id	sid	tid	token	lemma	pos
ahs-3127	1	1	impaginato	impaginato	PROPN
ahs-3127	1	2	79	79	NUM
ahs-3127	1	3	adv	adv	PROPN
ahs-3127	1	4	.	.	PUNCT
ahs-3127	1	5	hort	hort	PROPN
ahs-3127	1	6	.	.	PUNCT
ahs-3127	2	1	sci	sci	PROPN
ahs-3127	2	2	.	.	PROPN
ahs-3127	2	3	,	,	PUNCT
ahs-3127	2	4	2018	2018	NUM
ahs-3127	2	5	32(1	32(1	NUM
ahs-3127	2	6	):	):	PUNCT
ahs-3127	2	7	79	79	NUM
ahs-3127	2	8	-	-	SYM
ahs-3127	2	9	92	92	NUM
ahs-3127	2	10	doi	doi	NOUN
ahs-3127	2	11	:	:	PUNCT
ahs-3127	2	12	10.13128	10.13128	NUM
ahs-3127	2	13	/	/	SYM
ahs-3127	2	14	ahs-20646	ahs-20646	NOUN
ahs-3127	2	15	cotton	cotton	NOUN
ahs-3127	2	16	flowering	flower	VERB
ahs-3127	2	17	behavior	behavior	NOUN
ahs-3127	2	18	,	,	PUNCT
ahs-3127	2	19	fiber	fiber	NOUN
ahs-3127	2	20	traits	trait	NOUN
ahs-3127	2	21	and	and	CCONJ
ahs-3127	2	22	gene	gene	NOUN
ahs-3127	2	23	expression	expression	NOUN
ahs-3127	2	24	under	under	ADP
ahs-3127	2	25	watershortage	watershortage	NOUN
ahs-3127	2	26	stress	stress	NOUN
ahs-3127	2	27	d.	d.	PROPN
ahs-3127	2	28	jawdat	jawdat	PROPN
ahs-3127	2	29	1	1	NUM
ahs-3127	2	30	(	(	PUNCT
ahs-3127	2	31	*	*	NOUN
ahs-3127	2	32	)	)	PUNCT
ahs-3127	2	33	,	,	PUNCT
ahs-3127	2	34	a.w	a.w	PROPN
ahs-3127	2	35	.	.	PROPN
ahs-3127	2	36	allaf	allaf	PROPN
ahs-3127	2	37	2	2	NUM
ahs-3127	2	38	,	,	PUNCT
ahs-3127	2	39	n.	n.	NOUN
ahs-3127	2	40	taher	taher	ADJ
ahs-3127	2	41	1	1	NUM
ahs-3127	2	42	,	,	PUNCT
ahs-3127	2	43	a.	a.	PROPN
ahs-3127	2	44	al	al	PROPN
ahs-3127	2	45	-	-	PUNCT
ahs-3127	2	46	zier	zier	NOUN
ahs-3127	2	47	2	2	NUM
ahs-3127	2	48	,	,	PUNCT
ahs-3127	2	49	n.	n.	NOUN
ahs-3127	2	50	morsel	morsel	PROPN
ahs-3127	2	51	1	1	NUM
ahs-3127	2	52	,	,	PUNCT
ahs-3127	2	53	z.	z.	PROPN
ahs-3127	2	54	ajii	ajii	PROPN
ahs-3127	2	55	2	2	NUM
ahs-3127	2	56	,	,	PUNCT
ahs-3127	2	57	b.	b.	PROPN
ahs-3127	2	58	alsafadi	alsafadi	PROPN
ahs-3127	2	59	1	1	NUM
ahs-3127	2	60	1	1	NUM
ahs-3127	2	61	department	department	NOUN
ahs-3127	2	62	of	of	ADP
ahs-3127	2	63	molecular	molecular	ADJ
ahs-3127	2	64	biology	biology	NOUN
ahs-3127	2	65	and	and	CCONJ
ahs-3127	2	66	biotechnology	biotechnology	NOUN
ahs-3127	2	67	,	,	PUNCT
ahs-3127	2	68	atomic	atomic	ADJ
ahs-3127	2	69	energy	energy	NOUN
ahs-3127	2	70	commission	commission	PROPN
ahs-3127	2	71	,	,	PUNCT
ahs-3127	2	72	po	po	PROPN
ahs-3127	2	73	box	box	PROPN
ahs-3127	2	74	6091	6091	NUM
ahs-3127	2	75	,	,	PUNCT
ahs-3127	2	76	damascus	damascus	PROPN
ahs-3127	2	77	,	,	PUNCT
ahs-3127	2	78	syria	syria	PROPN
ahs-3127	2	79	.	.	PROPN
ahs-3127	2	80	2	2	NUM
ahs-3127	2	81	department	department	NOUN
ahs-3127	2	82	of	of	ADP
ahs-3127	2	83	chemistry	chemistry	NOUN
ahs-3127	2	84	,	,	PUNCT
ahs-3127	2	85	atomic	atomic	ADJ
ahs-3127	2	86	energy	energy	NOUN
ahs-3127	2	87	commission	commission	PROPN
ahs-3127	2	88	,	,	PUNCT
ahs-3127	2	89	po	po	PROPN
ahs-3127	2	90	box	box	PROPN
ahs-3127	2	91	6091	6091	NUM
ahs-3127	2	92	,	,	PUNCT
ahs-3127	2	93	damascus	damascus	PROPN
ahs-3127	2	94	,	,	PUNCT
ahs-3127	2	95	syria	syria	PROPN
ahs-3127	2	96	.	.	PUNCT
ahs-3127	3	1	key	key	ADJ
ahs-3127	3	2	words	word	NOUN
ahs-3127	3	3	:	:	PUNCT
ahs-3127	3	4	cotton	cotton	NOUN
ahs-3127	3	5	,	,	PUNCT
ahs-3127	3	6	fiber	fiber	NOUN
ahs-3127	3	7	quality	quality	NOUN
ahs-3127	3	8	,	,	PUNCT
ahs-3127	3	9	flowering	flowering	NOUN
ahs-3127	3	10	,	,	PUNCT
ahs-3127	3	11	ftir	ftir	ADJ
ahs-3127	3	12	,	,	PUNCT
ahs-3127	3	13	gene	gene	NOUN
ahs-3127	3	14	expression	expression	NOUN
ahs-3127	3	15	,	,	PUNCT
ahs-3127	3	16	tga	tga	PROPN
ahs-3127	3	17	,	,	PUNCT
ahs-3127	3	18	xrd	xrd	NOUN
ahs-3127	3	19	.	.	PUNCT
ahs-3127	4	1	abstract	abstract	PROPN
ahs-3127	4	2	:	:	PUNCT
ahs-3127	4	3	two	two	NUM
ahs-3127	4	4	accredited	accredited	ADJ
ahs-3127	4	5	cotton	cotton	NOUN
ahs-3127	4	6	(	(	PUNCT
ahs-3127	4	7	gossypium	gossypium	NOUN
ahs-3127	4	8	hirsutum	hirsutum	PROPN
ahs-3127	4	9	l.	l.	PROPN
ahs-3127	4	10	)	)	PUNCT
ahs-3127	4	11	cultivars	cultivar	NOUN
ahs-3127	4	12	(	(	PUNCT
ahs-3127	4	13	aleppo	aleppo	PROPN
ahs-3127	4	14	118	118	NUM
ahs-3127	4	15	and	and	CCONJ
ahs-3127	4	16	deir	deir	PROPN
ahs-3127	4	17	al	al	PROPN
ahs-3127	4	18	-	-	PROPN
ahs-3127	4	19	zour	zour	NOUN
ahs-3127	4	20	22	22	NUM
ahs-3127	4	21	)	)	PUNCT
ahs-3127	4	22	have	have	AUX
ahs-3127	4	23	been	be	AUX
ahs-3127	4	24	investigated	investigate	VERB
ahs-3127	4	25	to	to	PART
ahs-3127	4	26	assess	assess	VERB
ahs-3127	4	27	physiological	physiological	ADJ
ahs-3127	4	28	,	,	PUNCT
ahs-3127	4	29	morphological	morphological	ADJ
ahs-3127	4	30	,	,	PUNCT
ahs-3127	4	31	and	and	CCONJ
ahs-3127	4	32	molecular	molecular	ADJ
ahs-3127	4	33	responses	response	NOUN
ahs-3127	4	34	under	under	ADP
ahs-3127	4	35	water	water	NOUN
ahs-3127	4	36	shortage	shortage	NOUN
ahs-3127	4	37	conditions	condition	NOUN
ahs-3127	4	38	.	.	PUNCT
ahs-3127	5	1	both	both	DET
ahs-3127	5	2	cultivars	cultivar	NOUN
ahs-3127	5	3	have	have	AUX
ahs-3127	5	4	shown	show	VERB
ahs-3127	5	5	early	early	ADJ
ahs-3127	5	6	flowering	flowering	NOUN
ahs-3127	5	7	.	.	PUNCT
ahs-3127	6	1	however	however	ADV
ahs-3127	6	2	,	,	PUNCT
ahs-3127	6	3	higher	high	ADJ
ahs-3127	6	4	percentage	percentage	NOUN
ahs-3127	6	5	of	of	ADP
ahs-3127	6	6	treated	treat	VERB
ahs-3127	6	7	‘	'	PUNCT
ahs-3127	6	8	aleppo	aleppo	PROPN
ahs-3127	6	9	118	118	NUM
ahs-3127	6	10	’	'	PUNCT
ahs-3127	6	11	plants	plant	NOUN
ahs-3127	6	12	kept	keep	VERB
ahs-3127	6	13	flowering	flower	VERB
ahs-3127	6	14	towards	towards	ADP
ahs-3127	6	15	the	the	DET
ahs-3127	6	16	end	end	NOUN
ahs-3127	6	17	of	of	ADP
ahs-3127	6	18	the	the	DET
ahs-3127	6	19	growing	grow	VERB
ahs-3127	6	20	season	season	NOUN
ahs-3127	6	21	compared	compare	VERB
ahs-3127	6	22	to	to	AUX
ahs-3127	6	23	treated	treat	VERB
ahs-3127	6	24	‘	'	PUNCT
ahs-3127	6	25	deir	deir	PROPN
ahs-3127	6	26	al	al	PROPN
ahs-3127	6	27	-	-	PROPN
ahs-3127	6	28	zour	zour	ADJ
ahs-3127	6	29	22	22	NUM
ahs-3127	6	30	’	'	PUNCT
ahs-3127	6	31	plants	plant	NOUN
ahs-3127	6	32	.	.	PUNCT
ahs-3127	7	1	both	both	DET
ahs-3127	7	2	cultivars	cultivar	NOUN
ahs-3127	7	3	kept	keep	VERB
ahs-3127	7	4	consistent	consistent	ADJ
ahs-3127	7	5	micronaire	micronaire	NOUN
ahs-3127	7	6	and	and	CCONJ
ahs-3127	7	7	cohesion	cohesion	NOUN
ahs-3127	7	8	under	under	ADP
ahs-3127	7	9	normal	normal	ADJ
ahs-3127	7	10	and	and	CCONJ
ahs-3127	7	11	water	water	NOUN
ahs-3127	7	12	shortage	shortage	NOUN
ahs-3127	7	13	conditions	condition	NOUN
ahs-3127	7	14	.	.	PUNCT
ahs-3127	8	1	the	the	DET
ahs-3127	8	2	cultivar	cultivar	NOUN
ahs-3127	8	3	aleppo	aleppo	PROPN
ahs-3127	8	4	118	118	NUM
ahs-3127	8	5	displayed	display	VERB
ahs-3127	8	6	more	more	ADV
ahs-3127	8	7	consistent	consistent	ADJ
ahs-3127	8	8	fiber	fiber	NOUN
ahs-3127	8	9	quality	quality	NOUN
ahs-3127	8	10	between	between	ADP
ahs-3127	8	11	control	control	NOUN
ahs-3127	8	12	and	and	CCONJ
ahs-3127	8	13	treated	treat	VERB
ahs-3127	8	14	plants	plant	NOUN
ahs-3127	8	15	,	,	PUNCT
ahs-3127	8	16	while	while	SCONJ
ahs-3127	8	17	‘	'	PUNCT
ahs-3127	8	18	deir	deir	PROPN
ahs-3127	8	19	al	al	PROPN
ahs-3127	8	20	-	-	PROPN
ahs-3127	8	21	zour	zour	NOUN
ahs-3127	8	22	22	22	NUM
ahs-3127	8	23	’	'	PUNCT
ahs-3127	8	24	showed	show	VERB
ahs-3127	8	25	variation	variation	NOUN
ahs-3127	8	26	in	in	ADP
ahs-3127	8	27	fiber	fiber	NOUN
ahs-3127	8	28	length	length	NOUN
ahs-3127	8	29	and	and	CCONJ
ahs-3127	8	30	strength	strength	NOUN
ahs-3127	8	31	between	between	ADP
ahs-3127	8	32	control	control	NOUN
ahs-3127	8	33	and	and	CCONJ
ahs-3127	8	34	treated	treat	VERB
ahs-3127	8	35	plants	plant	NOUN
ahs-3127	8	36	.	.	PUNCT
ahs-3127	9	1	results	result	NOUN
ahs-3127	9	2	have	have	AUX
ahs-3127	9	3	demonstrated	demonstrate	VERB
ahs-3127	9	4	an	an	DET
ahs-3127	9	5	increase	increase	NOUN
ahs-3127	9	6	in	in	ADP
ahs-3127	9	7	fold	fold	ADJ
ahs-3127	9	8	expression	expression	NOUN
ahs-3127	9	9	of	of	ADP
ahs-3127	9	10	dreb1a	dreb1a	NOUN
ahs-3127	9	11	,	,	PUNCT
ahs-3127	9	12	tps	tps	NOUN
ahs-3127	9	13	and	and	CCONJ
ahs-3127	9	14	hspcb	hspcb	NOUN
ahs-3127	9	15	genes	gene	NOUN
ahs-3127	9	16	in	in	ADP
ahs-3127	9	17	the	the	DET
ahs-3127	9	18	flowering	flower	VERB
ahs-3127	9	19	stage	stage	NOUN
ahs-3127	9	20	of	of	ADP
ahs-3127	9	21	treated	treat	VERB
ahs-3127	9	22	plants	plant	NOUN
ahs-3127	9	23	compared	compare	VERB
ahs-3127	9	24	to	to	ADP
ahs-3127	9	25	the	the	DET
ahs-3127	9	26	controls	control	NOUN
ahs-3127	9	27	.	.	PUNCT
ahs-3127	10	1	results	result	NOUN
ahs-3127	10	2	also	also	ADV
ahs-3127	10	3	showed	show	VERB
ahs-3127	10	4	a	a	DET
ahs-3127	10	5	continuous	continuous	ADJ
ahs-3127	10	6	activation	activation	NOUN
ahs-3127	10	7	of	of	ADP
ahs-3127	10	8	dreb1a	dreb1a	ADJ
ahs-3127	10	9	gene	gene	NOUN
ahs-3127	10	10	in	in	ADP
ahs-3127	10	11	the	the	DET
ahs-3127	10	12	two	two	NUM
ahs-3127	10	13	critical	critical	ADJ
ahs-3127	10	14	growing	grow	VERB
ahs-3127	10	15	stages	stage	NOUN
ahs-3127	10	16	of	of	ADP
ahs-3127	10	17	a	a	DET
ahs-3127	10	18	cotton	cotton	NOUN
ahs-3127	10	19	life	life	NOUN
ahs-3127	10	20	cycle	cycle	NOUN
ahs-3127	10	21	,	,	PUNCT
ahs-3127	10	22	flowering	flowering	NOUN
ahs-3127	10	23	and	and	CCONJ
ahs-3127	10	24	boll	boll	NOUN
ahs-3127	10	25	development	development	NOUN
ahs-3127	10	26	in	in	ADP
ahs-3127	10	27	treated	treat	VERB
ahs-3127	10	28	plants	plant	NOUN
ahs-3127	10	29	of	of	ADP
ahs-3127	10	30	‘	'	PUNCT
ahs-3127	10	31	deir	deir	PROPN
ahs-3127	10	32	al	al	PROPN
ahs-3127	10	33	-	-	PROPN
ahs-3127	10	34	zour	zour	NOUN
ahs-3127	10	35	22	22	NUM
ahs-3127	10	36	’	'	PUNCT
ahs-3127	10	37	.	.	PUNCT
ahs-3127	11	1	this	this	DET
ahs-3127	11	2	work	work	NOUN
ahs-3127	11	3	illustrates	illustrate	VERB
ahs-3127	11	4	the	the	DET
ahs-3127	11	5	different	different	ADJ
ahs-3127	11	6	responses	response	NOUN
ahs-3127	11	7	of	of	ADP
ahs-3127	11	8	two	two	NUM
ahs-3127	11	9	cotton	cotton	NOUN
ahs-3127	11	10	cultivars	cultivar	NOUN
ahs-3127	11	11	under	under	ADP
ahs-3127	11	12	water	water	NOUN
ahs-3127	11	13	shortage	shortage	NOUN
ahs-3127	11	14	stress	stress	NOUN
ahs-3127	11	15	and	and	CCONJ
ahs-3127	11	16	its	its	PRON
ahs-3127	11	17	impact	impact	NOUN
ahs-3127	11	18	on	on	ADP
ahs-3127	11	19	flowering	flowering	NOUN
ahs-3127	11	20	and	and	CCONJ
ahs-3127	11	21	fiber	fiber	NOUN
ahs-3127	11	22	traits	trait	NOUN
ahs-3127	11	23	.	.	PUNCT
ahs-3127	12	1	1	1	X
ahs-3127	12	2	.	.	X
ahs-3127	12	3	introduction	introduction	NOUN
ahs-3127	12	4	the	the	DET
ahs-3127	12	5	supply	supply	NOUN
ahs-3127	12	6	of	of	ADP
ahs-3127	12	7	groundwater	groundwater	NOUN
ahs-3127	12	8	in	in	ADP
ahs-3127	12	9	agriculture	agriculture	NOUN
ahs-3127	12	10	is	be	AUX
ahs-3127	12	11	reduced	reduce	VERB
ahs-3127	12	12	due	due	ADJ
ahs-3127	12	13	to	to	ADP
ahs-3127	12	14	intersecting	intersect	VERB
ahs-3127	12	15	environmental	environmental	ADJ
ahs-3127	12	16	,	,	PUNCT
ahs-3127	12	17	industrial	industrial	ADJ
ahs-3127	12	18	and	and	CCONJ
ahs-3127	12	19	domestic	domestic	ADJ
ahs-3127	12	20	sectors	sector	NOUN
ahs-3127	12	21	.	.	PUNCT
ahs-3127	13	1	groundwater	groundwater	NOUN
ahs-3127	13	2	-	-	PUNCT
ahs-3127	13	3	dependent	dependent	ADJ
ahs-3127	13	4	agro	agro	NOUN
ahs-3127	13	5	-	-	PUNCT
ahs-3127	13	6	economies	economy	NOUN
ahs-3127	13	7	are	be	AUX
ahs-3127	13	8	mostly	mostly	ADV
ahs-3127	13	9	affected	affect	VERB
ahs-3127	13	10	by	by	ADP
ahs-3127	13	11	drought	drought	NOUN
ahs-3127	13	12	stress	stress	NOUN
ahs-3127	13	13	,	,	PUNCT
ahs-3127	13	14	water	water	NOUN
ahs-3127	13	15	deficits	deficit	NOUN
ahs-3127	13	16	and	and	CCONJ
ahs-3127	13	17	aquifer	aquifer	NOUN
ahs-3127	13	18	depletion	depletion	NOUN
ahs-3127	13	19	,	,	PUNCT
ahs-3127	13	20	specifically	specifically	ADV
ahs-3127	13	21	in	in	ADP
ahs-3127	13	22	the	the	DET
ahs-3127	13	23	arid	arid	NOUN
ahs-3127	13	24	and	and	CCONJ
ahs-3127	13	25	semi	semi	ADJ
ahs-3127	13	26	-	-	ADJ
ahs-3127	13	27	arid	arid	ADJ
ahs-3127	13	28	regions	region	NOUN
ahs-3127	13	29	.	.	PUNCT
ahs-3127	14	1	drought	drought	NOUN
ahs-3127	14	2	is	be	AUX
ahs-3127	14	3	considered	consider	VERB
ahs-3127	14	4	a	a	DET
ahs-3127	14	5	major	major	ADJ
ahs-3127	14	6	constraint	constraint	NOUN
ahs-3127	14	7	to	to	ADP
ahs-3127	14	8	crop	crop	NOUN
ahs-3127	14	9	productivity	productivity	NOUN
ahs-3127	14	10	and	and	CCONJ
ahs-3127	14	11	yield	yield	VERB
ahs-3127	14	12	stability	stability	NOUN
ahs-3127	14	13	around	around	ADP
ahs-3127	14	14	the	the	DET
ahs-3127	14	15	world	world	NOUN
ahs-3127	14	16	.	.	PUNCT
ahs-3127	15	1	it	it	PRON
ahs-3127	15	2	is	be	AUX
ahs-3127	15	3	therefore	therefore	ADV
ahs-3127	15	4	,	,	PUNCT
ahs-3127	15	5	a	a	DET
ahs-3127	15	6	major	major	ADJ
ahs-3127	15	7	challenge	challenge	NOUN
ahs-3127	15	8	to	to	ADP
ahs-3127	15	9	farmers	farmer	NOUN
ahs-3127	15	10	in	in	ADP
ahs-3127	15	11	drought	drought	NOUN
ahs-3127	15	12	subjected	subject	VERB
ahs-3127	15	13	regions	region	NOUN
ahs-3127	15	14	.	.	PUNCT
ahs-3127	16	1	water	water	NOUN
ahs-3127	16	2	saving	saving	NOUN
ahs-3127	16	3	and	and	CCONJ
ahs-3127	16	4	stable	stable	ADJ
ahs-3127	16	5	crop	crop	NOUN
ahs-3127	16	6	production	production	NOUN
ahs-3127	16	7	are	be	AUX
ahs-3127	16	8	the	the	DET
ahs-3127	16	9	main	main	ADJ
ahs-3127	16	10	challenges	challenge	NOUN
ahs-3127	16	11	that	that	PRON
ahs-3127	16	12	urge	urge	VERB
ahs-3127	16	13	researchers	researcher	NOUN
ahs-3127	16	14	to	to	PART
ahs-3127	16	15	develop	develop	VERB
ahs-3127	16	16	new	new	ADJ
ahs-3127	16	17	cultivars	cultivar	NOUN
ahs-3127	16	18	and	and	CCONJ
ahs-3127	16	19	irrigation	irrigation	NOUN
ahs-3127	16	20	strategies	strategy	NOUN
ahs-3127	16	21	for	for	ADP
ahs-3127	16	22	a	a	DET
ahs-3127	16	23	sustainable	sustainable	ADJ
ahs-3127	16	24	use	use	NOUN
ahs-3127	16	25	of	of	ADP
ahs-3127	16	26	water	water	NOUN
ahs-3127	16	27	in	in	ADP
ahs-3127	16	28	agriculture	agriculture	NOUN
ahs-3127	16	29	.	.	PUNCT
ahs-3127	17	1	developing	develop	VERB
ahs-3127	17	2	new	new	ADJ
ahs-3127	17	3	cultivars	cultivar	NOUN
ahs-3127	17	4	that	that	PRON
ahs-3127	17	5	tolerate	tolerate	VERB
ahs-3127	17	6	water	water	NOUN
ahs-3127	17	7	stress	stress	NOUN
ahs-3127	17	8	has	have	AUX
ahs-3127	17	9	been	be	AUX
ahs-3127	17	10	assisted	assist	VERB
ahs-3127	17	11	(	(	PUNCT
ahs-3127	17	12	*	*	NOUN
ahs-3127	17	13	)	)	PUNCT
ahs-3127	17	14	corresponding	corresponding	ADJ
ahs-3127	17	15	author	author	NOUN
ahs-3127	17	16	:	:	PUNCT
ahs-3127	17	17	ascientific2@aec.org.sy	ascientific2@aec.org.sy	X
ahs-3127	17	18	citation	citation	NOUN
ahs-3127	17	19	:	:	PUNCT
ahs-3127	17	20	jawdat	jawdat	PROPN
ahs-3127	17	21	d.	d.	PROPN
ahs-3127	17	22	,	,	PUNCT
ahs-3127	17	23	allaf	allaf	PROPN
ahs-3127	17	24	a.w	a.w	PROPN
ahs-3127	17	25	.	.	PROPN
ahs-3127	17	26	,	,	PUNCT
ahs-3127	17	27	taher	taher	PROPN
ahs-3127	17	28	n.	n.	PROPN
ahs-3127	17	29	,	,	PUNCT
ahs-3127	17	30	al	al	PROPN
ahs-3127	17	31	-	-	PUNCT
ahs-3127	17	32	zier	zier	NOUN
ahs-3127	17	33	a.	a.	NOUN
ahs-3127	17	34	,	,	PUNCT
ahs-3127	17	35	morsel	morsel	ADJ
ahs-3127	17	36	n.	n.	NOUN
ahs-3127	17	37	,	,	PUNCT
ahs-3127	17	38	ajii	ajii	PROPN
ahs-3127	17	39	z.	z.	PROPN
ahs-3127	17	40	,	,	PUNCT
ahs-3127	17	41	al	al	PROPN
