id	sid	tid	token	lemma	pos
ahs-3050	1	1	impaginato	impaginato	PROPN
ahs-3050	1	2	53	53	NUM
ahs-3050	1	3	1	1	NUM
ahs-3050	1	4	.	.	PUNCT
ahs-3050	2	1	introduction	introduction	NOUN
ahs-3050	2	2	calla	calla	NOUN
ahs-3050	2	3	and	and	CCONJ
ahs-3050	2	4	peruvian	peruvian	ADJ
ahs-3050	2	5	lily	lily	NOUN
ahs-3050	2	6	are	be	AUX
ahs-3050	2	7	commonly	commonly	ADV
ahs-3050	2	8	cultivated	cultivate	VERB
ahs-3050	2	9	in	in	ADP
ahs-3050	2	10	tuscany	tuscany	PROPN
ahs-3050	2	11	(	(	PUNCT
ahs-3050	2	12	italy	italy	PROPN
ahs-3050	2	13	)	)	PUNCT
ahs-3050	2	14	and	and	CCONJ
ahs-3050	2	15	they	they	PRON
ahs-3050	2	16	represent	represent	VERB
ahs-3050	2	17	one	one	NUM
ahs-3050	2	18	of	of	ADP
ahs-3050	2	19	the	the	DET
ahs-3050	2	20	main	main	ADJ
ahs-3050	2	21	cut	cut	NOUN
ahs-3050	2	22	flower	flower	NOUN
ahs-3050	2	23	productions	production	NOUN
ahs-3050	2	24	.	.	PUNCT
ahs-3050	3	1	calla	calla	PROPN
ahs-3050	3	2	lily	lily	PROPN
ahs-3050	4	1	[	[	X
ahs-3050	4	2	zantedeschia	zantedeschia	PROPN
ahs-3050	4	3	aethiopica	aethiopica	PROPN
ahs-3050	4	4	(	(	PUNCT
ahs-3050	4	5	l.	l.	PROPN
ahs-3050	4	6	)	)	PUNCT
ahs-3050	4	7	spreng	spreng	PROPN
ahs-3050	4	8	]	]	PUNCT
ahs-3050	4	9	is	be	AUX
ahs-3050	4	10	known	know	VERB
ahs-3050	4	11	to	to	PART
ahs-3050	4	12	be	be	AUX
ahs-3050	4	13	susceptible	susceptible	ADJ
ahs-3050	4	14	to	to	ADP
ahs-3050	4	15	at	at	ADV
ahs-3050	4	16	least	least	ADV
ahs-3050	4	17	13	13	NUM
ahs-3050	4	18	virus	virus	NOUN
ahs-3050	4	19	species	specie	NOUN
ahs-3050	4	20	,	,	PUNCT
ahs-3050	4	21	mainly	mainly	ADV
ahs-3050	4	22	belonging	belong	VERB
ahs-3050	4	23	to	to	ADP
ahs-3050	4	24	potyviridae	potyviridae	NOUN
ahs-3050	4	25	,	,	PUNCT
ahs-3050	4	26	bunyaviridae	bunyaviridae	NOUN
ahs-3050	4	27	,	,	PUNCT
ahs-3050	4	28	and	and	CCONJ
ahs-3050	4	29	tombusviridae	tombusviridae	NOUN
ahs-3050	4	30	(	(	PUNCT
ahs-3050	4	31	huang	huang	PROPN
ahs-3050	4	32	et	et	PROPN
ahs-3050	4	33	al	al	PROPN
ahs-3050	4	34	.	.	PROPN
ahs-3050	4	35	,	,	PUNCT
ahs-3050	4	36	2007	2007	NUM
ahs-3050	4	37	)	)	PUNCT
ahs-3050	4	38	.	.	PUNCT
ahs-3050	5	1	peruvian	peruvian	ADJ
ahs-3050	5	2	lily	lily	NOUN
ahs-3050	5	3	(	(	PUNCT
ahs-3050	5	4	alstroemeria	alstroemeria	NOUN
ahs-3050	5	5	spp	spp	NOUN
ahs-3050	5	6	.	.	PUNCT
ahs-3050	5	7	)	)	PUNCT
ahs-3050	5	8	has	have	AUX
ahs-3050	5	9	become	become	VERB
ahs-3050	5	10	one	one	NUM
ahs-3050	5	11	of	of	ADP
ahs-3050	5	12	the	the	DET
ahs-3050	5	13	most	most	ADV
ahs-3050	5	14	popular	popular	ADJ
ahs-3050	5	15	cut	cut	NOUN
ahs-3050	5	16	flowers	flower	NOUN
ahs-3050	5	17	worldwide	worldwide	ADV
ahs-3050	5	18	.	.	PUNCT
ahs-3050	6	1	it	it	PRON
ahs-3050	6	2	has	have	AUX
ahs-3050	6	3	been	be	AUX
ahs-3050	6	4	reported	report	VERB
ahs-3050	6	5	as	as	ADP
ahs-3050	6	6	the	the	DET
ahs-3050	6	7	natural	natural	ADJ
ahs-3050	6	8	host	host	NOUN
ahs-3050	6	9	of	of	ADP
ahs-3050	6	10	various	various	ADJ
ahs-3050	6	11	plant	plant	NOUN
ahs-3050	6	12	viruses	virus	NOUN
ahs-3050	6	13	,	,	PUNCT
ahs-3050	6	14	including	include	VERB
ahs-3050	6	15	members	member	NOUN
ahs-3050	6	16	of	of	ADP
ahs-3050	6	17	potyviridae	potyviridae	NOUN
ahs-3050	6	18	,	,	PUNCT
ahs-3050	6	19	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	6	20	or	or	CCONJ
ahs-3050	6	21	bunyaviridae	bunyaviridae	NOUN
ahs-3050	6	22	(	(	PUNCT
ahs-3050	6	23	park	park	NOUN
ahs-3050	6	24	et	et	NOUN
ahs-3050	6	25	al	al	PROPN
ahs-3050	6	26	.	.	PROPN
ahs-3050	6	27	,	,	PUNCT
ahs-3050	6	28	2010	2010	NUM
ahs-3050	6	29	)	)	PUNCT
ahs-3050	6	30	.	.	PUNCT
ahs-3050	7	1	in	in	ADP
ahs-3050	7	2	tuscany	tuscany	PROPN
ahs-3050	7	3	,	,	PUNCT
ahs-3050	7	4	virus	virus	NOUN
ahs-3050	7	5	surveys	survey	NOUN
ahs-3050	7	6	were	be	AUX
ahs-3050	7	7	carried	carry	VERB
ahs-3050	7	8	out	out	ADP
ahs-3050	7	9	on	on	ADP
ahs-3050	7	10	various	various	ADJ
ahs-3050	7	11	woody	woody	NOUN
ahs-3050	7	12	plants	plant	NOUN
ahs-3050	7	13	such	such	ADJ
ahs-3050	7	14	as	as	ADP
ahs-3050	7	15	grapevine	grapevine	NOUN
ahs-3050	7	16	(	(	PUNCT
ahs-3050	7	17	rizzo	rizzo	PROPN
ahs-3050	7	18	et	et	PROPN
ahs-3050	7	19	al	al	PROPN
ahs-3050	7	20	.	.	PROPN
ahs-3050	7	21	,	,	PUNCT
ahs-3050	7	22	2012	2012	NUM
ahs-3050	7	23	;	;	PUNCT
ahs-3050	7	24	2015	2015	NUM
ahs-3050	7	25	a	a	NOUN
ahs-3050	7	26	)	)	PUNCT
ahs-3050	7	27	but	but	CCONJ
ahs-3050	7	28	to	to	ADP
ahs-3050	7	29	our	our	PRON
ahs-3050	7	30	knowledge	knowledge	NOUN
ahs-3050	7	31	no	no	DET
ahs-3050	7	32	reports	report	NOUN
ahs-3050	7	33	are	be	AUX
ahs-3050	7	34	available	available	ADJ
ahs-3050	7	35	for	for	ADP
ahs-3050	7	36	calla	calla	NOUN
ahs-3050	7	37	and	and	CCONJ
ahs-3050	7	38	peruvian	peruvian	ADJ
ahs-3050	7	39	lily	lily	NOUN
ahs-3050	7	40	in	in	ADP
ahs-3050	7	41	italy	italy	PROPN
ahs-3050	7	42	.	.	PUNCT
ahs-3050	8	1	in	in	ADP
ahs-3050	8	2	order	order	NOUN
ahs-3050	8	3	to	to	PART
ahs-3050	8	4	evaluate	evaluate	VERB
ahs-3050	8	5	the	the	DET
ahs-3050	8	6	health	health	NOUN
ahs-3050	8	7	status	status	NOUN
ahs-3050	8	8	of	of	ADP
ahs-3050	8	9	these	these	DET
ahs-3050	8	10	plants	plant	NOUN
ahs-3050	8	11	in	in	ADP
ahs-3050	8	12	tuscan	tuscan	ADJ
ahs-3050	8	13	nurseries	nursery	NOUN
ahs-3050	8	14	,	,	PUNCT
ahs-3050	8	15	various	various	ADJ
ahs-3050	8	16	viruses	virus	NOUN
ahs-3050	8	17	were	be	AUX
ahs-3050	8	18	assayed	assayed	ADJ
ahs-3050	8	19	,	,	PUNCT
ahs-3050	8	20	belonging	belong	VERB
ahs-3050	8	21	to	to	ADP
ahs-3050	8	22	the	the	DET
ahs-3050	8	23	following	follow	VERB
ahs-3050	8	24	families	family	NOUN
ahs-3050	8	25	:	:	PUNCT
ahs-3050	8	26	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	9	1	[	[	X
ahs-3050	9	2	alstroemeria	alstroemeria	NOUN
ahs-3050	9	3	carla	carla	PROPN
ahs-3050	9	4	virus	virus	PROPN
ahs-3050	9	5	(	(	PUNCT
ahs-3050	9	6	alcv	alcv	PROPN
ahs-3050	9	7	)	)	PUNCT
ahs-3050	9	8	,	,	PUNCT
ahs-3050	9	9	lily	lily	ADJ
ahs-3050	9	10	symptomless	symptomless	ADJ
ahs-3050	9	11	virus	virus	NOUN
ahs-3050	9	12	(	(	PUNCT
ahs-3050	9	13	lsv	lsv	PROPN
ahs-3050	9	14	)	)	PUNCT
ahs-3050	9	15	]	]	PUNCT
ahs-3050	9	16	,	,	PUNCT
ahs-3050	9	17	bromoviridae	bromoviridae	NOUN
ahs-3050	9	18	[	[	X
ahs-3050	9	19	cucumber	cucumber	NOUN
ahs-3050	9	20	mosaic	mosaic	PROPN
ahs-3050	9	21	virus	virus	NOUN
ahs-3050	9	22	(	(	PUNCT
ahs-3050	9	23	cmv	cmv	PROPN
ahs-3050	9	24	)	)	PUNCT
ahs-3050	9	25	]	]	PUNCT
ahs-3050	9	26	,	,	PUNCT
ahs-3050	9	27	bunyaviridae	bunyaviridae	NOUN
ahs-3050	9	28	[	[	X
ahs-3050	9	29	impatiens	impatiens	ADJ
ahs-3050	9	30	necrotic	necrotic	ADJ
ahs-3050	9	31	spot	spot	NOUN
ahs-3050	9	32	virus	virus	NOUN
ahs-3050	9	33	(	(	PUNCT
ahs-3050	9	34	insv	insv	PROPN
ahs-3050	9	35	)	)	PUNCT
ahs-3050	9	36	,	,	PUNCT
ahs-3050	9	37	iris	iris	NOUN
ahs-3050	9	38	yellow	yellow	ADJ
ahs-3050	9	39	spot	spot	NOUN
ahs-3050	9	40	virus	virus	NOUN
ahs-3050	9	41	(	(	PUNCT
ahs-3050	9	42	iysv	iysv	NOUN
ahs-3050	9	43	)	)	PUNCT
ahs-3050	9	44	,	,	PUNCT
ahs-3050	9	45	tomato	tomato	NOUN
ahs-3050	9	46	spotted	spot	VERB
ahs-3050	9	47	wilt	wilt	ADJ
ahs-3050	9	48	virus	virus	NOUN
ahs-3050	9	49	(	(	PUNCT
ahs-3050	9	50	tswv	tswv	NOUN
ahs-3050	9	51	)	)	PUNCT
ahs-3050	9	52	]	]	PUNCT
ahs-3050	9	53	,	,	PUNCT
ahs-3050	9	54	comoviridae	comoviridae	PROPN
ahs-3050	10	1	[	[	X
ahs-3050	10	2	arabis	arabis	ADJ
ahs-3050	10	3	mosaic	mosaic	ADJ
ahs-3050	10	4	virus	virus	NOUN
ahs-3050	10	5	(	(	PUNCT
ahs-3050	10	6	armv	armv	NOUN
ahs-3050	10	7	)	)	PUNCT
ahs-3050	10	8	,	,	PUNCT
ahs-3050	10	9	broad	broad	ADJ
ahs-3050	10	10	bean	bean	NOUN
ahs-3050	10	11	wilt	wilt	NOUN
ahs-3050	10	12	virus	virus	NOUN
ahs-3050	10	13	1	1	NUM
ahs-3050	10	14	(	(	PUNCT
ahs-3050	10	15	bbwv-1	bbwv-1	PROPN
ahs-3050	10	16	)	)	PUNCT
ahs-3050	10	17	,	,	PUNCT
ahs-3050	10	18	broad	broad	ADJ
ahs-3050	10	19	bean	bean	NOUN
ahs-3050	10	20	wilt	wilt	NOUN
ahs-3050	10	21	virus	virus	NOUN
ahs-3050	10	22	2	2	NUM
ahs-3050	10	23	(	(	PUNCT
ahs-3050	10	24	bbwv-2	bbwv-2	NUM
ahs-3050	10	25	)	)	PUNCT
ahs-3050	10	26	]	]	PUNCT
ahs-3050	10	27	,	,	PUNCT
ahs-3050	10	28	potyviridae	potyviridae	NOUN
ahs-3050	10	29	[	[	X
ahs-3050	10	30	alstroemeria	alstroemeria	NOUN
ahs-3050	10	31	mosaic	mosaic	PROPN
ahs-3050	10	32	virus	virus	NOUN
ahs-3050	10	33	(	(	PUNCT
ahs-3050	10	34	almv	almv	NOUN
ahs-3050	10	35	)	)	PUNCT
ahs-3050	10	36	,	,	PUNCT
ahs-3050	10	37	bean	bean	NOUN
ahs-3050	10	38	yellow	yellow	ADJ
ahs-3050	10	39	mosaic	mosaic	PROPN
ahs-3050	10	40	virus	virus	NOUN
ahs-3050	10	41	(	(	PUNCT
ahs-3050	10	42	bymv	bymv	PROPN
ahs-3050	10	43	)	)	PUNCT
ahs-3050	10	44	,	,	PUNCT
ahs-3050	10	45	dasheen	dasheen	PROPN
ahs-3050	10	46	mosaic	mosaic	PROPN
ahs-3050	10	47	virus	virus	NOUN
ahs-3050	10	48	(	(	PUNCT
ahs-3050	10	49	dsmv	dsmv	NOUN
ahs-3050	10	50	)	)	PUNCT
ahs-3050	10	51	,	,	PUNCT
ahs-3050	10	52	konjac	konjac	PROPN
ahs-3050	10	53	mosaic	mosaic	PROPN
ahs-3050	10	54	virus	virus	NOUN
ahs-3050	10	55	(	(	PUNCT
ahs-3050	10	56	komv	komv	NOUN
ahs-3050	10	57	)	)	PUNCT
ahs-3050	10	58	,	,	PUNCT
ahs-3050	10	59	lily	lily	ADJ
ahs-3050	10	60	mottle	mottle	NOUN
ahs-3050	10	61	virus	virus	NOUN
ahs-3050	10	62	(	(	PUNCT
ahs-3050	10	63	lmov	lmov	ADJ
ahs-3050	10	64	)	)	PUNCT
ahs-3050	10	65	,	,	PUNCT
ahs-3050	10	66	turnip	turnip	NOUN
ahs-3050	10	67	mosaic	mosaic	PROPN
ahs-3050	10	68	virus	virus	NOUN
ahs-3050	10	69	(	(	PUNCT
ahs-3050	10	70	tumv	tumv	PROPN
ahs-3050	10	71	)	)	PUNCT
ahs-3050	10	72	,	,	PUNCT
ahs-3050	10	73	zantedeschia	zantedeschia	PROPN
ahs-3050	10	74	mosaic	mosaic	ADJ
ahs-3050	10	75	virus	virus	NOUN
ahs-3050	10	76	(	(	PUNCT
ahs-3050	10	77	zamv	zamv	NOUN
ahs-3050	10	78	)	)	PUNCT
ahs-3050	10	79	,	,	PUNCT
ahs-3050	10	80	zantedeschia	zantedeschia	PRON
ahs-3050	10	81	mild	mild	ADJ
ahs-3050	10	82	mosaic	mosaic	ADJ
ahs-3050	10	83	virus	virus	NOUN
ahs-3050	10	84	(	(	PUNCT
ahs-3050	10	85	zammv	zammv	PROPN
ahs-3050	10	86	)	)	PUNCT
ahs-3050	10	87	]	]	PUNCT
ahs-3050	10	88	,	,	PUNCT
ahs-3050	10	89	tombusviridae	tombusviridae	NOUN
ahs-3050	10	90	[	[	X
ahs-3050	10	91	carnation	carnation	NOUN
ahs-3050	10	92	mottle	mottle	NOUN
ahs-3050	10	93	virus	virus	NOUN
ahs-3050	10	94	(	(	PUNCT
ahs-3050	10	95	carnmv	carnmv	PROPN
ahs-3050	10	96	)	)	PUNCT
ahs-3050	10	97	]	]	PUNCT
ahs-3050	10	98	and	and	CCONJ
ahs-3050	10	99	unassigned	unassigned	ADJ
ahs-3050	10	100	[	[	PUNCT
ahs-3050	10	101	tobacco	tobacco	NOUN
ahs-3050	10	102	rattle	rattle	NOUN
ahs-3050	10	103	virus	virus	NOUN
ahs-3050	10	104	(	(	PUNCT
ahs-3050	10	105	trv	trv	PROPN
ahs-3050	10	106	)	)	PUNCT
ahs-3050	10	107	]	]	PUNCT
ahs-3050	10	108	.	.	PUNCT
ahs-3050	11	1	an	an	DET
ahs-3050	11	2	additional	additional	ADJ
ahs-3050	11	3	aim	aim	NOUN
ahs-3050	11	4	of	of	ADP
ahs-3050	11	5	this	this	DET
ahs-3050	11	6	survey	survey	NOUN
ahs-3050	11	7	was	be	AUX
ahs-3050	11	8	to	to	PART
ahs-3050	11	9	evidence	evidence	VERB
ahs-3050	11	10	new	new	ADJ
ahs-3050	11	11	viral	viral	ADJ
ahs-3050	11	12	records	record	NOUN
ahs-3050	11	13	in	in	ADP
ahs-3050	11	14	italy	italy	PROPN
ahs-3050	11	15	for	for	ADP
ahs-3050	11	16	these	these	DET
ahs-3050	11	17	widespread	widespread	ADJ
ahs-3050	11	18	cultivations	cultivation	NOUN
ahs-3050	11	19	,	,	PUNCT
ahs-3050	11	20	due	due	ADP
ahs-3050	11	21	to	to	ADP
ahs-3050	11	22	the	the	DET
ahs-3050	11	23	intense	intense	ADJ
ahs-3050	11	24	international	international	ADJ
ahs-3050	11	25	exchanges	exchange	NOUN
ahs-3050	11	26	that	that	PRON
ahs-3050	11	27	characterize	characterize	VERB
ahs-3050	11	28	the	the	DET
ahs-3050	11	29	commercialization	commercialization	NOUN
ahs-3050	11	30	of	of	ADP
ahs-3050	11	31	lily	lily	NOUN
ahs-3050	11	32	.	.	PUNCT
ahs-3050	12	1	2	2	X
ahs-3050	12	2	.	.	X
ahs-3050	12	3	materials	material	NOUN
ahs-3050	12	4	and	and	CCONJ
ahs-3050	12	5	methods	method	NOUN
ahs-3050	12	6	tests	test	NOUN
ahs-3050	12	7	were	be	AUX
ahs-3050	12	8	carried	carry	VERB
ahs-3050	12	9	out	out	ADP
ahs-3050	12	10	on	on	ADP
ahs-3050	12	11	90	90	NUM
ahs-3050	12	12	z.	z.	PROPN
ahs-3050	12	13	aethiopica	aethiopica	PROPN
ahs-3050	12	14	plants	plant	NOUN
ahs-3050	12	15	and	and	CCONJ
ahs-3050	12	16	48	48	NUM
ahs-3050	12	17	alstroemeria	alstroemeria	NOUN
