the	the	DET
ahs-12347	21	5	authors	author	NOUN
ahs-12347	21	6	declare	declare	VERB
ahs-12347	21	7	no	no	DET
ahs-12347	21	8	competing	compete	VERB
ahs-12347	21	9	interests	interest	NOUN
ahs-12347	21	10	.	.	PUNCT
ahs-12347	22	1	received	receive	VERB
ahs-12347	22	2	for	for	ADP
ahs-12347	22	3	publication	publication	NOUN
ahs-12347	22	4	24	24	NUM
ahs-12347	22	5	november	november	PROPN
ahs-12347	22	6	2021	2021	NUM
ahs-12347	22	7	accepted	accept	VERB
ahs-12347	22	8	for	for	ADP
ahs-12347	22	9	publication	publication	NOUN
ahs-12347	22	10	31	31	NUM
ahs-12347	22	11	august	august	PROPN
ahs-12347	22	12	2022	2022	NUM
ahs-12347	22	13	ahs	ahs	NOUN
ahs-12347	22	14	advances	advance	NOUN
ahs-12347	22	15	in	in	ADP
ahs-12347	22	16	horticultural	horticultural	ADJ
ahs-12347	22	17	science	science	NOUN
ahs-12347	22	18	short	short	ADJ
ahs-12347	22	19	note	note	PROPN
ahs-12347	22	20	https://doi.org/10.36253/ahsc-12347	https://doi.org/10.36253/ahsc-12347	PROPN
ahs-12347	22	21	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-12347	22	22	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-12347	22	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-12347	22	24	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-12347	22	25	adv	adv	PROPN
ahs-12347	22	26	.	.	PUNCT
ahs-12347	22	27	hort	hort	PROPN
ahs-12347	22	28	.	.	PUNCT
ahs-12347	23	1	sci	sci	PROPN
ahs-12347	23	2	.	.	PROPN
ahs-12347	23	3	,	,	PUNCT
ahs-12347	23	4	2022	2022	NUM
ahs-12347	23	5	36(3	36(3	NUM
ahs-12347	23	6	):	):	PUNCT
ahs-12347	23	7	247­251	247­251	NUM
ahs-12347	23	8	248	248	NUM
ahs-12347	23	9	ered	ere	VERB
ahs-12347	23	10	in	in	ADP
ahs-12347	23	11	the	the	DET
ahs-12347	23	12	afternoon	afternoon	NOUN
ahs-12347	23	13	.	.	PUNCT
ahs-12347	24	1	molecular	molecular	ADJ
ahs-12347	24	2	markers	marker	NOUN
ahs-12347	24	3	have	have	AUX
ahs-12347	24	4	not	not	PART
ahs-12347	24	5	previously	previously	ADV
ahs-12347	24	6	been	be	AUX
ahs-12347	24	7	test­	test­	VERB
ahs-12347	24	8	ed	ed	NOUN
ahs-12347	24	9	to	to	PART
ahs-12347	24	10	determine	determine	VERB
ahs-12347	24	11	timing	timing	NOUN
ahs-12347	24	12	of	of	ADP
ahs-12347	24	13	flowering	flower	VERB
ahs-12347	24	14	among	among	ADP
ahs-12347	24	15	hemerocallis	hemerocalli	NOUN
ahs-12347	24	16	species	specie	NOUN
ahs-12347	24	17	.	.	PUNCT
ahs-12347	25	1	therefore	therefore	ADV
ahs-12347	25	2	,	,	PUNCT
ahs-12347	25	3	this	this	DET
ahs-12347	25	4	study	study	NOUN
ahs-12347	25	5	was	be	AUX
ahs-12347	25	6	con­	con­	NOUN
ahs-12347	25	7	ducted	ducte	VERB
ahs-12347	25	8	to	to	PART
ahs-12347	25	9	investigate	investigate	VERB
ahs-12347	25	10	the	the	DET
ahs-12347	25	11	use	use	NOUN
ahs-12347	25	12	of	of	ADP
ahs-12347	25	13	snps	snps	PROPN
ahs-12347	25	14	of	of	ADP
ahs-12347	25	15	nuclear	nuclear	ADJ
ahs-12347	25	16	internal	internal	ADJ
ahs-12347	25	17	transcribed	transcribe	VERB
ahs-12347	25	18	spacers	spacer	NOUN
ahs-12347	25	19	1	1	NUM
ahs-12347	25	20	,	,	PUNCT
ahs-12347	25	21	2	2	NUM
ahs-12347	25	22	in	in	ADP
ahs-12347	25	23	a	a	DET
ahs-12347	25	24	ribosomal	ribosomal	NOUN
ahs-12347	25	25	rna	rna	NOUN
ahs-12347	25	26	gene	gene	NOUN
ahs-12347	25	27	(	(	PUNCT
ahs-12347	25	28	nrits	nrit	NOUN
ahs-12347	25	29	)	)	PUNCT
ahs-12347	25	30	and	and	CCONJ
ahs-12347	25	31	a	a	DET
ahs-12347	25	32	chloroplast	chloroplast	NOUN
ahs-12347	25	33	interspacer	interspacer	NOUN
ahs-12347	25	34	region	region	NOUN
ahs-12347	25	35	(	(	PUNCT
ahs-12347	25	36	cpis	cpis	PROPN
ahs-12347	25	37	)	)	PUNCT
ahs-12347	25	38	to	to	PART
ahs-12347	25	39	evaluate	evaluate	VERB
ahs-12347	25	40	the	the	DET
ahs-12347	25	41	genetic	genetic	ADJ
ahs-12347	25	42	relationships	relationship	NOUN
ahs-12347	25	43	between	between	ADP
ahs-12347	25	44	nocturnal	nocturnal	ADJ
ahs-12347	25	45	and	and	CCONJ
ahs-12347	25	46	day	day	NOUN
ahs-12347	25	47	flowering	flower	VERB
ahs-12347	25	48	species	specie	NOUN
ahs-12347	25	49	of	of	ADP
ahs-12347	25	50	hemerocallis	hemerocalli	NOUN
ahs-12347	25	51	.	.	PUNCT
ahs-12347	26	1	2	2	X
ahs-12347	26	2	.	.	X
ahs-12347	26	3	materials	material	NOUN
ahs-12347	26	4	and	and	CCONJ
ahs-12347	26	5	methods	method	NOUN
ahs-12347	26	6	the	the	DET
ahs-12347	26	7	nocturnal	nocturnal	ADJ
ahs-12347	26	8	flowering	flower	VERB
ahs-12347	26	9	species	specie	NOUN
ahs-12347	26	10	hemerocallis	hemerocalli	NOUN
ahs-12347	26	11	thunbergii	thunbergii	NOUN
ahs-12347	26	12	,	,	PUNCT
ahs-12347	26	13	h.	h.	PROPN
ahs-12347	26	14	minor	minor	PROPN
ahs-12347	26	15	,	,	PUNCT
ahs-12347	26	16	h.	h.	PROPN
ahs-12347	26	17	lilioasphodelus	lilioasphodelus	PROPN
ahs-12347	26	18	,	,	PUNCT
ahs-12347	26	19	and	and	CCONJ
ahs-12347	26	20	h.	h.	PROPN
ahs-12347	26	21	citri‐	citri‐	PROPN
ahs-12347	27	1	na	na	PROPN
ahs-12347	27	2	,	,	PUNCT
ahs-12347	27	3	and	and	CCONJ
ahs-12347	27	4	the	the	DET
ahs-12347	27	5	day	day	NOUN
ahs-12347	27	6	flowering	flower	VERB
ahs-12347	27	7	species	specie	NOUN
ahs-12347	27	8	h.	h.	PROPN
ahs-12347	27	9	hongdoensis	hongdoensis	PROPN
ahs-12347	27	10	m.g	m.g	PROPN
ahs-12347	27	11	.	.	PROPN
ahs-12347	27	12	chung	chung	PROPN
ahs-12347	27	13	&	&	CCONJ
ahs-12347	27	14	s.s	s.s	PROPN
ahs-12347	27	15	.	.	PROPN
ahs-12347	27	16	kang	kang	PROPN
ahs-12347	27	17	,	,	PUNCT
ahs-12347	27	18	h.	h.	PROPN
ahs-12347	27	19	vespertina	vespertina	PROPN
ahs-12347	27	20	h.	h.	PROPN
ahs-12347	27	21	hara	hara	PROPN
ahs-12347	27	22	,	,	PUNCT
ahs-12347	27	23	h.	h.	PROPN
ahs-12347	27	24	dumortierii	dumortierii	PROPN
ahs-12347	27	25	c.	c.	PROPN
ahs-12347	27	26	morren	morren	PROPN
ahs-12347	27	27	and	and	CCONJ
ahs-12347	27	28	hybrid	hybrid	NOUN
ahs-12347	27	29	‘	'	PUNCT
ahs-12347	27	30	stella	stella	X
ahs-12347	27	31	de	de	X
ahs-12347	27	32	oro	oro	X
ahs-12347	27	33	’	'	PUNCT
ahs-12347	27	34	were	be	AUX
ahs-12347	27	35	collected	collect	VERB
ahs-12347	27	36	from	from	ADP
ahs-12347	27	37	korea	korea	PROPN
ahs-12347	27	38	(	(	PUNCT
ahs-12347	27	39	k	k	PROPN
ahs-12347	27	40	)	)	PUNCT
ahs-12347	27	41	,	,	PUNCT
ahs-12347	27	42	china	china	PROPN
ahs-12347	27	43	(	(	PUNCT
ahs-12347	27	44	c	c	NOUN
ahs-12347	27	45	)	)	PUNCT
ahs-12347	27	46	,	,	PUNCT
ahs-12347	27	47	united	united	ADJ
ahs-12347	27	48	kingdom	kingdom	PROPN
ahs-12347	27	49	(	(	PUNCT
ahs-12347	27	50	uk	uk	PROPN
ahs-12347	27	51	)	)	PUNCT
ahs-12347	27	52	,	,	PUNCT
ahs-12347	27	53	united	united	PROPN
ahs-12347	27	54	states	states	PROPN
ahs-12347	27	55	of	of	ADP
ahs-12347	27	56	america	america	PROPN
ahs-12347	27	57	(	(	PUNCT
ahs-12347	27	58	ua	ua	PROPN
ahs-12347	27	59	)	)	PUNCT
ahs-12347	27	60	and	and	CCONJ
ahs-12347	27	61	germany	germany	PROPN
ahs-12347	27	62	(	(	PUNCT
ahs-12347	27	63	ge	ge	PROPN
ahs-12347	27	64	)	)	PUNCT
ahs-12347	27	65	(	(	PUNCT
ahs-12347	27	66	table	table	NOUN
ahs-12347	27	67	1	1	NUM
ahs-12347	27	68	)	)	PUNCT
ahs-12347	27	69	.	.	PUNCT
ahs-12347	28	1	samples	sample	NOUN
ahs-12347	28	2	were	be	AUX
ahs-12347	28	3	designated	designate	VERB
ahs-12347	28	4	as	as	ADP
ahs-12347	28	5	,	,	PUNCT
ahs-12347	28	6	for	for	ADP
ahs-12347	28	7	example	example	NOUN
ahs-12347	28	8	,	,	PUNCT
ahs-12347	28	9	k1	k1	NOUN
ahs-12347	28	10	(	(	PUNCT
ahs-12347	28	11	mother	mother	NOUN
ahs-12347	28	12	plant)/1­3	plant)/1­3	PROPN
ahs-12347	28	13	(	(	PUNCT
ahs-12347	28	14	seedling	seedle	VERB
ahs-12347	28	15	1	1	NUM
ahs-12347	28	16	,	,	PUNCT
ahs-12347	28	17	2	2	NUM
ahs-12347	28	18	,	,	PUNCT
ahs-12347	28	19	3	3	NUM
ahs-12347	28	20	from	from	ADP
ahs-12347	28	21	mother	mother	NOUN
ahs-12347	28	22	plant	plant	NOUN
ahs-12347	28	23	k1	k1	PROPN
ahs-12347	28	24	)	)	PUNCT
ahs-12347	28	25	.	.	PUNCT
ahs-12347	29	1	genomic	genomic	PROPN
ahs-12347	29	2	dna	dna	PROPN
ahs-12347	29	3	was	be	AUX
ahs-12347	29	4	isolated	isolate	VERB
ahs-12347	29	5	from	from	ADP
ahs-12347	29	6	young	young	ADJ
ahs-12347	29	7	leaves	leave	NOUN
ahs-12347	29	8	using	use	VERB
ahs-12347	29	9	dneasy	dneasy	NOUN
ahs-12347	29	10	plant	plant	NOUN
ahs-12347	29	11	mini	mini	NOUN
ahs-12347	29	12	kit	kit	NOUN
ahs-12347	29	13	(	(	PUNCT
ahs-12347	29	14	qiagen	qiagen	PROPN
ahs-12347	29	15	inc	inc	PROPN
ahs-12347	29	16	.	.	PROPN
ahs-12347	29	17	,	,	PUNCT
ahs-12347	29	18	valencia	valencia	PROPN
ahs-12347	29	19	,	,	PUNCT
ahs-12347	29	20	ca	ca	NOUN
ahs-12347	29	21	)	)	PUNCT
ahs-12347	29	22	.	.	PUNCT
ahs-12347	30	1	polymerase	polymerase	NOUN
ahs-12347	30	2	chain	chain	NOUN
ahs-12347	30	3	reaction	reaction	NOUN
ahs-12347	30	4	(	(	PUNCT
ahs-12347	30	5	pcr	pcr	PROPN
ahs-12347	30	6	)	)	PUNCT
ahs-12347	30	7	for	for	ADP
ahs-12347	30	8	nrits	nrit	NOUN
ahs-12347	30	9	was	be	AUX
ahs-12347	30	10	performed	perform	VERB
ahs-12347	30	11	with	with	ADP
ahs-12347	30	12	a	a	DET
ahs-12347	30	13	18s	18s	NUM
ahs-12347	30	14	rrna	rrna	PROPN
ahs-12347	30	15	gene	gene	NOUN
ahs-12347	30	16	specific	specific	PROPN
ahs-12347	30	17	forward	forward	ADJ
ahs-12347	30	18	primer	primer	NOUN
ahs-12347	30	19	its1	its1	PROPN
ahs-12347	30	20	(	(	PUNCT
ahs-12347	30	21	5’­tag	5’­tag	NUM
ahs-12347	30	22	agg	agg	PROPN
ahs-12347	30	23	aag	aag	PROPN
ahs-12347	30	24	gag	gag	PROPN
ahs-12347	30	25	aag	aag	PROPN
ahs-12347	30	26	tcg	tcg	PROPN
ahs-12347	30	27	taa	taa	PROPN
ahs-12347	30	28	caa	caa	PROPN
ahs-12347	30	29	gg­3	gg­3	PROPN
ahs-12347	30	30	’	'	PUNCT
ahs-12347	30	31	)	)	PUNCT
ahs-12347	30	32	and	and	CCONJ
ahs-12347	30	33	primer	primer	NOUN
ahs-12347	30	34	its2	its2	NOUN
ahs-12347	30	35	(	(	PUNCT
ahs-12347	30	36	5’­	5’­	NUM
ahs-12347	30	37	gattttcagtcctctgctc­	gattttcagtcctctgctc­	PROPN
ahs-12347	30	38	tac­3	tac­3	NOUN
ahs-12347	30	39	’	'	PUNCT
ahs-12347	30	40	)	)	PUNCT
ahs-12347	30	41	.	.	PUNCT
ahs-12347	31	1	the	the	DET
ahs-12347	31	2	reaction	reaction	NOUN
ahs-12347	31	3	mix	mix	NOUN
ahs-12347	31	4	consisted	consist	VERB
ahs-12347	31	5	of	of	ADP
ahs-12347	31	6	12.5	12.5	NUM
ahs-12347	31	7	μl	μl	ADP
ahs-12347	31	8	of	of	ADP
ahs-12347	31	9	2x	2x	NUM
ahs-12347	31	10	f­	f­	PROPN
ahs-12347	31	11	star	star	PROPN
ahs-12347	31	12	taq	taq	PROPN
ahs-12347	31	13	smartmix	smartmix	PROPN
ahs-12347	31	14	(	(	PUNCT
ahs-12347	31	15	solgent	solgent	PROPN
ahs-12347	31	16	co.	co.	PROPN
ahs-12347	31	17	,	,	PUNCT
ahs-12347	31	18	daejeon	daejeon	PROPN
ahs-12347	31	19	,	,	PUNCT
ahs-12347	31	20	korea	korea	PROPN
ahs-12347	31	21	)	)	PUNCT
ahs-12347	31	22	,	,	PUNCT
ahs-12347	31	23	2	2	NUM
ahs-12347	31	24	μl	μl	ADP
ahs-12347	31	25	of	of	ADP
ahs-12347	31	26	each	each	DET
ahs-12347	31	27	primer	primer	NOUN
ahs-12347	31	28	(	(	PUNCT
ahs-12347	31	29	0.4	0.4	NUM
ahs-12347	31	30	μm	μm	NUM
ahs-12347	31	31	final	final	ADJ
ahs-12347	31	32	concentration	concentration	NOUN
ahs-12347	31	33	)	)	PUNCT
ahs-12347	31	34	,	,	PUNCT
ahs-12347	31	35	and	and	CCONJ
ahs-12347	31	36	2	2	NUM
ahs-12347	31	37	μl	μl	NOUN
ahs-12347	31	38	of	of	ADP
ahs-12347	31	39	genomic	genomic	ADJ
ahs-12347	31	40	dna	dna	NOUN
ahs-12347	31	41	.	.	PUNCT
ahs-12347	32	1	for	for	ADP
ahs-12347	32	2	cpis	cpis	NOUN
ahs-12347	32	3	,	,	PUNCT
ahs-12347	32	4	forward	forward	ADV
ahs-12347	32	5	primer	primer	NOUN
ahs-12347	32	6	(	(	PUNCT
ahs-12347	32	7	5	5	NUM
ahs-12347	32	8	’	'	PUNCT
ahs-12347	32	9	­tcgt­	­tcgt­	PUNCT
ahs-12347	32	10	gagggttcaagtccctct­3	gagggttcaagtccctct­3	NOUN
ahs-12347	32	11	’	'	PUNCT
ahs-12347	32	12	)	)	PUNCT
ahs-12347	32	13	and	and	CCONJ
ahs-12347	32	14	reverse	reverse	ADJ
ahs-12347	32	15	primer	primer	NOUN
ahs-12347	32	16	(	(	PUNCT
ahs-12347	32	17	5’­	5’­	NUM
ahs-12347	32	18	gattttcagtcctctgctctac­3	gattttcagtcctctgctctac­3	NOUN
ahs-12347	32	19	’	'	PUNCT
ahs-12347	32	20	)	)	PUNCT
ahs-12347	32	21	were	be	AUX
ahs-12347	32	22	used	use	VERB
ahs-12347	32	23	.	.	PUNCT
ahs-12347	33	1	the	the	DET
ahs-12347	33	2	reaction	reaction	NOUN
ahs-12347	33	3	mix	mix	NOUN
ahs-12347	33	4	consisted	consist	VERB
ahs-12347	33	5	of	of	ADP
ahs-12347	33	6	12.5	12.5	NUM
ahs-12347	33	7	μl	μl	ADP
ahs-12347	33	8	of	of	ADP
ahs-12347	33	9	2x	2x	NUM
ahs-12347	33	10	f­star	f­star	NOUN
ahs-12347	33	11	taq	taq	NOUN
ahs-12347	33	12	smartmix	smartmix	NOUN
ahs-12347	33	13	(	(	PUNCT
ahs-12347	33	14	solgent	solgent	PROPN
ahs-12347	33	15	co.	co.	PROPN
ahs-12347	33	16	,	,	PUNCT