ahs-3127	17	42	-	-	PUNCT
ahs-3127	17	43	safadi	safadi	PROPN
ahs-3127	17	44	b.	b.	PROPN
ahs-3127	17	45	,	,	PUNCT
ahs-3127	17	46	2018	2018	NUM
ahs-3127	17	47	cotton	cotton	NOUN
ahs-3127	17	48	flowering	flower	VERB
ahs-3127	17	49	behavior	behavior	NOUN
ahs-3127	17	50	,	,	PUNCT
ahs-3127	17	51	fiber	fiber	NOUN
ahs-3127	17	52	traits	trait	NOUN
ahs-3127	17	53	and	and	CCONJ
ahs-3127	17	54	gene	gene	NOUN
ahs-3127	17	55	expression	expression	NOUN
ahs-3127	17	56	under	under	ADP
ahs-3127	17	57	water	water	NOUN
ahs-3127	17	58	-	-	PUNCT
ahs-3127	17	59	shortage	shortage	NOUN
ahs-3127	17	60	stress	stress	NOUN
ahs-3127	17	61	.	.	PUNCT
ahs-3127	18	1	adv	adv	PROPN
ahs-3127	18	2	.	.	PUNCT
ahs-3127	19	1	hort	hort	PROPN
ahs-3127	19	2	.	.	PUNCT
ahs-3127	20	1	sci	sci	PROPN
ahs-3127	20	2	.	.	PROPN
ahs-3127	20	3	,	,	PUNCT
ahs-3127	20	4	32(1	32(1	NUM
ahs-3127	20	5	):	):	PUNCT
ahs-3127	20	6	79	79	NUM
ahs-3127	20	7	-	-	SYM
ahs-3127	20	8	92	92	NUM
ahs-3127	20	9	copyright	copyright	NOUN
ahs-3127	20	10	:	:	PUNCT
ahs-3127	20	11	©	©	PROPN
ahs-3127	20	12	2018	2018	NUM
ahs-3127	20	13	jawdat	jawdat	NOUN
ahs-3127	20	14	d.	d.	PROPN
ahs-3127	20	15	,	,	PUNCT
ahs-3127	20	16	allaf	allaf	PROPN
ahs-3127	20	17	a.w	a.w	PROPN
ahs-3127	20	18	.	.	PROPN
ahs-3127	20	19	,	,	PUNCT
ahs-3127	20	20	taher	taher	PROPN
ahs-3127	20	21	n.	n.	PROPN
ahs-3127	20	22	,	,	PUNCT
ahs-3127	20	23	al	al	PROPN
ahs-3127	20	24	-	-	PUNCT
ahs-3127	20	25	zier	zier	NOUN
ahs-3127	20	26	a.	a.	NOUN
ahs-3127	20	27	,	,	PUNCT
ahs-3127	20	28	morsel	morsel	ADJ
ahs-3127	20	29	n.	n.	NOUN
ahs-3127	20	30	,	,	PUNCT
ahs-3127	20	31	ajii	ajii	PROPN
ahs-3127	20	32	z.	z.	PROPN
ahs-3127	20	33	,	,	PUNCT
ahs-3127	20	34	al	al	PROPN
ahs-3127	20	35	-	-	PUNCT
ahs-3127	20	36	safadi	safadi	PROPN
ahs-3127	20	37	b.	b.	PROPN
ahs-3127	20	38	this	this	PRON
ahs-3127	20	39	is	be	AUX
ahs-3127	20	40	an	an	DET
ahs-3127	20	41	open	open	ADJ
ahs-3127	20	42	access	access	NOUN
ahs-3127	20	43	,	,	PUNCT
ahs-3127	20	44	peer	peer	NOUN
ahs-3127	20	45	reviewed	review	VERB
ahs-3127	20	46	article	article	NOUN
ahs-3127	20	47	published	publish	VERB
ahs-3127	20	48	by	by	ADP
ahs-3127	20	49	firenze	firenze	PROPN
ahs-3127	20	50	university	university	PROPN
ahs-3127	20	51	press	press	NOUN
ahs-3127	20	52	(	(	PUNCT
ahs-3127	20	53	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-3127	20	54	)	)	PUNCT
ahs-3127	20	55	and	and	CCONJ
ahs-3127	20	56	distribuited	distribuite	VERB
ahs-3127	20	57	under	under	ADP
ahs-3127	20	58	the	the	DET
ahs-3127	20	59	terms	term	NOUN
ahs-3127	20	60	of	of	ADP
ahs-3127	20	61	the	the	DET
ahs-3127	20	62	creative	creative	ADJ
ahs-3127	20	63	commons	common	NOUN
ahs-3127	20	64	attribution	attribution	NOUN
ahs-3127	20	65	license	license	NOUN
ahs-3127	20	66	,	,	PUNCT
ahs-3127	20	67	which	which	PRON
ahs-3127	20	68	permits	permit	VERB
ahs-3127	20	69	unrestricted	unrestricted	ADJ
ahs-3127	20	70	use	use	NOUN
ahs-3127	20	71	,	,	PUNCT
ahs-3127	20	72	distribution	distribution	NOUN
ahs-3127	20	73	,	,	PUNCT
ahs-3127	20	74	and	and	CCONJ
ahs-3127	20	75	reproduction	reproduction	NOUN
ahs-3127	20	76	in	in	ADP
ahs-3127	20	77	any	any	DET
ahs-3127	20	78	medium	medium	NOUN
ahs-3127	20	79	,	,	PUNCT
ahs-3127	20	80	provided	provide	VERB
ahs-3127	20	81	the	the	DET
ahs-3127	20	82	original	original	ADJ
ahs-3127	20	83	author	author	NOUN
ahs-3127	20	84	and	and	CCONJ
ahs-3127	20	85	source	source	NOUN
ahs-3127	20	86	are	be	AUX
ahs-3127	20	87	credited	credit	VERB
ahs-3127	20	88	.	.	PUNCT
ahs-3127	21	1	data	datum	NOUN
ahs-3127	21	2	availability	availability	NOUN
ahs-3127	21	3	statement	statement	NOUN
ahs-3127	21	4	:	:	PUNCT
ahs-3127	21	5	all	all	DET
ahs-3127	21	6	relevant	relevant	ADJ
ahs-3127	21	7	data	datum	NOUN
ahs-3127	21	8	are	be	AUX
ahs-3127	21	9	within	within	ADP
ahs-3127	21	10	the	the	DET
ahs-3127	21	11	paper	paper	NOUN
ahs-3127	21	12	and	and	CCONJ
ahs-3127	21	13	its	its	PRON
ahs-3127	21	14	supporting	support	VERB
ahs-3127	21	15	information	information	NOUN
ahs-3127	21	16	files	file	NOUN
ahs-3127	21	17	.	.	PUNCT
ahs-3127	22	1	competing	compete	VERB
ahs-3127	22	2	interests	interest	NOUN
ahs-3127	22	3	:	:	PUNCT
ahs-3127	22	4	the	the	DET
ahs-3127	22	5	authors	author	NOUN
ahs-3127	22	6	declare	declare	VERB
ahs-3127	22	7	no	no	DET
ahs-3127	22	8	competing	compete	VERB
ahs-3127	22	9	interests	interest	NOUN
ahs-3127	22	10	.	.	PUNCT
ahs-3127	23	1	received	receive	VERB
ahs-3127	23	2	for	for	ADP
ahs-3127	23	3	publication	publication	NOUN
ahs-3127	23	4	10	10	NUM
ahs-3127	23	5	may	may	AUX
ahs-3127	23	6	2017	2017	NUM
ahs-3127	23	7	accepted	accept	VERB
ahs-3127	23	8	for	for	ADP
ahs-3127	23	9	publication	publication	NOUN
ahs-3127	23	10	12	12	NUM
ahs-3127	23	11	january	january	PROPN
ahs-3127	23	12	2018	2018	NUM
ahs-3127	23	13	ahs	ahs	NOUN
ahs-3127	23	14	advances	advance	NOUN
ahs-3127	23	15	in	in	ADP
ahs-3127	23	16	horticultural	horticultural	ADJ
ahs-3127	23	17	science	science	PROPN
ahs-3127	23	18	adv	adv	PROPN
ahs-3127	23	19	.	.	PUNCT
ahs-3127	23	20	hort	hort	PROPN
ahs-3127	23	21	.	.	PUNCT
ahs-3127	24	1	sci	sci	PROPN
ahs-3127	24	2	.	.	PROPN
ahs-3127	24	3	,	,	PUNCT
ahs-3127	24	4	2018	2018	NUM
ahs-3127	24	5	32(1	32(1	NUM
ahs-3127	24	6	):	):	PUNCT
ahs-3127	24	7	79	79	NUM
ahs-3127	24	8	-	-	SYM
ahs-3127	24	9	92	92	NUM
ahs-3127	24	10	80	80	NUM
ahs-3127	24	11	and	and	CCONJ
ahs-3127	24	12	supported	support	VERB
ahs-3127	24	13	by	by	ADP
ahs-3127	24	14	wide	wide	ADJ
ahs-3127	24	15	range	range	NOUN
ahs-3127	24	16	of	of	ADP
ahs-3127	24	17	strategies	strategy	NOUN
ahs-3127	24	18	and	and	CCONJ
ahs-3127	24	19	procedures	procedure	NOUN
ahs-3127	24	20	that	that	PRON
ahs-3127	24	21	enable	enable	VERB
ahs-3127	24	22	the	the	DET
ahs-3127	24	23	selection	selection	NOUN
ahs-3127	24	24	of	of	ADP
ahs-3127	24	25	candidate	candidate	NOUN
ahs-3127	24	26	parents	parent	NOUN
ahs-3127	24	27	and	and	CCONJ
ahs-3127	24	28	an	an	DET
ahs-3127	24	29	efficient	efficient	ADJ
ahs-3127	24	30	screening	screening	NOUN
ahs-3127	24	31	of	of	ADP
ahs-3127	24	32	targeted	target	VERB
ahs-3127	24	33	progenies	progeny	NOUN
ahs-3127	24	34	.	.	PUNCT
ahs-3127	25	1	genomics	genomic	NOUN
ahs-3127	25	2	,	,	PUNCT
ahs-3127	25	3	marker	marker	NOUN
ahs-3127	25	4	-	-	PUNCT
ahs-3127	25	5	assisted	assist	VERB
ahs-3127	25	6	selection	selection	NOUN
ahs-3127	25	7	,	,	PUNCT
ahs-3127	25	8	the	the	DET
ahs-3127	25	9	manipulation	manipulation	NOUN
ahs-3127	25	10	of	of	ADP
ahs-3127	25	11	qtls	qtls	NOUN
ahs-3127	25	12	using	use	VERB
ahs-3127	25	13	genetic	genetic	ADJ
ahs-3127	25	14	engineering	engineering	NOUN
ahs-3127	25	15	and	and	CCONJ
ahs-3127	25	16	transcriptomics	transcriptomic	NOUN
ahs-3127	25	17	can	can	AUX
ahs-3127	25	18	contribute	contribute	VERB
ahs-3127	25	19	in	in	ADP
ahs-3127	25	20	the	the	DET
ahs-3127	25	21	release	release	NOUN
ahs-3127	25	22	of	of	ADP
ahs-3127	25	23	improved	improve	VERB
ahs-3127	25	24	,	,	PUNCT
ahs-3127	25	25	drought	drought	NOUN
ahs-3127	25	26	-	-	PUNCT
ahs-3127	25	27	tolerant	tolerant	ADJ
ahs-3127	25	28	cultivars	cultivar	NOUN
ahs-3127	25	29	(	(	PUNCT
ahs-3127	25	30	tuberosa	tuberosa	NOUN
ahs-3127	25	31	and	and	CCONJ
ahs-3127	25	32	salvi	salvi	PROPN
ahs-3127	25	33	,	,	PUNCT
ahs-3127	25	34	2006	2006	NUM
ahs-3127	25	35	)	)	PUNCT
ahs-3127	25	36	.	.	PUNCT
ahs-3127	26	1	the	the	DET
ahs-3127	26	2	metabolomics	metabolomic	NOUN
ahs-3127	26	3	-	-	PUNCT
ahs-3127	26	4	assisted	assist	VERB
ahs-3127	26	5	breeding	breeding	NOUN
ahs-3127	26	6	is	be	AUX
ahs-3127	26	7	another	another	DET
ahs-3127	26	8	candidate	candidate	NOUN
ahs-3127	26	9	approach	approach	NOUN
ahs-3127	26	10	for	for	ADP
ahs-3127	26	11	the	the	DET
ahs-3127	26	12	development	development	NOUN
ahs-3127	26	13	of	of	ADP
ahs-3127	26	14	crops	crop	NOUN
ahs-3127	26	15	with	with	ADP
ahs-3127	26	16	increased	increase	VERB
ahs-3127	26	17	tolerance	tolerance	NOUN
ahs-3127	26	18	to	to	ADP
ahs-3127	26	19	abiotic	abiotic	ADJ
ahs-3127	26	20	stresses	stress	NOUN
ahs-3127	26	21	(	(	PUNCT
ahs-3127	26	22	fernie	fernie	PROPN
ahs-3127	26	23	and	and	CCONJ
ahs-3127	26	24	schauer	schauer	NOUN
ahs-3127	26	25	,	,	PUNCT
ahs-3127	26	26	2009	2009	NUM
ahs-3127	26	27	)	)	PUNCT
ahs-3127	26	28	.	.	PUNCT
ahs-3127	27	1	improving	improve	VERB
ahs-3127	27	2	drought	drought	NOUN
ahs-3127	27	3	tolerance	tolerance	NOUN
ahs-3127	27	4	in	in	ADP
ahs-3127	27	5	crops	crop	NOUN
ahs-3127	27	6	requires	require	VERB
ahs-3127	27	7	understanding	understand	VERB
ahs-3127	27	8	the	the	DET
ahs-3127	27	9	biochemical	biochemical	ADJ
ahs-3127	27	10	responses	response	NOUN
ahs-3127	27	11	under	under	ADP
ahs-3127	27	12	water	water	NOUN
ahs-3127	27	13	deficit	deficit	NOUN
ahs-3127	27	14	(	(	PUNCT
ahs-3127	27	15	reddy	reddy	PROPN
ahs-3127	27	16	et	et	PROPN
ahs-3127	27	17	al	al	PROPN
ahs-3127	27	18	.	.	PROPN
ahs-3127	27	19	,	,	PUNCT
ahs-3127	27	20	2004	2004	NUM
ahs-3127	27	21	)	)	PUNCT
ahs-3127	27	22	and	and	CCONJ
ahs-3127	27	23	the	the	DET
ahs-3127	27	24	characterization	characterization	NOUN
ahs-3127	27	25	of	of	ADP
ahs-3127	27	26	drought	drought	NOUN
ahs-3127	27	27	patterns	pattern	NOUN
ahs-3127	27	28	in	in	ADP
ahs-3127	27	29	the	the	DET
ahs-3127	27	30	growing	grow	VERB
ahs-3127	27	31	regions	region	NOUN
ahs-3127	27	32	along	along	ADP
ahs-3127	27	33	with	with	ADP
ahs-3127	27	34	the	the	DET
ahs-3127	27	35	physio	physio	ADJ
ahs-3127	27	36	-	-	PUNCT
ahs-3127	27	37	morphological	morphological	ADJ
ahs-3127	27	38	traits	trait	NOUN
ahs-3127	27	39	of	of	ADP
ahs-3127	27	40	these	these	DET
ahs-3127	27	41	crops	crop	NOUN
ahs-3127	27	42	under	under	ADP
ahs-3127	27	43	such	such	ADJ
ahs-3127	27	44	environments	environment	NOUN
ahs-3127	27	45	(	(	PUNCT
ahs-3127	27	46	fukai	fukai	NOUN
ahs-3127	27	47	and	and	CCONJ
ahs-3127	27	48	cooper	cooper	NOUN
ahs-3127	27	49	,	,	PUNCT
ahs-3127	27	50	1995	1995	NUM
ahs-3127	27	51	;	;	PUNCT
ahs-3127	27	52	khan	khan	PROPN
ahs-3127	27	53	et	et	PROPN
ahs-3127	27	54	al	al	PROPN
ahs-3127	27	55	.	.	PROPN
ahs-3127	27	56	,	,	PUNCT
ahs-3127	27	57	2010	2010	NUM
ahs-3127	27	58	)	)	PUNCT
ahs-3127	27	59	.	.	PUNCT
ahs-3127	28	1	plants	plant	NOUN
ahs-3127	28	2	have	have	AUX
ahs-3127	28	3	evolved	evolve	VERB
ahs-3127	28	4	their	their	PRON
ahs-3127	28	5	drought	drought	NOUN
ahs-3127	28	6	-	-	PUNCT
ahs-3127	28	7	adaptive	adaptive	ADJ
ahs-3127	28	8	strategies	strategy	NOUN
ahs-3127	28	9	(	(	PUNCT
ahs-3127	28	10	meyre	meyre	NOUN
ahs-3127	28	11	et	et	NOUN
ahs-3127	28	12	al	al	PROPN
ahs-3127	28	13	.	.	PROPN
ahs-3127	28	14	,	,	PUNCT
ahs-3127	28	15	2001	2001	NUM
ahs-3127	28	16	)	)	PUNCT
ahs-3127	28	17	,	,	PUNCT
ahs-3127	28	18	between	between	ADP
ahs-3127	28	19	drought	drought	NOUN
ahs-3127	28	20	escape	escape	NOUN
ahs-3127	28	21	(	(	PUNCT
ahs-3127	28	22	early	early	ADJ
ahs-3127	28	23	flowering	flowering	NOUN
ahs-3127	28	24	)	)	PUNCT
ahs-3127	28	25	and	and	CCONJ
ahs-3127	28	26	drought	drought	NOUN
ahs-3127	28	27	tolerance	tolerance	NOUN
ahs-3127	28	28	.	.	PUNCT
ahs-3127	29	1	comprehending	comprehend	VERB
ahs-3127	29	2	the	the	DET
ahs-3127	29	3	flowering	flowering	NOUN
ahs-3127	29	4	pattern	pattern	NOUN
ahs-3127	29	5	of	of	ADP
ahs-3127	29	6	each	each	DET
ahs-3127	29	7	crop	crop	NOUN
ahs-3127	29	8	under	under	ADP
ahs-3127	29	9	stressed	stressed	ADJ
ahs-3127	29	10	and	and	CCONJ
ahs-3127	29	11	non	non	ADJ
ahs-3127	29	12	-	-	ADJ
ahs-3127	29	13	stressed	stressed	ADJ
ahs-3127	29	14	environments	environment	NOUN
ahs-3127	29	15	is	be	AUX
ahs-3127	29	16	a	a	DET
ahs-3127	29	17	key	key	NOUN
ahs-3127	29	18	to	to	PART
ahs-3127	29	19	which	which	PRON
ahs-3127	29	20	drought	drought	NOUN
ahs-3127	29	21	-	-	PUNCT
ahs-3127	29	22	adaptive	adaptive	ADJ
ahs-3127	29	23	strategy	strategy	NOUN
ahs-3127	29	24	the	the	DET
ahs-3127	29	25	crop	crop	NOUN
ahs-3127	29	26	plant	plant	NOUN
ahs-3127	29	27	follows	follow	VERB
ahs-3127	29	28	.	.	PUNCT
ahs-3127	30	1	early	early	ADJ
ahs-3127	30	2	flowering	flowering	NOUN
ahs-3127	30	3	and	and	CCONJ
ahs-3127	30	4	maturity	maturity	NOUN
ahs-3127	30	5	can	can	AUX
ahs-3127	30	6	help	help	VERB
ahs-3127	30	7	in	in	ADP
ahs-3127	30	8	saving	save	VERB
ahs-3127	30	9	groundwater	groundwater	NOUN
ahs-3127	30	10	for	for	ADP
ahs-3127	30	11	irrigation	irrigation	NOUN
ahs-3127	30	12	and	and	CCONJ
ahs-3127	30	13	can	can	AUX
ahs-3127	30	14	help	help	VERB
ahs-3127	30	15	in	in	ADP
ahs-3127	30	16	avoiding	avoid	VERB
ahs-3127	30	17	early	early	ADJ
ahs-3127	30	18	rainfall	rainfall	NOUN
ahs-3127	30	19	that	that	PRON
ahs-3127	30	20	usually	usually	ADV
ahs-3127	30	21	affects	affect	VERB
ahs-3127	30	22	the	the	DET
ahs-3127	30	23	harvest	harvest	NOUN
ahs-3127	30	24	of	of	ADP
ahs-3127	30	25	certain	certain	ADJ
ahs-3127	30	26	crops	crop	NOUN
ahs-3127	30	27	such	such	ADJ
ahs-3127	30	28	as	as	ADP
ahs-3127	30	29	cotton	cotton	NOUN
ahs-3127	30	30	(	(	PUNCT
ahs-3127	30	31	jawdat	jawdat	NOUN
ahs-3127	30	32	et	et	PROPN
ahs-3127	30	33	al	al	PROPN
ahs-3127	30	34	.	.	PROPN
ahs-3127	30	35	,	,	PUNCT
ahs-3127	30	36	2012	2012	NUM
ahs-3127	30	37	)	)	PUNCT
ahs-3127	30	38	.	.	PUNCT
ahs-3127	31	1	therefore	therefore	ADV
ahs-3127	31	2	,	,	PUNCT
ahs-3127	31	3	a	a	DET
ahs-3127	31	4	vigilant	vigilant	ADJ
ahs-3127	31	5	assessment	assessment	NOUN
ahs-3127	31	6	of	of	ADP
ahs-3127	31	7	crop	crop	NOUN
ahs-3127	31	8	responses	response	NOUN
ahs-3127	31	9	to	to	PART
ahs-3127	31	10	alteration	alteration	NOUN
ahs-3127	31	11	in	in	ADP
ahs-3127	31	12	irrigation	irrigation	NOUN
ahs-3127	31	13	regimes	regime	NOUN
ahs-3127	31	14	is	be	AUX
ahs-3127	31	15	needed	need	VERB
ahs-3127	31	16	.	.	PUNCT
ahs-3127	32	1	at	at	ADP
ahs-3127	32	2	any	any	DET
ahs-3127	32	3	rate	rate	NOUN
ahs-3127	32	4	,	,	PUNCT
ahs-3127	32	5	amendments	amendment	NOUN
ahs-3127	32	6	and	and	CCONJ
ahs-3127	32	7	management	management	NOUN
ahs-3127	32	8	of	of	ADP
ahs-3127	32	9	irrigation	irrigation	NOUN
ahs-3127	32	10	and	and	CCONJ
ahs-3127	32	11	water	water	NOUN
ahs-3127	32	12	saving	saving	NOUN
ahs-3127	32	13	methods	method	NOUN
ahs-3127	32	14	has	have	VERB
ahs-3127	32	15	a	a	DET
ahs-3127	32	16	great	great	ADJ
ahs-3127	32	17	potential	potential	NOUN
ahs-3127	32	18	in	in	ADP
ahs-3127	32	19	saving	save	VERB
ahs-3127	32	20	water	water	NOUN
ahs-3127	32	21	sources	source	NOUN
ahs-3127	32	22	in	in	ADP
ahs-3127	32	23	the	the	DET
ahs-3127	32	24	arid	arid	NOUN
ahs-3127	32	25	and	and	CCONJ
ahs-3127	32	26	semi	semi	ADJ
ahs-3127	32	27	-	-	ADJ
ahs-3127	32	28	arid	arid	ADJ
ahs-3127	32	29	regions	region	NOUN
ahs-3127	32	30	(	(	PUNCT
ahs-3127	32	31	oweis	oweis	NOUN
ahs-3127	32	32	et	et	PROPN
ahs-3127	32	33	al	al	PROPN
ahs-3127	32	34	.	.	PROPN
ahs-3127	32	35	,	,	PUNCT
ahs-3127	32	36	2011	2011	NUM
ahs-3127	32	37	;	;	PUNCT
ahs-3127	32	38	ünlü	ünlü	NOUN
ahs-3127	32	39	et	et	PROPN
ahs-3127	32	40	al	al	PROPN
ahs-3127	32	41	.	.	PROPN
ahs-3127	32	42	,	,	PUNCT
ahs-3127	32	43	2011	2011	NUM
ahs-3127	32	44	)	)	PUNCT
ahs-3127	32	45	.	.	PUNCT
ahs-3127	33	1	cotton	cotton	NOUN
ahs-3127	33	2	is	be	AUX
ahs-3127	33	3	a	a	DET
ahs-3127	33	4	major	major	ADJ
ahs-3127	33	5	cash	cash	NOUN
