id	sid	tid	token	lemma	pos
ahs-3074	1	1	impaginato	impaginato	PROPN
ahs-3074	1	2	239	239	NUM
ahs-3074	1	3	1	1	NUM
ahs-3074	1	4	.	.	PUNCT
ahs-3074	2	1	introduction	introduction	NOUN
ahs-3074	2	2	a	a	DET
ahs-3074	2	3	variety	variety	NOUN
ahs-3074	2	4	of	of	ADP
ahs-3074	2	5	horticultural	horticultural	ADJ
ahs-3074	2	6	products	product	NOUN
ahs-3074	2	7	is	be	AUX
ahs-3074	2	8	grown	grow	VERB
ahs-3074	2	9	in	in	ADP
ahs-3074	2	10	afghanistan	afghanistan	PROPN
ahs-3074	2	11	with	with	ADP
ahs-3074	2	12	the	the	DET
ahs-3074	2	13	potential	potential	NOUN
ahs-3074	2	14	to	to	PART
ahs-3074	2	15	be	be	AUX
ahs-3074	2	16	(	(	PUNCT
ahs-3074	2	17	re)developed	re)develope	VERB
ahs-3074	2	18	into	into	ADP
ahs-3074	2	19	valuable	valuable	ADJ
ahs-3074	2	20	export	export	NOUN
ahs-3074	2	21	commodities	commodity	NOUN
ahs-3074	2	22	and	and	CCONJ
ahs-3074	2	23	brands	brand	NOUN
ahs-3074	2	24	.	.	PUNCT
ahs-3074	3	1	the	the	DET
ahs-3074	3	2	primary	primary	ADJ
ahs-3074	3	3	engine	engine	NOUN
ahs-3074	3	4	of	of	ADP
ahs-3074	3	5	the	the	DET
ahs-3074	3	6	afghan	afghan	ADJ
ahs-3074	3	7	economy	economy	NOUN
ahs-3074	3	8	is	be	AUX
ahs-3074	3	9	its	its	PRON
ahs-3074	3	10	agriculture	agriculture	NOUN
ahs-3074	3	11	industry	industry	NOUN
ahs-3074	3	12	,	,	PUNCT
ahs-3074	3	13	which	which	PRON
ahs-3074	3	14	engages	engage	VERB
ahs-3074	3	15	approximately	approximately	ADV
ahs-3074	3	16	80	80	NUM
ahs-3074	3	17	%	%	NOUN
ahs-3074	3	18	of	of	ADP
ahs-3074	3	19	the	the	DET
ahs-3074	3	20	working	work	VERB
ahs-3074	3	21	population	population	NOUN
ahs-3074	3	22	.	.	PUNCT
ahs-3074	4	1	fruit	fruit	NOUN
ahs-3074	4	2	trees	tree	NOUN
ahs-3074	4	3	,	,	PUNCT
ahs-3074	4	4	such	such	ADJ
ahs-3074	4	5	as	as	ADP
ahs-3074	4	6	peach	peach	NOUN
ahs-3074	4	7	,	,	PUNCT
ahs-3074	4	8	plum	plum	NOUN
ahs-3074	4	9	,	,	PUNCT
ahs-3074	4	10	apricot	apricot	NOUN
ahs-3074	4	11	or	or	CCONJ
ahs-3074	4	12	almond	almond	NOUN
ahs-3074	4	13	and	and	CCONJ
ahs-3074	4	14	grape	grape	NOUN
ahs-3074	4	15	are	be	AUX
ahs-3074	4	16	therefore	therefore	ADV
ahs-3074	4	17	of	of	ADP
ahs-3074	4	18	significant	significant	ADJ
ahs-3074	4	19	economic	economic	ADJ
ahs-3074	4	20	importance	importance	NOUN
ahs-3074	4	21	to	to	ADP
ahs-3074	4	22	the	the	DET
ahs-3074	4	23	country	country	NOUN
ahs-3074	4	24	,	,	PUNCT
ahs-3074	4	25	with	with	ADP
ahs-3074	4	26	importing	import	VERB
ahs-3074	4	27	or	or	CCONJ
ahs-3074	4	28	local	local	ADJ
ahs-3074	4	29	exchange	exchange	NOUN
ahs-3074	4	30	of	of	ADP
ahs-3074	4	31	plant	plant	NOUN
ahs-3074	4	32	material	material	NOUN
ahs-3074	4	33	for	for	ADP
ahs-3074	4	34	propagation	propagation	NOUN
ahs-3074	4	35	or	or	CCONJ
ahs-3074	4	36	commercial	commercial	ADJ
ahs-3074	4	37	growing	growing	NOUN
ahs-3074	4	38	of	of	ADP
ahs-3074	4	39	these	these	DET
ahs-3074	4	40	fruits	fruit	NOUN
ahs-3074	4	41	likely	likely	ADJ
ahs-3074	4	42	.	.	PUNCT
ahs-3074	5	1	the	the	DET
ahs-3074	5	2	absence	absence	NOUN
ahs-3074	5	3	of	of	ADP
ahs-3074	5	4	certain	certain	ADJ
ahs-3074	5	5	viruses	virus	NOUN
ahs-3074	5	6	is	be	AUX
ahs-3074	5	7	an	an	DET
ahs-3074	5	8	essential	essential	ADJ
ahs-3074	5	9	pre	pre	NOUN
ahs-3074	5	10	-	-	NOUN
ahs-3074	5	11	requisite	requisite	ADJ
ahs-3074	5	12	for	for	ADP
ahs-3074	5	13	virus	virus	NOUN
ahs-3074	5	14	-	-	PUNCT
ahs-3074	5	15	free	free	ADJ
ahs-3074	5	16	certification	certification	NOUN
ahs-3074	5	17	of	of	ADP
ahs-3074	5	18	plant	plant	NOUN
ahs-3074	5	19	material	material	NOUN
ahs-3074	5	20	in	in	ADP
ahs-3074	5	21	general	general	ADJ
ahs-3074	5	22	in	in	ADP
ahs-3074	5	23	many	many	ADJ
ahs-3074	5	24	parts	part	NOUN
ahs-3074	5	25	of	of	ADP
ahs-3074	5	26	the	the	DET
ahs-3074	5	27	world	world	NOUN
ahs-3074	5	28	(	(	PUNCT
ahs-3074	5	29	golino	golino	NOUN
ahs-3074	5	30	and	and	CCONJ
ahs-3074	5	31	savino	savino	NOUN
ahs-3074	5	32	,	,	PUNCT
ahs-3074	5	33	2005	2005	NUM
ahs-3074	5	34	;	;	PUNCT
ahs-3074	5	35	barba	barba	PROPN
ahs-3074	5	36	et	et	PROPN
ahs-3074	5	37	al	al	PROPN
ahs-3074	5	38	.	.	PROPN
ahs-3074	5	39	,	,	PUNCT
ahs-3074	5	40	2015	2015	NUM
ahs-3074	5	41	)	)	PUNCT
ahs-3074	5	42	.	.	PUNCT
ahs-3074	6	1	in	in	ADP
ahs-3074	6	2	afghanistan	afghanistan	PROPN
ahs-3074	6	3	,	,	PUNCT
ahs-3074	6	4	there	there	PRON
ahs-3074	6	5	is	be	VERB
ahs-3074	6	6	a	a	DET
ahs-3074	6	7	tremendous	tremendous	ADJ
ahs-3074	6	8	increase	increase	NOUN
ahs-3074	6	9	in	in	ADP
ahs-3074	6	10	fruit	fruit	NOUN
ahs-3074	6	11	tree	tree	NOUN
ahs-3074	6	12	nursery	nursery	NOUN
ahs-3074	6	13	production	production	NOUN
ahs-3074	6	14	and	and	CCONJ
ahs-3074	6	15	regulation	regulation	NOUN
ahs-3074	6	16	of	of	ADP
ahs-3074	6	17	phytosanitary	phytosanitary	ADJ
ahs-3074	6	18	certification	certification	NOUN
ahs-3074	6	19	of	of	ADP
ahs-3074	6	20	plant	plant	NOUN
ahs-3074	6	21	propagation	propagation	NOUN
ahs-3074	6	22	material	material	NOUN
ahs-3074	6	23	is	be	AUX
ahs-3074	6	24	therefore	therefore	ADV
ahs-3074	6	25	of	of	ADP
ahs-3074	6	26	major	major	ADJ
ahs-3074	6	27	importance	importance	NOUN
ahs-3074	6	28	.	.	PUNCT
ahs-3074	7	1	in	in	ADP
ahs-3074	7	2	2005	2005	NUM
ahs-3074	7	3	the	the	DET
ahs-3074	7	4	ministry	ministry	PROPN
ahs-3074	7	5	of	of	ADP
ahs-3074	7	6	agriculture	agriculture	PROPN
ahs-3074	7	7	,	,	PUNCT
ahs-3074	7	8	irrigation	irrigation	NOUN
ahs-3074	7	9	and	and	CCONJ
ahs-3074	7	10	livestock	livestock	NOUN
ahs-3074	7	11	(	(	PUNCT
ahs-3074	7	12	mail	mail	NOUN
ahs-3074	7	13	)	)	PUNCT
ahs-3074	7	14	stated	state	VERB
ahs-3074	7	15	in	in	ADP
ahs-3074	7	16	the	the	DET
ahs-3074	7	17	agriculture	agriculture	NOUN
ahs-3074	7	18	master	master	NOUN
ahs-3074	7	19	plan	plan	NOUN
ahs-3074	7	20	that	that	SCONJ
ahs-3074	7	21	the	the	DET
ahs-3074	7	22	rejuvenation	rejuvenation	NOUN
ahs-3074	7	23	of	of	ADP
ahs-3074	7	24	the	the	DET
ahs-3074	7	25	horticulture	horticulture	NOUN
ahs-3074	7	26	sector	sector	NOUN
ahs-3074	7	27	would	would	AUX
ahs-3074	7	28	be	be	AUX
ahs-3074	7	29	a	a	DET
ahs-3074	7	30	government	government	NOUN
ahs-3074	7	31	priority	priority	NOUN
ahs-3074	7	32	.	.	PUNCT
ahs-3074	8	1	thriving	thrive	VERB
ahs-3074	8	2	in	in	ADP
ahs-3074	8	3	the	the	DET
ahs-3074	8	4	1970s	1970	NOUN
ahs-3074	8	5	,	,	PUNCT
ahs-3074	8	6	this	this	DET
ahs-3074	8	7	sector	sector	NOUN
ahs-3074	8	8	has	have	AUX
ahs-3074	8	9	become	become	VERB
ahs-3074	8	10	incapable	incapable	ADJ
ahs-3074	8	11	of	of	ADP
ahs-3074	8	12	competing	compete	VERB
ahs-3074	8	13	in	in	ADP
ahs-3074	8	14	the	the	DET
ahs-3074	8	15	international	international	ADJ
ahs-3074	8	16	market	market	NOUN
ahs-3074	8	17	.	.	PUNCT
ahs-3074	9	1	three	three	NUM
ahs-3074	9	2	interconnected	interconnected	ADJ
ahs-3074	9	3	problems	problem	NOUN
ahs-3074	9	4	have	have	AUX
ahs-3074	9	5	been	be	AUX
ahs-3074	9	6	identified	identify	VERB
ahs-3074	9	7	for	for	ADP
ahs-3074	9	8	the	the	DET
ahs-3074	9	9	industry	industry	NOUN
ahs-3074	9	10	:	:	PUNCT
ahs-3074	9	11	1	1	X
ahs-3074	9	12	)	)	PUNCT
ahs-3074	9	13	the	the	DET
ahs-3074	9	14	existing	exist	VERB
ahs-3074	9	15	orchards	orchard	NOUN
ahs-3074	9	16	are	be	AUX
ahs-3074	9	17	run	run	VERB
ahs-3074	9	18	-	-	PUNCT
ahs-3074	9	19	down	down	NOUN
ahs-3074	9	20	and	and	CCONJ
ahs-3074	9	21	production	production	NOUN
ahs-3074	9	22	is	be	AUX
ahs-3074	9	23	adv	adv	PROPN
ahs-3074	9	24	.	.	PUNCT
ahs-3074	9	25	hort	hort	PROPN
ahs-3074	9	26	.	.	PUNCT
ahs-3074	10	1	sci	sci	PROPN
ahs-3074	10	2	.	.	PROPN
ahs-3074	10	3	,	,	PUNCT
ahs-3074	10	4	2016	2016	NUM
ahs-3074	10	5	30(4	30(4	NUM
ahs-3074	10	6	):	):	PUNCT
ahs-3074	10	7	239	239	NUM
ahs-3074	10	8	-	-	SYM
ahs-3074	10	9	248	248	NUM
ahs-3074	10	10	doi	doi	NOUN
ahs-3074	10	11	:	:	PUNCT
ahs-3074	10	12	10.13128	10.13128	NUM
ahs-3074	10	13	/	/	SYM
ahs-3074	10	14	ahs-20350	ahs-20350	NOUN
ahs-3074	10	15	the	the	DET
ahs-3074	10	16	phytosanitary	phytosanitary	ADJ
ahs-3074	10	17	status	status	NOUN
ahs-3074	10	18	of	of	ADP
ahs-3074	10	19	the	the	DET
ahs-3074	10	20	national	national	ADJ
ahs-3074	10	21	collection	collection	NOUN
ahs-3074	10	22	of	of	ADP
ahs-3074	10	23	fruits	fruit	NOUN
ahs-3074	10	24	and	and	CCONJ
ahs-3074	10	25	nuts	nut	NOUN
ahs-3074	10	26	of	of	ADP
ahs-3074	10	27	afghanistan	afghanistan	PROPN
ahs-3074	10	28	and	and	CCONJ
ahs-3074	10	29	the	the	DET
ahs-3074	10	30	private	private	ADJ
ahs-3074	10	31	mother	mother	NOUN
ahs-3074	10	32	stock	stock	NOUN
ahs-3074	10	33	nurseries	nursery	NOUN
ahs-3074	10	34	:	:	PUNCT
ahs-3074	10	35	a	a	DET
ahs-3074	10	36	virus	virus	NOUN
ahs-3074	10	37	survey	survey	VERB
ahs-3074	10	38	s.	s.	PROPN
ahs-3074	10	39	rehman	rehman	PROPN
ahs-3074	10	40	1	1	NUM
ahs-3074	10	41	,	,	PUNCT
ahs-3074	10	42	j.	j.	PROPN
ahs-3074	10	43	ahmad	ahmad	PROPN
ahs-3074	10	44	1	1	NUM
ahs-3074	10	45	,	,	PUNCT
ahs-3074	10	46	c.	c.	PROPN
ahs-3074	10	47	lanzoni	lanzoni	PROPN
ahs-3074	10	48	2	2	NUM
ahs-3074	10	49	,	,	PUNCT
ahs-3074	10	50	c.	c.	PROPN
ahs-3074	10	51	rubies	ruby	NOUN
ahs-3074	10	52	autonell	autonell	VERB
ahs-3074	10	53	2	2	NUM
ahs-3074	10	54	,	,	PUNCT
ahs-3074	10	55	c.	c.	PROPN
ahs-3074	10	56	ratti	ratti	NOUN
ahs-3074	10	57	2	2	NUM
ahs-3074	10	58	(	(	PUNCT
ahs-3074	10	59	*	*	NOUN
ahs-3074	10	60	)	)	SYM
ahs-3074	10	61	1	1	NUM
ahs-3074	10	62	plant	plant	NOUN
ahs-3074	10	63	biotecnology	biotecnology	NOUN
ahs-3074	10	64	laboratory	laboratory	NOUN
ahs-3074	10	65	,	,	PUNCT
ahs-3074	10	66	seed	seed	NOUN
ahs-3074	10	67	and	and	CCONJ
ahs-3074	10	68	planting	planting	NOUN
ahs-3074	10	69	material	material	NOUN
ahs-3074	10	70	certification	certification	NOUN
ahs-3074	10	71	directorate	directorate	NOUN
ahs-3074	10	72	,	,	PUNCT
ahs-3074	10	73	ministry	ministry	PROPN
ahs-3074	10	74	of	of	ADP
ahs-3074	10	75	agriculture	agriculture	PROPN
ahs-3074	10	76	,	,	PUNCT
ahs-3074	10	77	irrigation	irrigation	NOUN
ahs-3074	10	78	and	and	CCONJ
ahs-3074	10	79	livestock	livestock	NOUN
ahs-3074	10	80	,	,	PUNCT
ahs-3074	10	81	kabul	kabul	PROPN
ahs-3074	10	82	,	,	PUNCT
ahs-3074	10	83	afghanistan	afghanistan	PROPN
ahs-3074	10	84	.	.	PUNCT
ahs-3074	11	1	2	2	NUM
ahs-3074	11	2	dipartimento	dipartimento	NOUN
ahs-3074	11	3	di	di	PROPN
ahs-3074	11	4	scienze	scienze	PROPN
ahs-3074	11	5	agrarie	agrarie	PROPN
ahs-3074	11	6	,	,	PUNCT
ahs-3074	11	7	università	università	PROPN
ahs-3074	11	8	di	di	PROPN
ahs-3074	11	9	bologna	bologna	PROPN
ahs-3074	11	10	,	,	PUNCT
ahs-3074	11	11	via	via	ADP
ahs-3074	11	12	g.	g.	PROPN
ahs-3074	11	13	fanin	fanin	PROPN
ahs-3074	11	14	,	,	PUNCT
ahs-3074	11	15	40	40	NUM
ahs-3074	11	16	,	,	PUNCT
ahs-3074	11	17	40127	40127	NUM
ahs-3074	11	18	bologna	bologna	NOUN
ahs-3074	11	19	,	,	PUNCT
ahs-3074	11	20	italy	italy	PROPN
ahs-3074	11	21	.	.	PUNCT
ahs-3074	12	1	key	key	ADJ
ahs-3074	12	2	words	word	NOUN
ahs-3074	12	3	:	:	PUNCT
ahs-3074	12	4	germplasm	germplasm	NOUN
ahs-3074	12	5	,	,	PUNCT
ahs-3074	12	6	plant	plant	NOUN
ahs-3074	12	7	pathology	pathology	NOUN
ahs-3074	12	8	,	,	PUNCT
ahs-3074	12	9	virus	virus	NOUN
ahs-3074	12	10	disease	disease	NOUN
ahs-3074	12	11	.	.	PUNCT
ahs-3074	13	1	abstract	abstract	ADJ
ahs-3074	13	2	:	:	PUNCT
ahs-3074	13	3	the	the	DET
ahs-3074	13	4	horticultural	horticultural	ADJ
ahs-3074	13	5	industry	industry	NOUN
ahs-3074	13	6	is	be	AUX
ahs-3074	13	7	a	a	DET
ahs-3074	13	8	vital	vital	ADJ
ahs-3074	13	9	component	component	NOUN
ahs-3074	13	10	of	of	ADP
ahs-3074	13	11	the	the	DET
ahs-3074	13	12	agriculture	agriculture	NOUN
ahs-3074	13	13	sector	sector	NOUN
ahs-3074	13	14	of	of	ADP
ahs-3074	13	15	afghanistan	afghanistan	PROPN
ahs-3074	13	16	,	,	PUNCT
ahs-3074	13	17	the	the	DET
ahs-3074	13	18	primary	primary	ADJ
ahs-3074	13	19	engine	engine	NOUN
ahs-3074	13	20	of	of	ADP
ahs-3074	13	21	the	the	DET
ahs-3074	13	22	country	country	NOUN
ahs-3074	13	23	’s	’s	PART
ahs-3074	13	24	recovering	recover	VERB
ahs-3074	13	25	economy	economy	NOUN
ahs-3074	13	26	which	which	PRON
ahs-3074	13	27	engages	engage	VERB
ahs-3074	13	28	approximately	approximately	ADV
ahs-3074	13	29	80	80	NUM
ahs-3074	13	30	%	%	NOUN
ahs-3074	13	31	of	of	ADP
ahs-3074	13	32	the	the	DET
ahs-3074	13	33	working	work	VERB
ahs-3074	13	34	population	population	NOUN
ahs-3074	13	35	.	.	PUNCT
ahs-3074	14	1	this	this	DET
ahs-3074	14	2	sector	sector	NOUN
ahs-3074	14	3	was	be	AUX
ahs-3074	14	4	thriving	thrive	VERB
ahs-3074	14	5	in	in	ADP
ahs-3074	14	6	the	the	DET
ahs-3074	14	7	1970s	1970	NOUN
ahs-3074	14	8	,	,	PUNCT
ahs-3074	14	9	but	but	CCONJ
ahs-3074	14	10	is	be	AUX
ahs-3074	14	11	today	today	NOUN
ahs-3074	14	12	incapable	incapable	ADJ
ahs-3074	14	13	of	of	ADP
ahs-3074	14	14	competing	compete	VERB
ahs-3074	14	15	in	in	ADP
ahs-3074	14	16	the	the	DET
ahs-3074	14	17	international	international	ADJ
ahs-3074	14	18	market	market	NOUN
ahs-3074	14	19	.	.	PUNCT
ahs-3074	15	1	to	to	PART
ahs-3074	15	2	recover	recover	VERB
ahs-3074	15	3	and	and	CCONJ
ahs-3074	15	4	develop	develop	VERB
ahs-3074	15	5	the	the	DET
ahs-3074	15	6	horticulture	horticulture	NOUN
ahs-3074	15	7	of	of	ADP
ahs-3074	15	8	the	the	DET
ahs-3074	15	9	country	country	NOUN
ahs-3074	15	10	,	,	PUNCT
ahs-3074	15	11	the	the	DET
ahs-3074	15	12	european	european	PROPN
ahs-3074	15	13	community	community	PROPN
ahs-3074	15	14	(	(	PUNCT
ahs-3074	15	15	ec	ec	PROPN
ahs-3074	15	16	)	)	PUNCT
ahs-3074	15	17	supports	support	VERB
ahs-3074	15	18	the	the	DET
ahs-3074	15	19	phdp	phdp	NOUN
ahs-3074	15	20	(	(	PUNCT
ahs-3074	15	21	perennial	perennial	ADJ
ahs-3074	15	22	horticulture	horticulture	NOUN
ahs-3074	15	23	development	development	NOUN
ahs-3074	15	24	project	project	NOUN
ahs-3074	15	25	)	)	PUNCT
ahs-3074	15	26	,	,	PUNCT
ahs-3074	15	27	to	to	PART
ahs-3074	15	28	provide	provide	VERB
ahs-3074	15	29	true	true	ADJ
ahs-3074	15	30	to	to	PART
ahs-3074	15	31	type	type	VERB
ahs-3074	15	32	/	/	SYM
ahs-3074	15	33	ecotype	ecotype	ADJ
ahs-3074	15	34	and	and	CCONJ
ahs-3074	15	35	healthy	healthy	ADJ
ahs-3074	15	36	planting	planting	NOUN
ahs-3074	15	37	materials	material	NOUN
ahs-3074	15	38	,	,	PUNCT
ahs-3074	15	39	and	and	CCONJ
ahs-3074	15	40	the	the	DET
ahs-3074	15	41	plant	plant	NOUN
ahs-3074	15	42	biotechnology	biotechnology	NOUN
ahs-3074	15	43	laboratory	laboratory	NOUN
ahs-3074	15	44	,	,	PUNCT
ahs-3074	15	45	to	to	PART
ahs-3074	15	46	ensure	ensure	VERB
ahs-3074	15	47	the	the	DET
ahs-3074	15	48	health	health	NOUN
ahs-3074	15	49	status	status	NOUN
ahs-3074	15	50	of	of	ADP
ahs-3074	15	51	local	local	ADJ
ahs-3074	15	52	germplasm	germplasm	NOUN
ahs-3074	15	53	.	.	PUNCT
ahs-3074	16	1	this	this	DET
ahs-3074	16	2	laboratory	laboratory	NOUN
ahs-3074	16	3	started	start	VERB
ahs-3074	16	4	screening	screen	VERB
ahs-3074	16	5	the	the	DET
ahs-3074	16	6	health	health	NOUN
ahs-3074	16	7	status	status	NOUN
ahs-3074	16	8	of	of	ADP
ahs-3074	16	9	the	the	DET
ahs-3074	16	10	afghan	afghan	ADJ
ahs-3074	16	11	germplasm	germplasm	NOUN
ahs-3074	16	12	national	national	ADJ
ahs-3074	16	13	collections	collection	NOUN
ahs-3074	16	14	in	in	ADP
ahs-3074	16	15	order	order	NOUN
ahs-3074	16	16	to	to	PART
ahs-3074	16	17	ensure	ensure	VERB
ahs-3074	16	18	the	the	DET
ahs-3074	16	19	multiplication	multiplication	NOUN
ahs-3074	16	20	of	of	ADP
ahs-3074	16	21	not	not	PART
ahs-3074	16	22	only	only	ADV
ahs-3074	16	23	the	the	DET
ahs-3074	16	24	best	well	ADV
ahs-3074	16	25	-	-	PUNCT
ahs-3074	16	26	selected	select	VERB
ahs-3074	16	27	varieties	variety	NOUN
ahs-3074	16	28	or	or	CCONJ
ahs-3074	16	29	ecotype	ecotype	ADJ
ahs-3074	16	30	,	,	PUNCT
ahs-3074	16	31	but	but	CCONJ
ahs-3074	16	32	also	also	ADV
ahs-3074	16	33	to	to	PART
ahs-3074	16	34	avoid	avoid	VERB
ahs-3074	16	35	production	production	NOUN
ahs-3074	16	36	and	and	CCONJ
ahs-3074	16	37	distribution	distribution	NOUN
ahs-3074	16	38	of	of	ADP
ahs-3074	16	39	virus	virus	NOUN
ahs-3074	16	40	-	-	PUNCT
ahs-3074	16	41	infected	infect	VERB
ahs-3074	16	42	trees	tree	NOUN
ahs-3074	16	43	.	.	PUNCT
ahs-3074	17	1	inspection	inspection	NOUN
ahs-3074	17	2	for	for	ADP
ahs-3074	17	3	symptoms	symptom	NOUN
ahs-3074	17	4	and	and	CCONJ
ahs-3074	17	5	sample	sample	NOUN
ahs-3074	17	6	collection	collection	NOUN
ahs-3074	17	7	for	for	ADP
ahs-3074	17	8	viral	viral	ADJ
ahs-3074	17	9	diseases	disease	NOUN
ahs-3074	17	10	was	be	AUX
ahs-3074	17	11	carried	carry	VERB
ahs-3074	17	12	out	out	ADP
ahs-3074	17	13	in	in	ADP
ahs-3074	17	14	all	all	DET
ahs-3074	17	15	the	the	DET
ahs-3074	17	16	national	national	ADJ
ahs-3074	17	17	collection	collection	NOUN
ahs-3074	17	18	fields	field	NOUN
ahs-3074	17	19	,	,	PUNCT
ahs-3074	17	20	including	include	VERB
ahs-3074	17	21	cherry	cherry	NOUN
ahs-3074	17	22	,	,	PUNCT
ahs-3074	17	23	pear	pear	NOUN
ahs-3074	17	24	,	,	PUNCT
ahs-3074	17	25	peach	peach	NOUN
ahs-3074	17	26	,	,	PUNCT
ahs-3074	17	27	plum	plum	NOUN
ahs-3074	17	28	,	,	PUNCT
ahs-3074	17	29	apricot	apricot	PROPN
ahs-3074	17	30	,	,	PUNCT
ahs-3074	17	31	almond	almond	NOUN
ahs-3074	17	32	,	,	PUNCT
ahs-3074	17	33	apple	apple	NOUN
ahs-3074	17	34	,	,	PUNCT
ahs-3074	17	35	grape	grape	NOUN
ahs-3074	17	36	and	and	CCONJ
ahs-3074	17	37	citrus	citrus	NOUN
ahs-3074	17	38	plants	plant	NOUN
ahs-3074	17	39	,	,	PUNCT
ahs-3074	17	40	located	locate	VERB
ahs-3074	17	41	in	in	ADP
ahs-3074	17	42	different	different	ADJ
ahs-3074	17	43	areas	area	NOUN
ahs-3074	17	44	of	of	ADP
ahs-3074	17	45	the	the	DET
ahs-3074	17	46	country	country	NOUN
ahs-3074	17	47	.	.	PUNCT
ahs-3074	18	1	stone	stone	NOUN
ahs-3074	18	2	fruit	fruit	NOUN
ahs-3074	18	3	plants	plant	NOUN
ahs-3074	18	4	infected	infect	VERB
ahs-3074	18	5	by	by	ADP
ahs-3074	18	6	apple	apple	NOUN
ahs-3074	18	7	chlorotic	chlorotic	ADJ
ahs-3074	18	8	leaf	leaf	NOUN
ahs-3074	18	9	spot	spot	NOUN
ahs-3074	18	10	virus	virus	NOUN
ahs-3074	18	11	or	or	CCONJ
ahs-3074	18	12	prunus	prunus	NOUN
ahs-3074	18	13	necrotic	necrotic	ADJ
ahs-3074	18	14	ringspot	ringspot	NOUN
ahs-3074	18	15	virus	virus	NOUN
ahs-3074	18	16	have	have	AUX
ahs-3074	18	17	been	be	AUX
ahs-3074	18	18	identified	identify	VERB
ahs-3074	18	19	in	in	ADP
ahs-3074	18	20	the	the	DET
ahs-3074	18	21	national	national	ADJ
ahs-3074	18	22	collection	collection	NOUN
ahs-3074	18	23	experimental	experimental	ADJ
ahs-3074	18	24	farms	farm	NOUN
ahs-3074	18	25	located	locate	VERB
ahs-3074	18	26	in	in	ADP
ahs-3074	18	27	different	different	ADJ
ahs-3074	18	28	provinces	province	NOUN
ahs-3074	18	29	of	of	ADP
ahs-3074	18	30	afghanistan	afghanistan	PROPN
ahs-3074	18	31	.	.	PUNCT
ahs-3074	19	1	moreover	moreover	ADV
ahs-3074	19	2	,	,	PUNCT
ahs-3074	19	3	many	many	ADJ
ahs-3074	19	4	grape	grape	NOUN
ahs-3074	19	5	plants	plant	NOUN
ahs-3074	19	6	included	include	VERB
ahs-3074	19	7	in	in	ADP
ahs-3074	19	8	the	the	DET
ahs-3074	19	9	national	national	ADJ
ahs-3074	19	10	collection	collection	NOUN
ahs-3074	19	11	located	locate	VERB
ahs-3074	19	12	in	in	ADP
ahs-3074	19	13	herat	herat	PROPN
ahs-3074	19	14	and	and	CCONJ
ahs-3074	19	15	kandahar	kandahar	PROPN
ahs-3074	19	16	resulted	result	VERB
ahs-3074	19	17	infected	infect	VERB
ahs-3074	19	18	by	by	ADP
ahs-3074	19	19	grapevine	grapevine	NOUN
ahs-3074	19	20	fanleaf	fanleaf	NOUN
ahs-3074	19	21	virus	virus	NOUN
ahs-3074	19	22	,	,	PUNCT
ahs-3074	19	23	but	but	CCONJ
ahs-3074	19	24	only	only	ADV
ahs-3074	19	25	few	few	ADJ
ahs-3074	19	26	imported	import	VERB
ahs-3074	19	27	plants	plant	NOUN
ahs-3074	19	28	by	by	ADP
ahs-3074	19	29	grapevine	grapevine	NOUN
ahs-3074	19	30	leafroll	leafroll	NOUN
ahs-3074	19	31	associated	associate	VERB
ahs-3074	19	32	virus	virus	NOUN
ahs-3074	19	33	1	1	NUM
ahs-3074	19	34	,	,	PUNCT
ahs-3074	19	35	grapevine	grapevine	NOUN
ahs-3074	19	36	leafroll	leafroll	NOUN
ahs-3074	19	37	associated	associate	VERB
ahs-3074	19	38	virus	virus	NOUN
ahs-3074	19	39	3	3	NUM
ahs-3074	19	40	or	or	CCONJ
ahs-3074	19	41	grapevine	grapevine	NOUN
ahs-3074	19	42	virus	virus	NOUN
ahs-3074	19	43	a.	a.	NOUN
ahs-3074	19	44	finally	finally	ADV
ahs-3074	19	45	,	,	PUNCT
ahs-3074	19	46	in	in	ADP
ahs-3074	19	47	jalalabad	jalalabad	PROPN
ahs-3074	19	48	(	(	PUNCT
ahs-3074	19	49	nangarhar	nangarhar	PROPN
ahs-3074	19	50	province	province	NOUN
ahs-3074	19	51	)	)	PUNCT
ahs-3074	19	52	citrus	citrus	NOUN
ahs-3074	19	53	plants	plant	NOUN
ahs-3074	19	54	showing	show	VERB
ahs-3074	19	55	vein	vein	ADJ
ahs-3074	19	56	flecking	flecking	NOUN
ahs-3074	19	57	,	,	PUNCT
ahs-3074	19	58	yellowing	yellowing	NOUN
ahs-3074	19	59	and	and	CCONJ
ahs-3074	19	60	plant	plant	NOUN
ahs-3074	19	61	decline	decline	NOUN
ahs-3074	19	62	symptoms	symptom	NOUN
ahs-3074	19	63	were	be	AUX
ahs-3074	19	64	found	find	VERB
ahs-3074	19	65	to	to	PART
ahs-3074	19	66	be	be	AUX
ahs-3074	19	67	infected	infect	VERB
ahs-3074	19	68	by	by	ADP
ahs-3074	19	69	citrus	citrus	PROPN
ahs-3074	19	70	tristeza	tristeza	PROPN
ahs-3074	19	71	virus	virus	PROPN
ahs-3074	19	72	.	.	PUNCT
ahs-3074	20	1	some	some	PRON
ahs-3074	20	2	of	of	ADP
ahs-3074	20	3	the	the	DET
ahs-3074	20	4	identified	identify	VERB
ahs-3074	20	5	viral	viral	ADJ
ahs-3074	20	6	isolates	isolate	NOUN
ahs-3074	20	7	have	have	AUX
ahs-3074	20	8	been	be	AUX
ahs-3074	20	9	characterized	characterize	VERB
ahs-3074	20	10	molecularly	molecularly	ADV
ahs-3074	20	11	,	,	PUNCT
ahs-3074	20	12	amplifying	amplify	VERB
ahs-3074	20	13	a	a	DET
ahs-3074	20	14	fragment	fragment	NOUN
ahs-3074	20	15	corresponding	corresponding	NOUN
ahs-3074	20	16	to	to	ADP
ahs-3074	20	17	the	the	DET
ahs-3074	20	18	coat	coat	NOUN
ahs-3074	20	19	protein	protein	NOUN
ahs-3074	20	20	gene	gene	NOUN
ahs-3074	20	21	from	from	ADP
ahs-3074	20	22	a	a	DET
ahs-3074	20	23	selection	selection	NOUN
ahs-3074	20	24	of	of	ADP
ahs-3074	20	25	positive	positive	ADJ
ahs-3074	20	26	samples	sample	NOUN
ahs-3074	20	27	.	.	PUNCT
ahs-3074	21	1	the	the	DET
ahs-3074	21	2	presence	presence	NOUN
ahs-3074	21	3	of	of	ADP
ahs-3074	21	4	those	those	DET
ahs-3074	21	5	viruses	virus	NOUN
ahs-3074	21	6	in	in	ADP
ahs-3074	21	7	different	different	ADJ
ahs-3074	21	8	accessions	accession	NOUN
ahs-3074	21	9	of	of	ADP
ahs-3074	21	10	the	the	DET
ahs-3074	21	11	national	national	ADJ
ahs-3074	21	12	collection	collection	NOUN
ahs-3074	21	13	is	be	AUX
ahs-3074	21	14	of	of	ADP
ahs-3074	21	15	concern	concern	NOUN
ahs-3074	21	16	for	for	ADP
ahs-3074	21	17	afghan	afghan	ADJ
ahs-3074	21	18	horticulture	horticulture	NOUN
ahs-3074	21	19	.	.	PUNCT
ahs-3074	22	1	implementation	implementation	NOUN
ahs-3074	22	2	of	of	ADP
ahs-3074	22	3	the	the	DET
ahs-3074	22	4	certification	certification	NOUN
ahs-3074	22	5	schemes	scheme	NOUN
ahs-3074	22	6	is	be	AUX
ahs-3074	22	7	therefore	therefore	ADV
ahs-3074	22	8	necessary	necessary	ADJ
ahs-3074	22	9	to	to	PART
ahs-3074	22	10	quarantine	quarantine	VERB
ahs-3074	22	11	the	the	DET
ahs-3074	22	12	production	production	NOUN
ahs-3074	22	13	and	and	CCONJ
ahs-3074	22	14	for	for	ADP
ahs-3074	22	15	the	the	DET
ahs-3074	22	16	employment	employment	NOUN
ahs-3074	22	17	of	of	ADP
ahs-3074	22	18	virus	virus	NOUN
ahs-3074	22	19	-	-	PUNCT
ahs-3074	22	20	free	free	ADJ
ahs-3074	22	21	propagating	propagating	NOUN
ahs-3074	22	22	material	material	NOUN
ahs-3074	22	23	.	.	PUNCT
ahs-3074	23	1	(	(	PUNCT
ahs-3074	23	2	*	*	NOUN
ahs-3074	23	3	)	)	PUNCT
ahs-3074	23	4	corresponding	corresponding	ADJ
ahs-3074	23	5	author	author	NOUN
ahs-3074	23	6	:	:	PUNCT
ahs-3074	23	7	claudio.ratti@unibo.it	claudio.ratti@unibo.it	PROPN
ahs-3074	23	8	received	receive	VERB
ahs-3074	23	9	for	for	ADP
ahs-3074	23	10	publication	publication	NOUN
ahs-3074	23	11	4	4	NUM
ahs-3074	23	12	february	february	NOUN
ahs-3074	23	13	2016	2016	NUM
ahs-3074	23	14	accepted	accept	VERB
ahs-3074	23	15	for	for	ADP
ahs-3074	23	16	publication	publication	NOUN
ahs-3074	23	17	16	16	NUM
ahs-3074	23	18	february	february	PROPN
ahs-3074	23	19	2016	2016	NUM
ahs-3074	23	20	copyright	copyright	NOUN
ahs-3074	23	21	:	:	PUNCT
ahs-3074	23	22	©	©	PROPN
ahs-3074	23	23	2016	2016	NUM
ahs-3074	23	24	author(s	author(s	NOUN
ahs-3074	23	25	)	)	PUNCT
ahs-3074	23	26	.	.	PUNCT
ahs-3074	24	1	this	this	PRON
ahs-3074	24	2	is	be	AUX
ahs-3074	24	3	an	an	DET
ahs-3074	24	4	open	open	ADJ
ahs-3074	24	5	access	access	NOUN
ahs-3074	24	6	article	article	NOUN
ahs-3074	24	7	distributed	distribute	VERB
ahs-3074	24	8	under	under	ADP
ahs-3074	24	9	the	the	DET
ahs-3074	24	10	terms	term	NOUN
ahs-3074	24	11	of	of	ADP
ahs-3074	24	12	the	the	DET
ahs-3074	24	13	creative	creative	ADJ
ahs-3074	24	14	commons	common	NOUN
ahs-3074	24	15	attribution	attribution	NOUN
ahs-3074	24	16	license	license	NOUN
ahs-3074	24	17	,	,	PUNCT
ahs-3074	24	18	which	which	PRON
ahs-3074	24	19	permits	permit	VERB
ahs-3074	24	20	unrestricted	unrestricted	ADJ
ahs-3074	24	21	use	use	NOUN
ahs-3074	24	22	,	,	PUNCT
ahs-3074	24	23	distribution	distribution	NOUN
ahs-3074	24	24	,	,	PUNCT
ahs-3074	24	25	and	and	CCONJ
ahs-3074	24	26	reproduction	reproduction	NOUN
ahs-3074	24	27	in	in	ADP
ahs-3074	24	28	any	any	DET
ahs-3074	24	29	medium	medium	NOUN
ahs-3074	24	30	,	,	PUNCT
ahs-3074	24	31	provided	provide	VERB
ahs-3074	24	32	the	the	DET
ahs-3074	24	33	original	original	ADJ
ahs-3074	24	34	author	author	NOUN
ahs-3074	24	35	and	and	CCONJ
ahs-3074	24	36	source	source	NOUN
ahs-3074	24	37	are	be	AUX
ahs-3074	24	38	credited	credit	VERB
ahs-3074	24	39	.	.	PUNCT
ahs-3074	25	1	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-3074	25	2	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-3074	25	3	adv	adv	PROPN
ahs-3074	25	4	.	.	PUNCT
ahs-3074	25	5	hort	hort	PROPN
ahs-3074	25	6	.	.	PUNCT
ahs-3074	26	1	sci	sci	PROPN
ahs-3074	26	2	.	.	PROPN
ahs-3074	26	3	,	,	PUNCT
ahs-3074	26	4	2016	2016	NUM
ahs-3074	26	5	30(4	30(4	NUM
ahs-3074	26	6	):	):	PUNCT
ahs-3074	26	7	239	239	NUM
ahs-3074	26	8	-	-	SYM
ahs-3074	26	9	248	248	NUM
ahs-3074	26	10	240	240	NUM
ahs-3074	26	11	dwindling	dwindle	VERB
ahs-3074	26	12	in	in	ADP
ahs-3074	26	13	quantity	quantity	NOUN
ahs-3074	26	14	and	and	CCONJ
ahs-3074	26	15	quality	quality	NOUN
ahs-3074	26	16	;	;	PUNCT
ahs-3074	26	17	2	2	X
ahs-3074	26	18	)	)	PUNCT
ahs-3074	26	19	nursery	nursery	NOUN
ahs-3074	26	20	owners	owner	NOUN
ahs-3074	26	21	lack	lack	VERB
ahs-3074	26	22	access	access	NOUN
ahs-3074	26	23	to	to	ADP
ahs-3074	26	24	quality	quality	NOUN
ahs-3074	26	25	inputs	input	NOUN
ahs-3074	26	26	and	and	CCONJ
ahs-3074	26	27	services	service	NOUN
ahs-3074	26	28	;	;	PUNCT
ahs-3074	26	29	and	and	CCONJ
ahs-3074	26	30	3	3	X
ahs-3074	26	31	)	)	PUNCT
ahs-3074	26	32	the	the	DET
ahs-3074	26	33	regulatory	regulatory	ADJ
ahs-3074	26	34	framework	framework	NOUN
ahs-3074	26	35	to	to	PART
ahs-3074	26	36	develop	develop	VERB
ahs-3074	26	37	and	and	CCONJ
ahs-3074	26	38	support	support	VERB
ahs-3074	26	39	a	a	DET
ahs-3074	26	40	competitive	competitive	ADJ
ahs-3074	26	41	horticulture	horticulture	NOUN
ahs-3074	26	42	industry	industry	NOUN
ahs-3074	26	43	is	be	AUX
ahs-3074	26	44	minimal	minimal	ADJ
ahs-3074	26	45	.	.	PUNCT
ahs-3074	27	1	to	to	PART
ahs-3074	27	2	support	support	VERB
ahs-3074	27	3	and	and	CCONJ
ahs-3074	27	4	develop	develop	VERB
ahs-3074	27	5	the	the	DET
ahs-3074	27	6	horticultural	horticultural	ADJ
ahs-3074	27	7	industry	industry	NOUN
ahs-3074	27	8	of	of	ADP
ahs-3074	27	9	the	the	DET
ahs-3074	27	10	country	country	NOUN
ahs-3074	27	11	,	,	PUNCT
ahs-3074	27	12	a	a	DET
ahs-3074	27	13	nursery	nursery	NOUN
ahs-3074	27	14	certification	certification	NOUN
ahs-3074	27	15	system	system	NOUN
ahs-3074	27	16	was	be	AUX
ahs-3074	27	17	started	start	VERB
ahs-3074	27	18	in	in	ADP
ahs-3074	27	19	2006	2006	NUM
ahs-3074	27	20	from	from	ADP
ahs-3074	27	21	the	the	DET
ahs-3074	27	22	complete	complete	ADJ
ahs-3074	27	23	collection	collection	NOUN
ahs-3074	27	24	afghanistan	afghanistan	PROPN
ahs-3074	27	25	’s	’s	PART
ahs-3074	27	26	fruit	fruit	NOUN
ahs-3074	27	27	and	and	CCONJ
ahs-3074	27	28	nut	nut	NOUN
ahs-3074	27	29	trees	tree	NOUN
ahs-3074	27	30	crop	crop	NOUN
ahs-3074	27	31	varieties	variety	NOUN
ahs-3074	27	32	by	by	ADP
ahs-3074	27	33	the	the	DET
ahs-3074	27	34	perennial	perennial	ADJ
ahs-3074	27	35	horticulture	horticulture	NOUN
ahs-3074	27	36	development	development	NOUN
ahs-3074	27	37	project	project	NOUN
ahs-3074	27	38	(	(	PUNCT
ahs-3074	27	39	phdp	phdp	NOUN
ahs-3074	27	40	)	)	PUNCT
ahs-3074	27	41	funded	fund	VERB
ahs-3074	27	42	by	by	ADP
ahs-3074	27	43	european	european	PROPN
ahs-3074	27	44	union	union	PROPN
ahs-3074	27	45	(	(	PUNCT
ahs-3074	27	46	eu	eu	PROPN
ahs-3074	27	47	)	)	PUNCT
ahs-3074	27	48	.	.	PUNCT
ahs-3074	28	1	one	one	NUM
ahs-3074	28	2	of	of	ADP
ahs-3074	28	3	the	the	DET
ahs-3074	28	4	main	main	ADJ
ahs-3074	28	5	causes	cause	NOUN
ahs-3074	28	6	for	for	ADP
ahs-3074	28	7	the	the	DET
ahs-3074	28	8	decrease	decrease	NOUN
ahs-3074	28	9	in	in	ADP
ahs-3074	28	10	production	production	NOUN
ahs-3074	28	11	is	be	AUX
ahs-3074	28	12	deleterious	deleterious	ADJ
ahs-3074	28	13	pests	pest	NOUN
ahs-3074	28	14	and	and	CCONJ
ahs-3074	28	15	diseases	disease	NOUN
ahs-3074	28	16	,	,	PUNCT
ahs-3074	28	17	especially	especially	ADV
ahs-3074	28	18	plant	plant	NOUN
ahs-3074	28	19	viruses	virus	NOUN
ahs-3074	28	20	and	and	CCONJ
ahs-3074	28	21	viruslike	viruslike	ADP
ahs-3074	28	22	diseases	disease	NOUN
ahs-3074	28	23	present	present	ADJ
ahs-3074	28	24	in	in	ADP
ahs-3074	28	25	afghanistan	afghanistan	PROPN
ahs-3074	28	26	.	.	PUNCT
ahs-3074	29	1	virus	virus	NOUN
ahs-3074	29	2	infection	infection	NOUN
ahs-3074	29	3	in	in	ADP
ahs-3074	29	4	plants	plant	NOUN
ahs-3074	29	5	is	be	AUX
ahs-3074	29	6	particularly	particularly	ADV
ahs-3074	29	7	difficult	difficult	ADJ
ahs-3074	29	8	to	to	PART
ahs-3074	29	9	detect	detect	VERB
ahs-3074	29	10	as	as	ADP
ahs-3074	29	11	viral	viral	ADJ
ahs-3074	29	12	infection	infection	NOUN
ahs-3074	29	13	may	may	AUX
ahs-3074	29	14	be	be	AUX
ahs-3074	29	15	sectorial	sectorial	ADJ
ahs-3074	29	16	or	or	CCONJ
ahs-3074	29	17	latent	latent	NOUN
ahs-3074	29	18	,	,	PUNCT
ahs-3074	29	19	with	with	ADP
ahs-3074	29	20	symptoms	symptom	NOUN
ahs-3074	29	21	masked	mask	VERB
ahs-3074	29	22	or	or	CCONJ
ahs-3074	29	23	even	even	ADV
ahs-3074	29	24	absent	absent	ADJ
ahs-3074	29	25	under	under	ADP
ahs-3074	29	26	certain	certain	ADJ
ahs-3074	29	27	conditions	condition	NOUN
ahs-3074	29	28	.	.	PUNCT
ahs-3074	30	1	virus	virus	NOUN
ahs-3074	30	2	-	-	PUNCT
ahs-3074	30	3	free	free	ADJ
ahs-3074	30	4	certification	certification	NOUN
ahs-3074	30	5	is	be	AUX
ahs-3074	30	6	currently	currently	ADV
ahs-3074	30	7	implemented	implement	VERB
ahs-3074	30	8	using	use	VERB
ahs-3074	30	9	conventional	conventional	ADJ
ahs-3074	30	10	techniques	technique	NOUN
ahs-3074	30	11	for	for	ADP
ahs-3074	30	12	virus	virus	NOUN
ahs-3074	30	13	detection	detection	NOUN
ahs-3074	30	14	in	in	ADP
ahs-3074	30	15	vegetal	vegetal	ADJ
ahs-3074	30	16	material	material	NOUN
ahs-3074	30	17	such	such	ADJ
ahs-3074	30	18	as	as	ADP
ahs-3074	30	19	biological	biological	ADJ
ahs-3074	30	20	indexing	indexing	NOUN
ahs-3074	30	21	,	,	PUNCT
ahs-3074	30	22	serological	serological	ADJ
ahs-3074	30	23	or	or	CCONJ
ahs-3074	30	24	molecular	molecular	ADJ
ahs-3074	30	25	assays	assay	NOUN
ahs-3074	30	26	.	.	PUNCT
ahs-3074	31	1	biological	biological	ADJ
ahs-3074	31	2	indexing	indexing	NOUN
ahs-3074	31	3	requires	require	VERB
ahs-3074	31	4	,	,	PUNCT
ahs-3074	31	5	in	in	ADP
ahs-3074	31	6	many	many	ADJ
ahs-3074	31	7	instances	instance	NOUN
ahs-3074	31	8	,	,	PUNCT
ahs-3074	31	9	grafting	graft	VERB
ahs-3074	31	10	in	in	ADP
ahs-3074	31	11	greenhouse	greenhouse	NOUN
ahs-3074	31	12	facilities	facility	NOUN
ahs-3074	31	13	which	which	PRON
ahs-3074	31	14	is	be	AUX
ahs-3074	31	15	expensive	expensive	ADJ
ahs-3074	31	16	and	and	CCONJ
ahs-3074	31	17	time	time	NOUN
ahs-3074	31	18	consuming	consume	VERB
ahs-3074	31	19	.	.	PUNCT
ahs-3074	32	1	serological	serological	ADJ
ahs-3074	32	2	assays	assay	NOUN
ahs-3074	32	3	and	and	CCONJ
ahs-3074	32	4	molecular	molecular	ADJ
ahs-3074	32	5	techniques	technique	NOUN
ahs-3074	32	6	,	,	PUNCT
ahs-3074	32	7	particularly	particularly	ADV
ahs-3074	32	8	elisa	elisa	NOUN
ahs-3074	32	9	and	and	CCONJ
ahs-3074	32	10	rt	rt	NOUN
ahs-3074	32	11	-	-	PUNCT
ahs-3074	32	12	pcr	pcr	NOUN
ahs-3074	32	13	,	,	PUNCT
ahs-3074	32	14	have	have	AUX
ahs-3074	32	15	been	be	AUX
ahs-3074	32	16	tested	test	VERB
ahs-3074	32	17	in	in	ADP
