id	sid	tid	token	lemma	pos
ahs-14952	1	1	impaginato	impaginato	PROPN
ahs-14952	1	2	97	97	NUM
ahs-14952	1	3	adv	adv	PROPN
ahs-14952	1	4	.	.	PUNCT
ahs-14952	1	5	hort	hort	PROPN
ahs-14952	1	6	.	.	PUNCT
ahs-14952	2	1	sci	sci	PROPN
ahs-14952	2	2	.	.	PROPN
ahs-14952	2	3	,	,	PUNCT
ahs-14952	2	4	2024	2024	NUM
ahs-14952	2	5	38(1	38(1	NOUN
ahs-14952	2	6	):	):	PUNCT
ahs-14952	2	7	97­116	97­116	NUM
ahs-14952	2	8	doi	doi	NOUN
ahs-14952	2	9	:	:	PUNCT
ahs-14952	2	10	10.36253	10.36253	NUM
ahs-14952	2	11	/	/	SYM
ahs-14952	2	12	ahsc­14952	ahsc­14952	PROPN
ahs-14952	2	13	a	a	DET
ahs-14952	2	14	review	review	NOUN
ahs-14952	2	15	:	:	PUNCT
ahs-14952	2	16	molecular	molecular	ADJ
ahs-14952	2	17	identification	identification	NOUN
ahs-14952	2	18	of	of	ADP
ahs-14952	2	19	orchid	orchid	NOUN
ahs-14952	2	20	mycorrhiza	mycorrhiza	PROPN
ahs-14952	2	21	n.a	n.a	PROPN
ahs-14952	2	22	.	.	PROPN
ahs-14952	2	23	shamsudin	shamsudin	VERB
ahs-14952	2	24	1	1	NUM
ahs-14952	2	25	,	,	PUNCT
ahs-14952	3	1	j.s.s	j.s.s	PROPN
ahs-14952	3	2	.	.	PUNCT
ahs-14952	3	3	seelan	seelan	PROPN
ahs-14952	3	4	1	1	NUM
ahs-14952	3	5	,	,	PUNCT
ahs-14952	3	6	j.a	j.a	PROPN
ahs-14952	3	7	.	.	PROPN
ahs-14952	3	8	gansau	gansau	PROPN
ahs-14952	3	9	2	2	NUM
ahs-14952	3	10	,	,	PUNCT
ahs-14952	3	11	n.a	n.a	PROPN
ahs-14952	3	12	.	.	PROPN
ahs-14952	3	13	rusdi	rusdi	VERB
ahs-14952	3	14	1	1	NUM
ahs-14952	3	15	(	(	PUNCT
ahs-14952	3	16	*	*	ADJ
ahs-14952	3	17	)	)	PUNCT
ahs-14952	3	18	1	1	NUM
ahs-14952	3	19	institue	institue	NOUN
ahs-14952	3	20	for	for	ADP
ahs-14952	3	21	tropical	tropical	ADJ
ahs-14952	3	22	biology	biology	NOUN
ahs-14952	3	23	and	and	CCONJ
ahs-14952	3	24	conservation	conservation	NOUN
ahs-14952	3	25	,	,	PUNCT
ahs-14952	3	26	universiti	universiti	PROPN
ahs-14952	3	27	malaysia	malaysia	PROPN
ahs-14952	3	28	sabah	sabah	PROPN
ahs-14952	3	29	,	,	PUNCT
ahs-14952	3	30	jalan	jalan	PROPN
ahs-14952	3	31	ums	ums	PROPN
ahs-14952	3	32	,	,	PUNCT
ahs-14952	3	33	88400	88400	NUM
ahs-14952	3	34	kota	kota	PROPN
ahs-14952	3	35	kinabalu	kinabalu	PROPN
ahs-14952	3	36	,	,	PUNCT
ahs-14952	3	37	sabah	sabah	PROPN
ahs-14952	3	38	,	,	PUNCT
ahs-14952	3	39	malaysia	malaysia	PROPN
ahs-14952	3	40	.	.	PROPN
ahs-14952	3	41	2	2	NUM
ahs-14952	3	42	faculty	faculty	NOUN
ahs-14952	3	43	science	science	NOUN
ahs-14952	3	44	and	and	CCONJ
ahs-14952	3	45	natural	natural	ADJ
ahs-14952	3	46	resources	resource	NOUN
ahs-14952	3	47	,	,	PUNCT
ahs-14952	3	48	universiti	universiti	PROPN
ahs-14952	3	49	malaysia	malaysia	PROPN
ahs-14952	3	50	sabah	sabah	PROPN
ahs-14952	3	51	,	,	PUNCT
ahs-14952	3	52	jalan	jalan	PROPN
ahs-14952	3	53	ums	ums	PROPN
ahs-14952	3	54	,	,	PUNCT
ahs-14952	3	55	88400	88400	NUM
ahs-14952	3	56	kota	kota	PROPN
ahs-14952	3	57	kinabalu	kinabalu	PROPN
ahs-14952	3	58	,	,	PUNCT
ahs-14952	3	59	sabah	sabah	PROPN
ahs-14952	3	60	,	,	PUNCT
ahs-14952	3	61	malaysia	malaysia	PROPN
ahs-14952	3	62	.	.	PUNCT
ahs-14952	4	1	key	key	ADJ
ahs-14952	4	2	words	word	NOUN
ahs-14952	4	3	:	:	PUNCT
ahs-14952	4	4	identification	identification	NOUN
ahs-14952	4	5	,	,	PUNCT
ahs-14952	4	6	mycorrhizal	mycorrhizal	NOUN
ahs-14952	4	7	,	,	PUNCT
ahs-14952	4	8	orchid	orchid	NOUN
ahs-14952	4	9	.	.	PUNCT
ahs-14952	5	1	abstract	abstract	ADJ
ahs-14952	5	2	:	:	PUNCT
ahs-14952	6	1	orchids	orchid	NOUN
ahs-14952	6	2	are	be	AUX
ahs-14952	6	3	a	a	DET
ahs-14952	6	4	diverse	diverse	ADJ
ahs-14952	6	5	and	and	CCONJ
ahs-14952	6	6	widespread	widespread	ADJ
ahs-14952	6	7	family	family	NOUN
ahs-14952	6	8	of	of	ADP
ahs-14952	6	9	flowering	flower	VERB
ahs-14952	6	10	plants	plant	NOUN
ahs-14952	6	11	,	,	PUNCT
ahs-14952	6	12	with	with	ADP
ahs-14952	6	13	over	over	ADP
ahs-14952	6	14	25,000	25,000	NUM
ahs-14952	6	15	known	know	VERB
ahs-14952	6	16	species	specie	NOUN
ahs-14952	6	17	and	and	CCONJ
ahs-14952	6	18	more	more	ADJ
ahs-14952	6	19	than	than	ADP
ahs-14952	6	20	100,000	100,000	NUM
ahs-14952	6	21	hybrids	hybrid	NOUN
ahs-14952	6	22	and	and	CCONJ
ahs-14952	6	23	cultivars	cultivar	NOUN
ahs-14952	6	24	.	.	PUNCT
ahs-14952	7	1	orchids	orchid	NOUN
ahs-14952	7	2	are	be	AUX
ahs-14952	7	3	characterised	characterise	VERB
ahs-14952	7	4	by	by	ADP
ahs-14952	7	5	their	their	PRON
ahs-14952	7	6	often	often	ADV
ahs-14952	7	7	showy	showy	ADJ
ahs-14952	7	8	and	and	CCONJ
ahs-14952	7	9	highly	highly	ADV
ahs-14952	7	10	specialised	specialised	ADJ
ahs-14952	7	11	flowers	flower	NOUN
ahs-14952	7	12	and	and	CCONJ
ahs-14952	7	13	have	have	VERB
ahs-14952	7	14	unique	unique	ADJ
ahs-14952	7	15	and	and	CCONJ
ahs-14952	7	16	intricate	intricate	ADJ
ahs-14952	7	17	floral	floral	ADJ
ahs-14952	7	18	.	.	PUNCT
ahs-14952	8	1	orchids	orchid	NOUN
ahs-14952	8	2	are	be	AUX
ahs-14952	8	3	known	know	VERB
ahs-14952	8	4	to	to	PART
ahs-14952	8	5	be	be	AUX
ahs-14952	8	6	highly	highly	ADV
ahs-14952	8	7	dependent	dependent	ADJ
ahs-14952	8	8	on	on	ADP
ahs-14952	8	9	their	their	PRON
ahs-14952	8	10	mycorrhizal	mycorrhizal	NOUN
ahs-14952	8	11	fungi	fungus	NOUN
ahs-14952	8	12	for	for	ADP
ahs-14952	8	13	nutrient	nutrient	NOUN
ahs-14952	8	14	uptake	uptake	NOUN
ahs-14952	8	15	,	,	PUNCT
ahs-14952	8	16	especially	especially	ADV
ahs-14952	8	17	during	during	ADP
ahs-14952	8	18	the	the	DET
ahs-14952	8	19	early	early	ADJ
ahs-14952	8	20	stages	stage	NOUN
ahs-14952	8	21	of	of	ADP
ahs-14952	8	22	their	their	PRON
ahs-14952	8	23	development	development	NOUN
ahs-14952	8	24	.	.	PUNCT
ahs-14952	9	1	orchid	orchid	NOUN
ahs-14952	9	2	seeds	seed	NOUN
ahs-14952	9	3	lack	lack	VERB
ahs-14952	9	4	the	the	DET
ahs-14952	9	5	endosperm	endosperm	NOUN
ahs-14952	9	6	present	present	ADJ
ahs-14952	9	7	in	in	ADP
ahs-14952	9	8	most	most	ADJ
ahs-14952	9	9	other	other	ADJ
ahs-14952	9	10	seeds	seed	NOUN
ahs-14952	9	11	,	,	PUNCT
ahs-14952	9	12	which	which	PRON
ahs-14952	9	13	means	mean	VERB
ahs-14952	9	14	they	they	PRON
ahs-14952	9	15	can	can	AUX
ahs-14952	9	16	not	not	PART
ahs-14952	9	17	germinate	germinate	VERB
ahs-14952	9	18	without	without	ADP
ahs-14952	9	19	a	a	DET
ahs-14952	9	20	source	source	NOUN
ahs-14952	9	21	of	of	ADP
ahs-14952	9	22	nutrition	nutrition	NOUN
ahs-14952	9	23	.	.	PUNCT
ahs-14952	10	1	the	the	DET
ahs-14952	10	2	relationship	relationship	NOUN
ahs-14952	10	3	between	between	ADP
ahs-14952	10	4	orchids	orchid	NOUN
ahs-14952	10	5	and	and	CCONJ
ahs-14952	10	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	10	7	is	be	AUX
ahs-14952	10	8	known	know	VERB
ahs-14952	10	9	as	as	ADP
ahs-14952	10	10	orchid	orchid	NOUN
ahs-14952	10	11	mycorrhizae	mycorrhizae	NOUN
ahs-14952	10	12	or	or	CCONJ
ahs-14952	10	13	orchid	orchid	NOUN
ahs-14952	10	14	mycorrhiza	mycorrhiza	NOUN
ahs-14952	10	15	.	.	PUNCT
ahs-14952	11	1	in	in	ADP
ahs-14952	11	2	orchid	orchid	NOUN
ahs-14952	11	3	mycorrhiza	mycorrhiza	NOUN
ahs-14952	11	4	,	,	PUNCT
ahs-14952	11	5	the	the	DET
ahs-14952	11	6	orchid	orchid	NOUN
ahs-14952	11	7	plant	plant	NOUN
ahs-14952	11	8	forms	form	VERB
ahs-14952	11	9	a	a	DET
ahs-14952	11	10	mutualistic	mutualistic	ADJ
ahs-14952	11	11	relationship	relationship	NOUN
ahs-14952	11	12	with	with	ADP
ahs-14952	11	13	certain	certain	ADJ
ahs-14952	11	14	species	specie	NOUN
ahs-14952	11	15	of	of	ADP
ahs-14952	11	16	fungi	fungus	NOUN
ahs-14952	11	17	that	that	PRON
ahs-14952	11	18	are	be	AUX
ahs-14952	11	19	able	able	ADJ
ahs-14952	11	20	to	to	PART
ahs-14952	11	21	penetrate	penetrate	VERB
ahs-14952	11	22	the	the	DET
ahs-14952	11	23	orchid	orchid	NOUN
ahs-14952	11	24	’s	’s	PART
ahs-14952	11	25	roots	root	NOUN
ahs-14952	11	26	and	and	CCONJ
ahs-14952	11	27	colonise	colonise	VERB
ahs-14952	11	28	its	its	PRON
ahs-14952	11	29	tissues	tissue	NOUN
ahs-14952	11	30	to	to	PART
ahs-14952	11	31	provides	provide	VERB
ahs-14952	11	32	the	the	DET
ahs-14952	11	33	orchid	orchid	NOUN
ahs-14952	11	34	with	with	ADP
ahs-14952	11	35	essential	essential	ADJ
ahs-14952	11	36	nutrients	nutrient	NOUN
ahs-14952	11	37	.	.	PUNCT
ahs-14952	12	1	orchid	orchid	NOUN
ahs-14952	12	2	mycorrhizal	mycorrhizal	NOUN
ahs-14952	12	3	fungi	fungus	NOUN
ahs-14952	12	4	are	be	AUX
ahs-14952	12	5	often	often	ADV
ahs-14952	12	6	highly	highly	ADV
ahs-14952	12	7	specific	specific	ADJ
ahs-14952	12	8	,	,	PUNCT
ahs-14952	12	9	meaning	mean	VERB
ahs-14952	12	10	that	that	SCONJ
ahs-14952	12	11	they	they	PRON
ahs-14952	12	12	can	can	AUX
ahs-14952	12	13	only	only	ADV
ahs-14952	12	14	form	form	VERB
ahs-14952	12	15	partnerships	partnership	NOUN
ahs-14952	12	16	with	with	ADP
ahs-14952	12	17	certain	certain	ADJ
ahs-14952	12	18	orchid	orchid	NOUN
ahs-14952	12	19	species	specie	NOUN
ahs-14952	12	20	,	,	PUNCT
ahs-14952	12	21	and	and	CCONJ
ahs-14952	12	22	vice	vice	ADV
ahs-14952	12	23	versa	versa	ADV
ahs-14952	12	24	.	.	PUNCT
ahs-14952	13	1	the	the	DET
ahs-14952	13	2	importance	importance	NOUN
ahs-14952	13	3	of	of	ADP
ahs-14952	13	4	mycorrhizal	mycorrhizal	NOUN
ahs-14952	13	5	fungi	fungus	NOUN
ahs-14952	13	6	in	in	ADP
ahs-14952	13	7	the	the	DET
ahs-14952	13	8	orchid	orchid	NOUN
ahs-14952	13	9	life	life	NOUN
ahs-14952	13	10	cycle	cycle	NOUN
ahs-14952	13	11	is	be	AUX
ahs-14952	13	12	crucial	crucial	ADJ
ahs-14952	13	13	from	from	ADP
ahs-14952	13	14	both	both	CCONJ
ahs-14952	13	15	evolutionary	evolutionary	ADJ
ahs-14952	13	16	and	and	CCONJ
ahs-14952	13	17	ecological	ecological	ADJ
ahs-14952	13	18	standpoints	standpoint	NOUN
ahs-14952	13	19	.	.	PUNCT
ahs-14952	14	1	therefore	therefore	ADV
ahs-14952	14	2	,	,	PUNCT
ahs-14952	14	3	it	it	PRON
ahs-14952	14	4	is	be	AUX
ahs-14952	14	5	essential	essential	ADJ
ahs-14952	14	6	to	to	PART
ahs-14952	14	7	acquire	acquire	VERB
ahs-14952	14	8	a	a	DET
ahs-14952	14	9	thorough	thorough	ADJ
ahs-14952	14	10	comprehension	comprehension	NOUN
ahs-14952	14	11	of	of	ADP
ahs-14952	14	12	this	this	DET
ahs-14952	14	13	relationship	relationship	NOUN
ahs-14952	14	14	and	and	CCONJ
ahs-14952	14	15	develop	develop	VERB
ahs-14952	14	16	methodologies	methodology	NOUN
ahs-14952	14	17	for	for	ADP
ahs-14952	14	18	isolating	isolate	VERB
ahs-14952	14	19	,	,	PUNCT
ahs-14952	14	20	identifying	identifying	NOUN
ahs-14952	14	21	,	,	PUNCT
ahs-14952	14	22	and	and	CCONJ
ahs-14952	14	23	preserving	preserve	VERB
ahs-14952	14	24	significant	significant	ADJ
ahs-14952	14	25	fungal	fungal	ADJ
ahs-14952	14	26	strains	strain	NOUN
ahs-14952	14	27	that	that	PRON
ahs-14952	14	28	are	be	AUX
ahs-14952	14	29	associated	associate	VERB
ahs-14952	14	30	with	with	ADP
ahs-14952	14	31	different	different	ADJ
ahs-14952	14	32	orchid	orchid	NOUN
ahs-14952	14	33	species	specie	NOUN
ahs-14952	14	34	.	.	PUNCT
ahs-14952	15	1	in	in	ADP
ahs-14952	15	2	recent	recent	ADJ
ahs-14952	15	3	years	year	NOUN
ahs-14952	15	4	,	,	PUNCT
ahs-14952	15	5	there	there	PRON
ahs-14952	15	6	has	have	AUX
ahs-14952	15	7	been	be	AUX
ahs-14952	15	8	a	a	DET
ahs-14952	15	9	considerable	considerable	ADJ
ahs-14952	15	10	increase	increase	NOUN
ahs-14952	15	11	in	in	ADP
ahs-14952	15	12	research	research	NOUN
ahs-14952	15	13	concentration	concentration	NOUN
ahs-14952	15	14	on	on	ADP
ahs-14952	15	15	mycorrhizal	mycorrhizal	NOUN
ahs-14952	15	16	interactions	interaction	NOUN
ahs-14952	15	17	in	in	ADP
ahs-14952	15	18	orchids	orchid	NOUN
ahs-14952	15	19	.	.	PUNCT
ahs-14952	16	1	however	however	ADV
ahs-14952	16	2	,	,	PUNCT
ahs-14952	16	3	certain	certain	ADJ
ahs-14952	16	4	inquiries	inquiry	NOUN
ahs-14952	16	5	remain	remain	VERB
ahs-14952	16	6	unresolved	unresolved	ADJ
ahs-14952	16	7	pertaining	pertain	VERB
ahs-14952	16	8	to	to	ADP
ahs-14952	16	9	the	the	DET
ahs-14952	16	10	fungal	fungal	ADJ
ahs-14952	16	11	communities	community	NOUN
ahs-14952	16	12	associated	associate	VERB
ahs-14952	16	13	with	with	ADP
ahs-14952	16	14	orchids	orchid	NOUN
ahs-14952	16	15	as	as	ADV
ahs-14952	16	16	well	well	ADV
ahs-14952	16	17	as	as	ADP
ahs-14952	16	18	the	the	DET
ahs-14952	16	19	divergences	divergence	NOUN
ahs-14952	16	20	notices	notice	VERB
ahs-14952	16	21	across	across	ADP
ahs-14952	16	22	different	different	ADJ
ahs-14952	16	23	species	specie	NOUN
ahs-14952	16	24	and	and	CCONJ
ahs-14952	16	25	geographical	geographical	ADJ
ahs-14952	16	26	locales	locale	NOUN
ahs-14952	16	27	.	.	PUNCT
ahs-14952	17	1	the	the	DET
ahs-14952	17	2	present	present	ADJ
ahs-14952	17	3	paper	paper	NOUN
ahs-14952	17	4	provides	provide	VERB
ahs-14952	17	5	a	a	DET
ahs-14952	17	6	through	through	NOUN
ahs-14952	17	7	,	,	PUNCT
ahs-14952	17	8	and	and	CCONJ
ahs-14952	17	9	extensive	extensive	ADJ
ahs-14952	17	10	analysis	analysis	NOUN
ahs-14952	17	11	of	of	ADP
ahs-14952	17	12	the	the	DET
ahs-14952	17	13	fungal	fungal	ADJ
ahs-14952	17	14	life	life	NOUN
ahs-14952	17	15	associated	associate	VERB
ahs-14952	17	16	with	with	ADP
ahs-14952	17	17	orchids	orchid	NOUN
ahs-14952	17	18	.	.	PUNCT
ahs-14952	18	1	this	this	DET
ahs-14952	18	2	article	article	NOUN
ahs-14952	18	3	presents	present	VERB
ahs-14952	18	4	a	a	DET
ahs-14952	18	5	succinct	succinct	ADJ
ahs-14952	18	6	overview	overview	NOUN
ahs-14952	18	7	of	of	ADP
ahs-14952	18	8	the	the	DET
ahs-14952	18	9	molecular	molecular	ADJ
ahs-14952	18	10	techniques	technique	NOUN
ahs-14952	18	11	utilised	utilise	VERB
ahs-14952	18	12	by	by	ADP
ahs-14952	18	13	researchers	researcher	NOUN
ahs-14952	18	14	globally	globally	ADV
ahs-14952	18	15	to	to	PART
ahs-14952	18	16	isolate	isolate	VERB
ahs-14952	18	17	and	and	CCONJ
ahs-14952	18	18	identify	identify	VERB
ahs-14952	18	19	peloton­forming	peloton­forme	VERB
ahs-14952	18	20	fungi	fungus	NOUN
ahs-14952	18	21	in	in	ADP
ahs-14952	18	22	both	both	CCONJ
ahs-14952	18	23	temperateterrestrial	temperateterrestrial	ADJ
ahs-14952	18	24	and	and	CCONJ
ahs-14952	18	25	tropical	tropical	ADJ
ahs-14952	18	26	orchids	orchid	NOUN
ahs-14952	18	27	.	.	PUNCT
ahs-14952	19	1	the	the	DET
ahs-14952	19	2	review	review	NOUN
ahs-14952	19	3	begins	begin	VERB
ahs-14952	19	4	by	by	ADP
ahs-14952	19	5	proving	prove	VERB
ahs-14952	19	6	a	a	DET
ahs-14952	19	7	concise	concise	ADJ
ahs-14952	19	8	introduction	introduction	NOUN
ahs-14952	19	9	to	to	ADP
ahs-14952	19	10	the	the	DET
ahs-14952	19	11	background	background	NOUN
ahs-14952	19	12	material	material	NOUN
ahs-14952	19	13	regarding	regard	VERB
ahs-14952	19	14	the	the	DET
ahs-14952	19	15	wide	wide	ADJ
ahs-14952	19	16	range	range	NOUN
ahs-14952	19	17	of	of	ADP
ahs-14952	19	18	fungal	fungal	ADJ
ahs-14952	19	19	species	specie	NOUN
ahs-14952	19	20	that	that	PRON
ahs-14952	19	21	are	be	AUX
ahs-14952	19	22	linked	link	VERB
ahs-14952	19	23	with	with	ADP
ahs-14952	19	24	orchids	orchid	NOUN
ahs-14952	19	25	.	.	PUNCT
ahs-14952	20	1	it	it	PRON
ahs-14952	20	2	then	then	ADV
ahs-14952	20	3	proceeds	proceed	VERB
ahs-14952	20	4	to	to	PART
ahs-14952	20	5	explores	explore	NOUN
ahs-14952	20	6	the	the	DET
ahs-14952	20	7	topic	topic	NOUN
ahs-14952	20	8	of	of	ADP
ahs-14952	20	9	orchid	orchid	NOUN
ahs-14952	20	10	mycorrhizal	mycorrhizal	NOUN
ahs-14952	20	11	fungi	fungus	NOUN
ahs-14952	20	12	(	(	PUNCT
ahs-14952	20	13	omf	omf	NOUN
ahs-14952	20	14	)	)	PUNCT
ahs-14952	20	15	and	and	CCONJ
ahs-14952	20	16	orchid	orchid	NOUN
ahs-14952	20	17	non­mycorrhizal	non­mycorrhizal	PROPN
ahs-14952	20	18	fungi	fungus	NOUN
ahs-14952	20	19	(	(	PUNCT
ahs-14952	20	20	onf	onf	NOUN
ahs-14952	20	21	)	)	PUNCT
ahs-14952	20	22	.	.	PUNCT
ahs-14952	21	1	the	the	DET
ahs-14952	21	2	subsequent	subsequent	ADJ
ahs-14952	21	3	analysis	analysis	NOUN
ahs-14952	21	4	explores	explore	VERB
ahs-14952	21	5	the	the	DET
ahs-14952	21	6	crucial	crucial	ADJ
ahs-14952	21	7	function	function	NOUN
ahs-14952	21	8	that	that	PRON
ahs-14952	21	9	orchid	orchid	NOUN
ahs-14952	21	10	mycorrhizal	mycorrhizal	NOUN
ahs-14952	21	11	fungi	fungus	NOUN
ahs-14952	21	12	play	play	NOUN
ahs-14952	21	13	in	in	ADP
ahs-14952	21	14	the	the	DET
ahs-14952	21	15	processes	process	NOUN
ahs-14952	21	16	of	of	ADP
ahs-14952	21	17	seed	seed	NOUN
ahs-14952	21	18	germination	germination	NOUN
ahs-14952	21	19	and	and	CCONJ
ahs-14952	21	20	development	development	NOUN
ahs-14952	21	21	.	.	PUNCT
ahs-14952	22	1	moreover	moreover	ADV
ahs-14952	22	2	,	,	PUNCT
ahs-14952	22	3	the	the	DET
ahs-14952	22	4	study	study	NOUN
ahs-14952	22	5	elaborates	elaborate	VERB
ahs-14952	22	6	on	on	ADP
ahs-14952	22	7	the	the	DET
ahs-14952	22	8	methodologies	methodology	NOUN
ahs-14952	22	9	utilised	utilise	VERB
ahs-14952	22	10	for	for	ADP
ahs-14952	22	11	isolating	isolate	VERB
ahs-14952	22	12	fungi	fungus	NOUN
ahs-14952	22	13	,	,	PUNCT
ahs-14952	22	14	extracting	extract	VERB
ahs-14952	22	15	fungal	fungal	ADJ
ahs-14952	22	16	dna	dna	NOUN
ahs-14952	22	17	,	,	PUNCT
ahs-14952	22	18	selecting	select	VERB
ahs-14952	22	19	primers	primer	NOUN
ahs-14952	22	20	,	,	PUNCT
ahs-14952	22	21	amplifying	amplifying	ADJ
ahs-14952	22	22	dna	dna	NOUN
ahs-14952	22	23	and	and	CCONJ
ahs-14952	22	24	subsequent	subsequent	ADJ
ahs-14952	22	25	analysis	analysis	NOUN
ahs-14952	22	26	sequence	sequence	NOUN
ahs-14952	22	27	data	datum	NOUN
ahs-14952	22	28	.	.	PUNCT
ahs-14952	23	1	this	this	DET
ahs-14952	23	2	article	article	NOUN
ahs-14952	23	3	considers	consider	VERB
ahs-14952	23	4	several	several	ADJ
ahs-14952	23	5	molecular	molecular	ADJ
ahs-14952	23	6	identification	identification	NOUN
ahs-14952	23	7	approaches	approach	NOUN
ahs-14952	23	8	that	that	PRON
ahs-14952	23	9	are	be	AUX
ahs-14952	23	10	used	use	VERB
ahs-14952	23	11	in	in	ADP
ahs-14952	23	12	studying	study	VERB
ahs-14952	23	13	orchid	orchid	NOUN
ahs-14952	23	14	endophytic	endophytic	ADJ
ahs-14952	23	15	mycorrhizal	mycorrhizal	NOUN
ahs-14952	23	16	.	.	PUNCT
ahs-14952	24	1	using	use	VERB
ahs-14952	24	2	molecular	molecular	ADJ
ahs-14952	24	3	approaches	approach	NOUN
ahs-14952	24	4	,	,	PUNCT
ahs-14952	24	5	orchid	orchid	NOUN
ahs-14952	24	6	mycorrhizal	mycorrhizal	NOUN
ahs-14952	24	7	can	can	AUX
ahs-14952	24	8	be	be	AUX
ahs-14952	24	9	further	far	ADV
ahs-14952	24	10	explored	explore	VERB
ahs-14952	24	11	and	and	CCONJ
ahs-14952	24	12	identified	identify	VERB
ahs-14952	24	13	.	.	PUNCT
ahs-14952	25	1	(	(	PUNCT
ahs-14952	25	2	*	*	NOUN
ahs-14952	25	3	)	)	PUNCT
ahs-14952	25	4	corresponding	corresponding	ADJ
ahs-14952	25	5	author	author	NOUN
ahs-14952	25	6	:	:	PUNCT
ahs-14952	25	7	azizun@ums.edu.my	azizun@ums.edu.my	ADJ
ahs-14952	25	8	citation	citation	NOUN
ahs-14952	25	9	:	:	PUNCT
ahs-14952	25	10	shamsudin	shamsudin	VERB
ahs-14952	25	11	n.a	n.a	PROPN
ahs-14952	25	12	.	.	PROPN
ahs-14952	25	13	,	,	PUNCT
ahs-14952	25	14	seelan	seelan	PROPN
ahs-14952	25	15	j.s.s	j.s.s	PROPN
ahs-14952	25	16	.	.	PROPN
ahs-14952	25	17	,	,	PUNCT
ahs-14952	25	18	gansau	gansau	PROPN
ahs-14952	25	19	j.a	j.a	PROPN
ahs-14952	25	20	.	.	PROPN
ahs-14952	25	21	,	,	PUNCT
ahs-14952	25	22	rusdi	rusdi	VERB
ahs-14952	25	23	n.a	n.a	PROPN
ahs-14952	25	24	.	.	PROPN
ahs-14952	25	25	,	,	PUNCT
ahs-14952	25	26	2024	2024	NUM
ahs-14952	25	27	­	­	VERB
ahs-14952	25	28	a	a	DET
ahs-14952	25	29	review	review	NOUN
ahs-14952	25	30	:	:	PUNCT
ahs-14952	25	31	molecular	molecular	ADJ
ahs-14952	25	32	identifica‐	identifica‐	ADP
ahs-14952	25	33	tion	tion	NOUN
ahs-14952	25	34	of	of	ADP
ahs-14952	25	35	orchid	orchid	NOUN
ahs-14952	25	36	mycorrhiza	mycorrhiza	NOUN
ahs-14952	25	37	.	.	PUNCT
ahs-14952	26	1	­	­	PROPN
ahs-14952	26	2	adv	adv	PROPN
ahs-14952	26	3	.	.	PUNCT
ahs-14952	27	1	hort	hort	PROPN
ahs-14952	27	2	.	.	PUNCT
ahs-14952	28	1	sci	sci	PROPN
ahs-14952	28	2	.	.	PROPN
ahs-14952	28	3	,	,	PUNCT
ahs-14952	28	4	38(1	38(1	NUM
ahs-14952	28	5	):	):	PUNCT
ahs-14952	28	6	97­116	97­116	NUM
ahs-14952	28	7	.	.	PUNCT
ahs-14952	29	1	copyright	copyright	NOUN
ahs-14952	29	2	:	:	PUNCT
ahs-14952	29	3	©	©	PROPN
ahs-14952	29	4	2024	2024	NUM
ahs-14952	29	5	shamsudin	shamsudin	VERB
ahs-14952	29	6	n.a	n.a	PROPN
ahs-14952	29	7	.	.	PROPN
ahs-14952	29	8	,	,	PUNCT
ahs-14952	29	9	seelan	seelan	PROPN
ahs-14952	29	10	j.s.s	j.s.s	PROPN
ahs-14952	29	11	.	.	PROPN
ahs-14952	29	12	,	,	PUNCT
ahs-14952	29	13	gansau	gansau	PROPN
ahs-14952	29	14	j.a	j.a	PROPN
ahs-14952	29	15	.	.	PROPN
ahs-14952	29	16	,	,	PUNCT
ahs-14952	29	17	rusdi	rusdi	VERB
ahs-14952	29	18	n.a	n.a	PROPN
ahs-14952	29	19	.	.	PROPN
ahs-14952	30	1	this	this	PRON
ahs-14952	30	2	is	be	AUX
ahs-14952	30	3	an	an	DET
ahs-14952	30	4	open	open	ADJ
ahs-14952	30	5	access	access	NOUN
ahs-14952	30	6	,	,	PUNCT
ahs-14952	30	7	peer	peer	NOUN
ahs-14952	30	8	reviewed	review	VERB
ahs-14952	30	9	article	article	NOUN
ahs-14952	30	10	published	publish	VERB
ahs-14952	30	11	by	by	ADP
ahs-14952	30	12	firenze	firenze	PROPN
ahs-14952	30	13	university	university	PROPN
ahs-14952	30	14	press	press	NOUN
ahs-14952	30	15	(	(	PUNCT
ahs-14952	30	16	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-14952	30	17	)	)	PUNCT
ahs-14952	30	18	and	and	CCONJ
ahs-14952	30	19	distributed	distribute	VERB
ahs-14952	30	20	under	under	ADP
ahs-14952	30	21	the	the	DET
ahs-14952	30	22	terms	term	NOUN
ahs-14952	30	23	of	of	ADP
ahs-14952	30	24	the	the	DET
ahs-14952	30	25	creative	creative	ADJ
ahs-14952	30	26	commons	common	NOUN
ahs-14952	30	27	attribution	attribution	NOUN
ahs-14952	30	28	license	license	NOUN
ahs-14952	30	29	,	,	PUNCT
ahs-14952	30	30	which	which	PRON
ahs-14952	30	31	permits	permit	VERB
ahs-14952	30	32	unrestricted	unrestricted	ADJ
ahs-14952	30	33	use	use	NOUN
ahs-14952	30	34	,	,	PUNCT
ahs-14952	30	35	distribution	distribution	NOUN
ahs-14952	30	36	,	,	PUNCT
ahs-14952	30	37	and	and	CCONJ
ahs-14952	30	38	reproduction	reproduction	NOUN
ahs-14952	30	39	in	in	ADP
ahs-14952	30	40	any	any	DET
ahs-14952	30	41	medium	medium	NOUN
ahs-14952	30	42	,	,	PUNCT
ahs-14952	30	43	provided	provide	VERB
ahs-14952	30	44	the	the	DET
ahs-14952	30	45	original	original	ADJ
ahs-14952	30	46	author	author	NOUN
ahs-14952	30	47	and	and	CCONJ
ahs-14952	30	48	source	source	NOUN
ahs-14952	30	49	are	be	AUX
ahs-14952	30	50	credited	credit	VERB
ahs-14952	30	51	.	.	PUNCT
ahs-14952	31	1	data	datum	NOUN
ahs-14952	31	2	availability	availability	NOUN
ahs-14952	31	3	statement	statement	NOUN
ahs-14952	31	4	:	:	PUNCT
ahs-14952	31	5	all	all	DET
ahs-14952	31	6	relevant	relevant	ADJ
ahs-14952	31	7	data	datum	NOUN
ahs-14952	31	8	are	be	AUX
ahs-14952	31	9	within	within	ADP
ahs-14952	31	10	the	the	DET
ahs-14952	31	11	paper	paper	NOUN
ahs-14952	31	12	and	and	CCONJ
ahs-14952	31	13	its	its	PRON
ahs-14952	31	14	supporting	support	VERB
ahs-14952	31	15	information	information	NOUN
ahs-14952	31	16	files	file	NOUN
ahs-14952	31	17	.	.	PUNCT
ahs-14952	32	1	competing	compete	VERB
ahs-14952	32	2	interests	interest	NOUN
ahs-14952	32	3	:	:	PUNCT
ahs-14952	32	4	the	the	DET
ahs-14952	32	5	authors	author	NOUN
ahs-14952	32	6	declare	declare	VERB
ahs-14952	32	7	no	no	DET
ahs-14952	32	8	competing	compete	VERB
ahs-14952	32	9	interests	interest	NOUN
ahs-14952	32	10	.	.	PUNCT
ahs-14952	33	1	received	receive	VERB
ahs-14952	33	2	for	for	ADP
ahs-14952	33	3	publication	publication	NOUN
ahs-14952	33	4	21	21	NUM
ahs-14952	33	5	july	july	PROPN
ahs-14952	33	6	2023	2023	NUM
ahs-14952	33	7	accepted	accept	VERB
ahs-14952	33	8	for	for	ADP
ahs-14952	33	9	publication	publication	NOUN
ahs-14952	33	10	6	6	NUM
ahs-14952	33	11	november	november	PROPN
ahs-14952	33	12	2023	2023	NUM
ahs-14952	33	13	ahs	ahs	NOUN
ahs-14952	33	14	advances	advance	NOUN
ahs-14952	33	15	in	in	ADP
ahs-14952	33	16	horticultural	horticultural	ADJ
ahs-14952	33	17	science	science	NOUN
ahs-14952	33	18	review	review	NOUN
ahs-14952	33	19	paper	paper	NOUN
ahs-14952	33	20	https://doi.org/10.36253/ahsc-14952	https://doi.org/10.36253/ahsc-14952	PROPN
ahs-14952	33	21	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-14952	33	22	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-14952	33	23	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-14952	33	24	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-14952	33	25	adv	adv	PROPN
ahs-14952	33	26	.	.	PUNCT
ahs-14952	33	27	hort	hort	PROPN
ahs-14952	33	28	.	.	PUNCT
ahs-14952	34	1	sci	sci	PROPN
ahs-14952	34	2	.	.	PROPN
ahs-14952	34	3	,	,	PUNCT
ahs-14952	34	4	2024	2024	NUM
ahs-14952	34	5	38(1	38(1	NOUN
ahs-14952	34	6	):	):	PUNCT
ahs-14952	34	7	97­116	97­116	NUM
ahs-14952	34	8	98	98	NUM
ahs-14952	34	9	1	1	NUM
ahs-14952	34	10	.	.	PUNCT
ahs-14952	35	1	introduction	introduction	NOUN
ahs-14952	35	2	the	the	DET
ahs-14952	35	3	orchidaceae	orchidaceae	PROPN
ahs-14952	35	4	family	family	NOUN
ahs-14952	35	5	is	be	AUX
ahs-14952	35	6	considered	consider	VERB
ahs-14952	35	7	the	the	DET
ahs-14952	35	8	second	second	ADV
ahs-14952	35	9	largest	large	ADJ
ahs-14952	35	10	among	among	ADP
ahs-14952	35	11	flowering	flower	VERB
ahs-14952	35	12	plants	plant	NOUN
ahs-14952	35	13	,	,	PUNCT
ahs-14952	35	14	with	with	SCONJ
ahs-14952	35	15	its	its	PRON
ahs-14952	35	16	size	size	NOUN
ahs-14952	35	17	exceeded	exceed	VERB
ahs-14952	35	18	only	only	ADV
ahs-14952	35	19	by	by	ADP
ahs-14952	35	20	the	the	DET
ahs-14952	35	21	asteraceae	asteraceae	PROPN
ahs-14952	35	22	family	family	NOUN
ahs-14952	35	23	(	(	PUNCT
ahs-14952	35	24	givnish	givnish	VERB
ahs-14952	35	25	et	et	PROPN
ahs-14952	35	26	al	al	PROPN
ahs-14952	35	27	.	.	PROPN
ahs-14952	35	28	,	,	PUNCT
ahs-14952	35	29	2015	2015	NUM
ahs-14952	35	30	)	)	PUNCT
ahs-14952	35	31	.	.	PUNCT
ahs-14952	36	1	according	accord	VERB
ahs-14952	36	2	to	to	ADP
ahs-14952	36	3	govaerts	govaert	NOUN
ahs-14952	36	4	et	et	PROPN
ahs-14952	36	5	al	al	PROPN
ahs-14952	36	6	.	.	PUNCT
ahs-14952	37	1	(	(	PUNCT
ahs-14952	37	2	2017	2017	NUM
ahs-14952	37	3	)	)	PUNCT
ahs-14952	37	4	,	,	PUNCT
ahs-14952	37	5	the	the	DET
ahs-14952	37	6	number	number	NOUN
ahs-14952	37	7	of	of	ADP
ahs-14952	37	8	recognised	recognise	VERB
ahs-14952	37	9	orchid	orchid	NOUN
ahs-14952	37	10	species	specie	NOUN
ahs-14952	37	11	is	be	AUX
ahs-14952	37	12	estimated	estimate	VERB
ahs-14952	37	13	to	to	PART
ahs-14952	37	14	be	be	AUX
ahs-14952	37	15	29,199	29,199	NUM
ahs-14952	37	16	.	.	PUNCT
ahs-14952	38	1	the	the	DET
ahs-14952	38	2	decision	decision	NOUN
ahs-14952	38	3	to	to	PART
ahs-14952	38	4	classify	classify	VERB
ahs-14952	38	5	all	all	DET
ahs-14952	38	6	orchids	orchid	NOUN
ahs-14952	38	7	under	under	ADP
ahs-14952	38	8	appendices	appendix	NOUN
ahs-14952	38	9	i	i	PRON
ahs-14952	38	10	and	and	CCONJ
ahs-14952	38	11	ii	ii	PROPN
ahs-14952	38	12	by	by	ADP
ahs-14952	38	13	the	the	DET
ahs-14952	38	14	convention	convention	NOUN
ahs-14952	38	15	on	on	ADP
ahs-14952	38	16	international	international	ADJ
ahs-14952	38	17	trade	trade	NOUN
ahs-14952	38	18	in	in	ADP
ahs-14952	38	19	endangered	endangered	ADJ
ahs-14952	38	20	species	specie	NOUN
ahs-14952	38	21	of	of	ADP
ahs-14952	38	22	wild	wild	ADJ
ahs-14952	38	23	fauna	fauna	NOUN
ahs-14952	38	24	and	and	CCONJ
ahs-14952	38	25	flora	flora	NOUN
ahs-14952	38	26	(	(	PUNCT
ahs-14952	38	27	cites	cite	VERB
ahs-14952	38	28	)	)	PUNCT
ahs-14952	38	29	in	in	ADP
ahs-14952	38	30	2017	2017	NUM
ahs-14952	38	31	effectively	effectively	ADV
ahs-14952	38	32	prohibited	prohibit	VERB
ahs-14952	38	33	the	the	DET
ahs-14952	38	34	illicit	illicit	ADJ
ahs-14952	38	35	trade	trade	NOUN
ahs-14952	38	36	of	of	ADP
ahs-14952	38	37	these	these	DET
ahs-14952	38	38	plants	plant	NOUN
ahs-14952	38	39	(	(	PUNCT
ahs-14952	38	40	hinsley	hinsley	PROPN
ahs-14952	38	41	et	et	PROPN
ahs-14952	38	42	al	al	PROPN
ahs-14952	38	43	.	.	PROPN
ahs-14952	38	44	,	,	PUNCT
ahs-14952	38	45	2018	2018	NUM
ahs-14952	38	46	)	)	PUNCT
ahs-14952	38	47	.	.	PUNCT
ahs-14952	39	1	based	base	VERB
ahs-14952	39	2	on	on	ADP
ahs-14952	39	3	the	the	DET
ahs-14952	39	4	evaluations	evaluation	NOUN
ahs-14952	39	5	made	make	VERB
ahs-14952	39	6	on	on	ADP
ahs-14952	39	7	a	a	DET
ahs-14952	39	8	total	total	NOUN
ahs-14952	39	9	of	of	ADP
ahs-14952	39	10	1770	1770	NUM
ahs-14952	39	11	species	specie	NOUN
ahs-14952	39	12	of	of	ADP
ahs-14952	39	13	orchids	orchid	NOUN
ahs-14952	39	14	,	,	PUNCT
ahs-14952	39	15	it	it	PRON
ahs-14952	39	16	has	have	AUX
ahs-14952	39	17	been	be	AUX
ahs-14952	39	18	determined	determine	VERB
ahs-14952	39	19	that	that	SCONJ
ahs-14952	39	20	approximately	approximately	ADV
ahs-14952	39	21	46.5	46.5	NUM
ahs-14952	39	22	%	%	NOUN
ahs-14952	39	23	of	of	ADP
ahs-14952	39	24	these	these	DET
ahs-14952	39	25	species	specie	NOUN
ahs-14952	39	26	are	be	AUX
ahs-14952	39	27	classified	classify	VERB
ahs-14952	39	28	under	under	ADP
ahs-14952	39	29	the	the	DET
ahs-14952	39	30	categories	category	NOUN
ahs-14952	39	31	of	of	ADP
ahs-14952	39	32	vulnerability	vulnerability	NOUN
ahs-14952	39	33	,	,	PUNCT
ahs-14952	39	34	endangered	endanger	VERB
ahs-14952	39	35	,	,	PUNCT
ahs-14952	39	36	or	or	CCONJ
ahs-14952	39	37	critical	critical	ADJ
ahs-14952	39	38	endangered	endanger	VERB
ahs-14952	39	39	as	as	SCONJ
ahs-14952	39	40	reported	report	VERB
ahs-14952	39	41	by	by	ADP
ahs-14952	39	42	the	the	DET
ahs-14952	39	43	international	international	PROPN
ahs-14952	39	44	union	union	PROPN
ahs-14952	39	45	for	for	ADP
ahs-14952	39	46	conservation	conservation	NOUN
ahs-14952	39	47	of	of	ADP
ahs-14952	39	48	nature	nature	NOUN
ahs-14952	39	49	(	(	PUNCT
ahs-14952	39	50	iucn	iucn	NOUN
ahs-14952	39	51	,	,	PUNCT
ahs-14952	39	52	2021	2021	NUM
ahs-14952	39	53	)	)	PUNCT
ahs-14952	39	54	.	.	PUNCT
ahs-14952	40	1	this	this	DET
ahs-14952	40	2	precarious	precarious	ADJ
ahs-14952	40	3	state	state	NOUN
ahs-14952	40	4	remains	remain	VERB
ahs-14952	40	5	due	due	ADJ
ahs-14952	40	6	to	to	ADP
ahs-14952	40	7	a	a	DET
ahs-14952	40	8	variety	variety	NOUN
ahs-14952	40	9	of	of	ADP
ahs-14952	40	10	variables	variable	NOUN
ahs-14952	40	11	,	,	PUNCT
ahs-14952	40	12	including	include	VERB
ahs-14952	40	13	their	their	PRON
ahs-14952	40	14	difficult	difficult	ADJ
ahs-14952	40	15	germination	germination	NOUN
ahs-14952	40	16	process	process	NOUN
ahs-14952	40	17	and	and	CCONJ
ahs-14952	40	18	human	human	ADJ
ahs-14952	40	19	intervention	intervention	NOUN
ahs-14952	40	20	,	,	PUNCT
ahs-14952	40	21	such	such	ADJ
ahs-14952	40	22	as	as	ADP
ahs-14952	40	23	overcollection	overcollection	NOUN
ahs-14952	40	24	caused	cause	VERB
ahs-14952	40	25	by	by	ADP
ahs-14952	40	26	economic	economic	ADJ
ahs-14952	40	27	and	and	CCONJ
ahs-14952	40	28	horticultural	horticultural	ADJ
ahs-14952	40	29	needs	need	NOUN
ahs-14952	40	30	(	(	PUNCT
ahs-14952	40	31	pujasatria	pujasatria	PROPN
ahs-14952	40	32	et	et	PROPN
ahs-14952	40	33	al	al	PROPN
ahs-14952	40	34	.	.	PROPN
ahs-14952	40	35	,	,	PUNCT
ahs-14952	40	36	2020	2020	NUM
ahs-14952	40	37	;	;	PUNCT
ahs-14952	40	38	suresh	suresh	PROPN
ahs-14952	40	39	et	et	PROPN
ahs-14952	40	40	al	al	PROPN
ahs-14952	40	41	.	.	PROPN
ahs-14952	40	42	,	,	PUNCT
ahs-14952	40	43	2023	2023	NUM
ahs-14952	40	44	)	)	PUNCT
ahs-14952	40	45	.	.	PUNCT
ahs-14952	41	1	orchids	orchid	NOUN
ahs-14952	41	2	are	be	AUX
ahs-14952	41	3	extraordinarily	extraordinarily	ADV
ahs-14952	41	4	important	important	ADJ
ahs-14952	41	5	for	for	ADP
ahs-14952	41	6	biodiversity	biodiversity	NOUN
ahs-14952	41	7	,	,	PUNCT
ahs-14952	41	8	conservation	conservation	NOUN
ahs-14952	41	9	,	,	PUNCT
ahs-14952	41	10	and	and	CCONJ
ahs-14952	41	11	producing	produce	VERB
ahs-14952	41	12	a	a	DET
ahs-14952	41	13	vast	vast	ADJ
ahs-14952	41	14	array	array	NOUN
ahs-14952	41	15	of	of	ADP
ahs-14952	41	16	therapeutic	therapeutic	ADJ
ahs-14952	41	17	substances	substance	NOUN
ahs-14952	41	18	,	,	PUNCT
ahs-14952	41	19	nutritious	nutritious	ADJ
ahs-14952	41	20	foods	food	NOUN
ahs-14952	41	21	,	,	PUNCT
ahs-14952	41	22	and	and	CCONJ
ahs-14952	41	23	ornamental	ornamental	ADJ
ahs-14952	41	24	plants	plant	NOUN
ahs-14952	41	25	(	(	PUNCT
ahs-14952	41	26	hinsley	hinsley	PROPN
ahs-14952	41	27	et	et	PROPN
ahs-14952	41	28	al	al	PROPN
ahs-14952	41	29	.	.	PROPN
ahs-14952	41	30	,	,	PUNCT
ahs-14952	41	31	2018	2018	NUM
ahs-14952	41	32	)	)	PUNCT
ahs-14952	41	33	.	.	PUNCT
ahs-14952	42	1	orchid	orchid	NOUN
ahs-14952	42	2	conservationists	conservationist	NOUN
ahs-14952	42	3	strive	strive	VERB
ahs-14952	42	4	to	to	PART
ahs-14952	42	5	manage	manage	VERB
ahs-14952	42	6	market	market	NOUN
ahs-14952	42	7	needs	need	NOUN
ahs-14952	42	8	and	and	CCONJ
ahs-14952	42	9	biodiversity	biodiversity	NOUN
ahs-14952	42	10	on	on	ADP
ahs-14952	42	11	a	a	DET
ahs-14952	42	12	global	global	ADJ
ahs-14952	42	13	scale	scale	NOUN
ahs-14952	42	14	,	,	PUNCT
ahs-14952	42	15	which	which	PRON
ahs-14952	42	16	would	would	AUX
ahs-14952	42	17	need	need	VERB
ahs-14952	42	18	large­scale	large­scale	ADJ
ahs-14952	42	19	production	production	NOUN
ahs-14952	42	20	(	(	PUNCT
ahs-14952	42	21	pujasatria	pujasatria	PROPN
ahs-14952	42	22	et	et	PROPN
ahs-14952	42	23	al	al	PROPN
ahs-14952	42	24	.	.	PROPN
ahs-14952	42	25	,	,	PUNCT
ahs-14952	42	26	2020	2020	NUM
ahs-14952	42	27	)	)	PUNCT
ahs-14952	42	28	.	.	PUNCT
ahs-14952	43	1	numerous	numerous	ADJ
ahs-14952	43	2	species	specie	NOUN
ahs-14952	43	3	encounter	encounter	VERB
ahs-14952	43	4	the	the	DET
ahs-14952	43	5	peril	peril	NOUN
ahs-14952	43	6	of	of	ADP
ahs-14952	43	7	extinction	extinction	NOUN
ahs-14952	43	8	;	;	PUNCT
ahs-14952	43	9	however	however	ADV
ahs-14952	43	10	,	,	PUNCT
ahs-14952	43	11	orchids	orchid	NOUN
ahs-14952	43	12	adopt	adopt	VERB
ahs-14952	43	13	two	two	NUM
ahs-14952	43	14	distinct	distinct	ADJ
ahs-14952	43	15	evolutionary	evolutionary	ADJ
ahs-14952	43	16	strategies	strategy	NOUN
ahs-14952	43	17	,	,	PUNCT
ahs-14952	43	18	namely	namely	ADV
ahs-14952	43	19	sympodial	sympodial	ADJ
ahs-14952	43	20	growth	growth	NOUN
ahs-14952	43	21	and	and	CCONJ
ahs-14952	43	22	monopodial	monopodial	ADJ
ahs-14952	43	23	development	development	NOUN
ahs-14952	43	24	,	,	PUNCT
ahs-14952	43	25	which	which	PRON
ahs-14952	43	26	are	be	AUX
ahs-14952	43	27	regulated	regulate	VERB
ahs-14952	43	28	by	by	ADP
ahs-14952	43	29	a	a	DET
ahs-14952	43	30	diverse	diverse	ADJ
ahs-14952	43	31	array	array	NOUN
ahs-14952	43	32	of	of	ADP
ahs-14952	43	33	endophytic	endophytic	ADJ
ahs-14952	43	34	fungus	fungus	NOUN
ahs-14952	43	35	species	specie	NOUN
ahs-14952	43	36	.	.	PUNCT
ahs-14952	44	1	these	these	DET
ahs-14952	44	2	techniques	technique	NOUN
ahs-14952	44	3	serve	serve	VERB
ahs-14952	44	4	to	to	PART
ahs-14952	44	5	extend	extend	VERB
ahs-14952	44	6	the	the	DET
ahs-14952	44	7	longevity	longevity	NOUN
ahs-14952	44	8	of	of	ADP
ahs-14952	44	9	orchids	orchid	NOUN
ahs-14952	44	10	as	as	ADP
ahs-14952	44	11	herbaceous	herbaceous	ADJ
ahs-14952	44	12	plants	plant	NOUN
ahs-14952	44	13	.	.	PUNCT
ahs-14952	45	1	(	(	PUNCT
ahs-14952	45	2	srivastava	srivastava	PROPN
ahs-14952	45	3	,	,	PUNCT
ahs-14952	45	4	2018	2018	NUM
ahs-14952	45	5	)	)	PUNCT
ahs-14952	45	6	.	.	PUNCT
ahs-14952	46	1	orchid	orchid	NOUN
ahs-14952	46	2	endophyte	endophyte	PROPN
ahs-14952	46	3	has	have	VERB
ahs-14952	46	4	a	a	DET
ahs-14952	46	5	different	different	ADJ
ahs-14952	46	6	way	way	NOUN
ahs-14952	46	7	of	of	ADP
ahs-14952	46	8	penetrating	penetrate	VERB
ahs-14952	46	9	and	and	CCONJ
ahs-14952	46	10	colonising	colonise	VERB
ahs-14952	46	11	their	their	PRON
ahs-14952	46	12	host	host	NOUN
ahs-14952	46	13	,	,	PUNCT
ahs-14952	46	14	which	which	PRON
ahs-14952	46	15	makes	make	VERB
ahs-14952	46	16	them	they	PRON
ahs-14952	46	17	different	different	ADJ
ahs-14952	46	18	from	from	ADP
ahs-14952	46	19	another	another	DET
ahs-14952	46	20	fungal	fungal	ADJ
ahs-14952	46	21	pathogen	pathogen	NOUN
ahs-14952	46	22	.	.	PUNCT
ahs-14952	47	1	for	for	ADP
ahs-14952	47	2	example	example	NOUN
ahs-14952	47	3	,	,	PUNCT
ahs-14952	47	4	orchid	orchid	NOUN
ahs-14952	47	5	fungi	fungus	NOUN
ahs-14952	47	6	endophytes	endophyte	NOUN
ahs-14952	47	7	enter	enter	VERB
ahs-14952	47	8	through	through	ADP
ahs-14952	47	9	stomata	stomata	NOUN
ahs-14952	47	10	laterally	laterally	ADV
ahs-14952	47	11	in	in	ADP
ahs-14952	47	12	the	the	DET
ahs-14952	47	13	anticlinal	anticlinal	ADJ
ahs-14952	47	14	epidermal	epidermal	ADJ
ahs-14952	47	15	cell	cell	NOUN
ahs-14952	47	16	.	.	PUNCT
ahs-14952	48	1	they	they	PRON
ahs-14952	48	2	remain	remain	VERB
ahs-14952	48	3	intracellularly	intracellularly	ADJ
ahs-14952	48	4	in	in	ADP
ahs-14952	48	5	the	the	DET
ahs-14952	48	6	shoot	shoot	NOUN
ahs-14952	48	7	without	without	ADP
ahs-14952	48	8	colonising	colonise	VERB
ahs-14952	48	9	the	the	DET
ahs-14952	48	10	cell	cell	NOUN
ahs-14952	48	11	.	.	PUNCT
ahs-14952	49	1	in	in	ADP
ahs-14952	49	2	contrast	contrast	NOUN
ahs-14952	49	3	,	,	PUNCT
ahs-14952	49	4	pathogen	pathogen	NOUN
ahs-14952	49	5	fungi	fungus	NOUN
ahs-14952	49	6	enter	enter	VERB
ahs-14952	49	7	directly	directly	ADV
ahs-14952	49	8	from	from	ADP
ahs-14952	49	9	the	the	DET
ahs-14952	49	10	cell	cell	NOUN
ahs-14952	49	11	wall	wall	NOUN
ahs-14952	49	12	and	and	CCONJ
ahs-14952	49	13	typically	typically	ADV
ahs-14952	49	14	grow	grow	VERB
ahs-14952	49	15	extracellularly	extracellularly	ADV
ahs-14952	49	16	,	,	PUNCT
ahs-14952	49	17	potentially	potentially	ADV
ahs-14952	49	18	causing	cause	VERB
ahs-14952	49	19	harm	harm	NOUN
ahs-14952	49	20	to	to	ADP
ahs-14952	49	21	the	the	DET
ahs-14952	49	22	host	host	NOUN
ahs-14952	49	23	(	(	PUNCT
ahs-14952	49	24	sarsaiya	sarsaiya	PROPN
ahs-14952	49	25	et	et	PROPN
ahs-14952	49	26	al	al	PROPN
ahs-14952	49	27	.	.	PROPN
ahs-14952	49	28	,	,	PUNCT
ahs-14952	49	29	2019	2019	NUM
ahs-14952	49	30	)	)	PUNCT
ahs-14952	49	31	.	.	PUNCT
ahs-14952	50	1	diverse	diverse	ADJ
ahs-14952	50	2	fungal	fungal	ADJ
ahs-14952	50	3	taxa	taxa	NOUN
ahs-14952	50	4	include	include	VERB
ahs-14952	50	5	mutualistic	mutualistic	ADJ
ahs-14952	50	6	mycorhiza	mycorhiza	NOUN
ahs-14952	50	7	,	,	PUNCT
ahs-14952	50	8	endophytic	endophytic	ADJ
ahs-14952	50	9	fungi	fungus	NOUN
ahs-14952	50	10	and	and	CCONJ
ahs-14952	50	11	considerably	considerably	ADV
ahs-14952	50	12	diverse	diverse	ADJ
ahs-14952	50	13	as	as	ADV
ahs-14952	50	14	well	well	ADV
ahs-14952	50	15	as	as	ADP
ahs-14952	50	16	non­mycorrhizal	non­mycorrhizal	NOUN
ahs-14952	50	17	fungal	fungal	PROPN
ahs-14952	50	18	associates	associate	NOUN
ahs-14952	50	19	.	.	PUNCT
ahs-14952	51	1	the	the	DET
ahs-14952	51	2	role	role	NOUN
ahs-14952	51	3	of	of	ADP
ahs-14952	51	4	the	the	DET
ahs-14952	51	5	root­allied	root­allie	VERB
ahs-14952	51	6	fungi	fungi	NOUN
ahs-14952	51	7	is	be	AUX
ahs-14952	51	8	not	not	PART
ahs-14952	51	9	well	well	ADV
ahs-14952	51	10	understood	understand	VERB
ahs-14952	51	11	.	.	PUNCT
ahs-14952	52	1	according	accord	VERB
ahs-14952	52	2	to	to	ADP
ahs-14952	52	3	lee	lee	PROPN
ahs-14952	52	4	and	and	CCONJ
ahs-14952	52	5	yeung	yeung	PROPN
ahs-14952	52	6	(	(	PUNCT
ahs-14952	52	7	2018	2018	NUM
ahs-14952	52	8	)	)	PUNCT
ahs-14952	52	9	,	,	PUNCT
ahs-14952	52	10	some	some	PRON
ahs-14952	52	11	of	of	ADP
ahs-14952	52	12	these	these	DET
ahs-14952	52	13	fungi	fungus	NOUN
ahs-14952	52	14	may	may	AUX
ahs-14952	52	15	supply	supply	VERB
ahs-14952	52	16	organic	organic	ADJ
ahs-14952	52	17	carbon	carbon	NOUN
ahs-14952	52	18	,	,	PUNCT
ahs-14952	52	19	nutrients	nutrient	NOUN
ahs-14952	52	20	,	,	PUNCT
ahs-14952	52	21	and	and	CCONJ
ahs-14952	52	22	water	water	NOUN
ahs-14952	52	23	to	to	ADP
ahs-14952	52	24	the	the	DET
ahs-14952	52	25	orchid	orchid	NOUN
ahs-14952	52	26	,	,	PUNCT
ahs-14952	52	27	but	but	CCONJ
ahs-14952	52	28	the	the	DET
ahs-14952	52	29	degree	degree	NOUN
ahs-14952	52	30	of	of	ADP
ahs-14952	52	31	this	this	DET
ahs-14952	52	32	transfer	transfer	NOUN
ahs-14952	52	33	is	be	AUX
ahs-14952	52	34	typically	typically	ADV
ahs-14952	52	35	unknown	unknown	ADJ
ahs-14952	52	36	.	.	PUNCT
ahs-14952	53	1	numerous	numerous	ADJ
ahs-14952	53	2	report	report	NOUN
ahs-14952	53	3	on	on	ADP
ahs-14952	53	4	specific	specific	ADJ
ahs-14952	53	5	mycorrhizal	mycorrhizal	NOUN
ahs-14952	53	6	fungi	fungus	NOUN
ahs-14952	53	7	also	also	ADV
ahs-14952	53	8	shows	show	VERB
ahs-14952	53	9	the	the	DET
ahs-14952	53	10	ability	ability	NOUN
ahs-14952	53	11	to	to	PART
ahs-14952	53	12	stimulate	stimulate	VERB
ahs-14952	53	13	the	the	DET
ahs-14952	53	14	embryo	embryo	NOUN
ahs-14952	53	15	’s	’s	PART
ahs-14952	53	16	development	development	NOUN
ahs-14952	53	17	and	and	CCONJ
ahs-14952	53	18	supply	supply	VERB
ahs-14952	53	19	it	it	PRON
ahs-14952	53	20	with	with	ADP
ahs-14952	53	21	necessary	necessary	ADJ
ahs-14952	53	22	nutrients	nutrient	NOUN
ahs-14952	53	23	,	,	PUNCT
ahs-14952	53	24	allowing	allow	VERB
ahs-14952	53	25	the	the	DET
ahs-14952	53	26	orchid	orchid	NOUN
ahs-14952	53	27	seeds	seed	NOUN
ahs-14952	53	28	to	to	PART
ahs-14952	53	29	germinate	germinate	VERB
ahs-14952	53	30	(	(	PUNCT
ahs-14952	53	31	liu	liu	PROPN
ahs-14952	53	32	et	et	PROPN
ahs-14952	53	33	al	al	PROPN
ahs-14952	53	34	.	.	PROPN
ahs-14952	53	35	,	,	PUNCT
ahs-14952	53	36	2010	2010	NUM
ahs-14952	53	37	;	;	PUNCT
ahs-14952	53	38	zhang	zhang	PROPN
ahs-14952	53	39	et	et	PROPN
ahs-14952	53	40	al	al	PROPN
ahs-14952	53	41	.	.	PROPN
ahs-14952	53	42	,	,	PUNCT
ahs-14952	53	43	2016	2016	NUM
ahs-14952	53	44	;	;	PUNCT
ahs-14952	53	45	shao	shao	PROPN
ahs-14952	53	46	et	et	PROPN
ahs-14952	53	47	al	al	PROPN
ahs-14952	53	48	.	.	PROPN
ahs-14952	53	49	,	,	PUNCT
ahs-14952	53	50	2017	2017	NUM
ahs-14952	53	51	;	;	PUNCT
ahs-14952	53	52	herrera	herrera	NOUN
ahs-14952	53	53	et	et	PROPN
ahs-14952	53	54	al	al	PROPN
ahs-14952	53	55	.	.	PROPN
ahs-14952	53	56	,	,	PUNCT
ahs-14952	53	57	2019	2019	NUM
ahs-14952	53	58	;	;	PUNCT
ahs-14952	53	59	shah	shah	PROPN
ahs-14952	53	60	et	et	PROPN
ahs-14952	53	61	al	al	PROPN
ahs-14952	53	62	.	.	PROPN
ahs-14952	53	63	,	,	PUNCT
ahs-14952	53	64	2019	2019	NUM
ahs-14952	53	65	;	;	PUNCT
ahs-14952	53	66	suresh	suresh	PROPN
ahs-14952	53	67	et	et	PROPN
ahs-14952	53	68	al	al	PROPN
ahs-14952	53	69	.	.	PROPN
ahs-14952	53	70	,	,	PUNCT
ahs-14952	53	71	2023	2023	NUM
ahs-14952	53	72	)	)	PUNCT
ahs-14952	53	73	.	.	PUNCT
ahs-14952	54	1	in	in	ADP
ahs-14952	54	2	recent	recent	ADJ
ahs-14952	54	3	years	year	NOUN
ahs-14952	54	4	,	,	PUNCT
ahs-14952	54	5	the	the	PRON
ahs-14952	54	6	has	have	AUX
ahs-14952	54	7	been	be	AUX
ahs-14952	54	8	a	a	DET
ahs-14952	54	9	significant	significant	ADJ
ahs-14952	54	10	transformation	transformation	NOUN
ahs-14952	54	11	in	in	ADP
ahs-14952	54	12	the	the	DET
ahs-14952	54	13	application	application	NOUN
ahs-14952	54	14	of	of	ADP
ahs-14952	54	15	molecular	molecular	ADJ
ahs-14952	54	16	techniques	technique	NOUN
ahs-14952	54	17	.	.	PUNCT
ahs-14952	55	1	the	the	DET
ahs-14952	55	2	identification	identification	NOUN
ahs-14952	55	3	of	of	ADP
ahs-14952	55	4	fungi	fungus	NOUN
ahs-14952	55	5	within	within	ADP
ahs-14952	55	6	roots	root	NOUN
ahs-14952	55	7	has	have	AUX
ahs-14952	55	8	been	be	AUX
ahs-14952	55	9	accomplished	accomplish	VERB
ahs-14952	55	10	through	through	ADP
ahs-14952	55	11	the	the	DET
ahs-14952	55	12	application	application	NOUN
ahs-14952	55	13	of	of	ADP
ahs-14952	55	14	polymerase	polymerase	NOUN
ahs-14952	55	15	chain	chain	NOUN
ahs-14952	55	16	reaction	reaction	NOUN
ahs-14952	55	17	(	(	PUNCT
ahs-14952	55	18	pcr	pcr	NOUN
ahs-14952	55	19	)	)	PUNCT
ahs-14952	55	20	techniques	technique	NOUN
ahs-14952	55	21	,	,	PUNCT
ahs-14952	55	22	employing	employ	VERB
ahs-14952	55	23	fungal­specific	fungal­specific	ADJ
ahs-14952	55	24	primers	primer	NOUN
ahs-14952	55	25	(	(	PUNCT
ahs-14952	55	26	gardes	garde	NOUN
ahs-14952	55	27	and	and	CCONJ
ahs-14952	55	28	bruns	brun	NOUN
ahs-14952	55	29	,	,	PUNCT
ahs-14952	55	30	1993	1993	NUM
ahs-14952	55	31	)	)	PUNCT
ahs-14952	55	32	.	.	PUNCT
ahs-14952	56	1	such	such	ADJ
ahs-14952	56	2	methods	method	NOUN
ahs-14952	56	3	have	have	AUX
ahs-14952	56	4	been	be	AUX
ahs-14952	56	5	used	use	VERB
ahs-14952	56	6	to	to	PART
ahs-14952	56	7	characterize	characterize	VERB
ahs-14952	56	8	mycobionts	mycobiont	NOUN
ahs-14952	56	9	of	of	ADP
ahs-14952	56	10	orchidaceae	orchidaceae	PROPN
ahs-14952	56	11	,	,	PUNCT
ahs-14952	56	12	taylor	taylor	PROPN
ahs-14952	56	13	and	and	CCONJ
ahs-14952	56	14	bruns	brun	NOUN
ahs-14952	56	15	(	(	PUNCT
ahs-14952	56	16	1999	1999	NUM
ahs-14952	56	17	)	)	PUNCT
ahs-14952	56	18	employed	employ	VERB
ahs-14952	56	19	these	these	DET
ahs-14952	56	20	techniques	technique	NOUN
ahs-14952	56	21	to	to	PART
ahs-14952	56	22	characterise	characterise	VERB
ahs-14952	56	23	mycobionts	mycobiont	NOUN
ahs-14952	56	24	of	of	ADP
ahs-14952	56	25	orchidaceae	orchidaceae	PROPN
ahs-14952	56	26	,	,	PUNCT
ahs-14952	56	27	thereby	thereby	ADV
ahs-14952	56	28	removing	remove	VERB
ahs-14952	56	29	the	the	DET
ahs-14952	56	30	laboratories	laboratory	NOUN
ahs-14952	56	31	process	process	NOUN
ahs-14952	56	32	of	of	ADP
ahs-14952	56	33	culturing	culturing	NOUN
ahs-14952	56	34	.	.	PUNCT
ahs-14952	57	1	the	the	DET
ahs-14952	57	2	region	region	NOUN
ahs-14952	57	3	that	that	PRON
ahs-14952	57	4	is	be	AUX
ahs-14952	57	5	most	most	ADV
ahs-14952	57	6	frequently	frequently	ADV
ahs-14952	57	7	studied	study	VERB
ahs-14952	57	8	is	be	AUX
ahs-14952	57	9	the	the	DET
ahs-14952	57	10	nuclear	nuclear	ADJ
ahs-14952	57	11	ribosomal	ribosomal	NOUN
ahs-14952	57	12	internal	internal	ADJ
ahs-14952	57	13	transcriber	transcriber	NOUN
ahs-14952	57	14	spaces	space	NOUN
ahs-14952	57	15	(	(	PUNCT
ahs-14952	57	16	its	its	PRON
ahs-14952	57	17	)	)	PUNCT
ahs-14952	57	18	.	.	PUNCT
ahs-14952	58	1	therefore	therefore	ADV
ahs-14952	58	2	,	,	PUNCT
ahs-14952	58	3	there	there	PRON
ahs-14952	58	4	is	be	VERB
ahs-14952	58	5	a	a	DET
ahs-14952	58	6	want	want	NOUN
ahs-14952	58	7	for	for	ADP
ahs-14952	58	8	molecular	molecular	ADJ
ahs-14952	58	9	techniques	technique	NOUN
ahs-14952	58	10	capable	capable	ADJ
ahs-14952	58	11	of	of	ADP
ahs-14952	58	12	discerning	discern	VERB
ahs-14952	58	13	distinct	distinct	ADJ
ahs-14952	58	14	fungal	fungal	ADJ
ahs-14952	58	15	species	specie	NOUN
ahs-14952	58	16	in	in	ADP
ahs-14952	58	17	cases	case	NOUN
ahs-14952	58	18	where	where	SCONJ
ahs-14952	58	19	numerous	numerous	ADJ
ahs-14952	58	20	fungal	fungal	ADJ
ahs-14952	58	21	species	specie	NOUN
ahs-14952	58	22	are	be	AUX
ahs-14952	58	23	present	present	ADJ
ahs-14952	58	24	in	in	ADP
ahs-14952	58	25	a	a	DET
ahs-14952	58	26	single	single	ADJ
ahs-14952	58	27	plant	plant	NOUN
ahs-14952	58	28	.	.	PUNCT
ahs-14952	59	1	the	the	DET
ahs-14952	59	2	present	present	ADJ
ahs-14952	59	3	review	review	NOUN
ahs-14952	59	4	has	have	AUX
ahs-14952	59	5	provided	provide	VERB
ahs-14952	59	6	an	an	DET
ahs-14952	59	7	overview	overview	NOUN
ahs-14952	59	8	of	of	ADP
ahs-14952	59	9	the	the	DET
ahs-14952	59	10	principal	principal	ADJ
ahs-14952	59	11	discoveries	discovery	NOUN
ahs-14952	59	12	and	and	CCONJ
ahs-14952	59	13	methodologies	methodology	NOUN
ahs-14952	59	14	utilised	utilise	VERB
ahs-14952	59	15	in	in	ADP
ahs-14952	59	16	the	the	DET
ahs-14952	59	17	discipline	discipline	NOUN
ahs-14952	59	18	,	,	PUNCT
ahs-14952	59	19	underscoring	underscore	VERB
ahs-14952	59	20	the	the	DET
ahs-14952	59	21	significance	significance	NOUN
ahs-14952	59	22	of	of	ADP
ahs-14952	59	23	molecular	molecular	ADJ
ahs-14952	59	24	techniques	technique	NOUN
ahs-14952	59	25	such	such	ADJ
ahs-14952	59	26	as	as	ADP
ahs-14952	59	27	fungal	fungal	ADJ
ahs-14952	59	28	dna	dna	PROPN
ahs-14952	59	29	extraction	extraction	NOUN
ahs-14952	59	30	,	,	PUNCT
ahs-14952	59	31	primer	primer	NOUN
ahs-14952	59	32	selection	selection	NOUN
ahs-14952	59	33	,	,	PUNCT
ahs-14952	59	34	polymerase	polymerase	NOUN
ahs-14952	59	35	chain	chain	NOUN
ahs-14952	59	36	reaction	reaction	NOUN
ahs-14952	59	37	(	(	PUNCT
ahs-14952	59	38	pcr	pcr	NOUN
ahs-14952	59	39	)	)	PUNCT
ahs-14952	59	40	,	,	PUNCT
ahs-14952	59	41	and	and	CCONJ
ahs-14952	59	42	high	high	ADJ
ahs-14952	59	43	throughput	throughput	NOUN
ahs-14952	59	44	sequencing	sequence	VERB
ahs-14952	59	45	(	(	PUNCT
ahs-14952	59	46	hts	ht	NOUN
ahs-14952	59	47	)	)	PUNCT
ahs-14952	59	48	in	in	ADP
ahs-14952	59	49	discerning	discern	VERB
ahs-14952	59	50	the	the	DET
ahs-14952	59	51	taxonomy	taxonomy	NOUN
ahs-14952	59	52	of	of	ADP
ahs-14952	59	53	mycorrhizal	mycorrhizal	NOUN
ahs-14952	59	54	fungi	fungus	NOUN
ahs-14952	59	55	and	and	CCONJ
ahs-14952	59	56	elucidating	elucidate	VERB
ahs-14952	59	57	the	the	DET
ahs-14952	59	58	underlying	underlie	VERB
ahs-14952	59	59	molecular	molecular	ADJ
ahs-14952	59	60	mechanisms	mechanism	NOUN
ahs-14952	59	61	that	that	PRON
ahs-14952	59	62	regulate	regulate	VERB
ahs-14952	59	63	these	these	DET
ahs-14952	59	64	symbiotic	symbiotic	ADJ
ahs-14952	59	65	relationships	relationship	NOUN
ahs-14952	59	66	.	.	PUNCT
ahs-14952	60	1	furthermore	furthermore	ADV
ahs-14952	60	2	,	,	PUNCT
ahs-14952	60	3	the	the	DET
ahs-14952	60	4	utilisation	utilisation	NOUN
ahs-14952	60	5	of	of	ADP
ahs-14952	60	6	molecular	molecular	ADJ
ahs-14952	60	7	method	method	NOUN
ahs-14952	60	8	has	have	AUX
ahs-14952	60	9	provided	provide	VERB
ahs-14952	60	10	researchers	researcher	NOUN
ahs-14952	60	11	with	with	ADP
ahs-14952	60	12	enhanced	enhanced	ADJ
ahs-14952	60	13	capabilities	capability	NOUN
ahs-14952	60	14	to	to	PART
ahs-14952	60	15	explore	explore	VERB
ahs-14952	60	16	the	the	DET
ahs-14952	60	17	extensive	extensive	ADJ
ahs-14952	60	18	range	range	NOUN
ahs-14952	60	19	of	of	ADP
ahs-14952	60	20	orchid	orchid	NOUN
ahs-14952	60	21	mycorrhizal	mycorrhizal	NOUN
ahs-14952	60	22	variety	variety	NOUN
ahs-14952	60	23	.	.	PUNCT
ahs-14952	61	1	the	the	DET
ahs-14952	61	2	investigation	investigation	NOUN
ahs-14952	61	3	has	have	AUX
ahs-14952	61	4	not	not	PART
ahs-14952	61	5	only	only	ADV
ahs-14952	61	6	shown	show	VERB
ahs-14952	61	7	evolutionary	evolutionary	ADJ
ahs-14952	61	8	relationship	relationship	NOUN
ahs-14952	61	9	but	but	CCONJ
ahs-14952	61	10	has	have	AUX
ahs-14952	61	11	also	also	ADV
ahs-14952	61	12	yielded	yield	VERB
ahs-14952	61	13	significant	significant	ADJ
ahs-14952	61	14	insights	insight	NOUN
ahs-14952	61	15	into	into	ADP
ahs-14952	61	16	ecological	ecological	ADJ
ahs-14952	61	17	and	and	CCONJ
ahs-14952	61	18	conservation	conservation	NOUN
ahs-14952	61	19	concerns	concern	NOUN
ahs-14952	61	20	.	.	PUNCT
ahs-14952	62	1	a	a	DET
ahs-14952	62	2	thorough	thorough	ADJ
ahs-14952	62	3	comprehension	comprehension	NOUN
ahs-14952	62	4	of	of	ADP
ahs-14952	62	5	mycorrhizal	mycorrhizal	NOUN
ahs-14952	62	6	connections	connection	NOUN
ahs-14952	62	7	is	be	AUX
ahs-14952	62	8	essential	essential	ADJ
ahs-14952	62	9	for	for	ADP
ahs-14952	62	10	the	the	DET
ahs-14952	62	11	efficient	efficient	ADJ
ahs-14952	62	12	preservation	preservation	NOUN
ahs-14952	62	13	of	of	ADP
ahs-14952	62	14	orchid	orchid	NOUN
ahs-14952	62	15	species	specie	NOUN
ahs-14952	62	16	.	.	PUNCT
ahs-14952	63	1	in	in	ADP
ahs-14952	63	2	addition	addition	NOUN
ahs-14952	63	3	,	,	PUNCT
ahs-14952	63	4	the	the	DET
ahs-14952	63	5	exploration	exploration	NOUN
ahs-14952	63	6	of	of	ADP
ahs-14952	63	7	orchid	orchid	NOUN
ahs-14952	63	8	mycorrhizal	mycorrhizal	NOUN
ahs-14952	63	9	fungus	fungus	NOUN
ahs-14952	63	10	in	in	ADP
ahs-14952	63	11	the	the	DET
ahs-14952	63	12	fields	field	NOUN
ahs-14952	63	13	of	of	ADP
ahs-14952	63	14	biotechnology	biotechnology	NOUN
ahs-14952	63	15	and	and	CCONJ
ahs-14952	63	16	agriculture	agriculture	NOUN
ahs-14952	63	17	has	have	AUX
ahs-14952	63	18	resulted	result	VERB
ahs-14952	63	19	in	in	ADP
ahs-14952	63	20	the	the	DET
ahs-14952	63	21	identification	identification	NOUN
ahs-14952	63	22	of	of	ADP
ahs-14952	63	23	new	new	ADJ
ahs-14952	63	24	and	and	CCONJ
ahs-14952	63	25	important	important	ADJ
ahs-14952	63	26	mycorrhizal	mycorrhizal	NOUN
ahs-14952	63	27	fungi	fungi	NOUN
ahs-14952	63	28	.	.	PUNCT
ahs-14952	64	1	in	in	ADP
ahs-14952	64	2	the	the	DET
ahs-14952	64	3	context	context	NOUN
ahs-14952	64	4	of	of	ADP
ahs-14952	64	5	identifying	identify	VERB
ahs-14952	64	6	orchid	orchid	NOUN
ahs-14952	64	7	mycorrhizal	mycorrhizal	NOUN
ahs-14952	64	8	fungi	fungus	NOUN
ahs-14952	64	9	,	,	PUNCT
ahs-14952	64	10	many	many	ADJ
ahs-14952	64	11	methodologies	methodology	NOUN
ahs-14952	64	12	are	be	AUX
ahs-14952	64	13	routinely	routinely	ADV
ahs-14952	64	14	applied	apply	VERB
ahs-14952	64	15	,	,	PUNCT
ahs-14952	64	16	encompassing	encompass	VERB
ahs-14952	64	17	the	the	DET
ahs-14952	64	18	isolation	isolation	NOUN
ahs-14952	64	19	and	and	CCONJ
ahs-14952	64	20	cultivation	cultivation	NOUN
ahs-14952	64	21	of	of	ADP
ahs-14952	64	22	fungi	fungus	NOUN
ahs-14952	64	23	,	,	PUNCT
ahs-14952	64	24	microscopic	microscopic	ADJ
ahs-14952	64	25	analysis	analysis	NOUN
ahs-14952	64	26	and	and	CCONJ
ahs-14952	64	27	molecular	molecular	ADJ
ahs-14952	64	28	studies	study	NOUN
ahs-14952	64	29	.	.	PUNCT
ahs-14952	65	1	the	the	DET
ahs-14952	65	2	ongoing	ongoing	ADJ
ahs-14952	65	3	refining	refining	NOUN
ahs-14952	65	4	shamsudin	shamsudin	VERB
ahs-14952	65	5	et	et	PROPN
ahs-14952	65	6	al	al	PROPN
ahs-14952	65	7	.	.	PROPN
ahs-14952	66	1	‐	‐	ADP
ahs-14952	66	2	molecular	molecular	ADJ
ahs-14952	66	3	identification	identification	NOUN
ahs-14952	66	4	of	of	ADP
ahs-14952	66	5	orchid	orchid	NOUN
ahs-14952	66	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	66	7	99	99	NUM
ahs-14952	66	8	and	and	CCONJ
ahs-14952	66	9	improvement	improvement	NOUN
ahs-14952	66	10	of	of	ADP
ahs-14952	66	11	these	these	DET
ahs-14952	66	12	techniques	technique	NOUN
ahs-14952	66	13	play	play	VERB
ahs-14952	66	14	a	a	DET
ahs-14952	66	15	crucial	crucial	ADJ
ahs-14952	66	16	role	role	NOUN
ahs-14952	66	17	in	in	ADP
ahs-14952	66	18	further	far	ADV
ahs-14952	66	19	our	our	PRON
ahs-14952	66	20	understanding	understanding	NOUN
ahs-14952	66	21	and	and	CCONJ
ahs-14952	66	22	fascinating	fascinating	ADJ
ahs-14952	66	23	associations	association	NOUN
ahs-14952	66	24	between	between	ADP
ahs-14952	66	25	orchids	orchid	NOUN
ahs-14952	66	26	and	and	CCONJ
ahs-14952	66	27	their	their	PRON
ahs-14952	66	28	mycorrhizal	mycorrhizal	NOUN
ahs-14952	66	29	fungus	fungus	NOUN
ahs-14952	66	30	.	.	PUNCT
ahs-14952	67	1	2	2	X
ahs-14952	67	2	.	.	X
ahs-14952	67	3	orchid	orchid	NOUN
ahs-14952	67	4	and	and	CCONJ
ahs-14952	67	5	its	its	PRON
ahs-14952	67	6	fungi	fungi	NOUN
ahs-14952	67	7	diversity	diversity	NOUN
ahs-14952	67	8	orchids	orchid	NOUN
ahs-14952	67	9	form	form	VERB
ahs-14952	67	10	a	a	DET
ahs-14952	67	11	unique	unique	ADJ
ahs-14952	67	12	symbiotic	symbiotic	ADJ
ahs-14952	67	13	relationship	relationship	NOUN
ahs-14952	67	14	with	with	ADP
ahs-14952	67	15	the	the	DET
ahs-14952	67	16	plant	plant	NOUN
ahs-14952	67	17	and	and	CCONJ
ahs-14952	67	18	animal	animal	NOUN
ahs-14952	67	19	species	specie	NOUN
ahs-14952	67	20	present	present	ADJ
ahs-14952	67	21	in	in	ADP
ahs-14952	67	22	forest	forest	NOUN
ahs-14952	67	23	habitats	habitat	NOUN
ahs-14952	67	24	in	in	ADP
ahs-14952	67	25	order	order	NOUN
ahs-14952	67	26	to	to	PART
ahs-14952	67	27	acquires	acquire	VERB
ahs-14952	67	28	nutrients	nutrient	NOUN
ahs-14952	67	29	,	,	PUNCT
ahs-14952	67	30	facilitate	facilitate	VERB
ahs-14952	67	31	their	their	PRON
ahs-14952	67	32	own	own	ADJ
ahs-14952	67	33	development	development	NOUN
ahs-14952	67	34	,	,	PUNCT
ahs-14952	67	35	and	and	CCONJ
ahs-14952	67	36	facilitate	facilitate	VERB
ahs-14952	67	37	the	the	DET
ahs-14952	67	38	process	process	NOUN
ahs-14952	67	39	of	of	ADP
ahs-14952	67	40	pollination	pollination	NOUN
ahs-14952	67	41	.	.	PUNCT
ahs-14952	68	1	the	the	DET
ahs-14952	68	2	mycorrhizal	mycorrhizal	NOUN
ahs-14952	68	3	fungi	fungi	PROPN
ahs-14952	68	4	,	,	PUNCT
ahs-14952	68	5	which	which	PRON
ahs-14952	68	6	exhibit	exhibit	VERB
ahs-14952	68	7	symbiotic	symbiotic	ADJ
ahs-14952	68	8	germination	germination	NOUN
ahs-14952	68	9	,	,	PUNCT
ahs-14952	68	10	are	be	AUX
ahs-14952	68	11	if	if	SCONJ
ahs-14952	68	12	significant	significant	ADJ
ahs-14952	68	13	importance	importance	NOUN
ahs-14952	68	14	in	in	ADP
ahs-14952	68	15	facilitating	facilitate	VERB
ahs-14952	68	16	embryo	embryo	NOUN
ahs-14952	68	17	development	development	NOUN
ahs-14952	68	18	and	and	CCONJ
ahs-14952	68	19	supply	supply	VERB
ahs-14952	68	20	vital	vital	ADJ
ahs-14952	68	21	nutrients	nutrient	NOUN
ahs-14952	68	22	within	within	ADP
ahs-14952	68	23	the	the	DET
ahs-14952	68	24	natural	natural	ADJ
ahs-14952	68	25	environment	environment	NOUN
ahs-14952	68	26	.	.	PUNCT
ahs-14952	69	1	this	this	DET
ahs-14952	69	2	symbiotic	symbiotic	ADJ
ahs-14952	69	3	relationship	relationship	NOUN
ahs-14952	69	4	is	be	AUX
ahs-14952	69	5	crucial	crucial	ADJ
ahs-14952	69	6	in	in	ADP
ahs-14952	69	7	the	the	DET
ahs-14952	69	8	effective	effective	ADJ
ahs-14952	69	9	germination	germination	NOUN
ahs-14952	69	10	of	of	ADP
ahs-14952	69	11	orchid	orchid	NOUN
ahs-14952	69	12	seeds	seed	NOUN
ahs-14952	69	13	(	(	PUNCT
ahs-14952	69	14	liu	liu	PROPN
ahs-14952	69	15	et	et	PROPN
ahs-14952	69	16	al	al	PROPN
ahs-14952	69	17	.	.	PROPN
ahs-14952	69	18	,	,	PUNCT
ahs-14952	69	19	2010	2010	NUM
ahs-14952	69	20	;	;	PUNCT
ahs-14952	69	21	herrera	herrera	NOUN
ahs-14952	69	22	et	et	PROPN
ahs-14952	69	23	al	al	PROPN
ahs-14952	69	24	.	.	PROPN
ahs-14952	69	25	,	,	PUNCT
ahs-14952	69	26	2019	2019	NUM
ahs-14952	69	27	)	)	PUNCT
ahs-14952	69	28	.	.	PUNCT
ahs-14952	70	1	fungi	fungus	NOUN
ahs-14952	70	2	have	have	VERB
ahs-14952	70	3	a	a	DET
ahs-14952	70	4	crucial	crucial	ADJ
ahs-14952	70	5	role	role	NOUN
ahs-14952	70	6	as	as	ADP
ahs-14952	70	7	the	the	DET
ahs-14952	70	8	principal	principal	ADJ
ahs-14952	70	9	provider	provider	NOUN
ahs-14952	70	10	of	of	ADP
ahs-14952	70	11	essential	essential	ADJ
ahs-14952	70	12	nutrients	nutrient	NOUN
ahs-14952	70	13	for	for	ADP
ahs-14952	70	14	developing	develop	VERB
ahs-14952	70	15	orchidaceae	orchidaceae	ADJ
ahs-14952	70	16	plants	plant	NOUN
ahs-14952	70	17	,	,	PUNCT
ahs-14952	70	18	especially	especially	ADV
ahs-14952	70	19	in	in	ADP
ahs-14952	70	20	setting	set	VERB
ahs-14952	70	21	characterised	characterise	VERB
ahs-14952	70	22	by	by	ADP
ahs-14952	70	23	low	low	ADJ
ahs-14952	70	24	nutrients	nutrient	NOUN
ahs-14952	70	25	availability	availability	NOUN
ahs-14952	70	26	(	(	PUNCT
ahs-14952	70	27	long	long	ADV
ahs-14952	70	28	et	et	PROPN
ahs-14952	70	29	al	al	PROPN
ahs-14952	70	30	.	.	PROPN
ahs-14952	70	31	,	,	PUNCT
ahs-14952	70	32	2022	2022	NUM
ahs-14952	70	33	)	)	PUNCT
ahs-14952	70	34	.	.	PUNCT
ahs-14952	71	1	orchids	orchid	NOUN
ahs-14952	71	2	interact	interact	VERB
ahs-14952	71	3	with	with	ADP
ahs-14952	71	4	a	a	DET
ahs-14952	71	5	smaller	small	ADJ
ahs-14952	71	6	number	number	NOUN
ahs-14952	71	7	of	of	ADP
ahs-14952	71	8	mycorrhizal	mycorrhizal	NOUN
ahs-14952	71	9	fungi	fungus	NOUN
ahs-14952	71	10	than	than	ADP
ahs-14952	71	11	other	other	ADJ
ahs-14952	71	12	mycorrhizal	mycorrhizal	NOUN
ahs-14952	71	13	plants	plant	NOUN
ahs-14952	71	14	,	,	PUNCT
ahs-14952	71	15	with	with	ADP
ahs-14952	71	16	greater	great	ADJ
ahs-14952	71	17	specificity	specificity	NOUN
ahs-14952	71	18	for	for	ADP
ahs-14952	71	19	orchid	orchid	NOUN
ahs-14952	71	20	mycorrhizal	mycorrhizal	NOUN
ahs-14952	71	21	fungi	fungus	NOUN
ahs-14952	71	22	than	than	ADP
ahs-14952	71	23	ectomycorrhizae	ectomycorrhizae	NOUN
ahs-14952	71	24	,	,	PUNCT
ahs-14952	71	25	arbuscular	arbuscular	ADJ
ahs-14952	71	26	mycorrhizae	mycorrhizae	NOUN
ahs-14952	71	27	,	,	PUNCT
ahs-14952	71	28	and	and	CCONJ
ahs-14952	71	29	even	even	ADV
ahs-14952	71	30	ericoid	ericoid	VERB
ahs-14952	71	31	mycorrhizal	mycorrhizal	NOUN
ahs-14952	71	32	fungi	fungi	PROPN
ahs-14952	71	33	.	.	PUNCT
ahs-14952	72	1	in	in	ADP
ahs-14952	72	2	symbiotic	symbiotic	ADJ
ahs-14952	72	3	connection	connection	NOUN
ahs-14952	72	4	,	,	PUNCT
ahs-14952	72	5	fungi	fungus	NOUN
ahs-14952	72	6	provide	provide	VERB
ahs-14952	72	7	plants	plant	NOUN
ahs-14952	72	8	with	with	ADP
ahs-14952	72	9	water	water	NOUN
ahs-14952	72	10	and	and	CCONJ
ahs-14952	72	11	mineral	mineral	NOUN
ahs-14952	72	12	nutrients	nutrient	NOUN
ahs-14952	72	13	(	(	PUNCT
ahs-14952	72	14	especially	especially	ADV
ahs-14952	72	15	phosphorus	phosphorus	NOUN
ahs-14952	72	16	)	)	PUNCT
ahs-14952	72	17	while	while	SCONJ
ahs-14952	72	18	protecting	protect	VERB
ahs-14952	72	19	them	they	PRON
ahs-14952	72	20	from	from	ADP
ahs-14952	72	21	biotic	biotic	ADJ
ahs-14952	72	22	and	and	CCONJ
ahs-14952	72	23	abiotic	abiotic	ADJ
ahs-14952	72	24	stresses	stress	NOUN
ahs-14952	72	25	.	.	PUNCT
ahs-14952	73	1	in	in	ADP
ahs-14952	73	2	exchange	exchange	NOUN
ahs-14952	73	3	,	,	PUNCT
ahs-14952	73	4	plant	plant	NOUN
ahs-14952	73	5	hosts	host	NOUN
ahs-14952	73	6	provide	provide	VERB
ahs-14952	73	7	carbon	carbon	NOUN
ahs-14952	73	8	from	from	ADP
ahs-14952	73	9	photosynthesis	photosynthesis	NOUN
ahs-14952	73	10	to	to	ADP
ahs-14952	73	11	the	the	DET
ahs-14952	73	12	fungi	fungi	PROPN
ahs-14952	73	13	(	(	PUNCT
ahs-14952	73	14	rasmussen	rasmussen	PROPN
ahs-14952	73	15	,	,	PUNCT
ahs-14952	73	16	1995	1995	NUM
ahs-14952	73	17	;	;	PUNCT
ahs-14952	73	18	tedersoo	tedersoo	VERB
ahs-14952	73	19	et	et	PROPN
ahs-14952	73	20	al	al	PROPN
ahs-14952	73	21	.	.	PROPN
ahs-14952	73	22	,	,	PUNCT
ahs-14952	73	23	2017	2017	NUM
ahs-14952	73	24	)	)	PUNCT
ahs-14952	73	25	.	.	PUNCT
ahs-14952	74	1	many	many	ADJ
ahs-14952	74	2	orchid	orchid	NOUN
ahs-14952	74	3	species	specie	NOUN
ahs-14952	74	4	can	can	AUX
ahs-14952	74	5	not	not	PART
ahs-14952	74	6	commence	commence	VERB
ahs-14952	74	7	germination	germination	NOUN
ahs-14952	74	8	or	or	CCONJ
ahs-14952	74	9	grow	grow	VERB
ahs-14952	74	10	without	without	ADP
ahs-14952	74	11	their	their	PRON
ahs-14952	74	12	compatible	compatible	ADJ
ahs-14952	74	13	symbiotic	symbiotic	ADJ
ahs-14952	74	14	fungus	fungus	NOUN
ahs-14952	74	15	(	(	PUNCT
ahs-14952	74	16	rasmussen	rasmussen	PROPN
ahs-14952	74	17	,	,	PUNCT
ahs-14952	74	18	1995	1995	NUM
ahs-14952	74	19	;	;	PUNCT
ahs-14952	74	20	davis	davis	PROPN
ahs-14952	74	21	et	et	PROPN
ahs-14952	74	22	al	al	PROPN
ahs-14952	74	23	.	.	PROPN
ahs-14952	74	24	,	,	PUNCT
ahs-14952	74	25	2015	2015	NUM
ahs-14952	74	26	;	;	PUNCT
ahs-14952	74	27	fay	fay	PROPN
ahs-14952	74	28	,	,	PUNCT
ahs-14952	74	29	2018	2018	NUM
ahs-14952	74	30	;	;	PUNCT
ahs-14952	74	31	attri	attri	ADJ
ahs-14952	74	32	,	,	PUNCT
ahs-14952	74	33	2022	2022	NUM
ahs-14952	74	34	)	)	PUNCT
ahs-14952	74	35	,	,	PUNCT
ahs-14952	74	36	as	as	SCONJ
ahs-14952	74	37	their	their	PRON
ahs-14952	74	38	specificity	specificity	NOUN
ahs-14952	74	39	of	of	ADP
ahs-14952	74	40	mycorrhizal	mycorrhizal	NOUN
ahs-14952	74	41	connections	connection	NOUN
ahs-14952	74	42	that	that	PRON
ahs-14952	74	43	permit	permit	VERB
ahs-14952	74	44	in	in	ADP
ahs-14952	74	45	situ	situ	ADJ
ahs-14952	74	46	symbiotic	symbiotic	ADJ
ahs-14952	74	47	seed	seed	NOUN
ahs-14952	74	48	germination	germination	NOUN
ahs-14952	74	49	in	in	ADP
ahs-14952	74	50	orchids	orchid	NOUN
ahs-14952	74	51	is	be	AUX
ahs-14952	74	52	frequently	frequently	ADV
ahs-14952	74	53	so	so	ADV
ahs-14952	74	54	rigorous	rigorous	ADJ
ahs-14952	74	55	.	.	PUNCT
ahs-14952	75	1	the	the	DET
ahs-14952	75	2	aforementioned	aforementioned	ADJ
ahs-14952	75	3	circumstance	circumstance	NOUN
ahs-14952	75	4	has	have	AUX
ahs-14952	75	5	stimulated	stimulate	VERB
ahs-14952	75	6	inquiries	inquiry	NOUN
ahs-14952	75	7	into	into	ADP
ahs-14952	75	8	the	the	DET
ahs-14952	75	9	importance	importance	NOUN
ahs-14952	75	10	of	of	ADP
ahs-14952	75	11	fungus	fungus	NOUN
ahs-14952	75	12	in	in	ADP
ahs-14952	75	13	symbiotic	symbiotic	ADJ
ahs-14952	75	14	relationships	relationship	NOUN
ahs-14952	75	15	that	that	PRON
ahs-14952	75	16	are	be	AUX
ahs-14952	75	17	equally	equally	ADV
ahs-14952	75	18	crucial	crucial	ADJ
ahs-14952	75	19	and	and	CCONJ
ahs-14952	75	20	beneficial	beneficial	ADJ
ahs-14952	75	21	for	for	ADP
ahs-14952	75	22	the	the	DET
ahs-14952	75	23	ex‐situ	ex‐situ	ADJ
ahs-14952	75	24	preservation	preservation	NOUN
ahs-14952	75	25	of	of	ADP
ahs-14952	75	26	orchids	orchid	NOUN
ahs-14952	75	27	,	,	PUNCT
ahs-14952	75	28	specifically	specifically	ADV
ahs-14952	75	29	in	in	ADP
ahs-14952	75	30	the	the	DET
ahs-14952	75	31	context	context	NOUN
ahs-14952	75	32	of	of	ADP
ahs-14952	75	33	reintroduction	reintroduction	NOUN
ahs-14952	75	34	endeavours	endeavour	VERB
ahs-14952	75	35	.	.	PUNCT
ahs-14952	76	1	the	the	DET
ahs-14952	76	2	first	first	ADJ
ahs-14952	76	3	recorded	record	VERB
ahs-14952	76	4	evidence	evidence	NOUN
ahs-14952	76	5	of	of	ADP
ahs-14952	76	6	a	a	DET
ahs-14952	76	7	mycorrhizal	mycorrhizal	NOUN
ahs-14952	76	8	fungus	fungus	NOUN
ahs-14952	76	9	in	in	ADP
ahs-14952	76	10	an	an	DET
ahs-14952	76	11	orchid	orchid	NOUN
ahs-14952	76	12	may	may	AUX
ahs-14952	76	13	be	be	AUX
ahs-14952	76	14	traced	trace	VERB
ahs-14952	76	15	back	back	ADV
ahs-14952	76	16	to	to	ADP
ahs-14952	76	17	the	the	DET
ahs-14952	76	18	year	year	NOUN
ahs-14952	76	19	1824	1824	NUM
ahs-14952	76	20	,	,	PUNCT
ahs-14952	76	21	as	as	SCONJ
ahs-14952	76	22	documented	document	VERB
ahs-14952	76	23	by	by	ADP
ahs-14952	76	24	the	the	DET
ahs-14952	76	25	renowned	renowned	ADJ
ahs-14952	76	26	german	german	ADJ
ahs-14952	76	27	naturalist	naturalist	NOUN
ahs-14952	76	28	heinrich	heinrich	PROPN
ahs-14952	76	29	link	link	PROPN
ahs-14952	76	30	.	.	PUNCT
ahs-14952	77	1	nevertheless	nevertheless	ADV
ahs-14952	77	2	,	,	PUNCT
ahs-14952	77	3	the	the	DET
ahs-14952	77	4	specific	specific	ADJ
ahs-14952	77	5	function	function	NOUN
ahs-14952	77	6	of	of	ADP
ahs-14952	77	7	the	the	DET
ahs-14952	77	8	fungus	fungus	NOUN
ahs-14952	77	9	remained	remain	VERB
ahs-14952	77	10	ambiguous	ambiguous	ADJ
ahs-14952	77	11	until	until	ADP
ahs-14952	77	12	the	the	DET
ahs-14952	77	13	early	early	ADJ
ahs-14952	77	14	1900s	1900	NOUN
ahs-14952	77	15	when	when	SCONJ
ahs-14952	77	16	nöel	nöel	PROPN
ahs-14952	77	17	bernard	bernard	PROPN
ahs-14952	77	18	established	establish	VERB
ahs-14952	77	19	a	a	DET
ahs-14952	77	20	scientific	scientific	ADJ
ahs-14952	77	21	correlation	correlation	NOUN
ahs-14952	77	22	between	between	ADP
ahs-14952	77	23	filamentous	filamentous	ADJ
ahs-14952	77	24	fungi	fungus	NOUN
ahs-14952	77	25	and	and	CCONJ
ahs-14952	77	26	the	the	DET
ahs-14952	77	27	process	process	NOUN
ahs-14952	77	28	of	of	ADP
ahs-14952	77	29	seed	seed	NOUN
ahs-14952	77	30	germination	germination	NOUN
ahs-14952	77	31	(	(	PUNCT
ahs-14952	77	32	arditti	arditti	VERB
ahs-14952	77	33	and	and	CCONJ
ahs-14952	77	34	pridgeon	pridgeon	NOUN