ahs-3127	33	6	oilseed	oilseed	NOUN
ahs-3127	33	7	and	and	CCONJ
ahs-3127	33	8	fiber	fiber	NOUN
ahs-3127	33	9	crop	crop	NOUN
ahs-3127	33	10	with	with	ADP
ahs-3127	33	11	a	a	DET
ahs-3127	33	12	world	world	NOUN
ahs-3127	33	13	production	production	NOUN
ahs-3127	33	14	estimated	estimate	VERB
ahs-3127	33	15	to	to	PART
ahs-3127	33	16	be	be	AUX
ahs-3127	33	17	25.01	25.01	NUM
ahs-3127	33	18	million	million	NUM
ahs-3127	33	19	tonnes	tonne	NOUN
ahs-3127	33	20	in	in	ADP
ahs-3127	33	21	2013	2013	NUM
ahs-3127	33	22	-	-	SYM
ahs-3127	33	23	2014	2014	NUM
ahs-3127	33	24	as	as	SCONJ
ahs-3127	33	25	announced	announce	VERB
ahs-3127	33	26	at	at	ADP
ahs-3127	33	27	the	the	DET
ahs-3127	33	28	official	official	ADJ
ahs-3127	33	29	website	website	NOUN
ahs-3127	33	30	of	of	ADP
ahs-3127	33	31	the	the	DET
ahs-3127	33	32	international	international	ADJ
ahs-3127	33	33	cotton	cotton	NOUN
ahs-3127	33	34	advisory	advisory	NOUN
ahs-3127	33	35	committee	committee	NOUN
ahs-3127	33	36	(	(	PUNCT
ahs-3127	33	37	icac	icac	PROPN
ahs-3127	33	38	)	)	PUNCT
ahs-3127	33	39	(	(	PUNCT
ahs-3127	33	40	https://www.icac.org	https://www.icac.org	NUM
ahs-3127	33	41	)	)	PUNCT
ahs-3127	33	42	.	.	PUNCT
ahs-3127	34	1	the	the	DET
ahs-3127	34	2	widely	widely	ADV
ahs-3127	34	3	famous	famous	ADJ
ahs-3127	34	4	,	,	PUNCT
ahs-3127	34	5	allotetraploid	allotetraploid	VERB
ahs-3127	34	6	gossypium	gossypium	NOUN
ahs-3127	34	7	hirsutum	hirsutum	PROPN
ahs-3127	34	8	l.	l.	PROPN
ahs-3127	34	9	has	have	VERB
ahs-3127	34	10	a	a	DET
ahs-3127	34	11	distinct	distinct	ADJ
ahs-3127	34	12	growth	growth	NOUN
ahs-3127	34	13	manner	manner	NOUN
ahs-3127	34	14	and	and	CCONJ
ahs-3127	34	15	can	can	AUX
ahs-3127	34	16	be	be	AUX
ahs-3127	34	17	useful	useful	ADJ
ahs-3127	34	18	in	in	ADP
ahs-3127	34	19	monitoring	monitor	VERB
ahs-3127	34	20	growth	growth	NOUN
ahs-3127	34	21	and	and	CCONJ
ahs-3127	34	22	developmental	developmental	ADJ
ahs-3127	34	23	changes	change	NOUN
ahs-3127	34	24	under	under	ADP
ahs-3127	34	25	diverse	diverse	ADJ
ahs-3127	34	26	conditions	condition	NOUN
ahs-3127	34	27	(	(	PUNCT
ahs-3127	34	28	jawdat	jawdat	NOUN
ahs-3127	34	29	et	et	PROPN
ahs-3127	34	30	al	al	PROPN
ahs-3127	34	31	.	.	PROPN
ahs-3127	34	32	,	,	PUNCT
ahs-3127	34	33	2012	2012	NUM
ahs-3127	34	34	)	)	PUNCT
ahs-3127	34	35	.	.	PUNCT
ahs-3127	35	1	cotton	cotton	NOUN
ahs-3127	35	2	is	be	AUX
ahs-3127	35	3	grown	grow	VERB
ahs-3127	35	4	in	in	ADP
ahs-3127	35	5	around	around	ADP
ahs-3127	35	6	70	70	NUM
ahs-3127	35	7	countries	country	NOUN
ahs-3127	35	8	where	where	SCONJ
ahs-3127	35	9	the	the	DET
ahs-3127	35	10	irrigated	irrigated	ADJ
ahs-3127	35	11	system	system	NOUN
ahs-3127	35	12	dominates	dominate	VERB
ahs-3127	35	13	in	in	ADP
ahs-3127	35	14	arid	arid	ADJ
ahs-3127	35	15	regions	region	NOUN
ahs-3127	35	16	;	;	PUNCT
ahs-3127	35	17	and	and	CCONJ
ahs-3127	35	18	is	be	AUX
ahs-3127	35	19	used	use	VERB
ahs-3127	35	20	to	to	PART
ahs-3127	35	21	supplement	supplement	VERB
ahs-3127	35	22	rainfall	rainfall	NOUN
ahs-3127	35	23	in	in	ADP
ahs-3127	35	24	the	the	DET
ahs-3127	35	25	humid	humid	ADJ
ahs-3127	35	26	regions	region	NOUN
ahs-3127	35	27	to	to	PART
ahs-3127	35	28	ensure	ensure	VERB
ahs-3127	35	29	yield	yield	NOUN
ahs-3127	35	30	stability	stability	NOUN
ahs-3127	35	31	.	.	PUNCT
ahs-3127	36	1	seed	seed	NOUN
ahs-3127	36	2	cotton	cotton	NOUN
ahs-3127	36	3	production	production	NOUN
ahs-3127	36	4	in	in	ADP
ahs-3127	36	5	syria	syria	PROPN
ahs-3127	36	6	(	(	PUNCT
ahs-3127	36	7	mostly	mostly	ADV
ahs-3127	36	8	semi	semi	ADJ
ahs-3127	36	9	-	-	ADJ
ahs-3127	36	10	arid	arid	ADJ
ahs-3127	36	11	where	where	SCONJ
ahs-3127	36	12	cotton	cotton	NOUN
ahs-3127	36	13	is	be	AUX
ahs-3127	36	14	irrigated	irrigate	VERB
ahs-3127	36	15	)	)	PUNCT
ahs-3127	36	16	was	be	AUX
ahs-3127	36	17	around	around	ADV
ahs-3127	36	18	one	one	NUM
ahs-3127	36	19	million	million	NUM
ahs-3127	36	20	tonnes	tonne	NOUN
ahs-3127	36	21	in	in	ADP
ahs-3127	36	22	2000	2000	NUM
ahs-3127	36	23	.	.	PUNCT
ahs-3127	37	1	a	a	DET
ahs-3127	37	2	decrease	decrease	NOUN
ahs-3127	37	3	in	in	ADP
ahs-3127	37	4	production	production	NOUN
ahs-3127	37	5	from	from	ADP
ahs-3127	37	6	around	around	ADP
ahs-3127	37	7	670	670	NUM
ahs-3127	37	8	k	k	ADJ
ahs-3127	37	9	tonnes	tonne	NOUN
ahs-3127	37	10	in	in	ADP
ahs-3127	37	11	2009	2009	NUM
ahs-3127	37	12	to	to	ADP
ahs-3127	37	13	around	around	ADP
ahs-3127	37	14	472	472	NUM
ahs-3127	37	15	k	k	ADJ
ahs-3127	37	16	tonnes	tonne	NOUN
ahs-3127	37	17	in	in	ADP
ahs-3127	37	18	2010	2010	NUM
ahs-3127	37	19	and	and	CCONJ
ahs-3127	37	20	then	then	ADV
ahs-3127	37	21	up	up	ADP
ahs-3127	37	22	to	to	ADP
ahs-3127	37	23	about	about	ADP
ahs-3127	37	24	671	671	NUM
ahs-3127	37	25	k	k	ADJ
ahs-3127	37	26	tonnes	tonne	NOUN
ahs-3127	37	27	in	in	ADP
ahs-3127	37	28	2011	2011	NUM
ahs-3127	37	29	in	in	ADP
ahs-3127	37	30	the	the	DET
ahs-3127	37	31	same	same	ADJ
ahs-3127	37	32	cultivation	cultivation	NOUN
ahs-3127	37	33	area	area	NOUN
ahs-3127	37	34	(	(	PUNCT
ahs-3127	37	35	~200	~200	NOUN
ahs-3127	37	36	k	k	PROPN
ahs-3127	37	37	hectares	hectare	NOUN
ahs-3127	37	38	)	)	PUNCT
ahs-3127	37	39	,	,	PUNCT
ahs-3127	37	40	was	be	AUX
ahs-3127	37	41	attributed	attribute	VERB
ahs-3127	37	42	to	to	ADP
ahs-3127	37	43	the	the	DET
ahs-3127	37	44	drought	drought	NOUN
ahs-3127	37	45	wave	wave	NOUN
ahs-3127	37	46	that	that	PRON
ahs-3127	37	47	hit	hit	VERB
ahs-3127	37	48	the	the	DET
ahs-3127	37	49	country	country	NOUN
ahs-3127	37	50	in	in	ADP
ahs-3127	37	51	2010	2010	NUM
ahs-3127	37	52	.	.	PUNCT
ahs-3127	38	1	a	a	DET
ahs-3127	38	2	rapid	rapid	ADJ
ahs-3127	38	3	decline	decline	NOUN
ahs-3127	38	4	in	in	ADP
ahs-3127	38	5	production	production	NOUN
ahs-3127	38	6	was	be	AUX
ahs-3127	38	7	recorded	record	VERB
ahs-3127	38	8	between	between	ADP
ahs-3127	38	9	2011	2011	NUM
ahs-3127	38	10	and	and	CCONJ
ahs-3127	38	11	2014	2014	NUM
ahs-3127	38	12	,	,	PUNCT
ahs-3127	38	13	from	from	ADP
ahs-3127	38	14	around	around	ADP
ahs-3127	38	15	670	670	NUM
ahs-3127	38	16	to	to	ADP
ahs-3127	38	17	around	around	ADP
ahs-3127	38	18	162	162	NUM
ahs-3127	38	19	k	k	NOUN
ahs-3127	38	20	tonnes	tonne	NOUN
ahs-3127	38	21	respectively	respectively	ADV
ahs-3127	38	22	.	.	PUNCT
ahs-3127	39	1	this	this	PRON
ahs-3127	39	2	was	be	AUX
ahs-3127	39	3	concurrent	concurrent	ADJ
ahs-3127	39	4	with	with	ADP
ahs-3127	39	5	the	the	DET
ahs-3127	39	6	unfortunate	unfortunate	ADJ
ahs-3127	39	7	events	event	NOUN
ahs-3127	39	8	taking	take	VERB
ahs-3127	39	9	place	place	NOUN
ahs-3127	39	10	in	in	ADP
ahs-3127	39	11	syria	syria	PROPN
ahs-3127	39	12	.	.	PUNCT
ahs-3127	40	1	the	the	DET
ahs-3127	40	2	principal	principal	ADJ
ahs-3127	40	3	objective	objective	NOUN
ahs-3127	40	4	of	of	ADP
ahs-3127	40	5	this	this	DET
ahs-3127	40	6	paper	paper	NOUN
ahs-3127	40	7	is	be	AUX
ahs-3127	40	8	to	to	PART
ahs-3127	40	9	assess	assess	VERB
ahs-3127	40	10	physiological	physiological	ADJ
ahs-3127	40	11	,	,	PUNCT
ahs-3127	40	12	morphological	morphological	ADJ
ahs-3127	40	13	,	,	PUNCT
ahs-3127	40	14	molecular	molecular	ADJ
ahs-3127	40	15	,	,	PUNCT
ahs-3127	40	16	and	and	CCONJ
ahs-3127	40	17	biochemical	biochemical	ADJ
ahs-3127	40	18	responses	response	NOUN
ahs-3127	40	19	of	of	ADP
ahs-3127	40	20	two	two	NUM
ahs-3127	40	21	accredited	accredit	VERB
ahs-3127	40	22	cotton	cotton	NOUN
ahs-3127	40	23	cultivars	cultivar	NOUN
ahs-3127	40	24	in	in	ADP
ahs-3127	40	25	syria	syria	PROPN
ahs-3127	40	26	under	under	ADP
ahs-3127	40	27	deficit	deficit	NOUN
ahs-3127	40	28	water	water	NOUN
ahs-3127	40	29	regime	regime	NOUN
ahs-3127	40	30	,	,	PUNCT
ahs-3127	40	31	in	in	ADP
ahs-3127	40	32	benefits	benefit	NOUN
ahs-3127	40	33	of	of	ADP
ahs-3127	40	34	future	future	ADJ
ahs-3127	40	35	breeding	breeding	NOUN
ahs-3127	40	36	programs	program	NOUN
ahs-3127	40	37	.	.	PUNCT
ahs-3127	41	1	2	2	X
ahs-3127	41	2	.	.	X
ahs-3127	41	3	materials	material	NOUN
ahs-3127	41	4	and	and	CCONJ
ahs-3127	41	5	methods	method	NOUN
ahs-3127	41	6	plant	plant	NOUN
ahs-3127	41	7	materials	material	NOUN
ahs-3127	41	8	plant	plant	NOUN
ahs-3127	41	9	material	material	NOUN
ahs-3127	41	10	consisted	consist	VERB
ahs-3127	41	11	of	of	ADP
ahs-3127	41	12	cotton	cotton	NOUN
ahs-3127	41	13	seeds	seed	NOUN
ahs-3127	41	14	of	of	ADP
ahs-3127	41	15	two	two	NUM
ahs-3127	41	16	g.	g.	PROPN
ahs-3127	41	17	hirsutum	hirsutum	PROPN
ahs-3127	41	18	l.	l.	PROPN
ahs-3127	41	19	accredited	accredit	VERB
ahs-3127	41	20	local	local	ADJ
ahs-3127	41	21	cultivars	cultivar	NOUN
ahs-3127	41	22	:	:	PUNCT
ahs-3127	41	23	aleppo	aleppo	PROPN
ahs-3127	41	24	118	118	NUM
ahs-3127	42	1	[	[	X
ahs-3127	42	2	aleppo	aleppo	PROPN
ahs-3127	42	3	40	40	NUM
ahs-3127	42	4	(	(	PUNCT
ahs-3127	42	5	aleppo	aleppo	PROPN
ahs-3127	42	6	1	1	NUM
ahs-3127	42	7	x	x	SYM
ahs-3127	42	8	acala	acala	PROPN
ahs-3127	42	9	sj1	sj1	PROPN
ahs-3127	42	10	)	)	PUNCT
ahs-3127	42	11	x	x	SYM
ahs-3127	42	12	american	american	ADJ
ahs-3127	42	13	cultivar	cultivar	NOUN
ahs-3127	42	14	bw	bw	PROPN
ahs-3127	42	15	76	76	NUM
ahs-3127	42	16	-	-	SYM
ahs-3127	42	17	31	31	NUM
ahs-3127	42	18	]	]	PUNCT
ahs-3127	42	19	and	and	CCONJ
ahs-3127	42	20	deir	deir	PROPN
ahs-3127	42	21	al	al	PROPN
ahs-3127	42	22	-	-	PROPN
ahs-3127	42	23	zour	zour	PROPN
ahs-3127	42	24	22	22	NUM
ahs-3127	42	25	(	(	PUNCT
ahs-3127	42	26	a	a	DET
ahs-3127	42	27	selected	select	VERB
ahs-3127	42	28	line	line	NOUN
ahs-3127	42	29	from	from	ADP
ahs-3127	42	30	deltapine	deltapine	NOUN
ahs-3127	42	31	41	41	NUM
ahs-3127	42	32	)	)	PUNCT
ahs-3127	42	33	.	.	PUNCT
ahs-3127	43	1	drought	drought	NOUN
ahs-3127	43	2	stress	stress	NOUN
ahs-3127	43	3	treatment	treatment	NOUN
ahs-3127	43	4	seeds	seed	NOUN
ahs-3127	43	5	were	be	AUX
ahs-3127	43	6	sown	sow	VERB
ahs-3127	43	7	in	in	ADP
ahs-3127	43	8	rows	row	NOUN
ahs-3127	43	9	,	,	PUNCT
ahs-3127	43	10	where	where	SCONJ
ahs-3127	43	11	the	the	DET
ahs-3127	43	12	distance	distance	NOUN
ahs-3127	43	13	between	between	ADP
ahs-3127	43	14	rows	row	NOUN
ahs-3127	43	15	and	and	CCONJ
ahs-3127	43	16	plants	plant	NOUN
ahs-3127	43	17	were	be	AUX
ahs-3127	43	18	kept	keep	VERB
ahs-3127	43	19	at	at	ADP
ahs-3127	43	20	75	75	NUM
ahs-3127	43	21	and	and	CCONJ
ahs-3127	43	22	25	25	NUM
ahs-3127	43	23	cm	cm	NOUN
ahs-3127	43	24	respectively	respectively	ADV
ahs-3127	43	25	.	.	PUNCT
ahs-3127	44	1	experimental	experimental	ADJ
ahs-3127	44	2	plots	plot	NOUN
ahs-3127	44	3	were	be	AUX
ahs-3127	44	4	designed	design	VERB
ahs-3127	44	5	according	accord	VERB
ahs-3127	44	6	to	to	ADP
ahs-3127	44	7	a	a	DET
ahs-3127	44	8	randomized	randomized	ADJ
ahs-3127	44	9	complete	complete	ADJ
ahs-3127	44	10	block	block	NOUN
ahs-3127	44	11	design	design	NOUN
ahs-3127	44	12	(	(	PUNCT
ahs-3127	44	13	rcbd	rcbd	NOUN
ahs-3127	44	14	)	)	PUNCT
ahs-3127	44	15	with	with	SCONJ
ahs-3127	44	16	each	each	DET
ahs-3127	44	17	treatment	treatment	NOUN
ahs-3127	44	18	is	be	AUX
ahs-3127	44	19	replicated	replicate	VERB
ahs-3127	44	20	once	once	ADV
ahs-3127	44	21	in	in	ADP
ahs-3127	44	22	each	each	DET
ahs-3127	44	23	block	block	NOUN
ahs-3127	44	24	.	.	PUNCT
ahs-3127	45	1	the	the	DET
ahs-3127	45	2	experiment	experiment	NOUN
ahs-3127	45	3	site	site	NOUN
ahs-3127	45	4	was	be	AUX
ahs-3127	45	5	located	locate	VERB
ahs-3127	45	6	in	in	ADP
ahs-3127	45	7	doubaya	doubaya	NOUN
ahs-3127	45	8	in	in	ADP
ahs-3127	45	9	damascus	damascus	PROPN
ahs-3127	45	10	country	country	NOUN
ahs-3127	45	11	side	side	NOUN
ahs-3127	45	12	(	(	PUNCT
ahs-3127	45	13	980	980	NUM
ahs-3127	45	14	m	m	NOUN
ahs-3127	45	15	above	above	ADP
ahs-3127	45	16	sea	sea	NOUN
ahs-3127	45	17	level	level	NOUN
ahs-3127	45	18	,	,	PUNCT
ahs-3127	45	19	33	33	NUM
ahs-3127	45	20	°	°	NOUN
ahs-3127	45	21	29	29	NUM
ahs-3127	45	22	´	´	NOUN
ahs-3127	45	23	36	36	NUM
ahs-3127	45	24	´	´	NOUN
ahs-3127	45	25	n	n	PRON
ahs-3127	45	26	and	and	CCONJ
ahs-3127	45	27	36	36	NUM
ahs-3127	45	28	°	°	NOUN
ahs-3127	45	29	04	04	NUM
ahs-3127	45	30	´	´	NOUN
ahs-3127	45	31	57	57	NUM
ahs-3127	45	32	´	´	NOUN
ahs-3127	45	33	e	e	NOUN
ahs-3127	45	34	)	)	PUNCT
ahs-3127	45	35	.	.	PUNCT
ahs-3127	46	1	the	the	DET
ahs-3127	46	2	experiment	experiment	NOUN
ahs-3127	46	3	consists	consist	VERB
ahs-3127	46	4	of	of	ADP
ahs-3127	46	5	two	two	NUM
ahs-3127	46	6	irrigation	irrigation	NOUN
ahs-3127	46	7	treatments	treatment	NOUN
ahs-3127	46	8	(	(	PUNCT
ahs-3127	46	9	control	control	NOUN
ahs-3127	46	10	with	with	ADP
ahs-3127	46	11	full	full	ADJ
ahs-3127	46	12	irrigation	irrigation	NOUN
ahs-3127	46	13	and	and	CCONJ
ahs-3127	46	14	treated	treat	VERB
ahs-3127	46	15	with	with	ADP
ahs-3127	46	16	50	50	NUM
ahs-3127	46	17	%	%	NOUN
ahs-3127	46	18	of	of	ADP
ahs-3127	46	19	control	control	NOUN
ahs-3127	46	20	irrigation	irrigation	NOUN
ahs-3127	46	21	)	)	PUNCT
ahs-3127	46	22	,	,	PUNCT
ahs-3127	46	23	two	two	NUM
ahs-3127	46	24	cultivars	cultivar	NOUN
ahs-3127	46	25	(	(	PUNCT
ahs-3127	46	26	aleppo	aleppo	PROPN
ahs-3127	46	27	118	118	NUM
ahs-3127	46	28	and	and	CCONJ
ahs-3127	46	29	deir	deir	PROPN
ahs-3127	46	30	al	al	PROPN
ahs-3127	46	31	zour	zour	PROPN
ahs-3127	46	32	22	22	NUM
ahs-3127	46	33	)	)	PUNCT
ahs-3127	46	34	and	and	CCONJ
ahs-3127	46	35	three	three	NUM
ahs-3127	46	36	replicates	replicate	NOUN
ahs-3127	46	37	per	per	ADP
ahs-3127	46	38	treatment	treatment	NOUN
ahs-3127	46	39	.	.	PUNCT
ahs-3127	47	1	the	the	DET
ahs-3127	47	2	soil	soil	NOUN
ahs-3127	47	3	(	(	PUNCT
ahs-3127	47	4	total	total	NOUN
ahs-3127	47	5	n	n	CCONJ
ahs-3127	47	6	:	:	PUNCT
ahs-3127	47	7	0.08	0.08	NUM
ahs-3127	47	8	%	%	NOUN
ahs-3127	47	9	,	,	PUNCT
ahs-3127	47	10	available	available	ADJ
ahs-3127	47	11	p	p	X
ahs-3127	47	12	:	:	PUNCT
ahs-3127	47	13	12	12	NUM
ahs-3127	47	14	ppm	ppm	NOUN
ahs-3127	47	15	,	,	PUNCT
ahs-3127	47	16	k	k	NOUN
ahs-3127	47	17	:	:	PUNCT
ahs-3127	47	18	1.30	1.30	NUM
ahs-3127	47	19	meq/100	meq/100	NOUN
ahs-3127	47	20	g	g	NOUN
ahs-3127	47	21	,	,	PUNCT
ahs-3127	47	22	and	and	CCONJ
ahs-3127	47	23	organic	organic	ADJ
ahs-3127	47	24	matter	matter	NOUN
ahs-3127	47	25	:	:	PUNCT
ahs-3127	47	26	1.19	1.19	NUM
ahs-3127	47	27	%	%	NOUN
ahs-3127	47	28	)	)	PUNCT
ahs-3127	47	29	was	be	AUX
ahs-3127	47	30	prepared	prepare	VERB
ahs-3127	47	31	by	by	ADP
ahs-3127	47	32	tractor	tractor	NOUN
ahs-3127	47	33	ploughing	ploughing	NOUN
ahs-3127	47	34	deep	deep	ADV
ahs-3127	47	35	for	for	ADP
ahs-3127	47	36	45	45	NUM
ahs-3127	47	37	cm	cm	NOUN
ahs-3127	47	38	,	,	PUNCT
ahs-3127	47	39	followed	follow	VERB
ahs-3127	47	40	by	by	ADP
ahs-3127	47	41	two	two	NUM
ahs-3127	47	42	surface	surface	NOUN
ahs-3127	47	43	ploughings	ploughing	NOUN
ahs-3127	47	44	for	for	ADP
ahs-3127	47	45	15	15	NUM
ahs-3127	47	46	cm	cm	NOUN
ahs-3127	47	47	deep	deep	ADJ
ahs-3127	47	48	.	.	PUNCT
ahs-3127	48	1	fertilization	fertilization	NOUN
ahs-3127	48	2	was	be	AUX
ahs-3127	48	3	conducted	conduct	VERB
ahs-3127	48	4	following	follow	VERB
ahs-3127	48	5	the	the	DET
ahs-3127	48	6	cotton	cotton	NOUN
ahs-3127	48	7	research	research	NOUN
ahs-3127	48	8	administration	administration	NOUN
ahs-3127	48	9	(	(	PUNCT
ahs-3127	48	10	cra	cra	PROPN
