id	sid	tid	token	lemma	pos
ahs-14180	1	1	impaginato	impaginato	PROPN
ahs-14180	1	2	89	89	NUM
ahs-14180	1	3	adv	adv	PROPN
ahs-14180	1	4	.	.	PUNCT
ahs-14180	1	5	hort	hort	PROPN
ahs-14180	1	6	.	.	PUNCT
ahs-14180	2	1	sci	sci	PROPN
ahs-14180	2	2	.	.	PROPN
ahs-14180	2	3	,	,	PUNCT
ahs-14180	2	4	2023	2023	NUM
ahs-14180	2	5	37(1	37(1	NUM
ahs-14180	2	6	):	):	PUNCT
ahs-14180	2	7	89­99	89­99	PROPN
ahs-14180	2	8	doi	doi	NOUN
ahs-14180	2	9	:	:	PUNCT
ahs-14180	2	10	10.36253	10.36253	NUM
ahs-14180	2	11	/	/	SYM
ahs-14180	2	12	ahsc­14180	ahsc­14180	PROPN
ahs-14180	2	13	ethanol	ethanol	NOUN
ahs-14180	2	14	fermentation­	fermentation­	NOUN
ahs-14180	2	15	and	and	CCONJ
ahs-14180	2	16	ethylene	ethylene	NOUN
ahs-14180	2	17	physiology­related	physiology­relate	VERB
ahs-14180	2	18	gene	gene	NOUN
ahs-14180	2	19	expression	expression	NOUN
ahs-14180	2	20	profiles	profile	NOUN
ahs-14180	2	21	in	in	ADP
ahs-14180	2	22	red	red	PROPN
ahs-14180	2	23	delicious	delicious	PROPN
ahs-14180	2	24	apples	apple	NOUN
ahs-14180	2	25	stored	store	VERB
ahs-14180	2	26	under	under	ADP
ahs-14180	2	27	variable	variable	ADJ
ahs-14180	2	28	hypoxic	hypoxic	ADJ
ahs-14180	2	29	conditions	condition	NOUN
ahs-14180	2	30	and	and	CCONJ
ahs-14180	2	31	protocols	protocol	NOUN
ahs-14180	2	32	e.	e.	PROPN
ahs-14180	2	33	salamé	salamé	PROPN
ahs-14180	2	34	1	1	NUM
ahs-14180	2	35	,	,	PUNCT
ahs-14180	2	36	s.	s.	PROPN
ahs-14180	2	37	brizzolara	brizzolara	PROPN
ahs-14180	2	38	1	1	NUM
ahs-14180	2	39	(	(	PUNCT
ahs-14180	2	40	*	*	NOUN
ahs-14180	2	41	)	)	PUNCT
ahs-14180	2	42	,	,	PUNCT
ahs-14180	2	43	m.	m.	NOUN
ahs-14180	2	44	rodrigues	rodrigues	PROPN
ahs-14180	2	45	2	2	NUM
ahs-14180	2	46	,	,	PUNCT
ahs-14180	2	47	m.	m.	NOUN
ahs-14180	2	48	iob	iob	PROPN
ahs-14180	2	49	3	3	NUM
ahs-14180	2	50	,	,	PUNCT
ahs-14180	2	51	p.	p.	NOUN
ahs-14180	2	52	tonutti	tonutti	NOUN
ahs-14180	2	53	1	1	NUM
ahs-14180	2	54	,	,	PUNCT
ahs-14180	2	55	b.	b.	PROPN
ahs-14180	2	56	ruperti	ruperti	PROPN
ahs-14180	2	57	2	2	NUM
ahs-14180	2	58	1	1	NUM
ahs-14180	2	59	crop	crop	NOUN
ahs-14180	2	60	science	science	NOUN
ahs-14180	2	61	research	research	NOUN
ahs-14180	2	62	center	center	NOUN
ahs-14180	2	63	,	,	PUNCT
ahs-14180	2	64	scuola	scuola	PROPN
ahs-14180	2	65	superiore	superiore	NOUN
ahs-14180	2	66	sant’anna	sant’anna	NOUN
ahs-14180	2	67	,	,	PUNCT
ahs-14180	2	68	piazza	piazza	VERB
ahs-14180	2	69	martiri	martiri	ADV
ahs-14180	2	70	della	della	PROPN
ahs-14180	2	71	libertà	libertà	PROPN
ahs-14180	2	72	,	,	PUNCT
ahs-14180	2	73	33	33	NUM
ahs-14180	2	74	,	,	PUNCT
ahs-14180	2	75	56127	56127	NUM
ahs-14180	2	76	pisa	pisa	PROPN
ahs-14180	2	77	,	,	PUNCT
ahs-14180	2	78	italy	italy	PROPN
ahs-14180	2	79	.	.	PROPN
ahs-14180	3	1	2	2	NUM
ahs-14180	3	2	department	department	NOUN
ahs-14180	3	3	of	of	ADP
ahs-14180	3	4	agronomy	agronomy	NOUN
ahs-14180	3	5	,	,	PUNCT
ahs-14180	3	6	food	food	NOUN
ahs-14180	3	7	,	,	PUNCT
ahs-14180	3	8	natural	natural	ADJ
ahs-14180	3	9	resources	resource	NOUN
ahs-14180	3	10	,	,	PUNCT
ahs-14180	3	11	animals	animal	NOUN
ahs-14180	3	12	and	and	CCONJ
ahs-14180	3	13	environment	environment	NOUN
ahs-14180	3	14	,	,	PUNCT
ahs-14180	3	15	via	via	ADP
ahs-14180	3	16	dell’università	dell’università	NOUN
ahs-14180	3	17	,	,	PUNCT
ahs-14180	3	18	16	16	NUM
ahs-14180	3	19	,	,	PUNCT
ahs-14180	3	20	35020	35020	NUM
ahs-14180	3	21	legnaro	legnaro	NOUN
ahs-14180	3	22	(	(	PUNCT
ahs-14180	3	23	pd	pd	NOUN
ahs-14180	3	24	)	)	PUNCT
ahs-14180	3	25	,	,	PUNCT
ahs-14180	3	26	italy	italy	PROPN
ahs-14180	3	27	.	.	PROPN
ahs-14180	4	1	3	3	NUM
ahs-14180	4	2	marvil	marvil	NOUN
ahs-14180	4	3	engeneering	engeneere	VERB
ahs-14180	4	4	,	,	PUNCT
ahs-14180	4	5	zona	zona	PROPN
ahs-14180	4	6	produttiva	produttiva	PROPN
ahs-14180	4	7	schwemm	schwemm	PROPN
ahs-14180	4	8	,	,	PUNCT
ahs-14180	4	9	8	8	NUM
ahs-14180	4	10	,	,	PUNCT
ahs-14180	4	11	39040	39040	NUM
ahs-14180	4	12	magré	magré	NOUN
ahs-14180	4	13	sulla	sulla	PROPN
ahs-14180	4	14	strada	strada	PROPN
ahs-14180	4	15	del	del	PROPN
ahs-14180	4	16	vino	vino	PROPN
ahs-14180	4	17	(	(	PUNCT
ahs-14180	4	18	bz	bz	PROPN
ahs-14180	4	19	)	)	PUNCT
ahs-14180	4	20	,	,	PUNCT
ahs-14180	4	21	italy	italy	PROPN
ahs-14180	4	22	.	.	PUNCT
ahs-14180	5	1	key	key	ADJ
ahs-14180	5	2	words	word	NOUN
ahs-14180	5	3	:	:	PUNCT
ahs-14180	5	4	dynamic	dynamic	ADJ
ahs-14180	5	5	controlled	control	VERB
ahs-14180	5	6	atmosphere	atmosphere	NOUN
ahs-14180	5	7	,	,	PUNCT
ahs-14180	5	8	erf	erf	NOUN
ahs-14180	5	9	,	,	PUNCT
ahs-14180	5	10	low	low	ADJ
ahs-14180	5	11	oxygen	oxygen	NOUN
ahs-14180	5	12	,	,	PUNCT
ahs-14180	5	13	malus	malus	PROPN
ahs-14180	5	14	domestica	domestica	PROPN
ahs-14180	5	15	,	,	PUNCT
ahs-14180	5	16	postharvest	postharvest	NOUN
ahs-14180	5	17	.	.	PUNCT
ahs-14180	6	1	abstract	abstract	ADJ
ahs-14180	6	2	:	:	PUNCT
ahs-14180	6	3	dynamic	dynamic	ADJ
ahs-14180	6	4	controlled	control	VERB
ahs-14180	6	5	atmosphere	atmosphere	NOUN
ahs-14180	6	6	(	(	PUNCT
ahs-14180	6	7	dca	dca	PROPN
ahs-14180	6	8	)	)	PUNCT
ahs-14180	6	9	is	be	AUX
ahs-14180	6	10	beneficial	beneficial	ADJ
ahs-14180	6	11	in	in	ADP
ahs-14180	6	12	maintaining	maintain	VERB
ahs-14180	6	13	specific	specific	ADJ
ahs-14180	6	14	quality	quality	NOUN
ahs-14180	6	15	parameters	parameter	NOUN
ahs-14180	6	16	but	but	CCONJ
ahs-14180	6	17	,	,	PUNCT
ahs-14180	6	18	due	due	ADP
ahs-14180	6	19	to	to	ADP
ahs-14180	6	20	the	the	DET
ahs-14180	6	21	extreme	extreme	ADJ
ahs-14180	6	22	oxygen	oxygen	NOUN
ahs-14180	6	23	levels	level	NOUN
ahs-14180	6	24	applied	apply	VERB
ahs-14180	6	25	,	,	PUNCT
ahs-14180	6	26	can	can	AUX
ahs-14180	6	27	cause	cause	VERB
ahs-14180	6	28	adverse	adverse	ADJ
ahs-14180	6	29	effects	effect	NOUN
ahs-14180	6	30	on	on	ADP
ahs-14180	6	31	the	the	DET
ahs-14180	6	32	fruit	fruit	NOUN
ahs-14180	6	33	by	by	ADP
ahs-14180	6	34	inducing	induce	VERB
ahs-14180	6	35	excessive	excessive	ADJ
ahs-14180	6	36	anaerobic	anaerobic	NOUN
ahs-14180	6	37	metabolism	metabolism	NOUN
ahs-14180	6	38	and	and	CCONJ
ahs-14180	6	39	the	the	DET
ahs-14180	6	40	production	production	NOUN
ahs-14180	6	41	of	of	ADP
ahs-14180	6	42	off­flavors	off­flavor	NOUN
ahs-14180	6	43	.	.	PUNCT
ahs-14180	7	1	the	the	DET
ahs-14180	7	2	metabolic	metabolic	NOUN
ahs-14180	7	3	adaptation	adaptation	NOUN
ahs-14180	7	4	and	and	CCONJ
ahs-14180	7	5	responses	response	NOUN
ahs-14180	7	6	of	of	ADP
ahs-14180	7	7	apples	apple	NOUN
ahs-14180	7	8	(	(	PUNCT
ahs-14180	7	9	malus	malus	PROPN
ahs-14180	7	10	domestica	domestica	PROPN
ahs-14180	7	11	borkh	borkh	PROPN
ahs-14180	7	12	.	.	PUNCT
ahs-14180	7	13	)	)	PUNCT
ahs-14180	8	1	cv	cv	PROPN
ahs-14180	8	2	.	.	PROPN
ahs-14180	8	3	red	red	PROPN
ahs-14180	8	4	delicious	delicious	PROPN
ahs-14180	8	5	to	to	ADP
ahs-14180	8	6	static	static	ADJ
ahs-14180	8	7	or	or	CCONJ
ahs-14180	8	8	dynamic	dynamic	ADJ
ahs-14180	8	9	oxygen	oxygen	NOUN
ahs-14180	8	10	concentrations	concentration	NOUN
ahs-14180	8	11	(	(	PUNCT
ahs-14180	8	12	0.3	0.3	NUM
ahs-14180	8	13	and	and	CCONJ
ahs-14180	8	14	0.8	0.8	NUM
ahs-14180	8	15	%	%	NOUN
ahs-14180	8	16	,	,	PUNCT
ahs-14180	8	17	with	with	ADP
ahs-14180	8	18	sequential	sequential	ADJ
ahs-14180	8	19	shifts	shift	NOUN
ahs-14180	8	20	)	)	PUNCT
ahs-14180	8	21	during	during	ADP
ahs-14180	8	22	cold	cold	ADJ
ahs-14180	8	23	storage	storage	NOUN
ahs-14180	8	24	for	for	ADP
ahs-14180	8	25	7	7	NUM
ahs-14180	8	26	months	month	NOUN
ahs-14180	8	27	were	be	AUX
ahs-14180	8	28	studied	study	VERB
ahs-14180	8	29	by	by	ADP
ahs-14180	8	30	monitoring	monitor	VERB
ahs-14180	8	31	quality	quality	NOUN
ahs-14180	8	32	parameters	parameter	NOUN
ahs-14180	8	33	and	and	CCONJ
ahs-14180	8	34	the	the	DET
ahs-14180	8	35	expression	expression	NOUN
ahs-14180	8	36	of	of	ADP
ahs-14180	8	37	genes	gene	NOUN
ahs-14180	8	38	involved	involve	VERB
ahs-14180	8	39	in	in	ADP
ahs-14180	8	40	sugar	sugar	NOUN
ahs-14180	8	41	,	,	PUNCT
ahs-14180	8	42	fermentative	fermentative	ADJ
ahs-14180	8	43	metabolism	metabolism	NOUN
ahs-14180	8	44	,	,	PUNCT
ahs-14180	8	45	and	and	CCONJ
ahs-14180	8	46	ethylene	ethylene	NOUN
ahs-14180	8	47	physiology	physiology	NOUN
ahs-14180	8	48	.	.	PUNCT
ahs-14180	9	1	ethanol	ethanol	NOUN
ahs-14180	9	2	content	content	NOUN
ahs-14180	9	3	reached	reach	VERB
ahs-14180	9	4	the	the	DET
ahs-14180	9	5	highest	high	ADJ
ahs-14180	9	6	levels	level	NOUN
ahs-14180	9	7	(	(	PUNCT
ahs-14180	9	8	around	around	ADP
ahs-14180	9	9	400	400	NUM
ahs-14180	9	10	mg	mg	NUM
ahs-14180	9	11	/	/	SYM
ahs-14180	9	12	kg	kg	NOUN
ahs-14180	9	13	fw	fw	ADJ
ahs-14180	9	14	)	)	PUNCT
ahs-14180	9	15	under	under	ADP
ahs-14180	9	16	0.3	0.3	NUM
ahs-14180	9	17	%	%	NOUN
ahs-14180	9	18	oxygen	oxygen	NOUN
ahs-14180	9	19	concentration	concentration	NOUN
ahs-14180	9	20	and	and	CCONJ
ahs-14180	9	21	fruit	fruit	NOUN
ahs-14180	9	22	firmness	firmness	NOUN
ahs-14180	9	23	appeared	appear	VERB
ahs-14180	9	24	to	to	PART
ahs-14180	9	25	be	be	AUX
ahs-14180	9	26	reduced	reduce	VERB
ahs-14180	9	27	in	in	ADP
ahs-14180	9	28	samples	sample	NOUN
ahs-14180	9	29	accumulating	accumulate	VERB
ahs-14180	9	30	the	the	DET
ahs-14180	9	31	highest	high	ADJ
ahs-14180	9	32	levels	level	NOUN
ahs-14180	9	33	of	of	ADP
ahs-14180	9	34	ethanol	ethanol	NOUN
ahs-14180	9	35	.	.	PUNCT
ahs-14180	10	1	the	the	DET
ahs-14180	10	2	oxygen	oxygen	NOUN
ahs-14180	10	3	switch	switch	NOUN
ahs-14180	10	4	was	be	AUX
ahs-14180	10	5	effective	effective	ADJ
ahs-14180	10	6	in	in	ADP
ahs-14180	10	7	reducing	reduce	VERB
ahs-14180	10	8	the	the	DET
ahs-14180	10	9	ethanol	ethanol	NOUN
ahs-14180	10	10	concentrations	concentration	NOUN
ahs-14180	10	11	with	with	ADP
ahs-14180	10	12	timing­dependent	timing­dependent	ADJ
ahs-14180	10	13	variable	variable	ADJ
ahs-14180	10	14	effects	effect	NOUN
ahs-14180	10	15	.	.	PUNCT
ahs-14180	11	1	the	the	DET
ahs-14180	11	2	expression	expression	NOUN
ahs-14180	11	3	of	of	ADP
ahs-14180	11	4	fermentative	fermentative	ADJ
ahs-14180	11	5	(	(	PUNCT
ahs-14180	11	6	alcohol	alcohol	NOUN
ahs-14180	11	7	dehydrogenase	dehydrogenase	NOUN
ahs-14180	11	8	,	,	PUNCT
ahs-14180	11	9	lactate	lactate	PROPN
ahs-14180	11	10	dehydroge‐	dehydroge‐	NOUN
ahs-14180	11	11	nase	nase	PROPN
ahs-14180	11	12	,	,	PUNCT
ahs-14180	11	13	pyruvate	pyruvate	NOUN
ahs-14180	11	14	decarboxylase	decarboxylase	NOUN
ahs-14180	11	15	)	)	PUNCT
ahs-14180	11	16	and	and	CCONJ
ahs-14180	11	17	sugar	sugar	NOUN
ahs-14180	11	18	metabolism	metabolism	NOUN
ahs-14180	11	19	(	(	PUNCT
ahs-14180	11	20	β‐amylase	β‐amylase	ADP
ahs-14180	11	21	;	;	PUNCT
ahs-14180	11	22	phosphofruc‐	phosphofruc‐	X
ahs-14180	11	23	tokinase	tokinase	NOUN
ahs-14180	11	24	;	;	PUNCT
ahs-14180	11	25	sucrose	sucrose	ADJ
ahs-14180	11	26	synthase	synthase	NOUN
ahs-14180	11	27	)	)	PUNCT
ahs-14180	11	28	genes	gene	NOUN
ahs-14180	11	29	resulted	result	VERB
ahs-14180	11	30	to	to	PART
ahs-14180	11	31	be	be	AUX
ahs-14180	11	32	differently	differently	ADV
ahs-14180	11	33	affected	affect	VERB
ahs-14180	11	34	by	by	ADP
ahs-14180	11	35	the	the	DET
ahs-14180	11	36	hypoxic	hypoxic	ADJ
ahs-14180	11	37	conditions	condition	NOUN
ahs-14180	11	38	imposed	impose	VERB
ahs-14180	11	39	,	,	PUNCT
ahs-14180	11	40	in	in	ADP
ahs-14180	11	41	particular	particular	ADJ
ahs-14180	11	42	during	during	ADP
ahs-14180	11	43	the	the	DET
ahs-14180	11	44	early	early	ADJ
ahs-14180	11	45	stages	stage	NOUN
ahs-14180	11	46	of	of	ADP
ahs-14180	11	47	storage	storage	NOUN
ahs-14180	11	48	.	.	PUNCT
ahs-14180	12	1	sucrose	sucrose	VERB
ahs-14180	12	2	synthase	synthase	NOUN
ahs-14180	12	3	expression	expression	NOUN
ahs-14180	12	4	appeared	appear	VERB
ahs-14180	12	5	to	to	PART
ahs-14180	12	6	be	be	AUX
ahs-14180	12	7	highly	highly	ADV
ahs-14180	12	8	sensitive	sensitive	ADJ
ahs-14180	12	9	to	to	ADP
ahs-14180	12	10	changes	change	NOUN
ahs-14180	12	11	in	in	ADP
ahs-14180	12	12	low	low	ADJ
ahs-14180	12	13	oxygen	oxygen	NOUN
ahs-14180	12	14	concentration	concentration	NOUN
ahs-14180	12	15	.	.	PUNCT
ahs-14180	13	1	ethylene	ethylene	NOUN
ahs-14180	13	2	biosynthesis	biosynthesis	NOUN
ahs-14180	13	3	(	(	PUNCT
ahs-14180	13	4	acc	acc	NOUN
ahs-14180	13	5	synthase	synthase	NOUN
ahs-14180	13	6	and	and	CCONJ
ahs-14180	13	7	oxidase	oxidase	NOUN
ahs-14180	13	8	)	)	PUNCT
ahs-14180	13	9	genes	gene	NOUN
ahs-14180	13	10	showed	show	VERB
ahs-14180	13	11	marked	mark	VERB
ahs-14180	13	12	differences	difference	NOUN
ahs-14180	13	13	in	in	ADP
ahs-14180	13	14	their	their	PRON
ahs-14180	13	15	expression	expression	NOUN
ahs-14180	13	16	in	in	ADP
ahs-14180	13	17	relation	relation	NOUN
ahs-14180	13	18	to	to	ADP
ahs-14180	13	19	the	the	DET
ahs-14180	13	20	static	static	ADJ
ahs-14180	13	21	and	and	CCONJ
ahs-14180	13	22	dynamic	dynamic	ADJ
ahs-14180	13	23	protocols	protocol	NOUN
ahs-14180	13	24	and	and	CCONJ
ahs-14180	13	25	the	the	DET
ahs-14180	13	26	hypoxic	hypoxic	ADJ
ahs-14180	13	27	conditions	condition	NOUN
ahs-14180	13	28	,	,	PUNCT
ahs-14180	13	29	as	as	ADV
ahs-14180	13	30	well	well	ADV
ahs-14180	13	31	as	as	ADP
ahs-14180	13	32	six	six	NUM
ahs-14180	13	33	ethylene	ethylene	NOUN
ahs-14180	13	34	responsive	responsive	ADJ
ahs-14180	13	35	factors	factor	NOUN
ahs-14180	13	36	(	(	PUNCT
ahs-14180	13	37	erf	erf	NOUN
ahs-14180	13	38	)	)	PUNCT
ahs-14180	13	39	genes	gene	NOUN
ahs-14180	13	40	,	,	PUNCT
ahs-14180	13	41	some	some	PRON
ahs-14180	13	42	of	of	ADP
ahs-14180	13	43	them	they	PRON
ahs-14180	13	44	possibly	possibly	ADV
ahs-14180	13	45	involved	involve	VERB
ahs-14180	13	46	in	in	ADP
ahs-14180	13	47	the	the	DET
ahs-14180	13	48	oxygen	oxygen	NOUN
ahs-14180	13	49	sensing	sense	VERB
ahs-14180	13	50	mechanism	mechanism	NOUN
ahs-14180	13	51	operating	operate	VERB
ahs-14180	13	52	in	in	ADP
ahs-14180	13	53	fruit	fruit	NOUN
ahs-14180	13	54	tissues	tissue	NOUN
ahs-14180	13	55	.	.	PUNCT
ahs-14180	14	1	(	(	PUNCT
ahs-14180	14	2	*	*	NOUN
ahs-14180	14	3	)	)	PUNCT
ahs-14180	14	4	corresponding	corresponding	ADJ
ahs-14180	14	5	author	author	NOUN
ahs-14180	14	6	:	:	PUNCT
ahs-14180	14	7	stefano.brizzolara@santannapisa.it	stefano.brizzolara@santannapisa.it	PROPN
ahs-14180	14	8	citation	citation	NOUN
ahs-14180	14	9	:	:	PUNCT
ahs-14180	14	10	salamé	salamé	PROPN
ahs-14180	14	11	e.	e.	PROPN
ahs-14180	14	12	,	,	PUNCT
ahs-14180	14	13	brizzolara	brizzolara	PROPN
ahs-14180	14	14	s.	s.	PROPN
ahs-14180	14	15	,	,	PUNCT
ahs-14180	14	16	rodrigues	rodrigues	PROPN
ahs-14180	14	17	m.	m.	PROPN
ahs-14180	14	18	,	,	PUNCT
ahs-14180	14	19	iob	iob	PROPN
ahs-14180	14	20	m.	m.	PROPN
ahs-14180	14	21	,	,	PUNCT
ahs-14180	14	22	tonutti	tonutti	PROPN
ahs-14180	14	23	p.	p.	PROPN
ahs-14180	14	24	,	,	PUNCT
ahs-14180	14	25	ruperti	ruperti	PROPN
ahs-14180	14	26	b.	b.	PROPN
ahs-14180	14	27	,	,	PUNCT
ahs-14180	14	28	2023	2023	NUM
ahs-14180	14	29	­	­	NUM
ahs-14180	14	30	ethanol	ethanol	NOUN
ahs-14180	14	31	fermentation‐	fermentation‐	NOUN
ahs-14180	14	32	and	and	CCONJ
ahs-14180	14	33	ethylene	ethylene	NOUN
ahs-14180	14	34	physiology‐related	physiology‐relate	VERB
ahs-14180	14	35	gene	gene	NOUN
ahs-14180	14	36	expression	expression	NOUN
ahs-14180	14	37	profiles	profile	NOUN
ahs-14180	14	38	in	in	ADP
ahs-14180	14	39	red	red	PROPN
ahs-14180	14	40	delicious	delicious	PROPN
ahs-14180	14	41	apples	apple	NOUN
ahs-14180	14	42	stored	store	VERB
ahs-14180	14	43	under	under	ADP
ahs-14180	14	44	variable	variable	ADJ
ahs-14180	14	45	hypoxic	hypoxic	ADJ
ahs-14180	14	46	conditions	condition	NOUN
ahs-14180	14	47	and	and	CCONJ
ahs-14180	14	48	protocols	protocol	NOUN
ahs-14180	14	49	.	.	PUNCT
ahs-14180	15	1	­	­	PROPN
ahs-14180	15	2	adv	adv	PROPN
ahs-14180	15	3	.	.	PUNCT
ahs-14180	16	1	hort	hort	PROPN
ahs-14180	16	2	.	.	PUNCT
ahs-14180	17	1	sci	sci	PROPN
ahs-14180	17	2	.	.	PROPN
ahs-14180	17	3	,	,	PUNCT
ahs-14180	17	4	37(1	37(1	NUM
ahs-14180	17	5	):	):	PUNCT
ahs-14180	17	6	89­99	89­99	NUM
ahs-14180	17	7	.	.	PUNCT
ahs-14180	18	1	copyright	copyright	NOUN
ahs-14180	18	2	:	:	PUNCT
ahs-14180	18	3	©	©	PROPN
ahs-14180	18	4	2023	2023	NUM
ahs-14180	18	5	salamé	salamé	PROPN
ahs-14180	18	6	e.	e.	PROPN
ahs-14180	18	7	,	,	PUNCT
ahs-14180	18	8	brizzolara	brizzolara	PROPN
ahs-14180	18	9	s.	s.	PROPN
ahs-14180	18	10	,	,	PUNCT
ahs-14180	18	11	rodrigues	rodrigues	PROPN
ahs-14180	18	12	m.	m.	PROPN
ahs-14180	18	13	,	,	PUNCT
ahs-14180	18	14	iob	iob	PROPN
ahs-14180	18	15	m.	m.	PROPN
ahs-14180	18	16	,	,	PUNCT
ahs-14180	18	17	tonutti	tonutti	PROPN
ahs-14180	18	18	p.	p.	PROPN
ahs-14180	18	19	,	,	PUNCT
ahs-14180	18	20	ruperti	ruperti	PROPN
ahs-14180	18	21	b.	b.	PROPN
ahs-14180	19	1	this	this	PRON
ahs-14180	19	2	is	be	AUX
ahs-14180	19	3	an	an	DET
ahs-14180	19	4	open	open	ADJ
ahs-14180	19	5	access	access	NOUN
ahs-14180	19	6	,	,	PUNCT
ahs-14180	19	7	peer	peer	NOUN
ahs-14180	19	8	reviewed	review	VERB
ahs-14180	19	9	article	article	NOUN
ahs-14180	19	10	published	publish	VERB
ahs-14180	19	11	by	by	ADP
ahs-14180	19	12	firenze	firenze	PROPN
ahs-14180	19	13	university	university	PROPN
ahs-14180	19	14	press	press	NOUN
ahs-14180	19	15	(	(	PUNCT
ahs-14180	19	16	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-14180	19	17	)	)	PUNCT
ahs-14180	19	18	and	and	CCONJ
ahs-14180	19	19	distributed	distribute	VERB
ahs-14180	19	20	under	under	ADP
ahs-14180	19	21	the	the	DET
ahs-14180	19	22	terms	term	NOUN
ahs-14180	19	23	of	of	ADP
ahs-14180	19	24	the	the	DET
ahs-14180	19	25	creative	creative	ADJ
ahs-14180	19	26	commons	common	NOUN
ahs-14180	19	27	attribution	attribution	NOUN
ahs-14180	19	28	license	license	NOUN
ahs-14180	19	29	,	,	PUNCT
ahs-14180	19	30	which	which	PRON
ahs-14180	19	31	permits	permit	VERB
ahs-14180	19	32	unrestricted	unrestricted	ADJ
ahs-14180	19	33	use	use	NOUN
ahs-14180	19	34	,	,	PUNCT
ahs-14180	19	35	distribution	distribution	NOUN
ahs-14180	19	36	,	,	PUNCT
ahs-14180	19	37	and	and	CCONJ
ahs-14180	19	38	reproduction	reproduction	NOUN
ahs-14180	19	39	in	in	ADP
ahs-14180	19	40	any	any	DET
ahs-14180	19	41	medium	medium	NOUN
ahs-14180	19	42	,	,	PUNCT
ahs-14180	19	43	provided	provide	VERB
ahs-14180	19	44	the	the	DET
ahs-14180	19	45	original	original	ADJ
ahs-14180	19	46	author	author	NOUN
ahs-14180	19	47	and	and	CCONJ
ahs-14180	19	48	source	source	NOUN
ahs-14180	19	49	are	be	AUX
ahs-14180	19	50	credited	credit	VERB
ahs-14180	19	51	.	.	PUNCT
ahs-14180	20	1	data	datum	NOUN
ahs-14180	20	2	availability	availability	NOUN
ahs-14180	20	3	statement	statement	NOUN
ahs-14180	20	4	:	:	PUNCT
ahs-14180	20	5	all	all	DET
ahs-14180	20	6	relevant	relevant	ADJ
ahs-14180	20	7	data	datum	NOUN
ahs-14180	20	8	are	be	AUX
ahs-14180	20	9	within	within	ADP
ahs-14180	20	10	the	the	DET
ahs-14180	20	11	paper	paper	NOUN
ahs-14180	20	12	and	and	CCONJ
ahs-14180	20	13	its	its	PRON
ahs-14180	20	14	supporting	support	VERB
ahs-14180	20	15	information	information	NOUN
ahs-14180	20	16	files	file	NOUN
ahs-14180	20	17	.	.	PUNCT
ahs-14180	21	1	competing	compete	VERB
ahs-14180	21	2	interests	interest	NOUN
ahs-14180	21	3	:	:	PUNCT
ahs-14180	21	4	the	the	DET
ahs-14180	21	5	authors	author	NOUN
ahs-14180	21	6	declare	declare	VERB
ahs-14180	21	7	no	no	DET
ahs-14180	21	8	competing	compete	VERB
ahs-14180	21	9	interests	interest	NOUN
ahs-14180	21	10	.	.	PUNCT
ahs-14180	22	1	received	receive	VERB
ahs-14180	22	2	for	for	ADP
ahs-14180	22	3	publication	publication	NOUN
ahs-14180	22	4	12	12	NUM
ahs-14180	22	5	january	january	PROPN
ahs-14180	22	6	2023	2023	NUM
ahs-14180	22	7	accepted	accept	VERB
ahs-14180	22	8	for	for	ADP
ahs-14180	22	9	publication	publication	NOUN
ahs-14180	22	10	18	18	NUM
ahs-14180	22	11	february	february	PROPN
ahs-14180	22	12	2023	2023	NUM
ahs-14180	22	13	ahs	ahs	NOUN
ahs-14180	22	14	advances	advance	NOUN
ahs-14180	22	15	in	in	ADP
ahs-14180	22	16	horticultural	horticultural	ADJ
ahs-14180	22	17	science	science	NOUN
ahs-14180	22	18	https://doi.org/10.36253/ahsc-14180	https://doi.org/10.36253/ahsc-14180	NOUN
ahs-14180	22	19	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-14180	22	20	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-14180	22	21	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-14180	22	22	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-14180	22	23	adv	adv	PROPN
ahs-14180	22	24	.	.	PUNCT
ahs-14180	22	25	hort	hort	PROPN
ahs-14180	22	26	.	.	PUNCT
ahs-14180	23	1	sci	sci	PROPN
ahs-14180	23	2	.	.	PROPN
ahs-14180	23	3	,	,	PUNCT
ahs-14180	23	4	2023	2023	NUM
ahs-14180	23	5	37(1	37(1	NUM
ahs-14180	23	6	):	):	PUNCT
ahs-14180	23	7	89­99	89­99	NUM
ahs-14180	23	8	90	90	NUM
ahs-14180	23	9	1	1	NUM
ahs-14180	23	10	.	.	PUNCT
ahs-14180	24	1	introduction	introduction	NOUN
ahs-14180	24	2	dynamic	dynamic	ADJ
ahs-14180	24	3	controlled	control	VERB
ahs-14180	24	4	atmosphere	atmosphere	NOUN
ahs-14180	24	5	(	(	PUNCT
ahs-14180	24	6	dca	dca	PROPN
ahs-14180	24	7	)	)	PUNCT
ahs-14180	24	8	represents	represent	VERB
ahs-14180	24	9	one	one	NUM
ahs-14180	24	10	of	of	ADP
ahs-14180	24	11	the	the	DET
ahs-14180	24	12	latest	late	ADJ
ahs-14180	24	13	technical	technical	ADJ
ahs-14180	24	14	innovations	innovation	NOUN
ahs-14180	24	15	for	for	ADP
ahs-14180	24	16	the	the	DET
ahs-14180	24	17	long	long	ADJ
ahs-14180	24	18	storage	storage	NOUN
ahs-14180	24	19	of	of	ADP
ahs-14180	24	20	apples	apple	NOUN
ahs-14180	24	21	(	(	PUNCT
ahs-14180	24	22	and	and	CCONJ
ahs-14180	24	23	few	few	ADJ
ahs-14180	24	24	other	other	ADJ
ahs-14180	24	25	fruit	fruit	NOUN
ahs-14180	24	26	crops	crop	NOUN
ahs-14180	24	27	)	)	PUNCT
ahs-14180	24	28	(	(	PUNCT
ahs-14180	24	29	tonutti	tonutti	NOUN
ahs-14180	24	30	,	,	PUNCT
ahs-14180	24	31	2015	2015	NUM
ahs-14180	24	32	)	)	PUNCT
ahs-14180	24	33	.	.	PUNCT
ahs-14180	25	1	with	with	ADP
ahs-14180	25	2	this	this	DET
ahs-14180	25	3	technology	technology	NOUN
ahs-14180	25	4	,	,	PUNCT
ahs-14180	25	5	fruits	fruit	NOUN
ahs-14180	25	6	are	be	AUX
ahs-14180	25	7	kept	keep	VERB
ahs-14180	25	8	under	under	ADP
ahs-14180	25	9	extremely	extremely	ADV
ahs-14180	25	10	low	low	ADJ
ahs-14180	25	11	oxygen	oxygen	NOUN
ahs-14180	25	12	concentrations	concentration	NOUN
ahs-14180	25	13	(	(	PUNCT
ahs-14180	25	14	0.4	0.4	NUM
ahs-14180	25	15	kpa	kpa	NOUN
ahs-14180	25	16	or	or	CCONJ
ahs-14180	25	17	lower	low	ADJ
ahs-14180	25	18	)	)	PUNCT
ahs-14180	25	19	that	that	PRON
ahs-14180	25	20	are	be	AUX
ahs-14180	25	21	beneficial	beneficial	ADJ
ahs-14180	25	22	for	for	ADP
ahs-14180	25	23	maintaining	maintain	VERB
ahs-14180	25	24	specific	specific	ADJ
ahs-14180	25	25	quality	quality	NOUN
ahs-14180	25	26	parameters	parameter	NOUN
ahs-14180	25	27	(	(	PUNCT
ahs-14180	25	28	e.g.	e.g.	ADV
ahs-14180	25	29	,	,	PUNCT
ahs-14180	25	30	flesh	flesh	NOUN
ahs-14180	25	31	firmness	firmness	NOUN
ahs-14180	25	32	,	,	PUNCT
ahs-14180	25	33	acidity	acidity	NOUN
ahs-14180	25	34	)	)	PUNCT
ahs-14180	25	35	.	.	PUNCT
ahs-14180	26	1	however	however	ADV
ahs-14180	26	2	,	,	PUNCT
ahs-14180	26	3	by	by	ADP
ahs-14180	26	4	activating	activate	VERB
ahs-14180	26	5	anaerobic	anaerobic	ADJ
ahs-14180	26	6	metabolism	metabolism	NOUN
ahs-14180	26	7	,	,	PUNCT
ahs-14180	26	8	an	an	DET
ahs-14180	26	9	accumulation	accumulation	NOUN
ahs-14180	26	10	of	of	ADP
ahs-14180	26	11	ethanol	ethanol	NOUN
ahs-14180	26	12	takes	take	VERB
ahs-14180	26	13	place	place	NOUN
ahs-14180	26	14	.	.	PUNCT
ahs-14180	27	1	low	low	ADJ
ahs-14180	27	2	concentra­	concentra­	PROPN
ahs-14180	27	3	tions	tion	NOUN
ahs-14180	27	4	of	of	ADP
ahs-14180	27	5	ethanol	ethanol	NOUN
ahs-14180	27	6	are	be	AUX
ahs-14180	27	7	desirable	desirable	ADJ
ahs-14180	27	8	in	in	ADP
ahs-14180	27	9	terms	term	NOUN
ahs-14180	27	10	of	of	ADP
ahs-14180	27	11	improving	improve	VERB
ahs-14180	27	12	organoleptic	organoleptic	ADJ
ahs-14180	27	13	traits	trait	NOUN
ahs-14180	27	14	,	,	PUNCT
ahs-14180	27	15	reducing	reduce	VERB
ahs-14180	27	16	the	the	DET
ahs-14180	27	17	incidence	incidence	NOUN
ahs-14180	27	18	of	of	ADP
ahs-14180	27	19	chilling	chilling	ADJ
ahs-14180	27	20	injuries	injury	NOUN
ahs-14180	27	21	(	(	PUNCT
ahs-14180	27	22	e.g.	e.g.	ADV
ahs-14180	27	23	,	,	PUNCT
ahs-14180	27	24	superficial	superficial	ADJ
ahs-14180	27	25	scald	scald	NOUN
ahs-14180	27	26	)	)	PUNCT
ahs-14180	27	27	and	and	CCONJ
ahs-14180	27	28	limiting	limit	VERB
ahs-14180	27	29	ethylene	ethylene	NOUN
ahs-14180	27	30	biosynthesis	biosynthesis	NOUN
ahs-14180	27	31	(	(	PUNCT
ahs-14180	27	32	dixon	dixon	PROPN
ahs-14180	27	33	and	and	CCONJ
ahs-14180	27	34	hewett	hewett	PROPN
ahs-14180	27	35	,	,	PUNCT
ahs-14180	27	36	2000	2000	NUM
ahs-14180	27	37	;	;	PUNCT
ahs-14180	27	38	scott	scott	PROPN
ahs-14180	27	39	et	et	PROPN
ahs-14180	27	40	al	al	PROPN
ahs-14180	27	41	.	.	PROPN
ahs-14180	27	42	,	,	PUNCT
ahs-14180	27	43	2000	2000	NUM
ahs-14180	27	44	;	;	PUNCT
ahs-14180	27	45	weber	weber	PROPN
ahs-14180	27	46	et	et	PROPN
ahs-14180	27	47	al	al	PROPN
ahs-14180	27	48	.	.	PROPN
ahs-14180	27	49	,	,	PUNCT
ahs-14180	27	50	2020	2020	NUM
ahs-14180	27	51	)	)	PUNCT
ahs-14180	27	52	.	.	PUNCT
ahs-14180	28	1	yet	yet	ADV
ahs-14180	28	2	,	,	PUNCT
ahs-14180	28	3	the	the	DET
ahs-14180	28	4	accumulation	accumulation	NOUN
ahs-14180	28	5	of	of	ADP
ahs-14180	28	6	excessive	excessive	ADJ
ahs-14180	28	7	ethanol	ethanol	NOUN
ahs-14180	28	8	results	result	NOUN
ahs-14180	28	9	in	in	ADP
ahs-14180	28	10	the	the	DET
ahs-14180	28	11	appearance	appearance	NOUN
ahs-14180	28	12	of	of	ADP
ahs-14180	28	13	off­fla­	off­fla­	PROPN
ahs-14180	28	14	vors	vor	NOUN
ahs-14180	28	15	and	and	CCONJ
ahs-14180	28	16	physiological	physiological	ADJ
ahs-14180	28	17	disorders	disorder	NOUN
ahs-14180	28	18	(	(	PUNCT
ahs-14180	28	19	pedreschi	pedreschi	PROPN
ahs-14180	28	20	et	et	PROPN
ahs-14180	28	21	al	al	PROPN
ahs-14180	28	22	.	.	PROPN
ahs-14180	28	23	,	,	PUNCT
ahs-14180	28	24	2009	2009	NUM
ahs-14180	28	25	)	)	PUNCT
ahs-14180	28	26	.	.	PUNCT
ahs-14180	29	1	thus	thus	ADV
ahs-14180	29	2	,	,	PUNCT
ahs-14180	29	3	based	base	VERB
ahs-14180	29	4	on	on	ADP
ahs-14180	29	5	different	different	ADJ
ahs-14180	29	6	stress	stress	NOUN
ahs-14180	29	7	indicators	indicator	NOUN
ahs-14180	29	8	(	(	PUNCT
ahs-14180	29	9	chlorophyll	chlorophyll	VERB
ahs-14180	29	10	fluorescence	fluorescence	NOUN
ahs-14180	29	11	­cf­	­cf­	NOUN
ahs-14180	29	12	,	,	PUNCT
ahs-14180	29	13	respiratory	respiratory	ADJ
ahs-14180	29	14	quotient	quotient	NOUN
ahs-14180	29	15	­	­	NOUN
ahs-14180	29	16	rq­	rq­	VERB
ahs-14180	29	17	,	,	PUNCT
ahs-14180	29	18	and	and	CCONJ
ahs-14180	29	19	ethanol	ethanol	NOUN
ahs-14180	29	20	concentration	concentration	NOUN
ahs-14180	29	21	)	)	PUNCT
ahs-14180	29	22	,	,	PUNCT
ahs-14180	29	23	oxygen	oxygen	NOUN
ahs-14180	29	24	must	must	AUX
ahs-14180	29	25	be	be	AUX
ahs-14180	29	26	promptly	promptly	ADV
ahs-14180	29	27	adjusted	adjust	VERB
ahs-14180	29	28	(	(	PUNCT
ahs-14180	29	29	increased	increase	VERB
ahs-14180	29	30	)	)	PUNCT
ahs-14180	29	31	to	to	PART
ahs-14180	29	32	reach	reach	VERB
ahs-14180	29	33	“	"	PUNCT
ahs-14180	29	34	safe	safe	ADJ
ahs-14180	29	35	”	"	PUNCT
ahs-14180	29	36	con­	con­	NOUN
ahs-14180	29	37	centrations	centration	NOUN
ahs-14180	29	38	.	.	PUNCT
ahs-14180	30	1	the	the	DET
ahs-14180	30	2	imposed	impose	VERB
ahs-14180	30	3	extreme	extreme	ADJ
ahs-14180	30	4	hypoxic	hypoxic	ADJ
ahs-14180	30	5	conditions	condition	NOUN
ahs-14180	30	6	induce	induce	VERB
ahs-14180	30	7	selective	selective	ADJ
ahs-14180	30	8	responses	response	NOUN
ahs-14180	30	9	of	of	ADP
ahs-14180	30	10	apple	apple	NOUN
ahs-14180	30	11	tissues	tissue	NOUN
ahs-14180	30	12	starting	start	VERB
ahs-14180	30	13	from	from	ADP
ahs-14180	30	14	the	the	DET
ahs-14180	30	15	modulation	modulation	NOUN
ahs-14180	30	16	of	of	ADP
ahs-14180	30	17	gene	gene	NOUN
ahs-14180	30	18	expression	expression	NOUN
ahs-14180	30	19	involved	involve	VERB
ahs-14180	30	20	in	in	ADP
ahs-14180	30	21	particular	particular	ADJ
ahs-14180	30	22	in	in	ADP
ahs-14180	30	23	primary	primary	ADJ
ahs-14180	30	24	metabolism	metabolism	NOUN
ahs-14180	30	25	and	and	CCONJ
ahs-14180	30	26	hormone	hormone	NOUN
ahs-14180	30	27	(	(	PUNCT
ahs-14180	30	28	mainly	mainly	ADV
ahs-14180	30	29	ethylene	ethylene	NOUN
ahs-14180	30	30	)	)	PUNCT
ahs-14180	30	31	physiology	physiology	NOUN
ahs-14180	30	32	(	(	PUNCT
ahs-14180	30	33	cukrov	cukrov	X
ahs-14180	30	34	et	et	PROPN
ahs-14180	30	35	al	al	PROPN
ahs-14180	30	36	.	.	PROPN
ahs-14180	30	37	,	,	PUNCT
ahs-14180	30	38	2019	2019	NUM
ahs-14180	30	39	)	)	PUNCT
ahs-14180	30	40	.	.	PUNCT
ahs-14180	31	1	in	in	ADP
ahs-14180	31	2	granny	granny	PROPN
ahs-14180	31	3	smith	smith	PROPN
ahs-14180	31	4	,	,	PUNCT
ahs-14180	31	5	one	one	NUM
ahs-14180	31	6	of	of	ADP
ahs-14180	31	7	the	the	DET
ahs-14180	31	8	apple	apple	NOUN
ahs-14180	31	9	cultivar	cultivar	NOUN
ahs-14180	31	10	most	most	ADJ
ahs-14180	31	11	fre­	fre­	NOUN
ahs-14180	31	12	quently	quently	ADV
ahs-14180	31	13	stored	store	VERB
ahs-14180	31	14	in	in	ADP
ahs-14180	31	15	dca	dca	PROPN
ahs-14180	31	16	,	,	PUNCT
ahs-14180	31	17	differential	differential	ADJ
ahs-14180	31	18	expression	expression	NOUN
ahs-14180	31	19	of	of	ADP
ahs-14180	31	20	sucrose	sucrose	ADJ
ahs-14180	31	21	synthase	synthase	NOUN
ahs-14180	31	22	(	(	PUNCT
ahs-14180	31	23	susy	susy	NOUN
ahs-14180	31	24	)	)	PUNCT
ahs-14180	31	25	,	,	PUNCT
ahs-14180	31	26	alcohol	alcohol	NOUN
ahs-14180	31	27	dehydrogenase	dehydrogenase	NOUN
ahs-14180	31	28	(	(	PUNCT
ahs-14180	31	29	adh	adh	PROPN
ahs-14180	31	30	)	)	PUNCT
ahs-14180	31	31	and	and	CCONJ
ahs-14180	31	32	pyruvate­related	pyruvate­relate	VERB
ahs-14180	31	33	metabolism	metabolism	NOUN
ahs-14180	31	34	(	(	PUNCT
ahs-14180	31	35	lactate	lactate	NOUN
ahs-14180	31	36	dehydrogenase	dehydrogenase	NOUN
ahs-14180	31	37	,	,	PUNCT
ahs-14180	31	38	ldh	ldh	NOUN
ahs-14180	31	39	,	,	PUNCT
ahs-14180	31	40	pyruvate	pyruvate	NOUN
ahs-14180	31	41	decarboxylase	decarboxylase	NOUN
ahs-14180	31	42	,	,	PUNCT
ahs-14180	31	43	pdc	pdc	PROPN
ahs-14180	31	44	,	,	PUNCT
ahs-14180	31	45	and	and	CCONJ
ahs-14180	31	46	alanine	alanine	NOUN
ahs-14180	31	47	aminotransferase	aminotransferase	PROPN
ahs-14180	31	48	,	,	PUNCT
ahs-14180	31	49	alaat	alaat	ADJ
ahs-14180	31	50	)	)	PUNCT
ahs-14180	31	51	genes	gene	NOUN
ahs-14180	31	52	was	be	AUX
ahs-14180	31	53	detected	detect	VERB
ahs-14180	31	54	when	when	SCONJ
ahs-14180	31	55	comparing	compare	VERB
ahs-14180	31	56	0.4	0.4	NUM
ahs-14180	31	57	with	with	ADP
ahs-14180	31	58	0.8	0.8	NUM
ahs-14180	31	59	kpa	kpa	PROPN
ahs-14180	31	60	oxygen	oxygen	NOUN
ahs-14180	31	61	concentration	concentration	NOUN
ahs-14180	31	62	(	(	PUNCT
ahs-14180	31	63	cukrov	cukrov	X
ahs-14180	31	64	et	et	PROPN
ahs-14180	31	65	al	al	PROPN
ahs-14180	31	66	.	.	PROPN
ahs-14180	31	67	,	,	PUNCT
ahs-14180	31	68	2016	2016	NUM
ahs-14180	31	69	)	)	PUNCT
ahs-14180	31	70	.	.	PUNCT
ahs-14180	32	1	when	when	SCONJ
ahs-14180	32	2	,	,	PUNCT
ahs-14180	32	3	according	accord	VERB
ahs-14180	32	4	to	to	ADP
ahs-14180	32	5	the	the	DET
ahs-14180	32	6	dca	dca	PROPN
ahs-14180	32	7	protocol	protocol	NOUN
ahs-14180	32	8	,	,	PUNCT
ahs-14180	32	9	oxygen	oxygen	NOUN
ahs-14180	32	10	level	level	NOUN
ahs-14180	32	11	is	be	AUX
ahs-14180	32	12	increased	increase	VERB
ahs-14180	32	13	from	from	ADP
ahs-14180	32	14	the	the	DET
ahs-14180	32	15	lowest	low	ADJ
ahs-14180	32	16	applied	apply	VERB
ahs-14180	32	17	concentrations	concentration	NOUN
ahs-14180	32	18	,	,	PUNCT
ahs-14180	32	19	molecular	molecular	ADJ
ahs-14180	32	20	and	and	CCONJ
ahs-14180	32	21	metabolic	metabolic	NOUN
ahs-14180	32	22	rearrangements	rearrangement	NOUN
ahs-14180	32	23	rapidly	rapidly	ADV
ahs-14180	32	24	occur	occur	VERB
ahs-14180	32	25	,	,	PUNCT
ahs-14180	32	26	with	with	ADP
ahs-14180	32	27	changes	change	NOUN
ahs-14180	32	28	in	in	ADP
ahs-14180	32	29	both	both	CCONJ
ahs-14180	32	30	primary	primary	ADJ
ahs-14180	32	31	and	and	CCONJ
ahs-14180	32	32	secondary	secondary	ADJ
ahs-14180	32	33	metabolism	metabolism	NOUN
ahs-14180	32	34	(	(	PUNCT
ahs-14180	32	35	brizzolara	brizzolara	PROPN
ahs-14180	32	36	et	et	PROPN
ahs-14180	32	37	al	al	PROPN
ahs-14180	32	38	.	.	PROPN
ahs-14180	32	39	,	,	PUNCT
ahs-14180	32	40	2019	2019	NUM
ahs-14180	32	41	)	)	PUNCT
ahs-14180	32	42	,	,	PUNCT
ahs-14180	32	43	indicating	indicate	VERB
ahs-14180	32	44	that	that	SCONJ
ahs-14180	32	45	highly	highly	ADV
ahs-14180	32	46	reac­	reac­	PRON
ahs-14180	32	47	tive	tive	NOUN
ahs-14180	32	48	mechanisms	mechanism	NOUN
ahs-14180	32	49	and	and	CCONJ
ahs-14180	32	50	oxygen	oxygen	NOUN
ahs-14180	32	51	sensors	sensor	NOUN
ahs-14180	32	52	are	be	AUX
ahs-14180	32	53	present	present	ADJ
ahs-14180	32	54	in	in	ADP
ahs-14180	32	55	apple	apple	NOUN
ahs-14180	32	56	cortex	cortex	NOUN
ahs-14180	32	57	.	.	PUNCT
ahs-14180	33	1	the	the	DET
ahs-14180	33	2	expression	expression	NOUN
ahs-14180	33	3	of	of	ADP
ahs-14180	33	4	genes	gene	NOUN
ahs-14180	33	5	involved	involve	VERB
ahs-14180	33	6	in	in	ADP
ahs-14180	33	7	fer­	fer­	ADJ
ahs-14180	33	8	mentative	mentative	ADJ
ahs-14180	33	9	metabolisms	metabolism	NOUN
ahs-14180	33	10	(	(	PUNCT
ahs-14180	33	11	e.g.	e.g.	ADV
ahs-14180	33	12	,	,	PUNCT
ahs-14180	33	13	adh	adh	PROPN
ahs-14180	33	14	)	)	PUNCT
ahs-14180	33	15	,	,	PUNCT
ahs-14180	33	16	in	in	ADP
ahs-14180	33	17	secondary	secondary	ADJ
ahs-14180	33	18	metabolism	metabolism	NOUN
ahs-14180	33	19	(	(	PUNCT
ahs-14180	33	20	e.g.	e.g.	ADV
ahs-14180	33	21	,	,	PUNCT
ahs-14180	33	22	phenylpropanoid	phenylpropanoid	ADJ
ahs-14180	33	23	pathway	pathway	NOUN