ahs-3074	32	18	several	several	ADJ
ahs-3074	32	19	laboratories	laboratory	NOUN
ahs-3074	32	20	and	and	CCONJ
ahs-3074	32	21	shown	show	VERB
ahs-3074	32	22	to	to	PART
ahs-3074	32	23	be	be	AUX
ahs-3074	32	24	efficient	efficient	ADJ
ahs-3074	32	25	for	for	ADP
ahs-3074	32	26	detection	detection	NOUN
ahs-3074	32	27	and	and	CCONJ
ahs-3074	32	28	quantification	quantification	NOUN
ahs-3074	32	29	of	of	ADP
ahs-3074	32	30	virus	virus	NOUN
ahs-3074	32	31	infection	infection	NOUN
ahs-3074	32	32	in	in	ADP
ahs-3074	32	33	pome	pome	PROPN
ahs-3074	32	34	and	and	CCONJ
ahs-3074	32	35	stone	stone	NOUN
ahs-3074	32	36	fruits	fruit	NOUN
ahs-3074	32	37	(	(	PUNCT
ahs-3074	32	38	gambino	gambino	NOUN
ahs-3074	32	39	and	and	CCONJ
ahs-3074	32	40	gribaudo	gribaudo	NOUN
ahs-3074	32	41	,	,	PUNCT
ahs-3074	32	42	2006	2006	NUM
ahs-3074	32	43	;	;	PUNCT
ahs-3074	32	44	faggioli	faggioli	NOUN
ahs-3074	32	45	et	et	PROPN
ahs-3074	32	46	al	al	PROPN
ahs-3074	32	47	.	.	PROPN
ahs-3074	32	48	,	,	PUNCT
ahs-3074	32	49	2013	2013	NUM
ahs-3074	32	50	)	)	PUNCT
ahs-3074	32	51	.	.	PUNCT
ahs-3074	33	1	in	in	ADP
ahs-3074	33	2	a	a	DET
ahs-3074	33	3	country	country	NOUN
ahs-3074	33	4	such	such	ADJ
ahs-3074	33	5	as	as	ADP
ahs-3074	33	6	afghanistan	afghanistan	PROPN
ahs-3074	33	7	,	,	PUNCT
ahs-3074	33	8	the	the	DET
ahs-3074	33	9	establishment	establishment	NOUN
ahs-3074	33	10	of	of	ADP
ahs-3074	33	11	a	a	DET
ahs-3074	33	12	laboratory	laboratory	NOUN
ahs-3074	33	13	where	where	SCONJ
ahs-3074	33	14	sensitive	sensitive	ADJ
ahs-3074	33	15	,	,	PUNCT
ahs-3074	33	16	reliable	reliable	ADJ
ahs-3074	33	17	and	and	CCONJ
ahs-3074	33	18	specific	specific	ADJ
ahs-3074	33	19	techniques	technique	NOUN
ahs-3074	33	20	for	for	ADP
ahs-3074	33	21	routine	routine	ADJ
ahs-3074	33	22	detection	detection	NOUN
ahs-3074	33	23	of	of	ADP
ahs-3074	33	24	selected	select	VERB
ahs-3074	33	25	viruses	virus	NOUN
ahs-3074	33	26	of	of	ADP
ahs-3074	33	27	fruit	fruit	NOUN
ahs-3074	33	28	trees	tree	NOUN
ahs-3074	33	29	can	can	AUX
ahs-3074	33	30	performed	perform	VERB
ahs-3074	33	31	is	be	AUX
ahs-3074	33	32	therefore	therefore	ADV
ahs-3074	33	33	essential	essential	ADJ
ahs-3074	33	34	for	for	ADP
ahs-3074	33	35	virus	virus	NOUN
ahs-3074	33	36	-	-	PUNCT
ahs-3074	33	37	free	free	ADJ
ahs-3074	33	38	certification	certification	NOUN
ahs-3074	33	39	.	.	PUNCT
ahs-3074	34	1	many	many	ADJ
ahs-3074	34	2	viral	viral	ADJ
ahs-3074	34	3	diseases	disease	NOUN
ahs-3074	34	4	can	can	AUX
ahs-3074	34	5	affect	affect	VERB
ahs-3074	34	6	fruit	fruit	NOUN
ahs-3074	34	7	trees	tree	NOUN
ahs-3074	34	8	,	,	PUNCT
ahs-3074	34	9	resulting	result	VERB
ahs-3074	34	10	in	in	ADP
ahs-3074	34	11	latent	latent	NOUN
ahs-3074	34	12	or	or	CCONJ
ahs-3074	34	13	symptomatic	symptomatic	ADJ
ahs-3074	34	14	infection	infection	NOUN
ahs-3074	34	15	.	.	PUNCT
ahs-3074	35	1	according	accord	VERB
ahs-3074	35	2	to	to	ADP
ahs-3074	35	3	their	their	PRON
ahs-3074	35	4	effect	effect	NOUN
ahs-3074	35	5	on	on	ADP
ahs-3074	35	6	the	the	DET
ahs-3074	35	7	cultivated	cultivate	VERB
ahs-3074	35	8	host	host	NOUN
ahs-3074	35	9	,	,	PUNCT
ahs-3074	35	10	presence	presence	NOUN
ahs-3074	35	11	of	of	ADP
ahs-3074	35	12	the	the	DET
ahs-3074	35	13	most	most	ADV
ahs-3074	35	14	important	important	ADJ
ahs-3074	35	15	viruses	virus	NOUN
ahs-3074	35	16	in	in	ADP
ahs-3074	35	17	propagation	propagation	NOUN
ahs-3074	35	18	plant	plant	NOUN
ahs-3074	35	19	material	material	NOUN
ahs-3074	35	20	is	be	AUX
ahs-3074	35	21	regulated	regulate	VERB
ahs-3074	35	22	at	at	ADP
ahs-3074	35	23	international	international	ADJ
ahs-3074	35	24	level	level	NOUN
ahs-3074	35	25	.	.	PUNCT
ahs-3074	36	1	in	in	ADP
ahs-3074	36	2	particular	particular	ADJ
ahs-3074	36	3	,	,	PUNCT
ahs-3074	36	4	plum	plum	NOUN
ahs-3074	36	5	pox	pox	NOUN
ahs-3074	36	6	virus	virus	NOUN
ahs-3074	36	7	(	(	PUNCT
ahs-3074	36	8	ppv	ppv	NOUN
ahs-3074	36	9	)	)	PUNCT
ahs-3074	36	10	is	be	AUX
ahs-3074	36	11	the	the	DET
ahs-3074	36	12	causal	causal	ADJ
ahs-3074	36	13	agent	agent	NOUN
ahs-3074	36	14	of	of	ADP
ahs-3074	36	15	sharka	sharka	NOUN
ahs-3074	36	16	,	,	PUNCT
ahs-3074	36	17	the	the	DET
ahs-3074	36	18	most	most	ADV
ahs-3074	36	19	damaging	damaging	ADJ
ahs-3074	36	20	virus	virus	NOUN
ahs-3074	36	21	disease	disease	NOUN
ahs-3074	36	22	of	of	ADP
ahs-3074	36	23	stonefruits	stonefruit	NOUN
ahs-3074	36	24	.	.	PUNCT
ahs-3074	37	1	some	some	DET
ahs-3074	37	2	strains	strain	NOUN
ahs-3074	37	3	of	of	ADP
ahs-3074	37	4	apple	apple	NOUN
ahs-3074	37	5	chlorotic	chlorotic	ADJ
ahs-3074	37	6	leafspot	leafspot	NOUN
ahs-3074	37	7	virus	virus	NOUN
ahs-3074	37	8	(	(	PUNCT
ahs-3074	37	9	aclsv	aclsv	NOUN
ahs-3074	37	10	)	)	PUNCT
ahs-3074	37	11	can	can	AUX
ahs-3074	37	12	also	also	ADV
ahs-3074	37	13	induce	induce	VERB
ahs-3074	37	14	serious	serious	ADJ
ahs-3074	37	15	diseases	disease	NOUN
ahs-3074	37	16	in	in	ADP
ahs-3074	37	17	stone	stone	NOUN
ahs-3074	37	18	fruits	fruit	NOUN
ahs-3074	37	19	.	.	PUNCT
ahs-3074	38	1	prune	prune	NOUN
ahs-3074	38	2	dwarf	dwarf	NOUN
ahs-3074	38	3	virus	virus	NOUN
ahs-3074	38	4	(	(	PUNCT
ahs-3074	38	5	pdv	pdv	NOUN
ahs-3074	38	6	)	)	PUNCT
ahs-3074	38	7	and	and	CCONJ
ahs-3074	38	8	prunus	prunus	NOUN
ahs-3074	38	9	necrotic	necrotic	ADJ
ahs-3074	38	10	ringspot	ringspot	NOUN
ahs-3074	38	11	virus	virus	NOUN
ahs-3074	38	12	(	(	PUNCT
ahs-3074	38	13	pnrsv	pnrsv	PROPN
ahs-3074	38	14	)	)	PUNCT
ahs-3074	38	15	are	be	AUX
ahs-3074	38	16	of	of	ADP
ahs-3074	38	17	considerable	considerable	ADJ
ahs-3074	38	18	economic	economic	ADJ
ahs-3074	38	19	significance	significance	NOUN
ahs-3074	38	20	in	in	ADP
ahs-3074	38	21	stonefruits	stonefruit	NOUN
ahs-3074	38	22	as	as	ADV
ahs-3074	38	23	well	well	ADV
ahs-3074	38	24	,	,	PUNCT
ahs-3074	38	25	while	while	SCONJ
ahs-3074	38	26	citrus	citrus	PROPN
ahs-3074	38	27	tristeza	tristeza	PROPN
ahs-3074	38	28	virus	virus	PROPN
ahs-3074	38	29	(	(	PUNCT
ahs-3074	38	30	ctv	ctv	PROPN
ahs-3074	38	31	)	)	PUNCT
ahs-3074	38	32	is	be	AUX
ahs-3074	38	33	considered	consider	VERB
ahs-3074	38	34	to	to	PART
ahs-3074	38	35	be	be	AUX
ahs-3074	38	36	the	the	DET
ahs-3074	38	37	most	most	ADV
ahs-3074	38	38	destructive	destructive	ADJ
ahs-3074	38	39	virus	virus	NOUN
ahs-3074	38	40	of	of	ADP
ahs-3074	38	41	citrus	citrus	NOUN
ahs-3074	38	42	crops	crop	NOUN
ahs-3074	38	43	.	.	PUNCT
ahs-3074	39	1	apple	apple	PROPN
ahs-3074	39	2	mosaic	mosaic	PROPN
ahs-3074	39	3	virus	virus	NOUN
ahs-3074	39	4	(	(	PUNCT
ahs-3074	39	5	apmv	apmv	ADV
ahs-3074	39	6	)	)	PUNCT
ahs-3074	39	7	,	,	PUNCT
ahs-3074	39	8	apple	apple	NOUN
ahs-3074	39	9	stem	stem	NOUN
ahs-3074	39	10	grooving	groove	VERB
ahs-3074	39	11	virus	virus	NOUN
ahs-3074	39	12	(	(	PUNCT
ahs-3074	39	13	asgv	asgv	PROPN
ahs-3074	39	14	)	)	PUNCT
ahs-3074	39	15	and	and	CCONJ
ahs-3074	39	16	apple	apple	NOUN
ahs-3074	39	17	stem	stem	NOUN
ahs-3074	39	18	pitting	pit	VERB
ahs-3074	39	19	virus	virus	NOUN
ahs-3074	39	20	(	(	PUNCT
ahs-3074	39	21	aspv	aspv	PROPN
ahs-3074	39	22	)	)	PUNCT
ahs-3074	39	23	are	be	AUX
ahs-3074	39	24	spread	spread	VERB
ahs-3074	39	25	worldwide	worldwide	ADV
ahs-3074	39	26	and	and	CCONJ
ahs-3074	39	27	able	able	ADJ
ahs-3074	39	28	to	to	PART
ahs-3074	39	29	causes	cause	VERB
ahs-3074	39	30	significant	significant	ADJ
ahs-3074	39	31	losses	loss	NOUN
ahs-3074	39	32	in	in	ADP
ahs-3074	39	33	mixed	mixed	ADJ
ahs-3074	39	34	infections	infection	NOUN
ahs-3074	39	35	(	(	PUNCT
ahs-3074	39	36	hadidi	hadidi	PROPN
ahs-3074	39	37	et	et	PROPN
ahs-3074	39	38	al	al	PROPN
ahs-3074	39	39	.	.	PROPN
ahs-3074	39	40	,	,	PUNCT
ahs-3074	39	41	2011	2011	NUM
ahs-3074	39	42	;	;	PUNCT
ahs-3074	39	43	barba	barba	PROPN
ahs-3074	39	44	et	et	PROPN
ahs-3074	39	45	al	al	PROPN
ahs-3074	39	46	.	.	PROPN
ahs-3074	39	47	,	,	PUNCT
ahs-3074	39	48	2015	2015	NUM
ahs-3074	39	49	)	)	PUNCT
ahs-3074	39	50	.	.	PUNCT
ahs-3074	40	1	arabis	arabis	VERB
ahs-3074	40	2	mosaic	mosaic	ADJ
ahs-3074	40	3	virus	virus	NOUN
ahs-3074	40	4	(	(	PUNCT
ahs-3074	40	5	armv	armv	NOUN
ahs-3074	40	6	)	)	PUNCT
ahs-3074	40	7	,	,	PUNCT
ahs-3074	40	8	grapevine	grapevine	NOUN
ahs-3074	40	9	fleck	fleck	NOUN
ahs-3074	40	10	virus	virus	NOUN
ahs-3074	40	11	(	(	PUNCT
ahs-3074	40	12	gfkv	gfkv	ADJ
ahs-3074	40	13	)	)	PUNCT
ahs-3074	40	14	.	.	PUNCT
ahs-3074	41	1	grapevine	grapevine	NOUN
ahs-3074	41	2	fanleaf	fanleaf	PROPN
ahs-3074	41	3	virus	virus	NOUN
ahs-3074	41	4	(	(	PUNCT
ahs-3074	41	5	gflv	gflv	NOUN
ahs-3074	41	6	)	)	PUNCT
ahs-3074	41	7	,	,	PUNCT
ahs-3074	41	8	grapevine	grapevine	NOUN
ahs-3074	41	9	virus	virus	NOUN
ahs-3074	41	10	a	a	DET
ahs-3074	41	11	(	(	PUNCT
ahs-3074	41	12	gva	gva	PROPN
ahs-3074	41	13	)	)	PUNCT
ahs-3074	41	14	and	and	CCONJ
ahs-3074	41	15	“	"	PUNCT
ahs-3074	41	16	grapevine	grapevine	NOUN
ahs-3074	41	17	leafroll	leafroll	NOUN
ahs-3074	41	18	-	-	PUNCT
ahs-3074	41	19	associated	associate	VERB
ahs-3074	41	20	viruses	virus	NOUN
ahs-3074	41	21	”	"	PUNCT
ahs-3074	41	22	(	(	PUNCT
ahs-3074	41	23	glravs	glravs	NOUN
ahs-3074	41	24	)	)	PUNCT
ahs-3074	41	25	such	such	ADJ
ahs-3074	41	26	as	as	ADP
ahs-3074	41	27	grapevine	grapevine	NOUN
ahs-3074	41	28	leafroll	leafroll	NOUN
ahs-3074	41	29	associated	associate	VERB
ahs-3074	41	30	virus	virus	NOUN
ahs-3074	41	31	1	1	NUM
ahs-3074	41	32	,	,	PUNCT
ahs-3074	41	33	2	2	NUM
ahs-3074	41	34	and	and	CCONJ
ahs-3074	41	35	3	3	NUM
ahs-3074	41	36	(	(	PUNCT
ahs-3074	41	37	glrav-1	glrav-1	PROPN
ahs-3074	41	38	,	,	PUNCT
ahs-3074	41	39	glrav-2	glrav-2	NOUN
ahs-3074	41	40	and	and	CCONJ
ahs-3074	41	41	glrav-3	glrav-3	NUM
ahs-3074	41	42	)	)	PUNCT
ahs-3074	41	43	are	be	AUX
ahs-3074	41	44	of	of	ADP
ahs-3074	41	45	great	great	ADJ
ahs-3074	41	46	economic	economic	ADJ
ahs-3074	41	47	impact	impact	NOUN
ahs-3074	41	48	in	in	ADP
ahs-3074	41	49	grape	grape	NOUN
ahs-3074	41	50	and	and	CCONJ
ahs-3074	41	51	their	their	PRON
ahs-3074	41	52	absence	absence	NOUN
ahs-3074	41	53	in	in	ADP
ahs-3074	41	54	propagation	propagation	NOUN
ahs-3074	41	55	material	material	NOUN
ahs-3074	41	56	is	be	AUX
ahs-3074	41	57	an	an	DET
ahs-3074	41	58	essential	essential	ADJ
ahs-3074	41	59	requirement	requirement	NOUN
ahs-3074	41	60	in	in	ADP
ahs-3074	41	61	the	the	DET
ahs-3074	41	62	certification	certification	NOUN
ahs-3074	41	63	schemes	scheme	NOUN
ahs-3074	41	64	of	of	ADP
ahs-3074	41	65	most	most	ADJ
ahs-3074	41	66	countries	country	NOUN
ahs-3074	41	67	(	(	PUNCT
ahs-3074	41	68	martelli	martelli	PROPN
ahs-3074	41	69	,	,	PUNCT
ahs-3074	41	70	2014	2014	NUM
ahs-3074	41	71	)	)	PUNCT
ahs-3074	41	72	.	.	PUNCT
ahs-3074	42	1	national	national	ADJ
ahs-3074	42	2	collection	collection	NOUN
ahs-3074	42	3	centres	centre	NOUN
ahs-3074	42	4	were	be	AUX
ahs-3074	42	5	established	establish	VERB
ahs-3074	42	6	in	in	ADP
ahs-3074	42	7	six	six	NUM
ahs-3074	42	8	agro	agro	ADJ
ahs-3074	42	9	-	-	PUNCT
ahs-3074	42	10	ecological	ecological	ADJ
ahs-3074	42	11	zones	zone	NOUN
ahs-3074	42	12	in	in	ADP
ahs-3074	42	13	afghanistan	afghanistan	PROPN
ahs-3074	42	14	to	to	PART
ahs-3074	42	15	collect	collect	VERB
ahs-3074	42	16	germplasm	germplasm	NOUN
ahs-3074	42	17	.	.	PUNCT
ahs-3074	43	1	after	after	ADP
ahs-3074	43	2	registration	registration	NOUN
ahs-3074	43	3	and	and	CCONJ
ahs-3074	43	4	cataloguing	cataloguing	NOUN
ahs-3074	43	5	,	,	PUNCT
ahs-3074	43	6	the	the	DET
ahs-3074	43	7	mother	mother	NOUN
ahs-3074	43	8	stock	stock	NOUN
ahs-3074	43	9	nurseries	nursery	NOUN
ahs-3074	43	10	were	be	AUX
ahs-3074	43	11	established	establish	VERB
ahs-3074	43	12	from	from	ADP
ahs-3074	43	13	the	the	DET
ahs-3074	43	14	same	same	ADJ
ahs-3074	43	15	planting	planting	NOUN
ahs-3074	43	16	material	material	NOUN
ahs-3074	43	17	to	to	PART
ahs-3074	43	18	ensure	ensure	VERB
ahs-3074	43	19	the	the	DET
ahs-3074	43	20	availability	availability	NOUN
ahs-3074	43	21	of	of	ADP
ahs-3074	43	22	high	high	ADJ
ahs-3074	43	23	quality	quality	NOUN
ahs-3074	43	24	and	and	CCONJ
ahs-3074	43	25	healthy	healthy	ADJ
ahs-3074	43	26	planting	planting	NOUN
ahs-3074	43	27	material	material	NOUN
ahs-3074	43	28	to	to	ADP
ahs-3074	43	29	nursery	nursery	NOUN
ahs-3074	43	30	growers	grower	NOUN
ahs-3074	43	31	and	and	CCONJ
ahs-3074	43	32	farmers	farmer	NOUN
ahs-3074	43	33	.	.	PUNCT
ahs-3074	44	1	theoretical	theoretical	ADJ
ahs-3074	44	2	and	and	CCONJ
ahs-3074	44	3	practical	practical	ADJ
ahs-3074	44	4	knowledge	knowledge	NOUN
ahs-3074	44	5	are	be	AUX
ahs-3074	44	6	essential	essential	ADJ
ahs-3074	44	7	to	to	PART
ahs-3074	44	8	develop	develop	VERB
ahs-3074	44	9	a	a	DET
ahs-3074	44	10	complete	complete	ADJ
ahs-3074	44	11	profile	profile	NOUN
ahs-3074	44	12	for	for	ADP
ahs-3074	44	13	viral	viral	ADJ
ahs-3074	44	14	diseases	disease	NOUN
ahs-3074	44	15	in	in	ADP
ahs-3074	44	16	order	order	NOUN
ahs-3074	44	17	to	to	PART
ahs-3074	44	18	improve	improve	VERB
ahs-3074	44	19	the	the	DET
ahs-3074	44	20	quality	quality	NOUN
ahs-3074	44	21	of	of	ADP
ahs-3074	44	22	planting	planting	NOUN
ahs-3074	44	23	material	material	NOUN
ahs-3074	44	24	within	within	ADP
ahs-3074	44	25	the	the	DET
ahs-3074	44	26	national	national	ADJ
ahs-3074	44	27	fruit	fruit	NOUN
ahs-3074	44	28	tree	tree	NOUN
ahs-3074	44	29	germplasm	germplasm	NOUN
ahs-3074	44	30	(	(	PUNCT
ahs-3074	44	31	rizzo	rizzo	PROPN
ahs-3074	44	32	et	et	PROPN
ahs-3074	44	33	al	al	PROPN
ahs-3074	44	34	.	.	PROPN
ahs-3074	44	35	,	,	PUNCT
ahs-3074	44	36	2012	2012	NUM
ahs-3074	44	37	,	,	PUNCT
ahs-3074	44	38	2015	2015	NUM
ahs-3074	44	39	)	)	PUNCT
ahs-3074	44	40	.	.	PUNCT
ahs-3074	45	1	we	we	PRON
ahs-3074	45	2	therefore	therefore	ADV
ahs-3074	45	3	developed	develop	VERB
ahs-3074	45	4	an	an	DET
ahs-3074	45	5	in	in	ADP
ahs-3074	45	6	-	-	PUNCT
ahs-3074	45	7	depth	depth	NOUN
ahs-3074	45	8	study	study	NOUN
ahs-3074	45	9	regarding	regard	VERB
ahs-3074	45	10	the	the	DET
ahs-3074	45	11	detection	detection	NOUN
ahs-3074	45	12	and	and	CCONJ
ahs-3074	45	13	identification	identification	NOUN
ahs-3074	45	14	of	of	ADP
ahs-3074	45	15	viral	viral	ADJ
ahs-3074	45	16	pathogens	pathogen	NOUN
ahs-3074	45	17	through	through	ADP
ahs-3074	45	18	the	the	DET
ahs-3074	45	19	use	use	NOUN
ahs-3074	45	20	of	of	ADP
ahs-3074	45	21	advance	advance	NOUN
ahs-3074	45	22	and	and	CCONJ
ahs-3074	45	23	sensitive	sensitive	ADJ
ahs-3074	45	24	methodologies	methodology	NOUN
ahs-3074	45	25	and	and	CCONJ
ahs-3074	45	26	techniques	technique	NOUN
ahs-3074	45	27	to	to	PART
ahs-3074	45	28	characterize	characterize	VERB
ahs-3074	45	29	identified	identify	VERB
ahs-3074	45	30	plant	plant	NOUN
ahs-3074	45	31	viral	viral	ADJ
ahs-3074	45	32	pathogens	pathogen	NOUN
ahs-3074	45	33	and	and	CCONJ
ahs-3074	45	34	to	to	PART
ahs-3074	45	35	develop	develop	VERB
ahs-3074	45	36	control	control	NOUN
ahs-3074	45	37	strategies	strategy	NOUN
ahs-3074	45	38	for	for	ADP
ahs-3074	45	39	the	the	DET
ahs-3074	45	40	management	management	NOUN
ahs-3074	45	41	of	of	ADP
ahs-3074	45	42	diseases	disease	NOUN
ahs-3074	45	43	.	.	PUNCT
ahs-3074	46	1	these	these	DET
ahs-3074	46	2	efforts	effort	NOUN
ahs-3074	46	3	are	be	AUX
ahs-3074	46	4	aimed	aim	VERB
ahs-3074	46	5	at	at	ADP
ahs-3074	46	6	improving	improve	VERB
ahs-3074	46	7	the	the	DET
ahs-3074	46	8	quality	quality	NOUN
ahs-3074	46	9	of	of	ADP
ahs-3074	46	10	planting	planting	NOUN
ahs-3074	46	11	material	material	NOUN
ahs-3074	46	12	and	and	CCONJ
ahs-3074	46	13	will	will	AUX
ahs-3074	46	14	ensure	ensure	VERB
ahs-3074	46	15	access	access	NOUN
ahs-3074	46	16	to	to	ADP
ahs-3074	46	17	quality	quality	NOUN
ahs-3074	46	18	and	and	CCONJ
ahs-3074	46	19	certified	certified	ADJ
ahs-3074	46	20	planting	planting	NOUN
ahs-3074	46	21	material	material	NOUN
ahs-3074	46	22	for	for	ADP
ahs-3074	46	23	nursery	nursery	NOUN
ahs-3074	46	24	growers	grower	NOUN
ahs-3074	46	25	and	and	CCONJ
ahs-3074	46	26	orchard	orchard	ADJ
ahs-3074	46	27	owners	owner	NOUN
ahs-3074	46	28	for	for	ADP
ahs-3074	46	29	the	the	DET
ahs-3074	46	30	establishment	establishment	NOUN
ahs-3074	46	31	of	of	ADP
ahs-3074	46	32	new	new	ADJ
ahs-3074	46	33	orchard	orchard	NOUN
ahs-3074	46	34	/	/	SYM
ahs-3074	46	35	motherstock	motherstock	NOUN
ahs-3074	46	36	nurseries	nursery	NOUN
ahs-3074	46	37	,	,	PUNCT
ahs-3074	46	38	as	as	ADV
ahs-3074	46	39	well	well	ADV
ahs-3074	46	40	as	as	ADP
ahs-3074	46	41	for	for	ADP
ahs-3074	46	42	the	the	DET
ahs-3074	46	43	rehabilitation	rehabilitation	NOUN
ahs-3074	46	44	of	of	ADP
ahs-3074	46	45	existing	exist	VERB
ahs-3074	46	46	orchards	orchard	NOUN
ahs-3074	46	47	.	.	PUNCT
ahs-3074	47	1	screening	screen	VERB
ahs-3074	47	2	agricultural	agricultural	ADJ
ahs-3074	47	3	products	product	NOUN
ahs-3074	47	4	according	accord	VERB
ahs-3074	47	5	to	to	ADP
ahs-3074	47	6	the	the	DET
ahs-3074	47	7	protocols	protocol	NOUN
ahs-3074	47	8	and	and	CCONJ
ahs-3074	47	9	regulations	regulation	NOUN
ahs-3074	47	10	of	of	ADP
ahs-3074	47	11	global	global	ADJ
ahs-3074	47	12	plant	plant	NOUN
ahs-3074	47	13	quarantine	quarantine	NOUN
ahs-3074	47	14	will	will	AUX
ahs-3074	47	15	also	also	ADV
ahs-3074	47	16	positively	positively	ADV
ahs-3074	47	17	affect	affect	VERB
ahs-3074	47	18	the	the	DET
ahs-3074	47	19	import	import	NOUN
ahs-3074	47	20	and	and	CCONJ
ahs-3074	47	21	export	export	NOUN
ahs-3074	47	22	of	of	ADP
ahs-3074	47	23	afghan	afghan	ADJ
ahs-3074	47	24	agricultural	agricultural	ADJ
ahs-3074	47	25	entities	entity	NOUN
ahs-3074	47	26	.	.	PUNCT
ahs-3074	48	1	following	follow	VERB
ahs-3074	48	2	the	the	DET
ahs-3074	48	3	standards	standard	NOUN
ahs-3074	48	4	of	of	ADP
ahs-3074	48	5	international	international	ADJ
ahs-3074	48	6	sanitary	sanitary	NOUN
ahs-3074	48	7	and	and	CCONJ
ahs-3074	48	8	phytosanitary	phytosanitary	NOUN
ahs-3074	48	9	rules	rule	NOUN
ahs-3074	48	10	and	and	CCONJ
ahs-3074	48	11	regulations	regulation	NOUN
ahs-3074	48	12	is	be	AUX
ahs-3074	48	13	the	the	DET
ahs-3074	48	14	only	only	ADJ
ahs-3074	48	15	way	way	NOUN
ahs-3074	48	16	to	to	PART
ahs-3074	48	17	compete	compete	VERB
ahs-3074	48	18	in	in	ADP
ahs-3074	48	19	the	the	DET
ahs-3074	48	20	international	international	ADJ
ahs-3074	48	21	market	market	NOUN
ahs-3074	48	22	.	.	PUNCT
ahs-3074	49	1	2	2	X
ahs-3074	49	2	.	.	X
ahs-3074	49	3	materials	material	NOUN
ahs-3074	49	4	and	and	CCONJ
ahs-3074	49	5	methods	method	NOUN
ahs-3074	49	6	plant	plant	NOUN
ahs-3074	49	7	material	material	NOUN
ahs-3074	49	8	plant	plant	NOUN
ahs-3074	49	9	material	material	NOUN
ahs-3074	49	10	was	be	AUX
ahs-3074	49	11	collected	collect	VERB
ahs-3074	49	12	from	from	ADP
ahs-3074	49	13	the	the	DET
ahs-3074	49	14	national	national	ADJ
ahs-3074	49	15	collection	collection	NOUN
ahs-3074	49	16	centres	centre	NOUN
ahs-3074	49	17	(	(	PUNCT
ahs-3074	49	18	nccs	nccs	PROPN
ahs-3074	49	19	)	)	PUNCT
ahs-3074	49	20	and	and	CCONJ
ahs-3074	49	21	mother	mother	NOUN
ahs-3074	49	22	stock	stock	NOUN
ahs-3074	49	23	nurseries	nursery	NOUN
ahs-3074	49	24	(	(	PUNCT
ahs-3074	49	25	msns	msns	PROPN
ahs-3074	49	26	)	)	PUNCT
ahs-3074	49	27	from	from	ADP
ahs-3074	49	28	2009	2009	NUM
ahs-3074	49	29	to	to	ADP
ahs-3074	49	30	2015	2015	NUM
ahs-3074	49	31	.	.	PUNCT
ahs-3074	50	1	in	in	ADP
ahs-3074	50	2	total	total	ADJ
ahs-3074	50	3	,	,	PUNCT
ahs-3074	50	4	more	more	ADJ
ahs-3074	50	5	than	than	ADP
ahs-3074	50	6	12,000	12,000	NUM
ahs-3074	50	7	samples	sample	NOUN
ahs-3074	50	8	were	be	AUX
ahs-3074	50	9	collected	collect	VERB
ahs-3074	50	10	from	from	ADP
ahs-3074	50	11	different	different	ADJ
ahs-3074	50	12	species	specie	NOUN
ahs-3074	50	13	and	and	CCONJ
ahs-3074	50	14	tested	test	VERB
ahs-3074	50	15	for	for	ADP
ahs-3074	50	16	different	different	ADJ
ahs-3074	50	17	viruses	virus	NOUN
ahs-3074	50	18	.	.	PUNCT
ahs-3074	51	1	in	in	ADP
ahs-3074	51	2	particular	particular	ADJ
ahs-3074	51	3	,	,	PUNCT
ahs-3074	51	4	almond	almond	PROPN
ahs-3074	51	5	,	,	PUNCT
ahs-3074	51	6	apricot	apricot	PROPN
ahs-3074	51	7	,	,	PUNCT
ahs-3074	51	8	cherry	cherry	NOUN
ahs-3074	51	9	,	,	PUNCT
ahs-3074	51	10	peach	peach	NOUN
ahs-3074	51	11	and	and	CCONJ
ahs-3074	51	12	plum	plum	NOUN
ahs-3074	51	13	samples	sample	NOUN
ahs-3074	51	14	were	be	AUX
ahs-3074	51	15	tested	test	VERB
ahs-3074	51	16	for	for	ADP
ahs-3074	51	17	the	the	DET
ahs-3074	51	18	presence	presence	NOUN
ahs-3074	51	19	of	of	ADP
ahs-3074	51	20	aclsv	aclsv	NOUN
ahs-3074	51	21	,	,	PUNCT
ahs-3074	51	22	apmv	apmv	ADV
ahs-3074	51	23	,	,	PUNCT
ahs-3074	51	24	pdv	pdv	PROPN
ahs-3074	51	25	,	,	PUNCT
ahs-3074	51	26	pnrsv	pnrsv	PROPN
ahs-3074	51	27	and	and	CCONJ
ahs-3074	51	28	ppv	ppv	NOUN
ahs-3074	51	29	;	;	PUNCT
ahs-3074	51	30	apple	apple	NOUN
ahs-3074	51	31	and	and	CCONJ
ahs-3074	51	32	pear	pear	NOUN
ahs-3074	51	33	samples	sample	NOUN
ahs-3074	51	34	for	for	ADP
ahs-3074	51	35	aclsv	aclsv	NOUN
ahs-3074	51	36	,	,	PUNCT
ahs-3074	51	37	apmv	apmv	ADV
ahs-3074	51	38	,	,	PUNCT
ahs-3074	51	39	asgv	asgv	NOUN
ahs-3074	51	40	and	and	CCONJ
ahs-3074	51	41	aspv	aspv	NOUN
ahs-3074	51	42	;	;	PUNCT
ahs-3074	51	43	citrus	citrus	NOUN
ahs-3074	51	44	samples	sample	NOUN
ahs-3074	51	45	for	for	ADP
ahs-3074	51	46	ctv	ctv	NOUN
ahs-3074	51	47	;	;	PUNCT
ahs-3074	51	48	and	and	CCONJ
ahs-3074	51	49	grape	grape	NOUN
ahs-3074	51	50	samples	sample	NOUN
ahs-3074	51	51	for	for	ADP
ahs-3074	51	52	armv	armv	NOUN
ahs-3074	51	53	,	,	PUNCT
ahs-3074	51	54	gva	gva	PROPN
ahs-3074	51	55	,	,	PUNCT
ahs-3074	51	56	gfkv	gfkv	ADJ
ahs-3074	51	57	,	,	PUNCT
ahs-3074	51	58	gflv	gflv	NOUN
ahs-3074	51	59	,	,	PUNCT
ahs-3074	51	60	glrav-1	glrav-1	PROPN
ahs-3074	51	61	,	,	PUNCT
ahs-3074	51	62	glrav-2	glrav-2	PROPN
ahs-3074	51	63	and	and	CCONJ
ahs-3074	51	64	glrav-3	glrav-3	PROPN
ahs-3074	51	65	.	.	PUNCT
ahs-3074	52	1	rehman	rehman	PROPN
ahs-3074	52	2	et	et	PROPN
ahs-3074	52	3	al	al	PROPN
ahs-3074	52	4	.	.	PROPN
ahs-3074	52	5	phytosanitary	phytosanitary	PROPN
ahs-3074	52	6	status	status	NOUN
ahs-3074	52	7	of	of	ADP
ahs-3074	52	8	afghanistan	afghanistan	PROPN
ahs-3074	52	9	fruits	fruit	NOUN
ahs-3074	52	10	and	and	CCONJ
ahs-3074	52	11	nuts	nuts	ADJ
ahs-3074	52	12	collection	collection	NOUN
ahs-3074	52	13	.	.	PUNCT
ahs-3074	53	1	a	a	DET
ahs-3074	53	2	virus	virus	NOUN
ahs-3074	53	3	survay	survay	NOUN
ahs-3074	53	4	241	241	NUM
ahs-3074	53	5	about	about	ADV
ahs-3074	53	6	32	32	NUM
ahs-3074	53	7	%	%	NOUN
ahs-3074	53	8	of	of	ADP
ahs-3074	53	9	the	the	DET
ahs-3074	53	10	fruit	fruit	NOUN
ahs-3074	53	11	tree	tree	NOUN
ahs-3074	53	12	samples	sample	NOUN
ahs-3074	53	13	were	be	AUX
ahs-3074	53	14	collected	collect	VERB
ahs-3074	53	15	from	from	ADP
ahs-3074	53	16	the	the	DET
ahs-3074	53	17	six	six	NUM
ahs-3074	53	18	nccs	nccs	NOUN
ahs-3074	53	19	located	locate	VERB
ahs-3074	53	20	in	in	ADP
ahs-3074	53	21	kabul	kabul	PROPN
ahs-3074	53	22	(	(	PUNCT
ahs-3074	53	23	apricot	apricot	PROPN
ahs-3074	53	24	and	and	CCONJ
ahs-3074	53	25	plum	plum	NOUN
ahs-3074	53	26	)	)	PUNCT
ahs-3074	53	27	,	,	PUNCT
ahs-3074	53	28	balkh	balkh	PROPN
ahs-3074	53	29	(	(	PUNCT
ahs-3074	53	30	apricot	apricot	PROPN
ahs-3074	53	31	and	and	CCONJ
ahs-3074	53	32	almond	almond	NOUN
ahs-3074	53	33	)	)	PUNCT
ahs-3074	53	34	,	,	PUNCT
ahs-3074	53	35	kunduz	kunduz	INTJ
ahs-3074	53	36	(	(	PUNCT
ahs-3074	53	37	almond	almond	NOUN
ahs-3074	53	38	)	)	PUNCT
ahs-3074	53	39	,	,	PUNCT
ahs-3074	53	40	herat	herat	NOUN
ahs-3074	53	41	(	(	PUNCT
ahs-3074	53	42	grape	grape	NOUN
ahs-3074	53	43	and	and	CCONJ
ahs-3074	53	44	plum	plum	NOUN
ahs-3074	53	45	)	)	PUNCT
ahs-3074	53	46	,	,	PUNCT
ahs-3074	53	47	kandahar	kandahar	PROPN
ahs-3074	53	48	(	(	PUNCT
ahs-3074	53	49	grape	grape	NOUN
ahs-3074	53	50	and	and	CCONJ
ahs-3074	53	51	pomegranate	pomegranate	NOUN
ahs-3074	53	52	)	)	PUNCT
ahs-3074	53	53	and	and	CCONJ
ahs-3074	53	54	nangarhar	nangarhar	PROPN
ahs-3074	53	55	(	(	PUNCT
ahs-3074	53	56	citrus	citrus	NOUN
ahs-3074	53	57	and	and	CCONJ
ahs-3074	53	58	pomegranate	pomegranate	NOUN
ahs-3074	53	59	)	)	PUNCT
ahs-3074	53	60	.	.	PUNCT
ahs-3074	54	1	moreover	moreover	ADV
ahs-3074	54	2	,	,	PUNCT
ahs-3074	54	3	samples	sample	NOUN
ahs-3074	54	4	were	be	AUX
ahs-3074	54	5	also	also	ADV
ahs-3074	54	6	collected	collect	VERB
ahs-3074	54	7	from	from	ADP
ahs-3074	54	8	msns	msns	PROPN
ahs-3074	54	9	(	(	PUNCT
ahs-3074	54	10	26	26	NUM
ahs-3074	54	11	%	%	NOUN
ahs-3074	54	12	)	)	PUNCT
ahs-3074	54	13	and	and	CCONJ
ahs-3074	54	14	from	from	ADP
ahs-3074	54	15	private	private	ADJ
ahs-3074	54	16	orchards	orchard	NOUN
ahs-3074	54	17	(	(	PUNCT
ahs-3074	54	18	nearly	nearly	ADV
ahs-3074	54	19	40	40	NUM
ahs-3074	54	20	%	%	NOUN
ahs-3074	54	21	)	)	PUNCT
ahs-3074	54	22	(	(	PUNCT
ahs-3074	54	23	fig	fig	NOUN
ahs-3074	54	24	.	.	PUNCT
ahs-3074	55	1	1	1	NUM
ahs-3074	55	2	)	)	PUNCT
ahs-3074	55	3	.	.	PUNCT
ahs-3074	56	1	each	each	DET
ahs-3074	56	2	year	year	NOUN
ahs-3074	56	3	stone	stone	NOUN
ahs-3074	56	4	fruit	fruit	NOUN
ahs-3074	56	5	samples	sample	NOUN
ahs-3074	56	6	were	be	AUX
ahs-3074	56	7	collected	collect	VERB
ahs-3074	56	8	during	during	ADP
ahs-3074	56	9	the	the	DET
ahs-3074	56	10	vegetative	vegetative	ADJ
ahs-3074	56	11	stage	stage	NOUN
ahs-3074	56	12	in	in	ADP
ahs-3074	56	13	spring	spring	NOUN
ahs-3074	56	14	or	or	CCONJ
ahs-3074	56	15	summer	summer	NOUN
ahs-3074	56	16	,	,	PUNCT
ahs-3074	56	17	between	between	ADP
ahs-3074	56	18	march	march	PROPN
ahs-3074	56	19	and	and	CCONJ
ahs-3074	56	20	september	september	PROPN
ahs-3074	56	21	,	,	PUNCT
ahs-3074	56	22	according	accord	VERB
ahs-3074	56	23	to	to	ADP
ahs-3074	56	24	the	the	DET
ahs-3074	56	25	climatic	climatic	ADJ
ahs-3074	56	26	conditions	condition	NOUN
ahs-3074	56	27	of	of	ADP
ahs-3074	56	28	each	each	DET
ahs-3074	56	29	location	location	NOUN
ahs-3074	56	30	.	.	PUNCT
ahs-3074	57	1	similarly	similarly	ADV
ahs-3074	57	2	,	,	PUNCT
ahs-3074	57	3	apple	apple	NOUN
ahs-3074	57	4	and	and	CCONJ
ahs-3074	57	5	pear	pear	NOUN
ahs-3074	57	6	samples	sample	NOUN
ahs-3074	57	7	were	be	AUX
ahs-3074	57	8	collected	collect	VERB
ahs-3074	57	9	in	in	ADP
ahs-3074	57	10	may	may	PROPN
ahs-3074	57	11	,	,	PUNCT
ahs-3074	57	12	june	june	PROPN
ahs-3074	57	13	,	,	PUNCT
ahs-3074	57	14	july	july	PROPN
ahs-3074	57	15	or	or	CCONJ
ahs-3074	57	16	september	september	PROPN
ahs-3074	57	17	;	;	PUNCT
ahs-3074	57	18	citrus	citrus	NOUN
ahs-3074	57	19	in	in	ADP
ahs-3074	57	20	march	march	PROPN
ahs-3074	57	21	,	,	PUNCT
ahs-3074	57	22	may	may	AUX
ahs-3074	57	23	or	or	CCONJ
ahs-3074	57	24	november	november	PROPN
ahs-3074	57	25	;	;	PUNCT
ahs-3074	57	26	and	and	CCONJ
ahs-3074	57	27	grape	grape	NOUN
ahs-3074	57	28	in	in	ADP
ahs-3074	57	29	dormant	dormant	ADJ
ahs-3074	57	30	stage	stage	NOUN
ahs-3074	57	31	in	in	ADP
ahs-3074	57	32	january	january	PROPN
ahs-3074	57	33	,	,	PUNCT
ahs-3074	57	34	october	october	PROPN
ahs-3074	57	35	or	or	CCONJ
ahs-3074	57	36	december	december	PROPN
ahs-3074	57	37	.	.	PUNCT
ahs-3074	58	1	the	the	DET
ahs-3074	58	2	collecting	collecting	NOUN
ahs-3074	58	3	method	method	NOUN
ahs-3074	58	4	consisted	consist	VERB
ahs-3074	58	5	of	of	ADP
ahs-3074	58	6	sampling	sample	VERB
ahs-3074	58	7	leaves	leave	NOUN
ahs-3074	58	8	(	(	PUNCT
ahs-3074	58	9	in	in	ADP
ahs-3074	58	10	the	the	DET
ahs-3074	58	11	case	case	NOUN
ahs-3074	58	12	of	of	ADP
ahs-3074	58	13	stone	stone	NOUN
ahs-3074	58	14	and	and	CCONJ
ahs-3074	58	15	pome	pome	NOUN
ahs-3074	58	16	fruits	fruit	NOUN
ahs-3074	58	17	)	)	PUNCT
ahs-3074	58	18	,	,	PUNCT
ahs-3074	58	19	shoots	shoot	NOUN
ahs-3074	58	20	or	or	CCONJ
ahs-3074	58	21	canes	cane	NOUN
ahs-3074	58	22	(	(	PUNCT
ahs-3074	58	23	grape	grape	NOUN
ahs-3074	58	24	)	)	PUNCT
ahs-3074	58	25	or	or	CCONJ
ahs-3074	58	26	leaves	leave	NOUN
ahs-3074	58	27	and	and	CCONJ
ahs-3074	58	28	flowers	flower	NOUN
ahs-3074	58	29	(	(	PUNCT
ahs-3074	58	30	citrus	citrus	NOUN
ahs-3074	58	31	)	)	PUNCT
ahs-3074	58	32	homogeneously	homogeneously	ADV
ahs-3074	58	33	distributed	distribute	VERB
ahs-3074	58	34	around	around	ADP
ahs-3074	58	35	the	the	DET
ahs-3074	58	36	canopy	canopy	NOUN
ahs-3074	58	37	of	of	ADP
ahs-3074	58	38	the	the	DET
ahs-3074	58	39	plant	plant	NOUN
ahs-3074	58	40	.	.	PUNCT
ahs-3074	59	1	all	all	DET
ahs-3074	59	2	collected	collect	VERB
ahs-3074	59	3	material	material	NOUN
ahs-3074	59	4	was	be	AUX
ahs-3074	59	5	maintained	maintain	VERB
ahs-3074	59	6	under	under	ADP
ahs-3074	59	7	refrigeration	refrigeration	NOUN
ahs-3074	59	8	(	(	PUNCT
ahs-3074	59	9	below	below	ADP
ahs-3074	59	10	10	10	NUM
ahs-3074	59	11	°	°	NOUN
ahs-3074	59	12	c	c	NOUN
ahs-3074	59	13	)	)	PUNCT
ahs-3074	59	14	during	during	ADP
ahs-3074	59	15	transport	transport	NOUN
ahs-3074	59	16	from	from	ADP
ahs-3074	59	17	the	the	DET
ahs-3074	59	18	field	field	NOUN
ahs-3074	59	19	to	to	ADP
ahs-3074	59	20	the	the	DET
ahs-3074	59	21	laboratory	laboratory	NOUN
ahs-3074	59	22	,	,	PUNCT
ahs-3074	59	23	then	then	ADV
ahs-3074	59	24	kept	keep	VERB
ahs-3074	59	25	at	at	ADP
ahs-3074	59	26	-20	-20	NUM
ahs-3074	59	27	°	°	NOUN
ahs-3074	59	28	c	c	NOUN
ahs-3074	59	29	until	until	ADP
ahs-3074	59	30	analyses	analysis	NOUN
ahs-3074	59	31	.	.	PUNCT
ahs-3074	60	1	serological	serological	ADJ
ahs-3074	60	2	and	and	CCONJ
ahs-3074	60	3	molecular	molecular	ADJ
ahs-3074	60	4	analyses	analysis	NOUN
ahs-3074	60	5	all	all	DET
ahs-3074	60	6	samples	sample	NOUN
ahs-3074	60	7	were	be	AUX
ahs-3074	60	8	ground	grind	VERB
ahs-3074	60	9	in	in	ADP
ahs-3074	60	10	“	"	PUNCT
ahs-3074	60	11	universal	universal	ADJ
ahs-3074	60	12	”	"	PUNCT
ahs-3074	60	13	extraction	extraction	NOUN
ahs-3074	60	14	bags	bag	NOUN
ahs-3074	60	15	(	(	PUNCT
ahs-3074	60	16	12x15	12x15	NUM
ahs-3074	60	17	cm	cm	NOUN
ahs-3074	60	18	)	)	PUNCT
ahs-3074	60	19	using	use	VERB
ahs-3074	60	20	the	the	DET
ahs-3074	60	21	homex	homex	NOUN
ahs-3074	60	22	6	6	NUM
ahs-3074	60	23	homogenizer	homogenizer	NOUN
ahs-3074	60	24	(	(	PUNCT
ahs-3074	60	25	bioreba	bioreba	NOUN
ahs-3074	60	26	)	)	PUNCT
ahs-3074	60	27	then	then	ADV
ahs-3074	60	28	analysed	analyse	VERB
ahs-3074	60	29	by	by	ADP
ahs-3074	60	30	das	das	PROPN
ahs-3074	60	31	-	-	PUNCT
ahs-3074	60	32	elisa	elisa	NOUN
ahs-3074	60	33	using	use	VERB
ahs-3074	60	34	reagent	reagent	ADJ
ahs-3074	60	35	kits	kit	NOUN
ahs-3074	60	36	from	from	ADP
ahs-3074	60	37	bioreba	bioreba	NOUN
ahs-3074	60	38	(	(	PUNCT
ahs-3074	60	39	reinach	reinach	PROPN
ahs-3074	60	40	,	,	PUNCT
ahs-3074	60	41	switzerland	switzerland	PROPN
ahs-3074	60	42	)	)	PUNCT
ahs-3074	60	43	specific	specific	NOUN
ahs-3074	60	44	for	for	SCONJ
ahs-3074	60	45	each	each	DET
ahs-3074	60	46	virus	virus	NOUN
ahs-3074	60	47	assayed	assayed	ADJ
ahs-3074	60	48	and	and	CCONJ
ahs-3074	60	49	following	follow	VERB
ahs-3074	60	50	the	the	DET
ahs-3074	60	51	manufacturer	manufacturer	NOUN
ahs-3074	60	52	’s	’s	PART
ahs-3074	60	53	instructions	instruction	NOUN
ahs-3074	60	54	.	.	PUNCT
ahs-3074	61	1	samples	sample	NOUN
ahs-3074	61	2	that	that	PRON
ahs-3074	61	3	resulted	result	VERB
ahs-3074	61	4	positive	positive	ADJ
ahs-3074	61	5	by	by	ADP
ahs-3074	61	6	das	das	PROPN
ahs-3074	61	7	-	-	PUNCT
ahs-3074	61	8	elisa	elisa	PROPN
ahs-3074	61	9	test	test	NOUN
ahs-3074	61	10	were	be	AUX
ahs-3074	61	11	subsequently	subsequently	ADV
ahs-3074	61	12	analysed	analyse	VERB
ahs-3074	61	13	by	by	ADP
ahs-3074	61	14	rt	rt	PROPN
ahs-3074	61	15	-	-	PUNCT
ahs-3074	61	16	pcr	pcr	NOUN
ahs-3074	61	17	reaction	reaction	NOUN
ahs-3074	61	18	using	use	VERB
ahs-3074	61	19	specific	specific	ADJ
ahs-3074	61	20	primer	primer	NOUN
ahs-3074	61	21	pairs	pair	NOUN
ahs-3074	61	22	(	(	PUNCT
ahs-3074	61	23	table	table	NOUN
ahs-3074	61	24	1	1	NUM
ahs-3074	61	25	)	)	PUNCT
ahs-3074	61	26	.	.	PUNCT
ahs-3074	62	1	fig	fig	NOUN
ahs-3074	62	2	.	.	PUNCT
ahs-3074	63	1	1	1	NUM
ahs-3074	63	2	location	location	NOUN
ahs-3074	63	3	of	of	ADP
ahs-3074	63	4	the	the	DET
ahs-3074	63	5	six	six	NUM
ahs-3074	63	6	national	national	ADJ
ahs-3074	63	7	collection	collection	NOUN
ahs-3074	63	8	centres	centre	NOUN
ahs-3074	63	9	and	and	CCONJ
ahs-3074	63	10	of	of	ADP
ahs-3074	63	11	the	the	DET
ahs-3074	63	12	57	57	NUM
ahs-3074	63	13	mother	mother	NOUN
ahs-3074	63	14	stock	stock	NOUN
ahs-3074	63	15	nurseries	nursery	NOUN
ahs-3074	63	16	in	in	ADP
ahs-3074	63	17	afghanistan	afghanistan	PROPN
ahs-3074	63	18	.	.	PUNCT
ahs-3074	64	1	virus	virus	NOUN
ahs-3074	64	2	primers	primer	NOUN
ahs-3074	64	3	primers	primer	NOUN