ahs-14952	77	35	,	,	PUNCT
ahs-14952	77	36	1997	1997	NUM
ahs-14952	77	37	)	)	PUNCT
ahs-14952	77	38	.	.	PUNCT
ahs-14952	78	1	following	follow	VERB
ahs-14952	78	2	this	this	PRON
ahs-14952	78	3	,	,	PUNCT
ahs-14952	78	4	in	in	ADP
ahs-14952	78	5	the	the	DET
ahs-14952	78	6	early	early	ADJ
ahs-14952	78	7	1900s	1900s	NUM
ahs-14952	78	8	,	,	PUNCT
ahs-14952	78	9	the	the	DET
ahs-14952	78	10	study	study	NOUN
ahs-14952	78	11	of	of	ADP
ahs-14952	78	12	orchid	orchid	NOUN
ahs-14952	78	13	endophytes	endophyte	NOUN
ahs-14952	78	14	emerged	emerge	VERB
ahs-14952	78	15	as	as	ADP
ahs-14952	78	16	a	a	DET
ahs-14952	78	17	significant	significant	ADJ
ahs-14952	78	18	area	area	NOUN
ahs-14952	78	19	of	of	ADP
ahs-14952	78	20	interest	interest	NOUN
ahs-14952	78	21	within	within	ADP
ahs-14952	78	22	the	the	DET
ahs-14952	78	23	field	field	NOUN
ahs-14952	78	24	of	of	ADP
ahs-14952	78	25	orchid	orchid	NOUN
ahs-14952	78	26	biology	biology	NOUN
ahs-14952	78	27	research	research	NOUN
ahs-14952	78	28	.	.	PUNCT
ahs-14952	79	1	chand	chand	NOUN
ahs-14952	79	2	et	et	PROPN
ahs-14952	79	3	al	al	PROPN
ahs-14952	79	4	.	.	PROPN
ahs-14952	79	5	(	(	PUNCT
ahs-14952	79	6	2020	2020	NUM
ahs-14952	79	7	)	)	PUNCT
ahs-14952	79	8	conducted	conduct	VERB
ahs-14952	79	9	a	a	DET
ahs-14952	79	10	comprehensive	comprehensive	ADJ
ahs-14952	79	11	investigation	investigation	NOUN
ahs-14952	79	12	wherein	wherein	SCONJ
ahs-14952	79	13	they	they	PRON
ahs-14952	79	14	isolated	isolate	VERB
ahs-14952	79	15	and	and	CCONJ
ahs-14952	79	16	identified	identify	VERB
ahs-14952	79	17	many	many	ADJ
ahs-14952	79	18	orchid	orchid	NOUN
ahs-14952	79	19	endophytes	endophyte	NOUN
ahs-14952	79	20	,	,	PUNCT
ahs-14952	79	21	and	and	CCONJ
ahs-14952	79	22	thoroughly	thoroughly	ADV
ahs-14952	79	23	evaluated	evaluate	VERB
ahs-14952	79	24	their	their	PRON
ahs-14952	79	25	probable	probable	ADJ
ahs-14952	79	26	role	role	NOUN
ahs-14952	79	27	in	in	ADP
ahs-14952	79	28	orchid	orchid	NOUN
ahs-14952	79	29	symbiosis	symbiosis	NOUN
ahs-14952	79	30	.	.	PUNCT
ahs-14952	80	1	orchids	orchid	NOUN
ahs-14952	80	2	frequently	frequently	ADV
ahs-14952	80	3	establish	establish	VERB
ahs-14952	80	4	symbiotic	symbiotic	ADJ
ahs-14952	80	5	relationships	relationship	NOUN
ahs-14952	80	6	with	with	ADP
ahs-14952	80	7	fungus	fungus	NOUN
ahs-14952	80	8	that	that	PRON
ahs-14952	80	9	display	display	VERB
ahs-14952	80	10	substantial	substantial	ADJ
ahs-14952	80	11	evolutionary	evolutionary	ADJ
ahs-14952	80	12	and	and	CCONJ
ahs-14952	80	13	ecological	ecological	ADJ
ahs-14952	80	14	variability	variability	NOUN
ahs-14952	80	15	.	.	PUNCT
ahs-14952	81	1	epiphytic	epiphytic	ADJ
ahs-14952	81	2	orchids	orchid	NOUN
ahs-14952	81	3	exhibit	exhibit	VERB
ahs-14952	81	4	a	a	DET
ahs-14952	81	5	prevalence	prevalence	NOUN
ahs-14952	81	6	of	of	ADP
ahs-14952	81	7	both	both	DET
ahs-14952	81	8	basidiomycota	basidiomycota	NOUN
ahs-14952	81	9	and	and	CCONJ
ahs-14952	81	10	ascomycota	ascomycota	NOUN
ahs-14952	81	11	in	in	ADP
ahs-14952	81	12	their	their	PRON
ahs-14952	81	13	aerial	aerial	ADJ
ahs-14952	81	14	roots	root	NOUN
ahs-14952	81	15	as	as	ADV
ahs-14952	81	16	well	well	ADV
ahs-14952	81	17	as	as	ADP
ahs-14952	81	18	subterranean	subterranean	ADJ
ahs-14952	81	19	roots	root	NOUN
ahs-14952	81	20	or	or	CCONJ
ahs-14952	81	21	rhizomes	rhizome	NOUN
ahs-14952	81	22	,	,	PUNCT
ahs-14952	81	23	while	while	SCONJ
ahs-14952	81	24	chytridiomycota	chytridiomycota	NOUN
ahs-14952	81	25	,	,	PUNCT
ahs-14952	81	26	glomeromycota	glomeromycota	NOUN
ahs-14952	81	27	,	,	PUNCT
ahs-14952	81	28	zygomycota	zygomycota	NOUN
ahs-14952	81	29	,	,	PUNCT
ahs-14952	81	30	or	or	CCONJ
ahs-14952	81	31	mucoromycota	mucoromycota	NOUN
ahs-14952	81	32	are	be	AUX
ahs-14952	81	33	present	present	ADJ
ahs-14952	81	34	in	in	ADP
ahs-14952	81	35	comparatively	comparatively	ADV
ahs-14952	81	36	smaller	small	ADJ
ahs-14952	81	37	quantities	quantity	NOUN
ahs-14952	81	38	(	(	PUNCT
ahs-14952	81	39	waud	waud	VERB
ahs-14952	81	40	et	et	PROPN
ahs-14952	81	41	al	al	PROPN
ahs-14952	81	42	.	.	PROPN
ahs-14952	81	43	,	,	PUNCT
ahs-14952	81	44	2014	2014	NUM
ahs-14952	81	45	;	;	PUNCT
ahs-14952	81	46	cevallos	cevallos	PROPN
ahs-14952	81	47	et	et	PROPN
ahs-14952	81	48	al	al	PROPN
ahs-14952	81	49	.	.	PROPN
ahs-14952	81	50	,	,	PUNCT
ahs-14952	81	51	2017	2017	NUM
ahs-14952	81	52	;	;	PUNCT
ahs-14952	81	53	egidi	egidi	NOUN
ahs-14952	81	54	et	et	PROPN
ahs-14952	81	55	al	al	PROPN
ahs-14952	81	56	.	.	PROPN
ahs-14952	81	57	,	,	PUNCT
ahs-14952	81	58	2018	2018	NUM
ahs-14952	81	59	;	;	PUNCT
ahs-14952	81	60	novotná	novotná	NOUN
ahs-14952	81	61	et	et	PROPN
ahs-14952	81	62	al	al	PROPN
ahs-14952	81	63	.	.	PROPN
ahs-14952	81	64	,	,	PUNCT
ahs-14952	81	65	2018	2018	NUM
ahs-14952	81	66	)	)	PUNCT
ahs-14952	81	67	.	.	PUNCT
ahs-14952	82	1	the	the	DET
ahs-14952	82	2	classification	classification	NOUN
ahs-14952	82	3	of	of	ADP
ahs-14952	82	4	orchid	orchid	NOUN
ahs-14952	82	5	fungus	fungus	NOUN
ahs-14952	82	6	is	be	AUX
ahs-14952	82	7	determined	determine	VERB
ahs-14952	82	8	by	by	ADP
ahs-14952	82	9	the	the	DET
ahs-14952	82	10	existence	existence	NOUN
ahs-14952	82	11	or	or	CCONJ
ahs-14952	82	12	absence	absence	NOUN
ahs-14952	82	13	of	of	ADP
ahs-14952	82	14	functional	functional	ADJ
ahs-14952	82	15	pelotons	peloton	NOUN
ahs-14952	82	16	within	within	ADP
ahs-14952	82	17	cortical	cortical	ADJ
ahs-14952	82	18	cells	cell	NOUN
ahs-14952	82	19	,	,	PUNCT
ahs-14952	82	20	leading	lead	VERB
ahs-14952	82	21	to	to	ADP
ahs-14952	82	22	the	the	DET
ahs-14952	82	23	categorization	categorization	NOUN
ahs-14952	82	24	of	of	ADP
ahs-14952	82	25	orchid	orchid	NOUN
ahs-14952	82	26	mycorrhizal	mycorrhizal	NOUN
ahs-14952	82	27	fungi	fungus	NOUN
ahs-14952	82	28	(	(	PUNCT
ahs-14952	82	29	omf	omf	NOUN
ahs-14952	82	30	)	)	PUNCT
ahs-14952	82	31	or	or	CCONJ
ahs-14952	82	32	orchid	orchid	NOUN
ahs-14952	82	33	non­mycorrhizal	non­mycorrhizal	NOUN
ahs-14952	82	34	fungi	fungus	NOUN
ahs-14952	82	35	(	(	PUNCT
ahs-14952	82	36	onf	onf	NOUN
ahs-14952	82	37	)	)	PUNCT
ahs-14952	82	38	(	(	PUNCT
ahs-14952	82	39	li	li	PROPN
ahs-14952	82	40	et	et	PROPN
ahs-14952	82	41	al	al	PROPN
ahs-14952	82	42	.	.	PROPN
ahs-14952	82	43	,	,	PUNCT
ahs-14952	82	44	2021	2021	NUM
ahs-14952	82	45	)	)	PUNCT
ahs-14952	82	46	.	.	PUNCT
ahs-14952	83	1	3	3	X
ahs-14952	83	2	.	.	X
ahs-14952	83	3	orchid	orchid	NOUN
ahs-14952	83	4	mycorrhizal	mycorrhizal	NOUN
ahs-14952	83	5	fungi	fungi	NOUN
ahs-14952	83	6	(	(	PUNCT
ahs-14952	83	7	omf	omf	NOUN
ahs-14952	83	8	)	)	PUNCT
ahs-14952	83	9	and	and	CCONJ
ahs-14952	83	10	orchid	orchid	NOUN
ahs-14952	83	11	non­	non­	NOUN
ahs-14952	83	12	mycorrhizal	mycorrhizal	NOUN
ahs-14952	83	13	fungi	fungi	PROPN
ahs-14952	83	14	(	(	PUNCT
ahs-14952	83	15	onf	onf	X
ahs-14952	83	16	)	)	PUNCT
ahs-14952	83	17	the	the	DET
ahs-14952	83	18	phenomenon	phenomenon	NOUN
ahs-14952	83	19	referred	refer	VERB
ahs-14952	83	20	to	to	ADP
ahs-14952	83	21	as	as	ADP
ahs-14952	83	22	“	"	PUNCT
ahs-14952	83	23	orchid	orchid	NOUN
ahs-14952	83	24	mycorrhiza	mycorrhiza	NOUN
ahs-14952	83	25	”	"	PUNCT
ahs-14952	83	26	pertains	pertain	VERB
ahs-14952	83	27	to	to	ADP
ahs-14952	83	28	the	the	DET
ahs-14952	83	29	symbiotic	symbiotic	ADJ
ahs-14952	83	30	relationship	relationship	NOUN
ahs-14952	83	31	established	establish	VERB
ahs-14952	83	32	between	between	ADP
ahs-14952	83	33	the	the	DET
ahs-14952	83	34	orchid	orchid	NOUN
ahs-14952	83	35	plant	plant	NOUN
ahs-14952	83	36	and	and	CCONJ
ahs-14952	83	37	many	many	ADJ
ahs-14952	83	38	fungal	fungal	ADJ
ahs-14952	83	39	species	specie	NOUN
ahs-14952	83	40	that	that	PRON
ahs-14952	83	41	are	be	AUX
ahs-14952	83	42	capable	capable	ADJ
ahs-14952	83	43	of	of	ADP
ahs-14952	83	44	cohabiting	cohabit	VERB
ahs-14952	83	45	within	within	ADP
ahs-14952	83	46	its	its	PRON
ahs-14952	83	47	root	root	NOUN
ahs-14952	83	48	system	system	NOUN
ahs-14952	83	49	.	.	PUNCT
ahs-14952	84	1	the	the	DET
ahs-14952	84	2	germination	germination	NOUN
ahs-14952	84	3	of	of	ADP
ahs-14952	84	4	an	an	DET
ahs-14952	84	5	orchid	orchid	NOUN
ahs-14952	84	6	mycorrhizal	mycorrhizal	NOUN
ahs-14952	84	7	fungus	fungus	NOUN
ahs-14952	84	8	(	(	PUNCT
ahs-14952	84	9	omf	omf	NOUN
ahs-14952	84	10	)	)	PUNCT
ahs-14952	84	11	,	,	PUNCT
ahs-14952	84	12	and	and	CCONJ
ahs-14952	84	13	these	these	DET
ahs-14952	84	14	seeds	seed	NOUN
ahs-14952	84	15	rely	rely	VERB
ahs-14952	84	16	on	on	ADP
ahs-14952	84	17	one	one	NUM
ahs-14952	84	18	or	or	CCONJ
ahs-14952	84	19	more	more	ADJ
ahs-14952	84	20	omf	omf	NOUN
ahs-14952	84	21	’s	’s	NOUN
ahs-14952	84	22	for	for	ADP
ahs-14952	84	23	sustenance	sustenance	NOUN
ahs-14952	84	24	during	during	ADP
ahs-14952	84	25	their	their	PRON
ahs-14952	84	26	whole	whole	ADJ
ahs-14952	84	27	life	life	NOUN
ahs-14952	84	28	(	(	PUNCT
ahs-14952	84	29	bidartondo	bidartondo	NOUN
ahs-14952	84	30	and	and	CCONJ
ahs-14952	84	31	read	read	VERB
ahs-14952	84	32	,	,	PUNCT
ahs-14952	84	33	2008	2008	NUM
ahs-14952	84	34	)	)	PUNCT
ahs-14952	84	35	.	.	PUNCT
ahs-14952	85	1	within	within	ADP
ahs-14952	85	2	the	the	DET
ahs-14952	85	3	realm	realm	NOUN
ahs-14952	85	4	of	of	ADP
ahs-14952	85	5	fungi	fungi	PROPN
ahs-14952	85	6	,	,	PUNCT
ahs-14952	85	7	a	a	DET
ahs-14952	85	8	subset	subset	NOUN
ahs-14952	85	9	of	of	ADP
ahs-14952	85	10	these	these	DET
ahs-14952	85	11	organisms	organism	NOUN
ahs-14952	85	12	can	can	AUX
ahs-14952	85	13	be	be	AUX
ahs-14952	85	14	classified	classify	VERB
ahs-14952	85	15	as	as	ADP
ahs-14952	85	16	transient	transient	NOUN
ahs-14952	85	17	,	,	PUNCT
ahs-14952	85	18	denoting	denote	VERB
ahs-14952	85	19	their	their	PRON
ahs-14952	85	20	inability	inability	NOUN
ahs-14952	85	21	to	to	PART
ahs-14952	85	22	maintain	maintain	VERB
ahs-14952	85	23	a	a	DET
ahs-14952	85	24	sustained	sustained	ADJ
ahs-14952	85	25	presence	presence	NOUN
ahs-14952	85	26	within	within	ADP
ahs-14952	85	27	the	the	DET
ahs-14952	85	28	developing	develop	VERB
ahs-14952	85	29	and	and	CCONJ
ahs-14952	85	30	maturing	mature	VERB
ahs-14952	85	31	tissues	tissue	NOUN
ahs-14952	85	32	of	of	ADP
ahs-14952	85	33	orchids	orchid	NOUN
ahs-14952	85	34	.	.	PUNCT
ahs-14952	86	1	conversely	conversely	ADV
ahs-14952	86	2	,	,	PUNCT
ahs-14952	86	3	there	there	PRON
ahs-14952	86	4	exist	exist	VERB
ahs-14952	86	5	other	other	ADJ
ahs-14952	86	6	fungi	fungus	NOUN
ahs-14952	86	7	that	that	PRON
ahs-14952	86	8	establish	establish	VERB
ahs-14952	86	9	more	more	ADV
ahs-14952	86	10	long­lasting	long­lasting	ADJ
ahs-14952	86	11	associations	association	NOUN
ahs-14952	86	12	with	with	ADP
ahs-14952	86	13	these	these	DET
ahs-14952	86	14	plants	plant	NOUN
ahs-14952	86	15	.	.	PUNCT
ahs-14952	87	1	according	accord	VERB
ahs-14952	87	2	to	to	ADP
ahs-14952	87	3	lee	lee	PROPN
ahs-14952	87	4	and	and	CCONJ
ahs-14952	87	5	yeung	yeung	PROPN
ahs-14952	87	6	(	(	PUNCT
ahs-14952	87	7	2018	2018	NUM
ahs-14952	87	8	)	)	PUNCT
ahs-14952	87	9	,	,	PUNCT
ahs-14952	87	10	during	during	ADP
ahs-14952	87	11	the	the	DET
ahs-14952	87	12	maturation	maturation	NOUN
ahs-14952	87	13	process	process	NOUN
ahs-14952	87	14	of	of	ADP
ahs-14952	87	15	orchids	orchid	NOUN
ahs-14952	87	16	,	,	PUNCT
ahs-14952	87	17	specific	specific	ADJ
ahs-14952	87	18	fungi	fungus	NOUN
ahs-14952	87	19	that	that	PRON
ahs-14952	87	20	play	play	VERB
ahs-14952	87	21	a	a	DET
ahs-14952	87	22	role	role	NOUN
ahs-14952	87	23	in	in	ADP
ahs-14952	87	24	facilitating	facilitate	VERB
ahs-14952	87	25	germination	germination	NOUN
ahs-14952	87	26	persist	persist	VERB
ahs-14952	87	27	as	as	ADP
ahs-14952	87	28	“	"	PUNCT
ahs-14952	87	29	permanent	permanent	ADJ
ahs-14952	87	30	residents	resident	NOUN
ahs-14952	87	31	”	"	PUNCT
ahs-14952	87	32	whereas	whereas	SCONJ
ahs-14952	87	33	other	other	ADJ
ahs-14952	87	34	fungi	fungus	NOUN
ahs-14952	87	35	initiate	initiate	VERB
ahs-14952	87	36	germination	germination	NOUN
ahs-14952	87	37	and	and	CCONJ
ahs-14952	87	38	are	be	AUX
ahs-14952	87	39	subsequently	subsequently	ADV
ahs-14952	87	40	replaced	replace	VERB
ahs-14952	87	41	by	by	ADP
ahs-14952	87	42	different	different	ADJ
ahs-14952	87	43	fungal	fungal	ADJ
ahs-14952	87	44	partners	partner	NOUN
ahs-14952	87	45	.	.	PUNCT
ahs-14952	88	1	the	the	DET
ahs-14952	88	2	identification	identification	NOUN
ahs-14952	88	3	of	of	ADP
ahs-14952	88	4	coiled	coil	VERB
ahs-14952	88	5	pelotons	peloton	NOUN
ahs-14952	88	6	within	within	ADP
ahs-14952	88	7	cortical	cortical	ADJ
ahs-14952	88	8	root	root	NOUN
ahs-14952	88	9	cells	cell	NOUN
ahs-14952	88	10	is	be	AUX
ahs-14952	88	11	recognised	recognise	VERB
ahs-14952	88	12	as	as	ADP
ahs-14952	88	13	a	a	DET
ahs-14952	88	14	characteristic	characteristic	ADJ
ahs-14952	88	15	feature	feature	NOUN
ahs-14952	88	16	of	of	ADP
ahs-14952	88	17	orchid	orchid	NOUN
ahs-14952	88	18	mycorrhizal	mycorrhizal	NOUN
ahs-14952	88	19	fungus	fungus	NOUN
ahs-14952	88	20	(	(	PUNCT
ahs-14952	88	21	omf	omf	PROPN
ahs-14952	88	22	)	)	PUNCT
ahs-14952	88	23	,	,	PUNCT
ahs-14952	88	24	as	as	ADP
ahs-14952	88	25	examiner	examiner	NOUN
ahs-14952	88	26	in	in	ADP
ahs-14952	88	27	research	research	NOUN
ahs-14952	88	28	undertaken	undertake	VERB
ahs-14952	88	29	by	by	ADP
ahs-14952	88	30	dearnaley	dearnaley	PROPN
ahs-14952	88	31	et	et	PROPN
ahs-14952	88	32	al	al	PROPN
ahs-14952	88	33	.	.	PROPN
ahs-14952	89	1	(	(	PUNCT
ahs-14952	89	2	2016	2016	NUM
ahs-14952	89	3	)	)	PUNCT
ahs-14952	89	4	as	as	ADV
ahs-14952	89	5	well	well	ADV
ahs-14952	89	6	as	as	ADP
ahs-14952	89	7	rasmussen	rasmussen	PROPN
ahs-14952	89	8	(	(	PUNCT
ahs-14952	89	9	1995	1995	NUM
ahs-14952	89	10	)	)	PUNCT
ahs-14952	89	11	.	.	PUNCT
ahs-14952	90	1	in	in	ADP
ahs-14952	90	2	contrast	contrast	NOUN
ahs-14952	90	3	,	,	PUNCT
ahs-14952	90	4	adv	adv	PROPN
ahs-14952	90	5	.	.	PUNCT
ahs-14952	90	6	hort	hort	PROPN
ahs-14952	90	7	.	.	PUNCT
ahs-14952	91	1	sci	sci	PROPN
ahs-14952	91	2	.	.	PROPN
ahs-14952	91	3	,	,	PUNCT
ahs-14952	91	4	2024	2024	NUM
ahs-14952	91	5	38(1	38(1	NOUN
ahs-14952	91	6	):	):	PUNCT
ahs-14952	91	7	97­116	97­116	NUM
ahs-14952	91	8	100	100	NUM
ahs-14952	91	9	orchid	orchid	NOUN
ahs-14952	91	10	mycorrhizal	mycorrhizal	NOUN
ahs-14952	91	11	fungi	fungi	NOUN
ahs-14952	91	12	(	(	PUNCT
ahs-14952	91	13	onf	onf	NOUN
ahs-14952	91	14	)	)	PUNCT
ahs-14952	91	15	pertain	pertain	NOUN
ahs-14952	91	16	to	to	ADP
ahs-14952	91	17	a	a	DET
ahs-14952	91	18	distinct	distinct	ADJ
ahs-14952	91	19	classification	classification	NOUN
ahs-14952	91	20	of	of	ADP
ahs-14952	91	21	endophytic	endophytic	ADJ
ahs-14952	91	22	fungi	fungus	NOUN
ahs-14952	91	23	that	that	PRON
ahs-14952	91	24	reside	reside	VERB
ahs-14952	91	25	within	within	ADP
ahs-14952	91	26	the	the	DET
ahs-14952	91	27	roots	root	NOUN
ahs-14952	91	28	or	or	CCONJ
ahs-14952	91	29	other	other	ADJ
ahs-14952	91	30	tissues	tissue	NOUN
ahs-14952	91	31	or	or	CCONJ
ahs-14952	91	32	orchids	orchid	NOUN
ahs-14952	91	33	at	at	ADP
ahs-14952	91	34	specified	specify	VERB
ahs-14952	91	35	phases	phase	NOUN
ahs-14952	91	36	of	of	ADP
ahs-14952	91	37	their	their	PRON
ahs-14952	91	38	l	l	NOUN
ahs-14952	91	39	ife	ife	PROPN
ahs-14952	91	40	cycle	cycle	NOUN
ahs-14952	91	41	.	.	PUNCT
ahs-14952	92	1	nevertheless	nevertheless	ADV
ahs-14952	92	2	,	,	PUNCT
ahs-14952	92	3	it	it	PRON
ahs-14952	92	4	is	be	AUX
ahs-14952	92	5	imperative	imperative	ADJ
ahs-14952	92	6	to	to	PART
ahs-14952	92	7	elucidate	elucidate	VERB
ahs-14952	92	8	that	that	PRON
ahs-14952	92	9	oligotrophic	oligotrophic	ADJ
ahs-14952	92	10	nitrogen­	nitrogen­	PROPN
ahs-14952	92	11	fixation	fixation	NOUN
ahs-14952	92	12	bacteria	bacteria	NOUN
ahs-14952	92	13	(	(	PUNCT
ahs-14952	92	14	onfs	onfs	PROPN
ahs-14952	92	15	)	)	PUNCT
ahs-14952	92	16	are	be	AUX
ahs-14952	92	17	devoid	devoid	ADJ
ahs-14952	92	18	of	of	ADP
ahs-14952	92	19	peloton­like	peloton­like	ADJ
ahs-14952	92	20	structures	structure	NOUN
ahs-14952	92	21	and	and	CCONJ
ahs-14952	92	22	do	do	AUX
ahs-14952	92	23	not	not	PART
ahs-14952	92	24	elicit	elicit	VERB
ahs-14952	92	25	any	any	DET
ahs-14952	92	26	noticeable	noticeable	ADJ
ahs-14952	92	27	pathogenic	pathogenic	ADJ
ahs-14952	92	28	consequences	consequence	NOUN
ahs-14952	92	29	in	in	ADP
ahs-14952	92	30	the	the	DET
ahs-14952	92	31	host	host	NOUN
ahs-14952	92	32	plants	plant	NOUN
ahs-14952	92	33	.	.	PUNCT
ahs-14952	93	1	the	the	DET
ahs-14952	93	2	aforementioned	aforementioned	ADJ
ahs-14952	93	3	phenomenon	phenomenon	NOUN
ahs-14952	93	4	has	have	AUX
ahs-14952	93	5	been	be	AUX
ahs-14952	93	6	emphasised	emphasise	VERB
ahs-14952	93	7	in	in	ADP
ahs-14952	93	8	scientific	scientific	ADJ
ahs-14952	93	9	inquiries	inquiry	NOUN
ahs-14952	93	10	conducted	conduct	VERB
ahs-14952	93	11	by	by	ADP
ahs-14952	93	12	sisti	sisti	PROPN
ahs-14952	93	13	et	et	PROPN
ahs-14952	93	14	al	al	PROPN
ahs-14952	93	15	.	.	PROPN
ahs-14952	94	1	(	(	PUNCT
ahs-14952	94	2	2019	2019	NUM
ahs-14952	94	3	)	)	PUNCT
ahs-14952	94	4	and	and	CCONJ
ahs-14952	94	5	selosse	selosse	VERB
ahs-14952	94	6	et	et	PROPN
ahs-14952	94	7	al	al	PROPN
ahs-14952	94	8	.	.	PUNCT
ahs-14952	95	1	(	(	PUNCT
ahs-14952	95	2	2018	2018	NUM
ahs-14952	95	3	)	)	PUNCT
ahs-14952	95	4	.	.	PUNCT
ahs-14952	96	1	several	several	ADJ
ahs-14952	96	2	investigations	investigation	NOUN
ahs-14952	96	3	,	,	PUNCT
ahs-14952	96	4	like	like	ADP
ahs-14952	96	5	those	those	PRON
ahs-14952	96	6	conducted	conduct	VERB
ahs-14952	96	7	by	by	ADP
ahs-14952	96	8	herrera	herrera	PROPN
ahs-14952	96	9	et	et	PROPN
ahs-14952	96	10	al	al	PROPN
ahs-14952	96	11	.	.	PROPN
ahs-14952	96	12	(	(	PUNCT
ahs-14952	96	13	2019	2019	NUM
ahs-14952	96	14	)	)	PUNCT
ahs-14952	96	15	and	and	CCONJ
ahs-14952	96	16	waterman	waterman	PROPN
ahs-14952	96	17	et	et	PROPN
ahs-14952	96	18	al	al	PROPN
ahs-14952	96	19	.	.	PROPN
ahs-14952	96	20	(	(	PUNCT
ahs-14952	96	21	2011	2011	NUM
ahs-14952	96	22	)	)	PUNCT
ahs-14952	96	23	,	,	PUNCT
ahs-14952	96	24	have	have	AUX
ahs-14952	96	25	shown	show	VERB
ahs-14952	96	26	empirical	empirical	ADJ
ahs-14952	96	27	evidence	evidence	NOUN
ahs-14952	96	28	indicating	indicate	VERB
ahs-14952	96	29	the	the	DET
ahs-14952	96	30	involvement	involvement	NOUN
ahs-14952	96	31	of	of	ADP
ahs-14952	96	32	certain	certain	ADJ
ahs-14952	96	33	orchid	orchid	NOUN
ahs-14952	96	34	mycorrhizal	mycorrhizal	NOUN
ahs-14952	96	35	fungi	fungi	NOUN
ahs-14952	96	36	(	(	PUNCT
ahs-14952	96	37	omfs	omfs	PROPN
ahs-14952	96	38	)	)	PUNCT
ahs-14952	96	39	in	in	ADP
ahs-14952	96	40	the	the	DET
ahs-14952	96	41	process	process	NOUN
ahs-14952	96	42	of	of	ADP
ahs-14952	96	43	decomposition	decomposition	NOUN
ahs-14952	96	44	.	.	PUNCT
ahs-14952	97	1	the	the	DET
ahs-14952	97	2	observed	observed	ADJ
ahs-14952	97	3	mycorrhizal	mycorrhizal	NOUN
ahs-14952	97	4	fungi	fungi	NOUN
ahs-14952	97	5	(	(	PUNCT
ahs-14952	97	6	omfs	omfs	PROPN
ahs-14952	97	7	)	)	PUNCT
ahs-14952	97	8	have	have	AUX
ahs-14952	97	9	been	be	AUX
ahs-14952	97	10	documented	document	VERB
ahs-14952	97	11	to	to	PART
ahs-14952	97	12	facilitate	facilitate	VERB
ahs-14952	97	13	the	the	DET
ahs-14952	97	14	decomposition	decomposition	NOUN
ahs-14952	97	15	of	of	ADP
ahs-14952	97	16	nearby	nearby	ADJ
ahs-14952	97	17	substrates	substrate	NOUN
ahs-14952	97	18	and	and	CCONJ
ahs-14952	97	19	provide	provide	VERB
ahs-14952	97	20	essential	essential	ADJ
ahs-14952	97	21	nutrients	nutrient	NOUN
ahs-14952	97	22	to	to	ADP
ahs-14952	97	23	orchids	orchid	NOUN
ahs-14952	97	24	.	.	PUNCT
ahs-14952	98	1	it	it	PRON
ahs-14952	98	2	is	be	AUX
ahs-14952	98	3	important	important	ADJ
ahs-14952	98	4	to	to	PART
ahs-14952	98	5	acknowledge	acknowledge	VERB
ahs-14952	98	6	that	that	DET
ahs-14952	98	7	specific	specific	ADJ
ahs-14952	98	8	obligatory	obligatory	ADJ
ahs-14952	98	9	mycoheterotrophic	mycoheterotrophic	ADJ
ahs-14952	98	10	fungi	fungus	NOUN
ahs-14952	98	11	(	(	PUNCT
ahs-14952	98	12	omfs	omfs	PROPN
ahs-14952	98	13	)	)	PUNCT
ahs-14952	98	14	may	may	AUX
ahs-14952	98	15	have	have	AUX
ahs-14952	98	16	experienced	experience	VERB
ahs-14952	98	17	evolutionary	evolutionary	ADJ
ahs-14952	98	18	shifts	shift	NOUN
ahs-14952	98	19	from	from	ADP
ahs-14952	98	20	ancestral	ancestral	ADJ
ahs-14952	98	21	obligate	obligate	NOUN
ahs-14952	98	22	non­photosynthetic	non­photosynthetic	PROPN
ahs-14952	98	23	fungus	fungus	NOUN
ahs-14952	98	24	(	(	PUNCT
ahs-14952	98	25	onfs	onfs	PROPN
ahs-14952	98	26	)	)	PUNCT
ahs-14952	98	27	,	,	PUNCT
ahs-14952	98	28	gradually	gradually	ADV
ahs-14952	98	29	developing	develop	VERB
ahs-14952	98	30	mycorrhizal	mycorrhizal	NOUN
ahs-14952	98	31	capacities	capacity	NOUN
ahs-14952	98	32	.	.	PUNCT
ahs-14952	99	1	the	the	DET
ahs-14952	99	2	aforementioned	aforementioned	ADJ
ahs-14952	99	3	phenomenon	phenomenon	NOUN
ahs-14952	99	4	has	have	AUX
ahs-14952	99	5	been	be	AUX
ahs-14952	99	6	thoroughly	thoroughly	ADV
ahs-14952	99	7	investigated	investigate	VERB
ahs-14952	99	8	in	in	ADP
ahs-14952	99	9	scholarly	scholarly	ADJ
ahs-14952	99	10	studies	study	NOUN
ahs-14952	99	11	conducted	conduct	VERB
ahs-14952	99	12	by	by	ADP
ahs-14952	99	13	selosse	selosse	PROPN
ahs-14952	99	14	et	et	PROPN
ahs-14952	99	15	al	al	PROPN
ahs-14952	99	16	.	.	PROPN
ahs-14952	100	1	(	(	PUNCT
ahs-14952	100	2	2018	2018	NUM
ahs-14952	100	3	)	)	PUNCT
ahs-14952	100	4	and	and	CCONJ
ahs-14952	100	5	wang	wang	PROPN
ahs-14952	100	6	et	et	PROPN
ahs-14952	100	7	al	al	PROPN
ahs-14952	100	8	.	.	PROPN
ahs-14952	101	1	(	(	PUNCT
ahs-14952	101	2	2021	2021	NUM
ahs-14952	101	3	)	)	PUNCT
ahs-14952	101	4	.	.	PUNCT
ahs-14952	102	1	the	the	DET
ahs-14952	102	2	classification	classification	NOUN
ahs-14952	102	3	of	of	ADP
ahs-14952	102	4	orchid	orchid	NOUN
ahs-14952	102	5	mycorrhizal	mycorrhizal	NOUN
ahs-14952	102	6	fungus	fungus	NOUN
ahs-14952	102	7	(	(	PUNCT
ahs-14952	102	8	omf	omf	PROPN
ahs-14952	102	9	)	)	PUNCT
ahs-14952	102	10	has	have	VERB
ahs-14952	102	11	a	a	DET
ahs-14952	102	12	wide	wide	ADJ
ahs-14952	102	13	range	range	NOUN
ahs-14952	102	14	of	of	ADP
ahs-14952	102	15	fungal	fungal	ADJ
ahs-14952	102	16	species	specie	NOUN
ahs-14952	102	17	,	,	PUNCT
ahs-14952	102	18	consisting	consist	VERB
ahs-14952	102	19	of	of	ADP
ahs-14952	102	20	at	at	ADV
ahs-14952	102	21	least	least	ADV
ahs-14952	102	22	17	17	NUM
ahs-14952	102	23	families	family	NOUN
ahs-14952	102	24	from	from	ADP
ahs-14952	102	25	the	the	DET
ahs-14952	102	26	basidiomycetes	basidiomycete	NOUN
ahs-14952	102	27	group	group	NOUN
ahs-14952	102	28	and	and	CCONJ
ahs-14952	102	29	five	five	NUM
ahs-14952	102	30	families	family	NOUN
ahs-14952	102	31	or	or	CCONJ
ahs-14952	102	32	genera	genera	NOUN
ahs-14952	102	33	from	from	ADP
ahs-14952	102	34	the	the	DET
ahs-14952	102	35	ascomycetes	ascomycete	NOUN
ahs-14952	102	36	group	group	NOUN
ahs-14952	102	37	,	,	PUNCT
ahs-14952	102	38	as	as	SCONJ
ahs-14952	102	39	documented	document	VERB
ahs-14952	102	40	by	by	ADP
ahs-14952	102	41	dearnaley	dearnaley	PROPN
ahs-14952	102	42	(	(	PUNCT
ahs-14952	102	43	2007	2007	NUM
ahs-14952	102	44	)	)	PUNCT
ahs-14952	102	45	and	and	CCONJ
ahs-14952	102	46	dearnaley	dearnaley	PROPN
ahs-14952	102	47	et	et	PROPN
ahs-14952	102	48	al	al	PROPN
ahs-14952	102	49	.	.	PROPN
ahs-14952	103	1	(	(	PUNCT
ahs-14952	103	2	2012	2012	NUM
ahs-14952	103	3	)	)	PUNCT
ahs-14952	103	4	.	.	PUNCT
ahs-14952	104	1	within	within	ADP
ahs-14952	104	2	this	this	DET
ahs-14952	104	3	set	set	NOUN
ahs-14952	104	4	,	,	PUNCT
ahs-14952	104	5	there	there	PRON
ahs-14952	104	6	are	be	VERB
ahs-14952	104	7	several	several	ADJ
ahs-14952	104	8	noteworthy	noteworthy	ADJ
ahs-14952	104	9	groups	group	NOUN
ahs-14952	104	10	,	,	PUNCT
ahs-14952	104	11	namely	namely	ADV
ahs-14952	104	12	ceratobasidiaceae	ceratobasidiaceae	NOUN
ahs-14952	104	13	(	(	PUNCT
ahs-14952	104	14	cantharellales	cantharellales	PROPN
ahs-14952	104	15	)	)	PUNCT
ahs-14952	104	16	,	,	PUNCT
ahs-14952	104	17	tulasnellaceae	tulasnellaceae	ADV
ahs-14952	104	18	,	,	PUNCT
ahs-14952	104	19	and	and	CCONJ
ahs-14952	104	20	serendipitaceae	serendipitaceae	PROPN
ahs-14952	104	21	,	,	PUNCT
ahs-14952	104	22	which	which	PRON
ahs-14952	104	23	were	be	AUX
ahs-14952	104	24	previously	previously	ADV
ahs-14952	104	25	referred	refer	VERB
ahs-14952	104	26	to	to	ADP
ahs-14952	104	27	as	as	SCONJ
ahs-14952	104	28	the	the	DET
ahs-14952	104	29	sebacinales	sebacinale	NOUN
ahs-14952	104	30	clade	clade	PROPN
ahs-14952	104	31	b.	b.	PROPN
ahs-14952	104	32	the	the	DET
ahs-14952	104	33	classification	classification	NOUN
ahs-14952	104	34	of	of	ADP
ahs-14952	104	35	these	these	DET
ahs-14952	104	36	groupings	grouping	NOUN
ahs-14952	104	37	as	as	SCONJ
ahs-14952	104	38	rhizoctonia­type	rhizoctonia­type	NOUN
ahs-14952	104	39	basidiomycetes	basidiomycete	NOUN
ahs-14952	104	40	is	be	AUX
ahs-14952	104	41	largely	largely	ADV
ahs-14952	104	42	acknowledged	acknowledge	VERB
ahs-14952	104	43	in	in	ADP
ahs-14952	104	44	the	the	DET
ahs-14952	104	45	scientific	scientific	ADJ
ahs-14952	104	46	community	community	NOUN
ahs-14952	104	47	,	,	PUNCT
ahs-14952	104	48	as	as	SCONJ
ahs-14952	104	49	evidenced	evidence	VERB
ahs-14952	104	50	by	by	ADP
ahs-14952	104	51	multiple	multiple	ADJ
ahs-14952	104	52	research	research	NOUN
ahs-14952	104	53	(	(	PUNCT
ahs-14952	104	54	rasmussen	rasmussen	PROPN
ahs-14952	104	55	,	,	PUNCT
ahs-14952	104	56	1995	1995	NUM
ahs-14952	104	57	;	;	PUNCT
ahs-14952	104	58	bayman	bayman	NOUN
ahs-14952	104	59	and	and	CCONJ
ahs-14952	104	60	otero	otero	PROPN
ahs-14952	104	61	,	,	PUNCT
ahs-14952	104	62	2006	2006	NUM
ahs-14952	104	63	;	;	PUNCT
ahs-14952	105	1	sisti	sisti	PROPN
ahs-14952	105	2	et	et	PROPN
ahs-14952	105	3	al	al	PROPN
ahs-14952	105	4	.	.	PROPN
ahs-14952	105	5	,	,	PUNCT
ahs-14952	105	6	2019	2019	NUM
ahs-14952	105	7	;	;	PUNCT
ahs-14952	105	8	selosse	selosse	VERB
ahs-14952	105	9	et	et	PROPN
ahs-14952	105	10	al	al	PROPN
ahs-14952	105	11	.	.	PROPN
ahs-14952	105	12	,	,	PUNCT
ahs-14952	105	13	2018	2018	NUM
ahs-14952	105	14	;	;	PUNCT
ahs-14952	105	15	jędryczka	jędryczka	PROPN
ahs-14952	105	16	et	et	PROPN
ahs-14952	105	17	al	al	PROPN
ahs-14952	105	18	.	.	PROPN
ahs-14952	105	19	,	,	PUNCT
ahs-14952	105	20	2023	2023	NUM
ahs-14952	105	21	)	)	PUNCT
ahs-14952	105	22	.	.	PUNCT
ahs-14952	106	1	basidiomycetes	basidiomycete	NOUN
ahs-14952	106	2	and	and	CCONJ
ahs-14952	106	3	ascomycetes	ascomycete	NOUN
ahs-14952	106	4	,	,	PUNCT
ahs-14952	106	5	which	which	PRON
ahs-14952	106	6	are	be	AUX
ahs-14952	106	7	widely	widely	ADV
ahs-14952	106	8	distributed	distribute	VERB
ahs-14952	106	9	in	in	ADP
ahs-14952	106	10	terrestrial	terrestrial	ADJ
ahs-14952	106	11	ecosystems	ecosystem	NOUN
ahs-14952	106	12	and	and	CCONJ
ahs-14952	106	13	cultivated	cultivate	VERB
ahs-14952	106	14	plants	plant	NOUN
ahs-14952	106	15	globally	globally	ADV
ahs-14952	106	16	,	,	PUNCT
ahs-14952	106	17	have	have	VERB
ahs-14952	106	18	notable	notable	ADJ
ahs-14952	106	19	associations	association	NOUN
ahs-14952	106	20	with	with	ADP
ahs-14952	106	21	orchids	orchid	NOUN
ahs-14952	106	22	(	(	PUNCT
ahs-14952	106	23	trivedi	trivedi	PROPN
ahs-14952	106	24	et	et	PROPN
ahs-14952	106	25	al	al	PROPN
ahs-14952	106	26	.	.	PROPN
ahs-14952	106	27	,	,	PUNCT
ahs-14952	106	28	2020	2020	NUM
ahs-14952	106	29	;	;	PUNCT
ahs-14952	106	30	wang	wang	PROPN
ahs-14952	106	31	et	et	PROPN
ahs-14952	106	32	al	al	PROPN
ahs-14952	106	33	.	.	PROPN
ahs-14952	106	34	,	,	PUNCT
ahs-14952	106	35	2019	2019	NUM
ahs-14952	106	36	)	)	PUNCT
ahs-14952	106	37	.	.	PUNCT
ahs-14952	107	1	the	the	DET
ahs-14952	107	2	significance	significance	NOUN
ahs-14952	107	3	of	of	ADP
ahs-14952	107	4	orchid	orchid	NOUN
ahs-14952	107	5	mycorrhizal	mycorrhizal	NOUN
ahs-14952	107	6	fungi	fungus	NOUN
ahs-14952	107	7	(	(	PUNCT
ahs-14952	107	8	omf	omf	NOUN
ahs-14952	107	9	)	)	PUNCT
ahs-14952	107	10	in	in	ADP
ahs-14952	107	11	specific	specific	ADJ
ahs-14952	107	12	microenvironments	microenvironment	NOUN
ahs-14952	107	13	can	can	AUX
ahs-14952	107	14	not	not	PART
ahs-14952	107	15	be	be	AUX
ahs-14952	107	16	understated	understate	VERB
ahs-14952	107	17	,	,	PUNCT
ahs-14952	107	18	as	as	SCONJ
ahs-14952	107	19	they	they	PRON
ahs-14952	107	20	play	play	VERB
ahs-14952	107	21	a	a	DET
ahs-14952	107	22	crucial	crucial	ADJ
ahs-14952	107	23	role	role	NOUN
ahs-14952	107	24	in	in	ADP
ahs-14952	107	25	promoting	promote	VERB
ahs-14952	107	26	the	the	DET
ahs-14952	107	27	germination	germination	NOUN
ahs-14952	107	28	of	of	ADP
ahs-14952	107	29	orchid	orchid	NOUN
ahs-14952	107	30	seeds	seed	NOUN
ahs-14952	107	31	and	and	CCONJ
ahs-14952	107	32	the	the	DET
ahs-14952	107	33	subsequent	subsequent	ADJ
ahs-14952	107	34	growth	growth	NOUN
ahs-14952	107	35	of	of	ADP
ahs-14952	107	36	orchid	orchid	NOUN
ahs-14952	107	37	seedlings	seedling	NOUN
ahs-14952	107	38	.	.	PUNCT
ahs-14952	108	1	as	as	ADP
ahs-14952	108	2	a	a	DET
ahs-14952	108	3	result	result	NOUN
ahs-14952	108	4	,	,	PUNCT
ahs-14952	108	5	geographical	geographical	ADJ
ahs-14952	108	6	areas	area	NOUN
ahs-14952	108	7	that	that	PRON
ahs-14952	108	8	display	display	VERB
ahs-14952	108	9	a	a	DET
ahs-14952	108	10	significant	significant	ADJ
ahs-14952	108	11	occurrence	occurrence	NOUN
ahs-14952	108	12	of	of	ADP
ahs-14952	108	13	orchid	orchid	NOUN
ahs-14952	108	14	mycorrhizal	mycorrhizal	NOUN
ahs-14952	108	15	fungi	fungi	NOUN
ahs-14952	108	16	(	(	PUNCT
ahs-14952	108	17	omf	omf	NOUN
ahs-14952	108	18	)	)	PUNCT
ahs-14952	108	19	tend	tend	VERB
ahs-14952	108	20	to	to	PART
ahs-14952	108	21	showcase	showcase	VERB
ahs-14952	108	22	a	a	DET
ahs-14952	108	23	higher	high	ADJ
ahs-14952	108	24	range	range	NOUN
ahs-14952	108	25	of	of	ADP
ahs-14952	108	26	orchid	orchid	NOUN
ahs-14952	108	27	species	specie	NOUN
ahs-14952	108	28	,	,	PUNCT
ahs-14952	108	29	as	as	SCONJ
ahs-14952	108	30	documented	document	VERB
ahs-14952	108	31	by	by	ADP
ahs-14952	108	32	li	li	PROPN
ahs-14952	108	33	et	et	PROPN
ahs-14952	108	34	al	al	PROPN
ahs-14952	108	35	.	.	PROPN
ahs-14952	109	1	(	(	PUNCT
ahs-14952	109	2	2021	2021	NUM
ahs-14952	109	3	)	)	PUNCT
ahs-14952	109	4	.	.	PUNCT
ahs-14952	110	1	in	in	ADP
ahs-14952	110	2	their	their	PRON
ahs-14952	110	3	study	study	NOUN
ahs-14952	110	4	,	,	PUNCT
ahs-14952	110	5	hemrová	hemrová	PROPN
ahs-14952	110	6	et	et	PROPN
ahs-14952	110	7	al	al	PROPN
ahs-14952	110	8	.	.	PROPN
ahs-14952	111	1	(	(	PUNCT
ahs-14952	111	2	2019	2019	NUM
ahs-14952	111	3	)	)	PUNCT
ahs-14952	111	4	conducted	conduct	VERB
ahs-14952	111	5	germination	germination	NOUN
ahs-14952	111	6	tests	test	NOUN
ahs-14952	111	7	and	and	CCONJ
ahs-14952	111	8	developed	develop	VERB
ahs-14952	111	9	species	species	NOUN
ahs-14952	111	10	distribution	distribution	NOUN
ahs-14952	111	11	models	model	NOUN
ahs-14952	111	12	that	that	PRON
ahs-14952	111	13	integrated	integrate	VERB
ahs-14952	111	14	multiple	multiple	ADJ
ahs-14952	111	15	habitat	habitat	NOUN
ahs-14952	111	16	parameters	parameter	NOUN
ahs-14952	111	17	.	.	PUNCT
ahs-14952	112	1	the	the	DET
ahs-14952	112	2	results	result	NOUN
ahs-14952	112	3	of	of	ADP
ahs-14952	112	4	their	their	PRON
ahs-14952	112	5	study	study	NOUN
ahs-14952	112	6	emphasized	emphasize	VERB
ahs-14952	112	7	the	the	DET
ahs-14952	112	8	crucial	crucial	ADJ
ahs-14952	112	9	significance	significance	NOUN
ahs-14952	112	10	of	of	ADP
ahs-14952	112	11	fungal	fungal	ADJ
ahs-14952	112	12	symbionts	symbiont	NOUN
ahs-14952	112	13	in	in	ADP
ahs-14952	112	14	influencing	influence	VERB
ahs-14952	112	15	the	the	DET
ahs-14952	112	16	spatial	spatial	ADJ
ahs-14952	112	17	distribution	distribution	NOUN
ahs-14952	112	18	of	of	ADP
ahs-14952	112	19	orchids	orchid	NOUN
ahs-14952	112	20	on	on	ADP
ahs-14952	112	21	a	a	DET
ahs-14952	112	22	large	large	ADJ
ahs-14952	112	23	geographical	geographical	ADJ
ahs-14952	112	24	scale	scale	NOUN
ahs-14952	112	25	.	.	PUNCT
ahs-14952	113	1	furthermore	furthermore	ADV
ahs-14952	113	2	,	,	PUNCT
ahs-14952	113	3	mccormick	mccormick	PROPN
ahs-14952	113	4	et	et	PROPN
ahs-14952	113	5	al	al	PROPN
ahs-14952	113	6	.	.	PROPN
ahs-14952	113	7	(	(	PUNCT
ahs-14952	113	8	2019	2019	NUM
ahs-14952	113	9	)	)	PUNCT
ahs-14952	113	10	and	and	CCONJ
ahs-14952	113	11	other	other	ADJ
ahs-14952	113	12	scientific	scientific	ADJ
ahs-14952	113	13	inquiries	inquiry	NOUN
ahs-14952	113	14	have	have	AUX
ahs-14952	113	15	provided	provide	VERB
ahs-14952	113	16	substantial	substantial	ADJ
ahs-14952	113	17	data	datum	NOUN
ahs-14952	113	18	supporting	support	VERB
ahs-14952	113	19	a	a	DET
ahs-14952	113	20	strong	strong	ADJ
ahs-14952	113	21	and	and	CCONJ
ahs-14952	113	22	positive	positive	ADJ
ahs-14952	113	23	association	association	NOUN
ahs-14952	113	24	between	between	ADP
ahs-14952	113	25	the	the	DET
ahs-14952	113	26	prevalence	prevalence	NOUN
ahs-14952	113	27	of	of	ADP
ahs-14952	113	28	mycoheterotrophic	mycoheterotrophic	ADJ
ahs-14952	113	29	orchids	orchid	NOUN
ahs-14952	113	30	,	,	PUNCT
ahs-14952	113	31	which	which	PRON
ahs-14952	113	32	depend	depend	VERB
ahs-14952	113	33	on	on	ADP
ahs-14952	113	34	fungi	fungus	NOUN
ahs-14952	113	35	for	for	ADP
ahs-14952	113	36	nourishment	nourishment	NOUN
ahs-14952	113	37	,	,	PUNCT
ahs-14952	113	38	and	and	CCONJ
ahs-14952	113	39	the	the	DET
ahs-14952	113	40	existence	existence	NOUN
ahs-14952	113	41	of	of	ADP
ahs-14952	113	42	omf	omf	NOUN
ahs-14952	113	43	.	.	PUNCT
ahs-14952	114	1	the	the	DET
ahs-14952	114	2	cumulative	cumulative	ADJ
ahs-14952	114	3	evidence	evidence	NOUN
ahs-14952	114	4	suggests	suggest	VERB
ahs-14952	114	5	that	that	SCONJ
ahs-14952	114	6	omf	omf	NOUN
ahs-14952	114	7	has	have	VERB
ahs-14952	114	8	a	a	DET
ahs-14952	114	9	significant	significant	ADJ
ahs-14952	114	10	role	role	NOUN
ahs-14952	114	11	in	in	ADP
ahs-14952	114	12	shaping	shape	VERB
ahs-14952	114	13	the	the	DET
ahs-14952	114	14	population	population	NOUN
ahs-14952	114	15	dynamics	dynamic	NOUN
ahs-14952	114	16	of	of	ADP
ahs-14952	114	17	orchids	orchid	NOUN
ahs-14952	114	18	.	.	PUNCT
ahs-14952	115	1	4	4	X
ahs-14952	115	2	.	.	X
ahs-14952	115	3	orchid	orchid	NOUN
ahs-14952	115	4	mycorrhizal	mycorrhizal	NOUN
ahs-14952	115	5	and	and	CCONJ
ahs-14952	115	6	its	its	PRON
ahs-14952	115	7	roles	role	NOUN
ahs-14952	115	8	in	in	ADP
ahs-14952	115	9	seed	seed	NOUN
ahs-14952	115	10	germination	germination	NOUN
ahs-14952	115	11	and	and	CCONJ
ahs-14952	115	12	development	development	NOUN
ahs-14952	115	13	in	in	ADP
ahs-14952	115	14	general	general	ADJ
ahs-14952	115	15	,	,	PUNCT
ahs-14952	115	16	asymbiotic	asymbiotic	ADJ
ahs-14952	115	17	or	or	CCONJ
ahs-14952	115	18	symbiotic	symbiotic	ADJ
ahs-14952	115	19	procedures	procedure	NOUN
ahs-14952	115	20	can	can	AUX
ahs-14952	115	21	be	be	AUX
ahs-14952	115	22	used	use	VERB
ahs-14952	115	23	to	to	PART
ahs-14952	115	24	germinate	germinate	VERB
ahs-14952	115	25	orchid	orchid	NOUN
ahs-14952	115	26	seeds	seed	NOUN
ahs-14952	115	27	(	(	PUNCT
ahs-14952	115	28	yam	yam	NOUN
ahs-14952	115	29	and	and	CCONJ
ahs-14952	115	30	arditti	arditti	VERB
ahs-14952	115	31	,	,	PUNCT
ahs-14952	115	32	2009	2009	NUM
ahs-14952	115	33	)	)	PUNCT
ahs-14952	115	34	.	.	PUNCT
ahs-14952	116	1	it	it	PRON
ahs-14952	116	2	has	have	AUX
ahs-14952	116	3	been	be	AUX
ahs-14952	116	4	demonstrated	demonstrate	VERB
ahs-14952	116	5	that	that	SCONJ
ahs-14952	116	6	asymbiotic	asymbiotic	ADJ
ahs-14952	116	7	seed	seed	NOUN
ahs-14952	116	8	germination	germination	NOUN
ahs-14952	116	9	is	be	AUX
ahs-14952	116	10	an	an	DET
ahs-14952	116	11	effective	effective	ADJ
ahs-14952	116	12	method	method	NOUN
ahs-14952	116	13	for	for	ADP
ahs-14952	116	14	producing	produce	VERB
ahs-14952	116	15	plantlets	plantlet	NOUN
ahs-14952	116	16	of	of	ADP
ahs-14952	116	17	numerous	numerous	ADJ
ahs-14952	116	18	orchid	orchid	NOUN
ahs-14952	116	19	species	specie	NOUN
ahs-14952	116	20	for	for	ADP
ahs-14952	116	21	both	both	CCONJ
ahs-14952	116	22	commercial	commercial	ADJ
ahs-14952	116	23	and	and	CCONJ
ahs-14952	116	24	conservation	conservation	NOUN
ahs-14952	116	25	.	.	PUNCT
ahs-14952	117	1	it	it	PRON
ahs-14952	117	2	was	be	AUX
ahs-14952	117	3	believed	believe	VERB
ahs-14952	117	4	that	that	SCONJ
ahs-14952	117	5	root	root	NOUN
ahs-14952	117	6	orchid	orchid	NOUN
ahs-14952	117	7	mycorrhizal	mycorrhizal	NOUN
ahs-14952	117	8	fungi	fungus	NOUN
ahs-14952	117	9	are	be	AUX
ahs-14952	117	10	the	the	DET
ahs-14952	117	11	actual	actual	ADJ
ahs-14952	117	12	source	source	NOUN
ahs-14952	117	13	of	of	ADP
ahs-14952	117	14	seed­germinating	seed­germinate	VERB
ahs-14952	117	15	orchid	orchid	NOUN
ahs-14952	117	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	117	17	fungi	fungi	PROPN
ahs-14952	117	18	(	(	PUNCT
ahs-14952	117	19	rasmussen	rasmussen	PROPN
ahs-14952	117	20	,	,	PUNCT
ahs-14952	117	21	1995	1995	NUM
ahs-14952	117	22	)	)	PUNCT
ahs-14952	117	23	.	.	PUNCT
ahs-14952	118	1	root	root	PROPN
ahs-14952	118	2	fungal	fungal	ADJ
ahs-14952	118	3	endophytes	endophyte	NOUN
ahs-14952	118	4	are	be	AUX
ahs-14952	118	5	seen	see	VERB
ahs-14952	118	6	as	as	ADP
ahs-14952	118	7	advantageous	advantageous	ADJ
ahs-14952	118	8	plant	plant	NOUN
ahs-14952	118	9	residents	resident	NOUN
ahs-14952	118	10	that	that	PRON
ahs-14952	118	11	may	may	AUX
ahs-14952	118	12	increase	increase	VERB
ahs-14952	118	13	their	their	PRON
ahs-14952	118	14	productivity	productivity	NOUN
ahs-14952	118	15	and	and	CCONJ
ahs-14952	118	16	eventually	eventually	ADV
ahs-14952	118	17	support	support	VERB
ahs-14952	118	18	ecological	ecological	ADJ
ahs-14952	118	19	functions	function	NOUN
ahs-14952	118	20	.	.	PUNCT
ahs-14952	119	1	roots	root	NOUN
ahs-14952	119	2	of	of	ADP
ahs-14952	119	3	mature	mature	ADJ
ahs-14952	119	4	plants	plant	NOUN
ahs-14952	119	5	have	have	AUX
ahs-14952	119	6	provided	provide	VERB
ahs-14952	119	7	fungi	fungus	NOUN
ahs-14952	119	8	that	that	PRON
ahs-14952	119	9	have	have	AUX
ahs-14952	119	10	been	be	AUX
ahs-14952	119	11	isolated	isolate	VERB
ahs-14952	119	12	and	and	CCONJ
ahs-14952	119	13	tested	test	VERB
ahs-14952	119	14	,	,	PUNCT
ahs-14952	119	15	with	with	SCONJ
ahs-14952	119	16	several	several	ADJ
ahs-14952	119	17	successes	success	NOUN
ahs-14952	119	18	have	have	AUX
ahs-14952	119	19	been	be	AUX
ahs-14952	119	20	attained	attain	VERB
ahs-14952	119	21	employing	employ	VERB
ahs-14952	119	22	these	these	DET
ahs-14952	119	23	fungi	fungus	NOUN
ahs-14952	119	24	(	(	PUNCT
ahs-14952	119	25	nontachaiyapoom	nontachaiyapoom	NOUN
ahs-14952	119	26	et	et	PROPN
ahs-14952	119	27	al	al	PROPN
ahs-14952	119	28	.	.	PROPN
ahs-14952	119	29	,	,	PUNCT
ahs-14952	119	30	2011	2011	NUM
ahs-14952	119	31	;	;	PUNCT
ahs-14952	120	1	sebastián	sebastián	PROPN
ahs-14952	120	2	et	et	PROPN
ahs-14952	120	3	al	al	PROPN
ahs-14952	120	4	.	.	PROPN
ahs-14952	120	5	,	,	PUNCT
ahs-14952	120	6	2014	2014	NUM
ahs-14952	120	7	)	)	PUNCT
ahs-14952	120	8	.	.	PUNCT
ahs-14952	121	1	the	the	PRON
ahs-14952	121	2	in	in	ADP
ahs-14952	121	3	situ	situ	NOUN
ahs-14952	121	4	/	/	SYM
ahs-14952	121	5	ex‐situ	ex‐situ	ADJ
ahs-14952	121	6	seed	seed	NOUN
ahs-14952	121	7	baiting	baiting	NOUN
ahs-14952	121	8	technique	technique	NOUN
ahs-14952	121	9	has	have	AUX
ahs-14952	121	10	been	be	AUX
ahs-14952	121	11	increasingly	increasingly	ADV
ahs-14952	121	12	popular	popular	ADJ
ahs-14952	121	13	in	in	ADP
ahs-14952	121	14	recent	recent	ADJ
ahs-14952	121	15	years	year	NOUN
ahs-14952	121	16	as	as	ADP
ahs-14952	121	17	a	a	DET
ahs-14952	121	18	means	means	NOUN
ahs-14952	121	19	of	of	ADP
ahs-14952	121	20	obtaining	obtain	VERB
ahs-14952	121	21	efficacious	efficacious	ADJ
ahs-14952	121	22	fungi	fungus	NOUN
ahs-14952	121	23	that	that	PRON
ahs-14952	121	24	facilitate	facilitate	VERB
ahs-14952	121	25	seed	seed	NOUN
ahs-14952	121	26	germination	germination	NOUN
ahs-14952	121	27	.	.	PUNCT
ahs-14952	122	1	according	accord	VERB
ahs-14952	122	2	to	to	ADP
ahs-14952	122	3	previous	previous	ADJ
ahs-14952	122	4	studies	study	NOUN
ahs-14952	122	5	conducted	conduct	VERB
ahs-14952	122	6	by	by	ADP
ahs-14952	122	7	zhou	zhou	PROPN
ahs-14952	122	8	and	and	CCONJ
ahs-14952	122	9	gao	gao	PROPN
ahs-14952	122	10	(	(	PUNCT
ahs-14952	122	11	2016	2016	NUM
ahs-14952	122	12	)	)	PUNCT
ahs-14952	122	13	and	and	CCONJ
ahs-14952	122	14	rasmussen	rasmussen	PROPN
ahs-14952	122	15	and	and	CCONJ
ahs-14952	122	16	whigham	whigham	PROPN
ahs-14952	122	17	(	(	PUNCT
ahs-14952	122	18	1993	1993	NUM
ahs-14952	122	19	)	)	PUNCT
ahs-14952	122	20	,	,	PUNCT
ahs-14952	122	21	it	it	PRON
ahs-14952	122	22	has	have	AUX
ahs-14952	122	23	been	be	AUX
ahs-14952	122	24	observed	observe	VERB
ahs-14952	122	25	that	that	SCONJ
ahs-14952	122	26	fungus	fungus	NOUN
ahs-14952	122	27	obtained	obtain	VERB
ahs-14952	122	28	from	from	ADP
ahs-14952	122	29	naturally	naturally	ADV
ahs-14952	122	30	occurring	occur	VERB
ahs-14952	122	31	protocorms	protocorm	NOUN
ahs-14952	122	32	or	or	CCONJ
ahs-14952	122	33	seedlings	seedling	NOUN
ahs-14952	122	34	possess	possess	VERB
ahs-14952	122	35	the	the	DET
ahs-14952	122	36	capacity	capacity	NOUN
ahs-14952	122	37	to	to	PART
ahs-14952	122	38	induce	induce	VERB
ahs-14952	122	39	seed	seed	NOUN
ahs-14952	122	40	germination	germination	NOUN
ahs-14952	122	41	and	and	CCONJ
ahs-14952	122	42	facil	facil	NOUN
ahs-14952	122	43	itate	itate	VERB
ahs-14952	122	44	the	the	DET
ahs-14952	122	45	subsequent	subsequent	ADJ
ahs-14952	122	46	development	development	NOUN
ahs-14952	122	47	of	of	ADP
ahs-14952	122	48	seedlings	seedling	NOUN
ahs-14952	122	49	(	(	PUNCT
ahs-14952	122	50	table	table	NOUN
ahs-14952	122	51	1	1	NUM
ahs-14952	122	52	)	)	PUNCT
ahs-14952	122	53	.	.	PUNCT
ahs-14952	123	1	shao	shao	PROPN
ahs-14952	123	2	et	et	PROPN
ahs-14952	123	3	al	al	PROPN
ahs-14952	123	4	.	.	PROPN
ahs-14952	123	5	(	(	PUNCT
ahs-14952	123	6	2020	2020	NUM
ahs-14952	123	7	)	)	PUNCT
ahs-14952	123	8	conducted	conduct	VERB
ahs-14952	123	9	a	a	DET
ahs-14952	123	10	conservation	conservation	NOUN
ahs-14952	123	11	project	project	NOUN
ahs-14952	123	12	with	with	ADP
ahs-14952	123	13	the	the	DET
ahs-14952	123	14	objective	objective	NOUN
ahs-14952	123	15	of	of	ADP
ahs-14952	123	16	protecting	protect	VERB
ahs-14952	123	17	dendrobium	dendrobium	NOUN
ahs-14952	123	18	species	specie	NOUN
ahs-14952	123	19	shamsudin	shamsudin	VERB
ahs-14952	123	20	et	et	PROPN
ahs-14952	123	21	al	al	PROPN
ahs-14952	123	22	.	.	PROPN
ahs-14952	124	1	‐	‐	ADP
ahs-14952	124	2	molecular	molecular	ADJ
ahs-14952	124	3	identification	identification	NOUN
ahs-14952	124	4	of	of	ADP
ahs-14952	124	5	orchid	orchid	NOUN
ahs-14952	124	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	124	7	101e=	101e=	NUM
ahs-14952	124	8	epiphytes	epiphyte	NOUN
ahs-14952	124	9	;	;	PUNCT
ahs-14952	125	1	t=	t=	NOUN
ahs-14952	125	2	terrestrial	terrestrial	NOUN
ahs-14952	125	3	.	.	PUNCT
ahs-14952	125	4	table	table	NOUN
ahs-14952	125	5	1	1	NUM
ahs-14952	125	6	a	a	DET
ahs-14952	125	7	­	­	NOUN
ahs-14952	125	8	list	list	NOUN
ahs-14952	125	9	of	of	ADP
ahs-14952	125	10	orchid	orchid	NOUN
ahs-14952	125	11	mycorrhizal	mycorrhizal	NOUN
ahs-14952	125	12	fungi	fungus	NOUN
ahs-14952	125	13	that	that	PRON
ahs-14952	125	14	had	have	AUX
ahs-14952	125	15	been	be	AUX
ahs-14952	125	16	identified	identify	VERB
ahs-14952	125	17	and	and	CCONJ
ahs-14952	125	18	their	their	PRON
ahs-14952	125	19	roles	role	NOUN
ahs-14952	125	20	in	in	ADP
ahs-14952	125	21	orchid	orchid	NOUN
ahs-14952	125	22	micropropagation	micropropagation	NOUN
ahs-14952	125	23	orchid	orchid	NOUN
ahs-14952	125	24	fungi	fungi	VERB
ahs-14952	125	25	sp	sp	NOUN
ahs-14952	125	26	.	.	NOUN
ahs-14952	125	27	roles	role	NOUN
ahs-14952	125	28	references	reference	NOUN
ahs-14952	125	29	vanda	vanda	NOUN
ahs-14952	125	30	wightii	wightii	NOUN
ahs-14952	125	31	(	(	PUNCT
ahs-14952	125	32	e	e	NOUN
ahs-14952	125	33	)	)	PUNCT
ahs-14952	125	34	ceratobasidium	ceratobasidium	NOUN
ahs-14952	125	35	sp	sp	PROPN
ahs-14952	125	36	.	.	PROPN
ahs-14952	125	37	seed	seed	PROPN
ahs-14952	125	38	germination	germination	PROPN
ahs-14952	125	39	suresh	suresh	PROPN
ahs-14952	125	40	et	et	PROPN
ahs-14952	125	41	al	al	PROPN
ahs-14952	125	42	.	.	PROPN
ahs-14952	126	1	(	(	PUNCT
ahs-14952	126	2	2023	2023	NUM
ahs-14952	126	3	)	)	PUNCT
ahs-14952	126	4	paphiopedilum	paphiopedilum	NOUN
ahs-14952	126	5	barbigerum	barbigerum	NOUN
ahs-14952	126	6	(	(	PUNCT
ahs-14952	126	7	t	t	NOUN
ahs-14952	126	8	)	)	PUNCT
ahs-14952	126	9	epulorhiza	epulorhiza	NOUN
ahs-14952	126	10	sp	sp	PROPN
ahs-14952	126	11	.	.	NOUN
ahs-14952	126	12	seed	seed	NOUN
ahs-14952	126	13	germination	germination	NOUN
ahs-14952	126	14	and	and	CCONJ
ahs-14952	126	15	seedling	seedling	NOUN
ahs-14952	126	16	development	development	NOUN
ahs-14952	126	17	tian	tian	PROPN
ahs-14952	126	18	et	et	PROPN
ahs-14952	126	19	al	al	PROPN
ahs-14952	126	20	.	.	PROPN
ahs-14952	127	1	(	(	PUNCT
ahs-14952	127	2	2022	2022	NUM
ahs-14952	127	3	)	)	PUNCT
ahs-14952	127	4	serapias	serapias	PROPN
ahs-14952	127	5	vomeracea	vomeracea	PROPN
ahs-14952	127	6	(	(	PUNCT
ahs-14952	127	7	t	t	NOUN
ahs-14952	127	8	)	)	PUNCT
ahs-14952	127	9	tulasnella	tulasnella	NOUN
ahs-14952	127	10	calospora	calospora	NOUN
ahs-14952	127	11	seed	seed	NOUN
ahs-14952	127	12	germination	germination	NOUN
ahs-14952	127	13	and	and	CCONJ
ahs-14952	127	14	seedling	seedling	NOUN
ahs-14952	127	15	development	development	NOUN
ahs-14952	127	16	ghirardo	ghirardo	PROPN
ahs-14952	127	17	et	et	PROPN
ahs-14952	127	18	al	al	PROPN
ahs-14952	127	19	.	.	PROPN
ahs-14952	128	1	(	(	PUNCT
ahs-14952	128	2	2020	2020	NUM
ahs-14952	128	3	)	)	PUNCT
ahs-14952	128	4	epidendrum	epidendrum	PROPN
ahs-14952	128	5	secundum	secundum	PROPN
ahs-14952	128	6	(	(	PUNCT
ahs-14952	128	7	t	t	PROPN
ahs-14952	128	8	)	)	PUNCT
ahs-14952	128	9	ceratobasidium	ceratobasidium	NOUN
ahs-14952	128	10	sp	sp	PROPN
ahs-14952	128	11	.	.	PROPN
ahs-14952	128	12	,	,	PUNCT
ahs-14952	128	13	sebacina	sebacina	ADJ
ahs-14952	128	14	vermifera	vermifera	NOUN
ahs-14952	128	15	seed	seed	NOUN
ahs-14952	128	16	germination	germination	NOUN
ahs-14952	128	17	and	and	CCONJ
ahs-14952	128	18	seedling	seedling	NOUN
ahs-14952	128	19	development	development	NOUN
ahs-14952	128	20	durán­lópez	durán­lópez	PROPN
ahs-14952	128	21	et	et	PROPN
ahs-14952	128	22	al	al	PROPN
ahs-14952	128	23	.	.	PROPN
ahs-14952	129	1	(	(	PUNCT
ahs-14952	129	2	2019	2019	NUM
ahs-14952	129	3	)	)	PUNCT
ahs-14952	129	4	dactylorhiza	dactylorhiza	ADJ
ahs-14952	129	5	majalis	majalis	PROPN
ahs-14952	129	6	(	(	PUNCT
ahs-14952	129	7	t	t	NOUN
ahs-14952	129	8	)	)	PUNCT
ahs-14952	129	9	piriformospora	piriformospora	NOUN
ahs-14952	129	10	indica	indica	ADJ
ahs-14952	129	11	seed	seed	NOUN
ahs-14952	129	12	germination	germination	NOUN
ahs-14952	129	13	shah	shah	PROPN
ahs-14952	129	14	et	et	PROPN
ahs-14952	129	15	al	al	PROPN
ahs-14952	129	16	.	.	PROPN
ahs-14952	130	1	(	(	PUNCT
ahs-14952	130	2	2019	2019	NUM
ahs-14952	130	3	)	)	PUNCT
ahs-14952	130	4	chloraea	chloraea	NOUN
ahs-14952	130	5	gavilu	gavilu	NOUN
ahs-14952	130	6	(	(	PUNCT
ahs-14952	130	7	t	t	NOUN
ahs-14952	130	8	)	)	PUNCT
ahs-14952	130	9	tulasnella	tulasnella	NOUN
ahs-14952	130	10	sp	sp	PROPN
ahs-14952	130	11	.	.	PROPN
ahs-14952	130	12	seed	seed	NOUN
ahs-14952	130	13	germination	germination	PROPN
ahs-14952	130	14	herrera	herrera	PROPN
ahs-14952	130	15	et	et	PROPN
ahs-14952	130	16	al	al	PROPN
ahs-14952	130	17	.	.	PROPN
ahs-14952	131	1	(	(	PUNCT
ahs-14952	131	2	2017	2017	NUM
ahs-14952	131	3	)	)	PUNCT
ahs-14952	131	4	aerides	aeride	VERB
ahs-14952	131	5	multiflora	multiflora	NOUN
ahs-14952	131	6	(	(	PUNCT
ahs-14952	131	7	e	e	NOUN
ahs-14952	131	8	)	)	PUNCT
ahs-14952	131	9	ceratobasidium	ceratobasidium	NOUN
ahs-14952	131	10	sp	sp	PROPN
ahs-14952	131	11	.	.	PROPN
ahs-14952	131	12	seed	seed	NOUN
ahs-14952	131	13	germination	germination	NOUN
ahs-14952	131	14	bhatti	bhatti	PROPN
ahs-14952	131	15	et	et	PROPN
ahs-14952	131	16	al	al	PROPN
ahs-14952	131	17	.	.	PROPN
ahs-14952	132	1	(	(	PUNCT
ahs-14952	132	2	2017	2017	NUM
ahs-14952	132	3	)	)	PUNCT
ahs-14952	132	4	dendrobium	dendrobium	NOUN
ahs-14952	132	5	friedericksianum	friedericksianum	ADJ
ahs-14952	132	6	(	(	PUNCT
ahs-14952	132	7	e	e	NOUN
ahs-14952	132	8	)	)	PUNCT
ahs-14952	132	9	tulasnella	tulasnella	NOUN
ahs-14952	132	10	sp	sp	PROPN
ahs-14952	132	11	.	.	PROPN
ahs-14952	132	12	,	,	PUNCT
ahs-14952	132	13	seed	seed	NOUN
ahs-14952	132	14	germination	germination	NOUN
ahs-14952	132	15	and	and	CCONJ
ahs-14952	132	16	seedling	seedle	VERB
ahs-14952	132	17	development	development	NOUN
ahs-14952	132	18	agustini	agustini	PROPN
ahs-14952	132	19	et	et	PROPN
ahs-14952	132	20	al	al	PROPN
ahs-14952	132	21	.	.	PUNCT
ahs-14952	133	1	(	(	PUNCT
ahs-14952	133	2	2016	2016	NUM
ahs-14952	133	3	)	)	PUNCT
ahs-14952	133	4	tulasnellaceae	tulasnellaceae	PROPN
ahs-14952	133	5	rigidoporus	rigidoporus	PROPN
ahs-14952	133	6	vinctus	vinctus	NOUN
ahs-14952	133	7	,	,	PUNCT
ahs-14952	133	8	polyporales	polyporale	NOUN
ahs-14952	133	9	ceratobasidium	ceratobasidium	NOUN
ahs-14952	133	10	sp	sp	PROPN
ahs-14952	133	11	.	.	PROPN
ahs-14952	133	12	,	,	PUNCT
ahs-14952	133	13	tulasnellaceae	tulasnellaceae	VERB
ahs-14952	133	14	flavodon	flavodon	ADJ
ahs-14952	133	15	flavus	flavus	NOUN
ahs-14952	133	16	,	,	PUNCT
ahs-14952	133	17	polyporales	polyporale	NOUN
ahs-14952	133	18	nigroporus	nigroporus	NOUN
ahs-14952	133	19	vinosus	vinosus	NOUN
ahs-14952	133	20	,	,	PUNCT
ahs-14952	133	21	polyporales	polyporale	NOUN
ahs-14952	133	22	coriolopsis	coriolopsis	NOUN
ahs-14952	133	23	retropicta	retropicta	NOUN
ahs-14952	133	24	,	,	PUNCT
ahs-14952	133	25	polyporales	polyporale	NOUN
ahs-14952	133	26	valsa	valsa	VERB
ahs-14952	133	27	eugeniae	eugeniae	ADJ
ahs-14952	133	28	,	,	PUNCT
ahs-14952	133	29	diaporthales	diaporthale	NOUN
ahs-14952	133	30	.	.	PUNCT
ahs-14952	134	1	paphiopedilum	paphiopedilum	PROPN
ahs-14952	134	2	villosum	villosum	NOUN
ahs-14952	134	3	(	(	PUNCT
ahs-14952	134	4	e	e	NOUN
ahs-14952	134	5	)	)	PUNCT
ahs-14952	134	6	tulasnella	tulasnella	NOUN
ahs-14952	134	7	sp	sp	PROPN
ahs-14952	134	8	.	.	PROPN
ahs-14952	134	9	,	,	PUNCT
ahs-14952	134	10	seed	seed	NOUN
ahs-14952	134	11	germination	germination	PROPN
ahs-14952	134	12	khamchatra	khamchatra	PROPN
ahs-14952	134	13	et	et	PROPN
ahs-14952	134	14	al	al	PROPN
ahs-14952	134	15	.	.	PROPN
ahs-14952	135	1	(	(	PUNCT
ahs-14952	135	2	2016	2016	NUM
ahs-14952	135	3	)	)	PUNCT
ahs-14952	135	4	tulasnellaceae	tulasnellaceae	VERB
ahs-14952	135	5	dendrobium	dendrobium	NOUN
ahs-14952	135	6	lancifolium	lancifolium	NOUN
ahs-14952	135	7	(	(	PUNCT
ahs-14952	135	8	e	e	NOUN
ahs-14952	135	9	)	)	PUNCT
ahs-14952	135	10	rhizoctonia	rhizoctonia	PROPN
ahs-14952	135	11	sp	sp	PROPN
ahs-14952	135	12	.	.	PROPN
ahs-14952	135	13	seed	seed	NOUN
ahs-14952	135	14	germination	germination	NOUN
ahs-14952	135	15	agustini	agustini	NOUN
ahs-14952	135	16	et	et	PROPN
ahs-14952	135	17	al	al	PROPN
ahs-14952	135	18	.	.	PUNCT
ahs-14952	136	1	(	(	PUNCT
ahs-14952	136	2	2016	2016	NUM
ahs-14952	136	3	)	)	PUNCT
ahs-14952	136	4	liparis	liparis	PROPN
ahs-14952	136	5	japonica	japonica	PROPN
ahs-14952	136	6	(	(	PUNCT
ahs-14952	136	7	t	t	PROPN
ahs-14952	136	8	)	)	PUNCT
ahs-14952	136	9	rhizoctonia	rhizoctonia	PROPN
ahs-14952	136	10	sp	sp	PROPN
ahs-14952	136	11	.	.	PROPN
ahs-14952	136	12	seed	seed	NOUN
ahs-14952	136	13	germination	germination	NOUN
ahs-14952	136	14	ding	ding	PROPN
ahs-14952	136	15	et	et	PROPN
ahs-14952	136	16	al	al	PROPN
ahs-14952	136	17	.	.	PUNCT
ahs-14952	137	1	(	(	PUNCT
ahs-14952	137	2	2014	2014	NUM
ahs-14952	137	3	)	)	PUNCT
ahs-14952	137	4	dendrobium	dendrobium	NOUN
ahs-14952	137	5	aphyllum	aphyllum	NOUN
ahs-14952	137	6	(	(	PUNCT
ahs-14952	137	7	e	e	NOUN
ahs-14952	137	8	)	)	PUNCT
ahs-14952	137	9	tulasnella	tulasnella	NOUN
ahs-14952	137	10	sp	sp	PROPN
ahs-14952	137	11	.	.	PROPN
ahs-14952	137	12	,	,	PUNCT
ahs-14952	137	13	seed	seed	NOUN
ahs-14952	137	14	germination	germination	NOUN
ahs-14952	137	15	zi	zi	PROPN
ahs-14952	137	16	et	et	PROPN
ahs-14952	137	17	al	al	PROPN
ahs-14952	137	18	.	.	PROPN
ahs-14952	137	19	(	(	PUNCT
ahs-14952	137	20	2014	2014	NUM
ahs-14952	137	21	)	)	PUNCT
ahs-14952	137	22	trichoderma	trichoderma	PROPN
ahs-14952	137	23	sp	sp	PROPN
ahs-14952	137	24	.	.	PROPN
ahs-14952	137	25	dendrobium	dendrobium	NOUN
ahs-14952	137	26	aphyllum	aphyllum	NOUN
ahs-14952	137	27	(	(	PUNCT
ahs-14952	137	28	e	e	NOUN
ahs-14952	137	29	)	)	PUNCT
ahs-14952	137	30	,	,	PUNCT
ahs-14952	137	31	dendrobium	dendrobium	NOUN
ahs-14952	137	32	devianum	devianum	NOUN
ahs-14952	137	33	(	(	PUNCT
ahs-14952	137	34	e	e	NOUN
ahs-14952	137	35	)	)	PUNCT
ahs-14952	137	36	,	,	PUNCT
ahs-14952	137	37	and	and	CCONJ
ahs-14952	137	38	cymbidium	cymbidium	NOUN
ahs-14952	137	39	manni	manni	NOUN
ahs-14952	137	40	(	(	PUNCT
ahs-14952	137	41	e	e	NOUN
ahs-14952	137	42	)	)	PUNCT
ahs-14952	137	43	tulasnella	tulasnella	NOUN
ahs-14952	137	44	sp	sp	PROPN
ahs-14952	137	45	.	.	PROPN
ahs-14952	137	46	,	,	PUNCT
ahs-14952	137	47	epulorhiza	epulorhiza	PROPN
ahs-14952	137	48	sp	sp	PROPN
ahs-14952	137	49	.	.	NOUN
ahs-14952	137	50	seedling	seedling	NOUN
ahs-14952	137	51	growth	growth	NOUN
ahs-14952	137	52	zi	zi	PROPN
ahs-14952	137	53	et	et	PROPN
ahs-14952	137	54	al	al	PROPN
ahs-14952	137	55	.	.	PROPN
ahs-14952	138	1	(	(	PUNCT
ahs-14952	138	2	2014	2014	NUM
ahs-14952	138	3	)	)	PUNCT
ahs-14952	138	4	dendrobium	dendrobium	NOUN
ahs-14952	138	5	officinal	officinal	ADJ
ahs-14952	138	6	(	(	PUNCT
ahs-14952	138	7	e	e	NOUN
ahs-14952	138	8	)	)	PUNCT
ahs-14952	138	9	tulasnella	tulasnella	NOUN
ahs-14952	138	10	sp	sp	PROPN
ahs-14952	138	11	.	.	PROPN
ahs-14952	138	12	seed	seed	NOUN
ahs-14952	138	13	germination	germination	NOUN
ahs-14952	138	14	and	and	CCONJ
ahs-14952	138	15	seedling	seedling	NOUN
ahs-14952	138	16	growth	growth	NOUN
ahs-14952	138	17	ming	ming	PROPN
ahs-14952	138	18	et	et	PROPN
ahs-14952	138	19	al	al	PROPN
ahs-14952	138	20	.	.	PROPN
ahs-14952	139	1	(	(	PUNCT
ahs-14952	139	2	2014	2014	NUM
ahs-14952	139	3	)	)	PUNCT
ahs-14952	139	4	dendrobium	dendrobium	NOUN
ahs-14952	139	5	nobile	nobile	PROPN
ahs-14952	139	6	(	(	PUNCT
ahs-14952	139	7	e	e	NOUN
ahs-14952	139	8	)	)	PUNCT
ahs-14952	139	9	,	,	PUNCT
ahs-14952	139	10	dendrobium	dendrobium	NOUN
ahs-14952	139	11	chrysotoxum	chrysotoxum	NOUN
ahs-14952	139	12	(	(	PUNCT
ahs-14952	139	13	e	e	NOUN
ahs-14952	139	14	)	)	PUNCT
ahs-14952	139	15	,	,	PUNCT
ahs-14952	139	16	dendrobium	dendrobium	NOUN
ahs-14952	139	17	falconer	falconer	NOUN
ahs-14952	139	18	(	(	PUNCT
ahs-14952	139	19	e	e	NOUN
ahs-14952	139	20	)	)	PUNCT
ahs-14952	139	21	,	,	PUNCT
ahs-14952	139	22	dendrobium	dendrobium	NOUN
ahs-14952	139	23	aphyllum	aphyllum	NOUN
ahs-14952	139	24	(	(	PUNCT
ahs-14952	139	25	e	e	NOUN
ahs-14952	139	26	)	)	PUNCT
ahs-14952	139	27	xyalariaceae	xyalariaceae	PROPN
ahs-14952	139	28	sp	sp	PROPN
ahs-14952	139	29	.	.	NOUN
ahs-14952	139	30	seed	seed	NOUN
ahs-14952	139	31	germination	germination	PROPN
ahs-14952	139	32	chen	chen	PROPN
ahs-14952	139	33	et	et	PROPN
ahs-14952	139	34	al	al	PROPN
ahs-14952	139	35	.	.	PROPN
ahs-14952	140	1	(	(	PUNCT
ahs-14952	140	2	2013	2013	NUM
ahs-14952	140	3	)	)	PUNCT
ahs-14952	140	4	dendrobium	dendrobium	NOUN
ahs-14952	140	5	crumenatum	crumenatum	NOUN
ahs-14952	140	6	(	(	PUNCT
ahs-14952	140	7	e	e	NOUN
ahs-14952	140	8	)	)	PUNCT
ahs-14952	140	9	guignardia	guignardia	PROPN
ahs-14952	140	10	endophyllicola	endophyllicola	NOUN
ahs-14952	140	11	seed	seed	NOUN
ahs-14952	140	12	germination	germination	PROPN
ahs-14952	140	13	mangunwardoyo	mangunwardoyo	PROPN
ahs-14952	140	14	et	et	PROPN
ahs-14952	140	15	al	al	PROPN
ahs-14952	140	16	.	.	PROPN
ahs-14952	141	1	(	(	PUNCT
ahs-14952	141	2	2011	2011	NUM
ahs-14952	141	3	)	)	PUNCT
ahs-14952	141	4	pecteilis	pecteilis	PROPN
ahs-14952	141	5	susannae	susannae	NOUN
ahs-14952	141	6	(	(	PUNCT
ahs-14952	141	7	l.	l.	PROPN
ahs-14952	141	8	)	)	PUNCT
ahs-14952	141	9	epulorhiza	epulorhiza	PROPN
ahs-14952	141	10	sp	sp	PROPN
ahs-14952	141	11	.	.	NOUN
ahs-14952	141	12	seed	seed	NOUN
ahs-14952	141	13	germination	germination	NOUN
ahs-14952	141	14	and	and	CCONJ
ahs-14952	141	15	development	development	NOUN
ahs-14952	141	16	chutima	chutima	PROPN
ahs-14952	141	17	et	et	PROPN
ahs-14952	141	18	al	al	PROPN
ahs-14952	141	19	.	.	PROPN
ahs-14952	141	20	(	(	PUNCT
ahs-14952	141	21	2011	2011	NUM
ahs-14952	141	22	)	)	PUNCT
ahs-14952	141	23	102	102	NUM
ahs-14952	141	24	adv	adv	PROPN
ahs-14952	141	25	.	.	PUNCT
ahs-14952	141	26	hort	hort	PROPN
ahs-14952	141	27	.	.	PUNCT
ahs-14952	142	1	sci	sci	PROPN
ahs-14952	142	2	.	.	PROPN
ahs-14952	142	3	,	,	PUNCT
ahs-14952	142	4	2024	2024	NUM
ahs-14952	142	5	38(1	38(1	NOUN
ahs-14952	142	6	):	):	PUNCT
ahs-14952	142	7	97­116	97­116	NUM
ahs-14952	142	8	e=	e=	NOUN
ahs-14952	142	9	epiphytes	epiphyte	NOUN
ahs-14952	142	10	;	;	PUNCT
ahs-14952	142	11	t=	t=	NOUN
ahs-14952	142	12	terrestrial	terrestrial	NOUN
ahs-14952	142	13	.	.	PUNCT
ahs-14952	143	1	table	table	NOUN
ahs-14952	143	2	1	1	NUM
ahs-14952	143	3	b	b	NOUN
ahs-14952	143	4	­	­	NOUN
ahs-14952	143	5	list	list	NOUN
ahs-14952	143	6	of	of	ADP
ahs-14952	143	7	orchid	orchid	NOUN
ahs-14952	143	8	mycorrhizal	mycorrhizal	NOUN
ahs-14952	143	9	fungi	fungus	NOUN
ahs-14952	143	10	that	that	PRON
ahs-14952	143	11	had	have	AUX
ahs-14952	143	12	been	be	AUX
ahs-14952	143	13	identified	identify	VERB
ahs-14952	143	14	and	and	CCONJ
ahs-14952	143	15	their	their	PRON
ahs-14952	143	16	roles	role	NOUN
ahs-14952	143	17	in	in	ADP
ahs-14952	143	18	orchid	orchid	NOUN
ahs-14952	143	19	micropropagation	micropropagation	NOUN
ahs-14952	143	20	orchid	orchid	NOUN
ahs-14952	143	21	fungi	fungi	VERB
ahs-14952	143	22	sp	sp	NOUN
ahs-14952	143	23	.	.	NOUN
ahs-14952	143	24	roles	role	NOUN
ahs-14952	143	25	references	reference	NOUN
ahs-14952	143	26	dendrobium	dendrobium	NOUN
ahs-14952	143	27	nobile	nobile	PROPN
ahs-14952	143	28	(	(	PUNCT
ahs-14952	143	29	e	e	NOUN
ahs-14952	143	30	)	)	PUNCT
ahs-14952	143	31	leptodontidium	leptodontidium	NOUN
ahs-14952	143	32	seedling	seedling	NOUN
ahs-14952	143	33	development	development	NOUN
ahs-14952	143	34	hou	hou	PROPN
ahs-14952	143	35	and	and	CCONJ
ahs-14952	143	36	guo	guo	PROPN
ahs-14952	143	37	(	(	PUNCT
ahs-14952	143	38	2009	2009	NUM
ahs-14952	143	39	)	)	PUNCT
ahs-14952	143	40	cymbidium	cymbidium	NOUN
ahs-14952	143	41	eburneum	eburneum	NOUN
ahs-14952	143	42	(	(	PUNCT
ahs-14952	143	43	e	e	NOUN
ahs-14952	143	44	)	)	PUNCT
ahs-14952	143	45	alternaria	alternaria	PROPN
ahs-14952	143	46	sp	sp	PROPN
ahs-14952	143	47	.	.	PROPN
ahs-14952	143	48	,	,	PUNCT
ahs-14952	143	49	chaetomium	chaetomium	NOUN
ahs-14952	143	50	sp	sp	NOUN
ahs-14952	143	51	,	,	PUNCT
ahs-14952	143	52	vegetative	vegetative	ADJ
ahs-14952	143	53	growth	growth	NOUN
ahs-14952	143	54	zhao	zhao	PROPN
ahs-14952	143	55	and	and	CCONJ
ahs-14952	143	56	liu	liu	PROPN
ahs-14952	143	57	(	(	PUNCT
ahs-14952	143	58	2008	2008	NUM
ahs-14952	143	59	)	)	PUNCT
ahs-14952	143	60	fusarium	fusarium	NOUN
ahs-14952	143	61	sp	sp	PROPN
ahs-14952	143	62	.	.	PROPN
ahs-14952	143	63	gastrodia	gastrodia	NOUN
ahs-14952	143	64	elata	elata	NOUN
ahs-14952	143	65	(	(	PUNCT
ahs-14952	143	66	t	t	PROPN
ahs-14952	143	67	)	)	PUNCT
ahs-14952	143	68	mycena	mycena	NOUN
ahs-14952	143	69	osmundicola	osmundicola	ADJ
ahs-14952	143	70	seed	seed	NOUN
ahs-14952	143	71	germination	germination	NOUN
ahs-14952	143	72	kim	kim	PROPN
ahs-14952	143	73	et	et	PROPN
ahs-14952	143	74	al	al	PROPN
ahs-14952	143	75	.	.	PROPN
ahs-14952	144	1	(	(	PUNCT
ahs-14952	144	2	2006	2006	NUM
ahs-14952	144	3	)	)	PUNCT
ahs-14952	144	4	cymbidium	cymbidium	NOUN
ahs-14952	144	5	goeringii	goeringii	NOUN
ahs-14952	144	6	(	(	PUNCT
ahs-14952	144	7	t	t	PROPN
ahs-14952	144	8	)	)	PUNCT
ahs-14952	144	9	rhizoctonia	rhizoctonia	NOUN
ahs-14952	144	10	sp	sp	ADP
ahs-14952	144	11	seedling	seedling	NOUN
ahs-14952	144	12	development	development	NOUN
ahs-14952	144	13	jianrong	jianrong	PROPN
ahs-14952	144	14	et	et	PROPN
ahs-14952	144	15	al	al	PROPN
ahs-14952	144	16	.	.	PROPN
ahs-14952	145	1	(	(	PUNCT
ahs-14952	145	2	2005	2005	NUM
ahs-14952	145	3	)	)	PUNCT
ahs-14952	145	4	gastrodia	gastrodia	NOUN
ahs-14952	145	5	elata	elata	NOUN
ahs-14952	145	6	(	(	PUNCT
ahs-14952	145	7	t	t	PROPN
ahs-14952	145	8	)	)	PUNCT
ahs-14952	145	9	mycena	mycena	NOUN
ahs-14952	145	10	osmundicolor	osmundicolor	NOUN
ahs-14952	145	11	seed	seed	NOUN
ahs-14952	145	12	germination	germination	NOUN
ahs-14952	145	13	hong	hong	PROPN
ahs-14952	145	14	et	et	PROPN
ahs-14952	145	15	al	al	PROPN
ahs-14952	145	16	.	.	PROPN
ahs-14952	146	1	(	(	PUNCT
ahs-14952	146	2	2002	2002	NUM
ahs-14952	146	3	)	)	PUNCT
ahs-14952	146	4	paphiopedilum	paphiopedilum	NOUN
ahs-14952	146	5	armeniacum	armeniacum	NOUN
ahs-14952	146	6	(	(	PUNCT
ahs-14952	146	7	t	t	PROPN
ahs-14952	146	8	)	)	PUNCT
ahs-14952	146	9	phacodium	phacodium	PROPN
ahs-14952	146	10	sp	sp	PROPN
ahs-14952	146	11	.	.	PUNCT
ahs-14952	147	1	seedling	seedling	NOUN
ahs-14952	147	2	development	development	NOUN
ahs-14952	147	3	ming	ming	PROPN
ahs-14952	147	4	and	and	CCONJ
ahs-14952	147	5	zhou	zhou	PROPN
ahs-14952	147	6	(	(	PUNCT
ahs-14952	147	7	2001	2001	NUM
ahs-14952	147	8	)	)	PUNCT
ahs-14952	147	9	cypripedium	cypripedium	NOUN
ahs-14952	147	10	reginae	reginae	NOUN
ahs-14952	147	11	(	(	PUNCT
ahs-14952	147	12	t	t	NOUN
ahs-14952	147	13	)	)	PUNCT
ahs-14952	147	14	fusarium	fusarium	NOUN
ahs-14952	147	15	sp	sp	PROPN
ahs-14952	147	16	.	.	PROPN
ahs-14952	147	17	seed	seed	NOUN
ahs-14952	147	18	germination	germination	NOUN
ahs-14952	147	19	warcup	warcup	NOUN
ahs-14952	147	20	(	(	PUNCT
ahs-14952	147	21	1981	1981	NUM
ahs-14952	147	22	)	)	PUNCT
ahs-14952	147	23	dendrobium	dendrobium	NOUN
ahs-14952	147	24	discolor	discolor	NOUN
ahs-14952	147	25	(	(	PUNCT
ahs-14952	147	26	e	e	NOUN
ahs-14952	147	27	)	)	PUNCT
ahs-14952	147	28	,	,	PUNCT
ahs-14952	147	29	tulasnella	tulasnella	NOUN
ahs-14952	147	30	cruciate	cruciate	NOUN
ahs-14952	147	31	,	,	PUNCT
ahs-14952	147	32	seed	seed	NOUN
ahs-14952	147	33	germination	germination	NOUN
ahs-14952	147	34	warcup	warcup	NOUN
ahs-14952	147	35	(	(	PUNCT
ahs-14952	147	36	1981	1981	NUM
ahs-14952	147	37	)	)	PUNCT
ahs-14952	147	38	tulasnella	tulasnella	NOUN
ahs-14952	147	39	irregularis	irregularis	NOUN
ahs-14952	147	40	,	,	PUNCT
ahs-14952	147	41	tulasnella	tulasnella	NOUN
ahs-14952	147	42	allantospora	allantospora	PROPN
ahs-14952	147	43	calochilus	calochilus	PROPN
ahs-14952	147	44	sp	sp	PROPN
ahs-14952	147	45	.	.	PUNCT
ahs-14952	147	46	(	(	PUNCT
ahs-14952	147	47	t	t	PROPN
ahs-14952	147	48	)	)	PUNCT
ahs-14952	147	49	,	,	PUNCT
ahs-14952	147	50	tulasnella	tulasnella	NOUN
ahs-14952	147	51	asymmetrica	asymmetrica	PROPN
ahs-14952	147	52	,	,	PUNCT
ahs-14952	147	53	seed	seed	NOUN
ahs-14952	147	54	germination	germination	NOUN
ahs-14952	147	55	warcup	warcup	NOUN
ahs-14952	147	56	(	(	PUNCT
ahs-14952	147	57	1981	1981	NUM
ahs-14952	147	58	)	)	PUNCT
ahs-14952	147	59	diuris	diuris	PROPN
ahs-14952	147	60	maculata	maculata	PROPN
ahs-14952	147	61	sm	sm	PROPN
ahs-14952	147	62	.	.	PUNCT
ahs-14952	147	63	(	(	PUNCT
ahs-14952	147	64	t	t	PROPN
ahs-14952	147	65	)	)	PUNCT
ahs-14952	147	66	,	,	PUNCT
ahs-14952	147	67	tulasnella	tulasnella	NOUN
ahs-14952	147	68	cruciate	cruciate	NOUN
ahs-14952	147	69	,	,	PUNCT
ahs-14952	147	70	spiranthes	spiranthe	VERB
ahs-14952	147	71	sinensis	sinensis	NOUN
ahs-14952	147	72	(	(	PUNCT
ahs-14952	147	73	t	t	NOUN
ahs-14952	147	74	)	)	PUNCT
ahs-14952	147	75	tulasnella	tulasnella	NOUN
ahs-14952	147	76	irregularis	irregularis	NOUN
ahs-14952	147	77	,	,	PUNCT
ahs-14952	147	78	tulasnella	tulasnella	NOUN
ahs-14952	147	79	violea	violea	NOUN
ahs-14952	147	80	,	,	PUNCT
ahs-14952	147	81	tulasnella	tulasnella	NOUN
ahs-14952	147	82	allantospora	allantospora	PROPN
ahs-14952	147	83	diuris	diuris	PROPN
ahs-14952	147	84	sulphurea	sulphurea	PROPN
ahs-14952	147	85	.	.	PUNCT
ahs-14952	148	1	r.br	r.br	VERB
ahs-14952	148	2	.	.	PUNCT
ahs-14952	149	1	(	(	PUNCT
ahs-14952	149	2	t	t	NOUN
ahs-14952	149	3	)	)	PUNCT
ahs-14952	149	4	tulasnella	tulasnella	NOUN
ahs-14952	149	5	asymmetrica	asymmetrica	PROPN
ahs-14952	149	6	seed	seed	NOUN
ahs-14952	149	7	germination	germination	NOUN
ahs-14952	149	8	warcup	warcup	NOUN
ahs-14952	149	9	(	(	PUNCT
ahs-14952	149	10	1981	1981	NUM
ahs-14952	149	11	)	)	PUNCT
ahs-14952	149	12	orthocersa	orthocersa	PROPN
ahs-14952	149	13	strictum	strictum	PROPN
ahs-14952	149	14	(	(	PUNCT
ahs-14952	149	15	t	t	PROPN
ahs-14952	149	16	)	)	PUNCT
ahs-14952	149	17	tulasnella	tulasnella	NOUN
ahs-14952	149	18	asymmetrica	asymmetrica	PROPN
ahs-14952	149	19	,	,	PUNCT
ahs-14952	149	20	seed	seed	NOUN
ahs-14952	149	21	germination	germination	NOUN
ahs-14952	149	22	warcup	warcup	NOUN
ahs-14952	149	23	(	(	PUNCT
ahs-14952	149	24	1981	1981	NUM
ahs-14952	149	25	)	)	PUNCT
ahs-14952	149	26	tulasnella	tulasnella	NOUN
ahs-14952	149	27	cruciate	cruciate	NOUN
ahs-14952	149	28	,	,	PUNCT
ahs-14952	149	29	tulasnella	tulasnella	NOUN
ahs-14952	149	30	irregularis	irregularis	NOUN
ahs-14952	149	31	,	,	PUNCT
ahs-14952	149	32	tulasnella	tulasnella	NOUN
ahs-14952	149	33	violea	violea	PROPN
ahs-14952	149	34	thelymitra	thelymitra	PROPN
ahs-14952	149	35	ixoides	ixoide	NOUN
ahs-14952	149	36	(	(	PUNCT
ahs-14952	149	37	t	t	NOUN
ahs-14952	149	38	)	)	PUNCT
ahs-14952	149	39	tulasnella	tulasnella	NOUN
ahs-14952	149	40	asymmetrica	asymmetrica	PROPN
ahs-14952	149	41	,	,	PUNCT
ahs-14952	149	42	seed	seed	NOUN
ahs-14952	149	43	germination	germination	NOUN
ahs-14952	149	44	warcup	warcup	NOUN
ahs-14952	149	45	(	(	PUNCT
ahs-14952	149	46	1981	1981	NUM
ahs-14952	149	47	)	)	PUNCT
ahs-14952	149	48	tulasnella	tulasnella	NOUN
ahs-14952	149	49	cruciata	cruciata	VERB
ahs-14952	149	50	thelymitra	thelymitra	ADJ
ahs-14952	149	51	flexuosa	flexuosa	PROPN
ahs-14952	149	52	(	(	PUNCT
ahs-14952	149	53	t	t	NOUN
ahs-14952	149	54	)	)	PUNCT
ahs-14952	149	55	tulasnella	tulasnella	NOUN
ahs-14952	149	56	irregularis	irregularis	NOUN
ahs-14952	149	57	,	,	PUNCT
ahs-14952	149	58	seed	seed	NOUN
