id	sid	tid	token	lemma	pos
ahs-18399	1	1	133	133	NUM
ahs-18399	1	2	1	1	NUM
ahs-18399	1	3	.	.	PUNCT
ahs-18399	2	1	introduction	introduction	NOUN
ahs-18399	2	2	plants	plant	NOUN
ahs-18399	2	3	are	be	AUX
ahs-18399	2	4	naturally	naturally	ADV
ahs-18399	2	5	exposed	expose	VERB
ahs-18399	2	6	to	to	ADP
ahs-18399	2	7	ultraviolet	ultraviolet	NOUN
ahs-18399	2	8	(	(	PUNCT
ahs-18399	2	9	uv	uv	NOUN
ahs-18399	2	10	)	)	PUNCT
ahs-18399	2	11	rays	ray	NOUN
ahs-18399	2	12	mostly	mostly	ADV
ahs-18399	2	13	at	at	ADP
ahs-18399	2	14	uv	uv	NOUN
ahs-18399	2	15	-	-	PUNCT
ahs-18399	2	16	a	a	DET
ahs-18399	2	17	range	range	NOUN
ahs-18399	2	18	(	(	PUNCT
ahs-18399	2	19	wave	wave	NOUN
ahs-18399	2	20	length	length	NOUN
ahs-18399	2	21	,	,	PUNCT
ahs-18399	2	22	320	320	NUM
ahs-18399	2	23	-	-	SYM
ahs-18399	2	24	400	400	NUM
ahs-18399	2	25	nm	nm	NOUN
ahs-18399	2	26	)	)	PUNCT
ahs-18399	2	27	,	,	PUNCT
ahs-18399	2	28	especially	especially	ADV
ahs-18399	2	29	on	on	ADP
ahs-18399	2	30	sunny	sunny	ADJ
ahs-18399	2	31	days	day	NOUN
ahs-18399	2	32	in	in	ADP
ahs-18399	2	33	summer	summer	NOUN
ahs-18399	2	34	.	.	PUNCT
ahs-18399	3	1	in	in	ADP
ahs-18399	3	2	contrast	contrast	NOUN
ahs-18399	3	3	,	,	PUNCT
ahs-18399	3	4	the	the	DET
ahs-18399	3	5	level	level	NOUN
ahs-18399	3	6	of	of	ADP
ahs-18399	3	7	harmful	harmful	ADJ
ahs-18399	3	8	uv	uv	NOUN
ahs-18399	3	9	-	-	PUNCT
ahs-18399	3	10	c	c	NOUN
ahs-18399	3	11	(	(	PUNCT
ahs-18399	3	12	wave	wave	NOUN
ahs-18399	3	13	length	length	NOUN
ahs-18399	3	14	>	>	PUNCT
ahs-18399	3	15	220	220	NUM
ahs-18399	3	16	nm	nm	NOUN
ahs-18399	3	17	)	)	PUNCT
ahs-18399	3	18	and	and	CCONJ
ahs-18399	3	19	uv	uv	NOUN
ahs-18399	3	20	-	-	PUNCT
ahs-18399	3	21	b	b	NOUN
ahs-18399	3	22	(	(	PUNCT
ahs-18399	3	23	wave	wave	NOUN
ahs-18399	3	24	length	length	NOUN
ahs-18399	3	25	,	,	PUNCT
ahs-18399	3	26	280	280	NUM
ahs-18399	3	27	-	-	SYM
ahs-18399	3	28	320	320	NUM
ahs-18399	3	29	nm	nm	NOUN
ahs-18399	3	30	)	)	PUNCT
ahs-18399	3	31	reaching	reach	VERB
ahs-18399	3	32	the	the	DET
ahs-18399	3	33	ground	ground	NOUN
ahs-18399	3	34	surface	surface	NOUN
ahs-18399	3	35	which	which	PRON
ahs-18399	3	36	potentially	potentially	ADV
ahs-18399	3	37	damages	damage	VERB
ahs-18399	3	38	living	living	NOUN
ahs-18399	3	39	organisms	organism	NOUN
ahs-18399	3	40	including	include	VERB
ahs-18399	3	41	plants	plant	NOUN
ahs-18399	3	42	could	could	AUX
ahs-18399	3	43	be	be	AUX
ahs-18399	3	44	effectively	effectively	ADV
ahs-18399	3	45	blocked	block	VERB
ahs-18399	3	46	and	and	CCONJ
ahs-18399	3	47	minimized	minimize	VERB
ahs-18399	3	48	by	by	ADP
ahs-18399	3	49	the	the	DET
ahs-18399	3	50	presence	presence	NOUN
ahs-18399	3	51	of	of	ADP
ahs-18399	3	52	ozone	ozone	NOUN
ahs-18399	3	53	layer	layer	NOUN
ahs-18399	3	54	above	above	ADP
ahs-18399	3	55	the	the	DET
ahs-18399	3	56	stratosphere	stratosphere	NOUN
ahs-18399	3	57	(	(	PUNCT
ahs-18399	3	58	staehelin	staehelin	NOUN
ahs-18399	3	59	et	et	PROPN
ahs-18399	3	60	al	al	PROPN
ahs-18399	3	61	.	.	PROPN
ahs-18399	3	62	,	,	PUNCT
ahs-18399	3	63	2001	2001	NUM
ahs-18399	3	64	)	)	PUNCT
ahs-18399	3	65	.	.	PUNCT
ahs-18399	4	1	however	however	ADV
ahs-18399	4	2	,	,	PUNCT
ahs-18399	4	3	especially	especially	ADV
ahs-18399	4	4	in	in	ADP
ahs-18399	4	5	the	the	DET
ahs-18399	4	6	southern	southern	ADJ
ahs-18399	4	7	hemisphere	hemisphere	NOUN
ahs-18399	4	8	,	,	PUNCT
ahs-18399	4	9	the	the	DET
ahs-18399	4	10	area	area	NOUN
ahs-18399	4	11	of	of	ADP
ahs-18399	4	12	seasonal	seasonal	ADJ
ahs-18399	4	13	depletion	depletion	NOUN
ahs-18399	4	14	of	of	ADP
ahs-18399	4	15	the	the	DET
ahs-18399	4	16	ozone	ozone	NOUN
ahs-18399	4	17	layer	layer	NOUN
ahs-18399	4	18	often	often	ADV
ahs-18399	4	19	expands	expand	VERB
ahs-18399	4	20	outside	outside	ADP
ahs-18399	4	21	the	the	DET
ahs-18399	4	22	antarctic	antarctic	ADJ
ahs-18399	4	23	region	region	NOUN
ahs-18399	4	24	,	,	PUNCT
ahs-18399	4	25	occasionally	occasionally	ADV
ahs-18399	4	26	allowing	allow	VERB
ahs-18399	4	27	temporal	temporal	ADJ
ahs-18399	4	28	increases	increase	NOUN
ahs-18399	4	29	in	in	ADP
ahs-18399	4	30	solar	solar	ADJ
ahs-18399	4	31	uv	uv	NOUN
ahs-18399	4	32	-	-	PUNCT
ahs-18399	4	33	b	b	NOUN
ahs-18399	4	34	and	and	CCONJ
ahs-18399	4	35	relatively	relatively	ADV
ahs-18399	4	36	long	long	ADJ
ahs-18399	4	37	-	-	PUNCT
ahs-18399	4	38	wave	wave	NOUN
ahs-18399	4	39	range	range	NOUN
ahs-18399	4	40	of	of	ADP
ahs-18399	4	41	uv	uv	NOUN
ahs-18399	4	42	-	-	PUNCT
ahs-18399	4	43	c	c	NOUN
ahs-18399	4	44	reaching	reach	VERB
ahs-18399	4	45	the	the	DET
ahs-18399	4	46	earth	earth	NOUN
ahs-18399	4	47	’s	’s	PART
ahs-18399	4	48	surface	surface	NOUN
ahs-18399	4	49	(	(	PUNCT
ahs-18399	4	50	staehelin	staehelin	NOUN
ahs-18399	4	51	et	et	PROPN
ahs-18399	4	52	al	al	PROPN
ahs-18399	4	53	.	.	PROPN
ahs-18399	4	54	,	,	PUNCT
ahs-18399	4	55	2001	2001	NUM
ahs-18399	4	56	)	)	PUNCT
ahs-18399	4	57	.	.	PUNCT
ahs-18399	5	1	therefore	therefore	ADV
ahs-18399	5	2	,	,	PUNCT
ahs-18399	5	3	from	from	ADP
ahs-18399	5	4	the	the	DET
ahs-18399	5	5	global	global	ADJ
ahs-18399	5	6	point	point	NOUN
ahs-18399	5	7	of	of	ADP
ahs-18399	5	8	view	view	NOUN
ahs-18399	5	9	,	,	PUNCT
ahs-18399	5	10	studies	study	NOUN
ahs-18399	5	11	on	on	ADP
ahs-18399	5	12	the	the	DET
ahs-18399	5	13	plant	plant	NOUN
ahs-18399	5	14	-	-	PUNCT
ahs-18399	5	15	damaging	damage	VERB
ahs-18399	5	16	impact	impact	NOUN
ahs-18399	5	17	of	of	ADP
ahs-18399	5	18	uv	uv	NOUN
ahs-18399	5	19	rays	ray	NOUN
ahs-18399	5	20	have	have	VERB
ahs-18399	5	21	key	key	ADJ
ahs-18399	5	22	importance	importance	NOUN
ahs-18399	5	23	to	to	ADP
ahs-18399	5	24	both	both	DET
ahs-18399	5	25	biologists	biologist	NOUN
ahs-18399	5	26	and	and	CCONJ
ahs-18399	5	27	environmental	environmental	ADJ
ahs-18399	5	28	researchers	researcher	NOUN
ahs-18399	5	29	.	.	PUNCT
ahs-18399	6	1	in	in	ADP
ahs-18399	6	2	general	general	ADJ
ahs-18399	6	3	,	,	PUNCT
ahs-18399	6	4	irradiation	irradiation	NOUN
ahs-18399	6	5	with	with	ADP
ahs-18399	6	6	a	a	DET
ahs-18399	6	7	high	high	ADJ
ahs-18399	6	8	dose	dose	NOUN
ahs-18399	6	9	uv	uv	NOUN
ahs-18399	6	10	-	-	PUNCT
ahs-18399	6	11	c	c	NOUN
ahs-18399	6	12	results	result	NOUN
ahs-18399	6	13	in	in	ADP
ahs-18399	6	14	induction	induction	NOUN
ahs-18399	6	15	of	of	ADP
ahs-18399	6	16	programmed	program	VERB
ahs-18399	6	17	cell	cell	NOUN
ahs-18399	6	18	death	death	NOUN
ahs-18399	6	19	in	in	ADP
ahs-18399	6	20	living	live	VERB
ahs-18399	6	21	plants	plant	NOUN
ahs-18399	6	22	.	.	PUNCT
ahs-18399	7	1	in	in	ADP
ahs-18399	7	2	seedlings	seedling	NOUN
ahs-18399	7	3	and	and	CCONJ
ahs-18399	7	4	protoplasts	protoplast	NOUN
ahs-18399	7	5	of	of	ADP
ahs-18399	7	6	arabidopsis	arabidopsis	NOUN
ahs-18399	7	7	thaliana	thaliana	NOUN
ahs-18399	7	8	,	,	PUNCT
ahs-18399	7	9	a	a	DET
ahs-18399	7	10	dose	dose	NOUN
ahs-18399	7	11	of	of	ADP
ahs-18399	7	12	uv	uv	NOUN
ahs-18399	7	13	-	-	PUNCT
ahs-18399	7	14	c	c	NOUN
ahs-18399	7	15	around	around	ADP
ahs-18399	7	16	10	10	NUM
ahs-18399	7	17	-	-	SYM
ahs-18399	7	18	50	50	NUM
ahs-18399	7	19	kj	kj	NOUN
ahs-18399	7	20	m-2	m-2	NOUN
ahs-18399	7	21	induces	induce	VERB
ahs-18399	7	22	an	an	DET
ahs-18399	7	23	oligonucleosomal	oligonucleosomal	ADJ
ahs-18399	7	24	dna	dna	ADJ
ahs-18399	7	25	fragmentation	fragmentation	NOUN
ahs-18399	7	26	which	which	PRON
ahs-18399	7	27	is	be	AUX
ahs-18399	7	28	reminiscent	reminiscent	ADJ
ahs-18399	7	29	of	of	ADP
ahs-18399	7	30	the	the	DET
ahs-18399	7	31	apoptotic	apoptotic	ADJ
ahs-18399	7	32	dna	dna	NOUN
ahs-18399	7	33	laddering	ladder	VERB
ahs-18399	7	34	often	often	ADV
ahs-18399	7	35	described	describe	VERB
ahs-18399	7	36	in	in	ADP
ahs-18399	7	37	mammalian	mammalian	ADJ
ahs-18399	7	38	cells	cell	NOUN
ahs-18399	7	39	(	(	PUNCT
ahs-18399	7	40	danon	danon	ADJ
ahs-18399	7	41	and	and	CCONJ
ahs-18399	7	42	gallois	gallois	NOUN
ahs-18399	7	43	,	,	PUNCT
ahs-18399	7	44	1998	1998	NUM
ahs-18399	7	45	)	)	PUNCT
ahs-18399	7	46	.	.	PUNCT
ahs-18399	8	1	in	in	ADP
ahs-18399	8	2	addition	addition	NOUN
ahs-18399	8	3	,	,	PUNCT
ahs-18399	8	4	uv	uv	NOUN
ahs-18399	8	5	-	-	PUNCT
ahs-18399	8	6	c	c	NOUN
ahs-18399	8	7	-	-	PUNCT
ahs-18399	8	8	dependent	dependent	ADJ
ahs-18399	8	9	cell	cell	NOUN
ahs-18399	8	10	death	death	NOUN
ahs-18399	8	11	development	development	NOUN
ahs-18399	8	12	in	in	ADP
ahs-18399	8	13	arabidopsis	arabidopsis	NOUN
ahs-18399	8	14	involves	involve	VERB
ahs-18399	8	15	caspase	caspase	NOUN
ahs-18399	8	16	-	-	PUNCT
ahs-18399	8	17	like	like	ADJ
ahs-18399	8	18	activity	activity	NOUN
ahs-18399	8	19	which	which	PRON
ahs-18399	8	20	is	be	AUX
ahs-18399	8	21	also	also	ADV
ahs-18399	8	22	similar	similar	ADJ
ahs-18399	8	23	to	to	ADP
ahs-18399	8	24	the	the	DET
ahs-18399	8	25	events	event	NOUN
ahs-18399	8	26	in	in	ADP
ahs-18399	8	27	animal	animal	NOUN
ahs-18399	8	28	apoptosis	apoptosis	NOUN
ahs-18399	8	29	(	(	PUNCT
ahs-18399	8	30	danon	danon	NOUN
ahs-18399	8	31	et	et	PROPN
ahs-18399	8	32	al	al	PROPN
ahs-18399	8	33	.	.	PROPN
ahs-18399	8	34	,	,	PUNCT
ahs-18399	8	35	2004	2004	NUM
ahs-18399	8	36	)	)	PUNCT
ahs-18399	8	37	.	.	PUNCT
ahs-18399	9	1	on	on	ADP
ahs-18399	9	2	the	the	DET
ahs-18399	9	3	other	other	ADJ
ahs-18399	9	4	hand	hand	NOUN
ahs-18399	9	5	,	,	PUNCT
ahs-18399	9	6	a	a	DET
ahs-18399	9	7	pulse	pulse	NOUN
ahs-18399	9	8	or	or	CCONJ
ahs-18399	9	9	low	low	ADJ
ahs-18399	9	10	dose	dose	NOUN
ahs-18399	9	11	of	of	ADP
ahs-18399	9	12	uv	uv	NOUN
ahs-18399	9	13	-	-	PUNCT
ahs-18399	9	14	c	c	NOUN
ahs-18399	9	15	radiation	radiation	NOUN
ahs-18399	9	16	is	be	AUX
ahs-18399	9	17	frequently	frequently	ADV
ahs-18399	9	18	used	use	VERB
ahs-18399	9	19	for	for	ADP
ahs-18399	9	20	direct	direct	ADJ
ahs-18399	9	21	removal	removal	NOUN
ahs-18399	9	22	of	of	ADP
ahs-18399	9	23	germs	germ	NOUN
ahs-18399	9	24	from	from	ADP
ahs-18399	9	25	fresh	fresh	ADJ
ahs-18399	9	26	produce	produce	NOUN
ahs-18399	9	27	(	(	PUNCT
ahs-18399	9	28	stevens	stevens	PROPN
ahs-18399	9	29	et	et	PROPN
ahs-18399	9	30	al	al	PROPN
ahs-18399	9	31	.	.	PROPN
ahs-18399	9	32	,	,	PUNCT
ahs-18399	9	33	1998	1998	NUM
ahs-18399	9	34	)	)	PUNCT
ahs-18399	9	35	.	.	PUNCT
ahs-18399	10	1	for	for	ADP
ahs-18399	10	2	instance	instance	NOUN
ahs-18399	10	3	,	,	PUNCT
ahs-18399	10	4	exposure	exposure	NOUN
ahs-18399	10	5	of	of	ADP
ahs-18399	10	6	fruit	fruit	NOUN
ahs-18399	10	7	tissue	tissue	NOUN
ahs-18399	10	8	slices	slice	NOUN
ahs-18399	10	9	of	of	ADP
ahs-18399	10	10	zucchini	zucchini	NOUN
ahs-18399	10	11	squash	squash	VERB
ahs-18399	10	12	to	to	ADP
ahs-18399	10	13	low	low	ADJ
ahs-18399	10	14	dose	dose	NOUN
ahs-18399	10	15	uv	uv	PROPN
ahs-18399	10	16	-	-	PUNCT
ahs-18399	10	17	c	c	NOUN
ahs-18399	10	18	impact	impact	NOUN
ahs-18399	10	19	of	of	ADP
ahs-18399	10	20	uv	uv	NOUN
ahs-18399	10	21	irradiation	irradiation	NOUN
ahs-18399	10	22	in	in	ADP
ahs-18399	10	23	leaves	leave	NOUN
ahs-18399	10	24	,	,	PUNCT
ahs-18399	10	25	fruits	fruit	NOUN
ahs-18399	10	26	and	and	CCONJ
ahs-18399	10	27	suspension	suspension	NOUN
ahs-18399	10	28	-	-	PUNCT
ahs-18399	10	29	cultured	cultured	ADJ
ahs-18399	10	30	cells	cell	NOUN
ahs-18399	10	31	of	of	ADP
ahs-18399	10	32	micro	micro	NOUN
ahs-18399	10	33	-	-	PROPN
ahs-18399	10	34	tom	tom	PROPN
ahs-18399	10	35	,	,	PUNCT
ahs-18399	10	36	tomato	tomato	NOUN
ahs-18399	10	37	t.	t.	PROPN
ahs-18399	10	38	hiramatsu,1	hiramatsu,1	PROPN
ahs-18399	10	39	l.a	l.a	PROPN
ahs-18399	10	40	.	.	PROPN
ahs-18399	10	41	terry,2	terry,2	NOUN
ahs-18399	10	42	t.	t.	PROPN
ahs-18399	10	43	kadono,1	kadono,1	PROPN
ahs-18399	11	1	t.	t.	PROPN
ahs-18399	11	2	kawano1,3,4	kawano1,3,4	PROPN
ahs-18399	11	3	*	*	SYM
ahs-18399	11	4	1	1	NUM
ahs-18399	11	5	laboratory	laboratory	NOUN
ahs-18399	11	6	of	of	ADP
ahs-18399	11	7	chemical	chemical	NOUN
ahs-18399	11	8	biology	biology	NOUN
ahs-18399	11	9	and	and	CCONJ
ahs-18399	11	10	bioengineering	bioengineering	NOUN
ahs-18399	11	11	,	,	PUNCT
ahs-18399	11	12	faculty	faculty	NOUN
ahs-18399	11	13	and	and	CCONJ
ahs-18399	11	14	graduate	graduate	NOUN
ahs-18399	11	15	school	school	NOUN
ahs-18399	11	16	of	of	ADP
ahs-18399	11	17	environmental	environmental	ADJ
ahs-18399	11	18	engineering	engineering	NOUN
ahs-18399	11	19	,	,	PUNCT
ahs-18399	11	20	the	the	DET
ahs-18399	11	21	university	university	NOUN
ahs-18399	11	22	of	of	ADP
ahs-18399	11	23	kitakyushu	kitakyushu	NOUN
ahs-18399	11	24	,	,	PUNCT
ahs-18399	11	25	kitakyushu	kitakyushu	NOUN
ahs-18399	11	26	,	,	PUNCT
ahs-18399	11	27	japan	japan	PROPN
ahs-18399	11	28	.	.	PUNCT
ahs-18399	12	1	2	2	NUM
ahs-18399	12	2	plant	plant	NOUN
ahs-18399	12	3	science	science	NOUN
ahs-18399	12	4	laboratory	laboratory	NOUN
ahs-18399	12	5	,	,	PUNCT
ahs-18399	12	6	cranfield	cranfield	PROPN
ahs-18399	12	7	university	university	PROPN
ahs-18399	12	8	,	,	PUNCT
ahs-18399	12	9	bedfordshire	bedfordshire	NOUN
ahs-18399	12	10	cranfield	cranfield	NOUN
ahs-18399	12	11	,	,	PUNCT
ahs-18399	12	12	mk43	mk43	PROPN
ahs-18399	12	13	0al	0al	NOUN
ahs-18399	12	14	,	,	PUNCT
ahs-18399	12	15	united	united	ADJ
ahs-18399	12	16	kingdom	kingdom	PROPN
ahs-18399	12	17	.	.	PUNCT
ahs-18399	13	1	3	3	NUM
ahs-18399	13	2	kitakyushu	kitakyushu	PROPN
ahs-18399	13	3	research	research	NOUN
ahs-18399	13	4	center	center	NOUN
ahs-18399	13	5	(	(	PUNCT
ahs-18399	13	6	linv@kitakyushu	linv@kitakyushu	NOUN
ahs-18399	13	7	)	)	PUNCT
ahs-18399	13	8	,	,	PUNCT
ahs-18399	13	9	kitakyushu	kitakyushu	NOUN
ahs-18399	13	10	,	,	PUNCT
ahs-18399	13	11	japan	japan	PROPN
ahs-18399	13	12	.	.	PROPN
ahs-18399	13	13	4	4	NUM
ahs-18399	13	14	université	université	PROPN
ahs-18399	13	15	paris	paris	PROPN
ahs-18399	13	16	diderot	diderot	NOUN
ahs-18399	13	17	,	,	PUNCT
ahs-18399	13	18	sorbonne	sorbonne	PROPN
ahs-18399	13	19	paris	paris	PROPN
ahs-18399	13	20	cité	cité	PROPN
ahs-18399	13	21	,	,	PUNCT
ahs-18399	13	22	paris	paris	PROPN
ahs-18399	13	23	7	7	NUM
ahs-18399	13	24	interdisciplinary	interdisciplinary	ADJ
ahs-18399	13	25	energy	energy	NOUN
ahs-18399	13	26	research	research	NOUN
ahs-18399	13	27	institute	institute	PROPN
ahs-18399	13	28	(	(	PUNCT
ahs-18399	13	29	pieri	pieri	PROPN
ahs-18399	13	30	)	)	PUNCT
ahs-18399	13	31	,	,	PUNCT
ahs-18399	13	32	paris	paris	PROPN
ahs-18399	13	33	,	,	PUNCT
ahs-18399	13	34	france	france	PROPN
ahs-18399	13	35	.	.	PUNCT
ahs-18399	14	1	key	key	ADJ
ahs-18399	14	2	words	word	NOUN
ahs-18399	14	3	:	:	PUNCT
ahs-18399	14	4	ethylene	ethylene	NOUN
ahs-18399	14	5	,	,	PUNCT
ahs-18399	14	6	pathogenesis	pathogenesis	NOUN
ahs-18399	14	7	,	,	PUNCT
ahs-18399	14	8	redox	redox	NOUN
ahs-18399	14	9	,	,	PUNCT
ahs-18399	14	10	ripeness	ripeness	NOUN
ahs-18399	14	11	,	,	PUNCT
ahs-18399	14	12	salicylic	salicylic	ADJ
ahs-18399	14	13	acid	acid	NOUN
ahs-18399	14	14	,	,	PUNCT
ahs-18399	14	15	solanum	solanum	NOUN
ahs-18399	14	16	lycopersicum	lycopersicum	NOUN
ahs-18399	14	17	,	,	PUNCT
ahs-18399	14	18	ultraviolet	ultraviolet	NOUN
ahs-18399	14	19	.	.	PUNCT
ahs-18399	14	20	abbreviations	abbreviation	NOUN
ahs-18399	14	21	:	:	PUNCT
ahs-18399	14	22	acc=	acc=	PROPN
ahs-18399	14	23	1	1	NUM
ahs-18399	14	24	-	-	PUNCT
ahs-18399	14	25	amincocyclopropane-1	amincocyclopropane-1	NOUN
ahs-18399	14	26	-	-	PUNCT
ahs-18399	14	27	carboxylic	carboxylic	ADJ
ahs-18399	14	28	acid	acid	NOUN
ahs-18399	14	29	;	;	PUNCT
ahs-18399	14	30	acs1a=	acs1a=	PROPN
ahs-18399	14	31	1	1	NUM
ahs-18399	14	32	-	-	PUNCT
ahs-18399	14	33	amincocyclopropane-1	amincocyclopropane-1	NUM
ahs-18399	14	34	-	-	PUNCT
ahs-18399	14	35	carboxylic	carboxylic	ADJ
ahs-18399	14	36	acid	acid	NOUN
ahs-18399	14	37	synthase	synthase	NOUN
ahs-18399	14	38	;	;	PUNCT
ahs-18399	14	39	apx=	apx=	ADJ
ahs-18399	14	40	cytosolic	cytosolic	ADJ
ahs-18399	14	41	ascorbate	ascorbate	NOUN
ahs-18399	14	42	peroxidise	peroxidise	NOUN
ahs-18399	14	43	;	;	PUNCT
ahs-18399	14	44	cia=	cia=	ADJ
ahs-18399	14	45	chloroform	chloroform	NOUN
ahs-18399	14	46	and	and	CCONJ
ahs-18399	14	47	isoamyl	isoamyl	NOUN
ahs-18399	14	48	alcohol	alcohol	NOUN
ahs-18399	14	49	;	;	PUNCT
ahs-18399	14	50	dnase=	dnase=	X
ahs-18399	14	51	deoxyribonuclease	deoxyribonuclease	NOUN
ahs-18399	14	52	;	;	PUNCT
ahs-18399	14	53	pal=	pal=	PROPN
ahs-18399	14	54	phenylalanine	phenylalanine	ADJ
ahs-18399	14	55	ammonia	ammonia	NOUN
ahs-18399	14	56	-	-	PUNCT
ahs-18399	14	57	lyase	lyase	NOUN
ahs-18399	14	58	;	;	PUNCT
ahs-18399	14	59	pr=	pr=	VERB
ahs-18399	14	60	pathogenesis	pathogenesis	NOUN
ahs-18399	14	61	-	-	PUNCT
ahs-18399	14	62	related	relate	VERB
ahs-18399	14	63	;	;	PUNCT
ahs-18399	14	64	ros=	ros=	NUM
ahs-18399	14	65	reactive	reactive	ADJ
ahs-18399	14	66	oxygen	oxygen	NOUN
ahs-18399	14	67	species	specie	NOUN
ahs-18399	14	68	;	;	PUNCT
ahs-18399	14	69	rt	rt	PROPN
ahs-18399	14	70	-	-	PUNCT
ahs-18399	14	71	pcr=	pcr=	PROPN
ahs-18399	14	72	reverse	reverse	ADJ
ahs-18399	14	73	transcription	transcription	NOUN
ahs-18399	14	74	polymerase	polymerase	NOUN
ahs-18399	14	75	chain	chain	NOUN
ahs-18399	14	76	reaction	reaction	NOUN
ahs-18399	14	77	;	;	PUNCT
ahs-18399	14	78	sa=	sa=	NOUN
ahs-18399	14	79	salicylic	salicylic	PROPN
ahs-18399	14	80	acid	acid	PROPN
ahs-18399	14	81	;	;	PUNCT
ahs-18399	14	82	uv	uv	NOUN
ahs-18399	14	83	,	,	PUNCT
ahs-18399	14	84	ultraviolet	ultraviolet	NOUN
ahs-18399	14	85	.	.	PUNCT
ahs-18399	15	1	abstract	abstract	PROPN
ahs-18399	15	2	:	:	PUNCT
ahs-18399	15	3	the	the	DET
ahs-18399	15	4	present	present	ADJ
ahs-18399	15	5	study	study	NOUN
ahs-18399	15	6	aims	aim	VERB
ahs-18399	15	7	to	to	PART
ahs-18399	15	8	understand	understand	VERB
ahs-18399	15	9	both	both	CCONJ
ahs-18399	15	10	positive	positive	ADJ
ahs-18399	15	11	and	and	CCONJ
ahs-18399	15	12	negative	negative	ADJ
ahs-18399	15	13	impacts	impact	NOUN
ahs-18399	15	14	of	of	ADP
ahs-18399	15	15	ultraviolet	ultraviolet	NOUN
ahs-18399	15	16	(	(	PUNCT
ahs-18399	15	17	uv	uv	NOUN
ahs-18399	15	18	)	)	PUNCT
ahs-18399	15	19	rays	ray	NOUN
ahs-18399	15	20	in	in	ADP
ahs-18399	15	21	living	live	VERB
ahs-18399	15	22	dwarf	dwarf	NOUN
ahs-18399	15	23	tomato	tomato	NOUN
ahs-18399	15	24	plants	plant	NOUN
ahs-18399	15	25	(	(	PUNCT
ahs-18399	15	26	solanum	solanum	NOUN
ahs-18399	15	27	lycopersicum	lycopersicum	PROPN
ahs-18399	15	28	l.	l.	PROPN
ahs-18399	15	29	cv	cv	PROPN
ahs-18399	15	30	.	.	PROPN
ahs-18399	15	31	micro	micro	PROPN
ahs-18399	15	32	-	-	PROPN
ahs-18399	15	33	tom	tom	PROPN
ahs-18399	15	34	)	)	PUNCT
ahs-18399	15	35	.	.	PUNCT
ahs-18399	16	1	this	this	DET
ahs-18399	16	2	paper	paper	NOUN
ahs-18399	16	3	examines	examine	VERB
ahs-18399	16	4	the	the	DET
ahs-18399	16	5	impact	impact	NOUN
ahs-18399	16	6	of	of	ADP
ahs-18399	16	7	uv	uv	NOUN
ahs-18399	16	8	-	-	PUNCT
ahs-18399	16	9	c	c	NOUN
ahs-18399	16	10	(	(	PUNCT
ahs-18399	16	11	254	254	NUM
ahs-18399	16	12	nm	nm	NOUN
ahs-18399	16	13	)	)	PUNCT
ahs-18399	16	14	and	and	CCONJ
ahs-18399	16	15	uv	uv	NOUN
ahs-18399	16	16	-	-	PUNCT
ahs-18399	16	17	a	a	PRON
ahs-18399	16	18	(	(	PUNCT
ahs-18399	16	19	365	365	NUM
ahs-18399	16	20	nm	nm	NOUN
ahs-18399	16	21	)	)	PUNCT
ahs-18399	16	22	on	on	ADP
ahs-18399	16	23	induction	induction	NOUN
ahs-18399	16	24	of	of	ADP
ahs-18399	16	25	cell	cell	NOUN
ahs-18399	16	26	death	death	NOUN
ahs-18399	16	27	and	and	CCONJ
ahs-18399	16	28	expression	expression	NOUN
ahs-18399	16	29	patterns	pattern	NOUN
ahs-18399	16	30	of	of	ADP
ahs-18399	16	31	pathogenesis	pathogenesis	NOUN
ahs-18399	16	32	-	-	PUNCT
ahs-18399	16	33	related	relate	VERB
ahs-18399	16	34	(	(	PUNCT
ahs-18399	16	35	pr	pr	NOUN
ahs-18399	16	36	)	)	PUNCT
ahs-18399	16	37	,	,	PUNCT
ahs-18399	16	38	stress	stress	NOUN
ahs-18399	16	39	-	-	PUNCT
ahs-18399	16	40	related	relate	VERB
ahs-18399	16	41	and	and	CCONJ
ahs-18399	16	42	redox	redox	NOUN
ahs-18399	16	43	-	-	PUNCT
ahs-18399	16	44	related	relate	VERB
ahs-18399	16	45	genes	gene	NOUN
ahs-18399	16	46	,	,	PUNCT
ahs-18399	16	47	namely	namely	ADV
ahs-18399	16	48	,	,	PUNCT
ahs-18399	16	49	of	of	ADP
ahs-18399	16	50	1	1	NUM
ahs-18399	16	51	-	-	PUNCT
ahs-18399	16	52	amincocyclopropane-1	amincocyclopropane-1	NUM
ahs-18399	16	53	-	-	PUNCT
ahs-18399	16	54	carboxylic	carboxylic	ADJ
ahs-18399	16	55	acid	acid	NOUN
ahs-18399	16	56	synthase	synthase	NOUN
ahs-18399	16	57	(	(	PUNCT
ahs-18399	16	58	acs1a	acs1a	PROPN
ahs-18399	16	59	)	)	PUNCT
ahs-18399	16	60	,	,	PUNCT
ahs-18399	16	61	cytosolic	cytosolic	NOUN
ahs-18399	16	62	ascorbate	ascorbate	NOUN
ahs-18399	16	63	peroxidise	peroxidise	NOUN
ahs-18399	16	64	(	(	PUNCT
ahs-18399	16	65	apx	apx	NOUN
ahs-18399	16	66	)	)	PUNCT
ahs-18399	16	67	,	,	PUNCT
ahs-18399	16	68	phenylalanine	phenylalanine	ADJ
ahs-18399	16	69	ammonia	ammonia	NOUN
ahs-18399	16	70	-	-	PUNCT
ahs-18399	16	71	lyase	lyase	NOUN
ahs-18399	16	72	(	(	PUNCT
ahs-18399	16	73	pal	pal	NOUN
ahs-18399	16	74	)	)	PUNCT
ahs-18399	16	75	,	,	PUNCT
ahs-18399	16	76	and	and	CCONJ
ahs-18399	16	77	pathogenesis	pathogenesis	NOUN
ahs-18399	16	78	-	-	PUNCT
ahs-18399	16	79	related	relate	VERB
ahs-18399	16	80	genes	gene	NOUN
ahs-18399	16	81	(	(	PUNCT
ahs-18399	16	82	pr1	pr1	NOUN
ahs-18399	16	83	and	and	CCONJ
ahs-18399	16	84	pr	pr	NOUN
ahs-18399	16	85	-	-	PUNCT
ahs-18399	16	86	p2	p2	NOUN
ahs-18399	16	87	)	)	PUNCT
ahs-18399	16	88	,	,	PUNCT
ahs-18399	16	89	in	in	ADP
ahs-18399	16	90	leaves	leave	NOUN
ahs-18399	16	91	,	,	PUNCT
ahs-18399	16	92	fruits	fruit	NOUN
ahs-18399	16	93	(	(	PUNCT
ahs-18399	16	94	both	both	CCONJ
ahs-18399	16	95	green	green	ADJ
ahs-18399	16	96	and	and	CCONJ
ahs-18399	16	97	red	red	ADJ
ahs-18399	16	98	)	)	PUNCT
ahs-18399	16	99	,	,	PUNCT
ahs-18399	16	100	and	and	CCONJ
ahs-18399	16	101	suspension	suspension	NOUN
ahs-18399	16	102	-	-	PUNCT
ahs-18399	16	103	cultured	cultured	ADJ
ahs-18399	16	104	cells	cell	NOUN
ahs-18399	16	105	of	of	ADP
ahs-18399	16	106	micro	micro	NOUN
ahs-18399	16	107	-	-	PROPN
ahs-18399	16	108	tom	tom	PROPN
ahs-18399	16	109	.	.	PUNCT
ahs-18399	16	110	effects	effect	NOUN
ahs-18399	16	111	of	of	ADP
ahs-18399	16	112	short	short	ADJ
ahs-18399	16	113	exposure	exposure	NOUN
ahs-18399	16	114	to	to	ADP
ahs-18399	16	115	uv	uv	NOUN
ahs-18399	16	116	-	-	PUNCT
ahs-18399	16	117	c	c	NOUN
ahs-18399	16	118	,	,	PUNCT
ahs-18399	16	119	but	but	CCONJ
ahs-18399	16	120	not	not	PART
ahs-18399	16	121	to	to	PART
ahs-18399	16	122	uv	uv	VERB
ahs-18399	16	123	-	-	PUNCT
ahs-18399	16	124	a	a	NOUN
ahs-18399	16	125	,	,	PUNCT
ahs-18399	16	126	on	on	ADP
ahs-18399	16	127	induction	induction	NOUN
ahs-18399	16	128	of	of	ADP
ahs-18399	16	129	cell	cell	NOUN
ahs-18399	16	130	death	death	NOUN
ahs-18399	16	131	(	(	PUNCT
ahs-18399	16	132	in	in	ADP
ahs-18399	16	133	cell	cell	NOUN
ahs-18399	16	134	suspension	suspension	NOUN
ahs-18399	16	135	)	)	PUNCT
ahs-18399	16	136	and	and	CCONJ
ahs-18399	16	137	development	development	NOUN
ahs-18399	16	138	of	of	ADP
ahs-18399	16	139	lesions	lesion	NOUN
ahs-18399	16	140	accompanied	accompany	VERB
ahs-18399	16	141	by	by	ADP
ahs-18399	16	142	ion	ion	NOUN
ahs-18399	16	143	leakage	leakage	NOUN
ahs-18399	16	144	(	(	PUNCT
ahs-18399	16	145	in	in	ADP
ahs-18399	16	146	the	the	DET
ahs-18399	16	147	leaves	leave	NOUN
ahs-18399	16	148	)	)	PUNCT
ahs-18399	16	149	were	be	AUX
ahs-18399	16	150	observed	observe	VERB
ahs-18399	16	151	while	while	SCONJ
ahs-18399	16	152	no	no	DET
ahs-18399	16	153	morphological	morphological	ADJ
ahs-18399	16	154	change	change	NOUN
ahs-18399	16	155	was	be	AUX
ahs-18399	16	156	observed	observe	VERB
ahs-18399	16	157	in	in	ADP
ahs-18399	16	158	the	the	DET
ahs-18399	16	159	uv	uv	NOUN
ahs-18399	16	160	-	-	PUNCT
ahs-18399	16	161	treated	treat	VERB
ahs-18399	16	162	green	green	ADJ
ahs-18399	16	163	and	and	CCONJ
ahs-18399	16	164	red	red	ADJ
ahs-18399	16	165	fruits	fruit	NOUN
ahs-18399	16	166	.	.	PUNCT
ahs-18399	17	1	uv	uv	NOUN
ahs-18399	17	2	-	-	PUNCT
ahs-18399	17	3	dependent	dependent	ADJ
ahs-18399	17	4	induction	induction	NOUN
ahs-18399	17	5	of	of	ADP
ahs-18399	17	6	pr	pr	NOUN
ahs-18399	17	7	genes	gene	NOUN
ahs-18399	17	8	(	(	PUNCT
ahs-18399	17	9	pr1	pr1	NOUN
ahs-18399	17	10	and	and	CCONJ
ahs-18399	17	11	pr	pr	NOUN
ahs-18399	17	12	-	-	PUNCT
ahs-18399	17	13	p2	p2	NOUN
ahs-18399	17	14	)	)	PUNCT
ahs-18399	17	15	in	in	ADP
ahs-18399	17	16	these	these	DET
ahs-18399	17	17	samples	sample	NOUN
ahs-18399	17	18	suggested	suggest	VERB
ahs-18399	17	19	that	that	SCONJ
ahs-18399	17	20	uvs	uvs	PROPN
ahs-18399	17	21	can	can	AUX
ahs-18399	17	22	be	be	AUX
ahs-18399	17	23	used	use	VERB
ahs-18399	17	24	for	for	ADP
ahs-18399	17	25	plant	plant	NOUN
ahs-18399	17	26	defense	defense	NOUN
ahs-18399	17	27	activation	activation	NOUN
ahs-18399	17	28	.	.	PUNCT
ahs-18399	18	1	in	in	ADP
ahs-18399	18	2	addition	addition	NOUN
ahs-18399	18	3	,	,	PUNCT
ahs-18399	18	4	expression	expression	NOUN
ahs-18399	18	5	of	of	ADP
ahs-18399	18	6	acs1a	acs1a	PROPN
ahs-18399	18	7	was	be	AUX
ahs-18399	18	8	shown	show	VERB
ahs-18399	18	9	to	to	PART
ahs-18399	18	10	be	be	AUX
ahs-18399	18	11	negatively	negatively	ADV
ahs-18399	18	12	and	and	CCONJ
ahs-18399	18	13	positively	positively	ADV
ahs-18399	18	14	regulated	regulate	VERB
ahs-18399	18	15	by	by	ADP
ahs-18399	18	16	uv	uv	NOUN
ahs-18399	18	17	-	-	PUNCT
ahs-18399	18	18	c	c	NOUN
ahs-18399	18	19	and	and	CCONJ
ahs-18399	18	20	uv	uv	NOUN
ahs-18399	18	21	-	-	PUNCT
ahs-18399	18	22	a	a	NOUN
ahs-18399	18	23	,	,	PUNCT
ahs-18399	18	24	respectively	respectively	ADV
ahs-18399	18	25	.	.	PUNCT
ahs-18399	19	1	thus	thus	ADV
ahs-18399	19	2	uv	uv	NOUN
ahs-18399	19	3	-	-	PUNCT
ahs-18399	19	4	dependent	dependent	ADJ
ahs-18399	19	5	postharvest	postharv	ADJ
ahs-18399	19	6	controls	control	NOUN
ahs-18399	19	7	of	of	ADP
ahs-18399	19	8	fruit	fruit	NOUN
ahs-18399	19	9	maturity	maturity	NOUN
ahs-18399	19	10	and	and	CCONJ
ahs-18399	19	11	shelf	shelf	NOUN
ahs-18399	19	12	-	-	PUNCT
ahs-18399	19	13	life	life	NOUN
ahs-18399	19	14	are	be	AUX
ahs-18399	19	15	likely	likely	ADV
ahs-18399	19	16	applicable	applicable	ADJ
ahs-18399	19	17	(	(	PUNCT
ahs-18399	19	18	i.e.	i.e.	X
ahs-18399	19	19	retardation	retardation	NOUN
ahs-18399	19	20	and/or	and/or	CCONJ
ahs-18399	19	21	acceleration	acceleration	NOUN
ahs-18399	19	22	of	of	ADP
ahs-18399	19	23	maturation	maturation	NOUN
ahs-18399	19	24	)	)	PUNCT
ahs-18399	19	25	.	.	PUNCT
ahs-18399	20	1	adv	adv	PROPN
ahs-18399	20	2	.	.	PUNCT
ahs-18399	21	1	hort	hort	PROPN
ahs-18399	21	2	.	.	PUNCT
ahs-18399	22	1	sci	sci	PROPN
ahs-18399	22	2	.	.	PROPN
ahs-18399	22	3	,	,	PUNCT
ahs-18399	22	4	2014	2014	NUM
ahs-18399	22	5	28(3	28(3	NUM
ahs-18399	22	6	):	):	PUNCT
ahs-18399	22	7	133	133	NUM
ahs-18399	22	8	-	-	SYM
ahs-18399	22	9	140	140	NUM
ahs-18399	22	10	(	(	PUNCT
ahs-18399	22	11	*	*	NOUN
ahs-18399	22	12	)	)	PUNCT
ahs-18399	22	13	corresponding	corresponding	ADJ
ahs-18399	22	14	author	author	NOUN
ahs-18399	22	15	:	:	PUNCT
ahs-18399	22	16	kawanotom@env.kitakyu-u.ac.jp	kawanotom@env.kitakyu-u.ac.jp	PROPN
ahs-18399	22	17	received	receive	VERB
ahs-18399	22	18	for	for	ADP
ahs-18399	22	19	publication	publication	NOUN
ahs-18399	22	20	25	25	NUM
ahs-18399	22	21	june	june	PROPN
ahs-18399	22	22	2014	2014	NUM
ahs-18399	22	23	accepted	accept	VERB
ahs-18399	22	24	for	for	ADP
ahs-18399	22	25	publication	publication	NOUN
ahs-18399	22	26	1	1	NUM
ahs-18399	22	27	august	august	PROPN
ahs-18399	22	28	2014	2014	NUM
ahs-18399	22	29	134	134	NUM
ahs-18399	22	30	reportedly	reportedly	ADV
ahs-18399	22	31	lowers	lower	VERB
ahs-18399	22	32	the	the	DET
ahs-18399	22	33	microbial	microbial	ADJ
ahs-18399	22	34	activity	activity	NOUN
ahs-18399	22	35	and	and	CCONJ
ahs-18399	22	36	prevents	prevent	VERB
ahs-18399	22	37	deterioration	deterioration	NOUN
ahs-18399	22	38	of	of	ADP
ahs-18399	22	39	fruit	fruit	NOUN
ahs-18399	22	40	quality	quality	NOUN
ahs-18399	22	41	during	during	ADP
ahs-18399	22	42	subsequent	subsequent	ADJ
ahs-18399	22	43	storage	storage	NOUN
ahs-18399	22	44	at	at	ADP
ahs-18399	22	45	low	low	ADJ
ahs-18399	22	46	temperatures	temperature	NOUN
ahs-18399	22	47	,	,	PUNCT
ahs-18399	22	48	while	while	SCONJ
ahs-18399	22	49	a	a	DET
ahs-18399	22	50	burst	burst	NOUN
ahs-18399	22	51	in	in	ADP
ahs-18399	22	52	respiration	respiration	NOUN
ahs-18399	22	53	rate	rate	NOUN
ahs-18399	22	54	in	in	ADP
ahs-18399	22	55	the	the	DET
ahs-18399	22	56	treated	treat	VERB
ahs-18399	22	57	tissues	tissue	NOUN
ahs-18399	22	58	is	be	AUX
ahs-18399	22	59	induced	induce	VERB
ahs-18399	22	60	(	(	PUNCT
ahs-18399	22	61	erkan	erkan	PROPN
ahs-18399	22	62	et	et	PROPN
ahs-18399	22	63	al	al	PROPN
ahs-18399	22	64	.	.	PROPN
ahs-18399	22	65	,	,	PUNCT
ahs-18399	22	66	2001	2001	NUM
ahs-18399	22	67	)	)	PUNCT
ahs-18399	22	68	.	.	PUNCT
ahs-18399	23	1	in	in	ADP
ahs-18399	23	2	addition	addition	NOUN
ahs-18399	23	3	to	to	ADP
ahs-18399	23	4	direct	direct	ADJ
ahs-18399	23	5	removal	removal	NOUN
ahs-18399	23	6	of	of	ADP
ahs-18399	23	7	pathogenic	pathogenic	ADJ
ahs-18399	23	8	microbes	microbe	NOUN
ahs-18399	23	9	from	from	ADP
ahs-18399	23	10	the	the	DET
ahs-18399	23	11	plant	plant	NOUN
ahs-18399	23	12	surface	surface	NOUN
ahs-18399	23	13	by	by	ADP
ahs-18399	23	14	uv	uv	NOUN
ahs-18399	23	15	,	,	PUNCT
ahs-18399	23	16	researchers	researcher	NOUN
ahs-18399	23	17	have	have	AUX
ahs-18399	23	18	reported	report	VERB
ahs-18399	23	19	attempts	attempt	NOUN
ahs-18399	23	20	to	to	PART
ahs-18399	23	21	use	use	VERB
ahs-18399	23	22	uv	uv	NOUN
ahs-18399	23	23	radiation	radiation	NOUN
ahs-18399	23	24	for	for	ADP
ahs-18399	23	25	so	so	ADV
ahs-18399	23	26	-	-	PUNCT
ahs-18399	23	27	called	call	VERB
ahs-18399	23	28	‘	'	PUNCT
ahs-18399	23	29	plant	plant	NOUN
ahs-18399	23	30	hormesis	hormesis	NOUN
ahs-18399	23	31	’	'	PUNCT
ahs-18399	23	32	by	by	ADP
ahs-18399	23	33	which	which	PRON
ahs-18399	23	34	the	the	DET
ahs-18399	23	35	susceptibility	susceptibility	NOUN
ahs-18399	23	36	of	of	ADP
ahs-18399	23	37	plants	plant	NOUN
ahs-18399	23	38	to	to	ADP
ahs-18399	23	39	pathogens	pathogen	NOUN
ahs-18399	23	40	could	could	AUX
ahs-18399	23	41	be	be	AUX
ahs-18399	23	42	minimized	minimize	VERB
ahs-18399	23	43	and	and	CCONJ
ahs-18399	23	44	shelf	shelf	NOUN
ahs-18399	23	45	-	-	PUNCT
ahs-18399	23	46	lives	life	NOUN
ahs-18399	23	47	of	of	ADP
ahs-18399	23	48	fresh	fresh	ADJ
ahs-18399	23	49	produce	produce	NOUN
ahs-18399	23	50	could	could	AUX
ahs-18399	23	51	be	be	AUX
ahs-18399	23	52	extended	extend	VERB
ahs-18399	23	53	(	(	PUNCT
ahs-18399	23	54	stevens	stevens	PROPN
ahs-18399	23	55	et	et	PROPN
ahs-18399	23	56	al	al	PROPN
ahs-18399	23	57	.	.	PROPN
ahs-18399	23	58	,	,	PUNCT
ahs-18399	23	59	1996	1996	NUM
ahs-18399	23	60	,	,	PUNCT
ahs-18399	23	61	1998	1998	NUM
ahs-18399	23	62	)	)	PUNCT
ahs-18399	23	63	.	.	PUNCT
ahs-18399	24	1	to	to	ADP
ahs-18399	24	2	date	date	NOUN
ahs-18399	24	3	,	,	PUNCT
ahs-18399	24	4	various	various	ADJ
ahs-18399	24	5	fruits	fruit	NOUN
ahs-18399	24	6	and	and	CCONJ
ahs-18399	24	7	vegetables	vegetable	NOUN
ahs-18399	24	8	including	include	VERB
ahs-18399	24	9	sweet	sweet	ADJ
ahs-18399	24	10	potatoes	potato	NOUN
ahs-18399	24	11	(	(	PUNCT
ahs-18399	24	12	stevens	stevens	PROPN
ahs-18399	24	13	et	et	PROPN
ahs-18399	24	14	al	al	PROPN
ahs-18399	24	15	.	.	PROPN
ahs-18399	24	16	,	,	PUNCT
ahs-18399	24	17	1990	1990	NUM
ahs-18399	24	18	,	,	PUNCT
ahs-18399	24	19	1999	1999	NUM
ahs-18399	24	20	)	)	PUNCT
ahs-18399	24	21	,	,	PUNCT
ahs-18399	24	22	apples	apple	NOUN
ahs-18399	24	23	(	(	PUNCT
ahs-18399	24	24	lu	lu	NOUN
ahs-18399	24	25	et	et	PROPN
ahs-18399	24	26	al	al	PROPN
ahs-18399	24	27	.	.	PROPN
ahs-18399	24	28	,	,	PUNCT
ahs-18399	24	29	2007	2007	NUM
ahs-18399	24	30	)	)	PUNCT
ahs-18399	24	31	,	,	PUNCT
ahs-18399	24	32	peaches	peach	NOUN
ahs-18399	24	33	(	(	PUNCT
ahs-18399	24	34	stevens	stevens	PROPN
ahs-18399	24	35	et	et	PROPN
ahs-18399	24	36	al	al	PROPN
ahs-18399	24	37	.	.	PROPN
ahs-18399	24	38	,	,	PUNCT
ahs-18399	24	39	1998	1998	NUM
ahs-18399	24	40	;	;	PUNCT