ahs-3127	48	11	)	)	PUNCT
ahs-3127	48	12	guidelines	guideline	NOUN
ahs-3127	48	13	and	and	CCONJ
ahs-3127	48	14	recommendations	recommendation	NOUN
ahs-3127	48	15	.	.	PUNCT
ahs-3127	49	1	nitrogen	nitrogen	NOUN
ahs-3127	49	2	fertilizer	fertilizer	NOUN
ahs-3127	49	3	as	as	ADP
ahs-3127	49	4	urea	urea	NOUN
ahs-3127	49	5	46	46	NUM
ahs-3127	49	6	%	%	NOUN
ahs-3127	50	1	[	[	X
ahs-3127	50	2	co(nh2)2	co(nh2)2	X
ahs-3127	50	3	]	]	PUNCT
ahs-3127	50	4	was	be	AUX
ahs-3127	50	5	applied	apply	VERB
ahs-3127	50	6	at	at	ADP
ahs-3127	50	7	a	a	DET
ahs-3127	50	8	rate	rate	NOUN
ahs-3127	50	9	of	of	ADP
ahs-3127	50	10	415	415	NUM
ahs-3127	50	11	kg	kg	NOUN
ahs-3127	50	12	/	/	SYM
ahs-3127	50	13	ha	ha	INTJ
ahs-3127	50	14	in	in	ADP
ahs-3127	50	15	four	four	NUM
ahs-3127	50	16	unequally	unequally	ADV
ahs-3127	50	17	split	split	ADJ
ahs-3127	50	18	applications	application	NOUN
ahs-3127	50	19	,	,	PUNCT
ahs-3127	50	20	20	20	NUM
ahs-3127	50	21	%	%	NOUN
ahs-3127	50	22	before	before	ADP
ahs-3127	50	23	sowing	sowing	NOUN
ahs-3127	50	24	,	,	PUNCT
ahs-3127	50	25	40	40	NUM
ahs-3127	50	26	%	%	NOUN
ahs-3127	50	27	30	30	NUM
ahs-3127	50	28	days	day	NOUN
ahs-3127	50	29	after	after	ADP
ahs-3127	50	30	sowing	sowing	NOUN
ahs-3127	50	31	,	,	PUNCT
ahs-3127	50	32	20	20	NUM
ahs-3127	50	33	%	%	NOUN
ahs-3127	50	34	at	at	ADP
ahs-3127	50	35	floral	floral	ADJ
ahs-3127	50	36	bud	bud	ADJ
ahs-3127	50	37	emergence	emergence	NOUN
ahs-3127	50	38	,	,	PUNCT
ahs-3127	50	39	and	and	CCONJ
ahs-3127	50	40	20	20	NUM
ahs-3127	50	41	%	%	NOUN
ahs-3127	50	42	at	at	ADP
ahs-3127	50	43	bolls	boll	NOUN
ahs-3127	50	44	initiation	initiation	NOUN
ahs-3127	50	45	phase	phase	NOUN
ahs-3127	50	46	.	.	PUNCT
ahs-3127	51	1	phosphorus	phosphorus	NOUN
ahs-3127	51	2	fertilizer	fertilizer	NOUN
ahs-3127	52	1	[	[	X
ahs-3127	52	2	ca(h2po4)2	ca(h2po4)2	NOUN
ahs-3127	52	3	]	]	PUNCT
ahs-3127	52	4	was	be	AUX
ahs-3127	52	5	applied	apply	VERB
ahs-3127	52	6	at	at	ADP
ahs-3127	52	7	a	a	DET
ahs-3127	52	8	rate	rate	NOUN
ahs-3127	52	9	of	of	ADP
ahs-3127	52	10	130	130	NUM
ahs-3127	52	11	kg	kg	NOUN
ahs-3127	52	12	/	/	SYM
ahs-3127	52	13	ha	ha	ADJ
ahs-3127	52	14	before	before	ADP
ahs-3127	52	15	sowing	sowing	NOUN
ahs-3127	52	16	.	.	PUNCT
ahs-3127	53	1	potassium	potassium	NOUN
ahs-3127	53	2	fertilizer	fertilizer	NOUN
ahs-3127	53	3	was	be	AUX
ahs-3127	53	4	applied	apply	VERB
ahs-3127	53	5	at	at	ADP
ahs-3127	53	6	the	the	DET
ahs-3127	53	7	rate	rate	NOUN
ahs-3127	53	8	of	of	ADP
ahs-3127	53	9	170	170	NUM
ahs-3127	53	10	kg	kg	NOUN
ahs-3127	53	11	/	/	INTJ
ahs-3127	53	12	ha	ha	INTJ
ahs-3127	53	13	in	in	ADP
ahs-3127	53	14	the	the	DET
ahs-3127	53	15	form	form	NOUN
ahs-3127	53	16	of	of	ADP
ahs-3127	53	17	potassium	potassium	NOUN
ahs-3127	53	18	sulphate	sulphate	NOUN
ahs-3127	53	19	(	(	PUNCT
ahs-3127	53	20	k2so4	k2so4	PROPN
ahs-3127	53	21	)	)	PUNCT
ahs-3127	53	22	.	.	PUNCT
ahs-3127	54	1	drip	drip	NOUN
ahs-3127	54	2	irrigation	irrigation	NOUN
ahs-3127	54	3	was	be	AUX
ahs-3127	54	4	applied	apply	VERB
ahs-3127	54	5	at	at	ADP
ahs-3127	54	6	250	250	NUM
ahs-3127	54	7	m3	m3	PROPN
ahs-3127	54	8	/	/	SYM
ahs-3127	54	9	ha	ha	INTJ
ahs-3127	54	10	,	,	PUNCT
ahs-3127	54	11	at	at	ADP
ahs-3127	54	12	first	first	ADV
ahs-3127	54	13	,	,	PUNCT
ahs-3127	54	14	for	for	ADP
ahs-3127	54	15	both	both	CCONJ
ahs-3127	54	16	control	control	NOUN
ahs-3127	54	17	and	and	CCONJ
ahs-3127	54	18	treated	treat	VERB
ahs-3127	54	19	blocks	block	NOUN
ahs-3127	54	20	.	.	PUNCT
ahs-3127	55	1	consequent	consequent	ADJ
ahs-3127	55	2	irrigations	irrigation	NOUN
ahs-3127	55	3	were	be	AUX
ahs-3127	55	4	applied	apply	VERB
ahs-3127	55	5	during	during	ADP
ahs-3127	55	6	the	the	DET
ahs-3127	55	7	growing	grow	VERB
ahs-3127	55	8	season	season	NOUN
ahs-3127	55	9	of	of	ADP
ahs-3127	55	10	cultivated	cultivate	VERB
ahs-3127	55	11	plants	plant	NOUN
ahs-3127	55	12	once	once	ADV
ahs-3127	55	13	a	a	DET
ahs-3127	55	14	week	week	NOUN
ahs-3127	55	15	at	at	ADP
ahs-3127	55	16	250	250	NUM
ahs-3127	55	17	m3	m3	PROPN
ahs-3127	55	18	/	/	SYM
ahs-3127	55	19	ha	ha	INTJ
ahs-3127	55	20	(	(	PUNCT
ahs-3127	55	21	full	full	ADJ
ahs-3127	55	22	irrigation	irrigation	NOUN
ahs-3127	55	23	)	)	PUNCT
ahs-3127	55	24	in	in	ADP
ahs-3127	55	25	control	control	NOUN
ahs-3127	55	26	blocks	block	NOUN
ahs-3127	55	27	,	,	PUNCT
ahs-3127	55	28	and	and	CCONJ
ahs-3127	55	29	once	once	ADV
ahs-3127	55	30	in	in	ADP
ahs-3127	55	31	every	every	DET
ahs-3127	55	32	10	10	NUM
ahs-3127	55	33	days	day	NOUN
ahs-3127	55	34	at	at	ADP
ahs-3127	55	35	125	125	NUM
ahs-3127	55	36	m3	m3	PROPN
ahs-3127	55	37	/	/	SYM
ahs-3127	55	38	ha	ha	INTJ
ahs-3127	55	39	(	(	PUNCT
ahs-3127	55	40	deficit	deficit	NOUN
ahs-3127	55	41	irrigajawdat	irrigajawdat	NOUN
ahs-3127	55	42	et	et	PROPN
ahs-3127	55	43	al	al	PROPN
ahs-3127	55	44	.	.	PUNCT
ahs-3127	56	1	cotton	cotton	NOUN
ahs-3127	56	2	behaviour	behaviour	NOUN
ahs-3127	56	3	under	under	ADP
ahs-3127	56	4	water	water	NOUN
ahs-3127	56	5	stress	stress	NOUN
ahs-3127	56	6	81	81	NUM
ahs-3127	56	7	tion	tion	NOUN
ahs-3127	56	8	;	;	PUNCT
ahs-3127	56	9	receiving	receive	VERB
ahs-3127	56	10	water	water	NOUN
ahs-3127	56	11	at	at	ADP
ahs-3127	56	12	50	50	NUM
ahs-3127	56	13	%	%	NOUN
ahs-3127	56	14	of	of	ADP
ahs-3127	56	15	control	control	NOUN
ahs-3127	56	16	treatment	treatment	NOUN
ahs-3127	56	17	)	)	PUNCT
ahs-3127	56	18	in	in	ADP
ahs-3127	56	19	the	the	DET
ahs-3127	56	20	treated	treat	VERB
ahs-3127	56	21	blocks	block	NOUN
ahs-3127	56	22	.	.	PUNCT
ahs-3127	57	1	except	except	SCONJ
ahs-3127	57	2	for	for	ADP
ahs-3127	57	3	one	one	NUM
ahs-3127	57	4	week	week	NOUN
ahs-3127	57	5	where	where	SCONJ
ahs-3127	57	6	temperatures	temperature	NOUN
ahs-3127	57	7	reached	reach	VERB
ahs-3127	57	8	around	around	ADP
ahs-3127	57	9	45	45	NUM
ahs-3127	57	10	degrees	degree	NOUN
ahs-3127	57	11	in	in	ADP
ahs-3127	57	12	the	the	DET
ahs-3127	57	13	afternoon	afternoon	NOUN
ahs-3127	57	14	,	,	PUNCT
ahs-3127	57	15	we	we	PRON
ahs-3127	57	16	had	have	VERB
ahs-3127	57	17	to	to	PART
ahs-3127	57	18	irrigate	irrigate	VERB
ahs-3127	57	19	both	both	PRON
ahs-3127	57	20	control	control	NOUN
ahs-3127	57	21	and	and	CCONJ
ahs-3127	57	22	treatment	treatment	NOUN
ahs-3127	57	23	blocks	block	NOUN
ahs-3127	57	24	with	with	ADP
ahs-3127	57	25	emergency	emergency	NOUN
ahs-3127	57	26	full	full	ADJ
ahs-3127	57	27	irrigation	irrigation	NOUN
ahs-3127	57	28	.	.	PUNCT
ahs-3127	58	1	the	the	DET
ahs-3127	58	2	distance	distance	NOUN
ahs-3127	58	3	between	between	ADP
ahs-3127	58	4	emitters	emitter	NOUN
ahs-3127	58	5	was	be	AUX
ahs-3127	58	6	25	25	NUM
ahs-3127	58	7	cm	cm	NOUN
ahs-3127	58	8	and	and	CCONJ
ahs-3127	58	9	the	the	DET
ahs-3127	58	10	emitter	emitter	NOUN
ahs-3127	58	11	discharge	discharge	NOUN
ahs-3127	58	12	was	be	AUX
ahs-3127	58	13	8	8	NUM
ahs-3127	58	14	l	l	NOUN
ahs-3127	58	15	/	/	SYM
ahs-3127	58	16	h.	h.	NOUN
ahs-3127	58	17	thinning	thinning	NOUN
ahs-3127	58	18	of	of	ADP
ahs-3127	58	19	plants	plant	NOUN
ahs-3127	58	20	was	be	AUX
ahs-3127	58	21	conducted	conduct	VERB
ahs-3127	58	22	around	around	ADP
ahs-3127	58	23	4	4	NUM
ahs-3127	58	24	weeks	week	NOUN
ahs-3127	58	25	of	of	ADP
ahs-3127	58	26	germination	germination	NOUN
ahs-3127	58	27	.	.	PUNCT
ahs-3127	59	1	physiological	physiological	ADJ
ahs-3127	59	2	data	datum	NOUN
ahs-3127	59	3	chlorophyll	chlorophyll	VERB
ahs-3127	59	4	a	a	DET
ahs-3127	59	5	and	and	CCONJ
ahs-3127	59	6	b	b	NOUN
ahs-3127	59	7	content	content	NOUN
ahs-3127	59	8	.	.	PUNCT
ahs-3127	60	1	leaves	leave	VERB
ahs-3127	60	2	samples	sample	NOUN
ahs-3127	60	3	(	(	PUNCT
ahs-3127	60	4	100	100	NUM
ahs-3127	60	5	mg	mg	NUM
ahs-3127	60	6	/	/	SYM
ahs-3127	60	7	sample	sample	NOUN
ahs-3127	60	8	)	)	PUNCT
ahs-3127	60	9	were	be	AUX
ahs-3127	60	10	each	each	PRON
ahs-3127	60	11	immersed	immerse	VERB
ahs-3127	60	12	in	in	ADP
ahs-3127	60	13	4	4	NUM
ahs-3127	60	14	ml	ml	NOUN
ahs-3127	60	15	of	of	ADP
ahs-3127	60	16	95	95	NUM
ahs-3127	60	17	%	%	NOUN
ahs-3127	60	18	acetone	acetone	NOUN
ahs-3127	60	19	and	and	CCONJ
ahs-3127	60	20	incubated	incubate	VERB
ahs-3127	60	21	at	at	ADP
ahs-3127	60	22	6	6	NUM
ahs-3127	60	23	-	-	SYM
ahs-3127	60	24	8	8	NUM
ahs-3127	60	25	°	°	ADP
ahs-3127	60	26	c	c	NOUN
ahs-3127	60	27	for	for	ADP
ahs-3127	60	28	24	24	NUM
ahs-3127	60	29	hrs	hrs	NOUN
ahs-3127	60	30	.	.	PUNCT
ahs-3127	61	1	chlorophyll	chlorophyll	VERB
ahs-3127	61	2	a	a	DET
ahs-3127	61	3	and	and	CCONJ
ahs-3127	61	4	b	b	NOUN
ahs-3127	61	5	concentration	concentration	NOUN
ahs-3127	61	6	was	be	AUX
ahs-3127	61	7	determined	determine	VERB
ahs-3127	61	8	spectrophotometrically	spectrophotometrically	ADV
ahs-3127	61	9	by	by	ADP
ahs-3127	61	10	measuring	measure	VERB
ahs-3127	61	11	the	the	DET
ahs-3127	61	12	absorbance	absorbance	NOUN
ahs-3127	61	13	(	(	PUNCT
ahs-3127	61	14	optical	optical	ADJ
ahs-3127	61	15	density	density	NOUN
ahs-3127	61	16	-	-	PUNCT
ahs-3127	61	17	od	od	NOUN
ahs-3127	61	18	)	)	PUNCT
ahs-3127	61	19	at	at	ADP
ahs-3127	61	20	662	662	NUM
ahs-3127	61	21	and	and	CCONJ
ahs-3127	61	22	644	644	NUM
ahs-3127	61	23	nm	nm	NOUN
ahs-3127	61	24	respectively	respectively	ADV
ahs-3127	61	25	.	.	PUNCT
ahs-3127	62	1	the	the	DET
ahs-3127	62	2	concentrations	concentration	NOUN
ahs-3127	62	3	of	of	ADP
ahs-3127	62	4	chlorophyll	chlorophyll	NOUN
ahs-3127	62	5	a	a	PRON
ahs-3127	62	6	and	and	CCONJ
ahs-3127	62	7	chlorophyll	chlorophyll	NOUN
ahs-3127	62	8	b	b	PROPN
ahs-3127	62	9	(	(	PUNCT
ahs-3127	62	10	μg	μg	PROPN
ahs-3127	62	11	.	.	PROPN
ahs-3127	62	12	g-1	g-1	PROPN
ahs-3127	62	13	fw	fw	PROPN
ahs-3127	62	14	)	)	PUNCT
ahs-3127	62	15	in	in	ADP
ahs-3127	62	16	leaf	leaf	NOUN
ahs-3127	62	17	tissues	tissue	NOUN
ahs-3127	62	18	were	be	AUX
ahs-3127	62	19	calculated	calculate	VERB
ahs-3127	62	20	using	use	VERB
ahs-3127	62	21	the	the	DET
ahs-3127	62	22	following	follow	VERB
ahs-3127	62	23	equations	equation	NOUN
ahs-3127	62	24	(	(	PUNCT
ahs-3127	62	25	cha	cha	X
ahs-3127	62	26	-	-	PUNCT
ahs-3127	62	27	um	um	INTJ
ahs-3127	62	28	et	et	PROPN
ahs-3127	62	29	al	al	PROPN
ahs-3127	62	30	.	.	PROPN
ahs-3127	62	31	,	,	PUNCT
ahs-3127	62	32	2006	2006	NUM
ahs-3127	62	33	):	):	PUNCT
ahs-3127	62	34	chlorophyll	chlorophyll	NOUN
ahs-3127	62	35	a=	a=	NOUN
ahs-3127	62	36	9.784*d	9.784*d	NOUN
ahs-3127	62	37	662	662	NUM
ahs-3127	62	38	0.99*d	0.99*d	NUM
ahs-3127	62	39	644	644	NUM
ahs-3127	62	40	chlorophyll	chlorophyll	NOUN
ahs-3127	62	41	b=	b=	NOUN
ahs-3127	62	42	21.426*d	21.426*d	NUM
ahs-3127	62	43	644	644	NUM
ahs-3127	62	44	4.65*d	4.65*d	NUM
ahs-3127	62	45	662	662	NUM
ahs-3127	62	46	where	where	SCONJ
ahs-3127	62	47	di	di	NOUN
ahs-3127	62	48	is	be	AUX
ahs-3127	62	49	an	an	DET
ahs-3127	62	50	optical	optical	ADJ
ahs-3127	62	51	density	density	NOUN
ahs-3127	62	52	at	at	ADP
ahs-3127	62	53	the	the	DET
ahs-3127	62	54	wavelength	wavelength	NOUN
ahs-3127	62	55	i.	i.	PROPN
ahs-3127	62	56	osmotic	osmotic	PROPN
ahs-3127	62	57	potential	potential	ADJ
ahs-3127	62	58	op	op	NOUN
ahs-3127	62	59	)	)	PUNCT
ahs-3127	62	60	and	and	CCONJ
ahs-3127	62	61	osmotic	osmotic	ADJ
ahs-3127	62	62	adjustment	adjustment	NOUN
ahs-3127	62	63	(	(	PUNCT
ahs-3127	62	64	oa	oa	PROPN
ahs-3127	62	65	)	)	PUNCT
ahs-3127	62	66	.	.	PUNCT
ahs-3127	63	1	osmometer	osmometer	VERB
ahs-3127	63	2	readings	reading	NOUN
ahs-3127	63	3	in	in	ADP
ahs-3127	63	4	mosm	mosm	NOUN
ahs-3127	63	5	/	/	SYM
ahs-3127	63	6	kg	kg	PROPN
ahs-3127	63	7	,	,	PUNCT
ahs-3127	63	8	were	be	AUX
ahs-3127	63	9	taken	take	VERB
ahs-3127	63	10	using	use	VERB
ahs-3127	63	11	the	the	DET
ahs-3127	63	12	freezing	freezing	ADJ
ahs-3127	63	13	point	point	NOUN
ahs-3127	63	14	osmometer	osmometer	NOUN
ahs-3127	63	15	,	,	PUNCT
ahs-3127	63	16	the	the	DET
ahs-3127	63	17	microosmoettetm	microosmoettetm	NOUN
ahs-3127	63	18	(	(	PUNCT
ahs-3127	63	19	precision	precision	PROPN
ahs-3127	63	20	systems	systems	PROPN
ahs-3127	63	21	inc	inc	PROPN
ahs-3127	63	22	.	.	PROPN
ahs-3127	63	23	,	,	PUNCT
ahs-3127	63	24	usa	usa	PROPN
ahs-3127	63	25	)	)	PUNCT
ahs-3127	63	26	.	.	PUNCT
ahs-3127	64	1	frozen	frozen	ADJ
ahs-3127	64	2	100	100	NUM
ahs-3127	64	3	mg	mg	ADP
ahs-3127	64	4	of	of	ADP
ahs-3127	64	5	leaf	leaf	NOUN
ahs-3127	64	6	samples	sample	NOUN
ahs-3127	64	7	in	in	ADP
ahs-3127	64	8	liquid	liquid	ADJ
ahs-3127	64	9	nitrogen	nitrogen	NOUN
ahs-3127	64	10	were	be	AUX
ahs-3127	64	11	ground	ground	NOUN
ahs-3127	64	12	(	(	PUNCT
ahs-3127	64	13	a	a	DET
ahs-3127	64	14	pool	pool	NOUN
ahs-3127	64	15	of	of	ADP
ahs-3127	64	16	three	three	NUM
ahs-3127	64	17	leaves	leave	NOUN
ahs-3127	64	18	per	per	ADP
ahs-3127	64	19	treatment	treatment	NOUN
ahs-3127	64	20	)	)	PUNCT
ahs-3127	64	21	.	.	PUNCT
ahs-3127	65	1	two	two	NUM
ahs-3127	65	2	milliliters	milliliter	NOUN
ahs-3127	65	3	of	of	ADP
ahs-3127	65	4	autoclaved	autoclaved	PROPN
ahs-3127	65	5	d.d	d.d	PROPN
ahs-3127	65	6	.	.	PROPN
ahs-3127	65	7	water	water	PROPN
ahs-3127	65	8	were	be	AUX
ahs-3127	65	9	added	add	VERB
ahs-3127	65	10	to	to	ADP
ahs-3127	65	11	each	each	DET
ahs-3127	65	12	sample	sample	NOUN
ahs-3127	65	13	and	and	CCONJ
ahs-3127	65	14	samples	sample	NOUN
ahs-3127	65	15	were	be	AUX
ahs-3127	65	16	vortexed	vortexe	VERB
ahs-3127	65	17	briefly	briefly	ADV
ahs-3127	65	18	and	and	CCONJ
ahs-3127	65	19	centrifuged	centrifuge	VERB
ahs-3127	65	20	for	for	ADP
ahs-3127	65	21	one	one	NUM
ahs-3127	65	22	minute	minute	NOUN
ahs-3127	65	23	at	at	ADP
ahs-3127	65	24	13000	13000	NUM
ahs-3127	65	25	rpm	rpm	NOUN
ahs-3127	65	26	.	.	PUNCT
ahs-3127	66	1	fifty	fifty	NUM
ahs-3127	66	2	microliters	microliter	NOUN
ahs-3127	66	3	of	of	ADP
ahs-3127	66	4	the	the	DET
ahs-3127	66	5	supernatant	supernatant	NOUN
ahs-3127	66	6	were	be	AUX
ahs-3127	66	7	used	use	VERB
ahs-3127	66	8	for	for	ADP
ahs-3127	66	9	each	each	DET
ahs-3127	66	10	reading	reading	NOUN
ahs-3127	66	11	.	.	PUNCT
ahs-3127	67	1	the	the	DET
ahs-3127	67	2	osmotic	osmotic	ADJ
ahs-3127	67	3	potential	potential	NOUN
ahs-3127	67	4	ψs	ψs	NOUN
ahs-3127	67	5	was	be	AUX
ahs-3127	67	6	calculated	calculate	VERB
ahs-3127	67	7	using	use	VERB
ahs-3127	67	8	the	the	DET
ahs-3127	67	9	following	follow	VERB
ahs-3127	67	10	formula	formula	NOUN
ahs-3127	67	11	:	:	PUNCT
ahs-3127	67	12	op	op	NOUN
ahs-3127	67	13	(	(	PUNCT
ahs-3127	67	14	mpa)=	mpa)=	PROPN
ahs-3127	67	15	{	{	PUNCT
ahs-3127	67	16	r	r	NOUN
ahs-3127	67	17	*	*	PUNCT
ahs-3127	67	18	t	t	NOUN
ahs-3127	67	19	*	*	PUNCT
ahs-3127	67	20	osmometer	osmometer	PROPN
ahs-3127	67	21	reading}/1000	reading}/1000	PROPN
ahs-3127	67	22	where	where	SCONJ
ahs-3127	67	23	r	r	NOUN
ahs-3127	67	24	is	be	AUX
ahs-3127	67	25	the	the	DET
ahs-3127	67	26	gas	gas	NOUN
ahs-3127	67	27	constant	constant	ADJ
ahs-3127	67	28	(	(	PUNCT
ahs-3127	67	29	0.008314	0.008314	NUM
ahs-3127	67	30	)	)	PUNCT
ahs-3127	67	31	,	,	PUNCT
ahs-3127	67	32	and	and	CCONJ
ahs-3127	67	33	t	t	PROPN
ahs-3127	67	34	is	be	AUX
ahs-3127	67	35	the	the	DET
ahs-3127	67	36	laboratory	laboratory	NOUN
ahs-3127	67	37	temperature	temperature	NOUN
ahs-3127	67	38	in	in	ADP
ahs-3127	67	39	kelvin	kelvin	PROPN
ahs-3127	67	40	(	(	PUNCT
ahs-3127	67	41	298	298	NUM
ahs-3127	67	42	)	)	PUNCT