ahs-14952	149	59	germination	germination	NOUN
ahs-14952	149	60	warcup	warcup	NOUN
ahs-14952	149	61	(	(	PUNCT
ahs-14952	149	62	1981	1981	NUM
ahs-14952	149	63	)	)	PUNCT
ahs-14952	149	64	tulasnella	tulasnella	NOUN
ahs-14952	149	65	cruciata	cruciata	VERB
ahs-14952	149	66	thelymitra	thelymitra	ADJ
ahs-14952	149	67	media	medium	NOUN
ahs-14952	149	68	(	(	PUNCT
ahs-14952	149	69	t	t	NOUN
ahs-14952	149	70	)	)	PUNCT
ahs-14952	149	71	tulasnella	tulasnella	NOUN
ahs-14952	149	72	violea	violea	NOUN
ahs-14952	149	73	,	,	PUNCT
ahs-14952	149	74	seed	seed	NOUN
ahs-14952	149	75	germination	germination	NOUN
ahs-14952	149	76	warcup	warcup	NOUN
ahs-14952	149	77	(	(	PUNCT
ahs-14952	149	78	1981	1981	NUM
ahs-14952	149	79	)	)	PUNCT
ahs-14952	149	80	tulasnella	tulasnella	NOUN
ahs-14952	149	81	asymmetrica	asymmetrica	PROPN
ahs-14952	149	82	thelymitra	thelymitra	PROPN
ahs-14952	149	83	carnea	carnea	PROPN
ahs-14952	149	84	(	(	PUNCT
ahs-14952	149	85	t	t	NOUN
ahs-14952	149	86	)	)	PUNCT
ahs-14952	149	87	tulasnella	tulasnella	NOUN
ahs-14952	149	88	allantospora	allantospora	PROPN
ahs-14952	149	89	,	,	PUNCT
ahs-14952	149	90	seed	seed	NOUN
ahs-14952	149	91	germination	germination	NOUN
ahs-14952	149	92	warcup	warcup	NOUN
ahs-14952	149	93	(	(	PUNCT
ahs-14952	149	94	1981	1981	NUM
ahs-14952	149	95	)	)	PUNCT
ahs-14952	149	96	tulasnella	tulasnella	NOUN
ahs-14952	149	97	violea	violea	ADV
ahs-14952	149	98	shamsudin	shamsudin	VERB
ahs-14952	149	99	et	et	PROPN
ahs-14952	149	100	al	al	PROPN
ahs-14952	149	101	.	.	PROPN
ahs-14952	150	1	‐	‐	ADP
ahs-14952	150	2	molecular	molecular	ADJ
ahs-14952	150	3	identification	identification	NOUN
ahs-14952	150	4	of	of	ADP
ahs-14952	150	5	orchid	orchid	NOUN
ahs-14952	150	6	mycorrhiza	mycorrhiza	PROPN
ahs-14952	150	7	103	103	NUM
ahs-14952	150	8	that	that	PRON
ahs-14952	150	9	have	have	AUX
ahs-14952	150	10	been	be	AUX
ahs-14952	150	11	excessively	excessively	ADV
ahs-14952	150	12	harvested	harvest	VERB
ahs-14952	150	13	.	.	PUNCT
ahs-14952	151	1	they	they	PRON
ahs-14952	151	2	effectively	effectively	ADV
ahs-14952	151	3	isolated	isolate	VERB
ahs-14952	151	4	and	and	CCONJ
ahs-14952	151	5	obtained	obtain	VERB
ahs-14952	151	6	fungi	fungus	NOUN
ahs-14952	151	7	that	that	PRON
ahs-14952	151	8	enhance	enhance	VERB
ahs-14952	151	9	germination	germination	NOUN
ahs-14952	151	10	for	for	ADP
ahs-14952	151	11	several	several	ADJ
ahs-14952	151	12	dendrobium	dendrobium	NOUN
ahs-14952	151	13	species	specie	NOUN
ahs-14952	151	14	using	use	VERB
ahs-14952	151	15	the	the	DET
ahs-14952	151	16	seed	seed	NOUN
ahs-14952	151	17	baiting	bait	VERB
ahs-14952	151	18	approach	approach	NOUN
ahs-14952	151	19	,	,	PUNCT
ahs-14952	151	20	as	as	SCONJ
ahs-14952	151	21	described	describe	VERB
ahs-14952	151	22	by	by	ADP
ahs-14952	151	23	huang	huang	PROPN
ahs-14952	151	24	et	et	PROPN
ahs-14952	151	25	al	al	PROPN
ahs-14952	151	26	.	.	PROPN
ahs-14952	152	1	(	(	PUNCT
ahs-14952	152	2	2018	2018	NUM
ahs-14952	152	3	)	)	PUNCT
ahs-14952	152	4	.	.	PUNCT
ahs-14952	153	1	5	5	X
ahs-14952	153	2	.	.	X
ahs-14952	153	3	fungal	fungal	ADJ
ahs-14952	153	4	dna	dna	PROPN
ahs-14952	153	5	extraction	extraction	NOUN
ahs-14952	153	6	there	there	PRON
ahs-14952	153	7	are	be	VERB
ahs-14952	153	8	various	various	ADJ
ahs-14952	153	9	methodologies	methodology	NOUN
ahs-14952	153	10	commonly	commonly	ADV
ahs-14952	153	11	employed	employ	VERB
ahs-14952	153	12	for	for	ADP
ahs-14952	153	13	the	the	DET
ahs-14952	153	14	isolation	isolation	NOUN
ahs-14952	153	15	of	of	ADP
ahs-14952	153	16	orchid	orchid	NOUN
ahs-14952	153	17	mycorrhizal	mycorrhizal	NOUN
ahs-14952	153	18	fungus	fungus	NOUN
ahs-14952	153	19	from	from	ADP
ahs-14952	153	20	orchid	orchid	NOUN
ahs-14952	153	21	plants	plant	NOUN
ahs-14952	153	22	.	.	PUNCT
ahs-14952	154	1	these	these	DET
ahs-14952	154	2	methodologies	methodology	NOUN
ahs-14952	154	3	encompass	encompass	VERB
ahs-14952	154	4	the	the	DET
ahs-14952	154	5	isolation	isolation	NOUN
ahs-14952	154	6	of	of	ADP
ahs-14952	154	7	complete	complete	ADJ
ahs-14952	154	8	tissue	tissue	NOUN
ahs-14952	154	9	or	or	CCONJ
ahs-14952	154	10	tissue	tissue	NOUN
ahs-14952	154	11	segments	segment	NOUN
ahs-14952	154	12	,	,	PUNCT
ahs-14952	154	13	in	in	ADP
ahs-14952	154	14	situ	situ	ADJ
ahs-14952	154	15	seedings	seeding	NOUN
ahs-14952	154	16	,	,	PUNCT
ahs-14952	154	17	trapping	trap	VERB
ahs-14952	154	18	isolation	isolation	NOUN
ahs-14952	154	19	,	,	PUNCT
ahs-14952	154	20	and	and	CCONJ
ahs-14952	154	21	isolation	isolation	NOUN
ahs-14952	154	22	from	from	ADP
ahs-14952	154	23	a	a	DET
ahs-14952	154	24	solitary	solitary	ADJ
ahs-14952	154	25	peloton	peloton	NOUN
ahs-14952	154	26	.	.	PUNCT
ahs-14952	155	1	among	among	ADP
ahs-14952	155	2	these	these	DET
ahs-14952	155	3	methods	method	NOUN
ahs-14952	155	4	,	,	PUNCT
ahs-14952	155	5	the	the	DET
ahs-14952	155	6	technique	technique	NOUN
ahs-14952	155	7	of	of	ADP
ahs-14952	155	8	isolating	isolate	VERB
ahs-14952	155	9	a	a	DET
ahs-14952	155	10	single	single	ADJ
ahs-14952	155	11	peloton	peloton	NOUN
ahs-14952	155	12	,	,	PUNCT
ahs-14952	155	13	which	which	PRON
ahs-14952	155	14	involves	involve	VERB
ahs-14952	155	15	micromanipulation­based	micromanipulation­base	VERB
ahs-14952	155	16	isolation	isolation	NOUN
ahs-14952	155	17	from	from	ADP
ahs-14952	155	18	host	host	NOUN
ahs-14952	155	19	cells	cell	NOUN
ahs-14952	155	20	,	,	PUNCT
ahs-14952	155	21	is	be	AUX
ahs-14952	155	22	widely	widely	ADV
ahs-14952	155	23	regarded	regard	VERB
ahs-14952	155	24	as	as	ADP
ahs-14952	155	25	the	the	DET
ahs-14952	155	26	most	most	ADV
ahs-14952	155	27	reliable	reliable	ADJ
ahs-14952	155	28	and	and	CCONJ
ahs-14952	155	29	precise	precise	ADJ
ahs-14952	155	30	approach	approach	NOUN
ahs-14952	155	31	for	for	ADP
ahs-14952	155	32	extracting	extract	VERB
ahs-14952	155	33	endophytic	endophytic	ADJ
ahs-14952	155	34	mycorrhizal	mycorrhizal	NOUN
ahs-14952	155	35	fungi	fungus	NOUN
ahs-14952	155	36	(	(	PUNCT
ahs-14952	155	37	zettler	zettler	X
ahs-14952	155	38	et	et	PROPN
ahs-14952	155	39	al	al	PROPN
ahs-14952	155	40	.	.	PROPN
ahs-14952	155	41	,	,	PUNCT
ahs-14952	155	42	2003	2003	NUM
ahs-14952	155	43	;	;	PUNCT
ahs-14952	155	44	batty	batty	PROPN
ahs-14952	155	45	et	et	PROPN
ahs-14952	155	46	al	al	PROPN
ahs-14952	155	47	.	.	PROPN
ahs-14952	155	48	,	,	PUNCT
ahs-14952	155	49	2006	2006	NUM
ahs-14952	155	50	;	;	PUNCT
ahs-14952	155	51	zi	zi	PROPN
ahs-14952	155	52	et	et	PROPN
ahs-14952	155	53	al	al	PROPN
ahs-14952	155	54	.	.	PROPN
ahs-14952	155	55	,	,	PUNCT
ahs-14952	155	56	2014	2014	NUM
ahs-14952	155	57	;	;	PUNCT
ahs-14952	155	58	zettler	zettler	NOUN
ahs-14952	155	59	and	and	CCONJ
ahs-14952	155	60	corey	corey	PROPN
ahs-14952	155	61	,	,	PUNCT
ahs-14952	155	62	2018	2018	NUM
ahs-14952	155	63	)	)	PUNCT
ahs-14952	155	64	.	.	PUNCT
ahs-14952	156	1	the	the	DET
ahs-14952	156	2	prevailing	prevail	VERB
ahs-14952	156	3	conventional	conventional	ADJ
ahs-14952	156	4	method	method	NOUN
ahs-14952	156	5	for	for	ADP
ahs-14952	156	6	molecular	molecular	ADJ
ahs-14952	156	7	identification	identification	NOUN
ahs-14952	156	8	of	of	ADP
ahs-14952	156	9	orchid	orchid	NOUN
ahs-14952	156	10	mycorrhizal	mycorrhizal	NOUN
ahs-14952	156	11	fungus	fungus	NOUN
ahs-14952	156	12	generally	generally	ADV
ahs-14952	156	13	entails	entail	VERB
ahs-14952	156	14	the	the	DET
ahs-14952	156	15	extraction	extraction	NOUN
ahs-14952	156	16	of	of	ADP
ahs-14952	156	17	dna	dna	NOUN
ahs-14952	156	18	from	from	ADP
ahs-14952	156	19	agar	agar	NOUN
ahs-14952	156	20	plates	plate	NOUN
ahs-14952	156	21	or	or	CCONJ
ahs-14952	156	22	liquid	liquid	ADJ
ahs-14952	156	23	cultures	culture	NOUN
ahs-14952	156	24	,	,	PUNCT
ahs-14952	156	25	as	as	SCONJ
ahs-14952	156	26	opposed	oppose	VERB
ahs-14952	156	27	to	to	PART
ahs-14952	156	28	direct	direct	VERB
ahs-14952	156	29	extraction	extraction	NOUN
ahs-14952	156	30	from	from	ADP
ahs-14952	156	31	orchid	orchid	NOUN
ahs-14952	156	32	roots	root	NOUN
ahs-14952	156	33	(	(	PUNCT
ahs-14952	156	34	zettler	zettler	NOUN
ahs-14952	156	35	and	and	CCONJ
ahs-14952	156	36	corey	corey	PROPN
ahs-14952	156	37	,	,	PUNCT
ahs-14952	156	38	2018	2018	NUM
ahs-14952	156	39	)	)	PUNCT
ahs-14952	156	40	.	.	PUNCT
ahs-14952	157	1	the	the	DET
ahs-14952	157	2	fungal	fungal	ADJ
ahs-14952	157	3	cell	cell	NOUN
ahs-14952	157	4	wall	wall	NOUN
ahs-14952	157	5	primarily	primarily	ADV
ahs-14952	157	6	consists	consist	VERB
ahs-14952	157	7	of	of	ADP
ahs-14952	157	8	around	around	ADP
ahs-14952	157	9	80­90	80­90	NOUN
ahs-14952	157	10	%	%	NOUN
ahs-14952	157	11	polysaccharides	polysaccharide	NOUN
ahs-14952	157	12	,	,	PUNCT
ahs-14952	157	13	inorganic	inorganic	ADJ
ahs-14952	157	14	ions	ion	NOUN
ahs-14952	157	15	,	,	PUNCT
ahs-14952	157	16	lipids	lipid	NOUN
ahs-14952	157	17	,	,	PUNCT
ahs-14952	157	18	polyphosphates	polyphosphate	NOUN
ahs-14952	157	19	,	,	PUNCT
ahs-14952	157	20	and	and	CCONJ
ahs-14952	157	21	proteins	protein	NOUN
ahs-14952	157	22	,	,	PUNCT
ahs-14952	157	23	which	which	PRON
ahs-14952	157	24	together	together	ADV
ahs-14952	157	25	form	form	VERB
ahs-14952	157	26	the	the	DET
ahs-14952	157	27	matrix	matrix	NOUN
ahs-14952	157	28	that	that	PRON
ahs-14952	157	29	binds	bind	VERB
ahs-14952	157	30	the	the	DET
ahs-14952	157	31	wall	wall	NOUN
ahs-14952	157	32	.	.	PUNCT
ahs-14952	158	1	this	this	DET
ahs-14952	158	2	type	type	NOUN
ahs-14952	158	3	of	of	ADP
ahs-14952	158	4	cell	cell	NOUN
ahs-14952	158	5	wall	wall	NOUN
ahs-14952	158	6	also	also	ADV
ahs-14952	158	7	can	can	AUX
ahs-14952	158	8	be	be	AUX
ahs-14952	158	9	characterized	characterize	VERB
ahs-14952	158	10	by	by	ADP
ahs-14952	158	11	microfibrillar	microfibrillar	PROPN
ahs-14952	158	12	components	component	NOUN
ahs-14952	158	13	like	like	ADP
ahs-14952	158	14	chitin	chitin	NOUN
ahs-14952	158	15	,	,	PUNCT
ahs-14952	158	16	β­glucan	β­glucan	ADJ
ahs-14952	158	17	,	,	PUNCT
ahs-14952	158	18	and/or	and/or	CCONJ
ahs-14952	158	19	cellulose	cellulose	NOUN
ahs-14952	158	20	,	,	PUNCT
ahs-14952	158	21	which	which	PRON
ahs-14952	158	22	pose	pose	VERB
ahs-14952	158	23	challenges	challenge	NOUN
ahs-14952	158	24	in	in	ADP
ahs-14952	158	25	dna	dna	PROPN
ahs-14952	158	26	extraction	extraction	NOUN
ahs-14952	158	27	(	(	PUNCT
ahs-14952	158	28	turzhanova	turzhanova	X
ahs-14952	158	29	et	et	PROPN
ahs-14952	158	30	al	al	PROPN
ahs-14952	158	31	.	.	PROPN
ahs-14952	158	32	,	,	PUNCT
ahs-14952	158	33	2018	2018	NUM
ahs-14952	158	34	)	)	PUNCT
ahs-14952	158	35	.	.	PUNCT
ahs-14952	159	1	moreover	moreover	ADV
ahs-14952	159	2	,	,	PUNCT
ahs-14952	159	3	the	the	DET
ahs-14952	159	4	presence	presence	NOUN
ahs-14952	159	5	of	of	ADP
ahs-14952	159	6	a	a	DET
ahs-14952	159	7	substantial	substantial	ADJ
ahs-14952	159	8	quantity	quantity	NOUN
ahs-14952	159	9	of	of	ADP
ahs-14952	159	10	secondary	secondary	ADJ
ahs-14952	159	11	metabolites	metabolite	NOUN
ahs-14952	159	12	,	,	PUNCT
ahs-14952	159	13	such	such	ADJ
ahs-14952	159	14	as	as	ADP
ahs-14952	159	15	melanin	melanin	NOUN
ahs-14952	159	16	,	,	PUNCT
ahs-14952	159	17	can	can	AUX
ahs-14952	159	18	impede	impede	VERB
ahs-14952	159	19	subsequent	subsequent	ADJ
ahs-14952	159	20	reactions	reaction	NOUN
ahs-14952	159	21	(	(	PUNCT
ahs-14952	159	22	fernandez	fernandez	PROPN
ahs-14952	159	23	et	et	PROPN
ahs-14952	159	24	al	al	PROPN
ahs-14952	159	25	.	.	PROPN
ahs-14952	159	26	,	,	PUNCT
ahs-14952	159	27	2016	2016	NUM
ahs-14952	159	28	;	;	PUNCT
ahs-14952	159	29	janowski	janowski	PROPN
ahs-14952	159	30	et	et	PROPN
ahs-14952	159	31	al	al	PROPN
ahs-14952	159	32	.	.	PROPN
ahs-14952	159	33	,	,	PUNCT
ahs-14952	159	34	2019	2019	NUM
ahs-14952	159	35	)	)	PUNCT
ahs-14952	159	36	this	this	PRON
ahs-14952	159	37	become	become	VERB
ahs-14952	159	38	a	a	DET
ahs-14952	159	39	major	major	ADJ
ahs-14952	159	40	challenge	challenge	NOUN
ahs-14952	159	41	in	in	ADP
ahs-14952	159	42	dna	dna	PROPN
ahs-14952	159	43	extraction	extraction	NOUN
ahs-14952	159	44	of	of	ADP
ahs-14952	159	45	fungi	fungus	NOUN
ahs-14952	159	46	as	as	SCONJ
ahs-14952	159	47	it	it	PRON
ahs-14952	159	48	has	have	VERB
ahs-14952	159	49	a	a	DET
ahs-14952	159	50	robust	robust	ADJ
ahs-14952	159	51	cell	cell	NOUN
ahs-14952	159	52	walls	wall	NOUN
ahs-14952	159	53	that	that	PRON
ahs-14952	159	54	are	be	AUX
ahs-14952	159	55	resist	resist	VERB
ahs-14952	159	56	to	to	PART
ahs-14952	159	57	lysis	lysis	NOUN
ahs-14952	159	58	method	method	NOUN
ahs-14952	159	59	(	(	PUNCT
ahs-14952	159	60	jiang	jiang	PROPN
ahs-14952	159	61	et	et	PROPN
ahs-14952	159	62	al	al	PROPN
ahs-14952	159	63	.	.	PROPN
ahs-14952	159	64	,	,	PUNCT
ahs-14952	159	65	2011	2011	NUM
ahs-14952	159	66	)	)	PUNCT
ahs-14952	159	67	.	.	PUNCT
ahs-14952	160	1	the	the	DET
ahs-14952	160	2	isolating	isolate	VERB
ahs-14952	160	3	nucleic	nucleic	ADJ
ahs-14952	160	4	acids	acid	NOUN
ahs-14952	160	5	from	from	ADP
ahs-14952	160	6	fungi	fungus	NOUN
ahs-14952	160	7	,	,	PUNCT
ahs-14952	160	8	often	often	ADV
ahs-14952	160	9	necessitates	necessitate	VERB
ahs-14952	160	10	the	the	DET
ahs-14952	160	11	incorporation	incorporation	NOUN
ahs-14952	160	12	of	of	ADP
ahs-14952	160	13	additional	additional	ADJ
ahs-14952	160	14	lysis	lysis	NOUN
ahs-14952	160	15	steps	step	NOUN
ahs-14952	160	16	,	,	PUNCT
ahs-14952	160	17	which	which	PRON
ahs-14952	160	18	can	can	AUX
ahs-14952	160	19	include	include	VERB
ahs-14952	160	20	enzymatic	enzymatic	ADJ
ahs-14952	160	21	lysis	lysis	NOUN
ahs-14952	160	22	,	,	PUNCT
ahs-14952	160	23	mechanical	mechanical	ADJ
ahs-14952	160	24	homogenization	homogenization	NOUN
ahs-14952	160	25	,	,	PUNCT
ahs-14952	160	26	sonication	sonication	NOUN
ahs-14952	160	27	,	,	PUNCT
ahs-14952	160	28	or	or	CCONJ
ahs-14952	160	29	the	the	DET
ahs-14952	160	30	use	use	NOUN
ahs-14952	160	31	of	of	ADP
ahs-14952	160	32	potentially	potentially	ADV
ahs-14952	160	33	harmful	harmful	ADJ
ahs-14952	160	34	chemicals	chemical	NOUN
ahs-14952	160	35	(	(	PUNCT
ahs-14952	160	36	turzhanova	turzhanova	X
ahs-14952	160	37	et	et	PROPN
ahs-14952	160	38	al	al	PROPN
ahs-14952	160	39	.	.	PROPN
ahs-14952	160	40	,	,	PUNCT
ahs-14952	160	41	2018	2018	NUM
ahs-14952	160	42	)	)	PUNCT
ahs-14952	160	43	.	.	PUNCT
ahs-14952	161	1	dna	dna	PROPN
ahs-14952	161	2	samples	sample	NOUN
ahs-14952	161	3	were	be	AUX
ahs-14952	161	4	gathered	gather	VERB
ahs-14952	161	5	over	over	ADP
ahs-14952	161	6	a	a	DET
ahs-14952	161	7	period	period	NOUN
ahs-14952	161	8	of	of	ADP
ahs-14952	161	9	15	15	NUM
ahs-14952	161	10	years	year	NOUN
ahs-14952	161	11	,	,	PUNCT
ahs-14952	161	12	during	during	ADP
ahs-14952	161	13	which	which	PRON
ahs-14952	161	14	a	a	DET
ahs-14952	161	15	diverse	diverse	ADJ
ahs-14952	161	16	range	range	NOUN
ahs-14952	161	17	of	of	ADP
ahs-14952	161	18	extraction	extraction	NOUN
ahs-14952	161	19	procedures	procedure	NOUN
ahs-14952	161	20	were	be	AUX
ahs-14952	161	21	utilised	utilise	VERB
ahs-14952	161	22	to	to	PART
ahs-14952	161	23	extract	extract	VERB
ahs-14952	161	24	fungal	fungal	ADJ
ahs-14952	161	25	dna	dna	NOUN
ahs-14952	161	26	.	.	PUNCT
ahs-14952	162	1	nevertheless	nevertheless	ADV
ahs-14952	162	2	,	,	PUNCT
ahs-14952	162	3	the	the	DET
ahs-14952	162	4	extraction	extraction	NOUN
ahs-14952	162	5	of	of	ADP
ahs-14952	162	6	dna	dna	PROPN
ahs-14952	162	7	from	from	ADP
ahs-14952	162	8	the	the	DET
ahs-14952	162	9	various	various	ADJ
ahs-14952	162	10	types	type	NOUN
ahs-14952	162	11	of	of	ADP
ahs-14952	162	12	fungi	fungus	NOUN
ahs-14952	162	13	encountered	encounter	VERB
ahs-14952	162	14	does	do	AUX
ahs-14952	162	15	not	not	PART
ahs-14952	162	16	have	have	VERB
ahs-14952	162	17	a	a	DET
ahs-14952	162	18	universally	universally	ADV
ahs-14952	162	19	optimised	optimise	VERB
ahs-14952	162	20	approach	approach	NOUN
ahs-14952	162	21	.	.	PUNCT
ahs-14952	163	1	the	the	DET
ahs-14952	163	2	standard	standard	ADJ
ahs-14952	163	3	procedure	procedure	NOUN
ahs-14952	163	4	for	for	ADP
ahs-14952	163	5	the	the	DET
ahs-14952	163	6	extraction	extraction	NOUN
ahs-14952	163	7	of	of	ADP
ahs-14952	163	8	fungal	fungal	ADJ
ahs-14952	163	9	dna	dna	NOUN
ahs-14952	163	10	typically	typically	ADV
ahs-14952	163	11	encompasses	encompass	VERB
ahs-14952	163	12	several	several	ADJ
ahs-14952	163	13	sequential	sequential	ADJ
ahs-14952	163	14	stages	stage	NOUN
ahs-14952	163	15	.	.	PUNCT
ahs-14952	164	1	these	these	DET
ahs-14952	164	2	stages	stage	NOUN
ahs-14952	164	3	involve	involve	VERB
ahs-14952	164	4	the	the	DET
ahs-14952	164	5	cultivation	cultivation	NOUN
ahs-14952	164	6	of	of	ADP
ahs-14952	164	7	fungi	fungus	NOUN
ahs-14952	164	8	in	in	ADP
ahs-14952	164	9	either	either	CCONJ
ahs-14952	164	10	liquid	liquid	ADJ
ahs-14952	164	11	or	or	CCONJ
ahs-14952	164	12	solid	solid	ADJ
ahs-14952	164	13	growth	growth	NOUN
ahs-14952	164	14	media	medium	NOUN
ahs-14952	164	15	,	,	PUNCT
ahs-14952	164	16	disruption	disruption	NOUN
ahs-14952	164	17	of	of	ADP
ahs-14952	164	18	the	the	DET
ahs-14952	164	19	fungal	fungal	ADJ
ahs-14952	164	20	cell	cell	NOUN
ahs-14952	164	21	wall	wall	NOUN
ahs-14952	164	22	,	,	PUNCT
ahs-14952	164	23	elimination	elimination	NOUN
ahs-14952	164	24	of	of	ADP
ahs-14952	164	25	proteins	protein	NOUN
ahs-14952	164	26	using	use	VERB
ahs-14952	164	27	phenol	phenol	NOUN
ahs-14952	164	28	and	and	CCONJ
ahs-14952	164	29	chloroform	chloroform	NOUN
ahs-14952	164	30	,	,	PUNCT
ahs-14952	164	31	and	and	CCONJ
ahs-14952	164	32	subsequent	subsequent	ADJ
ahs-14952	164	33	isolation	isolation	NOUN
ahs-14952	164	34	of	of	ADP
ahs-14952	164	35	dna	dna	PROPN
ahs-14952	164	36	through	through	ADP
ahs-14952	164	37	precipitation	precipitation	NOUN
ahs-14952	164	38	with	with	ADP
ahs-14952	164	39	ethanol	ethanol	NOUN
ahs-14952	164	40	or	or	CCONJ
ahs-14952	164	41	isopropanol	isopropanol	NOUN
ahs-14952	164	42	(	(	PUNCT
ahs-14952	164	43	faggi	faggi	X
ahs-14952	164	44	et	et	PROPN
ahs-14952	164	45	al	al	PROPN
ahs-14952	164	46	.	.	PROPN
ahs-14952	164	47	,	,	PUNCT
ahs-14952	164	48	2005	2005	NUM
ahs-14952	164	49	)	)	PUNCT
ahs-14952	164	50	.	.	PUNCT
ahs-14952	165	1	even	even	ADV
ahs-14952	165	2	though	though	SCONJ
ahs-14952	165	3	the	the	DET
ahs-14952	165	4	presence	presence	NOUN
ahs-14952	165	5	of	of	ADP
ahs-14952	165	6	polysaccharide	polysaccharide	NOUN
ahs-14952	165	7	and	and	CCONJ
ahs-14952	165	8	polyphenolic	polyphenolic	ADJ
ahs-14952	165	9	compound	compound	NOUN
ahs-14952	165	10	in	in	ADP
ahs-14952	165	11	the	the	DET
ahs-14952	165	12	fungi	fungus	NOUN
ahs-14952	165	13	may	may	AUX
ahs-14952	165	14	inhibit	inhibit	VERB
ahs-14952	165	15	the	the	DET
ahs-14952	165	16	activity	activity	NOUN
ahs-14952	165	17	and	and	CCONJ
ahs-14952	165	18	effect	effect	NOUN
ahs-14952	165	19	of	of	ADP
ahs-14952	165	20	dna	dna	PROPN
ahs-14952	165	21	polymerase	polymerase	NOUN
ahs-14952	165	22	,	,	PUNCT
ahs-14952	165	23	but	but	CCONJ
ahs-14952	165	24	they	they	PRON
ahs-14952	165	25	can	can	AUX
ahs-14952	165	26	be	be	AUX
ahs-14952	165	27	easily	easily	ADV
ahs-14952	165	28	removed	remove	VERB
ahs-14952	165	29	by	by	ADP
ahs-14952	165	30	either	either	CCONJ
ahs-14952	165	31	using	use	VERB
ahs-14952	165	32	a	a	DET
ahs-14952	165	33	vacuum	vacuum	NOUN
ahs-14952	165	34	or	or	CCONJ
ahs-14952	165	35	spin	spin	VERB
ahs-14952	165	36	column	column	NOUN
ahs-14952	165	37	and	and	CCONJ
ahs-14952	165	38	by	by	ADP
ahs-14952	165	39	mixing	mix	VERB
ahs-14952	165	40	the	the	DET
ahs-14952	165	41	sample	sample	NOUN
ahs-14952	165	42	with	with	ADP
ahs-14952	165	43	bovine	bovine	PROPN
ahs-14952	165	44	serum	serum	NOUN
ahs-14952	165	45	albumin	albumin	PROPN
ahs-14952	165	46	(	(	PUNCT
ahs-14952	165	47	bsa	bsa	PROPN
ahs-14952	165	48	)	)	PUNCT
ahs-14952	165	49	,	,	PUNCT
ahs-14952	165	50	β­mercaptoethanol	β­mercaptoethanol	PROPN
ahs-14952	165	51	(	(	PUNCT
ahs-14952	165	52	βме	βме	NOUN
ahs-14952	165	53	)	)	PUNCT
ahs-14952	165	54	,	,	PUNCT
ahs-14952	165	55	n­	n­	NOUN
ahs-14952	165	56	trimethyl	trimethyl	NUM
ahs-14952	165	57	ammonium	ammonium	NOUN
ahs-14952	165	58	bromide	bromide	NOUN
ahs-14952	165	59	(	(	PUNCT
ahs-14952	165	60	ctab	ctab	NOUN
ahs-14952	165	61	)	)	PUNCT
ahs-14952	165	62	and	and	CCONJ
ahs-14952	165	63	polyvinylpyrrolidone	polyvinylpyrrolidone	NOUN
ahs-14952	165	64	(	(	PUNCT
ahs-14952	165	65	pvp	pvp	PROPN
ahs-14952	165	66	)	)	PUNCT
ahs-14952	165	67	(	(	PUNCT
ahs-14952	165	68	tripathy	tripathy	PROPN
ahs-14952	165	69	et	et	PROPN
ahs-14952	165	70	al	al	PROPN
ahs-14952	165	71	.	.	PROPN
ahs-14952	165	72	,	,	PUNCT
ahs-14952	165	73	2017	2017	NUM
ahs-14952	165	74	)	)	PUNCT
ahs-14952	165	75	.	.	PUNCT
ahs-14952	166	1	a	a	DET
ahs-14952	166	2	variety	variety	NOUN
ahs-14952	166	3	of	of	ADP
ahs-14952	166	4	methodologies	methodology	NOUN
ahs-14952	166	5	have	have	AUX
ahs-14952	166	6	been	be	AUX
ahs-14952	166	7	devised	devise	VERB
ahs-14952	166	8	to	to	PART
ahs-14952	166	9	isolate	isolate	VERB
ahs-14952	166	10	dna	dna	NOUN
ahs-14952	166	11	from	from	ADP
ahs-14952	166	12	fungal	fungal	ADJ
ahs-14952	166	13	tissues	tissue	NOUN
ahs-14952	166	14	,	,	PUNCT
ahs-14952	166	15	and	and	CCONJ
ahs-14952	166	16	the	the	DET
ahs-14952	166	17	most	most	ADV
ahs-14952	166	18	efficacious	efficacious	ADJ
ahs-14952	166	19	dna	dna	NOUN
ahs-14952	166	20	extraction	extraction	NOUN
ahs-14952	166	21	procedures	procedure	NOUN
ahs-14952	166	22	frequently	frequently	ADV
ahs-14952	166	23	integrate	integrate	VERB
ahs-14952	166	24	physical	physical	ADJ
ahs-14952	166	25	methodologies	methodology	NOUN
ahs-14952	166	26	(	(	PUNCT
ahs-14952	166	27	such	such	ADJ
ahs-14952	166	28	as	as	ADP
ahs-14952	166	29	microwave	microwave	NOUN
ahs-14952	166	30	treatment	treatment	NOUN
ahs-14952	166	31	,	,	PUNCT
ahs-14952	166	32	freeze	freeze	NOUN
ahs-14952	166	33	/	/	SYM
ahs-14952	166	34	thaw	thaw	NOUN
ahs-14952	166	35	cycles	cycle	NOUN
ahs-14952	166	36	,	,	PUNCT
ahs-14952	166	37	homogenization	homogenization	NOUN
ahs-14952	166	38	using	use	VERB
ahs-14952	166	39	glass	glass	NOUN
ahs-14952	166	40	beads	bead	NOUN
ahs-14952	166	41	,	,	PUNCT
ahs-14952	166	42	and	and	CCONJ
ahs-14952	166	43	grinding	grind	VERB
ahs-14952	166	44	in	in	ADP
ahs-14952	166	45	liquid	liquid	ADJ
ahs-14952	166	46	nitrogen	nitrogen	NOUN
ahs-14952	166	47	)	)	PUNCT
ahs-14952	166	48	with	with	ADP
ahs-14952	166	49	enzymatic	enzymatic	ADJ
ahs-14952	166	50	approaches	approach	NOUN
ahs-14952	166	51	(	(	PUNCT
ahs-14952	166	52	including	include	VERB
ahs-14952	166	53	gluconases	gluconase	NOUN
ahs-14952	166	54	,	,	PUNCT
ahs-14952	166	55	chitinases	chitinase	NOUN
ahs-14952	166	56	,	,	PUNCT
ahs-14952	166	57	and	and	CCONJ
ahs-14952	166	58	proteases	protease	NOUN
ahs-14952	166	59	)	)	PUNCT
ahs-14952	167	1	(	(	PUNCT
ahs-14952	167	2	zhang	zhang	X
ahs-14952	167	3	et	et	PROPN
ahs-14952	167	4	al	al	PROPN
ahs-14952	167	5	.	.	PROPN
ahs-14952	167	6	,	,	PUNCT
ahs-14952	167	7	2010	2010	NUM
ahs-14952	167	8	)	)	PUNCT
ahs-14952	167	9	.	.	PUNCT
ahs-14952	168	1	the	the	PRON
ahs-14952	168	2	exists	exist	VERB
ahs-14952	168	3	variety	variety	NOUN
ahs-14952	168	4	of	of	ADP
ahs-14952	168	5	ways	way	NOUN
ahs-14952	168	6	for	for	ADP
ahs-14952	168	7	extracting	extract	VERB
ahs-14952	168	8	dna	dna	NOUN
ahs-14952	168	9	and	and	CCONJ
ahs-14952	168	10	among	among	ADP
ahs-14952	168	11	them	they	PRON
ahs-14952	168	12	,	,	PUNCT
ahs-14952	168	13	the	the	DET
ahs-14952	168	14	ctab	ctab	ADJ
ahs-14952	168	15	approach	approach	NOUN
ahs-14952	168	16	(	(	PUNCT
ahs-14952	168	17	gardes	garde	NOUN
ahs-14952	168	18	and	and	CCONJ
ahs-14952	168	19	bruns	brun	NOUN
ahs-14952	168	20	,	,	PUNCT
ahs-14952	168	21	1993	1993	NUM
ahs-14952	168	22	)	)	PUNCT
ahs-14952	168	23	is	be	AUX
ahs-14952	168	24	frequently	frequently	ADV
ahs-14952	168	25	utilised	utilise	VERB
ahs-14952	168	26	.	.	PUNCT
ahs-14952	169	1	additional	additional	ADJ
ahs-14952	169	2	alternatives	alternative	NOUN
ahs-14952	169	3	for	for	ADP
ahs-14952	169	4	fungal	fungal	ADJ
ahs-14952	169	5	genomic	genomic	NOUN
ahs-14952	169	6	dna	dna	PROPN
ahs-14952	169	7	isolation	isolation	NOUN
ahs-14952	169	8	kits	kit	NOUN
ahs-14952	169	9	are	be	AUX
ahs-14952	169	10	the	the	DET
ahs-14952	169	11	omega	omega	NOUN
ahs-14952	169	12	fungal	fungal	ADJ
ahs-14952	169	13	e.z.n.a	e.z.n.a	PROPN
ahs-14952	169	14	kit	kit	NOUN
ahs-14952	169	15	(	(	PUNCT
ahs-14952	169	16	manufactured	manufacture	VERB
ahs-14952	169	17	by	by	ADP
ahs-14952	169	18	omega	omega	NOUN
ahs-14952	169	19	biotech	biotech	NOUN
ahs-14952	169	20	,	,	PUNCT
ahs-14952	169	21	doraville	doraville	PROPN
ahs-14952	169	22	,	,	PUNCT
ahs-14952	169	23	ga	ga	PROPN
ahs-14952	169	24	,	,	PUNCT
ahs-14952	169	25	usa	usa	PROPN
ahs-14952	169	26	)	)	PUNCT
ahs-14952	169	27	,	,	PUNCT
ahs-14952	169	28	the	the	DET
ahs-14952	169	29	qiagen	qiagen	NOUN
ahs-14952	169	30	plant	plant	NOUN
ahs-14952	169	31	dneasy	dneasy	PROPN
ahs-14952	169	32	kit	kit	PROPN
ahs-14952	169	33	,	,	PUNCT
ahs-14952	169	34	genomic	genomic	NOUN
ahs-14952	169	35	tip	tip	NOUN
ahs-14952	169	36	kits	kit	NOUN
ahs-14952	169	37	(	(	PUNCT
ahs-14952	169	38	qiagen	qiagen	PROPN
ahs-14952	169	39	,	,	PUNCT
ahs-14952	169	40	valencia	valencia	PROPN
ahs-14952	169	41	,	,	PUNCT
ahs-14952	169	42	cam	cam	PROPN
ahs-14952	169	43	usa	usa	PROPN
ahs-14952	169	44	)	)	PUNCT
ahs-14952	169	45	,	,	PUNCT
ahs-14952	169	46	or	or	CCONJ
ahs-14952	169	47	sangin	sangin	VERB
ahs-14952	169	48	biotech	biotech	ADJ
ahs-14952	169	49	rapid	rapid	ADJ
ahs-14952	169	50	fungi	fungi	NOUN
ahs-14952	169	51	genomic	genomic	NOUN
ahs-14952	169	52	dna	dna	NOUN
ahs-14952	169	53	isolation	isolation	NOUN
ahs-14952	169	54	kits	kit	NOUN
ahs-14952	169	55	(	(	PUNCT
ahs-14952	169	56	long	long	ADV
ahs-14952	169	57	et	et	PROPN
ahs-14952	169	58	al	al	PROPN
ahs-14952	169	59	.	.	PROPN
ahs-14952	169	60	,	,	PUNCT
ahs-14952	169	61	2022	2022	NUM
ahs-14952	169	62	)	)	PUNCT
ahs-14952	169	63	.	.	PUNCT
ahs-14952	170	1	in	in	ADP
ahs-14952	170	2	order	order	NOUN
ahs-14952	170	3	to	to	PART
ahs-14952	170	4	ascertain	ascertain	VERB
ahs-14952	170	5	the	the	DET
ahs-14952	170	6	effectiveness	effectiveness	NOUN
ahs-14952	170	7	of	of	ADP
ahs-14952	170	8	a	a	DET
ahs-14952	170	9	dna	dna	PROPN
ahs-14952	170	10	extraction	extraction	NOUN
ahs-14952	170	11	technique	technique	NOUN
ahs-14952	170	12	,	,	PUNCT
ahs-14952	170	13	it	it	PRON
ahs-14952	170	14	is	be	AUX
ahs-14952	170	15	important	important	ADJ
ahs-14952	170	16	to	to	PART
ahs-14952	170	17	evaluate	evaluate	VERB
ahs-14952	170	18	both	both	PRON
ahs-14952	170	19	the	the	DET
ahs-14952	170	20	quality	quality	NOUN
ahs-14952	170	21	and	and	CCONJ
ahs-14952	170	22	quantity	quantity	NOUN
ahs-14952	170	23	of	of	ADP
ahs-14952	170	24	the	the	DET
ahs-14952	170	25	dna	dna	PROPN
ahs-14952	170	26	obtained	obtain	VERB
ahs-14952	170	27	.	.	PUNCT
ahs-14952	171	1	the	the	DET
ahs-14952	171	2	concentration	concentration	NOUN
ahs-14952	171	3	of	of	ADP
ahs-14952	171	4	dna	dna	PROPN
ahs-14952	171	5	in	in	ADP
ahs-14952	171	6	the	the	DET
ahs-14952	171	7	samples	sample	NOUN
ahs-14952	171	8	was	be	AUX
ahs-14952	171	9	assessed	assess	VERB
ahs-14952	171	10	by	by	ADP
ahs-14952	171	11	employing	employ	VERB
ahs-14952	171	12	spectrophotometry	spectrophotometry	NOUN
ahs-14952	171	13	at	at	ADP
ahs-14952	171	14	wavelength	wavelength	NOUN
ahs-14952	171	15	of	of	ADP
ahs-14952	171	16	260	260	NUM
ahs-14952	171	17	nm	nm	NOUN
ahs-14952	171	18	,	,	PUNCT
ahs-14952	171	19	with	with	ADP
ahs-14952	171	20	measurement	measurement	NOUN
ahs-14952	171	21	expressed	express	VERB
ahs-14952	171	22	in	in	ADP
ahs-14952	171	23	units	unit	NOUN
ahs-14952	171	24	of	of	ADP
ahs-14952	171	25	nanograms	nanogram	NOUN
ahs-14952	171	26	per	per	ADP
ahs-14952	171	27	microliter	microliter	NOUN
ahs-14952	171	28	(	(	PUNCT
ahs-14952	171	29	ng/µl	ng/µl	NUM
ahs-14952	171	30	)	)	PUNCT
ahs-14952	171	31	.	.	PUNCT
ahs-14952	172	1	in	in	ADP
ahs-14952	172	2	addition	addition	NOUN
ahs-14952	172	3	,	,	PUNCT
ahs-14952	172	4	the	the	DET
ahs-14952	172	5	assessment	assessment	NOUN
ahs-14952	172	6	of	of	ADP
ahs-14952	172	7	dna	dna	PROPN
ahs-14952	172	8	purity	purity	NOUN
ahs-14952	172	9	was	be	AUX
ahs-14952	172	10	conducted	conduct	VERB
ahs-14952	172	11	by	by	ADP
ahs-14952	172	12	determining	determine	VERB
ahs-14952	172	13	the	the	DET
ahs-14952	172	14	a260	a260	PROPN
ahs-14952	172	15	/	/	SYM
ahs-14952	172	16	a280	a280	PROPN
ahs-14952	172	17	ratio	ratio	NOUN
ahs-14952	172	18	and	and	CCONJ
ahs-14952	172	19	a260/280	a260/280	NOUN
ahs-14952	172	20	ratio	ratio	NOUN
ahs-14952	172	21	utilising	utilise	VERB
ahs-14952	172	22	either	either	CCONJ
ahs-14952	172	23	a	a	DET
ahs-14952	172	24	uv­vis	uv­vi	VERB
ahs-14952	172	25	spectrophotometer	spectrophotometer	NOUN
ahs-14952	172	26	or	or	CCONJ
ahs-14952	172	27	nanodrop	nanodrop	NOUN
ahs-14952	172	28	devise	devise	NOUN
ahs-14952	172	29	(	(	PUNCT
ahs-14952	172	30	thermo	thermo	NOUN
ahs-14952	172	31	electron	electron	NOUN
ahs-14952	172	32	scientific	scientific	PROPN
ahs-14952	172	33	instruments	instrument	NOUN
ahs-14952	172	34	llc	llc	PROPN
ahs-14952	172	35	,	,	PUNCT
ahs-14952	172	36	usa	usa	PROPN
ahs-14952	172	37	)	)	PUNCT
ahs-14952	172	38	.	.	PUNCT
ahs-14952	173	1	generally	generally	ADV
ahs-14952	173	2	,	,	PUNCT
ahs-14952	173	3	the	the	DET
ahs-14952	173	4	a260	a260	PROPN
ahs-14952	173	5	/	/	SYM
ahs-14952	173	6	a280	a280	PROPN
ahs-14952	173	7	ratio	ratio	NOUN
ahs-14952	173	8	exceeded	exceed	VERB
ahs-14952	173	9	1.8	1.8	NUM
ahs-14952	173	10	suggesting	suggest	VERB
ahs-14952	173	11	that	that	SCONJ
ahs-14952	173	12	the	the	DET
ahs-14952	173	13	dna	dna	PROPN
ahs-14952	173	14	was	be	AUX
ahs-14952	173	15	largely	largely	ADV
ahs-14952	173	16	devoid	devoid	ADJ
ahs-14952	173	17	of	of	ADP
ahs-14952	173	18	proteins	protein	NOUN
ahs-14952	173	19	.	.	PUNCT
ahs-14952	174	1	in	in	ADP
ahs-14952	174	2	terms	term	NOUN
ahs-14952	174	3	of	of	ADP
ahs-14952	174	4	the	the	DET
ahs-14952	174	5	a260	a260	PROPN
ahs-14952	174	6	/	/	SYM
ahs-14952	174	7	a230	a230	PROPN
ahs-14952	174	8	ratio	ratio	NOUN
ahs-14952	174	9	,	,	PUNCT
ahs-14952	174	10	if	if	SCONJ
ahs-14952	174	11	it	it	PRON
ahs-14952	174	12	was	be	AUX
ahs-14952	174	13	approximately	approximately	ADV
ahs-14952	174	14	2	2	NUM
ahs-14952	174	15	,	,	PUNCT
ahs-14952	174	16	that	that	PRON
ahs-14952	174	17	indicate	indicate	VERB
ahs-14952	174	18	the	the	DET
ahs-14952	174	19	samples	sample	NOUN
ahs-14952	174	20	did	do	AUX
ahs-14952	174	21	not	not	PART
ahs-14952	174	22	contain	contain	VERB
ahs-14952	174	23	significant	significant	ADJ
ahs-14952	174	24	impurities	impurity	NOUN
ahs-14952	174	25	such	such	ADJ
ahs-14952	174	26	as	as	ADP
ahs-14952	174	27	carbohydrates	carbohydrate	NOUN
ahs-14952	174	28	,	,	PUNCT
ahs-14952	174	29	peptides	peptide	NOUN
ahs-14952	174	30	,	,	PUNCT
ahs-14952	174	31	phenols	phenol	NOUN
ahs-14952	174	32	,	,	PUNCT
ahs-14952	174	33	salts	salt	NOUN
ahs-14952	174	34	,	,	PUNCT
ahs-14952	174	35	or	or	CCONJ
ahs-14952	174	36	aromatic	aromatic	ADJ
ahs-14952	174	37	compounds	compound	NOUN
ahs-14952	174	38	(	(	PUNCT
ahs-14952	174	39	turzhanova	turzhanova	X
ahs-14952	174	40	et	et	PROPN
ahs-14952	174	41	al	al	PROPN
ahs-14952	174	42	.	.	PROPN
ahs-14952	174	43	,	,	PUNCT
ahs-14952	174	44	2018	2018	NUM
ahs-14952	174	45	)	)	PUNCT
ahs-14952	174	46	.	.	PUNCT
ahs-14952	175	1	furthermore	furthermore	ADV
ahs-14952	175	2	,	,	PUNCT
ahs-14952	175	3	the	the	DET
ahs-14952	175	4	quality	quality	NOUN
ahs-14952	175	5	of	of	ADP
ahs-14952	175	6	the	the	DET
ahs-14952	175	7	dna	dna	PROPN
ahs-14952	175	8	also	also	ADV
ahs-14952	175	9	can	can	AUX
ahs-14952	175	10	be	be	AUX
ahs-14952	175	11	evaluated	evaluate	VERB
ahs-14952	175	12	through	through	ADP
ahs-14952	175	13	adv	adv	PROPN
ahs-14952	175	14	.	.	PUNCT
ahs-14952	175	15	hort	hort	PROPN
ahs-14952	175	16	.	.	PUNCT
ahs-14952	176	1	sci	sci	PROPN
ahs-14952	176	2	.	.	PROPN
ahs-14952	176	3	,	,	PUNCT
ahs-14952	176	4	2024	2024	NUM
ahs-14952	176	5	38(1	38(1	NOUN
ahs-14952	176	6	):	):	PUNCT
ahs-14952	176	7	97­116	97­116	NUM
ahs-14952	176	8	104	104	NUM
ahs-14952	176	9	electrophoresis	electrophoresis	NOUN
ahs-14952	176	10	after	after	ADP
ahs-14952	176	11	pcr	pcr	ADJ
ahs-14952	176	12	amplification	amplification	NOUN
ahs-14952	176	13	of	of	ADP
ahs-14952	176	14	the	the	DET
ahs-14952	176	15	genomic	genomic	NOUN
ahs-14952	176	16	dna	dna	NOUN
ahs-14952	176	17	,	,	PUNCT
ahs-14952	176	18	using	use	VERB
ahs-14952	176	19	gene­specific	gene­specific	ADJ
ahs-14952	176	20	primers	primer	NOUN
ahs-14952	176	21	(	(	PUNCT
ahs-14952	176	22	tripathy	tripathy	NOUN
ahs-14952	176	23	et	et	PROPN
ahs-14952	176	24	al	al	PROPN
ahs-14952	176	25	.	.	PROPN
ahs-14952	176	26	,	,	PUNCT
ahs-14952	176	27	2017	2017	NUM
ahs-14952	176	28	)	)	PUNCT
ahs-14952	176	29	.	.	PUNCT
ahs-14952	177	1	the	the	DET
ahs-14952	177	2	standard	standard	ADJ
ahs-14952	177	3	ctab	ctab	ADJ
ahs-14952	177	4	phenol­chloroform	phenol­chloroform	NOUN
ahs-14952	177	5	extraction	extraction	NOUN
ahs-14952	177	6	procedure	procedure	NOUN
ahs-14952	177	7	has	have	AUX
ahs-14952	177	8	proven	prove	VERB
ahs-14952	177	9	effective	effective	ADJ
ahs-14952	177	10	across	across	ADP
ahs-14952	177	11	a	a	DET
ahs-14952	177	12	wide	wide	ADJ
ahs-14952	177	13	range	range	NOUN
ahs-14952	177	14	of	of	ADP
ahs-14952	177	15	species	specie	NOUN
ahs-14952	177	16	(	(	PUNCT
ahs-14952	177	17	strugnell	strugnell	NOUN
ahs-14952	177	18	et	et	PROPN
ahs-14952	177	19	al	al	PROPN
ahs-14952	177	20	.	.	PROPN
ahs-14952	177	21	,	,	PUNCT
ahs-14952	177	22	2006	2006	NUM
ahs-14952	177	23	;	;	PUNCT
ahs-14952	177	24	reineke	reineke	PROPN
ahs-14952	177	25	et	et	PROPN
ahs-14952	177	26	al	al	PROPN
ahs-14952	177	27	.	.	PROPN
ahs-14952	177	28	,	,	PUNCT
ahs-14952	177	29	1998	1998	NUM
ahs-14952	177	30	)	)	PUNCT
ahs-14952	177	31	and	and	CCONJ
ahs-14952	177	32	produce	produce	VERB
ahs-14952	177	33	a	a	DET
ahs-14952	177	34	high	high	ADJ
ahs-14952	177	35	purity	purity	NOUN
ahs-14952	177	36	of	of	ADP
ahs-14952	177	37	dna	dna	PROPN
ahs-14952	177	38	(	(	PUNCT
ahs-14952	177	39	zettler	zettler	NOUN
ahs-14952	177	40	and	and	CCONJ
ahs-14952	177	41	corey	corey	PROPN
ahs-14952	177	42	2018	2018	NUM
ahs-14952	177	43	)	)	PUNCT
ahs-14952	177	44	.	.	PUNCT
ahs-14952	178	1	study	study	NOUN
ahs-14952	178	2	by	by	ADP
ahs-14952	178	3	turzhanova	turzhanova	PROPN
ahs-14952	178	4	et	et	PROPN
ahs-14952	178	5	al	al	PROPN
ahs-14952	178	6	.	.	PROPN
ahs-14952	179	1	(	(	PUNCT
ahs-14952	179	2	2018	2018	NUM
ahs-14952	179	3	)	)	PUNCT
ahs-14952	179	4	on	on	ADP
ahs-14952	179	5	optimization	optimization	NOUN
ahs-14952	179	6	of	of	ADP
ahs-14952	179	7	dna	dna	PROPN
ahs-14952	179	8	extraction	extraction	NOUN
ahs-14952	179	9	methods	method	NOUN
ahs-14952	179	10	of	of	ADP
ahs-14952	179	11	fungi	fungi	PROPN
ahs-14952	179	12	has	have	AUX
ahs-14952	179	13	shown	show	VERB
ahs-14952	179	14	that	that	PRON
ahs-14952	179	15	ctab­method	ctab­method	NOUN
ahs-14952	179	16	and	and	CCONJ
ahs-14952	179	17	dneasy	dneasy	NOUN
ahs-14952	179	18	plant	plant	NOUN
ahs-14952	179	19	mini	mini	NOUN
ahs-14952	179	20	kit	kit	NOUN
ahs-14952	179	21	(	(	PUNCT
ahs-14952	179	22	qiagen	qiagen	PROPN
ahs-14952	179	23	)	)	PUNCT
ahs-14952	179	24	resulted	result	VERB
ahs-14952	179	25	a	a	DET
ahs-14952	179	26	highest	high	ADJ
ahs-14952	179	27	dna	dna	NOUN
ahs-14952	179	28	quality	quality	NOUN
ahs-14952	179	29	,	,	PUNCT
ahs-14952	179	30	while	while	SCONJ
ahs-14952	179	31	sds	sds	PROPN
ahs-14952	179	32	method	method	NOUN
ahs-14952	179	33	resulted	result	VERB
ahs-14952	179	34	in	in	ADP
ahs-14952	179	35	the	the	DET
ahs-14952	179	36	lowest	low	ADJ
ahs-14952	179	37	sample	sample	NOUN
ahs-14952	179	38	yields	yield	NOUN
ahs-14952	179	39	and	and	CCONJ
ahs-14952	179	40	quality	quality	NOUN
ahs-14952	179	41	.	.	PUNCT
ahs-14952	180	1	however	however	ADV
ahs-14952	180	2	,	,	PUNCT
ahs-14952	180	3	ctab­method	ctab­method	NOUN
ahs-14952	180	4	uses	use	VERB
ahs-14952	180	5	toxic	toxic	ADJ
ahs-14952	180	6	chemicals	chemical	NOUN
ahs-14952	180	7	and	and	CCONJ
ahs-14952	180	8	requires	require	VERB
ahs-14952	180	9	a	a	DET
ahs-14952	180	10	significant	significant	ADJ
ahs-14952	180	11	amount	amount	NOUN
ahs-14952	180	12	of	of	ADP
ahs-14952	180	13	bench	bench	NOUN
ahs-14952	180	14	time	time	NOUN
ahs-14952	180	15	,	,	PUNCT
ahs-14952	180	16	both	both	PRON
ahs-14952	180	17	limiting	limit	VERB
ahs-14952	180	18	its	its	PRON
ahs-14952	180	19	applicability	applicability	NOUN
ahs-14952	180	20	when	when	SCONJ
ahs-14952	180	21	scaling	scale	VERB
ahs-14952	180	22	up	up	ADP
ahs-14952	180	23	for	for	ADP
ahs-14952	180	24	big	big	ADJ
ahs-14952	180	25	comparative	comparative	ADJ
ahs-14952	180	26	research	research	NOUN
ahs-14952	180	27	(	(	PUNCT
ahs-14952	180	28	schiebelhut	schiebelhut	PROPN
ahs-14952	180	29	et	et	PROPN
ahs-14952	180	30	al	al	PROPN
ahs-14952	180	31	.	.	PROPN
ahs-14952	180	32	,	,	PUNCT
ahs-14952	180	33	2017	2017	NUM
ahs-14952	180	34	)	)	PUNCT
ahs-14952	180	35	.	.	PUNCT
ahs-14952	181	1	nowadays	nowadays	ADV
ahs-14952	181	2	,	,	PUNCT
ahs-14952	181	3	commercial	commercial	ADJ
ahs-14952	181	4	dna	dna	NOUN
ahs-14952	181	5	extraction	extraction	NOUN
ahs-14952	181	6	kits	kit	NOUN
ahs-14952	181	7	are	be	AUX
ahs-14952	181	8	more	more	ADV
ahs-14952	181	9	desirable	desirable	ADJ
ahs-14952	181	10	since	since	SCONJ
ahs-14952	181	11	they	they	PRON
ahs-14952	181	12	reduce	reduce	VERB
ahs-14952	181	13	exposure	exposure	NOUN
ahs-14952	181	14	to	to	ADP
ahs-14952	181	15	toxic	toxic	ADJ
ahs-14952	181	16	chemicals	chemical	NOUN
ahs-14952	181	17	and	and	CCONJ
ahs-14952	181	18	allow	allow	VERB
ahs-14952	181	19	for	for	ADP
ahs-14952	181	20	faster	fast	ADJ
ahs-14952	181	21	extraction	extraction	NOUN
ahs-14952	181	22	periods	period	NOUN
ahs-14952	181	23	.	.	PUNCT
ahs-14952	182	1	these	these	DET
ahs-14952	182	2	kits	kit	NOUN
ahs-14952	182	3	could	could	AUX
ahs-14952	182	4	offer	offer	VERB
ahs-14952	182	5	a	a	DET
ahs-14952	182	6	range	range	NOUN
ahs-14952	182	7	of	of	ADP
ahs-14952	182	8	low­	low­	NOUN
ahs-14952	182	9	to	to	ADP
ahs-14952	182	10	high­	high­	PROPN
ahs-14952	182	11	throughput	throughput	NOUN
ahs-14952	182	12	processing	processing	NOUN
ahs-14952	182	13	,	,	PUNCT
ahs-14952	182	14	vary	vary	VERB
ahs-14952	182	15	in	in	ADP
ahs-14952	182	16	price	price	NOUN
ahs-14952	182	17	from	from	ADP
ahs-14952	182	18	quite	quite	ADV
ahs-14952	182	19	inexpensive	inexpensive	ADJ
ahs-14952	182	20	to	to	ADP
ahs-14952	182	21	highly	highly	ADV
ahs-14952	182	22	costly	costly	ADJ
ahs-14952	182	23	,	,	PUNCT
ahs-14952	182	24	and	and	CCONJ
ahs-14952	182	25	may	may	AUX
ahs-14952	182	26	require	require	VERB
ahs-14952	182	27	some	some	DET
ahs-14952	182	28	specialist	specialist	ADJ
ahs-14952	182	29	gear	gear	NOUN
ahs-14952	182	30	.	.	PUNCT
ahs-14952	183	1	table	table	NOUN
ahs-14952	183	2	2	2	NUM
ahs-14952	183	3	below	below	ADV
ahs-14952	183	4	shows	show	VERB
ahs-14952	183	5	a	a	DET
ahs-14952	183	6	l	l	NOUN
ahs-14952	183	7	ist	ist	NOUN
ahs-14952	183	8	of	of	ADP
ahs-14952	183	9	extraction	extraction	NOUN
ahs-14952	183	10	methods	method	NOUN
ahs-14952	183	11	and	and	CCONJ
ahs-14952	183	12	kits	kit	NOUN
ahs-14952	183	13	used	use	VERB
ahs-14952	183	14	in	in	ADP
ahs-14952	183	15	the	the	DET
ahs-14952	183	16	extraction	extraction	NOUN
ahs-14952	183	17	method	method	NOUN
ahs-14952	183	18	of	of	ADP
ahs-14952	183	19	dna	dna	PROPN
ahs-14952	183	20	orchid	orchid	NOUN
ahs-14952	183	21	fungi	fungi	PROPN
ahs-14952	183	22	.	.	PUNCT
ahs-14952	184	1	a	a	DET
ahs-14952	184	2	large	large	ADJ
ahs-14952	184	3	percentage	percentage	NOUN
ahs-14952	184	4	of	of	ADP
ahs-14952	184	5	orchid	orchid	NOUN
ahs-14952	184	6	mycorrhizal	mycorrhizal	NOUN
ahs-14952	184	7	fungi	fungus	NOUN
ahs-14952	184	8	are	be	AUX
ahs-14952	184	9	mycelia	mycelia	NOUN
ahs-14952	184	10	sterilia	sterilia	NOUN
ahs-14952	184	11	.	.	PUNCT
ahs-14952	185	1	conventional	conventional	ADJ
ahs-14952	185	2	techniques	technique	NOUN
ahs-14952	185	3	have	have	AUX
ahs-14952	185	4	led	lead	VERB
ahs-14952	185	5	to	to	ADP
ahs-14952	185	6	a	a	DET
ahs-14952	185	7	paraphyletic	paraphyletic	ADJ
ahs-14952	185	8	taxonomy	taxonomy	NOUN
ahs-14952	185	9	in	in	ADP
ahs-14952	185	10	which	which	PRON
ahs-14952	185	11	unrelated	unrelated	ADJ
ahs-14952	185	12	fungi	fungus	NOUN
ahs-14952	185	13	are	be	AUX
ahs-14952	185	14	grouped	group	VERB
ahs-14952	185	15	together	together	ADV
ahs-14952	185	16	,	,	PUNCT
ahs-14952	185	17	requiring	require	VERB
ahs-14952	185	18	molecular	molecular	ADJ
ahs-14952	185	19	techniques	technique	NOUN
ahs-14952	185	20	for	for	ADP
ahs-14952	185	21	accurate	accurate	ADJ
ahs-14952	185	22	identification	identification	NOUN
ahs-14952	185	23	,	,	PUNCT
ahs-14952	185	24	phylogenetic	phylogenetic	ADJ
ahs-14952	185	25	inference	inference	NOUN
ahs-14952	185	26	,	,	PUNCT
ahs-14952	185	27	and	and	CCONJ
ahs-14952	185	28	genetic	genetic	ADJ
ahs-14952	185	29	relatedness	relatedness	NOUN
ahs-14952	185	30	(	(	PUNCT
ahs-14952	185	31	sen	sen	PROPN
ahs-14952	185	32	et	et	PROPN
ahs-14952	185	33	al	al	PROPN
ahs-14952	185	34	.	.	PROPN
ahs-14952	185	35	,	,	PUNCT
ahs-14952	185	36	1999	1999	NUM
ahs-14952	185	37	;	;	PUNCT
ahs-14952	185	38	otero	otero	PROPN
ahs-14952	185	39	et	et	PROPN
ahs-14952	185	40	al	al	PROPN
ahs-14952	185	41	.	.	PROPN
ahs-14952	185	42	,	,	PUNCT
ahs-14952	185	43	2002	2002	NUM
ahs-14952	185	44	;	;	PUNCT
ahs-14952	185	45	shan	shan	PROPN
ahs-14952	185	46	et	et	PROPN
ahs-14952	185	47	al	al	PROPN
ahs-14952	185	48	.	.	PROPN
ahs-14952	185	49	,	,	PUNCT
ahs-14952	185	50	2002	2002	NUM
ahs-14952	185	51	;	;	PUNCT
ahs-14952	185	52	yagame	yagame	PROPN
ahs-14952	185	53	et	et	PROPN
ahs-14952	185	54	al	al	PROPN
ahs-14952	185	55	.	.	PROPN
ahs-14952	185	56	,	,	PUNCT
ahs-14952	185	57	2008	2008	NUM
ahs-14952	185	58	)	)	PUNCT
ahs-14952	185	59	.	.	PUNCT
ahs-14952	186	1	molecular	molecular	ADJ
ahs-14952	186	2	sequencing	sequencing	NOUN
ahs-14952	186	3	,	,	PUNCT
ahs-14952	186	4	microscopic	microscopic	ADJ
ahs-14952	186	5	examination	examination	NOUN
ahs-14952	186	6	,	,	PUNCT
ahs-14952	186	7	and	and	CCONJ
ahs-14952	186	8	biochemical	biochemical	ADJ
ahs-14952	186	9	analysis	analysis	NOUN
ahs-14952	186	10	were	be	AUX
ahs-14952	186	11	among	among	ADP
ahs-14952	186	12	the	the	DET
ahs-14952	186	13	most	most	ADV
ahs-14952	186	14	used	use	VERB
ahs-14952	186	15	methods	method	NOUN
ahs-14952	186	16	to	to	PART
ahs-14952	186	17	identify	identify	VERB
ahs-14952	186	18	mycorrhizal	mycorrhizal	NOUN
ahs-14952	186	19	fungi	fungus	NOUN
ahs-14952	186	20	.	.	PUNCT
ahs-14952	187	1	for	for	ADP
ahs-14952	187	2	fungi	fungus	NOUN
ahs-14952	187	3	identification	identification	NOUN
ahs-14952	187	4	by	by	ADP
ahs-14952	187	5	morphological	morphological	ADJ
ahs-14952	187	6	characterisation	characterisation	NOUN
ahs-14952	187	7	,	,	PUNCT
ahs-14952	187	8	it	it	PRON
ahs-14952	187	9	table	table	VERB
ahs-14952	187	10	2	2	NUM
ahs-14952	187	11	­	­	NOUN
ahs-14952	187	12	types	type	NOUN
ahs-14952	187	13	of	of	ADP
ahs-14952	187	14	manual	manual	ADJ
ahs-14952	187	15	dna	dna	NOUN
ahs-14952	187	16	extraction	extraction	NOUN
ahs-14952	187	17	protocol	protocol	NOUN
ahs-14952	187	18	used	use	VERB
ahs-14952	187	19	to	to	PART
ahs-14952	187	20	extract	extract	VERB
ahs-14952	187	21	mycorrhizal	mycorrhizal	NOUN
ahs-14952	187	22	fungi	fungus	NOUN
ahs-14952	187	23	dna	dna	PROPN
ahs-14952	187	24	*	*	PUNCT
ahs-14952	187	25	modified	modify	VERB
ahs-14952	187	26	method	method	NOUN
ahs-14952	187	27	.	.	PUNCT
ahs-14952	188	1	protocol	protocol	NOUN
ahs-14952	188	2	name	name	NOUN
ahs-14952	188	3	abbreviation	abbreviation	NOUN
ahs-14952	188	4	chemistry	chemistry	NOUN
ahs-14952	188	5	/	/	SYM
ahs-14952	188	6	mechanism	mechanism	NOUN
ahs-14952	188	7	kits	kit	NOUN
ahs-14952	188	8	/	/	SYM
ahs-14952	188	9	supplies	supply	NOUN
ahs-14952	188	10	required	require	VERB
ahs-14952	188	11	dna	dna	PROPN
ahs-14952	188	12	extraction	extraction	NOUN
ahs-14952	188	13	time	time	NOUN
ahs-14952	188	14	references	reference	NOUN
ahs-14952	188	15	cetytrimethyl	cetytrimethyl	NOUN
ahs-14952	188	16	ammo­	ammo­	PRON
ahs-14952	188	17	nium	nium	NOUN
ahs-14952	188	18	bromide	bromide	NOUN
ahs-14952	188	19	(	(	PUNCT
ahs-14952	188	20	ctab)­	ctab)­	NOUN
ahs-14952	188	21	phenol­chloroform	phenol­chloroform	NOUN
ahs-14952	188	22	ctab	ctab	PROPN
ahs-14952	188	23	ctab	ctab	NOUN
ahs-14952	188	24	lysis	lysis	NOUN
ahs-14952	188	25	,	,	PUNCT
ahs-14952	188	26	followed	follow	VERB
ahs-14952	188	27	by	by	ADP
ahs-14952	188	28	phenol	phenol	ADJ
ahs-14952	188	29	chloroform	chloroform	NOUN
ahs-14952	188	30	purification	purification	NOUN
ahs-14952	188	31	step	step	NOUN
ahs-14952	188	32	all	all	DET
ahs-14952	188	33	reagents	reagent	NOUN
ahs-14952	188	34	are	be	AUX
ahs-14952	188	35	made	make	VERB
ahs-14952	188	36	in­house	in­house	ADP
ahs-14952	188	37	1	1	NUM
ahs-14952	188	38	hour	hour	NOUN
ahs-14952	188	39	30	30	NUM
ahs-14952	188	40	min	min	NOUN
ahs-14952	188	41	sambrook	sambrook	PROPN
ahs-14952	188	42	et	et	PROPN
ahs-14952	188	43	al	al	PROPN
ahs-14952	188	44	.	.	PROPN
ahs-14952	189	1	(	(	PUNCT
ahs-14952	189	2	2001	2001	NUM
ahs-14952	189	3	)	)	PUNCT
ahs-14952	189	4	;	;	PUNCT
ahs-14952	190	1	dawson	dawson	PROPN
ahs-14952	190	2	et	et	PROPN
ahs-14952	190	3	al	al	PROPN
ahs-14952	190	4	.	.	PROPN
ahs-14952	191	1	(	(	PUNCT
ahs-14952	191	2	1998	1998	NUM
ahs-14952	191	3	)	)	PUNCT
ahs-14952	191	4	sodium	sodium	NOUN
ahs-14952	191	5	dodecyl	dodecyl	PROPN
ahs-14952	191	6	sulfate	sulfate	VERB
ahs-14952	191	7	sds	sds	PROPN
ahs-14952	191	8	lysis	lysis	NOUN
ahs-14952	191	9	,	,	PUNCT
ahs-14952	191	10	followed	follow	VERB
ahs-14952	191	11	by	by	ADP
ahs-14952	191	12	phenol	phenol	ADJ
ahs-14952	191	13	chloroform	chloroform	NOUN
ahs-14952	191	14	purification	purification	NOUN
ahs-14952	191	15	step	step	NOUN
ahs-14952	191	16	sds	sds	NOUN
ahs-14952	191	17	and	and	CCONJ
ahs-14952	191	18	mercaptoetha­	mercaptoetha­	PROPN
ahs-14952	191	19	nol	nol	NOUN
ahs-14952	191	20	lysis	lysis	NOUN
ahs-14952	191	21	,	,	PUNCT
ahs-14952	191	22	followed	follow	VERB
ahs-14952	191	23	by	by	ADP
ahs-14952	191	24	chloroform	chloroform	NOUN
ahs-14952	191	25	purification	purification	NOUN
ahs-14952	191	26	step	step	NOUN
ahs-14952	191	27	all	all	DET
ahs-14952	191	28	reagents	reagent	NOUN
ahs-14952	191	29	are	be	AUX
ahs-14952	191	30	made	make	VERB
ahs-14952	191	31	in­house	in­house	AUX
ahs-14952	191	32	1	1	NUM
ahs-14952	191	33	hour	hour	NOUN
ahs-14952	191	34	5	5	NUM
ahs-14952	191	35	min	min	NOUN
ahs-14952	191	36	turzhanova	turzhanova	PROPN
ahs-14952	191	37	et	et	PROPN
ahs-14952	191	38	al	al	PROPN
ahs-14952	191	39	.	.	PROPN
ahs-14952	192	1	(	(	PUNCT
ahs-14952	192	2	2018	2018	NUM
ahs-14952	192	3	)	)	PUNCT
ahs-14952	192	4	phenol	phenol	NOUN
ahs-14952	192	5	chloroform	chloroform	NOUN
ahs-14952	192	6	isoamyl	isoamyl	NOUN
ahs-14952	192	7	alcohol	alcohol	NOUN
ahs-14952	192	8	extraction	extraction	NOUN
ahs-14952	192	9	method	method	NOUN
ahs-14952	192	10	pci	pci	ADJ
ahs-14952	192	11	buffer	buffer	NOUN
ahs-14952	192	12	lysis	lysis	NOUN
ahs-14952	192	13	.	.	PUNCT
ahs-14952	193	1	followed	follow	VERB
ahs-14952	193	2	by	by	ADP
ahs-14952	193	3	phenol	phenol	NOUN
ahs-14952	193	4	/	/	SYM
ahs-14952	193	5	chloroform	chloroform	NOUN
ahs-14952	193	6	/isoamyl	/isoamyl	PUNCT
ahs-14952	193	7	alcohol	alcohol	NOUN
ahs-14952	193	8	purification	purification	NOUN
ahs-14952	193	9	step	step	NOUN
ahs-14952	193	10	all	all	DET
ahs-14952	193	11	reagents	reagent	NOUN
ahs-14952	193	12	are	be	AUX
ahs-14952	193	13	made	make	VERB
ahs-14952	193	14	in­house	in­house	ADJ
ahs-14952	193	15	2	2	NUM
ahs-14952	193	16	hour	hour	NOUN
ahs-14952	193	17	10	10	NUM
ahs-14952	193	18	min	min	NOUN
ahs-14952	193	19	varma	varma	PROPN
ahs-14952	193	20	and	and	CCONJ
ahs-14952	193	21	kwon	kwon	PROPN
ahs-14952	193	22	chung	chung	PROPN
ahs-14952	193	23	(	(	PUNCT
ahs-14952	193	24	1991	1991	NUM
ahs-14952	193	25	)	)	PUNCT
ahs-14952	193	26	ezna	ezna	NOUN
ahs-14952	193	27	sp	sp	ADP
ahs-14952	193	28	fungal	fungal	ADJ
ahs-14952	193	29	dna	dna	NOUN
ahs-14952	193	30	omega	omega	NOUN
ahs-14952	193	31	fungal	fungal	ADJ
ahs-14952	193	32	ezna	ezna	PROPN
ahs-14952	193	33	silica	silica	NOUN
ahs-14952	193	34	based	base	VERB
ahs-14952	193	35	purification	purification	NOUN
ahs-14952	193	36	system	system	NOUN
ahs-14952	193	37	omega	omega	NOUN
ahs-14952	193	38	fungal	fungal	ADJ
ahs-14952	193	39	ezna	ezna	NOUN
ahs-14952	193	40	kit	kit	NOUN
ahs-14952	193	41	(	(	PUNCT
ahs-14952	193	42	omega	omega	NOUN
ahs-14952	193	43	biotek	biotek	NOUN
ahs-14952	193	44	,	,	PUNCT
ahs-14952	193	45	doraville	doraville	PROPN
ahs-14952	193	46	,	,	PUNCT
ahs-14952	193	47	ga	ga	PROPN
ahs-14952	193	48	,	,	PUNCT
ahs-14952	193	49	usa	usa	PROPN
ahs-14952	193	50	)	)	PUNCT
ahs-14952	193	51	45	45	NUM
ahs-14952	193	52	min	min	NOUN
ahs-14952	193	53	omega	omega	NOUN
ahs-14952	193	54	(	(	PUNCT
ahs-14952	193	55	2019	2019	NUM
ahs-14952	193	56	)	)	PUNCT
ahs-14952	193	57	qiamp	qiamp	PROPN
ahs-14952	193	58	mini	mini	NOUN
ahs-14952	193	59	kit	kit	NOUN
ahs-14952	193	60	(	(	PUNCT
ahs-14952	193	61	qiagen	qiagen	PROPN
ahs-14952	193	62	)	)	PUNCT
ahs-14952	193	63	qiaamp	qiaamp	PROPN
ahs-14952	193	64	mini	mini	NOUN
ahs-14952	193	65	kit	kit	NOUN
ahs-14952	193	66	silica	silica	NOUN
ahs-14952	193	67	based	base	VERB
ahs-14952	193	68	purification	purification	NOUN
ahs-14952	193	69	system	system	NOUN
ahs-14952	193	70	qiamp	qiamp	PROPN
ahs-14952	193	71	mini	mini	NOUN
ahs-14952	193	72	kit	kit	NOUN
ahs-14952	193	73	(	(	PUNCT
ahs-14952	193	74	qiagen	qiagen	PROPN
ahs-14952	193	75	)	)	PUNCT
ahs-14952	193	76	35	35	NUM
ahs-14952	193	77	min	min	NOUN
ahs-14952	193	78	turzhanova	turzhanova	NOUN
ahs-14952	193	79	et	et	PROPN
ahs-14952	193	80	al	al	PROPN
ahs-14952	193	81	.	.	PROPN
ahs-14952	194	1	(	(	PUNCT
ahs-14952	194	2	2018	2018	NUM
ahs-14952	194	3	)	)	PUNCT
ahs-14952	194	4	fungi	fungi	PROPN
ahs-14952	194	5	/	/	SYM
ahs-14952	194	6	yeast	yeast	NOUN
ahs-14952	194	7	genomic	genomic	NOUN
ahs-14952	194	8	dna	dna	NOUN
ahs-14952	194	9	isolation	isolation	NOUN
ahs-14952	194	10	(	(	PUNCT
ahs-14952	194	11	norgen	norgen	X
ahs-14952	194	12	)	)	PUNCT
ahs-14952	194	13	*	*	PUNCT
ahs-14952	194	14	fungi	fungi	PROPN
ahs-14952	194	15	/	/	SYM
ahs-14952	194	16	yeast	yeast	NOUN
ahs-14952	194	17	genomic	genomic	NOUN
ahs-14952	194	18	dna	dna	NOUN
ahs-14952	194	19	isolation	isolation	NOUN
ahs-14952	194	20	silica	silica	NOUN
ahs-14952	194	21	based	base	VERB
ahs-14952	194	22	purification	purification	NOUN
ahs-14952	194	23	system	system	NOUN
ahs-14952	194	24	fungi	fungi	NOUN
ahs-14952	194	25	/	/	SYM
ahs-14952	194	26	yeast	yeast	NOUN
ahs-14952	194	27	genomic	genomic	NOUN
ahs-14952	194	28	dna	dna	NOUN
ahs-14952	194	29	isolation	isolation	NOUN
ahs-14952	194	30	kit	kit	NOUN
ahs-14952	194	31	(	(	PUNCT
ahs-14952	194	32	norgen	norgen	ADV
ahs-14952	194	33	)	)	PUNCT
ahs-14952	194	34	more	more	ADJ
ahs-14952	194	35	than	than	ADP
ahs-14952	194	36	2	2	NUM
ahs-14952	194	37	hours	hour	NOUN
ahs-14952	194	38	kumar	kumar	PROPN
ahs-14952	194	39	and	and	CCONJ
ahs-14952	194	40	mugunthan	mugunthan	PROPN
ahs-14952	194	41	(	(	PUNCT
ahs-14952	194	42	2018	2018	NUM
ahs-14952	194	43	)	)	PUNCT
ahs-14952	194	44	shamsudin	shamsudin	VERB
ahs-14952	194	45	et	et	PROPN
ahs-14952	194	46	al	al	PROPN
ahs-14952	194	47	.	.	PROPN
ahs-14952	195	1	‐	‐	ADP
ahs-14952	195	2	molecular	molecular	ADJ
ahs-14952	195	3	identification	identification	NOUN
ahs-14952	195	4	of	of	ADP
ahs-14952	195	5	orchid	orchid	NOUN
ahs-14952	195	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	195	7	105	105	NUM
ahs-14952	195	8	can	can	AUX
ahs-14952	195	9	be	be	AUX
ahs-14952	195	10	conducted	conduct	VERB
ahs-14952	195	11	alone	alone	ADJ
ahs-14952	195	12	or	or	CCONJ
ahs-14952	195	13	in	in	ADP
ahs-14952	195	14	combination	combination	NOUN
ahs-14952	195	15	with	with	ADP
ahs-14952	195	16	molecular	molecular	ADJ
ahs-14952	195	17	analysis	analysis	NOUN
ahs-14952	195	18	,	,	PUNCT
ahs-14952	195	19	and	and	CCONJ
ahs-14952	195	20	usually	usually	ADV
ahs-14952	195	21	,	,	PUNCT
ahs-14952	195	22	most	most	ADJ
ahs-14952	195	23	research	research	NOUN
ahs-14952	195	24	will	will	AUX
ahs-14952	195	25	use	use	VERB
ahs-14952	195	26	both	both	DET
ahs-14952	195	27	combination	combination	NOUN
ahs-14952	195	28	methods	method	NOUN
ahs-14952	195	29	in	in	ADP
ahs-14952	195	30	identifying	identify	VERB
ahs-14952	195	31	mycorrhizal	mycorrhizal	NOUN
ahs-14952	195	32	fungi	fungus	NOUN
ahs-14952	195	33	.	.	PUNCT
ahs-14952	196	1	however	however	ADV
ahs-14952	196	2	,	,	PUNCT
ahs-14952	196	3	the	the	DET
ahs-14952	196	4	orchid	orchid	NOUN
ahs-14952	196	5	fungus	fungus	NOUN
ahs-14952	196	6	is	be	AUX
ahs-14952	196	7	notoriously	notoriously	ADV
ahs-14952	196	8	difficult	difficult	ADJ
ahs-14952	196	9	to	to	PART
ahs-14952	196	10	be	be	AUX
ahs-14952	196	11	determined	determine	VERB
ahs-14952	196	12	at	at	ADP
ahs-14952	196	13	the	the	DET
ahs-14952	196	14	species	species	NOUN
ahs-14952	196	15	level	level	NOUN
ahs-14952	196	16	because	because	SCONJ
ahs-14952	196	17	they	they	PRON
ahs-14952	196	18	do	do	AUX
ahs-14952	196	19	not	not	PART
ahs-14952	196	20	sporulate	sporulate	VERB
ahs-14952	196	21	readily	readily	ADV
ahs-14952	196	22	on	on	ADP
ahs-14952	196	23	cultures	culture	NOUN
ahs-14952	196	24	(	(	PUNCT
ahs-14952	196	25	boddington	boddington	NOUN
ahs-14952	196	26	and	and	CCONJ
ahs-14952	196	27	dearnaley	dearnaley	NOUN
ahs-14952	196	28	,	,	PUNCT
ahs-14952	196	29	2008	2008	NUM
ahs-14952	196	30	;	;	PUNCT
ahs-14952	196	31	ko	ko	PROPN
ahs-14952	196	32	et	et	PROPN
ahs-14952	196	33	al	al	PROPN
ahs-14952	196	34	.	.	PROPN
ahs-14952	196	35	,	,	PUNCT
ahs-14952	196	36	2011	2011	NUM
ahs-14952	196	37	;	;	PUNCT
ahs-14952	196	38	ma	ma	PROPN
ahs-14952	196	39	et	et	PROPN
ahs-14952	196	40	al	al	PROPN
ahs-14952	196	41	.	.	PROPN
ahs-14952	196	42	,	,	PUNCT
ahs-14952	196	43	2015	2015	NUM
ahs-14952	196	44	)	)	PUNCT
ahs-14952	196	45	.	.	PUNCT
ahs-14952	197	1	6	6	X
ahs-14952	197	2	.	.	X
ahs-14952	197	3	primer	primer	NOUN
ahs-14952	197	4	selection	selection	NOUN
ahs-14952	197	5	for	for	ADP
ahs-14952	197	6	fungal	fungal	ADJ
ahs-14952	197	7	amplification	amplification	NOUN
ahs-14952	197	8	after	after	ADP
ahs-14952	197	9	the	the	DET
ahs-14952	197	10	completion	completion	NOUN
ahs-14952	197	11	of	of	ADP
ahs-14952	197	12	dna	dna	PROPN
ahs-14952	197	13	extraction	extraction	NOUN
ahs-14952	197	14	from	from	ADP
ahs-14952	197	15	orchid	orchid	NOUN
ahs-14952	197	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	197	17	fungi	fungus	NOUN
ahs-14952	197	18	,	,	PUNCT
ahs-14952	197	19	the	the	DET
ahs-14952	197	20	subsequent	subsequent	ADJ
ahs-14952	197	21	step	step	NOUN
ahs-14952	197	22	involves	involve	VERB
ahs-14952	197	23	the	the	DET
ahs-14952	197	24	amplification	amplification	NOUN
ahs-14952	197	25	of	of	ADP
ahs-14952	197	26	fungal	fungal	ADJ
ahs-14952	197	27	dna	dna	NOUN
ahs-14952	197	28	through	through	ADP
ahs-14952	197	29	the	the	DET
ahs-14952	197	30	utilisation	utilisation	NOUN
ahs-14952	197	31	of	of	ADP
ahs-14952	197	32	a	a	DET
ahs-14952	197	33	polymerase	polymerase	NOUN
ahs-14952	197	34	chain	chain	NOUN
ahs-14952	197	35	reaction	reaction	NOUN
ahs-14952	197	36	(	(	PUNCT
ahs-14952	197	37	pcr	pcr	ADJ
ahs-14952	197	38	)	)	PUNCT
ahs-14952	197	39	technique	technique	NOUN
ahs-14952	197	40	.	.	PUNCT
ahs-14952	198	1	this	this	DET
ahs-14952	198	2	amplification	amplification	NOUN
ahs-14952	198	3	process	process	NOUN
ahs-14952	198	4	necessitates	necessitate	VERB
ahs-14952	198	5	the	the	DET
ahs-14952	198	6	use	use	NOUN
ahs-14952	198	7	of	of	ADP
ahs-14952	198	8	primers	primer	NOUN
ahs-14952	198	9	that	that	PRON
ahs-14952	198	10	are	be	AUX
ahs-14952	198	11	specifically	specifically	ADV
ahs-14952	198	12	designed	design	VERB
ahs-14952	198	13	to	to	PART
ahs-14952	198	14	target	target	VERB
ahs-14952	198	15	the	the	DET
ahs-14952	198	16	ribosomal	ribosomal	NOUN
ahs-14952	198	17	dna	dna	NOUN
ahs-14952	198	18	(	(	PUNCT
ahs-14952	198	19	rdna	rdna	NOUN
ahs-14952	198	20	)	)	PUNCT
ahs-14952	198	21	region	region	NOUN
ahs-14952	198	22	.	.	PUNCT
ahs-14952	199	1	the	the	DET
ahs-14952	199	2	rdna	rdna	PROPN
ahs-14952	199	3	cluster	cluster	NOUN
ahs-14952	199	4	consists	consist	VERB
ahs-14952	199	5	of	of	ADP
ahs-14952	199	6	several	several	ADJ
ahs-14952	199	7	components	component	NOUN
ahs-14952	199	8	,	,	PUNCT
ahs-14952	199	9	including	include	VERB
ahs-14952	199	10	18s	18s	NUM
ahs-14952	199	11	rdna	rdna	NOUN
ahs-14952	199	12	,	,	PUNCT
ahs-14952	199	13	5.8s	5.8s	NUM
ahs-14952	199	14	rdna	rdna	NOUN
ahs-14952	199	15	,	,	PUNCT
ahs-14952	199	16	28s	28	NOUN
ahs-14952	199	17	rdna	rdna	PROPN
ahs-14952	199	18	,	,	PUNCT
ahs-14952	199	19	the	the	DET
ahs-14952	199	20	external	external	ADJ
ahs-14952	199	21	transcribed	transcribe	VERB
ahs-14952	199	22	spacer	spacer	NOUN
ahs-14952	199	23	(	(	PUNCT
ahs-14952	199	24	ets	ets	PROPN
ahs-14952	199	25	)	)	PUNCT
ahs-14952	199	26	,	,	PUNCT
ahs-14952	199	27	and	and	CCONJ
ahs-14952	199	28	internal	internal	ADJ
ahs-14952	199	29	transcribed	transcribe	VERB
ahs-14952	199	30	spacer	spacer	NOUN
ahs-14952	199	31	1	1	NUM
ahs-14952	199	32	and	and	CCONJ
ahs-14952	199	33	2	2	NUM
ahs-14952	199	34	,	,	PUNCT
ahs-14952	199	35	which	which	PRON
ahs-14952	199	36	are	be	AUX
ahs-14952	199	37	generally	generally	ADV
ahs-14952	199	38	referred	refer	VERB
ahs-14952	199	39	to	to	ADP
ahs-14952	199	40	as	as	ADP
ahs-14952	199	41	its1	its1	PROPN
ahs-14952	199	42	and	and	CCONJ
ahs-14952	199	43	its2	its2	PROPN
ahs-14952	199	44	.	.	PUNCT
ahs-14952	200	1	the	the	DET
ahs-14952	200	2	utilisation	utilisation	NOUN
ahs-14952	200	3	of	of	ADP
ahs-14952	200	4	the	the	DET
ahs-14952	200	5	its	its	PRON
ahs-14952	200	6	region	region	NOUN
ahs-14952	200	7	for	for	ADP
ahs-14952	200	8	molecular	molecular	ADJ
ahs-14952	200	9	identification	identification	NOUN
ahs-14952	200	10	of	of	ADP
ahs-14952	200	11	fungi	fungus	NOUN
ahs-14952	200	12	can	can	AUX
ahs-14952	200	13	be	be	AUX
ahs-14952	200	14	traced	trace	VERB
ahs-14952	200	15	back	back	ADV
ahs-14952	200	16	to	to	ADP
ahs-14952	200	17	the	the	DET
ahs-14952	200	18	early	early	ADJ
ahs-14952	200	19	1990s	1990	NOUN
ahs-14952	200	20	,	,	PUNCT
ahs-14952	200	21	as	as	SCONJ
ahs-14952	200	22	shown	show	VERB
ahs-14952	200	23	by	by	ADP
ahs-14952	200	24	horton	horton	PROPN
ahs-14952	200	25	and	and	CCONJ
ahs-14952	200	26	bruns	brun	NOUN
ahs-14952	200	27	(	(	PUNCT
ahs-14952	200	28	2001	2001	NUM
ahs-14952	200	29	)	)	PUNCT
ahs-14952	200	30	and	and	CCONJ
ahs-14952	200	31	seifert	seifert	PROPN
ahs-14952	200	32	(	(	PUNCT
ahs-14952	200	33	2009	2009	NUM
ahs-14952	200	34	)	)	PUNCT
ahs-14952	200	35	.	.	PUNCT
ahs-14952	201	1	the	the	DET
ahs-14952	201	2	utilisation	utilisation	NOUN
ahs-14952	201	3	of	of	ADP
ahs-14952	201	4	the	the	DET
ahs-14952	201	5	its	its	PRON
ahs-14952	201	6	region	region	NOUN
ahs-14952	201	7	for	for	ADP
ahs-14952	201	8	molecular	molecular	ADJ
ahs-14952	201	9	identification	identification	NOUN
ahs-14952	201	10	is	be	AUX
ahs-14952	201	11	of	of	ADP
ahs-14952	201	12	great	great	ADJ
ahs-14952	201	13	significance	significance	NOUN
ahs-14952	201	14	in	in	ADP
ahs-14952	201	15	fungal	fungal	ADJ
ahs-14952	201	16	identification	identification	NOUN
ahs-14952	201	17	,	,	PUNCT
ahs-14952	201	18	principally	principally	ADV
ahs-14952	201	19	owing	owe	VERB
ahs-14952	201	20	to	to	ADP
ahs-14952	201	21	the	the	DET
ahs-14952	201	22	inclusion	inclusion	NOUN
ahs-14952	201	23	of	of	ADP
ahs-14952	201	24	two	two	NUM
ahs-14952	201	25	remarkably	remarkably	ADV
ahs-14952	201	26	variable	variable	ADJ
ahs-14952	201	27	spacers	spacer	NOUN
ahs-14952	201	28	,	,	PUNCT
ahs-14952	201	29	namely	namely	ADV
ahs-14952	201	30	its1	its1	PROPN
ahs-14952	201	31	and	and	CCONJ
ahs-14952	201	32	its2	its2	PROPN
ahs-14952	201	33	,	,	PUNCT
ahs-14952	201	34	which	which	PRON
ahs-14952	201	35	frequently	frequently	ADV
ahs-14952	201	36	exhibit	exhibit	VERB
ahs-14952	201	37	species­specific	species­specific	ADJ
ahs-14952	201	38	characteristics	characteristic	NOUN
ahs-14952	201	39	either	either	CCONJ
ahs-14952	201	40	independently	independently	ADV
ahs-14952	201	41	or	or	CCONJ
ahs-14952	201	42	in	in	ADP
ahs-14952	201	43	conjunction	conjunction	NOUN
ahs-14952	201	44	.	.	PUNCT
ahs-14952	202	1	moreover	moreover	ADV
ahs-14952	202	2	,	,	PUNCT
ahs-14952	202	3	it	it	PRON
ahs-14952	202	4	includes	include	VERB
ahs-14952	202	5	the	the	DET
ahs-14952	202	6	5.8s	5.8s	NUM
ahs-14952	202	7	gene	gene	NOUN
ahs-14952	202	8	,	,	PUNCT
ahs-14952	202	9	which	which	PRON
ahs-14952	202	10	is	be	AUX
ahs-14952	202	11	renowned	renowned	ADJ
ahs-14952	202	12	for	for	ADP
ahs-14952	202	13	its	its	PRON
ahs-14952	202	14	exceptional	exceptional	ADJ
ahs-14952	202	15	level	level	NOUN
ahs-14952	202	16	of	of	ADP
ahs-14952	202	17	conservation	conservation	NOUN
ahs-14952	202	18	.	.	PUNCT
ahs-14952	203	1	the	the	DET
ahs-14952	203	2	high	high	ADJ
ahs-14952	203	3	degree	degree	NOUN
ahs-14952	203	4	of	of	ADP
ahs-14952	203	5	sequence	sequence	NOUN
ahs-14952	203	6	conservation	conservation	NOUN
ahs-14952	203	7	observed	observe	VERB
ahs-14952	203	8	in	in	ADP
ahs-14952	203	9	the	the	DET
ahs-14952	203	10	adjacent	adjacent	ADJ
ahs-14952	203	11	genes	gene	NOUN
ahs-14952	203	12	,	,	PUNCT
ahs-14952	203	13	along	along	ADP
ahs-14952	203	14	with	with	ADP
ahs-14952	203	15	their	their	PRON
ahs-14952	203	16	designation	designation	NOUN
ahs-14952	203	17	as	as	SCONJ
ahs-14952	203	18	the	the	DET
ahs-14952	203	19	region	region	NOUN
ahs-14952	203	20	undergoing	undergo	VERB
ahs-14952	203	21	the	the	DET
ahs-14952	203	22	most	most	ADV
ahs-14952	203	23	rapid	rapid	ADJ
ahs-14952	203	24	evolution	evolution	NOUN
ahs-14952	203	25	and	and	CCONJ
ahs-14952	203	26	the	the	DET
ahs-14952	203	27	existence	existence	NOUN
ahs-14952	203	28	of	of	ADP
ahs-14952	203	29	multiple	multiple	ADJ
ahs-14952	203	30	copies	copy	NOUN
ahs-14952	203	31	of	of	ADP
ahs-14952	203	32	the	the	DET
ahs-14952	203	33	ribosomal	ribosomal	NOUN
ahs-14952	203	34	operon	operon	NOUN
ahs-14952	203	35	,	,	PUNCT
ahs-14952	203	36	facilitates	facilitate	VERB
ahs-14952	203	37	the	the	DET
ahs-14952	203	38	efficiency	efficiency	NOUN
ahs-14952	203	39	of	of	ADP
ahs-14952	203	40	primer	primer	NOUN
ahs-14952	203	41	design	design	NOUN
ahs-14952	203	42	and	and	CCONJ
ahs-14952	203	43	pcr	pcr	ADJ
ahs-14952	203	44	amplification	amplification	NOUN
ahs-14952	203	45	for	for	ADP
ahs-14952	203	46	the	the	DET
ahs-14952	203	47	its	its	PRON
ahs-14952	203	48	region	region	NOUN
ahs-14952	203	49	(	(	PUNCT
ahs-14952	203	50	bengtsson	bengtsson	PROPN
ahs-14952	203	51	palme	palme	PROPN
ahs-14952	203	52	et	et	PROPN
ahs-14952	203	53	al	al	PROPN
ahs-14952	203	54	.	.	PROPN
ahs-14952	203	55	,	,	PUNCT
ahs-14952	203	56	2013	2013	NUM
ahs-14952	203	57	;	;	PUNCT
ahs-14952	203	58	fajarningsih	fajarningsih	PROPN
ahs-14952	203	59	,	,	PUNCT
ahs-14952	203	60	2016	2016	NUM
ahs-14952	203	61	;	;	PUNCT
ahs-14952	203	62	raja	raja	PROPN
ahs-14952	203	63	et	et	PROPN
ahs-14952	203	64	al	al	PROPN
ahs-14952	203	65	.	.	PROPN
ahs-14952	203	66	,	,	PUNCT
ahs-14952	203	67	2017	2017	NUM
ahs-14952	203	68	)	)	PUNCT
ahs-14952	203	69	.	.	PUNCT
ahs-14952	204	1	these	these	DET
ahs-14952	204	2	two	two	NUM
ahs-14952	204	3	spacers	spacer	NOUN
ahs-14952	204	4	are	be	AUX
ahs-14952	204	5	copied	copy	VERB
ahs-14952	204	6	from	from	ADP
ahs-14952	204	7	the	the	DET
ahs-14952	204	8	ribosomal	ribosomal	NOUN
ahs-14952	204	9	dna	dna	NOUN
ahs-14952	204	10	,	,	PUNCT
ahs-14952	204	11	and	and	CCONJ
ahs-14952	204	12	when	when	SCONJ
ahs-14952	204	13	the	the	DET
ahs-14952	204	14	ribosomal	ribosomal	NOUN
ahs-14952	204	15	rnas	rna	NOUN
ahs-14952	204	16	complete	complete	ADJ
ahs-14952	204	17	,	,	PUNCT
ahs-14952	204	18	they	they	PRON
ahs-14952	204	19	are	be	AUX
ahs-14952	204	20	removed	remove	VERB
ahs-14952	204	21	from	from	ADP
ahs-14952	204	22	the	the	DET
ahs-14952	204	23	rrnas	rrna	NOUN
ahs-14952	204	24	.	.	PUNCT
ahs-14952	205	1	since	since	SCONJ
ahs-14952	205	2	the	the	DET
ahs-14952	205	3	spacers	spacer	NOUN
ahs-14952	205	4	are	be	AUX
ahs-14952	205	5	not	not	PART
ahs-14952	205	6	used	use	VERB
ahs-14952	205	7	in	in	ADP
ahs-14952	205	8	the	the	DET
ahs-14952	205	9	final	final	ADJ
ahs-14952	205	10	structure	structure	NOUN
ahs-14952	205	11	of	of	ADP
ahs-14952	205	12	the	the	DET
ahs-14952	205	13	ribosome	ribosome	NOUN
ahs-14952	205	14	,	,	PUNCT
ahs-14952	205	15	they	they	PRON
ahs-14952	205	16	are	be	AUX
ahs-14952	205	17	not	not	PART
ahs-14952	205	18	strongly	strongly	ADV
ahs-14952	205	19	selected	select	VERB
ahs-14952	205	20	against	against	ADP
ahs-14952	205	21	mutations	mutation	NOUN
ahs-14952	205	22	.	.	PUNCT
ahs-14952	206	1	therefore	therefore	ADV
ahs-14952	206	2	,	,	PUNCT
ahs-14952	206	3	the	the	DET
ahs-14952	206	4	identification	identification	NOUN
ahs-14952	206	5	of	of	ADP
ahs-14952	206	6	mycorrhizal	mycorrhizal	NOUN
ahs-14952	206	7	fungus	fungus	NOUN
ahs-14952	206	8	is	be	AUX
ahs-14952	206	9	considered	consider	VERB
ahs-14952	206	10	efficient	efficient	ADJ
ahs-14952	206	11	by	by	ADP
ahs-14952	206	12	using	use	VERB
ahs-14952	206	13	a	a	DET
ahs-14952	206	14	region­specific	region­specific	NOUN
ahs-14952	206	15	to	to	ADP
ahs-14952	206	16	eukaryotes	eukaryote	NOUN
ahs-14952	206	17	(	(	PUNCT
ahs-14952	206	18	tedersoo	tedersoo	PROPN
ahs-14952	206	19	and	and	CCONJ
ahs-14952	206	20	nilsson	nilsson	PROPN
ahs-14952	206	21	,	,	PUNCT
ahs-14952	206	22	2016	2016	NUM
ahs-14952	206	23	)	)	PUNCT
ahs-14952	206	24	.	.	PUNCT
ahs-14952	207	1	the	the	DET
ahs-14952	207	2	nuclear	nuclear	PROPN
ahs-14952	207	3	ribosomal	ribosomal	NOUN
ahs-14952	207	4	rna	rna	NOUN
ahs-14952	207	5	genes	gene	NOUN
ahs-14952	207	6	,	,	PUNCT
ahs-14952	207	7	including	include	VERB
ahs-14952	207	8	the	the	DET
ahs-14952	207	9	small	small	ADJ
ahs-14952	207	10	subunit	subunit	NOUN