ahs-3050	12	18	spp	spp	NOUN
ahs-3050	12	19	.	.	PUNCT
ahs-3050	13	1	plants	plant	NOUN
ahs-3050	13	2	collected	collect	VERB
ahs-3050	13	3	from	from	ADP
ahs-3050	13	4	12	12	NUM
ahs-3050	13	5	tuscan	tuscan	ADJ
ahs-3050	13	6	nurseries	nursery	NOUN
ahs-3050	13	7	in	in	ADP
ahs-3050	13	8	two	two	NUM
ahs-3050	13	9	years	year	NOUN
ahs-3050	13	10	.	.	PUNCT
ahs-3050	14	1	plants	plant	NOUN
ahs-3050	14	2	showed	show	VERB
ahs-3050	14	3	sympadv	sympadv	ADJ
ahs-3050	14	4	.	.	PUNCT
ahs-3050	15	1	hort	hort	PROPN
ahs-3050	15	2	.	.	PUNCT
ahs-3050	16	1	sci	sci	PROPN
ahs-3050	16	2	.	.	PROPN
ahs-3050	16	3	,	,	PUNCT
ahs-3050	16	4	2016	2016	NUM
ahs-3050	16	5	30(1	30(1	NUM
ahs-3050	16	6	):	):	PUNCT
ahs-3050	16	7	53	53	NUM
ahs-3050	16	8	-	-	SYM
ahs-3050	16	9	56	56	NUM
ahs-3050	16	10	doi	doi	NOUN
ahs-3050	16	11	:	:	PUNCT
ahs-3050	16	12	10.13128	10.13128	NUM
ahs-3050	16	13	/	/	SYM
ahs-3050	16	14	ahs-18702	ahs-18702	NOUN
ahs-3050	16	15	occurrence	occurrence	NOUN
ahs-3050	16	16	of	of	ADP
ahs-3050	16	17	viruses	virus	NOUN
ahs-3050	16	18	in	in	ADP
ahs-3050	16	19	calla	calla	NOUN
ahs-3050	16	20	and	and	CCONJ
ahs-3050	16	21	peruvian	peruvian	ADJ
ahs-3050	16	22	lily	lily	NOUN
ahs-3050	16	23	in	in	ADP
ahs-3050	16	24	tuscan	tuscan	ADJ
ahs-3050	16	25	nurseries	nursery	NOUN
ahs-3050	16	26	and	and	CCONJ
ahs-3050	16	27	evidence	evidence	NOUN
ahs-3050	16	28	of	of	ADP
ahs-3050	16	29	new	new	ADJ
ahs-3050	16	30	viral	viral	ADJ
ahs-3050	16	31	records	record	NOUN
ahs-3050	16	32	in	in	ADP
ahs-3050	16	33	italy	italy	PROPN
ahs-3050	16	34	a.	a.	PROPN
ahs-3050	16	35	luvisi	luvisi	VERB
ahs-3050	16	36	1,2	1,2	NUM
ahs-3050	16	37	(	(	PUNCT
ahs-3050	16	38	*	*	PROPN
ahs-3050	16	39	)	)	PUNCT
ahs-3050	16	40	,	,	PUNCT
ahs-3050	16	41	d.	d.	PROPN
ahs-3050	16	42	rizzo	rizzo	PROPN
ahs-3050	16	43	3	3	NUM
ahs-3050	16	44	,	,	PUNCT
ahs-3050	16	45	l.	l.	PROPN
ahs-3050	16	46	stefani	stefani	PROPN
ahs-3050	16	47	3	3	NUM
ahs-3050	16	48	,	,	PUNCT
ahs-3050	16	49	a.	a.	NOUN
ahs-3050	16	50	panattoni	panattoni	NOUN
ahs-3050	16	51	2	2	NUM
ahs-3050	16	52	,	,	PUNCT
ahs-3050	16	53	a.	a.	NOUN
ahs-3050	16	54	materazzi	materazzi	NOUN
ahs-3050	16	55	2	2	NUM
ahs-3050	16	56	1	1	NUM
ahs-3050	16	57	dipartimento	dipartimento	NOUN
ahs-3050	16	58	di	di	X
ahs-3050	16	59	scienze	scienze	PROPN
ahs-3050	16	60	e	e	PROPN
ahs-3050	16	61	tecnologie	tecnologie	X
ahs-3050	16	62	biologiche	biologiche	PROPN
ahs-3050	16	63	ed	ed	PROPN
ahs-3050	16	64	ambientali	ambientali	PROPN
ahs-3050	16	65	,	,	PUNCT
ahs-3050	16	66	centro	centro	PROPN
ahs-3050	16	67	ecotekne	ecotekne	VERB
ahs-3050	16	68	università	università	PROPN
ahs-3050	16	69	del	del	PROPN
ahs-3050	16	70	salento	salento	PROPN
ahs-3050	16	71	,	,	PUNCT
ahs-3050	16	72	via	via	ADP
ahs-3050	16	73	provinciale	provinciale	ADJ
ahs-3050	16	74	lecce	lecce	NOUN
ahs-3050	16	75	monteroni	monteroni	ADJ
ahs-3050	16	76	,	,	PUNCT
ahs-3050	16	77	73100	73100	NUM
ahs-3050	16	78	lecce	lecce	NOUN
ahs-3050	16	79	,	,	PUNCT
ahs-3050	16	80	italy	italy	PROPN
ahs-3050	16	81	.	.	PROPN
ahs-3050	17	1	2	2	NUM
ahs-3050	17	2	dipartimento	dipartimento	PROPN
ahs-3050	17	3	di	di	PROPN
ahs-3050	17	4	scienze	scienze	PROPN
ahs-3050	17	5	agrarie	agrarie	PROPN
ahs-3050	17	6	,	,	PUNCT
ahs-3050	17	7	alimentari	alimentari	X
ahs-3050	17	8	e	e	NOUN
ahs-3050	17	9	agro	agro	NOUN
ahs-3050	17	10	-	-	PUNCT
ahs-3050	17	11	ambientali	ambientali	PROPN
ahs-3050	17	12	,	,	PUNCT
ahs-3050	17	13	università	università	PROPN
ahs-3050	17	14	di	di	PROPN
ahs-3050	17	15	pisa	pisa	PROPN
ahs-3050	17	16	,	,	PUNCT
ahs-3050	17	17	via	via	ADP
ahs-3050	17	18	del	del	PROPN
ahs-3050	17	19	borghetto	borghetto	NOUN
ahs-3050	17	20	,	,	PUNCT
ahs-3050	17	21	80	80	NUM
ahs-3050	17	22	,	,	PUNCT
ahs-3050	17	23	56124	56124	NUM
ahs-3050	17	24	pisa	pisa	PROPN
ahs-3050	17	25	,	,	PUNCT
ahs-3050	17	26	italy	italy	PROPN
ahs-3050	17	27	.	.	PROPN
ahs-3050	17	28	3	3	NUM
ahs-3050	17	29	servizio	servizio	PROPN
ahs-3050	17	30	fitosanitario	fitosanitario	PROPN
ahs-3050	17	31	regionale	regionale	PROPN
ahs-3050	17	32	,	,	PUNCT
ahs-3050	17	33	regione	regione	PROPN
ahs-3050	17	34	toscana	toscana	PROPN
ahs-3050	17	35	,	,	PUNCT
ahs-3050	17	36	via	via	ADP
ahs-3050	17	37	ciliegiole	ciliegiole	NOUN
ahs-3050	17	38	,	,	PUNCT
ahs-3050	17	39	99	99	NUM
ahs-3050	17	40	,	,	PUNCT
ahs-3050	17	41	51100	51100	NUM
ahs-3050	17	42	pistoia	pistoia	PROPN
ahs-3050	17	43	,	,	PUNCT
ahs-3050	17	44	italy	italy	PROPN
ahs-3050	17	45	.	.	PUNCT
ahs-3050	18	1	key	key	ADJ
ahs-3050	18	2	words	word	NOUN
ahs-3050	18	3	:	:	PUNCT
ahs-3050	18	4	alstroemeria	alstroemeria	NOUN
ahs-3050	18	5	,	,	PUNCT
ahs-3050	18	6	rt	rt	NOUN
ahs-3050	18	7	-	-	PUNCT
ahs-3050	18	8	pcr	pcr	ADJ
ahs-3050	18	9	,	,	PUNCT
ahs-3050	18	10	zantedeschia	zantedeschia	ADJ
ahs-3050	18	11	.	.	PUNCT
ahs-3050	18	12	abstract	abstract	ADJ
ahs-3050	18	13	:	:	PUNCT
ahs-3050	18	14	in	in	ADP
ahs-3050	18	15	order	order	NOUN
ahs-3050	18	16	to	to	PART
ahs-3050	18	17	evaluate	evaluate	VERB
ahs-3050	18	18	the	the	DET
ahs-3050	18	19	health	health	NOUN
ahs-3050	18	20	status	status	NOUN
ahs-3050	18	21	of	of	ADP
ahs-3050	18	22	calla	calla	NOUN
ahs-3050	18	23	and	and	CCONJ
ahs-3050	18	24	peruvian	peruvian	ADJ
ahs-3050	18	25	lily	lily	NOUN
ahs-3050	18	26	in	in	ADP
ahs-3050	18	27	tuscan	tuscan	ADJ
ahs-3050	18	28	nurseries	nursery	NOUN
ahs-3050	18	29	,	,	PUNCT
ahs-3050	18	30	18	18	NUM
ahs-3050	18	31	viruses	virus	NOUN
ahs-3050	18	32	belonging	belong	VERB
ahs-3050	18	33	to	to	ADP
ahs-3050	18	34	six	six	NUM
ahs-3050	18	35	families	family	NOUN
ahs-3050	18	36	and	and	CCONJ
ahs-3050	18	37	one	one	NUM
ahs-3050	18	38	unassigned	unassigned	ADJ
ahs-3050	18	39	virus	virus	NOUN
ahs-3050	18	40	were	be	AUX
ahs-3050	18	41	assayed	assayed	ADJ
ahs-3050	18	42	.	.	PUNCT
ahs-3050	19	1	tests	test	NOUN
ahs-3050	19	2	were	be	AUX
ahs-3050	19	3	carried	carry	VERB
ahs-3050	19	4	out	out	ADP
ahs-3050	19	5	on	on	ADP
ahs-3050	19	6	90	90	NUM
ahs-3050	19	7	zantedeschia	zantedeschia	PROPN
ahs-3050	19	8	aethiopica	aethiopica	PROPN
ahs-3050	19	9	plants	plant	NOUN
ahs-3050	19	10	and	and	CCONJ
ahs-3050	19	11	48	48	NUM
ahs-3050	19	12	alstroemeria	alstroemeria	NOUN
ahs-3050	19	13	spp	spp	NOUN
ahs-3050	19	14	.	.	PUNCT
ahs-3050	20	1	plants	plant	NOUN
ahs-3050	20	2	collected	collect	VERB
ahs-3050	20	3	from	from	ADP
ahs-3050	20	4	12	12	NUM
ahs-3050	20	5	tuscan	tuscan	ADJ
ahs-3050	20	6	nurseries	nursery	NOUN
ahs-3050	20	7	in	in	ADP
ahs-3050	20	8	two	two	NUM
ahs-3050	20	9	years	year	NOUN
ahs-3050	20	10	,	,	PUNCT
ahs-3050	20	11	via	via	ADP
ahs-3050	20	12	rt	rt	ADJ
ahs-3050	20	13	-	-	PUNCT
ahs-3050	20	14	pcr	pcr	ADJ
ahs-3050	20	15	tests	test	NOUN
ahs-3050	20	16	.	.	PUNCT
ahs-3050	21	1	z.	z.	PROPN
ahs-3050	21	2	aethiopica	aethiopica	PROPN
ahs-3050	21	3	was	be	AUX
ahs-3050	21	4	mainly	mainly	ADV
ahs-3050	21	5	affected	affect	VERB
ahs-3050	21	6	by	by	ADP
ahs-3050	21	7	viruses	virus	NOUN
ahs-3050	21	8	belonging	belong	VERB
ahs-3050	21	9	to	to	ADP
ahs-3050	21	10	the	the	DET
ahs-3050	21	11	potyviridae	potyviridae	NOUN
ahs-3050	21	12	family	family	NOUN
ahs-3050	21	13	,	,	PUNCT
ahs-3050	21	14	with	with	ADP
ahs-3050	21	15	the	the	DET
ahs-3050	21	16	main	main	ADJ
ahs-3050	21	17	infection	infection	NOUN
ahs-3050	21	18	caused	cause	VERB
ahs-3050	21	19	by	by	ADP
ahs-3050	21	20	dasheen	dasheen	PROPN
ahs-3050	21	21	mosaic	mosaic	PROPN
ahs-3050	21	22	virus	virus	NOUN
ahs-3050	21	23	(	(	PUNCT
ahs-3050	21	24	dsmv	dsmv	NOUN
ahs-3050	21	25	)	)	PUNCT
ahs-3050	21	26	and	and	CCONJ
ahs-3050	21	27	zantedeschia	zantedeschia	ADV
ahs-3050	21	28	mild	mild	ADJ
ahs-3050	21	29	mosaic	mosaic	ADJ
ahs-3050	21	30	virus	virus	NOUN
ahs-3050	21	31	(	(	PUNCT
ahs-3050	21	32	zammv	zammv	PROPN
ahs-3050	21	33	)	)	PUNCT
ahs-3050	21	34	.	.	PUNCT
ahs-3050	22	1	even	even	ADV
ahs-3050	22	2	if	if	SCONJ
ahs-3050	22	3	alstroemeria	alstroemeria	NOUN
ahs-3050	22	4	spp	spp	NOUN
ahs-3050	22	5	.	.	PUNCT
ahs-3050	23	1	plants	plant	NOUN
ahs-3050	23	2	were	be	AUX
ahs-3050	23	3	affected	affect	VERB
ahs-3050	23	4	by	by	ADP
ahs-3050	23	5	potyviridae	potyviridae	NOUN
ahs-3050	23	6	family	family	NOUN
ahs-3050	23	7	viruses	virus	NOUN
ahs-3050	23	8	too	too	ADV
ahs-3050	23	9	,	,	PUNCT
ahs-3050	23	10	higher	high	ADJ
ahs-3050	23	11	infection	infection	NOUN
ahs-3050	23	12	rates	rate	NOUN
ahs-3050	23	13	were	be	AUX
ahs-3050	23	14	recorded	record	VERB
ahs-3050	23	15	for	for	ADP
ahs-3050	23	16	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	23	17	,	,	PUNCT
ahs-3050	23	18	where	where	SCONJ
ahs-3050	23	19	lily	lily	ADJ
ahs-3050	23	20	symptomless	symptomless	ADJ
ahs-3050	23	21	virus	virus	NOUN
ahs-3050	23	22	infected	infect	VERB
ahs-3050	23	23	more	more	ADJ
ahs-3050	23	24	than	than	ADP
ahs-3050	23	25	half	half	NOUN
ahs-3050	23	26	of	of	ADP
ahs-3050	23	27	plants	plant	NOUN
ahs-3050	23	28	.	.	PUNCT
ahs-3050	24	1	this	this	PRON
ahs-3050	24	2	is	be	AUX
ahs-3050	24	3	the	the	DET
ahs-3050	24	4	first	first	ADJ
ahs-3050	24	5	known	know	VERB
ahs-3050	24	6	report	report	NOUN
ahs-3050	24	7	of	of	ADP
ahs-3050	24	8	lily	lily	ADJ
ahs-3050	24	9	mottle	mottle	NOUN
ahs-3050	24	10	virus	virus	NOUN
ahs-3050	24	11	(	(	PUNCT
ahs-3050	24	12	lmov	lmov	ADJ
ahs-3050	24	13	)	)	PUNCT
ahs-3050	24	14	in	in	ADP
ahs-3050	24	15	alstroemeria	alstroemeria	NOUN
ahs-3050	24	16	spp	spp	NOUN
ahs-3050	24	17	.	.	PUNCT
ahs-3050	25	1	and	and	CCONJ
ahs-3050	25	2	z.	z.	PROPN
ahs-3050	25	3	aethiopica	aethiopica	PROPN
ahs-3050	25	4	or	or	CCONJ
ahs-3050	25	5	zammv	zammv	PROPN
ahs-3050	25	6	in	in	ADP
ahs-3050	25	7	alstroemeria	alstroemeria	NOUN
ahs-3050	25	8	spp	spp	NOUN
ahs-3050	25	9	.	.	PUNCT
ahs-3050	26	1	in	in	ADP
ahs-3050	26	2	italy	italy	PROPN
ahs-3050	26	3	.	.	PUNCT
ahs-3050	27	1	(	(	PUNCT
ahs-3050	27	2	*	*	NOUN
ahs-3050	27	3	)	)	PUNCT
ahs-3050	27	4	corresponding	corresponding	ADJ
ahs-3050	27	5	author	author	NOUN
ahs-3050	27	6	:	:	PUNCT
ahs-3050	27	7	andrea.luvisi@unisalento.it	andrea.luvisi@unisalento.it	NOUN
ahs-3050	27	8	received	receive	VERB
ahs-3050	27	9	for	for	ADP
ahs-3050	27	10	publication	publication	NOUN
ahs-3050	27	11	24	24	NUM
ahs-3050	27	12	november	november	PROPN
ahs-3050	27	13	2015	2015	NUM
ahs-3050	27	14	accepted	accept	VERB
ahs-3050	27	15	for	for	ADP
ahs-3050	27	16	publication	publication	NOUN
ahs-3050	27	17	22	22	NUM
ahs-3050	27	18	february	february	PROPN
ahs-3050	27	19	2016	2016	NUM
ahs-3050	27	20	copyright	copyright	NOUN
ahs-3050	27	21	:	:	PUNCT
ahs-3050	27	22	©	©	PROPN
ahs-3050	27	23	2016	2016	NUM
ahs-3050	27	24	author(s	author(s	NOUN
ahs-3050	27	25	)	)	PUNCT
ahs-3050	27	26	.	.	PUNCT
ahs-3050	28	1	this	this	PRON
ahs-3050	28	2	is	be	AUX
ahs-3050	28	3	an	an	DET
ahs-3050	28	4	open	open	ADJ
ahs-3050	28	5	access	access	NOUN
ahs-3050	28	6	article	article	NOUN
ahs-3050	28	7	distributed	distribute	VERB
ahs-3050	28	8	under	under	ADP
ahs-3050	28	9	the	the	DET
ahs-3050	28	10	terms	term	NOUN
ahs-3050	28	11	of	of	ADP
ahs-3050	28	12	the	the	DET
ahs-3050	28	13	creative	creative	ADJ
ahs-3050	28	14	commons	common	NOUN
ahs-3050	28	15	attribution	attribution	NOUN
ahs-3050	28	16	license	license	NOUN
ahs-3050	28	17	(	(	PUNCT
ahs-3050	28	18	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-3050	28	19	)	)	PUNCT
ahs-3050	28	20	,	,	PUNCT
ahs-3050	28	21	which	which	PRON
ahs-3050	28	22	permits	permit	VERB
ahs-3050	28	23	unrestricted	unrestricted	ADJ
ahs-3050	28	24	use	use	NOUN
ahs-3050	28	25	,	,	PUNCT
ahs-3050	28	26	distribution	distribution	NOUN
ahs-3050	28	27	,	,	PUNCT
ahs-3050	28	28	and	and	CCONJ
ahs-3050	28	29	reproduction	reproduction	NOUN
ahs-3050	28	30	in	in	ADP
ahs-3050	28	31	any	any	DET
ahs-3050	28	32	medium	medium	NOUN
ahs-3050	28	33	,	,	PUNCT
ahs-3050	28	34	provided	provide	VERB
ahs-3050	28	35	the	the	DET
ahs-3050	28	36	original	original	ADJ
ahs-3050	28	37	author	author	NOUN
ahs-3050	28	38	and	and	CCONJ
ahs-3050	28	39	source	source	NOUN
ahs-3050	28	40	are	be	AUX
ahs-3050	28	41	credited	credit	VERB
ahs-3050	28	42	.	.	PUNCT
ahs-3050	29	1	adv	adv	PROPN