ahs-14180	33	24	)	)	PUNCT
ahs-14180	33	25	,	,	PUNCT
ahs-14180	33	26	hor­	hor­	PROPN
ahs-14180	33	27	monal	monal	ADJ
ahs-14180	33	28	responses	response	NOUN
ahs-14180	33	29	and	and	CCONJ
ahs-14180	33	30	regulatory	regulatory	ADJ
ahs-14180	33	31	mechanisms	mechanism	NOUN
ahs-14180	33	32	(	(	PUNCT
ahs-14180	33	33	ethyl­	ethyl­	PROPN
ahs-14180	33	34	ene	ene	NOUN
ahs-14180	33	35	biosynthesis	biosynthesis	NOUN
ahs-14180	33	36	,	,	PUNCT
ahs-14180	33	37	erfs	erf	NOUN
ahs-14180	33	38	)	)	PUNCT
ahs-14180	33	39	resulted	result	VERB
ahs-14180	33	40	to	to	PART
ahs-14180	33	41	be	be	AUX
ahs-14180	33	42	affected	affect	VERB
ahs-14180	33	43	by	by	ADP
ahs-14180	33	44	the	the	DET
ahs-14180	33	45	oxygen	oxygen	NOUN
ahs-14180	33	46	switch	switch	NOUN
ahs-14180	33	47	.	.	PUNCT
ahs-14180	34	1	the	the	DET
ahs-14180	34	2	duration	duration	NOUN
ahs-14180	34	3	of	of	ADP
ahs-14180	34	4	the	the	DET
ahs-14180	34	5	storage	storage	NOUN
ahs-14180	34	6	and	and	CCONJ
ahs-14180	34	7	the	the	DET
ahs-14180	34	8	oxygen	oxygen	NOUN
ahs-14180	34	9	con­	con­	NOUN
ahs-14180	34	10	centrations	centration	NOUN
ahs-14180	34	11	applied	apply	VERB
ahs-14180	34	12	obviously	obviously	ADV
ahs-14180	34	13	play	play	VERB
ahs-14180	34	14	a	a	DET
ahs-14180	34	15	key	key	ADJ
ahs-14180	34	16	role	role	NOUN
ahs-14180	34	17	in	in	ADP
ahs-14180	34	18	deter­	deter­	PROPN
ahs-14180	34	19	mining	mining	NOUN
ahs-14180	34	20	the	the	DET
ahs-14180	34	21	fruit	fruit	NOUN
ahs-14180	34	22	metabolic	metabolic	NOUN
ahs-14180	34	23	responses	response	NOUN
ahs-14180	34	24	and	and	CCONJ
ahs-14180	34	25	the	the	DET
ahs-14180	34	26	dynam­	dynam­	PROPN
ahs-14180	34	27	ics	ic	NOUN
ahs-14180	34	28	of	of	ADP
ahs-14180	34	29	fermentative	fermentative	ADJ
ahs-14180	34	30	metabolite	metabolite	NOUN
ahs-14180	34	31	accumulation	accumulation	NOUN
ahs-14180	34	32	.	.	PUNCT
ahs-14180	35	1	in	in	ADP
ahs-14180	35	2	addi­	addi­	NUM
ahs-14180	35	3	tion	tion	NOUN
ahs-14180	35	4	,	,	PUNCT
ahs-14180	35	5	apple	apple	NOUN
ahs-14180	35	6	varieties	variety	NOUN
ahs-14180	35	7	react	react	VERB
ahs-14180	35	8	differently	differently	ADV
ahs-14180	35	9	to	to	ADP
ahs-14180	35	10	extremely	extremely	ADV
ahs-14180	35	11	low	low	ADJ
ahs-14180	35	12	oxygen	oxygen	NOUN
ahs-14180	35	13	conditions	condition	NOUN
ahs-14180	35	14	during	during	ADP
ahs-14180	35	15	storage	storage	NOUN
ahs-14180	35	16	,	,	PUNCT
ahs-14180	35	17	in	in	ADP
ahs-14180	35	18	particular	particular	ADJ
ahs-14180	35	19	in	in	ADP
ahs-14180	35	20	terms	term	NOUN
ahs-14180	35	21	of	of	ADP
ahs-14180	35	22	fermentation	fermentation	NOUN
ahs-14180	35	23	,	,	PUNCT
ahs-14180	35	24	ethanol	ethanol	NOUN
ahs-14180	35	25	production	production	NOUN
ahs-14180	35	26	and	and	CCONJ
ahs-14180	35	27	accu­	accu­	NOUN
ahs-14180	35	28	mulation	mulation	NOUN
ahs-14180	35	29	(	(	PUNCT
ahs-14180	35	30	thewes	thewe	NOUN
ahs-14180	35	31	et	et	PROPN
ahs-14180	35	32	al	al	PROPN
ahs-14180	35	33	.	.	PROPN
ahs-14180	35	34	,	,	PUNCT
ahs-14180	35	35	2019	2019	NUM
ahs-14180	35	36	;	;	PUNCT
ahs-14180	35	37	brizzolara	brizzolara	PROPN
ahs-14180	35	38	et	et	PROPN
ahs-14180	35	39	al	al	PROPN
ahs-14180	35	40	.	.	PROPN
ahs-14180	35	41	,	,	PUNCT
ahs-14180	35	42	2020	2020	NUM
ahs-14180	35	43	;	;	PUNCT
ahs-14180	35	44	thewes	thewe	NOUN
ahs-14180	35	45	et	et	NOUN
ahs-14180	35	46	al	al	PROPN
ahs-14180	35	47	.	.	PROPN
ahs-14180	35	48	,	,	PUNCT
ahs-14180	35	49	2021	2021	NUM
ahs-14180	35	50	a	a	PRON
ahs-14180	35	51	;	;	PUNCT
ahs-14180	35	52	park	park	NOUN
ahs-14180	35	53	et	et	PROPN
ahs-14180	35	54	al	al	PROPN
ahs-14180	35	55	.	.	PROPN
ahs-14180	35	56	,	,	PUNCT
ahs-14180	35	57	2022	2022	NUM
ahs-14180	35	58	)	)	PUNCT
ahs-14180	35	59	.	.	PUNCT
ahs-14180	36	1	zanella	zanella	NOUN
ahs-14180	36	2	and	and	CCONJ
ahs-14180	36	3	stürz	stürz	PROPN
ahs-14180	36	4	(	(	PUNCT
ahs-14180	36	5	2015	2015	NUM
ahs-14180	36	6	)	)	PUNCT
ahs-14180	36	7	showed	show	VERB
ahs-14180	36	8	that	that	SCONJ
ahs-14180	36	9	,	,	PUNCT
ahs-14180	36	10	differently	differently	ADV
ahs-14180	36	11	from	from	ADP
ahs-14180	36	12	eight	eight	NUM
ahs-14180	36	13	other	other	ADJ
ahs-14180	36	14	varieties	variety	NOUN
ahs-14180	36	15	,	,	PUNCT
ahs-14180	36	16	‘	'	PUNCT
ahs-14180	36	17	red	red	ADJ
ahs-14180	36	18	delicious	delicious	ADJ
ahs-14180	36	19	’	'	PUNCT
ahs-14180	36	20	apples	apple	NOUN
ahs-14180	36	21	react	react	VERB
ahs-14180	36	22	signifi­	signifi­	PROPN
ahs-14180	36	23	cantly	cantly	ADV
ahs-14180	36	24	and	and	CCONJ
ahs-14180	36	25	accumulate	accumulate	VERB
ahs-14180	36	26	higher	high	ADJ
ahs-14180	36	27	ethanol	ethanol	NOUN
ahs-14180	36	28	levels	level	NOUN
ahs-14180	36	29	under	under	ADP
ahs-14180	36	30	hypoxia	hypoxia	NOUN
ahs-14180	36	31	,	,	PUNCT
ahs-14180	36	32	and	and	CCONJ
ahs-14180	36	33	in	in	ADP
ahs-14180	36	34	a	a	DET
ahs-14180	36	35	specific	specific	ADJ
ahs-14180	36	36	comparison	comparison	NOUN
ahs-14180	36	37	between	between	ADP
ahs-14180	36	38	granny	granny	NOUN
ahs-14180	36	39	smith	smith	NOUN
ahs-14180	36	40	and	and	CCONJ
ahs-14180	36	41	red	red	PROPN
ahs-14180	36	42	delicious	delicious	PROPN
ahs-14180	36	43	(	(	PUNCT
ahs-14180	36	44	brizzolara	brizzolara	PROPN
ahs-14180	36	45	et	et	PROPN
ahs-14180	36	46	al	al	PROPN
ahs-14180	36	47	.	.	PROPN
ahs-14180	36	48	,	,	PUNCT
ahs-14180	36	49	2017	2017	NUM
ahs-14180	36	50	)	)	PUNCT
ahs-14180	36	51	,	,	PUNCT
ahs-14180	36	52	it	it	PRON
ahs-14180	36	53	was	be	AUX
ahs-14180	36	54	reported	report	VERB
ahs-14180	36	55	that	that	SCONJ
ahs-14180	36	56	the	the	DET
ahs-14180	36	57	latter	latter	ADJ
ahs-14180	36	58	considerably	considerably	ADV
ahs-14180	36	59	accumulated	accumulate	VERB
ahs-14180	36	60	ethanol	ethanol	NOUN
ahs-14180	36	61	under	under	ADP
ahs-14180	36	62	both	both	DET
ahs-14180	36	63	ulo	ulo	NOUN
ahs-14180	36	64	(	(	PUNCT
ahs-14180	36	65	0.9	0.9	NUM
ahs-14180	36	66	kpa	kpa	PROPN
ahs-14180	36	67	oxy­	oxy­	PROPN
ahs-14180	36	68	gen	gen	PROPN
ahs-14180	36	69	)	)	PUNCT
ahs-14180	36	70	and	and	CCONJ
ahs-14180	36	71	dca	dca	PROPN
ahs-14180	36	72	(	(	PUNCT
ahs-14180	36	73	0.2­0.55	0.2­0.55	NUM
ahs-14180	36	74	kpa	kpa	PROPN
ahs-14180	36	75	oxygen	oxygen	NOUN
ahs-14180	36	76	)	)	PUNCT
ahs-14180	36	77	conditions	condition	NOUN
ahs-14180	36	78	,	,	PUNCT
ahs-14180	36	79	as	as	SCONJ
ahs-14180	36	80	also	also	ADV
ahs-14180	36	81	observed	observe	VERB
ahs-14180	36	82	by	by	ADP
ahs-14180	36	83	lumpkin	lumpkin	PROPN
ahs-14180	36	84	et	et	PROPN
ahs-14180	36	85	al	al	PROPN
ahs-14180	36	86	.	.	PROPN
ahs-14180	36	87	(	(	PUNCT
ahs-14180	36	88	2014	2014	NUM
ahs-14180	36	89	)	)	PUNCT
ahs-14180	36	90	.	.	PUNCT
ahs-14180	37	1	among	among	ADP
ahs-14180	37	2	important	important	ADJ
ahs-14180	37	3	commercial	commercial	ADJ
ahs-14180	37	4	apple	apple	NOUN
ahs-14180	37	5	varieties	variety	NOUN
ahs-14180	37	6	,	,	PUNCT
ahs-14180	37	7	the	the	DET
ahs-14180	37	8	responses	response	NOUN
ahs-14180	37	9	of	of	ADP
ahs-14180	37	10	red	red	PROPN
ahs-14180	37	11	delicious	delicious	PROPN
ahs-14180	37	12	to	to	ADP
ahs-14180	37	13	controlled	control	VERB
ahs-14180	37	14	atmosphere	atmosphere	NOUN
ahs-14180	37	15	(	(	PUNCT
ahs-14180	37	16	ca	ca	NOUN
ahs-14180	37	17	)	)	PUNCT
ahs-14180	37	18	and	and	CCONJ
ahs-14180	37	19	dca	dca	PROPN
ahs-14180	37	20	still	still	ADV
ahs-14180	37	21	need	need	VERB
ahs-14180	37	22	to	to	PART
ahs-14180	37	23	be	be	AUX
ahs-14180	37	24	compared	compare	VERB
ahs-14180	37	25	and	and	CCONJ
ahs-14180	37	26	clarified	clarify	VERB
ahs-14180	37	27	,	,	PUNCT
ahs-14180	37	28	which	which	PRON
ahs-14180	37	29	makes	make	VERB
ahs-14180	37	30	this	this	DET
ahs-14180	37	31	cultivar	cultivar	NOUN
ahs-14180	37	32	a	a	DET
ahs-14180	37	33	genotype	genotype	NOUN
ahs-14180	37	34	of	of	ADP
ahs-14180	37	35	interest	interest	NOUN
ahs-14180	37	36	in	in	ADP
ahs-14180	37	37	terms	term	NOUN
ahs-14180	37	38	of	of	ADP
ahs-14180	37	39	both	both	DET
ahs-14180	37	40	applied	apply	VERB
ahs-14180	37	41	aspects	aspect	NOUN
ahs-14180	37	42	and	and	CCONJ
ahs-14180	37	43	physiological	physiological	ADJ
ahs-14180	37	44	stud­	stud­	PROPN
ahs-14180	37	45	ies	ie	NOUN
ahs-14180	37	46	related	relate	VERB
ahs-14180	37	47	to	to	ADP
ahs-14180	37	48	dca	dca	PROPN
ahs-14180	37	49	conditions	condition	NOUN
ahs-14180	37	50	and	and	CCONJ
ahs-14180	37	51	different	different	ADJ
ahs-14180	37	52	oxygen	oxygen	NOUN
ahs-14180	37	53	regimes	regime	NOUN
ahs-14180	37	54	and	and	CCONJ
ahs-14180	37	55	concentration	concentration	NOUN
ahs-14180	37	56	adjustment	adjustment	NOUN
ahs-14180	37	57	protocols	protocol	NOUN
ahs-14180	37	58	.	.	PUNCT
ahs-14180	38	1	2	2	X
ahs-14180	38	2	.	.	X
ahs-14180	38	3	materials	material	NOUN
ahs-14180	38	4	and	and	CCONJ
ahs-14180	38	5	methods	method	NOUN
ahs-14180	38	6	experimental	experimental	ADJ
ahs-14180	38	7	design	design	NOUN
ahs-14180	38	8	and	and	CCONJ
ahs-14180	38	9	sampling	sample	VERB
ahs-14180	38	10	organic	organic	ADJ
ahs-14180	38	11	apple	apple	NOUN
ahs-14180	38	12	(	(	PUNCT
ahs-14180	38	13	malus	malus	PROPN
ahs-14180	38	14	domestica	domestica	PROPN
ahs-14180	38	15	borkh	borkh	PROPN
ahs-14180	38	16	.	.	PROPN
ahs-14180	38	17	,	,	PUNCT
ahs-14180	38	18	cv	cv	PROPN
ahs-14180	38	19	.	.	PROPN
ahs-14180	38	20	red	red	PROPN
ahs-14180	38	21	delicious	delicious	PROPN
ahs-14180	38	22	)	)	PUNCT
ahs-14180	38	23	fruit	fruit	NOUN
ahs-14180	38	24	were	be	AUX
ahs-14180	38	25	harvested	harvest	VERB
ahs-14180	38	26	in	in	ADP
ahs-14180	38	27	correspondence	correspondence	NOUN
ahs-14180	38	28	of	of	ADP
ahs-14180	38	29	an	an	DET
ahs-14180	38	30	average	average	ADJ
ahs-14180	38	31	tss	tss	NOUN
ahs-14180	38	32	value	value	NOUN
ahs-14180	38	33	of	of	ADP
ahs-14180	38	34	10.8	10.8	NUM
ahs-14180	38	35	°	°	NUM
ahs-14180	38	36	brix	brix	NOUN
ahs-14180	38	37	.	.	PUNCT
ahs-14180	39	1	fruit	fruit	NOUN
ahs-14180	39	2	were	be	AUX
ahs-14180	39	3	selected	select	VERB
ahs-14180	39	4	for	for	ADP
ahs-14180	39	5	their	their	PRON
ahs-14180	39	6	uniformity	uniformity	NOUN
ahs-14180	39	7	and	and	CCONJ
ahs-14180	39	8	absence	absence	NOUN
ahs-14180	39	9	of	of	ADP
ahs-14180	39	10	physical	physical	ADJ
ahs-14180	39	11	defects	defect	NOUN
ahs-14180	39	12	/	/	SYM
ahs-14180	39	13	decay	decay	NOUN
ahs-14180	39	14	and	and	CCONJ
ahs-14180	39	15	then	then	ADV
ahs-14180	39	16	kept	keep	VERB
ahs-14180	39	17	for	for	ADP
ahs-14180	39	18	3	3	NUM
ahs-14180	39	19	days	day	NOUN
ahs-14180	39	20	of	of	ADP
ahs-14180	39	21	acclima­	acclima­	DET
ahs-14180	39	22	tion	tion	NOUN
ahs-14180	39	23	at	at	ADP
ahs-14180	39	24	low	low	ADJ
ahs-14180	39	25	temperature	temperature	NOUN
ahs-14180	39	26	(	(	PUNCT
ahs-14180	39	27	0	0	NUM
ahs-14180	39	28	°	°	NUM
ahs-14180	39	29	c	c	NOUN
ahs-14180	39	30	)	)	PUNCT
ahs-14180	39	31	.	.	PUNCT
ahs-14180	40	1	control	control	NOUN
ahs-14180	40	2	atmosphere	atmosphere	NOUN
ahs-14180	40	3	storage	storage	NOUN
ahs-14180	40	4	was	be	AUX
ahs-14180	40	5	applied	apply	VERB
ahs-14180	40	6	by	by	ADP
ahs-14180	40	7	divid­	divid­	PROPN
ahs-14180	40	8	ing	e	VERB
ahs-14180	40	9	the	the	DET
ahs-14180	40	10	fruit	fruit	NOUN
ahs-14180	40	11	into	into	ADP
ahs-14180	40	12	two	two	NUM
ahs-14180	40	13	groups	group	NOUN
ahs-14180	40	14	in	in	ADP
ahs-14180	40	15	two	two	NUM
ahs-14180	40	16	different	different	ADJ
ahs-14180	40	17	cold	cold	ADJ
ahs-14180	40	18	chambers	chamber	NOUN
ahs-14180	40	19	.	.	PUNCT
ahs-14180	41	1	the	the	DET
ahs-14180	41	2	first	first	ADJ
ahs-14180	41	3	group	group	NOUN
ahs-14180	41	4	(	(	PUNCT
ahs-14180	41	5	about	about	ADV
ahs-14180	41	6	300	300	NUM
ahs-14180	41	7	fruit	fruit	NOUN
ahs-14180	41	8	)	)	PUNCT
ahs-14180	41	9	was	be	AUX
ahs-14180	41	10	ini­	ini­	NOUN
ahs-14180	41	11	tially	tially	ADV
ahs-14180	41	12	stored	store	VERB
ahs-14180	41	13	under	under	ADP
ahs-14180	41	14	oxygen	oxygen	NOUN
ahs-14180	41	15	concentration	concentration	NOUN
ahs-14180	41	16	of	of	ADP
ahs-14180	41	17	0.3	0.3	NUM
ahs-14180	41	18	%	%	NOUN
ahs-14180	41	19	(	(	PUNCT
ahs-14180	41	20	0.3ox	0.3ox	PROPN
ahs-14180	41	21	)	)	PUNCT
ahs-14180	41	22	while	while	SCONJ
ahs-14180	41	23	the	the	DET
ahs-14180	41	24	second	second	ADJ
ahs-14180	41	25	group	group	NOUN
ahs-14180	41	26	(	(	PUNCT
ahs-14180	41	27	60	60	NUM
ahs-14180	41	28	fruit	fruit	NOUN
ahs-14180	41	29	)	)	PUNCT
ahs-14180	41	30	was	be	AUX
ahs-14180	41	31	stored	store	VERB
ahs-14180	41	32	under	under	ADP
ahs-14180	41	33	the	the	DET
ahs-14180	41	34	safer	safe	ADJ
ahs-14180	41	35	oxygen	oxygen	NOUN
ahs-14180	41	36	concentration	concentration	NOUN
ahs-14180	41	37	of	of	ADP
ahs-14180	41	38	0.8	0.8	NUM
ahs-14180	41	39	%	%	NOUN
ahs-14180	41	40	(	(	PUNCT
ahs-14180	41	41	0.8ox	0.8ox	NUM
ahs-14180	41	42	)	)	PUNCT
ahs-14180	41	43	for	for	ADP
ahs-14180	41	44	a	a	DET
ahs-14180	41	45	total	total	ADJ
ahs-14180	41	46	period	period	NOUN
ahs-14180	41	47	of	of	ADP
ahs-14180	41	48	218	218	NUM
ahs-14180	41	49	dia	dia	PROPN
ahs-14180	41	50	(	(	PUNCT
ahs-14180	41	51	days	day	NOUN
ahs-14180	41	52	in	in	ADP
ahs-14180	41	53	atmosphere	atmosphere	NOUN
ahs-14180	41	54	)	)	PUNCT
ahs-14180	41	55	.	.	PUNCT
ahs-14180	42	1	samples	sample	NOUN
ahs-14180	42	2	were	be	AUX
ahs-14180	42	3	collected	collect	VERB
ahs-14180	42	4	at	at	ADP
ahs-14180	42	5	harvest	harvest	NOUN
ahs-14180	42	6	and	and	CCONJ
ahs-14180	42	7	t0	t0	NOUN
ahs-14180	42	8	sampling	sample	VERB
ahs-14180	42	9	was	be	AUX
ahs-14180	42	10	carried	carry	VERB
ahs-14180	42	11	out	out	ADP
ahs-14180	42	12	after	after	ADP
ahs-14180	42	13	24h	24h	NOUN
ahs-14180	42	14	in	in	ADP
ahs-14180	42	15	atmosphere	atmosphere	NOUN
ahs-14180	42	16	(	(	PUNCT
ahs-14180	42	17	1	1	NUM
ahs-14180	42	18	dia	dia	PROPN
ahs-14180	42	19	)	)	PUNCT
ahs-14180	42	20	.	.	PUNCT
ahs-14180	43	1	to	to	PART
ahs-14180	43	2	simulate	simulate	VERB
ahs-14180	43	3	the	the	DET
ahs-14180	43	4	dynamic	dynamic	ADJ
ahs-14180	43	5	changes	change	NOUN
ahs-14180	43	6	in	in	ADP
ahs-14180	43	7	oxygen	oxygen	NOUN
ahs-14180	43	8	concentra­	concentra­	NOUN
ahs-14180	43	9	tions	tion	NOUN
ahs-14180	43	10	applied	apply	VERB
ahs-14180	43	11	during	during	ADP
ahs-14180	43	12	a	a	DET
ahs-14180	43	13	dca	dca	PROPN
ahs-14180	43	14	storage	storage	NOUN
ahs-14180	43	15	,	,	PUNCT
ahs-14180	43	16	at	at	ADP
ahs-14180	43	17	t1	t1	PROPN
ahs-14180	43	18	(	(	PUNCT
ahs-14180	43	19	10	10	NUM
ahs-14180	43	20	dia	dia	PROPN
ahs-14180	43	21	)	)	PUNCT
ahs-14180	43	22	60	60	NUM
ahs-14180	43	23	fruit	fruit	NOUN
ahs-14180	43	24	originally	originally	ADV
ahs-14180	43	25	stored	store	VERB
ahs-14180	43	26	under	under	ADP
ahs-14180	43	27	0.3ox	0.3ox	PROPN
ahs-14180	43	28	were	be	AUX
ahs-14180	43	29	shifted	shift	VERB
ahs-14180	43	30	to	to	ADP
ahs-14180	43	31	0.8	0.8	NUM
ahs-14180	43	32	%	%	NOUN
ahs-14180	43	33	oxygen	oxygen	NOUN
ahs-14180	43	34	level	level	NOUN
ahs-14180	43	35	and	and	CCONJ
ahs-14180	43	36	kept	keep	VERB
ahs-14180	43	37	under	under	ADP
ahs-14180	43	38	these	these	DET
ahs-14180	43	39	conditions	condition	NOUN
ahs-14180	43	40	for	for	ADP
ahs-14180	43	41	the	the	DET
ahs-14180	43	42	whole	whole	ADJ
ahs-14180	43	43	period	period	NOUN
ahs-14180	43	44	of	of	ADP
ahs-14180	43	45	storage	storage	NOUN
ahs-14180	43	46	(	(	PUNCT
ahs-14180	43	47	218	218	NUM
ahs-14180	43	48	dia	dia	PROPN
ahs-14180	43	49	)	)	PUNCT
ahs-14180	43	50	.	.	PUNCT
ahs-14180	44	1	these	these	DET
ahs-14180	44	2	sam­	sam­	NOUN
ahs-14180	44	3	ples	ple	NOUN
ahs-14180	44	4	were	be	AUX
ahs-14180	44	5	called	call	VERB
ahs-14180	44	6	shift	shift	NOUN
ahs-14180	44	7	1	1	NUM
ahs-14180	44	8	and	and	CCONJ
ahs-14180	44	9	were	be	AUX
ahs-14180	44	10	sampled	sample	VERB
ahs-14180	44	11	successive­	successive­	ADV
ahs-14180	44	12	ly	ly	X
ahs-14180	44	13	at	at	ADP
ahs-14180	44	14	the	the	DET
ahs-14180	44	15	following	following	ADJ
ahs-14180	44	16	time	time	NOUN
ahs-14180	44	17	points	point	NOUN
ahs-14180	44	18	.	.	PUNCT
ahs-14180	45	1	at	at	ADP
ahs-14180	45	2	t2	t2	PROPN
ahs-14180	45	3	(	(	PUNCT
ahs-14180	45	4	20	20	NUM
ahs-14180	45	5	dia	dia	PROPN
ahs-14180	45	6	)	)	PUNCT
ahs-14180	45	7	,	,	PUNCT
ahs-14180	45	8	anoth­	anoth­	PROPN
ahs-14180	45	9	er	er	INTJ
ahs-14180	45	10	60	60	NUM
ahs-14180	45	11	fruit	fruit	NOUN
ahs-14180	45	12	were	be	AUX
ahs-14180	45	13	moved	move	VERB
ahs-14180	45	14	from	from	ADP
ahs-14180	45	15	0.3	0.3	NUM
ahs-14180	45	16	%	%	NOUN
ahs-14180	45	17	to	to	PART
ahs-14180	45	18	0.8	0.8	NUM
ahs-14180	45	19	%	%	NOUN
ahs-14180	45	20	oxygen	oxygen	NOUN
ahs-14180	45	21	and	and	CCONJ
ahs-14180	45	22	were	be	AUX
ahs-14180	45	23	called	call	VERB
ahs-14180	45	24	shift	shift	NOUN
ahs-14180	45	25	2	2	NUM
ahs-14180	45	26	.	.	PUNCT
ahs-14180	46	1	shift	shift	NOUN
ahs-14180	46	2	3	3	NUM
ahs-14180	46	3	was	be	AUX
ahs-14180	46	4	performed	perform	VERB
ahs-14180	46	5	at	at	ADP
ahs-14180	46	6	t3	t3	PROPN
ahs-14180	46	7	(	(	PUNCT
ahs-14180	46	8	31	31	NUM
ahs-14180	46	9	dia	dia	PROPN
ahs-14180	46	10	)	)	PUNCT
ahs-14180	46	11	and	and	CCONJ
ahs-14180	46	12	shift	shift	VERB
ahs-14180	46	13	4	4	NUM
ahs-14180	46	14	took	take	VERB
ahs-14180	46	15	place	place	NOUN
ahs-14180	46	16	at	at	ADP
ahs-14180	46	17	t4	t4	PROPN
ahs-14180	46	18	(	(	PUNCT
ahs-14180	46	19	110	110	NUM
ahs-14180	46	20	dia	dia	PROPN
ahs-14180	46	21	)	)	PUNCT
ahs-14180	46	22	.	.	PUNCT
ahs-14180	47	1	a	a	DET
ahs-14180	47	2	salamé	salamé	PROPN
ahs-14180	47	3	et	et	PROPN
ahs-14180	47	4	al	al	PROPN
ahs-14180	47	5	.	.	PROPN
ahs-14180	47	6	‐	‐	PROPN
ahs-14180	47	7	dca	dca	PROPN
ahs-14180	47	8	storage	storage	NOUN
ahs-14180	47	9	of	of	ADP
ahs-14180	47	10	red	red	PROPN
ahs-14180	47	11	delicious	delicious	PROPN
ahs-14180	47	12	apples	apple	NOUN
ahs-14180	47	13	91	91	NUM
ahs-14180	47	14	schematic	schematic	ADJ
ahs-14180	47	15	diagram	diagram	NOUN
ahs-14180	47	16	of	of	ADP
ahs-14180	47	17	the	the	DET
ahs-14180	47	18	experimental	experimental	ADJ
ahs-14180	47	19	design	design	NOUN
ahs-14180	47	20	is	be	AUX
ahs-14180	47	21	reported	report	VERB
ahs-14180	47	22	in	in	ADP
ahs-14180	47	23	figure	figure	NOUN
ahs-14180	47	24	1	1	NUM
ahs-14180	47	25	.	.	PUNCT
ahs-14180	48	1	at	at	ADP
ahs-14180	48	2	each	each	DET
ahs-14180	48	3	sampling	sampling	NOUN
ahs-14180	48	4	point	point	NOUN
ahs-14180	48	5	,	,	PUNCT
ahs-14180	48	6	three	three	NUM
ahs-14180	48	7	biological	biological	ADJ
ahs-14180	48	8	replicates	replicate	NOUN
ahs-14180	48	9	taken	take	VERB
ahs-14180	48	10	from	from	ADP
ahs-14180	48	11	three	three	NUM
ahs-14180	48	12	different	different	ADJ
ahs-14180	48	13	fruit	fruit	NOUN
ahs-14180	48	14	for	for	ADP
ahs-14180	48	15	each	each	DET
ahs-14180	48	16	treatment	treatment	NOUN
ahs-14180	48	17	were	be	AUX
ahs-14180	48	18	considered	consider	VERB
ahs-14180	48	19	.	.	PUNCT
ahs-14180	49	1	samples	sample	NOUN
ahs-14180	49	2	of	of	ADP
ahs-14180	49	3	cor­	cor­	NOUN
ahs-14180	49	4	tex	tex	PROPN
ahs-14180	49	5	tissue	tissue	NOUN
ahs-14180	49	6	were	be	AUX
ahs-14180	49	7	collected	collect	VERB
ahs-14180	49	8	,	,	PUNCT
ahs-14180	49	9	immediately	immediately	ADV
ahs-14180	49	10	frozen	freeze	VERB
ahs-14180	49	11	in	in	ADP
ahs-14180	49	12	liq­	liq­	PROPN
ahs-14180	49	13	uid	uid	ADJ
ahs-14180	49	14	nitrogen	nitrogen	NOUN
ahs-14180	49	15	,	,	PUNCT
ahs-14180	49	16	and	and	CCONJ
ahs-14180	49	17	stored	store	VERB
ahs-14180	49	18	at	at	ADP
ahs-14180	49	19	­80	­80	PROPN
ahs-14180	49	20	°	°	ADP
ahs-14180	49	21	c	c	NOUN
ahs-14180	49	22	.	.	PUNCT
ahs-14180	50	1	flesh	flesh	NOUN
ahs-14180	50	2	firmness	firmness	NOUN
ahs-14180	50	3	,	,	PUNCT
ahs-14180	50	4	total	total	ADJ
ahs-14180	50	5	soluble	soluble	ADJ
ahs-14180	50	6	sugars	sugar	NOUN
ahs-14180	50	7	content	content	NOUN
ahs-14180	50	8	and	and	CCONJ
ahs-14180	50	9	ethanol	ethanol	NOUN
ahs-14180	50	10	quantification	quantification	NOUN
ahs-14180	50	11	flesh	flesh	NOUN
ahs-14180	50	12	firmness	firmness	NOUN
ahs-14180	50	13	was	be	AUX
ahs-14180	50	14	measured	measure	VERB
ahs-14180	50	15	at	at	ADP
ahs-14180	50	16	harvest	harvest	NOUN
ahs-14180	50	17	(	(	PUNCT
ahs-14180	50	18	t0	t0	NOUN
ahs-14180	50	19	)	)	PUNCT
ahs-14180	50	20	and	and	CCONJ
ahs-14180	50	21	at	at	ADP
ahs-14180	50	22	the	the	DET
ahs-14180	50	23	end	end	NOUN
ahs-14180	50	24	of	of	ADP
ahs-14180	50	25	the	the	DET
ahs-14180	50	26	storage	storage	NOUN
ahs-14180	50	27	at	at	ADP
ahs-14180	50	28	t5	t5	PROPN
ahs-14180	50	29	(	(	PUNCT
ahs-14180	50	30	218	218	NUM
ahs-14180	50	31	dia	dia	PROPN
ahs-14180	50	32	)	)	PUNCT
ahs-14180	50	33	.	.	PUNCT
ahs-14180	51	1	measurements	measurement	NOUN
ahs-14180	51	2	were	be	AUX
ahs-14180	51	3	taken	take	VERB
ahs-14180	51	4	at	at	ADP
ahs-14180	51	5	the	the	DET
ahs-14180	51	6	two	two	NUM
ahs-14180	51	7	opposite	opposite	ADJ
ahs-14180	51	8	sides	side	NOUN
ahs-14180	51	9	of	of	ADP
ahs-14180	51	10	the	the	DET
ahs-14180	51	11	equatorial	equatorial	ADJ
ahs-14180	51	12	part	part	NOUN
ahs-14180	51	13	using	use	VERB
ahs-14180	51	14	a	a	DET
ahs-14180	51	15	fruit	fruit	NOUN
ahs-14180	51	16	penetrometer	penetrometer	NOUN
ahs-14180	51	17	(	(	PUNCT
ahs-14180	51	18	mod	mod	PROPN
ahs-14180	51	19	.	.	PUNCT
ahs-14180	52	1	ft	ft	PROPN
ahs-14180	52	2	327	327	NUM
ahs-14180	52	3	,	,	PUNCT
ahs-14180	52	4	3­27	3­27	NUM
ahs-14180	52	5	lbs	lbs	NOUN
ahs-14180	52	6	)	)	PUNCT
ahs-14180	52	7	with	with	ADP
ahs-14180	52	8	a	a	DET
ahs-14180	52	9	large	large	ADJ
ahs-14180	52	10	plunger	plunger	NOUN
ahs-14180	52	11	tip	tip	NOUN
ahs-14180	52	12	(	(	PUNCT
ahs-14180	52	13	11	11	NUM
ahs-14180	52	14	mm­diameter	mm­diameter	NOUN
ahs-14180	52	15	)	)	PUNCT
ahs-14180	52	16	after	after	ADP
ahs-14180	52	17	removing	remove	VERB
ahs-14180	52	18	1	1	NUM
ahs-14180	52	19	mm	mm	NOUN
ahs-14180	52	20	of	of	ADP
ahs-14180	52	21	the	the	DET
ahs-14180	52	22	peel	peel	NOUN
ahs-14180	52	23	.	.	PUNCT
ahs-14180	53	1	total	total	ADJ
ahs-14180	53	2	soluble	soluble	ADJ
ahs-14180	53	3	solid	solid	ADJ
ahs-14180	53	4	content	content	NOUN
ahs-14180	53	5	(	(	PUNCT
ahs-14180	53	6	tss	tss	NOUN
ahs-14180	53	7	,	,	PUNCT
ahs-14180	53	8	°	°	NOUN
ahs-14180	53	9	brix	brix	NOUN
ahs-14180	53	10	)	)	PUNCT
ahs-14180	53	11	was	be	AUX
ahs-14180	53	12	deter­	deter­	PROPN
ahs-14180	53	13	mined	mine	VERB
ahs-14180	53	14	in	in	ADP
ahs-14180	53	15	the	the	DET
ahs-14180	53	16	flesh	flesh	NOUN
ahs-14180	53	17	juice	juice	NOUN
ahs-14180	53	18	of	of	ADP
ahs-14180	53	19	apples	apple	NOUN
ahs-14180	53	20	using	use	VERB
ahs-14180	53	21	a	a	DET
ahs-14180	53	22	portable	portable	ADJ
ahs-14180	53	23	refractometer	refractometer	NOUN
ahs-14180	53	24	(	(	PUNCT
ahs-14180	53	25	sinergica	sinergica	PROPN
ahs-14180	53	26	soluzioni	soluzioni	PROPN
ahs-14180	53	27	,	,	PUNCT
ahs-14180	53	28	pescara	pescara	PROPN
ahs-14180	53	29	,	,	PUNCT
ahs-14180	53	30	italy	italy	PROPN
ahs-14180	53	31	)	)	PUNCT
ahs-14180	53	32	;	;	PUNCT
ahs-14180	53	33	measurements	measurement	NOUN
ahs-14180	53	34	were	be	AUX
ahs-14180	53	35	performed	perform	VERB
ahs-14180	53	36	at	at	ADP
ahs-14180	53	37	harvest	harvest	NOUN
ahs-14180	53	38	and	and	CCONJ
ahs-14180	53	39	the	the	DET
ahs-14180	53	40	end	end	NOUN
ahs-14180	53	41	of	of	ADP
ahs-14180	53	42	the	the	DET
ahs-14180	53	43	storage	storage	NOUN
ahs-14180	53	44	at	at	ADP
ahs-14180	53	45	t5	t5	PROPN
ahs-14180	53	46	(	(	PUNCT
ahs-14180	53	47	218	218	NUM
ahs-14180	53	48	dia	dia	PROPN
ahs-14180	53	49	)	)	PUNCT
ahs-14180	53	50	on	on	ADP
ahs-14180	53	51	pulp	pulp	NOUN
ahs-14180	53	52	juice	juice	NOUN
ahs-14180	53	53	sam­	sam­	NOUN
ahs-14180	53	54	ples	ple	NOUN
ahs-14180	53	55	taken	take	VERB
ahs-14180	53	56	from	from	ADP
ahs-14180	53	57	the	the	DET
ahs-14180	53	58	opposite	opposite	ADJ
ahs-14180	53	59	sides	side	NOUN
ahs-14180	53	60	of	of	ADP
ahs-14180	53	61	the	the	DET
ahs-14180	53	62	fruit	fruit	NOUN
ahs-14180	53	63	.	.	PUNCT
ahs-14180	54	1	ethanol	ethanol	NOUN
ahs-14180	54	2	content	content	NOUN
ahs-14180	54	3	was	be	AUX
ahs-14180	54	4	measured	measure	VERB
ahs-14180	54	5	by	by	ADP
ahs-14180	54	6	using	use	VERB
ahs-14180	54	7	a	a	DET
ahs-14180	54	8	tectronik	tectronik	NOUN
ahs-14180	54	9	(	(	PUNCT
ahs-14180	54	10	tectronik	tectronik	X
ahs-14180	54	11	,	,	PUNCT
ahs-14180	54	12	padova	padova	PROPN
ahs-14180	54	13	,	,	PUNCT
ahs-14180	54	14	italy	italy	PROPN
ahs-14180	54	15	)	)	PUNCT
ahs-14180	54	16	senzytec	senzytec	PROPN
ahs-14180	54	17	analyser	analyser	NOUN
ahs-14180	54	18	,	,	PUNCT
ahs-14180	54	19	following	follow	VERB
ahs-14180	54	20	the	the	DET
ahs-14180	54	21	instructions	instruction	NOUN
ahs-14180	54	22	of	of	ADP
ahs-14180	54	23	the	the	DET
ahs-14180	54	24	manufacturer	manufacturer	NOUN
ahs-14180	54	25	and	and	CCONJ
ahs-14180	54	26	using	use	VERB
ahs-14180	54	27	100µl	100µl	PROPN
ahs-14180	54	28	of	of	ADP
ahs-14180	54	29	juice	juice	NOUN
ahs-14180	54	30	obtained	obtain	VERB
ahs-14180	54	31	by	by	ADP
ahs-14180	54	32	collectively	collectively	ADV
ahs-14180	54	33	pressing	press	VERB
ahs-14180	54	34	portions	portion	NOUN
ahs-14180	54	35	(	(	PUNCT
ahs-14180	54	36	approximately	approximately	ADV
ahs-14180	54	37	1/3	1/3	NUM
ahs-14180	54	38	)	)	PUNCT
ahs-14180	54	39	of	of	ADP
ahs-14180	54	40	the	the	DET
ahs-14180	54	41	cortex	cortex	NOUN
ahs-14180	54	42	of	of	ADP
ahs-14180	54	43	three	three	NUM
ahs-14180	54	44	apples	apple	NOUN
ahs-14180	54	45	rep­	rep­	ADV
ahs-14180	54	46	resenting	resent	VERB
ahs-14180	54	47	the	the	DET
ahs-14180	54	48	biological	biological	ADJ
ahs-14180	54	49	replicate	replicate	NOUN
ahs-14180	54	50	.	.	PUNCT
ahs-14180	55	1	rna	rna	NOUN
ahs-14180	55	2	extraction	extraction	NOUN
ahs-14180	55	3	and	and	CCONJ
ahs-14180	55	4	cdna	cdna	PROPN
ahs-14180	55	5	synthesis	synthesis	NOUN
ahs-14180	55	6	total	total	NOUN
ahs-14180	55	7	rna	rna	NOUN
ahs-14180	55	8	was	be	AUX
ahs-14180	55	9	isolated	isolate	VERB
ahs-14180	55	10	from	from	ADP
ahs-14180	55	11	cortex	cortex	NOUN
ahs-14180	55	12	tissue	tissue	NOUN
ahs-14180	55	13	using	use	VERB
ahs-14180	55	14	‘	'	PUNCT
ahs-14180	55	15	sigma	sigma	NOUN
ahs-14180	55	16	­aldrich	­aldrich	ADP
ahs-14180	55	17	’	'	PUNCT
ahs-14180	55	18	rna	rna	NOUN
ahs-14180	55	19	extraction	extraction	NOUN
ahs-14180	55	20	kit	kit	NOUN
ahs-14180	55	21	following	follow	VERB
ahs-14180	55	22	the	the	DET
ahs-14180	55	23	manufacturer	manufacturer	NOUN
ahs-14180	55	24	instructions	instruction	NOUN
ahs-14180	55	25	.	.	PUNCT
ahs-14180	56	1	total	total	ADJ
ahs-14180	56	2	rna	rna	PROPN
ahs-14180	56	3	was	be	AUX
ahs-14180	56	4	quantified	quantify	VERB
ahs-14180	56	5	(	(	PUNCT
ahs-14180	56	6	ng	ng	PROPN
ahs-14180	56	7	/	/	SYM
ahs-14180	56	8	μl	μl	NOUN
ahs-14180	56	9	)	)	PUNCT
ahs-14180	56	10	using	use	VERB
ahs-14180	56	11	uv	uv	NOUN
ahs-14180	56	12	spectrophotometry	spectrophotometry	NOUN
ahs-14180	56	13	calibrated	calibrate	VERB
ahs-14180	56	14	with	with	ADP
ahs-14180	56	15	rnase­free	rnase­free	NOUN
ahs-14180	56	16	water	water	NOUN
ahs-14180	56	17	.	.	PUNCT
ahs-14180	57	1	rna	rna	NOUN
ahs-14180	57	2	purity	purity	NOUN
ahs-14180	57	3	was	be	AUX
ahs-14180	57	4	assessed	assess	VERB
ahs-14180	57	5	by	by	ADP
ahs-14180	57	6	evalu­	evalu­	PROPN
ahs-14180	57	7	ating	ate	VERB
ahs-14180	57	8	the	the	DET
ahs-14180	57	9	absorbance	absorbance	NOUN
ahs-14180	57	10	ratio	ratio	NOUN
ahs-14180	57	11	at	at	ADP
ahs-14180	57	12	260/280	260/280	PROPN
ahs-14180	57	13	and	and	CCONJ
ahs-14180	57	14	260/230	260/230	PROPN
ahs-14180	57	15	nm	nm	PROPN
ahs-14180	57	16	.	.	PUNCT
ahs-14180	58	1	ribosomal	ribosomal	PROPN
ahs-14180	58	2	rna	rna	PROPN
ahs-14180	58	3	bands	band	NOUN
ahs-14180	58	4	integrity	integrity	NOUN
ahs-14180	58	5	was	be	AUX
ahs-14180	58	6	verified	verify	VERB
ahs-14180	58	7	using	use	VERB
ahs-14180	58	8	gelred	gelre	VERB
ahs-14180	58	9	™	™	NOUN
ahs-14180	58	10	­stained	­staine	VERB
ahs-14180	58	11	1	1	NUM
ahs-14180	58	12	%	%	NOUN
ahs-14180	58	13	agarose	agarose	NOUN
ahs-14180	58	14	gel	gel	NOUN
ahs-14180	58	15	(	(	PUNCT
ahs-14180	58	16	aranda	aranda	NOUN
ahs-14180	58	17	et	et	PROPN
ahs-14180	58	18	al	al	PROPN
ahs-14180	58	19	.	.	PROPN
ahs-14180	58	20	,	,	PUNCT
ahs-14180	58	21	2012	2012	NUM
ahs-14180	58	22	)	)	PUNCT
ahs-14180	58	23	.	.	PUNCT
ahs-14180	59	1	rna	rna	PROPN
ahs-14180	59	2	was	be	AUX
ahs-14180	59	3	reverse­transcribed	reverse­transcribe	VERB
ahs-14180	59	4	into	into	ADP
ahs-14180	59	5	first­strand	first­strand	ADJ
ahs-14180	59	6	cdna	cdna	PROPN
ahs-14180	59	7	using	use	VERB
ahs-14180	59	8	4	4	NUM
ahs-14180	59	9	µl	µl	ADP
ahs-14180	59	10	readyscript	readyscript	NOUN
ahs-14180	59	11	™	™	PROPN
ahs-14180	59	12	(	(	PUNCT
ahs-14180	59	13	sigma	sigma	NOUN
ahs-14180	59	14	,	,	PUNCT
ahs-14180	59	15	rdrt­	rdrt­	NOUN
ahs-14180	59	16	500rxn	500rxn	NUM
ahs-14180	59	17	)	)	PUNCT
ahs-14180	59	18	,	,	PUNCT
ahs-14180	59	19	starting	start	VERB
ahs-14180	59	20	from	from	ADP
ahs-14180	59	21	400	400	NUM
ahs-14180	59	22	ng	ng	PROPN
ahs-14180	59	23	of	of	ADP
ahs-14180	59	24	total	total	ADJ
ahs-14180	59	25	rna	rna	NOUN
ahs-14180	59	26	in	in	ADP
ahs-14180	59	27	a	a	DET
ahs-14180	59	28	final	final	ADJ
ahs-14180	59	29	volume	volume	NOUN
ahs-14180	59	30	of	of	ADP
ahs-14180	59	31	20	20	NUM
ahs-14180	59	32	µl	µl	NOUN
ahs-14180	59	33	using	use	VERB
ahs-14180	59	34	depc	depc	NOUN
ahs-14180	59	35	treated	treat	VERB
ahs-14180	59	36	water	water	NOUN
ahs-14180	59	37	.	.	PUNCT
ahs-14180	60	1	the	the	DET
ahs-14180	60	2	reac­	reac­	PROPN
ahs-14180	60	3	tion	tion	NOUN
ahs-14180	60	4	was	be	AUX
ahs-14180	60	5	incubated	incubate	VERB
ahs-14180	60	6	at	at	ADP
ahs-14180	60	7	25	25	NUM
ahs-14180	60	8	°	°	NOUN
ahs-14180	60	9	c	c	NOUN
ahs-14180	60	10	for	for	ADP
ahs-14180	60	11	5	5	NUM
ahs-14180	60	12	minutes	minute	NOUN
ahs-14180	60	13	,	,	PUNCT
ahs-14180	60	14	then	then	ADV
ahs-14180	60	15	at	at	ADP
ahs-14180	60	16	46	46	NUM
ahs-14180	60	17	°	°	ADP
ahs-14180	60	18	c	c	NOUN
ahs-14180	60	19	for	for	ADP
ahs-14180	60	20	20	20	NUM
ahs-14180	60	21	min	min	NOUN
ahs-14180	60	22	and	and	CCONJ
ahs-14180	60	23	then	then	ADV
ahs-14180	60	24	heated	heat	VERB
ahs-14180	60	25	at	at	ADP
ahs-14180	60	26	95	95	NUM
ahs-14180	60	27	°	°	ADP
ahs-14180	60	28	c	c	NOUN
ahs-14180	60	29	for	for	ADP
ahs-14180	60	30	1	1	NUM
ahs-14180	60	31	min	min	NOUN
ahs-14180	60	32	and	and	CCONJ
ahs-14180	60	33	finally	finally	ADV
ahs-14180	60	34	at	at	ADP
ahs-14180	60	35	4	4	NUM
ahs-14180	60	36	°	°	ADP
ahs-14180	60	37	c	c	NOUN
ahs-14180	60	38	for	for	ADP
ahs-14180	60	39	15	15	NUM
ahs-14180	60	40	min	min	NOUN
ahs-14180	60	41	.	.	PUNCT
ahs-14180	61	1	the	the	DET
ahs-14180	61	2	synthetized	synthetize	VERB
ahs-14180	61	3	cdna	cdna	PROPN
ahs-14180	61	4	was	be	AUX
ahs-14180	61	5	diluted	dilute	VERB
ahs-14180	61	6	1:5	1:5	NUM
ahs-14180	61	7	by	by	ADP
ahs-14180	61	8	adding	add	VERB
ahs-14180	61	9	sterile	sterile	ADJ
ahs-14180	61	10	water	water	NOUN
ahs-14180	61	11	.	.	PUNCT
ahs-14180	62	1	gene	gene	NOUN
ahs-14180	62	2	expression	expression	NOUN
ahs-14180	62	3	analysis	analysis	NOUN
ahs-14180	62	4	by	by	ADP
ahs-14180	62	5	real‐time	real‐time	NOUN
ahs-14180	62	6	pcr	pcr	PROPN
ahs-14180	62	7	quantitative	quantitative	ADJ
ahs-14180	62	8	real­time	real­time	ADJ
ahs-14180	62	9	pcr	pcr	PROPN
ahs-14180	62	10	was	be	AUX
ahs-14180	62	11	performed	perform	VERB
ahs-14180	62	12	using	use	VERB
ahs-14180	62	13	three	three	NUM
ahs-14180	62	14	biological	biological	ADJ
ahs-14180	62	15	replicates	replicate	NOUN
ahs-14180	62	16	and	and	CCONJ
ahs-14180	62	17	two	two	NUM
ahs-14180	62	18	technical	technical	ADJ
ahs-14180	62	19	repli­	repli­	PROPN
ahs-14180	62	20	cates	cat	VERB
ahs-14180	62	21	for	for	ADP
ahs-14180	62	22	each	each	DET
ahs-14180	62	23	sample	sample	NOUN
ahs-14180	62	24	.	.	PUNCT
ahs-14180	63	1	based	base	VERB
ahs-14180	63	2	on	on	ADP
ahs-14180	63	3	the	the	DET
ahs-14180	63	4	paper	paper	NOUN
ahs-14180	63	5	by	by	ADP
ahs-14180	63	6	cukrov	cukrov	PROPN
ahs-14180	63	7	et	et	PROPN
ahs-14180	63	8	al	al	PROPN
ahs-14180	63	9	.	.	PUNCT
ahs-14180	64	1	(	(	PUNCT
ahs-14180	64	2	2016	2016	NUM
ahs-14180	64	3	)	)	PUNCT
ahs-14180	64	4	,	,	PUNCT
ahs-14180	64	5	primer	primer	NOUN
ahs-14180	64	6	pairs	pair	NOUN
ahs-14180	64	7	of	of	ADP
ahs-14180	64	8	genes	gene	NOUN
ahs-14180	64	9	related	relate	VERB
ahs-14180	64	10	to	to	ADP
ahs-14180	64	11	sucrose	sucrose	VERB
ahs-14180	64	12	/	/	SYM
ahs-14180	64	13	starch	starch	NOUN
ahs-14180	64	14	metabolism	metabolism	NOUN
ahs-14180	64	15	(	(	PUNCT
ahs-14180	64	16	β‐amylase	β‐amylase	X
ahs-14180	64	17	,	,	PUNCT
ahs-14180	64	18	mdbam	mdbam	NOUN
ahs-14180	64	19	;	;	PUNCT
ahs-14180	64	20	phosphofructokinase	phosphofructokinase	NOUN
ahs-14180	64	21	,	,	PUNCT
ahs-14180	64	22	mdpfk	mdpfk	NOUN
ahs-14180	64	23	;	;	PUNCT
ahs-14180	64	24	sucrose	sucrose	ADJ
ahs-14180	64	25	synthase	synthase	NOUN
ahs-14180	64	26	,	,	PUNCT
ahs-14180	64	27	mdsusy	mdsusy	NOUN
ahs-14180	64	28	)	)	PUNCT
ahs-14180	64	29	,	,	PUNCT
ahs-14180	64	30	the	the	DET
ahs-14180	64	31	fermentative	fermentative	ADJ
ahs-14180	64	32	/	/	SYM
ahs-14180	64	33	pyruvic	pyruvic	ADJ
ahs-14180	64	34	acid	acid	NOUN
ahs-14180	64	35	metabolism	metabolism	NOUN
ahs-14180	64	36	(	(	PUNCT
ahs-14180	64	37	alcohol	alcohol	NOUN
ahs-14180	64	38	dehydrogenase	dehydrogenase	NOUN
ahs-14180	64	39	,	,	PUNCT
ahs-14180	64	40	mdadh	mdadh	NOUN
ahs-14180	64	41	;	;	PUNCT
ahs-14180	64	42	lactate	lactate	PROPN
ahs-14180	64	43	dehydroge‐	dehydroge‐	NOUN
ahs-14180	64	44	nase	nase	PROPN
ahs-14180	64	45	,	,	PUNCT
ahs-14180	64	46	mdldh	mdldh	NOUN
