id	sid	tid	token	lemma	pos
ahs-18395	1	1	119	119	NUM
ahs-18395	1	2	1	1	NUM
ahs-18395	1	3	.	.	PUNCT
ahs-18395	2	1	introduction	introduction	NOUN
ahs-18395	2	2	cochliobolus	cochliobolus	PROPN
ahs-18395	2	3	sativus	sativus	PROPN
ahs-18395	2	4	(	(	PUNCT
ahs-18395	2	5	ito	ito	PROPN
ahs-18395	2	6	&	&	CCONJ
ahs-18395	2	7	kurib	kurib	PROPN
ahs-18395	2	8	.	.	PUNCT
ahs-18395	2	9	)	)	PUNCT
ahs-18395	3	1	drechsl	drechsl	PROPN
ahs-18395	3	2	.	.	PUNCT
ahs-18395	4	1	ex	ex	X
ahs-18395	4	2	dast	dast	INTJ
ahs-18395	4	3	.	.	PUNCT
ahs-18395	5	1	[	[	X
ahs-18395	5	2	anamorph	anamorph	NOUN
ahs-18395	5	3	:	:	PUNCT
ahs-18395	5	4	bipolaris	bipolaris	VERB
ahs-18395	5	5	sorokiniana	sorokiniana	PROPN
ahs-18395	5	6	(	(	PUNCT
ahs-18395	5	7	sacc	sacc	PROPN
ahs-18395	5	8	.	.	PUNCT
ahs-18395	6	1	in	in	ADP
ahs-18395	6	2	sorok	sorok	NOUN
ahs-18395	6	3	.	.	PUNCT
ahs-18395	6	4	)	)	PUNCT
ahs-18395	6	5	shoem	shoem	PROPN
ahs-18395	6	6	.	.	PUNCT
ahs-18395	6	7	]	]	PUNCT
ahs-18395	6	8	is	be	AUX
ahs-18395	6	9	an	an	DET
ahs-18395	6	10	ascomycetous	ascomycetous	ADJ
ahs-18395	6	11	fungus	fungus	NOUN
ahs-18395	6	12	that	that	PRON
ahs-18395	6	13	causes	cause	VERB
ahs-18395	6	14	spot	spot	NOUN
ahs-18395	6	15	blotch	blotch	NOUN
ahs-18395	6	16	(	(	PUNCT
ahs-18395	6	17	sb	sb	NOUN
ahs-18395	6	18	)	)	PUNCT
ahs-18395	6	19	of	of	ADP
ahs-18395	6	20	barley	barley	NOUN
ahs-18395	6	21	,	,	PUNCT
ahs-18395	6	22	hordeum	hordeum	PROPN
ahs-18395	6	23	vulgare	vulgare	PROPN
ahs-18395	6	24	l.	l.	PROPN
ahs-18395	6	25	,	,	PUNCT
ahs-18395	6	26	a	a	DET
ahs-18395	6	27	disease	disease	NOUN
ahs-18395	6	28	responsible	responsible	ADJ
ahs-18395	6	29	for	for	ADP
ahs-18395	6	30	large	large	ADJ
ahs-18395	6	31	economic	economic	ADJ
ahs-18395	6	32	losses	loss	NOUN
ahs-18395	6	33	in	in	ADP
ahs-18395	6	34	barley	barley	NOUN
ahs-18395	6	35	-	-	PUNCT
ahs-18395	6	36	growing	grow	VERB
ahs-18395	6	37	areas	area	NOUN
ahs-18395	6	38	(	(	PUNCT
ahs-18395	6	39	mathre	mathre	ADJ
ahs-18395	6	40	,	,	PUNCT
ahs-18395	6	41	1990	1990	NUM
ahs-18395	6	42	)	)	PUNCT
ahs-18395	6	43	.	.	PUNCT
ahs-18395	7	1	although	although	SCONJ
ahs-18395	7	2	the	the	DET
ahs-18395	7	3	production	production	NOUN
ahs-18395	7	4	of	of	ADP
ahs-18395	7	5	conidia	conidia	NOUN
ahs-18395	7	6	is	be	AUX
ahs-18395	7	7	expected	expect	VERB
ahs-18395	7	8	to	to	PART
ahs-18395	7	9	produce	produce	VERB
ahs-18395	7	10	genetically	genetically	ADV
ahs-18395	7	11	identical	identical	ADJ
ahs-18395	7	12	clones	clone	NOUN
ahs-18395	7	13	,	,	PUNCT
ahs-18395	7	14	the	the	DET
ahs-18395	7	15	high	high	ADJ
ahs-18395	7	16	rate	rate	NOUN
ahs-18395	7	17	of	of	ADP
ahs-18395	7	18	appearance	appearance	NOUN
ahs-18395	7	19	of	of	ADP
ahs-18395	7	20	new	new	ADJ
ahs-18395	7	21	races	race	NOUN
ahs-18395	7	22	with	with	ADP
ahs-18395	7	23	the	the	DET
ahs-18395	7	24	ability	ability	NOUN
ahs-18395	7	25	to	to	PART
ahs-18395	7	26	infect	infect	VERB
ahs-18395	7	27	previously	previously	ADV
ahs-18395	7	28	resistant	resistant	ADJ
ahs-18395	7	29	varieties	variety	NOUN
ahs-18395	7	30	of	of	ADP
ahs-18395	7	31	barley	barley	NOUN
ahs-18395	7	32	suggests	suggest	VERB
ahs-18395	7	33	that	that	SCONJ
ahs-18395	7	34	c.	c.	PROPN
ahs-18395	7	35	sativus	sativus	PROPN
ahs-18395	7	36	may	may	AUX
ahs-18395	7	37	have	have	VERB
ahs-18395	7	38	high	high	ADJ
ahs-18395	7	39	mutation	mutation	NOUN
ahs-18395	7	40	rates	rate	NOUN
ahs-18395	7	41	in	in	ADP
ahs-18395	7	42	avirulence	avirulence	NOUN
ahs-18395	7	43	genes	gene	NOUN
ahs-18395	7	44	,	,	PUNCT
ahs-18395	7	45	which	which	PRON
ahs-18395	7	46	determine	determine	VERB
ahs-18395	7	47	race	race	NOUN
ahs-18395	7	48	(	(	PUNCT
ahs-18395	7	49	kumar	kumar	PROPN
ahs-18395	7	50	et	et	PROPN
ahs-18395	7	51	al	al	PROPN
ahs-18395	7	52	.	.	PROPN
ahs-18395	7	53	,	,	PUNCT
ahs-18395	7	54	2002	2002	NUM
ahs-18395	7	55	)	)	PUNCT
ahs-18395	7	56	.	.	PUNCT
ahs-18395	8	1	general	general	ADJ
ahs-18395	8	2	symptoms	symptom	NOUN
ahs-18395	8	3	of	of	ADP
ahs-18395	8	4	sb	sb	PROPN
ahs-18395	8	5	include	include	VERB
ahs-18395	8	6	light	light	ADJ
ahs-18395	8	7	brown	brown	ADJ
ahs-18395	8	8	lesions	lesion	NOUN
ahs-18395	8	9	with	with	ADP
ahs-18395	8	10	whitish	whitish	ADJ
ahs-18395	8	11	gray	gray	ADJ
ahs-18395	8	12	centers	center	NOUN
ahs-18395	8	13	and	and	CCONJ
ahs-18395	8	14	chlorotic	chlorotic	ADJ
ahs-18395	8	15	margins	margin	NOUN
ahs-18395	8	16	(	(	PUNCT
ahs-18395	8	17	kumar	kumar	PROPN
ahs-18395	8	18	et	et	PROPN
ahs-18395	8	19	al	al	PROPN
ahs-18395	8	20	.	.	PROPN
ahs-18395	8	21	,	,	PUNCT
ahs-18395	8	22	2002	2002	NUM
ahs-18395	8	23	)	)	PUNCT
ahs-18395	8	24	.	.	PUNCT
ahs-18395	9	1	most	most	ADJ
ahs-18395	9	2	varieties	variety	NOUN
ahs-18395	9	3	grown	grow	VERB
ahs-18395	9	4	around	around	ADP
ahs-18395	9	5	the	the	DET
ahs-18395	9	6	world	world	NOUN
ahs-18395	9	7	are	be	AUX
ahs-18395	9	8	susceptible	susceptible	ADJ
ahs-18395	9	9	to	to	ADP
ahs-18395	9	10	c.	c.	PROPN
ahs-18395	9	11	sativus	sativus	PROPN
ahs-18395	9	12	,	,	PUNCT
ahs-18395	9	13	although	although	SCONJ
ahs-18395	9	14	partial	partial	ADJ
ahs-18395	9	15	resistance	resistance	NOUN
ahs-18395	9	16	has	have	AUX
ahs-18395	9	17	been	be	AUX
ahs-18395	9	18	reported	report	VERB
ahs-18395	9	19	(	(	PUNCT
ahs-18395	9	20	arabi	arabi	X
ahs-18395	9	21	,	,	PUNCT
ahs-18395	9	22	2005	2005	NUM
ahs-18395	9	23	;	;	PUNCT
ahs-18395	9	24	zhou	zhou	PROPN
ahs-18395	9	25	and	and	CCONJ
ahs-18395	9	26	steffenson	steffenson	NOUN
ahs-18395	9	27	,	,	PUNCT
ahs-18395	9	28	2013	2013	NUM
ahs-18395	9	29	)	)	PUNCT
ahs-18395	9	30	.	.	PUNCT
ahs-18395	10	1	genetic	genetic	ADJ
ahs-18395	10	2	control	control	NOUN
ahs-18395	10	3	of	of	ADP
ahs-18395	10	4	sb	sb	PROPN
ahs-18395	10	5	resistance	resistance	PROPN
ahs-18395	10	6	is	be	AUX
ahs-18395	10	7	governed	govern	VERB
ahs-18395	10	8	by	by	ADP
ahs-18395	10	9	quantitative	quantitative	ADJ
ahs-18395	10	10	traits	trait	NOUN
ahs-18395	10	11	.	.	PUNCT
ahs-18395	11	1	two	two	NUM
ahs-18395	11	2	quantitative	quantitative	ADJ
ahs-18395	11	3	trait	trait	NOUN
ahs-18395	11	4	loci	loci	NOUN
ahs-18395	11	5	(	(	PUNCT
ahs-18395	11	6	qtls	qtls	PROPN
ahs-18395	11	7	)	)	PUNCT
ahs-18395	11	8	have	have	AUX
ahs-18395	11	9	been	be	AUX
ahs-18395	11	10	mapped	map	VERB
ahs-18395	11	11	to	to	ADP
ahs-18395	11	12	chromosomes	chromosome	NOUN
ahs-18395	11	13	1s	1	NOUN
ahs-18395	11	14	and	and	CCONJ
ahs-18395	11	15	5s	5s	NUM
ahs-18395	11	16	(	(	PUNCT
ahs-18395	11	17	steffenson	steffenson	NOUN
ahs-18395	11	18	et	et	PROPN
ahs-18395	11	19	al	al	PROPN
ahs-18395	11	20	.	.	PROPN
ahs-18395	11	21	,	,	PUNCT
ahs-18395	11	22	1996	1996	NUM
ahs-18395	11	23	)	)	PUNCT
ahs-18395	11	24	.	.	PUNCT
ahs-18395	12	1	however	however	ADV
ahs-18395	12	2	,	,	PUNCT
ahs-18395	12	3	in	in	ADP
ahs-18395	12	4	the	the	DET
ahs-18395	12	5	case	case	NOUN
ahs-18395	12	6	of	of	ADP
ahs-18395	12	7	the	the	DET
ahs-18395	12	8	host	host	NOUN
ahs-18395	12	9	-	-	PUNCT
ahs-18395	12	10	specific	specific	ADJ
ahs-18395	12	11	toxin	toxin	NOUN
ahs-18395	12	12	produced	produce	VERB
ahs-18395	12	13	by	by	ADP
ahs-18395	12	14	c.	c.	PROPN
ahs-18395	12	15	sativus	sativus	PROPN
ahs-18395	12	16	,	,	PUNCT
ahs-18395	12	17	the	the	DET
ahs-18395	12	18	fungus	fungus	NOUN
ahs-18395	12	19	which	which	PRON
ahs-18395	12	20	incites	incite	VERB
ahs-18395	12	21	sb	sb	PROPN
ahs-18395	12	22	of	of	ADP
ahs-18395	12	23	barley	barley	PROPN
ahs-18395	12	24	,	,	PUNCT
ahs-18395	12	25	the	the	DET
ahs-18395	12	26	toxin	toxin	NOUN
ahs-18395	12	27	will	will	AUX
ahs-18395	12	28	produce	produce	VERB
ahs-18395	12	29	all	all	DET
ahs-18395	12	30	the	the	DET
ahs-18395	12	31	symptoms	symptom	NOUN
ahs-18395	12	32	characteristic	characteristic	ADJ
ahs-18395	12	33	of	of	ADP
ahs-18395	12	34	the	the	DET
ahs-18395	12	35	disease	disease	NOUN
ahs-18395	12	36	;	;	PUNCT
ahs-18395	12	37	sensitivity	sensitivity	NOUN
ahs-18395	12	38	to	to	ADP
ahs-18395	12	39	the	the	DET
ahs-18395	12	40	toxin	toxin	NOUN
ahs-18395	12	41	is	be	AUX
ahs-18395	12	42	correlated	correlate	VERB
ahs-18395	12	43	with	with	ADP
ahs-18395	12	44	susceptibility	susceptibility	NOUN
ahs-18395	12	45	to	to	ADP
ahs-18395	12	46	the	the	DET
ahs-18395	12	47	pathogen	pathogen	NOUN
ahs-18395	12	48	and	and	CCONJ
ahs-18395	12	49	toxin	toxin	NOUN
ahs-18395	12	50	production	production	NOUN
ahs-18395	12	51	by	by	ADP
ahs-18395	12	52	the	the	DET
ahs-18395	12	53	pathogen	pathogen	NOUN
ahs-18395	12	54	is	be	AUX
ahs-18395	12	55	directly	directly	ADV
ahs-18395	12	56	related	relate	VERB
ahs-18395	12	57	to	to	ADP
ahs-18395	12	58	its	its	PRON
ahs-18395	12	59	ability	ability	NOUN
ahs-18395	12	60	to	to	PART
ahs-18395	12	61	cause	cause	VERB
ahs-18395	12	62	disease	disease	NOUN
ahs-18395	12	63	(	(	PUNCT
ahs-18395	12	64	kumar	kumar	PROPN
ahs-18395	12	65	et	et	PROPN
ahs-18395	12	66	al	al	PROPN
ahs-18395	12	67	.	.	PROPN
ahs-18395	12	68	,	,	PUNCT
ahs-18395	12	69	2002	2002	NUM
ahs-18395	12	70	)	)	PUNCT
ahs-18395	12	71	.	.	PUNCT
ahs-18395	13	1	although	although	SCONJ
ahs-18395	13	2	the	the	DET
ahs-18395	13	3	most	most	ADV
ahs-18395	13	4	effective	effective	ADJ
ahs-18395	13	5	control	control	NOUN
ahs-18395	13	6	strategy	strategy	NOUN
ahs-18395	13	7	for	for	ADP
ahs-18395	13	8	sb	sb	PROPN
ahs-18395	13	9	is	be	AUX
ahs-18395	13	10	cultivating	cultivate	VERB
ahs-18395	13	11	resistant	resistant	ADJ
ahs-18395	13	12	varieties	variety	NOUN
ahs-18395	13	13	,	,	PUNCT
ahs-18395	13	14	it	it	PRON
ahs-18395	13	15	has	have	AUX
ahs-18395	13	16	often	often	ADV
ahs-18395	13	17	achieved	achieve	VERB
ahs-18395	13	18	only	only	ADV
ahs-18395	13	19	short	short	ADJ
ahs-18395	13	20	-	-	PUNCT
ahs-18395	13	21	term	term	NOUN
ahs-18395	13	22	success	success	NOUN
ahs-18395	13	23	due	due	ADP
ahs-18395	13	24	to	to	ADP
ahs-18395	13	25	the	the	DET
ahs-18395	13	26	frequent	frequent	ADJ
ahs-18395	13	27	breakdown	breakdown	NOUN
ahs-18395	13	28	of	of	ADP
ahs-18395	13	29	newly	newly	ADV
ahs-18395	13	30	introduced	introduce	VERB
ahs-18395	13	31	resistance	resistance	NOUN
ahs-18395	13	32	(	(	PUNCT
ahs-18395	13	33	poudyal	poudyal	NOUN
ahs-18395	13	34	et	et	PROPN
ahs-18395	13	35	al	al	PROPN
ahs-18395	13	36	.	.	PROPN
ahs-18395	13	37	,	,	PUNCT
ahs-18395	13	38	2005	2005	NUM
ahs-18395	13	39	;	;	PUNCT
ahs-18395	13	40	gontariu	gontariu	ADJ
ahs-18395	13	41	and	and	CCONJ
ahs-18395	13	42	enea	enea	ADJ
ahs-18395	13	43	,	,	PUNCT
ahs-18395	13	44	2012	2012	NUM
ahs-18395	13	45	)	)	PUNCT
ahs-18395	13	46	.	.	PUNCT
ahs-18395	14	1	this	this	DET
ahs-18395	14	2	resistance	resistance	NOUN
ahs-18395	14	3	breakdown	breakdown	NOUN
ahs-18395	14	4	has	have	AUX
ahs-18395	14	5	been	be	AUX
ahs-18395	14	6	attributed	attribute	VERB
ahs-18395	14	7	to	to	ADP
ahs-18395	14	8	genetic	genetic	ADJ
ahs-18395	14	9	variability	variability	NOUN
ahs-18395	14	10	in	in	ADP
ahs-18395	14	11	c.	c.	PROPN
ahs-18395	14	12	sativus	sativus	PROPN
ahs-18395	14	13	(	(	PUNCT
ahs-18395	14	14	gilchrist	gilchrist	NOUN
ahs-18395	14	15	et	et	PROPN
ahs-18395	14	16	al	al	PROPN
ahs-18395	14	17	.	.	PROPN
ahs-18395	14	18	,	,	PUNCT
ahs-18395	14	19	1995	1995	NUM
ahs-18395	14	20	)	)	PUNCT
ahs-18395	14	21	.	.	PUNCT
ahs-18395	15	1	different	different	ADJ
ahs-18395	15	2	mechanisms	mechanism	NOUN
ahs-18395	15	3	have	have	AUX
ahs-18395	15	4	been	be	AUX
ahs-18395	15	5	suggested	suggest	VERB
ahs-18395	15	6	to	to	PART
ahs-18395	15	7	explain	explain	VERB
ahs-18395	15	8	the	the	DET
ahs-18395	15	9	frequent	frequent	ADJ
ahs-18395	15	10	generation	generation	NOUN
ahs-18395	15	11	of	of	ADP
ahs-18395	15	12	race	race	NOUN
ahs-18395	15	13	variants	variant	NOUN
ahs-18395	15	14	,	,	PUNCT
ahs-18395	15	15	including	include	VERB
ahs-18395	15	16	heterokaryosis	heterokaryosis	NOUN
ahs-18395	15	17	,	,	PUNCT
ahs-18395	15	18	parasexuality	parasexuality	NOUN
ahs-18395	15	19	and	and	CCONJ
ahs-18395	15	20	mutations	mutation	NOUN
ahs-18395	15	21	(	(	PUNCT
ahs-18395	15	22	kumar	kumar	PROPN
ahs-18395	15	23	et	et	PROPN
ahs-18395	15	24	al	al	PROPN
ahs-18395	15	25	.	.	PROPN
ahs-18395	15	26	,	,	PUNCT
ahs-18395	15	27	2002	2002	NUM
ahs-18395	15	28	;	;	PUNCT
ahs-18395	15	29	arabi	arabi	PROPN
ahs-18395	15	30	and	and	CCONJ
ahs-18395	15	31	jawhar	jawhar	PROPN
ahs-18395	15	32	,	,	PUNCT
ahs-18395	15	33	2007	2007	NUM
ahs-18395	15	34	)	)	PUNCT
ahs-18395	15	35	.	.	PUNCT
ahs-18395	16	1	however	however	ADV
ahs-18395	16	2	,	,	PUNCT
ahs-18395	16	3	the	the	DET
ahs-18395	16	4	activity	activity	NOUN
ahs-18395	16	5	of	of	ADP
ahs-18395	16	6	the	the	DET
ahs-18395	16	7	retrotransposon	retrotransposon	NOUN
ahs-18395	16	8	microsatellite	microsatellite	NOUN
ahs-18395	16	9	amplified	amplify	VERB
ahs-18395	16	10	polymorphism	polymorphism	NOUN
ahs-18395	16	11	(	(	PUNCT
ahs-18395	16	12	remap	remap	NOUN
ahs-18395	16	13	)	)	PUNCT
ahs-18395	16	14	is	be	AUX
ahs-18395	16	15	another	another	DET
ahs-18395	16	16	possible	possible	ADJ
ahs-18395	16	17	mechanism	mechanism	NOUN
ahs-18395	16	18	that	that	PRON
ahs-18395	16	19	has	have	AUX
ahs-18395	16	20	been	be	AUX
ahs-18395	16	21	suggested	suggest	VERB
ahs-18395	16	22	which	which	PRON
ahs-18395	16	23	uses	use	VERB
ahs-18395	16	24	1	1	NUM
ahs-18395	16	25	ltr	ltr	ADJ
ahs-18395	16	26	primer	primer	NOUN
ahs-18395	16	27	in	in	ADP
ahs-18395	16	28	combination	combination	NOUN
ahs-18395	16	29	with	with	ADP
ahs-18395	16	30	a	a	DET
ahs-18395	16	31	primer	primer	NOUN
ahs-18395	16	32	designed	design	VERB
ahs-18395	16	33	for	for	ADP
ahs-18395	16	34	annealing	anneal	VERB
ahs-18395	16	35	at	at	ADP
ahs-18395	16	36	the	the	DET
ahs-18395	16	37	3	3	NUM
ahs-18395	16	38	’	'	PUNCT
ahs-18395	16	39	end	end	NOUN
ahs-18395	16	40	of	of	ADP
ahs-18395	16	41	a	a	DET
ahs-18395	16	42	stretch	stretch	NOUN
ahs-18395	16	43	of	of	ADP
ahs-18395	16	44	a	a	DET
ahs-18395	16	45	simple	simple	ADJ
ahs-18395	16	46	sequence	sequence	NOUN
ahs-18395	16	47	repeat	repeat	NOUN
ahs-18395	16	48	(	(	PUNCT
ahs-18395	16	49	ssr	ssr	NOUN
ahs-18395	16	50	)	)	PUNCT
ahs-18395	16	51	and	and	CCONJ
ahs-18395	16	52	detects	detect	NOUN
ahs-18395	16	53	retrotransposons	retrotransposon	NOUN
ahs-18395	16	54	inserted	insert	VERB
ahs-18395	16	55	near	near	ADP
ahs-18395	16	56	ssrs	ssrs	PROPN
ahs-18395	16	57	(	(	PUNCT
ahs-18395	16	58	chadha	chadha	NOUN
ahs-18395	16	59	and	and	CCONJ
ahs-18395	16	60	gopalakrishna	gopalakrishna	NOUN
ahs-18395	16	61	,	,	PUNCT
ahs-18395	16	62	2005	2005	NUM
ahs-18395	16	63	;	;	PUNCT
ahs-18395	16	64	biswas	biswas	PROPN
ahs-18395	16	65	et	et	PROPN
ahs-18395	16	66	al	al	PROPN
ahs-18395	16	67	.	.	PROPN
ahs-18395	16	68	,	,	PUNCT
ahs-18395	16	69	2010	2010	NUM
ahs-18395	16	70	)	)	PUNCT
ahs-18395	16	71	.	.	PUNCT
ahs-18395	17	1	our	our	PRON
ahs-18395	17	2	overall	overall	ADJ
