id	sid	tid	token	lemma	pos
ahs-3111	1	1	impaginato	impaginato	PROPN
ahs-3111	1	2	275	275	NUM
ahs-3111	1	3	adv	adv	PROPN
ahs-3111	1	4	.	.	PUNCT
ahs-3111	1	5	hort	hort	PROPN
ahs-3111	1	6	.	.	PUNCT
ahs-3111	2	1	sci	sci	PROPN
ahs-3111	2	2	.	.	PROPN
ahs-3111	2	3	,	,	PUNCT
ahs-3111	2	4	2017	2017	NUM
ahs-3111	2	5	31(4	31(4	NUM
ahs-3111	2	6	):	):	PUNCT
ahs-3111	2	7	275	275	NUM
ahs-3111	2	8	-	-	SYM
ahs-3111	2	9	280	280	NUM
ahs-3111	2	10	doi	doi	NOUN
ahs-3111	2	11	:	:	PUNCT
ahs-3111	2	12	10.13128	10.13128	NUM
ahs-3111	2	13	/	/	SYM
ahs-3111	2	14	ahs-20694	ahs-20694	NOUN
ahs-3111	2	15	‘	'	PUNCT
ahs-3111	2	16	superior	superior	ADJ
ahs-3111	2	17	seedless	seedless	ADJ
ahs-3111	2	18	’	'	PUNCT
ahs-3111	2	19	grapevine	grapevine	NOUN
ahs-3111	2	20	grafted	graft	VERB
ahs-3111	2	21	on	on	ADP
ahs-3111	2	22	three	three	NUM
ahs-3111	2	23	rootstocks	rootstock	NOUN
ahs-3111	2	24	grown	grow	VERB
ahs-3111	2	25	on	on	ADP
ahs-3111	2	26	calcareous	calcareous	ADJ
ahs-3111	2	27	soil	soil	NOUN
ahs-3111	2	28	under	under	ADP
ahs-3111	2	29	diluted	diluted	ADJ
ahs-3111	2	30	brackish	brackish	ADJ
ahs-3111	2	31	water	water	NOUN
ahs-3111	2	32	irrigation	irrigation	NOUN
ahs-3111	2	33	.	.	PUNCT
ahs-3111	3	1	ii	ii	PROPN
ahs-3111	3	2	.	.	PUNCT
ahs-3111	4	1	expression	expression	NOUN
ahs-3111	4	2	of	of	ADP
ahs-3111	4	3	antioxidant	antioxidant	ADJ
ahs-3111	4	4	genes	gene	NOUN
ahs-3111	4	5	i.m	i.m	PROPN
ahs-3111	4	6	.	.	PUNCT
ahs-3111	5	1	qrunfleh	qrunfleh	PROPN
ahs-3111	5	2	1	1	NUM
ahs-3111	5	3	(	(	PUNCT
ahs-3111	5	4	*	*	NOUN
ahs-3111	5	5	)	)	PUNCT
ahs-3111	5	6	,	,	PUNCT
ahs-3111	5	7	s.	s.	PROPN
ahs-3111	5	8	abu	abu	PROPN
ahs-3111	5	9	-	-	PUNCT
ahs-3111	5	10	romman	romman	PROPN
ahs-3111	5	11	2	2	NUM
ahs-3111	5	12	,	,	PUNCT
ahs-3111	5	13	t.g	t.g	PROPN
ahs-3111	5	14	.	.	PROPN
ahs-3111	5	15	ammari	ammari	PROPN
ahs-3111	5	16	3	3	NUM
ahs-3111	5	17	1	1	NUM
ahs-3111	5	18	department	department	NOUN
ahs-3111	5	19	of	of	ADP
ahs-3111	5	20	plant	plant	NOUN
ahs-3111	5	21	production	production	NOUN
ahs-3111	5	22	and	and	CCONJ
ahs-3111	5	23	protection	protection	NOUN
ahs-3111	5	24	,	,	PUNCT
ahs-3111	5	25	faculty	faculty	NOUN
ahs-3111	5	26	of	of	ADP
ahs-3111	5	27	agricultural	agricultural	ADJ
ahs-3111	5	28	technology	technology	NOUN
ahs-3111	5	29	,	,	PUNCT
ahs-3111	5	30	al	al	PROPN
ahs-3111	5	31	-	-	PUNCT
ahs-3111	5	32	balqa	balqa	NOUN
ahs-3111	5	33	applied	apply	VERB
ahs-3111	5	34	university	university	NOUN
ahs-3111	5	35	,	,	PUNCT
ahs-3111	5	36	al	al	PROPN
ahs-3111	5	37	-	-	PUNCT
ahs-3111	5	38	salt	salt	NOUN
ahs-3111	5	39	19117	19117	NUM
ahs-3111	5	40	,	,	PUNCT
ahs-3111	5	41	jordan	jordan	PROPN
ahs-3111	5	42	.	.	PROPN
ahs-3111	6	1	2	2	NUM
ahs-3111	6	2	department	department	NOUN
ahs-3111	6	3	of	of	ADP
ahs-3111	6	4	biotechnology	biotechnology	NOUN
ahs-3111	6	5	,	,	PUNCT
ahs-3111	6	6	faculty	faculty	NOUN
ahs-3111	6	7	of	of	ADP
ahs-3111	6	8	agricultural	agricultural	ADJ
ahs-3111	6	9	technology	technology	NOUN
ahs-3111	6	10	,	,	PUNCT
ahs-3111	6	11	albalqa	albalqa	NOUN
ahs-3111	6	12	applied	apply	VERB
ahs-3111	6	13	university	university	NOUN
ahs-3111	6	14	,	,	PUNCT
ahs-3111	6	15	al	al	PROPN
ahs-3111	6	16	-	-	PUNCT
ahs-3111	6	17	salt	salt	NOUN
ahs-3111	6	18	19117	19117	NUM
ahs-3111	6	19	,	,	PUNCT
ahs-3111	6	20	jordan	jordan	PROPN
ahs-3111	6	21	.	.	PROPN
ahs-3111	7	1	3	3	NUM
ahs-3111	7	2	department	department	NOUN
ahs-3111	7	3	of	of	ADP
ahs-3111	7	4	water	water	NOUN
ahs-3111	7	5	resources	resource	NOUN
ahs-3111	7	6	and	and	CCONJ
ahs-3111	7	7	environmental	environmental	ADJ
ahs-3111	7	8	management	management	NOUN
ahs-3111	7	9	,	,	PUNCT
ahs-3111	7	10	faculty	faculty	NOUN
ahs-3111	7	11	of	of	ADP
ahs-3111	7	12	agricultural	agricultural	ADJ
ahs-3111	7	13	technology	technology	NOUN
ahs-3111	7	14	,	,	PUNCT
ahs-3111	7	15	al	al	PROPN
ahs-3111	7	16	-	-	PUNCT
ahs-3111	7	17	balqa	balqa	NOUN
ahs-3111	7	18	applied	apply	VERB
ahs-3111	7	19	university	university	NOUN
ahs-3111	7	20	,	,	PUNCT
ahs-3111	7	21	al	al	PROPN
ahs-3111	7	22	-	-	PUNCT
ahs-3111	7	23	salt	salt	NOUN
ahs-3111	7	24	19117	19117	NUM
ahs-3111	7	25	,	,	PUNCT
ahs-3111	7	26	jordan	jordan	PROPN
ahs-3111	7	27	.	.	PUNCT
ahs-3111	8	1	key	key	ADJ
ahs-3111	8	2	words	word	NOUN
ahs-3111	8	3	:	:	PUNCT
ahs-3111	8	4	41b	41b	NOUN
ahs-3111	8	5	,	,	PUNCT
ahs-3111	8	6	p1103	p1103	PROPN
ahs-3111	8	7	,	,	PUNCT
ahs-3111	8	8	r110	r110	PROPN
ahs-3111	8	9	,	,	PUNCT
ahs-3111	8	10	ros	ros	PROPN
ahs-3111	8	11	,	,	PUNCT
ahs-3111	8	12	salinity	salinity	NOUN
ahs-3111	8	13	.	.	PUNCT
ahs-3111	9	1	abstract	abstract	ADJ
ahs-3111	9	2	:	:	PUNCT
ahs-3111	9	3	grapevine	grapevine	NOUN
ahs-3111	9	4	rootstocks	rootstock	NOUN
ahs-3111	9	5	that	that	PRON
ahs-3111	9	6	can	can	AUX
ahs-3111	9	7	absorb	absorb	VERB
ahs-3111	9	8	brackish	brackish	ADJ
ahs-3111	9	9	water	water	NOUN
ahs-3111	9	10	and	and	CCONJ
ahs-3111	9	11	maintain	maintain	VERB
ahs-3111	9	12	satisfactory	satisfactory	ADJ
ahs-3111	9	13	growth	growth	NOUN
ahs-3111	9	14	of	of	ADP
ahs-3111	9	15	the	the	DET
ahs-3111	9	16	grapevine	grapevine	NOUN
ahs-3111	9	17	scion	scion	NOUN
ahs-3111	9	18	might	might	AUX
ahs-3111	9	19	be	be	AUX
ahs-3111	9	20	a	a	DET
ahs-3111	9	21	feasible	feasible	ADJ
ahs-3111	9	22	management	management	NOUN
ahs-3111	9	23	practice	practice	NOUN
ahs-3111	9	24	in	in	ADP
ahs-3111	9	25	areas	area	NOUN
ahs-3111	9	26	suffering	suffer	VERB
ahs-3111	9	27	scarce	scarce	ADJ
ahs-3111	9	28	water	water	NOUN
ahs-3111	9	29	resources	resource	NOUN
ahs-3111	9	30	.	.	PUNCT
ahs-3111	10	1	the	the	DET
ahs-3111	10	2	objective	objective	NOUN
ahs-3111	10	3	of	of	ADP
ahs-3111	10	4	this	this	DET
ahs-3111	10	5	study	study	NOUN
ahs-3111	10	6	was	be	AUX
ahs-3111	10	7	to	to	PART
ahs-3111	10	8	evaluate	evaluate	VERB
ahs-3111	10	9	the	the	DET
ahs-3111	10	10	expression	expression	NOUN
ahs-3111	10	11	of	of	ADP
ahs-3111	10	12	antioxidant	antioxidant	ADJ
ahs-3111	10	13	genes	gene	NOUN
ahs-3111	10	14	in	in	ADP
ahs-3111	10	15	‘	'	PUNCT
ahs-3111	10	16	superior	superior	ADJ
ahs-3111	10	17	seedless	seedless	NOUN
ahs-3111	10	18	’	'	PUNCT
ahs-3111	10	19	leaves	leave	NOUN
ahs-3111	10	20	grafted	graft	VERB
ahs-3111	10	21	on	on	ADP
ahs-3111	10	22	r110	r110	PROPN
ahs-3111	10	23	(	(	PUNCT
ahs-3111	10	24	vitis	vitis	NOUN
ahs-3111	10	25	berlandieri	berlandieri	NOUN
ahs-3111	10	26	x	x	PROPN
ahs-3111	10	27	v.	v.	PROPN
ahs-3111	10	28	rupestris	rupestris	PROPN
ahs-3111	10	29	)	)	PUNCT
ahs-3111	10	30	,	,	PUNCT
ahs-3111	10	31	41b	41b	NOUN
ahs-3111	10	32	(	(	PUNCT
ahs-3111	10	33	v.	v.	ADP
ahs-3111	10	34	berlandieri	berlandieri	PROPN
ahs-3111	10	35	x	x	PUNCT
ahs-3111	10	36	v.	v.	ADP
ahs-3111	10	37	vinifera	vinifera	NOUN
ahs-3111	10	38	)	)	PUNCT
ahs-3111	10	39	and	and	CCONJ
ahs-3111	10	40	p1103	p1103	NUM
ahs-3111	10	41	(	(	PUNCT
ahs-3111	10	42	v.	v.	ADP
ahs-3111	10	43	berlandieri	berlandieri	PROPN
ahs-3111	10	44	x	x	PROPN
ahs-3111	10	45	v.	v.	ADP
ahs-3111	10	46	rupestris	rupestris	PROPN
ahs-3111	10	47	)	)	PUNCT
ahs-3111	10	48	in	in	ADP
ahs-3111	10	49	response	response	NOUN
ahs-3111	10	50	to	to	ADP
ahs-3111	10	51	diluted	dilute	VERB
ahs-3111	10	52	brackish	brackish	ADJ
ahs-3111	10	53	water	water	NOUN
ahs-3111	10	54	irrigation	irrigation	NOUN
ahs-3111	10	55	at	at	ADP
ahs-3111	10	56	three	three	NUM
ahs-3111	10	57	levels	level	NOUN
ahs-3111	10	58	:	:	PUNCT
ahs-3111	10	59	1.5	1.5	NUM
ahs-3111	10	60	,	,	PUNCT
ahs-3111	10	61	3.0	3.0	NUM
ahs-3111	10	62	and	and	CCONJ
ahs-3111	10	63	5.0	5.0	NUM
ahs-3111	10	64	ds	ds	ADJ
ahs-3111	10	65	m-1	m-1	NUM
ahs-3111	10	66	in	in	ADP
ahs-3111	10	67	addition	addition	NOUN
ahs-3111	10	68	to	to	ADP
ahs-3111	10	69	the	the	DET
ahs-3111	10	70	0.8	0.8	NUM
ahs-3111	10	71	ds	ds	PROPN
ahs-3111	10	72	m-1	m-1	PROPN
ahs-3111	10	73	control	control	PROPN
ahs-3111	10	74	.	.	PUNCT
ahs-3111	11	1	results	result	NOUN
ahs-3111	11	2	revealed	reveal	VERB
ahs-3111	11	3	that	that	SCONJ
ahs-3111	11	4	after	after	ADP
ahs-3111	11	5	salinity	salinity	NOUN
ahs-3111	11	6	exposure	exposure	NOUN
ahs-3111	11	7	for	for	ADP
ahs-3111	11	8	two	two	NUM
ahs-3111	11	9	weeks	week	NOUN
ahs-3111	11	10	,	,	PUNCT
ahs-3111	11	11	the	the	DET
ahs-3111	11	12	transcript	transcript	NOUN
ahs-3111	11	13	levels	level	NOUN
ahs-3111	11	14	of	of	ADP
ahs-3111	11	15	apx	apx	PROPN
ahs-3111	11	16	,	,	PUNCT
ahs-3111	11	17	mn	mn	PROPN
ahs-3111	11	18	-	-	PUNCT
ahs-3111	11	19	sod	sod	NOUN
ahs-3111	11	20	and	and	CCONJ
ahs-3111	11	21	mdar	mdar	NOUN
ahs-3111	11	22	increased	increase	VERB
ahs-3111	11	23	in	in	ADP
ahs-3111	11	24	‘	'	PUNCT
ahs-3111	11	25	superior	superior	ADJ
ahs-3111	11	26	seedless	seedless	NOUN
ahs-3111	11	27	’	'	PUNCT
ahs-3111	11	28	leaves	leave	NOUN
ahs-3111	11	29	grafted	graft	VERB
ahs-3111	11	30	on	on	ADP
ahs-3111	11	31	the	the	DET
ahs-3111	11	32	different	different	ADJ
ahs-3111	11	33	rootstocks	rootstock	NOUN
ahs-3111	11	34	.	.	PUNCT
ahs-3111	12	1	however	however	ADV
ahs-3111	12	2	,	,	PUNCT
ahs-3111	12	3	their	their	PRON
ahs-3111	12	4	expression	expression	NOUN
ahs-3111	12	5	levels	level	NOUN
ahs-3111	12	6	in	in	ADP
ahs-3111	12	7	response	response	NOUN
ahs-3111	12	8	to	to	ADP
ahs-3111	12	9	salinity	salinity	NOUN
ahs-3111	12	10	were	be	AUX
ahs-3111	12	11	noticeably	noticeably	ADV
ahs-3111	12	12	higher	high	ADJ
ahs-3111	12	13	in	in	ADP
ahs-3111	12	14	plants	plant	NOUN
ahs-3111	12	15	grafted	graft	VERB
ahs-3111	12	16	on	on	ADP
ahs-3111	12	17	p1103	p1103	PROPN
ahs-3111	12	18	and	and	CCONJ
ahs-3111	12	19	r110	r110	PROPN
ahs-3111	12	20	compared	compare	VERB
ahs-3111	12	21	to	to	ADP
ahs-3111	12	22	41b	41b	NOUN
ahs-3111	12	23	.	.	PUNCT
ahs-3111	13	1	the	the	DET
ahs-3111	13	2	expression	expression	NOUN
ahs-3111	13	3	of	of	ADP
ahs-3111	13	4	cat	cat	NOUN
ahs-3111	13	5	gene	gene	NOUN
ahs-3111	13	6	showed	show	VERB
ahs-3111	13	7	obvious	obvious	ADJ
ahs-3111	13	8	enhanced	enhanced	ADJ
ahs-3111	13	9	level	level	NOUN
ahs-3111	13	10	in	in	ADP
ahs-3111	13	11	plants	plant	NOUN
ahs-3111	13	12	grafted	graft	VERB
ahs-3111	13	13	on	on	ADP
ahs-3111	13	14	p1103	p1103	PROPN
ahs-3111	13	15	in	in	ADP
ahs-3111	13	16	response	response	NOUN
ahs-3111	13	17	to	to	ADP
ahs-3111	13	18	salt	salt	NOUN
ahs-3111	13	19	exposure	exposure	NOUN
ahs-3111	13	20	.	.	PUNCT
ahs-3111	14	1	meanwhile	meanwhile	ADV
ahs-3111	14	2	,	,	PUNCT
ahs-3111	14	3	the	the	DET
ahs-3111	14	4	expression	expression	NOUN
ahs-3111	14	5	of	of	ADP
ahs-3111	14	6	cat	cat	NOUN
ahs-3111	14	7	gene	gene	NOUN
ahs-3111	14	8	in	in	ADP
ahs-3111	14	9	‘	'	PUNCT
ahs-3111	14	10	superior	superior	ADJ
ahs-3111	14	11	seedless	seedless	ADJ
ahs-3111	14	12	’	'	PUNCT
ahs-3111	14	13	scion	scion	NOUN
ahs-3111	14	14	grafted	graft	VERB
ahs-3111	14	15	on	on	ADP
ahs-3111	14	16	41b	41b	NOUN
ahs-3111	14	17	or	or	CCONJ
ahs-3111	14	18	r110	r110	PROPN
ahs-3111	14	19	showed	show	VERB
ahs-3111	14	20	almost	almost	ADV
ahs-3111	14	21	unchanged	unchanged	ADJ
ahs-3111	14	22	level	level	NOUN
ahs-3111	14	23	in	in	ADP
ahs-3111	14	24	control	control	NOUN
ahs-3111	14	25	and	and	CCONJ
ahs-3111	14	26	stressed	stress	VERB
ahs-3111	14	27	conditions	condition	NOUN
ahs-3111	14	28	.	.	PUNCT
ahs-3111	15	1	down	down	ADP
ahs-3111	15	2	-	-	PUNCT
ahs-3111	15	3	regulation	regulation	NOUN
ahs-3111	15	4	of	of	ADP
ahs-3111	15	5	cuzn	cuzn	NOUN
ahs-3111	15	6	-	-	PUNCT
ahs-3111	15	7	sod	sod	NOUN
ahs-3111	15	8	was	be	AUX
ahs-3111	15	9	recorded	record	VERB
ahs-3111	15	10	in	in	ADP
ahs-3111	15	11	leaves	leave	NOUN
ahs-3111	15	12	of	of	ADP
ahs-3111	15	13	‘	'	PUNCT
ahs-3111	15	14	superior	superior	ADJ
ahs-3111	15	15	seedless	seedless	NOUN
ahs-3111	15	16	’	'	PUNCT
ahs-3111	15	17	grafted	graft	VERB
ahs-3111	15	18	on	on	ADP
ahs-3111	15	19	p1103	p1103	NOUN
ahs-3111	15	20	.	.	PUNCT
ahs-3111	15	21	slight	slight	ADJ
ahs-3111	15	22	up	up	ADP
ahs-3111	15	23	-	-	PUNCT
ahs-3111	15	24	regulation	regulation	NOUN
ahs-3111	15	25	of	of	ADP
ahs-3111	15	26	this	this	DET
ahs-3111	15	27	gene	gene	NOUN
ahs-3111	15	28	in	in	ADP
ahs-3111	15	29	response	response	NOUN
ahs-3111	15	30	to	to	ADP
ahs-3111	15	31	saline	saline	NOUN
ahs-3111	15	32	condition	condition	NOUN
ahs-3111	15	33	was	be	AUX
ahs-3111	15	34	recorded	record	VERB
ahs-3111	15	35	when	when	SCONJ
ahs-3111	15	36	scion	scion	NOUN
ahs-3111	15	37	was	be	AUX
ahs-3111	15	38	grafted	graft	VERB
ahs-3111	15	39	on	on	ADP
ahs-3111	15	40	41b	41b	NOUN
ahs-3111	15	41	or	or	CCONJ
ahs-3111	15	42	r110	r110	PROPN
ahs-3111	15	43	.	.	PUNCT
ahs-3111	16	1	the	the	DET
ahs-3111	16	2	expression	expression	NOUN
ahs-3111	16	3	of	of	ADP
ahs-3111	16	4	gpx	gpx	NOUN
ahs-3111	16	5	was	be	AUX
ahs-3111	16	6	enhanced	enhance	VERB
ahs-3111	16	7	in	in	ADP
ahs-3111	16	8	scion	scion	NOUN
ahs-3111	16	9	grafted	graft	VERB
ahs-3111	16	10	on	on	ADP
ahs-3111	16	11	p1103	p1103	NUM
ahs-3111	16	12	and	and	CCONJ
ahs-3111	16	13	41b	41b	NOUN
ahs-3111	16	14	.	.	PUNCT
ahs-3111	17	1	on	on	ADP
ahs-3111	17	2	the	the	DET
ahs-3111	17	3	other	other	ADJ
ahs-3111	17	4	hand	hand	NOUN
ahs-3111	17	5	,	,	PUNCT
ahs-3111	17	6	scion	scion	NOUN
ahs-3111	17	7	grafted	graft	VERB
ahs-3111	17	8	on	on	ADP
ahs-3111	17	9	r110	r110	PROPN
ahs-3111	17	10	showed	show	VERB
ahs-3111	17	11	decreased	decrease	VERB
ahs-3111	17	12	expression	expression	NOUN
ahs-3111	17	13	of	of	ADP
ahs-3111	17	14	gpx	gpx	NOUN
ahs-3111	17	15	in	in	ADP
ahs-3111	17	16	response	response	NOUN
ahs-3111	17	17	to	to	ADP
ahs-3111	17	18	salt	salt	NOUN
ahs-3111	17	19	treatment	treatment	NOUN
ahs-3111	17	20	.	.	PUNCT
ahs-3111	18	1	grapevine	grapevine	NOUN
ahs-3111	18	2	rootstocks	rootstock	NOUN
ahs-3111	18	3	that	that	PRON
ahs-3111	18	4	have	have	VERB
ahs-3111	18	5	v.	v.	ADP
ahs-3111	18	6	rupestris	rupestris	PROPN
ahs-3111	18	7	and	and	CCONJ
ahs-3111	18	8	v.	v.	ADP
ahs-3111	18	9	berlandieri	berlandieri	PROPN
ahs-3111	18	10	in	in	ADP
ahs-3111	18	11	their	their	PRON
ahs-3111	18	12	parentage	parentage	NOUN
ahs-3111	18	13	are	be	AUX
ahs-3111	18	14	good	good	ADJ
ahs-3111	18	15	candidates	candidate	NOUN
ahs-3111	18	16	for	for	ADP
ahs-3111	18	17	salinity	salinity	NOUN
ahs-3111	18	18	tolerance	tolerance	NOUN
ahs-3111	18	19	.	.	PUNCT
ahs-3111	19	1	(	(	PUNCT
ahs-3111	19	2	*	*	NOUN
ahs-3111	19	3	)	)	PUNCT
ahs-3111	19	4	corresponding	corresponding	ADJ
ahs-3111	19	5	author	author	NOUN
ahs-3111	19	6	:	:	PUNCT
ahs-3111	19	7	iqrunf@bau.edu.jo	iqrunf@bau.edu.jo	ADJ
ahs-3111	19	8	citation	citation	NOUN
ahs-3111	19	9	:	:	PUNCT
ahs-3111	19	10	qrunfleh	qrunfleh	PROPN
ahs-3111	19	11	i.m	i.m	PROPN
ahs-3111	19	12	.	.	PROPN
ahs-3111	19	13	,	,	PUNCT
ahs-3111	19	14	abu	abu	PROPN
ahs-3111	19	15	-	-	PUNCT
ahs-3111	19	16	romman	romman	PROPN
ahs-3111	19	17	s.	s.	PROPN
ahs-3111	19	18	,	,	PUNCT
ahs-3111	19	19	ammari	ammari	PROPN
ahs-3111	19	20	t.g	t.g	PROPN
ahs-3111	19	21	.	.	PROPN
ahs-3111	19	22	,	,	PUNCT
ahs-3111	19	23	2017	2017	NUM
ahs-3111	19	24	‘	'	PUNCT
ahs-3111	19	25	superior	superior	ADJ
ahs-3111	19	26	seedless	seedless	ADJ
ahs-3111	19	27	’	'	PUNCT
ahs-3111	19	28	grapevine	grapevine	NOUN
ahs-3111	19	29	grafted	graft	VERB
ahs-3111	19	30	on	on	ADP
ahs-3111	19	31	three	three	NUM
ahs-3111	19	32	rootstocks	rootstock	NOUN
ahs-3111	19	33	grown	grow	VERB
ahs-3111	19	34	on	on	ADP
ahs-3111	19	35	calcareous	calcareous	ADJ
ahs-3111	19	36	soil	soil	NOUN
ahs-3111	19	37	under	under	ADP
ahs-3111	19	38	diluted	diluted	ADJ
ahs-3111	19	39	brackish	brackish	ADJ
ahs-3111	19	40	water	water	NOUN
ahs-3111	19	41	irrigation	irrigation	NOUN
ahs-3111	19	42	.	.	PUNCT
ahs-3111	20	1	ii	ii	PROPN
ahs-3111	20	2	.	.	PUNCT
ahs-3111	21	1	expression	expression	NOUN
ahs-3111	21	2	of	of	ADP
ahs-3111	21	3	antioxidant	antioxidant	ADJ
ahs-3111	21	4	genes	gene	NOUN
ahs-3111	21	5	adv	adv	PROPN
ahs-3111	21	6	.	.	PUNCT
ahs-3111	21	7	hort	hort	PROPN
ahs-3111	21	8	.	.	PUNCT
ahs-3111	22	1	sci	sci	PROPN
ahs-3111	22	2	.	.	PROPN
ahs-3111	22	3	,	,	PUNCT
ahs-3111	22	4	31(4	31(4	NUM
ahs-3111	22	5	):	):	PUNCT
ahs-3111	22	6	275	275	NUM
ahs-3111	22	7	-	-	SYM
ahs-3111	22	8	280	280	NUM
ahs-3111	22	9	copyright	copyright	NOUN
ahs-3111	22	10	:	:	PUNCT
ahs-3111	22	11	©	©	PROPN
ahs-3111	22	12	2017	2017	NUM
ahs-3111	22	13	qrunfleh	qrunfleh	PROPN
ahs-3111	22	14	i.m	i.m	PROPN
ahs-3111	22	15	.	.	PROPN
ahs-3111	22	16	,	,	PUNCT
ahs-3111	22	17	abu	abu	PROPN
ahs-3111	22	18	-	-	PUNCT
ahs-3111	22	19	romman	romman	PROPN
ahs-3111	22	20	s.	s.	PROPN
ahs-3111	22	21	,	,	PUNCT
ahs-3111	22	22	ammari	ammari	PROPN
ahs-3111	22	23	t.g	t.g	PROPN
ahs-3111	22	24	.	.	PROPN
ahs-3111	23	1	this	this	PRON
ahs-3111	23	2	is	be	AUX
ahs-3111	23	3	an	an	DET
ahs-3111	23	4	open	open	ADJ
ahs-3111	23	5	access	access	NOUN
ahs-3111	23	6	,	,	PUNCT
ahs-3111	23	7	peer	peer	NOUN
ahs-3111	23	8	reviewed	review	VERB
ahs-3111	23	9	article	article	NOUN
ahs-3111	23	10	published	publish	VERB
ahs-3111	23	11	by	by	ADP
ahs-3111	23	12	firenze	firenze	PROPN
ahs-3111	23	13	university	university	PROPN
ahs-3111	23	14	press	press	NOUN
ahs-3111	23	15	(	(	PUNCT
ahs-3111	23	16	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-3111	23	17	)	)	PUNCT
ahs-3111	23	18	and	and	CCONJ
ahs-3111	23	19	distribuited	distribuite	VERB
ahs-3111	23	20	under	under	ADP
ahs-3111	23	21	the	the	DET
ahs-3111	23	22	terms	term	NOUN
ahs-3111	23	23	of	of	ADP
ahs-3111	23	24	the	the	DET
ahs-3111	23	25	creative	creative	ADJ
ahs-3111	23	26	commons	common	NOUN
ahs-3111	23	27	attribution	attribution	NOUN
ahs-3111	23	28	license	license	NOUN
ahs-3111	23	29	,	,	PUNCT
ahs-3111	23	30	which	which	PRON
ahs-3111	23	31	permits	permit	VERB
ahs-3111	23	32	unrestricted	unrestricted	ADJ
ahs-3111	23	33	use	use	NOUN
ahs-3111	23	34	,	,	PUNCT
ahs-3111	23	35	distribution	distribution	NOUN
ahs-3111	23	36	,	,	PUNCT
ahs-3111	23	37	and	and	CCONJ
ahs-3111	23	38	reproduction	reproduction	NOUN
ahs-3111	23	39	in	in	ADP
ahs-3111	23	40	any	any	DET
ahs-3111	23	41	medium	medium	NOUN
ahs-3111	23	42	,	,	PUNCT
ahs-3111	23	43	provided	provide	VERB
ahs-3111	23	44	the	the	DET
ahs-3111	23	45	original	original	ADJ
ahs-3111	23	46	author	author	NOUN
ahs-3111	23	47	and	and	CCONJ
ahs-3111	23	48	source	source	NOUN
ahs-3111	23	49	are	be	AUX
ahs-3111	23	50	credited	credit	VERB
ahs-3111	23	51	.	.	PUNCT
ahs-3111	24	1	data	datum	NOUN
ahs-3111	24	2	availability	availability	NOUN
ahs-3111	24	3	statement	statement	NOUN
ahs-3111	24	4	:	:	PUNCT
ahs-3111	24	5	all	all	DET
ahs-3111	24	6	relevant	relevant	ADJ
ahs-3111	24	7	data	datum	NOUN
ahs-3111	24	8	are	be	AUX
ahs-3111	24	9	within	within	ADP
ahs-3111	24	10	the	the	DET
ahs-3111	24	11	paper	paper	NOUN
ahs-3111	24	12	and	and	CCONJ
ahs-3111	24	13	its	its	PRON
ahs-3111	24	14	supporting	support	VERB
ahs-3111	24	15	information	information	NOUN
ahs-3111	24	16	files	file	NOUN
ahs-3111	24	17	.	.	PUNCT
ahs-3111	25	1	competing	compete	VERB
ahs-3111	25	2	interests	interest	NOUN
ahs-3111	25	3	:	:	PUNCT
ahs-3111	25	4	the	the	DET
ahs-3111	25	5	authors	author	NOUN
ahs-3111	25	6	declare	declare	VERB
ahs-3111	25	7	no	no	DET
ahs-3111	25	8	competing	compete	VERB
ahs-3111	25	9	interests	interest	NOUN
ahs-3111	25	10	.	.	PUNCT
ahs-3111	26	1	received	receive	VERB
ahs-3111	26	2	for	for	ADP
ahs-3111	26	3	publication	publication	NOUN
ahs-3111	26	4	28	28	NUM
ahs-3111	26	5	may	may	AUX
ahs-3111	26	6	2017	2017	NUM
ahs-3111	26	7	accepted	accept	VERB
ahs-3111	26	8	for	for	ADP
ahs-3111	26	9	publication	publication	NOUN
ahs-3111	26	10	29	29	NUM
ahs-3111	26	11	september	september	PROPN
ahs-3111	26	12	2017	2017	NUM
ahs-3111	26	13	ahs	ahs	NOUN