ahs-3050	29	2	.	.	PUNCT
ahs-3050	29	3	hort	hort	PROPN
ahs-3050	29	4	.	.	PUNCT
ahs-3050	30	1	sci	sci	PROPN
ahs-3050	30	2	.	.	PROPN
ahs-3050	30	3	,	,	PUNCT
ahs-3050	30	4	2016	2016	NUM
ahs-3050	30	5	30(1	30(1	NUM
ahs-3050	30	6	):	):	PUNCT
ahs-3050	30	7	53	53	NUM
ahs-3050	30	8	-	-	SYM
ahs-3050	30	9	56	56	NUM
ahs-3050	30	10	54	54	NUM
ahs-3050	30	11	toms	tom	NOUN
ahs-3050	30	12	such	such	ADJ
ahs-3050	30	13	as	as	ADP
ahs-3050	30	14	foliar	foliar	ADJ
ahs-3050	30	15	chlorosis	chlorosis	NOUN
ahs-3050	30	16	,	,	PUNCT
ahs-3050	30	17	yellow	yellow	ADJ
ahs-3050	30	18	spot	spot	NOUN
ahs-3050	30	19	and	and	CCONJ
ahs-3050	30	20	stripes	stripe	NOUN
ahs-3050	30	21	.	.	PUNCT
ahs-3050	31	1	total	total	ADJ
ahs-3050	31	2	rna	rna	PROPN
ahs-3050	31	3	was	be	AUX
ahs-3050	31	4	extracted	extract	VERB
ahs-3050	31	5	from	from	ADP
ahs-3050	31	6	foliar	foliar	ADJ
ahs-3050	31	7	tissue	tissue	NOUN
ahs-3050	31	8	(	(	PUNCT
ahs-3050	31	9	2	2	NUM
ahs-3050	31	10	g	g	NOUN
ahs-3050	31	11	)	)	PUNCT
ahs-3050	31	12	using	use	VERB
ahs-3050	31	13	rneasy	rneasy	NOUN
ahs-3050	31	14	plant	plant	NOUN
ahs-3050	31	15	mini	mini	NOUN
ahs-3050	31	16	kit	kit	NOUN
ahs-3050	31	17	(	(	PUNCT
ahs-3050	31	18	qiagen	qiagen	PROPN
ahs-3050	31	19	,	,	PUNCT
ahs-3050	31	20	netherlands	netherlands	PROPN
ahs-3050	31	21	)	)	PUNCT
ahs-3050	31	22	protocol	protocol	NOUN
ahs-3050	31	23	,	,	PUNCT
ahs-3050	31	24	modified	modify	VERB
ahs-3050	31	25	according	accord	VERB
ahs-3050	31	26	to	to	ADP
ahs-3050	31	27	mackenzie	mackenzie	PROPN
ahs-3050	31	28	et	et	PROPN
ahs-3050	31	29	al	al	PROPN
ahs-3050	31	30	.	.	PROPN
ahs-3050	32	1	(	(	PUNCT
ahs-3050	32	2	1997	1997	NUM
ahs-3050	32	3	)	)	PUNCT
ahs-3050	32	4	.	.	PUNCT
ahs-3050	33	1	tissues	tissue	NOUN
ahs-3050	33	2	(	(	PUNCT
ahs-3050	33	3	2	2	NUM
ahs-3050	33	4	g	g	NOUN
ahs-3050	33	5	)	)	PUNCT
ahs-3050	33	6	were	be	AUX
ahs-3050	33	7	ground	grind	VERB
ahs-3050	33	8	using	use	VERB
ahs-3050	33	9	a	a	DET
ahs-3050	33	10	tissue	tissue	NOUN
ahs-3050	33	11	lyser	lyser	NOUN
ahs-3050	33	12	(	(	PUNCT
ahs-3050	33	13	qiagen	qiagen	PROPN
ahs-3050	33	14	)	)	PUNCT
ahs-3050	33	15	adding	add	VERB
ahs-3050	33	16	5	5	NUM
ahs-3050	33	17	ml	ml	NOUN
ahs-3050	33	18	of	of	ADP
ahs-3050	33	19	grinding	grind	VERB
ahs-3050	33	20	buffer	buffer	NOUN
ahs-3050	33	21	(	(	PUNCT
ahs-3050	33	22	4.0	4.0	NUM
ahs-3050	33	23	m	m	NOUN
ahs-3050	33	24	guanidine	guanidine	NOUN
ahs-3050	33	25	isothiocyanate	isothiocyanate	NOUN
ahs-3050	33	26	,	,	PUNCT
ahs-3050	33	27	0.2	0.2	NUM
ahs-3050	33	28	m	m	NUM
ahs-3050	33	29	sodium	sodium	NOUN
ahs-3050	33	30	acetate	acetate	NOUN
ahs-3050	33	31	ph	ph	ADJ
ahs-3050	33	32	5.0	5.0	NUM
ahs-3050	33	33	,	,	PUNCT
ahs-3050	33	34	25	25	NUM
ahs-3050	33	35	mm	mm	NUM
ahs-3050	33	36	edta	edta	NOUN
ahs-3050	33	37	,	,	PUNCT
ahs-3050	33	38	2.5	2.5	NUM
ahs-3050	33	39	%	%	NOUN
ahs-3050	33	40	pvp-40	pvp-40	NOUN
ahs-3050	33	41	and	and	CCONJ
ahs-3050	33	42	2.0	2.0	NUM
ahs-3050	33	43	%	%	NOUN
ahs-3050	33	44	sodium	sodium	NOUN
ahs-3050	33	45	bisulfate	bisulfate	NOUN
ahs-3050	33	46	)	)	PUNCT
ahs-3050	33	47	just	just	ADV
ahs-3050	33	48	before	before	ADP
ahs-3050	33	49	use	use	NOUN
ahs-3050	33	50	.	.	PUNCT
ahs-3050	34	1	the	the	DET
ahs-3050	34	2	homogenate	homogenate	NOUN
ahs-3050	34	3	(	(	PUNCT
ahs-3050	34	4	1	1	NUM
ahs-3050	34	5	ml	ml	NOUN
ahs-3050	34	6	)	)	PUNCT
ahs-3050	34	7	was	be	AUX
ahs-3050	34	8	transferred	transfer	VERB
ahs-3050	34	9	to	to	ADP
ahs-3050	34	10	a	a	DET
ahs-3050	34	11	1.5	1.5	NUM
ahs-3050	34	12	ml	ml	NOUN
ahs-3050	34	13	tube	tube	NOUN
ahs-3050	34	14	and	and	CCONJ
ahs-3050	34	15	100	100	NUM
ahs-3050	34	16	μl	μl	ADP
ahs-3050	34	17	of	of	ADP
ahs-3050	34	18	20	20	NUM
ahs-3050	34	19	%	%	NOUN
ahs-3050	34	20	sarkosyl	sarkosyl	NOUN
ahs-3050	34	21	were	be	AUX
ahs-3050	34	22	added	add	VERB
ahs-3050	34	23	.	.	PUNCT
ahs-3050	35	1	after	after	ADP
ahs-3050	35	2	2	2	NUM
ahs-3050	35	3	min	min	NOUN
ahs-3050	35	4	centrifugation	centrifugation	NOUN
ahs-3050	35	5	,	,	PUNCT
ahs-3050	35	6	600	600	NUM
ahs-3050	35	7	μl	μl	ADV
ahs-3050	35	8	were	be	AUX
ahs-3050	35	9	transferred	transfer	VERB
ahs-3050	35	10	to	to	ADP
ahs-3050	35	11	a	a	DET
ahs-3050	35	12	qiashredder	qiashredder	ADJ
ahs-3050	35	13	spin	spin	NOUN
ahs-3050	35	14	column	column	NOUN
ahs-3050	35	15	(	(	PUNCT
ahs-3050	35	16	qiagen	qiagen	PROPN
ahs-3050	35	17	)	)	PUNCT
ahs-3050	35	18	placed	place	VERB
ahs-3050	35	19	in	in	ADP
ahs-3050	35	20	a	a	DET
ahs-3050	35	21	2	2	NUM
ahs-3050	35	22	ml	ml	NOUN
ahs-3050	35	23	collection	collection	NOUN
ahs-3050	35	24	tube	tube	NOUN
ahs-3050	35	25	.	.	PUNCT
ahs-3050	36	1	the	the	DET
ahs-3050	36	2	subsequent	subsequent	ADJ
ahs-3050	36	3	steps	step	NOUN
ahs-3050	36	4	of	of	ADP
ahs-3050	36	5	rna	rna	NOUN
ahs-3050	36	6	extraction	extraction	NOUN
ahs-3050	36	7	were	be	AUX
ahs-3050	36	8	according	accord	VERB
ahs-3050	36	9	to	to	ADP
ahs-3050	36	10	the	the	DET
ahs-3050	36	11	manufacturer	manufacturer	NOUN
ahs-3050	36	12	’s	’s	PART
ahs-3050	36	13	protocol	protocol	NOUN
ahs-3050	36	14	.	.	PUNCT
ahs-3050	37	1	the	the	DET
ahs-3050	37	2	extracted	extract	VERB
ahs-3050	37	3	rna	rna	NOUN
ahs-3050	37	4	was	be	AUX
ahs-3050	37	5	then	then	ADV
ahs-3050	37	6	retro	retro	VERB
ahs-3050	37	7	-	-	PUNCT
ahs-3050	37	8	transcribed	transcribe	VERB
ahs-3050	37	9	into	into	ADP
ahs-3050	37	10	cdna	cdna	PROPN
ahs-3050	37	11	using	use	VERB
ahs-3050	37	12	the	the	DET
ahs-3050	37	13	iscript	iscript	ADJ
ahs-3050	37	14	cdna	cdna	PROPN
ahs-3050	37	15	synthesis	synthesis	NOUN
ahs-3050	37	16	kit	kit	NOUN
ahs-3050	37	17	(	(	PUNCT
ahs-3050	37	18	biorad	biorad	NOUN
ahs-3050	37	19	,	,	PUNCT
ahs-3050	37	20	usa	usa	PROPN
ahs-3050	37	21	)	)	PUNCT
ahs-3050	37	22	.	.	PUNCT
ahs-3050	38	1	for	for	ADP
ahs-3050	38	2	each	each	DET
ahs-3050	38	3	sample	sample	NOUN
ahs-3050	38	4	,	,	PUNCT
ahs-3050	38	5	2	2	NUM
ahs-3050	38	6	µl	µl	NOUN
ahs-3050	38	7	of	of	ADP
ahs-3050	38	8	cdna	cdna	PROPN
ahs-3050	38	9	were	be	AUX
ahs-3050	38	10	amplified	amplify	VERB
ahs-3050	38	11	in	in	ADP
ahs-3050	38	12	a	a	DET
ahs-3050	38	13	total	total	ADJ
ahs-3050	38	14	volume	volume	NOUN
ahs-3050	38	15	of	of	ADP
ahs-3050	38	16	20	20	NUM
ahs-3050	38	17	μl	μl	ADV
ahs-3050	38	18	containing	contain	VERB
ahs-3050	38	19	1x	1x	NUM
ahs-3050	38	20	hotmaster	hotmaster	NOUN
ahs-3050	38	21	buffer	buffer	NOUN
ahs-3050	38	22	,	,	PUNCT
ahs-3050	38	23	0.5	0.5	NUM
ahs-3050	38	24	μg	μg	PROPN
ahs-3050	38	25	/	/	SYM
ahs-3050	38	26	μl	μl	NUM
ahs-3050	38	27	bsa	bsa	PROPN
ahs-3050	38	28	and	and	CCONJ
ahs-3050	38	29	1	1	NUM
ahs-3050	38	30	u	u	NOUN
ahs-3050	38	31	of	of	ADP
ahs-3050	38	32	hotmaster	hotmaster	PROPN
ahs-3050	38	33	taq	taq	PROPN
ahs-3050	38	34	dna	dna	PROPN
ahs-3050	38	35	polymerase	polymerase	NOUN
ahs-3050	38	36	(	(	PUNCT
ahs-3050	38	37	eppendorf	eppendorf	PROPN
ahs-3050	38	38	,	,	PUNCT
ahs-3050	38	39	germany	germany	PROPN
ahs-3050	38	40	)	)	PUNCT
ahs-3050	38	41	.	.	PUNCT
ahs-3050	39	1	primers	primer	NOUN
ahs-3050	39	2	and	and	CCONJ
ahs-3050	39	3	rt	rt	ADJ
ahs-3050	39	4	-	-	PUNCT
ahs-3050	39	5	pcr	pcr	ADJ
ahs-3050	39	6	parameters	parameter	NOUN
ahs-3050	39	7	were	be	AUX
ahs-3050	39	8	chosen	choose	VERB
ahs-3050	39	9	following	follow	VERB
ahs-3050	39	10	the	the	DET
ahs-3050	39	11	protocols	protocol	NOUN
ahs-3050	39	12	reported	report	VERB
ahs-3050	39	13	in	in	ADP
ahs-3050	39	14	table	table	NOUN
ahs-3050	39	15	1	1	NUM
ahs-3050	39	16	.	.	X
ahs-3050	39	17	18s	18	NOUN
ahs-3050	39	18	rrna	rrna	PROPN
ahs-3050	39	19	was	be	AUX
ahs-3050	39	20	used	use	VERB
ahs-3050	39	21	as	as	ADP
ahs-3050	39	22	internal	internal	ADJ
ahs-3050	39	23	control	control	NOUN
ahs-3050	39	24	(	(	PUNCT
ahs-3050	39	25	osman	osman	NOUN
ahs-3050	39	26	and	and	CCONJ
ahs-3050	39	27	rowhani	rowhani	PROPN
ahs-3050	39	28	,	,	PUNCT
ahs-3050	39	29	2006	2006	NUM
ahs-3050	39	30	)	)	PUNCT
ahs-3050	39	31	.	.	PUNCT
ahs-3050	40	1	finally	finally	ADV
ahs-3050	40	2	,	,	PUNCT
ahs-3050	40	3	10	10	NUM
ahs-3050	40	4	μl	μl	ADP
ahs-3050	40	5	of	of	ADP
ahs-3050	40	6	the	the	DET
ahs-3050	40	7	amplification	amplification	NOUN
ahs-3050	40	8	mix	mix	NOUN
ahs-3050	40	9	was	be	AUX
ahs-3050	40	10	electrophoresed	electrophorese	VERB
ahs-3050	40	11	in	in	ADP
ahs-3050	40	12	a	a	DET
ahs-3050	40	13	1.5	1.5	NUM
ahs-3050	40	14	%	%	NOUN
ahs-3050	40	15	agarose	agarose	NOUN
ahs-3050	40	16	gel	gel	NOUN
ahs-3050	40	17	in	in	ADP
ahs-3050	40	18	tae	tae	NOUN
ahs-3050	40	19	buffer	buffer	NOUN
ahs-3050	40	20	[	[	PUNCT
ahs-3050	40	21	40	40	NUM
ahs-3050	40	22	mm	mm	NOUN
ahs-3050	40	23	tris	tris	NOUN
ahs-3050	40	24	base	base	NOUN
ahs-3050	40	25	,	,	PUNCT
ahs-3050	40	26	20	20	NUM
ahs-3050	40	27	mm	mm	NUM
ahs-3050	40	28	sodium	sodium	NOUN
ahs-3050	40	29	acetate	acetate	NOUN
ahs-3050	40	30	,	,	PUNCT
ahs-3050	40	31	1	1	NUM
ahs-3050	40	32	mm	mm	NOUN
ahs-3050	40	33	edta	edta	NOUN
ahs-3050	40	34	ph	ph	X
ahs-3050	40	35	(	(	PUNCT
ahs-3050	40	36	8.0	8.0	NUM
ahs-3050	40	37	)	)	PUNCT
ahs-3050	40	38	]	]	PUNCT
ahs-3050	40	39	.	.	PUNCT
ahs-3050	41	1	the	the	DET
ahs-3050	41	2	amplified	amplify	VERB
ahs-3050	41	3	cdna	cdna	PROPN
ahs-3050	41	4	fragments	fragment	NOUN
ahs-3050	41	5	were	be	AUX
ahs-3050	41	6	visualized	visualize	VERB
ahs-3050	41	7	on	on	ADP
ahs-3050	41	8	a	a	DET
ahs-3050	41	9	uv	uv	NOUN
ahs-3050	41	10	transilluminator	transilluminator	NOUN
ahs-3050	41	11	.	.	PUNCT
ahs-3050	42	1	data	datum	NOUN
ahs-3050	42	2	were	be	AUX
ahs-3050	42	3	analyzed	analyze	VERB
ahs-3050	42	4	using	use	VERB
ahs-3050	42	5	sigma	sigma	ADJ
ahs-3050	42	6	-	-	PUNCT
ahs-3050	42	7	plot	plot	NOUN
ahs-3050	42	8	software	software	NOUN
ahs-3050	42	9	(	(	PUNCT
ahs-3050	42	10	version	version	NOUN
ahs-3050	42	11	11	11	NUM
ahs-3050	42	12	;	;	PUNCT
ahs-3050	42	13	systat	systat	PROPN
ahs-3050	42	14	software	software	PROPN
ahs-3050	42	15	,	,	PUNCT
ahs-3050	42	16	san	san	PROPN
ahs-3050	42	17	jose	jose	PROPN
ahs-3050	42	18	,	,	PUNCT
ahs-3050	42	19	ca	ca	NOUN
ahs-3050	42	20	)	)	PUNCT
ahs-3050	42	21	.	.	PUNCT
ahs-3050	43	1	the	the	DET
ahs-3050	43	2	software	software	NOUN
ahs-3050	43	3	was	be	AUX
ahs-3050	43	4	used	use	VERB
ahs-3050	43	5	to	to	PART
ahs-3050	43	6	perform	perform	VERB
ahs-3050	43	7	analysis	analysis	NOUN
ahs-3050	43	8	of	of	ADP
ahs-3050	43	9	variance	variance	NOUN
ahs-3050	43	10	(	(	PUNCT
ahs-3050	43	11	anova	anova	PROPN
ahs-3050	43	12	)	)	PUNCT
ahs-3050	43	13	.	.	PUNCT
ahs-3050	44	1	data	datum	NOUN
ahs-3050	44	2	expressed	express	VERB
ahs-3050	44	3	in	in	ADP
ahs-3050	44	4	percent	percent	NOUN
ahs-3050	44	5	were	be	AUX
ahs-3050	44	6	converted	convert	VERB
ahs-3050	44	7	to	to	ADP
ahs-3050	44	8	arcsin	arcsin	PROPN
ahs-3050	44	9	values	value	NOUN
ahs-3050	44	10	.	.	PUNCT
ahs-3050	45	1	p	p	X
ahs-3050	45	2	<	<	X
ahs-3050	45	3	0.05	0.05	NUM
ahs-3050	45	4	was	be	AUX
ahs-3050	45	5	considered	consider	VERB
ahs-3050	45	6	to	to	PART
ahs-3050	45	7	be	be	AUX
ahs-3050	45	8	significant	significant	ADJ
ahs-3050	45	9	.	.	PUNCT
ahs-3050	46	1	3	3	X
ahs-3050	46	2	.	.	X
ahs-3050	46	3	results	result	VERB
ahs-3050	46	4	the	the	DET
ahs-3050	46	5	health	health	NOUN
ahs-3050	46	6	status	status	NOUN
ahs-3050	46	7	of	of	ADP
ahs-3050	46	8	calla	calla	NOUN
ahs-3050	46	9	and	and	CCONJ
ahs-3050	46	10	peruvian	peruvian	ADJ
ahs-3050	46	11	lily	lily	NOUN
ahs-3050	46	12	as	as	SCONJ
ahs-3050	46	13	determined	determine	VERB
ahs-3050	46	14	by	by	ADP
ahs-3050	46	15	the	the	DET
ahs-3050	46	16	present	present	ADJ
ahs-3050	46	17	survey	survey	NOUN
ahs-3050	46	18	is	be	AUX
ahs-3050	46	19	reported	report	VERB
ahs-3050	46	20	in	in	ADP
ahs-3050	46	21	table	table	NOUN
ahs-3050	46	22	2	2	NUM
ahs-3050	46	23	.	.	PUNCT
ahs-3050	46	24	z.	z.	PROPN
ahs-3050	46	25	aethiopica	aethiopica	PROPN
ahs-3050	46	26	was	be	AUX
ahs-3050	46	27	mainly	mainly	ADV
ahs-3050	46	28	affected	affect	VERB
ahs-3050	46	29	by	by	ADP
ahs-3050	46	30	viruses	virus	NOUN
ahs-3050	46	31	belonging	belong	VERB
ahs-3050	46	32	to	to	ADP
ahs-3050	46	33	the	the	DET
ahs-3050	46	34	potyviridae	potyviridae	NOUN
ahs-3050	46	35	family	family	NOUN