ahs-12347	33	17	korea	korea	PROPN
ahs-12347	33	18	)	)	PUNCT
ahs-12347	33	19	,	,	PUNCT
ahs-12347	33	20	2	2	NUM
ahs-12347	33	21	μl	μl	ADP
ahs-12347	33	22	of	of	ADP
ahs-12347	33	23	each	each	DET
ahs-12347	33	24	primer	primer	NOUN
ahs-12347	33	25	(	(	PUNCT
ahs-12347	33	26	0.4	0.4	NUM
ahs-12347	33	27	μm	μm	NUM
ahs-12347	33	28	final	final	ADJ
ahs-12347	33	29	concentration	concentration	NOUN
ahs-12347	33	30	)	)	PUNCT
ahs-12347	33	31	,	,	PUNCT
ahs-12347	33	32	and	and	CCONJ
ahs-12347	33	33	2	2	NUM
ahs-12347	33	34	μl	μl	NOUN
ahs-12347	33	35	of	of	ADP
ahs-12347	33	36	genomic	genomic	ADJ
ahs-12347	33	37	dna	dna	NOUN
ahs-12347	33	38	(	(	PUNCT
ahs-12347	33	39	50	50	NUM
ahs-12347	33	40	ng	ng	NOUN
ahs-12347	33	41	)	)	PUNCT
ahs-12347	33	42	and	and	CCONJ
ahs-12347	33	43	5	5	NUM
ahs-12347	33	44	μl	μl	NOUN
ahs-12347	33	45	of	of	ADP
ahs-12347	33	46	5×	5×	NUM
ahs-12347	33	47	band	band	NOUN
ahs-12347	33	48	doctor	doctor	NOUN
ahs-12347	33	49	buffer	buffer	NOUN
ahs-12347	33	50	(	(	PUNCT
ahs-12347	33	51	solgent	solgent	NOUN
ahs-12347	33	52	)	)	PUNCT
ahs-12347	33	53	,	,	PUNCT
ahs-12347	33	54	and	and	CCONJ
ahs-12347	33	55	made	make	VERB
ahs-12347	33	56	up	up	ADP
ahs-12347	33	57	to	to	ADP
ahs-12347	33	58	the	the	DET
ahs-12347	33	59	25	25	NUM
ahs-12347	33	60	μl	μl	ADP
ahs-12347	33	61	final	final	ADJ
ahs-12347	33	62	vol­	vol­	NOUN
ahs-12347	33	63	ume	ume	NOUN
ahs-12347	33	64	with	with	ADP
ahs-12347	33	65	pcr	pcr	ADJ
ahs-12347	33	66	ultrapure	ultrapure	NOUN
ahs-12347	33	67	water	water	NOUN
ahs-12347	33	68	.	.	PUNCT
ahs-12347	34	1	the	the	DET
ahs-12347	34	2	pcr	pcr	PROPN
ahs-12347	34	3	conditions	condition	NOUN
ahs-12347	34	4	were	be	AUX
ahs-12347	34	5	:	:	PUNCT
ahs-12347	34	6	2	2	NUM
ahs-12347	34	7	min	min	NOUN
ahs-12347	34	8	at	at	ADP
ahs-12347	34	9	95	95	NUM
ahs-12347	34	10	°	°	NOUN
ahs-12347	34	11	c	c	NOUN
ahs-12347	34	12	,	,	PUNCT
ahs-12347	34	13	followed	follow	VERB
ahs-12347	34	14	by	by	ADP
ahs-12347	34	15	35	35	NUM
ahs-12347	34	16	cycles	cycle	NOUN
ahs-12347	34	17	of	of	ADP
ahs-12347	34	18	20	20	NUM
ahs-12347	34	19	sec	sec	PROPN
ahs-12347	34	20	at	at	ADP
ahs-12347	34	21	95	95	NUM
ahs-12347	34	22	°	°	NOUN
ahs-12347	34	23	c	c	NOUN
ahs-12347	34	24	,	,	PUNCT
ahs-12347	34	25	40	40	NUM
ahs-12347	34	26	sec	sec	PROPN
ahs-12347	34	27	at	at	ADP
ahs-12347	34	28	65	65	NUM
ahs-12347	34	29	°	°	NOUN
ahs-12347	34	30	c	c	NOUN
ahs-12347	34	31	,	,	PUNCT
ahs-12347	34	32	and	and	CCONJ
ahs-12347	34	33	1	1	NUM
ahs-12347	34	34	min	min	NOUN
ahs-12347	34	35	at	at	ADP
ahs-12347	34	36	72	72	NUM
ahs-12347	34	37	°	°	NOUN
ahs-12347	34	38	c	c	NOUN
ahs-12347	34	39	,	,	PUNCT
ahs-12347	34	40	followed	follow	VERB
ahs-12347	34	41	by	by	ADP
ahs-12347	34	42	5	5	NUM
ahs-12347	34	43	min	min	NOUN
ahs-12347	34	44	of	of	ADP
ahs-12347	34	45	72	72	NUM
ahs-12347	34	46	°	°	ADP
ahs-12347	34	47	c	c	NOUN
ahs-12347	34	48	using	use	VERB
ahs-12347	34	49	an	an	DET
ahs-12347	34	50	abi	abi	PROPN
ahs-12347	34	51	veriti	veriti	PROPN
ahs-12347	34	52	dx	dx	PROPN
ahs-12347	34	53	thermal	thermal	PROPN
ahs-12347	34	54	cycler	cycler	PROPN
ahs-12347	34	55	(	(	PUNCT
ahs-12347	34	56	life	life	NOUN
ahs-12347	34	57	technologies	technology	NOUN
ahs-12347	34	58	,	,	PUNCT
ahs-12347	34	59	grand	grand	ADJ
ahs-12347	34	60	island	island	NOUN
ahs-12347	34	61	,	,	PUNCT
ahs-12347	34	62	ny	ny	PROPN
ahs-12347	34	63	,	,	PUNCT
ahs-12347	34	64	usa	usa	PROPN
ahs-12347	34	65	)	)	PUNCT
ahs-12347	34	66	.	.	PUNCT
ahs-12347	35	1	pcr	pcr	ADJ
ahs-12347	35	2	products	product	NOUN
ahs-12347	35	3	were	be	AUX
ahs-12347	35	4	direct	direct	ADJ
ahs-12347	35	5	sequenced	sequence	VERB
ahs-12347	35	6	as	as	SCONJ
ahs-12347	35	7	described	describe	VERB
ahs-12347	35	8	by	by	ADP
ahs-12347	35	9	park	park	NOUN
ahs-12347	35	10	et	et	PROPN
ahs-12347	35	11	al	al	PROPN
ahs-12347	35	12	.	.	PROPN
ahs-12347	36	1	(	(	PUNCT
ahs-12347	36	2	2014	2014	NUM
ahs-12347	36	3	)	)	PUNCT
ahs-12347	36	4	.	.	PUNCT
ahs-12347	37	1	sequences	sequence	NOUN
ahs-12347	37	2	were	be	AUX
ahs-12347	37	3	registered	register	VERB
ahs-12347	37	4	in	in	ADP
ahs-12347	37	5	the	the	DET
ahs-12347	37	6	national	national	ADJ
ahs-12347	37	7	center	center	NOUN
ahs-12347	37	8	for	for	ADP
ahs-12347	37	9	biotechnology	biotechnology	NOUN
ahs-12347	37	10	information	information	NOUN
ahs-12347	37	11	genbank	genbank	PROPN
ahs-12347	37	12	(	(	PUNCT
ahs-12347	37	13	ncbi	ncbi	PROPN
ahs-12347	37	14	,	,	PUNCT
ahs-12347	37	15	http://www.ncbi.nlm.nih.gov/	http://www.ncbi.nlm.nih.gov/	NOUN
ahs-12347	37	16	)	)	PUNCT
ahs-12347	37	17	.	.	PUNCT
ahs-12347	38	1	3	3	X
ahs-12347	38	2	.	.	NOUN
ahs-12347	38	3	results	result	NOUN
ahs-12347	38	4	and	and	CCONJ
ahs-12347	38	5	discussion	discussion	NOUN
ahs-12347	38	6	based	base	VERB
ahs-12347	38	7	on	on	ADP
ahs-12347	38	8	the	the	DET
ahs-12347	38	9	sequences	sequence	NOUN
ahs-12347	38	10	of	of	ADP
ahs-12347	38	11	nrits	nrit	NOUN
ahs-12347	38	12	,	,	PUNCT
ahs-12347	38	13	three	three	NUM
ahs-12347	38	14	haplo­	haplo­	ADJ
ahs-12347	38	15	types	type	NOUN
ahs-12347	38	16	were	be	AUX
ahs-12347	38	17	identified	identify	VERB
ahs-12347	38	18	:	:	PUNCT
ahs-12347	38	19	t	t	PROPN
ahs-12347	38	20	i­1	i­1	PROPN
ahs-12347	38	21	,	,	PUNCT
ahs-12347	38	22	t	t	PROPN
ahs-12347	38	23	i­2	i­2	PROPN
ahs-12347	38	24	,	,	PUNCT
ahs-12347	38	25	and	and	CCONJ
ahs-12347	38	26	t	t	PROPN
ahs-12347	38	27	ii	ii	PROPN
ahs-12347	38	28	(	(	PUNCT
ahs-12347	38	29	table	table	NOUN
ahs-12347	38	30	2	2	NUM
ahs-12347	38	31	)	)	PUNCT
ahs-12347	38	32	and	and	CCONJ
ahs-12347	38	33	based	base	VERB
ahs-12347	38	34	on	on	ADP
ahs-12347	38	35	the	the	DET
ahs-12347	38	36	sequences	sequence	NOUN
ahs-12347	38	37	of	of	ADP
ahs-12347	38	38	cpis	cpis	NOUN
ahs-12347	38	39	,	,	PUNCT
ahs-12347	38	40	7	7	NUM
ahs-12347	38	41	haplotypes	haplotype	NOUN
ahs-12347	38	42	were	be	AUX
ahs-12347	38	43	identified	identify	VERB
ahs-12347	38	44	:	:	PUNCT
ahs-12347	39	1	t	t	PROPN
ahs-12347	39	2	i	i	PRON
ahs-12347	39	3	,	,	PUNCT
ahs-12347	39	4	ti­1	ti­1	PROPN
ahs-12347	39	5	,	,	PUNCT
ahs-12347	39	6	tii	tii	PROPN
ahs-12347	39	7	,	,	PUNCT
ahs-12347	39	8	tiii	tiii	PROPN
ahs-12347	39	9	,	,	PUNCT
ahs-12347	39	10	tiv	tiv	PROPN
ahs-12347	39	11	,	,	PUNCT
ahs-12347	39	12	tv	tv	NOUN
ahs-12347	39	13	,	,	PUNCT
ahs-12347	39	14	and	and	CCONJ
ahs-12347	39	15	tvi	tvi	NOUN
ahs-12347	39	16	(	(	PUNCT
ahs-12347	39	17	table	table	NOUN
ahs-12347	39	18	3	3	NUM
ahs-12347	39	19	)	)	PUNCT
ahs-12347	39	20	.	.	PUNCT
ahs-12347	40	1	sequences	sequence	NOUN
ahs-12347	40	2	of	of	ADP
ahs-12347	40	3	cpis	cpis	PROPN
ahs-12347	40	4	were	be	AUX
ahs-12347	40	5	more	more	ADV
ahs-12347	40	6	informative	informative	ADJ
ahs-12347	40	7	to	to	PART
ahs-12347	40	8	separate	separate	VERB
ahs-12347	40	9	accessions	accession	NOUN
ahs-12347	40	10	than	than	ADP
ahs-12347	40	11	those	those	PRON
ahs-12347	40	12	of	of	ADP
ahs-12347	40	13	nrits	nrit	NOUN
ahs-12347	40	14	,	,	PUNCT
ahs-12347	40	15	suggest­	suggest­	VERB
ahs-12347	40	16	ing	e	VERB
ahs-12347	40	17	that	that	SCONJ
ahs-12347	40	18	the	the	DET
ahs-12347	40	19	its	its	PRON
ahs-12347	40	20	region	region	NOUN
ahs-12347	40	21	in	in	ADP
ahs-12347	40	22	hemerocallis	hemerocalli	NOUN
ahs-12347	40	23	may	may	AUX
ahs-12347	40	24	not	not	PART
ahs-12347	40	25	be	be	AUX
ahs-12347	40	26	useful	useful	ADJ
ahs-12347	40	27	as	as	ADP
ahs-12347	40	28	a	a	DET
ahs-12347	40	29	potential	potential	ADJ
ahs-12347	40	30	source	source	NOUN
ahs-12347	40	31	for	for	ADP
ahs-12347	40	32	species	species	NOUN
ahs-12347	40	33	identification	identification	NOUN
ahs-12347	40	34	,	,	PUNCT
ahs-12347	40	35	although	although	SCONJ
ahs-12347	40	36	accessions	accession	NOUN
ahs-12347	40	37	of	of	ADP
ahs-12347	40	38	cultivated	cultivate	VERB
ahs-12347	40	39	origin	origin	NOUN
ahs-12347	40	40	kolkwitzia	kolkwitzia	PROPN
ahs-12347	40	41	amabilis	amabilis	PROPN
ahs-12347	40	42	(	(	PUNCT
ahs-12347	40	43	graebn	graebn	NOUN
ahs-12347	40	44	.	.	PUNCT
ahs-12347	40	45	)	)	PUNCT
ahs-12347	41	1	christenh	christenh	NOUN
ahs-12347	41	2	were	be	AUX
ahs-12347	41	3	derived	derive	VERB
ahs-12347	41	4	from	from	ADP
ahs-12347	41	5	the	the	DET
ahs-12347	41	6	accession	accession	NOUN
ahs-12347	41	7	of	of	ADP
ahs-12347	41	8	known	know	VERB
ahs-12347	41	9	wild	wild	ADJ
ahs-12347	41	10	origin	origin	NOUN
ahs-12347	41	11	(	(	PUNCT
ahs-12347	41	12	aa816­84a	aa816­84a	PROPN
ahs-12347	41	13	)	)	PUNCT
ahs-12347	41	14	(	(	PUNCT
ahs-12347	41	15	park	park	NOUN
ahs-12347	41	16	et	et	PROPN
ahs-12347	41	17	al	al	PROPN
ahs-12347	41	18	.	.	PROPN
ahs-12347	41	19	,	,	PUNCT
ahs-12347	41	20	2014	2014	NUM
ahs-12347	41	21	)	)	PUNCT
ahs-12347	41	22	.	.	PUNCT
ahs-12347	42	1	nocturnal	nocturnal	ADJ
ahs-12347	42	2	flowering	flowering	NOUN
ahs-12347	42	3	h.	h.	PROPN
ahs-12347	42	4	citrina	citrina	PROPN
ahs-12347	42	5	,	,	PUNCT
ahs-12347	42	6	h.	h.	PROPN
ahs-12347	42	7	thunbergii	thunbergii	NOUN
ahs-12347	42	8	and	and	CCONJ
ahs-12347	42	9	h.	h.	PROPN
ahs-12347	42	10	lilioasphodelus	lilioasphodelus	ADJ
ahs-12347	42	11	flower	flower	NOUN
ahs-12347	42	12	in	in	ADP
ahs-12347	42	13	the	the	DET
ahs-12347	42	14	afternoon	afternoon	NOUN
ahs-12347	42	15	and	and	CCONJ
ahs-12347	42	16	wither	wither	VERB
ahs-12347	42	17	the	the	DET
ahs-12347	42	18	following	following	ADJ
ahs-12347	42	19	morning	morning	NOUN
ahs-12347	42	20	(	(	PUNCT
ahs-12347	42	21	table	table	NOUN
ahs-12347	42	22	1	1	NUM
ahs-12347	42	23	,	,	PUNCT
ahs-12347	42	24	fig	fig	NOUN
ahs-12347	42	25	.	.	NOUN
ahs-12347	43	1	1	1	NUM
ahs-12347	43	2	)	)	PUNCT
ahs-12347	43	3	.	.	PUNCT
ahs-12347	44	1	the	the	DET
ahs-12347	44	2	difference	difference	NOUN
ahs-12347	44	3	between	between	ADP
ahs-12347	44	4	two	two	NUM
ahs-12347	44	5	types	type	NOUN
ahs-12347	44	6	of	of	ADP
ahs-12347	44	7	floral	floral	ADJ
ahs-12347	44	8	morphology	morphology	NOUN
ahs-12347	44	9	of	of	ADP
ahs-12347	44	10	h.	h.	PROPN
ahs-12347	44	11	thun‐	thun‐	PROPN
ahs-12347	44	12	bergii	bergii	NOUN
ahs-12347	44	13	,	,	PUNCT
ahs-12347	44	14	based	base	VERB
ahs-12347	44	15	on	on	ADP
ahs-12347	44	16	the	the	DET
ahs-12347	44	17	presence	presence	NOUN
ahs-12347	44	18	or	or	CCONJ
ahs-12347	44	19	absence	absence	NOUN
ahs-12347	44	20	of	of	ADP
ahs-12347	44	21	bracts	bract	NOUN
ahs-12347	44	22	subtending	subtend	VERB
ahs-12347	44	23	the	the	DET
ahs-12347	44	24	flower	flower	NOUN
ahs-12347	44	25	buds	bud	NOUN
ahs-12347	44	26	;	;	PUNCT
ahs-12347	44	27	k7	k7	PROPN
ahs-12347	44	28	lacked	lack	VERB
ahs-12347	44	29	bracts	bract	NOUN
ahs-12347	44	30	while	while	SCONJ
ahs-12347	44	31	k8­9	k8­9	PROPN
ahs-12347	44	32	had	have	VERB
ahs-12347	44	33	bracts	bract	NOUN
ahs-12347	44	34	was	be	AUX
ahs-12347	44	35	detected	detect	VERB
ahs-12347	44	36	in	in	ADP
ahs-12347	44	37	the	the	DET
ahs-12347	44	38	haplotype	haplotype	NOUN
ahs-12347	44	39	of	of	ADP
ahs-12347	44	40	cpis	cpis	NOUN
ahs-12347	44	41	,	,	PUNCT
ahs-12347	44	42	with	with	ADP
ahs-12347	44	43	k7	k7	PROPN
ahs-12347	44	44	belonging	belong	VERB
ahs-12347	44	45	to	to	ADP
ahs-12347	44	46	type	type	NOUN
ahs-12347	44	47	i­1	i­1	ADJ
ahs-12347	44	48	and	and	CCONJ
ahs-12347	44	49	k8­9	k8­9	VERB
ahs-12347	44	50	belong­	belong­	PROPN
ahs-12347	44	51	ing	ing	NOUN
ahs-12347	44	52	to	to	PART
ahs-12347	44	53	type	type	VERB
ahs-12347	44	54	i	i	PRON
ahs-12347	44	55	that	that	PRON
ahs-12347	44	56	may	may	AUX
ahs-12347	44	57	result	result	VERB
ahs-12347	44	58	from	from	ADP
ahs-12347	44	59	that	that	SCONJ
ahs-12347	44	60	the	the	DET
ahs-12347	44	61	sequence	sequence	NOUN
ahs-12347	44	62	of	of	ADP
ahs-12347	44	63	the	the	DET
ahs-12347	44	64	its	its	PRON
ahs-12347	44	65	2	2	NUM
ahs-12347	44	66	region	region	NOUN
ahs-12347	44	67	is	be	AUX
ahs-12347	44	68	more	more	ADV
ahs-12347	44	69	variable	variable	ADJ
ahs-12347	44	70	than	than	ADP
ahs-12347	44	71	that	that	PRON
ahs-12347	44	72	of	of	ADP
ahs-12347	44	73	the	the	DET
ahs-12347	44	74	its	its	PRON
ahs-12347	44	75	1	1	NUM
ahs-12347	44	76	region	region	NOUN
ahs-12347	44	77	(	(	PUNCT
ahs-12347	44	78	ma	ma	PROPN
ahs-12347	44	79	et	et	PROPN
ahs-12347	44	80	al	al	PROPN
ahs-12347	44	81	.	.	PROPN
ahs-12347	44	82	,	,	PUNCT