ahs-18399	24	41	lu	lu	PROPN
ahs-18399	24	42	et	et	PROPN
ahs-18399	24	43	al	al	PROPN
ahs-18399	24	44	.	.	PROPN
ahs-18399	24	45	,	,	PUNCT
ahs-18399	24	46	2007	2007	NUM
ahs-18399	24	47	)	)	PUNCT
ahs-18399	24	48	,	,	PUNCT
ahs-18399	24	49	and	and	CCONJ
ahs-18399	24	50	tomatoes	tomato	NOUN
ahs-18399	24	51	(	(	PUNCT
ahs-18399	24	52	liu	liu	PROPN
ahs-18399	24	53	et	et	PROPN
ahs-18399	24	54	al	al	PROPN
ahs-18399	24	55	.	.	PROPN
ahs-18399	24	56	,	,	PUNCT
ahs-18399	24	57	1993	1993	NUM
ahs-18399	24	58	)	)	PUNCT
ahs-18399	24	59	have	have	AUX
ahs-18399	24	60	been	be	AUX
ahs-18399	24	61	tested	test	VERB
ahs-18399	24	62	for	for	ADP
ahs-18399	24	63	uv	uv	NOUN
ahs-18399	24	64	-	-	PUNCT
ahs-18399	24	65	mediated	mediate	VERB
ahs-18399	24	66	disease	disease	NOUN
ahs-18399	24	67	resistance	resistance	NOUN
ahs-18399	24	68	controls	control	NOUN
ahs-18399	24	69	.	.	PUNCT
ahs-18399	25	1	in	in	ADP
ahs-18399	25	2	most	most	ADJ
ahs-18399	25	3	of	of	ADP
ahs-18399	25	4	the	the	DET
ahs-18399	25	5	cases	case	NOUN
ahs-18399	25	6	,	,	PUNCT
ahs-18399	25	7	resistance	resistance	NOUN
ahs-18399	25	8	against	against	ADP
ahs-18399	25	9	pathogens	pathogen	NOUN
ahs-18399	25	10	was	be	AUX
ahs-18399	25	11	induced	induce	VERB
ahs-18399	25	12	by	by	ADP
ahs-18399	25	13	uv	uv	NOUN
ahs-18399	25	14	-	-	PUNCT
ahs-18399	25	15	c	c	PROPN
ahs-18399	25	16	(	(	PUNCT
ahs-18399	25	17	stevens	stevens	PROPN
ahs-18399	25	18	et	et	PROPN
ahs-18399	25	19	al	al	PROPN
ahs-18399	25	20	.	.	PROPN
ahs-18399	25	21	,	,	PUNCT
ahs-18399	25	22	1999	1999	NUM
ahs-18399	25	23	)	)	PUNCT
ahs-18399	25	24	.	.	PUNCT
ahs-18399	26	1	it	it	PRON
ahs-18399	26	2	is	be	AUX
ahs-18399	26	3	likely	likely	ADJ
ahs-18399	26	4	that	that	SCONJ
ahs-18399	26	5	treatment	treatment	NOUN
ahs-18399	26	6	with	with	ADP
ahs-18399	26	7	uv	uv	NOUN
ahs-18399	26	8	rays	ray	NOUN
ahs-18399	26	9	(	(	PUNCT
ahs-18399	26	10	including	include	VERB
ahs-18399	26	11	uvc	uvc	PROPN
ahs-18399	26	12	)	)	PUNCT
ahs-18399	26	13	builds	build	VERB
ahs-18399	26	14	up	up	ADP
ahs-18399	26	15	the	the	DET
ahs-18399	26	16	“	"	PUNCT
ahs-18399	26	17	immunity	immunity	NOUN
ahs-18399	26	18	”	"	PUNCT
ahs-18399	26	19	against	against	ADP
ahs-18399	26	20	microbial	microbial	ADJ
ahs-18399	26	21	infection	infection	NOUN
ahs-18399	26	22	in	in	ADP
ahs-18399	26	23	living	living	NOUN
ahs-18399	26	24	plants	plant	NOUN
ahs-18399	26	25	,	,	PUNCT
ahs-18399	26	26	thus	thus	ADV
ahs-18399	26	27	the	the	DET
ahs-18399	26	28	uv	uv	NOUN
ahs-18399	26	29	hormesis	hormesis	NOUN
ahs-18399	26	30	effects	effect	NOUN
ahs-18399	26	31	described	describe	VERB
ahs-18399	26	32	above	above	ADV
ahs-18399	26	33	may	may	AUX
ahs-18399	26	34	be	be	AUX
ahs-18399	26	35	,	,	PUNCT
ahs-18399	26	36	at	at	ADP
ahs-18399	26	37	least	least	ADJ
ahs-18399	26	38	partially	partially	ADV
ahs-18399	26	39	,	,	PUNCT
ahs-18399	26	40	attributed	attribute	VERB
ahs-18399	26	41	to	to	ADP
ahs-18399	26	42	stimulation	stimulation	NOUN
ahs-18399	26	43	of	of	ADP
ahs-18399	26	44	plants	plant	NOUN
ahs-18399	26	45	’	'	PUNCT
ahs-18399	26	46	innate	innate	ADJ
ahs-18399	26	47	immunity	immunity	NOUN
ahs-18399	26	48	.	.	PUNCT
ahs-18399	27	1	the	the	DET
ahs-18399	27	2	innate	innate	ADJ
ahs-18399	27	3	immune	immune	ADJ
ahs-18399	27	4	system	system	NOUN
ahs-18399	27	5	of	of	ADP
ahs-18399	27	6	plants	plant	NOUN
ahs-18399	27	7	against	against	ADP
ahs-18399	27	8	pathogenic	pathogenic	ADJ
ahs-18399	27	9	microbes	microbe	NOUN
ahs-18399	27	10	is	be	AUX
ahs-18399	27	11	known	know	VERB
ahs-18399	27	12	to	to	PART
ahs-18399	27	13	be	be	AUX
ahs-18399	27	14	elicited	elicit	VERB
ahs-18399	27	15	in	in	ADP
ahs-18399	27	16	response	response	NOUN
ahs-18399	27	17	to	to	ADP
ahs-18399	27	18	recognition	recognition	NOUN
ahs-18399	27	19	of	of	ADP
ahs-18399	27	20	pathogen	pathogen	NOUN
ahs-18399	27	21	-	-	PUNCT
ahs-18399	27	22	derived	derive	VERB
ahs-18399	27	23	molecules	molecule	NOUN
ahs-18399	27	24	by	by	ADP
ahs-18399	27	25	plant	plant	NOUN
ahs-18399	27	26	cells	cell	NOUN
ahs-18399	27	27	,	,	PUNCT
ahs-18399	27	28	as	as	SCONJ
ahs-18399	27	29	reviewed	review	VERB
ahs-18399	27	30	elsewhere	elsewhere	ADV
ahs-18399	27	31	(	(	PUNCT
ahs-18399	27	32	dangl	dangl	ADJ
ahs-18399	27	33	and	and	CCONJ
ahs-18399	27	34	jones	jones	PROPN
ahs-18399	27	35	,	,	PUNCT
ahs-18399	27	36	2001	2001	NUM
ahs-18399	27	37	;	;	PUNCT
ahs-18399	27	38	chisholm	chisholm	PROPN
ahs-18399	27	39	et	et	PROPN
ahs-18399	27	40	al	al	PROPN
ahs-18399	27	41	.	.	PROPN
ahs-18399	27	42	,	,	PUNCT
ahs-18399	27	43	2006	2006	NUM
ahs-18399	27	44	;	;	PUNCT
ahs-18399	27	45	yoshioka	yoshioka	PROPN
ahs-18399	27	46	et	et	PROPN
ahs-18399	27	47	al	al	PROPN
ahs-18399	27	48	.	.	PROPN
ahs-18399	27	49	,	,	PUNCT
ahs-18399	27	50	2008	2008	NUM
ahs-18399	27	51	)	)	PUNCT
ahs-18399	27	52	.	.	PUNCT
ahs-18399	28	1	recognition	recognition	NOUN
ahs-18399	28	2	of	of	ADP
ahs-18399	28	3	such	such	ADJ
ahs-18399	28	4	elicitors	elicitor	NOUN
ahs-18399	28	5	by	by	ADP
ahs-18399	28	6	the	the	DET
ahs-18399	28	7	host	host	NOUN
ahs-18399	28	8	cells	cell	NOUN
ahs-18399	28	9	’	'	PUNCT
ahs-18399	28	10	transmembrane	transmembrane	NOUN
ahs-18399	28	11	receptors	receptor	NOUN
ahs-18399	28	12	(	(	PUNCT
ahs-18399	28	13	jones	jones	NOUN
ahs-18399	28	14	and	and	CCONJ
ahs-18399	28	15	dangl	dangl	ADJ
ahs-18399	28	16	,	,	PUNCT
ahs-18399	28	17	2006	2006	NUM
ahs-18399	28	18	;	;	PUNCT
ahs-18399	28	19	altenbach	altenbach	NOUN
ahs-18399	28	20	and	and	CCONJ
ahs-18399	28	21	robatzek	robatzek	NOUN
ahs-18399	28	22	,	,	PUNCT
ahs-18399	28	23	2007	2007	NUM
ahs-18399	28	24	)	)	PUNCT
ahs-18399	28	25	or	or	CCONJ
ahs-18399	28	26	resistance	resistance	NOUN
ahs-18399	28	27	(	(	PUNCT
ahs-18399	28	28	r	r	NOUN
ahs-18399	28	29	)	)	PUNCT
ahs-18399	28	30	proteins	protein	NOUN
ahs-18399	28	31	(	(	PUNCT
ahs-18399	28	32	allen	allen	NOUN
ahs-18399	28	33	et	et	PROPN
ahs-18399	28	34	al	al	PROPN
ahs-18399	28	35	.	.	PROPN
ahs-18399	28	36	,	,	PUNCT
ahs-18399	28	37	2004	2004	NUM
ahs-18399	28	38	;	;	PUNCT
ahs-18399	28	39	chisholm	chisholm	PROPN
ahs-18399	28	40	et	et	PROPN
ahs-18399	28	41	al	al	PROPN
ahs-18399	28	42	.	.	PROPN
ahs-18399	28	43	,	,	PUNCT
ahs-18399	28	44	2006	2006	NUM
ahs-18399	28	45	;	;	PUNCT
ahs-18399	28	46	dodds	dodds	PROPN
ahs-18399	28	47	et	et	PROPN
ahs-18399	28	48	al	al	PROPN
ahs-18399	28	49	.	.	PROPN
ahs-18399	28	50	,	,	PUNCT
ahs-18399	28	51	2006	2006	NUM
ahs-18399	28	52	)	)	PUNCT
ahs-18399	28	53	reportedly	reportedly	ADV
ahs-18399	28	54	initiates	initiate	VERB
ahs-18399	28	55	the	the	DET
ahs-18399	28	56	cellular	cellular	ADJ
ahs-18399	28	57	signaling	signal	VERB
ahs-18399	28	58	cascades	cascade	NOUN
ahs-18399	28	59	which	which	PRON
ahs-18399	28	60	finally	finally	ADV
ahs-18399	28	61	activate	activate	VERB
ahs-18399	28	62	the	the	DET
ahs-18399	28	63	defense	defense	NOUN
ahs-18399	28	64	mechanisms	mechanism	NOUN
ahs-18399	28	65	.	.	PUNCT
ahs-18399	29	1	micro	micro	PROPN
ahs-18399	29	2	-	-	PROPN
ahs-18399	29	3	tom	tom	PROPN
ahs-18399	29	4	,	,	PUNCT
ahs-18399	29	5	a	a	DET
ahs-18399	29	6	dwarf	dwarf	NOUN
ahs-18399	29	7	cultivar	cultivar	NOUN
ahs-18399	29	8	of	of	ADP
ahs-18399	29	9	tomato	tomato	NOUN
ahs-18399	29	10	(	(	PUNCT
ahs-18399	29	11	solanum	solanum	NOUN
ahs-18399	29	12	lycopersicum	lycopersicum	PROPN
ahs-18399	29	13	l.	l.	PROPN
ahs-18399	29	14	)	)	PUNCT
ahs-18399	29	15	,	,	PUNCT
ahs-18399	29	16	originally	originally	ADV
ahs-18399	29	17	produced	produce	VERB
ahs-18399	29	18	for	for	ADP
ahs-18399	29	19	ornamental	ornamental	ADJ
ahs-18399	29	20	purposes	purpose	NOUN
ahs-18399	29	21	,	,	PUNCT
ahs-18399	29	22	has	have	AUX
ahs-18399	29	23	been	be	AUX
ahs-18399	29	24	proposed	propose	VERB
ahs-18399	29	25	as	as	ADP
ahs-18399	29	26	preferred	preferred	ADJ
ahs-18399	29	27	plant	plant	NOUN
ahs-18399	29	28	material	material	NOUN
ahs-18399	29	29	for	for	ADP
ahs-18399	29	30	molecular	molecular	ADJ
ahs-18399	29	31	biological	biological	ADJ
ahs-18399	29	32	research	research	NOUN
ahs-18399	29	33	,	,	PUNCT
ahs-18399	29	34	mainly	mainly	ADV
ahs-18399	29	35	because	because	SCONJ
ahs-18399	29	36	of	of	ADP
ahs-18399	29	37	its	its	PRON
ahs-18399	29	38	compact	compact	ADJ
ahs-18399	29	39	habitat	habitat	NOUN
ahs-18399	29	40	and	and	CCONJ
ahs-18399	29	41	short	short	ADJ
ahs-18399	29	42	life	life	NOUN
ahs-18399	29	43	cycle	cycle	NOUN
ahs-18399	29	44	(	(	PUNCT
ahs-18399	29	45	meissner	meissner	PROPN
ahs-18399	29	46	et	et	PROPN
ahs-18399	29	47	al	al	PROPN
ahs-18399	29	48	.	.	PROPN
ahs-18399	29	49	,	,	PUNCT
ahs-18399	29	50	1997	1997	NUM
ahs-18399	29	51	;	;	PUNCT
ahs-18399	29	52	eyal	eyal	PROPN
ahs-18399	29	53	and	and	CCONJ
ahs-18399	29	54	levy	levy	NOUN
ahs-18399	29	55	,	,	PUNCT
ahs-18399	29	56	2002	2002	NUM
ahs-18399	29	57	;	;	PUNCT
ahs-18399	29	58	marti	marti	PROPN
ahs-18399	29	59	et	et	PROPN
ahs-18399	29	60	al	al	PROPN
ahs-18399	29	61	.	.	PROPN
ahs-18399	29	62	,	,	PUNCT
ahs-18399	29	63	2006	2006	NUM
ahs-18399	29	64	)	)	PUNCT
ahs-18399	29	65	.	.	PUNCT
ahs-18399	30	1	recently	recently	ADV
ahs-18399	30	2	,	,	PUNCT
ahs-18399	30	3	abuqamar	abuqamar	NOUN
ahs-18399	30	4	et	et	PROPN
ahs-18399	30	5	al	al	PROPN
ahs-18399	30	6	.	.	PROPN
ahs-18399	31	1	(	(	PUNCT
ahs-18399	31	2	2009	2009	NUM
ahs-18399	31	3	)	)	PUNCT
ahs-18399	31	4	suggested	suggest	VERB
ahs-18399	31	5	that	that	SCONJ
ahs-18399	31	6	micro	micro	PROPN
ahs-18399	31	7	-	-	NOUN
ahs-18399	31	8	tom	tom	PROPN
ahs-18399	31	9	is	be	AUX
ahs-18399	31	10	a	a	DET
ahs-18399	31	11	good	good	ADJ
ahs-18399	31	12	model	model	NOUN
ahs-18399	31	13	for	for	ADP
ahs-18399	31	14	studying	study	VERB
ahs-18399	31	15	the	the	DET
ahs-18399	31	16	crosstalk	crosstalk	NOUN
ahs-18399	31	17	between	between	ADP
ahs-18399	31	18	biotic	biotic	ADJ
ahs-18399	31	19	and	and	CCONJ
ahs-18399	31	20	abiotic	abiotic	ADJ
ahs-18399	31	21	stress	stress	NOUN
ahs-18399	31	22	responses	response	NOUN
ahs-18399	31	23	through	through	ADP
ahs-18399	31	24	regulation	regulation	NOUN
ahs-18399	31	25	of	of	ADP
ahs-18399	31	26	gene	gene	NOUN
ahs-18399	31	27	expression	expression	NOUN
ahs-18399	31	28	.	.	PUNCT
ahs-18399	32	1	in	in	ADP
ahs-18399	32	2	the	the	DET
ahs-18399	32	3	present	present	ADJ
ahs-18399	32	4	study	study	NOUN
ahs-18399	32	5	,	,	PUNCT
ahs-18399	32	6	cellular	cellular	ADJ
ahs-18399	32	7	damage	damage	NOUN
ahs-18399	32	8	(	(	PUNCT
ahs-18399	32	9	viz	viz	NOUN
ahs-18399	32	10	.	.	PUNCT
ahs-18399	32	11	cell	cell	NOUN
ahs-18399	32	12	death	death	NOUN
ahs-18399	32	13	increase	increase	NOUN
ahs-18399	32	14	in	in	ADP
ahs-18399	32	15	suspension	suspension	NOUN
ahs-18399	32	16	culture	culture	NOUN
ahs-18399	32	17	and	and	CCONJ
ahs-18399	32	18	increase	increase	VERB
ahs-18399	32	19	in	in	ADP
ahs-18399	32	20	ion	ion	NOUN
ahs-18399	32	21	leakage	leakage	NOUN
ahs-18399	32	22	at	at	ADP
ahs-18399	32	23	tissue	tissue	NOUN
ahs-18399	32	24	level	level	NOUN
ahs-18399	32	25	)	)	PUNCT
ahs-18399	32	26	and	and	CCONJ
ahs-18399	32	27	preceding	precede	VERB
ahs-18399	32	28	changes	change	NOUN
ahs-18399	32	29	in	in	ADP
ahs-18399	32	30	the	the	DET
ahs-18399	32	31	gene	gene	NOUN
ahs-18399	32	32	expression	expression	NOUN
ahs-18399	32	33	patterns	pattern	NOUN
ahs-18399	32	34	,	,	PUNCT
ahs-18399	32	35	especially	especially	ADV
ahs-18399	32	36	those	those	PRON
ahs-18399	32	37	of	of	ADP
ahs-18399	32	38	defence	defence	NOUN
ahs-18399	32	39	-	-	PUNCT
ahs-18399	32	40	related	relate	VERB
ahs-18399	32	41	,	,	PUNCT
ahs-18399	32	42	redox	redox	NOUN
ahs-18399	32	43	-	-	PUNCT
ahs-18399	32	44	related	relate	VERB
ahs-18399	32	45	,	,	PUNCT
ahs-18399	32	46	dna	dna	PROPN
ahs-18399	32	47	maintenance	maintenance	NOUN
ahs-18399	32	48	-	-	PUNCT
ahs-18399	32	49	related	relate	VERB
ahs-18399	32	50	and	and	CCONJ
ahs-18399	32	51	fruit	fruit	NOUN
ahs-18399	32	52	maturation	maturation	NOUN
ahs-18399	32	53	-	-	PUNCT
ahs-18399	32	54	related	relate	VERB
ahs-18399	32	55	genes	gene	NOUN
ahs-18399	32	56	,	,	PUNCT
ahs-18399	32	57	are	be	AUX
ahs-18399	32	58	shown	show	VERB
ahs-18399	32	59	to	to	PART
ahs-18399	32	60	be	be	AUX
ahs-18399	32	61	induced	induce	VERB
ahs-18399	32	62	by	by	ADP
ahs-18399	32	63	uv	uv	NOUN
ahs-18399	32	64	-	-	PUNCT
ahs-18399	32	65	a	a	NOUN
ahs-18399	32	66	and	and	CCONJ
ahs-18399	32	67	uv	uv	NOUN
ahs-18399	32	68	-	-	PUNCT
ahs-18399	32	69	c	c	NOUN
ahs-18399	32	70	in	in	ADP
ahs-18399	32	71	the	the	DET
ahs-18399	32	72	leaves	leave	NOUN
ahs-18399	32	73	,	,	PUNCT
ahs-18399	32	74	fruits	fruit	NOUN
ahs-18399	32	75	and	and	CCONJ
ahs-18399	32	76	suspension	suspension	NOUN
ahs-18399	32	77	-	-	PUNCT
ahs-18399	32	78	cultured	cultured	ADJ
ahs-18399	32	79	cells	cell	NOUN
ahs-18399	32	80	of	of	ADP
ahs-18399	32	81	micro	micro	NOUN
ahs-18399	32	82	-	-	PROPN
ahs-18399	32	83	tom	tom	PROPN
ahs-18399	32	84	.	.	PUNCT
ahs-18399	33	1	the	the	DET
ahs-18399	33	2	signalling	signal	VERB
ahs-18399	33	3	mechanisms	mechanism	NOUN
ahs-18399	33	4	contributing	contribute	VERB
ahs-18399	33	5	to	to	ADP
ahs-18399	33	6	the	the	DET
ahs-18399	33	7	regulation	regulation	NOUN
ahs-18399	33	8	of	of	ADP
ahs-18399	33	9	uv	uv	NOUN
ahs-18399	33	10	responses	response	NOUN
ahs-18399	33	11	are	be	AUX
ahs-18399	33	12	also	also	ADV
ahs-18399	33	13	discussed	discuss	VERB
ahs-18399	33	14	by	by	ADP
ahs-18399	33	15	analogy	analogy	NOUN
ahs-18399	33	16	to	to	PART
ahs-18399	33	17	plant	plant	VERB
ahs-18399	33	18	immunity	immunity	NOUN
ahs-18399	33	19	responses	response	NOUN
ahs-18399	33	20	.	.	PUNCT
ahs-18399	34	1	furthermore	furthermore	ADV
ahs-18399	34	2	,	,	PUNCT
ahs-18399	34	3	the	the	DET
ahs-18399	34	4	discussion	discussion	NOUN
ahs-18399	34	5	addresses	address	VERB
ahs-18399	34	6	uv	uv	NOUN
ahs-18399	34	7	-	-	PUNCT
ahs-18399	34	8	dependent	dependent	ADJ
ahs-18399	34	9	extension	extension	NOUN
ahs-18399	34	10	of	of	ADP
ahs-18399	34	11	the	the	DET
ahs-18399	34	12	storage	storage	NOUN
ahs-18399	34	13	life	life	NOUN
ahs-18399	34	14	of	of	ADP
ahs-18399	34	15	tomato	tomato	NOUN
ahs-18399	34	16	fruits	fruit	NOUN
ahs-18399	34	17	through	through	ADP
ahs-18399	34	18	stimulation	stimulation	NOUN
ahs-18399	34	19	of	of	ADP
ahs-18399	34	20	plant	plant	NOUN
ahs-18399	34	21	immunity	immunity	NOUN
ahs-18399	34	22	mechanism	mechanism	NOUN
ahs-18399	34	23	by	by	ADP
ahs-18399	34	24	post	post	ADJ
ahs-18399	34	25	-	-	ADJ
ahs-18399	34	26	harvest	harvest	ADJ
ahs-18399	34	27	exposure	exposure	NOUN
ahs-18399	34	28	to	to	ADP
ahs-18399	34	29	uvs	uvs	PROPN
ahs-18399	34	30	.	.	PROPN
ahs-18399	35	1	2	2	X
ahs-18399	35	2	.	.	X
ahs-18399	35	3	materials	material	NOUN
ahs-18399	35	4	and	and	CCONJ
ahs-18399	35	5	methods	method	NOUN
ahs-18399	35	6	plant	plant	NOUN
ahs-18399	35	7	materials	material	NOUN
ahs-18399	35	8	following	follow	VERB
ahs-18399	35	9	the	the	DET
ahs-18399	35	10	protocols	protocol	NOUN
ahs-18399	35	11	described	describe	VERB
ahs-18399	35	12	elsewhere	elsewhere	ADV
ahs-18399	35	13	(	(	PUNCT
ahs-18399	35	14	kadono	kadono	PROPN
ahs-18399	35	15	et	et	PROPN
ahs-18399	35	16	al	al	PROPN
ahs-18399	35	17	.	.	PROPN
ahs-18399	35	18	,	,	PUNCT
ahs-18399	35	19	2009	2009	NUM
ahs-18399	35	20	)	)	PUNCT
ahs-18399	35	21	,	,	PUNCT
ahs-18399	35	22	seeds	seed	NOUN
ahs-18399	35	23	of	of	ADP
ahs-18399	35	24	tomato	tomato	NOUN
ahs-18399	35	25	(	(	PUNCT
ahs-18399	35	26	solanum	solanum	NOUN
ahs-18399	35	27	lycopersicum	lycopersicum	PROPN
ahs-18399	35	28	l.	l.	PROPN
ahs-18399	35	29	,	,	PUNCT
ahs-18399	35	30	cv	cv	PROPN
ahs-18399	35	31	.	.	PROPN
ahs-18399	35	32	micro	micro	PROPN
ahs-18399	35	33	-	-	PROPN
ahs-18399	35	34	tom	tom	PROPN
ahs-18399	35	35	)	)	PUNCT
ahs-18399	35	36	were	be	AUX
ahs-18399	35	37	allowed	allow	VERB
ahs-18399	35	38	to	to	PART
ahs-18399	35	39	germinate	germinate	VERB
ahs-18399	35	40	on	on	ADP
ahs-18399	35	41	a	a	DET
ahs-18399	35	42	wet	wet	ADJ
ahs-18399	35	43	paper	paper	NOUN
ahs-18399	35	44	towel	towel	NOUN
ahs-18399	35	45	in	in	ADP
ahs-18399	35	46	a	a	DET
ahs-18399	35	47	transparent	transparent	ADJ
ahs-18399	35	48	plastic	plastic	NOUN
ahs-18399	35	49	container	container	NOUN
ahs-18399	35	50	placed	place	VERB
ahs-18399	35	51	in	in	ADP
ahs-18399	35	52	a	a	DET
ahs-18399	35	53	light	light	ADJ
ahs-18399	35	54	-	-	PUNCT
ahs-18399	35	55	cycleconditioned	cycleconditione	VERB
ahs-18399	35	56	incubator	incubator	NOUN
ahs-18399	35	57	(	(	PUNCT
ahs-18399	35	58	12	12	NUM
ahs-18399	35	59	h	h	NOUN
ahs-18399	35	60	light	light	NOUN
ahs-18399	35	61	and	and	CCONJ
ahs-18399	35	62	12	12	NUM
ahs-18399	35	63	h	h	NOUN
ahs-18399	35	64	dark	dark	ADJ
ahs-18399	35	65	at	at	ADP
ahs-18399	35	66	23	23	NUM
ahs-18399	35	67	°	°	NOUN
ahs-18399	35	68	c	c	NOUN
ahs-18399	35	69	)	)	PUNCT
ahs-18399	35	70	.	.	PUNCT
ahs-18399	36	1	immediatly	immediatly	ADV
ahs-18399	36	2	after	after	ADP
ahs-18399	36	3	germination	germination	NOUN
ahs-18399	36	4	the	the	DET
ahs-18399	36	5	resulting	result	VERB
ahs-18399	36	6	plantlets	plantlet	NOUN
ahs-18399	36	7	were	be	AUX
ahs-18399	36	8	re	re	VERB
ahs-18399	36	9	-	-	VERB
ahs-18399	36	10	planted	plant	VERB
ahs-18399	36	11	in	in	ADP
ahs-18399	36	12	plastic	plastic	ADJ
ahs-18399	36	13	pots	pot	NOUN
ahs-18399	36	14	filled	fill	VERB
ahs-18399	36	15	with	with	ADP
ahs-18399	36	16	a	a	DET
ahs-18399	36	17	standard	standard	ADJ
ahs-18399	36	18	soil	soil	NOUN
ahs-18399	36	19	mixture	mixture	NOUN
ahs-18399	36	20	and	and	CCONJ
ahs-18399	36	21	watered	water	VERB
ahs-18399	36	22	daily	daily	ADV
ahs-18399	36	23	in	in	ADP
ahs-18399	36	24	the	the	DET
ahs-18399	36	25	light	light	ADJ
ahs-18399	36	26	-	-	PUNCT
ahs-18399	36	27	cycle	cycle	NOUN
ahs-18399	36	28	-	-	PUNCT
ahs-18399	36	29	controlled	control	VERB
ahs-18399	36	30	incubator	incubator	NOUN
ahs-18399	36	31	for	for	ADP
ahs-18399	36	32	three	three	NUM
ahs-18399	36	33	months	month	NOUN
ahs-18399	36	34	.	.	PUNCT
ahs-18399	37	1	from	from	ADP
ahs-18399	37	2	the	the	DET
ahs-18399	37	3	adult	adult	NOUN
ahs-18399	37	4	plants	plant	NOUN
ahs-18399	37	5	,	,	PUNCT
ahs-18399	37	6	leaflets	leaflet	NOUN
ahs-18399	37	7	,	,	PUNCT
ahs-18399	37	8	green	green	ADJ
ahs-18399	37	9	immature	immature	ADJ
ahs-18399	37	10	and	and	CCONJ
ahs-18399	37	11	red	red	ADJ
ahs-18399	37	12	ripe	ripe	ADJ
ahs-18399	37	13	fruits	fruit	NOUN
ahs-18399	37	14	(	(	PUNCT
ahs-18399	37	15	minimum	minimum	ADJ
ahs-18399	37	16	size	size	NOUN
ahs-18399	37	17	,	,	PUNCT
ahs-18399	37	18	15	15	NUM
ahs-18399	37	19	mm	mm	NOUN
ahs-18399	37	20	in	in	ADP
ahs-18399	37	21	diameter	diameter	NOUN
ahs-18399	37	22	)	)	PUNCT
ahs-18399	37	23	were	be	AUX
ahs-18399	37	24	harvested	harvest	VERB
ahs-18399	37	25	before	before	ADV
ahs-18399	37	26	and	and	CCONJ
ahs-18399	37	27	after	after	ADP
ahs-18399	37	28	irradiation	irradiation	NOUN
ahs-18399	37	29	with	with	ADP
ahs-18399	37	30	uv	uv	NOUN
ahs-18399	37	31	lights	light	NOUN
ahs-18399	37	32	.	.	PUNCT
ahs-18399	38	1	preparation	preparation	NOUN
ahs-18399	38	2	of	of	ADP
ahs-18399	38	3	cell	cell	NOUN
ahs-18399	38	4	suspension	suspension	NOUN
ahs-18399	38	5	culture	culture	NOUN
ahs-18399	38	6	again	again	ADV
ahs-18399	38	7	,	,	PUNCT
ahs-18399	38	8	following	follow	VERB
ahs-18399	38	9	protocols	protocol	NOUN
ahs-18399	38	10	described	describe	VERB
ahs-18399	38	11	elsewhere	elsewhere	ADV
ahs-18399	38	12	(	(	PUNCT
ahs-18399	38	13	kadono	kadono	PROPN
ahs-18399	38	14	et	et	PROPN
ahs-18399	38	15	al	al	PROPN
ahs-18399	38	16	.	.	PROPN
ahs-18399	38	17	,	,	PUNCT
ahs-18399	38	18	2009	2009	NUM
ahs-18399	38	19	)	)	PUNCT
ahs-18399	38	20	,	,	PUNCT
ahs-18399	38	21	cell	cell	NOUN
ahs-18399	38	22	suspension	suspension	NOUN
ahs-18399	38	23	culture	culture	NOUN
ahs-18399	38	24	derived	derive	VERB
ahs-18399	38	25	from	from	ADP
ahs-18399	38	26	micro	micro	NOUN
ahs-18399	38	27	-	-	NOUN
ahs-18399	38	28	tom	tom	PROPN
ahs-18399	38	29	was	be	AUX
ahs-18399	38	30	prepared	prepare	VERB
ahs-18399	38	31	.	.	PUNCT
ahs-18399	39	1	briefly	briefly	ADV
ahs-18399	39	2	,	,	PUNCT
ahs-18399	39	3	the	the	DET
ahs-18399	39	4	leaf	leaf	NOUN
ahs-18399	39	5	slices	slice	NOUN
ahs-18399	39	6	were	be	AUX
ahs-18399	39	7	taken	take	VERB
ahs-18399	39	8	from	from	ADP
ahs-18399	39	9	a	a	DET
ahs-18399	39	10	seedling	seedling	NOUN
ahs-18399	39	11	of	of	ADP
ahs-18399	39	12	micro	micro	NOUN
ahs-18399	39	13	-	-	PROPN
ahs-18399	39	14	tom	tom	PROPN
ahs-18399	39	15	grown	grow	VERB
ahs-18399	39	16	in	in	ADP
ahs-18399	39	17	vitro	vitro	X
ahs-18399	39	18	and	and	CCONJ
ahs-18399	39	19	placed	place	VERB
ahs-18399	39	20	on	on	ADP
ahs-18399	39	21	a	a	DET
ahs-18399	39	22	ms	ms	NOUN
ahs-18399	39	23	agar	agar	NOUN
ahs-18399	39	24	plate	plate	NOUN
ahs-18399	39	25	containing	contain	VERB
ahs-18399	39	26	2,4	2,4	NUM
ahs-18399	39	27	-	-	PUNCT
ahs-18399	39	28	dichlorophenoxyacetic	dichlorophenoxyacetic	ADJ
ahs-18399	39	29	acid	acid	NOUN
ahs-18399	39	30	(	(	PUNCT
ahs-18399	39	31	0.2	0.2	NUM
ahs-18399	39	32	μg	μg	PROPN
ahs-18399	39	33	ml-1	ml-1	PRON
ahs-18399	39	34	)	)	PUNCT
ahs-18399	39	35	to	to	PART
ahs-18399	39	36	promote	promote	VERB
ahs-18399	39	37	the	the	DET
ahs-18399	39	38	formation	formation	NOUN
ahs-18399	39	39	of	of	ADP
ahs-18399	39	40	calli	calli	NOUN
ahs-18399	39	41	.	.	PUNCT
ahs-18399	40	1	suspension	suspension	NOUN
ahs-18399	40	2	culture	culture	NOUN
ahs-18399	40	3	of	of	ADP
ahs-18399	40	4	cells	cell	NOUN
ahs-18399	40	5	was	be	AUX
ahs-18399	40	6	initiated	initiate	VERB
ahs-18399	40	7	by	by	ADP
ahs-18399	40	8	addition	addition	NOUN
ahs-18399	40	9	of	of	ADP
ahs-18399	40	10	the	the	DET
ahs-18399	40	11	sliced	slice	VERB
ahs-18399	40	12	calli	calli	NOUN
ahs-18399	40	13	into	into	ADP
ahs-18399	40	14	the	the	DET
ahs-18399	40	15	ms	ms	NOUN
ahs-18399	40	16	liquid	liquid	ADJ
ahs-18399	40	17	medium	medium	NOUN
ahs-18399	40	18	(	(	PUNCT
ahs-18399	40	19	ph	ph	NOUN
ahs-18399	40	20	5.8	5.8	NUM
ahs-18399	40	21	)	)	PUNCT
ahs-18399	40	22	.	.	PUNCT
ahs-18399	41	1	the	the	DET
ahs-18399	41	2	cells	cell	NOUN
ahs-18399	41	3	suspended	suspend	VERB
ahs-18399	41	4	in	in	ADP
ahs-18399	41	5	30	30	NUM
ahs-18399	41	6	ml	ml	NOUN
ahs-18399	41	7	of	of	ADP
ahs-18399	41	8	media	medium	NOUN
ahs-18399	41	9	in	in	ADP
ahs-18399	41	10	100	100	NUM
ahs-18399	41	11	ml	ml	ADJ
ahs-18399	41	12	-	-	PUNCT
ahs-18399	41	13	conical	conical	ADJ
ahs-18399	41	14	flasks	flask	NOUN
ahs-18399	41	15	were	be	AUX
ahs-18399	41	16	kept	keep	VERB
ahs-18399	41	17	on	on	ADP
ahs-18399	41	18	gyratory	gyratory	ADJ
ahs-18399	41	19	shakers	shaker	NOUN
ahs-18399	41	20	(	(	PUNCT
ahs-18399	41	21	at	at	ADP
ahs-18399	41	22	130	130	NUM
ahs-18399	41	23	rpm	rpm	NOUN
ahs-18399	41	24	)	)	PUNCT
ahs-18399	41	25	at	at	ADP
ahs-18399	41	26	23	23	NUM
ahs-18399	41	27	°	°	ADP
ahs-18399	41	28	c	c	NOUN
ahs-18399	41	29	in	in	ADP
ahs-18399	41	30	darkness	darkness	NOUN
ahs-18399	41	31	,	,	PUNCT
ahs-18399	41	32	with	with	ADP
ahs-18399	41	33	occasional	occasional	ADJ
ahs-18399	41	34	sub	sub	NOUN
ahs-18399	41	35	-	-	NOUN
ahs-18399	41	36	cultures	culture	NOUN
ahs-18399	41	37	by	by	ADP
ahs-18399	41	38	innoculating	innoculate	VERB
ahs-18399	41	39	the	the	DET
ahs-18399	41	40	fresh	fresh	ADJ
ahs-18399	41	41	media	medium	NOUN
ahs-18399	41	42	with	with	ADP
ahs-18399	41	43	3	3	NUM
ahs-18399	41	44	ml	ml	NOUN
ahs-18399	41	45	of	of	ADP
ahs-18399	41	46	confluent	confluent	ADJ
ahs-18399	41	47	culture	culture	NOUN
ahs-18399	41	48	.	.	PUNCT
ahs-18399	42	1	after	after	ADP
ahs-18399	42	2	about	about	ADV
ahs-18399	42	3	six	six	NUM
ahs-18399	42	4	months	month	NOUN
ahs-18399	42	5	of	of	ADP
ahs-18399	42	6	continuous	continuous	ADJ
ahs-18399	42	7	propagation	propagation	NOUN
ahs-18399	42	8	of	of	ADP
ahs-18399	42	9	the	the	DET
ahs-18399	42	10	cells	cell	NOUN
ahs-18399	42	11	with	with	ADP
ahs-18399	42	12	constant	constant	ADJ
ahs-18399	42	13	sub	sub	NOUN
ahs-18399	42	14	-	-	ADJ
ahs-18399	42	15	culturing	culturing	ADJ
ahs-18399	42	16	(	(	PUNCT
ahs-18399	42	17	initially	initially	ADV
ahs-18399	42	18	twice	twice	DET
ahs-18399	42	19	a	a	DET
ahs-18399	42	20	month	month	NOUN
ahs-18399	42	21	and	and	CCONJ
ahs-18399	42	22	later	later	ADV
ahs-18399	42	23	once	once	ADV
ahs-18399	42	24	a	a	DET
ahs-18399	42	25	week	week	NOUN
ahs-18399	42	26	)	)	PUNCT
ahs-18399	42	27	,	,	PUNCT
ahs-18399	42	28	a	a	DET
ahs-18399	42	29	stable	stable	ADJ
ahs-18399	42	30	cell	cell	NOUN
ahs-18399	42	31	line	line	NOUN
ahs-18399	42	32	was	be	AUX
ahs-18399	42	33	obtained	obtain	VERB
ahs-18399	42	34	.	.	PUNCT
ahs-18399	43	1	for	for	ADP
ahs-18399	43	2	experimental	experimental	ADJ
ahs-18399	43	3	purposes	purpose	NOUN
ahs-18399	43	4	,	,	PUNCT
ahs-18399	43	5	the	the	DET
ahs-18399	43	6	culture	culture	NOUN
ahs-18399	43	7	was	be	AUX
ahs-18399	43	8	pre	pre	VERB
ahs-18399	43	9	-	-	VERB
ahs-18399	43	10	conditioned	condition	VERB
ahs-18399	43	11	as	as	SCONJ
ahs-18399	43	12	follows	follow	VERB
ahs-18399	43	13	.	.	PUNCT
ahs-18399	44	1	the	the	DET
ahs-18399	44	2	confluent	confluent	ADJ
ahs-18399	44	3	culture	culture	NOUN
ahs-18399	44	4	was	be	AUX
ahs-18399	44	5	used	use	VERB
ahs-18399	44	6	to	to	PART
ahs-18399	44	7	inoculate	inoculate	VERB
ahs-18399	44	8	the	the	DET
ahs-18399	44	9	fresh	fresh	ADJ
ahs-18399	44	10	ms	ms	NOUN
ahs-18399	44	11	liquid	liquid	ADJ
ahs-18399	44	12	medium	medium	NOUN
ahs-18399	44	13	(	(	PUNCT
ahs-18399	44	14	3	3	NUM
ahs-18399	44	15	ml	ml	NOUN
ahs-18399	44	16	culture	culture	NOUN
ahs-18399	44	17	to	to	ADP
ahs-18399	44	18	30	30	NUM
ahs-18399	44	19	ml	ml	NOUN
ahs-18399	44	20	medium	medium	NOUN
ahs-18399	44	21	)	)	PUNCT
ahs-18399	44	22	and	and	CCONJ
ahs-18399	44	23	pre	pre	VERB
ahs-18399	44	24	-	-	ADJ
ahs-18399	44	25	cultured	cultured	ADJ
ahs-18399	44	26	for	for	ADP
ahs-18399	44	27	three	three	NUM
ahs-18399	44	28	days	day	NOUN
ahs-18399	44	29	.	.	PUNCT
ahs-18399	45	1	then	then	ADV
ahs-18399	45	2	6.5	6.5	NUM
ahs-18399	45	3	ml	ml	NOUN
ahs-18399	45	4	of	of	ADP
ahs-18399	45	5	each	each	DET
ahs-18399	45	6	pre	pre	NOUN
ahs-18399	45	7	-	-	NOUN
ahs-18399	45	8	culture	culture	NOUN
ahs-18399	45	9	was	be	AUX
ahs-18399	45	10	transferred	transfer	VERB
ahs-18399	45	11	to	to	ADP
ahs-18399	45	12	100	100	NUM
ahs-18399	45	13	ml	ml	NOUN
ahs-18399	45	14	of	of	ADP
ahs-18399	45	15	fresh	fresh	ADJ
ahs-18399	45	16	ms	ms	NOUN
ahs-18399	45	17	liquid	liquid	ADJ
ahs-18399	45	18	medium	medium	NOUN
ahs-18399	45	19	(	(	PUNCT
ahs-18399	45	20	in	in	ADP
ahs-18399	45	21	a	a	DET
ahs-18399	45	22	500	500	NUM
ahs-18399	45	23	ml	ml	NOUN
ahs-18399	45	24	conical	conical	ADJ
ahs-18399	45	25	flask	flask	NOUN
ahs-18399	45	26	)	)	PUNCT
ahs-18399	45	27	and	and	CCONJ
ahs-18399	45	28	further	far	ADV
ahs-18399	45	29	cultured	cultured	ADJ
ahs-18399	45	30	for	for	ADP
ahs-18399	45	31	three	three	NUM
ahs-18399	45	32	days	day	NOUN
ahs-18399	45	33	.	.	PUNCT
ahs-18399	46	1	the	the	DET
ahs-18399	46	2	resultant	resultant	NOUN
ahs-18399	46	3	three	three	NUM
ahs-18399	46	4	-	-	PUNCT
ahs-18399	46	5	day	day	NOUN
ahs-18399	46	6	-	-	PUNCT
ahs-18399	46	7	old	old	ADJ
ahs-18399	46	8	large	large	ADJ
ahs-18399	46	9	scale	scale	NOUN
ahs-18399	46	10	culture	culture	NOUN
ahs-18399	46	11	(	(	PUNCT
ahs-18399	46	12	at	at	ADP
ahs-18399	46	13	log	log	NOUN
ahs-18399	46	14	-	-	PUNCT
ahs-18399	46	15	phase	phase	NOUN
ahs-18399	46	16	)	)	PUNCT
ahs-18399	46	17	was	be	AUX
ahs-18399	46	18	harvested	harvest	VERB
ahs-18399	46	19	and	and	CCONJ
ahs-18399	46	20	used	use	VERB
ahs-18399	46	21	for	for	ADP
ahs-18399	46	22	the	the	DET
ahs-18399	46	23	experiments	experiment	NOUN
ahs-18399	46	24	.	.	PUNCT
ahs-18399	47	1	uv	uv	NOUN
ahs-18399	47	2	treatments	treatment	NOUN
ahs-18399	47	3	intact	intact	ADJ
ahs-18399	47	4	and/or	and/or	CCONJ
ahs-18399	47	5	excised	excise	VERB
ahs-18399	47	6	leaves	leave	NOUN
ahs-18399	47	7	(	(	PUNCT
ahs-18399	47	8	leaflets	leaflet	NOUN
ahs-18399	47	9	and	and	CCONJ
ahs-18399	47	10	leaf	leaf	NOUN
ahs-18399	47	11	disks	disk	NOUN
ahs-18399	47	12	)	)	PUNCT
ahs-18399	47	13	,	,	PUNCT
ahs-18399	47	14	green	green	ADJ
ahs-18399	47	15	and	and	CCONJ
ahs-18399	47	16	red	red	ADJ
ahs-18399	47	17	fruits	fruit	NOUN
ahs-18399	47	18	,	,	PUNCT
ahs-18399	47	19	and	and	CCONJ
ahs-18399	47	20	suspension	suspension	NOUN
ahs-18399	47	21	-	-	PUNCT
ahs-18399	47	22	cultured	cultured	ADJ
ahs-18399	47	23	cells	cell	NOUN
ahs-18399	47	24	of	of	ADP
ahs-18399	47	25	microtom	microtom	NOUN
ahs-18399	47	26	were	be	AUX
ahs-18399	47	27	irradiated	irradiate	VERB
ahs-18399	47	28	with	with	ADP
ahs-18399	47	29	uv	uv	NOUN
ahs-18399	47	30	-	-	PUNCT
ahs-18399	47	31	c	c	NOUN
ahs-18399	47	32	(	(	PUNCT
ahs-18399	47	33	254	254	NUM
ahs-18399	47	34	nm	nm	NOUN
ahs-18399	47	35	)	)	PUNCT
ahs-18399	47	36	or	or	CCONJ
ahs-18399	47	37	uv	uv	NOUN
ahs-18399	47	38	-	-	PUNCT
ahs-18399	47	39	a	a	PRON
ahs-18399	47	40	(	(	PUNCT
ahs-18399	47	41	365	365	NUM
ahs-18399	47	42	nm	nm	NOUN
ahs-18399	47	43	)	)	PUNCT
ahs-18399	47	44	using	use	VERB
ahs-18399	47	45	a	a	DET
ahs-18399	47	46	handy	handy	ADJ
ahs-18399	47	47	uv	uv	NOUN
ahs-18399	47	48	trans	trans	NOUN
ahs-18399	47	49	-	-	NOUN
ahs-18399	47	50	illuminator	illuminator	NOUN
ahs-18399	47	51	(	(	PUNCT
ahs-18399	47	52	sluv-4	sluv-4	PROPN
ahs-18399	47	53	,	,	PUNCT
ahs-18399	47	54	as	as	ADP
ahs-18399	47	55	-	-	PUNCT
ahs-18399	47	56	one	one	NUM
ahs-18399	47	57	,	,	PUNCT
ahs-18399	47	58	osaka	osaka	PROPN
ahs-18399	47	59	,	,	PUNCT
ahs-18399	47	60	japan	japan	PROPN
ahs-18399	47	61	)	)	PUNCT
ahs-18399	47	62	.	.	PUNCT
ahs-18399	48	1	the	the	DET
ahs-18399	48	2	intensities	intensity	NOUN
ahs-18399	48	3	of	of	ADP
ahs-18399	48	4	uv	uv	NOUN
ahs-18399	48	5	-	-	PUNCT
ahs-18399	48	6	a	a	NOUN
ahs-18399	48	7	and	and	CCONJ
ahs-18399	48	8	uv	uv	NOUN
ahs-18399	48	9	-	-	PUNCT
ahs-18399	48	10	c	c	NOUN
ahs-18399	48	11	were	be	AUX
ahs-18399	48	12	monitored	monitor	VERB
ahs-18399	48	13	with	with	ADP
ahs-18399	48	14	uv	uv	NOUN
ahs-18399	48	15	meters	meter	NOUN
ahs-18399	48	16	(	(	PUNCT
ahs-18399	48	17	uvx-25	uvx-25	PROPN
ahs-18399	48	18	,	,	PUNCT
ahs-18399	48	19	uvp	uvp	PROPN
ahs-18399	48	20	inc	inc	PROPN
ahs-18399	48	21	.	.	PROPN
ahs-18399	48	22	,	,	PUNCT
ahs-18399	48	23	upland	upland	NOUN
ahs-18399	48	24	,	,	PUNCT
ahs-18399	48	25	ca	ca	NOUN
ahs-18399	48	26	;	;	PUNCT
ahs-18399	48	27	yk-34uv	yk-34uv	PROPN
ahs-18399	48	28	,	,	PUNCT
ahs-18399	48	29	lutoron	lutoron	ADJ
ahs-18399	48	30	electronic	electronic	ADJ
ahs-18399	48	31	enterprise	enterprise	PROPN
ahs-18399	48	32	co.	co.	PROPN
ahs-18399	48	33	,	,	PUNCT
ahs-18399	48	34	ltd	ltd	PROPN
ahs-18399	48	35	.	.	PROPN
ahs-18399	48	36	,	,	PUNCT
ahs-18399	48	37	taipei	taipei	PROPN
ahs-18399	48	38	,	,	PUNCT
ahs-18399	48	39	taiwan	taiwan	PROPN
ahs-18399	48	40	)	)	PUNCT
ahs-18399	48	41	and	and	CCONJ
ahs-18399	48	42	the	the	DET
ahs-18399	48	43	intensity	intensity	NOUN
ahs-18399	48	44	of	of	ADP
ahs-18399	48	45	uv	uv	NOUN
ahs-18399	48	46	-	-	PUNCT
ahs-18399	48	47	a	a	NOUN
ahs-18399	48	48	and	and	CCONJ
ahs-18399	48	49	uv	uv	NOUN
ahs-18399	48	50	-	-	PUNCT
ahs-18399	48	51	c	c	NOUN
ahs-18399	48	52	applied	apply	VERB
ahs-18399	48	53	to	to	ADP
ahs-18399	48	54	the	the	DET
ahs-18399	48	55	surfaces	surface	NOUN
ahs-18399	48	56	of	of	ADP
ahs-18399	48	57	plant	plant	NOUN
ahs-18399	48	58	materials	material	NOUN
ahs-18399	48	59	were	be	AUX
ahs-18399	48	60	adjusted	adjust	VERB
ahs-18399	48	61	to	to	ADP
ahs-18399	48	62	2.2	2.2	NUM
ahs-18399	48	63	mw	mw	NOUN
ahs-18399	48	64	cm-2	cm-2	NOUN
ahs-18399	48	65	,	,	PUNCT
ahs-18399	48	66	therefore	therefore	ADV
ahs-18399	48	67	the	the	DET
ahs-18399	48	68	doses	dose	NOUN
ahs-18399	48	69	of	of	ADP
ahs-18399	48	70	uv	uv	NOUN
ahs-18399	48	71	irradiation	irradiation	NOUN
ahs-18399	48	72	were	be	AUX
ahs-18399	48	73	controlled	control	VERB
ahs-18399	48	74	by	by	ADP
ahs-18399	48	75	altering	alter	VERB
ahs-18399	48	76	the	the	DET