ahs-14180	64	47	;	;	PUNCT
ahs-14180	64	48	pyruvate	pyruvate	NOUN
ahs-14180	64	49	decarboxylase	decarboxylase	NOUN
ahs-14180	64	50	,	,	PUNCT
ahs-14180	64	51	mdpdc	mdpdc	NOUN
ahs-14180	64	52	;	;	PUNCT
ahs-14180	64	53	ala‐	ala‐	PROPN
ahs-14180	64	54	nine	nine	NUM
ahs-14180	64	55	aminotransferase	aminotransferase	NOUN
ahs-14180	64	56	,	,	PUNCT
ahs-14180	64	57	mdalaat	mdalaat	NOUN
ahs-14180	64	58	)	)	PUNCT
ahs-14180	64	59	,	,	PUNCT
ahs-14180	64	60	ethylene	ethylene	NOUN
ahs-14180	64	61	biosyn­	biosyn­	NOUN
ahs-14180	64	62	thesis	thesis	NOUN
ahs-14180	64	63	(	(	PUNCT
ahs-14180	64	64	acc	acc	NOUN
ahs-14180	64	65	synthase	synthase	NOUN
ahs-14180	64	66	,	,	PUNCT
ahs-14180	64	67	mdacs	mdac	NOUN
ahs-14180	64	68	;	;	PUNCT
ahs-14180	64	69	acc	acc	NOUN
ahs-14180	64	70	oxidase	oxidase	NOUN
ahs-14180	64	71	,	,	PUNCT
ahs-14180	64	72	mdaco	mdaco	PROPN
ahs-14180	64	73	)	)	PUNCT
ahs-14180	64	74	,	,	PUNCT
ahs-14180	64	75	and	and	CCONJ
ahs-14180	64	76	6	6	NUM
ahs-14180	64	77	ethylene	ethylene	NOUN
ahs-14180	64	78	responsive	responsive	ADJ
ahs-14180	64	79	factors	factor	NOUN
ahs-14180	64	80	(	(	PUNCT
ahs-14180	64	81	erfs	erfs	PROPN
ahs-14180	64	82	)	)	PUNCT
ahs-14180	64	83	were	be	AUX
ahs-14180	64	84	used	use	VERB
ahs-14180	64	85	(	(	PUNCT
ahs-14180	64	86	table	table	NOUN
ahs-14180	64	87	1	1	NUM
ahs-14180	64	88	)	)	PUNCT
ahs-14180	64	89	.	.	PUNCT
ahs-14180	65	1	actin	actin	PROPN
ahs-14180	65	2	was	be	AUX
ahs-14180	65	3	used	use	VERB
ahs-14180	65	4	as	as	ADP
ahs-14180	65	5	a	a	DET
ahs-14180	65	6	housekeeping	housekeeping	NOUN
ahs-14180	65	7	gene	gene	NOUN
ahs-14180	65	8	.	.	PUNCT
ahs-14180	66	1	reaction	reaction	NOUN
ahs-14180	66	2	mixtures	mixture	NOUN
ahs-14180	66	3	were	be	AUX
ahs-14180	66	4	prepared	prepare	VERB
ahs-14180	66	5	,	,	PUNCT
ahs-14180	66	6	under	under	ADP
ahs-14180	66	7	sterile	sterile	ADJ
ahs-14180	66	8	conditions	condition	NOUN
ahs-14180	66	9	,	,	PUNCT
ahs-14180	66	10	for	for	ADP
ahs-14180	66	11	the	the	DET
ahs-14180	66	12	target	target	NOUN
ahs-14180	66	13	and	and	CCONJ
ahs-14180	66	14	reference	reference	NOUN
ahs-14180	66	15	genes	gene	NOUN
ahs-14180	66	16	,	,	PUNCT
ahs-14180	66	17	con­	con­	PROPN
ahs-14180	66	18	taining	taine	VERB
ahs-14180	66	19	each	each	DET
ahs-14180	66	20	5	5	NUM
ahs-14180	66	21	μl	μl	ADP
ahs-14180	66	22	of	of	ADP
ahs-14180	66	23	2xsybr	2xsybr	NUM
ahs-14180	66	24	®	®	NOUN
ahs-14180	66	25	green	green	VERB
ahs-14180	66	26	qpcr	qpcr	ADJ
ahs-14180	66	27	readymix	readymix	NOUN
ahs-14180	66	28	™	™	PROPN
ahs-14180	66	29	(	(	PUNCT
ahs-14180	66	30	sigma	sigma	PROPN
ahs-14180	66	31	)	)	PUNCT
ahs-14180	66	32	,	,	PUNCT
ahs-14180	66	33	1	1	NUM
ahs-14180	66	34	μl	μl	ADP
ahs-14180	66	35	of	of	ADP
ahs-14180	66	36	each	each	DET
ahs-14180	66	37	primer	primer	NOUN
ahs-14180	66	38	(	(	PUNCT
ahs-14180	66	39	forward	forward	ADV
ahs-14180	66	40	and	and	CCONJ
ahs-14180	66	41	reverse	reverse	VERB
ahs-14180	66	42	)	)	PUNCT
ahs-14180	66	43	(	(	PUNCT
ahs-14180	66	44	10	10	NUM
ahs-14180	66	45	µm	µm	NOUN
ahs-14180	66	46	)	)	PUNCT
ahs-14180	66	47	,	,	PUNCT
ahs-14180	66	48	2	2	NUM
ahs-14180	66	49	µl	µl	ADP
ahs-14180	66	50	rnase­free	rnase­free	NOUN
ahs-14180	66	51	water	water	NOUN
ahs-14180	66	52	and	and	CCONJ
ahs-14180	66	53	1	1	NUM
ahs-14180	66	54	μl	μl	ADP
ahs-14180	66	55	of	of	ADP
ahs-14180	66	56	cdna	cdna	PROPN
ahs-14180	66	57	.	.	PUNCT
ahs-14180	67	1	the	the	DET
ahs-14180	67	2	automated	automate	VERB
ahs-14180	67	3	thermal	thermal	ADJ
ahs-14180	67	4	cycler	cycler	NOUN
ahs-14180	67	5	was	be	AUX
ahs-14180	67	6	programmed	program	VERB
ahs-14180	67	7	according	accord	VERB
ahs-14180	67	8	to	to	ADP
ahs-14180	67	9	the	the	DET
ahs-14180	67	10	following	following	ADJ
ahs-14180	67	11	conditions	condition	NOUN
ahs-14180	67	12	:	:	PUNCT
ahs-14180	67	13	initial	initial	ADJ
ahs-14180	67	14	denatu­	denatu­	CCONJ
ahs-14180	67	15	ration	ration	NOUN
ahs-14180	67	16	of	of	ADP
ahs-14180	67	17	95	95	NUM
ahs-14180	67	18	°	°	ADP
ahs-14180	67	19	c	c	NOUN
ahs-14180	67	20	for	for	ADP
ahs-14180	67	21	30	30	NUM
ahs-14180	67	22	sec	sec	PROPN
ahs-14180	67	23	followed	follow	VERB
ahs-14180	67	24	by	by	ADP
ahs-14180	67	25	40	40	NUM
ahs-14180	67	26	cycles	cycle	NOUN
ahs-14180	67	27	of	of	ADP
ahs-14180	67	28	:	:	PUNCT
ahs-14180	67	29	denaturation	denaturation	NOUN
ahs-14180	67	30	at	at	ADP
ahs-14180	67	31	95	95	NUM
ahs-14180	67	32	°	°	ADP
ahs-14180	67	33	c	c	NOUN
ahs-14180	67	34	for	for	ADP
ahs-14180	67	35	10	10	NUM
ahs-14180	67	36	sec	sec	PROPN
ahs-14180	67	37	,	,	PUNCT
ahs-14180	67	38	primer	primer	NOUN
ahs-14180	67	39	annealing	annealing	NOUN
ahs-14180	67	40	(	(	PUNCT
ahs-14180	67	41	according	accord	VERB
ahs-14180	67	42	to	to	ADP
ahs-14180	67	43	primer	primer	NOUN
ahs-14180	67	44	tm	tm	PROPN
ahs-14180	67	45	)	)	PUNCT
ahs-14180	67	46	for	for	ADP
ahs-14180	67	47	30	30	NUM
ahs-14180	67	48	sec	sec	NOUN
ahs-14180	67	49	and	and	CCONJ
ahs-14180	67	50	extension	extension	NOUN
ahs-14180	67	51	at	at	ADP
ahs-14180	67	52	72	72	NUM
ahs-14180	67	53	°	°	ADP
ahs-14180	67	54	c	c	NOUN
ahs-14180	67	55	for	for	ADP
ahs-14180	67	56	30	30	NUM
ahs-14180	67	57	sec	sec	PROPN
ahs-14180	67	58	.	.	PUNCT
ahs-14180	68	1	finally	finally	ADV
ahs-14180	68	2	,	,	PUNCT
ahs-14180	68	3	melt­curve	melt­curve	VERB
ahs-14180	68	4	stage	stage	NOUN
ahs-14180	68	5	at	at	ADP
ahs-14180	68	6	65	65	NUM
ahs-14180	68	7	°	°	ADP
ahs-14180	68	8	c	c	NOUN
ahs-14180	68	9	for	for	ADP
ahs-14180	68	10	0.5	0.5	NUM
ahs-14180	68	11	sec	sec	PROPN
ahs-14180	68	12	followed	follow	VERB
ahs-14180	68	13	by	by	ADP
ahs-14180	68	14	95	95	NUM
ahs-14180	68	15	°	°	NOUN
ahs-14180	68	16	c	c	NOUN
ahs-14180	68	17	for	for	ADP
ahs-14180	68	18	0.5	0.5	NUM
ahs-14180	68	19	sec	sec	PROPN
ahs-14180	68	20	.	.	PUNCT
ahs-14180	69	1	the	the	DET
ahs-14180	69	2	ct­values	ct­values	PROPN
ahs-14180	69	3	generated	generate	VERB
ahs-14180	69	4	were	be	AUX
ahs-14180	69	5	used	use	VERB
ahs-14180	69	6	to	to	PART
ahs-14180	69	7	evaluate	evaluate	VERB
ahs-14180	69	8	the	the	DET
ahs-14180	69	9	results	result	NOUN
ahs-14180	69	10	of	of	ADP
ahs-14180	69	11	the	the	DET
ahs-14180	69	12	gene	gene	NOUN
ahs-14180	69	13	expression	expression	NOUN
ahs-14180	69	14	levels	level	NOUN
ahs-14180	69	15	comparing	compare	VERB
ahs-14180	69	16	the	the	DET
ahs-14180	69	17	expression	expression	NOUN
ahs-14180	69	18	of	of	ADP
ahs-14180	69	19	each	each	DET
ahs-14180	69	20	target	target	NOUN
ahs-14180	69	21	gene	gene	NOUN
ahs-14180	69	22	to	to	ADP
ahs-14180	69	23	the	the	DET
ahs-14180	69	24	housekeep­	housekeep­	PROPN
ahs-14180	69	25	ing	ing	ADJ
ahs-14180	69	26	gene	gene	NOUN
ahs-14180	69	27	(	(	PUNCT
ahs-14180	69	28	actin	actin	NOUN
ahs-14180	69	29	)	)	PUNCT
ahs-14180	69	30	.	.	PUNCT
ahs-14180	70	1	for	for	ADP
ahs-14180	70	2	samples	sample	NOUN
ahs-14180	70	3	under	under	ADP
ahs-14180	70	4	static	static	ADJ
ahs-14180	70	5	0.8ox	0.8ox	PROPN
ahs-14180	70	6	,	,	PUNCT
ahs-14180	70	7	data	datum	NOUN
ahs-14180	70	8	were	be	AUX
ahs-14180	70	9	expressed	express	VERB
ahs-14180	70	10	with	with	ADP
ahs-14180	70	11	the	the	DET
ahs-14180	70	12	2­δδct	2­δδct	NUM
ahs-14180	70	13	method	method	NOUN
ahs-14180	70	14	(	(	PUNCT
ahs-14180	70	15	livak	livak	ADJ
ahs-14180	70	16	and	and	CCONJ
ahs-14180	70	17	schmittgen	schmittgen	NOUN
ahs-14180	70	18	,	,	PUNCT
ahs-14180	70	19	2001	2001	NUM
ahs-14180	70	20	)	)	PUNCT
ahs-14180	70	21	and	and	CCONJ
ahs-14180	70	22	normalized	normalize	VERB
ahs-14180	70	23	to	to	ADP
ahs-14180	70	24	the	the	DET
ahs-14180	70	25	correspond­	correspond­	PROPN
ahs-14180	70	26	ing	ing	ADJ
ahs-14180	70	27	sample	sample	NOUN
ahs-14180	70	28	at	at	ADP
ahs-14180	70	29	t1	t1	PROPN
ahs-14180	70	30	(	(	PUNCT
ahs-14180	70	31	1	1	NUM
ahs-14180	70	32	dia	dia	PROPN
ahs-14180	70	33	)	)	PUNCT
ahs-14180	70	34	.	.	PUNCT
ahs-14180	71	1	data	datum	NOUN
ahs-14180	71	2	of	of	ADP
ahs-14180	71	3	samples	sample	NOUN
ahs-14180	71	4	under	under	ADP
ahs-14180	71	5	0.3ox	0.3ox	NUM
ahs-14180	71	6	and	and	CCONJ
ahs-14180	71	7	the	the	DET
ahs-14180	71	8	shifts	shift	NOUN
ahs-14180	71	9	were	be	AUX
ahs-14180	71	10	expressed	express	VERB
ahs-14180	71	11	as	as	ADP
ahs-14180	71	12	fold	fold	ADJ
ahs-14180	71	13	change	change	NOUN
ahs-14180	71	14	of	of	ADP
ahs-14180	71	15	the	the	DET
ahs-14180	71	16	expression	expression	NOUN
ahs-14180	71	17	level	level	NOUN
ahs-14180	71	18	using	use	VERB
ahs-14180	71	19	the	the	DET
ahs-14180	71	20	formula	formula	NOUN
ahs-14180	71	21	:	:	PUNCT
ahs-14180	71	22	fc	fc	X
ahs-14180	71	23	=	=	NOUN
ahs-14180	71	24	log2(2‐δδct	log2(2‐δδct	ADV
ahs-14180	71	25	)	)	PUNCT
ahs-14180	71	26	normalized	normalize	VERB
ahs-14180	71	27	to	to	ADP
ahs-14180	71	28	the	the	DET
ahs-14180	71	29	corresponding	corresponding	ADJ
ahs-14180	71	30	sample	sample	NOUN
ahs-14180	71	31	of	of	ADP
ahs-14180	71	32	0.8ox	0.8ox	NUM
ahs-14180	71	33	at	at	ADP
ahs-14180	71	34	each	each	DET
ahs-14180	71	35	time	time	NOUN
ahs-14180	71	36	point	point	NOUN
ahs-14180	71	37	starting	start	VERB
ahs-14180	71	38	from	from	ADP
ahs-14180	71	39	10	10	NUM
ahs-14180	71	40	dia	dia	PROPN
ahs-14180	71	41	.	.	PUNCT
ahs-14180	72	1	statistical	statistical	ADJ
ahs-14180	72	2	analysis	analysis	NOUN
ahs-14180	72	3	for	for	ADP
ahs-14180	72	4	gene	gene	NOUN
ahs-14180	72	5	expression	expression	NOUN
ahs-14180	72	6	,	,	PUNCT
ahs-14180	72	7	data	datum	NOUN
ahs-14180	72	8	analysis	analysis	NOUN
ahs-14180	72	9	was	be	AUX
ahs-14180	72	10	performed	perform	VERB
ahs-14180	72	11	on	on	ADP
ahs-14180	72	12	six	six	NUM
ahs-14180	72	13	replicates	replicate	NOUN
ahs-14180	72	14	(	(	PUNCT
ahs-14180	72	15	3	3	NUM
ahs-14180	72	16	biological	biological	ADJ
ahs-14180	72	17	x	x	SYM
ahs-14180	72	18	2	2	NUM
ahs-14180	72	19	technical	technical	ADJ
ahs-14180	72	20	replicates	replicate	NOUN
ahs-14180	72	21	)	)	PUNCT
ahs-14180	72	22	.	.	PUNCT
ahs-14180	73	1	rstudio	rstudio	NOUN
ahs-14180	73	2	was	be	AUX
ahs-14180	73	3	used	use	VERB
ahs-14180	73	4	with	with	ADP
ahs-14180	73	5	external	external	ADJ
ahs-14180	73	6	package	package	NOUN
ahs-14180	73	7	“	"	PUNCT
ahs-14180	73	8	pcr	pcr	NOUN
ahs-14180	73	9	”	"	PUNCT
ahs-14180	73	10	to	to	PART
ahs-14180	73	11	cal­	cal­	VERB
ahs-14180	73	12	culate	culate	VERB
ahs-14180	73	13	the	the	DET
ahs-14180	73	14	relative	relative	ADJ
ahs-14180	73	15	expression	expression	NOUN
ahs-14180	73	16	and	and	CCONJ
ahs-14180	73	17	fold	fold	ADJ
ahs-14180	73	18	change	change	NOUN
ahs-14180	73	19	.	.	PUNCT
ahs-14180	74	1	for	for	ADP
ahs-14180	74	2	fig	fig	NOUN
ahs-14180	74	3	.	.	PUNCT
ahs-14180	75	1	1	1	NUM
ahs-14180	75	2	­	­	NUM
ahs-14180	75	3	red	red	PROPN
ahs-14180	75	4	delicious	delicious	PROPN
ahs-14180	75	5	dca	dca	PROPN
ahs-14180	75	6	storage	storage	NOUN
ahs-14180	75	7	experimental	experimental	ADJ
ahs-14180	75	8	design	design	NOUN
ahs-14180	75	9	.	.	PUNCT
ahs-14180	76	1	the	the	DET
ahs-14180	76	2	numbers	number	NOUN
ahs-14180	76	3	indicate	indicate	VERB
ahs-14180	76	4	the	the	DET
ahs-14180	76	5	days	day	NOUN
ahs-14180	76	6	in	in	ADP
ahs-14180	76	7	atmosphere	atmosphere	NOUN
ahs-14180	76	8	(	(	PUNCT
ahs-14180	76	9	dia	dia	PROPN
ahs-14180	76	10	)	)	PUNCT
ahs-14180	76	11	,	,	PUNCT
ahs-14180	76	12	▽	▽	NOUN
ahs-14180	76	13	indicates	indicate	VERB
ahs-14180	76	14	the	the	DET
ahs-14180	76	15	sampling	sampling	NOUN
ahs-14180	76	16	with	with	ADP
ahs-14180	76	17	color	color	NOUN
ahs-14180	76	18	coded	code	VERB
ahs-14180	76	19	for	for	ADP
ahs-14180	76	20	different	different	ADJ
ahs-14180	76	21	samples	sample	NOUN
ahs-14180	76	22	,	,	PUNCT
ahs-14180	76	23	0.3ox	0.3ox	NUM
ahs-14180	76	24	(	(	PUNCT
ahs-14180	76	25	blue	blue	ADJ
ahs-14180	76	26	)	)	PUNCT
ahs-14180	76	27	,	,	PUNCT
ahs-14180	76	28	0.8ox	0.8ox	PROPN
ahs-14180	76	29	(	(	PUNCT
ahs-14180	76	30	purple	purple	ADJ
ahs-14180	76	31	)	)	PUNCT
ahs-14180	76	32	,	,	PUNCT
ahs-14180	76	33	sh1	sh1	PROPN
ahs-14180	76	34	(	(	PUNCT
ahs-14180	76	35	red	red	PROPN
ahs-14180	76	36	)	)	PUNCT
ahs-14180	76	37	,	,	PUNCT
ahs-14180	76	38	sh2	sh2	PROPN
ahs-14180	76	39	(	(	PUNCT
ahs-14180	76	40	orange	orange	PROPN
ahs-14180	76	41	)	)	PUNCT
ahs-14180	76	42	,	,	PUNCT
ahs-14180	76	43	sh3	sh3	PROPN
ahs-14180	76	44	(	(	PUNCT
ahs-14180	76	45	yellow	yellow	ADJ
ahs-14180	76	46	)	)	PUNCT
ahs-14180	76	47	and	and	CCONJ
ahs-14180	76	48	sh4	sh4	PROPN
ahs-14180	76	49	(	(	PUNCT
ahs-14180	76	50	light	light	NOUN
ahs-14180	76	51	blue	blue	NOUN
ahs-14180	76	52	)	)	PUNCT
ahs-14180	76	53	.	.	PUNCT
ahs-14180	77	1	adv	adv	PROPN
ahs-14180	77	2	.	.	PUNCT
ahs-14180	77	3	hort	hort	PROPN
ahs-14180	77	4	.	.	PUNCT
ahs-14180	78	1	sci	sci	PROPN
ahs-14180	78	2	.	.	PROPN
ahs-14180	78	3	,	,	PUNCT
ahs-14180	78	4	2023	2023	NUM
ahs-14180	78	5	37(1	37(1	NUM
ahs-14180	78	6	):	):	PUNCT
ahs-14180	78	7	89­99	89­99	NUM
ahs-14180	78	8	92	92	NUM
ahs-14180	78	9	fruit	fruit	NOUN
ahs-14180	78	10	firmness	firmness	NOUN
ahs-14180	78	11	,	,	PUNCT
ahs-14180	78	12	tss	tss	NOUN
ahs-14180	78	13	and	and	CCONJ
ahs-14180	78	14	ethanol	ethanol	NOUN
ahs-14180	78	15	content	content	NOUN
ahs-14180	78	16	3	3	NUM
ahs-14180	78	17	biological	biological	ADJ
ahs-14180	78	18	replicates	replicate	NOUN
ahs-14180	78	19	were	be	AUX
ahs-14180	78	20	used	use	VERB
ahs-14180	78	21	.	.	PUNCT
ahs-14180	79	1	internal	internal	ADJ
ahs-14180	79	2	statistical	statistical	ADJ
ahs-14180	79	3	functions	function	NOUN
ahs-14180	79	4	and	and	CCONJ
ahs-14180	79	5	external	external	ADJ
ahs-14180	79	6	package	package	NOUN
ahs-14180	79	7	“	"	PUNCT
ahs-14180	79	8	agricolae	agricolae	PROPN
ahs-14180	79	9	”	"	PUNCT
ahs-14180	79	10	were	be	AUX
ahs-14180	79	11	used	use	VERB
ahs-14180	79	12	to	to	PART
ahs-14180	79	13	ana­	ana­	VERB
ahs-14180	79	14	lyze	lyze	VERB
ahs-14180	79	15	the	the	DET
ahs-14180	79	16	data	datum	NOUN
ahs-14180	79	17	(	(	PUNCT
ahs-14180	79	18	kronthaler	kronthaler	NOUN
ahs-14180	79	19	and	and	CCONJ
ahs-14180	79	20	zoellner	zoellner	NOUN
ahs-14180	79	21	,	,	PUNCT
ahs-14180	79	22	2021	2021	NUM
ahs-14180	79	23	)	)	PUNCT
ahs-14180	79	24	.	.	PUNCT
ahs-14180	80	1	all	all	DET
ahs-14180	80	2	data	datum	NOUN
ahs-14180	80	3	were	be	AUX
ahs-14180	80	4	analyzed	analyze	VERB
ahs-14180	80	5	using	use	VERB
ahs-14180	80	6	t‐test	t‐test	PUNCT
ahs-14180	80	7	for	for	SCONJ
ahs-14180	80	8	samples	sample	NOUN
ahs-14180	80	9	at	at	ADP
ahs-14180	80	10	1	1	NUM
ahs-14180	80	11	dia	dia	PROPN
ahs-14180	80	12	to	to	PART
ahs-14180	80	13	compare	compare	VERB
ahs-14180	80	14	0.3	0.3	NUM
ahs-14180	80	15	to	to	PART
ahs-14180	80	16	0.8ox	0.8ox	NOUN
ahs-14180	80	17	samples	sample	NOUN
ahs-14180	80	18	.	.	PUNCT
ahs-14180	81	1	one­way	one­way	PROPN
ahs-14180	81	2	anova	anova	PROPN
ahs-14180	81	3	and	and	CCONJ
ahs-14180	81	4	mean	mean	VERB
ahs-14180	81	5	comparison	comparison	NOUN
ahs-14180	81	6	with	with	ADP
ahs-14180	81	7	least	least	ADJ
ahs-14180	81	8	significant	significant	ADJ
ahs-14180	81	9	differ­	differ­	PROPN
ahs-14180	81	10	ence	ence	NOUN
ahs-14180	81	11	(	(	PUNCT
ahs-14180	81	12	lsd	lsd	NOUN
ahs-14180	81	13	)	)	PUNCT
ahs-14180	81	14	post­hoc	post­hoc	NOUN
ahs-14180	81	15	test	test	NOUN
ahs-14180	81	16	(	(	PUNCT
ahs-14180	81	17	p≤0.05	p≤0.05	NOUN
ahs-14180	81	18	)	)	PUNCT
ahs-14180	81	19	was	be	AUX
ahs-14180	81	20	used	use	VERB
ahs-14180	81	21	to	to	ADP
ahs-14180	81	22	com­	com­	PROPN
ahs-14180	81	23	pare	pare	PROPN
ahs-14180	81	24	different	different	ADJ
ahs-14180	81	25	samples	sample	NOUN
ahs-14180	81	26	of	of	ADP
ahs-14180	81	27	shifts	shift	NOUN
ahs-14180	81	28	to	to	ADP
ahs-14180	81	29	the	the	DET
ahs-14180	81	30	corresponding	correspond	VERB
ahs-14180	81	31	0.8ox	0.8ox	PROPN
ahs-14180	81	32	at	at	ADP
ahs-14180	81	33	each	each	DET
ahs-14180	81	34	time	time	NOUN
ahs-14180	81	35	point	point	NOUN
ahs-14180	81	36	starting	start	VERB
ahs-14180	81	37	from	from	ADP
ahs-14180	81	38	10	10	NUM
ahs-14180	81	39	dia	dia	PROPN
ahs-14180	81	40	.	.	PUNCT
ahs-14180	82	1	a	a	DET
ahs-14180	82	2	kruskal­wallis	kruskal­wallis	PROPN
ahs-14180	82	3	test	test	NOUN
ahs-14180	82	4	was	be	AUX
ahs-14180	82	5	applied	apply	VERB
ahs-14180	82	6	to	to	ADP
ahs-14180	82	7	non­parametric	non­parametric	ADJ
ahs-14180	82	8	data	datum	NOUN
ahs-14180	82	9	(	(	PUNCT
ahs-14180	82	10	p≤0.05	p≤0.05	NOUN
ahs-14180	82	11	)	)	PUNCT
ahs-14180	82	12	.	.	PUNCT
ahs-14180	83	1	3	3	X
ahs-14180	83	2	.	.	NOUN
ahs-14180	83	3	results	result	VERB
ahs-14180	83	4	flesh	flesh	NOUN
ahs-14180	83	5	firmness	firmness	NOUN
ahs-14180	83	6	,	,	PUNCT
ahs-14180	83	7	tss	tss	NOUN
ahs-14180	83	8	and	and	CCONJ
ahs-14180	83	9	ethanol	ethanol	NOUN
ahs-14180	83	10	production	production	NOUN
ahs-14180	83	11	at	at	ADP
ahs-14180	83	12	the	the	DET
ahs-14180	83	13	end	end	NOUN
ahs-14180	83	14	of	of	ADP
ahs-14180	83	15	the	the	DET
ahs-14180	83	16	storage	storage	NOUN
ahs-14180	83	17	period	period	NOUN
ahs-14180	83	18	and	and	CCONJ
ahs-14180	83	19	after	after	ADP
ahs-14180	83	20	five	five	NUM
ahs-14180	83	21	days	day	NOUN
ahs-14180	83	22	of	of	ADP
ahs-14180	83	23	shelf	shelf	NOUN
ahs-14180	83	24	life	life	NOUN
ahs-14180	83	25	at	at	ADP
ahs-14180	83	26	room	room	NOUN
ahs-14180	83	27	temperature	temperature	NOUN
ahs-14180	83	28	no	no	DET
ahs-14180	83	29	physiologi­	physiologi­	PROPN
ahs-14180	83	30	cal	cal	ADJ
ahs-14180	83	31	disorders	disorder	NOUN
ahs-14180	83	32	or	or	CCONJ
ahs-14180	83	33	external	external	ADJ
ahs-14180	83	34	/	/	SYM
ahs-14180	83	35	internal	internal	ADJ
ahs-14180	83	36	defects	defect	NOUN
ahs-14180	83	37	were	be	AUX
ahs-14180	83	38	observed	observe	VERB
ahs-14180	83	39	in	in	ADP
ahs-14180	83	40	all	all	DET
ahs-14180	83	41	analysed	analyse	VERB
ahs-14180	83	42	samples	sample	NOUN
ahs-14180	83	43	collected	collect	VERB
ahs-14180	83	44	from	from	ADP
ahs-14180	83	45	the	the	DET
ahs-14180	83	46	different	different	ADJ
ahs-14180	83	47	protocols	protocol	NOUN
ahs-14180	83	48	.	.	PUNCT
ahs-14180	84	1	concerning	concern	VERB
ahs-14180	84	2	technological	technological	ADJ
ahs-14180	84	3	parameters	parameter	NOUN
ahs-14180	84	4	,	,	PUNCT
ahs-14180	84	5	table	table	NOUN
ahs-14180	84	6	2	2	NUM
ahs-14180	84	7	reports	report	NOUN
ahs-14180	84	8	apple	apple	NOUN
ahs-14180	84	9	firmness	firmness	NOUN
ahs-14180	84	10	and	and	CCONJ
ahs-14180	84	11	tss	tss	NOUN
ahs-14180	84	12	values	value	NOUN
ahs-14180	84	13	for	for	ADP
ahs-14180	84	14	samples	sample	NOUN
ahs-14180	84	15	taken	take	VERB
ahs-14180	84	16	at	at	ADP
ahs-14180	84	17	harvest	harvest	NOUN
ahs-14180	84	18	(	(	PUNCT
ahs-14180	84	19	t0	t0	NOUN
ahs-14180	84	20	)	)	PUNCT
ahs-14180	84	21	and	and	CCONJ
ahs-14180	84	22	at	at	ADP
ahs-14180	84	23	the	the	DET
ahs-14180	84	24	end	end	NOUN
ahs-14180	84	25	of	of	ADP
ahs-14180	84	26	the	the	DET
ahs-14180	84	27	trial	trial	NOUN
ahs-14180	84	28	at	at	ADP
ahs-14180	84	29	218	218	NUM
ahs-14180	84	30	dia	dia	PROPN
ahs-14180	84	31	.	.	PUNCT
ahs-14180	84	32	results	result	NOUN
ahs-14180	84	33	showed	show	VERB
ahs-14180	84	34	that	that	SCONJ
ahs-14180	84	35	samples	sample	NOUN
ahs-14180	84	36	stored	store	VERB
ahs-14180	84	37	for	for	ADP
ahs-14180	84	38	30	30	NUM
ahs-14180	84	39	table	table	NOUN
ahs-14180	84	40	1	1	NUM
ahs-14180	84	41	­	­	NOUN
ahs-14180	84	42	primers	primer	NOUN
ahs-14180	84	43	pairs	pair	NOUN
ahs-14180	84	44	used	use	VERB
ahs-14180	84	45	in	in	ADP
ahs-14180	84	46	the	the	DET
ahs-14180	84	47	rt­qpcr	rt­qpcr	ADJ
ahs-14180	84	48	analysis	analysis	NOUN
ahs-14180	84	49	the	the	DET
ahs-14180	84	50	table	table	NOUN
ahs-14180	84	51	reports	report	VERB
ahs-14180	84	52	the	the	DET
ahs-14180	84	53	genes	gene	NOUN
ahs-14180	84	54	nomenclature	nomenclature	NOUN
ahs-14180	84	55	according	accord	VERB
ahs-14180	84	56	to	to	ADP
ahs-14180	84	57	https://iris.angers.inra.fr/gddh13/	https://iris.angers.inra.fr/gddh13/	NOUN
ahs-14180	84	58	,	,	PUNCT
ahs-14180	84	59	the	the	DET
ahs-14180	84	60	primers	primer	NOUN
ahs-14180	84	61	sequence	sequence	NOUN
ahs-14180	84	62	,	,	PUNCT
ahs-14180	84	63	length	length	NOUN
ahs-14180	84	64	,	,	PUNCT
ahs-14180	84	65	gc	gc	PROPN
ahs-14180	84	66	content	content	NOUN
ahs-14180	84	67	and	and	CCONJ
ahs-14180	84	68	melting	melt	VERB
ahs-14180	84	69	temperature	temperature	NOUN
ahs-14180	84	70	(	(	PUNCT
ahs-14180	84	71	tm	tm	NOUN
ahs-14180	84	72	)	)	PUNCT
ahs-14180	84	73	genes	gene	NOUN
ahs-14180	84	74	primer	primer	NOUN
ahs-14180	84	75	sequence	sequence	NOUN
ahs-14180	84	76	5'­3	5'­3	NUM
ahs-14180	84	77	'	'	PART
ahs-14180	84	78	length	length	NOUN
ahs-14180	84	79	(	(	PUNCT
ahs-14180	84	80	bp	bp	PROPN
ahs-14180	84	81	)	)	PUNCT
ahs-14180	84	82	gc	gc	PROPN
ahs-14180	84	83	content	content	NOUN
ahs-14180	84	84	(	(	PUNCT
ahs-14180	84	85	%	%	INTJ
ahs-14180	84	86	)	)	PUNCT
ahs-14180	84	87	tm	tm	PROPN
ahs-14180	84	88	(	(	PUNCT
ahs-14180	84	89	°	°	ADP
ahs-14180	84	90	c	c	NOUN
ahs-14180	84	91	)	)	PUNCT
ahs-14180	84	92	acc	acc	PROPN
ahs-14180	84	93	synthase	synthase	NOUN
ahs-14180	84	94	md15g1302200	md15g1302200	PROPN
ahs-14180	84	95	f	f	PROPN
ahs-14180	84	96	aagtggcgaactggagtcga	aagtggcgaactggagtcga	VERB
ahs-14180	84	97	20	20	NUM
ahs-14180	84	98	55	55	NUM
ahs-14180	84	99	67.2	67.2	NUM
ahs-14180	84	100	r	r	NOUN
ahs-14180	84	101	ggtttgatgggttcgtgacc	ggtttgatgggttcgtgacc	NOUN
ahs-14180	84	102	20	20	NUM
ahs-14180	84	103	55	55	NUM
ahs-14180	84	104	66.4	66.4	NUM
ahs-14180	84	105	acc	acc	PROPN
ahs-14180	84	106	oxidase	oxidase	NOUN
ahs-14180	84	107	md10g1328100	md10g1328100	PROPN
ahs-14180	84	108	f	f	PROPN
ahs-14180	84	109	cagtcggatgggaccagaa	cagtcggatgggaccagaa	VERB
ahs-14180	84	110	19	19	NUM
ahs-14180	84	111	57.8	57.8	NUM
ahs-14180	84	112	66.3	66.3	NUM
ahs-14180	84	113	r	r	NOUN
ahs-14180	84	114	gcttggaatttcaggccaga	gcttggaatttcaggccaga	NOUN
ahs-14180	84	115	20	20	NUM
ahs-14180	84	116	50	50	NUM
ahs-14180	84	117	66.3	66.3	NUM
ahs-14180	84	118	pyruvate	pyruvate	NOUN
ahs-14180	84	119	decarboxylase	decarboxylase	NOUN
ahs-14180	84	120	md04g1160100	md04g1160100	PROPN
ahs-14180	84	121	f	f	PROPN
ahs-14180	84	122	caaggcagtaaagccggtta	caaggcagtaaagccggtta	NOUN
ahs-14180	84	123	20	20	NUM
ahs-14180	84	124	50	50	NUM
ahs-14180	84	125	63.9	63.9	NUM
ahs-14180	84	126	r	r	NOUN
ahs-14180	84	127	aaatcggtccagcaaacaag	aaatcggtccagcaaacaag	NOUN
ahs-14180	84	128	20	20	NUM
ahs-14180	84	129	45	45	NUM
ahs-14180	84	130	63.9	63.9	NUM
ahs-14180	84	131	alcohol	alcohol	NOUN
ahs-14180	84	132	dehydrogenase	dehydrogenase	NOUN
ahs-14180	84	133	md10g1014200	md10g1014200	PROPN
ahs-14180	84	134	f	f	PROPN
ahs-14180	84	135	ggaagcactgaagccatgat	ggaagcactgaagccatgat	VERB
ahs-14180	84	136	20	20	NUM
ahs-14180	84	137	50	50	NUM
ahs-14180	84	138	64.2	64.2	NUM
ahs-14180	84	139	r	r	NOUN
ahs-14180	84	140	ctccacgacagagggaatgt	ctccacgacagagggaatgt	NOUN
ahs-14180	84	141	20	20	NUM
ahs-14180	84	142	55	55	NUM
ahs-14180	84	143	64.2	64.2	NUM
ahs-14180	84	144	lactate	lactate	NOUN
ahs-14180	84	145	dehydrogenase	dehydrogenase	NOUN
ahs-14180	84	146	mdp0000143956	mdp0000143956	PROPN
ahs-14180	84	147	f	f	PROPN
ahs-14180	84	148	cataaaactccttcaggctcca	cataaaactccttcaggctcca	VERB
ahs-14180	84	149	22	22	NUM
ahs-14180	84	150	45.4	45.4	NUM
ahs-14180	84	151	64.1	64.1	NUM
ahs-14180	84	152	r	r	NOUN
ahs-14180	84	153	gtgsggtcttgggtgaggat	gtgsggtcttgggtgaggat	NOUN
ahs-14180	84	154	22	22	NUM
ahs-14180	84	155	55	55	NUM
ahs-14180	84	156	63.9	63.9	NUM
ahs-14180	84	157	beta‐amylase	beta‐amylase	NOUN
ahs-14180	84	158	6	6	NUM
ahs-14180	84	159	md09g1103800	md09g1103800	PROPN
ahs-14180	84	160	f	f	PROPN
ahs-14180	84	161	ctatgtgccgatcttcgtga	ctatgtgccgatcttcgtga	PROPN
ahs-14180	84	162	20	20	NUM
ahs-14180	84	163	50	50	NUM
ahs-14180	84	164	63.8	63.8	NUM
ahs-14180	84	165	r	r	NOUN
ahs-14180	84	166	actgcttgaaacacgctcct	actgcttgaaacacgctcct	NOUN
ahs-14180	84	167	20	20	NUM
ahs-14180	84	168	50	50	NUM
ahs-14180	84	169	63.9	63.9	NUM
ahs-14180	84	170	sucrose	sucrose	NOUN
ahs-14180	84	171	synthase	synthase	NOUN
ahs-14180	84	172	md15g1223500	md15g1223500	PROPN
ahs-14180	84	173	f	f	PROPN
ahs-14180	85	1	tccgtgttcactgctacgag	tccgtgttcactgctacgag	ADV
ahs-14180	86	1	20	20	NUM
ahs-14180	86	2	55	55	NUM
ahs-14180	86	3	64.1	64.1	NUM
ahs-14180	86	4	r	r	NOUN
ahs-14180	86	5	gcctcaagaaggtccaacag	gcctcaagaaggtccaacag	VERB
ahs-14180	86	6	20	20	NUM
ahs-14180	86	7	55	55	NUM
ahs-14180	86	8	63.8	63.8	NUM
ahs-14180	86	9	phosphofructokinase	phosphofructokinase	NOUN
ahs-14180	87	1	md04g1042400	md04g1042400	PROPN
ahs-14180	88	1	f	f	PROPN
ahs-14180	88	2	agtcgtggagtggtggaatc	agtcgtggagtggtggaatc	PROPN
ahs-14180	88	3	20	20	NUM
ahs-14180	88	4	55	55	NUM
ahs-14180	88	5	64.1	64.1	NUM
ahs-14180	88	6	r	r	NOUN
ahs-14180	88	7	tagagggtgagggcttcaga	tagagggtgagggcttcaga	NOUN
ahs-14180	88	8	20	20	NUM
ahs-14180	88	9	55	55	NUM
ahs-14180	88	10	63.9	63.9	NUM
ahs-14180	88	11	alanine	alanine	NOUN
ahs-14180	88	12	aminotransferease	aminotransferease	ADV
ahs-14180	89	1	md09g1173000	md09g1173000	PROPN
ahs-14180	89	2	f	f	PROPN
ahs-14180	89	3	tgctgtccgaggtgaaatcgtc	tgctgtccgaggtgaaatcgtc	PROPN
ahs-14180	89	4	22	22	NUM
ahs-14180	89	5	54.5	54.5	NUM
ahs-14180	89	6	70.6	70.6	NUM
ahs-14180	89	7	r	r	NOUN
ahs-14180	89	8	agcccggattcgcctttaactc	agcccggattcgcctttaactc	NOUN
ahs-14180	89	9	22	22	NUM
ahs-14180	89	10	54.5	54.5	NUM
ahs-14180	89	11	69.9	69.9	NUM
ahs-14180	89	12	ethylene	ethylene	NOUN
ahs-14180	89	13	response	response	NOUN
ahs-14180	89	14	factor	factor	NOUN
ahs-14180	89	15	md11g1306500	md11g1306500	PROPN
ahs-14180	89	16	variant	variant	NOUN
ahs-14180	89	17	f	f	PROPN
ahs-14180	89	18	cggtggtgctataatctccg	cggtggtgctataatctccg	NOUN
ahs-14180	89	19	20	20	NUM
ahs-14180	89	20	55	55	NUM
ahs-14180	89	21	64.2	64.2	NUM
ahs-14180	89	22	r	r	NOUN
ahs-14180	89	23	ggaattgagtcggtgtgagtagtt	ggaattgagtcggtgtgagtagtt	NOUN
ahs-14180	89	24	24	24	NUM
ahs-14180	89	25	45.8	45.8	NUM
ahs-14180	89	26	64.3	64.3	NUM
ahs-14180	89	27	ethylene	ethylene	NOUN
ahs-14180	89	28	response	response	NOUN
ahs-14180	89	29	factor	factor	NOUN
ahs-14180	89	30	md11g1306500	md11g1306500	PROPN
ahs-14180	89	31	f	f	PROPN
ahs-14180	89	32	ctcccttcgccaagttcg	ctcccttcgccaagttcg	VERB
ahs-14180	89	33	18	18	NUM
ahs-14180	89	34	61.1	61.1	NUM
ahs-14180	89	35	65.9	65.9	NUM
ahs-14180	89	36	r	r	NOUN
ahs-14180	89	37	ttgagtcggtgcgattaacc	ttgagtcggtgcgattaacc	NOUN
ahs-14180	89	38	20	20	NUM
ahs-14180	89	39	50	50	NUM
ahs-14180	89	40	64.9	64.9	NUM
ahs-14180	89	41	ethylene	ethylene	NOUN
ahs-14180	89	42	response	response	NOUN
ahs-14180	89	43	factor	factor	NOUN
ahs-14180	89	44	md16g1162900	md16g1162900	PROPN
ahs-14180	89	45	f	f	PROPN
ahs-14180	89	46	ccagaagcccaaaccatcag	ccagaagcccaaaccatcag	VERB
ahs-14180	89	47	20	20	NUM
ahs-14180	89	48	55	55	NUM
ahs-14180	89	49	66.7	66.7	NUM
ahs-14180	89	50	r	r	NOUN
ahs-14180	89	51	ttcctcggcggtgttgta	ttcctcggcggtgttgta	NOUN
ahs-14180	89	52	18	18	NUM
ahs-14180	89	53	55.5	55.5	NUM
ahs-14180	89	54	65.4	65.4	NUM
ahs-14180	89	55	ethylene	ethylene	NOUN
ahs-14180	89	56	response	response	NOUN
ahs-14180	89	57	factor	factor	NOUN
ahs-14180	89	58	md13g1163300	md13g1163300	PROPN
ahs-14180	89	59	f	f	PROPN
ahs-14180	89	60	ggtggggaaatgtatgctaaga	ggtggggaaatgtatgctaaga	NOUN
ahs-14180	89	61	22	22	NUM
ahs-14180	89	62	45.4	45.4	NUM
ahs-14180	89	63	63.7	63.7	NUM
ahs-14180	89	64	r	r	NOUN
ahs-14180	89	65	gtcatccagcatccacagg	gtcatccagcatccacagg	NOUN
ahs-14180	89	66	19	19	NUM
ahs-14180	89	67	57.8	57.8	NUM
ahs-14180	89	68	64.4	64.4	NUM
ahs-14180	89	69	ethylene	ethylene	NOUN
ahs-14180	89	70	response	response	NOUN
ahs-14180	89	71	factor	factor	NOUN
ahs-14180	89	72	md17g1152400	md17g1152400	PROPN
ahs-14180	89	73	f	f	PROPN
ahs-14180	89	74	cttctgcaaagcgttctgtg	cttctgcaaagcgttctgtg	PROPN
ahs-14180	89	75	20	20	NUM
ahs-14180	89	76	50	50	NUM
ahs-14180	89	77	63.7	63.7	NUM
ahs-14180	89	78	r	r	NOUN
ahs-14180	89	79	ggcaggatcggatggag	ggcaggatcggatggag	NOUN
ahs-14180	89	80	17	17	NUM
ahs-14180	89	81	64.7	64.7	NUM
ahs-14180	89	82	64.5	64.5	NUM
ahs-14180	89	83	ethylene	ethylene	NOUN
ahs-14180	89	84	response	response	NOUN
ahs-14180	89	85	factor	factor	NOUN
ahs-14180	89	86	md09g1174400	md09g1174400	PROPN
ahs-14180	89	87	f	f	PROPN
ahs-14180	89	88	ttctgcaaagcgttccatc	ttctgcaaagcgttccatc	VERB
ahs-14180	89	89	19	19	NUM
ahs-14180	89	90	47.3	47.3	NUM
ahs-14180	89	91	64	64	NUM
ahs-14180	89	92	r	r	NOUN
ahs-14180	89	93	ttcattggcagggaaggtg	ttcattggcagggaaggtg	NOUN
ahs-14180	89	94	19	19	NUM
ahs-14180	89	95	52.6	52.6	NUM
ahs-14180	89	96	66	66	NUM
ahs-14180	89	97	actin	actin	NOUN
ahs-14180	89	98	md04g1127400	md04g1127400	NOUN
ahs-14180	89	99	f	f	PROPN
ahs-14180	89	100	tgaccgaatgagcaaggaaatta	tgaccgaatgagcaaggaaatta	CCONJ
ahs-14180	89	101	25	25	NUM
ahs-14180	89	102	40	40	NUM
ahs-14180	89	103	67.4	67.4	NUM
ahs-14180	89	104	r	r	NOUN
ahs-14180	89	105	tactcagctttggcaatccacatc	tactcagctttggcaatccacatc	NOUN
ahs-14180	89	106	24	24	NUM
ahs-14180	89	107	45.8	45.8	NUM
ahs-14180	89	108	68	68	NUM
ahs-14180	89	109	salamé	salamé	PROPN
ahs-14180	89	110	et	et	PROPN
ahs-14180	89	111	al	al	PROPN
ahs-14180	89	112	.	.	PROPN
ahs-14180	90	1	‐	‐	PROPN
ahs-14180	90	2	dca	dca	PROPN
ahs-14180	90	3	storage	storage	NOUN
ahs-14180	90	4	of	of	ADP
ahs-14180	90	5	red	red	PROPN
ahs-14180	90	6	delicious	delicious	PROPN
ahs-14180	90	7	apples	apple	NOUN
ahs-14180	90	8	93	93	NUM
ahs-14180	90	9	(	(	PUNCT
ahs-14180	90	10	sh3	sh3	NOUN
ahs-14180	90	11	)	)	PUNCT
ahs-14180	90	12	and	and	CCONJ
ahs-14180	90	13	110	110	NUM
ahs-14180	90	14	(	(	PUNCT
ahs-14180	90	15	sh4	sh4	NOUN
ahs-14180	90	16	)	)	PUNCT
ahs-14180	90	17	days	day	NOUN
ahs-14180	90	18	under	under	ADP
ahs-14180	90	19	0.3	0.3	NUM
ahs-14180	90	20	%	%	NOUN
ahs-14180	90	21	oxygen	oxygen	NOUN
ahs-14180	90	22	before	before	ADP
ahs-14180	90	23	being	be	AUX
ahs-14180	90	24	shifted	shift	VERB
ahs-14180	90	25	to	to	ADP
ahs-14180	90	26	0.8	0.8	NUM
ahs-14180	90	27	%	%	NOUN
ahs-14180	90	28	oxygen	oxygen	NOUN
ahs-14180	90	29	showed	show	VERB
ahs-14180	90	30	the	the	DET
ahs-14180	90	31	lowest	low	ADJ
ahs-14180	90	32	val­	val­	NOUN
ahs-14180	90	33	ues	ue	NOUN
ahs-14180	90	34	of	of	ADP
ahs-14180	90	35	firmness	firmness	NOUN
ahs-14180	90	36	at	at	ADP
ahs-14180	90	37	the	the	DET
ahs-14180	90	38	end	end	NOUN
ahs-14180	90	39	of	of	ADP
ahs-14180	90	40	the	the	DET
ahs-14180	90	41	trial	trial	NOUN
ahs-14180	90	42	.	.	PUNCT
ahs-14180	91	1	while	while	SCONJ
ahs-14180	91	2	0.8ox	0.8ox	PROPN
ahs-14180	91	3	,	,	PUNCT
ahs-14180	91	4	sh1	sh1	NOUN
ahs-14180	91	5	and	and	CCONJ
ahs-14180	91	6	sh2	sh2	NOUN
ahs-14180	91	7	samples	sample	NOUN
ahs-14180	91	8	maintained	maintain	VERB
ahs-14180	91	9	firmness	firmness	NOUN
ahs-14180	91	10	values	value	NOUN
ahs-14180	91	11	not	not	PART
ahs-14180	91	12	significantly	significantly	ADV
ahs-14180	91	13	different	different	ADJ
ahs-14180	91	14	from	from	ADP
ahs-14180	91	15	those	those	PRON
ahs-14180	91	16	detected	detect	VERB
ahs-14180	91	17	in	in	ADP
ahs-14180	91	18	t0	t0	PROPN
ahs-14180	91	19	sam­	sam­	NOUN
ahs-14180	91	20	ples	ple	NOUN
ahs-14180	91	21	.	.	PUNCT
ahs-14180	92	1	no	no	DET
ahs-14180	92	2	significant	significant	ADJ
ahs-14180	92	3	difference	difference	NOUN
ahs-14180	92	4	(	(	PUNCT
ahs-14180	92	5	p=0.414	p=0.414	NOUN
ahs-14180	92	6	,	,	PUNCT
ahs-14180	92	7	alpha	alpha	NOUN
ahs-14180	92	8	level	level	NOUN
ahs-14180	92	9	≤	≤	NUM
ahs-14180	92	10	0.05	0.05	NUM
ahs-14180	92	11	)	)	PUNCT
ahs-14180	92	12	was	be	AUX
ahs-14180	92	13	recorded	record	VERB
ahs-14180	92	14	for	for	ADP
ahs-14180	92	15	tss	tss	NOUN
ahs-14180	92	16	levels	level	NOUN
ahs-14180	92	17	over	over	ADP
ahs-14180	92	18	time	time	NOUN
ahs-14180	92	19	or	or	CCONJ
ahs-14180	92	20	between	between	ADP
ahs-14180	92	21	the	the	DET
ahs-14180	92	22	different	different	ADJ
ahs-14180	92	23	applied	applied	ADJ
ahs-14180	92	24	protocols	protocol	NOUN
ahs-14180	92	25	.	.	PUNCT
ahs-14180	93	1	ethanol	ethanol	NOUN
ahs-14180	93	2	levels	level	NOUN
ahs-14180	93	3	have	have	AUX
ahs-14180	93	4	been	be	AUX
ahs-14180	93	5	monitored	monitor	VERB
ahs-14180	93	6	along	along	ADP
ahs-14180	93	7	the	the	DET
ahs-14180	93	8	entire	entire	ADJ
ahs-14180	93	9	experimental	experimental	ADJ
ahs-14180	93	10	period	period	NOUN
ahs-14180	93	11	to	to	PART
ahs-14180	93	12	assess	assess	VERB
ahs-14180	93	13	the	the	DET
ahs-14180	93	14	activation	activation	NOUN
ahs-14180	93	15	of	of	ADP
ahs-14180	93	16	fermentative	fermentative	ADJ
ahs-14180	93	17	metabolism	metabolism	NOUN
ahs-14180	93	18	under	under	ADP
ahs-14180	93	19	static	static	ADJ
ahs-14180	93	20	and	and	CCONJ
ahs-14180	93	21	dynamic	dynamic	ADJ
ahs-14180	93	22	ca	ca	NOUN
ahs-14180	93	23	storage	storage	NOUN
ahs-14180	93	24	(	(	PUNCT
ahs-14180	93	25	fig	fig	NOUN
ahs-14180	93	26	.	.	PUNCT
ahs-14180	94	1	2	2	NUM
ahs-14180	94	2	)	)	PUNCT
ahs-14180	94	3	.	.	PUNCT
ahs-14180	95	1	0.3ox	0.3ox	NUM
ahs-14180	95	2	samples	sample	NOUN
ahs-14180	95	3	already	already	ADV
ahs-14180	95	4	showed	show	VERB
ahs-14180	95	5	higher	high	ADJ
ahs-14180	95	6	levels	level	NOUN
ahs-14180	95	7	than	than	ADP
ahs-14180	95	8	those	those	PRON
ahs-14180	95	9	of	of	ADP
ahs-14180	95	10	the	the	DET
ahs-14180	95	11	0.8ox	0.8ox	PROPN
ahs-14180	95	12	sample	sample	NOUN
ahs-14180	95	13	at	at	ADP
ahs-14180	95	14	10	10	NUM
ahs-14180	95	15	dia	dia	PROPN
ahs-14180	95	16	,	,	PUNCT
ahs-14180	95	17	and	and	CCONJ
ahs-14180	95	18	a	a	DET
ahs-14180	95	19	further	further	ADJ
ahs-14180	95	20	increase	increase	NOUN
ahs-14180	95	21	from	from	ADP