ahs-12347	44	83	2014	2014	NUM
ahs-12347	44	84	)	)	PUNCT
ahs-12347	44	85	.	.	PUNCT
ahs-12347	45	1	nocturnal	nocturnal	ADJ
ahs-12347	45	2	flowering	flower	VERB
ahs-12347	45	3	h.	h.	NOUN
ahs-12347	45	4	thunbergii	thunbergii	NOUN
ahs-12347	45	5	accessions	accession	NOUN
ahs-12347	45	6	collected	collect	VERB
ahs-12347	45	7	from	from	ADP
ahs-12347	45	8	the	the	DET
ahs-12347	45	9	same	same	ADJ
ahs-12347	45	10	loca­	loca­	ADJ
ahs-12347	45	11	tion	tion	NOUN
ahs-12347	45	12	in	in	ADP
ahs-12347	45	13	korea	korea	PROPN
ahs-12347	45	14	(	(	PUNCT
ahs-12347	45	15	k8­9	k8­9	PROPN
ahs-12347	45	16	,	,	PUNCT
ahs-12347	45	17	and	and	CCONJ
ahs-12347	45	18	k	k	PROPN
ahs-12347	45	19	8­13	8­13	NUM
ahs-12347	45	20	)	)	PUNCT
ahs-12347	45	21	should	should	AUX
ahs-12347	45	22	be	be	AUX
ahs-12347	45	23	evaluated	evaluate	VERB
ahs-12347	45	24	fig	fig	NOUN
ahs-12347	45	25	.	.	PUNCT
ahs-12347	46	1	1	1	NUM
ahs-12347	46	2	­	­	NUM
ahs-12347	46	3	nocturnal	nocturnal	ADJ
ahs-12347	46	4	h.	h.	NOUN
ahs-12347	46	5	thunbergii	thunbergii	NOUN
ahs-12347	46	6	accession	accession	NOUN
ahs-12347	46	7	7	7	NUM
ahs-12347	46	8	collected	collect	VERB
ahs-12347	46	9	from	from	ADP
ahs-12347	46	10	korea	korea	PROPN
ahs-12347	46	11	(	(	PUNCT
ahs-12347	46	12	k7	k7	PROPN
ahs-12347	46	13	)	)	PUNCT
ahs-12347	46	14	showing	show	VERB
ahs-12347	46	15	flower	flower	NOUN
ahs-12347	46	16	opening	opening	NOUN
ahs-12347	46	17	at	at	ADP
ahs-12347	46	18	4	4	NUM
ahs-12347	46	19	,	,	PUNCT
ahs-12347	46	20	5	5	NUM
ahs-12347	46	21	,	,	PUNCT
ahs-12347	46	22	and	and	CCONJ
ahs-12347	46	23	6	6	NUM
ahs-12347	46	24	pm	pm	NOUN
ahs-12347	46	25	and	and	CCONJ
ahs-12347	46	26	closed	close	VERB
ahs-12347	46	27	by	by	ADP
ahs-12347	46	28	10	10	NUM
ahs-12347	46	29	am	be	AUX
ahs-12347	46	30	following	follow	VERB
ahs-12347	46	31	day	day	NOUN
ahs-12347	46	32	.	.	PUNCT
ahs-12347	47	1	http://www.ncbi.nlm.nih.gov/	http://www.ncbi.nlm.nih.gov/	PROPN
ahs-12347	47	2	park	park	PROPN
ahs-12347	47	3	et	et	PROPN
ahs-12347	47	4	al	al	PROPN
ahs-12347	47	5	.	.	PROPN
ahs-12347	48	1	‐	‐	NOUN
ahs-12347	48	2	hemerocallis	hemerocallis	NOUN
ahs-12347	48	3	germplasm	germplasm	NOUN
ahs-12347	48	4	evaluation	evaluation	NOUN
ahs-12347	48	5	249	249	NUM
ahs-12347	48	6	further	far	ADV
ahs-12347	48	7	since	since	SCONJ
ahs-12347	48	8	these	these	DET
ahs-12347	48	9	accessions	accession	NOUN
ahs-12347	48	10	were	be	AUX
ahs-12347	48	11	grouped	group	VERB
ahs-12347	48	12	togeth­	togeth­	NOUN
ahs-12347	48	13	er	er	INTJ
ahs-12347	48	14	with	with	ADP
ahs-12347	48	15	other	other	ADJ
ahs-12347	48	16	h.	h.	PROPN
ahs-12347	48	17	thunbergii	thunbergii	PROPN
ahs-12347	48	18	accessions	accession	NOUN
ahs-12347	48	19	(	(	PUNCT
ahs-12347	48	20	k1­3	k1­3	PROPN
ahs-12347	48	21	)	)	PUNCT
ahs-12347	48	22	.	.	PUNCT
ahs-12347	49	1	there	there	PRON
ahs-12347	49	2	is	be	VERB
ahs-12347	49	3	no	no	DET
ahs-12347	49	4	correlation	correlation	NOUN
ahs-12347	49	5	between	between	ADP
ahs-12347	49	6	these	these	PRON
ahs-12347	49	7	nrits	nrit	VERB
ahs-12347	49	8	hap­	hap­	ADJ
ahs-12347	49	9	lotypes	lotype	NOUN
ahs-12347	49	10	and	and	CCONJ
ahs-12347	49	11	timing	timing	NOUN
ahs-12347	49	12	of	of	ADP
ahs-12347	49	13	flowering	flowering	NOUN
ahs-12347	49	14	observed	observe	VERB
ahs-12347	49	15	in	in	ADP
ahs-12347	49	16	h.	h.	PROPN
ahs-12347	49	17	citrina	citrina	PROPN
ahs-12347	49	18	;	;	PUNCT
ahs-12347	49	19	collected	collect	VERB
ahs-12347	49	20	from	from	ADP
ahs-12347	49	21	china	china	PROPN
ahs-12347	49	22	(	(	PUNCT
ahs-12347	49	23	c2	c2	PROPN
ahs-12347	49	24	)	)	PUNCT
ahs-12347	49	25	and	and	CCONJ
ahs-12347	49	26	the	the	DET
ahs-12347	49	27	united	united	ADJ
ahs-12347	49	28	kingdom	kingdom	PROPN
ahs-12347	49	29	(	(	PUNCT
ahs-12347	49	30	uk5	uk5	PROPN
ahs-12347	49	31	)	)	PUNCT
ahs-12347	49	32	,	,	PUNCT
ahs-12347	49	33	both	both	PRON
ahs-12347	49	34	belonging	belong	VERB
ahs-12347	49	35	to	to	AUX
ahs-12347	49	36	type	type	NOUN
ahs-12347	49	37	i	i	PRON
ahs-12347	49	38	,	,	PUNCT
ahs-12347	49	39	from	from	ADP
ahs-12347	49	40	germany	germany	PROPN
ahs-12347	49	41	(	(	PUNCT
ahs-12347	49	42	ge4	ge4	PROPN
ahs-12347	49	43	)	)	PUNCT
ahs-12347	49	44	,	,	PUNCT
ahs-12347	49	45	belonging	belong	VERB
ahs-12347	49	46	to	to	ADP
ahs-12347	49	47	type	type	NOUN
ahs-12347	49	48	ii	ii	PROPN
ahs-12347	49	49	,	,	PUNCT
ahs-12347	49	50	and	and	CCONJ
ahs-12347	49	51	from	from	ADP
ahs-12347	49	52	the	the	DET
ahs-12347	49	53	united	united	ADJ
ahs-12347	49	54	kingdom	kingdom	PROPN
ahs-12347	49	55	(	(	PUNCT
ahs-12347	49	56	uk1	uk1	PROPN
ahs-12347	49	57	)	)	PUNCT
ahs-12347	49	58	,	,	PUNCT
ahs-12347	49	59	belonging	belong	VERB
ahs-12347	49	60	to	to	ADP
ahs-12347	49	61	type	type	NOUN
ahs-12347	49	62	iii	iii	NOUN
ahs-12347	49	63	.	.	PUNCT
ahs-12347	50	1	this	this	PRON
ahs-12347	50	2	requires	require	VERB
ahs-12347	50	3	further	further	ADJ
ahs-12347	50	4	examination	examination	NOUN
ahs-12347	50	5	collecting	collect	VERB
ahs-12347	50	6	more	more	ADJ
ahs-12347	50	7	accessions	accession	NOUN
ahs-12347	50	8	from	from	ADP
ahs-12347	50	9	differ­	differ­	PROPN
ahs-12347	50	10	ent	ent	NOUN
ahs-12347	50	11	collection	collection	NOUN
ahs-12347	50	12	sites	site	NOUN
ahs-12347	50	13	.	.	PUNCT
ahs-12347	51	1	further	far	ADV
ahs-12347	51	2	,	,	PUNCT
ahs-12347	51	3	in	in	ADP
ahs-12347	51	4	cpis	cpis	NOUN
ahs-12347	51	5	,	,	PUNCT
ahs-12347	51	6	day	day	NOUN
ahs-12347	51	7	flowering	flower	VERB
ahs-12347	51	8	h.	h.	NOUN
ahs-12347	51	9	hongdoensis	hongdoensis	NOUN
ahs-12347	51	10	and	and	CCONJ
ahs-12347	51	11	h.	h.	PROPN
ahs-12347	51	12	vespertina	vespertina	PROPN
ahs-12347	51	13	belonged	belong	VERB
ahs-12347	51	14	to	to	PART
ahs-12347	51	15	type	type	VERB
ahs-12347	51	16	i	i	PROPN
ahs-12347	51	17	and	and	CCONJ
ahs-12347	51	18	ii	ii	PROPN
ahs-12347	51	19	,	,	PUNCT
ahs-12347	51	20	respectively	respectively	ADV
ahs-12347	51	21	.	.	PUNCT
ahs-12347	52	1	when	when	SCONJ
ahs-12347	52	2	t	t	PROPN
ahs-12347	52	3	was	be	AUX
ahs-12347	52	4	assigned	assign	VERB
ahs-12347	52	5	for	for	ADP
ahs-12347	52	6	the	the	DET
ahs-12347	52	7	ambiguous	ambiguous	ADJ
ahs-12347	52	8	code	code	NOUN
ahs-12347	52	9	c	c	PROPN
ahs-12347	52	10	or	or	CCONJ
ahs-12347	52	11	t	t	PROPN
ahs-12347	52	12	at	at	ADP
ahs-12347	52	13	the	the	DET
ahs-12347	52	14	positions	position	NOUN
ahs-12347	52	15	78	78	NUM
ahs-12347	52	16	,	,	PUNCT
ahs-12347	52	17	86	86	NUM
ahs-12347	52	18	,	,	PUNCT
ahs-12347	52	19	99	99	NUM
ahs-12347	52	20	,	,	PUNCT
ahs-12347	52	21	113	113	NUM
ahs-12347	52	22	,	,	PUNCT
ahs-12347	52	23	and	and	CCONJ
ahs-12347	52	24	120	120	NUM
ahs-12347	52	25	of	of	ADP
ahs-12347	52	26	nrits	nrit	NOUN
ahs-12347	52	27	sequence	sequence	NOUN
ahs-12347	52	28	for	for	ADP
ahs-12347	52	29	type	type	NOUN
ahs-12347	52	30	i­1	i­1	PROPN
ahs-12347	52	31	,	,	PUNCT
ahs-12347	52	32	and	and	CCONJ
ahs-12347	52	33	a	a	PRON
ahs-12347	52	34	was	be	AUX
ahs-12347	52	35	assigned	assign	VERB
ahs-12347	52	36	for	for	ADP
ahs-12347	52	37	a	a	PRON
ahs-12347	52	38	or	or	CCONJ
ahs-12347	52	39	g	g	NOUN
ahs-12347	52	40	at	at	ADP
ahs-12347	52	41	231	231	NUM
ahs-12347	52	42	,	,	PUNCT
ahs-12347	52	43	types	type	NOUN
ahs-12347	52	44	i­1	i­1	ADJ
ahs-12347	52	45	and	and	CCONJ
ahs-12347	52	46	i­2	i­2	PROPN
ahs-12347	52	47	can	can	AUX
ahs-12347	52	48	be	be	AUX
ahs-12347	52	49	combined	combine	VERB
ahs-12347	52	50	and	and	CCONJ
ahs-12347	52	51	all	all	DET
ahs-12347	52	52	accessions	accession	NOUN
ahs-12347	52	53	can	can	AUX
ahs-12347	52	54	be	be	AUX
ahs-12347	52	55	assigned	assign	VERB
ahs-12347	52	56	as	as	ADP
ahs-12347	52	57	type	type	NOUN
ahs-12347	52	58	i	i	PRON
ahs-12347	52	59	,	,	PUNCT
ahs-12347	52	60	separated	separate	VERB
ahs-12347	52	61	from	from	ADP
ahs-12347	52	62	h.	h.	PROPN
ahs-12347	52	63	minor	minor	PROPN
ahs-12347	52	64	(	(	PUNCT
ahs-12347	52	65	uk6	uk6	NOUN
ahs-12347	52	66	and	and	CCONJ
ahs-12347	52	67	ge3	ge3	VERB
ahs-12347	52	68	)	)	PUNCT
ahs-12347	52	69	as	as	ADP
ahs-12347	52	70	type	type	NOUN
ahs-12347	52	71	ii	ii	PROPN
ahs-12347	52	72	(	(	PUNCT
ahs-12347	52	73	tables	table	NOUN
ahs-12347	52	74	1	1	NUM
ahs-12347	52	75	and	and	CCONJ
ahs-12347	52	76	2	2	NUM
ahs-12347	52	77	)	)	PUNCT
ahs-12347	52	78	.	.	PUNCT
ahs-12347	53	1	they	they	PRON
ahs-12347	53	2	may	may	AUX
ahs-12347	53	3	be	be	AUX
ahs-12347	53	4	derived	derive	VERB
ahs-12347	53	5	from	from	ADP
ahs-12347	53	6	different	different	ADJ
ahs-12347	53	7	geographic	geographic	ADJ
ahs-12347	53	8	ori­	ori­	NOUN
ahs-12347	53	9	gins	gin	NOUN
ahs-12347	53	10	of	of	ADP
ahs-12347	53	11	k14	k14	PROPN
ahs-12347	53	12	or	or	CCONJ
ahs-12347	53	13	ua5	ua5	NOUN
ahs-12347	53	14	which	which	PRON
ahs-12347	53	15	were	be	AUX
ahs-12347	53	16	collected	collect	VERB
ahs-12347	53	17	from	from	ADP
ahs-12347	53	18	korea	korea	PROPN
ahs-12347	53	19	,	,	PUNCT
ahs-12347	53	20	belonging	belong	VERB
ahs-12347	53	21	to	to	AUX
ahs-12347	53	22	type	type	NOUN
ahs-12347	53	23	i­2	i­2	PROPN
ahs-12347	53	24	,	,	PUNCT
ahs-12347	53	25	and	and	CCONJ
ahs-12347	53	26	exhibit	exhibit	VERB
ahs-12347	53	27	some	some	DET
ahs-12347	53	28	degree	degree	NOUN
ahs-12347	53	29	of	of	ADP
ahs-12347	53	30	genetic	genetic	ADJ
ahs-12347	53	31	variation	variation	NOUN
ahs-12347	53	32	revealed	reveal	VERB
ahs-12347	53	33	in	in	ADP
ahs-12347	53	34	this	this	DET
ahs-12347	53	35	study	study	NOUN
ahs-12347	53	36	using	use	VERB
ahs-12347	53	37	univer­	univer­	PROPN
ahs-12347	53	38	sal	sal	PROPN
ahs-12347	53	39	primers	primer	NOUN
ahs-12347	53	40	for	for	ADP
ahs-12347	53	41	nrits	nrit	NOUN
ahs-12347	53	42	.	.	PUNCT
ahs-12347	54	1	however	however	ADV
ahs-12347	54	2	,	,	PUNCT
ahs-12347	54	3	different	different	ADJ
ahs-12347	54	4	strains	strain	NOUN
ahs-12347	54	5	or	or	CCONJ
ahs-12347	54	6	populations	population	NOUN
ahs-12347	54	7	of	of	ADP
ahs-12347	54	8	h.	h.	PROPN
ahs-12347	54	9	minor	minor	PROPN
ahs-12347	54	10	may	may	AUX
ahs-12347	54	11	exist	exist	VERB
ahs-12347	54	12	since	since	SCONJ
ahs-12347	54	13	h.	h.	PROPN
ahs-12347	54	14	minor	minor	ADJ
ahs-12347	54	15	table	table	NOUN
ahs-12347	54	16	1	1	NUM
ahs-12347	54	17	­	­	NOUN
ahs-12347	54	18	accession	accession	NOUN
ahs-12347	54	19	information	information	NOUN
ahs-12347	54	20	on	on	ADP
ahs-12347	54	21	hemerocallis	hemerocallis	NOUN
ahs-12347	54	22	taxa	taxa	NOUN
ahs-12347	54	23	(	(	PUNCT
ahs-12347	54	24	mother	mother	NOUN
ahs-12347	54	25	plants	plant	NOUN
ahs-12347	54	26	and	and	CCONJ
ahs-12347	54	27	their	their	PRON
ahs-12347	54	28	seedlings	seedling	NOUN
ahs-12347	54	29	)	)	PUNCT
ahs-12347	54	30	with	with	ADP
ahs-12347	54	31	flowering	flowering	NOUN
ahs-12347	54	32	characteristics	characteristic	NOUN
ahs-12347	54	33	.	.	PUNCT
ahs-12347	55	1	haplotype	haplotype	NOUN
ahs-12347	55	2	based	base	VERB
ahs-12347	55	3	on	on	ADP
ahs-12347	55	4	the	the	DET
ahs-12347	55	5	sequence	sequence	NOUN
ahs-12347	55	6	analysis	analysis	NOUN
ahs-12347	55	7	of	of	ADP
ahs-12347	55	8	nrits	nrit	NOUN
ahs-12347	55	9	and	and	CCONJ
ahs-12347	55	10	cpis	cpis	PROPN
ahs-12347	55	11	are	be	AUX
ahs-12347	55	12	indicated	indicate	VERB
ahs-12347	55	13	scientific	scientific	ADJ
ahs-12347	55	14	name	name	NOUN
ahs-12347	55	15	mother	mother	NOUN
ahs-12347	55	16	plant	plant	NOUN
ahs-12347	55	17	(	(	PUNCT
ahs-12347	55	18	leaf	leaf	NOUN
ahs-12347	55	19	)	)	PUNCT
ahs-12347	55	20	seedlings	seedling	NOUN
ahs-12347	55	21	a	a	DET
ahs-12347	55	22	flowering	flowering	NOUN
ahs-12347	55	23	time	time	NOUN
ahs-12347	55	24	b	b	PROPN
ahs-12347	55	25	source	source	NOUN
ahs-12347	55	26	,	,	PUNCT
ahs-12347	55	27	country	country	NOUN
ahs-12347	55	28	haplotype	haplotype	NOUN
ahs-12347	55	29	(	(	PUNCT
ahs-12347	55	30	t	t	NOUN
ahs-12347	55	31	)	)	PUNCT
ahs-12347	55	32	c	c	PROPN
ahs-12347	55	33	nrits	nrit	VERB
ahs-12347	55	34	cpis	cpis	PROPN
ahs-12347	55	35	h.	h.	PROPN
ahs-12347	55	36	thunbergii	thunbergii	PROPN
ahs-12347	55	37	k1	k1	PROPN
ahs-12347	55	38	d	d	X
ahs-12347	55	39	k1/1­3	k1/1­3	NOUN
ahs-12347	55	40	n	n	CCONJ
ahs-12347	55	41	jungseon­gun	jungseon­gun	ADV
ahs-12347	55	42	,	,	PUNCT
ahs-12347	55	43	korea	korea	PROPN