ahs-18395	17	3	question	question	NOUN
ahs-18395	17	4	was	be	AUX
ahs-18395	17	5	how	how	SCONJ
ahs-18395	17	6	stable	stable	ADJ
ahs-18395	17	7	c.	c.	PROPN
ahs-18395	17	8	sativus	sativus	PROPN
ahs-18395	17	9	isolates	isolate	NOUN
ahs-18395	17	10	would	would	AUX
ahs-18395	17	11	be	be	AUX
ahs-18395	17	12	both	both	PRON
ahs-18395	17	13	genotypically	genotypically	ADV
ahs-18395	17	14	and	and	CCONJ
ahs-18395	17	15	phenotypically	phenotypically	ADV
ahs-18395	17	16	during	during	ADP
ahs-18395	17	17	several	several	ADJ
ahs-18395	17	18	serial	serial	ADJ
ahs-18395	17	19	transfers	transfer	NOUN
ahs-18395	17	20	in	in	ADP
ahs-18395	17	21	one	one	NUM
ahs-18395	17	22	growing	grow	VERB
ahs-18395	17	23	season	season	NOUN
ahs-18395	17	24	.	.	PUNCT
ahs-18395	18	1	therefore	therefore	ADV
ahs-18395	18	2	,	,	PUNCT
ahs-18395	18	3	the	the	DET
ahs-18395	18	4	objective	objective	NOUN
ahs-18395	18	5	of	of	ADP
ahs-18395	18	6	this	this	DET
ahs-18395	18	7	work	work	NOUN
ahs-18395	18	8	was	be	AUX
ahs-18395	18	9	(	(	PUNCT
ahs-18395	18	10	i	i	NOUN
ahs-18395	18	11	)	)	PUNCT
ahs-18395	18	12	to	to	PART
ahs-18395	18	13	determine	determine	VERB
ahs-18395	18	14	phenotypic	phenotypic	ADJ
ahs-18395	18	15	variation	variation	NOUN
ahs-18395	18	16	of	of	ADP
ahs-18395	18	17	the	the	DET
ahs-18395	18	18	two	two	NUM
ahs-18395	18	19	major	major	ADJ
ahs-18395	18	20	pathotypes	pathotype	NOUN
ahs-18395	18	21	of	of	ADP
ahs-18395	18	22	c.	c.	PROPN
ahs-18395	18	23	sativus	sativus	PROPN
ahs-18395	18	24	in	in	ADP
ahs-18395	18	25	syria	syria	PROPN
ahs-18395	18	26	,	,	PUNCT
ahs-18395	18	27	pt1	pt1	PROPN
ahs-18395	18	28	and	and	CCONJ
ahs-18395	18	29	pt4	pt4	PROPN
ahs-18395	18	30	during	during	ADP
ahs-18395	18	31	seven	seven	NUM
ahs-18395	18	32	serial	serial	ADJ
ahs-18395	18	33	transfers	transfer	NOUN
ahs-18395	18	34	on	on	ADP
ahs-18395	18	35	barely	barely	ADV
ahs-18395	18	36	plants	plant	NOUN
ahs-18395	18	37	and	and	CCONJ
ahs-18395	18	38	(	(	PUNCT
ahs-18395	18	39	ii	ii	NOUN
ahs-18395	18	40	)	)	PUNCT
ahs-18395	18	41	to	to	PART
ahs-18395	18	42	investigate	investigate	VERB
ahs-18395	18	43	genetic	genetic	ADJ
ahs-18395	18	44	variation	variation	NOUN
ahs-18395	18	45	of	of	ADP
ahs-18395	18	46	the	the	DET
ahs-18395	18	47	isolates	isolate	NOUN
ahs-18395	18	48	collected	collect	VERB
ahs-18395	18	49	in	in	ADP
ahs-18395	18	50	each	each	DET
ahs-18395	18	51	generation	generation	NOUN
ahs-18395	18	52	using	use	VERB
ahs-18395	18	53	dna	dna	PROPN
ahs-18395	18	54	fingerprinting	fingerprinting	NOUN
ahs-18395	18	55	.	.	PUNCT
ahs-18395	19	1	cultural	cultural	ADJ
ahs-18395	19	2	and	and	CCONJ
ahs-18395	19	3	genetic	genetic	ADJ
ahs-18395	19	4	evaluation	evaluation	NOUN
ahs-18395	19	5	of	of	ADP
ahs-18395	19	6	cochliobolus	cochliobolus	PROPN
ahs-18395	19	7	sativus	sativus	PROPN
ahs-18395	19	8	during	during	ADP
ahs-18395	19	9	successive	successive	ADJ
ahs-18395	19	10	passages	passage	NOUN
ahs-18395	19	11	through	through	ADP
ahs-18395	19	12	susceptible	susceptible	ADJ
ahs-18395	19	13	barley	barley	NOUN
ahs-18395	19	14	m.i.e	m.i.e	NOUN
ahs-18395	19	15	.	.	PUNCT
ahs-18395	20	1	arabi	arabi	PROPN
ahs-18395	20	2	,	,	PUNCT
ahs-18395	20	3	m.	m.	NOUN
ahs-18395	20	4	jawhar	jawhar	PROPN
ahs-18395	20	5	(	(	PUNCT
ahs-18395	20	6	1	1	NUM
ahs-18395	20	7	)	)	PUNCT
ahs-18395	20	8	department	department	NOUN
ahs-18395	20	9	of	of	ADP
ahs-18395	20	10	molecular	molecular	ADJ
ahs-18395	20	11	biology	biology	NOUN
ahs-18395	20	12	and	and	CCONJ
ahs-18395	20	13	biotechnology	biotechnology	NOUN
ahs-18395	20	14	,	,	PUNCT
ahs-18395	20	15	aecs	aec	NOUN
ahs-18395	20	16	,	,	PUNCT
ahs-18395	20	17	damascus	damascus	PROPN
ahs-18395	20	18	,	,	PUNCT
ahs-18395	20	19	syria	syria	PROPN
ahs-18395	20	20	.	.	PUNCT
ahs-18395	21	1	key	key	ADJ
ahs-18395	21	2	words	word	NOUN
ahs-18395	21	3	:	:	PUNCT
ahs-18395	21	4	cochliobolus	cochliobolus	PROPN
ahs-18395	21	5	sativus	sativus	PROPN
ahs-18395	21	6	,	,	PUNCT
ahs-18395	21	7	hordeum	hordeum	NOUN
ahs-18395	21	8	vulgare	vulgare	NOUN
ahs-18395	21	9	,	,	PUNCT
ahs-18395	21	10	phenotypes	phenotype	NOUN
ahs-18395	21	11	,	,	PUNCT
ahs-18395	21	12	spot	spot	NOUN
ahs-18395	21	13	blotch	blotch	NOUN
ahs-18395	21	14	.	.	PUNCT
ahs-18395	22	1	abstract	abstract	ADJ
ahs-18395	22	2	:	:	PUNCT
ahs-18395	22	3	the	the	DET
ahs-18395	22	4	objective	objective	NOUN
ahs-18395	22	5	of	of	ADP
ahs-18395	22	6	this	this	DET
ahs-18395	22	7	work	work	NOUN
ahs-18395	22	8	was	be	AUX
ahs-18395	22	9	to	to	PART
ahs-18395	22	10	assess	assess	VERB
ahs-18395	22	11	the	the	DET
ahs-18395	22	12	stability	stability	NOUN
ahs-18395	22	13	of	of	ADP
ahs-18395	22	14	retrotransposons	retrotransposon	NOUN
ahs-18395	22	15	dna	dna	PROPN
ahs-18395	22	16	elements	element	NOUN
ahs-18395	22	17	and	and	CCONJ
ahs-18395	22	18	several	several	ADJ
ahs-18395	22	19	key	key	ADJ
ahs-18395	22	20	phenotypic	phenotypic	NOUN
ahs-18395	22	21	traits	trait	NOUN
ahs-18395	22	22	important	important	ADJ
ahs-18395	22	23	for	for	ADP
ahs-18395	22	24	virulence	virulence	NOUN
ahs-18395	22	25	of	of	ADP
ahs-18395	22	26	cochliobolus	cochliobolus	PROPN
ahs-18395	22	27	sativus	sativus	PROPN
ahs-18395	22	28	after	after	ADP
ahs-18395	22	29	serially	serially	ADV
ahs-18395	22	30	transferring	transfer	VERB
ahs-18395	22	31	through	through	ADP
ahs-18395	22	32	susceptible	susceptible	ADJ
ahs-18395	22	33	barley	barley	NOUN
ahs-18395	22	34	plants	plant	NOUN
ahs-18395	22	35	.	.	PUNCT
ahs-18395	23	1	a	a	DET
ahs-18395	23	2	significant	significant	ADJ
ahs-18395	23	3	increase	increase	NOUN
ahs-18395	23	4	in	in	ADP
ahs-18395	23	5	virulence	virulence	NOUN
ahs-18395	23	6	was	be	AUX
ahs-18395	23	7	observed	observe	VERB
ahs-18395	23	8	in	in	ADP
ahs-18395	23	9	offspring	offspring	NOUN
ahs-18395	23	10	isolates	isolate	NOUN
ahs-18395	23	11	generated	generate	VERB
ahs-18395	23	12	from	from	ADP
ahs-18395	23	13	the	the	DET
ahs-18395	23	14	aggressive	aggressive	ADJ
ahs-18395	23	15	isolate	isolate	PROPN
ahs-18395	23	16	pt4	pt4	NOUN
ahs-18395	23	17	,	,	PUNCT
ahs-18395	23	18	in	in	ADP
ahs-18395	23	19	contrast	contrast	NOUN
ahs-18395	23	20	to	to	ADP
ahs-18395	23	21	the	the	DET
ahs-18395	23	22	lack	lack	NOUN
ahs-18395	23	23	of	of	ADP
ahs-18395	23	24	significant	significant	ADJ
ahs-18395	23	25	changes	change	NOUN
ahs-18395	23	26	in	in	ADP
ahs-18395	23	27	those	those	PRON
ahs-18395	23	28	obtained	obtain	VERB
ahs-18395	23	29	from	from	ADP
ahs-18395	23	30	the	the	DET
ahs-18395	23	31	weakly	weakly	ADJ
ahs-18395	23	32	aggressive	aggressive	ADJ
ahs-18395	23	33	isolate	isolate	NOUN
ahs-18395	23	34	pt1	pt1	PROPN
ahs-18395	23	35	after	after	ADP
ahs-18395	23	36	seven	seven	NUM
ahs-18395	23	37	successive	successive	ADJ
ahs-18395	23	38	passages	passage	NOUN
ahs-18395	23	39	.	.	PUNCT
ahs-18395	24	1	no	no	DET
ahs-18395	24	2	apparent	apparent	ADJ
ahs-18395	24	3	differences	difference	NOUN
ahs-18395	24	4	in	in	ADP
ahs-18395	24	5	phenotypes	phenotype	NOUN
ahs-18395	24	6	,	,	PUNCT
ahs-18395	24	7	including	include	VERB
ahs-18395	24	8	mycelial	mycelial	ADJ
ahs-18395	24	9	growth	growth	NOUN
ahs-18395	24	10	,	,	PUNCT
ahs-18395	24	11	conidiation	conidiation	NOUN
ahs-18395	24	12	and	and	CCONJ
ahs-18395	24	13	conidial	conidial	ADJ
ahs-18395	24	14	germination	germination	NOUN
ahs-18395	24	15	were	be	AUX
ahs-18395	24	16	observed	observe	VERB
ahs-18395	24	17	among	among	ADP
ahs-18395	24	18	isolates	isolate	NOUN
ahs-18395	24	19	from	from	ADP
ahs-18395	24	20	the	the	DET
ahs-18395	24	21	same	same	ADJ
ahs-18395	24	22	parent	parent	NOUN
ahs-18395	24	23	isolate	isolate	NOUN
ahs-18395	24	24	on	on	ADP
ahs-18395	24	25	artificial	artificial	ADJ
ahs-18395	24	26	medium	medium	NOUN
ahs-18395	24	27	.	.	PUNCT
ahs-18395	25	1	based	base	VERB
ahs-18395	25	2	on	on	ADP
ahs-18395	25	3	retrotransposon	retrotransposon	NOUN
ahs-18395	25	4	microsatellite	microsatellite	NOUN
ahs-18395	25	5	amplified	amplify	VERB
ahs-18395	25	6	polymorphism	polymorphism	NOUN
ahs-18395	25	7	(	(	PUNCT
ahs-18395	25	8	remap	remap	NOUN
ahs-18395	25	9	)	)	PUNCT
ahs-18395	25	10	,	,	PUNCT
ahs-18395	25	11	parents	parent	NOUN
ahs-18395	25	12	and	and	CCONJ
ahs-18395	25	13	their	their	PRON
ahs-18395	25	14	generations	generation	NOUN
ahs-18395	25	15	were	be	AUX
ahs-18395	25	16	identical	identical	ADJ
ahs-18395	25	17	during	during	ADP
ahs-18395	25	18	the	the	DET
ahs-18395	25	19	serial	serial	ADJ
ahs-18395	25	20	transfers	transfer	NOUN
ahs-18395	25	21	.	.	PUNCT
ahs-18395	26	1	taken	take	VERB
ahs-18395	26	2	together	together	ADV
ahs-18395	26	3	,	,	PUNCT
ahs-18395	26	4	our	our	PRON
ahs-18395	26	5	results	result	NOUN
ahs-18395	26	6	suggest	suggest	VERB
ahs-18395	26	7	that	that	SCONJ
ahs-18395	26	8	all	all	DET
ahs-18395	26	9	singleconidials	singleconidial	NOUN
ahs-18395	26	10	of	of	ADP
ahs-18395	26	11	the	the	DET
ahs-18395	26	12	parents	parent	NOUN
ahs-18395	26	13	and	and	CCONJ
ahs-18395	26	14	their	their	PRON
ahs-18395	26	15	generations	generation	NOUN
ahs-18395	26	16	were	be	AUX
ahs-18395	26	17	stable	stable	ADJ
ahs-18395	26	18	genotypically	genotypically	ADV
ahs-18395	26	19	during	during	ADP
ahs-18395	26	20	seven	seven	NUM
ahs-18395	26	21	serial	serial	ADJ
ahs-18395	26	22	transfers	transfer	NOUN
ahs-18395	26	23	with	with	ADP
ahs-18395	26	24	a	a	DET
ahs-18395	26	25	change	change	NOUN
ahs-18395	26	26	in	in	ADP
ahs-18395	26	27	virulence	virulence	NOUN
ahs-18395	26	28	of	of	ADP
ahs-18395	26	29	the	the	DET
ahs-18395	26	30	aggressive	aggressive	ADJ
ahs-18395	26	31	isolate	isolate	NOUN
ahs-18395	26	32	generations	generation	NOUN
ahs-18395	26	33	.	.	PUNCT
ahs-18395	27	1	adv	adv	PROPN
ahs-18395	27	2	.	.	PUNCT
ahs-18395	27	3	hort	hort	PROPN
ahs-18395	27	4	.	.	PUNCT
ahs-18395	28	1	sci	sci	PROPN
ahs-18395	28	2	.	.	PROPN
ahs-18395	28	3	,	,	PUNCT
ahs-18395	28	4	2014	2014	NUM
ahs-18395	28	5	28(3	28(3	NUM
ahs-18395	28	6	):	):	PUNCT
ahs-18395	28	7	119	119	NUM
ahs-18395	28	8	-	-	SYM
ahs-18395	28	9	122	122	NUM
ahs-18395	28	10	(	(	PUNCT
ahs-18395	28	11	1	1	NUM
ahs-18395	28	12	)	)	PUNCT
ahs-18395	28	13	corresponding	correspond	VERB
ahs-18395	28	14	author	author	NOUN
ahs-18395	28	15	:	:	PUNCT
ahs-18395	28	16	ascientific@aec.org.sy	ascientific@aec.org.sy	PROPN
ahs-18395	28	17	received	receive	VERB
ahs-18395	28	18	for	for	ADP
ahs-18395	28	19	publication	publication	NOUN
ahs-18395	28	20	9	9	NUM
ahs-18395	28	21	june	june	PROPN
ahs-18395	28	22	2014	2014	NUM
ahs-18395	28	23	accepted	accept	VERB
ahs-18395	28	24	for	for	ADP
ahs-18395	28	25	publication	publication	NOUN
ahs-18395	28	26	15	15	NUM
ahs-18395	28	27	september	september	PROPN
ahs-18395	28	28	2014	2014	NUM
ahs-18395	28	29	120	120	NUM
ahs-18395	28	30	2	2	NUM
ahs-18395	28	31	.	.	PUNCT
ahs-18395	28	32	materials	material	NOUN
ahs-18395	28	33	and	and	CCONJ
ahs-18395	28	34	methods	method	NOUN
ahs-18395	28	35	fungal	fungal	ADJ
ahs-18395	28	36	isolates	isolate	NOUN
ahs-18395	28	37	for	for	ADP
ahs-18395	28	38	the	the	DET
ahs-18395	28	39	inoculation	inoculation	ADJ
ahs-18395	28	40	process	process	NOUN
ahs-18395	28	41	,	,	PUNCT
ahs-18395	28	42	two	two	NUM
ahs-18395	28	43	major	major	ADJ
ahs-18395	28	44	pathotypes	pathotype	NOUN
ahs-18395	28	45	of	of	ADP
ahs-18395	28	46	c.	c.	PROPN
ahs-18395	28	47	sativus	sativus	PROPN
ahs-18395	28	48	in	in	ADP
ahs-18395	28	49	syria	syria	PROPN
ahs-18395	28	50	,	,	PUNCT
ahs-18395	28	51	pt1	pt1	PROPN
ahs-18395	28	52	and	and	CCONJ
ahs-18395	28	53	pt4	pt4	PROPN
ahs-18395	28	54	,	,	PUNCT
ahs-18395	28	55	were	be	AUX
ahs-18395	28	56	used	use	VERB
ahs-18395	28	57	in	in	ADP
ahs-18395	28	58	this	this	DET
ahs-18395	28	59	study	study	NOUN
ahs-18395	28	60	.	.	PUNCT
ahs-18395	29	1	they	they	PRON
ahs-18395	29	2	were	be	AUX
ahs-18395	29	3	identical	identical	ADJ
ahs-18395	29	4	in	in	ADP
ahs-18395	29	5	spore	spore	ADJ
ahs-18395	29	6	morphology	morphology	NOUN
ahs-18395	29	7	and	and	CCONJ
ahs-18395	29	8	colony	colony	NOUN
ahs-18395	29	9	colour	colour	NOUN
ahs-18395	29	10	,	,	PUNCT
ahs-18395	29	11	but	but	CCONJ
ahs-18395	29	12	differed	differ	VERB
ahs-18395	29	13	widely	widely	ADV
ahs-18395	29	14	in	in	ADP
ahs-18395	29	15	dna	dna	PROPN
ahs-18395	29	16	patterns	pattern	NOUN
ahs-18395	29	17	and	and	CCONJ
ahs-18395	29	18	virulence	virulence	NOUN
ahs-18395	29	19	.	.	PUNCT
ahs-18395	30	1	after	after	ADP
ahs-18395	30	2	extensive	extensive	ADJ
ahs-18395	30	3	greenhouse	greenhouse	NOUN
ahs-18395	30	4	and	and	CCONJ
ahs-18395	30	5	laboratory	laboratory	NOUN
ahs-18395	30	6	screening	screening	NOUN
ahs-18395	30	7	over	over	ADP
ahs-18395	30	8	a	a	DET
ahs-18395	30	9	10	10	NUM
ahs-18395	30	10	-	-	PUNCT
ahs-18395	30	11	year	year	NOUN
ahs-18395	30	12	period	period	NOUN
ahs-18395	30	13	,	,	PUNCT
ahs-18395	30	14	pt4	pt4	PROPN
ahs-18395	30	15	was	be	AUX
ahs-18395	30	16	proven	prove	VERB
ahs-18395	30	17	to	to	PART
ahs-18395	30	18	be	be	AUX
ahs-18395	30	19	the	the	DET
ahs-18395	30	20	most	most	ADV
ahs-18395	30	21	virulent	virulent	NOUN
ahs-18395	30	22	isolate	isolate	NOUN
ahs-18395	30	23	to	to	ADP
ahs-18395	30	24	all	all	DET
ahs-18395	30	25	barley	barley	NOUN
ahs-18395	30	26	genotypes	genotype	NOUN
ahs-18395	30	27	available	available	ADJ
ahs-18395	30	28	so	so	ADV
ahs-18395	30	29	far	far	ADV
ahs-18395	30	30	(	(	PUNCT
ahs-18395	30	31	arabi	arabi	PROPN
ahs-18395	30	32	and	and	CCONJ
ahs-18395	30	33	jawhar	jawhar	PROPN
ahs-18395	30	34	,	,	PUNCT
ahs-18395	30	35	2003	2003	NUM
ahs-18395	30	36	;	;	PUNCT
ahs-18395	30	37	2007	2007	NUM
ahs-18395	30	38	)	)	PUNCT
ahs-18395	30	39	,	,	PUNCT
ahs-18395	30	40	therefore	therefore	ADV
ahs-18395	30	41	it	it	PRON
ahs-18395	30	42	was	be	AUX
ahs-18395	30	43	used	use	VERB
ahs-18395	30	44	in	in	ADP
ahs-18395	30	45	this	this	DET
ahs-18395	30	46	study	study	NOUN
ahs-18395	30	47	.	.	PUNCT
ahs-18395	31	1	each	each	DET
ahs-18395	31	2	isolate	isolate	NOUN
ahs-18395	31	3	was	be	AUX
ahs-18395	31	4	grown	grow	VERB
ahs-18395	31	5	separately	separately	ADV
ahs-18395	31	6	in	in	ADP
ahs-18395	31	7	9	9	NUM
ahs-18395	31	8	cm	cm	NOUN
ahs-18395	31	9	petri	petri	ADJ
ahs-18395	31	10	dishes	dish	NOUN
ahs-18395	31	11	containing	contain	VERB
ahs-18395	31	12	potato	potato	NOUN
ahs-18395	31	13	dextrose	dextrose	NOUN
ahs-18395	31	14	agar	agar	NOUN
ahs-18395	31	15	(	(	PUNCT
ahs-18395	31	16	pda	pda	NOUN
ahs-18395	31	17	,	,	PUNCT
ahs-18395	31	18	difco	difco	PROPN
ahs-18395	31	19	,	,	PUNCT
ahs-18395	31	20	detroit	detroit	PROPN
ahs-18395	31	21	,	,	PUNCT
ahs-18395	31	22	mi	mi	PROPN
ahs-18395	31	23	.	.	PROPN
ahs-18395	31	24	usa	usa	PROPN
ahs-18395	31	25	)	)	PUNCT
ahs-18395	31	26	and	and	CCONJ
ahs-18395	31	27	incubated	incubate	VERB
ahs-18395	31	28	for	for	ADP