ahs-3111	26	14	advances	advance	NOUN
ahs-3111	26	15	in	in	ADP
ahs-3111	26	16	horticultural	horticultural	ADJ
ahs-3111	26	17	science	science	PROPN
ahs-3111	26	18	adv	adv	PROPN
ahs-3111	26	19	.	.	PUNCT
ahs-3111	26	20	hort	hort	PROPN
ahs-3111	26	21	.	.	PUNCT
ahs-3111	27	1	sci	sci	PROPN
ahs-3111	27	2	.	.	PROPN
ahs-3111	27	3	,	,	PUNCT
ahs-3111	27	4	2017	2017	NUM
ahs-3111	27	5	31(4	31(4	NUM
ahs-3111	27	6	):	):	PUNCT
ahs-3111	27	7	275	275	NUM
ahs-3111	27	8	-	-	SYM
ahs-3111	27	9	280	280	NUM
ahs-3111	27	10	276	276	NUM
ahs-3111	27	11	1	1	NUM
ahs-3111	27	12	.	.	PUNCT
ahs-3111	28	1	introduction	introduction	NOUN
ahs-3111	28	2	grapes	grape	NOUN
ahs-3111	28	3	(	(	PUNCT
ahs-3111	28	4	vitis	vitis	PROPN
ahs-3111	28	5	sp	sp	NOUN
ahs-3111	28	6	.	.	PUNCT
ahs-3111	28	7	)	)	PUNCT
ahs-3111	28	8	are	be	AUX
ahs-3111	28	9	considered	consider	VERB
ahs-3111	28	10	as	as	ADP
ahs-3111	28	11	one	one	NUM
ahs-3111	28	12	of	of	ADP
ahs-3111	28	13	the	the	DET
ahs-3111	28	14	world	world	NOUN
ahs-3111	28	15	’s	’s	PART
ahs-3111	28	16	major	major	ADJ
ahs-3111	28	17	commercially	commercially	ADV
ahs-3111	28	18	grown	grow	VERB
ahs-3111	28	19	fruit	fruit	NOUN
ahs-3111	28	20	crops	crop	NOUN
ahs-3111	28	21	.	.	PUNCT
ahs-3111	29	1	in	in	ADP
ahs-3111	29	2	jordan	jordan	PROPN
ahs-3111	29	3	,	,	PUNCT
ahs-3111	29	4	grapes	grape	NOUN
ahs-3111	29	5	are	be	AUX
ahs-3111	29	6	ranked	rank	VERB
ahs-3111	29	7	in	in	ADP
ahs-3111	29	8	second	second	ADJ
ahs-3111	29	9	place	place	NOUN
ahs-3111	29	10	after	after	ADP
ahs-3111	29	11	olives	olive	NOUN
ahs-3111	29	12	regarding	regard	VERB
ahs-3111	29	13	the	the	DET
ahs-3111	29	14	total	total	ADJ
ahs-3111	29	15	area	area	NOUN
ahs-3111	29	16	planted	plant	VERB
ahs-3111	29	17	.	.	PUNCT
ahs-3111	30	1	the	the	DET
ahs-3111	30	2	total	total	ADJ
ahs-3111	30	3	area	area	NOUN
ahs-3111	30	4	planted	plant	VERB
ahs-3111	30	5	with	with	ADP
ahs-3111	30	6	grapes	grape	NOUN
ahs-3111	30	7	is	be	AUX
ahs-3111	30	8	3806	3806	NUM
ahs-3111	30	9	ha	ha	INTJ
ahs-3111	30	10	(	(	PUNCT
ahs-3111	30	11	fao	fao	PROPN
ahs-3111	30	12	,	,	PUNCT
ahs-3111	30	13	2014	2014	NUM
ahs-3111	30	14	)	)	PUNCT
ahs-3111	30	15	.	.	PUNCT
ahs-3111	31	1	more	more	ADJ
ahs-3111	31	2	than	than	ADP
ahs-3111	31	3	half	half	NOUN
ahs-3111	31	4	of	of	ADP
ahs-3111	31	5	that	that	DET
ahs-3111	31	6	area	area	NOUN
ahs-3111	31	7	is	be	AUX
ahs-3111	31	8	under	under	ADP
ahs-3111	31	9	irrigation	irrigation	NOUN
ahs-3111	31	10	and	and	CCONJ
ahs-3111	31	11	jordan	jordan	PROPN
ahs-3111	31	12	is	be	AUX
ahs-3111	31	13	now	now	ADV
ahs-3111	31	14	ranked	rank	VERB
ahs-3111	31	15	as	as	ADP
ahs-3111	31	16	the	the	DET
ahs-3111	31	17	world	world	NOUN
ahs-3111	31	18	’s	’s	PART
ahs-3111	31	19	second	second	ADJ
ahs-3111	31	20	water	water	NOUN
ahs-3111	31	21	-	-	PUNCT
ahs-3111	31	22	poorest	poor	ADJ
ahs-3111	31	23	country	country	NOUN
ahs-3111	31	24	.	.	PUNCT
ahs-3111	32	1	irrigation	irrigation	NOUN
ahs-3111	32	2	with	with	ADP
ahs-3111	32	3	low	low	ADJ
ahs-3111	32	4	quality	quality	NOUN
ahs-3111	32	5	water	water	NOUN
ahs-3111	32	6	during	during	ADP
ahs-3111	32	7	the	the	DET
ahs-3111	32	8	whole	whole	ADJ
ahs-3111	32	9	growing	grow	VERB
ahs-3111	32	10	season	season	NOUN
ahs-3111	32	11	of	of	ADP
ahs-3111	32	12	the	the	DET
ahs-3111	32	13	crops	crop	NOUN
ahs-3111	32	14	,	,	PUNCT
ahs-3111	32	15	even	even	ADV
ahs-3111	32	16	the	the	DET
ahs-3111	32	17	tolerant	tolerant	ADJ
ahs-3111	32	18	ones	one	NOUN
ahs-3111	32	19	,	,	PUNCT
ahs-3111	32	20	does	do	AUX
ahs-3111	32	21	not	not	PART
ahs-3111	32	22	always	always	ADV
ahs-3111	32	23	produce	produce	VERB
ahs-3111	32	24	high	high	ADJ
ahs-3111	32	25	yield	yield	NOUN
ahs-3111	32	26	.	.	PUNCT
ahs-3111	33	1	mixing	mix	VERB
ahs-3111	33	2	low	low	ADJ
ahs-3111	33	3	quality	quality	NOUN
ahs-3111	33	4	water	water	NOUN
ahs-3111	33	5	;	;	PUNCT
ahs-3111	33	6	such	such	ADJ
ahs-3111	33	7	as	as	ADP
ahs-3111	33	8	dam	dam	NOUN
ahs-3111	33	9	brackish	brackish	ADJ
ahs-3111	33	10	water	water	NOUN
ahs-3111	33	11	,	,	PUNCT
ahs-3111	33	12	with	with	ADP
ahs-3111	33	13	conventional	conventional	ADJ
ahs-3111	33	14	quality	quality	NOUN
ahs-3111	33	15	irrigation	irrigation	NOUN
ahs-3111	33	16	water	water	NOUN
ahs-3111	33	17	in	in	ADP
ahs-3111	33	18	ratios	ratio	NOUN
ahs-3111	33	19	to	to	PART
ahs-3111	33	20	keep	keep	VERB
ahs-3111	33	21	the	the	DET
ahs-3111	33	22	salinity	salinity	NOUN
ahs-3111	33	23	of	of	ADP
ahs-3111	33	24	the	the	DET
ahs-3111	33	25	irrigation	irrigation	NOUN
ahs-3111	33	26	water	water	NOUN
ahs-3111	33	27	below	below	ADP
ahs-3111	33	28	the	the	DET
ahs-3111	33	29	threshold	threshold	NOUN
ahs-3111	33	30	of	of	ADP
ahs-3111	33	31	the	the	DET
ahs-3111	33	32	target	target	NOUN
ahs-3111	33	33	crop	crop	NOUN
ahs-3111	33	34	might	might	AUX
ahs-3111	33	35	be	be	AUX
ahs-3111	33	36	an	an	DET
ahs-3111	33	37	acceptable	acceptable	ADJ
ahs-3111	33	38	management	management	NOUN
ahs-3111	33	39	practice	practice	NOUN
ahs-3111	33	40	and	and	CCONJ
ahs-3111	33	41	was	be	AUX
ahs-3111	33	42	used	use	VERB
ahs-3111	33	43	by	by	ADP
ahs-3111	33	44	many	many	ADJ
ahs-3111	33	45	researchers	researcher	NOUN
ahs-3111	33	46	(	(	PUNCT
ahs-3111	33	47	abdel	abdel	PROPN
ahs-3111	33	48	gawad	gawad	PROPN
ahs-3111	33	49	and	and	CCONJ
ahs-3111	33	50	ghaibeh	ghaibeh	NOUN
ahs-3111	33	51	,	,	PUNCT
ahs-3111	33	52	2001	2001	NUM
ahs-3111	33	53	)	)	PUNCT
ahs-3111	33	54	.	.	PUNCT
ahs-3111	34	1	alternating	alternate	VERB
ahs-3111	34	2	conventional	conventional	ADJ
ahs-3111	34	3	quality	quality	NOUN
ahs-3111	34	4	water	water	NOUN
ahs-3111	34	5	with	with	ADP
ahs-3111	34	6	brackish	brackish	ADJ
ahs-3111	34	7	water	water	NOUN
ahs-3111	34	8	is	be	AUX
ahs-3111	34	9	another	another	DET
ahs-3111	34	10	management	management	NOUN
ahs-3111	34	11	practice	practice	NOUN
ahs-3111	34	12	.	.	PUNCT
ahs-3111	35	1	its	its	PRON
ahs-3111	35	2	application	application	NOUN
ahs-3111	35	3	would	would	AUX
ahs-3111	35	4	be	be	AUX
ahs-3111	35	5	easier	easy	ADJ
ahs-3111	35	6	because	because	SCONJ
ahs-3111	35	7	it	it	PRON
ahs-3111	35	8	does	do	AUX
ahs-3111	35	9	not	not	PART
ahs-3111	35	10	need	need	VERB
ahs-3111	35	11	containers	container	NOUN
ahs-3111	35	12	for	for	ADP
ahs-3111	35	13	mixing	mix	VERB
ahs-3111	35	14	two	two	NUM
ahs-3111	35	15	different	different	ADJ
ahs-3111	35	16	sources	source	NOUN
ahs-3111	35	17	of	of	ADP
ahs-3111	35	18	irrigation	irrigation	NOUN
ahs-3111	35	19	water	water	NOUN
ahs-3111	35	20	.	.	PUNCT
ahs-3111	36	1	the	the	DET
ahs-3111	36	2	conventional	conventional	ADJ
ahs-3111	36	3	quality	quality	NOUN
ahs-3111	36	4	irrigation	irrigation	NOUN
ahs-3111	36	5	water	water	NOUN
ahs-3111	36	6	can	can	AUX
ahs-3111	36	7	be	be	AUX
ahs-3111	36	8	used	use	VERB
ahs-3111	36	9	during	during	ADP
ahs-3111	36	10	the	the	DET
ahs-3111	36	11	sensitive	sensitive	ADJ
ahs-3111	36	12	stages	stage	NOUN
ahs-3111	36	13	of	of	ADP
ahs-3111	36	14	plant	plant	NOUN
ahs-3111	36	15	growth	growth	NOUN
ahs-3111	36	16	and	and	CCONJ
ahs-3111	36	17	the	the	DET
ahs-3111	36	18	brackish	brackish	ADJ
ahs-3111	36	19	water	water	NOUN
ahs-3111	36	20	during	during	ADP
ahs-3111	36	21	the	the	DET
ahs-3111	36	22	non	non	ADJ
ahs-3111	36	23	-	-	ADJ
ahs-3111	36	24	sensitive	sensitive	ADJ
ahs-3111	36	25	or	or	CCONJ
ahs-3111	36	26	less	less	ADV
ahs-3111	36	27	sensitive	sensitive	ADJ
ahs-3111	36	28	stages	stage	NOUN
ahs-3111	36	29	.	.	PUNCT
ahs-3111	37	1	considerable	considerable	ADJ
ahs-3111	37	2	yields	yield	NOUN
ahs-3111	37	3	were	be	AUX
ahs-3111	37	4	obtained	obtain	VERB
ahs-3111	37	5	using	use	VERB
ahs-3111	37	6	saline	saline	ADJ
ahs-3111	37	7	irrigation	irrigation	NOUN
ahs-3111	37	8	water	water	NOUN
ahs-3111	37	9	(	(	PUNCT
ahs-3111	37	10	4	4	NUM
ahs-3111	37	11	-	-	SYM
ahs-3111	37	12	12	12	NUM
ahs-3111	37	13	ds	ds	ADJ
ahs-3111	37	14	m-1	m-1	NUM
ahs-3111	37	15	)	)	PUNCT
ahs-3111	37	16	in	in	ADP
ahs-3111	37	17	crops	crop	NOUN
ahs-3111	37	18	that	that	PRON
ahs-3111	37	19	had	have	AUX
ahs-3111	37	20	been	be	AUX
ahs-3111	37	21	previously	previously	ADV
ahs-3111	37	22	defined	define	VERB
ahs-3111	37	23	as	as	ADP
ahs-3111	37	24	moderately	moderately	ADV
ahs-3111	37	25	sensitive	sensitive	ADJ
ahs-3111	37	26	to	to	PART
ahs-3111	37	27	salt	salt	VERB
ahs-3111	37	28	stress	stress	NOUN
ahs-3111	37	29	(	(	PUNCT
ahs-3111	37	30	bustan	bustan	PROPN
ahs-3111	37	31	et	et	PROPN
ahs-3111	37	32	al	al	PROPN
ahs-3111	37	33	.	.	PROPN
ahs-3111	37	34	,	,	PUNCT
ahs-3111	37	35	2004	2004	NUM
ahs-3111	37	36	)	)	PUNCT
ahs-3111	37	37	.	.	PUNCT
ahs-3111	38	1	furthermore	furthermore	ADV
ahs-3111	38	2	,	,	PUNCT
ahs-3111	38	3	in	in	ADP
ahs-3111	38	4	some	some	DET
ahs-3111	38	5	crops	crop	NOUN
ahs-3111	38	6	(	(	PUNCT
ahs-3111	38	7	e.g.	e.g.	ADV
ahs-3111	38	8	,	,	PUNCT
ahs-3111	38	9	tomato	tomato	NOUN
ahs-3111	38	10	)	)	PUNCT
ahs-3111	38	11	the	the	DET
ahs-3111	38	12	reduction	reduction	NOUN
ahs-3111	38	13	in	in	ADP
ahs-3111	38	14	the	the	DET
ahs-3111	38	15	fresh	fresh	ADJ
ahs-3111	38	16	yield	yield	NOUN
ahs-3111	38	17	was	be	AUX
ahs-3111	38	18	compensated	compensate	VERB
ahs-3111	38	19	by	by	ADP
ahs-3111	38	20	an	an	DET
ahs-3111	38	21	increase	increase	NOUN
ahs-3111	38	22	in	in	ADP
ahs-3111	38	23	fruit	fruit	NOUN
ahs-3111	38	24	dry	dry	ADJ
ahs-3111	38	25	weight	weight	NOUN
ahs-3111	38	26	and	and	CCONJ
ahs-3111	38	27	other	other	ADJ
ahs-3111	38	28	quality	quality	NOUN
ahs-3111	38	29	parameters	parameter	NOUN
ahs-3111	38	30	(	(	PUNCT
ahs-3111	38	31	mizrahi	mizrahi	PROPN
ahs-3111	38	32	et	et	PROPN
ahs-3111	38	33	al	al	PROPN
ahs-3111	38	34	.	.	PROPN
ahs-3111	38	35	,	,	PUNCT
ahs-3111	38	36	1988	1988	NUM
ahs-3111	38	37	)	)	PUNCT
ahs-3111	38	38	.	.	PUNCT
ahs-3111	39	1	bustan	bustan	PROPN
ahs-3111	39	2	et	et	PROPN
ahs-3111	39	3	al	al	PROPN
ahs-3111	39	4	.	.	PROPN
ahs-3111	40	1	(	(	PUNCT
ahs-3111	40	2	2005	2005	NUM
ahs-3111	40	3	)	)	PUNCT
ahs-3111	40	4	reported	report	VERB
ahs-3111	40	5	that	that	SCONJ
ahs-3111	40	6	the	the	DET
ahs-3111	40	7	combination	combination	NOUN
ahs-3111	40	8	of	of	ADP
ahs-3111	40	9	fresh	fresh	ADJ
ahs-3111	40	10	(	(	PUNCT
ahs-3111	40	11	1.2	1.2	NUM
ahs-3111	40	12	ds	ds	ADJ
ahs-3111	40	13	m-1	m-1	NUM
ahs-3111	40	14	)	)	PUNCT
ahs-3111	40	15	and	and	CCONJ
ahs-3111	40	16	brackish	brackish	ADJ
ahs-3111	40	17	(	(	PUNCT
ahs-3111	40	18	7	7	NUM
ahs-3111	40	19	ds	ds	ADJ
ahs-3111	40	20	m-1	m-1	NUM
ahs-3111	40	21	)	)	PUNCT
ahs-3111	40	22	irrigation	irrigation	NOUN
ahs-3111	40	23	water	water	NOUN
ahs-3111	40	24	increased	increase	VERB
ahs-3111	40	25	the	the	DET
ahs-3111	40	26	yield	yield	NOUN
ahs-3111	40	27	level	level	NOUN
ahs-3111	40	28	of	of	ADP
ahs-3111	40	29	melon	melon	NOUN
ahs-3111	40	30	to	to	ADP
ahs-3111	40	31	that	that	PRON
ahs-3111	40	32	of	of	ADP
ahs-3111	40	33	fresh	fresh	ADJ
ahs-3111	40	34	water	water	NOUN
ahs-3111	40	35	plants	plant	NOUN
ahs-3111	40	36	whereas	whereas	SCONJ
ahs-3111	40	37	it	it	PRON
ahs-3111	40	38	brought	bring	VERB
ahs-3111	40	39	about	about	ADP
ahs-3111	40	40	the	the	DET
ahs-3111	40	41	improvement	improvement	NOUN
ahs-3111	40	42	of	of	ADP
ahs-3111	40	43	fruit	fruit	NOUN
ahs-3111	40	44	quality	quality	NOUN
ahs-3111	40	45	typical	typical	ADJ
ahs-3111	40	46	to	to	ADP
ahs-3111	40	47	brackish	brackish	ADJ
ahs-3111	40	48	water	water	NOUN
ahs-3111	40	49	plants	plant	NOUN
ahs-3111	40	50	,	,	PUNCT
ahs-3111	40	51	thus	thus	ADV
ahs-3111	40	52	providing	provide	VERB
ahs-3111	40	53	an	an	DET
ahs-3111	40	54	attractive	attractive	ADJ
ahs-3111	40	55	approach	approach	NOUN
ahs-3111	40	56	to	to	PART
ahs-3111	40	57	optimize	optimize	VERB
ahs-3111	40	58	late	late	ADJ
ahs-3111	40	59	-	-	PUNCT
ahs-3111	40	60	summer	summer	NOUN
ahs-3111	40	61	melon	melon	NOUN
ahs-3111	40	62	production	production	NOUN
ahs-3111	40	63	.	.	PUNCT
ahs-3111	41	1	plants	plant	NOUN
ahs-3111	41	2	subjected	subject	VERB
ahs-3111	41	3	to	to	ADP
ahs-3111	41	4	saline	saline	VERB
ahs-3111	41	5	environment	environment	NOUN
ahs-3111	41	6	use	use	VERB
ahs-3111	41	7	different	different	ADJ
ahs-3111	41	8	mechanisms	mechanism	NOUN
ahs-3111	41	9	to	to	PART
ahs-3111	41	10	overcome	overcome	VERB
ahs-3111	41	11	such	such	ADJ
ahs-3111	41	12	abiotic	abiotic	ADJ
ahs-3111	41	13	stress	stress	NOUN
ahs-3111	41	14	.	.	PUNCT
ahs-3111	42	1	to	to	PART
ahs-3111	42	2	avoid	avoid	VERB
ahs-3111	42	3	a	a	DET
ahs-3111	42	4	disorder	disorder	NOUN
ahs-3111	42	5	of	of	ADP
ahs-3111	42	6	ion	ion	NOUN
ahs-3111	42	7	homeostasis	homeostasis	NOUN
ahs-3111	42	8	under	under	ADP
ahs-3111	42	9	saline	saline	ADJ
ahs-3111	42	10	conditions	condition	NOUN
ahs-3111	42	11	,	,	PUNCT
ahs-3111	42	12	plant	plant	NOUN
ahs-3111	42	13	cells	cell	NOUN
ahs-3111	42	14	have	have	VERB
ahs-3111	42	15	to	to	PART
ahs-3111	42	16	maintain	maintain	VERB
ahs-3111	42	17	a	a	DET
ahs-3111	42	18	low	low	ADJ
ahs-3111	42	19	na+	na+	NOUN
ahs-3111	42	20	concentration	concentration	NOUN
ahs-3111	42	21	and	and	CCONJ
ahs-3111	42	22	keep	keep	VERB
ahs-3111	42	23	a	a	DET
ahs-3111	42	24	high	high	ADJ
ahs-3111	42	25	h+	h+	X
ahs-3111	42	26	concentration	concentration	NOUN
ahs-3111	42	27	in	in	ADP
ahs-3111	42	28	the	the	DET
ahs-3111	42	29	cytosol	cytosol	NOUN
ahs-3111	42	30	where	where	SCONJ
ahs-3111	42	31	enzymes	enzyme	NOUN
ahs-3111	42	32	for	for	ADP
ahs-3111	42	33	metabolism	metabolism	NOUN
ahs-3111	42	34	are	be	AUX
ahs-3111	42	35	located	locate	VERB
ahs-3111	42	36	(	(	PUNCT
ahs-3111	42	37	zörb	zörb	X
ahs-3111	42	38	et	et	PROPN
ahs-3111	42	39	al	al	PROPN
ahs-3111	42	40	.	.	PROPN
ahs-3111	42	41	,	,	PUNCT
ahs-3111	42	42	2005	2005	NUM
ahs-3111	42	43	)	)	PUNCT
ahs-3111	42	44	.	.	PUNCT
ahs-3111	43	1	usually	usually	ADV
ahs-3111	43	2	,	,	PUNCT
ahs-3111	43	3	plants	plant	NOUN
ahs-3111	43	4	use	use	VERB
ahs-3111	43	5	different	different	ADJ
ahs-3111	43	6	ways	way	NOUN
ahs-3111	43	7	to	to	PART
ahs-3111	43	8	maintain	maintain	VERB
ahs-3111	43	9	a	a	DET
ahs-3111	43	10	low	low	ADJ
ahs-3111	43	11	cytosolic	cytosolic	ADJ
ahs-3111	43	12	sodium	sodium	NOUN
ahs-3111	43	13	concentration	concentration	NOUN
ahs-3111	43	14	,	,	PUNCT
ahs-3111	43	15	including	include	VERB
ahs-3111	43	16	restricting	restrict	VERB
ahs-3111	43	17	na+	na+	NOUN
ahs-3111	43	18	influx	influx	NOUN
ahs-3111	43	19	,	,	PUNCT
ahs-3111	43	20	maintaining	maintain	VERB
ahs-3111	43	21	active	active	ADJ
ahs-3111	43	22	na+	na+	NOUN
ahs-3111	43	23	efflux	efflux	NOUN
ahs-3111	43	24	,	,	PUNCT
ahs-3111	43	25	and	and	CCONJ
ahs-3111	43	26	compartmentalizing	compartmentalize	VERB
ahs-3111	43	27	na+	na+	NOUN
ahs-3111	43	28	into	into	ADP
ahs-3111	43	29	the	the	DET
ahs-3111	43	30	vacuole	vacuole	NOUN
ahs-3111	43	31	,	,	PUNCT
ahs-3111	43	32	etc	etc	X
ahs-3111	43	33	.	.	X
ahs-3111	44	1	(	(	PUNCT
ahs-3111	44	2	rubio	rubio	PROPN
ahs-3111	44	3	et	et	PROPN
ahs-3111	44	4	al	al	PROPN
ahs-3111	44	5	.	.	PROPN
ahs-3111	44	6	,	,	PUNCT
ahs-3111	44	7	1995	1995	NUM
ahs-3111	44	8	)	)	PUNCT
ahs-3111	44	9	.	.	PUNCT
ahs-3111	45	1	these	these	DET
ahs-3111	45	2	mechanisms	mechanism	NOUN
ahs-3111	45	3	involve	involve	VERB
ahs-3111	45	4	a	a	DET
ahs-3111	45	5	number	number	NOUN
ahs-3111	45	6	of	of	ADP
ahs-3111	45	7	na+/h+	na+/h+	ADJ
ahs-3111	45	8	antiporter	antiporter	NOUN
ahs-3111	45	9	proteins	protein	NOUN
ahs-3111	45	10	that	that	PRON
ahs-3111	45	11	are	be	AUX
ahs-3111	45	12	localized	localize	VERB
ahs-3111	45	13	in	in	ADP
ahs-3111	45	14	plant	plant	NOUN
ahs-3111	45	15	plasma	plasma	NOUN
ahs-3111	45	16	and	and	CCONJ
ahs-3111	45	17	vacuolar	vacuolar	ADJ
ahs-3111	45	18	membranes	membrane	NOUN
ahs-3111	45	19	(	(	PUNCT
ahs-3111	45	20	vasekina	vasekina	NOUN
ahs-3111	45	21	et	et	PROPN
ahs-3111	45	22	al	al	PROPN
ahs-3111	45	23	.	.	PROPN
ahs-3111	45	24	,	,	PUNCT
ahs-3111	45	25	2005	2005	NUM
ahs-3111	45	26	)	)	PUNCT
ahs-3111	45	27	.	.	PUNCT
ahs-3111	46	1	they	they	PRON
ahs-3111	46	2	catalyze	catalyze	VERB
ahs-3111	46	3	the	the	DET
ahs-3111	46	4	exchange	exchange	NOUN
ahs-3111	46	5	of	of	ADP
ahs-3111	46	6	na+	na+	NOUN
ahs-3111	46	7	for	for	ADP
ahs-3111	46	8	h+	h+	X
ahs-3111	46	9	across	across	ADP
ahs-3111	46	10	membranes	membrane	NOUN
ahs-3111	46	11	and	and	CCONJ
ahs-3111	46	12	the	the	DET
ahs-3111	46	13	energy	energy	NOUN
ahs-3111	46	14	needed	need	VERB
ahs-3111	46	15	is	be	AUX
ahs-3111	46	16	generated	generate	VERB
ahs-3111	46	17	by	by	ADP
ahs-3111	46	18	the	the	DET
ahs-3111	46	19	h+-adenosine	h+-adenosine	NOUN
ahs-3111	46	20	triphosphatase	triphosphatase	NOUN
ahs-3111	46	21	and	and	CCONJ
ahs-3111	46	22	h+-pyrophosphatase	h+-pyrophosphatase	NOUN
ahs-3111	46	23	(	(	PUNCT
ahs-3111	46	24	niu	niu	PROPN
ahs-3111	46	25	et	et	PROPN
ahs-3111	46	26	al	al	PROPN
ahs-3111	46	27	.	.	PROPN
ahs-3111	46	28	,	,	PUNCT
ahs-3111	46	29	1995	1995	NUM
ahs-3111	46	30	;	;	PUNCT
ahs-3111	46	31	shi	shi	PROPN
ahs-3111	46	32	and	and	CCONJ
ahs-3111	46	33	zhu	zhu	PROPN
ahs-3111	46	34	,	,	PUNCT
ahs-3111	46	35	2002	2002	NUM
ahs-3111	46	36	)	)	PUNCT
ahs-3111	46	37	.	.	PUNCT
ahs-3111	47	1	plants	plant	NOUN
ahs-3111	47	2	exposed	expose	VERB
ahs-3111	47	3	to	to	ADP
ahs-3111	47	4	salt	salt	NOUN
ahs-3111	47	5	stress	stress	NOUN
ahs-3111	47	6	showed	show	VERB
ahs-3111	47	7	enhanced	enhanced	ADJ
ahs-3111	47	8	formation	formation	NOUN
ahs-3111	47	9	of	of	ADP
ahs-3111	47	10	reactive	reactive	ADJ
ahs-3111	47	11	oxygen	oxygen	NOUN
ahs-3111	47	12	species	specie	NOUN
ahs-3111	47	13	(	(	PUNCT
ahs-3111	47	14	ros	ros	PROPN
ahs-3111	47	15	)	)	PUNCT
ahs-3111	47	16	such	such	ADJ
ahs-3111	47	17	as	as	ADP
ahs-3111	47	18	superoxide	superoxide	NOUN
ahs-3111	47	19	anion	anion	NOUN
ahs-3111	47	20	,	,	PUNCT
ahs-3111	47	21	hydrogen	hydrogen	NOUN
ahs-3111	47	22	peroxide	peroxide	NOUN
ahs-3111	47	23	and	and	CCONJ
ahs-3111	47	24	singlet	singlet	ADJ
ahs-3111	47	25	oxygen	oxygen	NOUN
ahs-3111	47	26	(	(	PUNCT
ahs-3111	47	27	mittler	mittler	NOUN
ahs-3111	47	28	,	,	PUNCT
ahs-3111	47	29	2002	2002	NUM
ahs-3111	47	30	)	)	PUNCT
ahs-3111	47	31	.	.	PUNCT
ahs-3111	48	1	the	the	DET
ahs-3111	48	2	harmful	harmful	ADJ
ahs-3111	48	3	effects	effect	NOUN
ahs-3111	48	4	of	of	ADP
ahs-3111	48	5	these	these	DET
ahs-3111	48	6	molecules	molecule	NOUN
ahs-3111	48	7	are	be	AUX
ahs-3111	48	8	referred	refer	VERB
ahs-3111	48	9	to	to	ADP
ahs-3111	48	10	as	as	ADP
ahs-3111	48	11	oxidative	oxidative	ADJ
ahs-3111	48	12	stress	stress	NOUN
ahs-3111	48	13	(	(	PUNCT
ahs-3111	48	14	halliwell	halliwell	NOUN
ahs-3111	48	15	,	,	PUNCT
ahs-3111	48	16	2006	2006	NUM
ahs-3111	48	17	)	)	PUNCT
ahs-3111	48	18	.	.	PUNCT
ahs-3111	49	1	plants	plant	NOUN
ahs-3111	49	2	have	have	AUX
ahs-3111	49	3	evolved	evolve	VERB
ahs-3111	49	4	an	an	DET
ahs-3111	49	5	enzymatic	enzymatic	ADJ
ahs-3111	49	6	antioxidant	antioxidant	ADJ
ahs-3111	49	7	system	system	NOUN
ahs-3111	49	8	to	to	PART
ahs-3111	49	9	reduce	reduce	VERB
ahs-3111	49	10	the	the	DET
ahs-3111	49	11	ros	ros	PROPN
ahs-3111	49	12	levels	level	NOUN
ahs-3111	49	13	.	.	PUNCT
ahs-3111	50	1	this	this	DET
ahs-3111	50	2	enzymatic	enzymatic	ADJ
ahs-3111	50	3	system	system	NOUN
ahs-3111	50	4	includes	include	VERB
ahs-3111	50	5	superoxide	superoxide	NOUN
ahs-3111	50	6	dismutase	dismutase	NOUN
ahs-3111	50	7	,	,	PUNCT
ahs-3111	50	8	catalase	catalase	NOUN
ahs-3111	50	9	,	,	PUNCT
ahs-3111	50	10	ascorbate	ascorbate	NOUN
ahs-3111	50	11	peroxidase	peroxidase	NOUN
ahs-3111	50	12	and	and	CCONJ
ahs-3111	50	13	glutathione	glutathione	NOUN
ahs-3111	50	14	peroxidase	peroxidase	NOUN
ahs-3111	50	15	(	(	PUNCT