ahs-3050	46	36	.	.	PUNCT
ahs-3050	47	1	more	more	ADJ
ahs-3050	47	2	than	than	ADP
ahs-3050	47	3	two	two	NUM
ahs-3050	47	4	plants	plant	NOUN
ahs-3050	47	5	out	out	ADP
ahs-3050	47	6	of	of	ADP
ahs-3050	47	7	three	three	NUM
ahs-3050	47	8	were	be	AUX
ahs-3050	47	9	infected	infect	VERB
ahs-3050	47	10	by	by	ADP
ahs-3050	47	11	dsmv	dsmv	NOUN
ahs-3050	47	12	and	and	CCONJ
ahs-3050	47	13	50	50	NUM
ahs-3050	47	14	%	%	NOUN
ahs-3050	47	15	table	table	NOUN
ahs-3050	47	16	1	1	NUM
ahs-3050	47	17	list	list	NOUN
ahs-3050	47	18	of	of	ADP
ahs-3050	47	19	references	reference	NOUN
ahs-3050	47	20	for	for	ADP
ahs-3050	47	21	primers	primer	NOUN
ahs-3050	47	22	and	and	CCONJ
ahs-3050	47	23	rt	rt	ADJ
ahs-3050	47	24	-	-	PUNCT
ahs-3050	47	25	pcr	pcr	NOUN
ahs-3050	47	26	conditions	condition	NOUN
ahs-3050	47	27	target	target	VERB
ahs-3050	47	28	rt	rt	ADJ
ahs-3050	47	29	-	-	PUNCT
ahs-3050	47	30	pcr	pcr	NOUN
ahs-3050	47	31	assay	assay	NOUN
ahs-3050	47	32	comoviridae	comoviridae	NOUN
ahs-3050	47	33	armv	armv	NOUN
ahs-3050	47	34	faggioli	faggioli	NOUN
ahs-3050	47	35	et	et	PROPN
ahs-3050	47	36	al	al	PROPN
ahs-3050	47	37	.	.	PROPN
ahs-3050	47	38	,	,	PUNCT
ahs-3050	47	39	2005	2005	NUM
ahs-3050	47	40	bbwv-1	bbwv-1	PROPN
ahs-3050	47	41	ferrer	ferrer	PROPN
ahs-3050	47	42	et	et	PROPN
ahs-3050	47	43	al	al	PROPN
ahs-3050	47	44	.	.	PROPN
ahs-3050	47	45	,	,	PUNCT
ahs-3050	47	46	2008	2008	NUM
ahs-3050	47	47	bbwv-2	bbwv-2	NUM
ahs-3050	48	1	ferrer	ferrer	PROPN
ahs-3050	48	2	et	et	PROPN
ahs-3050	48	3	al	al	PROPN
ahs-3050	48	4	.	.	PROPN
ahs-3050	48	5	,	,	PUNCT
ahs-3050	48	6	2008	2008	NUM
ahs-3050	48	7	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	48	8	alcv	alcv	PROPN
ahs-3050	48	9	spence	spence	PROPN
ahs-3050	48	10	et	et	PROPN
ahs-3050	48	11	al	al	PROPN
ahs-3050	48	12	.	.	PROPN
ahs-3050	48	13	,	,	PUNCT
ahs-3050	48	14	2000	2000	NUM
ahs-3050	48	15	lsv	lsv	PROPN
ahs-3050	48	16	lim	lim	PROPN
ahs-3050	48	17	et	et	PROPN
ahs-3050	48	18	al	al	PROPN
ahs-3050	48	19	.	.	PROPN
ahs-3050	48	20	,	,	PUNCT
ahs-3050	48	21	2009	2009	NUM
ahs-3050	48	22	bromoviridae	bromoviridae	NOUN
ahs-3050	48	23	cmv	cmv	PROPN
ahs-3050	48	24	faggioli	faggioli	PROPN
ahs-3050	48	25	et	et	PROPN
ahs-3050	48	26	al	al	PROPN
ahs-3050	48	27	.	.	PROPN
ahs-3050	48	28	,	,	PUNCT
ahs-3050	48	29	2005	2005	NUM
ahs-3050	48	30	bunyaviridae	bunyaviridae	NOUN
ahs-3050	48	31	iysv	iysv	ADJ
ahs-3050	48	32	kritzman	kritzman	NOUN
ahs-3050	48	33	et	et	PROPN
ahs-3050	48	34	al	al	PROPN
ahs-3050	48	35	.	.	PROPN
ahs-3050	48	36	,	,	PUNCT
ahs-3050	48	37	2000	2000	NUM
ahs-3050	48	38	insv	insv	PROPN
ahs-3050	48	39	liu	liu	PROPN
ahs-3050	48	40	et	et	PROPN
ahs-3050	48	41	al	al	PROPN
ahs-3050	48	42	.	.	PROPN
ahs-3050	48	43	,	,	PUNCT
ahs-3050	48	44	2009	2009	NUM
ahs-3050	48	45	tswv	tswv	NOUN
ahs-3050	48	46	mumford	mumford	NOUN
ahs-3050	48	47	et	et	PROPN
ahs-3050	48	48	al	al	PROPN
ahs-3050	48	49	.	.	PROPN
ahs-3050	48	50	,	,	PUNCT
ahs-3050	48	51	1994	1994	NUM
ahs-3050	48	52	potyviridae	potyviridae	NOUN
ahs-3050	48	53	almv	almv	PROPN
ahs-3050	48	54	spence	spence	PROPN
ahs-3050	48	55	et	et	PROPN
ahs-3050	48	56	al	al	PROPN
ahs-3050	48	57	.	.	PROPN
ahs-3050	48	58	,	,	PUNCT
ahs-3050	48	59	2000	2000	NUM
ahs-3050	48	60	bymv	bymv	VERB
ahs-3050	48	61	ganesh	ganesh	NOUN
ahs-3050	48	62	selvaraj	selvaraj	VERB
ahs-3050	48	63	et	et	PROPN
ahs-3050	48	64	al	al	PROPN
ahs-3050	48	65	.	.	PROPN
ahs-3050	48	66	,	,	PUNCT
ahs-3050	48	67	2009	2009	NUM
ahs-3050	48	68	dsmv	dsmv	NOUN
ahs-3050	49	1	wen	wen	NOUN
ahs-3050	49	2	-	-	PROPN
ahs-3050	49	3	chi	chi	ADJ
ahs-3050	49	4	et	et	PROPN
ahs-3050	49	5	al	al	PROPN
ahs-3050	49	6	.	.	PROPN
ahs-3050	49	7	,	,	PUNCT
ahs-3050	49	8	2010	2010	NUM
ahs-3050	49	9	komv	komv	ADJ
ahs-3050	49	10	wen	wen	PROPN
ahs-3050	49	11	-	-	PROPN
ahs-3050	49	12	chi	chi	PROPN
ahs-3050	49	13	et	et	PROPN
ahs-3050	49	14	al	al	PROPN
ahs-3050	49	15	.	.	PROPN
ahs-3050	49	16	,	,	PUNCT
ahs-3050	49	17	2010	2010	NUM
ahs-3050	49	18	lmov	lmov	ADJ
ahs-3050	49	19	lim	lim	PROPN
ahs-3050	49	20	et	et	PROPN
ahs-3050	49	21	al	al	PROPN
ahs-3050	49	22	.	.	PROPN
ahs-3050	49	23	,	,	PUNCT
ahs-3050	49	24	2009	2009	NUM
ahs-3050	49	25	tumv	tumv	VERB
ahs-3050	49	26	wen	wen	PROPN
ahs-3050	49	27	-	-	PROPN
ahs-3050	49	28	chi	chi	PROPN
ahs-3050	49	29	et	et	PROPN
ahs-3050	49	30	al	al	PROPN
ahs-3050	49	31	.	.	PROPN
ahs-3050	49	32	,	,	PUNCT
ahs-3050	49	33	2010	2010	NUM
ahs-3050	49	34	zamv	zamv	NOUN
ahs-3050	49	35	kwon	kwon	VERB
ahs-3050	49	36	et	et	PROPN
ahs-3050	49	37	al	al	PROPN
ahs-3050	49	38	.	.	PROPN
ahs-3050	49	39	,	,	PUNCT
ahs-3050	49	40	2003	2003	NUM
ahs-3050	49	41	zammv	zammv	X
ahs-3050	49	42	wen	wen	PROPN
ahs-3050	49	43	-	-	PROPN
ahs-3050	49	44	chi	chi	PROPN
ahs-3050	49	45	et	et	PROPN
ahs-3050	49	46	al	al	PROPN
ahs-3050	49	47	.	.	PROPN
ahs-3050	49	48	,	,	PUNCT
ahs-3050	49	49	2010	2010	NUM
ahs-3050	49	50	tombusviridae	tombusviridae	NOUN
ahs-3050	49	51	carnmv	carnmv	PROPN
ahs-3050	49	52	cevik	cevik	PROPN
ahs-3050	49	53	et	et	PROPN
ahs-3050	49	54	al	al	PROPN
ahs-3050	49	55	.	.	PROPN
ahs-3050	49	56	,	,	PUNCT
ahs-3050	49	57	2010	2010	NUM
ahs-3050	49	58	unassigned	unassigne	VERB
ahs-3050	49	59	trv	trv	PROPN
ahs-3050	49	60	wei	wei	PROPN
ahs-3050	49	61	et	et	PROPN
ahs-3050	49	62	al	al	PROPN
ahs-3050	49	63	.	.	PROPN
ahs-3050	49	64	,	,	PUNCT
ahs-3050	49	65	2009	2009	NUM
ahs-3050	49	66	table	table	NOUN
ahs-3050	49	67	2	2	NUM
ahs-3050	49	68	health	health	NOUN
ahs-3050	49	69	status	status	NOUN
ahs-3050	49	70	of	of	ADP
ahs-3050	49	71	calla	calla	NOUN
ahs-3050	49	72	lily	lily	NOUN
ahs-3050	49	73	(	(	PUNCT
ahs-3050	49	74	zantedeschia	zantedeschia	NOUN
ahs-3050	49	75	aethiopica	aethiopica	PROPN
ahs-3050	49	76	)	)	PUNCT
ahs-3050	49	77	and	and	CCONJ
ahs-3050	49	78	peruvian	peruvian	ADJ
ahs-3050	49	79	lily	lily	NOUN
ahs-3050	49	80	(	(	PUNCT
ahs-3050	49	81	alstroemeria	alstroemeria	NOUN
ahs-3050	49	82	spp	spp	NOUN
ahs-3050	49	83	.	.	PUNCT
ahs-3050	49	84	)	)	PUNCT
ahs-3050	49	85	expressed	express	VERB
ahs-3050	49	86	as	as	ADP
ahs-3050	49	87	percentage	percentage	NOUN
ahs-3050	49	88	of	of	ADP
ahs-3050	49	89	infected	infected	ADJ
ahs-3050	49	90	plants	plant	NOUN
ahs-3050	49	91	target	target	VERB
ahs-3050	49	92	zantedeschia	zantedeschia	PROPN
ahs-3050	49	93	aethiopica	aethiopica	PROPN
ahs-3050	49	94	alstroemeria	alstroemeria	NOUN
ahs-3050	49	95	spp	spp	PROPN
ahs-3050	49	96	.	.	PUNCT
ahs-3050	50	1	comoviridae	comoviridae	PROPN
ahs-3050	50	2	armv	armv	NOUN
ahs-3050	50	3	bbwv-1	bbwv-1	PROPN
ahs-3050	50	4	bbwv-2	bbwv-2	NUM
ahs-3050	50	5	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	50	6	alcv	alcv	NOUN
ahs-3050	50	7	lsv	lsv	PROPN
ahs-3050	50	8	56.3	56.3	NUM
ahs-3050	50	9	a	a	DET
ahs-3050	50	10	bromoviridae	bromoviridae	NOUN
ahs-3050	50	11	cmv	cmv	NOUN
ahs-3050	50	12	12.5	12.5	NUM
ahs-3050	50	13	b	b	NOUN
ahs-3050	50	14	bunyaviridae	bunyaviridae	NOUN
ahs-3050	50	15	iysv	iysv	NOUN
ahs-3050	50	16	insv	insv	VERB
ahs-3050	50	17	3.3	3.3	NUM
ahs-3050	50	18	c	c	NOUN
ahs-3050	50	19	*	*	PUNCT
ahs-3050	50	20	tswv	tswv	PROPN
ahs-3050	50	21	3.3	3.3	NUM
ahs-3050	50	22	c	c	NOUN
ahs-3050	50	23	potyviridae	potyviridae	NOUN
ahs-3050	50	24	almv	almv	NOUN
ahs-3050	50	25	dsmv	dsmv	ADV
ahs-3050	50	26	66.7	66.7	NUM
ahs-3050	50	27	a	a	DET
ahs-3050	50	28	13.5	13.5	NUM
ahs-3050	50	29	b	b	NOUN
ahs-3050	50	30	komv	komv	ADJ
ahs-3050	50	31	lmov	lmov	ADJ
ahs-3050	50	32	16.7	16.7	NUM
ahs-3050	50	33	b	b	SYM
ahs-3050	50	34	12.5	12.5	NUM
ahs-3050	50	35	b	b	NOUN
ahs-3050	50	36	tumv	tumv	NOUN
ahs-3050	50	37	zammv	zammv	X
ahs-3050	50	38	50.0	50.0	NUM
ahs-3050	50	39	a	a	DET
ahs-3050	50	40	6.3	6.3	NUM
ahs-3050	50	41	c	c	NOUN
ahs-3050	50	42	tombusviridae	tombusviridae	NOUN
ahs-3050	50	43	carnmv	carnmv	NOUN
ahs-3050	50	44	unassigned	unassigned	ADJ
ahs-3050	50	45	trv	trv	PROPN
ahs-3050	50	46	*	*	PUNCT
ahs-3050	50	47	values	value	NOUN
ahs-3050	50	48	in	in	ADP
ahs-3050	50	49	the	the	DET
ahs-3050	50	50	same	same	ADJ
ahs-3050	50	51	column	column	NOUN
ahs-3050	50	52	followed	follow	VERB
ahs-3050	50	53	by	by	ADP
ahs-3050	50	54	the	the	DET
ahs-3050	50	55	same	same	ADJ
ahs-3050	50	56	letter	letter	NOUN
ahs-3050	50	57	do	do	AUX
ahs-3050	50	58	not	not	PART
ahs-3050	50	59	differ	differ	VERB
ahs-3050	50	60	significantly	significantly	ADV
ahs-3050	50	61	according	accord	VERB
ahs-3050	50	62	to	to	ADP
ahs-3050	50	63	duncan	duncan	PROPN
ahs-3050	50	64	’s	’s	PART
ahs-3050	50	65	multiple	multiple	ADJ
ahs-3050	50	66	range	range	NOUN
ahs-3050	50	67	test	test	NOUN
ahs-3050	50	68	(	(	PUNCT
ahs-3050	50	69	p=0.05	p=0.05	NOUN
ahs-3050	50	70	)	)	PUNCT
ahs-3050	50	71	.	.	PUNCT
ahs-3050	51	1	luvisi	luvisi	VERB
ahs-3050	51	2	et	et	PROPN
ahs-3050	51	3	al	al	PROPN
ahs-3050	51	4	.	.	PROPN
ahs-3050	51	5	occurrence	occurrence	NOUN
ahs-3050	51	6	of	of	ADP
ahs-3050	51	7	viruses	virus	NOUN
ahs-3050	51	8	in	in	ADP
ahs-3050	51	9	calla	calla	NOUN
ahs-3050	51	10	and	and	CCONJ
ahs-3050	51	11	peruvian	peruvian	ADJ
ahs-3050	51	12	lily	lily	NOUN
ahs-3050	51	13	in	in	ADP
ahs-3050	51	14	tuscan	tuscan	ADJ
ahs-3050	51	15	nurseries	nursery	NOUN
ahs-3050	51	16	55	55	NUM
ahs-3050	51	17	of	of	ADP
ahs-3050	51	18	tested	test	VERB
ahs-3050	51	19	plants	plant	NOUN
ahs-3050	51	20	were	be	AUX
ahs-3050	51	21	infected	infect	VERB
ahs-3050	51	22	by	by	ADP
ahs-3050	51	23	zammv	zammv	PROPN
ahs-3050	51	24	.	.	PUNCT
ahs-3050	52	1	lower	low	ADJ
ahs-3050	52	2	infection	infection	NOUN
ahs-3050	52	3	rates	rate	NOUN
ahs-3050	52	4	were	be	AUX
ahs-3050	52	5	reported	report	VERB
ahs-3050	52	6	for	for	ADP
ahs-3050	52	7	viruses	virus	NOUN
ahs-3050	52	8	belonging	belong	VERB
ahs-3050	52	9	to	to	ADP
ahs-3050	52	10	bunyaviridae	bunyaviridae	NOUN
ahs-3050	52	11	.	.	PUNCT
ahs-3050	53	1	even	even	ADV
ahs-3050	53	2	if	if	SCONJ
ahs-3050	53	3	alstroemeria	alstroemeria	NOUN
ahs-3050	53	4	spp	spp	NOUN
ahs-3050	53	5	.	.	PUNCT
ahs-3050	54	1	plants	plant	NOUN
ahs-3050	54	2	were	be	AUX
ahs-3050	54	3	affected	affect	VERB
ahs-3050	54	4	by	by	ADP
ahs-3050	54	5	potyviridae	potyviridae	NOUN
ahs-3050	54	6	viruses	virus	NOUN
ahs-3050	54	7	too	too	ADV
ahs-3050	54	8	,	,	PUNCT
ahs-3050	54	9	higher	high	ADJ
ahs-3050	54	10	infection	infection	NOUN
ahs-3050	54	11	rates	rate	NOUN
ahs-3050	54	12	were	be	AUX
ahs-3050	54	13	recorded	record	VERB
ahs-3050	54	14	for	for	ADP
ahs-3050	54	15	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	54	16	,	,	PUNCT
ahs-3050	54	17	where	where	SCONJ
ahs-3050	54	18	lsv	lsv	NOUN
ahs-3050	54	19	infected	infect	VERB
ahs-3050	54	20	more	more	ADJ
ahs-3050	54	21	than	than	ADP
ahs-3050	54	22	half	half	NOUN
ahs-3050	54	23	of	of	ADP
ahs-3050	54	24	plants	plant	NOUN
ahs-3050	54	25	.	.	PUNCT
ahs-3050	55	1	further	further	ADJ
ahs-3050	55	2	infections	infection	NOUN
ahs-3050	55	3	were	be	AUX
ahs-3050	55	4	caused	cause	VERB
ahs-3050	55	5	by	by	ADP
ahs-3050	55	6	bromoviridae	bromoviridae	NOUN
ahs-3050	55	7	viruses	virus	NOUN
ahs-3050	55	8	.	.	PUNCT
ahs-3050	56	1	comoviridae	comoviridae	NOUN
ahs-3050	56	2	,	,	PUNCT
ahs-3050	56	3	tombusviridae	tombusviridae	NOUN
ahs-3050	56	4	or	or	CCONJ
ahs-3050	56	5	trv	trv	PROPN
ahs-3050	56	6	infections	infection	NOUN
ahs-3050	56	7	were	be	AUX
ahs-3050	56	8	not	not	PART
ahs-3050	56	9	found	find	VERB
ahs-3050	56	10	in	in	ADP
ahs-3050	56	11	both	both	DET
ahs-3050	56	12	plants	plant	NOUN
ahs-3050	56	13	.	.	PUNCT
ahs-3050	57	1	in	in	ADP
ahs-3050	57	2	z.	z.	PROPN
ahs-3050	57	3	aethiopica	aethiopica	PROPN
ahs-3050	57	4	,	,	PUNCT
ahs-3050	57	5	mixed	mixed	ADJ
ahs-3050	57	6	infections	infection	NOUN
ahs-3050	57	7	were	be	AUX
ahs-3050	57	8	set	set	VERB
ahs-3050	57	9	at	at	ADP
ahs-3050	57	10	40	40	NUM
ahs-3050	57	11	%	%	NOUN
ahs-3050	57	12	for	for	ADP
ahs-3050	57	13	dsmv	dsmv	NOUN
ahs-3050	57	14	/	/	SYM
ahs-3050	57	15	zammv	zammv	NOUN
ahs-3050	57	16	,	,	PUNCT
ahs-3050	57	17	6.7	6.7	NUM
ahs-3050	57	18	%	%	NOUN
ahs-3050	57	19	for	for	ADP
ahs-3050	57	20	dsmv	dsmv	ADV
ahs-3050	57	21	/	/	SYM
ahs-3050	57	22	lmov	lmov	ADJ
ahs-3050	57	23	/	/	SYM