ahs-18395	31	29	10	10	NUM
ahs-18395	31	30	days	day	NOUN
ahs-18395	31	31	,	,	PUNCT
ahs-18395	31	32	at	at	ADP
ahs-18395	31	33	22±1	22±1	NUM
ahs-18395	31	34	°	°	ADP
ahs-18395	31	35	c	c	NOUN
ahs-18395	31	36	in	in	ADP
ahs-18395	31	37	the	the	DET
ahs-18395	31	38	dark	dark	NOUN
ahs-18395	31	39	to	to	PART
ahs-18395	31	40	allow	allow	VERB
ahs-18395	31	41	mycelial	mycelial	ADJ
ahs-18395	31	42	growth	growth	NOUN
ahs-18395	31	43	.	.	PUNCT
ahs-18395	32	1	inocula	inocula	NOUN
ahs-18395	32	2	preparation	preparation	NOUN
ahs-18395	32	3	,	,	PUNCT
ahs-18395	32	4	serial	serial	ADJ
ahs-18395	32	5	transfer	transfer	NOUN
ahs-18395	32	6	and	and	CCONJ
ahs-18395	32	7	isolation	isolation	NOUN
ahs-18395	32	8	methods	method	NOUN
ahs-18395	32	9	after	after	ADP
ahs-18395	32	10	culturing	culture	VERB
ahs-18395	32	11	pt1	pt1	PROPN
ahs-18395	32	12	and	and	CCONJ
ahs-18395	32	13	pt4	pt4	PROPN
ahs-18395	32	14	isolates	isolate	NOUN
ahs-18395	32	15	on	on	ADP
ahs-18395	32	16	pda	pda	PROPN
ahs-18395	32	17	medium	medium	NOUN
ahs-18395	32	18	,	,	PUNCT
ahs-18395	32	19	spores	spore	NOUN
ahs-18395	32	20	were	be	AUX
ahs-18395	32	21	collected	collect	VERB
ahs-18395	32	22	by	by	ADP
ahs-18395	32	23	flooding	flood	VERB
ahs-18395	32	24	each	each	DET
ahs-18395	32	25	plate	plate	NOUN
ahs-18395	32	26	with	with	ADP
ahs-18395	32	27	10	10	NUM
ahs-18395	32	28	ml	ml	NOUN
ahs-18395	32	29	sterile	sterile	ADJ
ahs-18395	32	30	water	water	NOUN
ahs-18395	32	31	with	with	ADP
ahs-18395	32	32	200	200	NUM
ahs-18395	32	33	ppm	ppm	NOUN
ahs-18395	32	34	of	of	ADP
ahs-18395	32	35	tween	tween	NOUN
ahs-18395	32	36	20	20	NUM
ahs-18395	32	37	,	,	PUNCT
ahs-18395	32	38	filtering	filter	VERB
ahs-18395	32	39	through	through	ADP
ahs-18395	32	40	cheesecloth	cheesecloth	NOUN
ahs-18395	32	41	to	to	PART
ahs-18395	32	42	remove	remove	VERB
ahs-18395	32	43	mycelium	mycelium	NOUN
ahs-18395	32	44	and	and	CCONJ
ahs-18395	32	45	adjusting	adjust	VERB
ahs-18395	32	46	the	the	DET
ahs-18395	32	47	concentration	concentration	NOUN
ahs-18395	32	48	of	of	ADP
ahs-18395	32	49	the	the	DET
ahs-18395	32	50	spore	spore	ADJ
ahs-18395	32	51	suspension	suspension	NOUN
ahs-18395	32	52	to	to	ADP
ahs-18395	32	53	2x104	2x104	NUM
ahs-18395	32	54	conidia	conidium	NOUN
ahs-18395	32	55	/	/	SYM
ahs-18395	32	56	ml	ml	VERB
ahs-18395	32	57	using	use	VERB
ahs-18395	32	58	hemacytometer	hemacytometer	PROPN
ahs-18395	32	59	counts	count	NOUN
ahs-18395	32	60	of	of	ADP
ahs-18395	32	61	conidia	conidia	NOUN
ahs-18395	32	62	.	.	PUNCT
ahs-18395	33	1	the	the	DET
ahs-18395	33	2	universal	universal	ADJ
ahs-18395	33	3	susceptible	susceptible	ADJ
ahs-18395	33	4	control	control	NOUN
ahs-18395	33	5	(	(	PUNCT
ahs-18395	33	6	cv	cv	PROPN
ahs-18395	33	7	.	.	PROPN
ahs-18395	33	8	wi2291	wi2291	ADJ
ahs-18395	33	9	)	)	PUNCT
ahs-18395	33	10	plants	plant	NOUN
ahs-18395	33	11	from	from	ADP
ahs-18395	33	12	australia	australia	PROPN
ahs-18395	33	13	were	be	AUX
ahs-18395	33	14	grown	grow	VERB
ahs-18395	33	15	in	in	ADP
ahs-18395	33	16	pots	pot	NOUN
ahs-18395	33	17	filled	fill	VERB
ahs-18395	33	18	with	with	ADP
ahs-18395	33	19	sterilized	sterilize	VERB
ahs-18395	33	20	peatmoss	peatmoss	NOUN
ahs-18395	33	21	,	,	PUNCT
ahs-18395	33	22	and	and	CCONJ
ahs-18395	33	23	arranged	arrange	VERB
ahs-18395	33	24	in	in	ADP
ahs-18395	33	25	a	a	DET
ahs-18395	33	26	randomized	randomized	ADJ
ahs-18395	33	27	complete	complete	ADJ
ahs-18395	33	28	block	block	NOUN
ahs-18395	33	29	design	design	NOUN
ahs-18395	33	30	with	with	ADP
ahs-18395	33	31	three	three	NUM
ahs-18395	33	32	replicates	replicate	NOUN
ahs-18395	33	33	.	.	PUNCT
ahs-18395	34	1	each	each	DET
ahs-18395	34	2	experimental	experimental	ADJ
ahs-18395	34	3	unit	unit	NOUN
ahs-18395	34	4	consisted	consist	VERB
ahs-18395	34	5	of	of	ADP
ahs-18395	34	6	10	10	NUM
ahs-18395	34	7	seedlings	seedling	NOUN
ahs-18395	34	8	.	.	PUNCT
ahs-18395	35	1	a	a	DET
ahs-18395	35	2	full	full	ADJ
ahs-18395	35	3	replicate	replicate	NOUN
ahs-18395	35	4	consisted	consisted	NOUN
ahs-18395	35	5	of	of	ADP
ahs-18395	35	6	10	10	NUM
ahs-18395	35	7	pots	pot	NOUN
ahs-18395	35	8	inoculated	inoculate	VERB
ahs-18395	35	9	with	with	ADP
ahs-18395	35	10	pt1	pt1	PROPN
ahs-18395	35	11	and	and	CCONJ
ahs-18395	35	12	pt4	pt4	PROPN
ahs-18395	35	13	isolates	isolate	NOUN
ahs-18395	35	14	.	.	PUNCT
ahs-18395	36	1	pots	pot	NOUN
ahs-18395	36	2	were	be	AUX
ahs-18395	36	3	placed	place	VERB
ahs-18395	36	4	in	in	ADP
ahs-18395	36	5	a	a	DET
ahs-18395	36	6	growth	growth	NOUN
ahs-18395	36	7	chamber	chamber	NOUN
ahs-18395	36	8	at	at	ADP
ahs-18395	36	9	temperatures	temperature	NOUN
ahs-18395	36	10	of	of	ADP
ahs-18395	36	11	22±1	22±1	NUM
ahs-18395	36	12	°	°	ADP
ahs-18395	36	13	c	c	NOUN
ahs-18395	36	14	(	(	PUNCT
ahs-18395	36	15	day	day	PROPN
ahs-18395	36	16	)	)	PUNCT
ahs-18395	36	17	and	and	CCONJ
ahs-18395	36	18	17±1	17±1	PROPN
ahs-18395	36	19	°	°	ADP
ahs-18395	36	20	c	c	PROPN
ahs-18395	36	21	(	(	PUNCT
ahs-18395	36	22	night	night	NOUN
ahs-18395	36	23	)	)	PUNCT
ahs-18395	36	24	with	with	ADP
ahs-18395	36	25	a	a	DET
ahs-18395	36	26	daylength	daylength	NOUN
ahs-18395	36	27	of	of	ADP
ahs-18395	36	28	12	12	NUM
ahs-18395	36	29	h	h	NOUN
ahs-18395	36	30	and	and	CCONJ
ahs-18395	36	31	a	a	DET
ahs-18395	36	32	relative	relative	ADJ
ahs-18395	36	33	humidity	humidity	NOUN
ahs-18395	36	34	(	(	PUNCT
ahs-18395	36	35	rh	rh	PROPN
ahs-18395	36	36	)	)	PUNCT
ahs-18395	36	37	of	of	ADP
ahs-18395	36	38	80	80	NUM
ahs-18395	36	39	-	-	SYM
ahs-18395	36	40	90	90	NUM
ahs-18395	36	41	%	%	NOUN
ahs-18395	36	42	.	.	PUNCT
ahs-18395	37	1	plants	plant	NOUN
ahs-18395	37	2	were	be	AUX
ahs-18395	37	3	inoculated	inoculate	VERB
ahs-18395	37	4	at	at	ADP
ahs-18395	37	5	growth	growth	NOUN
ahs-18395	37	6	stage	stage	NOUN
ahs-18395	37	7	(	(	PUNCT
ahs-18395	37	8	gs	gs	NOUN
ahs-18395	37	9	)	)	PUNCT
ahs-18395	37	10	12	12	NUM
ahs-18395	37	11	(	(	PUNCT
ahs-18395	37	12	zadoks	zadok	NOUN
ahs-18395	37	13	et	et	NOUN
ahs-18395	37	14	al	al	PROPN
ahs-18395	37	15	.	.	PROPN
ahs-18395	37	16	,	,	PUNCT
ahs-18395	37	17	1974	1974	NUM
ahs-18395	37	18	)	)	PUNCT
ahs-18395	37	19	by	by	ADP
ahs-18395	37	20	uniformly	uniformly	ADV
ahs-18395	37	21	spraying	spray	VERB
ahs-18395	37	22	each	each	DET
ahs-18395	37	23	plant	plant	NOUN
ahs-18395	37	24	with	with	ADP
ahs-18395	37	25	20	20	NUM
ahs-18395	37	26	ml	ml	NOUN
ahs-18395	37	27	of	of	ADP
ahs-18395	37	28	conidial	conidial	ADJ
ahs-18395	37	29	suspension	suspension	NOUN
ahs-18395	37	30	with	with	ADP
ahs-18395	37	31	a	a	DET
ahs-18395	37	32	hand	hand	NOUN
ahs-18395	37	33	-	-	PUNCT
ahs-18395	37	34	held	hold	VERB
ahs-18395	37	35	sprayer	sprayer	NOUN
ahs-18395	37	36	.	.	PUNCT
ahs-18395	38	1	plants	plant	NOUN
ahs-18395	38	2	were	be	AUX
ahs-18395	38	3	then	then	ADV
ahs-18395	38	4	placed	place	VERB
ahs-18395	38	5	in	in	ADP
ahs-18395	38	6	the	the	DET
ahs-18395	38	7	dark	dark	NOUN
ahs-18395	38	8	at	at	ADP
ahs-18395	38	9	95	95	NUM
ahs-18395	38	10	-	-	SYM
ahs-18395	38	11	100	100	NUM
ahs-18395	38	12	%	%	NOUN
ahs-18395	38	13	r.h	r.h	PROPN
ahs-18395	38	14	.	.	PROPN
ahs-18395	38	15	for	for	ADP
ahs-18395	38	16	the	the	DET
ahs-18395	38	17	first	first	ADJ
ahs-18395	38	18	18	18	NUM
ahs-18395	38	19	h.	h.	PROPN
ahs-18395	38	20	pt1	pt1	PROPN
ahs-18395	38	21	and	and	CCONJ
ahs-18395	38	22	pt4	pt4	PROPN
ahs-18395	38	23	isolates	isolate	NOUN
ahs-18395	38	24	and	and	CCONJ
ahs-18395	38	25	single	single	ADJ
ahs-18395	38	26	-	-	PUNCT
ahs-18395	38	27	conidial	conidial	ADJ
ahs-18395	38	28	isolates	isolate	NOUN
ahs-18395	38	29	from	from	ADP
ahs-18395	38	30	each	each	PRON
ahs-18395	38	31	of	of	ADP
ahs-18395	38	32	the	the	DET
ahs-18395	38	33	three	three	NUM
ahs-18395	38	34	replicates	replicate	NOUN
ahs-18395	38	35	from	from	ADP
ahs-18395	38	36	the	the	DET
ahs-18395	38	37	1st	1st	NOUN
ahs-18395	38	38	to	to	ADP
ahs-18395	38	39	7th	7th	ADJ
ahs-18395	38	40	passage	passage	NOUN
ahs-18395	38	41	generations	generation	NOUN
ahs-18395	38	42	through	through	ADP
ahs-18395	38	43	barley	barley	NOUN
ahs-18395	38	44	plants	plant	NOUN
ahs-18395	38	45	were	be	AUX
ahs-18395	38	46	compared	compare	VERB
ahs-18395	38	47	for	for	ADP
ahs-18395	38	48	virulence	virulence	NOUN
ahs-18395	38	49	.	.	PUNCT
ahs-18395	39	1	ten	ten	NUM
ahs-18395	39	2	days	day	NOUN
ahs-18395	39	3	after	after	ADP
ahs-18395	39	4	inoculation	inoculation	NOUN
ahs-18395	39	5	,	,	PUNCT
ahs-18395	39	6	one	one	NUM
ahs-18395	39	7	leaf	leaf	NOUN
ahs-18395	39	8	per	per	ADP
ahs-18395	39	9	plant	plant	NOUN
ahs-18395	39	10	,	,	PUNCT
ahs-18395	39	11	for	for	ADP
ahs-18395	39	12	a	a	DET
ahs-18395	39	13	total	total	NOUN
ahs-18395	39	14	of	of	ADP
ahs-18395	39	15	three	three	NUM
ahs-18395	39	16	leaves	leave	NOUN
ahs-18395	39	17	per	per	ADP
ahs-18395	39	18	replicate	replicate	NOUN
ahs-18395	39	19	,	,	PUNCT
ahs-18395	39	20	was	be	AUX
ahs-18395	39	21	sampled	sample	VERB
ahs-18395	39	22	,	,	PUNCT
ahs-18395	39	23	surface	surface	NOUN
ahs-18395	39	24	sterilized	sterilize	VERB
ahs-18395	39	25	and	and	CCONJ
ahs-18395	39	26	placed	place	VERB
ahs-18395	39	27	on	on	ADP
ahs-18395	39	28	a	a	DET
ahs-18395	39	29	water	water	NOUN
ahs-18395	39	30	agar	agar	NOUN
ahs-18395	39	31	plate	plate	NOUN
ahs-18395	39	32	.	.	PUNCT
ahs-18395	40	1	three	three	NUM
ahs-18395	40	2	days	day	NOUN
ahs-18395	40	3	later	later	ADV
ahs-18395	40	4	,	,	PUNCT
ahs-18395	40	5	a	a	DET
ahs-18395	40	6	single	single	ADJ
ahs-18395	40	7	conidium	conidium	NOUN
ahs-18395	40	8	from	from	ADP
ahs-18395	40	9	each	each	PRON
ahs-18395	40	10	of	of	ADP
ahs-18395	40	11	the	the	DET
ahs-18395	40	12	three	three	NUM
ahs-18395	40	13	plates	plate	NOUN
ahs-18395	40	14	was	be	AUX
ahs-18395	40	15	transferred	transfer	VERB
ahs-18395	40	16	to	to	PART
ahs-18395	40	17	pda	pda	VERB
ahs-18395	40	18	for	for	ADP
ahs-18395	40	19	genotypic	genotypic	NOUN
ahs-18395	40	20	and	and	CCONJ
ahs-18395	40	21	phenotypic	phenotypic	ADJ
ahs-18395	40	22	assays	assay	NOUN
ahs-18395	40	23	.	.	PUNCT
ahs-18395	41	1	the	the	DET
ahs-18395	41	2	infection	infection	NOUN
ahs-18395	41	3	response	response	NOUN
ahs-18395	41	4	based	base	VERB
ahs-18395	41	5	on	on	ADP
ahs-18395	41	6	the	the	DET
ahs-18395	41	7	measurement	measurement	NOUN
ahs-18395	41	8	of	of	ADP
ahs-18395	41	9	individual	individual	ADJ
ahs-18395	41	10	lesion	lesion	NOUN
ahs-18395	41	11	size	size	NOUN
ahs-18395	41	12	(	(	PUNCT
ahs-18395	41	13	dimension	dimension	NOUN
ahs-18395	41	14	;	;	PUNCT
ahs-18395	41	15	mm	mm	X
ahs-18395	41	16	)	)	PUNCT
ahs-18395	41	17	for	for	ADP
ahs-18395	41	18	each	each	DET
ahs-18395	41	19	second	second	ADJ
ahs-18395	41	20	leaf	leaf	NOUN
ahs-18395	41	21	was	be	AUX
ahs-18395	41	22	assessed	assess	VERB
ahs-18395	41	23	10	10	NUM
ahs-18395	41	24	days	day	NOUN
ahs-18395	41	25	after	after	ADP
ahs-18395	41	26	inoculation	inoculation	NOUN
ahs-18395	41	27	according	accord	VERB
ahs-18395	41	28	to	to	PART
ahs-18395	41	29	fetch	fetch	VERB
ahs-18395	41	30	and	and	CCONJ
ahs-18395	41	31	steffenson	steffenson	NOUN
ahs-18395	41	32	(	(	PUNCT
ahs-18395	41	33	1999	1999	NUM
ahs-18395	41	34	)	)	PUNCT
ahs-18395	41	35	scale	scale	NOUN
ahs-18395	41	36	.	.	PUNCT
ahs-18395	42	1	each	each	DET
ahs-18395	42	2	leaf	leaf	NOUN
ahs-18395	42	3	was	be	AUX
ahs-18395	42	4	assessed	assess	VERB
ahs-18395	42	5	separately	separately	ADV
ahs-18395	42	6	and	and	CCONJ
ahs-18395	42	7	the	the	DET
ahs-18395	42	8	assessments	assessment	NOUN
ahs-18395	42	9	were	be	AUX
ahs-18395	42	10	performed	perform	VERB
ahs-18395	42	11	by	by	ADP
ahs-18395	42	12	the	the	DET
ahs-18395	42	13	same	same	ADJ
ahs-18395	42	14	person	person	NOUN
ahs-18395	42	15	in	in	ADP
ahs-18395	42	16	all	all	DET
ahs-18395	42	17	experiments	experiment	NOUN
ahs-18395	42	18	.	.	PUNCT
ahs-18395	43	1	in	in	ADP
ahs-18395	43	2	vitro	vitro	X
ahs-18395	43	3	phenotypic	phenotypic	ADJ
ahs-18395	43	4	assays	assay	NOUN
ahs-18395	43	5	in	in	ADP
ahs-18395	43	6	vitro	vitro	X
ahs-18395	43	7	phenotypic	phenotypic	ADJ
ahs-18395	43	8	assays	assay	NOUN
ahs-18395	43	9	were	be	AUX
ahs-18395	43	10	achieved	achieve	VERB
ahs-18395	43	11	by	by	ADP
ahs-18395	43	12	transferring	transfer	VERB
ahs-18395	43	13	plugs	plug	NOUN
ahs-18395	43	14	of	of	ADP
ahs-18395	43	15	mycelim	mycelim	PROPN
ahs-18395	43	16	(	(	PUNCT
ahs-18395	43	17	5	5	NUM
ahs-18395	43	18	mm	mm	PROPN
ahs-18395	43	19	diameter	diameter	NOUN
ahs-18395	43	20	)	)	PUNCT
ahs-18395	43	21	of	of	ADP
ahs-18395	43	22	each	each	DET
ahs-18395	43	23	parent	parent	NOUN
ahs-18395	43	24	and	and	CCONJ
ahs-18395	43	25	generations	generation	NOUN
ahs-18395	43	26	onto	onto	ADP
ahs-18395	43	27	pda	pda	NOUN
ahs-18395	43	28	media	medium	NOUN
ahs-18395	43	29	and	and	CCONJ
ahs-18395	43	30	incubation	incubation	NOUN
ahs-18395	43	31	at	at	ADP
ahs-18395	43	32	room	room	NOUN
ahs-18395	43	33	temperature	temperature	NOUN
ahs-18395	43	34	(	(	PUNCT
ahs-18395	43	35	22±1	22±1	NOUN
ahs-18395	43	36	°	°	SYM
ahs-18395	43	37	c	c	NOUN
ahs-18395	43	38	)	)	PUNCT
ahs-18395	43	39	in	in	ADP
ahs-18395	43	40	the	the	DET
ahs-18395	43	41	dark	dark	NOUN
ahs-18395	43	42	.	.	PUNCT
ahs-18395	44	1	conidial	conidial	ADJ
ahs-18395	44	2	germination	germination	NOUN
ahs-18395	44	3	rate	rate	NOUN
ahs-18395	44	4	was	be	AUX
ahs-18395	44	5	recorded	record	VERB
ahs-18395	44	6	after	after	ADP
ahs-18395	44	7	24	24	NUM
ahs-18395	44	8	h	h	NOUN
ahs-18395	44	9	on	on	ADP
ahs-18395	44	10	glass	glass	NOUN
ahs-18395	44	11	cover	cover	NOUN
ahs-18395	44	12	slips	slip	NOUN
ahs-18395	44	13	as	as	SCONJ
ahs-18395	44	14	described	describe	VERB
ahs-18395	44	15	previously	previously	ADV
ahs-18395	44	16	(	(	PUNCT
ahs-18395	44	17	arabi	arabi	PROPN
ahs-18395	44	18	and	and	CCONJ
ahs-18395	44	19	jawhar	jawhar	PROPN
ahs-18395	44	20	,	,	PUNCT
ahs-18395	44	21	2001	2001	NUM
ahs-18395	44	22	)	)	PUNCT
ahs-18395	44	23	.	.	PUNCT
ahs-18395	45	1	colony	colony	NOUN
ahs-18395	45	2	diameter	diameter	NOUN
ahs-18395	45	3	was	be	AUX
ahs-18395	45	4	measured	measure	VERB
ahs-18395	45	5	seven	seven	NUM
ahs-18395	45	6	days	day	NOUN
ahs-18395	45	7	post	post	NOUN
ahs-18395	45	8	incubation	incubation	NOUN
ahs-18395	45	9	.	.	PUNCT
ahs-18395	46	1	conidia	conidium	NOUN
ahs-18395	46	2	were	be	AUX
ahs-18395	46	3	harvested	harvest	VERB
ahs-18395	46	4	from	from	ADP
ahs-18395	46	5	15	15	NUM
ahs-18395	46	6	-	-	PUNCT
ahs-18395	46	7	day	day	NOUN
ahs-18395	46	8	cultures	culture	NOUN
ahs-18395	46	9	using	use	VERB
ahs-18395	46	10	sterile	sterile	ADJ
ahs-18395	46	11	distilled	distil	VERB
ahs-18395	46	12	water	water	NOUN
ahs-18395	46	13	and	and	CCONJ
ahs-18395	46	14	counted	count	VERB
ahs-18395	46	15	with	with	ADP
ahs-18395	46	16	a	a	DET
ahs-18395	46	17	hemocytometer	hemocytometer	NOUN