ahs-3111	50	16	apel	apel	NOUN
ahs-3111	50	17	and	and	CCONJ
ahs-3111	50	18	hirt	hirt	NOUN
ahs-3111	50	19	,	,	PUNCT
ahs-3111	50	20	2004	2004	NUM
ahs-3111	50	21	)	)	PUNCT
ahs-3111	50	22	.	.	PUNCT
ahs-3111	51	1	the	the	DET
ahs-3111	51	2	development	development	NOUN
ahs-3111	51	3	of	of	ADP
ahs-3111	51	4	salt	salt	NOUN
ahs-3111	51	5	-	-	PUNCT
ahs-3111	51	6	tolerant	tolerant	ADJ
ahs-3111	51	7	crops	crop	NOUN
ahs-3111	51	8	is	be	AUX
ahs-3111	51	9	a	a	DET
ahs-3111	51	10	practical	practical	ADJ
ahs-3111	51	11	solution	solution	NOUN
ahs-3111	51	12	to	to	PART
ahs-3111	51	13	sustain	sustain	VERB
ahs-3111	51	14	agricultural	agricultural	ADJ
ahs-3111	51	15	productivity	productivity	NOUN
ahs-3111	51	16	.	.	PUNCT
ahs-3111	52	1	because	because	SCONJ
ahs-3111	52	2	of	of	ADP
ahs-3111	52	3	the	the	DET
ahs-3111	52	4	complexity	complexity	NOUN
ahs-3111	52	5	of	of	ADP
ahs-3111	52	6	the	the	DET
ahs-3111	52	7	trait	trait	NOUN
ahs-3111	52	8	,	,	PUNCT
ahs-3111	52	9	traditional	traditional	ADJ
ahs-3111	52	10	crop	crop	NOUN
ahs-3111	52	11	-	-	PUNCT
ahs-3111	52	12	breeding	breed	VERB
ahs-3111	52	13	programs	program	NOUN
ahs-3111	52	14	aimed	aim	VERB
ahs-3111	52	15	at	at	ADP
ahs-3111	52	16	improving	improve	VERB
ahs-3111	52	17	tolerance	tolerance	NOUN
ahs-3111	52	18	to	to	ADP
ahs-3111	52	19	salinity	salinity	NOUN
ahs-3111	52	20	have	have	VERB
ahs-3111	52	21	limited	limit	VERB
ahs-3111	52	22	success	success	NOUN
ahs-3111	52	23	.	.	PUNCT
ahs-3111	53	1	therefore	therefore	ADV
ahs-3111	53	2	,	,	PUNCT
ahs-3111	53	3	understanding	understand	VERB
ahs-3111	53	4	the	the	DET
ahs-3111	53	5	cellular	cellular	ADJ
ahs-3111	53	6	and	and	CCONJ
ahs-3111	53	7	molecular	molecular	ADJ
ahs-3111	53	8	bases	basis	NOUN
ahs-3111	53	9	of	of	ADP
ahs-3111	53	10	salinity	salinity	NOUN
ahs-3111	53	11	-	-	PUNCT
ahs-3111	53	12	tolerance	tolerance	NOUN
ahs-3111	53	13	mechanisms	mechanism	NOUN
ahs-3111	53	14	is	be	AUX
ahs-3111	53	15	essential	essential	ADJ
ahs-3111	53	16	for	for	ADP
ahs-3111	53	17	marker	marker	NOUN
ahs-3111	53	18	-	-	PUNCT
ahs-3111	53	19	assisted	assist	VERB
ahs-3111	53	20	selection	selection	NOUN
ahs-3111	53	21	and	and	CCONJ
ahs-3111	53	22	genetic	genetic	ADJ
ahs-3111	53	23	engineering	engineering	NOUN
ahs-3111	53	24	of	of	ADP
ahs-3111	53	25	salt	salt	NOUN
ahs-3111	53	26	tolerance	tolerance	NOUN
ahs-3111	53	27	in	in	ADP
ahs-3111	53	28	economic	economic	ADJ
ahs-3111	53	29	crops	crop	NOUN
ahs-3111	53	30	.	.	PUNCT
ahs-3111	54	1	understanding	understand	VERB
ahs-3111	54	2	the	the	DET
ahs-3111	54	3	responses	response	NOUN
ahs-3111	54	4	of	of	ADP
ahs-3111	54	5	plants	plant	NOUN
ahs-3111	54	6	to	to	ADP
ahs-3111	54	7	the	the	DET
ahs-3111	54	8	major	major	ADJ
ahs-3111	54	9	environmental	environmental	ADJ
ahs-3111	54	10	stressor	stressor	PROPN
ahs-3111	54	11	salinity	salinity	NOUN
ahs-3111	54	12	is	be	AUX
ahs-3111	54	13	an	an	DET
ahs-3111	54	14	important	important	ADJ
ahs-3111	54	15	topic	topic	NOUN
ahs-3111	54	16	for	for	ADP
ahs-3111	54	17	the	the	DET
ahs-3111	54	18	biotechnological	biotechnological	ADJ
ahs-3111	54	19	application	application	NOUN
ahs-3111	54	20	of	of	ADP
ahs-3111	54	21	functional	functional	ADJ
ahs-3111	54	22	mechanisms	mechanism	NOUN
ahs-3111	54	23	of	of	ADP
ahs-3111	54	24	stress	stress	NOUN
ahs-3111	54	25	adaptation	adaptation	NOUN
ahs-3111	54	26	.	.	PUNCT
ahs-3111	55	1	plant	plant	NOUN
ahs-3111	55	2	engineering	engineering	NOUN
ahs-3111	55	3	strategies	strategy	NOUN
ahs-3111	55	4	for	for	ADP
ahs-3111	55	5	cellular	cellular	ADJ
ahs-3111	55	6	and	and	CCONJ
ahs-3111	55	7	metabolic	metabolic	NOUN
ahs-3111	55	8	reprogramming	reprogramme	VERB
ahs-3111	55	9	to	to	PART
ahs-3111	55	10	increase	increase	VERB
ahs-3111	55	11	the	the	DET
ahs-3111	55	12	efficiency	efficiency	NOUN
ahs-3111	55	13	of	of	ADP
ahs-3111	55	14	plant	plant	NOUN
ahs-3111	55	15	adaptive	adaptive	ADJ
ahs-3111	55	16	processes	process	NOUN
ahs-3111	55	17	may	may	AUX
ahs-3111	55	18	either	either	CCONJ
ahs-3111	55	19	focus	focus	VERB
ahs-3111	55	20	on	on	ADP
ahs-3111	55	21	(	(	PUNCT
ahs-3111	55	22	1	1	X
ahs-3111	55	23	)	)	PUNCT
ahs-3111	55	24	conferring	confer	VERB
ahs-3111	55	25	stress	stress	NOUN
ahs-3111	55	26	tolerance	tolerance	NOUN
ahs-3111	55	27	by	by	ADP
ahs-3111	55	28	directly	directly	ADV
ahs-3111	55	29	reprogramming	reprogramme	VERB
ahs-3111	55	30	ion	ion	NOUN
ahs-3111	55	31	transport	transport	NOUN
ahs-3111	55	32	processes	process	NOUN
ahs-3111	55	33	and	and	CCONJ
ahs-3111	55	34	primary	primary	ADJ
ahs-3111	55	35	metabolism	metabolism	NOUN
ahs-3111	55	36	or	or	CCONJ
ahs-3111	55	37	(	(	PUNCT
ahs-3111	55	38	2	2	NUM
ahs-3111	55	39	)	)	PUNCT
ahs-3111	55	40	by	by	ADP
ahs-3111	55	41	modulating	modulate	VERB
ahs-3111	55	42	signaling	signal	VERB
ahs-3111	55	43	and	and	CCONJ
ahs-3111	55	44	regulatory	regulatory	ADJ
ahs-3111	55	45	pathways	pathway	NOUN
ahs-3111	55	46	of	of	ADP
ahs-3111	55	47	the	the	DET
ahs-3111	55	48	adaptive	adaptive	ADJ
ahs-3111	55	49	mechanisms	mechanism	NOUN
ahs-3111	55	50	.	.	PUNCT
ahs-3111	56	1	the	the	DET
ahs-3111	56	2	second	second	ADJ
ahs-3111	56	3	approach	approach	NOUN
ahs-3111	56	4	seems	seem	VERB
ahs-3111	56	5	to	to	PART
ahs-3111	56	6	be	be	AUX
ahs-3111	56	7	more	more	ADJ
ahs-3111	56	8	perspective	perspective	NOUN
ahs-3111	56	9	because	because	SCONJ
ahs-3111	56	10	it	it	PRON
ahs-3111	56	11	is	be	AUX
ahs-3111	56	12	likely	likely	ADJ
ahs-3111	56	13	that	that	SCONJ
ahs-3111	56	14	signaling	signal	VERB
ahs-3111	56	15	and	and	CCONJ
ahs-3111	56	16	regulatory	regulatory	ADJ
ahs-3111	56	17	factors	factor	NOUN
ahs-3111	56	18	orchestrate	orchestrate	VERB
ahs-3111	56	19	as	as	ADP
ahs-3111	56	20	key	key	ADJ
ahs-3111	56	21	signaling	signal	VERB
ahs-3111	56	22	components	component	NOUN
ahs-3111	56	23	the	the	DET
ahs-3111	56	24	transcriptional	transcriptional	ADJ
ahs-3111	56	25	and	and	CCONJ
ahs-3111	56	26	translational	translational	ADJ
ahs-3111	56	27	control	control	NOUN
ahs-3111	56	28	of	of	ADP
ahs-3111	56	29	group	group	NOUN
ahs-3111	56	30	(	(	PUNCT
ahs-3111	56	31	1	1	NUM
ahs-3111	56	32	)	)	PUNCT
ahs-3111	56	33	adaptive	adaptive	ADJ
ahs-3111	56	34	mechanisms	mechanism	NOUN
ahs-3111	56	35	(	(	PUNCT
ahs-3111	56	36	diédhiou	diédhiou	NOUN
ahs-3111	56	37	et	et	PROPN
ahs-3111	56	38	al	al	PROPN
ahs-3111	56	39	.	.	PROPN
ahs-3111	56	40	,	,	PUNCT
ahs-3111	56	41	2008	2008	NUM
ahs-3111	56	42	;	;	PUNCT
ahs-3111	56	43	popova	popova	NOUN
ahs-3111	56	44	et	et	PROPN
ahs-3111	56	45	al	al	PROPN
ahs-3111	56	46	.	.	PROPN
ahs-3111	56	47	,	,	PUNCT
ahs-3111	56	48	2008	2008	NUM
ahs-3111	56	49	)	)	PUNCT
ahs-3111	56	50	.	.	PUNCT
ahs-3111	57	1	most	most	ADJ
ahs-3111	57	2	knowledge	knowledge	NOUN
ahs-3111	57	3	on	on	ADP
ahs-3111	57	4	molecular	molecular	ADJ
ahs-3111	57	5	mechanisms	mechanism	NOUN
ahs-3111	57	6	involved	involve	VERB
ahs-3111	57	7	in	in	ADP
ahs-3111	57	8	plant	plant	NOUN
ahs-3111	57	9	salt	salt	NOUN
ahs-3111	57	10	responses	response	NOUN
ahs-3111	57	11	and	and	CCONJ
ahs-3111	57	12	adaptation	adaptation	NOUN
ahs-3111	57	13	has	have	AUX
ahs-3111	57	14	been	be	AUX
ahs-3111	57	15	derived	derive	VERB
ahs-3111	57	16	from	from	ADP
ahs-3111	57	17	analyses	analysis	NOUN
ahs-3111	57	18	of	of	ADP
ahs-3111	57	19	the	the	DET
ahs-3111	57	20	glycophytic	glycophytic	ADJ
ahs-3111	57	21	models	model	NOUN
ahs-3111	57	22	arabidopsis	arabidopsis	VERB
ahs-3111	57	23	thaliana	thaliana	NOUN
ahs-3111	57	24	and	and	CCONJ
ahs-3111	57	25	rice	rice	NOUN
ahs-3111	57	26	.	.	PUNCT
ahs-3111	58	1	such	such	ADJ
ahs-3111	58	2	knowledge	knowledge	NOUN
ahs-3111	58	3	is	be	AUX
ahs-3111	58	4	lacking	lack	VERB
ahs-3111	58	5	in	in	ADP
ahs-3111	58	6	vitis	vitis	ADJ
ahs-3111	58	7	species	specie	NOUN
ahs-3111	58	8	,	,	PUNCT
ahs-3111	58	9	therefore	therefore	ADV
ahs-3111	58	10	detecting	detect	VERB
ahs-3111	58	11	expression	expression	NOUN
ahs-3111	58	12	changes	change	NOUN
ahs-3111	58	13	of	of	ADP
ahs-3111	58	14	antioxidant	antioxidant	ADJ
ahs-3111	58	15	defense	defense	NOUN
ahs-3111	58	16	genes	gene	NOUN
ahs-3111	58	17	is	be	AUX
ahs-3111	58	18	the	the	DET
ahs-3111	58	19	objective	objective	NOUN
ahs-3111	58	20	of	of	ADP
ahs-3111	58	21	this	this	DET
ahs-3111	58	22	study	study	NOUN
ahs-3111	58	23	.	.	PUNCT
ahs-3111	59	1	since	since	SCONJ
ahs-3111	59	2	the	the	DET
ahs-3111	59	3	understanding	understanding	NOUN
ahs-3111	59	4	of	of	ADP
ahs-3111	59	5	a	a	DET
ahs-3111	59	6	plants	plant	NOUN
ahs-3111	59	7	response	response	NOUN
ahs-3111	59	8	to	to	ADP
ahs-3111	59	9	a	a	DET
ahs-3111	59	10	stress	stress	NOUN
ahs-3111	59	11	requires	require	VERB
ahs-3111	59	12	an	an	DET
ahs-3111	59	13	evaluation	evaluation	NOUN
ahs-3111	59	14	of	of	ADP
ahs-3111	59	15	stress	stress	NOUN
ahs-3111	59	16	induced	induce	VERB
ahs-3111	59	17	changes	change	NOUN
ahs-3111	59	18	in	in	ADP
ahs-3111	59	19	gene	gene	NOUN
ahs-3111	59	20	expression	expression	NOUN
ahs-3111	59	21	,	,	PUNCT
ahs-3111	59	22	the	the	DET
ahs-3111	59	23	expression	expression	NOUN
ahs-3111	59	24	of	of	ADP
ahs-3111	59	25	major	major	ADJ
ahs-3111	59	26	defense	defense	NOUN
ahs-3111	59	27	genes	gene	NOUN
ahs-3111	59	28	(	(	PUNCT
ahs-3111	59	29	superoxide	superoxide	NOUN
ahs-3111	59	30	disqrunfleh	disqrunfleh	NOUN
ahs-3111	59	31	et	et	PROPN
ahs-3111	59	32	al	al	PROPN
ahs-3111	59	33	.	.	PUNCT
ahs-3111	60	1	‘	'	PUNCT
ahs-3111	60	2	superior	superior	ADJ
ahs-3111	60	3	seedless	seedless	NOUN
ahs-3111	60	4	’	'	PUNCT
ahs-3111	60	5	grown	grow	VERB
ahs-3111	60	6	under	under	ADP
ahs-3111	60	7	diluted	diluted	ADJ
ahs-3111	60	8	brackish	brackish	ADJ
ahs-3111	60	9	water	water	NOUN
ahs-3111	60	10	irrigation	irrigation	NOUN
ahs-3111	60	11	.	.	PUNCT
ahs-3111	61	1	ii	ii	PROPN
ahs-3111	61	2	.	.	PUNCT
ahs-3111	62	1	expression	expression	NOUN
ahs-3111	62	2	of	of	ADP
ahs-3111	62	3	antioxidant	antioxidant	ADJ
ahs-3111	62	4	genes	gene	NOUN
ahs-3111	62	5	277	277	NUM
ahs-3111	62	6	mutase	mutase	NOUN
ahs-3111	62	7	,	,	PUNCT
ahs-3111	62	8	ascorbate	ascorbate	NOUN
ahs-3111	62	9	peroxidase	peroxidase	NOUN
ahs-3111	62	10	,	,	PUNCT
ahs-3111	62	11	catalase	catalase	NOUN
ahs-3111	62	12	,	,	PUNCT
ahs-3111	62	13	glutathione	glutathione	NOUN
ahs-3111	62	14	peroxidase	peroxidase	NOUN
ahs-3111	62	15	,	,	PUNCT
ahs-3111	62	16	monodehydroascorbate	monodehydroascorbate	ADJ
ahs-3111	62	17	reductase	reductase	NOUN
ahs-3111	62	18	)	)	PUNCT
ahs-3111	62	19	in	in	ADP
ahs-3111	62	20	‘	'	PUNCT
ahs-3111	62	21	superior	superior	ADJ
ahs-3111	62	22	seedless	seedless	NOUN
ahs-3111	62	23	’	'	PUNCT
ahs-3111	62	24	grafted	graft	VERB
ahs-3111	62	25	on	on	ADP
ahs-3111	62	26	different	different	ADJ
ahs-3111	62	27	rootstocks	rootstock	NOUN
ahs-3111	62	28	has	have	AUX
ahs-3111	62	29	been	be	AUX
ahs-3111	62	30	examined	examine	VERB
ahs-3111	62	31	by	by	ADP
ahs-3111	62	32	rt	rt	NOUN
ahs-3111	62	33	-	-	PUNCT
ahs-3111	62	34	pcr	pcr	NOUN
ahs-3111	62	35	.	.	PUNCT
ahs-3111	63	1	2	2	X
ahs-3111	63	2	.	.	X
ahs-3111	63	3	materials	material	NOUN
ahs-3111	63	4	and	and	CCONJ
ahs-3111	63	5	methods	method	NOUN
ahs-3111	63	6	plant	plant	NOUN
ahs-3111	63	7	material	material	NOUN
ahs-3111	63	8	three	three	NUM
ahs-3111	63	9	grape	grape	NOUN
ahs-3111	63	10	rootstocks	rootstock	NOUN
ahs-3111	63	11	were	be	AUX
ahs-3111	63	12	evaluated	evaluate	VERB
ahs-3111	63	13	in	in	ADP
ahs-3111	63	14	this	this	DET
ahs-3111	63	15	study	study	NOUN
ahs-3111	63	16	:	:	PUNCT
ahs-3111	63	17	r110	r110	PROPN
ahs-3111	63	18	(	(	PUNCT
ahs-3111	63	19	vitis	vitis	NOUN
ahs-3111	63	20	berlandieri	berlandieri	NOUN
ahs-3111	63	21	x	x	PROPN
ahs-3111	63	22	v.	v.	PROPN
ahs-3111	63	23	rupestris	rupestris	PROPN
ahs-3111	63	24	)	)	PUNCT
ahs-3111	63	25	,	,	PUNCT
ahs-3111	63	26	41b	41b	NOUN
ahs-3111	63	27	(	(	PUNCT
ahs-3111	63	28	v.	v.	ADP
ahs-3111	63	29	berlandieri	berlandieri	PROPN
ahs-3111	63	30	x	x	PUNCT
ahs-3111	63	31	v.	v.	ADP
ahs-3111	63	32	vinifera	vinifera	NOUN
ahs-3111	63	33	)	)	PUNCT
ahs-3111	63	34	and	and	CCONJ
ahs-3111	63	35	p1103	p1103	NUM
ahs-3111	63	36	(	(	PUNCT
ahs-3111	63	37	v.	v.	ADP
ahs-3111	63	38	berlandieri	berlandieri	PROPN
ahs-3111	63	39	x	x	PROPN
ahs-3111	63	40	v.	v.	PROPN
ahs-3111	63	41	rupestris	rupestris	PROPN
ahs-3111	63	42	)	)	PUNCT
ahs-3111	63	43	.	.	PUNCT
ahs-3111	64	1	the	the	DET
ahs-3111	64	2	rootstocks	rootstock	NOUN
ahs-3111	64	3	were	be	AUX
ahs-3111	64	4	purchased	purchase	VERB
ahs-3111	64	5	from	from	ADP
ahs-3111	64	6	les	les	PROPN
ahs-3111	64	7	pépiniéristes	pépiniériste	NOUN
ahs-3111	64	8	du	du	PROPN
ahs-3111	64	9	comtat	comtat	NOUN
ahs-3111	64	10	,	,	PUNCT
ahs-3111	64	11	sarrians	sarrian	NOUN
ahs-3111	64	12	,	,	PUNCT
ahs-3111	64	13	france	france	PROPN
ahs-3111	64	14	.	.	PUNCT
ahs-3111	65	1	after	after	ADP
ahs-3111	65	2	being	be	AUX
ahs-3111	65	3	imported	import	VERB
ahs-3111	65	4	,	,	PUNCT
ahs-3111	65	5	‘	'	PUNCT
ahs-3111	65	6	superior	superior	ADJ
ahs-3111	65	7	seedless	seedless	ADJ
ahs-3111	65	8	’	'	PUNCT
ahs-3111	65	9	bud	bud	ADJ
ahs-3111	65	10	cultivar	cultivar	NOUN
ahs-3111	65	11	was	be	AUX
ahs-3111	65	12	grafted	graft	VERB
ahs-3111	65	13	on	on	ADP
ahs-3111	65	14	the	the	DET
ahs-3111	65	15	rootstocks	rootstock	NOUN
ahs-3111	65	16	in	in	ADP
ahs-3111	65	17	a	a	DET
ahs-3111	65	18	local	local	ADJ
ahs-3111	65	19	nursery	nursery	NOUN
ahs-3111	65	20	;	;	PUNCT
ahs-3111	65	21	al	al	PROPN
ahs-3111	65	22	-	-	PUNCT
ahs-3111	65	23	bushra	bushra	PROPN
ahs-3111	65	24	nurseries	nurseries	PROPN
ahs-3111	65	25	,	,	PUNCT
ahs-3111	65	26	may	may	AUX
ahs-3111	65	27	,	,	PUNCT
ahs-3111	65	28	2013	2013	NUM
ahs-3111	65	29	.	.	PUNCT
ahs-3111	66	1	grafted	graft	VERB
ahs-3111	66	2	plant	plant	NOUN
ahs-3111	66	3	materials	material	NOUN
ahs-3111	66	4	were	be	AUX
ahs-3111	66	5	planted	plant	VERB
ahs-3111	66	6	in	in	ADP
ahs-3111	66	7	polyethylene	polyethylene	NOUN
ahs-3111	66	8	bags	bag	NOUN
ahs-3111	66	9	filled	fill	VERB
ahs-3111	66	10	with	with	ADP
ahs-3111	66	11	peatmoss	peatmoss	NOUN
ahs-3111	66	12	.	.	PUNCT
ahs-3111	67	1	the	the	DET
ahs-3111	67	2	one	one	NUM
ahs-3111	67	3	year	year	NOUN
ahs-3111	67	4	old	old	ADJ
ahs-3111	67	5	grafted	graft	VERB
ahs-3111	67	6	grapevine	grapevine	NOUN
ahs-3111	67	7	rootstocks	rootstock	NOUN
ahs-3111	67	8	were	be	AUX
ahs-3111	67	9	grown	grow	VERB
ahs-3111	67	10	for	for	ADP
ahs-3111	67	11	several	several	ADJ
ahs-3111	67	12	months	month	NOUN
ahs-3111	67	13	to	to	PART
ahs-3111	67	14	allow	allow	VERB
ahs-3111	67	15	for	for	ADP
ahs-3111	67	16	the	the	DET
ahs-3111	67	17	formation	formation	NOUN
ahs-3111	67	18	of	of	ADP
ahs-3111	67	19	a	a	DET
ahs-3111	67	20	well	well	ADV
ahs-3111	67	21	developed	develop	VERB
ahs-3111	67	22	root	root	NOUN
ahs-3111	67	23	system	system	NOUN
ahs-3111	67	24	before	before	ADP
ahs-3111	67	25	applying	apply	VERB
ahs-3111	67	26	treatments	treatment	NOUN
ahs-3111	67	27	.	.	PUNCT
ahs-3111	68	1	fertilizers	fertilizer	NOUN
ahs-3111	68	2	and	and	CCONJ
ahs-3111	68	3	fungicides	fungicide	NOUN
ahs-3111	68	4	were	be	AUX
ahs-3111	68	5	applied	apply	VERB
ahs-3111	68	6	as	as	ADP
ahs-3111	68	7	necessary	necessary	ADJ
ahs-3111	68	8	.	.	PUNCT
ahs-3111	69	1	soil	soil	NOUN
ahs-3111	69	2	and	and	CCONJ
ahs-3111	69	3	water	water	NOUN
ahs-3111	69	4	the	the	DET
ahs-3111	69	5	soil	soil	NOUN
ahs-3111	69	6	was	be	AUX
ahs-3111	69	7	brought	bring	VERB
ahs-3111	69	8	from	from	ADP
ahs-3111	69	9	the	the	DET
ahs-3111	69	10	southern	southern	PROPN
ahs-3111	69	11	jordan	jordan	PROPN
ahs-3111	69	12	valley	valley	PROPN
ahs-3111	69	13	.	.	PUNCT
ahs-3111	70	1	soil	soil	NOUN
ahs-3111	70	2	was	be	AUX
ahs-3111	70	3	crushed	crush	VERB
ahs-3111	70	4	and	and	CCONJ
ahs-3111	70	5	sieved	sieve	VERB
ahs-3111	70	6	through	through	ADP
ahs-3111	70	7	1	1	NUM
ahs-3111	70	8	cm	cm	NOUN
ahs-3111	70	9	sieve	sieve	NOUN
ahs-3111	70	10	and	and	CCONJ
ahs-3111	70	11	plastic	plastic	ADJ
ahs-3111	70	12	pots	pot	NOUN
ahs-3111	70	13	(	(	PUNCT
ahs-3111	70	14	the	the	DET
ahs-3111	70	15	working	work	VERB
ahs-3111	70	16	volume	volume	NOUN
ahs-3111	70	17	of	of	ADP
ahs-3111	70	18	the	the	DET
ahs-3111	70	19	pots	pot	NOUN
ahs-3111	70	20	was	be	AUX
ahs-3111	70	21	44	44	NUM
ahs-3111	70	22	l	l	NOUN
ahs-3111	70	23	)	)	PUNCT
ahs-3111	70	24	were	be	AUX
ahs-3111	70	25	filled	fill	VERB
ahs-3111	70	26	with	with	ADP
ahs-3111	70	27	50	50	NUM
ahs-3111	70	28	kg	kg	NOUN
ahs-3111	70	29	each	each	PRON
ahs-3111	70	30	in	in	ADP
ahs-3111	70	31	order	order	NOUN
ahs-3111	70	32	to	to	PART
ahs-3111	70	33	roughly	roughly	ADV
ahs-3111	70	34	have	have	AUX
ahs-3111	70	35	a	a	DET
ahs-3111	70	36	bulk	bulk	ADJ
ahs-3111	70	37	density	density	NOUN
ahs-3111	70	38	of	of	ADP
ahs-3111	70	39	1.14	1.14	NUM
ahs-3111	70	40	g	g	NOUN
ahs-3111	70	41	cm-3	cm-3	NOUN
ahs-3111	70	42	.	.	PUNCT
ahs-3111	71	1	the	the	DET
ahs-3111	71	2	bulk	bulk	ADJ
ahs-3111	71	3	density	density	NOUN
ahs-3111	71	4	is	be	AUX
ahs-3111	71	5	within	within	ADP
ahs-3111	71	6	the	the	DET
ahs-3111	71	7	typical	typical	ADJ
ahs-3111	71	8	range	range	NOUN
ahs-3111	71	9	of	of	ADP
ahs-3111	71	10	bulk	bulk	ADJ
ahs-3111	71	11	densities	density	NOUN
ahs-3111	71	12	of	of	ADP
ahs-3111	71	13	agricultural	agricultural	ADJ
ahs-3111	71	14	soils	soil	NOUN
ahs-3111	71	15	.	.	PUNCT
ahs-3111	72	1	if	if	SCONJ
ahs-3111	72	2	bulk	bulk	ADJ
ahs-3111	72	3	density	density	NOUN
ahs-3111	72	4	was	be	AUX
ahs-3111	72	5	higher	high	ADJ
ahs-3111	72	6	,	,	PUNCT
ahs-3111	72	7	infiltration	infiltration	NOUN
ahs-3111	72	8	would	would	AUX
ahs-3111	72	9	be	be	AUX
ahs-3111	72	10	very	very	ADV
ahs-3111	72	11	slower	slow	ADJ
ahs-3111	72	12	and	and	CCONJ
ahs-3111	72	13	hydraulic	hydraulic	ADJ
ahs-3111	72	14	conductivity	conductivity	NOUN
ahs-3111	72	15	would	would	AUX
ahs-3111	72	16	be	be	AUX
ahs-3111	72	17	slower	slow	ADJ
ahs-3111	72	18	as	as	ADV
ahs-3111	72	19	well	well	ADV
ahs-3111	72	20	.	.	PUNCT
ahs-3111	73	1	low	low	ADJ
ahs-3111	73	2	hydraulic	hydraulic	ADJ
ahs-3111	73	3	conductivity	conductivity	NOUN
ahs-3111	73	4	would	would	AUX
ahs-3111	73	5	exacerbate	exacerbate	VERB
ahs-3111	73	6	the	the	DET
ahs-3111	73	7	osmotic	osmotic	ADJ
ahs-3111	73	8	effect	effect	NOUN
ahs-3111	73	9	and	and	CCONJ
ahs-3111	73	10	create	create	VERB
ahs-3111	73	11	anoxic	anoxic	ADJ
ahs-3111	73	12	conditions	condition	NOUN
ahs-3111	73	13	.	.	PUNCT
ahs-3111	74	1	the	the	DET
ahs-3111	74	2	pots	pot	NOUN
ahs-3111	74	3	were	be	AUX
ahs-3111	74	4	placed	place	VERB
ahs-3111	74	5	in	in	ADP
ahs-3111	74	6	a	a	DET
ahs-3111	74	7	controlled	control	VERB
ahs-3111	74	8	greenhouse	greenhouse	NOUN
ahs-3111	74	9	.	.	PUNCT
ahs-3111	75	1	grafted	graft	VERB
ahs-3111	75	2	grapevines	grapevine	NOUN
ahs-3111	75	3	were	be	AUX
ahs-3111	75	4	transplanted	transplant	VERB
ahs-3111	75	5	in	in	ADP
ahs-3111	75	6	february	february	PROPN
ahs-3111	75	7	and	and	CCONJ
ahs-3111	75	8	the	the	DET
ahs-3111	75	9	growth	growth	NOUN
ahs-3111	75	10	was	be	AUX
ahs-3111	75	11	unified	unify	VERB
ahs-3111	75	12	based	base	VERB
ahs-3111	75	13	on	on	ADP
ahs-3111	75	14	the	the	DET
ahs-3111	75	15	number	number	NOUN
ahs-3111	75	16	of	of	ADP
ahs-3111	75	17	buds	bud	NOUN
ahs-3111	75	18	and	and	CCONJ
ahs-3111	75	19	root	root	NOUN
ahs-3111	75	20	length	length	NOUN
ahs-3111	75	21	.	.	PUNCT
ahs-3111	76	1	the	the	DET
ahs-3111	76	2	root	root	NOUN
ahs-3111	76	3	system	system	NOUN
ahs-3111	76	4	was	be	AUX
ahs-3111	76	5	cut	cut	VERB
ahs-3111	76	6	back	back	ADV
ahs-3111	76	7	to	to	ADP
ahs-3111	76	8	15	15	NUM
ahs-3111	76	9	cm	cm	NOUN
ahs-3111	76	10	in	in	ADP