ahs-18399	48	77	length	length	NOUN
ahs-18399	48	78	of	of	ADP
ahs-18399	48	79	irradiation	irradiation	NOUN
ahs-18399	48	80	time	time	NOUN
ahs-18399	48	81	.	.	PUNCT
ahs-18399	49	1	leaflets	leaflet	NOUN
ahs-18399	49	2	and	and	CCONJ
ahs-18399	49	3	fruits	fruit	NOUN
ahs-18399	49	4	were	be	AUX
ahs-18399	49	5	exposed	expose	VERB
ahs-18399	49	6	to	to	ADP
ahs-18399	49	7	uv	uv	NOUN
ahs-18399	49	8	rays	ray	NOUN
ahs-18399	49	9	immediately	immediately	ADV
ahs-18399	49	10	after	after	ADP
ahs-18399	49	11	harvest	harvest	NOUN
ahs-18399	49	12	.	.	PUNCT
ahs-18399	50	1	to	to	PART
ahs-18399	50	2	prevent	prevent	VERB
ahs-18399	50	3	water	water	NOUN
ahs-18399	50	4	loss	loss	NOUN
ahs-18399	50	5	from	from	ADP
ahs-18399	50	6	the	the	DET
ahs-18399	50	7	leafy	leafy	ADJ
ahs-18399	50	8	samples	sample	NOUN
ahs-18399	50	9	during	during	ADP
ahs-18399	50	10	uv	uv	NOUN
ahs-18399	50	11	irradiation	irradiation	NOUN
ahs-18399	50	12	and	and	CCONJ
ahs-18399	50	13	incubation	incubation	NOUN
ahs-18399	50	14	,	,	PUNCT
ahs-18399	50	15	leaflets	leaflet	NOUN
ahs-18399	50	16	and	and	CCONJ
ahs-18399	50	17	leaf	leaf	NOUN
ahs-18399	50	18	discs	disc	NOUN
ahs-18399	50	19	were	be	AUX
ahs-18399	50	20	floated	float	VERB
ahs-18399	50	21	on	on	ADP
ahs-18399	50	22	ultrapure	ultrapure	ADJ
ahs-18399	50	23	water	water	NOUN
ahs-18399	50	24	in	in	ADP
ahs-18399	50	25	petri	petri	ADJ
ahs-18399	50	26	dishes	dish	NOUN
ahs-18399	50	27	.	.	PUNCT
ahs-18399	51	1	for	for	ADP
ahs-18399	51	2	treatment	treatment	NOUN
ahs-18399	51	3	of	of	ADP
ahs-18399	51	4	the	the	DET
ahs-18399	51	5	cultured	cultured	ADJ
ahs-18399	51	6	cells	cell	NOUN
ahs-18399	51	7	,	,	PUNCT
ahs-18399	51	8	1	1	NUM
ahs-18399	51	9	ml	ml	NOUN
ahs-18399	51	10	of	of	ADP
ahs-18399	51	11	cell	cell	NOUN
ahs-18399	51	12	suspension	suspension	NOUN
ahs-18399	51	13	was	be	AUX
ahs-18399	51	14	added	add	VERB
ahs-18399	51	15	to	to	ADP
ahs-18399	51	16	each	each	DET
ahs-18399	51	17	well	well	NOUN
ahs-18399	51	18	on	on	ADP
ahs-18399	51	19	12	12	NUM
ahs-18399	51	20	-	-	PUNCT
ahs-18399	51	21	well	well	NOUN
ahs-18399	51	22	microplates	microplate	NOUN
ahs-18399	51	23	and	and	CCONJ
ahs-18399	51	24	used	use	VERB
ahs-18399	51	25	for	for	ADP
ahs-18399	51	26	irradiation	irradiation	NOUN
ahs-18399	51	27	with	with	ADP
ahs-18399	51	28	uv	uv	NOUN
ahs-18399	51	29	rays	ray	NOUN
ahs-18399	51	30	.	.	PUNCT
ahs-18399	52	1	irradiation	irradiation	NOUN
ahs-18399	52	2	time	time	NOUN
ahs-18399	52	3	varied	varied	ADJ
ahs-18399	52	4	as	as	SCONJ
ahs-18399	52	5	indicated	indicate	VERB
ahs-18399	52	6	in	in	ADP
ahs-18399	52	7	the	the	DET
ahs-18399	52	8	results	result	NOUN
ahs-18399	52	9	section	section	NOUN
ahs-18399	52	10	.	.	PUNCT
ahs-18399	53	1	measurement	measurement	NOUN
ahs-18399	53	2	of	of	ADP
ahs-18399	53	3	ion	ion	NOUN
ahs-18399	53	4	leakage	leakage	NOUN
ahs-18399	53	5	from	from	ADP
ahs-18399	53	6	leaf	leaf	NOUN
ahs-18399	53	7	discs	disc	NOUN
ahs-18399	53	8	measurements	measurement	NOUN
ahs-18399	53	9	of	of	ADP
ahs-18399	53	10	ion	ion	NOUN
ahs-18399	53	11	leakage	leakage	NOUN
ahs-18399	53	12	were	be	AUX
ahs-18399	53	13	performed	perform	VERB
ahs-18399	53	14	using	use	VERB
ahs-18399	53	15	the	the	DET
ahs-18399	53	16	discs	disc	NOUN
ahs-18399	53	17	of	of	ADP
ahs-18399	53	18	leaflets	leaflet	NOUN
ahs-18399	53	19	floated	float	VERB
ahs-18399	53	20	on	on	ADP
ahs-18399	53	21	the	the	DET
ahs-18399	53	22	ultrapure	ultrapure	NOUN
ahs-18399	53	23	water	water	NOUN
ahs-18399	53	24	.	.	PUNCT
ahs-18399	54	1	leaf	leaf	NOUN
ahs-18399	54	2	discs	disc	NOUN
ahs-18399	54	3	were	be	AUX
ahs-18399	54	4	irradiated	irradiate	VERB
ahs-18399	54	5	with	with	ADP
ahs-18399	54	6	uv	uv	NOUN
ahs-18399	54	7	rays	ray	NOUN
ahs-18399	54	8	for	for	ADP
ahs-18399	54	9	30	30	NUM
ahs-18399	54	10	min	min	NOUN
ahs-18399	54	11	and	and	CCONJ
ahs-18399	54	12	further	further	ADJ
ahs-18399	54	13	in135	in135	NOUN
ahs-18399	54	14	cubated	cubate	VERB
ahs-18399	54	15	in	in	ADP
ahs-18399	54	16	darkness	darkness	NOUN
ahs-18399	54	17	for	for	ADP
ahs-18399	54	18	up	up	ADP
ahs-18399	54	19	to	to	PART
ahs-18399	54	20	24	24	NUM
ahs-18399	54	21	h.	h.	NOUN
ahs-18399	54	22	each	each	DET
ahs-18399	54	23	single	single	ADJ
ahs-18399	54	24	well	well	ADV
ahs-18399	54	25	on	on	SCONJ
ahs-18399	54	26	a	a	DET
ahs-18399	54	27	12	12	NUM
ahs-18399	54	28	-	-	PUNCT
ahs-18399	54	29	well	well	NOUN
ahs-18399	54	30	microplate	microplate	NOUN
ahs-18399	54	31	was	be	AUX
ahs-18399	54	32	filled	fill	VERB
ahs-18399	54	33	with	with	ADP
ahs-18399	54	34	5	5	NUM
ahs-18399	54	35	ml	ml	NOUN
ahs-18399	54	36	of	of	ADP
ahs-18399	54	37	ultrapure	ultrapure	NOUN
ahs-18399	54	38	water	water	NOUN
ahs-18399	54	39	and	and	CCONJ
ahs-18399	54	40	used	use	VERB
ahs-18399	54	41	to	to	PART
ahs-18399	54	42	float	float	VERB
ahs-18399	54	43	three	three	NUM
ahs-18399	54	44	leaf	leaf	NOUN
ahs-18399	54	45	discs	disc	NOUN
ahs-18399	54	46	(	(	PUNCT
ahs-18399	54	47	diameter	diameter	NOUN
ahs-18399	54	48	,	,	PUNCT
ahs-18399	54	49	9	9	NUM
ahs-18399	54	50	mm	mm	NOUN
ahs-18399	54	51	)	)	PUNCT
ahs-18399	54	52	freshly	freshly	ADV
ahs-18399	54	53	prepared	prepare	VERB
ahs-18399	54	54	from	from	ADP
ahs-18399	54	55	the	the	DET
ahs-18399	54	56	leaflets	leaflet	NOUN
ahs-18399	54	57	.	.	PUNCT
ahs-18399	55	1	using	use	VERB
ahs-18399	55	2	a	a	DET
ahs-18399	55	3	handheld	handheld	ADJ
ahs-18399	55	4	conductivity	conductivity	NOUN
ahs-18399	55	5	meter	meter	NOUN
ahs-18399	55	6	(	(	PUNCT
ahs-18399	55	7	cd502a	cd502a	NOUN
ahs-18399	55	8	,	,	PUNCT
ahs-18399	55	9	custom	custom	ADJ
ahs-18399	55	10	,	,	PUNCT
ahs-18399	55	11	tokyo	tokyo	PROPN
ahs-18399	55	12	,	,	PUNCT
ahs-18399	55	13	japan	japan	PROPN
ahs-18399	55	14	)	)	PUNCT
ahs-18399	55	15	,	,	PUNCT
ahs-18399	55	16	monitoring	monitoring	NOUN
ahs-18399	55	17	of	of	ADP
ahs-18399	55	18	the	the	DET
ahs-18399	55	19	changes	change	NOUN
ahs-18399	55	20	in	in	ADP
ahs-18399	55	21	conductivity	conductivity	NOUN
ahs-18399	55	22	in	in	ADP
ahs-18399	55	23	the	the	DET
ahs-18399	55	24	bathing	bathe	VERB
ahs-18399	55	25	liquid	liquid	NOUN
ahs-18399	55	26	(	(	PUNCT
ahs-18399	55	27	with	with	ADP
ahs-18399	55	28	1	1	NUM
ahs-18399	55	29	h	h	NOUN
ahs-18399	55	30	intervals	interval	NOUN
ahs-18399	55	31	up	up	ADP
ahs-18399	55	32	to	to	PART
ahs-18399	55	33	10	10	NUM
ahs-18399	55	34	h	h	NOUN
ahs-18399	55	35	)	)	PUNCT
ahs-18399	55	36	were	be	AUX
ahs-18399	55	37	carried	carry	VERB
ahs-18399	55	38	out	out	ADP
ahs-18399	55	39	following	follow	VERB
ahs-18399	55	40	24	24	NUM
ahs-18399	55	41	h	h	NOUN
ahs-18399	55	42	of	of	ADP
ahs-18399	55	43	post	post	ADJ
ahs-18399	55	44	-	-	ADJ
ahs-18399	55	45	uv	uv	ADJ
ahs-18399	55	46	incubation	incubation	NOUN
ahs-18399	55	47	.	.	PUNCT
ahs-18399	56	1	an	an	DET
ahs-18399	56	2	increase	increase	NOUN
ahs-18399	56	3	in	in	ADP
ahs-18399	56	4	conductivity	conductivity	NOUN
ahs-18399	56	5	reflects	reflect	VERB
ahs-18399	56	6	the	the	DET
ahs-18399	56	7	leakage	leakage	NOUN
ahs-18399	56	8	of	of	ADP
ahs-18399	56	9	ions	ion	NOUN
ahs-18399	56	10	from	from	ADP
ahs-18399	56	11	the	the	DET
ahs-18399	56	12	uv	uv	NOUN
ahs-18399	56	13	-	-	PUNCT
ahs-18399	56	14	dependently	dependently	ADV
ahs-18399	56	15	damaged	damage	VERB
ahs-18399	56	16	leaves	leave	NOUN
ahs-18399	56	17	.	.	PUNCT
ahs-18399	57	1	the	the	DET
ahs-18399	57	2	extent	extent	NOUN
ahs-18399	57	3	of	of	ADP
ahs-18399	57	4	ion	ion	NOUN
ahs-18399	57	5	leakage	leakage	NOUN
ahs-18399	57	6	was	be	AUX
ahs-18399	57	7	expressed	express	VERB
ahs-18399	57	8	as	as	ADP
ahs-18399	57	9	the	the	DET
ahs-18399	57	10	ratio	ratio	NOUN
ahs-18399	57	11	(	(	PUNCT
ahs-18399	57	12	percentage	percentage	NOUN
ahs-18399	57	13	)	)	PUNCT
ahs-18399	57	14	of	of	ADP
ahs-18399	57	15	recorded	record	VERB
ahs-18399	57	16	conductivity	conductivity	NOUN
ahs-18399	57	17	to	to	ADP
ahs-18399	57	18	the	the	DET
ahs-18399	57	19	maximal	maximal	ADJ
ahs-18399	57	20	conductivity	conductivity	NOUN
ahs-18399	57	21	obtained	obtain	VERB
ahs-18399	57	22	after	after	ADP
ahs-18399	57	23	boiling	boil	VERB
ahs-18399	57	24	the	the	DET
ahs-18399	57	25	samples	sample	NOUN
ahs-18399	57	26	.	.	PUNCT
ahs-18399	58	1	evaluation	evaluation	NOUN
ahs-18399	58	2	of	of	ADP
ahs-18399	58	3	cell	cell	NOUN
ahs-18399	58	4	death	death	NOUN
ahs-18399	58	5	analysis	analysis	NOUN
ahs-18399	58	6	of	of	ADP
ahs-18399	58	7	induced	induced	ADJ
ahs-18399	58	8	cell	cell	NOUN
ahs-18399	58	9	death	death	NOUN
ahs-18399	58	10	in	in	ADP
ahs-18399	58	11	suspension	suspension	NOUN
ahs-18399	58	12	culture	culture	NOUN
ahs-18399	58	13	was	be	AUX
ahs-18399	58	14	carried	carry	VERB
ahs-18399	58	15	out	out	ADP
ahs-18399	58	16	as	as	SCONJ
ahs-18399	58	17	described	describe	VERB
ahs-18399	58	18	elsewhere	elsewhere	ADV
ahs-18399	58	19	(	(	PUNCT
ahs-18399	58	20	iwase	iwase	NOUN
ahs-18399	58	21	et	et	PROPN
ahs-18399	58	22	al	al	PROPN
ahs-18399	58	23	.	.	PROPN
ahs-18399	58	24	,	,	PUNCT
ahs-18399	58	25	2014	2014	NUM
ahs-18399	58	26	)	)	PUNCT
ahs-18399	58	27	.	.	PUNCT
ahs-18399	59	1	following	follow	VERB
ahs-18399	59	2	uv	uv	NOUN
ahs-18399	59	3	-	-	PUNCT
ahs-18399	59	4	treatments	treatment	NOUN
ahs-18399	59	5	,	,	PUNCT
ahs-18399	59	6	200	200	NUM
ahs-18399	59	7	μl	μl	ADV
ahs-18399	59	8	-	-	PUNCT
ahs-18399	59	9	aliquots	aliquot	NOUN
ahs-18399	59	10	of	of	ADP
ahs-18399	59	11	cell	cell	NOUN
ahs-18399	59	12	suspension	suspension	NOUN
ahs-18399	59	13	were	be	AUX
ahs-18399	59	14	sampled	sample	VERB
ahs-18399	59	15	and	and	CCONJ
ahs-18399	59	16	transferred	transfer	VERB
ahs-18399	59	17	into	into	ADP
ahs-18399	59	18	1.5	1.5	NUM
ahs-18399	59	19	ml	ml	ADP
ahs-18399	59	20	tubes	tube	NOUN
ahs-18399	59	21	and	and	CCONJ
ahs-18399	59	22	statically	statically	ADV
ahs-18399	59	23	incubated	incubate	VERB
ahs-18399	59	24	in	in	ADP
ahs-18399	59	25	darkness	darkness	NOUN
ahs-18399	59	26	(	(	PUNCT
ahs-18399	59	27	for	for	ADP
ahs-18399	59	28	2	2	NUM
ahs-18399	59	29	h	h	NOUN
ahs-18399	59	30	unless	unless	SCONJ
ahs-18399	59	31	indicated	indicate	VERB
ahs-18399	59	32	)	)	PUNCT
ahs-18399	59	33	.	.	PUNCT
ahs-18399	60	1	then	then	ADV
ahs-18399	60	2	,	,	PUNCT
ahs-18399	60	3	0.1	0.1	NUM
ahs-18399	60	4	%	%	NOUN
ahs-18399	60	5	(	(	PUNCT
ahs-18399	60	6	w	w	NOUN
ahs-18399	60	7	/	/	SYM
ahs-18399	60	8	v	v	NOUN
ahs-18399	60	9	)	)	PUNCT
ahs-18399	60	10	evans	evans	PROPN
ahs-18399	60	11	blue	blue	PROPN
ahs-18399	60	12	was	be	AUX
ahs-18399	60	13	added	add	VERB
ahs-18399	60	14	to	to	ADP
ahs-18399	60	15	the	the	DET
ahs-18399	60	16	cell	cell	NOUN
ahs-18399	60	17	suspension	suspension	NOUN
ahs-18399	60	18	and	and	CCONJ
ahs-18399	60	19	further	far	ADV
ahs-18399	60	20	incubated	incubate	VERB
ahs-18399	60	21	for	for	ADP
ahs-18399	60	22	an	an	DET
ahs-18399	60	23	additional	additional	ADJ
ahs-18399	60	24	1	1	NUM
ahs-18399	60	25	h.	h.	NOUN
ahs-18399	60	26	following	follow	VERB
ahs-18399	60	27	repeated	repeat	VERB
ahs-18399	60	28	washes	wash	NOUN
ahs-18399	60	29	with	with	ADP
ahs-18399	60	30	fresh	fresh	ADJ
ahs-18399	60	31	media	medium	NOUN
ahs-18399	60	32	,	,	PUNCT
ahs-18399	60	33	counting	counting	NOUN
ahs-18399	60	34	of	of	ADP
ahs-18399	60	35	the	the	DET
ahs-18399	60	36	stained	stain	VERB
ahs-18399	60	37	cells	cell	NOUN
ahs-18399	60	38	was	be	AUX
ahs-18399	60	39	performed	perform	VERB
ahs-18399	60	40	under	under	ADP
ahs-18399	60	41	microscopes	microscope	NOUN
ahs-18399	60	42	(	(	PUNCT
ahs-18399	60	43	smz800	smz800	NOUN
ahs-18399	60	44	and	and	CCONJ
ahs-18399	60	45	labophoto	labophoto	ADJ
ahs-18399	60	46	,	,	PUNCT
ahs-18399	60	47	nikon	nikon	PROPN
ahs-18399	60	48	,	,	PUNCT
ahs-18399	60	49	tokyo	tokyo	PROPN
ahs-18399	60	50	,	,	PUNCT
ahs-18399	60	51	japan	japan	PROPN
ahs-18399	60	52	;	;	PUNCT
ahs-18399	60	53	vhx-100	vhx-100	NOUN
ahs-18399	60	54	,	,	PUNCT
ahs-18399	60	55	keyence	keyence	NOUN
ahs-18399	60	56	,	,	PUNCT
ahs-18399	60	57	tokyo	tokyo	PROPN
ahs-18399	60	58	,	,	PUNCT
ahs-18399	60	59	japan	japan	PROPN
ahs-18399	60	60	)	)	PUNCT
ahs-18399	60	61	and	and	CCONJ
ahs-18399	60	62	the	the	DET
ahs-18399	60	63	level	level	NOUN
ahs-18399	60	64	of	of	ADP
ahs-18399	60	65	cell	cell	NOUN
ahs-18399	60	66	death	death	NOUN
ahs-18399	60	67	was	be	AUX
ahs-18399	60	68	quantified	quantify	VERB
ahs-18399	60	69	.	.	PUNCT
ahs-18399	61	1	for	for	ADP
ahs-18399	61	2	statistical	statistical	ADJ
ahs-18399	61	3	analysis	analysis	NOUN
ahs-18399	61	4	,	,	PUNCT
ahs-18399	61	5	three	three	NUM
ahs-18399	61	6	to	to	PART
ahs-18399	61	7	four	four	NUM
ahs-18399	61	8	different	different	ADJ
ahs-18399	61	9	digital	digital	ADJ
ahs-18399	61	10	images	image	NOUN
ahs-18399	61	11	of	of	ADP
ahs-18399	61	12	cells	cell	NOUN
ahs-18399	61	13	under	under	ADP
ahs-18399	61	14	the	the	DET
ahs-18399	61	15	microscope	microscope	NOUN
ahs-18399	61	16	(	(	PUNCT
ahs-18399	61	17	each	each	PRON
ahs-18399	61	18	covering	cover	VERB
ahs-18399	61	19	50	50	NUM
ahs-18399	61	20	-	-	SYM
ahs-18399	61	21	100	100	NUM
ahs-18399	61	22	cells	cell	NOUN
ahs-18399	61	23	to	to	PART
ahs-18399	61	24	be	be	AUX
ahs-18399	61	25	counted	count	VERB
ahs-18399	61	26	)	)	PUNCT
ahs-18399	61	27	were	be	AUX
ahs-18399	61	28	acquired	acquire	VERB
ahs-18399	61	29	and	and	CCONJ
ahs-18399	61	30	analyzed	analyze	VERB
ahs-18399	61	31	.	.	PUNCT
ahs-18399	62	1	rna	rna	NOUN
ahs-18399	62	2	isolation	isolation	NOUN
ahs-18399	62	3	following	follow	VERB
ahs-18399	62	4	uv	uv	NOUN
ahs-18399	62	5	irradiation	irradiation	NOUN
ahs-18399	62	6	isolation	isolation	NOUN
ahs-18399	62	7	of	of	ADP
ahs-18399	62	8	rna	rna	NOUN
ahs-18399	62	9	followed	follow	VERB
ahs-18399	62	10	by	by	ADP
ahs-18399	62	11	reverse	reverse	NOUN
ahs-18399	62	12	-	-	PUNCT
ahs-18399	62	13	trancriptase	trancriptase	NOUN
ahs-18399	62	14	polymerase	polymerase	NOUN
ahs-18399	62	15	chain	chain	NOUN
ahs-18399	62	16	reaction	reaction	NOUN
ahs-18399	62	17	(	(	PUNCT
ahs-18399	62	18	rt	rt	NOUN
ahs-18399	62	19	-	-	PUNCT
ahs-18399	62	20	pcr	pcr	NOUN
ahs-18399	62	21	)	)	PUNCT
ahs-18399	62	22	was	be	AUX
ahs-18399	62	23	carried	carry	VERB
ahs-18399	62	24	out	out	ADP
ahs-18399	62	25	basically	basically	ADV
ahs-18399	62	26	as	as	SCONJ
ahs-18399	62	27	described	describe	VERB
ahs-18399	62	28	(	(	PUNCT
ahs-18399	62	29	kunihiro	kunihiro	PROPN
ahs-18399	62	30	et	et	PROPN
ahs-18399	62	31	al	al	PROPN
ahs-18399	62	32	.	.	PROPN
ahs-18399	62	33	,	,	PUNCT
ahs-18399	62	34	2011	2011	NUM
ahs-18399	62	35	)	)	PUNCT
ahs-18399	62	36	.	.	PUNCT
ahs-18399	63	1	leaflets	leaflet	NOUN
ahs-18399	63	2	and	and	CCONJ
ahs-18399	63	3	fruits	fruit	NOUN
ahs-18399	63	4	were	be	AUX
ahs-18399	63	5	subjected	subject	VERB
ahs-18399	63	6	to	to	ADP
ahs-18399	63	7	irradiation	irradiation	NOUN
ahs-18399	63	8	with	with	ADP
ahs-18399	63	9	uv	uv	NOUN
ahs-18399	63	10	rays	ray	NOUN
ahs-18399	63	11	for	for	ADP
ahs-18399	63	12	30	30	NUM
ahs-18399	63	13	min	min	NOUN
ahs-18399	63	14	,	,	PUNCT
ahs-18399	63	15	and	and	CCONJ
ahs-18399	63	16	were	be	AUX
ahs-18399	63	17	sampled	sample	VERB
ahs-18399	63	18	and	and	CCONJ
ahs-18399	63	19	frozen	freeze	VERB
ahs-18399	63	20	in	in	ADP
ahs-18399	63	21	liquid	liquid	NOUN
ahs-18399	63	22	n	n	NOUN
ahs-18399	63	23	2	2	NUM
ahs-18399	63	24	at	at	ADP
ahs-18399	63	25	0	0	NUM
ahs-18399	63	26	,	,	PUNCT
ahs-18399	63	27	1	1	NUM
ahs-18399	63	28	and	and	CCONJ
ahs-18399	63	29	10	10	NUM
ahs-18399	63	30	h	h	NOUN
ahs-18399	63	31	after	after	ADP
ahs-18399	63	32	irradiation	irradiation	NOUN
ahs-18399	63	33	.	.	PUNCT
ahs-18399	64	1	post	post	ADJ
ahs-18399	64	2	-	-	ADJ
ahs-18399	64	3	uv	uv	ADJ
ahs-18399	64	4	incubation	incubation	NOUN
ahs-18399	64	5	was	be	AUX
ahs-18399	64	6	carried	carry	VERB
ahs-18399	64	7	out	out	ADP
ahs-18399	64	8	in	in	ADP
ahs-18399	64	9	darkness	darkness	NOUN
ahs-18399	64	10	.	.	PUNCT
ahs-18399	65	1	cell	cell	NOUN
ahs-18399	65	2	suspensions	suspension	NOUN
ahs-18399	65	3	on	on	ADP
ahs-18399	65	4	12	12	NUM
ahs-18399	65	5	-	-	PUNCT
ahs-18399	65	6	well	well	NOUN
ahs-18399	65	7	microplates	microplate	NOUN
ahs-18399	65	8	subjected	subject	VERB
ahs-18399	65	9	to	to	ADP
ahs-18399	65	10	15	15	NUM
ahs-18399	65	11	min	min	NOUN
ahs-18399	65	12	of	of	ADP
ahs-18399	65	13	irradiation	irradiation	NOUN
ahs-18399	65	14	with	with	ADP
ahs-18399	65	15	uv	uv	NOUN
ahs-18399	65	16	rays	ray	NOUN
ahs-18399	65	17	were	be	AUX
ahs-18399	65	18	further	far	ADV
ahs-18399	65	19	incubated	incubate	VERB
ahs-18399	65	20	for	for	ADP
ahs-18399	65	21	1	1	NUM
ahs-18399	65	22	h	h	NOUN
ahs-18399	65	23	in	in	ADP
ahs-18399	65	24	the	the	DET
ahs-18399	65	25	darkness	darkness	NOUN
ahs-18399	65	26	.	.	PUNCT
ahs-18399	66	1	cells	cell	NOUN
ahs-18399	66	2	were	be	AUX
ahs-18399	66	3	then	then	ADV
ahs-18399	66	4	harvested	harvest	VERB
ahs-18399	66	5	by	by	ADP
ahs-18399	66	6	filtering	filter	VERB
ahs-18399	66	7	through	through	ADP
ahs-18399	66	8	40	40	NUM
ahs-18399	66	9	-	-	PUNCT
ahs-18399	66	10	μm	μm	NOUN
ahs-18399	66	11	pore	pore	ADJ
ahs-18399	66	12	nylon	nylon	NOUN
ahs-18399	66	13	mesh	mesh	NOUN
ahs-18399	66	14	and	and	CCONJ
ahs-18399	66	15	washed	wash	VERB
ahs-18399	66	16	with	with	ADP
ahs-18399	66	17	fresh	fresh	ADJ
ahs-18399	66	18	liquid	liquid	ADJ
ahs-18399	66	19	culture	culture	NOUN
ahs-18399	66	20	medium	medium	NOUN
ahs-18399	66	21	.	.	PUNCT
ahs-18399	67	1	the	the	DET
ahs-18399	67	2	obtained	obtain	VERB
ahs-18399	67	3	samples	sample	NOUN
ahs-18399	67	4	were	be	AUX
ahs-18399	67	5	frozen	freeze	VERB
ahs-18399	67	6	in	in	ADP
ahs-18399	67	7	liquid	liquid	NOUN
ahs-18399	67	8	n	n	NOUN
ahs-18399	67	9	2	2	NUM
ahs-18399	67	10	.	.	PUNCT
ahs-18399	68	1	these	these	DET
ahs-18399	68	2	frozen	frozen	ADJ
ahs-18399	68	3	samples	sample	NOUN
ahs-18399	68	4	were	be	AUX
ahs-18399	68	5	ground	grind	VERB
ahs-18399	68	6	using	use	VERB
ahs-18399	68	7	a	a	DET
ahs-18399	68	8	pestle	pestle	NOUN
ahs-18399	68	9	and	and	CCONJ
ahs-18399	68	10	mortar	mortar	NOUN
ahs-18399	68	11	and	and	CCONJ
ahs-18399	68	12	transferred	transfer	VERB
ahs-18399	68	13	to	to	ADP
ahs-18399	68	14	plastic	plastic	ADJ
ahs-18399	68	15	tubes	tube	NOUN
ahs-18399	68	16	and	and	CCONJ
ahs-18399	68	17	extracted	extract	VERB
ahs-18399	68	18	with	with	ADP
ahs-18399	68	19	the	the	DET
ahs-18399	68	20	rna	rna	NOUN
ahs-18399	68	21	extraction	extraction	NOUN
ahs-18399	68	22	buffer	buffer	NOUN
ahs-18399	68	23	containing	contain	VERB
ahs-18399	68	24	100	100	NUM
ahs-18399	68	25	mm	mm	PROPN
ahs-18399	68	26	tris	tris	PROPN
ahs-18399	68	27	-	-	PUNCT
ahs-18399	68	28	hcl	hcl	PROPN
ahs-18399	68	29	(	(	PUNCT
ahs-18399	68	30	ph	ph	PROPN
ahs-18399	68	31	8)	8)	NUM
ahs-18399	68	32	,	,	PUNCT
ahs-18399	68	33	100	100	NUM
ahs-18399	68	34	mm	mm	NOUN
ahs-18399	68	35	ethylenediaminetetraacetic	ethylenediaminetetraacetic	ADJ
ahs-18399	68	36	acid	acid	NOUN
ahs-18399	68	37	,	,	PUNCT
ahs-18399	68	38	100	100	NUM
ahs-18399	68	39	mm	mm	NOUN
ahs-18399	68	40	licl	licl	ADJ
ahs-18399	68	41	,	,	PUNCT
ahs-18399	68	42	and	and	CCONJ
ahs-18399	68	43	1	1	NUM
ahs-18399	68	44	%	%	NOUN
ahs-18399	68	45	sodium	sodium	NOUN
ahs-18399	68	46	dodecyl	dodecyl	NOUN
ahs-18399	68	47	sulfate	sulfate	NOUN
ahs-18399	68	48	.	.	PUNCT
ahs-18399	69	1	then	then	ADV
ahs-18399	69	2	aliquots	aliquot	NOUN
ahs-18399	69	3	of	of	ADP
ahs-18399	69	4	1:1	1:1	NUM
ahs-18399	69	5	mixture	mixture	NOUN
ahs-18399	69	6	of	of	ADP
ahs-18399	69	7	phenol	phenol	NOUN
ahs-18399	69	8	and	and	CCONJ
ahs-18399	69	9	cia	cia	PROPN
ahs-18399	69	10	(	(	PUNCT
ahs-18399	69	11	chloroform	chloroform	NOUN
ahs-18399	69	12	:	:	PUNCT
ahs-18399	69	13	isoamyl	isoamyl	NOUN
ahs-18399	69	14	alcohol	alcohol	NOUN
ahs-18399	69	15	at	at	ADP
ahs-18399	69	16	24:1	24:1	NUM
ahs-18399	69	17	)	)	PUNCT
ahs-18399	69	18	were	be	AUX
ahs-18399	69	19	added	add	VERB
ahs-18399	69	20	and	and	CCONJ
ahs-18399	69	21	samples	sample	NOUN
ahs-18399	69	22	were	be	AUX
ahs-18399	69	23	subjected	subject	VERB
ahs-18399	69	24	to	to	ADP
ahs-18399	69	25	centrifugation	centrifugation	NOUN
ahs-18399	69	26	at	at	ADP
ahs-18399	69	27	14,000	14,000	NUM
ahs-18399	69	28	g	g	NOUN
ahs-18399	69	29	for	for	ADP
ahs-18399	69	30	10	10	NUM
ahs-18399	69	31	min	min	NOUN
ahs-18399	69	32	at	at	ADP
ahs-18399	69	33	4	4	NUM
ahs-18399	69	34	°	°	NOUN
ahs-18399	69	35	c	c	NOUN
ahs-18399	69	36	.	.	PUNCT
ahs-18399	70	1	the	the	DET
ahs-18399	70	2	upper	upper	ADJ
ahs-18399	70	3	layer	layer	NOUN
ahs-18399	70	4	collected	collect	VERB
ahs-18399	70	5	in	in	ADP
ahs-18399	70	6	separate	separate	ADJ
ahs-18399	70	7	tubes	tube	NOUN
ahs-18399	70	8	were	be	AUX
ahs-18399	70	9	further	far	ADV
ahs-18399	70	10	subjected	subject	VERB
ahs-18399	70	11	to	to	ADP
ahs-18399	70	12	extraction	extraction	NOUN
ahs-18399	70	13	with	with	ADP
ahs-18399	70	14	aliquots	aliquot	NOUN
ahs-18399	70	15	of	of	ADP
ahs-18399	70	16	phenol	phenol	NOUN
ahs-18399	70	17	and	and	CCONJ
ahs-18399	70	18	cia	cia	PROPN
ahs-18399	70	19	and	and	CCONJ
ahs-18399	70	20	centrifugation	centrifugation	NOUN
ahs-18399	70	21	.	.	PUNCT
ahs-18399	71	1	the	the	DET
ahs-18399	71	2	resultant	resultant	NOUN
ahs-18399	71	3	upper	upper	ADJ
ahs-18399	71	4	layer	layer	NOUN
ahs-18399	71	5	was	be	AUX
ahs-18399	71	6	again	again	ADV
ahs-18399	71	7	collected	collect	VERB
ahs-18399	71	8	in	in	ADP
ahs-18399	71	9	new	new	ADJ
ahs-18399	71	10	tubes	tube	NOUN
ahs-18399	71	11	and	and	CCONJ
ahs-18399	71	12	mixed	mix	VERB
ahs-18399	71	13	with	with	ADP
ahs-18399	71	14	1/3	1/3	NUM
ahs-18399	71	15	volume	volume	NOUN
ahs-18399	71	16	of	of	ADP
ahs-18399	71	17	10	10	NUM
ahs-18399	71	18	m	m	VERB
ahs-18399	71	19	licl	licl	ADJ
ahs-18399	71	20	and	and	CCONJ
ahs-18399	71	21	kept	keep	VERB
ahs-18399	71	22	at	at	ADP
ahs-18399	71	23	-30	-30	PROPN
ahs-18399	71	24	°	°	PROPN
ahs-18399	71	25	c	c	NOUN
ahs-18399	71	26	for	for	ADP
ahs-18399	71	27	2	2	NUM
ahs-18399	71	28	h.	h.	NOUN
ahs-18399	71	29	following	follow	VERB
ahs-18399	71	30	centrifugation	centrifugation	NOUN
ahs-18399	71	31	,	,	PUNCT
ahs-18399	71	32	the	the	DET
ahs-18399	71	33	resultant	resultant	NOUN
ahs-18399	71	34	pellets	pellet	NOUN
ahs-18399	71	35	were	be	AUX
ahs-18399	71	36	collected	collect	VERB
ahs-18399	71	37	and	and	CCONJ
ahs-18399	71	38	re	re	VERB
ahs-18399	71	39	-	-	VERB
ahs-18399	71	40	suspended	suspend	VERB
ahs-18399	71	41	in	in	ADP
ahs-18399	71	42	2	2	NUM
ahs-18399	71	43	m	m	NOUN
ahs-18399	71	44	licl	licl	ADJ
ahs-18399	71	45	and	and	CCONJ
ahs-18399	71	46	spin	spin	AUX
ahs-18399	71	47	-	-	PUNCT
ahs-18399	71	48	collected	collect	VERB
ahs-18399	71	49	.	.	PUNCT
ahs-18399	72	1	the	the	DET
ahs-18399	72	2	pellet	pellet	NOUN
ahs-18399	72	3	formed	form	VERB
ahs-18399	72	4	was	be	AUX
ahs-18399	72	5	dissolved	dissolve	VERB
ahs-18399	72	6	in	in	ADP
ahs-18399	72	7	te	te	ADP
ahs-18399	72	8	buffer	buffer	NOUN
ahs-18399	72	9	and	and	CCONJ
ahs-18399	72	10	added	add	VERB
ahs-18399	72	11	with	with	ADP
ahs-18399	72	12	1/2	1/2	NUM
ahs-18399	72	13	volume	volume	NOUN
ahs-18399	72	14	of	of	ADP
ahs-18399	72	15	both	both	DET
ahs-18399	72	16	phenol	phenol	NOUN
ahs-18399	72	17	and	and	CCONJ
ahs-18399	72	18	cia	cia	PROPN
ahs-18399	72	19	.	.	PUNCT
ahs-18399	73	1	the	the	DET
ahs-18399	73	2	samples	sample	NOUN
ahs-18399	73	3	were	be	AUX
ahs-18399	73	4	subjected	subject	VERB
ahs-18399	73	5	to	to	ADP
ahs-18399	73	6	10	10	NUM
ahs-18399	73	7	min	min	NOUN
ahs-18399	73	8	of	of	ADP
ahs-18399	73	9	centrifugation	centrifugation	NOUN
ahs-18399	73	10	and	and	CCONJ
ahs-18399	73	11	the	the	DET
ahs-18399	73	12	upper	upper	ADJ
ahs-18399	73	13	layer	layer	NOUN
ahs-18399	73	14	was	be	AUX
ahs-18399	73	15	collected	collect	VERB
ahs-18399	73	16	and	and	CCONJ
ahs-18399	73	17	mixed	mix	VERB
ahs-18399	73	18	with	with	ADP
ahs-18399	73	19	the	the	DET
ahs-18399	73	20	aliquot	aliquot	NOUN
ahs-18399	73	21	of	of	ADP
ahs-18399	73	22	cia	cia	PROPN
ahs-18399	73	23	,	,	PUNCT
ahs-18399	73	24	and	and	CCONJ
ahs-18399	73	25	further	far	ADV
ahs-18399	73	26	centrifuged	centrifuge	VERB
ahs-18399	73	27	.	.	PUNCT
ahs-18399	74	1	for	for	ADP
ahs-18399	74	2	precipitation	precipitation	NOUN
ahs-18399	74	3	of	of	ADP
ahs-18399	74	4	rna	rna	NOUN
ahs-18399	74	5	,	,	PUNCT
ahs-18399	74	6	the	the	DET
ahs-18399	74	7	upper	upper	ADJ
ahs-18399	74	8	layer	layer	NOUN
ahs-18399	74	9	was	be	AUX
ahs-18399	74	10	collected	collect	VERB
ahs-18399	74	11	and	and	CCONJ
ahs-18399	74	12	mixed	mix	VERB
ahs-18399	74	13	with	with	ADP
ahs-18399	74	14	1/10	1/10	NUM
ahs-18399	74	15	volume	volume	NOUN
ahs-18399	74	16	of	of	ADP
ahs-18399	74	17	3	3	NUM
ahs-18399	74	18	m	m	NOUN
ahs-18399	74	19	sodium	sodium	NOUN
ahs-18399	74	20	acetate	acetate	NOUN
ahs-18399	74	21	and	and	CCONJ
ahs-18399	74	22	2.5	2.5	NUM
ahs-18399	74	23	volume	volume	NOUN
ahs-18399	74	24	of	of	ADP
ahs-18399	74	25	absolute	absolute	ADJ
ahs-18399	74	26	ethanol	ethanol	NOUN
ahs-18399	74	27	,	,	PUNCT
ahs-18399	74	28	and	and	CCONJ
ahs-18399	74	29	centrifuged	centrifuge	VERB
ahs-18399	74	30	.	.	PUNCT
ahs-18399	75	1	the	the	DET
ahs-18399	75	2	pellet	pellet	NOUN
ahs-18399	75	3	washed	wash	VERB
ahs-18399	75	4	with	with	ADP
ahs-18399	75	5	70	70	NUM
ahs-18399	75	6	%	%	NOUN
ahs-18399	75	7	ethanol	ethanol	NOUN
ahs-18399	75	8	was	be	AUX
ahs-18399	75	9	spin	spin	NOUN
ahs-18399	75	10	-	-	PUNCT
ahs-18399	75	11	collected	collect	VERB
ahs-18399	75	12	,	,	PUNCT
ahs-18399	75	13	dried	dry	VERB
ahs-18399	75	14	and	and	CCONJ
ahs-18399	75	15	dissolved	dissolve	VERB
ahs-18399	75	16	in	in	ADP
ahs-18399	75	17	diethylpyrocarbonate	diethylpyrocarbonate	NOUN
ahs-18399	75	18	-	-	PUNCT
ahs-18399	75	19	treated	treat	VERB
ahs-18399	75	20	water	water	NOUN
ahs-18399	75	21	.	.	PUNCT
ahs-18399	76	1	rt	rt	ADJ
ahs-18399	76	2	-	-	PUNCT
ahs-18399	76	3	pcr	pcr	NOUN
ahs-18399	76	4	prior	prior	ADV
ahs-18399	76	5	to	to	ADP
ahs-18399	76	6	analysis	analysis	NOUN
ahs-18399	76	7	with	with	ADP
ahs-18399	76	8	rt	rt	NOUN
ahs-18399	76	9	-	-	PUNCT
ahs-18399	76	10	pcr	pcr	ADJ
ahs-18399	76	11	,	,	PUNCT
ahs-18399	76	12	genomic	genomic	ADJ
ahs-18399	76	13	dna	dna	PROPN
ahs-18399	76	14	concomitantly	concomitantly	ADV
ahs-18399	76	15	present	present	ADJ
ahs-18399	76	16	in	in	ADP
ahs-18399	76	17	the	the	DET
ahs-18399	76	18	total	total	ADJ
ahs-18399	76	19	rna	rna	NOUN
ahs-18399	76	20	preparations	preparation	NOUN
ahs-18399	76	21	was	be	AUX
ahs-18399	76	22	eliminated	eliminate	VERB
ahs-18399	76	23	with	with	ADP
ahs-18399	76	24	rnase	rnase	PROPN
ahs-18399	76	25	-	-	PUNCT
ahs-18399	76	26	free	free	ADJ
ahs-18399	76	27	cloned	clone	VERB
ahs-18399	76	28	dnase	dnase	NOUN
ahs-18399	76	29	i	i	PRON
ahs-18399	76	30	(	(	PUNCT
ahs-18399	76	31	takara	takara	PROPN
ahs-18399	76	32	bio	bio	PROPN
ahs-18399	76	33	inc	inc	PROPN
ahs-18399	76	34	.	.	PROPN
ahs-18399	76	35	,	,	PUNCT
ahs-18399	76	36	otsu	otsu	PROPN
ahs-18399	76	37	,	,	PUNCT
ahs-18399	76	38	japan	japan	PROPN
ahs-18399	76	39	)	)	PUNCT
ahs-18399	76	40	.	.	PUNCT
ahs-18399	77	1	first	first	ADJ
ahs-18399	77	2	-	-	PUNCT
ahs-18399	77	3	strand	strand	NOUN
ahs-18399	77	4	cdna	cdna	PROPN
ahs-18399	77	5	synthesis	synthesis	NOUN
ahs-18399	77	6	was	be	AUX
ahs-18399	77	7	performed	perform	VERB
ahs-18399	77	8	using	use	VERB
ahs-18399	77	9	superscripttm	superscripttm	PROPN
ahs-18399	77	10	iii	iii	NUM
ahs-18399	77	11	reverse	reverse	ADJ
ahs-18399	77	12	transcriptase	transcriptase	NOUN
ahs-18399	77	13	(	(	PUNCT
ahs-18399	77	14	invitrogen	invitrogen	PROPN
ahs-18399	77	15	corporation	corporation	NOUN
ahs-18399	77	16	,	,	PUNCT
ahs-18399	77	17	ca	ca	NOUN
ahs-18399	77	18	)	)	PUNCT
ahs-18399	77	19	.	.	PUNCT
ahs-18399	78	1	the	the	DET
ahs-18399	78	2	reaction	reaction	NOUN
ahs-18399	78	3	mixtures	mixture	NOUN
ahs-18399	78	4	(	(	PUNCT
ahs-18399	78	5	20	20	NUM
ahs-18399	78	6	μl	μl	PRON
ahs-18399	78	7	/	/	SYM
ahs-18399	78	8	tube	tube	NOUN
ahs-18399	78	9	)	)	PUNCT
ahs-18399	78	10	contained	contain	VERB
ahs-18399	78	11	total	total	ADJ
ahs-18399	78	12	rna	rna	NOUN
ahs-18399	78	13	(	(	PUNCT
ahs-18399	78	14	2	2	NUM
ahs-18399	78	15	μg	μg	NOUN
ahs-18399	78	16	)	)	PUNCT
ahs-18399	78	17	,	,	PUNCT
ahs-18399	78	18	oligo-(dt	oligo-(dt	PROPN
ahs-18399	78	19	)	)	PUNCT
ahs-18399	78	20	20	20	NUM
ahs-18399	78	21	(	(	PUNCT
ahs-18399	78	22	2.5	2.5	NUM
ahs-18399	78	23	mm	mm	NOUN
ahs-18399	78	24	)	)	PUNCT
ahs-18399	78	25	,	,	PUNCT
ahs-18399	78	26	and	and	CCONJ
ahs-18399	78	27	dntp	dntp	NOUN
ahs-18399	78	28	mixture	mixture	NOUN
ahs-18399	78	29	(	(	PUNCT
ahs-18399	78	30	2	2	NUM
ahs-18399	78	31	mm	mm	NOUN
ahs-18399	78	32	)	)	PUNCT
ahs-18399	78	33	.	.	PUNCT
ahs-18399	79	1	the	the	DET
ahs-18399	79	2	tubes	tube	NOUN
ahs-18399	79	3	were	be	AUX
ahs-18399	79	4	heated	heat	VERB
ahs-18399	79	5	to	to	ADP
ahs-18399	79	6	65	65	NUM
ahs-18399	79	7	°	°	ADP
ahs-18399	79	8	c	c	NOUN
ahs-18399	79	9	for	for	ADP
ahs-18399	79	10	5	5	NUM
ahs-18399	79	11	min	min	NOUN
ahs-18399	79	12	,	,	PUNCT
ahs-18399	79	13	cooled	cool	VERB
ahs-18399	79	14	and	and	CCONJ
ahs-18399	79	15	kept	keep	VERB
ahs-18399	79	16	at	at	ADP
ahs-18399	79	17	4	4	NUM
ahs-18399	79	18	°	°	ADP
ahs-18399	79	19	c	c	NOUN
ahs-18399	79	20	for	for	ADP
ahs-18399	79	21	1	1	NUM
ahs-18399	79	22	min	min	NOUN
ahs-18399	79	23	using	use	VERB
ahs-18399	79	24	program	program	NOUN
ahs-18399	79	25	temp	temp	NOUN
ahs-18399	79	26	control	control	NOUN
ahs-18399	79	27	system	system	NOUN
ahs-18399	79	28	pc-320	pc-320	NOUN
ahs-18399	79	29	(	(	PUNCT
ahs-18399	79	30	astec	astec	ADJ
ahs-18399	79	31	,	,	PUNCT
ahs-18399	79	32	fukuoka	fukuoka	NOUN
ahs-18399	79	33	,	,	PUNCT
ahs-18399	79	34	japan	japan	PROPN
ahs-18399	79	35	)	)	PUNCT
ahs-18399	79	36	.	.	PUNCT
ahs-18399	80	1	to	to	ADP
ahs-18399	80	2	the	the	DET
ahs-18399	80	3	reaction	reaction	NOUN
ahs-18399	80	4	mixture	mixture	NOUN
ahs-18399	80	5	,	,	PUNCT
ahs-18399	80	6	4	4	NUM
ahs-18399	80	7	μl	μl	ADP
ahs-18399	80	8	of	of	ADP
ahs-18399	80	9	5x	5x	NUM
ahs-18399	80	10	first	first	ADJ
ahs-18399	80	11	-	-	PUNCT
ahs-18399	80	12	strand	strand	NOUN
ahs-18399	80	13	buffer	buffer	NOUN
ahs-18399	80	14	,	,	PUNCT
ahs-18399	80	15	1	1	NUM
ahs-18399	80	16	μl	μl	ADP
ahs-18399	80	17	of	of	ADP
ahs-18399	80	18	0.1	0.1	NUM
ahs-18399	80	19	m	m	NOUN
ahs-18399	80	20	dithiothreitol	dithiothreitol	ADJ
ahs-18399	80	21	,	,	PUNCT
ahs-18399	80	22	1	1	NUM
ahs-18399	80	23	μl	μl	NUM
ahs-18399	80	24	of	of	ADP
ahs-18399	80	25	rnaseout	rnaseout	NOUN
ahs-18399	80	26	recombinant	recombinant	ADJ
ahs-18399	80	27	rnase	rnase	PROPN
ahs-18399	80	28	inhibitor	inhibitor	NOUN
ahs-18399	80	29	and	and	CCONJ
ahs-18399	80	30	1	1	NUM
ahs-18399	80	31	μl	μl	ADP
ahs-18399	80	32	of	of	ADP
ahs-18399	80	33	superscripttm	superscripttm	PROPN
ahs-18399	80	34	iii	iii	NUM
ahs-18399	80	35	reverse	reverse	ADJ
ahs-18399	80	36	transcriptase	transcriptase	NOUN
ahs-18399	80	37	(	(	PUNCT
ahs-18399	80	38	200	200	NUM
ahs-18399	80	39	units	unit	NOUN
ahs-18399	80	40	μl-1	μl-1	PART
ahs-18399	80	41	)	)	PUNCT
ahs-18399	80	42	were	be	AUX
ahs-18399	80	43	added	add	VERB
ahs-18399	80	44	and	and	CCONJ
ahs-18399	80	45	incubated	incubate	VERB
ahs-18399	80	46	at	at	ADP
ahs-18399	80	47	50	50	NUM
ahs-18399	80	48	°	°	ADP
ahs-18399	80	49	c	c	NOUN
ahs-18399	80	50	for	for	ADP
ahs-18399	80	51	60	60	NUM
ahs-18399	80	52	min	min	NOUN
ahs-18399	80	53	.	.	PUNCT
ahs-18399	81	1	the	the	DET
ahs-18399	81	2	reaction	reaction	NOUN
ahs-18399	81	3	was	be	AUX
ahs-18399	81	4	terminated	terminate	VERB
ahs-18399	81	5	by	by	ADP
ahs-18399	81	6	heating	heat	VERB
ahs-18399	81	7	at	at	ADP
ahs-18399	81	8	70	70	NUM
ahs-18399	81	9	°	°	ADP
ahs-18399	81	10	c	c	NOUN
ahs-18399	81	11	for	for	ADP
ahs-18399	81	12	15	15	NUM
ahs-18399	81	13	min	min	NOUN
ahs-18399	81	14	and	and	CCONJ
ahs-18399	81	15	cooling	cool	VERB
ahs-18399	81	16	at	at	ADP
ahs-18399	81	17	4	4	NUM
ahs-18399	81	18	°	°	ADP
ahs-18399	81	19	c	c	NOUN
ahs-18399	81	20	for	for	ADP
ahs-18399	81	21	15	15	NUM