ahs-18395	46	18	.	.	PUNCT
ahs-18395	47	1	all	all	DET
ahs-18395	47	2	the	the	DET
ahs-18395	47	3	experiments	experiment	NOUN
ahs-18395	47	4	were	be	AUX
ahs-18395	47	5	repeated	repeat	VERB
ahs-18395	47	6	three	three	NUM
ahs-18395	47	7	times	time	NOUN
ahs-18395	47	8	with	with	ADP
ahs-18395	47	9	five	five	NUM
ahs-18395	47	10	replicates	replicate	NOUN
ahs-18395	47	11	,	,	PUNCT
ahs-18395	47	12	and	and	CCONJ
ahs-18395	47	13	a	a	DET
ahs-18395	47	14	representative	representative	ADJ
ahs-18395	47	15	set	set	NOUN
ahs-18395	47	16	of	of	ADP
ahs-18395	47	17	data	datum	NOUN
ahs-18395	47	18	is	be	AUX
ahs-18395	47	19	presented	present	VERB
ahs-18395	47	20	.	.	PUNCT
ahs-18395	48	1	statistical	statistical	ADJ
ahs-18395	48	2	analysis	analysis	NOUN
ahs-18395	48	3	was	be	AUX
ahs-18395	48	4	performed	perform	VERB
ahs-18395	48	5	using	use	VERB
ahs-18395	48	6	the	the	DET
ahs-18395	48	7	stat	stat	NOUN
ahs-18395	48	8	-	-	PUNCT
ahs-18395	48	9	itcf	itcf	PROPN
ahs-18395	48	10	program	program	NOUN
ahs-18395	48	11	(	(	PUNCT
ahs-18395	48	12	anonymous	anonymous	ADJ
ahs-18395	48	13	,	,	PUNCT
ahs-18395	48	14	1988	1988	NUM
ahs-18395	48	15	)	)	PUNCT
ahs-18395	48	16	.	.	PUNCT
ahs-18395	49	1	remap	remap	VERB
ahs-18395	49	2	analysis	analysis	NOUN
ahs-18395	49	3	dna	dna	NOUN
ahs-18395	49	4	extraction	extraction	NOUN
ahs-18395	49	5	from	from	ADP
ahs-18395	49	6	parent	parent	NOUN
ahs-18395	49	7	and	and	CCONJ
ahs-18395	49	8	generation	generation	NOUN
ahs-18395	49	9	isolates	isolate	NOUN
ahs-18395	49	10	was	be	AUX
ahs-18395	49	11	performed	perform	VERB
ahs-18395	49	12	according	accord	VERB
ahs-18395	49	13	to	to	ADP
ahs-18395	49	14	standard	standard	ADJ
ahs-18395	49	15	protocols	protocol	NOUN
ahs-18395	49	16	(	(	PUNCT
ahs-18395	49	17	leach	leach	NOUN
ahs-18395	49	18	et	et	NOUN
ahs-18395	49	19	al	al	PROPN
ahs-18395	49	20	.	.	PROPN
ahs-18395	49	21	,	,	PUNCT
ahs-18395	49	22	1986	1986	NUM
ahs-18395	49	23	)	)	PUNCT
ahs-18395	49	24	.	.	PUNCT
ahs-18395	50	1	remap	remap	VERB
ahs-18395	50	2	analysis	analysis	NOUN
ahs-18395	50	3	and	and	CCONJ
ahs-18395	50	4	primer	primer	NOUN
ahs-18395	50	5	sequences	sequence	NOUN
ahs-18395	50	6	were	be	AUX
ahs-18395	50	7	achieved	achieve	VERB
ahs-18395	50	8	using	use	VERB
ahs-18395	50	9	a	a	DET
ahs-18395	50	10	standard	standard	ADJ
ahs-18395	50	11	method	method	NOUN
ahs-18395	50	12	described	describe	VERB
ahs-18395	50	13	by	by	ADP
ahs-18395	50	14	kalendar	kalendar	PROPN
ahs-18395	50	15	et	et	PROPN
ahs-18395	50	16	al	al	PROPN
ahs-18395	50	17	.	.	PUNCT
ahs-18395	50	18	(	(	PUNCT
ahs-18395	50	19	1999	1999	NUM
ahs-18395	50	20	)	)	PUNCT
ahs-18395	50	21	.	.	PUNCT
ahs-18395	51	1	pcr	pcr	ADJ
ahs-18395	51	2	reactions	reaction	NOUN
ahs-18395	51	3	were	be	AUX
ahs-18395	51	4	performed	perform	VERB
ahs-18395	51	5	in	in	ADP
ahs-18395	51	6	25	25	NUM
ahs-18395	51	7	μl	μl	NOUN
ahs-18395	51	8	reaction	reaction	NOUN
ahs-18395	51	9	volume	volume	NOUN
ahs-18395	51	10	containing	contain	VERB
ahs-18395	51	11	1×	1×	NUM
ahs-18395	51	12	taq	taq	NOUN
ahs-18395	51	13	polymerase	polymerase	NOUN
ahs-18395	51	14	buffer	buffer	NOUN
ahs-18395	51	15	(	(	PUNCT
ahs-18395	51	16	10	10	NUM
ahs-18395	51	17	mmol	mmol	NOUN
ahs-18395	51	18	tris	tris	NOUN
ahs-18395	51	19	-	-	PUNCT
ahs-18395	51	20	hcl	hcl	NOUN
ahs-18395	51	21	/	/	SYM
ahs-18395	51	22	l	l	NOUN
ahs-18395	51	23	(	(	PUNCT
ahs-18395	51	24	ph	ph	PROPN
ahs-18395	51	25	8.3	8.3	NUM
ahs-18395	51	26	)	)	PUNCT
ahs-18395	51	27	,	,	PUNCT
ahs-18395	51	28	50	50	NUM
ahs-18395	51	29	mmol	mmol	NOUN
ahs-18395	51	30	kcl	kcl	PROPN
ahs-18395	51	31	/	/	SYM
ahs-18395	51	32	l	l	PROPN
ahs-18395	51	33	,	,	PUNCT
ahs-18395	51	34	2.5	2.5	NUM
ahs-18395	51	35	mmol	mmol	NOUN
ahs-18395	51	36	mgcl2	mgcl2	PROPN
ahs-18395	51	37	/	/	SYM
ahs-18395	51	38	l	l	NOUN
ahs-18395	51	39	,	,	PUNCT
ahs-18395	51	40	0.01	0.01	NUM
ahs-18395	51	41	%	%	NOUN
ahs-18395	51	42	gelatin	gelatin	NOUN
ahs-18395	51	43	)	)	PUNCT
ahs-18395	51	44	,	,	PUNCT
ahs-18395	51	45	0.5	0.5	NUM
ahs-18395	51	46	u	u	NOUN
ahs-18395	51	47	taq	taq	NOUN
ahs-18395	51	48	polymerase	polymerase	NOUN
ahs-18395	51	49	(	(	PUNCT
ahs-18395	51	50	eppendorf	eppendorf	PROPN
ahs-18395	51	51	,	,	PUNCT
ahs-18395	51	52	germany	germany	PROPN
ahs-18395	51	53	)	)	PUNCT
ahs-18395	51	54	,	,	PUNCT
ahs-18395	51	55	150	150	NUM
ahs-18395	51	56	μmol	μmol	NOUN
ahs-18395	51	57	of	of	ADP
ahs-18395	51	58	each	each	DET
ahs-18395	51	59	dntp	dntp	PROPN
ahs-18395	51	60	/	/	SYM
ahs-18395	51	61	l	l	NOUN
ahs-18395	51	62	,	,	PUNCT
ahs-18395	51	63	0.4	0.4	NUM
ahs-18395	51	64	μmol	μmol	PROPN
ahs-18395	51	65	ltr1	ltr1	PROPN
ahs-18395	51	66	primer	primer	NOUN
ahs-18395	51	67	/	/	SYM
ahs-18395	51	68	l	l	NOUN
ahs-18395	51	69	,	,	PUNCT
ahs-18395	51	70	0.6	0.6	NUM
ahs-18395	51	71	μmol	μmol	NOUN
ahs-18395	51	72	of	of	ADP
ahs-18395	51	73	issr	issr	ADJ
ahs-18395	51	74	primer	primer	NOUN
ahs-18395	51	75	/	/	SYM
ahs-18395	51	76	l	l	NOUN
ahs-18395	51	77	(	(	PUNCT
ahs-18395	51	78	table	table	NOUN
ahs-18395	51	79	1	1	NUM
ahs-18395	51	80	)	)	PUNCT
ahs-18395	51	81	,	,	PUNCT
ahs-18395	51	82	and	and	CCONJ
ahs-18395	51	83	50	50	NUM
ahs-18395	51	84	ng	ng	NOUN
ahs-18395	51	85	of	of	ADP
ahs-18395	51	86	template	template	NOUN
ahs-18395	51	87	dna	dna	NOUN
ahs-18395	51	88	.	.	PUNCT
ahs-18395	52	1	a	a	DET
ahs-18395	52	2	pcr	pcr	NOUN
ahs-18395	52	3	was	be	AUX
ahs-18395	52	4	carried	carry	VERB
ahs-18395	52	5	out	out	ADP
ahs-18395	52	6	in	in	ADP
ahs-18395	52	7	an	an	DET
ahs-18395	52	8	eppendorf	eppendorf	PROPN
ahs-18395	52	9	dna	dna	PROPN
ahs-18395	52	10	thermal	thermal	ADJ
ahs-18395	52	11	master	master	PROPN
ahs-18395	52	12	gradient	gradient	PROPN
ahs-18395	52	13	cycler	cycler	NOUN
ahs-18395	52	14	(	(	PUNCT
ahs-18395	52	15	eppendorf	eppendorf	PROPN
ahs-18395	52	16	nethelerhinz	nethelerhinz	PROPN
ahs-18395	52	17	,	,	PUNCT
ahs-18395	52	18	hamburg	hamburg	PROPN
ahs-18395	52	19	,	,	PUNCT
ahs-18395	52	20	germany	germany	PROPN
ahs-18395	52	21	)	)	PUNCT
ahs-18395	52	22	.	.	PUNCT
ahs-18395	53	1	the	the	DET
ahs-18395	53	2	amplification	amplification	NOUN
ahs-18395	53	3	conditions	condition	NOUN
ahs-18395	53	4	were	be	AUX
ahs-18395	53	5	as	as	SCONJ
ahs-18395	53	6	follows	follow	VERB
ahs-18395	53	7	:	:	PUNCT
ahs-18395	53	8	92	92	NUM
ahs-18395	53	9	°	°	NUM
ahs-18395	53	10	c	c	NOUN
ahs-18395	53	11	for	for	ADP
ahs-18395	53	12	5	5	NUM
ahs-18395	53	13	min	min	NOUN
ahs-18395	53	14	,	,	PUNCT
ahs-18395	53	15	followed	follow	VERB
ahs-18395	53	16	by	by	ADP
ahs-18395	53	17	40	40	NUM
ahs-18395	53	18	cycles	cycle	NOUN
ahs-18395	53	19	of	of	ADP
ahs-18395	53	20	92	92	NUM
ahs-18395	53	21	°	°	NUM
ahs-18395	53	22	c	c	NOUN
ahs-18395	53	23	for	for	ADP
ahs-18395	53	24	45	45	NUM
ahs-18395	53	25	s	s	NOUN
ahs-18395	53	26	,	,	PUNCT
ahs-18395	53	27	55	55	NUM
ahs-18395	53	28	°	°	ADP
ahs-18395	53	29	c	c	NOUN
ahs-18395	53	30	for	for	ADP
ahs-18395	53	31	45	45	NUM
ahs-18395	53	32	s	s	NOUN
ahs-18395	53	33	,	,	PUNCT
ahs-18395	53	34	and	and	CCONJ
ahs-18395	53	35	72	72	NUM
ahs-18395	53	36	°	°	NOUN
ahs-18395	53	37	c	c	NOUN
ahs-18395	53	38	for	for	ADP
ahs-18395	53	39	1	1	NUM
ahs-18395	53	40	min	min	NOUN
ahs-18395	53	41	;	;	PUNCT
ahs-18395	53	42	and	and	CCONJ
ahs-18395	53	43	a	a	DET
ahs-18395	53	44	final	final	ADJ
ahs-18395	53	45	extension	extension	NOUN
ahs-18395	53	46	step	step	NOUN
ahs-18395	53	47	of	of	ADP
ahs-18395	53	48	72	72	NUM
ahs-18395	53	49	°	°	ADP
ahs-18395	53	50	c	c	NOUN
ahs-18395	53	51	for	for	ADP
ahs-18395	53	52	10	10	NUM
ahs-18395	53	53	min	min	NOUN
ahs-18395	53	54	.	.	PROPN
ahs-18395	53	55	amplified	amplify	VERB
ahs-18395	53	56	products	product	NOUN
ahs-18395	53	57	were	be	AUX
ahs-18395	53	58	electrophoresed	electrophorese	VERB
ahs-18395	53	59	in	in	ADP
ahs-18395	53	60	a	a	DET
ahs-18395	53	61	2	2	NUM
ahs-18395	53	62	%	%	NOUN
ahs-18395	53	63	agarose	agarose	NOUN
ahs-18395	53	64	gel	gel	NOUN
ahs-18395	53	65	using	use	VERB
ahs-18395	53	66	1	1	NUM
ahs-18395	53	67	×	×	NOUN
ahs-18395	53	68	tris	tris	ADJ
ahs-18395	53	69	-	-	PUNCT
ahs-18395	53	70	borate	borate	NOUN
ahs-18395	53	71	-	-	PUNCT
ahs-18395	53	72	edta	edta	NOUN
ahs-18395	53	73	buffer	buffer	NOUN
ahs-18395	53	74	(	(	PUNCT
ahs-18395	53	75	100	100	NUM
ahs-18395	53	76	mmol	mmol	NOUN
ahs-18395	53	77	tris	tris	NOUN
ahs-18395	53	78	-	-	PUNCT
ahs-18395	53	79	hcl	hcl	NOUN
ahs-18395	53	80	/	/	SYM
ahs-18395	53	81	l	l	PROPN
ahs-18395	53	82	,	,	PUNCT
ahs-18395	53	83	ph	ph	ADJ
ahs-18395	53	84	8.3	8.3	NUM
ahs-18395	53	85	,	,	PUNCT
ahs-18395	53	86	83	83	NUM
ahs-18395	53	87	mmol	mmol	NOUN
ahs-18395	53	88	boric	boric	ADJ
ahs-18395	53	89	acid	acid	NOUN
ahs-18395	53	90	/	/	SYM
ahs-18395	53	91	l	l	NOUN
ahs-18395	53	92	,	,	PUNCT
ahs-18395	53	93	1	1	NUM
ahs-18395	53	94	mmol	mmol	NOUN
ahs-18395	53	95	edta	edta	NOUN
ahs-18395	53	96	/	/	SYM
ahs-18395	53	97	l	l	NOUN
ahs-18395	53	98	)	)	PUNCT
ahs-18395	53	99	at	at	ADP
ahs-18395	53	100	100v	100v	NUM
ahs-18395	53	101	.	.	PUNCT
ahs-18395	54	1	the	the	DET
ahs-18395	54	2	gels	gel	NOUN
ahs-18395	54	3	were	be	AUX
ahs-18395	54	4	stained	stain	VERB
ahs-18395	54	5	with	with	ADP
ahs-18395	54	6	ethidium	ethidium	NOUN
ahs-18395	54	7	bromide	bromide	NOUN
ahs-18395	54	8	solution	solution	NOUN
ahs-18395	54	9	and	and	CCONJ
ahs-18395	54	10	visualized	visualize	VERB
ahs-18395	54	11	under	under	ADP
ahs-18395	54	12	ultraviolet	ultraviolet	ADJ
ahs-18395	54	13	illumination	illumination	NOUN
ahs-18395	54	14	.	.	PUNCT
ahs-18395	55	1	sizes	size	NOUN
ahs-18395	55	2	of	of	ADP
ahs-18395	55	3	the	the	DET
ahs-18395	55	4	amplified	amplify	VERB
ahs-18395	55	5	products	product	NOUN
ahs-18395	55	6	were	be	AUX
ahs-18395	55	7	determined	determine	VERB
ahs-18395	55	8	relative	relative	ADJ
ahs-18395	55	9	to	to	ADP
ahs-18395	55	10	a	a	DET
ahs-18395	55	11	100	100	NUM
ahs-18395	55	12	-	-	PUNCT
ahs-18395	55	13	bp	bp	NOUN
ahs-18395	55	14	dna	dna	PROPN
ahs-18395	55	15	ladder	ladder	NOUN
ahs-18395	55	16	(	(	PUNCT
ahs-18395	55	17	mbi	mbi	NOUN
ahs-18395	55	18	fermentas	fermentas	PROPN
ahs-18395	55	19	,	,	PUNCT
ahs-18395	55	20	york	york	PROPN
ahs-18395	55	21	,	,	PUNCT
ahs-18395	55	22	uk	uk	PROPN
ahs-18395	55	23	)	)	PUNCT
ahs-18395	55	24	.	.	PUNCT
ahs-18395	56	1	3	3	X
ahs-18395	56	2	.	.	X
ahs-18395	56	3	discussion	discussion	NOUN
ahs-18395	56	4	and	and	CCONJ
ahs-18395	56	5	conclusions	conclusion	NOUN
ahs-18395	56	6	disease	disease	NOUN
ahs-18395	56	7	symptoms	symptom	NOUN
ahs-18395	56	8	(	(	PUNCT
ahs-18395	56	9	presence	presence	NOUN
ahs-18395	56	10	of	of	ADP
ahs-18395	56	11	necrosis	necrosis	NOUN
ahs-18395	56	12	and	and	CCONJ
ahs-18395	56	13	chlorosis	chlorosis	NOUN
ahs-18395	56	14	)	)	PUNCT
ahs-18395	56	15	were	be	AUX
ahs-18395	56	16	severe	severe	ADJ
ahs-18395	56	17	on	on	ADP
ahs-18395	56	18	the	the	DET
ahs-18395	56	19	susceptible	susceptible	ADJ
ahs-18395	56	20	genotype	genotype	NOUN
ahs-18395	56	21	wi2291	wi2291	ADJ
ahs-18395	56	22	that	that	PRON
ahs-18395	56	23	was	be	AUX
ahs-18395	56	24	infected	infect	VERB
ahs-18395	56	25	with	with	ADP
ahs-18395	56	26	pathogenic	pathogenic	ADJ
ahs-18395	56	27	isolates	isolate	NOUN
ahs-18395	56	28	after	after	ADP
ahs-18395	56	29	10	10	NUM
ahs-18395	56	30	days	day	NOUN
ahs-18395	56	31	of	of	ADP
ahs-18395	56	32	inoculation	inoculation	NOUN
ahs-18395	56	33	.	.	PUNCT
ahs-18395	57	1	pt1	pt1	PROPN
ahs-18395	57	2	and	and	CCONJ
ahs-18395	57	3	their	their	PRON
ahs-18395	57	4	generations	generation	NOUN
ahs-18395	57	5	induced	induce	VERB
ahs-18395	57	6	small	small	ADJ
ahs-18395	57	7	round	round	NOUN
ahs-18395	57	8	to	to	ADP
ahs-18395	57	9	oblong	oblong	ADJ
ahs-18395	57	10	dark	dark	ADJ
ahs-18395	57	11	brown	brown	ADJ
ahs-18395	57	12	necrotic	necrotic	ADJ
ahs-18395	57	13	lesions	lesion	NOUN
ahs-18395	57	14	,	,	PUNCT
ahs-18395	57	15	whereas	whereas	ADV
ahs-18395	57	16	,	,	PUNCT
ahs-18395	57	17	pt4	pt4	NOUN
ahs-18395	57	18	and	and	CCONJ
ahs-18395	57	19	their	their	PRON
ahs-18395	57	20	generations	generation	NOUN
ahs-18395	57	21	induced	induce	VERB
ahs-18395	57	22	solid	solid	ADJ
ahs-18395	57	23	dark	dark	ADJ
ahs-18395	57	24	brown	brown	ADJ
ahs-18395	57	25	necrotic	necrotic	ADJ
ahs-18395	57	26	lesions	lesion	NOUN
ahs-18395	57	27	with	with	ADP
ahs-18395	57	28	expanding	expand	VERB
ahs-18395	57	29	chlorosis	chlorosis	NOUN
ahs-18395	57	30	(	(	PUNCT
ahs-18395	57	31	the	the	DET
ahs-18395	57	32	‘	'	PUNCT
ahs-18395	57	33	classic	classic	ADJ
ahs-18395	57	34	’	'	PUNCT
ahs-18395	57	35	spot	spot	NOUN
ahs-18395	57	36	blotch	blotch	NOUN
ahs-18395	57	37	lesion	lesion	NOUN
ahs-18395	57	38	)	)	PUNCT
ahs-18395	57	39	in	in	ADP
ahs-18395	57	40	highly	highly	ADV
ahs-18395	57	41	compatible	compatible	ADJ
ahs-18395	57	42	interactions	interaction	NOUN
ahs-18395	57	43	.	.	PUNCT
ahs-18395	58	1	as	as	SCONJ
ahs-18395	58	2	offspring	offspring	NOUN
ahs-18395	58	3	isolates	isolate	NOUN
ahs-18395	58	4	from	from	ADP
ahs-18395	58	5	the	the	DET
ahs-18395	58	6	most	most	ADV
ahs-18395	58	7	diseased	diseased	ADJ
ahs-18395	58	8	plants	plant	NOUN
ahs-18395	58	9	were	be	AUX
ahs-18395	58	10	serially	serially	ADV
ahs-18395	58	11	passaged	passage	VERB
ahs-18395	58	12	table	table	NOUN
ahs-18395	58	13	1	1	NUM
ahs-18395	58	14	remap	remap	NOUN
ahs-18395	58	15	primers	primer	NOUN
ahs-18395	58	16	used	use	VERB
ahs-18395	58	17	in	in	ADP
ahs-18395	58	18	the	the	DET
ahs-18395	58	19	study	study	NOUN
ahs-18395	58	20	primer	primer	NOUN
ahs-18395	58	21	no	no	INTJ
ahs-18395	58	22	.	.	PUNCT
ahs-18395	59	1	sequence	sequence	NOUN
ahs-18395	59	2	1	1	NUM
ahs-18395	59	3	(	(	PUNCT
ahs-18395	59	4	ga)8t+tgtttcccatgcgacgttccccaaca	ga)8t+tgtttcccatgcgacgttccccaaca	NOUN
ahs-18395	59	5	2	2	NUM
ahs-18395	59	6	(	(	PUNCT
ahs-18395	59	7	ag)8t+gcatcaaaggcattggaggtg	ag)8t+gcatcaaaggcattggaggtg	NOUN
ahs-18395	59	8	3	3	NUM
ahs-18395	59	9	(	(	PUNCT
ahs-18395	59	10	ga)8t+	ga)8t+	NOUN
ahs-18395	59	11	gcatcaaaggcattggaggtg	gcatcaaaggcattggaggtg	NOUN
ahs-18395	59	12	4	4	NUM
ahs-18395	59	13	(	(	PUNCT
ahs-18395	59	14	ga)8t+cactagtgattcattatgctgagtg	ga)8t+cactagtgattcattatgctgagtg	NOUN
ahs-18395	59	15	5	5	NUM
ahs-18395	59	16	(	(	PUNCT
ahs-18395	59	17	ag)8t+gcatcaaaggcattggaggtg	ag)8t+gcatcaaaggcattggaggtg	NOUN
ahs-18395	59	18	6	6	NUM
ahs-18395	59	19	(	(	PUNCT
ahs-18395	59	20	ag)8t+	ag)8t+	NOUN
ahs-18395	59	21	cactagtgattcattatgctgagtg	cactagtgattcattatgctgagtg	NOUN
ahs-18395	59	22	7	7	NUM
ahs-18395	59	23	(	(	PUNCT
ahs-18395	59	24	ag)8g+ccaatggactggacatccgatggg	ag)8g+ccaatggactggacatccgatggg	NOUN
ahs-18395	59	25	8	8	NUM
ahs-18395	59	26	(	(	PUNCT
ahs-18395	59	27	ag)8t+	ag)8t+	NOUN
ahs-18395	59	28	tgtttcccatgcgacgttccccaaca	tgtttcccatgcgacgttccccaaca	NOUN
ahs-18395	59	29	9	9	NUM