ahs-12347	55	44	i­2	i­2	PROPN
ahs-12347	56	1	i	i	PRON
ahs-12347	56	2	h.	h.	PROPN
ahs-12347	56	3	thunbergii	thunbergii	PROPN
ahs-12347	56	4	k2	k2	PROPN
ahs-12347	56	5	k2/1­3	k2/1­3	NOUN
ahs-12347	57	1	n	n	CCONJ
ahs-12347	57	2	i­2	i­2	PROPN
ahs-12347	58	1	i	i	PRON
ahs-12347	58	2	h.	h.	PROPN
ahs-12347	58	3	thunbergii	thunbergii	NOUN
ahs-12347	58	4	k3	k3	VERB
ahs-12347	58	5	k3/1­3	k3/1­3	NOUN
ahs-12347	59	1	n	n	CCONJ
ahs-12347	59	2	i­2	i­2	PROPN
ahs-12347	60	1	i	i	PRON
ahs-12347	60	2	h.	h.	PROPN
ahs-12347	60	3	thunbergii	thunbergii	NOUN
ahs-12347	60	4	k7	k7	PROPN
ahs-12347	60	5	n	n	PROPN
ahs-12347	60	6	j.w	j.w	PROPN
ahs-12347	60	7	.	.	PROPN
ahs-12347	60	8	chang	chang	PROPN
ahs-12347	60	9	,	,	PUNCT
ahs-12347	60	10	gomyeong­dong	gomyeong­dong	PROPN
ahs-12347	60	11	,	,	PUNCT
ahs-12347	60	12	jecheon­si	jecheon­si	PROPN
ahs-12347	60	13	,	,	PUNCT
ahs-12347	60	14	chungcheongbuk­do	chungcheongbuk­do	PROPN
ahs-12347	60	15	,	,	PUNCT
ahs-12347	60	16	korea	korea	PROPN
ahs-12347	60	17	i­2	i­2	PROPN
ahs-12347	60	18	i­1	i­1	PROPN
ahs-12347	60	19	h.	h.	PROPN
ahs-12347	60	20	thunbergii	thunbergii	NOUN
ahs-12347	60	21	k8,9	k8,9	PROPN
ahs-12347	60	22	e	e	PROPN
ahs-12347	60	23	n	n	PROPN
ahs-12347	60	24	e.j	e.j	PROPN
ahs-12347	60	25	.	.	PROPN
ahs-12347	60	26	kim	kim	PROPN
ahs-12347	60	27	,	,	PUNCT
ahs-12347	60	28	gomsi­gil	gomsi­gil	PROPN
ahs-12347	60	29	,	,	PUNCT
ahs-12347	60	30	ungdam­ri	ungdam­ri	PROPN
ahs-12347	60	31	,	,	PUNCT
ahs-12347	60	32	paju­gun	paju­gun	NOUN
ahs-12347	60	33	,	,	PUNCT
ahs-12347	60	34	kyunggi­do	kyunggi­do	PROPN
ahs-12347	60	35	,	,	PUNCT
ahs-12347	60	36	korea	korea	PROPN
ahs-12347	61	1	i­2	i­2	PROPN
ahs-12347	62	1	i	i	PROPN
ahs-12347	62	2	ka8­13	ka8­13	PROPN
ahs-12347	62	3	d	d	PROPN
ahs-12347	62	4	n	n	PROPN
ahs-12347	62	5	e.j	e.j	PROPN
ahs-12347	62	6	.	.	PROPN
ahs-12347	62	7	kim	kim	PROPN
ahs-12347	62	8	,	,	PUNCT
ahs-12347	62	9	m.s	m.s	PROPN
ahs-12347	62	10	.	.	PROPN
ahs-12347	62	11	roh	roh	PROPN
ahs-12347	62	12	,	,	PUNCT
ahs-12347	62	13	gomsi­gil	gomsi­gil	NOUN
ahs-12347	62	14	,	,	PUNCT
ahs-12347	62	15	ungdam­ri	ungdam­ri	PROPN
ahs-12347	62	16	,	,	PUNCT
ahs-12347	62	17	paju­gun	paju­gun	NOUN
ahs-12347	62	18	,	,	PUNCT
ahs-12347	62	19	kyunggi­do	kyunggi­do	PROPN
ahs-12347	62	20	,	,	PUNCT
ahs-12347	62	21	korea	korea	PROPN
ahs-12347	62	22	i­2	i­2	PROPN
ahs-12347	62	23	iv	iv	PROPN
ahs-12347	62	24	h.	h.	PROPN
ahs-12347	62	25	thunbergii	thunbergii	PROPN
ahs-12347	62	26	k11	k11	NOUN
ahs-12347	62	27	n	n	CCONJ
ahs-12347	62	28	hantaek	hantaek	NOUN
ahs-12347	62	29	botanical	botanical	ADJ
ahs-12347	62	30	garden	garden	NOUN
ahs-12347	62	31	,	,	PUNCT
ahs-12347	62	32	korea	korea	PROPN
ahs-12347	62	33	i­2	i­2	PROPN
ahs-12347	63	1	i	i	PRON
ahs-12347	63	2	h.	h.	PROPN
ahs-12347	63	3	thunbergii	thunbergii	PROPN
ahs-12347	63	4	uk3	uk3	PROPN
ahs-12347	63	5	,	,	PUNCT
ahs-12347	63	6	4	4	NUM
ahs-12347	63	7	n	n	DET
ahs-12347	63	8	royal	royal	ADJ
ahs-12347	63	9	botanical	botanical	ADJ
ahs-12347	63	10	garden	garden	PROPN
ahs-12347	63	11	edinburgh	edinburgh	PROPN
ahs-12347	63	12	,	,	PUNCT
ahs-12347	63	13	uk	uk	PROPN
ahs-12347	63	14	(	(	PUNCT
ahs-12347	63	15	19300128a	19300128a	NUM
ahs-12347	63	16	f	f	X
ahs-12347	63	17	)	)	PUNCT
ahs-12347	64	1	i­2	i­2	PROPN
ahs-12347	65	1	i	i	PRON
ahs-12347	65	2	h.	h.	PROPN
ahs-12347	65	3	thunbergii	thunbergii	PROPN
ahs-12347	65	4	ua7	ua7	PROPN
ahs-12347	65	5	­	­	PROPN
ahs-12347	65	6	n	n	ADV
ahs-12347	65	7	united	united	PROPN
ahs-12347	65	8	states	states	PROPN
ahs-12347	65	9	national	national	PROPN
ahs-12347	65	10	arboretum	arboretum	PROPN
ahs-12347	65	11	,	,	PUNCT
ahs-12347	65	12	washington	washington	PROPN
ahs-12347	65	13	,	,	PUNCT
ahs-12347	65	14	dc	dc	PROPN
ahs-12347	65	15	,	,	PUNCT
ahs-12347	65	16	usa	usa	PROPN
ahs-12347	65	17	(	(	PUNCT
ahs-12347	65	18	usna	usna	PROPN
ahs-12347	65	19	;	;	PUNCT
ahs-12347	65	20	na54757.3	na54757.3	NUM
ahs-12347	65	21	collected	collect	VERB
ahs-12347	65	22	from	from	ADP
ahs-12347	65	23	korea	korea	PROPN
ahs-12347	65	24	)	)	PUNCT
ahs-12347	66	1	i­2	i­2	PROPN
ahs-12347	66	2	i	i	PRON
ahs-12347	66	3	h.	h.	PROPN
ahs-12347	66	4	minor	minor	ADJ
ahs-12347	66	5	­	­	VERB
ahs-12347	66	6	k14/1­3	k14/1­3	NOUN
ahs-12347	66	7	d	d	X
ahs-12347	66	8	hantaek	hantaek	NOUN
ahs-12347	66	9	botanical	botanical	ADJ
ahs-12347	66	10	garden	garden	NOUN
ahs-12347	66	11	,	,	PUNCT
ahs-12347	66	12	korea	korea	PROPN
ahs-12347	66	13	i­2	i­2	PROPN
ahs-12347	66	14	i­1	i­1	PROPN
ahs-12347	66	15	h.	h.	PROPN
ahs-12347	66	16	minor	minor	ADJ
ahs-12347	66	17	uk6	uk6	PROPN
ahs-12347	66	18	uk6/1­3	uk6/1­3	PROPN
ahs-12347	66	19	n	n	CCONJ
ahs-12347	66	20	?	?	PUNCT
ahs-12347	67	1	royal	royal	ADJ
ahs-12347	67	2	botanical	botanical	ADJ
ahs-12347	67	3	garden	garden	PROPN
ahs-12347	67	4	edinburgh	edinburgh	PROPN
ahs-12347	67	5	,	,	PUNCT
ahs-12347	67	6	uk	uk	PROPN
ahs-12347	67	7	ii	ii	PROPN
ahs-12347	67	8	v	v	ADP
ahs-12347	67	9	h.	h.	PROPN
ahs-12347	67	10	minor	minor	ADJ
ahs-12347	67	11	ge3/1­3	ge3/1­3	PROPN
ahs-12347	67	12	n	n	CCONJ
ahs-12347	67	13	?	?	PUNCT
ahs-12347	68	1	botanischer	botanischer	PROPN
ahs-12347	68	2	garten	garten	PROPN
ahs-12347	68	3	leipzig	leipzig	PROPN
ahs-12347	68	4	(	(	PUNCT
ahs-12347	68	5	xx­o­lz­ad439/2006	xx­o­lz­ad439/2006	PROPN
ahs-12347	68	6	)	)	PUNCT
ahs-12347	68	7	ii	ii	NOUN
ahs-12347	68	8	v	v	ADP
ahs-12347	68	9	h.	h.	PROPN
ahs-12347	68	10	minor	minor	ADJ
ahs-12347	68	11	ua5	ua5	NOUN
ahs-12347	68	12	­	­	NUM
ahs-12347	68	13	d	d	NOUN
ahs-12347	68	14	usna	usna	PROPN
ahs-12347	68	15	;	;	PUNCT
ahs-12347	68	16	na31800.1	na31800.1	NUM
ahs-12347	68	17	i­2	i­2	PROPN
ahs-12347	68	18	i	i	PRON
ahs-12347	68	19	h.	h.	PROPN
ahs-12347	68	20	lilioasphodelus	lilioasphodelus	PROPN
ahs-12347	68	21	­	­	VERB
ahs-12347	68	22	c1/1	c1/1	PROPN
ahs-12347	69	1	n	n	PROPN
ahs-12347	69	2	x.w	x.w	PROPN
ahs-12347	69	3	.	.	PROPN
ahs-12347	69	4	wu	wu	PROPN
ahs-12347	69	5	,	,	PUNCT
ahs-12347	70	1	china	china	PROPN
ahs-12347	70	2	i­2	i­2	PROPN
ahs-12347	70	3	i	i	PRON
ahs-12347	70	4	c1/2­3	c1/2­3	VERB
ahs-12347	71	1	i­1	i­1	INTJ
ahs-12347	72	1	i	i	PRON
ahs-12347	72	2	h.	h.	PROPN
ahs-12347	72	3	liliasphodelus	liliasphodelus	PROPN
ahs-12347	72	4	ua6	ua6	PROPN
ahs-12347	72	5	­	­	VERB
ahs-12347	72	6	n	n	X
ahs-12347	72	7	usna	usna	NOUN
ahs-12347	72	8	;	;	PUNCT
ahs-12347	72	9	na54879.3	na54879.3	NUM
ahs-12347	72	10	i­2	i­2	PROPN
ahs-12347	72	11	i	i	PRON
ahs-12347	72	12	h.	h.	PROPN
ahs-12347	72	13	citrina	citrina	PROPN
ahs-12347	72	14	­	­	VERB
ahs-12347	72	15	c2/1­3	c2/1­3	PROPN
ahs-12347	72	16	n	n	PROPN
ahs-12347	72	17	x.w	x.w	PROPN
ahs-12347	72	18	.	.	PROPN
ahs-12347	72	19	wu	wu	PROPN
ahs-12347	72	20	,	,	PUNCT
ahs-12347	73	1	china	china	PROPN
ahs-12347	73	2	i­2	i­2	PROPN
ahs-12347	73	3	i	i	PRON
ahs-12347	73	4	h.	h.	PROPN
ahs-12347	73	5	citrina	citrina	PROPN
ahs-12347	73	6	uk1	uk1	PROPN
ahs-12347	74	1	n	n	DET
ahs-12347	74	2	royal	royal	ADJ
ahs-12347	74	3	botanical	botanical	ADJ
ahs-12347	74	4	garden	garden	PROPN
ahs-12347	74	5	edinburgh	edinburgh	PROPN
ahs-12347	74	6	,	,	PUNCT
ahs-12347	74	7	uk	uk	PROPN
ahs-12347	74	8	(	(	PUNCT
ahs-12347	74	9	19685548a	19685548a	NUM
ahs-12347	74	10	u	u	NOUN
ahs-12347	74	11	)	)	PUNCT
ahs-12347	74	12	i­2	i­2	PROPN
ahs-12347	74	13	iii	iii	PROPN
ahs-12347	74	14	h.	h.	PROPN
ahs-12347	74	15	citrina	citrina	PROPN
ahs-12347	74	16	uk5	uk5	PROPN
ahs-12347	74	17	n	n	NUM
ahs-12347	74	18	royal	royal	ADJ
ahs-12347	74	19	botanical	botanical	ADJ
ahs-12347	74	20	garden	garden	PROPN
ahs-12347	74	21	edinburgh	edinburgh	PROPN
ahs-12347	74	22	,	,	PUNCT
ahs-12347	74	23	uk	uk	PROPN
ahs-12347	74	24	i­2	i­2	PROPN
ahs-12347	75	1	i	i	PROPN
ahs-12347	75	2	h.	h.	PROPN
ahs-12347	75	3	citrina	citrina	PROPN
ahs-12347	75	4	ge4/1­3	ge4/1­3	PROPN
ahs-12347	75	5	n	n	PROPN
ahs-12347	75	6	botanischer	botanischer	PROPN
ahs-12347	75	7	garten	garten	PROPN
ahs-12347	75	8	leipzig	leipzig	PROPN
ahs-12347	75	9	(	(	PUNCT
ahs-12347	75	10	xx­o­lz­aw78/1998	xx­o­lz­aw78/1998	PROPN
ahs-12347	75	11	,	,	PUNCT
ahs-12347	75	12	2000	2000	NUM
ahs-12347	75	13	)	)	PUNCT
ahs-12347	76	1	i­2	i­2	PROPN
ahs-12347	76	2	ii	ii	PROPN
ahs-12347	76	3	h.	h.	PROPN
ahs-12347	76	4	citrina	citrina	PROPN
ahs-12347	76	5	‘	'	PUNCT
ahs-12347	76	6	april	april	PROPN
ahs-12347	76	7	flower	flower	NOUN
ahs-12347	76	8	’	'	PUNCT
ahs-12347	76	9	­	­	VERB
ahs-12347	76	10	c3/1­3	c3/1­3	PROPN
ahs-12347	76	11	x.w	x.w	PROPN
ahs-12347	76	12	.	.	PROPN
ahs-12347	76	13	wu	wu	PROPN
ahs-12347	76	14	,	,	PUNCT
ahs-12347	77	1	china	china	PROPN
ahs-12347	77	2	i­2	i­2	PROPN
ahs-12347	77	3	i	i	PRON
ahs-12347	77	4	h.	h.	PROPN
ahs-12347	77	5	vespertina	vespertina	PROPN
ahs-12347	77	6	k12	k12	PROPN
ahs-12347	78	1	k12/1­3	k12/1­3	PROPN
ahs-12347	78	2	d	d	X
ahs-12347	78	3	hantaek	hantaek	NOUN
ahs-12347	78	4	botanical	botanical	ADJ
ahs-12347	78	5	garden	garden	NOUN
ahs-12347	78	6	,	,	PUNCT
ahs-12347	78	7	korea	korea	PROPN
ahs-12347	78	8	i­2	i­2	PROPN
ahs-12347	78	9	ii	ii	PROPN
ahs-12347	78	10	h.	h.	PROPN
ahs-12347	78	11	dumortierii	dumortierii	PROPN
ahs-12347	78	12	c.	c.	PROPN
ahs-12347	78	13	morren	morren	PROPN
ahs-12347	78	14	k13	k13	VERB
ahs-12347	78	15	d	d	PROPN
ahs-12347	78	16	hantaek	hantaek	NOUN
ahs-12347	78	17	botanical	botanical	ADJ
ahs-12347	78	18	garden	garden	NOUN
ahs-12347	78	19	,	,	PUNCT
ahs-12347	78	20	korea	korea	PROPN
ahs-12347	78	21	i­2	i­2	PROPN
ahs-12347	78	22	vi	vi	PROPN
ahs-12347	78	23	h.	h.	NOUN
ahs-12347	78	24	hongdoensis	hongdoensis	NOUN
ahs-12347	78	25	­	­	VERB
ahs-12347	78	26	k15/1­3	k15/1­3	NOUN
ahs-12347	78	27	d	d	PROPN
ahs-12347	78	28	hantaek	hantaek	NOUN
ahs-12347	78	29	botanical	botanical	ADJ
ahs-12347	78	30	garden	garden	NOUN
ahs-12347	78	31	,	,	PUNCT
ahs-12347	78	32	korea	korea	PROPN
ahs-12347	78	33	i­2	i­2	PROPN
ahs-12347	78	34	i	i	PRON
ahs-12347	78	35	‘	'	PUNCT
ahs-12347	78	36	stella	stella	X
ahs-12347	78	37	de	de	X
ahs-12347	78	38	oro	oro	X
ahs-12347	78	39	’	'	PUNCT
ahs-12347	78	40	ua2	ua2	PROPN
ahs-12347	78	41	ua2/1­3	ua2/1­3	PROPN
ahs-12347	78	42	d	d	PROPN
ahs-12347	78	43	m.s	m.s	PROPN
ahs-12347	78	44	.	.	PROPN
ahs-12347	78	45	roh	roh	PROPN
ahs-12347	78	46	,	,	PUNCT
ahs-12347	78	47	ann	ann	PROPN
ahs-12347	78	48	arbor	arbor	PROPN
ahs-12347	78	49	,	,	PUNCT
ahs-12347	78	50	mi	mi	PROPN
ahs-12347	78	51	.	.	PROPN
ahs-12347	78	52	,	,	PUNCT
ahs-12347	78	53	usa	usa	PROPN
ahs-12347	78	54	i­1	i­1	PROPN
ahs-12347	78	55	i	i	PRON
ahs-12347	78	56	a	a	DET
ahs-12347	78	57	seedlings	seedling	NOUN
ahs-12347	78	58	1	1	NUM
ahs-12347	78	59	,	,	PUNCT
ahs-12347	78	60	2	2	NUM
ahs-12347	78	61	,	,	PUNCT
ahs-12347	78	62	3	3	NUM
ahs-12347	78	63	from	from	ADP
ahs-12347	78	64	mother	mother	NOUN
ahs-12347	78	65	plant	plant	NOUN
ahs-12347	78	66	k1	k1	PROPN
ahs-12347	78	67	.	.	PUNCT
ahs-12347	79	1	designations	designation	NOUN
ahs-12347	79	2	of	of	ADP
ahs-12347	79	3	accession	accession	NOUN
ahs-12347	79	4	of	of	ADP
ahs-12347	79	5	mother	mother	NOUN
ahs-12347	79	6	plant	plant	NOUN
ahs-12347	79	7	and	and	CCONJ
ahs-12347	79	8	three	three	NUM
ahs-12347	79	9	seedlings	seedling	NOUN
ahs-12347	79	10	are	be	AUX
ahs-12347	79	11	indicated	indicate	VERB
ahs-12347	79	12	as	as	ADP
ahs-12347	79	13	k1	k1	NOUN
ahs-12347	79	14	and	and	CCONJ
ahs-12347	79	15	k1/1­3	k1/1­3	NOUN
ahs-12347	79	16	,	,	PUNCT
ahs-12347	79	17	respectively	respectively	ADV
ahs-12347	79	18	.	.	PUNCT
ahs-12347	80	1	b	b	X
ahs-12347	80	2	flower	flower	NOUN
ahs-12347	80	3	opens	open	VERB
ahs-12347	80	4	in	in	ADP
ahs-12347	80	5	the	the	DET
ahs-12347	80	6	morning	morning	NOUN
ahs-12347	80	7	and	and	CCONJ
ahs-12347	80	8	withers	wither	NOUN
ahs-12347	80	9	in	in	ADP
ahs-12347	80	10	the	the	DET
ahs-12347	80	11	late	late	ADJ
ahs-12347	80	12	afternoon	afternoon	NOUN
ahs-12347	80	13	(	(	PUNCT
ahs-12347	80	14	day	day	NOUN
ahs-12347	80	15	,	,	PUNCT
ahs-12347	80	16	d	d	NOUN
ahs-12347	80	17	)	)	PUNCT
ahs-12347	80	18	or	or	CCONJ
ahs-12347	80	19	opens	open	VERB
ahs-12347	80	20	in	in	ADP
ahs-12347	80	21	the	the	DET
ahs-12347	80	22	late	late	ADJ
ahs-12347	80	23	afternoon	afternoon	NOUN