ahs-18399	81	22	min	min	NOUN
ahs-18399	81	23	.	.	PUNCT
ahs-18399	82	1	the	the	DET
ahs-18399	82	2	resultant	resultant	NOUN
ahs-18399	82	3	cdna	cdna	PROPN
ahs-18399	82	4	solution	solution	NOUN
ahs-18399	82	5	was	be	AUX
ahs-18399	82	6	used	use	VERB
ahs-18399	82	7	for	for	ADP
ahs-18399	82	8	pcr	pcr	NOUN
ahs-18399	82	9	performed	perform	VERB
ahs-18399	82	10	with	with	ADP
ahs-18399	82	11	60	60	NUM
ahs-18399	82	12	ng	ng	PROPN
ahs-18399	82	13	of	of	ADP
ahs-18399	82	14	first	first	ADJ
ahs-18399	82	15	-	-	PUNCT
ahs-18399	82	16	strand	strand	NOUN
ahs-18399	82	17	cdna	cdna	PROPN
ahs-18399	82	18	and	and	CCONJ
ahs-18399	82	19	takara	takara	PROPN
ahs-18399	82	20	extaqtm	extaqtm	PROPN
ahs-18399	82	21	(	(	PUNCT
ahs-18399	82	22	takara	takara	PROPN
ahs-18399	82	23	bio	bio	PROPN
ahs-18399	82	24	inc	inc	PROPN
ahs-18399	82	25	.	.	PROPN
ahs-18399	82	26	,	,	PUNCT
ahs-18399	82	27	otsu	otsu	PROPN
ahs-18399	82	28	,	,	PUNCT
ahs-18399	82	29	japan	japan	PROPN
ahs-18399	82	30	)	)	PUNCT
ahs-18399	82	31	.	.	PUNCT
ahs-18399	83	1	for	for	ADP
ahs-18399	83	2	each	each	DET
ahs-18399	83	3	sample	sample	NOUN
ahs-18399	83	4	,	,	PUNCT
ahs-18399	83	5	30	30	NUM
ahs-18399	83	6	cycles	cycle	NOUN
ahs-18399	83	7	of	of	ADP
ahs-18399	83	8	pcr	pcr	NOUN
ahs-18399	83	9	were	be	AUX
ahs-18399	83	10	performed	perform	VERB
ahs-18399	83	11	with	with	ADP
ahs-18399	83	12	denaturing	denaturing	NOUN
ahs-18399	83	13	at	at	ADP
ahs-18399	83	14	94	94	NUM
ahs-18399	83	15	°	°	ADP
ahs-18399	83	16	c	c	NOUN
ahs-18399	83	17	for	for	ADP
ahs-18399	83	18	1	1	NUM
ahs-18399	83	19	min	min	NOUN
ahs-18399	83	20	,	,	PUNCT
ahs-18399	83	21	annealing	anneal	VERB
ahs-18399	83	22	for	for	ADP
ahs-18399	83	23	1	1	NUM
ahs-18399	83	24	min	min	NOUN
ahs-18399	83	25	and	and	CCONJ
ahs-18399	83	26	elongation	elongation	NOUN
ahs-18399	83	27	at	at	ADP
ahs-18399	83	28	72	72	NUM
ahs-18399	83	29	°	°	ADP
ahs-18399	83	30	c	c	NOUN
ahs-18399	83	31	for	for	SCONJ
ahs-18399	83	32	1	1	NUM
ahs-18399	83	33	min	min	NOUN
ahs-18399	83	34	.	.	NOUN
ahs-18399	83	35	sequences	sequence	NOUN
ahs-18399	83	36	of	of	ADP
ahs-18399	83	37	the	the	DET
ahs-18399	83	38	primers	primer	NOUN
ahs-18399	83	39	used	use	VERB
ahs-18399	83	40	and	and	CCONJ
ahs-18399	83	41	anealing	aneale	VERB
ahs-18399	83	42	temperatures	temperature	NOUN
ahs-18399	83	43	employed	employ	VERB
ahs-18399	83	44	are	be	AUX
ahs-18399	83	45	listed	list	VERB
ahs-18399	83	46	in	in	ADP
ahs-18399	83	47	table	table	NOUN
ahs-18399	83	48	1	1	NUM
ahs-18399	83	49	.	.	PUNCT
ahs-18399	83	50	table	table	NOUN
ahs-18399	83	51	1	1	NUM
ahs-18399	83	52	list	list	NOUN
ahs-18399	83	53	of	of	ADP
ahs-18399	83	54	primers	primer	NOUN
ahs-18399	83	55	used	use	VERB
ahs-18399	83	56	for	for	ADP
ahs-18399	83	57	rt	rt	ADJ
ahs-18399	83	58	-	-	PUNCT
ahs-18399	83	59	pcr	pcr	ADJ
ahs-18399	83	60	genes	gene	NOUN
ahs-18399	83	61	studied	study	VERB
ahs-18399	83	62	accession	accession	NOUN
ahs-18399	83	63	numbers	number	NOUN
ahs-18399	83	64	*	*	PUNCT
ahs-18399	83	65	forward	forward	ADJ
ahs-18399	83	66	primers	primer	NOUN
ahs-18399	83	67	reverse	reverse	VERB
ahs-18399	83	68	primers	primer	NOUN
ahs-18399	83	69	tm	tm	PROPN
ahs-18399	83	70	(	(	PUNCT
ahs-18399	83	71	˚c	˚c	ADJ
ahs-18399	83	72	)	)	PUNCT
ahs-18399	83	73	actin	actin	NOUN
ahs-18399	83	74	u60481	u60481	PROPN
ahs-18399	83	75	cacactgtccctatttacga	cacactgtccctatttacga	ADJ
ahs-18399	83	76	gtaataacttgtccatcagg	gtaataacttgtccatcagg	NOUN
ahs-18399	83	77	51.3	51.3	NUM
ahs-18399	83	78	acs1a	acs1a	PROPN
ahs-18399	83	79	u72389	u72389	NOUN
ahs-18399	83	80	gctttgggttagtttcagctc	gctttgggttagtttcagctc	NOUN
ahs-18399	83	81	gttcatgaactcatgatccaatc	gttcatgaactcatgatccaatc	NOUN
ahs-18399	83	82	56.5	56.5	NUM
ahs-18399	83	83	apx	apx	NOUN
ahs-18399	83	84	dq096286	dq096286	ADJ
ahs-18399	83	85	gagtacctcaaggctgttgacaaatg	gagtacctcaaggctgttgacaaatg	PROPN
ahs-18399	83	86	gagcctcagcaragtcagcaaag	gagcctcagcaragtcagcaaag	VERB
ahs-18399	83	87	60.0	60.0	NUM
ahs-18399	83	88	pr	pr	NOUN
ahs-18399	83	89	-	-	PUNCT
ahs-18399	83	90	p2	p2	NOUN
ahs-18399	83	91	x58548	x58548	PROPN
ahs-18399	83	92	ggagagagttaacaagttgtgtg	ggagagagttaacaagttgtgtg	PROPN
ahs-18399	83	93	gagtagtattaaaagttagctcg	gagtagtattaaaagttagctcg	VERB
ahs-18399	83	94	60.0	60.0	NUM
ahs-18399	83	95	pr1	pr1	NOUN
ahs-18399	83	96	dq159948	dq159948	PROPN
ahs-18399	83	97	cttctcatggtattagcc	cttctcatggtattagcc	PROPN
ahs-18399	83	98	ccaccatccgttgttgc	ccaccatccgttgttgc	VERB
ahs-18399	83	99	50.3	50.3	NUM
ahs-18399	83	100	pal	pal	NOUN
ahs-18399	83	101	m83314	m83314	NOUN
ahs-18399	83	102	gacacacaagttgaagcatcac	gacacacaagttgaagcatcac	NOUN
ahs-18399	83	103	cacatcttggttgtgttgctc	cacatcttggttgtgttgctc	NOUN
ahs-18399	83	104	56.5	56.5	NUM
ahs-18399	83	105	*	*	PUNCT
ahs-18399	83	106	accession	accession	NOUN
ahs-18399	83	107	numbers	number	NOUN
ahs-18399	83	108	were	be	AUX
ahs-18399	83	109	of	of	ADP
ahs-18399	83	110	ncbi	ncbi	PROPN
ahs-18399	83	111	genbank	genbank	PROPN
ahs-18399	83	112	.	.	PUNCT
ahs-18399	84	1	tm=	tm=	PROPN
ahs-18399	84	2	melting	melt	VERB
ahs-18399	84	3	temperature	temperature	NOUN
ahs-18399	84	4	used	use	VERB
ahs-18399	84	5	for	for	ADP
ahs-18399	84	6	annealing	anneal	VERB
ahs-18399	84	7	.	.	PUNCT
ahs-18399	85	1	136	136	NUM
ahs-18399	85	2	3	3	NUM
ahs-18399	85	3	.	.	PUNCT
ahs-18399	85	4	results	result	VERB
ahs-18399	85	5	cellular	cellular	ADJ
ahs-18399	85	6	damage	damage	NOUN
ahs-18399	85	7	on	on	ADP
ahs-18399	85	8	the	the	DET
ahs-18399	85	9	uv	uv	NOUN
ahs-18399	85	10	-	-	PUNCT
ahs-18399	85	11	c	c	NOUN
ahs-18399	85	12	-	-	PUNCT
ahs-18399	85	13	treated	treat	VERB
ahs-18399	85	14	leaves	leave	NOUN
ahs-18399	85	15	,	,	PUNCT
ahs-18399	85	16	the	the	DET
ahs-18399	85	17	damaging	damaging	ADJ
ahs-18399	85	18	impact	impact	NOUN
ahs-18399	85	19	of	of	ADP
ahs-18399	85	20	uv	uv	NOUN
ahs-18399	85	21	-	-	PUNCT
ahs-18399	85	22	c	c	NOUN
ahs-18399	85	23	at	at	ADP
ahs-18399	85	24	cellular	cellular	ADJ
ahs-18399	85	25	level	level	NOUN
ahs-18399	85	26	could	could	AUX
ahs-18399	85	27	be	be	AUX
ahs-18399	85	28	visualized	visualize	VERB
ahs-18399	85	29	as	as	SCONJ
ahs-18399	85	30	spotted	spot	VERB
ahs-18399	85	31	lesions	lesion	NOUN
ahs-18399	85	32	appeared	appear	VERB
ahs-18399	85	33	(	(	PUNCT
ahs-18399	85	34	fig	fig	NOUN
ahs-18399	85	35	.	.	PUNCT
ahs-18399	85	36	1	1	NUM
ahs-18399	85	37	)	)	PUNCT
ahs-18399	85	38	.	.	PUNCT
ahs-18399	86	1	such	such	ADJ
ahs-18399	86	2	visible	visible	ADJ
ahs-18399	86	3	damage	damage	NOUN
ahs-18399	86	4	was	be	AUX
ahs-18399	86	5	not	not	PART
ahs-18399	86	6	observed	observe	VERB
ahs-18399	86	7	on	on	ADP
ahs-18399	86	8	the	the	DET
ahs-18399	86	9	uv	uv	NOUN
ahs-18399	86	10	-	-	PUNCT
ahs-18399	86	11	a	a	PRON
ahs-18399	86	12	-	-	PUNCT
ahs-18399	86	13	treated	treat	VERB
ahs-18399	86	14	leaves	leave	NOUN
ahs-18399	86	15	.	.	PUNCT
ahs-18399	87	1	in	in	ADP
ahs-18399	87	2	addition	addition	NOUN
ahs-18399	87	3	to	to	ADP
ahs-18399	87	4	visible	visible	ADJ
ahs-18399	87	5	symptoms	symptom	NOUN
ahs-18399	87	6	,	,	PUNCT
ahs-18399	87	7	uv	uv	NOUN
ahs-18399	87	8	-	-	PUNCT
ahs-18399	87	9	c	c	NOUN
ahs-18399	87	10	irradiation	irradiation	NOUN
ahs-18399	87	11	resulted	result	VERB
ahs-18399	87	12	in	in	ADP
ahs-18399	87	13	a	a	DET
ahs-18399	87	14	marked	mark	VERB
ahs-18399	87	15	increase	increase	NOUN
ahs-18399	87	16	in	in	ADP
ahs-18399	87	17	ion	ion	NOUN
ahs-18399	87	18	leakage	leakage	NOUN
ahs-18399	87	19	from	from	ADP
ahs-18399	87	20	leaf	leaf	NOUN
ahs-18399	87	21	disc	disc	NOUN
ahs-18399	87	22	preparations	preparation	NOUN
ahs-18399	87	23	(	(	PUNCT
ahs-18399	87	24	fig	fig	NOUN
ahs-18399	87	25	.	.	PUNCT
ahs-18399	88	1	2	2	NUM
ahs-18399	88	2	)	)	PUNCT
ahs-18399	88	3	.	.	PUNCT
ahs-18399	89	1	leakage	leakage	NOUN
ahs-18399	89	2	of	of	ADP
ahs-18399	89	3	ions	ion	NOUN
ahs-18399	89	4	indicates	indicate	VERB
ahs-18399	89	5	that	that	SCONJ
ahs-18399	89	6	the	the	DET
ahs-18399	89	7	cellular	cellular	ADJ
ahs-18399	89	8	membrane	membrane	NOUN
ahs-18399	89	9	is	be	AUX
ahs-18399	89	10	one	one	NUM
ahs-18399	89	11	of	of	ADP
ahs-18399	89	12	the	the	DET
ahs-18399	89	13	targets	target	NOUN
ahs-18399	89	14	of	of	ADP
ahs-18399	89	15	the	the	DET
ahs-18399	89	16	damaging	damaging	ADJ
ahs-18399	89	17	impact	impact	NOUN
ahs-18399	89	18	of	of	ADP
ahs-18399	89	19	uv	uv	NOUN
ahs-18399	89	20	-	-	PUNCT
ahs-18399	89	21	c	c	NOUN
ahs-18399	89	22	irradiation	irradiation	NOUN
ahs-18399	89	23	.	.	PUNCT
ahs-18399	90	1	after	after	SCONJ
ahs-18399	90	2	irradiations	irradiation	NOUN
ahs-18399	90	3	with	with	ADP
ahs-18399	90	4	uv	uv	NOUN
ahs-18399	90	5	rays	ray	NOUN
ahs-18399	90	6	at	at	ADP
ahs-18399	90	7	2.2	2.2	NUM
ahs-18399	90	8	mw	mw	ADJ
ahs-18399	90	9	cm-2	cm-2	NOUN
ahs-18399	90	10	,	,	PUNCT
ahs-18399	90	11	suspension	suspension	NOUN
ahs-18399	90	12	-	-	PUNCT
ahs-18399	90	13	cultured	cultured	ADJ
ahs-18399	90	14	cells	cell	NOUN
ahs-18399	90	15	of	of	ADP
ahs-18399	90	16	micro	micro	NOUN
ahs-18399	90	17	-	-	PROPN
ahs-18399	90	18	tom	tom	PROPN
ahs-18399	90	19	showed	show	VERB
ahs-18399	90	20	development	development	NOUN
ahs-18399	90	21	of	of	ADP
ahs-18399	90	22	cell	cell	NOUN
ahs-18399	90	23	death	death	NOUN
ahs-18399	90	24	depending	depend	VERB
ahs-18399	90	25	on	on	ADP
ahs-18399	90	26	the	the	DET
ahs-18399	90	27	type	type	NOUN
ahs-18399	90	28	of	of	ADP
ahs-18399	90	29	uvs	uvs	PROPN
ahs-18399	90	30	,	,	PUNCT
ahs-18399	90	31	exposure	exposure	NOUN
ahs-18399	90	32	time	time	NOUN
ahs-18399	90	33	and	and	CCONJ
ahs-18399	90	34	the	the	DET
ahs-18399	90	35	length	length	NOUN
ahs-18399	90	36	of	of	ADP
ahs-18399	90	37	post	post	ADJ
ahs-18399	90	38	-	-	ADJ
ahs-18399	90	39	exposure	exposure	ADJ
ahs-18399	90	40	incubation	incubation	NOUN
ahs-18399	90	41	(	(	PUNCT
ahs-18399	90	42	fig	fig	NOUN
ahs-18399	90	43	.	.	PUNCT
ahs-18399	91	1	3	3	NUM
ahs-18399	91	2	)	)	PUNCT
ahs-18399	91	3	.	.	PUNCT
ahs-18399	92	1	compared	compare	VERB
ahs-18399	92	2	to	to	ADP
ahs-18399	92	3	uv	uv	NOUN
ahs-18399	92	4	-	-	PUNCT
ahs-18399	92	5	a	a	NOUN
ahs-18399	92	6	,	,	PUNCT
ahs-18399	92	7	impact	impact	NOUN
ahs-18399	92	8	of	of	ADP
ahs-18399	92	9	uv	uv	NOUN
ahs-18399	92	10	-	-	PUNCT
ahs-18399	92	11	c	c	NOUN
ahs-18399	92	12	irradiation	irradiation	NOUN
ahs-18399	92	13	was	be	AUX
ahs-18399	92	14	shown	show	VERB
ahs-18399	92	15	to	to	PART
ahs-18399	92	16	be	be	AUX
ahs-18399	92	17	much	much	ADV
ahs-18399	92	18	more	more	ADV
ahs-18399	92	19	severe	severe	ADJ
ahs-18399	92	20	,	,	PUNCT
ahs-18399	92	21	requiring	require	VERB
ahs-18399	92	22	shorter	short	ADJ
ahs-18399	92	23	irradiation	irradiation	NOUN
ahs-18399	92	24	time	time	NOUN
ahs-18399	92	25	and	and	CCONJ
ahs-18399	92	26	post	post	ADJ
ahs-18399	92	27	-	-	ADJ
ahs-18399	92	28	irradiation	irradiation	ADJ
ahs-18399	92	29	incubation	incubation	NOUN
ahs-18399	92	30	.	.	PUNCT
ahs-18399	93	1	uv	uv	NOUN
ahs-18399	93	2	-	-	PUNCT
ahs-18399	93	3	responsive	responsive	ADJ
ahs-18399	93	4	gene	gene	NOUN
ahs-18399	93	5	expressions	expression	NOUN
ahs-18399	93	6	the	the	DET
ahs-18399	93	7	genes	gene	NOUN
ahs-18399	93	8	examined	examine	VERB
ahs-18399	93	9	were	be	AUX
ahs-18399	93	10	1	1	NUM
ahs-18399	93	11	-	-	PUNCT
ahs-18399	93	12	amincocyclopropane1	amincocyclopropane1	NOUN
ahs-18399	93	13	-	-	PUNCT
ahs-18399	93	14	carboxylic	carboxylic	ADJ
ahs-18399	93	15	acid	acid	NOUN
ahs-18399	93	16	(	(	PUNCT
ahs-18399	93	17	acc	acc	PROPN
ahs-18399	93	18	)	)	PUNCT
ahs-18399	93	19	synthase	synthase	NOUN
ahs-18399	93	20	gene	gene	NOUN
ahs-18399	93	21	(	(	PUNCT
ahs-18399	93	22	acs1a	acs1a	PROPN
ahs-18399	93	23	)	)	PUNCT
ahs-18399	93	24	,	,	PUNCT
ahs-18399	93	25	ascorbate	ascorbate	NOUN
ahs-18399	93	26	peroxidise	peroxidise	ADJ
ahs-18399	93	27	gene	gene	NOUN
ahs-18399	93	28	(	(	PUNCT
ahs-18399	93	29	apx	apx	PROPN
ahs-18399	93	30	,	,	PUNCT
ahs-18399	93	31	cytosolic	cytosolic	ADJ
ahs-18399	93	32	isoform	isoform	NOUN
ahs-18399	93	33	)	)	PUNCT
ahs-18399	93	34	,	,	PUNCT
ahs-18399	93	35	pathogenesis	pathogenesis	NOUN
ahs-18399	93	36	-	-	PUNCT
ahs-18399	93	37	related	relate	VERB
ahs-18399	93	38	(	(	PUNCT
ahs-18399	93	39	pr	pr	NOUN
ahs-18399	93	40	)	)	PUNCT
ahs-18399	93	41	genes	gene	NOUN
ahs-18399	93	42	pr1	pr1	NOUN
ahs-18399	93	43	and	and	CCONJ
ahs-18399	93	44	pr	pr	NOUN
ahs-18399	93	45	-	-	PUNCT
ahs-18399	93	46	p2	p2	NOUN
ahs-18399	93	47	,	,	PUNCT
ahs-18399	93	48	and	and	CCONJ
ahs-18399	93	49	phenylalanine	phenylalanine	ADJ
ahs-18399	93	50	ammonia	ammonia	NOUN
ahs-18399	93	51	-	-	PUNCT
ahs-18399	93	52	lyase	lyase	NOUN
ahs-18399	93	53	gene	gene	NOUN
ahs-18399	93	54	(	(	PUNCT
ahs-18399	93	55	pal	pal	NOUN
ahs-18399	93	56	)	)	PUNCT
ahs-18399	93	57	as	as	ADP
ahs-18399	93	58	possible	possible	ADJ
ahs-18399	93	59	targets	target	NOUN
ahs-18399	93	60	of	of	ADP
ahs-18399	93	61	uv	uv	NOUN
ahs-18399	93	62	impact	impact	NOUN
ahs-18399	93	63	,	,	PUNCT
ahs-18399	93	64	and	and	CCONJ
ahs-18399	93	65	actin	actin	NOUN
ahs-18399	93	66	gene	gene	NOUN
ahs-18399	93	67	as	as	ADP
ahs-18399	93	68	non	non	ADJ
ahs-18399	93	69	-	-	ADJ
ahs-18399	93	70	inducible	inducible	ADJ
ahs-18399	93	71	reference	reference	NOUN
ahs-18399	93	72	.	.	PUNCT
ahs-18399	94	1	fig	fig	NOUN
ahs-18399	94	2	.	.	PUNCT
ahs-18399	95	1	1	1	NUM
ahs-18399	95	2	development	development	NOUN
ahs-18399	95	3	of	of	ADP
ahs-18399	95	4	uv	uv	NOUN
ahs-18399	95	5	-	-	PUNCT
ahs-18399	95	6	induced	induced	ADJ
ahs-18399	95	7	symptoms	symptom	NOUN
ahs-18399	95	8	(	(	PUNCT
ahs-18399	95	9	lesions	lesion	NOUN
ahs-18399	95	10	)	)	PUNCT
ahs-18399	95	11	on	on	ADP
ahs-18399	95	12	the	the	DET
ahs-18399	95	13	leaves	leave	NOUN
ahs-18399	95	14	of	of	ADP
ahs-18399	95	15	micro	micro	NOUN
ahs-18399	95	16	-	-	NOUN
ahs-18399	95	17	tom	tom	PROPN
ahs-18399	95	18	after	after	ADP
ahs-18399	95	19	the	the	DET
ahs-18399	95	20	uv	uv	NOUN
ahs-18399	95	21	-	-	PUNCT
ahs-18399	95	22	irradiation	irradiation	NOUN
ahs-18399	95	23	.	.	PUNCT
ahs-18399	96	1	leaflets	leaflet	NOUN
ahs-18399	96	2	were	be	AUX
ahs-18399	96	3	irradiated	irradiate	VERB
ahs-18399	96	4	with	with	ADP
ahs-18399	96	5	uv	uv	NOUN
ahs-18399	96	6	rays	ray	NOUN
ahs-18399	96	7	for	for	ADP
ahs-18399	96	8	30	30	NUM
ahs-18399	96	9	min	min	NOUN
ahs-18399	96	10	and	and	CCONJ
ahs-18399	96	11	further	far	ADV
ahs-18399	96	12	incubated	incubate	VERB
ahs-18399	96	13	in	in	ADP
ahs-18399	96	14	darkness	darkness	NOUN
ahs-18399	96	15	on	on	ADP
ahs-18399	96	16	ultrapure	ultrapure	ADJ
ahs-18399	96	17	water	water	NOUN
ahs-18399	96	18	.	.	PUNCT
ahs-18399	97	1	lesions	lesion	NOUN
ahs-18399	97	2	on	on	ADP
ahs-18399	97	3	the	the	DET
ahs-18399	97	4	leaves	leave	NOUN
ahs-18399	97	5	were	be	AUX
ahs-18399	97	6	observed	observe	VERB
ahs-18399	97	7	under	under	ADP
ahs-18399	97	8	microscopes	microscope	NOUN
ahs-18399	97	9	.	.	PUNCT
ahs-18399	98	1	typical	typical	ADJ
ahs-18399	98	2	images	image	NOUN
ahs-18399	98	3	from	from	ADP
ahs-18399	98	4	three	three	NUM
ahs-18399	98	5	repeated	repeat	VERB
ahs-18399	98	6	experiments	experiment	NOUN
ahs-18399	98	7	are	be	AUX
ahs-18399	98	8	shown	show	VERB
ahs-18399	98	9	.	.	PUNCT
ahs-18399	99	1	fig	fig	NOUN
ahs-18399	99	2	.	.	PUNCT
ahs-18399	100	1	2	2	NUM
ahs-18399	100	2	measurement	measurement	NOUN
ahs-18399	100	3	of	of	ADP
ahs-18399	100	4	ion	ion	NOUN
ahs-18399	100	5	leakage	leakage	NOUN
ahs-18399	100	6	from	from	ADP
ahs-18399	100	7	the	the	DET
ahs-18399	100	8	uv	uv	NOUN
ahs-18399	100	9	-	-	PUNCT
ahs-18399	100	10	irradiated	irradiate	VERB
ahs-18399	100	11	leaf	leaf	NOUN
ahs-18399	100	12	discs	disc	NOUN
ahs-18399	100	13	of	of	ADP
ahs-18399	100	14	micro	micro	NOUN
ahs-18399	100	15	-	-	PROPN
ahs-18399	100	16	tom	tom	PROPN
ahs-18399	100	17	.	.	PUNCT
ahs-18399	100	18	leaf	leaf	NOUN
ahs-18399	100	19	discs	disc	NOUN
ahs-18399	100	20	were	be	AUX
ahs-18399	100	21	irradiated	irradiate	VERB
ahs-18399	100	22	with	with	ADP
ahs-18399	100	23	uv	uv	NOUN
ahs-18399	100	24	rays	ray	NOUN
ahs-18399	100	25	for	for	ADP
ahs-18399	100	26	30	30	NUM
ahs-18399	100	27	min	min	NOUN
ahs-18399	100	28	and	and	CCONJ
ahs-18399	100	29	further	far	ADV
ahs-18399	100	30	incubated	incubate	VERB
ahs-18399	100	31	in	in	ADP
ahs-18399	100	32	darkness	darkness	NOUN
ahs-18399	100	33	on	on	ADP
ahs-18399	100	34	ultrapure	ultrapure	ADJ
ahs-18399	100	35	water	water	NOUN
ahs-18399	100	36	.	.	PUNCT
ahs-18399	101	1	the	the	DET
ahs-18399	101	2	percentage	percentage	NOUN
ahs-18399	101	3	of	of	ADP
ahs-18399	101	4	ion	ion	NOUN
ahs-18399	101	5	leakage	leakage	NOUN
ahs-18399	101	6	was	be	AUX
ahs-18399	101	7	calculated	calculate	VERB
ahs-18399	101	8	as	as	ADP
ahs-18399	101	9	a	a	DET
ahs-18399	101	10	ratio	ratio	NOUN
ahs-18399	101	11	to	to	ADP
ahs-18399	101	12	conductivity	conductivity	NOUN
ahs-18399	101	13	after	after	ADP
ahs-18399	101	14	boiling	boil	VERB
ahs-18399	101	15	of	of	ADP
ahs-18399	101	16	the	the	DET
ahs-18399	101	17	leaf	leaf	NOUN
ahs-18399	101	18	samples	sample	NOUN
ahs-18399	101	19	.	.	PUNCT
ahs-18399	102	1	each	each	DET
ahs-18399	102	2	data	datum	NOUN
ahs-18399	102	3	point	point	NOUN
ahs-18399	102	4	and	and	CCONJ
ahs-18399	102	5	error	error	NOUN
ahs-18399	102	6	bar	bar	NOUN
ahs-18399	102	7	reflect	reflect	VERB
ahs-18399	102	8	the	the	DET
ahs-18399	102	9	mean	mean	NOUN
ahs-18399	102	10	and	and	CCONJ
ahs-18399	102	11	s.d	s.d	PROPN
ahs-18399	102	12	.	.	PROPN
ahs-18399	102	13	,	,	PUNCT
ahs-18399	102	14	respectively	respectively	ADV
ahs-18399	102	15	(	(	PUNCT
ahs-18399	102	16	n	n	NOUN
ahs-18399	102	17	=	=	SYM
ahs-18399	102	18	3	3	NUM
ahs-18399	102	19	)	)	PUNCT
ahs-18399	102	20	.	.	PUNCT
ahs-18399	103	1	fig	fig	NOUN
ahs-18399	103	2	.	.	PUNCT
ahs-18399	104	1	3	3	NUM
ahs-18399	104	2	uv	uv	NOUN
ahs-18399	104	3	-	-	PUNCT
ahs-18399	104	4	induced	induce	VERB
ahs-18399	104	5	cell	cell	NOUN
ahs-18399	104	6	death	death	NOUN
ahs-18399	104	7	in	in	ADP
ahs-18399	104	8	suspension	suspension	NOUN
ahs-18399	104	9	cultured	cultured	ADJ
ahs-18399	104	10	cells	cell	NOUN
ahs-18399	104	11	.	.	PUNCT
ahs-18399	105	1	(	(	PUNCT
ahs-18399	105	2	a	a	X
ahs-18399	105	3	)	)	PUNCT
ahs-18399	105	4	effect	effect	NOUN
ahs-18399	105	5	of	of	ADP
ahs-18399	105	6	irradiation	irradiation	NOUN
ahs-18399	105	7	time	time	NOUN
ahs-18399	105	8	on	on	ADP
ahs-18399	105	9	the	the	DET
ahs-18399	105	10	uv	uv	NOUN
ahs-18399	105	11	-	-	PUNCT
ahs-18399	105	12	induced	induce	VERB
ahs-18399	105	13	cell	cell	NOUN
ahs-18399	105	14	death	death	NOUN
ahs-18399	105	15	.	.	PUNCT
ahs-18399	106	1	(	(	PUNCT
ahs-18399	106	2	b	b	X
ahs-18399	106	3	)	)	PUNCT
ahs-18399	106	4	progress	progress	NOUN
ahs-18399	106	5	of	of	ADP
ahs-18399	106	6	cell	cell	NOUN
ahs-18399	106	7	death	death	NOUN
ahs-18399	106	8	after	after	ADP
ahs-18399	106	9	the	the	DET
ahs-18399	106	10	uv	uv	NOUN
ahs-18399	106	11	-	-	PUNCT
ahs-18399	106	12	a	a	DET
ahs-18399	106	13	-	-	PUNCT
ahs-18399	106	14	irradiation	irradiation	NOUN
ahs-18399	106	15	.	.	PUNCT
ahs-18399	107	1	(	(	PUNCT
ahs-18399	107	2	c	c	X
ahs-18399	107	3	)	)	PUNCT
ahs-18399	107	4	progress	progress	NOUN
ahs-18399	107	5	of	of	ADP
ahs-18399	107	6	cell	cell	NOUN
ahs-18399	107	7	death	death	NOUN
ahs-18399	107	8	after	after	ADP
ahs-18399	107	9	the	the	DET
ahs-18399	107	10	uv	uv	NOUN
ahs-18399	107	11	-	-	PUNCT
ahs-18399	107	12	c	c	NOUN
ahs-18399	107	13	-	-	PUNCT
ahs-18399	107	14	irradiation	irradiation	NOUN
ahs-18399	107	15	.	.	PUNCT
ahs-18399	108	1	cell	cell	NOUN
ahs-18399	108	2	death	death	NOUN
ahs-18399	108	3	was	be	AUX
ahs-18399	108	4	judged	judge	VERB
ahs-18399	108	5	by	by	ADP
ahs-18399	108	6	evans	evans	PROPN
ahs-18399	108	7	blue	blue	PROPN
ahs-18399	108	8	staining	stain	VERB
ahs-18399	108	9	under	under	ADP
ahs-18399	108	10	microscopes	microscope	NOUN
ahs-18399	108	11	.	.	PUNCT
ahs-18399	109	1	each	each	DET
ahs-18399	109	2	data	datum	NOUN
ahs-18399	109	3	point	point	NOUN
ahs-18399	109	4	and	and	CCONJ
ahs-18399	109	5	error	error	NOUN
ahs-18399	109	6	bar	bar	NOUN
ahs-18399	109	7	reflect	reflect	VERB
ahs-18399	109	8	the	the	DET
ahs-18399	109	9	mean	mean	NOUN
ahs-18399	109	10	and	and	CCONJ
ahs-18399	109	11	s.d	s.d	PROPN
ahs-18399	109	12	.	.	PROPN
ahs-18399	109	13	,	,	PUNCT
ahs-18399	109	14	respectively	respectively	ADV
ahs-18399	109	15	(	(	PUNCT
ahs-18399	109	16	n	n	NOUN
ahs-18399	109	17	=	=	SYM
ahs-18399	109	18	3	3	NUM
ahs-18399	109	19	)	)	PUNCT
ahs-18399	109	20	.	.	PUNCT
ahs-18399	110	1	137	137	NUM
ahs-18399	110	2	in	in	ADP
ahs-18399	110	3	the	the	DET
ahs-18399	110	4	cell	cell	NOUN
ahs-18399	110	5	suspension	suspension	NOUN
ahs-18399	110	6	culture	culture	NOUN
ahs-18399	110	7	of	of	ADP
ahs-18399	110	8	micro	micro	NOUN
ahs-18399	110	9	-	-	PROPN
ahs-18399	110	10	tom	tom	PROPN
ahs-18399	110	11	,	,	PUNCT
ahs-18399	110	12	expression	expression	NOUN
ahs-18399	110	13	of	of	ADP
ahs-18399	110	14	apx	apx	PROPN
ahs-18399	110	15	,	,	PUNCT
ahs-18399	110	16	pr	pr	NOUN
ahs-18399	110	17	-	-	PUNCT
ahs-18399	110	18	p2	p2	NOUN
ahs-18399	110	19	,	,	PUNCT
ahs-18399	110	20	pal	pal	NOUN
ahs-18399	110	21	,	,	PUNCT
ahs-18399	110	22	and	and	CCONJ
ahs-18399	110	23	actin	actin	NOUN
ahs-18399	110	24	were	be	AUX
ahs-18399	110	25	shown	show	VERB
ahs-18399	110	26	to	to	PART
ahs-18399	110	27	be	be	AUX
ahs-18399	110	28	maintained	maintain	VERB
ahs-18399	110	29	at	at	ADP
ahs-18399	110	30	active	active	ADJ
ahs-18399	110	31	level	level	NOUN
ahs-18399	110	32	even	even	ADV
ahs-18399	110	33	prior	prior	ADV
ahs-18399	110	34	to	to	ADP
ahs-18399	110	35	the	the	DET
ahs-18399	110	36	irradiation	irradiation	NOUN
ahs-18399	110	37	with	with	ADP
ahs-18399	110	38	uv	uv	NOUN
ahs-18399	110	39	rays	ray	NOUN
ahs-18399	110	40	(	(	PUNCT
ahs-18399	110	41	fig	fig	NOUN
ahs-18399	110	42	.	.	PUNCT
ahs-18399	110	43	4	4	NUM
ahs-18399	110	44	a	a	PRON
ahs-18399	110	45	,	,	PUNCT
ahs-18399	110	46	dark	dark	ADJ
ahs-18399	110	47	control	control	NOUN
ahs-18399	110	48	)	)	PUNCT
ahs-18399	110	49	.	.	PUNCT
ahs-18399	111	1	in	in	ADP
ahs-18399	111	2	the	the	DET
ahs-18399	111	3	leaf	leaf	NOUN
ahs-18399	111	4	samples	sample	NOUN
ahs-18399	111	5	of	of	ADP
ahs-18399	111	6	micro	micro	NOUN
ahs-18399	111	7	-	-	PROPN
ahs-18399	111	8	tom	tom	PROPN
ahs-18399	111	9	,	,	PUNCT
ahs-18399	111	10	acs1a	acs1a	PROPN
ahs-18399	111	11	,	,	PUNCT
ahs-18399	111	12	apx	apx	PROPN
ahs-18399	111	13	,	,	PUNCT
ahs-18399	111	14	pal	pal	NOUN
ahs-18399	111	15	,	,	PUNCT
ahs-18399	111	16	pr-1	pr-1	PUNCT
ahs-18399	111	17	and	and	CCONJ
ahs-18399	111	18	actin	actin	NOUN
ahs-18399	111	19	were	be	AUX
ahs-18399	111	20	shown	show	VERB
ahs-18399	111	21	to	to	PART
ahs-18399	111	22	be	be	AUX
ahs-18399	111	23	expressed	express	VERB
ahs-18399	111	24	without	without	ADP
ahs-18399	111	25	uv	uv	NOUN
ahs-18399	111	26	irradiations	irradiation	NOUN
ahs-18399	111	27	(	(	PUNCT
ahs-18399	111	28	fig	fig	NOUN
ahs-18399	111	29	.	.	PUNCT
ahs-18399	112	1	4	4	NUM
ahs-18399	112	2	b	b	NOUN
ahs-18399	112	3	)	)	PUNCT
ahs-18399	112	4	.	.	PUNCT
ahs-18399	113	1	similarly	similarly	ADV
ahs-18399	113	2	,	,	PUNCT
ahs-18399	113	3	mature	mature	ADJ
ahs-18399	113	4	red	red	ADJ
ahs-18399	113	5	fruit	fruit	NOUN
ahs-18399	113	6	samples	sample	NOUN
ahs-18399	113	7	revealed	reveal	VERB
ahs-18399	113	8	high	high	ADJ
ahs-18399	113	9	expressions	expression	NOUN
ahs-18399	113	10	of	of	ADP
ahs-18399	113	11	acs1a	acs1a	PROPN
ahs-18399	113	12	,	,	PUNCT
ahs-18399	113	13	apx	apx	PROPN
ahs-18399	113	14	,	,	PUNCT
ahs-18399	113	15	pr-1	pr-1	PUNCT
ahs-18399	113	16	and	and	CCONJ
ahs-18399	113	17	actin	actin	NOUN
ahs-18399	113	18	,	,	PUNCT
ahs-18399	113	19	prior	prior	ADV
ahs-18399	113	20	to	to	ADP
ahs-18399	113	21	the	the	DET
ahs-18399	113	22	irradiation	irradiation	NOUN
ahs-18399	113	23	with	with	ADP
ahs-18399	113	24	uv	uv	NOUN
ahs-18399	113	25	rays	ray	NOUN
ahs-18399	113	26	(	(	PUNCT
ahs-18399	113	27	fig	fig	NOUN
ahs-18399	113	28	.	.	PUNCT
ahs-18399	114	1	5	5	NUM
ahs-18399	114	2	b	b	NOUN
ahs-18399	114	3	)	)	PUNCT
ahs-18399	114	4	.	.	PUNCT
ahs-18399	115	1	in	in	ADP
ahs-18399	115	2	contrast	contrast	NOUN
ahs-18399	115	3	,	,	PUNCT
ahs-18399	115	4	in	in	ADP
ahs-18399	115	5	the	the	DET
ahs-18399	115	6	green	green	ADJ
ahs-18399	115	7	fruit	fruit	NOUN
ahs-18399	115	8	samples	sample	NOUN
ahs-18399	115	9	,	,	PUNCT
ahs-18399	115	10	only	only	ADV
ahs-18399	115	11	apx	apx	PROPN
ahs-18399	115	12	and	and	CCONJ
ahs-18399	115	13	actin	actin	NOUN
ahs-18399	115	14	were	be	AUX
ahs-18399	115	15	expressed	express	VERB
ahs-18399	115	16	in	in	ADP
ahs-18399	115	17	the	the	DET
ahs-18399	115	18	dark	dark	ADJ
ahs-18399	115	19	control	control	NOUN
ahs-18399	115	20	(	(	PUNCT
ahs-18399	115	21	fig	fig	NOUN
ahs-18399	115	22	.	.	PUNCT
ahs-18399	116	1	5	5	NUM
ahs-18399	116	2	a	a	PRON
ahs-18399	116	3	)	)	PUNCT
ahs-18399	116	4	.	.	PUNCT
ahs-18399	117	1	among	among	ADP
ahs-18399	117	2	the	the	DET
ahs-18399	117	3	genes	gene	NOUN
ahs-18399	117	4	tested	test	VERB
ahs-18399	117	5	,	,	PUNCT
ahs-18399	117	6	acs1a	acs1a	PROPN
ahs-18399	117	7	was	be	AUX
ahs-18399	117	8	the	the	DET
ahs-18399	117	9	only	only	ADJ
ahs-18399	117	10	gene	gene	NOUN
ahs-18399	117	11	uvdependently	uvdependently	ADV
ahs-18399	117	12	activated	activate	VERB
ahs-18399	117	13	in	in	ADP
ahs-18399	117	14	the	the	DET
ahs-18399	117	15	cell	cell	NOUN
ahs-18399	117	16	suspension	suspension	NOUN
ahs-18399	117	17	culture	culture	NOUN
ahs-18399	117	18	.	.	PUNCT
ahs-18399	118	1	expression	expression	NOUN
ahs-18399	118	2	of	of	ADP
ahs-18399	118	3	acs1a	acs1a	PROPN
ahs-18399	118	4	was	be	AUX
ahs-18399	118	5	induced	induce	VERB
ahs-18399	118	6	by	by	ADP
ahs-18399	118	7	both	both	DET
ahs-18399	118	8	uv	uv	NOUN
ahs-18399	118	9	-	-	PUNCT
ahs-18399	118	10	a	a	NOUN
ahs-18399	118	11	and	and	CCONJ
ahs-18399	118	12	uv	uv	NOUN
ahs-18399	118	13	-	-	PUNCT
ahs-18399	118	14	c	c	NOUN
ahs-18399	118	15	(	(	PUNCT
ahs-18399	118	16	fig	fig	NOUN
ahs-18399	118	17	.	.	PUNCT
ahs-18399	119	1	4	4	NUM
ahs-18399	119	2	a	a	PRON
ahs-18399	119	3	)	)	PUNCT
ahs-18399	119	4	.	.	PUNCT
ahs-18399	120	1	uv	uv	NOUN
ahs-18399	120	2	-	-	PUNCT
ahs-18399	120	3	a	a	PRON
ahs-18399	120	4	-	-	PUNCT
ahs-18399	120	5	dependent	dependent	ADJ
ahs-18399	120	6	activations	activation	NOUN
ahs-18399	120	7	of	of	ADP
ahs-18399	120	8	pr1	pr1	NOUN
ahs-18399	120	9	in	in	ADP
ahs-18399	120	10	the	the	DET
ahs-18399	120	11	green	green	ADJ
ahs-18399	120	12	fruits	fruit	NOUN
ahs-18399	120	13	and	and	CCONJ
ahs-18399	120	14	leaves	leave	NOUN
ahs-18399	120	15	,	,	PUNCT
ahs-18399	120	16	of	of	ADP
ahs-18399	120	17	acs1a	acs1a	NOUN
ahs-18399	120	18	in	in	ADP
ahs-18399	120	19	the	the	DET
ahs-18399	120	20	green	green	ADJ
ahs-18399	120	21	fruits	fruit	NOUN
ahs-18399	120	22	and	and	CCONJ
ahs-18399	120	23	cell	cell	NOUN
ahs-18399	120	24	suspension	suspension	NOUN
ahs-18399	120	25	culture	culture	NOUN
ahs-18399	120	26	,	,	PUNCT
ahs-18399	120	27	and	and	CCONJ
ahs-18399	120	28	of	of	ADP
ahs-18399	120	29	pal	pal	NOUN
ahs-18399	120	30	and	and	CCONJ
ahs-18399	120	31	pr	pr	NOUN
ahs-18399	120	32	-	-	PUNCT
ahs-18399	120	33	p2	p2	NOUN
ahs-18399	120	34	in	in	ADP
ahs-18399	120	35	the	the	DET
ahs-18399	120	36	green	green	ADJ
ahs-18399	120	37	fruits	fruit	NOUN
ahs-18399	120	38	were	be	AUX
ahs-18399	120	39	observed	observe	VERB
ahs-18399	120	40	(	(	PUNCT
ahs-18399	120	41	fig	fig	NOUN
ahs-18399	120	42	.	.	NOUN
ahs-18399	120	43	4	4	NUM
ahs-18399	120	44	and	and	CCONJ
ahs-18399	120	45	5	5	NUM
ahs-18399	120	46	)	)	PUNCT
ahs-18399	120	47	.	.	PUNCT
ahs-18399	121	1	uv	uv	NOUN
ahs-18399	121	2	-	-	PUNCT
ahs-18399	121	3	c	c	NOUN
ahs-18399	121	4	-	-	PUNCT
ahs-18399	121	5	dependent	dependent	ADJ
ahs-18399	121	6	activation	activation	NOUN
ahs-18399	121	7	of	of	ADP
ahs-18399	121	8	pr1	pr1	NOUN
ahs-18399	121	9	in	in	ADP
ahs-18399	121	10	green	green	ADJ
ahs-18399	121	11	fruits	fruit	NOUN
ahs-18399	121	12	and	and	CCONJ
ahs-18399	121	13	leaves	leave	NOUN
ahs-18399	121	14	,	,	PUNCT
ahs-18399	121	15	of	of	ADP
ahs-18399	121	16	pr	pr	NOUN
ahs-18399	121	17	-	-	PUNCT
ahs-18399	121	18	p2	p2	NOUN
ahs-18399	121	19	in	in	ADP
ahs-18399	121	20	the	the	DET
ahs-18399	121	21	leaves	leave	NOUN
ahs-18399	121	22	,	,	PUNCT
ahs-18399	121	23	of	of	ADP
ahs-18399	121	24	pal	pal	NOUN
ahs-18399	121	25	in	in	ADP
ahs-18399	121	26	green	green	ADJ
ahs-18399	121	27	fruit	fruit	NOUN
ahs-18399	121	28	tissue	tissue	NOUN
ahs-18399	121	29	,	,	PUNCT
ahs-18399	121	30	and	and	CCONJ
ahs-18399	121	31	of	of	ADP
ahs-18399	121	32	acs1a	acs1a	NOUN
ahs-18399	121	33	in	in	ADP
ahs-18399	121	34	the	the	DET
ahs-18399	121	35	green	green	ADJ
ahs-18399	121	36	fruits	fruit	NOUN
ahs-18399	121	37	and	and	CCONJ
ahs-18399	121	38	also	also	ADV
ahs-18399	121	39	in	in	ADP
ahs-18399	121	40	the	the	DET
ahs-18399	121	41	cell	cell	NOUN
ahs-18399	121	42	suspension	suspension	NOUN
ahs-18399	121	43	culture	culture	NOUN
ahs-18399	121	44	were	be	AUX
ahs-18399	121	45	observed	observe	VERB
ahs-18399	121	46	(	(	PUNCT
ahs-18399	121	47	fig	fig	NOUN
ahs-18399	121	48	.	.	NOUN
ahs-18399	121	49	4	4	NUM
ahs-18399	121	50	and	and	CCONJ
ahs-18399	121	51	5	5	NUM
ahs-18399	121	52	)	)	PUNCT
ahs-18399	121	53	.	.	PUNCT
ahs-18399	122	1	although	although	SCONJ
ahs-18399	122	2	pr1	pr1	NOUN
ahs-18399	122	3	was	be	AUX
ahs-18399	122	4	shown	show	VERB
ahs-18399	122	5	to	to	PART
ahs-18399	122	6	be	be	AUX
ahs-18399	122	7	responsive	responsive	ADJ
ahs-18399	122	8	to	to	ADP
ahs-18399	122	9	both	both	DET
ahs-18399	122	10	uv	uv	NOUN
ahs-18399	122	11	-	-	PUNCT
ahs-18399	122	12	a	a	NOUN
ahs-18399	122	13	and	and	CCONJ
ahs-18399	122	14	uv	uv	NOUN
ahs-18399	122	15	-	-	PUNCT
ahs-18399	122	16	c	c	NOUN
ahs-18399	122	17	in	in	ADP
ahs-18399	122	18	green	green	ADJ
ahs-18399	122	19	fruit	fruit	NOUN
ahs-18399	122	20	tissue	tissue	NOUN
ahs-18399	122	21	,	,	PUNCT
ahs-18399	122	22	the	the	DET
ahs-18399	122	23	temporal	temporal	ADJ
ahs-18399	122	24	profiles	profile	NOUN
ahs-18399	122	25	of	of	ADP
ahs-18399	122	26	induced	induced	ADJ
ahs-18399	122	27	gene	gene	NOUN
ahs-18399	122	28	expression	expression	NOUN
ahs-18399	122	29	largely	largely	ADV
ahs-18399	122	30	differed	differ	VERB
ahs-18399	122	31	.	.	PUNCT
ahs-18399	123	1	in	in	ADP
ahs-18399	123	2	green	green	ADJ
ahs-18399	123	3	fruits	fruit	NOUN
ahs-18399	123	4	,	,	PUNCT
ahs-18399	123	5	uv	uv	NOUN
ahs-18399	123	6	-	-	PUNCT
ahs-18399	123	7	a	a	NOUN
ahs-18399	123	8	and	and	CCONJ
ahs-18399	123	9	uv	uv	NOUN
ahs-18399	123	10	-	-	PUNCT
ahs-18399	123	11	c	c	NOUN
ahs-18399	123	12	were	be	AUX
ahs-18399	123	13	shown	show	VERB
ahs-18399	123	14	to	to	PART
ahs-18399	123	15	be	be	AUX
ahs-18399	123	16	rapid	rapid	ADJ
ahs-18399	123	17	and	and	CCONJ
ahs-18399	123	18	slow	slow	ADJ
ahs-18399	123	19	inducers	inducer	NOUN
ahs-18399	123	20	of	of	ADP
ahs-18399	123	21	pr1	pr1	NOUN
ahs-18399	123	22	expression	expression	NOUN
ahs-18399	123	23	,	,	PUNCT
ahs-18399	123	24	respectively	respectively	ADV
ahs-18399	123	25	(	(	PUNCT
ahs-18399	123	26	fig	fig	NOUN
ahs-18399	123	27	5	5	NUM
ahs-18399	123	28	)	)	PUNCT
ahs-18399	123	29	.	.	PUNCT
ahs-18399	124	1	since	since	SCONJ
ahs-18399	124	2	,	,	PUNCT
ahs-18399	124	3	most	most	ADJ
ahs-18399	124	4	of	of	ADP
ahs-18399	124	5	the	the	DET
ahs-18399	124	6	genes	gene	NOUN
ahs-18399	124	7	examined	examine	VERB
ahs-18399	124	8	were	be	AUX
ahs-18399	124	9	active	active	ADJ
ahs-18399	124	10	in	in	ADP
ahs-18399	124	11	the	the	DET
ahs-18399	124	12	dark	dark	ADJ
ahs-18399	124	13	control	control	NOUN
ahs-18399	124	14	of	of	ADP
ahs-18399	124	15	red	red	ADJ
ahs-18399	124	16	fruit	fruit	NOUN
ahs-18399	124	17	samples	sample	NOUN
ahs-18399	124	18	,	,	PUNCT
ahs-18399	124	19	drastic	drastic	ADJ
ahs-18399	124	20	activation	activation	NOUN
ahs-18399	124	21	of	of	ADP
ahs-18399	124	22	gene	gene	NOUN