ahs-3050	57	24	zammv	zammv	NOUN
ahs-3050	57	25	and	and	CCONJ
ahs-3050	57	26	3.3	3.3	NUM
ahs-3050	57	27	%	%	NOUN
ahs-3050	57	28	for	for	ADP
ahs-3050	57	29	dsmv	dsmv	NOUN
ahs-3050	57	30	/	/	SYM
ahs-3050	57	31	lmov(data	lmov(data	PROPN
ahs-3050	57	32	not	not	PART
ahs-3050	57	33	shown	show	VERB
ahs-3050	57	34	)	)	PUNCT
ahs-3050	57	35	.	.	PUNCT
ahs-3050	58	1	in	in	ADP
ahs-3050	58	2	alstroemeria	alstroemeria	NOUN
ahs-3050	58	3	spp	spp	PROPN
ahs-3050	58	4	.	.	PROPN
ahs-3050	58	5	,	,	PUNCT
ahs-3050	58	6	mixed	mixed	ADJ
ahs-3050	58	7	infections	infection	NOUN
ahs-3050	58	8	were	be	AUX
ahs-3050	58	9	set	set	VERB
ahs-3050	58	10	at	at	ADP
ahs-3050	58	11	6.3	6.3	NUM
ahs-3050	58	12	%	%	NOUN
ahs-3050	58	13	for	for	ADP
ahs-3050	58	14	lsv	lsv	PROPN
ahs-3050	58	15	/	/	SYM
ahs-3050	58	16	zammv	zammv	PROPN
ahs-3050	58	17	,	,	PUNCT
ahs-3050	58	18	lsv	lsv	NOUN
ahs-3050	58	19	/	/	SYM
ahs-3050	58	20	lmov	lmov	ADJ
ahs-3050	58	21	,	,	PUNCT
ahs-3050	58	22	dsmv	dsmv	ADJ
ahs-3050	58	23	/	/	SYM
ahs-3050	58	24	zammv	zammv	PROPN
ahs-3050	58	25	,	,	PUNCT
ahs-3050	58	26	cmv	cmv	PROPN
ahs-3050	58	27	/	/	SYM
ahs-3050	58	28	lsv	lsv	PROPN
ahs-3050	58	29	or	or	CCONJ
ahs-3050	58	30	cmv	cmv	NOUN
ahs-3050	58	31	/	/	SYM
ahs-3050	58	32	dsmv	dsmv	ADJ
ahs-3050	58	33	/	/	SYM
ahs-3050	58	34	lsv	lsv	NOUN
ahs-3050	58	35	.	.	PUNCT
ahs-3050	59	1	with	with	ADP
ahs-3050	59	2	regard	regard	NOUN
ahs-3050	59	3	to	to	ADP
ahs-3050	59	4	alstroemeria	alstroemeria	NOUN
ahs-3050	59	5	spp	spp	NOUN
ahs-3050	59	6	.	.	PROPN
ahs-3050	59	7	,	,	PUNCT
ahs-3050	59	8	the	the	DET
ahs-3050	59	9	sequence	sequence	NOUN
ahs-3050	59	10	obtained	obtain	VERB
ahs-3050	59	11	from	from	ADP
ahs-3050	59	12	a	a	DET
ahs-3050	59	13	zammv	zammv	ADJ
ahs-3050	59	14	amplicon	amplicon	NOUN
ahs-3050	59	15	(	(	PUNCT
ahs-3050	59	16	genbank	genbank	NOUN
ahs-3050	59	17	accession	accession	NOUN
ahs-3050	59	18	no	no	INTJ
ahs-3050	59	19	.	.	PUNCT
ahs-3050	60	1	kf156666	kf156666	PROPN
ahs-3050	60	2	(	(	PUNCT
ahs-3050	60	3	table	table	NOUN
ahs-3050	60	4	3	3	NUM
ahs-3050	60	5	)	)	PUNCT
ahs-3050	60	6	had	have	VERB
ahs-3050	60	7	99	99	NUM
ahs-3050	60	8	%	%	NOUN
ahs-3050	60	9	nucleotide	nucleotide	NOUN
ahs-3050	60	10	identity	identity	NOUN
ahs-3050	60	11	with	with	ADP
ahs-3050	60	12	the	the	DET
ahs-3050	60	13	corresponding	correspond	VERB
ahs-3050	60	14	fragment	fragment	NOUN
ahs-3050	60	15	of	of	ADP
ahs-3050	60	16	a	a	DET
ahs-3050	60	17	reference	reference	NOUN
ahs-3050	60	18	zammv	zammv	NOUN
ahs-3050	60	19	isolate	isolate	NOUN
ahs-3050	60	20	(	(	PUNCT
ahs-3050	60	21	genbank	genbank	NOUN
ahs-3050	60	22	accession	accession	NOUN
ahs-3050	60	23	no	no	INTJ
ahs-3050	60	24	.	.	PUNCT
ahs-3050	61	1	ay626825	ay626825	PROPN
ahs-3050	61	2	)	)	PUNCT
ahs-3050	61	3	.	.	PUNCT
ahs-3050	62	1	further	further	ADJ
ahs-3050	62	2	isolates	isolate	NOUN
ahs-3050	62	3	of	of	ADP
ahs-3050	62	4	lmov	lmov	ADJ
ahs-3050	62	5	were	be	AUX
ahs-3050	62	6	detected	detect	VERB
ahs-3050	62	7	(	(	PUNCT
ahs-3050	62	8	genbank	genbank	PROPN
ahs-3050	62	9	accessions	accession	NOUN
ahs-3050	62	10	no	no	PROPN
ahs-3050	62	11	.	.	PUNCT
ahs-3050	63	1	kf156667	kf156667	NOUN
ahs-3050	63	2	,	,	PUNCT
ahs-3050	63	3	kf156668	kf156668	PROPN
ahs-3050	63	4	,	,	PUNCT
ahs-3050	63	5	kf156669	kf156669	PROPN
ahs-3050	63	6	)	)	PUNCT
ahs-3050	63	7	.	.	PUNCT
ahs-3050	64	1	each	each	DET
ahs-3050	64	2	further	further	ADJ
ahs-3050	64	3	isolate	isolate	NOUN
ahs-3050	64	4	had	have	VERB
ahs-3050	64	5	99	99	NUM
ahs-3050	64	6	%	%	NOUN
ahs-3050	64	7	nucleotide	nucleotide	NOUN
ahs-3050	64	8	identity	identity	NOUN
ahs-3050	64	9	with	with	ADP
ahs-3050	64	10	the	the	DET
ahs-3050	64	11	corresponding	correspond	VERB
ahs-3050	64	12	fragment	fragment	NOUN
ahs-3050	64	13	of	of	ADP
ahs-3050	64	14	a	a	DET
ahs-3050	64	15	reference	reference	NOUN
ahs-3050	64	16	zammv	zammv	NOUN
ahs-3050	64	17	isolate	isolate	NOUN
ahs-3050	64	18	.	.	PUNCT
ahs-3050	65	1	all	all	DET
ahs-3050	65	2	four	four	NUM
ahs-3050	65	3	isolates	isolate	NOUN
ahs-3050	65	4	are	be	AUX
ahs-3050	65	5	different	different	ADJ
ahs-3050	65	6	but	but	CCONJ
ahs-3050	65	7	had	have	VERB
ahs-3050	65	8	99	99	NUM
ahs-3050	65	9	%	%	NOUN
ahs-3050	65	10	nucleotide	nucleotide	NOUN
ahs-3050	65	11	identity	identity	NOUN
ahs-3050	65	12	.	.	PUNCT
ahs-3050	66	1	the	the	DET
ahs-3050	66	2	sequence	sequence	NOUN
ahs-3050	66	3	obtained	obtain	VERB
ahs-3050	66	4	from	from	ADP
ahs-3050	66	5	lmov	lmov	ADJ
ahs-3050	66	6	amplicon	amplicon	NOUN
ahs-3050	66	7	(	(	PUNCT
ahs-3050	66	8	genbank	genbank	NOUN
ahs-3050	66	9	accession	accession	NOUN
ahs-3050	66	10	no	no	INTJ
ahs-3050	66	11	.	.	PUNCT
ahs-3050	66	12	kf156662	kf156662	PROPN
ahs-3050	66	13	)	)	PUNCT
ahs-3050	66	14	(	(	PUNCT
ahs-3050	66	15	table	table	NOUN
ahs-3050	66	16	3	3	NUM
ahs-3050	66	17	)	)	PUNCT
ahs-3050	66	18	had	have	VERB
ahs-3050	66	19	94	94	NUM
ahs-3050	66	20	%	%	NOUN
ahs-3050	66	21	nucleotide	nucleotide	NOUN
ahs-3050	66	22	identity	identity	NOUN
ahs-3050	66	23	with	with	ADP
ahs-3050	66	24	the	the	DET
ahs-3050	66	25	corresponding	correspond	VERB
ahs-3050	66	26	fragment	fragment	NOUN
ahs-3050	66	27	of	of	ADP
ahs-3050	66	28	a	a	DET
ahs-3050	66	29	reference	reference	NOUN
ahs-3050	66	30	lmov	lmov	VERB
ahs-3050	66	31	isolate	isolate	NOUN
ahs-3050	66	32	(	(	PUNCT
ahs-3050	66	33	genbank	genbank	NOUN
ahs-3050	66	34	accession	accession	NOUN
ahs-3050	66	35	no	no	INTJ
ahs-3050	66	36	.	.	PUNCT
ahs-3050	67	1	jn703466	jn703466	PROPN
ahs-3050	67	2	)	)	PUNCT
ahs-3050	67	3	.	.	PUNCT
ahs-3050	68	1	the	the	DET
ahs-3050	68	2	same	same	ADJ
ahs-3050	68	3	lmov	lmov	ADJ
ahs-3050	68	4	amplicon	amplicon	NOUN
ahs-3050	68	5	was	be	AUX
ahs-3050	68	6	obtained	obtain	VERB
ahs-3050	68	7	from	from	ADP
ahs-3050	68	8	a	a	DET
ahs-3050	68	9	z.	z.	PROPN
ahs-3050	68	10	aethiopica	aethiopica	PROPN
ahs-3050	68	11	sample	sample	NOUN
ahs-3050	68	12	as	as	ADV
ahs-3050	68	13	well	well	ADV
ahs-3050	68	14	.	.	PUNCT
ahs-3050	69	1	further	further	ADJ
ahs-3050	69	2	isolates	isolate	NOUN
ahs-3050	69	3	of	of	ADP
ahs-3050	69	4	lmov	lmov	ADJ
ahs-3050	69	5	were	be	AUX
ahs-3050	69	6	detected	detect	VERB
ahs-3050	69	7	in	in	ADP
ahs-3050	69	8	both	both	DET
ahs-3050	69	9	species	specie	NOUN
ahs-3050	69	10	with	with	ADP
ahs-3050	69	11	100	100	NUM
ahs-3050	69	12	%	%	NOUN
ahs-3050	69	13	nucleotide	nucleotide	NOUN
ahs-3050	69	14	identity	identity	NOUN
ahs-3050	69	15	with	with	ADP
ahs-3050	69	16	kf156662	kf156662	PROPN
ahs-3050	69	17	(	(	PUNCT
ahs-3050	69	18	genbank	genbank	PROPN
ahs-3050	69	19	accessions	accessions	PROPN
ahs-3050	69	20	no	no	INTJ
ahs-3050	69	21	.	.	PUNCT
ahs-3050	70	1	kf156663	kf156663	PROPN
ahs-3050	70	2	,	,	PUNCT
ahs-3050	70	3	kf156664	kf156664	PROPN
ahs-3050	70	4	,	,	PUNCT
ahs-3050	70	5	kf156665	kf156665	PROPN
ahs-3050	70	6	)	)	PUNCT
ahs-3050	70	7	.	.	PUNCT
ahs-3050	71	1	4	4	X
ahs-3050	71	2	.	.	X
ahs-3050	71	3	conclusions	conclusion	NOUN
ahs-3050	71	4	various	various	ADJ
ahs-3050	71	5	viral	viral	ADJ
ahs-3050	71	6	infections	infection	NOUN
ahs-3050	71	7	,	,	PUNCT
ahs-3050	71	8	mainly	mainly	ADV
ahs-3050	71	9	due	due	ADP
ahs-3050	71	10	to	to	ADP
ahs-3050	71	11	viruses	virus	NOUN
ahs-3050	71	12	belonging	belong	VERB
ahs-3050	71	13	to	to	ADP
ahs-3050	71	14	two	two	NUM
ahs-3050	71	15	families	family	NOUN
ahs-3050	71	16	,	,	PUNCT
ahs-3050	71	17	betaflexiviridae	betaflexiviridae	NOUN
ahs-3050	71	18	and	and	CCONJ
ahs-3050	71	19	potyviridae	potyviridae	NOUN
ahs-3050	71	20	,	,	PUNCT
ahs-3050	71	21	seem	seem	VERB
ahs-3050	71	22	to	to	PART
ahs-3050	71	23	affect	affect	VERB
ahs-3050	71	24	calla	calla	NOUN
ahs-3050	71	25	and	and	CCONJ
ahs-3050	71	26	peruvian	peruvian	ADJ
ahs-3050	71	27	lily	lily	NOUN
ahs-3050	71	28	in	in	ADP
ahs-3050	71	29	tuscan	tuscan	ADJ
ahs-3050	71	30	nurseries	nursery	NOUN
ahs-3050	71	31	.	.	PUNCT
ahs-3050	72	1	most	most	ADV
ahs-3050	72	2	detected	detect	VERB
ahs-3050	72	3	viruses	virus	NOUN
ahs-3050	72	4	are	be	AUX
ahs-3050	72	5	frequently	frequently	ADV
ahs-3050	72	6	reported	report	VERB
ahs-3050	72	7	for	for	ADP
ahs-3050	72	8	both	both	CCONJ
ahs-3050	72	9	plants	plant	NOUN
ahs-3050	72	10	and	and	CCONJ
ahs-3050	72	11	mixed	mixed	ADJ
ahs-3050	72	12	infection	infection	NOUN
ahs-3050	72	13	of	of	ADP
ahs-3050	72	14	virus	virus	NOUN
ahs-3050	72	15	belonging	belong	VERB
ahs-3050	72	16	to	to	ADP
ahs-3050	72	17	potyviridae	potyviridae	NOUN
ahs-3050	72	18	are	be	AUX
ahs-3050	72	19	quite	quite	ADV
ahs-3050	72	20	common	common	ADJ
ahs-3050	72	21	in	in	ADP
ahs-3050	72	22	z.	z.	PROPN
ahs-3050	72	23	aethiopica	aethiopica	PROPN
ahs-3050	72	24	(	(	PUNCT
ahs-3050	72	25	huang	huang	PROPN
ahs-3050	72	26	et	et	PROPN
ahs-3050	72	27	al	al	PROPN
ahs-3050	72	28	.	.	PROPN
ahs-3050	72	29	,	,	PUNCT
ahs-3050	72	30	2007	2007	NUM
ahs-3050	72	31	)	)	PUNCT
ahs-3050	72	32	.	.	PUNCT
ahs-3050	73	1	however	however	ADV
ahs-3050	73	2	,	,	PUNCT
ahs-3050	73	3	some	some	DET
ahs-3050	73	4	evidence	evidence	NOUN
ahs-3050	73	5	is	be	AUX
ahs-3050	73	6	rarer	rare	ADJ
ahs-3050	73	7	.	.	PUNCT
ahs-3050	74	1	to	to	ADP
ahs-3050	74	2	our	our	PRON
ahs-3050	74	3	knowledge	knowledge	NOUN
ahs-3050	74	4	this	this	PRON
ahs-3050	74	5	is	be	AUX
ahs-3050	74	6	the	the	DET
ahs-3050	74	7	first	first	ADJ
ahs-3050	74	8	report	report	NOUN
ahs-3050	74	9	of	of	ADP
ahs-3050	74	10	lmov	lmov	ADJ
ahs-3050	74	11	in	in	ADP
ahs-3050	74	12	alstroemeria	alstroemeria	NOUN
ahs-3050	74	13	spp	spp	NOUN
ahs-3050	74	14	.	.	PUNCT
ahs-3050	75	1	and	and	CCONJ
ahs-3050	75	2	z.	z.	PROPN
ahs-3050	75	3	aethiopica	aethiopica	PROPN
ahs-3050	75	4	or	or	CCONJ
ahs-3050	75	5	zammv	zammv	PROPN
ahs-3050	75	6	in	in	ADP
ahs-3050	75	7	alstroemeria	alstroemeria	NOUN
ahs-3050	75	8	spp	spp	NOUN
ahs-3050	75	9	.	.	PUNCT
ahs-3050	76	1	in	in	ADP
ahs-3050	76	2	italy	italy	PROPN
ahs-3050	76	3	,	,	PUNCT
ahs-3050	76	4	while	while	SCONJ
ahs-3050	76	5	zammv	zammv	NOUN
ahs-3050	76	6	was	be	AUX
ahs-3050	76	7	recently	recently	ADV
ahs-3050	76	8	identified	identify	VERB
ahs-3050	76	9	in	in	ADP
ahs-3050	76	10	taiwan	taiwan	PROPN
ahs-3050	76	11	(	(	PUNCT
ahs-3050	76	12	huang	huang	PROPN
ahs-3050	76	13	and	and	CCONJ
ahs-3050	76	14	chang	chang	PROPN
ahs-3050	76	15	,	,	PUNCT
ahs-3050	76	16	2005	2005	NUM
ahs-3050	76	17	)	)	PUNCT
ahs-3050	76	18	and	and	CCONJ
ahs-3050	76	19	in	in	ADP
ahs-3050	76	20	italy	italy	PROPN
ahs-3050	76	21	(	(	PUNCT
ahs-3050	76	22	rizzo	rizzo	PROPN
ahs-3050	76	23	et	et	PROPN
ahs-3050	76	24	al	al	PROPN
ahs-3050	76	25	.	.	PROPN
ahs-3050	76	26	,	,	PUNCT
ahs-3050	76	27	2015	2015	NUM
ahs-3050	76	28	b	b	NOUN
ahs-3050	76	29	)	)	PUNCT
ahs-3050	76	30	.	.	PUNCT
ahs-3050	77	1	this	this	DET
ahs-3050	77	2	report	report	NOUN
ahs-3050	77	3	puts	put	VERB
ahs-3050	77	4	in	in	ADP
ahs-3050	77	5	evidence	evidence	NOUN
ahs-3050	77	6	how	how	SCONJ
ahs-3050	77	7	widespread	widespread	ADJ
ahs-3050	77	8	the	the	DET
ahs-3050	77	9	virus	virus	NOUN
ahs-3050	77	10	is	be	AUX
ahs-3050	77	11	within	within	ADP
ahs-3050	77	12	these	these	DET
ahs-3050	77	13	common	common	ADJ
ahs-3050	77	14	plants	plant	NOUN
ahs-3050	77	15	and	and	CCONJ
ahs-3050	77	16	the	the	DET
ahs-3050	77	17	need	need	NOUN
ahs-3050	77	18	for	for	ADP
ahs-3050	77	19	constant	constant	ADJ
ahs-3050	77	20	monitoring	monitoring	NOUN
ahs-3050	77	21	of	of	ADP
ahs-3050	77	22	the	the	DET
ahs-3050	77	23	health	health	NOUN
ahs-3050	77	24	status	status	NOUN
ahs-3050	77	25	for	for	ADP
ahs-3050	77	26	flower	flower	NOUN
ahs-3050	77	27	production	production	NOUN
ahs-3050	77	28	.	.	PUNCT
ahs-3050	78	1	even	even	ADV
ahs-3050	78	2	if	if	SCONJ
ahs-3050	78	3	some	some	PRON
ahs-3050	78	4	of	of	ADP
ahs-3050	78	5	viruses	virus	NOUN
ahs-3050	78	6	that	that	PRON
ahs-3050	78	7	affect	affect	VERB
ahs-3050	78	8	calla	calla	NOUN
ahs-3050	78	9	and	and	CCONJ
ahs-3050	78	10	peruvian	peruvian	ADJ
ahs-3050	78	11	lily	lily	NOUN
ahs-3050	78	12	may	may	AUX
ahs-3050	78	13	be	be	AUX
ahs-3050	78	14	eradicated	eradicate	VERB
ahs-3050	78	15	by	by	ADP
ahs-3050	78	16	thermotherapy	thermotherapy	NOUN