ahs-12347	80	24	and	and	CCONJ
ahs-12347	80	25	withers	wither	NOUN
ahs-12347	80	26	early	early	ADV
ahs-12347	80	27	on	on	ADP
ahs-12347	80	28	the	the	DET
ahs-12347	80	29	next	next	ADJ
ahs-12347	80	30	morning	morning	NOUN
ahs-12347	80	31	(	(	PUNCT
ahs-12347	80	32	night	night	NOUN
ahs-12347	80	33	,	,	PUNCT
ahs-12347	80	34	n	n	CCONJ
ahs-12347	80	35	)	)	PUNCT
ahs-12347	80	36	.	.	PUNCT
ahs-12347	81	1	flowering	flower	VERB
ahs-12347	81	2	characteristics	characteristic	NOUN
ahs-12347	81	3	were	be	AUX
ahs-12347	81	4	not	not	PART
ahs-12347	81	5	evaluated	evaluate	VERB
ahs-12347	81	6	in	in	ADP
ahs-12347	81	7	this	this	DET
ahs-12347	81	8	study	study	NOUN
ahs-12347	81	9	for	for	ADP
ahs-12347	81	10	h.	h.	PROPN
ahs-12347	81	11	minor	minor	PROPN
ahs-12347	81	12	collected	collect	VERB
ahs-12347	81	13	from	from	ADP
ahs-12347	81	14	royal	royal	ADJ
ahs-12347	81	15	botanical	botanical	ADJ
ahs-12347	81	16	garden	garden	PROPN
ahs-12347	81	17	edinburgh	edinburgh	PROPN
ahs-12347	81	18	,	,	PUNCT
ahs-12347	81	19	uk	uk	PROPN
ahs-12347	81	20	and	and	CCONJ
ahs-12347	81	21	botanischer	botanischer	PROPN
ahs-12347	81	22	garten	garten	PROPN
ahs-12347	81	23	leipzig	leipzig	PROPN
ahs-12347	81	24	(	(	PUNCT
ahs-12347	81	25	xx­o­lz­ad439/2006	xx­o­lz­ad439/2006	ADJ
ahs-12347	81	26	)	)	PUNCT
ahs-12347	81	27	.	.	PUNCT
ahs-12347	82	1	c	c	NOUN
ahs-12347	82	2	refer	refer	VERB
ahs-12347	82	3	to	to	ADP
ahs-12347	82	4	table	table	NOUN
ahs-12347	82	5	2	2	NUM
ahs-12347	82	6	for	for	ADP
ahs-12347	82	7	nrits	nrit	NOUN
ahs-12347	82	8	and	and	CCONJ
ahs-12347	82	9	table	table	NOUN
ahs-12347	82	10	3	3	NUM
ahs-12347	82	11	for	for	ADP
ahs-12347	82	12	cpis	cpis	NOUN
ahs-12347	82	13	haplotypes	haplotype	NOUN
ahs-12347	82	14	and	and	CCONJ
ahs-12347	82	15	single	single	ADJ
ahs-12347	82	16	nucleotide	nucleotide	ADJ
ahs-12347	82	17	polymorphisms	polymorphism	NOUN
ahs-12347	82	18	.	.	PUNCT
ahs-12347	83	1	d	d	NOUN
ahs-12347	83	2	collected	collect	VERB
ahs-12347	83	3	or	or	CCONJ
ahs-12347	83	4	received	receive	VERB
ahs-12347	83	5	from	from	ADP
ahs-12347	83	6	korea	korea	PROPN
ahs-12347	83	7	(	(	PUNCT
ahs-12347	83	8	k	k	PROPN
ahs-12347	83	9	,	,	PUNCT
ahs-12347	83	10	ka	ka	PROPN
ahs-12347	83	11	)	)	PUNCT
ahs-12347	83	12	,	,	PUNCT
ahs-12347	83	13	united	united	PROPN
ahs-12347	83	14	states	states	PROPN
ahs-12347	83	15	of	of	ADP
ahs-12347	83	16	america	america	PROPN
ahs-12347	83	17	(	(	PUNCT
ahs-12347	83	18	ua	ua	PROPN
ahs-12347	83	19	)	)	PUNCT
ahs-12347	83	20	,	,	PUNCT
ahs-12347	83	21	united	united	ADJ
ahs-12347	83	22	kingdom	kingdom	PROPN
ahs-12347	83	23	(	(	PUNCT
ahs-12347	83	24	uk	uk	PROPN
ahs-12347	83	25	)	)	PUNCT
ahs-12347	83	26	,	,	PUNCT
ahs-12347	83	27	germany	germany	PROPN
ahs-12347	83	28	(	(	PUNCT
ahs-12347	83	29	ge	ge	PROPN
ahs-12347	83	30	)	)	PUNCT
ahs-12347	83	31	,	,	PUNCT
ahs-12347	83	32	and	and	CCONJ
ahs-12347	83	33	china	china	PROPN
ahs-12347	83	34	(	(	PUNCT
ahs-12347	83	35	c	c	NOUN
ahs-12347	83	36	)	)	PUNCT
ahs-12347	83	37	.	.	PUNCT
ahs-12347	84	1	e	e	NOUN
ahs-12347	84	2	samples	sample	NOUN
ahs-12347	84	3	of	of	ADP
ahs-12347	84	4	k8	k8	NOUN
ahs-12347	84	5	and	and	CCONJ
ahs-12347	84	6	9	9	NUM
ahs-12347	84	7	and	and	CCONJ
ahs-12347	84	8	of	of	ADP
ahs-12347	84	9	ka	ka	PROPN
ahs-12347	84	10	8­13	8­13	PROPN
ahs-12347	84	11	were	be	AUX
ahs-12347	84	12	collected	collect	VERB
ahs-12347	84	13	from	from	ADP
ahs-12347	84	14	the	the	DET
ahs-12347	84	15	same	same	ADJ
ahs-12347	84	16	location	location	NOUN
ahs-12347	84	17	in	in	ADP
ahs-12347	84	18	2011	2011	NUM
ahs-12347	84	19	and	and	CCONJ
ahs-12347	84	20	2014	2014	NUM
ahs-12347	84	21	,	,	PUNCT
ahs-12347	84	22	respectively	respectively	ADV
ahs-12347	84	23	.	.	PUNCT
ahs-12347	85	1	f	f	PROPN
ahs-12347	85	2	samples	sample	NOUN
ahs-12347	85	3	were	be	AUX
ahs-12347	85	4	of	of	ADP
ahs-12347	85	5	garden	garden	NOUN
ahs-12347	85	6	origin	origin	NOUN
ahs-12347	85	7	from	from	ADP
ahs-12347	85	8	dendrologische	dendrologische	NOUN
ahs-12347	85	9	gartenerei	gartenerei	NOUN
ahs-12347	85	10	in	in	ADP
ahs-12347	85	11	pruhonce	pruhonce	NOUN
ahs-12347	85	12	,	,	PUNCT
ahs-12347	85	13	czech	czech	PROPN
ahs-12347	85	14	republic	republic	NOUN
ahs-12347	85	15	via	via	ADP
ahs-12347	85	16	peter	peter	PROPN
ahs-12347	85	17	brownless	brownless	PROPN
ahs-12347	85	18	.	.	PUNCT
ahs-12347	86	1	adv	adv	PROPN
ahs-12347	86	2	.	.	PUNCT
ahs-12347	87	1	hort	hort	PROPN
ahs-12347	87	2	.	.	PUNCT
ahs-12347	88	1	sci	sci	PROPN
ahs-12347	88	2	.	.	PROPN
ahs-12347	88	3	,	,	PUNCT
ahs-12347	88	4	2022	2022	NUM
ahs-12347	88	5	36(3	36(3	NUM
ahs-12347	88	6	):	):	PUNCT
ahs-12347	88	7	247­251	247­251	NUM
ahs-12347	88	8	250	250	NUM
ahs-12347	88	9	flowers	flower	NOUN
ahs-12347	88	10	in	in	ADP
ahs-12347	88	11	the	the	DET
ahs-12347	88	12	morning	morning	NOUN
ahs-12347	88	13	under	under	ADP
ahs-12347	88	14	sunny	sunny	ADJ
ahs-12347	88	15	weather	weather	NOUN
ahs-12347	88	16	at	at	ADP
ahs-12347	88	17	>	>	X
ahs-12347	88	18	16oc	16oc	NOUN
ahs-12347	88	19	and	and	CCONJ
ahs-12347	88	20	withers	wither	NOUN
ahs-12347	88	21	in	in	ADP
ahs-12347	88	22	the	the	DET
ahs-12347	88	23	afternoon	afternoon	NOUN
ahs-12347	88	24	,	,	PUNCT
ahs-12347	88	25	as	as	SCONJ
ahs-12347	88	26	reported	report	VERB
ahs-12347	88	27	at	at	ADP
ahs-12347	88	28	the	the	DET
ahs-12347	88	29	botanical	botanical	ADJ
ahs-12347	88	30	garden	garden	PROPN
ahs-12347	88	31	institute	institute	NOUN
ahs-12347	88	32	,	,	PUNCT
ahs-12347	88	33	far	far	PROPN
ahs-12347	88	34	east	east	NOUN
ahs-12347	88	35	branch	branch	NOUN
ahs-12347	88	36	,	,	PUNCT
ahs-12347	88	37	russian	russian	ADJ
ahs-12347	88	38	academy	academy	PROPN
ahs-12347	88	39	of	of	ADP
ahs-12347	88	40	sciences	sciences	PROPN
ahs-12347	88	41	(	(	PUNCT
ahs-12347	88	42	krestova	krestova	PROPN
ahs-12347	88	43	and	and	CCONJ
ahs-12347	88	44	nesterova	nesterova	X
ahs-12347	88	45	,	,	PUNCT
ahs-12347	88	46	2003	2003	NUM
ahs-12347	88	47	)	)	PUNCT
ahs-12347	88	48	.	.	PUNCT
ahs-12347	89	1	the	the	DET
ahs-12347	89	2	h.	h.	PROPN
ahs-12347	89	3	minor	minor	PROPN
ahs-12347	89	4	,	,	PUNCT
ahs-12347	89	5	received	receive	VERB
ahs-12347	89	6	from	from	ADP
ahs-12347	89	7	the	the	DET
ahs-12347	89	8	us	us	PROPN
ahs-12347	89	9	national	national	PROPN
ahs-12347	89	10	arboretum	arboretum	NOUN
ahs-12347	89	11	(	(	PUNCT
ahs-12347	89	12	usna	usna	PROPN
ahs-12347	89	13	;	;	PUNCT
ahs-12347	89	14	na31800.1	na31800.1	NUM
ahs-12347	89	15	)	)	PUNCT
ahs-12347	89	16	original­	original­	NOUN
ahs-12347	90	1	ly	ly	PRON
ahs-12347	90	2	collected	collect	VERB
ahs-12347	90	3	from	from	ADP
ahs-12347	90	4	korea	korea	PROPN
ahs-12347	90	5	,	,	PUNCT
ahs-12347	90	6	flowers	flower	NOUN
ahs-12347	90	7	in	in	ADP
ahs-12347	90	8	the	the	DET
ahs-12347	90	9	morning	morning	NOUN
ahs-12347	90	10	in	in	ADP
ahs-12347	90	11	ann	ann	PROPN
ahs-12347	90	12	arbor	arbor	PROPN
ahs-12347	90	13	,	,	PUNCT
ahs-12347	90	14	mi	mi	PROPN
ahs-12347	90	15	,	,	PUNCT
ahs-12347	90	16	usa	usa	PROPN
ahs-12347	90	17	.	.	PROPN
ahs-12347	90	18	therefore	therefore	ADV
ahs-12347	90	19	,	,	PUNCT
ahs-12347	90	20	further	further	ADJ
ahs-12347	90	21	investigation	investigation	NOUN
ahs-12347	90	22	of	of	ADP
ahs-12347	90	23	hemerocallis	hemerocalli	NOUN
ahs-12347	90	24	minor	minor	ADJ
ahs-12347	90	25	is	be	AUX
ahs-12347	90	26	needed	need	VERB
ahs-12347	90	27	to	to	PART
ahs-12347	90	28	determine	determine	VERB
ahs-12347	90	29	whether	whether	SCONJ
ahs-12347	90	30	accessions	accession	NOUN
ahs-12347	90	31	collected	collect	VERB
ahs-12347	90	32	from	from	ADP
ahs-12347	90	33	china	china	PROPN
ahs-12347	90	34	,	,	PUNCT
ahs-12347	90	35	korea	korea	PROPN
ahs-12347	90	36	and	and	CCONJ
ahs-12347	90	37	the	the	DET
ahs-12347	90	38	far	far	ADV
ahs-12347	90	39	eastern	eastern	ADJ
ahs-12347	90	40	part	part	NOUN
ahs-12347	90	41	of	of	ADP
ahs-12347	90	42	russia	russia	PROPN
ahs-12347	90	43	are	be	AUX
ahs-12347	90	44	of	of	ADP
ahs-12347	90	45	two	two	NUM
ahs-12347	90	46	different	different	ADJ
ahs-12347	90	47	flowering	flowering	NOUN
ahs-12347	90	48	types	type	NOUN
ahs-12347	90	49	.	.	PUNCT
ahs-12347	91	1	hemerocallis	hemerocalli	NOUN
ahs-12347	91	2	hybrid	hybrid	ADJ
ahs-12347	91	3	‘	'	PUNCT
ahs-12347	91	4	stella	stella	X
ahs-12347	91	5	de	de	X
ahs-12347	91	6	oro	oro	X
ahs-12347	91	7	’	'	PUNCT
ahs-12347	91	8	(	(	PUNCT
ahs-12347	91	9	ua2	ua2	PROPN
ahs-12347	91	10	)	)	PUNCT
ahs-12347	91	11	,	,	PUNCT
ahs-12347	91	12	day	day	NOUN
ahs-12347	91	13	flowering	flower	VERB
ahs-12347	91	14	landscape	landscape	NOUN
ahs-12347	91	15	plant	plant	NOUN
ahs-12347	91	16	of	of	ADP
ahs-12347	91	17	unknown	unknown	ADJ
ahs-12347	91	18	parentage	parentage	NOUN
ahs-12347	91	19	,	,	PUNCT
ahs-12347	91	20	was	be	AUX
ahs-12347	91	21	grouped	group	VERB
ahs-12347	91	22	with	with	ADP
ahs-12347	91	23	h.	h.	PROPN
ahs-12347	91	24	minor	minor	PROPN
ahs-12347	91	25	collected	collect	VERB
ahs-12347	91	26	from	from	ADP
ahs-12347	91	27	korea	korea	PROPN
ahs-12347	91	28	(	(	PUNCT
ahs-12347	91	29	k14	k14	PROPN
ahs-12347	91	30	)	)	PUNCT
ahs-12347	91	31	,	,	PUNCT
ahs-12347	91	32	but	but	CCONJ
ahs-12347	91	33	not	not	PART
ahs-12347	91	34	with	with	ADP
ahs-12347	91	35	h.	h.	PROPN
ahs-12347	91	36	minor	minor	PROPN
ahs-12347	91	37	(	(	PUNCT
ahs-12347	91	38	uk6	uk6	NOUN
ahs-12347	91	39	and	and	CCONJ
ahs-12347	91	40	ge3	ge3	NOUN
ahs-12347	91	41	)	)	PUNCT
ahs-12347	91	42	acces­	acces­	NOUN
ahs-12347	91	43	sions	sion	NOUN
ahs-12347	91	44	and	and	CCONJ
ahs-12347	91	45	their	their	PRON
ahs-12347	91	46	seedlings	seedling	NOUN
ahs-12347	91	47	(	(	PUNCT
ahs-12347	91	48	k14/1­3	k14/1­3	NOUN
ahs-12347	91	49	)	)	PUNCT
ahs-12347	91	50	and	and	CCONJ
ahs-12347	91	51	uk6/1­3	uk6/1­3	PROPN
ahs-12347	91	52	,	,	PUNCT
ahs-12347	91	53	based	base	VERB
ahs-12347	91	54	on	on	ADP
ahs-12347	91	55	the	the	DET
ahs-12347	91	56	haplotypes	haplotype	NOUN
ahs-12347	91	57	of	of	ADP
ahs-12347	91	58	snps	snps	PROPN
ahs-12347	91	59	with	with	ADP
ahs-12347	91	60	a	a	DET
ahs-12347	91	61	nrits	nrit	NOUN
ahs-12347	91	62	region	region	NOUN
ahs-12347	91	63	(	(	PUNCT
ahs-12347	91	64	table	table	NOUN
ahs-12347	91	65	2	2	NUM
ahs-12347	91	66	)	)	PUNCT
ahs-12347	91	67	and	and	CCONJ
ahs-12347	91	68	with	with	ADP
ahs-12347	91	69	cpis	cpis	PROPN
ahs-12347	91	70	(	(	PUNCT
ahs-12347	91	71	table	table	NOUN
ahs-12347	91	72	3	3	NUM
ahs-12347	91	73	)	)	PUNCT
ahs-12347	91	74	.	.	PUNCT
ahs-12347	92	1	grouping	group	VERB
ahs-12347	92	2	of	of	ADP
ahs-12347	92	3	h.	h.	PROPN
ahs-12347	92	4	dumortieri	dumortieri	PROPN
ahs-12347	92	5	(	(	PUNCT
ahs-12347	92	6	k13	k13	PROPN
ahs-12347	92	7	)	)	PUNCT
ahs-12347	92	8	with	with	ADP
ahs-12347	92	9	h.	h.	PROPN
ahs-12347	92	10	minor	minor	PROPN
ahs-12347	92	11	(	(	PUNCT
ahs-12347	92	12	uk6	uk6	NOUN
ahs-12347	92	13	and	and	CCONJ
ahs-12347	92	14	ge3	ge3	VERB
ahs-12347	92	15	)	)	PUNCT
ahs-12347	92	16	with	with	ADP
ahs-12347	92	17	nrits	nrit	NOUN
ahs-12347	92	18	region	region	NOUN
ahs-12347	92	19	was	be	AUX
ahs-12347	92	20	also	also	ADV
ahs-12347	92	21	different	different	ADJ
ahs-12347	92	22	from	from	ADP
ahs-12347	92	23	that	that	PRON
ahs-12347	92	24	with	with	ADP
ahs-12347	92	25	cpis	cpis	PROPN
ahs-12347	92	26	(	(	PUNCT
ahs-12347	92	27	table	table	NOUN
ahs-12347	92	28	3	3	NUM
ahs-12347	92	29	)	)	PUNCT
ahs-12347	92	30	.	.	PUNCT
ahs-12347	93	1	mcgarty	mcgarty	NOUN
ahs-12347	93	2	(	(	PUNCT
ahs-12347	93	3	2006	2006	NUM
ahs-12347	93	4	)	)	PUNCT
ahs-12347	93	5	used	use	VERB
ahs-12347	93	6	aflp	aflp	PROPN
ahs-12347	93	7	markers	marker	NOUN
ahs-12347	93	8	from	from	ADP
ahs-12347	93	9	hemerocallis	hemerocallis	NOUN
ahs-12347	93	10	species	specie	NOUN
ahs-12347	93	11	,	,	PUNCT
ahs-12347	93	12	and	and	CCONJ
ahs-12347	93	13	placed	place	VERB
ahs-12347	93	14	h.	h.	PROPN
ahs-12347	93	15	lilioasphodelus	lilioasphodelus	PROPN
ahs-12347	93	16	with	with	ADP
ahs-12347	93	17	h.	h.	PROPN
ahs-12347	93	18	thunbergii	thunbergii	NOUN
ahs-12347	93	19	in	in	ADP
ahs-12347	93	20	one	one	NUM
ahs-12347	93	21	sub­group	sub­group	NOUN
ahs-12347	93	22	and	and	CCONJ
ahs-12347	93	23	h.	h.	PROPN
ahs-12347	93	24	citrina	citrina	PROPN