ahs-18399	124	23	expression	expression	NOUN
ahs-18399	124	24	could	could	AUX
ahs-18399	124	25	not	not	PART
ahs-18399	124	26	be	be	AUX
ahs-18399	124	27	observed	observe	VERB
ahs-18399	124	28	,	,	PUNCT
ahs-18399	124	29	except	except	SCONJ
ahs-18399	124	30	for	for	ADP
ahs-18399	124	31	the	the	DET
ahs-18399	124	32	case	case	NOUN
ahs-18399	124	33	of	of	ADP
ahs-18399	124	34	enhancement	enhancement	NOUN
ahs-18399	124	35	of	of	ADP
ahs-18399	124	36	pr	pr	NOUN
ahs-18399	124	37	-	-	PUNCT
ahs-18399	124	38	p2	p2	NOUN
ahs-18399	124	39	expression	expression	NOUN
ahs-18399	124	40	which	which	PRON
ahs-18399	124	41	was	be	AUX
ahs-18399	124	42	originally	originally	ADV
ahs-18399	124	43	active	active	ADJ
ahs-18399	124	44	in	in	ADP
ahs-18399	124	45	the	the	DET
ahs-18399	124	46	dark	dark	ADJ
ahs-18399	124	47	control	control	NOUN
ahs-18399	124	48	.	.	PUNCT
ahs-18399	125	1	apx	apx	PROPN
ahs-18399	125	2	was	be	AUX
ahs-18399	125	3	shown	show	VERB
ahs-18399	125	4	to	to	PART
ahs-18399	125	5	be	be	AUX
ahs-18399	125	6	active	active	ADJ
ahs-18399	125	7	in	in	ADP
ahs-18399	125	8	all	all	DET
ahs-18399	125	9	materials	material	NOUN
ahs-18399	125	10	even	even	ADV
ahs-18399	125	11	prior	prior	ADV
ahs-18399	125	12	to	to	ADP
ahs-18399	125	13	uv	uv	NOUN
ahs-18399	125	14	irradiation	irradiation	NOUN
ahs-18399	125	15	,	,	PUNCT
ahs-18399	125	16	thus	thus	ADV
ahs-18399	125	17	only	only	ADV
ahs-18399	125	18	the	the	DET
ahs-18399	125	19	suppressive	suppressive	ADJ
ahs-18399	125	20	impacts	impact	NOUN
ahs-18399	125	21	of	of	ADP
ahs-18399	125	22	uv	uv	NOUN
ahs-18399	125	23	irradiations	irradiation	NOUN
ahs-18399	125	24	could	could	AUX
ahs-18399	125	25	be	be	AUX
ahs-18399	125	26	expected	expect	VERB
ahs-18399	125	27	with	with	ADP
ahs-18399	125	28	this	this	DET
ahs-18399	125	29	gene	gene	NOUN
ahs-18399	125	30	.	.	PUNCT
ahs-18399	126	1	suppression	suppression	NOUN
ahs-18399	126	2	of	of	ADP
ahs-18399	126	3	apx	apx	NOUN
ahs-18399	126	4	expression	expression	NOUN
ahs-18399	126	5	was	be	AUX
ahs-18399	126	6	observed	observe	VERB
ahs-18399	126	7	in	in	ADP
ahs-18399	126	8	the	the	DET
ahs-18399	126	9	uv	uv	NOUN
ahs-18399	126	10	-	-	PUNCT
ahs-18399	126	11	c	c	NOUN
ahs-18399	126	12	-	-	PUNCT
ahs-18399	126	13	treated	treat	VERB
ahs-18399	126	14	red	red	ADJ
ahs-18399	126	15	fruit	fruit	NOUN
ahs-18399	126	16	samples	sample	NOUN
ahs-18399	126	17	at	at	ADP
ahs-18399	126	18	10	10	NUM
ahs-18399	126	19	h	h	NOUN
ahs-18399	126	20	after	after	ADP
ahs-18399	126	21	irradiation	irradiation	NOUN
ahs-18399	126	22	.	.	PUNCT
ahs-18399	127	1	similarly	similarly	ADV
ahs-18399	127	2	,	,	PUNCT
ahs-18399	127	3	following	follow	VERB
ahs-18399	127	4	irradiation	irradiation	NOUN
ahs-18399	127	5	with	with	ADP
ahs-18399	127	6	uv	uv	NOUN
ahs-18399	127	7	-	-	PUNCT
ahs-18399	127	8	c	c	NOUN
ahs-18399	127	9	,	,	PUNCT
ahs-18399	127	10	expressions	expression	NOUN
ahs-18399	127	11	of	of	ADP
ahs-18399	127	12	pr	pr	NOUN
ahs-18399	127	13	-	-	PUNCT
ahs-18399	127	14	p2	p2	NOUN
ahs-18399	127	15	and	and	CCONJ
ahs-18399	127	16	pal	pal	NOUN
ahs-18399	127	17	,	,	PUNCT
ahs-18399	127	18	which	which	PRON
ahs-18399	127	19	were	be	AUX
ahs-18399	127	20	constitutively	constitutively	ADV
ahs-18399	127	21	active	active	ADJ
ahs-18399	127	22	in	in	ADP
ahs-18399	127	23	the	the	DET
ahs-18399	127	24	cell	cell	NOUN
ahs-18399	127	25	suspension	suspension	NOUN
ahs-18399	127	26	,	,	PUNCT
ahs-18399	127	27	were	be	AUX
ahs-18399	127	28	eventually	eventually	ADV
ahs-18399	127	29	suppressed	suppress	VERB
ahs-18399	127	30	.	.	PUNCT
ahs-18399	128	1	expression	expression	NOUN
ahs-18399	128	2	of	of	ADP
ahs-18399	128	3	acs1a	acs1a	PROPN
ahs-18399	128	4	in	in	ADP
ahs-18399	128	5	the	the	DET
ahs-18399	128	6	leaves	leave	NOUN
ahs-18399	128	7	and	and	CCONJ
ahs-18399	128	8	red	red	ADJ
ahs-18399	128	9	fruits	fruit	NOUN
ahs-18399	128	10	was	be	AUX
ahs-18399	128	11	shown	show	VERB
ahs-18399	128	12	to	to	PART
ahs-18399	128	13	be	be	AUX
ahs-18399	128	14	suppressed	suppress	VERB
ahs-18399	128	15	by	by	ADP
ahs-18399	128	16	uv	uv	NOUN
ahs-18399	128	17	-	-	PUNCT
ahs-18399	128	18	a	a	DET
ahs-18399	128	19	irradiation	irradiation	NOUN
ahs-18399	128	20	.	.	PUNCT
ahs-18399	129	1	expression	expression	NOUN
ahs-18399	129	2	of	of	ADP
ahs-18399	129	3	acs1a	acs1a	PROPN
ahs-18399	129	4	,	,	PUNCT
ahs-18399	129	5	pr	pr	NOUN
ahs-18399	129	6	-	-	PUNCT
ahs-18399	129	7	p2	p2	NOUN
ahs-18399	129	8	,	,	PUNCT
ahs-18399	129	9	and	and	CCONJ
ahs-18399	129	10	pr1	pr1	NOUN
ahs-18399	129	11	,	,	PUNCT
ahs-18399	129	12	originally	originally	ADV
ahs-18399	129	13	active	active	ADJ
ahs-18399	129	14	in	in	ADP
ahs-18399	129	15	red	red	ADJ
ahs-18399	129	16	fruits	fruit	NOUN
ahs-18399	129	17	,	,	PUNCT
ahs-18399	129	18	were	be	AUX
ahs-18399	129	19	shown	show	VERB
ahs-18399	129	20	to	to	PART
ahs-18399	129	21	be	be	AUX
ahs-18399	129	22	suppressed	suppress	VERB
ahs-18399	129	23	by	by	ADP
ahs-18399	129	24	uv	uv	NOUN
ahs-18399	129	25	-	-	PUNCT
ahs-18399	129	26	c	c	NOUN
ahs-18399	129	27	treatments	treatment	NOUN
ahs-18399	129	28	.	.	PUNCT
ahs-18399	130	1	4	4	X
ahs-18399	130	2	.	.	X
ahs-18399	130	3	discussion	discussion	NOUN
ahs-18399	130	4	and	and	CCONJ
ahs-18399	130	5	conclusions	conclusion	NOUN
ahs-18399	130	6	cell	cell	NOUN
ahs-18399	130	7	death	death	NOUN
ahs-18399	130	8	or	or	CCONJ
ahs-18399	130	9	defense	defense	NOUN
ahs-18399	130	10	activation	activation	NOUN
ahs-18399	130	11	?	?	PUNCT
ahs-18399	131	1	a	a	DET
ahs-18399	131	2	number	number	NOUN
ahs-18399	131	3	of	of	ADP
ahs-18399	131	4	researchers	researcher	NOUN
ahs-18399	131	5	have	have	AUX
ahs-18399	131	6	documented	document	VERB
ahs-18399	131	7	toxic	toxic	ADJ
ahs-18399	131	8	impacts	impact	NOUN
ahs-18399	131	9	of	of	ADP
ahs-18399	131	10	uv	uv	NOUN
ahs-18399	131	11	rays	ray	NOUN
ahs-18399	131	12	in	in	ADP
ahs-18399	131	13	living	live	VERB
ahs-18399	131	14	plants	plant	NOUN
ahs-18399	131	15	including	include	VERB
ahs-18399	131	16	the	the	DET
ahs-18399	131	17	damages	damage	NOUN
ahs-18399	131	18	to	to	ADP
ahs-18399	131	19	dna	dna	PROPN
ahs-18399	131	20	,	,	PUNCT
ahs-18399	131	21	inhibition	inhibition	NOUN
ahs-18399	131	22	of	of	ADP
ahs-18399	131	23	photosynthesis	photosynthesis	NOUN
ahs-18399	131	24	,	,	PUNCT
ahs-18399	131	25	generation	generation	NOUN
ahs-18399	131	26	of	of	ADP
ahs-18399	131	27	reactive	reactive	ADJ
ahs-18399	131	28	oxygen	oxygen	NOUN
ahs-18399	131	29	species	specie	NOUN
ahs-18399	131	30	(	(	PUNCT
ahs-18399	131	31	ros	ros	PROPN
ahs-18399	131	32	)	)	PUNCT
ahs-18399	131	33	(	(	PUNCT
ahs-18399	131	34	roldán	roldán	NOUN
ahs-18399	131	35	-	-	PUNCT
ahs-18399	131	36	arjona	arjona	PROPN
ahs-18399	131	37	and	and	CCONJ
ahs-18399	131	38	ariza	ariza	NOUN
ahs-18399	131	39	,	,	PUNCT
ahs-18399	131	40	2009	2009	NUM
ahs-18399	131	41	)	)	PUNCT
ahs-18399	131	42	.	.	PUNCT
ahs-18399	132	1	on	on	ADP
ahs-18399	132	2	the	the	DET
ahs-18399	132	3	other	other	ADJ
ahs-18399	132	4	hand	hand	NOUN
ahs-18399	132	5	,	,	PUNCT
ahs-18399	132	6	there	there	PRON
ahs-18399	132	7	have	have	AUX
ahs-18399	132	8	been	be	AUX
ahs-18399	132	9	some	some	DET
ahs-18399	132	10	attempts	attempt	NOUN
ahs-18399	132	11	to	to	PART
ahs-18399	132	12	develop	develop	VERB
ahs-18399	132	13	the	the	DET
ahs-18399	132	14	uv	uv	NOUN
ahs-18399	132	15	irradiation	irradiation	NOUN
ahs-18399	132	16	protocol	protocol	NOUN
ahs-18399	132	17	for	for	ADP
ahs-18399	132	18	so	so	ADV
ahs-18399	132	19	-	-	PUNCT
ahs-18399	132	20	called	call	VERB
ahs-18399	132	21	‘	'	PUNCT
ahs-18399	132	22	plant	plant	NOUN
ahs-18399	132	23	hormesis	hormesis	NOUN
ahs-18399	132	24	’	'	PUNCT
ahs-18399	132	25	by	by	ADP
ahs-18399	132	26	which	which	PRON
ahs-18399	132	27	the	the	DET
ahs-18399	132	28	susceptibility	susceptibility	NOUN
ahs-18399	132	29	of	of	ADP
ahs-18399	132	30	plants	plant	NOUN
ahs-18399	132	31	to	to	ADP
ahs-18399	132	32	invading	invade	VERB
ahs-18399	132	33	pathogen	pathogen	NOUN
ahs-18399	132	34	is	be	AUX
ahs-18399	132	35	minimized	minimize	VERB
ahs-18399	132	36	and	and	CCONJ
ahs-18399	132	37	thus	thus	ADV
ahs-18399	132	38	shelf	shelf	NOUN
ahs-18399	132	39	-	-	PUNCT
ahs-18399	132	40	life	life	NOUN
ahs-18399	132	41	of	of	ADP
ahs-18399	132	42	fresh	fresh	ADJ
ahs-18399	132	43	produces	produce	NOUN
ahs-18399	132	44	is	be	AUX
ahs-18399	132	45	likely	likely	ADV
ahs-18399	132	46	extended	extended	ADJ
ahs-18399	132	47	(	(	PUNCT
ahs-18399	132	48	lu	lu	NOUN
ahs-18399	132	49	et	et	PROPN
ahs-18399	132	50	al	al	PROPN
ahs-18399	132	51	.	.	PROPN
ahs-18399	132	52	,	,	PUNCT
ahs-18399	132	53	2007	2007	NUM
ahs-18399	132	54	)	)	PUNCT
ahs-18399	132	55	.	.	PUNCT
ahs-18399	133	1	for	for	ADP
ahs-18399	133	2	example	example	NOUN
ahs-18399	133	3	,	,	PUNCT
ahs-18399	133	4	kunz	kunz	PROPN
ahs-18399	133	5	et	et	PROPN
ahs-18399	133	6	al	al	PROPN
ahs-18399	133	7	.	.	PROPN
ahs-18399	133	8	(	(	PUNCT
ahs-18399	133	9	2008	2008	NUM
ahs-18399	133	10	)	)	PUNCT
ahs-18399	133	11	demonstrated	demonstrate	VERB
ahs-18399	133	12	that	that	SCONJ
ahs-18399	133	13	uv	uv	NOUN
ahs-18399	133	14	-	-	PUNCT
ahs-18399	133	15	c	c	NOUN
ahs-18399	133	16	-	-	PUNCT
ahs-18399	133	17	induced	induce	VERB
ahs-18399	133	18	dna	dna	NOUN
ahs-18399	133	19	damage	damage	NOUN
ahs-18399	133	20	in	in	ADP
ahs-18399	133	21	arabidopsis	arabidopsis	NOUN
ahs-18399	133	22	accompanies	accompany	VERB
ahs-18399	133	23	the	the	DET
ahs-18399	133	24	doseand	doseand	ADJ
ahs-18399	133	25	time	time	NOUN
ahs-18399	133	26	-	-	PUNCT
ahs-18399	133	27	dependent	dependent	ADJ
ahs-18399	133	28	development	development	NOUN
ahs-18399	133	29	of	of	ADP
ahs-18399	133	30	resistance	resistance	NOUN
ahs-18399	133	31	against	against	ADP
ahs-18399	133	32	hyaloperonospora	hyaloperonospora	PROPN
ahs-18399	133	33	parasitica	parasitica	PROPN
ahs-18399	133	34	.	.	PUNCT
ahs-18399	134	1	interestingly	interestingly	ADV
ahs-18399	134	2	,	,	PUNCT
ahs-18399	134	3	it	it	PRON
ahs-18399	134	4	has	have	AUX
ahs-18399	134	5	been	be	AUX
ahs-18399	134	6	shown	show	VERB
ahs-18399	134	7	that	that	SCONJ
ahs-18399	134	8	,	,	PUNCT
ahs-18399	134	9	even	even	ADV
ahs-18399	134	10	in	in	ADP
ahs-18399	134	11	the	the	DET
ahs-18399	134	12	absence	absence	NOUN
ahs-18399	134	13	of	of	ADP
ahs-18399	134	14	uv	uv	NOUN
ahs-18399	134	15	-	-	PUNCT
ahs-18399	134	16	c	c	NOUN
ahs-18399	134	17	,	,	PUNCT
ahs-18399	134	18	plant	plant	NOUN
ahs-18399	134	19	nucleotide	nucleotide	NOUN
ahs-18399	134	20	excision	excision	NOUN
ahs-18399	134	21	repair	repair	NOUN
ahs-18399	134	22	mutants	mutant	NOUN
ahs-18399	134	23	displayed	display	VERB
ahs-18399	134	24	the	the	DET
ahs-18399	134	25	identical	identical	ADJ
ahs-18399	134	26	type	type	NOUN
ahs-18399	134	27	of	of	ADP
ahs-18399	134	28	resistance	resistance	NOUN
ahs-18399	134	29	to	to	ADP
ahs-18399	134	30	h.	h.	PROPN
ahs-18399	134	31	parasitica	parasitica	PROPN
ahs-18399	134	32	,	,	PUNCT
ahs-18399	134	33	suggesting	suggest	VERB
ahs-18399	134	34	a	a	DET
ahs-18399	134	35	positive	positive	ADJ
ahs-18399	134	36	role	role	NOUN
ahs-18399	134	37	for	for	ADP
ahs-18399	134	38	uv	uv	NOUN
ahs-18399	134	39	-	-	PUNCT
ahs-18399	134	40	c	c	NOUN
ahs-18399	134	41	-	-	PUNCT
ahs-18399	134	42	mediated	mediate	VERB
ahs-18399	134	43	dna	dna	NOUN
ahs-18399	134	44	damaging	damage	VERB
ahs-18399	134	45	events	event	NOUN
ahs-18399	134	46	in	in	ADP
ahs-18399	134	47	plant	plant	NOUN
ahs-18399	134	48	immunity	immunity	NOUN
ahs-18399	134	49	activation	activation	NOUN
ahs-18399	134	50	.	.	PUNCT
ahs-18399	135	1	apx	apx	PROPN
ahs-18399	135	2	,	,	PUNCT
ahs-18399	135	3	one	one	NUM
ahs-18399	135	4	of	of	ADP
ahs-18399	135	5	the	the	DET
ahs-18399	135	6	typical	typical	ADJ
ahs-18399	135	7	antioxidant	antioxidant	ADJ
ahs-18399	135	8	genes	gene	NOUN
ahs-18399	135	9	,	,	PUNCT
ahs-18399	135	10	encodes	encode	NOUN
ahs-18399	135	11	for	for	ADP
ahs-18399	135	12	the	the	DET
ahs-18399	135	13	enzyme	enzyme	NOUN
ahs-18399	135	14	capable	capable	ADJ
ahs-18399	135	15	of	of	ADP
ahs-18399	135	16	h	h	NOUN
ahs-18399	135	17	2	2	NUM
ahs-18399	135	18	o	o	NOUN
ahs-18399	135	19	2	2	NUM
ahs-18399	135	20	elimination	elimination	NOUN
ahs-18399	135	21	,	,	PUNCT
ahs-18399	135	22	thus	thus	ADV
ahs-18399	135	23	protecting	protect	VERB
ahs-18399	135	24	fig	fig	NOUN
ahs-18399	135	25	.	.	PUNCT
ahs-18399	136	1	4	4	NUM
ahs-18399	136	2	rt	rt	ADJ
ahs-18399	136	3	-	-	PUNCT
ahs-18399	136	4	pcr	pcr	NOUN
ahs-18399	136	5	analysis	analysis	NOUN
ahs-18399	136	6	of	of	ADP
ahs-18399	136	7	uv	uv	NOUN
ahs-18399	136	8	-	-	PUNCT
ahs-18399	136	9	responsive	responsive	ADJ
ahs-18399	136	10	gene	gene	NOUN
ahs-18399	136	11	expressions	expression	NOUN
ahs-18399	136	12	in	in	ADP
ahs-18399	136	13	cell	cell	NOUN
ahs-18399	136	14	suspension	suspension	NOUN
ahs-18399	136	15	and	and	CCONJ
ahs-18399	136	16	green	green	ADJ
ahs-18399	136	17	leaves	leave	NOUN
ahs-18399	136	18	.	.	PUNCT
ahs-18399	137	1	typical	typical	ADJ
ahs-18399	137	2	rt	rt	ADJ
ahs-18399	137	3	-	-	PUNCT
ahs-18399	137	4	pcr	pcr	ADJ
ahs-18399	137	5	profiles	profile	NOUN
ahs-18399	137	6	of	of	ADP
ahs-18399	137	7	gene	gene	NOUN
ahs-18399	137	8	expressions	expression	NOUN
ahs-18399	137	9	in	in	ADP
ahs-18399	137	10	uv	uv	NOUN
ahs-18399	137	11	-	-	PUNCT
ahs-18399	137	12	irradiated	irradiate	VERB
ahs-18399	137	13	cell	cell	NOUN
ahs-18399	137	14	suspension	suspension	NOUN
ahs-18399	137	15	(	(	PUNCT
ahs-18399	137	16	a	a	NOUN
ahs-18399	137	17	)	)	PUNCT
ahs-18399	137	18	and	and	CCONJ
ahs-18399	137	19	leaf	leaf	NOUN
ahs-18399	137	20	samples	sample	NOUN
ahs-18399	137	21	(	(	PUNCT
ahs-18399	137	22	b	b	X
ahs-18399	137	23	)	)	PUNCT
ahs-18399	137	24	are	be	AUX
ahs-18399	137	25	shown	show	VERB
ahs-18399	137	26	.	.	PUNCT
ahs-18399	138	1	actin	actin	PROPN
ahs-18399	138	2	was	be	AUX
ahs-18399	138	3	used	use	VERB
ahs-18399	138	4	as	as	ADP
ahs-18399	138	5	an	an	DET
ahs-18399	138	6	internal	internal	ADJ
ahs-18399	138	7	control	control	NOUN
ahs-18399	138	8	.	.	PUNCT
ahs-18399	139	1	note	note	NOUN
ahs-18399	139	2	:	:	PUNCT
ahs-18399	139	3	comparison	comparison	NOUN
ahs-18399	139	4	of	of	ADP
ahs-18399	139	5	the	the	DET
ahs-18399	139	6	density	density	NOUN
ahs-18399	139	7	of	of	ADP
ahs-18399	139	8	bands	band	NOUN
ahs-18399	139	9	on	on	ADP
ahs-18399	139	10	several	several	ADJ
ahs-18399	139	11	gels	gel	NOUN
ahs-18399	139	12	were	be	AUX
ahs-18399	139	13	performed	perform	VERB
ahs-18399	139	14	after	after	ADP
ahs-18399	139	15	gathering	gather	VERB
ahs-18399	139	16	the	the	DET
ahs-18399	139	17	images	image	NOUN
ahs-18399	139	18	of	of	ADP
ahs-18399	139	19	gels	gel	NOUN
ahs-18399	139	20	on	on	ADP
ahs-18399	139	21	the	the	DET
ahs-18399	139	22	black	black	ADJ
ahs-18399	139	23	background	background	NOUN
ahs-18399	139	24	.	.	PUNCT
ahs-18399	140	1	fig	fig	NOUN
ahs-18399	140	2	.	.	PUNCT
ahs-18399	141	1	5	5	NUM
ahs-18399	141	2	rt	rt	ADJ
ahs-18399	141	3	-	-	PUNCT
ahs-18399	141	4	pcr	pcr	NOUN
ahs-18399	141	5	analysis	analysis	NOUN
ahs-18399	141	6	of	of	ADP
ahs-18399	141	7	uv	uv	NOUN
ahs-18399	141	8	-	-	PUNCT
ahs-18399	141	9	responsive	responsive	ADJ
ahs-18399	141	10	gene	gene	NOUN
ahs-18399	141	11	expressions	expression	NOUN
ahs-18399	141	12	in	in	ADP
ahs-18399	141	13	green	green	ADJ
ahs-18399	141	14	fruits	fruit	NOUN
ahs-18399	141	15	and	and	CCONJ
ahs-18399	141	16	red	red	ADJ
ahs-18399	141	17	ripe	ripe	ADJ
ahs-18399	141	18	fruits	fruit	NOUN
ahs-18399	141	19	.	.	PUNCT
ahs-18399	142	1	typical	typical	ADJ
ahs-18399	142	2	rt	rt	ADJ
ahs-18399	142	3	-	-	PUNCT
ahs-18399	142	4	pcr	pcr	ADJ
ahs-18399	142	5	profiles	profile	NOUN
ahs-18399	142	6	of	of	ADP
ahs-18399	142	7	gene	gene	NOUN
ahs-18399	142	8	expressions	expression	NOUN
ahs-18399	142	9	in	in	ADP
ahs-18399	142	10	uv	uv	NOUN
ahs-18399	142	11	-	-	PUNCT
ahs-18399	142	12	irradiated	irradiate	VERB
ahs-18399	142	13	green	green	ADJ
ahs-18399	142	14	fruits	fruit	NOUN
ahs-18399	142	15	(	(	PUNCT
ahs-18399	142	16	a	a	NOUN
ahs-18399	142	17	)	)	PUNCT
ahs-18399	142	18	and	and	CCONJ
ahs-18399	142	19	red	red	ADJ
ahs-18399	142	20	ripe	ripe	ADJ
ahs-18399	142	21	fruits	fruit	NOUN
ahs-18399	142	22	(	(	PUNCT
ahs-18399	142	23	b	b	NOUN
ahs-18399	142	24	)	)	PUNCT
ahs-18399	142	25	are	be	AUX
ahs-18399	142	26	shown	show	VERB
ahs-18399	142	27	.	.	PUNCT
ahs-18399	143	1	actin	actin	PROPN
ahs-18399	143	2	was	be	AUX
ahs-18399	143	3	used	use	VERB
ahs-18399	143	4	as	as	ADP
ahs-18399	143	5	an	an	DET
ahs-18399	143	6	internal	internal	ADJ
ahs-18399	143	7	control	control	NOUN
ahs-18399	143	8	.	.	PUNCT
ahs-18399	144	1	note	note	NOUN
ahs-18399	144	2	:	:	PUNCT
ahs-18399	144	3	comparison	comparison	NOUN
ahs-18399	144	4	of	of	ADP
ahs-18399	144	5	the	the	DET
ahs-18399	144	6	density	density	NOUN
ahs-18399	144	7	of	of	ADP
ahs-18399	144	8	bands	band	NOUN
ahs-18399	144	9	on	on	ADP
ahs-18399	144	10	several	several	ADJ
ahs-18399	144	11	gels	gel	NOUN
ahs-18399	144	12	were	be	AUX
ahs-18399	144	13	performed	perform	VERB
ahs-18399	144	14	after	after	ADP
ahs-18399	144	15	gathering	gather	VERB
ahs-18399	144	16	the	the	DET
ahs-18399	144	17	images	image	NOUN
ahs-18399	144	18	of	of	ADP
ahs-18399	144	19	gels	gel	NOUN
ahs-18399	144	20	on	on	ADP
ahs-18399	144	21	the	the	DET
ahs-18399	144	22	black	black	ADJ
ahs-18399	144	23	background	background	NOUN
ahs-18399	144	24	.	.	PUNCT
ahs-18399	145	1	138	138	NUM
ahs-18399	145	2	the	the	DET
ahs-18399	145	3	plants	plant	NOUN
ahs-18399	145	4	from	from	ADP
ahs-18399	145	5	the	the	DET
ahs-18399	145	6	damaging	damaging	ADJ
ahs-18399	145	7	impacts	impact	NOUN
ahs-18399	145	8	of	of	ADP
ahs-18399	145	9	ros	ros	PROPN
ahs-18399	145	10	.	.	PUNCT
ahs-18399	146	1	pr	pr	NOUN
ahs-18399	146	2	genes	gene	NOUN
ahs-18399	146	3	(	(	PUNCT
ahs-18399	146	4	viz	viz	PROPN
ahs-18399	146	5	.	.	PROPN
ahs-18399	146	6	,	,	PUNCT
ahs-18399	146	7	pr	pr	NOUN
ahs-18399	146	8	-	-	PUNCT
ahs-18399	146	9	p2	p2	NOUN
ahs-18399	146	10	and	and	CCONJ
ahs-18399	146	11	pr1	pr1	NOUN
ahs-18399	146	12	)	)	PUNCT
ahs-18399	146	13	and	and	CCONJ
ahs-18399	146	14	pal	pal	NOUN
ahs-18399	146	15	are	be	AUX
ahs-18399	146	16	related	relate	VERB
ahs-18399	146	17	to	to	ADP
ahs-18399	146	18	the	the	DET
ahs-18399	146	19	actions	action	NOUN
ahs-18399	146	20	and	and	CCONJ
ahs-18399	146	21	production	production	NOUN
ahs-18399	146	22	of	of	ADP
ahs-18399	146	23	salicylic	salicylic	ADJ
ahs-18399	146	24	acid	acid	NOUN
ahs-18399	146	25	(	(	PUNCT
ahs-18399	146	26	sa	sa	PROPN
ahs-18399	146	27	)	)	PUNCT
ahs-18399	146	28	.	.	PUNCT
ahs-18399	147	1	sa	sa	PROPN
ahs-18399	147	2	is	be	AUX
ahs-18399	147	3	a	a	DET
ahs-18399	147	4	hormonelike	hormonelike	ADJ
ahs-18399	147	5	natural	natural	ADJ
ahs-18399	147	6	signaling	signal	VERB
ahs-18399	147	7	molecule	molecule	NOUN
ahs-18399	147	8	involved	involve	VERB
ahs-18399	147	9	in	in	ADP
ahs-18399	147	10	the	the	DET
ahs-18399	147	11	defense	defense	NOUN
ahs-18399	147	12	response	response	NOUN
ahs-18399	147	13	against	against	ADP
ahs-18399	147	14	infection	infection	NOUN
ahs-18399	147	15	by	by	ADP
ahs-18399	147	16	pathogens	pathogen	NOUN
ahs-18399	147	17	in	in	ADP
ahs-18399	147	18	higher	high	ADJ
ahs-18399	147	19	plants	plant	NOUN
ahs-18399	147	20	.	.	PUNCT
ahs-18399	148	1	sa	sa	NOUN
ahs-18399	148	2	acts	act	VERB
ahs-18399	148	3	by	by	ADP
ahs-18399	148	4	stimulating	stimulate	VERB
ahs-18399	148	5	the	the	DET
ahs-18399	148	6	production	production	NOUN
ahs-18399	148	7	of	of	ADP
ahs-18399	148	8	pr	pr	NOUN
ahs-18399	148	9	proteins	protein	NOUN
ahs-18399	148	10	through	through	ADP
ahs-18399	148	11	a	a	DET
ahs-18399	148	12	complex	complex	ADJ
ahs-18399	148	13	signaling	signaling	ADJ
ahs-18399	148	14	mechanism	mechanism	NOUN
ahs-18399	148	15	involving	involve	VERB
ahs-18399	148	16	ros	ros	PROPN
ahs-18399	148	17	,	,	PUNCT
ahs-18399	148	18	calcium	calcium	NOUN
ahs-18399	148	19	and	and	CCONJ
ahs-18399	148	20	protein	protein	NOUN
ahs-18399	148	21	phosphorylation	phosphorylation	NOUN
ahs-18399	148	22	in	in	ADP
ahs-18399	148	23	the	the	DET
ahs-18399	148	24	early	early	ADJ
ahs-18399	148	25	stages	stage	NOUN
ahs-18399	148	26	(	(	PUNCT
ahs-18399	148	27	kawano	kawano	PROPN
ahs-18399	148	28	et	et	PROPN
ahs-18399	148	29	al	al	PROPN
ahs-18399	148	30	.	.	PROPN
ahs-18399	148	31	,	,	PUNCT
ahs-18399	148	32	1998	1998	NUM
ahs-18399	148	33	;	;	PUNCT
ahs-18399	148	34	kawano	kawano	PROPN
ahs-18399	148	35	and	and	CCONJ
ahs-18399	148	36	bouteau	bouteau	PROPN
ahs-18399	148	37	,	,	PUNCT
ahs-18399	148	38	2013	2013	NUM
ahs-18399	148	39	)	)	PUNCT
ahs-18399	148	40	.	.	PUNCT
ahs-18399	149	1	in	in	ADP
ahs-18399	149	2	solanaceae	solanaceae	ADJ
ahs-18399	149	3	plants	plant	NOUN
ahs-18399	149	4	including	include	VERB
ahs-18399	149	5	tobacco	tobacco	NOUN
ahs-18399	149	6	and	and	CCONJ
ahs-18399	149	7	tomato	tomato	NOUN
ahs-18399	149	8	,	,	PUNCT
ahs-18399	149	9	the	the	DET
ahs-18399	149	10	increase	increase	NOUN
ahs-18399	149	11	in	in	ADP
ahs-18399	149	12	pal	pal	ADJ
ahs-18399	149	13	expression	expression	NOUN
ahs-18399	149	14	reportedly	reportedly	ADV
ahs-18399	149	15	results	result	VERB
ahs-18399	149	16	in	in	ADP
ahs-18399	149	17	accumulation	accumulation	NOUN
ahs-18399	149	18	of	of	ADP
ahs-18399	149	19	sa	sa	PROPN
ahs-18399	149	20	(	(	PUNCT
ahs-18399	149	21	kawano	kawano	PROPN
ahs-18399	149	22	et	et	PROPN
ahs-18399	149	23	al	al	PROPN
ahs-18399	149	24	.	.	PROPN
ahs-18399	149	25	,	,	PUNCT
ahs-18399	149	26	2004	2004	NUM
ahs-18399	149	27	)	)	PUNCT
ahs-18399	149	28	.	.	PUNCT
ahs-18399	150	1	here	here	ADV
ahs-18399	150	2	,	,	PUNCT
ahs-18399	150	3	the	the	DET
ahs-18399	150	4	short	short	ADJ
ahs-18399	150	5	exposure	exposure	NOUN
ahs-18399	150	6	to	to	ADP
ahs-18399	150	7	uv	uv	NOUN
ahs-18399	150	8	-	-	PUNCT
ahs-18399	150	9	c	c	NOUN
ahs-18399	150	10	but	but	CCONJ
ahs-18399	150	11	not	not	PART
ahs-18399	150	12	to	to	PART
ahs-18399	150	13	uv	uv	VERB
ahs-18399	150	14	-	-	PUNCT
ahs-18399	150	15	a	a	PRON
ahs-18399	150	16	resulted	result	VERB
ahs-18399	150	17	in	in	ADP
ahs-18399	150	18	an	an	DET
ahs-18399	150	19	acute	acute	ADJ
ahs-18399	150	20	increase	increase	NOUN
ahs-18399	150	21	in	in	ADP
ahs-18399	150	22	cell	cell	NOUN
ahs-18399	150	23	death	death	NOUN
ahs-18399	150	24	in	in	ADP
ahs-18399	150	25	the	the	DET
ahs-18399	150	26	cell	cell	NOUN
ahs-18399	150	27	suspension	suspension	NOUN
ahs-18399	150	28	culture	culture	NOUN
ahs-18399	150	29	(	(	PUNCT
ahs-18399	150	30	fig	fig	NOUN
ahs-18399	150	31	.	.	PUNCT
ahs-18399	151	1	3	3	NUM
ahs-18399	151	2	)	)	PUNCT
ahs-18399	151	3	.	.	PUNCT
ahs-18399	152	1	development	development	NOUN
ahs-18399	152	2	of	of	ADP
ahs-18399	152	3	lesions	lesion	NOUN
ahs-18399	152	4	(	(	PUNCT
ahs-18399	152	5	visible	visible	ADJ
ahs-18399	152	6	symptoms	symptom	NOUN
ahs-18399	152	7	)	)	PUNCT
ahs-18399	152	8	,	,	PUNCT
ahs-18399	152	9	(	(	PUNCT
ahs-18399	152	10	fig	fig	NOUN
ahs-18399	152	11	.	.	NOUN
ahs-18399	152	12	1	1	NUM
ahs-18399	152	13	)	)	PUNCT
ahs-18399	152	14	accompanied	accompany	VERB
ahs-18399	152	15	by	by	ADP
ahs-18399	152	16	ion	ion	NOUN
ahs-18399	152	17	leakage	leakage	NOUN
ahs-18399	152	18	(	(	PUNCT
ahs-18399	152	19	sign	sign	NOUN
ahs-18399	152	20	of	of	ADP
ahs-18399	152	21	membrane	membrane	NOUN
ahs-18399	152	22	damage	damage	NOUN
ahs-18399	152	23	)	)	PUNCT
ahs-18399	152	24	(	(	PUNCT
ahs-18399	152	25	fig	fig	NOUN
ahs-18399	152	26	.	.	NOUN
ahs-18399	152	27	2	2	NUM
ahs-18399	152	28	)	)	PUNCT
ahs-18399	152	29	was	be	AUX
ahs-18399	152	30	induced	induce	VERB
ahs-18399	152	31	in	in	ADP
ahs-18399	152	32	the	the	DET
ahs-18399	152	33	uv	uv	NOUN
ahs-18399	152	34	-	-	PUNCT
ahs-18399	152	35	c	c	NOUN
ahs-18399	152	36	-	-	PUNCT
ahs-18399	152	37	treated	treat	VERB
ahs-18399	152	38	leaf	leaf	NOUN
ahs-18399	152	39	samples	sample	NOUN
ahs-18399	152	40	.	.	PUNCT
ahs-18399	153	1	in	in	ADP
ahs-18399	153	2	contrast	contrast	NOUN
ahs-18399	153	3	,	,	PUNCT
ahs-18399	153	4	no	no	DET
ahs-18399	153	5	visible	visible	ADJ
ahs-18399	153	6	damage	damage	NOUN
ahs-18399	153	7	was	be	AUX
ahs-18399	153	8	observed	observe	VERB
ahs-18399	153	9	in	in	ADP
ahs-18399	153	10	the	the	DET
ahs-18399	153	11	uvtreated	uvtreate	VERB
ahs-18399	153	12	green	green	ADJ
ahs-18399	153	13	and	and	CCONJ
ahs-18399	153	14	red	red	ADJ
ahs-18399	153	15	fruits	fruit	NOUN
ahs-18399	153	16	.	.	PUNCT
ahs-18399	154	1	it	it	PRON
ahs-18399	154	2	is	be	AUX
ahs-18399	154	3	noteworthy	noteworthy	ADJ
ahs-18399	154	4	that	that	SCONJ
ahs-18399	154	5	uv	uv	NOUN
ahs-18399	154	6	-	-	PUNCT
ahs-18399	154	7	a	a	NOUN
ahs-18399	154	8	or	or	CCONJ
ahs-18399	154	9	sub	sub	ADJ
ahs-18399	154	10	-	-	ADJ
ahs-18399	154	11	lethal	lethal	ADJ
ahs-18399	154	12	low	low	ADJ
ahs-18399	154	13	dose	dose	NOUN
ahs-18399	154	14	uv	uv	PROPN
ahs-18399	154	15	-	-	PUNCT
ahs-18399	154	16	c	c	PROPN
ahs-18399	154	17	was	be	AUX
ahs-18399	154	18	shown	show	VERB
ahs-18399	154	19	to	to	PART
ahs-18399	154	20	induce	induce	VERB
ahs-18399	154	21	the	the	DET
ahs-18399	154	22	defenserelated	defenserelate	VERB
ahs-18399	154	23	genes	gene	NOUN
ahs-18399	154	24	(	(	PUNCT
ahs-18399	154	25	pr1	pr1	NOUN
ahs-18399	154	26	and	and	CCONJ
ahs-18399	154	27	pr	pr	NOUN
ahs-18399	154	28	-	-	PUNCT
ahs-18399	154	29	p2	p2	NOUN
ahs-18399	154	30	genes	gene	NOUN
ahs-18399	154	31	)	)	PUNCT
ahs-18399	154	32	in	in	ADP
ahs-18399	154	33	the	the	DET
ahs-18399	154	34	leaves	leave	NOUN
ahs-18399	154	35	(	(	PUNCT
ahs-18399	154	36	fig	fig	NOUN
ahs-18399	154	37	.	.	PUNCT
ahs-18399	155	1	4	4	NUM
ahs-18399	155	2	b	b	NOUN
ahs-18399	155	3	)	)	PUNCT
ahs-18399	155	4	and	and	CCONJ
ahs-18399	155	5	green	green	ADJ
ahs-18399	155	6	fruit	fruit	NOUN
ahs-18399	155	7	tissues	tissue	NOUN
ahs-18399	155	8	(	(	PUNCT
ahs-18399	155	9	fig	fig	NOUN
ahs-18399	155	10	.	.	PUNCT
ahs-18399	156	1	5	5	NUM
ahs-18399	156	2	a	a	PRON
ahs-18399	156	3	)	)	PUNCT
ahs-18399	156	4	.	.	PUNCT
ahs-18399	157	1	the	the	DET
ahs-18399	157	2	above	above	ADJ
ahs-18399	157	3	data	datum	NOUN
ahs-18399	157	4	imply	imply	VERB
ahs-18399	157	5	that	that	SCONJ
ahs-18399	157	6	cell	cell	NOUN
ahs-18399	157	7	death	death	NOUN
ahs-18399	157	8	(	(	PUNCT
ahs-18399	157	9	possibly	possibly	ADV
ahs-18399	157	10	apoptotic	apoptotic	ADJ
ahs-18399	157	11	,	,	PUNCT
ahs-18399	157	12	data	datum	NOUN
ahs-18399	157	13	not	not	PART
ahs-18399	157	14	shown	show	VERB
ahs-18399	157	15	)	)	PUNCT
ahs-18399	157	16	and	and	CCONJ
ahs-18399	157	17	plant	plant	NOUN
ahs-18399	157	18	protection	protection	NOUN
ahs-18399	157	19	mechanisms	mechanism	NOUN
ahs-18399	157	20	(	(	PUNCT
ahs-18399	157	21	expression	expression	NOUN
ahs-18399	157	22	of	of	ADP
ahs-18399	157	23	antioxidant	antioxidant	ADJ
ahs-18399	157	24	genes	gene	NOUN
ahs-18399	157	25	and	and	CCONJ
ahs-18399	157	26	pr	pr	NOUN
ahs-18399	157	27	genes	gene	NOUN
ahs-18399	157	28	)	)	PUNCT
ahs-18399	157	29	are	be	AUX
ahs-18399	157	30	induced	induce	VERB
ahs-18399	157	31	by	by	ADP
ahs-18399	157	32	high	high	ADJ
ahs-18399	157	33	and	and	CCONJ
ahs-18399	157	34	low	low	ADJ
ahs-18399	157	35	doses	dose	NOUN
ahs-18399	157	36	of	of	ADP
ahs-18399	157	37	uv	uv	NOUN
ahs-18399	157	38	-	-	PUNCT
ahs-18399	157	39	c	c	NOUN
ahs-18399	157	40	,	,	PUNCT
ahs-18399	157	41	respectively	respectively	ADV
ahs-18399	157	42	.	.	PUNCT
ahs-18399	158	1	therefore	therefore	ADV
ahs-18399	158	2	,	,	PUNCT
ahs-18399	158	3	moderate	moderate	ADJ
ahs-18399	158	4	doses	dose	NOUN
ahs-18399	158	5	of	of	ADP
ahs-18399	158	6	uv	uv	NOUN
ahs-18399	158	7	irradiation	irradiation	NOUN
ahs-18399	158	8	should	should	AUX
ahs-18399	158	9	be	be	AUX
ahs-18399	158	10	applicable	applicable	ADJ
ahs-18399	158	11	to	to	ADP
ahs-18399	158	12	plants	plant	NOUN
ahs-18399	158	13	to	to	PART
ahs-18399	158	14	confer	confer	VERB
ahs-18399	158	15	tolerance	tolerance	NOUN
ahs-18399	158	16	to	to	ADP
ahs-18399	158	17	a	a	DET
ahs-18399	158	18	variety	variety	NOUN
ahs-18399	158	19	of	of	ADP
ahs-18399	158	20	abiotic	abiotic	ADJ
ahs-18399	158	21	stresses	stress	NOUN
ahs-18399	158	22	(	(	PUNCT
ahs-18399	158	23	chiefly	chiefly	ADV
ahs-18399	158	24	,	,	PUNCT
ahs-18399	158	25	oxidative	oxidative	ADJ
ahs-18399	158	26	stress	stress	NOUN
ahs-18399	158	27	)	)	PUNCT
ahs-18399	158	28	and	and	CCONJ
ahs-18399	158	29	innate	innate	ADJ
ahs-18399	158	30	plant	plant	NOUN
ahs-18399	158	31	immunity	immunity	NOUN
ahs-18399	158	32	(	(	PUNCT
ahs-18399	158	33	represented	represent	VERB
ahs-18399	158	34	by	by	ADP
ahs-18399	158	35	the	the	DET
ahs-18399	158	36	induced	induced	ADJ
ahs-18399	158	37	expression	expression	NOUN
ahs-18399	158	38	of	of	ADP
ahs-18399	158	39	pr	pr	NOUN
ahs-18399	158	40	genes	gene	NOUN
ahs-18399	158	41	)	)	PUNCT
ahs-18399	158	42	.	.	PUNCT
ahs-18399	159	1	possible	possible	ADJ
ahs-18399	159	2	involvement	involvement	NOUN
ahs-18399	159	3	of	of	ADP
ahs-18399	159	4	sa	sa	NOUN
ahs-18399	159	5	signaling	signal	VERB
ahs-18399	159	6	our	our	PRON
ahs-18399	159	7	data	datum	NOUN
ahs-18399	159	8	are	be	AUX
ahs-18399	159	9	comparable	comparable	ADJ
ahs-18399	159	10	to	to	ADP
ahs-18399	159	11	the	the	DET
ahs-18399	159	12	work	work	NOUN
ahs-18399	159	13	of	of	ADP
ahs-18399	159	14	marco	marco	PROPN
ahs-18399	159	15	et	et	PROPN
ahs-18399	159	16	al	al	PROPN
ahs-18399	159	17	.	.	PROPN
ahs-18399	160	1	(	(	PUNCT
ahs-18399	160	2	2008	2008	NUM
ahs-18399	160	3	)	)	PUNCT
ahs-18399	160	4	who	who	PRON
ahs-18399	160	5	reported	report	VERB
ahs-18399	160	6	the	the	DET
ahs-18399	160	7	ozone	ozone	NOUN
ahs-18399	160	8	-	-	PUNCT
ahs-18399	160	9	induced	induce	VERB
ahs-18399	160	10	gene	gene	NOUN
ahs-18399	160	11	expression	expression	NOUN
ahs-18399	160	12	controls	control	NOUN
ahs-18399	160	13	in	in	ADP
ahs-18399	160	14	the	the	DET
ahs-18399	160	15	leaves	leave	NOUN
ahs-18399	160	16	of	of	ADP
ahs-18399	160	17	three	three	NUM
ahs-18399	160	18	tomato	tomato	NOUN
ahs-18399	160	19	cultivars	cultivar	NOUN
ahs-18399	160	20	(	(	PUNCT
ahs-18399	160	21	viz	viz	PROPN
ahs-18399	160	22	.	.	PROPN
ahs-18399	160	23	,	,	PUNCT
ahs-18399	160	24	nikita	nikita	PROPN
ahs-18399	160	25	,	,	PUNCT
ahs-18399	160	26	alisa	alisa	PROPN
ahs-18399	160	27	craig	craig	PROPN
ahs-18399	160	28	and	and	CCONJ
ahs-18399	160	29	valenciano	valenciano	PROPN
ahs-18399	160	30	)	)	PUNCT
ahs-18399	160	31	.	.	PUNCT
ahs-18399	161	1	similar	similar	ADJ
ahs-18399	161	2	to	to	ADP
ahs-18399	161	3	our	our	PRON
ahs-18399	161	4	data	datum	NOUN
ahs-18399	161	5	on	on	ADP
ahs-18399	161	6	uv	uv	NOUN
ahs-18399	161	7	-	-	PUNCT
ahs-18399	161	8	treated	treat	VERB
ahs-18399	161	9	micro	micro	NOUN
ahs-18399	161	10	-	-	NOUN
ahs-18399	161	11	tom	tom	PROPN
ahs-18399	161	12	,	,	PUNCT
ahs-18399	161	13	expression	expression	NOUN
ahs-18399	161	14	of	of	ADP
ahs-18399	161	15	apx	apx	PROPN
ahs-18399	161	16	is	be	AUX
ahs-18399	161	17	reportedly	reportedly	ADV
ahs-18399	161	18	suppressed	suppress	VERB
ahs-18399	161	19	in	in	ADP
ahs-18399	161	20	the	the	DET
ahs-18399	161	21	ozone	ozone	NOUN
ahs-18399	161	22	-	-	PUNCT
ahs-18399	161	23	treated	treat	VERB
ahs-18399	161	24	nikita	nikita	NOUN
ahs-18399	161	25	tomato	tomato	NOUN
ahs-18399	161	26	(	(	PUNCT
ahs-18399	161	27	marco	marco	PROPN
ahs-18399	161	28	et	et	PROPN
ahs-18399	161	29	al	al	PROPN
ahs-18399	161	30	.	.	PROPN
ahs-18399	161	31	,	,	PUNCT
ahs-18399	161	32	2008	2008	NUM
ahs-18399	161	33	)	)	PUNCT
ahs-18399	161	34	.	.	PUNCT
ahs-18399	162	1	in	in	ADP
ahs-18399	162	2	addition	addition	NOUN
ahs-18399	162	3	,	,	PUNCT
ahs-18399	162	4	the	the	DET
ahs-18399	162	5	tomato	tomato	NOUN
ahs-18399	162	6	leaves	leave	VERB
ahs-18399	162	7	chronically	chronically	ADV
ahs-18399	162	8	exposed	expose	VERB
ahs-18399	162	9	to	to	ADP
ahs-18399	162	10	ozone	ozone	NOUN
ahs-18399	162	11	showed	show	VERB