ahs-14180	95	22	10	10	NUM
ahs-14180	95	23	to	to	PART
ahs-14180	95	24	20	20	NUM
ahs-14180	95	25	dia	dia	PROPN
ahs-14180	95	26	with	with	ADP
ahs-14180	95	27	values	value	NOUN
ahs-14180	95	28	around	around	ADP
ahs-14180	95	29	400	400	NUM
ahs-14180	95	30	mg	mg	NUM
ahs-14180	95	31	/	/	SYM
ahs-14180	95	32	kg	kg	PROPN
ahs-14180	95	33	fw	fw	NOUN
ahs-14180	95	34	up	up	ADP
ahs-14180	95	35	to	to	ADP
ahs-14180	95	36	110	110	NUM
ahs-14180	95	37	dia	dia	PROPN
ahs-14180	95	38	(	(	PUNCT
ahs-14180	95	39	last	last	ADJ
ahs-14180	95	40	sampling	sampling	NOUN
ahs-14180	95	41	time	time	NOUN
ahs-14180	95	42	for	for	ADP
ahs-14180	95	43	this	this	DET
ahs-14180	95	44	specific	specific	ADJ
ahs-14180	95	45	treatment	treatment	NOUN
ahs-14180	95	46	)	)	PUNCT
ahs-14180	95	47	.	.	PUNCT
ahs-14180	96	1	on	on	ADP
ahs-14180	96	2	the	the	DET
ahs-14180	96	3	other	other	ADJ
ahs-14180	96	4	hand	hand	NOUN
ahs-14180	96	5	,	,	PUNCT
ahs-14180	96	6	0.8ox	0.8ox	NUM
ahs-14180	96	7	samples	sample	NOUN
ahs-14180	96	8	showed	show	VERB
ahs-14180	96	9	a	a	DET
ahs-14180	96	10	similar	similar	ADJ
ahs-14180	96	11	trend	trend	NOUN
ahs-14180	96	12	in	in	ADP
ahs-14180	96	13	terms	term	NOUN
ahs-14180	96	14	of	of	ADP
ahs-14180	96	15	ethanol	ethanol	NOUN
ahs-14180	96	16	accumulation	accumulation	NOUN
ahs-14180	96	17	but	but	CCONJ
ahs-14180	96	18	with	with	ADP
ahs-14180	96	19	significantly	significantly	ADV
ahs-14180	96	20	lower	low	ADJ
ahs-14180	96	21	amounts	amount	NOUN
ahs-14180	96	22	compared	compare	VERB
ahs-14180	96	23	to	to	ADP
ahs-14180	96	24	0.3ox	0.3ox	NUM
ahs-14180	96	25	samples	sample	NOUN
ahs-14180	96	26	and	and	CCONJ
ahs-14180	96	27	a	a	DET
ahs-14180	96	28	decreasing	decrease	VERB
ahs-14180	96	29	trend	trend	NOUN
ahs-14180	96	30	after	after	SCONJ
ahs-14180	96	31	the	the	DET
ahs-14180	96	32	highest	high	ADJ
ahs-14180	96	33	concentrations	concentration	NOUN
ahs-14180	96	34	detected	detect	VERB
ahs-14180	96	35	at	at	ADP
ahs-14180	96	36	20	20	NUM
ahs-14180	96	37	and	and	CCONJ
ahs-14180	96	38	31	31	NUM
ahs-14180	96	39	dia	dia	PROPN
ahs-14180	96	40	.	.	PUNCT
ahs-14180	97	1	samples	sample	NOUN
ahs-14180	97	2	subjected	subject	VERB
ahs-14180	97	3	to	to	ADP
ahs-14180	97	4	par­	par­	NOUN
ahs-14180	97	5	tial	tial	ADJ
ahs-14180	97	6	re­oxygenation	re­oxygenation	NOUN
ahs-14180	97	7	at	at	ADP
ahs-14180	97	8	different	different	ADJ
ahs-14180	97	9	time	time	NOUN
ahs-14180	97	10	points	point	NOUN
ahs-14180	97	11	(	(	PUNCT
ahs-14180	97	12	sh1	sh1	PROPN
ahs-14180	97	13	,	,	PUNCT
ahs-14180	97	14	sh2	sh2	PROPN
ahs-14180	97	15	,	,	PUNCT
ahs-14180	97	16	sh3	sh3	NOUN
ahs-14180	97	17	and	and	CCONJ
ahs-14180	97	18	sh4	sh4	PROPN
ahs-14180	97	19	)	)	PUNCT
ahs-14180	97	20	showed	show	VERB
ahs-14180	97	21	a	a	DET
ahs-14180	97	22	different	different	ADJ
ahs-14180	97	23	behaviour	behaviour	NOUN
ahs-14180	97	24	:	:	PUNCT
ahs-14180	97	25	sh1	sh1	PROPN
ahs-14180	97	26	did	do	AUX
ahs-14180	97	27	not	not	PART
ahs-14180	97	28	show	show	VERB
ahs-14180	97	29	significant	significant	ADJ
ahs-14180	97	30	difference	difference	NOUN
ahs-14180	97	31	from	from	ADP
ahs-14180	97	32	0.3ox	0.3ox	NUM
ahs-14180	97	33	at	at	ADP
ahs-14180	97	34	20	20	NUM
ahs-14180	97	35	dia	dia	PROPN
ahs-14180	97	36	,	,	PUNCT
ahs-14180	97	37	but	but	CCONJ
ahs-14180	97	38	displayed	display	VERB
ahs-14180	97	39	a	a	DET
ahs-14180	97	40	reduced	reduce	VERB
ahs-14180	97	41	amount	amount	NOUN
ahs-14180	97	42	at	at	ADP
ahs-14180	97	43	31	31	NUM
ahs-14180	97	44	and	and	CCONJ
ahs-14180	97	45	at	at	ADP
ahs-14180	97	46	110	110	NUM
ahs-14180	97	47	dia	dia	PROPN
ahs-14180	97	48	as	as	ADV
ahs-14180	97	49	also	also	ADV
ahs-14180	97	50	observed	observe	VERB
ahs-14180	97	51	for	for	ADP
ahs-14180	97	52	sh2	sh2	PROPN
ahs-14180	97	53	.	.	PUNCT
ahs-14180	98	1	interestingly	interestingly	ADV
ahs-14180	98	2	,	,	PUNCT
ahs-14180	98	3	at	at	ADP
ahs-14180	98	4	110	110	NUM
ahs-14180	98	5	dia	dia	PROPN
ahs-14180	98	6	ethanol	ethanol	NOUN
ahs-14180	98	7	levels	level	NOUN
ahs-14180	98	8	were	be	AUX
ahs-14180	98	9	simi­	simi­	VERB
ahs-14180	98	10	lar	lar	ADJ
ahs-14180	98	11	in	in	ADP
ahs-14180	98	12	all	all	PRON
ahs-14180	98	13	shifted	shift	VERB
ahs-14180	98	14	and	and	CCONJ
ahs-14180	98	15	in	in	ADP
ahs-14180	98	16	0.8ox	0.8ox	NOUN
ahs-14180	98	17	samples	sample	NOUN
ahs-14180	98	18	.	.	PUNCT
ahs-14180	99	1	this	this	PRON
ahs-14180	99	2	was	be	AUX
ahs-14180	99	3	also	also	ADV
ahs-14180	99	4	observed	observe	VERB
ahs-14180	99	5	at	at	ADP
ahs-14180	99	6	218	218	NUM
ahs-14180	99	7	dia	dia	PROPN
ahs-14180	99	8	,	,	PUNCT
ahs-14180	99	9	except	except	SCONJ
ahs-14180	99	10	for	for	ADP
ahs-14180	99	11	sh4	sh4	NOUN
ahs-14180	99	12	apples	apple	NOUN
ahs-14180	99	13	that	that	PRON
ahs-14180	99	14	dis­	dis­	PROPN
ahs-14180	99	15	played	play	VERB
ahs-14180	99	16	still	still	ADV
ahs-14180	99	17	significant	significant	ADJ
ahs-14180	99	18	higher	high	ADJ
ahs-14180	99	19	levels	level	NOUN
ahs-14180	99	20	(	(	PUNCT
ahs-14180	99	21	fig	fig	NOUN
ahs-14180	99	22	.	.	PUNCT
ahs-14180	100	1	2	2	NUM
ahs-14180	100	2	)	)	PUNCT
ahs-14180	100	3	.	.	PUNCT
ahs-14180	101	1	effect	effect	NOUN
ahs-14180	101	2	of	of	ADP
ahs-14180	101	3	different	different	ADJ
ahs-14180	101	4	protocols	protocol	NOUN
ahs-14180	101	5	on	on	ADP
ahs-14180	101	6	sugar	sugar	NOUN
ahs-14180	101	7	metabolism‐	metabolism‐	PROPN
ahs-14180	101	8	and	and	CCONJ
ahs-14180	101	9	fermentation‐related	fermentation‐relate	VERB
ahs-14180	101	10	gene	gene	NOUN
ahs-14180	101	11	expression	expression	NOUN
ahs-14180	101	12	for	for	ADP
ahs-14180	101	13	gene	gene	NOUN
ahs-14180	101	14	expression	expression	NOUN
ahs-14180	101	15	data	datum	NOUN
ahs-14180	101	16	analysis	analysis	NOUN
ahs-14180	101	17	,	,	PUNCT
ahs-14180	101	18	0.8ox	0.8ox	NUM
ahs-14180	101	19	samples	sample	NOUN
ahs-14180	101	20	,	,	PUNCT
ahs-14180	101	21	kept	keep	VERB
ahs-14180	101	22	under	under	ADP
ahs-14180	101	23	a	a	DET
ahs-14180	101	24	static	static	ADJ
ahs-14180	101	25	concentration	concentration	NOUN
ahs-14180	101	26	throughout	throughout	ADP
ahs-14180	101	27	the	the	DET
ahs-14180	101	28	experiment	experiment	NOUN
ahs-14180	101	29	(	(	PUNCT
ahs-14180	101	30	from	from	ADP
ahs-14180	101	31	1	1	NUM
ahs-14180	101	32	to	to	ADP
ahs-14180	101	33	218	218	NUM
ahs-14180	101	34	dia	dia	PROPN
ahs-14180	101	35	)	)	PUNCT
ahs-14180	101	36	,	,	PUNCT
ahs-14180	101	37	were	be	AUX
ahs-14180	101	38	considered	consider	VERB
ahs-14180	101	39	as	as	ADP
ahs-14180	101	40	a	a	DET
ahs-14180	101	41	reference	reference	NOUN
ahs-14180	101	42	for	for	ADP
ahs-14180	101	43	the	the	DET
ahs-14180	101	44	other	other	ADJ
ahs-14180	101	45	storage	storage	NOUN
ahs-14180	101	46	protocols	protocol	NOUN
ahs-14180	101	47	(	(	PUNCT
ahs-14180	101	48	0.3ox	0.3ox	PROPN
ahs-14180	101	49	,	,	PUNCT
ahs-14180	101	50	sh1	sh1	PROPN
ahs-14180	101	51	,	,	PUNCT
ahs-14180	101	52	sh2	sh2	PROPN
ahs-14180	101	53	,	,	PUNCT
ahs-14180	101	54	sh3	sh3	NOUN
ahs-14180	101	55	and	and	CCONJ
ahs-14180	101	56	sh4	sh4	PROPN
ahs-14180	101	57	)	)	PUNCT
ahs-14180	101	58	.	.	PUNCT
ahs-14180	102	1	consequently	consequently	ADV
ahs-14180	102	2	,	,	PUNCT
ahs-14180	102	3	the	the	DET
ahs-14180	102	4	gene	gene	NOUN
ahs-14180	102	5	expres­	expres­	PROPN
ahs-14180	102	6	sion	sion	NOUN
ahs-14180	102	7	levels	level	NOUN
ahs-14180	102	8	of	of	ADP
ahs-14180	102	9	these	these	DET
ahs-14180	102	10	latter	latter	ADJ
ahs-14180	102	11	samples	sample	NOUN
ahs-14180	102	12	were	be	AUX
ahs-14180	102	13	expressed	express	VERB
ahs-14180	102	14	as	as	ADP
ahs-14180	102	15	fold	fold	ADJ
ahs-14180	102	16	change	change	NOUN
ahs-14180	102	17	in	in	ADP
ahs-14180	102	18	relation	relation	NOUN
ahs-14180	102	19	to	to	ADP
ahs-14180	102	20	0.8ox	0.8ox	PROPN
ahs-14180	102	21	.	.	PUNCT
ahs-14180	103	1	considering	consider	VERB
ahs-14180	103	2	sugar	sugar	NOUN
ahs-14180	103	3	metabolism	metabolism	NOUN
ahs-14180	103	4	,	,	PUNCT
ahs-14180	103	5	the	the	DET
ahs-14180	103	6	expression	expression	NOUN
ahs-14180	103	7	lev­	lev­	NOUN
ahs-14180	103	8	els	el	NOUN
ahs-14180	103	9	of	of	ADP
ahs-14180	103	10	three	three	NUM
ahs-14180	103	11	genes	gene	NOUN
ahs-14180	103	12	were	be	AUX
ahs-14180	103	13	monitored	monitor	VERB
ahs-14180	103	14	throughout	throughout	ADP
ahs-14180	103	15	stor­	stor­	NOUN
ahs-14180	103	16	age	age	NOUN
ahs-14180	103	17	(	(	PUNCT
ahs-14180	103	18	fig	fig	NOUN
ahs-14180	103	19	.	.	PUNCT
ahs-14180	104	1	3	3	NUM
ahs-14180	104	2	)	)	PUNCT
ahs-14180	104	3	.	.	PUNCT
ahs-14180	105	1	in	in	ADP
ahs-14180	105	2	0.8ox	0.8ox	NUM
ahs-14180	105	3	samples	sample	NOUN
ahs-14180	105	4	,	,	PUNCT
ahs-14180	105	5	mdbam	mdbam	VERB
ahs-14180	105	6	gene	gene	NOUN
ahs-14180	105	7	revealed	reveal	VERB
ahs-14180	105	8	a	a	DET
ahs-14180	105	9	significant	significant	ADJ
ahs-14180	105	10	up	up	ADP
ahs-14180	105	11	regulation	regulation	NOUN
ahs-14180	105	12	,	,	PUNCT
ahs-14180	105	13	compared	compare	VERB
ahs-14180	105	14	to	to	ADP
ahs-14180	105	15	t0	t0	PRON
ahs-14180	105	16	,	,	PUNCT
ahs-14180	105	17	at	at	ADP
ahs-14180	105	18	31	31	NUM
ahs-14180	105	19	and	and	CCONJ
ahs-14180	105	20	110	110	NUM
ahs-14180	105	21	dia	dia	PROPN
ahs-14180	105	22	.	.	PUNCT
ahs-14180	106	1	a	a	DET
ahs-14180	106	2	significantly	significantly	ADV
ahs-14180	106	3	lower	low	ADJ
ahs-14180	106	4	expression	expression	NOUN
ahs-14180	106	5	level	level	NOUN
ahs-14180	106	6	was	be	AUX
ahs-14180	106	7	recorded	record	VERB
ahs-14180	106	8	in	in	ADP
ahs-14180	106	9	0.3ox	0.3ox	PROPN
ahs-14180	106	10	samples	sample	NOUN
ahs-14180	106	11	at	at	ADP
ahs-14180	106	12	10	10	NUM
ahs-14180	106	13	and	and	CCONJ
ahs-14180	106	14	110	110	NUM
ahs-14180	106	15	dia	dia	PROPN
ahs-14180	106	16	.	.	PUNCT
ahs-14180	107	1	sh1	sh1	PROPN
ahs-14180	107	2	,	,	PUNCT
ahs-14180	107	3	sh2	sh2	PROPN
ahs-14180	107	4	,	,	PUNCT
ahs-14180	107	5	sh3	sh3	PROPN
ahs-14180	107	6	and	and	CCONJ
ahs-14180	107	7	sh4	sh4	PROPN
ahs-14180	107	8	samples	sample	NOUN
ahs-14180	107	9	had	have	AUX
ahs-14180	107	10	significantly	significantly	ADV
ahs-14180	107	11	lower	low	ADJ
ahs-14180	107	12	lev­	lev­	NOUN
ahs-14180	107	13	els	el	NOUN
ahs-14180	107	14	of	of	ADP
ahs-14180	107	15	expression	expression	NOUN
ahs-14180	107	16	at	at	ADP
ahs-14180	107	17	110	110	NUM
ahs-14180	107	18	dia	dia	PROPN
ahs-14180	107	19	.	.	PUNCT
ahs-14180	108	1	at	at	ADP
ahs-14180	108	2	the	the	DET
ahs-14180	108	3	last	last	ADJ
ahs-14180	108	4	sampling	sampling	NOUN
ahs-14180	108	5	time	time	NOUN
ahs-14180	108	6	,	,	PUNCT
ahs-14180	108	7	218	218	NUM
ahs-14180	108	8	dia	dia	PROPN
ahs-14180	108	9	,	,	PUNCT
ahs-14180	108	10	all	all	PRON
ahs-14180	108	11	shifted	shift	VERB
ahs-14180	108	12	samples	sample	NOUN
ahs-14180	108	13	,	,	PUNCT
ahs-14180	108	14	except	except	SCONJ
ahs-14180	108	15	sh3	sh3	PROPN
ahs-14180	108	16	,	,	PUNCT
ahs-14180	108	17	revealed	reveal	VERB
ahs-14180	108	18	significantly	significantly	ADV
ahs-14180	108	19	higher	high	ADJ
ahs-14180	108	20	expression	expression	NOUN
ahs-14180	108	21	values	value	NOUN
ahs-14180	108	22	com­	com­	NOUN
ahs-14180	108	23	pared	pare	VERB
ahs-14180	108	24	to	to	ADP
ahs-14180	108	25	0.8ox	0.8ox	PROPN
ahs-14180	108	26	.	.	PUNCT
ahs-14180	109	1	mdpfk	mdpfk	ADJ
ahs-14180	109	2	gene	gene	NOUN
ahs-14180	109	3	expression	expression	NOUN
ahs-14180	109	4	showed	show	VERB
ahs-14180	109	5	a	a	DET
ahs-14180	109	6	steady	steady	ADJ
ahs-14180	109	7	state	state	NOUN
ahs-14180	109	8	in	in	ADP
ahs-14180	109	9	samples	sample	NOUN
ahs-14180	109	10	stored	store	VERB
ahs-14180	109	11	at	at	ADP
ahs-14180	109	12	0.8ox	0.8ox	PROPN
ahs-14180	109	13	.	.	PUNCT
ahs-14180	110	1	a	a	DET
ahs-14180	110	2	lower	low	ADJ
ahs-14180	110	3	expression	expression	NOUN
ahs-14180	110	4	level	level	NOUN
ahs-14180	110	5	of	of	ADP
ahs-14180	110	6	this	this	DET
ahs-14180	110	7	gene	gene	NOUN
ahs-14180	110	8	was	be	AUX
ahs-14180	110	9	detected	detect	VERB
ahs-14180	110	10	at	at	ADP
ahs-14180	110	11	10	10	NUM
ahs-14180	110	12	dia	dia	PROPN
ahs-14180	110	13	in	in	ADP
ahs-14180	110	14	0.3ox	0.3ox	PROPN
ahs-14180	110	15	samples	sample	NOUN
ahs-14180	110	16	.	.	PUNCT
ahs-14180	111	1	sh1	sh1	ADJ
ahs-14180	111	2	samples	sample	NOUN
ahs-14180	111	3	showed	show	VERB
ahs-14180	111	4	higher	high	ADJ
ahs-14180	111	5	expres­	expres­	PROPN
ahs-14180	111	6	sion	sion	NOUN
ahs-14180	111	7	at	at	ADP
ahs-14180	111	8	31	31	NUM
ahs-14180	111	9	dia	dia	PROPN
ahs-14180	111	10	,	,	PUNCT
ahs-14180	111	11	sh2	sh2	PROPN
ahs-14180	111	12	had	have	VERB
ahs-14180	111	13	lower	low	ADJ
ahs-14180	111	14	expression	expression	NOUN
ahs-14180	111	15	level	level	NOUN
ahs-14180	111	16	at	at	ADP
ahs-14180	111	17	31	31	NUM
ahs-14180	111	18	dia	dia	PROPN
ahs-14180	111	19	and	and	CCONJ
ahs-14180	111	20	higher	high	ADJ
ahs-14180	111	21	at	at	ADP
ahs-14180	111	22	110	110	NUM
ahs-14180	111	23	and	and	CCONJ
ahs-14180	111	24	218	218	NUM
ahs-14180	111	25	dia	dia	PROPN
ahs-14180	111	26	,	,	PUNCT
ahs-14180	111	27	while	while	SCONJ
ahs-14180	111	28	sh3	sh3	PROPN
ahs-14180	111	29	sam­	sam­	NOUN
ahs-14180	111	30	ples	ple	NOUN
ahs-14180	111	31	showed	show	VERB
ahs-14180	111	32	higher	high	ADJ
ahs-14180	111	33	expression	expression	NOUN
ahs-14180	111	34	levels	level	NOUN
ahs-14180	111	35	at	at	ADP
ahs-14180	111	36	218	218	NUM
ahs-14180	111	37	dia	dia	PROPN
ahs-14180	111	38	.	.	PUNCT
ahs-14180	112	1	considering	consider	VERB
ahs-14180	112	2	mdsusy	mdsusy	NOUN
ahs-14180	112	3	,	,	PUNCT
ahs-14180	112	4	in	in	ADP
ahs-14180	112	5	0.8ox	0.8ox	NUM
ahs-14180	112	6	apples	apple	VERB
ahs-14180	112	7	the	the	DET
ahs-14180	112	8	expression	expression	NOUN
ahs-14180	112	9	showed	show	VERB
ahs-14180	112	10	a	a	DET
ahs-14180	112	11	significant	significant	ADJ
ahs-14180	112	12	induction	induction	NOUN
ahs-14180	112	13	at	at	ADP
ahs-14180	112	14	10	10	NUM
ahs-14180	112	15	and	and	CCONJ
ahs-14180	112	16	20	20	NUM
ahs-14180	112	17	dia	dia	PROPN
ahs-14180	112	18	,	,	PUNCT
ahs-14180	112	19	fol­	fol­	NOUN
ahs-14180	112	20	lowed	low	VERB
ahs-14180	112	21	by	by	ADP
ahs-14180	112	22	a	a	DET
ahs-14180	112	23	basal	basal	ADJ
ahs-14180	112	24	expression	expression	NOUN
ahs-14180	112	25	level	level	NOUN
ahs-14180	112	26	at	at	ADP
ahs-14180	112	27	all	all	DET
ahs-14180	112	28	the	the	DET
ahs-14180	112	29	other	other	ADJ
ahs-14180	112	30	sampling	sampling	NOUN
ahs-14180	112	31	points	point	NOUN
ahs-14180	112	32	.	.	PUNCT
ahs-14180	113	1	samples	sample	NOUN
ahs-14180	113	2	stored	store	VERB
ahs-14180	113	3	under	under	ADP
ahs-14180	113	4	0.3ox	0.3ox	PROPN
ahs-14180	113	5	revealed	reveal	VERB
ahs-14180	113	6	two	two	NUM
ahs-14180	113	7	marked	marked	ADJ
ahs-14180	113	8	and	and	CCONJ
ahs-14180	113	9	significant	significant	ADJ
ahs-14180	113	10	peaks	peak	NOUN
ahs-14180	113	11	of	of	ADP
ahs-14180	113	12	induc­	induc­	PROPN
ahs-14180	113	13	tion	tion	NOUN
ahs-14180	113	14	,	,	PUNCT
ahs-14180	113	15	at	at	ADP
ahs-14180	113	16	10	10	NUM
ahs-14180	113	17	and	and	CCONJ
ahs-14180	113	18	110	110	NUM
ahs-14180	113	19	dia	dia	PROPN
ahs-14180	113	20	.	.	PROPN
ahs-14180	114	1	interestingly	interestingly	ADV
ahs-14180	114	2	,	,	PUNCT
ahs-14180	114	3	sh1	sh1	PROPN
ahs-14180	114	4	showed	show	VERB
ahs-14180	114	5	significantly	significantly	ADV
ahs-14180	114	6	reduced	reduce	VERB
ahs-14180	114	7	levels	level	NOUN
ahs-14180	114	8	of	of	ADP
ahs-14180	114	9	expression	expression	NOUN
ahs-14180	114	10	at	at	ADP
ahs-14180	114	11	20	20	NUM
ahs-14180	114	12	dia	dia	PROPN
ahs-14180	114	13	,	,	PUNCT
ahs-14180	114	14	while	while	SCONJ
ahs-14180	114	15	sh2	sh2	PROPN
ahs-14180	114	16	and	and	CCONJ
ahs-14180	114	17	sh4	sh4	NOUN
ahs-14180	114	18	revealed	reveal	VERB
ahs-14180	114	19	significantly	significantly	ADV
ahs-14180	114	20	higher	high	ADJ
ahs-14180	114	21	expression	expression	NOUN
ahs-14180	114	22	at	at	ADP
ahs-14180	114	23	218	218	NUM
ahs-14180	114	24	dia	dia	PROPN
ahs-14180	114	25	.	.	PUNCT
ahs-14180	115	1	concerning	concern	VERB
ahs-14180	115	2	the	the	DET
ahs-14180	115	3	gene	gene	NOUN
ahs-14180	115	4	related	relate	VERB
ahs-14180	115	5	to	to	ADP
ahs-14180	115	6	the	the	DET
ahs-14180	115	7	fermenta­	fermenta­	NOUN
ahs-14180	115	8	tive	tive	NOUN
ahs-14180	115	9	/	/	SYM
ahs-14180	115	10	pyruvic	pyruvic	ADJ
ahs-14180	115	11	acid	acid	NOUN
ahs-14180	115	12	metabolism	metabolism	NOUN
ahs-14180	115	13	(	(	PUNCT
ahs-14180	115	14	fig	fig	NOUN
ahs-14180	115	15	.	.	AUX
ahs-14180	115	16	4	4	NUM
ahs-14180	115	17	)	)	PUNCT
ahs-14180	115	18	,	,	PUNCT
ahs-14180	115	19	mdldh	mdldh	PROPN
ahs-14180	115	20	expres­	expres­	PROPN
ahs-14180	115	21	sion	sion	PROPN
ahs-14180	115	22	showed	show	VERB
ahs-14180	115	23	,	,	PUNCT
ahs-14180	115	24	in	in	ADP
ahs-14180	115	25	0.8ox	0.8ox	NUM
ahs-14180	115	26	samples	sample	NOUN
ahs-14180	115	27	,	,	PUNCT
ahs-14180	115	28	a	a	DET
ahs-14180	115	29	significant	significant	ADJ
ahs-14180	115	30	increase	increase	NOUN
ahs-14180	115	31	fig	fig	NOUN
ahs-14180	115	32	.	.	PUNCT
ahs-14180	116	1	2	2	NUM
ahs-14180	116	2	­	­	NOUN
ahs-14180	116	3	ethanol	ethanol	NOUN
ahs-14180	116	4	content	content	NOUN
ahs-14180	116	5	(	(	PUNCT
ahs-14180	116	6	mg	mg	PROPN
ahs-14180	116	7	/	/	SYM
ahs-14180	116	8	kg	kg	PROPN
ahs-14180	116	9	fw	fw	ADJ
ahs-14180	116	10	)	)	PUNCT
ahs-14180	116	11	.	.	PUNCT
ahs-14180	117	1	samples	sample	NOUN
ahs-14180	117	2	stored	store	VERB
ahs-14180	117	3	in	in	ADP
ahs-14180	117	4	0.3ox	0.3ox	PROPN
ahs-14180	117	5	(	(	PUNCT
ahs-14180	117	6	blue	blue	ADJ
ahs-14180	117	7	)	)	PUNCT
ahs-14180	117	8	,	,	PUNCT
ahs-14180	117	9	0.8ox	0.8ox	PROPN
ahs-14180	117	10	(	(	PUNCT
ahs-14180	117	11	purple	purple	ADJ
ahs-14180	117	12	)	)	PUNCT
ahs-14180	117	13	,	,	PUNCT
ahs-14180	117	14	sh1	sh1	PROPN
ahs-14180	117	15	(	(	PUNCT
ahs-14180	117	16	red	red	PROPN
ahs-14180	117	17	)	)	PUNCT
ahs-14180	117	18	,	,	PUNCT
ahs-14180	117	19	sh2	sh2	PROPN
ahs-14180	117	20	(	(	PUNCT
ahs-14180	117	21	orange	orange	PROPN
ahs-14180	117	22	)	)	PUNCT
ahs-14180	117	23	,	,	PUNCT
ahs-14180	117	24	sh3	sh3	PROPN
ahs-14180	117	25	(	(	PUNCT
ahs-14180	117	26	yellow	yellow	ADJ
ahs-14180	117	27	)	)	PUNCT
ahs-14180	117	28	and	and	CCONJ
ahs-14180	117	29	sh4	sh4	PROPN
ahs-14180	117	30	(	(	PUNCT
ahs-14180	117	31	light	light	NOUN
ahs-14180	117	32	blue	blue	NOUN
ahs-14180	117	33	)	)	PUNCT
ahs-14180	117	34	analysed	analyse	VERB
ahs-14180	117	35	from	from	ADP
ahs-14180	117	36	10	10	NUM
ahs-14180	117	37	to	to	PART
ahs-14180	117	38	218	218	NUM
ahs-14180	117	39	days	day	NOUN
ahs-14180	117	40	in	in	ADP
ahs-14180	117	41	atmosphere	atmosphere	NOUN
ahs-14180	117	42	(	(	PUNCT
ahs-14180	117	43	dia	dia	PROPN
ahs-14180	117	44	)	)	PUNCT
ahs-14180	117	45	.	.	PUNCT
ahs-14180	118	1	different	different	ADJ
ahs-14180	118	2	letters	letter	NOUN
ahs-14180	118	3	indicate	indicate	VERB
ahs-14180	118	4	sig­	sig­	NOUN
ahs-14180	118	5	nificant	nificant	ADJ
ahs-14180	118	6	differences	difference	NOUN
ahs-14180	118	7	among	among	ADP
ahs-14180	118	8	samples	sample	NOUN
ahs-14180	118	9	(	(	PUNCT
ahs-14180	118	10	anova	anova	X
ahs-14180	118	11	,	,	PUNCT
ahs-14180	118	12	lsd	lsd	NOUN
ahs-14180	118	13	post­	post­	NOUN
ahs-14180	118	14	hoc	hoc	X
ahs-14180	118	15	test	test	NOUN
ahs-14180	118	16	(	(	PUNCT
ahs-14180	118	17	p	p	NOUN
ahs-14180	118	18	≤	≤	NOUN
ahs-14180	118	19	0.05	0.05	NUM
ahs-14180	118	20	)	)	PUNCT
ahs-14180	118	21	.	.	PUNCT
ahs-14180	119	1	different	different	ADJ
ahs-14180	119	2	letters	letter	NOUN
ahs-14180	119	3	indicate	indicate	VERB
ahs-14180	119	4	significant	significant	ADJ
ahs-14180	119	5	differences	difference	NOUN
ahs-14180	119	6	among	among	ADP
ahs-14180	119	7	samples	sample	NOUN
ahs-14180	119	8	(	(	PUNCT
ahs-14180	119	9	anova	anova	X
ahs-14180	119	10	,	,	PUNCT
ahs-14180	119	11	lsd	lsd	NOUN
ahs-14180	119	12	post­hoc	post­hoc	NOUN
ahs-14180	119	13	test	test	NOUN
ahs-14180	119	14	(	(	PUNCT
ahs-14180	119	15	p≤0.05	p≤0.05	NOUN
ahs-14180	119	16	)	)	PUNCT
ahs-14180	119	17	.	.	PUNCT
ahs-14180	120	1	table	table	NOUN
ahs-14180	120	2	2	2	NUM
ahs-14180	120	3	­	­	NOUN
ahs-14180	120	4	firmness	firmness	NOUN
ahs-14180	120	5	and	and	CCONJ
ahs-14180	120	6	total	total	ADJ
ahs-14180	120	7	soluble	soluble	ADJ
ahs-14180	120	8	solids	solid	NOUN
ahs-14180	120	9	(	(	PUNCT
ahs-14180	120	10	tss	tss	PROPN
ahs-14180	120	11	)	)	PUNCT
ahs-14180	120	12	.	.	PUNCT
ahs-14180	121	1	mean	mean	VERB
ahs-14180	121	2	values	value	NOUN
ahs-14180	121	3	(	(	PUNCT
ahs-14180	121	4	±se	±se	PROPN
ahs-14180	121	5	)	)	PUNCT
ahs-14180	121	6	of	of	ADP
ahs-14180	121	7	apple	apple	NOUN
ahs-14180	121	8	samples	sample	NOUN
ahs-14180	121	9	at	at	ADP
ahs-14180	121	10	harvest	harvest	NOUN
ahs-14180	121	11	(	(	PUNCT
ahs-14180	121	12	t0	t0	NOUN
ahs-14180	121	13	)	)	PUNCT
ahs-14180	121	14	and	and	CCONJ
ahs-14180	121	15	after	after	ADP
ahs-14180	121	16	218	218	NUM
ahs-14180	121	17	dia	dia	PROPN
ahs-14180	121	18	of	of	ADP
ahs-14180	121	19	static	static	PROPN
ahs-14180	121	20	(	(	PUNCT
ahs-14180	121	21	0.8ox	0.8ox	NUM
ahs-14180	121	22	)	)	PUNCT
ahs-14180	121	23	and	and	CCONJ
ahs-14180	121	24	dynamic	dynamic	ADJ
ahs-14180	121	25	atmosphere	atmosphere	NOUN
ahs-14180	121	26	storage	storage	NOUN
ahs-14180	121	27	(	(	PUNCT
ahs-14180	121	28	shift	shift	NOUN
ahs-14180	121	29	1­4	1­4	NUM
ahs-14180	121	30	)	)	PUNCT
ahs-14180	121	31	are	be	AUX
ahs-14180	121	32	reported	report	VERB
ahs-14180	121	33	in	in	ADP
ahs-14180	121	34	the	the	DET
ahs-14180	121	35	table	table	NOUN
ahs-14180	121	36	samples	sample	VERB
ahs-14180	121	37	dia	dia	PROPN
ahs-14180	121	38	firmness	firmness	NOUN
ahs-14180	121	39	(	(	PUNCT
ahs-14180	121	40	n	n	CCONJ
ahs-14180	121	41	)	)	PUNCT
ahs-14180	121	42	tss	tss	NOUN
ahs-14180	121	43	(	(	PUNCT
ahs-14180	121	44	°	°	NOUN
ahs-14180	121	45	brix	brix	NOUN
ahs-14180	121	46	)	)	PUNCT
ahs-14180	121	47	at	at	ADP
ahs-14180	121	48	harvest	harvest	NOUN
ahs-14180	121	49	0	0	NUM
ahs-14180	121	50	75.10	75.10	NUM
ahs-14180	121	51	±	±	NUM
ahs-14180	121	52	0.96	0.96	NUM
ahs-14180	121	53	a	a	DET
ahs-14180	121	54	10.85	10.85	NUM
ahs-14180	121	55	±	±	NUM
ahs-14180	121	56	0.45	0.45	NUM
ahs-14180	121	57	static	static	NOUN
ahs-14180	121	58	0.8ox	0.8ox	PROPN
ahs-14180	121	59	218	218	NUM
ahs-14180	121	60	67.67	67.67	NUM
ahs-14180	121	61	±	±	NUM
ahs-14180	121	62	2.85	2.85	NUM
ahs-14180	121	63	ab	ab	PROPN
ahs-14180	121	64	11.40	11.40	NUM
ahs-14180	121	65	±	±	NUM
ahs-14180	121	66	0.06	0.06	NUM
ahs-14180	121	67	shift	shift	NOUN
ahs-14180	121	68	1	1	NUM
ahs-14180	121	69	218	218	NUM
ahs-14180	121	70	62.52	62.52	NUM
ahs-14180	121	71	±	±	NUM
ahs-14180	121	72	3.51	3.51	NUM
ahs-14180	121	73	ab	ab	PROPN
ahs-14180	121	74	11.76	11.76	NUM
ahs-14180	121	75	±	±	NUM
ahs-14180	121	76	0.32	0.32	NUM
ahs-14180	121	77	shift	shift	NOUN
ahs-14180	121	78	2	2	NUM
ahs-14180	121	79	218	218	NUM
ahs-14180	121	80	67.91	67.91	NUM
ahs-14180	121	81	±	±	NUM
ahs-14180	121	82	0.73	0.73	NUM
ahs-14180	121	83	ab	ab	PROPN
ahs-14180	121	84	11.53	11.53	NUM
ahs-14180	121	85	±	±	NUM
ahs-14180	121	86	0.24	0.24	NUM
ahs-14180	121	87	shift	shift	NOUN
ahs-14180	121	88	3	3	NUM
ahs-14180	121	89	218	218	NUM
ahs-14180	121	90	58.10	58.10	NUM
ahs-14180	121	91	±	±	NUM
ahs-14180	121	92	6.76	6.76	NUM
ahs-14180	121	93	b	b	SYM
ahs-14180	121	94	10.86	10.86	NUM
ahs-14180	121	95	±	±	NUM
ahs-14180	121	96	0.13	0.13	NUM
ahs-14180	121	97	shift	shift	NOUN
ahs-14180	121	98	4	4	NUM
ahs-14180	121	99	218	218	NUM
ahs-14180	121	100	61.30	61.30	NUM
ahs-14180	121	101	±	±	NUM
ahs-14180	121	102	5.83	5.83	NUM
ahs-14180	121	103	b	b	PROPN
ahs-14180	121	104	11.40	11.40	NUM
ahs-14180	121	105	±	±	NUM
ahs-14180	121	106	0.06	0.06	NUM
ahs-14180	121	107	94	94	NUM
ahs-14180	121	108	adv	adv	PROPN
ahs-14180	121	109	.	.	PUNCT
ahs-14180	122	1	hort	hort	PROPN
ahs-14180	122	2	.	.	PUNCT
ahs-14180	123	1	sci	sci	PROPN
ahs-14180	123	2	.	.	PROPN
ahs-14180	123	3	,	,	PUNCT
ahs-14180	123	4	2023	2023	NUM
ahs-14180	123	5	37(1	37(1	NUM
ahs-14180	123	6	):	):	PUNCT
ahs-14180	123	7	89­99	89­99	NUM
ahs-14180	123	8	of	of	ADP
ahs-14180	123	9	expression	expression	NOUN
ahs-14180	123	10	only	only	ADV
ahs-14180	123	11	at	at	ADP
ahs-14180	123	12	10	10	NUM
ahs-14180	123	13	dia	dia	PROPN
ahs-14180	123	14	.	.	PROPN
ahs-14180	123	15	compared	compare	VERB
ahs-14180	123	16	to	to	ADP
ahs-14180	123	17	0.8ox	0.8ox	NUM
ahs-14180	123	18	sam­	sam­	NOUN
ahs-14180	123	19	ples	ple	NOUN
ahs-14180	123	20	,	,	PUNCT
ahs-14180	123	21	0.3ox	0.3ox	NUM
ahs-14180	123	22	treatment	treatment	NOUN
ahs-14180	123	23	induced	induce	VERB
ahs-14180	123	24	higher	high	ADJ
ahs-14180	123	25	expression	expression	NOUN
ahs-14180	123	26	at	at	ADP
ahs-14180	123	27	10	10	NUM
ahs-14180	123	28	and	and	CCONJ
ahs-14180	123	29	110	110	NUM
ahs-14180	123	30	dia	dia	PROPN
ahs-14180	123	31	,	,	PUNCT
ahs-14180	123	32	and	and	CCONJ
ahs-14180	123	33	a	a	DET
ahs-14180	123	34	general	general	ADJ
ahs-14180	123	35	up­regulation	up­regulation	PROPN
ahs-14180	123	36	in	in	ADP
ahs-14180	123	37	shift­	shift­	NOUN
ahs-14180	123	38	ed	ed	NOUN
ahs-14180	123	39	samples	sample	NOUN
ahs-14180	123	40	at	at	ADP
ahs-14180	123	41	218	218	NUM
ahs-14180	123	42	dia	dia	PROPN
ahs-14180	123	43	.	.	PUNCT
ahs-14180	123	44	mdpdc	mdpdc	PROPN
ahs-14180	123	45	,	,	PUNCT
ahs-14180	123	46	involved	involve	VERB
ahs-14180	123	47	in	in	ADP
ahs-14180	123	48	the	the	DET
ahs-14180	123	49	pro­	pro­	NOUN
ahs-14180	123	50	duction	duction	NOUN
ahs-14180	123	51	of	of	ADP
ahs-14180	123	52	acetaldehyde	acetaldehyde	NOUN
ahs-14180	123	53	,	,	PUNCT
ahs-14180	123	54	increased	increase	VERB
ahs-14180	123	55	its	its	PRON
ahs-14180	123	56	expression	expression	NOUN
ahs-14180	123	57	at	at	ADP
ahs-14180	123	58	20	20	NUM
ahs-14180	123	59	and	and	CCONJ
ahs-14180	123	60	31	31	NUM
ahs-14180	123	61	dia	dia	PROPN
ahs-14180	123	62	in	in	ADP
ahs-14180	123	63	0.8ox	0.8ox	PROPN
ahs-14180	123	64	samples	sample	NOUN
ahs-14180	123	65	.	.	PUNCT
ahs-14180	124	1	0.3ox	0.3ox	NUM
ahs-14180	124	2	apples	apple	NOUN
ahs-14180	124	3	revealed	reveal	VERB
ahs-14180	124	4	an	an	DET
ahs-14180	124	5	earlier	early	ADJ
ahs-14180	124	6	increase	increase	NOUN
ahs-14180	124	7	in	in	ADP
ahs-14180	124	8	the	the	DET
ahs-14180	124	9	expression	expression	NOUN
ahs-14180	124	10	of	of	ADP
ahs-14180	124	11	mdpdc	mdpdc	PROPN
ahs-14180	124	12	gene	gene	NOUN
ahs-14180	124	13	,	,	PUNCT
ahs-14180	124	14	significant	significant	ADJ
ahs-14180	124	15	at	at	ADP
ahs-14180	124	16	10	10	NUM
ahs-14180	124	17	dia	dia	PROPN
ahs-14180	124	18	.	.	PUNCT
ahs-14180	125	1	among	among	ADP
ahs-14180	125	2	samples	sample	NOUN
ahs-14180	125	3	that	that	PRON
ahs-14180	125	4	underwent	undergo	VERB
ahs-14180	125	5	partial	partial	ADJ
ahs-14180	125	6	re­oxygenation	re­oxygenation	NOUN
ahs-14180	125	7	,	,	PUNCT
ahs-14180	125	8	a	a	DET
ahs-14180	125	9	general	general	ADJ
ahs-14180	125	10	lower	low	ADJ
ahs-14180	125	11	expression	expression	NOUN
ahs-14180	125	12	,	,	PUNCT
ahs-14180	125	13	always	always	ADV
ahs-14180	125	14	compared	compare	VERB
ahs-14180	125	15	to	to	ADP
ahs-14180	125	16	0.8ox	0.8ox	NUM
ahs-14180	125	17	,	,	PUNCT
ahs-14180	125	18	was	be	AUX
ahs-14180	125	19	observed	observe	VERB
ahs-14180	125	20	at	at	ADP
ahs-14180	125	21	110	110	NUM
ahs-14180	125	22	dia	dia	PROPN
ahs-14180	125	23	,	,	PUNCT
ahs-14180	125	24	followed	follow	VERB
ahs-14180	125	25	by	by	ADP
ahs-14180	125	26	increased	increase	VERB
ahs-14180	125	27	levels	level	NOUN
ahs-14180	125	28	at	at	ADP
ahs-14180	125	29	218	218	NUM
ahs-14180	125	30	dia	dia	PROPN
ahs-14180	125	31	.	.	PROPN
ahs-14180	125	32	acetaldehyde	acetaldehyde	PROPN
ahs-14180	125	33	can	can	AUX
ahs-14180	125	34	be	be	AUX
ahs-14180	125	35	further	far	ADV
ahs-14180	125	36	converted	convert	VERB
ahs-14180	125	37	to	to	ADP
ahs-14180	125	38	fig	fig	NOUN
ahs-14180	125	39	.	.	PUNCT
ahs-14180	126	1	4	4	NUM
ahs-14180	126	2	­	­	NUM
ahs-14180	126	3	relative	relative	ADJ
ahs-14180	126	4	expression	expression	NOUN
ahs-14180	126	5	of	of	ADP
ahs-14180	126	6	genes	gene	NOUN
ahs-14180	126	7	related	relate	VERB
ahs-14180	126	8	to	to	ADP
ahs-14180	126	9	fermentative	fermentative	ADJ
ahs-14180	126	10	/	/	SYM
ahs-14180	126	11	pyruvic	pyruvic	ADJ
ahs-14180	126	12	acid	acid	NOUN
ahs-14180	126	13	metabolism	metabolism	NOUN
ahs-14180	126	14	,	,	PUNCT
ahs-14180	126	15	lactate	lactate	NOUN
ahs-14180	126	16	dehydrogenase	dehydrogenase	NOUN
ahs-14180	126	17	,	,	PUNCT
ahs-14180	126	18	pyruvate	pyruvate	NOUN
ahs-14180	126	19	decarboxylase	decarboxylase	NOUN
ahs-14180	126	20	,	,	PUNCT
ahs-14180	126	21	alcohol	alcohol	NOUN
ahs-14180	126	22	dehydrogenase	dehydrogenase	NOUN
ahs-14180	126	23	and	and	CCONJ
ahs-14180	126	24	alanine	alanine	NOUN
ahs-14180	126	25	aminotransferase	aminotransferase	NOUN
ahs-14180	126	26	.	.	PUNCT
ahs-14180	127	1	for	for	ADP
ahs-14180	127	2	samples	sample	NOUN
ahs-14180	127	3	0.3ox	0.3ox	NUM
ahs-14180	127	4	(	(	PUNCT
ahs-14180	127	5	blue	blue	ADJ
ahs-14180	127	6	)	)	PUNCT
ahs-14180	127	7	,	,	PUNCT
ahs-14180	127	8	sh1	sh1	PROPN
ahs-14180	127	9	(	(	PUNCT
ahs-14180	127	10	red	red	PROPN
ahs-14180	127	11	)	)	PUNCT
ahs-14180	127	12	,	,	PUNCT
ahs-14180	127	13	sh2	sh2	PROPN
ahs-14180	127	14	(	(	PUNCT
ahs-14180	127	15	orange	orange	PROPN
ahs-14180	127	16	)	)	PUNCT
ahs-14180	127	17	,	,	PUNCT
ahs-14180	127	18	sh3	sh3	PROPN
ahs-14180	127	19	(	(	PUNCT
ahs-14180	127	20	yellow	yellow	ADJ
ahs-14180	127	21	)	)	PUNCT
ahs-14180	127	22	and	and	CCONJ
ahs-14180	127	23	sh4	sh4	PROPN
ahs-14180	127	24	(	(	PUNCT
ahs-14180	127	25	light	light	NOUN
ahs-14180	127	26	blue	blue	NOUN
ahs-14180	127	27	)	)	PUNCT
ahs-14180	127	28	the	the	DET
ahs-14180	127	29	expression	expression	NOUN
ahs-14180	127	30	level	level	NOUN
ahs-14180	127	31	is	be	AUX
ahs-14180	127	32	reported	report	VERB
ahs-14180	127	33	from	from	ADP
ahs-14180	127	34	1	1	NUM
ahs-14180	127	35	to	to	PART
ahs-14180	127	36	218	218	NUM
ahs-14180	127	37	days	day	NOUN
ahs-14180	127	38	in	in	ADP
ahs-14180	127	39	atmosphere	atmosphere	NOUN
ahs-14180	127	40	(	(	PUNCT
ahs-14180	127	41	dia	dia	PROPN
ahs-14180	127	42	)	)	PUNCT
ahs-14180	127	43	as	as	SCONJ
ahs-14180	127	44	log2	log2	PROPN
ahs-14180	127	45	fc	fc	PROPN
ahs-14180	127	46	normalized	normalize	VERB
ahs-14180	127	47	on	on	ADP
ahs-14180	127	48	0.8ox	0.8ox	NUM
ahs-14180	127	49	expression	expression	NOUN
ahs-14180	127	50	level	level	NOUN
ahs-14180	127	51	at	at	ADP
ahs-14180	127	52	each	each	DET
ahs-14180	127	53	time	time	NOUN
ahs-14180	127	54	point	point	NOUN
ahs-14180	127	55	.	.	PUNCT
ahs-14180	128	1	the	the	DET
ahs-14180	128	2	red	red	ADJ
ahs-14180	128	3	line	line	NOUN
ahs-14180	128	4	represents	represent	VERB
ahs-14180	128	5	gene	gene	NOUN
ahs-14180	128	6	relative	relative	ADJ
ahs-14180	128	7	expression	expression	NOUN
ahs-14180	128	8	in	in	ADP
ahs-14180	128	9	0.8ox	0.8ox	NOUN
ahs-14180	128	10	samples	sample	NOUN
ahs-14180	128	11	.	.	PUNCT
ahs-14180	129	1	black	black	ADJ
ahs-14180	129	2	asterisks	asterisk	NOUN
ahs-14180	129	3	indicate	indicate	VERB
ahs-14180	129	4	significant	significant	ADJ
ahs-14180	129	5	dif­	dif­	NOUN
ahs-14180	129	6	ferences	ference	NOUN
ahs-14180	129	7	(	(	PUNCT
ahs-14180	129	8	anova	anova	PROPN
ahs-14180	129	9	,	,	PUNCT
ahs-14180	129	10	lsd	lsd	NOUN
ahs-14180	129	11	post­hoc	post­hoc	NOUN
ahs-14180	129	12	test	test	NOUN
ahs-14180	129	13	(	(	PUNCT
ahs-14180	129	14	p≤0.05	p≤0.05	NOUN
ahs-14180	129	15	)	)	PUNCT
ahs-14180	129	16	comparing	compare	VERB
ahs-14180	129	17	each	each	DET
ahs-14180	129	18	sample	sample	NOUN
ahs-14180	129	19	to	to	ADP
ahs-14180	129	20	0.8ox	0.8ox	NOUN
ahs-14180	129	21	level	level	NOUN
ahs-14180	129	22	at	at	ADP
ahs-14180	129	23	the	the	DET
ahs-14180	129	24	same	same	ADJ
ahs-14180	129	25	sampling	sampling	NOUN
ahs-14180	129	26	time	time	NOUN
ahs-14180	129	27	.	.	PUNCT
ahs-14180	130	1	red	red	ADJ
ahs-14180	130	2	asterisks	asterisk	NOUN
ahs-14180	130	3	indicate	indicate	VERB
ahs-14180	130	4	significant	significant	ADJ
ahs-14180	130	5	differences	difference	NOUN
ahs-14180	130	6	(	(	PUNCT
ahs-14180	130	7	anova	anova	PROPN
ahs-14180	130	8	,	,	PUNCT
ahs-14180	130	9	lsd	lsd	NOUN
ahs-14180	130	10	post­hoc	post­hoc	NOUN
ahs-14180	130	11	test	test	NOUN
ahs-14180	130	12	(	(	PUNCT
ahs-14180	130	13	p	p	NOUN
ahs-14180	130	14	≤	≤	NUM
ahs-14180	130	15	0.05	0.05	NUM
ahs-14180	130	16	)	)	PUNCT
ahs-14180	130	17	between	between	ADP
ahs-14180	130	18	0.8ox	0.8ox	ADJ
ahs-14180	130	19	samples	sample	NOUN
ahs-14180	130	20	at	at	ADP
ahs-14180	130	21	the	the	DET
ahs-14180	130	22	specific	specific	ADJ
ahs-14180	130	23	time	time	NOUN
ahs-14180	130	24	points	point	NOUN
ahs-14180	130	25	and	and	CCONJ
ahs-14180	130	26	0.8ox	0.8ox	NUM
ahs-14180	130	27	apples	apple	NOUN
ahs-14180	130	28	at	at	ADP
ahs-14180	130	29	1	1	NUM
ahs-14180	130	30	dia	dia	PROPN
ahs-14180	130	31	.	.	PROPN
ahs-14180	130	32	fig	fig	PROPN
ahs-14180	130	33	.	.	PUNCT
ahs-14180	131	1	3	3	NUM
ahs-14180	131	2	­	­	NUM
ahs-14180	131	3	relative	relative	ADJ
ahs-14180	131	4	expression	expression	NOUN
ahs-14180	131	5	of	of	ADP
ahs-14180	131	6	genes	gene	NOUN
ahs-14180	131	7	related	relate	VERB
ahs-14180	131	8	to	to	ADP
ahs-14180	131	9	sugar	sugar	NOUN
ahs-14180	131	10	metabolism	metabolism	NOUN
ahs-14180	131	11	and	and	CCONJ
ahs-14180	131	12	energy	energy	NOUN
ahs-14180	131	13	production	production	NOUN