ahs-3074	64	4	sequences	sequence	NOUN
ahs-3074	64	5	(	(	PUNCT
ahs-3074	64	6	5	5	NUM
ahs-3074	64	7	’	’	SYM
ahs-3074	64	8	3	3	NUM
ahs-3074	64	9	’	'	PUNCT
ahs-3074	64	10	)	)	PUNCT
ahs-3074	64	11	size	size	NOUN
ahs-3074	64	12	of	of	ADP
ahs-3074	64	13	amplif	amplif	PROPN
ahs-3074	64	14	.	.	PUNCT
ahs-3074	65	1	(	(	PUNCT
ahs-3074	65	2	bp	bp	PROPN
ahs-3074	65	3	)	)	PUNCT
ahs-3074	65	4	cycling	cycling	NOUN
ahs-3074	65	5	(	(	PUNCT
ahs-3074	65	6	temp./time	temp./time	NOUN
ahs-3074	65	7	)	)	PUNCT
ahs-3074	65	8	*	*	NOUN
ahs-3074	65	9	n	n	CCONJ
ahs-3074	65	10	°	°	NOUN
ahs-3074	65	11	of	of	ADP
ahs-3074	65	12	cycles	cycle	NOUN
ahs-3074	65	13	reference	reference	NOUN
ahs-3074	65	14	denat	denat	PROPN
ahs-3074	65	15	.	.	PUNCT
ahs-3074	66	1	anneal	anneal	PROPN
ahs-3074	66	2	.	.	PUNCT
ahs-3074	66	3	exten	exten	PROPN
ahs-3074	66	4	.	.	PUNCT
ahs-3074	67	1	aclsv	aclsv	NOUN
ahs-3074	67	2	sense	sense	NOUN
ahs-3074	67	3	ttcatggaaagacaggggcaa	ttcatggaaagacaggggcaa	NOUN
ahs-3074	67	4	677	677	NUM
ahs-3074	67	5	94	94	NUM
ahs-3074	67	6	°	°	PROPN
ahs-3074	67	7	c/20	c/20	NOUN
ahs-3074	67	8	s	s	PART
ahs-3074	67	9	58	58	NUM
ahs-3074	67	10	°	°	NOUN
ahs-3074	67	11	c/20	c/20	NOUN
ahs-3074	67	12	s	s	PART
ahs-3074	67	13	72	72	NUM
ahs-3074	67	14	°	°	NOUN
ahs-3074	67	15	c/20	c/20	NOUN
ahs-3074	67	16	s	s	PART
ahs-3074	67	17	35	35	NUM
ahs-3074	67	18	menzel	menzel	ADJ
ahs-3074	67	19	et	et	PROPN
ahs-3074	67	20	al	al	PROPN
ahs-3074	67	21	.	.	PROPN
ahs-3074	67	22	,	,	PUNCT
ahs-3074	67	23	2002	2002	NUM
ahs-3074	67	24	antisense	antisense	NOUN
ahs-3074	67	25	aagtctacaggctatttattataagtctaa	aagtctacaggctatttattataagtctaa	PROPN
ahs-3074	67	26	pnrsv	pnrsv	PROPN
ahs-3074	67	27	mg1	mg1	PROPN
ahs-3074	67	28	atggtttgccgaatttgc	atggtttgccgaatttgc	VERB
ahs-3074	67	29	675	675	NUM
ahs-3074	67	30	94	94	NUM
ahs-3074	67	31	°	°	NUM
ahs-3074	67	32	c/60	c/60	NOUN
ahs-3074	67	33	s	s	PART
ahs-3074	67	34	55	55	NUM
ahs-3074	67	35	°	°	NUM
ahs-3074	67	36	c/45	c/45	PROPN
ahs-3074	67	37	s	s	PART
ahs-3074	67	38	72	72	NUM
ahs-3074	67	39	°	°	NUM
ahs-3074	67	40	c/60	c/60	NOUN
ahs-3074	67	41	s	s	PART
ahs-3074	67	42	35	35	NUM
ahs-3074	67	43	glasa	glasa	NOUN
ahs-3074	67	44	et	et	PROPN
ahs-3074	67	45	al	al	PROPN
ahs-3074	67	46	.	.	PROPN
ahs-3074	67	47	,	,	PUNCT
ahs-3074	67	48	2002	2002	NUM
ahs-3074	67	49	mg2	mg2	PROPN
ahs-3074	67	50	actctagatctcaagcaggtc	actctagatctcaagcaggtc	PROPN
ahs-3074	67	51	gflv	gflv	PROPN
ahs-3074	67	52	m3	m3	PROPN
ahs-3074	67	53	atgctggatatcgtgaccctgt	atgctggatatcgtgaccctgt	NOUN
ahs-3074	67	54	118	118	NUM
ahs-3074	67	55	94	94	NUM
ahs-3074	67	56	°	°	NUM
ahs-3074	67	57	c/10	c/10	NOUN
ahs-3074	67	58	s	s	PART
ahs-3074	67	59	54	54	NUM
ahs-3074	67	60	°	°	NUM
ahs-3074	67	61	c/10	c/10	NOUN
ahs-3074	67	62	s	s	PART
ahs-3074	67	63	72	72	NUM
ahs-3074	67	64	°	°	ADP
ahs-3074	67	65	c/45	c/45	PROPN
ahs-3074	67	66	s	s	PART
ahs-3074	67	67	35	35	NUM
ahs-3074	67	68	gambino	gambino	NOUN
ahs-3074	67	69	and	and	CCONJ
ahs-3074	67	70	gribaudo	gribaudo	NOUN
ahs-3074	67	71	,	,	PUNCT
ahs-3074	67	72	2006	2006	NUM
ahs-3074	67	73	m4	m4	PROPN
ahs-3074	67	74	gaaggtatgcctgcttcagtgg	gaaggtatgcctgcttcagtgg	PROPN
ahs-3074	67	75	ctv	ctv	PROPN
ahs-3074	67	76	ctvf	ctvf	PROPN
ahs-3074	67	77	taatggacgacgaacaaaga	taatggacgacgaacaaaga	PROPN
ahs-3074	67	78	655	655	NUM
ahs-3074	67	79	94	94	NUM
ahs-3074	67	80	°	°	NOUN
ahs-3074	67	81	c/40	c/40	NOUN
ahs-3074	67	82	s	s	PART
ahs-3074	67	83	56	56	NUM
ahs-3074	67	84	°	°	NOUN
ahs-3074	67	85	c/40	c/40	NOUN
ahs-3074	67	86	s	s	PART
ahs-3074	67	87	72	72	NUM
ahs-3074	67	88	°	°	NUM
ahs-3074	67	89	c/60	c/60	NOUN
ahs-3074	67	90	s	s	PART
ahs-3074	67	91	30	30	NUM
ahs-3074	67	92	rehman	rehman	NOUN
ahs-3074	67	93	et	et	PROPN
ahs-3074	67	94	al	al	PROPN
ahs-3074	67	95	.	.	PROPN
ahs-3074	67	96	,	,	PUNCT
ahs-3074	67	97	2012	2012	NUM
ahs-3074	67	98	ctvr	ctvr	NOUN
ahs-3074	67	99	ccaagctgcctgacattagt	ccaagctgcctgacattagt	NOUN
ahs-3074	67	100	table	table	NOUN
ahs-3074	67	101	1	1	NUM
ahs-3074	67	102	list	list	NOUN
ahs-3074	67	103	of	of	ADP
ahs-3074	67	104	primer	primer	NOUN
ahs-3074	67	105	pairs	pair	NOUN
ahs-3074	67	106	,	,	PUNCT
ahs-3074	67	107	size	size	NOUN
ahs-3074	67	108	of	of	ADP
ahs-3074	67	109	amplicons	amplicon	NOUN
ahs-3074	67	110	,	,	PUNCT
ahs-3074	67	111	and	and	CCONJ
ahs-3074	67	112	rt	rt	ADJ
ahs-3074	67	113	-	-	PUNCT
ahs-3074	67	114	pcr	pcr	NOUN
ahs-3074	67	115	conditions	condition	NOUN
ahs-3074	67	116	used	use	VERB
ahs-3074	67	117	to	to	PART
ahs-3074	67	118	confirm	confirm	VERB
ahs-3074	67	119	viral	viral	ADJ
ahs-3074	67	120	infection	infection	NOUN
ahs-3074	67	121	in	in	ADP
ahs-3074	67	122	all	all	DET
ahs-3074	67	123	samples	sample	NOUN
ahs-3074	67	124	resulting	result	VERB
ahs-3074	67	125	positive	positive	ADJ
ahs-3074	67	126	to	to	ADP
ahs-3074	67	127	the	the	DET
ahs-3074	67	128	das	das	PROPN
ahs-3074	67	129	-	-	PUNCT
ahs-3074	67	130	elisa	elisa	PROPN
ahs-3074	67	131	test	test	NOUN
ahs-3074	67	132	*	*	PUNCT
ahs-3074	67	133	pcr	pcr	ADJ
ahs-3074	67	134	amplifications	amplification	NOUN
ahs-3074	67	135	were	be	AUX
ahs-3074	67	136	performed	perform	VERB
ahs-3074	67	137	at	at	ADP
ahs-3074	67	138	94	94	NUM
ahs-3074	67	139	°	°	ADP
ahs-3074	67	140	c	c	NOUN
ahs-3074	67	141	for	for	ADP
ahs-3074	67	142	5	5	NUM
ahs-3074	67	143	min	min	NOUN
ahs-3074	67	144	for	for	ADP
ahs-3074	67	145	initial	initial	ADJ
ahs-3074	67	146	denaturation	denaturation	NOUN
ahs-3074	67	147	and	and	CCONJ
ahs-3074	67	148	72	72	NUM
ahs-3074	67	149	°	°	NOUN
ahs-3074	67	150	c	c	NOUN
ahs-3074	67	151	for	for	ADP
ahs-3074	67	152	5	5	NUM
ahs-3074	67	153	min	min	NOUN
ahs-3074	67	154	for	for	ADP
ahs-3074	67	155	final	final	ADJ
ahs-3074	67	156	extension	extension	NOUN
ahs-3074	67	157	.	.	PUNCT
ahs-3074	68	1	adv	adv	PROPN
ahs-3074	68	2	.	.	PUNCT
ahs-3074	68	3	hort	hort	PROPN
ahs-3074	68	4	.	.	PUNCT
ahs-3074	69	1	sci	sci	PROPN
ahs-3074	69	2	.	.	PROPN
ahs-3074	69	3	,	,	PUNCT
ahs-3074	69	4	2016	2016	NUM
ahs-3074	69	5	30(4	30(4	NUM
ahs-3074	69	6	):	):	PUNCT
ahs-3074	69	7	239	239	NUM
ahs-3074	69	8	-	-	SYM
ahs-3074	69	9	248	248	NUM
ahs-3074	69	10	242	242	NUM
ahs-3074	69	11	total	total	ADJ
ahs-3074	69	12	rnas	rna	NOUN
ahs-3074	69	13	were	be	AUX
ahs-3074	69	14	extracted	extract	VERB
ahs-3074	69	15	from	from	ADP
ahs-3074	69	16	each	each	DET
ahs-3074	69	17	sample	sample	NOUN
ahs-3074	69	18	using	use	VERB
ahs-3074	69	19	ctab	ctab	NOUN
ahs-3074	69	20	rna	rna	NOUN
ahs-3074	69	21	extraction	extraction	NOUN
ahs-3074	69	22	method	method	NOUN
ahs-3074	69	23	,	,	PUNCT
ahs-3074	69	24	as	as	SCONJ
ahs-3074	69	25	previous	previous	ADJ
ahs-3074	69	26	reported	report	VERB
ahs-3074	69	27	(	(	PUNCT
ahs-3074	69	28	ratti	ratti	PROPN
ahs-3074	69	29	et	et	PROPN
ahs-3074	69	30	al	al	PROPN
ahs-3074	69	31	.	.	PROPN
ahs-3074	69	32	,	,	PUNCT
ahs-3074	69	33	2004	2004	NUM
ahs-3074	69	34	)	)	PUNCT
ahs-3074	69	35	.	.	PUNCT
ahs-3074	70	1	complementary	complementary	ADJ
ahs-3074	70	2	dna	dna	PROPN
ahs-3074	70	3	(	(	PUNCT
ahs-3074	70	4	cdna	cdna	PROPN
ahs-3074	70	5	)	)	PUNCT
ahs-3074	70	6	was	be	AUX
ahs-3074	70	7	synthesized	synthesize	VERB
ahs-3074	70	8	using	use	VERB
ahs-3074	70	9	m	m	ADJ
ahs-3074	70	10	-	-	PUNCT
ahs-3074	70	11	mlv	mlv	ADJ
ahs-3074	70	12	reverse	reverse	ADJ
ahs-3074	70	13	transcriptase	transcriptase	NOUN
ahs-3074	70	14	(	(	PUNCT
ahs-3074	70	15	promega	promega	PROPN
ahs-3074	70	16	,	,	PUNCT
ahs-3074	70	17	usa	usa	PROPN
ahs-3074	70	18	)	)	PUNCT
ahs-3074	70	19	in	in	ADP
ahs-3074	70	20	a	a	DET
ahs-3074	70	21	final	final	ADJ
ahs-3074	70	22	volume	volume	NOUN
ahs-3074	70	23	of	of	ADP
ahs-3074	70	24	5.0	5.0	NUM
ahs-3074	70	25	µl	µl	NOUN
ahs-3074	70	26	.	.	PUNCT
ahs-3074	71	1	rna	rna	NOUN
ahs-3074	71	2	(	(	PUNCT
ahs-3074	71	3	1.0	1.0	NUM
ahs-3074	71	4	µl	µl	NOUN
ahs-3074	71	5	)	)	PUNCT
ahs-3074	71	6	,	,	PUNCT
ahs-3074	71	7	mixed	mix	VERB
ahs-3074	71	8	with	with	ADP
ahs-3074	71	9	m	m	ADJ
ahs-3074	71	10	-	-	PUNCT
ahs-3074	71	11	mlv	mlv	ADJ
ahs-3074	71	12	5x	5x	NUM
ahs-3074	71	13	buffer	buffer	NOUN
ahs-3074	71	14	,	,	PUNCT
ahs-3074	71	15	0.5	0.5	NUM
ahs-3074	71	16	µl	µl	ADP
ahs-3074	71	17	10	10	NUM
ahs-3074	71	18	mm	mm	NOUN
ahs-3074	71	19	dntps	dntps	NOUN
ahs-3074	71	20	,	,	PUNCT
ahs-3074	71	21	1.0	1.0	NUM
ahs-3074	71	22	µl	µl	PART
ahs-3074	71	23	10nmol	10nmol	NUM
ahs-3074	71	24	/	/	SYM
ahs-3074	71	25	ml	ml	ADP
ahs-3074	71	26	specific	specific	ADJ
ahs-3074	71	27	reverse	reverse	NOUN
ahs-3074	71	28	primer	primer	NOUN
ahs-3074	71	29	,	,	PUNCT
ahs-3074	71	30	0.25	0.25	NUM
ahs-3074	71	31	µl	µl	NOUN
ahs-3074	71	32	of	of	ADP
ahs-3074	71	33	200	200	NUM
ahs-3074	71	34	u/µl	u/µl	PROPN
ahs-3074	71	35	m	m	NOUN
ahs-3074	71	36	-	-	PUNCT
ahs-3074	71	37	mlv	mlv	ADJ
ahs-3074	71	38	and	and	CCONJ
ahs-3074	71	39	2.25	2.25	NUM
ahs-3074	71	40	µl	µl	ADP
ahs-3074	71	41	of	of	ADP
ahs-3074	71	42	nucleasefree	nucleasefree	NOUN
ahs-3074	71	43	water	water	NOUN
ahs-3074	71	44	,	,	PUNCT
ahs-3074	71	45	then	then	ADV
ahs-3074	71	46	incubated	incubate	VERB
ahs-3074	71	47	at	at	ADP
ahs-3074	71	48	4	4	NUM
ahs-3074	71	49	2	2	NUM
ahs-3074	71	50	°	°	ADP
ahs-3074	71	51	c	c	NOUN
ahs-3074	71	52	(	(	PUNCT
ahs-3074	71	53	or	or	CCONJ
ahs-3074	71	54	37	37	NUM
ahs-3074	71	55	°	°	NOUN
ahs-3074	71	56	c	c	NOUN
ahs-3074	71	57	for	for	ADP
ahs-3074	71	58	aclsv	aclsv	NOUN
ahs-3074	71	59	and	and	CCONJ
ahs-3074	71	60	pnrsv	pnrsv	NUM
ahs-3074	71	61	)	)	PUNCT
ahs-3074	71	62	for	for	ADP
ahs-3074	71	63	1	1	NUM
ahs-3074	71	64	h.	h.	NOUN
ahs-3074	71	65	for	for	ADP
ahs-3074	71	66	pcr	pcr	ADJ
ahs-3074	71	67	amplification	amplification	NOUN
ahs-3074	71	68	,	,	PUNCT
ahs-3074	71	69	5.0	5.0	NUM
ahs-3074	71	70	µl	µl	NOUN
ahs-3074	71	71	of	of	ADP
ahs-3074	71	72	cdna	cdna	PROPN
ahs-3074	71	73	template	template	NOUN
ahs-3074	71	74	,	,	PUNCT
ahs-3074	71	75	5.0	5.0	NUM
ahs-3074	71	76	µl	µl	NOUN
ahs-3074	71	77	of	of	ADP
ahs-3074	71	78	5x	5x	NUM
ahs-3074	71	79	green	green	ADJ
ahs-3074	71	80	gotaq	gotaq	NOUN
ahs-3074	71	81	buffer	buffer	NOUN
ahs-3074	71	82	,	,	PUNCT
ahs-3074	71	83	1.5	1.5	NUM
ahs-3074	71	84	µl	µl	NOUN
ahs-3074	71	85	of	of	ADP
ahs-3074	71	86	25	25	NUM
ahs-3074	71	87	mm	mm	NUM
ahs-3074	71	88	mgcl2	mgcl2	PROPN
ahs-3074	71	89	,	,	PUNCT
ahs-3074	71	90	1.0	1.0	NUM
ahs-3074	71	91	µl	µl	PART
ahs-3074	71	92	10	10	NUM
ahs-3074	71	93	nmol	nmol	NOUN
ahs-3074	71	94	/	/	SYM
ahs-3074	71	95	ml	ml	NOUN
ahs-3074	71	96	of	of	ADP
ahs-3074	71	97	specific	specific	ADJ
ahs-3074	71	98	forward	forward	ADJ
ahs-3074	71	99	primer	primer	NOUN
ahs-3074	71	100	,	,	PUNCT
ahs-3074	71	101	0.5	0.5	NUM
ahs-3074	71	102	µl	µl	NOUN
ahs-3074	71	103	of	of	ADP
ahs-3074	71	104	10	10	NUM
ahs-3074	71	105	mm	mm	NOUN
ahs-3074	71	106	dntps	dntps	NOUN
ahs-3074	71	107	and	and	CCONJ
ahs-3074	71	108	0.2	0.2	NUM
ahs-3074	71	109	µl	µl	ADP
ahs-3074	71	110	of	of	ADP
ahs-3074	71	111	5	5	NUM
ahs-3074	71	112	u/µl	u/µl	PROPN
ahs-3074	71	113	gotaq	gotaq	X
ahs-3074	71	114	polymerase	polymerase	NOUN
ahs-3074	71	115	(	(	PUNCT
ahs-3074	71	116	promega	promega	PROPN
ahs-3074	71	117	,	,	PUNCT
ahs-3074	71	118	usa	usa	PROPN
ahs-3074	71	119	)	)	PUNCT
ahs-3074	71	120	were	be	AUX
ahs-3074	71	121	mixed	mix	VERB
ahs-3074	71	122	in	in	ADP
ahs-3074	71	123	a	a	DET
ahs-3074	71	124	total	total	ADJ
ahs-3074	71	125	volume	volume	NOUN
ahs-3074	71	126	of	of	ADP
ahs-3074	71	127	25	25	NUM
ahs-3074	71	128	µl	µl	NOUN
ahs-3074	71	129	.	.	PUNCT
ahs-3074	72	1	the	the	DET
ahs-3074	72	2	number	number	NOUN
ahs-3074	72	3	of	of	ADP
ahs-3074	72	4	cycles	cycle	NOUN
ahs-3074	72	5	and	and	CCONJ
ahs-3074	72	6	cycling	cycling	NOUN
ahs-3074	72	7	conditions	condition	NOUN
ahs-3074	72	8	for	for	ADP
ahs-3074	72	9	each	each	DET
ahs-3074	72	10	primer	primer	NOUN
ahs-3074	72	11	set	set	VERB
ahs-3074	72	12	are	be	AUX
ahs-3074	72	13	given	give	VERB
ahs-3074	72	14	in	in	ADP
ahs-3074	72	15	table	table	NOUN
ahs-3074	72	16	1	1	NUM
ahs-3074	72	17	.	.	PUNCT
ahs-3074	73	1	the	the	DET
ahs-3074	73	2	amplified	amplify	VERB
ahs-3074	73	3	pcr	pcr	ADJ
ahs-3074	73	4	products	product	NOUN
ahs-3074	73	5	were	be	AUX
ahs-3074	73	6	analysed	analyse	VERB
ahs-3074	73	7	in	in	ADP
ahs-3074	73	8	1	1	NUM
ahs-3074	73	9	%	%	NOUN
ahs-3074	73	10	agarose	agarose	NOUN
ahs-3074	73	11	gel	gel	NOUN
ahs-3074	73	12	stained	stain	VERB
ahs-3074	73	13	by	by	ADP
ahs-3074	73	14	ethidium	ethidium	NOUN
ahs-3074	73	15	-	-	PUNCT
ahs-3074	73	16	bromide	bromide	NOUN
ahs-3074	73	17	and	and	CCONJ
ahs-3074	73	18	visualized	visualize	VERB
ahs-3074	73	19	under	under	ADP
ahs-3074	73	20	uv	uv	NOUN
ahs-3074	73	21	light	light	NOUN
ahs-3074	73	22	after	after	ADP
ahs-3074	73	23	electrophoresis	electrophoresis	NOUN
ahs-3074	73	24	.	.	PUNCT
ahs-3074	74	1	3	3	X
ahs-3074	74	2	.	.	X
ahs-3074	74	3	results	result	VERB
ahs-3074	74	4	das	das	PROPN
ahs-3074	74	5	-	-	PUNCT
ahs-3074	74	6	elisa	elisa	NOUN
ahs-3074	74	7	analyses	analyse	VERB
ahs-3074	74	8	all	all	DET
ahs-3074	74	9	apple	apple	NOUN
ahs-3074	74	10	and	and	CCONJ
ahs-3074	74	11	pear	pear	NOUN
ahs-3074	74	12	plants	plant	NOUN
ahs-3074	74	13	analysed	analyse	VERB
ahs-3074	74	14	(	(	PUNCT
ahs-3074	74	15	180	180	NUM
ahs-3074	74	16	samples	sample	NOUN
ahs-3074	74	17	)	)	PUNCT
ahs-3074	74	18	resulted	result	VERB
ahs-3074	74	19	free	free	ADJ
ahs-3074	74	20	from	from	ADP
ahs-3074	74	21	aclsv	aclsv	NOUN
ahs-3074	74	22	,	,	PUNCT
ahs-3074	74	23	apmv	apmv	ADV
ahs-3074	74	24	,	,	PUNCT
ahs-3074	74	25	asgv	asgv	NOUN
ahs-3074	74	26	and	and	CCONJ
ahs-3074	74	27	aspv	aspv	NOUN
ahs-3074	74	28	.	.	PUNCT
ahs-3074	75	1	symptoms	symptom	NOUN
ahs-3074	75	2	such	such	ADJ
ahs-3074	75	3	as	as	ADP
ahs-3074	75	4	yellowing	yellow	VERB
ahs-3074	75	5	,	,	PUNCT
ahs-3074	75	6	leaf	leaf	NOUN
ahs-3074	75	7	distortion	distortion	NOUN
ahs-3074	75	8	and	and	CCONJ
ahs-3074	75	9	puckering	puckering	NOUN
ahs-3074	75	10	were	be	AUX
ahs-3074	75	11	observed	observe	VERB
ahs-3074	75	12	in	in	ADP
ahs-3074	75	13	some	some	DET
ahs-3074	75	14	stone	stone	NOUN
ahs-3074	75	15	fruit	fruit	NOUN
ahs-3074	75	16	plants	plant	NOUN
ahs-3074	75	17	during	during	ADP
ahs-3074	75	18	collection	collection	NOUN
ahs-3074	75	19	of	of	ADP
ahs-3074	75	20	the	the	DET
ahs-3074	75	21	5521	5521	NUM
ahs-3074	75	22	samples	sample	NOUN
ahs-3074	75	23	that	that	PRON
ahs-3074	75	24	were	be	AUX
ahs-3074	75	25	tested	test	VERB
ahs-3074	75	26	by	by	ADP
ahs-3074	75	27	das	das	PROPN
ahs-3074	75	28	-	-	PUNCT
ahs-3074	75	29	elisa	elisa	NOUN
ahs-3074	75	30	(	(	PUNCT
ahs-3074	75	31	fig	fig	NOUN
ahs-3074	75	32	.	.	PUNCT
ahs-3074	76	1	2	2	NUM
ahs-3074	76	2	)	)	PUNCT
ahs-3074	76	3	.	.	PUNCT
ahs-3074	77	1	among	among	ADP
ahs-3074	77	2	them	they	PRON
ahs-3074	77	3	,	,	PUNCT
ahs-3074	77	4	23	23	NUM
ahs-3074	77	5	(	(	PUNCT
ahs-3074	77	6	0.4	0.4	NUM
ahs-3074	77	7	%	%	NOUN
ahs-3074	77	8	)	)	PUNCT
ahs-3074	77	9	samples	sample	NOUN
ahs-3074	77	10	collected	collect	VERB
ahs-3074	77	11	from	from	ADP
ahs-3074	77	12	several	several	ADJ
ahs-3074	77	13	msns	msns	PROPN
ahs-3074	77	14	in	in	ADP
ahs-3074	77	15	kabul	kabul	PROPN
ahs-3074	77	16	,	,	PUNCT
ahs-3074	77	17	khandahar	khandahar	PROPN
ahs-3074	77	18	,	,	PUNCT
ahs-3074	77	19	parwan	parwan	NOUN
ahs-3074	77	20	,	,	PUNCT
ahs-3074	77	21	herat	herat	NOUN
ahs-3074	77	22	and	and	CCONJ
ahs-3074	77	23	baghlan	baghlan	PROPN
ahs-3074	77	24	provinces	province	NOUN
ahs-3074	77	25	resulted	result	VERB
ahs-3074	77	26	positive	positive	ADJ
ahs-3074	77	27	to	to	AUX
ahs-3074	77	28	aclsv	aclsv	VERB
ahs-3074	77	29	.	.	PUNCT
ahs-3074	78	1	in	in	ADP
ahs-3074	78	2	particular	particular	ADJ
ahs-3074	78	3	,	,	PUNCT
ahs-3074	78	4	there	there	PRON
ahs-3074	78	5	were	be	VERB
ahs-3074	78	6	two	two	NUM
ahs-3074	78	7	plants	plant	NOUN
ahs-3074	78	8	of	of	ADP
ahs-3074	78	9	european	european	ADJ
ahs-3074	78	10	plum	plum	NOUN
ahs-3074	78	11	(	(	PUNCT
ahs-3074	78	12	clone	clone	NOUN
ahs-3074	78	13	364	364	NUM
ahs-3074	78	14	/	/	SYM
ahs-3074	78	15	local	local	ADJ
ahs-3074	78	16	name	name	NOUN
ahs-3074	78	17	alu	alu	NOUN
ahs-3074	78	18	bokharashalili	bokharashalili	NOUN
ahs-3074	78	19	)	)	PUNCT
ahs-3074	78	20	,	,	PUNCT
ahs-3074	78	21	one	one	NUM
ahs-3074	78	22	cross	cross	NOUN
ahs-3074	78	23	of	of	ADP
ahs-3074	78	24	myrobalan	myrobalan	NOUN
ahs-3074	78	25	and	and	CCONJ
ahs-3074	78	26	japanese	japanese	ADJ
ahs-3074	78	27	plum	plum	NOUN
ahs-3074	78	28	(	(	PUNCT
ahs-3074	78	29	4031	4031	NUM
ahs-3074	78	30	/	/	SYM
ahs-3074	78	31	grangej	grangej	VERB
ahs-3074	78	32	zard	zard	PROPN
ahs-3074	78	33	)	)	PUNCT
ahs-3074	78	34	,	,	PUNCT
ahs-3074	78	35	17	17	NUM
ahs-3074	78	36	plants	plant	NOUN
ahs-3074	78	37	of	of	ADP
ahs-3074	78	38	peach	peach	NOUN
ahs-3074	78	39	(	(	PUNCT
ahs-3074	78	40	five	five	NUM
ahs-3074	78	41	from	from	ADP
ahs-3074	78	42	804	804	NUM
ahs-3074	78	43	/	/	SYM
ahs-3074	78	44	turki	turki	NOUN
ahs-3074	78	45	sorkh	sorkh	PROPN
ahs-3074	78	46	,	,	PUNCT
ahs-3074	78	47	five	five	NUM
ahs-3074	78	48	from	from	ADP
ahs-3074	78	49	812	812	NUM
ahs-3074	78	50	/	/	SYM
ahs-3074	78	51	dir	dir	NOUN
ahs-3074	78	52	ras	ras	NOUN
ahs-3074	78	53	and	and	CCONJ
ahs-3074	78	54	seven	seven	NUM
ahs-3074	78	55	from	from	ADP
ahs-3074	78	56	811	811	NUM
ahs-3074	78	57	/	/	SYM
ahs-3074	78	58	turkizard	turkizard	NOUN
ahs-3074	78	59	)	)	PUNCT
ahs-3074	78	60	,	,	PUNCT
ahs-3074	78	61	one	one	NUM
ahs-3074	78	62	plant	plant	NOUN
ahs-3074	78	63	of	of	ADP
ahs-3074	78	64	almond	almond	NOUN
ahs-3074	78	65	(	(	PUNCT
ahs-3074	78	66	159	159	NUM
ahs-3074	78	67	/	/	SYM
ahs-3074	78	68	sattarbai	sattarbai	PROPN
ahs-3074	78	69	bakhmali	bakhmali	PROPN
ahs-3074	78	70	)	)	PUNCT
ahs-3074	78	71	and	and	CCONJ
ahs-3074	78	72	two	two	NUM
ahs-3074	78	73	plants	plant	NOUN
ahs-3074	78	74	of	of	ADP
ahs-3074	78	75	apricot	apricot	PROPN
ahs-3074	78	76	(	(	PUNCT
ahs-3074	78	77	373	373	NUM
ahs-3074	78	78	/	/	SYM
ahs-3074	78	79	shakarpara	shakarpara	NOUN
ahs-3074	78	80	and	and	CCONJ
ahs-3074	78	81	4037	4037	NUM
ahs-3074	78	82	/	/	SYM
ahs-3074	78	83	aqa	aqa	PROPN
ahs-3074	78	84	banu	banu	PROPN
ahs-3074	78	85	)	)	PUNCT
ahs-3074	78	86	.	.	PUNCT
ahs-3074	79	1	two	two	NUM
ahs-3074	79	2	(	(	PUNCT
ahs-3074	79	3	0.03	0.03	NUM
ahs-3074	79	4	%	%	NOUN
ahs-3074	79	5	)	)	PUNCT
ahs-3074	79	6	almond	almond	NOUN
ahs-3074	79	7	samples	sample	NOUN
ahs-3074	79	8	,	,	PUNCT
ahs-3074	79	9	both	both	PRON
ahs-3074	79	10	collected	collect	VERB
ahs-3074	79	11	from	from	ADP
ahs-3074	79	12	the	the	DET
ahs-3074	79	13	ncc	ncc	NOUN
ahs-3074	79	14	in	in	ADP
ahs-3074	79	15	balkh	balkh	PROPN
ahs-3074	79	16	province	province	PROPN
ahs-3074	79	17	,	,	PUNCT
ahs-3074	79	18	resulted	result	VERB
ahs-3074	79	19	infected	infect	VERB
ahs-3074	79	20	by	by	ADP
ahs-3074	79	21	apmv	apmv	PROPN
ahs-3074	79	22	;	;	PUNCT
ahs-3074	79	23	in	in	SCONJ
ahs-3074	79	24	was	be	AUX
ahs-3074	79	25	interesting	interesting	ADJ
ahs-3074	79	26	that	that	SCONJ
ahs-3074	79	27	one	one	NUM
ahs-3074	79	28	of	of	ADP
ahs-3074	79	29	them	they	PRON
ahs-3074	79	30	also	also	ADV
ahs-3074	79	31	tested	test	VERB
ahs-3074	79	32	positive	positive	ADJ
ahs-3074	79	33	to	to	ADP
ahs-3074	79	34	pnrsv	pnrsv	NUM
ahs-3074	79	35	.	.	PUNCT
ahs-3074	80	1	analyses	analysis	NOUN
ahs-3074	80	2	against	against	ADP
ahs-3074	80	3	pnrsv	pnrsv	PROPN
ahs-3074	80	4	evidenced	evidence	VERB
ahs-3074	80	5	38	38	NUM
ahs-3074	80	6	samples	sample	NOUN
ahs-3074	80	7	(	(	PUNCT
ahs-3074	80	8	0.6	0.6	NUM
ahs-3074	80	9	%	%	NOUN
ahs-3074	80	10	)	)	PUNCT
ahs-3074	80	11	,	,	PUNCT
ahs-3074	80	12	collected	collect	VERB
ahs-3074	80	13	from	from	ADP
ahs-3074	80	14	nccs	nccs	PROPN
ahs-3074	80	15	or	or	CCONJ
ahs-3074	80	16	msns	msns	NOUN
ahs-3074	80	17	located	locate	VERB
ahs-3074	80	18	in	in	ADP
ahs-3074	80	19	balkh	balkh	NOUN
ahs-3074	80	20	,	,	PUNCT
ahs-3074	80	21	herat	herat	PROPN
ahs-3074	80	22	,	,	PUNCT
ahs-3074	80	23	kabul	kabul	PROPN
ahs-3074	80	24	,	,	PUNCT
ahs-3074	80	25	khandaharand	khandaharand	NOUN
ahs-3074	80	26	paktya	paktya	NOUN
ahs-3074	80	27	as	as	SCONJ
ahs-3074	80	28	infected	infect	VERB
ahs-3074	80	29	by	by	ADP
ahs-3074	80	30	the	the	DET
ahs-3074	80	31	virus	virus	NOUN
ahs-3074	80	32	(	(	PUNCT
ahs-3074	80	33	13	13	NUM
ahs-3074	80	34	almond	almond	NOUN
ahs-3074	80	35	,	,	PUNCT
ahs-3074	80	36	five	five	NUM
ahs-3074	80	37	plum	plum	NOUN
ahs-3074	80	38	,	,	PUNCT
ahs-3074	80	39	nine	nine	NUM
ahs-3074	80	40	peach	peach	NOUN
ahs-3074	80	41	,	,	PUNCT
ahs-3074	80	42	and	and	CCONJ
ahs-3074	80	43	11	11	NUM
ahs-3074	80	44	cherry	cherry	NOUN
ahs-3074	80	45	plants	plant	NOUN
ahs-3074	80	46	)	)	PUNCT
ahs-3074	80	47	.	.	PUNCT
ahs-3074	81	1	finally	finally	ADV
ahs-3074	81	2	,	,	PUNCT
ahs-3074	81	3	one	one	NUM
ahs-3074	81	4	plum	plum	NOUN
ahs-3074	81	5	sample	sample	NOUN
ahs-3074	81	6	(	(	PUNCT
ahs-3074	81	7	cv	cv	PROPN
ahs-3074	81	8	.	.	PROPN
ahs-3074	81	9	alu	alu	PROPN
ahs-3074	81	10	bokhara	bokhara	PROPN
ahs-3074	81	11	shalili	shalili	PROPN
ahs-3074	81	12	)	)	PUNCT
ahs-3074	81	13	,	,	PUNCT
ahs-3074	81	14	from	from	ADP
ahs-3074	81	15	a	a	DET
ahs-3074	81	16	msn	msn	NOUN
ahs-3074	81	17	in	in	ADP
ahs-3074	81	18	kabul	kabul	PROPN
ahs-3074	81	19	,	,	PUNCT
ahs-3074	81	20	resulted	result	VERB
ahs-3074	81	21	infected	infect	VERB
ahs-3074	81	22	by	by	ADP
ahs-3074	81	23	pdv	pdv	NOUN
ahs-3074	81	24	while	while	SCONJ
ahs-3074	81	25	none	none	NOUN
ahs-3074	81	26	of	of	ADP
ahs-3074	81	27	the	the	DET
ahs-3074	81	28	stone	stone	NOUN
ahs-3074	81	29	fruit	fruit	NOUN
ahs-3074	81	30	samples	sample	NOUN
ahs-3074	81	31	tested	test	VERB
ahs-3074	81	32	resulted	result	VERB
ahs-3074	81	33	positive	positive	ADJ
ahs-3074	81	34	to	to	ADP
ahs-3074	81	35	ppv	ppv	NOUN
ahs-3074	81	36	(	(	PUNCT
ahs-3074	81	37	tables	table	NOUN
ahs-3074	81	38	2	2	NUM
ahs-3074	81	39	-	-	SYM
ahs-3074	81	40	6	6	NUM
ahs-3074	81	41	and	and	CCONJ
ahs-3074	81	42	fig	fig	NOUN
ahs-3074	81	43	.	.	PUNCT
ahs-3074	82	1	3	3	NUM
ahs-3074	82	2	)	)	PUNCT
ahs-3074	82	3	.	.	PUNCT
ahs-3074	83	1	among	among	ADP
ahs-3074	83	2	the	the	DET
ahs-3074	83	3	895	895	NUM
ahs-3074	83	4	grape	grape	NOUN
ahs-3074	83	5	samples	sample	NOUN
ahs-3074	83	6	analysed	analyse	VERB
ahs-3074	83	7	,	,	PUNCT
ahs-3074	83	8	one	one	NUM
ahs-3074	83	9	plant	plant	NOUN
ahs-3074	83	10	from	from	ADP
ahs-3074	83	11	the	the	DET
ahs-3074	83	12	ncc	ncc	NOUN
ahs-3074	83	13	in	in	ADP
ahs-3074	83	14	kandahar	kandahar	PROPN
ahs-3074	83	15	(	(	PUNCT
ahs-3074	83	16	cv	cv	PROPN
ahs-3074	83	17	.	.	PROPN
ahs-3074	83	18	shir	shir	PROPN
ahs-3074	83	19	ahmadi	ahmadi	PROPN
ahs-3074	83	20	herat	herat	PROPN
ahs-3074	83	21	)	)	PUNCT
ahs-3074	83	22	resulted	result	VERB
ahs-3074	83	23	infected	infect	VERB
ahs-3074	83	24	by	by	ADP
ahs-3074	83	25	gva	gva	PROPN
ahs-3074	83	26	and	and	CCONJ
ahs-3074	83	27	only	only	ADV
ahs-3074	83	28	one	one	NUM
ahs-3074	83	29	sample	sample	NOUN
ahs-3074	83	30	of	of	ADP
ahs-3074	83	31	the	the	DET
ahs-3074	83	32	cv	cv	PROPN
ahs-3074	83	33	.	.	PROPN
ahs-3074	83	34	pizzutello	pizzutello	PROPN
ahs-3074	83	35	bianco	bianco	PROPN
ahs-3074	83	36	,	,	PUNCT
ahs-3074	83	37	imported	import	VERB
ahs-3074	83	38	from	from	ADP
ahs-3074	83	39	italy	italy	PROPN
ahs-3074	83	40	and	and	CCONJ
ahs-3074	83	41	collected	collect	VERB
ahs-3074	83	42	in	in	ADP
ahs-3074	83	43	the	the	DET
ahs-3074	83	44	ncc	ncc	NOUN
ahs-3074	83	45	in	in	ADP
ahs-3074	83	46	herat	herat	PROPN
ahs-3074	83	47	,	,	PUNCT
ahs-3074	83	48	tested	test	VERB
ahs-3074	83	49	positive	positive	ADJ
ahs-3074	83	50	to	to	ADP
ahs-3074	83	51	glrav-1	glrav-1	PROPN
ahs-3074	83	52	(	(	PUNCT
ahs-3074	83	53	it	it	PRON
ahs-3074	83	54	also	also	ADV
ahs-3074	83	55	resulted	result	VERB
ahs-3074	83	56	as	as	SCONJ
ahs-3074	83	57	infected	infect	VERB
ahs-3074	83	58	by	by	ADP
ahs-3074	83	59	glrav-3	glrav-3	PROPN
ahs-3074	83	60	)	)	PUNCT
ahs-3074	83	61	.	.	PUNCT
ahs-3074	84	1	moreover	moreover	ADV
ahs-3074	84	2	,	,	PUNCT
ahs-3074	84	3	glrav-3	glrav-3	PROPN
ahs-3074	84	4	was	be	AUX
ahs-3074	84	5	detected	detect	VERB
ahs-3074	84	6	in	in	ADP
ahs-3074	84	7	two	two	NUM
ahs-3074	84	8	samples	sample	NOUN
ahs-3074	84	9	(	(	PUNCT
ahs-3074	84	10	cv	cv	PROPN
ahs-3074	84	11	.	.	PROPN
ahs-3074	84	12	pizzutello	pizzutello	PROPN
ahs-3074	84	13	bianco	bianco	PROPN
ahs-3074	84	14	and	and	CCONJ
ahs-3074	84	15	uva	uva	PROPN
ahs-3074	84	16	palieri	palieri	PROPN
ahs-3074	84	17	both	both	PRON
ahs-3074	84	18	imported	import	VERB
ahs-3074	84	19	from	from	ADP
ahs-3074	84	20	italy	italy	PROPN
ahs-3074	84	21	)	)	PUNCT
ahs-3074	84	22	,	,	PUNCT
ahs-3074	84	23	collected	collect	VERB
ahs-3074	84	24	from	from	ADP
ahs-3074	84	25	the	the	DET
ahs-3074	84	26	nnc	nnc	PROPN
ahs-3074	84	27	in	in	ADP
ahs-3074	84	28	herat	herat	PROPN
ahs-3074	84	29	.	.	PUNCT
ahs-3074	85	1	regarding	regard	VERB
ahs-3074	85	2	gflv	gflv	NOUN
ahs-3074	85	3	,	,	PUNCT
ahs-3074	85	4	all	all	DET
ahs-3074	85	5	the	the	DET
ahs-3074	85	6	62	62	NUM
ahs-3074	85	7	samples	sample	NOUN
ahs-3074	85	8	which	which	PRON
ahs-3074	85	9	resulted	resulted	AUX
ahs-3074	85	10	infected	infect	VERB
ahs-3074	85	11	by	by	ADP
ahs-3074	85	12	the	the	DET
ahs-3074	85	13	virus	virus	NOUN
ahs-3074	85	14	(	(	PUNCT
ahs-3074	85	15	6.9	6.9	NUM
ahs-3074	85	16	%	%	NOUN
ahs-3074	85	17	)	)	PUNCT
ahs-3074	85	18	belong	belong	VERB
ahs-3074	85	19	to	to	ADP
ahs-3074	85	20	afghan	afghan	ADJ
ahs-3074	85	21	cultivars	cultivar	NOUN
ahs-3074	85	22	,	,	PUNCT
ahs-3074	85	23	with	with	ADP
ahs-3074	85	24	the	the	DET
ahs-3074	85	25	exception	exception	NOUN
ahs-3074	85	26	of	of	ADP
ahs-3074	85	27	the	the	DET
ahs-3074	85	28	cv	cv	PROPN
ahs-3074	85	29	.	.	PROPN
ahs-3074	85	30	regina	regina	PROPN
ahs-3074	85	31	dei	dei	PROPN
ahs-3074	85	32	vigneti	vigneti	PROPN
ahs-3074	85	33	imported	import	VERB
ahs-3074	85	34	from	from	ADP
ahs-3074	85	35	italy	italy	PROPN
ahs-3074	85	36	.	.	PUNCT
ahs-3074	86	1	all	all	DET
ahs-3074	86	2	grape	grape	NOUN
ahs-3074	86	3	samples	sample	NOUN
ahs-3074	86	4	tested	test	VERB
ahs-3074	86	5	resulted	result	VERB
ahs-3074	86	6	negative	negative	ADJ
ahs-3074	86	7	to	to	ADP
ahs-3074	86	8	armv	armv	ADJ
ahs-3074	86	9	,	,	PUNCT
ahs-3074	86	10	gfkv	gfkv	NOUN
ahs-3074	86	11	and	and	CCONJ
ahs-3074	86	12	glrav-2	glrav-2	PROPN
ahs-3074	86	13	(	(	PUNCT
ahs-3074	86	14	table	table	NOUN
ahs-3074	86	15	7	7	NUM
ahs-3074	86	16	)	)	PUNCT
ahs-3074	86	17	(	(	PUNCT
ahs-3074	86	18	fig	fig	NOUN
ahs-3074	86	19	.	.	PUNCT
ahs-3074	87	1	3	3	NUM
ahs-3074	87	2	)	)	PUNCT
ahs-3074	87	3	.	.	PUNCT
ahs-3074	88	1	in	in	ADP
ahs-3074	88	2	addition	addition	NOUN
ahs-3074	88	3	,	,	PUNCT
ahs-3074	88	4	the	the	DET
ahs-3074	88	5	plant	plant	NOUN
ahs-3074	88	6	biotechnology	biotechnology	NOUN
ahs-3074	88	7	laboratory	laboratory	NOUN
ahs-3074	88	8	analyzed	analyze	VERB
ahs-3074	88	9	5400	5400	NUM
ahs-3074	88	10	citrus	citrus	NOUN
ahs-3074	88	11	plants	plant	NOUN
ahs-3074	88	12	and	and	CCONJ
ahs-3074	88	13	318	318	NUM
ahs-3074	88	14	of	of	ADP
ahs-3074	88	15	them	they	PRON
ahs-3074	88	16	(	(	PUNCT
ahs-3074	88	17	5.9	5.9	NUM
ahs-3074	88	18	%	%	NOUN
ahs-3074	88	19	)	)	PUNCT
ahs-3074	88	20	resulted	result	VERB
ahs-3074	88	21	infected	infect	VERB
ahs-3074	88	22	by	by	ADP
ahs-3074	88	23	ctv	ctv	PROPN
ahs-3074	88	24	.	.	PUNCT
ahs-3074	89	1	in	in	ADP
ahs-3074	89	2	particular	particular	ADJ
ahs-3074	89	3	,	,	PUNCT
ahs-3074	89	4	among	among	ADP
ahs-3074	89	5	the	the	DET
ahs-3074	89	6	positive	positive	ADJ
ahs-3074	89	7	samples	sample	NOUN
ahs-3074	89	8	,	,	PUNCT
ahs-3074	89	9	eight	eight	NUM
ahs-3074	89	10	plants	plant	NOUN
ahs-3074	89	11	,	,	PUNCT
ahs-3074	89	12	showing	show	VERB
ahs-3074	89	13	vein	vein	ADJ
ahs-3074	89	14	clearing	clearing	NOUN
ahs-3074	89	15	and	and	CCONJ
ahs-3074	89	16	flecking	fleck	VERB
ahs-3074	89	17	,	,	PUNCT
ahs-3074	89	18	yellowing	yellowing	NOUN
ahs-3074	89	19	and	and	CCONJ
ahs-3074	89	20	plant	plant	NOUN
ahs-3074	89	21	decline	decline	NOUN
ahs-3074	89	22	symptoms	symptom	NOUN
ahs-3074	89	23	(	(	PUNCT
ahs-3074	89	24	fig	fig	NOUN
ahs-3074	89	25	.	.	PUNCT
ahs-3074	89	26	4	4	NUM
ahs-3074	89	27	)	)	PUNCT
ahs-3074	89	28	,	,	PUNCT
ahs-3074	89	29	were	be	AUX
ahs-3074	89	30	collected	collect	VERB
ahs-3074	89	31	from	from	ADP
ahs-3074	89	32	the	the	DET
ahs-3074	89	33	ncc	ncc	NOUN
ahs-3074	89	34	in	in	ADP
ahs-3074	89	35	jalalabad	jalalabad	PROPN
ahs-3074	89	36	and	and	CCONJ
ahs-3074	89	37	belong	belong	VERB
ahs-3074	89	38	to	to	ADP
ahs-3074	89	39	six	six	NUM
ahs-3074	89	40	different	different	ADJ
ahs-3074	89	41	accessions	accession	NOUN
ahs-3074	89	42	:	:	PUNCT
ahs-3074	89	43	kumquat	kumquat	PROPN
ahs-3074	89	44	cv	cv	PROPN
ahs-3074	89	45	.	.	PROPN
ahs-3074	89	46	fig	fig	PROPN
ahs-3074	89	47	.	.	PUNCT
ahs-3074	90	1	2	2	NUM
ahs-3074	90	2	yellowing	yellowing	NOUN
ahs-3074	90	3	observed	observe	VERB
ahs-3074	90	4	in	in	ADP
ahs-3074	90	5	an	an	DET
ahs-3074	90	6	apricot	apricot	NOUN
ahs-3074	90	7	accession	accession	NOUN
ahs-3074	90	8	during	during	ADP
ahs-3074	90	9	sample	sample	NOUN
ahs-3074	90	10	collection	collection	NOUN
ahs-3074	90	11	in	in	ADP
ahs-3074	90	12	a	a	DET
ahs-3074	90	13	national	national	ADJ
ahs-3074	90	14	collection	collection	NOUN
ahs-3074	90	15	centre	centre	NOUN
ahs-3074	90	16	.	.	PUNCT
ahs-3074	91	1	rehman	rehman	NOUN
ahs-3074	91	2	et	et	PROPN
ahs-3074	91	3	al	al	PROPN
ahs-3074	91	4	.	.	PROPN
ahs-3074	91	5	phytosanitary	phytosanitary	PROPN
ahs-3074	91	6	status	status	NOUN
ahs-3074	91	7	of	of	ADP
ahs-3074	91	8	afghanistan	afghanistan	PROPN
ahs-3074	91	9	fruits	fruit	NOUN
ahs-3074	91	10	and	and	CCONJ
ahs-3074	91	11	nuts	nuts	ADJ
ahs-3074	91	12	collection	collection	NOUN
ahs-3074	91	13	.	.	PUNCT
ahs-3074	92	1	a	a	DET
ahs-3074	92	2	virus	virus	NOUN
ahs-3074	92	3	survay	survay	VERB
ahs-3074	92	4	243	243	NUM
ahs-3074	92	5	table	table	NOUN
ahs-3074	92	6	3	3	NUM
ahs-3074	92	7	apricot	apricot	PROPN
ahs-3074	92	8	samples	sample	NOUN
ahs-3074	92	9	tested	test	VERB
ahs-3074	92	10	and	and	CCONJ
ahs-3074	92	11	resulting	result	VERB
ahs-3074	92	12	positive	positive	ADJ
ahs-3074	92	13	by	by	ADP
ahs-3074	92	14	das	das	PROPN
ahs-3074	92	15	-	-	PUNCT
ahs-3074	92	16	elisa	elisa	NOUN
ahs-3074	92	17	during	during	ADP
ahs-3074	92	18	the	the	DET
ahs-3074	92	19	first	first	ADJ
ahs-3074	92	20	seven	seven	NUM
ahs-3074	92	21	years	year	NOUN
ahs-3074	92	22	of	of	ADP
ahs-3074	92	23	activity	activity	NOUN
ahs-3074	92	24	of	of	ADP
ahs-3074	92	25	the	the	DET
ahs-3074	92	26	plant	plant	NOUN
ahs-3074	92	27	biotechnology	biotechnology	NOUN
ahs-3074	92	28	laboratory	laboratory	NOUN
ahs-3074	92	29	based	base	VERB
ahs-3074	92	30	in	in	ADP
ahs-3074	92	31	kabul	kabul	PROPN
ahs-3074	92	32	virus	virus	NOUN
ahs-3074	92	33	region	region	NOUN
ahs-3074	92	34	2009	2009	NUM
ahs-3074	92	35	2010	2010	NUM
ahs-3074	92	36	2011	2011	NUM
ahs-3074	92	37	2012	2012	NUM
ahs-3074	92	38	2013	2013	NUM
ahs-3074	92	39	2014	2014	NUM
ahs-3074	92	40	2015	2015	NUM
ahs-3074	92	41	total	total	NOUN
ahs-3074	92	42	tested	test	VERB
ahs-3074	92	43	positive	positive	ADJ
ahs-3074	92	44	tested	test	VERB
ahs-3074	92	45	positive	positive	ADJ
ahs-3074	92	46	tested	test	VERB
ahs-3074	92	47	positive	positive	ADJ
ahs-3074	92	48	tested	test	VERB
ahs-3074	92	49	positive	positive	ADJ
ahs-3074	92	50	tested	test	VERB
ahs-3074	92	51	positive	positive	ADJ
ahs-3074	92	52	tested	test	VERB
ahs-3074	92	53	positive	positive	ADJ
ahs-3074	92	54	tested	test	VERB
ahs-3074	92	55	positive	positive	ADJ
ahs-3074	92	56	tested	test	VERB
ahs-3074	92	57	positive	positive	ADJ
ahs-3074	92	58	ppv	ppv	NOUN
ahs-3074	92	59	north	north	NOUN
ahs-3074	92	60	174	174	NUM
ahs-3074	92	61	0	0	NUM
ahs-3074	92	62	0	0	NUM
ahs-3074	92	63	0	0	NUM
ahs-3074	92	64	205	205	NUM
ahs-3074	92	65	0	0	NUM
ahs-3074	92	66	174	174	NUM
ahs-3074	92	67	0	0	NUM
ahs-3074	93	1	53	53	NUM
ahs-3074	93	2	0	0	NUM
ahs-3074	93	3	82	82	NUM
ahs-3074	93	4	0	0	NUM
ahs-3074	93	5	78	78	NUM
ahs-3074	93	6	0	0	NUM
ahs-3074	94	1	766	766	NUM
ahs-3074	94	2	0	0	NUM
ahs-3074	94	3	central	central	ADJ
ahs-3074	94	4	2	2	NUM
ahs-3074	94	5	0	0	NUM
ahs-3074	94	6	0	0	NUM
ahs-3074	94	7	0	0	NUM
ahs-3074	94	8	24	24	NUM
ahs-3074	94	9	0	0	NUM
ahs-3074	94	10	136	136	NUM
ahs-3074	94	11	0	0	NUM
ahs-3074	94	12	103	103	NUM
ahs-3074	94	13	0	0	NUM
ahs-3074	94	14	69	69	NUM
ahs-3074	94	15	0	0	NUM