ahs-3050	78	17	(	(	PUNCT
ahs-3050	78	18	panattoni	panattoni	NOUN
ahs-3050	78	19	et	et	PROPN
ahs-3050	78	20	al	al	PROPN
ahs-3050	78	21	.	.	PROPN
ahs-3050	78	22	,	,	PUNCT
ahs-3050	78	23	2013	2013	NUM
ahs-3050	78	24	)	)	PUNCT
ahs-3050	78	25	and	and	CCONJ
ahs-3050	78	26	heat	heat	NOUN
ahs-3050	78	27	treatment	treatment	NOUN
ahs-3050	78	28	may	may	AUX
ahs-3050	78	29	help	help	VERB
ahs-3050	78	30	in	in	ADP
ahs-3050	78	31	bromoviridae	bromoviridae	ADJ
ahs-3050	78	32	control	control	NOUN
ahs-3050	78	33	(	(	PUNCT
ahs-3050	78	34	luvisi	luvisi	VERB
ahs-3050	78	35	et	et	PROPN
ahs-3050	78	36	al	al	PROPN
ahs-3050	78	37	.	.	PROPN
ahs-3050	78	38	,	,	PUNCT
ahs-3050	78	39	2015	2015	NUM
ahs-3050	78	40	)	)	PUNCT
ahs-3050	78	41	,	,	PUNCT
ahs-3050	78	42	prevention	prevention	NOUN
ahs-3050	78	43	represents	represent	VERB
ahs-3050	78	44	the	the	DET
ahs-3050	78	45	preferred	preferred	ADJ
ahs-3050	78	46	method	method	NOUN
ahs-3050	78	47	of	of	ADP
ahs-3050	78	48	virus	virus	NOUN
ahs-3050	78	49	control	control	NOUN
ahs-3050	78	50	.	.	PUNCT
ahs-3050	79	1	references	reference	NOUN
ahs-3050	79	2	cevik	cevik	PROPN
ahs-3050	79	3	b.	b.	PROPN
ahs-3050	79	4	,	,	PUNCT
ahs-3050	79	5	bakir	bakir	PROPN
ahs-3050	79	6	t.	t.	PROPN
ahs-3050	79	7	,	,	PUNCT
ahs-3050	79	8	koca	koca	PROPN
ahs-3050	79	9	g.	g.	PROPN
ahs-3050	79	10	,	,	PUNCT
ahs-3050	79	11	2010	2010	NUM
ahs-3050	79	12	first	first	ADJ
ahs-3050	79	13	report	report	NOUN
ahs-3050	79	14	of	of	ADP
ahs-3050	79	15	carnation	carnation	NOUN
ahs-3050	79	16	mottle	mottle	NOUN
ahs-3050	79	17	virus	virus	NOUN
ahs-3050	79	18	in	in	ADP
ahs-3050	79	19	turkey	turkey	PROPN
ahs-3050	79	20	.	.	PUNCT
ahs-3050	80	1	plant	plant	NOUN
ahs-3050	80	2	pathol	pathol	NOUN
ahs-3050	80	3	.	.	PUNCT
ahs-3050	80	4	,	,	PUNCT
ahs-3050	80	5	59	59	NUM
ahs-3050	80	6	:	:	SYM
ahs-3050	80	7	394	394	NUM
ahs-3050	80	8	.	.	PUNCT
ahs-3050	80	9	faggioli	faggioli	PROPN
ahs-3050	80	10	f.	f.	PROPN
ahs-3050	80	11	,	,	PUNCT
ahs-3050	80	12	ferretti	ferretti	PROPN
ahs-3050	80	13	l.	l.	PROPN
ahs-3050	80	14	,	,	PUNCT
ahs-3050	80	15	albanese	albanese	PROPN
ahs-3050	80	16	g.	g.	PROPN
ahs-3050	80	17	,	,	PUNCT
ahs-3050	80	18	sciarroni	sciarroni	PROPN
ahs-3050	80	19	r.	r.	PROPN
ahs-3050	80	20	,	,	PUNCT
ahs-3050	80	21	pasquini	pasquini	PROPN
ahs-3050	80	22	g.	g.	PROPN
ahs-3050	80	23	,	,	PUNCT
ahs-3050	80	24	lumia	lumia	PROPN
ahs-3050	80	25	v.	v.	PROPN
ahs-3050	80	26	,	,	PUNCT
ahs-3050	80	27	barba	barba	PROPN
ahs-3050	80	28	m.	m.	NOUN
ahs-3050	80	29	,	,	PUNCT
ahs-3050	80	30	2005	2005	NUM
ahs-3050	80	31	distribution	distribution	NOUN
ahs-3050	80	32	of	of	ADP
ahs-3050	80	33	olive	olive	NOUN
ahs-3050	80	34	tree	tree	NOUN
ahs-3050	80	35	viruses	virus	NOUN
ahs-3050	80	36	in	in	ADP
ahs-3050	80	37	italy	italy	PROPN
ahs-3050	80	38	as	as	SCONJ
ahs-3050	80	39	revealed	reveal	VERB
ahs-3050	80	40	by	by	ADP
ahs-3050	80	41	one	one	NUM
ahs-3050	80	42	-	-	PUNCT
ahs-3050	80	43	step	step	NOUN
ahs-3050	80	44	rtpcr	rtpcr	NOUN
ahs-3050	80	45	.	.	PUNCT
ahs-3050	81	1	j.	j.	PROPN
ahs-3050	81	2	plant	plant	PROPN
ahs-3050	81	3	pathol	pathol	PROPN
ahs-3050	81	4	.	.	PUNCT
ahs-3050	81	5	,	,	PUNCT
ahs-3050	81	6	87	87	NUM
ahs-3050	81	7	:	:	SYM
ahs-3050	81	8	49	49	NUM
ahs-3050	81	9	-	-	SYM
ahs-3050	81	10	55	55	NUM
ahs-3050	81	11	.	.	PUNCT
ahs-3050	82	1	table	table	NOUN
ahs-3050	82	2	3	3	NUM
ahs-3050	82	3	sequence	sequence	NOUN
ahs-3050	82	4	of	of	ADP
ahs-3050	82	5	isolates	isolate	NOUN
ahs-3050	82	6	of	of	ADP
ahs-3050	82	7	zantedeschia	zantedeschia	ADJ
ahs-3050	82	8	mild	mild	ADJ
ahs-3050	82	9	mosaic	mosaic	ADJ
ahs-3050	82	10	virus	virus	NOUN
ahs-3050	82	11	and	and	CCONJ
ahs-3050	82	12	lily	lily	ADJ
ahs-3050	82	13	mottle	mottle	NOUN
ahs-3050	82	14	virus	virus	NOUN
ahs-3050	82	15	isolate	isolate	NOUN
ahs-3050	82	16	detected	detect	VERB
ahs-3050	82	17	in	in	ADP
ahs-3050	82	18	italy	italy	PROPN
ahs-3050	82	19	zantedeschia	zantedeschia	PROPN
ahs-3050	82	20	mild	mild	ADJ
ahs-3050	82	21	mosaic	mosaic	ADJ
ahs-3050	82	22	virus	virus	NOUN
ahs-3050	82	23	isolate	isolate	VERB
ahs-3050	82	24	2079	2079	NUM
ahs-3050	82	25	polyprotein	polyprotein	ADJ
ahs-3050	82	26	gene	gene	NOUN
ahs-3050	82	27	,	,	PUNCT
ahs-3050	82	28	partial	partial	ADJ
ahs-3050	82	29	cds	cd	NOUN
ahs-3050	82	30	(	(	PUNCT
ahs-3050	82	31	genbank	genbank	NOUN
ahs-3050	82	32	:	:	PUNCT
ahs-3050	82	33	kf156666	kf156666	PROPN
ahs-3050	82	34	)	)	PUNCT
ahs-3050	82	35	tcattgagtaccaaccccaacagtccgatctgtttaatactcgcgcgtcacaaacccaattcaataattggtatgatgcgatcaaaaatgagtatggggttgatgatagtcagatgcagagaatcatgaatggcttcatggtgtggtgtctcgagaatgggacatcaccaaacataaatggcgtgtgggttatgatggatggggatgaacaagtagaatttccactaaaaccaatggtggagaatgccaagcctacgctgcgtcaaataatgcaccacttttcagacgcagccgaggcttacattgaacttaggaatgccgctgccccatatatgcctagatatgggttgctgcggaacttaagagacagaggtctagcacgcttcgcattcgacttctatgaagtcacttcaaagacaccagatcgtgctagagaagctgtagcgcagatgaaggcagcagcgctaaacaatgtttccacaaggatgtttggattggatggaaatattgcaactgccacggagaacactgaaaggcacactgctaaggatgtaagtccgagcatgcactcgctactcgggatctcagccttgcagtaaaggagctggaaacagcccacagttattgtcttgcgatagggtttaaatagccgtactattgtcgttgctagatgttgcagtgtgggcctcccaccttaaggtttatcagtgtggctttccacctagttccttacattgcgcatagtatgtgt	tcattgagtaccaaccccaacagtccgatctgtttaatactcgcgcgtcacaaacccaattcaataattggtatgatgcgatcaaaaatgagtatggggttgatgatagtcagatgcagagaatcatgaatggcttcatggtgtggtgtctcgagaatgggacatcaccaaacataaatggcgtgtgggttatgatggatggggatgaacaagtagaatttccactaaaaccaatggtggagaatgccaagcctacgctgcgtcaaataatgcaccacttttcagacgcagccgaggcttacattgaacttaggaatgccgctgccccatatatgcctagatatgggttgctgcggaacttaagagacagaggtctagcacgcttcgcattcgacttctatgaagtcacttcaaagacaccagatcgtgctagagaagctgtagcgcagatgaaggcagcagcgctaaacaatgtttccacaaggatgtttggattggatggaaatattgcaactgccacggagaacactgaaaggcacactgctaaggatgtaagtccgagcatgcactcgctactcgggatctcagccttgcagtaaaggagctggaaacagcccacagttattgtcttgcgatagggtttaaatagccgtactattgtcgttgctagatgttgcagtgtgggcctcccaccttaaggtttatcagtgtggctttccacctagttccttacattgcgcatagtatgtgt	PROPN
ahs-3050	82	36	lily	lily	PROPN
ahs-3050	82	37	mottle	mottle	NOUN
ahs-3050	82	38	virus	virus	NOUN
ahs-3050	82	39	isolate	isolate	VERB
ahs-3050	82	40	2409	2409	NUM
ahs-3050	82	41	coat	coat	NOUN
ahs-3050	82	42	protein	protein	NOUN
ahs-3050	82	43	gene	gene	NOUN
ahs-3050	82	44	,	,	PUNCT
ahs-3050	82	45	partial	partial	ADJ
ahs-3050	82	46	cds	cd	NOUN
ahs-3050	82	47	(	(	PUNCT
ahs-3050	82	48	genbank	genbank	NOUN
ahs-3050	82	49	:	:	PUNCT
ahs-3050	82	50	kf156662.1	kf156662.1	NUM
ahs-3050	82	51	)	)	PUNCT
ahs-3050	82	52	tgctggggcctctagctccacacaaacgagtcgcccaacacgtccagagattgccgcggtcgatgtagcaccacaacagagctctgaggctagagtgcgtgatcgtgatgttgatgctggcaccgtgggaacataccaaatccctcgactgaaagcactggcaacaaagattaacgtacccaaggtcaaggggcgaacaatagtgaacactgggcaccttgtgaactacaacccagaccaaacagatatttcaaatacaaggtcaacccagaagcaatttgagacctggcataacgctgtgaaagatgagtatggtctcaacgacgagagtatggctctcgcaatgaatggtctgatggtttggtgcatagagaatggcacctcaccaaacataaatggcgtgtggctcatgatggacggagatcagcaagttgaatttcctttacgtcctatacttgaacacgcaaaaccgacgctgcgccaaattatggcgcatttctcaaacctcgctgaagcttatattgagaagcaaaatttggagaaaccgtacatgcctaggtacggccttcagcgaaatctcaccgatttcaatctagcacgatttgcttttgatttctatga	tgctggggcctctagctccacacaaacgagtcgcccaacacgtccagagattgccgcggtcgatgtagcaccacaacagagctctgaggctagagtgcgtgatcgtgatgttgatgctggcaccgtgggaacataccaaatccctcgactgaaagcactggcaacaaagattaacgtacccaaggtcaaggggcgaacaatagtgaacactgggcaccttgtgaactacaacccagaccaaacagatatttcaaatacaaggtcaacccagaagcaatttgagacctggcataacgctgtgaaagatgagtatggtctcaacgacgagagtatggctctcgcaatgaatggtctgatggtttggtgcatagagaatggcacctcaccaaacataaatggcgtgtggctcatgatggacggagatcagcaagttgaatttcctttacgtcctatacttgaacacgcaaaaccgacgctgcgccaaattatggcgcatttctcaaacctcgctgaagcttatattgagaagcaaaatttggagaaaccgtacatgcctaggtacggccttcagcgaaatctcaccgatttcaatctagcacgatttgcttttgatttctatga	PROPN
ahs-3050	82	53	adv	adv	PROPN
ahs-3050	82	54	.	.	PUNCT
ahs-3050	82	55	hort	hort	PROPN
ahs-3050	82	56	.	.	PUNCT
ahs-3050	83	1	sci	sci	PROPN
ahs-3050	83	2	.	.	PROPN
ahs-3050	83	3	,	,	PUNCT
ahs-3050	83	4	2016	2016	NUM
ahs-3050	83	5	30(1	30(1	NUM
ahs-3050	83	6	):	):	PUNCT
ahs-3050	83	7	53	53	NUM
ahs-3050	83	8	-	-	SYM
ahs-3050	83	9	56	56	NUM
ahs-3050	83	10	56	56	NUM
ahs-3050	83	11	ferrer	ferrer	PROPN
ahs-3050	83	12	r.	r.	PROPN
ahs-3050	83	13	,	,	PUNCT
ahs-3050	83	14	escriu	escriu	PROPN
ahs-3050	83	15	f.	f.	PROPN
ahs-3050	83	16	,	,	PUNCT
ahs-3050	83	17	luis	luis	PROPN
ahs-3050	83	18	-	-	PUNCT
ahs-3050	83	19	arteaga	arteaga	NOUN
ahs-3050	83	20	m.	m.	NOUN
ahs-3050	83	21	,	,	PUNCT
ahs-3050	83	22	guerri	guerri	PROPN
ahs-3050	83	23	j.	j.	PROPN
ahs-3050	83	24	,	,	PUNCT
ahs-3050	83	25	moreno	moreno	PROPN
ahs-3050	83	26	p.	p.	PROPN
ahs-3050	83	27	,	,	PUNCT
ahs-3050	83	28	rubio	rubio	PROPN
ahs-3050	83	29	l.	l.	PROPN
ahs-3050	83	30	,	,	PUNCT
ahs-3050	83	31	2008	2008	NUM
ahs-3050	83	32	new	new	ADJ
ahs-3050	83	33	molecular	molecular	ADJ
ahs-3050	83	34	methods	method	NOUN
ahs-3050	83	35	for	for	ADP
ahs-3050	83	36	identification	identification	NOUN
ahs-3050	83	37	of	of	ADP
ahs-3050	83	38	broad	broad	ADJ
ahs-3050	83	39	bean	bean	NOUN
ahs-3050	83	40	wilt	wilt	NOUN
ahs-3050	83	41	virus	virus	NOUN
ahs-3050	83	42	1	1	NUM
ahs-3050	83	43	.	.	PUNCT
ahs-3050	83	44	mol	mol	PROPN
ahs-3050	83	45	.	.	PROPN
ahs-3050	83	46	cell	cell	NOUN
ahs-3050	83	47	.	.	PUNCT
ahs-3050	84	1	probes	probe	NOUN
ahs-3050	84	2	,	,	PUNCT
ahs-3050	84	3	22	22	NUM
ahs-3050	84	4	:	:	PUNCT
ahs-3050	84	5	223	223	NUM
ahs-3050	84	6	-	-	SYM
ahs-3050	84	7	227	227	NUM
ahs-3050	84	8	.	.	PUNCT
ahs-3050	85	1	ganesh	ganesh	PROPN
ahs-3050	85	2	selvaraj	selvaraj	PROPN
ahs-3050	85	3	d.	d.	PROPN
ahs-3050	85	4	,	,	PUNCT
ahs-3050	85	5	pokorny	pokorny	PROPN
ahs-3050	85	6	r.	r.	PROPN
ahs-3050	85	7	,	,	PUNCT
ahs-3050	85	8	holkova	holkova	PROPN
ahs-3050	85	9	l.	l.	PROPN
ahs-3050	85	10	,	,	PUNCT
ahs-3050	85	11	2009	2009	NUM
ahs-3050	85	12	comparative	comparative	ADJ
ahs-3050	85	13	analysis	analysis	NOUN
ahs-3050	85	14	of	of	ADP
ahs-3050	85	15	elisa	elisa	NOUN
ahs-3050	85	16	,	,	PUNCT
ahs-3050	85	17	one	one	NUM
ahs-3050	85	18	step	step	NOUN
ahs-3050	85	19	rt	rt	NOUN
ahs-3050	85	20	-	-	PUNCT
ahs-3050	85	21	pcr	pcr	ADJ
ahs-3050	85	22	and	and	CCONJ
ahs-3050	85	23	icrt	icrt	ADJ
ahs-3050	85	24	-	-	PUNCT
ahs-3050	85	25	pcr	pcr	NOUN
ahs-3050	85	26	for	for	ADP
ahs-3050	85	27	the	the	DET
ahs-3050	85	28	detection	detection	NOUN
ahs-3050	85	29	of	of	ADP
ahs-3050	85	30	bean	bean	NOUN
ahs-3050	85	31	yellow	yellow	ADJ
ahs-3050	85	32	mosaic	mosaic	PROPN
ahs-3050	85	33	virus	virus	NOUN
ahs-3050	85	34	in	in	ADP
ahs-3050	85	35	gladiolus	gladiolus	NOUN
ahs-3050	85	36	.	.	PUNCT
ahs-3050	86	1	commun	commun	PROPN
ahs-3050	86	2	.	.	PUNCT
ahs-3050	87	1	agric	agric	PROPN
ahs-3050	87	2	.	.	PUNCT
ahs-3050	88	1	appl	appl	PROPN
ahs-3050	88	2	.	.	PUNCT
ahs-3050	89	1	biol	biol	PROPN
ahs-3050	89	2	.	.	PUNCT
ahs-3050	90	1	sci	sci	PROPN
ahs-3050	90	2	.	.	PROPN
ahs-3050	90	3	,	,	PUNCT
ahs-3050	90	4	74	74	NUM
ahs-3050	90	5	:	:	SYM
ahs-3050	90	6	853859	853859	NUM
ahs-3050	90	7	.	.	PUNCT
ahs-3050	91	1	huang	huang	PROPN
ahs-3050	91	2	c.h	c.h	PROPN
ahs-3050	91	3	.	.	PROPN
ahs-3050	91	4	,	,	PUNCT
ahs-3050	91	5	chang	chang	PROPN
ahs-3050	91	6	y.c	y.c	PROPN
ahs-3050	91	7	.	.	PROPN
ahs-3050	91	8	,	,	PUNCT
ahs-3050	91	9	2005	2005	NUM
ahs-3050	91	10	identification	identification	NOUN
ahs-3050	91	11	and	and	CCONJ
ahs-3050	91	12	molecular	molecular	ADJ
ahs-3050	91	13	characterization	characterization	NOUN
ahs-3050	91	14	of	of	ADP
ahs-3050	91	15	zantedeschia	zantedeschia	ADJ
ahs-3050	91	16	mild	mild	ADJ
ahs-3050	91	17	mosaic	mosaic	ADJ
ahs-3050	91	18	virus	virus	NOUN
ahs-3050	91	19	,	,	PUNCT
ahs-3050	91	20	a	a	DET
ahs-3050	91	21	new	new	ADJ
ahs-3050	91	22	calla	calla	NOUN
ahs-3050	91	23	-	-	PUNCT
ahs-3050	91	24	lilly	lilly	NOUN
ahs-3050	91	25	-	-	PUNCT
ahs-3050	91	26	infecting	infect	VERB
ahs-3050	91	27	potyvirus	potyvirus	NOUN
ahs-3050	91	28	.	.	PUNCT
ahs-3050	92	1	arch	arch	NOUN
ahs-3050	92	2	.	.	PUNCT
ahs-3050	93	1	virol	virol	NOUN