ahs-3111	76	11	length	length	NOUN
ahs-3111	76	12	and	and	CCONJ
ahs-3111	76	13	the	the	DET
ahs-3111	76	14	vegetative	vegetative	ADJ
ahs-3111	76	15	system	system	NOUN
ahs-3111	76	16	was	be	AUX
ahs-3111	76	17	cut	cut	VERB
ahs-3111	76	18	back	back	ADV
ahs-3111	76	19	to	to	ADP
ahs-3111	76	20	eight	eight	NUM
ahs-3111	76	21	buds	bud	NOUN
ahs-3111	76	22	.	.	PUNCT
ahs-3111	77	1	the	the	DET
ahs-3111	77	2	water	water	NOUN
ahs-3111	77	3	was	be	AUX
ahs-3111	77	4	brought	bring	VERB
ahs-3111	77	5	from	from	ADP
ahs-3111	77	6	al	al	PROPN
ahs-3111	77	7	-	-	PUNCT
ahs-3111	77	8	karameh	karameh	PROPN
ahs-3111	77	9	dam	dam	NOUN
ahs-3111	77	10	located	locate	VERB
ahs-3111	77	11	in	in	ADP
ahs-3111	77	12	the	the	DET
ahs-3111	77	13	jordan	jordan	PROPN
ahs-3111	77	14	valley	valley	PROPN
ahs-3111	77	15	and	and	CCONJ
ahs-3111	77	16	stored	store	VERB
ahs-3111	77	17	in	in	ADP
ahs-3111	77	18	a	a	DET
ahs-3111	77	19	galvanized	galvanized	ADJ
ahs-3111	77	20	tank	tank	NOUN
ahs-3111	77	21	.	.	PUNCT
ahs-3111	78	1	three	three	NUM
ahs-3111	78	2	levels	level	NOUN
ahs-3111	78	3	of	of	ADP
ahs-3111	78	4	irrigation	irrigation	NOUN
ahs-3111	78	5	water	water	NOUN
ahs-3111	78	6	salinity	salinity	NOUN
ahs-3111	78	7	;	;	PUNCT
ahs-3111	78	8	in	in	ADP
ahs-3111	78	9	terms	term	NOUN
ahs-3111	78	10	of	of	ADP
ahs-3111	78	11	electrical	electrical	ADJ
ahs-3111	78	12	conductivity	conductivity	NOUN
ahs-3111	78	13	(	(	PUNCT
ahs-3111	78	14	ec	ec	PROPN
ahs-3111	78	15	)	)	PUNCT
ahs-3111	78	16	,	,	PUNCT
ahs-3111	78	17	were	be	AUX
ahs-3111	78	18	applied	apply	VERB
ahs-3111	78	19	:	:	PUNCT
ahs-3111	78	20	1.5	1.5	NUM
ahs-3111	78	21	,	,	PUNCT
ahs-3111	78	22	3.0	3.0	NUM
ahs-3111	78	23	and	and	CCONJ
ahs-3111	78	24	5.0	5.0	NUM
ahs-3111	78	25	ds	ds	ADJ
ahs-3111	78	26	m-1	m-1	NUM
ahs-3111	78	27	in	in	ADP
ahs-3111	78	28	addition	addition	NOUN
ahs-3111	78	29	to	to	ADP
ahs-3111	78	30	the	the	DET
ahs-3111	78	31	0.8	0.8	NUM
ahs-3111	78	32	ds	ds	PROPN
ahs-3111	78	33	m-1	m-1	PROPN
ahs-3111	78	34	control	control	PROPN
ahs-3111	78	35	.	.	PUNCT
ahs-3111	79	1	these	these	DET
ahs-3111	79	2	three	three	NUM
ahs-3111	79	3	levels	level	NOUN
ahs-3111	79	4	of	of	ADP
ahs-3111	79	5	diluted	dilute	VERB
ahs-3111	79	6	brackish	brackish	ADJ
ahs-3111	79	7	water	water	NOUN
ahs-3111	79	8	were	be	AUX
ahs-3111	79	9	used	use	VERB
ahs-3111	79	10	to	to	PART
ahs-3111	79	11	find	find	VERB
ahs-3111	79	12	out	out	ADP
ahs-3111	79	13	the	the	DET
ahs-3111	79	14	salt	salt	NOUN
ahs-3111	79	15	level	level	NOUN
ahs-3111	79	16	that	that	PRON
ahs-3111	79	17	would	would	AUX
ahs-3111	79	18	result	result	VERB
ahs-3111	79	19	in	in	ADP
ahs-3111	79	20	a	a	DET
ahs-3111	79	21	tolerable	tolerable	ADJ
ahs-3111	79	22	“	"	PUNCT
ahs-3111	79	23	adverse	adverse	ADJ
ahs-3111	79	24	”	"	PUNCT
ahs-3111	79	25	effect	effect	NOUN
ahs-3111	79	26	to	to	PART
ahs-3111	79	27	design	design	VERB
ahs-3111	79	28	alternate	alternate	ADJ
ahs-3111	79	29	irrigation	irrigation	NOUN
ahs-3111	79	30	that	that	PRON
ahs-3111	79	31	would	would	AUX
ahs-3111	79	32	contribute	contribute	VERB
ahs-3111	79	33	to	to	ADP
ahs-3111	79	34	water	water	NOUN
ahs-3111	79	35	saving	saving	NOUN
ahs-3111	79	36	.	.	PUNCT
ahs-3111	80	1	these	these	DET
ahs-3111	80	2	concentrations	concentration	NOUN
ahs-3111	80	3	were	be	AUX
ahs-3111	80	4	selected	select	VERB
ahs-3111	80	5	based	base	VERB
ahs-3111	80	6	upon	upon	SCONJ
ahs-3111	80	7	the	the	DET
ahs-3111	80	8	threshold	threshold	NOUN
ahs-3111	80	9	ec	ec	PROPN
ahs-3111	80	10	of	of	ADP
ahs-3111	80	11	grapes	grape	NOUN
ahs-3111	80	12	(	(	PUNCT
ahs-3111	80	13	i.e.	i.e.	X
ahs-3111	80	14	ec<2	ec<2	PROPN
ahs-3111	80	15	ds	ds	ADJ
ahs-3111	80	16	m-1	m-1	NUM
ahs-3111	80	17	)	)	PUNCT
ahs-3111	80	18	.	.	PUNCT
ahs-3111	81	1	the	the	DET
ahs-3111	81	2	treatments	treatment	NOUN
ahs-3111	81	3	were	be	AUX
ahs-3111	81	4	prepared	prepare	VERB
ahs-3111	81	5	by	by	ADP
ahs-3111	81	6	mixing	mix	VERB
ahs-3111	81	7	the	the	DET
ahs-3111	81	8	dam	dam	NOUN
ahs-3111	81	9	water	water	NOUN
ahs-3111	81	10	with	with	ADP
ahs-3111	81	11	tap	tap	NOUN
ahs-3111	81	12	water	water	NOUN
ahs-3111	81	13	.	.	PUNCT
ahs-3111	82	1	a	a	DET
ahs-3111	82	2	portable	portable	ADJ
ahs-3111	82	3	conductivity	conductivity	NOUN
ahs-3111	82	4	meter	meter	NOUN
ahs-3111	82	5	(	(	PUNCT
ahs-3111	82	6	model	model	NOUN
ahs-3111	82	7	cond	cond	PROPN
ahs-3111	82	8	3210	3210	NUM
ahs-3111	82	9	,	,	PUNCT
ahs-3111	82	10	wtw	wtw	PROPN
ahs-3111	82	11	,	,	PUNCT
ahs-3111	82	12	germany	germany	PROPN
ahs-3111	82	13	)	)	PUNCT
ahs-3111	82	14	was	be	AUX
ahs-3111	82	15	used	use	VERB
ahs-3111	82	16	to	to	PART
ahs-3111	82	17	measure	measure	VERB
ahs-3111	82	18	the	the	DET
ahs-3111	82	19	ec	ec	PROPN
ahs-3111	82	20	and	and	CCONJ
ahs-3111	82	21	to	to	PART
ahs-3111	82	22	obtain	obtain	VERB
ahs-3111	82	23	the	the	DET
ahs-3111	82	24	determined	determined	ADJ
ahs-3111	82	25	salinity	salinity	NOUN
ahs-3111	82	26	levels	level	NOUN
ahs-3111	82	27	.	.	PUNCT
ahs-3111	83	1	the	the	DET
ahs-3111	83	2	twelve	twelve	NUM
ahs-3111	83	3	treatments	treatment	NOUN
ahs-3111	83	4	were	be	AUX
ahs-3111	83	5	arranged	arrange	VERB
ahs-3111	83	6	in	in	ADP
ahs-3111	83	7	a	a	DET
ahs-3111	83	8	randomized	randomized	ADJ
ahs-3111	83	9	complete	complete	ADJ
ahs-3111	83	10	block	block	NOUN
ahs-3111	83	11	design	design	NOUN
ahs-3111	83	12	with	with	ADP
ahs-3111	83	13	three	three	NUM
ahs-3111	83	14	replicates	replicate	NOUN
ahs-3111	83	15	.	.	PUNCT
ahs-3111	84	1	the	the	DET
ahs-3111	84	2	grafted	graft	VERB
ahs-3111	84	3	grapevines	grapevine	NOUN
ahs-3111	84	4	started	start	VERB
ahs-3111	84	5	to	to	PART
ahs-3111	84	6	break	break	VERB
ahs-3111	84	7	the	the	DET
ahs-3111	84	8	dormancy	dormancy	NOUN
ahs-3111	84	9	period	period	NOUN
ahs-3111	84	10	during	during	ADP
ahs-3111	84	11	spring	spring	NOUN
ahs-3111	84	12	.	.	PUNCT
ahs-3111	85	1	composite	composite	ADJ
ahs-3111	85	2	fertilizer	fertilizer	NOUN
ahs-3111	85	3	(	(	PUNCT
ahs-3111	85	4	20:20:20	20:20:20	NUM
ahs-3111	85	5	)	)	PUNCT
ahs-3111	85	6	,	,	PUNCT
ahs-3111	85	7	urea	urea	NOUN
ahs-3111	85	8	and	and	CCONJ
ahs-3111	85	9	ammonium	ammonium	NOUN
ahs-3111	85	10	sulphate	sulphate	NOUN
ahs-3111	85	11	were	be	AUX
ahs-3111	85	12	also	also	ADV
ahs-3111	85	13	applied	apply	VERB
ahs-3111	85	14	to	to	ADP
ahs-3111	85	15	the	the	DET
ahs-3111	85	16	grapevines	grapevine	NOUN
ahs-3111	85	17	and	and	CCONJ
ahs-3111	85	18	growth	growth	NOUN
ahs-3111	85	19	was	be	AUX
ahs-3111	85	20	again	again	ADV
ahs-3111	85	21	unified	unify	VERB
ahs-3111	85	22	before	before	ADP
ahs-3111	85	23	applying	apply	VERB
ahs-3111	85	24	the	the	DET
ahs-3111	85	25	assigned	assign	VERB
ahs-3111	85	26	treatments	treatment	NOUN
ahs-3111	85	27	.	.	PUNCT
ahs-3111	86	1	irrigation	irrigation	NOUN
ahs-3111	86	2	with	with	ADP
ahs-3111	86	3	the	the	DET
ahs-3111	86	4	assigned	assign	VERB
ahs-3111	86	5	treatments	treatment	NOUN
ahs-3111	86	6	started	start	VERB
ahs-3111	86	7	in	in	ADP
ahs-3111	86	8	may	may	PROPN
ahs-3111	86	9	.	.	PUNCT
ahs-3111	87	1	all	all	DET
ahs-3111	87	2	pots	pot	NOUN
ahs-3111	87	3	received	receive	VERB
ahs-3111	87	4	the	the	DET
ahs-3111	87	5	same	same	ADJ
ahs-3111	87	6	amount	amount	NOUN
ahs-3111	87	7	of	of	ADP
ahs-3111	87	8	water	water	NOUN
ahs-3111	87	9	whenever	whenever	SCONJ
ahs-3111	87	10	irrigation	irrigation	NOUN
ahs-3111	87	11	was	be	AUX
ahs-3111	87	12	applied	apply	VERB
ahs-3111	87	13	.	.	PUNCT
ahs-3111	88	1	each	each	DET
ahs-3111	88	2	pot	pot	NOUN
ahs-3111	88	3	received	receive	VERB
ahs-3111	88	4	a	a	DET
ahs-3111	88	5	total	total	ADJ
ahs-3111	88	6	amount	amount	NOUN
ahs-3111	88	7	of	of	ADP
ahs-3111	88	8	irrigation	irrigation	NOUN
ahs-3111	88	9	water	water	NOUN
ahs-3111	88	10	equal	equal	ADJ
ahs-3111	88	11	to	to	ADP
ahs-3111	88	12	446	446	NUM
ahs-3111	88	13	mm	mm	NOUN
ahs-3111	88	14	.	.	PUNCT
ahs-3111	89	1	irrigation	irrigation	NOUN
ahs-3111	89	2	was	be	AUX
ahs-3111	89	3	scheduled	schedule	VERB
ahs-3111	89	4	according	accord	VERB
ahs-3111	89	5	to	to	ADP
ahs-3111	89	6	evaporation	evaporation	NOUN
ahs-3111	89	7	readings	reading	NOUN
ahs-3111	89	8	from	from	ADP
ahs-3111	89	9	free	free	ADJ
ahs-3111	89	10	water	water	NOUN
ahs-3111	89	11	surface	surface	NOUN
ahs-3111	89	12	(	(	PUNCT
ahs-3111	89	13	in	in	ADP
ahs-3111	89	14	mm	mm	PROPN
ahs-3111	89	15	)	)	PUNCT
ahs-3111	89	16	taken	take	VERB
ahs-3111	89	17	every	every	DET
ahs-3111	89	18	48	48	NUM
ahs-3111	89	19	hours	hour	NOUN
ahs-3111	89	20	and	and	CCONJ
ahs-3111	89	21	corrected	correct	VERB
ahs-3111	89	22	using	use	VERB
ahs-3111	89	23	proper	proper	ADJ
ahs-3111	89	24	grapevine	grapevine	NOUN
ahs-3111	89	25	crop	crop	NOUN
ahs-3111	89	26	coefficient	coefficient	NOUN
ahs-3111	89	27	of	of	ADP
ahs-3111	89	28	0.30	0.30	NUM
ahs-3111	89	29	(	(	PUNCT
ahs-3111	89	30	according	accord	VERB
ahs-3111	89	31	to	to	ADP
ahs-3111	89	32	food	food	NOUN
ahs-3111	89	33	and	and	CCONJ
ahs-3111	89	34	agriculture	agriculture	NOUN
ahs-3111	89	35	organization	organization	NOUN
ahs-3111	89	36	)	)	PUNCT
ahs-3111	89	37	.	.	PUNCT
ahs-3111	90	1	dna	dna	PROPN
ahs-3111	90	2	and	and	CCONJ
ahs-3111	90	3	rna	rna	NOUN
ahs-3111	90	4	extraction	extraction	NOUN
ahs-3111	90	5	leaves	leave	NOUN
ahs-3111	90	6	were	be	AUX
ahs-3111	90	7	sampled	sample	VERB
ahs-3111	90	8	starting	start	VERB
ahs-3111	90	9	from	from	ADP
ahs-3111	90	10	february	february	PROPN
ahs-3111	90	11	until	until	ADP
ahs-3111	90	12	november	november	PROPN
ahs-3111	90	13	,	,	PUNCT
ahs-3111	90	14	2014	2014	NUM
ahs-3111	90	15	(	(	PUNCT
ahs-3111	90	16	every	every	DET
ahs-3111	90	17	two	two	NUM
ahs-3111	90	18	weeks	week	NOUN
ahs-3111	90	19	)	)	PUNCT
ahs-3111	90	20	and	and	CCONJ
ahs-3111	90	21	frozen	freeze	VERB
ahs-3111	90	22	in	in	ADP
ahs-3111	90	23	liquid	liquid	ADJ
ahs-3111	90	24	nitrogen	nitrogen	NOUN
ahs-3111	90	25	for	for	ADP
ahs-3111	90	26	analyzing	analyze	VERB
ahs-3111	90	27	dna	dna	PROPN
ahs-3111	90	28	and	and	CCONJ
ahs-3111	90	29	rna	rna	NOUN
ahs-3111	90	30	using	use	VERB
ahs-3111	90	31	kits	kit	NOUN
ahs-3111	90	32	(	(	PUNCT
ahs-3111	90	33	intron	intron	PROPN
ahs-3111	90	34	,	,	PUNCT
ahs-3111	90	35	korea	korea	PROPN
ahs-3111	90	36	)	)	PUNCT
ahs-3111	90	37	.	.	PUNCT
ahs-3111	91	1	total	total	ADJ
ahs-3111	91	2	rna	rna	PROPN
ahs-3111	91	3	was	be	AUX
ahs-3111	91	4	extracted	extract	VERB
ahs-3111	91	5	from	from	ADP
ahs-3111	91	6	frozen	frozen	ADJ
ahs-3111	91	7	leaf	leaf	NOUN
ahs-3111	91	8	samples	sample	NOUN
ahs-3111	91	9	with	with	ADP
ahs-3111	91	10	the	the	DET
ahs-3111	91	11	iqeasy	iqeasy	ADJ
ahs-3111	91	12	™	™	ADJ
ahs-3111	91	13	plus	plus	CCONJ
ahs-3111	91	14	plant	plant	NOUN
ahs-3111	91	15	rna	rna	NOUN
ahs-3111	91	16	extraction	extraction	NOUN
ahs-3111	91	17	mini	mini	NOUN
ahs-3111	91	18	kit	kit	NOUN
ahs-3111	91	19	(	(	PUNCT
ahs-3111	91	20	intron	intron	ADJ
ahs-3111	91	21	biotechnology	biotechnology	NOUN
ahs-3111	91	22	,	,	PUNCT
ahs-3111	91	23	korea	korea	PROPN
ahs-3111	91	24	)	)	PUNCT
ahs-3111	91	25	according	accord	VERB
ahs-3111	91	26	to	to	ADP
ahs-3111	91	27	user	user	NOUN
ahs-3111	91	28	’s	’s	PART
ahs-3111	91	29	manual	manual	NOUN
ahs-3111	91	30	.	.	PUNCT
ahs-3111	92	1	rna	rna	NOUN
ahs-3111	92	2	concentration	concentration	NOUN
ahs-3111	92	3	and	and	CCONJ
ahs-3111	92	4	purity	purity	NOUN
ahs-3111	92	5	were	be	AUX
ahs-3111	92	6	estimated	estimate	VERB
ahs-3111	92	7	based	base	VERB
ahs-3111	92	8	on	on	ADP
ahs-3111	92	9	absorbance	absorbance	NOUN
ahs-3111	92	10	at	at	ADP
ahs-3111	92	11	260	260	NUM
ahs-3111	92	12	and	and	CCONJ
ahs-3111	92	13	280	280	NUM
ahs-3111	92	14	nm	nm	NOUN
ahs-3111	92	15	.	.	PUNCT
ahs-3111	93	1	two	two	NUM
ahs-3111	93	2	microgram	microgram	NOUN
ahs-3111	93	3	of	of	ADP
ahs-3111	93	4	rna	rna	PROPN
ahs-3111	93	5	was	be	AUX
ahs-3111	93	6	used	use	VERB
ahs-3111	93	7	to	to	PART
ahs-3111	93	8	reverse	reverse	VERB
ahs-3111	93	9	transcribe	transcribe	VERB
ahs-3111	93	10	the	the	DET
ahs-3111	93	11	first	first	ADJ
ahs-3111	93	12	strand	strand	NOUN
ahs-3111	93	13	cdna	cdna	PROPN
ahs-3111	93	14	using	use	VERB
ahs-3111	93	15	power	power	NOUN
ahs-3111	93	16	cdna	cdna	PROPN
ahs-3111	93	17	synthesis	synthesis	NOUN
ahs-3111	93	18	system	system	NOUN
ahs-3111	93	19	(	(	PUNCT
ahs-3111	93	20	intron	intron	ADJ
ahs-3111	93	21	biotechnology	biotechnology	NOUN
ahs-3111	93	22	,	,	PUNCT
ahs-3111	93	23	korea	korea	PROPN
ahs-3111	93	24	)	)	PUNCT
ahs-3111	93	25	according	accord	VERB
ahs-3111	93	26	to	to	ADP
ahs-3111	93	27	the	the	DET
ahs-3111	93	28	manufacturer	manufacturer	NOUN
ahs-3111	93	29	’s	’s	PART
ahs-3111	93	30	protocols	protocol	NOUN
ahs-3111	93	31	with	with	ADP
ahs-3111	93	32	oligo	oligo	NOUN
ahs-3111	93	33	(	(	PUNCT
ahs-3111	93	34	dt)15	dt)15	PROPN
ahs-3111	93	35	as	as	ADP
ahs-3111	93	36	a	a	DET
ahs-3111	93	37	primer	primer	NOUN
ahs-3111	93	38	in	in	ADP
ahs-3111	93	39	a	a	DET
ahs-3111	93	40	reaction	reaction	NOUN
ahs-3111	93	41	volume	volume	NOUN
ahs-3111	93	42	of	of	ADP
ahs-3111	93	43	20	20	NUM
ahs-3111	93	44	µl	µl	NOUN
ahs-3111	93	45	.	.	PUNCT
ahs-3111	94	1	the	the	DET
ahs-3111	94	2	first	first	ADJ
ahs-3111	94	3	strand	strand	NOUN
ahs-3111	94	4	cdnas	cdna	NOUN
ahs-3111	94	5	generated	generate	VERB
ahs-3111	94	6	for	for	ADP
ahs-3111	94	7	all	all	DET
ahs-3111	94	8	the	the	DET
ahs-3111	94	9	samples	sample	NOUN
ahs-3111	94	10	were	be	AUX
ahs-3111	94	11	used	use	VERB
ahs-3111	94	12	for	for	ADP
ahs-3111	94	13	semi	semi	ADJ
ahs-3111	94	14	-	-	ADJ
ahs-3111	94	15	quantitative	quantitative	ADJ
ahs-3111	94	16	rt	rt	NOUN
ahs-3111	94	17	-	-	PUNCT
ahs-3111	94	18	pcr	pcr	NOUN
ahs-3111	94	19	to	to	PART
ahs-3111	94	20	monitor	monitor	VERB
ahs-3111	94	21	the	the	DET
ahs-3111	94	22	transcript	transcript	NOUN
ahs-3111	94	23	levels	level	NOUN
ahs-3111	94	24	.	.	PUNCT
ahs-3111	95	1	the	the	DET
ahs-3111	95	2	gene	gene	NOUN
ahs-3111	95	3	-	-	PUNCT
ahs-3111	95	4	specific	specific	ADJ
ahs-3111	95	5	primers	primer	NOUN
ahs-3111	95	6	for	for	ADP
ahs-3111	95	7	rt	rt	NOUN
ahs-3111	95	8	-	-	PUNCT
ahs-3111	95	9	pcr	pcr	PROPN
ahs-3111	95	10	were	be	AUX
ahs-3111	95	11	designed	design	VERB
ahs-3111	95	12	based	base	VERB
ahs-3111	95	13	on	on	ADP
ahs-3111	95	14	the	the	DET
ahs-3111	95	15	basis	basis	NOUN
ahs-3111	95	16	of	of	ADP
ahs-3111	95	17	the	the	DET
ahs-3111	95	18	sequences	sequence	NOUN
ahs-3111	95	19	published	publish	VERB
ahs-3111	95	20	in	in	ADP
ahs-3111	95	21	genbank	genbank	NOUN
ahs-3111	95	22	using	use	VERB
ahs-3111	95	23	the	the	DET
ahs-3111	95	24	software	software	NOUN
ahs-3111	95	25	primer	primer	NOUN
ahs-3111	95	26	-	-	PUNCT
ahs-3111	95	27	blast	blast	NOUN
ahs-3111	95	28	(	(	PUNCT
ahs-3111	96	1	http://www.ncbi.nlm.nih.gov/	http://www.ncbi.nlm.nih.gov/	ADP
ahs-3111	96	2	tools	tool	NOUN
ahs-3111	96	3	/	/	SYM
ahs-3111	96	4	primer	primer	NOUN
ahs-3111	96	5	-	-	PUNCT
ahs-3111	96	6	blast	blast	NOUN
ahs-3111	96	7	/	/	SYM
ahs-3111	96	8	index.cgi?link_loc	index.cgi?link_loc	NOUN
ahs-3111	96	9	=	=	SYM
ahs-3111	96	10	blasthome	blasthome	NOUN
ahs-3111	96	11	)	)	PUNCT
ahs-3111	96	12	.	.	PUNCT
ahs-3111	97	1	the	the	DET
ahs-3111	97	2	ef-1α	ef-1α	PROPN
ahs-3111	97	3	gene	gene	NOUN
ahs-3111	97	4	was	be	AUX
ahs-3111	97	5	selected	select	VERB
ahs-3111	97	6	as	as	ADP
ahs-3111	97	7	a	a	DET
ahs-3111	97	8	reference	reference	NOUN
ahs-3111	97	9	gene	gene	NOUN
ahs-3111	97	10	.	.	PUNCT
ahs-3111	98	1	the	the	DET
ahs-3111	98	2	primer	primer	NOUN
ahs-3111	98	3	sequences	sequence	NOUN
ahs-3111	98	4	are	be	AUX
ahs-3111	98	5	listed	list	VERB
ahs-3111	98	6	in	in	ADP
ahs-3111	98	7	table	table	NOUN
ahs-3111	98	8	(	(	PUNCT
ahs-3111	98	9	1	1	NUM
ahs-3111	98	10	)	)	PUNCT
ahs-3111	98	11	.	.	PUNCT
ahs-3111	99	1	the	the	DET
ahs-3111	99	2	pcr	pcr	PROPN
ahs-3111	99	3	reaction	reaction	NOUN
ahs-3111	99	4	was	be	AUX
ahs-3111	99	5	performed	perform	VERB
ahs-3111	99	6	using	use	VERB
ahs-3111	99	7	intron	intron	ADJ
ahs-3111	99	8	i	i	PROPN
ahs-3111	99	9	-	-	PUNCT
ahs-3111	99	10	maxtm	maxtm	PROPN
ahs-3111	99	11	ii	ii	NOUN
ahs-3111	99	12	system	system	NOUN
ahs-3111	99	13	(	(	PUNCT
ahs-3111	99	14	intron	intron	PROPN
ahs-3111	99	15	,	,	PUNCT
ahs-3111	99	16	korea	korea	PROPN
ahs-3111	99	17	)	)	PUNCT
ahs-3111	99	18	.	.	PUNCT
ahs-3111	100	1	the	the	DET
ahs-3111	100	2	same	same	ADJ
ahs-3111	100	3	thermal	thermal	ADJ
ahs-3111	100	4	profile	profile	NOUN
ahs-3111	100	5	was	be	AUX
ahs-3111	100	6	used	use	VERB
ahs-3111	100	7	for	for	ADP
ahs-3111	100	8	all	all	DET
ahs-3111	100	9	pcr	pcr	ADJ
ahs-3111	100	10	reactions	reaction	NOUN
ahs-3111	100	11	;	;	PUNCT
ahs-3111	100	12	pcr	pcr	PROPN
ahs-3111	100	13	was	be	AUX
ahs-3111	100	14	initiated	initiate	VERB
ahs-3111	100	15	with	with	ADP
ahs-3111	100	16	enzyme	enzyme	NOUN
ahs-3111	100	17	activation	activation	NOUN
ahs-3111	100	18	at	at	ADP
ahs-3111	100	19	95	95	NUM
ahs-3111	100	20	°	°	ADP
ahs-3111	100	21	c	c	NOUN
ahs-3111	100	22	for	for	ADP
ahs-3111	100	23	2	2	NUM
ahs-3111	100	24	min	min	NOUN
ahs-3111	100	25	followed	follow	VERB
ahs-3111	100	26	by	by	ADP
ahs-3111	100	27	32	32	NUM
ahs-3111	100	28	cycles	cycle	NOUN
ahs-3111	100	29	of	of	ADP
ahs-3111	100	30	40s	40	NOUN
ahs-3111	100	31	at	at	ADP
ahs-3111	100	32	95	95	NUM
ahs-3111	100	33	°	°	NOUN
ahs-3111	100	34	c	c	NOUN
ahs-3111	100	35	,	,	PUNCT
ahs-3111	100	36	40s	40s	NUM
ahs-3111	100	37	at	at	ADP
ahs-3111	100	38	56	56	NUM
ahs-3111	100	39	°	°	NOUN
ahs-3111	100	40	c	c	NOUN
ahs-3111	100	41	and	and	CCONJ
ahs-3111	100	42	1	1	NUM
ahs-3111	100	43	min	min	NOUN
ahs-3111	100	44	at	at	ADP
ahs-3111	100	45	72	72	NUM
ahs-3111	100	46	°	°	NOUN
ahs-3111	100	47	c	c	NOUN
ahs-3111	100	48	.	.	PUNCT
ahs-3111	101	1	different	different	ADJ
ahs-3111	101	2	amplification	amplification	NOUN
ahs-3111	101	3	cycles	cycle	NOUN
ahs-3111	101	4	were	be	AUX
ahs-3111	101	5	tried	try	VERB
ahs-3111	101	6	and	and	CCONJ
ahs-3111	101	7	the	the	DET
ahs-3111	101	8	product	product	NOUN
ahs-3111	101	9	of	of	ADP
ahs-3111	101	10	the	the	DET
ahs-3111	101	11	32	32	NUM
ahs-3111	101	12	cycles	cycle	NOUN
ahs-3111	101	13	was	be	AUX
ahs-3111	101	14	selected	select	VERB
ahs-3111	101	15	to	to	PART
ahs-3111	101	16	be	be	AUX
ahs-3111	101	17	presented	present	VERB
ahs-3111	101	18	.	.	PUNCT
ahs-3111	102	1	all	all	DET
ahs-3111	102	2	rt	rt	ADJ
ahs-3111	102	3	-	-	PUNCT
ahs-3111	102	4	pcr	pcr	ADJ
ahs-3111	102	5	products	product	NOUN
ahs-3111	102	6	were	be	AUX
ahs-3111	102	7	loaded	load	VERB
ahs-3111	102	8	in	in	ADP
ahs-3111	102	9	ethidium	ethidium	ADJ
ahs-3111	102	10	bromide	bromide	NOUN
ahs-3111	102	11	-	-	PUNCT
ahs-3111	102	12	stained	stain	VERB
ahs-3111	102	13	1.5	1.5	NUM
ahs-3111	102	14	%	%	NOUN
ahs-3111	102	15	(	(	PUNCT
ahs-3111	102	16	w	w	NOUN
ahs-3111	102	17	/	/	SYM
ahs-3111	102	18	v	v	NOUN
ahs-3111	102	19	)	)	PUNCT
ahs-3111	102	20	agarose	agarose	NOUN
ahs-3111	102	21	gel	gel	NOUN
ahs-3111	102	22	.	.	PUNCT
ahs-3111	103	1	adv	adv	PROPN
ahs-3111	103	2	.	.	PUNCT
ahs-3111	104	1	hort	hort	PROPN
ahs-3111	104	2	.	.	PUNCT
ahs-3111	105	1	sci	sci	PROPN
ahs-3111	105	2	.	.	PROPN
ahs-3111	105	3	,	,	PUNCT
ahs-3111	105	4	2017	2017	NUM
ahs-3111	105	5	31(4	31(4	NUM
ahs-3111	105	6	):	):	PUNCT
ahs-3111	105	7	275	275	NUM
ahs-3111	105	8	-	-	SYM
ahs-3111	105	9	280	280	NUM
ahs-3111	105	10	278	278	NUM
ahs-3111	105	11	3	3	NUM
ahs-3111	105	12	.	.	PUNCT
ahs-3111	105	13	results	result	NOUN
ahs-3111	105	14	and	and	CCONJ
ahs-3111	105	15	discussion	discussion	NOUN
ahs-3111	105	16	as	as	ADP
ahs-3111	105	17	an	an	DET
ahs-3111	105	18	abiotic	abiotic	ADJ