ahs-12347	93	25	,	,	PUNCT
ahs-12347	93	26	h.	h.	PROPN
ahs-12347	93	27	minor	minor	PROPN
ahs-12347	93	28	,	,	PUNCT
ahs-12347	93	29	and	and	CCONJ
ahs-12347	93	30	h.	h.	PROPN
ahs-12347	93	31	dumortieri	dumortieri	PROPN
ahs-12347	93	32	in	in	ADP
ahs-12347	93	33	another	another	PRON
ahs-12347	93	34	.	.	PUNCT
ahs-12347	94	1	this	this	PRON
ahs-12347	94	2	suggests	suggest	VERB
ahs-12347	94	3	that	that	SCONJ
ahs-12347	94	4	day	day	NOUN
ahs-12347	94	5	and	and	CCONJ
ahs-12347	94	6	night	night	NOUN
ahs-12347	94	7	flowering	flower	VERB
ahs-12347	94	8	species	specie	NOUN
ahs-12347	94	9	can	can	AUX
ahs-12347	94	10	not	not	PART
ahs-12347	94	11	be	be	AUX
ahs-12347	94	12	sepa­	sepa­	ADV
ahs-12347	94	13	rated	rate	VERB
ahs-12347	94	14	either	either	CCONJ
ahs-12347	94	15	by	by	ADP
ahs-12347	94	16	aflp	aflp	PROPN
ahs-12347	94	17	markers	marker	NOUN
ahs-12347	94	18	,	,	PUNCT
ahs-12347	94	19	or	or	CCONJ
ahs-12347	94	20	by	by	ADP
ahs-12347	94	21	snps	snps	PROPN
ahs-12347	94	22	from	from	ADP
ahs-12347	94	23	a	a	DET
ahs-12347	94	24	nrits	nrit	NOUN
ahs-12347	94	25	region	region	NOUN
ahs-12347	94	26	or	or	CCONJ
ahs-12347	94	27	cpis	cpis	NOUN
ahs-12347	94	28	,	,	PUNCT
ahs-12347	94	29	as	as	SCONJ
ahs-12347	94	30	attempted	attempt	VERB
ahs-12347	94	31	in	in	ADP
ahs-12347	94	32	this	this	DET
ahs-12347	94	33	study	study	NOUN
ahs-12347	94	34	.	.	PUNCT
ahs-12347	95	1	difficulties	difficulty	NOUN
ahs-12347	95	2	with	with	ADP
ahs-12347	95	3	identifying	identify	VERB
ahs-12347	95	4	species	specie	NOUN
ahs-12347	95	5	of	of	ADP
ahs-12347	95	6	hemerocallis	hemerocalli	NOUN
ahs-12347	95	7	native	native	ADJ
ahs-12347	95	8	to	to	ADP
ahs-12347	95	9	korea	korea	PROPN
ahs-12347	95	10	may	may	AUX
ahs-12347	95	11	not	not	PART
ahs-12347	95	12	be	be	AUX
ahs-12347	95	13	easy	easy	ADJ
ahs-12347	95	14	to	to	PART
ahs-12347	95	15	resolve	resolve	VERB
ahs-12347	95	16	and	and	CCONJ
ahs-12347	95	17	flowering	flowering	NOUN
ahs-12347	95	18	time	time	NOUN
ahs-12347	95	19	in	in	ADP
ahs-12347	95	20	f1	f1	ADJ
ahs-12347	95	21	hybrids	hybrid	NOUN
ahs-12347	95	22	between	between	ADP
ahs-12347	95	23	h.	h.	PROPN
ahs-12347	95	24	fulva	fulva	PROPN
ahs-12347	95	25	(	(	PUNCT
ahs-12347	95	26	day	day	NOUN
ahs-12347	95	27	flowering	flowering	NOUN
ahs-12347	95	28	)	)	PUNCT
ahs-12347	95	29	and	and	CCONJ
ahs-12347	95	30	h.	h.	PROPN
ahs-12347	95	31	citrina	citrina	PROPN
ahs-12347	95	32	(	(	PUNCT
ahs-12347	95	33	nocturnal	nocturnal	ADJ
ahs-12347	95	34	flowering	flowering	NOUN
ahs-12347	95	35	)	)	PUNCT
ahs-12347	95	36	showed	show	VERB
ahs-12347	95	37	discontinuous	discontinuous	ADJ
ahs-12347	95	38	bimodal	bimodal	NOUN
ahs-12347	95	39	distribution	distribution	NOUN
ahs-12347	95	40	(	(	PUNCT
ahs-12347	95	41	hasegawa	hasegawa	PROPN
ahs-12347	95	42	et	et	PROPN
ahs-12347	95	43	al	al	PROPN
ahs-12347	95	44	.	.	PROPN
ahs-12347	95	45	,	,	PUNCT
ahs-12347	95	46	2006	2006	NUM
ahs-12347	95	47	)	)	PUNCT
ahs-12347	95	48	.	.	PUNCT
ahs-12347	96	1	beyond	beyond	ADP
ahs-12347	96	2	the	the	DET
ahs-12347	96	3	identification	identification	NOUN
ahs-12347	96	4	issue	issue	NOUN
ahs-12347	96	5	for	for	ADP
ahs-12347	96	6	the	the	DET
ahs-12347	96	7	accessions	accession	NOUN
ahs-12347	96	8	h.	h.	PROPN
ahs-12347	96	9	thunbergii	thunbergii	PROPN
ahs-12347	96	10	ka8­13	ka8­13	PROPN
ahs-12347	96	11	,	,	PUNCT
ahs-12347	96	12	grouping	group	VERB
ahs-12347	96	13	of	of	ADP
ahs-12347	96	14	species	specie	NOUN
ahs-12347	96	15	investigat­	investigat­	NOUN
ahs-12347	96	16	ed	ed	NOUN
ahs-12347	96	17	in	in	ADP
ahs-12347	96	18	this	this	DET
ahs-12347	96	19	study	study	NOUN
ahs-12347	96	20	differs	differ	VERB
ahs-12347	96	21	significantly	significantly	ADV
ahs-12347	96	22	between	between	ADP
ahs-12347	96	23	nrits	nrit	NOUN
ahs-12347	96	24	and	and	CCONJ
ahs-12347	96	25	cpis	cpis	PROPN
ahs-12347	96	26	(	(	PUNCT
ahs-12347	96	27	tables	table	NOUN
ahs-12347	96	28	2	2	NUM
ahs-12347	96	29	and	and	CCONJ
ahs-12347	96	30	3	3	NUM
ahs-12347	96	31	)	)	PUNCT
ahs-12347	96	32	.	.	PUNCT
ahs-12347	97	1	difficulties	difficulty	NOUN
ahs-12347	97	2	with	with	ADP
ahs-12347	97	3	identifying	identify	VERB
ahs-12347	97	4	species	specie	NOUN
ahs-12347	97	5	of	of	ADP
ahs-12347	97	6	hemerocallis	hemerocalli	NOUN
ahs-12347	97	7	native	native	ADJ
ahs-12347	97	8	to	to	ADP
ahs-12347	97	9	korea	korea	PROPN
ahs-12347	97	10	may	may	AUX
ahs-12347	97	11	not	not	PART
ahs-12347	97	12	be	be	AUX
ahs-12347	97	13	easy	easy	ADJ
ahs-12347	97	14	to	to	PART
ahs-12347	97	15	resolve	resolve	VERB
ahs-12347	97	16	and	and	CCONJ
ahs-12347	97	17	flowering	flowering	NOUN
ahs-12347	97	18	time	time	NOUN
ahs-12347	97	19	in	in	ADP
ahs-12347	97	20	f1	f1	ADJ
ahs-12347	97	21	hybrids	hybrid	NOUN
ahs-12347	97	22	between	between	ADP
ahs-12347	97	23	h.	h.	PROPN
ahs-12347	97	24	fulva	fulva	PROPN
ahs-12347	97	25	(	(	PUNCT
ahs-12347	97	26	day	day	NOUN
ahs-12347	97	27	flowering	flowering	NOUN
ahs-12347	97	28	)	)	PUNCT
ahs-12347	97	29	and	and	CCONJ
ahs-12347	97	30	h.	h.	PROPN
ahs-12347	97	31	citrina	citrina	PROPN
ahs-12347	97	32	(	(	PUNCT
ahs-12347	97	33	night	night	NOUN
ahs-12347	97	34	flowering	flowering	NOUN
ahs-12347	97	35	)	)	PUNCT
ahs-12347	97	36	showed	show	VERB
ahs-12347	97	37	discontinuous	discontinuous	ADJ
ahs-12347	97	38	bimodal	bimodal	NOUN
ahs-12347	97	39	distribu­	distribu­	PROPN
ahs-12347	97	40	tion	tion	NOUN
ahs-12347	97	41	(	(	PUNCT
ahs-12347	97	42	hasegawa	hasegawa	PROPN
ahs-12347	97	43	et	et	PROPN
ahs-12347	97	44	al	al	PROPN
ahs-12347	97	45	.	.	PROPN
ahs-12347	97	46	,	,	PUNCT
ahs-12347	97	47	2006	2006	NUM
ahs-12347	97	48	)	)	PUNCT
ahs-12347	97	49	.	.	PUNCT
ahs-12347	98	1	distinguishing	distinguish	VERB
ahs-12347	98	2	nocturnal	nocturnal	ADJ
ahs-12347	98	3	flowering	flowering	NOUN
ahs-12347	98	4	forms	form	NOUN
ahs-12347	98	5	of	of	ADP
ahs-12347	98	6	h.	h.	PROPN
ahs-12347	98	7	minor	minor	PROPN
ahs-12347	98	8	from	from	ADP
ahs-12347	98	9	day	day	NOUN
ahs-12347	98	10	flowering	flowering	NOUN
ahs-12347	98	11	forms	form	NOUN
ahs-12347	98	12	is	be	AUX
ahs-12347	98	13	not	not	PART
ahs-12347	98	14	possible	possible	ADJ
ahs-12347	98	15	due	due	ADP
ahs-12347	98	16	to	to	ADP
ahs-12347	98	17	the	the	DET
ahs-12347	98	18	existence	existence	NOUN
ahs-12347	98	19	of	of	ADP
ahs-12347	98	20	two	two	NUM
ahs-12347	98	21	different	different	ADJ
ahs-12347	98	22	genotypes	genotype	NOUN
ahs-12347	98	23	collected	collect	VERB
ahs-12347	98	24	from	from	ADP
ahs-12347	98	25	china	china	PROPN
ahs-12347	98	26	,	,	PUNCT
ahs-12347	98	27	korea	korea	PROPN
ahs-12347	98	28	and	and	CCONJ
ahs-12347	98	29	far	far	ADV
ahs-12347	98	30	eastern	eastern	ADJ
ahs-12347	98	31	russia	russia	PROPN
ahs-12347	98	32	and	and	CCONJ
ahs-12347	98	33	by	by	ADP
ahs-12347	98	34	testing	test	VERB
ahs-12347	98	35	the	the	DET
ahs-12347	98	36	universal	universal	ADJ
ahs-12347	98	37	primers	primer	NOUN
ahs-12347	98	38	by	by	ADP
ahs-12347	98	39	snps	snps	PROPN
ahs-12347	98	40	of	of	ADP
ahs-12347	98	41	nrits	nrit	NOUN
ahs-12347	98	42	region	region	NOUN
ahs-12347	98	43	and	and	CCONJ
ahs-12347	98	44	cpis	cpis	NOUN
ahs-12347	98	45	.	.	PUNCT
ahs-12347	99	1	however	however	ADV
ahs-12347	99	2	,	,	PUNCT
ahs-12347	99	3	these	these	DET
ahs-12347	99	4	primers	primer	NOUN
ahs-12347	99	5	were	be	AUX
ahs-12347	99	6	used	use	VERB
ahs-12347	99	7	suc­	suc­	PROPN
ahs-12347	99	8	cessfully	cessfully	ADV
ahs-12347	99	9	to	to	PART
ahs-12347	99	10	identify	identify	VERB
ahs-12347	99	11	mother	mother	NOUN
ahs-12347	99	12	plants	plant	NOUN
ahs-12347	99	13	and	and	CCONJ
ahs-12347	99	14	seedlings	seedling	NOUN
ahs-12347	99	15	of	of	ADP
ahs-12347	99	16	ligustrum	ligustrum	ADJ
ahs-12347	99	17	quihoui	quihoui	ADJ
ahs-12347	99	18	carrière	carrière	NOUN
ahs-12347	99	19	(	(	PUNCT
ahs-12347	99	20	ma	ma	PROPN
ahs-12347	99	21	et	et	PROPN
ahs-12347	99	22	al	al	PROPN
ahs-12347	99	23	.	.	PUNCT
ahs-12347	99	24	,	,	PUNCT
ahs-12347	99	25	2014	2014	NUM
ahs-12347	99	26	)	)	PUNCT
ahs-12347	99	27	.	.	PUNCT
ahs-12347	100	1	table	table	NOUN
ahs-12347	100	2	2	2	NUM
ahs-12347	100	3	­	­	NOUN
ahs-12347	100	4	haplotype	haplotype	NOUN
ahs-12347	100	5	based	base	VERB
ahs-12347	100	6	on	on	ADP
ahs-12347	100	7	single	single	ADJ
ahs-12347	100	8	nucleotide	nucleotide	ADJ
ahs-12347	100	9	polymorphisms	polymorphism	NOUN
ahs-12347	100	10	(	(	PUNCT
ahs-12347	100	11	snps	snps	PROPN
ahs-12347	100	12	)	)	PUNCT
ahs-12347	100	13	and	and	CCONJ
ahs-12347	100	14	insertion	insertion	NOUN
ahs-12347	100	15	and	and	CCONJ
ahs-12347	100	16	deletion	deletion	NOUN
ahs-12347	100	17	(	(	PUNCT
ahs-12347	100	18	in	in	ADP
ahs-12347	100	19	/	/	SYM
ahs-12347	100	20	del	del	NOUN
ahs-12347	100	21	)	)	PUNCT
ahs-12347	100	22	of	of	ADP
ahs-12347	100	23	a	a	DET
ahs-12347	100	24	nuclear	nuclear	ADJ
ahs-12347	100	25	internal	internal	NOUN
ahs-12347	100	26	tran­	tran­	NUM
ahs-12347	100	27	scribed	scribe	VERB
ahs-12347	100	28	spacer	spacer	NOUN
ahs-12347	100	29	1	1	NUM
ahs-12347	100	30	,	,	PUNCT
ahs-12347	100	31	2	2	NUM
ahs-12347	100	32	in	in	ADP
ahs-12347	100	33	a	a	DET
ahs-12347	100	34	ribosomal	ribosomal	NOUN
ahs-12347	100	35	rna	rna	NOUN
ahs-12347	100	36	gene	gene	NOUN
ahs-12347	100	37	of	of	ADP
ahs-12347	100	38	hemerocallis	hemerocallis	NOUN
ahs-12347	100	39	accessions	accession	NOUN
ahs-12347	100	40	haplotype	haplotype	NOUN
ahs-12347	100	41	ncbi	ncbi	NOUN
ahs-12347	100	42	registration	registration	NOUN
ahs-12347	100	43	positions	position	NOUN
ahs-12347	100	44	and	and	CCONJ
ahs-12347	100	45	codes	code	NOUN
ahs-12347	100	46	of	of	ADP
ahs-12347	100	47	nucleotide	nucleotide	ADJ
ahs-12347	100	48	single	single	ADJ
ahs-12347	100	49	nucleotide	nucleotide	ADJ
ahs-12347	100	50	polymorphisms	polymorphism	NOUN
ahs-12347	100	51	in	in	ADP
ahs-12347	100	52	/	/	SYM
ahs-12347	100	53	del	del	PROPN
ahs-12347	100	54	78	78	NUM
ahs-12347	100	55	86	86	NUM
ahs-12347	100	56	99	99	NUM
ahs-12347	100	57	113	113	NUM
ahs-12347	100	58	120	120	NUM
ahs-12347	100	59	170	170	NUM
ahs-12347	100	60	206	206	NUM
ahs-12347	100	61	210	210	NUM
ahs-12347	100	62	231	231	NUM
ahs-12347	100	63	254	254	NUM
ahs-12347	100	64	432	432	NUM
ahs-12347	100	65	568	568	NUM
ahs-12347	100	66	597	597	NUM
ahs-12347	100	67	435­441	435­441	NUM
ahs-12347	100	68	i­1	i­1	ADJ
ahs-12347	100	69	kt189161	kt189161	NOUN
ahs-12347	100	70	c	c	X
ahs-12347	100	71	/	/	SYM
ahs-12347	100	72	t	t	PROPN
ahs-12347	100	73	c	c	PROPN
ahs-12347	100	74	/	/	SYM
ahs-12347	100	75	t	t	PROPN
ahs-12347	100	76	c	c	NOUN
ahs-12347	100	77	c	c	X
ahs-12347	100	78	/	/	SYM
ahs-12347	100	79	t	t	PROPN
ahs-12347	100	80	c	c	PROPN
ahs-12347	100	81	/	/	SYM
ahs-12347	100	82	t	t	PROPN
ahs-12347	100	83	a	a	DET
ahs-12347	100	84	g	g	NOUN
ahs-12347	100	85	a	a	DET
ahs-12347	100	86	a	a	NOUN
ahs-12347	100	87	/	/	SYM
ahs-12347	100	88	g	g	NOUN
ahs-12347	100	89	a	a	PRON
ahs-12347	100	90	a	a	DET
ahs-12347	100	91	g	g	NOUN
ahs-12347	101	1	g	g	PROPN
ahs-12347	101	2	c7	c7	PROPN
ahs-12347	101	3	i­2	i­2	PROPN
ahs-12347	101	4	kt189162	kt189162	PROPN
ahs-12347	102	1	c	c	NOUN
ahs-12347	103	1	c	c	NOUN
ahs-12347	103	2	c	c	NOUN
ahs-12347	103	3	c	c	NOUN
ahs-12347	103	4	c	c	NOUN
ahs-12347	103	5	a	a	DET
ahs-12347	103	6	g	g	NOUN
ahs-12347	103	7	a	a	DET
ahs-12347	103	8	a	a	DET
ahs-12347	103	9	a	a	NOUN
ahs-12347	103	10	a	a	DET
ahs-12347	103	11	g	g	NOUN
ahs-12347	103	12	g	g	PROPN
ahs-12347	103	13	c6­7	c6­7	PROPN
ahs-12347	103	14	ii	ii	PROPN
ahs-12347	103	15	kt189163	kt189163	PROPN
ahs-12347	104	1	c	c	PROPN
ahs-12347	105	1	c	c	NOUN
ahs-12347	105	2	t	t	PROPN
ahs-12347	105	3	c	c	NOUN
ahs-12347	105	4	c	c	NOUN
ahs-12347	105	5	g	g	PROPN
ahs-12347	105	6	c	c	NOUN
ahs-12347	105	7	c	c	NOUN
ahs-12347	105	8	c	c	NOUN
ahs-12347	105	9	c	c	PROPN
ahs-12347	105	10	g	g	PROPN
ahs-12347	105	11	a	a	DET
ahs-12347	105	12	a	a	DET
ahs-12347	105	13	c7	c7	PROPN
ahs-12347	105	14	table	table	NOUN
ahs-12347	105	15	3	3	NUM
ahs-12347	105	16	­	­	NUM
ahs-12347	105	17	haplotypes	haplotype	NOUN
ahs-12347	105	18	based	base	VERB
ahs-12347	105	19	on	on	ADP
ahs-12347	105	20	single	single	ADJ
ahs-12347	105	21	nucleotide	nucleotide	ADJ