ahs-14180	131	14	β­amylase	β­amylase	NOUN
ahs-14180	131	15	,	,	PUNCT
ahs-14180	131	16	phosphofructokinase	phosphofructokinase	NOUN
ahs-14180	131	17	,	,	PUNCT
ahs-14180	131	18	and	and	CCONJ
ahs-14180	131	19	sucrose	sucrose	VERB
ahs-14180	131	20	synthase	synthase	NOUN
ahs-14180	131	21	.	.	PUNCT
ahs-14180	132	1	for	for	ADP
ahs-14180	132	2	samples	sample	NOUN
ahs-14180	132	3	0.3ox	0.3ox	NUM
ahs-14180	132	4	(	(	PUNCT
ahs-14180	132	5	blue	blue	ADJ
ahs-14180	132	6	)	)	PUNCT
ahs-14180	132	7	,	,	PUNCT
ahs-14180	132	8	sh1	sh1	PROPN
ahs-14180	132	9	(	(	PUNCT
ahs-14180	132	10	red	red	PROPN
ahs-14180	132	11	)	)	PUNCT
ahs-14180	132	12	,	,	PUNCT
ahs-14180	132	13	sh2	sh2	PROPN
ahs-14180	132	14	(	(	PUNCT
ahs-14180	132	15	orange	orange	PROPN
ahs-14180	132	16	)	)	PUNCT
ahs-14180	132	17	,	,	PUNCT
ahs-14180	132	18	sh3	sh3	PROPN
ahs-14180	132	19	(	(	PUNCT
ahs-14180	132	20	yellow	yellow	ADJ
ahs-14180	132	21	)	)	PUNCT
ahs-14180	132	22	and	and	CCONJ
ahs-14180	132	23	sh4	sh4	PROPN
ahs-14180	132	24	(	(	PUNCT
ahs-14180	132	25	light	light	NOUN
ahs-14180	132	26	blue	blue	NOUN
ahs-14180	132	27	)	)	PUNCT
ahs-14180	132	28	the	the	DET
ahs-14180	132	29	expression	expression	NOUN
ahs-14180	132	30	level	level	NOUN
ahs-14180	132	31	is	be	AUX
ahs-14180	132	32	reported	report	VERB
ahs-14180	132	33	from	from	ADP
ahs-14180	132	34	1	1	NUM
ahs-14180	132	35	to	to	PART
ahs-14180	132	36	218	218	NUM
ahs-14180	132	37	days	day	NOUN
ahs-14180	132	38	in	in	ADP
ahs-14180	132	39	atmosphere	atmosphere	NOUN
ahs-14180	132	40	(	(	PUNCT
ahs-14180	132	41	dia	dia	PROPN
ahs-14180	132	42	)	)	PUNCT
ahs-14180	132	43	as	as	SCONJ
ahs-14180	132	44	log2	log2	PROPN
ahs-14180	132	45	fc	fc	PROPN
ahs-14180	132	46	normalized	normalize	VERB
ahs-14180	132	47	on	on	ADP
ahs-14180	132	48	0.8ox	0.8ox	NUM
ahs-14180	132	49	expression	expression	NOUN
ahs-14180	132	50	level	level	NOUN
ahs-14180	132	51	at	at	ADP
ahs-14180	132	52	each	each	DET
ahs-14180	132	53	time	time	NOUN
ahs-14180	132	54	point	point	NOUN
ahs-14180	132	55	.	.	PUNCT
ahs-14180	133	1	the	the	DET
ahs-14180	133	2	red	red	ADJ
ahs-14180	133	3	line	line	PROPN
ahs-14180	133	4	repre­	repre­	PROPN
ahs-14180	133	5	sents	sents	PROPN
ahs-14180	133	6	gene	gene	VERB
ahs-14180	133	7	relative	relative	ADJ
ahs-14180	133	8	expression	expression	NOUN
ahs-14180	133	9	in	in	ADP
ahs-14180	133	10	0.8ox	0.8ox	NOUN
ahs-14180	133	11	samples	sample	NOUN
ahs-14180	133	12	.	.	PUNCT
ahs-14180	134	1	black	black	ADJ
ahs-14180	134	2	asterisks	asterisk	NOUN
ahs-14180	134	3	indicate	indicate	VERB
ahs-14180	134	4	significant	significant	ADJ
ahs-14180	134	5	differences	difference	NOUN
ahs-14180	134	6	(	(	PUNCT
ahs-14180	134	7	anova	anova	PROPN
ahs-14180	134	8	,	,	PUNCT
ahs-14180	134	9	lsd	lsd	NOUN
ahs-14180	134	10	post­hoc	post­hoc	NOUN
ahs-14180	134	11	test	test	NOUN
ahs-14180	134	12	(	(	PUNCT
ahs-14180	134	13	p≤0.05	p≤0.05	NOUN
ahs-14180	134	14	)	)	PUNCT
ahs-14180	134	15	comparing	compare	VERB
ahs-14180	134	16	each	each	DET
ahs-14180	134	17	sample	sample	NOUN
ahs-14180	134	18	to	to	ADP
ahs-14180	134	19	0.8ox	0.8ox	NOUN
ahs-14180	134	20	level	level	NOUN
ahs-14180	134	21	at	at	ADP
ahs-14180	134	22	the	the	DET
ahs-14180	134	23	same	same	ADJ
ahs-14180	134	24	sampling	sampling	NOUN
ahs-14180	134	25	time	time	NOUN
ahs-14180	134	26	.	.	PUNCT
ahs-14180	135	1	red	red	ADJ
ahs-14180	135	2	asterisks	asterisk	NOUN
ahs-14180	135	3	indicate	indicate	VERB
ahs-14180	135	4	significant	significant	ADJ
ahs-14180	135	5	differences	difference	NOUN
ahs-14180	135	6	(	(	PUNCT
ahs-14180	135	7	anova	anova	PROPN
ahs-14180	135	8	,	,	PUNCT
ahs-14180	135	9	lsd	lsd	NOUN
ahs-14180	135	10	post­hoc	post­hoc	NOUN
ahs-14180	135	11	test	test	NOUN
ahs-14180	135	12	(	(	PUNCT
ahs-14180	135	13	p≤0.05	p≤0.05	NOUN
ahs-14180	135	14	)	)	PUNCT
ahs-14180	135	15	between	between	ADP
ahs-14180	135	16	0.8ox	0.8ox	ADJ
ahs-14180	135	17	samples	sample	NOUN
ahs-14180	135	18	at	at	ADP
ahs-14180	135	19	the	the	DET
ahs-14180	135	20	specific	specific	ADJ
ahs-14180	135	21	time	time	NOUN
ahs-14180	135	22	points	point	NOUN
ahs-14180	135	23	and	and	CCONJ
ahs-14180	135	24	0.8ox	0.8ox	NUM
ahs-14180	135	25	apples	apple	NOUN
ahs-14180	135	26	at	at	ADP
ahs-14180	135	27	1	1	NUM
ahs-14180	135	28	dia	dia	PROPN
ahs-14180	135	29	.	.	PROPN
ahs-14180	135	30	salamé	salamé	PROPN
ahs-14180	135	31	et	et	PROPN
ahs-14180	135	32	al	al	PROPN
ahs-14180	135	33	.	.	PROPN
ahs-14180	136	1	‐	‐	PROPN
ahs-14180	136	2	dca	dca	PROPN
ahs-14180	136	3	storage	storage	NOUN
ahs-14180	136	4	of	of	ADP
ahs-14180	136	5	red	red	PROPN
ahs-14180	136	6	delicious	delicious	PROPN
ahs-14180	136	7	apples	apple	NOUN
ahs-14180	136	8	95	95	NUM
ahs-14180	136	9	ethanol	ethanol	NOUN
ahs-14180	136	10	under	under	ADP
ahs-14180	136	11	low	low	ADJ
ahs-14180	136	12	oxygen	oxygen	NOUN
ahs-14180	136	13	levels	level	NOUN
ahs-14180	136	14	by	by	ADP
ahs-14180	136	15	the	the	DET
ahs-14180	136	16	enzyme	enzyme	NOUN
ahs-14180	136	17	coded	code	VERB
ahs-14180	136	18	by	by	ADP
ahs-14180	136	19	mdadh	mdadh	NOUN
ahs-14180	136	20	genes	gene	NOUN
ahs-14180	136	21	,	,	PUNCT
ahs-14180	136	22	and	and	CCONJ
ahs-14180	136	23	this	this	PRON
ahs-14180	136	24	is	be	AUX
ahs-14180	136	25	a	a	DET
ahs-14180	136	26	crucial	crucial	ADJ
ahs-14180	136	27	reaction	reaction	NOUN
ahs-14180	136	28	in	in	ADP
ahs-14180	136	29	apple	apple	NOUN
ahs-14180	136	30	tissue	tissue	NOUN
ahs-14180	136	31	under	under	ADP
ahs-14180	136	32	hypoxia	hypoxia	NOUN
ahs-14180	136	33	.	.	PUNCT
ahs-14180	137	1	compared	compare	VERB
ahs-14180	137	2	to	to	ADP
ahs-14180	137	3	t0	t0	PROPN
ahs-14180	137	4	sam­	sam­	NOUN
ahs-14180	137	5	ples	ple	NOUN
ahs-14180	137	6	,	,	PUNCT
ahs-14180	137	7	the	the	DET
ahs-14180	137	8	selected	select	VERB
ahs-14180	137	9	mdadh	mdadh	NOUN
ahs-14180	137	10	gene	gene	NOUN
ahs-14180	137	11	showed	show	VERB
ahs-14180	137	12	a	a	DET
ahs-14180	137	13	significant	significant	ADJ
ahs-14180	137	14	increase	increase	NOUN
ahs-14180	137	15	only	only	ADV
ahs-14180	137	16	at	at	ADP
ahs-14180	137	17	218	218	NUM
ahs-14180	137	18	dia	dia	PROPN
ahs-14180	137	19	in	in	ADP
ahs-14180	137	20	0.8ox	0.8ox	PROPN
ahs-14180	137	21	sample	sample	NOUN
ahs-14180	137	22	.	.	PUNCT
ahs-14180	138	1	the	the	DET
ahs-14180	138	2	applica­	applica­	PROPN
ahs-14180	138	3	tion	tion	NOUN
ahs-14180	138	4	of	of	ADP
ahs-14180	138	5	0.3	0.3	NUM
ahs-14180	138	6	%	%	NOUN
ahs-14180	138	7	oxygen	oxygen	NOUN
ahs-14180	138	8	resulted	result	VERB
ahs-14180	138	9	in	in	ADP
ahs-14180	138	10	general	general	ADJ
ahs-14180	138	11	higher	high	ADJ
ahs-14180	138	12	levels	level	NOUN
ahs-14180	138	13	of	of	ADP
ahs-14180	138	14	expression	expression	NOUN
ahs-14180	138	15	until	until	ADP
ahs-14180	138	16	31	31	NUM
ahs-14180	138	17	dia	dia	PROPN
ahs-14180	138	18	,	,	PUNCT
ahs-14180	138	19	significant	significant	ADJ
ahs-14180	138	20	at	at	ADP
ahs-14180	138	21	10	10	NUM
ahs-14180	138	22	and	and	CCONJ
ahs-14180	138	23	31	31	NUM
ahs-14180	138	24	dia	dia	PROPN
ahs-14180	138	25	.	.	PUNCT
ahs-14180	139	1	at	at	ADP
ahs-14180	139	2	110	110	NUM
ahs-14180	139	3	dia	dia	PROPN
ahs-14180	139	4	,	,	PUNCT
ahs-14180	139	5	a	a	DET
ahs-14180	139	6	significant	significant	ADJ
ahs-14180	139	7	decrease	decrease	NOUN
ahs-14180	139	8	in	in	ADP
ahs-14180	139	9	mdadh	mdadh	NOUN
ahs-14180	139	10	expression	expression	NOUN
ahs-14180	139	11	was	be	AUX
ahs-14180	139	12	recorded	record	VERB
ahs-14180	139	13	for	for	ADP
ahs-14180	139	14	0.3ox	0.3ox	PROPN
ahs-14180	139	15	apples	apple	NOUN
ahs-14180	139	16	as	as	ADV
ahs-14180	139	17	well	well	ADV
ahs-14180	139	18	as	as	ADP
ahs-14180	139	19	for	for	ADP
ahs-14180	139	20	all	all	DET
ahs-14180	139	21	shifted	shift	VERB
ahs-14180	139	22	samples	sample	NOUN
ahs-14180	139	23	.	.	PUNCT
ahs-14180	140	1	mdalaat	mdalaat	NOUN
ahs-14180	140	2	is	be	AUX
ahs-14180	140	3	involved	involve	VERB
ahs-14180	140	4	in	in	ADP
ahs-14180	140	5	the	the	DET
ahs-14180	140	6	reversible	reversible	ADJ
ahs-14180	140	7	transfer	transfer	NOUN
ahs-14180	140	8	of	of	ADP
ahs-14180	140	9	an	an	DET
ahs-14180	140	10	amino	amino	NOUN
ahs-14180	140	11	group	group	NOUN
ahs-14180	140	12	from	from	ADP
ahs-14180	140	13	glutamate	glutamate	NOUN
ahs-14180	140	14	to	to	PART
ahs-14180	140	15	pyruvate	pyruvate	VERB
ahs-14180	140	16	,	,	PUNCT
ahs-14180	140	17	which	which	PRON
ahs-14180	140	18	in	in	ADP
ahs-14180	140	19	turn	turn	NOUN
ahs-14180	140	20	forms	form	VERB
ahs-14180	140	21	2­oxoglutarate	2­oxoglutarate	NUM
ahs-14180	140	22	and	and	CCONJ
ahs-14180	140	23	alanine	alanine	NOUN
ahs-14180	140	24	.	.	PUNCT
ahs-14180	141	1	in	in	ADP
ahs-14180	141	2	0.8ox	0.8ox	NUM
ahs-14180	141	3	sam­	sam­	NOUN
ahs-14180	141	4	ples	ple	NOUN
ahs-14180	141	5	,	,	PUNCT
ahs-14180	141	6	this	this	DET
ahs-14180	141	7	gene	gene	NOUN
ahs-14180	141	8	showed	show	VERB
ahs-14180	141	9	a	a	DET
ahs-14180	141	10	peak	peak	NOUN
ahs-14180	141	11	of	of	ADP
ahs-14180	141	12	expression	expression	NOUN
ahs-14180	141	13	at	at	ADP
ahs-14180	141	14	110	110	NUM
ahs-14180	141	15	dia	dia	PROPN
ahs-14180	141	16	.	.	PUNCT
ahs-14180	142	1	the	the	DET
ahs-14180	142	2	expression	expression	NOUN
ahs-14180	142	3	in	in	ADP
ahs-14180	142	4	0.3ox	0.3ox	NUM
ahs-14180	142	5	samples	sample	NOUN
ahs-14180	142	6	is	be	AUX
ahs-14180	142	7	highly	highly	ADV
ahs-14180	142	8	induced	induce	VERB
ahs-14180	142	9	at	at	ADP
ahs-14180	142	10	10	10	NUM
ahs-14180	142	11	dia	dia	PROPN
ahs-14180	142	12	,	,	PUNCT
ahs-14180	142	13	while	while	SCONJ
ahs-14180	142	14	it	it	PRON
ahs-14180	142	15	strongly	strongly	ADV
ahs-14180	142	16	decreased	decrease	VERB
ahs-14180	142	17	at	at	ADP
ahs-14180	142	18	110	110	NUM
ahs-14180	142	19	dia	dia	PROPN
ahs-14180	142	20	,	,	PUNCT
ahs-14180	142	21	similarly	similarly	ADV
ahs-14180	142	22	to	to	PART
ahs-14180	142	23	sh2	sh2	VERB
ahs-14180	142	24	and	and	CCONJ
ahs-14180	142	25	sh3	sh3	PROPN
ahs-14180	142	26	.	.	PUNCT
ahs-14180	142	27	higher	high	ADJ
ahs-14180	142	28	expression	expression	NOUN
ahs-14180	142	29	of	of	ADP
ahs-14180	142	30	this	this	DET
ahs-14180	142	31	gene	gene	NOUN
ahs-14180	142	32	was	be	AUX
ahs-14180	142	33	detected	detect	VERB
ahs-14180	142	34	at	at	ADP
ahs-14180	142	35	218	218	NUM
ahs-14180	142	36	in	in	ADP
ahs-14180	142	37	sh4	sh4	PROPN
ahs-14180	142	38	sample	sample	NOUN
ahs-14180	142	39	(	(	PUNCT
ahs-14180	142	40	fig	fig	NOUN
ahs-14180	142	41	.	.	PUNCT
ahs-14180	143	1	4	4	NUM
ahs-14180	143	2	)	)	PUNCT
ahs-14180	143	3	.	.	PUNCT
ahs-14180	144	1	ethylene	ethylene	NOUN
ahs-14180	144	2	biosynthesis	biosynthesis	NOUN
ahs-14180	144	3	and	and	CCONJ
ahs-14180	144	4	erfs	erf	VERB
ahs-14180	144	5	gene	gene	NOUN
ahs-14180	144	6	expression	expression	NOUN
ahs-14180	144	7	the	the	DET
ahs-14180	144	8	expression	expression	NOUN
ahs-14180	144	9	of	of	ADP
ahs-14180	144	10	two	two	NUM
ahs-14180	144	11	genes	gene	NOUN
ahs-14180	144	12	involved	involve	VERB
ahs-14180	144	13	in	in	ADP
ahs-14180	144	14	ethylene	ethylene	NOUN
ahs-14180	144	15	biosynthesis	biosynthesis	NOUN
ahs-14180	144	16	,	,	PUNCT
ahs-14180	144	17	namely	namely	ADV
ahs-14180	144	18	mdacs	mdac	NOUN
ahs-14180	144	19	and	and	CCONJ
ahs-14180	144	20	mdaco	mdaco	NOUN
ahs-14180	144	21	,	,	PUNCT
ahs-14180	144	22	has	have	AUX
ahs-14180	144	23	been	be	AUX
ahs-14180	144	24	analysed	analyse	VERB
ahs-14180	144	25	(	(	PUNCT
ahs-14180	144	26	fig	fig	NOUN
ahs-14180	144	27	.	.	PUNCT
ahs-14180	145	1	5	5	NUM
ahs-14180	145	2	)	)	PUNCT
ahs-14180	145	3	.	.	PUNCT
ahs-14180	146	1	these	these	DET
ahs-14180	146	2	two	two	NUM
ahs-14180	146	3	genes	gene	NOUN
ahs-14180	146	4	appeared	appear	VERB
ahs-14180	146	5	to	to	PART
ahs-14180	146	6	be	be	AUX
ahs-14180	146	7	highly	highly	ADV
ahs-14180	146	8	affected	affect	VERB
ahs-14180	146	9	during	during	ADP
ahs-14180	146	10	storage	storage	NOUN
ahs-14180	146	11	under	under	ADP
ahs-14180	146	12	0.8	0.8	NUM
ahs-14180	146	13	%	%	NOUN
ahs-14180	146	14	oxygen	oxygen	NOUN
ahs-14180	146	15	concentration	concentration	NOUN
ahs-14180	146	16	.	.	PUNCT
ahs-14180	147	1	the	the	DET
ahs-14180	147	2	expression	expression	NOUN
ahs-14180	147	3	of	of	ADP
ahs-14180	147	4	both	both	DET
ahs-14180	147	5	genes	gene	NOUN
ahs-14180	147	6	increased	increase	VERB
ahs-14180	147	7	with	with	ADP
ahs-14180	147	8	time	time	NOUN
ahs-14180	147	9	,	,	PUNCT
ahs-14180	147	10	constantly	constantly	ADV
ahs-14180	147	11	for	for	ADP
ahs-14180	147	12	mdaco	mdaco	NOUN
ahs-14180	147	13	,	,	PUNCT
ahs-14180	147	14	which	which	PRON
ahs-14180	147	15	also	also	ADV
ahs-14180	147	16	reached	reach	VERB
ahs-14180	147	17	the	the	DET
ahs-14180	147	18	highest	high	ADJ
ahs-14180	147	19	recorded	record	VERB
ahs-14180	147	20	levels	level	NOUN
ahs-14180	147	21	of	of	ADP
ahs-14180	147	22	expres­	expres­	PROPN
ahs-14180	147	23	sion	sion	NOUN
ahs-14180	147	24	,	,	PUNCT
ahs-14180	147	25	while	while	SCONJ
ahs-14180	147	26	,	,	PUNCT
ahs-14180	147	27	in	in	ADP
ahs-14180	147	28	the	the	DET
ahs-14180	147	29	case	case	NOUN
ahs-14180	147	30	of	of	ADP
ahs-14180	147	31	mdacs	mdac	NOUN
ahs-14180	147	32	,	,	PUNCT
ahs-14180	147	33	a	a	DET
ahs-14180	147	34	peak	peak	NOUN
ahs-14180	147	35	at	at	ADP
ahs-14180	147	36	110	110	NUM
ahs-14180	147	37	dia	dia	PROPN
ahs-14180	147	38	was	be	AUX
ahs-14180	147	39	detected	detect	VERB
ahs-14180	147	40	.	.	PUNCT
ahs-14180	148	1	regarding	regard	VERB
ahs-14180	148	2	mdacs	mdacs	ADJ
ahs-14180	148	3	gene	gene	NOUN
ahs-14180	148	4	expression	expression	NOUN
ahs-14180	148	5	,	,	PUNCT
ahs-14180	148	6	0.3ox	0.3ox	NUM
ahs-14180	148	7	samples	sample	NOUN
ahs-14180	148	8	showed	show	VERB
ahs-14180	148	9	increased	increase	VERB
ahs-14180	148	10	values	value	NOUN
ahs-14180	148	11	(	(	PUNCT
ahs-14180	148	12	compared	compare	VERB
ahs-14180	148	13	to	to	ADP
ahs-14180	148	14	0.8ox	0.8ox	NUM
ahs-14180	148	15	)	)	PUNCT
ahs-14180	148	16	at	at	ADP
ahs-14180	148	17	10	10	NUM
ahs-14180	148	18	dia	dia	PROPN
ahs-14180	148	19	,	,	PUNCT
ahs-14180	148	20	but	but	CCONJ
ahs-14180	148	21	lower	low	ADJ
ahs-14180	148	22	levels	level	NOUN
ahs-14180	148	23	at	at	ADP
ahs-14180	148	24	20	20	NUM
ahs-14180	148	25	,	,	PUNCT
ahs-14180	148	26	31	31	NUM
ahs-14180	148	27	and	and	CCONJ
ahs-14180	148	28	110	110	NUM
ahs-14180	148	29	dia	dia	PROPN
ahs-14180	148	30	,	,	PUNCT
ahs-14180	148	31	when	when	SCONJ
ahs-14180	148	32	also	also	ADV
ahs-14180	148	33	sh2	sh2	VERB
ahs-14180	148	34	and	and	CCONJ
ahs-14180	148	35	3	3	NUM
ahs-14180	148	36	showed	show	VERB
ahs-14180	148	37	low	low	ADJ
ahs-14180	148	38	expression	expression	NOUN
ahs-14180	148	39	lev­	lev­	NOUN
ahs-14180	148	40	els	el	NOUN
ahs-14180	148	41	.	.	PUNCT
ahs-14180	149	1	mdaco	mdaco	PROPN
ahs-14180	149	2	gene	gene	NOUN
ahs-14180	149	3	revealed	reveal	VERB
ahs-14180	149	4	marked	mark	VERB
ahs-14180	149	5	higher	high	ADJ
ahs-14180	149	6	levels	level	NOUN
ahs-14180	149	7	in	in	ADP
ahs-14180	149	8	0.3	0.3	NUM
ahs-14180	149	9	ox	ox	NOUN
ahs-14180	149	10	samples	sample	NOUN
ahs-14180	149	11	at	at	ADP
ahs-14180	149	12	10	10	NUM
ahs-14180	149	13	dia	dia	PROPN
ahs-14180	149	14	and	and	CCONJ
ahs-14180	149	15	in	in	ADP
ahs-14180	149	16	sh1	sh1	ADJ
ahs-14180	149	17	samples	sample	NOUN
ahs-14180	149	18	at	at	ADP
ahs-14180	149	19	20	20	NUM
ahs-14180	149	20	,	,	PUNCT
ahs-14180	149	21	31	31	NUM
ahs-14180	149	22	,	,	PUNCT
ahs-14180	149	23	and	and	CCONJ
ahs-14180	150	1	110	110	NUM
ahs-14180	150	2	dia	dia	PROPN
ahs-14180	150	3	.	.	PUNCT
ahs-14180	151	1	lower	low	ADJ
ahs-14180	151	2	expression	expression	NOUN
ahs-14180	151	3	levels	level	NOUN
ahs-14180	151	4	were	be	AUX
ahs-14180	151	5	detected	detect	VERB
ahs-14180	151	6	in	in	ADP
ahs-14180	151	7	0.3ox	0.3ox	PROPN
ahs-14180	151	8	apples	apple	NOUN
ahs-14180	151	9	at	at	ADP
ahs-14180	151	10	20	20	NUM
ahs-14180	151	11	,	,	PUNCT
ahs-14180	151	12	31	31	NUM
ahs-14180	151	13	and	and	CCONJ
ahs-14180	151	14	110	110	NUM
ahs-14180	151	15	dia	dia	PROPN
ahs-14180	151	16	.	.	PROPN
ahs-14180	152	1	interestingly	interestingly	ADV
ahs-14180	152	2	,	,	PUNCT
ahs-14180	152	3	sh1	sh1	PROPN
ahs-14180	152	4	samples	sample	NOUN
ahs-14180	152	5	showed	show	VERB
ahs-14180	152	6	higher	high	ADJ
ahs-14180	152	7	levels	level	NOUN
ahs-14180	152	8	of	of	ADP
ahs-14180	152	9	expression	expression	NOUN
ahs-14180	152	10	,	,	PUNCT
ahs-14180	152	11	compared	compare	VERB
ahs-14180	152	12	to	to	ADP
ahs-14180	152	13	0.8ox	0.8ox	NUM
ahs-14180	152	14	,	,	PUNCT
ahs-14180	152	15	at	at	ADP
ahs-14180	152	16	20	20	NUM
ahs-14180	152	17	,	,	PUNCT
ahs-14180	152	18	31	31	NUM
ahs-14180	152	19	,	,	PUNCT
ahs-14180	152	20	and	and	CCONJ
ahs-14180	152	21	110	110	NUM
ahs-14180	152	22	dia	dia	PROPN
ahs-14180	152	23	.	.	PUNCT
ahs-14180	153	1	all	all	PRON
ahs-14180	153	2	shifted	shift	VERB
ahs-14180	153	3	samples	sample	NOUN
ahs-14180	153	4	had	have	VERB
ahs-14180	153	5	lower	low	ADJ
ahs-14180	153	6	expression	expression	NOUN
ahs-14180	153	7	level	level	NOUN
ahs-14180	153	8	than	than	ADP
ahs-14180	153	9	0.8ox	0.8ox	NUM
ahs-14180	153	10	apples	apple	NOUN
ahs-14180	153	11	at	at	ADP
ahs-14180	153	12	218	218	NUM
ahs-14180	153	13	dia	dia	PROPN
ahs-14180	153	14	.	.	PUNCT
ahs-14180	154	1	the	the	DET
ahs-14180	154	2	ethylene	ethylene	NOUN
ahs-14180	154	3	signalling	signalling	NOUN
ahs-14180	154	4	and	and	CCONJ
ahs-14180	154	5	response	response	NOUN
ahs-14180	154	6	pathway	pathway	NOUN
ahs-14180	154	7	includes	include	VERB
ahs-14180	154	8	ethylene	ethylene	NOUN
ahs-14180	154	9	response	response	NOUN
ahs-14180	154	10	factors	factor	NOUN
ahs-14180	154	11	(	(	PUNCT
ahs-14180	154	12	erfs	erfs	PROPN
ahs-14180	154	13	)	)	PUNCT
ahs-14180	154	14	,	,	PUNCT
ahs-14180	154	15	which	which	PRON
ahs-14180	154	16	belong	belong	VERB
ahs-14180	154	17	to	to	ADP
ahs-14180	154	18	the	the	DET
ahs-14180	154	19	transcription	transcription	NOUN
ahs-14180	154	20	factor	factor	NOUN
ahs-14180	154	21	family	family	NOUN
ahs-14180	154	22	apetala2	apetala2	PROPN
ahs-14180	154	23	/	/	SYM
ahs-14180	154	24	erf	erf	NOUN
ahs-14180	154	25	that	that	PRON
ahs-14180	154	26	plays	play	VERB
ahs-14180	154	27	important	important	ADJ
ahs-14180	154	28	roles	role	NOUN
ahs-14180	154	29	in	in	ADP
ahs-14180	154	30	stress­	stress­	PUNCT
ahs-14180	154	31	related	relate	VERB
ahs-14180	154	32	responses	response	NOUN
ahs-14180	154	33	.	.	PUNCT
ahs-14180	155	1	the	the	DET
ahs-14180	155	2	effect	effect	NOUN
ahs-14180	155	3	of	of	ADP
ahs-14180	155	4	the	the	DET
ahs-14180	155	5	different	different	ADJ
ahs-14180	155	6	applied	apply	VERB
ahs-14180	155	7	storage	storage	NOUN
ahs-14180	155	8	protocols	protocol	NOUN
ahs-14180	155	9	on	on	ADP
ahs-14180	155	10	the	the	DET
ahs-14180	155	11	expression	expression	NOUN
ahs-14180	155	12	level	level	NOUN
ahs-14180	155	13	of	of	ADP
ahs-14180	155	14	six	six	NUM
ahs-14180	155	15	erf	erf	NOUN
ahs-14180	155	16	genes	gene	NOUN
ahs-14180	155	17	has	have	AUX
ahs-14180	155	18	been	be	AUX
ahs-14180	155	19	investigated	investigate	VERB
ahs-14180	155	20	throughout	throughout	ADP
ahs-14180	155	21	the	the	DET
ahs-14180	155	22	experi­	experi­	NOUN
ahs-14180	155	23	ment	ment	NOUN
ahs-14180	155	24	(	(	PUNCT
ahs-14180	155	25	fig	fig	NOUN
ahs-14180	155	26	.	.	PUNCT
ahs-14180	156	1	6	6	NUM
ahs-14180	156	2	)	)	PUNCT
ahs-14180	156	3	.	.	PUNCT
ahs-14180	157	1	in	in	ADP
ahs-14180	157	2	general	general	ADJ
ahs-14180	157	3	,	,	PUNCT
ahs-14180	157	4	samples	sample	NOUN
ahs-14180	157	5	showed	show	VERB
ahs-14180	157	6	relatively	relatively	ADV
ahs-14180	157	7	similar	similar	ADJ
ahs-14180	157	8	responses	response	NOUN
ahs-14180	157	9	in	in	ADP
ahs-14180	157	10	terms	term	NOUN
ahs-14180	157	11	of	of	ADP
ahs-14180	157	12	erf	erf	NOUN
ahs-14180	157	13	expression	expression	NOUN
ahs-14180	157	14	.	.	PUNCT
ahs-14180	158	1	overall	overall	ADV
ahs-14180	158	2	,	,	PUNCT
ahs-14180	158	3	considering	consider	VERB
ahs-14180	158	4	0.8ox	0.8ox	SYM
ahs-14180	158	5	samples	sample	VERB
ahs-14180	158	6	a	a	DET
ahs-14180	158	7	general	general	ADJ
ahs-14180	158	8	increase	increase	NOUN
ahs-14180	158	9	of	of	ADP
ahs-14180	158	10	erf	erf	NOUN
ahs-14180	158	11	genes	gene	NOUN
ahs-14180	158	12	expression	expression	NOUN
ahs-14180	158	13	was	be	AUX
ahs-14180	158	14	observed	observe	VERB
ahs-14180	158	15	up	up	ADP
ahs-14180	158	16	to	to	ADP
ahs-14180	158	17	110	110	NUM
ahs-14180	158	18	dia	dia	PROPN
ahs-14180	158	19	,	,	PUNCT
ahs-14180	158	20	which	which	PRON
ahs-14180	158	21	was	be	AUX
ahs-14180	158	22	significant	significant	ADJ
ahs-14180	158	23	at	at	ADP
ahs-14180	158	24	different	different	ADJ
ahs-14180	158	25	time	time	NOUN
ahs-14180	158	26	points	point	NOUN
ahs-14180	158	27	for	for	ADP
ahs-14180	158	28	the	the	DET
ahs-14180	158	29	differ­	differ­	PROPN
ahs-14180	158	30	ent	ent	NOUN
ahs-14180	158	31	analysed	analyse	VERB
ahs-14180	158	32	erfs	erf	NOUN
ahs-14180	158	33	(	(	PUNCT
ahs-14180	158	34	md09g1174400	md09g1174400	NOUN
ahs-14180	158	35	gene	gene	NOUN
ahs-14180	158	36	at	at	ADP
ahs-14180	158	37	110	110	NUM
ahs-14180	158	38	dia	dia	PROPN
ahs-14180	158	39	;	;	PUNCT
ahs-14180	158	40	md13g1163300	md13g1163300	NOUN
ahs-14180	158	41	gene	gene	NOUN
ahs-14180	158	42	at	at	ADP
ahs-14180	158	43	10	10	NUM
ahs-14180	158	44	,	,	PUNCT
ahs-14180	158	45	20	20	NUM
ahs-14180	158	46	and	and	CCONJ
ahs-14180	158	47	31	31	NUM
ahs-14180	158	48	dia	dia	PROPN
ahs-14180	158	49	;	;	PUNCT
ahs-14180	158	50	md11g1306500	md11g1306500	NOUN
ahs-14180	158	51	gene	gene	NOUN
ahs-14180	158	52	at	at	ADP
ahs-14180	158	53	10	10	NUM
ahs-14180	158	54	,	,	PUNCT
ahs-14180	158	55	20	20	NUM
ahs-14180	158	56	and	and	CCONJ
ahs-14180	158	57	31	31	NUM
ahs-14180	158	58	dia	dia	PROPN
ahs-14180	158	59	;	;	PUNCT
ahs-14180	158	60	md16g1162900	md16g1162900	ADJ
ahs-14180	158	61	gene	gene	NOUN
ahs-14180	158	62	at	at	ADP
ahs-14180	158	63	10	10	NUM
ahs-14180	158	64	,	,	PUNCT
ahs-14180	158	65	31	31	NUM
ahs-14180	158	66	and	and	CCONJ
ahs-14180	158	67	110	110	NUM
ahs-14180	158	68	dia	dia	PROPN
ahs-14180	158	69	;	;	PUNCT
ahs-14180	158	70	md11g1306500	md11g1306500	ADJ
ahs-14180	158	71	variant	variant	ADJ
ahs-14180	158	72	gene	gene	NOUN
ahs-14180	158	73	at	at	ADP
ahs-14180	158	74	10	10	NUM
ahs-14180	158	75	,	,	PUNCT
ahs-14180	158	76	20	20	NUM
ahs-14180	158	77	and	and	CCONJ
ahs-14180	158	78	31	31	NUM
ahs-14180	158	79	dia	dia	PROPN
ahs-14180	158	80	;	;	PUNCT
ahs-14180	158	81	fig	fig	NOUN
ahs-14180	158	82	.	.	PUNCT
ahs-14180	159	1	5	5	NUM
ahs-14180	159	2	­	­	NUM
ahs-14180	159	3	relative	relative	ADJ
ahs-14180	159	4	expression	expression	NOUN
ahs-14180	159	5	of	of	ADP
ahs-14180	159	6	ethylene	ethylene	NOUN
ahs-14180	159	7	biosynthesis	biosynthesis	NOUN
ahs-14180	159	8	genes	gene	NOUN
ahs-14180	159	9	acc­synthase	acc­synthase	NOUN
ahs-14180	159	10	and	and	CCONJ
ahs-14180	159	11	acc­oxidase	acc­oxidase	NOUN
ahs-14180	159	12	.	.	PUNCT
ahs-14180	160	1	for	for	ADP
ahs-14180	160	2	samples	sample	NOUN
ahs-14180	160	3	0.3ox	0.3ox	NUM
ahs-14180	160	4	(	(	PUNCT
ahs-14180	160	5	blue	blue	ADJ
ahs-14180	160	6	)	)	PUNCT
ahs-14180	160	7	,	,	PUNCT
ahs-14180	160	8	sh1	sh1	PROPN
ahs-14180	160	9	(	(	PUNCT
ahs-14180	160	10	red	red	PROPN
ahs-14180	160	11	)	)	PUNCT
ahs-14180	160	12	,	,	PUNCT
ahs-14180	160	13	sh2	sh2	PROPN
ahs-14180	160	14	(	(	PUNCT
ahs-14180	160	15	orange	orange	PROPN
ahs-14180	160	16	)	)	PUNCT
ahs-14180	160	17	,	,	PUNCT
ahs-14180	160	18	sh3	sh3	PROPN
ahs-14180	160	19	(	(	PUNCT
ahs-14180	160	20	yellow	yellow	ADJ
ahs-14180	160	21	)	)	PUNCT
ahs-14180	160	22	and	and	CCONJ
ahs-14180	160	23	sh4	sh4	PROPN
ahs-14180	160	24	(	(	PUNCT
ahs-14180	160	25	light	light	NOUN
ahs-14180	160	26	blue	blue	NOUN
ahs-14180	160	27	)	)	PUNCT
ahs-14180	160	28	the	the	DET
ahs-14180	160	29	expression	expression	NOUN
ahs-14180	160	30	level	level	NOUN
ahs-14180	160	31	is	be	AUX
ahs-14180	160	32	reported	report	VERB
ahs-14180	160	33	from	from	ADP
ahs-14180	160	34	1	1	NUM
ahs-14180	160	35	to	to	PART
ahs-14180	160	36	218	218	NUM
ahs-14180	160	37	days	day	NOUN
ahs-14180	160	38	in	in	ADP
ahs-14180	160	39	atmosphere	atmosphere	NOUN
ahs-14180	160	40	(	(	PUNCT
ahs-14180	160	41	dia	dia	PROPN
ahs-14180	160	42	)	)	PUNCT
ahs-14180	160	43	as	as	SCONJ
ahs-14180	160	44	log2	log2	PROPN
ahs-14180	160	45	fc	fc	PROPN
ahs-14180	160	46	normalized	normalize	VERB
ahs-14180	160	47	on	on	ADP
ahs-14180	160	48	0.8ox	0.8ox	NUM
ahs-14180	160	49	expression	expression	NOUN
ahs-14180	160	50	level	level	NOUN
ahs-14180	160	51	at	at	ADP
ahs-14180	160	52	each	each	DET
ahs-14180	160	53	time	time	NOUN
ahs-14180	160	54	point	point	NOUN
ahs-14180	160	55	.	.	PUNCT
ahs-14180	161	1	the	the	DET
ahs-14180	161	2	red	red	ADJ
ahs-14180	161	3	line	line	NOUN
ahs-14180	161	4	represents	represent	VERB
ahs-14180	161	5	gene	gene	NOUN
ahs-14180	161	6	relative	relative	ADJ
ahs-14180	161	7	expression	expression	NOUN
ahs-14180	161	8	in	in	ADP
ahs-14180	161	9	0.8ox	0.8ox	NOUN
ahs-14180	161	10	samples	sample	NOUN
ahs-14180	161	11	.	.	PUNCT
ahs-14180	162	1	black	black	ADJ
ahs-14180	162	2	asterisks	asterisk	NOUN
ahs-14180	162	3	indicate	indicate	VERB
ahs-14180	162	4	significant	significant	ADJ
ahs-14180	162	5	differences	difference	NOUN
ahs-14180	162	6	(	(	PUNCT
ahs-14180	162	7	anova	anova	PROPN
ahs-14180	162	8	,	,	PUNCT
ahs-14180	162	9	lsd	lsd	NOUN
ahs-14180	162	10	post­hoc	post­hoc	NOUN
ahs-14180	162	11	test	test	NOUN
ahs-14180	162	12	(	(	PUNCT
ahs-14180	162	13	p≤0.05	p≤0.05	NOUN
ahs-14180	162	14	)	)	PUNCT
ahs-14180	162	15	comparing	compare	VERB
ahs-14180	162	16	each	each	DET
ahs-14180	162	17	sample	sample	NOUN
ahs-14180	162	18	to	to	ADP
ahs-14180	162	19	0.8ox	0.8ox	NOUN
ahs-14180	162	20	level	level	NOUN
ahs-14180	162	21	at	at	ADP
ahs-14180	162	22	the	the	DET
ahs-14180	162	23	same	same	ADJ
ahs-14180	162	24	sampling	sampling	NOUN
ahs-14180	162	25	time	time	NOUN
ahs-14180	162	26	.	.	PUNCT
ahs-14180	163	1	red	red	ADJ
ahs-14180	163	2	asterisks	asterisk	NOUN
ahs-14180	163	3	indicate	indicate	VERB
ahs-14180	163	4	significant	significant	ADJ
ahs-14180	163	5	differences	difference	NOUN
ahs-14180	163	6	(	(	PUNCT
ahs-14180	163	7	anova	anova	PROPN
ahs-14180	163	8	,	,	PUNCT
ahs-14180	163	9	lsd	lsd	PROPN
ahs-14180	163	10	post­hoc	post­hoc	NOUN
ahs-14180	163	11	test	test	NOUN
ahs-14180	163	12	(	(	PUNCT
ahs-14180	163	13	p≤	p≤	NOUN
ahs-14180	163	14	0.05	0.05	NUM
ahs-14180	163	15	)	)	PUNCT
ahs-14180	163	16	between	between	ADP
ahs-14180	163	17	0.8ox	0.8ox	ADJ
ahs-14180	163	18	samples	sample	NOUN
ahs-14180	163	19	at	at	ADP
ahs-14180	163	20	the	the	DET
ahs-14180	163	21	specific	specific	ADJ
ahs-14180	163	22	time	time	NOUN
ahs-14180	163	23	points	point	NOUN
ahs-14180	163	24	and	and	CCONJ
ahs-14180	163	25	0.8ox	0.8ox	NUM
ahs-14180	163	26	apples	apple	NOUN
ahs-14180	163	27	at	at	ADP
ahs-14180	163	28	1	1	NUM
ahs-14180	163	29	dia	dia	PROPN
ahs-14180	163	30	.	.	PUNCT
ahs-14180	164	1	adv	adv	PROPN
ahs-14180	164	2	.	.	PUNCT
ahs-14180	164	3	hort	hort	PROPN
ahs-14180	164	4	.	.	PUNCT
ahs-14180	165	1	sci	sci	PROPN
ahs-14180	165	2	.	.	PROPN
ahs-14180	165	3	,	,	PUNCT
ahs-14180	165	4	2023	2023	NUM
ahs-14180	165	5	37(1	37(1	NUM
ahs-14180	165	6	):	):	PUNCT
ahs-14180	165	7	89­99	89­99	NUM
ahs-14180	165	8	96	96	NUM
ahs-14180	165	9	md17g1152400	md17g1152400	NOUN
ahs-14180	165	10	gene	gene	NOUN
ahs-14180	165	11	at	at	ADP
ahs-14180	165	12	10	10	NUM
ahs-14180	165	13	and	and	CCONJ
ahs-14180	165	14	110	110	NUM
ahs-14180	165	15	dia	dia	PROPN
ahs-14180	165	16	)	)	PUNCT
ahs-14180	165	17	.	.	PUNCT
ahs-14180	166	1	the	the	DET
ahs-14180	166	2	expression	expression	NOUN
ahs-14180	166	3	of	of	ADP
ahs-14180	166	4	erf	erf	NOUN
ahs-14180	166	5	genes	gene	NOUN
ahs-14180	166	6	in	in	ADP
ahs-14180	166	7	0.3ox	0.3ox	NUM
ahs-14180	166	8	samples	sample	NOUN
ahs-14180	166	9	was	be	AUX
ahs-14180	166	10	instead	instead	ADV
ahs-14180	166	11	characterized	characterize	VERB
ahs-14180	166	12	by	by	ADP
ahs-14180	166	13	significant	significant	ADJ
ahs-14180	166	14	lower	low	ADJ
ahs-14180	166	15	levels	level	NOUN
ahs-14180	166	16	at	at	ADP
ahs-14180	166	17	the	the	DET
ahs-14180	166	18	different	different	ADJ
ahs-14180	166	19	time	time	NOUN
ahs-14180	166	20	points	point	VERB
ahs-14180	166	21	with	with	ADP
ahs-14180	166	22	only	only	ADV
ahs-14180	166	23	two	two	NUM
ahs-14180	166	24	exceptions	exception	NOUN
ahs-14180	166	25	:	:	PUNCT
ahs-14180	166	26	md09g1174400	md09g1174400	NOUN
ahs-14180	166	27	gene	gene	NOUN
ahs-14180	166	28	at	at	ADP
ahs-14180	166	29	10	10	NUM
ahs-14180	166	30	dia	dia	PROPN
ahs-14180	166	31	and	and	CCONJ
ahs-14180	166	32	md11g1306500	md11g1306500	PROPN
ahs-14180	166	33	gene	gene	NOUN
ahs-14180	166	34	at	at	ADP
ahs-14180	166	35	20	20	NUM
ahs-14180	166	36	dia	dia	PROPN
ahs-14180	166	37	,	,	PUNCT
ahs-14180	166	38	when	when	SCONJ
ahs-14180	166	39	significantly	significantly	ADV
ahs-14180	166	40	higher	high	ADJ
ahs-14180	166	41	levels	level	NOUN
ahs-14180	166	42	of	of	ADP
ahs-14180	166	43	expression	expression	NOUN
ahs-14180	166	44	than	than	SCONJ
ahs-14180	166	45	those	those	PRON
ahs-14180	166	46	of	of	ADP
ahs-14180	166	47	0.8ox	0.8ox	NOUN
ahs-14180	166	48	apples	apple	NOUN
ahs-14180	166	49	were	be	AUX
ahs-14180	166	50	recorded	record	VERB
ahs-14180	166	51	.	.	PUNCT
ahs-14180	167	1	on	on	ADP
ahs-14180	167	2	the	the	DET
ahs-14180	167	3	other	other	ADJ
ahs-14180	167	4	hand	hand	NOUN
ahs-14180	167	5	,	,	PUNCT
ahs-14180	167	6	considering	consider	VERB
ahs-14180	167	7	apples	apple	NOUN
ahs-14180	167	8	subjected	subject	VERB
ahs-14180	167	9	to	to	ADP
ahs-14180	167	10	partial	partial	ADJ
ahs-14180	167	11	re­oxygenation	re­oxygenation	NOUN
ahs-14180	167	12	samplings	sampling	NOUN
ahs-14180	167	13	,	,	PUNCT
ahs-14180	167	14	lower	low	ADJ
ahs-14180	167	15	levels	level	NOUN
ahs-14180	167	16	of	of	ADP
ahs-14180	167	17	expression	expression	NOUN
ahs-14180	167	18	were	be	AUX
ahs-14180	167	19	generally	generally	ADV
ahs-14180	167	20	detected	detect	VERB
ahs-14180	167	21	up	up	ADP
ahs-14180	167	22	to	to	PART
ahs-14180	167	23	31	31	NUM
ahs-14180	167	24	dia	dia	PROPN
ahs-14180	167	25	,	,	PUNCT
ahs-14180	167	26	with	with	ADP
ahs-14180	167	27	only	only	ADV
ahs-14180	167	28	two	two	NUM
ahs-14180	167	29	exceptions	exception	NOUN
ahs-14180	167	30	(	(	PUNCT
ahs-14180	167	31	md11g1306500	md11g1306500	NOUN
ahs-14180	167	32	and	and	CCONJ
ahs-14180	167	33	md16g1162900	md16g1162900	NOUN
ahs-14180	167	34	)	)	PUNCT
ahs-14180	167	35	concerning	concern	VERB
ahs-14180	167	36	sh2	sh2	NOUN
ahs-14180	167	37	samples	sample	NOUN
ahs-14180	167	38	at	at	ADP
ahs-14180	167	39	31	31	NUM
ahs-14180	167	40	dia	dia	PROPN
ahs-14180	167	41	,	,	PUNCT
ahs-14180	167	42	when	when	SCONJ
ahs-14180	167	43	a	a	DET
ahs-14180	167	44	significantly	significantly	ADV
ahs-14180	167	45	higher	high	ADJ
ahs-14180	167	46	level	level	NOUN
ahs-14180	167	47	of	of	ADP
ahs-14180	167	48	expression	expression	NOUN
ahs-14180	167	49	was	be	AUX
ahs-14180	167	50	observed	observe	VERB
ahs-14180	167	51	.	.	PUNCT
ahs-14180	168	1	after	after	ADP
ahs-14180	168	2	110	110	NUM
ahs-14180	168	3	dia	dia	PROPN
ahs-14180	168	4	,	,	PUNCT
ahs-14180	168	5	the	the	DET
ahs-14180	168	6	different	different	ADJ
ahs-14180	168	7	samples	sample	NOUN
ahs-14180	168	8	revealed	reveal	VERB
ahs-14180	168	9	vari­	vari­	NOUN
ahs-14180	168	10	able	able	ADJ
ahs-14180	168	11	patterns	pattern	NOUN
ahs-14180	168	12	.	.	PUNCT
ahs-14180	169	1	concerning	concern	VERB
ahs-14180	169	2	md09g1174400	md09g1174400	NOUN
ahs-14180	169	3	and	and	CCONJ
ahs-14180	169	4	md13g1163300	md13g1163300	PROPN
ahs-14180	169	5	genes	gene	NOUN
ahs-14180	169	6	,	,	PUNCT
ahs-14180	169	7	sh1	sh1	PROPN
ahs-14180	169	8	and	and	CCONJ
ahs-14180	169	9	sh3	sh3	PROPN
ahs-14180	169	10	showed	show	VERB
ahs-14180	169	11	signifi­	signifi­	PRON
ahs-14180	169	12	cantly	cantly	ADV
ahs-14180	169	13	lower	low	ADJ
ahs-14180	169	14	levels	level	NOUN
ahs-14180	169	15	of	of	ADP
ahs-14180	169	16	expression	expression	NOUN
ahs-14180	169	17	,	,	PUNCT
ahs-14180	169	18	while	while	SCONJ
ahs-14180	169	19	sh2	sh2	PROPN
ahs-14180	169	20	had	have	AUX
ahs-14180	169	21	sig­	sig­	VERB
ahs-14180	169	22	nificantly	nificantly	ADV
ahs-14180	169	23	higher	high	ADJ
ahs-14180	169	24	levels	level	NOUN
ahs-14180	169	25	.	.	PUNCT
ahs-14180	170	1	for	for	ADP
ahs-14180	170	2	these	these	DET
ahs-14180	170	3	two	two	NUM
ahs-14180	170	4	genes	gene	NOUN
ahs-14180	170	5	at	at	ADP
ahs-14180	170	6	218	218	NUM
ahs-14180	170	7	dia	dia	PROPN
ahs-14180	170	8	only	only	ADV
ahs-14180	170	9	sh2	sh2	PROPN
ahs-14180	170	10	revealed	reveal	VERB
ahs-14180	170	11	significantly	significantly	ADV
ahs-14180	170	12	higher	high	ADJ
ahs-14180	170	13	levels	level	NOUN
ahs-14180	170	14	of	of	ADP
ahs-14180	170	15	expression	expression	NOUN
ahs-14180	170	16	compared	compare	VERB
ahs-14180	170	17	to	to	ADP
ahs-14180	170	18	0.8ox	0.8ox	NUM
ahs-14180	170	19	samples	sample	NOUN
ahs-14180	170	20	,	,	PUNCT
ahs-14180	170	21	despite	despite	SCONJ
ahs-14180	170	22	a	a	DET
ahs-14180	170	23	general	general	ADJ
ahs-14180	170	24	increasing	increase	VERB
ahs-14180	170	25	trend	trend	NOUN
ahs-14180	170	26	in	in	ADP
ahs-14180	170	27	all	all	DET
ahs-14180	170	28	apples	apple	NOUN
ahs-14180	170	29	subjected	subject	VERB
ahs-14180	170	30	to	to	ADP
ahs-14180	170	31	partial	partial	ADJ