ahs-3111	105	19	stress	stress	NOUN
ahs-3111	105	20	,	,	PUNCT
ahs-3111	105	21	salinity	salinity	NOUN
ahs-3111	105	22	induces	induce	VERB
ahs-3111	105	23	oxidative	oxidative	ADJ
ahs-3111	105	24	damage	damage	NOUN
ahs-3111	105	25	in	in	ADP
ahs-3111	105	26	plant	plant	NOUN
ahs-3111	105	27	cells	cell	NOUN
ahs-3111	105	28	through	through	ADP
ahs-3111	105	29	the	the	DET
ahs-3111	105	30	increased	increase	VERB
ahs-3111	105	31	generation	generation	NOUN
ahs-3111	105	32	of	of	ADP
ahs-3111	105	33	reactive	reactive	ADJ
ahs-3111	105	34	oxygen	oxygen	NOUN
ahs-3111	105	35	species	specie	NOUN
ahs-3111	105	36	(	(	PUNCT
ahs-3111	105	37	ros	ros	PROPN
ahs-3111	105	38	)	)	PUNCT
ahs-3111	105	39	in	in	ADP
ahs-3111	105	40	different	different	ADJ
ahs-3111	105	41	cell	cell	NOUN
ahs-3111	105	42	compartments	compartment	NOUN
ahs-3111	105	43	(	(	PUNCT
ahs-3111	105	44	mittler	mittler	NOUN
ahs-3111	105	45	,	,	PUNCT
ahs-3111	105	46	2002	2002	NUM
ahs-3111	105	47	)	)	PUNCT
ahs-3111	105	48	.	.	PUNCT
ahs-3111	106	1	the	the	DET
ahs-3111	106	2	activation	activation	NOUN
ahs-3111	106	3	of	of	ADP
ahs-3111	106	4	antioxidant	antioxidant	ADJ
ahs-3111	106	5	defense	defense	NOUN
ahs-3111	106	6	system	system	NOUN
ahs-3111	106	7	reduces	reduce	VERB
ahs-3111	106	8	the	the	DET
ahs-3111	106	9	level	level	NOUN
ahs-3111	106	10	of	of	ADP
ahs-3111	106	11	ros	ros	PROPN
ahs-3111	106	12	and	and	CCONJ
ahs-3111	106	13	minimizes	minimize	VERB
ahs-3111	106	14	the	the	DET
ahs-3111	106	15	impact	impact	NOUN
ahs-3111	106	16	of	of	ADP
ahs-3111	106	17	oxidative	oxidative	ADJ
ahs-3111	106	18	stress	stress	NOUN
ahs-3111	106	19	and	and	CCONJ
ahs-3111	106	20	its	its	PRON
ahs-3111	106	21	associated	associated	ADJ
ahs-3111	106	22	damage	damage	NOUN
ahs-3111	106	23	.	.	PUNCT
ahs-3111	107	1	plant	plant	NOUN
ahs-3111	107	2	cells	cell	NOUN
ahs-3111	107	3	possess	possess	VERB
ahs-3111	107	4	antioxidant	antioxidant	ADJ
ahs-3111	107	5	enzymes	enzyme	NOUN
ahs-3111	107	6	which	which	PRON
ahs-3111	107	7	have	have	VERB
ahs-3111	107	8	the	the	DET
ahs-3111	107	9	ability	ability	NOUN
ahs-3111	107	10	to	to	PART
ahs-3111	107	11	detoxify	detoxify	VERB
ahs-3111	107	12	toxic	toxic	ADJ
ahs-3111	107	13	ros	ros	PROPN
ahs-3111	107	14	(	(	PUNCT
ahs-3111	107	15	apel	apel	NOUN
ahs-3111	107	16	and	and	CCONJ
ahs-3111	107	17	hirt	hirt	NOUN
ahs-3111	107	18	,	,	PUNCT
ahs-3111	107	19	2004	2004	NUM
ahs-3111	107	20	)	)	PUNCT
ahs-3111	107	21	.	.	PUNCT
ahs-3111	108	1	rootstock	rootstock	NOUN
ahs-3111	108	2	choice	choice	NOUN
ahs-3111	108	3	should	should	AUX
ahs-3111	108	4	be	be	AUX
ahs-3111	108	5	taken	take	VERB
ahs-3111	108	6	with	with	ADP
ahs-3111	108	7	careful	careful	ADJ
ahs-3111	108	8	consideration	consideration	NOUN
ahs-3111	108	9	since	since	SCONJ
ahs-3111	108	10	the	the	DET
ahs-3111	108	11	scion	scion	NOUN
ahs-3111	108	12	is	be	AUX
ahs-3111	108	13	dependent	dependent	ADJ
ahs-3111	108	14	on	on	ADP
ahs-3111	108	15	the	the	DET
ahs-3111	108	16	rootstock	rootstock	NOUN
ahs-3111	108	17	(	(	PUNCT
ahs-3111	108	18	creasy	creasy	NOUN
ahs-3111	108	19	and	and	CCONJ
ahs-3111	108	20	creasy	creasy	NOUN
ahs-3111	108	21	,	,	PUNCT
ahs-3111	108	22	2009	2009	NUM
ahs-3111	108	23	)	)	PUNCT
ahs-3111	108	24	.	.	PUNCT
ahs-3111	109	1	novel	novel	ADJ
ahs-3111	109	2	rootstocks	rootstock	NOUN
ahs-3111	109	3	are	be	AUX
ahs-3111	109	4	frequently	frequently	ADV
ahs-3111	109	5	used	use	VERB
ahs-3111	109	6	to	to	PART
ahs-3111	109	7	confer	confer	VERB
ahs-3111	109	8	resistance	resistance	NOUN
ahs-3111	109	9	to	to	ADP
ahs-3111	109	10	environmental	environmental	ADJ
ahs-3111	109	11	adversities	adversity	NOUN
ahs-3111	109	12	in	in	ADP
ahs-3111	109	13	horticultural	horticultural	ADJ
ahs-3111	109	14	crops	crop	NOUN
ahs-3111	109	15	(	(	PUNCT
ahs-3111	109	16	albacete	albacete	PROPN
ahs-3111	109	17	et	et	PROPN
ahs-3111	109	18	al	al	PROPN
ahs-3111	109	19	.	.	PROPN
ahs-3111	109	20	,	,	PUNCT
ahs-3111	109	21	2015	2015	NUM
ahs-3111	109	22	)	)	PUNCT
ahs-3111	109	23	.	.	PUNCT
ahs-3111	110	1	a	a	DET
ahs-3111	110	2	promising	promising	ADJ
ahs-3111	110	3	approach	approach	NOUN
ahs-3111	110	4	to	to	PART
ahs-3111	110	5	improve	improve	VERB
ahs-3111	110	6	salt	salt	NOUN
ahs-3111	110	7	tolerance	tolerance	NOUN
ahs-3111	110	8	of	of	ADP
ahs-3111	110	9	horticultural	horticultural	ADJ
ahs-3111	110	10	species	specie	NOUN
ahs-3111	110	11	is	be	AUX
ahs-3111	110	12	the	the	DET
ahs-3111	110	13	use	use	NOUN
ahs-3111	110	14	of	of	ADP
ahs-3111	110	15	grafting	graft	VERB
ahs-3111	110	16	on	on	ADP
ahs-3111	110	17	salt	salt	NOUN
ahs-3111	110	18	-	-	PUNCT
ahs-3111	110	19	tolerant	tolerant	ADJ
ahs-3111	110	20	rootstocks	rootstock	NOUN
ahs-3111	110	21	(	(	PUNCT
ahs-3111	110	22	colla	colla	X
ahs-3111	110	23	et	et	NOUN
ahs-3111	110	24	al	al	PROPN
ahs-3111	110	25	.	.	PROPN
ahs-3111	110	26	,	,	PUNCT
ahs-3111	110	27	2010	2010	NUM
ahs-3111	110	28	;	;	PUNCT
ahs-3111	110	29	giuffrida	giuffrida	PROPN
ahs-3111	110	30	et	et	PROPN
ahs-3111	110	31	al	al	PROPN
ahs-3111	110	32	.	.	PROPN
ahs-3111	110	33	,	,	PUNCT
ahs-3111	110	34	2014	2014	NUM
ahs-3111	110	35	;	;	PUNCT
ahs-3111	110	36	simpson	simpson	PROPN
ahs-3111	110	37	et	et	PROPN
ahs-3111	110	38	al	al	PROPN
ahs-3111	110	39	.	.	PROPN
ahs-3111	110	40	,	,	PUNCT
ahs-3111	110	41	2015	2015	NUM
ahs-3111	110	42	;	;	PUNCT
ahs-3111	110	43	zrig	zrig	NOUN
ahs-3111	110	44	et	et	PROPN
ahs-3111	110	45	al	al	PROPN
ahs-3111	110	46	.	.	PROPN
ahs-3111	110	47	,	,	PUNCT
ahs-3111	110	48	2016	2016	NUM
ahs-3111	110	49	)	)	PUNCT
ahs-3111	110	50	.	.	PUNCT
ahs-3111	111	1	grapevine	grapevine	NOUN
ahs-3111	111	2	rootstock	rootstock	NOUN
ahs-3111	111	3	selection	selection	NOUN
ahs-3111	111	4	is	be	AUX
ahs-3111	111	5	a	a	DET
ahs-3111	111	6	key	key	ADJ
ahs-3111	111	7	factor	factor	NOUN
ahs-3111	111	8	and	and	CCONJ
ahs-3111	111	9	could	could	AUX
ahs-3111	111	10	be	be	AUX
ahs-3111	111	11	considered	consider	VERB
ahs-3111	111	12	an	an	DET
ahs-3111	111	13	important	important	ADJ
ahs-3111	111	14	strategy	strategy	NOUN
ahs-3111	111	15	to	to	PART
ahs-3111	111	16	mitigate	mitigate	VERB
ahs-3111	111	17	salinity	salinity	NOUN
ahs-3111	111	18	stress	stress	NOUN
ahs-3111	111	19	.	.	PUNCT
ahs-3111	112	1	grape	grape	NOUN
ahs-3111	112	2	rootstocks	rootstock	NOUN
ahs-3111	112	3	do	do	AUX
ahs-3111	112	4	influence	influence	VERB
ahs-3111	112	5	the	the	DET
ahs-3111	112	6	scion	scion	NOUN
ahs-3111	112	7	cultivar	cultivar	NOUN
ahs-3111	112	8	in	in	ADP
ahs-3111	112	9	many	many	ADJ
ahs-3111	112	10	growth	growth	NOUN
ahs-3111	112	11	and	and	CCONJ
ahs-3111	112	12	physiological	physiological	ADJ
ahs-3111	112	13	aspects	aspect	NOUN
ahs-3111	112	14	(	(	PUNCT
ahs-3111	112	15	gu	gu	NOUN
ahs-3111	112	16	,	,	PUNCT
ahs-3111	112	17	2003	2003	NUM
ahs-3111	112	18	)	)	PUNCT
ahs-3111	112	19	.	.	PUNCT
ahs-3111	113	1	however	however	ADV
ahs-3111	113	2	,	,	PUNCT
ahs-3111	113	3	some	some	DET
ahs-3111	113	4	contradictions	contradiction	NOUN
ahs-3111	113	5	can	can	AUX
ahs-3111	113	6	be	be	AUX
ahs-3111	113	7	found	find	VERB
ahs-3111	113	8	in	in	ADP
ahs-3111	113	9	the	the	DET
ahs-3111	113	10	literature	literature	NOUN
ahs-3111	113	11	in	in	ADP
ahs-3111	113	12	terms	term	NOUN
ahs-3111	113	13	of	of	ADP
ahs-3111	113	14	the	the	DET
ahs-3111	113	15	salt	salt	NOUN
ahs-3111	113	16	tolerance	tolerance	NOUN
ahs-3111	113	17	of	of	ADP
ahs-3111	113	18	grapevine	grapevine	NOUN
ahs-3111	113	19	rootstocks	rootstock	NOUN
ahs-3111	113	20	implying	imply	VERB
ahs-3111	113	21	that	that	SCONJ
ahs-3111	113	22	various	various	ADJ
ahs-3111	113	23	factors	factor	NOUN
ahs-3111	113	24	are	be	AUX
ahs-3111	113	25	involved	involve	VERB
ahs-3111	113	26	,	,	PUNCT
ahs-3111	113	27	which	which	PRON
ahs-3111	113	28	eventually	eventually	ADV
ahs-3111	113	29	determine	determine	VERB
ahs-3111	113	30	grapevine	grapevine	NOUN
ahs-3111	113	31	response	response	NOUN
ahs-3111	113	32	to	to	PART
ahs-3111	113	33	salt	salt	VERB
ahs-3111	113	34	stress	stress	NOUN
ahs-3111	113	35	.	.	PUNCT
ahs-3111	114	1	for	for	ADP
ahs-3111	114	2	example	example	NOUN
ahs-3111	114	3	,	,	PUNCT
ahs-3111	114	4	southey	southey	PROPN
ahs-3111	114	5	and	and	CCONJ
ahs-3111	114	6	jooste	jooste	PROPN
ahs-3111	114	7	(	(	PUNCT
ahs-3111	114	8	1991	1991	NUM
ahs-3111	114	9	)	)	PUNCT
ahs-3111	114	10	found	find	VERB
ahs-3111	114	11	that	that	SCONJ
ahs-3111	114	12	american	american	ADJ
ahs-3111	114	13	hybrids	hybrid	NOUN
ahs-3111	114	14	performed	perform	VERB
ahs-3111	114	15	poorly	poorly	ADV
ahs-3111	114	16	in	in	ADP
ahs-3111	114	17	response	response	NOUN
ahs-3111	114	18	to	to	ADP
ahs-3111	114	19	salinity	salinity	NOUN
ahs-3111	114	20	when	when	SCONJ
ahs-3111	114	21	used	use	VERB
ahs-3111	114	22	as	as	ADP
ahs-3111	114	23	rootstocks	rootstock	NOUN
ahs-3111	114	24	for	for	ADP
ahs-3111	114	25	the	the	DET
ahs-3111	114	26	cultivar	cultivar	NOUN
ahs-3111	114	27	‘	'	PUNCT
ahs-3111	114	28	colombard	colombard	ADJ
ahs-3111	114	29	’	'	PUNCT
ahs-3111	114	30	.	.	PUNCT
ahs-3111	115	1	in	in	ADP
ahs-3111	115	2	addition	addition	NOUN
ahs-3111	115	3	,	,	PUNCT
ahs-3111	115	4	cavagnaro	cavagnaro	NOUN
ahs-3111	115	5	et	et	NOUN
ahs-3111	115	6	al	al	PROPN
ahs-3111	115	7	.	.	PROPN
ahs-3111	115	8	(	(	PUNCT
ahs-3111	115	9	2006	2006	NUM
ahs-3111	115	10	)	)	PUNCT
ahs-3111	115	11	concluded	conclude	VERB
ahs-3111	115	12	that	that	SCONJ
ahs-3111	115	13	argentinean	argentinean	PROPN
ahs-3111	115	14	cultivars	cultivar	NOUN
ahs-3111	115	15	performed	perform	VERB
ahs-3111	115	16	better	well	ADV
ahs-3111	115	17	than	than	ADP
ahs-3111	115	18	european	european	ADJ
ahs-3111	115	19	cultivars	cultivar	NOUN
ahs-3111	115	20	in	in	ADP
ahs-3111	115	21	an	an	DET
ahs-3111	115	22	in	in	X
ahs-3111	115	23	vitro	vitro	X
ahs-3111	115	24	salinity	salinity	NOUN
ahs-3111	115	25	evaluation	evaluation	NOUN
ahs-3111	115	26	study	study	NOUN
ahs-3111	115	27	.	.	PUNCT
ahs-3111	116	1	regarding	regard	VERB
ahs-3111	116	2	differences	difference	NOUN
ahs-3111	116	3	in	in	ADP
ahs-3111	116	4	ranking	rank	VERB
ahs-3111	116	5	rootstocks	rootstock	NOUN
ahs-3111	116	6	,	,	PUNCT
ahs-3111	116	7	dardeniz	dardeniz	VERB
ahs-3111	116	8	et	et	PROPN
ahs-3111	116	9	al	al	PROPN
ahs-3111	116	10	.	.	PROPN
ahs-3111	117	1	(	(	PUNCT
ahs-3111	117	2	2006	2006	NUM
ahs-3111	117	3	)	)	PUNCT
ahs-3111	117	4	indicated	indicate	VERB
ahs-3111	117	5	that	that	SCONJ
ahs-3111	117	6	41b	41b	NOUN
ahs-3111	117	7	was	be	AUX
ahs-3111	117	8	the	the	DET
ahs-3111	117	9	most	most	ADV
ahs-3111	117	10	salt	salt	NOUN
ahs-3111	117	11	resistant	resistant	ADJ
ahs-3111	117	12	rootstock	rootstock	NOUN
ahs-3111	117	13	,	,	PUNCT
ahs-3111	117	14	followed	follow	VERB
ahs-3111	117	15	by	by	ADP
ahs-3111	117	16	140ru	140ru	PROPN
ahs-3111	117	17	and	and	CCONJ
ahs-3111	117	18	p1103	p1103	NOUN
ahs-3111	117	19	,	,	PUNCT
ahs-3111	117	20	and	and	CCONJ
ahs-3111	117	21	the	the	DET
ahs-3111	117	22	least	least	ADJ
ahs-3111	117	23	resistant	resistant	ADJ
ahs-3111	117	24	was	be	AUX
ahs-3111	117	25	5	5	NUM
ahs-3111	117	26	bb	bb	NOUN
ahs-3111	117	27	.	.	PUNCT
ahs-3111	118	1	on	on	ADP
ahs-3111	118	2	the	the	DET
ahs-3111	118	3	other	other	ADJ
ahs-3111	118	4	hand	hand	NOUN
ahs-3111	118	5	,	,	PUNCT
ahs-3111	118	6	walker	walker	PROPN
ahs-3111	118	7	et	et	PROPN
ahs-3111	118	8	al	al	PROPN
ahs-3111	118	9	.	.	PROPN
ahs-3111	119	1	(	(	PUNCT
ahs-3111	119	2	2002	2002	NUM
ahs-3111	119	3	)	)	PUNCT
ahs-3111	119	4	showed	show	VERB
ahs-3111	119	5	that	that	SCONJ
ahs-3111	119	6	the	the	DET
ahs-3111	119	7	highest	high	ADJ
ahs-3111	119	8	salt	salt	NOUN
ahs-3111	119	9	resistance	resistance	NOUN
ahs-3111	119	10	was	be	AUX
ahs-3111	119	11	obtained	obtain	VERB
ahs-3111	119	12	when	when	SCONJ
ahs-3111	119	13	p1003	p1003	NOUN
ahs-3111	119	14	was	be	AUX
ahs-3111	119	15	used	use	VERB
ahs-3111	119	16	as	as	ADP
ahs-3111	119	17	a	a	DET
ahs-3111	119	18	rootstock	rootstock	NOUN
ahs-3111	119	19	.	.	PUNCT
ahs-3111	120	1	to	to	PART
ahs-3111	120	2	determine	determine	VERB
ahs-3111	120	3	whether	whether	SCONJ
ahs-3111	120	4	nacl	nacl	NOUN
ahs-3111	120	5	-	-	PUNCT
ahs-3111	120	6	induced	induced	ADJ
ahs-3111	120	7	stress	stress	NOUN
ahs-3111	120	8	and	and	CCONJ
ahs-3111	120	9	rootstock	rootstock	NOUN
ahs-3111	120	10	type	type	NOUN
ahs-3111	120	11	were	be	AUX
ahs-3111	120	12	able	able	ADJ
ahs-3111	120	13	to	to	PART
ahs-3111	120	14	regulate	regulate	VERB
ahs-3111	120	15	the	the	DET
ahs-3111	120	16	expression	expression	NOUN
ahs-3111	120	17	levels	level	NOUN
ahs-3111	120	18	of	of	ADP
ahs-3111	120	19	genes	gene	NOUN
ahs-3111	120	20	responsible	responsible	ADJ
ahs-3111	120	21	for	for	ADP
ahs-3111	120	22	antioxidant	antioxidant	ADJ
ahs-3111	120	23	defense	defense	NOUN
ahs-3111	120	24	response	response	NOUN
ahs-3111	120	25	,	,	PUNCT
ahs-3111	120	26	a	a	DET
ahs-3111	120	27	semi	semi	ADJ
ahs-3111	120	28	-	-	ADJ
ahs-3111	120	29	quantitative	quantitative	ADJ
ahs-3111	120	30	rt	rt	ADJ
ahs-3111	120	31	-	-	PUNCT
ahs-3111	120	32	pcr	pcr	ADJ
ahs-3111	120	33	assay	assay	NOUN
ahs-3111	120	34	was	be	AUX
ahs-3111	120	35	performed	perform	VERB
ahs-3111	120	36	for	for	ADP
ahs-3111	120	37	the	the	DET
ahs-3111	120	38	analysis	analysis	NOUN
ahs-3111	120	39	of	of	ADP
ahs-3111	120	40	six	six	NUM
ahs-3111	120	41	major	major	ADJ
ahs-3111	120	42	antioxidant	antioxidant	ADJ
ahs-3111	120	43	enzyme	enzyme	NOUN
ahs-3111	120	44	genes	gene	NOUN
ahs-3111	120	45	(	(	PUNCT
ahs-3111	120	46	apx	apx	NOUN
ahs-3111	120	47	,	,	PUNCT
ahs-3111	120	48	cat	cat	NOUN
ahs-3111	120	49	,	,	PUNCT
ahs-3111	120	50	cuzn	cuzn	ADJ
ahs-3111	120	51	-	-	PUNCT
ahs-3111	120	52	sod	sod	NOUN
ahs-3111	120	53	,	,	PUNCT
ahs-3111	120	54	mn	mn	NOUN
ahs-3111	120	55	-	-	PUNCT
ahs-3111	120	56	sod	sod	NOUN
ahs-3111	120	57	,	,	PUNCT
ahs-3111	120	58	gpx	gpx	NOUN
ahs-3111	120	59	,	,	PUNCT
ahs-3111	120	60	and	and	CCONJ
ahs-3111	120	61	mdar	mdar	NOUN
ahs-3111	120	62	)	)	PUNCT
ahs-3111	120	63	(	(	PUNCT
ahs-3111	120	64	fig	fig	NOUN
ahs-3111	120	65	.	.	PUNCT
ahs-3111	121	1	1	1	NUM
ahs-3111	121	2	)	)	PUNCT
ahs-3111	121	3	.	.	PUNCT
ahs-3111	122	1	table	table	NOUN
ahs-3111	122	2	1	1	NUM
ahs-3111	122	3	primer	primer	NOUN
ahs-3111	122	4	pairs	pair	NOUN
ahs-3111	122	5	used	use	VERB
ahs-3111	122	6	in	in	ADP
ahs-3111	122	7	gene	gene	NOUN
ahs-3111	122	8	expression	expression	NOUN
ahs-3111	122	9	analysis	analysis	NOUN
ahs-3111	122	10	gene	gene	NOUN
ahs-3111	122	11	genebank	genebank	NOUN
ahs-3111	122	12	i	i	PROPN
ahs-3111	122	13	d	d	PROPN
ahs-3111	122	14	primer	primer	NOUN
ahs-3111	122	15	pairs	pair	NOUN
ahs-3111	122	16	(	(	PUNCT
ahs-3111	122	17	5'→3	5'→3	NUM
ahs-3111	122	18	'	'	NOUN
ahs-3111	122	19	)	)	PUNCT
ahs-3111	122	20	amplicon	amplicon	NOUN
ahs-3111	122	21	size	size	NOUN
ahs-3111	122	22	(	(	PUNCT
ahs-3111	122	23	bp	bp	PROPN
ahs-3111	122	24	)	)	PUNCT
ahs-3111	122	25	ascorbate	ascorbate	NOUN
ahs-3111	122	26	peroxidase	peroxidase	NOUN
ahs-3111	123	1	eu280159	eu280159	PROPN
ahs-3111	123	2	f	f	X
ahs-3111	123	3	:	:	PUNCT
ahs-3111	123	4	gacaatgaagcacccagaggag	gacaatgaagcacccagaggag	NOUN
ahs-3111	123	5	542	542	NUM
ahs-3111	123	6	(	(	PUNCT
ahs-3111	123	7	apx	apx	NOUN
ahs-3111	123	8	)	)	PUNCT
ahs-3111	123	9	r	r	NOUN
ahs-3111	123	10	:	:	PUNCT
ahs-3111	123	11	aatgggcttcagcatagtcagc	aatgggcttcagcatagtcagc	ADJ
ahs-3111	123	12	cuzn	cuzn	NOUN
ahs-3111	123	13	-	-	PUNCT
ahs-3111	123	14	superoxide	superoxide	NOUN
ahs-3111	123	15	dismutase	dismutase	NOUN
ahs-3111	124	1	af056622	af056622	PROPN
ahs-3111	124	2	f	f	NOUN
ahs-3111	124	3	:	:	PUNCT
ahs-3111	124	4	ctgctccatctcgtgtctttct	ctgctccatctcgtgtctttct	NOUN
ahs-3111	124	5	452	452	NUM
ahs-3111	124	6	(	(	PUNCT
ahs-3111	124	7	cuzn	cuzn	ADJ
ahs-3111	124	8	-	-	PUNCT
ahs-3111	124	9	sod	sod	NOUN
ahs-3111	124	10	)	)	PUNCT
ahs-3111	124	11	r	r	NOUN
ahs-3111	124	12	:	:	PUNCT
ahs-3111	124	13	atccacaattgttgcttcagcc	atccacaattgttgcttcagcc	ADP
ahs-3111	124	14	mn	mn	PROPN
ahs-3111	124	15	-	-	PUNCT
ahs-3111	124	16	superoxide	superoxide	NOUN
ahs-3111	124	17	dismutase	dismutase	NOUN
ahs-3111	124	18	np_001268135	np_001268135	X
ahs-3111	124	19	f	f	NOUN
ahs-3111	124	20	:	:	PUNCT
ahs-3111	124	21	agaaaatcgctagggttagggc	agaaaatcgctagggttagggc	NOUN
ahs-3111	124	22	538	538	NUM
ahs-3111	124	23	(	(	PUNCT
ahs-3111	124	24	mn	mn	NOUN
ahs-3111	124	25	-	-	NOUN
ahs-3111	124	26	sod	sod	NOUN
ahs-3111	124	27	)	)	PUNCT
ahs-3111	124	28	r	r	NOUN
ahs-3111	124	29	:	:	PUNCT
ahs-3111	124	30	tacccagcaatggaaccaagtt	tacccagcaatggaaccaagtt	ADJ
ahs-3111	124	31	catalase	catalase	NOUN
ahs-3111	124	32	af236127	af236127	NOUN
ahs-3111	125	1	f	f	X
ahs-3111	125	2	:	:	PUNCT
ahs-3111	125	3	aggcccagttcttcttgaggat	aggcccagttcttcttgaggat	ADJ
ahs-3111	125	4	860	860	NUM
ahs-3111	125	5	(	(	PUNCT
ahs-3111	125	6	cat	cat	NOUN
ahs-3111	125	7	)	)	PUNCT
ahs-3111	125	8	r	r	NOUN
ahs-3111	125	9	:	:	PUNCT
ahs-3111	125	10	aggcaagcatctcattctcagc	aggcaagcatctcattctcagc	NOUN
ahs-3111	125	11	glutathione	glutathione	NOUN
ahs-3111	125	12	peroxidase	peroxidase	PROPN
ahs-3111	125	13	xm_002272900	xm_002272900	PROPN
ahs-3111	126	1	f	f	PROPN
ahs-3111	126	2	:	:	PUNCT
ahs-3111	126	3	atgtcgaagcaaatacagcagg	atgtcgaagcaaatacagcagg	PROPN
ahs-3111	126	4	472	472	NUM
ahs-3111	126	5	(	(	PUNCT
ahs-3111	126	6	gpx	gpx	NOUN
ahs-3111	126	7	)	)	PUNCT
ahs-3111	126	8	r	r	NOUN
ahs-3111	126	9	:	:	PUNCT
ahs-3111	126	10	tgagaggggaagttgttgggta	tgagaggggaagttgttgggta	ADJ
ahs-3111	126	11	monodehydroascorbate	monodehydroascorbate	ADJ
ahs-3111	126	12	reductase	reductase	NOUN
ahs-3111	126	13	np_001267971	np_001267971	VERB
ahs-3111	126	14	f	f	NOUN
ahs-3111	126	15	:	:	PUNCT
ahs-3111	126	16	tcatgtttgtgttggaagcgga	tcatgtttgtgttggaagcgga	PROPN
ahs-3111	126	17	868	868	NUM
ahs-3111	126	18	(	(	PUNCT
ahs-3111	126	19	mdar	mdar	NOUN
ahs-3111	126	20	)	)	PUNCT
ahs-3111	126	21	r	r	NOUN
ahs-3111	126	22	:	:	PUNCT
ahs-3111	126	23	ggacagatcaaaggcacgagag	ggacagatcaaaggcacgagag	NOUN
ahs-3111	126	24	elongation	elongation	NOUN
ahs-3111	126	25	factor	factor	NOUN
ahs-3111	126	26	1α	1α	NUM
ahs-3111	126	27	xp_002277159	xp_002277159	PROPN
ahs-3111	127	1	f	f	X
ahs-3111	127	2	:	:	PUNCT
ahs-3111	127	3	attgtggtcattggccatgttg	attgtggtcattggccatgttg	NOUN
ahs-3111	127	4	566	566	NUM
ahs-3111	127	5	(	(	PUNCT
ahs-3111	127	6	ef-1α	ef-1α	PROPN
ahs-3111	127	7	)	)	PUNCT
ahs-3111	128	1	r	r	NOUN
ahs-3111	128	2	:	:	PUNCT
ahs-3111	128	3	ccttcgaaaccagagatgggaa	ccttcgaaaccagagatgggaa	PROPN
ahs-3111	128	4	fig	fig	NOUN
ahs-3111	128	5	.	.	PUNCT
ahs-3111	129	1	1	1	NUM
ahs-3111	129	2	semi	semi	ADJ
ahs-3111	129	3	-	-	ADJ
ahs-3111	129	4	quantitative	quantitative	ADJ
ahs-3111	129	5	rt	rt	ADJ
ahs-3111	129	6	-	-	PUNCT
ahs-3111	129	7	pcr	pcr	ADJ
ahs-3111	129	8	expression	expression	NOUN
ahs-3111	129	9	analysis	analysis	NOUN
ahs-3111	129	10	of	of	ADP
ahs-3111	129	11	major	major	ADJ
ahs-3111	129	12	antioxidant	antioxidant	ADJ
ahs-3111	129	13	enzyme	enzyme	NOUN
ahs-3111	129	14	genes	gene	NOUN
ahs-3111	129	15	in	in	ADP
ahs-3111	129	16	‘	'	PUNCT
ahs-3111	129	17	superior	superior	ADJ
ahs-3111	129	18	seedless	seedless	NOUN
ahs-3111	129	19	’	'	PUNCT
ahs-3111	129	20	grafted	graft	VERB
ahs-3111	129	21	on	on	ADP
ahs-3111	129	22	different	different	ADJ
ahs-3111	129	23	rootstocks	rootstock	NOUN
ahs-3111	129	24	and	and	CCONJ
ahs-3111	129	25	exposed	expose	VERB
ahs-3111	129	26	to	to	ADP
ahs-3111	129	27	salinity	salinity	NOUN
ahs-3111	129	28	for	for	ADP
ahs-3111	129	29	two	two	NUM
ahs-3111	129	30	weeks	week	NOUN
ahs-3111	129	31	.	.	PUNCT