ahs-12347	105	22	polymorphisms	polymorphism	NOUN
ahs-12347	105	23	(	(	PUNCT
ahs-12347	105	24	snps	snps	PROPN
ahs-12347	105	25	)	)	PUNCT
ahs-12347	105	26	and	and	CCONJ
ahs-12347	105	27	insertion	insertion	NOUN
ahs-12347	105	28	and	and	CCONJ
ahs-12347	105	29	deletion	deletion	NOUN
ahs-12347	105	30	(	(	PUNCT
ahs-12347	105	31	in	in	ADP
ahs-12347	105	32	/	/	SYM
ahs-12347	105	33	del	del	NOUN
ahs-12347	105	34	)	)	PUNCT
ahs-12347	105	35	of	of	ADP
ahs-12347	105	36	a	a	DET
ahs-12347	105	37	chloroplast	chloroplast	NOUN
ahs-12347	105	38	interspacer	interspacer	NOUN
ahs-12347	105	39	region	region	NOUN
ahs-12347	105	40	of	of	ADP
ahs-12347	105	41	hemerocallis	hemerocallis	NOUN
ahs-12347	105	42	accessions	accession	NOUN
ahs-12347	105	43	haplotype	haplotype	NOUN
ahs-12347	105	44	ncbi	ncbi	NOUN
ahs-12347	105	45	registration	registration	NOUN
ahs-12347	105	46	positions	position	NOUN
ahs-12347	105	47	and	and	CCONJ
ahs-12347	105	48	codes	code	NOUN
ahs-12347	105	49	of	of	ADP
ahs-12347	105	50	nucleotide	nucleotide	ADJ
ahs-12347	105	51	single	single	ADJ
ahs-12347	105	52	nucleotide	nucleotide	ADJ
ahs-12347	105	53	polymorphisms	polymorphism	NOUN
ahs-12347	105	54	in	in	ADP
ahs-12347	105	55	/	/	SYM
ahs-12347	105	56	del	del	NOUN
ahs-12347	105	57	26	26	NUM
ahs-12347	105	58	216	216	NUM
ahs-12347	105	59	243	243	NUM
ahs-12347	105	60	246	246	NUM
ahs-12347	105	61	291	291	NUM
ahs-12347	105	62	315	315	NUM
ahs-12347	105	63	37	37	NUM
ahs-12347	105	64	302	302	NUM
ahs-12347	106	1	i	i	PRON
ahs-12347	106	2	kt189164	kt189164	PROPN
ahs-12347	106	3	t	t	PROPN
ahs-12347	106	4	c	c	NOUN
ahs-12347	106	5	c	c	PROPN
ahs-12347	106	6	c	c	PROPN
ahs-12347	106	7	a	a	DET
ahs-12347	106	8	a	a	DET
ahs-12347	106	9	t9	t9	PROPN
ahs-12347	106	10	t7	t7	PROPN
ahs-12347	106	11	i­1	i­1	PROPN
ahs-12347	107	1	kt189165	kt189165	PROPN
ahs-12347	107	2	t	t	PROPN
ahs-12347	108	1	c	c	PROPN
ahs-12347	108	2	c	c	PROPN
ahs-12347	108	3	c	c	PROPN
ahs-12347	109	1	a	a	DET
ahs-12347	109	2	a	a	DET
ahs-12347	109	3	t9	t9	PROPN
ahs-12347	109	4	t8	t8	PROPN
ahs-12347	109	5	ii	ii	PROPN
ahs-12347	109	6	kt189166	kt189166	PROPN
ahs-12347	109	7	t	t	PROPN
ahs-12347	109	8	c	c	NOUN
ahs-12347	109	9	c	c	NOUN
ahs-12347	109	10	c	c	PROPN
ahs-12347	109	11	c	c	PROPN
ahs-12347	109	12	a	a	DET
ahs-12347	109	13	t9	t9	PROPN
ahs-12347	109	14	t8	t8	PROPN
ahs-12347	109	15	iii	iii	NUM
ahs-12347	109	16	kt189167	kt189167	PROPN
ahs-12347	109	17	t	t	PROPN
ahs-12347	109	18	c	c	PROPN
ahs-12347	109	19	c	c	PROPN
ahs-12347	109	20	a	a	DET
ahs-12347	109	21	a	a	DET
ahs-12347	109	22	a	a	DET
ahs-12347	109	23	t9	t9	PROPN
ahs-12347	109	24	t8	t8	NOUN
ahs-12347	109	25	iv	iv	ADP
ahs-12347	109	26	kt189168	kt189168	PROPN
ahs-12347	109	27	c	c	PROPN
ahs-12347	109	28	c	c	PROPN
ahs-12347	109	29	a	a	DET
ahs-12347	109	30	a	a	DET
ahs-12347	109	31	a	a	DET
ahs-12347	109	32	a	a	DET
ahs-12347	109	33	t8	t8	NOUN
ahs-12347	109	34	t8	t8	X
ahs-12347	109	35	v	v	ADP
ahs-12347	109	36	kt189169	kt189169	PROPN
ahs-12347	109	37	c	c	NOUN
ahs-12347	109	38	c	c	NOUN
ahs-12347	109	39	c	c	PROPN
ahs-12347	109	40	a	a	DET
ahs-12347	109	41	a	a	DET
ahs-12347	109	42	a	a	DET
ahs-12347	109	43	t8	t8	X
ahs-12347	109	44	t8	t8	X
ahs-12347	109	45	vi	vi	DET
ahs-12347	109	46	kt189170	kt189170	NOUN
ahs-12347	110	1	c	c	PROPN
ahs-12347	110	2	a	a	DET
ahs-12347	110	3	c	c	NOUN
ahs-12347	110	4	a	a	DET
ahs-12347	110	5	a	a	DET
ahs-12347	110	6	a	a	DET
ahs-12347	110	7	t10	t10	NOUN
ahs-12347	110	8	t8	t8	PROPN
ahs-12347	110	9	park	park	PROPN
ahs-12347	110	10	et	et	PROPN
ahs-12347	110	11	al	al	PROPN
ahs-12347	110	12	.	.	PROPN
ahs-12347	111	1	‐	‐	NOUN
ahs-12347	111	2	hemerocallis	hemerocallis	NOUN
ahs-12347	111	3	germplasm	germplasm	NOUN
ahs-12347	111	4	evaluation	evaluation	NOUN
ahs-12347	111	5	251	251	NUM
ahs-12347	111	6	seedlings	seedling	NOUN
ahs-12347	111	7	grouped	group	VERB
ahs-12347	111	8	in	in	ADP
ahs-12347	111	9	the	the	DET
ahs-12347	111	10	haplotype	haplotype	NOUN
ahs-12347	111	11	with	with	ADP
ahs-12347	111	12	their	their	PRON
ahs-12347	111	13	moth­	moth­	ADJ
ahs-12347	111	14	er	er	INTJ
ahs-12347	111	15	plants	plant	NOUN
ahs-12347	111	16	,	,	PUNCT
ahs-12347	111	17	except	except	SCONJ
ahs-12347	111	18	the	the	DET
ahs-12347	111	19	mother	mother	NOUN
ahs-12347	111	20	plant	plant	NOUN
ahs-12347	111	21	(	(	PUNCT
ahs-12347	111	22	c1	c1	PROPN
ahs-12347	111	23	)	)	PUNCT
ahs-12347	111	24	and	and	CCONJ
ahs-12347	111	25	seedlings	seedling	NOUN
ahs-12347	111	26	2­3	2­3	NUM
ahs-12347	111	27	of	of	ADP
ahs-12347	111	28	h.	h.	PROPN
ahs-12347	111	29	liloasphodelus	liloasphodelus	PROPN
ahs-12347	111	30	(	(	PUNCT
ahs-12347	111	31	c1/2­3	c1/2­3	NOUN
ahs-12347	111	32	)	)	PUNCT
ahs-12347	111	33	,	,	PUNCT
ahs-12347	111	34	which	which	PRON
ahs-12347	111	35	belonged	belong	VERB
ahs-12347	111	36	to	to	PART
ahs-12347	111	37	type	type	VERB
ahs-12347	111	38	i	i	PRON
ahs-12347	111	39	,	,	PUNCT
ahs-12347	111	40	type	type	VERB
ahs-12347	111	41	i­2	i­2	PROPN
ahs-12347	111	42	and	and	CCONJ
ahs-12347	111	43	i­1	i­1	PROPN
ahs-12347	111	44	,	,	PUNCT
ahs-12347	111	45	respectively	respectively	ADV
ahs-12347	111	46	,	,	PUNCT
ahs-12347	111	47	in	in	ADP
ahs-12347	111	48	nr­its	nr­it	NOUN
ahs-12347	111	49	region	region	NOUN
ahs-12347	111	50	(	(	PUNCT
ahs-12347	111	51	tables	table	NOUN
ahs-12347	111	52	1	1	NUM
ahs-12347	111	53	and	and	CCONJ
ahs-12347	111	54	2	2	NUM
ahs-12347	111	55	)	)	PUNCT
ahs-12347	111	56	.	.	PUNCT
ahs-12347	112	1	the	the	DET
ahs-12347	112	2	current	current	ADJ
ahs-12347	112	3	primers	primer	NOUN
ahs-12347	112	4	for	for	ADP
ahs-12347	112	5	nrits	nrit	NOUN
ahs-12347	112	6	region	region	NOUN
ahs-12347	112	7	and	and	CCONJ
ahs-12347	112	8	cpis	cpis	PROPN
ahs-12347	112	9	can	can	AUX
ahs-12347	112	10	not	not	PART
ahs-12347	112	11	be	be	AUX
ahs-12347	112	12	used	use	VERB
ahs-12347	112	13	to	to	PART
ahs-12347	112	14	differentiate	differentiate	VERB
ahs-12347	112	15	noc­	noc­	ADJ
ahs-12347	112	16	turnal	turnal	ADJ
ahs-12347	112	17	flowering	flower	VERB
ahs-12347	112	18	species	specie	NOUN
ahs-12347	112	19	from	from	ADP
ahs-12347	112	20	day	day	NOUN
ahs-12347	112	21	flowering	flower	VERB
ahs-12347	112	22	species	specie	NOUN
ahs-12347	112	23	.	.	PUNCT
ahs-12347	113	1	lee	lee	PROPN
ahs-12347	113	2	and	and	CCONJ
ahs-12347	113	3	maki	maki	PROPN
ahs-12347	113	4	(	(	PUNCT
ahs-12347	113	5	2015	2015	NUM
ahs-12347	113	6	)	)	PUNCT
ahs-12347	113	7	reported	report	VERB
ahs-12347	113	8	that	that	SCONJ
ahs-12347	113	9	cpdna	cpdna	ADV
ahs-12347	113	10	in	in	ADP
ahs-12347	113	11	the	the	DET
ahs-12347	113	12	majority	majority	NOUN
ahs-12347	113	13	of	of	ADP
ahs-12347	113	14	cultivars	cultivar	NOUN
ahs-12347	113	15	were	be	AUX
ahs-12347	113	16	inherited	inherit	VERB
ahs-12347	113	17	from	from	ADP
ahs-12347	113	18	h.	h.	PROPN
ahs-12347	113	19	 	 	SPACE
ahs-12347	113	20	albo‐	albo‐	ADJ
ahs-12347	113	21	marginata	marginata	NOUN
ahs-12347	113	22	,	,	PUNCT
ahs-12347	113	23	although	although	SCONJ
ahs-12347	113	24	the	the	DET
ahs-12347	113	25	leaf	leaf	NOUN
ahs-12347	113	26	morphology	morphology	NOUN
ahs-12347	113	27	was	be	AUX
ahs-12347	113	28	simi­	simi­	VERB
ahs-12347	113	29	lar	lar	ADJ
ahs-12347	113	30	to	to	ADP
ahs-12347	113	31	h.	h.	NOUN
ahs-12347	113	32	 	 	SPACE
ahs-12347	113	33	sieboldiana	sieboldiana	PROPN
ahs-12347	113	34	,	,	PUNCT
ahs-12347	113	35	indicating	indicate	VERB
ahs-12347	113	36	that	that	SCONJ
ahs-12347	113	37	nrits	nrit	VERB
ahs-12347	113	38	should	should	AUX
ahs-12347	113	39	fur­	fur­	ADV
ahs-12347	113	40	ther	ther	ADV
ahs-12347	113	41	be	be	AUX
ahs-12347	113	42	investigated	investigate	VERB
ahs-12347	113	43	.	.	PUNCT
ahs-12347	114	1	4	4	X
ahs-12347	114	2	.	.	X
ahs-12347	114	3	conclusions	conclusion	NOUN
ahs-12347	114	4	the	the	DET
ahs-12347	114	5	sequence	sequence	NOUN
ahs-12347	114	6	variations	variation	NOUN
ahs-12347	114	7	of	of	ADP
ahs-12347	114	8	nrits	nrit	NOUN
ahs-12347	114	9	region	region	NOUN
ahs-12347	114	10	and	and	CCONJ
ahs-12347	114	11	cpis	cpis	PROPN
ahs-12347	114	12	can	can	AUX
ahs-12347	114	13	not	not	PART
ahs-12347	114	14	be	be	AUX
ahs-12347	114	15	used	use	VERB
ahs-12347	114	16	to	to	PART
ahs-12347	114	17	distinguish	distinguish	VERB
ahs-12347	114	18	nocturnal	nocturnal	ADJ
ahs-12347	114	19	flowering	flower	VERB
ahs-12347	114	20	species	specie	NOUN
ahs-12347	114	21	from	from	ADP
ahs-12347	114	22	day	day	NOUN
ahs-12347	114	23	flowering	flower	VERB
ahs-12347	114	24	hemerocallis	hemerocalli	NOUN
ahs-12347	114	25	species	specie	NOUN
ahs-12347	114	26	.	.	PUNCT
ahs-12347	115	1	markers	marker	NOUN
ahs-12347	115	2	other	other	ADJ
ahs-12347	115	3	than	than	ADP
ahs-12347	115	4	those	those	PRON
ahs-12347	115	5	evaluated	evaluate	VERB
ahs-12347	115	6	in	in	ADP
ahs-12347	115	7	this	this	DET
ahs-12347	115	8	study	study	NOUN
ahs-12347	115	9	should	should	AUX
ahs-12347	115	10	be	be	AUX
ahs-12347	115	11	evaluated	evaluate	VERB
ahs-12347	115	12	.	.	PUNCT
ahs-12347	116	1	genetic	genetic	ADJ
ahs-12347	116	2	variations	variation	NOUN
ahs-12347	116	3	among	among	ADP
ahs-12347	116	4	seedlings	seedling	NOUN
ahs-12347	116	5	or	or	CCONJ
ahs-12347	116	6	between	between	ADP
ahs-12347	116	7	mother	mother	NOUN
ahs-12347	116	8	plant	plant	NOUN
ahs-12347	116	9	and	and	CCONJ
ahs-12347	116	10	their	their	PRON
ahs-12347	116	11	seedlings	seedling	NOUN
ahs-12347	116	12	were	be	AUX
ahs-12347	116	13	observed	observe	VERB
ahs-12347	116	14	in	in	ADP
ahs-12347	116	15	h.	h.	PROPN
ahs-12347	116	16	lilioasphodelus	lilioasphodelus	PROPN
ahs-12347	116	17	(	(	PUNCT
ahs-12347	116	18	c1/1	c1/1	NOUN
ahs-12347	116	19	vs.	vs.	ADP
ahs-12347	116	20	c1/2­3	c1/2­3	NOUN
ahs-12347	116	21	)	)	PUNCT
ahs-12347	116	22	,	,	PUNCT
ahs-12347	116	23	requiring	require	VERB
ahs-12347	116	24	seedlings	seedling	NOUN
ahs-12347	116	25	of	of	ADP
ahs-12347	116	26	h.	h.	PROPN
ahs-12347	116	27	lilioasphodelus	lilioasphodelus	PROPN
ahs-12347	116	28	to	to	PART
ahs-12347	116	29	investigate	investigate	VERB
ahs-12347	116	30	to	to	PART
ahs-12347	116	31	confirm	confirm	VERB
ahs-12347	116	32	the	the	DET
ahs-12347	116	33	results	result	NOUN
ahs-12347	116	34	of	of	ADP
ahs-12347	116	35	this	this	DET
ahs-12347	116	36	study	study	NOUN
ahs-12347	116	37	.	.	PUNCT
ahs-12347	117	1	discrepancies	discrepancy	NOUN
ahs-12347	117	2	in	in	ADP
ahs-12347	117	3	flowering	flower	VERB
ahs-12347	117	4	time	time	NOUN
ahs-12347	117	5	among	among	ADP
ahs-12347	117	6	h.	h.	PROPN
ahs-12347	117	7	minor	minor	ADJ
ahs-12347	117	8	accessions	accession	NOUN
ahs-12347	117	9	also	also	ADV
ahs-12347	117	10	suggest	suggest	VERB
ahs-12347	117	11	that	that	SCONJ
ahs-12347	117	12	more	more	ADJ
ahs-12347	117	13	germplasm	germplasm	NOUN
ahs-12347	117	14	with	with	ADP
ahs-12347	117	15	diverse	diverse	ADJ
ahs-12347	117	16	geographic	geographic	ADJ
ahs-12347	117	17	origins	origin	NOUN
ahs-12347	117	18	should	should	AUX
ahs-12347	117	19	be	be	AUX
ahs-12347	117	20	evaluated	evaluate	VERB
ahs-12347	117	21	.	.	PUNCT
ahs-12347	118	1	acknowledgements	acknowledgement	NOUN
ahs-12347	118	2	critical	critical	ADJ
ahs-12347	118	3	review	review	NOUN
ahs-12347	118	4	and	and	CCONJ
ahs-12347	118	5	english	english	ADJ
ahs-12347	118	6	editing	editing	NOUN
ahs-12347	118	7	of	of	ADP
ahs-12347	118	8	the	the	DET
ahs-12347	118	9	manu­	manu­	PROPN
ahs-12347	118	10	script	script	NOUN
ahs-12347	118	11	by	by	ADP
ahs-12347	118	12	dr	dr	PROPN
ahs-12347	118	13	.	.	PROPN
ahs-12347	118	14	c.j	c.j	PROPN
ahs-12347	118	15	.	.	PROPN
ahs-12347	118	16	catanzaro	catanzaro	PROPN
ahs-12347	118	17	,	,	PUNCT
ahs-12347	118	18	virginia	virginia	PROPN
ahs-12347	118	19	state	state	PROPN
ahs-12347	118	20	university	university	PROPN
ahs-12347	118	21	,	,	PUNCT
ahs-12347	118	22	va	va	PROPN
ahs-12347	118	23	,	,	PUNCT
ahs-12347	118	24	usa	usa	PROPN
ahs-12347	118	25	,	,	PUNCT
ahs-12347	118	26	is	be	AUX
ahs-12347	118	27	greatly	greatly	ADV
ahs-12347	118	28	appreciated	appreciated	ADJ
ahs-12347	118	29	.	.	PUNCT
ahs-12347	119	1	references	reference	NOUN
ahs-12347	119	2	chen	chen	PROPN
ahs-12347	119	3	x.	x.	PROPN
ahs-12347	119	4	,	,	PUNCT