ahs-18399	162	12	activation	activation	NOUN
ahs-18399	162	13	of	of	ADP
ahs-18399	162	14	redox	redox	NOUN
ahs-18399	162	15	-	-	PUNCT
ahs-18399	162	16	related	relate	VERB
ahs-18399	162	17	and	and	CCONJ
ahs-18399	162	18	defense	defense	NOUN
ahs-18399	162	19	-	-	PUNCT
ahs-18399	162	20	related	relate	VERB
ahs-18399	162	21	genes	gene	NOUN
ahs-18399	162	22	such	such	ADJ
ahs-18399	162	23	as	as	ADP
ahs-18399	162	24	pal	pal	NOUN
ahs-18399	162	25	(	(	PUNCT
ahs-18399	162	26	marco	marco	PROPN
ahs-18399	162	27	et	et	PROPN
ahs-18399	162	28	al	al	PROPN
ahs-18399	162	29	.	.	PROPN
ahs-18399	162	30	,	,	PUNCT
ahs-18399	162	31	2008	2008	NUM
ahs-18399	162	32	)	)	PUNCT
ahs-18399	162	33	.	.	PUNCT
ahs-18399	163	1	thus	thus	ADV
ahs-18399	163	2	,	,	PUNCT
ahs-18399	163	3	ozone	ozone	NOUN
ahs-18399	163	4	-	-	PUNCT
ahs-18399	163	5	induced	induce	VERB
ahs-18399	163	6	gene	gene	NOUN
ahs-18399	163	7	expression	expression	NOUN
ahs-18399	163	8	patterns	pattern	NOUN
ahs-18399	163	9	and	and	CCONJ
ahs-18399	163	10	the	the	DET
ahs-18399	163	11	uv	uv	NOUN
ahs-18399	163	12	-	-	PUNCT
ahs-18399	163	13	induced	induce	VERB
ahs-18399	163	14	gene	gene	NOUN
ahs-18399	163	15	expression	expression	NOUN
ahs-18399	163	16	patterns	pattern	NOUN
ahs-18399	163	17	may	may	AUX
ahs-18399	163	18	share	share	VERB
ahs-18399	163	19	a	a	DET
ahs-18399	163	20	common	common	ADJ
ahs-18399	163	21	regulatory	regulatory	ADJ
ahs-18399	163	22	mechanism	mechanism	NOUN
ahs-18399	163	23	.	.	PUNCT
ahs-18399	164	1	one	one	NUM
ahs-18399	164	2	of	of	ADP
ahs-18399	164	3	the	the	DET
ahs-18399	164	4	key	key	ADJ
ahs-18399	164	5	pathways	pathway	NOUN
ahs-18399	164	6	that	that	PRON
ahs-18399	164	7	may	may	AUX
ahs-18399	164	8	be	be	AUX
ahs-18399	164	9	common	common	ADJ
ahs-18399	164	10	to	to	ADP
ahs-18399	164	11	ozone	ozone	NOUN
ahs-18399	164	12	response	response	NOUN
ahs-18399	164	13	and	and	CCONJ
ahs-18399	164	14	uv	uv	NOUN
ahs-18399	164	15	response	response	NOUN
ahs-18399	164	16	in	in	ADP
ahs-18399	164	17	tomato	tomato	NOUN
ahs-18399	164	18	is	be	AUX
ahs-18399	164	19	the	the	DET
ahs-18399	164	20	sa	sa	NOUN
ahs-18399	164	21	signaling	signal	VERB
ahs-18399	164	22	pathway	pathway	NOUN
ahs-18399	164	23	.	.	PUNCT
ahs-18399	165	1	expressions	expression	NOUN
ahs-18399	165	2	of	of	ADP
ahs-18399	165	3	pr	pr	NOUN
ahs-18399	165	4	genes	gene	NOUN
ahs-18399	165	5	and	and	CCONJ
ahs-18399	165	6	eds1	eds1	ADJ
ahs-18399	165	7	,	,	PUNCT
ahs-18399	165	8	known	know	VERB
ahs-18399	165	9	factors	factor	NOUN
ahs-18399	165	10	functioning	function	VERB
ahs-18399	165	11	upstream	upstream	NOUN
ahs-18399	165	12	of	of	ADP
ahs-18399	165	13	sa	sa	NOUN
ahs-18399	165	14	-	-	PUNCT
ahs-18399	165	15	dependent	dependent	ADJ
ahs-18399	165	16	expression	expression	NOUN
ahs-18399	165	17	of	of	ADP
ahs-18399	165	18	pr	pr	NOUN
ahs-18399	165	19	genes	gene	NOUN
ahs-18399	165	20	(	(	PUNCT
ahs-18399	165	21	falk	falk	NOUN
ahs-18399	165	22	et	et	NOUN
ahs-18399	165	23	al	al	PROPN
ahs-18399	165	24	.	.	PROPN
ahs-18399	165	25	,	,	PUNCT
ahs-18399	165	26	1999	1999	NUM
ahs-18399	165	27	)	)	PUNCT
ahs-18399	165	28	,	,	PUNCT
ahs-18399	165	29	were	be	AUX
ahs-18399	165	30	induced	induce	VERB
ahs-18399	165	31	by	by	ADP
ahs-18399	165	32	ozone	ozone	NOUN
ahs-18399	165	33	in	in	ADP
ahs-18399	165	34	three	three	NUM
ahs-18399	165	35	tomato	tomato	NOUN
ahs-18399	165	36	cultivars	cultivar	NOUN
ahs-18399	165	37	(	(	PUNCT
ahs-18399	165	38	marco	marco	PROPN
ahs-18399	165	39	et	et	PROPN
ahs-18399	165	40	al	al	PROPN
ahs-18399	165	41	.	.	PROPN
ahs-18399	165	42	,	,	PUNCT
ahs-18399	165	43	2008	2008	NUM
ahs-18399	165	44	)	)	PUNCT
ahs-18399	165	45	.	.	PUNCT
ahs-18399	166	1	in	in	ADP
ahs-18399	166	2	the	the	DET
ahs-18399	166	3	present	present	ADJ
ahs-18399	166	4	investigation	investigation	NOUN
ahs-18399	166	5	,	,	PUNCT
ahs-18399	166	6	activation	activation	NOUN
ahs-18399	166	7	of	of	ADP
ahs-18399	166	8	pal	pal	ADJ
ahs-18399	166	9	and	and	CCONJ
ahs-18399	166	10	pr	pr	NOUN
ahs-18399	166	11	genes	gene	NOUN
ahs-18399	166	12	in	in	ADP
ahs-18399	166	13	the	the	DET
ahs-18399	166	14	uvtreated	uvtreate	VERB
ahs-18399	166	15	micro	micro	NOUN
ahs-18399	166	16	-	-	NOUN
ahs-18399	166	17	tom	tom	PROPN
ahs-18399	166	18	leaves	leave	NOUN
ahs-18399	166	19	(	(	PUNCT
ahs-18399	166	20	fig	fig	NOUN
ahs-18399	166	21	.	.	PUNCT
ahs-18399	167	1	4b	4b	PROPN
ahs-18399	167	2	)	)	PUNCT
ahs-18399	167	3	was	be	AUX
ahs-18399	167	4	observed	observe	VERB
ahs-18399	167	5	,	,	PUNCT
ahs-18399	167	6	suggesting	suggest	VERB
ahs-18399	167	7	the	the	DET
ahs-18399	167	8	possible	possible	ADJ
ahs-18399	167	9	involvement	involvement	NOUN
ahs-18399	167	10	of	of	ADP
ahs-18399	167	11	a	a	DET
ahs-18399	167	12	sa	sa	NOUN
ahs-18399	167	13	signaling	signal	VERB
ahs-18399	167	14	path	path	NOUN
ahs-18399	167	15	.	.	PUNCT
ahs-18399	168	1	recently	recently	ADV
ahs-18399	168	2	,	,	PUNCT
ahs-18399	168	3	in	in	ADP
ahs-18399	168	4	the	the	DET
ahs-18399	168	5	culture	culture	NOUN
ahs-18399	168	6	of	of	ADP
ahs-18399	168	7	arabidopsis	arabidopsis	NOUN
ahs-18399	168	8	cells	cell	NOUN
ahs-18399	168	9	,	,	PUNCT
ahs-18399	168	10	we	we	PRON
ahs-18399	168	11	observed	observe	VERB
ahs-18399	168	12	that	that	SCONJ
ahs-18399	168	13	over	over	ADP
ahs-18399	168	14	-	-	PUNCT
ahs-18399	168	15	expression	expression	NOUN
ahs-18399	168	16	of	of	ADP
ahs-18399	168	17	bacterial	bacterial	ADJ
ahs-18399	168	18	salicylate	salicylate	NOUN
ahs-18399	168	19	hydroxylase	hydroxylase	NOUN
ahs-18399	168	20	gene	gene	NOUN
ahs-18399	168	21	(	(	PUNCT
ahs-18399	168	22	nahg	nahg	PROPN
ahs-18399	168	23	)	)	PUNCT
ahs-18399	168	24	and	and	CCONJ
ahs-18399	168	25	pharmacological	pharmacological	ADJ
ahs-18399	168	26	reagents	reagent	NOUN
ahs-18399	168	27	targeting	target	VERB
ahs-18399	168	28	either	either	CCONJ
ahs-18399	168	29	ros	ros	PROPN
ahs-18399	168	30	or	or	CCONJ
ahs-18399	168	31	calcium	calcium	NOUN
ahs-18399	168	32	signaling	signal	VERB
ahs-18399	168	33	effectively	effectively	ADV
ahs-18399	168	34	blocked	block	VERB
ahs-18399	168	35	both	both	CCONJ
ahs-18399	168	36	the	the	DET
ahs-18399	168	37	cell	cell	NOUN
ahs-18399	168	38	death	death	NOUN
ahs-18399	168	39	induction	induction	NOUN
ahs-18399	168	40	by	by	ADP
ahs-18399	168	41	high	high	ADJ
ahs-18399	168	42	-	-	PUNCT
ahs-18399	168	43	dose	dose	NOUN
ahs-18399	168	44	uv	uv	NOUN
ahs-18399	168	45	-	-	PUNCT
ahs-18399	168	46	c	c	NOUN
ahs-18399	168	47	and	and	CCONJ
ahs-18399	168	48	induction	induction	NOUN
ahs-18399	168	49	of	of	ADP
ahs-18399	168	50	defense	defense	NOUN
ahs-18399	168	51	-	-	PUNCT
ahs-18399	168	52	related	relate	VERB
ahs-18399	168	53	gene	gene	NOUN
ahs-18399	168	54	expressions	expression	NOUN
ahs-18399	168	55	by	by	ADP
ahs-18399	168	56	sub	sub	ADJ
ahs-18399	168	57	-	-	ADJ
ahs-18399	168	58	lethal	lethal	ADJ
ahs-18399	168	59	low	low	ADJ
ahs-18399	168	60	-	-	PUNCT
ahs-18399	168	61	dose	dose	NOUN
ahs-18399	168	62	uv	uv	NOUN
ahs-18399	168	63	-	-	PUNCT
ahs-18399	168	64	c	c	PROPN
ahs-18399	168	65	(	(	PUNCT
ahs-18399	168	66	hiramatsu	hiramatsu	NOUN
ahs-18399	168	67	et	et	PROPN
ahs-18399	168	68	al	al	PROPN
ahs-18399	168	69	.	.	PROPN
ahs-18399	168	70	,	,	PUNCT
ahs-18399	168	71	unpublished	unpublished	ADJ
ahs-18399	168	72	results	result	NOUN
ahs-18399	168	73	)	)	PUNCT
ahs-18399	168	74	.	.	PUNCT
ahs-18399	169	1	requirements	requirement	NOUN
ahs-18399	169	2	for	for	ADP
ahs-18399	169	3	early	early	ADJ
ahs-18399	169	4	calcium	calcium	NOUN
ahs-18399	169	5	signaling	signal	VERB
ahs-18399	169	6	,	,	PUNCT
ahs-18399	169	7	proven	prove	VERB
ahs-18399	169	8	by	by	ADP
ahs-18399	169	9	aequorin	aequorin	NOUN
ahs-18399	169	10	luminescence	luminescence	NOUN
ahs-18399	169	11	and	and	CCONJ
ahs-18399	169	12	the	the	DET
ahs-18399	169	13	action	action	NOUN
ahs-18399	169	14	of	of	ADP
ahs-18399	169	15	calcium	calcium	NOUN
ahs-18399	169	16	targeted	target	VERB
ahs-18399	169	17	pharmacological	pharmacological	ADJ
ahs-18399	169	18	reagents	reagent	NOUN
ahs-18399	169	19	,	,	PUNCT
ahs-18399	169	20	and	and	CCONJ
ahs-18399	169	21	generation	generation	NOUN
ahs-18399	169	22	of	of	ADP
ahs-18399	169	23	ros	ros	PROPN
ahs-18399	169	24	,	,	PUNCT
ahs-18399	169	25	are	be	AUX
ahs-18399	169	26	commonly	commonly	ADV
ahs-18399	169	27	observed	observe	VERB
ahs-18399	169	28	in	in	ADP
ahs-18399	169	29	various	various	ADJ
ahs-18399	169	30	plant	plant	NOUN
ahs-18399	169	31	models	model	NOUN
ahs-18399	169	32	during	during	ADP
ahs-18399	169	33	the	the	DET
ahs-18399	169	34	responses	response	NOUN
ahs-18399	169	35	to	to	ADP
ahs-18399	169	36	sa	sa	PROPN
ahs-18399	169	37	(	(	PUNCT
ahs-18399	169	38	kawano	kawano	PROPN
ahs-18399	169	39	et	et	PROPN
ahs-18399	169	40	al	al	PROPN
ahs-18399	169	41	.	.	PROPN
ahs-18399	169	42	,	,	PUNCT
ahs-18399	169	43	1998	1998	NUM
ahs-18399	169	44	;	;	PUNCT
ahs-18399	169	45	kawano	kawano	PROPN
ahs-18399	169	46	and	and	CCONJ
ahs-18399	169	47	muto	muto	PROPN
ahs-18399	169	48	,	,	PUNCT
ahs-18399	169	49	2000	2000	NUM
ahs-18399	169	50	;	;	PUNCT
ahs-18399	169	51	kawano	kawano	PROPN
ahs-18399	169	52	and	and	CCONJ
ahs-18399	169	53	bouteau	bouteau	PROPN
ahs-18399	169	54	,	,	PUNCT
ahs-18399	169	55	2013	2013	NUM
ahs-18399	169	56	)	)	PUNCT
ahs-18399	169	57	,	,	PUNCT
ahs-18399	169	58	pathogen	pathogen	NOUN
ahs-18399	169	59	-	-	PUNCT
ahs-18399	169	60	derived	derive	VERB
ahs-18399	169	61	molecules	molecule	NOUN
ahs-18399	169	62	(	(	PUNCT
ahs-18399	169	63	kadota	kadota	NOUN
ahs-18399	169	64	et	et	PROPN
ahs-18399	169	65	al	al	PROPN
ahs-18399	169	66	.	.	PROPN
ahs-18399	169	67	,	,	PUNCT
ahs-18399	169	68	2004	2004	NUM
ahs-18399	169	69	)	)	PUNCT
ahs-18399	169	70	,	,	PUNCT
ahs-18399	169	71	ozone	ozone	NOUN
ahs-18399	169	72	(	(	PUNCT
ahs-18399	169	73	kadono	kadono	PROPN
ahs-18399	169	74	et	et	PROPN
ahs-18399	169	75	al	al	PROPN
ahs-18399	169	76	.	.	PROPN
ahs-18399	169	77	,	,	PUNCT
ahs-18399	169	78	2006	2006	NUM
ahs-18399	169	79	,	,	PUNCT
ahs-18399	169	80	2010	2010	NUM
ahs-18399	169	81	;	;	PUNCT
ahs-18399	169	82	tran	tran	PROPN
ahs-18399	169	83	et	et	PROPN
ahs-18399	169	84	al	al	PROPN
ahs-18399	169	85	.	.	PROPN
ahs-18399	169	86	,	,	PUNCT
ahs-18399	169	87	2013	2013	NUM
ahs-18399	169	88	)	)	PUNCT
ahs-18399	169	89	,	,	PUNCT
ahs-18399	169	90	peroxyacetyl	peroxyacetyl	PROPN
ahs-18399	169	91	nitrate	nitrate	NOUN
ahs-18399	169	92	(	(	PUNCT
ahs-18399	169	93	yukihiro	yukihiro	PROPN
ahs-18399	169	94	et	et	PROPN
ahs-18399	169	95	al	al	PROPN
ahs-18399	169	96	.	.	PROPN
ahs-18399	169	97	,	,	PUNCT
ahs-18399	169	98	2012	2012	NUM
ahs-18399	169	99	)	)	PUNCT
ahs-18399	169	100	,	,	PUNCT
ahs-18399	169	101	toxic	toxic	ADJ
ahs-18399	169	102	metal	metal	NOUN
ahs-18399	169	103	ions	ion	NOUN
ahs-18399	169	104	(	(	PUNCT
ahs-18399	169	105	lin	lin	PROPN
ahs-18399	169	106	et	et	PROPN
ahs-18399	169	107	al	al	PROPN
ahs-18399	169	108	.	.	PROPN
ahs-18399	169	109	,	,	PUNCT
ahs-18399	169	110	2005	2005	NUM
ahs-18399	169	111	;	;	PUNCT
ahs-18399	169	112	kagenishi	kagenishi	PROPN
ahs-18399	169	113	et	et	PROPN
ahs-18399	169	114	al	al	PROPN
ahs-18399	169	115	.	.	PROPN
ahs-18399	169	116	,	,	PUNCT
ahs-18399	169	117	2011	2011	NUM
ahs-18399	169	118	;	;	PUNCT
ahs-18399	169	119	kunihiro	kunihiro	PROPN
ahs-18399	169	120	et	et	PROPN
ahs-18399	169	121	al	al	PROPN
ahs-18399	169	122	.	.	PROPN
ahs-18399	169	123	,	,	PUNCT
ahs-18399	169	124	2011	2011	NUM
ahs-18399	169	125	)	)	PUNCT
ahs-18399	169	126	,	,	PUNCT
ahs-18399	169	127	and	and	CCONJ
ahs-18399	169	128	uv	uv	NOUN
ahs-18399	169	129	(	(	PUNCT
ahs-18399	169	130	hiramatsu	hiramatsu	NOUN
ahs-18399	169	131	et	et	PROPN
ahs-18399	169	132	al	al	PROPN
ahs-18399	169	133	.	.	PROPN
ahs-18399	169	134	,	,	PUNCT
ahs-18399	169	135	unpublished	unpublished	ADJ
ahs-18399	169	136	results	result	NOUN
ahs-18399	169	137	)	)	PUNCT
ahs-18399	169	138	.	.	PUNCT
ahs-18399	170	1	possible	possible	ADJ
ahs-18399	170	2	regulation	regulation	NOUN
ahs-18399	170	3	of	of	ADP
ahs-18399	170	4	sa	sa	NOUN
ahs-18399	170	5	action	action	NOUN
ahs-18399	170	6	by	by	ADP
ahs-18399	170	7	uv	uv	NOUN
ahs-18399	170	8	-	-	PUNCT
ahs-18399	170	9	c	c	NOUN
ahs-18399	170	10	according	accord	VERB
ahs-18399	170	11	to	to	ADP
ahs-18399	170	12	the	the	DET
ahs-18399	170	13	work	work	NOUN
ahs-18399	170	14	by	by	ADP
ahs-18399	170	15	nawrath	nawrath	NOUN
ahs-18399	170	16	et	et	PROPN
ahs-18399	170	17	al	al	PROPN
ahs-18399	170	18	.	.	PROPN
ahs-18399	171	1	(	(	PUNCT
ahs-18399	171	2	2002	2002	NUM
ahs-18399	171	3	)	)	PUNCT
ahs-18399	171	4	using	use	VERB
ahs-18399	171	5	arabidopsis	arabidopsis	NOUN
ahs-18399	171	6	thaliana	thaliana	NOUN
ahs-18399	171	7	,	,	PUNCT
ahs-18399	171	8	expression	expression	NOUN
ahs-18399	171	9	of	of	ADP
ahs-18399	171	10	eds5	eds5	PROPN
ahs-18399	171	11	,	,	PUNCT
ahs-18399	171	12	a	a	DET
ahs-18399	171	13	member	member	NOUN
ahs-18399	171	14	of	of	ADP
ahs-18399	171	15	multidrug	multidrug	NOUN
ahs-18399	171	16	and	and	CCONJ
ahs-18399	171	17	toxin	toxin	NOUN
ahs-18399	171	18	extrusion	extrusion	NOUN
ahs-18399	171	19	transporter	transporter	NOUN
ahs-18399	171	20	family	family	NOUN
ahs-18399	171	21	,	,	PUNCT
ahs-18399	171	22	known	know	VERB
ahs-18399	171	23	to	to	PART
ahs-18399	171	24	be	be	AUX
ahs-18399	171	25	involved	involve	VERB
ahs-18399	171	26	in	in	ADP
ahs-18399	171	27	the	the	DET
ahs-18399	171	28	accumulation	accumulation	NOUN
ahs-18399	171	29	of	of	ADP
ahs-18399	171	30	sa	sa	PROPN
ahs-18399	171	31	and	and	CCONJ
ahs-18399	171	32	pr1	pr1	PROPN
ahs-18399	171	33	transcript	transcript	NOUN
ahs-18399	171	34	,	,	PUNCT
ahs-18399	171	35	is	be	AUX
ahs-18399	171	36	very	very	ADV
ahs-18399	171	37	low	low	ADJ
ahs-18399	171	38	in	in	ADP
ahs-18399	171	39	unstressed	unstressed	ADJ
ahs-18399	171	40	plants	plant	NOUN
ahs-18399	171	41	but	but	CCONJ
ahs-18399	171	42	strongly	strongly	ADV
ahs-18399	171	43	induced	induce	VERB
ahs-18399	171	44	by	by	ADP
ahs-18399	171	45	attacks	attack	NOUN
ahs-18399	171	46	by	by	ADP
ahs-18399	171	47	pathogens	pathogen	NOUN
ahs-18399	171	48	,	,	PUNCT
ahs-18399	171	49	treatment	treatment	NOUN
ahs-18399	171	50	with	with	ADP
ahs-18399	171	51	sa	sa	NOUN
ahs-18399	171	52	,	,	PUNCT
ahs-18399	171	53	and	and	CCONJ
ahs-18399	171	54	irradiation	irradiation	NOUN
ahs-18399	171	55	with	with	ADP
ahs-18399	171	56	uv	uv	NOUN
ahs-18399	171	57	-	-	PUNCT
ahs-18399	171	58	c.	c.	NOUN
ahs-18399	171	59	eds5	eds5	PROPN
ahs-18399	171	60	expression	expression	NOUN
ahs-18399	171	61	induced	induce	VERB
ahs-18399	171	62	by	by	ADP
ahs-18399	171	63	pathogen	pathogen	NOUN
ahs-18399	171	64	infection	infection	NOUN
ahs-18399	171	65	and	and	CCONJ
ahs-18399	171	66	uv	uv	NOUN
ahs-18399	171	67	-	-	PUNCT
ahs-18399	171	68	c	c	NOUN
ahs-18399	171	69	exposure	exposure	NOUN
ahs-18399	171	70	largely	largely	ADV
ahs-18399	171	71	depends	depend	VERB
ahs-18399	171	72	on	on	ADP
ahs-18399	171	73	the	the	DET
ahs-18399	171	74	pathogen	pathogen	NOUN
ahs-18399	171	75	response	response	NOUN
ahs-18399	171	76	proteins	protein	NOUN
ahs-18399	171	77	eds1	eds1	NOUN
ahs-18399	171	78	,	,	PUNCT
ahs-18399	171	79	pad4	pad4	NOUN
ahs-18399	171	80	,	,	PUNCT
ahs-18399	171	81	and	and	CCONJ
ahs-18399	171	82	ndr1	ndr1	PROPN
ahs-18399	171	83	,	,	PUNCT
ahs-18399	171	84	suggesting	suggest	VERB
ahs-18399	171	85	the	the	DET
ahs-18399	171	86	requirements	requirement	NOUN
ahs-18399	171	87	for	for	ADP
ahs-18399	171	88	the	the	DET
ahs-18399	171	89	signal	signal	ADJ
ahs-18399	171	90	transduction	transduction	NOUN
ahs-18399	171	91	pathways	pathway	NOUN
ahs-18399	171	92	commonly	commonly	ADV
ahs-18399	171	93	employed	employ	VERB
ahs-18399	171	94	in	in	ADP
ahs-18399	171	95	uv	uv	NOUN
ahs-18399	171	96	-	-	PUNCT
ahs-18399	171	97	c	c	NOUN
ahs-18399	171	98	responses	response	NOUN
ahs-18399	171	99	and	and	CCONJ
ahs-18399	171	100	defence	defence	NOUN
ahs-18399	171	101	responses	response	NOUN
ahs-18399	171	102	(	(	PUNCT
ahs-18399	171	103	nawrath	nawrath	NOUN
ahs-18399	171	104	et	et	PROPN
ahs-18399	171	105	al	al	PROPN
ahs-18399	171	106	.	.	PROPN
ahs-18399	171	107	,	,	PUNCT
ahs-18399	171	108	2002	2002	NUM
ahs-18399	171	109	)	)	PUNCT
ahs-18399	171	110	.	.	PUNCT
ahs-18399	172	1	this	this	DET
ahs-18399	172	2	defense	defense	NOUN
ahs-18399	172	3	mechanismdependently	mechanismdependently	ADV
ahs-18399	172	4	induced	induce	VERB
ahs-18399	172	5	eds5	eds5	PROPN
ahs-18399	172	6	transcript	transcript	NOUN
ahs-18399	172	7	reportedly	reportedly	ADV
ahs-18399	172	8	starts	start	VERB
ahs-18399	172	9	accumulating	accumulate	VERB
ahs-18399	172	10	2	2	NUM
ahs-18399	172	11	h	h	NOUN
ahs-18399	172	12	after	after	ADP
ahs-18399	172	13	exposure	exposure	NOUN
ahs-18399	172	14	to	to	ADP
ahs-18399	172	15	uv	uv	NOUN
ahs-18399	172	16	-	-	PUNCT
ahs-18399	172	17	c	c	NOUN
ahs-18399	172	18	,	,	PUNCT
ahs-18399	172	19	and	and	CCONJ
ahs-18399	172	20	the	the	DET
ahs-18399	172	21	transcription	transcription	NOUN
ahs-18399	172	22	level	level	NOUN
ahs-18399	172	23	likely	likely	ADV
ahs-18399	172	24	remains	remain	VERB
ahs-18399	172	25	for	for	ADP
ahs-18399	172	26	two	two	NUM
ahs-18399	172	27	days	day	NOUN
ahs-18399	172	28	,	,	PUNCT
ahs-18399	172	29	thus	thus	ADV
ahs-18399	172	30	further	far	ADV
ahs-18399	172	31	contributing	contribute	VERB
ahs-18399	172	32	to	to	ADP
ahs-18399	172	33	the	the	DET
ahs-18399	172	34	long	long	ADV
ahs-18399	172	35	-	-	PUNCT
ahs-18399	172	36	lasting	last	VERB
ahs-18399	172	37	sa	sa	NOUN
ahs-18399	172	38	responses	response	NOUN
ahs-18399	172	39	.	.	PUNCT
ahs-18399	173	1	this	this	DET
ahs-18399	173	2	view	view	NOUN
ahs-18399	173	3	shall	shall	AUX
ahs-18399	173	4	be	be	AUX
ahs-18399	173	5	studied	study	VERB
ahs-18399	173	6	in	in	ADP
ahs-18399	173	7	detail	detail	NOUN
ahs-18399	173	8	in	in	ADP
ahs-18399	173	9	our	our	PRON
ahs-18399	173	10	future	future	ADJ
ahs-18399	173	11	experiments	experiment	NOUN
ahs-18399	173	12	.	.	PUNCT
ahs-18399	174	1	possible	possible	ADJ
ahs-18399	174	2	role	role	NOUN
ahs-18399	174	3	of	of	ADP
ahs-18399	174	4	chlorophylls	chlorophyll	NOUN
ahs-18399	174	5	.	.	PUNCT
ahs-18399	175	1	our	our	PRON
ahs-18399	175	2	data	datum	NOUN
ahs-18399	175	3	indicate	indicate	VERB
ahs-18399	175	4	that	that	SCONJ
ahs-18399	175	5	the	the	DET
ahs-18399	175	6	response	response	NOUN
ahs-18399	175	7	in	in	ADP
ahs-18399	175	8	green	green	ADJ
ahs-18399	175	9	samples	sample	NOUN
ahs-18399	175	10	(	(	PUNCT
ahs-18399	175	11	leaves	leave	NOUN
ahs-18399	175	12	and	and	CCONJ
ahs-18399	175	13	immature	immature	ADJ
ahs-18399	175	14	fruits	fruit	NOUN
ahs-18399	175	15	)	)	PUNCT
ahs-18399	175	16	and	and	CCONJ
ahs-18399	175	17	non	non	ADJ
ahs-18399	175	18	-	-	ADJ
ahs-18399	175	19	green	green	ADJ
ahs-18399	175	20	samples	sample	NOUN
ahs-18399	175	21	(	(	PUNCT
ahs-18399	175	22	ripe	ripe	ADJ
ahs-18399	175	23	fruits	fruit	NOUN
ahs-18399	175	24	and	and	CCONJ
ahs-18399	175	25	suspension	suspension	NOUN
ahs-18399	175	26	cultured	cultured	ADJ
ahs-18399	175	27	cells	cell	NOUN
ahs-18399	175	28	)	)	PUNCT
ahs-18399	175	29	might	might	AUX
ahs-18399	175	30	differ	differ	VERB
ahs-18399	175	31	in	in	ADP
ahs-18399	175	32	their	their	PRON
ahs-18399	175	33	modes	mode	NOUN
ahs-18399	175	34	of	of	ADP
ahs-18399	175	35	responses	response	NOUN
ahs-18399	175	36	to	to	ADP
ahs-18399	175	37	uvs	uvs	PROPN
ahs-18399	175	38	.	.	PUNCT
ahs-18399	176	1	while	while	SCONJ
ahs-18399	176	2	pr1	pr1	NOUN
ahs-18399	176	3	expression	expression	NOUN
ahs-18399	176	4	,	,	PUNCT
ahs-18399	176	5	one	one	NUM
ahs-18399	176	6	typical	typical	ADJ
ahs-18399	176	7	measure	measure	NOUN
ahs-18399	176	8	of	of	ADP
ahs-18399	176	9	stress	stress	NOUN
ahs-18399	176	10	responses	response	NOUN
ahs-18399	176	11	,	,	PUNCT
ahs-18399	176	12	was	be	AUX
ahs-18399	176	13	induced	induce	VERB
ahs-18399	176	14	by	by	ADP
ahs-18399	176	15	uv	uv	NOUN
ahs-18399	176	16	-	-	PUNCT
ahs-18399	176	17	c	c	NOUN
ahs-18399	176	18	in	in	ADP
ahs-18399	176	19	green	green	ADJ
ahs-18399	176	20	tissues	tissue	NOUN
ahs-18399	176	21	,	,	PUNCT
ahs-18399	176	22	non	non	ADJ
ahs-18399	176	23	-	-	ADJ
ahs-18399	176	24	green	green	ADJ
ahs-18399	176	25	samples	sample	NOUN
ahs-18399	176	26	(	(	PUNCT
ahs-18399	176	27	both	both	CCONJ
ahs-18399	176	28	the	the	DET
ahs-18399	176	29	ripe	ripe	ADJ
ahs-18399	176	30	fruits	fruit	NOUN
ahs-18399	176	31	and	and	CCONJ
ahs-18399	176	32	cell	cell	NOUN
ahs-18399	176	33	suspensions	suspension	NOUN
ahs-18399	176	34	)	)	PUNCT
ahs-18399	176	35	showed	show	VERB
ahs-18399	176	36	no	no	DET
ahs-18399	176	37	induction	induction	NOUN
ahs-18399	176	38	of	of	ADP
ahs-18399	176	39	pr1	pr1	NOUN
ahs-18399	176	40	expression	expression	NOUN
ahs-18399	176	41	(	(	PUNCT
ahs-18399	176	42	fig	fig	NOUN
ahs-18399	176	43	.	.	NOUN
ahs-18399	176	44	4	4	NUM
ahs-18399	176	45	and	and	CCONJ
ahs-18399	176	46	5	5	NUM
ahs-18399	176	47	)	)	PUNCT
ahs-18399	176	48	.	.	PUNCT
ahs-18399	177	1	it	it	PRON
ahs-18399	177	2	is	be	AUX
ahs-18399	177	3	tempting	tempting	ADJ
ahs-18399	177	4	to	to	PART
ahs-18399	177	5	speculate	speculate	VERB
ahs-18399	177	6	that	that	SCONJ
ahs-18399	177	7	the	the	DET
ahs-18399	177	8	chlorophyll	chlorophyll	NOUN
ahs-18399	177	9	-	-	PUNCT
ahs-18399	177	10	related	relate	VERB
ahs-18399	177	11	compounds	compound	NOUN
ahs-18399	177	12	may	may	AUX
ahs-18399	177	13	behave	behave	VERB
ahs-18399	177	14	as	as	ADP
ahs-18399	177	15	secondary	secondary	ADJ
ahs-18399	177	16	active	active	ADJ
ahs-18399	177	17	signals	signal	NOUN
ahs-18399	177	18	for	for	ADP
ahs-18399	177	19	mediating	mediate	VERB
ahs-18399	177	20	the	the	DET
ahs-18399	177	21	stress	stress	NOUN
ahs-18399	177	22	responses	response	NOUN
ahs-18399	177	23	.	.	PUNCT
ahs-18399	178	1	one	one	NUM
ahs-18399	178	2	of	of	ADP
ahs-18399	178	3	such	such	ADJ
ahs-18399	178	4	candidate	candidate	NOUN
ahs-18399	178	5	compounds	compound	NOUN
ahs-18399	178	6	may	may	AUX
ahs-18399	178	7	be	be	AUX
ahs-18399	178	8	pheophorbide	pheophorbide	ADJ
ahs-18399	178	9	a	a	DET
ahs-18399	178	10	derived	derived	NOUN
ahs-18399	178	11	from	from	ADP
ahs-18399	178	12	chlorophyll	chlorophyll	NOUN
ahs-18399	178	13	a	a	PRON
ahs-18399	178	14	,	,	PUNCT
ahs-18399	178	15	which	which	PRON
ahs-18399	178	16	is	be	AUX
ahs-18399	178	17	known	know	VERB
ahs-18399	178	18	to	to	PART
ahs-18399	178	19	be	be	AUX
ahs-18399	178	20	produced	produce	VERB
ahs-18399	178	21	in	in	ADP
ahs-18399	178	22	the	the	DET
ahs-18399	178	23	ethylene	ethylene	NOUN
ahs-18399	178	24	-	-	PUNCT
ahs-18399	178	25	exposed	expose	VERB
ahs-18399	178	26	green	green	ADJ
ahs-18399	178	27	tomato	tomato	NOUN
ahs-18399	178	28	fruits	fruit	NOUN
ahs-18399	178	29	(	(	PUNCT
ahs-18399	178	30	kawano	kawano	PROPN
ahs-18399	178	31	et	et	PROPN
ahs-18399	178	32	al	al	PROPN
ahs-18399	178	33	.	.	PROPN
ahs-18399	178	34	,	,	PUNCT
ahs-18399	178	35	1999	1999	NUM
ahs-18399	178	36	)	)	PUNCT
ahs-18399	178	37	.	.	PUNCT
ahs-18399	179	1	recently	recently	ADV
ahs-18399	179	2	,	,	PUNCT
ahs-18399	179	3	it	it	PRON
ahs-18399	179	4	was	be	AUX
ahs-18399	179	5	revealed	reveal	VERB
ahs-18399	179	6	that	that	SCONJ
ahs-18399	179	7	pheophorbide	pheophorbide	NOUN
ahs-18399	179	8	a	a	DET
ahs-18399	179	9	plays	play	NOUN
ahs-18399	179	10	a	a	DET
ahs-18399	179	11	key	key	ADJ
ahs-18399	179	12	role	role	NOUN
ahs-18399	179	13	in	in	ADP
ahs-18399	179	14	both	both	CCONJ
ahs-18399	179	15	light	light	ADJ
ahs-18399	179	16	-	-	PUNCT
ahs-18399	179	17	dependent	dependent	ADJ
ahs-18399	179	18	and	and	CCONJ
ahs-18399	179	19	light	light	ADJ
ahs-18399	179	20	-	-	PUNCT
ahs-18399	179	21	independent	independent	ADJ
ahs-18399	179	22	cell	cell	NOUN
ahs-18399	179	23	death	death	NOUN
ahs-18399	179	24	mechanism	mechanism	NOUN
ahs-18399	179	25	in	in	ADP
ahs-18399	179	26	plants	plant	NOUN
ahs-18399	179	27	(	(	PUNCT
ahs-18399	179	28	hirashima	hirashima	INTJ
ahs-18399	179	29	et	et	PROPN
ahs-18399	179	30	al	al	PROPN
ahs-18399	179	31	.	.	PROPN
ahs-18399	179	32	,	,	PUNCT
ahs-18399	179	33	2009	2009	NUM
ahs-18399	179	34	)	)	PUNCT
ahs-18399	179	35	.	.	PUNCT
ahs-18399	180	1	this	this	DET
ahs-18399	180	2	aspect	aspect	NOUN
ahs-18399	180	3	is	be	AUX
ahs-18399	180	4	worth	worth	ADJ
ahs-18399	180	5	testing	testing	NOUN
ahs-18399	180	6	in	in	ADP
ahs-18399	180	7	future	future	ADJ
ahs-18399	180	8	experiments	experiment	NOUN
ahs-18399	180	9	.	.	PUNCT
ahs-18399	181	1	regulation	regulation	NOUN
ahs-18399	181	2	of	of	ADP
ahs-18399	181	3	ethylene	ethylene	NOUN
ahs-18399	181	4	production	production	NOUN
ahs-18399	181	5	acs1a	acs1a	NOUN
ahs-18399	181	6	coding	coding	NOUN
ahs-18399	181	7	for	for	ADP
ahs-18399	181	8	acc	acc	PROPN
ahs-18399	181	9	synthase	synthase	NOUN
ahs-18399	181	10	is	be	AUX
ahs-18399	181	11	a	a	DET
ahs-18399	181	12	ripening	ripen	VERB
ahs-18399	181	13	-	-	PUNCT
ahs-18399	181	14	related	relate	VERB
ahs-18399	181	15	gene	gene	NOUN
ahs-18399	181	16	responsible	responsible	ADJ
ahs-18399	181	17	for	for	ADP
ahs-18399	181	18	production	production	NOUN
ahs-18399	181	19	of	of	ADP
ahs-18399	181	20	ethylene	ethylene	NOUN
ahs-18399	181	21	precursor	precursor	NOUN
ahs-18399	181	22	,	,	PUNCT
ahs-18399	181	23	acc	acc	PROPN
ahs-18399	181	24	.	.	PROPN
ahs-18399	182	1	since	since	SCONJ
ahs-18399	182	2	ethylene	ethylene	NOUN
ahs-18399	182	3	promotes	promote	VERB
ahs-18399	182	4	the	the	DET
ahs-18399	182	5	ripening	ripening	NOUN
ahs-18399	182	6	of	of	ADP
ahs-18399	182	7	fruits	fruit	NOUN
ahs-18399	182	8	and	and	CCONJ
ahs-18399	182	9	senescence	senescence	NOUN
ahs-18399	182	10	of	of	ADP
ahs-18399	182	11	leaves	leave	NOUN
ahs-18399	182	12	,	,	PUNCT
ahs-18399	182	13	uv	uv	NOUN
ahs-18399	182	14	-	-	PUNCT
ahs-18399	182	15	dependent	dependent	ADJ
ahs-18399	182	16	changes	change	NOUN
ahs-18399	182	17	in	in	ADP
ahs-18399	182	18	acs1a	acs1a	NOUN
ahs-18399	182	19	expression	expression	NOUN
ahs-18399	182	20	may	may	AUX
ahs-18399	182	21	drastically	drastically	ADV
ahs-18399	182	22	affect	affect	VERB
ahs-18399	182	23	the	the	DET
ahs-18399	182	24	life	life	NOUN
ahs-18399	182	25	-	-	PUNCT
ahs-18399	182	26	cycle	cycle	NOUN
ahs-18399	182	27	of	of	ADP
ahs-18399	182	28	the	the	DET
ahs-18399	182	29	139	139	NUM
ahs-18399	182	30	plants	plant	NOUN
ahs-18399	182	31	and	and	CCONJ
ahs-18399	182	32	shelf	shelf	NOUN
ahs-18399	182	33	-	-	PUNCT
ahs-18399	182	34	life	life	NOUN
ahs-18399	182	35	of	of	ADP
ahs-18399	182	36	the	the	DET
ahs-18399	182	37	fruits	fruit	NOUN
ahs-18399	182	38	.	.	PUNCT
ahs-18399	183	1	this	this	DET
ahs-18399	183	2	ethylene	ethylene	NOUN
ahs-18399	183	3	biosynthesis	biosynthesis	NOUN
ahs-18399	183	4	-	-	PUNCT
ahs-18399	183	5	related	relate	VERB
ahs-18399	183	6	gene	gene	NOUN
ahs-18399	183	7	was	be	AUX
ahs-18399	183	8	shown	show	VERB
ahs-18399	183	9	to	to	PART
ahs-18399	183	10	be	be	AUX
ahs-18399	183	11	activated	activate	VERB
ahs-18399	183	12	by	by	ADP
ahs-18399	183	13	both	both	DET
ahs-18399	183	14	uv	uv	NOUN
ahs-18399	183	15	-	-	PUNCT
ahs-18399	183	16	a	a	NOUN
ahs-18399	183	17	and	and	CCONJ
ahs-18399	183	18	uv	uv	NOUN
ahs-18399	183	19	-	-	PUNCT
ahs-18399	183	20	c	c	NOUN
ahs-18399	183	21	in	in	ADP
ahs-18399	183	22	the	the	DET
ahs-18399	183	23	cell	cell	NOUN
ahs-18399	183	24	suspension	suspension	NOUN
ahs-18399	183	25	culture	culture	NOUN
ahs-18399	183	26	and	and	CCONJ
ahs-18399	183	27	green	green	ADJ
ahs-18399	183	28	fruits	fruit	NOUN
ahs-18399	183	29	,	,	PUNCT
ahs-18399	183	30	suggesting	suggest	VERB
ahs-18399	183	31	that	that	SCONJ
ahs-18399	183	32	uv	uv	NOUN
ahs-18399	183	33	treatments	treatment	NOUN
ahs-18399	183	34	may	may	AUX
ahs-18399	183	35	be	be	AUX
ahs-18399	183	36	available	available	ADJ
ahs-18399	183	37	for	for	ADP
ahs-18399	183	38	postharvest	postharvest	ADJ
ahs-18399	183	39	enhancement	enhancement	NOUN
ahs-18399	183	40	of	of	ADP
ahs-18399	183	41	fruit	fruit	NOUN
ahs-18399	183	42	maturity	maturity	NOUN
ahs-18399	183	43	.	.	PUNCT
ahs-18399	184	1	interestingly	interestingly	ADV
ahs-18399	184	2	,	,	PUNCT
ahs-18399	184	3	uv	uv	NOUN
ahs-18399	184	4	-	-	PUNCT
ahs-18399	184	5	a	a	NOUN
ahs-18399	184	6	and	and	CCONJ
ahs-18399	184	7	uv	uv	NOUN
ahs-18399	184	8	-	-	PUNCT
ahs-18399	184	9	c	c	NOUN
ahs-18399	184	10	irradiation	irradiation	NOUN
ahs-18399	184	11	to	to	ADP
ahs-18399	184	12	red	red	ADJ
ahs-18399	184	13	fruits	fruit	NOUN
ahs-18399	184	14	resulted	result	VERB
ahs-18399	184	15	in	in	ADP
ahs-18399	184	16	gradual	gradual	ADJ
ahs-18399	184	17	lowering	lowering	NOUN
ahs-18399	184	18	of	of	ADP
ahs-18399	184	19	the	the	DET
ahs-18399	184	20	acs1a	acs1a	PROPN
ahs-18399	184	21	expression	expression	NOUN
ahs-18399	184	22	level	level	NOUN
ahs-18399	184	23	(	(	PUNCT
ahs-18399	184	24	fig	fig	NOUN
ahs-18399	184	25	.	.	PUNCT
ahs-18399	185	1	5	5	NUM
ahs-18399	185	2	)	)	PUNCT
ahs-18399	185	3	,	,	PUNCT
ahs-18399	185	4	suggesting	suggest	VERB
ahs-18399	185	5	that	that	SCONJ
ahs-18399	185	6	uvs	uvs	PROPN
ahs-18399	185	7	are	be	AUX
ahs-18399	185	8	possibly	possibly	ADV
ahs-18399	185	9	applicable	applicable	ADJ
ahs-18399	185	10	for	for	ADP
ahs-18399	185	11	retardation	retardation	NOUN
ahs-18399	185	12	and	and	CCONJ
ahs-18399	185	13	prevention	prevention	NOUN
ahs-18399	185	14	of	of	ADP
ahs-18399	185	15	ethylene	ethylene	NOUN
ahs-18399	185	16	-	-	PUNCT
ahs-18399	185	17	mediated	mediate	VERB
ahs-18399	185	18	fruit	fruit	NOUN
ahs-18399	185	19	over	over	ADP
ahs-18399	185	20	-	-	PUNCT
ahs-18399	185	21	ripening	ripen	VERB
ahs-18399	185	22	and	and	CCONJ
ahs-18399	185	23	softening	softening	NOUN
ahs-18399	185	24	.	.	PUNCT
ahs-18399	186	1	acknowledgements	acknowledgement	NOUN
ahs-18399	186	2	this	this	DET
ahs-18399	186	3	work	work	NOUN
ahs-18399	186	4	was	be	AUX
ahs-18399	186	5	supported	support	VERB
ahs-18399	186	6	by	by	ADP
ahs-18399	186	7	the	the	DET
ahs-18399	186	8	grant	grant	NOUN
ahs-18399	186	9	-	-	PUNCT
ahs-18399	186	10	in	in	ADP
ahs-18399	186	11	-	-	PUNCT
ahs-18399	186	12	aid	aid	NOUN
ahs-18399	186	13	from	from	ADP
ahs-18399	186	14	kitakyushu	kitakyushu	PROPN
ahs-18399	186	15	foundation	foundation	NOUN
ahs-18399	186	16	for	for	ADP
ahs-18399	186	17	the	the	DET
ahs-18399	186	18	advancement	advancement	NOUN
ahs-18399	186	19	of	of	ADP
ahs-18399	186	20	industry	industry	NOUN
ahs-18399	186	21	,	,	PUNCT
ahs-18399	186	22	science	science	NOUN
ahs-18399	186	23	,	,	PUNCT
ahs-18399	186	24	and	and	CCONJ
ahs-18399	186	25	technology	technology	NOUN
ahs-18399	186	26	(	(	PUNCT
ahs-18399	186	27	fais	fais	PROPN
ahs-18399	186	28	)	)	PUNCT
ahs-18399	186	29	and	and	CCONJ
ahs-18399	186	30	a	a	DET
ahs-18399	186	31	grant	grant	NOUN
ahs-18399	186	32	of	of	ADP
ahs-18399	186	33	regional	regional	ADJ
ahs-18399	186	34	innovation	innovation	NOUN
ahs-18399	186	35	strategy	strategy	NOUN
ahs-18399	186	36	support	support	NOUN
ahs-18399	186	37	program	program	NOUN
ahs-18399	186	38	implemented	implement	VERB
ahs-18399	186	39	by	by	ADP
ahs-18399	186	40	ministry	ministry	PROPN
ahs-18399	186	41	of	of	ADP
ahs-18399	186	42	education	education	PROPN
ahs-18399	186	43	,	,	PUNCT
ahs-18399	186	44	culture	culture	NOUN
ahs-18399	186	45	,	,	PUNCT
ahs-18399	186	46	sports	sport	NOUN
ahs-18399	186	47	,	,	PUNCT
ahs-18399	186	48	science	science	NOUN
ahs-18399	186	49	and	and	CCONJ
ahs-18399	186	50	technology	technology	NOUN
ahs-18399	186	51	(	(	PUNCT
ahs-18399	186	52	mext	mext	NOUN
ahs-18399	186	53	)	)	PUNCT
ahs-18399	186	54	,	,	PUNCT
ahs-18399	186	55	japan	japan	PROPN
ahs-18399	186	56	.	.	PUNCT
ahs-18399	187	1	references	reference	NOUN
ahs-18399	187	2	abuqamar	abuqamar	PROPN
ahs-18399	187	3	s.	s.	PROPN
ahs-18399	187	4	,	,	PUNCT
ahs-18399	187	5	luo	luo	PROPN
ahs-18399	187	6	h.	h.	PROPN
ahs-18399	187	7	,	,	PUNCT
ahs-18399	187	8	laluk	laluk	PROPN
ahs-18399	187	9	k.	k.	PROPN