ahs-18395	59	30	(	(	PUNCT
ahs-18395	59	31	ag)8g+	ag)8g+	PRON
ahs-18395	59	32	tgtttcccatgcgacgttccccaaca	tgtttcccatgcgacgttccccaaca	NOUN
ahs-18395	59	33	121	121	NUM
ahs-18395	59	34	on	on	ADP
ahs-18395	59	35	barley	barley	NOUN
ahs-18395	59	36	,	,	PUNCT
ahs-18395	59	37	virulence	virulence	NOUN
ahs-18395	59	38	of	of	ADP
ahs-18395	59	39	the	the	DET
ahs-18395	59	40	aggressive	aggressive	ADJ
ahs-18395	59	41	isolate	isolate	PROPN
ahs-18395	59	42	pt4	pt4	PROPN
ahs-18395	59	43	was	be	AUX
ahs-18395	59	44	increased	increase	VERB
ahs-18395	59	45	during	during	ADP
ahs-18395	59	46	seven	seven	NUM
ahs-18395	59	47	transfers	transfer	NOUN
ahs-18395	59	48	on	on	ADP
ahs-18395	59	49	plants	plant	NOUN
ahs-18395	59	50	,	,	PUNCT
ahs-18395	59	51	and	and	CCONJ
ahs-18395	59	52	the	the	DET
ahs-18395	59	53	ability	ability	NOUN
ahs-18395	59	54	of	of	ADP
ahs-18395	59	55	weakly	weakly	ADJ
ahs-18395	59	56	aggressive	aggressive	ADJ
ahs-18395	59	57	isolate	isolate	NOUN
ahs-18395	59	58	pt1	pt1	PROPN
ahs-18395	59	59	to	to	PART
ahs-18395	59	60	maintain	maintain	VERB
ahs-18395	59	61	its	its	PRON
ahs-18395	59	62	virulence	virulence	NOUN
ahs-18395	59	63	was	be	AUX
ahs-18395	59	64	observed	observe	VERB
ahs-18395	59	65	(	(	PUNCT
ahs-18395	59	66	table	table	NOUN
ahs-18395	59	67	2	2	NUM
ahs-18395	59	68	)	)	PUNCT
ahs-18395	59	69	.	.	PUNCT
ahs-18395	60	1	all	all	DET
ahs-18395	60	2	pt4	pt4	PROPN
ahs-18395	60	3	isolates	isolate	NOUN
ahs-18395	60	4	were	be	AUX
ahs-18395	60	5	highly	highly	ADV
ahs-18395	60	6	virulent	virulent	ADJ
ahs-18395	60	7	to	to	ADP
ahs-18395	60	8	cv	cv	PROPN
ahs-18395	60	9	.	.	PROPN
ahs-18395	61	1	wi2291	wi2291	PROPN
ahs-18395	61	2	with	with	ADP
ahs-18395	61	3	a	a	DET
ahs-18395	61	4	mode	mode	NOUN
ahs-18395	61	5	of	of	ADP
ahs-18395	61	6	4	4	NUM
ahs-18395	61	7	(	(	PUNCT
ahs-18395	61	8	typifying	typify	VERB
ahs-18395	61	9	>	>	X
ahs-18395	61	10	90	90	NUM
ahs-18395	61	11	%	%	NOUN
ahs-18395	61	12	of	of	ADP
ahs-18395	61	13	the	the	DET
ahs-18395	61	14	lesions	lesion	NOUN
ahs-18395	61	15	observed	observe	VERB
ahs-18395	61	16	on	on	ADP
ahs-18395	61	17	leaves	leave	NOUN
ahs-18395	61	18	)	)	PUNCT
ahs-18395	61	19	,	,	PUNCT
ahs-18395	61	20	whereas	whereas	SCONJ
ahs-18395	61	21	,	,	PUNCT
ahs-18395	61	22	all	all	DET
ahs-18395	61	23	pt1	pt1	PROPN
ahs-18395	61	24	isolates	isolate	NOUN
ahs-18395	61	25	were	be	AUX
ahs-18395	61	26	virulent	virulent	ADJ
ahs-18395	61	27	exhibiting	exhibit	VERB
ahs-18395	61	28	a	a	DET
ahs-18395	61	29	mode	mode	NOUN
ahs-18395	61	30	of	of	ADP
ahs-18395	61	31	2	2	NUM
ahs-18395	61	32	(	(	PUNCT
ahs-18395	61	33	typifying	typify	VERB
ahs-18395	61	34	>	>	X
ahs-18395	61	35	10	10	NUM
ahs-18395	61	36	%	%	NOUN
ahs-18395	61	37	of	of	ADP
ahs-18395	61	38	the	the	DET
ahs-18395	61	39	lesions	lesion	NOUN
ahs-18395	61	40	observed	observe	VERB
ahs-18395	61	41	on	on	ADP
ahs-18395	61	42	leaves	leave	NOUN
ahs-18395	61	43	)	)	PUNCT
ahs-18395	61	44	,	,	PUNCT
ahs-18395	61	45	indicating	indicate	VERB
ahs-18395	61	46	that	that	SCONJ
ahs-18395	61	47	virulence	virulence	NOUN
ahs-18395	61	48	was	be	AUX
ahs-18395	61	49	not	not	PART
ahs-18395	61	50	significantly	significantly	ADV
ahs-18395	61	51	affected	affect	VERB
ahs-18395	61	52	.	.	PUNCT
ahs-18395	62	1	infection	infection	NOUN
ahs-18395	62	2	responses	response	NOUN
ahs-18395	62	3	of	of	ADP
ahs-18395	62	4	wi2291	wi2291	PROPN
ahs-18395	62	5	to	to	PART
ahs-18395	62	6	c.	c.	PROPN
ahs-18395	62	7	sativus	sativus	PROPN
ahs-18395	62	8	isolates	isolates	PROPN
ahs-18395	62	9	pt1	pt1	PROPN
ahs-18395	62	10	and	and	CCONJ
ahs-18395	62	11	pt4	pt4	NOUN
ahs-18395	62	12	,	,	PUNCT
ahs-18395	62	13	and	and	CCONJ
ahs-18395	62	14	their	their	PRON
ahs-18395	62	15	generations	generation	NOUN
ahs-18395	62	16	are	be	AUX
ahs-18395	62	17	summarized	summarize	VERB
ahs-18395	62	18	in	in	ADP
ahs-18395	62	19	table	table	NOUN
ahs-18395	62	20	2	2	NUM
ahs-18395	62	21	.	.	PUNCT
ahs-18395	63	1	the	the	DET
ahs-18395	63	2	pattern	pattern	NOUN
ahs-18395	63	3	of	of	ADP
ahs-18395	63	4	continuous	continuous	ADJ
ahs-18395	63	5	incremental	incremental	ADJ
ahs-18395	63	6	increase	increase	NOUN
ahs-18395	63	7	in	in	ADP
ahs-18395	63	8	virulence	virulence	NOUN
ahs-18395	63	9	has	have	AUX
ahs-18395	63	10	been	be	AUX
ahs-18395	63	11	reported	report	VERB
ahs-18395	63	12	in	in	ADP
ahs-18395	63	13	f.	f.	PROPN
ahs-18395	63	14	oxysporum	oxysporum	PROPN
ahs-18395	63	15	f.	f.	PROPN
ahs-18395	63	16	sp	sp	PROPN
ahs-18395	63	17	.	.	PROPN
ahs-18395	63	18	ciceris	ciceris	PROPN
ahs-18395	63	19	,	,	PUNCT
ahs-18395	63	20	on	on	ADP
ahs-18395	63	21	chickpea	chickpea	PROPN
ahs-18395	63	22	(	(	PUNCT
ahs-18395	63	23	jiménez	jiménez	PROPN
ahs-18395	63	24	-	-	PUNCT
ahs-18395	63	25	gasco	gasco	PROPN
ahs-18395	63	26	et	et	PROPN
ahs-18395	63	27	al	al	PROPN
ahs-18395	63	28	.	.	PROPN
ahs-18395	63	29	,	,	PUNCT
ahs-18395	63	30	2004	2004	NUM
ahs-18395	63	31	)	)	PUNCT
ahs-18395	63	32	,	,	PUNCT
ahs-18395	63	33	and	and	CCONJ
ahs-18395	63	34	in	in	ADP
ahs-18395	63	35	magnaporthe	magnaporthe	ADJ
ahs-18395	63	36	oryzae	oryzae	NOUN
ahs-18395	63	37	on	on	ADP
ahs-18395	63	38	rice	rice	NOUN
ahs-18395	63	39	(	(	PUNCT
ahs-18395	63	40	park	park	NOUN
ahs-18395	63	41	et	et	PROPN
ahs-18395	63	42	al	al	PROPN
ahs-18395	63	43	.	.	PROPN
ahs-18395	63	44	,	,	PUNCT
ahs-18395	63	45	2010	2010	NUM
ahs-18395	63	46	)	)	PUNCT
ahs-18395	63	47	.	.	PUNCT
ahs-18395	64	1	however	however	ADV
ahs-18395	64	2	,	,	PUNCT
ahs-18395	64	3	the	the	DET
ahs-18395	64	4	pathosystems	pathosystem	NOUN
ahs-18395	64	5	involving	involve	VERB
ahs-18395	64	6	the	the	DET
ahs-18395	64	7	genera	genera	NOUN
ahs-18395	64	8	of	of	ADP
ahs-18395	64	9	cochliobolus	cochliobolus	NOUN
ahs-18395	64	10	and	and	CCONJ
ahs-18395	64	11	the	the	DET
ahs-18395	64	12	involvement	involvement	NOUN
ahs-18395	64	13	of	of	ADP
ahs-18395	64	14	host	host	NOUN
ahs-18395	64	15	-	-	PUNCT
ahs-18395	64	16	specific	specific	ADJ
ahs-18395	64	17	toxins	toxin	NOUN
ahs-18395	64	18	in	in	ADP
ahs-18395	64	19	pathogenicity	pathogenicity	NOUN
ahs-18395	64	20	and	and	CCONJ
ahs-18395	64	21	virulence	virulence	NOUN
ahs-18395	64	22	are	be	AUX
ahs-18395	64	23	well	well	ADV
ahs-18395	64	24	documented	document	VERB
ahs-18395	64	25	(	(	PUNCT
ahs-18395	64	26	olbe	olbe	NOUN
ahs-18395	64	27	et	et	NOUN
ahs-18395	64	28	al	al	PROPN
ahs-18395	64	29	.	.	PROPN
ahs-18395	64	30	,	,	PUNCT
ahs-18395	64	31	1995	1995	NUM
ahs-18395	64	32	)	)	PUNCT
ahs-18395	64	33	.	.	PUNCT
ahs-18395	65	1	the	the	DET
ahs-18395	65	2	number	number	NOUN
ahs-18395	65	3	of	of	ADP
ahs-18395	65	4	sb	sb	PROPN
ahs-18395	65	5	lesions	lesion	NOUN
ahs-18395	65	6	(	(	PUNCT
ahs-18395	65	7	presence	presence	NOUN
ahs-18395	65	8	of	of	ADP
ahs-18395	65	9	necrosis	necrosis	NOUN
ahs-18395	65	10	and	and	CCONJ
ahs-18395	65	11	chlorosis	chlorosis	NOUN
ahs-18395	65	12	)	)	PUNCT
ahs-18395	65	13	were	be	AUX
ahs-18395	65	14	always	always	ADV
ahs-18395	65	15	high	high	ADJ
ahs-18395	65	16	in	in	ADP
ahs-18395	65	17	the	the	DET
ahs-18395	65	18	virulent	virulent	NOUN
ahs-18395	65	19	isolate	isolate	PROPN
ahs-18395	65	20	pt4	pt4	PROPN
ahs-18395	65	21	during	during	ADP
ahs-18395	65	22	the	the	DET
ahs-18395	65	23	serial	serial	ADJ
ahs-18395	65	24	passages	passage	NOUN
ahs-18395	65	25	(	(	PUNCT
ahs-18395	65	26	fig	fig	NOUN
ahs-18395	65	27	.	.	PUNCT
ahs-18395	65	28	1	1	NUM
ahs-18395	65	29	)	)	PUNCT
ahs-18395	65	30	.	.	PUNCT
ahs-18395	66	1	this	this	PRON
ahs-18395	66	2	can	can	AUX
ahs-18395	66	3	be	be	AUX
ahs-18395	66	4	attributed	attribute	VERB
ahs-18395	66	5	to	to	ADP
ahs-18395	66	6	a	a	DET
ahs-18395	66	7	higher	high	ADJ
ahs-18395	66	8	proportion	proportion	NOUN
ahs-18395	66	9	of	of	ADP
ahs-18395	66	10	pt4	pt4	NOUN
ahs-18395	66	11	spores	spore	NOUN
ahs-18395	66	12	being	be	AUX
ahs-18395	66	13	able	able	ADJ
ahs-18395	66	14	to	to	PART
ahs-18395	66	15	establish	establish	VERB
ahs-18395	66	16	lesions	lesion	NOUN
ahs-18395	66	17	than	than	ADP
ahs-18395	66	18	pt1	pt1	NOUN
ahs-18395	66	19	spores	spore	NOUN
ahs-18395	66	20	.	.	PUNCT
ahs-18395	67	1	this	this	PRON
ahs-18395	67	2	indicates	indicate	VERB
ahs-18395	67	3	that	that	SCONJ
ahs-18395	67	4	the	the	DET
ahs-18395	67	5	more	more	ADV
ahs-18395	67	6	virulent	virulent	ADJ
ahs-18395	67	7	pt4	pt4	PROPN
ahs-18395	67	8	causes	cause	VERB
ahs-18395	67	9	more	more	ADJ
ahs-18395	67	10	lesions	lesion	NOUN
ahs-18395	67	11	(	(	PUNCT
ahs-18395	67	12	per	per	ADP
ahs-18395	67	13	leaf	leaf	NOUN
ahs-18395	67	14	)	)	PUNCT
ahs-18395	67	15	from	from	ADP
ahs-18395	67	16	a	a	DET
ahs-18395	67	17	given	give	VERB
ahs-18395	67	18	inoculum	inoculum	NOUN
ahs-18395	67	19	dose	dose	NOUN
ahs-18395	67	20	than	than	ADP
ahs-18395	67	21	pt1	pt1	PROPN
ahs-18395	67	22	as	as	ADP
ahs-18395	67	23	presented	present	VERB
ahs-18395	67	24	in	in	ADP
ahs-18395	67	25	figure	figure	NOUN
ahs-18395	67	26	1	1	NUM
ahs-18395	67	27	.	.	PUNCT
ahs-18395	68	1	the	the	DET
ahs-18395	68	2	existence	existence	NOUN
ahs-18395	68	3	of	of	ADP
ahs-18395	68	4	pathotypes	pathotype	NOUN
ahs-18395	68	5	expressing	express	VERB
ahs-18395	68	6	differential	differential	ADJ
ahs-18395	68	7	virulence	virulence	NOUN
ahs-18395	68	8	on	on	ADP
ahs-18395	68	9	host	host	NOUN
ahs-18395	68	10	genotypes	genotype	NOUN
ahs-18395	68	11	is	be	AUX
ahs-18395	68	12	uncommon	uncommon	ADJ
ahs-18395	68	13	in	in	ADP
ahs-18395	68	14	species	specie	NOUN
ahs-18395	68	15	related	relate	VERB
ahs-18395	68	16	to	to	ADP
ahs-18395	68	17	c.	c.	PROPN
ahs-18395	68	18	sativus	sativus	PROPN
ahs-18395	68	19	.	.	PUNCT
ahs-18395	69	1	differential	differential	ADJ
ahs-18395	69	2	reactions	reaction	NOUN
ahs-18395	69	3	,	,	PUNCT
ahs-18395	69	4	such	such	ADJ
ahs-18395	69	5	as	as	ADP
ahs-18395	69	6	those	those	PRON
ahs-18395	69	7	expressed	express	VERB
ahs-18395	69	8	by	by	ADP
ahs-18395	69	9	the	the	DET
ahs-18395	69	10	pathotypes	pathotypes	PROPN
ahs-18395	69	11	pt1	pt1	PROPN
ahs-18395	69	12	and	and	CCONJ
ahs-18395	69	13	pt4	pt4	PROPN
ahs-18395	69	14	on	on	ADP
ahs-18395	69	15	two	two	NUM
ahs-18395	69	16	-	-	PUNCT
ahs-18395	69	17	rowed	row	VERB
ahs-18395	69	18	genotypes	genotype	NOUN
ahs-18395	69	19	(	(	PUNCT
ahs-18395	69	20	wi	wi	PROPN
ahs-18395	69	21	2291	2291	NUM
ahs-18395	69	22	)	)	PUNCT
ahs-18395	69	23	,	,	PUNCT
ahs-18395	69	24	usually	usually	ADV
ahs-18395	69	25	are	be	AUX
ahs-18395	69	26	a	a	DET
ahs-18395	69	27	feature	feature	NOUN
ahs-18395	69	28	of	of	ADP
ahs-18395	69	29	gene	gene	NOUN
ahs-18395	69	30	-	-	PUNCT
ahs-18395	69	31	for	for	ADP
ahs-18395	69	32	-	-	PUNCT
ahs-18395	69	33	gene	gene	NOUN
ahs-18395	69	34	interactions	interaction	NOUN
ahs-18395	69	35	(	(	PUNCT
ahs-18395	69	36	flor	flor	NOUN
ahs-18395	69	37	,	,	PUNCT
ahs-18395	69	38	1956	1956	NUM
ahs-18395	69	39	)	)	PUNCT
ahs-18395	69	40	or	or	CCONJ
ahs-18395	69	41	an	an	DET
ahs-18395	69	42	incompatibility	incompatibility	NOUN
ahs-18395	69	43	system	system	NOUN
ahs-18395	69	44	(	(	PUNCT
ahs-18395	69	45	briggs	briggs	PROPN
ahs-18395	69	46	and	and	CCONJ
ahs-18395	69	47	johal	johal	PROPN
ahs-18395	69	48	,	,	PUNCT
ahs-18395	69	49	1994	1994	NUM
ahs-18395	69	50	)	)	PUNCT
ahs-18395	69	51	.	.	PUNCT
ahs-18395	70	1	a	a	DET
ahs-18395	70	2	hypothesis	hypothesis	NOUN
ahs-18395	70	3	that	that	PRON
ahs-18395	70	4	these	these	DET
ahs-18395	70	5	two	two	NUM
ahs-18395	70	6	differentially	differentially	ADV
ahs-18395	70	7	virulent	virulent	ADJ
ahs-18395	70	8	c.	c.	PROPN
ahs-18395	70	9	sativus	sativus	PROPN
ahs-18395	70	10	isolates	isolate	NOUN
ahs-18395	70	11	are	be	AUX
ahs-18395	70	12	pathotypes	pathotype	NOUN
ahs-18395	70	13	that	that	PRON
ahs-18395	70	14	produce	produce	VERB
ahs-18395	70	15	two	two	NUM
ahs-18395	70	16	different	different	ADJ
ahs-18395	70	17	types	type	NOUN
ahs-18395	70	18	of	of	ADP
ahs-18395	70	19	host	host	NOUN
ahs-18395	70	20	-	-	PUNCT
ahs-18395	70	21	specific	specific	ADJ
ahs-18395	70	22	toxins	toxin	NOUN
ahs-18395	70	23	may	may	AUX
ahs-18395	70	24	also	also	ADV
ahs-18395	70	25	be	be	AUX
ahs-18395	70	26	valid	valid	ADJ
ahs-18395	70	27	.	.	PUNCT
ahs-18395	71	1	additionally	additionally	ADV
ahs-18395	71	2	,	,	PUNCT
ahs-18395	71	3	no	no	DET
ahs-18395	71	4	significant	significant	ADJ
ahs-18395	71	5	differences	difference	NOUN
ahs-18395	71	6	were	be	AUX
ahs-18395	71	7	observed	observe	VERB
ahs-18395	71	8	between	between	ADP
ahs-18395	71	9	the	the	DET
ahs-18395	71	10	parental	parental	ADJ
ahs-18395	71	11	isolates	isolate	NOUN
ahs-18395	71	12	and	and	CCONJ
ahs-18395	71	13	any	any	DET
ahs-18395	71	14	isolates	isolate	NOUN
ahs-18395	71	15	derived	derive	VERB
ahs-18395	71	16	from	from	ADP
ahs-18395	71	17	them	they	PRON
ahs-18395	71	18	through	through	ADP
ahs-18395	71	19	the	the	DET
ahs-18395	71	20	seven	seven	NUM
ahs-18395	71	21	serial	serial	ADJ
ahs-18395	71	22	transfers	transfer	NOUN
ahs-18395	71	23	for	for	ADP
ahs-18395	71	24	any	any	PRON
ahs-18395	71	25	of	of	ADP
ahs-18395	71	26	the	the	DET
ahs-18395	71	27	phenotypic	phenotypic	ADJ
ahs-18395	71	28	characters	character	NOUN
ahs-18395	71	29	tested	test	VERB
ahs-18395	71	30	in	in	ADP
ahs-18395	71	31	vitro	vitro	X
ahs-18395	71	32	including	include	VERB
ahs-18395	71	33	mycelial	mycelial	ADJ
ahs-18395	71	34	growth	growth	NOUN
ahs-18395	71	35	,	,	PUNCT
ahs-18395	71	36	conidiation	conidiation	NOUN
ahs-18395	71	37	and	and	CCONJ
ahs-18395	71	38	conidial	conidial	ADJ
ahs-18395	71	39	germination	germination	NOUN
ahs-18395	71	40	on	on	ADP
ahs-18395	71	41	pda	pda	NOUN
ahs-18395	71	42	media	medium	NOUN
ahs-18395	71	43	(	(	PUNCT
ahs-18395	71	44	fig	fig	NOUN
ahs-18395	71	45	.	.	PUNCT
ahs-18395	72	1	2	2	NUM
ahs-18395	72	2	)	)	PUNCT
ahs-18395	72	3	.	.	PUNCT
ahs-18395	73	1	these	these	DET
ahs-18395	73	2	results	result	NOUN
ahs-18395	73	3	are	be	AUX
ahs-18395	73	4	similar	similar	ADJ
ahs-18395	73	5	to	to	ADP
ahs-18395	73	6	those	those	PRON
ahs-18395	73	7	of	of	ADP
ahs-18395	73	8	latterel	latterel	NOUN
ahs-18395	73	9	and	and	CCONJ
ahs-18395	73	10	rossi	rossi	ADJ
ahs-18395	73	11	(	(	PUNCT
ahs-18395	73	12	1986	1986	NUM
ahs-18395	73	13	)	)	PUNCT
ahs-18395	73	14	,	,	PUNCT
ahs-18395	73	15	who	who	PRON
ahs-18395	73	16	reported	report	VERB
ahs-18395	73	17	no	no	DET
ahs-18395	73	18	changes	change	NOUN
ahs-18395	73	19	in	in	ADP
ahs-18395	73	20	cultural	cultural	ADJ
ahs-18395	73	21	characteristics	characteristic	NOUN
ahs-18395	73	22	in	in	ADP
ahs-18395	73	23	magnaporthe	magnaporthe	ADJ
ahs-18395	73	24	oryzae	oryzae	PROPN
ahs-18395	73	25	isolates	isolate	NOUN
ahs-18395	73	26	after	after	ADP
ahs-18395	73	27	serial	serial	ADJ
ahs-18395	73	28	transfers	transfer	NOUN
ahs-18395	73	29	of	of	ADP
ahs-18395	73	30	the	the	DET