ahs-3050	93	2	.	.	PUNCT
ahs-3050	93	3	,	,	PUNCT
ahs-3050	93	4	150	150	NUM
ahs-3050	93	5	:	:	SYM
ahs-3050	93	6	1221	1221	NUM
ahs-3050	93	7	-	-	SYM
ahs-3050	93	8	1230	1230	NUM
ahs-3050	93	9	.	.	PUNCT
ahs-3050	94	1	huang	huang	PROPN
ahs-3050	94	2	c.h	c.h	PROPN
ahs-3050	94	3	.	.	PROPN
ahs-3050	94	4	,	,	PUNCT
ahs-3050	94	5	hu	hu	PROPN
ahs-3050	94	6	w.c	w.c	VERB
ahs-3050	94	7	.	.	PROPN
ahs-3050	94	8	,	,	PUNCT
ahs-3050	94	9	yang	yang	PROPN
ahs-3050	94	10	t.c	t.c	PROPN
ahs-3050	94	11	.	.	PROPN
ahs-3050	94	12	,	,	PUNCT
ahs-3050	94	13	chang	chang	PROPN
ahs-3050	94	14	y.c	y.c	PROPN
ahs-3050	94	15	.	.	PROPN
ahs-3050	94	16	,	,	PUNCT
ahs-3050	94	17	2007	2007	NUM
ahs-3050	94	18	zantedeschia	zantedeschia	PRON
ahs-3050	94	19	mild	mild	ADJ
ahs-3050	94	20	mosaic	mosaic	ADJ
ahs-3050	94	21	virus	virus	NOUN
ahs-3050	94	22	,	,	PUNCT
ahs-3050	94	23	a	a	DET
ahs-3050	94	24	new	new	ADJ
ahs-3050	94	25	widespread	widespread	ADJ
ahs-3050	94	26	virus	virus	NOUN
ahs-3050	94	27	in	in	ADP
ahs-3050	94	28	calla	calla	NOUN
ahs-3050	94	29	lily	lily	NOUN
ahs-3050	94	30	,	,	PUNCT
ahs-3050	94	31	detected	detect	VERB
ahs-3050	94	32	by	by	ADP
ahs-3050	94	33	elisa	elisa	NOUN
ahs-3050	94	34	,	,	PUNCT
ahs-3050	94	35	dot	dot	NOUN
ahs-3050	94	36	-	-	PUNCT
ahs-3050	94	37	blot	blot	NOUN
ahs-3050	94	38	hybridization	hybridization	NOUN
ahs-3050	94	39	and	and	CCONJ
ahs-3050	94	40	ic	ic	PROPN
ahs-3050	94	41	-	-	PUNCT
ahs-3050	94	42	rt	rt	NOUN
ahs-3050	94	43	-	-	PUNCT
ahs-3050	94	44	pcr	pcr	NOUN
ahs-3050	94	45	.	.	PUNCT
ahs-3050	95	1	plant	plant	NOUN
ahs-3050	95	2	pathol	pathol	NOUN
ahs-3050	95	3	.	.	PUNCT
ahs-3050	95	4	,	,	PUNCT
ahs-3050	95	5	56	56	NUM
ahs-3050	95	6	:	:	SYM
ahs-3050	95	7	183	183	NUM
ahs-3050	95	8	-	-	SYM
ahs-3050	95	9	189	189	NUM
ahs-3050	95	10	.	.	PUNCT
ahs-3050	96	1	kritzman	kritzman	PROPN
ahs-3050	96	2	a.	a.	PROPN
ahs-3050	96	3	,	,	PUNCT
ahs-3050	96	4	beckelman	beckelman	PROPN
ahs-3050	96	5	h.	h.	PROPN
ahs-3050	96	6	,	,	PUNCT
ahs-3050	96	7	alexandrov	alexandrov	PROPN
ahs-3050	96	8	s.	s.	PROPN
ahs-3050	96	9	,	,	PUNCT
ahs-3050	96	10	cohen	cohen	PROPN
ahs-3050	96	11	j.	j.	PROPN
ahs-3050	96	12	,	,	PUNCT
ahs-3050	96	13	lampel	lampel	ADJ
ahs-3050	96	14	m.	m.	NOUN
ahs-3050	96	15	,	,	PUNCT
ahs-3050	96	16	zeidan	zeidan	PROPN
ahs-3050	96	17	m.	m.	PROPN
ahs-3050	96	18	,	,	PUNCT
ahs-3050	96	19	raccah	raccah	PROPN
ahs-3050	96	20	b.	b.	PROPN
ahs-3050	96	21	,	,	PUNCT
ahs-3050	96	22	gera	gera	PROPN
ahs-3050	96	23	a.	a.	PROPN
ahs-3050	96	24	,	,	PUNCT
ahs-3050	96	25	2000	2000	NUM
ahs-3050	96	26	lisianthus	lisianthu	NOUN
ahs-3050	96	27	leaf	leaf	NOUN
ahs-3050	96	28	necrosis	necrosis	NOUN
ahs-3050	96	29	:	:	PUNCT
ahs-3050	96	30	a	a	DET
ahs-3050	96	31	new	new	ADJ
ahs-3050	96	32	disease	disease	NOUN
ahs-3050	96	33	of	of	ADP
ahs-3050	96	34	lisianthus	lisianthu	NOUN
ahs-3050	96	35	caused	cause	VERB
ahs-3050	96	36	by	by	ADP
ahs-3050	96	37	iris	iris	NOUN
ahs-3050	96	38	yellow	yellow	ADJ
ahs-3050	96	39	spot	spot	PROPN
ahs-3050	96	40	virus	virus	NOUN
ahs-3050	96	41	.	.	PUNCT
ahs-3050	97	1	plan	plan	VERB
ahs-3050	97	2	dis	dis	PROPN
ahs-3050	97	3	.	.	PROPN
ahs-3050	97	4	,	,	PUNCT
ahs-3050	97	5	84	84	NUM
ahs-3050	97	6	:	:	SYM
ahs-3050	97	7	11851189	11851189	NUM
ahs-3050	97	8	.	.	PUNCT
ahs-3050	98	1	kwon	kwon	PROPN
ahs-3050	98	2	s.b	s.b	PROPN
ahs-3050	98	3	.	.	PROPN
ahs-3050	98	4	,	,	PUNCT
ahs-3050	98	5	ha	ha	INTJ
ahs-3050	99	1	j.h	j.h	PROPN
ahs-3050	99	2	.	.	PROPN
ahs-3050	99	3	,	,	PUNCT
ahs-3050	99	4	yoon	yoon	PROPN
ahs-3050	99	5	j.y	j.y	PROPN
ahs-3050	99	6	.	.	PROPN
ahs-3050	99	7	,	,	PUNCT
ahs-3050	99	8	ryu	ryu	PROPN
ahs-3050	99	9	k.h	k.h	PROPN
ahs-3050	99	10	.	.	PROPN
ahs-3050	99	11	,	,	PUNCT
ahs-3050	99	12	2003	2003	NUM
ahs-3050	99	13	zantedeschia	zantedeschia	PROPN
ahs-3050	99	14	mosaic	mosaic	PROPN
ahs-3050	99	15	virus	virus	NOUN
ahs-3050	99	16	causing	cause	VERB
ahs-3050	99	17	leaf	leaf	NOUN
ahs-3050	99	18	mosaic	mosaic	ADJ
ahs-3050	99	19	symptom	symptom	NOUN
ahs-3050	99	20	in	in	ADP
ahs-3050	99	21	calla	calla	NOUN
ahs-3050	99	22	lily	lily	NOUN
ahs-3050	99	23	is	be	AUX
ahs-3050	99	24	a	a	DET
ahs-3050	99	25	new	new	ADJ
ahs-3050	99	26	potyvirus	potyvirus	NOUN
ahs-3050	99	27	.	.	PUNCT
ahs-3050	100	1	arch	arch	NOUN
ahs-3050	100	2	.	.	PUNCT
ahs-3050	101	1	virol	virol	NOUN
ahs-3050	101	2	.	.	PUNCT
ahs-3050	101	3	,	,	PUNCT
ahs-3050	101	4	147	147	NUM
ahs-3050	101	5	:	:	PUNCT
ahs-3050	101	6	2281	2281	NUM
ahs-3050	101	7	-	-	SYM
ahs-3050	101	8	2289	2289	NUM
ahs-3050	101	9	.	.	PUNCT
ahs-3050	102	1	lim	lim	PROPN
ahs-3050	102	2	h.j	h.j	PROPN
ahs-3050	102	3	.	.	PROPN
ahs-3050	102	4	,	,	PUNCT
ahs-3050	102	5	bae	bae	PROPN
ahs-3050	102	6	e.h	e.h	PROPN
ahs-3050	102	7	.	.	PROPN
ahs-3050	102	8	,	,	PUNCT
ahs-3050	102	9	lee	lee	PROPN
ahs-3050	102	10	y.j	y.j	PROPN
ahs-3050	102	11	.	.	PROPN
ahs-3050	102	12	,	,	PUNCT
ahs-3050	102	13	park	park	PROPN
ahs-3050	102	14	s.h	s.h	PROPN
ahs-3050	102	15	.	.	PROPN
ahs-3050	102	16	,	,	PUNCT
ahs-3050	102	17	lee	lee	PROPN
ahs-3050	102	18	k.j	k.j	PROPN
ahs-3050	102	19	.	.	PROPN
ahs-3050	102	20	,	,	PUNCT
ahs-3050	102	21	kim	kim	PROPN
ahs-3050	102	22	s.r	s.r	PROPN
ahs-3050	102	23	.	.	PROPN
ahs-3050	102	24	,	,	PUNCT
ahs-3050	102	25	2009	2009	NUM
ahs-3050	102	26	detection	detection	NOUN
ahs-3050	102	27	of	of	ADP
ahs-3050	102	28	lily	lily	ADJ
ahs-3050	102	29	symptomless	symptomless	ADJ
ahs-3050	102	30	virus	virus	NOUN
ahs-3050	102	31	,	,	PUNCT
ahs-3050	102	32	lily	lily	ADJ
ahs-3050	102	33	mottle	mottle	NOUN
ahs-3050	102	34	virus	virus	NOUN
ahs-3050	102	35	,	,	PUNCT
ahs-3050	102	36	and	and	CCONJ
ahs-3050	102	37	cucumber	cucumber	PROPN
ahs-3050	102	38	mosaic	mosaic	PROPN
ahs-3050	102	39	virus	virus	NOUN
ahs-3050	102	40	from	from	ADP
ahs-3050	102	41	lilium	lilium	PROPN
ahs-3050	102	42	grown	grow	VERB
ahs-3050	102	43	in	in	ADP
ahs-3050	102	44	korea	korea	PROPN
ahs-3050	102	45	by	by	ADP
ahs-3050	102	46	rt	rt	PROPN
ahs-3050	102	47	-	-	PUNCT
ahs-3050	102	48	pcr	pcr	NOUN
ahs-3050	102	49	.	.	PUNCT
ahs-3050	103	1	korean	korean	ADJ
ahs-3050	103	2	journal	journal	PROPN
ahs-3050	103	3	of	of	ADP
ahs-3050	103	4	microbiology	microbiology	NOUN
ahs-3050	103	5	,	,	PUNCT
ahs-3050	103	6	45	45	NUM
ahs-3050	103	7	:	:	PUNCT
ahs-3050	103	8	251	251	NUM
ahs-3050	103	9	-	-	SYM
ahs-3050	103	10	256	256	NUM
ahs-3050	103	11	.	.	PUNCT
ahs-3050	104	1	liu	liu	PROPN
ahs-3050	104	2	h.y	h.y	PROPN
ahs-3050	104	3	.	.	PROPN
ahs-3050	104	4	,	,	PUNCT
ahs-3050	104	5	sears	sears	PROPN
ahs-3050	104	6	j.l	j.l	PROPN
ahs-3050	104	7	.	.	PROPN
ahs-3050	104	8	,	,	PUNCT
ahs-3050	104	9	mou	mou	PROPN
ahs-3050	104	10	b.	b.	PROPN
ahs-3050	104	11	,	,	PUNCT
ahs-3050	104	12	2009	2009	NUM
ahs-3050	104	13	spinach	spinach	NOUN
ahs-3050	104	14	(	(	PUNCT
ahs-3050	104	15	spinacia	spinacia	PROPN
ahs-3050	104	16	oleracea	oleracea	PROPN
ahs-3050	104	17	)	)	PUNCT
ahs-3050	104	18	is	be	AUX
ahs-3050	104	19	a	a	DET
ahs-3050	104	20	new	new	ADJ
ahs-3050	104	21	natural	natural	ADJ
ahs-3050	104	22	host	host	NOUN
ahs-3050	104	23	of	of	ADP
ahs-3050	104	24	impatiens	impatiens	ADJ
ahs-3050	104	25	necrotic	necrotic	ADJ
ahs-3050	104	26	spot	spot	NOUN
ahs-3050	104	27	virus	virus	NOUN
ahs-3050	104	28	in	in	ADP
ahs-3050	104	29	california	california	PROPN
ahs-3050	104	30	.	.	PUNCT
ahs-3050	105	1	plant	plant	NOUN
ahs-3050	105	2	dis	dis	PROPN
ahs-3050	105	3	.	.	PROPN
ahs-3050	105	4	,	,	PUNCT
ahs-3050	105	5	93	93	NUM
ahs-3050	105	6	:	:	PUNCT
ahs-3050	105	7	673	673	NUM
ahs-3050	105	8	.	.	PUNCT
ahs-3050	106	1	luvisi	luvisi	VERB
ahs-3050	106	2	a.	a.	NOUN
ahs-3050	106	3	,	,	PUNCT
ahs-3050	106	4	panattoni	panattoni	PROPN
ahs-3050	106	5	a.	a.	NOUN
ahs-3050	106	6	,	,	PUNCT
ahs-3050	106	7	materazzi	materazzi	PROPN
ahs-3050	106	8	a.	a.	PROPN
ahs-3050	106	9	,	,	PUNCT
ahs-3050	106	10	2015	2015	NUM
ahs-3050	106	11	heat	heat	NOUN
ahs-3050	106	12	treatments	treatment	NOUN
ahs-3050	106	13	for	for	ADP
ahs-3050	106	14	sustainable	sustainable	ADJ
ahs-3050	106	15	control	control	NOUN
ahs-3050	106	16	of	of	ADP
ahs-3050	106	17	soil	soil	NOUN
ahs-3050	106	18	viruses	virus	NOUN
ahs-3050	106	19	.	.	PUNCT
ahs-3050	107	1	agron	agron	AUX
ahs-3050	107	2	.	.	PUNCT
ahs-3050	107	3	sustain	sustain	VERB
ahs-3050	107	4	.	.	PUNCT
ahs-3050	108	1	dev	dev	PROPN
ahs-3050	108	2	.	.	PROPN
ahs-3050	108	3	,	,	PUNCT
ahs-3050	108	4	35	35	NUM
ahs-3050	108	5	:	:	SYM
ahs-3050	108	6	657	657	NUM
ahs-3050	108	7	-	-	SYM
ahs-3050	108	8	666	666	NUM
ahs-3050	108	9	.	.	PUNCT
ahs-3050	109	1	mackenzie	mackenzie	PROPN
ahs-3050	109	2	d.j	d.j	PROPN
ahs-3050	109	3	.	.	PROPN
ahs-3050	109	4	,	,	PUNCT
ahs-3050	109	5	mclean	mclean	PROPN
ahs-3050	109	6	m.a	m.a	PROPN
ahs-3050	109	7	.	.	PROPN
ahs-3050	109	8	,	,	PUNCT
ahs-3050	109	9	mukerji	mukerji	PROPN
ahs-3050	109	10	s.	s.	PROPN
ahs-3050	109	11	,	,	PUNCT
ahs-3050	109	12	green	green	ADJ
ahs-3050	109	13	m.	m.	NOUN
ahs-3050	109	14	,	,	PUNCT
ahs-3050	109	15	1997	1997	NUM
ahs-3050	109	16	improved	improve	VERB
ahs-3050	109	17	rna	rna	NOUN
ahs-3050	109	18	extraction	extraction	NOUN
ahs-3050	109	19	from	from	ADP
ahs-3050	109	20	woody	woody	NOUN
ahs-3050	109	21	plants	plant	NOUN
ahs-3050	109	22	for	for	ADP
ahs-3050	109	23	the	the	DET
ahs-3050	109	24	detection	detection	NOUN
ahs-3050	109	25	of	of	ADP
ahs-3050	109	26	viral	viral	ADJ
ahs-3050	109	27	pathogens	pathogen	NOUN
ahs-3050	109	28	by	by	ADP
ahs-3050	109	29	reverse	reverse	ADJ
ahs-3050	109	30	transcriptionpolymerase	transcriptionpolymerase	NOUN
ahs-3050	109	31	chain	chain	NOUN
ahs-3050	109	32	reaction	reaction	NOUN
ahs-3050	109	33	.	.	PUNCT
ahs-3050	110	1	plant	plant	NOUN
ahs-3050	110	2	dis	dis	PROPN
ahs-3050	110	3	.	.	PROPN
ahs-3050	110	4	,	,	PUNCT
ahs-3050	110	5	81	81	NUM
ahs-3050	110	6	:	:	PUNCT
ahs-3050	110	7	222	222	NUM
ahs-3050	110	8	-	-	SYM
ahs-3050	110	9	226	226	NUM
ahs-3050	110	10	.	.	PUNCT
ahs-3050	111	1	mumford	mumford	PROPN
ahs-3050	111	2	r.a	r.a	PROPN
ahs-3050	111	3	.	.	PROPN
ahs-3050	111	4	,	,	PUNCT
ahs-3050	111	5	barker	barker	PROPN
ahs-3050	111	6	i.	i.	PROPN
ahs-3050	111	7	,	,	PUNCT
ahs-3050	111	8	wood	wood	PROPN
ahs-3050	111	9	k.r	k.r	PROPN
ahs-3050	111	10	.	.	PROPN
ahs-3050	111	11	,	,	PUNCT
ahs-3050	111	12	1994	1994	NUM
ahs-3050	111	13	the	the	DET
ahs-3050	111	14	detection	detection	NOUN
ahs-3050	111	15	of	of	ADP
ahs-3050	111	16	tomato	tomato	NOUN
ahs-3050	111	17	spotted	spot	VERB
ahs-3050	111	18	wilt	wilt	ADJ
ahs-3050	111	19	virus	virus	NOUN
ahs-3050	111	20	using	use	VERB
ahs-3050	111	21	the	the	DET
ahs-3050	111	22	polymerase	polymerase	NOUN
ahs-3050	111	23	chain	chain	NOUN
ahs-3050	111	24	reaction	reaction	NOUN
ahs-3050	111	25	.	.	PUNCT
ahs-3050	112	1	j.	j.	PROPN
ahs-3050	112	2	virol	virol	PROPN
ahs-3050	112	3	.	.	PUNCT
ahs-3050	113	1	methods	method	NOUN
ahs-3050	113	2	,	,	PUNCT
ahs-3050	113	3	46	46	NUM
ahs-3050	113	4	:	:	SYM
ahs-3050	113	5	303	303	NUM
ahs-3050	113	6	-	-	SYM
ahs-3050	113	7	311	311	NUM
ahs-3050	113	8	.	.	PUNCT
ahs-3050	114	1	osman	osman	PROPN
ahs-3050	114	2	f.	f.	PROPN
ahs-3050	114	3	,	,	PUNCT
ahs-3050	114	4	rowhani	rowhani	PROPN
ahs-3050	114	5	a.	a.	PROPN
ahs-3050	114	6	,	,	PUNCT
ahs-3050	114	7	2006	2006	NUM
ahs-3050	114	8	application	application	NOUN
ahs-3050	114	9	of	of	ADP
ahs-3050	114	10	a	a	DET
ahs-3050	114	11	spotting	spot	VERB
ahs-3050	114	12	sample	sample	NOUN
ahs-3050	114	13	preparation	preparation	NOUN
ahs-3050	114	14	technique	technique	NOUN
ahs-3050	114	15	for	for	ADP
ahs-3050	114	16	the	the	DET
ahs-3050	114	17	detection	detection	NOUN
ahs-3050	114	18	of	of	ADP
ahs-3050	114	19	pathogens	pathogen	NOUN
ahs-3050	114	20	in	in	ADP
ahs-3050	114	21	woody	woody	NOUN
ahs-3050	114	22	plants	plant	NOUN
ahs-3050	114	23	by	by	ADP
ahs-3050	114	24	rt	rt	NOUN
ahs-3050	114	25	-	-	PUNCT
ahs-3050	114	26	pcr	pcr	ADJ
ahs-3050	114	27	and	and	CCONJ
ahs-3050	114	28	real	real	ADJ
ahs-3050	114	29	-	-	PUNCT
ahs-3050	114	30	time	time	NOUN
ahs-3050	114	31	pcr	pcr	NOUN
ahs-3050	114	32	(	(	PUNCT
ahs-3050	114	33	taqman	taqman	NOUN
ahs-3050	114	34	)	)	PUNCT