ahs-18399	187	10	,	,	PUNCT
ahs-18399	187	11	mickelbart	mickelbart	PROPN
ahs-18399	187	12	m.v	m.v	PROPN
ahs-18399	187	13	.	.	PROPN
ahs-18399	187	14	,	,	PUNCT
ahs-18399	187	15	mengiste	mengiste	PROPN
ahs-18399	187	16	t.	t.	PROPN
ahs-18399	187	17	,	,	PUNCT
ahs-18399	187	18	2009	2009	NUM
ahs-18399	187	19	crosstalk	crosstalk	NOUN
ahs-18399	187	20	between	between	ADP
ahs-18399	187	21	biotic	biotic	ADJ
ahs-18399	187	22	and	and	CCONJ
ahs-18399	187	23	abiotic	abiotic	ADJ
ahs-18399	187	24	stress	stress	NOUN
ahs-18399	187	25	responses	response	NOUN
ahs-18399	187	26	in	in	ADP
ahs-18399	187	27	tomato	tomato	NOUN
ahs-18399	187	28	is	be	AUX
ahs-18399	187	29	mediated	mediate	VERB
ahs-18399	187	30	by	by	ADP
ahs-18399	187	31	the	the	DET
ahs-18399	187	32	aim1	aim1	NOUN
ahs-18399	187	33	transcription	transcription	NOUN
ahs-18399	187	34	factor	factor	NOUN
ahs-18399	187	35	.	.	PUNCT
ahs-18399	188	1	plant	plant	NOUN
ahs-18399	188	2	j.	j.	PROPN
ahs-18399	188	3	,	,	PUNCT
ahs-18399	188	4	58	58	NUM
ahs-18399	188	5	:	:	PUNCT
ahs-18399	188	6	347	347	NUM
ahs-18399	188	7	-	-	SYM
ahs-18399	188	8	360	360	NUM
ahs-18399	188	9	.	.	PUNCT
ahs-18399	189	1	allen	allen	PROPN
ahs-18399	189	2	r.l	r.l	PROPN
ahs-18399	189	3	.	.	PROPN
ahs-18399	189	4	,	,	PUNCT
ahs-18399	189	5	bittner	bittner	PROPN
ahs-18399	189	6	-	-	PUNCT
ahs-18399	189	7	eddy	eddy	PROPN
ahs-18399	189	8	p.d	p.d	PROPN
ahs-18399	189	9	.	.	PROPN
ahs-18399	189	10	,	,	PUNCT
ahs-18399	189	11	grenville	grenville	PROPN
ahs-18399	189	12	-	-	PUNCT
ahs-18399	189	13	briggs	briggs	PROPN
ahs-18399	189	14	l.j	l.j	PROPN
ahs-18399	189	15	.	.	PROPN
ahs-18399	189	16	,	,	PUNCT
ahs-18399	189	17	meitz	meitz	PROPN
ahs-18399	189	18	j.c	j.c	PROPN
ahs-18399	189	19	.	.	PROPN
ahs-18399	189	20	,	,	PUNCT
ahs-18399	189	21	rehmany	rehmany	PROPN
ahs-18399	189	22	a.p	a.p	PROPN
ahs-18399	189	23	.	.	PROPN
ahs-18399	189	24	,	,	PUNCT
ahs-18399	189	25	rose	rise	VERB
ahs-18399	189	26	l.e	l.e	PROPN
ahs-18399	189	27	.	.	PROPN
ahs-18399	189	28	,	,	PUNCT
ahs-18399	189	29	beynon	beynon	PROPN
ahs-18399	189	30	j.l	j.l	PROPN
ahs-18399	189	31	.	.	PROPN
ahs-18399	189	32	,	,	PUNCT
ahs-18399	189	33	2004	2004	NUM
ahs-18399	189	34	host	host	NOUN
ahs-18399	189	35	-	-	PUNCT
ahs-18399	189	36	parasite	parasite	NOUN
ahs-18399	189	37	coevolutionary	coevolutionary	ADJ
ahs-18399	189	38	conflict	conflict	NOUN
ahs-18399	189	39	between	between	ADP
ahs-18399	189	40	arabidopsis	arabidopsis	NOUN
ahs-18399	189	41	and	and	CCONJ
ahs-18399	189	42	downy	downy	VERB
ahs-18399	189	43	mildew	mildew	NOUN
ahs-18399	189	44	.	.	PUNCT
ahs-18399	190	1	science	science	NOUN
ahs-18399	190	2	,	,	PUNCT
ahs-18399	190	3	306	306	NUM
ahs-18399	190	4	:	:	SYM
ahs-18399	190	5	1957	1957	NUM
ahs-18399	190	6	-	-	SYM
ahs-18399	190	7	1960	1960	NUM
ahs-18399	190	8	.	.	PUNCT
ahs-18399	191	1	altenbach	altenbach	PROPN
ahs-18399	191	2	d.	d.	PROPN
ahs-18399	191	3	,	,	PUNCT
ahs-18399	191	4	robatzek	robatzek	PROPN
ahs-18399	191	5	s.	s.	PROPN
ahs-18399	191	6	,	,	PUNCT
ahs-18399	191	7	2007	2007	NUM
ahs-18399	191	8	pattern	pattern	NOUN
ahs-18399	191	9	recognition	recognition	NOUN
ahs-18399	191	10	receptors	receptor	NOUN
ahs-18399	191	11	:	:	PUNCT
ahs-18399	191	12	from	from	ADP
ahs-18399	191	13	the	the	DET
ahs-18399	191	14	cell	cell	NOUN
ahs-18399	191	15	surface	surface	NOUN
ahs-18399	191	16	to	to	ADP
ahs-18399	191	17	intracellular	intracellular	ADJ
ahs-18399	191	18	dynamics	dynamic	NOUN
ahs-18399	191	19	.	.	PUNCT
ahs-18399	192	1	mol	mol	PROPN
ahs-18399	192	2	.	.	PROPN
ahs-18399	192	3	plant	plant	NOUN
ahs-18399	192	4	microbe	microbe	NOUN
ahs-18399	192	5	interact	interact	VERB
ahs-18399	192	6	.	.	PUNCT
ahs-18399	193	1	,	,	PUNCT
ahs-18399	193	2	20	20	NUM
ahs-18399	193	3	:	:	SYM
ahs-18399	193	4	1031	1031	NUM
ahs-18399	193	5	-	-	SYM
ahs-18399	193	6	1039	1039	NUM
ahs-18399	193	7	.	.	PUNCT
ahs-18399	194	1	chisholm	chisholm	PROPN
ahs-18399	194	2	s.t	s.t	PROPN
ahs-18399	194	3	.	.	PROPN
ahs-18399	194	4	,	,	PUNCT
ahs-18399	194	5	coaker	coaker	PROPN
ahs-18399	194	6	g.	g.	PROPN
ahs-18399	194	7	,	,	PUNCT
ahs-18399	194	8	day	day	PROPN
ahs-18399	194	9	b.	b.	PROPN
ahs-18399	194	10	,	,	PUNCT
ahs-18399	194	11	staskawicz	staskawicz	PROPN
ahs-18399	194	12	b.j	b.j	PROPN
ahs-18399	194	13	.	.	PROPN
ahs-18399	194	14	,	,	PUNCT
ahs-18399	194	15	2006	2006	NUM
ahs-18399	194	16	host	host	NOUN
ahs-18399	194	17	-	-	PUNCT
ahs-18399	194	18	microbe	microbe	NOUN
ahs-18399	194	19	interactions	interaction	NOUN
ahs-18399	194	20	:	:	PUNCT
ahs-18399	194	21	shaping	shape	VERB
ahs-18399	194	22	the	the	DET
ahs-18399	194	23	evolution	evolution	NOUN
ahs-18399	194	24	of	of	ADP
ahs-18399	194	25	the	the	DET
ahs-18399	194	26	plant	plant	NOUN
ahs-18399	194	27	immune	immune	ADJ
ahs-18399	194	28	response	response	NOUN
ahs-18399	194	29	.	.	PUNCT
ahs-18399	195	1	cell	cell	NOUN
ahs-18399	195	2	,	,	PUNCT
ahs-18399	195	3	124	124	NUM
ahs-18399	195	4	:	:	PUNCT
ahs-18399	195	5	803	803	NUM
ahs-18399	195	6	-	-	SYM
ahs-18399	195	7	814	814	NUM
ahs-18399	195	8	.	.	PUNCT
ahs-18399	196	1	dangl	dangl	PROPN
ahs-18399	196	2	j.l	j.l	PROPN
ahs-18399	196	3	.	.	PROPN
ahs-18399	196	4	,	,	PUNCT
ahs-18399	196	5	jones	jones	PROPN
ahs-18399	196	6	j.d.g	j.d.g	PROPN
ahs-18399	196	7	.	.	PROPN
ahs-18399	196	8	,	,	PUNCT
ahs-18399	196	9	2001	2001	NUM
ahs-18399	196	10	plant	plant	NOUN
ahs-18399	196	11	pathogens	pathogen	NOUN
ahs-18399	196	12	and	and	CCONJ
ahs-18399	196	13	integrated	integrate	VERB
ahs-18399	196	14	defence	defence	NOUN
ahs-18399	196	15	responses	response	NOUN
ahs-18399	196	16	to	to	ADP
ahs-18399	196	17	infection	infection	NOUN
ahs-18399	196	18	.	.	PUNCT
ahs-18399	197	1	nature	nature	NOUN
ahs-18399	197	2	,	,	PUNCT
ahs-18399	197	3	411	411	NUM
ahs-18399	197	4	:	:	PUNCT
ahs-18399	197	5	826833	826833	NUM
ahs-18399	197	6	.	.	PUNCT
ahs-18399	198	1	danon	danon	ADJ
ahs-18399	198	2	a.	a.	PROPN
ahs-18399	198	3	,	,	PUNCT
ahs-18399	198	4	gallois	gallois	VERB
ahs-18399	198	5	p.	p.	NOUN
ahs-18399	198	6	,	,	PUNCT
ahs-18399	198	7	1998	1998	NUM
ahs-18399	198	8	uv	uv	NOUN
ahs-18399	198	9	-	-	PUNCT
ahs-18399	198	10	c	c	NOUN
ahs-18399	198	11	radiation	radiation	NOUN
ahs-18399	198	12	induces	induce	VERB
ahs-18399	198	13	apoptotic	apoptotic	ADJ
ahs-18399	198	14	-	-	PUNCT
ahs-18399	198	15	like	like	ADJ
ahs-18399	198	16	changes	change	NOUN
ahs-18399	198	17	in	in	ADP
ahs-18399	198	18	arabidopsis	arabidopsis	NOUN
ahs-18399	198	19	thaliana	thaliana	NOUN
ahs-18399	198	20	.	.	PUNCT
ahs-18399	199	1	febs	febs	NOUN
ahs-18399	199	2	letters	letter	NOUN
ahs-18399	199	3	,	,	PUNCT
ahs-18399	199	4	437	437	NUM
ahs-18399	199	5	:	:	PUNCT
ahs-18399	199	6	131	131	NUM
ahs-18399	199	7	-	-	SYM
ahs-18399	199	8	136	136	NUM
ahs-18399	199	9	.	.	PUNCT
ahs-18399	200	1	danon	danon	ADJ
ahs-18399	200	2	a.	a.	PROPN
ahs-18399	200	3	,	,	PUNCT
ahs-18399	200	4	rotari	rotari	PROPN
ahs-18399	200	5	v.i	v.i	PROPN
ahs-18399	200	6	.	.	PROPN
ahs-18399	200	7	,	,	PUNCT
ahs-18399	200	8	gordon	gordon	PROPN
ahs-18399	200	9	a.	a.	PROPN
ahs-18399	200	10	,	,	PUNCT
ahs-18399	200	11	mailhac	mailhac	PROPN
ahs-18399	200	12	n.	n.	PROPN
ahs-18399	200	13	,	,	PUNCT
ahs-18399	200	14	gallois	gallois	VERB
ahs-18399	200	15	p.	p.	NOUN
ahs-18399	200	16	,	,	PUNCT
ahs-18399	200	17	2004	2004	NUM
ahs-18399	200	18	ultraviolet	ultraviolet	NOUN
ahs-18399	200	19	-	-	PUNCT
ahs-18399	200	20	c	c	NOUN
ahs-18399	200	21	overexposure	overexposure	NOUN
ahs-18399	200	22	induces	induce	NOUN
ahs-18399	200	23	programmed	program	VERB
ahs-18399	200	24	cell	cell	NOUN
ahs-18399	200	25	death	death	NOUN
ahs-18399	200	26	in	in	ADP
ahs-18399	200	27	arabidopsis	arabidopsis	NOUN
ahs-18399	200	28	,	,	PUNCT
ahs-18399	200	29	which	which	PRON
ahs-18399	200	30	is	be	AUX
ahs-18399	200	31	mediated	mediate	VERB
ahs-18399	200	32	by	by	ADP
ahs-18399	200	33	caspase	caspase	NOUN
ahs-18399	200	34	-	-	PUNCT
ahs-18399	200	35	like	like	ADJ
ahs-18399	200	36	activities	activity	NOUN
ahs-18399	200	37	and	and	CCONJ
ahs-18399	200	38	which	which	PRON
ahs-18399	200	39	can	can	AUX
ahs-18399	200	40	be	be	AUX
ahs-18399	200	41	suppressed	suppress	VERB
ahs-18399	200	42	by	by	ADP
ahs-18399	200	43	caspase	caspase	PROPN
ahs-18399	200	44	inhibitors	inhibitor	NOUN
ahs-18399	200	45	,	,	PUNCT
ahs-18399	200	46	p35	p35	NOUN
ahs-18399	200	47	and	and	CCONJ
ahs-18399	200	48	defender	defender	NOUN
ahs-18399	200	49	against	against	ADP
ahs-18399	200	50	apoptotic	apoptotic	ADJ
ahs-18399	200	51	death	death	NOUN
ahs-18399	200	52	.	.	PUNCT
ahs-18399	201	1	j.	j.	PROPN
ahs-18399	201	2	biol	biol	PROPN
ahs-18399	201	3	.	.	PUNCT
ahs-18399	202	1	chem	chem	PROPN
ahs-18399	202	2	.	.	PUNCT
ahs-18399	202	3	,	,	PUNCT
ahs-18399	203	1	279	279	NUM
ahs-18399	203	2	:	:	PUNCT
ahs-18399	203	3	779	779	NUM
ahs-18399	203	4	-	-	SYM
ahs-18399	203	5	787	787	NUM
ahs-18399	203	6	.	.	PUNCT
ahs-18399	204	1	dodds	dodds	PROPN
ahs-18399	204	2	p.n	p.n	PROPN
ahs-18399	204	3	.	.	PROPN
ahs-18399	204	4	,	,	PUNCT
ahs-18399	204	5	lawrence	lawrence	PROPN
ahs-18399	204	6	g.j	g.j	PROPN
ahs-18399	204	7	.	.	PROPN
ahs-18399	204	8	,	,	PUNCT
ahs-18399	204	9	catanzariti	catanzariti	PROPN
ahs-18399	204	10	a.m.	a.m.	PROPN
ahs-18399	204	11	,	,	PUNCT
ahs-18399	204	12	the	the	DET
ahs-18399	204	13	t.	t.	PROPN
ahs-18399	204	14	,	,	PUNCT
ahs-18399	204	15	wang	wang	PROPN
ahs-18399	204	16	c.i.a	c.i.a	PROPN
ahs-18399	204	17	.	.	PROPN
ahs-18399	204	18	,	,	PUNCT
ahs-18399	205	1	ayliffe	ayliffe	PROPN
ahs-18399	205	2	m.a	m.a	PROPN
ahs-18399	205	3	.	.	PROPN
ahs-18399	205	4	,	,	PUNCT
ahs-18399	205	5	kobe	kobe	PROPN
ahs-18399	205	6	b.	b.	PROPN
ahs-18399	205	7	,	,	PUNCT
ahs-18399	205	8	ellis	ellis	PROPN
ahs-18399	205	9	j.g	j.g	PROPN
ahs-18399	205	10	.	.	PROPN
ahs-18399	205	11	,	,	PUNCT
ahs-18399	205	12	2006	2006	NUM
ahs-18399	205	13	direct	direct	ADJ
ahs-18399	205	14	protein	protein	NOUN
ahs-18399	205	15	interaction	interaction	NOUN
ahs-18399	205	16	underlies	underlie	VERB
ahs-18399	205	17	gene	gene	NOUN
ahs-18399	205	18	-	-	PUNCT
ahs-18399	205	19	for	for	ADP
ahs-18399	205	20	-	-	PUNCT
ahs-18399	205	21	gene	gene	NOUN
ahs-18399	205	22	specificity	specificity	NOUN
ahs-18399	205	23	and	and	CCONJ
ahs-18399	205	24	coevolution	coevolution	NOUN
ahs-18399	205	25	of	of	ADP
ahs-18399	205	26	the	the	DET
ahs-18399	205	27	flax	flax	PROPN
ahs-18399	205	28	resistance	resistance	NOUN
ahs-18399	205	29	genes	gene	NOUN
ahs-18399	205	30	and	and	CCONJ
ahs-18399	205	31	flax	flax	NOUN
ahs-18399	205	32	avirulence	avirulence	NOUN
ahs-18399	205	33	genes	gene	NOUN
ahs-18399	205	34	.	.	PUNCT
ahs-18399	206	1	proc	proc	NOUN
ahs-18399	206	2	.	.	PUNCT
ahs-18399	207	1	natl	natl	PROPN
ahs-18399	207	2	.	.	PUNCT
ahs-18399	208	1	acad	acad	PROPN
ahs-18399	208	2	.	.	PUNCT
ahs-18399	209	1	sci	sci	PROPN
ahs-18399	209	2	.	.	PROPN
ahs-18399	209	3	usa	usa	PROPN
ahs-18399	209	4	,	,	PUNCT
ahs-18399	209	5	103(23	103(23	NUM
ahs-18399	209	6	):	):	PUNCT
ahs-18399	209	7	8888	8888	NUM
ahs-18399	209	8	-	-	SYM
ahs-18399	209	9	8893	8893	NUM
ahs-18399	209	10	.	.	PUNCT
ahs-18399	210	1	erkan	erkan	PROPN
ahs-18399	210	2	m.	m.	PROPN
ahs-18399	210	3	,	,	PUNCT
ahs-18399	210	4	yi	yi	PROPN
ahs-18399	210	5	c.	c.	PROPN
ahs-18399	210	6	,	,	PUNCT
ahs-18399	210	7	krizek	krizek	PROPN
ahs-18399	210	8	d.t	d.t	PROPN
ahs-18399	210	9	.	.	PROPN
ahs-18399	210	10	,	,	PUNCT
ahs-18399	210	11	2001	2001	NUM
ahs-18399	210	12	uv	uv	NOUN
ahs-18399	210	13	-	-	PUNCT
ahs-18399	210	14	c	c	NOUN
ahs-18399	210	15	irradiation	irradiation	NOUN
ahs-18399	210	16	reduces	reduce	VERB
ahs-18399	210	17	microbial	microbial	ADJ
ahs-18399	210	18	populations	population	NOUN
ahs-18399	210	19	and	and	CCONJ
ahs-18399	210	20	deterioration	deterioration	NOUN
ahs-18399	210	21	in	in	ADP
ahs-18399	210	22	cucurbita	cucurbita	PROPN
ahs-18399	210	23	pepo	pepo	NOUN
ahs-18399	210	24	fruit	fruit	NOUN
ahs-18399	210	25	tissue	tissue	NOUN
ahs-18399	210	26	.	.	PUNCT
ahs-18399	211	1	environ	environ	X
ahs-18399	211	2	.	.	PUNCT
ahs-18399	212	1	exper	exper	PROPN
ahs-18399	212	2	.	.	PUNCT
ahs-18399	213	1	bot	bot	PROPN
ahs-18399	213	2	.	.	PUNCT
ahs-18399	214	1	,	,	PUNCT
ahs-18399	214	2	45	45	NUM
ahs-18399	214	3	:	:	SYM
ahs-18399	214	4	1	1	NUM
ahs-18399	214	5	-	-	SYM
ahs-18399	214	6	9	9	NUM
ahs-18399	214	7	.	.	PUNCT
ahs-18399	214	8	eyal	eyal	PROPN
ahs-18399	214	9	e.	e.	PROPN
ahs-18399	214	10	,	,	PUNCT
ahs-18399	214	11	levy	levy	PROPN
ahs-18399	214	12	a.a	a.a	PROPN
ahs-18399	214	13	.	.	PROPN
ahs-18399	214	14	,	,	PUNCT
ahs-18399	214	15	2002	2002	NUM
ahs-18399	214	16	tomato	tomato	NOUN
ahs-18399	214	17	mutants	mutant	NOUN
ahs-18399	214	18	as	as	ADP
ahs-18399	214	19	tools	tool	NOUN
ahs-18399	214	20	for	for	ADP
ahs-18399	214	21	functional	functional	ADJ
ahs-18399	214	22	genomics	genomic	NOUN
ahs-18399	214	23	.	.	PUNCT
ahs-18399	215	1	curr	curr	PROPN
ahs-18399	215	2	.	.	PUNCT
ahs-18399	216	1	opin	opin	NOUN
ahs-18399	216	2	.	.	PUNCT
ahs-18399	217	1	plant	plant	NOUN
ahs-18399	217	2	biol	biol	PROPN
ahs-18399	217	3	.	.	PUNCT
ahs-18399	217	4	,	,	PUNCT
ahs-18399	217	5	5	5	NUM
ahs-18399	217	6	:	:	SYM
ahs-18399	217	7	112	112	NUM
ahs-18399	217	8	-	-	SYM
ahs-18399	217	9	117	117	NUM
ahs-18399	217	10	.	.	PUNCT
ahs-18399	218	1	falk	falk	PROPN
ahs-18399	218	2	a.	a.	PROPN
ahs-18399	218	3	,	,	PUNCT
ahs-18399	218	4	feys	fey	VERB
ahs-18399	218	5	b.j	b.j	PROPN
ahs-18399	218	6	.	.	PROPN
ahs-18399	218	7	,	,	PUNCT
ahs-18399	218	8	frost	frost	NOUN
ahs-18399	218	9	l.n	l.n	PROPN
ahs-18399	218	10	.	.	PROPN
ahs-18399	218	11	,	,	PUNCT
ahs-18399	218	12	jones	jones	PROPN
ahs-18399	218	13	j.d.g	j.d.g	PROPN
ahs-18399	218	14	.	.	PROPN
ahs-18399	218	15	,	,	PUNCT
ahs-18399	219	1	daniels	daniels	PROPN
ahs-18399	219	2	m.j	m.j	PROPN
ahs-18399	219	3	.	.	PROPN
ahs-18399	219	4	,	,	PUNCT
ahs-18399	219	5	parker	parker	PROPN
ahs-18399	219	6	j.e	j.e	PROPN
ahs-18399	219	7	.	.	PROPN
ahs-18399	219	8	,	,	PUNCT
ahs-18399	219	9	1999	1999	NUM
ahs-18399	219	10	eds1	eds1	VERB
ahs-18399	219	11	,	,	PUNCT
ahs-18399	219	12	an	an	DET
ahs-18399	219	13	essential	essential	ADJ
ahs-18399	219	14	component	component	NOUN
ahs-18399	219	15	of	of	ADP
ahs-18399	219	16	r	r	NOUN
ahs-18399	219	17	gene	gene	NOUN
ahs-18399	219	18	-	-	PUNCT
ahs-18399	219	19	mediated	mediate	VERB
ahs-18399	219	20	disease	disease	NOUN
ahs-18399	219	21	resistance	resistance	NOUN
ahs-18399	219	22	in	in	ADP
ahs-18399	219	23	arabidopsis	arabidopsis	NOUN
ahs-18399	219	24	has	have	VERB
ahs-18399	219	25	homology	homology	NOUN
ahs-18399	219	26	to	to	ADP
ahs-18399	219	27	eukaryotic	eukaryotic	ADJ
ahs-18399	219	28	lipases	lipase	NOUN
ahs-18399	219	29	.	.	PUNCT
ahs-18399	220	1	proc	proc	NOUN
ahs-18399	220	2	.	.	PUNCT
ahs-18399	221	1	natl	natl	PROPN
ahs-18399	221	2	.	.	PUNCT
ahs-18399	222	1	acad	acad	PROPN
ahs-18399	222	2	.	.	PUNCT
ahs-18399	223	1	sci	sci	PROPN
ahs-18399	223	2	.	.	PROPN
ahs-18399	223	3	usa	usa	PROPN
ahs-18399	223	4	,	,	PUNCT
ahs-18399	223	5	96	96	NUM
ahs-18399	223	6	:	:	SYM
ahs-18399	223	7	3292	3292	NUM
ahs-18399	223	8	-	-	SYM
ahs-18399	223	9	3297	3297	NUM
ahs-18399	223	10	.	.	PUNCT
ahs-18399	224	1	hirashima	hirashima	PROPN
ahs-18399	224	2	m.	m.	PROPN
ahs-18399	224	3	,	,	PUNCT
ahs-18399	224	4	tanaka	tanaka	PROPN
ahs-18399	224	5	r.	r.	PROPN
ahs-18399	224	6	,	,	PUNCT
ahs-18399	224	7	tanaka	tanaka	PROPN
ahs-18399	224	8	a.	a.	PROPN
ahs-18399	224	9	,	,	PUNCT
ahs-18399	224	10	2009	2009	NUM
ahs-18399	224	11	light	light	ADJ
ahs-18399	224	12	-	-	PUNCT
ahs-18399	224	13	independent	independent	ADJ
ahs-18399	224	14	cell	cell	NOUN
ahs-18399	224	15	death	death	NOUN
ahs-18399	224	16	induced	induce	VERB
ahs-18399	224	17	by	by	ADP
ahs-18399	224	18	accumulation	accumulation	NOUN
ahs-18399	224	19	of	of	ADP
ahs-18399	224	20	pheophorbide	pheophorbide	NOUN
ahs-18399	224	21	a	a	PRON
ahs-18399	224	22	in	in	ADP
ahs-18399	224	23	arabidopsis	arabidopsis	NOUN
ahs-18399	224	24	thaliana	thaliana	NOUN
ahs-18399	224	25	.	.	PUNCT
ahs-18399	225	1	plant	plant	NOUN
ahs-18399	225	2	cell	cell	NOUN
ahs-18399	225	3	physiol	physiol	PROPN
ahs-18399	225	4	.	.	PUNCT
ahs-18399	226	1	,	,	PUNCT
ahs-18399	226	2	50	50	NUM
ahs-18399	226	3	:	:	SYM
ahs-18399	226	4	719772	719772	NUM
ahs-18399	226	5	.	.	PUNCT
ahs-18399	227	1	iwase	iwase	PROPN
ahs-18399	227	2	j.	j.	PROPN
ahs-18399	227	3	,	,	PUNCT
ahs-18399	227	4	furukawa	furukawa	PROPN
ahs-18399	227	5	h.	h.	PROPN
ahs-18399	227	6	,	,	PUNCT
ahs-18399	227	7	hiramatsu	hiramatsu	NOUN
ahs-18399	227	8	t.	t.	PROPN
ahs-18399	227	9	,	,	PUNCT
ahs-18399	227	10	bouteau	bouteau	PROPN
ahs-18399	227	11	f.	f.	PROPN
ahs-18399	227	12	,	,	PUNCT
ahs-18399	227	13	mancuso	mancuso	PROPN
ahs-18399	227	14	s.	s.	PROPN
ahs-18399	227	15	,	,	PUNCT
ahs-18399	227	16	tanaka	tanaka	PROPN
ahs-18399	227	17	k.	k.	PROPN
ahs-18399	227	18	,	,	PUNCT
ahs-18399	227	19	okazaki	okazaki	PROPN
ahs-18399	227	20	t.	t.	PROPN
ahs-18399	227	21	,	,	PUNCT
ahs-18399	227	22	kawano	kawano	PROPN
ahs-18399	227	23	t.	t.	PROPN
ahs-18399	227	24	,	,	PUNCT
ahs-18399	227	25	2014	2014	NUM
ahs-18399	227	26	protection	protection	NOUN
ahs-18399	227	27	of	of	ADP
ahs-18399	227	28	tobacco	tobacco	NOUN
ahs-18399	227	29	cells	cell	NOUN
ahs-18399	227	30	from	from	ADP
ahs-18399	227	31	oxidative	oxidative	ADJ
ahs-18399	227	32	copper	copper	NOUN
ahs-18399	227	33	toxicity	toxicity	NOUN
ahs-18399	227	34	by	by	ADP
ahs-18399	227	35	catalytically	catalytically	ADV
ahs-18399	227	36	active	active	ADJ
ahs-18399	227	37	metal	metal	NOUN
ahs-18399	227	38	-	-	PUNCT
ahs-18399	227	39	binding	bind	VERB
ahs-18399	227	40	dna	dna	NOUN
ahs-18399	227	41	oligomers	oligomer	NOUN
ahs-18399	227	42	.	.	PUNCT
ahs-18399	228	1	j.	j.	PROPN
ahs-18399	228	2	of	of	ADP
ahs-18399	228	3	exper	exper	PROPN
ahs-18399	228	4	.	.	PUNCT
ahs-18399	229	1	bot	bot	PROPN
ahs-18399	229	2	.	.	PUNCT
ahs-18399	229	3	,	,	PUNCT
ahs-18399	229	4	65	65	NUM
ahs-18399	229	5	:	:	SYM
ahs-18399	229	6	1391	1391	NUM
ahs-18399	229	7	-	-	SYM
ahs-18399	229	8	1402	1402	NUM
ahs-18399	229	9	.	.	PUNCT
ahs-18399	230	1	jones	jones	PROPN
ahs-18399	230	2	j.d	j.d	PROPN
ahs-18399	230	3	.	.	PROPN
ahs-18399	230	4	,	,	PUNCT
ahs-18399	230	5	dangl	dangl	PROPN
ahs-18399	230	6	j.l	j.l	PROPN
ahs-18399	230	7	.	.	PROPN
ahs-18399	230	8	,	,	PUNCT
ahs-18399	230	9	2006	2006	NUM
ahs-18399	230	10	the	the	DET
ahs-18399	230	11	plant	plant	NOUN
ahs-18399	230	12	immune	immune	ADJ
ahs-18399	230	13	system	system	NOUN
ahs-18399	230	14	.	.	PUNCT
ahs-18399	231	1	nature	nature	NOUN
ahs-18399	231	2	,	,	PUNCT
ahs-18399	231	3	444	444	NUM
ahs-18399	231	4	:	:	SYM
ahs-18399	231	5	323	323	NUM
ahs-18399	231	6	-	-	SYM
ahs-18399	231	7	329	329	NUM
ahs-18399	231	8	.	.	PUNCT
ahs-18399	232	1	kadono	kadono	PROPN
ahs-18399	232	2	t.	t.	PROPN
ahs-18399	232	3	,	,	PUNCT
ahs-18399	232	4	kawano	kawano	PROPN
ahs-18399	232	5	t.	t.	PROPN
ahs-18399	232	6	,	,	PUNCT
ahs-18399	232	7	yuasa	yuasa	PROPN
ahs-18399	232	8	t.	t.	PROPN
ahs-18399	232	9	,	,	PUNCT
ahs-18399	232	10	iwaya	iwaya	NOUN
ahs-18399	232	11	-	-	PUNCT
ahs-18399	232	12	inoue	inoue	PROPN
ahs-18399	232	13	m.	m.	NOUN
ahs-18399	232	14	,	,	PUNCT
ahs-18399	232	15	2009	2009	NUM
ahs-18399	232	16	effect	effect	NOUN
ahs-18399	232	17	of	of	ADP
ahs-18399	232	18	sugars	sugar	NOUN
ahs-18399	232	19	on	on	ADP
ahs-18399	232	20	aluminum	aluminum	NOUN
ahs-18399	232	21	-	-	PUNCT
ahs-18399	232	22	induced	induce	VERB
ahs-18399	232	23	oxidative	oxidative	ADJ
ahs-18399	232	24	burst	burst	NOUN
ahs-18399	232	25	and	and	CCONJ
ahs-18399	232	26	cell	cell	NOUN
ahs-18399	232	27	death	death	NOUN
ahs-18399	232	28	in	in	ADP
ahs-18399	232	29	tomato	tomato	NOUN
ahs-18399	232	30	suspension	suspension	NOUN
ahs-18399	232	31	cells	cell	NOUN
ahs-18399	232	32	,	,	PUNCT
ahs-18399	232	33	pp	pp	ADV
ahs-18399	232	34	.	.	PUNCT
ahs-18399	232	35	201	201	NUM
ahs-18399	232	36	-	-	SYM
ahs-18399	232	37	204	204	NUM
ahs-18399	232	38	.	.	PUNCT
ahs-18399	233	1	in	in	ADP
ahs-18399	233	2	:	:	PUNCT
ahs-18399	233	3	shen	shen	PROPN
ahs-18399	233	4	x.	x.	PROPN
ahs-18399	233	5	,	,	PUNCT
ahs-18399	233	6	x.	x.	PROPN
ahs-18399	233	7	yang	yang	PROPN
ahs-18399	233	8	,	,	PUNCT
ahs-18399	233	9	x.	x.	PROPN
ahs-18399	233	10	zhang	zhang	PROPN
ahs-18399	233	11	,	,	PUNCT
ahs-18399	233	12	j.c	j.c	PROPN
ahs-18399	233	13	.	.	PROPN
ahs-18399	233	14	zong	zong	PROPN
ahs-18399	233	15	,	,	PUNCT
ahs-18399	233	16	l.j	l.j	PROPN
ahs-18399	233	17	.	.	PROPN
ahs-18399	233	18	kricka	kricka	PROPN
ahs-18399	233	19	,	,	PUNCT
ahs-18399	233	20	and	and	CCONJ
ahs-18399	233	21	p.e	p.e	PROPN
ahs-18399	233	22	.	.	PROPN
ahs-18399	233	23	stanley	stanley	PROPN
ahs-18399	233	24	(	(	PUNCT
ahs-18399	233	25	ed	ed	NOUN
ahs-18399	233	26	.	.	PUNCT
ahs-18399	233	27	)	)	PUNCT
ahs-18399	233	28	bioluminescence	bioluminescence	NOUN
ahs-18399	233	29	and	and	CCONJ
ahs-18399	233	30	chemiluminescence	chemiluminescence	NOUN
ahs-18399	233	31	:	:	PUNCT
ahs-18399	233	32	light	light	ADJ
ahs-18399	233	33	emission	emission	NOUN
ahs-18399	233	34	:	:	PUNCT
ahs-18399	233	35	biology	biology	NOUN
ahs-18399	233	36	and	and	CCONJ
ahs-18399	233	37	scientific	scientific	ADJ
ahs-18399	233	38	applications	application	NOUN
ahs-18399	233	39	.	.	PUNCT
ahs-18399	234	1	world	world	NOUN
ahs-18399	234	2	scientific	scientific	ADJ
ahs-18399	234	3	publishing	publishing	NOUN
ahs-18399	234	4	,	,	PUNCT
ahs-18399	234	5	singapore	singapore	PROPN
ahs-18399	234	6	,	,	PUNCT
ahs-18399	234	7	pp	pp	ADJ
ahs-18399	234	8	.	.	PUNCT
ahs-18399	235	1	504	504	NUM
ahs-18399	235	2	.	.	PUNCT
ahs-18399	236	1	kadono	kadono	PROPN
ahs-18399	236	2	t.	t.	PROPN
ahs-18399	236	3	,	,	PUNCT
ahs-18399	236	4	tran	tran	PROPN
ahs-18399	236	5	d.	d.	PROPN
ahs-18399	236	6	,	,	PUNCT
ahs-18399	236	7	errakhi	errakhi	PROPN
ahs-18399	236	8	r.	r.	PROPN
ahs-18399	236	9	,	,	PUNCT
ahs-18399	236	10	hiramatsu	hiramatsu	NOUN
ahs-18399	236	11	t.	t.	PROPN
ahs-18399	236	12	,	,	PUNCT
ahs-18399	236	13	meimoun	meimoun	PROPN
ahs-18399	236	14	p.	p.	PROPN
ahs-18399	236	15	,	,	PUNCT
ahs-18399	236	16	briand	briand	PROPN
ahs-18399	236	17	j.	j.	PROPN
ahs-18399	236	18	,	,	PUNCT
ahs-18399	236	19	iwaya	iwaya	PROPN
ahs-18399	236	20	-	-	PUNCT
ahs-18399	236	21	inoue	inoue	PROPN
ahs-18399	236	22	m.	m.	NOUN
ahs-18399	236	23	,	,	PUNCT
ahs-18399	236	24	kawano	kawano	PROPN
ahs-18399	236	25	t.	t.	PROPN
ahs-18399	236	26	,	,	PUNCT
ahs-18399	236	27	bouteau	bouteau	PROPN
ahs-18399	236	28	f.	f.	PROPN
ahs-18399	236	29	,	,	PUNCT
ahs-18399	236	30	2010	2010	NUM
ahs-18399	236	31	increased	increase	VERB
ahs-18399	236	32	anion	anion	NOUN
ahs-18399	236	33	channel	channel	NOUN
ahs-18399	236	34	activity	activity	NOUN
ahs-18399	236	35	is	be	AUX
ahs-18399	236	36	an	an	DET
ahs-18399	236	37	unavoidable	unavoidable	ADJ
ahs-18399	236	38	event	event	NOUN
ahs-18399	236	39	in	in	ADP
ahs-18399	236	40	ozone	ozone	NOUN
ahs-18399	236	41	-	-	PUNCT
ahs-18399	236	42	induced	induce	VERB
ahs-18399	236	43	programmed	program	VERB
ahs-18399	236	44	cell	cell	NOUN
ahs-18399	236	45	death	death	NOUN
ahs-18399	236	46	.	.	PUNCT
ahs-18399	237	1	plos	plos	PROPN
ahs-18399	237	2	one	one	NUM
ahs-18399	237	3	,	,	PUNCT
ahs-18399	237	4	5	5	NUM
ahs-18399	237	5	:	:	PUNCT
ahs-18399	237	6	e13373	e13373	PROPN
ahs-18399	237	7	.	.	PROPN
ahs-18399	238	1	kadono	kadono	PROPN
ahs-18399	239	1	t.	t.	PROPN
ahs-18399	239	2	,	,	PUNCT
ahs-18399	239	3	yamaguchi	yamaguchi	PROPN
ahs-18399	239	4	y.	y.	PROPN
ahs-18399	239	5	,	,	PUNCT
ahs-18399	239	6	furuichi	furuichi	PROPN
ahs-18399	239	7	t.	t.	PROPN
ahs-18399	239	8	,	,	PUNCT
ahs-18399	239	9	hirono	hirono	PROPN
ahs-18399	239	10	m.	m.	NOUN
ahs-18399	239	11	,	,	PUNCT
ahs-18399	239	12	garrec	garrec	PROPN
ahs-18399	239	13	j.p	j.p	PROPN
ahs-18399	239	14	.	.	PROPN
ahs-18399	239	15	,	,	PUNCT
ahs-18399	239	16	kawano	kawano	PROPN
ahs-18399	239	17	t.	t.	PROPN
ahs-18399	239	18	,	,	PUNCT
ahs-18399	239	19	2006	2006	NUM
ahs-18399	239	20	ozone	ozone	NOUN
ahs-18399	239	21	-	-	PUNCT
ahs-18399	239	22	induced	induce	VERB
ahs-18399	239	23	cell	cell	NOUN
ahs-18399	239	24	death	death	NOUN
ahs-18399	239	25	mediated	mediate	VERB
ahs-18399	239	26	with	with	ADP
ahs-18399	239	27	oxidative	oxidative	ADJ
ahs-18399	239	28	and	and	CCONJ
ahs-18399	239	29	calcium	calcium	NOUN
ahs-18399	239	30	signaling	signal	VERB
ahs-18399	239	31	pathways	pathway	NOUN
ahs-18399	239	32	in	in	ADP
ahs-18399	239	33	tobacco	tobacco	NOUN
ahs-18399	239	34	bel	bel	NOUN
ahs-18399	239	35	-	-	PUNCT
ahs-18399	239	36	w3	w3	PROPN
ahs-18399	239	37	and	and	CCONJ
ahs-18399	239	38	bel	bel	NOUN
ahs-18399	239	39	-	-	PUNCT
ahs-18399	239	40	b	b	PROPN
ahs-18399	239	41	cell	cell	NOUN
ahs-18399	239	42	suspension	suspension	NOUN
ahs-18399	239	43	cultures	culture	NOUN
ahs-18399	239	44	.	.	PUNCT
ahs-18399	240	1	plant	plant	NOUN
ahs-18399	240	2	signal	signal	NOUN
ahs-18399	240	3	.	.	PUNCT
ahs-18399	241	1	behav	behav	PROPN
ahs-18399	241	2	.	.	PUNCT
ahs-18399	241	3	,	,	PUNCT
ahs-18399	241	4	1	1	NUM
ahs-18399	241	5	:	:	SYM
ahs-18399	241	6	312	312	NUM
ahs-18399	241	7	-	-	SYM
ahs-18399	241	8	322	322	NUM
ahs-18399	241	9	.	.	PUNCT
ahs-18399	242	1	kadota	kadota	PROPN
ahs-18399	242	2	y.	y.	PROPN
ahs-18399	242	3	,	,	PUNCT
ahs-18399	242	4	goh	goh	PROPN
ahs-18399	242	5	t.	t.	PROPN
ahs-18399	242	6	,	,	PUNCT
ahs-18399	242	7	tomatsu	tomatsu	PROPN
ahs-18399	242	8	h.	h.	PROPN
ahs-18399	242	9	,	,	PUNCT
ahs-18399	242	10	tamauchi	tamauchi	PROPN
ahs-18399	242	11	r.	r.	PROPN
ahs-18399	242	12	,	,	PUNCT
ahs-18399	242	13	higashi	higashi	PROPN
ahs-18399	242	14	k.	k.	PROPN
ahs-18399	242	15	,	,	PUNCT
ahs-18399	242	16	muto	muto	PROPN
ahs-18399	242	17	s.	s.	PROPN
ahs-18399	242	18	,	,	PUNCT
ahs-18399	242	19	kuchitsu	kuchitsu	PROPN
ahs-18399	242	20	k.	k.	PROPN
ahs-18399	242	21	,	,	PUNCT
ahs-18399	242	22	2004	2004	NUM
ahs-18399	242	23	cryptogeininduced	cryptogeininduce	VERB
ahs-18399	242	24	initial	initial	ADJ
ahs-18399	242	25	events	event	NOUN
ahs-18399	242	26	in	in	ADP
ahs-18399	242	27	tobacco	tobacco	NOUN
ahs-18399	242	28	by-2	by-2	NOUN
ahs-18399	242	29	cells	cell	NOUN
ahs-18399	242	30	:	:	PUNCT
ahs-18399	242	31	pharmacological	pharmacological	ADJ
ahs-18399	242	32	characterization	characterization	NOUN
ahs-18399	242	33	of	of	ADP
ahs-18399	242	34	molecular	molecular	ADJ
ahs-18399	242	35	relationship	relationship	NOUN
ahs-18399	242	36	among	among	ADP
ahs-18399	242	37	cytosolic	cytosolic	NOUN
ahs-18399	242	38	ca2	ca2	PROPN
ahs-18399	242	39	+	+	X
ahs-18399	242	40	transients	transient	NOUN
ahs-18399	242	41	,	,	PUNCT
ahs-18399	242	42	anion	anion	NOUN
ahs-18399	242	43	efflux	efflux	NOUN
ahs-18399	242	44	and	and	CCONJ
ahs-18399	242	45	production	production	NOUN
ahs-18399	242	46	of	of	ADP
ahs-18399	242	47	reactive	reactive	ADJ
ahs-18399	242	48	oxygen	oxygen	NOUN
ahs-18399	242	49	species	specie	NOUN
ahs-18399	242	50	.	.	PUNCT
ahs-18399	243	1	plant	plant	NOUN
ahs-18399	243	2	cell	cell	NOUN
ahs-18399	243	3	physiol	physiol	PROPN
ahs-18399	243	4	.	.	PUNCT
ahs-18399	244	1	,	,	PUNCT
ahs-18399	244	2	45(2	45(2	NOUN
ahs-18399	244	3	):	):	PUNCT
ahs-18399	244	4	160	160	NUM
ahs-18399	244	5	-	-	SYM
ahs-18399	244	6	170	170	NUM
ahs-18399	244	7	.	.	PUNCT
ahs-18399	245	1	kagenishi	kagenishi	PROPN
ahs-18399	245	2	t.	t.	PROPN
ahs-18399	245	3	,	,	PUNCT
ahs-18399	245	4	yokawa	yokawa	PROPN
ahs-18399	245	5	k.	k.	PROPN
ahs-18399	245	6	,	,	PUNCT
ahs-18399	245	7	kadono	kadono	PROPN
ahs-18399	245	8	t.	t.	PROPN
ahs-18399	245	9	,	,	PUNCT
ahs-18399	245	10	uezu	uezu	PROPN
ahs-18399	245	11	k.	k.	PROPN
ahs-18399	245	12	,	,	PUNCT
ahs-18399	245	13	kawano	kawano	PROPN
ahs-18399	245	14	t.	t.	PROPN
ahs-18399	245	15	,	,	PUNCT
ahs-18399	245	16	2011	2011	NUM
ahs-18399	245	17	copper	copper	NOUN
ahs-18399	245	18	-	-	PUNCT
ahs-18399	245	19	binding	bind	VERB
ahs-18399	245	20	peptides	peptide	NOUN
ahs-18399	245	21	from	from	ADP
ahs-18399	245	22	human	human	ADJ
ahs-18399	245	23	prion	prion	NOUN
ahs-18399	245	24	protein	protein	NOUN
ahs-18399	245	25	and	and	CCONJ
ahs-18399	245	26	newly	newly	ADV
ahs-18399	245	27	designed	design	VERB
ahs-18399	245	28	peroxidative	peroxidative	ADJ
ahs-18399	245	29	biocatalysts	biocatalyst	NOUN
ahs-18399	245	30	.	.	PUNCT
ahs-18399	246	1	z	z	NOUN
ahs-18399	246	2	naturforsch	naturforsch	PROPN
ahs-18399	246	3	.	.	PUNCT
ahs-18399	246	4	,	,	PUNCT
ahs-18399	246	5	66	66	NUM
ahs-18399	246	6	c	c	NOUN
ahs-18399	246	7	:	:	PUNCT
ahs-18399	246	8	182	182	NUM
ahs-18399	246	9	-	-	SYM
ahs-18399	246	10	190	190	NUM
ahs-18399	246	11	.	.	PUNCT
ahs-18399	247	1	kawano	kawano	PROPN
ahs-18399	247	2	t.	t.	PROPN
ahs-18399	247	3	,	,	PUNCT
ahs-18399	247	4	adachi	adachi	PROPN
ahs-18399	247	5	m.	m.	PROPN
ahs-18399	247	6	,	,	PUNCT
ahs-18399	247	7	kurata	kurata	PROPN
ahs-18399	247	8	h.	h.	PROPN
ahs-18399	247	9	,	,	PUNCT
ahs-18399	247	10	azuma	azuma	PROPN
ahs-18399	247	11	r.	r.	PROPN
ahs-18399	247	12	,	,	PUNCT
ahs-18399	247	13	shimokawa	shimokawa	PROPN
ahs-18399	247	14	k.	k.	PROPN
ahs-18399	247	15	,	,	PUNCT
ahs-18399	247	16	1999	1999	NUM
ahs-18399	247	17	calcium	calcium	NOUN
ahs-18399	247	18	-	-	PUNCT
ahs-18399	247	19	dependent	dependent	ADJ
ahs-18399	247	20	catabolism	catabolism	NOUN
ahs-18399	247	21	of	of	ADP
ahs-18399	247	22	phaeophorbide	phaeophorbide	NOUN
ahs-18399	247	23	a	a	PRON
ahs-18399	247	24	in	in	ADP
ahs-18399	247	25	tomato	tomato	NOUN
ahs-18399	247	26	fruit	fruit	NOUN
ahs-18399	247	27	.	.	PUNCT
ahs-18399	248	1	j.	j.	PROPN
ahs-18399	248	2	japan	japan	PROPN
ahs-18399	248	3	soc	soc	PROPN
ahs-18399	248	4	.	.	PUNCT
ahs-18399	249	1	hort	hort	PROPN
ahs-18399	249	2	.	.	PUNCT
ahs-18399	250	1	sci	sci	PROPN
ahs-18399	250	2	.	.	PROPN
ahs-18399	250	3	,	,	PUNCT
ahs-18399	250	4	68	68	NUM
ahs-18399	250	5	:	:	SYM
ahs-18399	250	6	810	810	NUM
ahs-18399	250	7	-	-	SYM
ahs-18399	250	8	816	816	NUM
ahs-18399	250	9	.	.	PUNCT
ahs-18399	250	10	kawano	kawano	PROPN
ahs-18399	250	11	t.	t.	PROPN
ahs-18399	250	12	,	,	PUNCT
ahs-18399	250	13	bouteau	bouteau	PROPN
ahs-18399	250	14	f.	f.	PROPN
ahs-18399	250	15	,	,	PUNCT
ahs-18399	250	16	2013	2013	NUM
ahs-18399	250	17	crosstalk	crosstalk	VERB
ahs-18399	250	18	between	between	ADP
ahs-18399	250	19	intracellular	intracellular	ADJ
ahs-18399	250	20	and	and	CCONJ
ahs-18399	250	21	extracellular	extracellular	ADJ
ahs-18399	250	22	salicylic	salicylic	ADJ
ahs-18399	250	23	acid	acid	NOUN
ahs-18399	250	24	signaling	signal	VERB
ahs-18399	250	25	events	event	NOUN
ahs-18399	250	26	leading	lead	VERB
ahs-18399	250	27	to	to	ADP
ahs-18399	250	28	long	long	ADJ
ahs-18399	250	29	-	-	PUNCT
ahs-18399	250	30	distance	distance	NOUN
ahs-18399	250	31	spread	spread	NOUN
ahs-18399	250	32	of	of	ADP
ahs-18399	250	33	signals	signal	NOUN
ahs-18399	250	34	.	.	PUNCT
ahs-18399	251	1	plant	plant	NOUN
ahs-18399	251	2	cell	cell	NOUN
ahs-18399	251	3	rep	rep	PROPN
ahs-18399	251	4	.	.	PROPN
ahs-18399	251	5	,	,	PUNCT
ahs-18399	251	6	32	32	NUM
ahs-18399	251	7	:	:	SYM
ahs-18399	251	8	1125	1125	NUM
ahs-18399	251	9	-	-	SYM
ahs-18399	251	10	1138	1138	NUM
ahs-18399	251	11	.	.	PUNCT
ahs-18399	252	1	kawano	kawano	PROPN
ahs-18399	252	2	t.	t.	PROPN
ahs-18399	252	3	,	,	PUNCT
ahs-18399	252	4	furuichi	furuichi	PROPN
ahs-18399	252	5	t.	t.	PROPN
ahs-18399	252	6	,	,	PUNCT
ahs-18399	252	7	muso	muso	PROPN
ahs-18399	252	8	s.	s.	PROPN
ahs-18399	252	9	,	,	PUNCT
ahs-18399	252	10	2004	2004	NUM
ahs-18399	252	11	controlled	control	VERB
ahs-18399	252	12	free	free	ADJ
ahs-18399	252	13	salicylic	salicylic	ADJ
ahs-18399	252	14	acid	acid	NOUN
ahs-18399	252	15	levels	level	NOUN
ahs-18399	252	16	and	and	CCONJ
ahs-18399	252	17	corresponding	corresponding	ADJ
ahs-18399	252	18	signaling	signaling	ADJ
ahs-18399	252	19	mechanisms	mechanism	NOUN
ahs-18399	252	20	in	in	ADP