ahs-3127	67	43	.	.	PUNCT
ahs-3127	68	1	the	the	DET
ahs-3127	68	2	osmotic	osmotic	ADJ
ahs-3127	68	3	adjustment	adjustment	NOUN
ahs-3127	68	4	(	(	PUNCT
ahs-3127	68	5	oa	oa	INTJ
ahs-3127	68	6	)	)	PUNCT
ahs-3127	68	7	was	be	AUX
ahs-3127	68	8	calculated	calculate	VERB
ahs-3127	68	9	as	as	ADP
ahs-3127	68	10	the	the	DET
ahs-3127	68	11	difference	difference	NOUN
ahs-3127	68	12	between	between	ADP
ahs-3127	68	13	the	the	DET
ahs-3127	68	14	osmotic	osmotic	ADJ
ahs-3127	68	15	potential	potential	NOUN
ahs-3127	68	16	of	of	ADP
ahs-3127	68	17	non	non	ADJ
ahs-3127	68	18	-	-	ADJ
ahs-3127	68	19	stressed	stressed	ADJ
ahs-3127	68	20	plants	plant	NOUN
ahs-3127	68	21	and	and	CCONJ
ahs-3127	68	22	the	the	DET
ahs-3127	68	23	water	water	NOUN
ahs-3127	68	24	stressed	stress	VERB
ahs-3127	68	25	plants	plant	NOUN
ahs-3127	68	26	.	.	PUNCT
ahs-3127	69	1	morphological	morphological	ADJ
ahs-3127	69	2	data	datum	NOUN
ahs-3127	69	3	twenty	twenty	NUM
ahs-3127	69	4	plants	plant	NOUN
ahs-3127	69	5	of	of	ADP
ahs-3127	69	6	each	each	DET
ahs-3127	69	7	replicate	replicate	NOUN
ahs-3127	69	8	were	be	AUX
ahs-3127	69	9	randomly	randomly	ADV
ahs-3127	69	10	tagged	tag	VERB
ahs-3127	69	11	and	and	CCONJ
ahs-3127	69	12	flowering	flower	VERB
ahs-3127	69	13	behavior	behavior	NOUN
ahs-3127	69	14	data	datum	NOUN
ahs-3127	69	15	for	for	ADP
ahs-3127	69	16	days	day	NOUN
ahs-3127	69	17	after	after	ADP
ahs-3127	69	18	planting	planting	NOUN
ahs-3127	69	19	(	(	PUNCT
ahs-3127	69	20	dap	dap	PROPN
ahs-3127	69	21	)	)	PUNCT
ahs-3127	69	22	were	be	AUX
ahs-3127	69	23	recorded	record	VERB
ahs-3127	69	24	such	such	ADJ
ahs-3127	69	25	as	as	ADP
ahs-3127	69	26	:	:	PUNCT
ahs-3127	69	27	first	first	ADJ
ahs-3127	69	28	floral	floral	ADJ
ahs-3127	69	29	bud	bud	ADJ
ahs-3127	69	30	emergence	emergence	NOUN
ahs-3127	69	31	,	,	PUNCT
ahs-3127	69	32	plant	plant	NOUN
ahs-3127	69	33	height	height	NOUN
ahs-3127	69	34	at	at	ADP
ahs-3127	69	35	first	first	ADJ
ahs-3127	69	36	flower	flower	NOUN
ahs-3127	69	37	,	,	PUNCT
ahs-3127	69	38	and	and	CCONJ
ahs-3127	69	39	nodes	node	NOUN
ahs-3127	69	40	above	above	ADP
ahs-3127	69	41	white	white	ADJ
ahs-3127	69	42	flower	flower	NOUN
ahs-3127	69	43	(	(	PUNCT
ahs-3127	69	44	nawf	nawf	PROPN
ahs-3127	69	45	)	)	PUNCT
ahs-3127	69	46	.	.	PUNCT
ahs-3127	70	1	the	the	DET
ahs-3127	70	2	percentage	percentage	NOUN
ahs-3127	70	3	of	of	ADP
ahs-3127	70	4	plants	plant	NOUN
ahs-3127	70	5	bearing	bear	VERB
ahs-3127	70	6	flowers	flower	NOUN
ahs-3127	70	7	and	and	CCONJ
ahs-3127	70	8	plants	plant	NOUN
ahs-3127	70	9	bearing	bear	VERB
ahs-3127	70	10	floral	floral	ADJ
ahs-3127	70	11	buds	bud	NOUN
ahs-3127	70	12	were	be	AUX
ahs-3127	70	13	recorded	record	VERB
ahs-3127	70	14	towards	towards	ADP
ahs-3127	70	15	end	end	NOUN
ahs-3127	70	16	of	of	ADP
ahs-3127	70	17	season	season	NOUN
ahs-3127	70	18	.	.	PUNCT
ahs-3127	71	1	end	end	NOUN
ahs-3127	71	2	of	of	ADP
ahs-3127	71	3	season	season	NOUN
ahs-3127	71	4	data	datum	NOUN
ahs-3127	71	5	also	also	ADV
ahs-3127	71	6	included	include	VERB
ahs-3127	71	7	:	:	PUNCT
ahs-3127	71	8	plant	plant	NOUN
ahs-3127	71	9	height	height	NOUN
ahs-3127	71	10	,	,	PUNCT
ahs-3127	71	11	root	root	NOUN
ahs-3127	71	12	depth	depth	NOUN
ahs-3127	71	13	(	(	PUNCT
ahs-3127	71	14	randomly	randomly	ADV
ahs-3127	71	15	selected	select	VERB
ahs-3127	71	16	plants	plant	NOUN
ahs-3127	71	17	from	from	ADP
ahs-3127	71	18	each	each	DET
ahs-3127	71	19	replicate	replicate	NOUN
ahs-3127	71	20	were	be	AUX
ahs-3127	71	21	carefully	carefully	ADV
ahs-3127	71	22	pulled	pull	VERB
ahs-3127	71	23	out	out	ADP
ahs-3127	71	24	of	of	ADP
ahs-3127	71	25	ground	ground	NOUN
ahs-3127	71	26	)	)	PUNCT
ahs-3127	71	27	,	,	PUNCT
ahs-3127	71	28	and	and	CCONJ
ahs-3127	71	29	number	number	NOUN
ahs-3127	71	30	of	of	ADP
ahs-3127	71	31	secondary	secondary	ADJ
ahs-3127	71	32	roots	root	NOUN
ahs-3127	71	33	.	.	PUNCT
ahs-3127	72	1	physical	physical	ADJ
ahs-3127	72	2	and	and	CCONJ
ahs-3127	72	3	chemical	chemical	NOUN
ahs-3127	72	4	fiber	fiber	NOUN
ahs-3127	72	5	properties	property	NOUN
ahs-3127	72	6	fiber	fiber	VERB
ahs-3127	72	7	quality	quality	NOUN
ahs-3127	72	8	testing	testing	NOUN
ahs-3127	72	9	.	.	PUNCT
ahs-3127	73	1	thirty	thirty	NUM
ahs-3127	73	2	bolls	boll	NOUN
ahs-3127	73	3	of	of	ADP
ahs-3127	73	4	each	each	DET
ahs-3127	73	5	replicate	replicate	NOUN
ahs-3127	73	6	were	be	AUX
ahs-3127	73	7	picked	pick	VERB
ahs-3127	73	8	and	and	CCONJ
ahs-3127	73	9	sent	send	VERB
ahs-3127	73	10	to	to	ADP
ahs-3127	73	11	the	the	DET
ahs-3127	73	12	fiber	fiber	NOUN
ahs-3127	73	13	quality	quality	NOUN
ahs-3127	73	14	lab	lab	NOUN
ahs-3127	73	15	at	at	ADP
ahs-3127	73	16	the	the	DET
ahs-3127	73	17	cotton	cotton	NOUN
ahs-3127	73	18	research	research	NOUN
ahs-3127	73	19	administration	administration	NOUN
ahs-3127	73	20	(	(	PUNCT
ahs-3127	73	21	cra	cra	PROPN
ahs-3127	73	22	)	)	PUNCT
ahs-3127	73	23	for	for	ADP
ahs-3127	73	24	testing	testing	NOUN
ahs-3127	73	25	:	:	PUNCT
ahs-3127	73	26	micronaire	micronaire	NOUN
ahs-3127	73	27	,	,	PUNCT
ahs-3127	73	28	fiber	fiber	NOUN
ahs-3127	73	29	length	length	NOUN
ahs-3127	73	30	,	,	PUNCT
ahs-3127	73	31	fiber	fiber	NOUN
ahs-3127	73	32	strength	strength	NOUN
ahs-3127	73	33	,	,	PUNCT
ahs-3127	73	34	fiber	fiber	NOUN
ahs-3127	73	35	cohesion	cohesion	NOUN
ahs-3127	73	36	,	,	PUNCT
ahs-3127	73	37	and	and	CCONJ
ahs-3127	73	38	ginning	gin	VERB
ahs-3127	73	39	percentage	percentage	NOUN
ahs-3127	73	40	.	.	PUNCT
ahs-3127	74	1	cra	cra	PROPN
ahs-3127	74	2	fiber	fiber	NOUN
ahs-3127	74	3	quality	quality	NOUN
ahs-3127	74	4	lab	lab	NOUN
ahs-3127	74	5	conducts	conduct	VERB
ahs-3127	74	6	its	its	PRON
ahs-3127	74	7	testing	testing	NOUN
ahs-3127	74	8	according	accord	VERB
ahs-3127	74	9	to	to	ADP
ahs-3127	74	10	the	the	DET
ahs-3127	74	11	international	international	ADJ
ahs-3127	74	12	testing	testing	NOUN
ahs-3127	74	13	standards	standard	NOUN
ahs-3127	74	14	with	with	ADP
ahs-3127	74	15	a	a	DET
ahs-3127	74	16	temperature	temperature	NOUN
ahs-3127	74	17	of	of	ADP
ahs-3127	74	18	22±2	22±2	NUM
ahs-3127	74	19	°	°	NOUN
ahs-3127	74	20	c	c	NOUN
ahs-3127	74	21	and	and	CCONJ
ahs-3127	74	22	relative	relative	ADJ
ahs-3127	74	23	humidity	humidity	NOUN
ahs-3127	74	24	of	of	ADP
ahs-3127	74	25	64%±4	64%±4	NUM
ahs-3127	74	26	%	%	NOUN
ahs-3127	74	27	.	.	PUNCT
ahs-3127	75	1	the	the	DET
ahs-3127	75	2	lab	lab	NOUN
ahs-3127	75	3	uses	use	VERB
ahs-3127	75	4	the	the	DET
ahs-3127	75	5	following	follow	VERB
ahs-3127	75	6	instruments	instrument	NOUN
ahs-3127	75	7	:	:	PUNCT
ahs-3127	75	8	micronaire	micronaire	VERB
ahs-3127	75	9	775	775	NUM
ahs-3127	75	10	,	,	PUNCT
ahs-3127	75	11	digital	digital	ADJ
ahs-3127	75	12	fibrograph	fibrograph	NOUN
ahs-3127	75	13	,	,	PUNCT
ahs-3127	75	14	pressley	pressley	NOUN
ahs-3127	75	15	tester	tester	NOUN
ahs-3127	75	16	and	and	CCONJ
ahs-3127	75	17	stelometer	stelometer	NOUN
ahs-3127	75	18	for	for	ADP
ahs-3127	75	19	fiber	fiber	NOUN
ahs-3127	75	20	testing	testing	NOUN
ahs-3127	75	21	.	.	PUNCT
ahs-3127	76	1	fourier	fourier	PROPN
ahs-3127	76	2	transform	transform	VERB
ahs-3127	76	3	infrared	infrared	ADJ
ahs-3127	76	4	(	(	PUNCT
ahs-3127	76	5	ftir	ftir	PROPN
ahs-3127	76	6	)	)	PUNCT
ahs-3127	76	7	acquisition	acquisition	NOUN
ahs-3127	76	8	spectra	spectra	NOUN
ahs-3127	76	9	of	of	ADP
ahs-3127	76	10	cotton	cotton	NOUN
ahs-3127	76	11	fiber	fiber	NOUN
ahs-3127	76	12	ftir	ftir	PROPN
ahs-3127	76	13	was	be	AUX
ahs-3127	76	14	conducted	conduct	VERB
ahs-3127	76	15	to	to	PART
ahs-3127	76	16	study	study	VERB
ahs-3127	76	17	the	the	DET
ahs-3127	76	18	chemical	chemical	NOUN
ahs-3127	76	19	variance	variance	NOUN
ahs-3127	76	20	,	,	PUNCT
ahs-3127	76	21	if	if	SCONJ
ahs-3127	76	22	any	any	PRON
ahs-3127	76	23	,	,	PUNCT
ahs-3127	76	24	between	between	ADP
ahs-3127	76	25	fibers	fiber	NOUN
ahs-3127	76	26	from	from	ADP
ahs-3127	76	27	control	control	NOUN
ahs-3127	76	28	and	and	CCONJ
ahs-3127	76	29	treated	treat	VERB
ahs-3127	76	30	plants	plant	NOUN
ahs-3127	76	31	of	of	ADP
ahs-3127	76	32	the	the	DET
ahs-3127	76	33	two	two	NUM
ahs-3127	76	34	studied	study	VERB
ahs-3127	76	35	cultivars	cultivar	NOUN
ahs-3127	76	36	.	.	PUNCT
ahs-3127	77	1	the	the	DET
ahs-3127	77	2	infrared	infrared	ADJ
ahs-3127	77	3	spectra	spectra	NOUN
ahs-3127	77	4	were	be	AUX
ahs-3127	77	5	recorded	record	VERB
ahs-3127	77	6	on	on	ADP
ahs-3127	77	7	nicolet	nicolet	PROPN
ahs-3127	77	8	6700	6700	NUM
ahs-3127	77	9	in	in	ADP
ahs-3127	77	10	the	the	DET
ahs-3127	77	11	range	range	NOUN
ahs-3127	77	12	4000	4000	NUM
ahs-3127	77	13	to	to	ADP
ahs-3127	77	14	400	400	NUM
ahs-3127	77	15	cm-1	cm-1	NOUN
ahs-3127	77	16	with	with	ADP
ahs-3127	77	17	a	a	DET
ahs-3127	77	18	resolution	resolution	NOUN
ahs-3127	77	19	of	of	ADP
ahs-3127	77	20	4	4	NUM
ahs-3127	77	21	cm-1	cm-1	NOUN
ahs-3127	77	22	at	at	ADP
ahs-3127	77	23	32	32	NUM
ahs-3127	77	24	scans	scan	NOUN
ahs-3127	77	25	as	as	ADP
ahs-3127	77	26	direct	direct	ADJ
ahs-3127	77	27	measurements	measurement	NOUN
ahs-3127	77	28	of	of	ADP
ahs-3127	77	29	the	the	DET
ahs-3127	77	30	cotton	cotton	NOUN
ahs-3127	77	31	fibers	fiber	NOUN
ahs-3127	77	32	(	(	PUNCT
ahs-3127	77	33	three	three	NUM
ahs-3127	77	34	replicates	replicate	NOUN
ahs-3127	77	35	per	per	ADP
ahs-3127	77	36	treatment	treatment	NOUN
ahs-3127	77	37	)	)	PUNCT
ahs-3127	77	38	samples	sample	NOUN
ahs-3127	77	39	using	use	VERB
ahs-3127	77	40	universal	universal	ADJ
ahs-3127	77	41	attenuated	attenuate	VERB
ahs-3127	77	42	total	total	ADJ
ahs-3127	77	43	reflectance	reflectance	NOUN
ahs-3127	77	44	technique	technique	NOUN
ahs-3127	77	45	ftir	ftir	NOUN
ahs-3127	77	46	-	-	NOUN
ahs-3127	77	47	atr	atr	PROPN
ahs-3127	77	48	with	with	ADP
ahs-3127	77	49	krs-5	krs-5	ADJ
ahs-3127	77	50	crystals	crystal	NOUN
ahs-3127	77	51	.	.	PUNCT
ahs-3127	78	1	the	the	DET
ahs-3127	78	2	instrument	instrument	NOUN
ahs-3127	78	3	is	be	AUX
ahs-3127	78	4	equipped	equip	VERB
ahs-3127	78	5	with	with	ADP
ahs-3127	78	6	dtgs	dtgs	ADJ
ahs-3127	78	7	detector	detector	NOUN
ahs-3127	78	8	and	and	CCONJ
ahs-3127	78	9	kbr	kbr	PROPN
ahs-3127	78	10	beam	beam	NOUN
ahs-3127	78	11	splitter	splitter	NOUN
ahs-3127	78	12	.	.	PUNCT
ahs-3127	79	1	the	the	DET
ahs-3127	79	2	operating	operate	VERB
ahs-3127	79	3	system	system	NOUN
ahs-3127	79	4	used	use	VERB
ahs-3127	79	5	was	be	AUX
ahs-3127	79	6	the	the	DET
ahs-3127	79	7	omnic	omnic	ADJ
ahs-3127	79	8	software	software	NOUN
ahs-3127	79	9	(	(	PUNCT
ahs-3127	79	10	version	version	NOUN
ahs-3127	79	11	7.3	7.3	NUM
ahs-3127	79	12	,	,	PUNCT
ahs-3127	79	13	thermo	thermo	NOUN
ahs-3127	79	14	nicolet	nicolet	NOUN
ahs-3127	79	15	,	,	PUNCT
ahs-3127	79	16	usa	usa	PROPN
ahs-3127	79	17	)	)	PUNCT
ahs-3127	79	18	.	.	PUNCT
ahs-3127	80	1	the	the	DET
ahs-3127	80	2	infrared	infrared	ADJ
ahs-3127	80	3	spectra	spectra	NOUN
ahs-3127	80	4	of	of	ADP
ahs-3127	80	5	fiber	fiber	NOUN
ahs-3127	80	6	samples	sample	NOUN
ahs-3127	80	7	for	for	ADP
ahs-3127	80	8	control	control	NOUN
ahs-3127	80	9	and	and	CCONJ
ahs-3127	80	10	treated	treat	VERB
ahs-3127	80	11	plants	plant	NOUN
ahs-3127	80	12	of	of	ADP
ahs-3127	80	13	aleppo	aleppo	PROPN
ahs-3127	80	14	118	118	NUM
ahs-3127	80	15	and	and	CCONJ
ahs-3127	80	16	deir	deir	PROPN
ahs-3127	80	17	al	al	PROPN
ahs-3127	80	18	zour	zour	PROPN
ahs-3127	80	19	22	22	NUM
ahs-3127	80	20	cultivars	cultivar	NOUN
ahs-3127	80	21	were	be	AUX
ahs-3127	80	22	recorded	record	VERB
ahs-3127	80	23	.	.	PUNCT
ahs-3127	81	1	the	the	DET
ahs-3127	81	2	recorded	record	VERB
ahs-3127	81	3	spectra	spectra	NOUN
ahs-3127	81	4	were	be	AUX
ahs-3127	81	5	repeated	repeat	VERB
ahs-3127	81	6	three	three	NUM
ahs-3127	81	7	times	time	NOUN
ahs-3127	81	8	for	for	ADP
ahs-3127	81	9	each	each	DET
ahs-3127	81	10	investigated	investigate	VERB
ahs-3127	81	11	sample	sample	NOUN
ahs-3127	81	12	.	.	PUNCT
ahs-3127	82	1	measurement	measurement	NOUN
ahs-3127	82	2	of	of	ADP
ahs-3127	82	3	crystallinity	crystallinity	NOUN
ahs-3127	82	4	by	by	ADP
ahs-3127	82	5	conventional	conventional	ADJ
ahs-3127	82	6	x	x	NOUN
ahs-3127	82	7	-	-	NOUN
ahs-3127	82	8	ray	ray	NOUN
ahs-3127	82	9	powder	powder	NOUN
ahs-3127	82	10	diffractometry	diffractometry	NOUN
ahs-3127	82	11	(	(	PUNCT
ahs-3127	82	12	xrd	xrd	PROPN
ahs-3127	82	13	)	)	PUNCT
ahs-3127	82	14	xrd	xrd	NOUN
ahs-3127	82	15	was	be	AUX
ahs-3127	82	16	applied	apply	VERB
ahs-3127	82	17	to	to	PART
ahs-3127	82	18	determine	determine	VERB
ahs-3127	82	19	the	the	DET
ahs-3127	82	20	crystallinity	crystallinity	NOUN
ahs-3127	82	21	of	of	ADP
ahs-3127	82	22	fiber	fiber	NOUN
ahs-3127	82	23	samples	sample	NOUN
ahs-3127	82	24	from	from	ADP
ahs-3127	82	25	control	control	NOUN
ahs-3127	82	26	and	and	CCONJ
ahs-3127	82	27	treated	treat	VERB
ahs-3127	82	28	plants	plant	NOUN
ahs-3127	82	29	of	of	ADP
ahs-3127	82	30	‘	'	PUNCT
ahs-3127	82	31	aleppo	aleppo	PROPN
ahs-3127	82	32	118	118	NUM
ahs-3127	82	33	’	'	PUNCT
ahs-3127	82	34	and	and	CCONJ
ahs-3127	82	35	‘	'	PUNCT
ahs-3127	82	36	deir	deir	PROPN
ahs-3127	82	37	al	al	PROPN
ahs-3127	82	38	-	-	PROPN
ahs-3127	82	39	zour	zour	ADJ
ahs-3127	82	40	22	22	NUM
ahs-3127	82	41	’	'	PUNCT
ahs-3127	82	42	samples	sample	NOUN
ahs-3127	82	43	.	.	PUNCT
ahs-3127	83	1	x	x	X
ahs-3127	83	2	-	-	PUNCT
ahs-3127	83	3	ray	ray	NOUN
ahs-3127	83	4	powder	powder	NOUN
ahs-3127	83	5	diffraction	diffraction	NOUN
ahs-3127	83	6	patterns	pattern	NOUN
ahs-3127	83	7	were	be	AUX
ahs-3127	83	8	obtained	obtain	VERB
ahs-3127	83	9	on	on	ADP
ahs-3127	83	10	a	a	DET
ahs-3127	83	11	stoe	stoe	NOUN
ahs-3127	83	12	transmission	transmission	NOUN
ahs-3127	83	13	stadi	stadi	NOUN
ahs-3127	83	14	-	-	PUNCT
ahs-3127	83	15	p	p	NOUN
ahs-3127	83	16	diffractometer	diffractometer	NOUN
ahs-3127	83	17	with	with	ADP
ahs-3127	83	18	monochromatic	monochromatic	ADJ
ahs-3127	83	19	cu	cu	PROPN
ahs-3127	83	20	kα1	kα1	PROPN
ahs-3127	83	21	radiation	radiation	NOUN
ahs-3127	83	22	(	(	PUNCT
ahs-3127	83	23	λ	λ	X
ahs-3127	83	24	=	=	SYM
ahs-3127	83	25	1.5406	1.5406	NUM
ahs-3127	83	26	å	å	NOUN
ahs-3127	83	27	)	)	PUNCT
ahs-3127	83	28	selected	select	VERB
ahs-3127	83	29	using	use	VERB
ahs-3127	83	30	an	an	DET
ahs-3127	83	31	incident	incident	NOUN
ahs-3127	83	32	-	-	PUNCT
ahs-3127	83	33	beam	beam	NOUN
ahs-3127	83	34	curved	curve	VERB
ahs-3127	83	35	-	-	PUNCT
ahs-3127	83	36	crystal	crystal	NOUN
ahs-3127	83	37	germanium	germanium	NOUN
ahs-3127	83	38	ge	ge	PROPN
ahs-3127	83	39	(	(	PUNCT
ahs-3127	83	40	111	111	NUM
ahs-3127	83	41	)	)	PUNCT
ahs-3127	83	42	monochromator	monochromator	NOUN
ahs-3127	83	43	,	,	PUNCT
ahs-3127	83	44	with	with	ADP
ahs-3127	83	45	the	the	DET
ahs-3127	83	46	stoe	stoe	PROPN
ahs-3127	83	47	transmission	transmission	NOUN
ahs-3127	83	48	geometry	geometry	NOUN
ahs-3127	83	49	(	(	PUNCT
ahs-3127	83	50	horizontal	horizontal	ADJ
ahs-3127	83	51	set	set	NOUN
ahs-3127	83	52	-	-	PUNCT
ahs-3127	83	53	up	up	NOUN
ahs-3127	83	54	)	)	PUNCT
ahs-3127	83	55	and	and	CCONJ
ahs-3127	83	56	a	a	DET
ahs-3127	83	57	linear	linear	ADJ
ahs-3127	83	58	position	position	NOUN
ahs-3127	83	59	-	-	PUNCT
ahs-3127	83	60	sensitive	sensitive	ADJ