ahs-18395	73	31	same	same	ADJ
ahs-18395	73	32	isolates	isolate	NOUN
ahs-18395	73	33	from	from	ADP
ahs-18395	73	34	stock	stock	NOUN
ahs-18395	73	35	cultures	culture	NOUN
ahs-18395	73	36	over	over	ADP
ahs-18395	73	37	a	a	DET
ahs-18395	73	38	long	long	ADJ
ahs-18395	73	39	period	period	NOUN
ahs-18395	73	40	of	of	ADP
ahs-18395	73	41	time	time	NOUN
ahs-18395	73	42	.	.	PUNCT
ahs-18395	74	1	to	to	PART
ahs-18395	74	2	evaluate	evaluate	VERB
ahs-18395	74	3	genotypic	genotypic	NOUN
ahs-18395	74	4	stability	stability	NOUN
ahs-18395	74	5	during	during	ADP
ahs-18395	74	6	serial	serial	ADJ
ahs-18395	74	7	transfers	transfer	NOUN
ahs-18395	74	8	,	,	PUNCT
ahs-18395	74	9	remap	remap	VERB
ahs-18395	74	10	fingerprinting	fingerprinting	NOUN
ahs-18395	74	11	technique	technique	NOUN
ahs-18395	74	12	was	be	AUX
ahs-18395	74	13	used	use	VERB
ahs-18395	74	14	.	.	PUNCT
ahs-18395	75	1	the	the	DET
ahs-18395	75	2	remap	remap	NOUN
ahs-18395	75	3	haplotypes	haplotype	NOUN
ahs-18395	75	4	of	of	ADP
ahs-18395	75	5	seven	seven	NUM
ahs-18395	75	6	generations	generation	NOUN
ahs-18395	75	7	were	be	AUX
ahs-18395	75	8	identical	identical	ADJ
ahs-18395	75	9	to	to	ADP
ahs-18395	75	10	their	their	PRON
ahs-18395	75	11	parent	parent	NOUN
ahs-18395	75	12	isolates	isolate	NOUN
ahs-18395	75	13	(	(	PUNCT
ahs-18395	75	14	fig	fig	NOUN
ahs-18395	75	15	.	.	PUNCT
ahs-18395	76	1	3	3	NUM
ahs-18395	76	2	)	)	PUNCT
ahs-18395	76	3	;	;	PUNCT
ahs-18395	76	4	this	this	PRON
ahs-18395	76	5	might	might	AUX
ahs-18395	76	6	be	be	AUX
ahs-18395	76	7	an	an	DET
ahs-18395	76	8	indicator	indicator	NOUN
ahs-18395	76	9	of	of	ADP
ahs-18395	76	10	the	the	DET
ahs-18395	76	11	stability	stability	NOUN
ahs-18395	76	12	of	of	ADP
ahs-18395	76	13	transposable	transposable	ADJ
ahs-18395	76	14	elements	element	NOUN
ahs-18395	76	15	during	during	ADP
ahs-18395	76	16	serial	serial	ADJ
ahs-18395	76	17	passages	passage	NOUN
ahs-18395	76	18	.	.	PUNCT
ahs-18395	77	1	the	the	DET
ahs-18395	77	2	lack	lack	NOUN
ahs-18395	77	3	of	of	ADP
ahs-18395	77	4	molecular	molecular	ADJ
ahs-18395	77	5	variation	variation	NOUN
ahs-18395	77	6	in	in	ADP
ahs-18395	77	7	offspring	offspring	NOUN
ahs-18395	77	8	of	of	ADP
ahs-18395	77	9	pt4	pt4	NOUN
ahs-18395	77	10	isolates	isolate	NOUN
ahs-18395	77	11	with	with	ADP
ahs-18395	77	12	increased	increase	VERB
ahs-18395	77	13	virulence	virulence	NOUN
ahs-18395	77	14	(	(	PUNCT
ahs-18395	77	15	table	table	NOUN
ahs-18395	77	16	2	2	NUM
ahs-18395	77	17	;	;	PUNCT
ahs-18395	77	18	fig	fig	NOUN
ahs-18395	77	19	.	.	PUNCT
ahs-18395	78	1	3	3	X
ahs-18395	78	2	)	)	PUNCT
ahs-18395	78	3	is	be	AUX
ahs-18395	78	4	consistent	consistent	ADJ
ahs-18395	78	5	with	with	ADP
ahs-18395	78	6	the	the	DET
ahs-18395	78	7	fact	fact	NOUN
ahs-18395	78	8	that	that	SCONJ
ahs-18395	78	9	mutation	mutation	NOUN
ahs-18395	78	10	rates	rate	NOUN
ahs-18395	78	11	at	at	ADP
ahs-18395	78	12	virulence	virulence	NOUN
ahs-18395	78	13	loci	locus	NOUN
ahs-18395	78	14	are	be	AUX
ahs-18395	78	15	higher	high	ADJ
ahs-18395	78	16	than	than	ADP
ahs-18395	78	17	those	those	PRON
ahs-18395	78	18	at	at	ADP
ahs-18395	78	19	the	the	DET
ahs-18395	78	20	molecular	molecular	ADJ
ahs-18395	78	21	loci	loci	NOUN
ahs-18395	78	22	that	that	PRON
ahs-18395	78	23	define	define	VERB
ahs-18395	78	24	genotypes	genotype	NOUN
ahs-18395	78	25	(	(	PUNCT
ahs-18395	78	26	goodwin	goodwin	PROPN
ahs-18395	78	27	et	et	PROPN
ahs-18395	78	28	al	al	PROPN
ahs-18395	78	29	.	.	PROPN
ahs-18395	78	30	,	,	PUNCT
ahs-18395	78	31	1995	1995	NUM
ahs-18395	78	32	)	)	PUNCT
ahs-18395	78	33	.	.	PUNCT
ahs-18395	79	1	the	the	DET
ahs-18395	79	2	results	result	NOUN
ahs-18395	79	3	of	of	ADP
ahs-18395	79	4	this	this	DET
ahs-18395	79	5	study	study	NOUN
ahs-18395	79	6	demonstrate	demonstrate	VERB
ahs-18395	79	7	that	that	SCONJ
ahs-18395	79	8	the	the	DET
ahs-18395	79	9	virulence	virulence	NOUN
ahs-18395	79	10	of	of	ADP
ahs-18395	79	11	the	the	DET
ahs-18395	79	12	offspring	offspring	NOUN
ahs-18395	79	13	isolates	isolate	NOUN
ahs-18395	79	14	generated	generate	VERB
ahs-18395	79	15	from	from	ADP
ahs-18395	79	16	the	the	DET
ahs-18395	79	17	aggressive	aggressive	PROPN
ahs-18395	79	18	isolate	isolate	PROPN
ahs-18395	79	19	pt4	pt4	PROPN
ahs-18395	79	20	significantly	significantly	ADV
ahs-18395	79	21	increased	increase	VERB
ahs-18395	79	22	after	after	SCONJ
ahs-18395	79	23	seven	seven	NUM
ahs-18395	79	24	successive	successive	ADJ
ahs-18395	79	25	table	table	NOUN
ahs-18395	79	26	2	2	NUM
ahs-18395	79	27	infection	infection	NOUN
ahs-18395	79	28	responses	response	NOUN
ahs-18395	79	29	of	of	ADP
ahs-18395	79	30	barley	barley	PROPN
ahs-18395	79	31	cv	cv	PROPN
ahs-18395	79	32	.	.	PROPN
ahs-18395	79	33	wi	wi	PROPN
ahs-18395	79	34	2291	2291	NUM
ahs-18395	79	35	infected	infect	VERB
ahs-18395	79	36	with	with	ADP
ahs-18395	79	37	parents	parent	NOUN
ahs-18395	79	38	and	and	CCONJ
ahs-18395	79	39	progeny	progeny	VERB
ahs-18395	79	40	isolates	isolate	NOUN
ahs-18395	79	41	of	of	ADP
ahs-18395	79	42	cochliobolus	cochliobolus	PROPN
ahs-18395	79	43	sativus	sativus	PROPN
ahs-18395	79	44	based	base	VERB
ahs-18395	79	45	on	on	ADP
ahs-18395	79	46	the	the	DET
ahs-18395	79	47	scale	scale	NOUN
ahs-18395	79	48	of	of	ADP
ahs-18395	79	49	fetch	fetch	NOUN
ahs-18395	79	50	and	and	CCONJ
ahs-18395	79	51	steffenson	steffenson	NOUN
ahs-18395	79	52	(	(	PUNCT
ahs-18395	79	53	1999	1999	NUM
ahs-18395	79	54	)	)	PUNCT
ahs-18395	79	55	isolates	isolate	VERB
ahs-18395	79	56	infection	infection	NOUN
ahs-18395	79	57	response	response	NOUN
ahs-18395	79	58	parent	parent	NOUN
ahs-18395	79	59	passages	passage	NOUN
ahs-18395	79	60	1	1	NUM
ahs-18395	79	61	2	2	NUM
ahs-18395	79	62	3	3	NUM
ahs-18395	79	63	4	4	NUM
ahs-18395	79	64	5	5	NUM
ahs-18395	79	65	6	6	NUM
ahs-18395	79	66	7	7	NUM
ahs-18395	79	67	pt1	pt1	PROPN
ahs-18395	79	68	mode	mode	NOUN
ahs-18395	79	69	(	(	PUNCT
ahs-18395	79	70	z	z	NOUN
ahs-18395	79	71	)	)	PUNCT
ahs-18395	79	72	2	2	NUM
ahs-18395	79	73	1	1	NUM
ahs-18395	79	74	2	2	NUM
ahs-18395	79	75	2	2	NUM
ahs-18395	79	76	2	2	NUM
ahs-18395	79	77	2	2	NUM
ahs-18395	79	78	1	1	NUM
ahs-18395	79	79	1	1	NUM
ahs-18395	79	80	range	range	NOUN
ahs-18395	79	81	(	(	PUNCT
ahs-18395	79	82	y	y	NOUN
ahs-18395	79	83	)	)	PUNCT
ahs-18395	79	84	1	1	NUM
ahs-18395	79	85	-	-	SYM
ahs-18395	79	86	2	2	NUM
ahs-18395	79	87	1	1	NUM
ahs-18395	79	88	-	-	SYM
ahs-18395	79	89	2	2	NUM
ahs-18395	79	90	2	2	NUM
ahs-18395	79	91	1	1	NUM
ahs-18395	79	92	-	-	SYM
ahs-18395	79	93	2	2	NUM
ahs-18395	79	94	1	1	NUM
ahs-18395	79	95	-	-	SYM
ahs-18395	79	96	2	2	NUM
ahs-18395	79	97	1	1	NUM
ahs-18395	79	98	-	-	SYM
ahs-18395	79	99	2	2	NUM
ahs-18395	79	100	1	1	NUM
ahs-18395	79	101	-	-	SYM
ahs-18395	79	102	2	2	NUM
ahs-18395	79	103	1	1	NUM
ahs-18395	79	104	-	-	SYM
ahs-18395	79	105	2	2	NUM
ahs-18395	79	106	pt4	pt4	NOUN
ahs-18395	79	107	mode	mode	NOUN
ahs-18395	79	108	4	4	NUM
ahs-18395	79	109	4	4	NUM
ahs-18395	79	110	4	4	NUM
ahs-18395	79	111	4	4	NUM
ahs-18395	79	112	4	4	NUM
ahs-18395	79	113	-	-	SYM
ahs-18395	79	114	5	5	NUM
ahs-18395	79	115	4	4	NUM
ahs-18395	79	116	4	4	NUM
ahs-18395	79	117	4	4	NUM
ahs-18395	79	118	-	-	SYM
ahs-18395	79	119	5	5	NUM
ahs-18395	79	120	range	range	NOUN
ahs-18395	79	121	7	7	NUM
ahs-18395	79	122	-	-	SYM
ahs-18395	79	123	9	9	NUM
ahs-18395	79	124	6	6	NUM
ahs-18395	79	125	7	7	NUM
ahs-18395	79	126	7	7	NUM
ahs-18395	79	127	-	-	SYM
ahs-18395	79	128	8	8	NUM
ahs-18395	79	129	8	8	NUM
ahs-18395	79	130	-	-	SYM
ahs-18395	79	131	9	9	NUM
ahs-18395	79	132	9	9	NUM
ahs-18395	79	133	9	9	NUM
ahs-18395	79	134	9	9	NUM
ahs-18395	79	135	(	(	PUNCT
ahs-18395	79	136	z	z	NOUN
ahs-18395	79	137	)	)	PUNCT
ahs-18395	79	138	mode=	mode=	X
ahs-18395	79	139	the	the	DET
ahs-18395	79	140	most	most	ADV
ahs-18395	79	141	common	common	ADJ
ahs-18395	79	142	infection	infection	NOUN
ahs-18395	79	143	response	response	NOUN
ahs-18395	79	144	observed	observe	VERB
ahs-18395	79	145	on	on	ADP
ahs-18395	79	146	the	the	DET
ahs-18395	79	147	barley	barley	PROPN
ahs-18395	79	148	cv	cv	PROPN
ahs-18395	79	149	.	.	PROPN
ahs-18395	80	1	wi2291	wi2291	PROPN
ahs-18395	80	2	.	.	PUNCT
ahs-18395	81	1	(	(	PUNCT
ahs-18395	81	2	y	y	X
ahs-18395	81	3	)	)	PUNCT
ahs-18395	81	4	range=	range=	VERB
ahs-18395	81	5	the	the	DET
ahs-18395	81	6	lowest	low	ADJ
ahs-18395	81	7	and	and	CCONJ
ahs-18395	81	8	highest	high	ADJ
ahs-18395	81	9	infection	infection	NOUN
ahs-18395	81	10	responses	response	NOUN
ahs-18395	81	11	observed	observe	VERB
ahs-18395	81	12	on	on	ADP
ahs-18395	81	13	the	the	DET
ahs-18395	81	14	barley	barley	PROPN
ahs-18395	81	15	cv	cv	PROPN
ahs-18395	81	16	.	.	PROPN
ahs-18395	82	1	wi2291	wi2291	PROPN
ahs-18395	82	2	.	.	PUNCT
ahs-18395	83	1	fig	fig	NOUN
ahs-18395	83	2	.	.	PUNCT
ahs-18395	84	1	1	1	NUM
ahs-18395	84	2	number	number	NOUN
ahs-18395	84	3	of	of	ADP
ahs-18395	84	4	lesions	lesion	NOUN
ahs-18395	84	5	caused	cause	VERB
ahs-18395	84	6	by	by	ADP
ahs-18395	84	7	pt1	pt1	PROPN
ahs-18395	84	8	and	and	CCONJ
ahs-18395	84	9	pt4	pt4	PROPN
ahs-18395	84	10	isolates	isolate	NOUN
ahs-18395	84	11	after	after	ADP
ahs-18395	84	12	seven	seven	NUM
ahs-18395	84	13	serial	serial	ADJ
ahs-18395	84	14	transfers	transfer	NOUN
ahs-18395	84	15	barley	barley	PROPN
ahs-18395	84	16	cv	cv	PROPN
ahs-18395	84	17	.	.	PROPN
ahs-18395	85	1	wi2291	wi2291	PROPN
ahs-18395	85	2	.	.	PUNCT
ahs-18395	86	1	fig	fig	NOUN
ahs-18395	86	2	.	.	PUNCT
ahs-18395	87	1	2	2	NUM
ahs-18395	87	2	cultural	cultural	ADJ
ahs-18395	87	3	characterization	characterization	NOUN
ahs-18395	87	4	of	of	ADP
ahs-18395	87	5	two	two	NUM
ahs-18395	87	6	c.	c.	PROPN
ahs-18395	87	7	sativus	sativus	PROPN
ahs-18395	87	8	isolates	isolates	PROPN
ahs-18395	87	9	pt1	pt1	PROPN
ahs-18395	87	10	and	and	CCONJ
ahs-18395	87	11	pt4	pt4	PROPN
ahs-18395	87	12	after	after	ADP
ahs-18395	87	13	seven	seven	NUM
ahs-18395	87	14	passages	passage	NOUN
ahs-18395	87	15	on	on	ADP
ahs-18395	87	16	pda	pda	NOUN
ahs-18395	87	17	medium	medium	NOUN
ahs-18395	87	18	and	and	CCONJ
ahs-18395	87	19	through	through	ADP
ahs-18395	87	20	barley	barley	NOUN
ahs-18395	87	21	plants	plant	NOUN
ahs-18395	87	22	.	.	PUNCT
ahs-18395	88	1	fig	fig	NOUN
ahs-18395	88	2	.	.	PUNCT
ahs-18395	89	1	3	3	NUM
ahs-18395	89	2	agarose	agarose	NOUN
ahs-18395	89	3	gel	gel	NOUN
ahs-18395	89	4	electrophoresis	electrophoresis	NOUN
ahs-18395	89	5	of	of	ADP
ahs-18395	89	6	remap	remap	NOUN
ahs-18395	89	7	analysis	analysis	NOUN
ahs-18395	89	8	pt1	pt1	PROPN
ahs-18395	89	9	and	and	CCONJ
ahs-18395	89	10	pt4	pt4	PROPN
ahs-18395	89	11	parent	parent	NOUN
ahs-18395	89	12	isolates	isolate	NOUN
ahs-18395	89	13	after	after	ADP
ahs-18395	89	14	seven	seven	NUM
ahs-18395	89	15	passages	passage	NOUN
ahs-18395	89	16	through	through	ADP
ahs-18395	89	17	barley	barley	PROPN
ahs-18395	89	18	cv	cv	PROPN
ahs-18395	89	19	.	.	PROPN
ahs-18395	90	1	wi2291	wi2291	ADJ
ahs-18395	90	2	using	use	VERB
ahs-18395	90	3	primer	primer	NOUN
ahs-18395	90	4	;	;	PUNCT
ahs-18395	90	5	(	(	PUNCT
ahs-18395	90	6	ga)8t+gcatcaaaggcattggaggtg	ga)8t+gcatcaaaggcattggaggtg	NOUN
ahs-18395	90	7	.	.	PUNCT
ahs-18395	90	8	m	m	PROPN
ahs-18395	90	9	–	–	PUNCT
ahs-18395	90	10	marker	marker	NOUN
ahs-18395	90	11	ladder	ladder	NOUN
ahs-18395	90	12	1	1	NUM
ahs-18395	90	13	kb	kb	PROPN
ahs-18395	90	14	.	.	PUNCT
ahs-18395	91	1	122	122	NUM
ahs-18395	91	2	passages	passage	NOUN
ahs-18395	91	3	,	,	PUNCT
ahs-18395	91	4	in	in	ADP
ahs-18395	91	5	contrast	contrast	NOUN
ahs-18395	91	6	to	to	ADP
ahs-18395	91	7	the	the	DET
ahs-18395	91	8	lack	lack	NOUN
ahs-18395	91	9	of	of	ADP
ahs-18395	91	10	significant	significant	ADJ
ahs-18395	91	11	changes	change	NOUN
ahs-18395	91	12	in	in	ADP
ahs-18395	91	13	those	those	PRON
ahs-18395	91	14	obtained	obtain	VERB
ahs-18395	91	15	from	from	ADP
ahs-18395	91	16	the	the	DET
ahs-18395	91	17	weakly	weakly	ADJ
ahs-18395	91	18	aggressive	aggressive	ADJ
ahs-18395	91	19	isolate	isolate	PROPN
ahs-18395	91	20	pt1	pt1	PROPN
ahs-18395	91	21	.	.	PUNCT
ahs-18395	92	1	no	no	DET
ahs-18395	92	2	apparent	apparent	ADJ
ahs-18395	92	3	differences	difference	NOUN
ahs-18395	92	4	in	in	ADP
ahs-18395	92	5	phenotypes	phenotype	NOUN
ahs-18395	92	6	,	,	PUNCT
ahs-18395	92	7	including	include	VERB
ahs-18395	92	8	mycelial	mycelial	ADJ
ahs-18395	92	9	growth	growth	NOUN
ahs-18395	92	10	,	,	PUNCT
ahs-18395	92	11	conidiation	conidiation	NOUN
ahs-18395	92	12	and	and	CCONJ
ahs-18395	92	13	conidial	conidial	ADJ
ahs-18395	92	14	germination	germination	NOUN
ahs-18395	92	15	,	,	PUNCT
ahs-18395	92	16	were	be	AUX
ahs-18395	92	17	observed	observe	VERB
ahs-18395	92	18	among	among	ADP
ahs-18395	92	19	isolates	isolate	NOUN
ahs-18395	92	20	from	from	ADP
ahs-18395	92	21	the	the	DET
ahs-18395	92	22	same	same	ADJ
ahs-18395	92	23	parent	parent	NOUN
ahs-18395	92	24	isolate	isolate	NOUN
ahs-18395	92	25	on	on	ADP
ahs-18395	92	26	artificial	artificial	ADJ
ahs-18395	92	27	medium	medium	NOUN
ahs-18395	92	28	.	.	PUNCT
ahs-18395	93	1	all	all	DET
ahs-18395	93	2	single	single	ADJ
ahs-18395	93	3	-	-	PUNCT
ahs-18395	93	4	conidial	conidial	NOUN
ahs-18395	93	5	of	of	ADP
ahs-18395	93	6	the	the	DET
ahs-18395	93	7	parents	parent	NOUN
ahs-18395	93	8	and	and	CCONJ
ahs-18395	93	9	their	their	PRON
ahs-18395	93	10	generations	generation	NOUN
ahs-18395	93	11	were	be	AUX
ahs-18395	93	12	stable	stable	ADJ
ahs-18395	93	13	genotypically	genotypically	ADV
ahs-18395	93	14	during	during	ADP
ahs-18395	93	15	the	the	DET
ahs-18395	93	16	serial	serial	ADJ
ahs-18395	93	17	transfers	transfer	NOUN
ahs-18395	93	18	with	with	ADP
ahs-18395	93	19	a	a	DET
ahs-18395	93	20	change	change	NOUN
ahs-18395	93	21	in	in	ADP
ahs-18395	93	22	virulence	virulence	NOUN
ahs-18395	93	23	of	of	ADP
ahs-18395	93	24	the	the	DET
ahs-18395	93	25	aggressive	aggressive	ADJ
ahs-18395	93	26	isolate	isolate	NOUN
ahs-18395	93	27	generations	generation	NOUN
ahs-18395	93	28	.	.	PUNCT
ahs-18395	94	1	acknowledgements	acknowledgement	NOUN
ahs-18395	94	2	the	the	DET
ahs-18395	94	3	authors	author	NOUN
ahs-18395	94	4	thank	thank	VERB
ahs-18395	94	5	the	the	DET
ahs-18395	94	6	director	director	NOUN
ahs-18395	94	7	general	general	ADJ
ahs-18395	94	8	of	of	ADP
ahs-18395	94	9	aecs	aec	NOUN
ahs-18395	94	10	and	and	CCONJ
ahs-18395	94	11	the	the	DET
ahs-18395	94	12	head	head	NOUN
ahs-18395	94	13	of	of	ADP
ahs-18395	94	14	biotechnology	biotechnology	NOUN
ahs-18395	94	15	department	department	NOUN
ahs-18395	94	16	for	for	ADP
ahs-18395	94	17	their	their	PRON
ahs-18395	94	18	help	help	NOUN
ahs-18395	94	19	throughout	throughout	ADP
ahs-18395	94	20	the	the	DET
ahs-18395	94	21	period	period	NOUN
ahs-18395	94	22	of	of	ADP
ahs-18395	94	23	this	this	DET