ahs-18399	252	21	plants	plant	NOUN
ahs-18399	252	22	.	.	PUNCT
ahs-18399	253	1	plant	plant	NOUN
ahs-18399	253	2	biotechnol	biotechnol	NOUN
ahs-18399	253	3	.	.	PUNCT
ahs-18399	253	4	,	,	PUNCT
ahs-18399	253	5	21	21	NUM
ahs-18399	253	6	:	:	PUNCT
ahs-18399	253	7	319	319	NUM
ahs-18399	253	8	-	-	SYM
ahs-18399	253	9	335	335	NUM
ahs-18399	253	10	.	.	PUNCT
ahs-18399	254	1	kawano	kawano	PROPN
ahs-18399	254	2	t.	t.	PROPN
ahs-18399	254	3	,	,	PUNCT
ahs-18399	254	4	muto	muto	PROPN
ahs-18399	254	5	s.	s.	PROPN
ahs-18399	254	6	,	,	PUNCT
ahs-18399	254	7	2000	2000	NUM
ahs-18399	254	8	mechanism	mechanism	NOUN
ahs-18399	254	9	of	of	ADP
ahs-18399	254	10	peroxidase	peroxidase	ADJ
ahs-18399	254	11	actions	action	NOUN
ahs-18399	254	12	for	for	ADP
ahs-18399	254	13	salicylic	salicylic	ADJ
ahs-18399	254	14	acid	acid	NOUN
ahs-18399	254	15	-	-	PUNCT
ahs-18399	254	16	induced	induce	VERB
ahs-18399	254	17	generation	generation	NOUN
ahs-18399	254	18	of	of	ADP
ahs-18399	254	19	active	active	ADJ
ahs-18399	254	20	oxygen	oxygen	NOUN
ahs-18399	254	21	species	specie	NOUN
ahs-18399	254	22	and	and	CCONJ
ahs-18399	254	23	an	an	DET
ahs-18399	254	24	increase	increase	NOUN
ahs-18399	254	25	in	in	ADP
ahs-18399	254	26	cytosolic	cytosolic	ADJ
ahs-18399	254	27	calcium	calcium	NOUN
ahs-18399	254	28	in	in	ADP
ahs-18399	254	29	tobacco	tobacco	NOUN
ahs-18399	254	30	suspension	suspension	NOUN
ahs-18399	254	31	culture	culture	NOUN
ahs-18399	254	32	.	.	PUNCT
ahs-18399	255	1	j.	j.	PROPN
ahs-18399	255	2	exper	exper	PROPN
ahs-18399	255	3	.	.	PUNCT
ahs-18399	256	1	bot	bot	PROPN
ahs-18399	256	2	.	.	PUNCT
ahs-18399	256	3	,	,	PUNCT
ahs-18399	256	4	51	51	NUM
ahs-18399	256	5	:	:	SYM
ahs-18399	256	6	685	685	NUM
ahs-18399	256	7	-	-	SYM
ahs-18399	256	8	693	693	NUM
ahs-18399	256	9	.	.	PUNCT
ahs-18399	256	10	140	140	NUM
ahs-18399	256	11	kawano	kawano	PROPN
ahs-18399	256	12	t.	t.	PROPN
ahs-18399	256	13	,	,	PUNCT
ahs-18399	256	14	sahashi	sahashi	PROPN
ahs-18399	256	15	n.	n.	PROPN
ahs-18399	256	16	,	,	PUNCT
ahs-18399	256	17	takahashi	takahashi	PROPN
ahs-18399	256	18	k.	k.	PROPN
ahs-18399	256	19	,	,	PUNCT
ahs-18399	256	20	uozumi	uozumi	PROPN
ahs-18399	256	21	n.	n.	NOUN
ahs-18399	256	22	,	,	PUNCT
ahs-18399	256	23	muto	muto	PROPN
ahs-18399	256	24	s.	s.	PROPN
ahs-18399	256	25	,	,	PUNCT
ahs-18399	256	26	1998	1998	NUM
ahs-18399	256	27	salicylic	salicylic	NOUN
ahs-18399	256	28	acid	acid	NOUN
ahs-18399	256	29	induces	induce	VERB
ahs-18399	256	30	extracellular	extracellular	ADJ
ahs-18399	256	31	superoxide	superoxide	NOUN
ahs-18399	256	32	generation	generation	NOUN
ahs-18399	256	33	followed	follow	VERB
ahs-18399	256	34	by	by	ADP
ahs-18399	256	35	an	an	DET
ahs-18399	256	36	increase	increase	NOUN
ahs-18399	256	37	in	in	ADP
ahs-18399	256	38	cytosolic	cytosolic	ADJ
ahs-18399	256	39	calcium	calcium	NOUN
ahs-18399	256	40	ion	ion	NOUN
ahs-18399	256	41	in	in	ADP
ahs-18399	256	42	tobacco	tobacco	NOUN
ahs-18399	256	43	suspension	suspension	NOUN
ahs-18399	256	44	culture	culture	NOUN
ahs-18399	256	45	:	:	PUNCT
ahs-18399	256	46	the	the	DET
ahs-18399	256	47	earliest	early	ADJ
ahs-18399	256	48	events	event	NOUN
ahs-18399	256	49	in	in	ADP
ahs-18399	256	50	salicylic	salicylic	ADJ
ahs-18399	256	51	acid	acid	NOUN
ahs-18399	256	52	signal	signal	NOUN
ahs-18399	256	53	transduction	transduction	NOUN
ahs-18399	256	54	.	.	PUNCT
ahs-18399	257	1	plant	plant	NOUN
ahs-18399	257	2	cell	cell	NOUN
ahs-18399	257	3	physiol	physiol	PROPN
ahs-18399	257	4	.	.	PUNCT
ahs-18399	258	1	,	,	PUNCT
ahs-18399	258	2	39	39	NUM
ahs-18399	258	3	:	:	SYM
ahs-18399	258	4	721	721	NUM
ahs-18399	258	5	-	-	SYM
ahs-18399	258	6	730	730	NUM
ahs-18399	258	7	.	.	PUNCT
ahs-18399	259	1	kunihiro	kunihiro	PROPN
ahs-18399	259	2	s.	s.	PROPN
ahs-18399	259	3	,	,	PUNCT
ahs-18399	259	4	hiramatsu	hiramatsu	NOUN
ahs-18399	259	5	t.	t.	PROPN
ahs-18399	259	6	,	,	PUNCT
ahs-18399	259	7	kawano	kawano	PROPN
ahs-18399	259	8	t.	t.	PROPN
ahs-18399	259	9	,	,	PUNCT
ahs-18399	259	10	2011	2011	NUM
ahs-18399	259	11	involvement	involvement	NOUN
ahs-18399	259	12	of	of	ADP
ahs-18399	259	13	salicylic	salicylic	ADJ
ahs-18399	259	14	acid	acid	NOUN
ahs-18399	259	15	signal	signal	NOUN
ahs-18399	259	16	transduction	transduction	NOUN
ahs-18399	259	17	in	in	ADP
ahs-18399	259	18	aluminum	aluminum	NOUN
ahs-18399	259	19	-	-	PUNCT
ahs-18399	259	20	responsive	responsive	ADJ
ahs-18399	259	21	oxidative	oxidative	ADJ
ahs-18399	259	22	burst	burst	NOUN
ahs-18399	259	23	in	in	ADP
ahs-18399	259	24	arabidopsis	arabidopsis	NOUN
ahs-18399	259	25	thaliana	thaliana	NOUN
ahs-18399	259	26	cell	cell	NOUN
ahs-18399	259	27	suspension	suspension	NOUN
ahs-18399	259	28	culture	culture	NOUN
ahs-18399	259	29	.	.	PUNCT
ahs-18399	260	1	plant	plant	NOUN
ahs-18399	260	2	signal	signal	NOUN
ahs-18399	260	3	behav	behav	NOUN
ahs-18399	260	4	.	.	PUNCT
ahs-18399	260	5	,	,	PUNCT
ahs-18399	260	6	6	6	NUM
ahs-18399	260	7	:	:	SYM
ahs-18399	260	8	611	611	NUM
ahs-18399	260	9	-	-	SYM
ahs-18399	260	10	616	616	NUM
ahs-18399	260	11	.	.	PUNCT
ahs-18399	261	1	kunz	kunz	PROPN
ahs-18399	261	2	b.a	b.a	PROPN
ahs-18399	261	3	.	.	PROPN
ahs-18399	261	4	,	,	PUNCT
ahs-18399	261	5	dando	dando	PROPN
ahs-18399	261	6	p.k	p.k	PROPN
ahs-18399	261	7	.	.	PROPN
ahs-18399	261	8	,	,	PUNCT
ahs-18399	261	9	grice	grice	PROPN
ahs-18399	261	10	d.m	d.m	PROPN
ahs-18399	261	11	.	.	PROPN
ahs-18399	261	12	,	,	PUNCT
ahs-18399	261	13	mohr	mohr	PROPN
ahs-18399	261	14	p.g	p.g	PROPN
ahs-18399	261	15	.	.	PROPN
ahs-18399	261	16	,	,	PUNCT
ahs-18399	261	17	schenk	schenk	PROPN
ahs-18399	261	18	p.m.	p.m.	PROPN
ahs-18399	261	19	,	,	PUNCT
ahs-18399	261	20	cahill	cahill	PROPN
ahs-18399	261	21	d.m	d.m	PROPN
ahs-18399	261	22	.	.	PROPN
ahs-18399	261	23	,	,	PUNCT
ahs-18399	261	24	2008	2008	NUM
ahs-18399	261	25	uv	uv	NOUN
ahs-18399	261	26	-	-	PUNCT
ahs-18399	261	27	induced	induce	VERB
ahs-18399	261	28	dna	dna	PROPN
ahs-18399	261	29	damage	damage	NOUN
ahs-18399	261	30	promotes	promote	VERB
ahs-18399	261	31	resistance	resistance	NOUN
ahs-18399	261	32	to	to	ADP
ahs-18399	261	33	the	the	DET
ahs-18399	261	34	biotrophic	biotrophic	ADJ
ahs-18399	261	35	pathogen	pathogen	NOUN
ahs-18399	261	36	hyaloperonospora	hyaloperonospora	PROPN
ahs-18399	261	37	parasitica	parasitica	PROPN
ahs-18399	261	38	in	in	ADP
ahs-18399	261	39	arabidopsis	arabidopsis	NOUN
ahs-18399	261	40	.	.	PUNCT
ahs-18399	262	1	plant	plant	NOUN
ahs-18399	262	2	physiol	physiol	PROPN
ahs-18399	262	3	.	.	PUNCT
ahs-18399	263	1	,	,	PUNCT
ahs-18399	263	2	148	148	NUM
ahs-18399	263	3	:	:	PUNCT
ahs-18399	263	4	1021	1021	NUM
ahs-18399	263	5	-	-	SYM
ahs-18399	263	6	1031	1031	NUM
ahs-18399	263	7	.	.	PUNCT
ahs-18399	264	1	lin	lin	PROPN
ahs-18399	264	2	c.	c.	PROPN
ahs-18399	264	3	,	,	PUNCT
ahs-18399	264	4	yu	yu	PROPN
ahs-18399	264	5	y.	y.	PROPN
ahs-18399	264	6	,	,	PUNCT
ahs-18399	264	7	kadono	kadono	PROPN
ahs-18399	264	8	t.	t.	PROPN
ahs-18399	264	9	,	,	PUNCT
ahs-18399	264	10	iwata	iwata	PROPN
ahs-18399	264	11	m.	m.	PROPN
ahs-18399	264	12	,	,	PUNCT
ahs-18399	264	13	umemura	umemura	PROPN
ahs-18399	264	14	k.	k.	PROPN
ahs-18399	264	15	,	,	PUNCT
ahs-18399	264	16	furuichi	furuichi	PROPN
ahs-18399	264	17	t.	t.	PROPN
ahs-18399	264	18	,	,	PUNCT
ahs-18399	264	19	kuse	kuse	NOUN
ahs-18399	264	20	m.	m.	NOUN
ahs-18399	264	21	,	,	PUNCT
ahs-18399	264	22	isobe	isobe	NOUN
ahs-18399	264	23	m.	m.	NOUN
ahs-18399	264	24	,	,	PUNCT
ahs-18399	264	25	yamamoto	yamamoto	PROPN
ahs-18399	264	26	y.	y.	PROPN
ahs-18399	264	27	,	,	PUNCT
ahs-18399	264	28	matsumoto	matsumoto	PROPN
ahs-18399	264	29	h.	h.	PROPN
ahs-18399	264	30	,	,	PUNCT
ahs-18399	264	31	yoshizuka	yoshizuka	PROPN
ahs-18399	264	32	k.	k.	PROPN
ahs-18399	264	33	,	,	PUNCT
ahs-18399	264	34	kawano	kawano	PROPN
ahs-18399	264	35	t.	t.	PROPN
ahs-18399	264	36	,	,	PUNCT
ahs-18399	264	37	2005	2005	NUM
ahs-18399	264	38	action	action	NOUN
ahs-18399	264	39	of	of	ADP
ahs-18399	264	40	aluminum	aluminum	NOUN
ahs-18399	264	41	,	,	PUNCT
ahs-18399	264	42	novel	novel	ADJ
ahs-18399	264	43	tpc1	tpc1	NOUN
ahs-18399	264	44	-	-	PUNCT
ahs-18399	264	45	type	type	NOUN
ahs-18399	264	46	channel	channel	NOUN
ahs-18399	264	47	inhibitor	inhibitor	NOUN
ahs-18399	264	48	,	,	PUNCT
ahs-18399	264	49	against	against	ADP
ahs-18399	264	50	salicylate	salicylate	NOUN
ahs-18399	264	51	-	-	PUNCT
ahs-18399	264	52	induced	induced	ADJ
ahs-18399	264	53	and	and	CCONJ
ahs-18399	264	54	cold	cold	ADJ
ahs-18399	264	55	shock	shock	NOUN
ahs-18399	264	56	-	-	PUNCT
ahs-18399	264	57	induced	induce	VERB
ahs-18399	264	58	calcium	calcium	NOUN
ahs-18399	264	59	influx	influx	NOUN
ahs-18399	264	60	in	in	ADP
ahs-18399	264	61	tobacco	tobacco	NOUN
ahs-18399	264	62	by-2	by-2	NOUN
ahs-18399	264	63	cells	cell	NOUN
ahs-18399	264	64	.	.	PUNCT
ahs-18399	265	1	biochem	biochem	PROPN
ahs-18399	265	2	.	.	PUNCT
ahs-18399	266	1	biophys	biophy	NOUN
ahs-18399	266	2	.	.	PUNCT
ahs-18399	267	1	res	re	NOUN
ahs-18399	267	2	.	.	PUNCT
ahs-18399	268	1	commun	commun	PROPN
ahs-18399	268	2	.	.	PROPN
ahs-18399	268	3	,	,	PUNCT
ahs-18399	268	4	332	332	NUM
ahs-18399	268	5	:	:	PUNCT
ahs-18399	268	6	823	823	NUM
ahs-18399	268	7	-	-	SYM
ahs-18399	268	8	830	830	NUM
ahs-18399	268	9	.	.	PUNCT
ahs-18399	269	1	liu	liu	PROPN
ahs-18399	269	2	j.	j.	PROPN
ahs-18399	269	3	,	,	PUNCT
ahs-18399	269	4	stevens	stevens	PROPN
ahs-18399	269	5	c.	c.	PROPN
ahs-18399	269	6	,	,	PUNCT
ahs-18399	269	7	khan	khan	PROPN
ahs-18399	269	8	v.a	v.a	PROPN
ahs-18399	269	9	.	.	PROPN
ahs-18399	269	10	,	,	PUNCT
ahs-18399	269	11	lu	lu	PROPN
ahs-18399	269	12	j.y	j.y	PROPN
ahs-18399	269	13	.	.	PROPN
ahs-18399	269	14	,	,	PUNCT
ahs-18399	269	15	wilson	wilson	PROPN
ahs-18399	269	16	c.l	c.l	PROPN
ahs-18399	269	17	.	.	PROPN
ahs-18399	269	18	,	,	PUNCT
ahs-18399	269	19	adeyeye	adeyeye	PROPN
ahs-18399	269	20	o.	o.	PROPN
ahs-18399	269	21	,	,	PUNCT
ahs-18399	269	22	1993	1993	NUM
ahs-18399	269	23	application	application	NOUN
ahs-18399	269	24	of	of	ADP
ahs-18399	269	25	ultraviolet	ultraviolet	NOUN
ahs-18399	269	26	-	-	PUNCT
ahs-18399	269	27	c	c	NOUN
ahs-18399	269	28	light	light	NOUN
ahs-18399	269	29	on	on	ADP
ahs-18399	269	30	storage	storage	NOUN
ahs-18399	269	31	rots	rot	NOUN
ahs-18399	269	32	and	and	CCONJ
ahs-18399	269	33	ripening	ripening	NOUN
ahs-18399	269	34	of	of	ADP
ahs-18399	269	35	tomatoes	tomato	NOUN
ahs-18399	269	36	.	.	PUNCT
ahs-18399	270	1	j.	j.	PROPN
ahs-18399	270	2	food	food	PROPN
ahs-18399	270	3	protect	protect	PROPN
ahs-18399	270	4	.	.	PUNCT
ahs-18399	270	5	,	,	PUNCT
ahs-18399	270	6	56	56	NUM
ahs-18399	270	7	:	:	SYM
ahs-18399	270	8	868	868	NUM
ahs-18399	270	9	-	-	SYM
ahs-18399	270	10	873	873	NUM
ahs-18399	270	11	.	.	PUNCT
ahs-18399	271	1	lu	lu	PROPN
ahs-18399	271	2	j.y	j.y	PROPN
ahs-18399	271	3	.	.	PROPN
ahs-18399	271	4	,	,	PUNCT
ahs-18399	271	5	stevens.c	stevens.c	ADV
ahs-18399	271	6	.	.	PUNCT
ahs-18399	271	7	,	,	PUNCT
ahs-18399	271	8	khan	khan	PROPN
ahs-18399	271	9	v.a	v.a	PROPN
ahs-18399	271	10	.	.	PROPN
ahs-18399	271	11	,	,	PUNCT
ahs-18399	271	12	kabwe	kabwe	ADJ
ahs-18399	271	13	m.	m.	NOUN
ahs-18399	271	14	,	,	PUNCT
ahs-18399	271	15	wilson	wilson	PROPN
ahs-18399	271	16	c.l	c.l	PROPN
ahs-18399	271	17	.	.	PROPN
ahs-18399	271	18	,	,	PUNCT
ahs-18399	271	19	2007	2007	NUM
ahs-18399	271	20	the	the	DET
ahs-18399	271	21	effect	effect	NOUN
ahs-18399	271	22	of	of	ADP
ahs-18399	271	23	ultraviolet	ultraviolet	ADJ
ahs-18399	271	24	irradiation	irradiation	NOUN
ahs-18399	271	25	on	on	ADP
ahs-18399	271	26	shelf	shelf	NOUN
ahs-18399	271	27	-	-	PUNCT
ahs-18399	271	28	life	life	NOUN
ahs-18399	271	29	and	and	CCONJ
ahs-18399	271	30	ripening	ripening	NOUN
ahs-18399	271	31	of	of	ADP
ahs-18399	271	32	peaches	peach	NOUN
ahs-18399	271	33	and	and	CCONJ
ahs-18399	271	34	apples	apple	NOUN
ahs-18399	271	35	.	.	PUNCT
ahs-18399	272	1	j.	j.	PROPN
ahs-18399	272	2	food	food	PROPN
ahs-18399	272	3	qualit	qualit	PROPN
ahs-18399	272	4	.	.	PROPN
ahs-18399	272	5	,	,	PUNCT
ahs-18399	272	6	14	14	NUM
ahs-18399	272	7	:	:	PUNCT
ahs-18399	272	8	299	299	NUM
ahs-18399	272	9	-	-	SYM
ahs-18399	272	10	305	305	NUM
ahs-18399	272	11	.	.	PUNCT
ahs-18399	273	1	marco	marco	PROPN
ahs-18399	273	2	f.	f.	PROPN
ahs-18399	273	3	,	,	PUNCT
ahs-18399	273	4	calvo	calvo	PROPN
ahs-18399	273	5	e.	e.	PROPN
ahs-18399	273	6	,	,	PUNCT
ahs-18399	273	7	carrasco	carrasco	PROPN
ahs-18399	273	8	p.	p.	PROPN
ahs-18399	273	9	,	,	PUNCT
ahs-18399	273	10	sanz	sanz	PROPN
ahs-18399	273	11	m.j	m.j	PROPN
ahs-18399	273	12	.	.	PROPN
ahs-18399	273	13	,	,	PUNCT
ahs-18399	273	14	2008	2008	NUM
ahs-18399	273	15	analysis	analysis	NOUN
ahs-18399	273	16	of	of	ADP
ahs-18399	273	17	molecular	molecular	ADJ
ahs-18399	273	18	markers	marker	NOUN
ahs-18399	273	19	in	in	ADP
ahs-18399	273	20	three	three	NUM
ahs-18399	273	21	different	different	ADJ
ahs-18399	273	22	tomato	tomato	NOUN
ahs-18399	273	23	cultivars	cultivar	NOUN
ahs-18399	273	24	exposed	expose	VERB
ahs-18399	273	25	to	to	ADP
ahs-18399	273	26	ozone	ozone	NOUN
ahs-18399	273	27	stress	stress	NOUN
ahs-18399	273	28	.	.	PUNCT
ahs-18399	274	1	plant	plant	NOUN
ahs-18399	274	2	cell	cell	NOUN
ahs-18399	274	3	rep	rep	PROPN
ahs-18399	274	4	.	.	PROPN
ahs-18399	274	5	,	,	PUNCT
ahs-18399	274	6	27	27	NUM
ahs-18399	274	7	:	:	SYM
ahs-18399	274	8	197	197	NUM
ahs-18399	274	9	-	-	SYM
ahs-18399	274	10	207	207	NUM
ahs-18399	274	11	.	.	PUNCT
ahs-18399	275	1	marti	marti	PROPN
ahs-18399	275	2	e.	e.	PROPN
ahs-18399	275	3	,	,	PUNCT
ahs-18399	275	4	gisbert	gisbert	PROPN
ahs-18399	275	5	c.	c.	PROPN
ahs-18399	275	6	,	,	PUNCT
ahs-18399	275	7	bishop	bishop	PROPN
ahs-18399	275	8	g.j	g.j	PROPN
ahs-18399	275	9	.	.	PROPN
ahs-18399	275	10	,	,	PUNCT
ahs-18399	275	11	dixon	dixon	PROPN
ahs-18399	275	12	m.s	m.s	PROPN
ahs-18399	275	13	.	.	PROPN
ahs-18399	275	14	,	,	PUNCT
ahs-18399	275	15	garcia	garcia	PROPN
ahs-18399	275	16	-	-	PUNCT
ahs-18399	275	17	martinez	martinez	PROPN
ahs-18399	275	18	j.l	j.l	PROPN
ahs-18399	275	19	.	.	PROPN
ahs-18399	275	20	,	,	PUNCT
ahs-18399	275	21	2006	2006	NUM
ahs-18399	275	22	genetic	genetic	ADJ
ahs-18399	275	23	and	and	CCONJ
ahs-18399	275	24	physiological	physiological	ADJ
ahs-18399	275	25	characterization	characterization	NOUN
ahs-18399	275	26	of	of	ADP
ahs-18399	275	27	tomato	tomato	NOUN
ahs-18399	275	28	cv	cv	PROPN
ahs-18399	275	29	.	.	PROPN
ahs-18399	275	30	micro	micro	PROPN
ahs-18399	275	31	-	-	PROPN
ahs-18399	275	32	tom	tom	PROPN
ahs-18399	275	33	.	.	PUNCT
ahs-18399	276	1	j.	j.	PROPN
ahs-18399	276	2	exper	exper	PROPN
ahs-18399	276	3	.	.	PUNCT
ahs-18399	277	1	bot	bot	PROPN
ahs-18399	277	2	.	.	PUNCT
ahs-18399	277	3	,	,	PUNCT
ahs-18399	277	4	57	57	NUM
ahs-18399	277	5	:	:	SYM
ahs-18399	277	6	2037	2037	NUM
ahs-18399	277	7	-	-	SYM
ahs-18399	277	8	2047	2047	NUM
ahs-18399	277	9	.	.	PUNCT
ahs-18399	278	1	meissner	meissner	PROPN
ahs-18399	278	2	r.	r.	PROPN
ahs-18399	278	3	,	,	PUNCT
ahs-18399	278	4	jacobson	jacobson	PROPN
ahs-18399	278	5	y.	y.	PROPN
ahs-18399	278	6	,	,	PUNCT
ahs-18399	278	7	melamed	melamed	PROPN
ahs-18399	278	8	s.	s.	PROPN
ahs-18399	278	9	,	,	PUNCT
ahs-18399	278	10	levyatuv	levyatuv	PROPN
ahs-18399	278	11	s.	s.	PROPN
ahs-18399	278	12	,	,	PUNCT
ahs-18399	278	13	shalev	shalev	NOUN
ahs-18399	278	14	g.	g.	PROPN
ahs-18399	278	15	,	,	PUNCT
ahs-18399	278	16	ashri	ashri	PROPN
ahs-18399	278	17	a.	a.	NOUN
ahs-18399	278	18	,	,	PUNCT
ahs-18399	278	19	elkind	elkind	PROPN
ahs-18399	278	20	y.	y.	NOUN
ahs-18399	278	21	,	,	PUNCT
ahs-18399	278	22	levy	levy	NOUN
ahs-18399	278	23	a.	a.	NOUN
ahs-18399	278	24	,	,	PUNCT
ahs-18399	278	25	1997	1997	NUM
ahs-18399	278	26	a	a	DET
ahs-18399	278	27	new	new	ADJ
ahs-18399	278	28	model	model	NOUN
ahs-18399	278	29	system	system	NOUN
ahs-18399	278	30	for	for	ADP
ahs-18399	278	31	tomato	tomato	NOUN
ahs-18399	278	32	genetics	genetic	NOUN
ahs-18399	278	33	.	.	PUNCT
ahs-18399	279	1	plant	plant	NOUN
ahs-18399	279	2	j.	j.	PROPN
ahs-18399	279	3	,	,	PUNCT
ahs-18399	279	4	12	12	NUM
ahs-18399	279	5	:	:	SYM
ahs-18399	279	6	14651472	14651472	NUM
ahs-18399	279	7	.	.	PUNCT
ahs-18399	280	1	nawrath	nawrath	PROPN
ahs-18399	280	2	c.	c.	PROPN
ahs-18399	280	3	,	,	PUNCT
ahs-18399	280	4	heck	heck	INTJ
ahs-18399	280	5	s.	s.	PROPN
ahs-18399	280	6	,	,	PUNCT
ahs-18399	280	7	parinthawong	parinthawong	NOUN
ahs-18399	280	8	n.	n.	NOUN
ahs-18399	280	9	,	,	PUNCT
ahs-18399	280	10	métraux	métraux	PROPN
ahs-18399	280	11	j.p	j.p	PROPN
ahs-18399	280	12	.	.	PROPN
ahs-18399	280	13	,	,	PUNCT
ahs-18399	280	14	2002	2002	NUM
ahs-18399	280	15	eds5	eds5	PROPN
ahs-18399	280	16	,	,	PUNCT
ahs-18399	280	17	an	an	DET
ahs-18399	280	18	essential	essential	ADJ
ahs-18399	280	19	component	component	NOUN
ahs-18399	280	20	of	of	ADP
ahs-18399	280	21	salicylic	salicylic	ADJ
ahs-18399	280	22	aciddependent	aciddependent	NOUN
ahs-18399	280	23	signaling	signal	VERB
ahs-18399	280	24	for	for	ADP
ahs-18399	280	25	disease	disease	NOUN
ahs-18399	280	26	resistance	resistance	NOUN
ahs-18399	280	27	in	in	ADP
ahs-18399	280	28	arabidopsis	arabidopsis	NOUN
ahs-18399	280	29	,	,	PUNCT
ahs-18399	280	30	is	be	AUX
ahs-18399	280	31	a	a	DET
ahs-18399	280	32	member	member	NOUN
ahs-18399	280	33	of	of	ADP
ahs-18399	280	34	the	the	DET
ahs-18399	280	35	mate	mate	NOUN
ahs-18399	280	36	transporter	transporter	NOUN
ahs-18399	280	37	family	family	NOUN
ahs-18399	280	38	.	.	PUNCT
ahs-18399	281	1	plant	plant	NOUN
ahs-18399	281	2	cell	cell	NOUN
ahs-18399	281	3	,	,	PUNCT
ahs-18399	281	4	14	14	NUM
ahs-18399	281	5	:	:	SYM
ahs-18399	281	6	275	275	NUM
ahs-18399	281	7	-	-	SYM
ahs-18399	281	8	286	286	NUM
ahs-18399	281	9	.	.	PUNCT
ahs-18399	281	10	roldán	roldán	PROPN
ahs-18399	281	11	-	-	PUNCT
ahs-18399	281	12	arjona	arjona	PROPN
ahs-18399	281	13	t.	t.	PROPN
ahs-18399	281	14	,	,	PUNCT
ahs-18399	281	15	ariza	ariza	PROPN
ahs-18399	281	16	r.r	r.r	PROPN
ahs-18399	281	17	.	.	PROPN
ahs-18399	281	18	,	,	PUNCT
ahs-18399	281	19	2009	2009	NUM
ahs-18399	281	20	repair	repair	NOUN
ahs-18399	281	21	and	and	CCONJ
ahs-18399	281	22	tolerance	tolerance	NOUN
ahs-18399	281	23	of	of	ADP
ahs-18399	281	24	oxidative	oxidative	ADJ
ahs-18399	281	25	dna	dna	NOUN
ahs-18399	281	26	damage	damage	NOUN
ahs-18399	281	27	in	in	ADP
ahs-18399	281	28	plants	plant	NOUN
ahs-18399	281	29	.	.	PUNCT
ahs-18399	282	1	mutat	mutat	ADJ
ahs-18399	282	2	.	.	PUNCT
ahs-18399	282	3	res	re	NOUN
ahs-18399	282	4	.	.	PROPN
ahs-18399	282	5	,	,	PUNCT
ahs-18399	282	6	681	681	NUM
ahs-18399	282	7	:	:	SYM
ahs-18399	282	8	169	169	NUM
ahs-18399	282	9	-	-	SYM
ahs-18399	282	10	179	179	NUM
ahs-18399	282	11	.	.	PUNCT
ahs-18399	283	1	staehelin	staehelin	PROPN
ahs-18399	283	2	j.	j.	PROPN
ahs-18399	283	3	,	,	PUNCT
ahs-18399	283	4	harris	harris	PROPN
ahs-18399	283	5	n.r.p	n.r.p	PROPN
ahs-18399	283	6	.	.	PROPN
ahs-18399	283	7	,	,	PUNCT
ahs-18399	283	8	appenzeller	appenzeller	PROPN
ahs-18399	283	9	c.	c.	PROPN
ahs-18399	283	10	,	,	PUNCT
ahs-18399	283	11	eberhard	eberhard	PROPN
ahs-18399	283	12	j.	j.	PROPN
ahs-18399	283	13	,	,	PUNCT
ahs-18399	283	14	2001	2001	NUM
ahs-18399	283	15	ozone	ozone	NOUN
ahs-18399	283	16	trends	trend	NOUN
ahs-18399	283	17	:	:	PUNCT
ahs-18399	283	18	a	a	DET
ahs-18399	283	19	review	review	NOUN
ahs-18399	283	20	.	.	PUNCT
ahs-18399	284	1	rev	rev	PROPN
ahs-18399	284	2	.	.	PROPN
ahs-18399	284	3	geophys	geophy	NOUN
ahs-18399	284	4	,	,	PUNCT
ahs-18399	284	5	39	39	NUM
ahs-18399	284	6	:	:	SYM
ahs-18399	284	7	231	231	NUM
ahs-18399	284	8	-	-	SYM
ahs-18399	284	9	290	290	NUM
ahs-18399	284	10	.	.	PUNCT
ahs-18399	285	1	stevens	stevens	PROPN
ahs-18399	285	2	c.	c.	PROPN
ahs-18399	285	3	,	,	PUNCT
ahs-18399	285	4	khan	khan	PROPN
ahs-18399	285	5	v.a	v.a	PROPN
ahs-18399	285	6	.	.	PROPN
ahs-18399	285	7	,	,	PUNCT
ahs-18399	285	8	lu	lu	PROPN
ahs-18399	285	9	j.y	j.y	PROPN
ahs-18399	285	10	.	.	PROPN
ahs-18399	285	11	,	,	PUNCT
ahs-18399	285	12	wilson	wilson	PROPN
ahs-18399	285	13	c.l	c.l	PROPN
ahs-18399	285	14	.	.	PROPN
ahs-18399	285	15	,	,	PUNCT
ahs-18399	285	16	chalutz	chalutz	PROPN
ahs-18399	285	17	e.	e.	PROPN
ahs-18399	285	18	,	,	PUNCT
ahs-18399	285	19	droby	droby	VERB
ahs-18399	285	20	s.	s.	PROPN
ahs-18399	285	21	,	,	PUNCT
ahs-18399	285	22	kabwe	kabwe	PROPN
ahs-18399	285	23	m.k	m.k	PROPN
ahs-18399	285	24	.	.	PROPN
ahs-18399	285	25	,	,	PUNCT
ahs-18399	285	26	haung	haung	PROPN
ahs-18399	285	27	z.	z.	PROPN
ahs-18399	285	28	,	,	PUNCT
ahs-18399	285	29	adeyeye	adeyeye	PROPN
ahs-18399	285	30	o.	o.	PROPN
ahs-18399	285	31	,	,	PUNCT
ahs-18399	285	32	pusey	pusey	PROPN
ahs-18399	285	33	l.p	l.p	PROPN
ahs-18399	285	34	.	.	PROPN
ahs-18399	285	35	,	,	PUNCT
ahs-18399	285	36	tang	tang	PROPN
ahs-18399	285	37	a.y.a	a.y.a	PROPN
ahs-18399	285	38	.	.	PROPN
ahs-18399	285	39	,	,	PUNCT
ahs-18399	285	40	1999	1999	NUM
ahs-18399	285	41	induced	induce	VERB
ahs-18399	285	42	resistance	resistance	NOUN
ahs-18399	285	43	of	of	ADP
ahs-18399	285	44	sweetpotato	sweetpotato	NOUN
ahs-18399	285	45	to	to	PART
ahs-18399	285	46	fusarium	fusarium	NOUN
ahs-18399	285	47	root	root	NOUN
ahs-18399	285	48	rot	rot	VERB
ahs-18399	285	49	by	by	ADP
ahs-18399	285	50	uv	uv	NOUN
ahs-18399	285	51	-	-	PUNCT
ahs-18399	285	52	c	c	NOUN
ahs-18399	285	53	hormesis	hormesis	NOUN
ahs-18399	285	54	.	.	PUNCT
ahs-18399	286	1	crop	crop	NOUN
ahs-18399	286	2	protect	protect	NOUN
ahs-18399	286	3	.	.	PUNCT
ahs-18399	287	1	,	,	PUNCT
ahs-18399	287	2	18	18	NUM
ahs-18399	287	3	:	:	PUNCT
ahs-18399	287	4	463	463	NUM
ahs-18399	287	5	-	-	SYM
ahs-18399	287	6	470	470	NUM
ahs-18399	287	7	.	.	PUNCT
ahs-18399	288	1	stevens	stevens	PROPN
ahs-18399	288	2	c.	c.	PROPN
ahs-18399	288	3	,	,	PUNCT
ahs-18399	288	4	khan	khan	PROPN
ahs-18399	288	5	v.a	v.a	PROPN
ahs-18399	288	6	.	.	PROPN
ahs-18399	288	7	,	,	PUNCT
ahs-18399	288	8	lu	lu	PROPN
ahs-18399	288	9	j.y	j.y	PROPN
ahs-18399	288	10	.	.	PROPN
ahs-18399	288	11	,	,	PUNCT
ahs-18399	288	12	wilson	wilson	PROPN
ahs-18399	288	13	c.l	c.l	PROPN
ahs-18399	288	14	.	.	PROPN
ahs-18399	288	15	,	,	PUNCT
ahs-18399	288	16	pusey	pusey	PROPN
ahs-18399	288	17	p.l	p.l	PROPN
ahs-18399	288	18	.	.	PROPN
ahs-18399	288	19	,	,	PUNCT
ahs-18399	288	20	kabwe	kabwe	PROPN
ahs-18399	288	21	m.k	m.k	PROPN
ahs-18399	288	22	.	.	PROPN
ahs-18399	288	23	,	,	PUNCT
ahs-18399	288	24	igwegbe	igwegbe	NOUN
ahs-18399	288	25	e.c.k	e.c.k	PROPN
ahs-18399	288	26	.	.	PROPN
ahs-18399	288	27	,	,	PUNCT
ahs-18399	288	28	chalutz	chalutz	PROPN
ahs-18399	288	29	e.	e.	PROPN
ahs-18399	288	30	,	,	PUNCT
ahs-18399	288	31	droby	droby	VERB
ahs-18399	288	32	s.	s.	PROPN
ahs-18399	288	33	,	,	PUNCT
ahs-18399	288	34	1998	1998	NUM
ahs-18399	288	35	the	the	DET
ahs-18399	288	36	germicidal	germicidal	ADJ
ahs-18399	288	37	and	and	CCONJ
ahs-18399	288	38	hormetic	hormetic	ADJ
ahs-18399	288	39	effects	effect	NOUN
ahs-18399	288	40	of	of	ADP
ahs-18399	288	41	uv	uv	NOUN
ahs-18399	288	42	-	-	PUNCT
ahs-18399	288	43	c	c	NOUN
ahs-18399	288	44	light	light	NOUN
ahs-18399	288	45	on	on	ADP
ahs-18399	288	46	reducing	reduce	VERB
ahs-18399	288	47	brown	brown	ADJ
ahs-18399	288	48	rot	rot	NOUN
ahs-18399	288	49	disease	disease	NOUN
ahs-18399	288	50	and	and	CCONJ
ahs-18399	288	51	yeast	yeast	NOUN
ahs-18399	288	52	microflora	microflora	NOUN
ahs-18399	288	53	of	of	ADP
ahs-18399	288	54	peaches	peach	NOUN
ahs-18399	288	55	.	.	PUNCT
ahs-18399	289	1	crop	crop	NOUN
ahs-18399	289	2	protection	protection	NOUN
ahs-18399	289	3	,	,	PUNCT
ahs-18399	289	4	17	17	NUM
ahs-18399	289	5	:	:	SYM
ahs-18399	289	6	75	75	NUM
ahs-18399	289	7	-	-	SYM
ahs-18399	289	8	84	84	NUM
ahs-18399	289	9	.	.	PUNCT
ahs-18399	290	1	stevens	stevens	PROPN
ahs-18399	290	2	c.	c.	PROPN
ahs-18399	290	3	,	,	PUNCT
ahs-18399	290	4	khan	khan	PROPN
ahs-18399	290	5	v.a	v.a	PROPN
ahs-18399	290	6	.	.	PROPN
ahs-18399	290	7	,	,	PUNCT
ahs-18399	290	8	tang	tang	PROPN
ahs-18399	290	9	a.y	a.y	PROPN
ahs-18399	290	10	.	.	PROPN
ahs-18399	290	11	,	,	PUNCT
ahs-18399	290	12	lu	lu	PROPN
ahs-18399	290	13	j.y	j.y	PROPN
ahs-18399	290	14	.	.	PROPN
ahs-18399	290	15	,	,	PUNCT
ahs-18399	290	16	1990	1990	NUM
ahs-18399	290	17	the	the	DET
ahs-18399	290	18	effect	effect	NOUN
ahs-18399	290	19	of	of	ADP
ahs-18399	290	20	ultraviolet	ultraviolet	ADJ
ahs-18399	290	21	radiation	radiation	NOUN
ahs-18399	290	22	on	on	ADP
ahs-18399	290	23	mold	mold	NOUN
ahs-18399	290	24	rots	rot	NOUN
ahs-18399	290	25	and	and	CCONJ
ahs-18399	290	26	nutrients	nutrient	NOUN
ahs-18399	290	27	of	of	ADP
ahs-18399	290	28	stored	store	VERB
ahs-18399	290	29	sweet	sweet	ADJ
ahs-18399	290	30	potatoes	potato	NOUN
ahs-18399	290	31	.	.	PUNCT
ahs-18399	291	1	j.	j.	PROPN
ahs-18399	291	2	food	food	PROPN
ahs-18399	291	3	protect	protect	PROPN
ahs-18399	291	4	.	.	PUNCT
ahs-18399	291	5	,	,	PUNCT
ahs-18399	291	6	53	53	NUM
ahs-18399	291	7	:	:	PUNCT
ahs-18399	291	8	223	223	NUM
ahs-18399	291	9	-	-	SYM
ahs-18399	291	10	226	226	NUM
ahs-18399	291	11	.	.	PUNCT
ahs-18399	292	1	stevens	stevens	PROPN
ahs-18399	292	2	c.	c.	PROPN
ahs-18399	292	3	,	,	PUNCT
ahs-18399	292	4	wilson	wilson	PROPN
ahs-18399	292	5	c.l	c.l	PROPN
ahs-18399	292	6	.	.	PROPN
ahs-18399	292	7	,	,	PUNCT
ahs-18399	292	8	lu	lu	PROPN
ahs-18399	293	1	j.y	j.y	PROPN
ahs-18399	293	2	.	.	PROPN
ahs-18399	293	3	,	,	PUNCT
ahs-18399	293	4	khan	khan	PROPN
ahs-18399	293	5	v.a	v.a	PROPN
ahs-18399	293	6	.	.	PROPN
ahs-18399	293	7	,	,	PUNCT
ahs-18399	293	8	chalutz	chalutz	PROPN
ahs-18399	293	9	e.	e.	PROPN
ahs-18399	293	10	,	,	PUNCT
ahs-18399	293	11	droby	droby	VERB
ahs-18399	293	12	s.	s.	PROPN
ahs-18399	293	13	,	,	PUNCT
ahs-18399	293	14	kabwe	kabwe	PROPN
ahs-18399	293	15	m.k	m.k	PROPN
ahs-18399	293	16	.	.	PROPN
ahs-18399	293	17	,	,	PUNCT
ahs-18399	293	18	haung	haung	PROPN
ahs-18399	293	19	z.	z.	PROPN
ahs-18399	293	20	,	,	PUNCT
ahs-18399	293	21	adeyeye	adeyeye	PROPN
ahs-18399	293	22	o.	o.	PROPN
ahs-18399	293	23	,	,	PUNCT
ahs-18399	293	24	pusey	pusey	PROPN
ahs-18399	293	25	l.p	l.p	PROPN
ahs-18399	293	26	.	.	PROPN
ahs-18399	293	27	,	,	PUNCT
ahs-18399	293	28	wisniewski	wisniewski	PROPN
ahs-18399	293	29	m.e	m.e	PROPN
ahs-18399	293	30	.	.	PROPN
ahs-18399	293	31	,	,	PUNCT
ahs-18399	293	32	west	west	PROPN
ahs-18399	293	33	m.	m.	PROPN
ahs-18399	293	34	,	,	PUNCT
ahs-18399	293	35	1996	1996	NUM
ahs-18399	293	36	plant	plant	NOUN
ahs-18399	293	37	hormesis	hormesis	NOUN
ahs-18399	293	38	induced	induce	VERB
ahs-18399	293	39	by	by	ADP
ahs-18399	293	40	ultraviolet	ultraviolet	ADJ
ahs-18399	293	41	light	light	PROPN
ahs-18399	293	42	-	-	PUNCT
ahs-18399	293	43	c	c	NOUN
ahs-18399	293	44	for	for	ADP
ahs-18399	293	45	controlling	control	VERB
ahs-18399	293	46	postharvest	postharvest	ADJ
ahs-18399	293	47	diseases	disease	NOUN
ahs-18399	293	48	of	of	ADP
ahs-18399	293	49	tree	tree	NOUN
ahs-18399	293	50	fruits	fruit	NOUN
ahs-18399	293	51	.	.	PUNCT
ahs-18399	294	1	crop	crop	NOUN
ahs-18399	294	2	protect	protect	NOUN
ahs-18399	294	3	.	.	PUNCT
ahs-18399	294	4	,	,	PUNCT
ahs-18399	294	5	15(2	15(2	NUM
ahs-18399	294	6	):	):	PUNCT
ahs-18399	294	7	129134	129134	NUM
ahs-18399	294	8	.	.	PUNCT
ahs-18399	295	1	tran	tran	PROPN
ahs-18399	295	2	d.	d.	PROPN
ahs-18399	295	3	,	,	PUNCT
ahs-18399	295	4	rossi	rossi	PROPN
ahs-18399	295	5	m.	m.	PROPN
ahs-18399	295	6	,	,	PUNCT
ahs-18399	295	7	biligui	biligui	PROPN
ahs-18399	295	8	b.	b.	PROPN
ahs-18399	295	9	,	,	PUNCT
ahs-18399	295	10	kawano	kawano	PROPN
ahs-18399	295	11	t.	t.	PROPN
ahs-18399	295	12	,	,	PUNCT
ahs-18399	295	13	mancuso	mancuso	PROPN
ahs-18399	295	14	s.	s.	PROPN
ahs-18399	295	15	,	,	PUNCT
ahs-18399	295	16	bouteau	bouteau	PROPN
ahs-18399	295	17	f.	f.	PROPN
ahs-18399	295	18	,	,	PUNCT
ahs-18399	295	19	2013	2013	NUM
ahs-18399	295	20	ozone	ozone	NOUN
ahs-18399	295	21	-	-	PUNCT
ahs-18399	295	22	induced	induce	VERB
ahs-18399	295	23	caspase	caspase	NOUN
ahs-18399	295	24	-	-	PUNCT
ahs-18399	295	25	like	like	ADJ
ahs-18399	295	26	activities	activity	NOUN
ahs-18399	295	27	are	be	AUX
ahs-18399	295	28	dependent	dependent	ADJ
ahs-18399	295	29	on	on	ADP
ahs-18399	295	30	early	early	ADJ
ahs-18399	295	31	ion	ion	NOUN
ahs-18399	295	32	channel	channel	NOUN
ahs-18399	295	33	regulations	regulation	NOUN
ahs-18399	295	34	and	and	CCONJ
ahs-18399	295	35	ros	ros	PROPN
ahs-18399	295	36	generation	generation	NOUN
ahs-18399	295	37	in	in	ADP
ahs-18399	295	38	arabidopsis	arabidopsis	NOUN
ahs-18399	295	39	thaliana	thaliana	NOUN
ahs-18399	295	40	cells	cell	NOUN
ahs-18399	295	41	.	.	PUNCT
ahs-18399	296	1	plant	plant	NOUN
ahs-18399	296	2	signal	signal	NOUN
ahs-18399	296	3	behav	behav	NOUN
ahs-18399	296	4	.	.	PUNCT
ahs-18399	296	5	,	,	PUNCT
ahs-18399	296	6	8	8	NUM
ahs-18399	296	7	:	:	PUNCT
ahs-18399	296	8	e25170	e25170	X
ahs-18399	296	9	.	.	PUNCT
ahs-18399	297	1	yoshioka	yoshioka	PROPN
ahs-18399	297	2	h.	h.	PROPN
ahs-18399	297	3	,	,	PUNCT
ahs-18399	297	4	bouteau	bouteau	PROPN
ahs-18399	297	5	f.	f.	PROPN
ahs-18399	297	6	,	,	PUNCT
ahs-18399	297	7	kawano	kawano	PROPN
ahs-18399	297	8	t.	t.	PROPN
ahs-18399	297	9	,	,	PUNCT
ahs-18399	297	10	2008	2008	NUM
ahs-18399	297	11	discovery	discovery	NOUN
ahs-18399	297	12	of	of	ADP
ahs-18399	297	13	oxidative	oxidative	ADJ
ahs-18399	297	14	burst	burst	NOUN
ahs-18399	297	15	in	in	ADP
ahs-18399	297	16	the	the	DET
ahs-18399	297	17	field	field	NOUN
ahs-18399	297	18	of	of	ADP
ahs-18399	297	19	plant	plant	NOUN
ahs-18399	297	20	immunity	immunity	NOUN
ahs-18399	297	21	:	:	PUNCT
ahs-18399	297	22	looking	look	VERB
ahs-18399	297	23	back	back	ADV
ahs-18399	297	24	at	at	ADP
ahs-18399	297	25	the	the	DET
ahs-18399	297	26	early	early	ADJ
ahs-18399	297	27	pioneering	pioneering	ADJ
ahs-18399	297	28	works	work	NOUN
ahs-18399	297	29	and	and	CCONJ
ahs-18399	297	30	towards	towards	ADP
ahs-18399	297	31	the	the	DET
ahs-18399	297	32	future	future	ADJ
ahs-18399	297	33	development	development	NOUN
ahs-18399	297	34	.	.	PUNCT
ahs-18399	298	1	plant	plant	NOUN
ahs-18399	298	2	signal	signal	NOUN
ahs-18399	298	3	.	.	PUNCT
ahs-18399	299	1	behav	behav	PROPN
ahs-18399	299	2	.	.	PUNCT
ahs-18399	299	3	,	,	PUNCT
ahs-18399	299	4	3	3	NUM
ahs-18399	299	5	:	:	SYM
ahs-18399	299	6	153	153	NUM
ahs-18399	299	7	-	-	SYM
ahs-18399	299	8	155	155	NUM
ahs-18399	299	9	.	.	PUNCT
ahs-18399	300	1	yukihiro	yukihiro	PROPN
ahs-18399	300	2	m.	m.	PROPN
ahs-18399	300	3	,	,	PUNCT
ahs-18399	300	4	hiramatsu	hiramatsu	NOUN
ahs-18399	300	5	t.	t.	PROPN
ahs-18399	300	6	,	,	PUNCT
ahs-18399	300	7	bouteau	bouteau	PROPN
ahs-18399	300	8	f.	f.	PROPN
ahs-18399	300	9	,	,	PUNCT
ahs-18399	300	10	kadono	kadono	PROPN
ahs-18399	300	11	t.	t.	PROPN
ahs-18399	300	12	,	,	PUNCT
ahs-18399	300	13	kawano	kawano	PROPN
ahs-18399	300	14	t.	t.	PROPN
ahs-18399	300	15	,	,	PUNCT
ahs-18399	300	16	2012	2012	NUM
ahs-18399	300	17	peroxyacetyl	peroxyacetyl	NOUN
ahs-18399	300	18	nitrate	nitrate	NOUN
ahs-18399	300	19	-	-	PUNCT
ahs-18399	300	20	induced	induce	VERB
ahs-18399	300	21	oxidative	oxidative	ADJ
ahs-18399	300	22	and	and	CCONJ
ahs-18399	300	23	calcium	calcium	NOUN
ahs-18399	300	24	signaling	signal	VERB
ahs-18399	300	25	events	event	NOUN
ahs-18399	300	26	leading	lead	VERB
ahs-18399	300	27	to	to	ADP
ahs-18399	300	28	cell	cell	NOUN
ahs-18399	300	29	death	death	NOUN
ahs-18399	300	30	in	in	ADP
ahs-18399	300	31	ozone	ozone	NOUN
ahs-18399	300	32	-	-	PUNCT
ahs-18399	300	33	sensitive	sensitive	ADJ
ahs-18399	300	34	tobacco	tobacco	NOUN
ahs-18399	300	35	cell	cell	NOUN
ahs-18399	300	36	-	-	PUNCT
ahs-18399	300	37	line	line	NOUN
ahs-18399	300	38	.	.	PUNCT
ahs-18399	301	1	plant	plant	NOUN
ahs-18399	301	2	signal	signal	NOUN
ahs-18399	301	3	behav	behav	NOUN
ahs-18399	301	4	.	.	PUNCT
ahs-18399	301	5	,	,	PUNCT
ahs-18399	301	6	7	7	NUM
ahs-18399	301	7	:	:	SYM
ahs-18399	301	8	113	113	NUM
ahs-18399	301	9	-	-	SYM
ahs-18399	301	10	120	120	NUM
ahs-18399	301	11	.	.	PUNCT