ahs-14180	170	32	re­oxygenation	re­oxygenation	NOUN
ahs-14180	170	33	.	.	PUNCT
ahs-14180	171	1	as	as	ADV
ahs-14180	171	2	far	far	ADV
ahs-14180	171	3	as	as	SCONJ
ahs-14180	171	4	the	the	DET
ahs-14180	171	5	md11g1306500	md11g1306500	PROPN
ahs-14180	171	6	gene	gene	NOUN
ahs-14180	171	7	is	be	AUX
ahs-14180	171	8	concerned	concern	VERB
ahs-14180	171	9	,	,	PUNCT
ahs-14180	171	10	significant	significant	ADJ
ahs-14180	171	11	higher	high	ADJ
ahs-14180	171	12	expression	expression	NOUN
ahs-14180	171	13	was	be	AUX
ahs-14180	171	14	detected	detect	VERB
ahs-14180	171	15	for	for	ADP
ahs-14180	171	16	both	both	CCONJ
ahs-14180	171	17	sh1	sh1	PROPN
ahs-14180	171	18	and	and	CCONJ
ahs-14180	171	19	sh2	sh2	VERB
ahs-14180	171	20	at	at	ADP
ahs-14180	171	21	110	110	NUM
ahs-14180	171	22	dia	dia	PROPN
ahs-14180	171	23	,	,	PUNCT
ahs-14180	171	24	while	while	SCONJ
ahs-14180	171	25	only	only	ADV
ahs-14180	171	26	sh3	sh3	PROPN
ahs-14180	171	27	had	have	VERB
ahs-14180	171	28	signifi­	signifi­	NUM
ahs-14180	171	29	cantly	cantly	ADV
ahs-14180	171	30	higher	high	ADJ
ahs-14180	171	31	levels	level	NOUN
ahs-14180	171	32	at	at	ADP
ahs-14180	171	33	218	218	NUM
ahs-14180	171	34	dia	dia	PROPN
ahs-14180	171	35	.	.	PUNCT
ahs-14180	172	1	md16g1162900	md16g1162900	ADJ
ahs-14180	172	2	gene	gene	NOUN
ahs-14180	172	3	expression	expression	NOUN
ahs-14180	172	4	in	in	ADP
ahs-14180	172	5	shifted	shift	VERB
ahs-14180	172	6	samples	sample	NOUN
ahs-14180	172	7	revealed	reveal	VERB
ahs-14180	172	8	significant	significant	ADJ
ahs-14180	172	9	lower	low	ADJ
ahs-14180	172	10	levels	level	NOUN
ahs-14180	172	11	at	at	ADP
ahs-14180	172	12	110	110	NUM
ahs-14180	172	13	dia	dia	PROPN
ahs-14180	172	14	,	,	PUNCT
ahs-14180	172	15	while	while	SCONJ
ahs-14180	172	16	only	only	ADV
ahs-14180	172	17	sh4	sh4	PROPN
ahs-14180	172	18	had	have	VERB
ahs-14180	172	19	signifi­	signifi­	NUM
ahs-14180	172	20	cantly	cantly	ADV
ahs-14180	172	21	higher	high	ADJ
ahs-14180	172	22	levels	level	NOUN
ahs-14180	172	23	at	at	ADP
ahs-14180	172	24	218	218	NUM
ahs-14180	172	25	dia	dia	PROPN
ahs-14180	172	26	.	.	PUNCT
ahs-14180	173	1	in	in	ADP
ahs-14180	173	2	the	the	DET
ahs-14180	173	3	case	case	NOUN
ahs-14180	173	4	of	of	ADP
ahs-14180	173	5	md11g1306500	md11g1306500	ADJ
ahs-14180	173	6	variant	variant	ADJ
ahs-14180	173	7	gene	gene	NOUN
ahs-14180	173	8	sh1	sh1	NOUN
ahs-14180	173	9	and	and	CCONJ
ahs-14180	173	10	sh2	sh2	PROPN
ahs-14180	173	11	had	have	VERB
ahs-14180	173	12	higher	high	ADJ
ahs-14180	173	13	expression	expression	NOUN
ahs-14180	173	14	levels	level	NOUN
ahs-14180	173	15	at	at	ADP
ahs-14180	173	16	110	110	NUM
ahs-14180	173	17	dia	dia	PROPN
ahs-14180	173	18	,	,	PUNCT
ahs-14180	173	19	while	while	SCONJ
ahs-14180	173	20	only	only	ADV
ahs-14180	173	21	sh2	sh2	PROPN
ahs-14180	173	22	and	and	CCONJ
ahs-14180	173	23	sh4	sh4	NOUN
ahs-14180	173	24	showed	show	VERB
ahs-14180	173	25	significantly	significantly	ADV
ahs-14180	173	26	higher	high	ADJ
ahs-14180	173	27	levels	level	NOUN
ahs-14180	173	28	at	at	ADP
ahs-14180	173	29	218	218	NUM
ahs-14180	173	30	dia	dia	PROPN
ahs-14180	173	31	.	.	PUNCT
ahs-14180	174	1	lastly	lastly	ADV
ahs-14180	174	2	,	,	PUNCT
ahs-14180	174	3	md17g1152400	md17g1152400	NOUN
ahs-14180	174	4	gene	gene	NOUN
ahs-14180	174	5	had	have	VERB
ahs-14180	174	6	a	a	DET
ahs-14180	174	7	significantly	significantly	ADV
ahs-14180	174	8	high­	high­	NOUN
ahs-14180	174	9	er	er	INTJ
ahs-14180	174	10	level	level	NOUN
ahs-14180	174	11	of	of	ADP
ahs-14180	174	12	expression	expression	NOUN
ahs-14180	174	13	in	in	ADP
ahs-14180	174	14	samples	sample	NOUN
ahs-14180	174	15	of	of	ADP
ahs-14180	174	16	sh1	sh1	PROPN
ahs-14180	174	17	and	and	CCONJ
ahs-14180	174	18	sh2	sh2	VERB
ahs-14180	174	19	at	at	ADP
ahs-14180	174	20	110	110	NUM
ahs-14180	174	21	dia	dia	PROPN
ahs-14180	174	22	,	,	PUNCT
ahs-14180	174	23	while	while	SCONJ
ahs-14180	174	24	sh3	sh3	PROPN
ahs-14180	174	25	apples	apple	NOUN
ahs-14180	174	26	had	have	VERB
ahs-14180	174	27	significantly	significantly	ADV
ahs-14180	174	28	lower	low	ADJ
ahs-14180	174	29	fig	fig	NOUN
ahs-14180	174	30	.	.	PUNCT
ahs-14180	175	1	6	6	NUM
ahs-14180	175	2	­	­	NUM
ahs-14180	175	3	relative	relative	ADJ
ahs-14180	175	4	expression	expression	NOUN
ahs-14180	175	5	of	of	ADP
ahs-14180	175	6	genes	gene	NOUN
ahs-14180	175	7	belonging	belong	VERB
ahs-14180	175	8	to	to	ADP
ahs-14180	175	9	ethylene	ethylene	NOUN
ahs-14180	175	10	response	response	NOUN
ahs-14180	175	11	factor	factor	NOUN
ahs-14180	175	12	(	(	PUNCT
ahs-14180	175	13	erf	erf	NOUN
ahs-14180	175	14	)	)	PUNCT
ahs-14180	175	15	gene	gene	NOUN
ahs-14180	175	16	family	family	NOUN
ahs-14180	175	17	.	.	PUNCT
ahs-14180	176	1	for	for	ADP
ahs-14180	176	2	samples	sample	NOUN
ahs-14180	176	3	0.3ox	0.3ox	NUM
ahs-14180	176	4	(	(	PUNCT
ahs-14180	176	5	blue	blue	ADJ
ahs-14180	176	6	)	)	PUNCT
ahs-14180	176	7	,	,	PUNCT
ahs-14180	176	8	sh1	sh1	PROPN
ahs-14180	176	9	(	(	PUNCT
ahs-14180	176	10	red	red	PROPN
ahs-14180	176	11	)	)	PUNCT
ahs-14180	176	12	,	,	PUNCT
ahs-14180	176	13	sh2	sh2	PROPN
ahs-14180	176	14	(	(	PUNCT
ahs-14180	176	15	orange	orange	PROPN
ahs-14180	176	16	)	)	PUNCT
ahs-14180	176	17	,	,	PUNCT
ahs-14180	176	18	sh3	sh3	PROPN
ahs-14180	176	19	(	(	PUNCT
ahs-14180	176	20	yellow	yellow	ADJ
ahs-14180	176	21	)	)	PUNCT
ahs-14180	176	22	and	and	CCONJ
ahs-14180	176	23	sh4	sh4	PROPN
ahs-14180	176	24	(	(	PUNCT
ahs-14180	176	25	light	light	NOUN
ahs-14180	176	26	blue	blue	NOUN
ahs-14180	176	27	)	)	PUNCT
ahs-14180	176	28	the	the	DET
ahs-14180	176	29	expression	expression	NOUN
ahs-14180	176	30	level	level	NOUN
ahs-14180	176	31	is	be	AUX
ahs-14180	176	32	reported	report	VERB
ahs-14180	176	33	from	from	ADP
ahs-14180	176	34	1	1	NUM
ahs-14180	176	35	to	to	PART
ahs-14180	176	36	218	218	NUM
ahs-14180	176	37	days	day	NOUN
ahs-14180	176	38	in	in	ADP
ahs-14180	176	39	atmosphere	atmosphere	NOUN
ahs-14180	176	40	(	(	PUNCT
ahs-14180	176	41	dia	dia	PROPN
ahs-14180	176	42	)	)	PUNCT
ahs-14180	176	43	as	as	SCONJ
ahs-14180	176	44	log2	log2	PROPN
ahs-14180	176	45	fc	fc	PROPN
ahs-14180	176	46	normalized	normalize	VERB
ahs-14180	176	47	on	on	ADP
ahs-14180	176	48	0.8ox	0.8ox	NUM
ahs-14180	176	49	expression	expression	NOUN
ahs-14180	176	50	level	level	NOUN
ahs-14180	176	51	at	at	ADP
ahs-14180	176	52	each	each	DET
ahs-14180	176	53	time	time	NOUN
ahs-14180	176	54	point	point	NOUN
ahs-14180	176	55	.	.	PUNCT
ahs-14180	177	1	the	the	DET
ahs-14180	177	2	red	red	ADJ
ahs-14180	177	3	line	line	NOUN
ahs-14180	177	4	represents	represent	VERB
ahs-14180	177	5	gene	gene	NOUN
ahs-14180	177	6	relative	relative	ADJ
ahs-14180	177	7	expression	expression	NOUN
ahs-14180	177	8	in	in	ADP
ahs-14180	177	9	0.8ox	0.8ox	NOUN
ahs-14180	177	10	samples	sample	NOUN
ahs-14180	177	11	.	.	PUNCT
ahs-14180	178	1	black	black	ADJ
ahs-14180	178	2	asterisks	asterisk	NOUN
ahs-14180	178	3	indicate	indicate	VERB
ahs-14180	178	4	significant	significant	ADJ
ahs-14180	178	5	differences	difference	NOUN
ahs-14180	178	6	(	(	PUNCT
ahs-14180	178	7	anova	anova	PROPN
ahs-14180	178	8	,	,	PUNCT
ahs-14180	178	9	lsd	lsd	NOUN
ahs-14180	178	10	post­hoc	post­hoc	NOUN
ahs-14180	178	11	test	test	NOUN
ahs-14180	178	12	(	(	PUNCT
ahs-14180	178	13	p≤0.05	p≤0.05	NOUN
ahs-14180	178	14	)	)	PUNCT
ahs-14180	178	15	comparing	compare	VERB
ahs-14180	178	16	each	each	DET
ahs-14180	178	17	sample	sample	NOUN
ahs-14180	178	18	to	to	ADP
ahs-14180	178	19	0.8%ox	0.8%ox	PROPN
ahs-14180	178	20	level	level	NOUN
ahs-14180	178	21	at	at	ADP
ahs-14180	178	22	the	the	DET
ahs-14180	178	23	same	same	ADJ
ahs-14180	178	24	sampling	sampling	NOUN
ahs-14180	178	25	time	time	NOUN
ahs-14180	178	26	.	.	PUNCT
ahs-14180	179	1	red	red	ADJ
ahs-14180	179	2	asterisks	asterisk	NOUN
ahs-14180	179	3	indicate	indicate	VERB
ahs-14180	179	4	significant	significant	ADJ
ahs-14180	179	5	differences	difference	NOUN
ahs-14180	179	6	(	(	PUNCT
ahs-14180	179	7	anova	anova	PROPN
ahs-14180	179	8	,	,	PUNCT
ahs-14180	179	9	lsd	lsd	NOUN
ahs-14180	179	10	post­hoc	post­hoc	NOUN
ahs-14180	179	11	test	test	NOUN
ahs-14180	179	12	(	(	PUNCT
ahs-14180	179	13	p≤0.05	p≤0.05	NOUN
ahs-14180	179	14	)	)	PUNCT
ahs-14180	179	15	between	between	ADP
ahs-14180	179	16	0.8ox	0.8ox	ADJ
ahs-14180	179	17	samples	sample	NOUN
ahs-14180	179	18	at	at	ADP
ahs-14180	179	19	the	the	DET
ahs-14180	179	20	specific	specific	ADJ
ahs-14180	179	21	time	time	NOUN
ahs-14180	179	22	points	point	NOUN
ahs-14180	179	23	and	and	CCONJ
ahs-14180	179	24	0.8ox	0.8ox	NUM
ahs-14180	179	25	apples	apple	NOUN
ahs-14180	179	26	at	at	ADP
ahs-14180	179	27	1	1	NUM
ahs-14180	179	28	dia	dia	PROPN
ahs-14180	179	29	.	.	PROPN
ahs-14180	179	30	salamé	salamé	PROPN
ahs-14180	179	31	et	et	PROPN
ahs-14180	179	32	al	al	PROPN
ahs-14180	179	33	.	.	PROPN
ahs-14180	180	1	‐	‐	PROPN
ahs-14180	180	2	dca	dca	PROPN
ahs-14180	180	3	storage	storage	NOUN
ahs-14180	180	4	of	of	ADP
ahs-14180	180	5	red	red	PROPN
ahs-14180	180	6	delicious	delicious	PROPN
ahs-14180	180	7	apples	apple	NOUN
ahs-14180	180	8	97	97	NUM
ahs-14180	180	9	expression	expression	NOUN
ahs-14180	180	10	for	for	ADP
ahs-14180	180	11	this	this	DET
ahs-14180	180	12	gene	gene	NOUN
ahs-14180	180	13	.	.	PUNCT
ahs-14180	181	1	on	on	ADP
ahs-14180	181	2	the	the	DET
ahs-14180	181	3	other	other	ADJ
ahs-14180	181	4	hand	hand	NOUN
ahs-14180	181	5	,	,	PUNCT
ahs-14180	181	6	all	all	DET
ahs-14180	181	7	shift­	shift­	NOUN
ahs-14180	181	8	ed	ed	NOUN
ahs-14180	181	9	samples	sample	NOUN
ahs-14180	181	10	showed	show	VERB
ahs-14180	181	11	significantly	significantly	ADV
ahs-14180	181	12	higher	high	ADJ
ahs-14180	181	13	expression	expression	NOUN
ahs-14180	181	14	of	of	ADP
ahs-14180	181	15	this	this	DET
ahs-14180	181	16	gene	gene	NOUN
ahs-14180	181	17	at	at	ADP
ahs-14180	181	18	218	218	NUM
ahs-14180	181	19	dia	dia	PROPN
ahs-14180	181	20	compared	compare	VERB
ahs-14180	181	21	to	to	ADP
ahs-14180	181	22	0.8ox	0.8ox	NUM
ahs-14180	181	23	apples	apple	NOUN
ahs-14180	181	24	.	.	PUNCT
ahs-14180	182	1	a	a	DET
ahs-14180	182	2	general	general	ADJ
ahs-14180	182	3	trend	trend	NOUN
ahs-14180	182	4	was	be	AUX
ahs-14180	182	5	identified	identify	VERB
ahs-14180	182	6	for	for	ADP
ahs-14180	182	7	all	all	DET
ahs-14180	182	8	samples	sample	NOUN
ahs-14180	182	9	subjected	subject	VERB
ahs-14180	182	10	to	to	ADP
ahs-14180	182	11	partial	partial	ADJ
ahs-14180	182	12	re­oxygenation	re­oxygenation	NOUN
ahs-14180	182	13	:	:	PUNCT
ahs-14180	182	14	in	in	ADP
ahs-14180	182	15	general	general	ADJ
ahs-14180	182	16	the	the	DET
ahs-14180	182	17	expression	expression	NOUN
ahs-14180	182	18	level	level	NOUN
ahs-14180	182	19	of	of	ADP
ahs-14180	182	20	the	the	DET
ahs-14180	182	21	erf	erf	NOUN
ahs-14180	182	22	gene	gene	NOUN
ahs-14180	182	23	was	be	AUX
ahs-14180	182	24	induced	induce	VERB
ahs-14180	182	25	at	at	ADP
ahs-14180	182	26	218	218	NUM
ahs-14180	182	27	dia	dia	PROPN
ahs-14180	182	28	.	.	PROPN
ahs-14180	183	1	4	4	NUM
ahs-14180	183	2	.	.	X
ahs-14180	183	3	discussion	discussion	NOUN
ahs-14180	183	4	and	and	CCONJ
ahs-14180	183	5	conclusions	conclusion	NOUN
ahs-14180	183	6	an	an	DET
ahs-14180	183	7	in­depth	in­depth	X
ahs-14180	183	8	understanding	understanding	NOUN
ahs-14180	183	9	of	of	ADP
ahs-14180	183	10	low	low	ADJ
ahs-14180	183	11	oxygen	oxygen	NOUN
ahs-14180	183	12	responses	response	NOUN
ahs-14180	183	13	in	in	ADP
ahs-14180	183	14	fruits	fruit	NOUN
ahs-14180	183	15	is	be	AUX
ahs-14180	183	16	of	of	ADP
ahs-14180	183	17	fundamental	fundamental	ADJ
ahs-14180	183	18	importance	importance	NOUN
ahs-14180	183	19	for	for	ADP
ahs-14180	183	20	the	the	DET
ahs-14180	183	21	optimisation	optimisation	NOUN
ahs-14180	183	22	of	of	ADP
ahs-14180	183	23	storage	storage	NOUN
ahs-14180	183	24	approaches	approach	NOUN
ahs-14180	183	25	and	and	CCONJ
ahs-14180	183	26	for	for	ADP
ahs-14180	183	27	the	the	DET
ahs-14180	183	28	development	development	NOUN
ahs-14180	183	29	of	of	ADP
ahs-14180	183	30	protocols	protocol	NOUN
ahs-14180	183	31	aimed	aim	VERB
ahs-14180	183	32	at	at	ADP
ahs-14180	183	33	maintaining	maintain	VERB
ahs-14180	183	34	opti­	opti­	PRON
ahs-14180	183	35	mal	mal	ADJ
ahs-14180	183	36	quality	quality	NOUN
ahs-14180	183	37	while	while	SCONJ
ahs-14180	183	38	preventing	prevent	VERB
ahs-14180	183	39	the	the	DET
ahs-14180	183	40	occurrence	occurrence	NOUN
ahs-14180	183	41	of	of	ADP
ahs-14180	183	42	physi­	physi­	PROPN
ahs-14180	183	43	ological	ological	ADJ
ahs-14180	183	44	disorders	disorder	NOUN
ahs-14180	183	45	associated	associate	VERB
ahs-14180	183	46	with	with	ADP
ahs-14180	183	47	long	long	ADJ
ahs-14180	183	48	term	term	NOUN
ahs-14180	183	49	storage	storage	NOUN
ahs-14180	183	50	.	.	PUNCT
ahs-14180	184	1	metabolic	metabolic	NOUN
ahs-14180	184	2	adaptation	adaptation	NOUN
ahs-14180	184	3	responses	response	NOUN
ahs-14180	184	4	to	to	ADP
ahs-14180	184	5	hypoxic	hypoxic	ADJ
ahs-14180	184	6	condi­	condi­	NOUN
ahs-14180	184	7	tions	tion	NOUN
ahs-14180	184	8	have	have	AUX
ahs-14180	184	9	only	only	ADV
ahs-14180	184	10	recently	recently	ADV
ahs-14180	184	11	started	start	VERB
ahs-14180	184	12	to	to	PART
ahs-14180	184	13	be	be	AUX
ahs-14180	184	14	clarified	clarify	VERB
ahs-14180	184	15	in	in	ADP
ahs-14180	184	16	apple	apple	NOUN
ahs-14180	184	17	fruits	fruit	NOUN
ahs-14180	184	18	and	and	CCONJ
ahs-14180	184	19	are	be	AUX
ahs-14180	184	20	gaining	gain	VERB
ahs-14180	184	21	increasing	increase	VERB
ahs-14180	184	22	interest	interest	NOUN
ahs-14180	184	23	since	since	SCONJ
ahs-14180	184	24	apples	apple	NOUN
ahs-14180	184	25	are	be	AUX
ahs-14180	184	26	routinely	routinely	ADV
ahs-14180	184	27	stored	store	VERB
ahs-14180	184	28	for	for	ADP
ahs-14180	184	29	very	very	ADV
ahs-14180	184	30	long	long	ADJ
ahs-14180	184	31	periods	period	NOUN
ahs-14180	184	32	of	of	ADP
ahs-14180	184	33	time	time	NOUN
ahs-14180	184	34	thanks	thank	NOUN
ahs-14180	184	35	to	to	ADP
ahs-14180	184	36	the	the	DET
ahs-14180	184	37	adoption	adoption	NOUN
ahs-14180	184	38	of	of	ADP
ahs-14180	184	39	low	low	ADJ
ahs-14180	184	40	oxygen	oxygen	NOUN
ahs-14180	184	41	(	(	PUNCT
ahs-14180	184	42	0.8	0.8	NUM
ahs-14180	184	43	kpa	kpa	NOUN
ahs-14180	184	44	oxygen	oxygen	NOUN
ahs-14180	184	45	,	,	PUNCT
ahs-14180	184	46	ultra	ultra	ADJ
ahs-14180	184	47	low	low	ADJ
ahs-14180	184	48	oxygen	oxygen	NOUN
ahs-14180	184	49	,	,	PUNCT
ahs-14180	184	50	ulo	ulo	NOUN
ahs-14180	184	51	)	)	PUNCT
ahs-14180	184	52	or	or	CCONJ
ahs-14180	184	53	dynamic	dynamic	ADJ
ahs-14180	184	54	con­	con­	NOUN
ahs-14180	184	55	trolled	troll	VERB
ahs-14180	184	56	atmosphere	atmosphere	NOUN
ahs-14180	184	57	(	(	PUNCT
ahs-14180	184	58	dca	dca	PROPN
ahs-14180	184	59	,	,	PUNCT
ahs-14180	184	60	0.4	0.4	NUM
ahs-14180	184	61	or	or	CCONJ
ahs-14180	184	62	lower	low	ADJ
ahs-14180	184	63	kpa	kpa	PROPN
ahs-14180	184	64	oxygen	oxygen	NOUN
ahs-14180	184	65	)	)	PUNCT
ahs-14180	184	66	protocols	protocol	NOUN
ahs-14180	184	67	.	.	PUNCT
ahs-14180	185	1	primary	primary	ADJ
ahs-14180	185	2	metabolism	metabolism	NOUN
ahs-14180	185	3	and	and	CCONJ
ahs-14180	185	4	ethylene	ethylene	NOUN
ahs-14180	185	5	physiol­	physiol­	NOUN
ahs-14180	185	6	ogy	ogy	NOUN
ahs-14180	185	7	are	be	AUX
ahs-14180	185	8	markedly	markedly	ADV
ahs-14180	185	9	affected	affect	VERB
ahs-14180	185	10	by	by	ADP
ahs-14180	185	11	hypoxia	hypoxia	NOUN
ahs-14180	185	12	with	with	ADP
ahs-14180	185	13	differ­	differ­	PROPN
ahs-14180	185	14	ences	ence	NOUN
ahs-14180	185	15	depending	depend	VERB
ahs-14180	185	16	on	on	ADP
ahs-14180	185	17	the	the	DET
ahs-14180	185	18	oxygen	oxygen	NOUN
ahs-14180	185	19	concentration	concentration	NOUN
ahs-14180	185	20	and	and	CCONJ
ahs-14180	185	21	modulation	modulation	NOUN
ahs-14180	185	22	,	,	PUNCT
ahs-14180	185	23	and	and	CCONJ
ahs-14180	185	24	the	the	DET
ahs-14180	185	25	genotype	genotype	NOUN
ahs-14180	185	26	.	.	PUNCT
ahs-14180	186	1	in	in	ADP
ahs-14180	186	2	this	this	DET
ahs-14180	186	3	study	study	NOUN
ahs-14180	186	4	we	we	PRON
ahs-14180	186	5	char­	char­	VERB
ahs-14180	186	6	acterized	acterize	VERB
ahs-14180	186	7	the	the	DET
ahs-14180	186	8	ethanol	ethanol	NOUN
ahs-14180	186	9	accumulation	accumulation	NOUN
ahs-14180	186	10	and	and	CCONJ
ahs-14180	186	11	the	the	DET
ahs-14180	186	12	expres­	expres­	PROPN
ahs-14180	186	13	sion	sion	NOUN
ahs-14180	186	14	pattern	pattern	NOUN
ahs-14180	186	15	of	of	ADP
ahs-14180	186	16	sugar	sugar	NOUN
ahs-14180	186	17	/	/	SYM
ahs-14180	186	18	fermentative	fermentative	NOUN
ahs-14180	186	19	metabolism­	metabolism­	PROPN
ahs-14180	186	20	and	and	CCONJ
ahs-14180	186	21	ethylene	ethylene	NOUN
ahs-14180	186	22	physiology­related	physiology­relate	VERB
ahs-14180	186	23	genes	gene	NOUN
ahs-14180	186	24	of	of	ADP
ahs-14180	186	25	red	red	PROPN
ahs-14180	186	26	delicious	delicious	PROPN
ahs-14180	186	27	apples	apple	NOUN
ahs-14180	186	28	in	in	ADP
ahs-14180	186	29	ca	ca	PROPN
ahs-14180	186	30	/	/	SYM
ahs-14180	186	31	dca	dca	PROPN
ahs-14180	186	32	storage	storage	NOUN
ahs-14180	186	33	.	.	PUNCT
ahs-14180	187	1	our	our	PRON
ahs-14180	187	2	goal	goal	NOUN
ahs-14180	187	3	was	be	AUX
ahs-14180	187	4	that	that	PRON
ahs-14180	187	5	of	of	ADP
ahs-14180	187	6	better	well	ADJ
ahs-14180	187	7	understanding	understand	VERB
ahs-14180	187	8	the	the	DET
ahs-14180	187	9	behaviour	behaviour	NOUN
ahs-14180	187	10	and	and	CCONJ
ahs-14180	187	11	the	the	DET
ahs-14180	187	12	responses	response	NOUN
ahs-14180	187	13	(	(	PUNCT
ahs-14180	187	14	also	also	ADV
ahs-14180	187	15	in	in	ADP
ahs-14180	187	16	terms	term	NOUN
ahs-14180	187	17	of	of	ADP
ahs-14180	187	18	specific	specific	ADJ
ahs-14180	187	19	quality	quality	NOUN
ahs-14180	187	20	parameters	parameter	NOUN
ahs-14180	187	21	)	)	PUNCT
ahs-14180	187	22	of	of	ADP
ahs-14180	187	23	this	this	DET
ahs-14180	187	24	apple	apple	NOUN
ahs-14180	187	25	variety	variety	NOUN
ahs-14180	187	26	in	in	ADP
ahs-14180	187	27	relation	relation	NOUN
ahs-14180	187	28	to	to	ADP
ahs-14180	187	29	two	two	NUM
ahs-14180	187	30	levels	level	NOUN
ahs-14180	187	31	of	of	ADP
ahs-14180	187	32	low	low	ADJ
ahs-14180	187	33	oxygen	oxygen	NOUN
ahs-14180	187	34	con­	con­	NOUN
ahs-14180	187	35	centration	centration	NOUN
ahs-14180	187	36	and	and	CCONJ
ahs-14180	187	37	the	the	DET
ahs-14180	187	38	variable	variable	NOUN
ahs-14180	187	39	(	(	PUNCT
ahs-14180	187	40	in	in	ADP
ahs-14180	187	41	terms	term	NOUN
ahs-14180	187	42	of	of	ADP
ahs-14180	187	43	timing	timing	NOUN
ahs-14180	187	44	)	)	PUNCT
ahs-14180	187	45	switch	switch	VERB
ahs-14180	187	46	from	from	ADP
ahs-14180	187	47	0.3	0.3	NUM
ahs-14180	187	48	to	to	PART
ahs-14180	187	49	0.8	0.8	NUM
ahs-14180	187	50	%	%	NOUN
ahs-14180	187	51	oxygen	oxygen	NOUN
ahs-14180	187	52	levels	level	NOUN
ahs-14180	187	53	.	.	PUNCT
ahs-14180	188	1	the	the	DET
ahs-14180	188	2	storage	storage	NOUN
ahs-14180	188	3	under	under	ADP
ahs-14180	188	4	0.3	0.3	NUM
ahs-14180	188	5	%	%	NOUN
ahs-14180	188	6	oxygen	oxygen	NOUN
ahs-14180	188	7	resulted	result	VERB
ahs-14180	188	8	in	in	ADP
ahs-14180	188	9	an	an	DET
ahs-14180	188	10	early	early	ADJ
ahs-14180	188	11	significant	significant	ADJ
ahs-14180	188	12	accumulation	accumulation	NOUN
ahs-14180	188	13	of	of	ADP
ahs-14180	188	14	ethanol	ethanol	NOUN
ahs-14180	188	15	already	already	ADV
ahs-14180	188	16	at	at	ADP
ahs-14180	188	17	10	10	NUM
ahs-14180	188	18	dia	dia	PROPN
ahs-14180	188	19	and	and	CCONJ
ahs-14180	188	20	that	that	SCONJ
ahs-14180	188	21	further	far	ADV
ahs-14180	188	22	increased	increase	VERB
ahs-14180	188	23	at	at	ADP
ahs-14180	188	24	20	20	NUM
ahs-14180	188	25	dia	dia	PROPN
ahs-14180	188	26	.	.	PUNCT
ahs-14180	189	1	this	this	DET
ahs-14180	189	2	level	level	NOUN
ahs-14180	189	3	remained	remain	VERB
ahs-14180	189	4	rather	rather	ADV
ahs-14180	189	5	stable	stable	ADJ
ahs-14180	189	6	as	as	ADV
ahs-14180	189	7	long	long	ADV
ahs-14180	189	8	as	as	SCONJ
ahs-14180	189	9	the	the	DET
ahs-14180	189	10	fruit	fruit	NOUN
ahs-14180	189	11	were	be	AUX
ahs-14180	189	12	kept	keep	VERB
ahs-14180	189	13	at	at	ADP
ahs-14180	189	14	0.3	0.3	NUM
ahs-14180	189	15	%	%	NOUN
ahs-14180	189	16	oxygen	oxygen	NOUN
ahs-14180	189	17	atmosphere	atmosphere	NOUN
ahs-14180	189	18	until	until	ADP
ahs-14180	189	19	110	110	NUM
ahs-14180	189	20	dia	dia	PROPN
ahs-14180	189	21	.	.	PUNCT
ahs-14180	190	1	although	although	SCONJ
ahs-14180	190	2	to	to	ADP
ahs-14180	190	3	a	a	DET
ahs-14180	190	4	lesser	less	ADJ
ahs-14180	190	5	extent	extent	NOUN
ahs-14180	190	6	,	,	PUNCT
ahs-14180	190	7	ethanol	ethanol	NOUN
ahs-14180	190	8	content	content	NOUN
ahs-14180	190	9	also	also	ADV
ahs-14180	190	10	increased	increase	VERB
ahs-14180	190	11	in	in	ADP
ahs-14180	190	12	0.8ox	0.8ox	NUM
ahs-14180	190	13	samples	sample	NOUN
ahs-14180	190	14	,	,	PUNCT
ahs-14180	190	15	confirming	confirm	VERB
ahs-14180	190	16	what	what	PRON
ahs-14180	190	17	observed	observe	VERB
ahs-14180	190	18	by	by	ADP
ahs-14180	190	19	brizzolara	brizzolara	PROPN
ahs-14180	190	20	et	et	PROPN
ahs-14180	190	21	al	al	PROPN
ahs-14180	190	22	.	.	PROPN
ahs-14180	191	1	(	(	PUNCT
ahs-14180	191	2	2017	2017	NUM
ahs-14180	191	3	)	)	PUNCT
ahs-14180	191	4	.	.	PUNCT
ahs-14180	192	1	in	in	ADP
ahs-14180	192	2	these	these	DET
ahs-14180	192	3	apples	apple	NOUN
ahs-14180	192	4	,	,	PUNCT
ahs-14180	192	5	ethanol	ethanol	NOUN
ahs-14180	192	6	con­	con­	NOUN
ahs-14180	192	7	tent	tent	NOUN
ahs-14180	192	8	levelled	level	VERB
ahs-14180	192	9	off	off	ADP
ahs-14180	192	10	after	after	ADP
ahs-14180	192	11	three	three	NUM
ahs-14180	192	12	months	month	NOUN
ahs-14180	192	13	of	of	ADP
ahs-14180	192	14	storage	storage	NOUN
ahs-14180	192	15	.	.	PUNCT
ahs-14180	193	1	the	the	DET
ahs-14180	193	2	metabolization	metabolization	NOUN
ahs-14180	193	3	of	of	ADP
ahs-14180	193	4	ethanol	ethanol	NOUN
ahs-14180	193	5	seemed	seem	VERB
ahs-14180	193	6	to	to	PART
ahs-14180	193	7	be	be	AUX
ahs-14180	193	8	more	more	ADJ
ahs-14180	193	9	sensi­	sensi­	PROPN
ahs-14180	193	10	tive	tive	NOUN
ahs-14180	193	11	to	to	PART
ahs-14180	193	12	re­oxygenation	re­oxygenation	VERB
ahs-14180	193	13	when	when	SCONJ
ahs-14180	193	14	apples	apple	NOUN
ahs-14180	193	15	had	have	AUX
ahs-14180	193	16	experienced	experience	VERB
ahs-14180	193	17	a	a	DET
ahs-14180	193	18	shorter	short	ADJ
ahs-14180	193	19	period	period	NOUN
ahs-14180	193	20	of	of	ADP
ahs-14180	193	21	dca	dca	PROPN
ahs-14180	193	22	.	.	PUNCT
ahs-14180	194	1	in	in	ADP
ahs-14180	194	2	fact	fact	NOUN
ahs-14180	194	3	,	,	PUNCT
ahs-14180	194	4	the	the	DET
ahs-14180	194	5	longest	long	ADJ
ahs-14180	194	6	storage	storage	NOUN
ahs-14180	194	7	under	under	ADP
ahs-14180	194	8	0.3	0.3	NUM
ahs-14180	194	9	%	%	NOUN
ahs-14180	194	10	oxygen	oxygen	NOUN
ahs-14180	194	11	resulted	result	VERB
ahs-14180	194	12	in	in	ADP
ahs-14180	194	13	more	more	ADV
ahs-14180	194	14	stable	stable	ADJ
ahs-14180	194	15	ethanol	ethanol	NOUN
ahs-14180	194	16	levels	level	NOUN
ahs-14180	194	17	in	in	ADP
ahs-14180	194	18	the	the	DET
ahs-14180	194	19	cortex	cortex	NOUN
ahs-14180	194	20	at	at	ADP
ahs-14180	194	21	the	the	DET
ahs-14180	194	22	end	end	NOUN
ahs-14180	194	23	of	of	ADP
ahs-14180	194	24	the	the	DET
ahs-14180	194	25	storage	storage	NOUN
ahs-14180	194	26	period	period	NOUN
ahs-14180	194	27	(	(	PUNCT
ahs-14180	194	28	218	218	NUM
ahs-14180	194	29	dia	dia	PROPN
ahs-14180	194	30	,	,	PUNCT
ahs-14180	194	31	sh4	sh4	NOUN
ahs-14180	194	32	in	in	ADP
ahs-14180	194	33	fig	fig	NOUN
ahs-14180	194	34	.	.	PUNCT
ahs-14180	195	1	2	2	NUM
ahs-14180	195	2	)	)	PUNCT
ahs-14180	195	3	.	.	PUNCT
ahs-14180	196	1	considering	consider	VERB
ahs-14180	196	2	one	one	NUM
ahs-14180	196	3	of	of	ADP
ahs-14180	196	4	the	the	DET
ahs-14180	196	5	main	main	ADJ
ahs-14180	196	6	parameters	parameter	NOUN
ahs-14180	196	7	dictating	dictate	VERB
ahs-14180	196	8	the	the	DET
ahs-14180	196	9	commercial	commercial	ADJ
ahs-14180	196	10	life	life	NOUN
ahs-14180	196	11	of	of	ADP
ahs-14180	196	12	apples	apple	NOUN
ahs-14180	196	13	,	,	PUNCT
ahs-14180	196	14	the	the	DET
ahs-14180	196	15	samples	sample	NOUN
ahs-14180	196	16	sh3	sh3	NOUN
ahs-14180	196	17	and	and	CCONJ
ahs-14180	196	18	sh4	sh4	PROPN
ahs-14180	196	19	showed	show	VERB
ahs-14180	196	20	the	the	DET
ahs-14180	196	21	lowest	low	ADJ
ahs-14180	196	22	values	value	NOUN
ahs-14180	196	23	of	of	ADP
ahs-14180	196	24	flesh	flesh	NOUN
ahs-14180	196	25	firmness	firmness	NOUN
ahs-14180	196	26	at	at	ADP
ahs-14180	196	27	the	the	DET
ahs-14180	196	28	end	end	NOUN
ahs-14180	196	29	of	of	ADP
ahs-14180	196	30	the	the	DET
ahs-14180	196	31	trial	trial	NOUN
ahs-14180	196	32	.	.	PUNCT
ahs-14180	197	1	this	this	DET
ahs-14180	197	2	behaviour	behaviour	NOUN
ahs-14180	197	3	could	could	AUX
ahs-14180	197	4	be	be	AUX
ahs-14180	197	5	associated	associate	VERB
ahs-14180	197	6	to	to	ADP
ahs-14180	197	7	the	the	DET
ahs-14180	197	8	highest	high	ADJ
ahs-14180	197	9	levels	level	NOUN
ahs-14180	197	10	of	of	ADP
ahs-14180	197	11	ethanol	ethanol	NOUN
ahs-14180	197	12	accumulated	accumulate	VERB
ahs-14180	197	13	in	in	ADP
ahs-14180	197	14	these	these	DET
ahs-14180	197	15	samples	sample	NOUN
ahs-14180	197	16	.	.	PUNCT
ahs-14180	198	1	in	in	ADP
ahs-14180	198	2	braeburn	braeburn	NOUN
ahs-14180	198	3	apples	apple	NOUN
ahs-14180	198	4	ethanol	ethanol	NOUN
ahs-14180	198	5	production	production	NOUN
ahs-14180	198	6	exceeding	exceed	VERB
ahs-14180	198	7	472	472	NUM
ahs-14180	198	8	μl·l­1	μl·l­1	NOUN
ahs-14180	198	9	and	and	CCONJ
ahs-14180	198	10	the	the	DET
ahs-14180	198	11	overproduction	overproduction	NOUN
ahs-14180	198	12	of	of	ADP
ahs-14180	198	13	anaerobic	anaerobic	ADJ
ahs-14180	198	14	metabolites	metabolite	NOUN
ahs-14180	198	15	in	in	ADP
ahs-14180	198	16	royal	royal	ADJ
ahs-14180	198	17	gala	gala	NOUN
ahs-14180	198	18	resulted	result	VERB
ahs-14180	198	19	in	in	ADP
ahs-14180	198	20	a	a	DET
ahs-14180	198	21	decrease	decrease	NOUN
ahs-14180	198	22	of	of	ADP
ahs-14180	198	23	flesh	flesh	NOUN
ahs-14180	198	24	firmness	firmness	NOUN
ahs-14180	198	25	(	(	PUNCT
ahs-14180	198	26	weber	weber	PROPN
ahs-14180	198	27	et	et	PROPN
ahs-14180	198	28	al	al	PROPN
ahs-14180	198	29	.	.	PROPN
ahs-14180	198	30	,	,	PUNCT
ahs-14180	198	31	2020	2020	NUM
ahs-14180	198	32	;	;	PUNCT
ahs-14180	198	33	thewes	thewe	NOUN
ahs-14180	198	34	et	et	NOUN
ahs-14180	198	35	al	al	PROPN
ahs-14180	198	36	.	.	PROPN
ahs-14180	198	37	,	,	PUNCT
ahs-14180	198	38	2021	2021	NUM
ahs-14180	198	39	b	b	NOUN
ahs-14180	198	40	)	)	PUNCT
ahs-14180	198	41	.	.	PUNCT
ahs-14180	199	1	in	in	ADP
ahs-14180	199	2	persimmon	persimmon	NOUN
ahs-14180	199	3	,	,	PUNCT
ahs-14180	199	4	it	it	PRON
ahs-14180	199	5	has	have	AUX
ahs-14180	199	6	been	be	AUX
ahs-14180	199	7	observed	observe	VERB
ahs-14180	199	8	that	that	PRON
ahs-14180	199	9	accelerated	accelerate	VERB
ahs-14180	199	10	loss	loss	NOUN
ahs-14180	199	11	of	of	ADP
ahs-14180	199	12	flesh	flesh	NOUN
ahs-14180	199	13	firm­	firm­	PROPN
ahs-14180	199	14	ness	ness	NOUN
ahs-14180	199	15	during	during	ADP
ahs-14180	199	16	storage	storage	NOUN
ahs-14180	199	17	was	be	AUX
ahs-14180	199	18	induced	induce	VERB
ahs-14180	199	19	by	by	ADP
ahs-14180	199	20	ethanol	ethanol	NOUN
ahs-14180	199	21	treat­	treat­	DET
ahs-14180	199	22	ments	ment	NOUN
ahs-14180	199	23	applied	apply	VERB
ahs-14180	199	24	to	to	PART
ahs-14180	199	25	reduce	reduce	VERB
ahs-14180	199	26	astringency	astringency	NOUN
ahs-14180	199	27	(	(	PUNCT
ahs-14180	199	28	vilhena	vilhena	PROPN
ahs-14180	199	29	et	et	PROPN
ahs-14180	199	30	al	al	PROPN
ahs-14180	199	31	.	.	PROPN
ahs-14180	199	32	,	,	PUNCT
ahs-14180	199	33	2022	2022	NUM
ahs-14180	199	34	)	)	PUNCT
ahs-14180	199	35	.	.	PUNCT
ahs-14180	200	1	these	these	DET
ahs-14180	200	2	authors	author	NOUN
ahs-14180	200	3	observed	observe	VERB
ahs-14180	200	4	that	that	SCONJ
ahs-14180	200	5	this	this	DET
ahs-14180	200	6	event	event	NOUN
ahs-14180	200	7	is	be	AUX
ahs-14180	200	8	closely	closely	ADV
ahs-14180	200	9	related	relate	VERB
ahs-14180	200	10	to	to	ADP
ahs-14180	200	11	greater	great	ADJ
ahs-14180	200	12	parenchyma	parenchyma	NOUN
ahs-14180	200	13	degradation	degradation	NOUN
ahs-14180	200	14	during	during	ADP
ahs-14180	200	15	storage	storage	NOUN
ahs-14180	200	16	caused	cause	VERB
ahs-14180	200	17	by	by	ADP
ahs-14180	200	18	ethanol	ethanol	NOUN
ahs-14180	200	19	treatment	treatment	NOUN
ahs-14180	200	20	.	.	PUNCT
ahs-14180	201	1	if	if	SCONJ
ahs-14180	201	2	this	this	DET
ahs-14180	201	3	cellular	cellular	ADJ
ahs-14180	201	4	event	event	NOUN
ahs-14180	201	5	also	also	ADV
ahs-14180	201	6	occurs	occur	VERB
ahs-14180	201	7	in	in	ADP
ahs-14180	201	8	apple	apple	NOUN
ahs-14180	201	9	fruit	fruit	NOUN
ahs-14180	201	10	accumulating	accumulate	VERB
ahs-14180	201	11	high	high	ADJ
ahs-14180	201	12	ethanol	ethanol	NOUN
ahs-14180	201	13	levels	level	NOUN
ahs-14180	201	14	following	follow	VERB
ahs-14180	201	15	hypoxic	hypoxic	ADJ
ahs-14180	201	16	storage	storage	NOUN
ahs-14180	201	17	condi­	condi­	NOUN
ahs-14180	201	18	tions	tion	NOUN
ahs-14180	201	19	remains	remain	VERB
ahs-14180	201	20	to	to	PART
ahs-14180	201	21	be	be	AUX
ahs-14180	201	22	elucidated	elucidate	VERB
ahs-14180	201	23	.	.	PUNCT
ahs-14180	202	1	it	it	PRON
ahs-14180	202	2	is	be	AUX
ahs-14180	202	3	interesting	interesting	ADJ
ahs-14180	202	4	to	to	PART
ahs-14180	202	5	note	note	VERB
ahs-14180	202	6	that	that	SCONJ
ahs-14180	202	7	even	even	ADV
ahs-14180	202	8	in	in	ADP
ahs-14180	202	9	the	the	DET
ahs-14180	202	10	samples	sample	NOUN
ahs-14180	202	11	with	with	ADP
ahs-14180	202	12	the	the	DET
ahs-14180	202	13	highest	high	ADJ
ahs-14180	202	14	ethanol	ethanol	NOUN
ahs-14180	202	15	content	content	NOUN
ahs-14180	202	16	(	(	PUNCT
ahs-14180	202	17	0.3ox	0.3ox	PROPN
ahs-14180	202	18	)	)	PUNCT
ahs-14180	202	19	no	no	DET
ahs-14180	202	20	internal	internal	ADJ
ahs-14180	202	21	physiological	physiological	ADJ
ahs-14180	202	22	disorders	disorder	NOUN
ahs-14180	202	23	(	(	PUNCT
ahs-14180	202	24	e.g.	e.g.	ADV
ahs-14180	202	25	,	,	PUNCT
ahs-14180	202	26	flesh	flesh	NOUN
ahs-14180	202	27	breakdown	breakdown	NOUN
ahs-14180	202	28	)	)	PUNCT
ahs-14180	202	29	were	be	AUX
ahs-14180	202	30	detected	detect	VERB
ahs-14180	202	31	.	.	PUNCT
ahs-14180	203	1	the	the	DET
ahs-14180	203	2	gene	gene	NOUN
ahs-14180	203	3	expression	expression	NOUN
ahs-14180	203	4	data	datum	NOUN
ahs-14180	203	5	confirmed	confirm	VERB
ahs-14180	203	6	that	that	SCONJ
ahs-14180	203	7	the	the	DET
ahs-14180	203	8	molecular	molecular	ADJ
ahs-14180	203	9	regulation	regulation	NOUN
ahs-14180	203	10	of	of	ADP
ahs-14180	203	11	hypoxic	hypoxic	ADJ
ahs-14180	203	12	responses	response	NOUN
ahs-14180	203	13	is	be	AUX
ahs-14180	203	14	overall	overall	ADV
ahs-14180	203	15	conserved	conserved	ADJ
ahs-14180	203	16	among	among	ADP
ahs-14180	203	17	apple	apple	NOUN
ahs-14180	203	18	varieties	variety	NOUN
ahs-14180	203	19	:	:	PUNCT
ahs-14180	203	20	the	the	DET
ahs-14180	203	21	up­regulation	up­regulation	PROPN
ahs-14180	203	22	of	of	ADP
ahs-14180	203	23	mdpdc	mdpdc	PROPN
ahs-14180	203	24	,	,	PUNCT
ahs-14180	203	25	mdadh	mdadh	NOUN
ahs-14180	203	26	and	and	CCONJ
ahs-14180	203	27	mdalaat	mdalaat	NOUN
ahs-14180	203	28	in	in	ADP
ahs-14180	203	29	response	response	NOUN
ahs-14180	203	30	to	to	ADP
ahs-14180	203	31	extreme	extreme	ADJ
ahs-14180	203	32	levels	level	NOUN
ahs-14180	203	33	of	of	ADP
ahs-14180	203	34	hypoxia	hypoxia	NOUN
ahs-14180	203	35	(	(	PUNCT
ahs-14180	203	36	0.3	0.3	NUM
ahs-14180	203	37	oxygen	oxygen	NOUN
ahs-14180	203	38	concentration	concentration	NOUN
ahs-14180	203	39	)	)	PUNCT
ahs-14180	203	40	is	be	AUX
ahs-14180	203	41	readily	readily	ADV
ahs-14180	203	42	activated	activate	VERB
ahs-14180	203	43	and	and	CCONJ
ahs-14180	203	44	peaks	peak	NOUN
ahs-14180	203	45	at	at	ADP
ahs-14180	203	46	10	10	NUM
ahs-14180	203	47	dia	dia	PROPN
ahs-14180	203	48	,	,	PUNCT
ahs-14180	203	49	after	after	SCONJ
ahs-14180	203	50	which	which	PRON
ahs-14180	203	51	is	be	AUX
ahs-14180	203	52	promptly	promptly	ADV
ahs-14180	203	53	and	and	CCONJ
ahs-14180	203	54	progressively	progressively	ADV
ahs-14180	203	55	levelled	level	VERB
ahs-14180	203	56	down	down	ADP
ahs-14180	203	57	until	until	ADP
ahs-14180	203	58	110	110	NUM
ahs-14180	203	59	dia	dia	PROPN
ahs-14180	203	60	,	,	PUNCT
ahs-14180	203	61	when	when	SCONJ
ahs-14180	203	62	a	a	DET
ahs-14180	203	63	general	general	ADJ
ahs-14180	203	64	low	low	ADJ
ahs-14180	203	65	level	level	NOUN
ahs-14180	203	66	of	of	ADP
ahs-14180	203	67	expression	expression	NOUN
ahs-14180	203	68	(	(	PUNCT
ahs-14180	203	69	com­	com­	PROPN
ahs-14180	203	70	pared	pare	VERB
ahs-14180	203	71	to	to	ADP
ahs-14180	203	72	0.8ox	0.8ox	NOUN
ahs-14180	203	73	samples	sample	NOUN
ahs-14180	203	74	)	)	PUNCT
ahs-14180	203	75	is	be	AUX
ahs-14180	203	76	present	present	ADJ
ahs-14180	203	77	in	in	ADP
ahs-14180	203	78	0.3ox	0.3ox	NUM
ahs-14180	203	79	and	and	CCONJ
ahs-14180	203	80	shift­	shift­	PRON
ahs-14180	203	81	ed	ed	NOUN
ahs-14180	203	82	samples	sample	NOUN
ahs-14180	203	83	.	.	PUNCT
ahs-14180	204	1	this	this	PRON
ahs-14180	204	2	possibly	possibly	ADV
ahs-14180	204	3	suggests	suggest	VERB
ahs-14180	204	4	a	a	DET
ahs-14180	204	5	negative	negative	ADJ
ahs-14180	204	6	feed­	feed­	PUNCT
ahs-14180	204	7	back	back	ADV
ahs-14180	204	8	exerted	exert	VERB