ahs-3111	130	1	the	the	DET
ahs-3111	130	2	ef-1α	ef-1α	PROPN
ahs-3111	130	3	gene	gene	NOUN
ahs-3111	130	4	was	be	AUX
ahs-3111	130	5	used	use	VERB
ahs-3111	130	6	as	as	ADP
ahs-3111	130	7	the	the	DET
ahs-3111	130	8	internal	internal	ADJ
ahs-3111	130	9	control	control	NOUN
ahs-3111	130	10	for	for	ADP
ahs-3111	130	11	normalization	normalization	NOUN
ahs-3111	130	12	of	of	ADP
ahs-3111	130	13	loading	loading	NOUN
ahs-3111	130	14	.	.	PUNCT
ahs-3111	131	1	qrunfleh	qrunfleh	PROPN
ahs-3111	131	2	et	et	PROPN
ahs-3111	131	3	al	al	PROPN
ahs-3111	131	4	.	.	PUNCT
ahs-3111	132	1	‘	'	PUNCT
ahs-3111	132	2	superior	superior	ADJ
ahs-3111	132	3	seedless	seedless	NOUN
ahs-3111	132	4	’	'	PUNCT
ahs-3111	132	5	grown	grow	VERB
ahs-3111	132	6	under	under	ADP
ahs-3111	132	7	diluted	diluted	ADJ
ahs-3111	132	8	brackish	brackish	ADJ
ahs-3111	132	9	water	water	NOUN
ahs-3111	132	10	irrigation	irrigation	NOUN
ahs-3111	132	11	.	.	PUNCT
ahs-3111	133	1	ii	ii	PROPN
ahs-3111	133	2	.	.	PUNCT
ahs-3111	134	1	expression	expression	NOUN
ahs-3111	134	2	of	of	ADP
ahs-3111	134	3	antioxidant	antioxidant	ADJ
ahs-3111	134	4	genes	gene	NOUN
ahs-3111	134	5	279	279	NUM
ahs-3111	134	6	plants	plant	NOUN
ahs-3111	134	7	utilize	utilize	VERB
ahs-3111	134	8	antioxidant	antioxidant	ADJ
ahs-3111	134	9	enzymes	enzyme	NOUN
ahs-3111	134	10	,	,	PUNCT
ahs-3111	134	11	such	such	ADJ
ahs-3111	134	12	as	as	ADP
ahs-3111	134	13	:	:	PUNCT
ahs-3111	134	14	superoxide	superoxide	NOUN
ahs-3111	134	15	dismutase	dismutase	NOUN
ahs-3111	134	16	(	(	PUNCT
ahs-3111	134	17	sod	sod	NOUN
ahs-3111	134	18	)	)	PUNCT
ahs-3111	134	19	,	,	PUNCT
ahs-3111	134	20	catalase	catalase	NOUN
ahs-3111	134	21	(	(	PUNCT
ahs-3111	134	22	cat	cat	NOUN
ahs-3111	134	23	)	)	PUNCT
ahs-3111	134	24	,	,	PUNCT
ahs-3111	134	25	glutathione	glutathione	NOUN
ahs-3111	134	26	peroxidase	peroxidase	NOUN
ahs-3111	134	27	(	(	PUNCT
ahs-3111	134	28	gpx	gpx	PROPN
ahs-3111	134	29	)	)	PUNCT
ahs-3111	134	30	,	,	PUNCT
ahs-3111	134	31	ascorbate	ascorbate	NOUN
ahs-3111	134	32	peroxidase	peroxidase	NOUN
ahs-3111	134	33	(	(	PUNCT
ahs-3111	134	34	apx	apx	PROPN
ahs-3111	134	35	)	)	PUNCT
ahs-3111	134	36	and	and	CCONJ
ahs-3111	134	37	monodehydroascorbate	monodehydroascorbate	ADJ
ahs-3111	134	38	reductase	reductase	NOUN
ahs-3111	134	39	(	(	PUNCT
ahs-3111	134	40	mdar	mdar	PROPN
ahs-3111	134	41	)	)	PUNCT
ahs-3111	134	42	,	,	PUNCT
ahs-3111	134	43	as	as	ADP
ahs-3111	134	44	defense	defense	NOUN
ahs-3111	134	45	mechanisms	mechanism	NOUN
ahs-3111	134	46	against	against	ADP
ahs-3111	134	47	salinity	salinity	NOUN
ahs-3111	134	48	and	and	CCONJ
ahs-3111	134	49	do	do	AUX
ahs-3111	134	50	have	have	VERB
ahs-3111	134	51	the	the	DET
ahs-3111	134	52	ability	ability	NOUN
ahs-3111	134	53	to	to	PART
ahs-3111	134	54	detoxify	detoxify	VERB
ahs-3111	134	55	toxic	toxic	ADJ
ahs-3111	134	56	ros	ros	PROPN
ahs-3111	134	57	(	(	PUNCT
ahs-3111	134	58	apel	apel	NOUN
ahs-3111	134	59	and	and	CCONJ
ahs-3111	134	60	hirt	hirt	NOUN
ahs-3111	134	61	,	,	PUNCT
ahs-3111	134	62	2004	2004	NUM
ahs-3111	134	63	)	)	PUNCT
ahs-3111	134	64	.	.	PUNCT
ahs-3111	135	1	their	their	PRON
ahs-3111	135	2	expression	expression	NOUN
ahs-3111	135	3	has	have	AUX
ahs-3111	135	4	been	be	AUX
ahs-3111	135	5	studied	study	VERB
ahs-3111	135	6	in	in	ADP
ahs-3111	135	7	many	many	ADJ
ahs-3111	135	8	crops	crop	NOUN
ahs-3111	135	9	as	as	SCONJ
ahs-3111	135	10	previously	previously	ADV
ahs-3111	135	11	mentioned	mention	VERB
ahs-3111	135	12	in	in	ADP
ahs-3111	135	13	the	the	DET
ahs-3111	135	14	introduction	introduction	NOUN
ahs-3111	135	15	part	part	NOUN
ahs-3111	135	16	.	.	PUNCT
ahs-3111	136	1	however	however	ADV
ahs-3111	136	2	,	,	PUNCT
ahs-3111	136	3	such	such	ADJ
ahs-3111	136	4	knowledge	knowledge	NOUN
ahs-3111	136	5	is	be	AUX
ahs-3111	136	6	lacking	lack	VERB
ahs-3111	136	7	in	in	ADP
ahs-3111	136	8	vitis	vitis	ADJ
ahs-3111	136	9	species	specie	NOUN
ahs-3111	136	10	,	,	PUNCT
ahs-3111	136	11	specifically	specifically	ADV
ahs-3111	136	12	in	in	ADP
ahs-3111	136	13	vitis	vitis	ADJ
ahs-3111	136	14	berlandieri	berlandieri	NOUN
ahs-3111	136	15	and	and	CCONJ
ahs-3111	136	16	rupestris	rupestris	PROPN
ahs-3111	136	17	.	.	PUNCT
ahs-3111	137	1	meanwhile	meanwhile	ADV
ahs-3111	137	2	,	,	PUNCT
ahs-3111	137	3	their	their	PRON
ahs-3111	137	4	expression	expression	NOUN
ahs-3111	137	5	is	be	AUX
ahs-3111	137	6	extensively	extensively	ADV
ahs-3111	137	7	studied	study	VERB
ahs-3111	137	8	in	in	ADP
ahs-3111	137	9	both	both	DET
ahs-3111	137	10	vinifera	vinifera	NOUN
ahs-3111	137	11	rootstocks	rootstock	NOUN
ahs-3111	137	12	and	and	CCONJ
ahs-3111	137	13	cultivars	cultivar	NOUN
ahs-3111	137	14	(	(	PUNCT
ahs-3111	137	15	carvalho	carvalho	NOUN
ahs-3111	137	16	et	et	PROPN
ahs-3111	137	17	al	al	PROPN
ahs-3111	137	18	.	.	PROPN
ahs-3111	137	19	,	,	PUNCT
ahs-3111	137	20	2015	2015	NUM
ahs-3111	137	21	)	)	PUNCT
ahs-3111	137	22	.	.	PUNCT
ahs-3111	138	1	after	after	ADP
ahs-3111	138	2	salinity	salinity	NOUN
ahs-3111	138	3	exposure	exposure	NOUN
ahs-3111	138	4	for	for	ADP
ahs-3111	138	5	two	two	NUM
ahs-3111	138	6	weeks	week	NOUN
ahs-3111	138	7	,	,	PUNCT
ahs-3111	138	8	the	the	DET
ahs-3111	138	9	transcript	transcript	NOUN
ahs-3111	138	10	levels	level	NOUN
ahs-3111	138	11	of	of	ADP
ahs-3111	138	12	apx	apx	PROPN
ahs-3111	138	13	,	,	PUNCT
ahs-3111	138	14	mn	mn	PROPN
ahs-3111	138	15	-	-	PUNCT
ahs-3111	138	16	sod	sod	NOUN
ahs-3111	138	17	and	and	CCONJ
ahs-3111	138	18	mdar	mdar	NOUN
ahs-3111	138	19	were	be	AUX
ahs-3111	138	20	increased	increase	VERB
ahs-3111	138	21	in	in	ADP
ahs-3111	138	22	leaves	leave	NOUN
ahs-3111	138	23	of	of	ADP
ahs-3111	138	24	‘	'	PUNCT
ahs-3111	138	25	superior	superior	ADJ
ahs-3111	138	26	seedless	seedless	NOUN
ahs-3111	138	27	’	'	PUNCT
ahs-3111	138	28	grafted	graft	VERB
ahs-3111	138	29	on	on	ADP
ahs-3111	138	30	the	the	DET
ahs-3111	138	31	different	different	ADJ
ahs-3111	138	32	rootstocks	rootstock	NOUN
ahs-3111	138	33	.	.	PUNCT
ahs-3111	139	1	however	however	ADV
ahs-3111	139	2	,	,	PUNCT
ahs-3111	139	3	their	their	PRON
ahs-3111	139	4	expression	expression	NOUN
ahs-3111	139	5	levels	level	NOUN
ahs-3111	139	6	in	in	ADP
ahs-3111	139	7	response	response	NOUN
ahs-3111	139	8	to	to	ADP
ahs-3111	139	9	salinity	salinity	NOUN
ahs-3111	139	10	were	be	AUX
ahs-3111	139	11	noticeably	noticeably	ADV
ahs-3111	139	12	higher	high	ADJ
ahs-3111	139	13	in	in	ADP
ahs-3111	139	14	plants	plant	NOUN
ahs-3111	139	15	grafted	graft	VERB
ahs-3111	139	16	on	on	ADP
ahs-3111	139	17	p1103	p1103	PROPN
ahs-3111	139	18	and	and	CCONJ
ahs-3111	139	19	r110	r110	PROPN
ahs-3111	139	20	compared	compare	VERB
ahs-3111	139	21	to	to	ADP
ahs-3111	139	22	41b	41b	NOUN
ahs-3111	139	23	.	.	PUNCT
ahs-3111	140	1	the	the	DET
ahs-3111	140	2	expression	expression	NOUN
ahs-3111	140	3	of	of	ADP
ahs-3111	140	4	cat	cat	NOUN
ahs-3111	140	5	gene	gene	NOUN
ahs-3111	140	6	showed	show	VERB
ahs-3111	140	7	obvious	obvious	ADJ
ahs-3111	140	8	enhanced	enhanced	ADJ
ahs-3111	140	9	level	level	NOUN
ahs-3111	140	10	in	in	ADP
ahs-3111	140	11	plants	plant	NOUN
ahs-3111	140	12	grafted	graft	VERB
ahs-3111	140	13	on	on	ADP
ahs-3111	140	14	p1103	p1103	PROPN
ahs-3111	140	15	in	in	ADP
ahs-3111	140	16	response	response	NOUN
ahs-3111	140	17	to	to	ADP
ahs-3111	140	18	salt	salt	NOUN
ahs-3111	140	19	exposure	exposure	NOUN
ahs-3111	140	20	.	.	PUNCT
ahs-3111	141	1	however	however	ADV
ahs-3111	141	2	,	,	PUNCT
ahs-3111	141	3	the	the	DET
ahs-3111	141	4	expression	expression	NOUN
ahs-3111	141	5	of	of	ADP
ahs-3111	141	6	cat	cat	NOUN
ahs-3111	141	7	gene	gene	NOUN
ahs-3111	141	8	in	in	ADP
ahs-3111	141	9	‘	'	PUNCT
ahs-3111	141	10	superior	superior	ADJ
ahs-3111	141	11	seedless	seedless	ADJ
ahs-3111	141	12	’	'	PUNCT
ahs-3111	141	13	scion	scion	NOUN
ahs-3111	141	14	grafted	graft	VERB
ahs-3111	141	15	on	on	ADP
ahs-3111	141	16	41b	41b	NOUN
ahs-3111	141	17	or	or	CCONJ
ahs-3111	141	18	r110	r110	PROPN
ahs-3111	141	19	showed	show	VERB
ahs-3111	141	20	almost	almost	ADV
ahs-3111	141	21	unchanged	unchanged	ADJ
ahs-3111	141	22	level	level	NOUN
ahs-3111	141	23	in	in	ADP
ahs-3111	141	24	control	control	NOUN
ahs-3111	141	25	and	and	CCONJ
ahs-3111	141	26	stressed	stress	VERB
ahs-3111	141	27	conditions	condition	NOUN
ahs-3111	141	28	.	.	PUNCT
ahs-3111	142	1	down	down	ADP
ahs-3111	142	2	-	-	PUNCT
ahs-3111	142	3	regulation	regulation	NOUN
ahs-3111	142	4	of	of	ADP
ahs-3111	142	5	cuzn	cuzn	NOUN
ahs-3111	142	6	-	-	PUNCT
ahs-3111	142	7	sod	sod	NOUN
ahs-3111	142	8	was	be	AUX
ahs-3111	142	9	recorded	record	VERB
ahs-3111	142	10	in	in	ADP
ahs-3111	142	11	leaves	leave	NOUN
ahs-3111	142	12	of	of	ADP
ahs-3111	142	13	‘	'	PUNCT
ahs-3111	142	14	superior	superior	ADJ
ahs-3111	142	15	seedless	seedless	NOUN
ahs-3111	142	16	’	'	PUNCT
ahs-3111	142	17	grafted	graft	VERB
ahs-3111	142	18	on	on	ADP
ahs-3111	142	19	p1103	p1103	PROPN
ahs-3111	142	20	,	,	PUNCT
ahs-3111	142	21	while	while	SCONJ
ahs-3111	142	22	,	,	PUNCT
ahs-3111	142	23	slight	slight	ADJ
ahs-3111	142	24	up	up	ADP
ahs-3111	142	25	-	-	PUNCT
ahs-3111	142	26	regulation	regulation	NOUN
ahs-3111	142	27	of	of	ADP
ahs-3111	142	28	this	this	DET
ahs-3111	142	29	gene	gene	NOUN
ahs-3111	142	30	in	in	ADP
ahs-3111	142	31	response	response	NOUN
ahs-3111	142	32	to	to	ADP
ahs-3111	142	33	saline	saline	NOUN
ahs-3111	142	34	condition	condition	NOUN
ahs-3111	142	35	was	be	AUX
ahs-3111	142	36	recorded	record	VERB
ahs-3111	142	37	when	when	SCONJ
ahs-3111	142	38	scion	scion	NOUN
ahs-3111	142	39	was	be	AUX
ahs-3111	142	40	grafted	graft	VERB
ahs-3111	142	41	on	on	ADP
ahs-3111	142	42	41b	41b	NOUN
ahs-3111	142	43	or	or	CCONJ
ahs-3111	142	44	r110	r110	PROPN
ahs-3111	142	45	.	.	PUNCT
ahs-3111	143	1	in	in	ADP
ahs-3111	143	2	response	response	NOUN
ahs-3111	143	3	to	to	ADP
ahs-3111	143	4	salinity	salinity	NOUN
ahs-3111	143	5	stress	stress	NOUN
ahs-3111	143	6	,	,	PUNCT
ahs-3111	143	7	the	the	DET
ahs-3111	143	8	expression	expression	NOUN
ahs-3111	143	9	of	of	ADP
ahs-3111	143	10	gpx	gpx	NOUN
ahs-3111	143	11	was	be	AUX
ahs-3111	143	12	enhanced	enhance	VERB
ahs-3111	143	13	in	in	ADP
ahs-3111	143	14	scion	scion	NOUN
ahs-3111	143	15	grafted	graft	VERB
ahs-3111	143	16	on	on	ADP
ahs-3111	143	17	p1103	p1103	NUM
ahs-3111	143	18	and	and	CCONJ
ahs-3111	143	19	41b	41b	NOUN
ahs-3111	143	20	.	.	PUNCT
ahs-3111	144	1	on	on	ADP
ahs-3111	144	2	the	the	DET
ahs-3111	144	3	other	other	ADJ
ahs-3111	144	4	hand	hand	NOUN
ahs-3111	144	5	,	,	PUNCT
ahs-3111	144	6	scion	scion	NOUN
ahs-3111	144	7	grafted	graft	VERB
ahs-3111	144	8	on	on	ADP
ahs-3111	144	9	r110	r110	PROPN
ahs-3111	144	10	showed	show	VERB
ahs-3111	144	11	decreased	decrease	VERB
ahs-3111	144	12	expression	expression	NOUN
ahs-3111	144	13	of	of	ADP
ahs-3111	144	14	gpx	gpx	NOUN
ahs-3111	144	15	in	in	ADP
ahs-3111	144	16	response	response	NOUN
ahs-3111	144	17	to	to	ADP
ahs-3111	144	18	salt	salt	NOUN
ahs-3111	144	19	treatment	treatment	NOUN
ahs-3111	144	20	.	.	PUNCT
ahs-3111	145	1	the	the	DET
ahs-3111	145	2	expression	expression	NOUN
ahs-3111	145	3	of	of	ADP
ahs-3111	145	4	these	these	DET
ahs-3111	145	5	genes	gene	NOUN
ahs-3111	145	6	was	be	AUX
ahs-3111	145	7	evaluated	evaluate	VERB
ahs-3111	145	8	every	every	DET
ahs-3111	145	9	two	two	NUM
ahs-3111	145	10	weeks	week	NOUN
ahs-3111	145	11	,	,	PUNCT
ahs-3111	145	12	and	and	CCONJ
ahs-3111	145	13	only	only	ADV
ahs-3111	145	14	the	the	DET
ahs-3111	145	15	results	result	NOUN
ahs-3111	145	16	after	after	ADP
ahs-3111	145	17	the	the	DET
ahs-3111	145	18	first	first	ADJ
ahs-3111	145	19	two	two	NUM
ahs-3111	145	20	weeks	week	NOUN
ahs-3111	145	21	of	of	ADP
ahs-3111	145	22	the	the	DET
ahs-3111	145	23	stress	stress	NOUN
ahs-3111	145	24	treatment	treatment	NOUN
ahs-3111	145	25	were	be	AUX
ahs-3111	145	26	presented	present	VERB
ahs-3111	145	27	since	since	SCONJ
ahs-3111	145	28	no	no	DET
ahs-3111	145	29	differences	difference	NOUN
ahs-3111	145	30	in	in	ADP
ahs-3111	145	31	expression	expression	NOUN
ahs-3111	145	32	were	be	AUX
ahs-3111	145	33	noticed	notice	VERB
ahs-3111	145	34	at	at	ADP
ahs-3111	145	35	the	the	DET
ahs-3111	145	36	other	other	ADJ
ahs-3111	145	37	time	time	NOUN
ahs-3111	145	38	points	point	NOUN
ahs-3111	145	39	between	between	ADP
ahs-3111	145	40	different	different	ADJ
ahs-3111	145	41	treatments	treatment	NOUN
ahs-3111	145	42	.	.	PUNCT
ahs-3111	146	1	this	this	PRON
ahs-3111	146	2	indicates	indicate	VERB
ahs-3111	146	3	early	early	ADJ
ahs-3111	146	4	differential	differential	ADJ
ahs-3111	146	5	responses	response	NOUN
ahs-3111	146	6	to	to	PART
ahs-3111	146	7	salt	salt	VERB
ahs-3111	146	8	stress	stress	NOUN
ahs-3111	146	9	at	at	ADP
ahs-3111	146	10	the	the	DET
ahs-3111	146	11	level	level	NOUN
ahs-3111	146	12	of	of	ADP
ahs-3111	146	13	antioxidant	antioxidant	ADJ
ahs-3111	146	14	defense	defense	NOUN
ahs-3111	146	15	genes	gene	NOUN
ahs-3111	146	16	.	.	PUNCT
ahs-3111	147	1	such	such	ADJ
ahs-3111	147	2	responses	response	NOUN
ahs-3111	147	3	were	be	AUX
ahs-3111	147	4	previously	previously	ADV
ahs-3111	147	5	reported	report	VERB
ahs-3111	147	6	in	in	ADP
ahs-3111	147	7	other	other	ADJ
ahs-3111	147	8	plant	plant	NOUN
ahs-3111	147	9	species	specie	NOUN
ahs-3111	147	10	(	(	PUNCT
ahs-3111	147	11	ellouzi	ellouzi	PROPN
ahs-3111	147	12	et	et	PROPN
ahs-3111	147	13	al	al	PROPN
ahs-3111	147	14	.	.	PROPN
ahs-3111	147	15	,	,	PUNCT
ahs-3111	147	16	2014	2014	NUM
ahs-3111	147	17	;	;	PUNCT
ahs-3111	147	18	ranjit	ranjit	VERB
ahs-3111	147	19	et	et	PROPN
ahs-3111	147	20	al	al	PROPN
ahs-3111	147	21	.	.	PROPN
ahs-3111	147	22	,	,	PUNCT
ahs-3111	147	23	2016	2016	NUM
ahs-3111	147	24	)	)	PUNCT
ahs-3111	147	25	.	.	PUNCT
ahs-3111	148	1	4	4	X
ahs-3111	148	2	.	.	X
ahs-3111	148	3	conclusions	conclusion	NOUN
ahs-3111	148	4	rootstock	rootstock	VERB
ahs-3111	148	5	choice	choice	NOUN
ahs-3111	148	6	is	be	AUX
ahs-3111	148	7	critical	critical	ADJ
ahs-3111	148	8	in	in	ADP
ahs-3111	148	9	determining	determine	VERB
ahs-3111	148	10	grapevine	grapevine	NOUN
ahs-3111	148	11	performance	performance	NOUN
ahs-3111	148	12	and	and	CCONJ
ahs-3111	148	13	productivity	productivity	NOUN
ahs-3111	148	14	under	under	ADP
ahs-3111	148	15	saline	saline	ADJ
ahs-3111	148	16	conditions	condition	NOUN
ahs-3111	148	17	.	.	PUNCT
ahs-3111	149	1	expression	expression	NOUN
ahs-3111	149	2	levels	level	NOUN
ahs-3111	149	3	of	of	ADP
ahs-3111	149	4	apx	apx	PROPN
ahs-3111	149	5	,	,	PUNCT
ahs-3111	149	6	mn	mn	PROPN
ahs-3111	149	7	-	-	PUNCT
ahs-3111	149	8	sod	sod	NOUN
ahs-3111	149	9	and	and	CCONJ
ahs-3111	149	10	mdar	mdar	NOUN
ahs-3111	149	11	were	be	AUX
ahs-3111	149	12	noticeably	noticeably	ADV
ahs-3111	149	13	higher	high	ADJ
ahs-3111	149	14	in	in	ADP
ahs-3111	149	15	plants	plant	NOUN
ahs-3111	149	16	grafted	graft	VERB
ahs-3111	149	17	on	on	ADP
ahs-3111	149	18	p1103	p1103	PROPN
ahs-3111	149	19	and	and	CCONJ
ahs-3111	149	20	r110	r110	PROPN
ahs-3111	149	21	compared	compare	VERB
ahs-3111	149	22	to	to	ADP
ahs-3111	149	23	41b	41b	NOUN
ahs-3111	149	24	.	.	PUNCT
ahs-3111	150	1	the	the	DET
ahs-3111	150	2	expression	expression	NOUN
ahs-3111	150	3	of	of	ADP
ahs-3111	150	4	cat	cat	NOUN
ahs-3111	150	5	and	and	CCONJ
ahs-3111	150	6	gpx	gpx	NOUN
ahs-3111	150	7	genes	gene	NOUN
ahs-3111	150	8	showed	show	VERB
ahs-3111	150	9	obvious	obvious	ADJ
ahs-3111	150	10	enhanced	enhanced	ADJ
ahs-3111	150	11	level	level	NOUN
ahs-3111	150	12	in	in	ADP
ahs-3111	150	13	plants	plant	NOUN
ahs-3111	150	14	grafted	graft	VERB
ahs-3111	150	15	only	only	ADV
ahs-3111	150	16	on	on	ADP
ahs-3111	150	17	p1103	p1103	PROPN
ahs-3111	150	18	in	in	ADP
ahs-3111	150	19	response	response	NOUN
ahs-3111	150	20	to	to	ADP
ahs-3111	150	21	salt	salt	NOUN
ahs-3111	150	22	exposure	exposure	NOUN
ahs-3111	150	23	.	.	PUNCT
ahs-3111	151	1	cuzn	cuzn	ADJ
ahs-3111	151	2	-	-	PUNCT
ahs-3111	151	3	sod	sod	NOUN
ahs-3111	151	4	was	be	AUX
ahs-3111	151	5	down	down	ADV
ahs-3111	151	6	-	-	PUNCT
ahs-3111	151	7	regulated	regulate	VERB
ahs-3111	151	8	in	in	ADP
ahs-3111	151	9	leaves	leave	NOUN
ahs-3111	151	10	of	of	ADP
ahs-3111	151	11	‘	'	PUNCT
ahs-3111	151	12	superior	superior	ADJ
ahs-3111	151	13	seedless	seedless	NOUN
ahs-3111	151	14	’	'	PUNCT
ahs-3111	151	15	grafted	graft	VERB
ahs-3111	151	16	on	on	ADP
ahs-3111	151	17	p1103	p1103	NUM
ahs-3111	151	18	and	and	CCONJ
ahs-3111	151	19	up	up	ADV
ahs-3111	151	20	-	-	PUNCT
ahs-3111	151	21	regulated	regulate	VERB
ahs-3111	151	22	when	when	SCONJ
ahs-3111	151	23	scion	scion	NOUN
ahs-3111	151	24	was	be	AUX
ahs-3111	151	25	grafted	graft	VERB
ahs-3111	151	26	on	on	ADP
ahs-3111	151	27	41b	41b	NOUN
ahs-3111	151	28	or	or	CCONJ
ahs-3111	151	29	r110	r110	PROPN
ahs-3111	151	30	.	.	PUNCT
ahs-3111	152	1	rootstocks	rootstock	NOUN
ahs-3111	152	2	with	with	ADP
ahs-3111	152	3	enhanced	enhanced	ADJ
ahs-3111	152	4	expression	expression	NOUN
ahs-3111	152	5	levels	level	NOUN
ahs-3111	152	6	of	of	ADP
ahs-3111	152	7	antioxidant	antioxidant	ADJ
ahs-3111	152	8	defense	defense	NOUN
ahs-3111	152	9	genes	gene	NOUN
ahs-3111	152	10	,	,	PUNCT
ahs-3111	152	11	such	such	ADJ
ahs-3111	152	12	as	as	ADP
ahs-3111	152	13	superoxide	superoxide	NOUN
ahs-3111	152	14	dismutase	dismutase	NOUN
ahs-3111	152	15	(	(	PUNCT
ahs-3111	152	16	sod	sod	NOUN
ahs-3111	152	17	)	)	PUNCT
ahs-3111	152	18	and	and	CCONJ
ahs-3111	152	19	catalase	catalase	NOUN
ahs-3111	152	20	(	(	PUNCT
ahs-3111	152	21	cat	cat	NOUN
ahs-3111	152	22	)	)	PUNCT
ahs-3111	152	23	can	can	AUX
ahs-3111	152	24	possibly	possibly	ADV
ahs-3111	152	25	eliminate	eliminate	VERB
ahs-3111	152	26	or	or	CCONJ
ahs-3111	152	27	reduce	reduce	VERB
ahs-3111	152	28	detrimental	detrimental	ADJ
ahs-3111	152	29	effects	effect	NOUN
ahs-3111	152	30	of	of	ADP
ahs-3111	152	31	ros	ros	PROPN
ahs-3111	152	32	.	.	PUNCT
ahs-3111	153	1	thus	thus	ADV
ahs-3111	153	2	,	,	PUNCT
ahs-3111	153	3	grapevine	grapevine	NOUN
ahs-3111	153	4	rootstocks	rootstock	NOUN
ahs-3111	153	5	that	that	PRON
ahs-3111	153	6	possess	possess	VERB
ahs-3111	153	7	this	this	DET
ahs-3111	153	8	defense	defense	NOUN
ahs-3111	153	9	line	line	NOUN
ahs-3111	153	10	are	be	AUX
ahs-3111	153	11	more	more	ADV
ahs-3111	153	12	preferable	preferable	ADJ
ahs-3111	153	13	to	to	PART
ahs-3111	153	14	be	be	AUX
ahs-3111	153	15	utilized	utilize	VERB
ahs-3111	153	16	for	for	ADP
ahs-3111	153	17	soils	soil	NOUN
ahs-3111	153	18	subjected	subject	VERB
ahs-3111	153	19	to	to	ADP
ahs-3111	153	20	salinity	salinity	NOUN
ahs-3111	153	21	or	or	CCONJ
ahs-3111	153	22	grapevines	grapevine	NOUN
ahs-3111	153	23	irrigated	irrigate	VERB
ahs-3111	153	24	with	with	ADP
ahs-3111	153	25	diluted	diluted	ADJ
ahs-3111	153	26	brackish	brackish	ADJ
ahs-3111	153	27	water	water	NOUN
ahs-3111	153	28	.	.	PUNCT
ahs-3111	154	1	moreover	moreover	ADV
ahs-3111	154	2	,	,	PUNCT
ahs-3111	154	3	additional	additional	ADJ
ahs-3111	154	4	studies	study	NOUN
ahs-3111	154	5	are	be	AUX
ahs-3111	154	6	needed	need	VERB
ahs-3111	154	7	to	to	PART
ahs-3111	154	8	investigate	investigate	VERB
ahs-3111	154	9	the	the	DET
ahs-3111	154	10	salt	salt	NOUN
ahs-3111	154	11	-	-	PUNCT
ahs-3111	154	12	stress	stress	NOUN
ahs-3111	154	13	responses	response	NOUN
ahs-3111	154	14	of	of	ADP
ahs-3111	154	15	enzymatic	enzymatic	ADJ
ahs-3111	154	16	and	and	CCONJ
ahs-3111	154	17	non	non	ADJ
ahs-3111	154	18	-	-	ADJ
ahs-3111	154	19	enzymatic	enzymatic	ADJ
ahs-3111	154	20	antioxidant	antioxidant	ADJ
ahs-3111	154	21	components	component	NOUN
ahs-3111	154	22	in	in	ADP