ahs-14952	207	11	(	(	PUNCT
ahs-14952	207	12	ssu	ssu	PROPN
ahs-14952	207	13	)	)	PUNCT
ahs-14952	207	14	(	(	PUNCT
ahs-14952	207	15	18s	18	NOUN
ahs-14952	207	16	)	)	PUNCT
ahs-14952	207	17	and	and	CCONJ
ahs-14952	207	18	large	large	ADJ
ahs-14952	207	19	subunit	subunit	NOUN
ahs-14952	207	20	(	(	PUNCT
ahs-14952	207	21	lsu	lsu	NOUN
ahs-14952	207	22	)	)	PUNCT
ahs-14952	207	23	(	(	PUNCT
ahs-14952	207	24	28s	28	NOUN
ahs-14952	207	25	)	)	PUNCT
ahs-14952	207	26	are	be	AUX
ahs-14952	207	27	commonly	commonly	ADV
ahs-14952	207	28	utilised	utilise	VERB
ahs-14952	207	29	in	in	ADP
ahs-14952	207	30	scientific	scientific	ADJ
ahs-14952	207	31	investigations	investigation	NOUN
ahs-14952	207	32	pertaining	pertain	VERB
ahs-14952	207	33	to	to	ADP
ahs-14952	207	34	aquatic	aquatic	ADJ
ahs-14952	207	35	fungus	fungus	NOUN
ahs-14952	207	36	and	and	CCONJ
ahs-14952	207	37	arbuscular	arbuscular	ADJ
ahs-14952	207	38	mycorrhizal	mycorrhizal	NOUN
ahs-14952	207	39	fungi	fungus	NOUN
ahs-14952	207	40	.	.	PUNCT
ahs-14952	208	1	nevertheless	nevertheless	ADV
ahs-14952	208	2	,	,	PUNCT
ahs-14952	208	3	in	in	ADP
ahs-14952	208	4	the	the	DET
ahs-14952	208	5	case	case	NOUN
ahs-14952	208	6	of	of	ADP
ahs-14952	208	7	ascomycetes	ascomycete	NOUN
ahs-14952	208	8	and	and	CCONJ
ahs-14952	208	9	basidiomycetes	basidiomycete	NOUN
ahs-14952	208	10	,	,	PUNCT
ahs-14952	208	11	these	these	DET
ahs-14952	208	12	markers	marker	NOUN
ahs-14952	208	13	generally	generally	ADV
ahs-14952	208	14	offer	offer	VERB
ahs-14952	208	15	taxonomic	taxonomic	ADJ
ahs-14952	208	16	insights	insight	NOUN
ahs-14952	208	17	primarily	primarily	ADV
ahs-14952	208	18	at	at	ADP
ahs-14952	208	19	level	level	NOUN
ahs-14952	208	20	beyond	beyond	ADP
ahs-14952	208	21	the	the	DET
ahs-14952	208	22	species	specie	NOUN
ahs-14952	208	23	,	,	PUNCT
ahs-14952	208	24	and	and	CCONJ
ahs-14952	208	25	occasionally	occasionally	ADV
ahs-14952	208	26	at	at	ADP
ahs-14952	208	27	the	the	DET
ahs-14952	208	28	genus	genus	ADJ
ahs-14952	208	29	level	level	NOUN
ahs-14952	208	30	.	.	PUNCT
ahs-14952	209	1	this	this	DET
ahs-14952	209	2	problem	problem	NOUN
ahs-14952	209	3	is	be	AUX
ahs-14952	209	4	caused	cause	VERB
ahs-14952	209	5	by	by	ADP
ahs-14952	209	6	the	the	DET
ahs-14952	209	7	fact	fact	NOUN
ahs-14952	209	8	that	that	SCONJ
ahs-14952	209	9	the	the	DET
ahs-14952	209	10	ssu	ssu	PROPN
ahs-14952	209	11	and	and	CCONJ
ahs-14952	209	12	lsu	lsu	NOUN
ahs-14952	209	13	sequences	sequence	NOUN
ahs-14952	209	14	of	of	ADP
ahs-14952	209	15	the	the	DET
ahs-14952	209	16	many	many	ADJ
ahs-14952	209	17	species	specie	NOUN
ahs-14952	209	18	that	that	PRON
ahs-14952	209	19	belong	belong	VERB
ahs-14952	209	20	to	to	ADP
ahs-14952	209	21	these	these	DET
ahs-14952	209	22	fungal	fungal	ADJ
ahs-14952	209	23	groupings	grouping	NOUN
ahs-14952	209	24	have	have	AUX
ahs-14952	209	25	only	only	ADV
ahs-14952	209	26	minute	minute	VERB
ahs-14952	209	27	to	to	ADP
ahs-14952	209	28	nonexistent	nonexistent	ADJ
ahs-14952	209	29	differences	difference	NOUN
ahs-14952	209	30	between	between	ADP
ahs-14952	209	31	them	they	PRON
ahs-14952	209	32	.	.	PUNCT
ahs-14952	210	1	because	because	SCONJ
ahs-14952	210	2	of	of	ADP
ahs-14952	210	3	this	this	PRON
ahs-14952	210	4	,	,	PUNCT
ahs-14952	210	5	precise	precise	ADJ
ahs-14952	210	6	distinction	distinction	NOUN
ahs-14952	210	7	becomes	become	VERB
ahs-14952	210	8	a	a	DET
ahs-14952	210	9	challenging	challenge	VERB
ahs-14952	210	10	obstacle	obstacle	NOUN
ahs-14952	210	11	.	.	PUNCT
ahs-14952	211	1	according	accord	VERB
ahs-14952	211	2	to	to	ADP
ahs-14952	211	3	the	the	DET
ahs-14952	211	4	findings	finding	NOUN
ahs-14952	211	5	of	of	ADP
ahs-14952	211	6	the	the	DET
ahs-14952	211	7	research	research	NOUN
ahs-14952	211	8	carried	carry	VERB
ahs-14952	211	9	out	out	ADP
ahs-14952	211	10	by	by	ADP
ahs-14952	211	11	nilsson	nilsson	PROPN
ahs-14952	211	12	et	et	PROPN
ahs-14952	211	13	al	al	PROPN
ahs-14952	211	14	.	.	PROPN
ahs-14952	212	1	(	(	PUNCT
ahs-14952	212	2	2019	2019	NUM
ahs-14952	212	3	)	)	PUNCT
ahs-14952	212	4	,	,	PUNCT
ahs-14952	212	5	the	the	DET
ahs-14952	212	6	ability	ability	NOUN
ahs-14952	212	7	of	of	ADP
ahs-14952	212	8	ssu	ssu	PROPN
ahs-14952	212	9	,	,	PUNCT
ahs-14952	212	10	lsu	lsu	NOUN
ahs-14952	212	11	,	,	PUNCT
ahs-14952	212	12	and	and	CCONJ
ahs-14952	212	13	protein­coding	protein­coding	NOUN
ahs-14952	212	14	genes	gene	NOUN
ahs-14952	212	15	like	like	ADP
ahs-14952	212	16	the	the	DET
ahs-14952	212	17	rna	rna	NOUN
ahs-14952	212	18	polymerase	polymerase	NOUN
ahs-14952	212	19	gene	gene	NOUN
ahs-14952	212	20	rpb2	rpb2	NOUN
ahs-14952	212	21	to	to	PART
ahs-14952	212	22	be	be	AUX
ahs-14952	212	23	aligned	align	VERB
ahs-14952	212	24	across	across	ADP
ahs-14952	212	25	different	different	ADJ
ahs-14952	212	26	fungal	fungal	ADJ
ahs-14952	212	27	phyla	phyla	NOUN
ahs-14952	212	28	is	be	AUX
ahs-14952	212	29	a	a	DET
ahs-14952	212	30	significant	significant	ADJ
ahs-14952	212	31	benefit	benefit	NOUN
ahs-14952	212	32	offered	offer	VERB
ahs-14952	212	33	by	by	ADP
ahs-14952	212	34	these	these	DET
ahs-14952	212	35	types	type	NOUN
ahs-14952	212	36	of	of	ADP
ahs-14952	212	37	genes	gene	NOUN
ahs-14952	212	38	.	.	PUNCT
ahs-14952	213	1	this	this	PRON
ahs-14952	213	2	makes	make	VERB
ahs-14952	213	3	it	it	PRON
ahs-14952	213	4	possible	possible	ADJ
ahs-14952	213	5	to	to	PART
ahs-14952	213	6	analyse	analyse	VERB
ahs-14952	213	7	large­scale	large­scale	ADJ
ahs-14952	213	8	phylogenetic	phylogenetic	ADJ
ahs-14952	213	9	relationships	relationship	NOUN
ahs-14952	213	10	at	at	ADP
ahs-14952	213	11	the	the	DET
ahs-14952	213	12	phylum	phylum	NOUN
ahs-14952	213	13	and	and	CCONJ
ahs-14952	213	14	order	order	NOUN
ahs-14952	213	15	levels	level	NOUN
ahs-14952	213	16	,	,	PUNCT
ahs-14952	213	17	which	which	PRON
ahs-14952	213	18	is	be	AUX
ahs-14952	213	19	something	something	PRON
ahs-14952	213	20	that	that	PRON
ahs-14952	213	21	the	the	DET
ahs-14952	213	22	its	its	PRON
ahs-14952	213	23	region	region	NOUN
ahs-14952	213	24	normally	normally	ADV
ahs-14952	213	25	has	have	VERB
ahs-14952	213	26	difficulty	difficulty	NOUN
ahs-14952	213	27	accomplishing	accomplish	VERB
ahs-14952	213	28	without	without	ADP
ahs-14952	213	29	very	very	ADV
ahs-14952	213	30	identical	identical	ADJ
ahs-14952	213	31	reference	reference	NOUN
ahs-14952	213	32	sequences	sequence	NOUN
ahs-14952	213	33	(	(	PUNCT
ahs-14952	213	34	větrovský	větrovský	VERB
ahs-14952	213	35	et	et	PROPN
ahs-14952	213	36	al	al	PROPN
ahs-14952	213	37	.	.	PROPN
ahs-14952	213	38	,	,	PUNCT
ahs-14952	213	39	2016	2016	NUM
ahs-14952	213	40	)	)	PUNCT
ahs-14952	213	41	.	.	PUNCT
ahs-14952	214	1	because	because	SCONJ
ahs-14952	214	2	the	the	DET
ahs-14952	214	3	its	its	PRON
ahs-14952	214	4	region	region	NOUN
ahs-14952	214	5	often	often	ADV
ahs-14952	214	6	ranges	range	VERB
ahs-14952	214	7	in	in	ADP
ahs-14952	214	8	length	length	NOUN
ahs-14952	214	9	from	from	ADP
ahs-14952	214	10	500­700	500­700	NUM
ahs-14952	214	11	bases	basis	NOUN
ahs-14952	214	12	,	,	PUNCT
ahs-14952	214	13	the	the	DET
ahs-14952	214	14	majority	majority	NOUN
ahs-14952	214	15	of	of	ADP
ahs-14952	214	16	high­throughput	high­throughput	ADJ
ahs-14952	214	17	sequencing	sequence	VERB
ahs-14952	214	18	(	(	PUNCT
ahs-14952	214	19	hts	ht	NOUN
ahs-14952	214	20	)	)	PUNCT
ahs-14952	214	21	studies	study	NOUN
ahs-14952	214	22	concentrate	concentrate	VERB
ahs-14952	214	23	on	on	ADP
ahs-14952	214	24	the	the	DET
ahs-14952	214	25	shorter	short	ADJ
ahs-14952	214	26	its1	its1	PROPN
ahs-14952	214	27	or	or	CCONJ
ahs-14952	214	28	its2	its2	ADJ
ahs-14952	214	29	subregions	subregion	NOUN
ahs-14952	214	30	,	,	PUNCT
ahs-14952	214	31	which	which	PRON
ahs-14952	214	32	typically	typically	ADV
ahs-14952	214	33	range	range	VERB
ahs-14952	214	34	in	in	ADP
ahs-14952	214	35	length	length	NOUN
ahs-14952	214	36	from	from	ADP
ahs-14952	214	37	250­400	250­400	NUM
ahs-14952	214	38	bases	basis	NOUN
ahs-14952	214	39	.	.	PUNCT
ahs-14952	215	1	this	this	DET
ahs-14952	215	2	constraint	constraint	NOUN
ahs-14952	215	3	is	be	AUX
ahs-14952	215	4	the	the	DET
ahs-14952	215	5	result	result	NOUN
ahs-14952	215	6	of	of	ADP
ahs-14952	215	7	the	the	DET
ahs-14952	215	8	fact	fact	NOUN
ahs-14952	215	9	that	that	SCONJ
ahs-14952	215	10	the	the	DET
ahs-14952	215	11	its	its	PRON
ahs-14952	215	12	region	region	NOUN
ahs-14952	215	13	is	be	AUX
ahs-14952	215	14	normally	normally	ADV
ahs-14952	215	15	between	between	ADP
ahs-14952	215	16	500­700	500­700	NUM
ahs-14952	215	17	bases	basis	NOUN
ahs-14952	215	18	in	in	ADP
ahs-14952	215	19	length	length	NOUN
ahs-14952	215	20	.	.	PUNCT
ahs-14952	216	1	according	accord	VERB
ahs-14952	216	2	to	to	ADP
ahs-14952	216	3	tedersoo	tedersoo	PROPN
ahs-14952	216	4	et	et	PROPN
ahs-14952	216	5	al	al	PROPN
ahs-14952	216	6	.	.	PROPN
ahs-14952	217	1	(	(	PUNCT
ahs-14952	217	2	2015	2015	NUM
ahs-14952	217	3	)	)	PUNCT
ahs-14952	217	4	,	,	PUNCT
ahs-14952	217	5	the	the	DET
ahs-14952	217	6	its2	its2	PROPN
ahs-14952	217	7	subregion	subregion	NOUN
ahs-14952	217	8	in	in	ADP
ahs-14952	217	9	particular	particular	ADJ
ahs-14952	217	10	stands	stand	VERB
ahs-14952	217	11	out	out	ADP
ahs-14952	217	12	due	due	ADP
ahs-14952	217	13	to	to	ADP
ahs-14952	217	14	the	the	DET
ahs-14952	217	15	fact	fact	NOUN
ahs-14952	217	16	that	that	SCONJ
ahs-14952	217	17	it	it	PRON
ahs-14952	217	18	exhibits	exhibit	VERB
ahs-14952	217	19	lesser	less	ADJ
ahs-14952	217	20	length	length	NOUN
ahs-14952	217	21	fluctuations	fluctuation	NOUN
ahs-14952	217	22	and	and	CCONJ
ahs-14952	217	23	more	more	ADJ
ahs-14952	217	24	universal	universal	ADJ
ahs-14952	217	25	primer	primer	NOUN
ahs-14952	217	26	sites	site	NOUN
ahs-14952	217	27	.	.	PUNCT
ahs-14952	218	1	this	this	PRON
ahs-14952	218	2	,	,	PUNCT
ahs-14952	218	3	in	in	ADP
ahs-14952	218	4	turn	turn	NOUN
ahs-14952	218	5	,	,	PUNCT
ahs-14952	218	6	results	result	VERB
ahs-14952	218	7	in	in	ADP
ahs-14952	218	8	reduced	reduce	VERB
ahs-14952	218	9	taxonomic	taxonomic	ADJ
ahs-14952	218	10	bias	bias	NOUN
ahs-14952	218	11	.	.	PUNCT
ahs-14952	219	1	the	the	DET
ahs-14952	219	2	its1	its1	PROPN
ahs-14952	219	3	and	and	CCONJ
ahs-14952	219	4	its2	its2	PROPN
ahs-14952	219	5	subregions	subregion	NOUN
ahs-14952	219	6	have	have	AUX
ahs-14952	219	7	demonstrated	demonstrate	VERB
ahs-14952	219	8	their	their	PRON
ahs-14952	219	9	suitability	suitability	NOUN
ahs-14952	219	10	for	for	ADP
ahs-14952	219	11	second	second	ADJ
ahs-14952	219	12	generation	generation	NOUN
ahs-14952	219	13	high­	high­	NOUN
ahs-14952	219	14	throughput	throughput	NOUN
ahs-14952	219	15	sequencing	sequence	VERB
ahs-14952	219	16	(	(	PUNCT
ahs-14952	219	17	hts	ht	NOUN
ahs-14952	219	18	)	)	PUNCT
ahs-14952	219	19	techniques	technique	NOUN
ahs-14952	219	20	.	.	PUNCT
ahs-14952	220	1	however	however	ADV
ahs-14952	220	2	,	,	PUNCT
ahs-14952	220	3	third	third	ADJ
ahs-14952	220	4	generation	generation	NOUN
ahs-14952	220	5	methodologies	methodology	NOUN
ahs-14952	220	6	,	,	PUNCT
ahs-14952	220	7	such	such	ADJ
ahs-14952	220	8	as	as	ADP
ahs-14952	220	9	those	those	DET
ahs-14952	220	10	utilising	utilise	VERB
ahs-14952	220	11	pacbiosciences	pacbioscience	NOUN
ahs-14952	220	12	(	(	PUNCT
ahs-14952	220	13	pacbio	pacbio	NOUN
ahs-14952	220	14	)	)	PUNCT
ahs-14952	220	15	and	and	CCONJ
ahs-14952	220	16	oxford	oxford	ADJ
ahs-14952	220	17	nanopore	nanopore	ADJ
ahs-14952	220	18	platforms	platform	NOUN
ahs-14952	220	19	,	,	PUNCT
ahs-14952	220	20	provide	provide	VERB
ahs-14952	220	21	the	the	DET
ahs-14952	220	22	ability	ability	NOUN
ahs-14952	220	23	to	to	PART
ahs-14952	220	24	target	target	VERB
ahs-14952	220	25	the	the	DET
ahs-14952	220	26	complete	complete	ADJ
ahs-14952	220	27	its	its	PRON
ahs-14952	220	28	region	region	NOUN
ahs-14952	220	29	,	,	PUNCT
ahs-14952	220	30	as	as	ADV
ahs-14952	220	31	well	well	ADV
ahs-14952	220	32	as	as	ADP
ahs-14952	220	33	segments	segment	NOUN
ahs-14952	220	34	or	or	CCONJ
ahs-14952	220	35	even	even	ADV
ahs-14952	220	36	the	the	DET
ahs-14952	220	37	entire	entire	ADJ
ahs-14952	220	38	adjacent	adjacent	ADJ
ahs-14952	220	39	rrna	rrna	NOUN
ahs-14952	220	40	genes	gene	NOUN
ahs-14952	220	41	(	(	PUNCT
ahs-14952	220	42	nilsson	nilsson	PROPN
ahs-14952	220	43	et	et	PROPN
ahs-14952	220	44	al	al	PROPN
ahs-14952	220	45	.	.	PROPN
ahs-14952	220	46	,	,	PUNCT
ahs-14952	220	47	2019	2019	NUM
ahs-14952	220	48	)	)	PUNCT
ahs-14952	220	49	.	.	PUNCT
ahs-14952	221	1	targeting	target	VERB
ahs-14952	221	2	the	the	DET
ahs-14952	221	3	entire	entire	ADJ
ahs-14952	221	4	internal	internal	ADJ
ahs-14952	221	5	transcribed	transcribe	VERB
ahs-14952	221	6	spacer	spacer	NOUN
ahs-14952	221	7	(	(	PUNCT
ahs-14952	221	8	its	its	PRON
ahs-14952	221	9	)	)	PUNCT
ahs-14952	221	10	area	area	NOUN
ahs-14952	221	11	,	,	PUNCT
ahs-14952	221	12	rather	rather	ADV
ahs-14952	221	13	than	than	ADP
ahs-14952	221	14	its	its	PRON
ahs-14952	221	15	subregions	subregion	NOUN
ahs-14952	221	16	has	have	VERB
ahs-14952	221	17	several	several	ADJ
ahs-14952	221	18	advantages	advantage	NOUN
ahs-14952	221	19	,	,	PUNCT
ahs-14952	221	20	including	include	VERB
ahs-14952	221	21	improved	improve	VERB
ahs-14952	221	22	taxonomic	taxonomic	ADJ
ahs-14952	221	23	accuracy	accuracy	NOUN
ahs-14952	221	24	and	and	CCONJ
ahs-14952	221	25	less	less	ADJ
ahs-14952	221	26	amplification	amplification	NOUN
ahs-14952	221	27	of	of	ADP
ahs-14952	221	28	non­viable	non­viable	ADJ
ahs-14952	221	29	organism	organism	NOUN
ahs-14952	221	30	.	.	PUNCT
ahs-14952	222	1	nevertheless	nevertheless	ADV
ahs-14952	222	2	,	,	PUNCT
ahs-14952	222	3	one	one	NUM
ahs-14952	222	4	limitation	limitation	NOUN
ahs-14952	222	5	of	of	ADP
ahs-14952	222	6	this	this	DET
ahs-14952	222	7	methodology	methodology	NOUN
ahs-14952	222	8	is	be	AUX
ahs-14952	222	9	its	its	PRON
ahs-14952	222	10	reduced	reduced	ADJ
ahs-14952	222	11	efficacy	efficacy	NOUN
ahs-14952	222	12	when	when	SCONJ
ahs-14952	222	13	utilised	utilise	VERB
ahs-14952	222	14	on	on	ADP
ahs-14952	222	15	materials	material	NOUN
ahs-14952	222	16	of	of	ADP
ahs-14952	222	17	subpar	subpar	ADJ
ahs-14952	222	18	quality	quality	NOUN
ahs-14952	222	19	,	,	PUNCT
ahs-14952	222	20	such	such	ADJ
ahs-14952	222	21	as	as	ADP
ahs-14952	222	22	ancient	ancient	ADJ
ahs-14952	222	23	herbarium	herbarium	NOUN
ahs-14952	222	24	specimens	specimen	NOUN
ahs-14952	222	25	,	,	PUNCT
ahs-14952	222	26	which	which	PRON
ahs-14952	222	27	degrade	degrade	VERB
ahs-14952	222	28	to	to	ADP
ahs-14952	222	29	a	a	DET
ahs-14952	222	30	degree	degree	NOUN
ahs-14952	222	31	where	where	SCONJ
ahs-14952	222	32	doing	do	VERB
ahs-14952	222	33	its	its	PRON
ahs-14952	222	34	dna	dna	NOUN
ahs-14952	222	35	sequencing	sequencing	NOUN
ahs-14952	222	36	becomes	become	VERB
ahs-14952	222	37	impractical	impractical	ADJ
ahs-14952	222	38	(	(	PUNCT
ahs-14952	222	39	tedersoo	tedersoo	VERB
ahs-14952	222	40	et	et	PROPN
ahs-14952	222	41	al	al	PROPN
ahs-14952	222	42	.	.	PROPN
ahs-14952	222	43	,	,	PUNCT
ahs-14952	222	44	adv	adv	PROPN
ahs-14952	222	45	.	.	PUNCT
ahs-14952	222	46	hort	hort	PROPN
ahs-14952	222	47	.	.	PUNCT
ahs-14952	223	1	sci	sci	PROPN
ahs-14952	223	2	.	.	PROPN
ahs-14952	223	3	,	,	PUNCT
ahs-14952	223	4	2024	2024	NUM
ahs-14952	223	5	38(1	38(1	NOUN
ahs-14952	223	6	):	):	PUNCT
ahs-14952	223	7	97­116	97­116	NUM
ahs-14952	223	8	106	106	NUM
ahs-14952	223	9	2017	2017	NUM
ahs-14952	223	10	)	)	PUNCT
ahs-14952	223	11	.	.	PUNCT
ahs-14952	224	1	according	accord	VERB
ahs-14952	224	2	to	to	ADP
ahs-14952	224	3	study	study	NOUN
ahs-14952	224	4	conducted	conduct	VERB
ahs-14952	224	5	by	by	ADP
ahs-14952	224	6	nilsson	nilsson	PROPN
ahs-14952	224	7	et	et	PROPN
ahs-14952	224	8	al	al	PROPN
ahs-14952	224	9	.	.	PROPN
ahs-14952	225	1	(	(	PUNCT
ahs-14952	225	2	2019	2019	NUM
ahs-14952	225	3	)	)	PUNCT
ahs-14952	225	4	,	,	PUNCT
ahs-14952	225	5	it	it	PRON
ahs-14952	225	6	is	be	AUX
ahs-14952	225	7	recommended	recommend	VERB
ahs-14952	225	8	to	to	PART
ahs-14952	225	9	allocate	allocate	VERB
ahs-14952	225	10	a	a	DET
ahs-14952	225	11	significant	significant	ADJ
ahs-14952	225	12	amount	amount	NOUN
ahs-14952	225	13	of	of	ADP
ahs-14952	225	14	effort	effort	NOUN
ahs-14952	225	15	to	to	ADP
ahs-14952	225	16	the	the	DET
ahs-14952	225	17	analysis	analysis	NOUN
ahs-14952	225	18	and	and	CCONJ
ahs-14952	225	19	selection	selection	NOUN
ahs-14952	225	20	of	of	ADP
ahs-14952	225	21	primers	primer	NOUN
ahs-14952	225	22	,	,	PUNCT
ahs-14952	225	23	this	this	PRON
ahs-14952	225	24	is	be	AUX
ahs-14952	225	25	due	due	ADJ
ahs-14952	225	26	to	to	ADP
ahs-14952	225	27	the	the	DET
ahs-14952	225	28	fact	fact	NOUN
ahs-14952	225	29	that	that	SCONJ
ahs-14952	225	30	only	only	ADV
ahs-14952	225	31	a	a	DET
ahs-14952	225	32	limited	limited	ADJ
ahs-14952	225	33	number	number	NOUN
ahs-14952	225	34	of	of	ADP
ahs-14952	225	35	primers	primer	NOUN
ahs-14952	225	36	have	have	AUX
ahs-14952	225	37	the	the	DET
ahs-14952	225	38	capability	capability	NOUN
ahs-14952	225	39	to	to	PART
ahs-14952	225	40	amplify	amplify	VERB
ahs-14952	225	41	over	over	ADP
ahs-14952	225	42	90	90	NUM
ahs-14952	225	43	%	%	NOUN
ahs-14952	225	44	of	of	ADP
ahs-14952	225	45	fungal	fungal	ADJ
ahs-14952	225	46	groups	group	NOUN
ahs-14952	225	47	.	.	PUNCT
ahs-14952	226	1	additionally	additionally	ADV
ahs-14952	226	2	,	,	PUNCT
ahs-14952	226	3	the	the	DET
ahs-14952	226	4	process	process	NOUN
ahs-14952	226	5	of	of	ADP
ahs-14952	226	6	primer	primer	NOUN
ahs-14952	226	7	selection	selection	NOUN
ahs-14952	226	8	necessitates	necessitate	VERB
ahs-14952	226	9	meticulous	meticulous	ADJ
ahs-14952	226	10	examination	examination	NOUN
ahs-14952	226	11	of	of	ADP
ahs-14952	226	12	the	the	DET
ahs-14952	226	13	target	target	NOUN
ahs-14952	226	14	taxa	taxa	NOUN
ahs-14952	226	15	,	,	PUNCT
ahs-14952	226	16	as	as	SCONJ
ahs-14952	226	17	highlighted	highlight	VERB
ahs-14952	226	18	by	by	ADP
ahs-14952	226	19	tedersoo	tedersoo	PROPN
ahs-14952	226	20	et	et	PROPN
ahs-14952	226	21	al	al	PROPN
ahs-14952	226	22	.	.	PROPN
ahs-14952	226	23	(	(	PUNCT
ahs-14952	226	24	2015	2015	NUM
ahs-14952	226	25	)	)	PUNCT
ahs-14952	226	26	.	.	PUNCT
ahs-14952	227	1	the	the	DET
ahs-14952	227	2	following	follow	VERB
ahs-14952	227	3	table	table	NOUN
ahs-14952	227	4	3	3	NUM
ahs-14952	227	5	and	and	CCONJ
ahs-14952	227	6	4	4	NUM
ahs-14952	227	7	show	show	VERB
ahs-14952	227	8	an	an	DET
ahs-14952	227	9	illustrative	illustrative	ADJ
ahs-14952	227	10	depiction	depiction	NOUN
ahs-14952	227	11	of	of	ADP
ahs-14952	227	12	its	its	PRON
ahs-14952	227	13	primers	primer	NOUN
ahs-14952	227	14	together	together	ADV
ahs-14952	227	15	with	with	ADP
ahs-14952	227	16	their	their	PRON
ahs-14952	227	17	corresponding	correspond	VERB
ahs-14952	227	18	sequences	sequence	NOUN
ahs-14952	227	19	.	.	PUNCT
ahs-14952	228	1	7	7	X
ahs-14952	228	2	.	.	NUM
ahs-14952	228	3	identified	identify	VERB
ahs-14952	228	4	fungal	fungal	NOUN
ahs-14952	228	5	from	from	ADP
ahs-14952	228	6	orchid	orchid	NOUN
ahs-14952	228	7	root	root	NOUN
ahs-14952	228	8	by	by	ADP
ahs-14952	228	9	using	use	VERB
ahs-14952	228	10	internal	internal	ADJ
ahs-14952	228	11	transcribe	transcribe	NOUN
ahs-14952	228	12	region	region	NOUN
ahs-14952	228	13	gardes	garde	NOUN
ahs-14952	228	14	and	and	CCONJ
ahs-14952	228	15	bruns	brun	NOUN
ahs-14952	228	16	(	(	PUNCT
ahs-14952	228	17	1993	1993	NUM
ahs-14952	228	18	)	)	PUNCT
ahs-14952	228	19	and	and	CCONJ
ahs-14952	228	20	white	white	PROPN
ahs-14952	228	21	et	et	PROPN
ahs-14952	228	22	al	al	PROPN
ahs-14952	228	23	.	.	PROPN
ahs-14952	229	1	(	(	PUNCT
ahs-14952	229	2	1990	1990	NUM
ahs-14952	229	3	)	)	PUNCT
ahs-14952	229	4	have	have	AUX
ahs-14952	229	5	produced	produce	VERB
ahs-14952	229	6	well	well	ADV
ahs-14952	229	7	recognised	recognise	VERB
ahs-14952	229	8	primers	primer	NOUN
ahs-14952	229	9	in	in	ADP
ahs-14952	229	10	the	the	DET
ahs-14952	229	11	field	field	NOUN
ahs-14952	229	12	of	of	ADP
ahs-14952	229	13	fungal	fungal	ADJ
ahs-14952	229	14	ecology	ecology	NOUN
ahs-14952	229	15	for	for	ADP
ahs-14952	229	16	species­level	species­level	ADJ
ahs-14952	229	17	identification	identification	NOUN
ahs-14952	229	18	based	base	VERB
ahs-14952	229	19	on	on	ADP
ahs-14952	229	20	sequencing	sequence	VERB
ahs-14952	229	21	.	.	PUNCT
ahs-14952	230	1	these	these	DET
ahs-14952	230	2	primers	primer	NOUN
ahs-14952	230	3	,	,	PUNCT
ahs-14952	230	4	namely	namely	ADV
ahs-14952	230	5	its1	its1	PROPN
ahs-14952	230	6	,	,	PUNCT
ahs-14952	230	7	its2	its2	PROPN
ahs-14952	230	8	,	,	PUNCT
ahs-14952	230	9	its3	its3	PROPN
ahs-14952	230	10	,	,	PUNCT
ahs-14952	230	11	its4	its4	PROPN
ahs-14952	230	12	,	,	PUNCT
ahs-14952	230	13	its1f	its1f	PROPN
ahs-14952	230	14	,	,	PUNCT
ahs-14952	230	15	its86f	its86f	NOUN
ahs-14952	230	16	,	,	PUNCT
ahs-14952	230	17	and	and	CCONJ
ahs-14952	230	18	cnl2f	cnl2f	NOUN
ahs-14952	230	19	,	,	PUNCT
ahs-14952	230	20	are	be	AUX
ahs-14952	230	21	considered	consider	VERB
ahs-14952	230	22	to	to	PART
ahs-14952	230	23	be	be	AUX
ahs-14952	230	24	broad­spectrum	broad­spectrum	ADJ
ahs-14952	230	25	primers	primer	NOUN
ahs-14952	230	26	.	.	PUNCT
ahs-14952	231	1	the	the	DET
ahs-14952	231	2	its1	its1	PROPN
ahs-14952	231	3	and	and	CCONJ
ahs-14952	231	4	its4	its4	PROPN
ahs-14952	231	5	primers	primer	NOUN
ahs-14952	231	6	are	be	AUX
ahs-14952	231	7	commonly	commonly	ADV
ahs-14952	231	8	employed	employ	VERB
ahs-14952	231	9	as	as	ADP
ahs-14952	231	10	standard	standard	ADJ
ahs-14952	231	11	primers	primer	NOUN
ahs-14952	231	12	in	in	ADP
ahs-14952	231	13	numerous	numerous	ADJ
ahs-14952	231	14	laboratories	laboratory	NOUN
ahs-14952	231	15	(	(	PUNCT
ahs-14952	231	16	fajarningsih	fajarningsih	NOUN
ahs-14952	231	17	,	,	PUNCT
ahs-14952	231	18	2016	2016	NUM
ahs-14952	231	19	)	)	PUNCT
ahs-14952	231	20	.	.	PUNCT
ahs-14952	232	1	the	the	DET
ahs-14952	232	2	list	list	NOUN
ahs-14952	232	3	of	of	ADP
ahs-14952	232	4	endophytic	endophytic	ADJ
ahs-14952	232	5	fungi	fungus	NOUN
ahs-14952	232	6	that	that	PRON
ahs-14952	232	7	have	have	AUX
ahs-14952	232	8	been	be	AUX
ahs-14952	232	9	isolated	isolate	VERB
ahs-14952	232	10	and	and	CCONJ
ahs-14952	232	11	identified	identify	VERB
ahs-14952	232	12	from	from	ADP
ahs-14952	232	13	orchid	orchid	NOUN
ahs-14952	232	14	roots	root	NOUN
ahs-14952	232	15	is	be	AUX
ahs-14952	232	16	presented	present	VERB
ahs-14952	232	17	in	in	ADP
ahs-14952	232	18	table	table	NOUN
ahs-14952	232	19	5	5	NUM
ahs-14952	232	20	.	.	PUNCT
ahs-14952	233	1	this	this	PRON
ahs-14952	233	2	was	be	AUX
ahs-14952	233	3	accomplished	accomplish	VERB
ahs-14952	233	4	by	by	ADP
ahs-14952	233	5	employing	employ	VERB
ahs-14952	233	6	a	a	DET
ahs-14952	233	7	broad­	broad­	NUM
ahs-14952	233	8	spectrum	spectrum	NOUN
ahs-14952	233	9	primer	primer	NOUN
ahs-14952	233	10	(	(	PUNCT
ahs-14952	233	11	its1	its1	PROPN
ahs-14952	233	12	and	and	CCONJ
ahs-14952	233	13	its4	its4	PROPN
ahs-14952	233	14	)	)	PUNCT
ahs-14952	233	15	.	.	PUNCT
ahs-14952	234	1	however	however	ADV
ahs-14952	234	2	,	,	PUNCT
ahs-14952	234	3	some	some	DET
ahs-14952	234	4	primers	primer	NOUN
ahs-14952	234	5	are	be	AUX
ahs-14952	234	6	designed	design	VERB
ahs-14952	234	7	to	to	PART
ahs-14952	234	8	be	be	AUX
ahs-14952	234	9	specific	specific	ADJ
ahs-14952	234	10	.	.	PUNCT
ahs-14952	235	1	for	for	ADP
ahs-14952	235	2	example	example	NOUN
ahs-14952	235	3	,	,	PUNCT
ahs-14952	235	4	the	the	DET
ahs-14952	235	5	its86f	its86f	ADJ
ahs-14952	235	6	primers	primer	NOUN
ahs-14952	235	7	are	be	AUX
ahs-14952	235	8	used	use	VERB
ahs-14952	235	9	primarily	primarily	ADV
ahs-14952	235	10	for	for	ADP
ahs-14952	235	11	medically	medically	ADV
ahs-14952	235	12	important	important	ADJ
ahs-14952	235	13	fungal	fungal	ADJ
ahs-14952	235	14	pathogen	pathogen	NOUN
ahs-14952	235	15	,	,	PUNCT
ahs-14952	235	16	but	but	CCONJ
ahs-14952	235	17	they	they	PRON
ahs-14952	235	18	are	be	AUX
ahs-14952	235	19	rarely	rarely	ADV
ahs-14952	235	20	used	use	VERB
ahs-14952	235	21	in	in	ADP
ahs-14952	235	22	mycorrhizal	mycorrhizal	NOUN
ahs-14952	235	23	identification	identification	NOUN
ahs-14952	235	24	,	,	PUNCT
ahs-14952	235	25	especially	especially	ADV
ahs-14952	235	26	fungi	fungi	VERB
ahs-14952	235	27	communities	community	NOUN
ahs-14952	235	28	from	from	ADP
ahs-14952	235	29	environmental	environmental	ADJ
ahs-14952	235	30	samples	sample	NOUN
ahs-14952	235	31	.	.	PUNCT
ahs-14952	236	1	in	in	ADP
ahs-14952	236	2	orchid	orchid	NOUN
ahs-14952	236	3	mycorrhizal	mycorrhizal	NOUN
ahs-14952	236	4	fungi	fungus	NOUN
ahs-14952	236	5	identification	identification	NOUN
ahs-14952	236	6	,	,	PUNCT
ahs-14952	236	7	the	the	DET
ahs-14952	236	8	its1­f	its1­f	NOUN
ahs-14952	236	9	is	be	AUX
ahs-14952	236	10	one	one	NUM
ahs-14952	236	11	of	of	ADP
ahs-14952	236	12	the	the	DET
ahs-14952	236	13	most	most	ADV
ahs-14952	236	14	effective	effective	ADJ
ahs-14952	236	15	primers	primer	NOUN
ahs-14952	236	16	for	for	ADP
ahs-14952	236	17	the	the	DET
ahs-14952	236	18	its	its	PRON
ahs-14952	236	19	region	region	NOUN
ahs-14952	236	20	amplification	amplification	NOUN
ahs-14952	236	21	,	,	PUNCT
ahs-14952	236	22	especially	especially	ADV
ahs-14952	236	23	for	for	ADP
ahs-14952	236	24	eumycota	eumycota	NOUN
ahs-14952	236	25	.	.	PUNCT
ahs-14952	237	1	for	for	ADP
ahs-14952	237	2	example	example	NOUN
ahs-14952	237	3	,	,	PUNCT
ahs-14952	237	4	the	the	DET
ahs-14952	237	5	primer	primer	NOUN
ahs-14952	237	6	its1­f	its1­f	PROPN
ahs-14952	237	7	and	and	CCONJ
ahs-14952	237	8	its4	its4	PROPN
ahs-14952	237	9	always	always	ADV
ahs-14952	237	10	used	use	VERB
ahs-14952	237	11	in	in	ADP
ahs-14952	237	12	pair	pair	NOUN
ahs-14952	237	13	to	to	PART
ahs-14952	237	14	identified	identify	VERB
ahs-14952	237	15	an	an	DET
ahs-14952	237	16	fusarium	fusarium	NOUN
ahs-14952	237	17	sp	sp	NOUN
ahs-14952	237	18	.	.	PUNCT
ahs-14952	238	1	as	as	ADP
ahs-14952	238	2	in	in	ADP
ahs-14952	238	3	the	the	DET
ahs-14952	238	4	study	study	NOUN
ahs-14952	238	5	by	by	ADP
ahs-14952	238	6	sukarno	sukarno	PROPN
ahs-14952	238	7	et	et	PROPN
ahs-14952	238	8	al	al	PROPN
ahs-14952	238	9	.	.	PROPN
ahs-14952	238	10	(	(	PUNCT
ahs-14952	238	11	2023	2023	NUM
ahs-14952	238	12	)	)	PUNCT
ahs-14952	238	13	,	,	PUNCT
ahs-14952	238	14	where	where	SCONJ
ahs-14952	238	15	they	they	PRON
ahs-14952	238	16	manage	manage	VERB
ahs-14952	238	17	to	to	PART
ahs-14952	238	18	identified	identify	VERB
ahs-14952	238	19	several	several	ADJ
ahs-14952	238	20	species	specie	NOUN
ahs-14952	238	21	of	of	ADP
ahs-14952	238	22	fusarium	fusarium	NOUN
ahs-14952	238	23	using	use	VERB
ahs-14952	238	24	this	this	DET
ahs-14952	238	25	primer	primer	NOUN
ahs-14952	238	26	combination	combination	NOUN
ahs-14952	238	27	.	.	PUNCT
ahs-14952	239	1	the	the	DET
ahs-14952	239	2	its1­f	its1­f	PROPN
ahs-14952	239	3	and	and	CCONJ
ahs-14952	239	4	its4­b	its4­b	NOUN
ahs-14952	239	5	primer	primer	NOUN
ahs-14952	239	6	were	be	AUX
ahs-14952	239	7	designed	design	VERB
ahs-14952	239	8	to	to	PART
ahs-14952	239	9	be	be	AUX
ahs-14952	239	10	specific	specific	ADJ
ahs-14952	239	11	basidiomycetes	basidiomycete	NOUN
ahs-14952	239	12	(	(	PUNCT
ahs-14952	239	13	gardes	garde	NOUN
ahs-14952	239	14	and	and	CCONJ
ahs-14952	239	15	bruns	brun	NOUN
ahs-14952	239	16	,	,	PUNCT
ahs-14952	239	17	1993	1993	NUM
ahs-14952	239	18	)	)	PUNCT
ahs-14952	239	19	.	.	PUNCT
ahs-14952	240	1	besides	besides	SCONJ
ahs-14952	240	2	that	that	PRON
ahs-14952	240	3	,	,	PUNCT
ahs-14952	240	4	both	both	DET
ahs-14952	240	5	primers	primer	NOUN
ahs-14952	240	6	can	can	AUX
ahs-14952	240	7	minimise	minimise	VERB
ahs-14952	240	8	plant	plant	NOUN
ahs-14952	240	9	sequence	sequence	NOUN
ahs-14952	240	10	amplification	amplification	NOUN
ahs-14952	240	11	(	(	PUNCT
ahs-14952	240	12	taylor	taylor	PROPN
ahs-14952	240	13	and	and	CCONJ
ahs-14952	240	14	mccormick	mccormick	PROPN
ahs-14952	240	15	,	,	PUNCT
ahs-14952	240	16	2008	2008	NUM
ahs-14952	240	17	)	)	PUNCT
ahs-14952	240	18	.	.	PUNCT
ahs-14952	241	1	however	however	ADV
ahs-14952	241	2	,	,	PUNCT
ahs-14952	241	3	this	this	DET
ahs-14952	241	4	primer	primer	NOUN
ahs-14952	241	5	is	be	AUX
ahs-14952	241	6	ineffective	ineffective	ADJ
ahs-14952	241	7	in	in	ADP
ahs-14952	241	8	amplifying	amplify	VERB
ahs-14952	241	9	some	some	DET
ahs-14952	241	10	species	specie	NOUN
ahs-14952	241	11	of	of	ADP
ahs-14952	241	12	tulasnellaceae	tulasnellaceae	NOUN
ahs-14952	241	13	that	that	PRON
ahs-14952	241	14	belong	belong	VERB
ahs-14952	241	15	to	to	ADP
ahs-14952	241	16	basidiomycota	basidiomycota	PROPN
ahs-14952	241	17	phylum	phylum	NOUN
ahs-14952	241	18	,	,	PUNCT
ahs-14952	241	19	as	as	SCONJ
ahs-14952	241	20	their	their	PRON
ahs-14952	241	21	nuclear	nuclear	ADJ
ahs-14952	241	22	ribosomal	ribosomal	NOUN
ahs-14952	241	23	is	be	AUX
ahs-14952	241	24	evolving	evolve	VERB
ahs-14952	241	25	rapidly	rapidly	ADV
ahs-14952	241	26	and	and	CCONJ
ahs-14952	241	27	some	some	DET
ahs-14952	241	28	primers	primer	NOUN
ahs-14952	241	29	are	be	AUX
ahs-14952	241	30	typically	typically	ADV
ahs-14952	241	31	conserved	conserve	VERB
ahs-14952	241	32	along	along	ADP
ahs-14952	241	33	the	the	DET
ahs-14952	241	34	eumycota	eumycota	NOUN
ahs-14952	241	35	are	be	AUX
ahs-14952	241	36	not	not	PART
ahs-14952	241	37	maintained	maintain	VERB
ahs-14952	241	38	in	in	ADP
ahs-14952	241	39	tulasnellaceae	tulasnellaceae	ADJ
ahs-14952	241	40	table	table	NOUN
ahs-14952	241	41	3	3	NUM
ahs-14952	241	42	­	­	NOUN
ahs-14952	241	43	list	list	NOUN
ahs-14952	241	44	of	of	ADP
ahs-14952	241	45	recommended	recommend	VERB
ahs-14952	241	46	primer	primer	NOUN
ahs-14952	241	47	for	for	ADP
ahs-14952	241	48	identification	identification	NOUN
ahs-14952	241	49	of	of	ADP
ahs-14952	241	50	orchid	orchid	NOUN
ahs-14952	241	51	mycorrhizal	mycorrhizal	NOUN
ahs-14952	241	52	primer	primer	NOUN
ahs-14952	241	53	sequence	sequence	NOUN
ahs-14952	241	54	(	(	PUNCT
ahs-14952	241	55	5’­3	5’­3	PROPN
ahs-14952	241	56	'	'	NUM
ahs-14952	241	57	)	)	PUNCT
ahs-14952	241	58	references	reference	NOUN
ahs-14952	241	59	modified	modify	VERB
ahs-14952	241	60	its1ngs	its1ng	NOUN
ahs-14952	241	61	tccgtaggtgaacctgc	tccgtaggtgaacctgc	VERB
ahs-14952	241	62	oja	oja	PROPN
ahs-14952	241	63	et	et	PROPN
ahs-14952	241	64	al	al	PROPN
ahs-14952	241	65	.	.	PROPN
ahs-14952	242	1	(	(	PUNCT
ahs-14952	242	2	2014	2014	NUM
ahs-14952	242	3	)	)	PUNCT
ahs-14952	242	4	modified	modify	VERB
ahs-14952	242	5	its1fngs	its1fngs	PROPN
ahs-14952	242	6	ggtcatttagaggaagtaa	ggtcatttagaggaagtaa	PROPN
ahs-14952	242	7	oja	oja	PROPN
ahs-14952	242	8	et	et	PROPN
ahs-14952	242	9	al	al	PROPN
ahs-14952	242	10	.	.	PROPN
ahs-14952	243	1	(	(	PUNCT
ahs-14952	243	2	2014	2014	NUM
ahs-14952	243	3	)	)	PUNCT
ahs-14952	243	4	modified	modify	VERB
ahs-14952	243	5	its4ngs	its4ng	NOUN
ahs-14952	243	6	tcctscgcttattgatatgc	tcctscgcttattgatatgc	ADJ
ahs-14952	243	7	oja	oja	NOUN
ahs-14952	243	8	et	et	NOUN
ahs-14952	243	9	al	al	PROPN
ahs-14952	243	10	.	.	PROPN
ahs-14952	244	1	(	(	PUNCT
ahs-14952	244	2	2014	2014	NUM
ahs-14952	244	3	)	)	PUNCT
ahs-14952	244	4	its4tul2	its4tul2	VERB
ahs-14952	244	5	ttcttttcctccgctgawta	ttcttttcctccgctgawta	PROPN
ahs-14952	244	6	oja	oja	PROPN
ahs-14952	244	7	et	et	PROPN
ahs-14952	244	8	al	al	PROPN
ahs-14952	244	9	.	.	PROPN
ahs-14952	245	1	(	(	PUNCT
ahs-14952	245	2	2014	2014	NUM
ahs-14952	245	3	)	)	PUNCT
ahs-14952	246	1	tw14ngs	tw14ng	NOUN
ahs-14952	246	2	ctatcctgrgrgaaayttc	ctatcctgrgrgaaayttc	NOUN
ahs-14952	246	3	tedersoo	tedersoo	VERB
ahs-14952	246	4	et	et	PROPN
ahs-14952	246	5	al	al	PROPN
ahs-14952	246	6	.	.	PROPN
ahs-14952	247	1	(	(	PUNCT
ahs-14952	247	2	2014	2014	NUM
ahs-14952	247	3	)	)	PUNCT
ahs-14952	247	4	fits9	fits9	NOUN
ahs-14952	248	1	gaacgcagcraaiigyga	gaacgcagcraaiigyga	NOUN
ahs-14952	248	2	ihrmark	ihrmark	PROPN
ahs-14952	248	3	et	et	PROPN
ahs-14952	248	4	al	al	PROPN
ahs-14952	248	5	.	.	PROPN
ahs-14952	249	1	(	(	PUNCT
ahs-14952	249	2	2012	2012	NUM
ahs-14952	249	3	)	)	PUNCT
ahs-14952	249	4	gits7	gits7	PROPN
ahs-14952	250	1	gtgartcatcgartctttg	gtgartcatcgartctttg	PROPN
ahs-14952	250	2	ihrmark	ihrmark	PROPN
ahs-14952	250	3	et	et	PROPN
ahs-14952	250	4	al	al	PROPN
ahs-14952	250	5	.	.	PROPN
ahs-14952	251	1	(	(	PUNCT
ahs-14952	251	2	2012	2012	NUM
ahs-14952	251	3	)	)	PUNCT
ahs-14952	251	4	fits7	fits7	NOUN
ahs-14952	251	5	gtgartcatcgaatcttc	gtgartcatcgaatcttc	NOUN
ahs-14952	251	6	ihrmark	ihrmark	NOUN
ahs-14952	251	7	et	et	PROPN
ahs-14952	251	8	al	al	PROPN
ahs-14952	251	9	.	.	PROPN
ahs-14952	252	1	(	(	PUNCT
ahs-14952	252	2	2012	2012	NUM
ahs-14952	252	3	)	)	PUNCT
ahs-14952	252	4	its4tul	its4tul	PROPN
ahs-14952	252	5	ccgccagattcacacattga	ccgccagattcacacattga	NOUN
ahs-14952	252	6	taylors	taylor	NOUN
ahs-14952	252	7	and	and	CCONJ
ahs-14952	252	8	mccormick	mccormick	PROPN
ahs-14952	252	9	(	(	PUNCT
ahs-14952	252	10	2008	2008	NUM
ahs-14952	252	11	)	)	PUNCT
ahs-14952	253	1	its1­of	its1­of	PROPN
ahs-14952	253	2	aactcggccatttagaggaagt	aactcggccatttagaggaagt	ADP
ahs-14952	253	3	/	/	SYM
ahs-14952	253	4	aacttggtcatttagaggaagt	aacttggtcatttagaggaagt	PRON
ahs-14952	253	5	taylors	taylor	NOUN
ahs-14952	253	6	and	and	CCONJ
ahs-14952	253	7	mccormick	mccormick	PROPN
ahs-14952	253	8	(	(	PUNCT
ahs-14952	253	9	2008	2008	NUM
ahs-14952	253	10	)	)	PUNCT
ahs-14952	253	11	its4­of	its4­of	PROPN
ahs-14952	253	12	gttactaggggaatccttgtt	gttactaggggaatccttgtt	NOUN
ahs-14952	253	13	taylors	taylor	NOUN
ahs-14952	253	14	and	and	CCONJ
ahs-14952	253	15	mccormick	mccormick	PROPN
ahs-14952	253	16	(	(	PUNCT
ahs-14952	253	17	2008	2008	NUM
ahs-14952	253	18	)	)	PUNCT
ahs-14952	253	19	its86f	its86f	NOUN
ahs-14952	253	20	gtgaatcatcgaatctttgaa	gtgaatcatcgaatctttgaa	NOUN
ahs-14952	253	21	turenne	turenne	NOUN
ahs-14952	253	22	et	et	PROPN
ahs-14952	253	23	al	al	PROPN
ahs-14952	253	24	.	.	PROPN
ahs-14952	254	1	(	(	PUNCT
ahs-14952	254	2	1999	1999	NUM
ahs-14952	254	3	)	)	PUNCT
ahs-14952	255	1	its1f	its1f	PROPN
ahs-14952	255	2	cttggtcatttagaggaagtaa	cttggtcatttagaggaagtaa	PROPN
ahs-14952	255	3	gardes	gardes	PROPN
ahs-14952	255	4	and	and	CCONJ
ahs-14952	255	5	bruns	brun	NOUN
ahs-14952	255	6	(	(	PUNCT
ahs-14952	255	7	1993	1993	NUM
ahs-14952	255	8	)	)	PUNCT
ahs-14952	256	1	its4b	its4b	PROPN
ahs-14952	256	2	caggagacttgtacacggtccag	caggagacttgtacacggtccag	VERB
ahs-14952	256	3	gardes	gardes	PROPN
ahs-14952	256	4	and	and	CCONJ
ahs-14952	256	5	bruns	brun	NOUN
ahs-14952	256	6	(	(	PUNCT
ahs-14952	256	7	1993	1993	NUM
ahs-14952	256	8	)	)	PUNCT
ahs-14952	256	9	its1	its1	PROPN
ahs-14952	256	10	tccgtaggtgaacctgcgg	tccgtaggtgaacctgcgg	PROPN
ahs-14952	256	11	white	white	PROPN
ahs-14952	256	12	et	et	PROPN
ahs-14952	256	13	al	al	PROPN
ahs-14952	256	14	.	.	PROPN
ahs-14952	257	1	(	(	PUNCT
ahs-14952	257	2	1990	1990	NUM
ahs-14952	257	3	)	)	PUNCT
ahs-14952	257	4	its2	its2	PROPN
ahs-14952	257	5	gctgcgttcttcatcgatgc	gctgcgttcttcatcgatgc	VERB
ahs-14952	257	6	white	white	PROPN
ahs-14952	257	7	et	et	PROPN
ahs-14952	257	8	al	al	PROPN
ahs-14952	257	9	.	.	PROPN
ahs-14952	258	1	(	(	PUNCT
ahs-14952	258	2	1990	1990	NUM
ahs-14952	258	3	)	)	PUNCT
ahs-14952	258	4	its3	its3	NOUN
ahs-14952	258	5	gcatcgatgaagaacgcagc	gcatcgatgaagaacgcagc	X
ahs-14952	258	6	white	white	PROPN
ahs-14952	258	7	et	et	PROPN
ahs-14952	258	8	al	al	PROPN
ahs-14952	258	9	.	.	PROPN
ahs-14952	259	1	(	(	PUNCT
ahs-14952	259	2	1990	1990	NUM
ahs-14952	259	3	)	)	PUNCT
ahs-14952	259	4	its4	its4	PROPN
ahs-14952	259	5	tcctccgcttattgatatgc	tcctccgcttattgatatgc	NOUN
ahs-14952	259	6	white	white	PROPN
ahs-14952	259	7	et	et	PROPN
ahs-14952	259	8	al	al	PROPN
ahs-14952	259	9	.	.	PROPN
ahs-14952	260	1	(	(	PUNCT
ahs-14952	260	2	1990	1990	NUM
ahs-14952	260	3	)	)	PUNCT
ahs-14952	260	4	ns7	ns7	PROPN
ahs-14952	260	5	gaggcaataacaggtctgtgatgc	gaggcaataacaggtctgtgatgc	VERB
ahs-14952	260	6	white	white	PROPN
ahs-14952	260	7	et	et	PROPN
ahs-14952	260	8	al	al	PROPN
ahs-14952	260	9	.	.	PROPN
ahs-14952	261	1	(	(	PUNCT
ahs-14952	261	2	1990	1990	NUM
ahs-14952	261	3	)	)	PUNCT
ahs-14952	261	4	cnl2f	cnl2f	PRON
ahs-14952	261	5	gtttcccttttaacaatttcac	gtttcccttttaacaatttcac	NOUN
ahs-14952	261	6	white	white	PROPN
ahs-14952	261	7	et	et	PROPN
ahs-14952	261	8	al	al	PROPN
ahs-14952	261	9	.	.	PROPN
ahs-14952	262	1	(	(	PUNCT
ahs-14952	262	2	1990	1990	NUM
ahs-14952	262	3	)	)	PUNCT
ahs-14952	262	4	107	107	NUM
ahs-14952	262	5	table	table	NOUN
ahs-14952	262	6	4	4	NUM
ahs-14952	262	7	­	­	NOUN
ahs-14952	262	8	list	list	NOUN
ahs-14952	262	9	of	of	ADP
ahs-14952	262	10	recommended	recommend	VERB
ahs-14952	262	11	primer	primer	NOUN
ahs-14952	262	12	pair	pair	NOUN
ahs-14952	262	13	for	for	ADP
ahs-14952	262	14	sequencing	sequence	VERB
ahs-14952	262	15	of	of	ADP
ahs-14952	262	16	orchid	orchid	NOUN
ahs-14952	262	17	mycorrhizal	mycorrhizal	NOUN
ahs-14952	262	18	partners	partner	NOUN
ahs-14952	262	19	primer	primer	NOUN
ahs-14952	262	20	pair	pair	NOUN
ahs-14952	262	21	primer	primer	NOUN
ahs-14952	262	22	name	name	NOUN
ahs-14952	262	23	(	(	PUNCT
ahs-14952	262	24	forward/	forward/	NOUN
ahs-14952	262	25	reverse	reverse	VERB
ahs-14952	262	26	)	)	PUNCT
ahs-14952	262	27	sequence	sequence	NOUN
ahs-14952	262	28	(	(	PUNCT
ahs-14952	262	29	5’­3	5’­3	PROPN
ahs-14952	262	30	'	'	PUNCT
ahs-14952	262	31	)	)	PUNCT
ahs-14952	262	32	target	target	NOUN
ahs-14952	262	33	region	region	NOUN
ahs-14952	262	34	annealing	anneal	VERB
ahs-14952	262	35	temp	temp	NOUN
ahs-14952	262	36	(	(	PUNCT
ahs-14952	262	37	oc	oc	NOUN
ahs-14952	262	38	)	)	PUNCT
ahs-14952	262	39	target	target	NOUN
ahs-14952	262	40	clade	clade	NOUN
ahs-14952	262	41	(	(	PUNCT
ahs-14952	262	42	orchid	orchid	NOUN
ahs-14952	262	43	specific	specific	ADJ
ahs-14952	262	44	group	group	NOUN
ahs-14952	262	45	fungi	fungus	NOUN
ahs-14952	262	46	)	)	PUNCT
ahs-14952	262	47	references	reference	NOUN
ahs-14952	262	48	its1	its1	PROPN
ahs-14952	262	49	/	/	SYM
ahs-14952	262	50	its4	its4	PROPN
ahs-14952	262	51	its1	its1	PROPN
ahs-14952	262	52	(	(	PUNCT
ahs-14952	262	53	f	f	X
ahs-14952	262	54	)	)	PUNCT
ahs-14952	262	55	tccgtaggtgaacctgcgg	tccgtaggtgaacctgcgg	PROPN
ahs-14952	262	56	its1	its1	PROPN
ahs-14952	262	57	/	/	PUNCT
ahs-14952	262	58	its2	its2	PROPN
ahs-14952	262	59	53	53	NUM
ahs-14952	262	60	all	all	DET
ahs-14952	262	61	basidiomycota	basidiomycota	PROPN
ahs-14952	262	62	white	white	PROPN
ahs-14952	262	63	et	et	PROPN
ahs-14952	262	64	al	al	PROPN
ahs-14952	262	65	.	.	PROPN
ahs-14952	263	1	(	(	PUNCT
ahs-14952	263	2	1990	1990	NUM
ahs-14952	263	3	)	)	PUNCT
ahs-14952	263	4	its4	its4	PROPN
ahs-14952	263	5	(	(	PUNCT
ahs-14952	263	6	r	r	NOUN
ahs-14952	263	7	)	)	PUNCT
ahs-14952	263	8	tcctccgcttattgatatgc	tcctccgcttattgatatgc	NOUN
ahs-14952	263	9	its1/	its1/	PRON
ahs-14952	264	1	its4­	its4­	INTJ
ahs-14952	264	2	tul	tul	PROPN
ahs-14952	264	3	its1	its1	PROPN
ahs-14952	264	4	(	(	PUNCT
ahs-14952	264	5	f	f	X
ahs-14952	264	6	)	)	PUNCT
ahs-14952	264	7	tccgtaggtgaacctgcgg	tccgtaggtgaacctgcgg	PROPN
ahs-14952	264	8	its1	its1	PROPN
ahs-14952	264	9	/	/	PUNCT
ahs-14952	264	10	its2	its2	PROPN
ahs-14952	264	11	54	54	NUM
ahs-14952	264	12	tulasnella	tulasnella	NOUN
ahs-14952	264	13	taylor	taylor	PROPN
ahs-14952	264	14	and	and	CCONJ
ahs-14952	264	15	mccormick	mccormick	PROPN
ahs-14952	264	16	(	(	PUNCT
ahs-14952	264	17	2008	2008	NUM
ahs-14952	264	18	)	)	PUNCT
ahs-14952	264	19	its4­tul	its4­tul	PROPN
ahs-14952	264	20	ccgccagattcacacattga	ccgccagattcacacattga	NOUN
ahs-14952	264	21	its1­of	its1­of	PROPN
ahs-14952	264	22	/	/	SYM
ahs-14952	264	23	its4­of	its4­of	PROPN
ahs-14952	264	24	its1­of	its1­of	PROPN
ahs-14952	264	25	(	(	PUNCT
ahs-14952	264	26	f	f	X
ahs-14952	264	27	)	)	PUNCT
ahs-14952	264	28	aactcggccatttagaggaagt	aactcggccatttagaggaagt	ADP
ahs-14952	264	29	its1	its1	PROPN
ahs-14952	264	30	/	/	PUNCT
ahs-14952	264	31	its2	its2	PROPN
ahs-14952	264	32	60	60	NUM
ahs-14952	264	33	all	all	DET
ahs-14952	264	34	basidiomycota	basidiomycota	PROPN
ahs-14952	264	35	taylor	taylor	PROPN
ahs-14952	264	36	and	and	CCONJ
ahs-14952	264	37	mccormick	mccormick	PROPN
ahs-14952	264	38	(	(	PUNCT
ahs-14952	264	39	2008	2008	NUM
ahs-14952	264	40	)	)	PUNCT
ahs-14952	264	41	its1­of	its1­of	PROPN
ahs-14952	264	42	(	(	PUNCT
ahs-14952	264	43	f	f	X
ahs-14952	264	44	)	)	PUNCT
ahs-14952	264	45	aacttggtcatttagaggaagt	aacttggtcatttagaggaagt	NOUN
ahs-14952	264	46	its4­of	its4­of	PROPN
ahs-14952	264	47	(	(	PUNCT
ahs-14952	264	48	r	r	NOUN
ahs-14952	264	49	)	)	PUNCT
ahs-14952	264	50	gttactaggggaatccttgtt	gttactaggggaatccttgtt	NOUN
ahs-14952	264	51	ssu1318­tom	ssu1318­tom	PROPN
ahs-14952	264	52	/	/	SYM
ahs-14952	264	53	lsu­tom4	lsu­tom4	PROPN
ahs-14952	264	54	ssu1318­tom	ssu1318­tom	PROPN
ahs-14952	264	55	(	(	PUNCT
ahs-14952	264	56	f	f	X
ahs-14952	264	57	)	)	PUNCT
ahs-14952	264	58	cgataacgaacgagaccttat	cgataacgaacgagaccttat	PROPN
ahs-14952	264	59	ssu	ssu	PROPN
ahs-14952	264	60	/	/	SYM
ahs-14952	264	61	lsu	lsu	NOUN
ahs-14952	264	62	62	62	NUM
ahs-14952	264	63	thelephoraceae	thelephoraceae	NOUN
ahs-14952	264	64	taylor	taylor	PROPN
ahs-14952	264	65	and	and	CCONJ
ahs-14952	264	66	mccormick	mccormick	PROPN
ahs-14952	264	67	(	(	PUNCT
ahs-14952	264	68	2008	2008	NUM
ahs-14952	264	69	)	)	PUNCT
ahs-14952	264	70	lsu­tom4	lsu­tom4	PROPN
ahs-14952	265	1	gccctgttccaagagactta	gccctgttccaagagactta	PROPN
ahs-14952	265	2	its86f	its86f	PROPN
ahs-14952	265	3	/	/	SYM
ahs-14952	265	4	its4	its4	PROPN
ahs-14952	265	5	its86f	its86f	NOUN
ahs-14952	265	6	(	(	PUNCT
ahs-14952	265	7	f	f	X
ahs-14952	265	8	)	)	PUNCT
ahs-14952	265	9	gtgaatcatcgaatctttgaa	gtgaatcatcgaatctttgaa	NOUN
ahs-14952	265	10	its­2	its­2	VERB
ahs-14952	265	11	59	59	NUM
ahs-14952	265	12	both	both	CCONJ
ahs-14952	265	13	ascomycota	ascomycota	NOUN
ahs-14952	265	14	and	and	CCONJ
ahs-14952	265	15	basidiomycota	basidiomycota	PROPN
ahs-14952	265	16	white	white	PROPN
ahs-14952	265	17	et	et	PROPN
ahs-14952	265	18	al	al	PROPN
ahs-14952	265	19	.	.	PROPN
ahs-14952	266	1	(	(	PUNCT
ahs-14952	266	2	1990	1990	NUM
ahs-14952	266	3	)	)	PUNCT
ahs-14952	266	4	its4	its4	PROPN
ahs-14952	266	5	(	(	PUNCT
ahs-14952	266	6	r	r	NOUN
ahs-14952	266	7	)	)	PUNCT
ahs-14952	266	8	tcctccgcttattgatatgc	tcctccgcttattgatatgc	NOUN
ahs-14952	266	9	(	(	PUNCT
ahs-14952	266	10	including	include	VERB
ahs-14952	266	11	some	some	DET
ahs-14952	266	12	tulasnella	tulasnella	NOUN
ahs-14952	266	13	)	)	PUNCT
ahs-14952	266	14	its3	its3	PROPN
ahs-14952	266	15	/	/	SYM
ahs-14952	266	16	its4of	its4of	PROPN
ahs-14952	266	17	its3	its3	NOUN
ahs-14952	266	18	(	(	PUNCT
ahs-14952	266	19	f	f	X
ahs-14952	266	20	)	)	PUNCT
ahs-14952	266	21	gcatcgatgaagaacgcagc	gcatcgatgaagaacgcagc	X
ahs-14952	266	22	its­2	its­2	VERB
ahs-14952	266	23	62	62	NUM
ahs-14952	266	24	all	all	DET
ahs-14952	266	25	basidomycota	basidomycota	ADJ
ahs-14952	266	26	white	white	PROPN
ahs-14952	266	27	et	et	PROPN
ahs-14952	266	28	al	al	PROPN
ahs-14952	266	29	.	.	PROPN
ahs-14952	267	1	(	(	PUNCT
ahs-14952	267	2	1990	1990	NUM
ahs-14952	267	3	)	)	PUNCT
ahs-14952	267	4	its4of	its4of	PROPN
ahs-14952	267	5	(	(	PUNCT
ahs-14952	267	6	r	r	NOUN
ahs-14952	267	7	)	)	PUNCT
ahs-14952	267	8	gttactaggggaatccttgtt	gttactaggggaatccttgtt	NOUN
ahs-14952	267	9	taylor	taylor	PROPN
ahs-14952	267	10	and	and	CCONJ
ahs-14952	267	11	mccormick	mccormick	PROPN
ahs-14952	267	12	(	(	PUNCT
ahs-14952	267	13	2008	2008	NUM
ahs-14952	267	14	)	)	PUNCT
ahs-14952	268	1	5.8s­tulngs	5.8s­tulngs	NUM
ahs-14952	268	2	/	/	SYM
ahs-14952	268	3	its4­tul2	its4­tul2	PROPN
ahs-14952	268	4	5.8s­tulngs	5.8s­tulngs	PROPN
ahs-14952	268	5	cattcgatgaagaccgttgc	cattcgatgaagaccgttgc	NOUN
ahs-14952	268	6	its­2	its­2	ADP
ahs-14952	268	7	57	57	NUM
ahs-14952	268	8	all	all	DET
ahs-14952	268	9	basidiomycota	basidiomycota	PROPN
ahs-14952	268	10	(	(	PUNCT
ahs-14952	268	11	inc	inc	PROPN
ahs-14952	268	12	.	.	PROPN
ahs-14952	268	13	serendipitaceae	serendipitaceae	PROPN
ahs-14952	268	14	and	and	CCONJ
ahs-14952	268	15	rammitsu	rammitsu	VERB
ahs-14952	268	16	et	et	PROPN
ahs-14952	268	17	al	al	PROPN
ahs-14952	268	18	.	.	PROPN
ahs-14952	268	19	(	(	PUNCT
ahs-14952	268	20	2021	2021	NUM
ahs-14952	268	21	)	)	PUNCT
ahs-14952	268	22	its4­tul2	its4­tul2	NOUN
ahs-14952	268	23	ttcttttcctccgctgawta	ttcttttcctccgctgawta	NOUN
ahs-14952	268	24	tulasnellaceae	tulasnellaceae	ADV
ahs-14952	268	25	)	)	PUNCT
ahs-14952	268	26	oja	oja	PROPN
ahs-14952	268	27	et	et	PROPN
ahs-14952	268	28	al	al	PROPN
ahs-14952	268	29	.	.	PROPN
ahs-14952	269	1	(	(	PUNCT
ahs-14952	269	2	2014	2014	NUM
ahs-14952	269	3	)	)	PUNCT
ahs-14952	269	4	ns7	ns7	PROPN
ahs-14952	269	5	/	/	SYM
ahs-14952	269	6	its1of­rc	its1of­rc	PROPN
ahs-14952	269	7	ns7	ns7	PROPN
ahs-14952	269	8	(	(	PUNCT
ahs-14952	269	9	f	f	X
ahs-14952	269	10	)	)	PUNCT
ahs-14952	269	11	gaggcaataacaggtctgtgatgc	gaggcaataacaggtctgtgatgc	VERB
ahs-14952	269	12	ssu	ssu	PROPN
ahs-14952	269	13	62	62	NUM
ahs-14952	269	14	some	some	DET
ahs-14952	269	15	ascomycota	ascomycota	NOUN
ahs-14952	269	16	and	and	CCONJ
ahs-14952	269	17	basidiomycota	basidiomycota	NOUN
ahs-14952	269	18	(	(	PUNCT
ahs-14952	269	19	including	include	VERB
ahs-14952	269	20	some	some	DET
ahs-14952	269	21	tulasnella	tulasnella	NOUN
ahs-14952	269	22	)	)	PUNCT
ahs-14952	269	23	white	white	PROPN
ahs-14952	269	24	et	et	PROPN
ahs-14952	269	25	al	al	PROPN
ahs-14952	269	26	.	.	PROPN
ahs-14952	270	1	(	(	PUNCT
ahs-14952	270	2	1990	1990	NUM
ahs-14952	270	3	)	)	PUNCT
ahs-14952	270	4	its1of­rc­g	its1of­rc­g	PUNCT
ahs-14952	270	5	(	(	PUNCT
ahs-14952	270	6	r	r	NOUN
ahs-14952	270	7	)	)	PUNCT
ahs-14952	270	8	acttcctctaaatggccgagtt	acttcctctaaatggccgagtt	NOUN
ahs-14952	270	9	waud	waud	VERB
ahs-14952	270	10	et	et	PROPN
ahs-14952	270	11	al	al	PROPN
ahs-14952	270	12	.	.	PROPN
ahs-14952	271	1	(	(	PUNCT
ahs-14952	271	2	2014	2014	NUM
ahs-14952	271	3	)	)	PUNCT
ahs-14952	271	4	its1of­rc­a	its1of­rc­a	PRON
ahs-14952	271	5	(	(	PUNCT
ahs-14952	271	6	r	r	NOUN
ahs-14952	271	7	)	)	PUNCT
ahs-14952	271	8	acttcctctaaatgaccaagtt	acttcctctaaatgaccaagtt	NOUN
ahs-14952	271	9	waud	waud	NOUN
ahs-14952	271	10	et	et	PROPN
ahs-14952	271	11	al	al	PROPN
ahs-14952	271	12	.	.	PROPN
ahs-14952	272	1	(	(	PUNCT
ahs-14952	272	2	2014	2014	NUM
ahs-14952	272	3	)	)	PUNCT
ahs-14952	272	4	its1of	its1of	PROPN
ahs-14952	272	5	/	/	SYM
ahs-14952	272	6	its2	its2	PROPN
ahs-14952	272	7	m	m	PROPN
ahs-14952	272	8	its1­of	its1­of	PROPN
ahs-14952	272	9	(	(	PUNCT
ahs-14952	272	10	f	f	X
ahs-14952	272	11	)	)	PUNCT
ahs-14952	272	12	aactcggccatttagaggaagt	aactcggccatttagaggaagt	ADP
ahs-14952	272	13	its­1	its­1	ADV
ahs-14952	272	14	62	62	NUM
ahs-14952	272	15	some	some	DET
ahs-14952	272	16	ascomycota	ascomycota	NOUN
ahs-14952	272	17	and	and	CCONJ
ahs-14952	272	18	basidiomycota	basidiomycota	NOUN
ahs-14952	272	19	(	(	PUNCT
ahs-14952	272	20	including	include	VERB
ahs-14952	272	21	some	some	DET
ahs-14952	272	22	tulasnella	tulasnella	NOUN
ahs-14952	272	23	)	)	PUNCT
ahs-14952	272	24	taylor	taylor	PROPN
ahs-14952	272	25	and	and	CCONJ
ahs-14952	272	26	mccormick	mccormick	PROPN
ahs-14952	272	27	(	(	PUNCT
ahs-14952	272	28	2008	2008	NUM
ahs-14952	272	29	)	)	PUNCT
ahs-14952	273	1	its1­of	its1­of	PROPN
ahs-14952	273	2	(	(	PUNCT
ahs-14952	273	3	f	f	X
ahs-14952	273	4	)	)	PUNCT
ahs-14952	273	5	aacttggtcatttagaggaagt	aacttggtcatttagaggaagt	NOUN
ahs-14952	273	6	its	its	PRON
ahs-14952	273	7	2	2	NUM
ahs-14952	273	8	m	m	NOUN
ahs-14952	273	9	tcgctgcgttcttcatcga	tcgctgcgttcttcatcga	ADJ
ahs-14952	273	10	its1f	its1f	PROPN
ahs-14952	273	11	/	/	SYM
ahs-14952	273	12	its2	its2	NOUN
ahs-14952	273	13	its1f	its1f	PROPN
ahs-14952	274	1	(	(	PUNCT
ahs-14952	274	2	f	f	X
ahs-14952	274	3	)	)	PUNCT
ahs-14952	274	4	cttggtcatttagaggaagtaa	cttggtcatttagaggaagtaa	PROPN
ahs-14952	274	5	its­1	its­1	VERB
ahs-14952	274	6	62	62	NUM
ahs-14952	274	7	both	both	CCONJ
ahs-14952	274	8	ascomycota	ascomycota	NOUN
ahs-14952	274	9	and	and	CCONJ
ahs-14952	274	10	basidomycota	basidomycota	NOUN
ahs-14952	274	11	(	(	PUNCT
ahs-14952	274	12	including	include	VERB
ahs-14952	274	13	gardes	garde	NOUN
ahs-14952	274	14	and	and	CCONJ
ahs-14952	274	15	bruns	brun	NOUN
ahs-14952	274	16	(	(	PUNCT
ahs-14952	274	17	1993	1993	NUM
ahs-14952	274	18	)	)	PUNCT
ahs-14952	274	19	its2	its2	NOUN
ahs-14952	274	20	(	(	PUNCT
ahs-14952	274	21	r	r	NOUN
ahs-14952	274	22	)	)	PUNCT
ahs-14952	274	23	gctgcgttcttcatcgatgc	gctgcgttcttcatcgatgc	VERB
ahs-14952	274	24	some	some	DET
ahs-14952	274	25	tulasnella	tulasnella	NOUN
ahs-14952	274	26	)	)	PUNCT
ahs-14952	274	27	white	white	PROPN
ahs-14952	274	28	et	et	PROPN
ahs-14952	274	29	al	al	PROPN
ahs-14952	274	30	.	.	PROPN
ahs-14952	274	31	(	(	PUNCT
ahs-14952	274	32	1990	1990	NUM
ahs-14952	274	33	)	)	PUNCT
ahs-14952	274	34	its4of­rc	its4of­rc	PROPN
ahs-14952	274	35	/	/	SYM
ahs-14952	274	36	cnl2f	cnl2f	PROPN
ahs-14952	274	37	its4of­rc	its4of­rc	PROPN
ahs-14952	274	38	(	(	PUNCT
ahs-14952	274	39	f	f	X
ahs-14952	274	40	)	)	PUNCT
ahs-14952	274	41	aacaaggattcccctagtaac	aacaaggattcccctagtaac	NOUN
ahs-14952	274	42	lsu	lsu	NOUN
ahs-14952	274	43	59	59	NUM
ahs-14952	274	44	some	some	DET
ahs-14952	274	45	ascomycota	ascomycota	NOUN
ahs-14952	274	46	and	and	CCONJ
ahs-14952	274	47	basidiomycota	basidiomycota	NOUN
ahs-14952	274	48	(	(	PUNCT
ahs-14952	274	49	including	include	VERB
ahs-14952	274	50	waud	waud	PROPN
ahs-14952	274	51	et	et	PROPN
ahs-14952	274	52	al	al	PROPN
ahs-14952	274	53	.	.	PROPN
ahs-14952	275	1	(	(	PUNCT
ahs-14952	275	2	2014	2014	NUM
ahs-14952	275	3	)	)	PUNCT
ahs-14952	275	4	cnl2f	cnl2f	ADP
ahs-14952	275	5	(	(	PUNCT
ahs-14952	275	6	r	r	NOUN
ahs-14952	275	7	)	)	PUNCT
ahs-14952	275	8	gtttcccttttaacaatttcac	gtttcccttttaacaatttcac	NOUN
ahs-14952	275	9	some	some	DET
ahs-14952	275	10	tulasnella	tulasnella	NOUN
ahs-14952	275	11	)	)	PUNCT
ahs-14952	275	12	white	white	PROPN
ahs-14952	275	13	et	et	PROPN
ahs-14952	275	14	al	al	PROPN
ahs-14952	275	15	.	.	PROPN
ahs-14952	276	1	(	(	PUNCT
ahs-14952	276	2	1990	1990	NUM
ahs-14952	276	3	)	)	PUNCT
ahs-14952	276	4	shamsudin	shamsudin	VERB
ahs-14952	276	5	et	et	PROPN
ahs-14952	276	6	al	al	PROPN
ahs-14952	276	7	.	.	PROPN
ahs-14952	277	1	‐	‐	ADP
ahs-14952	277	2	molecular	molecular	ADJ
ahs-14952	277	3	identification	identification	NOUN
ahs-14952	277	4	of	of	ADP
ahs-14952	277	5	orchid	orchid	NOUN
ahs-14952	277	6	mycorrhiza	mycorrhiza	PROPN
ahs-14952	277	7	adv	adv	PROPN
ahs-14952	277	8	.	.	PUNCT
ahs-14952	277	9	hort	hort	PROPN
ahs-14952	277	10	.	.	PUNCT
ahs-14952	278	1	sci	sci	PROPN
ahs-14952	278	2	.	.	PROPN
ahs-14952	278	3	,	,	PUNCT
ahs-14952	278	4	2024	2024	NUM
ahs-14952	278	5	38(1	38(1	NOUN
ahs-14952	278	6	):	):	PUNCT
ahs-14952	278	7	97­116	97­116	NUM
ahs-14952	278	8	108	108	NUM
ahs-14952	278	9	table	table	NOUN
ahs-14952	278	10	5	5	NUM
ahs-14952	278	11	­	­	NOUN
ahs-14952	278	12	list	list	NOUN
ahs-14952	278	13	of	of	ADP
ahs-14952	278	14	endophytic	endophytic	ADJ
ahs-14952	278	15	fungi	fungus	NOUN
ahs-14952	278	16	that	that	PRON
ahs-14952	278	17	has	have	AUX
ahs-14952	278	18	been	be	AUX
ahs-14952	278	19	isolated	isolate	VERB
ahs-14952	278	20	and	and	CCONJ
ahs-14952	278	21	identified	identify	VERB
ahs-14952	278	22	from	from	ADP
ahs-14952	278	23	root	root	NOUN
ahs-14952	278	24	by	by	ADP
ahs-14952	278	25	using	use	VERB
ahs-14952	278	26	a	a	DET
ahs-14952	278	27	broad­spectrum	broad­spectrum	NOUN
ahs-14952	278	28	primer	primer	NOUN
ahs-14952	278	29	(	(	PUNCT
ahs-14952	278	30	its1	its1	PROPN
ahs-14952	278	31	and	and	CCONJ
ahs-14952	278	32	its4	its4	PROPN
ahs-14952	278	33	)	)	PUNCT
ahs-14952	278	34	orchid	orchid	NOUN
ahs-14952	278	35	species	specie	NOUN
ahs-14952	278	36	endophytic	endophytic	ADJ
ahs-14952	278	37	fungal	fungal	NOUN
ahs-14952	278	38	(	(	PUNCT
ahs-14952	278	39	accession	accession	NOUN
ahs-14952	278	40	no./taxonomic	no./taxonomic	ADJ
ahs-14952	278	41	affiliation	affiliation	NOUN
ahs-14952	278	42	)	)	PUNCT
ahs-14952	278	43	type	type	NOUN
ahs-14952	278	44	of	of	ADP
ahs-14952	278	45	primer	primer	NOUN
ahs-14952	278	46	country	country	NOUN
ahs-14952	278	47	references	reference	NOUN
ahs-14952	278	48	vanda	vanda	PROPN
ahs-14952	278	49	wightii	wightii	PROPN
ahs-14952	278	50	ceratobasidium_wyd1	ceratobasidium_wyd1	PROPN
ahs-14952	278	51	(	(	PUNCT
ahs-14952	278	52	mw59578	mw59578	PROPN
ahs-14952	278	53	)	)	PUNCT
ahs-14952	278	54	its1	its1	PROPN
ahs-14952	278	55	and	and	CCONJ
ahs-14952	278	56	its4	its4	PROPN
ahs-14952	278	57	india	india	PROPN
ahs-14952	278	58	suresh	suresh	PROPN
ahs-14952	278	59	et	et	PROPN
ahs-14952	278	60	al	al	PROPN
ahs-14952	278	61	.	.	PROPN
ahs-14952	279	1	(	(	PUNCT
ahs-14952	279	2	2023	2023	NUM
ahs-14952	279	3	)	)	PUNCT
ahs-14952	279	4	dendrobium	dendrobium	NOUN
ahs-14952	279	5	longicornu	longicornu	PROPN
ahs-14952	279	6	alternaria	alternaria	NOUN
ahs-14952	279	7	sp	sp	PROPN
ahs-14952	279	8	.	.	PUNCT
ahs-14952	280	1	(	(	PUNCT
ahs-14952	280	2	mn256650	mn256650	PROPN
ahs-14952	280	3	)	)	PUNCT
ahs-14952	280	4	,	,	PUNCT
ahs-14952	280	5	its1	its1	PROPN
ahs-14952	280	6	and	and	CCONJ
ahs-14952	280	7	its4	its4	PROPN
ahs-14952	280	8	nepal	nepal	PROPN
ahs-14952	280	9	shah	shah	PROPN
ahs-14952	280	10	et	et	PROPN
ahs-14952	280	11	al	al	PROPN
ahs-14952	280	12	.	.	PROPN
ahs-14952	281	1	(	(	PUNCT
ahs-14952	281	2	2022	2022	NUM
ahs-14952	281	3	)	)	PUNCT
ahs-14952	281	4	cladosporium	cladosporium	NOUN
ahs-14952	281	5	sp	sp	PROPN
ahs-14952	281	6	.	.	PUNCT
ahs-14952	282	1	(	(	PUNCT
ahs-14952	282	2	mn256649	mn256649	PROPN
ahs-14952	282	3	)	)	PUNCT
ahs-14952	282	4	,	,	PUNCT
ahs-14952	282	5	coniochaeta	coniochaeta	PROPN
ahs-14952	282	6	sp	sp	NOUN
ahs-14952	282	7	.	.	PUNCT
ahs-14952	282	8	(	(	PUNCT
ahs-14952	282	9	mk225602	mk225602	PROPN
ahs-14952	282	10	)	)	PUNCT
ahs-14952	282	11	,	,	PUNCT
ahs-14952	282	12	penicillium	penicillium	NOUN
ahs-14952	282	13	sp	sp	NOUN
ahs-14952	282	14	.	.	PUNCT
ahs-14952	282	15	(	(	PUNCT
ahs-14952	282	16	mn256653	mn256653	PROPN
ahs-14952	282	17	)	)	PUNCT
ahs-14952	282	18	,	,	PUNCT
ahs-14952	282	19	fusarium	fusarium	NOUN
ahs-14952	282	20	sp	sp	NOUN
ahs-14952	282	21	.	.	PUNCT
ahs-14952	283	1	(	(	PUNCT
ahs-14952	283	2	mn256645	mn256645	NOUN
ahs-14952	283	3	)	)	PUNCT
ahs-14952	283	4	,	,	PUNCT
ahs-14952	283	5	fusarium	fusarium	NOUN
ahs-14952	283	6	sp	sp	NOUN
ahs-14952	283	7	.	.	PUNCT
ahs-14952	283	8	(	(	PUNCT
ahs-14952	283	9	mn256647	mn256647	PROPN
ahs-14952	283	10	)	)	PUNCT
ahs-14952	283	11	,	,	PUNCT
ahs-14952	283	12	fusarium	fusarium	NOUN
ahs-14952	283	13	sp	sp	NOUN
ahs-14952	283	14	.	.	PUNCT
ahs-14952	283	15	(	(	PUNCT
ahs-14952	283	16	mn256646	mn256646	NOUN
ahs-14952	283	17	)	)	PUNCT
ahs-14952	283	18	.	.	PUNCT
ahs-14952	284	1	aerides	aeride	NOUN
ahs-14952	284	2	rosea	rosea	ADV
ahs-14952	284	3	tulasnellaceae	tulasnellaceae	ADV
ahs-14952	284	4	sp	sp	NOUN
ahs-14952	284	5	.	.	PUNCT
ahs-14952	285	1	(	(	PUNCT
ahs-14952	285	2	jf691200	jf691200	PROPN
ahs-14952	285	3	)	)	PUNCT
ahs-14952	285	4	its1	its1	PROPN
ahs-14952	285	5	and	and	CCONJ
ahs-14952	285	6	its4	its4	PROPN
ahs-14952	285	7	china	china	PROPN
ahs-14952	285	8	zhao	zhao	PROPN
ahs-14952	285	9	et	et	PROPN
ahs-14952	285	10	al	al	PROPN
ahs-14952	285	11	.	.	PROPN
ahs-14952	286	1	(	(	PUNCT
ahs-14952	286	2	2021	2021	NUM
ahs-14952	286	3	)	)	PUNCT
ahs-14952	286	4	dendrobium	dendrobium	NOUN
ahs-14952	286	5	nobile	nobile	PROPN
ahs-14952	286	6	tulasnella	tulasnella	PROPN
ahs-14952	286	7	deliquescens	deliquescen	NOUN
ahs-14952	286	8	(	(	PUNCT
ahs-14952	286	9	lc175331	lc175331	PROPN
ahs-14952	286	10	)	)	PUNCT
ahs-14952	286	11	its1	its1	PROPN
ahs-14952	286	12	and	and	CCONJ
ahs-14952	286	13	its4	its4	PROPN
ahs-14952	286	14	china	china	PROPN
ahs-14952	286	15	zhao	zhao	PROPN
ahs-14952	286	16	et	et	PROPN
ahs-14952	286	17	al	al	PROPN
ahs-14952	286	18	.	.	PROPN
ahs-14952	287	1	(	(	PUNCT
ahs-14952	287	2	2021	2021	NUM
ahs-14952	287	3	)	)	PUNCT
ahs-14952	287	4	dendrobium	dendrobium	NOUN
ahs-14952	287	5	cucullatum	cucullatum	PROPN
ahs-14952	287	6	tulasnella	tulasnella	PROPN
ahs-14952	287	7	sp	sp	PROPN
ahs-14952	287	8	.	.	PROPN
ahs-14952	287	9	strain	strain	PROPN
ahs-14952	287	10	sscdo­4	sscdo­4	PROPN
ahs-14952	287	11	(	(	PUNCT
ahs-14952	287	12	mh348613	mh348613	PROPN
ahs-14952	287	13	its1	its1	PROPN
ahs-14952	287	14	and	and	CCONJ
ahs-14952	287	15	its4	its4	PROPN
ahs-14952	287	16	china	china	PROPN
ahs-14952	287	17	zhao	zhao	PROPN
ahs-14952	287	18	et	et	PROPN
ahs-14952	287	19	al	al	PROPN
ahs-14952	287	20	.	.	PROPN
ahs-14952	288	1	(	(	PUNCT
ahs-14952	288	2	2021	2021	NUM
ahs-14952	288	3	)	)	PUNCT
ahs-14952	288	4	epigeneium	epigeneium	NOUN
ahs-14952	288	5	amplum	amplum	VERB
ahs-14952	288	6	tulasnella	tulasnella	NOUN
ahs-14952	288	7	sp	sp	PROPN
ahs-14952	288	8	.	.	PROPN
ahs-14952	288	9	140	140	NUM
ahs-14952	288	10	(	(	PUNCT
ahs-14952	288	11	ay373281	ay373281	PROPN
ahs-14952	288	12	)	)	PUNCT
ahs-14952	288	13	its1	its1	PROPN
ahs-14952	288	14	and	and	CCONJ
ahs-14952	288	15	its4	its4	PROPN
ahs-14952	288	16	china	china	PROPN
ahs-14952	288	17	zhao	zhao	PROPN
ahs-14952	288	18	et	et	PROPN
ahs-14952	288	19	al	al	PROPN
ahs-14952	288	20	.	.	PROPN
ahs-14952	289	1	(	(	PUNCT
ahs-14952	289	2	2021	2021	NUM
ahs-14952	289	3	)	)	PUNCT
ahs-14952	289	4	gastrochilus	gastrochilus	NOUN
ahs-14952	289	5	calceolaris	calceolaris	PROPN
ahs-14952	289	6	ceratobasidium	ceratobasidium	PROPN
ahs-14952	289	7	sp	sp	PROPN
ahs-14952	289	8	.	.	PROPN
ahs-14952	289	9	gc	gc	PROPN
ahs-14952	289	10	(	(	PUNCT
ahs-14952	289	11	gq369961	gq369961	PROPN
ahs-14952	289	12	)	)	PUNCT
ahs-14952	289	13	,	,	PUNCT
ahs-14952	289	14	its1	its1	PROPN
ahs-14952	289	15	and	and	CCONJ
ahs-14952	289	16	its4	its4	PROPN
ahs-14952	289	17	bangladesh	bangladesh	PROPN
ahs-14952	289	18	hossain	hossain	PROPN
ahs-14952	289	19	(	(	PUNCT
ahs-14952	290	1	2019	2019	NUM
ahs-14952	290	2	)	)	PUNCT
ahs-14952	290	3	ceratobasidium	ceratobasidium	NOUN
ahs-14952	290	4	sp	sp	PROPN
ahs-14952	290	5	.	.	PUNCT
ahs-14952	290	6	fpub	fpub	PROPN
ahs-14952	290	7	168	168	NUM
ahs-14952	290	8	(	(	PUNCT
ahs-14952	290	9	ef536969	ef536969	PROPN
ahs-14952	290	10	)	)	PUNCT
ahs-14952	290	11	,	,	PUNCT
ahs-14952	290	12	rhizoctonia	rhizoctonia	PROPN
ahs-14952	290	13	sp	sp	PROPN
ahs-14952	290	14	.	.	PROPN
ahs-14952	290	15	abn1b	abn1b	PROPN
ahs-14952	290	16	(	(	PUNCT
ahs-14952	290	17	aj318432	aj318432	NOUN
ahs-14952	290	18	)	)	PUNCT
ahs-14952	290	19	,	,	PUNCT
ahs-14952	291	1	rhizoctonia	rhizoctonia	PROPN
ahs-14952	291	2	sp	sp	PROPN
ahs-14952	291	3	.	.	PUNCT
ahs-14952	291	4	onv6	onv6	PROPN
ahs-14952	291	5	(	(	PUNCT
ahs-14952	291	6	aj318436	aj318436	PROPN
ahs-14952	291	7	)	)	PUNCT
ahs-14952	291	8	aerides	aeride	VERB
ahs-14952	291	9	multiflora	multiflora	PROPN
ahs-14952	291	10	ceratobasidum	ceratobasidum	PROPN
ahs-14952	291	11	sp	sp	PROPN
ahs-14952	291	12	.	.	PUNCT
ahs-14952	292	1	(	(	PUNCT
ahs-14952	292	2	jx913820	jx913820	PROPN
ahs-14952	292	3	)	)	PUNCT
ahs-14952	292	4	,	,	PUNCT
ahs-14952	292	5	ceratobasidum	ceratobasidum	PROPN
ahs-14952	292	6	sp	sp	PROPN
ahs-14952	292	7	.	.	PUNCT
ahs-14952	293	1	(	(	PUNCT
ahs-14952	293	2	jx913820	jx913820	PROPN
ahs-14952	293	3	)	)	PUNCT
ahs-14952	293	4	,	,	PUNCT
ahs-14952	293	5	its1	its1	PROPN
ahs-14952	293	6	and	and	CCONJ
ahs-14952	293	7	its4	its4	PROPN
ahs-14952	293	8	india	india	PROPN
ahs-14952	293	9	bhatti	bhatti	PROPN
ahs-14952	293	10	et	et	PROPN
ahs-14952	293	11	al	al	PROPN
ahs-14952	293	12	.	.	PROPN
ahs-14952	294	1	(	(	PUNCT
ahs-14952	294	2	2017	2017	NUM
ahs-14952	294	3	)	)	PUNCT
ahs-14952	294	4	paphiopedilum	paphiopedilum	NOUN
ahs-14952	294	5	villosum	villosum	NOUN
ahs-14952	294	6	(	(	PUNCT
ahs-14952	294	7	lindl	lindl	PROPN
ahs-14952	294	8	.	.	PUNCT
ahs-14952	294	9	)	)	PUNCT
ahs-14952	295	1	stein	stein	PROPN
ahs-14952	295	2	.	.	PUNCT
ahs-14952	296	1	tulasnella	tulasnella	PROPN
ahs-14952	296	2	sp	sp	PROPN
ahs-14952	296	3	.	.	PUNCT
ahs-14952	297	1	(	(	PUNCT
ahs-14952	297	2	ay373281)/tulasnellaceae	ay373281)/tulasnellaceae	PROPN
ahs-14952	297	3	rigidoporus	rigidoporus	NOUN
ahs-14952	297	4	vinctus	vinctus	NOUN
ahs-14952	297	5	(	(	PUNCT
ahs-14952	297	6	hq400710)/	hq400710)/	PROPN
ahs-14952	297	7	polyporales	polyporale	NOUN
ahs-14952	297	8	ceratobasidium	ceratobasidium	NOUN
ahs-14952	297	9	sp	sp	PROPN
ahs-14952	297	10	.	.	PUNCT
ahs-14952	298	1	(	(	PUNCT
ahs-14952	298	2	hm117643)/tulasnellaceae	hm117643)/tulasnellaceae	PROPN
ahs-14952	298	3	flavodon	flavodon	ADJ
ahs-14952	298	4	flavus	flavus	NOUN
ahs-14952	298	5	(	(	PUNCT
ahs-14952	298	6	jq638521)/polyporales	jq638521)/polyporales	PROPN
ahs-14952	298	7	nigroporus	nigroporus	NOUN
ahs-14952	298	8	vinosus	vinosus	NOUN
ahs-14952	298	9	(	(	PUNCT
ahs-14952	298	10	ab811859)/polyporales	ab811859)/polyporales	PROPN
ahs-14952	298	11	coriolopsis	coriolopsis	NOUN
ahs-14952	298	12	retropicta	retropicta	NOUN
ahs-14952	298	13	(	(	PUNCT
ahs-14952	298	14	kc867403)/polyporales	kc867403)/polyporales	PROPN
ahs-14952	298	15	valsa	valsa	VERB
ahs-14952	298	16	eugeniae	eugeniae	NOUN
ahs-14952	298	17	(	(	PUNCT
ahs-14952	298	18	ay347344)/diaporthales	ay347344)/diaporthales	PROPN
ahs-14952	298	19	its1	its1	PROPN
ahs-14952	298	20	and	and	CCONJ
ahs-14952	298	21	its4	its4	PROPN
ahs-14952	298	22	thailand	thailand	PROPN
ahs-14952	298	23	khamchatra	khamchatra	PROPN
ahs-14952	298	24	et	et	PROPN
ahs-14952	298	25	al	al	PROPN
ahs-14952	298	26	.	.	PROPN
ahs-14952	299	1	(	(	PUNCT
ahs-14952	299	2	2016	2016	NUM
ahs-14952	299	3	)	)	PUNCT
ahs-14952	299	4	aerides	aeride	VERB
ahs-14952	299	5	multiflorum	multiflorum	PROPN
ahs-14952	299	6	ceratobasidium	ceratobasidium	NOUN
ahs-14952	299	7	sp	sp	PROPN
ahs-14952	299	8	.	.	PUNCT
ahs-14952	300	1	(	(	PUNCT
ahs-14952	300	2	eu605733	eu605733	PROPN
ahs-14952	300	3	)	)	PUNCT
ahs-14952	300	4	its1	its1	PROPN
ahs-14952	300	5	and	and	CCONJ
ahs-14952	300	6	its4	its4	PROPN
ahs-14952	300	7	western	western	ADJ
ahs-14952	300	8	himalayas	himalayas	PROPN
ahs-14952	300	9	hossain	hossain	PROPN
ahs-14952	300	10	et	et	PROPN
ahs-14952	300	11	al	al	PROPN
ahs-14952	300	12	.	.	PROPN
ahs-14952	301	1	(	(	PUNCT
ahs-14952	301	2	2013	2013	NUM
ahs-14952	301	3	)	)	PUNCT
ahs-14952	301	4	rhynchostylis	rhynchostyli	VERB
ahs-14952	301	5	retusa	retusa	ADJ
ahs-14952	301	6	ceratobasidium	ceratobasidium	NOUN
ahs-14952	301	7	sp	sp	PROPN
ahs-14952	301	8	.	.	PUNCT
ahs-14952	302	1	(	(	PUNCT
ahs-14952	302	2	eu605732	eu605732	PROPN
ahs-14952	302	3	)	)	PUNCT
ahs-14952	302	4	its1	its1	PROPN
ahs-14952	302	5	and	and	CCONJ
ahs-14952	302	6	its4	its4	PROPN
ahs-14952	302	7	western	western	ADJ
ahs-14952	302	8	himalayas	himalayas	PROPN
ahs-14952	302	9	hossain	hossain	PROPN
ahs-14952	302	10	et	et	PROPN
ahs-14952	302	11	al	al	PROPN
ahs-14952	302	12	.	.	PROPN
ahs-14952	303	1	(	(	PUNCT
ahs-14952	303	2	2013	2013	NUM
ahs-14952	303	3	)	)	PUNCT
ahs-14952	303	4	pecteilis	pecteilis	PROPN
ahs-14952	303	5	susannae	susannae	NOUN
ahs-14952	303	6	(	(	PUNCT
ahs-14952	303	7	l.	l.	PROPN
ahs-14952	303	8	)	)	PUNCT
ahs-14952	303	9	epulorhiza	epulorhiza	PROPN
ahs-14952	303	10	sp	sp	PROPN
ahs-14952	303	11	.	.	PROPN
ahs-14952	303	12	gq856216	gq856216	PROPN
ahs-14952	303	13	its1	its1	PROPN
ahs-14952	303	14	and	and	CCONJ
ahs-14952	303	15	its4	its4	PROPN
ahs-14952	304	1	thailand	thailand	PROPN
ahs-14952	304	2	chutima	chutima	PROPN
ahs-14952	304	3	et	et	PROPN
ahs-14952	304	4	al	al	PROPN
ahs-14952	304	5	.	.	PROPN
ahs-14952	305	1	(	(	PUNCT
ahs-14952	305	2	2011	2011	NUM
ahs-14952	305	3	)	)	PUNCT
ahs-14952	305	4	epulorhiza	epulorhiza	PROPN
ahs-14952	305	5	sp	sp	PROPN
ahs-14952	305	6	.	.	PUNCT
ahs-14952	305	7	gq856215	gq856215	PROPN
ahs-14952	305	8	epulorhiza	epulorhiza	PROPN
ahs-14952	305	9	sp	sp	PROPN
ahs-14952	305	10	.	.	PUNCT
ahs-14952	306	1	gq856214	gq856214	PROPN
ahs-14952	306	2	fusarium	fusarium	PROPN
ahs-14952	306	3	sp	sp	PROPN
ahs-14952	306	4	.	.	PUNCT
ahs-14952	306	5	gq862347	gq862347	PROPN
ahs-14952	306	6	epulorhiza	epulorhiza	PROPN
ahs-14952	306	7	sp	sp	PROPN
ahs-14952	306	8	.	.	PROPN
ahs-14952	306	9	fj882028	fj882028	PROPN
ahs-14952	306	10	epulorhiza	epulorhiza	PROPN
ahs-14952	306	11	sp	sp	PROPN
ahs-14952	306	12	.	.	PUNCT
ahs-14952	306	13	gq862346	gq862346	PROPN
ahs-14952	306	14	epulorhiza	epulorhiza	PROPN
ahs-14952	306	15	sp	sp	PROPN
ahs-14952	306	16	.	.	PUNCT
ahs-14952	307	1	fj940903	fj940903	PROPN
ahs-14952	307	2	epulorhiza	epulorhiza	PROPN
ahs-14952	307	3	sp	sp	PROPN
ahs-14952	307	4	.	.	PROPN
ahs-14952	307	5	fj873174	fj873174	PROPN
ahs-14952	307	6	shamsudin	shamsudin	VERB
ahs-14952	307	7	et	et	PROPN
ahs-14952	307	8	al	al	PROPN
ahs-14952	307	9	.	.	PROPN
ahs-14952	308	1	‐	‐	ADP
ahs-14952	308	2	molecular	molecular	ADJ
ahs-14952	308	3	identification	identification	NOUN
ahs-14952	308	4	of	of	ADP
ahs-14952	308	5	orchid	orchid	NOUN
ahs-14952	308	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	308	7	109	109	NUM
ahs-14952	308	8	(	(	PUNCT
ahs-14952	308	9	taylor	taylor	PROPN
ahs-14952	308	10	and	and	CCONJ
ahs-14952	308	11	mccormick	mccormick	PROPN
ahs-14952	308	12	2008	2008	NUM
ahs-14952	308	13	)	)	PUNCT
ahs-14952	308	14	.	.	PUNCT
ahs-14952	309	1	to	to	PART
ahs-14952	309	2	address	address	VERB
ahs-14952	309	3	this	this	DET
ahs-14952	309	4	issue	issue	NOUN
ahs-14952	309	5	,	,	PUNCT
ahs-14952	309	6	the	the	DET
ahs-14952	309	7	its4­tul	its4­tul	NOUN
ahs-14952	309	8	primer	primer	NOUN
ahs-14952	309	9	has	have	AUX
ahs-14952	309	10	been	be	AUX
ahs-14952	309	11	designed	design	VERB
ahs-14952	309	12	to	to	PART
ahs-14952	309	13	study	study	VERB
ahs-14952	309	14	only	only	ADV
ahs-14952	309	15	tulasnella	tulasnella	NOUN
ahs-14952	309	16	species	specie	NOUN
ahs-14952	309	17	,	,	PUNCT
ahs-14952	309	18	thereby	thereby	ADV
ahs-14952	309	19	minimising	minimise	VERB
ahs-14952	309	20	the	the	DET
ahs-14952	309	21	amplification	amplification	NOUN
ahs-14952	309	22	of	of	ADP
ahs-14952	309	23	other	other	ADJ
ahs-14952	309	24	taxa	taxa	NOUN
ahs-14952	309	25	.	.	PUNCT
ahs-14952	310	1	two	two	NUM
ahs-14952	310	2	primers	primer	NOUN