ahs-18395	94	24	research	research	NOUN
ahs-18395	94	25	.	.	PUNCT
ahs-18395	95	1	references	reference	NOUN
ahs-18395	95	2	anonymous	anonymous	ADJ
ahs-18395	95	3	,	,	PUNCT
ahs-18395	95	4	1988	1988	NUM
ahs-18395	95	5	stat	stat	PROPN
ahs-18395	95	6	-	-	PUNCT
ahs-18395	95	7	itcf	itcf	NOUN
ahs-18395	95	8	,	,	PUNCT
ahs-18395	95	9	programme	programme	NOUN
ahs-18395	95	10	,	,	PUNCT
ahs-18395	95	11	microsta	microsta	PROPN
ahs-18395	95	12	,	,	PUNCT
ahs-18395	95	13	realized	realize	VERB
ahs-18395	95	14	by	by	ADP
ahs-18395	95	15	ecosoft	ecosoft	ADJ
ahs-18395	95	16	,	,	PUNCT
ahs-18395	95	17	2nd	2nd	PROPN
ahs-18395	95	18	ver	ver	PROPN
ahs-18395	95	19	.	.	PUNCT
ahs-18395	96	1	institut	institut	PROPN
ahs-18395	96	2	technique	technique	PROPN
ahs-18395	96	3	des	des	PROPN
ahs-18395	96	4	cereals	cereals	PROPN
ahs-18395	96	5	et	et	PROPN
ahs-18395	96	6	des	des	PROPN
ahs-18395	96	7	fourrages	fourrages	PROPN
ahs-18395	96	8	,	,	PUNCT
ahs-18395	96	9	paris	paris	PROPN
ahs-18395	96	10	,	,	PUNCT
ahs-18395	96	11	pp	pp	X
ahs-18395	96	12	.	.	PUNCT
ahs-18395	97	1	55	55	NUM
ahs-18395	97	2	.	.	PUNCT
ahs-18395	98	1	arabi	arabi	PROPN
ahs-18395	98	2	m.i.e	m.i.e	PROPN
ahs-18395	98	3	.	.	PROPN
ahs-18395	98	4	,	,	PUNCT
ahs-18395	98	5	2005	2005	NUM
ahs-18395	98	6	inheritance	inheritance	NOUN
ahs-18395	98	7	of	of	ADP
ahs-18395	98	8	partial	partial	ADJ
ahs-18395	98	9	resistance	resistance	NOUN
ahs-18395	98	10	to	to	ADP
ahs-18395	98	11	spot	spot	NOUN
ahs-18395	98	12	blotch	blotch	NOUN
ahs-18395	98	13	in	in	ADP
ahs-18395	98	14	barley	barley	NOUN
ahs-18395	98	15	.	.	PUNCT
ahs-18395	99	1	plant	plant	NOUN
ahs-18395	99	2	breeding	breeding	NOUN
ahs-18395	99	3	,	,	PUNCT
ahs-18395	99	4	124	124	NUM
ahs-18395	99	5	:	:	PUNCT
ahs-18395	99	6	605	605	NUM
ahs-18395	99	7	-	-	SYM
ahs-18395	99	8	607	607	NUM
ahs-18395	99	9	.	.	PUNCT
ahs-18395	100	1	arabi	arabi	PROPN
ahs-18395	100	2	m.i.e	m.i.e	PROPN
ahs-18395	100	3	.	.	PROPN
ahs-18395	100	4	,	,	PUNCT
ahs-18395	100	5	jawhar	jawhar	PROPN
ahs-18395	100	6	m.	m.	NOUN
ahs-18395	100	7	,	,	PUNCT
ahs-18395	100	8	2001	2001	NUM
ahs-18395	100	9	the	the	DET
ahs-18395	100	10	response	response	NOUN
ahs-18395	100	11	of	of	ADP
ahs-18395	100	12	cochliobolus	cochliobolus	PROPN
ahs-18395	100	13	sativus	sativus	PROPN
ahs-18395	100	14	to	to	ADP
ahs-18395	100	15	ultraviolet	ultraviolet	PROPN
ahs-18395	100	16	c	c	PROPN
ahs-18395	100	17	radiation	radiation	NOUN
ahs-18395	100	18	.	.	PUNCT
ahs-18395	101	1	journal	journal	NOUN
ahs-18395	101	2	of	of	ADP
ahs-18395	101	3	phytopathology	phytopathology	NOUN
ahs-18395	101	4	,	,	PUNCT
ahs-18395	101	5	149	149	NUM
ahs-18395	101	6	:	:	SYM
ahs-18395	101	7	521	521	NUM
ahs-18395	101	8	-	-	SYM
ahs-18395	101	9	525	525	NUM
ahs-18395	101	10	.	.	PUNCT
ahs-18395	102	1	arabi	arabi	PROPN
ahs-18395	102	2	m.i.e	m.i.e	PROPN
ahs-18395	102	3	.	.	PROPN
ahs-18395	102	4	,	,	PUNCT
ahs-18395	102	5	jawhar	jawhar	PROPN
ahs-18395	102	6	m.	m.	NOUN
ahs-18395	102	7	,	,	PUNCT
ahs-18395	102	8	2003	2003	NUM
ahs-18395	102	9	pathotypes	pathotype	NOUN
ahs-18395	102	10	of	of	ADP
ahs-18395	102	11	cochliobolus	cochliobolus	PROPN
ahs-18395	102	12	sativus	sativus	PROPN
ahs-18395	102	13	(	(	PUNCT
ahs-18395	102	14	spot	spot	NOUN
ahs-18395	102	15	blotch	blotch	NOUN
ahs-18395	102	16	)	)	PUNCT
ahs-18395	102	17	on	on	ADP
ahs-18395	102	18	barley	barley	NOUN
ahs-18395	102	19	in	in	ADP
ahs-18395	102	20	syria	syria	PROPN
ahs-18395	102	21	.	.	PUNCT
ahs-18395	103	1	journal	journal	PROPN
ahs-18395	103	2	of	of	ADP
ahs-18395	103	3	plant	plant	NOUN
ahs-18395	103	4	pathology	pathology	NOUN
ahs-18395	103	5	,	,	PUNCT
ahs-18395	103	6	85	85	NUM
ahs-18395	103	7	:	:	SYM
ahs-18395	103	8	193	193	NUM
ahs-18395	103	9	-	-	SYM
ahs-18395	103	10	196	196	NUM
ahs-18395	103	11	.	.	PUNCT
ahs-18395	104	1	arabi	arabi	PROPN
ahs-18395	104	2	m.i.e	m.i.e	PROPN
ahs-18395	104	3	.	.	PROPN
ahs-18395	104	4	,	,	PUNCT
ahs-18395	104	5	jawhar	jawhar	PROPN
ahs-18395	104	6	m.	m.	NOUN
ahs-18395	104	7	,	,	PUNCT
ahs-18395	104	8	2007	2007	NUM
ahs-18395	104	9	molecular	molecular	ADJ
ahs-18395	104	10	and	and	CCONJ
ahs-18395	104	11	pathogenic	pathogenic	ADJ
ahs-18395	104	12	variation	variation	NOUN
ahs-18395	104	13	identified	identify	VERB
ahs-18395	104	14	among	among	ADP
ahs-18395	104	15	isolates	isolate	NOUN
ahs-18395	104	16	of	of	ADP
ahs-18395	104	17	cochliobolus	cochliobolus	PROPN
ahs-18395	104	18	sativus	sativus	PROPN
ahs-18395	104	19	.	.	PUNCT
ahs-18395	105	1	australasian	australasian	ADJ
ahs-18395	105	2	plant	plant	NOUN
ahs-18395	105	3	pathology	pathology	NOUN
ahs-18395	105	4	,	,	PUNCT
ahs-18395	105	5	36	36	NUM
ahs-18395	105	6	:	:	SYM
ahs-18395	105	7	17	17	NUM
ahs-18395	105	8	-	-	SYM
ahs-18395	105	9	21	21	NUM
ahs-18395	105	10	.	.	PUNCT
ahs-18395	106	1	biswas	biswas	PROPN
ahs-18395	106	2	m.k	m.k	PROPN
ahs-18395	106	3	.	.	PROPN
ahs-18395	106	4	,	,	PUNCT
ahs-18395	106	5	xu	xu	PROPN
ahs-18395	106	6	q.	q.	PROPN
ahs-18395	106	7	,	,	PUNCT
ahs-18395	106	8	deng	deng	PROPN
ahs-18395	106	9	x.x	x.x	PROPN
ahs-18395	106	10	.	.	PROPN
ahs-18395	106	11	,	,	PUNCT
ahs-18395	106	12	2010	2010	NUM
ahs-18395	106	13	utility	utility	NOUN
ahs-18395	106	14	of	of	ADP
ahs-18395	106	15	rapd	rapd	NOUN
ahs-18395	106	16	,	,	PUNCT
ahs-18395	106	17	issr	issr	PROPN
ahs-18395	106	18	,	,	PUNCT
ahs-18395	106	19	irap	irap	NOUN
ahs-18395	106	20	and	and	CCONJ
ahs-18395	106	21	remap	remap	VERB
ahs-18395	106	22	markers	marker	NOUN
ahs-18395	106	23	for	for	ADP
ahs-18395	106	24	the	the	DET
ahs-18395	106	25	genetic	genetic	ADJ
ahs-18395	106	26	analysis	analysis	NOUN
ahs-18395	106	27	of	of	ADP
ahs-18395	106	28	citrus	citrus	PROPN
ahs-18395	106	29	spp	spp	PROPN
ahs-18395	106	30	.	.	PUNCT
ahs-18395	107	1	science	science	NOUN
ahs-18395	107	2	horticulture	horticulture	PROPN
ahs-18395	107	3	,	,	PUNCT
ahs-18395	107	4	124	124	NUM
ahs-18395	107	5	:	:	SYM
ahs-18395	107	6	254	254	NUM
ahs-18395	107	7	-	-	SYM
ahs-18395	107	8	261	261	NUM
ahs-18395	107	9	.	.	PUNCT
ahs-18395	108	1	briggs	briggs	PROPN
ahs-18395	108	2	s.p	s.p	PROPN
ahs-18395	108	3	.	.	PROPN
ahs-18395	108	4	,	,	PUNCT
ahs-18395	108	5	johal	johal	PROPN
ahs-18395	108	6	g.s	g.s	PROPN
ahs-18395	108	7	.	.	PROPN
ahs-18395	108	8	,	,	PUNCT
ahs-18395	108	9	1994	1994	NUM
ahs-18395	108	10	genetics	genetics	NOUN
ahs-18395	108	11	patterns	pattern	NOUN
ahs-18395	108	12	of	of	ADP
ahs-18395	108	13	plant	plant	NOUN
ahs-18395	108	14	host	host	NOUN
ahs-18395	108	15	-	-	PUNCT
ahs-18395	108	16	parasite	parasite	NOUN
ahs-18395	108	17	interactions	interaction	NOUN
ahs-18395	108	18	.	.	PUNCT
ahs-18395	109	1	trends	trend	NOUN
ahs-18395	109	2	in	in	ADP
ahs-18395	109	3	genetics	genetic	NOUN
ahs-18395	109	4	,	,	PUNCT
ahs-18395	109	5	10	10	NUM
ahs-18395	109	6	:	:	SYM
ahs-18395	109	7	12	12	NUM
ahs-18395	109	8	-	-	SYM
ahs-18395	109	9	16	16	NUM
ahs-18395	109	10	.	.	PUNCT
ahs-18395	110	1	chadha	chadha	PROPN
ahs-18395	110	2	s.	s.	PROPN
ahs-18395	110	3	,	,	PUNCT
ahs-18395	110	4	gopalakrishna	gopalakrishna	PROPN
ahs-18395	110	5	t.	t.	PROPN
ahs-18395	110	6	,	,	PUNCT
ahs-18395	110	7	2005	2005	NUM
ahs-18395	110	8	retrotransposonmicrosatellite	retrotransposonmicrosatellite	ADJ
ahs-18395	110	9	amplified	amplify	VERB
ahs-18395	110	10	polymorphism	polymorphism	NOUN
ahs-18395	110	11	(	(	PUNCT
ahs-18395	110	12	remap	remap	NOUN
ahs-18395	110	13	)	)	PUNCT
ahs-18395	110	14	markers	marker	NOUN
ahs-18395	110	15	for	for	ADP
ahs-18395	110	16	genetic	genetic	ADJ
ahs-18395	110	17	diversity	diversity	NOUN
ahs-18395	110	18	assessment	assessment	NOUN
ahs-18395	110	19	of	of	ADP
ahs-18395	110	20	the	the	DET
ahs-18395	110	21	rice	rice	NOUN
ahs-18395	110	22	blast	blast	NOUN
ahs-18395	110	23	pathogen	pathogen	NOUN
ahs-18395	110	24	(	(	PUNCT
ahs-18395	110	25	magnaporthe	magnaporthe	NOUN
ahs-18395	110	26	grisea	grisea	PROPN
ahs-18395	110	27	)	)	PUNCT
ahs-18395	110	28	.	.	PUNCT
ahs-18395	111	1	genome	genome	NOUN
ahs-18395	111	2	,	,	PUNCT
ahs-18395	111	3	48	48	NUM
ahs-18395	111	4	:	:	SYM
ahs-18395	111	5	943	943	NUM
ahs-18395	111	6	-	-	SYM
ahs-18395	111	7	945	945	NUM
ahs-18395	111	8	.	.	PUNCT
ahs-18395	111	9	fetch	fetch	VERB
ahs-18395	111	10	t.c	t.c	PROPN
ahs-18395	111	11	.	.	PROPN
ahs-18395	111	12	,	,	PUNCT
ahs-18395	111	13	steffenson	steffenson	NOUN
ahs-18395	111	14	b.j	b.j	PROPN
ahs-18395	111	15	.	.	PROPN
ahs-18395	111	16	,	,	PUNCT
ahs-18395	111	17	1999	1999	NUM
ahs-18395	111	18	rating	rating	NOUN
ahs-18395	111	19	scales	scale	NOUN
ahs-18395	111	20	for	for	ADP
ahs-18395	111	21	assessing	assess	VERB
ahs-18395	111	22	infection	infection	NOUN
ahs-18395	111	23	responses	response	NOUN
ahs-18395	111	24	of	of	ADP
ahs-18395	111	25	barley	barley	NOUN
ahs-18395	111	26	infected	infect	VERB
ahs-18395	111	27	with	with	ADP
ahs-18395	111	28	cochliobolus	cochliobolus	PROPN
ahs-18395	111	29	sativus	sativus	PROPN
ahs-18395	111	30	.	.	PUNCT
ahs-18395	111	31	plant	plant	NOUN
ahs-18395	111	32	disease	disease	NOUN
ahs-18395	111	33	,	,	PUNCT
ahs-18395	111	34	83	83	NUM
ahs-18395	111	35	:	:	SYM
ahs-18395	111	36	231	231	NUM
ahs-18395	111	37	-	-	SYM
ahs-18395	111	38	217	217	NUM
ahs-18395	111	39	.	.	PUNCT
ahs-18395	112	1	flor	flor	PROPN
ahs-18395	112	2	h.h	h.h	PROPN
ahs-18395	112	3	.	.	PROPN
ahs-18395	112	4	,	,	PUNCT
ahs-18395	112	5	1956	1956	NUM
ahs-18395	112	6	the	the	DET
ahs-18395	112	7	complementary	complementary	ADJ
ahs-18395	112	8	genetic	genetic	ADJ
ahs-18395	112	9	systems	system	NOUN
ahs-18395	112	10	in	in	ADP
ahs-18395	112	11	flax	flax	NOUN
ahs-18395	112	12	and	and	CCONJ
ahs-18395	112	13	flax	flax	PROPN
ahs-18395	112	14	rust	rust	NOUN
ahs-18395	112	15	.	.	PUNCT
ahs-18395	113	1	advances	advance	NOUN
ahs-18395	113	2	in	in	ADP
ahs-18395	113	3	genetics	genetic	NOUN
ahs-18395	113	4	,	,	PUNCT
ahs-18395	113	5	8	8	NUM
ahs-18395	113	6	:	:	SYM
ahs-18395	113	7	29	29	NUM
ahs-18395	113	8	-	-	SYM
ahs-18395	113	9	54	54	NUM
ahs-18395	113	10	.	.	PUNCT
ahs-18395	114	1	gilchrist	gilchrist	PROPN
ahs-18395	114	2	s.	s.	PROPN
ahs-18395	114	3	,	,	PUNCT
ahs-18395	114	4	vivar	vivar	PROPN
ahs-18395	114	5	f.l.h	f.l.h	PROPN
ahs-18395	114	6	.	.	PROPN
ahs-18395	114	7	,	,	PUNCT
ahs-18395	114	8	gonzalez	gonzalez	PROPN
ahs-18395	114	9	c.	c.	PROPN
ahs-18395	114	10	,	,	PUNCT
ahs-18395	114	11	velaquez	velaquez	PROPN
ahs-18395	114	12	c.	c.	PROPN
ahs-18395	114	13	,	,	PUNCT
ahs-18395	114	14	1995	1995	NUM
ahs-18395	114	15	selecting	select	VERB
ahs-18395	114	16	sources	source	NOUN
ahs-18395	114	17	of	of	ADP
ahs-18395	114	18	resistance	resistance	NOUN
ahs-18395	114	19	to	to	ADP
ahs-18395	114	20	cochliobolus	cochliobolus	PROPN
ahs-18395	114	21	sativus	sativus	PROPN
ahs-18395	114	22	under	under	ADP
ahs-18395	114	23	subtropical	subtropical	ADJ
ahs-18395	114	24	conditions	condition	NOUN
ahs-18395	114	25	and	and	CCONJ
ahs-18395	114	26	preliminary	preliminary	ADJ
ahs-18395	114	27	loss	loss	NOUN
ahs-18395	114	28	.	.	PUNCT
ahs-18395	115	1	rachis	rachis	NOUN
ahs-18395	115	2	,	,	PUNCT
ahs-18395	115	3	14	14	NUM
ahs-18395	115	4	:	:	SYM
ahs-18395	115	5	35	35	NUM
ahs-18395	115	6	-	-	SYM
ahs-18395	115	7	40	40	NUM
ahs-18395	115	8	.	.	PUNCT
ahs-18395	115	9	gontariu	gontariu	PROPN
ahs-18395	115	10	i.	i.	PROPN
ahs-18395	115	11	,	,	PUNCT
ahs-18395	115	12	enea	enea	PROPN
ahs-18395	115	13	i.c	i.c	PROPN
ahs-18395	115	14	.	.	PROPN
ahs-18395	115	15	,	,	PUNCT
ahs-18395	115	16	2012	2012	NUM
ahs-18395	115	17	studies	study	NOUN
ahs-18395	115	18	on	on	ADP
ahs-18395	115	19	the	the	DET
ahs-18395	115	20	efficiency	efficiency	NOUN
ahs-18395	115	21	of	of	ADP
ahs-18395	115	22	some	some	DET
ahs-18395	115	23	fungicide	fungicide	NOUN
ahs-18395	115	24	at	at	ADP
ahs-18395	115	25	two	two	NUM
ahs-18395	115	26	-	-	PUNCT
ahs-18395	115	27	row	row	NOUN
ahs-18395	115	28	spring	spring	NOUN
ahs-18395	115	29	barley	barley	NOUN
ahs-18395	115	30	for	for	ADP
ahs-18395	115	31	fighting	fight	VERB
ahs-18395	115	32	against	against	ADP
ahs-18395	115	33	spot	spot	NOUN
ahs-18395	115	34	blotch	blotch	NOUN
ahs-18395	115	35	(	(	PUNCT
ahs-18395	115	36	cochliobolus	cochliobolus	PROPN
ahs-18395	115	37	sativus	sativus	PROPN
ahs-18395	115	38	ito	ito	PROPN
ahs-18395	115	39	and	and	CCONJ
ahs-18395	115	40	kurib	kurib	PROPN
ahs-18395	115	41	)	)	PUNCT
ahs-18395	115	42	in	in	ADP
ahs-18395	115	43	the	the	DET
ahs-18395	115	44	north	north	NOUN
ahs-18395	115	45	-	-	PUNCT
ahs-18395	115	46	west	west	PROPN
ahs-18395	115	47	suceava	suceava	PROPN
ahs-18395	115	48	plateau	plateau	PROPN
ahs-18395	115	49	.	.	PUNCT
ahs-18395	116	1	agriculture	agriculture	PROPN
ahs-18395	116	2	journal	journal	PROPN
ahs-18395	116	3	,	,	PUNCT
ahs-18395	116	4	7	7	NUM
ahs-18395	116	5	:	:	SYM
ahs-18395	116	6	70	70	NUM
ahs-18395	116	7	-	-	SYM
ahs-18395	116	8	73	73	NUM
ahs-18395	116	9	.	.	PUNCT
ahs-18395	117	1	goodwin	goodwin	PROPN
ahs-18395	117	2	s.b	s.b	PROPN
ahs-18395	117	3	.	.	PROPN
ahs-18395	117	4	,	,	PUNCT
ahs-18395	117	5	sujkowski	sujkowski	PROPN
ahs-18395	117	6	l.s	l.s	PROPN
ahs-18395	117	7	.	.	PROPN
ahs-18395	117	8	,	,	PUNCT
ahs-18395	117	9	fry	fry	PROPN
ahs-18395	117	10	w.e	w.e	PROPN
ahs-18395	117	11	.	.	PROPN
ahs-18395	117	12	,	,	PUNCT
ahs-18395	117	13	1995	1995	NUM
ahs-18395	117	14	rapid	rapid	ADJ
ahs-18395	117	15	evolution	evolution	NOUN
ahs-18395	117	16	of	of	ADP
ahs-18395	117	17	pathogenicity	pathogenicity	NOUN
ahs-18395	117	18	within	within	ADP
ahs-18395	117	19	clonal	clonal	ADJ
ahs-18395	117	20	lineages	lineage	NOUN
ahs-18395	117	21	of	of	ADP
ahs-18395	117	22	the	the	DET
ahs-18395	117	23	potato	potato	NOUN
ahs-18395	117	24	late	late	ADJ
ahs-18395	117	25	blight	blight	NOUN
ahs-18395	117	26	disease	disease	NOUN
ahs-18395	117	27	fungus	fungus	PROPN
ahs-18395	117	28	.	.	PUNCT
ahs-18395	118	1	phytopathology	phytopathology	NOUN
ahs-18395	118	2	,	,	PUNCT
ahs-18395	118	3	85	85	NUM
ahs-18395	118	4	:	:	PUNCT
ahs-18395	118	5	669	669	NUM
ahs-18395	118	6	-	-	SYM
ahs-18395	118	7	676	676	NUM
ahs-18395	118	8	.	.	PUNCT
ahs-18395	119	1	jiménez	jiménez	PROPN
ahs-18395	119	2	-	-	PUNCT
ahs-18395	119	3	gasco	gasco	PROPN
ahs-18395	119	4	m.m	m.m	PROPN
ahs-18395	119	5	.	.	PROPN
ahs-18395	119	6	,	,	PUNCT
ahs-18395	119	7	milgroom	milgroom	VERB
ahs-18395	119	8	m.g	m.g	PROPN
ahs-18395	119	9	.	.	PROPN
ahs-18395	119	10	,	,	PUNCT
ahs-18395	119	11	jiménez	jiménez	PROPN
ahs-18395	119	12	-	-	PUNCT
ahs-18395	119	13	diaz	diaz	PROPN
ahs-18395	119	14	r.m	r.m	PROPN
ahs-18395	119	15	.	.	PROPN
ahs-18395	119	16	,	,	PUNCT
ahs-18395	119	17	2004	2004	NUM
ahs-18395	119	18	stepwise	stepwise	NOUN
ahs-18395	119	19	evolution	evolution	NOUN
ahs-18395	119	20	of	of	ADP
ahs-18395	119	21	races	race	NOUN
ahs-18395	119	22	in	in	ADP