ahs-3127	83	61	detector	detector	NOUN
ahs-3127	83	62	(	(	PUNCT
ahs-3127	83	63	psd	psd	PROPN
ahs-3127	83	64	)	)	PUNCT
ahs-3127	83	65	.	.	PUNCT
ahs-3127	84	1	the	the	DET
ahs-3127	84	2	determination	determination	NOUN
ahs-3127	84	3	of	of	ADP
ahs-3127	84	4	crystallinity	crystallinity	NOUN
ahs-3127	84	5	of	of	ADP
ahs-3127	84	6	the	the	DET
ahs-3127	84	7	samples	sample	NOUN
ahs-3127	84	8	was	be	AUX
ahs-3127	84	9	performed	perform	VERB
ahs-3127	84	10	with	with	ADP
ahs-3127	84	11	the	the	DET
ahs-3127	84	12	program	program	NOUN
ahs-3127	84	13	winxpow	winxpow	NOUN
ahs-3127	84	14	(	(	PUNCT
ahs-3127	84	15	stoe	stoe	NOUN
ahs-3127	84	16	and	and	CCONJ
ahs-3127	84	17	cie	cie	PROPN
ahs-3127	84	18	,	,	PUNCT
ahs-3127	84	19	1999	1999	NUM
ahs-3127	84	20	)	)	PUNCT
ahs-3127	84	21	using	use	VERB
ahs-3127	84	22	single	single	ADJ
ahs-3127	84	23	-	-	PUNCT
ahs-3127	84	24	sample	sample	NOUN
ahs-3127	84	25	method	method	NOUN
ahs-3127	84	26	.	.	PUNCT
ahs-3127	85	1	this	this	DET
ahs-3127	85	2	method	method	NOUN
ahs-3127	85	3	requires	require	VERB
ahs-3127	85	4	defining	define	VERB
ahs-3127	85	5	the	the	DET
ahs-3127	85	6	portions	portion	NOUN
ahs-3127	85	7	of	of	ADP
ahs-3127	85	8	the	the	DET
ahs-3127	85	9	diagram	diagram	NOUN
ahs-3127	85	10	due	due	ADP
ahs-3127	85	11	to	to	ADP
ahs-3127	85	12	air	air	NOUN
ahs-3127	85	13	scatter	scatter	NOUN
ahs-3127	85	14	and	and	CCONJ
ahs-3127	85	15	inelastic	inelastic	ADJ
ahs-3127	85	16	scattering	scattering	NOUN
ahs-3127	85	17	,	,	PUNCT
ahs-3127	85	18	amorphous	amorphous	ADJ
ahs-3127	85	19	scattering	scattering	NOUN
ahs-3127	85	20	and	and	CCONJ
ahs-3127	85	21	bragg	bragg	PROPN
ahs-3127	85	22	or	or	CCONJ
ahs-3127	85	23	crystal	crystal	NOUN
ahs-3127	85	24	scattering	scattering	NOUN
ahs-3127	85	25	.	.	PUNCT
ahs-3127	86	1	if	if	SCONJ
ahs-3127	86	2	ic(2q	ic(2q	NUM
ahs-3127	86	3	)	)	PUNCT
ahs-3127	86	4	and	and	CCONJ
ahs-3127	86	5	ia(2q	ia(2q	NOUN
ahs-3127	86	6	)	)	PUNCT
ahs-3127	86	7	are	be	AUX
ahs-3127	86	8	known	know	VERB
ahs-3127	86	9	for	for	ADP
ahs-3127	86	10	the	the	DET
ahs-3127	86	11	whole	whole	ADJ
ahs-3127	86	12	diagram	diagram	NOUN
ahs-3127	86	13	,	,	PUNCT
ahs-3127	86	14	the	the	DET
ahs-3127	86	15	crystallinity	crystallinity	NOUN
ahs-3127	86	16	index	index	NOUN
ahs-3127	86	17	is	be	AUX
ahs-3127	86	18	calculated	calculate	VERB
ahs-3127	86	19	from	from	ADP
ahs-3127	86	20	the	the	DET
ahs-3127	86	21	relation	relation	NOUN
ahs-3127	86	22	:	:	PUNCT
ahs-3127	86	23	xc=(∑ic(2θ)⁄(lp∙f∙t)⁄(∑[(ic	xc=(∑ic(2θ)⁄(lp∙f∙t)⁄(∑[(ic	PROPN
ahs-3127	87	1	(	(	PUNCT
ahs-3127	87	2	2θ)⁄t+ia	2θ)⁄t+ia	NUM
ahs-3127	87	3	(	(	PUNCT
ahs-3127	87	4	2θ)]⁄(lp∙f	2θ)]⁄(lp∙f	NUM
ahs-3127	87	5	)	)	PUNCT
ahs-3127	87	6	eq	eq	NOUN
ahs-3127	87	7	.	.	PROPN
ahs-3127	87	8	1	1	NUM
ahs-3127	87	9	adv	adv	PROPN
ahs-3127	87	10	.	.	PUNCT
ahs-3127	87	11	hort	hort	PROPN
ahs-3127	87	12	.	.	PUNCT
ahs-3127	88	1	sci	sci	PROPN
ahs-3127	88	2	.	.	PROPN
ahs-3127	88	3	,	,	PUNCT
ahs-3127	88	4	2018	2018	NUM
ahs-3127	88	5	32(1	32(1	NUM
ahs-3127	88	6	):	):	PUNCT
ahs-3127	88	7	79	79	NUM
ahs-3127	88	8	-	-	SYM
ahs-3127	88	9	92	92	NUM
ahs-3127	88	10	82	82	NUM
ahs-3127	88	11	the	the	DET
ahs-3127	88	12	summing	summing	NOUN
ahs-3127	88	13	is	be	AUX
ahs-3127	88	14	over	over	ADP
ahs-3127	88	15	bragg	bragg	PROPN
ahs-3127	88	16	angle	angle	NOUN
ahs-3127	88	17	(	(	PUNCT
ahs-3127	88	18	2q	2q	NUM
ahs-3127	88	19	)	)	PUNCT
ahs-3127	88	20	.	.	PUNCT
ahs-3127	89	1	the	the	DET
ahs-3127	89	2	lorentz	lorentz	PROPN
ahs-3127	89	3	-	-	PUNCT
ahs-3127	89	4	polarization	polarization	NOUN
ahs-3127	89	5	factor	factor	NOUN
ahs-3127	89	6	lp	lp	NOUN
ahs-3127	89	7	,	,	PUNCT
ahs-3127	89	8	the	the	DET
ahs-3127	89	9	average	average	ADJ
ahs-3127	89	10	form	form	NOUN
ahs-3127	89	11	factor	factor	NOUN
ahs-3127	89	12	f	f	PROPN
ahs-3127	89	13	and	and	CCONJ
ahs-3127	89	14	the	the	DET
ahs-3127	89	15	temperature	temperature	NOUN
ahs-3127	89	16	factor	factor	NOUN
ahs-3127	89	17	t	t	PROPN
ahs-3127	89	18	are	be	AUX
ahs-3127	89	19	all	all	ADV
ahs-3127	89	20	2q	2q	NUM
ahs-3127	89	21	-	-	PUNCT
ahs-3127	89	22	dependent	dependent	ADJ
ahs-3127	89	23	functions	function	NOUN
ahs-3127	89	24	:	:	PUNCT
ahs-3127	89	25	lp(2θ)=	lp(2θ)=	NOUN
ahs-3127	89	26	1	1	NUM
ahs-3127	89	27	+	+	NUM
ahs-3127	89	28	cos2	cos2	NOUN
ahs-3127	89	29	(	(	PUNCT
ahs-3127	89	30	2θ	2θ	NUM
ahs-3127	89	31	)	)	PUNCT
ahs-3127	90	1	⁄	⁄	PROPN
ahs-3127	90	2	(	(	PUNCT
ahs-3127	90	3	sin2	sin2	NOUN
ahs-3127	90	4	(	(	PUNCT
ahs-3127	90	5	2θ	2θ	NUM
ahs-3127	90	6	)	)	PUNCT
ahs-3127	91	1	cosθ	cosθ	NOUN
ahs-3127	91	2	eq	eq	NOUN
ahs-3127	91	3	.	.	PROPN
ahs-3127	91	4	2	2	NUM
ahs-3127	91	5	f(2θ)=	f(2θ)=	NOUN
ahs-3127	91	6	∑f	∑f	PROPN
ahs-3127	91	7	(	(	PUNCT
ahs-3127	91	8	n	n	CCONJ
ahs-3127	91	9	,	,	PUNCT
ahs-3127	91	10	2θ	2θ	NUM
ahs-3127	91	11	)	)	PUNCT
ahs-3127	91	12	eq	eq	NOUN
ahs-3127	91	13	.	.	PROPN
ahs-3127	91	14	3	3	NUM
ahs-3127	91	15	t(2θ)=	t(2θ)=	NOUN
ahs-3127	91	16	exp(-2b	exp(-2b	X
ahs-3127	91	17	sin22θ	sin22θ	NOUN
ahs-3127	91	18	)	)	PUNCT
ahs-3127	91	19	⁄	⁄	ADP
ahs-3127	91	20	λ2	λ2	NOUN
ahs-3127	91	21	)	)	PUNCT
ahs-3127	91	22	eq	eq	NOUN
ahs-3127	91	23	.	.	PROPN
ahs-3127	91	24	4	4	NUM
ahs-3127	91	25	the	the	DET
ahs-3127	91	26	summing	summing	NOUN
ahs-3127	91	27	in	in	ADP
ahs-3127	91	28	eq	eq	NOUN
ahs-3127	91	29	.	.	PROPN
ahs-3127	91	30	3	3	NUM
ahs-3127	91	31	is	be	AUX
ahs-3127	91	32	over	over	ADP
ahs-3127	91	33	all	all	DET
ahs-3127	91	34	atoms	atom	NOUN
ahs-3127	91	35	in	in	ADP
ahs-3127	91	36	the	the	DET
ahs-3127	91	37	formula	formula	NOUN
ahs-3127	91	38	unit	unit	NOUN
ahs-3127	91	39	.	.	PUNCT
ahs-3127	92	1	the	the	DET
ahs-3127	92	2	sample	sample	NOUN
ahs-3127	92	3	’s	’s	PART
ahs-3127	92	4	overall	overall	ADJ
ahs-3127	92	5	formula	formula	NOUN
ahs-3127	92	6	and	and	CCONJ
ahs-3127	92	7	average	average	ADJ
ahs-3127	92	8	temperature	temperature	NOUN
ahs-3127	92	9	factor	factor	NOUN
ahs-3127	92	10	(	(	PUNCT
ahs-3127	92	11	b	b	NOUN
ahs-3127	92	12	)	)	PUNCT
ahs-3127	92	13	have	have	VERB
ahs-3127	92	14	to	to	PART
ahs-3127	92	15	be	be	AUX
ahs-3127	92	16	known	know	VERB
ahs-3127	92	17	in	in	ADP
ahs-3127	92	18	order	order	NOUN
ahs-3127	92	19	to	to	PART
ahs-3127	92	20	be	be	AUX
ahs-3127	92	21	able	able	ADJ
ahs-3127	92	22	to	to	PART
ahs-3127	92	23	apply	apply	VERB
ahs-3127	92	24	this	this	DET
ahs-3127	92	25	method	method	NOUN
ahs-3127	92	26	.	.	PUNCT
ahs-3127	93	1	it	it	PRON
ahs-3127	93	2	’s	’	VERB
ahs-3127	93	3	noteworthy	noteworthy	ADJ
ahs-3127	93	4	to	to	PART
ahs-3127	93	5	mention	mention	VERB
ahs-3127	93	6	that	that	PRON
ahs-3127	93	7	sample	sample	NOUN
ahs-3127	93	8	absorption	absorption	NOUN
ahs-3127	93	9	is	be	AUX
ahs-3127	93	10	always	always	ADV
ahs-3127	93	11	neglected	neglect	VERB
ahs-3127	93	12	;	;	PUNCT
ahs-3127	93	13	therefore	therefore	ADV
ahs-3127	93	14	,	,	PUNCT
ahs-3127	93	15	this	this	DET
ahs-3127	93	16	method	method	NOUN
ahs-3127	93	17	works	work	VERB
ahs-3127	93	18	well	well	ADV
ahs-3127	93	19	for	for	ADP
ahs-3127	93	20	transmission	transmission	NOUN
ahs-3127	93	21	data	datum	NOUN
ahs-3127	93	22	of	of	ADP
ahs-3127	93	23	organic	organic	ADJ
ahs-3127	93	24	samples	sample	NOUN
ahs-3127	93	25	within	within	ADP
ahs-3127	93	26	±	±	NUM
ahs-3127	93	27	3	3	NUM
ahs-3127	93	28	%	%	NOUN
ahs-3127	93	29	error	error	NOUN
ahs-3127	93	30	of	of	ADP
ahs-3127	93	31	the	the	DET
ahs-3127	93	32	true	true	ADJ
ahs-3127	93	33	crystallinity	crystallinity	NOUN
ahs-3127	93	34	.	.	PUNCT
ahs-3127	94	1	the	the	DET
ahs-3127	94	2	formula	formula	NOUN
ahs-3127	94	3	of	of	ADP
ahs-3127	94	4	cellulose	cellulose	NOUN
ahs-3127	94	5	(	(	PUNCT
ahs-3127	94	6	c6h12o5	c6h12o5	PROPN
ahs-3127	94	7	)	)	PUNCT
ahs-3127	94	8	and	and	CCONJ
ahs-3127	94	9	b	b	X
ahs-3127	94	10	=	=	SYM
ahs-3127	94	11	4.0	4.0	NUM
ahs-3127	94	12	å2	å2	NOUN
ahs-3127	94	13	was	be	AUX
ahs-3127	94	14	used	use	VERB
ahs-3127	94	15	for	for	ADP
ahs-3127	94	16	our	our	PRON
ahs-3127	94	17	cotton	cotton	NOUN
ahs-3127	94	18	fiber	fiber	NOUN
ahs-3127	94	19	samples	sample	NOUN
ahs-3127	94	20	.	.	PUNCT
ahs-3127	95	1	thermogravimetry	thermogravimetry	NOUN
ahs-3127	95	2	analysis	analysis	NOUN
ahs-3127	95	3	(	(	PUNCT
ahs-3127	95	4	tga	tga	NOUN
ahs-3127	95	5	)	)	PUNCT
ahs-3127	95	6	and	and	CCONJ
ahs-3127	95	7	differential	differential	NOUN
ahs-3127	95	8	scanning	scanning	NOUN
ahs-3127	95	9	calorimetry	calorimetry	NOUN
ahs-3127	95	10	(	(	PUNCT
ahs-3127	95	11	dsc	dsc	NOUN
ahs-3127	95	12	)	)	PUNCT
ahs-3127	95	13	the	the	DET
ahs-3127	95	14	dynamic	dynamic	ADJ
ahs-3127	95	15	weight	weight	NOUN
ahs-3127	95	16	loss	loss	NOUN
ahs-3127	95	17	of	of	ADP
ahs-3127	95	18	fiber	fiber	NOUN
ahs-3127	95	19	samples	sample	NOUN
ahs-3127	95	20	as	as	ADP
ahs-3127	95	21	a	a	DET
ahs-3127	95	22	function	function	NOUN
ahs-3127	95	23	of	of	ADP
ahs-3127	95	24	increasing	increase	VERB
ahs-3127	95	25	temperature	temperature	NOUN
ahs-3127	95	26	tests	test	NOUN
ahs-3127	95	27	were	be	AUX
ahs-3127	95	28	conducted	conduct	VERB
ahs-3127	95	29	using	use	VERB
ahs-3127	95	30	a	a	DET
ahs-3127	95	31	mettler	mettler	ADJ
ahs-3127	95	32	instrument	instrument	NOUN
ahs-3127	95	33	(	(	PUNCT
ahs-3127	95	34	tg50	tg50	PROPN
ahs-3127	95	35	)	)	PUNCT
ahs-3127	95	36	.	.	PUNCT
ahs-3127	96	1	the	the	DET
ahs-3127	96	2	tests	test	NOUN
ahs-3127	96	3	were	be	AUX
ahs-3127	96	4	carried	carry	VERB
ahs-3127	96	5	out	out	ADP
ahs-3127	96	6	in	in	ADP
ahs-3127	96	7	a	a	DET
ahs-3127	96	8	nitrogen	nitrogen	NOUN
ahs-3127	96	9	atmosphere	atmosphere	NOUN
ahs-3127	96	10	,	,	PUNCT
ahs-3127	96	11	purged	purge	VERB
ahs-3127	96	12	(	(	PUNCT
ahs-3127	96	13	30	30	NUM
ahs-3127	96	14	ml	ml	NOUN
ahs-3127	96	15	/	/	SYM
ahs-3127	96	16	min	min	NOUN
ahs-3127	96	17	)	)	PUNCT
ahs-3127	96	18	using	use	VERB
ahs-3127	96	19	sample	sample	NOUN
ahs-3127	96	20	weights	weight	NOUN
ahs-3127	96	21	of	of	ADP
ahs-3127	96	22	10	10	NUM
ahs-3127	96	23	-	-	SYM
ahs-3127	96	24	15	15	NUM
ahs-3127	96	25	mg	mg	NOUN
ahs-3127	96	26	at	at	ADP
ahs-3127	96	27	a	a	DET
ahs-3127	96	28	heating	heating	NOUN
ahs-3127	96	29	rate	rate	NOUN
ahs-3127	96	30	of	of	ADP
ahs-3127	96	31	10oc	10oc	PROPN
ahs-3127	96	32	/	/	SYM
ahs-3127	96	33	min	min	NOUN
ahs-3127	96	34	.	.	PUNCT
ahs-3127	97	1	the	the	DET
ahs-3127	97	2	resolution	resolution	NOUN
ahs-3127	97	3	of	of	ADP
ahs-3127	97	4	the	the	DET
ahs-3127	97	5	balance	balance	NOUN
ahs-3127	97	6	is	be	AUX
ahs-3127	97	7	given	give	VERB
ahs-3127	97	8	,	,	PUNCT
ahs-3127	97	9	as	as	ADP
ahs-3127	97	10	1	1	NUM
ahs-3127	97	11	microgram	microgram	NOUN
ahs-3127	97	12	for	for	ADP
ahs-3127	97	13	weights	weight	NOUN
ahs-3127	97	14	less	less	ADJ
ahs-3127	97	15	than	than	ADP
ahs-3127	97	16	100	100	NUM
ahs-3127	97	17	milligrams	milligram	NOUN
ahs-3127	97	18	,	,	PUNCT
ahs-3127	97	19	and	and	CCONJ
ahs-3127	97	20	the	the	DET
ahs-3127	97	21	temperature	temperature	NOUN
ahs-3127	97	22	precision	precision	NOUN
ahs-3127	97	23	of	of	ADP
ahs-3127	97	24	the	the	DET
ahs-3127	97	25	instrument	instrument	NOUN
ahs-3127	97	26	is	be	AUX
ahs-3127	97	27	±	±	NUM
ahs-3127	97	28	2oc	2oc	NOUN
ahs-3127	97	29	.	.	PUNCT
ahs-3127	98	1	dsc	dsc	PROPN
ahs-3127	98	2	was	be	AUX
ahs-3127	98	3	used	use	VERB
ahs-3127	98	4	to	to	PART
ahs-3127	98	5	determine	determine	VERB
ahs-3127	98	6	the	the	DET
ahs-3127	98	7	glass	glass	NOUN
ahs-3127	98	8	transition	transition	NOUN
ahs-3127	98	9	temperatures	temperature	NOUN
ahs-3127	98	10	of	of	ADP
ahs-3127	98	11	the	the	DET
ahs-3127	98	12	prepared	prepare	VERB
ahs-3127	98	13	samples	sample	NOUN
ahs-3127	98	14	.	.	PUNCT
ahs-3127	99	1	a	a	DET
ahs-3127	99	2	mettler	mettler	PROPN
ahs-3127	99	3	instrument	instrument	NOUN
ahs-3127	99	4	(	(	PUNCT
ahs-3127	99	5	dsc20	dsc20	PROPN
ahs-3127	99	6	)	)	PUNCT
ahs-3127	99	7	was	be	AUX
ahs-3127	99	8	utilized	utilize	VERB
ahs-3127	99	9	to	to	PART
ahs-3127	99	10	record	record	VERB
ahs-3127	99	11	the	the	DET
ahs-3127	99	12	dsc	dsc	NOUN
ahs-3127	99	13	spectra	spectra	NOUN
ahs-3127	99	14	.	.	PUNCT
ahs-3127	100	1	all	all	DET
ahs-3127	100	2	samples	sample	NOUN
ahs-3127	100	3	were	be	AUX
ahs-3127	100	4	tested	test	VERB
ahs-3127	100	5	in	in	ADP
ahs-3127	100	6	aluminum	aluminum	NOUN
ahs-3127	100	7	pans	pan	NOUN
ahs-3127	100	8	at	at	ADP
ahs-3127	100	9	a	a	DET
ahs-3127	100	10	heating	heating	NOUN
ahs-3127	100	11	rate	rate	NOUN
ahs-3127	100	12	of	of	ADP
ahs-3127	100	13	10oc	10oc	PROPN
ahs-3127	100	14	/	/	SYM
ahs-3127	100	15	min	min	NOUN
ahs-3127	100	16	over	over	ADP
ahs-3127	100	17	a	a	DET
ahs-3127	100	18	temperature	temperature	NOUN
ahs-3127	100	19	range	range	NOUN
ahs-3127	100	20	from	from	ADP
ahs-3127	100	21	room	room	NOUN
ahs-3127	100	22	temperature	temperature	NOUN
ahs-3127	100	23	to	to	ADP
ahs-3127	100	24	400oc	400oc	PROPN
ahs-3127	100	25	.	.	PUNCT
ahs-3127	101	1	the	the	DET
ahs-3127	101	2	precision	precision	NOUN
ahs-3127	101	3	of	of	ADP
ahs-3127	101	4	the	the	DET
ahs-3127	101	5	used	use	VERB
ahs-3127	101	6	instrument	instrument	NOUN
ahs-3127	101	7	is	be	AUX
ahs-3127	101	8	±	±	NUM
ahs-3127	101	9	0.2oc	0.2oc	PROPN
ahs-3127	101	10	.	.	PUNCT
ahs-3127	102	1	scanning	scan	VERB
ahs-3127	102	2	electron	electron	NOUN
ahs-3127	102	3	microscopy	microscopy	NOUN
ahs-3127	102	4	(	(	PUNCT
ahs-3127	102	5	sem	sem	NOUN
ahs-3127	102	6	)	)	PUNCT
ahs-3127	102	7	scanning	scan	VERB
ahs-3127	102	8	electron	electron	NOUN
ahs-3127	102	9	microscopy	microscopy	NOUN
ahs-3127	102	10	(	(	PUNCT
ahs-3127	102	11	vegaii	vegaii	PROPN
ahs-3127	102	12	xmu	xmu	PROPN
ahs-3127	102	13	,	,	PUNCT
ahs-3127	102	14	tescan	tescan	ADJ
ahs-3127	102	15	,	,	PUNCT
ahs-3127	102	16	czech	czech	ADJ
ahs-3127	102	17	republic	republic	NOUN
ahs-3127	102	18	)	)	PUNCT
ahs-3127	102	19	with	with	ADP
ahs-3127	102	20	an	an	DET
ahs-3127	102	21	accelerating	accelerate	VERB
ahs-3127	102	22	voltage	voltage	NOUN
ahs-3127	102	23	of	of	ADP
ahs-3127	102	24	30	30	NUM
ahs-3127	102	25	kv	kv	NOUN
ahs-3127	102	26	,	,	PUNCT
ahs-3127	102	27	was	be	AUX
ahs-3127	102	28	operated	operate	VERB
ahs-3127	102	29	to	to	PART
ahs-3127	102	30	capture	capture	VERB
ahs-3127	102	31	sem	sem	ADJ
ahs-3127	102	32	images	image	NOUN
ahs-3127	102	33	of	of	ADP
ahs-3127	102	34	cotton	cotton	NOUN
ahs-3127	102	35	fibers	fiber	NOUN
ahs-3127	102	36	coming	come	VERB
ahs-3127	102	37	from	from	ADP
ahs-3127	102	38	control	control	NOUN
ahs-3127	102	39	and	and	CCONJ
ahs-3127	102	40	treated	treat	VERB
ahs-3127	102	41	plants	plant	NOUN
ahs-3127	102	42	of	of	ADP
ahs-3127	102	43	both	both	DET
ahs-3127	102	44	cultivars	cultivar	NOUN
ahs-3127	102	45	.	.	PUNCT
ahs-3127	103	1	gene	gene	NOUN
ahs-3127	103	2	expression	expression	NOUN
ahs-3127	103	3	analysis	analysis	NOUN
ahs-3127	103	4	rna	rna	NOUN
ahs-3127	103	5	isolation	isolation	NOUN
ahs-3127	103	6	and	and	CCONJ
ahs-3127	103	7	cdna	cdna	PROPN
ahs-3127	103	8	synthesis	synthesis	NOUN
ahs-3127	103	9	.	.	PUNCT
ahs-3127	104	1	total	total	ADJ
ahs-3127	104	2	rna	rna	PROPN
ahs-3127	104	3	was	be	AUX
ahs-3127	104	4	isolated	isolate	VERB
ahs-3127	104	5	from	from	ADP
ahs-3127	104	6	leaves	leave	NOUN
ahs-3127	104	7	of	of	ADP