ahs-14180	204	9	by	by	ADP
ahs-14180	204	10	ethanol	ethanol	NOUN
ahs-14180	204	11	on	on	ADP
ahs-14180	204	12	its	its	PRON
ahs-14180	204	13	own	own	ADJ
ahs-14180	204	14	synthesis	synthesis	NOUN
ahs-14180	204	15	.	.	PUNCT
ahs-14180	205	1	in	in	ADP
ahs-14180	205	2	agreement	agreement	NOUN
ahs-14180	205	3	with	with	ADP
ahs-14180	205	4	these	these	DET
ahs-14180	205	5	findings	finding	NOUN
ahs-14180	205	6	,	,	PUNCT
ahs-14180	205	7	one	one	NUM
ahs-14180	205	8	of	of	ADP
ahs-14180	205	9	the	the	DET
ahs-14180	205	10	genes	gene	NOUN
ahs-14180	205	11	encoding	encode	VERB
ahs-14180	205	12	group	group	NOUN
ahs-14180	205	13	vii	vii	PROPN
ahs-14180	205	14	ethylene	ethylene	NOUN
ahs-14180	205	15	response	response	NOUN
ahs-14180	205	16	factors	factor	NOUN
ahs-14180	205	17	(	(	PUNCT
ahs-14180	205	18	md09g1174400	md09g1174400	NOUN
ahs-14180	205	19	)	)	PUNCT
ahs-14180	205	20	,	,	PUNCT
ahs-14180	205	21	with	with	ADP
ahs-14180	205	22	similarity	similarity	NOUN
ahs-14180	205	23	to	to	ADP
ahs-14180	205	24	rap2	rap2	ADJ
ahs-14180	205	25	proteins	protein	NOUN
ahs-14180	205	26	involved	involve	VERB
ahs-14180	205	27	in	in	ADP
ahs-14180	205	28	low	low	ADJ
ahs-14180	205	29	oxygen	oxygen	NOUN
ahs-14180	205	30	signalling	signal	VERB
ahs-14180	205	31	in	in	ADP
ahs-14180	205	32	model	model	NOUN
ahs-14180	205	33	systems	system	NOUN
ahs-14180	205	34	(	(	PUNCT
ahs-14180	205	35	licausi	licausi	NOUN
ahs-14180	205	36	et	et	PROPN
ahs-14180	205	37	al	al	PROPN
ahs-14180	205	38	.	.	PROPN
ahs-14180	205	39	,	,	PUNCT
ahs-14180	205	40	2011	2011	NUM
ahs-14180	205	41	;	;	PUNCT
ahs-14180	205	42	gibbs	gibbs	PROPN
ahs-14180	205	43	et	et	PROPN
ahs-14180	205	44	al	al	PROPN
ahs-14180	205	45	.	.	PROPN
ahs-14180	205	46	,	,	PUNCT
ahs-14180	205	47	2011	2011	NUM
ahs-14180	205	48	)	)	PUNCT
ahs-14180	205	49	,	,	PUNCT
ahs-14180	205	50	displayed	display	VERB
ahs-14180	205	51	an	an	DET
ahs-14180	205	52	expression	expression	NOUN
ahs-14180	205	53	pattern	pattern	NOUN
ahs-14180	205	54	overlapping	overlap	VERB
ahs-14180	205	55	with	with	ADP
ahs-14180	205	56	that	that	PRON
ahs-14180	205	57	of	of	ADP
ahs-14180	205	58	the	the	DET
ahs-14180	205	59	fer­	fer­	ADJ
ahs-14180	205	60	mentative	mentative	ADJ
ahs-14180	205	61	metabolic	metabolic	NOUN
ahs-14180	205	62	genes	gene	NOUN
ahs-14180	205	63	with	with	ADP
ahs-14180	205	64	a	a	DET
ahs-14180	205	65	transient	transient	ADJ
ahs-14180	205	66	up­regu­	up­regu­	ADJ
ahs-14180	205	67	lation	lation	NOUN
ahs-14180	205	68	at	at	ADP
ahs-14180	205	69	10	10	NUM
ahs-14180	205	70	dia	dia	PROPN
ahs-14180	205	71	and	and	CCONJ
ahs-14180	205	72	low	low	ADJ
ahs-14180	205	73	expression	expression	NOUN
ahs-14180	205	74	levels	level	NOUN
ahs-14180	205	75	at	at	ADP
ahs-14180	205	76	110	110	NUM
ahs-14180	205	77	dia	dia	PROPN
ahs-14180	205	78	.	.	PUNCT
ahs-14180	206	1	it	it	PRON
ahs-14180	206	2	is	be	AUX
ahs-14180	206	3	well	well	ADV
ahs-14180	206	4	known	know	VERB
ahs-14180	206	5	that	that	SCONJ
ahs-14180	206	6	under	under	ADP
ahs-14180	206	7	energy	energy	NOUN
ahs-14180	206	8	shortage	shortage	NOUN
ahs-14180	206	9	condi­	condi­	NOUN
ahs-14180	206	10	tions	tion	NOUN
ahs-14180	206	11	,	,	PUNCT
ahs-14180	206	12	such	such	ADJ
ahs-14180	206	13	as	as	ADP
ahs-14180	206	14	those	those	PRON
ahs-14180	206	15	induced	induce	VERB
ahs-14180	206	16	by	by	ADP
ahs-14180	206	17	low	low	ADJ
ahs-14180	206	18	oxygen	oxygen	NOUN
ahs-14180	206	19	condi­	condi­	NOUN
ahs-14180	206	20	tions	tion	NOUN
ahs-14180	206	21	,	,	PUNCT
ahs-14180	206	22	plant	plant	NOUN
ahs-14180	206	23	tissues	tissue	NOUN
ahs-14180	206	24	and	and	CCONJ
ahs-14180	206	25	organs	organ	NOUN
ahs-14180	206	26	(	(	PUNCT
ahs-14180	206	27	including	include	VERB
ahs-14180	206	28	fruit	fruit	NOUN
ahs-14180	206	29	)	)	PUNCT
ahs-14180	206	30	instead	instead	ADV
ahs-14180	206	31	of	of	ADP
ahs-14180	206	32	using	use	VERB
ahs-14180	206	33	invertases	invertase	NOUN
ahs-14180	206	34	and	and	CCONJ
ahs-14180	206	35	hexokinases	hexokinase	NOUN
ahs-14180	206	36	to	to	PART
ahs-14180	206	37	pro­	pro­	VERB
ahs-14180	206	38	duce	duce	NOUN
ahs-14180	206	39	hexose­phosphates	hexose­phosphate	NOUN
ahs-14180	206	40	to	to	PART
ahs-14180	206	41	form	form	VERB
ahs-14180	206	42	sucrose	sucrose	PROPN
ahs-14180	206	43	,	,	PUNCT
ahs-14180	206	44	an	an	DET
ahs-14180	206	45	atp	atp	NOUN
ahs-14180	206	46	consuming	consume	VERB
ahs-14180	206	47	process	process	NOUN
ahs-14180	206	48	,	,	PUNCT
ahs-14180	206	49	can	can	AUX
ahs-14180	206	50	use	use	VERB
ahs-14180	206	51	sucrose	sucrose	ADJ
ahs-14180	206	52	synthase	synthase	NOUN
ahs-14180	206	53	as	as	ADP
ahs-14180	206	54	alternative	alternative	ADJ
ahs-14180	206	55	energy	energy	NOUN
ahs-14180	206	56	saving	saving	NOUN
ahs-14180	206	57	pathway	pathway	NOUN
ahs-14180	206	58	(	(	PUNCT
ahs-14180	206	59	mustroph	mustroph	PROPN
ahs-14180	206	60	et	et	PROPN
ahs-14180	206	61	al	al	PROPN
ahs-14180	206	62	.	.	PROPN
ahs-14180	206	63	,	,	PUNCT
ahs-14180	206	64	2014	2014	NUM
ahs-14180	206	65	)	)	PUNCT
ahs-14180	206	66	.	.	PUNCT
ahs-14180	207	1	the	the	DET
ahs-14180	207	2	activation	activation	NOUN
ahs-14180	207	3	under	under	ADP
ahs-14180	207	4	hypoxic	hypoxic	ADJ
ahs-14180	207	5	conditions	condition	NOUN
ahs-14180	207	6	of	of	ADP
ahs-14180	207	7	sucrose	sucrose	ADJ
ahs-14180	207	8	synthase	synthase	NOUN
ahs-14180	207	9	was	be	AUX
ahs-14180	207	10	already	already	ADV
ahs-14180	207	11	reported	report	VERB
ahs-14180	207	12	by	by	ADP
ahs-14180	207	13	cukrov	cukrov	PROPN
ahs-14180	207	14	et	et	PROPN
ahs-14180	207	15	al	al	PROPN
ahs-14180	207	16	.	.	PUNCT
ahs-14180	208	1	(	(	PUNCT
ahs-14180	208	2	2016	2016	NUM
ahs-14180	208	3	)	)	PUNCT
ahs-14180	208	4	in	in	ADP
ahs-14180	208	5	granny	granny	ADJ
ahs-14180	208	6	smith	smith	PROPN
ahs-14180	208	7	apples	apple	NOUN
ahs-14180	208	8	,	,	PUNCT
ahs-14180	208	9	and	and	CCONJ
ahs-14180	208	10	our	our	PRON
ahs-14180	208	11	expression	expression	NOUN
ahs-14180	208	12	adv	adv	PROPN
ahs-14180	208	13	.	.	PUNCT
ahs-14180	208	14	hort	hort	PROPN
ahs-14180	208	15	.	.	PUNCT
ahs-14180	209	1	sci	sci	PROPN
ahs-14180	209	2	.	.	PROPN
ahs-14180	209	3	,	,	PUNCT
ahs-14180	209	4	2023	2023	NUM
ahs-14180	209	5	37(1	37(1	NUM
ahs-14180	209	6	):	):	PUNCT
ahs-14180	209	7	89­99	89­99	NUM
ahs-14180	209	8	98	98	NUM
ahs-14180	209	9	data	datum	NOUN
ahs-14180	209	10	(	(	PUNCT
ahs-14180	209	11	showing	show	VERB
ahs-14180	209	12	a	a	DET
ahs-14180	209	13	high	high	ADJ
ahs-14180	209	14	induction	induction	NOUN
ahs-14180	209	15	at	at	ADP
ahs-14180	209	16	10	10	NUM
ahs-14180	209	17	dia	dia	PROPN
ahs-14180	209	18	in	in	ADP
ahs-14180	209	19	0.3ox	0.3ox	PROPN
ahs-14180	209	20	and	and	CCONJ
ahs-14180	209	21	a	a	DET
ahs-14180	209	22	prompt	prompt	ADJ
ahs-14180	209	23	reduction	reduction	NOUN
ahs-14180	209	24	of	of	ADP
ahs-14180	209	25	expression	expression	NOUN
ahs-14180	209	26	level	level	NOUN
ahs-14180	209	27	in	in	ADP
ahs-14180	209	28	sh1	sh1	ADJ
ahs-14180	209	29	apples	apple	NOUN
ahs-14180	209	30	at	at	ADP
ahs-14180	209	31	31	31	NUM
ahs-14180	209	32	dia	dia	PROPN
ahs-14180	209	33	)	)	PUNCT
ahs-14180	209	34	confirm	confirm	VERB
ahs-14180	209	35	that	that	SCONJ
ahs-14180	209	36	this	this	DET
ahs-14180	209	37	gene	gene	NOUN
ahs-14180	209	38	can	can	AUX
ahs-14180	209	39	be	be	AUX
ahs-14180	209	40	considered	consider	VERB
ahs-14180	209	41	highly	highly	ADV
ahs-14180	209	42	sensitive	sensitive	ADJ
ahs-14180	209	43	to	to	ADP
ahs-14180	209	44	oxygen	oxygen	NOUN
ahs-14180	209	45	levels	level	NOUN
ahs-14180	209	46	also	also	ADV
ahs-14180	209	47	in	in	ADP
ahs-14180	209	48	cv	cv	PROPN
ahs-14180	209	49	.	.	PROPN
ahs-14180	209	50	red	red	PROPN
ahs-14180	209	51	delicious	delicious	PROPN
ahs-14180	209	52	.	.	PUNCT
ahs-14180	210	1	a	a	DET
ahs-14180	210	2	cultivar­specific	cultivar­specific	ADJ
ahs-14180	210	3	behaviour	behaviour	NOUN
ahs-14180	210	4	is	be	AUX
ahs-14180	210	5	,	,	PUNCT
ahs-14180	210	6	instead	instead	ADV
ahs-14180	210	7	,	,	PUNCT
ahs-14180	210	8	observed	observed	ADJ
ahs-14180	210	9	regarding	regard	VERB
ahs-14180	210	10	beta­amylase	beta­amylase	NOUN
ahs-14180	210	11	and	and	CCONJ
ahs-14180	210	12	phosphofruc­	phosphofruc­	PROPN
ahs-14180	210	13	tokinase	tokinase	NOUN
ahs-14180	210	14	.	.	PUNCT
ahs-14180	211	1	in	in	ADP
ahs-14180	211	2	fact	fact	NOUN
ahs-14180	211	3	,	,	PUNCT
ahs-14180	211	4	these	these	DET
ahs-14180	211	5	genes	gene	NOUN
ahs-14180	211	6	in	in	ADP
ahs-14180	211	7	granny	granny	ADJ
ahs-14180	211	8	smith	smith	NOUN
ahs-14180	211	9	apples	apple	NOUN
ahs-14180	211	10	follow	follow	VERB
ahs-14180	211	11	a	a	DET
ahs-14180	211	12	similar	similar	ADJ
ahs-14180	211	13	expression	expression	NOUN
ahs-14180	211	14	pattern	pattern	NOUN
ahs-14180	211	15	compared	compare	VERB
ahs-14180	211	16	to	to	ADP
ahs-14180	211	17	mdsusy	mdsusy	NOUN
ahs-14180	211	18	(	(	PUNCT
ahs-14180	211	19	cukrov	cukrov	X
ahs-14180	211	20	et	et	PROPN
ahs-14180	211	21	al	al	PROPN
ahs-14180	211	22	.	.	PROPN
ahs-14180	211	23	,	,	PUNCT
ahs-14180	211	24	2016	2016	NUM
ahs-14180	211	25	)	)	PUNCT
ahs-14180	211	26	,	,	PUNCT
ahs-14180	211	27	not	not	PART
ahs-14180	211	28	observed	observe	VERB
ahs-14180	211	29	in	in	ADP
ahs-14180	211	30	the	the	DET
ahs-14180	211	31	present	present	ADJ
ahs-14180	211	32	trials	trial	NOUN
ahs-14180	211	33	on	on	ADP
ahs-14180	211	34	red	red	PROPN
ahs-14180	211	35	delicious	delicious	PROPN
ahs-14180	211	36	.	.	PUNCT
ahs-14180	212	1	as	as	ADV
ahs-14180	212	2	far	far	ADV
ahs-14180	212	3	as	as	SCONJ
ahs-14180	212	4	ethylene	ethylene	NOUN
ahs-14180	212	5	biosynthesis	biosynthesis	NOUN
ahs-14180	212	6	is	be	AUX
ahs-14180	212	7	concerned	concern	VERB
ahs-14180	212	8	,	,	PUNCT
ahs-14180	212	9	the	the	DET
ahs-14180	212	10	expression	expression	NOUN
ahs-14180	212	11	pattern	pattern	NOUN
ahs-14180	212	12	of	of	ADP
ahs-14180	212	13	acc	acc	PROPN
ahs-14180	212	14	oxidase	oxidase	NOUN
ahs-14180	212	15	detected	detect	VERB
ahs-14180	212	16	in	in	ADP
ahs-14180	212	17	0.8ox	0.8ox	PROPN
ahs-14180	212	18	red	red	PROPN
ahs-14180	212	19	delicious	delicious	PROPN
ahs-14180	212	20	samples	sample	NOUN
ahs-14180	212	21	mirrors	mirror	NOUN
ahs-14180	212	22	that	that	PRON
ahs-14180	212	23	observed	observe	VERB
ahs-14180	212	24	in	in	ADP
ahs-14180	212	25	granny	granny	NOUN
ahs-14180	212	26	smith	smith	PROPN
ahs-14180	212	27	(	(	PUNCT
ahs-14180	212	28	cukrov	cukrov	PROPN
ahs-14180	212	29	et	et	PROPN
ahs-14180	212	30	al	al	PROPN
ahs-14180	212	31	.	.	PROPN
ahs-14180	212	32	,	,	PUNCT
ahs-14180	212	33	2016	2016	NUM
ahs-14180	212	34	)	)	PUNCT
ahs-14180	212	35	,	,	PUNCT
ahs-14180	212	36	while	while	SCONJ
ahs-14180	212	37	the	the	DET
ahs-14180	212	38	tran­	tran­	NUM
ahs-14180	212	39	sient	sient	ADJ
ahs-14180	212	40	higher	high	ADJ
ahs-14180	212	41	expression	expression	NOUN
ahs-14180	212	42	levels	level	NOUN
ahs-14180	212	43	observed	observe	VERB
ahs-14180	212	44	for	for	ADP
ahs-14180	212	45	both	both	CCONJ
ahs-14180	212	46	acc	acc	PROPN
ahs-14180	212	47	synthase	synthase	NOUN
ahs-14180	212	48	and	and	CCONJ
ahs-14180	212	49	oxidase	oxidase	NOUN
ahs-14180	212	50	at	at	ADP
ahs-14180	212	51	10	10	NUM
ahs-14180	212	52	dia	dia	PROPN
ahs-14180	212	53	under	under	ADP
ahs-14180	212	54	0.3	0.3	NUM
ahs-14180	212	55	%	%	NOUN
ahs-14180	212	56	oxygen	oxygen	NOUN
ahs-14180	212	57	appear	appear	VERB
ahs-14180	212	58	to	to	PART
ahs-14180	212	59	be	be	AUX
ahs-14180	212	60	a	a	DET
ahs-14180	212	61	specific	specific	ADJ
ahs-14180	212	62	response	response	NOUN
ahs-14180	212	63	of	of	ADP
ahs-14180	212	64	cv	cv	PROPN
ahs-14180	212	65	.	.	PROPN
ahs-14180	212	66	red	red	PROPN
ahs-14180	212	67	delicious	delicious	PROPN
ahs-14180	212	68	apple	apple	PROPN
ahs-14180	212	69	.	.	PUNCT
ahs-14180	213	1	interestingly	interestingly	ADV
ahs-14180	213	2	,	,	PUNCT
ahs-14180	213	3	the	the	DET
ahs-14180	213	4	transcription	transcription	NOUN
ahs-14180	213	5	of	of	ADP
ahs-14180	213	6	both	both	DET
ahs-14180	213	7	genes	gene	NOUN
ahs-14180	213	8	appeared	appear	VERB
ahs-14180	213	9	to	to	PART
ahs-14180	213	10	be	be	AUX
ahs-14180	213	11	re­activated	re­activate	VERB
ahs-14180	213	12	exclusively	exclusively	ADV
ahs-14180	213	13	in	in	ADP
ahs-14180	213	14	the	the	DET
ahs-14180	213	15	first	first	ADJ
ahs-14180	213	16	and	and	CCONJ
ahs-14180	213	17	second	second	ADJ
ahs-14180	213	18	shift	shift	NOUN
ahs-14180	213	19	to	to	ADP
ahs-14180	213	20	0.8ox	0.8ox	PROPN
ahs-14180	213	21	(	(	PUNCT
ahs-14180	213	22	sh1	sh1	NOUN
ahs-14180	213	23	and	and	CCONJ
ahs-14180	213	24	sh2	sh2	PROPN
ahs-14180	213	25	)	)	PUNCT
ahs-14180	213	26	,	,	PUNCT
ahs-14180	213	27	performed	perform	VERB
ahs-14180	213	28	after	after	ADP
ahs-14180	213	29	10	10	NUM
ahs-14180	213	30	and	and	CCONJ
ahs-14180	213	31	20	20	NUM
ahs-14180	213	32	dia	dia	PROPN
ahs-14180	213	33	,	,	PUNCT
ahs-14180	213	34	respectively	respectively	ADV
ahs-14180	213	35	,	,	PUNCT
ahs-14180	213	36	and	and	CCONJ
ahs-14180	213	37	showed	show	VERB
ahs-14180	213	38	a	a	DET
ahs-14180	213	39	peak	peak	NOUN
ahs-14180	213	40	at	at	ADP
ahs-14180	213	41	31	31	NUM
ahs-14180	213	42	dia	dia	PROPN
ahs-14180	213	43	followed	follow	VERB
ahs-14180	213	44	by	by	ADP
ahs-14180	213	45	lower	low	ADJ
ahs-14180	213	46	expression	expression	NOUN
ahs-14180	213	47	levels	level	NOUN
ahs-14180	213	48	.	.	PUNCT
ahs-14180	214	1	however	however	ADV
ahs-14180	214	2	,	,	PUNCT
ahs-14180	214	3	the	the	DET
ahs-14180	214	4	increase	increase	NOUN
ahs-14180	214	5	of	of	ADP
ahs-14180	214	6	mdacs	mdac	NOUN
ahs-14180	214	7	and	and	CCONJ
ahs-14180	214	8	mdaco	mdaco	VERB
ahs-14180	214	9	tran­	tran­	NUM
ahs-14180	214	10	script	script	NOUN
ahs-14180	214	11	following	follow	VERB
ahs-14180	214	12	the	the	DET
ahs-14180	214	13	oxygen	oxygen	NOUN
ahs-14180	214	14	resupply	resupply	NOUN
ahs-14180	214	15	reached	reach	VERB
ahs-14180	214	16	a	a	DET
ahs-14180	214	17	level	level	NOUN
ahs-14180	214	18	significantly	significantly	ADV
ahs-14180	214	19	lower	low	ADJ
ahs-14180	214	20	than	than	ADP
ahs-14180	214	21	that	that	PRON
ahs-14180	214	22	reached	reach	VERB
ahs-14180	214	23	by	by	ADP
ahs-14180	214	24	apples	apple	NOUN
ahs-14180	214	25	that	that	PRON
ahs-14180	214	26	had	have	AUX
ahs-14180	214	27	been	be	AUX
ahs-14180	214	28	constantly	constantly	ADV
ahs-14180	214	29	kept	keep	VERB
ahs-14180	214	30	at	at	ADP
ahs-14180	214	31	0.8ox	0.8ox	PROPN
ahs-14180	214	32	.	.	PUNCT
ahs-14180	215	1	it	it	PRON
ahs-14180	215	2	could	could	AUX
ahs-14180	215	3	be	be	AUX
ahs-14180	215	4	hypothesised	hypothesise	VERB
ahs-14180	215	5	that	that	SCONJ
ahs-14180	215	6	this	this	PRON
ahs-14180	215	7	may	may	AUX
ahs-14180	215	8	be	be	AUX
ahs-14180	215	9	due	due	ADJ
ahs-14180	215	10	to	to	ADP
ahs-14180	215	11	the	the	DET
ahs-14180	215	12	higher	high	ADJ
ahs-14180	215	13	lev­	lev­	NOUN
ahs-14180	215	14	els	el	NOUN
ahs-14180	215	15	of	of	ADP
ahs-14180	215	16	ethanol	ethanol	NOUN
ahs-14180	215	17	accumulated	accumulate	VERB
ahs-14180	215	18	in	in	ADP
ahs-14180	215	19	the	the	DET
ahs-14180	215	20	pulp	pulp	NOUN
ahs-14180	215	21	of	of	ADP
ahs-14180	215	22	dca	dca	PROPN
ahs-14180	215	23	stored	store	VERB
ahs-14180	215	24	apples	apple	NOUN
ahs-14180	215	25	,	,	PUNCT
ahs-14180	215	26	which	which	PRON
ahs-14180	215	27	might	might	AUX
ahs-14180	215	28	exert	exert	VERB
ahs-14180	215	29	a	a	DET
ahs-14180	215	30	suppressive	suppressive	ADJ
ahs-14180	215	31	action	action	NOUN
ahs-14180	215	32	on	on	ADP
ahs-14180	215	33	ethylene	ethylene	NOUN
ahs-14180	215	34	biosynthesis	biosynthesis	NOUN
ahs-14180	215	35	as	as	SCONJ
ahs-14180	215	36	previously	previously	ADV
ahs-14180	215	37	shown	show	VERB
ahs-14180	215	38	by	by	ADP
ahs-14180	215	39	some	some	DET
ahs-14180	215	40	authors	author	NOUN
ahs-14180	215	41	in	in	ADP
ahs-14180	215	42	different	different	ADJ
ahs-14180	215	43	apple	apple	NOUN
ahs-14180	215	44	varieties	variety	NOUN
ahs-14180	215	45	(	(	PUNCT
ahs-14180	215	46	pesis	pesis	NOUN
ahs-14180	215	47	et	et	NOUN
ahs-14180	215	48	al	al	PROPN
ahs-14180	215	49	.	.	PROPN
ahs-14180	215	50	,	,	PUNCT
ahs-14180	215	51	2005	2005	NUM
ahs-14180	215	52	;	;	PUNCT
ahs-14180	215	53	thewes	thewe	NOUN
ahs-14180	215	54	et	et	NOUN
ahs-14180	215	55	al	al	PROPN
ahs-14180	215	56	.	.	PROPN
ahs-14180	215	57	,	,	PUNCT
ahs-14180	215	58	2019	2019	NUM
ahs-14180	215	59	;	;	PUNCT
ahs-14180	215	60	weber	weber	PROPN
ahs-14180	215	61	et	et	PROPN
ahs-14180	215	62	al	al	PROPN
ahs-14180	215	63	.	.	PROPN
ahs-14180	215	64	,	,	PUNCT
ahs-14180	215	65	2020	2020	NUM
ahs-14180	215	66	;	;	PUNCT
ahs-14180	215	67	thewes	thewe	NOUN
ahs-14180	215	68	et	et	NOUN
ahs-14180	215	69	al	al	PROPN
ahs-14180	215	70	.	.	PROPN
ahs-14180	215	71	,	,	PUNCT
ahs-14180	215	72	2021	2021	NUM
ahs-14180	215	73	a	a	PRON
ahs-14180	215	74	)	)	PUNCT
ahs-14180	215	75	.	.	PUNCT
ahs-14180	216	1	concluding	concluding	NOUN
ahs-14180	216	2	,	,	PUNCT
ahs-14180	216	3	the	the	DET
ahs-14180	216	4	recovery	recovery	NOUN
ahs-14180	216	5	from	from	ADP
ahs-14180	216	6	anoxia	anoxia	PROPN
ahs-14180	216	7	in	in	ADP
ahs-14180	216	8	apple	apple	NOUN
ahs-14180	216	9	fruits	fruit	NOUN
ahs-14180	216	10	is	be	AUX
ahs-14180	216	11	dependent	dependent	ADJ
ahs-14180	216	12	on	on	ADP
ahs-14180	216	13	the	the	DET
ahs-14180	216	14	length	length	NOUN
ahs-14180	216	15	of	of	ADP
ahs-14180	216	16	exposure	exposure	NOUN
ahs-14180	216	17	to	to	ADP
ahs-14180	216	18	the	the	DET
ahs-14180	216	19	anoxic	anoxic	ADJ
ahs-14180	216	20	stress	stress	NOUN
ahs-14180	216	21	(	(	PUNCT
ahs-14180	216	22	wood	wood	NOUN
ahs-14180	216	23	et	et	NOUN
ahs-14180	216	24	al	al	PROPN
ahs-14180	216	25	.	.	PROPN
ahs-14180	216	26	,	,	PUNCT
ahs-14180	216	27	2022	2022	NUM
ahs-14180	216	28	)	)	PUNCT
ahs-14180	216	29	.	.	PUNCT
ahs-14180	217	1	our	our	PRON
ahs-14180	217	2	data	datum	NOUN
ahs-14180	217	3	on	on	ADP
ahs-14180	217	4	ethanol	ethanol	NOUN
ahs-14180	217	5	accumulation	accumulation	NOUN
ahs-14180	217	6	and	and	CCONJ
ahs-14180	217	7	ethylene­related	ethylene­relate	VERB
ahs-14180	217	8	gene	gene	NOUN
ahs-14180	217	9	expression	expression	NOUN
ahs-14180	217	10	are	be	AUX
ahs-14180	217	11	in	in	ADP
ahs-14180	217	12	line	line	NOUN
ahs-14180	217	13	with	with	ADP
ahs-14180	217	14	these	these	DET
ahs-14180	217	15	findings	finding	NOUN
ahs-14180	217	16	,	,	PUNCT
ahs-14180	217	17	showing	show	VERB
ahs-14180	217	18	that	that	SCONJ
ahs-14180	217	19	longer	long	ADJ
ahs-14180	217	20	periods	period	NOUN
ahs-14180	217	21	of	of	ADP
ahs-14180	217	22	exposure	exposure	NOUN
ahs-14180	217	23	to	to	ADP
ahs-14180	217	24	0.3	0.3	NUM
ahs-14180	217	25	%	%	NOUN
ahs-14180	217	26	oxygen	oxygen	NOUN
ahs-14180	217	27	result	result	NOUN
ahs-14180	217	28	in	in	ADP
ahs-14180	217	29	the	the	DET
ahs-14180	217	30	maintenance	maintenance	NOUN
ahs-14180	217	31	of	of	ADP
ahs-14180	217	32	higher	high	ADJ
ahs-14180	217	33	levels	level	NOUN
ahs-14180	217	34	of	of	ADP
ahs-14180	217	35	ethanol	ethanol	NOUN
ahs-14180	217	36	and	and	CCONJ
ahs-14180	217	37	on	on	ADP
ahs-14180	217	38	the	the	DET
ahs-14180	217	39	prevention	prevention	NOUN
ahs-14180	217	40	of	of	ADP
ahs-14180	217	41	transcription	transcription	NOUN
ahs-14180	217	42	of	of	ADP
ahs-14180	217	43	ethylene	ethylene	NOUN
ahs-14180	217	44	biosyn­	biosyn­	NOUN
ahs-14180	217	45	thetic	thetic	ADJ
ahs-14180	217	46	genes	gene	NOUN
ahs-14180	217	47	.	.	PUNCT
ahs-14180	218	1	the	the	DET
ahs-14180	218	2	effect	effect	NOUN
ahs-14180	218	3	of	of	ADP
ahs-14180	218	4	low	low	ADJ
ahs-14180	218	5	oxygen	oxygen	NOUN
ahs-14180	218	6	storage	storage	NOUN
ahs-14180	218	7	of	of	ADP
ahs-14180	218	8	red	red	PROPN
ahs-14180	218	9	delicious	delicious	PROPN
ahs-14180	218	10	apples	apple	NOUN
ahs-14180	218	11	on	on	ADP
ahs-14180	218	12	transcript	transcript	NOUN
ahs-14180	218	13	abundance	abundance	NOUN
ahs-14180	218	14	of	of	ADP
ahs-14180	218	15	several	several	ADJ
ahs-14180	218	16	important	important	ADJ
ahs-14180	218	17	genes	gene	NOUN
ahs-14180	218	18	related	relate	VERB
ahs-14180	218	19	to	to	ADP
ahs-14180	218	20	hypoxic	hypoxic	ADJ
ahs-14180	218	21	stress	stress	ADJ
ahs-14180	218	22	response	response	NOUN
ahs-14180	218	23	in	in	ADP
ahs-14180	218	24	apple	apple	NOUN
ahs-14180	218	25	fruit	fruit	NOUN
ahs-14180	218	26	revealed	reveal	VERB
ahs-14180	218	27	both	both	DET
ahs-14180	218	28	similarity	similarity	NOUN
ahs-14180	218	29	with	with	ADP
ahs-14180	218	30	granny	granny	ADJ
ahs-14180	218	31	smith	smith	NOUN
ahs-14180	218	32	apples	apple	NOUN
ahs-14180	218	33	stored	store	VERB
ahs-14180	218	34	under	under	ADP
ahs-14180	218	35	the	the	DET
ahs-14180	218	36	same	same	ADJ
ahs-14180	218	37	ca	ca	NOUN
ahs-14180	218	38	protocols	protocol	NOUN
ahs-14180	218	39	,	,	PUNCT
ahs-14180	218	40	and	and	CCONJ
ahs-14180	218	41	spe­	spe­	NOUN
ahs-14180	218	42	cific	cific	NOUN
ahs-14180	218	43	responses	response	NOUN
ahs-14180	218	44	of	of	ADP
ahs-14180	218	45	cv	cv	PROPN
ahs-14180	218	46	.	.	PROPN
ahs-14180	218	47	red	red	PROPN
ahs-14180	218	48	delicious	delicious	PROPN
ahs-14180	218	49	.	.	PUNCT
ahs-14180	219	1	in	in	ADP
ahs-14180	219	2	both	both	CCONJ
ahs-14180	219	3	red	red	PROPN
ahs-14180	219	4	delicious	delicious	PROPN
ahs-14180	219	5	and	and	CCONJ
ahs-14180	219	6	granny	granny	ADJ
ahs-14180	219	7	smith	smith	NOUN
ahs-14180	219	8	apples	apple	NOUN
ahs-14180	219	9	two	two	NUM
ahs-14180	219	10	phases	phase	NOUN
ahs-14180	219	11	can	can	AUX
ahs-14180	219	12	be	be	AUX
ahs-14180	219	13	recognized	recognize	VERB
ahs-14180	219	14	in	in	ADP
ahs-14180	219	15	relation	relation	NOUN
ahs-14180	219	16	to	to	ADP
ahs-14180	219	17	fermentative	fermentative	ADJ
ahs-14180	219	18	metabolism	metabolism	NOUN
ahs-14180	219	19	:	:	PUNCT
ahs-14180	219	20	a	a	DET
ahs-14180	219	21	first	first	ADJ
ahs-14180	219	22	phase	phase	NOUN
ahs-14180	219	23	characterised	characterise	VERB
ahs-14180	219	24	by	by	ADP
ahs-14180	219	25	the	the	DET
ahs-14180	219	26	activation	activation	NOUN
ahs-14180	219	27	of	of	ADP
ahs-14180	219	28	fermen­	fermen­	PROPN
ahs-14180	219	29	tative	tative	PROPN
ahs-14180	219	30	pathways	pathway	NOUN
ahs-14180	219	31	,	,	PUNCT
ahs-14180	219	32	and	and	CCONJ
ahs-14180	219	33	a	a	DET
ahs-14180	219	34	second	second	ADJ
ahs-14180	219	35	phase	phase	NOUN
ahs-14180	219	36	(	(	PUNCT
ahs-14180	219	37	from	from	ADP
ahs-14180	219	38	two	two	NUM
ahs-14180	219	39	months	month	NOUN
ahs-14180	219	40	onward	onward	ADV
ahs-14180	219	41	)	)	PUNCT
ahs-14180	219	42	in	in	ADP
ahs-14180	219	43	which	which	PRON
ahs-14180	219	44	a	a	DET
ahs-14180	219	45	generalized	generalized	ADJ
ahs-14180	219	46	de­activation	de­activation	NOUN
ahs-14180	219	47	of	of	ADP
ahs-14180	219	48	fermentative	fermentative	ADJ
ahs-14180	219	49	metabolism	metabolism	NOUN
ahs-14180	219	50	is	be	AUX
ahs-14180	219	51	observed	observe	VERB
ahs-14180	219	52	.	.	PUNCT
ahs-14180	220	1	acknowledgements	acknowledgement	NOUN
ahs-14180	220	2	this	this	DET
ahs-14180	220	3	study	study	NOUN
ahs-14180	220	4	was	be	AUX
ahs-14180	220	5	carried	carry	VERB
ahs-14180	220	6	out	out	ADP
ahs-14180	220	7	by	by	ADP
ahs-14180	220	8	pt	pt	PROPN
ahs-14180	220	9	and	and	CCONJ
ahs-14180	220	10	sb	sb	PROPN
ahs-14180	220	11	within	within	ADP
ahs-14180	220	12	the	the	DET
ahs-14180	220	13	agritech	agritech	ADJ
ahs-14180	220	14	national	national	PROPN
ahs-14180	220	15	research	research	NOUN
ahs-14180	220	16	center	center	NOUN
ahs-14180	220	17	and	and	CCONJ
ahs-14180	220	18	received	receive	VERB
ahs-14180	220	19	funding	funding	NOUN
ahs-14180	220	20	from	from	ADP
ahs-14180	220	21	the	the	DET
ahs-14180	220	22	european	european	PROPN
ahs-14180	220	23	union	union	PROPN
ahs-14180	220	24	next­	next­	PROPN
ahs-14180	220	25	generationeu	generationeu	NOUN
ahs-14180	220	26	(	(	PUNCT
ahs-14180	220	27	piano	piano	NOUN
ahs-14180	220	28	nazionale	nazionale	PROPN
ahs-14180	220	29	di	di	X
ahs-14180	220	30	ripresa	ripresa	PROPN
ahs-14180	220	31	e	e	PROPN
ahs-14180	220	32	resilienza	resilienza	NOUN
ahs-14180	220	33	(	(	PUNCT
ahs-14180	220	34	pnrr	pnrr	PROPN
ahs-14180	220	35	)	)	PUNCT
ahs-14180	220	36	–	–	PUNCT
ahs-14180	220	37	missione	missione	NOUN
ahs-14180	220	38	4	4	NUM
ahs-14180	220	39	componente	componente	NOUN
ahs-14180	220	40	2	2	NUM
ahs-14180	220	41	,	,	PUNCT
ahs-14180	220	42	investimento	investimento	VERB
ahs-14180	220	43	1.4	1.4	NUM
ahs-14180	220	44	–	–	PUNCT
ahs-14180	220	45	d.d	d.d	PROPN
ahs-14180	220	46	.	.	PROPN
ahs-14180	220	47	1032	1032	NUM
ahs-14180	220	48	17/06/2022	17/06/2022	NUM
ahs-14180	220	49	,	,	PUNCT
ahs-14180	220	50	cn00000022	cn00000022	NOUN
ahs-14180	220	51	)	)	PUNCT
ahs-14180	220	52	.	.	PUNCT
ahs-14180	221	1	this	this	DET
ahs-14180	221	2	manuscript	manuscript	NOUN
ahs-14180	221	3	reflects	reflect	VERB
ahs-14180	221	4	only	only	ADV
ahs-14180	221	5	the	the	DET
ahs-14180	221	6	authors	author	NOUN
ahs-14180	221	7	views	view	VERB
ahs-14180	221	8	and	and	CCONJ
ahs-14180	221	9	opinions	opinion	NOUN
ahs-14180	221	10	,	,	PUNCT
ahs-14180	221	11	neither	neither	CCONJ
ahs-14180	221	12	the	the	DET
ahs-14180	221	13	european	european	PROPN
ahs-14180	221	14	union	union	PROPN
ahs-14180	221	15	nor	nor	CCONJ
ahs-14180	221	16	the	the	DET
ahs-14180	221	17	european	european	PROPN
ahs-14180	221	18	commission	commission	PROPN
ahs-14180	221	19	can	can	AUX
ahs-14180	221	20	be	be	AUX
ahs-14180	221	21	consid­	consid­	VERB
ahs-14180	221	22	ered	ere	VERB
ahs-14180	221	23	responsible	responsible	ADJ
ahs-14180	221	24	for	for	ADP
ahs-14180	221	25	them	they	PRON
ahs-14180	221	26	.	.	PUNCT
ahs-14180	222	1	sb	sb	PROPN
ahs-14180	222	2	was	be	AUX
ahs-14180	222	3	supported	support	VERB
ahs-14180	222	4	by	by	ADP
ahs-14180	222	5	the	the	DET
ahs-14180	222	6	special	special	ADJ
ahs-14180	222	7	project	project	NOUN
ahs-14180	222	8	of	of	ADP
ahs-14180	222	9	scuola	scuola	NOUN
ahs-14180	222	10	superiore	superiore	NOUN
ahs-14180	222	11	sant’anna	sant’anna	VERB
ahs-14180	222	12	isvstrategico2019	isvstrategico2019	PROPN
ahs-14180	222	13	.	.	PUNCT
ahs-14180	223	1	this	this	DET
ahs-14180	223	2	work	work	NOUN
ahs-14180	223	3	has	have	AUX
ahs-14180	223	4	been	be	AUX
ahs-14180	223	5	supported	support	VERB
ahs-14180	223	6	by	by	ADP
ahs-14180	223	7	the	the	DET
ahs-14180	223	8	networking	network	VERB
ahs-14180	223	9	activities	activity	NOUN
ahs-14180	223	10	“	"	PUNCT
ahs-14180	223	11	oxygen	oxygen	NOUN
ahs-14180	223	12	sensing	sense	VERB
ahs-14180	223	13	a	a	DET
ahs-14180	223	14	novel	novel	ADJ
ahs-14180	223	15	mean	mean	NOUN
ahs-14180	223	16	for	for	ADP
ahs-14180	223	17	biology	biology	NOUN
ahs-14180	223	18	and	and	CCONJ
ahs-14180	223	19	technology	technology	NOUN
ahs-14180	223	20	of	of	ADP
ahs-14180	223	21	fruit	fruit	NOUN
ahs-14180	223	22	quality	quality	NOUN
ahs-14180	223	23	”	"	PUNCT
ahs-14180	223	24	(	(	PUNCT
ahs-14180	223	25	ca:18210	ca:18210	NOUN
ahs-14180	223	26	)	)	PUNCT
ahs-14180	223	27	which	which	PRON
ahs-14180	223	28	is	be	AUX
ahs-14180	223	29	implemented	implement	VERB
ahs-14180	223	30	under	under	ADP
ahs-14180	223	31	the	the	DET
ahs-14180	223	32	cost	cost	NOUN
ahs-14180	223	33	action	action	NOUN
ahs-14180	223	34	“	"	PUNCT
ahs-14180	223	35	roxy­cost	roxy­cost	X
ahs-14180	223	36	,	,	PUNCT
ahs-14180	223	37	”	"	PUNCT
ahs-14180	223	38	funded	fund	VERB
ahs-14180	223	39	by	by	ADP
ahs-14180	223	40	the	the	DET
ahs-14180	223	41	european	european	ADJ
ahs-14180	223	42	cooperation	cooperation	NOUN
ahs-14180	223	43	in	in	ADP
ahs-14180	223	44	science	science	PROPN
ahs-14180	223	45	&	&	CCONJ
ahs-14180	223	46	technology	technology	PROPN
ahs-14180	223	47	(	(	PUNCT
ahs-14180	223	48	2019­2023	2019­2023	NUM
ahs-14180	223	49	)	)	PUNCT
ahs-14180	223	50	.	.	PUNCT
ahs-14180	224	1	funding	funding	NOUN
ahs-14180	224	2	was	be	AUX
ahs-14180	224	3	provided	provide	VERB
ahs-14180	224	4	by	by	ADP
ahs-14180	224	5	marvil	marvil	NOUN
ahs-14180	224	6	engeneering	engeneere	VERB
ahs-14180	224	7	srl	srl	PROPN
ahs-14180	224	8	through	through	ADP
ahs-14180	224	9	project	project	NOUN
ahs-14180	224	10	“	"	PUNCT
ahs-14180	224	11	rupe	rupe	NOUN
ahs-14180	224	12	comm17_01	comm17_01	PROPN
ahs-14180	224	13	”	"	PUNCT
ahs-14180	224	14	and	and	CCONJ
ahs-14180	224	15	by	by	ADP
ahs-14180	224	16	university	university	PROPN
ahs-14180	224	17	of	of	ADP
ahs-14180	224	18	padova	padova	PROPN
ahs-14180	224	19	project	project	NOUN
ahs-14180	224	20	bird173975/17	bird173975/17	NOUN
ahs-14180	224	21	.	.	PUNCT
ahs-14180	225	1	references	reference	NOUN
ahs-14180	225	2	aranda	aranda	PROPN
ahs-14180	225	3	p.s	p.s	PROPN
ahs-14180	225	4	.	.	PROPN
ahs-14180	225	5	,	,	PUNCT
ahs-14180	225	6	lajoie	lajoie	PROPN
ahs-14180	225	7	d.m	d.m	PROPN
ahs-14180	225	8	.	.	PROPN
ahs-14180	225	9	,	,	PUNCT
ahs-14180	225	10	jorcyk	jorcyk	PROPN
ahs-14180	225	11	c.	c.	PROPN
ahs-14180	225	12	l.	l.	PROPN
ahs-14180	225	13	,	,	PUNCT
ahs-14180	225	14	2012	2012	NUM
ahs-14180	225	15	­	­	NUM
ahs-14180	225	16	bleach	bleach	NOUN
ahs-14180	225	17	gel	gel	NOUN
ahs-14180	225	18	:	:	PUNCT
ahs-14180	225	19	a	a	DET
ahs-14180	225	20	simple	simple	ADJ
ahs-14180	225	21	agarose	agarose	NOUN
ahs-14180	225	22	gel	gel	NOUN
ahs-14180	225	23	for	for	ADP
ahs-14180	225	24	analyzing	analyze	VERB
ahs-14180	225	25	rna	rna	NOUN
ahs-14180	225	26	quality	quality	NOUN
ahs-14180	225	27	.	.	PUNCT
ahs-14180	226	1	‐	‐	NOUN
ahs-14180	226	2	elect	elect	NOUN
ahs-14180	226	3	.	.	PUNCT
ahs-14180	226	4	,	,	PUNCT
ahs-14180	226	5	33(2	33(2	NUM
ahs-14180	226	6	):	):	PUNCT
ahs-14180	226	7	366­369	366­369	PROPN
ahs-14180	226	8	.	.	PUNCT
ahs-14180	227	1	brizzolara	brizzolara	PROPN
ahs-14180	227	2	s.	s.	PROPN
ahs-14180	227	3	,	,	PUNCT
ahs-14180	227	4	cukrov	cukrov	PROPN
ahs-14180	227	5	d.	d.	PROPN
ahs-14180	227	6	,	,	PUNCT
ahs-14180	227	7	mercadini	mercadini	ADJ
ahs-14180	227	8	m.	m.	NOUN
ahs-14180	227	9	,	,	PUNCT
ahs-14180	227	10	martinelli	martinelli	PROPN
ahs-14180	227	11	f.	f.	PROPN
ahs-14180	227	12	,	,	PUNCT
ahs-14180	227	13	ruperti	ruperti	PROPN
ahs-14180	227	14	b.	b.	PROPN
ahs-14180	227	15	,	,	PUNCT
ahs-14180	227	16	tonutti	tonutti	PROPN
ahs-14180	227	17	p.	p.	NOUN
ahs-14180	227	18	,	,	PUNCT
ahs-14180	227	19	2019	2019	NUM
ahs-14180	227	20	­	­	NOUN
ahs-14180	227	21	short‐term	short‐term	ADJ
ahs-14180	227	22	respons‐	respons‐	PROPN
ahs-14180	227	23	es	es	PROPN
ahs-14180	227	24	of	of	ADP
ahs-14180	227	25	apple	apple	NOUN
ahs-14180	227	26	fruit	fruit	NOUN
ahs-14180	227	27	to	to	ADP
ahs-14180	227	28	partial	partial	ADJ
ahs-14180	227	29	reoxygenation	reoxygenation	NOUN
ahs-14180	227	30	during	during	ADP
ahs-14180	227	31	extreme	extreme	ADJ
ahs-14180	227	32	hypoxic	hypoxic	ADJ
ahs-14180	227	33	storage	storage	NOUN
ahs-14180	227	34	conditions	condition	NOUN
ahs-14180	227	35	.	.	PUNCT
ahs-14180	228	1	­	­	PROPN
ahs-14180	228	2	j.	j.	PROPN
ahs-14180	228	3	agric	agric	PROPN
ahs-14180	228	4	.	.	PUNCT
ahs-14180	229	1	food	food	NOUN
ahs-14180	229	2	chem	chem	NOUN
ahs-14180	229	3	.	.	PUNCT
ahs-14180	229	4	,	,	PUNCT
ahs-14180	230	1	67(17	67(17	NUM
ahs-14180	230	2	):	):	PUNCT
ahs-14180	230	3	4754­4763	4754­4763	NUM
ahs-14180	230	4	.	.	PUNCT
ahs-14180	231	1	brizzolara	brizzolara	PROPN
ahs-14180	231	2	s.	s.	PROPN
ahs-14180	231	3	,	,	PUNCT
ahs-14180	231	4	manganaris	manganaris	PROPN
ahs-14180	231	5	g.a	g.a	PROPN
ahs-14180	231	6	.	.	PROPN
ahs-14180	231	7	,	,	PUNCT
ahs-14180	231	8	fotopoulos	fotopoulos	PROPN
ahs-14180	231	9	v.	v.	PROPN
ahs-14180	231	10	,	,	PUNCT
ahs-14180	231	11	watkins	watkins	PROPN
ahs-14180	231	12	c.b	c.b	PROPN
ahs-14180	231	13	.	.	PROPN
ahs-14180	231	14	,	,	PUNCT
ahs-14180	231	15	tonutti	tonutti	PROPN
ahs-14180	231	16	p.	p.	NOUN
ahs-14180	231	17	,	,	PUNCT
ahs-14180	231	18	2020	2020	NUM
ahs-14180	231	19	­	­	VERB
ahs-14180	231	20	primary	primary	ADJ
ahs-14180	231	21	metabolism	metabolism	NOUN
ahs-14180	231	22	in	in	ADP
ahs-14180	231	23	fresh	fresh	ADJ
ahs-14180	231	24	fruits	fruit	NOUN
ahs-14180	231	25	during	during	ADP
ahs-14180	231	26	storage	storage	NOUN
ahs-14180	231	27	.	.	PUNCT
ahs-14180	232	1	­	­	PROPN
ahs-14180	232	2	front	front	ADJ
ahs-14180	232	3	.	.	PUNCT
ahs-14180	233	1	plant	plant	NOUN
ahs-14180	233	2	sci	sci	PROPN
ahs-14180	233	3	.	.	PROPN
ahs-14180	233	4	,	,	PUNCT
ahs-14180	233	5	11	11	NUM
ahs-14180	233	6	:	:	SYM
ahs-14180	233	7	80	80	NUM
ahs-14180	233	8	.	.	PUNCT
ahs-14180	233	9	brizzolara	brizzolara	PROPN
ahs-14180	233	10	s.	s.	PROPN
ahs-14180	233	11	,	,	PUNCT
ahs-14180	233	12	santucci	santucci	PROPN
ahs-14180	233	13	c.	c.	PROPN
ahs-14180	233	14	,	,	PUNCT
ahs-14180	233	15	tenori	tenori	PROPN
ahs-14180	233	16	l.	l.	PROPN
ahs-14180	233	17	,	,	PUNCT
ahs-14180	233	18	hertog	hertog	PROPN
ahs-14180	233	19	m.	m.	NOUN
ahs-14180	233	20	,	,	PUNCT
ahs-14180	233	21	nicolai	nicolai	PROPN
ahs-14180	233	22	b.	b.	PROPN
ahs-14180	233	23	,	,	PUNCT
ahs-14180	233	24	stürz	stürz	PROPN
ahs-14180	233	25	s.	s.	PROPN
ahs-14180	233	26	,	,	PUNCT
ahs-14180	233	27	zanella	zanella	PROPN
ahs-14180	233	28	a.	a.	PROPN
ahs-14180	233	29	,	,	PUNCT
ahs-14180	233	30	tonutti	tonutti	PROPN
ahs-14180	233	31	p.	p.	NOUN
ahs-14180	233	32	,	,	PUNCT
ahs-14180	233	33	2017	2017	NUM
ahs-14180	233	34	­	­	VERB
ahs-14180	233	35	a	a	DET
ahs-14180	233	36	metabolomics	metabolomic	NOUN
ahs-14180	233	37	approach	approach	NOUN
ahs-14180	233	38	to	to	PART
ahs-14180	233	39	elucidate	elucidate	VERB