ahs-14952	310	3	that	that	PRON
ahs-14952	310	4	are	be	AUX
ahs-14952	310	5	tulasnellla	tulasnellla	NOUN
ahs-14952	310	6	specific	specific	ADJ
ahs-14952	310	7	which	which	PRON
ahs-14952	310	8	is	be	AUX
ahs-14952	310	9	its4­tul	its4­tul	PROPN
ahs-14952	310	10	and	and	CCONJ
ahs-14952	310	11	its4r	its4r	PROPN
ahs-14952	310	12	are	be	AUX
ahs-14952	310	13	designed	design	VERB
ahs-14952	310	14	from	from	ADP
ahs-14952	310	15	the	the	DET
ahs-14952	310	16	3­end	3­end	NUM
ahs-14952	310	17	of	of	ADP
ahs-14952	310	18	its2	its2	PROPN
ahs-14952	310	19	(	(	PUNCT
ahs-14952	310	20	suárez	suárez	NOUN
ahs-14952	310	21	et	et	PROPN
ahs-14952	310	22	al	al	PROPN
ahs-14952	310	23	.	.	PROPN
ahs-14952	310	24	,	,	PUNCT
ahs-14952	310	25	2006	2006	NUM
ahs-14952	310	26	)	)	PUNCT
ahs-14952	310	27	.	.	PUNCT
ahs-14952	311	1	the	the	DET
ahs-14952	311	2	its4­tul	its4­tul	PROPN
ahs-14952	311	3	primer	primer	NOUN
ahs-14952	311	4	is	be	AUX
ahs-14952	311	5	a	a	DET
ahs-14952	311	6	perfect	perfect	ADJ
ahs-14952	311	7	or	or	CCONJ
ahs-14952	311	8	near­perfect	near­perfect	ADJ
ahs-14952	311	9	match	match	NOUN
ahs-14952	311	10	for	for	ADP
ahs-14952	311	11	some	some	PRON
ahs-14952	311	12	of	of	ADP
ahs-14952	311	13	the	the	DET
ahs-14952	311	14	core	core	ADJ
ahs-14952	311	15	species	specie	NOUN
ahs-14952	311	16	of	of	ADP
ahs-14952	311	17	tulasnella	tulasnella	NOUN
ahs-14952	311	18	but	but	CCONJ
ahs-14952	311	19	their	their	PRON
ahs-14952	311	20	mismatches	mismatch	NOUN
ahs-14952	311	21	with	with	ADP
ahs-14952	311	22	the	the	DET
ahs-14952	311	23	majority	majority	NOUN
ahs-14952	311	24	of	of	ADP
ahs-14952	311	25	other	other	ADJ
ahs-14952	311	26	fungi	fungus	NOUN
ahs-14952	311	27	make	make	VERB
ahs-14952	311	28	them	they	PRON
ahs-14952	311	29	a	a	DET
ahs-14952	311	30	specific	specific	ADJ
ahs-14952	311	31	primer	primer	NOUN
ahs-14952	311	32	.	.	PUNCT
ahs-14952	312	1	its4­tul	its4­tul	PROPN
ahs-14952	312	2	has	have	AUX
ahs-14952	312	3	been	be	AUX
ahs-14952	312	4	used	use	VERB
ahs-14952	312	5	widely	widely	ADV
ahs-14952	312	6	as	as	ADP
ahs-14952	312	7	a	a	DET
ahs-14952	312	8	primer	primer	NOUN
ahs-14952	312	9	,	,	PUNCT
ahs-14952	312	10	especially	especially	ADV
ahs-14952	312	11	for	for	ADP
ahs-14952	312	12	the	the	DET
ahs-14952	312	13	identification	identification	NOUN
ahs-14952	312	14	of	of	ADP
ahs-14952	312	15	orchid	orchid	NOUN
ahs-14952	312	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	312	17	primarily	primarily	ADV
ahs-14952	312	18	targeted	target	VERB
ahs-14952	312	19	tulasnellaceae	tulasnellaceae	ADV
ahs-14952	312	20	,	,	PUNCT
ahs-14952	312	21	which	which	PRON
ahs-14952	312	22	are	be	AUX
ahs-14952	312	23	mostly	mostly	ADV
ahs-14952	312	24	reported	report	VERB
ahs-14952	312	25	to	to	PART
ahs-14952	312	26	have	have	VERB
ahs-14952	312	27	the	the	DET
ahs-14952	312	28	ability	ability	NOUN
ahs-14952	312	29	to	to	PART
ahs-14952	312	30	promote	promote	VERB
ahs-14952	312	31	seed	seed	NOUN
ahs-14952	312	32	germination	germination	NOUN
ahs-14952	312	33	(	(	PUNCT
ahs-14952	312	34	oja	oja	NOUN
ahs-14952	312	35	et	et	PROPN
ahs-14952	312	36	al	al	PROPN
ahs-14952	312	37	.	.	PROPN
ahs-14952	312	38	,	,	PUNCT
ahs-14952	312	39	2014	2014	NUM
ahs-14952	312	40	;	;	PUNCT
ahs-14952	312	41	mccormick	mccormick	PROPN
ahs-14952	312	42	et	et	PROPN
ahs-14952	312	43	al	al	PROPN
ahs-14952	312	44	.	.	PROPN
ahs-14952	312	45	,	,	PUNCT
ahs-14952	312	46	2021	2021	NUM
ahs-14952	312	47	;	;	PUNCT
ahs-14952	312	48	suetsugu	suetsugu	ADJ
ahs-14952	312	49	et	et	PROPN
ahs-14952	312	50	al	al	PROPN
ahs-14952	312	51	.	.	PROPN
ahs-14952	312	52	,	,	PUNCT
ahs-14952	312	53	2021	2021	NUM
ahs-14952	312	54	)	)	PUNCT
ahs-14952	312	55	.	.	PUNCT
ahs-14952	313	1	meanwhile	meanwhile	ADV
ahs-14952	313	2	,	,	PUNCT
ahs-14952	313	3	its1­of	its1­of	PROPN
ahs-14952	313	4	and	and	CCONJ
ahs-14952	313	5	its4­of	its4­of	PROPN
ahs-14952	313	6	is	be	AUX
ahs-14952	313	7	nowadays	nowadays	ADV
ahs-14952	313	8	are	be	AUX
ahs-14952	313	9	increasingly	increasingly	ADV
ahs-14952	313	10	used	use	VERB
ahs-14952	313	11	in	in	ADP
ahs-14952	313	12	characterising	characterise	VERB
ahs-14952	313	13	orchid	orchid	NOUN
ahs-14952	313	14	fungal	fungal	ADJ
ahs-14952	313	15	symbionts	symbiont	NOUN
ahs-14952	313	16	as	as	SCONJ
ahs-14952	313	17	they	they	PRON
ahs-14952	313	18	are	be	AUX
ahs-14952	313	19	designed	design	VERB
ahs-14952	313	20	to	to	PART
ahs-14952	313	21	be	be	AUX
ahs-14952	313	22	a	a	DET
ahs-14952	313	23	broad	broad	ADJ
ahs-14952	313	24	spectrum	spectrum	NOUN
ahs-14952	313	25	basidiomycete	basidiomycete	PROPN
ahs-14952	313	26	specific	specific	ADJ
ahs-14952	313	27	primer	primer	NOUN
ahs-14952	313	28	(	(	PUNCT
ahs-14952	313	29	currah	currah	PROPN
ahs-14952	313	30	and	and	CCONJ
ahs-14952	313	31	sherburne	sherburne	PROPN
ahs-14952	313	32	,	,	PUNCT
ahs-14952	313	33	1992	1992	NUM
ahs-14952	313	34	;	;	PUNCT
ahs-14952	313	35	taylor	taylor	PROPN
ahs-14952	313	36	and	and	CCONJ
ahs-14952	313	37	mccormick	mccormick	PROPN
ahs-14952	313	38	,	,	PUNCT
ahs-14952	313	39	2008	2008	NUM
ahs-14952	313	40	;	;	PUNCT
ahs-14952	313	41	jacquemyn	jacquemyn	PROPN
ahs-14952	313	42	et	et	PROPN
ahs-14952	313	43	al	al	PROPN
ahs-14952	313	44	.	.	PROPN
ahs-14952	313	45	,	,	PUNCT
ahs-14952	313	46	2010	2010	NUM
ahs-14952	313	47	)	)	PUNCT
ahs-14952	313	48	.	.	PUNCT
ahs-14952	314	1	a	a	DET
ahs-14952	314	2	study	study	NOUN
ahs-14952	314	3	on	on	ADP
ahs-14952	314	4	identification	identification	NOUN
ahs-14952	314	5	of	of	ADP
ahs-14952	314	6	fungi	fungus	NOUN
ahs-14952	314	7	identification	identification	NOUN
ahs-14952	314	8	of	of	ADP
ahs-14952	314	9	terrestrial	terrestrial	ADJ
ahs-14952	314	10	orchid	orchid	NOUN
ahs-14952	314	11	mycorrhizal	mycorrhizal	NOUN
ahs-14952	314	12	by	by	ADP
ahs-14952	314	13	using	use	VERB
ahs-14952	314	14	broad	broad	ADJ
ahs-14952	314	15	spectrum	spectrum	ADJ
ahs-14952	314	16	fungal	fungal	ADJ
ahs-14952	314	17	taxa	taxa	NOUN
ahs-14952	314	18	primer	primer	NOUN
ahs-14952	314	19	(	(	PUNCT
ahs-14952	314	20	its86f	its86f	NOUN
ahs-14952	314	21	/	/	SYM
ahs-14952	314	22	its4	its4	PROPN
ahs-14952	314	23	)	)	PUNCT
ahs-14952	314	24	by	by	ADP
ahs-14952	314	25	waud	waud	PROPN
ahs-14952	314	26	et	et	PROPN
ahs-14952	314	27	al	al	PROPN
ahs-14952	314	28	.	.	PROPN
ahs-14952	314	29	(	(	PUNCT
ahs-14952	314	30	2014	2014	NUM
ahs-14952	314	31	)	)	PUNCT
ahs-14952	314	32	has	have	AUX
ahs-14952	314	33	outperformed	outperform	VERB
ahs-14952	314	34	the	the	DET
ahs-14952	314	35	other	other	ADJ
ahs-14952	314	36	primer	primer	NOUN
ahs-14952	314	37	pair	pair	NOUN
ahs-14952	314	38	.	.	PUNCT
ahs-14952	315	1	the	the	DET
ahs-14952	315	2	study	study	NOUN
ahs-14952	315	3	also	also	ADV
ahs-14952	315	4	assessed	assess	VERB
ahs-14952	315	5	the	the	DET
ahs-14952	315	6	efficacy	efficacy	NOUN
ahs-14952	315	7	of	of	ADP
ahs-14952	315	8	several	several	ADJ
ahs-14952	315	9	type	type	NOUN
ahs-14952	315	10	of	of	ADP
ahs-14952	315	11	broad­spectrum	broad­spectrum	NOUN
ahs-14952	315	12	primer	primer	NOUN
ahs-14952	315	13	and	and	CCONJ
ahs-14952	315	14	specific	specific	ADJ
ahs-14952	315	15	primer	primer	NOUN
ahs-14952	315	16	for	for	ADP
ahs-14952	315	17	orchid	orchid	NOUN
ahs-14952	315	18	mycorrhizal	mycorrhizal	NOUN
ahs-14952	315	19	fungi	fungus	NOUN
ahs-14952	315	20	to	to	PART
ahs-14952	315	21	understand	understand	VERB
ahs-14952	315	22	and	and	CCONJ
ahs-14952	315	23	characterized	characterize	VERB
ahs-14952	315	24	orchid	orchid	NOUN
ahs-14952	315	25	mycorrhizal	mycorrhizal	NOUN
ahs-14952	315	26	communities	community	NOUN
ahs-14952	315	27	and	and	CCONJ
ahs-14952	315	28	suggested	suggest	VERB
ahs-14952	315	29	several	several	ADJ
ahs-14952	315	30	suitable	suitable	ADJ
ahs-14952	315	31	primer	primer	NOUN
ahs-14952	315	32	pairs	pair	NOUN
ahs-14952	315	33	.	.	PUNCT
ahs-14952	316	1	other	other	ADJ
ahs-14952	316	2	study	study	NOUN
ahs-14952	316	3	also	also	ADV
ahs-14952	316	4	uses	use	VERB
ahs-14952	316	5	the	the	DET
ahs-14952	316	6	broad­spectrum	broad­spectrum	NOUN
ahs-14952	316	7	primer	primer	PROPN
ahs-14952	316	8	pair	pair	PROPN
ahs-14952	316	9	its86f	its86f	PROPN
ahs-14952	316	10	/	/	SYM
ahs-14952	316	11	its4	its4	PROPN
ahs-14952	316	12	to	to	PART
ahs-14952	316	13	investigate	investigate	VERB
ahs-14952	316	14	the	the	DET
ahs-14952	316	15	orchid	orchid	NOUN
ahs-14952	316	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	316	17	community	community	NOUN
ahs-14952	316	18	in	in	ADP
ahs-14952	316	19	both	both	CCONJ
ahs-14952	316	20	epiphytic	epiphytic	ADJ
ahs-14952	316	21	and	and	CCONJ
ahs-14952	316	22	terrestrial	terrestrial	ADJ
ahs-14952	316	23	orchid	orchid	NOUN
ahs-14952	316	24	(	(	PUNCT
ahs-14952	316	25	cevallos	cevallos	PROPN
ahs-14952	316	26	et	et	PROPN
ahs-14952	316	27	al	al	PROPN
ahs-14952	316	28	.	.	PROPN
ahs-14952	316	29	,	,	PUNCT
ahs-14952	316	30	2017	2017	NUM
ahs-14952	316	31	;	;	PUNCT
ahs-14952	316	32	johnson	johnson	PROPN
ahs-14952	316	33	et	et	PROPN
ahs-14952	316	34	al	al	PROPN
ahs-14952	316	35	.	.	PROPN
ahs-14952	316	36	,	,	PUNCT
ahs-14952	316	37	2021	2021	NUM
ahs-14952	316	38	)	)	PUNCT
ahs-14952	316	39	.	.	PUNCT
ahs-14952	317	1	however	however	ADV
ahs-14952	317	2	,	,	PUNCT
ahs-14952	317	3	the	the	DET
ahs-14952	317	4	use	use	NOUN
ahs-14952	317	5	of	of	ADP
ahs-14952	317	6	broad­	broad­	NUM
ahs-14952	317	7	spectrum	spectrum	NOUN
ahs-14952	317	8	primer	primer	NOUN
ahs-14952	317	9	for	for	ADP
ahs-14952	317	10	identification	identification	NOUN
ahs-14952	317	11	of	of	ADP
ahs-14952	317	12	orchid	orchid	NOUN
ahs-14952	317	13	mycorrhizal	mycorrhizal	NOUN
ahs-14952	317	14	fungi	fungus	NOUN
ahs-14952	317	15	is	be	AUX
ahs-14952	317	16	constrained	constrain	VERB
ahs-14952	317	17	by	by	ADP
ahs-14952	317	18	a	a	DET
ahs-14952	317	19	primer	primer	NOUN
ahs-14952	317	20	bias	bias	NOUN
ahs-14952	317	21	,	,	PUNCT
ahs-14952	317	22	which	which	PRON
ahs-14952	317	23	arise	arise	VERB
ahs-14952	317	24	from	from	ADP
ahs-14952	317	25	the	the	DET
ahs-14952	317	26	inability	inability	NOUN
ahs-14952	317	27	of	of	ADP
ahs-14952	317	28	the	the	DET
ahs-14952	317	29	primer	primer	NOUN
ahs-14952	317	30	to	to	PART
ahs-14952	317	31	identify	identify	VERB
ahs-14952	317	32	a	a	DET
ahs-14952	317	33	specific	specific	ADJ
ahs-14952	317	34	fungus	fungus	NOUN
ahs-14952	317	35	within	within	ADP
ahs-14952	317	36	a	a	DET
ahs-14952	317	37	sample	sample	NOUN
ahs-14952	317	38	due	due	ADP
ahs-14952	317	39	to	to	ADP
ahs-14952	317	40	the	the	DET
ahs-14952	317	41	mismatch	mismatch	NOUN
ahs-14952	317	42	during	during	ADP
ahs-14952	317	43	pcr	pcr	PROPN
ahs-14952	317	44	.	.	PUNCT
ahs-14952	318	1	while	while	SCONJ
ahs-14952	318	2	tulasnellaceae	tulasnellaceae	PROPN
ahs-14952	318	3	fungi	fungus	NOUN
ahs-14952	318	4	are	be	AUX
ahs-14952	318	5	commonly	commonly	ADV
ahs-14952	318	6	associated	associate	VERB
ahs-14952	318	7	with	with	ADP
ahs-14952	318	8	orchids	orchid	NOUN
ahs-14952	318	9	(	(	PUNCT
ahs-14952	318	10	dearnaley	dearnaley	PROPN
ahs-14952	318	11	et	et	PROPN
ahs-14952	318	12	al	al	PROPN
ahs-14952	318	13	.	.	PROPN
ahs-14952	318	14	2012	2012	NUM
ahs-14952	318	15	)	)	PUNCT
ahs-14952	318	16	,	,	PUNCT
ahs-14952	318	17	their	their	PRON
ahs-14952	318	18	molecular	molecular	ADJ
ahs-14952	318	19	detection	detection	NOUN
ahs-14952	318	20	poses	pose	VERB
ahs-14952	318	21	challenges	challenge	NOUN
ahs-14952	318	22	due	due	ADJ
ahs-14952	318	23	to	to	ADP
ahs-14952	318	24	mismatches	mismatch	NOUN
ahs-14952	318	25	with	with	ADP
ahs-14952	318	26	universal	universal	ADJ
ahs-14952	318	27	fungal	fungal	ADJ
ahs-14952	318	28	primers	primer	NOUN
ahs-14952	318	29	(	(	PUNCT
ahs-14952	318	30	suárez	suárez	NOUN
ahs-14952	318	31	et	et	PROPN
ahs-14952	318	32	al	al	PROPN
ahs-14952	318	33	.	.	PROPN
ahs-14952	318	34	,	,	PUNCT
ahs-14952	318	35	2006	2006	NUM
ahs-14952	318	36	;	;	PUNCT
ahs-14952	318	37	taylor	taylor	PROPN
ahs-14952	318	38	and	and	CCONJ
ahs-14952	318	39	mccormick	mccormick	PROPN
ahs-14952	318	40	2008	2008	NUM
ahs-14952	318	41	;	;	PUNCT
ahs-14952	318	42	waud	waud	VERB
ahs-14952	318	43	et	et	PROPN
ahs-14952	318	44	al	al	PROPN
ahs-14952	318	45	.	.	PROPN
ahs-14952	318	46	,	,	PUNCT
ahs-14952	318	47	2014	2014	NUM
ahs-14952	318	48	;	;	PUNCT
ahs-14952	318	49	rammitsu	rammitsu	NOUN
ahs-14952	318	50	et	et	PROPN
ahs-14952	318	51	al	al	PROPN
ahs-14952	318	52	.	.	PROPN
ahs-14952	318	53	,	,	PUNCT
ahs-14952	318	54	2021	2021	NUM
ahs-14952	318	55	)	)	PUNCT
ahs-14952	318	56	.	.	PUNCT
ahs-14952	319	1	moreover	moreover	ADV
ahs-14952	319	2	,	,	PUNCT
ahs-14952	319	3	previous	previous	ADJ
ahs-14952	319	4	comprehensive	comprehensive	ADJ
ahs-14952	319	5	investigations	investigation	NOUN
ahs-14952	319	6	conducted	conduct	VERB
ahs-14952	319	7	through	through	ADP
ahs-14952	319	8	sanger	sanger	PROPN
ahs-14952	319	9	sequencing­based	sequencing­base	VERB
ahs-14952	319	10	methodologies	methodology	NOUN
ahs-14952	319	11	have	have	AUX
ahs-14952	319	12	indicated	indicate	VERB
ahs-14952	319	13	distinctions	distinction	NOUN
ahs-14952	319	14	between	between	ADP
ahs-14952	319	15	the	the	DET
ahs-14952	319	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	319	17	communities	community	NOUN
ahs-14952	319	18	associated	associate	VERB
ahs-14952	319	19	with	with	ADP
ahs-14952	319	20	epiphytic	epiphytic	ADJ
ahs-14952	319	21	orchids	orchid	NOUN
ahs-14952	319	22	and	and	CCONJ
ahs-14952	319	23	those	those	PRON
ahs-14952	319	24	associated	associate	VERB
ahs-14952	319	25	with	with	ADP
ahs-14952	319	26	terrestrial	terrestrial	ADJ
ahs-14952	319	27	orchids	orchid	NOUN
ahs-14952	319	28	(	(	PUNCT
ahs-14952	319	29	martos	martos	X
ahs-14952	319	30	et	et	PROPN
ahs-14952	319	31	al	al	PROPN
ahs-14952	319	32	.	.	PROPN
ahs-14952	319	33	,	,	PUNCT
ahs-14952	319	34	2012	2012	NUM
ahs-14952	319	35	;	;	PUNCT
ahs-14952	319	36	xing	xing	PROPN
ahs-14952	319	37	et	et	PROPN
ahs-14952	319	38	al	al	PROPN
ahs-14952	319	39	.	.	PROPN
ahs-14952	319	40	,	,	PUNCT
ahs-14952	319	41	2019	2019	NUM
ahs-14952	319	42	)	)	PUNCT
ahs-14952	319	43	.	.	PUNCT
ahs-14952	320	1	the	the	DET
ahs-14952	320	2	utilising	utilising	NOUN
ahs-14952	320	3	of	of	ADP
ahs-14952	320	4	tulasnellaceae­specific	tulasnellaceae­specific	ADJ
ahs-14952	320	5	primers	primer	NOUN
ahs-14952	320	6	for	for	ADP
ahs-14952	320	7	the	the	DET
ahs-14952	320	8	assessmen	assessman	NOUN
ahs-14952	320	9	of	of	ADP
ahs-14952	320	10	orchid	orchid	NOUN
ahs-14952	320	11	mycorrhiza	mycorrhiza	NOUN
ahs-14952	320	12	;	;	PUNCT
ahs-14952	320	13	networks	network	NOUN
ahs-14952	320	14	by	by	ADP
ahs-14952	320	15	metabarcoding	metabarcode	VERB
ahs-14952	320	16	analysis	analysis	NOUN
ahs-14952	320	17	is	be	AUX
ahs-14952	320	18	highly	highly	ADV
ahs-14952	320	19	recommended	recommend	VERB
ahs-14952	320	20	,	,	PUNCT
ahs-14952	320	21	particurlay	particurlay	VERB
ahs-14952	320	22	in	in	ADP
ahs-14952	320	23	the	the	DET
ahs-14952	320	24	context	context	NOUN
ahs-14952	320	25	of	of	ADP
ahs-14952	320	26	epiphytic	epiphytic	ADJ
ahs-14952	320	27	orchids	orchid	NOUN
ahs-14952	320	28	,	,	PUNCT
ahs-14952	320	29	as	as	SCONJ
ahs-14952	320	30	emphasised	emphasise	VERB
ahs-14952	320	31	in	in	ADP
ahs-14952	320	32	the	the	DET
ahs-14952	320	33	research	research	NOUN
ahs-14952	320	34	conducted	conduct	VERB
ahs-14952	320	35	by	by	ADP
ahs-14952	320	36	rammitsu	rammitsu	NOUN
ahs-14952	320	37	et	et	PROPN
ahs-14952	320	38	al	al	PROPN
ahs-14952	320	39	.	.	PROPN
ahs-14952	321	1	(	(	PUNCT
ahs-14952	321	2	2021	2021	NUM
ahs-14952	321	3	)	)	PUNCT
ahs-14952	321	4	.	.	PUNCT
ahs-14952	322	1	the	the	DET
ahs-14952	322	2	commonly	commonly	ADV
ahs-14952	322	3	used	use	VERB
ahs-14952	322	4	broad	broad	ADJ
ahs-14952	322	5	spectrum	spectrum	NOUN
ahs-14952	322	6	primer	primer	NOUN
ahs-14952	322	7	,	,	PUNCT
ahs-14952	322	8	its86f	its86f	NOUN
ahs-14952	322	9	/	/	SYM
ahs-14952	322	10	its4	its4	PROPN
ahs-14952	322	11	effectively	effectively	ADV
ahs-14952	322	12	identified	identify	VERB
ahs-14952	322	13	ceratobasidiaceae	ceratobasidiaceae	NOUN
ahs-14952	322	14	and	and	CCONJ
ahs-14952	322	15	serendipitaceae	serendipitaceae	PROPN
ahs-14952	322	16	fungi	fungus	NOUN
ahs-14952	322	17	but	but	CCONJ
ahs-14952	322	18	proved	prove	VERB
ahs-14952	322	19	inadequate	inadequate	ADJ
ahs-14952	322	20	in	in	ADP
ahs-14952	322	21	detecting	detect	VERB
ahs-14952	322	22	the	the	DET
ahs-14952	322	23	diversity	diversity	NOUN
ahs-14952	322	24	of	of	ADP
ahs-14952	322	25	tulasnellaceae	tulasnellaceae	ADJ
ahs-14952	322	26	fungi	fungi	PROPN
ahs-14952	322	27	(	(	PUNCT
ahs-14952	322	28	rammitsu	rammitsu	NOUN
ahs-14952	322	29	et	et	PROPN
ahs-14952	322	30	al	al	PROPN
ahs-14952	322	31	.	.	PROPN
ahs-14952	322	32	,	,	PUNCT
ahs-14952	322	33	2021	2021	NUM
ahs-14952	322	34	)	)	PUNCT
ahs-14952	322	35	.	.	PUNCT
ahs-14952	323	1	due	due	ADP
ahs-14952	323	2	to	to	ADP
ahs-14952	323	3	significant	significant	ADJ
ahs-14952	323	4	primer	primer	NOUN
ahs-14952	323	5	biases	bias	NOUN
ahs-14952	323	6	present	present	ADJ
ahs-14952	323	7	within	within	ADP
ahs-14952	323	8	the	the	DET
ahs-14952	323	9	tulasnellaceae	tulasnellaceae	ADJ
ahs-14952	323	10	family	family	NOUN
ahs-14952	323	11	,	,	PUNCT
ahs-14952	323	12	which	which	PRON
ahs-14952	323	13	plays	play	VERB
ahs-14952	323	14	a	a	DET
ahs-14952	323	15	crucial	crucial	ADJ
ahs-14952	323	16	role	role	NOUN
ahs-14952	323	17	as	as	ADP
ahs-14952	323	18	mycorrhizal	mycorrhizal	NOUN
ahs-14952	323	19	symbionts	symbiont	NOUN
ahs-14952	323	20	in	in	ADP
ahs-14952	323	21	the	the	DET
ahs-14952	323	22	majority	majority	NOUN
ahs-14952	323	23	of	of	ADP
ahs-14952	323	24	orchid	orchid	NOUN
ahs-14952	323	25	species	specie	NOUN
ahs-14952	323	26	,	,	PUNCT
ahs-14952	323	27	it	it	PRON
ahs-14952	323	28	is	be	AUX
ahs-14952	323	29	imperative	imperative	ADJ
ahs-14952	323	30	to	to	PART
ahs-14952	323	31	exercise	exercise	VERB
ahs-14952	323	32	caution	caution	NOUN
ahs-14952	323	33	in	in	ADP
ahs-14952	323	34	selecting	select	VERB
ahs-14952	323	35	primers	primer	NOUN
ahs-14952	323	36	and	and	CCONJ
ahs-14952	323	37	thoroughly	thoroughly	ADV
ahs-14952	323	38	assess	assess	VERB
ahs-14952	323	39	potential	potential	ADJ
ahs-14952	323	40	biases	bias	NOUN
ahs-14952	323	41	(	(	PUNCT
ahs-14952	323	42	oja	oja	PROPN
ahs-14952	323	43	et	et	PROPN
ahs-14952	323	44	al	al	PROPN
ahs-14952	323	45	.	.	PROPN
ahs-14952	323	46	,	,	PUNCT
ahs-14952	323	47	2014	2014	NUM
ahs-14952	323	48	)	)	PUNCT
ahs-14952	323	49	.	.	PUNCT
ahs-14952	324	1	8	8	X
ahs-14952	324	2	.	.	X
ahs-14952	324	3	sequencing	sequence	VERB
ahs-14952	324	4	when	when	SCONJ
ahs-14952	324	5	it	it	PRON
ahs-14952	324	6	comes	come	VERB
ahs-14952	324	7	to	to	ADP
ahs-14952	324	8	fungi	fungi	PROPN
ahs-14952	324	9	,	,	PUNCT
ahs-14952	324	10	morphology	morphology	NOUN
ahs-14952	324	11	is	be	AUX
ahs-14952	324	12	often	often	ADV
ahs-14952	324	13	the	the	DET
ahs-14952	324	14	method	method	NOUN
ahs-14952	324	15	of	of	ADP
ahs-14952	324	16	choice	choice	NOUN
ahs-14952	324	17	for	for	ADP
ahs-14952	324	18	performing	perform	VERB
ahs-14952	324	19	the	the	DET
ahs-14952	324	20	fundamental	fundamental	ADJ
ahs-14952	324	21	function	function	NOUN
ahs-14952	324	22	of	of	ADP
ahs-14952	324	23	species	specie	NOUN
ahs-14952	324	24	distinction	distinction	NOUN
ahs-14952	324	25	.	.	PUNCT
ahs-14952	325	1	however	however	ADV
ahs-14952	325	2	,	,	PUNCT
ahs-14952	325	3	distinguishing	distinguish	VERB
ahs-14952	325	4	species	specie	NOUN
ahs-14952	325	5	based	base	VERB
ahs-14952	325	6	on	on	ADP
ahs-14952	325	7	their	their	PRON
ahs-14952	325	8	morphology	morphology	NOUN
ahs-14952	325	9	can	can	AUX
ahs-14952	325	10	be	be	AUX
ahs-14952	325	11	difficult	difficult	ADJ
ahs-14952	325	12	,	,	PUNCT
ahs-14952	325	13	particularly	particularly	ADV
ahs-14952	325	14	for	for	ADP
ahs-14952	325	15	fungi	fungus	NOUN
ahs-14952	325	16	that	that	PRON
ahs-14952	325	17	do	do	AUX
ahs-14952	325	18	not	not	PART
ahs-14952	325	19	have	have	VERB
ahs-14952	325	20	complex	complex	ADJ
ahs-14952	325	21	fruiting	fruiting	NOUN
ahs-14952	325	22	bodies	body	NOUN
ahs-14952	325	23	,	,	PUNCT
ahs-14952	325	24	as	as	SCONJ
ahs-14952	325	25	is	be	AUX
ahs-14952	325	26	the	the	DET
ahs-14952	325	27	case	case	NOUN
ahs-14952	325	28	with	with	ADP
ahs-14952	325	29	the	the	DET
ahs-14952	325	30	three	three	NUM
ahs-14952	325	31	families	family	NOUN
ahs-14952	325	32	of	of	ADP
ahs-14952	325	33	rhizoctonia	rhizoctonia	NOUN
ahs-14952	325	34	species	specie	NOUN
ahs-14952	325	35	that	that	PRON
ahs-14952	325	36	are	be	AUX
ahs-14952	325	37	linked	link	VERB
ahs-14952	325	38	with	with	ADP
ahs-14952	325	39	orchids	orchid	NOUN
ahs-14952	325	40	(	(	PUNCT
ahs-14952	325	41	gardes	garde	NOUN
ahs-14952	325	42	and	and	CCONJ
ahs-14952	325	43	bruns	brun	NOUN
ahs-14952	325	44	,	,	PUNCT
ahs-14952	325	45	1993	1993	NUM
ahs-14952	325	46	)	)	PUNCT
ahs-14952	325	47	.	.	PUNCT
ahs-14952	326	1	conventionally	conventionally	ADV
ahs-14952	326	2	,	,	PUNCT
ahs-14952	326	3	it	it	PRON
ahs-14952	326	4	has	have	AUX
ahs-14952	326	5	been	be	AUX
ahs-14952	326	6	thought	think	VERB
ahs-14952	326	7	that	that	SCONJ
ahs-14952	326	8	the	the	DET
ahs-14952	326	9	‘	'	PUNCT
ahs-14952	326	10	rhizoctonia	rhizoctonia	NOUN
ahs-14952	326	11	’	'	PUNCT
ahs-14952	326	12	complex	complex	NOUN
ahs-14952	326	13	,	,	PUNCT
ahs-14952	326	14	which	which	PRON
ahs-14952	326	15	includes	include	VERB
ahs-14952	326	16	species	specie	NOUN
ahs-14952	326	17	from	from	ADP
ahs-14952	326	18	three	three	NUM
ahs-14952	326	19	different	different	ADJ
ahs-14952	326	20	fungal	fungal	ADJ
ahs-14952	326	21	families	family	NOUN
ahs-14952	326	22	(	(	PUNCT
ahs-14952	326	23	tulasnellaceae	tulasnellaceae	ADV
ahs-14952	326	24	,	,	PUNCT
ahs-14952	326	25	ceratobasidiaceae	ceratobasidiaceae	NOUN
ahs-14952	326	26	,	,	PUNCT
ahs-14952	326	27	and	and	CCONJ
ahs-14952	326	28	serendipitaceae	serendipitaceae	PROPN
ahs-14952	326	29	)	)	PUNCT
ahs-14952	326	30	,	,	PUNCT
ahs-14952	326	31	makes	make	VERB
ahs-14952	326	32	up	up	ADP
ahs-14952	326	33	the	the	DET
ahs-14952	326	34	bulk	bulk	NOUN
ahs-14952	326	35	,	,	PUNCT
ahs-14952	326	36	if	if	SCONJ
ahs-14952	326	37	not	not	PART
ahs-14952	326	38	the	the	DET
ahs-14952	326	39	entirety	entirety	NOUN
ahs-14952	326	40	,	,	PUNCT
ahs-14952	326	41	of	of	ADP
ahs-14952	326	42	orchid	orchid	NOUN
ahs-14952	326	43	mycorrhizal	mycorrhizal	NOUN
ahs-14952	326	44	fungus	fungus	NOUN
ahs-14952	326	45	.	.	PUNCT
ahs-14952	327	1	however	however	ADV
ahs-14952	327	2	,	,	PUNCT
ahs-14952	327	3	recent	recent	ADJ
ahs-14952	327	4	research	research	NOUN
ahs-14952	327	5	suggests	suggest	VERB
ahs-14952	327	6	that	that	SCONJ
ahs-14952	327	7	this	this	PRON
ahs-14952	327	8	may	may	AUX
ahs-14952	327	9	not	not	PART
ahs-14952	327	10	be	be	AUX
ahs-14952	327	11	the	the	DET
ahs-14952	327	12	case	case	NOUN
ahs-14952	327	13	.	.	PUNCT
ahs-14952	328	1	septal	septal	ADJ
ahs-14952	328	2	ultrastructure	ultrastructure	NOUN
ahs-14952	328	3	is	be	AUX
ahs-14952	328	4	a	a	DET
ahs-14952	328	5	defining	define	VERB
ahs-14952	328	6	characteristic	characteristic	NOUN
ahs-14952	328	7	that	that	PRON
ahs-14952	328	8	separates	separate	VERB
ahs-14952	328	9	the	the	DET
ahs-14952	328	10	various	various	ADJ
ahs-14952	328	11	clades	clade	NOUN
ahs-14952	328	12	within	within	ADP
ahs-14952	328	13	rhizoctonia	rhizoctonia	NOUN
ahs-14952	328	14	(	(	PUNCT
ahs-14952	328	15	currah	currah	PROPN
ahs-14952	328	16	and	and	CCONJ
ahs-14952	328	17	sherburne	sherburne	PROPN
ahs-14952	328	18	,	,	PUNCT
ahs-14952	328	19	1992	1992	NUM
ahs-14952	328	20	)	)	PUNCT
ahs-14952	328	21	,	,	PUNCT
ahs-14952	328	22	but	but	CCONJ
ahs-14952	328	23	careful	careful	ADJ
ahs-14952	328	24	inspection	inspection	NOUN
ahs-14952	328	25	is	be	AUX
ahs-14952	328	26	still	still	ADV
ahs-14952	328	27	required	require	VERB
ahs-14952	328	28	to	to	PART
ahs-14952	328	29	distinguish	distinguish	VERB
ahs-14952	328	30	sebacinaceae	sebacinaceae	NOUN
ahs-14952	328	31	and	and	CCONJ
ahs-14952	328	32	tulasnellaceae	tulasnellaceae	PROPN
ahs-14952	328	33	(	(	PUNCT
ahs-14952	328	34	andersen	andersen	PROPN
ahs-14952	328	35	,	,	PUNCT
ahs-14952	328	36	1996	1996	NUM
ahs-14952	328	37	)	)	PUNCT
ahs-14952	328	38	.	.	PUNCT
ahs-14952	329	1	this	this	DET
ahs-14952	329	2	problem	problem	NOUN
ahs-14952	329	3	is	be	AUX
ahs-14952	329	4	compounded	compound	VERB
ahs-14952	329	5	by	by	ADP
ahs-14952	329	6	the	the	DET
ahs-14952	329	7	fact	fact	NOUN
ahs-14952	329	8	that	that	SCONJ
ahs-14952	329	9	when	when	SCONJ
ahs-14952	329	10	the	the	DET
ahs-14952	329	11	cryptic	cryptic	ADJ
ahs-14952	329	12	,	,	PUNCT
ahs-14952	329	13	resupinate	resupinate	ADJ
ahs-14952	329	14	fruiting	fruiting	NOUN
ahs-14952	329	15	structures	structure	NOUN
ahs-14952	329	16	are	be	AUX
ahs-14952	329	17	seldom	seldom	ADV
ahs-14952	329	18	observed	observe	VERB
ahs-14952	329	19	.	.	PUNCT
ahs-14952	330	1	basidial	basidial	ADJ
ahs-14952	330	2	morphology	morphology	NOUN
ahs-14952	330	3	offers	offer	VERB
ahs-14952	330	4	suitable	suitable	ADJ
ahs-14952	330	5	identification	identification	NOUN
ahs-14952	330	6	of	of	ADP
ahs-14952	330	7	orchid­associated	orchid­associate	VERB
ahs-14952	330	8	rhizoctonia	rhizoctonia	NOUN
ahs-14952	330	9	species	specie	NOUN
ahs-14952	330	10	at	at	ADP
ahs-14952	330	11	the	the	DET
ahs-14952	330	12	morphospecies	morphospecie	NOUN
ahs-14952	330	13	level	level	NOUN
ahs-14952	330	14	(	(	PUNCT
ahs-14952	330	15	warcup	warcup	NOUN
ahs-14952	330	16	and	and	CCONJ
ahs-14952	330	17	talbot	talbot	PROPN
ahs-14952	330	18	,	,	PUNCT
ahs-14952	330	19	1967	1967	NUM
ahs-14952	330	20	)	)	PUNCT
ahs-14952	330	21	.	.	PUNCT
ahs-14952	331	1	however	however	ADV
ahs-14952	331	2	,	,	PUNCT
ahs-14952	331	3	orchid	orchid	NOUN
ahs-14952	331	4	isolates	isolate	NOUN
ahs-14952	331	5	are	be	AUX
ahs-14952	331	6	rarely	rarely	ADV
ahs-14952	331	7	induced	induce	VERB
ahs-14952	331	8	to	to	PART
ahs-14952	331	9	fruit	fruit	VERB
ahs-14952	331	10	in	in	ADP
ahs-14952	331	11	culture	culture	NOUN
ahs-14952	331	12	as	as	SCONJ
ahs-14952	331	13	some	some	DET
ahs-14952	331	14	fungi	fungus	NOUN
ahs-14952	331	15	can	can	AUX
ahs-14952	331	16	not	not	PART
ahs-14952	331	17	be	be	AUX
ahs-14952	331	18	produced	produce	VERB
ahs-14952	331	19	in	in	ADP
ahs-14952	331	20	artificial	artificial	ADJ
ahs-14952	331	21	circumstances	circumstance	NOUN
ahs-14952	331	22	(	(	PUNCT
ahs-14952	331	23	currah	currah	INTJ
ahs-14952	331	24	et	et	PROPN
ahs-14952	331	25	al	al	PROPN
ahs-14952	331	26	.	.	PROPN
ahs-14952	331	27	,	,	PUNCT
ahs-14952	331	28	1990	1990	NUM
ahs-14952	331	29	)	)	PUNCT
ahs-14952	331	30	.	.	PUNCT
ahs-14952	332	1	in	in	ADP
ahs-14952	332	2	order	order	NOUN
ahs-14952	332	3	to	to	PART
ahs-14952	332	4	expand	expand	VERB
ahs-14952	332	5	knowledge	knowledge	NOUN
ahs-14952	332	6	of	of	ADP
ahs-14952	332	7	fungal	fungal	ADJ
ahs-14952	332	8	variety	variety	NOUN
ahs-14952	332	9	,	,	PUNCT
ahs-14952	332	10	culture­independent	culture­independent	NOUN
ahs-14952	332	11	technologies	technology	NOUN
ahs-14952	332	12	(	(	PUNCT
ahs-14952	332	13	sequencing	sequence	VERB
ahs-14952	332	14	and	and	CCONJ
ahs-14952	332	15	cloning	cloning	NOUN
ahs-14952	332	16	)	)	PUNCT
ahs-14952	332	17	have	have	AUX
ahs-14952	332	18	been	be	AUX
ahs-14952	332	19	created	create	VERB
ahs-14952	332	20	.	.	PUNCT
ahs-14952	333	1	morphological	morphological	ADJ
ahs-14952	333	2	identification	identification	NOUN
ahs-14952	333	3	methods	method	NOUN
ahs-14952	333	4	are	be	AUX
ahs-14952	333	5	conventional	conventional	ADJ
ahs-14952	333	6	identification	identification	NOUN
ahs-14952	333	7	method	method	NOUN
ahs-14952	333	8	that	that	PRON
ahs-14952	333	9	involves	involve	VERB
ahs-14952	333	10	evaluating	evaluate	VERB
ahs-14952	333	11	the	the	DET
ahs-14952	333	12	adv	adv	PROPN
ahs-14952	333	13	.	.	PUNCT
ahs-14952	333	14	hort	hort	PROPN
ahs-14952	333	15	.	.	PUNCT
ahs-14952	334	1	sci	sci	PROPN
ahs-14952	334	2	.	.	PROPN
ahs-14952	334	3	,	,	PUNCT
ahs-14952	334	4	2024	2024	NUM
ahs-14952	334	5	38(1	38(1	NOUN
ahs-14952	334	6	):	):	PUNCT
ahs-14952	334	7	97­116	97­116	NUM
ahs-14952	334	8	110	110	NUM
ahs-14952	334	9	morphological	morphological	ADJ
ahs-14952	334	10	and	and	CCONJ
ahs-14952	334	11	microscopic	microscopic	ADJ
ahs-14952	334	12	features	feature	NOUN
ahs-14952	334	13	of	of	ADP
ahs-14952	334	14	fungi	fungus	NOUN
ahs-14952	334	15	on	on	ADP
ahs-14952	334	16	different	different	ADJ
ahs-14952	334	17	culture	culture	NOUN
ahs-14952	334	18	media	medium	NOUN
ahs-14952	334	19	and	and	CCONJ
ahs-14952	334	20	under	under	ADP
ahs-14952	334	21	different	different	ADJ
ahs-14952	334	22	conditions	condition	NOUN
ahs-14952	334	23	.	.	PUNCT
ahs-14952	335	1	this	this	DET
ahs-14952	335	2	method	method	NOUN
ahs-14952	335	3	can	can	AUX
ahs-14952	335	4	be	be	AUX
ahs-14952	335	5	accompanied	accompany	VERB
ahs-14952	335	6	by	by	ADP
ahs-14952	335	7	other	other	ADJ
ahs-14952	335	8	identification	identification	NOUN
ahs-14952	335	9	methods	method	NOUN
ahs-14952	335	10	to	to	PART
ahs-14952	335	11	help	help	VERB
ahs-14952	335	12	identify	identify	VERB
ahs-14952	335	13	fungi	fungus	NOUN
ahs-14952	335	14	more	more	ADV
ahs-14952	335	15	accurately	accurately	ADV
ahs-14952	335	16	.	.	PUNCT
ahs-14952	336	1	other	other	ADJ
ahs-14952	336	2	methods	method	NOUN
ahs-14952	336	3	,	,	PUNCT
ahs-14952	336	4	such	such	ADJ
ahs-14952	336	5	as	as	ADP
ahs-14952	336	6	microscopic	microscopic	ADJ
ahs-14952	336	7	examination	examination	NOUN
ahs-14952	336	8	or	or	CCONJ
ahs-14952	336	9	biochemical	biochemical	ADJ
ahs-14952	336	10	screening	screening	NOUN
ahs-14952	336	11	,	,	PUNCT
ahs-14952	336	12	can	can	AUX
ahs-14952	336	13	be	be	AUX
ahs-14952	336	14	performed	perform	VERB
ahs-14952	336	15	alone	alone	ADV
ahs-14952	336	16	or	or	CCONJ
ahs-14952	336	17	in	in	ADP
ahs-14952	336	18	conjunction	conjunction	NOUN
ahs-14952	336	19	with	with	ADP
ahs-14952	336	20	molecular	molecular	ADJ
ahs-14952	336	21	analysis	analysis	NOUN
ahs-14952	336	22	.	.	PUNCT
ahs-14952	337	1	with	with	ADP
ahs-14952	337	2	the	the	DET
ahs-14952	337	3	recent	recent	ADJ
ahs-14952	337	4	development	development	NOUN
ahs-14952	337	5	of	of	ADP
ahs-14952	337	6	advanced	advanced	ADJ
ahs-14952	337	7	molecular	molecular	ADJ
ahs-14952	337	8	techniques	technique	NOUN
ahs-14952	337	9	(	(	PUNCT
ahs-14952	337	10	e.g.	e.g.	ADV
ahs-14952	337	11	,	,	PUNCT
ahs-14952	337	12	next­generation	next­generation	NOUN
ahs-14952	337	13	sequencing	sequencing	NOUN
ahs-14952	337	14	)	)	PUNCT
ahs-14952	337	15	,	,	PUNCT
ahs-14952	337	16	the	the	DET
ahs-14952	337	17	spectrum	spectrum	NOUN
ahs-14952	337	18	of	of	ADP
ahs-14952	337	19	fungi	fungus	NOUN
ahs-14952	337	20	discovered	discover	VERB
ahs-14952	337	21	at	at	ADP
ahs-14952	337	22	the	the	DET
ahs-14952	337	23	species	species	NOUN
ahs-14952	337	24	level	level	NOUN
ahs-14952	337	25	has	have	AUX
ahs-14952	337	26	expanded	expand	VERB
ahs-14952	337	27	significantly	significantly	ADV
ahs-14952	337	28	,	,	PUNCT
ahs-14952	337	29	allowing	allow	VERB
ahs-14952	337	30	for	for	ADP
ahs-14952	337	31	more	more	ADV
ahs-14952	337	32	precise	precise	ADJ
ahs-14952	337	33	ecological	ecological	ADJ
ahs-14952	337	34	inferences	inference	NOUN
ahs-14952	337	35	(	(	PUNCT
ahs-14952	337	36	peay	peay	ADJ
ahs-14952	337	37	,	,	PUNCT
ahs-14952	337	38	2014	2014	NUM
ahs-14952	337	39	)	)	PUNCT
ahs-14952	337	40	.	.	PUNCT
ahs-14952	338	1	high­throughput	high­throughput	ADJ
ahs-14952	338	2	sequencing	sequence	VERB
ahs-14952	338	3	(	(	PUNCT
ahs-14952	338	4	hts	ht	NOUN
ahs-14952	338	5	)	)	PUNCT
ahs-14952	338	6	technologies	technology	NOUN
ahs-14952	338	7	provide	provide	VERB
ahs-14952	338	8	a	a	DET
ahs-14952	338	9	number	number	NOUN
ahs-14952	338	10	of	of	ADP
ahs-14952	338	11	benefits	benefit	NOUN
ahs-14952	338	12	,	,	PUNCT
ahs-14952	338	13	including	include	VERB
ahs-14952	338	14	the	the	DET
ahs-14952	338	15	capability	capability	NOUN
ahs-14952	338	16	to	to	PART
ahs-14952	338	17	identify	identify	VERB
ahs-14952	338	18	fungi	fungus	NOUN
ahs-14952	338	19	at	at	ADP
ahs-14952	338	20	trace	trace	NOUN
ahs-14952	338	21	levels	level	NOUN
ahs-14952	338	22	,	,	PUNCT
ahs-14952	338	23	quick	quick	ADJ
ahs-14952	338	24	microbial	microbial	ADJ
ahs-14952	338	25	community	community	NOUN
ahs-14952	338	26	structure	structure	NOUN
ahs-14952	338	27	analysis	analysis	NOUN
ahs-14952	338	28	,	,	PUNCT
ahs-14952	338	29	and	and	CCONJ
ahs-14952	338	30	cost­effectiveness	cost­effectiveness	NOUN
ahs-14952	338	31	(	(	PUNCT
ahs-14952	338	32	cruz	cruz	PROPN
ahs-14952	338	33	et	et	PROPN
ahs-14952	338	34	al	al	PROPN
ahs-14952	338	35	.	.	PROPN
ahs-14952	338	36	,	,	PUNCT
ahs-14952	338	37	2014	2014	NUM
ahs-14952	338	38	;	;	PUNCT
ahs-14952	338	39	tedersoo	tedersoo	PROPN
ahs-14952	338	40	and	and	CCONJ
ahs-14952	338	41	nilsson	nilsson	PROPN
ahs-14952	338	42	,	,	PUNCT
ahs-14952	338	43	2016	2016	NUM
ahs-14952	338	44	;	;	PUNCT
ahs-14952	338	45	nilsson	nilsson	PROPN
ahs-14952	338	46	et	et	PROPN
ahs-14952	338	47	al	al	PROPN
ahs-14952	338	48	.	.	PROPN
ahs-14952	338	49	,	,	PUNCT
ahs-14952	338	50	2019	2019	NUM
ahs-14952	338	51	)	)	PUNCT
ahs-14952	338	52	.	.	PUNCT
ahs-14952	339	1	these	these	DET
ahs-14952	339	2	benefits	benefit	NOUN
ahs-14952	339	3	can	can	AUX
ahs-14952	339	4	be	be	AUX
ahs-14952	339	5	found	find	VERB
ahs-14952	339	6	in	in	ADP
ahs-14952	339	7	hts	hts	PROPN
ahs-14952	339	8	technologies	technology	NOUN
ahs-14952	339	9	.	.	PUNCT
ahs-14952	340	1	according	accord	VERB
ahs-14952	340	2	to	to	ADP
ahs-14952	340	3	nilsson	nilsson	PROPN
ahs-14952	340	4	et	et	PROPN
ahs-14952	340	5	al	al	PROPN
ahs-14952	340	6	.	.	PROPN
ahs-14952	341	1	(	(	PUNCT
ahs-14952	341	2	2019	2019	NUM
ahs-14952	341	3	)	)	PUNCT
ahs-14952	341	4	,	,	PUNCT
ahs-14952	341	5	a	a	DET
ahs-14952	341	6	typical	typical	ADJ
ahs-14952	341	7	hts	hts	PROPN
ahs-14952	341	8	metabarcoding	metabarcoding	NOUN
ahs-14952	341	9	process	process	NOUN
ahs-14952	341	10	consists	consist	VERB
ahs-14952	341	11	of	of	ADP
ahs-14952	341	12	several	several	ADJ
ahs-14952	341	13	important	important	ADJ
ahs-14952	341	14	stages	stage	NOUN
ahs-14952	341	15	,	,	PUNCT
ahs-14952	341	16	including	include	VERB
ahs-14952	341	17	dna	dna	PROPN
ahs-14952	341	18	extraction	extraction	NOUN
ahs-14952	341	19	,	,	PUNCT
ahs-14952	341	20	marker­based	marker­base	VERB
ahs-14952	341	21	pcr	pcr	ADJ
ahs-14952	341	22	amplification	amplification	NOUN
ahs-14952	341	23	,	,	PUNCT
ahs-14952	341	24	dna	dna	NOUN
ahs-14952	341	25	sequencing	sequencing	NOUN
ahs-14952	341	26	,	,	PUNCT
ahs-14952	341	27	sequence	sequence	NOUN
ahs-14952	341	28	processing	processing	NOUN
ahs-14952	341	29	,	,	PUNCT
ahs-14952	341	30	and	and	CCONJ
ahs-14952	341	31	data	datum	NOUN
ahs-14952	341	32	analysis	analysis	NOUN
ahs-14952	341	33	.	.	PUNCT
ahs-14952	342	1	these	these	DET
ahs-14952	342	2	processes	process	NOUN
ahs-14952	342	3	are	be	AUX
ahs-14952	342	4	listed	list	VERB
ahs-14952	342	5	in	in	ADP
ahs-14952	342	6	the	the	DET
ahs-14952	342	7	order	order	NOUN
ahs-14952	342	8	as	as	SCONJ
ahs-14952	342	9	follows	follow	VERB
ahs-14952	342	10	:	:	PUNCT
ahs-14952	342	11	sampling	sample	VERB
ahs-14952	342	12	then	then	ADV
ahs-14952	342	13	dna	dna	PROPN
ahs-14952	342	14	extraction	extraction	NOUN
ahs-14952	342	15	.	.	PUNCT
ahs-14952	343	1	however	however	ADV
ahs-14952	343	2	,	,	PUNCT
ahs-14952	343	3	one	one	NUM
ahs-14952	343	4	potential	potential	ADJ
ahs-14952	343	5	downside	downside	NOUN
ahs-14952	343	6	of	of	ADP
ahs-14952	343	7	these	these	DET
ahs-14952	343	8	technologies	technology	NOUN
ahs-14952	343	9	is	be	AUX
ahs-14952	343	10	that	that	SCONJ
ahs-14952	343	11	they	they	PRON
ahs-14952	343	12	may	may	AUX
ahs-14952	343	13	potentially	potentially	ADV
ahs-14952	343	14	result	result	VERB
ahs-14952	343	15	in	in	ADP
ahs-14952	343	16	the	the	DET
ahs-14952	343	17	spread	spread	NOUN
ahs-14952	343	18	of	of	ADP
ahs-14952	343	19	pollutants	pollutant	NOUN
ahs-14952	343	20	and	and	CCONJ
ahs-14952	343	21	mycorrhizal	mycorrhizal	NOUN
ahs-14952	343	22	fungi	fungus	NOUN
ahs-14952	343	23	that	that	PRON
ahs-14952	343	24	are	be	AUX
ahs-14952	343	25	not	not	PART
ahs-14952	343	26	specific	specific	ADJ
ahs-14952	343	27	to	to	ADP
ahs-14952	343	28	orchids	orchid	NOUN
ahs-14952	343	29	.	.	PUNCT
ahs-14952	344	1	research	research	NOUN
ahs-14952	344	2	methodology	methodology	NOUN
ahs-14952	344	3	and	and	CCONJ
ahs-14952	344	4	sequencing	sequencing	NOUN
ahs-14952	344	5	carried	carry	VERB
ahs-14952	344	6	out	out	ADP
ahs-14952	344	7	on	on	ADP
ahs-14952	344	8	high­throughput	high­throughput	ADJ
ahs-14952	344	9	platforms	platform	NOUN
ahs-14952	344	10	are	be	AUX
ahs-14952	344	11	the	the	DET
ahs-14952	344	12	two	two	NUM
ahs-14952	344	13	components	component	NOUN
ahs-14952	344	14	of	of	ADP
ahs-14952	344	15	the	the	DET
ahs-14952	344	16	most	most	ADV
ahs-14952	344	17	typical	typical	ADJ
ahs-14952	344	18	approaches	approach	NOUN
ahs-14952	344	19	to	to	ADP
ahs-14952	344	20	molecular	molecular	ADJ
ahs-14952	344	21	identification	identification	NOUN
ahs-14952	344	22	.	.	PUNCT
ahs-14952	345	1	dna	dna	PROPN
ahs-14952	345	2	microarrays	microarray	NOUN
ahs-14952	345	3	,	,	PUNCT
ahs-14952	345	4	clone	clone	NOUN
ahs-14952	345	5	libraries	library	NOUN
ahs-14952	345	6	,	,	PUNCT
ahs-14952	345	7	denaturing	denature	VERB
ahs-14952	345	8	gradient	gradient	ADJ
ahs-14952	345	9	gel	gel	NOUN
ahs-14952	345	10	electrophoresis	electrophoresis	NOUN
ahs-14952	345	11	,	,	PUNCT
ahs-14952	345	12	fluorescence	fluorescence	NOUN
ahs-14952	345	13	in	in	ADP
ahs-14952	345	14	situ	situ	ADJ
ahs-14952	345	15	hybridization	hybridization	NOUN
ahs-14952	345	16	,	,	PUNCT
ahs-14952	345	17	and	and	CCONJ
ahs-14952	345	18	gene	gene	NOUN
ahs-14952	345	19	chip	chip	NOUN
ahs-14952	345	20	approaches	approach	NOUN
ahs-14952	345	21	are	be	AUX
ahs-14952	345	22	some	some	PRON
ahs-14952	345	23	of	of	ADP
ahs-14952	345	24	the	the	DET
ahs-14952	345	25	other	other	ADJ
ahs-14952	345	26	methods	method	NOUN
ahs-14952	345	27	that	that	PRON
ahs-14952	345	28	can	can	AUX
ahs-14952	345	29	be	be	AUX
ahs-14952	345	30	utilised	utilise	VERB
ahs-14952	345	31	for	for	ADP
ahs-14952	345	32	the	the	DET
ahs-14952	345	33	identification	identification	NOUN
ahs-14952	345	34	of	of	ADP
ahs-14952	345	35	fungi	fungi	PROPN
ahs-14952	345	36	(	(	PUNCT
ahs-14952	345	37	dearnaley	dearnaley	PROPN
ahs-14952	345	38	,	,	PUNCT
ahs-14952	345	39	2007	2007	NUM
ahs-14952	345	40	)	)	PUNCT
ahs-14952	345	41	.	.	PUNCT
ahs-14952	346	1	however	however	ADV
ahs-14952	346	2	,	,	PUNCT
ahs-14952	346	3	these	these	DET
ahs-14952	346	4	technologies	technology	NOUN
ahs-14952	346	5	have	have	VERB
ahs-14952	346	6	short­	short­	NUM
ahs-14952	346	7	comings	coming	NOUN
ahs-14952	346	8	such	such	ADJ
ahs-14952	346	9	as	as	ADP
ahs-14952	346	10	limited	limited	ADJ
ahs-14952	346	11	throughput	throughput	NOUN
ahs-14952	346	12	,	,	PUNCT
ahs-14952	346	13	time­consuming	time­consuming	NOUN
ahs-14952	346	14	processes	process	NOUN
ahs-14952	346	15	,	,	PUNCT
ahs-14952	346	16	and	and	CCONJ
ahs-14952	346	17	lower	low	ADJ
ahs-14952	346	18	accuracy	accuracy	NOUN
ahs-14952	346	19	.	.	PUNCT
ahs-14952	347	1	additionally	additionally	ADV
ahs-14952	347	2	,	,	PUNCT
ahs-14952	347	3	they	they	PRON
ahs-14952	347	4	have	have	AUX
ahs-14952	347	5	been	be	AUX
ahs-14952	347	6	overshadowed	overshadow	VERB
ahs-14952	347	7	by	by	ADP
ahs-14952	347	8	the	the	DET
ahs-14952	347	9	growing	grow	VERB
ahs-14952	347	10	popularity	popularity	NOUN
ahs-14952	347	11	of	of	ADP
ahs-14952	347	12	alternative	alternative	ADJ
ahs-14952	347	13	methods	method	NOUN
ahs-14952	347	14	such	such	ADJ
ahs-14952	347	15	as	as	ADP
ahs-14952	347	16	the	the	DET
ahs-14952	347	17	miseq	miseq	NOUN
ahs-14952	347	18	pe300	pe300	ADJ
ahs-14952	347	19	and	and	CCONJ
ahs-14952	347	20	hiseq	hiseq	NOUN
ahs-14952	347	21	pe250	pe250	ADJ
ahs-14952	347	22	platforms	platform	NOUN
ahs-14952	347	23	(	(	PUNCT
ahs-14952	347	24	julou	julou	PROPN
ahs-14952	347	25	et	et	PROPN
ahs-14952	347	26	al	al	PROPN
ahs-14952	347	27	.	.	PROPN
ahs-14952	347	28	,	,	PUNCT
ahs-14952	347	29	2005	2005	NUM
ahs-14952	347	30	)	)	PUNCT
ahs-14952	347	31	.	.	PUNCT
ahs-14952	348	1	furthermore	furthermore	ADV
ahs-14952	348	2	,	,	PUNCT
ahs-14952	348	3	alternative	alternative	ADJ
ahs-14952	348	4	methods	method	NOUN
ahs-14952	348	5	,	,	PUNCT
ahs-14952	348	6	such	such	ADJ
ahs-14952	348	7	as	as	ADP
ahs-14952	348	8	using	use	VERB
ahs-14952	348	9	an	an	DET
ahs-14952	348	10	illumina	illumina	PROPN
ahs-14952	348	11	novaseq	novaseq	PROPN
ahs-14952	348	12	/	/	SYM
ahs-14952	348	13	hiseq	hiseq	NOUN
ahs-14952	348	14	sequencer	sequencer	NOUN
ahs-14952	348	15	and	and	CCONJ
ahs-14952	348	16	the	the	DET
ahs-14952	348	17	application	application	NOUN
ahs-14952	348	18	of	of	ADP
ahs-14952	348	19	shotgun	shotgun	NOUN
ahs-14952	348	20	metagenomic	metagenomic	ADJ
ahs-14952	348	21	technology	technology	NOUN
ahs-14952	348	22	,	,	PUNCT
ahs-14952	348	23	provide	provide	VERB
ahs-14952	348	24	access	access	NOUN
ahs-14952	348	25	to	to	ADP
ahs-14952	348	26	functional	functional	ADJ
ahs-14952	348	27	gene	gene	NOUN
ahs-14952	348	28	information	information	NOUN
ahs-14952	348	29	from	from	ADP
ahs-14952	348	30	all	all	DET
ahs-14952	348	31	microorganisms	microorganism	NOUN
ahs-14952	348	32	within	within	ADP
ahs-14952	348	33	a	a	DET
ahs-14952	348	34	community	community	NOUN
ahs-14952	348	35	through	through	ADP
ahs-14952	348	36	genomic	genomic	ADJ
ahs-14952	348	37	dna	dna	NOUN
ahs-14952	348	38	analysis	analysis	NOUN
ahs-14952	348	39	(	(	PUNCT
ahs-14952	348	40	bahram	bahram	PROPN
ahs-14952	348	41	et	et	PROPN
ahs-14952	348	42	al	al	PROPN
ahs-14952	348	43	.	.	PROPN
ahs-14952	348	44	,	,	PUNCT
ahs-14952	348	45	2018	2018	NUM
ahs-14952	348	46	;	;	PUNCT
ahs-14952	348	47	fadiji	fadiji	NOUN
ahs-14952	348	48	and	and	CCONJ
ahs-14952	348	49	babalola	babalola	NOUN
ahs-14952	348	50	,	,	PUNCT
ahs-14952	348	51	2020	2020	NUM
ahs-14952	348	52	)	)	PUNCT
ahs-14952	348	53	.	.	PUNCT
ahs-14952	349	1	these	these	DET
ahs-14952	349	2	methods	method	NOUN
ahs-14952	349	3	were	be	AUX
ahs-14952	349	4	developed	develop	VERB
ahs-14952	349	5	by	by	ADP
ahs-14952	349	6	bahram	bahram	PROPN
ahs-14952	349	7	et	et	PROPN
ahs-14952	349	8	al	al	PROPN
ahs-14952	349	9	.	.	PROPN
ahs-14952	350	1	(	(	PUNCT
ahs-14952	350	2	2018	2018	NUM
ahs-14952	350	3	)	)	PUNCT
ahs-14952	350	4	and	and	CCONJ
ahs-14952	350	5	fadiji	fadiji	NOUN
ahs-14952	350	6	and	and	CCONJ
ahs-14952	350	7	babalola	babalola	NOUN
ahs-14952	350	8	(	(	PUNCT
ahs-14952	350	9	2020	2020	NUM
ahs-14952	350	10	)	)	PUNCT
ahs-14952	350	11	.	.	PUNCT
ahs-14952	351	1	an	an	DET
ahs-14952	351	2	important	important	ADJ
ahs-14952	351	3	step	step	NOUN
ahs-14952	351	4	forward	forward	ADV
ahs-14952	351	5	in	in	ADP
ahs-14952	351	6	orchid	orchid	NOUN
ahs-14952	351	7	mycorrhiza	mycorrhiza	NOUN
ahs-14952	351	8	research	research	NOUN
ahs-14952	351	9	has	have	AUX
ahs-14952	351	10	been	be	AUX
ahs-14952	351	11	taken	take	VERB
ahs-14952	351	12	thanks	thank	NOUN
ahs-14952	351	13	to	to	ADP
ahs-14952	351	14	the	the	DET
ahs-14952	351	15	development	development	NOUN
ahs-14952	351	16	of	of	ADP
ahs-14952	351	17	this	this	DET
ahs-14952	351	18	technique	technique	NOUN
ahs-14952	351	19	and	and	CCONJ
ahs-14952	351	20	the	the	DET
ahs-14952	351	21	growing	grow	VERB
ahs-14952	351	22	availability	availability	NOUN
ahs-14952	351	23	of	of	ADP
ahs-14952	351	24	orchid	orchid	NOUN
ahs-14952	351	25	and	and	CCONJ
ahs-14952	351	26	reference	reference	NOUN
ahs-14952	351	27	orchid	orchid	NOUN
ahs-14952	351	28	mycorrhizal	mycorrhizal	NOUN
ahs-14952	351	29	fungal	fungal	ADJ
ahs-14952	351	30	genomes	genome	NOUN
ahs-14952	351	31	(	(	PUNCT
ahs-14952	351	32	zhang	zhang	X
ahs-14952	351	33	et	et	PROPN
ahs-14952	351	34	al	al	PROPN
ahs-14952	351	35	.	.	PROPN
ahs-14952	351	36	,	,	PUNCT
ahs-14952	351	37	2016	2016	NUM
ahs-14952	351	38	)	)	PUNCT
ahs-14952	351	39	.	.	PUNCT
ahs-14952	352	1	because	because	SCONJ
ahs-14952	352	2	of	of	ADP
ahs-14952	352	3	their	their	PRON
ahs-14952	352	4	ability	ability	NOUN
ahs-14952	352	5	to	to	PART
ahs-14952	352	6	simultaneously	simultaneously	ADV
ahs-14952	352	7	sequence	sequence	VERB
ahs-14952	352	8	a	a	DET
ahs-14952	352	9	mixed	mixed	ADJ
ahs-14952	352	10	dna	dna	NOUN
ahs-14952	352	11	template	template	NOUN
ahs-14952	352	12	across	across	ADP
ahs-14952	352	13	numerous	numerous	ADJ
ahs-14952	352	14	samples	sample	NOUN
ahs-14952	352	15	with	with	ADP
ahs-14952	352	16	a	a	DET
ahs-14952	352	17	high	high	ADJ
ahs-14952	352	18	sequencing	sequence	VERB
ahs-14952	352	19	depth	depth	NOUN
ahs-14952	352	20	(	(	PUNCT
ahs-14952	352	21	nilsson	nilsson	PROPN
ahs-14952	352	22	et	et	PROPN
ahs-14952	352	23	al	al	PROPN
ahs-14952	352	24	.	.	PROPN
ahs-14952	352	25	,	,	PUNCT
ahs-14952	352	26	2019	2019	NUM
ahs-14952	352	27	)	)	PUNCT
ahs-14952	352	28	,	,	PUNCT
ahs-14952	352	29	next­generation	next­generation	NOUN
ahs-14952	352	30	sequencing	sequencing	NOUN
ahs-14952	352	31	(	(	PUNCT
ahs-14952	352	32	ngs	ng	NOUN
ahs-14952	352	33	)	)	PUNCT
ahs-14952	352	34	approaches	approach	NOUN
ahs-14952	352	35	have	have	AUX
ahs-14952	352	36	become	become	VERB
ahs-14952	352	37	practically	practically	ADV
ahs-14952	352	38	widespread	widespread	ADJ
ahs-14952	352	39	in	in	ADP
ahs-14952	352	40	mycorrhizal	mycorrhizal	NOUN
ahs-14952	352	41	research	research	NOUN
ahs-14952	352	42	in	in	ADP
ahs-14952	352	43	recent	recent	ADJ
ahs-14952	352	44	years	year	NOUN
ahs-14952	352	45	.	.	PUNCT
ahs-14952	353	1	this	this	PRON
ahs-14952	353	2	is	be	AUX
ahs-14952	353	3	partly	partly	ADV
ahs-14952	353	4	owing	owe	VERB
ahs-14952	353	5	to	to	ADP
ahs-14952	353	6	the	the	DET
ahs-14952	353	7	fact	fact	NOUN
ahs-14952	353	8	that	that	SCONJ
ahs-14952	353	9	ngs	ng	NOUN
ahs-14952	353	10	methods	method	NOUN
ahs-14952	353	11	have	have	AUX
ahs-14952	353	12	grown	grow	VERB
ahs-14952	353	13	more	more	ADV
ahs-14952	353	14	affordable	affordable	ADJ
ahs-14952	353	15	in	in	ADP
ahs-14952	353	16	recent	recent	ADJ
ahs-14952	353	17	years	year	NOUN
ahs-14952	353	18	.	.	PUNCT
ahs-14952	354	1	in	in	ADP
ahs-14952	354	2	contrast	contrast	NOUN
ahs-14952	354	3	,	,	PUNCT
ahs-14952	354	4	sequencing	sequence	VERB
ahs-14952	354	5	dna	dna	NOUN
ahs-14952	354	6	from	from	ADP
ahs-14952	354	7	individual	individual	ADJ
ahs-14952	354	8	mycorrhizal	mycorrhizal	NOUN
ahs-14952	354	9	root	root	NOUN
ahs-14952	354	10	tips	tip	NOUN
ahs-14952	354	11	may	may	AUX
ahs-14952	354	12	be	be	AUX
ahs-14952	354	13	ideal	ideal	ADJ
ahs-14952	354	14	for	for	ADP
ahs-14952	354	15	sanger	sanger	PROPN
ahs-14952	354	16	sequencing	sequence	VERB
ahs-14952	354	17	when	when	SCONJ
ahs-14952	354	18	it	it	PRON
ahs-14952	354	19	comes	come	VERB
ahs-14952	354	20	to	to	ADP
ahs-14952	354	21	detecting	detect	VERB
ahs-14952	354	22	shifts	shift	NOUN
ahs-14952	354	23	in	in	ADP
ahs-14952	354	24	regularly	regularly	ADV
ahs-14952	354	25	occurring	occur	VERB
ahs-14952	354	26	fungus	fungus	NOUN
ahs-14952	354	27	species	specie	NOUN
ahs-14952	354	28	(	(	PUNCT
ahs-14952	354	29	shemesh	shemesh	X
ahs-14952	354	30	et	et	PROPN
ahs-14952	354	31	al	al	PROPN
ahs-14952	354	32	.	.	PROPN
ahs-14952	354	33	,	,	PUNCT
ahs-14952	354	34	2020	2020	NUM
ahs-14952	354	35	)	)	PUNCT
ahs-14952	354	36	.	.	PUNCT
ahs-14952	355	1	this	this	PRON
ahs-14952	355	2	was	be	AUX
ahs-14952	355	3	found	find	VERB
ahs-14952	355	4	by	by	ADP
ahs-14952	355	5	shemesh	shemesh	NOUN
ahs-14952	355	6	and	and	CCONJ
ahs-14952	355	7	colleagues	colleague	NOUN
ahs-14952	355	8	.	.	PUNCT
ahs-14952	356	1	in	in	ADP
ahs-14952	356	2	contrast	contrast	NOUN
ahs-14952	356	3	to	to	ADP
ahs-14952	356	4	next­generation	next­generation	NOUN
ahs-14952	356	5	sequencing	sequence	VERB
ahs-14952	356	6	technologies	technology	NOUN
ahs-14952	356	7	,	,	PUNCT
ahs-14952	356	8	which	which	PRON
ahs-14952	356	9	can	can	AUX
ahs-14952	356	10	process	process	VERB
ahs-14952	356	11	millions	million	NOUN
ahs-14952	356	12	of	of	ADP
ahs-14952	356	13	dna	dna	PROPN
ahs-14952	356	14	fragments	fragment	NOUN
ahs-14952	356	15	simultaneously	simultaneously	ADV
ahs-14952	356	16	,	,	PUNCT
ahs-14952	356	17	the	the	DET
ahs-14952	356	18	sanger	sanger	PROPN
ahs-14952	356	19	sequencing	sequencing	NOUN
ahs-14952	356	20	method	method	NOUN
ahs-14952	356	21	only	only	ADV
ahs-14952	356	22	processes	process	VERB
ahs-14952	356	23	one	one	NUM
ahs-14952	356	24	dna	dna	NOUN
ahs-14952	356	25	fragment	fragment	NOUN
ahs-14952	356	26	at	at	ADP
ahs-14952	356	27	a	a	DET
ahs-14952	356	28	time	time	NOUN
ahs-14952	356	29	(	(	PUNCT
ahs-14952	356	30	slatko	slatko	PROPN
ahs-14952	356	31	et	et	PROPN
ahs-14952	356	32	al	al	PROPN
ahs-14952	356	33	.	.	PROPN
ahs-14952	356	34	,	,	PUNCT
ahs-14952	356	35	2018	2018	NUM
ahs-14952	356	36	)	)	PUNCT
ahs-14952	356	37	.	.	PUNCT
ahs-14952	357	1	this	this	PRON
ahs-14952	357	2	makes	make	VERB
ahs-14952	357	3	the	the	DET
ahs-14952	357	4	sanger	sanger	PROPN
ahs-14952	357	5	sequencing	sequencing	NOUN
ahs-14952	357	6	method	method	NOUN
ahs-14952	357	7	superior	superior	ADJ
ahs-14952	357	8	in	in	ADP
ahs-14952	357	9	terms	term	NOUN
ahs-14952	357	10	of	of	ADP
ahs-14952	357	11	sequencing	sequence	VERB
ahs-14952	357	12	volume	volume	NOUN
ahs-14952	357	13	.	.	PUNCT
ahs-14952	358	1	this	this	DET
ahs-14952	358	2	distinction	distinction	NOUN
ahs-14952	358	3	has	have	VERB
ahs-14952	358	4	the	the	DET
ahs-14952	358	5	ability	ability	NOUN
ahs-14952	358	6	to	to	PART
ahs-14952	358	7	bring	bring	VERB
ahs-14952	358	8	forth	forth	ADV
ahs-14952	358	9	different	different	ADJ
ahs-14952	358	10	conclusions	conclusion	NOUN
ahs-14952	358	11	regarding	regard	VERB
ahs-14952	358	12	the	the	DET
ahs-14952	358	13	make­up	make­up	NOUN
ahs-14952	358	14	of	of	ADP
ahs-14952	358	15	the	the	DET
ahs-14952	358	16	community	community	NOUN
ahs-14952	358	17	.	.	PUNCT
ahs-14952	359	1	9	9	X
ahs-14952	359	2	.	.	X
ahs-14952	359	3	conclusions	conclusion	NOUN
ahs-14952	359	4	this	this	DET
ahs-14952	359	5	review	review	NOUN
ahs-14952	359	6	provides	provide	VERB
ahs-14952	359	7	an	an	DET
ahs-14952	359	8	overview	overview	NOUN
ahs-14952	359	9	of	of	ADP
ahs-14952	359	10	the	the	DET
ahs-14952	359	11	most	most	ADV
ahs-14952	359	12	significant	significant	ADJ
ahs-14952	359	13	literature	literature	NOUN
ahs-14952	359	14	in	in	ADP
ahs-14952	359	15	orchid	orchid	NOUN
ahs-14952	359	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	359	17	fungi	fungus	NOUN
ahs-14952	359	18	from	from	ADP
ahs-14952	359	19	about	about	ADP
ahs-14952	359	20	2002­2023	2002­2023	NUM
ahs-14952	359	21	.	.	PUNCT
ahs-14952	360	1	the	the	DET
ahs-14952	360	2	molecular	molecular	ADJ
ahs-14952	360	3	identification	identification	NOUN
ahs-14952	360	4	of	of	ADP
ahs-14952	360	5	orchid	orchid	NOUN
ahs-14952	360	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	360	7	represents	represent	VERB
ahs-14952	360	8	a	a	DET
ahs-14952	360	9	significant	significant	ADJ
ahs-14952	360	10	advancement	advancement	NOUN
ahs-14952	360	11	in	in	ADP
ahs-14952	360	12	our	our	PRON
ahs-14952	360	13	understanding	understanding	NOUN
ahs-14952	360	14	of	of	ADP
ahs-14952	360	15	the	the	DET
ahs-14952	360	16	complex	complex	ADJ
ahs-14952	360	17	relationships	relationship	NOUN
ahs-14952	360	18	between	between	ADP
ahs-14952	360	19	orchids	orchid	NOUN
ahs-14952	360	20	and	and	CCONJ
ahs-14952	360	21	their	their	PRON
ahs-14952	360	22	mycorrhizal	mycorrhizal	NOUN
ahs-14952	360	23	fungal	fungal	NOUN
ahs-14952	360	24	.	.	PUNCT
ahs-14952	361	1	in	in	ADP
ahs-14952	361	2	addition	addition	NOUN
ahs-14952	361	3	,	,	PUNCT
ahs-14952	361	4	finding	find	VERB
ahs-14952	361	5	the	the	DET
ahs-14952	361	6	most	most	ADV
ahs-14952	361	7	appropriate	appropriate	ADJ
ahs-14952	361	8	extraction	extraction	NOUN
ahs-14952	361	9	method	method	NOUN
ahs-14952	361	10	and	and	CCONJ
ahs-14952	361	11	choosing	choose	VERB
ahs-14952	361	12	a	a	DET
ahs-14952	361	13	suitable	suitable	ADJ
ahs-14952	361	14	primer	primer	NOUN
ahs-14952	361	15	for	for	ADP
ahs-14952	361	16	amplification	amplification	NOUN
ahs-14952	361	17	is	be	AUX
ahs-14952	361	18	essential	essential	ADJ
ahs-14952	361	19	to	to	PART
ahs-14952	361	20	ensure	ensure	VERB
ahs-14952	361	21	accurate	accurate	ADJ
ahs-14952	361	22	identification	identification	NOUN
ahs-14952	361	23	.	.	PUNCT
ahs-14952	362	1	moreover	moreover	ADV
ahs-14952	362	2	,	,	PUNCT
ahs-14952	362	3	the	the	DET
ahs-14952	362	4	utilization	utilization	NOUN
ahs-14952	362	5	of	of	ADP
ahs-14952	362	6	molecular	molecular	ADJ
ahs-14952	362	7	techniques	technique	NOUN
ahs-14952	362	8	compliments	compliment	NOUN
ahs-14952	362	9	morphology­based	morphology­base	VERB
ahs-14952	362	10	identifications	identification	NOUN
ahs-14952	362	11	offers	offer	VERB
ahs-14952	362	12	a	a	DET
ahs-14952	362	13	reliable	reliable	ADJ
ahs-14952	362	14	,	,	PUNCT
ahs-14952	362	15	unbiased	unbiased	ADJ
ahs-14952	362	16	,	,	PUNCT
ahs-14952	362	17	and	and	CCONJ
ahs-14952	362	18	frequently	frequently	ADV
ahs-14952	362	19	more	more	ADV
ahs-14952	362	20	precise	precise	ADJ
ahs-14952	362	21	tools	tool	NOUN
ahs-14952	362	22	for	for	ADP
ahs-14952	362	23	confirming	confirm	VERB
ahs-14952	362	24	species	specie	NOUN
ahs-14952	362	25	.	.	PUNCT
ahs-14952	363	1	it	it	PRON
ahs-14952	363	2	is	be	AUX
ahs-14952	363	3	particularly	particularly	ADV
ahs-14952	363	4	beneficial	beneficial	ADJ
ahs-14952	363	5	for	for	ADP
ahs-14952	363	6	cryptic	cryptic	ADJ
ahs-14952	363	7	species	specie	NOUN
ahs-14952	363	8	,	,	PUNCT
ahs-14952	363	9	hybrids	hybrid	NOUN
ahs-14952	363	10	,	,	PUNCT
ahs-14952	363	11	morphological	morphological	ADJ
ahs-14952	363	12	variables	variable	NOUN
ahs-14952	363	13	organism	organism	NOUN
ahs-14952	363	14	such	such	ADJ
ahs-14952	363	15	as	as	ADP
ahs-14952	363	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	363	17	,	,	PUNCT
ahs-14952	363	18	or	or	CCONJ
ahs-14952	363	19	situations	situation	NOUN
ahs-14952	363	20	when	when	SCONJ
ahs-14952	363	21	usual	usual	ADJ
ahs-14952	363	22	identification	identification	NOUN
ahs-14952	363	23	methods	method	NOUN
ahs-14952	363	24	fail	fail	VERB
ahs-14952	363	25	.	.	PUNCT
ahs-14952	364	1	based	base	VERB
ahs-14952	364	2	on	on	ADP
ahs-14952	364	3	the	the	DET
ahs-14952	364	4	review	review	NOUN
ahs-14952	364	5	,	,	PUNCT
ahs-14952	364	6	the	the	DET
ahs-14952	364	7	its	its	PRON
ahs-14952	364	8	regions	region	NOUN
ahs-14952	364	9	prove	prove	VERB
ahs-14952	364	10	to	to	PART
ahs-14952	364	11	be	be	AUX
ahs-14952	364	12	a	a	DET
ahs-14952	364	13	great	great	ADJ
ahs-14952	364	14	primer	primer	NOUN
ahs-14952	364	15	in	in	ADP
ahs-14952	364	16	the	the	DET
ahs-14952	364	17	field	field	NOUN
ahs-14952	364	18	of	of	ADP
ahs-14952	364	19	mycorrhizal	mycorrhizal	NOUN
ahs-14952	364	20	studies	study	NOUN
ahs-14952	364	21	to	to	ADP
ahs-14952	364	22	its	its	PRON
ahs-14952	364	23	inherent	inherent	ADJ
ahs-14952	364	24	variability	variability	NOUN
ahs-14952	364	25	,	,	PUNCT
ahs-14952	364	26	widespread	widespread	ADJ
ahs-14952	364	27	applicability	applicability	NOUN
ahs-14952	364	28	and	and	CCONJ
ahs-14952	364	29	straightforward	straightforward	ADJ
ahs-14952	364	30	amplification	amplification	NOUN
ahs-14952	364	31	process	process	NOUN
ahs-14952	364	32	and	and	CCONJ
ahs-14952	364	33	compatibility	compatibility	NOUN
ahs-14952	364	34	with	with	ADP
ahs-14952	364	35	established	establish	VERB
ahs-14952	364	36	databases	database	NOUN
ahs-14952	364	37	.	.	PUNCT
ahs-14952	365	1	this	this	DET
ahs-14952	365	2	technique	technique	NOUN
ahs-14952	365	3	enables	enable	VERB
ahs-14952	365	4	researchers	researcher	NOUN
ahs-14952	365	5	to	to	PART
ahs-14952	365	6	accurately	accurately	ADV
ahs-14952	365	7	identify	identify	VERB
ahs-14952	365	8	the	the	DET
ahs-14952	365	9	specific	specific	ADJ
ahs-14952	365	10	fungal	fungal	ADJ
ahs-14952	365	11	species	specie	NOUN
ahs-14952	365	12	shamsudin	shamsudin	VERB
ahs-14952	365	13	et	et	PROPN
ahs-14952	365	14	al	al	PROPN
ahs-14952	365	15	.	.	PROPN
ahs-14952	366	1	‐	‐	ADP
ahs-14952	366	2	molecular	molecular	ADJ
ahs-14952	366	3	identification	identification	NOUN
ahs-14952	366	4	of	of	ADP
ahs-14952	366	5	orchid	orchid	NOUN
ahs-14952	366	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	366	7	111	111	NUM
ahs-14952	366	8	associated	associate	VERB
ahs-14952	366	9	with	with	ADP
ahs-14952	366	10	a	a	DET
ahs-14952	366	11	particular	particular	ADJ
ahs-14952	366	12	orchid	orchid	NOUN
ahs-14952	366	13	species	specie	NOUN
ahs-14952	366	14	and	and	CCONJ
ahs-14952	366	15	to	to	PART
ahs-14952	366	16	investigate	investigate	VERB
ahs-14952	366	17	the	the	DET
ahs-14952	366	18	functional	functional	ADJ
ahs-14952	366	19	tole	tole	NOUN
ahs-14952	366	20	of	of	ADP
ahs-14952	366	21	these	these	DET
ahs-14952	366	22	fungi	fungus	NOUN
ahs-14952	366	23	in	in	ADP
ahs-14952	366	24	orchid	orchid	NOUN
ahs-14952	366	25	growth	growth	NOUN
ahs-14952	366	26	and	and	CCONJ
ahs-14952	366	27	development	development	NOUN
ahs-14952	366	28	.	.	PUNCT
ahs-14952	367	1	with	with	ADP
ahs-14952	367	2	the	the	DET
ahs-14952	367	3	advancement	advancement	NOUN
ahs-14952	367	4	of	of	ADP
ahs-14952	367	5	molecular	molecular	ADJ
ahs-14952	367	6	techniques	technique	NOUN
ahs-14952	367	7	,	,	PUNCT
ahs-14952	367	8	it	it	PRON
ahs-14952	367	9	is	be	AUX
ahs-14952	367	10	now	now	ADV
ahs-14952	367	11	possible	possible	ADJ
ahs-14952	367	12	to	to	PART
ahs-14952	367	13	examine	examine	VERB
ahs-14952	367	14	the	the	DET
ahs-14952	367	15	genetic	genetic	ADJ
ahs-14952	367	16	diversity	diversity	NOUN
ahs-14952	367	17	of	of	ADP
ahs-14952	367	18	these	these	DET
ahs-14952	367	19	fungi	fungus	NOUN
ahs-14952	367	20	and	and	CCONJ
ahs-14952	367	21	understand	understand	VERB
ahs-14952	367	22	the	the	DET
ahs-14952	367	23	evolutionary	evolutionary	ADJ
ahs-14952	367	24	relationship	relationship	NOUN
ahs-14952	367	25	between	between	ADP
ahs-14952	367	26	different	different	ADJ
ahs-14952	367	27	orchid	orchid	NOUN
ahs-14952	367	28	mycorrhizal	mycorrhizal	NOUN
ahs-14952	367	29	fungi	fungus	NOUN
ahs-14952	367	30	.	.	PUNCT
ahs-14952	368	1	these	these	PRON
ahs-14952	368	2	may	may	AUX
ahs-14952	368	3	lead	lead	VERB
ahs-14952	368	4	to	to	ADP
ahs-14952	368	5	the	the	DET
ahs-14952	368	6	development	development	NOUN
ahs-14952	368	7	of	of	ADP
ahs-14952	368	8	new	new	ADJ
ahs-14952	368	9	conservation	conservation	NOUN
ahs-14952	368	10	strategies	strategy	NOUN
ahs-14952	368	11	for	for	ADP
ahs-14952	368	12	these	these	DET
ahs-14952	368	13	unique	unique	ADJ
ahs-14952	368	14	and	and	CCONJ
ahs-14952	368	15	valuable	valuable	ADJ
ahs-14952	368	16	plant	plant	NOUN
ahs-14952	368	17	species	specie	NOUN
ahs-14952	368	18	.	.	PUNCT
ahs-14952	369	1	acknowledgements	acknowledgement	NOUN
ahs-14952	369	2	we	we	PRON
ahs-14952	369	3	would	would	AUX
ahs-14952	369	4	like	like	VERB
ahs-14952	369	5	to	to	PART
ahs-14952	369	6	thank	thank	VERB
ahs-14952	369	7	to	to	ADP
ahs-14952	369	8	sabah	sabah	PROPN
ahs-14952	369	9	biodiversity	biodiversity	NOUN
ahs-14952	369	10	centre	centre	NOUN
ahs-14952	369	11	for	for	ADP
ahs-14952	369	12	research	research	NOUN
ahs-14952	369	13	license	license	NOUN
ahs-14952	369	14	(	(	PUNCT
ahs-14952	369	15	jkm	jkm	PROPN
ahs-14952	369	16	/	/	SYM
ahs-14952	369	17	mbs.1000­2/2	mbs.1000­2/2	PROPN
ahs-14952	369	18	jld.15(55	jld.15(55	PROPN
ahs-14952	369	19	)	)	PUNCT
ahs-14952	369	20	)	)	PUNCT
ahs-14952	369	21	.	.	PUNCT
ahs-14952	370	1	this	this	DET
ahs-14952	370	2	work	work	NOUN
ahs-14952	370	3	was	be	AUX
ahs-14952	370	4	supported	support	VERB
ahs-14952	370	5	by	by	ADP
ahs-14952	370	6	the	the	DET
ahs-14952	370	7	ministry	ministry	PROPN
ahs-14952	370	8	of	of	ADP
ahs-14952	370	9	higher	high	ADJ
ahs-14952	370	10	education	education	NOUN
ahs-14952	370	11	[	[	X
ahs-14952	370	12	frgs/1/2021	frgs/1/2021	NOUN
ahs-14952	370	13	/	/	SYM
ahs-14952	370	14	wab11	wab11	PROPN
ahs-14952	370	15	/	/	SYM
ahs-14952	370	16	ums	ums	PROPN
ahs-14952	370	17	/02/3	/02/3	PUNCT
ahs-14952	370	18	]	]	PUNCT
ahs-14952	370	19	and	and	CCONJ
ahs-14952	370	20	university	university	PROPN
ahs-14952	370	21	malaysia	malaysia	PROPN
ahs-14952	370	22	sabah	sabah	PROPN
ahs-14952	371	1	[	[	X
ahs-14952	371	2	ums	ums	X
ahs-14952	371	3	great	great	ADJ
ahs-14952	371	4	gug0059­1/2023	gug0059­1/2023	PROPN
ahs-14952	371	5	]	]	PUNCT
ahs-14952	371	6	.	.	PUNCT
ahs-14952	372	1	references	reference	NOUN
ahs-14952	372	2	agustini	agustini	VERB
ahs-14952	372	3	v.	v.	ADV
ahs-14952	372	4	,	,	PUNCT
ahs-14952	372	5	sufaati	sufaati	PROPN
ahs-14952	372	6	s.	s.	PROPN
ahs-14952	372	7	,	,	PUNCT
ahs-14952	372	8	suharn	suharn	VERB
ahs-14952	372	9	o.	o.	PROPN
ahs-14952	372	10	,	,	PUNCT
ahs-14952	372	11	suwannasa	suwannasa	PROPN
ahs-14952	372	12	i.	i.	PROPN
ahs-14952	372	13	,	,	PUNCT
ahs-14952	372	14	2016	2016	NUM
ahs-14952	372	15	­	­	PROPN
ahs-14952	372	16	rhizoctonia‐like	rhizoctonia‐like	NOUN
ahs-14952	372	17	fungi	fungus	NOUN
ahs-14952	372	18	isolated	isolate	VERB
ahs-14952	372	19	from	from	ADP
ahs-14952	372	20	roots	root	NOUN
ahs-14952	372	21	of	of	ADP
ahs-14952	372	22	dendrobium	dendrobium	NOUN
ahs-14952	372	23	lancifolium	lancifolium	NOUN
ahs-14952	372	24	var	var	NOUN
ahs-14952	372	25	.	.	PUNCT
ahs-14952	373	1	papuanum	papuanum	PROPN
ahs-14952	373	2	and	and	CCONJ
ahs-14952	373	3	calanthe	calanthe	PRON
ahs-14952	373	4	triplicata	triplicata	NOUN
ahs-14952	373	5	in	in	ADP
ahs-14952	373	6	papua	papua	PROPN
ahs-14952	373	7	,	,	PUNCT
ahs-14952	373	8	indonesia	indonesia	PROPN
ahs-14952	373	9	.	.	PUNCT
ahs-14952	374	1	­	­	PROPN
ahs-14952	374	2	biodiversitas	biodiversita	NOUN
ahs-14952	374	3	,	,	PUNCT
ahs-14952	374	4	17(1	17(1	NUM
ahs-14952	374	5	):	):	PUNCT
ahs-14952	374	6	377­383	377­383	NUM
ahs-14952	374	7	.	.	PUNCT
ahs-14952	375	1	andersen	andersen	PROPN
ahs-14952	375	2	t.f	t.f	PROPN
ahs-14952	375	3	.	.	PROPN
ahs-14952	375	4	,	,	PUNCT
ahs-14952	375	5	1996	1996	NUM
ahs-14952	375	6	­	­	VERB
ahs-14952	375	7	a	a	DET
ahs-14952	375	8	comparative	comparative	ADJ
ahs-14952	375	9	taxonomic	taxonomic	ADJ
ahs-14952	375	10	study	study	NOUN
ahs-14952	375	11	of	of	ADP
ahs-14952	375	12	rhizoctonia	rhizoctonia	PROPN
ahs-14952	375	13	sensu	sensu	NOUN
ahs-14952	375	14	lato	lato	NOUN
ahs-14952	375	15	employing	employ	VERB
ahs-14952	375	16	morphological	morphological	ADJ
ahs-14952	375	17	,	,	PUNCT
ahs-14952	375	18	ultrastructural	ultrastructural	ADJ
ahs-14952	375	19	and	and	CCONJ
ahs-14952	375	20	molecular	molecular	ADJ
ahs-14952	375	21	methods	method	NOUN
ahs-14952	375	22	.	.	PUNCT
ahs-14952	376	1	­	­	VERB
ahs-14952	376	2	mycol	mycol	PROPN
ahs-14952	376	3	.	.	PUNCT
ahs-14952	377	1	res	re	NOUN
ahs-14952	377	2	.	.	PROPN
ahs-14952	377	3	,	,	PUNCT
ahs-14952	377	4	100(9	100(9	NUM
ahs-14952	377	5	):	):	PUNCT
ahs-14952	377	6	1117­1128	1117­1128	NUM
ahs-14952	377	7	.	.	PUNCT
ahs-14952	378	1	arditti	arditti	PROPN
ahs-14952	378	2	j.	j.	PROPN
ahs-14952	378	3	,	,	PUNCT
ahs-14952	378	4	pridgeon	pridgeon	PROPN
ahs-14952	378	5	a.m.	a.m.	ADV
ahs-14952	378	6	,	,	PUNCT
ahs-14952	378	7	1997	1997	NUM
ahs-14952	378	8	­	­	VERB
ahs-14952	378	9	orchid	orchid	NOUN
ahs-14952	378	10	biology	biology	NOUN
ahs-14952	378	11	:	:	PUNCT
ahs-14952	378	12	review	review	NOUN
ahs-14952	378	13	and	and	CCONJ
ahs-14952	378	14	perspective	perspective	NOUN
ahs-14952	378	15	,	,	PUNCT
ahs-14952	378	16	vii	vii	PROPN
ahs-14952	378	17	.	.	PROPN
ahs-14952	378	18	springer	springer	PROPN
ahs-14952	378	19	,	,	PUNCT
ahs-14952	378	20	dordrecth	dordrecth	NOUN
ahs-14952	378	21	,	,	PUNCT
ahs-14952	378	22	germany	germany	PROPN
ahs-14952	378	23	,	,	PUNCT
ahs-14952	378	24	pp	pp	X
ahs-14952	378	25	.	.	PUNCT
ahs-14952	379	1	394	394	NUM
ahs-14952	379	2	.	.	PUNCT
ahs-14952	380	1	attri	attri	PROPN
ahs-14952	380	2	l.k	l.k	PROPN
ahs-14952	380	3	.	.	PROPN
ahs-14952	380	4	,	,	PUNCT
ahs-14952	380	5	2022	2022	NUM
ahs-14952	380	6	­	­	VERB
ahs-14952	380	7	a	a	DET
ahs-14952	380	8	study	study	NOUN
ahs-14952	380	9	on	on	ADP
ahs-14952	380	10	mycorhizal	mycorhizal	NOUN
ahs-14952	380	11	associations	association	NOUN
ahs-14952	380	12	in	in	ADP
ahs-14952	380	13	an	an	DET
ahs-14952	380	14	economically	economically	ADV
ahs-14952	380	15	important	important	ADJ
ahs-14952	380	16	orchid	orchid	NOUN
ahs-14952	380	17	.	.	PUNCT
ahs-14952	381	1	­	­	PROPN
ahs-14952	381	2	j.	j.	PROPN
ahs-14952	381	3	phytol	phytol	PROPN
ahs-14952	381	4	.	.	PUNCT
ahs-14952	382	1	res	re	NOUN
ahs-14952	382	2	.	.	PROPN
ahs-14952	382	3	,	,	PUNCT
ahs-14952	382	4	2(4	2(4	NUM
ahs-14952	382	5	):	):	PUNCT
ahs-14952	382	6	38­43	38­43	NUM
ahs-14952	382	7	.	.	PUNCT
ahs-14952	382	8	bahram	bahram	PROPN
ahs-14952	382	9	m.	m.	PROPN
ahs-14952	382	10	,	,	PUNCT
ahs-14952	382	11	hildebrand	hildebrand	PROPN
ahs-14952	382	12	f.	f.	PROPN
ahs-14952	382	13	,	,	PUNCT
ahs-14952	382	14	forslund	forslund	PROPN
ahs-14952	382	15	s.k	s.k	PROPN
ahs-14952	382	16	.	.	PROPN
ahs-14952	382	17	,	,	PUNCT
ahs-14952	382	18	anderson	anderson	PROPN
ahs-14952	382	19	j.l	j.l	PROPN
ahs-14952	382	20	.	.	PROPN
ahs-14952	382	21	,	,	PUNCT
ahs-14952	382	22	soudzilovskaia	soudzilovskaia	PROPN
ahs-14952	382	23	n.a	n.a	PROPN
ahs-14952	382	24	.	.	PROPN
ahs-14952	382	25	,	,	PUNCT
ahs-14952	382	26	bodegom	bodegom	VERB
ahs-14952	382	27	p.m.	p.m.	NOUN
ahs-14952	382	28	,	,	PUNCT
ahs-14952	382	29	bengtsson­palme	bengtsson­palme	PROPN
ahs-14952	382	30	j.	j.	PROPN
ahs-14952	382	31	,	,	PUNCT
ahs-14952	382	32	anslan	anslan	PROPN
ahs-14952	382	33	s.	s.	PROPN
ahs-14952	382	34	,	,	PUNCT
ahs-14952	382	35	coelho	coelho	PROPN
ahs-14952	383	1	l.p	l.p	PROPN
ahs-14952	383	2	.	.	PROPN
ahs-14952	383	3	,	,	PUNCT
ahs-14952	383	4	harend	harend	PROPN
ahs-14952	383	5	h.	h.	PROPN
ahs-14952	383	6	,	,	PUNCT
ahs-14952	383	7	huerta­cepas	huerta­cepas	PROPN