ahs-3074	94	16	42	42	NUM
ahs-3074	94	17	0	0	NUM
ahs-3074	94	18	376	376	NUM
ahs-3074	94	19	0	0	NUM
ahs-3074	94	20	south	south	NOUN
ahs-3074	94	21	0	0	NUM
ahs-3074	94	22	0	0	NUM
ahs-3074	94	23	0	0	NUM
ahs-3074	94	24	0	0	NUM
ahs-3074	94	25	0	0	NUM
ahs-3074	94	26	0	0	NUM
ahs-3074	94	27	0	0	NUM
ahs-3074	94	28	0	0	NUM
ahs-3074	94	29	47	47	NUM
ahs-3074	94	30	0	0	NUM
ahs-3074	94	31	0	0	NUM
ahs-3074	94	32	0	0	NUM
ahs-3074	94	33	0	0	NUM
ahs-3074	94	34	0	0	NUM
ahs-3074	94	35	47	47	NUM
ahs-3074	94	36	0	0	NUM
ahs-3074	94	37	pdv	pdv	NOUN
ahs-3074	94	38	north	north	NOUN
ahs-3074	94	39	174	174	NUM
ahs-3074	94	40	0	0	NUM
ahs-3074	94	41	0	0	NUM
ahs-3074	94	42	0	0	NUM
ahs-3074	94	43	205	205	NUM
ahs-3074	94	44	0	0	NUM
ahs-3074	94	45	174	174	NUM
ahs-3074	94	46	0	0	NUM
ahs-3074	94	47	53	53	NUM
ahs-3074	94	48	0	0	NUM
ahs-3074	94	49	82	82	NUM
ahs-3074	94	50	0	0	NUM
ahs-3074	94	51	78	78	NUM
ahs-3074	94	52	0	0	NUM
ahs-3074	95	1	766	766	NUM
ahs-3074	95	2	0	0	NUM
ahs-3074	95	3	central	central	ADJ
ahs-3074	95	4	2	2	NUM
ahs-3074	95	5	0	0	NUM
ahs-3074	95	6	0	0	NUM
ahs-3074	95	7	0	0	NUM
ahs-3074	95	8	24	24	NUM
ahs-3074	95	9	0	0	NUM
ahs-3074	95	10	136	136	NUM
ahs-3074	95	11	0	0	NUM
ahs-3074	95	12	103	103	NUM
ahs-3074	95	13	0	0	NUM
ahs-3074	95	14	69	69	NUM
ahs-3074	95	15	0	0	NUM
ahs-3074	95	16	42	42	NUM
ahs-3074	95	17	0	0	NUM
ahs-3074	95	18	376	376	NUM
ahs-3074	95	19	0	0	NUM
ahs-3074	95	20	south	south	NOUN
ahs-3074	95	21	0	0	NUM
ahs-3074	95	22	0	0	NUM
ahs-3074	95	23	0	0	NUM
ahs-3074	95	24	0	0	NUM
ahs-3074	95	25	0	0	NUM
ahs-3074	95	26	0	0	NUM
ahs-3074	95	27	0	0	NUM
ahs-3074	95	28	0	0	NUM
ahs-3074	95	29	47	47	NUM
ahs-3074	95	30	0	0	NUM
ahs-3074	95	31	0	0	NUM
ahs-3074	95	32	0	0	NUM
ahs-3074	95	33	0	0	NUM
ahs-3074	95	34	0	0	NUM
ahs-3074	95	35	47	47	NUM
ahs-3074	95	36	0	0	NUM
ahs-3074	95	37	pnrsv	pnrsv	PROPN
ahs-3074	95	38	north	north	NOUN
ahs-3074	95	39	174	174	NUM
ahs-3074	95	40	6	6	NUM
ahs-3074	95	41	(	(	PUNCT
ahs-3074	95	42	balkh	balkh	NOUN
ahs-3074	95	43	)	)	PUNCT
ahs-3074	95	44	0	0	NUM
ahs-3074	95	45	0	0	NUM
ahs-3074	95	46	205	205	NUM
ahs-3074	95	47	5	5	NUM
ahs-3074	95	48	(	(	PUNCT
ahs-3074	95	49	balkh	balkh	NOUN
ahs-3074	95	50	)	)	PUNCT
ahs-3074	95	51	174	174	NUM
ahs-3074	95	52	0	0	NUM
ahs-3074	95	53	53	53	NUM
ahs-3074	95	54	0	0	NUM
ahs-3074	95	55	82	82	NUM
ahs-3074	95	56	0	0	NUM
ahs-3074	95	57	78	78	NUM
ahs-3074	95	58	0	0	NUM
ahs-3074	95	59	766	766	NUM
ahs-3074	95	60	11	11	NUM
ahs-3074	95	61	central	central	ADJ
ahs-3074	95	62	2	2	NUM
ahs-3074	95	63	1	1	NUM
ahs-3074	95	64	(	(	PUNCT
ahs-3074	95	65	herat	herat	NOUN
ahs-3074	95	66	)	)	PUNCT
ahs-3074	95	67	0	0	NUM
ahs-3074	95	68	0	0	NUM
ahs-3074	95	69	24	24	NUM
ahs-3074	95	70	0	0	NUM
ahs-3074	95	71	136	136	NUM
ahs-3074	95	72	0	0	NUM
ahs-3074	95	73	103	103	NUM
ahs-3074	95	74	0	0	NUM
ahs-3074	95	75	69	69	NUM
ahs-3074	95	76	0	0	NUM
ahs-3074	95	77	42	42	NUM
ahs-3074	95	78	1	1	NUM
ahs-3074	95	79	(	(	PUNCT
ahs-3074	95	80	herat	herat	NOUN
ahs-3074	95	81	)	)	PUNCT
ahs-3074	95	82	376	376	NUM
ahs-3074	95	83	2	2	NUM
ahs-3074	95	84	south	south	NOUN
ahs-3074	95	85	0	0	NUM
ahs-3074	95	86	0	0	NUM
ahs-3074	95	87	0	0	NUM
ahs-3074	95	88	0	0	NUM
ahs-3074	95	89	0	0	NUM
ahs-3074	95	90	0	0	NUM
ahs-3074	95	91	0	0	NUM
ahs-3074	95	92	0	0	NUM
ahs-3074	96	1	47	47	NUM
ahs-3074	96	2	0	0	NUM
ahs-3074	96	3	0	0	NUM
ahs-3074	96	4	0	0	NUM
ahs-3074	96	5	0	0	NUM
ahs-3074	96	6	0	0	NUM
ahs-3074	97	1	47	47	NUM
ahs-3074	97	2	0	0	NUM
ahs-3074	98	1	apmv	apmv	CCONJ
ahs-3074	98	2	north	north	NOUN
ahs-3074	98	3	174	174	NUM
ahs-3074	98	4	0	0	NUM
ahs-3074	98	5	0	0	NUM
ahs-3074	98	6	0	0	NUM
ahs-3074	98	7	205	205	NUM
ahs-3074	98	8	0	0	NUM
ahs-3074	98	9	174	174	NUM
ahs-3074	98	10	0	0	NUM
ahs-3074	99	1	53	53	NUM
ahs-3074	99	2	0	0	NUM
ahs-3074	99	3	82	82	NUM
ahs-3074	99	4	0	0	NUM
ahs-3074	99	5	78	78	NUM
ahs-3074	99	6	0	0	NUM
ahs-3074	100	1	766	766	NUM
ahs-3074	100	2	0	0	NUM
ahs-3074	100	3	central	central	ADJ
ahs-3074	100	4	2	2	NUM
ahs-3074	100	5	0	0	NUM
ahs-3074	100	6	0	0	NUM
ahs-3074	100	7	0	0	NUM
ahs-3074	100	8	24	24	NUM
ahs-3074	100	9	0	0	NUM
ahs-3074	100	10	136	136	NUM
ahs-3074	100	11	0	0	NUM
ahs-3074	100	12	103	103	NUM
ahs-3074	100	13	0	0	NUM
ahs-3074	100	14	69	69	NUM
ahs-3074	100	15	0	0	NUM
ahs-3074	100	16	42	42	NUM
ahs-3074	100	17	0	0	NUM
ahs-3074	100	18	376	376	NUM
ahs-3074	100	19	0	0	NUM
ahs-3074	100	20	south	south	NOUN
ahs-3074	100	21	0	0	NUM
ahs-3074	100	22	0	0	NUM
ahs-3074	100	23	0	0	NUM
ahs-3074	100	24	0	0	NUM
ahs-3074	100	25	0	0	NUM
ahs-3074	100	26	0	0	NUM
ahs-3074	100	27	0	0	NUM
ahs-3074	100	28	0	0	NUM
ahs-3074	100	29	47	47	NUM
ahs-3074	100	30	0	0	NUM
ahs-3074	100	31	0	0	NUM
ahs-3074	100	32	0	0	NUM
ahs-3074	100	33	0	0	NUM
ahs-3074	100	34	0	0	NUM
ahs-3074	100	35	47	47	NUM
ahs-3074	100	36	0	0	NUM
ahs-3074	100	37	aclsv	aclsv	VERB
ahs-3074	100	38	north	north	NOUN
ahs-3074	100	39	0	0	NUM
ahs-3074	100	40	0	0	NUM
ahs-3074	100	41	0	0	NUM
ahs-3074	100	42	0	0	NUM
ahs-3074	100	43	205	205	NUM
ahs-3074	100	44	0	0	NUM
ahs-3074	100	45	174	174	NUM
ahs-3074	100	46	0	0	NUM
ahs-3074	100	47	53	53	NUM
ahs-3074	100	48	0	0	NUM
ahs-3074	100	49	82	82	NUM
ahs-3074	100	50	0	0	NUM
ahs-3074	100	51	78	78	NUM
ahs-3074	100	52	0	0	NUM
ahs-3074	100	53	592	592	NUM
ahs-3074	100	54	0	0	NUM
ahs-3074	100	55	central	central	ADJ
ahs-3074	100	56	0	0	NUM
ahs-3074	100	57	0	0	NUM
ahs-3074	100	58	0	0	NUM
ahs-3074	100	59	0	0	NUM
ahs-3074	100	60	24	24	NUM
ahs-3074	100	61	0	0	NUM
ahs-3074	100	62	136	136	NUM
ahs-3074	100	63	0	0	NUM
ahs-3074	100	64	103	103	NUM
ahs-3074	100	65	0	0	NUM
ahs-3074	100	66	69	69	NUM
ahs-3074	100	67	0	0	NUM
ahs-3074	100	68	42	42	NUM
ahs-3074	100	69	1	1	NUM
ahs-3074	100	70	(	(	PUNCT
ahs-3074	100	71	herat	herat	NOUN
ahs-3074	100	72	)	)	PUNCT
ahs-3074	100	73	374	374	NUM
ahs-3074	100	74	1	1	NUM
ahs-3074	100	75	south	south	NOUN
ahs-3074	100	76	0	0	NUM
ahs-3074	100	77	0	0	NUM
ahs-3074	100	78	0	0	NUM
ahs-3074	100	79	0	0	NUM
ahs-3074	100	80	0	0	NUM
ahs-3074	100	81	0	0	NUM
ahs-3074	100	82	0	0	NUM
ahs-3074	100	83	0	0	NUM
ahs-3074	101	1	47	47	NUM
ahs-3074	101	2	0	0	NUM
ahs-3074	101	3	0	0	NUM
ahs-3074	101	4	0	0	NUM
ahs-3074	101	5	0	0	NUM
ahs-3074	101	6	0	0	NUM
ahs-3074	102	1	47	47	NUM
ahs-3074	102	2	0	0	NUM
ahs-3074	102	3	total	total	NOUN
ahs-3074	102	4	176	176	NUM
ahs-3074	102	5	7	7	NUM
ahs-3074	102	6	0	0	NUM
ahs-3074	102	7	0	0	NUM
ahs-3074	102	8	229	229	NUM
ahs-3074	102	9	5	5	NUM
ahs-3074	102	10	310	310	NUM
ahs-3074	102	11	0	0	NUM
ahs-3074	102	12	203	203	NUM
ahs-3074	102	13	0	0	NUM
ahs-3074	102	14	151	151	NUM
ahs-3074	102	15	0	0	NUM
ahs-3074	102	16	120	120	NUM
ahs-3074	102	17	2	2	NUM
ahs-3074	102	18	1189	1189	NUM
ahs-3074	102	19	14	14	NUM
ahs-3074	102	20	table	table	NOUN
ahs-3074	102	21	2	2	NUM
ahs-3074	102	22	almond	almond	NOUN
ahs-3074	102	23	samples	sample	NOUN
ahs-3074	102	24	tested	test	VERB
ahs-3074	102	25	and	and	CCONJ
ahs-3074	102	26	resulting	result	VERB
ahs-3074	102	27	positive	positive	ADJ
ahs-3074	102	28	by	by	ADP
ahs-3074	102	29	das	das	PROPN
ahs-3074	102	30	-	-	PUNCT
ahs-3074	102	31	elisa	elisa	NOUN
ahs-3074	102	32	during	during	ADP
ahs-3074	102	33	the	the	DET
ahs-3074	102	34	first	first	ADJ
ahs-3074	102	35	seven	seven	NUM
ahs-3074	102	36	years	year	NOUN
ahs-3074	102	37	of	of	ADP
ahs-3074	102	38	activity	activity	NOUN
ahs-3074	102	39	of	of	ADP
ahs-3074	102	40	the	the	DET
ahs-3074	102	41	plant	plant	NOUN
ahs-3074	102	42	biotechnology	biotechnology	NOUN
ahs-3074	102	43	laboratory	laboratory	NOUN
ahs-3074	102	44	based	base	VERB
ahs-3074	102	45	in	in	ADP
ahs-3074	102	46	kabul	kabul	PROPN
ahs-3074	102	47	northern	northern	ADJ
ahs-3074	102	48	regions	region	NOUN
ahs-3074	102	49	:	:	PUNCT
ahs-3074	102	50	badakhshan	badakhshan	PROPN
ahs-3074	102	51	,	,	PUNCT
ahs-3074	102	52	baghlan	baghlan	PROPN
ahs-3074	102	53	,	,	PUNCT
ahs-3074	102	54	balkh	balkh	PROPN
ahs-3074	102	55	,	,	PUNCT
ahs-3074	102	56	faryab	faryab	PROPN
ahs-3074	102	57	,	,	PUNCT
ahs-3074	102	58	jowzjan	jowzjan	PROPN
ahs-3074	102	59	,	,	PUNCT
ahs-3074	102	60	kunduz	kunduz	PROPN
ahs-3074	102	61	,	,	PUNCT
ahs-3074	102	62	samangan	samangan	ADJ
ahs-3074	102	63	,	,	PUNCT
ahs-3074	102	64	sar	sar	PROPN
ahs-3074	102	65	-	-	PUNCT
ahs-3074	102	66	e	e	NOUN
ahs-3074	102	67	pol	pol	NOUN
ahs-3074	102	68	and	and	CCONJ
ahs-3074	102	69	takhar	takhar	PROPN
ahs-3074	102	70	.	.	PUNCT
ahs-3074	103	1	central	central	ADJ
ahs-3074	103	2	regions	region	NOUN
ahs-3074	103	3	:	:	PUNCT
ahs-3074	103	4	badghis	badghis	NOUN
ahs-3074	103	5	,	,	PUNCT
ahs-3074	103	6	bamiyan	bamiyan	ADJ
ahs-3074	103	7	,	,	PUNCT
ahs-3074	103	8	farah	farah	PROPN
ahs-3074	103	9	,	,	PUNCT
ahs-3074	103	10	ghor	ghor	PROPN
ahs-3074	103	11	,	,	PUNCT
ahs-3074	103	12	herat	herat	PROPN
ahs-3074	103	13	,	,	PUNCT
ahs-3074	103	14	kabul	kabul	PROPN
ahs-3074	103	15	,	,	PUNCT
ahs-3074	103	16	kapisa	kapisa	NOUN
ahs-3074	103	17	,	,	PUNCT
ahs-3074	103	18	kunar	kunar	NOUN
ahs-3074	103	19	,	,	PUNCT
ahs-3074	103	20	laghman	laghman	PROPN
ahs-3074	103	21	,	,	PUNCT
ahs-3074	103	22	logar	logar	PROPN
ahs-3074	103	23	,	,	PUNCT
ahs-3074	103	24	nangarhar	nangarhar	PROPN
ahs-3074	103	25	,	,	PUNCT
ahs-3074	103	26	nurestan	nurestan	ADJ
ahs-3074	103	27	,	,	PUNCT
ahs-3074	103	28	panjshir	panjshir	NOUN
ahs-3074	103	29	,	,	PUNCT
ahs-3074	103	30	parwan	parwan	NOUN
ahs-3074	103	31	and	and	CCONJ
ahs-3074	103	32	wardak	wardak	NOUN
ahs-3074	103	33	.	.	PUNCT
ahs-3074	104	1	southern	southern	ADJ
ahs-3074	104	2	regions	region	NOUN
ahs-3074	104	3	:	:	PUNCT
ahs-3074	104	4	daykundi	daykundi	NOUN
ahs-3074	104	5	,	,	PUNCT
ahs-3074	104	6	ghazni	ghazni	NOUN
ahs-3074	104	7	,	,	PUNCT
ahs-3074	104	8	helmand	helmand	PROPN
ahs-3074	104	9	,	,	PUNCT
ahs-3074	104	10	kandahar	kandahar	PROPN
ahs-3074	104	11	,	,	PUNCT
ahs-3074	104	12	khost	khost	PROPN
ahs-3074	104	13	,	,	PUNCT
ahs-3074	104	14	nimruz	nimruz	PROPN
ahs-3074	104	15	,	,	PUNCT
ahs-3074	104	16	orūzgān	orūzgān	PROPN
ahs-3074	104	17	,	,	PUNCT
ahs-3074	104	18	paktia	paktia	NOUN
ahs-3074	104	19	,	,	PUNCT
ahs-3074	104	20	paktika	paktika	NOUN
ahs-3074	104	21	,	,	PUNCT
ahs-3074	104	22	zabul	zabul	PROPN
ahs-3074	104	23	.	.	PUNCT
ahs-3074	105	1	virus	virus	NOUN
ahs-3074	105	2	region	region	NOUN
ahs-3074	105	3	2009	2009	NUM
ahs-3074	105	4	2010	2010	NUM
ahs-3074	105	5	2011	2011	NUM
ahs-3074	105	6	2012	2012	NUM
ahs-3074	105	7	2013	2013	NUM
ahs-3074	105	8	2014	2014	NUM
ahs-3074	105	9	2015	2015	NUM
ahs-3074	105	10	total	total	NOUN
ahs-3074	105	11	tested	test	VERB
ahs-3074	105	12	positive	positive	ADJ
ahs-3074	105	13	tested	test	VERB
ahs-3074	105	14	positive	positive	ADJ
ahs-3074	105	15	tested	test	VERB
ahs-3074	105	16	positive	positive	ADJ
ahs-3074	105	17	tested	test	VERB
ahs-3074	105	18	positive	positive	ADJ
ahs-3074	105	19	tested	test	VERB
ahs-3074	105	20	positive	positive	ADJ
ahs-3074	105	21	tested	test	VERB
ahs-3074	105	22	positive	positive	ADJ
ahs-3074	105	23	tested	test	VERB
ahs-3074	105	24	positive	positive	ADJ
ahs-3074	105	25	tested	test	VERB
ahs-3074	105	26	positive	positive	ADJ
ahs-3074	105	27	ppv	ppv	NOUN
ahs-3074	105	28	north	north	NOUN
ahs-3074	105	29	0	0	NUM
ahs-3074	105	30	0	0	NUM
ahs-3074	105	31	0	0	NUM
ahs-3074	105	32	0	0	NUM
ahs-3074	105	33	0	0	NUM
ahs-3074	105	34	0	0	NUM
ahs-3074	105	35	68	68	NUM
ahs-3074	105	36	0	0	NUM
ahs-3074	105	37	0	0	NUM
ahs-3074	105	38	0	0	NUM
ahs-3074	105	39	40	40	NUM
ahs-3074	105	40	0	0	NUM
ahs-3074	105	41	80	80	NUM
ahs-3074	105	42	0	0	NUM
ahs-3074	105	43	188	188	NUM
ahs-3074	105	44	0	0	NUM
ahs-3074	105	45	central	central	ADJ
ahs-3074	105	46	278	278	NUM
ahs-3074	105	47	0	0	NUM
ahs-3074	105	48	833	833	NUM
ahs-3074	105	49	0	0	NUM
ahs-3074	105	50	0	0	NUM
ahs-3074	105	51	0	0	NUM
ahs-3074	105	52	221	221	NUM
ahs-3074	105	53	0	0	NUM
ahs-3074	105	54	141	141	NUM
ahs-3074	105	55	0	0	NUM
ahs-3074	105	56	69	69	NUM
ahs-3074	105	57	0	0	NUM
ahs-3074	105	58	48	48	NUM
ahs-3074	105	59	0	0	NUM
ahs-3074	105	60	1590	1590	NUM
ahs-3074	105	61	0	0	NUM
ahs-3074	106	1	south	south	NOUN
ahs-3074	106	2	0	0	NUM
ahs-3074	106	3	0	0	NUM
ahs-3074	106	4	0	0	NUM
ahs-3074	106	5	0	0	NUM
ahs-3074	106	6	0	0	NUM
ahs-3074	106	7	0	0	NUM
ahs-3074	106	8	0	0	NUM
ahs-3074	106	9	0	0	NUM
ahs-3074	106	10	29	29	NUM
ahs-3074	106	11	0	0	NUM
ahs-3074	106	12	0	0	NUM
ahs-3074	106	13	0	0	NUM
ahs-3074	106	14	0	0	NUM
ahs-3074	106	15	0	0	NUM
ahs-3074	106	16	29	29	NUM
ahs-3074	106	17	0	0	NUM
ahs-3074	106	18	pdv	pdv	X
ahs-3074	106	19	north	north	NOUN
ahs-3074	106	20	0	0	NUM
ahs-3074	106	21	0	0	NUM
ahs-3074	106	22	0	0	NUM
ahs-3074	106	23	0	0	NUM
ahs-3074	106	24	0	0	NUM
ahs-3074	106	25	0	0	NUM
ahs-3074	107	1	68	68	NUM
ahs-3074	107	2	0	0	NUM
ahs-3074	107	3	0	0	NUM
ahs-3074	107	4	0	0	NUM
ahs-3074	108	1	40	40	NUM
ahs-3074	108	2	0	0	NUM
ahs-3074	108	3	80	80	NUM
ahs-3074	108	4	0	0	NUM
ahs-3074	108	5	188	188	NUM
ahs-3074	108	6	0	0	NUM
ahs-3074	108	7	central	central	ADJ
ahs-3074	108	8	278	278	NUM
ahs-3074	108	9	0	0	NUM
ahs-3074	108	10	833	833	NUM
ahs-3074	108	11	0	0	NUM
ahs-3074	108	12	0	0	NUM
ahs-3074	108	13	0	0	NUM
ahs-3074	109	1	221	221	NUM
ahs-3074	109	2	0	0	NUM
ahs-3074	109	3	141	141	NUM
ahs-3074	109	4	0	0	NUM
ahs-3074	109	5	69	69	NUM
ahs-3074	109	6	0	0	NUM
ahs-3074	109	7	48	48	NUM
ahs-3074	109	8	0	0	NUM
ahs-3074	109	9	1590	1590	NUM
ahs-3074	109	10	0	0	NUM
ahs-3074	109	11	south	south	NOUN
ahs-3074	109	12	0	0	NUM
ahs-3074	109	13	0	0	NUM
ahs-3074	109	14	0	0	NUM
ahs-3074	109	15	0	0	NUM
ahs-3074	109	16	0	0	NUM
ahs-3074	109	17	0	0	NUM
ahs-3074	109	18	0	0	NUM
ahs-3074	109	19	0	0	NUM
ahs-3074	109	20	29	29	NUM
ahs-3074	109	21	0	0	NUM
ahs-3074	109	22	0	0	NUM
ahs-3074	109	23	0	0	NUM
ahs-3074	109	24	0	0	NUM
ahs-3074	109	25	0	0	NUM
ahs-3074	109	26	29	29	NUM
ahs-3074	109	27	0	0	NUM
ahs-3074	109	28	pnrsv	pnrsv	PROPN
ahs-3074	109	29	north	north	NOUN
ahs-3074	109	30	0	0	NUM
ahs-3074	109	31	0	0	NUM
ahs-3074	109	32	0	0	NUM
ahs-3074	109	33	0	0	NUM
ahs-3074	109	34	0	0	NUM
ahs-3074	109	35	0	0	NUM
ahs-3074	110	1	68	68	NUM
ahs-3074	110	2	0	0	NUM
ahs-3074	110	3	0	0	NUM
ahs-3074	110	4	0	0	NUM
ahs-3074	110	5	40	40	NUM
ahs-3074	110	6	0	0	NUM
ahs-3074	110	7	80	80	NUM
ahs-3074	110	8	0	0	NUM
ahs-3074	110	9	188	188	NUM
ahs-3074	110	10	0	0	NUM
ahs-3074	110	11	central	central	ADJ
ahs-3074	110	12	278	278	NUM
ahs-3074	110	13	0	0	NUM
ahs-3074	110	14	833	833	NUM
ahs-3074	110	15	0	0	NUM
ahs-3074	110	16	0	0	NUM
ahs-3074	110	17	0	0	NUM
ahs-3074	110	18	221	221	NUM
ahs-3074	110	19	0	0	NUM
ahs-3074	110	20	141	141	NUM
ahs-3074	110	21	0	0	NUM
ahs-3074	110	22	69	69	NUM
ahs-3074	110	23	0	0	NUM
ahs-3074	110	24	48	48	NUM
ahs-3074	110	25	0	0	NUM
ahs-3074	110	26	1590	1590	NUM
ahs-3074	110	27	0	0	NUM
ahs-3074	110	28	south	south	NOUN
ahs-3074	110	29	0	0	NUM
ahs-3074	110	30	0	0	NUM
ahs-3074	110	31	0	0	NUM
ahs-3074	110	32	0	0	NUM
ahs-3074	110	33	0	0	NUM
ahs-3074	110	34	0	0	NUM
ahs-3074	110	35	0	0	NUM
ahs-3074	110	36	0	0	NUM
ahs-3074	110	37	29	29	NUM
ahs-3074	110	38	0	0	NUM
ahs-3074	110	39	0	0	NUM
ahs-3074	110	40	0	0	NUM
ahs-3074	110	41	0	0	NUM
ahs-3074	110	42	0	0	NUM
ahs-3074	110	43	29	29	NUM
ahs-3074	110	44	0	0	NUM
ahs-3074	110	45	apmv	apmv	CCONJ
ahs-3074	110	46	north	north	NOUN
ahs-3074	110	47	0	0	NUM
ahs-3074	110	48	0	0	NUM
ahs-3074	110	49	0	0	NUM
ahs-3074	110	50	0	0	NUM
ahs-3074	110	51	0	0	NUM
ahs-3074	110	52	0	0	NUM
ahs-3074	110	53	68	68	NUM
ahs-3074	110	54	0	0	NUM
ahs-3074	110	55	0	0	NUM
ahs-3074	110	56	0	0	NUM
ahs-3074	111	1	40	40	NUM
ahs-3074	111	2	0	0	NUM
ahs-3074	111	3	80	80	NUM
ahs-3074	111	4	0	0	NUM
ahs-3074	111	5	188	188	NUM
ahs-3074	111	6	0	0	NUM
ahs-3074	111	7	central	central	ADJ
ahs-3074	111	8	278	278	NUM
ahs-3074	111	9	0	0	NUM
ahs-3074	111	10	833	833	NUM
ahs-3074	111	11	0	0	NUM
ahs-3074	111	12	0	0	NUM
ahs-3074	111	13	0	0	NUM
ahs-3074	112	1	221	221	NUM
ahs-3074	112	2	0	0	NUM
ahs-3074	112	3	141	141	NUM
ahs-3074	112	4	0	0	NUM
ahs-3074	112	5	69	69	NUM
ahs-3074	112	6	0	0	NUM
ahs-3074	112	7	48	48	NUM
ahs-3074	112	8	0	0	NUM
ahs-3074	112	9	1590	1590	NUM
ahs-3074	112	10	0	0	NUM
ahs-3074	112	11	south	south	NOUN
ahs-3074	112	12	0	0	NUM
ahs-3074	112	13	0	0	NUM
ahs-3074	112	14	0	0	NUM
ahs-3074	112	15	0	0	NUM
ahs-3074	112	16	0	0	NUM
ahs-3074	112	17	0	0	NUM
ahs-3074	112	18	0	0	NUM
ahs-3074	112	19	0	0	NUM
ahs-3074	112	20	29	29	NUM
ahs-3074	112	21	0	0	NUM
ahs-3074	112	22	0	0	NUM
ahs-3074	112	23	0	0	NUM
ahs-3074	112	24	0	0	NUM
ahs-3074	112	25	0	0	NUM
ahs-3074	112	26	29	29	NUM
ahs-3074	112	27	0	0	NUM
ahs-3074	112	28	aclsv	aclsv	NOUN
ahs-3074	112	29	north	north	NOUN
ahs-3074	112	30	0	0	NUM
ahs-3074	112	31	0	0	NUM
ahs-3074	112	32	0	0	NUM
ahs-3074	112	33	0	0	NUM
ahs-3074	112	34	0	0	NUM
ahs-3074	112	35	0	0	NUM
ahs-3074	112	36	68	68	NUM
ahs-3074	112	37	0	0	NUM
ahs-3074	112	38	0	0	NUM
ahs-3074	112	39	0	0	NUM
ahs-3074	112	40	40	40	NUM
ahs-3074	112	41	0	0	NUM
ahs-3074	112	42	80	80	NUM
ahs-3074	112	43	2	2	NUM
ahs-3074	112	44	(	(	PUNCT
ahs-3074	112	45	baghlan	baghlan	NOUN
ahs-3074	112	46	)	)	PUNCT
ahs-3074	112	47	188	188	NUM
ahs-3074	112	48	2	2	NUM
ahs-3074	112	49	central	central	NOUN
ahs-3074	112	50	0	0	NUM
ahs-3074	112	51	0	0	NUM
ahs-3074	112	52	0	0	NUM
ahs-3074	112	53	0	0	NUM
ahs-3074	112	54	318	318	NUM
ahs-3074	112	55	0	0	NUM
ahs-3074	112	56	221	221	NUM
ahs-3074	112	57	0	0	NUM
ahs-3074	112	58	141	141	NUM
ahs-3074	112	59	0	0	NUM
ahs-3074	112	60	69	69	NUM
ahs-3074	112	61	0	0	NUM
ahs-3074	112	62	48	48	NUM
ahs-3074	112	63	0	0	NUM
ahs-3074	112	64	797	797	NUM
ahs-3074	112	65	0	0	NUM
ahs-3074	112	66	south	south	NOUN
ahs-3074	112	67	0	0	NUM
ahs-3074	112	68	0	0	NUM
ahs-3074	112	69	0	0	NUM
ahs-3074	112	70	0	0	NUM
ahs-3074	112	71	0	0	NUM
ahs-3074	112	72	0	0	NUM
ahs-3074	112	73	0	0	NUM
ahs-3074	112	74	0	0	NUM
ahs-3074	112	75	29	29	NUM
ahs-3074	112	76	0	0	NUM
ahs-3074	112	77	0	0	NUM
ahs-3074	112	78	0	0	NUM
ahs-3074	112	79	0	0	NUM
ahs-3074	112	80	0	0	NUM
ahs-3074	112	81	29	29	NUM
ahs-3074	112	82	0	0	NUM
ahs-3074	112	83	total	total	NOUN
ahs-3074	112	84	278	278	NUM
ahs-3074	112	85	0	0	NUM
ahs-3074	112	86	833	833	NUM
ahs-3074	112	87	0	0	NUM
ahs-3074	112	88	318	318	NUM
ahs-3074	112	89	0	0	NUM
ahs-3074	112	90	289	289	NUM
ahs-3074	112	91	0	0	NUM
ahs-3074	112	92	170	170	NUM
ahs-3074	112	93	0	0	NUM
ahs-3074	112	94	109	109	NUM
ahs-3074	112	95	0	0	NUM
ahs-3074	112	96	128	128	NUM
ahs-3074	112	97	2	2	NUM
ahs-3074	112	98	2125	2125	NUM
ahs-3074	112	99	2	2	NUM
ahs-3074	112	100	see	see	VERB
ahs-3074	112	101	legend	legend	NOUN
ahs-3074	112	102	of	of	ADP
ahs-3074	112	103	table	table	NOUN
ahs-3074	112	104	2	2	NUM
ahs-3074	112	105	for	for	ADP
ahs-3074	112	106	provinces	province	NOUN
ahs-3074	112	107	included	include	VERB
ahs-3074	112	108	in	in	ADP
ahs-3074	112	109	northern	northern	ADJ
ahs-3074	112	110	,	,	PUNCT
ahs-3074	112	111	central	central	ADJ
ahs-3074	112	112	and	and	CCONJ
ahs-3074	112	113	southern	southern	ADJ
ahs-3074	112	114	regions	region	NOUN
ahs-3074	112	115	.	.	PUNCT
ahs-3074	113	1	table	table	NOUN
ahs-3074	113	2	4	4	NUM
ahs-3074	113	3	cherry	cherry	NOUN
ahs-3074	113	4	samples	sample	NOUN
ahs-3074	113	5	tested	test	VERB
ahs-3074	113	6	and	and	CCONJ
ahs-3074	113	7	resulting	result	VERB
ahs-3074	113	8	positive	positive	ADJ
ahs-3074	113	9	by	by	ADP
ahs-3074	113	10	das	das	PROPN
ahs-3074	113	11	-	-	PUNCT
ahs-3074	113	12	elisa	elisa	NOUN
ahs-3074	113	13	during	during	ADP
ahs-3074	113	14	the	the	DET
ahs-3074	113	15	first	first	ADJ
ahs-3074	113	16	seven	seven	NUM
ahs-3074	113	17	years	year	NOUN
ahs-3074	113	18	of	of	ADP
ahs-3074	113	19	activity	activity	NOUN
ahs-3074	113	20	of	of	ADP
ahs-3074	113	21	the	the	DET
ahs-3074	113	22	plant	plant	NOUN
ahs-3074	113	23	biotechnology	biotechnology	NOUN
ahs-3074	113	24	laboratory	laboratory	NOUN
ahs-3074	113	25	based	base	VERB
ahs-3074	113	26	in	in	ADP
ahs-3074	113	27	kabul	kabul	PROPN
ahs-3074	113	28	see	see	VERB
ahs-3074	113	29	legend	legend	NOUN
ahs-3074	113	30	of	of	ADP
ahs-3074	113	31	table	table	NOUN
ahs-3074	113	32	2	2	NUM
ahs-3074	113	33	for	for	ADP
ahs-3074	113	34	provinces	province	NOUN
ahs-3074	113	35	included	include	VERB
ahs-3074	113	36	in	in	ADP
ahs-3074	113	37	northern	northern	ADJ
ahs-3074	113	38	,	,	PUNCT
ahs-3074	113	39	central	central	ADJ
ahs-3074	113	40	and	and	CCONJ
ahs-3074	113	41	southern	southern	ADJ
ahs-3074	113	42	regions	region	NOUN
ahs-3074	113	43	.	.	PUNCT
ahs-3074	114	1	virus	virus	NOUN
ahs-3074	114	2	region	region	NOUN
ahs-3074	114	3	2009	2009	NUM
ahs-3074	114	4	2010	2010	NUM
ahs-3074	114	5	2011	2011	NUM
ahs-3074	114	6	2012	2012	NUM
ahs-3074	114	7	2013	2013	NUM
ahs-3074	114	8	2014	2014	NUM
ahs-3074	114	9	2015	2015	NUM
ahs-3074	114	10	total	total	NOUN
ahs-3074	114	11	tested	test	VERB
ahs-3074	114	12	positive	positive	ADJ
ahs-3074	114	13	tested	test	VERB
ahs-3074	114	14	positive	positive	ADJ
ahs-3074	114	15	tested	test	VERB
ahs-3074	114	16	positive	positive	ADJ
ahs-3074	114	17	tested	test	VERB
ahs-3074	114	18	positive	positive	ADJ
ahs-3074	114	19	tested	test	VERB
ahs-3074	114	20	positive	positive	ADJ
ahs-3074	114	21	tested	test	VERB
ahs-3074	114	22	positive	positive	ADJ
ahs-3074	114	23	tested	test	VERB
ahs-3074	114	24	positive	positive	ADJ
ahs-3074	114	25	tested	test	VERB
ahs-3074	114	26	positive	positive	ADJ
ahs-3074	114	27	ppv	ppv	NOUN
ahs-3074	114	28	north	north	NOUN
ahs-3074	114	29	0	0	NUM
ahs-3074	114	30	0	0	NUM
ahs-3074	114	31	0	0	NUM
ahs-3074	114	32	0	0	NUM
ahs-3074	114	33	0	0	NUM
ahs-3074	114	34	0	0	NUM
ahs-3074	114	35	7	7	NUM
ahs-3074	114	36	0	0	NUM
ahs-3074	114	37	0	0	NUM
ahs-3074	114	38	0	0	NUM
ahs-3074	114	39	0	0	NUM
ahs-3074	114	40	0	0	NUM
ahs-3074	114	41	0	0	NUM
ahs-3074	114	42	0	0	NUM
ahs-3074	114	43	7	7	NUM
ahs-3074	114	44	0	0	NUM
ahs-3074	114	45	central	central	ADJ
ahs-3074	114	46	0	0	NUM
ahs-3074	114	47	0	0	NUM
ahs-3074	114	48	0	0	NUM
ahs-3074	114	49	0	0	NUM
ahs-3074	114	50	0	0	NUM
ahs-3074	114	51	0	0	NUM
ahs-3074	114	52	1	1	NUM
ahs-3074	114	53	0	0	NUM
ahs-3074	114	54	93	93	NUM
ahs-3074	114	55	0	0	NUM
ahs-3074	114	56	58	58	NUM
ahs-3074	114	57	0	0	NUM
ahs-3074	114	58	35	35	NUM
ahs-3074	114	59	0	0	NUM
ahs-3074	114	60	187	187	NUM
ahs-3074	114	61	0	0	NUM
ahs-3074	114	62	south	south	NOUN
ahs-3074	114	63	0	0	NUM
ahs-3074	114	64	0	0	NUM
ahs-3074	114	65	0	0	NUM
ahs-3074	114	66	0	0	NUM
ahs-3074	114	67	0	0	NUM
ahs-3074	114	68	0	0	NUM
ahs-3074	114	69	0	0	NUM
ahs-3074	114	70	0	0	NUM
ahs-3074	114	71	18	18	NUM
ahs-3074	114	72	0	0	NUM
ahs-3074	114	73	0	0	NUM
ahs-3074	114	74	0	0	NUM
ahs-3074	114	75	0	0	NUM
ahs-3074	114	76	0	0	NUM
ahs-3074	114	77	18	18	NUM
ahs-3074	114	78	0	0	NUM
ahs-3074	114	79	pdv	pdv	NOUN
ahs-3074	114	80	north	north	NOUN
ahs-3074	114	81	0	0	NUM
ahs-3074	114	82	0	0	NUM
ahs-3074	114	83	0	0	NUM
ahs-3074	114	84	0	0	NUM
ahs-3074	114	85	0	0	NUM
ahs-3074	114	86	0	0	NUM
ahs-3074	114	87	7	7	NUM
ahs-3074	114	88	0	0	NUM
ahs-3074	114	89	0	0	NUM
ahs-3074	114	90	0	0	NUM
ahs-3074	114	91	0	0	NUM
ahs-3074	114	92	0	0	NUM
ahs-3074	114	93	0	0	NUM
ahs-3074	114	94	0	0	NUM
ahs-3074	114	95	7	7	NUM
ahs-3074	114	96	0	0	NUM
ahs-3074	114	97	central	central	ADJ
ahs-3074	114	98	0	0	NUM
ahs-3074	114	99	0	0	NUM
ahs-3074	114	100	0	0	NUM
ahs-3074	114	101	0	0	NUM
ahs-3074	114	102	0	0	NUM
ahs-3074	114	103	0	0	NUM
ahs-3074	114	104	1	1	NUM
ahs-3074	114	105	0	0	NUM
ahs-3074	114	106	93	93	NUM
ahs-3074	114	107	0	0	NUM
ahs-3074	114	108	58	58	NUM
ahs-3074	114	109	0	0	NUM
ahs-3074	114	110	35	35	NUM
ahs-3074	114	111	0	0	NUM
ahs-3074	114	112	187	187	NUM
ahs-3074	114	113	0	0	NUM
ahs-3074	114	114	south	south	NOUN
ahs-3074	114	115	0	0	NUM
ahs-3074	114	116	0	0	NUM
ahs-3074	114	117	0	0	NUM
ahs-3074	114	118	0	0	NUM
ahs-3074	114	119	0	0	NUM
ahs-3074	114	120	0	0	NUM
ahs-3074	114	121	0	0	NUM
ahs-3074	114	122	0	0	NUM
ahs-3074	114	123	18	18	NUM
ahs-3074	114	124	0	0	NUM
ahs-3074	114	125	0	0	NUM
ahs-3074	114	126	0	0	NUM
ahs-3074	114	127	0	0	NUM
ahs-3074	114	128	0	0	NUM
ahs-3074	114	129	18	18	NUM
ahs-3074	114	130	0	0	NUM
ahs-3074	114	131	pnrsv	pnrsv	PROPN
ahs-3074	114	132	north	north	NOUN
ahs-3074	114	133	0	0	NUM
ahs-3074	114	134	0	0	NUM
ahs-3074	114	135	0	0	NUM
ahs-3074	114	136	0	0	NUM
ahs-3074	114	137	0	0	NUM
ahs-3074	114	138	0	0	NUM
ahs-3074	114	139	7	7	NUM
ahs-3074	114	140	0	0	NUM
ahs-3074	114	141	0	0	NUM
ahs-3074	114	142	0	0	NUM
ahs-3074	114	143	0	0	NUM
ahs-3074	114	144	0	0	NUM
ahs-3074	114	145	0	0	NUM
ahs-3074	114	146	0	0	NUM
ahs-3074	114	147	7	7	NUM
ahs-3074	114	148	0	0	NUM
ahs-3074	114	149	central	central	ADJ
ahs-3074	114	150	0	0	NUM
ahs-3074	114	151	0	0	NUM
ahs-3074	114	152	0	0	NUM
ahs-3074	114	153	0	0	NUM
ahs-3074	114	154	0	0	NUM
ahs-3074	114	155	0	0	NUM
ahs-3074	114	156	1	1	NUM
ahs-3074	114	157	0	0	NUM
ahs-3074	114	158	93	93	NUM
ahs-3074	114	159	6	6	NUM
ahs-3074	114	160	(	(	PUNCT
ahs-3074	114	161	kabul	kabul	PROPN
ahs-3074	114	162	)	)	PUNCT
ahs-3074	114	163	58	58	NUM
ahs-3074	114	164	1	1	NUM
ahs-3074	114	165	(	(	PUNCT
ahs-3074	114	166	kabul	kabul	PROPN
ahs-3074	114	167	)	)	PUNCT
ahs-3074	114	168	35	35	NUM
ahs-3074	114	169	3	3	NUM
ahs-3074	114	170	(	(	PUNCT
ahs-3074	114	171	herat	herat	NOUN
ahs-3074	114	172	)	)	PUNCT
ahs-3074	114	173	187	187	NUM
ahs-3074	114	174	10	10	NUM
ahs-3074	114	175	south	south	NOUN
ahs-3074	114	176	0	0	NUM
ahs-3074	114	177	0	0	NUM
ahs-3074	114	178	0	0	NUM
ahs-3074	114	179	0	0	NUM
ahs-3074	114	180	0	0	NUM
ahs-3074	114	181	0	0	NUM
ahs-3074	114	182	0	0	NUM
ahs-3074	114	183	0	0	NUM
ahs-3074	114	184	18	18	NUM
ahs-3074	114	185	1	1	NUM
ahs-3074	114	186	(	(	PUNCT
ahs-3074	114	187	paktya	paktya	PROPN
ahs-3074	114	188	)	)	PUNCT
ahs-3074	114	189	0	0	NUM
ahs-3074	114	190	0	0	NUM
ahs-3074	114	191	0	0	NUM
ahs-3074	114	192	0	0	NUM
ahs-3074	114	193	18	18	NUM
ahs-3074	114	194	1	1	NUM
ahs-3074	114	195	apmv	apmv	ADV
ahs-3074	114	196	north	north	NOUN
ahs-3074	114	197	0	0	NUM
ahs-3074	114	198	0	0	NUM
ahs-3074	114	199	0	0	NUM
ahs-3074	114	200	0	0	NUM
ahs-3074	114	201	0	0	NUM
ahs-3074	114	202	0	0	NUM
ahs-3074	114	203	7	7	NUM
ahs-3074	114	204	0	0	NUM
ahs-3074	114	205	0	0	NUM
ahs-3074	114	206	0	0	NUM
ahs-3074	114	207	0	0	NUM
ahs-3074	114	208	0	0	NUM
ahs-3074	114	209	0	0	NUM
ahs-3074	114	210	0	0	NUM
ahs-3074	114	211	7	7	NUM
ahs-3074	114	212	0	0	NUM
ahs-3074	114	213	central	central	ADJ
ahs-3074	114	214	0	0	NUM
ahs-3074	114	215	0	0	NUM
ahs-3074	114	216	0	0	NUM
ahs-3074	114	217	0	0	NUM
ahs-3074	114	218	0	0	NUM
ahs-3074	114	219	0	0	NUM
ahs-3074	114	220	1	1	NUM
ahs-3074	114	221	0	0	NUM
ahs-3074	114	222	93	93	NUM
ahs-3074	114	223	0	0	NUM
ahs-3074	114	224	58	58	NUM
ahs-3074	114	225	0	0	NUM
ahs-3074	114	226	35	35	NUM
ahs-3074	114	227	0	0	NUM
ahs-3074	114	228	187	187	NUM
ahs-3074	114	229	0	0	NUM
ahs-3074	114	230	south	south	NOUN
ahs-3074	114	231	0	0	NUM
ahs-3074	114	232	0	0	NUM
ahs-3074	114	233	0	0	NUM
ahs-3074	114	234	0	0	NUM
ahs-3074	114	235	0	0	NUM
ahs-3074	114	236	0	0	NUM
ahs-3074	114	237	0	0	NUM
ahs-3074	114	238	0	0	NUM
ahs-3074	114	239	18	18	NUM
ahs-3074	114	240	0	0	NUM
ahs-3074	114	241	0	0	NUM
ahs-3074	114	242	0	0	NUM
ahs-3074	114	243	0	0	NUM
ahs-3074	114	244	0	0	NUM
ahs-3074	114	245	18	18	NUM
ahs-3074	114	246	0	0	NUM
ahs-3074	114	247	aclsv	aclsv	NOUN
ahs-3074	114	248	north	north	NOUN
ahs-3074	114	249	0	0	NUM
ahs-3074	114	250	0	0	NUM
ahs-3074	114	251	0	0	NUM
ahs-3074	114	252	0	0	NUM
ahs-3074	114	253	0	0	NUM
ahs-3074	114	254	0	0	NUM
ahs-3074	114	255	7	7	NUM
ahs-3074	114	256	0	0	NUM
ahs-3074	114	257	0	0	NUM
ahs-3074	114	258	0	0	NUM
ahs-3074	114	259	0	0	NUM
ahs-3074	114	260	0	0	NUM
ahs-3074	114	261	0	0	NUM
ahs-3074	114	262	0	0	NUM
ahs-3074	114	263	7	7	NUM
ahs-3074	114	264	0	0	NUM
ahs-3074	114	265	central	central	ADJ
ahs-3074	114	266	0	0	NUM
ahs-3074	114	267	0	0	NUM
ahs-3074	114	268	0	0	NUM
ahs-3074	114	269	0	0	NUM
ahs-3074	114	270	0	0	NUM
ahs-3074	114	271	0	0	NUM
ahs-3074	114	272	1	1	NUM
ahs-3074	114	273	0	0	NUM
ahs-3074	114	274	93	93	NUM
ahs-3074	114	275	0	0	NUM
ahs-3074	114	276	58	58	NUM
ahs-3074	114	277	0	0	NUM
ahs-3074	114	278	35	35	NUM
ahs-3074	114	279	0	0	NUM
ahs-3074	114	280	187	187	NUM
ahs-3074	114	281	0	0	NUM
ahs-3074	114	282	south	south	NOUN
ahs-3074	114	283	0	0	NUM
ahs-3074	114	284	0	0	NUM
ahs-3074	114	285	0	0	NUM
ahs-3074	114	286	0	0	NUM
ahs-3074	114	287	0	0	NUM
ahs-3074	114	288	0	0	NUM
ahs-3074	114	289	0	0	NUM
ahs-3074	114	290	0	0	NUM
ahs-3074	114	291	18	18	NUM
ahs-3074	114	292	0	0	NUM
ahs-3074	114	293	0	0	NUM
ahs-3074	114	294	0	0	NUM
ahs-3074	114	295	0	0	NUM
ahs-3074	114	296	0	0	NUM
ahs-3074	114	297	18	18	NUM
ahs-3074	114	298	0	0	NUM
ahs-3074	114	299	total	total	NOUN
ahs-3074	114	300	0	0	NUM
ahs-3074	114	301	0	0	NUM
ahs-3074	114	302	0	0	NUM
ahs-3074	114	303	0	0	NUM
ahs-3074	114	304	0	0	NUM
ahs-3074	114	305	0	0	NUM
ahs-3074	114	306	8	8	NUM
ahs-3074	114	307	0	0	NUM
ahs-3074	114	308	111	111	NUM
ahs-3074	115	1	7	7	NUM
ahs-3074	115	2	58	58	NUM
ahs-3074	115	3	1	1	NUM
ahs-3074	115	4	35	35	NUM
ahs-3074	115	5	3	3	NUM
ahs-3074	115	6	212	212	NUM
ahs-3074	115	7	11	11	NUM
ahs-3074	115	8	adv	adv	PROPN
ahs-3074	115	9	.	.	PUNCT
ahs-3074	115	10	hort	hort	PROPN
ahs-3074	115	11	.	.	PUNCT
ahs-3074	116	1	sci	sci	PROPN
ahs-3074	116	2	.	.	PROPN
ahs-3074	116	3	,	,	PUNCT
ahs-3074	116	4	2016	2016	NUM
ahs-3074	116	5	30(4	30(4	NUM
ahs-3074	116	6	):	):	PUNCT
ahs-3074	116	7	239	239	NUM
ahs-3074	116	8	-	-	SYM
ahs-3074	116	9	248	248	NUM
ahs-3074	116	10	244	244	NUM
ahs-3074	116	11	table	table	NOUN
ahs-3074	116	12	6	6	NUM
ahs-3074	116	13	plum	plum	NOUN
ahs-3074	116	14	samples	sample	NOUN
ahs-3074	116	15	tested	test	VERB
ahs-3074	116	16	and	and	CCONJ
ahs-3074	116	17	resulting	result	VERB
ahs-3074	116	18	positive	positive	ADJ
ahs-3074	116	19	by	by	ADP
ahs-3074	116	20	das	das	PROPN
ahs-3074	116	21	-	-	PUNCT
ahs-3074	116	22	elisa	elisa	NOUN
ahs-3074	116	23	during	during	ADP
ahs-3074	116	24	the	the	DET
ahs-3074	116	25	first	first	ADJ
ahs-3074	116	26	seven	seven	NUM
ahs-3074	116	27	years	year	NOUN
ahs-3074	116	28	of	of	ADP
ahs-3074	116	29	activity	activity	NOUN
ahs-3074	116	30	of	of	ADP
ahs-3074	116	31	the	the	DET
ahs-3074	116	32	plant	plant	NOUN
ahs-3074	116	33	biotechnology	biotechnology	NOUN
ahs-3074	116	34	laboratory	laboratory	NOUN
ahs-3074	116	35	based	base	VERB
ahs-3074	116	36	in	in	ADP
ahs-3074	116	37	kabul	kabul	PROPN
ahs-3074	116	38	see	see	VERB
ahs-3074	116	39	legend	legend	NOUN
ahs-3074	116	40	of	of	ADP
ahs-3074	116	41	table	table	NOUN
ahs-3074	116	42	2	2	NUM
ahs-3074	116	43	for	for	ADP
ahs-3074	116	44	provinces	province	NOUN
ahs-3074	116	45	included	include	VERB
ahs-3074	116	46	in	in	ADP
ahs-3074	116	47	northern	northern	ADJ
ahs-3074	116	48	,	,	PUNCT
ahs-3074	116	49	central	central	ADJ
ahs-3074	116	50	and	and	CCONJ
ahs-3074	116	51	southern	southern	ADJ
ahs-3074	116	52	regions	region	NOUN
ahs-3074	116	53	.	.	PUNCT
ahs-3074	117	1	virus	virus	NOUN
ahs-3074	117	2	region	region	NOUN
ahs-3074	117	3	2009	2009	NUM
ahs-3074	117	4	2010	2010	NUM
ahs-3074	117	5	2011	2011	NUM
ahs-3074	117	6	2012	2012	NUM
ahs-3074	117	7	2013	2013	NUM
ahs-3074	117	8	2014	2014	NUM
ahs-3074	117	9	2015	2015	NUM
ahs-3074	117	10	total	total	NOUN
ahs-3074	117	11	tested	test	VERB
ahs-3074	117	12	positive	positive	ADJ
ahs-3074	117	13	tested	test	VERB
ahs-3074	117	14	positive	positive	ADJ
ahs-3074	117	15	tested	test	VERB
ahs-3074	117	16	positive	positive	ADJ
ahs-3074	117	17	tested	test	VERB
ahs-3074	117	18	positive	positive	ADJ
ahs-3074	117	19	tested	test	VERB
ahs-3074	117	20	positive	positive	ADJ
ahs-3074	117	21	tested	test	VERB
ahs-3074	117	22	positive	positive	ADJ
ahs-3074	117	23	tested	test	VERB
ahs-3074	117	24	positive	positive	ADJ
ahs-3074	117	25	tested	test	VERB
ahs-3074	117	26	positive	positive	ADJ
ahs-3074	117	27	ppv	ppv	NOUN
ahs-3074	117	28	north	north	NOUN
ahs-3074	117	29	0	0	NUM
ahs-3074	117	30	0	0	NUM
ahs-3074	117	31	0	0	NUM
ahs-3074	117	32	0	0	NUM
ahs-3074	117	33	0	0	NUM
ahs-3074	117	34	0	0	NUM
ahs-3074	117	35	48	48	NUM
ahs-3074	117	36	0	0	NUM
ahs-3074	117	37	31	31	NUM
ahs-3074	117	38	0	0	NUM
ahs-3074	117	39	0	0	NUM
ahs-3074	117	40	0	0	NUM
ahs-3074	117	41	45	45	NUM
ahs-3074	117	42	0	0	NUM
ahs-3074	117	43	124	124	NUM
ahs-3074	117	44	0	0	NUM
ahs-3074	117	45	central	central	ADJ
ahs-3074	117	46	160	160	NUM