ahs-14180	233	40	apple	apple	NOUN
ahs-14180	233	41	fruit	fruit	NOUN
ahs-14180	233	42	responses	response	NOUN
ahs-14180	233	43	to	to	ADP
ahs-14180	233	44	static	static	ADJ
ahs-14180	233	45	and	and	CCONJ
ahs-14180	233	46	dynamic	dynamic	ADJ
ahs-14180	233	47	controlled	control	VERB
ahs-14180	233	48	atmosphere	atmosphere	NOUN
ahs-14180	233	49	storage	storage	NOUN
ahs-14180	233	50	.	.	PUNCT
ahs-14180	234	1	­	­	PROPN
ahs-14180	234	2	postharvest	postharv	ADJ
ahs-14180	234	3	biol	biol	PROPN
ahs-14180	234	4	.	.	PUNCT
ahs-14180	235	1	technol	technol	PROPN
ahs-14180	235	2	.	.	PROPN
ahs-14180	235	3	,	,	PUNCT
ahs-14180	236	1	127	127	NUM
ahs-14180	236	2	:	:	PUNCT
ahs-14180	236	3	76­87	76­87	NUM
ahs-14180	236	4	.	.	PUNCT
ahs-14180	237	1	cukrov	cukrov	PROPN
ahs-14180	237	2	d.	d.	PROPN
ahs-14180	237	3	,	,	PUNCT
ahs-14180	237	4	brizzolara	brizzolara	PROPN
ahs-14180	237	5	s.	s.	PROPN
ahs-14180	237	6	,	,	PUNCT
ahs-14180	237	7	tonutti	tonutti	PROPN
ahs-14180	237	8	p.	p.	NOUN
ahs-14180	237	9	,	,	PUNCT
ahs-14180	237	10	2019	2019	NUM
ahs-14180	237	11	­	­	VERB
ahs-14180	237	12	physiological	physiological	ADJ
ahs-14180	237	13	and	and	CCONJ
ahs-14180	237	14	biochemical	biochemical	ADJ
ahs-14180	237	15	effects	effect	NOUN
ahs-14180	237	16	of	of	ADP
ahs-14180	237	17	controlled	control	VERB
ahs-14180	237	18	and	and	CCONJ
ahs-14180	237	19	modified	modified	ADJ
ahs-14180	237	20	atmospheres	atmosphere	NOUN
ahs-14180	237	21	,	,	PUNCT
ahs-14180	237	22	pp	pp	ADV
ahs-14180	237	23	.	.	PUNCT
ahs-14180	238	1	425­442	425­442	NUM
ahs-14180	238	2	.	.	PUNCT
ahs-14180	239	1	‐	‐	ADV
ahs-14180	239	2	in	in	ADP
ahs-14180	239	3	:	:	PUNCT
ahs-14180	239	4	yahia	yahia	PROPN
ahs-14180	239	5	e.m	e.m	PROPN
ahs-14180	239	6	.	.	PROPN
ahs-14180	239	7	,	,	PUNCT
ahs-14180	239	8	and	and	CCONJ
ahs-14180	239	9	a.	a.	PROPN
ahs-14180	239	10	carrillo­lopez	carrillo­lopez	PROPN
ahs-14180	239	11	(	(	PUNCT
ahs-14180	239	12	eds	eds	PROPN
ahs-14180	239	13	.	.	PUNCT
ahs-14180	239	14	)	)	PUNCT
ahs-14180	239	15	postharvest	postharvest	VERB
ahs-14180	239	16	physiology	physiology	NOUN
ahs-14180	239	17	and	and	CCONJ
ahs-14180	239	18	biochemistry	biochemistry	NOUN
ahs-14180	239	19	of	of	ADP
ahs-14180	239	20	fruits	fruit	NOUN
ahs-14180	239	21	and	and	CCONJ
ahs-14180	239	22	vegetables	vegetable	NOUN
ahs-14180	239	23	.	.	PUNCT
ahs-14180	240	1	woodhead	woodhead	PROPN
ahs-14180	240	2	salamé	salamé	PROPN
ahs-14180	240	3	et	et	PROPN
ahs-14180	240	4	al	al	PROPN
ahs-14180	240	5	.	.	PROPN
ahs-14180	241	1	‐	‐	PROPN
ahs-14180	241	2	dca	dca	PROPN
ahs-14180	241	3	storage	storage	NOUN
ahs-14180	241	4	of	of	ADP
ahs-14180	241	5	red	red	PROPN
ahs-14180	241	6	delicious	delicious	PROPN
ahs-14180	241	7	apples	apple	NOUN
ahs-14180	241	8	99	99	NUM
ahs-14180	241	9	publising­elsevier	publising­elsevier	NOUN
ahs-14180	241	10	,	,	PUNCT
ahs-14180	241	11	uk	uk	PROPN
ahs-14180	241	12	,	,	PUNCT
ahs-14180	241	13	pp	pp	ADJ
ahs-14180	241	14	.	.	PUNCT
ahs-14180	242	1	510	510	NUM
ahs-14180	242	2	.	.	PUNCT
ahs-14180	242	3	cukrov	cukrov	PROPN
ahs-14180	242	4	d.	d.	PROPN
ahs-14180	242	5	,	,	PUNCT
ahs-14180	242	6	zermiani	zermiani	NOUN
ahs-14180	242	7	m.	m.	NOUN
ahs-14180	242	8	,	,	PUNCT
ahs-14180	242	9	brizzolara	brizzolara	PROPN
ahs-14180	242	10	s.	s.	PROPN
ahs-14180	242	11	,	,	PUNCT
ahs-14180	242	12	cestaro	cestaro	NOUN
ahs-14180	242	13	a.	a.	PROPN
ahs-14180	242	14	,	,	PUNCT
ahs-14180	242	15	licausi	licausi	PROPN
ahs-14180	242	16	f.	f.	PROPN
ahs-14180	242	17	,	,	PUNCT
ahs-14180	242	18	luchinat	luchinat	PROPN
ahs-14180	242	19	c.	c.	PROPN
ahs-14180	242	20	,	,	PUNCT
ahs-14180	242	21	santucci	santucci	PROPN
ahs-14180	242	22	c.	c.	PROPN
ahs-14180	242	23	,	,	PUNCT
ahs-14180	242	24	tenori	tenori	PROPN
ahs-14180	242	25	l.	l.	PROPN
ahs-14180	242	26	,	,	PUNCT
ahs-14180	242	27	van	van	PROPN
ahs-14180	242	28	veen	veen	PROPN
ahs-14180	242	29	h.	h.	PROPN
ahs-14180	242	30	,	,	PUNCT
ahs-14180	242	31	zuccolo	zuccolo	PROPN
ahs-14180	242	32	a.	a.	PROPN
ahs-14180	242	33	,	,	PUNCT
ahs-14180	242	34	ruperti	ruperti	PROPN
ahs-14180	242	35	b.	b.	PROPN
ahs-14180	242	36	,	,	PUNCT
ahs-14180	242	37	tonutti	tonutti	PROPN
ahs-14180	242	38	p.	p.	NOUN
ahs-14180	242	39	,	,	PUNCT
ahs-14180	242	40	2016	2016	NUM
ahs-14180	242	41	‐	‐	NOUN
ahs-14180	242	42	extreme	extreme	ADJ
ahs-14180	242	43	hypoxic	hypoxic	ADJ
ahs-14180	242	44	conditions	condition	NOUN
ahs-14180	242	45	induce	induce	VERB
ahs-14180	242	46	selective	selective	ADJ
ahs-14180	242	47	molecular	molecular	ADJ
ahs-14180	242	48	responses	response	NOUN
ahs-14180	242	49	and	and	CCONJ
ahs-14180	242	50	metabolic	metabolic	NOUN
ahs-14180	242	51	reset	reset	NOUN
ahs-14180	242	52	in	in	ADP
ahs-14180	242	53	detached	detach	VERB
ahs-14180	242	54	apple	apple	NOUN
ahs-14180	242	55	fruit	fruit	NOUN
ahs-14180	242	56	.	.	PUNCT
ahs-14180	243	1	­	­	PROPN
ahs-14180	243	2	front	front	ADJ
ahs-14180	243	3	.	.	PUNCT
ahs-14180	244	1	plant	plant	NOUN
ahs-14180	244	2	sci	sci	PROPN
ahs-14180	244	3	.	.	PROPN
ahs-14180	244	4	,	,	PUNCT
ahs-14180	244	5	7	7	NUM
ahs-14180	244	6	:	:	SYM
ahs-14180	244	7	146	146	NUM
ahs-14180	244	8	.	.	PUNCT
ahs-14180	245	1	dixon	dixon	PROPN
ahs-14180	245	2	j.	j.	PROPN
ahs-14180	245	3	,	,	PUNCT
ahs-14180	245	4	hewett	hewett	PROPN
ahs-14180	245	5	e.w	e.w	PROPN
ahs-14180	245	6	.	.	PROPN
ahs-14180	245	7	,	,	PUNCT
ahs-14180	245	8	2000	2000	NUM
ahs-14180	245	9	­	­	VERB
ahs-14180	245	10	factors	factor	NOUN
ahs-14180	245	11	affecting	affect	VERB
ahs-14180	245	12	apple	apple	NOUN
ahs-14180	245	13	aroma	aroma	NOUN
ahs-14180	245	14	/	/	SYM
ahs-14180	245	15	flavor	flavor	NOUN
ahs-14180	245	16	volatile	volatile	ADJ
ahs-14180	245	17	concentration	concentration	NOUN
ahs-14180	245	18	:	:	PUNCT
ahs-14180	245	19	a	a	DET
ahs-14180	245	20	review	review	NOUN
ahs-14180	245	21	.	.	PUNCT
ahs-14180	246	1	­	­	PROPN
ahs-14180	246	2	n.	n.	PROPN
ahs-14180	246	3	z.	z.	PROPN
ahs-14180	246	4	j.	j.	PROPN
ahs-14180	246	5	crop	crop	PROPN
ahs-14180	246	6	hortic	hortic	PROPN
ahs-14180	246	7	.	.	PUNCT
ahs-14180	247	1	sci	sci	PROPN
ahs-14180	247	2	.	.	PROPN
ahs-14180	247	3	,	,	PUNCT
ahs-14180	247	4	28	28	NUM
ahs-14180	247	5	:	:	PUNCT
ahs-14180	247	6	155­173	155­173	NUM
ahs-14180	247	7	.	.	PUNCT
ahs-14180	248	1	gibbs	gibbs	PROPN
ahs-14180	248	2	d.j	d.j	PROPN
ahs-14180	248	3	.	.	PROPN
ahs-14180	248	4	,	,	PUNCT
ahs-14180	248	5	lee	lee	PROPN
ahs-14180	248	6	s.c	s.c	PROPN
ahs-14180	248	7	.	.	PROPN
ahs-14180	248	8	,	,	PUNCT
ahs-14180	248	9	isa	isa	VERB
ahs-14180	248	10	n.m	n.m	PROPN
ahs-14180	248	11	.	.	PROPN
ahs-14180	248	12	,	,	PUNCT
ahs-14180	248	13	gramuglia	gramuglia	PROPN
ahs-14180	248	14	s.	s.	PROPN
ahs-14180	248	15	,	,	PUNCT
ahs-14180	248	16	fukao	fukao	PROPN
ahs-14180	248	17	t.	t.	PROPN
ahs-14180	248	18	,	,	PUNCT
ahs-14180	248	19	bassel	bassel	PROPN
ahs-14180	248	20	g.w	g.w	PROPN
ahs-14180	248	21	.	.	PROPN
ahs-14180	248	22	,	,	PUNCT
ahs-14180	248	23	correia	correia	PROPN
ahs-14180	248	24	c.s	c.s	AUX
ahs-14180	248	25	.	.	PROPN
ahs-14180	248	26	,	,	PUNCT
ahs-14180	248	27	corbineau	corbineau	PROPN
ahs-14180	248	28	f.	f.	PROPN
ahs-14180	248	29	,	,	PUNCT
ahs-14180	248	30	theodoulou	theodoulou	PROPN
ahs-14180	248	31	f.l	f.l	PROPN
ahs-14180	248	32	.	.	PROPN
ahs-14180	248	33	,	,	PUNCT
ahs-14180	248	34	bailey­serres	bailey­serre	VERB
ahs-14180	248	35	j.	j.	PROPN
ahs-14180	248	36	,	,	PUNCT
ahs-14180	248	37	2011	2011	NUM
ahs-14180	248	38	‐	‐	ADJ
ahs-14180	248	39	homeostatic	homeostatic	ADJ
ahs-14180	248	40	response	response	NOUN
ahs-14180	248	41	to	to	ADP
ahs-14180	248	42	hypoxia	hypoxia	NOUN
ahs-14180	248	43	is	be	AUX
ahs-14180	248	44	regulated	regulate	VERB
ahs-14180	248	45	by	by	ADP
ahs-14180	248	46	the	the	DET
ahs-14180	248	47	n‐	n‐	NOUN
ahs-14180	248	48	end	end	NOUN
ahs-14180	248	49	rule	rule	NOUN
ahs-14180	248	50	pathway	pathway	NOUN
ahs-14180	248	51	in	in	ADP
ahs-14180	248	52	plants	plant	NOUN
ahs-14180	248	53	.	.	PUNCT
ahs-14180	249	1	­	­	NUM
ahs-14180	249	2	nature	nature	NOUN
ahs-14180	249	3	,	,	PUNCT
ahs-14180	249	4	479	479	NUM
ahs-14180	249	5	:	:	PUNCT
ahs-14180	249	6	415­418	415­418	NOUN
ahs-14180	249	7	.	.	PUNCT
ahs-14180	250	1	kronthaler	kronthal	ADJ
ahs-14180	250	2	f.	f.	PROPN
ahs-14180	250	3	,	,	PUNCT
ahs-14180	250	4	zöllner	zöllner	NOUN
ahs-14180	250	5	s.	s.	PROPN
ahs-14180	250	6	,	,	PUNCT
ahs-14180	250	7	2021	2021	NUM
ahs-14180	250	8	­	­	VERB
ahs-14180	250	9	data	datum	NOUN
ahs-14180	250	10	analysis	analysis	NOUN
ahs-14180	250	11	with	with	ADP
ahs-14180	250	12	rstudio	rstudio	NOUN
ahs-14180	250	13	.	.	PUNCT
ahs-14180	251	1	­	­	PROPN
ahs-14180	251	2	springer	springer	PROPN
ahs-14180	251	3	,	,	PUNCT
ahs-14180	251	4	berlin	berlin	PROPN
ahs-14180	251	5	/	/	SYM
ahs-14180	251	6	heidelberg	heidelberg	PROPN
ahs-14180	251	7	,	,	PUNCT
ahs-14180	251	8	germany	germany	PROPN
ahs-14180	251	9	.	.	PUNCT
ahs-14180	252	1	licausi	licausi	PROPN
ahs-14180	252	2	f.	f.	PROPN
ahs-14180	252	3	,	,	PUNCT
ahs-14180	252	4	kosmacz	kosmacz	PROPN
ahs-14180	252	5	m.	m.	NOUN
ahs-14180	252	6	,	,	PUNCT
ahs-14180	252	7	weits	weit	VERB
ahs-14180	252	8	d.a	d.a	PROPN
ahs-14180	252	9	.	.	PROPN
ahs-14180	252	10	,	,	PUNCT
ahs-14180	252	11	giuntoli	giuntoli	PROPN
ahs-14180	252	12	b.	b.	PROPN
ahs-14180	252	13	,	,	PUNCT
ahs-14180	252	14	giorgi	giorgi	PROPN
ahs-14180	252	15	f.m	f.m	PROPN
ahs-14180	252	16	.	.	PROPN
ahs-14180	252	17	,	,	PUNCT
ahs-14180	252	18	voesenek	voesenek	PROPN
ahs-14180	252	19	l.a	l.a	PROPN
ahs-14180	252	20	.	.	PROPN
ahs-14180	252	21	,	,	PUNCT
ahs-14180	252	22	van	van	PROPN
ahs-14180	252	23	dongen	dongen	PROPN
ahs-14180	252	24	j.t	j.t	PROPN
ahs-14180	252	25	.	.	PROPN
ahs-14180	252	26	,	,	PUNCT
ahs-14180	252	27	2011	2011	NUM
ahs-14180	252	28	­	­	VERB
ahs-14180	252	29	oxygen	oxygen	NOUN
ahs-14180	252	30	sensing	sensing	NOUN
ahs-14180	252	31	in	in	ADP
ahs-14180	252	32	plants	plant	NOUN
ahs-14180	252	33	is	be	AUX
ahs-14180	252	34	mediated	mediate	VERB
ahs-14180	252	35	by	by	ADP
ahs-14180	252	36	an	an	DET
ahs-14180	252	37	n‐end	n‐end	ADJ
ahs-14180	252	38	rule	rule	NOUN
ahs-14180	252	39	pathway	pathway	NOUN
ahs-14180	252	40	for	for	ADP
ahs-14180	252	41	protein	protein	NOUN
ahs-14180	252	42	destabilization	destabilization	NOUN
ahs-14180	252	43	.	.	PUNCT
ahs-14180	253	1	‐	‐	ADJ
ahs-14180	253	2	nature	nature	NOUN
ahs-14180	253	3	,	,	PUNCT
ahs-14180	253	4	479(7373	479(7373	NUM
ahs-14180	253	5	):	):	PUNCT
ahs-14180	253	6	419­	419­	PROPN
ahs-14180	253	7	422	422	NUM
ahs-14180	253	8	.	.	PUNCT
ahs-14180	254	1	livak	livak	PROPN
ahs-14180	254	2	k.j	k.j	PROPN
ahs-14180	254	3	.	.	PROPN
ahs-14180	254	4	,	,	PUNCT
ahs-14180	254	5	schmittgen	schmittgen	PROPN
ahs-14180	254	6	d.s	d.s	PROPN
ahs-14180	254	7	.	.	PROPN
ahs-14180	254	8	,	,	PUNCT
ahs-14180	254	9	2001	2001	NUM
ahs-14180	254	10	­	­	VERB
ahs-14180	254	11	analysis	analysis	NOUN
ahs-14180	254	12	of	of	ADP
ahs-14180	254	13	relative	relative	ADJ
ahs-14180	254	14	gene	gene	NOUN
ahs-14180	254	15	expression	expression	NOUN
ahs-14180	254	16	data	datum	NOUN
ahs-14180	254	17	using	use	VERB
ahs-14180	254	18	real‐time	real‐time	NOUN
ahs-14180	254	19	quantitative	quantitative	ADJ
ahs-14180	254	20	pcr	pcr	NOUN
ahs-14180	254	21	and	and	CCONJ
ahs-14180	254	22	the	the	DET
ahs-14180	254	23	2−	2−	NUM
ahs-14180	254	24	δδct	δδct	NOUN
ahs-14180	254	25	method	method	NOUN
ahs-14180	254	26	.	.	PUNCT
ahs-14180	255	1	‐	‐	ADJ
ahs-14180	255	2	methods	method	NOUN
ahs-14180	255	3	,	,	PUNCT
ahs-14180	255	4	25(4	25(4	NOUN
ahs-14180	255	5	):	):	PUNCT
ahs-14180	255	6	402­408	402­408	NOUN
ahs-14180	255	7	.	.	PUNCT
ahs-14180	256	1	lumpkin	lumpkin	PROPN
ahs-14180	256	2	c.	c.	PROPN
ahs-14180	256	3	,	,	PUNCT
ahs-14180	256	4	fellman	fellman	NOUN
ahs-14180	256	5	j.k	j.k	PROPN
ahs-14180	256	6	.	.	PROPN
ahs-14180	256	7	,	,	PUNCT
ahs-14180	256	8	rudell	rudell	PROPN
ahs-14180	256	9	d.r	d.r	PROPN
ahs-14180	256	10	.	.	PROPN
ahs-14180	256	11	,	,	PUNCT
ahs-14180	256	12	mattheis	mattheis	PROPN
ahs-14180	256	13	j.	j.	PROPN
ahs-14180	256	14	,	,	PUNCT
ahs-14180	256	15	2014	2014	NUM
ahs-14180	256	16	­	­	VERB
ahs-14180	256	17	‘	'	PUNCT
ahs-14180	256	18	scarlett	scarlett	NOUN
ahs-14180	256	19	spur	spur	VERB
ahs-14180	256	20	red	red	PROPN
ahs-14180	256	21	delicious	delicious	PROPN
ahs-14180	256	22	’	'	PUNCT
ahs-14180	256	23	apple	apple	NOUN
ahs-14180	256	24	volatile	volatile	ADJ
ahs-14180	256	25	pro‐	pro‐	PROPN
ahs-14180	256	26	duction	duction	NOUN
ahs-14180	256	27	accompanying	accompany	VERB
ahs-14180	256	28	physiological	physiological	ADJ
ahs-14180	256	29	disorder	disorder	NOUN
ahs-14180	256	30	develop‐	develop‐	NOUN
ahs-14180	256	31	ment	ment	NOUN
ahs-14180	256	32	during	during	ADP
ahs-14180	256	33	low	low	ADJ
ahs-14180	256	34	po2	po2	PROPN
ahs-14180	256	35	controlled	control	VERB
ahs-14180	256	36	atmosphere	atmosphere	NOUN
ahs-14180	256	37	storage	storage	NOUN
ahs-14180	256	38	.	.	PUNCT
ahs-14180	257	1	­	­	PROPN
ahs-14180	257	2	j.	j.	PROPN
ahs-14180	257	3	agric	agric	PROPN
ahs-14180	257	4	.	.	PUNCT
ahs-14180	258	1	food	food	NOUN
ahs-14180	258	2	chem	chem	NOUN
ahs-14180	258	3	.	.	PUNCT
ahs-14180	258	4	,	,	PUNCT
ahs-14180	258	5	62	62	NUM
ahs-14180	258	6	:	:	SYM
ahs-14180	258	7	1741­1754	1741­1754	NUM
ahs-14180	258	8	.	.	X
ahs-14180	258	9	mustroph	mustroph	PROPN
ahs-14180	258	10	a.	a.	PROPN
ahs-14180	258	11	,	,	PUNCT
ahs-14180	258	12	hess	hess	PROPN
ahs-14180	258	13	n.	n.	NOUN
ahs-14180	258	14	,	,	PUNCT
ahs-14180	258	15	sasidharan	sasidharan	PROPN
ahs-14180	258	16	r.	r.	PROPN
ahs-14180	258	17	,	,	PUNCT
ahs-14180	258	18	2014	2014	NUM
ahs-14180	258	19	­	­	NUM
ahs-14180	258	20	hypoxic	hypoxic	ADJ
ahs-14180	258	21	energy	energy	NOUN
ahs-14180	258	22	metabolism	metabolism	NOUN
ahs-14180	258	23	and	and	CCONJ
ahs-14180	258	24	ppi	ppi	NOUN
ahs-14180	258	25	as	as	ADP
ahs-14180	258	26	an	an	DET
ahs-14180	258	27	alternative	alternative	ADJ
ahs-14180	258	28	energy	energy	NOUN
ahs-14180	258	29	currency	currency	NOUN
ahs-14180	258	30	,	,	PUNCT
ahs-14180	258	31	pp	pp	ADV
ahs-14180	258	32	.	.	PUNCT
ahs-14180	259	1	165­184	165­184	NOUN
ahs-14180	259	2	.	.	PUNCT
ahs-14180	260	1	‐	‐	ADV
ahs-14180	260	2	in	in	ADP
ahs-14180	260	3	:	:	PUNCT
ahs-14180	260	4	van	van	PROPN
ahs-14180	260	5	dongen	dongen	PROPN
ahs-14180	260	6	j.	j.	PROPN
ahs-14180	260	7	and	and	CCONJ
ahs-14180	260	8	f.	f.	PROPN
ahs-14180	260	9	licausi	licausi	PROPN
ahs-14180	260	10	(	(	PUNCT
ahs-14180	260	11	eds	ed	NOUN
ahs-14180	260	12	.	.	PUNCT
ahs-14180	260	13	)	)	PUNCT
ahs-14180	261	1	low‐oxygen	low‐oxygen	NOUN
ahs-14180	261	2	stress	stress	NOUN
ahs-14180	261	3	in	in	ADP
ahs-14180	261	4	plants	plant	NOUN
ahs-14180	261	5	.	.	PUNCT
ahs-14180	262	1	oxygen	oxygen	NOUN
ahs-14180	262	2	sensing	sensing	NOUN
ahs-14180	262	3	and	and	CCONJ
ahs-14180	262	4	adaptive	adaptive	ADJ
ahs-14180	262	5	responses	response	NOUN
ahs-14180	262	6	to	to	ADP
ahs-14180	262	7	hypoxia	hypoxia	NOUN
ahs-14180	262	8	.	.	PUNCT
ahs-14180	263	1	springer	springer	NOUN
ahs-14180	263	2	,	,	PUNCT
ahs-14180	263	3	vienna	vienna	PROPN
ahs-14180	263	4	,	,	PUNCT
ahs-14180	263	5	austria	austria	PROPN
ahs-14180	263	6	,	,	PUNCT
ahs-14180	263	7	pp	pp	ADJ
ahs-14180	263	8	.	.	PUNCT
ahs-14180	264	1	426	426	NUM
ahs-14180	264	2	.	.	PUNCT
ahs-14180	265	1	park	park	PROPN
ahs-14180	265	2	d.	d.	PROPN
ahs-14180	265	3	,	,	PUNCT
ahs-14180	265	4	al	al	PROPN
ahs-14180	265	5	shoffe	shoffe	PROPN
ahs-14180	265	6	y.	y.	PROPN
ahs-14180	265	7	,	,	PUNCT
ahs-14180	265	8	algul	algul	PROPN
ahs-14180	265	9	b.e	b.e	PROPN
ahs-14180	265	10	.	.	PROPN
ahs-14180	265	11	,	,	PUNCT
ahs-14180	265	12	watkins	watkins	PROPN
ahs-14180	265	13	c.b	c.b	PROPN
ahs-14180	265	14	.	.	PROPN
ahs-14180	265	15	,	,	PUNCT
ahs-14180	265	16	2022	2022	NUM
ahs-14180	265	17	­	­	VERB
ahs-14180	265	18	fermentative	fermentative	ADJ
ahs-14180	265	19	metabolism	metabolism	NOUN
ahs-14180	265	20	of	of	ADP
ahs-14180	265	21	three	three	NUM
ahs-14180	265	22	apple	apple	NOUN
ahs-14180	265	23	cultivars	cultivar	NOUN
ahs-14180	265	24	dur‐	dur‐	NOUN
ahs-14180	265	25	ing	ing	ADJ
ahs-14180	265	26	storage	storage	NOUN
ahs-14180	265	27	under	under	ADP
ahs-14180	265	28	low	low	ADJ
ahs-14180	265	29	partial	partial	ADJ
ahs-14180	265	30	pressures	pressure	NOUN
ahs-14180	265	31	of	of	ADP
ahs-14180	265	32	oxygen	oxygen	NOUN
ahs-14180	265	33	.	.	PUNCT
ahs-14180	266	1	­	­	PROPN
ahs-14180	266	2	postharvest	postharv	ADJ
ahs-14180	266	3	biol	biol	PROPN
ahs-14180	266	4	.	.	PUNCT
ahs-14180	267	1	technol	technol	PROPN
ahs-14180	267	2	.	.	PROPN
ahs-14180	267	3	,	,	PUNCT
ahs-14180	267	4	193	193	NUM
ahs-14180	267	5	:	:	SYM
ahs-14180	267	6	112037	112037	NUM
ahs-14180	267	7	.	.	PUNCT
ahs-14180	268	1	pedreschi	pedreschi	PROPN
ahs-14180	268	2	r.	r.	PROPN
ahs-14180	268	3	,	,	PUNCT
ahs-14180	268	4	franck	franck	PROPN
ahs-14180	268	5	c.	c.	PROPN
ahs-14180	268	6	,	,	PUNCT
ahs-14180	268	7	lammertyn	lammertyn	PROPN
ahs-14180	268	8	j.	j.	PROPN
ahs-14180	268	9	,	,	PUNCT
ahs-14180	268	10	erban	erban	PROPN
ahs-14180	268	11	a.	a.	PROPN
ahs-14180	268	12	,	,	PUNCT
ahs-14180	268	13	kopka	kopka	PROPN
ahs-14180	268	14	j.	j.	PROPN
ahs-14180	268	15	,	,	PUNCT
ahs-14180	268	16	hertog	hertog	PROPN
ahs-14180	268	17	m.	m.	NOUN
ahs-14180	268	18	,	,	PUNCT
ahs-14180	268	19	verlinden	verlinden	PROPN
ahs-14180	268	20	b.	b.	PROPN
ahs-14180	268	21	,	,	PUNCT
ahs-14180	268	22	nicolai	nicolai	PROPN
ahs-14180	268	23	b.	b.	PROPN
ahs-14180	268	24	,	,	PUNCT
ahs-14180	268	25	2009	2009	NUM
ahs-14180	268	26	‐	‐	ADJ
ahs-14180	268	27	metabolic	metabolic	NOUN
ahs-14180	268	28	profiling	profiling	NOUN
ahs-14180	268	29	of	of	ADP
ahs-14180	268	30	“	"	PUNCT
ahs-14180	268	31	conference	conference	NOUN
ahs-14180	268	32	”	"	PUNCT
ahs-14180	268	33	pears	pear	NOUN
ahs-14180	268	34	under	under	ADP
ahs-14180	268	35	low	low	ADJ
ahs-14180	268	36	oxygen	oxygen	NOUN
ahs-14180	268	37	stress	stress	NOUN
ahs-14180	268	38	.	.	PUNCT
ahs-14180	269	1	­	­	PROPN
ahs-14180	269	2	postharvest	postharv	ADJ
ahs-14180	269	3	biol	biol	PROPN
ahs-14180	269	4	.	.	PUNCT
ahs-14180	270	1	technol	technol	PROPN
ahs-14180	270	2	.	.	PROPN
ahs-14180	270	3	,	,	PUNCT
ahs-14180	271	1	51(2	51(2	NUM
ahs-14180	271	2	):	):	PUNCT
ahs-14180	271	3	123­	123­	PROPN
ahs-14180	271	4	130	130	NUM
ahs-14180	271	5	.	.	PUNCT
ahs-14180	272	1	pesis	pesis	PROPN
ahs-14180	272	2	e.	e.	PROPN
ahs-14180	272	3	,	,	PUNCT
ahs-14180	272	4	2005	2005	NUM
ahs-14180	272	5	­	­	VERB
ahs-14180	272	6	the	the	DET
ahs-14180	272	7	role	role	NOUN
ahs-14180	272	8	of	of	ADP
ahs-14180	272	9	anaerobic	anaerobic	ADJ
ahs-14180	272	10	metabolites	metabolite	NOUN
ahs-14180	272	11	,	,	PUNCT
ahs-14180	272	12	acetaldehyde	acetaldehyde	NOUN
ahs-14180	272	13	,	,	PUNCT
ahs-14180	272	14	and	and	CCONJ
ahs-14180	272	15	ethanol	ethanol	NOUN
ahs-14180	272	16	,	,	PUNCT
ahs-14180	272	17	in	in	ADP
ahs-14180	272	18	fruit	fruit	NOUN
ahs-14180	272	19	ripening	ripening	NOUN
ahs-14180	272	20	,	,	PUNCT
ahs-14180	272	21	enhance‐	enhance‐	NOUN
ahs-14180	272	22	ment	ment	NOUN
ahs-14180	272	23	of	of	ADP
ahs-14180	272	24	fruit	fruit	NOUN
ahs-14180	272	25	quality	quality	NOUN
ahs-14180	272	26	and	and	CCONJ
ahs-14180	272	27	fruit	fruit	NOUN
ahs-14180	272	28	deterioration	deterioration	NOUN
ahs-14180	272	29	.	.	PUNCT
ahs-14180	273	1	­	­	PROPN
ahs-14180	273	2	postharvest	postharv	ADJ
ahs-14180	273	3	biol	biol	ADJ
ahs-14180	273	4	technol	technol	NOUN
ahs-14180	273	5	.	.	PUNCT
ahs-14180	273	6	,	,	PUNCT
ahs-14180	273	7	37(1	37(1	NUM
ahs-14180	273	8	):	):	PUNCT
ahs-14180	273	9	1­19	1­19	NUM
ahs-14180	273	10	.	.	PUNCT
ahs-14180	274	1	scott	scott	PROPN
ahs-14180	274	2	k.j	k.j	PROPN
ahs-14180	274	3	.	.	PROPN
ahs-14180	274	4	,	,	PUNCT
ahs-14180	274	5	yuen	yuen	PROPN
ahs-14180	274	6	c.m.c	c.m.c	PROPN
ahs-14180	274	7	.	.	PROPN
ahs-14180	274	8	,	,	PUNCT
ahs-14180	274	9	ghahramani	ghahramani	PROPN
ahs-14180	274	10	f.	f.	PROPN
ahs-14180	274	11	,	,	PUNCT
ahs-14180	274	12	2000	2000	NUM
ahs-14180	274	13	­	­	NOUN
ahs-14180	274	14	ethanol	ethanol	NOUN
ahs-14180	274	15	vapor	vapor	NOUN
ahs-14180	274	16	‐	‐	VERB
ahs-14180	274	17	a	a	DET
ahs-14180	274	18	new	new	ADJ
ahs-14180	274	19	anti‐scald	anti‐scald	NOUN
ahs-14180	274	20	treatment	treatment	NOUN
ahs-14180	274	21	for	for	ADP
ahs-14180	274	22	apples	apple	NOUN
ahs-14180	274	23	.	.	PUNCT
ahs-14180	275	1	­	­	PROPN
ahs-14180	275	2	postharvest	postharv	ADJ
ahs-14180	275	3	biol	biol	PROPN
ahs-14180	275	4	.	.	PUNCT
ahs-14180	276	1	technol	technol	PROPN
ahs-14180	276	2	.	.	PROPN
ahs-14180	276	3	,	,	PUNCT
ahs-14180	276	4	6	6	NUM
ahs-14180	276	5	:	:	PUNCT
ahs-14180	276	6	201­208	201­208	NUM
ahs-14180	276	7	.	.	PUNCT
ahs-14180	277	1	thewes	thewes	PROPN
ahs-14180	277	2	f.r	f.r	PROPN
ahs-14180	277	3	.	.	PROPN
ahs-14180	277	4	,	,	PUNCT
ahs-14180	277	5	balkees	balkees	PROPN
ahs-14180	277	6	b.m	b.m	PROPN
ahs-14180	277	7	.	.	PROPN
ahs-14180	277	8	,	,	PUNCT
ahs-14180	277	9	buchele	buchele	PROPN
ahs-14180	277	10	f.	f.	PROPN
ahs-14180	277	11	,	,	PUNCT
ahs-14180	277	12	wunsche	wunsche	PROPN
ahs-14180	277	13	j.n	j.n	PROPN
ahs-14180	277	14	.	.	PROPN
ahs-14180	277	15	,	,	PUNCT
ahs-14180	277	16	neuwald	neuwald	PROPN
ahs-14180	277	17	d.a	d.a	PROPN
ahs-14180	277	18	.	.	PROPN
ahs-14180	277	19	,	,	PUNCT
ahs-14180	277	20	brackmann	brackmann	PROPN
ahs-14180	277	21	a.	a.	PROPN
ahs-14180	277	22	,	,	PUNCT
ahs-14180	277	23	2021	2021	NUM
ahs-14180	277	24	a	a	DET
ahs-14180	277	25	­	­	NOUN
ahs-14180	277	26	ethanol	ethanol	NOUN
ahs-14180	277	27	vapor	vapor	NOUN
ahs-14180	277	28	treatment	treatment	NOUN
ahs-14180	277	29	inhibits	inhibit	VERB
ahs-14180	277	30	apple	apple	NOUN
ahs-14180	277	31	ripening	ripening	NOUN
ahs-14180	277	32	at	at	ADP
ahs-14180	277	33	room	room	NOUN
ahs-14180	277	34	tem‐	tem‐	NOUN
ahs-14180	277	35	perature	perature	NOUN
ahs-14180	277	36	even	even	ADV
ahs-14180	277	37	with	with	ADP
ahs-14180	277	38	the	the	DET
ahs-14180	277	39	presence	presence	NOUN
ahs-14180	277	40	of	of	ADP
ahs-14180	277	41	ethylene	ethylene	NOUN
ahs-14180	277	42	.	.	PUNCT
ahs-14180	278	1	­	­	PROPN
ahs-14180	278	2	postharvest	postharv	ADJ
ahs-14180	278	3	biol	biol	PROPN
ahs-14180	278	4	.	.	PUNCT
ahs-14180	279	1	technol	technol	PROPN
ahs-14180	279	2	.	.	PROPN
ahs-14180	279	3	,	,	PUNCT
ahs-14180	279	4	173	173	NUM
ahs-14180	279	5	:	:	SYM
ahs-14180	279	6	111415	111415	NUM
ahs-14180	279	7	.	.	PUNCT
ahs-14180	280	1	thewes	thewes	NOUN
ahs-14180	280	2	f.r	f.r	PROPN
ahs-14180	280	3	.	.	PROPN
ahs-14180	280	4	,	,	PUNCT
ahs-14180	280	5	brackmann	brackmann	PROPN
ahs-14180	280	6	a.	a.	PROPN
ahs-14180	280	7	,	,	PUNCT
ahs-14180	280	8	neuwald	neuwald	NOUN
ahs-14180	280	9	d.a	d.a	PROPN
ahs-14180	280	10	.	.	PROPN
ahs-14180	280	11	,	,	PUNCT
ahs-14180	280	12	2019	2019	NUM
ahs-14180	280	13	­	­	NUM
ahs-14180	280	14	dynamics	dynamic	NOUN
ahs-14180	280	15	of	of	ADP
ahs-14180	280	16	sugars	sugar	NOUN
ahs-14180	280	17	,	,	PUNCT
ahs-14180	280	18	anaerobic	anaerobic	ADJ
ahs-14180	280	19	metabolism	metabolism	NOUN
ahs-14180	280	20	enzymes	enzyme	NOUN
ahs-14180	280	21	and	and	CCONJ
ahs-14180	280	22	metabolites	metabolite	NOUN
ahs-14180	280	23	in	in	ADP
ahs-14180	280	24	apples	apple	NOUN
ahs-14180	280	25	stored	store	VERB
ahs-14180	280	26	under	under	ADP
ahs-14180	280	27	dynamic	dynamic	ADJ
ahs-14180	280	28	con‐	con‐	NOUN
ahs-14180	280	29	trolled	troll	VERB
ahs-14180	280	30	atmosphere	atmosphere	NOUN
ahs-14180	280	31	.	.	PUNCT
ahs-14180	281	1	­	­	PROPN
ahs-14180	281	2	sci	sci	PROPN
ahs-14180	281	3	.	.	PUNCT
ahs-14180	282	1	hortic	hortic	PROPN
ahs-14180	282	2	.	.	PUNCT
ahs-14180	283	1	,	,	PUNCT
ahs-14180	283	2	255	255	NUM
ahs-14180	283	3	:	:	PUNCT
ahs-14180	283	4	145­152	145­152	NUM
ahs-14180	283	5	.	.	PUNCT
ahs-14180	284	1	thewes	thewes	PROPN
ahs-14180	284	2	f.r	f.r	PROPN
ahs-14180	284	3	.	.	PROPN
ahs-14180	284	4	,	,	PUNCT
ahs-14180	284	5	thewes	thewes	NOUN
ahs-14180	284	6	f.r	f.r	PROPN
ahs-14180	284	7	.	.	PROPN
ahs-14180	284	8	,	,	PUNCT
ahs-14180	284	9	both	both	CCONJ
ahs-14180	284	10	v.	v.	ADP
ahs-14180	284	11	,	,	PUNCT
ahs-14180	284	12	schultz	schultz	PROPN
ahs-14180	284	13	e.e	e.e	PROPN
ahs-14180	284	14	.	.	PROPN
ahs-14180	284	15	,	,	PUNCT
ahs-14180	284	16	pas­	pas­	PROPN
ahs-14180	284	17	quetti	quetti	PROPN
ahs-14180	284	18	berghetti	berghetti	PROPN
ahs-14180	284	19	m.r	m.r	PROPN
ahs-14180	284	20	.	.	PROPN
ahs-14180	284	21	,	,	PUNCT
ahs-14180	284	22	ludwig	ludwig	PROPN
ahs-14180	284	23	v.	v.	PROPN
ahs-14180	284	24	,	,	PUNCT
ahs-14180	284	25	brackmann	brackmann	PROPN
ahs-14180	284	26	a.	a.	PROPN
ahs-14180	284	27	,	,	PUNCT
ahs-14180	284	28	2021	2021	NUM
ahs-14180	284	29	b	b	NOUN
ahs-14180	284	30	­	­	NUM
ahs-14180	284	31	static	static	ADJ
ahs-14180	284	32	×	×	PROPN
ahs-14180	284	33	dynamic	dynamic	ADJ
ahs-14180	284	34	controlled	control	VERB
ahs-14180	284	35	atmosphere	atmosphere	NOUN
ahs-14180	284	36	:	:	PUNCT
ahs-14180	284	37	impacts	impact	NOUN
ahs-14180	284	38	of	of	ADP
ahs-14180	284	39	aerobic	aerobic	ADJ
ahs-14180	284	40	and	and	CCONJ
ahs-14180	284	41	anaerobic	anaerobic	ADJ
ahs-14180	284	42	metabolism	metabolism	NOUN
ahs-14180	284	43	on	on	ADP
ahs-14180	284	44	physi‐	physi‐	NOUN
ahs-14180	284	45	ological	ological	ADJ
ahs-14180	284	46	disorders	disorder	NOUN
ahs-14180	284	47	and	and	CCONJ
ahs-14180	284	48	overall	overall	ADJ
ahs-14180	284	49	quality	quality	NOUN
ahs-14180	284	50	of	of	ADP
ahs-14180	284	51	‘	'	PUNCT
ahs-14180	284	52	royal	royal	ADJ
ahs-14180	284	53	gala	gala	NOUN
ahs-14180	284	54	’	'	PUNCT
ahs-14180	284	55	apples	apple	NOUN
ahs-14180	284	56	.	.	PUNCT
ahs-14180	285	1	‐	‐	NOUN
ahs-14180	285	2	lwt	lwt	NOUN
ahs-14180	285	3	,	,	PUNCT
ahs-14180	285	4	food	food	PROPN
ahs-14180	285	5	sci	sci	PROPN
ahs-14180	285	6	.	.	PROPN
ahs-14180	285	7	technol	technol	PROPN
ahs-14180	285	8	.	.	PROPN
ahs-14180	285	9	,	,	PUNCT
ahs-14180	285	10	141	141	NUM
ahs-14180	285	11	:	:	SYM
ahs-14180	285	12	110922	110922	NUM
ahs-14180	285	13	.	.	PUNCT
ahs-14180	286	1	tonutti	tonutti	PROPN
ahs-14180	286	2	p.	p.	PROPN
ahs-14180	286	3	,	,	PUNCT
ahs-14180	286	4	2015	2015	NUM
ahs-14180	286	5	­	­	VERB
ahs-14180	286	6	the	the	DET
ahs-14180	286	7	technical	technical	ADJ
ahs-14180	286	8	evolution	evolution	NOUN
ahs-14180	286	9	of	of	ADP
ahs-14180	286	10	ca	ca	PROPN
ahs-14180	286	11	storage	storage	NOUN
ahs-14180	286	12	protocols	protocol	NOUN
ahs-14180	286	13	and	and	CCONJ
ahs-14180	286	14	the	the	DET
ahs-14180	286	15	advancements	advancement	NOUN
ahs-14180	286	16	in	in	ADP
ahs-14180	286	17	elucidating	elucidate	VERB
ahs-14180	286	18	the	the	DET
ahs-14180	286	19	fruit	fruit	NOUN
ahs-14180	286	20	responses	response	NOUN
ahs-14180	286	21	to	to	ADP
ahs-14180	286	22	low	low	ADJ
ahs-14180	286	23	oxygen	oxygen	NOUN
ahs-14180	286	24	stress	stress	NOUN
ahs-14180	286	25	.	.	PUNCT
ahs-14180	287	1	­	­	PROPN
ahs-14180	287	2	acta	acta	PROPN
ahs-14180	287	3	horticulturae	horticulturae	PROPN
ahs-14180	287	4	,	,	PUNCT
ahs-14180	287	5	1079	1079	NUM
ahs-14180	287	6	:	:	PUNCT
ahs-14180	288	1	53­60	53­60	NUM
ahs-14180	288	2	.	.	PUNCT
ahs-14180	289	1	vilhena	vilhena	PROPN
ahs-14180	289	2	n.q	n.q	PROPN
ahs-14180	289	3	.	.	PROPN
ahs-14180	289	4	,	,	PUNCT
ahs-14180	289	5	tessmer	tessmer	PROPN
ahs-14180	289	6	m.a	m.a	PROPN
ahs-14180	289	7	.	.	PROPN
ahs-14180	289	8	,	,	PUNCT
ahs-14180	289	9	hernando	hernando	PROPN
ahs-14180	289	10	i.	i.	PROPN
ahs-14180	289	11	,	,	PUNCT
ahs-14180	289	12	kluge	kluge	VERB
ahs-14180	289	13	r.a	r.a	PROPN
ahs-14180	289	14	.	.	PROPN
ahs-14180	289	15	,	,	PUNCT
ahs-14180	289	16	quiles	quiles	PROPN
ahs-14180	289	17	a.	a.	PROPN
ahs-14180	289	18	,	,	PUNCT
ahs-14180	289	19	salvador	salvador	PROPN
ahs-14180	289	20	a.	a.	PROPN
ahs-14180	289	21	,	,	PUNCT
ahs-14180	289	22	2022	2022	NUM
ahs-14180	289	23	­	­	VERB
ahs-14180	289	24	structural	structural	ADJ
ahs-14180	289	25	changes	change	NOUN
ahs-14180	289	26	caused	cause	VERB
ahs-14180	289	27	by	by	ADP
ahs-14180	289	28	co2	co2	NOUN
ahs-14180	289	29	or	or	CCONJ
ahs-14180	289	30	ethanol	ethanol	NOUN
ahs-14180	289	31	deastringency	deastringency	NOUN
ahs-14180	289	32	treatments	treatment	NOUN
ahs-14180	289	33	in	in	ADP
ahs-14180	289	34	cold‐stored	cold‐stored	ADJ
ahs-14180	289	35	‘	'	PUNCT
ahs-14180	289	36	giombo	giombo	NOUN
ahs-14180	289	37	’	'	PUNCT
ahs-14180	289	38	persimmon	persimmon	NOUN
ahs-14180	289	39	.	.	PUNCT
ahs-14180	290	1	­	­	PROPN
ahs-14180	290	2	j.	j.	PROPN
ahs-14180	290	3	agron	agron	PROPN
ahs-14180	290	4	.	.	PUNCT
ahs-14180	290	5	,12(10	,12(10	PUNCT
ahs-14180	290	6	)	)	PUNCT
ahs-14180	290	7	.	.	PUNCT
ahs-14180	291	1	weber	weber	PROPN
ahs-14180	291	2	a.	a.	PROPN
ahs-14180	291	3	,	,	PUNCT
ahs-14180	291	4	neuwald	neuwald	NOUN
ahs-14180	291	5	d.a	d.a	PROPN
ahs-14180	291	6	.	.	PROPN
ahs-14180	291	7	,	,	PUNCT
ahs-14180	291	8	kittermann	kittermann	PROPN
ahs-14180	291	9	d.	d.	PROPN
ahs-14180	291	10	,	,	PUNCT
ahs-14180	291	11	thewes	thewes	PROPN
ahs-14180	291	12	f.r	f.r	PROPN
ahs-14180	291	13	.	.	PROPN
ahs-14180	291	14	,	,	PUNCT
ahs-14180	291	15	both	both	CCONJ
ahs-14180	291	16	v.	v.	ADP
ahs-14180	291	17	,	,	PUNCT
ahs-14180	291	18	brackmann	brackmann	PROPN
ahs-14180	291	19	a.	a.	PROPN
ahs-14180	291	20	,	,	PUNCT
ahs-14180	291	21	2020	2020	NUM
ahs-14180	291	22	­	­	VERB
ahs-14180	291	23	influence	influence	NOUN
ahs-14180	291	24	of	of	ADP
ahs-14180	291	25	respirato‐	respirato‐	NOUN
ahs-14180	291	26	ry	ry	PROPN
ahs-14180	291	27	quotient	quotient	VERB
ahs-14180	291	28	dynamic	dynamic	PROPN
ahs-14180	291	29	controlled	control	VERB
ahs-14180	291	30	atmosphere	atmosphere	NOUN
ahs-14180	291	31	(	(	PUNCT
ahs-14180	291	32	dca‐rq	dca‐rq	NOUN
ahs-14180	291	33	)	)	PUNCT
ahs-14180	291	34	and	and	CCONJ
ahs-14180	291	35	ethanol	ethanol	NOUN
ahs-14180	291	36	application	application	NOUN
ahs-14180	291	37	on	on	ADP
ahs-14180	291	38	softening	soften	VERB
ahs-14180	291	39	of	of	ADP
ahs-14180	291	40	braeburn	braeburn	NOUN
ahs-14180	291	41	apples	apple	NOUN
ahs-14180	291	42	.	.	PUNCT
ahs-14180	292	1	‐	‐	ADJ
ahs-14180	292	2	food	food	NOUN
ahs-14180	292	3	chem	chem	NOUN
ahs-14180	292	4	.	.	PUNCT
ahs-14180	292	5	,	,	PUNCT
ahs-14180	292	6	303	303	NUM
ahs-14180	292	7	:	:	SYM
ahs-14180	292	8	125346	125346	NUM
ahs-14180	292	9	.	.	PUNCT
ahs-14180	293	1	wood	wood	PROPN
ahs-14180	293	2	r.m	r.m	PROPN
ahs-14180	293	3	.	.	PROPN
ahs-14180	293	4	,	,	PUNCT
ahs-14180	293	5	thewes	thewes	NOUN
ahs-14180	293	6	f.r	f.r	PROPN
ahs-14180	293	7	.	.	PROPN
ahs-14180	293	8	,	,	PUNCT
ahs-14180	293	9	reynaud	reynaud	PROPN
ahs-14180	293	10	m.	m.	PROPN
ahs-14180	293	11	,	,	PUNCT
ahs-14180	293	12	kittemann	kittemann	PROPN
ahs-14180	293	13	d.	d.	PROPN
ahs-14180	293	14	,	,	PUNCT
ahs-14180	293	15	sautter	sautter	PROPN
ahs-14180	293	16	c.k	c.k	PROPN
ahs-14180	293	17	.	.	PROPN
ahs-14180	293	18	,	,	PUNCT
ahs-14180	293	19	wünsche	wünsche	PROPN
ahs-14180	293	20	j.n	j.n	PROPN
ahs-14180	293	21	.	.	PROPN
ahs-14180	293	22	,	,	PUNCT
ahs-14180	293	23	neuwald	neuwald	PROPN
ahs-14180	293	24	d.a	d.a	PROPN
ahs-14180	293	25	.	.	PROPN
ahs-14180	293	26	,	,	PUNCT
ahs-14180	293	27	2022	2022	NUM
ahs-14180	293	28	­	­	VERB
ahs-14180	293	29	apple	apple	NOUN
ahs-14180	293	30	fruit	fruit	NOUN
ahs-14180	293	31	recovery	recovery	NOUN
ahs-14180	293	32	from	from	ADP
ahs-14180	293	33	anoxia	anoxia	PROPN
ahs-14180	293	34	under	under	ADP
ahs-14180	293	35	controlled	control	VERB
ahs-14180	293	36	atmosphere	atmosphere	NOUN
ahs-14180	293	37	storage	storage	NOUN
ahs-14180	293	38	.	.	PUNCT
ahs-14180	294	1	­	­	VERB
ahs-14180	294	2	food	food	NOUN
ahs-14180	294	3	chem	chem	NOUN
ahs-14180	294	4	.	.	PUNCT
ahs-14180	294	5	,	,	PUNCT
ahs-14180	294	6	371	371	NUM
ahs-14180	294	7	:	:	SYM
ahs-14180	294	8	131152	131152	NUM
ahs-14180	294	9	.	.	PUNCT
ahs-14180	295	1	zanella	zanella	NOUN
ahs-14180	295	2	a.	a.	PROPN
ahs-14180	295	3	,	,	PUNCT
ahs-14180	295	4	stürz	stürz	PROPN
ahs-14180	295	5	s.	s.	PROPN
ahs-14180	295	6	,	,	PUNCT
ahs-14180	295	7	2015	2015	NUM
ahs-14180	295	8	‐	‐	NOUN
ahs-14180	295	9	optimizing	optimize	VERB
ahs-14180	295	10	postharvest	postharvest	VERB
ahs-14180	295	11	life	life	NOUN
ahs-14180	295	12	of	of	ADP
ahs-14180	295	13	horticultural	horticultural	ADJ
ahs-14180	295	14	products	product	NOUN
ahs-14180	295	15	by	by	ADP
ahs-14180	295	16	means	mean	NOUN
ahs-14180	295	17	of	of	ADP
ahs-14180	295	18	dynamic	dynamic	ADJ
ahs-14180	295	19	ca	ca	NOUN
ahs-14180	295	20	:	:	PUNCT
ahs-14180	295	21	fruit	fruit	NOUN
ahs-14180	295	22	physiology	physiology	NOUN
ahs-14180	295	23	controls	control	VERB
ahs-14180	295	24	atmosphere	atmosphere	NOUN
ahs-14180	295	25	composition	composition	NOUN
ahs-14180	295	26	during	during	ADP
ahs-14180	295	27	storage	storage	NOUN
ahs-14180	295	28	.	.	PUNCT
ahs-14180	296	1	­	­	PROPN
ahs-14180	296	2	acta	acta	PROPN
ahs-14180	296	3	horticulturae	horticulturae	PROPN
ahs-14180	296	4	,	,	PUNCT
ahs-14180	296	5	1071	1071	NUM
ahs-14180	296	6	:	:	PUNCT
ahs-14180	297	1	59­68	59­68	X
ahs-14180	297	2	.	.	PUNCT
ahs-14180	298	1	https://www.sciencedirect.com/science/article/pii/s0925521422002058	https://www.sciencedirect.com/science/article/pii/s0925521422002058	NUM
ahs-14180	298	2	https://www.sciencedirect.com/science/article/pii/s0925521422002058	https://www.sciencedirect.com/science/article/pii/s0925521422002058	NUM