ahs-14952	383	8	j.	j.	PROPN
ahs-14952	383	9	,	,	PUNCT
ahs-14952	383	10	medema	medema	PROPN
ahs-14952	383	11	m.h	m.h	PROPN
ahs-14952	383	12	.	.	PROPN
ahs-14952	383	13	,	,	PUNCT
ahs-14952	383	14	maltz	maltz	VERB
ahs-14952	383	15	m.r	m.r	PROPN
ahs-14952	383	16	.	.	PROPN
ahs-14952	383	17	,	,	PUNCT
ahs-14952	383	18	mundra	mundra	PROPN
ahs-14952	383	19	s.	s.	PROPN
ahs-14952	383	20	,	,	PUNCT
ahs-14952	383	21	olsson	olsson	PROPN
ahs-14952	383	22	p.a	p.a	PROPN
ahs-14952	383	23	.	.	PROPN
ahs-14952	383	24	,	,	PUNCT
ahs-14952	383	25	pent	pent	NOUN
ahs-14952	383	26	m.	m.	NOUN
ahs-14952	383	27	,	,	PUNCT
ahs-14952	383	28	põlme	põlme	PROPN
ahs-14952	383	29	s.	s.	PROPN
ahs-14952	383	30	,	,	PUNCT
ahs-14952	383	31	sunagawa	sunagawa	PROPN
ahs-14952	383	32	s.	s.	PROPN
ahs-14952	383	33	,	,	PUNCT
ahs-14952	383	34	ryberg	ryberg	NOUN
ahs-14952	383	35	m.	m.	NOUN
ahs-14952	383	36	,	,	PUNCT
ahs-14952	383	37	tedersoo	tedersoo	PROPN
ahs-14952	383	38	l.	l.	PROPN
ahs-14952	383	39	,	,	PUNCT
ahs-14952	383	40	bork	bork	PROPN
ahs-14952	383	41	p.	p.	PROPN
ahs-14952	383	42	,	,	PUNCT
ahs-14952	383	43	2018	2018	NUM
ahs-14952	383	44	­	­	NOUN
ahs-14952	383	45	structure	structure	NOUN
ahs-14952	383	46	and	and	CCONJ
ahs-14952	383	47	function	function	NOUN
ahs-14952	383	48	of	of	ADP
ahs-14952	383	49	the	the	DET
ahs-14952	383	50	global	global	ADJ
ahs-14952	383	51	topsoil	topsoil	NOUN
ahs-14952	383	52	microbiome	microbiome	NOUN
ahs-14952	383	53	.	.	PUNCT
ahs-14952	384	1	­	­	NUM
ahs-14952	384	2	nature	nature	NOUN
ahs-14952	384	3	,	,	PUNCT
ahs-14952	384	4	560(7717	560(7717	NUM
ahs-14952	384	5	):	):	PUNCT
ahs-14952	384	6	233­237	233­237	NUM
ahs-14952	384	7	.	.	PUNCT
ahs-14952	385	1	batty	batty	PROPN
ahs-14952	385	2	a.l	a.l	PROPN
ahs-14952	385	3	.	.	PROPN
ahs-14952	385	4	,	,	PUNCT
ahs-14952	385	5	brundrett	brundrett	PROPN
ahs-14952	385	6	m.c	m.c	PROPN
ahs-14952	385	7	.	.	PROPN
ahs-14952	385	8	,	,	PUNCT
ahs-14952	386	1	dixon	dixon	PROPN
ahs-14952	386	2	k.w	k.w	PROPN
ahs-14952	386	3	.	.	PROPN
ahs-14952	386	4	,	,	PUNCT
ahs-14952	386	5	sivasithamparam	sivasithamparam	PROPN
ahs-14952	386	6	k.	k.	PROPN
ahs-14952	386	7	,	,	PUNCT
ahs-14952	386	8	2006	2006	NUM
ahs-14952	386	9	­	­	VERB
ahs-14952	386	10	in	in	ADP
ahs-14952	386	11	situ	situ	ADJ
ahs-14952	386	12	symbiotic	symbiotic	ADJ
ahs-14952	386	13	seed	seed	NOUN
ahs-14952	386	14	germination	germination	NOUN
ahs-14952	386	15	and	and	CCONJ
ahs-14952	386	16	propagation	propagation	NOUN
ahs-14952	386	17	of	of	ADP
ahs-14952	386	18	terrestrial	terrestrial	ADJ
ahs-14952	386	19	orchid	orchid	NOUN
ahs-14952	386	20	seedlings	seedling	NOUN
ahs-14952	386	21	for	for	ADP
ahs-14952	386	22	establishment	establishment	NOUN
ahs-14952	386	23	at	at	ADP
ahs-14952	386	24	field	field	NOUN
ahs-14952	386	25	sites	site	NOUN
ahs-14952	386	26	.	.	PUNCT
ahs-14952	387	1	­	­	PROPN
ahs-14952	387	2	aust	aust	PROPN
ahs-14952	387	3	.	.	PUNCT
ahs-14952	388	1	j.	j.	PROPN
ahs-14952	388	2	bot	bot	PROPN
ahs-14952	388	3	.	.	PUNCT
ahs-14952	388	4	,	,	PUNCT
ahs-14952	388	5	54(4	54(4	NUM
ahs-14952	388	6	):	):	PUNCT
ahs-14952	388	7	375­381	375­381	NUM
ahs-14952	388	8	.	.	PUNCT
ahs-14952	389	1	bayman	bayman	PROPN
ahs-14952	389	2	p.	p.	PROPN
ahs-14952	389	3	,	,	PUNCT
ahs-14952	389	4	otero	otero	PROPN
ahs-14952	389	5	j.t	j.t	PROPN
ahs-14952	389	6	.	.	PROPN
ahs-14952	389	7	,	,	PUNCT
ahs-14952	389	8	2006	2006	NUM
ahs-14952	389	9	­	­	VERB
ahs-14952	389	10	microbial	microbial	ADJ
ahs-14952	389	11	endophytes	endophyte	NOUN
ahs-14952	389	12	of	of	ADP
ahs-14952	389	13	orchid	orchid	NOUN
ahs-14952	389	14	roots	root	NOUN
ahs-14952	389	15	,	,	PUNCT
ahs-14952	389	16	pp	pp	ADV
ahs-14952	389	17	.	.	PUNCT
ahs-14952	390	1	153­177	153­177	NUM
ahs-14952	390	2	.	.	PUNCT
ahs-14952	391	1	­	­	VERB
ahs-14952	391	2	in	in	ADP
ahs-14952	391	3	:	:	PUNCT
ahs-14952	391	4	schulz	schulz	PROPN
ahs-14952	391	5	b.j.e	b.j.e	PROPN
ahs-14952	391	6	.	.	PUNCT
ahs-14952	391	7	,	,	PUNCT
ahs-14952	391	8	c.j.c	c.j.c	PROPN
ahs-14952	391	9	.	.	PROPN
ahs-14952	391	10	boyle	boyle	PROPN
ahs-14952	391	11	,	,	PUNCT
ahs-14952	391	12	and	and	CCONJ
ahs-14952	391	13	t.n	t.n	PROPN
ahs-14952	391	14	.	.	PROPN
ahs-14952	391	15	sieber	sieber	PROPN
ahs-14952	391	16	(	(	PUNCT
ahs-14952	391	17	eds	ed	NOUN
ahs-14952	391	18	.	.	PUNCT
ahs-14952	391	19	)	)	PUNCT
ahs-14952	391	20	microbial	microbial	ADJ
ahs-14952	391	21	root	root	NOUN
ahs-14952	391	22	endophytes	endophyte	NOUN
ahs-14952	391	23	.	.	PUNCT
ahs-14952	392	1	vol	vol	NOUN
ahs-14952	392	2	.	.	PROPN
ahs-14952	393	1	9	9	NUM
ahs-14952	393	2	.	.	X
ahs-14952	393	3	springer	springer	NOUN
ahs-14952	393	4	,	,	PUNCT
ahs-14952	393	5	berlin	berlin	PROPN
ahs-14952	393	6	,	,	PUNCT
ahs-14952	393	7	heidelberg	heidelberg	PROPN
ahs-14952	393	8	,	,	PUNCT
ahs-14952	393	9	germany	germany	PROPN
ahs-14952	393	10	,	,	PUNCT
ahs-14952	393	11	pp	pp	X
ahs-14952	393	12	.	.	PUNCT
ahs-14952	394	1	387	387	X
ahs-14952	394	2	.	.	X
ahs-14952	394	3	bengtsson	bengtsson	PROPN
ahs-14952	394	4	palme	palme	PROPN
ahs-14952	394	5	j.	j.	PROPN
ahs-14952	394	6	,	,	PUNCT
ahs-14952	394	7	ryberg	ryberg	NOUN
ahs-14952	394	8	m.	m.	NOUN
ahs-14952	394	9	,	,	PUNCT
ahs-14952	394	10	hartmann	hartmann	PROPN
ahs-14952	394	11	m.	m.	PROPN
ahs-14952	394	12	,	,	PUNCT
ahs-14952	394	13	branco	branco	PROPN
ahs-14952	394	14	s.	s.	PROPN
ahs-14952	394	15	,	,	PUNCT
ahs-14952	394	16	wang	wang	PROPN
ahs-14952	394	17	z.	z.	PROPN
ahs-14952	394	18	,	,	PUNCT
ahs-14952	394	19	godhe	godhe	PROPN
ahs-14952	394	20	a.	a.	PROPN
ahs-14952	394	21	,	,	PUNCT
ahs-14952	394	22	godh	godh	PROPN
ahs-14952	394	23	e.	e.	PROPN
ahs-14952	394	24	,	,	PUNCT
ahs-14952	394	25	de	de	PROPN
ahs-14952	394	26	wit	wit	PROPN
ahs-14952	394	27	p.	p.	PROPN
ahs-14952	394	28	,	,	PUNCT
ahs-14952	394	29	sánchez­garcía	sánchez­garcía	ADJ
ahs-14952	394	30	m.	m.	NOUN
ahs-14952	394	31	,	,	PUNCT
ahs-14952	394	32	ebersberger	ebersberger	ADJ
ahs-14952	394	33	i.	i.	PROPN
ahs-14952	394	34	,	,	PUNCT
ahs-14952	394	35	de	de	PROPN
ahs-14952	394	36	sousa	sousa	PROPN
ahs-14952	394	37	f.	f.	PROPN
ahs-14952	394	38	,	,	PUNCT
ahs-14952	394	39	amend	amend	PROPN
ahs-14952	394	40	a.	a.	PROPN
ahs-14952	394	41	,	,	PUNCT
ahs-14952	394	42	jumpponen	jumpponen	PROPN
ahs-14952	394	43	a.	a.	PROPN
ahs-14952	394	44	,	,	PUNCT
ahs-14952	394	45	unterseher	unterseher	PROPN
ahs-14952	394	46	m.	m.	NOUN
ahs-14952	394	47	,	,	PUNCT
ahs-14952	394	48	kristiansson	kristiansson	PROPN
ahs-14952	394	49	k.	k.	PROPN
ahs-14952	394	50	,	,	PUNCT
ahs-14952	394	51	abarenkov	abarenkov	PROPN
ahs-14952	394	52	k.	k.	PROPN
ahs-14952	394	53	,	,	PUNCT
ahs-14952	394	54	bertrand	bertrand	PROPN
ahs-14952	394	55	y.j.k	y.j.k	PROPN
ahs-14952	394	56	.	.	PROPN
ahs-14952	394	57	,	,	PUNCT
ahs-14952	394	58	sanli	sanli	PROPN
ahs-14952	394	59	k.	k.	PROPN
ahs-14952	394	60	,	,	PUNCT
ahs-14952	394	61	eriksson	eriksson	PROPN
ahs-14952	394	62	k.m	k.m	PROPN
ahs-14952	394	63	.	.	PROPN
ahs-14952	394	64	,	,	PUNCT
ahs-14952	394	65	vik	vik	PROPN
ahs-14952	394	66	u.	u.	PROPN
ahs-14952	394	67	,	,	PUNCT
ahs-14952	394	68	veldre	veldre	PROPN
ahs-14952	394	69	v.	v.	PROPN
ahs-14952	394	70	,	,	PUNCT
ahs-14952	394	71	nilsson	nilsson	PROPN
ahs-14952	394	72	r.h	r.h	PROPN
ahs-14952	394	73	.	.	PROPN
ahs-14952	394	74	,	,	PUNCT
ahs-14952	394	75	2013	2013	NUM
ahs-14952	394	76	­	­	NUM
ahs-14952	394	77	improved	improve	VERB
ahs-14952	394	78	software	software	NOUN
ahs-14952	394	79	detection	detection	NOUN
ahs-14952	394	80	and	and	CCONJ
ahs-14952	394	81	extraction	extraction	NOUN
ahs-14952	394	82	of	of	ADP
ahs-14952	394	83	its1	its1	PROPN
ahs-14952	394	84	and	and	CCONJ
ahs-14952	394	85	its	its	PRON
ahs-14952	394	86	2	2	NUM
ahs-14952	394	87	from	from	ADP
ahs-14952	394	88	ribosomal	ribosomal	VERB
ahs-14952	394	89	its	its	PRON
ahs-14952	394	90	sequences	sequence	NOUN
ahs-14952	394	91	of	of	ADP
ahs-14952	394	92	fungi	fungus	NOUN
ahs-14952	394	93	and	and	CCONJ
ahs-14952	394	94	other	other	ADJ
ahs-14952	394	95	eukaryotes	eukaryote	NOUN
ahs-14952	394	96	for	for	ADP
ahs-14952	394	97	analysis	analysis	NOUN
ahs-14952	394	98	of	of	ADP
ahs-14952	394	99	environmental	environmental	ADJ
ahs-14952	394	100	sequencing	sequence	VERB
ahs-14952	394	101	data	datum	NOUN
ahs-14952	394	102	.	.	PUNCT
ahs-14952	395	1	­	­	PROPN
ahs-14952	395	2	methods	method	NOUN
ahs-14952	395	3	ecol	ecol	NOUN
ahs-14952	395	4	.	.	PUNCT
ahs-14952	396	1	evol	evol	NOUN
ahs-14952	396	2	.	.	PUNCT
ahs-14952	396	3	,	,	PUNCT
ahs-14952	396	4	4	4	NUM
ahs-14952	396	5	:	:	PUNCT
ahs-14952	396	6	914­919	914­919	NOUN
ahs-14952	396	7	.	.	PUNCT
ahs-14952	397	1	bhatti	bhatti	PROPN
ahs-14952	397	2	s.k	s.k	PROPN
ahs-14952	397	3	.	.	PROPN
ahs-14952	397	4	,	,	PUNCT
ahs-14952	397	5	verma	verma	PROPN
ahs-14952	397	6	j.	j.	PROPN
ahs-14952	397	7	,	,	PUNCT
ahs-14952	397	8	jaspreet	jaspreet	PROPN
ahs-14952	397	9	k.s	k.s	PROPN
ahs-14952	397	10	.	.	PROPN
ahs-14952	397	11	,	,	PUNCT
ahs-14952	397	12	pathak	pathak	PROPN
ahs-14952	397	13	p.	p.	PROPN
ahs-14952	397	14	,	,	PUNCT
ahs-14952	397	15	2017	2017	NUM
ahs-14952	397	16	­	­	NUM
ahs-14952	397	17	symbiotic	symbiotic	ADJ
ahs-14952	397	18	seed	seed	NOUN
ahs-14952	397	19	germination	germination	NOUN
ahs-14952	397	20	of	of	ADP
ahs-14952	397	21	aerides	aeride	NOUN
ahs-14952	397	22	multiflora	multiflora	PROPN
ahs-14952	397	23	roxb	roxb	NOUN
ahs-14952	397	24	.	.	PUNCT
ahs-14952	398	1	a	a	DET
ahs-14952	398	2	study	study	NOUN
ahs-14952	398	3	in	in	ADP
ahs-14952	398	4	vitro	vitro	X
ahs-14952	398	5	.	.	PUNCT
ahs-14952	399	1	­	­	PROPN
ahs-14952	399	2	j.	j.	PROPN
ahs-14952	399	3	orchid	orchid	PROPN
ahs-14952	399	4	soc	soc	PROPN
ahs-14952	399	5	.	.	PUNCT
ahs-14952	400	1	india	india	PROPN
ahs-14952	400	2	.	.	PROPN
ahs-14952	400	3	,	,	PUNCT
ahs-14952	400	4	31	31	NUM
ahs-14952	400	5	:	:	PUNCT
ahs-14952	401	1	85­91	85­91	NUM
ahs-14952	401	2	.	.	PUNCT
ahs-14952	402	1	bidartondo	bidartondo	PROPN
ahs-14952	402	2	m.i	m.i	PROPN
ahs-14952	402	3	.	.	PROPN
ahs-14952	402	4	,	,	PUNCT
ahs-14952	402	5	read	read	VERB
ahs-14952	402	6	d.j	d.j	PROPN
ahs-14952	402	7	.	.	PROPN
ahs-14952	402	8	,	,	PUNCT
ahs-14952	402	9	2008	2008	NUM
ahs-14952	402	10	­	­	VERB
ahs-14952	402	11	fungal	fungal	ADJ
ahs-14952	402	12	specificity	specificity	NOUN
ahs-14952	402	13	bottlenecks	bottleneck	NOUN
ahs-14952	402	14	during	during	ADP
ahs-14952	402	15	orchid	orchid	NOUN
ahs-14952	402	16	germination	germination	NOUN
ahs-14952	402	17	and	and	CCONJ
ahs-14952	402	18	development	development	NOUN
ahs-14952	402	19	.	.	PUNCT
ahs-14952	403	1	­	­	PROPN
ahs-14952	403	2	mol	mol	PROPN
ahs-14952	403	3	.	.	PUNCT
ahs-14952	404	1	ecol	ecol	PROPN
ahs-14952	404	2	.	.	PUNCT
ahs-14952	404	3	,	,	PUNCT
ahs-14952	404	4	17(16	17(16	NUM
ahs-14952	404	5	):	):	PUNCT
ahs-14952	404	6	3707­3716	3707­3716	NUM
ahs-14952	404	7	.	.	PUNCT
ahs-14952	404	8	boddington	boddington	NOUN
ahs-14952	404	9	m.	m.	NOUN
ahs-14952	404	10	,	,	PUNCT
ahs-14952	404	11	dearnaley	dearnaley	PROPN
ahs-14952	404	12	j.d.w	j.d.w	NOUN
ahs-14952	404	13	.	.	PROPN
ahs-14952	404	14	,	,	PUNCT
ahs-14952	404	15	2008	2008	NUM
ahs-14952	404	16	­	­	VERB
ahs-14952	404	17	morphological	morphological	ADJ
ahs-14952	404	18	and	and	CCONJ
ahs-14952	404	19	molecular	molecular	ADJ
ahs-14952	404	20	identification	identification	NOUN
ahs-14952	404	21	of	of	ADP
ahs-14952	404	22	fungal	fungal	ADJ
ahs-14952	404	23	endophytes	endophyte	NOUN
ahs-14952	404	24	from	from	ADP
ahs-14952	404	25	roots	root	NOUN
ahs-14952	404	26	of	of	ADP
ahs-14952	404	27	dendrobium	dendrobium	NOUN
ahs-14952	404	28	speciosum	speciosum	NOUN
ahs-14952	404	29	.	.	PUNCT
ahs-14952	405	1	­	­	PROPN
ahs-14952	405	2	proc	proc	PROPN
ahs-14952	405	3	.	.	PUNCT
ahs-14952	406	1	r.	r.	PROPN
ahs-14952	406	2	soc	soc	PROPN
ahs-14952	406	3	.	.	PUNCT
ahs-14952	407	1	qld	qld	PROPN
ahs-14952	407	2	.	.	PROPN
ahs-14952	407	3	,	,	PUNCT
ahs-14952	407	4	114	114	NUM
ahs-14952	407	5	:	:	PUNCT
ahs-14952	408	1	13­17	13­17	X
ahs-14952	408	2	.	.	PUNCT
ahs-14952	409	1	cevallos	cevallos	PROPN
ahs-14952	409	2	s.	s.	PROPN
ahs-14952	409	3	,	,	PUNCT
ahs-14952	409	4	sánchez­rodríguez	sánchez­rodríguez	NOUN
ahs-14952	409	5	a.	a.	PROPN
ahs-14952	409	6	,	,	PUNCT
ahs-14952	409	7	decock	decock	PROPN
ahs-14952	409	8	c.	c.	PROPN
ahs-14952	409	9	,	,	PUNCT
ahs-14952	409	10	declerck	declerck	PROPN
ahs-14952	409	11	s.	s.	PROPN
ahs-14952	409	12	,	,	PUNCT
ahs-14952	409	13	suárez	suárez	PROPN
ahs-14952	409	14	j.p	j.p	PROPN
ahs-14952	409	15	.	.	PROPN
ahs-14952	409	16	,	,	PUNCT
ahs-14952	409	17	2017	2017	NUM
ahs-14952	409	18	­	­	NOUN
ahs-14952	409	19	are	be	AUX
ahs-14952	409	20	there	there	PRON
ahs-14952	409	21	keystone	keystone	PROPN
ahs-14952	409	22	mycorrhizal	mycorrhizal	NOUN
ahs-14952	409	23	fungi	fungus	NOUN
ahs-14952	409	24	associated	associate	VERB
ahs-14952	409	25	to	to	ADP
ahs-14952	409	26	tropical	tropical	ADJ
ahs-14952	409	27	epiphytic	epiphytic	ADJ
ahs-14952	409	28	orchids	orchid	NOUN
ahs-14952	409	29	?	?	PUNCT
ahs-14952	409	30	.	.	PUNCT
ahs-14952	410	1	­	­	PROPN
ahs-14952	410	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	410	3	,	,	PUNCT
ahs-14952	410	4	27	27	NUM
ahs-14952	410	5	:	:	SYM
ahs-14952	410	6	225­232	225­232	NUM
ahs-14952	410	7	.	.	PUNCT
ahs-14952	411	1	chand	chand	PROPN
ahs-14952	411	2	k.	k.	PROPN
ahs-14952	411	3	,	,	PUNCT
ahs-14952	411	4	shah	shah	PROPN
ahs-14952	411	5	s.	s.	PROPN
ahs-14952	411	6	,	,	PUNCT
ahs-14952	411	7	sharma	sharma	PROPN
ahs-14952	411	8	j.	j.	PROPN
ahs-14952	411	9	,	,	PUNCT
ahs-14952	411	10	paudel	paudel	PROPN
ahs-14952	411	11	m.p	m.p	PROPN
ahs-14952	411	12	.	.	PROPN
ahs-14952	411	13	,	,	PUNCT
ahs-14952	411	14	pant	pant	PROPN
ahs-14952	411	15	b.	b.	PROPN
ahs-14952	411	16	,	,	PUNCT
ahs-14952	411	17	2020	2020	NUM
ahs-14952	411	18	­	­	NUM
ahs-14952	411	19	isolation	isolation	NOUN
ahs-14952	411	20	,	,	PUNCT
ahs-14952	411	21	characterization	characterization	NOUN
ahs-14952	411	22	,	,	PUNCT
ahs-14952	411	23	and	and	CCONJ
ahs-14952	411	24	plant	plant	VERB
ahs-14952	411	25	growth‐	growth‐	ADJ
ahs-14952	411	26	promoting	promote	VERB
ahs-14952	411	27	activities	activity	NOUN
ahs-14952	411	28	of	of	ADP
ahs-14952	411	29	endophytic	endophytic	ADJ
ahs-14952	411	30	fungi	fungus	NOUN
ahs-14952	411	31	from	from	ADP
ahs-14952	411	32	a	a	DET
ahs-14952	411	33	wild	wild	ADJ
ahs-14952	411	34	orchid	orchid	NOUN
ahs-14952	411	35	vanda	vanda	NOUN
ahs-14952	411	36	cristata	cristata	PROPN
ahs-14952	411	37	.	.	PUNCT
ahs-14952	412	1	­	­	NOUN
ahs-14952	412	2	plant	plant	NOUN
ahs-14952	412	3	signal	signal	NOUN
ahs-14952	412	4	.	.	PUNCT
ahs-14952	413	1	behav	behav	PROPN
ahs-14952	413	2	.	.	PUNCT
ahs-14952	413	3	,	,	PUNCT
ahs-14952	413	4	15(5	15(5	NUM
ahs-14952	413	5	):	):	PUNCT
ahs-14952	413	6	1744294	1744294	NUM
ahs-14952	413	7	.	.	PUNCT
ahs-14952	414	1	chen	chen	PROPN
ahs-14952	414	2	j.	j.	PROPN
ahs-14952	414	3	,	,	PUNCT
ahs-14952	414	4	zhang	zhang	PROPN
ahs-14952	414	5	l.­c	l.­c	PROPN
ahs-14952	414	6	.	.	PUNCT
ahs-14952	414	7	,	,	PUNCT
ahs-14952	414	8	xing	xing	PROPN
ahs-14952	414	9	y.­m	y.­m	PROPN
ahs-14952	414	10	.	.	PROPN
ahs-14952	414	11	,	,	PUNCT
ahs-14952	414	12	wang	wang	PROPN
ahs-14952	414	13	y.­q	y.­q	PROPN
ahs-14952	414	14	.	.	PROPN
ahs-14952	414	15	,	,	PUNCT
ahs-14952	414	16	xing	xing	PROPN
ahs-14952	414	17	x.­k	x.­k	NUM
ahs-14952	414	18	.	.	PROPN
ahs-14952	414	19	,	,	PUNCT
ahs-14952	414	20	zhang	zhang	PROPN
ahs-14952	414	21	d.­w	d.­w	PROPN
ahs-14952	414	22	.	.	PROPN
ahs-14952	414	23	,	,	PUNCT
ahs-14952	414	24	liang	liang	PROPN
ahs-14952	414	25	h.­q	h.­q	PROPN
ahs-14952	414	26	.	.	PROPN
ahs-14952	414	27	,	,	PUNCT
ahs-14952	414	28	guo	guo	PROPN
ahs-14952	414	29	s.­x	s.­x	PROPN
ahs-14952	414	30	.	.	PUNCT
ahs-14952	414	31	,	,	PUNCT
ahs-14952	414	32	2013	2013	NUM
ahs-14952	414	33	­	­	VERB
ahs-14952	414	34	diversity	diversity	NOUN
ahs-14952	414	35	and	and	CCONJ
ahs-14952	414	36	taxonomy	taxonomy	NOUN
ahs-14952	414	37	of	of	ADP
ahs-14952	414	38	endophytic	endophytic	ADJ
ahs-14952	414	39	xylariaceous	xylariaceous	ADJ
ahs-14952	414	40	fungi	fungus	NOUN
ahs-14952	414	41	from	from	ADP
ahs-14952	414	42	medicinal	medicinal	ADJ
ahs-14952	414	43	plants	plant	NOUN
ahs-14952	414	44	of	of	ADP
ahs-14952	414	45	dendrobium	dendrobium	NOUN
ahs-14952	414	46	(	(	PUNCT
ahs-14952	414	47	orchidaceae	orchidaceae	PROPN
ahs-14952	414	48	)	)	PUNCT
ahs-14952	414	49	.	.	PUNCT
ahs-14952	415	1	­	­	PROPN
ahs-14952	415	2	plos	plos	PROPN
ahs-14952	415	3	one	one	NUM
ahs-14952	415	4	,	,	PUNCT
ahs-14952	415	5	8(3	8(3	NUM
ahs-14952	415	6	):	):	PUNCT
ahs-14952	415	7	e58268	e58268	PROPN
ahs-14952	415	8	.	.	PUNCT
ahs-14952	416	1	chutima	chutima	PROPN
ahs-14952	416	2	r.	r.	PROPN
ahs-14952	416	3	,	,	PUNCT
ahs-14952	416	4	dell	dell	PROPN
ahs-14952	416	5	b.	b.	PROPN
ahs-14952	416	6	,	,	PUNCT
ahs-14952	416	7	vessabutr	vessabutr	NOUN
ahs-14952	416	8	s.	s.	PROPN
ahs-14952	416	9	,	,	PUNCT
ahs-14952	416	10	bussaban	bussaban	PROPN
ahs-14952	416	11	b.	b.	PROPN
ahs-14952	416	12	,	,	PUNCT
ahs-14952	416	13	lumyong	lumyong	PROPN
ahs-14952	416	14	s.	s.	PROPN
ahs-14952	416	15	,	,	PUNCT
ahs-14952	416	16	2011	2011	NUM
ahs-14952	416	17	­	­	VERB
ahs-14952	416	18	endophytic	endophytic	ADJ
ahs-14952	416	19	fungi	fungus	NOUN
ahs-14952	416	20	from	from	ADP
ahs-14952	416	21	pecteilis	pecteilis	PROPN
ahs-14952	416	22	susannae	susannae	PROPN
ahs-14952	416	23	(	(	PUNCT
ahs-14952	416	24	l.	l.	PROPN
ahs-14952	416	25	)	)	PUNCT
ahs-14952	416	26	rafin	rafin	NOUN
ahs-14952	416	27	(	(	PUNCT
ahs-14952	416	28	orchidaceae	orchidaceae	PROPN
ahs-14952	416	29	)	)	PUNCT
ahs-14952	416	30	,	,	PUNCT
ahs-14952	416	31	a	a	DET
ahs-14952	416	32	threatened	threaten	VERB
ahs-14952	416	33	terrestrial	terrestrial	ADJ
ahs-14952	416	34	orchid	orchid	NOUN
ahs-14952	416	35	in	in	ADP
ahs-14952	416	36	thailand	thailand	PROPN
ahs-14952	416	37	.	.	PUNCT
ahs-14952	417	1	­	­	PROPN
ahs-14952	417	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	417	3	,	,	PUNCT
ahs-14952	417	4	21(3	21(3	NUM
ahs-14952	417	5	):	):	PUNCT
ahs-14952	417	6	221­	221­	NUM
ahs-14952	417	7	229	229	NUM
ahs-14952	417	8	.	.	PUNCT
ahs-14952	418	1	cruz	cruz	PROPN
ahs-14952	418	2	d.	d.	PROPN
ahs-14952	418	3	,	,	PUNCT
ahs-14952	418	4	suárez	suárez	PROPN
ahs-14952	418	5	j.p	j.p	PROPN
ahs-14952	418	6	.	.	PROPN
ahs-14952	418	7	,	,	PUNCT
ahs-14952	418	8	kottke	kottke	PROPN
ahs-14952	418	9	i.	i.	PROPN
ahs-14952	418	10	,	,	PUNCT
ahs-14952	418	11	piepenbring	piepenbre	VERB
ahs-14952	418	12	m.	m.	NOUN
ahs-14952	418	13	,	,	PUNCT
ahs-14952	418	14	2014	2014	NUM
ahs-14952	418	15	­	­	NUM
ahs-14952	418	16	cryptic	cryptic	ADJ
ahs-14952	418	17	species	specie	NOUN
ahs-14952	418	18	revealed	reveal	VERB
ahs-14952	418	19	by	by	ADP
ahs-14952	418	20	molecular	molecular	ADJ
ahs-14952	418	21	phylogenetic	phylogenetic	ADJ
ahs-14952	418	22	analysis	analysis	NOUN
ahs-14952	418	23	of	of	ADP
ahs-14952	418	24	sequences	sequence	NOUN
ahs-14952	418	25	obtained	obtain	VERB
ahs-14952	418	26	from	from	ADP
ahs-14952	418	27	basidiomata	basidiomata	NOUN
ahs-14952	418	28	of	of	ADP
ahs-14952	418	29	tulasnella	tulasnella	NOUN
ahs-14952	418	30	.	.	PUNCT
ahs-14952	419	1	­	­	PROPN
ahs-14952	419	2	mycologia	mycologia	NOUN
ahs-14952	419	3	,	,	PUNCT
ahs-14952	419	4	106(4	106(4	NUM
ahs-14952	419	5	):	):	PUNCT
ahs-14952	419	6	708­722	708­722	NOUN
ahs-14952	419	7	.	.	PUNCT
ahs-14952	420	1	currah	currah	PROPN
ahs-14952	421	1	r.s	r.s	PROPN
ahs-14952	421	2	.	.	PROPN
ahs-14952	421	3	,	,	PUNCT
ahs-14952	421	4	sherburne	sherburne	PROPN
ahs-14952	421	5	r.	r.	PROPN
ahs-14952	421	6	,	,	PUNCT
ahs-14952	421	7	1992	1992	NUM
ahs-14952	421	8	­	­	VERB
ahs-14952	421	9	septal	septal	ADJ
ahs-14952	421	10	ultrastructure	ultrastructure	NOUN
ahs-14952	421	11	of	of	ADP
ahs-14952	421	12	some	some	DET
ahs-14952	421	13	fungal	fungal	ADJ
ahs-14952	421	14	endophytes	endophyte	NOUN
ahs-14952	421	15	from	from	ADP
ahs-14952	421	16	boreal	boreal	ADJ
ahs-14952	421	17	orchid	orchid	NOUN
ahs-14952	421	18	mycorrhizas	mycorrhiza	NOUN
ahs-14952	421	19	.	.	PUNCT
ahs-14952	422	1	­	­	VERB
ahs-14952	422	2	mycol	mycol	PROPN
ahs-14952	422	3	.	.	PUNCT
ahs-14952	423	1	res	re	NOUN
ahs-14952	423	2	.	.	PROPN
ahs-14952	423	3	,	,	PUNCT
ahs-14952	423	4	96(7	96(7	NUM
ahs-14952	423	5	):	):	PUNCT
ahs-14952	423	6	583­587	583­587	NUM
ahs-14952	423	7	.	.	PUNCT
ahs-14952	424	1	currah	currah	PROPN
ahs-14952	424	2	r.s	r.s	PROPN
ahs-14952	424	3	.	.	PROPN
ahs-14952	424	4	,	,	PUNCT
ahs-14952	424	5	smreciu	smreciu	PROPN
ahs-14952	424	6	e.a	e.a	PROPN
ahs-14952	424	7	.	.	PROPN
ahs-14952	424	8	,	,	PUNCT
ahs-14952	424	9	hambleton	hambleton	PROPN
ahs-14952	424	10	s.	s.	PROPN
ahs-14952	424	11	,	,	PUNCT
ahs-14952	424	12	1990	1990	NUM
ahs-14952	424	13	.	.	PUNCT
ahs-14952	425	1	­	­	VERB
ahs-14952	425	2	mycorrhizae	mycorrhizae	NOUN
ahs-14952	425	3	and	and	CCONJ
ahs-14952	425	4	mycorrhizal	mycorrhizal	NOUN
ahs-14952	425	5	fungi	fungus	NOUN
ahs-14952	425	6	of	of	ADP
ahs-14952	425	7	boreal	boreal	ADJ
ahs-14952	425	8	species	specie	NOUN
ahs-14952	425	9	of	of	ADP
ahs-14952	425	10	platanthera	platanthera	NOUN
ahs-14952	425	11	and	and	CCONJ
ahs-14952	425	12	coeloglossum	coeloglossum	VERB
ahs-14952	425	13	(	(	PUNCT
ahs-14952	425	14	orchidaceae	orchidaceae	PROPN
ahs-14952	425	15	)	)	PUNCT
ahs-14952	425	16	.	.	PUNCT
ahs-14952	426	1	­	­	PROPN
ahs-14952	426	2	canad	canad	PROPN
ahs-14952	426	3	.	.	PUNCT
ahs-14952	427	1	j.	j.	PROPN
ahs-14952	427	2	bot	bot	PROPN
ahs-14952	427	3	.	.	PUNCT
ahs-14952	427	4	,	,	PUNCT
ahs-14952	427	5	68(6	68(6	NOUN
ahs-14952	427	6	):	):	PUNCT
ahs-14952	427	7	1171­1181	1171­1181	NUM
ahs-14952	427	8	.	.	PUNCT
ahs-14952	428	1	davis	davis	PROPN
ahs-14952	428	2	j.b	j.b	PROPN
ahs-14952	428	3	.	.	PROPN
ahs-14952	428	4	,	,	PUNCT
ahs-14952	428	5	phillips	phillips	PROPN
ahs-14952	428	6	r.d	r.d	PROPN
ahs-14952	428	7	.	.	PROPN
ahs-14952	428	8	,	,	PUNCT
ahs-14952	428	9	wright	wright	PROPN
ahs-14952	428	10	m.	m.	PROPN
ahs-14952	428	11	,	,	PUNCT
ahs-14952	428	12	linde	linde	PROPN
ahs-14952	428	13	c.c	c.c	PROPN
ahs-14952	428	14	.	.	PROPN
ahs-14952	428	15	,	,	PUNCT
ahs-14952	428	16	dixon	dixon	PROPN
ahs-14952	428	17	k.w	k.w	PROPN
ahs-14952	428	18	.	.	PROPN
ahs-14952	428	19	,	,	PUNCT
ahs-14952	428	20	2015	2015	NUM
ahs-14952	428	21	­	­	NOUN
ahs-14952	428	22	continent‐wide	continent‐wide	ADJ
ahs-14952	428	23	distribution	distribution	NOUN
ahs-14952	428	24	in	in	ADP
ahs-14952	428	25	mycorrhizal	mycorrhizal	NOUN
ahs-14952	428	26	fungi	fungus	NOUN
ahs-14952	428	27	 	 	SPACE
ahs-14952	428	28	:	:	PUNCT
ahs-14952	428	29	implications	implication	NOUN
ahs-14952	428	30	for	for	ADP
ahs-14952	428	31	the	the	DET
ahs-14952	428	32	biogeography	biogeography	NOUN
ahs-14952	428	33	of	of	ADP
ahs-14952	428	34	specialized	specialized	PROPN
ahs-14952	428	35	adv	adv	PROPN
ahs-14952	428	36	.	.	PUNCT
ahs-14952	428	37	hort	hort	PROPN
ahs-14952	428	38	.	.	PUNCT
ahs-14952	429	1	sci	sci	PROPN
ahs-14952	429	2	.	.	PROPN
ahs-14952	429	3	,	,	PUNCT
ahs-14952	429	4	2024	2024	NUM
ahs-14952	429	5	38(1	38(1	NOUN
ahs-14952	429	6	):	):	PUNCT
ahs-14952	429	7	97­116	97­116	NUM
ahs-14952	429	8	112	112	NUM
ahs-14952	429	9	orchids	orchid	NOUN
ahs-14952	429	10	.	.	PUNCT
ahs-14952	430	1	­	­	PROPN
ahs-14952	430	2	ann	ann	PROPN
ahs-14952	430	3	.	.	PUNCT
ahs-14952	430	4	bot	bot	PROPN
ahs-14952	430	5	.	.	PUNCT
ahs-14952	430	6	,	,	PUNCT
ahs-14952	430	7	116(3	116(3	NUM
ahs-14952	430	8	):	):	PUNCT
ahs-14952	430	9	413­421	413­421	NOUN
ahs-14952	430	10	.	.	PUNCT
ahs-14952	431	1	dawson	dawson	PROPN
ahs-14952	431	2	m.n	m.n	PROPN
ahs-14952	431	3	.	.	PROPN
ahs-14952	431	4	,	,	PUNCT
ahs-14952	431	5	raskoff	raskoff	PROPN
ahs-14952	431	6	k.a	k.a	PROPN
ahs-14952	431	7	.	.	PROPN
ahs-14952	431	8	,	,	PUNCT
ahs-14952	431	9	jacobs	jacobs	PROPN
ahs-14952	431	10	d.k	d.k	PROPN
ahs-14952	431	11	.	.	PROPN
ahs-14952	431	12	,	,	PUNCT
ahs-14952	431	13	1998	1998	NUM
ahs-14952	431	14	­	­	NOUN
ahs-14952	431	15	field	field	NOUN
ahs-14952	431	16	preservation	preservation	NOUN
ahs-14952	431	17	of	of	ADP
ahs-14952	431	18	marine	marine	ADJ
ahs-14952	431	19	invertebrate	invertebrate	NOUN
ahs-14952	431	20	tissue	tissue	NOUN
ahs-14952	431	21	for	for	ADP
ahs-14952	431	22	dna	dna	PROPN
ahs-14952	431	23	analyses	analysis	NOUN
ahs-14952	431	24	.	.	PUNCT
ahs-14952	432	1	­	­	PROPN
ahs-14952	432	2	mol	mol	PROPN
ahs-14952	432	3	.	.	PUNCT
ahs-14952	433	1	mar	mar	PROPN
ahs-14952	433	2	.	.	PUNCT
ahs-14952	433	3	biol	biol	PROPN
ahs-14952	433	4	.	.	PUNCT
ahs-14952	434	1	biotechnol	biotechnol	PROPN
ahs-14952	434	2	.	.	PUNCT
ahs-14952	434	3	,	,	PUNCT
ahs-14952	434	4	7(2	7(2	NUM
ahs-14952	434	5	):	):	PUNCT
ahs-14952	434	6	145­152	145­152	NUM
ahs-14952	434	7	.	.	PUNCT
ahs-14952	435	1	dearnaley	dearnaley	PROPN
ahs-14952	435	2	j.	j.	PROPN
ahs-14952	435	3	,	,	PUNCT
ahs-14952	435	4	perotto	perotto	PROPN
ahs-14952	435	5	s.	s.	PROPN
ahs-14952	435	6	,	,	PUNCT
ahs-14952	435	7	selosse	selosse	PROPN
ahs-14952	435	8	m.	m.	PROPN
ahs-14952	435	9	a.	a.	PROPN
ahs-14952	435	10	,	,	PUNCT
ahs-14952	435	11	2016	2016	NUM
ahs-14952	435	12	­	­	NOUN
ahs-14952	435	13	structure	structure	NOUN
ahs-14952	435	14	and	and	CCONJ
ahs-14952	435	15	development	development	NOUN
ahs-14952	435	16	of	of	ADP
ahs-14952	435	17	orchid	orchid	NOUN
ahs-14952	435	18	mycorrhizas	mycorrhiza	NOUN
ahs-14952	435	19	,	,	PUNCT
ahs-14952	435	20	pp	pp	ADV
ahs-14952	435	21	.	.	PUNCT
ahs-14952	436	1	63­86	63­86	X
ahs-14952	436	2	.	.	PUNCT
ahs-14952	437	1	­	­	NOUN
ahs-14952	437	2	in	in	ADP
ahs-14952	437	3	:	:	PUNCT
ahs-14952	437	4	martin	martin	PROPN
ahs-14952	437	5	f.	f.	PROPN
ahs-14952	437	6	(	(	PUNCT
ahs-14952	437	7	ed	ed	NOUN
ahs-14952	437	8	)	)	PUNCT
ahs-14952	437	9	­molecular	­molecular	ADJ
ahs-14952	437	10	mycorrhizal	mycorrhizal	NOUN
ahs-14952	437	11	symbiosis	symbiosis	NOUN
ahs-14952	437	12	.	.	PUNCT
ahs-14952	438	1	john	john	PROPN
ahs-14952	438	2	wiley	wiley	PROPN
ahs-14952	438	3	&	&	CCONJ
ahs-14952	438	4	sons	sons	PROPN
ahs-14952	438	5	,	,	PUNCT
ahs-14952	438	6	inc	inc	PROPN
ahs-14952	438	7	.	.	PROPN
ahs-14952	438	8	,	,	PUNCT
ahs-14952	438	9	new	new	PROPN
ahs-14952	438	10	york	york	PROPN
ahs-14952	438	11	,	,	PUNCT
ahs-14952	438	12	pp	pp	PROPN
ahs-14952	438	13	.	.	PUNCT
ahs-14952	438	14	506	506	NUM
ahs-14952	438	15	.	.	PUNCT
ahs-14952	439	1	dearnaley	dearnaley	PROPN
ahs-14952	439	2	j.d.w	j.d.w	PROPN
ahs-14952	439	3	.	.	PUNCT
ahs-14952	439	4	,	,	PUNCT
ahs-14952	439	5	2007	2007	NUM
ahs-14952	439	6	­	­	VERB
ahs-14952	439	7	further	further	ADJ
ahs-14952	439	8	advances	advance	NOUN
ahs-14952	439	9	in	in	ADP
ahs-14952	439	10	orchid	orchid	NOUN
ahs-14952	439	11	mycorrhizal	mycorrhizal	NOUN
ahs-14952	439	12	research	research	NOUN
ahs-14952	439	13	.	.	PUNCT
ahs-14952	440	1	­	­	PROPN
ahs-14952	440	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	440	3	,	,	PUNCT
ahs-14952	440	4	17(6	17(6	NUM
ahs-14952	440	5	):	):	PUNCT
ahs-14952	440	6	475­486	475­486	PROPN
ahs-14952	440	7	.	.	PUNCT
ahs-14952	441	1	dearnaley	dearnaley	PROPN
ahs-14952	441	2	j.d.w	j.d.w	PROPN
ahs-14952	441	3	.	.	PUNCT
ahs-14952	441	4	,	,	PUNCT
ahs-14952	441	5	martos	martos	ADJ
ahs-14952	441	6	f.	f.	PROPN
ahs-14952	441	7	,	,	PUNCT
ahs-14952	441	8	selosse	selosse	PROPN
ahs-14952	441	9	m.a	m.a	PROPN
ahs-14952	441	10	.	.	PROPN
ahs-14952	441	11	,	,	PUNCT
ahs-14952	441	12	2012	2012	NUM
ahs-14952	441	13	­	­	VERB
ahs-14952	441	14	orchid	orchid	NOUN
ahs-14952	441	15	mycorrhizas	mycorrhiza	NOUN
ahs-14952	441	16	:	:	PUNCT
ahs-14952	442	1	molecular	molecular	ADJ
ahs-14952	442	2	ecology	ecology	NOUN
ahs-14952	442	3	,	,	PUNCT
ahs-14952	442	4	physiology	physiology	NOUN
ahs-14952	442	5	,	,	PUNCT
ahs-14952	442	6	evolution	evolution	NOUN
ahs-14952	442	7	and	and	CCONJ
ahs-14952	442	8	conservation	conservation	NOUN
ahs-14952	442	9	aspects	aspect	NOUN
ahs-14952	442	10	,	,	PUNCT
ahs-14952	442	11	pp	pp	X
ahs-14952	442	12	.	.	PUNCT
ahs-14952	443	1	207­230	207­230	NUM
ahs-14952	443	2	.	.	PUNCT
ahs-14952	444	1	­	­	NOUN
ahs-14952	444	2	in	in	ADP
ahs-14952	444	3	:	:	PUNCT
ahs-14952	444	4	hock	hock	PROPN
ahs-14952	444	5	b.	b.	PROPN
ahs-14952	444	6	(	(	PUNCT
ahs-14952	444	7	ed	ed	NOUN
ahs-14952	444	8	.	.	PUNCT
ahs-14952	444	9	)	)	PUNCT
ahs-14952	445	1	fungal	fungal	ADJ
ahs-14952	445	2	associations	association	NOUN
ahs-14952	445	3	.	.	PUNCT
ahs-14952	446	1	vol	vol	NOUN
ahs-14952	446	2	.	.	PROPN
ahs-14952	446	3	9	9	NUM
ahs-14952	446	4	.	.	X
ahs-14952	446	5	springer	springer	NOUN
ahs-14952	446	6	,	,	PUNCT
ahs-14952	446	7	berlin	berlin	PROPN
ahs-14952	446	8	,	,	PUNCT
ahs-14952	446	9	germany	germany	PROPN
ahs-14952	446	10	,	,	PUNCT
ahs-14952	446	11	pp	pp	X
ahs-14952	446	12	.	.	PUNCT
ahs-14952	447	1	406	406	NUM
ahs-14952	447	2	.	.	PUNCT
ahs-14952	448	1	ding	ding	PROPN
ahs-14952	448	2	r.	r.	PROPN
ahs-14952	448	3	,	,	PUNCT
ahs-14952	448	4	chen	chen	PROPN
ahs-14952	448	5	x.h	x.h	PROPN
ahs-14952	448	6	.	.	PROPN
ahs-14952	448	7	,	,	PUNCT
ahs-14952	448	8	zhang	zhang	PROPN
ahs-14952	448	9	l.j	l.j	PROPN
ahs-14952	448	10	.	.	PROPN
ahs-14952	448	11	,	,	PUNCT
ahs-14952	448	12	yu	yu	PROPN
ahs-14952	448	13	bo	bo	PROPN
ahs-14952	448	14	,	,	PUNCT
ahs-14952	448	15	qu	qu	PROPN
ahs-14952	448	16	x.d	x.d	PROPN
ahs-14952	448	17	.	.	PROPN
ahs-14952	448	18	,	,	PUNCT
ahs-14952	448	19	duan	duan	PROPN
ahs-14952	448	20	r.	r.	PROPN
ahs-14952	448	21	,	,	PUNCT
ahs-14952	448	22	xu	xu	PROPN
ahs-14952	449	1	y.f	y.f	PROPN
ahs-14952	449	2	.	.	PROPN
ahs-14952	449	3	,	,	PUNCT
ahs-14952	449	4	2014	2014	NUM
ahs-14952	449	5	­	­	VERB
ahs-14952	449	6	identity	identity	NOUN
ahs-14952	449	7	and	and	CCONJ
ahs-14952	449	8	specificity	specificity	NOUN
ahs-14952	449	9	of	of	ADP
ahs-14952	449	10	rhizoctonia‐	rhizoctonia‐	NOUN
ahs-14952	449	11	like	like	ADP
ahs-14952	449	12	fungi	fungus	NOUN
ahs-14952	449	13	from	from	ADP
ahs-14952	449	14	different	different	ADJ
ahs-14952	449	15	populations	population	NOUN
ahs-14952	449	16	of	of	ADP
ahs-14952	449	17	liparis	liparis	NOUN
ahs-14952	449	18	japonica	japonica	PROPN
ahs-14952	449	19	(	(	PUNCT
ahs-14952	449	20	orchidaceae	orchidaceae	PROPN
ahs-14952	449	21	)	)	PUNCT
ahs-14952	449	22	in	in	ADP
ahs-14952	449	23	northeast	northeast	ADJ
ahs-14952	449	24	china	china	PROPN
ahs-14952	449	25	.	.	PUNCT
ahs-14952	450	1	­	­	PROPN
ahs-14952	450	2	plos	plos	PROPN
ahs-14952	450	3	one	one	NUM
ahs-14952	450	4	,	,	PUNCT
ahs-14952	450	5	9(8	9(8	NUM
ahs-14952	450	6	):	):	PUNCT
ahs-14952	450	7	e105573	e105573	NOUN
ahs-14952	450	8	.	.	PUNCT
ahs-14952	451	1	durán­lópez	durán­lópez	PROPN
ahs-14952	451	2	m.e	m.e	PROPN
ahs-14952	451	3	.	.	PROPN
ahs-14952	451	4	,	,	PUNCT
ahs-14952	451	5	caroca­cáceres	caroca­cácere	VERB
ahs-14952	451	6	r.	r.	PROPN
ahs-14952	451	7	,	,	PUNCT
ahs-14952	451	8	jahreis	jahreis	PROPN
ahs-14952	451	9	k.	k.	PROPN
ahs-14952	451	10	,	,	PUNCT
ahs-14952	451	11	narváez­vera	narváez­vera	NOUN
ahs-14952	451	12	m.	m.	NOUN
ahs-14952	451	13	,	,	PUNCT
ahs-14952	451	14	ansaloni	ansaloni	PROPN
ahs-14952	451	15	r.	r.	PROPN
ahs-14952	451	16	,	,	PUNCT
ahs-14952	451	17	cazar	cazar	PROPN
ahs-14952	451	18	m.e	m.e	PROPN
ahs-14952	451	19	.	.	PROPN
ahs-14952	451	20	,	,	PUNCT
ahs-14952	451	21	2019	2019	NUM
ahs-14952	451	22	­	­	VERB
ahs-14952	451	23	the	the	DET
ahs-14952	451	24	micorryzal	micorryzal	NOUN
ahs-14952	451	25	fungi	fungus	NOUN
ahs-14952	451	26	ceratobasidium	ceratobasidium	NOUN
ahs-14952	451	27	sp	sp	PROPN
ahs-14952	451	28	.	.	PROPN
ahs-14952	451	29	and	and	CCONJ
ahs-14952	451	30	sebacina	sebacina	PROPN
ahs-14952	451	31	vermifera	vermifera	NOUN
ahs-14952	451	32	promote	promote	NOUN
ahs-14952	451	33	seed	seed	NOUN
ahs-14952	451	34	germination	germination	NOUN
ahs-14952	451	35	and	and	CCONJ
ahs-14952	451	36	seedling	seedling	NOUN
ahs-14952	451	37	development	development	NOUN
ahs-14952	451	38	of	of	ADP
ahs-14952	451	39	the	the	DET
ahs-14952	451	40	terrestrial	terrestrial	ADJ
ahs-14952	451	41	orchid	orchid	NOUN
ahs-14952	451	42	epidendrum	epidendrum	PROPN
ahs-14952	451	43	secundum	secundum	PROPN
ahs-14952	451	44	jacq	jacq	PROPN
ahs-14952	451	45	.	.	PUNCT
ahs-14952	452	1	­	­	PROPN
ahs-14952	452	2	s.	s.	PROPN
ahs-14952	452	3	afr	afr	PROPN
ahs-14952	452	4	.	.	PUNCT
ahs-14952	453	1	j.	j.	PROPN
ahs-14952	453	2	bot	bot	PROPN
ahs-14952	453	3	.	.	PROPN
ahs-14952	453	4	,	,	PUNCT
ahs-14952	453	5	125(54	125(54	NUM
ahs-14952	453	6	):	):	PUNCT
ahs-14952	453	7	54­61	54­61	PROPN
ahs-14952	453	8	.	.	PUNCT
ahs-14952	454	1	egidi	egidi	PROPN
ahs-14952	454	2	e.	e.	PROPN
ahs-14952	454	3	,	,	PUNCT
ahs-14952	454	4	may	may	PROPN
ahs-14952	454	5	t.w	t.w	PROPN
ahs-14952	454	6	.	.	PROPN
ahs-14952	454	7	,	,	PUNCT
ahs-14952	454	8	franks	frank	VERB
ahs-14952	454	9	a.e	a.e	PROPN
ahs-14952	454	10	.	.	PROPN
ahs-14952	454	11	,	,	PUNCT
ahs-14952	454	12	2018	2018	NUM
ahs-14952	454	13	­	­	NOUN
ahs-14952	454	14	seeking	seek	VERB
ahs-14952	454	15	the	the	DET
ahs-14952	454	16	needle	needle	NOUN
ahs-14952	454	17	in	in	ADP
ahs-14952	454	18	the	the	DET
ahs-14952	454	19	haystack	haystack	NOUN
ahs-14952	454	20	:	:	PUNCT
ahs-14952	454	21	undetectability	undetectability	NOUN
ahs-14952	454	22	of	of	ADP
ahs-14952	454	23	mycorrhizal	mycorrhizal	NOUN
ahs-14952	454	24	fungi	fungus	NOUN
ahs-14952	454	25	outside	outside	ADP
ahs-14952	454	26	of	of	ADP
ahs-14952	454	27	the	the	DET
ahs-14952	454	28	plant	plant	NOUN
ahs-14952	454	29	rhizosphere	rhizosphere	ADV
ahs-14952	454	30	associated	associate	VERB
ahs-14952	454	31	with	with	ADP
ahs-14952	454	32	an	an	DET
ahs-14952	454	33	endangered	endangered	ADJ
ahs-14952	454	34	australian	australian	ADJ
ahs-14952	454	35	orchid	orchid	NOUN
ahs-14952	454	36	.	.	PUNCT
ahs-14952	455	1	­	­	VERB
ahs-14952	455	2	fungal	fungal	ADJ
ahs-14952	455	3	ecol	ecol	NOUN
ahs-14952	455	4	.	.	PUNCT
ahs-14952	456	1	,	,	PUNCT
ahs-14952	456	2	33	33	NUM
ahs-14952	456	3	:	:	SYM
ahs-14952	456	4	13­	13­	NUM
ahs-14952	456	5	23	23	NUM
ahs-14952	456	6	.	.	PUNCT
ahs-14952	457	1	fadiji	fadiji	PROPN
ahs-14952	457	2	a.e	a.e	PROPN
ahs-14952	457	3	.	.	PROPN
ahs-14952	457	4	,	,	PUNCT
ahs-14952	457	5	babalola	babalola	PROPN
ahs-14952	457	6	o.o	o.o	PROPN
ahs-14952	457	7	.	.	PROPN
ahs-14952	457	8	,	,	PUNCT
ahs-14952	457	9	2020	2020	NUM
ahs-14952	457	10	­	­	VERB
ahs-14952	457	11	metagenomics	metagenomic	NOUN
ahs-14952	457	12	methods	method	NOUN
ahs-14952	457	13	for	for	ADP
ahs-14952	457	14	the	the	DET
ahs-14952	457	15	study	study	NOUN
ahs-14952	457	16	of	of	ADP
ahs-14952	457	17	plant‐associated	plant‐associated	ADJ
ahs-14952	457	18	microbial	microbial	ADJ
ahs-14952	457	19	communities	community	NOUN
ahs-14952	457	20	:	:	PUNCT
ahs-14952	457	21	a	a	DET
ahs-14952	457	22	review	review	NOUN
ahs-14952	457	23	.	.	PUNCT
ahs-14952	458	1	­	­	PROPN
ahs-14952	458	2	j.	j.	PROPN
ahs-14952	458	3	microbiol	microbiol	PROPN
ahs-14952	458	4	.	.	PUNCT
ahs-14952	459	1	methods	method	NOUN
ahs-14952	459	2	,	,	PUNCT
ahs-14952	459	3	170	170	NUM
ahs-14952	459	4	:	:	SYM
ahs-14952	459	5	105860	105860	NUM
ahs-14952	459	6	.	.	PUNCT
ahs-14952	460	1	faggi	faggi	PROPN
ahs-14952	460	2	e.	e.	PROPN
ahs-14952	460	3	,	,	PUNCT
ahs-14952	460	4	pini	pini	PROPN
ahs-14952	460	5	g.	g.	PROPN
ahs-14952	460	6	,	,	PUNCT
ahs-14952	460	7	campisi	campisi	PROPN
ahs-14952	460	8	e.	e.	PROPN
ahs-14952	460	9	,	,	PUNCT
ahs-14952	460	10	2005	2005	NUM
ahs-14952	460	11	­	­	NOUN
ahs-14952	460	12	use	use	NOUN
ahs-14952	460	13	of	of	ADP
ahs-14952	460	14	magnetic	magnetic	ADJ
ahs-14952	460	15	beads	bead	NOUN
ahs-14952	460	16	to	to	PART
ahs-14952	460	17	extract	extract	VERB
ahs-14952	460	18	fungal	fungal	ADJ
ahs-14952	460	19	dna	dna	NOUN
ahs-14952	460	20	.	.	PUNCT
ahs-14952	461	1	­	­	PROPN
ahs-14952	461	2	mycoses	mycose	NOUN
ahs-14952	461	3	.	.	PUNCT
ahs-14952	462	1	,	,	PUNCT
ahs-14952	462	2	48	48	NUM
ahs-14952	462	3	:	:	PUNCT
ahs-14952	462	4	3­7	3­7	NUM
ahs-14952	462	5	.	.	PROPN
ahs-14952	462	6	fajarningsih	fajarningsih	PROPN
ahs-14952	462	7	n.d	n.d	PROPN
ahs-14952	462	8	.	.	PROPN
ahs-14952	462	9	,	,	PUNCT
ahs-14952	462	10	2016	2016	NUM
ahs-14952	462	11	­	­	VERB
ahs-14952	462	12	internal	internal	ADJ
ahs-14952	462	13	transcribed	transcribe	VERB
ahs-14952	462	14	spacer	spacer	NOUN
ahs-14952	462	15	(	(	PUNCT
ahs-14952	462	16	its	its	PRON
ahs-14952	462	17	)	)	PUNCT
ahs-14952	462	18	as	as	SCONJ
ahs-14952	462	19	dna	dna	PROPN
ahs-14952	462	20	barcoding	barcode	VERB
ahs-14952	462	21	to	to	PART
ahs-14952	462	22	identify	identify	VERB
ahs-14952	462	23	fungal	fungal	ADJ
ahs-14952	462	24	species	specie	NOUN
ahs-14952	462	25	:	:	PUNCT
ahs-14952	462	26	a	a	DET
ahs-14952	462	27	review	review	NOUN
ahs-14952	462	28	.	.	PUNCT
ahs-14952	463	1	­	­	AUX
ahs-14952	463	2	squalen	squalen	ADJ
ahs-14952	463	3	bull	bull	NOUN
ahs-14952	463	4	.	.	PUNCT
ahs-14952	463	5	,	,	PUNCT
ahs-14952	463	6	11(2	11(2	X
ahs-14952	463	7	):	):	PUNCT
ahs-14952	463	8	37­44	37­44	NUM
ahs-14952	463	9	.	.	PUNCT
ahs-14952	463	10	fay	fay	PROPN
ahs-14952	463	11	m.f	m.f	PROPN
ahs-14952	463	12	.	.	PROPN
ahs-14952	463	13	,	,	PUNCT
ahs-14952	463	14	feustel	feustel	PROPN
ahs-14952	463	15	m.	m.	PROPN
ahs-14952	463	16	,	,	PUNCT
ahs-14952	463	17	newlands	newlands	PROPN
ahs-14952	463	18	c.	c.	PROPN
ahs-14952	463	19	,	,	PUNCT
ahs-14952	463	20	gebauer	gebauer	NOUN
ahs-14952	463	21	g.	g.	PROPN
ahs-14952	463	22	2018	2018	NUM
ahs-14952	463	23	­	­	VERB
ahs-14952	463	24	inferring	infer	VERB
ahs-14952	463	25	the	the	DET
ahs-14952	463	26	mycorrhizal	mycorrhizal	NOUN
ahs-14952	463	27	status	status	NOUN
ahs-14952	463	28	of	of	ADP
ahs-14952	463	29	introduced	introduce	VERB
ahs-14952	463	30	plants	plant	NOUN
ahs-14952	463	31	of	of	ADP
ahs-14952	463	32	cypripedium	cypripedium	NOUN
ahs-14952	463	33	calceolus	calceolus	NOUN
ahs-14952	463	34	(	(	PUNCT
ahs-14952	463	35	orchidaceae	orchidaceae	PROPN
ahs-14952	463	36	)	)	PUNCT
ahs-14952	463	37	in	in	ADP
ahs-14952	463	38	northern	northern	ADJ
ahs-14952	463	39	england	england	PROPN
ahs-14952	463	40	using	use	VERB
ahs-14952	463	41	stable	stable	ADJ
ahs-14952	463	42	isotope	isotope	NOUN
ahs-14952	463	43	analysis	analysis	NOUN
ahs-14952	463	44	.	.	PUNCT
ahs-14952	464	1	­	­	PROPN
ahs-14952	464	2	bot	bot	PROPN
ahs-14952	464	3	.	.	PUNCT
ahs-14952	465	1	j.	j.	PROPN
ahs-14952	465	2	linn	linn	PROPN
ahs-14952	465	3	.	.	PROPN
ahs-14952	465	4	,	,	PUNCT
ahs-14952	465	5	186(4	186(4	NUM
ahs-14952	465	6	):	):	PUNCT
ahs-14952	465	7	587­590	587­590	NOUN
ahs-14952	465	8	.	.	PUNCT
ahs-14952	466	1	fernandez	fernandez	PROPN
ahs-14952	466	2	c.w	c.w	PROPN
ahs-14952	466	3	.	.	PROPN
ahs-14952	466	4	,	,	PUNCT
ahs-14952	466	5	langley	langley	PROPN
ahs-14952	466	6	j.a	j.a	PROPN
ahs-14952	466	7	.	.	PROPN
ahs-14952	466	8	,	,	PUNCT
ahs-14952	466	9	chapman	chapman	PROPN
ahs-14952	466	10	s.	s.	PROPN
ahs-14952	466	11	,	,	PUNCT
ahs-14952	466	12	mccormack	mccormack	PROPN
ahs-14952	466	13	m.l	m.l	PROPN
ahs-14952	466	14	.	.	PROPN
ahs-14952	466	15	,	,	PUNCT
ahs-14952	466	16	koide	koide	VERB
ahs-14952	466	17	r.t	r.t	PROPN
ahs-14952	466	18	.	.	PROPN
ahs-14952	466	19	,	,	PUNCT
ahs-14952	466	20	2016	2016	NUM
ahs-14952	466	21	­	­	VERB
ahs-14952	466	22	the	the	DET
ahs-14952	466	23	decomposition	decomposition	NOUN
ahs-14952	466	24	of	of	ADP
ahs-14952	466	25	ectomycorrhizal	ectomycorrhizal	NOUN
ahs-14952	466	26	fungal	fungal	ADJ
ahs-14952	466	27	necromass	necromass	NOUN
ahs-14952	466	28	.	.	PUNCT
ahs-14952	467	1	­	­	VERB
ahs-14952	467	2	soil	soil	NOUN
ahs-14952	467	3	biol	biol	PROPN
ahs-14952	467	4	.	.	PUNCT
ahs-14952	468	1	biochem	biochem	PROPN
ahs-14952	468	2	.	.	PUNCT
ahs-14952	468	3	,	,	PUNCT
ahs-14952	469	1	93	93	NUM
ahs-14952	469	2	:	:	PUNCT
ahs-14952	469	3	38­49	38­49	NUM
ahs-14952	469	4	.	.	PUNCT
ahs-14952	470	1	gardes	gardes	PROPN
ahs-14952	470	2	m.	m.	NOUN
ahs-14952	470	3	,	,	PUNCT
ahs-14952	470	4	bruns	bruns	PROPN
ahs-14952	470	5	t.d	t.d	PROPN
ahs-14952	470	6	.	.	PROPN
ahs-14952	470	7	,	,	PUNCT
ahs-14952	470	8	1993	1993	NUM
ahs-14952	470	9	­	­	VERB
ahs-14952	470	10	its	its	PRON
ahs-14952	470	11	primers	primer	NOUN
ahs-14952	470	12	with	with	ADP
ahs-14952	470	13	enhanced	enhanced	ADJ
ahs-14952	470	14	specificity	specificity	NOUN
ahs-14952	470	15	for	for	ADP
ahs-14952	470	16	basidiomycetes‐application	basidiomycetes‐application	NOUN
ahs-14952	470	17	to	to	ADP
ahs-14952	470	18	the	the	DET
ahs-14952	470	19	identification	identification	NOUN
ahs-14952	470	20	of	of	ADP
ahs-14952	470	21	mycorrhizae	mycorrhizae	NOUN
ahs-14952	470	22	and	and	CCONJ
ahs-14952	470	23	rusts	rust	NOUN
ahs-14952	470	24	.	.	PUNCT
ahs-14952	471	1	­	­	PROPN
ahs-14952	471	2	mol	mol	PROPN
ahs-14952	471	3	.	.	PUNCT
ahs-14952	471	4	ecol	ecol	PROPN
ahs-14952	471	5	.	.	PUNCT
ahs-14952	471	6	,	,	PUNCT
ahs-14952	471	7	2(2	2(2	NUM
ahs-14952	471	8	):	):	PUNCT
ahs-14952	471	9	113­118	113­118	NUM
ahs-14952	471	10	.	.	PUNCT
ahs-14952	472	1	ghirardo	ghirardo	PROPN
ahs-14952	472	2	a.	a.	PROPN
ahs-14952	472	3	,	,	PUNCT
ahs-14952	472	4	fochi	fochi	PROPN
ahs-14952	472	5	v.	v.	PROPN
ahs-14952	472	6	,	,	PUNCT
ahs-14952	472	7	lange	lange	PROPN
ahs-14952	472	8	b.	b.	PROPN
ahs-14952	472	9	,	,	PUNCT
ahs-14952	472	10	witting	witte	VERB
ahs-14952	472	11	m.	m.	NOUN
ahs-14952	472	12	,	,	PUNCT
ahs-14952	472	13	schnitzler	schnitzler	PROPN
ahs-14952	472	14	j.p	j.p	PROPN
ahs-14952	472	15	.	.	PROPN
ahs-14952	472	16	,	,	PUNCT
ahs-14952	472	17	perotto	perotto	PROPN
ahs-14952	472	18	s.	s.	PROPN
ahs-14952	472	19	,	,	PUNCT
ahs-14952	472	20	balestrini	balestrini	PROPN
ahs-14952	472	21	r.	r.	PROPN
ahs-14952	472	22	,	,	PUNCT
ahs-14952	472	23	2020	2020	NUM
ahs-14952	472	24	­	­	VERB
ahs-14952	472	25	metabolomic	metabolomic	ADJ
ahs-14952	472	26	adjustments	adjustment	NOUN
ahs-14952	472	27	in	in	ADP
ahs-14952	472	28	the	the	DET
ahs-14952	472	29	orchid	orchid	NOUN
ahs-14952	472	30	mycorrhizal	mycorrhizal	NOUN
ahs-14952	472	31	fungus	fungus	NOUN
ahs-14952	472	32	tulasnella	tulasnella	NOUN
ahs-14952	472	33	calospora	calospora	NOUN
ahs-14952	472	34	during	during	ADP
ahs-14952	472	35	symbiosis	symbiosis	NOUN
ahs-14952	472	36	with	with	ADP
ahs-14952	472	37	serapias	serapias	PROPN
ahs-14952	472	38	vomeracea	vomeracea	PROPN
ahs-14952	472	39	.	.	PUNCT
ahs-14952	473	1	­	­	VERB
ahs-14952	473	2	new	new	ADJ
ahs-14952	473	3	phytol	phytol	NOUN
ahs-14952	473	4	.	.	PUNCT
ahs-14952	473	5	,	,	PUNCT
ahs-14952	473	6	228(6	228(6	NUM
ahs-14952	473	7	):	):	PUNCT
ahs-14952	473	8	1939­1952	1939­1952	NUM
ahs-14952	473	9	.	.	PUNCT
ahs-14952	474	1	givnish	givnish	PROPN
ahs-14952	474	2	t.j	t.j	PROPN
ahs-14952	474	3	.	.	PROPN
ahs-14952	474	4	,	,	PUNCT
ahs-14952	474	5	spalink	spalink	PROPN
ahs-14952	474	6	d.	d.	PROPN
ahs-14952	474	7	,	,	PUNCT
ahs-14952	474	8	ames	ames	PROPN
ahs-14952	474	9	m.	m.	PROPN
ahs-14952	474	10	,	,	PUNCT
ahs-14952	474	11	lyon	lyon	PROPN
ahs-14952	474	12	s.p	s.p	PROPN
ahs-14952	474	13	.	.	PROPN
ahs-14952	474	14	,	,	PUNCT
ahs-14952	474	15	hunter	hunter	PROPN
ahs-14952	474	16	s.j	s.j	PROPN
ahs-14952	474	17	.	.	PROPN
ahs-14952	474	18	,	,	PUNCT
ahs-14952	474	19	zuluaga	zuluaga	NOUN
ahs-14952	474	20	a.	a.	NOUN
ahs-14952	474	21	,	,	PUNCT
ahs-14952	474	22	iles	iles	PROPN
ahs-14952	474	23	w.j.d	w.j.d	PROPN
ahs-14952	474	24	.	.	PUNCT
ahs-14952	474	25	,	,	PUNCT
ahs-14952	475	1	clements	clements	PROPN
ahs-14952	475	2	m.a	m.a	PROPN
ahs-14952	475	3	.	.	PROPN
ahs-14952	475	4	,	,	PUNCT
ahs-14952	475	5	arroyo	arroyo	PROPN
ahs-14952	475	6	m.t.k	m.t.k	PROPN
ahs-14952	475	7	.	.	PROPN
ahs-14952	475	8	,	,	PUNCT
ahs-14952	475	9	leebens­mack	leebens­mack	PROPN
ahs-14952	475	10	j.	j.	PROPN
ahs-14952	475	11	,	,	PUNCT
ahs-14952	475	12	endara	endara	PROPN
ahs-14952	475	13	l.	l.	PROPN
ahs-14952	475	14	,	,	PUNCT
ahs-14952	475	15	kriebel	kriebel	PROPN
ahs-14952	475	16	r.	r.	PROPN
ahs-14952	475	17	,	,	PUNCT
ahs-14952	475	18	neubig	neubig	PROPN
ahs-14952	475	19	k.m	k.m	PROPN
ahs-14952	475	20	.	.	PROPN
ahs-14952	475	21	,	,	PUNCT
ahs-14952	475	22	whitten	whitten	PROPN
ahs-14952	475	23	w.m	w.m	PROPN
ahs-14952	475	24	.	.	PROPN
ahs-14952	475	25	,	,	PUNCT
ahs-14952	475	26	williams	williams	PROPN
ahs-14952	475	27	n.h	n.h	PROPN
ahs-14952	475	28	.	.	PROPN
ahs-14952	475	29	,	,	PUNCT
ahs-14952	475	30	cameron	cameron	PROPN
ahs-14952	475	31	k.m	k.m	PROPN
ahs-14952	475	32	.	.	PROPN
ahs-14952	475	33	,	,	PUNCT
ahs-14952	475	34	2015	2015	NUM
ahs-14952	475	35	­	­	VERB
ahs-14952	475	36	orchid	orchid	NOUN
ahs-14952	475	37	phylogenomics	phylogenomic	NOUN
ahs-14952	475	38	and	and	CCONJ
ahs-14952	475	39	multiple	multiple	ADJ
ahs-14952	475	40	drivers	driver	NOUN
ahs-14952	475	41	of	of	ADP
ahs-14952	475	42	their	their	PRON
ahs-14952	475	43	extraordinary	extraordinary	ADJ
ahs-14952	475	44	diversification	diversification	NOUN
ahs-14952	475	45	.	.	PUNCT
ahs-14952	476	1	­	­	PROPN
ahs-14952	476	2	proc	proc	PROPN
ahs-14952	476	3	.	.	PUNCT
ahs-14952	477	1	r.	r.	PROPN
ahs-14952	477	2	soc	soc	PROPN
ahs-14952	477	3	.	.	PUNCT
ahs-14952	478	1	b	b	X
ahs-14952	478	2	:	:	PUNCT
ahs-14952	478	3	biol	biol	PROPN
ahs-14952	478	4	.	.	PUNCT
ahs-14952	479	1	sci	sci	PROPN
ahs-14952	479	2	.	.	PROPN
ahs-14952	479	3	,	,	PUNCT
ahs-14952	479	4	282(1814	282(1814	NUM
ahs-14952	479	5	):	):	PUNCT
ahs-14952	479	6	20151553	20151553	NUM
ahs-14952	479	7	.	.	PUNCT
ahs-14952	480	1	govaerts	govaert	NOUN
ahs-14952	480	2	r.	r.	PROPN
ahs-14952	480	3	,	,	PUNCT
ahs-14952	480	4	bernet	bernet	NOUN
ahs-14952	480	5	p.	p.	NOUN
ahs-14952	480	6	,	,	PUNCT
ahs-14952	480	7	kratochvil	kratochvil	PROPN
ahs-14952	480	8	k.	k.	PROPN
ahs-14952	480	9	,	,	PUNCT
ahs-14952	480	10	gerlach	gerlach	PROPN
ahs-14952	480	11	g.	g.	PROPN
ahs-14952	480	12	,	,	PUNCT
ahs-14952	480	13	carr	carr	PROPN
ahs-14952	480	14	g.	g.	PROPN
ahs-14952	480	15	,	,	PUNCT
ahs-14952	480	16	alrich	alrich	PROPN
ahs-14952	480	17	p.	p.	PROPN
ahs-14952	480	18	,	,	PUNCT
ahs-14952	480	19	pridgeon	pridgeon	PROPN
ahs-14952	480	20	a.m.	a.m.	ADV
ahs-14952	480	21	,	,	PUNCT
ahs-14952	480	22	pfahl	pfahl	PROPN
ahs-14952	480	23	j.	j.	PROPN
ahs-14952	480	24	,	,	PUNCT
ahs-14952	480	25	campacci	campacci	PROPN
ahs-14952	480	26	m.a	m.a	PROPN
ahs-14952	480	27	.	.	PROPN
ahs-14952	480	28	,	,	PUNCT
ahs-14952	480	29	holland	holland	PROPN
ahs-14952	480	30	baptista	baptista	PROPN
ahs-14952	480	31	d.	d.	PROPN
ahs-14952	480	32	,	,	PUNCT
ahs-14952	480	33	tigges	tigge	VERB
ahs-14952	480	34	h.	h.	PROPN
ahs-14952	480	35	,	,	PUNCT
ahs-14952	480	36	shaw	shaw	PROPN
ahs-14952	480	37	j.	j.	PROPN
ahs-14952	480	38	,	,	PUNCT
ahs-14952	480	39	cribb	cribb	PROPN
ahs-14952	480	40	p.	p.	PROPN
ahs-14952	480	41	,	,	PUNCT
ahs-14952	480	42	george	george	PROPN
ahs-14952	480	43	a.	a.	PROPN
ahs-14952	480	44	,	,	PUNCT
ahs-14952	480	45	kreuz	kreuz	PROPN
ahs-14952	480	46	k.	k.	PROPN
ahs-14952	480	47	,	,	PUNCT
ahs-14952	480	48	wood	wood	PROPN
ahs-14952	480	49	j.	j.	PROPN
ahs-14952	480	50	j.	j.	PROPN
ahs-14952	480	51	,	,	PUNCT
ahs-14952	480	52	2017	2017	NUM
ahs-14952	480	53	­	­	PROPN
ahs-14952	480	54	world	world	NOUN
ahs-14952	480	55	checklist	checklist	NOUN
ahs-14952	480	56	of	of	ADP
ahs-14952	480	57	orchidaceae	orchidaceae	PROPN
ahs-14952	480	58	,	,	PUNCT
ahs-14952	480	59	kew	kew	PROPN
ahs-14952	480	60	:	:	PUNCT
ahs-14952	480	61	facilitated	facilitate	VERB
ahs-14952	480	62	by	by	ADP
ahs-14952	480	63	the	the	DET
ahs-14952	480	64	royal	royal	PROPN
ahs-14952	480	65	botanic	botanic	ADJ
ahs-14952	480	66	gardens	gardens	PROPN
ahs-14952	480	67	.	.	PUNCT
ahs-14952	481	1	­	­	PROPN
ahs-14952	481	2	http://apps.kew.org/wcsp/.	http://apps.kew.org/wcsp/.	PROPN
ahs-14952	481	3	hemrová	hemrová	PROPN
ahs-14952	481	4	l.	l.	PROPN
ahs-14952	481	5	,	,	PUNCT
ahs-14952	481	6	kotilínek	kotilínek	ADJ
ahs-14952	481	7	m.	m.	NOUN
ahs-14952	481	8	,	,	PUNCT
ahs-14952	481	9	konečná	konečná	PROPN
ahs-14952	481	10	k.	k.	PROPN
ahs-14952	481	11	,	,	PUNCT
ahs-14952	481	12	paulič	paulič	PROPN
ahs-14952	481	13	r.	r.	PROPN
ahs-14952	481	14	,	,	PUNCT
ahs-14952	481	15	jersáková	jersáková	PROPN
ahs-14952	481	16	j.	j.	PROPN
ahs-14952	481	17	,	,	PUNCT
ahs-14952	481	18	těšitelová	těšitelová	NOUN
ahs-14952	481	19	t.	t.	PROPN
ahs-14952	481	20	,	,	PUNCT
ahs-14952	481	21	knappová	knappová	PROPN
ahs-14952	481	22	j.	j.	PROPN
ahs-14952	481	23	,	,	PUNCT
ahs-14952	481	24	münzbergová	münzbergová	PROPN
ahs-14952	481	25	j.	j.	PROPN
ahs-14952	481	26	,	,	PUNCT
ahs-14952	481	27	2019	2019	NUM
ahs-14952	481	28	­	­	NOUN
ahs-14952	481	29	identification	identification	NOUN
ahs-14952	481	30	of	of	ADP
ahs-14952	481	31	drivers	driver	NOUN
ahs-14952	481	32	of	of	ADP
ahs-14952	481	33	landscape	landscape	NOUN
ahs-14952	481	34	distribution	distribution	NOUN
ahs-14952	481	35	of	of	ADP
ahs-14952	481	36	forest	forest	NOUN
ahs-14952	481	37	orchids	orchid	NOUN
ahs-14952	481	38	using	use	VERB
ahs-14952	481	39	germination	germination	NOUN
ahs-14952	481	40	experiment	experiment	NOUN
ahs-14952	481	41	and	and	CCONJ
ahs-14952	481	42	species	species	NOUN
ahs-14952	481	43	distribution	distribution	NOUN
ahs-14952	481	44	models	model	NOUN
ahs-14952	481	45	.	.	PUNCT
ahs-14952	482	1	­	­	PROPN
ahs-14952	482	2	oecologia	oecologia	PROPN
ahs-14952	482	3	,	,	PUNCT
ahs-14952	482	4	190(2	190(2	NUM
ahs-14952	482	5	):	):	PUNCT
ahs-14952	482	6	411­423	411­423	NUM
ahs-14952	482	7	.	.	PUNCT
ahs-14952	483	1	herrera	herrera	PROPN
ahs-14952	483	2	h.	h.	PROPN
ahs-14952	483	3	,	,	PUNCT
ahs-14952	483	4	valadares	valadare	VERB
ahs-14952	483	5	r.	r.	PROPN
ahs-14952	483	6	,	,	PUNCT
ahs-14952	483	7	contreras	contreras	PROPN
ahs-14952	483	8	d.	d.	PROPN
ahs-14952	483	9	,	,	PUNCT
ahs-14952	483	10	bashan	bashan	PROPN
ahs-14952	483	11	y.	y.	PROPN
ahs-14952	483	12	,	,	PUNCT
ahs-14952	483	13	arriagada	arriagada	PROPN
ahs-14952	483	14	c.	c.	PROPN
ahs-14952	483	15	,	,	PUNCT
ahs-14952	483	16	2017	2017	NUM
ahs-14952	483	17	­	­	NOUN
ahs-14952	483	18	mycorrhizal	mycorrhizal	NOUN
ahs-14952	483	19	compatibility	compatibility	NOUN
ahs-14952	483	20	and	and	CCONJ
ahs-14952	483	21	symbiotic	symbiotic	ADJ
ahs-14952	483	22	seed	seed	NOUN
ahs-14952	483	23	germination	germination	NOUN
ahs-14952	483	24	of	of	ADP
ahs-14952	483	25	orchids	orchid	NOUN
ahs-14952	483	26	from	from	ADP
ahs-14952	483	27	the	the	DET
ahs-14952	483	28	coastal	coastal	ADJ
ahs-14952	483	29	range	range	NOUN
ahs-14952	483	30	and	and	CCONJ
ahs-14952	483	31	andes	andes	PROPN
ahs-14952	483	32	in	in	ADP
ahs-14952	483	33	south	south	PROPN
ahs-14952	483	34	central	central	PROPN
ahs-14952	483	35	chile	chile	PROPN
ahs-14952	483	36	.	.	PUNCT
ahs-14952	484	1	­	­	PROPN
ahs-14952	484	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	484	3	,	,	PUNCT
ahs-14952	484	4	27(3	27(3	NUM
ahs-14952	484	5	):	):	PUNCT
ahs-14952	484	6	175­188	175­188	NUM
ahs-14952	484	7	.	.	PUNCT
ahs-14952	485	1	herrera	herrera	PROPN
ahs-14952	485	2	p.	p.	PROPN
ahs-14952	485	3	,	,	PUNCT
ahs-14952	485	4	suárez	suárez	PROPN
ahs-14952	485	5	j.p	j.p	PROPN
ahs-14952	485	6	.	.	PROPN
ahs-14952	485	7	,	,	PUNCT
ahs-14952	485	8	sánchez­rodríguez	sánchez­rodríguez	NOUN
ahs-14952	485	9	a.	a.	PROPN
ahs-14952	485	10	,	,	PUNCT
ahs-14952	485	11	molina	molina	PROPN
ahs-14952	485	12	m.v.c	m.v.c	PROPN
ahs-14952	485	13	.	.	PROPN
ahs-14952	485	14	,	,	PUNCT
ahs-14952	485	15	prieto	prieto	NOUN
ahs-14952	485	16	m.	m.	NOUN
ahs-14952	485	17	,	,	PUNCT
ahs-14952	485	18	méndez	méndez	NOUN
ahs-14952	485	19	m.	m.	NOUN
ahs-14952	485	20	,	,	PUNCT
ahs-14952	485	21	2019	2019	NUM
ahs-14952	485	22	­	­	AUX
ahs-14952	485	23	many	many	ADJ
ahs-14952	485	24	broadly‐shared	broadly‐share	VERB
ahs-14952	485	25	mycobionts	mycobiont	NOUN
ahs-14952	485	26	characterize	characterize	VERB
ahs-14952	485	27	mycorrhizal	mycorrhizal	NOUN
ahs-14952	485	28	interactions	interaction	NOUN
ahs-14952	485	29	of	of	ADP
ahs-14952	485	30	two	two	NUM
ahs-14952	485	31	coexisting	coexist	VERB
ahs-14952	485	32	epiphytic	epiphytic	ADJ
ahs-14952	485	33	orchids	orchid	NOUN
ahs-14952	485	34	in	in	ADP
ahs-14952	485	35	a	a	DET
ahs-14952	485	36	high	high	ADJ
ahs-14952	485	37	elevation	elevation	NOUN
ahs-14952	485	38	tropical	tropical	ADJ
ahs-14952	485	39	forest	forest	NOUN
ahs-14952	485	40	.	.	PUNCT
ahs-14952	486	1	­	­	VERB
ahs-14952	486	2	fungal	fungal	ADJ
ahs-14952	486	3	ecol	ecol	NOUN
ahs-14952	486	4	.	.	PUNCT
ahs-14952	486	5	,	,	PUNCT
ahs-14952	486	6	39	39	NUM
ahs-14952	486	7	:	:	PUNCT
ahs-14952	486	8	26­36	26­36	NUM
ahs-14952	486	9	.	.	PUNCT
ahs-14952	487	1	hinsley	hinsley	PROPN
ahs-14952	487	2	a.	a.	PROPN
ahs-14952	487	3	,	,	PUNCT
ahs-14952	487	4	de	de	PROPN
ahs-14952	487	5	boer	boer	PROPN
ahs-14952	487	6	h.j	h.j	PROPN
ahs-14952	487	7	.	.	PROPN
ahs-14952	487	8	,	,	PUNCT
ahs-14952	487	9	fay	fay	PROPN
ahs-14952	487	10	m.f	m.f	PROPN
ahs-14952	487	11	.	.	PROPN
ahs-14952	487	12	,	,	PUNCT
ahs-14952	487	13	gale	gale	PROPN
ahs-14952	487	14	s.w	s.w	PROPN
ahs-14952	487	15	.	.	PROPN
ahs-14952	487	16	,	,	PUNCT
ahs-14952	487	17	gardiner	gardiner	PROPN
ahs-14952	487	18	l.m	l.m	PROPN
ahs-14952	487	19	.	.	PROPN
ahs-14952	487	20	,	,	PUNCT
ahs-14952	487	21	gunasekara	gunasekara	PROPN
ahs-14952	487	22	r.s	r.s	PROPN
ahs-14952	487	23	.	.	PROPN
ahs-14952	487	24	,	,	PUNCT
ahs-14952	487	25	kumar	kumar	PROPN
ahs-14952	487	26	p.	p.	PROPN
ahs-14952	487	27	,	,	PUNCT
ahs-14952	487	28	masters	masters	PROPN
ahs-14952	487	29	s.	s.	PROPN
ahs-14952	487	30	,	,	PUNCT
ahs-14952	487	31	metusala	metusala	PROPN
ahs-14952	487	32	d.	d.	PROPN
ahs-14952	487	33	,	,	PUNCT
ahs-14952	487	34	roberts	roberts	PROPN
ahs-14952	487	35	d.l	d.l	PROPN
ahs-14952	487	36	.	.	PROPN
ahs-14952	487	37	,	,	PUNCT
ahs-14952	487	38	veldman	veldman	PROPN
ahs-14952	487	39	s.	s.	PROPN
ahs-14952	487	40	,	,	PUNCT
ahs-14952	487	41	wong	wong	PROPN
ahs-14952	487	42	s.	s.	PROPN
ahs-14952	487	43	,	,	PUNCT
ahs-14952	487	44	phelps	phelps	PROPN
ahs-14952	487	45	j.	j.	PROPN
ahs-14952	487	46	,	,	PUNCT
ahs-14952	487	47	2018	2018	NUM
ahs-14952	487	48	­	­	VERB
ahs-14952	487	49	a	a	DET
ahs-14952	487	50	review	review	NOUN
ahs-14952	487	51	of	of	ADP
ahs-14952	487	52	the	the	DET
ahs-14952	487	53	trade	trade	NOUN
ahs-14952	487	54	in	in	ADP
ahs-14952	487	55	orchids	orchid	NOUN
ahs-14952	487	56	and	and	CCONJ
ahs-14952	487	57	its	its	PRON
ahs-14952	487	58	implications	implication	NOUN
ahs-14952	487	59	for	for	ADP
ahs-14952	487	60	conservation	conservation	NOUN
ahs-14952	487	61	.	.	PUNCT
ahs-14952	488	1	­	­	PROPN
ahs-14952	488	2	bot	bot	PROPN
ahs-14952	488	3	.	.	PUNCT
ahs-14952	489	1	j.	j.	PROPN
ahs-14952	489	2	linn	linn	PROPN
ahs-14952	489	3	.	.	PUNCT
ahs-14952	490	1	soc	soc	PROPN
ahs-14952	490	2	.	.	PUNCT
ahs-14952	490	3	,	,	PUNCT
ahs-14952	490	4	186(4	186(4	NUM
ahs-14952	490	5	):	):	PUNCT
ahs-14952	490	6	435­455	435­455	NUM
ahs-14952	490	7	.	.	PUNCT
ahs-14952	491	1	hong	hong	PROPN
ahs-14952	491	2	i.p	i.p	PROPN
ahs-14952	491	3	.	.	PROPN
ahs-14952	491	4	,	,	PUNCT
ahs-14952	491	5	kim	kim	PROPN
ahs-14952	491	6	h.k	h.k	PROPN
ahs-14952	491	7	.	.	PROPN
ahs-14952	491	8	,	,	PUNCT
ahs-14952	491	9	park	park	PROPN
ahs-14952	491	10	j.s	j.s	PROPN
ahs-14952	491	11	.	.	PROPN
ahs-14952	491	12	,	,	PUNCT
ahs-14952	491	13	kim	kim	PROPN
ahs-14952	491	14	g.p	g.p	PROPN
ahs-14952	491	15	.	.	PROPN
ahs-14952	491	16	,	,	PUNCT
ahs-14952	491	17	lee	lee	PROPN
ahs-14952	491	18	m.w	m.w	PROPN
ahs-14952	491	19	.	.	PROPN
ahs-14952	491	20	,	,	PUNCT
ahs-14952	491	21	guo	guo	PROPN
ahs-14952	491	22	s.x	s.x	PROPN
ahs-14952	491	23	.	.	PROPN
ahs-14952	491	24	,	,	PUNCT
ahs-14952	491	25	2002	2002	NUM
ahs-14952	491	26	­	­	VERB
ahs-14952	491	27	physiological	physiological	ADJ
ahs-14952	491	28	characteristics	characteristic	NOUN
ahs-14952	491	29	of	of	ADP
ahs-14952	491	30	symbiotic	symbiotic	ADJ
ahs-14952	491	31	fungi	fungus	NOUN
ahs-14952	491	32	associated	associate	VERB
ahs-14952	491	33	with	with	ADP
ahs-14952	491	34	the	the	DET
ahs-14952	491	35	seed	seed	NOUN
ahs-14952	491	36	germination	germination	NOUN
ahs-14952	491	37	of	of	ADP
ahs-14952	491	38	gastrodia	gastrodia	NOUN
ahs-14952	491	39	elata	elata	NOUN
ahs-14952	491	40	.	.	PUNCT
ahs-14952	492	1	­	­	PROPN
ahs-14952	492	2	mycobiology	mycobiology	PROPN
ahs-14952	492	3	,	,	PUNCT
ahs-14952	492	4	30(1	30(1	NUM
ahs-14952	492	5	):	):	PUNCT
ahs-14952	492	6	22­26	22­26	PROPN
ahs-14952	492	7	.	.	PUNCT
ahs-14952	493	1	horton	horton	PROPN
ahs-14952	493	2	t.r	t.r	PROPN
ahs-14952	493	3	.	.	PROPN
ahs-14952	493	4	,	,	PUNCT
ahs-14952	493	5	bruns	brun	VERB
ahs-14952	493	6	t.b	t.b	PROPN
ahs-14952	493	7	.	.	PROPN
ahs-14952	493	8	,	,	PUNCT
ahs-14952	493	9	2001	2001	NUM
ahs-14952	493	10	­	­	VERB
ahs-14952	493	11	the	the	DET
ahs-14952	493	12	molecular	molecular	ADJ
ahs-14952	493	13	revolution	revolution	NOUN
ahs-14952	493	14	in	in	ADP
ahs-14952	493	15	ectomycorrhizal	ectomycorrhizal	NOUN
ahs-14952	493	16	ecology	ecology	NOUN
ahs-14952	493	17	:	:	PUNCT
ahs-14952	493	18	peeking	peek	VERB
ahs-14952	493	19	into	into	ADP
ahs-14952	493	20	the	the	DET
ahs-14952	493	21	black‐box	black‐box	NOUN
ahs-14952	493	22	.	.	PUNCT
ahs-14952	494	1	­	­	PROPN
ahs-14952	494	2	mol	mol	PROPN
ahs-14952	494	3	.	.	PUNCT
ahs-14952	494	4	ecol	ecol	PROPN
ahs-14952	494	5	.	.	PUNCT
ahs-14952	494	6	,	,	PUNCT
ahs-14952	494	7	10(8	10(8	NUM
ahs-14952	494	8	):	):	PUNCT
ahs-14952	494	9	1855­1871	1855­1871	NUM
ahs-14952	494	10	.	.	PUNCT
ahs-14952	495	1	hossain	hossain	PROPN
ahs-14952	495	2	m.m	m.m	PROPN
ahs-14952	495	3	.	.	PROPN
ahs-14952	495	4	,	,	PUNCT
ahs-14952	495	5	2019	2019	NUM
ahs-14952	495	6	.	.	PUNCT
ahs-14952	496	1	­	­	PROPN
ahs-14952	496	2	morpho‐molecular	morpho‐molecular	NOUN
ahs-14952	496	3	characterization	characterization	NOUN
ahs-14952	496	4	of	of	ADP
ahs-14952	496	5	ceratobasidium	ceratobasidium	NOUN
ahs-14952	496	6	sp	sp	PROPN
ahs-14952	496	7	.	.	PUNCT
ahs-14952	496	8	:	:	PUNCT
ahs-14952	497	1	a	a	DET
ahs-14952	497	2	mycorrhizal	mycorrhizal	NOUN
ahs-14952	497	3	fungi	fungus	NOUN
ahs-14952	497	4	isolated	isolate	VERB
ahs-14952	497	5	from	from	ADP
ahs-14952	497	6	a	a	DET
ahs-14952	497	7	rare	rare	ADJ
ahs-14952	497	8	epiphytic	epiphytic	ADJ
ahs-14952	497	9	orchid	orchid	NOUN
ahs-14952	497	10	gastrochilus	gastrochilus	NOUN
ahs-14952	497	11	calceolaris	calceolaris	NOUN
ahs-14952	497	12	(	(	PUNCT
ahs-14952	497	13	j.	j.	PROPN
ahs-14952	497	14	e.	e.	PROPN
ahs-14952	497	15	sm	sm	PROPN
ahs-14952	497	16	.	.	PUNCT
ahs-14952	497	17	)	)	PUNCT
ahs-14952	498	1	d.	d.	PROPN
ahs-14952	498	2	don	don	PROPN
ahs-14952	498	3	.	.	PUNCT
ahs-14952	499	1	­	­	PROPN
ahs-14952	499	2	bangladesh	bangladesh	PROPN
ahs-14952	499	3	j.	j.	PROPN
ahs-14952	499	4	plant	plant	PROPN
ahs-14952	499	5	taxon	taxon	PROPN
ahs-14952	499	6	.	.	PUNCT
ahs-14952	499	7	,	,	PUNCT
ahs-14952	499	8	26(2):249­257	26(2):249­257	PROPN
ahs-14952	499	9	.	.	PUNCT
ahs-14952	500	1	hossain	hossain	PROPN
ahs-14952	500	2	m.m	m.m	PROPN
ahs-14952	500	3	.	.	PROPN
ahs-14952	500	4	rahi	rahi	PROPN
ahs-14952	500	5	p.	p.	PROPN
ahs-14952	500	6	,	,	PUNCT
ahs-14952	500	7	gulati	gulati	PROPN
ahs-14952	500	8	a.	a.	PROPN
ahs-14952	500	9	,	,	PUNCT
ahs-14952	500	10	sharma	sharma	PROPN
ahs-14952	500	11	m.	m.	NOUN
ahs-14952	500	12	,	,	PUNCT
ahs-14952	500	13	2013	2013	NUM
ahs-14952	500	14	­	­	AUX
ahs-14952	500	15	improved	improve	VERB
ahs-14952	500	16	ex	ex	X
ahs-14952	500	17	vitro	vitro	X
ahs-14952	500	18	survival	survival	NOUN
ahs-14952	500	19	of	of	ADP
ahs-14952	500	20	asymbiotically	asymbiotically	ADV
ahs-14952	500	21	raised	raise	VERB
ahs-14952	500	22	seedlings	seedling	NOUN
ahs-14952	500	23	of	of	ADP
ahs-14952	500	24	cymbidium	cymbidium	NOUN
ahs-14952	500	25	using	use	VERB
ahs-14952	500	26	mycorrhizal	mycorrhizal	NOUN
ahs-14952	500	27	fungi	fungus	NOUN
ahs-14952	500	28	isolated	isolate	VERB
ahs-14952	500	29	from	from	ADP
ahs-14952	500	30	distant	distant	ADJ
ahs-14952	500	31	orchid	orchid	NOUN
ahs-14952	500	32	taxa	taxa	NOUN
ahs-14952	500	33	.	.	PUNCT
ahs-14952	501	1	­	­	PROPN
ahs-14952	501	2	sci	sci	PROPN
ahs-14952	501	3	.	.	PUNCT
ahs-14952	501	4	hortic	hortic	PROPN
ahs-14952	501	5	.	.	PUNCT
ahs-14952	501	6	,	,	PUNCT
ahs-14952	501	7	159	159	NUM
ahs-14952	501	8	:	:	SYM
ahs-14952	501	9	109­116	109­116	NUM
ahs-14952	501	10	.	.	PUNCT
ahs-14952	502	1	hou	hou	PROPN
ahs-14952	502	2	x.q	x.q	PROPN
ahs-14952	502	3	.	.	PROPN
ahs-14952	502	4	,	,	PUNCT
ahs-14952	502	5	guo	guo	PROPN
ahs-14952	502	6	s.x	s.x	PROPN
ahs-14952	502	7	.	.	PROPN
ahs-14952	502	8	,	,	PUNCT
ahs-14952	502	9	2009	2009	NUM
ahs-14952	502	10	­	­	NOUN
ahs-14952	502	11	interaction	interaction	NOUN
ahs-14952	502	12	between	between	ADP
ahs-14952	502	13	a	a	DET
ahs-14952	502	14	dark	dark	ADJ
ahs-14952	502	15	shamsudin	shamsudin	VERB
ahs-14952	502	16	et	et	PROPN
ahs-14952	502	17	al	al	PROPN
ahs-14952	502	18	.	.	PROPN
ahs-14952	503	1	‐	‐	ADP
ahs-14952	503	2	molecular	molecular	ADJ
ahs-14952	503	3	identification	identification	NOUN
ahs-14952	503	4	of	of	ADP
ahs-14952	503	5	orchid	orchid	NOUN
ahs-14952	503	6	mycorrhiza	mycorrhiza	NOUN
ahs-14952	503	7	113	113	NUM
ahs-14952	503	8	septate	septate	ADJ
ahs-14952	503	9	endophytic	endophytic	ADJ
ahs-14952	503	10	isolate	isolate	NOUN
ahs-14952	503	11	from	from	ADP
ahs-14952	503	12	dendrobium	dendrobium	NOUN
ahs-14952	503	13	sp	sp	NOUN
ahs-14952	503	14	.	.	PROPN
ahs-14952	504	1	and	and	CCONJ
ahs-14952	504	2	roots	root	NOUN
ahs-14952	504	3	of	of	ADP
ahs-14952	504	4	d.	d.	PROPN
ahs-14952	504	5	nobile	nobile	PROPN
ahs-14952	504	6	seedlings	seedling	NOUN
ahs-14952	504	7	.	.	PUNCT
ahs-14952	505	1	­	­	PROPN
ahs-14952	505	2	j.	j.	PROPN
ahs-14952	505	3	integr	integr	PROPN
ahs-14952	505	4	.	.	PUNCT
ahs-14952	506	1	plant	plant	PROPN
ahs-14952	506	2	biol	biol	PROPN
ahs-14952	506	3	.	.	PUNCT
ahs-14952	506	4	,	,	PUNCT
ahs-14952	506	5	51(4	51(4	NUM
ahs-14952	506	6	):	):	PUNCT
ahs-14952	506	7	374­381	374­381	NUM
ahs-14952	506	8	.	.	PUNCT
ahs-14952	507	1	huang	huang	PROPN
ahs-14952	507	2	h.	h.	PROPN
ahs-14952	507	3	,	,	PUNCT
ahs-14952	507	4	zi	zi	PROPN
ahs-14952	507	5	x.m	x.m	PROPN
ahs-14952	507	6	.	.	PROPN
ahs-14952	507	7	,	,	PUNCT
ahs-14952	507	8	lin	lin	PROPN
ahs-14952	507	9	h.	h.	PROPN
ahs-14952	507	10	,	,	PUNCT
ahs-14952	507	11	gao	gao	PROPN
ahs-14952	507	12	y.g	y.g	PROPN
ahs-14952	507	13	.	.	PROPN
ahs-14952	507	14	,	,	PUNCT
ahs-14952	507	15	2018	2018	NUM
ahs-14952	507	16	­	­	NOUN
ahs-14952	507	17	host‐	host‐	NOUN
ahs-14952	507	18	specificity	specificity	NOUN
ahs-14952	507	19	of	of	ADP
ahs-14952	507	20	symbiotic	symbiotic	ADJ
ahs-14952	507	21	mycorrhizal	mycorrhizal	NOUN
ahs-14952	507	22	fungi	fungus	NOUN
ahs-14952	507	23	for	for	ADP
ahs-14952	507	24	enhancing	enhance	VERB
ahs-14952	507	25	seed	seed	NOUN
ahs-14952	507	26	germination	germination	NOUN
ahs-14952	507	27	,	,	PUNCT
ahs-14952	507	28	protocorm	protocorm	NOUN
ahs-14952	507	29	formation	formation	NOUN
ahs-14952	507	30	and	and	CCONJ
ahs-14952	507	31	seedling	seedle	VERB
ahs-14952	507	32	development	development	NOUN
ahs-14952	507	33	of	of	ADP
ahs-14952	507	34	over‐collected	over‐collected	ADJ
ahs-14952	507	35	medicinal	medicinal	ADJ
ahs-14952	507	36	orchid	orchid	NOUN
ahs-14952	507	37	,	,	PUNCT
ahs-14952	507	38	dendrobium	dendrobium	NOUN
ahs-14952	507	39	devonianum	devonianum	NOUN
ahs-14952	507	40	.	.	PUNCT
ahs-14952	508	1	­	­	PROPN
ahs-14952	508	2	j.	j.	PROPN
ahs-14952	508	3	microbiol	microbiol	PROPN
ahs-14952	508	4	.	.	PUNCT
ahs-14952	508	5	,	,	PUNCT
ahs-14952	508	6	56(1	56(1	NUM
ahs-14952	508	7	):	):	PUNCT
ahs-14952	508	8	42­48	42­48	NUM
ahs-14952	508	9	.	.	PUNCT
ahs-14952	509	1	ihrmark	ihrmark	PROPN
ahs-14952	509	2	k.	k.	PROPN
ahs-14952	509	3	,	,	PUNCT
ahs-14952	509	4	bödeker	bödeker	NOUN
ahs-14952	509	5	i.t.m	i.t.m	NOUN
ahs-14952	509	6	.	.	PROPN
ahs-14952	509	7	,	,	PUNCT
ahs-14952	509	8	cruz­martinez	cruz­martinez	PROPN
ahs-14952	509	9	k.	k.	PROPN
ahs-14952	509	10	,	,	PUNCT
ahs-14952	509	11	friberg	friberg	PROPN
ahs-14952	509	12	h.	h.	PROPN
ahs-14952	509	13	,	,	PUNCT
ahs-14952	509	14	kubartova	kubartova	PROPN
ahs-14952	509	15	a.	a.	PROPN
ahs-14952	509	16	,	,	PUNCT
ahs-14952	509	17	schenck	schenck	PROPN
ahs-14952	509	18	j.	j.	PROPN
ahs-14952	509	19	,	,	PUNCT
ahs-14952	509	20	strid	strid	PROPN
ahs-14952	509	21	y.	y.	PROPN
ahs-14952	509	22	,	,	PUNCT
ahs-14952	509	23	stenlid	stenlid	PROPN
ahs-14952	509	24	j.	j.	PROPN
ahs-14952	509	25	,	,	PUNCT
ahs-14952	509	26	brandström	brandström	PROPN
ahs-14952	509	27	durling	durle	VERB
ahs-14952	509	28	m.	m.	NOUN
ahs-14952	509	29	,	,	PUNCT
ahs-14952	509	30	clemmensen	clemmensen	PROPN
ahs-14952	509	31	k.e	k.e	PROPN
ahs-14952	509	32	.	.	PROPN
ahs-14952	509	33	,	,	PUNCT
ahs-14952	509	34	lindahl	lindahl	PROPN
ahs-14952	509	35	b.j	b.j	PROPN
ahs-14952	509	36	.	.	PROPN
ahs-14952	509	37	,	,	PUNCT
ahs-14952	509	38	2012	2012	NUM
ahs-14952	509	39	­	­	VERB
ahs-14952	509	40	new	new	ADJ
ahs-14952	509	41	primers	primer	NOUN
ahs-14952	509	42	to	to	PART
ahs-14952	509	43	amplify	amplify	VERB
ahs-14952	509	44	the	the	DET
ahs-14952	509	45	fungal	fungal	ADJ
ahs-14952	509	46	its2	its2	NOUN
ahs-14952	509	47	region	region	NOUN
ahs-14952	509	48	‐	‐	ADJ
ahs-14952	509	49	evaluation	evaluation	NOUN
ahs-14952	509	50	by	by	ADP
ahs-14952	509	51	454‐sequencing	454‐sequencing	PROPN
ahs-14952	509	52	of	of	ADP
ahs-14952	509	53	artificial	artificial	ADJ
ahs-14952	509	54	and	and	CCONJ
ahs-14952	509	55	natural	natural	ADJ
ahs-14952	509	56	communities	community	NOUN
ahs-14952	509	57	.	.	PUNCT
ahs-14952	510	1	­	­	PROPN
ahs-14952	510	2	fems	fems	PROPN
ahs-14952	510	3	microbiol	microbiol	PROPN
ahs-14952	510	4	.	.	PUNCT
ahs-14952	511	1	ecol	ecol	PROPN
ahs-14952	511	2	.	.	PUNCT
ahs-14952	511	3	,	,	PUNCT
ahs-14952	511	4	82(3	82(3	NUM
ahs-14952	511	5	):	):	PUNCT
ahs-14952	511	6	666­677	666­677	PROPN
ahs-14952	511	7	.	.	PUNCT
ahs-14952	511	8	iucn	iucn	PROPN
ahs-14952	511	9	,	,	PUNCT
ahs-14952	511	10	2021	2021	NUM
ahs-14952	511	11	­	­	VERB