ahs-3074	117	47	0	0	NUM
ahs-3074	117	48	0	0	NUM
ahs-3074	117	49	0	0	NUM
ahs-3074	117	50	190	190	NUM
ahs-3074	117	51	0	0	NUM
ahs-3074	117	52	168	168	NUM
ahs-3074	117	53	0	0	NUM
ahs-3074	117	54	140	140	NUM
ahs-3074	117	55	0	0	NUM
ahs-3074	117	56	31	31	NUM
ahs-3074	117	57	0	0	NUM
ahs-3074	117	58	15	15	NUM
ahs-3074	117	59	0	0	NUM
ahs-3074	117	60	704	704	NUM
ahs-3074	117	61	0	0	NUM
ahs-3074	117	62	south	south	NOUN
ahs-3074	117	63	0	0	NUM
ahs-3074	117	64	0	0	NUM
ahs-3074	117	65	0	0	NUM
ahs-3074	117	66	0	0	NUM
ahs-3074	117	67	0	0	NUM
ahs-3074	117	68	0	0	NUM
ahs-3074	117	69	0	0	NUM
ahs-3074	117	70	0	0	NUM
ahs-3074	117	71	0	0	NUM
ahs-3074	117	72	0	0	NUM
ahs-3074	117	73	0	0	NUM
ahs-3074	117	74	0	0	NUM
ahs-3074	117	75	0	0	NUM
ahs-3074	117	76	0	0	NUM
ahs-3074	117	77	0	0	NUM
ahs-3074	117	78	0	0	NUM
ahs-3074	117	79	pdv	pdv	NOUN
ahs-3074	117	80	north	north	NOUN
ahs-3074	117	81	0	0	NUM
ahs-3074	117	82	0	0	NUM
ahs-3074	117	83	0	0	NUM
ahs-3074	117	84	0	0	NUM
ahs-3074	117	85	0	0	NUM
ahs-3074	117	86	0	0	NUM
ahs-3074	117	87	48	48	NUM
ahs-3074	117	88	0	0	NUM
ahs-3074	117	89	31	31	NUM
ahs-3074	117	90	0	0	NUM
ahs-3074	117	91	0	0	NUM
ahs-3074	117	92	0	0	NUM
ahs-3074	118	1	45	45	NUM
ahs-3074	118	2	0	0	NUM
ahs-3074	118	3	124	124	NUM
ahs-3074	118	4	0	0	NUM
ahs-3074	118	5	central	central	ADJ
ahs-3074	118	6	160	160	NUM
ahs-3074	118	7	0	0	NUM
ahs-3074	118	8	0	0	NUM
ahs-3074	118	9	0	0	NUM
ahs-3074	118	10	190	190	NUM
ahs-3074	118	11	0	0	NUM
ahs-3074	118	12	168	168	NUM
ahs-3074	118	13	0	0	NUM
ahs-3074	118	14	140	140	NUM
ahs-3074	118	15	0	0	NUM
ahs-3074	118	16	31	31	NUM
ahs-3074	118	17	0	0	NUM
ahs-3074	118	18	15	15	NUM
ahs-3074	118	19	0	0	NUM
ahs-3074	118	20	704	704	NUM
ahs-3074	118	21	0	0	NUM
ahs-3074	118	22	south	south	NOUN
ahs-3074	118	23	0	0	NUM
ahs-3074	118	24	0	0	NUM
ahs-3074	118	25	0	0	NUM
ahs-3074	118	26	0	0	NUM
ahs-3074	118	27	0	0	NUM
ahs-3074	118	28	0	0	NUM
ahs-3074	118	29	0	0	NUM
ahs-3074	118	30	0	0	NUM
ahs-3074	118	31	0	0	NUM
ahs-3074	118	32	0	0	NUM
ahs-3074	118	33	0	0	NUM
ahs-3074	118	34	0	0	NUM
ahs-3074	118	35	0	0	NUM
ahs-3074	118	36	0	0	NUM
ahs-3074	118	37	0	0	NUM
ahs-3074	118	38	0	0	NUM
ahs-3074	118	39	pnrsv	pnrsv	PROPN
ahs-3074	118	40	north	north	NOUN
ahs-3074	118	41	0	0	NUM
ahs-3074	118	42	0	0	NUM
ahs-3074	118	43	0	0	NUM
ahs-3074	118	44	0	0	NUM
ahs-3074	118	45	0	0	NUM
ahs-3074	118	46	0	0	NUM
ahs-3074	118	47	48	48	NUM
ahs-3074	118	48	0	0	NUM
ahs-3074	118	49	31	31	NUM
ahs-3074	118	50	0	0	NUM
ahs-3074	118	51	0	0	NUM
ahs-3074	118	52	0	0	NUM
ahs-3074	118	53	45	45	NUM
ahs-3074	118	54	0	0	NUM
ahs-3074	118	55	124	124	NUM
ahs-3074	118	56	0	0	NUM
ahs-3074	118	57	central	central	ADJ
ahs-3074	118	58	160	160	NUM
ahs-3074	118	59	5	5	NUM
ahs-3074	118	60	(	(	PUNCT
ahs-3074	118	61	herat	herat	NOUN
ahs-3074	118	62	)	)	PUNCT
ahs-3074	118	63	0	0	PUNCT
ahs-3074	118	64	0	0	NUM
ahs-3074	119	1	190	190	NUM
ahs-3074	119	2	0	0	NUM
ahs-3074	119	3	168	168	NUM
ahs-3074	119	4	0	0	NUM
ahs-3074	119	5	140	140	NUM
ahs-3074	119	6	0	0	NUM
ahs-3074	119	7	31	31	NUM
ahs-3074	119	8	0	0	NUM
ahs-3074	119	9	15	15	NUM
ahs-3074	119	10	0	0	NUM
ahs-3074	119	11	704	704	NUM
ahs-3074	119	12	5	5	NUM
ahs-3074	119	13	south	south	NOUN
ahs-3074	119	14	0	0	NUM
ahs-3074	119	15	0	0	NUM
ahs-3074	119	16	0	0	NUM
ahs-3074	119	17	0	0	NUM
ahs-3074	119	18	0	0	NUM
ahs-3074	119	19	0	0	NUM
ahs-3074	119	20	0	0	NUM
ahs-3074	119	21	0	0	NUM
ahs-3074	119	22	0	0	NUM
ahs-3074	119	23	0	0	NUM
ahs-3074	119	24	0	0	NUM
ahs-3074	119	25	0	0	NUM
ahs-3074	119	26	0	0	NUM
ahs-3074	119	27	0	0	NUM
ahs-3074	119	28	0	0	NUM
ahs-3074	119	29	1	1	NUM
ahs-3074	119	30	apmv	apmv	ADP
ahs-3074	119	31	north	north	NOUN
ahs-3074	119	32	0	0	NUM
ahs-3074	119	33	0	0	NUM
ahs-3074	119	34	0	0	NUM
ahs-3074	119	35	0	0	NUM
ahs-3074	119	36	0	0	NUM
ahs-3074	119	37	0	0	NUM
ahs-3074	119	38	48	48	NUM
ahs-3074	119	39	0	0	NUM
ahs-3074	119	40	31	31	NUM
ahs-3074	119	41	0	0	NUM
ahs-3074	119	42	0	0	NUM
ahs-3074	119	43	0	0	NUM
ahs-3074	120	1	45	45	NUM
ahs-3074	120	2	0	0	NUM
ahs-3074	120	3	124	124	NUM
ahs-3074	120	4	0	0	NUM
ahs-3074	120	5	central	central	ADJ
ahs-3074	120	6	160	160	NUM
ahs-3074	120	7	0	0	NUM
ahs-3074	120	8	0	0	NUM
ahs-3074	120	9	0	0	NUM
ahs-3074	120	10	190	190	NUM
ahs-3074	120	11	0	0	NUM
ahs-3074	120	12	168	168	NUM
ahs-3074	120	13	0	0	NUM
ahs-3074	120	14	140	140	NUM
ahs-3074	120	15	0	0	NUM
ahs-3074	120	16	31	31	NUM
ahs-3074	120	17	0	0	NUM
ahs-3074	120	18	15	15	NUM
ahs-3074	120	19	0	0	NUM
ahs-3074	120	20	704	704	NUM
ahs-3074	120	21	0	0	NUM
ahs-3074	120	22	south	south	NOUN
ahs-3074	120	23	0	0	NUM
ahs-3074	120	24	0	0	NUM
ahs-3074	120	25	0	0	NUM
ahs-3074	120	26	0	0	NUM
ahs-3074	120	27	0	0	NUM
ahs-3074	120	28	0	0	NUM
ahs-3074	120	29	0	0	NUM
ahs-3074	120	30	0	0	NUM
ahs-3074	120	31	0	0	NUM
ahs-3074	120	32	0	0	NUM
ahs-3074	120	33	0	0	NUM
ahs-3074	120	34	0	0	NUM
ahs-3074	120	35	0	0	NUM
ahs-3074	120	36	0	0	NUM
ahs-3074	120	37	0	0	NUM
ahs-3074	120	38	0	0	NUM
ahs-3074	120	39	aclsv	aclsv	NOUN
ahs-3074	120	40	north	north	NOUN
ahs-3074	120	41	0	0	NUM
ahs-3074	120	42	0	0	NUM
ahs-3074	120	43	0	0	NUM
ahs-3074	120	44	0	0	NUM
ahs-3074	120	45	0	0	NUM
ahs-3074	120	46	0	0	NUM
ahs-3074	120	47	48	48	NUM
ahs-3074	120	48	0	0	NUM
ahs-3074	120	49	31	31	NUM
ahs-3074	120	50	0	0	NUM
ahs-3074	120	51	0	0	NUM
ahs-3074	120	52	0	0	NUM
ahs-3074	120	53	45	45	NUM
ahs-3074	120	54	0	0	NUM
ahs-3074	120	55	124	124	NUM
ahs-3074	120	56	0	0	NUM
ahs-3074	120	57	central	central	ADJ
ahs-3074	120	58	0	0	NUM
ahs-3074	120	59	0	0	NUM
ahs-3074	120	60	0	0	NUM
ahs-3074	120	61	0	0	NUM
ahs-3074	120	62	190	190	NUM
ahs-3074	120	63	0	0	NUM
ahs-3074	120	64	168	168	NUM
ahs-3074	120	65	0	0	NUM
ahs-3074	120	66	140	140	NUM
ahs-3074	120	67	2	2	NUM
ahs-3074	120	68	(	(	PUNCT
ahs-3074	120	69	kabul	kabul	PROPN
ahs-3074	120	70	)	)	PUNCT
ahs-3074	120	71	31	31	NUM
ahs-3074	120	72	0	0	NUM
ahs-3074	120	73	15	15	NUM
ahs-3074	120	74	0	0	NUM
ahs-3074	120	75	544	544	NUM
ahs-3074	120	76	2	2	NUM
ahs-3074	120	77	south	south	NOUN
ahs-3074	120	78	0	0	NUM
ahs-3074	120	79	0	0	NUM
ahs-3074	120	80	0	0	NUM
ahs-3074	120	81	0	0	NUM
ahs-3074	120	82	0	0	NUM
ahs-3074	120	83	0	0	NUM
ahs-3074	120	84	0	0	NUM
ahs-3074	120	85	0	0	NUM
ahs-3074	120	86	33	33	NUM
ahs-3074	120	87	1	1	NUM
ahs-3074	120	88	(	(	PUNCT
ahs-3074	120	89	kandahar	kandahar	PROPN
ahs-3074	120	90	)	)	PUNCT
ahs-3074	120	91	0	0	NUM
ahs-3074	121	1	0	0	NUM
ahs-3074	121	2	0	0	NUM
ahs-3074	121	3	0	0	NUM
ahs-3074	121	4	33	33	NUM
ahs-3074	121	5	1	1	NUM
ahs-3074	121	6	total	total	NOUN
ahs-3074	121	7	160	160	NUM
ahs-3074	121	8	5	5	NUM
ahs-3074	121	9	0	0	NUM
ahs-3074	121	10	0	0	NUM
ahs-3074	121	11	190	190	NUM
ahs-3074	121	12	0	0	NUM
ahs-3074	121	13	216	216	NUM
ahs-3074	121	14	0	0	NUM
ahs-3074	121	15	204	204	NUM
ahs-3074	121	16	3	3	NUM
ahs-3074	121	17	31	31	NUM
ahs-3074	121	18	0	0	NUM
ahs-3074	121	19	60	60	NUM
ahs-3074	121	20	0	0	NUM
ahs-3074	121	21	861	861	NUM
ahs-3074	121	22	8	8	NUM
ahs-3074	121	23	fig	fig	NOUN
ahs-3074	121	24	.	.	PUNCT
ahs-3074	122	1	3	3	NUM
ahs-3074	122	2	distribution	distribution	NOUN
ahs-3074	122	3	,	,	PUNCT
ahs-3074	122	4	among	among	ADP
ahs-3074	122	5	afghan	afghan	ADJ
ahs-3074	122	6	provinces	province	NOUN
ahs-3074	122	7	,	,	PUNCT
ahs-3074	122	8	of	of	ADP
ahs-3074	122	9	samples	sample	NOUN
ahs-3074	122	10	resulting	result	VERB
ahs-3074	122	11	positive	positive	ADJ
ahs-3074	122	12	to	to	ADP
ahs-3074	122	13	aclsv	aclsv	VERB
ahs-3074	122	14	,	,	PUNCT
ahs-3074	122	15	apmv	apmv	ADV
ahs-3074	122	16	,	,	PUNCT
ahs-3074	122	17	ctv	ctv	PROPN
ahs-3074	122	18	,	,	PUNCT
ahs-3074	122	19	gflv	gflv	NOUN
ahs-3074	122	20	,	,	PUNCT
ahs-3074	122	21	glrav-1	glrav-1	PROPN
ahs-3074	122	22	,	,	PUNCT
ahs-3074	122	23	glrav-3	glrav-3	PROPN
ahs-3074	122	24	,	,	PUNCT
ahs-3074	122	25	gva	gva	PROPN
ahs-3074	122	26	,	,	PUNCT
ahs-3074	122	27	pdv	pdv	NOUN
ahs-3074	122	28	or	or	CCONJ
ahs-3074	122	29	pnrsv	pnrsv	PROPN
ahs-3074	122	30	.	.	PUNCT
ahs-3074	123	1	see	see	VERB
ahs-3074	123	2	legend	legend	NOUN
ahs-3074	123	3	of	of	ADP
ahs-3074	123	4	table	table	NOUN
ahs-3074	123	5	2	2	NUM
ahs-3074	123	6	for	for	ADP
ahs-3074	123	7	provinces	province	NOUN
ahs-3074	123	8	included	include	VERB
ahs-3074	123	9	in	in	ADP
ahs-3074	123	10	northern	northern	ADJ
ahs-3074	123	11	,	,	PUNCT
ahs-3074	123	12	central	central	ADJ
ahs-3074	123	13	and	and	CCONJ
ahs-3074	123	14	southern	southern	ADJ
ahs-3074	123	15	regions	region	NOUN
ahs-3074	123	16	.	.	PUNCT
ahs-3074	124	1	table	table	NOUN
ahs-3074	124	2	5	5	NUM
ahs-3074	124	3	peach	peach	NOUN
ahs-3074	124	4	samples	sample	NOUN
ahs-3074	124	5	tested	test	VERB
ahs-3074	124	6	and	and	CCONJ
ahs-3074	124	7	resulting	result	VERB
ahs-3074	124	8	positive	positive	ADJ
ahs-3074	124	9	by	by	ADP
ahs-3074	124	10	das	das	PROPN
ahs-3074	124	11	-	-	PUNCT
ahs-3074	124	12	elisa	elisa	NOUN
ahs-3074	124	13	during	during	ADP
ahs-3074	124	14	the	the	DET
ahs-3074	124	15	first	first	ADJ
ahs-3074	124	16	seven	seven	NUM
ahs-3074	124	17	years	year	NOUN
ahs-3074	124	18	of	of	ADP
ahs-3074	124	19	activity	activity	NOUN
ahs-3074	124	20	of	of	ADP
ahs-3074	124	21	the	the	DET
ahs-3074	124	22	plant	plant	NOUN
ahs-3074	124	23	biotechnology	biotechnology	NOUN
ahs-3074	124	24	laboratory	laboratory	NOUN
ahs-3074	124	25	based	base	VERB
ahs-3074	124	26	in	in	ADP
ahs-3074	124	27	kabul	kabul	PROPN
ahs-3074	124	28	virus	virus	NOUN
ahs-3074	124	29	region	region	NOUN
ahs-3074	124	30	2009	2009	NUM
ahs-3074	124	31	2010	2010	NUM
ahs-3074	124	32	2011	2011	NUM
ahs-3074	124	33	2012	2012	NUM
ahs-3074	124	34	2013	2013	NUM
ahs-3074	124	35	2014	2014	NUM
ahs-3074	124	36	2015	2015	NUM
ahs-3074	124	37	total	total	NOUN
ahs-3074	124	38	tested	test	VERB
ahs-3074	124	39	positive	positive	ADJ
ahs-3074	124	40	tested	test	VERB
ahs-3074	124	41	positive	positive	ADJ
ahs-3074	124	42	tested	test	VERB
ahs-3074	124	43	positive	positive	ADJ
ahs-3074	124	44	tested	test	VERB
ahs-3074	124	45	positive	positive	ADJ
ahs-3074	124	46	tested	test	VERB
ahs-3074	124	47	positive	positive	ADJ
ahs-3074	124	48	tested	test	VERB
ahs-3074	124	49	positive	positive	ADJ
ahs-3074	124	50	tested	test	VERB
ahs-3074	124	51	positive	positive	ADJ
ahs-3074	124	52	tested	test	VERB
ahs-3074	124	53	positive	positive	ADJ
ahs-3074	124	54	ppv	ppv	NOUN
ahs-3074	124	55	north	north	NOUN
ahs-3074	124	56	0	0	NUM
ahs-3074	124	57	0	0	NUM
ahs-3074	124	58	0	0	NUM
ahs-3074	124	59	0	0	NUM
ahs-3074	124	60	0	0	NUM
ahs-3074	124	61	0	0	NUM
ahs-3074	125	1	75	75	NUM
ahs-3074	125	2	0	0	NUM
ahs-3074	125	3	41	41	NUM
ahs-3074	125	4	0	0	NUM
ahs-3074	125	5	9	9	NUM
ahs-3074	125	6	0	0	NUM
ahs-3074	125	7	65	65	NUM
ahs-3074	125	8	0	0	NUM
ahs-3074	125	9	190	190	NUM
ahs-3074	125	10	0	0	NUM
ahs-3074	125	11	central	central	ADJ
ahs-3074	125	12	4	4	NUM
ahs-3074	125	13	0	0	NUM
ahs-3074	125	14	0	0	NUM
ahs-3074	125	15	0	0	NUM
ahs-3074	126	1	267	267	NUM
ahs-3074	126	2	0	0	NUM
ahs-3074	126	3	374	374	NUM
ahs-3074	126	4	0	0	NUM
ahs-3074	126	5	186	186	NUM
ahs-3074	126	6	0	0	NUM
ahs-3074	126	7	21	21	NUM
ahs-3074	126	8	0	0	NUM
ahs-3074	126	9	13	13	NUM
ahs-3074	126	10	0	0	NUM
ahs-3074	126	11	865	865	NUM
ahs-3074	126	12	0	0	NUM
ahs-3074	126	13	south	south	NOUN
ahs-3074	126	14	0	0	NUM
ahs-3074	126	15	0	0	NUM
ahs-3074	126	16	0	0	NUM
ahs-3074	126	17	0	0	NUM
ahs-3074	126	18	0	0	NUM
ahs-3074	126	19	0	0	NUM
ahs-3074	126	20	0	0	NUM
ahs-3074	126	21	0	0	NUM
ahs-3074	126	22	75	75	NUM
ahs-3074	126	23	0	0	NUM
ahs-3074	126	24	0	0	NUM
ahs-3074	126	25	0	0	NUM
ahs-3074	126	26	0	0	NUM
ahs-3074	126	27	0	0	NUM
ahs-3074	126	28	75	75	NUM
ahs-3074	126	29	0	0	NUM
ahs-3074	126	30	pdv	pdv	NOUN
ahs-3074	126	31	north	north	NOUN
ahs-3074	126	32	0	0	NUM
ahs-3074	126	33	0	0	NUM
ahs-3074	126	34	0	0	NUM
ahs-3074	126	35	0	0	NUM
ahs-3074	126	36	0	0	NUM
ahs-3074	126	37	0	0	NUM
ahs-3074	127	1	75	75	NUM
ahs-3074	127	2	0	0	NUM
ahs-3074	127	3	41	41	NUM
ahs-3074	127	4	0	0	NUM
ahs-3074	127	5	9	9	NUM
ahs-3074	127	6	0	0	NUM
ahs-3074	127	7	65	65	NUM
ahs-3074	127	8	0	0	NUM
ahs-3074	127	9	190	190	NUM
ahs-3074	127	10	0	0	NUM
ahs-3074	127	11	central	central	ADJ
ahs-3074	127	12	4	4	NUM
ahs-3074	127	13	0	0	NUM
ahs-3074	127	14	0	0	NUM
ahs-3074	127	15	0	0	NUM
ahs-3074	128	1	267	267	NUM
ahs-3074	128	2	0	0	NUM
ahs-3074	128	3	374	374	NUM
ahs-3074	128	4	0	0	NUM
ahs-3074	128	5	186	186	NUM
ahs-3074	128	6	0	0	NUM
ahs-3074	128	7	21	21	NUM
ahs-3074	128	8	0	0	NUM
ahs-3074	128	9	13	13	NUM
ahs-3074	128	10	0	0	NUM
ahs-3074	128	11	865	865	NUM
ahs-3074	128	12	0	0	NUM
ahs-3074	128	13	south	south	NOUN
ahs-3074	128	14	0	0	NUM
ahs-3074	128	15	0	0	NUM
ahs-3074	128	16	0	0	NUM
ahs-3074	128	17	0	0	NUM
ahs-3074	128	18	0	0	NUM
ahs-3074	128	19	0	0	NUM
ahs-3074	128	20	0	0	NUM
ahs-3074	128	21	0	0	NUM
ahs-3074	128	22	75	75	NUM
ahs-3074	128	23	0	0	NUM
ahs-3074	128	24	0	0	NUM
ahs-3074	128	25	0	0	NUM
ahs-3074	128	26	0	0	NUM
ahs-3074	128	27	0	0	NUM
ahs-3074	128	28	75	75	NUM
ahs-3074	128	29	0	0	NUM
ahs-3074	128	30	pnrsvnorth	pnrsvnorth	NOUN
ahs-3074	128	31	0	0	NUM
ahs-3074	128	32	0	0	NUM
ahs-3074	128	33	0	0	NUM
ahs-3074	128	34	0	0	NUM
ahs-3074	128	35	0	0	NUM
ahs-3074	128	36	0	0	NUM
ahs-3074	128	37	75	75	NUM
ahs-3074	128	38	0	0	NUM
ahs-3074	128	39	41	41	NUM
ahs-3074	128	40	0	0	NUM
ahs-3074	128	41	9	9	NUM
ahs-3074	128	42	0	0	NUM
ahs-3074	128	43	65	65	NUM
ahs-3074	128	44	0	0	NUM
ahs-3074	128	45	190	190	NUM
ahs-3074	128	46	0	0	NUM
ahs-3074	128	47	central	central	ADJ
ahs-3074	128	48	4	4	NUM
ahs-3074	128	49	0	0	NUM
ahs-3074	128	50	0	0	NUM
ahs-3074	128	51	0	0	NUM
ahs-3074	128	52	267	267	NUM
ahs-3074	128	53	0	0	NUM
ahs-3074	128	54	374	374	NUM
ahs-3074	128	55	7	7	NUM
ahs-3074	128	56	(	(	PUNCT
ahs-3074	128	57	herat	herat	NOUN
ahs-3074	128	58	)	)	PUNCT
ahs-3074	128	59	186	186	NUM
ahs-3074	128	60	1	1	NUM
ahs-3074	128	61	(	(	PUNCT
ahs-3074	128	62	kabul	kabul	PROPN
ahs-3074	128	63	)	)	PUNCT
ahs-3074	128	64	21	21	NUM
ahs-3074	128	65	0	0	NUM
ahs-3074	128	66	13	13	NUM
ahs-3074	128	67	0	0	NUM
ahs-3074	128	68	865	865	NUM
ahs-3074	128	69	8	8	NUM
ahs-3074	128	70	south	south	NOUN
ahs-3074	128	71	0	0	NUM
ahs-3074	128	72	0	0	NUM
ahs-3074	128	73	0	0	NUM
ahs-3074	128	74	0	0	NUM
ahs-3074	128	75	0	0	NUM
ahs-3074	128	76	0	0	NUM
ahs-3074	128	77	0	0	NUM
ahs-3074	128	78	0	0	NUM
ahs-3074	128	79	75	75	NUM
ahs-3074	128	80	1	1	NUM
ahs-3074	128	81	(	(	PUNCT
ahs-3074	128	82	kandahar	kandahar	PROPN
ahs-3074	128	83	)	)	PUNCT
ahs-3074	128	84	0	0	NUM
ahs-3074	128	85	0	0	NUM
ahs-3074	128	86	0	0	NUM
ahs-3074	128	87	0	0	NUM
ahs-3074	128	88	75	75	NUM
ahs-3074	128	89	1	1	NUM
ahs-3074	128	90	apmv	apmv	ADP
ahs-3074	128	91	north	north	NOUN
ahs-3074	128	92	0	0	NUM
ahs-3074	128	93	0	0	NUM
ahs-3074	128	94	0	0	NUM
ahs-3074	128	95	0	0	NUM
ahs-3074	128	96	0	0	NUM
ahs-3074	128	97	0	0	NUM
ahs-3074	128	98	75	75	NUM
ahs-3074	128	99	0	0	NUM
ahs-3074	128	100	41	41	NUM
ahs-3074	128	101	0	0	NUM
ahs-3074	128	102	9	9	NUM
ahs-3074	128	103	0	0	NUM
ahs-3074	128	104	65	65	NUM
ahs-3074	128	105	0	0	NUM
ahs-3074	128	106	190	190	NUM
ahs-3074	128	107	0	0	NUM
ahs-3074	128	108	central	central	ADJ
ahs-3074	128	109	4	4	NUM
ahs-3074	128	110	0	0	NUM
ahs-3074	128	111	0	0	NUM
ahs-3074	128	112	0	0	NUM
ahs-3074	129	1	267	267	NUM
ahs-3074	129	2	0	0	NUM
ahs-3074	129	3	374	374	NUM
ahs-3074	129	4	0	0	NUM
ahs-3074	129	5	186	186	NUM
ahs-3074	129	6	0	0	NUM
ahs-3074	129	7	21	21	NUM
ahs-3074	129	8	0	0	NUM
ahs-3074	129	9	13	13	NUM
ahs-3074	129	10	0	0	NUM
ahs-3074	129	11	865	865	NUM
ahs-3074	129	12	0	0	NUM
ahs-3074	129	13	south	south	NOUN
ahs-3074	129	14	0	0	NUM
ahs-3074	129	15	0	0	NUM
ahs-3074	129	16	0	0	NUM
ahs-3074	129	17	0	0	NUM
ahs-3074	129	18	0	0	NUM
ahs-3074	129	19	0	0	NUM
ahs-3074	129	20	0	0	NUM
ahs-3074	129	21	0	0	NUM
ahs-3074	129	22	75	75	NUM
ahs-3074	129	23	0	0	NUM
ahs-3074	129	24	0	0	NUM
ahs-3074	129	25	0	0	NUM
ahs-3074	129	26	0	0	NUM
ahs-3074	129	27	0	0	NUM
ahs-3074	129	28	75	75	NUM
ahs-3074	129	29	0	0	NUM
ahs-3074	129	30	aclsv	aclsv	NOUN
ahs-3074	129	31	north	north	NOUN
ahs-3074	129	32	0	0	NUM
ahs-3074	129	33	0	0	NUM
ahs-3074	129	34	0	0	NUM
ahs-3074	129	35	0	0	NUM
ahs-3074	129	36	0	0	NUM
ahs-3074	129	37	0	0	NUM
ahs-3074	129	38	75	75	NUM
ahs-3074	129	39	0	0	NUM
ahs-3074	129	40	41	41	NUM
ahs-3074	129	41	0	0	NUM
ahs-3074	129	42	9	9	NUM
ahs-3074	129	43	0	0	NUM
ahs-3074	129	44	65	65	NUM
ahs-3074	129	45	0	0	NUM
ahs-3074	129	46	190	190	NUM
ahs-3074	129	47	0	0	NUM
ahs-3074	129	48	central	central	ADJ
ahs-3074	129	49	0	0	NUM
ahs-3074	129	50	0	0	NUM
ahs-3074	129	51	0	0	NUM
ahs-3074	129	52	0	0	NUM
ahs-3074	130	1	267	267	NUM
ahs-3074	130	2	0	0	NUM
ahs-3074	130	3	374	374	NUM
ahs-3074	130	4	0	0	NUM
ahs-3074	130	5	186	186	NUM
ahs-3074	130	6	17	17	NUM
ahs-3074	130	7	(	(	PUNCT
ahs-3074	130	8	kabul	kabul	PROPN
ahs-3074	130	9	)	)	PUNCT
ahs-3074	130	10	21	21	NUM
ahs-3074	130	11	0	0	NUM
ahs-3074	130	12	13	13	NUM
ahs-3074	130	13	0	0	NUM
ahs-3074	130	14	861	861	NUM
ahs-3074	130	15	17	17	NUM
ahs-3074	130	16	south	south	NOUN
ahs-3074	130	17	0	0	NUM
ahs-3074	130	18	0	0	NUM
ahs-3074	130	19	0	0	NUM
ahs-3074	130	20	0	0	NUM
ahs-3074	130	21	0	0	NUM
ahs-3074	130	22	0	0	NUM
ahs-3074	130	23	0	0	NUM
ahs-3074	130	24	0	0	NUM
ahs-3074	130	25	75	75	NUM
ahs-3074	130	26	0	0	NUM
ahs-3074	130	27	0	0	NUM
ahs-3074	130	28	0	0	NUM
ahs-3074	130	29	0	0	NUM
ahs-3074	130	30	0	0	NUM
ahs-3074	131	1	75	75	NUM
ahs-3074	131	2	0	0	NUM
ahs-3074	131	3	total	total	NOUN
ahs-3074	131	4	4	4	NUM
ahs-3074	131	5	0	0	NUM
ahs-3074	131	6	0	0	NUM
ahs-3074	131	7	0	0	NUM
ahs-3074	131	8	267	267	NUM
ahs-3074	131	9	0	0	NUM
ahs-3074	131	10	449	449	NUM
ahs-3074	131	11	7	7	NUM
ahs-3074	131	12	302	302	NUM
ahs-3074	131	13	19	19	NUM
ahs-3074	131	14	30	30	NUM
ahs-3074	131	15	0	0	NUM
ahs-3074	131	16	78	78	NUM
ahs-3074	131	17	0	0	NUM
ahs-3074	131	18	1130	1130	NUM
ahs-3074	131	19	26	26	NUM
ahs-3074	131	20	rehman	rehman	NOUN
ahs-3074	131	21	et	et	PROPN
ahs-3074	131	22	al	al	PROPN
ahs-3074	131	23	.	.	PROPN
ahs-3074	131	24	phytosanitary	phytosanitary	PROPN
ahs-3074	131	25	status	status	NOUN
ahs-3074	131	26	of	of	ADP
ahs-3074	131	27	afghanistan	afghanistan	PROPN
ahs-3074	131	28	fruits	fruit	NOUN
ahs-3074	131	29	and	and	CCONJ
ahs-3074	131	30	nuts	nuts	ADJ
ahs-3074	131	31	collection	collection	NOUN
ahs-3074	131	32	.	.	PUNCT
ahs-3074	132	1	a	a	DET
ahs-3074	132	2	virus	virus	NOUN
ahs-3074	132	3	survay	survay	NOUN
ahs-3074	132	4	245	245	NUM
ahs-3074	132	5	margarita	margarita	NOUN
ahs-3074	132	6	(	(	PUNCT
ahs-3074	132	7	isolates	isolate	NOUN
ahs-3074	132	8	j4	j4	PROPN
ahs-3074	132	9	and	and	CCONJ
ahs-3074	132	10	j8	j8	NOUN
ahs-3074	132	11	)	)	PUNCT
ahs-3074	132	12	,	,	PUNCT
ahs-3074	132	13	orange	orange	PROPN
ahs-3074	132	14	cv	cv	PROPN
ahs-3074	132	15	.	.	PROPN
ahs-3074	132	16	mahali	mahali	PROPN
ahs-3074	132	17	(	(	PUNCT
ahs-3074	132	18	j61	j61	NOUN
ahs-3074	132	19	)	)	PUNCT
ahs-3074	132	20	,	,	PUNCT
ahs-3074	132	21	rough	rough	ADJ
ahs-3074	132	22	lemon	lemon	PROPN
ahs-3074	132	23	cv	cv	PROPN
ahs-3074	132	24	.	.	PROPN
ahs-3074	132	25	mahali	mahali	PROPN
ahs-3074	132	26	(	(	PUNCT
ahs-3074	132	27	j101	j101	PROPN
ahs-3074	132	28	)	)	PUNCT
ahs-3074	132	29	and	and	CCONJ
ahs-3074	132	30	mandarin	mandarin	PROPN
ahs-3074	132	31	group	group	NOUN
ahs-3074	132	32	cvs	cvs	PROPN
ahs-3074	132	33	.	.	PUNCT
ahs-3074	133	1	fruter	fruter	PROPN
ahs-3074	133	2	(	(	PUNCT
ahs-3074	133	3	j76	j76	PROPN
ahs-3074	133	4	)	)	PUNCT
ahs-3074	133	5	,	,	PUNCT
ahs-3074	133	6	tangelo	tangelo	NOUN
ahs-3074	133	7	mapo	mapo	PROPN
ahs-3074	133	8	and	and	CCONJ
ahs-3074	133	9	clementine	clementine	PROPN
ahs-3074	133	10	di	di	NOUN
ahs-3074	133	11	nules	nule	NOUN
ahs-3074	133	12	.	.	PUNCT
ahs-3074	134	1	the	the	DET
ahs-3074	134	2	other	other	ADJ
ahs-3074	134	3	312	312	NUM
ahs-3074	134	4	plants	plant	NOUN
ahs-3074	134	5	positive	positive	ADJ
ahs-3074	134	6	to	to	ADP
ahs-3074	134	7	ctv	ctv	PROPN
ahs-3074	134	8	were	be	AUX
ahs-3074	134	9	collected	collect	VERB
ahs-3074	134	10	from	from	ADP
ahs-3074	134	11	private	private	ADJ
ahs-3074	134	12	orchards	orchard	NOUN
ahs-3074	134	13	located	locate	VERB
ahs-3074	134	14	in	in	ADP
ahs-3074	134	15	the	the	DET
ahs-3074	134	16	provinces	province	NOUN
ahs-3074	134	17	of	of	ADP
ahs-3074	134	18	kunar	kunar	NOUN
ahs-3074	134	19	,	,	PUNCT
ahs-3074	134	20	laghman	laghman	PROPN
ahs-3074	134	21	,	,	PUNCT
ahs-3074	134	22	and	and	CCONJ
ahs-3074	134	23	nangarhar	nangarhar	PROPN
ahs-3074	134	24	(	(	PUNCT
ahs-3074	134	25	table	table	NOUN
ahs-3074	134	26	8	8	NUM
ahs-3074	134	27	,	,	PUNCT
ahs-3074	134	28	fig	fig	NOUN
ahs-3074	134	29	.	.	PUNCT
ahs-3074	135	1	3	3	NUM
ahs-3074	135	2	)	)	PUNCT
ahs-3074	135	3	.	.	PUNCT
ahs-3074	136	1	rt	rt	NOUN
ahs-3074	136	2	-	-	PUNCT
ahs-3074	136	3	pcr	pcr	ADJ
ahs-3074	136	4	and	and	CCONJ
ahs-3074	136	5	molecular	molecular	ADJ
ahs-3074	136	6	characterization	characterization	NOUN
ahs-3074	136	7	samples	sample	NOUN
ahs-3074	136	8	from	from	ADP
ahs-3074	136	9	stone	stone	NOUN
ahs-3074	136	10	fruit	fruit	NOUN
ahs-3074	136	11	plants	plant	NOUN
ahs-3074	136	12	which	which	PRON
ahs-3074	136	13	resulted	result	VERB
ahs-3074	136	14	infected	infect	VERB
ahs-3074	136	15	by	by	ADP
ahs-3074	136	16	aclsv	aclsv	NOUN
ahs-3074	136	17	,	,	PUNCT
ahs-3074	136	18	or	or	CCONJ
ahs-3074	136	19	pnrsv	pnrsv	PROPN
ahs-3074	136	20	following	follow	VERB
ahs-3074	136	21	das	das	PROPN
ahs-3074	136	22	-	-	PUNCT
ahs-3074	136	23	elisa	elisa	NOUN
ahs-3074	136	24	technique	technique	NOUN
ahs-3074	136	25	were	be	AUX
ahs-3074	136	26	analysed	analyse	VERB
ahs-3074	136	27	also	also	ADV
ahs-3074	136	28	by	by	ADP
ahs-3074	136	29	rt	rt	ADJ
ahs-3074	136	30	-	-	PUNCT
ahs-3074	136	31	pcr	pcr	NOUN
ahs-3074	136	32	reaction	reaction	NOUN
ahs-3074	136	33	.	.	PUNCT
ahs-3074	137	1	the	the	DET
ahs-3074	137	2	results	result	NOUN
ahs-3074	137	3	obtained	obtain	VERB
ahs-3074	137	4	confirmed	confirm	VERB
ahs-3074	137	5	the	the	DET
ahs-3074	137	6	presence	presence	NOUN
ahs-3074	137	7	of	of	ADP
ahs-3074	137	8	each	each	DET
ahs-3074	137	9	viral	viral	ADJ
ahs-3074	137	10	agent	agent	NOUN
ahs-3074	137	11	assayed	assayed	ADJ
ahs-3074	137	12	in	in	ADP
ahs-3074	137	13	the	the	DET
ahs-3074	137	14	samples	sample	NOUN
ahs-3074	137	15	tested	test	VERB
ahs-3074	137	16	.	.	PUNCT
ahs-3074	138	1	in	in	ADP
ahs-3074	138	2	particular	particular	ADJ
ahs-3074	138	3	,	,	PUNCT
ahs-3074	138	4	regarding	regard	VERB
ahs-3074	138	5	aclsv	aclsv	NOUN
ahs-3074	138	6	isolates	isolate	NOUN
ahs-3074	138	7	,	,	PUNCT
ahs-3074	138	8	a	a	DET
ahs-3074	138	9	677	677	NUM
ahs-3074	138	10	-	-	PUNCT
ahs-3074	138	11	long	long	ADJ
ahs-3074	138	12	nucleotide	nucleotide	NOUN
ahs-3074	138	13	fragment	fragment	NOUN
ahs-3074	138	14	,	,	PUNCT
ahs-3074	138	15	corresponding	correspond	VERB
ahs-3074	138	16	to	to	ADP
ahs-3074	138	17	partial	partial	ADJ
ahs-3074	138	18	coat	coat	NOUN
ahs-3074	138	19	protein	protein	NOUN
ahs-3074	138	20	gene	gene	NOUN
ahs-3074	138	21	,	,	PUNCT
ahs-3074	138	22	was	be	AUX
ahs-3074	138	23	amplified	amplify	VERB
ahs-3074	138	24	from	from	ADP
ahs-3074	138	25	all	all	DET
ahs-3074	138	26	elisa	elisa	NOUN
ahs-3074	138	27	-	-	ADJ
ahs-3074	138	28	positive	positive	ADJ
ahs-3074	138	29	samples	sample	NOUN
ahs-3074	138	30	by	by	ADP
ahs-3074	138	31	rt	rt	NOUN
ahs-3074	138	32	-	-	PUNCT
ahs-3074	138	33	pcr	pcr	PROPN
ahs-3074	138	34	using	use	VERB
ahs-3074	138	35	aclsv	aclsv	NOUN
ahs-3074	138	36	sense	sense	NOUN
ahs-3074	138	37	and	and	CCONJ
ahs-3074	138	38	antisense	antisense	NOUN
ahs-3074	138	39	primers	primer	NOUN
ahs-3074	138	40	(	(	PUNCT
ahs-3074	138	41	menzel	menzel	PROPN
ahs-3074	138	42	et	et	PROPN
ahs-3074	138	43	al	al	PROPN
ahs-3074	138	44	.	.	PROPN
ahs-3074	138	45	,	,	PUNCT
ahs-3074	138	46	2002	2002	NUM
ahs-3074	138	47	)	)	PUNCT
ahs-3074	138	48	.	.	PUNCT
ahs-3074	139	1	eleven	eleven	NUM
ahs-3074	139	2	of	of	ADP
ahs-3074	139	3	the	the	DET
ahs-3074	139	4	identified	identify	VERB
ahs-3074	139	5	isolates	isolate	NOUN
ahs-3074	139	6	of	of	ADP
ahs-3074	139	7	aclsv	aclsv	NOUN
ahs-3074	139	8	were	be	AUX
ahs-3074	139	9	then	then	ADV
ahs-3074	139	10	characterized	characterize	VERB
ahs-3074	139	11	molecularly	molecularly	ADV
ahs-3074	139	12	.	.	PUNCT
ahs-3074	140	1	sequence	sequence	NOUN
ahs-3074	140	2	analysis	analysis	NOUN
ahs-3074	140	3	revealed	reveal	VERB
ahs-3074	140	4	similarity	similarity	NOUN
ahs-3074	140	5	ranging	range	VERB
ahs-3074	140	6	from	from	ADP
ahs-3074	140	7	83.6	83.6	NUM
ahs-3074	140	8	to	to	PART
ahs-3074	140	9	100.0	100.0	NUM
ahs-3074	140	10	%	%	NOUN
ahs-3074	140	11	within	within	ADP
ahs-3074	140	12	aclsv	aclsv	NOUN
ahs-3074	140	13	isolates	isolate	NOUN
ahs-3074	140	14	detected	detect	VERB
ahs-3074	140	15	in	in	ADP
ahs-3074	140	16	afghanistan	afghanistan	PROPN
ahs-3074	140	17	.	.	PUNCT
ahs-3074	141	1	blast	blast	NOUN
ahs-3074	141	2	analysis	analysis	NOUN
ahs-3074	141	3	showed	show	VERB
ahs-3074	141	4	that	that	SCONJ
ahs-3074	141	5	sequences	sequence	NOUN
ahs-3074	141	6	of	of	ADP
ahs-3074	141	7	two	two	NUM
ahs-3074	141	8	peach	peach	NOUN
ahs-3074	141	9	isolates	isolate	NOUN
ahs-3074	141	10	,	,	PUNCT
ahs-3074	141	11	812	812	NUM
ahs-3074	141	12	/	/	SYM
ahs-3074	141	13	dir	dir	PROPN
ahs-3074	141	14	ras	ras	NOUN
ahs-3074	141	15	,	,	PUNCT
ahs-3074	141	16	shared	share	VERB
ahs-3074	141	17	the	the	DET
ahs-3074	141	18	highest	high	ADJ
ahs-3074	141	19	nucleotide	nucleotide	NOUN
ahs-3074	141	20	similarity	similarity	NOUN
ahs-3074	141	21	(	(	PUNCT
ahs-3074	141	22	95.8	95.8	NUM
ahs-3074	141	23	and	and	CCONJ
ahs-3074	141	24	96.2	96.2	NUM
ahs-3074	141	25	%	%	NOUN
ahs-3074	141	26	)	)	PUNCT
ahs-3074	141	27	with	with	ADP
ahs-3074	141	28	the	the	DET
ahs-3074	141	29	genbank	genbank	PROPN
ahs-3074	141	30	aclsv	aclsv	NOUN
ahs-3074	141	31	isolates	isolate	NOUN
ahs-3074	141	32	apr	apr	VERB
ahs-3074	141	33	3	3	NUM
ahs-3074	141	34	from	from	ADP
ahs-3074	141	35	jordan	jordan	PROPN
ahs-3074	141	36	(	(	PUNCT
ahs-3074	141	37	aj586631	aj586631	PROPN
ahs-3074	141	38	)	)	PUNCT
ahs-3074	141	39	.	.	PUNCT
ahs-3074	142	1	moreover	moreover	ADV
ahs-3074	142	2	,	,	PUNCT
ahs-3074	142	3	the	the	DET
ahs-3074	142	4	same	same	ADJ
ahs-3074	142	5	afghan	afghan	ADJ
ahs-3074	142	6	isolates	isolate	NOUN
ahs-3074	142	7	showed	show	VERB
ahs-3074	142	8	nucleotide	nucleotide	ADJ
ahs-3074	142	9	identity	identity	NOUN
ahs-3074	142	10	between	between	ADP
ahs-3074	142	11	95.0	95.0	NUM
ahs-3074	142	12	and	and	CCONJ
ahs-3074	142	13	95.7	95.7	NUM
ahs-3074	142	14	%	%	NOUN
ahs-3074	142	15	with	with	ADP
ahs-3074	142	16	isolates	isolate	NOUN
ahs-3074	142	17	s4	s4	PROPN
ahs-3074	142	18	,	,	PUNCT
ahs-3074	142	19	pp23	pp23	PROPN
ahs-3074	142	20	,	,	PUNCT
ahs-3074	142	21	pp63	pp63	PROPN
ahs-3074	142	22	,	,	PUNCT
ahs-3074	142	23	and	and	CCONJ
ahs-3074	142	24	hl2	hl2	NOUN
ahs-3074	142	25	(	(	PUNCT
ahs-3074	142	26	jn849008	jn849008	NOUN
ahs-3074	142	27	,	,	PUNCT
ahs-3074	142	28	gu327991	gu327991	PROPN
ahs-3074	142	29	,	,	PUNCT
ahs-3074	142	30	gu328003	gu328003	PROPN
ahs-3074	142	31	and	and	CCONJ
ahs-3074	142	32	gq334211	gq334211	PROPN
ahs-3074	142	33	,	,	PUNCT
ahs-3074	142	34	respectively	respectively	ADV
ahs-3074	142	35	)	)	PUNCT
ahs-3074	142	36	from	from	ADP
ahs-3074	142	37	china	china	PROPN
ahs-3074	142	38	.	.	PUNCT
ahs-3074	143	1	sequence	sequence	NOUN
ahs-3074	143	2	analysis	analysis	NOUN
ahs-3074	143	3	of	of	ADP
ahs-3074	143	4	isolate	isolate	ADJ
ahs-3074	143	5	364	364	NUM
ahs-3074	143	6	/	/	SYM
ahs-3074	143	7	alu	alu	NOUN
ahs-3074	143	8	table	table	NOUN
ahs-3074	143	9	7	7	NUM
ahs-3074	143	10	grape	grape	NOUN
ahs-3074	143	11	samples	sample	NOUN
ahs-3074	143	12	tested	test	VERB
ahs-3074	143	13	and	and	CCONJ
ahs-3074	143	14	resulting	result	VERB
ahs-3074	143	15	positive	positive	ADJ
ahs-3074	143	16	by	by	ADP
ahs-3074	143	17	das	das	PROPN
ahs-3074	143	18	-	-	PUNCT
ahs-3074	143	19	elisa	elisa	NOUN
ahs-3074	143	20	during	during	ADP
ahs-3074	143	21	the	the	DET
ahs-3074	143	22	first	first	ADJ
ahs-3074	143	23	seven	seven	NUM
ahs-3074	143	24	years	year	NOUN
ahs-3074	143	25	of	of	ADP
ahs-3074	143	26	activity	activity	NOUN
ahs-3074	143	27	of	of	ADP
ahs-3074	143	28	the	the	DET
ahs-3074	143	29	plant	plant	NOUN
ahs-3074	143	30	biotechnology	biotechnology	NOUN
ahs-3074	143	31	laboratory	laboratory	NOUN
ahs-3074	143	32	based	base	VERB
ahs-3074	143	33	in	in	ADP
ahs-3074	143	34	kabul	kabul	PROPN
ahs-3074	143	35	virus	virus	NOUN
ahs-3074	143	36	region	region	NOUN
ahs-3074	143	37	2009	2009	NUM
ahs-3074	143	38	2010	2010	NUM
ahs-3074	143	39	2011	2011	NUM
ahs-3074	143	40	2012	2012	NUM
ahs-3074	143	41	2013	2013	NUM
ahs-3074	143	42	2014	2014	NUM
ahs-3074	143	43	2015	2015	NUM
ahs-3074	143	44	total	total	NOUN
ahs-3074	143	45	tested	test	VERB
ahs-3074	143	46	positive	positive	ADJ
ahs-3074	143	47	tested	test	VERB
ahs-3074	143	48	positive	positive	ADJ
ahs-3074	143	49	tested	test	VERB
ahs-3074	143	50	positive	positive	ADJ
ahs-3074	143	51	tested	test	VERB
ahs-3074	143	52	positive	positive	ADJ
ahs-3074	143	53	tested	test	VERB
ahs-3074	143	54	positive	positive	ADJ
ahs-3074	143	55	tested	test	VERB
ahs-3074	143	56	positive	positive	ADJ
ahs-3074	143	57	tested	test	VERB
ahs-3074	143	58	positive	positive	ADJ
ahs-3074	143	59	tested	test	VERB
ahs-3074	143	60	positive	positive	ADJ
ahs-3074	143	61	gflv	gflv	NOUN
ahs-3074	143	62	herat	herat	NOUN
ahs-3074	143	63	0	0	NUM
ahs-3074	143	64	0	0	NUM
ahs-3074	143	65	0	0	NUM
ahs-3074	143	66	0	0	NUM
ahs-3074	143	67	156	156	NUM
ahs-3074	143	68	19	19	NUM
ahs-3074	143	69	117	117	NUM
ahs-3074	143	70	13	13	NUM
ahs-3074	143	71	271	271	NUM
ahs-3074	143	72	22	22	NUM
ahs-3074	143	73	0	0	NUM
ahs-3074	143	74	0	0	NUM
ahs-3074	143	75	0	0	NUM
ahs-3074	143	76	0	0	NUM
ahs-3074	143	77	544	544	NUM
ahs-3074	143	78	54	54	NUM
ahs-3074	143	79	kandahar	kandahar	NOUN
ahs-3074	143	80	0	0	NUM
ahs-3074	143	81	0	0	NUM
ahs-3074	143	82	0	0	NUM
ahs-3074	143	83	0	0	NUM
ahs-3074	143	84	0	0	NUM
ahs-3074	143	85	0	0	NUM
ahs-3074	143	86	0	0	NUM
ahs-3074	143	87	0	0	NUM
ahs-3074	143	88	268	268	NUM
ahs-3074	143	89	0	0	NUM
ahs-3074	143	90	0	0	NUM
ahs-3074	143	91	0	0	NUM
ahs-3074	143	92	0	0	NUM
ahs-3074	143	93	268	268	NUM
ahs-3074	143	94	0	0	NUM
ahs-3074	143	95	armv	armv	NOUN
ahs-3074	143	96	herat	herat	NOUN
ahs-3074	143	97	0	0	NUM
ahs-3074	143	98	0	0	NUM
ahs-3074	143	99	0	0	NUM
ahs-3074	143	100	0	0	NUM
ahs-3074	143	101	156	156	NUM
ahs-3074	143	102	0	0	NUM
ahs-3074	143	103	117	117	NUM
ahs-3074	143	104	0	0	NUM
ahs-3074	143	105	271	271	NUM
ahs-3074	143	106	0	0	NUM
ahs-3074	143	107	0	0	NUM
ahs-3074	143	108	0	0	NUM
ahs-3074	143	109	0	0	NUM
ahs-3074	143	110	0	0	NUM
ahs-3074	143	111	544	544	NUM
ahs-3074	143	112	0	0	NUM
ahs-3074	143	113	kandahar	kandahar	PROPN
ahs-3074	143	114	0	0	NUM
ahs-3074	143	115	0	0	NUM
ahs-3074	143	116	0	0	NUM
ahs-3074	143	117	0	0	NUM
ahs-3074	143	118	0	0	NUM
ahs-3074	143	119	0	0	NUM
ahs-3074	143	120	0	0	NUM
ahs-3074	143	121	0	0	NUM
ahs-3074	143	122	0	0	NUM
ahs-3074	143	123	0	0	NUM
ahs-3074	143	124	0	0	NUM
ahs-3074	143	125	0	0	NUM
ahs-3074	143	126	0	0	NUM
ahs-3074	143	127	0	0	NUM
ahs-3074	143	128	0	0	NUM
ahs-3074	143	129	0	0	NUM
ahs-3074	143	130	gva	gva	PROPN
ahs-3074	143	131	herat	herat	NOUN
ahs-3074	143	132	83	83	NUM
ahs-3074	143	133	0	0	NUM
ahs-3074	143	134	0	0	NUM
ahs-3074	143	135	0	0	NUM
ahs-3074	143	136	156	156	NUM
ahs-3074	143	137	0	0	NUM
ahs-3074	143	138	117	117	NUM
ahs-3074	143	139	0	0	NUM
ahs-3074	143	140	271	271	NUM
ahs-3074	143	141	0	0	NUM
ahs-3074	143	142	0	0	NUM
ahs-3074	143	143	0	0	NUM
ahs-3074	143	144	0	0	NUM
ahs-3074	143	145	0	0	NUM
ahs-3074	143	146	627	627	NUM
ahs-3074	143	147	0	0	NUM
ahs-3074	143	148	kandahar	kandahar	PROPN
ahs-3074	143	149	0	0	NUM
ahs-3074	143	150	0	0	NUM
ahs-3074	143	151	0	0	NUM
ahs-3074	143	152	0	0	NUM
ahs-3074	143	153	0	0	NUM
ahs-3074	143	154	0	0	NUM
ahs-3074	143	155	0	0	NUM
ahs-3074	143	156	0	0	NUM
ahs-3074	143	157	0	0	NUM
ahs-3074	143	158	1	1	NUM
ahs-3074	143	159	0	0	NUM
ahs-3074	143	160	0	0	NUM
ahs-3074	143	161	0	0	NUM
ahs-3074	143	162	0	0	NUM
ahs-3074	143	163	0	0	NUM
ahs-3074	143	164	1	1	NUM
ahs-3074	143	165	gfkv	gfkv	ADJ
ahs-3074	143	166	herat	herat	NOUN
ahs-3074	143	167	83	83	NUM
ahs-3074	143	168	0	0	NUM
ahs-3074	143	169	0	0	NUM