ahs-3127	104	8	cotton	cotton	NOUN
ahs-3127	104	9	plants	plant	NOUN
ahs-3127	104	10	using	use	VERB
ahs-3127	104	11	the	the	DET
ahs-3127	104	12	modified	modify	VERB
ahs-3127	104	13	hot	hot	ADJ
ahs-3127	104	14	borate	borate	NOUN
ahs-3127	104	15	method	method	NOUN
ahs-3127	104	16	(	(	PUNCT
ahs-3127	104	17	jawdat	jawdat	NOUN
ahs-3127	104	18	and	and	CCONJ
ahs-3127	104	19	karajoli	karajoli	NOUN
ahs-3127	104	20	,	,	PUNCT
ahs-3127	104	21	2012	2012	NUM
ahs-3127	104	22	)	)	PUNCT
ahs-3127	104	23	.	.	PUNCT
ahs-3127	105	1	quality	quality	NOUN
ahs-3127	105	2	of	of	ADP
ahs-3127	105	3	total	total	ADJ
ahs-3127	105	4	rna	rna	NOUN
ahs-3127	105	5	was	be	AUX
ahs-3127	105	6	tested	test	VERB
ahs-3127	105	7	by	by	ADP
ahs-3127	105	8	agarose	agarose	NOUN
ahs-3127	105	9	-	-	PUNCT
ahs-3127	105	10	formaldehyde	formaldehyde	NOUN
ahs-3127	105	11	gel	gel	NOUN
ahs-3127	105	12	electrophoresis	electrophoresis	NOUN
ahs-3127	105	13	using	use	VERB
ahs-3127	105	14	standard	standard	ADJ
ahs-3127	105	15	protocols	protocol	NOUN
ahs-3127	105	16	.	.	PUNCT
ahs-3127	106	1	the	the	DET
ahs-3127	106	2	iscripttm	iscripttm	NOUN
ahs-3127	106	3	select	select	VERB
ahs-3127	106	4	cdna	cdna	PROPN
ahs-3127	106	5	synthesis	synthesis	NOUN
ahs-3127	106	6	kit	kit	NOUN
ahs-3127	106	7	(	(	PUNCT
ahs-3127	106	8	biorad	biorad	NOUN
ahs-3127	106	9	,	,	PUNCT
ahs-3127	106	10	usa	usa	PROPN
ahs-3127	106	11	)	)	PUNCT
ahs-3127	106	12	was	be	AUX
ahs-3127	106	13	used	use	VERB
ahs-3127	106	14	to	to	PART
ahs-3127	106	15	obtain	obtain	VERB
ahs-3127	106	16	first	first	ADJ
ahs-3127	106	17	strand	strand	NOUN
ahs-3127	106	18	cdna	cdna	PROPN
ahs-3127	106	19	starting	start	VERB
ahs-3127	106	20	from	from	ADP
ahs-3127	106	21	1	1	NUM
ahs-3127	106	22	µg	µg	ADV
ahs-3127	106	23	total	total	ADJ
ahs-3127	106	24	rna	rna	NOUN
ahs-3127	106	25	following	follow	VERB
ahs-3127	106	26	the	the	DET
ahs-3127	106	27	manufacturer	manufacturer	NOUN
ahs-3127	106	28	’s	’s	PART
ahs-3127	106	29	protocol	protocol	NOUN
ahs-3127	106	30	.	.	PUNCT
ahs-3127	107	1	the	the	DET
ahs-3127	107	2	cdna	cdna	PROPN
ahs-3127	107	3	was	be	AUX
ahs-3127	107	4	diluted	dilute	VERB
ahs-3127	107	5	4x	4x	NOUN
ahs-3127	107	6	and	and	CCONJ
ahs-3127	107	7	stored	store	VERB
ahs-3127	107	8	at	at	ADP
ahs-3127	107	9	-20	-20	NUM
ahs-3127	107	10	°	°	NOUN
ahs-3127	107	11	c	c	NOUN
ahs-3127	107	12	.	.	PUNCT
ahs-3127	108	1	relative	relative	ADJ
ahs-3127	108	2	quantification	quantification	NOUN
ahs-3127	108	3	of	of	ADP
ahs-3127	108	4	gene	gene	NOUN
ahs-3127	108	5	expression	expression	NOUN
ahs-3127	108	6	the	the	DET
ahs-3127	108	7	cdna	cdna	PROPN
ahs-3127	108	8	samples	sample	NOUN
ahs-3127	108	9	(	(	PUNCT
ahs-3127	108	10	control	control	VERB
ahs-3127	108	11	and	and	CCONJ
ahs-3127	108	12	treated	treat	VERB
ahs-3127	108	13	)	)	PUNCT
ahs-3127	108	14	were	be	AUX
ahs-3127	108	15	used	use	VERB
ahs-3127	108	16	as	as	ADP
ahs-3127	108	17	a	a	DET
ahs-3127	108	18	template	template	NOUN
ahs-3127	108	19	to	to	PART
ahs-3127	108	20	quantify	quantify	VERB
ahs-3127	108	21	target	target	NOUN
ahs-3127	108	22	genes	gene	NOUN
ahs-3127	108	23	(	(	PUNCT
ahs-3127	108	24	dreb1a	dreb1a	NOUN
ahs-3127	108	25	,	,	PUNCT
ahs-3127	108	26	tps	tps	NOUN
ahs-3127	108	27	and	and	CCONJ
ahs-3127	108	28	hspcb	hspcb	ADJ
ahs-3127	108	29	)	)	PUNCT
ahs-3127	108	30	expression	expression	NOUN
ahs-3127	108	31	level	level	NOUN
ahs-3127	108	32	.	.	PUNCT
ahs-3127	109	1	realtime	realtime	ADJ
ahs-3127	109	2	pcr	pcr	NOUN
ahs-3127	109	3	was	be	AUX
ahs-3127	109	4	performed	perform	VERB
ahs-3127	109	5	in	in	ADP
ahs-3127	109	6	two	two	NUM
ahs-3127	109	7	replicates	replicate	NOUN
ahs-3127	109	8	in	in	ADP
ahs-3127	109	9	a	a	DET
ahs-3127	109	10	25	25	NUM
ahs-3127	109	11	µl	µl	NOUN
ahs-3127	109	12	of	of	ADP
ahs-3127	109	13	a	a	DET
ahs-3127	109	14	reaction	reaction	NOUN
ahs-3127	109	15	mixture	mixture	NOUN
ahs-3127	109	16	composed	compose	VERB
ahs-3127	109	17	of	of	ADP
ahs-3127	109	18	12.5	12.5	NUM
ahs-3127	109	19	µl	µl	PART
ahs-3127	109	20	iq	iq	ADV
ahs-3127	109	21	sybr	sybr	ADP
ahs-3127	109	22	super	super	ADJ
ahs-3127	109	23	mix	mix	NOUN
ahs-3127	109	24	(	(	PUNCT
ahs-3127	109	25	biorad	biorad	NOUN
ahs-3127	109	26	,	,	PUNCT
ahs-3127	109	27	usa	usa	PROPN
ahs-3127	109	28	)	)	PUNCT
ahs-3127	109	29	,	,	PUNCT
ahs-3127	109	30	1	1	NUM
ahs-3127	109	31	µl	µl	NOUN
ahs-3127	109	32	of	of	ADP
ahs-3127	109	33	cdna	cdna	PROPN
ahs-3127	109	34	,	,	PUNCT
ahs-3127	109	35	1	1	NUM
ahs-3127	109	36	µl	µl	ADP
ahs-3127	109	37	of	of	ADP
ahs-3127	109	38	each	each	PRON
ahs-3127	109	39	of	of	ADP
ahs-3127	109	40	the	the	DET
ahs-3127	109	41	forward	forward	ADJ
ahs-3127	109	42	and	and	CCONJ
ahs-3127	109	43	reverse	reverse	ADJ
ahs-3127	109	44	primer	primer	NOUN
ahs-3127	109	45	(	(	PUNCT
ahs-3127	109	46	10	10	NUM
ahs-3127	109	47	µm	µm	NOUN
ahs-3127	109	48	)	)	PUNCT
ahs-3127	109	49	,	,	PUNCT
ahs-3127	109	50	and	and	CCONJ
ahs-3127	109	51	9.5	9.5	NUM
ahs-3127	109	52	µl	µl	NOUN
ahs-3127	109	53	of	of	ADP
ahs-3127	109	54	d.d	d.d	PROPN
ahs-3127	109	55	.	.	PROPN
ahs-3127	109	56	water	water	PROPN
ahs-3127	109	57	.	.	PUNCT
ahs-3127	110	1	the	the	DET
ahs-3127	110	2	quantification	quantification	NOUN
ahs-3127	110	3	of	of	ADP
ahs-3127	110	4	mrna	mrna	PROPN
ahs-3127	110	5	levels	level	NOUN
ahs-3127	110	6	was	be	AUX
ahs-3127	110	7	normalized	normalize	VERB
ahs-3127	110	8	with	with	ADP
ahs-3127	110	9	the	the	DET
ahs-3127	110	10	level	level	NOUN
ahs-3127	110	11	of	of	ADP
ahs-3127	110	12	mrna	mrna	NOUN
ahs-3127	110	13	for	for	ADP
ahs-3127	110	14	ghef1α5	ghef1α5	PROPN
ahs-3127	110	15	(	(	PUNCT
ahs-3127	110	16	artico	artico	PROPN
ahs-3127	110	17	et	et	PROPN
ahs-3127	110	18	al	al	PROPN
ahs-3127	110	19	.	.	PROPN
ahs-3127	110	20	,	,	PUNCT
ahs-3127	110	21	2010	2010	NUM
ahs-3127	110	22	)	)	PUNCT
ahs-3127	110	23	.	.	PUNCT
ahs-3127	111	1	the	the	DET
ahs-3127	111	2	relative	relative	ADJ
ahs-3127	111	3	expression	expression	NOUN
ahs-3127	111	4	(	(	PUNCT
ahs-3127	111	5	fold	fold	NOUN
ahs-3127	111	6	expression	expression	NOUN
ahs-3127	111	7	)	)	PUNCT
ahs-3127	111	8	was	be	AUX
ahs-3127	111	9	calculated	calculate	VERB
ahs-3127	111	10	using	use	VERB
ahs-3127	111	11	the	the	DET
ahs-3127	111	12	-∆∆ct	-∆∆ct	PUNCT
ahs-3127	111	13	method	method	NOUN
ahs-3127	111	14	as	as	SCONJ
ahs-3127	111	15	follows	follow	VERB
ahs-3127	111	16	:	:	PUNCT
ahs-3127	112	1	2-∆∆ct	2-∆∆ct	NUM
ahs-3127	112	2	=	=	SYM
ahs-3127	112	3	2[(ct	2[(ct	NUM
ahs-3127	112	4	treated	treat	VERB
ahs-3127	112	5	target	target	NOUN
ahs-3127	112	6	gene	gene	NOUN
ahs-3127	112	7	–	–	PUNCT
ahs-3127	112	8	ct	ct	NUM
ahs-3127	112	9	treated	treat	VERB
ahs-3127	112	10	reference	reference	NOUN
ahs-3127	112	11	gene	gene	NOUN
ahs-3127	112	12	)	)	PUNCT
ahs-3127	112	13	(	(	PUNCT
ahs-3127	112	14	ct	ct	NUM
ahs-3127	112	15	untreated	untreated	ADJ
ahs-3127	112	16	target	target	NOUN
ahs-3127	112	17	gene	gene	NOUN
ahs-3127	112	18	ct	ct	NUM
ahs-3127	112	19	untreated	untreated	ADJ
ahs-3127	112	20	reference	reference	NOUN
ahs-3127	112	21	gene	gene	NOUN
ahs-3127	112	22	)	)	PUNCT
ahs-3127	112	23	]	]	PUNCT
ahs-3127	112	24	specific	specific	ADJ
ahs-3127	112	25	target	target	NOUN
ahs-3127	112	26	and	and	CCONJ
ahs-3127	112	27	reference	reference	NOUN
ahs-3127	112	28	gene	gene	NOUN
ahs-3127	112	29	primers	primer	NOUN
ahs-3127	112	30	are	be	AUX
ahs-3127	112	31	listed	list	VERB
ahs-3127	112	32	in	in	ADP
ahs-3127	112	33	table	table	NOUN
ahs-3127	112	34	1	1	NUM
ahs-3127	112	35	.	.	SYM
ahs-3127	112	36	3	3	X
ahs-3127	112	37	.	.	NOUN
ahs-3127	112	38	results	result	VERB
ahs-3127	112	39	physiological	physiological	ADJ
ahs-3127	112	40	,	,	PUNCT
ahs-3127	112	41	morphological	morphological	ADJ
ahs-3127	112	42	,	,	PUNCT
ahs-3127	112	43	molecular	molecular	ADJ
ahs-3127	112	44	and	and	CCONJ
ahs-3127	112	45	chemical	chemical	NOUN
ahs-3127	112	46	data	datum	NOUN
ahs-3127	112	47	were	be	AUX
ahs-3127	112	48	recorded	record	VERB
ahs-3127	112	49	to	to	PART
ahs-3127	112	50	identify	identify	VERB
ahs-3127	112	51	main	main	ADJ
ahs-3127	112	52	changes	change	NOUN
ahs-3127	112	53	in	in	ADP
ahs-3127	112	54	two	two	NUM
ahs-3127	112	55	cash	cash	NOUN
ahs-3127	112	56	cultivars	cultivar	NOUN
ahs-3127	112	57	of	of	ADP
ahs-3127	112	58	cotton	cotton	NOUN
ahs-3127	112	59	.	.	PUNCT
ahs-3127	113	1	the	the	DET
ahs-3127	113	2	physiological	physiological	ADJ
ahs-3127	113	3	and	and	CCONJ
ahs-3127	113	4	molecular	molecular	ADJ
ahs-3127	113	5	analysis	analysis	NOUN
ahs-3127	113	6	were	be	AUX
ahs-3127	113	7	carried	carry	VERB
ahs-3127	113	8	out	out	ADP
ahs-3127	113	9	on	on	ADP
ahs-3127	113	10	leaf	leaf	NOUN
ahs-3127	113	11	material	material	NOUN
ahs-3127	113	12	from	from	ADP
ahs-3127	113	13	control	control	NOUN
ahs-3127	113	14	and	and	CCONJ
ahs-3127	113	15	treated	treat	VERB
ahs-3127	113	16	plants	plant	NOUN
ahs-3127	113	17	of	of	ADP
ahs-3127	113	18	‘	'	PUNCT
ahs-3127	113	19	aleppo	aleppo	PROPN
ahs-3127	113	20	118	118	NUM
ahs-3127	113	21	’	'	PUNCT
ahs-3127	113	22	and	and	CCONJ
ahs-3127	113	23	‘	'	PUNCT
ahs-3127	113	24	deir	deir	PROPN
ahs-3127	113	25	al	al	PROPN
ahs-3127	113	26	-	-	PROPN
ahs-3127	113	27	zour	zour	NOUN
ahs-3127	113	28	22	22	NUM
ahs-3127	113	29	’	'	PUNCT
ahs-3127	113	30	,	,	PUNCT
ahs-3127	113	31	harvested	harvest	VERB
ahs-3127	113	32	45	45	NUM
ahs-3127	113	33	dap	dap	PROPN
ahs-3127	113	34	table	table	NOUN
ahs-3127	113	35	1	1	NUM
ahs-3127	113	36	target	target	NOUN
ahs-3127	113	37	and	and	CCONJ
ahs-3127	113	38	reference	reference	NOUN
ahs-3127	113	39	genes	gene	NOUN
ahs-3127	113	40	accession	accession	NOUN
ahs-3127	113	41	numbers	number	NOUN
ahs-3127	113	42	and	and	CCONJ
ahs-3127	113	43	primers	primer	NOUN
ahs-3127	113	44	sequences	sequence	NOUN
ahs-3127	113	45	gene	gene	NOUN
ahs-3127	113	46	genbank	genbank	NOUN
ahs-3127	113	47	accession	accession	NOUN
ahs-3127	114	1	no	no	INTJ
ahs-3127	114	2	.	.	PUNCT
ahs-3127	115	1	forward	forward	ADV
ahs-3127	115	2	and	and	CCONJ
ahs-3127	115	3	reverse	reverse	VERB
ahs-3127	115	4	primers	primer	NOUN
ahs-3127	115	5	(	(	PUNCT
ahs-3127	115	6	5’-3	5’-3	NOUN
ahs-3127	115	7	’	'	PUNCT
ahs-3127	115	8	)	)	PUNCT
ahs-3127	115	9	dehydration	dehydration	NOUN
ahs-3127	115	10	responsive	responsive	ADJ
ahs-3127	115	11	element	element	NOUN
ahs-3127	115	12	binding	bind	VERB
ahs-3127	115	13	gene	gene	NOUN
ahs-3127	115	14	(	(	PUNCT
ahs-3127	115	15	dreb1a	dreb1a	NOUN
ahs-3127	115	16	)	)	PUNCT
ahs-3127	115	17	ay321150.3	ay321150.3	PRON
ahs-3127	115	18	f	f	X
ahs-3127	115	19	-	-	PUNCT
ahs-3127	115	20	agctatagcactgagagggaag	agctatagcactgagagggaag	VERB
ahs-3127	115	21	r	r	NOUN
ahs-3127	115	22	-	-	PUNCT
ahs-3127	115	23	gcttcttcgtccaagtaaaacc	gcttcttcgtccaagtaaaacc	ADJ
ahs-3127	115	24	trehalose-6	trehalose-6	ADJ
ahs-3127	115	25	-	-	ADJ
ahs-3127	115	26	phosphate	phosphate	ADJ
ahs-3127	115	27	-	-	PUNCT
ahs-3127	115	28	synthase	synthase	NOUN
ahs-3127	115	29	gene	gene	NOUN
ahs-3127	115	30	(	(	PUNCT
ahs-3127	115	31	tps	tps	NOUN
ahs-3127	115	32	)	)	PUNCT
ahs-3127	115	33	ay628139.1	ay628139.1	PART
ahs-3127	116	1	f	f	NOUN
ahs-3127	116	2	-	-	PUNCT
ahs-3127	116	3	ttcactacatgctgcccatgtg	ttcactacatgctgcccatgtg	ADJ
ahs-3127	116	4	r	r	NOUN
ahs-3127	116	5	-	-	PUNCT
ahs-3127	116	6	ggctgtggaggaaaaaaccaag	ggctgtggaggaaaaaaccaag	ADJ
ahs-3127	116	7	heat	heat	NOUN
ahs-3127	116	8	-	-	PUNCT
ahs-3127	116	9	shock	shock	NOUN
ahs-3127	116	10	protein	protein	NOUN
ahs-3127	116	11	calmodulin	calmodulin	NOUN
ahs-3127	116	12	binding	bind	VERB
ahs-3127	116	13	gene	gene	NOUN
ahs-3127	116	14	(	(	PUNCT
ahs-3127	116	15	hspcb	hspcb	PROPN
ahs-3127	116	16	)	)	PUNCT
ahs-3127	116	17	ay819767.1	ay819767.1	NUM
ahs-3127	116	18	f	f	X
ahs-3127	116	19	-	-	PUNCT
ahs-3127	116	20	ctccttgaatgtatttactgcc	ctccttgaatgtatttactgcc	NOUN
ahs-3127	116	21	r	r	NOUN
ahs-3127	116	22	-	-	PUNCT
ahs-3127	116	23	gtgcgtcctctagtgtcttt	gtgcgtcctctagtgtcttt	NOUN
ahs-3127	116	24	elongation	elongation	NOUN
ahs-3127	116	25	factor	factor	NOUN
ahs-3127	116	26	1	1	NUM
ahs-3127	116	27	-	-	PUNCT
ahs-3127	116	28	alphagene	alphagene	ADJ
ahs-3127	116	29	(	(	PUNCT
ahs-3127	116	30	ef1α5	ef1α5	ADJ
ahs-3127	116	31	)	)	PUNCT
ahs-3127	116	32	dq174254	dq174254	NOUN
ahs-3127	116	33	f	f	NOUN
ahs-3127	116	34	-	-	PUNCT
ahs-3127	116	35	tccccatctctggttttgag	tccccatctctggttttgag	INTJ
ahs-3127	116	36	r	r	NOUN
ahs-3127	116	37	-	-	PUNCT
ahs-3127	116	38	cttgggctcattgatctgggt	cttgggctcattgatctgggt	NOUN
ahs-3127	116	39	jawdat	jawdat	NOUN
ahs-3127	116	40	et	et	PROPN
ahs-3127	116	41	al	al	PROPN
ahs-3127	116	42	.	.	PUNCT
ahs-3127	117	1	cotton	cotton	NOUN
ahs-3127	117	2	behaviour	behaviour	NOUN
ahs-3127	117	3	under	under	ADP
ahs-3127	117	4	water	water	NOUN
ahs-3127	117	5	stress	stress	NOUN
ahs-3127	117	6	83	83	NUM
ahs-3127	117	7	in	in	ADP
ahs-3127	117	8	the	the	DET
ahs-3127	117	9	course	course	NOUN
ahs-3127	117	10	of	of	ADP
ahs-3127	117	11	floral	floral	ADJ
ahs-3127	117	12	bud	bud	ADJ
ahs-3127	117	13	initiation	initiation	NOUN
ahs-3127	117	14	stage	stage	NOUN
ahs-3127	117	15	.	.	PUNCT
ahs-3127	118	1	chlorophyll	chlorophyll	VERB
ahs-3127	118	2	a	a	PRON
ahs-3127	118	3	and	and	CCONJ
ahs-3127	118	4	b	b	NOUN
ahs-3127	118	5	content	content	NOUN
ahs-3127	118	6	and	and	CCONJ
ahs-3127	118	7	osmotic	osmotic	ADJ
ahs-3127	118	8	potential	potential	NOUN
ahs-3127	118	9	the	the	DET
ahs-3127	118	10	chlorophyll	chlorophyll	NOUN
ahs-3127	118	11	a	a	DET
ahs-3127	118	12	content	content	NOUN
ahs-3127	118	13	showed	show	VERB
ahs-3127	118	14	a	a	DET
ahs-3127	118	15	non	non	ADJ
ahs-3127	118	16	-	-	ADJ
ahs-3127	118	17	significant	significant	ADJ
ahs-3127	118	18	decreasing	decrease	VERB
ahs-3127	118	19	trend	trend	NOUN
ahs-3127	118	20	in	in	ADP
ahs-3127	118	21	treated	treat	VERB
ahs-3127	118	22	plants	plant	NOUN
ahs-3127	118	23	compared	compare	VERB
ahs-3127	118	24	to	to	PART
ahs-3127	118	25	control	control	VERB
ahs-3127	118	26	plants	plant	NOUN
ahs-3127	118	27	in	in	ADP
ahs-3127	118	28	both	both	DET
ahs-3127	118	29	cultivars	cultivar	NOUN
ahs-3127	118	30	.	.	PUNCT
ahs-3127	119	1	however	however	ADV
ahs-3127	119	2	,	,	PUNCT
ahs-3127	119	3	the	the	DET
ahs-3127	119	4	chlorophyll	chlorophyll	NOUN
ahs-3127	119	5	b	b	PROPN
ahs-3127	119	6	content	content	NOUN
ahs-3127	119	7	showed	show	VERB
ahs-3127	119	8	a	a	DET
ahs-3127	119	9	small	small	ADJ
ahs-3127	119	10	increment	increment	NOUN
ahs-3127	119	11	in	in	ADP
ahs-3127	119	12	the	the	DET
ahs-3127	119	13	treated	treat	VERB
ahs-3127	119	14	plants	plant	NOUN
ahs-3127	119	15	.	.	PUNCT
ahs-3127	120	1	the	the	DET
ahs-3127	120	2	chlorophyll	chlorophyll	NOUN
ahs-3127	120	3	a	a	PRON
ahs-3127	120	4	/	/	SYM
ahs-3127	120	5	b	b	NOUN
ahs-3127	120	6	ratio	ratio	NOUN
ahs-3127	120	7	showed	show	VERB
ahs-3127	120	8	a	a	DET
ahs-3127	120	9	reduction	reduction	NOUN
ahs-3127	120	10	in	in	ADP
ahs-3127	120	11	treated	treat	VERB
ahs-3127	120	12	plants	plant	NOUN
ahs-3127	120	13	of	of	ADP
ahs-3127	120	14	both	both	DET
ahs-3127	120	15	cultivars	cultivar	NOUN
ahs-3127	120	16	.	.	PUNCT
ahs-3127	121	1	a	a	DET