ahs-3111	154	23	grapevine	grapevine	NOUN
ahs-3111	154	24	grafted	graft	VERB
ahs-3111	154	25	on	on	ADP
ahs-3111	154	26	contrasting	contrast	VERB
ahs-3111	154	27	rootstocks	rootstock	NOUN
ahs-3111	154	28	.	.	PUNCT
ahs-3111	155	1	acknowledgements	acknowledgement	NOUN
ahs-3111	155	2	this	this	DET
ahs-3111	155	3	research	research	NOUN
ahs-3111	155	4	was	be	AUX
ahs-3111	155	5	funded	fund	VERB
ahs-3111	155	6	by	by	ADP
ahs-3111	155	7	the	the	DET
ahs-3111	155	8	scientific	scientific	ADJ
ahs-3111	155	9	research	research	NOUN
ahs-3111	155	10	support	support	NOUN
ahs-3111	155	11	fund	fund	NOUN
ahs-3111	155	12	under	under	ADP
ahs-3111	155	13	the	the	DET
ahs-3111	155	14	number	number	NOUN
ahs-3111	155	15	agr/2/04/2011	agr/2/04/2011	NOUN
ahs-3111	155	16	.	.	PUNCT
ahs-3111	156	1	we	we	PRON
ahs-3111	156	2	wish	wish	VERB
ahs-3111	156	3	especially	especially	ADV
ahs-3111	156	4	to	to	PART
ahs-3111	156	5	acknowledge	acknowledge	VERB
ahs-3111	156	6	the	the	DET
ahs-3111	156	7	help	help	NOUN
ahs-3111	156	8	of	of	ADP
ahs-3111	156	9	ayah	ayah	NOUN
ahs-3111	156	10	awad	awad	NOUN
ahs-3111	156	11	for	for	ADP
ahs-3111	156	12	her	her	PRON
ahs-3111	156	13	technical	technical	ADJ
ahs-3111	156	14	assistance	assistance	NOUN
ahs-3111	156	15	.	.	PUNCT
ahs-3111	157	1	references	reference	NOUN
ahs-3111	157	2	abdel	abdel	PROPN
ahs-3111	157	3	gawad	gawad	PROPN
ahs-3111	157	4	g.	g.	PROPN
ahs-3111	157	5	,	,	PUNCT
ahs-3111	157	6	ghaibeh	ghaibeh	PROPN
ahs-3111	157	7	a.	a.	NOUN
ahs-3111	157	8	,	,	PUNCT
ahs-3111	157	9	2001	2001	NUM
ahs-3111	157	10	use	use	NOUN
ahs-3111	157	11	of	of	ADP
ahs-3111	157	12	low	low	ADJ
ahs-3111	157	13	quality	quality	NOUN
ahs-3111	157	14	water	water	NOUN
ahs-3111	157	15	for	for	ADP
ahs-3111	157	16	irrigation	irrigation	NOUN
ahs-3111	157	17	in	in	ADP
ahs-3111	157	18	the	the	DET
ahs-3111	157	19	middle	middle	PROPN
ahs-3111	157	20	east	east	PROPN
ahs-3111	157	21	.	.	PUNCT
ahs-3111	158	1	proc	proc	PROPN
ahs-3111	158	2	.	.	PUNCT
ahs-3111	159	1	symp	symp	PROPN
ahs-3111	159	2	.	.	PUNCT
ahs-3111	160	1	sustainable	sustainable	ADJ
ahs-3111	160	2	management	management	NOUN
ahs-3111	160	3	of	of	ADP
ahs-3111	160	4	irrigated	irrigated	ADJ
ahs-3111	160	5	land	land	NOUN
ahs-3111	160	6	for	for	ADP
ahs-3111	160	7	salinity	salinity	NOUN
ahs-3111	160	8	and	and	CCONJ
ahs-3111	160	9	toxic	toxic	ADJ
ahs-3111	160	10	elements	element	NOUN
ahs-3111	160	11	control	control	NOUN
ahs-3111	160	12	.	.	PUNCT
ahs-3111	161	1	us	us	PROPN
ahs-3111	161	2	salinity	salinity	PROPN
ahs-3111	161	3	laboratory	laboratory	PROPN
ahs-3111	161	4	riverside	riverside	PROPN
ahs-3111	161	5	,	,	PUNCT
ahs-3111	161	6	california	california	PROPN
ahs-3111	161	7	,	,	PUNCT
ahs-3111	161	8	usa	usa	PROPN
ahs-3111	161	9	.	.	PROPN
ahs-3111	161	10	albacete	albacete	PROPN
ahs-3111	161	11	a.	a.	PROPN
ahs-3111	161	12	,	,	PUNCT
ahs-3111	161	13	andújar	andújar	PROPN
ahs-3111	161	14	c.	c.	PROPN
ahs-3111	161	15	,	,	PUNCT
ahs-3111	161	16	dodd	dodd	PROPN
ahs-3111	161	17	i.	i.	PROPN
ahs-3111	161	18	,	,	PUNCT
ahs-3111	161	19	giuffrida	giuffrida	PROPN
ahs-3111	161	20	f.	f.	PROPN
ahs-3111	161	21	,	,	PUNCT
ahs-3111	161	22	hichri	hichri	PROPN
ahs-3111	161	23	i.	i.	PROPN
ahs-3111	161	24	,	,	PUNCT
ahs-3111	161	25	lutts	lutts	PROPN
ahs-3111	161	26	s.	s.	PROPN
ahs-3111	161	27	,	,	PUNCT
ahs-3111	161	28	thompson	thompson	PROPN
ahs-3111	161	29	a.	a.	NOUN
ahs-3111	161	30	,	,	PUNCT
ahs-3111	161	31	asins	asin	VERB
ahs-3111	161	32	m.	m.	NOUN
ahs-3111	161	33	,	,	PUNCT
ahs-3111	161	34	2015	2015	NUM
ahs-3111	161	35	rootstock	rootstock	NOUN
ahs-3111	161	36	-	-	PUNCT
ahs-3111	161	37	mediated	mediate	VERB
ahs-3111	161	38	variation	variation	NOUN
ahs-3111	161	39	in	in	ADP
ahs-3111	161	40	tomato	tomato	NOUN
ahs-3111	161	41	vegetative	vegetative	ADJ
ahs-3111	161	42	growth	growth	NOUN
ahs-3111	161	43	under	under	ADP
ahs-3111	161	44	drought	drought	NOUN
ahs-3111	161	45	,	,	PUNCT
ahs-3111	161	46	salinity	salinity	NOUN
ahs-3111	161	47	and	and	CCONJ
ahs-3111	161	48	soil	soil	NOUN
ahs-3111	161	49	impedance	impedance	NOUN
ahs-3111	161	50	stresses	stress	NOUN
ahs-3111	161	51	.	.	PUNCT
ahs-3111	162	1	acta	acta	PROPN
ahs-3111	162	2	horticulturae	horticulturae	PROPN
ahs-3111	162	3	,	,	PUNCT
ahs-3111	162	4	1086	1086	NUM
ahs-3111	162	5	:	:	PUNCT
ahs-3111	162	6	141	141	NUM
ahs-3111	162	7	-	-	SYM
ahs-3111	162	8	146	146	NUM
ahs-3111	162	9	apel	apel	PROPN
ahs-3111	162	10	k.	k.	PROPN
ahs-3111	162	11	,	,	PUNCT
ahs-3111	162	12	hirt	hirt	PROPN
ahs-3111	162	13	h.	h.	PROPN
ahs-3111	162	14	,	,	PUNCT
ahs-3111	162	15	2004	2004	NUM
ahs-3111	162	16	reactive	reactive	ADJ
ahs-3111	162	17	oxygen	oxygen	NOUN
ahs-3111	162	18	species	specie	NOUN
ahs-3111	162	19	:	:	PUNCT
ahs-3111	162	20	metabolism	metabolism	NOUN
ahs-3111	162	21	,	,	PUNCT
ahs-3111	162	22	oxidative	oxidative	ADJ
ahs-3111	162	23	stress	stress	NOUN
ahs-3111	162	24	,	,	PUNCT
ahs-3111	162	25	and	and	CCONJ
ahs-3111	162	26	signal	signal	ADJ
ahs-3111	162	27	transduction	transduction	NOUN
ahs-3111	162	28	.	.	PUNCT
ahs-3111	163	1	annual	annual	ADJ
ahs-3111	163	2	review	review	NOUN
ahs-3111	163	3	of	of	ADP
ahs-3111	163	4	plant	plant	NOUN
ahs-3111	163	5	biology	biology	NOUN
ahs-3111	163	6	,	,	PUNCT
ahs-3111	163	7	55	55	NUM
ahs-3111	163	8	:	:	PUNCT
ahs-3111	163	9	373	373	NUM
ahs-3111	163	10	-	-	SYM
ahs-3111	163	11	399	399	NUM
ahs-3111	163	12	.	.	PUNCT
ahs-3111	164	1	bustan	bustan	PROPN
ahs-3111	164	2	a.	a.	PROPN
ahs-3111	164	3	,	,	PUNCT
ahs-3111	164	4	cohen	cohen	PROPN
ahs-3111	164	5	s.	s.	PROPN
ahs-3111	164	6	,	,	PUNCT
ahs-3111	164	7	de	de	PROPN
ahs-3111	164	8	malach	malach	NOUN
ahs-3111	164	9	y.	y.	PROPN
ahs-3111	164	10	,	,	PUNCT
ahs-3111	164	11	zimmermann	zimmermann	PROPN
ahs-3111	164	12	p.	p.	PROPN
ahs-3111	164	13	,	,	PUNCT
ahs-3111	164	14	golan	golan	PROPN
ahs-3111	164	15	r.	r.	PROPN
ahs-3111	164	16	,	,	PUNCT
ahs-3111	164	17	sagi	sagi	PROPN
ahs-3111	164	18	m.	m.	PROPN
ahs-3111	164	19	,	,	PUNCT
ahs-3111	164	20	pasternak	pasternak	PROPN
ahs-3111	164	21	d.	d.	PROPN
ahs-3111	164	22	,	,	PUNCT
ahs-3111	164	23	2005	2005	NUM
ahs-3111	164	24	effects	effect	NOUN
ahs-3111	164	25	of	of	ADP
ahs-3111	164	26	timing	timing	NOUN
ahs-3111	164	27	and	and	CCONJ
ahs-3111	164	28	duration	duration	NOUN
ahs-3111	164	29	of	of	ADP
ahs-3111	164	30	brackish	brackish	ADJ
ahs-3111	164	31	irrigation	irrigation	NOUN
ahs-3111	164	32	water	water	NOUN
ahs-3111	164	33	on	on	ADP
ahs-3111	164	34	fruit	fruit	NOUN
ahs-3111	164	35	yield	yield	NOUN
ahs-3111	164	36	and	and	CCONJ
ahs-3111	164	37	quality	quality	NOUN
ahs-3111	164	38	of	of	ADP
ahs-3111	164	39	late	late	ADJ
ahs-3111	164	40	summer	summer	NOUN
ahs-3111	164	41	melons	melon	NOUN
ahs-3111	164	42	.	.	PUNCT
ahs-3111	165	1	agric	agric	PROPN
ahs-3111	165	2	.	.	PUNCT
ahs-3111	165	3	water	water	NOUN
ahs-3111	165	4	manag	manag	PROPN
ahs-3111	165	5	.	.	PUNCT
ahs-3111	165	6	,	,	PUNCT
ahs-3111	166	1	74(2	74(2	NUM
ahs-3111	166	2	):	):	PUNCT
ahs-3111	166	3	123	123	NUM
ahs-3111	166	4	-	-	SYM
ahs-3111	166	5	134	134	NUM
ahs-3111	166	6	.	.	PUNCT
ahs-3111	167	1	bustan	bustan	PROPN
ahs-3111	167	2	a.	a.	PROPN
ahs-3111	167	3	,	,	PUNCT
ahs-3111	167	4	sagi	sagi	PROPN
ahs-3111	167	5	m.	m.	PROPN
ahs-3111	167	6	,	,	PUNCT
ahs-3111	167	7	de	de	X
ahs-3111	167	8	malach	malach	NOUN
ahs-3111	167	9	y.	y.	NOUN
ahs-3111	167	10	,	,	PUNCT
ahs-3111	167	11	pasternak	pasternak	PROPN
ahs-3111	167	12	d.	d.	PROPN
ahs-3111	167	13	,	,	PUNCT
ahs-3111	167	14	2004	2004	NUM
ahs-3111	167	15	effects	effect	NOUN
ahs-3111	167	16	of	of	ADP
ahs-3111	167	17	saline	saline	ADJ
ahs-3111	167	18	irrigation	irrigation	NOUN
ahs-3111	167	19	water	water	NOUN
ahs-3111	167	20	and	and	CCONJ
ahs-3111	167	21	heat	heat	NOUN
ahs-3111	167	22	waves	wave	NOUN
ahs-3111	167	23	on	on	ADP
ahs-3111	167	24	potato	potato	NOUN
ahs-3111	167	25	production	production	NOUN
ahs-3111	167	26	in	in	ADP
ahs-3111	167	27	an	an	DET
ahs-3111	167	28	arid	arid	NOUN
ahs-3111	167	29	environment	environment	NOUN
ahs-3111	167	30	.	.	PUNCT
ahs-3111	168	1	field	field	NOUN
ahs-3111	168	2	crops	crop	NOUN
ahs-3111	168	3	research	research	NOUN
ahs-3111	168	4	,	,	PUNCT
ahs-3111	168	5	90(2	90(2	NUM
ahs-3111	168	6	-	-	PUNCT
ahs-3111	168	7	3	3	NUM
ahs-3111	168	8	):	):	PUNCT
ahs-3111	168	9	275	275	NUM
ahs-3111	168	10	-	-	SYM
ahs-3111	168	11	285	285	NUM
ahs-3111	168	12	.	.	PUNCT
ahs-3111	169	1	carvalho	carvalho	PROPN
ahs-3111	169	2	l.	l.	PROPN
ahs-3111	169	3	,	,	PUNCT
ahs-3111	169	4	vidigal	vidigal	ADJ
ahs-3111	169	5	p.	p.	NOUN
ahs-3111	169	6	,	,	PUNCT
ahs-3111	169	7	amâncio	amâncio	PROPN
ahs-3111	169	8	s.	s.	PROPN
ahs-3111	169	9	,	,	PUNCT
ahs-3111	169	10	2015	2015	NUM
ahs-3111	169	11	oxidative	oxidative	ADJ
ahs-3111	169	12	stress	stress	NOUN
ahs-3111	169	13	homeostasis	homeostasis	NOUN
ahs-3111	169	14	in	in	ADP
ahs-3111	169	15	grapevine	grapevine	NOUN
ahs-3111	169	16	(	(	PUNCT
ahs-3111	169	17	vitis	vitis	ADJ
ahs-3111	169	18	vinifera	vinifera	NOUN
ahs-3111	169	19	l.	l.	NOUN
ahs-3111	169	20	)	)	PUNCT
ahs-3111	169	21	.	.	PUNCT
ahs-3111	170	1	frontiers	frontier	NOUN
ahs-3111	170	2	in	in	ADP
ahs-3111	170	3	environ	environ	PROPN
ahs-3111	170	4	.	.	PUNCT
ahs-3111	171	1	sci	sci	PROPN
ahs-3111	171	2	.	.	PROPN
ahs-3111	171	3	,	,	PUNCT
ahs-3111	171	4	3(20	3(20	NUM
ahs-3111	171	5	):	):	PUNCT
ahs-3111	171	6	1	1	NUM
ahs-3111	171	7	-	-	SYM
ahs-3111	171	8	15	15	NUM
ahs-3111	171	9	.	.	PUNCT
ahs-3111	172	1	cavagnaro	cavagnaro	PROPN
ahs-3111	172	2	j.	j.	PROPN
ahs-3111	172	3	,	,	PUNCT
ahs-3111	172	4	ponce	ponce	PROPN
ahs-3111	172	5	m.	m.	NOUN
ahs-3111	172	6	,	,	PUNCT
ahs-3111	172	7	guzmán	guzmán	PROPN
ahs-3111	172	8	j.	j.	PROPN
ahs-3111	172	9	,	,	PUNCT
ahs-3111	172	10	cirrincione	cirrincione	NOUN
ahs-3111	172	11	m.	m.	NOUN
ahs-3111	172	12	,	,	PUNCT
ahs-3111	172	13	adv	adv	PROPN
ahs-3111	172	14	.	.	PUNCT
ahs-3111	172	15	hort	hort	PROPN
ahs-3111	172	16	.	.	PUNCT
ahs-3111	173	1	sci	sci	PROPN
ahs-3111	173	2	.	.	PROPN
ahs-3111	173	3	,	,	PUNCT
ahs-3111	173	4	2017	2017	NUM
ahs-3111	173	5	31(4	31(4	NUM
ahs-3111	173	6	):	):	PUNCT
ahs-3111	173	7	275	275	NUM
ahs-3111	173	8	-	-	SYM
ahs-3111	173	9	280	280	NUM
ahs-3111	173	10	280	280	NUM
ahs-3111	173	11	2006	2006	NUM
ahs-3111	173	12	argentinean	argentinean	NOUN
ahs-3111	173	13	cultivars	cultivar	NOUN
ahs-3111	173	14	of	of	ADP
ahs-3111	173	15	vitis	vitis	ADJ
ahs-3111	173	16	vinifera	vinifera	NOUN
ahs-3111	173	17	grow	grow	VERB
ahs-3111	173	18	better	well	ADJ
ahs-3111	173	19	than	than	ADP
ahs-3111	173	20	european	european	ADJ
ahs-3111	173	21	ones	one	NOUN
ahs-3111	173	22	when	when	SCONJ
ahs-3111	173	23	cultured	cultured	ADJ
ahs-3111	173	24	in	in	ADP
ahs-3111	173	25	vitro	vitro	X
ahs-3111	173	26	under	under	ADP
ahs-3111	173	27	salinity	salinity	NOUN
ahs-3111	173	28	.	.	PUNCT
ahs-3111	174	1	biocell	biocell	PROPN
ahs-3111	174	2	,	,	PUNCT
ahs-3111	174	3	30(1	30(1	NUM
ahs-3111	174	4	):	):	PUNCT
ahs-3111	174	5	1	1	NUM
ahs-3111	174	6	-	-	SYM
ahs-3111	174	7	7	7	NUM
ahs-3111	174	8	.	.	PUNCT
ahs-3111	174	9	colla	colla	PROPN
ahs-3111	174	10	g.	g.	PROPN
ahs-3111	174	11	,	,	PUNCT
ahs-3111	174	12	rouphael	rouphael	VERB
ahs-3111	174	13	y.	y.	PROPN
ahs-3111	174	14	,	,	PUNCT
ahs-3111	174	15	leonardi	leonardi	PROPN
ahs-3111	174	16	c.	c.	PROPN
ahs-3111	174	17	,	,	PUNCT
ahs-3111	174	18	bie	bie	PROPN
ahs-3111	174	19	z.	z.	PROPN
ahs-3111	174	20	,	,	PUNCT
ahs-3111	174	21	2010	2010	NUM
ahs-3111	174	22	role	role	NOUN
ahs-3111	174	23	of	of	ADP
ahs-3111	174	24	grafting	graft	VERB
ahs-3111	174	25	in	in	ADP
ahs-3111	174	26	vegetable	vegetable	NOUN
ahs-3111	174	27	crops	crop	NOUN
ahs-3111	174	28	grown	grow	VERB
ahs-3111	174	29	under	under	ADP
ahs-3111	174	30	saline	saline	ADJ
ahs-3111	174	31	conditions	condition	NOUN
ahs-3111	174	32	.	.	PUNCT
ahs-3111	175	1	sci	sci	PROPN
ahs-3111	175	2	.	.	PROPN
ahs-3111	175	3	hortic	hortic	PROPN
ahs-3111	175	4	.	.	PUNCT
ahs-3111	175	5	,	,	PUNCT
ahs-3111	176	1	127	127	NUM
ahs-3111	176	2	:	:	PUNCT
ahs-3111	176	3	147	147	NUM
ahs-3111	176	4	-	-	SYM
ahs-3111	176	5	155	155	NUM
ahs-3111	176	6	.	.	PUNCT
ahs-3111	176	7	creasy	creasy	PROPN
ahs-3111	176	8	g.	g.	PROPN
ahs-3111	176	9	,	,	PUNCT
ahs-3111	176	10	creasy	creasy	PROPN
ahs-3111	176	11	l.	l.	PROPN
ahs-3111	176	12	,	,	PUNCT
ahs-3111	176	13	2009	2009	NUM
ahs-3111	176	14	grapes	grape	NOUN
ahs-3111	176	15	.	.	PUNCT
ahs-3111	177	1	crop	crop	NOUN
ahs-3111	177	2	production	production	NOUN
ahs-3111	177	3	science	science	NOUN
ahs-3111	177	4	in	in	ADP
ahs-3111	177	5	horticulture	horticulture	NOUN
ahs-3111	177	6	.	.	PUNCT
ahs-3111	178	1	cabi	cabi	PROPN
ahs-3111	178	2	,	,	PUNCT
ahs-3111	178	3	cambridge	cambridge	PROPN
ahs-3111	178	4	,	,	PUNCT
ahs-3111	178	5	ma	ma	PROPN
ahs-3111	178	6	,	,	PUNCT
ahs-3111	178	7	usa	usa	PROPN
ahs-3111	178	8	,	,	PUNCT
ahs-3111	178	9	pp	pp	X
ahs-3111	178	10	.	.	PUNCT
ahs-3111	179	1	312	312	NUM
ahs-3111	179	2	.	.	PROPN
ahs-3111	179	3	dardeniz	dardeniz	PROPN
ahs-3111	179	4	a.	a.	PROPN
ahs-3111	179	5	,	,	PUNCT
ahs-3111	179	6	müftüoğlu	müftüoğlu	PROPN
ahs-3111	179	7	n.	n.	PROPN
ahs-3111	179	8	,	,	PUNCT
ahs-3111	179	9	altay	altay	PROPN
ahs-3111	179	10	h.	h.	PROPN
ahs-3111	179	11	,	,	PUNCT
ahs-3111	179	12	2006	2006	NUM
ahs-3111	179	13	determination	determination	NOUN
ahs-3111	179	14	of	of	ADP
ahs-3111	179	15	salt	salt	NOUN
ahs-3111	179	16	tolerance	tolerance	NOUN
ahs-3111	179	17	of	of	ADP
ahs-3111	179	18	some	some	DET
ahs-3111	179	19	american	american	ADJ
ahs-3111	179	20	grape	grape	NOUN
ahs-3111	179	21	rootstocks	rootstock	NOUN
ahs-3111	179	22	.	.	PUNCT
ahs-3111	180	1	bangladesh	bangladesh	PROPN
ahs-3111	180	2	j.	j.	PROPN
ahs-3111	180	3	bot	bot	PROPN
ahs-3111	180	4	.	.	PUNCT
ahs-3111	180	5	,	,	PUNCT
ahs-3111	180	6	35(2	35(2	NUM
ahs-3111	180	7	):	):	PUNCT
ahs-3111	180	8	143	143	NUM
ahs-3111	180	9	-	-	SYM
ahs-3111	180	10	150	150	NUM
ahs-3111	180	11	.	.	PUNCT
ahs-3111	181	1	diédhiou	diédhiou	PROPN
ahs-3111	181	2	c.	c.	PROPN
ahs-3111	181	3	,	,	PUNCT
ahs-3111	181	4	popova	popova	NOUN
ahs-3111	181	5	o.	o.	PROPN
ahs-3111	181	6	,	,	PUNCT
ahs-3111	181	7	dietz	dietz	PROPN
ahs-3111	181	8	k.	k.	PROPN
ahs-3111	181	9	,	,	PUNCT
ahs-3111	181	10	golldack	golldack	PROPN
ahs-3111	181	11	d.	d.	PROPN
ahs-3111	181	12	,	,	PUNCT
ahs-3111	181	13	2008	2008	NUM
ahs-3111	181	14	the	the	DET
ahs-3111	181	15	snf1type	snf1type	PROPN
ahs-3111	181	16	serine	serine	NOUN
ahs-3111	181	17	-	-	PUNCT
ahs-3111	181	18	threonine	threonine	ADJ
ahs-3111	181	19	protein	protein	NOUN
ahs-3111	181	20	kinase	kinase	PROPN
ahs-3111	181	21	sapk4	sapk4	PROPN
ahs-3111	181	22	regulates	regulate	VERB
ahs-3111	181	23	stress	stress	NOUN
ahs-3111	181	24	responsive	responsive	ADJ
ahs-3111	181	25	gene	gene	NOUN
ahs-3111	181	26	expression	expression	NOUN
ahs-3111	181	27	in	in	ADP
ahs-3111	181	28	rice	rice	NOUN
ahs-3111	181	29	.	.	PUNCT
ahs-3111	182	1	bmc	bmc	ADJ
ahs-3111	182	2	plant	plant	NOUN
ahs-3111	182	3	biology	biology	NOUN
ahs-3111	182	4	,	,	PUNCT
ahs-3111	182	5	8	8	NUM
ahs-3111	182	6	:	:	SYM
ahs-3111	182	7	49	49	NUM
ahs-3111	182	8	.	.	PUNCT
ahs-3111	183	1	ellouzi	ellouzi	PROPN
ahs-3111	183	2	h.	h.	PROPN
ahs-3111	183	3	,	,	PUNCT
ahs-3111	183	4	hamed	hamed	PROPN
ahs-3111	183	5	b.	b.	PROPN
ahs-3111	183	6	,	,	PUNCT
ahs-3111	183	7	hernández	hernández	PROPN
ahs-3111	183	8	i.	i.	PROPN
ahs-3111	183	9	,	,	PUNCT
ahs-3111	183	10	cela	cela	PROPN
ahs-3111	183	11	j.	j.	PROPN
ahs-3111	183	12	,	,	PUNCT
ahs-3111	183	13	müller	müller	PROPN
ahs-3111	183	14	m.	m.	PROPN
ahs-3111	183	15	,	,	PUNCT
ahs-3111	183	16	magné	magné	PROPN
ahs-3111	183	17	c.	c.	PROPN
ahs-3111	183	18	,	,	PUNCT
ahs-3111	183	19	abdelly	abdelly	ADV
ahs-3111	183	20	c.	c.	NOUN
ahs-3111	183	21	,	,	PUNCT
ahs-3111	183	22	munné	munné	NOUN
ahs-3111	183	23	-	-	PUNCT
ahs-3111	183	24	bosch	bosch	PROPN
ahs-3111	183	25	s.	s.	PROPN
ahs-3111	183	26	,	,	PUNCT
ahs-3111	183	27	2014	2014	NUM
ahs-3111	183	28	a	a	DET
ahs-3111	183	29	comparative	comparative	ADJ
ahs-3111	183	30	study	study	NOUN
ahs-3111	183	31	of	of	ADP
ahs-3111	183	32	the	the	DET
ahs-3111	183	33	early	early	ADJ
ahs-3111	183	34	osmotic	osmotic	ADJ
ahs-3111	183	35	,	,	PUNCT
ahs-3111	183	36	ionic	ionic	ADJ
ahs-3111	183	37	,	,	PUNCT
ahs-3111	183	38	redox	redox	ADJ
ahs-3111	183	39	and	and	CCONJ
ahs-3111	183	40	hormonal	hormonal	ADJ
ahs-3111	183	41	signaling	signal	VERB
ahs-3111	183	42	response	response	NOUN
ahs-3111	183	43	in	in	ADP
ahs-3111	183	44	leaves	leave	NOUN
ahs-3111	183	45	and	and	CCONJ
ahs-3111	183	46	roots	root	NOUN
ahs-3111	183	47	of	of	ADP
ahs-3111	183	48	two	two	NUM
ahs-3111	183	49	halophytes	halophyte	NOUN
ahs-3111	183	50	and	and	CCONJ
ahs-3111	183	51	a	a	DET
ahs-3111	183	52	glycophyte	glycophyte	NOUN
ahs-3111	183	53	to	to	ADP
ahs-3111	183	54	salinity	salinity	NOUN
ahs-3111	183	55	.	.	PUNCT
ahs-3111	184	1	planta	planta	PROPN
ahs-3111	184	2	,	,	PUNCT
ahs-3111	184	3	240(6	240(6	NUM
ahs-3111	184	4	):	):	PUNCT
ahs-3111	184	5	1299	1299	NUM
ahs-3111	184	6	-	-	SYM
ahs-3111	184	7	1317	1317	NUM
ahs-3111	184	8	.	.	PUNCT
ahs-3111	185	1	fao	fao	ADJ
ahs-3111	185	2	,	,	PUNCT
ahs-3111	185	3	2014	2014	NUM
ahs-3111	185	4	statistical	statistical	ADJ
ahs-3111	185	5	pocketbook	pocketbook	NOUN
ahs-3111	185	6	.	.	PUNCT
ahs-3111	186	1	world	world	NOUN
ahs-3111	186	2	food	food	PROPN
ahs-3111	186	3	and	and	CCONJ
ahs-3111	186	4	agriculture	agriculture	NOUN
ahs-3111	186	5	,	,	PUNCT
ahs-3111	186	6	2014	2014	NUM
ahs-3111	186	7	.	.	PUNCT
ahs-3111	187	1	food	food	NOUN
ahs-3111	187	2	and	and	CCONJ
ahs-3111	187	3	agriculture	agriculture	NOUN
ahs-3111	187	4	organization	organization	NOUN
ahs-3111	187	5	of	of	ADP
ahs-3111	187	6	the	the	DET
ahs-3111	187	7	united	united	PROPN
ahs-3111	187	8	nations	nations	PROPN
ahs-3111	187	9	(	(	PUNCT
ahs-3111	187	10	fao	fao	PROPN
ahs-3111	187	11	)	)	PUNCT
ahs-3111	187	12	,	,	PUNCT
ahs-3111	187	13	rome	rome	PROPN
ahs-3111	187	14	,	,	PUNCT
ahs-3111	187	15	italy	italy	PROPN
ahs-3111	187	16	.	.	PUNCT
ahs-3111	188	1	giuffrida	giuffrida	PROPN
ahs-3111	188	2	f.	f.	PROPN
ahs-3111	188	3	,	,	PUNCT
ahs-3111	188	4	cassaniti	cassaniti	PROPN
ahs-3111	188	5	c.	c.	PROPN
ahs-3111	188	6	,	,	PUNCT
ahs-3111	188	7	leonardi	leonardi	PROPN
ahs-3111	188	8	c.	c.	PROPN
ahs-3111	188	9	,	,	PUNCT
ahs-3111	188	10	2014	2014	NUM
ahs-3111	188	11	tomato	tomato	NOUN
ahs-3111	188	12	and	and	CCONJ
ahs-3111	188	13	eggplant	eggplant	NOUN
ahs-3111	188	14	scions	scion	NOUN
ahs-3111	188	15	influence	influence	VERB
ahs-3111	188	16	the	the	DET
ahs-3111	188	17	effect	effect	NOUN
ahs-3111	188	18	of	of	ADP
ahs-3111	188	19	rootstock	rootstock	NOUN
ahs-3111	188	20	under	under	ADP
ahs-3111	188	21	na2so4	na2so4	NOUN
ahs-3111	188	22	salinity	salinity	NOUN
ahs-3111	188	23	.	.	PUNCT
ahs-3111	189	1	acta	acta	PROPN
ahs-3111	189	2	agriculturae	agriculturae	PROPN
ahs-3111	189	3	scandinavica	scandinavica	PROPN
ahs-3111	189	4	,	,	PUNCT
ahs-3111	189	5	section	section	NOUN
ahs-3111	189	6	b	b	NOUN
ahs-3111	189	7	soil	soil	NOUN
ahs-3111	189	8	&	&	CCONJ
ahs-3111	189	9	plant	plant	NOUN
ahs-3111	189	10	science	science	NOUN
ahs-3111	189	11	,	,	PUNCT
ahs-3111	189	12	64(8	64(8	NUM
ahs-3111	189	13	):	):	PUNCT
ahs-3111	189	14	700	700	NUM
ahs-3111	189	15	-	-	SYM
ahs-3111	189	16	709	709	NUM
ahs-3111	189	17	.	.	PUNCT
ahs-3111	190	1	gu	gu	PROPN
ahs-3111	190	2	s.	s.	PROPN
ahs-3111	190	3	,	,	PUNCT
ahs-3111	190	4	2003	2003	NUM
ahs-3111	190	5	rootstock	rootstock	NOUN