ahs-3074	143	170	0	0	NUM
ahs-3074	143	171	156	156	NUM
ahs-3074	143	172	0	0	NUM
ahs-3074	143	173	117	117	NUM
ahs-3074	143	174	0	0	NUM
ahs-3074	143	175	271	271	NUM
ahs-3074	143	176	0	0	NUM
ahs-3074	143	177	0	0	NUM
ahs-3074	143	178	0	0	NUM
ahs-3074	143	179	0	0	NUM
ahs-3074	143	180	0	0	NUM
ahs-3074	143	181	627	627	NUM
ahs-3074	143	182	0	0	NUM
ahs-3074	143	183	kandahar	kandahar	PROPN
ahs-3074	143	184	0	0	NUM
ahs-3074	143	185	0	0	NUM
ahs-3074	143	186	0	0	NUM
ahs-3074	143	187	0	0	NUM
ahs-3074	143	188	0	0	NUM
ahs-3074	143	189	0	0	NUM
ahs-3074	143	190	0	0	NUM
ahs-3074	143	191	0	0	NUM
ahs-3074	143	192	0	0	NUM
ahs-3074	143	193	0	0	NUM
ahs-3074	143	194	0	0	NUM
ahs-3074	143	195	0	0	NUM
ahs-3074	143	196	0	0	NUM
ahs-3074	143	197	0	0	NUM
ahs-3074	143	198	0	0	NUM
ahs-3074	143	199	0	0	NUM
ahs-3074	143	200	glrav-1	glrav-1	PROPN
ahs-3074	143	201	herat	herat	NOUN
ahs-3074	143	202	83	83	NUM
ahs-3074	143	203	0	0	NUM
ahs-3074	143	204	0	0	NUM
ahs-3074	143	205	0	0	NUM
ahs-3074	144	1	156	156	NUM
ahs-3074	144	2	0	0	NUM
ahs-3074	144	3	117	117	NUM
ahs-3074	144	4	1	1	NUM
ahs-3074	144	5	271	271	NUM
ahs-3074	144	6	0	0	NUM
ahs-3074	144	7	0	0	NUM
ahs-3074	144	8	0	0	NUM
ahs-3074	144	9	0	0	NUM
ahs-3074	144	10	0	0	NUM
ahs-3074	144	11	627	627	NUM
ahs-3074	144	12	1	1	NUM
ahs-3074	144	13	kandahar	kandahar	NOUN
ahs-3074	144	14	0	0	NUM
ahs-3074	144	15	0	0	NUM
ahs-3074	144	16	0	0	NUM
ahs-3074	144	17	0	0	NUM
ahs-3074	144	18	0	0	NUM
ahs-3074	144	19	0	0	NUM
ahs-3074	144	20	0	0	NUM
ahs-3074	144	21	0	0	NUM
ahs-3074	144	22	0	0	NUM
ahs-3074	144	23	0	0	NUM
ahs-3074	144	24	0	0	NUM
ahs-3074	144	25	0	0	NUM
ahs-3074	144	26	0	0	NUM
ahs-3074	144	27	0	0	NUM
ahs-3074	144	28	0	0	NUM
ahs-3074	144	29	0	0	NUM
ahs-3074	144	30	glrav-2	glrav-2	NUM
ahs-3074	144	31	herat	herat	NOUN
ahs-3074	144	32	83	83	NUM
ahs-3074	144	33	0	0	NUM
ahs-3074	144	34	0	0	NUM
ahs-3074	144	35	0	0	NUM
ahs-3074	144	36	156	156	NUM
ahs-3074	144	37	0	0	NUM
ahs-3074	144	38	117	117	NUM
ahs-3074	144	39	0	0	NUM
ahs-3074	144	40	271	271	NUM
ahs-3074	144	41	0	0	NUM
ahs-3074	144	42	0	0	NUM
ahs-3074	144	43	0	0	NUM
ahs-3074	144	44	0	0	NUM
ahs-3074	144	45	0	0	NUM
ahs-3074	144	46	627	627	NUM
ahs-3074	144	47	0	0	NUM
ahs-3074	144	48	kandahar	kandahar	PROPN
ahs-3074	144	49	0	0	NUM
ahs-3074	144	50	0	0	NUM
ahs-3074	144	51	0	0	NUM
ahs-3074	144	52	0	0	NUM
ahs-3074	144	53	0	0	NUM
ahs-3074	144	54	0	0	NUM
ahs-3074	144	55	0	0	NUM
ahs-3074	144	56	0	0	NUM
ahs-3074	144	57	0	0	NUM
ahs-3074	144	58	0	0	NUM
ahs-3074	144	59	0	0	NUM
ahs-3074	144	60	0	0	NUM
ahs-3074	144	61	0	0	NUM
ahs-3074	144	62	0	0	NUM
ahs-3074	144	63	0	0	NUM
ahs-3074	144	64	0	0	NUM
ahs-3074	144	65	glrav-3	glrav-3	NOUN
ahs-3074	144	66	herat	herat	NOUN
ahs-3074	144	67	83	83	NUM
ahs-3074	144	68	0	0	NUM
ahs-3074	144	69	0	0	NUM
ahs-3074	144	70	0	0	NUM
ahs-3074	144	71	156	156	NUM
ahs-3074	144	72	0	0	NUM
ahs-3074	144	73	117	117	NUM
ahs-3074	144	74	2	2	NUM
ahs-3074	144	75	271	271	NUM
ahs-3074	144	76	0	0	NUM
ahs-3074	144	77	0	0	NUM
ahs-3074	144	78	0	0	NUM
ahs-3074	144	79	0	0	NUM
ahs-3074	144	80	0	0	NUM
ahs-3074	144	81	627	627	NUM
ahs-3074	144	82	2	2	NUM
ahs-3074	144	83	kandahar	kandahar	NOUN
ahs-3074	144	84	0	0	NUM
ahs-3074	144	85	0	0	NUM
ahs-3074	144	86	0	0	NUM
ahs-3074	144	87	0	0	NUM
ahs-3074	144	88	0	0	NUM
ahs-3074	144	89	0	0	NUM
ahs-3074	144	90	0	0	NUM
ahs-3074	144	91	0	0	NUM
ahs-3074	144	92	0	0	NUM
ahs-3074	144	93	0	0	NUM
ahs-3074	144	94	0	0	NUM
ahs-3074	144	95	0	0	NUM
ahs-3074	144	96	0	0	NUM
ahs-3074	144	97	0	0	NUM
ahs-3074	144	98	0	0	NUM
ahs-3074	144	99	0	0	NUM
ahs-3074	144	100	total	total	NOUN
ahs-3074	144	101	83	83	NUM
ahs-3074	144	102	0	0	NUM
ahs-3074	144	103	0	0	NUM
ahs-3074	144	104	0	0	NUM
ahs-3074	144	105	156	156	NUM
ahs-3074	144	106	19	19	NUM
ahs-3074	144	107	117	117	NUM
ahs-3074	144	108	16	16	NUM
ahs-3074	144	109	539	539	NUM
ahs-3074	144	110	23	23	NUM
ahs-3074	144	111	0	0	NUM
ahs-3074	144	112	0	0	NUM
ahs-3074	144	113	0	0	NUM
ahs-3074	144	114	0	0	NUM
ahs-3074	144	115	895	895	NUM
ahs-3074	144	116	58	58	NUM
ahs-3074	144	117	fig	fig	NOUN
ahs-3074	144	118	.	.	PUNCT
ahs-3074	144	119	4	4	NUM
ahs-3074	144	120	vein	vein	ADJ
ahs-3074	144	121	clearing	clearing	NOUN
ahs-3074	144	122	and	and	CCONJ
ahs-3074	144	123	yellowing	yellowing	NOUN
ahs-3074	144	124	symptoms	symptom	NOUN
ahs-3074	144	125	observed	observe	VERB
ahs-3074	144	126	in	in	ADP
ahs-3074	144	127	citrus	citrus	NOUN
ahs-3074	144	128	accessions	accession	NOUN
ahs-3074	144	129	collected	collect	VERB
ahs-3074	144	130	from	from	ADP
ahs-3074	144	131	the	the	DET
ahs-3074	144	132	national	national	ADJ
ahs-3074	144	133	collection	collection	NOUN
ahs-3074	144	134	centre	centre	NOUN
ahs-3074	144	135	in	in	ADP
ahs-3074	144	136	jalalabad	jalalabad	PROPN
ahs-3074	144	137	(	(	PUNCT
ahs-3074	144	138	nangarhar	nangarhar	PROPN
ahs-3074	144	139	province	province	PROPN
ahs-3074	144	140	)	)	PUNCT
ahs-3074	144	141	.	.	PUNCT
ahs-3074	145	1	table	table	NOUN
ahs-3074	145	2	8	8	NUM
ahs-3074	145	3	citrus	citrus	NOUN
ahs-3074	145	4	samples	sample	NOUN
ahs-3074	145	5	tested	test	VERB
ahs-3074	145	6	and	and	CCONJ
ahs-3074	145	7	resulting	result	VERB
ahs-3074	145	8	positive	positive	ADJ
ahs-3074	145	9	by	by	ADP
ahs-3074	145	10	das	das	PROPN
ahs-3074	145	11	-	-	PUNCT
ahs-3074	145	12	elisa	elisa	NOUN
ahs-3074	145	13	during	during	ADP
ahs-3074	145	14	the	the	DET
ahs-3074	145	15	first	first	ADJ
ahs-3074	145	16	seven	seven	NUM
ahs-3074	145	17	years	year	NOUN
ahs-3074	145	18	of	of	ADP
ahs-3074	145	19	activity	activity	NOUN
ahs-3074	145	20	of	of	ADP
ahs-3074	145	21	the	the	DET
ahs-3074	145	22	plant	plant	NOUN
ahs-3074	145	23	biotechnology	biotechnology	NOUN
ahs-3074	145	24	laboratory	laboratory	NOUN
ahs-3074	145	25	based	base	VERB
ahs-3074	145	26	in	in	ADP
ahs-3074	145	27	kabul	kabul	PROPN
ahs-3074	145	28	.	.	PUNCT
ahs-3074	146	1	virus	virus	NOUN
ahs-3074	146	2	region	region	NOUN
ahs-3074	146	3	2009	2009	NUM
ahs-3074	146	4	2010	2010	NUM
ahs-3074	146	5	2011	2011	NUM
ahs-3074	146	6	2012	2012	NUM
ahs-3074	146	7	2013	2013	NUM
ahs-3074	146	8	2014	2014	NUM
ahs-3074	146	9	2015	2015	NUM
ahs-3074	146	10	total	total	NOUN
ahs-3074	146	11	tested	test	VERB
ahs-3074	146	12	positive	positive	ADJ
ahs-3074	146	13	tested	test	VERB
ahs-3074	146	14	positive	positive	ADJ
ahs-3074	146	15	tested	test	VERB
ahs-3074	146	16	positive	positive	ADJ
ahs-3074	146	17	tested	test	VERB
ahs-3074	146	18	positive	positive	ADJ
ahs-3074	146	19	tested	test	VERB
ahs-3074	146	20	positive	positive	ADJ
ahs-3074	146	21	tested	test	VERB
ahs-3074	146	22	positive	positive	ADJ
ahs-3074	146	23	tested	test	VERB
ahs-3074	146	24	positive	positive	ADJ
ahs-3074	146	25	tested	test	VERB
ahs-3074	146	26	positive	positive	ADJ
ahs-3074	146	27	ctv	ctv	PROPN
ahs-3074	146	28	nangarhar	nangarhar	PROPN
ahs-3074	146	29	0	0	NUM
ahs-3074	146	30	0	0	NUM
ahs-3074	146	31	193	193	NUM
ahs-3074	146	32	6	6	NUM
ahs-3074	146	33	263	263	NUM
ahs-3074	146	34	2	2	NUM
ahs-3074	146	35	1276	1276	NUM
ahs-3074	146	36	153	153	NUM
ahs-3074	146	37	1554	1554	NUM
ahs-3074	146	38	110	110	NUM
ahs-3074	146	39	131	131	NUM
ahs-3074	146	40	0	0	NUM
ahs-3074	146	41	492	492	NUM
ahs-3074	146	42	0	0	NUM
ahs-3074	146	43	3909	3909	NUM
ahs-3074	146	44	271	271	NUM
ahs-3074	146	45	laghman	laghman	NOUN
ahs-3074	146	46	0	0	NUM
ahs-3074	146	47	0	0	NUM
ahs-3074	146	48	0	0	NUM
ahs-3074	146	49	0	0	NUM
ahs-3074	146	50	0	0	NUM
ahs-3074	146	51	0	0	NUM
ahs-3074	146	52	180	180	NUM
ahs-3074	146	53	9	9	NUM
ahs-3074	146	54	200	200	NUM
ahs-3074	146	55	4	4	NUM
ahs-3074	146	56	0	0	NUM
ahs-3074	146	57	0	0	NUM
ahs-3074	146	58	296	296	NUM
ahs-3074	146	59	3	3	NUM
ahs-3074	146	60	676	676	NUM
ahs-3074	146	61	16	16	NUM
ahs-3074	146	62	kunar	kunar	NOUN
ahs-3074	146	63	0	0	NUM
ahs-3074	146	64	0	0	NUM
ahs-3074	146	65	0	0	NUM
ahs-3074	146	66	0	0	NUM
ahs-3074	146	67	0	0	NUM
ahs-3074	146	68	0	0	NUM
ahs-3074	146	69	318	318	NUM
ahs-3074	146	70	21	21	NUM
ahs-3074	146	71	246	246	NUM
ahs-3074	146	72	9	9	NUM
ahs-3074	146	73	0	0	NUM
ahs-3074	146	74	0	0	NUM
ahs-3074	146	75	249	249	NUM
ahs-3074	146	76	1	1	NUM
ahs-3074	146	77	813	813	NUM
ahs-3074	146	78	31	31	NUM
ahs-3074	146	79	total	total	NOUN
ahs-3074	146	80	0	0	NUM
ahs-3074	146	81	0	0	NUM
ahs-3074	146	82	193	193	NUM
ahs-3074	146	83	6	6	NUM
ahs-3074	146	84	263	263	NUM
ahs-3074	146	85	2	2	NUM
ahs-3074	146	86	1774	1774	NUM
ahs-3074	146	87	183	183	NUM
ahs-3074	146	88	2000	2000	NUM
ahs-3074	146	89	123	123	NUM
ahs-3074	146	90	131	131	NUM
ahs-3074	146	91	0	0	NUM
ahs-3074	146	92	1037	1037	NUM
ahs-3074	146	93	4	4	NUM
ahs-3074	146	94	5398	5398	NUM
ahs-3074	146	95	318	318	NUM
ahs-3074	146	96	adv	adv	PROPN
ahs-3074	146	97	.	.	PUNCT
ahs-3074	146	98	hort	hort	PROPN
ahs-3074	146	99	.	.	PUNCT
ahs-3074	147	1	sci	sci	PROPN
ahs-3074	147	2	.	.	PROPN
ahs-3074	147	3	,	,	PUNCT
ahs-3074	147	4	2016	2016	NUM
ahs-3074	147	5	30(4	30(4	NUM
ahs-3074	147	6	):	):	PUNCT
ahs-3074	147	7	239	239	NUM
ahs-3074	147	8	-	-	SYM
ahs-3074	147	9	248	248	NUM
ahs-3074	147	10	246	246	NUM
ahs-3074	147	11	bokhara	bokhara	NOUN
ahs-3074	147	12	shalili	shalili	NOUN
ahs-3074	147	13	,	,	PUNCT
ahs-3074	147	14	804	804	NUM
ahs-3074	147	15	/	/	SYM
ahs-3074	147	16	turki	turki	ADJ
ahs-3074	147	17	sorkh	sorkh	PROPN
ahs-3074	147	18	and	and	CCONJ
ahs-3074	147	19	811	811	NUM
ahs-3074	147	20	/	/	SYM
ahs-3074	147	21	turki	turki	PROPN
ahs-3074	147	22	zard	zard	PROPN
ahs-3074	147	23	proved	prove	VERB
ahs-3074	147	24	that	that	SCONJ
ahs-3074	147	25	they	they	PRON
ahs-3074	147	26	are	be	AUX
ahs-3074	147	27	99.6	99.6	NUM
ahs-3074	147	28	to	to	PART
ahs-3074	147	29	100.0	100.0	NUM
ahs-3074	147	30	%	%	NOUN
ahs-3074	147	31	identical	identical	ADJ
ahs-3074	147	32	with	with	ADP
ahs-3074	147	33	each	each	DET
ahs-3074	147	34	other	other	ADJ
ahs-3074	147	35	and	and	CCONJ
ahs-3074	147	36	share	share	VERB
ahs-3074	147	37	high	high	ADJ
ahs-3074	147	38	(	(	PUNCT
ahs-3074	147	39	94.3	94.3	NUM
ahs-3074	147	40	to	to	PART
ahs-3074	147	41	94.7	94.7	NUM
ahs-3074	147	42	%	%	NOUN
ahs-3074	147	43	)	)	PUNCT
ahs-3074	147	44	nucleotide	nucleotide	NOUN
ahs-3074	147	45	identity	identity	NOUN
ahs-3074	147	46	with	with	ADP
ahs-3074	147	47	the	the	DET
ahs-3074	147	48	iranian	iranian	PROPN
ahs-3074	147	49	isolate	isolate	NOUN
ahs-3074	147	50	t12ja	t12ja	PROPN
ahs-3074	147	51	(	(	PUNCT
ahs-3074	147	52	km586376	km586376	PROPN
ahs-3074	147	53	)	)	PUNCT
ahs-3074	147	54	.	.	PUNCT
ahs-3074	148	1	lower	low	ADJ
ahs-3074	148	2	nucleotide	nucleotide	ADJ
ahs-3074	148	3	similarity	similarity	NOUN
ahs-3074	148	4	(	(	PUNCT
ahs-3074	148	5	86.2	86.2	NUM
ahs-3074	148	6	%	%	NOUN
ahs-3074	148	7	)	)	PUNCT
ahs-3074	148	8	was	be	AUX
ahs-3074	148	9	shown	show	VERB
ahs-3074	148	10	by	by	ADP
ahs-3074	148	11	one	one	NUM
ahs-3074	148	12	804	804	NUM
ahs-3074	148	13	/	/	SYM
ahs-3074	148	14	turki	turki	ADJ
ahs-3074	148	15	sorkh	sorkh	PROPN
ahs-3074	148	16	isolate	isolate	VERB
ahs-3074	148	17	with	with	ADP
ahs-3074	148	18	the	the	DET
ahs-3074	148	19	isolate	isolate	ADJ
ahs-3074	148	20	274	274	NUM
ahs-3074	148	21	-	-	PUNCT
ahs-3074	148	22	chal	chal	NOUN
ahs-3074	148	23	(	(	PUNCT
ahs-3074	148	24	fn391009	fn391009	PROPN
ahs-3074	148	25	)	)	PUNCT
ahs-3074	148	26	from	from	ADP
ahs-3074	148	27	greece	greece	PROPN
ahs-3074	148	28	.	.	PUNCT
ahs-3074	149	1	finally	finally	ADV
ahs-3074	149	2	,	,	PUNCT
ahs-3074	149	3	analysis	analysis	NOUN
ahs-3074	149	4	of	of	ADP
ahs-3074	149	5	the	the	DET
ahs-3074	149	6	sequence	sequence	NOUN
ahs-3074	149	7	of	of	ADP
ahs-3074	149	8	isolates	isolate	NOUN
ahs-3074	149	9	804	804	NUM
ahs-3074	149	10	/	/	SYM
ahs-3074	149	11	turki	turki	NOUN
ahs-3074	149	12	sorkh	sorkh	PROPN
ahs-3074	149	13	,	,	PUNCT
ahs-3074	149	14	811	811	NUM
ahs-3074	149	15	/	/	SYM
ahs-3074	149	16	turki	turki	NOUN
ahs-3074	149	17	zard	zard	NOUN
ahs-3074	149	18	and	and	CCONJ
ahs-3074	149	19	812	812	NUM
ahs-3074	149	20	/	/	SYM
ahs-3074	149	21	dir	dir	NOUN
ahs-3074	149	22	ras	ras	PROPN
ahs-3074	149	23	revealed	reveal	VERB
ahs-3074	149	24	a	a	DET
ahs-3074	149	25	high	high	ADJ
ahs-3074	149	26	degree	degree	NOUN
ahs-3074	149	27	of	of	ADP
ahs-3074	149	28	identity	identity	NOUN
ahs-3074	149	29	(	(	PUNCT
ahs-3074	149	30	86.2	86.2	NUM
ahs-3074	149	31	to	to	PART
ahs-3074	149	32	88.4	88.4	NUM
ahs-3074	149	33	%	%	NOUN
ahs-3074	149	34	)	)	PUNCT
ahs-3074	149	35	with	with	ADP
ahs-3074	149	36	the	the	DET
ahs-3074	149	37	corresponding	corresponding	ADJ
ahs-3074	149	38	nucleotide	nucleotide	ADJ
ahs-3074	149	39	sequences	sequence	NOUN
ahs-3074	149	40	of	of	ADP
ahs-3074	149	41	the	the	DET
ahs-3074	149	42	isolate	isolate	NOUN
ahs-3074	149	43	sk-92	sk-92	NOUN
ahs-3074	149	44	-	-	PUNCT
ahs-3074	149	45	pl	pl	NOUN
ahs-3074	149	46	(	(	PUNCT
ahs-3074	149	47	hq398253	hq398253	PROPN
ahs-3074	149	48	)	)	PUNCT
ahs-3074	149	49	from	from	ADP
ahs-3074	149	50	slovakia	slovakia	PROPN
ahs-3074	149	51	.	.	PUNCT
ahs-3074	150	1	rt	rt	ADJ
ahs-3074	150	2	-	-	PUNCT
ahs-3074	150	3	pcr	pcr	PROPN
ahs-3074	150	4	reaction	reaction	NOUN
ahs-3074	150	5	performed	perform	VERB
ahs-3074	150	6	on	on	ADP
ahs-3074	150	7	samples	sample	NOUN
ahs-3074	150	8	infected	infect	VERB
ahs-3074	150	9	by	by	ADP
ahs-3074	150	10	pnrsv	pnrsv	PROPN
ahs-3074	150	11	,	,	PUNCT
ahs-3074	150	12	according	accord	VERB
ahs-3074	150	13	to	to	ADP
ahs-3074	150	14	das	das	PROPN
ahs-3074	150	15	-	-	PUNCT
ahs-3074	150	16	elisa	elisa	NOUN
ahs-3074	150	17	results	result	NOUN
ahs-3074	150	18	,	,	PUNCT
ahs-3074	150	19	amplified	amplify	VERB
ahs-3074	150	20	a	a	DET
ahs-3074	150	21	fragment	fragment	NOUN
ahs-3074	150	22	of	of	ADP
ahs-3074	150	23	675	675	NUM
ahs-3074	150	24	nucleotides	nucleotide	NOUN
ahs-3074	150	25	in	in	ADP
ahs-3074	150	26	length	length	NOUN
ahs-3074	150	27	when	when	SCONJ
ahs-3074	150	28	pnrsv	pnrsv	PRON
ahs-3074	150	29	specific	specific	ADJ
ahs-3074	150	30	primer	primer	NOUN
ahs-3074	150	31	pair	pair	PROPN
ahs-3074	150	32	mg1	mg1	PROPN
ahs-3074	150	33	/	/	SYM
ahs-3074	150	34	mg2	mg2	PROPN
ahs-3074	150	35	was	be	AUX
ahs-3074	150	36	used	use	VERB
ahs-3074	150	37	(	(	PUNCT
ahs-3074	150	38	table	table	NOUN
ahs-3074	150	39	1	1	NUM
ahs-3074	150	40	)	)	PUNCT
ahs-3074	150	41	.	.	PUNCT
ahs-3074	151	1	regarding	regard	VERB
ahs-3074	151	2	grape	grape	NOUN
ahs-3074	151	3	samples	sample	NOUN
ahs-3074	151	4	,	,	PUNCT
ahs-3074	151	5	specific	specific	ADJ
ahs-3074	151	6	pcr	pcr	ADJ
ahs-3074	151	7	products	product	NOUN
ahs-3074	151	8	of	of	ADP
ahs-3074	151	9	118	118	NUM
ahs-3074	151	10	nucleotides	nucleotide	NOUN
ahs-3074	151	11	where	where	SCONJ
ahs-3074	151	12	also	also	ADV
ahs-3074	151	13	observed	observe	VERB
ahs-3074	151	14	on	on	ADP
ahs-3074	151	15	das	das	PROPN
ahs-3074	151	16	-	-	PUNCT
ahs-3074	151	17	elisa	elisa	NOUN
ahs-3074	151	18	positive	positive	ADJ
ahs-3074	151	19	samples	sample	NOUN
ahs-3074	151	20	,	,	PUNCT
ahs-3074	151	21	using	use	VERB
ahs-3074	151	22	specific	specific	ADJ
ahs-3074	151	23	primers	primer	NOUN
ahs-3074	151	24	pair	pair	VERB
ahs-3074	151	25	m3	m3	PROPN
ahs-3074	151	26	/	/	SYM
ahs-3074	151	27	m4	m4	PROPN
ahs-3074	151	28	against	against	ADP
ahs-3074	151	29	gflv	gflv	NOUN
ahs-3074	151	30	as	as	SCONJ
ahs-3074	151	31	reported	report	VERB
ahs-3074	151	32	in	in	ADP
ahs-3074	151	33	table	table	NOUN
ahs-3074	151	34	1	1	NUM
ahs-3074	151	35	.	.	PUNCT
ahs-3074	152	1	some	some	PRON
ahs-3074	152	2	of	of	ADP
ahs-3074	152	3	the	the	DET
ahs-3074	152	4	citrus	citrus	NOUN
ahs-3074	152	5	samples	sample	NOUN
ahs-3074	152	6	tested	test	VERB
ahs-3074	152	7	positive	positive	ADJ
ahs-3074	152	8	by	by	ADP
ahs-3074	152	9	das	das	PROPN
ahs-3074	152	10	-	-	PUNCT
ahs-3074	152	11	elisa	elisa	PROPN
ahs-3074	152	12	were	be	AUX
ahs-3074	152	13	also	also	ADV
ahs-3074	152	14	tested	test	VERB
ahs-3074	152	15	using	use	VERB
ahs-3074	152	16	primers	primer	NOUN
ahs-3074	152	17	ctvf	ctvf	NOUN
ahs-3074	152	18	and	and	CCONJ
ahs-3074	152	19	ctvr	ctvr	NOUN
ahs-3074	152	20	allowing	allow	VERB
ahs-3074	152	21	amplification	amplification	NOUN
ahs-3074	152	22	of	of	ADP
ahs-3074	152	23	specific	specific	ADJ
ahs-3074	152	24	pcr	pcr	ADJ
ahs-3074	152	25	products	product	NOUN
ahs-3074	152	26	655	655	NUM
ahs-3074	152	27	nucleotides	nucleotide	NOUN
ahs-3074	152	28	in	in	ADP
ahs-3074	152	29	length	length	NOUN
ahs-3074	152	30	(	(	PUNCT
ahs-3074	152	31	table	table	NOUN
ahs-3074	152	32	1	1	NUM
ahs-3074	152	33	)	)	PUNCT
ahs-3074	152	34	.	.	PUNCT
ahs-3074	153	1	moreover	moreover	ADV
ahs-3074	153	2	,	,	PUNCT
ahs-3074	153	3	six	six	NUM
ahs-3074	153	4	ctv	ctv	NOUN
ahs-3074	153	5	isolates	isolate	NOUN
ahs-3074	153	6	collected	collect	VERB
ahs-3074	153	7	at	at	ADP
ahs-3074	153	8	the	the	DET
ahs-3074	153	9	jalalabad	jalalabad	PROPN
ahs-3074	153	10	station	station	NOUN
ahs-3074	153	11	were	be	AUX
ahs-3074	153	12	characterized	characterize	VERB
ahs-3074	153	13	.	.	PUNCT
ahs-3074	154	1	sequence	sequence	NOUN
ahs-3074	154	2	analysis	analysis	NOUN
ahs-3074	154	3	revealed	reveal	VERB
ahs-3074	154	4	high	high	ADJ
ahs-3074	154	5	similarity	similarity	NOUN
ahs-3074	154	6	,	,	PUNCT
ahs-3074	154	7	ranging	range	VERB
ahs-3074	154	8	from	from	ADP
ahs-3074	154	9	91.1	91.1	NUM
ahs-3074	154	10	to	to	PART
ahs-3074	154	11	99.8	99.8	NUM
ahs-3074	154	12	%	%	NOUN
ahs-3074	154	13	,	,	PUNCT
ahs-3074	154	14	within	within	SCONJ
ahs-3074	154	15	the	the	DET
ahs-3074	154	16	ctv	ctv	NOUN
ahs-3074	154	17	isolates	isolate	NOUN
ahs-3074	154	18	detected	detect	VERB
ahs-3074	154	19	.	.	PUNCT
ahs-3074	155	1	in	in	ADP
ahs-3074	155	2	accordance	accordance	NOUN
ahs-3074	155	3	with	with	ADP
ahs-3074	155	4	the	the	DET
ahs-3074	155	5	previously	previously	ADV
ahs-3074	155	6	defined	define	VERB
ahs-3074	155	7	phylogenetic	phylogenetic	ADJ
ahs-3074	155	8	groups	group	NOUN
ahs-3074	155	9	(	(	PUNCT
ahs-3074	155	10	zemzami	zemzami	X
ahs-3074	155	11	et	et	PROPN
ahs-3074	155	12	al	al	PROPN
ahs-3074	155	13	.	.	PROPN
ahs-3074	155	14	,	,	PUNCT
ahs-3074	155	15	2002	2002	NUM
ahs-3074	155	16	)	)	PUNCT
ahs-3074	155	17	,	,	PUNCT
ahs-3074	155	18	nucleotide	nucleotide	NOUN
ahs-3074	155	19	sequences	sequence	NOUN
ahs-3074	155	20	of	of	ADP
ahs-3074	155	21	afghan	afghan	PROPN
ahs-3074	155	22	ctv	ctv	PROPN
ahs-3074	155	23	isolates	isolate	NOUN
ahs-3074	155	24	cluster	cluster	NOUN
ahs-3074	155	25	in	in	ADP
ahs-3074	155	26	group	group	NOUN
ahs-3074	155	27	1	1	NUM
ahs-3074	155	28	(	(	PUNCT
ahs-3074	155	29	j4	j4	PROPN
ahs-3074	155	30	and	and	CCONJ
ahs-3074	155	31	j8	j8	NOUN
ahs-3074	155	32	)	)	PUNCT
ahs-3074	155	33	,	,	PUNCT
ahs-3074	155	34	group	group	NOUN
ahs-3074	155	35	4	4	NUM
ahs-3074	155	36	(	(	PUNCT
ahs-3074	155	37	j61	j61	NOUN
ahs-3074	155	38	and	and	CCONJ
ahs-3074	155	39	j76	j76	NOUN
ahs-3074	155	40	)	)	PUNCT
ahs-3074	155	41	and	and	CCONJ
ahs-3074	155	42	group	group	NOUN
ahs-3074	155	43	5	5	NUM
ahs-3074	155	44	(	(	PUNCT
ahs-3074	155	45	j101	j101	PROPN
ahs-3074	155	46	)	)	PUNCT
ahs-3074	155	47	.	.	PUNCT
ahs-3074	156	1	in	in	ADP
ahs-3074	156	2	particular	particular	ADJ
ahs-3074	156	3	,	,	PUNCT
ahs-3074	156	4	j4	j4	PROPN
ahs-3074	156	5	and	and	CCONJ
ahs-3074	156	6	j8	j8	PROPN
ahs-3074	156	7	isolates	isolate	NOUN
ahs-3074	156	8	show	show	PROPN
ahs-3074	156	9	,	,	PUNCT
ahs-3074	156	10	respectively	respectively	ADV
ahs-3074	156	11	,	,	PUNCT
ahs-3074	156	12	99.4	99.4	NUM
ahs-3074	156	13	and	and	CCONJ
ahs-3074	156	14	99.2	99.2	NUM
ahs-3074	156	15	%	%	NOUN
ahs-3074	156	16	identity	identity	NOUN
ahs-3074	156	17	with	with	ADP
ahs-3074	156	18	reference	reference	NOUN
ahs-3074	156	19	isolate	isolate	NOUN
ahs-3074	156	20	t36	t36	NOUN
ahs-3074	156	21	(	(	PUNCT
ahs-3074	156	22	m76485	m76485	PROPN
ahs-3074	156	23	)	)	PUNCT
ahs-3074	156	24	from	from	ADP
ahs-3074	156	25	the	the	DET
ahs-3074	156	26	usa	usa	PROPN
ahs-3074	156	27	(	(	PUNCT
ahs-3074	156	28	florida	florida	PROPN
ahs-3074	156	29	)	)	PUNCT
ahs-3074	156	30	.	.	PUNCT
ahs-3074	157	1	furthermore	furthermore	ADV
ahs-3074	157	2	,	,	PUNCT
ahs-3074	157	3	in	in	ADP
ahs-3074	157	4	group	group	NOUN
ahs-3074	157	5	4	4	NUM
ahs-3074	157	6	,	,	PUNCT
ahs-3074	157	7	isolate	isolate	VERB
ahs-3074	157	8	j61	j61	NOUN
ahs-3074	157	9	and	and	CCONJ
ahs-3074	157	10	j76	j76	NOUN
ahs-3074	157	11	were	be	AUX
ahs-3074	157	12	more	more	ADV
ahs-3074	157	13	similar	similar	ADJ
ahs-3074	157	14	to	to	ADP
ahs-3074	157	15	ano-1	ano-1	PUNCT
ahs-3074	157	16	isolate	isolate	VERB
ahs-3074	157	17	(	(	PUNCT
ahs-3074	157	18	dq211658	dq211658	NOUN
ahs-3074	157	19	)	)	PUNCT
ahs-3074	157	20	from	from	ADP
ahs-3074	157	21	egypt	egypt	PROPN
ahs-3074	157	22	(	(	PUNCT
ahs-3074	157	23	98.5	98.5	NUM
ahs-3074	157	24	and	and	CCONJ
ahs-3074	157	25	98.0	98.0	NUM
ahs-3074	157	26	%	%	NOUN
ahs-3074	157	27	identity	identity	NOUN
ahs-3074	157	28	,	,	PUNCT
ahs-3074	157	29	respectively	respectively	ADV
ahs-3074	157	30	)	)	PUNCT
ahs-3074	157	31	than	than	SCONJ
ahs-3074	157	32	to	to	PART
ahs-3074	157	33	isolate	isolate	VERB
ahs-3074	157	34	443	443	NUM
ahs-3074	157	35	-	-	SYM
ahs-3074	157	36	4	4	NUM
ahs-3074	157	37	(	(	PUNCT
ahs-3074	157	38	ay791844	ay791844	PROPN
ahs-3074	157	39	)	)	PUNCT
ahs-3074	157	40	from	from	ADP
ahs-3074	157	41	croatia	croatia	PROPN
ahs-3074	157	42	(	(	PUNCT
ahs-3074	157	43	97.4	97.4	NUM
ahs-3074	157	44	and	and	CCONJ
ahs-3074	157	45	97.5	97.5	NUM
ahs-3074	157	46	%	%	NOUN
ahs-3074	157	47	,	,	PUNCT
ahs-3074	157	48	respectively	respectively	ADV
ahs-3074	157	49	)	)	PUNCT
ahs-3074	157	50	.	.	PUNCT
ahs-3074	158	1	finally	finally	ADV
ahs-3074	158	2	,	,	PUNCT
ahs-3074	158	3	isolate	isolate	VERB
ahs-3074	158	4	j101	j101	PROPN
ahs-3074	158	5	,	,	PUNCT
ahs-3074	158	6	in	in	ADP
ahs-3074	158	7	group	group	NOUN
ahs-3074	158	8	5	5	NUM
ahs-3074	158	9	,	,	PUNCT
ahs-3074	158	10	shows	show	VERB
ahs-3074	158	11	95.6	95.6	NUM
ahs-3074	158	12	%	%	NOUN
ahs-3074	158	13	identity	identity	NOUN
ahs-3074	158	14	with	with	ADP
ahs-3074	158	15	isolates	isolate	NOUN
ahs-3074	158	16	c268	c268	PROPN
ahs-3074	158	17	-	-	PUNCT
ahs-3074	158	18	2	2	NUM
ahs-3074	158	19	(	(	PUNCT
ahs-3074	158	20	ay750770	ay750770	NOUN
ahs-3074	158	21	)	)	PUNCT
ahs-3074	158	22	and	and	CCONJ
ahs-3074	158	23	c269	c269	NOUN
ahs-3074	158	24	-	-	SYM
ahs-3074	158	25	6	6	NUM
ahs-3074	158	26	(	(	PUNCT
ahs-3074	158	27	ay750775	ay750775	PROPN
ahs-3074	158	28	)	)	PUNCT
ahs-3074	158	29	from	from	ADP
ahs-3074	158	30	argentina	argentina	PROPN
ahs-3074	158	31	.	.	PUNCT
ahs-3074	159	1	4	4	X
ahs-3074	159	2	.	.	X
ahs-3074	159	3	discussion	discussion	NOUN
ahs-3074	159	4	and	and	CCONJ
ahs-3074	159	5	conclusions	conclusion	NOUN
ahs-3074	159	6	to	to	PART
ahs-3074	159	7	improve	improve	VERB
ahs-3074	159	8	afghanistan	afghanistan	PROPN
ahs-3074	159	9	’s	’s	PART
ahs-3074	159	10	agricultural	agricultural	ADJ
ahs-3074	159	11	sector	sector	NOUN
ahs-3074	159	12	,	,	PUNCT
ahs-3074	159	13	the	the	DET
ahs-3074	159	14	ec	ec	PROPN
ahs-3074	159	15	supports	support	VERB
ahs-3074	159	16	the	the	DET
ahs-3074	159	17	phdp	phdp	NOUN
ahs-3074	159	18	(	(	PUNCT
ahs-3074	159	19	perennial	perennial	ADJ
ahs-3074	159	20	horticulture	horticulture	NOUN
ahs-3074	159	21	development	development	NOUN
ahs-3074	159	22	project	project	NOUN
ahs-3074	159	23	)	)	PUNCT
ahs-3074	159	24	,	,	PUNCT
ahs-3074	159	25	for	for	ADP
ahs-3074	159	26	true	true	ADJ
ahs-3074	159	27	to	to	PART
ahs-3074	159	28	type	type	VERB
ahs-3074	159	29	/	/	SYM
ahs-3074	159	30	ecotype	ecotype	ADJ
ahs-3074	159	31	and	and	CCONJ
ahs-3074	159	32	healthy	healthy	ADJ
ahs-3074	159	33	planting	planting	NOUN
ahs-3074	159	34	materials	material	NOUN
ahs-3074	159	35	,	,	PUNCT
ahs-3074	159	36	and	and	CCONJ
ahs-3074	159	37	the	the	DET
ahs-3074	159	38	plant	plant	NOUN
ahs-3074	159	39	biotechnology	biotechnology	NOUN
ahs-3074	159	40	laboratory	laboratory	NOUN
ahs-3074	159	41	,	,	PUNCT
ahs-3074	159	42	to	to	PART
ahs-3074	159	43	ensure	ensure	VERB
ahs-3074	159	44	the	the	DET
ahs-3074	159	45	health	health	NOUN
ahs-3074	159	46	status	status	NOUN
ahs-3074	159	47	of	of	ADP
ahs-3074	159	48	local	local	ADJ
ahs-3074	159	49	germplasm	germplasm	NOUN
ahs-3074	159	50	.	.	PUNCT
ahs-3074	160	1	the	the	DET
ahs-3074	160	2	laboratory	laboratory	NOUN
ahs-3074	160	3	started	start	VERB
ahs-3074	160	4	screening	screen	VERB
ahs-3074	160	5	the	the	DET
ahs-3074	160	6	health	health	NOUN
ahs-3074	160	7	status	status	NOUN
ahs-3074	160	8	of	of	ADP
ahs-3074	160	9	the	the	DET
ahs-3074	160	10	afghan	afghan	ADJ
ahs-3074	160	11	germplasm	germplasm	NOUN
ahs-3074	160	12	national	national	ADJ
ahs-3074	160	13	collection	collection	NOUN
ahs-3074	160	14	in	in	ADP
ahs-3074	160	15	order	order	NOUN
ahs-3074	160	16	to	to	PART
ahs-3074	160	17	ensure	ensure	VERB
ahs-3074	160	18	the	the	DET
ahs-3074	160	19	multiplication	multiplication	NOUN
ahs-3074	160	20	of	of	ADP
ahs-3074	160	21	not	not	PART
ahs-3074	160	22	only	only	ADV
ahs-3074	160	23	the	the	DET
ahs-3074	160	24	best	well	ADV
ahs-3074	160	25	-	-	PUNCT
ahs-3074	160	26	selected	select	VERB
ahs-3074	160	27	varieties	variety	NOUN
ahs-3074	160	28	or	or	CCONJ
ahs-3074	160	29	ecotype	ecotype	ADJ
ahs-3074	160	30	,	,	PUNCT
ahs-3074	160	31	but	but	CCONJ
ahs-3074	160	32	also	also	ADV
ahs-3074	160	33	to	to	PART
ahs-3074	160	34	avoid	avoid	VERB
ahs-3074	160	35	production	production	NOUN
ahs-3074	160	36	and	and	CCONJ
ahs-3074	160	37	distribution	distribution	NOUN
ahs-3074	160	38	of	of	ADP
ahs-3074	160	39	virus	virus	NOUN
ahs-3074	160	40	-	-	PUNCT
ahs-3074	160	41	infected	infect	VERB
ahs-3074	160	42	fruit	fruit	NOUN
ahs-3074	160	43	trees	tree	NOUN
ahs-3074	160	44	.	.	PUNCT
ahs-3074	161	1	symptom	symptom	NOUN
ahs-3074	161	2	inspection	inspection	NOUN
ahs-3074	161	3	and	and	CCONJ
ahs-3074	161	4	sample	sample	NOUN
ahs-3074	161	5	collection	collection	NOUN
ahs-3074	161	6	for	for	ADP
ahs-3074	161	7	viral	viral	ADJ
ahs-3074	161	8	diseases	disease	NOUN
ahs-3074	161	9	was	be	AUX
ahs-3074	161	10	carried	carry	VERB
ahs-3074	161	11	out	out	ADP
ahs-3074	161	12	in	in	ADP
ahs-3074	161	13	all	all	DET
ahs-3074	161	14	the	the	DET
ahs-3074	161	15	national	national	ADJ
ahs-3074	161	16	collection	collection	NOUN
ahs-3074	161	17	fields	field	NOUN
ahs-3074	161	18	,	,	PUNCT
ahs-3074	161	19	including	include	VERB
ahs-3074	161	20	peach	peach	NOUN
ahs-3074	161	21	,	,	PUNCT
ahs-3074	161	22	plum	plum	NOUN
ahs-3074	161	23	,	,	PUNCT
ahs-3074	161	24	apricot	apricot	PROPN
ahs-3074	161	25	,	,	PUNCT
ahs-3074	161	26	almond	almond	NOUN
ahs-3074	161	27	,	,	PUNCT
ahs-3074	161	28	apple	apple	NOUN
ahs-3074	161	29	,	,	PUNCT
ahs-3074	161	30	grape	grape	NOUN
ahs-3074	161	31	and	and	CCONJ
ahs-3074	161	32	citrus	citrus	NOUN
ahs-3074	161	33	plants	plant	NOUN
ahs-3074	161	34	,	,	PUNCT
ahs-3074	161	35	located	locate	VERB
ahs-3074	161	36	in	in	ADP
ahs-3074	161	37	different	different	ADJ
ahs-3074	161	38	areas	area	NOUN
ahs-3074	161	39	of	of	ADP
ahs-3074	161	40	the	the	DET
ahs-3074	161	41	country	country	NOUN
ahs-3074	161	42	.	.	PUNCT
ahs-3074	162	1	during	during	ADP
ahs-3074	162	2	the	the	DET
ahs-3074	162	3	first	first	ADJ
ahs-3074	162	4	seven	seven	NUM
ahs-3074	162	5	years	year	NOUN
ahs-3074	162	6	of	of	ADP
ahs-3074	162	7	its	its	PRON
ahs-3074	162	8	activity	activity	NOUN
ahs-3074	162	9	,	,	PUNCT
ahs-3074	162	10	the	the	DET
ahs-3074	162	11	plant	plant	NOUN
ahs-3074	162	12	biotechnology	biotechnology	NOUN
ahs-3074	162	13	laboratory	laboratory	NOUN
ahs-3074	162	14	based	base	VERB
ahs-3074	162	15	in	in	ADP
ahs-3074	162	16	kabul	kabul	PROPN
ahs-3074	162	17	,	,	PUNCT
ahs-3074	162	18	played	play	VERB
ahs-3074	162	19	a	a	DET
ahs-3074	162	20	key	key	ADJ
ahs-3074	162	21	role	role	NOUN
ahs-3074	162	22	by	by	ADP
ahs-3074	162	23	satisfying	satisfy	VERB
ahs-3074	162	24	the	the	DET
ahs-3074	162	25	increasing	increase	VERB
ahs-3074	162	26	need	need	NOUN
ahs-3074	162	27	for	for	ADP
ahs-3074	162	28	certified	certified	ADJ
ahs-3074	162	29	propagation	propagation	NOUN
ahs-3074	162	30	plant	plant	NOUN
ahs-3074	162	31	material	material	NOUN
ahs-3074	162	32	to	to	PART
ahs-3074	162	33	establish	establish	VERB
ahs-3074	162	34	new	new	ADJ
ahs-3074	162	35	plantations	plantation	NOUN
ahs-3074	162	36	in	in	ADP
ahs-3074	162	37	afghanistan	afghanistan	PROPN
ahs-3074	162	38	.	.	PUNCT
ahs-3074	163	1	moreover	moreover	ADV
ahs-3074	163	2	,	,	PUNCT
ahs-3074	163	3	it	it	PRON
ahs-3074	163	4	contributed	contribute	VERB
ahs-3074	163	5	to	to	ADP
ahs-3074	163	6	protecting	protect	VERB
ahs-3074	163	7	the	the	DET
ahs-3074	163	8	country	country	NOUN
ahs-3074	163	9	from	from	ADP
ahs-3074	163	10	undesirable	undesirable	ADJ
ahs-3074	163	11	introduction	introduction	NOUN
ahs-3074	163	12	of	of	ADP
ahs-3074	163	13	pathogens	pathogen	NOUN
ahs-3074	163	14	due	due	ADJ
ahs-3074	163	15	to	to	ADP
ahs-3074	163	16	increasing	increase	VERB
ahs-3074	163	17	exchanges	exchange	NOUN
ahs-3074	163	18	of	of	ADP
ahs-3074	163	19	propagation	propagation	NOUN
ahs-3074	163	20	plant	plant	NOUN
ahs-3074	163	21	material	material	NOUN
ahs-3074	163	22	among	among	ADP
ahs-3074	163	23	different	different	ADJ
ahs-3074	163	24	countries	country	NOUN
ahs-3074	163	25	and	and	CCONJ
ahs-3074	163	26	between	between	ADP
ahs-3074	163	27	different	different	ADJ
ahs-3074	163	28	continents	continent	NOUN
ahs-3074	163	29	.	.	PUNCT
ahs-3074	164	1	until	until	ADP
ahs-3074	164	2	now	now	ADV
ahs-3074	164	3	,	,	PUNCT
ahs-3074	164	4	the	the	DET
ahs-3074	164	5	plant	plant	NOUN
ahs-3074	164	6	biotechnology	biotechnology	NOUN
ahs-3074	164	7	laboratory	laboratory	NOUN
ahs-3074	164	8	has	have	AUX
ahs-3074	164	9	verified	verify	VERB
ahs-3074	164	10	the	the	DET
ahs-3074	164	11	absence	absence	NOUN
ahs-3074	164	12	of	of	ADP
ahs-3074	164	13	ppv	ppv	NOUN
ahs-3074	164	14	(	(	PUNCT
ahs-3074	164	15	the	the	DET
ahs-3074	164	16	most	most	ADV
ahs-3074	164	17	devastating	devastating	ADJ
ahs-3074	164	18	virus	virus	NOUN
ahs-3074	164	19	for	for	ADP
ahs-3074	164	20	stone	stone	NOUN
ahs-3074	164	21	fruit	fruit	NOUN
ahs-3074	164	22	)	)	PUNCT
ahs-3074	164	23	in	in	ADP
ahs-3074	164	24	the	the	DET
ahs-3074	164	25	afghan	afghan	ADJ
ahs-3074	164	26	germplasm	germplasm	NOUN
ahs-3074	164	27	and	and	CCONJ
ahs-3074	164	28	detected	detect	VERB
ahs-3074	164	29	and	and	CCONJ
ahs-3074	164	30	verified	verify	VERB
ahs-3074	164	31	the	the	DET
ahs-3074	164	32	presence	presence	NOUN
ahs-3074	164	33	of	of	ADP
ahs-3074	164	34	several	several	ADJ
ahs-3074	164	35	important	important	ADJ
ahs-3074	164	36	plant	plant	NOUN
ahs-3074	164	37	viruses	virus	NOUN
ahs-3074	164	38	in	in	ADP
ahs-3074	164	39	stone	stone	NOUN
ahs-3074	164	40	fruits	fruit	NOUN
ahs-3074	164	41	,	,	PUNCT
ahs-3074	164	42	citrus	citrus	NOUN
ahs-3074	164	43	and	and	CCONJ
ahs-3074	164	44	grapevines	grapevine	NOUN
ahs-3074	164	45	.	.	PUNCT
ahs-3074	165	1	further	further	ADJ
ahs-3074	165	2	activity	activity	NOUN
ahs-3074	165	3	will	will	AUX
ahs-3074	165	4	be	be	AUX
ahs-3074	165	5	addressed	address	VERB
ahs-3074	165	6	to	to	ADP
ahs-3074	165	7	confirming	confirm	VERB
ahs-3074	165	8	,	,	PUNCT
ahs-3074	165	9	by	by	ADP
ahs-3074	165	10	rt	rt	PROPN
ahs-3074	165	11	-	-	PUNCT
ahs-3074	165	12	pcr	pcr	ADJ
ahs-3074	165	13	,	,	PUNCT
ahs-3074	165	14	infection	infection	NOUN
ahs-3074	165	15	by	by	ADP
ahs-3074	165	16	apmv	apmv	PROPN
ahs-3074	165	17	,	,	PUNCT
ahs-3074	165	18	pdv	pdv	PROPN
ahs-3074	165	19	,	,	PUNCT
ahs-3074	165	20	gva	gva	PROPN
ahs-3074	165	21	,	,	PUNCT
ahs-3074	165	22	glrav-1	glrav-1	PROPN
ahs-3074	165	23	and	and	CCONJ
ahs-3074	165	24	glrav-3	glrav-3	PROPN
ahs-3074	165	25	in	in	ADP
ahs-3074	165	26	almond	almond	NOUN
ahs-3074	165	27	,	,	PUNCT
ahs-3074	165	28	plum	plum	NOUN
ahs-3074	165	29	and	and	CCONJ
ahs-3074	165	30	grape	grape	NOUN
ahs-3074	165	31	accessions	accession	NOUN
ahs-3074	165	32	which	which	PRON
ahs-3074	165	33	resulted	result	VERB
ahs-3074	165	34	positive	positive	ADJ
ahs-3074	165	35	by	by	ADP
ahs-3074	165	36	das	das	PROPN
ahs-3074	165	37	-	-	PUNCT
ahs-3074	165	38	elisa	elisa	NOUN
ahs-3074	165	39	,	,	PUNCT
ahs-3074	165	40	using	use	VERB
ahs-3074	165	41	specific	specific	ADJ
ahs-3074	165	42	primer	primer	NOUN
ahs-3074	165	43	pairs	pair	NOUN
ahs-3074	165	44	(	(	PUNCT