ahs-14952	511	12	the	the	DET
ahs-14952	511	13	iucn	iucn	PROPN
ahs-14952	511	14	red	red	ADJ
ahs-14952	511	15	list	list	NOUN
ahs-14952	511	16	of	of	ADP
ahs-14952	511	17	threatened	threatened	ADJ
ahs-14952	511	18	species	specie	NOUN
ahs-14952	511	19	,	,	PUNCT
ahs-14952	511	20	version	version	NOUN
ahs-14952	511	21	2021‐1	2021‐1	NUM
ahs-14952	511	22	.	.	PUNCT
ahs-14952	512	1	­	­	PROPN
ahs-14952	512	2	www.iucnredlist.org	www.iucnredlist.org	NUM
ahs-14952	512	3	.	.	PUNCT
ahs-14952	513	1	jacquemyn	jacquemyn	PROPN
ahs-14952	513	2	h.	h.	PROPN
ahs-14952	513	3	,	,	PUNCT
ahs-14952	513	4	honnay	honnay	PROPN
ahs-14952	513	5	o.	o.	PROPN
ahs-14952	513	6	,	,	PUNCT
ahs-14952	513	7	cammue	cammue	VERB
ahs-14952	513	8	b.p.a	b.p.a	NOUN
ahs-14952	513	9	.	.	PUNCT
ahs-14952	513	10	,	,	PUNCT
ahs-14952	513	11	brys	brys	ADP
ahs-14952	513	12	r.	r.	PROPN
ahs-14952	513	13	,	,	PUNCT
ahs-14952	513	14	lievens	lievens	PROPN
ahs-14952	513	15	r.	r.	PROPN
ahs-14952	513	16	,	,	PUNCT
ahs-14952	513	17	2010	2010	NUM
ahs-14952	513	18	­	­	VERB
ahs-14952	513	19	low	low	ADJ
ahs-14952	513	20	specificity	specificity	NOUN
ahs-14952	513	21	and	and	CCONJ
ahs-14952	513	22	nested	nest	VERB
ahs-14952	513	23	subset	subset	NOUN
ahs-14952	513	24	structure	structure	NOUN
ahs-14952	513	25	characterize	characterize	VERB
ahs-14952	513	26	mycorrhizal	mycorrhizal	NOUN
ahs-14952	513	27	associations	association	NOUN
ahs-14952	513	28	in	in	ADP
ahs-14952	513	29	five	five	NUM
ahs-14952	513	30	closely	closely	ADV
ahs-14952	513	31	related	relate	VERB
ahs-14952	513	32	species	specie	NOUN
ahs-14952	513	33	of	of	ADP
ahs-14952	513	34	the	the	DET
ahs-14952	513	35	genus	genus	NOUN
ahs-14952	513	36	orchis	orchis	NOUN
ahs-14952	513	37	.	.	PUNCT
ahs-14952	514	1	­	­	PROPN
ahs-14952	514	2	mol	mol	PROPN
ahs-14952	514	3	.	.	PUNCT
ahs-14952	514	4	ecol	ecol	PROPN
ahs-14952	514	5	.	.	PUNCT
ahs-14952	514	6	,	,	PUNCT
ahs-14952	514	7	19(18	19(18	NUM
ahs-14952	514	8	):	):	PUNCT
ahs-14952	514	9	4086­4095	4086­4095	NUM
ahs-14952	514	10	.	.	PUNCT
ahs-14952	515	1	janowski	janowski	PROPN
ahs-14952	515	2	d.	d.	PROPN
ahs-14952	515	3	,	,	PUNCT
ahs-14952	515	4	wilgan	wilgan	PROPN
ahs-14952	515	5	r.	r.	PROPN
ahs-14952	515	6	,	,	PUNCT
ahs-14952	515	7	leski	leski	PROPN
ahs-14952	515	8	t.	t.	PROPN
ahs-14952	515	9	,	,	PUNCT
ahs-14952	515	10	karlinski	karlinski	PROPN
ahs-14952	515	11	l.	l.	PROPN
ahs-14952	515	12	,	,	PUNCT
ahs-14952	515	13	rudawska	rudawska	NOUN
ahs-14952	515	14	m.	m.	NOUN
ahs-14952	515	15	,	,	PUNCT
ahs-14952	515	16	2019	2019	NUM
ahs-14952	515	17	­	­	VERB
ahs-14952	515	18	effective	effective	ADJ
ahs-14952	515	19	molecular	molecular	ADJ
ahs-14952	515	20	identification	identification	NOUN
ahs-14952	515	21	of	of	ADP
ahs-14952	515	22	ectomycorrhizal	ectomycorrhizal	NOUN
ahs-14952	515	23	fungi	fungus	NOUN
ahs-14952	515	24	:	:	PUNCT
ahs-14952	515	25	revisiting	revisit	VERB
ahs-14952	515	26	dna	dna	NOUN
ahs-14952	515	27	isolation	isolation	NOUN
ahs-14952	515	28	methods	method	NOUN
ahs-14952	515	29	.	.	PUNCT
ahs-14952	516	1	­	­	NOUN
ahs-14952	516	2	forests	forest	NOUN
ahs-14952	516	3	,	,	PUNCT
ahs-14952	516	4	10(3	10(3	NUM
ahs-14952	516	5	):	):	PUNCT
ahs-14952	516	6	1­10	1­10	NUM
ahs-14952	516	7	.	.	PUNCT
ahs-14952	517	1	jędryczka	jędryczka	PROPN
ahs-14952	517	2	e.	e.	PROPN
ahs-14952	517	3	,	,	PUNCT
ahs-14952	517	4	hendel	hendel	PROPN
ahs-14952	517	5	p.	p.	PROPN
ahs-14952	517	6	,	,	PUNCT
ahs-14952	517	7	nabrdalik	nabrdalik	PROPN
ahs-14952	517	8	m.	m.	NOUN
ahs-14952	517	9	,	,	PUNCT
ahs-14952	517	10	2023	2023	NUM
ahs-14952	517	11	­	­	PROPN
ahs-14952	517	12	rhizoctonia	rhizoctonia	PROPN
ahs-14952	517	13	spp	spp	PROPN
ahs-14952	517	14	.	.	PUNCT
ahs-14952	518	1	as	as	ADP
ahs-14952	518	2	beneficial	beneficial	ADJ
ahs-14952	518	3	and	and	CCONJ
ahs-14952	518	4	mycorrhizal	mycorrhizal	NOUN
ahs-14952	518	5	fungi	fungus	NOUN
ahs-14952	518	6	,	,	PUNCT
ahs-14952	518	7	pp	pp	X
ahs-14952	518	8	.	.	PUNCT
ahs-14952	519	1	213­220	213­220	X
ahs-14952	519	2	.	.	PUNCT
ahs-14952	520	1	­	­	VERB
ahs-14952	520	2	in	in	ADP
ahs-14952	520	3	:	:	PUNCT
ahs-14952	520	4	sharma	sharma	PROPN
ahs-14952	520	5	v.	v.	PROPN
ahs-14952	520	6	,	,	PUNCT
ahs-14952	520	7	r.	r.	PROPN
ahs-14952	520	8	salwan	salwan	PROPN
ahs-14952	520	9	,	,	PUNCT
ahs-14952	520	10	e.	e.	PROPN
ahs-14952	520	11	moliszewska	moliszewska	PROPN
ahs-14952	520	12	,	,	PUNCT
ahs-14952	520	13	d.	d.	PROPN
ahs-14952	520	14	ruano	ruano	PROPN
ahs-14952	520	15	rosa	rosa	PROPN
ahs-14952	520	16	,	,	PUNCT
ahs-14952	520	17	and	and	CCONJ
ahs-14952	520	18	m.	m.	NOUN
ahs-14952	520	19	jedryczka	jedryczka	PROPN
ahs-14952	520	20	(	(	PUNCT
ahs-14952	520	21	eds	eds	PROPN
ahs-14952	520	22	.	.	PUNCT
ahs-14952	520	23	)	)	PUNCT
ahs-14952	521	1	the	the	DET
ahs-14952	521	2	chemical	chemical	ADJ
ahs-14952	521	3	dialogue	dialogue	NOUN
ahs-14952	521	4	between	between	ADP
ahs-14952	521	5	plants	plant	NOUN
ahs-14952	521	6	and	and	CCONJ
ahs-14952	521	7	beneficial	beneficial	ADJ
ahs-14952	521	8	microorganisms	microorganism	NOUN
ahs-14952	521	9	.	.	PUNCT
ahs-14952	522	1	academic	academic	ADJ
ahs-14952	522	2	press	press	PROPN
ahs-14952	522	3	,	,	PUNCT
ahs-14952	522	4	london	london	PROPN
ahs-14952	522	5	,	,	PUNCT
ahs-14952	522	6	uk	uk	PROPN
ahs-14952	522	7	,	,	PUNCT
ahs-14952	522	8	pp	pp	ADJ
ahs-14952	522	9	.	.	PUNCT
ahs-14952	523	1	365	365	NUM
ahs-14952	523	2	.	.	PUNCT
ahs-14952	524	1	jiang	jiang	PROPN
ahs-14952	524	2	y.x	y.x	PROPN
ahs-14952	524	3	.	.	PROPN
ahs-14952	524	4	,	,	PUNCT
ahs-14952	525	1	wu	wu	PROPN
ahs-14952	525	2	j.g	j.g	PROPN
ahs-14952	525	3	.	.	PROPN
ahs-14952	525	4	,	,	PUNCT
ahs-14952	525	5	yu	yu	PROPN
ahs-14952	525	6	k.q	k.q	PROPN
ahs-14952	525	7	.	.	PROPN
ahs-14952	525	8	,	,	PUNCT
ahs-14952	525	9	ai	ai	VERB
ahs-14952	525	10	c.x	c.x	PROPN
ahs-14952	525	11	.	.	PROPN
ahs-14952	525	12	,	,	PUNCT
ahs-14952	525	13	zou	zou	PROPN
ahs-14952	525	14	f.	f.	PROPN
ahs-14952	525	15	,	,	PUNCT
ahs-14952	526	1	zhou	zhou	PROPN
ahs-14952	526	2	h.w	h.w	PROPN
ahs-14952	526	3	.	.	PROPN
ahs-14952	526	4	,	,	PUNCT
ahs-14952	526	5	2011	2011	NUM
ahs-14952	526	6	­	­	NUM
ahs-14952	526	7	integrated	integrate	VERB
ahs-14952	526	8	lysis	lysis	NOUN
ahs-14952	526	9	procedures	procedure	NOUN
ahs-14952	526	10	reduce	reduce	VERB
ahs-14952	526	11	extraction	extraction	NOUN
ahs-14952	526	12	biases	bias	NOUN
ahs-14952	526	13	of	of	ADP
ahs-14952	526	14	microbial	microbial	ADJ
ahs-14952	526	15	dna	dna	NOUN
ahs-14952	526	16	from	from	ADP
ahs-14952	526	17	mangrove	mangrove	PROPN
ahs-14952	526	18	sediment	sediment	NOUN
ahs-14952	526	19	.	.	PUNCT
ahs-14952	527	1	­	­	PROPN
ahs-14952	527	2	j.	j.	PROPN
ahs-14952	527	3	biosci	biosci	PROPN
ahs-14952	527	4	.	.	PUNCT
ahs-14952	528	1	bioeng	bioeng	PROPN
ahs-14952	528	2	.	.	PROPN
ahs-14952	528	3	,	,	PUNCT
ahs-14952	528	4	111(2	111(2	NUM
ahs-14952	528	5	):	):	PUNCT
ahs-14952	528	6	153­157	153­157	NUM
ahs-14952	528	7	.	.	PUNCT
ahs-14952	529	1	jianrong	jianrong	PROPN
ahs-14952	529	2	w.	w.	PROPN
ahs-14952	529	3	,	,	PUNCT
ahs-14952	529	4	sufen	sufen	PROPN
ahs-14952	529	5	h.	h.	PROPN
ahs-14952	529	6	,	,	PUNCT
ahs-14952	529	7	youyong	youyong	PROPN
ahs-14952	529	8	z.	z.	PROPN
ahs-14952	529	9	,	,	PUNCT
ahs-14952	529	10	mei	mei	PROPN
ahs-14952	529	11	l.	l.	PROPN
ahs-14952	529	12	,	,	PUNCT
ahs-14952	529	13	guangping	guangpe	VERB
ahs-14952	529	14	w.	w.	PROPN
ahs-14952	529	15	,	,	PUNCT
ahs-14952	529	16	wenlin	wenlin	PROPN
ahs-14952	529	17	g.	g.	PROPN
ahs-14952	529	18	,	,	PUNCT
ahs-14952	529	19	2005	2005	NUM
ahs-14952	529	20	­	­	AUX
ahs-14952	529	21	ultra‐structure	ultra‐structure	NOUN
ahs-14952	529	22	of	of	ADP
ahs-14952	529	23	symbiosis	symbiosis	NOUN
ahs-14952	529	24	mycorrhizal	mycorrhizal	NOUN
ahs-14952	529	25	between	between	ADP
ahs-14952	529	26	cymbidium	cymbidium	NOUN
ahs-14952	529	27	goeringii	goeringii	NOUN
ahs-14952	529	28	and	and	CCONJ
ahs-14952	529	29	rhizoctonia	rhizoctonia	PROPN
ahs-14952	529	30	sp	sp	PROPN
ahs-14952	529	31	.	.	PROPN
ahs-14952	529	32	­	­	PROPN
ahs-14952	529	33	j.	j.	PROPN
ahs-14952	529	34	nanjing	nanjing	PROPN
ahs-14952	529	35	for	for	ADP
ahs-14952	529	36	.	.	PUNCT
ahs-14952	530	1	univ	univ	PROPN
ahs-14952	530	2	.	.	PROPN
ahs-14952	530	3	,	,	PUNCT
ahs-14952	530	4	29(4	29(4	NOUN
ahs-14952	530	5	):	):	PUNCT
ahs-14952	530	6	105­	105­	NUM
ahs-14952	530	7	108	108	NUM
ahs-14952	530	8	.	.	PUNCT
ahs-14952	531	1	johnson	johnson	PROPN
ahs-14952	531	2	l.j	l.j	PROPN
ahs-14952	531	3	.	.	PROPN
ahs-14952	531	4	,	,	PUNCT
ahs-14952	531	5	gónzalez­chávez	gónzalez­chávez	PROPN
ahs-14952	531	6	m.d.c.a	m.d.c.a	PROPN
ahs-14952	531	7	.	.	PROPN
ahs-14952	531	8	,	,	PUNCT
ahs-14952	531	9	carrillo­	carrillo­	PROPN
ahs-14952	531	10	gonzález	gonzález	PROPN
ahs-14952	531	11	r.	r.	PROPN
ahs-14952	531	12	,	,	PUNCT
ahs-14952	531	13	porras­alfaro	porras­alfaro	NOUN
ahs-14952	531	14	a.	a.	PROPN
ahs-14952	531	15	,	,	PUNCT
ahs-14952	531	16	mueller	mueller	PROPN
ahs-14952	531	17	g.m	g.m	PROPN
ahs-14952	531	18	.	.	PROPN
ahs-14952	531	19	,	,	PUNCT
ahs-14952	531	20	2021	2021	NUM
ahs-14952	531	21	­	­	VERB
ahs-14952	531	22	vanilla	vanilla	NOUN
ahs-14952	531	23	aerial	aerial	ADJ
ahs-14952	531	24	and	and	CCONJ
ahs-14952	531	25	terrestrial	terrestrial	ADJ
ahs-14952	531	26	roots	root	NOUN
ahs-14952	531	27	host	host	VERB
ahs-14952	531	28	rich	rich	ADJ
ahs-14952	531	29	communities	community	NOUN
ahs-14952	531	30	of	of	ADP
ahs-14952	531	31	orchid	orchid	NOUN
ahs-14952	531	32	mycorrhizal	mycorrhizal	NOUN
ahs-14952	531	33	and	and	CCONJ
ahs-14952	531	34	ectomycorrhizal	ectomycorrhizal	NOUN
ahs-14952	531	35	fungi	fungus	NOUN
ahs-14952	531	36	.	.	PUNCT
ahs-14952	532	1	­	­	NOUN
ahs-14952	532	2	plants	plant	NOUN
ahs-14952	532	3	,	,	PUNCT
ahs-14952	532	4	people	people	NOUN
ahs-14952	532	5	,	,	PUNCT
ahs-14952	532	6	planet	planet	NOUN
ahs-14952	532	7	,	,	PUNCT
ahs-14952	532	8	3(5	3(5	NUM
ahs-14952	532	9	):	):	PUNCT
ahs-14952	532	10	541­552	541­552	NUM
ahs-14952	532	11	.	.	PUNCT
ahs-14952	532	12	julou	julou	PROPN
ahs-14952	532	13	t.	t.	PROPN
ahs-14952	532	14	,	,	PUNCT
ahs-14952	532	15	burghardt	burghardt	PROPN
ahs-14952	532	16	b.	b.	PROPN
ahs-14952	532	17	,	,	PUNCT
ahs-14952	532	18	gebauer	gebauer	PROPN
ahs-14952	532	19	g.	g.	PROPN
ahs-14952	532	20	,	,	PUNCT
ahs-14952	532	21	berveiller	berveiller	PROPN
ahs-14952	532	22	b.	b.	PROPN
ahs-14952	532	23	,	,	PUNCT
ahs-14952	532	24	damesin	damesin	PROPN
ahs-14952	532	25	c.	c.	PROPN
ahs-14952	532	26	,	,	PUNCT
ahs-14952	532	27	selosse	selosse	PROPN
ahs-14952	532	28	m.	m.	PROPN
ahs-14952	532	29	a.	a.	PROPN
ahs-14952	532	30	,	,	PUNCT
ahs-14952	532	31	2005	2005	NUM
ahs-14952	532	32	­	­	VERB
ahs-14952	532	33	mixotrophy	mixotrophy	NOUN
ahs-14952	532	34	in	in	ADP
ahs-14952	532	35	orchids	orchid	NOUN
ahs-14952	532	36	:	:	PUNCT
ahs-14952	532	37	insights	insight	NOUN
ahs-14952	532	38	from	from	ADP
ahs-14952	532	39	a	a	DET
ahs-14952	532	40	comparative	comparative	ADJ
ahs-14952	532	41	study	study	NOUN
ahs-14952	532	42	of	of	ADP
ahs-14952	532	43	green	green	ADJ
ahs-14952	532	44	individuals	individual	NOUN
ahs-14952	532	45	and	and	CCONJ
ahs-14952	532	46	nonphotosynthetic	nonphotosynthetic	ADJ
ahs-14952	532	47	individuals	individual	NOUN
ahs-14952	532	48	of	of	ADP
ahs-14952	532	49	cephalanthera	cephalanthera	NOUN
ahs-14952	532	50	damasonium	damasonium	NOUN
ahs-14952	532	51	.	.	PUNCT
ahs-14952	533	1	­	­	VERB
ahs-14952	533	2	new	new	ADJ
ahs-14952	533	3	phytol	phytol	NOUN
ahs-14952	533	4	.	.	PUNCT
ahs-14952	533	5	,	,	PUNCT
ahs-14952	533	6	166(2	166(2	NUM
ahs-14952	533	7	):	):	PUNCT
ahs-14952	533	8	639­653	639­653	NOUN
ahs-14952	533	9	.	.	PUNCT
ahs-14952	534	1	khamchatra	khamchatra	PROPN
ahs-14952	534	2	n.	n.	PROPN
ahs-14952	534	3	,	,	PUNCT
ahs-14952	534	4	dixon	dixon	PROPN
ahs-14952	534	5	k.w	k.w	PROPN
ahs-14952	534	6	.	.	PROPN
ahs-14952	534	7	,	,	PUNCT
ahs-14952	534	8	tantiwiwat	tantiwiwat	PROPN
ahs-14952	534	9	s.	s.	PROPN
ahs-14952	534	10	,	,	PUNCT
ahs-14952	534	11	piapukiew	piapukiew	PROPN
ahs-14952	534	12	j.	j.	PROPN
ahs-14952	534	13	,	,	PUNCT
ahs-14952	534	14	2016	2016	NUM
ahs-14952	534	15	­	­	NUM
ahs-14952	534	16	symbiotic	symbiotic	ADJ
ahs-14952	534	17	seed	seed	NOUN
ahs-14952	534	18	germination	germination	NOUN
ahs-14952	534	19	of	of	ADP
ahs-14952	534	20	an	an	DET
ahs-14952	534	21	endangered	endangered	ADJ
ahs-14952	534	22	epiphytic	epiphytic	ADJ
ahs-14952	534	23	slipper	slipper	NOUN
ahs-14952	534	24	orchid	orchid	NOUN
ahs-14952	534	25	,	,	PUNCT
ahs-14952	534	26	paphiopedilum	paphiopedilum	NOUN
ahs-14952	534	27	villosum	villosum	NOUN
ahs-14952	534	28	(	(	PUNCT
ahs-14952	534	29	lindl	lindl	PROPN
ahs-14952	534	30	.	.	PUNCT
ahs-14952	534	31	)	)	PUNCT
ahs-14952	535	1	stein	stein	PROPN
ahs-14952	535	2	.	.	PUNCT
ahs-14952	536	1	from	from	ADP
ahs-14952	536	2	thailand	thailand	PROPN
ahs-14952	536	3	.	.	PUNCT
ahs-14952	537	1	­	­	PROPN
ahs-14952	537	2	s.	s.	PROPN
ahs-14952	537	3	afr	afr	PROPN
ahs-14952	537	4	.	.	PUNCT
ahs-14952	538	1	j.	j.	PROPN
ahs-14952	538	2	bot	bot	PROPN
ahs-14952	538	3	.	.	PUNCT
ahs-14952	538	4	,	,	PUNCT
ahs-14952	539	1	104	104	NUM
ahs-14952	539	2	:	:	PUNCT
ahs-14952	539	3	76­81	76­81	X
ahs-14952	539	4	.	.	PUNCT
ahs-14952	540	1	kim	kim	PROPN
ahs-14952	540	2	y.i	y.i	PROPN
ahs-14952	540	3	.	.	PROPN
ahs-14952	540	4	,	,	PUNCT
ahs-14952	540	5	chang	chang	PROPN
ahs-14952	540	6	k.j	k.j	PROPN
ahs-14952	540	7	.	.	PROPN
ahs-14952	540	8	,	,	PUNCT
ahs-14952	540	9	ka	ka	PROPN
ahs-14952	540	10	k.h	k.h	PROPN
ahs-14952	540	11	.	.	PROPN
ahs-14952	540	12	,	,	PUNCT
ahs-14952	540	13	hur	hur	PROPN
ahs-14952	540	14	h.	h.	PROPN
ahs-14952	540	15	,	,	PUNCT
ahs-14952	540	16	hong	hong	PROPN
ahs-14952	540	17	i.p	i.p	PROPN
ahs-14952	540	18	.	.	PROPN
ahs-14952	540	19	,	,	PUNCT
ahs-14952	540	20	shim	shim	NOUN
ahs-14952	540	21	j.o	j.o	PROPN
ahs-14952	540	22	.	.	PROPN
ahs-14952	540	23	,	,	PUNCT
ahs-14952	540	24	lee	lee	PROPN
ahs-14952	540	25	t.s	t.s	PROPN
ahs-14952	540	26	.	.	PROPN
ahs-14952	540	27	,	,	PUNCT
ahs-14952	540	28	lee	lee	PROPN
ahs-14952	540	29	j.y	j.y	PROPN
ahs-14952	540	30	.	.	PROPN
ahs-14952	540	31	,	,	PUNCT
ahs-14952	540	32	lee	lee	PROPN
ahs-14952	540	33	m.w	m.w	PROPN
ahs-14952	540	34	.	.	PROPN
ahs-14952	540	35	,	,	PUNCT
ahs-14952	540	36	2006	2006	NUM
ahs-14952	540	37	‐	‐	ADJ
ahs-14952	540	38	seed	seed	NOUN
ahs-14952	540	39	germination	germination	NOUN
ahs-14952	540	40	of	of	ADP
ahs-14952	540	41	gastrodia	gastrodia	NOUN
ahs-14952	540	42	elata	elata	NOUN
ahs-14952	540	43	using	use	VERB
ahs-14952	540	44	symbiotic	symbiotic	ADJ
ahs-14952	540	45	fungi	fungi	PROPN
ahs-14952	540	46	,	,	PUNCT
ahs-14952	540	47	mycena	mycena	NOUN
ahs-14952	540	48	osmundicola	osmundicola	ADJ
ahs-14952	540	49	.	.	PUNCT
ahs-14952	541	1	­	­	PROPN
ahs-14952	541	2	mycobiology	mycobiology	PROPN
ahs-14952	541	3	,	,	PUNCT
ahs-14952	541	4	34(2	34(2	NUM
ahs-14952	541	5	):	):	PUNCT
ahs-14952	541	6	79	79	NUM
ahs-14952	541	7	.	.	PUNCT
ahs-14952	542	1	ko	ko	PROPN
ahs-14952	542	2	t.w.k	t.w.k	PROPN
ahs-14952	542	3	.	.	PUNCT
ahs-14952	542	4	,	,	PUNCT
ahs-14952	542	5	stephenson	stephenson	PROPN
ahs-14952	542	6	s.l	s.l	PROPN
ahs-14952	542	7	.	.	PROPN
ahs-14952	542	8	,	,	PUNCT
ahs-14952	542	9	bahkali	bahkali	VERB
ahs-14952	542	10	a.h	a.h	PROPN
ahs-14952	542	11	.	.	PROPN
ahs-14952	542	12	,	,	PUNCT
ahs-14952	542	13	hyde	hyde	PROPN
ahs-14952	542	14	k.d	k.d	PROPN
ahs-14952	542	15	.	.	PROPN
ahs-14952	542	16	,	,	PUNCT
ahs-14952	542	17	2011	2011	NUM
ahs-14952	542	18	­	­	VERB
ahs-14952	542	19	from	from	ADP
ahs-14952	542	20	morphology	morphology	NOUN
ahs-14952	542	21	to	to	ADP
ahs-14952	542	22	molecular	molecular	ADJ
ahs-14952	542	23	biology	biology	NOUN
ahs-14952	542	24	:	:	PUNCT
ahs-14952	542	25	can	can	AUX
ahs-14952	542	26	we	we	PRON
ahs-14952	542	27	use	use	VERB
ahs-14952	542	28	sequence	sequence	NOUN
ahs-14952	542	29	data	datum	NOUN
ahs-14952	542	30	to	to	PART
ahs-14952	542	31	identify	identify	VERB
ahs-14952	542	32	fungal	fungal	ADJ
ahs-14952	542	33	endophytes	endophyte	NOUN
ahs-14952	542	34	?	?	PUNCT
ahs-14952	543	1	­	­	VERB
ahs-14952	543	2	fungal	fungal	ADJ
ahs-14952	543	3	divers	diver	NOUN
ahs-14952	543	4	.	.	PUNCT
ahs-14952	543	5	,	,	PUNCT
ahs-14952	543	6	50	50	NUM
ahs-14952	543	7	113­120	113­120	NUM
ahs-14952	543	8	.	.	PUNCT
ahs-14952	544	1	kumar	kumar	PROPN
ahs-14952	544	2	m.	m.	PROPN
ahs-14952	544	3	,	,	PUNCT
ahs-14952	544	4	mugunthan	mugunthan	NOUN
ahs-14952	544	5	m.	m.	NOUN
ahs-14952	544	6	,	,	PUNCT
ahs-14952	544	7	2018	2018	NUM
ahs-14952	544	8	­	­	NUM
ahs-14952	544	9	evaluation	evaluation	NOUN
ahs-14952	544	10	of	of	ADP
ahs-14952	544	11	three	three	NUM
ahs-14952	544	12	dna	dna	NOUN
ahs-14952	544	13	extraction	extraction	NOUN
ahs-14952	544	14	methods	method	NOUN
ahs-14952	544	15	from	from	ADP
ahs-14952	544	16	fungal	fungal	ADJ
ahs-14952	544	17	cultures	culture	NOUN
ahs-14952	544	18	.	.	PUNCT
ahs-14952	545	1	­	­	PROPN
ahs-14952	545	2	mjafi	mjafi	PROPN
ahs-14952	545	3	.	.	PUNCT
ahs-14952	546	1	,	,	PUNCT
ahs-14952	546	2	74(4	74(4	NUM
ahs-14952	546	3	):	):	PUNCT
ahs-14952	546	4	333­336	333­336	NUM
ahs-14952	546	5	.	.	PUNCT
ahs-14952	547	1	lee	lee	PROPN
ahs-14952	547	2	y.i	y.i	PROPN
ahs-14952	547	3	.	.	PROPN
ahs-14952	547	4	,	,	PUNCT
ahs-14952	547	5	yeung	yeung	PROPN
ahs-14952	547	6	e.c	e.c	PROPN
ahs-14952	547	7	.	.	PROPN
ahs-14952	547	8	,	,	PUNCT
ahs-14952	547	9	2018	2018	NUM
ahs-14952	547	10	­	­	VERB
ahs-14952	547	11	orchid	orchid	NOUN
ahs-14952	547	12	propagation	propagation	NOUN
ahs-14952	547	13	:	:	PUNCT
ahs-14952	547	14	from	from	ADP
ahs-14952	547	15	laboratories	laboratory	NOUN
ahs-14952	547	16	to	to	PART
ahs-14952	547	17	greenhouses	greenhouse	VERB
ahs-14952	547	18	‐	‐	ADJ
ahs-14952	547	19	methods	method	NOUN
ahs-14952	547	20	and	and	CCONJ
ahs-14952	547	21	protocols	protocol	NOUN
ahs-14952	547	22	.	.	PUNCT
ahs-14952	548	1	­	­	PROPN
ahs-14952	548	2	springer	springer	PROPN
ahs-14952	548	3	,	,	PUNCT
ahs-14952	548	4	new	new	PROPN
ahs-14952	548	5	york	york	PROPN
ahs-14952	548	6	,	,	PUNCT
ahs-14952	548	7	pp	pp	X
ahs-14952	548	8	.	.	PUNCT
ahs-14952	549	1	535	535	NUM
ahs-14952	549	2	.	.	PUNCT
ahs-14952	550	1	li	li	PROPN
ahs-14952	550	2	t.	t.	PROPN
ahs-14952	550	3	,	,	PUNCT
ahs-14952	550	4	wu	wu	PROPN
ahs-14952	550	5	s.	s.	PROPN
ahs-14952	550	6	,	,	PUNCT
ahs-14952	550	7	yang	yang	PROPN
ahs-14952	550	8	w.	w.	PROPN
ahs-14952	550	9	,	,	PUNCT
ahs-14952	550	10	selosse	selosse	PROPN
ahs-14952	550	11	m.a	m.a	PROPN
ahs-14952	550	12	.	.	PROPN
ahs-14952	550	13	,	,	PUNCT
ahs-14952	550	14	gao	gao	PROPN
ahs-14952	550	15	j.	j.	PROPN
ahs-14952	550	16	,	,	PUNCT
ahs-14952	550	17	2021	2021	NUM
ahs-14952	550	18	­	­	VERB
ahs-14952	550	19	how	how	SCONJ
ahs-14952	550	20	mycorrhizal	mycorrhizal	NOUN
ahs-14952	550	21	associations	association	NOUN
ahs-14952	550	22	influence	influence	VERB
ahs-14952	550	23	orchid	orchid	NOUN
ahs-14952	550	24	distribution	distribution	NOUN
ahs-14952	550	25	and	and	CCONJ
ahs-14952	550	26	population	population	NOUN
ahs-14952	550	27	dynamics	dynamic	NOUN
ahs-14952	550	28	.	.	PUNCT
ahs-14952	551	1	­	­	PROPN
ahs-14952	551	2	front	front	ADJ
ahs-14952	551	3	.	.	PUNCT
ahs-14952	552	1	plant	plant	NOUN
ahs-14952	552	2	sci	sci	PROPN
ahs-14952	552	3	.	.	PROPN
ahs-14952	552	4	,	,	PUNCT
ahs-14952	552	5	12	12	NUM
ahs-14952	552	6	:	:	SYM
ahs-14952	552	7	647114	647114	NUM
ahs-14952	552	8	.	.	PUNCT
ahs-14952	553	1	liu	liu	PROPN
ahs-14952	553	2	h.	h.	PROPN
ahs-14952	553	3	,	,	PUNCT
ahs-14952	553	4	lu	lu	PROPN
ahs-14952	553	5	y.	y.	PROPN
ahs-14952	553	6	,	,	PUNCT
ahs-14952	553	7	liu	liu	PROPN
ahs-14952	553	8	h.	h.	PROPN
ahs-14952	553	9	,	,	PUNCT
ahs-14952	553	10	2010	2010	NUM
ahs-14952	553	11	­	­	VERB
ahs-14952	553	12	studies	study	NOUN
ahs-14952	553	13	of	of	ADP
ahs-14952	553	14	mycorrhizal	mycorrhizal	NOUN
ahs-14952	553	15	fungi	fungus	NOUN
ahs-14952	553	16	of	of	ADP
ahs-14952	553	17	chinese	chinese	ADJ
ahs-14952	553	18	orchids	orchid	NOUN
ahs-14952	553	19	and	and	CCONJ
ahs-14952	553	20	their	their	PRON
ahs-14952	553	21	role	role	NOUN
ahs-14952	553	22	in	in	ADP
ahs-14952	553	23	orchid	orchid	NOUN
ahs-14952	553	24	conservation	conservation	NOUN
ahs-14952	553	25	in	in	ADP
ahs-14952	553	26	china	china	PROPN
ahs-14952	553	27	‐	‐	VERB
ahs-14952	553	28	a	a	DET
ahs-14952	553	29	review	review	NOUN
ahs-14952	553	30	.	.	PUNCT
ahs-14952	554	1	­	­	PROPN
ahs-14952	554	2	bot	bot	PROPN
ahs-14952	554	3	.	.	PUNCT
ahs-14952	555	1	rev	rev	PROPN
ahs-14952	555	2	.	.	PROPN
ahs-14952	555	3	,	,	PUNCT
ahs-14952	555	4	76	76	NUM
ahs-14952	555	5	:	:	SYM
ahs-14952	555	6	241­262	241­262	NUM
ahs-14952	555	7	.	.	PUNCT
ahs-14952	556	1	long	long	ADJ
ahs-14952	556	2	y.	y.	PROPN
ahs-14952	556	3	,	,	PUNCT
ahs-14952	556	4	nong	nong	PROPN
ahs-14952	556	5	q.	q.	PROPN
ahs-14952	556	6	,	,	PUNCT
ahs-14952	556	7	xie	xie	PROPN
ahs-14952	556	8	l.	l.	PROPN
ahs-14952	556	9	,	,	PUNCT
ahs-14952	556	10	zhang	zhang	PROPN
ahs-14952	556	11	w.	w.	PROPN
ahs-14952	556	12	,	,	PUNCT
ahs-14952	556	13	chen	chen	PROPN
ahs-14952	556	14	y.	y.	PROPN
ahs-14952	556	15	,	,	PUNCT
ahs-14952	556	16	zhang	zhang	PROPN
ahs-14952	556	17	y.	y.	PROPN
ahs-14952	556	18	,	,	PUNCT
ahs-14952	556	19	2022	2022	NUM
ahs-14952	556	20	­	­	NOUN
ahs-14952	556	21	tiankengomelania	tiankengomelania	NOUN
ahs-14952	556	22	guangxiense	guangxiense	NOUN
ahs-14952	556	23	,	,	PUNCT
ahs-14952	556	24	gen	gen	PROPN
ahs-14952	556	25	.	.	PROPN
ahs-14952	556	26	et	et	PROPN
ahs-14952	556	27	sp	sp	PROPN
ahs-14952	556	28	.	.	PROPN
ahs-14952	556	29	nov	nov	PROPN
ahs-14952	556	30	.	.	PROPN
ahs-14952	556	31	,	,	PUNCT
ahs-14952	556	32	a	a	DET
ahs-14952	556	33	dark	dark	ADJ
ahs-14952	556	34	septate	septate	ADJ
ahs-14952	556	35	endophytic	endophytic	ADJ
ahs-14952	556	36	fungus	fungus	NOUN
ahs-14952	556	37	,	,	PUNCT
ahs-14952	556	38	promotes	promote	VERB
ahs-14952	556	39	the	the	DET
ahs-14952	556	40	growth	growth	NOUN
ahs-14952	556	41	of	of	ADP
ahs-14952	556	42	the	the	DET
ahs-14952	556	43	medicinal	medicinal	ADJ
ahs-14952	556	44	orchid	orchid	NOUN
ahs-14952	556	45	dendrobium	dendrobium	NOUN
ahs-14952	556	46	officinale	officinale	NOUN
ahs-14952	556	47	.	.	PUNCT
ahs-14952	557	1	­	­	VERB
ahs-14952	557	2	fungal	fungal	ADJ
ahs-14952	557	3	biol	biol	NOUN
ahs-14952	557	4	.	.	PUNCT
ahs-14952	557	5	,	,	PUNCT
ahs-14952	557	6	126(5	126(5	NUM
ahs-14952	557	7	):	):	PUNCT
ahs-14952	557	8	333­341	333­341	NUM
ahs-14952	557	9	.	.	PUNCT
ahs-14952	557	10	ma	ma	PROPN
ahs-14952	557	11	x.	x.	PROPN
ahs-14952	557	12	,	,	PUNCT
ahs-14952	557	13	kang	kang	PROPN
ahs-14952	557	14	j.	j.	PROPN
ahs-14952	557	15	,	,	PUNCT
ahs-14952	557	16	nontachaiyapoom	nontachaiyapoom	PROPN
ahs-14952	557	17	s.	s.	PROPN
ahs-14952	557	18	,	,	PUNCT
ahs-14952	557	19	wen	wen	PROPN
ahs-14952	557	20	t.	t.	PROPN
ahs-14952	557	21	,	,	PUNCT
ahs-14952	557	22	hyde	hyde	PROPN
ahs-14952	557	23	k.d	k.d	PROPN
ahs-14952	557	24	.	.	PROPN
ahs-14952	557	25	,	,	PUNCT
ahs-14952	557	26	2015	2015	NUM
ahs-14952	557	27	­	­	VERB
ahs-14952	557	28	non‐mycorrhizal	non‐mycorrhizal	AUX
ahs-14952	557	29	endophytic	endophytic	ADJ
ahs-14952	557	30	fungi	fungus	NOUN
ahs-14952	557	31	from	from	ADP
ahs-14952	557	32	orchids	orchid	NOUN
ahs-14952	557	33	.	.	PUNCT
ahs-14952	558	1	­	­	PROPN
ahs-14952	558	2	curr	curr	PROPN
ahs-14952	558	3	.	.	PUNCT
ahs-14952	559	1	sci	sci	PROPN
ahs-14952	559	2	.	.	PROPN
ahs-14952	559	3	,	,	PUNCT
ahs-14952	559	4	109(1	109(1	NUM
ahs-14952	559	5	):	):	PUNCT
ahs-14952	559	6	72­87	72­87	NOUN
ahs-14952	559	7	.	.	PUNCT
ahs-14952	560	1	mangunwardoyo	mangunwardoyo	PROPN
ahs-14952	560	2	w.	w.	PROPN
ahs-14952	560	3	,	,	PUNCT
ahs-14952	560	4	suciatmih	suciatmih	PROPN
ahs-14952	560	5	s.	s.	PROPN
ahs-14952	560	6	,	,	PUNCT
ahs-14952	560	7	gandjar	gandjar	NOUN
ahs-14952	560	8	i.	i.	NOUN
ahs-14952	560	9	,	,	PUNCT
ahs-14952	560	10	2011	2011	NUM
ahs-14952	560	11	­	­	PROPN
ahs-14952	560	12	frequency	frequency	NOUN
ahs-14952	560	13	of	of	ADP
ahs-14952	560	14	endophytic	endophytic	ADJ
ahs-14952	560	15	fungi	fungus	NOUN
ahs-14952	560	16	isolated	isolate	VERB
ahs-14952	560	17	from	from	ADP
ahs-14952	560	18	dendrobium	dendrobium	NOUN
ahs-14952	560	19	crumenatum	crumenatum	NOUN
ahs-14952	560	20	sw	sw	PROPN
ahs-14952	560	21	.	.	PUNCT
ahs-14952	561	1	(	(	PUNCT
ahs-14952	561	2	pigeon	pigeon	NOUN
ahs-14952	561	3	orchid	orchid	NOUN
ahs-14952	561	4	)	)	PUNCT
ahs-14952	561	5	and	and	CCONJ
ahs-14952	561	6	antimicrobial	antimicrobial	ADJ
ahs-14952	561	7	activity	activity	NOUN
ahs-14952	561	8	.	.	PUNCT
ahs-14952	562	1	­	­	PROPN
ahs-14952	562	2	biodiversitas	biodiversita	NOUN
ahs-14952	562	3	j.	j.	PROPN
ahs-14952	562	4	biol	biol	PROPN
ahs-14952	562	5	.	.	PUNCT
ahs-14952	563	1	div	div	PROPN
ahs-14952	563	2	.	.	PROPN
ahs-14952	563	3	,	,	PUNCT
ahs-14952	563	4	13(1	13(1	NUM
ahs-14952	563	5	):	):	PUNCT
ahs-14952	563	6	34­39	34­39	NUM
ahs-14952	563	7	.	.	PUNCT
ahs-14952	563	8	martos	martos	PROPN
ahs-14952	563	9	f.	f.	PROPN
ahs-14952	563	10	,	,	PUNCT
ahs-14952	563	11	munoz	munoz	PROPN
ahs-14952	563	12	f.	f.	PROPN
ahs-14952	563	13	,	,	PUNCT
ahs-14952	563	14	pailler	pailler	NOUN
ahs-14952	563	15	t.	t.	PROPN
ahs-14952	563	16	,	,	PUNCT
ahs-14952	563	17	kottk	kottk	PROPN
ahs-14952	563	18	i.	i.	PROPN
ahs-14952	563	19	,	,	PUNCT
ahs-14952	563	20	gonneau	gonneau	PROPN
ahs-14952	563	21	c.	c.	PROPN
ahs-14952	563	22	,	,	PUNCT
ahs-14952	563	23	selosse	selosse	PROPN
ahs-14952	563	24	m.	m.	PROPN
ahs-14952	563	25	a.	a.	PROPN
ahs-14952	563	26	,	,	PUNCT
ahs-14952	563	27	2012	2012	NUM
ahs-14952	563	28	­	­	VERB
ahs-14952	563	29	the	the	DET
ahs-14952	563	30	role	role	NOUN
ahs-14952	563	31	of	of	ADP
ahs-14952	563	32	epiphytism	epiphytism	NOUN
ahs-14952	563	33	in	in	ADP
ahs-14952	563	34	architecture	architecture	NOUN
ahs-14952	563	35	and	and	CCONJ
ahs-14952	563	36	evolutionary	evolutionary	ADJ
ahs-14952	563	37	constraint	constraint	NOUN
ahs-14952	563	38	within	within	ADP
ahs-14952	563	39	mycorrhizal	mycorrhizal	NOUN
ahs-14952	563	40	networks	network	NOUN
ahs-14952	563	41	of	of	ADP
ahs-14952	563	42	tropical	tropical	ADJ
ahs-14952	563	43	orchids	orchid	NOUN
ahs-14952	563	44	.	.	PUNCT
ahs-14952	564	1	­	­	PROPN
ahs-14952	564	2	mol	mol	PROPN
ahs-14952	564	3	.	.	PUNCT
ahs-14952	565	1	ecol	ecol	PROPN
ahs-14952	565	2	.	.	PUNCT
ahs-14952	566	1	,	,	PUNCT
ahs-14952	566	2	21(20	21(20	NUM
ahs-14952	566	3	):	):	PUNCT
ahs-14952	566	4	5098­5109	5098­5109	NUM
ahs-14952	566	5	.	.	PUNCT
ahs-14952	566	6	mccormick	mccormick	PROPN
ahs-14952	566	7	m.	m.	PROPN
ahs-14952	566	8	,	,	PUNCT
ahs-14952	566	9	burnett	burnett	PROPN
ahs-14952	566	10	r.	r.	PROPN
ahs-14952	566	11	,	,	PUNCT
ahs-14952	566	12	whigham	whigham	PROPN
ahs-14952	566	13	d.	d.	PROPN
ahs-14952	566	14	,	,	PUNCT
ahs-14952	566	15	2021	2021	NUM
ahs-14952	566	16	­	­	X
ahs-14952	566	17	protocorm‐supporting	protocorm‐supporte	VERB
ahs-14952	566	18	fungi	fungus	NOUN
ahs-14952	566	19	are	be	AUX
ahs-14952	566	20	retained	retain	VERB
ahs-14952	566	21	in	in	ADP
ahs-14952	566	22	roots	root	NOUN
ahs-14952	566	23	of	of	ADP
ahs-14952	566	24	mature	mature	ADJ
ahs-14952	566	25	tipularia	tipularia	PROPN
ahs-14952	566	26	discolor	discolor	PROPN
ahs-14952	566	27	orchids	orchid	NOUN
ahs-14952	566	28	as	as	ADP
ahs-14952	566	29	mycorrhizal	mycorrhizal	NOUN
ahs-14952	566	30	fungal	fungal	ADJ
ahs-14952	566	31	diversity	diversity	NOUN
ahs-14952	566	32	increases	increase	NOUN
ahs-14952	566	33	.	.	PUNCT
ahs-14952	567	1	­	­	NOUN
ahs-14952	567	2	plants	plant	NOUN
ahs-14952	567	3	,	,	PUNCT
ahs-14952	567	4	10(6	10(6	NUM
ahs-14952	567	5	):	):	PUNCT
ahs-14952	567	6	1251	1251	NUM
ahs-14952	567	7	.	.	PUNCT
ahs-14952	568	1	mccormick	mccormick	PROPN
ahs-14952	568	2	m.k	m.k	PROPN
ahs-14952	568	3	.	.	PROPN
ahs-14952	568	4	,	,	PUNCT
ahs-14952	568	5	whigham	whigham	PROPN
ahs-14952	568	6	d.f	d.f	PROPN
ahs-14952	568	7	.	.	PROPN
ahs-14952	568	8	,	,	PUNCT
ahs-14952	568	9	neill	neill	PROPN
ahs-14952	568	10	j.p.o	j.p.o	PROPN
ahs-14952	568	11	.	.	PROPN
ahs-14952	568	12	,	,	PUNCT
ahs-14952	569	1	becker	becker	PROPN
ahs-14952	569	2	j.j	j.j	PROPN
ahs-14952	569	3	.	.	PROPN
ahs-14952	569	4	,	,	PUNCT
ahs-14952	569	5	werner	werner	PROPN
ahs-14952	569	6	s.	s.	PROPN
ahs-14952	569	7	,	,	PUNCT
ahs-14952	569	8	rasmussen	rasmussen	PROPN
ahs-14952	569	9	h.n	h.n	PROPN
ahs-14952	569	10	.	.	PROPN
ahs-14952	569	11	,	,	PUNCT
ahs-14952	569	12	bruns	bruns	PROPN
ahs-14952	569	13	t.d	t.d	PROPN
ahs-14952	569	14	.	.	PROPN
ahs-14952	569	15	,	,	PUNCT
ahs-14952	569	16	taylor	taylor	PROPN
ahs-14952	569	17	t.d	t.d	PROPN
ahs-14952	569	18	.	.	PROPN
ahs-14952	569	19	,	,	PUNCT
ahs-14952	569	20	2019	2019	NUM
ahs-14952	569	21	­	­	NOUN
ahs-14952	569	22	abundance	abundance	NOUN
ahs-14952	569	23	and	and	CCONJ
ahs-14952	569	24	distribution	distribution	NOUN
ahs-14952	569	25	of	of	ADP
ahs-14952	569	26	corallorhiza	corallorhiza	ADJ
ahs-14952	569	27	odontorhiza	odontorhiza	NOUN
ahs-14952	569	28	reflect	reflect	VERB
ahs-14952	569	29	variations	variation	NOUN
ahs-14952	569	30	in	in	ADP
ahs-14952	569	31	climate	climate	NOUN
ahs-14952	569	32	and	and	CCONJ
ahs-14952	569	33	ectomycorrhizae	ectomycorrhizae	NOUN
ahs-14952	569	34	.	.	PUNCT
ahs-14952	570	1	­	­	PROPN
ahs-14952	570	2	ecol	ecol	NOUN
ahs-14952	570	3	.	.	PUNCT
ahs-14952	571	1	monogr	monogr	PROPN
ahs-14952	571	2	.	.	PUNCT
ahs-14952	571	3	,	,	PUNCT
ahs-14952	572	1	79(4	79(4	NOUN
ahs-14952	572	2	):	):	PUNCT
ahs-14952	572	3	619­635	619­635	PROPN
ahs-14952	572	4	.	.	PUNCT
ahs-14952	572	5	ming	ming	PROPN
ahs-14952	572	6	l.	l.	PROPN
ahs-14952	572	7	,	,	PUNCT
ahs-14952	572	8	zhou	zhou	PROPN
ahs-14952	572	9	z.	z.	PROPN
ahs-14952	572	10	,	,	PUNCT
ahs-14952	572	11	2001	2001	NUM
ahs-14952	572	12	­	­	VERB
ahs-14952	572	13	studies	study	NOUN
ahs-14952	572	14	and	and	CCONJ
ahs-14952	572	15	applications	application	NOUN
ahs-14952	572	16	on	on	ADP
ahs-14952	572	17	mycorrhiza	mycorrhiza	NOUN
ahs-14952	572	18	of	of	ADP
ahs-14952	572	19	paphiopedilum	paphiopedilum	NOUN
ahs-14952	572	20	armeniacum	armeniacum	NOUN
ahs-14952	572	21	.	.	PUNCT
ahs-14952	573	1	­	­	AUX
ahs-14952	573	2	j.	j.	PROPN
ahs-14952	573	3	biol	biol	PROPN
ahs-14952	573	4	.	.	PUNCT
ahs-14952	573	5	,	,	PUNCT
ahs-14952	573	6	18(6	18(6	NOUN
ahs-14952	573	7	):	):	PUNCT
ahs-14952	573	8	17­18	17­18	PROPN
ahs-14952	573	9	.	.	PUNCT
ahs-14952	573	10	ming	ming	PROPN
ahs-14952	573	11	x.t	x.t	PROPN
ahs-14952	573	12	.	.	PROPN
ahs-14952	573	13	,	,	PUNCT
ahs-14952	573	14	wang	wang	PROPN
ahs-14952	573	15	c.l	c.l	PROPN
ahs-14952	573	16	.	.	PROPN
ahs-14952	573	17	,	,	PUNCT
ahs-14952	573	18	chen	chen	PROPN
ahs-14952	573	19	x.m	x.m	PROPN
ahs-14952	573	20	.	.	PROPN
ahs-14952	573	21	,	,	PUNCT
ahs-14952	574	1	zhou	zhou	PROPN
ahs-14952	574	2	y.q	y.q	PROPN
ahs-14952	574	3	.	.	PROPN
ahs-14952	574	4	,	,	PUNCT
ahs-14952	575	1	wang	wang	PROPN
ahs-14952	575	2	y.q	y.q	PROPN
ahs-14952	575	3	.	.	PROPN
ahs-14952	575	4	,	,	PUNCT
ahs-14952	576	1	lou	lou	PROPN
ahs-14952	576	2	a.x	a.x	PROPN
ahs-14952	576	3	.	.	PROPN
ahs-14952	576	4	,	,	PUNCT
ahs-14952	576	5	liu	liu	PROPN
ahs-14952	576	6	z.h	z.h	PROPN
ahs-14952	576	7	.	.	PROPN
ahs-14952	576	8	,	,	PUNCT
ahs-14952	576	9	guo	guo	PROPN
ahs-14952	576	10	s.x	s.x	PROPN
ahs-14952	576	11	.	.	PROPN
ahs-14952	576	12	,	,	PUNCT
ahs-14952	576	13	2014	2014	NUM
ahs-14952	576	14	­	­	VERB
ahs-14952	576	15	in	in	ADP
ahs-14952	576	16	vitro	vitro	X
ahs-14952	576	17	seed	seed	NOUN
ahs-14952	576	18	germination	germination	NOUN
ahs-14952	576	19	and	and	CCONJ
ahs-14952	576	20	seedling	seedling	NOUN
ahs-14952	576	21	growth	growth	NOUN
ahs-14952	576	22	of	of	ADP
ahs-14952	576	23	an	an	DET
ahs-14952	576	24	endangered	endangered	ADJ
ahs-14952	576	25	adv	adv	PROPN
ahs-14952	576	26	.	.	PUNCT
ahs-14952	576	27	hort	hort	PROPN
ahs-14952	576	28	.	.	PUNCT
ahs-14952	577	1	sci	sci	PROPN
ahs-14952	577	2	.	.	PROPN
ahs-14952	577	3	,	,	PUNCT
ahs-14952	577	4	2024	2024	NUM
ahs-14952	577	5	38(1	38(1	NOUN
ahs-14952	577	6	):	):	PUNCT
ahs-14952	577	7	97­116	97­116	NUM
ahs-14952	577	8	114	114	NUM
ahs-14952	577	9	epiphytic	epiphytic	ADJ
ahs-14952	577	10	orchid	orchid	NOUN
ahs-14952	577	11	,	,	PUNCT
ahs-14952	577	12	dendrobium	dendrobium	NOUN
ahs-14952	577	13	officinale	officinale	NOUN
ahs-14952	577	14	,	,	PUNCT
ahs-14952	577	15	endemic	endemic	ADJ
ahs-14952	577	16	to	to	ADP
ahs-14952	577	17	china	china	PROPN
ahs-14952	577	18	using	use	VERB
ahs-14952	577	19	mycorrhizal	mycorrhizal	NOUN
ahs-14952	577	20	fungi	fungus	NOUN
ahs-14952	577	21	(	(	PUNCT
ahs-14952	577	22	tulasnella	tulasnella	NOUN
ahs-14952	577	23	sp	sp	PROPN
ahs-14952	577	24	.	.	PUNCT
ahs-14952	577	25	)	)	PUNCT
ahs-14952	577	26	.	.	PUNCT
ahs-14952	578	1	­	­	PROPN
ahs-14952	578	2	sci	sci	PROPN
ahs-14952	578	3	.	.	PUNCT
ahs-14952	578	4	hortic	hortic	PROPN
ahs-14952	578	5	.	.	PUNCT
ahs-14952	578	6	,	,	PUNCT
ahs-14952	579	1	165(2104	165(2104	PROPN
ahs-14952	579	2	):	):	PUNCT
ahs-14952	579	3	62­68	62­68	PROPN
ahs-14952	579	4	.	.	PUNCT
ahs-14952	580	1	nilsson	nilsson	PROPN
ahs-14952	580	2	r.h	r.h	PROPN
ahs-14952	580	3	.	.	PROPN
ahs-14952	580	4	,	,	PUNCT
ahs-14952	580	5	anslan	anslan	PROPN
ahs-14952	580	6	s.	s.	PROPN
ahs-14952	580	7	,	,	PUNCT
ahs-14952	580	8	bahram	bahram	PROPN
ahs-14952	580	9	m.	m.	NOUN
ahs-14952	580	10	,	,	PUNCT
ahs-14952	580	11	wurzbacher	wurzbacher	PROPN
ahs-14952	580	12	c.	c.	PROPN
ahs-14952	580	13	,	,	PUNCT
ahs-14952	580	14	baldrian	baldrian	PROPN
ahs-14952	580	15	p.	p.	PROPN
ahs-14952	580	16	,	,	PUNCT
ahs-14952	580	17	tedersoo	tedersoo	PROPN
ahs-14952	580	18	l.	l.	PROPN
ahs-14952	580	19	,	,	PUNCT
ahs-14952	580	20	2019	2019	NUM
ahs-14952	580	21	­	­	PROPN
ahs-14952	580	22	mycobiome	mycobiome	NOUN
ahs-14952	580	23	diversity	diversity	NOUN
ahs-14952	580	24	:	:	PUNCT
ahs-14952	580	25	high‐throughput	high‐throughput	VERB
ahs-14952	580	26	sequencing	sequencing	NOUN
ahs-14952	580	27	and	and	CCONJ
ahs-14952	580	28	identification	identification	NOUN
ahs-14952	580	29	of	of	ADP
ahs-14952	580	30	fungi	fungi	PROPN
ahs-14952	580	31	.	.	PUNCT
ahs-14952	581	1	­	­	PROPN
ahs-14952	581	2	nat	nat	PROPN
ahs-14952	581	3	.	.	PUNCT
ahs-14952	582	1	rev	rev	PROPN
ahs-14952	582	2	.	.	PROPN
ahs-14952	582	3	microbiol	microbiol	PROPN
ahs-14952	582	4	.	.	PUNCT
ahs-14952	582	5	,	,	PUNCT
ahs-14952	582	6	17(2	17(2	NUM
ahs-14952	582	7	):	):	PUNCT
ahs-14952	582	8	95­	95­	NUM
ahs-14952	582	9	109	109	NUM
ahs-14952	582	10	.	.	PUNCT
ahs-14952	582	11	nontachaiyapoom	nontachaiyapoom	PROPN
ahs-14952	582	12	s.	s.	PROPN
ahs-14952	582	13	,	,	PUNCT
ahs-14952	582	14	sasirat	sasirat	PROPN
ahs-14952	582	15	s.	s.	PROPN
ahs-14952	582	16	,	,	PUNCT
ahs-14952	582	17	manoch	manoch	PROPN
ahs-14952	582	18	l.	l.	PROPN
ahs-14952	582	19	,	,	PUNCT
ahs-14952	582	20	2011	2011	NUM
ahs-14952	582	21	­	­	NUM
ahs-14952	582	22	symbiotic	symbiotic	ADJ
ahs-14952	582	23	seed	seed	NOUN
ahs-14952	582	24	germination	germination	NOUN
ahs-14952	582	25	of	of	ADP
ahs-14952	582	26	grammatophyllum	grammatophyllum	PROPN
ahs-14952	582	27	speciosum	speciosum	PROPN
ahs-14952	582	28	blume	blume	PROPN
ahs-14952	582	29	and	and	CCONJ
ahs-14952	582	30	dendrobium	dendrobium	PROPN
ahs-14952	582	31	draconis	draconis	PROPN
ahs-14952	582	32	rchb	rchb	NOUN
ahs-14952	582	33	.	.	PUNCT
ahs-14952	583	1	f.	f.	PROPN
ahs-14952	583	2	,	,	PUNCT
ahs-14952	583	3	native	native	ADJ
ahs-14952	583	4	orchids	orchid	NOUN
ahs-14952	583	5	of	of	ADP
ahs-14952	583	6	thailand	thailand	PROPN
ahs-14952	583	7	.	.	PUNCT
ahs-14952	584	1	­	­	PROPN
ahs-14952	584	2	sci	sci	PROPN
ahs-14952	584	3	.	.	PUNCT
ahs-14952	585	1	hortic	hortic	PROPN
ahs-14952	585	2	.	.	PUNCT
ahs-14952	585	3	,	,	PUNCT
ahs-14952	586	1	130(1	130(1	NUM
ahs-14952	586	2	):	):	PUNCT
ahs-14952	586	3	303­	303­	NUM
ahs-14952	586	4	308	308	NUM
ahs-14952	586	5	.	.	PUNCT
ahs-14952	587	1	novotná	novotná	PROPN
ahs-14952	587	2	a.	a.	PROPN
ahs-14952	587	3	,	,	PUNCT
ahs-14952	587	4	benítez	benítez	PROPN
ahs-14952	587	5	a.	a.	PROPN
ahs-14952	587	6	,	,	PUNCT
ahs-14952	587	7	herrera	herrera	PROPN
ahs-14952	587	8	p.	p.	PROPN
ahs-14952	587	9	,	,	PUNCT
ahs-14952	587	10	cruz	cruz	PROPN
ahs-14952	587	11	d.	d.	PROPN
ahs-14952	587	12	,	,	PUNCT
ahs-14952	587	13	filipczyková	filipczyková	PROPN
ahs-14952	587	14	e.	e.	PROPN
ahs-14952	587	15	,	,	PUNCT
ahs-14952	587	16	suárez	suárez	PROPN
ahs-14952	587	17	j.p	j.p	PROPN
ahs-14952	587	18	.	.	PROPN
ahs-14952	587	19	,	,	PUNCT
ahs-14952	587	20	2018	2018	NUM
ahs-14952	587	21	­	­	VERB
ahs-14952	587	22	high	high	ADJ
ahs-14952	587	23	diversity	diversity	NOUN
ahs-14952	587	24	of	of	ADP
ahs-14952	587	25	root‐associated	root‐associate	VERB
ahs-14952	587	26	fungi	fungus	NOUN
ahs-14952	587	27	isolated	isolate	VERB
ahs-14952	587	28	from	from	ADP
ahs-14952	587	29	three	three	NUM
ahs-14952	587	30	epiphytic	epiphytic	ADJ
ahs-14952	587	31	orchids	orchid	NOUN
ahs-14952	587	32	in	in	ADP
ahs-14952	587	33	southern	southern	ADJ
ahs-14952	587	34	ecuador	ecuador	PROPN
ahs-14952	587	35	.	.	PUNCT
ahs-14952	588	1	­	­	PROPN
ahs-14952	588	2	mycocience	mycocience	NOUN
ahs-14952	588	3	,	,	PUNCT
ahs-14952	588	4	59(1	59(1	NUM
ahs-14952	588	5	):	):	PUNCT
ahs-14952	588	6	24­	24­	PROPN
ahs-14952	588	7	32	32	NUM
ahs-14952	588	8	.	.	PUNCT
ahs-14952	589	1	oja	oja	PROPN
ahs-14952	589	2	j.	j.	PROPN
ahs-14952	589	3	,	,	PUNCT
ahs-14952	589	4	kohout	kohout	PROPN
ahs-14952	589	5	p.	p.	PROPN
ahs-14952	589	6	,	,	PUNCT
ahs-14952	589	7	tedersoo	tedersoo	PROPN
ahs-14952	589	8	l.	l.	PROPN
ahs-14952	589	9	,	,	PUNCT
ahs-14952	589	10	kull	kull	PROPN
ahs-14952	589	11	t.	t.	PROPN
ahs-14952	589	12	,	,	PUNCT
ahs-14952	589	13	kõljalg	kõljalg	PROPN
ahs-14952	589	14	u.	u.	PROPN
ahs-14952	589	15	,	,	PUNCT
ahs-14952	589	16	2014	2014	NUM
ahs-14952	589	17	­	­	VERB
ahs-14952	589	18	temporal	temporal	ADJ
ahs-14952	589	19	patterns	pattern	NOUN
ahs-14952	589	20	of	of	ADP
ahs-14952	589	21	orchid	orchid	NOUN
ahs-14952	589	22	mycorrhizal	mycorrhizal	NOUN
ahs-14952	589	23	fungi	fungus	NOUN
ahs-14952	589	24	in	in	ADP
ahs-14952	589	25	meadows	meadow	NOUN
ahs-14952	589	26	and	and	CCONJ
ahs-14952	589	27	forests	forest	NOUN
ahs-14952	589	28	as	as	SCONJ
ahs-14952	589	29	revealed	reveal	VERB
ahs-14952	589	30	by	by	ADP
ahs-14952	589	31	454	454	NUM
ahs-14952	589	32	pyrosequencing	pyrosequencing	NOUN
ahs-14952	589	33	.	.	PUNCT
ahs-14952	590	1	­	­	VERB
ahs-14952	590	2	new	new	ADJ
ahs-14952	590	3	phytol	phytol	NOUN
ahs-14952	590	4	.	.	PUNCT
ahs-14952	590	5	,	,	PUNCT
ahs-14952	590	6	205(4	205(4	NUM
ahs-14952	590	7	):	):	PUNCT
ahs-14952	590	8	1608­1618	1608­1618	NUM
ahs-14952	590	9	.	.	PUNCT
ahs-14952	590	10	omega	omega	NOUN
ahs-14952	590	11	biot­tek	biot­tek	NOUN
ahs-14952	590	12	.	.	PUNCT
ahs-14952	591	1	e.z.n.a	e.z.n.a	PROPN
ahs-14952	591	2	.	.	PROPN
ahs-14952	591	3	®	®	PROPN
ahs-14952	591	4	,	,	PUNCT
ahs-14952	591	5	2019	2019	NUM
ahs-14952	591	6	­	­	NUM
ahs-14952	591	7	fungal	fungal	ADJ
ahs-14952	591	8	dna	dna	PROPN
ahs-14952	591	9	mini	mini	PROPN
ahs-14952	591	10	kit	kit	PROPN
ahs-14952	591	11	.	.	PUNCT
ahs-14952	592	1	­	­	PROPN
ahs-14952	592	2	https://www.omegabiotek.com/product/e­z­n­a­	https://www.omegabiotek.com/product/e­z­n­a­	PUNCT
ahs-14952	592	3	fungal­dna­mini­kit/	fungal­dna­mini­kit/	PROPN
ahs-14952	592	4	otero	otero	PROPN
ahs-14952	592	5	j.t	j.t	PROPN
ahs-14952	592	6	.	.	PROPN
ahs-14952	592	7	,	,	PUNCT
ahs-14952	592	8	ackerman	ackerman	PROPN
ahs-14952	592	9	j.d	j.d	PROPN
ahs-14952	592	10	.	.	PROPN
ahs-14952	592	11	,	,	PUNCT
ahs-14952	592	12	bayman	bayman	NOUN
ahs-14952	592	13	p.	p.	NOUN
ahs-14952	592	14	,	,	PUNCT
ahs-14952	592	15	2002	2002	NUM
ahs-14952	592	16	­	­	VERB
ahs-14952	592	17	diversity	diversity	NOUN
ahs-14952	592	18	and	and	CCONJ
ahs-14952	592	19	host	host	NOUN
ahs-14952	592	20	specificity	specificity	NOUN
ahs-14952	592	21	of	of	ADP
ahs-14952	592	22	endophytic	endophytic	ADJ
ahs-14952	592	23	rhizoctonia‐like	rhizoctonia‐like	NOUN
ahs-14952	592	24	fungi	fungus	NOUN
ahs-14952	592	25	from	from	ADP
ahs-14952	592	26	tropical	tropical	ADJ
ahs-14952	592	27	orchid	orchid	NOUN
ahs-14952	592	28	.	.	PUNCT
ahs-14952	593	1	­	­	PROPN
ahs-14952	593	2	am	am	PROPN
ahs-14952	593	3	.	.	PUNCT
ahs-14952	594	1	j.	j.	PROPN
ahs-14952	594	2	bot	bot	PROPN
ahs-14952	594	3	.	.	PUNCT
ahs-14952	594	4	,	,	PUNCT
ahs-14952	594	5	89(11	89(11	NUM
ahs-14952	594	6	):	):	PUNCT
ahs-14952	594	7	1852­1858	1852­1858	NUM
ahs-14952	594	8	.	.	PUNCT
ahs-14952	595	1	peay	peay	ADJ
ahs-14952	595	2	k.g	k.g	PROPN
ahs-14952	595	3	.	.	PROPN
ahs-14952	595	4	,	,	PUNCT
ahs-14952	595	5	2014	2014	NUM
ahs-14952	595	6	­	­	VERB
ahs-14952	595	7	back	back	ADV
ahs-14952	595	8	to	to	ADP
ahs-14952	595	9	the	the	DET
ahs-14952	595	10	future	future	NOUN
ahs-14952	595	11	:	:	PUNCT
ahs-14952	595	12	natural	natural	ADJ
ahs-14952	595	13	history	history	NOUN
ahs-14952	595	14	and	and	CCONJ
ahs-14952	595	15	the	the	DET
ahs-14952	595	16	way	way	NOUN
ahs-14952	595	17	forward	forward	ADV
ahs-14952	595	18	in	in	ADP
ahs-14952	595	19	modern	modern	ADJ
ahs-14952	595	20	fungal	fungal	ADJ
ahs-14952	595	21	ecology	ecology	NOUN
ahs-14952	595	22	.	.	PUNCT
ahs-14952	596	1	­	­	PROPN
ahs-14952	596	2	fungal	fungal	ADJ
ahs-14952	596	3	ecol	ecol	NOUN
ahs-14952	596	4	.	.	PUNCT
ahs-14952	596	5	,	,	PUNCT
ahs-14952	596	6	12(c	12(c	NUM
ahs-14952	596	7	):	):	PUNCT
ahs-14952	597	1	4­9	4­9	PROPN
ahs-14952	597	2	.	.	PUNCT
ahs-14952	598	1	pujasatria	pujasatria	PROPN
ahs-14952	598	2	g.c	g.c	PROPN
ahs-14952	598	3	.	.	PROPN
ahs-14952	598	4	,	,	PUNCT
ahs-14952	598	5	miura	miura	PROPN
ahs-14952	598	6	c.	c.	PROPN
ahs-14952	598	7	,	,	PUNCT
ahs-14952	598	8	kaminaka	kaminaka	PROPN
ahs-14952	598	9	h.	h.	PROPN
ahs-14952	598	10	,	,	PUNCT
ahs-14952	598	11	2020	2020	NUM
ahs-14952	598	12	­	­	VERB
ahs-14952	598	13	in	in	ADV
ahs-14952	598	14	vitro	vitro	X
ahs-14952	598	15	symbiotic	symbiotic	ADJ
ahs-14952	598	16	germination	germination	NOUN
ahs-14952	598	17	:	:	PUNCT
ahs-14952	598	18	a	a	DET
ahs-14952	598	19	revitalised	revitalise	VERB
ahs-14952	598	20	heuristic	heuristic	ADJ
ahs-14952	598	21	approach	approach	NOUN
ahs-14952	598	22	for	for	ADP
ahs-14952	598	23	orchid	orchid	NOUN
ahs-14952	598	24	species	specie	NOUN
ahs-14952	598	25	conservation	conservation	NOUN
ahs-14952	598	26	.	.	PUNCT
ahs-14952	599	1	­	­	NOUN
ahs-14952	599	2	plants	plant	NOUN
ahs-14952	599	3	,	,	PUNCT
ahs-14952	599	4	9(12	9(12	NUM
ahs-14952	599	5	):	):	PUNCT
ahs-14952	599	6	1742	1742	NUM
ahs-14952	599	7	.	.	PUNCT
ahs-14952	600	1	raja	raja	PROPN
ahs-14952	600	2	h.a	h.a	PROPN
ahs-14952	600	3	.	.	PROPN
ahs-14952	600	4	,	,	PUNCT
ahs-14952	600	5	miller	miller	PROPN
ahs-14952	600	6	a.n	a.n	PROPN
ahs-14952	600	7	.	.	PROPN
ahs-14952	600	8	,	,	PUNCT
ahs-14952	600	9	pearce	pearce	PROPN
ahs-14952	600	10	c.j	c.j	PROPN
ahs-14952	600	11	.	.	PROPN
ahs-14952	600	12	,	,	PUNCT
ahs-14952	600	13	oberlies	oberlies	PROPN
ahs-14952	600	14	n.h	n.h	PROPN
ahs-14952	600	15	.	.	PROPN
ahs-14952	600	16	,	,	PUNCT
ahs-14952	600	17	2017	2017	NUM
ahs-14952	600	18	­	­	NUM
ahs-14952	600	19	fungal	fungal	ADJ
ahs-14952	600	20	identification	identification	NOUN
ahs-14952	600	21	using	use	VERB
ahs-14952	600	22	molecular	molecular	ADJ
ahs-14952	600	23	tools	tool	NOUN
ahs-14952	600	24	:	:	PUNCT
ahs-14952	600	25	a	a	DET
ahs-14952	600	26	primer	primer	NOUN
ahs-14952	600	27	for	for	ADP
ahs-14952	600	28	the	the	DET
ahs-14952	600	29	natural	natural	ADJ
ahs-14952	600	30	products	product	NOUN
ahs-14952	600	31	research	research	NOUN
ahs-14952	600	32	community	community	NOUN
ahs-14952	600	33	.	.	PUNCT
ahs-14952	601	1	­	­	PROPN
ahs-14952	601	2	j.	j.	PROPN
ahs-14952	601	3	nat	nat	PROPN
ahs-14952	601	4	.	.	PUNCT
ahs-14952	602	1	prod	prod	PROPN
ahs-14952	602	2	.	.	PUNCT
ahs-14952	602	3	,	,	PUNCT
ahs-14952	602	4	80(3	80(3	NUM
ahs-14952	602	5	):	):	PUNCT
ahs-14952	602	6	756­770	756­770	NOUN
ahs-14952	602	7	.	.	PUNCT
ahs-14952	603	1	rammitsu	rammitsu	PROPN
ahs-14952	603	2	k.	k.	PROPN
ahs-14952	603	3	,	,	PUNCT
ahs-14952	603	4	kajita	kajita	PROPN
ahs-14952	603	5	t.	t.	PROPN
ahs-14952	603	6	,	,	PUNCT
ahs-14952	603	7	imai	imai	PROPN
ahs-14952	603	8	r.	r.	PROPN
ahs-14952	603	9	,	,	PUNCT
ahs-14952	603	10	ogura­tsujita	ogura­tsujita	NOUN
ahs-14952	603	11	y.	y.	NOUN
ahs-14952	603	12	,	,	PUNCT
ahs-14952	603	13	2021	2021	NUM
ahs-14952	603	14	­	­	VERB
ahs-14952	603	15	strong	strong	ADJ
ahs-14952	603	16	primer	primer	NOUN
ahs-14952	603	17	bias	bias	NOUN
ahs-14952	603	18	for	for	ADP
ahs-14952	603	19	tulasnellaceae	tulasnellaceae	ADJ
ahs-14952	603	20	fungi	fungus	NOUN
ahs-14952	603	21	in	in	ADP
ahs-14952	603	22	metabarcoding	metabarcoding	NOUN
ahs-14952	603	23	:	:	PUNCT
ahs-14952	603	24	specific	specific	ADJ
ahs-14952	603	25	primers	primer	NOUN
ahs-14952	603	26	improve	improve	VERB
ahs-14952	603	27	the	the	DET
ahs-14952	603	28	characterization	characterization	NOUN
ahs-14952	603	29	of	of	ADP
ahs-14952	603	30	the	the	DET
ahs-14952	603	31	mycorrhizal	mycorrhizal	NOUN
ahs-14952	603	32	communities	community	NOUN
ahs-14952	603	33	of	of	ADP
ahs-14952	603	34	epiphytic	epiphytic	ADJ
ahs-14952	603	35	orchids	orchid	NOUN
ahs-14952	603	36	.	.	PUNCT
ahs-14952	604	1	­	­	PROPN
ahs-14952	604	2	mycoscience	mycoscience	PROPN
ahs-14952	604	3	,	,	PUNCT
ahs-14952	604	4	62(6	62(6	NOUN
ahs-14952	604	5	):	):	PUNCT
ahs-14952	604	6	356­363	356­363	NUM
ahs-14952	604	7	.	.	PUNCT
ahs-14952	605	1	rasmussen	rasmussen	PROPN
ahs-14952	605	2	h.n	h.n	PROPN
ahs-14952	605	3	.	.	PROPN
ahs-14952	605	4	,	,	PUNCT
ahs-14952	605	5	1995	1995	NUM
ahs-14952	605	6	­	­	VERB
ahs-14952	605	7	terrestrial	terrestrial	ADJ
ahs-14952	605	8	orchids	orchid	NOUN
ahs-14952	605	9	‐	‐	VERB
ahs-14952	605	10	from	from	ADP
ahs-14952	605	11	seeds	seed	NOUN
ahs-14952	605	12	to	to	ADP
ahs-14952	605	13	mycothophic	mycothophic	ADJ
ahs-14952	605	14	plants	plant	NOUN
ahs-14952	605	15	.	.	PUNCT
ahs-14952	606	1	­	­	PROPN
ahs-14952	606	2	cambridge	cambridge	PROPN
ahs-14952	606	3	university	university	PROPN
ahs-14952	606	4	press	press	PROPN
ahs-14952	606	5	,	,	PUNCT
ahs-14952	606	6	cambridge	cambridge	PROPN
ahs-14952	606	7	,	,	PUNCT
ahs-14952	606	8	new	new	PROPN
ahs-14952	606	9	york	york	PROPN
ahs-14952	606	10	,	,	PUNCT
ahs-14952	606	11	pp	pp	PROPN
ahs-14952	606	12	.	.	PUNCT
ahs-14952	607	1	460	460	NUM
ahs-14952	607	2	.	.	PUNCT
ahs-14952	608	1	rasmussen	rasmussen	PROPN
ahs-14952	608	2	h.n	h.n	PROPN
ahs-14952	608	3	.	.	PROPN
ahs-14952	608	4	,	,	PUNCT
ahs-14952	608	5	whigham	whigham	PROPN
ahs-14952	608	6	d.f	d.f	PROPN
ahs-14952	608	7	.	.	PROPN
ahs-14952	608	8	,	,	PUNCT
ahs-14952	608	9	1993	1993	NUM
ahs-14952	608	10	­	­	NOUN
ahs-14952	608	11	seed	seed	NOUN
ahs-14952	608	12	ecology	ecology	NOUN
ahs-14952	608	13	of	of	ADP
ahs-14952	608	14	dust	dust	NOUN
ahs-14952	608	15	seeds	seed	NOUN
ahs-14952	608	16	in	in	ADP
ahs-14952	608	17	situ	situ	NOUN
ahs-14952	608	18	:	:	PUNCT
ahs-14952	608	19	a	a	DET
ahs-14952	608	20	new	new	ADJ
ahs-14952	608	21	study	study	NOUN
ahs-14952	608	22	technique	technique	NOUN
ahs-14952	608	23	and	and	CCONJ
ahs-14952	608	24	its	its	PRON
ahs-14952	608	25	application	application	NOUN
ahs-14952	608	26	in	in	ADP
ahs-14952	608	27	terrestrial	terrestrial	ADJ
ahs-14952	608	28	orchids	orchid	NOUN
ahs-14952	608	29	.	.	PUNCT
ahs-14952	609	1	­	­	PROPN
ahs-14952	609	2	am	am	PROPN
ahs-14952	609	3	.	.	PUNCT
ahs-14952	610	1	j.	j.	PROPN
ahs-14952	610	2	bot	bot	PROPN
ahs-14952	610	3	.	.	PROPN
ahs-14952	610	4	,	,	PUNCT
ahs-14952	610	5	80(12	80(12	NUM
ahs-14952	610	6	):	):	PUNCT
ahs-14952	610	7	1374­378	1374­378	NUM
ahs-14952	610	8	.	.	PUNCT
ahs-14952	611	1	reineke	reineke	ADJ
ahs-14952	611	2	a.	a.	NOUN
ahs-14952	611	3	,	,	PUNCT
ahs-14952	611	4	karlovsky	karlovsky	PROPN
ahs-14952	611	5	p.	p.	PROPN
ahs-14952	611	6	,	,	PUNCT
ahs-14952	611	7	zebitz	zebitz	PROPN
ahs-14952	611	8	c.p.w	c.p.w	PROPN
ahs-14952	611	9	.	.	PUNCT
ahs-14952	611	10	,	,	PUNCT
ahs-14952	611	11	1998	1998	NUM
ahs-14952	611	12	­	­	NOUN
ahs-14952	611	13	preparation	preparation	NOUN
ahs-14952	611	14	and	and	CCONJ
ahs-14952	611	15	purification	purification	NOUN
ahs-14952	611	16	of	of	ADP
ahs-14952	611	17	dna	dna	NOUN
ahs-14952	611	18	from	from	ADP
ahs-14952	611	19	insects	insect	NOUN
ahs-14952	611	20	for	for	ADP
ahs-14952	611	21	aflp	aflp	ADJ
ahs-14952	611	22	analysis	analysis	NOUN
ahs-14952	611	23	.	.	PUNCT
ahs-14952	612	1	­	­	PROPN
ahs-14952	612	2	insect	insect	PROPN
ahs-14952	612	3	mol	mol	PROPN
ahs-14952	612	4	.	.	PUNCT
ahs-14952	613	1	biol	biol	PROPN
ahs-14952	613	2	.	.	PUNCT
ahs-14952	613	3	,	,	PUNCT
ahs-14952	613	4	7(1	7(1	NUM
ahs-14952	613	5	):	):	PUNCT
ahs-14952	613	6	95­99	95­99	NUM
ahs-14952	613	7	.	.	PUNCT
ahs-14952	614	1	sambrook	sambrook	PROPN
ahs-14952	614	2	j.	j.	PROPN
ahs-14952	614	3	,	,	PUNCT
ahs-14952	614	4	maccallum	maccallum	PROPN
ahs-14952	614	5	p.	p.	PROPN
ahs-14952	614	6	,	,	PUNCT
ahs-14952	614	7	russell	russell	PROPN
ahs-14952	614	8	d.	d.	PROPN
ahs-14952	614	9	,	,	PUNCT
ahs-14952	614	10	2001	2001	NUM
ahs-14952	614	11	­	­	VERB
ahs-14952	614	12	molecular	molecular	ADJ
ahs-14952	614	13	cloning	cloning	NOUN
ahs-14952	614	14	:	:	PUNCT
ahs-14952	614	15	a	a	DET
ahs-14952	614	16	laboratory	laboratory	NOUN
ahs-14952	614	17	manual	manual	NOUN
ahs-14952	614	18	.	.	PUNCT
ahs-14952	615	1	3rd	3rd	ADJ
ahs-14952	615	2	edition	edition	NOUN
ahs-14952	615	3	.	.	PUNCT
ahs-14952	616	1	­	­	VERB
ahs-14952	616	2	cold	cold	ADJ
ahs-14952	616	3	spring	spring	NOUN
ahs-14952	616	4	harbor	harbor	NOUN
ahs-14952	616	5	press	press	PROPN
ahs-14952	616	6	,	,	PUNCT
ahs-14952	616	7	cold	cold	ADJ
ahs-14952	616	8	spring	spring	NOUN
ahs-14952	616	9	harbor	harbor	NOUN
ahs-14952	616	10	,	,	PUNCT
ahs-14952	616	11	ny	ny	PROPN
ahs-14952	616	12	,	,	PUNCT
ahs-14952	616	13	usa	usa	PROPN
ahs-14952	616	14	,	,	PUNCT
ahs-14952	616	15	pp	pp	ADJ
ahs-14952	616	16	.	.	PUNCT
ahs-14952	617	1	2344	2344	NUM
ahs-14952	617	2	.	.	PUNCT
ahs-14952	618	1	sarsaiya	sarsaiya	PROPN
ahs-14952	618	2	s.	s.	PROPN
ahs-14952	618	3	,	,	PUNCT
ahs-14952	618	4	shi	shi	PROPN
ahs-14952	618	5	j.	j.	PROPN
ahs-14952	618	6	,	,	PUNCT
ahs-14952	618	7	chen	chen	PROPN
ahs-14952	618	8	j.	j.	PROPN
ahs-14952	618	9	,	,	PUNCT
ahs-14952	618	10	2019	2019	NUM
ahs-14952	618	11	­	­	VERB
ahs-14952	618	12	a	a	DET
ahs-14952	618	13	comprehensive	comprehensive	ADJ
ahs-14952	618	14	review	review	NOUN
ahs-14952	618	15	on	on	ADP
ahs-14952	618	16	fungal	fungal	ADJ
ahs-14952	618	17	endophytes	endophyte	NOUN
ahs-14952	618	18	and	and	CCONJ
ahs-14952	618	19	its	its	PRON
ahs-14952	618	20	dynamics	dynamic	NOUN
ahs-14952	618	21	on	on	ADP
ahs-14952	618	22	orchidaceae	orchidaceae	ADJ
ahs-14952	618	23	plants	plant	NOUN
ahs-14952	618	24	:	:	PUNCT
ahs-14952	618	25	current	current	ADJ
ahs-14952	618	26	research	research	NOUN
ahs-14952	618	27	,	,	PUNCT
ahs-14952	618	28	challenges	challenge	NOUN
ahs-14952	618	29	,	,	PUNCT
ahs-14952	618	30	and	and	CCONJ
ahs-14952	618	31	future	future	ADJ
ahs-14952	618	32	possibilities	possibility	NOUN
ahs-14952	618	33	.	.	PUNCT
ahs-14952	619	1	­	­	AUX
ahs-14952	619	2	bioengineered	bioengineere	VERB
ahs-14952	619	3	.	.	PUNCT
ahs-14952	619	4	,	,	PUNCT
ahs-14952	620	1	10(1	10(1	NUM
ahs-14952	620	2	):	):	PUNCT
ahs-14952	620	3	316­334	316­334	PROPN
ahs-14952	620	4	.	.	PUNCT
ahs-14952	621	1	schiebelhut	schiebelhut	PROPN
ahs-14952	621	2	l.m	l.m	PROPN
ahs-14952	621	3	.	.	PROPN
ahs-14952	621	4	,	,	PUNCT
ahs-14952	621	5	abboud	abboud	PROPN
ahs-14952	621	6	s.s	s.s	PROPN
ahs-14952	621	7	.	.	PROPN
ahs-14952	621	8	,	,	PUNCT
ahs-14952	621	9	gómez	gómez	PROPN
ahs-14952	621	10	daglio	daglio	PROPN
ahs-14952	621	11	l.e	l.e	PROPN
ahs-14952	621	12	.	.	PROPN
ahs-14952	621	13	,	,	PUNCT
ahs-14952	621	14	swift	swift	ADJ
ahs-14952	621	15	h.f	h.f	PROPN
ahs-14952	621	16	.	.	PROPN
ahs-14952	621	17	,	,	PUNCT
ahs-14952	621	18	dawson	dawson	PROPN
ahs-14952	621	19	m.n	m.n	PROPN
ahs-14952	621	20	.	.	PROPN
ahs-14952	621	21	,	,	PUNCT
ahs-14952	621	22	2017	2017	NUM
ahs-14952	621	23	­	­	VERB
ahs-14952	621	24	a	a	DET
ahs-14952	621	25	comparison	comparison	NOUN
ahs-14952	621	26	of	of	ADP
ahs-14952	621	27	dna	dna	NOUN
ahs-14952	621	28	extraction	extraction	NOUN
ahs-14952	621	29	methods	method	NOUN
ahs-14952	621	30	for	for	ADP
ahs-14952	621	31	high‐throughput	high‐throughput	VERB
ahs-14952	621	32	dna	dna	PROPN
ahs-14952	621	33	analyses	analysis	NOUN
ahs-14952	621	34	.	.	PUNCT
ahs-14952	622	1	­	­	PROPN
ahs-14952	622	2	mol	mol	PROPN
ahs-14952	622	3	.	.	PUNCT
ahs-14952	623	1	ecol	ecol	PROPN
ahs-14952	623	2	.	.	PUNCT
ahs-14952	624	1	resour	resour	NOUN
ahs-14952	624	2	.	.	PUNCT
ahs-14952	624	3	,	,	PUNCT
ahs-14952	625	1	17(4	17(4	NUM
ahs-14952	625	2	):	):	PUNCT
ahs-14952	625	3	721­729	721­729	ADJ
ahs-14952	625	4	.	.	PUNCT
ahs-14952	626	1	sebastián	sebastián	PROPN
ahs-14952	626	2	f.	f.	PROPN
ahs-14952	626	3	,	,	PUNCT
ahs-14952	626	4	vanesa	vanesa	PROPN
ahs-14952	626	5	s.	s.	PROPN
ahs-14952	626	6	,	,	PUNCT
ahs-14952	626	7	eduardo	eduardo	PROPN
ahs-14952	626	8	f.	f.	PROPN
ahs-14952	626	9	,	,	PUNCT
ahs-14952	626	10	graciela	graciela	PROPN
ahs-14952	626	11	t.	t.	PROPN
ahs-14952	626	12	,	,	PUNCT
ahs-14952	626	13	silvana	silvana	PROPN
ahs-14952	626	14	s.	s.	PROPN
ahs-14952	626	15	,	,	PUNCT
ahs-14952	626	16	2014	2014	NUM
ahs-14952	626	17	­	­	NUM
ahs-14952	626	18	symbiotic	symbiotic	ADJ
ahs-14952	626	19	seed	seed	NOUN
ahs-14952	626	20	germination	germination	NOUN
ahs-14952	626	21	and	and	CCONJ
ahs-14952	626	22	protocorm	protocorm	NOUN
ahs-14952	626	23	development	development	NOUN
ahs-14952	626	24	of	of	ADP
ahs-14952	626	25	aa	aa	PROPN
ahs-14952	626	26	achalensis	achalensis	PROPN
ahs-14952	626	27	schltr	schltr	PROPN
ahs-14952	626	28	.	.	PUNCT
ahs-14952	626	29	,	,	PUNCT
ahs-14952	626	30	a	a	DET
ahs-14952	626	31	terrestrial	terrestrial	ADJ
ahs-14952	626	32	orchid	orchid	NOUN
ahs-14952	626	33	endemic	endemic	ADJ
ahs-14952	626	34	from	from	ADP
ahs-14952	626	35	argentina.­	argentina.­	NOUN
ahs-14952	626	36	mycorrhiza	mycorrhiza	NOUN
ahs-14952	626	37	,	,	PUNCT
ahs-14952	626	38	24(1	24(1	NUM
ahs-14952	626	39	):	):	PUNCT
ahs-14952	626	40	35­43	35­43	X
ahs-14952	626	41	.	.	PUNCT
ahs-14952	627	1	seifert	seifert	PROPN
ahs-14952	627	2	k.a	k.a	PROPN
ahs-14952	627	3	.	.	PROPN
ahs-14952	627	4	,	,	PUNCT
ahs-14952	627	5	2009	2009	NUM
ahs-14952	627	6	­	­	NOUN
ahs-14952	627	7	progress	progress	NOUN
ahs-14952	627	8	towards	towards	ADP
ahs-14952	627	9	dna	dna	PROPN
ahs-14952	627	10	barcoding	barcoding	NOUN
ahs-14952	627	11	of	of	ADP
ahs-14952	627	12	fungi	fungi	PROPN
ahs-14952	627	13	.	.	PUNCT
ahs-14952	628	1	­	­	PROPN
ahs-14952	628	2	mol	mol	PROPN
ahs-14952	628	3	.	.	PUNCT
ahs-14952	629	1	ecol	ecol	PROPN
ahs-14952	629	2	.	.	PUNCT
ahs-14952	630	1	resour	resour	NOUN
ahs-14952	630	2	.	.	PROPN
ahs-14952	630	3	,	,	PUNCT
ahs-14952	630	4	9	9	NUM
ahs-14952	630	5	:	:	SYM
ahs-14952	630	6	83­89	83­89	NUM
ahs-14952	630	7	.	.	PUNCT
ahs-14952	631	1	selosse	selosse	PROPN
ahs-14952	631	2	m.a	m.a	PROPN
ahs-14952	631	3	.	.	PROPN
ahs-14952	631	4	,	,	PUNCT
ahs-14952	631	5	schneider­maunoury	schneider­maunoury	PROPN
ahs-14952	631	6	l.	l.	PROPN
ahs-14952	631	7	,	,	PUNCT
ahs-14952	631	8	martos	martos	ADJ
ahs-14952	631	9	f.	f.	PROPN
ahs-14952	631	10	,	,	PUNCT
ahs-14952	631	11	2018	2018	NUM
ahs-14952	631	12	­	­	NUM
ahs-14952	631	13	time	time	NOUN
ahs-14952	631	14	to	to	PART
ahs-14952	631	15	re‐think	re‐think	VERB
ahs-14952	631	16	fungal	fungal	ADJ
ahs-14952	631	17	ecology	ecology	NOUN
ahs-14952	631	18	?	?	PUNCT
ahs-14952	632	1	fungal	fungal	ADJ
ahs-14952	632	2	ecological	ecological	ADJ
ahs-14952	632	3	niches	niche	NOUN
ahs-14952	632	4	are	be	AUX
ahs-14952	632	5	often	often	ADV
ahs-14952	632	6	prejudged	prejudge	VERB
ahs-14952	632	7	.	.	PUNCT
ahs-14952	633	1	­	­	VERB
ahs-14952	633	2	new	new	ADJ
ahs-14952	633	3	phytol	phytol	NOUN
ahs-14952	633	4	.	.	PUNCT
ahs-14952	634	1	,	,	PUNCT
ahs-14952	635	1	217(3	217(3	NUM
ahs-14952	635	2	):	):	PUNCT
ahs-14952	635	3	968­972	968­972	NUM
ahs-14952	635	4	.	.	PUNCT
ahs-14952	636	1	sen	sen	PROPN
ahs-14952	636	2	r.	r.	PROPN
ahs-14952	636	3	,	,	PUNCT
ahs-14952	636	4	hietala	hietala	VERB
ahs-14952	636	5	a.m.	a.m.	ADV
ahs-14952	636	6	,	,	PUNCT
ahs-14952	636	7	zelmer	zelmer	PROPN
ahs-14952	636	8	c.d	c.d	PROPN
ahs-14952	636	9	.	.	PROPN
ahs-14952	636	10	,	,	PUNCT
ahs-14952	636	11	1999	1999	NUM
ahs-14952	636	12	­	­	VERB
ahs-14952	636	13	common	common	ADJ
ahs-14952	636	14	anastomosis	anastomosis	NOUN
ahs-14952	636	15	and	and	CCONJ
ahs-14952	636	16	internal	internal	ADJ
ahs-14952	636	17	transcribed	transcribe	VERB
ahs-14952	636	18	spacer	spacer	NOUN
ahs-14952	636	19	rflp	rflp	NOUN
ahs-14952	636	20	groupings	grouping	NOUN
ahs-14952	636	21	in	in	ADP
ahs-14952	636	22	binucleate	binucleate	NOUN
ahs-14952	636	23	rhizoctonia	rhizoctonia	NOUN
ahs-14952	636	24	isolates	isolate	NOUN
ahs-14952	636	25	representing	represent	VERB
ahs-14952	636	26	root	root	NOUN
ahs-14952	636	27	endophytes	endophyte	NOUN
ahs-14952	636	28	of	of	ADP
ahs-14952	636	29	pinus	pinus	NOUN
ahs-14952	636	30	sylvestris	sylvestris	NOUN
ahs-14952	636	31	,	,	PUNCT
ahs-14952	636	32	ceratorhiza	ceratorhiza	NOUN
ahs-14952	636	33	spp	spp	NOUN
ahs-14952	636	34	.	.	PUNCT
ahs-14952	637	1	from	from	ADP
ahs-14952	637	2	orchid	orchid	NOUN
ahs-14952	637	3	mycorrhizas	mycorrhiza	NOUN
ahs-14952	637	4	and	and	CCONJ
ahs-14952	637	5	a	a	DET
ahs-14952	637	6	phytopathogenic	phytopathogenic	ADJ
ahs-14952	637	7	anastomosis	anastomosis	NOUN
ahs-14952	637	8	group	group	NOUN
ahs-14952	637	9	.	.	PUNCT
ahs-14952	638	1	­	­	VERB
ahs-14952	638	2	new	new	ADJ
ahs-14952	638	3	phytol	phytol	NOUN
ahs-14952	638	4	.	.	PUNCT
ahs-14952	639	1	,	,	PUNCT
ahs-14952	640	1	144(2	144(2	NUM
ahs-14952	640	2	):	):	PUNCT
ahs-14952	640	3	331­	331­	NUM
ahs-14952	640	4	341	341	NUM
ahs-14952	640	5	.	.	PUNCT
ahs-14952	641	1	shah	shah	PROPN
ahs-14952	641	2	s.	s.	PROPN
ahs-14952	641	3	,	,	PUNCT
ahs-14952	641	4	shah	shah	PROPN
ahs-14952	641	5	b.	b.	PROPN
ahs-14952	641	6	,	,	PUNCT
ahs-14952	641	7	sharma	sharma	PROPN
ahs-14952	641	8	r.	r.	PROPN
ahs-14952	641	9	,	,	PUNCT
ahs-14952	641	10	rekadwad	rekadwad	PROPN
ahs-14952	641	11	b.	b.	PROPN
ahs-14952	641	12	,	,	PUNCT
ahs-14952	641	13	shouche	shouche	PROPN
ahs-14952	641	14	y.	y.	PROPN
ahs-14952	641	15	s.	s.	PROPN
ahs-14952	641	16	,	,	PUNCT
ahs-14952	641	17	sharma	sharma	PROPN
ahs-14952	641	18	j.	j.	PROPN
ahs-14952	641	19	,	,	PUNCT
ahs-14952	641	20	pant	pant	PROPN
ahs-14952	641	21	b.	b.	PROPN
ahs-14952	641	22	,	,	PUNCT
ahs-14952	641	23	2022	2022	NUM
ahs-14952	641	24	­	­	VERB
ahs-14952	641	25	colonization	colonization	NOUN
ahs-14952	641	26	with	with	ADP
ahs-14952	641	27	non‐	non‐	ADJ
ahs-14952	641	28	mycorrhizal	mycorrhizal	NOUN
ahs-14952	641	29	culturable	culturable	ADJ
ahs-14952	641	30	endophytic	endophytic	ADJ
ahs-14952	641	31	fungi	fungi	NOUN
ahs-14952	641	32	enhances	enhance	VERB
ahs-14952	641	33	orchid	orchid	NOUN
ahs-14952	641	34	growth	growth	NOUN
ahs-14952	641	35	and	and	CCONJ
ahs-14952	641	36	indole	indole	ADJ
ahs-14952	641	37	acetic	acetic	ADJ
ahs-14952	641	38	acid	acid	NOUN
ahs-14952	641	39	production	production	NOUN
ahs-14952	641	40	.	.	PUNCT
ahs-14952	642	1	­	­	PROPN
ahs-14952	642	2	bmc	bmc	PROPN
ahs-14952	642	3	microbiol	microbiol	PROPN
ahs-14952	642	4	.	.	PUNCT
ahs-14952	642	5	,	,	PUNCT
ahs-14952	642	6	22(1	22(1	NUM
ahs-14952	642	7	):	):	PUNCT
ahs-14952	642	8	1­13	1­13	NUM
ahs-14952	642	9	.	.	PUNCT
ahs-14952	643	1	shah	shah	PROPN
ahs-14952	643	2	s.	s.	PROPN
ahs-14952	643	3	,	,	PUNCT
ahs-14952	643	4	thapa	thapa	PROPN
ahs-14952	643	5	b.b	b.b	PROPN
ahs-14952	643	6	.	.	PROPN
ahs-14952	643	7	,	,	PUNCT
ahs-14952	643	8	chand	chand	PROPN
ahs-14952	643	9	k.	k.	PROPN
ahs-14952	643	10	,	,	PUNCT
ahs-14952	643	11	pradhan	pradhan	PROPN
ahs-14952	643	12	s.	s.	PROPN
ahs-14952	643	13	,	,	PUNCT
ahs-14952	643	14	singh	singh	PROPN
ahs-14952	643	15	a.	a.	NOUN
ahs-14952	643	16	,	,	PUNCT
ahs-14952	643	17	varma	varma	PROPN
ahs-14952	643	18	a.	a.	PROPN
ahs-14952	643	19	,	,	PUNCT
ahs-14952	643	20	thakuri	thakuri	PROPN
ahs-14952	643	21	l.	l.	PROPN
ahs-14952	643	22	s.	s.	PROPN
ahs-14952	643	23	,	,	PUNCT
ahs-14952	643	24	joshi	joshi	PROPN
ahs-14952	643	25	p.	p.	PROPN
ahs-14952	643	26	,	,	PUNCT
ahs-14952	643	27	pant	pant	PROPN
ahs-14952	643	28	b.	b.	PROPN
ahs-14952	643	29	,	,	PUNCT
ahs-14952	643	30	2019	2019	NUM
ahs-14952	643	31	­	­	PROPN
ahs-14952	643	32	piriformospora	piriformospora	NOUN
ahs-14952	643	33	indica	indica	PROPN
ahs-14952	643	34	promotes	promote	VERB
ahs-14952	643	35	the	the	DET
ahs-14952	643	36	growth	growth	NOUN
ahs-14952	643	37	of	of	ADP
ahs-14952	643	38	the	the	DET
ahs-14952	643	39	in­	in­	PROPN
ahs-14952	643	40	vitro‐raised	vitro‐raise	VERB
ahs-14952	643	41	cymbidium	cymbidium	NOUN
ahs-14952	643	42	aloifolium	aloifolium	NOUN
ahs-14952	643	43	plantlet	plantlet	NOUN
ahs-14952	643	44	and	and	CCONJ
ahs-14952	643	45	their	their	PRON
ahs-14952	643	46	acclimatization	acclimatization	NOUN
ahs-14952	643	47	.	.	PUNCT
ahs-14952	644	1	­	­	PROPN
ahs-14952	644	2	plant	plant	NOUN
ahs-14952	644	3	signal	signal	NOUN
ahs-14952	644	4	.	.	PUNCT
ahs-14952	645	1	behav	behav	PROPN
ahs-14952	645	2	.	.	PUNCT
ahs-14952	645	3	,	,	PUNCT
ahs-14952	645	4	14(6	14(6	NOUN
ahs-14952	645	5	):	):	PUNCT
ahs-14952	645	6	1­7	1­7	NUM
ahs-14952	645	7	.	.	PUNCT
ahs-14952	646	1	shan	shan	PROPN
ahs-14952	646	2	x.c	x.c	PROPN
ahs-14952	646	3	.	.	PROPN
ahs-14952	646	4	,	,	PUNCT
ahs-14952	646	5	liew	liew	PROPN
ahs-14952	646	6	e.c.y	e.c.y	PROPN
ahs-14952	646	7	.	.	PROPN
ahs-14952	646	8	,	,	PUNCT
ahs-14952	647	1	weatherhead	weatherhead	PROPN
ahs-14952	647	2	m.a	m.a	PROPN
ahs-14952	647	3	.	.	PROPN
ahs-14952	647	4	,	,	PUNCT
ahs-14952	647	5	hodgkiss	hodgkiss	PROPN
ahs-14952	647	6	i.j	i.j	PROPN
ahs-14952	647	7	.	.	PROPN
ahs-14952	647	8	,	,	PUNCT
ahs-14952	647	9	2002	2002	NUM
ahs-14952	647	10	­	­	NOUN
ahs-14952	647	11	characterization	characterization	NOUN
ahs-14952	647	12	and	and	CCONJ
ahs-14952	647	13	taxonomic	taxonomic	ADJ
ahs-14952	647	14	placement	placement	NOUN
ahs-14952	647	15	of	of	ADP
ahs-14952	647	16	rhizoctonia‐like	rhizoctonia‐like	ADJ
ahs-14952	647	17	endophytes	endophyte	NOUN
ahs-14952	647	18	from	from	ADP
ahs-14952	647	19	orchid	orchid	NOUN
ahs-14952	647	20	roots	root	NOUN
ahs-14952	647	21	.	.	PUNCT
ahs-14952	648	1	­	­	ADJ
ahs-14952	648	2	mycologia	mycologia	NOUN
ahs-14952	648	3	,	,	PUNCT
ahs-14952	648	4	94(2	94(2	NUM
ahs-14952	648	5	):	):	PUNCT
ahs-14952	648	6	230­239	230­239	NUM
ahs-14952	648	7	.	.	PUNCT
ahs-14952	649	1	shao	shao	PROPN
ahs-14952	649	2	s.c	s.c	PROPN
ahs-14952	649	3	.	.	PROPN
ahs-14952	649	4	,	,	PUNCT
ahs-14952	649	5	burgess	burgess	PROPN
ahs-14952	649	6	k.s	k.s	PROPN
ahs-14952	649	7	.	.	PROPN
ahs-14952	649	8	,	,	PUNCT
ahs-14952	649	9	cruse­sanders	cruse­sanders	PROPN
ahs-14952	649	10	j.m	j.m	PROPN
ahs-14952	649	11	.	.	PROPN
ahs-14952	649	12	,	,	PUNCT
ahs-14952	649	13	liu	liu	PROPN
ahs-14952	649	14	q.	q.	PROPN
ahs-14952	649	15	,	,	PUNCT
ahs-14952	649	16	fan	fan	PROPN
ahs-14952	649	17	x.l	x.l	PROPN
ahs-14952	649	18	.	.	PROPN
ahs-14952	649	19	,	,	PUNCT
ahs-14952	649	20	huang	huang	PROPN
ahs-14952	649	21	h.	h.	PROPN
ahs-14952	649	22	,	,	PUNCT
ahs-14952	649	23	gao	gao	PROPN
ahs-14952	649	24	j.y	j.y	PROPN
ahs-14952	649	25	.	.	PROPN
ahs-14952	649	26	,	,	PUNCT
ahs-14952	649	27	2017	2017	NUM
ahs-14952	649	28	­	­	VERB
ahs-14952	649	29	using	use	VERB
ahs-14952	649	30	in	in	ADP
ahs-14952	649	31	situ	situ	ADJ
ahs-14952	649	32	symbiotic	symbiotic	ADJ
ahs-14952	649	33	seed	seed	NOUN
ahs-14952	649	34	germination	germination	NOUN
ahs-14952	649	35	to	to	PART
ahs-14952	649	36	restore	restore	VERB
ahs-14952	649	37	over‐collected	over‐collected	ADJ
ahs-14952	649	38	medicinal	medicinal	ADJ
ahs-14952	649	39	orchids	orchid	NOUN
ahs-14952	649	40	in	in	ADP
ahs-14952	649	41	southwest	southwest	PROPN
ahs-14952	649	42	china	china	PROPN
ahs-14952	649	43	.	.	PUNCT
ahs-14952	650	1	­	­	PROPN
ahs-14952	650	2	front	front	ADJ
ahs-14952	650	3	.	.	PUNCT
ahs-14952	651	1	plant	plant	NOUN
ahs-14952	651	2	sci	sci	PROPN
ahs-14952	651	3	.	.	PROPN
ahs-14952	651	4	,	,	PUNCT
ahs-14952	651	5	8	8	NUM
ahs-14952	651	6	:	:	SYM
ahs-14952	651	7	1­10	1­10	NUM
ahs-14952	651	8	.	.	X
ahs-14952	652	1	shao	shao	PROPN
ahs-14952	652	2	s.c	s.c	PROPN
ahs-14952	652	3	.	.	PROPN
ahs-14952	652	4	,	,	PUNCT
ahs-14952	652	5	wang	wang	PROPN
ahs-14952	652	6	q.x	q.x	PROPN
ahs-14952	652	7	.	.	PROPN
ahs-14952	652	8	,	,	PUNCT
ahs-14952	652	9	beng	beng	PROPN
ahs-14952	652	10	k.c	k.c	PROPN
ahs-14952	652	11	.	.	PROPN
ahs-14952	652	12	,	,	PUNCT
ahs-14952	652	13	zhao	zhao	PROPN
ahs-14952	652	14	d.k	d.k	PROPN
ahs-14952	652	15	.	.	PROPN
ahs-14952	652	16	,	,	PUNCT
ahs-14952	652	17	jacquemyn	jacquemyn	PROPN
ahs-14952	652	18	h.	h.	PROPN
ahs-14952	652	19	,	,	PUNCT
ahs-14952	652	20	2020	2020	NUM
ahs-14952	652	21	­	­	NUM
ahs-14952	652	22	fungi	fungus	NOUN
ahs-14952	652	23	isolated	isolate	VERB
ahs-14952	652	24	from	from	ADP
ahs-14952	652	25	host	host	NOUN
ahs-14952	652	26	protocorms	protocorm	NOUN
ahs-14952	652	27	accelerate	accelerate	VERB
ahs-14952	652	28	symbiotic	symbiotic	ADJ
ahs-14952	652	29	seed	seed	NOUN
ahs-14952	652	30	germination	germination	NOUN
ahs-14952	652	31	in	in	ADP
ahs-14952	652	32	an	an	DET
ahs-14952	652	33	endangered	endangered	ADJ
ahs-14952	652	34	orchid	orchid	NOUN
ahs-14952	652	35	species	specie	NOUN
ahs-14952	652	36	(	(	PUNCT
ahs-14952	652	37	dendrobium	dendrobium	NOUN
ahs-14952	652	38	chrysotoxum	chrysotoxum	NOUN
ahs-14952	652	39	)	)	PUNCT
ahs-14952	652	40	from	from	ADP
ahs-14952	652	41	southern	southern	ADJ
ahs-14952	652	42	china	china	PROPN
ahs-14952	652	43	.	.	PUNCT
ahs-14952	653	1	­	­	PROPN
ahs-14952	653	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	653	3	,	,	PUNCT