ahs-12347	119	5	noguchi	noguchi	PROPN
ahs-12347	119	6	j.	j.	PROPN
ahs-12347	119	7	,	,	PUNCT
ahs-12347	119	8	2000	2000	NUM
ahs-12347	119	9	­	­	VERB
ahs-12347	119	10	31	31	NUM
ahs-12347	119	11	.	.	PUNCT
ahs-12347	120	1	hemerocallis	hemerocallis	PROPN
ahs-12347	120	2	linnaeus	linnaeus	NOUN
ahs-12347	120	3	,	,	PUNCT
ahs-12347	120	4	sp	sp	PROPN
ahs-12347	120	5	.	.	PROPN
ahs-12347	120	6	p1	p1	PROPN
ahs-12347	120	7	.	.	PUNCT
ahs-12347	121	1	1:324	1:324	NUM
ahs-12347	121	2	.	.	NUM
ahs-12347	121	3	1753	1753	NUM
ahs-12347	121	4	.	.	PUNCT
ahs-12347	122	1	­	­	VERB
ahs-12347	122	2	flora	flora	NOUN
ahs-12347	122	3	of	of	ADP
ahs-12347	122	4	china	china	PROPN
ahs-12347	122	5	,	,	PUNCT
ahs-12347	122	6	24	24	NUM
ahs-12347	122	7	:	:	PUNCT
ahs-12347	122	8	161­165	161­165	NUM
ahs-12347	122	9	.	.	PUNCT
ahs-12347	123	1	gulia	gulia	PROPN
ahs-12347	123	2	s.k	s.k	PROPN
ahs-12347	123	3	.	.	PROPN
ahs-12347	123	4	,	,	PUNCT
ahs-12347	123	5	singh	singh	PROPN
ahs-12347	123	6	b.p	b.p	PROPN
ahs-12347	123	7	.	.	PROPN
ahs-12347	123	8	,	,	PUNCT
ahs-12347	123	9	cartter	cartter	VERB
ahs-12347	123	10	j.	j.	PROPN
ahs-12347	123	11	,	,	PUNCT
ahs-12347	123	12	griesbach	griesbach	PROPN
ahs-12347	123	13	r.j	r.j	PROPN
ahs-12347	123	14	.	.	PROPN
ahs-12347	123	15	,	,	PUNCT
ahs-12347	123	16	2009	2009	NUM
ahs-12347	123	17	­	­	NUM
ahs-12347	123	18	daylily	daylily	ADV
ahs-12347	123	19	:	:	PUNCT
ahs-12347	123	20	botany	botany	NOUN
ahs-12347	123	21	,	,	PUNCT
ahs-12347	123	22	propagation	propagation	NOUN
ahs-12347	123	23	,	,	PUNCT
ahs-12347	123	24	breeding	breeding	NOUN
ahs-12347	123	25	.	.	PUNCT
ahs-12347	124	1	­	­	PROPN
ahs-12347	124	2	hort	hort	PROPN
ahs-12347	124	3	.	.	PUNCT
ahs-12347	125	1	rev	rev	PROPN
ahs-12347	125	2	.	.	PROPN
ahs-12347	125	3	,	,	PUNCT
ahs-12347	125	4	35	35	NUM
ahs-12347	125	5	:	:	SYM
ahs-12347	125	6	193­220	193­220	NUM
ahs-12347	125	7	.	.	PUNCT
ahs-12347	126	1	hasegawa	hasegawa	PROPN
ahs-12347	126	2	m.	m.	PROPN
ahs-12347	126	3	,	,	PUNCT
ahs-12347	126	4	yahara	yahara	NOUN
ahs-12347	126	5	t.	t.	PROPN
ahs-12347	126	6	,	,	PUNCT
ahs-12347	126	7	yasumoto	yasumoto	PROPN
ahs-12347	126	8	a.	a.	PROPN
ahs-12347	126	9	,	,	PUNCT
ahs-12347	126	10	hotta	hotta	ADJ
ahs-12347	126	11	m.	m.	NOUN
ahs-12347	126	12	,	,	PUNCT
ahs-12347	126	13	2006	2006	NUM
ahs-12347	126	14	­	­	NOUN
ahs-12347	126	15	bimodal	bimodal	NOUN
ahs-12347	126	16	distribution	distribution	NOUN
ahs-12347	126	17	of	of	ADP
ahs-12347	126	18	flowering	flower	VERB
ahs-12347	126	19	time	time	NOUN
ahs-12347	126	20	in	in	ADP
ahs-12347	126	21	a	a	DET
ahs-12347	126	22	nat‐	nat‐	ADJ
ahs-12347	126	23	ural	ural	ADJ
ahs-12347	126	24	hybrid	hybrid	ADJ
ahs-12347	126	25	population	population	NOUN
ahs-12347	126	26	of	of	ADP
ahs-12347	126	27	daylily	daylily	NOUN
ahs-12347	126	28	(	(	PUNCT
ahs-12347	126	29	hemerocallis	hemerocalli	NOUN
ahs-12347	126	30	fulva	fulva	NOUN
ahs-12347	126	31	)	)	PUNCT
ahs-12347	126	32	and	and	CCONJ
ahs-12347	126	33	night	night	NOUN
ahs-12347	126	34	lily	lily	PROPN
ahs-12347	126	35	(	(	PUNCT
ahs-12347	126	36	hemerocallis	hemerocallis	PROPN
ahs-12347	126	37	citrina	citrina	PROPN
ahs-12347	126	38	)	)	PUNCT
ahs-12347	126	39	.	.	PUNCT
ahs-12347	127	1	­	­	PROPN
ahs-12347	127	2	j.	j.	PROPN
ahs-12347	127	3	plant	plant	NOUN
ahs-12347	127	4	res	re	NOUN
ahs-12347	127	5	.	.	PUNCT
ahs-12347	127	6	,	,	PUNCT
ahs-12347	127	7	119	119	NUM
ahs-12347	127	8	:	:	PUNCT
ahs-12347	127	9	63­68	63­68	X
ahs-12347	127	10	.	.	PUNCT
ahs-12347	127	11	krestova	krestova	PROPN
ahs-12347	128	1	i.n	i.n	PROPN
ahs-12347	128	2	.	.	PROPN
ahs-12347	128	3	,	,	PUNCT
ahs-12347	128	4	nesterova	nesterova	PROPN
ahs-12347	128	5	s.v	s.v	PROPN
ahs-12347	128	6	.	.	PROPN
ahs-12347	128	7	,	,	PUNCT
ahs-12347	128	8	2003	2003	NUM
ahs-12347	128	9	­	­	VERB
ahs-12347	128	10	flowering	flower	VERB
ahs-12347	128	11	and	and	CCONJ
ahs-12347	128	12	pol‐	pol‐	PROPN
ahs-12347	128	13	lination	lination	NOUN
ahs-12347	128	14	of	of	ADP
ahs-12347	128	15	the	the	DET
ahs-12347	128	16	native	native	ADJ
ahs-12347	128	17	daylily	daylily	NOUN
ahs-12347	128	18	species	specie	NOUN
ahs-12347	128	19	(	(	PUNCT
ahs-12347	128	20	hemerocallis	hemerocalli	NOUN
ahs-12347	128	21	)	)	PUNCT
ahs-12347	128	22	in	in	ADP
ahs-12347	128	23	the	the	DET
ahs-12347	128	24	botanical	botanical	ADJ
ahs-12347	128	25	garden	garden	PROPN
ahs-12347	128	26	institute	institute	NOUN
ahs-12347	128	27	,	,	PUNCT
ahs-12347	128	28	far	far	PROPN
ahs-12347	128	29	east	east	NOUN
ahs-12347	128	30	branch	branch	NOUN
ahs-12347	128	31	,	,	PUNCT
ahs-12347	128	32	russian	russian	ADJ
ahs-12347	128	33	academy	academy	PROPN
ahs-12347	128	34	of	of	ADP
ahs-12347	128	35	sciences	sciences	PROPN
ahs-12347	128	36	.	.	PUNCT
ahs-12347	129	1	­	­	PROPN
ahs-12347	129	2	contemp	contemp	NOUN
ahs-12347	129	3	.	.	PUNCT
ahs-12347	130	1	problems	problem	NOUN
ahs-12347	130	2	ecol	ecol	PRON
ahs-12347	130	3	.	.	PUNCT
ahs-12347	130	4	,	,	PUNCT
ahs-12347	130	5	6	6	NUM
ahs-12347	130	6	:	:	SYM
ahs-12347	130	7	48­	48­	NUM
ahs-12347	130	8	454	454	NUM
ahs-12347	130	9	.	.	PUNCT
ahs-12347	131	1	lee	lee	PROPN
ahs-12347	131	2	s.	s.	PROPN
ahs-12347	131	3	,	,	PUNCT
ahs-12347	131	4	maki	maki	NOUN
ahs-12347	131	5	m.	m.	NOUN
ahs-12347	131	6	,	,	PUNCT
ahs-12347	131	7	2015	2015	NUM
ahs-12347	131	8	­	­	NOUN
ahs-12347	131	9	origins	origin	NOUN
ahs-12347	131	10	of	of	ADP
ahs-12347	131	11	hosta	hosta	NOUN
ahs-12347	131	12	cultivars	cultivar	NOUN
ahs-12347	131	13	based	base	VERB
ahs-12347	131	14	on	on	ADP
ahs-12347	131	15	sequence	sequence	NOUN
ahs-12347	131	16	variations	variation	NOUN
ahs-12347	131	17	in	in	ADP
ahs-12347	131	18	chloroplast	chloroplast	ADJ
ahs-12347	131	19	dna	dna	NOUN
ahs-12347	131	20	.	.	PUNCT
ahs-12347	132	1	­	­	PROPN
ahs-12347	132	2	hort	hort	PROPN
ahs-12347	132	3	.	.	PUNCT
ahs-12347	133	1	j.	j.	PROPN
ahs-12347	133	2	,	,	PUNCT
ahs-12347	133	3	84	84	NUM
ahs-12347	133	4	:	:	PUNCT
ahs-12347	133	5	350­354	350­354	NUM
ahs-12347	133	6	.	.	PUNCT
ahs-12347	134	1	ma	ma	PROPN
ahs-12347	134	2	s.h	s.h	PROPN
ahs-12347	134	3	.	.	PROPN
ahs-12347	134	4	,	,	PUNCT
ahs-12347	134	5	burchi	burchi	PROPN
ahs-12347	134	6	g.	g.	PROPN
ahs-12347	134	7	,	,	PUNCT
ahs-12347	134	8	suh	suh	PROPN
ahs-12347	134	9	j.k	j.k	PROPN
ahs-12347	134	10	.	.	PROPN
ahs-12347	134	11	,	,	PUNCT
ahs-12347	134	12	roh	roh	PROPN
ahs-12347	134	13	m.s	m.s	PROPN
ahs-12347	134	14	.	.	PROPN
ahs-12347	134	15	,	,	PUNCT
ahs-12347	134	16	joung	joung	PROPN
ahs-12347	134	17	y.h	y.h	PROPN
ahs-12347	134	18	.	.	PROPN
ahs-12347	134	19	,	,	PUNCT
ahs-12347	134	20	2014	2014	NUM
ahs-12347	134	21	­	­	NOUN
ahs-12347	134	22	identification	identification	NOUN
ahs-12347	134	23	of	of	ADP
ahs-12347	134	24	ligustrum	ligustrum	ADJ
ahs-12347	134	25	seedlings	seedling	NOUN
ahs-12347	134	26	based	base	VERB
ahs-12347	134	27	on	on	ADP
ahs-12347	134	28	sequence	sequence	NOUN
ahs-12347	134	29	analysis	analysis	NOUN
ahs-12347	134	30	of	of	ADP
ahs-12347	134	31	an	an	DET
ahs-12347	134	32	internal	internal	ADJ
ahs-12347	134	33	transcribed	transcribe	VERB
ahs-12347	134	34	spacer	spacer	NOUN
ahs-12347	134	35	.	.	PUNCT
ahs-12347	135	1	­	­	PROPN
ahs-12347	135	2	hort	hort	PROPN
ahs-12347	135	3	.	.	PUNCT
ahs-12347	136	1	environ	environ	PROPN
ahs-12347	136	2	.	.	PUNCT
ahs-12347	136	3	biotechnol	biotechnol	PROPN
ahs-12347	136	4	.	.	PUNCT
ahs-12347	136	5	,	,	PUNCT
ahs-12347	136	6	55	55	NUM
ahs-12347	136	7	:	:	SYM
ahs-12347	136	8	423­427	423­427	NUM
ahs-12347	136	9	.	.	PUNCT
ahs-12347	137	1	mcgarty	mcgarty	PROPN
ahs-12347	137	2	t.p	t.p	PROPN
ahs-12347	137	3	.	.	PROPN
ahs-12347	137	4	,	,	PUNCT
ahs-12347	137	5	2006	2006	NUM
ahs-12347	137	6	­	­	VERB
ahs-12347	137	7	phylogenetics	phylogenetic	NOUN
ahs-12347	137	8	,	,	PUNCT
ahs-12347	137	9	dna	dna	NOUN
ahs-12347	137	10	,	,	PUNCT
ahs-12347	137	11	classification	classification	NOUN
ahs-12347	137	12	and	and	CCONJ
ahs-12347	137	13	the	the	DET
ahs-12347	137	14	genus	genus	NOUN
ahs-12347	137	15	hemerocallis	hemerocalli	NOUN
ahs-12347	137	16	.	.	PUNCT
ahs-12347	138	1	­	­	VERB
ahs-12347	138	2	http://www.telmarcgar­	http://www.telmarcgar­	NUM
ahs-12347	138	3	dens.com	dens.com	X
ahs-12347	138	4	.	.	PROPN
ahs-12347	138	5	park	park	PROPN
ahs-12347	138	6	s.e	s.e	PROPN
ahs-12347	138	7	.	.	PROPN
ahs-12347	138	8	,	,	PUNCT
ahs-12347	138	9	burchi	burchi	PROPN
ahs-12347	138	10	g.	g.	PROPN
ahs-12347	138	11	,	,	PUNCT
ahs-12347	138	12	roh	roh	PROPN
ahs-12347	138	13	m.s	m.s	PROPN
ahs-12347	138	14	.	.	PROPN
ahs-12347	138	15	,	,	PUNCT
ahs-12347	138	16	joung	joung	PROPN
ahs-12347	138	17	y.h	y.h	PROPN
ahs-12347	138	18	.	.	PROPN
ahs-12347	138	19	,	,	PUNCT
ahs-12347	138	20	2014	2014	NUM
ahs-12347	138	21	­	­	NOUN
ahs-12347	138	22	characterization	characterization	NOUN
ahs-12347	138	23	of	of	ADP
ahs-12347	138	24	kolkwitzia	kolkwitzia	PROPN
ahs-12347	138	25	amabilis	amabilis	PROPN
ahs-12347	138	26	accessions	accession	NOUN
ahs-12347	138	27	based	base	VERB
ahs-12347	138	28	on	on	ADP
ahs-12347	138	29	flowering	flowering	NOUN
ahs-12347	138	30	and	and	CCONJ
ahs-12347	138	31	molecular	molecular	ADJ
ahs-12347	138	32	markers	marker	NOUN
ahs-12347	138	33	.	.	PUNCT
ahs-12347	139	1	­	­	PROPN
ahs-12347	139	2	scientia	scientia	PROPN
ahs-12347	139	3	hort	hort	PROPN
ahs-12347	139	4	.	.	PROPN
ahs-12347	139	5	,	,	PUNCT
ahs-12347	139	6	165	165	NUM
ahs-12347	139	7	:	:	SYM
ahs-12347	139	8	190­195	190­195	NUM
ahs-12347	139	9	.	.	PUNCT
ahs-12347	140	1	tomkins	tomkins	PROPN
ahs-12347	140	2	j.p	j.p	PROPN
ahs-12347	140	3	.	.	PROPN
ahs-12347	140	4	,	,	PUNCT
ahs-12347	140	5	wood	wood	PROPN
ahs-12347	140	6	t.c	t.c	PROPN
ahs-12347	140	7	.	.	PROPN
ahs-12347	140	8	,	,	PUNCT
ahs-12347	140	9	barnes	barnes	PROPN
ahs-12347	140	10	l.s	l.s	PROPN
ahs-12347	140	11	.	.	PROPN
ahs-12347	140	12	,	,	PUNCT
ahs-12347	140	13	westman	westman	NOUN
ahs-12347	140	14	a.	a.	NOUN
ahs-12347	140	15	,	,	PUNCT
ahs-12347	140	16	wing	wing	NOUN
ahs-12347	140	17	r.a	r.a	PROPN
ahs-12347	140	18	.	.	PROPN
ahs-12347	140	19	,	,	PUNCT
ahs-12347	140	20	2001	2001	NUM
ahs-12347	140	21	­	­	NOUN
ahs-12347	140	22	evaluation	evaluation	NOUN
ahs-12347	140	23	of	of	ADP
ahs-12347	140	24	genetic	genetic	ADJ
ahs-12347	140	25	variation	variation	NOUN
ahs-12347	140	26	in	in	ADP
ahs-12347	140	27	the	the	DET
ahs-12347	140	28	daylily	daylily	NOUN
ahs-12347	140	29	(	(	PUNCT
ahs-12347	140	30	hemerocallis	hemerocallis	PROPN
ahs-12347	140	31	spp	spp	NOUN
ahs-12347	140	32	.	.	PUNCT
ahs-12347	140	33	)	)	PUNCT
ahs-12347	141	1	using	use	VERB
ahs-12347	141	2	aflp	aflp	PROPN
ahs-12347	141	3	markers	marker	NOUN
ahs-12347	141	4	.	.	PUNCT
ahs-12347	142	1	­	­	PROPN
ahs-12347	142	2	theor	theor	PROPN
ahs-12347	142	3	.	.	PUNCT
ahs-12347	143	1	appl	appl	PROPN
ahs-12347	143	2	.	.	PUNCT
ahs-12347	144	1	genet	genet	PROPN
ahs-12347	144	2	.	.	PUNCT
ahs-12347	145	1	,	,	PUNCT
ahs-12347	145	2	102	102	NUM
ahs-12347	145	3	:	:	PUNCT
ahs-12347	145	4	489­496	489­496	NUM
ahs-12347	145	5	.	.	PUNCT
ahs-12347	146	1	usda	usda	NOUN
ahs-12347	146	2	,	,	PUNCT
ahs-12347	146	3	ars	ar	NOUN
ahs-12347	146	4	,	,	PUNCT
ahs-12347	146	5	national	national	ADJ
ahs-12347	146	6	genetic	genetic	ADJ
ahs-12347	146	7	resources	resource	NOUN
ahs-12347	146	8	program	program	NOUN
ahs-12347	146	9	,	,	PUNCT
ahs-12347	146	10	2015	2015	NUM
ahs-12347	146	11	­	­	NOUN
ahs-12347	146	12	germplasm	germplasm	NOUN
ahs-12347	146	13	resources	resource	NOUN
ahs-12347	146	14	information	information	NOUN
ahs-12347	146	15	network	network	NOUN
ahs-12347	146	16	‐	‐	ADV
ahs-12347	146	17	(	(	PUNCT
ahs-12347	146	18	grin	grin	NOUN
ahs-12347	146	19	)	)	PUNCT
ahs-12347	147	1	[	[	X
ahs-12347	147	2	online	online	NOUN
ahs-12347	147	3	database	database	NOUN
ahs-12347	147	4	]	]	X
ahs-12347	147	5	.	.	PUNCT
ahs-12347	148	1	national	national	ADJ
ahs-12347	148	2	germplasm	germplasm	PROPN
ahs-12347	148	3	resources	resource	NOUN
ahs-12347	148	4	laboratory	laboratory	NOUN
ahs-12347	148	5	,	,	PUNCT
ahs-12347	148	6	beltsville	beltsville	PROPN
ahs-12347	148	7	,	,	PUNCT
ahs-12347	148	8	maryland	maryland	PROPN
ahs-12347	148	9	.	.	PUNCT