ahs-3074	165	45	parakh	parakh	NOUN
ahs-3074	165	46	et	et	PROPN
ahs-3074	165	47	al	al	PROPN
ahs-3074	165	48	.	.	PROPN
ahs-3074	165	49	,	,	PUNCT
ahs-3074	165	50	1995	1995	NUM
ahs-3074	165	51	;	;	PUNCT
ahs-3074	165	52	menzel	menzel	PROPN
ahs-3074	165	53	et	et	PROPN
ahs-3074	165	54	al	al	PROPN
ahs-3074	165	55	.	.	PROPN
ahs-3074	165	56	,	,	PUNCT
ahs-3074	165	57	2002	2002	NUM
ahs-3074	165	58	;	;	PUNCT
ahs-3074	165	59	goszczynski	goszczynski	NOUN
ahs-3074	165	60	and	and	CCONJ
ahs-3074	165	61	jooste	jooste	NOUN
ahs-3074	165	62	,	,	PUNCT
ahs-3074	165	63	2003	2003	NUM
ahs-3074	165	64	;	;	PUNCT
ahs-3074	165	65	osman	osman	PROPN
ahs-3074	165	66	et	et	PROPN
ahs-3074	165	67	al	al	PROPN
ahs-3074	165	68	.	.	PROPN
ahs-3074	165	69	,	,	PUNCT
ahs-3074	165	70	2008	2008	NUM
ahs-3074	165	71	)	)	PUNCT
ahs-3074	165	72	.	.	PUNCT
ahs-3074	166	1	the	the	DET
ahs-3074	166	2	plant	plant	NOUN
ahs-3074	166	3	biotechnology	biotechnology	NOUN
ahs-3074	166	4	laboratory	laboratory	NOUN
ahs-3074	166	5	first	first	ADV
ahs-3074	166	6	reported	report	VERB
ahs-3074	166	7	aclsv	aclsv	NOUN
ahs-3074	166	8	occurrence	occurrence	NOUN
ahs-3074	166	9	in	in	ADP
ahs-3074	166	10	peach	peach	NOUN
ahs-3074	166	11	,	,	PUNCT
ahs-3074	166	12	plum	plum	NOUN
ahs-3074	166	13	,	,	PUNCT
ahs-3074	166	14	almond	almond	NOUN
ahs-3074	166	15	and	and	CCONJ
ahs-3074	166	16	apricot	apricot	NOUN
ahs-3074	166	17	plants	plant	NOUN
ahs-3074	166	18	in	in	ADP
ahs-3074	166	19	afghanistan	afghanistan	PROPN
ahs-3074	166	20	.	.	PUNCT
ahs-3074	167	1	according	accord	VERB
ahs-3074	167	2	to	to	ADP
ahs-3074	167	3	the	the	DET
ahs-3074	167	4	preliminary	preliminary	ADJ
ahs-3074	167	5	results	result	NOUN
ahs-3074	167	6	of	of	ADP
ahs-3074	167	7	sequence	sequence	NOUN
ahs-3074	167	8	analysis	analysis	NOUN
ahs-3074	167	9	,	,	PUNCT
ahs-3074	167	10	due	due	ADP
ahs-3074	167	11	to	to	ADP
ahs-3074	167	12	the	the	DET
ahs-3074	167	13	relative	relative	ADJ
ahs-3074	167	14	low	low	ADJ
ahs-3074	167	15	identity	identity	NOUN
ahs-3074	167	16	with	with	ADP
ahs-3074	167	17	other	other	ADJ
ahs-3074	167	18	aclsv	aclsv	NOUN
ahs-3074	167	19	isolates	isolate	NOUN
ahs-3074	167	20	present	present	ADJ
ahs-3074	167	21	in	in	ADP
ahs-3074	167	22	genbank	genbank	PROPN
ahs-3074	167	23	,	,	PUNCT
ahs-3074	167	24	our	our	PRON
ahs-3074	167	25	mother	mother	NOUN
ahs-3074	167	26	stock	stock	NOUN
ahs-3074	167	27	nurseries	nursery	NOUN
ahs-3074	167	28	appear	appear	VERB
ahs-3074	167	29	to	to	PART
ahs-3074	167	30	be	be	AUX
ahs-3074	167	31	infected	infect	VERB
ahs-3074	167	32	by	by	ADP
ahs-3074	167	33	several	several	ADJ
ahs-3074	167	34	afghan	afghan	ADJ
ahs-3074	167	35	isolates	isolate	NOUN
ahs-3074	167	36	of	of	ADP
ahs-3074	167	37	the	the	DET
ahs-3074	167	38	virus	virus	NOUN
ahs-3074	167	39	,	,	PUNCT
ahs-3074	167	40	but	but	CCONJ
ahs-3074	167	41	further	further	ADJ
ahs-3074	167	42	studies	study	NOUN
ahs-3074	167	43	will	will	AUX
ahs-3074	167	44	be	be	AUX
ahs-3074	167	45	addressed	address	VERB
ahs-3074	167	46	to	to	ADP
ahs-3074	167	47	understanding	understanding	NOUN
ahs-3074	167	48	if	if	SCONJ
ahs-3074	167	49	aclsv	aclsv	NOUN
ahs-3074	167	50	has	have	AUX
ahs-3074	167	51	been	be	AUX
ahs-3074	167	52	introduced	introduce	VERB
ahs-3074	167	53	into	into	ADP
ahs-3074	167	54	the	the	DET
ahs-3074	167	55	country	country	NOUN
ahs-3074	167	56	through	through	ADP
ahs-3074	167	57	infected	infected	ADJ
ahs-3074	167	58	propagation	propagation	NOUN
ahs-3074	167	59	material	material	NOUN
ahs-3074	167	60	.	.	PUNCT
ahs-3074	168	1	in	in	ADP
ahs-3074	168	2	any	any	DET
ahs-3074	168	3	case	case	NOUN
ahs-3074	168	4	,	,	PUNCT
ahs-3074	168	5	the	the	DET
ahs-3074	168	6	presence	presence	NOUN
ahs-3074	168	7	of	of	ADP
ahs-3074	168	8	aclsv	aclsv	NOUN
ahs-3074	168	9	in	in	ADP
ahs-3074	168	10	important	important	ADJ
ahs-3074	168	11	cultivars	cultivar	NOUN
ahs-3074	168	12	of	of	ADP
ahs-3074	168	13	peach	peach	NOUN
ahs-3074	168	14	and	and	CCONJ
ahs-3074	168	15	plum	plum	NOUN
ahs-3074	168	16	is	be	AUX
ahs-3074	168	17	a	a	DET
ahs-3074	168	18	worrying	worrying	ADJ
ahs-3074	168	19	aspect	aspect	NOUN
ahs-3074	168	20	of	of	ADP
ahs-3074	168	21	the	the	DET
ahs-3074	168	22	afghan	afghan	PROPN
ahs-3074	168	23	certification	certification	NOUN
ahs-3074	168	24	program	program	NOUN
ahs-3074	168	25	.	.	PUNCT
ahs-3074	169	1	similarly	similarly	ADV
ahs-3074	169	2	,	,	PUNCT
ahs-3074	169	3	our	our	PRON
ahs-3074	169	4	results	result	NOUN
ahs-3074	169	5	identified	identify	VERB
ahs-3074	169	6	,	,	PUNCT
ahs-3074	169	7	for	for	ADP
ahs-3074	169	8	the	the	DET
ahs-3074	169	9	first	first	ADJ
ahs-3074	169	10	time	time	NOUN
ahs-3074	169	11	,	,	PUNCT
ahs-3074	169	12	pnrsv	pnrsv	PROPN
ahs-3074	169	13	,	,	PUNCT
ahs-3074	169	14	apmv	apmv	ADV
ahs-3074	169	15	,	,	PUNCT
ahs-3074	169	16	and	and	CCONJ
ahs-3074	169	17	pdv	pdv	NOUN
ahs-3074	169	18	infected	infect	VERB
ahs-3074	169	19	plants	plant	NOUN
ahs-3074	169	20	in	in	ADP
ahs-3074	169	21	afghanistan	afghanistan	PROPN
ahs-3074	169	22	.	.	PUNCT
ahs-3074	170	1	even	even	ADV
ahs-3074	170	2	if	if	SCONJ
ahs-3074	170	3	the	the	DET
ahs-3074	170	4	latter	latter	ADJ
ahs-3074	170	5	two	two	NUM
ahs-3074	170	6	viruses	virus	NOUN
ahs-3074	170	7	were	be	AUX
ahs-3074	170	8	detected	detect	VERB
ahs-3074	170	9	by	by	ADP
ahs-3074	170	10	das	das	PROPN
ahs-3074	170	11	-	-	PUNCT
ahs-3074	170	12	elisa	elisa	NOUN
ahs-3074	170	13	test	test	NOUN
ahs-3074	170	14	,	,	PUNCT
ahs-3074	170	15	the	the	DET
ahs-3074	170	16	presence	presence	NOUN
ahs-3074	170	17	of	of	ADP
ahs-3074	170	18	the	the	DET
ahs-3074	170	19	viruses	virus	NOUN
ahs-3074	170	20	in	in	ADP
ahs-3074	170	21	accessions	accession	NOUN
ahs-3074	170	22	of	of	ADP
ahs-3074	170	23	the	the	DET
ahs-3074	170	24	national	national	ADJ
ahs-3074	170	25	collection	collection	NOUN
ahs-3074	170	26	field	field	NOUN
ahs-3074	170	27	is	be	AUX
ahs-3074	170	28	cause	cause	NOUN
ahs-3074	170	29	for	for	ADP
ahs-3074	170	30	worry	worry	NOUN
ahs-3074	170	31	for	for	ADP
ahs-3074	170	32	afghan	afghan	ADJ
ahs-3074	170	33	horticulture	horticulture	NOUN
ahs-3074	170	34	as	as	SCONJ
ahs-3074	170	35	all	all	DET
ahs-3074	170	36	three	three	NUM
ahs-3074	170	37	viruses	virus	NOUN
ahs-3074	170	38	spread	spread	VERB
ahs-3074	170	39	through	through	ADP
ahs-3074	170	40	infected	infected	ADJ
ahs-3074	170	41	propagating	propagating	NOUN
ahs-3074	170	42	material	material	NOUN
ahs-3074	170	43	and	and	CCONJ
ahs-3074	170	44	nursery	nursery	NOUN
ahs-3074	170	45	productions	production	NOUN
ahs-3074	170	46	(	(	PUNCT
ahs-3074	170	47	mink	mink	NOUN
ahs-3074	170	48	,	,	PUNCT
ahs-3074	170	49	1992	1992	NUM
ahs-3074	170	50	)	)	PUNCT
ahs-3074	170	51	.	.	PUNCT
ahs-3074	171	1	moreover	moreover	ADV
ahs-3074	171	2	,	,	PUNCT
ahs-3074	171	3	pnrsv	pnrsv	PROPN
ahs-3074	171	4	and	and	CCONJ
ahs-3074	171	5	pdv	pdv	NOUN
ahs-3074	171	6	are	be	AUX
ahs-3074	171	7	also	also	ADV
ahs-3074	171	8	seedand	seedand	VERB
ahs-3074	171	9	pollen	pollen	NOUN
ahs-3074	171	10	-	-	PUNCT
ahs-3074	171	11	transmitrehman	transmitrehman	NOUN
ahs-3074	171	12	et	et	PROPN
ahs-3074	171	13	al	al	PROPN
ahs-3074	171	14	.	.	PROPN
ahs-3074	171	15	phytosanitary	phytosanitary	PROPN
ahs-3074	171	16	status	status	NOUN
ahs-3074	171	17	of	of	ADP
ahs-3074	171	18	afghanistan	afghanistan	PROPN
ahs-3074	171	19	fruits	fruit	NOUN
ahs-3074	171	20	and	and	CCONJ
ahs-3074	171	21	nuts	nuts	ADJ
ahs-3074	171	22	collection	collection	NOUN
ahs-3074	171	23	.	.	PUNCT
ahs-3074	172	1	a	a	DET
ahs-3074	172	2	virus	virus	NOUN
ahs-3074	172	3	survay	survay	VERB
ahs-3074	172	4	247	247	NUM
ahs-3074	172	5	ted	te	VERB
ahs-3074	172	6	and	and	CCONJ
ahs-3074	172	7	can	can	AUX
ahs-3074	172	8	be	be	AUX
ahs-3074	172	9	spread	spread	VERB
ahs-3074	172	10	by	by	ADP
ahs-3074	172	11	pollinating	pollinate	VERB
ahs-3074	172	12	insects	insect	NOUN
ahs-3074	172	13	(	(	PUNCT
ahs-3074	172	14	kelley	kelley	PROPN
ahs-3074	172	15	and	and	CCONJ
ahs-3074	172	16	cameron	cameron	PROPN
ahs-3074	172	17	,	,	PUNCT
ahs-3074	172	18	1986	1986	NUM
ahs-3074	172	19	;	;	PUNCT
ahs-3074	172	20	aparicio	aparicio	PROPN
ahs-3074	172	21	et	et	PROPN
ahs-3074	172	22	al	al	PROPN
ahs-3074	172	23	.	.	PROPN
ahs-3074	172	24	,	,	PUNCT
ahs-3074	172	25	1999	1999	NUM
ahs-3074	172	26	;	;	PUNCT
ahs-3074	172	27	glasa	glasa	PROPN
ahs-3074	172	28	et	et	PROPN
ahs-3074	172	29	al	al	PROPN
ahs-3074	172	30	.	.	PROPN
ahs-3074	172	31	,	,	PUNCT
ahs-3074	172	32	2002	2002	NUM
ahs-3074	172	33	;	;	PUNCT
ahs-3074	172	34	amari	amari	PROPN
ahs-3074	172	35	et	et	PROPN
ahs-3074	172	36	al	al	PROPN
ahs-3074	172	37	.	.	PROPN
ahs-3074	172	38	,	,	PUNCT
ahs-3074	172	39	2007	2007	NUM
ahs-3074	172	40	)	)	PUNCT
ahs-3074	172	41	while	while	SCONJ
ahs-3074	172	42	seed	seed	NOUN
ahs-3074	172	43	transmission	transmission	NOUN
ahs-3074	172	44	of	of	ADP
ahs-3074	172	45	apmv	apmv	ADV
ahs-3074	172	46	is	be	AUX
ahs-3074	172	47	known	know	VERB
ahs-3074	172	48	only	only	ADV
ahs-3074	172	49	in	in	ADP
ahs-3074	172	50	hazelnuts	hazelnut	NOUN
ahs-3074	172	51	(	(	PUNCT
ahs-3074	172	52	cameron	cameron	PROPN
ahs-3074	172	53	and	and	CCONJ
ahs-3074	172	54	thompson	thompson	PROPN
ahs-3074	172	55	,	,	PUNCT
ahs-3074	172	56	1985	1985	NUM
ahs-3074	172	57	)	)	PUNCT
ahs-3074	172	58	.	.	PUNCT
ahs-3074	173	1	a	a	DET
ahs-3074	173	2	comparative	comparative	ADJ
ahs-3074	173	3	sequence	sequence	NOUN
ahs-3074	173	4	and	and	CCONJ
ahs-3074	173	5	phylogenetic	phylogenetic	ADJ
ahs-3074	173	6	analysis	analysis	NOUN
ahs-3074	173	7	will	will	AUX
ahs-3074	173	8	be	be	AUX
ahs-3074	173	9	performed	perform	VERB
ahs-3074	173	10	(	(	PUNCT
ahs-3074	173	11	zindović	zindović	NOUN
ahs-3074	173	12	et	et	PROPN
ahs-3074	173	13	al	al	PROPN
ahs-3074	173	14	.	.	PROPN
ahs-3074	173	15	,	,	PUNCT
ahs-3074	173	16	2015	2015	NUM
ahs-3074	173	17	)	)	PUNCT
ahs-3074	173	18	to	to	PART
ahs-3074	173	19	show	show	VERB
ahs-3074	173	20	if	if	SCONJ
ahs-3074	173	21	clustering	clustering	NOUN
ahs-3074	173	22	of	of	ADP
ahs-3074	173	23	various	various	ADJ
ahs-3074	173	24	isolates	isolate	NOUN
ahs-3074	173	25	is	be	AUX
ahs-3074	173	26	associated	associate	VERB
ahs-3074	173	27	or	or	CCONJ
ahs-3074	173	28	not	not	PART
ahs-3074	173	29	with	with	ADP
ahs-3074	173	30	geographic	geographic	ADJ
ahs-3074	173	31	and	and	CCONJ
ahs-3074	173	32	host	host	NOUN
ahs-3074	173	33	origin	origin	NOUN
ahs-3074	173	34	.	.	PUNCT
ahs-3074	174	1	regarding	regard	VERB
ahs-3074	174	2	the	the	DET
ahs-3074	174	3	detection	detection	NOUN
ahs-3074	174	4	of	of	ADP
ahs-3074	174	5	viruses	virus	NOUN
ahs-3074	174	6	in	in	ADP
ahs-3074	174	7	grape	grape	NOUN
ahs-3074	174	8	,	,	PUNCT
ahs-3074	174	9	according	accord	VERB
ahs-3074	174	10	to	to	ADP
ahs-3074	174	11	our	our	PRON
ahs-3074	174	12	results	result	NOUN
ahs-3074	174	13	the	the	DET
ahs-3074	174	14	presence	presence	NOUN
ahs-3074	174	15	in	in	ADP
ahs-3074	174	16	the	the	DET
ahs-3074	174	17	ncc	ncc	NOUN
ahs-3074	174	18	in	in	ADP
ahs-3074	174	19	kandahar	kandahar	PROPN
ahs-3074	174	20	of	of	ADP
ahs-3074	174	21	gva	gva	PROPN
ahs-3074	174	22	and	and	CCONJ
ahs-3074	174	23	glrav-1	glrav-1	PROPN
ahs-3074	174	24	,	,	PUNCT
ahs-3074	174	25	and	and	CCONJ
ahs-3074	174	26	glrav-3	glrav-3	NOUN
ahs-3074	174	27	in	in	ADP
ahs-3074	174	28	herat	herat	NOUN
ahs-3074	174	29	seems	seem	VERB
ahs-3074	174	30	to	to	PART
ahs-3074	174	31	be	be	AUX
ahs-3074	174	32	restricted	restrict	VERB
ahs-3074	174	33	to	to	ADP
ahs-3074	174	34	only	only	ADV
ahs-3074	174	35	a	a	DET
ahs-3074	174	36	few	few	ADJ
ahs-3074	174	37	accessions	accession	NOUN
ahs-3074	174	38	.	.	PUNCT
ahs-3074	175	1	early	early	ADJ
ahs-3074	175	2	detection	detection	NOUN
ahs-3074	175	3	of	of	ADP
ahs-3074	175	4	these	these	DET
ahs-3074	175	5	viruses	virus	NOUN
ahs-3074	175	6	by	by	ADP
ahs-3074	175	7	the	the	DET
ahs-3074	175	8	plant	plant	NOUN
ahs-3074	175	9	biotechnology	biotechnology	NOUN
ahs-3074	175	10	laboratory	laboratory	NOUN
ahs-3074	175	11	avoided	avoid	VERB
ahs-3074	175	12	multiplication	multiplication	NOUN
ahs-3074	175	13	and	and	CCONJ
ahs-3074	175	14	therefore	therefore	ADV
ahs-3074	175	15	the	the	DET
ahs-3074	175	16	spread	spread	NOUN
ahs-3074	175	17	of	of	ADP
ahs-3074	175	18	infected	infected	ADJ
ahs-3074	175	19	grape	grape	NOUN
ahs-3074	175	20	material	material	NOUN
ahs-3074	175	21	in	in	ADP
ahs-3074	175	22	afghanistan	afghanistan	PROPN
ahs-3074	175	23	.	.	PUNCT
ahs-3074	176	1	in	in	ADP
ahs-3074	176	2	contrast	contrast	NOUN
ahs-3074	176	3	,	,	PUNCT
ahs-3074	176	4	the	the	DET
ahs-3074	176	5	noticeable	noticeable	ADJ
ahs-3074	176	6	presence	presence	NOUN
ahs-3074	176	7	of	of	ADP
ahs-3074	176	8	gflv	gflv	NOUN
ahs-3074	176	9	(	(	PUNCT
ahs-3074	176	10	nearly	nearly	ADV
ahs-3074	176	11	7	7	NUM
ahs-3074	176	12	%	%	NOUN
ahs-3074	176	13	)	)	PUNCT
ahs-3074	176	14	in	in	ADP
ahs-3074	176	15	local	local	ADJ
ahs-3074	176	16	cultivars	cultivar	NOUN
ahs-3074	176	17	maintained	maintain	VERB
ahs-3074	176	18	at	at	ADP
ahs-3074	176	19	the	the	DET
ahs-3074	176	20	ncc	ncc	NOUN
ahs-3074	176	21	in	in	ADP
ahs-3074	176	22	herat	herat	PROPN
ahs-3074	176	23	suggests	suggest	VERB
ahs-3074	176	24	the	the	DET
ahs-3074	176	25	presence	presence	NOUN
ahs-3074	176	26	of	of	ADP
ahs-3074	176	27	the	the	DET
ahs-3074	176	28	virus	virus	NOUN
ahs-3074	176	29	in	in	ADP
ahs-3074	176	30	afghan	afghan	ADJ
ahs-3074	176	31	germplasm	germplasm	NOUN
ahs-3074	176	32	of	of	ADP
ahs-3074	176	33	grape	grape	NOUN
ahs-3074	176	34	for	for	ADP
ahs-3074	176	35	some	some	DET
ahs-3074	176	36	time	time	NOUN
ahs-3074	176	37	.	.	PUNCT
ahs-3074	177	1	this	this	DET
ahs-3074	177	2	hypothesis	hypothesis	NOUN
ahs-3074	177	3	should	should	AUX
ahs-3074	177	4	be	be	AUX
ahs-3074	177	5	confirmed	confirm	VERB
ahs-3074	177	6	by	by	ADP
ahs-3074	177	7	studying	study	VERB
ahs-3074	177	8	the	the	DET
ahs-3074	177	9	genetic	genetic	ADJ
ahs-3074	177	10	variability	variability	NOUN
ahs-3074	177	11	of	of	ADP
ahs-3074	177	12	afghan	afghan	ADJ
ahs-3074	177	13	isolates	isolate	NOUN
ahs-3074	177	14	in	in	ADP
ahs-3074	177	15	order	order	NOUN
ahs-3074	177	16	to	to	PART
ahs-3074	177	17	investigate	investigate	VERB
ahs-3074	177	18	the	the	DET
ahs-3074	177	19	relationship	relationship	NOUN
ahs-3074	177	20	among	among	ADP
ahs-3074	177	21	their	their	PRON
ahs-3074	177	22	geographical	geographical	ADJ
ahs-3074	177	23	origin	origin	NOUN
ahs-3074	177	24	,	,	PUNCT
ahs-3074	177	25	sequence	sequence	NOUN
ahs-3074	177	26	variability	variability	NOUN
ahs-3074	177	27	,	,	PUNCT
ahs-3074	177	28	and	and	CCONJ
ahs-3074	177	29	grapevine	grapevine	NOUN
ahs-3074	177	30	cultivar	cultivar	NOUN
ahs-3074	177	31	(	(	PUNCT
ahs-3074	177	32	meng	meng	PROPN
ahs-3074	177	33	et	et	PROPN
ahs-3074	177	34	al	al	PROPN
ahs-3074	177	35	.	.	PROPN
ahs-3074	177	36	,	,	PUNCT
ahs-3074	177	37	2006	2006	NUM
ahs-3074	177	38	;	;	PUNCT
ahs-3074	177	39	vigne	vigne	PROPN
ahs-3074	177	40	et	et	PROPN
ahs-3074	177	41	al	al	PROPN
ahs-3074	177	42	.	.	PROPN
ahs-3074	177	43	,	,	PUNCT
ahs-3074	177	44	2009	2009	NUM
ahs-3074	177	45	;	;	PUNCT
ahs-3074	177	46	terlizzi	terlizzi	PROPN
ahs-3074	177	47	et	et	PROPN
ahs-3074	177	48	al	al	PROPN
ahs-3074	177	49	.	.	PROPN
ahs-3074	177	50	,	,	PUNCT
ahs-3074	177	51	2015	2015	NUM
ahs-3074	177	52	)	)	PUNCT
ahs-3074	177	53	.	.	PUNCT
ahs-3074	178	1	finally	finally	ADV
ahs-3074	178	2	,	,	PUNCT
ahs-3074	178	3	our	our	PRON
ahs-3074	178	4	analyses	analysis	NOUN
ahs-3074	178	5	identified	identify	VERB
ahs-3074	178	6	,	,	PUNCT
ahs-3074	178	7	for	for	ADP
ahs-3074	178	8	the	the	DET
ahs-3074	178	9	first	first	ADJ
ahs-3074	178	10	time	time	NOUN
ahs-3074	178	11	,	,	PUNCT
ahs-3074	178	12	ctv	ctv	PROPN
ahs-3074	178	13	infected	infect	VERB
ahs-3074	178	14	plants	plant	NOUN
ahs-3074	178	15	in	in	ADP
ahs-3074	178	16	afghanistan	afghanistan	PROPN
ahs-3074	178	17	(	(	PUNCT
ahs-3074	178	18	rehman	rehman	NOUN
ahs-3074	178	19	et	et	PROPN
ahs-3074	178	20	al	al	PROPN
ahs-3074	178	21	.	.	PROPN
ahs-3074	178	22	,	,	PUNCT
ahs-3074	178	23	2012	2012	NUM
ahs-3074	178	24	)	)	PUNCT
ahs-3074	178	25	.	.	PUNCT
ahs-3074	179	1	the	the	DET
ahs-3074	179	2	presence	presence	NOUN
ahs-3074	179	3	of	of	ADP
ahs-3074	179	4	a	a	DET
ahs-3074	179	5	dangerous	dangerous	ADJ
ahs-3074	179	6	viral	viral	ADJ
ahs-3074	179	7	disease	disease	NOUN
ahs-3074	179	8	such	such	ADJ
ahs-3074	179	9	as	as	ADP
ahs-3074	179	10	ctv	ctv	NOUN
ahs-3074	179	11	in	in	ADP
ahs-3074	179	12	many	many	ADJ
ahs-3074	179	13	citrus	citrus	NOUN
ahs-3074	179	14	trees	tree	NOUN
ahs-3074	179	15	(	(	PUNCT
ahs-3074	179	16	nearly	nearly	ADV
ahs-3074	179	17	6	6	NUM
ahs-3074	179	18	%	%	NOUN
ahs-3074	179	19	of	of	ADP
ahs-3074	179	20	the	the	DET
ahs-3074	179	21	assayed	assayed	ADJ
ahs-3074	179	22	plants	plant	NOUN
ahs-3074	179	23	)	)	PUNCT
ahs-3074	179	24	from	from	ADP
ahs-3074	179	25	nccs	nccs	PROPN
ahs-3074	179	26	,	,	PUNCT
ahs-3074	179	27	msns	msns	NOUN
ahs-3074	179	28	and	and	CCONJ
ahs-3074	179	29	private	private	ADJ
ahs-3074	179	30	orchards	orchard	NOUN
ahs-3074	179	31	represents	represent	VERB
ahs-3074	179	32	a	a	DET
ahs-3074	179	33	serious	serious	ADJ
ahs-3074	179	34	problem	problem	NOUN
ahs-3074	179	35	for	for	ADP
ahs-3074	179	36	the	the	DET
ahs-3074	179	37	afghan	afghan	ADJ
ahs-3074	179	38	citrus	citrus	NOUN
ahs-3074	179	39	industry	industry	NOUN
ahs-3074	179	40	.	.	PUNCT
ahs-3074	180	1	high	high	ADJ
ahs-3074	180	2	sequence	sequence	NOUN
ahs-3074	180	3	identity	identity	NOUN
ahs-3074	180	4	with	with	ADP
ahs-3074	180	5	many	many	ADJ
ahs-3074	180	6	isolates	isolate	NOUN
ahs-3074	180	7	from	from	ADP
ahs-3074	180	8	usa	usa	PROPN
ahs-3074	180	9	,	,	PUNCT
ahs-3074	180	10	egypt	egypt	PROPN
ahs-3074	180	11	,	,	PUNCT
ahs-3074	180	12	croatia	croatia	PROPN
ahs-3074	180	13	,	,	PUNCT
ahs-3074	180	14	and	and	CCONJ
ahs-3074	180	15	argentina	argentina	PROPN
ahs-3074	180	16	together	together	ADV
ahs-3074	180	17	with	with	ADP
ahs-3074	180	18	the	the	DET
ahs-3074	180	19	large	large	ADJ
ahs-3074	180	20	spread	spread	NOUN
ahs-3074	180	21	of	of	ADP
ahs-3074	180	22	the	the	DET
ahs-3074	180	23	virus	virus	NOUN
ahs-3074	180	24	in	in	ADP
ahs-3074	180	25	afghan	afghan	ADJ
ahs-3074	180	26	citrus	citrus	NOUN
ahs-3074	180	27	-	-	PUNCT
ahs-3074	180	28	cultivating	cultivate	VERB
ahs-3074	180	29	areas	area	NOUN
ahs-3074	180	30	suggests	suggest	VERB
ahs-3074	180	31	the	the	DET
ahs-3074	180	32	introduction	introduction	NOUN
ahs-3074	180	33	of	of	ADP
ahs-3074	180	34	the	the	DET
ahs-3074	180	35	virus	virus	NOUN
ahs-3074	180	36	into	into	ADP
ahs-3074	180	37	the	the	DET
ahs-3074	180	38	country	country	NOUN
ahs-3074	180	39	a	a	DET
ahs-3074	180	40	long	long	ADJ
ahs-3074	180	41	time	time	NOUN
ahs-3074	180	42	ago	ago	ADV
ahs-3074	180	43	.	.	PUNCT
ahs-3074	181	1	the	the	DET
ahs-3074	181	2	presence	presence	NOUN
ahs-3074	181	3	of	of	ADP
ahs-3074	181	4	this	this	DET
ahs-3074	181	5	virus	virus	NOUN
ahs-3074	181	6	seems	seem	VERB
ahs-3074	181	7	to	to	PART
ahs-3074	181	8	be	be	AUX
ahs-3074	181	9	,	,	PUNCT
ahs-3074	181	10	therefore	therefore	ADV
ahs-3074	181	11	,	,	PUNCT
ahs-3074	181	12	endemic	endemic	ADJ
ahs-3074	181	13	;	;	PUNCT
ahs-3074	181	14	further	further	ADJ
ahs-3074	181	15	investigations	investigation	NOUN
ahs-3074	181	16	showed	show	VERB
ahs-3074	181	17	that	that	SCONJ
ahs-3074	181	18	infected	infected	ADJ
ahs-3074	181	19	plants	plant	NOUN
ahs-3074	181	20	did	do	AUX
ahs-3074	181	21	not	not	PART
ahs-3074	181	22	exhibit	exhibit	VERB
ahs-3074	181	23	quite	quite	ADV
ahs-3074	181	24	as	as	ADP
ahs-3074	181	25	dramatic	dramatic	ADJ
ahs-3074	181	26	symptoms	symptom	NOUN
ahs-3074	181	27	as	as	SCONJ
ahs-3074	181	28	those	those	PRON
ahs-3074	181	29	usually	usually	ADV
ahs-3074	181	30	found	find	VERB
ahs-3074	181	31	in	in	ADP
ahs-3074	181	32	other	other	ADJ
ahs-3074	181	33	citrus	citrus	NOUN
ahs-3074	181	34	cultivation	cultivation	NOUN
ahs-3074	181	35	areas	area	NOUN
ahs-3074	181	36	(	(	PUNCT
ahs-3074	181	37	e.g.	e.g.	ADV
ahs-3074	181	38	spain	spain	PROPN
ahs-3074	181	39	,	,	PUNCT
ahs-3074	181	40	brazil	brazil	PROPN
ahs-3074	181	41	,	,	PUNCT
ahs-3074	181	42	argentina	argentina	PROPN
ahs-3074	181	43	etc	etc	X
ahs-3074	181	44	.	.	PUNCT
ahs-3074	181	45	)	)	PUNCT
ahs-3074	181	46	where	where	SCONJ
ahs-3074	181	47	the	the	DET
ahs-3074	181	48	virus	virus	NOUN
ahs-3074	181	49	is	be	AUX
ahs-3074	181	50	extremely	extremely	ADV
ahs-3074	181	51	dangerous	dangerous	ADJ
ahs-3074	181	52	and	and	CCONJ
ahs-3074	181	53	causes	cause	VERB
ahs-3074	181	54	in	in	ADP
ahs-3074	181	55	some	some	DET
ahs-3074	181	56	cases	case	NOUN
ahs-3074	181	57	plants	plant	VERB
ahs-3074	181	58	death	death	NOUN
ahs-3074	181	59	(	(	PUNCT
ahs-3074	181	60	rochapeña	rochapeña	PROPN
ahs-3074	181	61	et	et	PROPN
ahs-3074	181	62	al	al	PROPN
ahs-3074	181	63	.	.	PROPN
ahs-3074	181	64	,	,	PUNCT
ahs-3074	181	65	1995	1995	NUM
ahs-3074	181	66	)	)	PUNCT
ahs-3074	181	67	.	.	PUNCT
ahs-3074	182	1	a	a	DET
ahs-3074	182	2	specific	specific	ADJ
ahs-3074	182	3	research	research	NOUN
ahs-3074	182	4	program	program	NOUN
ahs-3074	182	5	is	be	AUX
ahs-3074	182	6	in	in	ADP
ahs-3074	182	7	progress	progress	NOUN
ahs-3074	182	8	to	to	PART
ahs-3074	182	9	investigate	investigate	VERB
ahs-3074	182	10	if	if	SCONJ
ahs-3074	182	11	a	a	DET
ahs-3074	182	12	mild	mild	ADJ
ahs-3074	182	13	strain	strain	NOUN
ahs-3074	182	14	of	of	ADP
ahs-3074	182	15	ctv	ctv	PROPN
ahs-3074	182	16	is	be	AUX
ahs-3074	182	17	present	present	ADJ
ahs-3074	182	18	in	in	ADP
ahs-3074	182	19	the	the	DET
ahs-3074	182	20	eastern	eastern	ADJ
ahs-3074	182	21	region	region	NOUN
ahs-3074	182	22	(	(	PUNCT
ahs-3074	182	23	nangarhar	nangarhar	PROPN
ahs-3074	182	24	,	,	PUNCT
ahs-3074	182	25	kunar	kunar	PROPN
ahs-3074	182	26	,	,	PUNCT
ahs-3074	182	27	laghman	laghman	NOUN
ahs-3074	182	28	)	)	PUNCT
ahs-3074	182	29	environment	environment	NOUN
ahs-3074	182	30	,	,	PUNCT
ahs-3074	182	31	if	if	SCONJ
ahs-3074	182	32	tolerant	tolerant	ADV
ahs-3074	182	33	/	/	SYM
ahs-3074	182	34	resistant	resistant	ADJ
ahs-3074	182	35	sour	sour	ADJ
ahs-3074	182	36	orange	orange	NOUN
ahs-3074	182	37	rootstock	rootstock	NOUN
ahs-3074	182	38	clones	clone	NOUN
ahs-3074	182	39	exist	exist	VERB
ahs-3074	182	40	,	,	PUNCT
ahs-3074	182	41	or	or	CCONJ
ahs-3074	182	42	if	if	SCONJ
ahs-3074	182	43	the	the	DET
ahs-3074	182	44	environmental	environmental	ADJ
ahs-3074	182	45	(	(	PUNCT
ahs-3074	182	46	climate	climate	NOUN
ahs-3074	182	47	and	and	CCONJ
ahs-3074	182	48	soil	soil	NOUN
ahs-3074	182	49	conditions	condition	NOUN
ahs-3074	182	50	)	)	PUNCT
ahs-3074	182	51	influences	influence	VERB
ahs-3074	182	52	the	the	DET
ahs-3074	182	53	infectivity	infectivity	NOUN
ahs-3074	182	54	of	of	ADP
ahs-3074	182	55	ctv	ctv	PROPN
ahs-3074	182	56	.	.	PUNCT
ahs-3074	183	1	due	due	ADP
ahs-3074	183	2	to	to	ADP
ahs-3074	183	3	the	the	DET
ahs-3074	183	4	economic	economic	ADJ
ahs-3074	183	5	importance	importance	NOUN
ahs-3074	183	6	of	of	ADP
ahs-3074	183	7	these	these	DET
ahs-3074	183	8	crops	crop	NOUN
ahs-3074	183	9	,	,	PUNCT
ahs-3074	183	10	implementation	implementation	NOUN
ahs-3074	183	11	of	of	ADP
ahs-3074	183	12	the	the	DET
ahs-3074	183	13	certification	certification	NOUN
ahs-3074	183	14	schemes	scheme	NOUN
ahs-3074	183	15	is	be	AUX
ahs-3074	183	16	therefore	therefore	ADV
ahs-3074	183	17	necessary	necessary	ADJ
ahs-3074	183	18	in	in	ADP
ahs-3074	183	19	afghanistan	afghanistan	PROPN
ahs-3074	183	20	in	in	ADP
ahs-3074	183	21	order	order	NOUN
ahs-3074	183	22	to	to	PART
ahs-3074	183	23	guarantee	guarantee	VERB
ahs-3074	183	24	the	the	DET
ahs-3074	183	25	production	production	NOUN
ahs-3074	183	26	and	and	CCONJ
ahs-3074	183	27	employment	employment	NOUN
ahs-3074	183	28	of	of	ADP
ahs-3074	183	29	virus	virus	NOUN
ahs-3074	183	30	-	-	PUNCT
ahs-3074	183	31	free	free	ADJ
ahs-3074	183	32	propagating	propagating	NOUN
ahs-3074	183	33	material	material	NOUN
ahs-3074	183	34	.	.	PUNCT
ahs-3074	184	1	it	it	PRON
ahs-3074	184	2	is	be	AUX
ahs-3074	184	3	well	well	ADV
ahs-3074	184	4	known	know	VERB
ahs-3074	184	5	that	that	SCONJ
ahs-3074	184	6	data	datum	NOUN
ahs-3074	184	7	regarding	regard	VERB
ahs-3074	184	8	the	the	DET
ahs-3074	184	9	presence	presence	NOUN
ahs-3074	184	10	and	and	CCONJ
ahs-3074	184	11	spread	spread	VERB
ahs-3074	184	12	of	of	ADP
ahs-3074	184	13	different	different	ADJ
ahs-3074	184	14	plant	plant	NOUN
ahs-3074	184	15	viruses	virus	NOUN
ahs-3074	184	16	are	be	AUX
ahs-3074	184	17	important	important	ADJ
ahs-3074	184	18	for	for	ADP
ahs-3074	184	19	individual	individual	ADJ
ahs-3074	184	20	countries	country	NOUN
ahs-3074	184	21	,	,	PUNCT
ahs-3074	184	22	their	their	PRON
ahs-3074	184	23	neighbours	neighbour	NOUN
ahs-3074	184	24	,	,	PUNCT
ahs-3074	184	25	and	and	CCONJ
ahs-3074	184	26	for	for	ADP
ahs-3074	184	27	the	the	DET
ahs-3074	184	28	whole	whole	ADJ
ahs-3074	184	29	agricultural	agricultural	ADJ
ahs-3074	184	30	community	community	NOUN
ahs-3074	184	31	where	where	SCONJ
ahs-3074	184	32	different	different	ADJ
ahs-3074	184	33	viruses	virus	NOUN
ahs-3074	184	34	can	can	AUX
ahs-3074	184	35	be	be	AUX
ahs-3074	184	36	spread	spread	VERB
ahs-3074	184	37	by	by	ADP
ahs-3074	184	38	vegetative	vegetative	ADJ
ahs-3074	184	39	propagation	propagation	NOUN
ahs-3074	184	40	via	via	ADP
ahs-3074	184	41	plant	plant	NOUN
ahs-3074	184	42	material	material	NOUN
ahs-3074	184	43	.	.	PUNCT
ahs-3074	185	1	a	a	DET
ahs-3074	185	2	continuous	continuous	ADJ
ahs-3074	185	3	survey	survey	NOUN
ahs-3074	185	4	is	be	AUX
ahs-3074	185	5	therefore	therefore	ADV
ahs-3074	185	6	necessary	necessary	ADJ
ahs-3074	185	7	to	to	PART
ahs-3074	185	8	protect	protect	VERB
ahs-3074	185	9	afghanistan	afghanistan	PROPN
ahs-3074	185	10	from	from	ADP
ahs-3074	185	11	the	the	DET
ahs-3074	185	12	introduction	introduction	NOUN
ahs-3074	185	13	and/or	and/or	CCONJ
ahs-3074	185	14	spread	spread	VERB
ahs-3074	185	15	of	of	ADP
ahs-3074	185	16	dangerous	dangerous	ADJ
ahs-3074	185	17	pests	pest	NOUN
ahs-3074	185	18	.	.	PUNCT
ahs-3074	186	1	as	as	SCONJ
ahs-3074	186	2	previously	previously	ADV
ahs-3074	186	3	experienced	experience	VERB
ahs-3074	186	4	,	,	PUNCT
ahs-3074	186	5	most	most	ADV
ahs-3074	186	6	effective	effective	ADJ
ahs-3074	186	7	management	management	NOUN
ahs-3074	186	8	programs	program	NOUN
ahs-3074	186	9	require	require	VERB
ahs-3074	186	10	prompt	prompt	ADJ
ahs-3074	186	11	removal	removal	NOUN
ahs-3074	186	12	of	of	ADP
ahs-3074	186	13	infected	infected	ADJ
ahs-3074	186	14	trees	tree	NOUN
ahs-3074	186	15	and	and	CCONJ
ahs-3074	186	16	replacement	replacement	NOUN
ahs-3074	186	17	with	with	ADP
ahs-3074	186	18	healthy	healthy	ADJ
ahs-3074	186	19	planting	planting	NOUN
ahs-3074	186	20	material	material	NOUN
ahs-3074	186	21	from	from	ADP
ahs-3074	186	22	certified	certified	ADJ
ahs-3074	186	23	nurseries	nursery	NOUN
ahs-3074	186	24	(	(	PUNCT
ahs-3074	186	25	hadidi	hadidi	PROPN
ahs-3074	186	26	et	et	PROPN
ahs-3074	186	27	al	al	PROPN
ahs-3074	186	28	.	.	PROPN
ahs-3074	186	29	,	,	PUNCT
ahs-3074	186	30	2011	2011	NUM
ahs-3074	186	31	;	;	PUNCT
ahs-3074	186	32	pallas	pallas	PROPN
ahs-3074	186	33	et	et	PROPN
ahs-3074	186	34	al	al	PROPN
ahs-3074	186	35	.	.	PROPN
ahs-3074	186	36	,	,	PUNCT
ahs-3074	186	37	2012	2012	NUM
ahs-3074	186	38	)	)	PUNCT
ahs-3074	186	39	.	.	PUNCT
ahs-3074	187	1	establishment	establishment	NOUN
ahs-3074	187	2	of	of	ADP
ahs-3074	187	3	rigid	rigid	ADJ
ahs-3074	187	4	phytosanitary	phytosanitary	NOUN
ahs-3074	187	5	controls	control	NOUN
ahs-3074	187	6	related	relate	VERB
ahs-3074	187	7	to	to	ADP
ahs-3074	187	8	the	the	DET
ahs-3074	187	9	importation	importation	NOUN
ahs-3074	187	10	of	of	ADP
ahs-3074	187	11	propagation	propagation	NOUN
ahs-3074	187	12	material	material	NOUN
ahs-3074	187	13	,	,	PUNCT
ahs-3074	187	14	as	as	ADV
ahs-3074	187	15	well	well	ADV
ahs-3074	187	16	as	as	ADP
ahs-3074	187	17	the	the	DET
ahs-3074	187	18	eradication	eradication	NOUN
ahs-3074	187	19	of	of	ADP
ahs-3074	187	20	infected	infected	ADJ
ahs-3074	187	21	trees	tree	NOUN
ahs-3074	187	22	,	,	PUNCT
ahs-3074	187	23	is	be	AUX
ahs-3074	187	24	therefore	therefore	ADV
ahs-3074	187	25	of	of	ADP
ahs-3074	187	26	great	great	ADJ
ahs-3074	187	27	importance	importance	NOUN
ahs-3074	187	28	in	in	ADP
ahs-3074	187	29	afghanistan	afghanistan	PROPN
ahs-3074	187	30	.	.	PUNCT
ahs-3074	188	1	references	reference	NOUN
ahs-3074	188	2	amari	amari	PROPN
ahs-3074	188	3	k.	k.	PROPN
ahs-3074	188	4	,	,	PUNCT
ahs-3074	188	5	burgos	burgos	PROPN
ahs-3074	188	6	l.	l.	PROPN
ahs-3074	188	7	,	,	PUNCT
ahs-3074	188	8	pallás	pallás	PROPN
ahs-3074	188	9	v.	v.	PROPN
ahs-3074	188	10	,	,	PUNCT
ahs-3074	188	11	sánchez	sánchez	NOUN
ahs-3074	188	12	-	-	PUNCT
ahs-3074	188	13	pina	pina	PROPN
ahs-3074	188	14	m.a	m.a	PROPN
ahs-3074	188	15	.	.	PROPN
ahs-3074	188	16	,	,	PUNCT
ahs-3074	188	17	2007	2007	NUM
ahs-3074	188	18	prunus	prunus	NOUN
ahs-3074	188	19	necrotic	necrotic	ADJ
ahs-3074	188	20	ringspot	ringspot	NOUN
ahs-3074	188	21	virus	virus	NOUN
ahs-3074	188	22	early	early	ADJ
ahs-3074	188	23	invasion	invasion	NOUN
ahs-3074	188	24	and	and	CCONJ
ahs-3074	188	25	its	its	PRON
ahs-3074	188	26	effects	effect	NOUN
ahs-3074	188	27	on	on	ADP
ahs-3074	188	28	apricot	apricot	PROPN
ahs-3074	188	29	pollen	pollen	PROPN
ahs-3074	188	30	grain	grain	NOUN
ahs-3074	188	31	performance	performance	NOUN
ahs-3074	188	32	.	.	PUNCT
ahs-3074	189	1	phytopathology	phytopathology	NOUN
ahs-3074	189	2	,	,	PUNCT
ahs-3074	189	3	97	97	NUM
ahs-3074	189	4	:	:	SYM
ahs-3074	189	5	892	892	NUM
ahs-3074	189	6	-	-	SYM
ahs-3074	189	7	899	899	NUM
ahs-3074	189	8	.	.	PUNCT
ahs-3074	190	1	aparicio	aparicio	PROPN
ahs-3074	190	2	f.	f.	PROPN
ahs-3074	190	3	,	,	PUNCT
ahs-3074	190	4	sánchez	sánchez	NOUN
ahs-3074	190	5	-	-	PUNCT
ahs-3074	190	6	pina	pina	PROPN
ahs-3074	190	7	m.a	m.a	PROPN
ahs-3074	190	8	.	.	PROPN
ahs-3074	190	9	,	,	PUNCT
ahs-3074	190	10	sánchez	sánchez	PROPN
ahs-3074	190	11	-	-	PUNCT
ahs-3074	190	12	navarro	navarro	PROPN
ahs-3074	190	13	j.a	j.a	PROPN
ahs-3074	190	14	.	.	PROPN
ahs-3074	190	15	,	,	PUNCT
ahs-3074	190	16	pallás	pallás	PROPN
ahs-3074	191	1	v.	v.	PROPN
ahs-3074	191	2	,	,	PUNCT
ahs-3074	191	3	1999	1999	NUM
ahs-3074	191	4	location	location	NOUN
ahs-3074	191	5	of	of	ADP
ahs-3074	191	6	prunus	prunus	NOUN
ahs-3074	191	7	necrotic	necrotic	ADJ
ahs-3074	191	8	ringspot	ringspot	NOUN
ahs-3074	191	9	ilarvirus	ilarvirus	NOUN
ahs-3074	191	10	within	within	ADP
ahs-3074	191	11	pollen	pollen	NOUN
ahs-3074	191	12	grains	grain	NOUN
ahs-3074	191	13	of	of	ADP
ahs-3074	191	14	infected	infected	ADJ
ahs-3074	191	15	nectarine	nectarine	NOUN
ahs-3074	191	16	trees	tree	NOUN
ahs-3074	191	17	:	:	PUNCT
ahs-3074	191	18	evidence	evidence	NOUN
ahs-3074	191	19	from	from	ADP
ahs-3074	191	20	rt	rt	NOUN
ahs-3074	191	21	-	-	PUNCT
ahs-3074	191	22	pcr	pcr	ADJ
ahs-3074	191	23	,	,	PUNCT
ahs-3074	191	24	dot	dot	NOUN
ahs-3074	191	25	-	-	PUNCT
ahs-3074	191	26	blot	blot	NOUN
ahs-3074	191	27	and	and	CCONJ
ahs-3074	191	28	in	in	ADP
ahs-3074	191	29	situ	situ	ADJ
ahs-3074	191	30	hybridisation	hybridisation	NOUN
ahs-3074	191	31	.	.	PUNCT
ahs-3074	192	1	eur	eur	PROPN
ahs-3074	192	2	.	.	PUNCT
ahs-3074	193	1	j.	j.	PROPN
ahs-3074	193	2	plant	plant	PROPN
ahs-3074	193	3	pathol	pathol	PROPN
ahs-3074	193	4	.	.	PUNCT
ahs-3074	193	5	,	,	PUNCT
ahs-3074	193	6	105(6	105(6	NUM
ahs-3074	193	7	):	):	PUNCT
ahs-3074	193	8	623	623	NUM
ahs-3074	193	9	-	-	SYM
ahs-3074	193	10	627	627	NUM
ahs-3074	193	11	.	.	PUNCT
ahs-3074	194	1	barba	barba	PROPN
ahs-3074	194	2	m.	m.	PROPN
ahs-3074	194	3	,	,	PUNCT
ahs-3074	194	4	ilardi	ilardi	PROPN
ahs-3074	194	5	v.	v.	PROPN
ahs-3074	194	6	,	,	PUNCT
ahs-3074	194	7	pasquini	pasquini	NOUN
ahs-3074	194	8	g.	g.	PROPN
ahs-3074	194	9	,	,	PUNCT
ahs-3074	194	10	2015	2015	NUM
ahs-3074	194	11	control	control	NOUN
ahs-3074	194	12	of	of	ADP
ahs-3074	194	13	pome	pome	NOUN
ahs-3074	194	14	and	and	CCONJ
ahs-3074	194	15	stone	stone	NOUN
ahs-3074	194	16	fruit	fruit	NOUN
ahs-3074	194	17	virus	virus	NOUN
ahs-3074	194	18	diseases	disease	NOUN
ahs-3074	194	19	.	.	PUNCT
ahs-3074	195	1	adv	adv	PROPN
ahs-3074	195	2	.	.	PUNCT