ahs-3050	114	35	.	.	PUNCT
ahs-3050	115	1	j.	j.	PROPN
ahs-3050	115	2	virol	virol	PROPN
ahs-3050	115	3	.	.	PUNCT
ahs-3050	116	1	methods	method	NOUN
ahs-3050	116	2	,	,	PUNCT
ahs-3050	116	3	133	133	NUM
ahs-3050	116	4	:	:	SYM
ahs-3050	116	5	130	130	NUM
ahs-3050	116	6	-	-	SYM
ahs-3050	116	7	136	136	NUM
ahs-3050	116	8	.	.	PUNCT
ahs-3050	117	1	panattoni	panattoni	PROPN
ahs-3050	117	2	a.	a.	PROPN
ahs-3050	117	3	,	,	PUNCT
ahs-3050	117	4	luvisi	luvisi	VERB
ahs-3050	117	5	a.	a.	PROPN
ahs-3050	117	6	,	,	PUNCT
ahs-3050	117	7	triolo	triolo	PROPN
ahs-3050	117	8	e.	e.	PROPN
ahs-3050	117	9	,	,	PUNCT
ahs-3050	117	10	2013	2013	NUM
ahs-3050	117	11	elimination	elimination	NOUN
ahs-3050	117	12	of	of	ADP
ahs-3050	117	13	viruses	virus	NOUN
ahs-3050	117	14	in	in	ADP
ahs-3050	117	15	plants	plant	NOUN
ahs-3050	117	16	:	:	PUNCT
ahs-3050	117	17	twenty	twenty	NUM
ahs-3050	117	18	years	year	NOUN
ahs-3050	117	19	of	of	ADP
ahs-3050	117	20	progress	progress	NOUN
ahs-3050	117	21	.	.	PUNCT
ahs-3050	118	1	span	span	NOUN
ahs-3050	118	2	.	.	PUNCT
ahs-3050	119	1	j	j	PROPN
ahs-3050	119	2	agric	agric	PROPN
ahs-3050	119	3	.	.	PUNCT
ahs-3050	120	1	res	re	NOUN
ahs-3050	120	2	.	.	PROPN
ahs-3050	120	3	,	,	PUNCT
ahs-3050	120	4	11	11	NUM
ahs-3050	120	5	:	:	SYM
ahs-3050	120	6	173	173	NUM
ahs-3050	120	7	-	-	SYM
ahs-3050	120	8	188	188	NUM
ahs-3050	120	9	.	.	PUNCT
ahs-3050	121	1	park	park	PROPN
ahs-3050	121	2	t.h	t.h	PROPN
ahs-3050	121	3	.	.	PROPN
ahs-3050	121	4	,	,	PUNCT
ahs-3050	121	5	han	han	PROPN
ahs-3050	121	6	i.s	i.s	PROPN
ahs-3050	121	7	.	.	PROPN
ahs-3050	121	8	,	,	PUNCT
ahs-3050	121	9	kim	kim	PROPN
ahs-3050	121	10	j.b	j.b	PROPN
ahs-3050	121	11	.	.	PROPN
ahs-3050	121	12	,	,	PUNCT
ahs-3050	121	13	2010	2010	NUM
ahs-3050	121	14	review	review	NOUN
ahs-3050	121	15	on	on	ADP
ahs-3050	121	16	the	the	DET
ahs-3050	121	17	development	development	NOUN
ahs-3050	121	18	of	of	ADP
ahs-3050	121	19	virus	virus	NOUN
ahs-3050	121	20	resistant	resistant	ADJ
ahs-3050	121	21	plants	plant	NOUN
ahs-3050	121	22	in	in	ADP
ahs-3050	121	23	alstroemeria	alstroemeria	NOUN
ahs-3050	121	24	.	.	PUNCT
ahs-3050	122	1	j.	j.	PROPN
ahs-3050	122	2	plant	plant	PROPN
ahs-3050	122	3	biotechnol	biotechnol	NOUN
ahs-3050	122	4	.	.	PUNCT
ahs-3050	122	5	,	,	PUNCT
ahs-3050	122	6	37	37	NUM
ahs-3050	122	7	:	:	SYM
ahs-3050	122	8	370	370	NUM
ahs-3050	122	9	-	-	SYM
ahs-3050	122	10	378	378	NUM
ahs-3050	122	11	.	.	PUNCT
ahs-3050	123	1	rizzo	rizzo	PROPN
ahs-3050	123	2	d.	d.	PROPN
ahs-3050	123	3	,	,	PUNCT
ahs-3050	123	4	materazzi	materazzi	PROPN
ahs-3050	123	5	a.	a.	PROPN
ahs-3050	123	6	,	,	PUNCT
ahs-3050	123	7	stefani	stefani	PROPN
ahs-3050	123	8	l.	l.	PROPN
ahs-3050	123	9	,	,	PUNCT
ahs-3050	123	10	farina	farina	PROPN
ahs-3050	123	11	p.	p.	PROPN
ahs-3050	123	12	,	,	PUNCT
ahs-3050	123	13	vanarelli	vanarelli	PROPN
ahs-3050	123	14	s.	s.	PROPN
ahs-3050	123	15	,	,	PUNCT
ahs-3050	123	16	panattoni	panattoni	PROPN
ahs-3050	123	17	a.	a.	NOUN
ahs-3050	123	18	,	,	PUNCT
ahs-3050	123	19	luvisi	luvisi	VERB
ahs-3050	123	20	a.	a.	PROPN
ahs-3050	123	21	,	,	PUNCT
ahs-3050	123	22	2015	2015	NUM
ahs-3050	123	23	a	a	DET
ahs-3050	123	24	distribution	distribution	NOUN
ahs-3050	123	25	of	of	ADP
ahs-3050	123	26	regulated	regulated	ADJ
ahs-3050	123	27	viruses	virus	NOUN
ahs-3050	123	28	in	in	ADP
ahs-3050	123	29	cv	cv	PROPN
ahs-3050	123	30	.	.	PROPN
ahs-3050	123	31	sangiovese	sangiovese	NOUN
ahs-3050	123	32	vineyards	vineyard	NOUN
ahs-3050	123	33	in	in	ADP
ahs-3050	123	34	tuscany	tuscany	PROPN
ahs-3050	123	35	.	.	PUNCT
ahs-3050	124	1	j.	j.	PROPN
ahs-3050	124	2	plant	plant	PROPN
ahs-3050	124	3	pathol	pathol	PROPN
ahs-3050	124	4	.	.	PUNCT
ahs-3050	124	5	,	,	PUNCT
ahs-3050	124	6	97	97	NUM
ahs-3050	124	7	:	:	SYM
ahs-3050	124	8	131	131	NUM
ahs-3050	124	9	-	-	SYM
ahs-3050	124	10	135	135	NUM
ahs-3050	124	11	.	.	PUNCT
ahs-3050	125	1	rizzo	rizzo	PROPN
ahs-3050	125	2	d.	d.	PROPN
ahs-3050	125	3	,	,	PUNCT
ahs-3050	125	4	panattoni	panattoni	PROPN
ahs-3050	125	5	a.	a.	NOUN
ahs-3050	125	6	,	,	PUNCT
ahs-3050	125	7	stefani	stefani	PROPN
ahs-3050	125	8	l.	l.	PROPN
ahs-3050	125	9	,	,	PUNCT
ahs-3050	125	10	paoli	paoli	PROPN
ahs-3050	125	11	m.	m.	PROPN
ahs-3050	125	12	,	,	PUNCT
ahs-3050	125	13	nesi	nesi	PROPN
ahs-3050	125	14	b.	b.	PROPN
ahs-3050	125	15	,	,	PUNCT
ahs-3050	125	16	lazzereschi	lazzereschi	PROPN
ahs-3050	125	17	s.	s.	PROPN
ahs-3050	125	18	,	,	PUNCT
ahs-3050	125	19	vanarelli	vanarelli	PROPN
ahs-3050	125	20	s.	s.	PROPN
ahs-3050	125	21	,	,	PUNCT
ahs-3050	125	22	farina	farina	PROPN
ahs-3050	125	23	p.	p.	PROPN
ahs-3050	125	24	,	,	PUNCT
ahs-3050	125	25	della	della	PROPN
ahs-3050	125	26	bartola	bartola	PROPN
ahs-3050	125	27	m.	m.	NOUN
ahs-3050	125	28	,	,	PUNCT
ahs-3050	125	29	materazzi	materazzi	PROPN
ahs-3050	125	30	a.	a.	PROPN
ahs-3050	125	31	,	,	PUNCT
ahs-3050	125	32	luvisi	luvisi	VERB
ahs-3050	125	33	a.	a.	PROPN
ahs-3050	125	34	,	,	PUNCT
ahs-3050	125	35	2015	2015	NUM
ahs-3050	125	36	b	b	NOUN
ahs-3050	125	37	first	first	ADJ
ahs-3050	125	38	report	report	NOUN
ahs-3050	125	39	of	of	ADP
ahs-3050	125	40	zantedeschia	zantedeschia	ADJ
ahs-3050	125	41	mild	mild	ADJ
ahs-3050	125	42	mosaic	mosaic	ADJ
ahs-3050	125	43	virus	virus	NOUN
ahs-3050	125	44	on	on	ADP
ahs-3050	125	45	zantedeschia	zantedeschia	PROPN
ahs-3050	125	46	aethiopica	aethiopica	PROPN
ahs-3050	125	47	(	(	PUNCT
ahs-3050	125	48	l	l	NOUN
ahs-3050	125	49	)	)	PUNCT
ahs-3050	125	50	spreng	spreng	PROPN
ahs-3050	125	51	in	in	ADP
ahs-3050	125	52	italy	italy	PROPN
ahs-3050	125	53	.	.	PUNCT
ahs-3050	126	1	j.	j.	PROPN
ahs-3050	126	2	plant	plant	PROPN
ahs-3050	126	3	pathol	pathol	PROPN
ahs-3050	126	4	.	.	PUNCT
ahs-3050	126	5	,	,	PUNCT
ahs-3050	126	6	92	92	NUM
ahs-3050	126	7	:	:	SYM
ahs-3050	126	8	399	399	NUM
ahs-3050	126	9	.	.	PUNCT
ahs-3050	127	1	rizzo	rizzo	PROPN
ahs-3050	127	2	d.	d.	PROPN
ahs-3050	127	3	,	,	PUNCT
ahs-3050	127	4	stefani	stefani	PROPN
ahs-3050	127	5	l.	l.	PROPN
ahs-3050	127	6	,	,	PUNCT
ahs-3050	127	7	paoli	paoli	PROPN
ahs-3050	127	8	m.	m.	PROPN
ahs-3050	127	9	,	,	PUNCT
ahs-3050	127	10	triolo	triolo	PROPN
ahs-3050	127	11	e.	e.	PROPN
ahs-3050	127	12	,	,	PUNCT
ahs-3050	127	13	panattoni	panattoni	PROPN
ahs-3050	127	14	a.	a.	NOUN
ahs-3050	127	15	,	,	PUNCT
ahs-3050	127	16	luvisi	luvisi	VERB
ahs-3050	127	17	a.	a.	PROPN
ahs-3050	127	18	,	,	PUNCT
ahs-3050	127	19	2012	2012	NUM
ahs-3050	127	20	the	the	DET
ahs-3050	127	21	sustainability	sustainability	NOUN
ahs-3050	127	22	of	of	ADP
ahs-3050	127	23	old	old	ADJ
ahs-3050	127	24	grapevine	grapevine	NOUN
ahs-3050	127	25	mother	mother	NOUN
ahs-3050	127	26	plants	plant	NOUN
ahs-3050	127	27	in	in	ADP
ahs-3050	127	28	relation	relation	NOUN
ahs-3050	127	29	to	to	ADP
ahs-3050	127	30	new	new	ADJ
ahs-3050	127	31	mandatory	mandatory	ADJ
ahs-3050	127	32	diagnostic	diagnostic	ADJ
ahs-3050	127	33	tests	test	NOUN
ahs-3050	127	34	for	for	ADP
ahs-3050	127	35	virus	virus	NOUN
ahs-3050	127	36	control	control	NOUN
ahs-3050	127	37	.	.	PUNCT
ahs-3050	128	1	adv	adv	PROPN
ahs-3050	128	2	.	.	PUNCT
ahs-3050	129	1	hort	hort	PROPN
ahs-3050	129	2	.	.	PUNCT
ahs-3050	130	1	sci	sci	PROPN
ahs-3050	130	2	.	.	PROPN
ahs-3050	130	3	,	,	PUNCT
ahs-3050	130	4	26(3	26(3	NUM
ahs-3050	130	5	-	-	SYM
ahs-3050	130	6	4	4	NUM
ahs-3050	130	7	):	):	PUNCT
ahs-3050	130	8	148150	148150	NUM
ahs-3050	130	9	.	.	PUNCT
ahs-3050	131	1	spence	spence	PROPN
ahs-3050	131	2	n.j	n.j	PROPN
ahs-3050	131	3	.	.	PROPN
ahs-3050	131	4	,	,	PUNCT
ahs-3050	131	5	mills	mills	PROPN
ahs-3050	131	6	p.r	p.r	PROPN
ahs-3050	131	7	.	.	PROPN
ahs-3050	131	8	,	,	PUNCT
ahs-3050	131	9	barbara	barbara	PROPN
ahs-3050	131	10	d.j	d.j	PROPN
ahs-3050	131	11	.	.	PROPN
ahs-3050	131	12	,	,	PUNCT
ahs-3050	131	13	2000	2000	NUM
ahs-3050	131	14	a	a	DET
ahs-3050	131	15	surbey	surbey	NOUN
ahs-3050	131	16	of	of	ADP
ahs-3050	131	17	viruses	virus	NOUN
ahs-3050	131	18	of	of	ADP
ahs-3050	131	19	alstroemeria	alstroemeria	NOUN
ahs-3050	131	20	in	in	ADP
ahs-3050	131	21	the	the	DET
ahs-3050	131	22	uk	uk	PROPN
ahs-3050	131	23	and	and	CCONJ
ahs-3050	131	24	the	the	DET
ahs-3050	131	25	characterization	characterization	NOUN
ahs-3050	131	26	of	of	ADP
ahs-3050	131	27	carlaviruses	carlaviruse	NOUN
ahs-3050	131	28	infecting	infect	VERB
ahs-3050	131	29	alstroemeria	alstroemeria	NOUN
ahs-3050	131	30	.	.	PUNCT
ahs-3050	132	1	eur	eur	PROPN
ahs-3050	132	2	.	.	PUNCT
ahs-3050	133	1	j.	j.	PROPN
ahs-3050	133	2	plant	plant	PROPN
ahs-3050	133	3	pathol	pathol	PROPN
ahs-3050	133	4	.	.	PUNCT
ahs-3050	133	5	,	,	PUNCT
ahs-3050	133	6	106	106	NUM
ahs-3050	133	7	:	:	PUNCT
ahs-3050	133	8	843	843	NUM
ahs-3050	133	9	-	-	SYM
ahs-3050	133	10	847	847	NUM
ahs-3050	133	11	.	.	PUNCT
ahs-3050	134	1	wei	wei	PROPN
ahs-3050	134	2	t.	t.	PROPN
ahs-3050	134	3	,	,	PUNCT
ahs-3050	134	4	lu	lu	PROPN
ahs-3050	134	5	g.	g.	PROPN
ahs-3050	134	6	,	,	PUNCT
ahs-3050	134	7	clover	clover	NOUN
ahs-3050	134	8	g.r.g	g.r.g	PROPN
ahs-3050	134	9	.	.	PROPN
ahs-3050	134	10	,	,	PUNCT
ahs-3050	134	11	2009	2009	NUM
ahs-3050	134	12	a	a	DET
ahs-3050	134	13	multiplex	multiplex	PROPN
ahs-3050	134	14	rt	rt	PROPN
ahs-3050	134	15	-	-	PUNCT
ahs-3050	134	16	pcr	pcr	PROPN
ahs-3050	134	17	for	for	ADP
ahs-3050	134	18	the	the	DET
ahs-3050	134	19	detection	detection	NOUN
ahs-3050	134	20	of	of	ADP
ahs-3050	134	21	potato	potato	NOUN
ahs-3050	134	22	yellow	yellow	ADJ
ahs-3050	134	23	vein	vein	NOUN
ahs-3050	134	24	virus	virus	NOUN
ahs-3050	134	25	,	,	PUNCT
ahs-3050	134	26	tobacco	tobacco	NOUN
ahs-3050	134	27	rattle	rattle	NOUN
ahs-3050	134	28	virus	virus	NOUN
ahs-3050	134	29	and	and	CCONJ
ahs-3050	134	30	tomato	tomato	NOUN
ahs-3050	134	31	infectious	infectious	ADJ
ahs-3050	134	32	chlorosis	chlorosis	NOUN
ahs-3050	134	33	virus	virus	NOUN
ahs-3050	134	34	in	in	ADP
ahs-3050	134	35	potato	potato	NOUN
ahs-3050	134	36	with	with	ADP
ahs-3050	134	37	a	a	DET
ahs-3050	134	38	plant	plant	NOUN
ahs-3050	134	39	internal	internal	ADJ
ahs-3050	134	40	amplification	amplification	NOUN
ahs-3050	134	41	control	control	NOUN
ahs-3050	134	42	.	.	PUNCT
ahs-3050	135	1	plant	plant	NOUN
ahs-3050	135	2	pathol	pathol	NOUN
ahs-3050	135	3	.	.	PUNCT
ahs-3050	135	4	,	,	PUNCT
ahs-3050	135	5	58	58	NUM
ahs-3050	135	6	:	:	PUNCT
ahs-3050	135	7	203	203	NUM
ahs-3050	135	8	-	-	SYM
ahs-3050	135	9	209	209	NUM
ahs-3050	135	10	.	.	PUNCT
ahs-3050	136	1	wen	wen	PROPN
ahs-3050	136	2	-	-	PROPN
ahs-3050	136	3	chi	chi	PROPN
ahs-3050	136	4	h.	h.	PROPN
ahs-3050	136	5	,	,	PUNCT
ahs-3050	136	6	chin	chin	PROPN
ahs-3050	136	7	-	-	PUNCT
ahs-3050	136	8	hsing	hsing	PROPN
ahs-3050	136	9	h.	h.	PROPN
ahs-3050	136	10	,	,	PUNCT
ahs-3050	136	11	shu	shu	PROPN
ahs-3050	136	12	-	-	PUNCT
ahs-3050	136	13	chuan	chuan	PROPN
ahs-3050	136	14	l.	l.	PROPN
ahs-3050	136	15	,	,	PUNCT
ahs-3050	136	16	chun	chun	PROPN
ahs-3050	136	17	-	-	PUNCT
ahs-3050	136	18	i	i	PROPN
ahs-3050	136	19	w.	w.	PROPN
ahs-3050	136	20	,	,	PUNCT
ahs-3050	136	21	ya	ya	PROPN
ahs-3050	136	22	-	-	PUNCT
ahs-3050	136	23	chun	chun	PROPN
ahs-3050	136	24	c.	c.	PROPN
ahs-3050	136	25	,	,	PUNCT
ahs-3050	136	26	2010	2010	NUM
ahs-3050	136	27	detection	detection	NOUN
ahs-3050	136	28	of	of	ADP
ahs-3050	136	29	four	four	NUM
ahs-3050	136	30	calla	calla	NOUN
ahs-3050	136	31	potyviruses	potyviruse	NOUN
ahs-3050	136	32	by	by	ADP
ahs-3050	136	33	multiplex	multiplex	PROPN
ahs-3050	136	34	rt	rt	PROPN
ahs-3050	136	35	-	-	PUNCT
ahs-3050	136	36	pcr	pcr	PROPN
ahs-3050	136	37	using	use	VERB
ahs-3050	136	38	nad5	nad5	PROPN
ahs-3050	136	39	mrna	mrna	PROPN
ahs-3050	136	40	as	as	ADP
ahs-3050	136	41	an	an	DET
ahs-3050	136	42	internal	internal	ADJ
ahs-3050	136	43	control	control	NOUN
ahs-3050	136	44	.	.	PUNCT
ahs-3050	137	1	eur	eur	PROPN
ahs-3050	137	2	.	.	PUNCT
ahs-3050	138	1	j.	j.	PROPN
ahs-3050	138	2	plant	plant	PROPN
ahs-3050	138	3	pathol	pathol	PROPN
ahs-3050	138	4	.	.	PUNCT
ahs-3050	138	5	,	,	PUNCT
ahs-3050	138	6	126	126	NUM
ahs-3050	138	7	:	:	SYM
ahs-3050	138	8	43	43	NUM
ahs-3050	138	9	-	-	SYM
ahs-3050	138	10	52	52	NUM
ahs-3050	138	11	.	.	PUNCT