ahs-18395	119	23	fusarium	fusarium	NOUN
ahs-18395	119	24	oxysporum	oxysporum	PROPN
ahs-18395	119	25	f.	f.	PROPN
ahs-18395	119	26	sp	sp	PROPN
ahs-18395	119	27	.	.	PROPN
ahs-18395	119	28	ciceris	ciceris	PROPN
ahs-18395	119	29	inferred	infer	VERB
ahs-18395	119	30	from	from	ADP
ahs-18395	119	31	fingerprinting	fingerprint	VERB
ahs-18395	119	32	with	with	ADP
ahs-18395	119	33	repetitive	repetitive	ADJ
ahs-18395	119	34	dna	dna	PROPN
ahs-18395	119	35	sequences	sequence	NOUN
ahs-18395	119	36	.	.	PUNCT
ahs-18395	120	1	phytopathology	phytopathology	NOUN
ahs-18395	120	2	,	,	PUNCT
ahs-18395	120	3	94	94	NUM
ahs-18395	120	4	:	:	PUNCT
ahs-18395	120	5	228	228	NUM
ahs-18395	120	6	-	-	SYM
ahs-18395	120	7	235	235	NUM
ahs-18395	120	8	.	.	PUNCT
ahs-18395	120	9	kalendar	kalendar	PROPN
ahs-18395	120	10	r.	r.	PROPN
ahs-18395	120	11	,	,	PUNCT
ahs-18395	120	12	grob	grob	PROPN
ahs-18395	120	13	t.	t.	PROPN
ahs-18395	120	14	,	,	PUNCT
ahs-18395	120	15	regina	regina	PROPN
ahs-18395	120	16	m.	m.	PROPN
ahs-18395	120	17	,	,	PUNCT
ahs-18395	120	18	suoniem	suoniem	PROPN
ahs-18395	120	19	a.	a.	PROPN
ahs-18395	120	20	,	,	PUNCT
ahs-18395	120	21	schulman	schulman	PROPN
ahs-18395	120	22	a.	a.	PROPN
ahs-18395	120	23	,	,	PUNCT
ahs-18395	120	24	1999	1999	NUM
ahs-18395	120	25	irap	irap	NOUN
ahs-18395	120	26	and	and	CCONJ
ahs-18395	120	27	remap	remap	NOUN
ahs-18395	120	28	:	:	PUNCT
ahs-18395	120	29	two	two	NUM
ahs-18395	120	30	new	new	ADJ
ahs-18395	120	31	retrotransposon	retrotransposon	NOUN
ahs-18395	120	32	-	-	PUNCT
ahs-18395	120	33	based	base	VERB
ahs-18395	120	34	dna	dna	NOUN
ahs-18395	120	35	fingerprinting	fingerprint	VERB
ahs-18395	120	36	techniques	technique	NOUN
ahs-18395	120	37	.	.	PUNCT
ahs-18395	121	1	theoretical	theoretical	ADJ
ahs-18395	121	2	and	and	CCONJ
ahs-18395	121	3	applied	apply	VERB
ahs-18395	121	4	genetics	genetic	NOUN
ahs-18395	121	5	,	,	PUNCT
ahs-18395	121	6	98	98	NUM
ahs-18395	121	7	:	:	PUNCT
ahs-18395	121	8	704	704	NUM
ahs-18395	121	9	-	-	SYM
ahs-18395	121	10	711	711	NUM
ahs-18395	121	11	.	.	PUNCT
ahs-18395	122	1	kumar	kumar	PROPN
ahs-18395	122	2	j.	j.	PROPN
ahs-18395	122	3	,	,	PUNCT
ahs-18395	122	4	schafer	schafer	PROPN
ahs-18395	122	5	p.r	p.r	PROPN
ahs-18395	122	6	.	.	PROPN
ahs-18395	122	7	,	,	PUNCT
ahs-18395	122	8	langen	langen	PROPN
ahs-18395	122	9	g.	g.	PROPN
ahs-18395	122	10	,	,	PUNCT
ahs-18395	122	11	baltruschat	baltruschat	PROPN
ahs-18395	122	12	h.	h.	PROPN
ahs-18395	122	13	,	,	PUNCT
ahs-18395	122	14	stein	stein	PROPN
ahs-18395	122	15	e.	e.	PROPN
ahs-18395	122	16	,	,	PUNCT
ahs-18395	122	17	nagarajan	nagarajan	PROPN
ahs-18395	122	18	s.	s.	PROPN
ahs-18395	122	19	,	,	PUNCT
ahs-18395	122	20	kogel	kogel	PROPN
ahs-18395	122	21	h.k	h.k	PROPN
ahs-18395	122	22	.	.	PROPN
ahs-18395	122	23	,	,	PUNCT
ahs-18395	122	24	2002	2002	NUM
ahs-18395	122	25	bipolaris	bipolaris	PROPN
ahs-18395	122	26	sorokiniana	sorokiniana	PROPN
ahs-18395	122	27	,	,	PUNCT
ahs-18395	122	28	a	a	DET
ahs-18395	122	29	cereal	cereal	NOUN
ahs-18395	122	30	pathogen	pathogen	NOUN
ahs-18395	122	31	of	of	ADP
ahs-18395	122	32	global	global	ADJ
ahs-18395	122	33	concern	concern	NOUN
ahs-18395	122	34	:	:	PUNCT
ahs-18395	122	35	cytological	cytological	ADJ
ahs-18395	122	36	and	and	CCONJ
ahs-18395	122	37	molecular	molecular	ADJ
ahs-18395	122	38	approaches	approach	NOUN
ahs-18395	122	39	towards	towards	ADP
ahs-18395	122	40	better	well	ADJ
ahs-18395	122	41	control	control	NOUN
ahs-18395	122	42	.	.	PUNCT
ahs-18395	123	1	molecular	molecular	ADJ
ahs-18395	123	2	of	of	ADP
ahs-18395	123	3	plant	plant	NOUN
ahs-18395	123	4	pathology	pathology	NOUN
ahs-18395	123	5	,	,	PUNCT
ahs-18395	123	6	3	3	NUM
ahs-18395	123	7	:	:	SYM
ahs-18395	123	8	185	185	NUM
ahs-18395	123	9	-	-	SYM
ahs-18395	123	10	195	195	NUM
ahs-18395	123	11	.	.	PUNCT
ahs-18395	124	1	latterell	latterell	PROPN
ahs-18395	124	2	f.m	f.m	PROPN
ahs-18395	124	3	.	.	PROPN
ahs-18395	124	4	,	,	PUNCT
ahs-18395	124	5	rossi	rossi	PROPN
ahs-18395	124	6	a.e	a.e	PROPN
ahs-18395	124	7	.	.	PROPN
ahs-18395	124	8	,	,	PUNCT
ahs-18395	124	9	1986	1986	NUM
ahs-18395	124	10	logevity	logevity	NOUN
ahs-18395	124	11	and	and	CCONJ
ahs-18395	124	12	pathogenic	pathogenic	ADJ
ahs-18395	124	13	stability	stability	NOUN
ahs-18395	124	14	of	of	ADP
ahs-18395	124	15	pyricularia	pyricularia	PROPN
ahs-18395	124	16	oryzae	oryzae	PROPN
ahs-18395	124	17	.	.	PUNCT
ahs-18395	125	1	phytopathology	phytopathology	NOUN
ahs-18395	125	2	,	,	PUNCT
ahs-18395	125	3	76	76	NUM
ahs-18395	125	4	:	:	SYM
ahs-18395	125	5	231	231	NUM
ahs-18395	125	6	-	-	SYM
ahs-18395	125	7	235	235	NUM
ahs-18395	125	8	.	.	PUNCT
ahs-18395	126	1	leach	leach	NOUN
ahs-18395	126	2	j.	j.	PROPN
ahs-18395	126	3	,	,	PUNCT
ahs-18395	126	4	finkelstein	finkelstein	PROPN
ahs-18395	126	5	d.b	d.b	PROPN
ahs-18395	126	6	.	.	PROPN
ahs-18395	126	7	,	,	PUNCT
ahs-18395	126	8	rambosek	rambosek	PROPN
ahs-18395	126	9	j.a	j.a	PROPN
ahs-18395	126	10	.	.	PROPN
ahs-18395	126	11	,	,	PUNCT
ahs-18395	126	12	1986	1986	NUM
ahs-18395	126	13	rapid	rapid	ADJ
ahs-18395	126	14	miniprep	miniprep	NOUN
ahs-18395	126	15	of	of	ADP
ahs-18395	126	16	dna	dna	PROPN
ahs-18395	126	17	from	from	ADP
ahs-18395	126	18	filamentous	filamentous	ADJ
ahs-18395	126	19	fungi	fungus	NOUN
ahs-18395	126	20	.	.	PUNCT
ahs-18395	127	1	fungal	fungal	ADJ
ahs-18395	127	2	genetics	genetic	NOUN
ahs-18395	127	3	newsletter	newsletter	NOUN
ahs-18395	127	4	,	,	PUNCT
ahs-18395	127	5	33	33	NUM
ahs-18395	127	6	:	:	SYM
ahs-18395	127	7	32	32	NUM
ahs-18395	127	8	-	-	SYM
ahs-18395	127	9	33	33	NUM
ahs-18395	127	10	.	.	PUNCT
ahs-18395	128	1	mathre	mathre	PROPN
ahs-18395	128	2	d.	d.	PROPN
ahs-18395	128	3	,	,	PUNCT
ahs-18395	128	4	1990	1990	NUM
ahs-18395	128	5	compendium	compendium	NOUN
ahs-18395	128	6	of	of	ADP
ahs-18395	128	7	barley	barley	NOUN
ahs-18395	128	8	diseases	disease	NOUN
ahs-18395	128	9	.	.	PUNCT
ahs-18395	129	1	aps	aps	PROPN
ahs-18395	129	2	press	press	PROPN
ahs-18395	129	3	,	,	PUNCT
ahs-18395	129	4	st	st	PROPN
ahs-18395	129	5	.	.	PROPN
ahs-18395	129	6	paul	paul	PROPN
ahs-18395	129	7	,	,	PUNCT
ahs-18395	129	8	mn	mn	PROPN
ahs-18395	129	9	,	,	PUNCT
ahs-18395	129	10	usa	usa	PROPN
ahs-18395	129	11	,	,	PUNCT
ahs-18395	129	12	2nd	2nd	PROPN
ahs-18395	129	13	edition	edition	NOUN
ahs-18395	129	14	,	,	PUNCT
ahs-18395	129	15	pp	pp	PROPN
ahs-18395	129	16	.	.	PUNCT
ahs-18395	130	1	90	90	NUM
ahs-18395	130	2	.	.	PUNCT
ahs-18395	130	3	olbe	olbe	NOUN
ahs-18395	130	4	m.	m.	NOUN
ahs-18395	130	5	,	,	PUNCT
ahs-18395	130	6	smmarin	smmarin	NOUN
ahs-18395	130	7	m.	m.	NOUN
ahs-18395	130	8	,	,	PUNCT
ahs-18395	130	9	gustafsson	gustafsson	PROPN
ahs-18395	130	10	m.	m.	PROPN
ahs-18395	130	11	,	,	PUNCT
ahs-18395	130	12	lundborg	lundborg	ADJ
ahs-18395	130	13	,	,	PUNCT
ahs-18395	130	14	t.	t.	PROPN
ahs-18395	130	15	,	,	PUNCT
ahs-18395	130	16	1995	1995	NUM
ahs-18395	130	17	effect	effect	NOUN
ahs-18395	130	18	of	of	ADP
ahs-18395	130	19	the	the	DET
ahs-18395	130	20	fungal	fungal	ADJ
ahs-18395	130	21	pathogen	pathogen	NOUN
ahs-18395	130	22	bipolaris	bipolaris	PROPN
ahs-18395	130	23	sorokiniana	sorokiniana	PROPN
ahs-18395	130	24	toxin	toxin	PROPN
ahs-18395	130	25	pre	pre	NOUN
ahs-18395	130	26	-	-	NOUN
ahs-18395	130	27	heminthosporol	heminthosporol	NOUN
ahs-18395	130	28	on	on	ADP
ahs-18395	130	29	barley	barley	NOUN
ahs-18395	130	30	root	root	NOUN
ahs-18395	130	31	plasma	plasma	NOUN
ahs-18395	130	32	membrane	membrane	NOUN
ahs-18395	130	33	vesicles	vesicle	NOUN
ahs-18395	130	34	.	.	PUNCT
ahs-18395	131	1	plant	plant	NOUN
ahs-18395	131	2	pathology	pathology	NOUN
ahs-18395	131	3	,	,	PUNCT
ahs-18395	131	4	44	44	NUM
ahs-18395	131	5	:	:	SYM
ahs-18395	131	6	625	625	NUM
ahs-18395	131	7	-	-	SYM
ahs-18395	131	8	635	635	NUM
ahs-18395	131	9	.	.	PUNCT
ahs-18395	132	1	park	park	PROPN
ahs-18395	132	2	s.y	s.y	PROPN
ahs-18395	132	3	.	.	PROPN
ahs-18395	132	4	,	,	PUNCT
ahs-18395	132	5	chi	chi	PROPN
ahs-18395	132	6	h.m	h.m	PROPN
ahs-18395	132	7	.	.	PROPN
ahs-18395	132	8	,	,	PUNCT
ahs-18395	132	9	milgroom	milgroom	VERB
ahs-18395	132	10	m.c	m.c	PROPN
ahs-18395	132	11	.	.	PROPN
ahs-18395	132	12	,	,	PUNCT
ahs-18395	132	13	kim	kim	PROPN
ahs-18395	132	14	h.	h.	PROPN
ahs-18395	132	15	,	,	PUNCT
ahs-18395	132	16	han	han	PROPN
ahs-18395	132	17	s.	s.	PROPN
ahs-18395	132	18	,	,	PUNCT
ahs-18395	132	19	skang	skang	PROPN
ahs-18395	132	20	s.	s.	PROPN
ahs-18395	132	21	,	,	PUNCT
ahs-18395	132	22	le	le	PROPN
ahs-18395	132	23	y.h	y.h	PROPN
ahs-18395	132	24	.	.	PROPN
ahs-18395	132	25	,	,	PUNCT
ahs-18395	132	26	2010	2010	NUM
ahs-18395	132	27	genetic	genetic	ADJ
ahs-18395	132	28	stability	stability	NOUN
ahs-18395	132	29	of	of	ADP
ahs-18395	132	30	magnaporthe	magnaporthe	PROPN
ahs-18395	132	31	oryzae	oryzae	NOUN
ahs-18395	132	32	during	during	ADP
ahs-18395	132	33	successive	successive	ADJ
ahs-18395	132	34	passages	passage	NOUN
ahs-18395	132	35	through	through	ADP
ahs-18395	132	36	rice	rice	NOUN
ahs-18395	132	37	plants	plant	NOUN
ahs-18395	132	38	and	and	CCONJ
ahs-18395	132	39	on	on	ADP
ahs-18395	132	40	artificial	artificial	ADJ
ahs-18395	132	41	medium	medium	NOUN
ahs-18395	132	42	.	.	PUNCT
ahs-18395	133	1	the	the	DET
ahs-18395	133	2	plant	plant	NOUN
ahs-18395	133	3	pathology	pathology	NOUN
ahs-18395	133	4	journal	journal	NOUN
ahs-18395	133	5	,	,	PUNCT
ahs-18395	133	6	26	26	NUM
ahs-18395	133	7	:	:	SYM
ahs-18395	133	8	313	313	NUM
ahs-18395	133	9	-	-	SYM
ahs-18395	133	10	320	320	NUM
ahs-18395	133	11	.	.	PUNCT
ahs-18395	133	12	poudyal	poudyal	PROPN
ahs-18395	133	13	s.d	s.d	PROPN
ahs-18395	133	14	.	.	PROPN
ahs-18395	133	15	,	,	PUNCT
ahs-18395	133	16	duveiller	duveiller	PROPN
ahs-18395	133	17	e.	e.	PROPN
ahs-18395	133	18	,	,	PUNCT
ahs-18395	133	19	sharma	sharma	PROPN
ahs-18395	133	20	r.c	r.c	PROPN
ahs-18395	133	21	.	.	PROPN
ahs-18395	133	22	,	,	PUNCT
ahs-18395	133	23	2005	2005	NUM
ahs-18395	133	24	effects	effect	NOUN
ahs-18395	133	25	of	of	ADP
ahs-18395	133	26	seed	seed	NOUN
ahs-18395	133	27	treatment	treatment	NOUN
ahs-18395	133	28	and	and	CCONJ
ahs-18395	133	29	foliar	foliar	ADJ
ahs-18395	133	30	fungicides	fungicide	NOUN
ahs-18395	133	31	on	on	ADP
ahs-18395	133	32	helminthosporium	helminthosporium	ADJ
ahs-18395	133	33	leaf	leaf	NOUN
ahs-18395	133	34	blight	blight	NOUN
ahs-18395	133	35	and	and	CCONJ
ahs-18395	133	36	performance	performance	NOUN
ahs-18395	133	37	of	of	ADP
ahs-18395	133	38	wheat	wheat	NOUN
ahs-18395	133	39	in	in	ADP
ahs-18395	133	40	warmer	warm	ADJ
ahs-18395	133	41	growing	grow	VERB
ahs-18395	133	42	conditions	condition	NOUN
ahs-18395	133	43	.	.	PUNCT
ahs-18395	134	1	journal	journal	NOUN
ahs-18395	134	2	of	of	ADP
ahs-18395	134	3	phytopathology	phytopathology	NOUN
ahs-18395	134	4	,	,	PUNCT
ahs-18395	134	5	153	153	NUM
ahs-18395	134	6	:	:	SYM
ahs-18395	134	7	401	401	NUM
ahs-18395	134	8	-	-	SYM
ahs-18395	134	9	408	408	NUM
ahs-18395	134	10	.	.	PUNCT
ahs-18395	135	1	steffenson	steffenson	PROPN
ahs-18395	135	2	b.j	b.j	PROPN
ahs-18395	135	3	.	.	PROPN
ahs-18395	135	4	,	,	PUNCT
ahs-18395	135	5	hayes	hayes	PROPN
ahs-18395	135	6	p.m.	p.m.	PROPN
ahs-18395	135	7	,	,	PUNCT
ahs-18395	135	8	kleinhofs	kleinhofs	PROPN
ahs-18395	135	9	a.	a.	NOUN
ahs-18395	135	10	,	,	PUNCT
ahs-18395	135	11	1996	1996	NUM
ahs-18395	135	12	genetics	genetic	NOUN
ahs-18395	135	13	of	of	ADP
ahs-18395	135	14	seeding	seeding	NOUN
ahs-18395	135	15	and	and	CCONJ
ahs-18395	135	16	adult	adult	NOUN
ahs-18395	135	17	plant	plant	NOUN
ahs-18395	135	18	resistance	resistance	NOUN
ahs-18395	135	19	to	to	ADP
ahs-18395	135	20	net	net	ADJ
ahs-18395	135	21	blotch	blotch	NOUN
ahs-18395	135	22	(	(	PUNCT
ahs-18395	135	23	pyrenophora	pyrenophora	NOUN
ahs-18395	135	24	teres	tere	NOUN
ahs-18395	135	25	f.	f.	PROPN
ahs-18395	135	26	teres	teres	PROPN
ahs-18395	135	27	)	)	PUNCT
ahs-18395	135	28	and	and	CCONJ
ahs-18395	135	29	spot	spot	NOUN
ahs-18395	135	30	blotch	blotch	NOUN
ahs-18395	135	31	(	(	PUNCT
ahs-18395	135	32	cochliobolus	cochliobolus	PROPN
ahs-18395	135	33	sativus	sativus	PROPN
ahs-18395	135	34	)	)	PUNCT
ahs-18395	135	35	in	in	ADP
ahs-18395	135	36	barley	barley	NOUN
ahs-18395	135	37	.	.	PUNCT
ahs-18395	136	1	theoretical	theoretical	ADJ
ahs-18395	136	2	of	of	ADP
ahs-18395	136	3	applied	applied	ADJ
ahs-18395	136	4	genetics	genetic	NOUN
ahs-18395	136	5	,	,	PUNCT
ahs-18395	136	6	92	92	NUM
ahs-18395	136	7	:	:	SYM
ahs-18395	136	8	552	552	NUM
ahs-18395	136	9	-	-	SYM
ahs-18395	136	10	558	558	NUM
ahs-18395	136	11	.	.	PUNCT
ahs-18395	137	1	zadoks	zadoks	PROPN
ahs-18395	137	2	j.c	j.c	PROPN
ahs-18395	137	3	.	.	PROPN
ahs-18395	137	4	,	,	PUNCT
ahs-18395	137	5	chang	chang	PROPN
ahs-18395	137	6	t.t	t.t	PROPN
ahs-18395	137	7	.	.	PROPN
ahs-18395	137	8	,	,	PUNCT
ahs-18395	137	9	konzak	konzak	PROPN
ahs-18395	137	10	c.f	c.f	PROPN
ahs-18395	137	11	.	.	PROPN
ahs-18395	137	12	,	,	PUNCT
ahs-18395	137	13	1974	1974	NUM
ahs-18395	137	14	a	a	DET
ahs-18395	137	15	decimal	decimal	ADJ
ahs-18395	137	16	code	code	NOUN
ahs-18395	137	17	for	for	ADP
ahs-18395	137	18	the	the	DET
ahs-18395	137	19	growth	growth	NOUN
ahs-18395	137	20	stages	stage	NOUN
ahs-18395	137	21	of	of	ADP
ahs-18395	137	22	cereals	cereal	NOUN
ahs-18395	137	23	.	.	PUNCT
ahs-18395	138	1	weed	weed	NOUN
ahs-18395	138	2	research	research	NOUN
ahs-18395	138	3	,	,	PUNCT
ahs-18395	138	4	14	14	NUM
ahs-18395	138	5	:	:	SYM
ahs-18395	138	6	415	415	NUM
ahs-18395	138	7	-	-	SYM
ahs-18395	138	8	421	421	NUM
ahs-18395	138	9	.	.	PUNCT
ahs-18395	139	1	zhou	zhou	PROPN
ahs-18395	139	2	h.	h.	PROPN
ahs-18395	139	3	,	,	PUNCT
ahs-18395	139	4	steffenson	steffenson	PROPN
ahs-18395	139	5	b.	b.	PROPN
ahs-18395	139	6	,	,	PUNCT
ahs-18395	139	7	2013	2013	NUM
ahs-18395	139	8	genome	genome	NOUN
ahs-18395	139	9	-	-	PUNCT
ahs-18395	139	10	wide	wide	ADJ
ahs-18395	139	11	association	association	NOUN
ahs-18395	139	12	mapping	mapping	NOUN
ahs-18395	139	13	reveals	reveal	VERB
ahs-18395	139	14	genetic	genetic	ADJ
ahs-18395	139	15	architecture	architecture	NOUN
ahs-18395	139	16	of	of	ADP
ahs-18395	139	17	durable	durable	ADJ
ahs-18395	139	18	spot	spot	NOUN
ahs-18395	139	19	blotch	blotch	NOUN
ahs-18395	139	20	resistance	resistance	NOUN
ahs-18395	139	21	in	in	ADP
ahs-18395	139	22	us	us	PROPN
ahs-18395	139	23	barley	barley	NOUN
ahs-18395	139	24	breeding	breeding	NOUN
ahs-18395	139	25	germplasm	germplasm	NOUN
ahs-18395	139	26	.	.	PUNCT
ahs-18395	140	1	molecular	molecular	ADJ
ahs-18395	140	2	breeding	breeding	NOUN
ahs-18395	140	3	,	,	PUNCT
ahs-18395	140	4	32	32	NUM
ahs-18395	140	5	:	:	SYM
ahs-18395	140	6	139	139	NUM
ahs-18395	140	7	-	-	SYM
ahs-18395	140	8	154	154	NUM
ahs-18395	140	9	.	.	PUNCT