ahs-3111	190	6	and	and	CCONJ
ahs-3111	190	7	mounding	mound	VERB
ahs-3111	190	8	effect	effect	NOUN
ahs-3111	190	9	on	on	ADP
ahs-3111	190	10	growth	growth	NOUN
ahs-3111	190	11	and	and	CCONJ
ahs-3111	190	12	cold	cold	ADJ
ahs-3111	190	13	hardiness	hardiness	ADJ
ahs-3111	190	14	of	of	ADP
ahs-3111	190	15	‘	'	PUNCT
ahs-3111	190	16	gewürztraminer	gewürztraminer	NOUN
ahs-3111	190	17	’	'	PUNCT
ahs-3111	190	18	(	(	PUNCT
ahs-3111	190	19	vitis	vitis	ADJ
ahs-3111	190	20	vinifera	vinifera	NOUN
ahs-3111	190	21	)	)	PUNCT
ahs-3111	190	22	and	and	CCONJ
ahs-3111	190	23	bud	bud	ADJ
ahs-3111	190	24	dormancy	dormancy	NOUN
ahs-3111	190	25	of	of	ADP
ahs-3111	190	26	‘	'	PUNCT
ahs-3111	190	27	lacrosse	lacrosse	ADJ
ahs-3111	190	28	’	'	PUNCT
ahs-3111	190	29	and	and	CCONJ
ahs-3111	190	30	‘	'	PUNCT
ahs-3111	190	31	chambourcin	chambourcin	NOUN
ahs-3111	190	32	’	'	PUNCT
ahs-3111	190	33	(	(	PUNCT
ahs-3111	190	34	vitis	vitis	ADJ
ahs-3111	190	35	spp	spp	NOUN
ahs-3111	190	36	.	.	PUNCT
ahs-3111	190	37	)	)	PUNCT
ahs-3111	190	38	.	.	PUNCT
ahs-3111	191	1	ph	ph	PROPN
ahs-3111	191	2	d.	d.	PROPN
ahs-3111	191	3	dissertation	dissertation	PROPN
ahs-3111	191	4	,	,	PUNCT
ahs-3111	191	5	university	university	PROPN
ahs-3111	191	6	of	of	ADP
ahs-3111	191	7	nebraska	nebraska	PROPN
ahs-3111	191	8	,	,	PUNCT
ahs-3111	191	9	lincoln	lincoln	PROPN
ahs-3111	191	10	,	,	PUNCT
ahs-3111	191	11	usa	usa	PROPN
ahs-3111	191	12	.	.	PROPN
ahs-3111	192	1	halliwell	halliwell	PROPN
ahs-3111	192	2	b.	b.	PROPN
ahs-3111	192	3	,	,	PUNCT
ahs-3111	192	4	2006	2006	NUM
ahs-3111	192	5	reactive	reactive	ADJ
ahs-3111	192	6	oxygen	oxygen	NOUN
ahs-3111	192	7	species	specie	NOUN
ahs-3111	192	8	and	and	CCONJ
ahs-3111	192	9	antioxidant	antioxidant	NOUN
ahs-3111	192	10	.	.	PUNCT
ahs-3111	193	1	redox	redox	ADJ
ahs-3111	193	2	biology	biology	NOUN
ahs-3111	193	3	is	be	AUX
ahs-3111	193	4	a	a	DET
ahs-3111	193	5	fundamental	fundamental	ADJ
ahs-3111	193	6	theme	theme	NOUN
ahs-3111	193	7	of	of	ADP
ahs-3111	193	8	aerobic	aerobic	ADJ
ahs-3111	193	9	life	life	NOUN
ahs-3111	193	10	.	.	PUNCT
ahs-3111	194	1	plant	plant	NOUN
ahs-3111	194	2	physiology	physiology	NOUN
ahs-3111	194	3	,	,	PUNCT
ahs-3111	194	4	141	141	NUM
ahs-3111	194	5	:	:	SYM
ahs-3111	194	6	312	312	NUM
ahs-3111	194	7	-	-	SYM
ahs-3111	194	8	322	322	NUM
ahs-3111	194	9	.	.	PUNCT
ahs-3111	195	1	mittler	mittler	PROPN
ahs-3111	195	2	r.	r.	PROPN
ahs-3111	195	3	,	,	PUNCT
ahs-3111	195	4	2002	2002	NUM
ahs-3111	195	5	oxidative	oxidative	ADJ
ahs-3111	195	6	stress	stress	NOUN
ahs-3111	195	7	,	,	PUNCT
ahs-3111	195	8	antioxidants	antioxidant	NOUN
ahs-3111	195	9	and	and	CCONJ
ahs-3111	195	10	stress	stress	NOUN
ahs-3111	195	11	tolerance	tolerance	NOUN
ahs-3111	195	12	.	.	PUNCT
ahs-3111	196	1	trends	trend	NOUN
ahs-3111	196	2	plant	plant	VERB
ahs-3111	196	3	sci	sci	PROPN
ahs-3111	196	4	.	.	PROPN
ahs-3111	196	5	,	,	PUNCT
ahs-3111	196	6	7(9	7(9	NUM
ahs-3111	196	7	):	):	PUNCT
ahs-3111	196	8	405	405	NUM
ahs-3111	196	9	-	-	SYM
ahs-3111	196	10	410	410	NUM
ahs-3111	196	11	.	.	PUNCT
ahs-3111	197	1	mizrahi	mizrahi	PROPN
ahs-3111	197	2	y.	y.	PROPN
ahs-3111	197	3	,	,	PUNCT
ahs-3111	197	4	taleisnik	taleisnik	PROPN
ahs-3111	197	5	e.	e.	PROPN
ahs-3111	197	6	,	,	PUNCT
ahs-3111	197	7	kagan	kagan	PROPN
ahs-3111	197	8	-	-	PUNCT
ahs-3111	197	9	zur	zur	PROPN
ahs-3111	197	10	v.	v.	ADV
ahs-3111	197	11	,	,	PUNCT
ahs-3111	197	12	zohar	zohar	PROPN
ahs-3111	197	13	y.	y.	PROPN
ahs-3111	197	14	,	,	PUNCT
ahs-3111	197	15	offenbach	offenbach	PROPN
ahs-3111	197	16	r.	r.	PROPN
ahs-3111	197	17	,	,	PUNCT
ahs-3111	197	18	matan	matan	PROPN
ahs-3111	197	19	e.	e.	PROPN
ahs-3111	197	20	,	,	PUNCT
ahs-3111	197	21	golan	golan	PROPN
ahs-3111	197	22	r.	r.	PROPN
ahs-3111	197	23	,	,	PUNCT
ahs-3111	197	24	1988	1988	NUM
ahs-3111	197	25	a	a	DET
ahs-3111	197	26	saline	saline	ADJ
ahs-3111	197	27	irrigation	irrigation	NOUN
ahs-3111	197	28	regime	regime	NOUN
ahs-3111	197	29	for	for	ADP
ahs-3111	197	30	improving	improve	VERB
ahs-3111	197	31	tomato	tomato	NOUN
ahs-3111	197	32	fruit	fruit	NOUN
ahs-3111	197	33	quality	quality	NOUN
ahs-3111	197	34	without	without	ADP
ahs-3111	197	35	reducing	reduce	VERB
ahs-3111	197	36	yield	yield	NOUN
ahs-3111	197	37	.	.	PUNCT
ahs-3111	198	1	j.	j.	PROPN
ahs-3111	198	2	amer	amer	PROPN
ahs-3111	198	3	.	.	PUNCT
ahs-3111	198	4	soc	soc	PROPN
ahs-3111	198	5	.	.	PUNCT
ahs-3111	199	1	hort	hort	PROPN
ahs-3111	199	2	.	.	PUNCT
ahs-3111	200	1	sci	sci	PROPN
ahs-3111	200	2	.	.	PROPN
ahs-3111	200	3	,	,	PUNCT
ahs-3111	200	4	113(2	113(2	NUM
ahs-3111	200	5	):	):	PUNCT
ahs-3111	200	6	202	202	NUM
ahs-3111	200	7	-	-	SYM
ahs-3111	200	8	205	205	NUM
ahs-3111	200	9	.	.	PUNCT
ahs-3111	201	1	niu	niu	PROPN
ahs-3111	201	2	x.	x.	PROPN
ahs-3111	201	3	,	,	PUNCT
ahs-3111	201	4	bressan	bressan	PROPN
ahs-3111	201	5	r.	r.	PROPN
ahs-3111	201	6	,	,	PUNCT
ahs-3111	201	7	hasegawa	hasegawa	PROPN
ahs-3111	201	8	p.	p.	PROPN
ahs-3111	201	9	,	,	PUNCT
ahs-3111	201	10	pardo	pardo	PROPN
ahs-3111	201	11	j.	j.	PROPN
ahs-3111	201	12	,	,	PUNCT
ahs-3111	201	13	1995	1995	NUM
ahs-3111	201	14	ion	ion	NOUN
ahs-3111	201	15	homeostasis	homeostasis	NOUN
ahs-3111	201	16	in	in	ADP
ahs-3111	201	17	nacl	nacl	ADJ
ahs-3111	201	18	stress	stress	NOUN
ahs-3111	201	19	environments	environment	NOUN
ahs-3111	201	20	.	.	PUNCT
ahs-3111	202	1	plant	plant	NOUN
ahs-3111	202	2	physiology	physiology	NOUN
ahs-3111	202	3	,	,	PUNCT
ahs-3111	202	4	109(3	109(3	NUM
ahs-3111	202	5	):	):	PUNCT
ahs-3111	202	6	735	735	NUM
ahs-3111	202	7	-	-	SYM
ahs-3111	202	8	742	742	NUM
ahs-3111	202	9	.	.	PUNCT
ahs-3111	203	1	popova	popova	PROPN
ahs-3111	203	2	o.	o.	PROPN
ahs-3111	203	3	,	,	PUNCT
ahs-3111	203	4	yang	yang	PROPN
ahs-3111	203	5	o.	o.	PROPN
ahs-3111	203	6	,	,	PUNCT
ahs-3111	203	7	dietz	dietz	PROPN
ahs-3111	203	8	k.	k.	PROPN
ahs-3111	203	9	,	,	PUNCT
ahs-3111	203	10	golldack	golldack	PROPN
ahs-3111	203	11	d.	d.	PROPN
ahs-3111	203	12	,	,	PUNCT
ahs-3111	203	13	2008	2008	NUM
ahs-3111	203	14	differential	differential	NOUN
ahs-3111	203	15	transcript	transcript	NOUN
ahs-3111	203	16	regulation	regulation	NOUN
ahs-3111	203	17	in	in	ADP
ahs-3111	203	18	arabidopsis	arabidopsis	NOUN
ahs-3111	203	19	thaliana	thaliana	NOUN
ahs-3111	203	20	and	and	CCONJ
ahs-3111	203	21	the	the	DET
ahs-3111	203	22	halotolerant	halotolerant	ADJ
ahs-3111	203	23	lobularia	lobularia	NOUN
ahs-3111	203	24	maritima	maritima	PROPN
ahs-3111	203	25	indicates	indicate	VERB
ahs-3111	203	26	genes	gene	NOUN
ahs-3111	203	27	with	with	ADP
ahs-3111	203	28	potential	potential	ADJ
ahs-3111	203	29	function	function	NOUN
ahs-3111	203	30	in	in	ADP
ahs-3111	203	31	plant	plant	NOUN
ahs-3111	203	32	salt	salt	NOUN
ahs-3111	203	33	adaptation	adaptation	NOUN
ahs-3111	203	34	.	.	PUNCT
ahs-3111	204	1	gene	gene	NOUN
ahs-3111	204	2	,	,	PUNCT
ahs-3111	204	3	423(2	423(2	NUM
ahs-3111	204	4	):	):	PUNCT
ahs-3111	204	5	142	142	NUM
ahs-3111	204	6	-	-	SYM
ahs-3111	204	7	148	148	NUM
ahs-3111	204	8	.	.	PUNCT
ahs-3111	205	1	ranjit	ranjit	PROPN
ahs-3111	205	2	s.l	s.l	PROPN
ahs-3111	205	3	.	.	PROPN
ahs-3111	205	4	,	,	PUNCT
ahs-3111	205	5	manish	manish	PROPN
ahs-3111	205	6	p.	p.	PROPN
ahs-3111	205	7	,	,	PUNCT
ahs-3111	205	8	penna	penna	PROPN
ahs-3111	205	9	s.	s.	PROPN
ahs-3111	205	10	,	,	PUNCT
ahs-3111	205	11	2016	2016	NUM
ahs-3111	205	12	early	early	ADV
ahs-3111	205	13	osmotic	osmotic	ADJ
ahs-3111	205	14	,	,	PUNCT
ahs-3111	205	15	antioxidant	antioxidant	ADJ
ahs-3111	205	16	,	,	PUNCT
ahs-3111	205	17	ionic	ionic	ADJ
ahs-3111	205	18	,	,	PUNCT
ahs-3111	205	19	and	and	CCONJ
ahs-3111	205	20	redox	redox	ADJ
ahs-3111	205	21	responses	response	NOUN
ahs-3111	205	22	to	to	ADP
ahs-3111	205	23	salinity	salinity	NOUN
ahs-3111	205	24	in	in	ADP
ahs-3111	205	25	leaves	leave	NOUN
ahs-3111	205	26	and	and	CCONJ
ahs-3111	205	27	roots	root	NOUN
ahs-3111	205	28	of	of	ADP
ahs-3111	205	29	indian	indian	ADJ
ahs-3111	205	30	mustard	mustard	NOUN
ahs-3111	205	31	(	(	PUNCT
ahs-3111	205	32	brassica	brassica	PROPN
ahs-3111	205	33	juncea	juncea	PROPN
ahs-3111	205	34	l.	l.	PROPN
ahs-3111	205	35	)	)	PUNCT
ahs-3111	205	36	.	.	PUNCT
ahs-3111	206	1	protoplasma	protoplasma	NOUN
ahs-3111	206	2	,	,	PUNCT
ahs-3111	206	3	253(1	253(1	NUM
ahs-3111	206	4	):	):	PUNCT
ahs-3111	206	5	101	101	NUM
ahs-3111	206	6	-	-	SYM
ahs-3111	206	7	110	110	NUM
ahs-3111	206	8	.	.	PUNCT
ahs-3111	207	1	rubio	rubio	PROPN
ahs-3111	207	2	f.	f.	PROPN
ahs-3111	207	3	,	,	PUNCT
ahs-3111	207	4	gassmann	gassmann	PROPN
ahs-3111	207	5	w.	w.	PROPN
ahs-3111	207	6	,	,	PUNCT
ahs-3111	207	7	schroeder	schroeder	PROPN
ahs-3111	207	8	j.	j.	PROPN
ahs-3111	207	9	,	,	PUNCT
ahs-3111	207	10	1995	1995	NUM
ahs-3111	207	11	sodiumdriven	sodiumdriven	VERB
ahs-3111	207	12	potassium	potassium	NOUN
ahs-3111	207	13	uptake	uptake	NOUN
ahs-3111	207	14	by	by	ADP
ahs-3111	207	15	the	the	DET
ahs-3111	207	16	plant	plant	NOUN
ahs-3111	207	17	potassium	potassium	NOUN
ahs-3111	207	18	transporter	transporter	NOUN
ahs-3111	207	19	hkt1	hkt1	NOUN
ahs-3111	207	20	and	and	CCONJ
ahs-3111	207	21	mutations	mutation	NOUN
ahs-3111	207	22	conferring	confer	VERB
ahs-3111	207	23	salt	salt	NOUN
ahs-3111	207	24	tolerance	tolerance	NOUN
ahs-3111	207	25	.	.	PUNCT
ahs-3111	208	1	science	science	NOUN
ahs-3111	208	2	,	,	PUNCT
ahs-3111	208	3	270	270	NUM
ahs-3111	208	4	:	:	PUNCT
ahs-3111	208	5	1660	1660	NUM
ahs-3111	208	6	-	-	SYM
ahs-3111	208	7	1663	1663	NUM
ahs-3111	208	8	.	.	PUNCT
ahs-3111	209	1	shi	shi	PROPN
ahs-3111	209	2	h.	h.	PROPN
ahs-3111	209	3	,	,	PUNCT
ahs-3111	209	4	zhu	zhu	PROPN
ahs-3111	209	5	j.	j.	PROPN
ahs-3111	209	6	,	,	PUNCT
ahs-3111	209	7	2002	2002	NUM
ahs-3111	209	8	regulation	regulation	NOUN
ahs-3111	209	9	of	of	ADP
ahs-3111	209	10	expression	expression	NOUN
ahs-3111	209	11	of	of	ADP
ahs-3111	209	12	the	the	DET
ahs-3111	209	13	vacuolar	vacuolar	ADJ
ahs-3111	209	14	na+/h+	na+/h+	ADJ
ahs-3111	209	15	antiporter	antiporter	NOUN
ahs-3111	209	16	gene	gene	NOUN
ahs-3111	209	17	atnhx1	atnhx1	NOUN
ahs-3111	209	18	by	by	ADP
ahs-3111	209	19	salt	salt	NOUN
ahs-3111	209	20	stress	stress	NOUN
ahs-3111	209	21	and	and	CCONJ
ahs-3111	209	22	abscisic	abscisic	ADJ
ahs-3111	209	23	acid	acid	NOUN
ahs-3111	209	24	.	.	PUNCT
ahs-3111	210	1	plant	plant	NOUN
ahs-3111	210	2	molecular	molecular	ADJ
ahs-3111	210	3	biology	biology	NOUN
ahs-3111	210	4	,	,	PUNCT
ahs-3111	210	5	50(3	50(3	NUM
ahs-3111	210	6	):	):	PUNCT
ahs-3111	210	7	543550	543550	NUM
ahs-3111	210	8	.	.	PUNCT
ahs-3111	211	1	simpson	simpson	PROPN
ahs-3111	211	2	c.r	c.r	PROPN
ahs-3111	211	3	.	.	PROPN
ahs-3111	211	4	,	,	PUNCT
ahs-3111	211	5	nelson	nelson	PROPN
ahs-3111	211	6	s.d	s.d	PROPN
ahs-3111	211	7	.	.	PROPN
ahs-3111	211	8	,	,	PUNCT
ahs-3111	211	9	melgar	melgar	PROPN
ahs-3111	211	10	j.c	j.c	PROPN
ahs-3111	211	11	.	.	PROPN
ahs-3111	211	12	,	,	PUNCT
ahs-3111	211	13	jifon	jifon	PROPN
ahs-3111	211	14	j.	j.	PROPN
ahs-3111	211	15	,	,	PUNCT
ahs-3111	211	16	schuster	schuster	PROPN
ahs-3111	211	17	g.	g.	PROPN
ahs-3111	211	18	,	,	PUNCT
ahs-3111	211	19	volder	volder	PROPN
ahs-3111	211	20	a.	a.	PROPN
ahs-3111	211	21	,	,	PUNCT
ahs-3111	211	22	2015	2015	NUM
ahs-3111	211	23	effects	effect	NOUN
ahs-3111	211	24	of	of	ADP
ahs-3111	211	25	salinity	salinity	NOUN
ahs-3111	211	26	on	on	ADP
ahs-3111	211	27	physiological	physiological	ADJ
ahs-3111	211	28	parameters	parameter	NOUN
ahs-3111	211	29	of	of	ADP
ahs-3111	211	30	grafted	graft	VERB
ahs-3111	211	31	and	and	CCONJ
ahs-3111	211	32	ungrafted	ungrafted	ADJ
ahs-3111	211	33	citrus	citrus	NOUN
ahs-3111	211	34	trees	tree	NOUN
ahs-3111	211	35	.	.	PUNCT
ahs-3111	212	1	scientia	scientia	PROPN
ahs-3111	212	2	horticulturae	horticulturae	PROPN
ahs-3111	212	3	,	,	PUNCT
ahs-3111	212	4	197	197	NUM
ahs-3111	212	5	:	:	SYM
ahs-3111	212	6	483	483	NUM
ahs-3111	212	7	-	-	SYM
ahs-3111	212	8	489	489	NUM
ahs-3111	212	9	.	.	PUNCT
ahs-3111	213	1	southey	southey	PROPN
ahs-3111	213	2	j.	j.	PROPN
ahs-3111	213	3	,	,	PUNCT
ahs-3111	213	4	jooste	jooste	PROPN
ahs-3111	213	5	j.	j.	PROPN
ahs-3111	213	6	,	,	PUNCT
ahs-3111	213	7	1991	1991	NUM
ahs-3111	213	8	the	the	DET
ahs-3111	213	9	effect	effect	NOUN
ahs-3111	213	10	of	of	ADP
ahs-3111	213	11	grapevine	grapevine	NOUN
ahs-3111	213	12	rootstock	rootstock	NOUN
ahs-3111	213	13	on	on	ADP
ahs-3111	213	14	the	the	DET
ahs-3111	213	15	performance	performance	NOUN
ahs-3111	213	16	of	of	ADP
ahs-3111	213	17	vitis	vitis	ADJ
ahs-3111	213	18	vinifera	vinifera	NOUN
ahs-3111	213	19	l.	l.	PROPN
ahs-3111	213	20	(	(	PUNCT
ahs-3111	213	21	cv	cv	PROPN
ahs-3111	213	22	.	.	PROPN
ahs-3111	213	23	colombard	colombard	PROPN
ahs-3111	213	24	)	)	PUNCT
ahs-3111	213	25	on	on	ADP
ahs-3111	213	26	a	a	DET
ahs-3111	213	27	relatively	relatively	ADV
ahs-3111	213	28	saline	saline	ADJ
ahs-3111	213	29	soil	soil	NOUN
ahs-3111	213	30	.	.	PUNCT
ahs-3111	214	1	s.	s.	PROPN
ahs-3111	214	2	afr	afr	PROPN
ahs-3111	214	3	.	.	PUNCT
ahs-3111	215	1	j.	j.	PROPN
ahs-3111	215	2	enol	enol	PROPN
ahs-3111	215	3	.	.	PUNCT
ahs-3111	216	1	vitic	vitic	ADJ
ahs-3111	216	2	.	.	PUNCT
ahs-3111	216	3	,	,	PUNCT
ahs-3111	217	1	12(1	12(1	NUM
ahs-3111	217	2	):	):	PUNCT
ahs-3111	217	3	32	32	NUM
ahs-3111	217	4	-	-	SYM
ahs-3111	217	5	41	41	NUM
ahs-3111	217	6	.	.	PUNCT
ahs-3111	218	1	vasekina	vasekina	PROPN
ahs-3111	218	2	a.	a.	PROPN
ahs-3111	218	3	,	,	PUNCT
ahs-3111	218	4	yershov	yershov	PROPN
ahs-3111	218	5	p.	p.	PROPN
ahs-3111	218	6	,	,	PUNCT
ahs-3111	218	7	reshetova	reshetova	PROPN
ahs-3111	218	8	o.	o.	PROPN
ahs-3111	218	9	,	,	PUNCT
ahs-3111	218	10	tikhonova	tikhonova	PROPN
ahs-3111	218	11	t.	t.	PROPN
ahs-3111	218	12	,	,	PUNCT
ahs-3111	218	13	lunin	lunin	VERB
ahs-3111	218	14	v.	v.	ADV
ahs-3111	218	15	,	,	PUNCT
ahs-3111	218	16	trofimova	trofimova	PROPN
ahs-3111	218	17	m.	m.	NOUN
ahs-3111	218	18	,	,	PUNCT
ahs-3111	218	19	babakov	babakov	PROPN
ahs-3111	218	20	a.	a.	PROPN
ahs-3111	218	21	,	,	PUNCT
ahs-3111	218	22	2005	2005	NUM
ahs-3111	218	23	vacuolar	vacuolar	ADJ
ahs-3111	218	24	na+/h+	na+/h+	ADV
ahs-3111	218	25	antiporter	antiporter	VERB
ahs-3111	218	26	from	from	ADP
ahs-3111	218	27	barley	barley	NOUN
ahs-3111	218	28	:	:	PUNCT
ahs-3111	218	29	identification	identification	NOUN
ahs-3111	218	30	and	and	CCONJ
ahs-3111	218	31	response	response	NOUN
ahs-3111	218	32	to	to	PART
ahs-3111	218	33	salt	salt	VERB
ahs-3111	218	34	stress	stress	NOUN
ahs-3111	218	35	.	.	PUNCT
ahs-3111	219	1	biochemistry	biochemistry	NOUN
ahs-3111	219	2	,	,	PUNCT
ahs-3111	219	3	70(1	70(1	NUM
ahs-3111	219	4	):	):	PUNCT
ahs-3111	219	5	100107	100107	NUM
ahs-3111	219	6	.	.	PUNCT
ahs-3111	220	1	walker	walker	PROPN
ahs-3111	220	2	r.	r.	PROPN
ahs-3111	220	3	,	,	PUNCT
ahs-3111	220	4	blackmore	blackmore	PROPN
ahs-3111	220	5	d.	d.	PROPN
ahs-3111	220	6	,	,	PUNCT
ahs-3111	220	7	clingeleffer	clingeleffer	VERB
ahs-3111	220	8	p.	p.	NOUN
ahs-3111	220	9	,	,	PUNCT
ahs-3111	220	10	correll	correll	PROPN
ahs-3111	220	11	r.	r.	PROPN
ahs-3111	220	12	,	,	PUNCT
ahs-3111	220	13	2002	2002	NUM
ahs-3111	220	14	rootstock	rootstock	NOUN
ahs-3111	220	15	effects	effect	NOUN
ahs-3111	220	16	on	on	ADP
ahs-3111	220	17	salt	salt	NOUN
ahs-3111	220	18	tolerance	tolerance	NOUN
ahs-3111	220	19	of	of	ADP
ahs-3111	220	20	irrigated	irrigated	ADJ
ahs-3111	220	21	field	field	NOUN
ahs-3111	220	22	grown	grow	VERB
ahs-3111	220	23	grapevines	grapevine	NOUN
ahs-3111	220	24	(	(	PUNCT
ahs-3111	220	25	vitis	vitis	ADJ
ahs-3111	220	26	vinifera	vinifera	NOUN
ahs-3111	220	27	l.	l.	PROPN
ahs-3111	220	28	cv	cv	PROPN
ahs-3111	220	29	.	.	PROPN
ahs-3111	220	30	sultana	sultana	PROPN
ahs-3111	220	31	)	)	PUNCT
ahs-3111	220	32	.	.	PUNCT
ahs-3111	221	1	1	1	X
ahs-3111	221	2	.	.	X
ahs-3111	221	3	yield	yield	NOUN
ahs-3111	221	4	and	and	CCONJ
ahs-3111	221	5	vigor	vigor	ADJ
ahs-3111	221	6	inter	inter	NOUN
ahs-3111	221	7	-	-	NOUN
ahs-3111	221	8	relationships	relationship	NOUN
ahs-3111	221	9	.	.	PUNCT
ahs-3111	222	1	australian	australian	ADJ
ahs-3111	222	2	j.	j.	PROPN
ahs-3111	222	3	grape	grape	PROPN
ahs-3111	222	4	and	and	CCONJ
ahs-3111	222	5	wine	wine	NOUN
ahs-3111	222	6	res	re	NOUN
ahs-3111	222	7	.	.	PUNCT
ahs-3111	222	8	,	,	PUNCT
ahs-3111	222	9	8	8	NUM
ahs-3111	222	10	:	:	SYM
ahs-3111	222	11	3	3	NUM
ahs-3111	222	12	-	-	SYM
ahs-3111	222	13	14	14	NUM
ahs-3111	222	14	.	.	PUNCT
ahs-3111	223	1	zörb	zörb	PROPN
ahs-3111	223	2	c.	c.	PROPN
ahs-3111	223	3	,	,	PUNCT
ahs-3111	223	4	noll	noll	PROPN
ahs-3111	223	5	a.	a.	PROPN
ahs-3111	223	6	,	,	PUNCT
ahs-3111	223	7	karl	karl	PROPN
ahs-3111	223	8	s.	s.	PROPN
ahs-3111	223	9	,	,	PUNCT
ahs-3111	223	10	leib	leib	PROPN
ahs-3111	223	11	k.	k.	PROPN
ahs-3111	223	12	,	,	PUNCT
ahs-3111	223	13	yan	yan	PROPN
ahs-3111	223	14	f.	f.	PROPN
ahs-3111	223	15	,	,	PUNCT
ahs-3111	223	16	schubert	schubert	PROPN
ahs-3111	223	17	s.	s.	PROPN
ahs-3111	223	18	,	,	PUNCT
ahs-3111	223	19	2005	2005	NUM
ahs-3111	223	20	molecular	molecular	ADJ
ahs-3111	223	21	characterization	characterization	NOUN
ahs-3111	223	22	of	of	ADP
ahs-3111	223	23	na+/h+	na+/h+	ADJ
ahs-3111	223	24	antiporters	antiporter	NOUN
ahs-3111	223	25	(	(	PUNCT
ahs-3111	223	26	zmnhx	zmnhx	NOUN
ahs-3111	223	27	)	)	PUNCT
ahs-3111	223	28	of	of	ADP
ahs-3111	223	29	maize	maize	NOUN
ahs-3111	223	30	(	(	PUNCT
ahs-3111	223	31	zea	zea	PROPN
ahs-3111	223	32	mays	mays	PROPN
ahs-3111	223	33	l.	l.	PROPN
ahs-3111	223	34	)	)	PUNCT
ahs-3111	223	35	and	and	CCONJ
ahs-3111	223	36	their	their	PRON
ahs-3111	223	37	expression	expression	NOUN
ahs-3111	223	38	under	under	ADP
ahs-3111	223	39	salt	salt	NOUN
ahs-3111	223	40	stress	stress	NOUN
ahs-3111	223	41	.	.	PUNCT
ahs-3111	224	1	j.	j.	PROPN
ahs-3111	224	2	plant	plant	PROPN
ahs-3111	224	3	physiol	physiol	PROPN
ahs-3111	224	4	.	.	PUNCT
ahs-3111	224	5	,	,	PUNCT
ahs-3111	224	6	162(1	162(1	NUM
ahs-3111	224	7	):	):	PUNCT
ahs-3111	224	8	55	55	NUM
ahs-3111	224	9	-	-	SYM
ahs-3111	224	10	66	66	NUM
ahs-3111	224	11	.	.	PUNCT
ahs-3111	225	1	zrig	zrig	PROPN
ahs-3111	225	2	a.	a.	PROPN
ahs-3111	225	3	,	,	PUNCT
ahs-3111	225	4	mohamed	mohamed	PROPN
ahs-3111	225	5	h.b	h.b	PROPN
ahs-3111	225	6	.	.	PROPN
ahs-3111	225	7	,	,	PUNCT
ahs-3111	225	8	tounekti	tounekti	PROPN
ahs-3111	225	9	t.	t.	PROPN
ahs-3111	225	10	,	,	PUNCT
ahs-3111	225	11	khemira	khemira	PROPN
ahs-3111	225	12	h.	h.	PROPN
ahs-3111	225	13	,	,	PUNCT
ahs-3111	225	14	serrano	serrano	PROPN
ahs-3111	225	15	m.	m.	NOUN
ahs-3111	225	16	,	,	PUNCT
ahs-3111	225	17	valero	valero	PROPN
ahs-3111	225	18	d.	d.	PROPN
ahs-3111	225	19	,	,	PUNCT
ahs-3111	225	20	vadel	vadel	PROPN
ahs-3111	225	21	a.m.	a.m.	PROPN
ahs-3111	225	22	,	,	PUNCT
ahs-3111	225	23	2016	2016	NUM
ahs-3111	225	24	effect	effect	NOUN
ahs-3111	225	25	of	of	ADP
ahs-3111	225	26	rootstock	rootstock	NOUN
ahs-3111	225	27	on	on	ADP
ahs-3111	225	28	salinity	salinity	NOUN
ahs-3111	225	29	tolerance	tolerance	NOUN
ahs-3111	225	30	of	of	ADP
ahs-3111	225	31	sweet	sweet	ADJ
ahs-3111	225	32	almond	almond	NOUN
ahs-3111	225	33	(	(	PUNCT
ahs-3111	225	34	cv	cv	PROPN
ahs-3111	225	35	.	.	PROPN
ahs-3111	225	36	mazzetto	mazzetto	NOUN
ahs-3111	225	37	)	)	PUNCT
ahs-3111	225	38	.	.	PUNCT
ahs-3111	226	1	south	south	ADJ
ahs-3111	226	2	african	african	ADJ
ahs-3111	226	3	journal	journal	NOUN
ahs-3111	226	4	of	of	ADP
ahs-3111	226	5	botany	botany	NOUN
ahs-3111	226	6	,	,	PUNCT
ahs-3111	226	7	102	102	NUM
ahs-3111	226	8	:	:	SYM
ahs-3111	226	9	50	50	NUM
ahs-3111	226	10	-	-	SYM
ahs-3111	226	11	59	59	NUM
ahs-3111	226	12	.	.	PUNCT