ahs-14952	653	4	30(4	30(4	NUM
ahs-14952	653	5	):	):	PUNCT
ahs-14952	653	6	529­539	529­539	PROPN
ahs-14952	653	7	.	.	PUNCT
ahs-14952	654	1	shemesh	shemesh	PROPN
ahs-14952	654	2	h.	h.	PROPN
ahs-14952	654	3	,	,	PUNCT
ahs-14952	654	4	boaz	boaz	PROPN
ahs-14952	654	5	b.e	b.e	PROPN
ahs-14952	654	6	.	.	PROPN
ahs-14952	654	7	,	,	PUNCT
ahs-14952	654	8	millar	millar	PROPN
ahs-14952	654	9	c.i	c.i	PROPN
ahs-14952	654	10	.	.	PROPN
ahs-14952	654	11	,	,	PUNCT
ahs-14952	654	12	bruns	bruns	PROPN
ahs-14952	654	13	t.d	t.d	PROPN
ahs-14952	654	14	.	.	PROPN
ahs-14952	654	15	,	,	PUNCT
ahs-14952	654	16	2020	2020	NUM
ahs-14952	654	17	­	­	VERB
ahs-14952	654	18	symbiotic	symbiotic	ADJ
ahs-14952	654	19	interactions	interaction	NOUN
ahs-14952	654	20	above	above	ADP
ahs-14952	654	21	treeline	treeline	NOUN
ahs-14952	654	22	of	of	ADP
ahs-14952	654	23	long‐lived	long‐live	VERB
ahs-14952	654	24	pines	pine	NOUN
ahs-14952	654	25	:	:	PUNCT
ahs-14952	654	26	mycorrhizal	mycorrhizal	NOUN
ahs-14952	654	27	advantage	advantage	NOUN
ahs-14952	654	28	of	of	ADP
ahs-14952	654	29	limber	limber	NOUN
ahs-14952	654	30	pine	pine	NOUN
ahs-14952	654	31	(	(	PUNCT
ahs-14952	654	32	pinus	pinus	NOUN
ahs-14952	654	33	flexilis	flexilis	PROPN
ahs-14952	654	34	)	)	PUNCT
ahs-14952	654	35	over	over	ADP
ahs-14952	654	36	great	great	ADJ
ahs-14952	654	37	basin	basin	NOUN
ahs-14952	654	38	bristlecone	bristlecone	NOUN
ahs-14952	654	39	pine	pine	NOUN
ahs-14952	654	40	(	(	PUNCT
ahs-14952	654	41	pinus	pinus	NOUN
ahs-14952	654	42	shamsudin	shamsudin	VERB
ahs-14952	654	43	et	et	PROPN
ahs-14952	654	44	al	al	PROPN
ahs-14952	654	45	.	.	PROPN
ahs-14952	655	1	‐	‐	ADP
ahs-14952	655	2	molecular	molecular	ADJ
ahs-14952	655	3	identification	identification	NOUN
ahs-14952	655	4	of	of	ADP
ahs-14952	655	5	orchid	orchid	NOUN
ahs-14952	655	6	mycorrhiza	mycorrhiza	PROPN
ahs-14952	655	7	115	115	NUM
ahs-14952	655	8	longaeva	longaeva	NOUN
ahs-14952	655	9	)	)	PUNCT
ahs-14952	655	10	at	at	ADP
ahs-14952	655	11	the	the	DET
ahs-14952	655	12	seedling	seedling	NOUN
ahs-14952	655	13	stage	stage	NOUN
ahs-14952	655	14	.	.	PUNCT
ahs-14952	656	1	­	­	PROPN
ahs-14952	656	2	j.	j.	PROPN
ahs-14952	656	3	ecol	ecol	PROPN
ahs-14952	656	4	.	.	PUNCT
ahs-14952	657	1	,	,	PUNCT
ahs-14952	657	2	108(3	108(3	NUM
ahs-14952	657	3	):	):	PUNCT
ahs-14952	657	4	908­	908­	NOUN
ahs-14952	657	5	916	916	NUM
ahs-14952	657	6	.	.	PUNCT
ahs-14952	658	1	sisti	sisti	PROPN
ahs-14952	659	1	l.s	l.s	PROPN
ahs-14952	659	2	.	.	PROPN
ahs-14952	659	3	,	,	PUNCT
ahs-14952	659	4	flores­borges	flores­borge	VERB
ahs-14952	659	5	d.n.a	d.n.a	NOUN
ahs-14952	659	6	.	.	PROPN
ahs-14952	659	7	,	,	PUNCT
ahs-14952	659	8	de	de	PROPN
ahs-14952	659	9	andrade	andrade	PROPN
ahs-14952	659	10	s.a.l	s.a.l	PROPN
ahs-14952	659	11	.	.	PROPN
ahs-14952	659	12	,	,	PUNCT
ahs-14952	659	13	koehler	koehler	PROPN
ahs-14952	659	14	s.	s.	PROPN
ahs-14952	659	15	,	,	PUNCT
ahs-14952	659	16	bonatelli	bonatelli	PROPN
ahs-14952	659	17	m.l	m.l	PROPN
ahs-14952	659	18	.	.	PROPN
ahs-14952	659	19	,	,	PUNCT
ahs-14952	660	1	sampaio	sampaio	PROPN
ahs-14952	660	2	mayer	mayer	PROPN
ahs-14952	660	3	j.l	j.l	PROPN
ahs-14952	660	4	.	.	PROPN
ahs-14952	660	5	,	,	PUNCT
ahs-14952	660	6	2019	2019	NUM
ahs-14952	660	7	­	­	VERB
ahs-14952	660	8	the	the	DET
ahs-14952	660	9	role	role	NOUN
ahs-14952	660	10	of	of	ADP
ahs-14952	660	11	non‐mycorrhizal	non‐mycorrhizal	NUM
ahs-14952	660	12	fungi	fungi	VERB
ahs-14952	660	13	in	in	ADP
ahs-14952	660	14	germination	germination	NOUN
ahs-14952	660	15	of	of	ADP
ahs-14952	660	16	the	the	DET
ahs-14952	660	17	mycoheterotrophic	mycoheterotrophic	ADJ
ahs-14952	660	18	orchid	orchid	NOUN
ahs-14952	660	19	pogoniopsis	pogoniopsis	NOUN
ahs-14952	660	20	schenckii	schenckii	PROPN
ahs-14952	660	21	cogn	cogn	VERB
ahs-14952	660	22	.	.	PUNCT
ahs-14952	661	1	­	­	PROPN
ahs-14952	661	2	front	front	ADJ
ahs-14952	661	3	.	.	PUNCT
ahs-14952	662	1	plant	plant	NOUN
ahs-14952	662	2	sci	sci	PROPN
ahs-14952	662	3	.	.	PROPN
ahs-14952	662	4	,	,	PUNCT
ahs-14952	662	5	10	10	NUM
ahs-14952	662	6	:	:	SYM
ahs-14952	662	7	1­13	1­13	NUM
ahs-14952	662	8	.	.	PUNCT
ahs-14952	662	9	slatko	slatko	PROPN
ahs-14952	663	1	b.e	b.e	PROPN
ahs-14952	663	2	.	.	PROPN
ahs-14952	663	3	,	,	PUNCT
ahs-14952	663	4	gardner	gardner	PROPN
ahs-14952	663	5	a.f	a.f	PROPN
ahs-14952	663	6	.	.	PROPN
ahs-14952	663	7	,	,	PUNCT
ahs-14952	663	8	ausubel	ausubel	PROPN
ahs-14952	663	9	f.m	f.m	PROPN
ahs-14952	663	10	.	.	PROPN
ahs-14952	663	11	,	,	PUNCT
ahs-14952	663	12	2018	2018	NUM
ahs-14952	663	13	­	­	VERB
ahs-14952	663	14	overview	overview	NOUN
ahs-14952	663	15	of	of	ADP
ahs-14952	663	16	next‐generation	next‐generation	NOUN
ahs-14952	663	17	sequencing	sequence	VERB
ahs-14952	663	18	technologies.‐	technologies.‐	PROPN
ahs-14952	663	19	curr	curr	PROPN
ahs-14952	663	20	.	.	PUNCT
ahs-14952	664	1	protoc	protoc	PROPN
ahs-14952	664	2	.	.	PUNCT
ahs-14952	665	1	mol	mol	PROPN
ahs-14952	665	2	.	.	PUNCT
ahs-14952	666	1	biol	biol	PROPN
ahs-14952	666	2	.	.	PUNCT
ahs-14952	666	3	,	,	PUNCT
ahs-14952	666	4	122(1	122(1	NUM
ahs-14952	666	5	):	):	PUNCT
ahs-14952	666	6	1­11	1­11	NUM
ahs-14952	666	7	.	.	PUNCT
ahs-14952	667	1	srivastava	srivastava	PROPN
ahs-14952	667	2	s.	s.	PROPN
ahs-14952	667	3	,	,	PUNCT
ahs-14952	667	4	kadooka	kadooka	PROPN
ahs-14952	667	5	c.	c.	PROPN
ahs-14952	667	6	,	,	PUNCT
ahs-14952	667	7	uchida	uchida	PROPN
ahs-14952	667	8	j.y	j.y	PROPN
ahs-14952	667	9	.	.	PROPN
ahs-14952	667	10	,	,	PUNCT
ahs-14952	667	11	2018	2018	NUM
ahs-14952	667	12	­	­	PROPN
ahs-14952	667	13	fusarium	fusarium	NOUN
ahs-14952	667	14	species	specie	NOUN
ahs-14952	667	15	as	as	ADP
ahs-14952	667	16	pathogen	pathogen	NOUN
ahs-14952	667	17	on	on	ADP
ahs-14952	667	18	orchids	orchid	NOUN
ahs-14952	667	19	.	.	PUNCT
ahs-14952	668	1	­	­	PROPN
ahs-14952	668	2	microbiol	microbiol	PROPN
ahs-14952	668	3	.	.	PUNCT
ahs-14952	669	1	res	re	NOUN
ahs-14952	669	2	.	.	PROPN
ahs-14952	669	3	,	,	PUNCT
ahs-14952	669	4	207	207	NUM
ahs-14952	669	5	:	:	PUNCT
ahs-14952	669	6	188­195	188­195	NUM
ahs-14952	669	7	.	.	PUNCT
ahs-14952	669	8	strugnell	strugnell	PROPN
ahs-14952	669	9	j.	j.	PROPN
ahs-14952	669	10	,	,	PUNCT
ahs-14952	669	11	norman	norman	PROPN
ahs-14952	669	12	m.	m.	PROPN
ahs-14952	669	13	,	,	PUNCT
ahs-14952	669	14	cooper	cooper	PROPN
ahs-14952	669	15	a.	a.	PROPN
ahs-14952	669	16	,	,	PUNCT
ahs-14952	669	17	2006	2006	NUM
ahs-14952	669	18	­	­	VERB
ahs-14952	669	19	dna	dna	PROPN
ahs-14952	669	20	from	from	ADP
ahs-14952	669	21	beach‐washed	beach‐washe	VERB
ahs-14952	669	22	shells	shell	NOUN
ahs-14952	669	23	of	of	ADP
ahs-14952	669	24	the	the	DET
ahs-14952	669	25	ram	ram	NOUN
ahs-14952	669	26	’s	’s	PART
ahs-14952	669	27	horn	horn	NOUN
ahs-14952	669	28	squid	squid	NOUN
ahs-14952	669	29	,	,	PUNCT
ahs-14952	669	30	spirula	spirula	NOUN
ahs-14952	669	31	spirula	spirula	NOUN
ahs-14952	669	32	.	.	PUNCT
ahs-14952	670	1	­	­	PROPN
ahs-14952	670	2	bull	bull	PROPN
ahs-14952	670	3	.	.	PUNCT
ahs-14952	671	1	mar	mar	PROPN
ahs-14952	671	2	.	.	PUNCT
ahs-14952	671	3	sci	sci	PROPN
ahs-14952	671	4	.	.	PROPN
ahs-14952	671	5	,	,	PUNCT
ahs-14952	672	1	78(2	78(2	X
ahs-14952	672	2	):	):	PUNCT
ahs-14952	672	3	389­391	389­391	NUM
ahs-14952	672	4	.	.	PUNCT
ahs-14952	672	5	suárez	suárez	PROPN
ahs-14952	672	6	j.p	j.p	PROPN
ahs-14952	672	7	.	.	PROPN
ahs-14952	672	8	,	,	PUNCT
ahs-14952	672	9	weiß	weiß	PROPN
ahs-14952	672	10	m.	m.	NOUN
ahs-14952	672	11	,	,	PUNCT
ahs-14952	672	12	abele	abele	PROPN
ahs-14952	672	13	a.	a.	PROPN
ahs-14952	672	14	,	,	PUNCT
ahs-14952	672	15	garnica	garnica	PROPN
ahs-14952	672	16	s.	s.	PROPN
ahs-14952	672	17	,	,	PUNCT
ahs-14952	672	18	oberwinkler	oberwinkler	PROPN
ahs-14952	672	19	f.	f.	PROPN
ahs-14952	672	20	,	,	PUNCT
ahs-14952	672	21	kottke	kottke	PROPN
ahs-14952	672	22	i.	i.	PROPN
ahs-14952	672	23	,	,	PUNCT
ahs-14952	672	24	2006	2006	NUM
ahs-14952	672	25	­	­	VERB
ahs-14952	672	26	diverse	diverse	ADJ
ahs-14952	672	27	tulasnelloid	tulasnelloid	ADJ
ahs-14952	672	28	fungi	fungi	PROPN
ahs-14952	672	29	form	form	NOUN
ahs-14952	672	30	mycorrhizas	mycorrhiza	VERB
ahs-14952	672	31	with	with	ADP
ahs-14952	672	32	epiphytic	epiphytic	ADJ
ahs-14952	672	33	orchids	orchid	NOUN
ahs-14952	672	34	in	in	ADP
ahs-14952	672	35	an	an	DET
ahs-14952	672	36	andean	andean	ADJ
ahs-14952	672	37	cloud	cloud	NOUN
ahs-14952	672	38	forest	forest	NOUN
ahs-14952	672	39	.	.	PUNCT
ahs-14952	673	1	­	­	VERB
ahs-14952	673	2	mycol	mycol	PROPN
ahs-14952	673	3	.	.	PUNCT
ahs-14952	674	1	res	re	NOUN
ahs-14952	674	2	.	.	PROPN
ahs-14952	674	3	,	,	PUNCT
ahs-14952	674	4	110(11	110(11	NUM
ahs-14952	674	5	):	):	PUNCT
ahs-14952	674	6	1257­	1257­	NUM
ahs-14952	674	7	1270	1270	NUM
ahs-14952	674	8	.	.	PUNCT
ahs-14952	675	1	suetsugu	suetsugu	ADJ
ahs-14952	675	2	k.	k.	PROPN
ahs-14952	675	3	,	,	PUNCT
ahs-14952	675	4	haraguchi	haraguchi	PROPN
ahs-14952	675	5	t.f	t.f	PROPN
ahs-14952	675	6	.	.	PROPN
ahs-14952	675	7	,	,	PUNCT
ahs-14952	675	8	tanabe	tanabe	PROPN
ahs-14952	675	9	a.s	a.s	PROPN
ahs-14952	675	10	.	.	PROPN
ahs-14952	675	11	,	,	PUNCT
ahs-14952	675	12	tayasun	tayasun	PROPN
ahs-14952	675	13	i.	i.	PROPN
ahs-14952	675	14	,	,	PUNCT
ahs-14952	675	15	2021	2021	NUM
ahs-14952	675	16	­	­	VERB
ahs-14952	675	17	specialized	specialized	ADJ
ahs-14952	675	18	mycorrhizal	mycorrhizal	NOUN
ahs-14952	675	19	association	association	NOUN
ahs-14952	675	20	between	between	ADP
ahs-14952	675	21	a	a	DET
ahs-14952	675	22	partially	partially	ADV
ahs-14952	675	23	mycoheterotrophic	mycoheterotrophic	ADJ
ahs-14952	675	24	orchid	orchid	NOUN
ahs-14952	675	25	oreorchis	oreorchis	PRON
ahs-14952	675	26	indica	indica	NOUN
ahs-14952	675	27	and	and	CCONJ
ahs-14952	675	28	a	a	DET
ahs-14952	675	29	tomentella	tomentella	NOUN
ahs-14952	675	30	taxon	taxon	ADJ
ahs-14952	675	31	.	.	PUNCT
ahs-14952	676	1	­	­	PROPN
ahs-14952	676	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	676	3	,	,	PUNCT
ahs-14952	676	4	31(2	31(2	NUM
ahs-14952	676	5	):	):	PUNCT
ahs-14952	676	6	243­250	243­250	NUM
ahs-14952	676	7	.	.	PUNCT
ahs-14952	677	1	sukarno	sukarno	PROPN
ahs-14952	677	2	n.	n.	PROPN
ahs-14952	677	3	,	,	PUNCT
ahs-14952	677	4	mursidawati	mursidawati	PROPN
ahs-14952	677	5	s.	s.	PROPN
ahs-14952	677	6	,	,	PUNCT
ahs-14952	677	7	listiyowati	listiyowati	PROPN
ahs-14952	677	8	s.	s.	PROPN
ahs-14952	677	9	,	,	PUNCT
ahs-14952	677	10	nugraha	nugraha	PROPN
ahs-14952	677	11	n.h	n.h	PROPN
ahs-14952	677	12	.	.	PROPN
ahs-14952	677	13	,	,	PUNCT
ahs-14952	677	14	fadillah	fadillah	PROPN
ahs-14952	677	15	w.n	w.n	PROPN
ahs-14952	677	16	.	.	PROPN
ahs-14952	677	17	,	,	PUNCT
ahs-14952	677	18	waite	waite	PROPN
ahs-14952	677	19	m.	m.	NOUN
ahs-14952	677	20	,	,	PUNCT
ahs-14952	677	21	2023	2023	NUM
ahs-14952	677	22	­	­	NUM
ahs-14952	677	23	root	root	NOUN
ahs-14952	677	24	associated	associate	VERB
ahs-14952	677	25	fusarium	fusarium	NOUN
ahs-14952	677	26	solani	solani	NOUN
ahs-14952	677	27	species	specie	NOUN
ahs-14952	677	28	complex	complex	NOUN
ahs-14952	677	29	(	(	PUNCT
ahs-14952	677	30	fssc	fssc	NOUN
ahs-14952	677	31	)	)	PUNCT
ahs-14952	677	32	in	in	ADP
ahs-14952	677	33	epiphytic	epiphytic	ADJ
ahs-14952	677	34	and	and	CCONJ
ahs-14952	677	35	terrestrial	terrestrial	ADJ
ahs-14952	677	36	orchids	orchid	NOUN
ahs-14952	677	37	.	.	PUNCT
ahs-14952	678	1	­	­	PROPN
ahs-14952	678	2	biodiversitas	biodiversita	NOUN
ahs-14952	678	3	j.	j.	PROPN
ahs-14952	678	4	biol	biol	PROPN
ahs-14952	678	5	.	.	PUNCT
ahs-14952	679	1	div	div	PROPN
ahs-14952	679	2	.	.	PROPN
ahs-14952	679	3	,	,	PUNCT
ahs-14952	679	4	24(5	24(5	NUM
ahs-14952	679	5	):	):	PUNCT
ahs-14952	679	6	2577­2586	2577­2586	NUM
ahs-14952	679	7	.	.	X
ahs-14952	679	8	suresh	suresh	PROPN
ahs-14952	679	9	l.	l.	PROPN
ahs-14952	679	10	,	,	PUNCT
ahs-14952	679	11	raveendran	raveendran	PROPN
ahs-14952	679	12	r.	r.	PROPN
ahs-14952	679	13	,	,	PUNCT
ahs-14952	679	14	decruse	decruse	PROPN
ahs-14952	679	15	w.	w.	PROPN
ahs-14952	679	16	,	,	PUNCT
ahs-14952	679	17	2023	2023	NUM
ahs-14952	679	18	­	­	NUM
ahs-14952	679	19	specific	specific	ADJ
ahs-14952	679	20	primers	primer	NOUN
ahs-14952	679	21	improve	improve	VERB
ahs-14952	679	22	the	the	DET
ahs-14952	679	23	characterizations	characterization	NOUN
ahs-14952	679	24	.	.	PUNCT
ahs-14952	680	1	­	­	PROPN
ahs-14952	680	2	plant	plant	PROPN
ahs-14952	680	3	sci	sci	PROPN
ahs-14952	680	4	.	.	PUNCT
ahs-14952	681	1	today	today	NOUN
ahs-14952	681	2	,	,	PUNCT
ahs-14952	681	3	10(3	10(3	NUM
ahs-14952	681	4	):	):	PUNCT
ahs-14952	681	5	375­384	375­384	NUM
ahs-14952	681	6	.	.	PUNCT
ahs-14952	682	1	taylor	taylor	PROPN
ahs-14952	682	2	d.l	d.l	PROPN
ahs-14952	682	3	.	.	PROPN
ahs-14952	682	4	,	,	PUNCT
ahs-14952	682	5	bruns	bruns	PROPN
ahs-14952	682	6	t.d	t.d	PROPN
ahs-14952	682	7	.	.	PROPN
ahs-14952	682	8	,	,	PUNCT
ahs-14952	682	9	1999	1999	NUM
ahs-14952	682	10	­	­	VERB
ahs-14952	682	11	community	community	NOUN
ahs-14952	682	12	structure	structure	NOUN
ahs-14952	682	13	of	of	ADP
ahs-14952	682	14	ectomycorrhizal	ectomycorrhizal	NOUN
ahs-14952	682	15	fungi	fungus	NOUN
ahs-14952	682	16	in	in	ADP
ahs-14952	682	17	a	a	DET
ahs-14952	682	18	pinus	pinus	NOUN
ahs-14952	682	19	muricata	muricata	NOUN
ahs-14952	682	20	forest	forest	NOUN
ahs-14952	682	21	:	:	PUNCT
ahs-14952	682	22	minimal	minimal	ADJ
ahs-14952	682	23	overlap	overlap	NOUN
ahs-14952	682	24	between	between	ADP
ahs-14952	682	25	the	the	DET
ahs-14952	682	26	mature	mature	ADJ
ahs-14952	682	27	forest	forest	NOUN
ahs-14952	682	28	and	and	CCONJ
ahs-14952	682	29	resistant	resistant	ADJ
ahs-14952	682	30	propagule	propagule	NOUN
ahs-14952	682	31	communities	community	NOUN
ahs-14952	682	32	.	.	PUNCT
ahs-14952	683	1	­	­	PROPN
ahs-14952	683	2	mol	mol	PROPN
ahs-14952	683	3	.	.	PUNCT
ahs-14952	683	4	ecol	ecol	PROPN
ahs-14952	683	5	.	.	PUNCT
ahs-14952	683	6	,	,	PUNCT
ahs-14952	683	7	8(11	8(11	NUM
ahs-14952	683	8	):	):	PUNCT
ahs-14952	683	9	1837­1850	1837­1850	NUM
ahs-14952	683	10	.	.	PUNCT
ahs-14952	684	1	taylor	taylor	PROPN
ahs-14952	684	2	d.l	d.l	PROPN
ahs-14952	684	3	.	.	PROPN
ahs-14952	684	4	,	,	PUNCT
ahs-14952	684	5	mccormick	mccormick	PROPN
ahs-14952	684	6	m.k	m.k	PROPN
ahs-14952	684	7	.	.	PROPN
ahs-14952	684	8	,	,	PUNCT
ahs-14952	684	9	2008	2008	NUM
ahs-14952	684	10	­	­	VERB
ahs-14952	684	11	internal	internal	ADJ
ahs-14952	684	12	transcribed	transcribe	VERB
ahs-14952	684	13	spacer	spacer	NOUN
ahs-14952	684	14	primers	primer	NOUN
ahs-14952	684	15	and	and	CCONJ
ahs-14952	684	16	sequences	sequence	NOUN
ahs-14952	684	17	for	for	ADP
ahs-14952	684	18	improved	improved	ADJ
ahs-14952	684	19	characterization	characterization	NOUN
ahs-14952	684	20	of	of	ADP
ahs-14952	684	21	basidiomycetous	basidiomycetous	ADJ
ahs-14952	684	22	orchid	orchid	NOUN
ahs-14952	684	23	mycorrhizas	mycorrhiza	NOUN
ahs-14952	684	24	.	.	PUNCT
ahs-14952	685	1	­	­	VERB
ahs-14952	685	2	new	new	ADJ
ahs-14952	685	3	phytol	phytol	NOUN
ahs-14952	685	4	.	.	PUNCT
ahs-14952	686	1	,	,	PUNCT
ahs-14952	686	2	177(4	177(4	NUM
ahs-14952	686	3	):	):	PUNCT
ahs-14952	686	4	1020­1033	1020­1033	NUM
ahs-14952	686	5	.	.	PUNCT
ahs-14952	687	1	tedersoo	tedersoo	PROPN
ahs-14952	687	2	l.	l.	PROPN
ahs-14952	687	3	,	,	PUNCT
ahs-14952	687	4	anslan	anslan	PROPN
ahs-14952	687	5	s.	s.	PROPN
ahs-14952	687	6	,	,	PUNCT
ahs-14952	687	7	bahram	bahram	PROPN
ahs-14952	687	8	m.	m.	NOUN
ahs-14952	687	9	,	,	PUNCT
ahs-14952	687	10	põlme	põlme	PROPN
ahs-14952	687	11	s.	s.	PROPN
ahs-14952	687	12	,	,	PUNCT
ahs-14952	687	13	riit	riit	PROPN
ahs-14952	687	14	t.	t.	PROPN
ahs-14952	687	15	,	,	PUNCT
ahs-14952	687	16	liiv	liiv	PROPN
ahs-14952	687	17	i.	i.	PROPN
ahs-14952	687	18	,	,	PUNCT
ahs-14952	687	19	kõljalg	kõljalg	PROPN
ahs-14952	687	20	u.	u.	PROPN
ahs-14952	687	21	,	,	PUNCT
ahs-14952	687	22	kisand	kisand	PROPN
ahs-14952	687	23	v.	v.	PROPN
ahs-14952	687	24	,	,	PUNCT
ahs-14952	687	25	nilsson	nilsson	PROPN
ahs-14952	687	26	r.h	r.h	PROPN
ahs-14952	687	27	.	.	PROPN
ahs-14952	687	28	,	,	PUNCT
ahs-14952	687	29	hildebrand	hildebrand	PROPN
ahs-14952	687	30	f.	f.	PROPN
ahs-14952	687	31	,	,	PUNCT
ahs-14952	687	32	bork	bork	PROPN
ahs-14952	687	33	p.	p.	PROPN
ahs-14952	687	34	,	,	PUNCT
ahs-14952	687	35	abarenkov	abarenkov	PROPN
ahs-14952	687	36	k.	k.	PROPN
ahs-14952	687	37	,	,	PUNCT
ahs-14952	687	38	2015	2015	NUM
ahs-14952	687	39	­	­	PROPN
ahs-14952	687	40	shotgun	shotgun	PROPN
ahs-14952	687	41	metagenomes	metagenome	NOUN
ahs-14952	687	42	and	and	CCONJ
ahs-14952	687	43	multiple	multiple	ADJ
ahs-14952	687	44	primer	primer	NOUN
ahs-14952	687	45	pair‐	pair‐	X
ahs-14952	687	46	barcode	barcode	NOUN
ahs-14952	687	47	combinations	combination	NOUN
ahs-14952	687	48	of	of	ADP
ahs-14952	687	49	amplicons	amplicon	NOUN
ahs-14952	687	50	reveal	reveal	VERB
ahs-14952	687	51	biases	bias	NOUN
ahs-14952	687	52	in	in	ADP
ahs-14952	687	53	metabarcoding	metabarcode	VERB
ahs-14952	687	54	analyses	analysis	NOUN
ahs-14952	687	55	of	of	ADP
ahs-14952	687	56	fungi	fungi	PROPN
ahs-14952	687	57	.	.	PUNCT
ahs-14952	688	1	­	­	PROPN
ahs-14952	688	2	mycokeys	mycokey	NOUN
ahs-14952	688	3	,	,	PUNCT
ahs-14952	688	4	10	10	NUM
ahs-14952	688	5	:	:	PUNCT
ahs-14952	688	6	1­43	1­43	NUM
ahs-14952	688	7	.	.	PUNCT
ahs-14952	689	1	tedersoo	tedersoo	PROPN
ahs-14952	689	2	l.	l.	PROPN
ahs-14952	689	3	,	,	PUNCT
ahs-14952	689	4	bahram	bahram	PROPN
ahs-14952	689	5	m.	m.	NOUN
ahs-14952	689	6	,	,	PUNCT
ahs-14952	689	7	põlme	põlme	PROPN
ahs-14952	689	8	s.	s.	PROPN
ahs-14952	689	9	,	,	PUNCT
ahs-14952	689	10	kõljalg	kõljalg	PROPN
ahs-14952	689	11	u.	u.	PROPN
ahs-14952	689	12	,	,	PUNCT
ahs-14952	689	13	yorou	yorou	PROPN
ahs-14952	689	14	n.s	n.s	PROPN
ahs-14952	689	15	.	.	PROPN
ahs-14952	689	16	,	,	PUNCT
ahs-14952	689	17	wijesundera	wijesundera	PROPN
ahs-14952	689	18	r.	r.	PROPN
ahs-14952	689	19	,	,	PUNCT
ahs-14952	689	20	ruiz	ruiz	PROPN
ahs-14952	689	21	l.v	l.v	PROPN
ahs-14952	689	22	.	.	PROPN
ahs-14952	689	23	,	,	PUNCT
ahs-14952	689	24	vasco­palacios	vasco­palacio	NOUN
ahs-14952	689	25	a.	a.	NOUN
ahs-14952	689	26	m.	m.	NOUN
ahs-14952	689	27	,	,	PUNCT
ahs-14952	689	28	thu	thu	PROPN
ahs-14952	689	29	p.q	p.q	PROPN
ahs-14952	689	30	.	.	PROPN
ahs-14952	689	31	,	,	PUNCT
ahs-14952	689	32	suija	suija	PROPN
ahs-14952	689	33	a.	a.	PROPN
ahs-14952	689	34	,	,	PUNCT
ahs-14952	689	35	smith	smith	PROPN
ahs-14952	689	36	m.e	m.e	PROPN
ahs-14952	689	37	.	.	PROPN
ahs-14952	689	38	,	,	PUNCT
ahs-14952	689	39	sharp	sharp	PROPN
ahs-14952	689	40	c.	c.	PROPN
ahs-14952	689	41	,	,	PUNCT
ahs-14952	689	42	saluveer	saluveer	PROPN
ahs-14952	689	43	e.	e.	PROPN
ahs-14952	689	44	,	,	PUNCT
ahs-14952	689	45	saitta	saitta	PROPN
ahs-14952	689	46	a.	a.	PROPN
ahs-14952	689	47	,	,	PUNCT
ahs-14952	689	48	rosas	rosas	PROPN
ahs-14952	689	49	m.	m.	PROPN
ahs-14952	689	50	,	,	PUNCT
ahs-14952	689	51	riit	riit	PROPN
ahs-14952	689	52	t.	t.	PROPN
ahs-14952	689	53	,	,	PUNCT
ahs-14952	689	54	ratkowsky	ratkowsky	PROPN
ahs-14952	689	55	d.	d.	PROPN
ahs-14952	689	56	,	,	PUNCT
ahs-14952	689	57	pritsch	pritsch	PROPN
ahs-14952	689	58	k.	k.	PROPN
ahs-14952	689	59	,	,	PUNCT
ahs-14952	689	60	põldmaa	põldmaa	PROPN
ahs-14952	689	61	k.	k.	PROPN
ahs-14952	689	62	,	,	PUNCT
ahs-14952	689	63	piepenbring	piepenbre	VERB
ahs-14952	689	64	m.	m.	NOUN
ahs-14952	689	65	,	,	PUNCT
ahs-14952	689	66	phosri	phosri	PROPN
ahs-14952	689	67	c.	c.	PROPN
ahs-14952	689	68	,	,	PUNCT
ahs-14952	689	69	peterson	peterson	NOUN
ahs-14952	689	70	m.	m.	NOUN
ahs-14952	689	71	,	,	PUNCT
ahs-14952	689	72	parts	part	NOUN
ahs-14952	689	73	k.	k.	PROPN
ahs-14952	689	74	,	,	PUNCT
ahs-14952	689	75	pärtel	pärtel	PROPN
ahs-14952	689	76	k.	k.	PROPN
ahs-14952	689	77	,	,	PUNCT
ahs-14952	689	78	otsing	otsing	PROPN
ahs-14952	689	79	e.	e.	PROPN
ahs-14952	689	80	,	,	PUNCT
ahs-14952	689	81	nouhra	nouhra	PROPN
ahs-14952	689	82	e.	e.	PROPN
ahs-14952	689	83	,	,	PUNCT
ahs-14952	689	84	njouonkou	njouonkou	PROPN
ahs-14952	689	85	a.l	a.l	PROPN
ahs-14952	689	86	.	.	PROPN
ahs-14952	689	87	,	,	PUNCT
ahs-14952	689	88	nilsson	nilsson	PROPN
ahs-14952	689	89	r.h	r.h	PROPN
ahs-14952	689	90	.	.	PROPN
ahs-14952	689	91	,	,	PUNCT
ahs-14952	689	92	morgado	morgado	PROPN
ahs-14952	689	93	l.n	l.n	PROPN
ahs-14952	689	94	.	.	PROPN
ahs-14952	689	95	,	,	PUNCT
ahs-14952	689	96	mayor	mayor	PROPN
ahs-14952	689	97	j.	j.	PROPN
ahs-14952	689	98	,	,	PUNCT
ahs-14952	689	99	may	may	PROPN
ahs-14952	689	100	t.w	t.w	PROPN
ahs-14952	689	101	.	.	PROPN
ahs-14952	689	102	,	,	PUNCT
ahs-14952	689	103	majukim	majukim	PROPN
ahs-14952	689	104	l.	l.	PROPN
ahs-14952	689	105	,	,	PUNCT
ahs-14952	689	106	lodge	lodge	PROPN
ahs-14952	689	107	d.l	d.l	PROPN
ahs-14952	689	108	.	.	PROPN
ahs-14952	689	109	,	,	PUNCT
ahs-14952	689	110	lee	lee	PROPN
ahs-14952	689	111	s.s	s.s	PROPN
ahs-14952	689	112	.	.	PROPN
ahs-14952	689	113	,	,	PUNCT
ahs-14952	689	114	larsson	larsson	PROPN
ahs-14952	690	1	k.h	k.h	PROPN
ahs-14952	690	2	.	.	PROPN
ahs-14952	690	3	,	,	PUNCT
ahs-14952	690	4	kohout	kohout	PROPN
ahs-14952	690	5	p.	p.	PROPN
ahs-14952	690	6	,	,	PUNCT
ahs-14952	690	7	hosaka	hosaka	PROPN
ahs-14952	690	8	k.	k.	PROPN
ahs-14952	690	9	,	,	PUNCT
ahs-14952	690	10	hiiesalu	hiiesalu	PROPN
ahs-14952	690	11	i.	i.	PROPN
ahs-14952	690	12	,	,	PUNCT
ahs-14952	690	13	henkel	henkel	PROPN
ahs-14952	690	14	t.w	t.w	PROPN
ahs-14952	690	15	.	.	PROPN
ahs-14952	690	16	,	,	PUNCT
ahs-14952	690	17	harend	harend	PROPN
ahs-14952	690	18	h.	h.	PROPN
ahs-14952	690	19	,	,	PUNCT
ahs-14952	690	20	guo	guo	PROPN
ahs-14952	690	21	l.d	l.d	PROPN
ahs-14952	690	22	.	.	PROPN
ahs-14952	690	23	,	,	PUNCT
ahs-14952	690	24	greslebin	greslebin	PROPN
ahs-14952	690	25	a.	a.	NOUN
ahs-14952	690	26	,	,	PUNCT
ahs-14952	690	27	gretlet	gretlet	PROPN
ahs-14952	690	28	g.	g.	PROPN
ahs-14952	690	29	,	,	PUNCT
ahs-14952	690	30	geml	geml	PROPN
ahs-14952	690	31	j.	j.	PROPN
ahs-14952	690	32	,	,	PUNCT
ahs-14952	690	33	gates	gates	PROPN
ahs-14952	690	34	g.	g.	PROPN
ahs-14952	690	35	,	,	PUNCT
ahs-14952	690	36	dunstan	dunstan	PROPN
ahs-14952	690	37	w.	w.	PROPN
ahs-14952	690	38	,	,	PUNCT
ahs-14952	690	39	dunk	dunk	PROPN
ahs-14952	690	40	c.	c.	PROPN
ahs-14952	690	41	,	,	PUNCT
ahs-14952	690	42	drenkhan	drenkhan	PROPN
ahs-14952	690	43	r.	r.	PROPN
ahs-14952	690	44	,	,	PUNCT
ahs-14952	690	45	dearnaley	dearnaley	PROPN
ahs-14952	690	46	j.	j.	PROPN
ahs-14952	690	47	,	,	PUNCT
ahs-14952	690	48	de	de	PROPN
ahs-14952	690	49	kesel	kesel	PROPN
ahs-14952	690	50	a.	a.	NOUN
ahs-14952	690	51	,	,	PUNCT
ahs-14952	690	52	dang	dang	PROPN
ahs-14952	690	53	t.	t.	PROPN
ahs-14952	690	54	,	,	PUNCT
ahs-14952	690	55	chen	chen	PROPN
ahs-14952	690	56	x.	x.	PROPN
ahs-14952	690	57	,	,	PUNCT
ahs-14952	690	58	buegger	buegger	PROPN
ahs-14952	690	59	f.	f.	PROPN
ahs-14952	690	60	,	,	PUNCT
ahs-14952	690	61	brearley	brearley	PROPN
ahs-14952	690	62	f.q	f.q	PROPN
ahs-14952	690	63	.	.	PROPN
ahs-14952	690	64	,	,	PUNCT
ahs-14952	690	65	bonito	bonito	PROPN
ahs-14952	690	66	g.	g.	PROPN
ahs-14952	690	67	,	,	PUNCT
ahs-14952	690	68	anslan	anslan	PROPN
ahs-14952	690	69	s.	s.	PROPN
ahs-14952	690	70	,	,	PUNCT
ahs-14952	690	71	abell	abell	PROPN
ahs-14952	690	72	s.	s.	PROPN
ahs-14952	690	73	,	,	PUNCT
ahs-14952	690	74	abarenkov	abarenkov	PROPN
ahs-14952	690	75	k.	k.	PROPN
ahs-14952	690	76	,	,	PUNCT
ahs-14952	690	77	2014	2014	NUM
ahs-14952	690	78	­	­	VERB
ahs-14952	690	79	global	global	ADJ
ahs-14952	690	80	diversity	diversity	NOUN
ahs-14952	690	81	and	and	CCONJ
ahs-14952	690	82	geography	geography	NOUN
ahs-14952	690	83	of	of	ADP
ahs-14952	690	84	soil	soil	NOUN
ahs-14952	690	85	fungi	fungi	PROPN
ahs-14952	690	86	.	.	PUNCT
ahs-14952	691	1	­	­	PROPN
ahs-14952	691	2	science	science	PROPN
ahs-14952	691	3	,	,	PUNCT
ahs-14952	691	4	346(6213	346(6213	NUM
ahs-14952	691	5	):	):	PUNCT
ahs-14952	691	6	1256688	1256688	NUM
ahs-14952	691	7	.	.	PUNCT
ahs-14952	692	1	tedersoo	tedersoo	PROPN
ahs-14952	692	2	l.	l.	PROPN
ahs-14952	692	3	,	,	PUNCT
ahs-14952	692	4	bahram	bahram	PROPN
ahs-14952	692	5	m.	m.	NOUN
ahs-14952	692	6	,	,	PUNCT
ahs-14952	692	7	puusepp	puusepp	NOUN
ahs-14952	692	8	m.	m.	NOUN
ahs-14952	692	9	,	,	PUNCT
ahs-14952	692	10	nilsson	nilsson	PROPN
ahs-14952	692	11	r.h	r.h	PROPN
ahs-14952	692	12	.	.	PROPN
ahs-14952	692	13	,	,	PUNCT
ahs-14952	692	14	james	james	PROPN
ahs-14952	692	15	j.y	j.y	PROPN
ahs-14952	692	16	.	.	PROPN
ahs-14952	692	17	,	,	PUNCT
ahs-14952	692	18	2017	2017	NUM
ahs-14952	692	19	­	­	NUM
ahs-14952	692	20	novel	novel	ADJ
ahs-14952	692	21	soil‐inhabiting	soil‐inhabiting	NOUN
ahs-14952	692	22	clades	clade	NOUN
ahs-14952	692	23	fill	fill	VERB
ahs-14952	692	24	gaps	gap	NOUN
ahs-14952	692	25	in	in	ADP
ahs-14952	692	26	the	the	DET
ahs-14952	692	27	fungal	fungal	ADJ
ahs-14952	692	28	tree	tree	NOUN
ahs-14952	692	29	of	of	ADP
ahs-14952	692	30	life.­	life.­	ADJ
ahs-14952	692	31	microbiome	microbiome	NOUN
ahs-14952	692	32	,	,	PUNCT
ahs-14952	692	33	5(1	5(1	NUM
ahs-14952	692	34	):	):	PUNCT
ahs-14952	692	35	1­10	1­10	NUM
ahs-14952	692	36	.	.	PUNCT
ahs-14952	693	1	tedersoo	tedersoo	PROPN
ahs-14952	693	2	l.	l.	PROPN
ahs-14952	693	3	,	,	PUNCT
ahs-14952	693	4	nilsson	nilsson	PROPN
ahs-14952	693	5	r.h	r.h	PROPN
ahs-14952	693	6	.	.	PROPN
ahs-14952	693	7	,	,	PUNCT
ahs-14952	693	8	2016	2016	NUM
ahs-14952	693	9	­	­	VERB
ahs-14952	693	10	molecular	molecular	ADJ
ahs-14952	693	11	identification	identification	NOUN
ahs-14952	693	12	of	of	ADP
ahs-14952	693	13	fungi	fungi	PROPN
ahs-14952	693	14	,	,	PUNCT
ahs-14952	693	15	pp	pp	ADJ
ahs-14952	693	16	.	.	PUNCT
ahs-14952	694	1	301­322	301­322	NUM
ahs-14952	694	2	.	.	PUNCT
ahs-14952	694	3	­	­	NOUN
ahs-14952	694	4	in	in	ADP
ahs-14952	694	5	martin	martin	PROPN
ahs-14952	694	6	f.	f.	PROPN
ahs-14952	694	7	(	(	PUNCT
ahs-14952	694	8	ed	ed	NOUN
ahs-14952	694	9	.	.	PUNCT
ahs-14952	694	10	)	)	PUNCT
ahs-14952	695	1	molecular	molecular	ADJ
ahs-14952	695	2	mycorrhizal	mycorrhizal	NOUN
ahs-14952	695	3	symbiosis	symbiosis	NOUN
ahs-14952	695	4	.	.	PUNCT
ahs-14952	696	1	john	john	PROPN
ahs-14952	696	2	wiley	wiley	PROPN
ahs-14952	696	3	&	&	CCONJ
ahs-14952	696	4	sons	sons	PROPN
ahs-14952	696	5	,	,	PUNCT
ahs-14952	696	6	inc	inc	PROPN
ahs-14952	696	7	.	.	PROPN
ahs-14952	696	8	,	,	PUNCT
ahs-14952	696	9	new	new	PROPN
ahs-14952	696	10	york	york	PROPN
ahs-14952	696	11	,	,	PUNCT
ahs-14952	696	12	pp	pp	PROPN
ahs-14952	696	13	.	.	PUNCT
ahs-14952	696	14	506	506	NUM
ahs-14952	696	15	.	.	PUNCT
ahs-14952	697	1	tian	tian	PROPN
ahs-14952	697	2	f.	f.	PROPN
ahs-14952	697	3	,	,	PUNCT
ahs-14952	697	4	liao	liao	PROPN
ahs-14952	697	5	x.f	x.f	PROPN
ahs-14952	697	6	.	.	PROPN
ahs-14952	697	7	,	,	PUNCT
ahs-14952	697	8	wang	wang	PROPN
ahs-14952	697	9	l.h	l.h	PROPN
ahs-14952	697	10	.	.	PROPN
ahs-14952	697	11	,	,	PUNCT
ahs-14952	697	12	bai	bai	PROPN
ahs-14952	697	13	x.x	x.x	PROPN
ahs-14952	697	14	.	.	PROPN
ahs-14952	697	15	,	,	PUNCT
ahs-14952	697	16	yang	yang	PROPN
ahs-14952	697	17	y.b	y.b	PROPN
ahs-14952	697	18	.	.	PROPN
ahs-14952	697	19	,	,	PUNCT
ahs-14952	697	20	luo	luo	PROPN
ahs-14952	697	21	z.q	z.q	PROPN
ahs-14952	697	22	.	.	PROPN
ahs-14952	697	23	,	,	PUNCT
ahs-14952	697	24	yan	yan	PROPN
ahs-14952	697	25	f.x	f.x	PROPN
ahs-14952	697	26	.	.	PROPN
ahs-14952	697	27	,	,	PUNCT
ahs-14952	697	28	2022	2022	NUM
ahs-14952	697	29	­	­	VERB
ahs-14952	697	30	isolation	isolation	NOUN
ahs-14952	697	31	and	and	CCONJ
ahs-14952	697	32	identification	identification	NOUN
ahs-14952	697	33	of	of	ADP
ahs-14952	697	34	beneficial	beneficial	ADJ
ahs-14952	697	35	orchid	orchid	NOUN
ahs-14952	697	36	mycorrhizal	mycorrhizal	NOUN
ahs-14952	697	37	fungi	fungus	NOUN
ahs-14952	697	38	in	in	ADP
ahs-14952	697	39	paphiopedilum	paphiopedilum	PROPN
ahs-14952	697	40	barbigerum	barbigerum	NOUN
ahs-14952	697	41	(	(	PUNCT
ahs-14952	697	42	orchidaceae	orchidaceae	PROPN
ahs-14952	697	43	)	)	PUNCT
ahs-14952	697	44	.	.	PUNCT
ahs-14952	698	1	­	­	PROPN
ahs-14952	698	2	plant	plant	NOUN
ahs-14952	698	3	signal	signal	NOUN
ahs-14952	698	4	.	.	PUNCT
ahs-14952	699	1	behav	behav	PROPN
ahs-14952	699	2	.	.	PUNCT
ahs-14952	699	3	,	,	PUNCT
ahs-14952	699	4	17(1	17(1	NUM
ahs-14952	699	5	):	):	PUNCT
ahs-14952	699	6	2005882	2005882	NUM
ahs-14952	699	7	.	.	PUNCT
ahs-14952	700	1	tripathy	tripathy	PROPN
ahs-14952	700	2	s.k	s.k	PROPN
ahs-14952	700	3	.	.	PROPN
ahs-14952	700	4	,	,	PUNCT
ahs-14952	700	5	maharana	maharana	PROPN
ahs-14952	700	6	m.	m.	PROPN
ahs-14952	700	7	,	,	PUNCT
ahs-14952	700	8	ithape	ithape	NOUN
ahs-14952	700	9	d.m	d.m	PROPN
ahs-14952	700	10	.	.	PROPN
ahs-14952	700	11	,	,	PUNCT
ahs-14952	700	12	lenka	lenka	PROPN
ahs-14952	700	13	d.	d.	PROPN
ahs-14952	700	14	,	,	PUNCT
ahs-14952	700	15	mishra	mishra	PROPN
ahs-14952	700	16	d.	d.	PROPN
ahs-14952	700	17	,	,	PUNCT
ahs-14952	700	18	prusti	prusti	PROPN
ahs-14952	700	19	a.	a.	PROPN
ahs-14952	700	20	,	,	PUNCT
ahs-14952	700	21	swain	swain	PROPN
ahs-14952	700	22	d.	d.	PROPN
ahs-14952	700	23	,	,	PUNCT
ahs-14952	700	24	mohanty	mohanty	PROPN
ahs-14952	700	25	m.r	m.r	PROPN
ahs-14952	700	26	.	.	PROPN
ahs-14952	700	27	,	,	PUNCT
ahs-14952	700	28	reshmi	reshmi	VERB
ahs-14952	700	29	raj	raj	PROPN
ahs-14952	700	30	k.r	k.r	PROPN
ahs-14952	700	31	.	.	PROPN
ahs-14952	700	32	,	,	PUNCT
ahs-14952	700	33	2017	2017	NUM
ahs-14952	700	34	­	­	NOUN
ahs-14952	700	35	exploring	explore	VERB
ahs-14952	700	36	rapid	rapid	ADJ
ahs-14952	700	37	and	and	CCONJ
ahs-14952	700	38	efficient	efficient	ADJ
ahs-14952	700	39	protocol	protocol	NOUN
ahs-14952	700	40	for	for	ADP
ahs-14952	700	41	isolation	isolation	NOUN
ahs-14952	700	42	of	of	ADP
ahs-14952	700	43	fungal	fungal	ADJ
ahs-14952	700	44	dna	dna	NOUN
ahs-14952	700	45	.	.	PUNCT
ahs-14952	701	1	­	­	PROPN
ahs-14952	701	2	ijcmas	ijcma	NOUN
ahs-14952	701	3	,	,	PUNCT
ahs-14952	701	4	6(3	6(3	NUM
ahs-14952	701	5	):	):	PUNCT
ahs-14952	701	6	951­960	951­960	NUM
ahs-14952	701	7	.	.	PUNCT
ahs-14952	702	1	trivedi	trivedi	PROPN
ahs-14952	702	2	p.	p.	PROPN
ahs-14952	702	3	,	,	PUNCT
ahs-14952	702	4	leach	leach	NOUN
ahs-14952	702	5	j.e	j.e	NOUN
ahs-14952	702	6	.	.	PROPN
ahs-14952	702	7	,	,	PUNCT
ahs-14952	702	8	tringe	tringe	PROPN
ahs-14952	702	9	s.e	s.e	PROPN
ahs-14952	702	10	.	.	PROPN
ahs-14952	702	11	,	,	PUNCT
ahs-14952	702	12	sa	sa	PROPN
ahs-14952	702	13	t.	t.	PROPN
ahs-14952	702	14	,	,	PUNCT
ahs-14952	702	15	singh	singh	PROPN
ahs-14952	702	16	b.k	b.k	PROPN
ahs-14952	702	17	.	.	PROPN
ahs-14952	702	18	,	,	PUNCT
ahs-14952	702	19	2020	2020	NUM
ahs-14952	702	20	­	­	VERB
ahs-14952	702	21	plant‐microbiome	plant‐microbiome	NOUN
ahs-14952	702	22	interactions	interaction	NOUN
ahs-14952	702	23	:	:	PUNCT
ahs-14952	702	24	from	from	ADP
ahs-14952	702	25	community	community	NOUN
ahs-14952	702	26	assembly	assembly	NOUN
ahs-14952	702	27	to	to	PART
ahs-14952	702	28	plant	plant	VERB
ahs-14952	702	29	health	health	NOUN
ahs-14952	702	30	.	.	PUNCT
ahs-14952	703	1	­	­	PROPN
ahs-14952	703	2	nat	nat	PROPN
ahs-14952	703	3	.	.	PUNCT
ahs-14952	704	1	rev	rev	PROPN
ahs-14952	704	2	.	.	PROPN
ahs-14952	704	3	microbiol	microbiol	PROPN
ahs-14952	704	4	.	.	PUNCT
ahs-14952	704	5	,	,	PUNCT
ahs-14952	704	6	18(11	18(11	NUM
ahs-14952	704	7	):	):	PUNCT
ahs-14952	705	1	607­621	607­621	NUM
ahs-14952	705	2	.	.	PUNCT
ahs-14952	706	1	turenne	turenne	PROPN
ahs-14952	706	2	c.y	c.y	PROPN
ahs-14952	706	3	.	.	PROPN
ahs-14952	706	4	,	,	PUNCT
ahs-14952	706	5	sanche	sanche	PROPN
ahs-14952	706	6	s.e	s.e	PROPN
ahs-14952	706	7	.	.	PROPN
ahs-14952	706	8	,	,	PUNCT
ahs-14952	706	9	hoban	hoban	PROPN
ahs-14952	706	10	d.j	d.j	PROPN
ahs-14952	706	11	.	.	PROPN
ahs-14952	706	12	,	,	PUNCT
ahs-14952	706	13	karlowsky	karlowsky	PROPN
ahs-14952	706	14	j.a	j.a	PROPN
ahs-14952	706	15	.	.	PROPN
ahs-14952	706	16	,	,	PUNCT
ahs-14952	706	17	kabani	kabani	PROPN
ahs-14952	706	18	a.m.	a.m.	PROPN
ahs-14952	706	19	,	,	PUNCT
ahs-14952	706	20	1999	1999	NUM
ahs-14952	706	21	­	­	VERB
ahs-14952	706	22	rapid	rapid	ADJ
ahs-14952	706	23	identification	identification	NOUN
ahs-14952	706	24	of	of	ADP
ahs-14952	706	25	fungi	fungus	NOUN
ahs-14952	706	26	by	by	ADP
ahs-14952	706	27	using	use	VERB
ahs-14952	706	28	the	the	DET
ahs-14952	706	29	its2	its2	ADJ
ahs-14952	706	30	genetic	genetic	ADJ
ahs-14952	706	31	region	region	NOUN
ahs-14952	706	32	and	and	CCONJ
ahs-14952	706	33	an	an	DET
ahs-14952	706	34	automated	automate	VERB
ahs-14952	706	35	fluorescent	fluorescent	ADJ
ahs-14952	706	36	capillary	capillary	ADJ
ahs-14952	706	37	electrophoresis	electrophoresis	NOUN
ahs-14952	706	38	system	system	NOUN
ahs-14952	706	39	.	.	PUNCT
ahs-14952	707	1	­	­	PROPN
ahs-14952	707	2	j.	j.	PROPN
ahs-14952	707	3	clin	clin	PROPN
ahs-14952	707	4	.	.	PUNCT
ahs-14952	708	1	microbiol	microbiol	PROPN
ahs-14952	708	2	.	.	PUNCT
ahs-14952	708	3	,	,	PUNCT
ahs-14952	708	4	37(6	37(6	NUM
ahs-14952	708	5	):	):	PUNCT
ahs-14952	708	6	1846­1851	1846­1851	NUM
ahs-14952	708	7	.	.	PUNCT
ahs-14952	708	8	turzhanova	turzhanova	PROPN
ahs-14952	709	1	a.s	a.s	PROPN
ahs-14952	709	2	.	.	PROPN
ahs-14952	709	3	,	,	PUNCT
ahs-14952	709	4	rukavitsyna	rukavitsyna	VERB
ahs-14952	709	5	i.v	i.v	PROPN
ahs-14952	709	6	.	.	PROPN
ahs-14952	709	7	,	,	PUNCT
ahs-14952	709	8	khapilna	khapilna	PROPN
ahs-14952	709	9	o.n	o.n	PROPN
ahs-14952	709	10	.	.	PROPN
ahs-14952	709	11	,	,	PUNCT
ahs-14952	709	12	kalendar	kalendar	PROPN
ahs-14952	709	13	r.n	r.n	PROPN
ahs-14952	709	14	.	.	PROPN
ahs-14952	709	15	,	,	PUNCT
ahs-14952	709	16	2018	2018	NUM
ahs-14952	709	17	­	­	VERB
ahs-14952	709	18	optimization	optimization	NOUN
ahs-14952	709	19	of	of	ADP
ahs-14952	709	20	dna	dna	PROPN
ahs-14952	709	21	extraction	extraction	NOUN
ahs-14952	709	22	from	from	ADP
ahs-14952	709	23	filamentous	filamentous	ADJ
ahs-14952	709	24	fungi	fungus	NOUN
ahs-14952	709	25	alternaria	alternaria	NOUN
ahs-14952	709	26	sp	sp	PROPN
ahs-14952	709	27	.	.	PROPN
ahs-14952	709	28	and	and	CCONJ
ahs-14952	709	29	fusarium	fusarium	NOUN
ahs-14952	709	30	sp	sp	NOUN
ahs-14952	709	31	.	.	PROPN
ahs-14952	709	32	­	­	PROPN
ahs-14952	709	33	eurasian	eurasian	PROPN
ahs-14952	709	34	j.	j.	PROPN
ahs-14952	709	35	appl	appl	PROPN
ahs-14952	709	36	.	.	PROPN
ahs-14952	710	1	biotechnol	biotechnol	PROPN
ahs-14952	710	2	.	.	PUNCT
ahs-14952	710	3	,	,	PUNCT
ahs-14952	710	4	3	3	NUM
ahs-14952	710	5	:	:	SYM
ahs-14952	710	6	1­9	1­9	X
ahs-14952	710	7	.	.	PUNCT
ahs-14952	710	8	varma	varma	PROPN
ahs-14952	710	9	a.	a.	PROPN
ahs-14952	710	10	,	,	PUNCT
ahs-14952	710	11	kwon	kwon	PROPN
ahs-14952	710	12	chung	chung	PROPN
ahs-14952	711	1	k.j	k.j	PROPN
ahs-14952	711	2	.	.	PROPN
ahs-14952	711	3	,	,	PUNCT
ahs-14952	711	4	1991	1991	NUM
ahs-14952	711	5	­	­	VERB
ahs-14952	711	6	rapid	rapid	ADJ
ahs-14952	711	7	method	method	NOUN
ahs-14952	711	8	to	to	PART
ahs-14952	711	9	extract	extract	VERB
ahs-14952	711	10	dna	dna	PROPN
ahs-14952	711	11	from	from	ADP
ahs-14952	711	12	cryptococcus	cryptococcus	PROPN
ahs-14952	711	13	neoformans	neoforman	NOUN
ahs-14952	711	14	.	.	PUNCT
ahs-14952	712	1	­	­	VERB
ahs-14952	712	2	j.	j.	PROPN
ahs-14952	712	3	clin	clin	PROPN
ahs-14952	712	4	.	.	PUNCT
ahs-14952	713	1	microbiol	microbiol	PROPN
ahs-14952	713	2	.	.	PUNCT
ahs-14952	713	3	,	,	PUNCT
ahs-14952	713	4	29(4	29(4	NOUN
ahs-14952	713	5	):	):	PUNCT
ahs-14952	713	6	810­812	810­812	NUM
ahs-14952	713	7	.	.	PUNCT
ahs-14952	714	1	větrovský	větrovský	PROPN
ahs-14952	714	2	t.	t.	PROPN
ahs-14952	714	3	,	,	PUNCT
ahs-14952	714	4	kolařík	kolařík	PROPN
ahs-14952	714	5	m.	m.	NOUN
ahs-14952	714	6	,	,	PUNCT
ahs-14952	714	7	žifčáková	žifčáková	PROPN
ahs-14952	714	8	l.	l.	PROPN
ahs-14952	714	9	,	,	PUNCT
ahs-14952	714	10	zelenka	zelenka	PROPN
ahs-14952	714	11	t.	t.	PROPN
ahs-14952	714	12	,	,	PUNCT
ahs-14952	714	13	baldrian	baldrian	PROPN
ahs-14952	714	14	p.	p.	PROPN
ahs-14952	714	15	,	,	PUNCT
ahs-14952	714	16	2016	2016	NUM
ahs-14952	714	17	­	­	VERB
ahs-14952	714	18	the	the	DET
ahs-14952	714	19	rpb2	rpb2	NOUN
ahs-14952	714	20	gene	gene	NOUN
ahs-14952	714	21	represents	represent	VERB
ahs-14952	714	22	a	a	DET
ahs-14952	714	23	viable	viable	ADJ
ahs-14952	714	24	alternative	alternative	ADJ
ahs-14952	714	25	molecular	molecular	ADJ
ahs-14952	714	26	marker	marker	NOUN
ahs-14952	714	27	for	for	ADP
ahs-14952	714	28	the	the	DET
ahs-14952	714	29	analysis	analysis	NOUN
ahs-14952	714	30	of	of	ADP
ahs-14952	714	31	environmental	environmental	ADJ
ahs-14952	714	32	fungal	fungal	ADJ
ahs-14952	714	33	communities	community	NOUN
ahs-14952	714	34	.	.	PUNCT
ahs-14952	715	1	­	­	PROPN
ahs-14952	715	2	mol	mol	PROPN
ahs-14952	715	3	.	.	PUNCT
ahs-14952	716	1	ecol	ecol	PROPN
ahs-14952	716	2	.	.	PUNCT
ahs-14952	717	1	resour	resour	NOUN
ahs-14952	717	2	.	.	PUNCT
ahs-14952	717	3	,	,	PUNCT
ahs-14952	717	4	16(2	16(2	NUM
ahs-14952	717	5	):	):	PUNCT
ahs-14952	717	6	388­401	388­401	NUM
ahs-14952	717	7	.	.	PUNCT
ahs-14952	718	1	wang	wang	PROPN
ahs-14952	718	2	d.	d.	PROPN
ahs-14952	718	3	,	,	PUNCT
ahs-14952	718	4	jacquemyn	jacquemyn	PROPN
ahs-14952	718	5	d.	d.	PROPN
ahs-14952	718	6	,	,	PUNCT
ahs-14952	718	7	gomes	gomes	PROPN
ahs-14952	718	8	s.f.i	s.f.i	PROPN
ahs-14952	718	9	.	.	PROPN
ahs-14952	718	10	,	,	PUNCT
ahs-14952	718	11	vos	vos	PROPN
ahs-14952	719	1	r.a	r.a	PROPN
ahs-14952	719	2	.	.	PROPN
ahs-14952	719	3	,	,	PUNCT
ahs-14952	719	4	vincent	vincent	PROPN
ahs-14952	719	5	s.f.t	s.f.t	PROPN
ahs-14952	719	6	.	.	PUNCT
ahs-14952	719	7	,	,	PUNCT
ahs-14952	719	8	2021	2021	NUM
ahs-14952	719	9	­	­	VERB
ahs-14952	719	10	symbiont	symbiont	NOUN
ahs-14952	719	11	switching	switching	NOUN
ahs-14952	719	12	and	and	CCONJ
ahs-14952	719	13	trophic	trophic	ADJ
ahs-14952	719	14	mode	mode	NOUN
ahs-14952	719	15	shifts	shift	NOUN
ahs-14952	719	16	in	in	ADP
ahs-14952	719	17	orchidaceae	orchidaceae	PROPN
ahs-14952	719	18	.	.	PUNCT
ahs-14952	720	1	­	­	VERB
ahs-14952	720	2	new	new	ADJ
ahs-14952	720	3	phytol	phytol	NOUN
ahs-14952	720	4	.	.	PUNCT
ahs-14952	721	1	,	,	PUNCT
ahs-14952	722	1	231(2	231(2	NUM
ahs-14952	722	2	):	):	PUNCT
ahs-14952	722	3	791­	791­	PROPN
ahs-14952	722	4	800	800	NUM
ahs-14952	722	5	.	.	PUNCT
ahs-14952	723	1	wang	wang	PROPN
ahs-14952	723	2	z.	z.	PROPN
ahs-14952	723	3	,	,	PUNCT
ahs-14952	723	4	jiang	jiang	PROPN
ahs-14952	723	5	y.	y.	PROPN
ahs-14952	723	6	,	,	PUNCT
ahs-14952	723	7	deane	deane	PROPN
ahs-14952	723	8	d.c	d.c	PROPN
ahs-14952	723	9	.	.	PROPN
ahs-14952	723	10	,	,	PUNCT
ahs-14952	723	11	he	he	PRON
ahs-14952	723	12	f.	f.	PROPN
ahs-14952	723	13	,	,	PUNCT
ahs-14952	723	14	shu	shu	PROPN
ahs-14952	723	15	w.	w.	PROPN
ahs-14952	723	16	,	,	PUNCT
ahs-14952	723	17	liu	liu	PROPN
ahs-14952	723	18	y.	y.	PROPN
ahs-14952	723	19	,	,	PUNCT
ahs-14952	723	20	2019	2019	NUM
ahs-14952	723	21	­	­	NUM
ahs-14952	723	22	effects	effect	NOUN
ahs-14952	723	23	of	of	ADP
ahs-14952	723	24	host	host	NOUN
ahs-14952	723	25	phylogeny	phylogeny	NOUN
ahs-14952	723	26	,	,	PUNCT
ahs-14952	723	27	habitat	habitat	NOUN
ahs-14952	723	28	and	and	CCONJ
ahs-14952	723	29	spatial	spatial	ADJ
ahs-14952	723	30	proximity	proximity	NOUN
ahs-14952	723	31	on	on	ADP
ahs-14952	723	32	host	host	NOUN
ahs-14952	723	33	specificity	specificity	NOUN
ahs-14952	723	34	and	and	CCONJ
ahs-14952	723	35	diversity	diversity	NOUN
ahs-14952	723	36	of	of	ADP
ahs-14952	723	37	pathogenic	pathogenic	ADJ
ahs-14952	723	38	and	and	CCONJ
ahs-14952	723	39	mycorrhizal	mycorrhizal	NOUN
ahs-14952	723	40	fungi	fungus	NOUN
ahs-14952	723	41	in	in	ADP
ahs-14952	723	42	a	a	DET
ahs-14952	723	43	subtropical	subtropical	ADJ
ahs-14952	723	44	forest	forest	NOUN
ahs-14952	723	45	.	.	PUNCT
ahs-14952	724	1	­	­	VERB
ahs-14952	724	2	new	new	ADJ
ahs-14952	724	3	phytol	phytol	NOUN
ahs-14952	724	4	.	.	PUNCT
ahs-14952	724	5	,	,	PUNCT
ahs-14952	724	6	223(1	223(1	NUM
ahs-14952	724	7	):	):	PUNCT
ahs-14952	724	8	462­474	462­474	NOUN
ahs-14952	724	9	.	.	PUNCT
ahs-14952	725	1	warcup	warcup	PROPN
ahs-14952	726	1	j.h	j.h	PROPN
ahs-14952	726	2	.	.	PROPN
ahs-14952	726	3	,	,	PUNCT
ahs-14952	726	4	1981	1981	NUM
ahs-14952	726	5	­	­	VERB
ahs-14952	726	6	the	the	DET
ahs-14952	726	7	mycorrhizal	mycorrhizal	NOUN
ahs-14952	726	8	relationship	relationship	NOUN
ahs-14952	726	9	of	of	ADP
ahs-14952	726	10	adv	adv	PROPN
ahs-14952	726	11	.	.	PUNCT
ahs-14952	726	12	hort	hort	PROPN
ahs-14952	726	13	.	.	PUNCT
ahs-14952	727	1	sci	sci	PROPN
ahs-14952	727	2	.	.	PROPN
ahs-14952	727	3	,	,	PUNCT
ahs-14952	727	4	2024	2024	NUM
ahs-14952	727	5	38(1	38(1	NOUN
ahs-14952	727	6	):	):	PUNCT
ahs-14952	727	7	97­116	97­116	NUM
ahs-14952	727	8	116	116	NUM
ahs-14952	727	9	austaralian	austaralian	ADJ
ahs-14952	727	10	orchids	orchid	NOUN
ahs-14952	727	11	.	.	PUNCT
ahs-14952	728	1	­	­	VERB
ahs-14952	728	2	new	new	ADJ
ahs-14952	728	3	phytol	phytol	NOUN
ahs-14952	728	4	.	.	PUNCT
ahs-14952	729	1	,	,	PUNCT
ahs-14952	729	2	87(2	87(2	NUM
ahs-14952	729	3	):	):	PUNCT
ahs-14952	729	4	371­381	371­381	NUM
ahs-14952	729	5	.	.	PUNCT
ahs-14952	730	1	warcup	warcup	PROPN
ahs-14952	731	1	j.h	j.h	PROPN
ahs-14952	731	2	.	.	PROPN
ahs-14952	731	3	,	,	PUNCT
ahs-14952	731	4	talbot	talbot	PROPN
ahs-14952	731	5	p.h.b	p.h.b	PROPN
ahs-14952	731	6	.	.	PROPN
ahs-14952	731	7	,	,	PUNCT
ahs-14952	731	8	1967	1967	NUM
ahs-14952	731	9	­	­	VERB
ahs-14952	731	10	perfect	perfect	ADJ
ahs-14952	731	11	states	state	NOUN
ahs-14952	731	12	of	of	ADP
ahs-14952	731	13	rhizoctonias	rhizoctonia	NOUN
ahs-14952	731	14	associated	associate	VERB
ahs-14952	731	15	with	with	ADP
ahs-14952	731	16	orchids	orchid	NOUN
ahs-14952	731	17	.	.	PUNCT
ahs-14952	732	1	­	­	VERB
ahs-14952	732	2	new	new	ADJ
ahs-14952	732	3	phytol	phytol	NOUN
ahs-14952	732	4	.	.	PUNCT
ahs-14952	732	5	,	,	PUNCT
ahs-14952	733	1	66(4	66(4	NUM
ahs-14952	733	2	):	):	PUNCT
ahs-14952	733	3	631­641	631­641	NUM
ahs-14952	733	4	.	.	PUNCT
ahs-14952	734	1	waterman	waterman	PROPN
ahs-14952	734	2	r.j	r.j	PROPN
ahs-14952	734	3	.	.	PROPN
ahs-14952	734	4	,	,	PUNCT
ahs-14952	734	5	bidartondo	bidartondo	PROPN
ahs-14952	734	6	m.i	m.i	PROPN
ahs-14952	734	7	.	.	PROPN
ahs-14952	734	8	,	,	PUNCT
ahs-14952	734	9	stofberg	stofberg	PROPN
ahs-14952	734	10	j.	j.	PROPN
ahs-14952	734	11	,	,	PUNCT
ahs-14952	734	12	combs	comb	VERB
ahs-14952	734	13	j.k	j.k	PROPN
ahs-14952	734	14	.	.	PROPN
ahs-14952	734	15	,	,	PUNCT
ahs-14952	734	16	gebauer	gebauer	PROPN
ahs-14952	734	17	g.	g.	PROPN
ahs-14952	734	18	,	,	PUNCT
ahs-14952	734	19	savolainen	savolainen	NOUN
ahs-14952	734	20	v.	v.	PROPN
ahs-14952	734	21	,	,	PUNCT
ahs-14952	734	22	barraclough	barraclough	PROPN
ahs-14952	734	23	t.g	t.g	PROPN
ahs-14952	734	24	.	.	PROPN
ahs-14952	734	25	,	,	PUNCT
ahs-14952	734	26	pauw	pauw	NOUN
ahs-14952	734	27	a.	a.	NOUN
ahs-14952	734	28	,	,	PUNCT
ahs-14952	734	29	2011	2011	NUM
ahs-14952	734	30	­	­	VERB
ahs-14952	734	31	the	the	DET
ahs-14952	734	32	effects	effect	NOUN
ahs-14952	734	33	of	of	ADP
ahs-14952	734	34	above‐	above‐	ADJ
ahs-14952	734	35	and	and	CCONJ
ahs-14952	734	36	belowground	belowground	ADJ
ahs-14952	734	37	mutualisms	mutualism	NOUN
ahs-14952	734	38	on	on	ADP
ahs-14952	734	39	orchid	orchid	NOUN
ahs-14952	734	40	speciation	speciation	NOUN
ahs-14952	734	41	and	and	CCONJ
ahs-14952	734	42	coexistence	coexistence	NOUN
ahs-14952	734	43	.	.	PUNCT
ahs-14952	735	1	­	­	PROPN
ahs-14952	735	2	am	am	PROPN
ahs-14952	735	3	.	.	PUNCT
ahs-14952	736	1	nat	nat	PROPN
ahs-14952	736	2	.	.	PUNCT
ahs-14952	736	3	,	,	PUNCT
ahs-14952	736	4	177(2	177(2	NUM
ahs-14952	736	5	):	):	PUNCT
ahs-14952	736	6	e54­e68	e54­e68	NOUN
ahs-14952	736	7	.	.	PROPN
ahs-14952	736	8	waud	waud	PROPN
ahs-14952	736	9	m.	m.	NOUN
ahs-14952	736	10	,	,	PUNCT
ahs-14952	736	11	busschaert	busschaert	PROPN
ahs-14952	736	12	p.	p.	PROPN
ahs-14952	736	13	,	,	PUNCT
ahs-14952	736	14	ruyters	ruyters	PROPN
ahs-14952	736	15	s.	s.	PROPN
ahs-14952	736	16	,	,	PUNCT
ahs-14952	736	17	jacquemyn	jacquemyn	PROPN
ahs-14952	736	18	h.	h.	PROPN
ahs-14952	736	19	,	,	PUNCT
ahs-14952	736	20	lievens	lievens	PROPN
ahs-14952	736	21	b.	b.	PROPN
ahs-14952	736	22	,	,	PUNCT
ahs-14952	736	23	2014	2014	NUM
ahs-14952	736	24	­	­	NOUN
ahs-14952	736	25	impact	impact	NOUN
ahs-14952	736	26	of	of	ADP
ahs-14952	736	27	primer	primer	NOUN
ahs-14952	736	28	choice	choice	NOUN
ahs-14952	736	29	on	on	ADP
ahs-14952	736	30	characterization	characterization	NOUN
ahs-14952	736	31	of	of	ADP
ahs-14952	736	32	orchid	orchid	NOUN
ahs-14952	736	33	mycorrhizal	mycorrhizal	NOUN
ahs-14952	736	34	communities	community	NOUN
ahs-14952	736	35	using	use	VERB
ahs-14952	736	36	454	454	NUM
ahs-14952	736	37	pyrosequencing	pyrosequencing	NOUN
ahs-14952	736	38	.	.	PUNCT
ahs-14952	737	1	­	­	PROPN
ahs-14952	737	2	mol	mol	PROPN
ahs-14952	737	3	.	.	PUNCT
ahs-14952	738	1	ecol	ecol	PROPN
ahs-14952	738	2	.	.	PUNCT
ahs-14952	739	1	resour	resour	NOUN
ahs-14952	739	2	.	.	PROPN
ahs-14952	739	3	,	,	PUNCT
ahs-14952	739	4	14(4	14(4	NUM
ahs-14952	739	5	):	):	PUNCT
ahs-14952	739	6	679­699	679­699	NOUN
ahs-14952	739	7	.	.	PUNCT
ahs-14952	740	1	white	white	PROPN
ahs-14952	740	2	t.j	t.j	PROPN
ahs-14952	740	3	.	.	PROPN
ahs-14952	740	4	,	,	PUNCT
ahs-14952	740	5	bruns	bruns	PROPN
ahs-14952	740	6	t.d	t.d	PROPN
ahs-14952	740	7	.	.	PROPN
ahs-14952	740	8	,	,	PUNCT
ahs-14952	740	9	lee	lee	PROPN
ahs-14952	740	10	s.b	s.b	PROPN
ahs-14952	740	11	.	.	PROPN
ahs-14952	740	12	,	,	PUNCT
ahs-14952	740	13	taylor	taylor	PROPN
ahs-14952	740	14	r.j	r.j	PROPN
ahs-14952	740	15	.	.	PROPN
ahs-14952	740	16	,	,	PUNCT
ahs-14952	740	17	1990	1990	NUM
ahs-14952	740	18	­	­	NOUN
ahs-14952	740	19	amplification	amplification	NOUN
ahs-14952	740	20	and	and	CCONJ
ahs-14952	740	21	direct	direct	ADJ
ahs-14952	740	22	sequencing	sequencing	NOUN
ahs-14952	740	23	of	of	ADP
ahs-14952	740	24	fungal	fungal	ADJ
ahs-14952	740	25	ribosomal	ribosomal	NOUN
ahs-14952	740	26	rna	rna	NOUN
ahs-14952	740	27	genes	gene	NOUN
ahs-14952	740	28	for	for	ADP
ahs-14952	740	29	phylogenetics	phylogenetic	NOUN
ahs-14952	740	30	.	.	PUNCT
ahs-14952	741	1	­	­	VERB
ahs-14952	741	2	in	in	ADP
ahs-14952	741	3	:	:	PUNCT
ahs-14952	741	4	innis	innis	PROPN
ahs-14952	741	5	m.a	m.a	PROPN
ahs-14952	741	6	.	.	PROPN
ahs-14952	741	7	,	,	PUNCT
ahs-14952	741	8	d.h	d.h	PROPN
ahs-14952	741	9	.	.	PROPN
ahs-14952	741	10	gelfand	gelfand	PROPN
ahs-14952	741	11	,	,	PUNCT
ahs-14952	741	12	j.j	j.j	PROPN
ahs-14952	741	13	.	.	PROPN
ahs-14952	741	14	sninsky	sninsky	PROPN
ahs-14952	741	15	,	,	PUNCT
ahs-14952	741	16	and	and	CCONJ
ahs-14952	741	17	t.j	t.j	PROPN
ahs-14952	741	18	.	.	PROPN
ahs-14952	741	19	white	white	PROPN
ahs-14952	741	20	(	(	PUNCT
ahs-14952	741	21	eds	ed	NOUN
ahs-14952	741	22	.	.	PUNCT
ahs-14952	741	23	)	)	PUNCT
ahs-14952	741	24	pcr	pcr	ADJ
ahs-14952	741	25	protocols	protocol	NOUN
ahs-14952	741	26	:	:	PUNCT
ahs-14952	741	27	a	a	DET
ahs-14952	741	28	guide	guide	NOUN
ahs-14952	741	29	to	to	ADP
ahs-14952	741	30	methods	method	NOUN
ahs-14952	741	31	and	and	CCONJ
ahs-14952	741	32	applications	application	NOUN
ahs-14952	741	33	.	.	PUNCT
ahs-14952	742	1	academic	academic	ADJ
ahs-14952	742	2	press	press	PROPN
ahs-14952	742	3	,	,	PUNCT
ahs-14952	742	4	inc	inc	PROPN
ahs-14952	742	5	.	.	PROPN
ahs-14952	742	6	san	san	PROPN
ahs-14952	742	7	diego	diego	PROPN
ahs-14952	742	8	,	,	PUNCT
ahs-14952	742	9	ca	ca	PROPN
ahs-14952	742	10	,	,	PUNCT
ahs-14952	742	11	usa	usa	PROPN
ahs-14952	742	12	,	,	PUNCT
ahs-14952	742	13	pp	pp	PROPN
ahs-14952	742	14	.	.	PUNCT
ahs-14952	743	1	482	482	NUM
ahs-14952	743	2	..	..	PUNCT
ahs-14952	743	3	xing	xing	PROPN
ahs-14952	743	4	x.	x.	PROPN
ahs-14952	743	5	,	,	PUNCT
ahs-14952	743	6	jacquemyn	jacquemyn	PROPN
ahs-14952	743	7	h.	h.	PROPN
ahs-14952	743	8	,	,	PUNCT
ahs-14952	743	9	gai	gai	PROPN
ahs-14952	743	10	x.	x.	PROPN
ahs-14952	743	11	,	,	PUNCT
ahs-14952	743	12	gao	gao	PROPN
ahs-14952	743	13	y.	y.	PROPN
ahs-14952	743	14	,	,	PUNCT
ahs-14952	743	15	liu	liu	PROPN
ahs-14952	743	16	q.	q.	PROPN
ahs-14952	743	17	,	,	PUNCT
ahs-14952	743	18	zhao	zhao	PROPN
ahs-14952	743	19	z.	z.	PROPN
ahs-14952	743	20	,	,	PUNCT
ahs-14952	743	21	2019	2019	NUM
ahs-14952	743	22	­	­	VERB
ahs-14952	743	23	the	the	DET
ahs-14952	743	24	impact	impact	NOUN
ahs-14952	743	25	of	of	ADP
ahs-14952	743	26	life	life	NOUN
ahs-14952	743	27	form	form	NOUN
ahs-14952	743	28	on	on	ADP
ahs-14952	743	29	the	the	DET
ahs-14952	743	30	architecture	architecture	NOUN
ahs-14952	743	31	of	of	ADP
ahs-14952	743	32	orchid	orchid	NOUN
ahs-14952	743	33	mycorrhizal	mycorrhizal	NOUN
ahs-14952	743	34	networks	network	NOUN
ahs-14952	743	35	in	in	ADP
ahs-14952	743	36	tropical	tropical	ADJ
ahs-14952	743	37	forest	forest	NOUN
ahs-14952	743	38	.	.	PUNCT
ahs-14952	744	1	­	­	PROPN
ahs-14952	744	2	oikos	oikos	PROPN
ahs-14952	744	3	,	,	PUNCT
ahs-14952	744	4	128(9	128(9	NUM
ahs-14952	744	5	):	):	PUNCT
ahs-14952	744	6	1254­1264	1254­1264	NUM
ahs-14952	744	7	.	.	PUNCT
ahs-14952	745	1	yagame	yagame	PROPN
ahs-14952	745	2	y.	y.	PROPN
ahs-14952	745	3	,	,	PUNCT
ahs-14952	745	4	yamato	yamato	PROPN
ahs-14952	745	5	m.	m.	NOUN
ahs-14952	745	6	,	,	PUNCT
ahs-14952	745	7	suzuki	suzuki	PROPN
ahs-14952	745	8	a.	a.	PROPN
ahs-14952	745	9	,	,	PUNCT
ahs-14952	745	10	iwase	iwase	PROPN
ahs-14952	745	11	k.	k.	PROPN
ahs-14952	745	12	,	,	PUNCT
ahs-14952	745	13	2008	2008	NUM
ahs-14952	745	14	­	­	VERB
ahs-14952	745	15	ceratobasidiaceae	ceratobasidiaceae	PROPN
ahs-14952	745	16	mycorrhizal	mycorrhizal	NOUN
ahs-14952	745	17	fungi	fungus	NOUN
ahs-14952	745	18	isolated	isolate	VERB
ahs-14952	745	19	from	from	ADP
ahs-14952	745	20	nonphotosynthetic	nonphotosynthetic	ADJ
ahs-14952	745	21	orchid	orchid	NOUN
ahs-14952	745	22	chamaegastrodia	chamaegastrodia	PROPN
ahs-14952	745	23	sikokiana	sikokiana	PROPN
ahs-14952	745	24	.	.	PUNCT
ahs-14952	746	1	­	­	PROPN
ahs-14952	746	2	mycorrhiza	mycorrhiza	ADJ
ahs-14952	746	3	,	,	PUNCT
ahs-14952	746	4	18(2	18(2	NUM
ahs-14952	746	5	):	):	PUNCT
ahs-14952	746	6	97­101	97­101	NUM
ahs-14952	746	7	.	.	PUNCT
ahs-14952	747	1	yam	yam	PROPN
ahs-14952	748	1	t.w	t.w	PROPN
ahs-14952	748	2	.	.	PROPN
ahs-14952	748	3	,	,	PUNCT
ahs-14952	748	4	arditti	arditti	PROPN
ahs-14952	748	5	j.	j.	PROPN
ahs-14952	748	6	,	,	PUNCT
ahs-14952	748	7	2009	2009	NUM
ahs-14952	748	8	­	­	VERB
ahs-14952	748	9	history	history	NOUN
ahs-14952	748	10	of	of	ADP
ahs-14952	748	11	orchid	orchid	NOUN
ahs-14952	748	12	propagation	propagation	NOUN
ahs-14952	748	13	:	:	PUNCT
ahs-14952	748	14	a	a	DET
ahs-14952	748	15	mirror	mirror	NOUN
ahs-14952	748	16	of	of	ADP
ahs-14952	748	17	the	the	DET
ahs-14952	748	18	history	history	NOUN
ahs-14952	748	19	of	of	ADP
ahs-14952	748	20	biotechnology	biotechnology	NOUN
ahs-14952	748	21	.	.	PUNCT
ahs-14952	749	1	­	­	PROPN
ahs-14952	749	2	plant	plant	NOUN
ahs-14952	749	3	biotechnol	biotechnol	NOUN
ahs-14952	749	4	.	.	PUNCT
ahs-14952	750	1	rep	rep	PROPN
ahs-14952	750	2	.	.	PROPN
ahs-14952	750	3	,	,	PUNCT
ahs-14952	750	4	3(1	3(1	NUM
ahs-14952	750	5	):	):	PUNCT
ahs-14952	750	6	1­56	1­56	NOUN
ahs-14952	750	7	.	.	PUNCT
ahs-14952	751	1	zettler	zettler	PROPN
ahs-14952	751	2	l.w	l.w	PROPN
ahs-14952	751	3	.	.	PROPN
ahs-14952	751	4	,	,	PUNCT
ahs-14952	751	5	corey	corey	PROPN
ahs-14952	751	6	l.l	l.l	PROPN
ahs-14952	751	7	.	.	PROPN
ahs-14952	751	8	,	,	PUNCT
ahs-14952	751	9	2018	2018	NUM
ahs-14952	751	10	­	­	VERB
ahs-14952	751	11	orchid	orchid	NOUN
ahs-14952	751	12	mycorrhizal	mycorrhizal	NOUN
ahs-14952	751	13	fungi	fungus	NOUN
ahs-14952	751	14	:	:	PUNCT
ahs-14952	751	15	isolation	isolation	NOUN
ahs-14952	751	16	and	and	CCONJ
ahs-14952	751	17	identification	identification	NOUN
ahs-14952	751	18	techniques	technique	NOUN
ahs-14952	751	19	,	,	PUNCT
ahs-14952	751	20	pp	pp	ADP
ahs-14952	751	21	.	.	PUNCT
ahs-14952	752	1	27­59	27­59	X
ahs-14952	752	2	.	.	PUNCT
ahs-14952	753	1	­	­	NOUN
ahs-14952	753	2	in	in	ADP
ahs-14952	753	3	:	:	PUNCT
ahs-14952	753	4	lee	lee	PROPN
ahs-14952	753	5	y.	y.	PROPN
ahs-14952	753	6	,	,	PUNCT
ahs-14952	753	7	and	and	CCONJ
ahs-14952	753	8	e.c.i	e.c.i	NOUN
ahs-14952	753	9	.	.	PUNCT
ahs-14952	754	1	tak	tak	NOUN
ahs-14952	754	2	(	(	PUNCT
ahs-14952	754	3	eds	ed	NOUN
ahs-14952	754	4	.	.	PUNCT
ahs-14952	754	5	)	)	PUNCT
ahs-14952	754	6	orchid	orchid	NOUN
ahs-14952	754	7	propagation	propagation	NOUN
ahs-14952	754	8	:	:	PUNCT
ahs-14952	754	9	from	from	ADP
ahs-14952	754	10	laboratories	laboratory	NOUN
ahs-14952	754	11	to	to	PART
ahs-14952	754	12	greenhouses	greenhouse	VERB
ahs-14952	754	13	‐	‐	ADJ
ahs-14952	754	14	methods	method	NOUN
ahs-14952	754	15	and	and	CCONJ
ahs-14952	754	16	protocols	protocol	NOUN
ahs-14952	754	17	.	.	PUNCT
ahs-14952	755	1	springer	springer	NOUN
ahs-14952	755	2	,	,	PUNCT
ahs-14952	755	3	new	new	PROPN
ahs-14952	755	4	york	york	PROPN
ahs-14952	755	5	,	,	PUNCT
ahs-14952	755	6	pp	pp	X
ahs-14952	755	7	.	.	PUNCT
ahs-14952	756	1	535	535	NUM
ahs-14952	756	2	.	.	PUNCT
ahs-14952	757	1	zettler	zettler	PROPN
ahs-14952	757	2	l.w	l.w	PROPN
ahs-14952	757	3	.	.	PROPN
ahs-14952	757	4	,	,	PUNCT
ahs-14952	757	5	mcinnis	mcinnis	PROPN
ahs-14952	757	6	t.m	t.m	PROPN
ahs-14952	757	7	.	.	PROPN
ahs-14952	757	8	,	,	PUNCT
ahs-14952	757	9	1994	1994	NUM
ahs-14952	757	10	­	­	VERB
ahs-14952	757	11	light	light	ADJ
ahs-14952	757	12	enhancement	enhancement	NOUN
ahs-14952	757	13	of	of	ADP
ahs-14952	757	14	symbiotic	symbiotic	ADJ
ahs-14952	757	15	seed	seed	NOUN
ahs-14952	757	16	germination	germination	NOUN
ahs-14952	757	17	and	and	CCONJ
ahs-14952	757	18	development	development	NOUN
ahs-14952	757	19	of	of	ADP
ahs-14952	757	20	an	an	DET
ahs-14952	757	21	endangered	endangered	ADJ
ahs-14952	757	22	terrestrial	terrestrial	ADJ
ahs-14952	757	23	orchid	orchid	NOUN
ahs-14952	757	24	(	(	PUNCT
ahs-14952	757	25	platanthera	platanthera	NOUN
ahs-14952	757	26	integrilabia	integrilabia	NOUN
ahs-14952	757	27	)	)	PUNCT
ahs-14952	757	28	.	.	PUNCT
ahs-14952	758	1	­	­	PROPN
ahs-14952	758	2	plant	plant	PROPN
ahs-14952	758	3	sci	sci	PROPN
ahs-14952	758	4	.	.	PROPN
ahs-14952	758	5	,	,	PUNCT
ahs-14952	758	6	102(2	102(2	NUM
ahs-14952	758	7	):	):	PUNCT
ahs-14952	758	8	133­138	133­138	PROPN
ahs-14952	758	9	.	.	PUNCT
ahs-14952	759	1	zhang	zhang	PROPN
ahs-14952	759	2	g.q	g.q	PROPN
ahs-14952	759	3	.	.	PROPN
ahs-14952	759	4	,	,	PUNCT
ahs-14952	759	5	xu	xu	PROPN
ahs-14952	759	6	q.	q.	PROPN
ahs-14952	759	7	,	,	PUNCT
ahs-14952	759	8	bian	bian	PROPN
ahs-14952	759	9	c.	c.	PROPN
ahs-14952	759	10	,	,	PUNCT
ahs-14952	759	11	tsai	tsai	PROPN
ahs-14952	759	12	w.c	w.c	VERB
ahs-14952	759	13	.	.	PROPN
ahs-14952	759	14	,	,	PUNCT
ahs-14952	759	15	yeh	yeh	PROPN
ahs-14952	759	16	c.m	c.m	PROPN
ahs-14952	759	17	.	.	PROPN
ahs-14952	759	18	,	,	PUNCT
ahs-14952	759	19	liu	liu	PROPN
ahs-14952	759	20	k.w	k.w	PROPN
ahs-14952	759	21	.	.	PROPN
ahs-14952	759	22	,	,	PUNCT
ahs-14952	759	23	yoshida	yoshida	PROPN
ahs-14952	759	24	k.	k.	PROPN
ahs-14952	759	25	,	,	PUNCT
ahs-14952	759	26	zhang	zhang	PROPN
ahs-14952	759	27	l.s	l.s	PROPN
ahs-14952	759	28	.	.	PROPN
ahs-14952	759	29	,	,	PUNCT
ahs-14952	759	30	chang	chang	PROPN
ahs-14952	759	31	s.b	s.b	PROPN
ahs-14952	759	32	.	.	PROPN
ahs-14952	759	33	,	,	PUNCT
ahs-14952	759	34	chen	chen	PROPN
ahs-14952	759	35	f.	f.	PROPN
ahs-14952	759	36	,	,	PUNCT
ahs-14952	759	37	shi	shi	PROPN
ahs-14952	759	38	y.	y.	PROPN
ahs-14952	759	39	,	,	PUNCT
ahs-14952	759	40	su	su	PROPN
ahs-14952	759	41	y.y	y.y	PROPN
ahs-14952	759	42	.	.	PROPN
ahs-14952	759	43	,	,	PUNCT
ahs-14952	759	44	zhang	zhang	PROPN
ahs-14952	759	45	y.q	y.q	PROPN
ahs-14952	759	46	.	.	PROPN
ahs-14952	759	47	,	,	PUNCT
ahs-14952	759	48	chen	chen	PROPN
ahs-14952	759	49	l.j	l.j	PROPN
ahs-14952	759	50	.	.	PROPN
ahs-14952	759	51	,	,	PUNCT
ahs-14952	759	52	yin	yin	PROPN
ahs-14952	759	53	y.	y.	PROPN
ahs-14952	759	54	,	,	PUNCT
ahs-14952	759	55	lin	lin	PROPN
ahs-14952	759	56	m.	m.	PROPN
ahs-14952	759	57	,	,	PUNCT
ahs-14952	759	58	huang	huang	PROPN
ahs-14952	759	59	h.	h.	PROPN
ahs-14952	759	60	,	,	PUNCT
ahs-14952	759	61	deng	deng	PROPN
ahs-14952	759	62	h.	h.	PROPN
ahs-14952	759	63	,	,	PUNCT
ahs-14952	759	64	wang	wang	PROPN
ahs-14952	759	65	z.w	z.w	PROPN
ahs-14952	759	66	.	.	PROPN
ahs-14952	759	67	,	,	PUNCT
ahs-14952	759	68	zhu	zhu	PROPN
ahs-14952	760	1	s.l	s.l	PROPN
ahs-14952	760	2	.	.	PROPN
ahs-14952	760	3	,	,	PUNCT
ahs-14952	760	4	zhao	zhao	PROPN
ahs-14952	760	5	x.	x.	PROPN
ahs-14952	760	6	,	,	PUNCT
ahs-14952	760	7	deng	deng	PROPN
ahs-14952	760	8	c.	c.	PROPN
ahs-14952	760	9	,	,	PUNCT
ahs-14952	760	10	niu	niu	PROPN
ahs-14952	760	11	s.c	s.c	PROPN
ahs-14952	760	12	.	.	PROPN
ahs-14952	760	13	,	,	PUNCT
ahs-14952	760	14	huang	huang	PROPN
ahs-14952	760	15	j.	j.	PROPN
ahs-14952	760	16	,	,	PUNCT
ahs-14952	760	17	wang	wang	PROPN
ahs-14952	760	18	m.	m.	PROPN
ahs-14952	760	19	,	,	PUNCT
ahs-14952	760	20	liu	liu	PROPN
ahs-14952	760	21	g.h	g.h	PROPN
ahs-14952	760	22	.	.	PROPN
ahs-14952	760	23	,	,	PUNCT
ahs-14952	760	24	yang	yang	PROPN
ahs-14952	760	25	h.y	h.y	PROPN
ahs-14952	760	26	.	.	PROPN
ahs-14952	760	27	,	,	PUNCT
ahs-14952	760	28	xiao	xiao	PROPN
ahs-14952	760	29	x.j	x.j	PROPN
ahs-14952	760	30	.	.	PROPN
ahs-14952	760	31	,	,	PUNCT
ahs-14952	760	32	hsiao	hsiao	PROPN
ahs-14952	760	33	y.y	y.y	PROPN
ahs-14952	760	34	.	.	PROPN
ahs-14952	760	35	,	,	PUNCT
ahs-14952	760	36	wu	wu	PROPN
ahs-14952	760	37	w.l	w.l	PROPN
ahs-14952	760	38	.	.	PROPN
ahs-14952	760	39	,	,	PUNCT
ahs-14952	760	40	chen	chen	PROPN
ahs-14952	760	41	y.y	y.y	PROPN
ahs-14952	760	42	.	.	PROPN
ahs-14952	760	43	,	,	PUNCT
ahs-14952	760	44	mitsuda	mitsuda	PROPN
ahs-14952	760	45	n.	n.	PROPN
ahs-14952	760	46	,	,	PUNCT
ahs-14952	760	47	ohme	ohme	PROPN
ahs-14952	760	48	takagi	takagi	PROPN
ahs-14952	760	49	m.	m.	NOUN
ahs-14952	760	50	,	,	PUNCT
ahs-14952	760	51	luo	luo	PROPN
ahs-14952	760	52	y.b	y.b	PROPN
ahs-14952	760	53	.	.	PROPN
ahs-14952	760	54	,	,	PUNCT
ahs-14952	760	55	van	van	PROPN
ahs-14952	760	56	de	de	PROPN
ahs-14952	760	57	peer	peer	NOUN
ahs-14952	760	58	y.	y.	NOUN
ahs-14952	760	59	,	,	PUNCT
ahs-14952	760	60	liu	liu	PROPN
ahs-14952	760	61	y.z	y.z	PROPN
ahs-14952	760	62	.	.	PROPN
ahs-14952	760	63	,	,	PUNCT
ahs-14952	760	64	2016	2016	NUM
ahs-14952	760	65	­	­	VERB
ahs-14952	760	66	the	the	DET
ahs-14952	760	67	dendrobium	dendrobium	NOUN
ahs-14952	760	68	catenatum	catenatum	NOUN
ahs-14952	760	69	lindl	lindl	PROPN
ahs-14952	760	70	.	.	PUNCT
ahs-14952	761	1	genome	genome	NOUN
ahs-14952	761	2	sequence	sequence	NOUN
ahs-14952	761	3	provides	provide	VERB
ahs-14952	761	4	insights	insight	NOUN
ahs-14952	761	5	into	into	ADP
ahs-14952	761	6	polysaccharide	polysaccharide	ADJ
ahs-14952	761	7	synthase	synthase	NOUN
ahs-14952	761	8	,	,	PUNCT
ahs-14952	761	9	floral	floral	ADJ
ahs-14952	761	10	development	development	NOUN
ahs-14952	761	11	and	and	CCONJ
ahs-14952	761	12	adaptive	adaptive	ADJ
ahs-14952	761	13	evolution	evolution	NOUN
ahs-14952	761	14	.	.	PUNCT
ahs-14952	762	1	­	­	PROPN
ahs-14952	762	2	sci	sci	PROPN
ahs-14952	762	3	.	.	PUNCT
ahs-14952	762	4	rep	rep	PROPN
ahs-14952	762	5	.	.	PROPN
ahs-14952	762	6	,	,	PUNCT
ahs-14952	762	7	6(1	6(1	NUM
ahs-14952	762	8	):	):	PUNCT
ahs-14952	762	9	10929	10929	NUM
ahs-14952	762	10	.	.	PUNCT
ahs-14952	763	1	zhang	zhang	PROPN
ahs-14952	763	2	y.j	y.j	PROPN
ahs-14952	763	3	.	.	PROPN
ahs-14952	763	4	,	,	PUNCT
ahs-14952	763	5	zhang	zhang	PROPN
ahs-14952	763	6	s.	s.	PROPN
ahs-14952	763	7	,	,	PUNCT
ahs-14952	763	8	liu	liu	PROPN
ahs-14952	763	9	x.z	x.z	PROPN
ahs-14952	763	10	.	.	PROPN
ahs-14952	763	11	,	,	PUNCT
ahs-14952	763	12	wen	wen	PROPN
ahs-14952	763	13	h.a	h.a	PROPN
ahs-14952	763	14	.	.	PROPN
ahs-14952	763	15	,	,	PUNCT
ahs-14952	763	16	wang	wang	PROPN
ahs-14952	763	17	m.	m.	PROPN
ahs-14952	763	18	,	,	PUNCT
ahs-14952	763	19	2010	2010	NUM
ahs-14952	763	20	.	.	PUNCT
ahs-14952	764	1	­	­	VERB
ahs-14952	764	2	a	a	DET
ahs-14952	764	3	simple	simple	ADJ
ahs-14952	764	4	method	method	NOUN
ahs-14952	764	5	of	of	ADP
ahs-14952	764	6	genomic	genomic	ADJ
ahs-14952	764	7	dna	dna	NOUN
ahs-14952	764	8	extraction	extraction	NOUN
ahs-14952	764	9	suitable	suitable	ADJ
ahs-14952	764	10	for	for	ADP
ahs-14952	764	11	analysis	analysis	NOUN
ahs-14952	764	12	of	of	ADP
ahs-14952	764	13	bulk	bulk	ADJ
ahs-14952	764	14	fungal	fungal	ADJ
ahs-14952	764	15	strains	strain	NOUN
ahs-14952	764	16	.	.	PUNCT
ahs-14952	765	1	­	­	PROPN
ahs-14952	765	2	lett	lett	PROPN
ahs-14952	765	3	.	.	PUNCT
ahs-14952	766	1	appl	appl	PROPN
ahs-14952	766	2	.	.	PUNCT
ahs-14952	767	1	microbiol	microbiol	PROPN
ahs-14952	767	2	.	.	PUNCT
ahs-14952	767	3	,	,	PUNCT
ahs-14952	767	4	51(1	51(1	NUM
ahs-14952	767	5	):	):	PUNCT
ahs-14952	767	6	114­118	114­118	NUM
ahs-14952	767	7	.	.	PUNCT
ahs-14952	768	1	zhao	zhao	PROPN
ahs-14952	768	2	j.n	j.n	PROPN
ahs-14952	768	3	.	.	PROPN
ahs-14952	769	1	liu	liu	PROPN
ahs-14952	769	2	h.x	h.x	PROPN
ahs-14952	769	3	.	.	PROPN
ahs-14952	769	4	,	,	PUNCT
ahs-14952	769	5	2008	2008	NUM
ahs-14952	769	6	­	­	NUM
ahs-14952	769	7	effects	effect	NOUN
ahs-14952	769	8	of	of	ADP
ahs-14952	769	9	fungal	fungal	ADJ
ahs-14952	769	10	elicitors	elicitor	NOUN
ahs-14952	769	11	on	on	ADP
ahs-14952	769	12	the	the	DET
ahs-14952	769	13	protocorm	protocorm	NOUN
ahs-14952	769	14	of	of	ADP
ahs-14952	769	15	cymbidium	cymbidium	NOUN
ahs-14952	769	16	eburneum	eburneum	NOUN
ahs-14952	769	17	.	.	PUNCT
ahs-14952	770	1	­	­	PROPN
ahs-14952	770	2	eco	eco	PROPN
ahs-14952	770	3	.	.	PUNCT
ahs-14952	771	1	sci	sci	PROPN
ahs-14952	771	2	.	.	PROPN
ahs-14952	771	3	,	,	PUNCT
ahs-14952	771	4	27(2	27(2	NUM
ahs-14952	771	5	):	):	PUNCT
ahs-14952	771	6	134­137	134­137	NUM
ahs-14952	771	7	.	.	PUNCT
ahs-14952	772	1	zhao	zhao	PROPN
ahs-14952	772	2	d.k	d.k	PROPN
ahs-14952	772	3	.	.	PROPN
ahs-14952	772	4	,	,	PUNCT
ahs-14952	772	5	selosse	selosse	PROPN
ahs-14952	772	6	m.a	m.a	PROPN
ahs-14952	772	7	.	.	PROPN
ahs-14952	772	8	,	,	PUNCT
ahs-14952	772	9	wu	wu	PROPN
ahs-14952	772	10	l.	l.	PROPN
ahs-14952	772	11	,	,	PUNCT
ahs-14952	772	12	luo	luo	PROPN
ahs-14952	772	13	y.	y.	PROPN
ahs-14952	772	14	,	,	PUNCT
ahs-14952	772	15	shao	shao	PROPN
ahs-14952	772	16	s.c	s.c	PROPN
ahs-14952	772	17	.	.	PROPN
ahs-14952	772	18	,	,	PUNCT
ahs-14952	772	19	ruan	ruan	PROPN
ahs-14952	772	20	y.l	y.l	PROPN
ahs-14952	772	21	.	.	PROPN
ahs-14952	772	22	,	,	PUNCT
ahs-14952	772	23	2021	2021	NUM
ahs-14952	772	24	­	­	VERB
ahs-14952	772	25	orchid	orchid	NOUN
ahs-14952	772	26	reintroduction	reintroduction	NOUN
ahs-14952	772	27	based	base	VERB
ahs-14952	772	28	on	on	ADP
ahs-14952	772	29	seed	seed	NOUN
ahs-14952	772	30	germination‐promoting	germination‐promoting	NOUN
ahs-14952	772	31	mycorrhizal	mycorrhizal	NOUN
ahs-14952	772	32	fungi	fungus	NOUN
ahs-14952	772	33	derived	derive	VERB
ahs-14952	772	34	from	from	ADP
ahs-14952	772	35	protocorms	protocorm	NOUN
ahs-14952	772	36	or	or	CCONJ
ahs-14952	772	37	seedlings	seedling	NOUN
ahs-14952	772	38	.	.	PUNCT
ahs-14952	773	1	­	­	PROPN
ahs-14952	773	2	front	front	ADJ
ahs-14952	773	3	.	.	PUNCT
ahs-14952	774	1	plant	plant	NOUN
ahs-14952	774	2	sci	sci	PROPN
ahs-14952	774	3	.	.	PROPN
ahs-14952	774	4	,	,	PUNCT
ahs-14952	774	5	12	12	NUM
ahs-14952	774	6	:	:	SYM
ahs-14952	774	7	1­11	1­11	NUM
ahs-14952	774	8	.	.	PUNCT
ahs-14952	775	1	zhou	zhou	PROPN
ahs-14952	775	2	x.	x.	PROPN
ahs-14952	775	3	,	,	PUNCT
ahs-14952	775	4	gao	gao	PROPN
ahs-14952	775	5	j.y	j.y	PROPN
ahs-14952	775	6	.	.	PROPN
ahs-14952	775	7	,	,	PUNCT
ahs-14952	775	8	2016	2016	NUM
ahs-14952	775	9	­	­	VERB
ahs-14952	775	10	highly	highly	ADV
ahs-14952	775	11	compatible	compatible	ADJ
ahs-14952	775	12	epa‐01	epa‐01	PUNCT
ahs-14952	775	13	strain	strain	NOUN
ahs-14952	775	14	promotes	promote	VERB
ahs-14952	775	15	seed	seed	NOUN
ahs-14952	775	16	germination	germination	NOUN
ahs-14952	775	17	and	and	CCONJ
ahs-14952	775	18	protocorm	protocorm	NOUN
ahs-14952	775	19	development	development	NOUN
ahs-14952	775	20	of	of	ADP
ahs-14952	775	21	papilionanthe	papilionanthe	DET
ahs-14952	775	22	teres	tere	NOUN
ahs-14952	775	23	(	(	PUNCT
ahs-14952	775	24	orchidaceae	orchidaceae	PROPN
ahs-14952	775	25	)	)	PUNCT
ahs-14952	775	26	.	.	PUNCT
ahs-14952	776	1	­	­	NOUN
ahs-14952	776	2	plant	plant	NOUN
ahs-14952	776	3	cell	cell	NOUN
ahs-14952	776	4	,	,	PUNCT
ahs-14952	776	5	tissue	tissue	NOUN
ahs-14952	776	6	organ	organ	NOUN
ahs-14952	776	7	cult	cult	NOUN
ahs-14952	776	8	.	.	PUNCT
ahs-14952	776	9	,	,	PUNCT
ahs-14952	776	10	125(3	125(3	NUM
ahs-14952	776	11	):	):	PUNCT
ahs-14952	776	12	479­493	479­493	NUM
ahs-14952	776	13	.	.	PUNCT
ahs-14952	777	1	zi	zi	PROPN
ahs-14952	777	2	x.m	x.m	PROPN
ahs-14952	777	3	.	.	PROPN
ahs-14952	777	4	,	,	PUNCT
ahs-14952	777	5	sheng	sheng	PROPN
ahs-14952	777	6	c.l	c.l	PROPN
ahs-14952	777	7	.	.	PROPN
ahs-14952	777	8	,	,	PUNCT
ahs-14952	777	9	goodale	goodale	VERB
ahs-14952	777	10	u.m	u.m	PROPN
ahs-14952	777	11	.	.	PROPN
ahs-14952	777	12	,	,	PUNCT
ahs-14952	777	13	shao	shao	PROPN
ahs-14952	777	14	s.c	s.c	PROPN
ahs-14952	777	15	.	.	PROPN
ahs-14952	777	16	,	,	PUNCT
ahs-14952	777	17	gao	gao	PROPN
ahs-14952	777	18	j.y	j.y	PROPN
ahs-14952	777	19	.	.	PROPN
ahs-14952	777	20	,	,	PUNCT
ahs-14952	777	21	2014	2014	NUM
ahs-14952	777	22	­	­	NOUN
ahs-14952	777	23	in	in	ADP
ahs-14952	777	24	situ	situ	ADJ
ahs-14952	777	25	seed	seed	NOUN
ahs-14952	777	26	baiting	bait	VERB
ahs-14952	777	27	to	to	PART
ahs-14952	777	28	isolate	isolate	VERB
ahs-14952	777	29	germination‐	germination‐	ADJ
ahs-14952	777	30	enhancing	enhance	VERB
ahs-14952	777	31	fungi	fungus	NOUN
ahs-14952	777	32	for	for	ADP
ahs-14952	777	33	an	an	DET
ahs-14952	777	34	epiphytic	epiphytic	ADJ
ahs-14952	777	35	orchid	orchid	NOUN
ahs-14952	777	36	,	,	PUNCT
ahs-14952	777	37	dendrobium	dendrobium	NOUN
ahs-14952	777	38	aphyllum	aphyllum	NOUN
ahs-14952	777	39	(	(	PUNCT
ahs-14952	777	40	orchidaceae	orchidaceae	PROPN
ahs-14952	777	41	)	)	PUNCT
ahs-14952	777	42	.	.	PUNCT
ahs-14952	778	1	­	­	PROPN
ahs-14952	778	2	mycorrhiza	mycorrhiza	PROPN
ahs-14952	778	3	,	,	PUNCT
ahs-14952	778	4	24(7	24(7	NUM
ahs-14952	778	5	):	):	PUNCT
ahs-14952	778	6	487­499	487­499	NUM
ahs-14952	778	7	.	.	PUNCT