ahs-3074	195	3	virus	virus	NOUN
ahs-3074	195	4	res	re	NOUN
ahs-3074	195	5	.	.	PROPN
ahs-3074	195	6	,	,	PUNCT
ahs-3074	195	7	91	91	NUM
ahs-3074	195	8	:	:	SYM
ahs-3074	195	9	4783	4783	NUM
ahs-3074	195	10	.	.	PUNCT
ahs-3074	196	1	cameron	cameron	PROPN
ahs-3074	196	2	h.r	h.r	PROPN
ahs-3074	196	3	.	.	PROPN
ahs-3074	196	4	,	,	PUNCT
ahs-3074	196	5	thompson	thompson	PROPN
ahs-3074	196	6	m.	m.	NOUN
ahs-3074	196	7	,	,	PUNCT
ahs-3074	196	8	1985	1985	NUM
ahs-3074	196	9	seed	seed	NOUN
ahs-3074	196	10	transmission	transmission	NOUN
ahs-3074	196	11	of	of	ADP
ahs-3074	196	12	apple	apple	NOUN
ahs-3074	196	13	mosaic	mosaic	ADJ
ahs-3074	196	14	virus	virus	NOUN
ahs-3074	196	15	in	in	ADP
ahs-3074	196	16	hazelnut	hazelnut	NOUN
ahs-3074	196	17	.	.	PUNCT
ahs-3074	197	1	acta	acta	PROPN
ahs-3074	197	2	horticulturae	horticulturae	PROPN
ahs-3074	197	3	,	,	PUNCT
ahs-3074	197	4	193	193	NUM
ahs-3074	197	5	:	:	SYM
ahs-3074	197	6	131	131	NUM
ahs-3074	197	7	-	-	SYM
ahs-3074	197	8	132	132	NUM
ahs-3074	197	9	.	.	PUNCT
ahs-3074	198	1	faggioli	faggioli	PROPN
ahs-3074	198	2	f.	f.	PROPN
ahs-3074	198	3	,	,	PUNCT
ahs-3074	198	4	anaclerio	anaclerio	PROPN
ahs-3074	198	5	f.	f.	PROPN
ahs-3074	198	6	,	,	PUNCT
ahs-3074	198	7	angelini	angelini	PROPN
ahs-3074	198	8	e.	e.	PROPN
ahs-3074	198	9	,	,	PUNCT
ahs-3074	198	10	antonelli	antonelli	PROPN
ahs-3074	198	11	m.g	m.g	PROPN
ahs-3074	198	12	.	.	PROPN
ahs-3074	198	13	,	,	PUNCT
ahs-3074	198	14	bertazzon	bertazzon	VERB
ahs-3074	198	15	n.	n.	NOUN
ahs-3074	198	16	,	,	PUNCT
ahs-3074	198	17	2013	2013	NUM
ahs-3074	198	18	harmonization	harmonization	NOUN
ahs-3074	198	19	and	and	CCONJ
ahs-3074	198	20	validation	validation	NOUN
ahs-3074	198	21	of	of	ADP
ahs-3074	198	22	diagnostic	diagnostic	ADJ
ahs-3074	198	23	protocols	protocol	NOUN
ahs-3074	198	24	for	for	ADP
ahs-3074	198	25	the	the	DET
ahs-3074	198	26	detection	detection	NOUN
ahs-3074	198	27	of	of	ADP
ahs-3074	198	28	grapevine	grapevine	NOUN
ahs-3074	198	29	viruses	virus	NOUN
ahs-3074	198	30	covered	cover	VERB
ahs-3074	198	31	by	by	ADP
ahs-3074	198	32	phytosanitary	phytosanitary	NOUN
ahs-3074	198	33	rules	rule	NOUN
ahs-3074	198	34	.	.	PUNCT
ahs-3074	199	1	adv	adv	PROPN
ahs-3074	199	2	.	.	PUNCT
ahs-3074	199	3	hort	hort	PROPN
ahs-3074	199	4	.	.	PUNCT
ahs-3074	200	1	sci	sci	PROPN
ahs-3074	200	2	.	.	PROPN
ahs-3074	200	3	,	,	PUNCT
ahs-3074	200	4	27(3	27(3	NUM
ahs-3074	200	5	):	):	PUNCT
ahs-3074	200	6	107	107	NUM
ahs-3074	200	7	-	-	SYM
ahs-3074	200	8	108	108	NUM
ahs-3074	200	9	.	.	PUNCT
ahs-3074	201	1	gambino	gambino	PROPN
ahs-3074	201	2	g.	g.	PROPN
ahs-3074	201	3	,	,	PUNCT
ahs-3074	201	4	gribaudo	gribaudo	NOUN
ahs-3074	201	5	i.	i.	PROPN
ahs-3074	201	6	,	,	PUNCT
ahs-3074	201	7	2006	2006	NUM
ahs-3074	201	8	simultaneous	simultaneous	ADJ
ahs-3074	201	9	detection	detection	NOUN
ahs-3074	201	10	of	of	ADP
ahs-3074	201	11	nine	nine	NUM
ahs-3074	201	12	grapevine	grapevine	NOUN
ahs-3074	201	13	viruses	virus	NOUN
ahs-3074	201	14	by	by	ADP
ahs-3074	201	15	multiplex	multiplex	PROPN
ahs-3074	201	16	rt	rt	PROPN
ahs-3074	201	17	-	-	PUNCT
ahs-3074	201	18	pcr	pcr	PROPN
ahs-3074	201	19	with	with	ADP
ahs-3074	201	20	coamplification	coamplification	NOUN
ahs-3074	201	21	of	of	ADP
ahs-3074	201	22	a	a	DET
ahs-3074	201	23	plant	plant	NOUN
ahs-3074	201	24	rna	rna	NOUN
ahs-3074	201	25	internal	internal	ADJ
ahs-3074	201	26	control	control	NOUN
ahs-3074	201	27	.	.	PUNCT
ahs-3074	202	1	phytopathology	phytopathology	NOUN
ahs-3074	202	2	,	,	PUNCT
ahs-3074	202	3	96	96	NUM
ahs-3074	202	4	:	:	SYM
ahs-3074	202	5	1223	1223	NUM
ahs-3074	202	6	-	-	SYM
ahs-3074	202	7	1229	1229	NUM
ahs-3074	202	8	.	.	PUNCT
ahs-3074	203	1	glasa	glasa	PROPN
ahs-3074	203	2	m.	m.	PROPN
ahs-3074	203	3	,	,	PUNCT
ahs-3074	203	4	betinova	betinova	PROPN
ahs-3074	203	5	e.	e.	PROPN
ahs-3074	203	6	,	,	PUNCT
ahs-3074	203	7	kudela	kudela	PROPN
ahs-3074	203	8	o.	o.	PROPN
ahs-3074	203	9	,	,	PUNCT
ahs-3074	203	10	subr	subr	PROPN
ahs-3074	203	11	z.	z.	PROPN
ahs-3074	203	12	,	,	PUNCT
ahs-3074	203	13	2002	2002	NUM
ahs-3074	203	14	biological	biological	ADJ
ahs-3074	203	15	and	and	CCONJ
ahs-3074	203	16	molecular	molecular	ADJ
ahs-3074	203	17	characterization	characterization	NOUN
ahs-3074	203	18	of	of	ADP
ahs-3074	203	19	prunus	prunus	NOUN
ahs-3074	203	20	necrotic	necrotic	ADJ
ahs-3074	203	21	ringspot	ringspot	NOUN
ahs-3074	203	22	virus	virus	NOUN
ahs-3074	203	23	isolates	isolate	NOUN
ahs-3074	203	24	and	and	CCONJ
ahs-3074	203	25	possible	possible	ADJ
ahs-3074	203	26	approaches	approach	NOUN
ahs-3074	203	27	to	to	ADP
ahs-3074	203	28	their	their	PRON
ahs-3074	203	29	phylogenetic	phylogenetic	ADJ
ahs-3074	203	30	typing	typing	NOUN
ahs-3074	203	31	.	.	PUNCT
ahs-3074	204	1	ann	ann	PROPN
ahs-3074	204	2	.	.	PUNCT
ahs-3074	204	3	appl	appl	PROPN
ahs-3074	204	4	.	.	PUNCT
ahs-3074	205	1	biol	biol	PROPN
ahs-3074	205	2	.	.	PUNCT
ahs-3074	205	3	,	,	PUNCT
ahs-3074	205	4	140	140	NUM
ahs-3074	205	5	:	:	SYM
ahs-3074	205	6	279	279	NUM
ahs-3074	205	7	-	-	SYM
ahs-3074	205	8	283	283	NUM
ahs-3074	205	9	.	.	PUNCT
ahs-3074	206	1	golino	golino	PROPN
ahs-3074	206	2	d.a	d.a	PROPN
ahs-3074	206	3	.	.	PROPN
ahs-3074	206	4	,	,	PUNCT
ahs-3074	206	5	savino	savino	PROPN
ahs-3074	206	6	v.	v.	PROPN
ahs-3074	206	7	,	,	PUNCT
ahs-3074	206	8	2005	2005	NUM
ahs-3074	206	9	certification	certification	NOUN
ahs-3074	206	10	and	and	CCONJ
ahs-3074	206	11	international	international	ADJ
ahs-3074	206	12	regulation	regulation	NOUN
ahs-3074	206	13	of	of	ADP
ahs-3074	206	14	planting	planting	NOUN
ahs-3074	206	15	material	material	NOUN
ahs-3074	206	16	,	,	PUNCT
ahs-3074	206	17	177	177	NUM
ahs-3074	206	18	-	-	SYM
ahs-3074	206	19	198	198	NUM
ahs-3074	206	20	.	.	PUNCT
ahs-3074	207	1	in	in	ADP
ahs-3074	207	2	:	:	PUNCT
ahs-3074	207	3	wilcox	wilcox	PROPN
ahs-3074	207	4	w.f	w.f	PROPN
ahs-3074	207	5	.	.	PROPN
ahs-3074	207	6	,	,	PUNCT
ahs-3074	207	7	w.g	w.g	PROPN
ahs-3074	207	8	.	.	PROPN
ahs-3074	207	9	gubler	gubler	PROPN
ahs-3074	207	10	,	,	PUNCT
ahs-3074	207	11	and	and	CCONJ
ahs-3074	207	12	j.k	j.k	PROPN
ahs-3074	207	13	.	.	PROPN
ahs-3074	207	14	uyemoto	uyemoto	PROPN
ahs-3074	207	15	(	(	PUNCT
ahs-3074	207	16	eds	ed	NOUN
ahs-3074	207	17	.	.	PUNCT
ahs-3074	207	18	)	)	PUNCT
ahs-3074	207	19	compendium	compendium	NOUN
ahs-3074	207	20	of	of	ADP
ahs-3074	207	21	grape	grape	NOUN
ahs-3074	207	22	diseases	disease	NOUN
ahs-3074	207	23	.	.	PUNCT
ahs-3074	208	1	aps	aps	PROPN
ahs-3074	208	2	press	press	PROPN
ahs-3074	208	3	,	,	PUNCT
ahs-3074	208	4	st	st	PROPN
ahs-3074	208	5	.	.	PROPN
ahs-3074	208	6	paul	paul	PROPN
ahs-3074	208	7	,	,	PUNCT
ahs-3074	208	8	adv	adv	PROPN
ahs-3074	208	9	.	.	PUNCT
ahs-3074	208	10	hort	hort	PROPN
ahs-3074	208	11	.	.	PUNCT
ahs-3074	209	1	sci	sci	PROPN
ahs-3074	209	2	.	.	PROPN
ahs-3074	209	3	,	,	PUNCT
ahs-3074	209	4	2016	2016	NUM
ahs-3074	209	5	30(3	30(3	NOUN
ahs-3074	209	6	):	):	PUNCT
ahs-3074	209	7	239	239	NUM
ahs-3074	209	8	-	-	SYM
ahs-3074	209	9	248	248	NUM
ahs-3074	209	10	248	248	NUM
ahs-3074	209	11	mn	mn	PROPN
ahs-3074	209	12	,	,	PUNCT
ahs-3074	209	13	usa	usa	PROPN
ahs-3074	209	14	,	,	PUNCT
ahs-3074	209	15	pp	pp	X
ahs-3074	209	16	.	.	PUNCT
ahs-3074	210	1	232	232	X
ahs-3074	210	2	.	.	PUNCT
ahs-3074	211	1	goszczynski	goszczynski	PROPN
ahs-3074	211	2	d.e	d.e	PROPN
ahs-3074	211	3	.	.	PROPN
ahs-3074	211	4	,	,	PUNCT
ahs-3074	211	5	jooste	jooste	PROPN
ahs-3074	211	6	a.e.c	a.e.c	PROPN
ahs-3074	211	7	.	.	PROPN
ahs-3074	211	8	,	,	PUNCT
ahs-3074	211	9	2003	2003	NUM
ahs-3074	211	10	identification	identification	NOUN
ahs-3074	211	11	of	of	ADP
ahs-3074	211	12	divergent	divergent	ADJ
ahs-3074	211	13	variants	variant	NOUN
ahs-3074	211	14	of	of	ADP
ahs-3074	211	15	grapevine	grapevine	NOUN
ahs-3074	211	16	virus	virus	NOUN
ahs-3074	211	17	a.	a.	PROPN
ahs-3074	211	18	eur	eur	PROPN
ahs-3074	211	19	.	.	PUNCT
ahs-3074	212	1	j.	j.	PROPN
ahs-3074	212	2	plant	plant	PROPN
ahs-3074	212	3	pathol	pathol	PROPN
ahs-3074	212	4	.	.	PUNCT
ahs-3074	212	5	,	,	PUNCT
ahs-3074	212	6	109(4	109(4	NUM
ahs-3074	212	7	):	):	PUNCT
ahs-3074	212	8	397	397	NUM
ahs-3074	212	9	-	-	SYM
ahs-3074	212	10	403	403	NUM
ahs-3074	212	11	.	.	PUNCT
ahs-3074	213	1	hadidi	hadidi	PROPN
ahs-3074	213	2	a.	a.	PROPN
ahs-3074	213	3	,	,	PUNCT
ahs-3074	213	4	barba	barba	PROPN
ahs-3074	213	5	m.	m.	NOUN
ahs-3074	213	6	,	,	PUNCT
ahs-3074	213	7	candresse	candresse	PROPN
ahs-3074	213	8	t.	t.	PROPN
ahs-3074	213	9	,	,	PUNCT
ahs-3074	213	10	jelkmann	jelkmann	PROPN
ahs-3074	213	11	w.	w.	PROPN
ahs-3074	213	12	,	,	PUNCT
ahs-3074	213	13	2011	2011	NUM
ahs-3074	213	14	virus	virus	NOUN
ahs-3074	213	15	and	and	CCONJ
ahs-3074	213	16	virus	virus	NOUN
ahs-3074	213	17	-	-	PUNCT
ahs-3074	213	18	like	like	ADJ
ahs-3074	213	19	diseases	disease	NOUN
ahs-3074	213	20	of	of	ADP
ahs-3074	213	21	pome	pome	NOUN
ahs-3074	213	22	and	and	CCONJ
ahs-3074	213	23	stone	stone	NOUN
ahs-3074	213	24	fruits	fruit	NOUN
ahs-3074	213	25	.	.	PUNCT
ahs-3074	214	1	aps	aps	PROPN
ahs-3074	214	2	press	press	PROPN
ahs-3074	214	3	,	,	PUNCT
ahs-3074	214	4	st	st	PROPN
ahs-3074	214	5	.	.	PROPN
ahs-3074	214	6	paul	paul	PROPN
ahs-3074	214	7	,	,	PUNCT
ahs-3074	214	8	mn	mn	PROPN
ahs-3074	214	9	,	,	PUNCT
ahs-3074	214	10	usa	usa	PROPN
ahs-3074	214	11	,	,	PUNCT
ahs-3074	214	12	pp	pp	X
ahs-3074	214	13	.	.	PUNCT
ahs-3074	215	1	428	428	X
ahs-3074	215	2	.	.	PUNCT
ahs-3074	216	1	kelley	kelley	PROPN
ahs-3074	216	2	r.d	r.d	PROPN
ahs-3074	216	3	.	.	PROPN
ahs-3074	216	4	,	,	PUNCT
ahs-3074	216	5	cameron	cameron	PROPN
ahs-3074	216	6	h.r	h.r	PROPN
ahs-3074	216	7	.	.	PROPN
ahs-3074	216	8	,	,	PUNCT
ahs-3074	216	9	1986	1986	NUM
ahs-3074	216	10	location	location	NOUN
ahs-3074	216	11	of	of	ADP
ahs-3074	216	12	prune	prune	NOUN
ahs-3074	216	13	dwarf	dwarf	NOUN
ahs-3074	216	14	and	and	CCONJ
ahs-3074	216	15	prunus	prunus	NOUN
ahs-3074	216	16	necrotic	necrotic	ADJ
ahs-3074	216	17	rings	ring	NOUN
ahs-3074	216	18	spot	spot	NOUN
ahs-3074	216	19	viruses	virus	NOUN
ahs-3074	216	20	associated	associate	VERB
ahs-3074	216	21	with	with	ADP
ahs-3074	216	22	sweet	sweet	ADJ
ahs-3074	216	23	cherry	cherry	NOUN
ahs-3074	216	24	pollen	pollen	NOUN
ahs-3074	216	25	and	and	CCONJ
ahs-3074	216	26	seed	seed	NOUN
ahs-3074	216	27	.	.	PUNCT
ahs-3074	217	1	phytopathology	phytopathology	NOUN
ahs-3074	217	2	,	,	PUNCT
ahs-3074	217	3	76	76	NUM
ahs-3074	217	4	:	:	PUNCT
ahs-3074	217	5	317	317	NUM
ahs-3074	217	6	-	-	SYM
ahs-3074	217	7	322	322	NUM
ahs-3074	217	8	.	.	PUNCT
ahs-3074	218	1	martelli	martelli	PROPN
ahs-3074	218	2	g.p	g.p	PROPN
ahs-3074	218	3	.	.	PROPN
ahs-3074	218	4	,	,	PUNCT
ahs-3074	218	5	2014	2014	NUM
ahs-3074	218	6	directory	directory	NOUN
ahs-3074	218	7	of	of	ADP
ahs-3074	218	8	virus	virus	NOUN
ahs-3074	218	9	and	and	CCONJ
ahs-3074	218	10	virus	virus	NOUN
ahs-3074	218	11	-	-	PUNCT
ahs-3074	218	12	like	like	ADJ
ahs-3074	218	13	diseases	disease	NOUN
ahs-3074	218	14	of	of	ADP
ahs-3074	218	15	the	the	DET
ahs-3074	218	16	grapevine	grapevine	NOUN
ahs-3074	218	17	and	and	CCONJ
ahs-3074	218	18	their	their	PRON
ahs-3074	218	19	agents	agent	NOUN
ahs-3074	218	20	.	.	PUNCT
ahs-3074	219	1	j.	j.	PROPN
ahs-3074	219	2	plant	plant	PROPN
ahs-3074	219	3	pathol	pathol	PROPN
ahs-3074	219	4	.	.	PUNCT
ahs-3074	219	5	,	,	PUNCT
ahs-3074	219	6	96(1	96(1	NUM
ahs-3074	219	7	sup	sup	NOUN
ahs-3074	219	8	):	):	PUNCT
ahs-3074	219	9	1	1	NUM
ahs-3074	219	10	-	-	SYM
ahs-3074	219	11	136	136	NUM
ahs-3074	219	12	.	.	PUNCT
ahs-3074	220	1	meng	meng	PROPN
ahs-3074	220	2	b.	b.	PROPN
ahs-3074	220	3	,	,	PUNCT
ahs-3074	220	4	rebelo	rebelo	PROPN
ahs-3074	220	5	a.r	a.r	PROPN
ahs-3074	220	6	.	.	PROPN
ahs-3074	220	7	,	,	PUNCT
ahs-3074	220	8	fisher	fisher	PROPN
ahs-3074	220	9	h.	h.	PROPN
ahs-3074	220	10	,	,	PUNCT
ahs-3074	220	11	2006	2006	NUM
ahs-3074	220	12	genetic	genetic	ADJ
ahs-3074	220	13	diversity	diversity	NOUN
ahs-3074	220	14	analyses	analysis	NOUN
ahs-3074	220	15	of	of	ADP
ahs-3074	220	16	grapevine	grapevine	NOUN
ahs-3074	220	17	rupestris	rupestris	PROPN
ahs-3074	220	18	stem	stem	NOUN
ahs-3074	220	19	pitting	pitting	NOUN
ahs-3074	220	20	-	-	PUNCT
ahs-3074	220	21	associated	associate	VERB
ahs-3074	220	22	virus	virus	NOUN
ahs-3074	220	23	reveal	reveal	VERB
ahs-3074	220	24	distinct	distinct	ADJ
ahs-3074	220	25	population	population	NOUN
ahs-3074	220	26	structures	structure	NOUN
ahs-3074	220	27	in	in	ADP
ahs-3074	220	28	scion	scion	NOUN
ahs-3074	220	29	versus	versus	ADP
ahs-3074	220	30	rootstock	rootstock	NOUN
ahs-3074	220	31	varieties	variety	NOUN
ahs-3074	220	32	.	.	PUNCT
ahs-3074	221	1	j.	j.	PROPN
ahs-3074	221	2	gen.virol	gen.virol	PROPN
ahs-3074	221	3	.	.	PROPN
ahs-3074	221	4	,	,	PUNCT
ahs-3074	221	5	87	87	NUM
ahs-3074	221	6	:	:	SYM
ahs-3074	221	7	1725	1725	NUM
ahs-3074	221	8	-	-	SYM
ahs-3074	221	9	1733	1733	NUM
ahs-3074	221	10	.	.	PUNCT
ahs-3074	222	1	menzel	menzel	PROPN
ahs-3074	222	2	w.	w.	PROPN
ahs-3074	222	3	,	,	PUNCT
ahs-3074	222	4	jelkmann	jelkmann	PROPN
ahs-3074	222	5	w.	w.	PROPN
ahs-3074	222	6	,	,	PUNCT
ahs-3074	222	7	maiss	maiss	PROPN
ahs-3074	222	8	e.	e.	PROPN
ahs-3074	222	9	,	,	PUNCT
ahs-3074	222	10	2002	2002	NUM
ahs-3074	222	11	detection	detection	NOUN
ahs-3074	222	12	of	of	ADP
ahs-3074	222	13	four	four	NUM
ahs-3074	222	14	apple	apple	NOUN
ahs-3074	222	15	viruses	virus	NOUN
ahs-3074	222	16	by	by	ADP
ahs-3074	222	17	multiplex	multiplex	PROPN
ahs-3074	222	18	rt	rt	PROPN
ahs-3074	222	19	-	-	PUNCT
ahs-3074	222	20	pcr	pcr	ADJ
ahs-3074	222	21	assays	assay	NOUN
ahs-3074	222	22	with	with	ADP
ahs-3074	222	23	coamplification	coamplification	NOUN
ahs-3074	222	24	of	of	ADP
ahs-3074	222	25	plant	plant	NOUN
ahs-3074	222	26	mrna	mrna	PROPN
ahs-3074	222	27	as	as	ADP
ahs-3074	222	28	internal	internal	ADJ
ahs-3074	222	29	control	control	NOUN
ahs-3074	222	30	.	.	PUNCT
ahs-3074	223	1	j.	j.	PROPN
ahs-3074	223	2	virol	virol	PROPN
ahs-3074	223	3	.	.	PUNCT
ahs-3074	224	1	methods	method	NOUN
ahs-3074	224	2	,	,	PUNCT
ahs-3074	224	3	99	99	NUM
ahs-3074	224	4	:	:	SYM
ahs-3074	224	5	81	81	NUM
ahs-3074	224	6	-	-	SYM
ahs-3074	224	7	92	92	NUM
ahs-3074	224	8	.	.	PUNCT
ahs-3074	225	1	mink	mink	PROPN
ahs-3074	225	2	g.i	g.i	PROPN
ahs-3074	225	3	.	.	PROPN
ahs-3074	225	4	,	,	PUNCT
ahs-3074	225	5	199	199	NUM
ahs-3074	225	6	ilarvirus	ilarvirus	NOUN
ahs-3074	225	7	vectors	vector	NOUN
ahs-3074	225	8	.	.	PUNCT
ahs-3074	226	1	adv	adv	PROPN
ahs-3074	226	2	.	.	PUNCT
ahs-3074	227	1	dis	dis	PROPN
ahs-3074	227	2	.	.	PUNCT
ahs-3074	228	1	vector	vector	NOUN
ahs-3074	228	2	res	re	NOUN
ahs-3074	228	3	.	.	PUNCT
ahs-3074	228	4	,	,	PUNCT
ahs-3074	228	5	9	9	NUM
ahs-3074	228	6	:	:	SYM
ahs-3074	228	7	261	261	NUM
ahs-3074	228	8	-	-	SYM
ahs-3074	228	9	281	281	NUM
ahs-3074	228	10	.	.	PUNCT
ahs-3074	229	1	osman	osman	PROPN
ahs-3074	229	2	f.	f.	PROPN
ahs-3074	229	3	,	,	PUNCT
ahs-3074	229	4	leutenegger	leutenegger	PROPN
ahs-3074	229	5	c.	c.	PROPN
ahs-3074	229	6	,	,	PUNCT
ahs-3074	229	7	golino	golino	PROPN
ahs-3074	229	8	d.	d.	PROPN
ahs-3074	229	9	,	,	PUNCT
ahs-3074	229	10	rowhani	rowhani	PROPN
ahs-3074	229	11	a.	a.	PROPN
ahs-3074	229	12	,	,	PUNCT
ahs-3074	229	13	2008	2008	NUM
ahs-3074	229	14	comparison	comparison	NOUN
ahs-3074	229	15	of	of	ADP
ahs-3074	229	16	low	low	ADJ
ahs-3074	229	17	-	-	PUNCT
ahs-3074	229	18	density	density	NOUN
ahs-3074	229	19	arrays	array	VERB
ahs-3074	229	20	,	,	PUNCT
ahs-3074	229	21	rt	rt	ADJ
ahs-3074	229	22	-	-	PUNCT
ahs-3074	229	23	pcr	pcr	ADJ
ahs-3074	229	24	and	and	CCONJ
ahs-3074	229	25	real	real	ADJ
ahs-3074	229	26	-	-	PUNCT
ahs-3074	229	27	time	time	NOUN
ahs-3074	229	28	taqman	taqman	NOUN
ahs-3074	229	29	®	®	NOUN
ahs-3074	229	30	rt	rt	PROPN
ahs-3074	229	31	-	-	PUNCT
ahs-3074	229	32	pcr	pcr	NOUN
ahs-3074	229	33	in	in	ADP
ahs-3074	229	34	detection	detection	NOUN
ahs-3074	229	35	of	of	ADP
ahs-3074	229	36	grapevine	grapevine	NOUN
ahs-3074	229	37	viruses	virus	NOUN
ahs-3074	229	38	.	.	PUNCT
ahs-3074	230	1	j.	j.	PROPN
ahs-3074	230	2	virol	virol	PROPN
ahs-3074	230	3	.	.	PUNCT
ahs-3074	231	1	methods	method	NOUN
ahs-3074	231	2	,	,	PUNCT
ahs-3074	231	3	149(2	149(2	NUM
ahs-3074	231	4	):	):	PUNCT
ahs-3074	231	5	292	292	NUM
ahs-3074	231	6	-	-	SYM
ahs-3074	231	7	299	299	NUM
ahs-3074	231	8	.	.	PUNCT
ahs-3074	232	1	pallas	pallas	PROPN
ahs-3074	232	2	v.	v.	PROPN
ahs-3074	232	3	,	,	PUNCT
ahs-3074	232	4	aparicio	aparicio	PROPN
ahs-3074	232	5	f.	f.	PROPN
ahs-3074	232	6	,	,	PUNCT
ahs-3074	232	7	herranz	herranz	PROPN
ahs-3074	232	8	k.	k.	PROPN
ahs-3074	232	9	,	,	PUNCT
ahs-3074	232	10	amari	amari	PROPN
ahs-3074	232	11	k.	k.	PROPN
ahs-3074	232	12	,	,	PUNCT
ahs-3074	232	13	sanchezpina	sanchezpina	PROPN
ahs-3074	232	14	m.a	m.a	PROPN
ahs-3074	232	15	.	.	PROPN
ahs-3074	232	16	,	,	PUNCT
ahs-3074	232	17	myrta	myrta	PROPN
ahs-3074	232	18	a.	a.	PROPN
ahs-3074	232	19	,	,	PUNCT
ahs-3074	232	20	sanchez	sanchez	PROPN
ahs-3074	232	21	-	-	PUNCT
ahs-3074	232	22	navarro	navarro	PROPN
ahs-3074	232	23	2012	2012	NUM
ahs-3074	232	24	ilarviruses	ilarviruse	NOUN
ahs-3074	232	25	of	of	ADP
ahs-3074	232	26	prunus	prunus	NOUN
ahs-3074	232	27	spp	spp	NOUN
ahs-3074	232	28	.	.	PUNCT
ahs-3074	232	29	:	:	PUNCT
ahs-3074	233	1	a	a	DET
ahs-3074	233	2	continued	continued	ADJ
ahs-3074	233	3	concern	concern	NOUN
ahs-3074	233	4	for	for	ADP
ahs-3074	233	5	fruit	fruit	NOUN
ahs-3074	233	6	trees	tree	NOUN
ahs-3074	233	7	.	.	PUNCT
ahs-3074	234	1	phytopathology	phytopathology	NOUN
ahs-3074	234	2	,	,	PUNCT
ahs-3074	234	3	102	102	NUM
ahs-3074	234	4	,	,	PUNCT
ahs-3074	234	5	1108	1108	NUM
ahs-3074	234	6	-	-	SYM
ahs-3074	234	7	1120	1120	NUM
ahs-3074	234	8	.	.	PUNCT
ahs-3074	235	1	parakh	parakh	PROPN
ahs-3074	235	2	d.r	d.r	PROPN
ahs-3074	235	3	.	.	PROPN
ahs-3074	235	4	,	,	PUNCT
ahs-3074	235	5	shamloul	shamloul	PROPN
ahs-3074	235	6	a.m.	a.m.	PROPN
ahs-3074	235	7	,	,	PUNCT
ahs-3074	235	8	hadidi	hadidi	PROPN
ahs-3074	235	9	a.	a.	PROPN
ahs-3074	235	10	,	,	PUNCT
ahs-3074	235	11	scott	scott	PROPN
ahs-3074	235	12	s.w	s.w	PROPN
ahs-3074	235	13	.	.	PROPN
ahs-3074	235	14	,	,	PUNCT
ahs-3074	235	15	waterworth	waterworth	ADJ
ahs-3074	235	16	h.e	h.e	PROPN
ahs-3074	235	17	.	.	PROPN
ahs-3074	235	18	,	,	PUNCT
ahs-3074	235	19	howell	howell	PROPN
ahs-3074	235	20	w.e	w.e	PROPN
ahs-3074	235	21	.	.	PROPN
ahs-3074	235	22	,	,	PUNCT
ahs-3074	235	23	mink	mink	PROPN
ahs-3074	235	24	g.i	g.i	PROPN
ahs-3074	235	25	.	.	PROPN
ahs-3074	235	26	,	,	PUNCT
ahs-3074	235	27	1995	1995	NUM
ahs-3074	235	28	detection	detection	NOUN
ahs-3074	235	29	of	of	ADP
ahs-3074	235	30	prune	prune	NOUN
ahs-3074	235	31	dwarf	dwarf	NOUN
ahs-3074	235	32	ilarvirus	ilarvirus	NOUN
ahs-3074	235	33	from	from	ADP
ahs-3074	235	34	infected	infected	ADJ
ahs-3074	235	35	stone	stone	NOUN
ahs-3074	235	36	fruits	fruit	NOUN
ahs-3074	235	37	using	use	VERB
ahs-3074	235	38	reverse	reverse	ADJ
ahs-3074	235	39	transcription	transcription	NOUN
ahs-3074	235	40	-	-	PUNCT
ahs-3074	235	41	polymerase	polymerase	NOUN
ahs-3074	235	42	chain	chain	NOUN
ahs-3074	235	43	reaction	reaction	NOUN
ahs-3074	235	44	.	.	PUNCT
ahs-3074	236	1	acta	acta	PROPN
ahs-3074	236	2	horticulturae	horticulturae	PROPN
ahs-3074	236	3	,	,	PUNCT
ahs-3074	236	4	386	386	NUM
ahs-3074	236	5	:	:	PUNCT
ahs-3074	236	6	421	421	NUM
ahs-3074	236	7	-	-	SYM
ahs-3074	236	8	430	430	NUM
ahs-3074	236	9	.	.	PUNCT
ahs-3074	237	1	ratti	ratti	PROPN
ahs-3074	237	2	c.	c.	PROPN
ahs-3074	237	3	,	,	PUNCT
ahs-3074	237	4	budge	budge	ADJ
ahs-3074	237	5	g.	g.	PROPN
ahs-3074	237	6	,	,	PUNCT
ahs-3074	237	7	ward	ward	PROPN
ahs-3074	237	8	l.	l.	PROPN
ahs-3074	237	9	,	,	PUNCT
ahs-3074	237	10	clover	clover	PROPN
ahs-3074	237	11	g.	g.	PROPN
ahs-3074	237	12	,	,	PUNCT
ahs-3074	237	13	rubiesautonell	rubiesautonell	PROPN
ahs-3074	237	14	c.	c.	PROPN
ahs-3074	237	15	,	,	PUNCT
ahs-3074	237	16	henry	henry	PROPN
ahs-3074	237	17	c.	c.	PROPN
ahs-3074	237	18	,	,	PUNCT
ahs-3074	237	19	2004	2004	NUM
ahs-3074	237	20	detection	detection	NOUN
ahs-3074	237	21	and	and	CCONJ
ahs-3074	237	22	relative	relative	ADJ
ahs-3074	237	23	quantitation	quantitation	NOUN
ahs-3074	237	24	of	of	ADP
ahs-3074	237	25	soil	soil	NOUN
ahs-3074	237	26	-	-	PUNCT
ahs-3074	237	27	borne	bear	VERB
ahs-3074	237	28	cereal	cereal	NOUN
ahs-3074	237	29	mosaic	mosaic	PROPN
ahs-3074	237	30	virus	virus	NOUN
ahs-3074	237	31	(	(	PUNCT
ahs-3074	237	32	sbcmv	sbcmv	PROPN
ahs-3074	237	33	)	)	PUNCT
ahs-3074	237	34	and	and	CCONJ
ahs-3074	237	35	polymyxa	polymyxa	NOUN
ahs-3074	237	36	graminis	graminis	NOUN
ahs-3074	237	37	in	in	ADP
ahs-3074	237	38	winter	winter	NOUN
ahs-3074	237	39	wheat	wheat	NOUN
ahs-3074	237	40	using	use	VERB
ahs-3074	237	41	realtime	realtime	ADJ
ahs-3074	237	42	pcr	pcr	NOUN
ahs-3074	238	1	[	[	X
ahs-3074	238	2	taqman	taqman	NOUN
ahs-3074	238	3	(	(	PUNCT
ahs-3074	238	4	r	r	NOUN
ahs-3074	238	5	)	)	PUNCT
ahs-3074	238	6	]	]	PUNCT
ahs-3074	238	7	.	.	PUNCT
ahs-3074	239	1	j.	j.	PROPN
ahs-3074	239	2	virol	virol	PROPN
ahs-3074	239	3	.	.	PUNCT
ahs-3074	240	1	methods	method	NOUN
ahs-3074	240	2	,	,	PUNCT
ahs-3074	240	3	122	122	NUM
ahs-3074	240	4	:	:	SYM
ahs-3074	240	5	95	95	NUM
ahs-3074	240	6	-	-	SYM
ahs-3074	240	7	103	103	NUM
ahs-3074	240	8	.	.	PUNCT
ahs-3074	241	1	rehman	rehman	PROPN
ahs-3074	241	2	s.	s.	PROPN
ahs-3074	241	3	,	,	PUNCT
ahs-3074	241	4	ahmad	ahmad	PROPN
ahs-3074	241	5	j.	j.	PROPN
ahs-3074	241	6	,	,	PUNCT
ahs-3074	241	7	lanzoni	lanzoni	PROPN
ahs-3074	241	8	c.	c.	PROPN
ahs-3074	241	9	,	,	PUNCT
ahs-3074	241	10	rubies	ruby	NOUN
ahs-3074	241	11	autonell	autonell	VERB
ahs-3074	241	12	c.	c.	PROPN
ahs-3074	241	13	,	,	PUNCT
ahs-3074	241	14	ratti	ratti	PROPN
ahs-3074	241	15	c.	c.	PROPN
ahs-3074	241	16	,	,	PUNCT
ahs-3074	241	17	2012	2012	NUM
ahs-3074	241	18	first	first	ADJ
ahs-3074	241	19	report	report	NOUN
ahs-3074	241	20	of	of	ADP
ahs-3074	241	21	citrus	citrus	PROPN
ahs-3074	241	22	tristeza	tristeza	PROPN
ahs-3074	241	23	virus	virus	NOUN
ahs-3074	241	24	in	in	ADP
ahs-3074	241	25	national	national	ADJ
ahs-3074	241	26	germplasm	germplasm	NOUN
ahs-3074	241	27	of	of	ADP
ahs-3074	241	28	citrus	citrus	NOUN
ahs-3074	241	29	in	in	ADP
ahs-3074	241	30	afghanistan	afghanistan	PROPN
ahs-3074	241	31	.	.	PUNCT
ahs-3074	242	1	plant	plant	NOUN
ahs-3074	242	2	disease	disease	NOUN
ahs-3074	242	3	,	,	PUNCT
ahs-3074	242	4	96(2	96(2	NUM
ahs-3074	242	5	):	):	PUNCT
ahs-3074	242	6	296	296	NUM
ahs-3074	242	7	.	.	PUNCT
ahs-3074	243	1	rizzo	rizzo	PROPN
ahs-3074	243	2	d.	d.	PROPN
ahs-3074	243	3	,	,	PUNCT
ahs-3074	243	4	materazzi	materazzi	PROPN
ahs-3074	243	5	a.	a.	PROPN
ahs-3074	243	6	,	,	PUNCT
ahs-3074	243	7	stefani	stefani	PROPN
ahs-3074	243	8	l.	l.	PROPN
ahs-3074	243	9	,	,	PUNCT
ahs-3074	243	10	farina	farina	PROPN
ahs-3074	243	11	p.	p.	PROPN
ahs-3074	243	12	,	,	PUNCT
ahs-3074	243	13	vanarelli	vanarelli	PROPN
ahs-3074	243	14	s.	s.	PROPN
ahs-3074	243	15	,	,	PUNCT
ahs-3074	243	16	panattoni	panattoni	PROPN
ahs-3074	243	17	a.	a.	NOUN
ahs-3074	243	18	,	,	PUNCT
ahs-3074	243	19	luvisi	luvisi	VERB
ahs-3074	243	20	a.	a.	NOUN
ahs-3074	243	21	,	,	PUNCT
ahs-3074	243	22	2015	2015	NUM
ahs-3074	243	23	distribution	distribution	NOUN
ahs-3074	243	24	of	of	ADP
ahs-3074	243	25	regulated	regulated	ADJ
ahs-3074	243	26	viruses	virus	NOUN
ahs-3074	243	27	in	in	ADP
ahs-3074	243	28	cv	cv	PROPN
ahs-3074	243	29	.	.	PROPN
ahs-3074	243	30	sangiovese	sangiovese	NOUN
ahs-3074	243	31	vineyards	vineyard	NOUN
ahs-3074	243	32	in	in	ADP
ahs-3074	243	33	tuscany	tuscany	PROPN
ahs-3074	243	34	.	.	PUNCT
ahs-3074	244	1	j.	j.	PROPN
ahs-3074	244	2	plant	plant	PROPN
ahs-3074	244	3	pathol	pathol	PROPN
ahs-3074	244	4	.	.	PUNCT
ahs-3074	244	5	,	,	PUNCT
ahs-3074	244	6	97(2	97(2	NUM
ahs-3074	244	7	):	):	PUNCT
ahs-3074	244	8	131	131	NUM
ahs-3074	244	9	-	-	SYM
ahs-3074	244	10	135	135	NUM
ahs-3074	244	11	.	.	PUNCT
ahs-3074	245	1	rizzo	rizzo	PROPN
ahs-3074	245	2	d.	d.	PROPN
ahs-3074	245	3	,	,	PUNCT
ahs-3074	245	4	stefani	stefani	PROPN
ahs-3074	245	5	l.	l.	PROPN
ahs-3074	245	6	,	,	PUNCT
ahs-3074	245	7	paoli	paoli	PROPN
ahs-3074	245	8	m.	m.	PROPN
ahs-3074	245	9	,	,	PUNCT
ahs-3074	245	10	triolo	triolo	PROPN
ahs-3074	245	11	e.	e.	PROPN
ahs-3074	245	12	,	,	PUNCT
ahs-3074	245	13	panattoni	panattoni	PROPN
ahs-3074	245	14	a.	a.	NOUN
ahs-3074	245	15	,	,	PUNCT
ahs-3074	245	16	luvisi	luvisi	VERB
ahs-3074	245	17	a.	a.	PROPN
ahs-3074	245	18	,	,	PUNCT
ahs-3074	245	19	2012	2012	NUM
ahs-3074	245	20	the	the	DET
ahs-3074	245	21	sustainability	sustainability	NOUN
ahs-3074	245	22	of	of	ADP
ahs-3074	245	23	old	old	ADJ
ahs-3074	245	24	grapevine	grapevine	NOUN
ahs-3074	245	25	mother	mother	NOUN
ahs-3074	245	26	plants	plant	NOUN
ahs-3074	245	27	in	in	ADP
ahs-3074	245	28	relation	relation	NOUN
ahs-3074	245	29	to	to	ADP
ahs-3074	245	30	new	new	ADJ
ahs-3074	245	31	mandatory	mandatory	ADJ
ahs-3074	245	32	diagnostic	diagnostic	ADJ
ahs-3074	245	33	tests	test	NOUN
ahs-3074	245	34	for	for	ADP
ahs-3074	245	35	virus	virus	NOUN
ahs-3074	245	36	control	control	NOUN
ahs-3074	245	37	.	.	PUNCT
ahs-3074	246	1	adv	adv	PROPN
ahs-3074	246	2	.	.	PUNCT
ahs-3074	247	1	hort	hort	PROPN
ahs-3074	247	2	.	.	PUNCT
ahs-3074	248	1	sci	sci	PROPN
ahs-3074	248	2	.	.	PROPN
ahs-3074	248	3	,	,	PUNCT
ahs-3074	248	4	26(3	26(3	NUM
ahs-3074	248	5	-	-	SYM
ahs-3074	248	6	4	4	NUM
ahs-3074	248	7	):	):	PUNCT
ahs-3074	248	8	148150	148150	NUM
ahs-3074	248	9	.	.	PUNCT
ahs-3074	249	1	rocha	rocha	PROPN
ahs-3074	249	2	-	-	PUNCT
ahs-3074	249	3	peña	peña	PROPN
ahs-3074	249	4	m.a	m.a	PROPN
ahs-3074	249	5	.	.	PROPN
ahs-3074	249	6	,	,	PUNCT
ahs-3074	249	7	1995	1995	NUM
ahs-3074	249	8	citrus	citrus	NOUN
ahs-3074	249	9	tristeza	tristeza	PROPN
ahs-3074	249	10	virus	virus	NOUN
ahs-3074	249	11	and	and	CCONJ
ahs-3074	249	12	its	its	PRON
ahs-3074	249	13	aphid	aphid	NOUN
ahs-3074	249	14	vector	vector	NOUN
ahs-3074	249	15	toxoptera	toxoptera	NOUN
ahs-3074	249	16	citricida	citricida	PROPN
ahs-3074	249	17	.	.	PUNCT
ahs-3074	250	1	plant	plant	NOUN
ahs-3074	250	2	disease	disease	NOUN
ahs-3074	250	3	,	,	PUNCT
ahs-3074	250	4	79	79	NUM
ahs-3074	250	5	:	:	SYM
ahs-3074	250	6	437	437	NUM
ahs-3074	250	7	-	-	SYM
ahs-3074	250	8	445	445	NUM
ahs-3074	250	9	.	.	PUNCT
ahs-3074	251	1	terlizzi	terlizzi	PROPN
ahs-3074	251	2	f.	f.	PROPN
ahs-3074	251	3	,	,	PUNCT
ahs-3074	251	4	pisi	pisi	PROPN
ahs-3074	251	5	a.	a.	PROPN
ahs-3074	251	6	,	,	PUNCT
ahs-3074	251	7	fiore	fiore	NOUN
ahs-3074	251	8	n.	n.	NOUN
ahs-3074	251	9	,	,	PUNCT
ahs-3074	251	10	zamorano	zamorano	PROPN
ahs-3074	251	11	a.	a.	PROPN
ahs-3074	251	12	,	,	PUNCT
ahs-3074	251	13	credi	credi	PROPN
ahs-3074	251	14	r.	r.	PROPN
ahs-3074	251	15	,	,	PUNCT
ahs-3074	251	16	ratti	ratti	PROPN
ahs-3074	251	17	c.	c.	PROPN
ahs-3074	251	18	,	,	PUNCT
ahs-3074	251	19	2015	2015	NUM
ahs-3074	251	20	molecular	molecular	ADJ
ahs-3074	251	21	characterization	characterization	NOUN
ahs-3074	251	22	of	of	ADP
ahs-3074	251	23	the	the	DET
ahs-3074	251	24	movement	movement	NOUN
ahs-3074	251	25	and	and	CCONJ
ahs-3074	251	26	coat	coat	NOUN
ahs-3074	251	27	protein	protein	NOUN
ahs-3074	251	28	genes	gene	NOUN
ahs-3074	251	29	of	of	ADP
ahs-3074	251	30	grapevine	grapevine	NOUN
ahs-3074	251	31	fanleaf	fanleaf	NOUN
ahs-3074	251	32	virus	virus	NOUN
ahs-3074	251	33	isolates	isolate	NOUN
ahs-3074	251	34	from	from	ADP
ahs-3074	251	35	italy	italy	PROPN
ahs-3074	251	36	.	.	PUNCT
ahs-3074	252	1	j.	j.	PROPN
ahs-3074	252	2	gen	gen	PROPN
ahs-3074	252	3	.	.	PROPN
ahs-3074	252	4	plant	plant	NOUN
ahs-3074	252	5	pathol	pathol	NOUN
ahs-3074	252	6	.	.	PUNCT
ahs-3074	252	7	,	,	PUNCT
ahs-3074	252	8	81(1	81(1	NUM
ahs-3074	252	9	):	):	PUNCT
ahs-3074	252	10	63	63	NUM
ahs-3074	252	11	-	-	SYM
ahs-3074	252	12	67	67	NUM
ahs-3074	252	13	.	.	PUNCT
ahs-3074	253	1	vigne	vigne	PROPN
ahs-3074	253	2	e.	e.	PROPN
ahs-3074	253	3	,	,	PUNCT
ahs-3074	253	4	marmonier	marmonier	PROPN
ahs-3074	253	5	a.	a.	PROPN
ahs-3074	253	6	,	,	PUNCT
ahs-3074	253	7	komar	komar	PROPN
ahs-3074	253	8	v.	v.	PROPN
ahs-3074	253	9	,	,	PUNCT
ahs-3074	253	10	lemaire	lemaire	PROPN
ahs-3074	253	11	o.	o.	PROPN
ahs-3074	253	12	,	,	PUNCT
ahs-3074	253	13	fuchs	fuchs	PROPN
ahs-3074	253	14	m.	m.	NOUN
ahs-3074	253	15	,	,	PUNCT
ahs-3074	253	16	2009	2009	NUM
ahs-3074	253	17	genetic	genetic	ADJ
ahs-3074	253	18	structure	structure	NOUN
ahs-3074	253	19	and	and	CCONJ
ahs-3074	253	20	variability	variability	NOUN
ahs-3074	253	21	of	of	ADP
ahs-3074	253	22	virus	virus	NOUN
ahs-3074	253	23	populations	population	NOUN
ahs-3074	253	24	in	in	ADP
ahs-3074	253	25	cross	cross	NOUN
ahs-3074	253	26	protected	protect	VERB
ahs-3074	253	27	grapevines	grapevine	NOUN
ahs-3074	253	28	superinfected	superinfect	VERB
ahs-3074	253	29	by	by	ADP
ahs-3074	253	30	grapevine	grapevine	NOUN
ahs-3074	253	31	fanleaf	fanleaf	NOUN
ahs-3074	253	32	virus	virus	NOUN
ahs-3074	253	33	.	.	PUNCT
ahs-3074	254	1	virus	virus	NOUN
ahs-3074	254	2	res	re	NOUN
ahs-3074	254	3	.	.	PUNCT
ahs-3074	254	4	,	,	PUNCT
ahs-3074	254	5	144	144	NUM
ahs-3074	254	6	:	:	SYM
ahs-3074	254	7	154162	154162	NUM
ahs-3074	254	8	.	.	PUNCT
ahs-3074	255	1	zemzami	zemzami	PROPN
ahs-3074	255	2	m.	m.	PROPN
ahs-3074	255	3	,	,	PUNCT
ahs-3074	255	4	soares	soar	VERB
ahs-3074	255	5	c.m	c.m	PROPN
ahs-3074	255	6	.	.	PROPN
ahs-3074	255	7	,	,	PUNCT
ahs-3074	255	8	bailey	bailey	PROPN
ahs-3074	255	9	a.m.	a.m.	PROPN
ahs-3074	255	10	,	,	PUNCT
ahs-3074	255	11	niblett	niblett	NOUN
ahs-3074	255	12	c.l	c.l	PROPN
ahs-3074	255	13	.	.	PROPN
ahs-3074	255	14	,	,	PUNCT
ahs-3074	255	15	nolasco	nolasco	PROPN
ahs-3074	255	16	g.	g.	PROPN
ahs-3074	255	17	,	,	PUNCT
ahs-3074	255	18	2002	2002	NUM
ahs-3074	255	19	molecular	molecular	ADJ
ahs-3074	255	20	characterization	characterization	NOUN
ahs-3074	255	21	and	and	CCONJ
ahs-3074	255	22	classification	classification	NOUN
ahs-3074	255	23	of	of	ADP
ahs-3074	255	24	moroccan	moroccan	ADJ
ahs-3074	255	25	isolates	isolate	NOUN
ahs-3074	255	26	of	of	ADP
ahs-3074	255	27	citrus	citrus	NOUN
ahs-3074	255	28	tristeza	tristeza	PROPN
ahs-3074	255	29	closterovirus	closterovirus	NOUN
ahs-3074	255	30	.	.	PUNCT
ahs-3074	256	1	proceedings	proceeding	NOUN
ahs-3074	256	2	of	of	ADP
ahs-3074	256	3	the	the	DET
ahs-3074	256	4	15th	15th	ADJ
ahs-3074	256	5	conference	conference	NOUN
ahs-3074	256	6	of	of	ADP
ahs-3074	256	7	the	the	DET
ahs-3074	256	8	international	international	ADJ
ahs-3074	256	9	organization	organization	NOUN
ahs-3074	256	10	of	of	ADP
ahs-3074	256	11	citrus	citrus	NOUN
ahs-3074	256	12	virologists	virologist	NOUN
ahs-3074	256	13	,	,	PUNCT
ahs-3074	256	14	iocv	iocv	NOUN
ahs-3074	256	15	,	,	PUNCT
ahs-3074	256	16	riverside	riverside	NOUN
ahs-3074	256	17	,	,	PUNCT
ahs-3074	256	18	ca	ca	PROPN
ahs-3074	256	19	,	,	PUNCT
ahs-3074	256	20	usa	usa	PROPN
ahs-3074	256	21	,	,	PUNCT
ahs-3074	256	22	pp	pp	PROPN
ahs-3074	256	23	.	.	PUNCT
ahs-3074	257	1	8	8	NUM
ahs-3074	257	2	-	-	SYM
ahs-3074	257	3	12	12	NUM
ahs-3074	257	4	.	.	PUNCT
ahs-3074	258	1	zindović	zindović	PROPN
ahs-3074	258	2	j.	j.	PROPN
ahs-3074	258	3	,	,	PUNCT
ahs-3074	258	4	rubies	ruby	NOUN
ahs-3074	258	5	autonell	autonell	VERB
ahs-3074	258	6	c.	c.	PROPN
ahs-3074	258	7	,	,	PUNCT
ahs-3074	258	8	ratti	ratti	PROPN
ahs-3074	258	9	c.	c.	PROPN
ahs-3074	258	10	,	,	PUNCT
ahs-3074	258	11	2015	2015	NUM
ahs-3074	258	12	molecular	molecular	ADJ
ahs-3074	258	13	characterization	characterization	NOUN
ahs-3074	258	14	of	of	ADP
ahs-3074	258	15	the	the	DET
ahs-3074	258	16	coat	coat	NOUN
ahs-3074	258	17	protein	protein	NOUN
ahs-3074	258	18	gene	gene	NOUN
ahs-3074	258	19	of	of	ADP
ahs-3074	258	20	prunus	prunus	NOUN
ahs-3074	258	21	necrotic	necrotic	ADJ
ahs-3074	258	22	ringspot	ringspot	NOUN
ahs-3074	258	23	virus	virus	NOUN
ahs-3074	258	24	infecting	infect	VERB
ahs-3074	258	25	peach	peach	NOUN
ahs-3074	258	26	in	in	ADP
ahs-3074	258	27	montenegro	montenegro	PROPN
ahs-3074	258	28	.	.	PUNCT
ahs-3074	259	1	eur	eur	PROPN
ahs-3074	259	2	.	.	PUNCT
ahs-3074	260	1	j.	j.	PROPN
ahs-3074	260	2	plant	plant	PROPN
ahs-3074	260	3	pathol	pathol	PROPN
ahs-3074	260	4	.	.	PUNCT
ahs-3074	261	1	,	,	PUNCT
ahs-3074	261	2	43	43	NUM
ahs-3074	261	3	:	:	PUNCT
ahs-3074	261	4	881	881	NUM
ahs-3074	261	5	-	-	SYM
ahs-3074	261	6	891	891	NUM
ahs-3074	261	7	.	.	PUNCT