ahs-3127	121	2	larger	large	ADJ
ahs-3127	121	3	reduction	reduction	NOUN
ahs-3127	121	4	(	(	PUNCT
ahs-3127	121	5	18	18	NUM
ahs-3127	121	6	%	%	NOUN
ahs-3127	121	7	)	)	PUNCT
ahs-3127	121	8	was	be	AUX
ahs-3127	121	9	observed	observe	VERB
ahs-3127	121	10	in	in	ADP
ahs-3127	121	11	treated	treat	VERB
ahs-3127	121	12	plants	plant	NOUN
ahs-3127	121	13	of	of	ADP
ahs-3127	121	14	‘	'	PUNCT
ahs-3127	121	15	deir	deir	PROPN
ahs-3127	121	16	al	al	PROPN
ahs-3127	121	17	-	-	PROPN
ahs-3127	121	18	zour	zour	NOUN
ahs-3127	121	19	22	22	NUM
ahs-3127	121	20	’	'	PUNCT
ahs-3127	121	21	compared	compare	VERB
ahs-3127	121	22	to	to	ADP
ahs-3127	121	23	the	the	DET
ahs-3127	121	24	small	small	ADJ
ahs-3127	121	25	reduction	reduction	NOUN
ahs-3127	121	26	(	(	PUNCT
ahs-3127	121	27	4	4	NUM
ahs-3127	121	28	%	%	NOUN
ahs-3127	121	29	)	)	PUNCT
ahs-3127	121	30	in	in	ADP
ahs-3127	121	31	treated	treat	VERB
ahs-3127	121	32	plants	plant	NOUN
ahs-3127	121	33	of	of	ADP
ahs-3127	121	34	‘	'	PUNCT
ahs-3127	121	35	aleppo	aleppo	PROPN
ahs-3127	121	36	118	118	NUM
ahs-3127	121	37	’	'	PUNCT
ahs-3127	121	38	(	(	PUNCT
ahs-3127	121	39	fig	fig	NOUN
ahs-3127	121	40	.	.	NOUN
ahs-3127	121	41	1	1	NUM
ahs-3127	121	42	inset	inset	NOUN
ahs-3127	121	43	graph	graph	NOUN
ahs-3127	121	44	)	)	PUNCT
ahs-3127	121	45	.	.	PUNCT
ahs-3127	122	1	a	a	DET
ahs-3127	122	2	non	non	ADJ
ahs-3127	122	3	-	-	ADJ
ahs-3127	122	4	significant	significant	ADJ
ahs-3127	122	5	drop	drop	NOUN
ahs-3127	122	6	in	in	ADP
ahs-3127	122	7	the	the	DET
ahs-3127	122	8	osmotic	osmotic	ADJ
ahs-3127	122	9	potential	potential	NOUN
ahs-3127	122	10	of	of	ADP
ahs-3127	122	11	leaves	leave	NOUN
ahs-3127	122	12	in	in	ADP
ahs-3127	122	13	treated	treat	VERB
ahs-3127	122	14	plants	plant	NOUN
ahs-3127	122	15	was	be	AUX
ahs-3127	122	16	observed	observe	VERB
ahs-3127	122	17	in	in	ADP
ahs-3127	122	18	both	both	DET
ahs-3127	122	19	cultivars	cultivar	NOUN
ahs-3127	122	20	and	and	CCONJ
ahs-3127	122	21	the	the	DET
ahs-3127	122	22	osmotic	osmotic	ADJ
ahs-3127	122	23	adjustment	adjustment	NOUN
ahs-3127	122	24	was	be	AUX
ahs-3127	122	25	higher	high	ADJ
ahs-3127	122	26	(	(	PUNCT
ahs-3127	122	27	0.016	0.016	NUM
ahs-3127	122	28	mpa	mpa	PROPN
ahs-3127	122	29	)	)	PUNCT
ahs-3127	122	30	in	in	ADP
ahs-3127	122	31	‘	'	PUNCT
ahs-3127	122	32	aleppo	aleppo	PROPN
ahs-3127	122	33	118	118	NUM
ahs-3127	122	34	’	'	PUNCT
ahs-3127	122	35	compared	compare	VERB
ahs-3127	122	36	to	to	ADP
ahs-3127	122	37	‘	'	PUNCT
ahs-3127	122	38	deir	deir	PROPN
ahs-3127	122	39	alzour	alzour	NOUN
ahs-3127	122	40	22	22	NUM
ahs-3127	122	41	’	'	PUNCT
ahs-3127	122	42	(	(	PUNCT
ahs-3127	122	43	0.006	0.006	NUM
ahs-3127	122	44	mpa	mpa	NOUN
ahs-3127	122	45	)	)	PUNCT
ahs-3127	122	46	(	(	PUNCT
ahs-3127	122	47	fig	fig	NOUN
ahs-3127	122	48	.	.	PUNCT
ahs-3127	122	49	1	1	NUM
ahs-3127	122	50	)	)	PUNCT
ahs-3127	122	51	.	.	PUNCT
ahs-3127	123	1	plant	plant	NOUN
ahs-3127	123	2	morphology	morphology	NOUN
ahs-3127	123	3	early	early	ADV
ahs-3127	123	4	floral	floral	ADJ
ahs-3127	123	5	bud	bud	ADJ
ahs-3127	123	6	emergence	emergence	NOUN
ahs-3127	123	7	was	be	AUX
ahs-3127	123	8	observed	observe	VERB
ahs-3127	123	9	in	in	ADP
ahs-3127	123	10	both	both	DET
ahs-3127	123	11	treated	treat	VERB
ahs-3127	123	12	cultivars	cultivar	NOUN
ahs-3127	123	13	compared	compare	VERB
ahs-3127	123	14	to	to	PART
ahs-3127	123	15	control	control	VERB
ahs-3127	123	16	plants	plant	NOUN
ahs-3127	123	17	(	(	PUNCT
ahs-3127	123	18	fig	fig	NOUN
ahs-3127	123	19	.	.	NOUN
ahs-3127	123	20	2	2	NUM
ahs-3127	123	21	inset	inset	NOUN
ahs-3127	123	22	graph	graph	NOUN
ahs-3127	123	23	i	i	PROPN
ahs-3127	123	24	)	)	PUNCT
ahs-3127	123	25	.	.	PUNCT
ahs-3127	124	1	the	the	DET
ahs-3127	124	2	control	control	NOUN
ahs-3127	124	3	plants	plant	NOUN
ahs-3127	124	4	of	of	ADP
ahs-3127	124	5	aleppo	aleppo	PROPN
ahs-3127	124	6	118	118	NUM
ahs-3127	124	7	cultivars	cultivar	NOUN
ahs-3127	124	8	flowered	flower	VERB
ahs-3127	124	9	earlier	early	ADV
ahs-3127	124	10	than	than	ADP
ahs-3127	124	11	control	control	VERB
ahs-3127	124	12	plants	plant	NOUN
ahs-3127	124	13	of	of	ADP
ahs-3127	124	14	‘	'	PUNCT
ahs-3127	124	15	deir	deir	X
ahs-3127	124	16	alzour	alzour	NOUN
ahs-3127	124	17	22	22	NUM
ahs-3127	124	18	’	'	PUNCT
ahs-3127	124	19	.	.	PUNCT
ahs-3127	125	1	nawf	nawf	PROPN
ahs-3127	125	2	counts	count	NOUN
ahs-3127	125	3	,	,	PUNCT
ahs-3127	125	4	another	another	DET
ahs-3127	125	5	indicator	indicator	NOUN
ahs-3127	125	6	of	of	ADP
ahs-3127	125	7	flowering	flowering	NOUN
ahs-3127	125	8	earliness	earliness	NOUN
ahs-3127	125	9	,	,	PUNCT
ahs-3127	125	10	was	be	AUX
ahs-3127	125	11	also	also	ADV
ahs-3127	125	12	recorded	record	VERB
ahs-3127	125	13	in	in	ADP
ahs-3127	125	14	the	the	DET
ahs-3127	125	15	third	third	ADJ
ahs-3127	125	16	week	week	NOUN
ahs-3127	125	17	of	of	ADP
ahs-3127	125	18	first	first	ADJ
ahs-3127	125	19	flower	flower	NOUN
ahs-3127	125	20	emergence	emergence	NOUN
ahs-3127	125	21	(	(	PUNCT
ahs-3127	125	22	fig	fig	NOUN
ahs-3127	125	23	.	.	NOUN
ahs-3127	125	24	2	2	NUM
ahs-3127	125	25	inset	inset	NOUN
ahs-3127	125	26	graph	graph	NOUN
ahs-3127	125	27	ii	ii	PROPN
ahs-3127	125	28	)	)	PUNCT
ahs-3127	125	29	.	.	PUNCT
ahs-3127	126	1	recorded	record	VERB
ahs-3127	126	2	nawf	nawf	PROPN
ahs-3127	126	3	counts	count	NOUN
ahs-3127	126	4	showed	show	VERB
ahs-3127	126	5	a	a	DET
ahs-3127	126	6	significant	significant	ADJ
ahs-3127	126	7	decrease	decrease	NOUN
ahs-3127	126	8	in	in	ADP
ahs-3127	126	9	treated	treat	VERB
ahs-3127	126	10	plants	plant	NOUN
ahs-3127	126	11	of	of	ADP
ahs-3127	126	12	both	both	DET
ahs-3127	126	13	cultivars	cultivar	NOUN
ahs-3127	126	14	.	.	PUNCT
ahs-3127	127	1	a	a	DET
ahs-3127	127	2	final	final	ADJ
ahs-3127	127	3	record	record	NOUN
ahs-3127	127	4	of	of	ADP
ahs-3127	127	5	plants	plant	NOUN
ahs-3127	127	6	with	with	ADP
ahs-3127	127	7	flowers	flower	NOUN
ahs-3127	127	8	,	,	PUNCT
ahs-3127	127	9	and	and	CCONJ
ahs-3127	127	10	plants	plant	NOUN
ahs-3127	127	11	with	with	ADP
ahs-3127	127	12	floral	floral	ADJ
ahs-3127	127	13	bud	bud	ADJ
ahs-3127	127	14	percentages	percentage	NOUN
ahs-3127	127	15	were	be	AUX
ahs-3127	127	16	also	also	ADV
ahs-3127	127	17	taken	take	VERB
ahs-3127	127	18	five	five	NUM
ahs-3127	127	19	months	month	NOUN
ahs-3127	127	20	after	after	ADP
ahs-3127	127	21	planting	plant	VERB
ahs-3127	127	22	towards	towards	ADP
ahs-3127	127	23	the	the	DET
ahs-3127	127	24	end	end	NOUN
ahs-3127	127	25	of	of	ADP
ahs-3127	127	26	season	season	NOUN
ahs-3127	127	27	(	(	PUNCT
ahs-3127	127	28	fig	fig	NOUN
ahs-3127	127	29	.	.	PUNCT
ahs-3127	128	1	2	2	NUM
ahs-3127	128	2	)	)	PUNCT
ahs-3127	128	3	.	.	PUNCT
ahs-3127	129	1	end	end	NOUN
ahs-3127	129	2	of	of	ADP
ahs-3127	129	3	season	season	NOUN
ahs-3127	129	4	flowering	flowering	NOUN
ahs-3127	129	5	counts	count	NOUN
ahs-3127	129	6	have	have	AUX
ahs-3127	129	7	shown	show	VERB
ahs-3127	129	8	‘	'	PUNCT
ahs-3127	129	9	aleppo	aleppo	PROPN
ahs-3127	129	10	118	118	NUM
ahs-3127	129	11	’	'	PUNCT
ahs-3127	129	12	tendency	tendency	NOUN
ahs-3127	129	13	to	to	PART
ahs-3127	129	14	keep	keep	VERB
ahs-3127	129	15	initiating	initiate	VERB
ahs-3127	129	16	floral	floral	ADJ
ahs-3127	129	17	buds	bud	NOUN
ahs-3127	129	18	(	(	PUNCT
ahs-3127	129	19	~	~	PUNCT
ahs-3127	129	20	21	21	NUM
ahs-3127	129	21	%	%	NOUN
ahs-3127	129	22	)	)	PUNCT
ahs-3127	129	23	in	in	ADP
ahs-3127	129	24	treated	treat	VERB
ahs-3127	129	25	plants	plant	NOUN
ahs-3127	129	26	compared	compare	VERB
ahs-3127	129	27	to	to	PART
ahs-3127	129	28	control	control	VERB
ahs-3127	129	29	plants	plant	NOUN
ahs-3127	129	30	(	(	PUNCT
ahs-3127	129	31	5.6	5.6	NUM
ahs-3127	129	32	%	%	NOUN
ahs-3127	129	33	)	)	PUNCT
ahs-3127	129	34	,	,	PUNCT
ahs-3127	129	35	and	and	CCONJ
ahs-3127	129	36	produce	produce	VERB
ahs-3127	129	37	fully	fully	ADV
ahs-3127	129	38	opened	open	VERB
ahs-3127	129	39	flowers	flower	NOUN
ahs-3127	129	40	(	(	PUNCT
ahs-3127	129	41	~	~	PUNCT
ahs-3127	129	42	31	31	NUM
ahs-3127	129	43	%	%	NOUN
ahs-3127	129	44	)	)	PUNCT
ahs-3127	129	45	in	in	ADP
ahs-3127	129	46	treated	treat	VERB
ahs-3127	129	47	compared	compare	VERB
ahs-3127	129	48	to	to	PART
ahs-3127	129	49	control	control	VERB
ahs-3127	129	50	plants	plant	NOUN
ahs-3127	129	51	(	(	PUNCT
ahs-3127	129	52	~	~	SYM
ahs-3127	129	53	2	2	NUM
ahs-3127	129	54	%	%	NOUN
ahs-3127	129	55	)	)	PUNCT
ahs-3127	129	56	.	.	PUNCT
ahs-3127	130	1	however	however	ADV
ahs-3127	130	2	,	,	PUNCT
ahs-3127	130	3	a	a	DET
ahs-3127	130	4	similar	similar	ADJ
ahs-3127	130	5	but	but	CCONJ
ahs-3127	130	6	less	less	ADV
ahs-3127	130	7	potent	potent	ADJ
ahs-3127	130	8	flowering	flowering	NOUN
ahs-3127	130	9	counts	count	NOUN
ahs-3127	130	10	pattern	pattern	NOUN
ahs-3127	130	11	was	be	AUX
ahs-3127	130	12	observed	observe	VERB
ahs-3127	130	13	in	in	ADP
ahs-3127	130	14	deir	deir	PROPN
ahs-3127	130	15	al	al	PROPN
ahs-3127	130	16	-	-	PROPN
ahs-3127	130	17	zour	zour	PROPN
ahs-3127	130	18	22	22	NUM
ahs-3127	130	19	cultivar	cultivar	NOUN
ahs-3127	130	20	.	.	PUNCT
ahs-3127	131	1	end	end	NOUN
ahs-3127	131	2	of	of	ADP
ahs-3127	131	3	season	season	NOUN
ahs-3127	131	4	measurements	measurement	NOUN
ahs-3127	131	5	have	have	AUX
ahs-3127	131	6	also	also	ADV
ahs-3127	131	7	included	include	VERB
ahs-3127	131	8	plant	plant	NOUN
ahs-3127	131	9	stem	stem	NOUN
ahs-3127	131	10	height	height	NOUN
ahs-3127	131	11	,	,	PUNCT
ahs-3127	131	12	taproot	taproot	ADJ
ahs-3127	131	13	depth	depth	NOUN
ahs-3127	131	14	and	and	CCONJ
ahs-3127	131	15	number	number	NOUN
ahs-3127	131	16	of	of	ADP
ahs-3127	131	17	secondary	secondary	ADJ
ahs-3127	131	18	roots	root	NOUN
ahs-3127	131	19	(	(	PUNCT
ahs-3127	131	20	table	table	NOUN
ahs-3127	131	21	2	2	NUM
ahs-3127	131	22	)	)	PUNCT
ahs-3127	131	23	.	.	PUNCT
ahs-3127	132	1	treated	treat	VERB
ahs-3127	132	2	plants	plant	NOUN
ahs-3127	132	3	in	in	ADP
ahs-3127	132	4	both	both	DET
ahs-3127	132	5	cultivars	cultivar	NOUN
ahs-3127	132	6	showed	show	VERB
ahs-3127	132	7	a	a	DET
ahs-3127	132	8	slight	slight	ADJ
ahs-3127	132	9	increase	increase	NOUN
ahs-3127	132	10	in	in	ADP
ahs-3127	132	11	plant	plant	NOUN
ahs-3127	132	12	stem	stem	NOUN
ahs-3127	132	13	height	height	NOUN
ahs-3127	132	14	and	and	CCONJ
ahs-3127	132	15	minor	minor	ADJ
ahs-3127	132	16	decrease	decrease	NOUN
ahs-3127	132	17	in	in	ADP
ahs-3127	132	18	root	root	NOUN
ahs-3127	132	19	depth	depth	NOUN
ahs-3127	132	20	.	.	PUNCT
ahs-3127	133	1	however	however	ADV
ahs-3127	133	2	,	,	PUNCT
ahs-3127	133	3	non	non	ADJ
ahs-3127	133	4	-	-	ADJ
ahs-3127	133	5	significant	significant	ADJ
ahs-3127	133	6	increase	increase	NOUN
ahs-3127	133	7	in	in	ADP
ahs-3127	133	8	number	number	NOUN
ahs-3127	133	9	of	of	ADP
ahs-3127	133	10	secondary	secondary	ADJ
ahs-3127	133	11	roots	root	NOUN
ahs-3127	133	12	was	be	AUX
ahs-3127	133	13	observed	observe	VERB
ahs-3127	133	14	in	in	ADP
ahs-3127	133	15	treated	treat	VERB
ahs-3127	133	16	plants	plant	NOUN
ahs-3127	133	17	of	of	ADP
ahs-3127	133	18	both	both	DET
ahs-3127	133	19	cultivars	cultivar	NOUN
ahs-3127	133	20	.	.	PUNCT
ahs-3127	134	1	physical	physical	ADJ
ahs-3127	134	2	and	and	CCONJ
ahs-3127	134	3	chemical	chemical	NOUN
ahs-3127	134	4	fiber	fiber	NOUN
ahs-3127	134	5	properties	property	NOUN
ahs-3127	134	6	fiber	fiber	VERB
ahs-3127	134	7	quality	quality	NOUN
ahs-3127	134	8	testing	testing	NOUN
ahs-3127	134	9	.	.	PUNCT
ahs-3127	135	1	the	the	DET
ahs-3127	135	2	two	two	NUM
ahs-3127	135	3	tested	test	VERB
ahs-3127	135	4	cultivars	cultivar	NOUN
ahs-3127	135	5	have	have	AUX
ahs-3127	135	6	presented	present	VERB
ahs-3127	135	7	slightly	slightly	ADV
ahs-3127	135	8	different	different	ADJ
ahs-3127	135	9	behavior	behavior	NOUN
ahs-3127	135	10	in	in	ADP
ahs-3127	135	11	terms	term	NOUN
ahs-3127	135	12	of	of	ADP
ahs-3127	135	13	fiber	fiber	NOUN
ahs-3127	135	14	properties	property	NOUN
ahs-3127	135	15	.	.	PUNCT
ahs-3127	136	1	seed	seed	NOUN
ahs-3127	136	2	cotton	cotton	NOUN
ahs-3127	136	3	yield	yield	NOUN
ahs-3127	136	4	showed	show	VERB
ahs-3127	136	5	no	no	DET
ahs-3127	136	6	significant	significant	ADJ
ahs-3127	136	7	difference	difference	NOUN
ahs-3127	136	8	between	between	ADP
ahs-3127	136	9	treated	treat	VERB
ahs-3127	136	10	and	and	CCONJ
ahs-3127	136	11	control	control	VERB
ahs-3127	136	12	plants	plant	NOUN
ahs-3127	136	13	in	in	ADP
ahs-3127	136	14	each	each	DET
ahs-3127	136	15	cultivar	cultivar	NOUN
ahs-3127	136	16	.	.	PUNCT
ahs-3127	137	1	the	the	DET
ahs-3127	137	2	cultivar	cultivar	NOUN
ahs-3127	137	3	deir	deir	PROPN
ahs-3127	137	4	al	al	PROPN
ahs-3127	137	5	-	-	PROPN
ahs-3127	137	6	zour	zour	PROPN
ahs-3127	137	7	22	22	NUM
ahs-3127	137	8	showed	show	VERB
ahs-3127	137	9	a	a	DET
ahs-3127	137	10	significant	significant	ADJ
ahs-3127	137	11	increase	increase	NOUN
ahs-3127	137	12	in	in	ADP
ahs-3127	137	13	both	both	DET
ahs-3127	137	14	fiber	fiber	NOUN
ahs-3127	137	15	length	length	NOUN
ahs-3127	137	16	and	and	CCONJ
ahs-3127	137	17	strength	strength	NOUN
ahs-3127	137	18	in	in	ADP
ahs-3127	137	19	the	the	DET
ahs-3127	137	20	treated	treat	VERB
ahs-3127	137	21	plants	plant	NOUN
ahs-3127	137	22	compared	compare	VERB
ahs-3127	137	23	to	to	ADP
ahs-3127	137	24	control	control	NOUN
ahs-3127	137	25	ones	one	NOUN
ahs-3127	137	26	.	.	PUNCT
ahs-3127	138	1	fiber	fiber	NOUN
ahs-3127	138	2	fig	fig	NOUN
ahs-3127	138	3	.	.	PUNCT
ahs-3127	139	1	1	1	NUM
ahs-3127	139	2	the	the	DET
ahs-3127	139	3	inset	inset	NOUN
ahs-3127	139	4	graph	graph	NOUN
ahs-3127	139	5	is	be	AUX
ahs-3127	139	6	chlorophyll	chlorophyll	NOUN
ahs-3127	139	7	a	a	DET
ahs-3127	139	8	/	/	SYM
ahs-3127	139	9	b	b	NOUN
ahs-3127	139	10	ratio	ratio	NOUN
ahs-3127	139	11	in	in	ADP
ahs-3127	139	12	leaves	leave	NOUN
ahs-3127	139	13	of	of	ADP
ahs-3127	139	14	control	control	NOUN
ahs-3127	139	15	(	(	PUNCT
ahs-3127	139	16	c	c	NOUN
ahs-3127	139	17	)	)	PUNCT
ahs-3127	139	18	and	and	CCONJ
ahs-3127	139	19	treated	treat	VERB
ahs-3127	139	20	(	(	PUNCT
ahs-3127	139	21	t	t	PROPN
ahs-3127	139	22	)	)	PUNCT
ahs-3127	139	23	‘	'	PUNCT
ahs-3127	139	24	aleppo	aleppo	X
ahs-3127	139	25	118	118	NUM
ahs-3127	139	26	’	'	PUNCT
ahs-3127	139	27	and	and	CCONJ
ahs-3127	139	28	‘	'	PUNCT
ahs-3127	139	29	deir	deir	PROPN
ahs-3127	139	30	-	-	PROPN
ahs-3127	139	31	al	al	PROPN
ahs-3127	139	32	zour	zour	PROPN
ahs-3127	139	33	22	22	NUM
ahs-3127	139	34	’	'	PUNCT
ahs-3127	139	35	plants	plant	NOUN
ahs-3127	139	36	.	.	PUNCT
ahs-3127	140	1	main	main	ADJ
ahs-3127	140	2	graph	graph	NOUN
ahs-3127	140	3	represents	represent	VERB
ahs-3127	140	4	osmotic	osmotic	ADJ
ahs-3127	140	5	potential	potential	ADJ
ahs-3127	140	6	and	and	CCONJ
ahs-3127	140	7	osmotic	osmotic	ADJ
ahs-3127	140	8	adjustment	adjustment	NOUN
ahs-3127	140	9	in	in	ADP
ahs-3127	140	10	leaves	leave	NOUN
ahs-3127	140	11	of	of	ADP
ahs-3127	140	12	control	control	NOUN
ahs-3127	140	13	and	and	CCONJ
ahs-3127	140	14	treated	treat	VERB
ahs-3127	140	15	‘	'	PUNCT
ahs-3127	140	16	aleppo	aleppo	PROPN
ahs-3127	140	17	118	118	NUM
ahs-3127	140	18	’	'	PUNCT
ahs-3127	140	19	and	and	CCONJ
ahs-3127	140	20	‘	'	PUNCT
ahs-3127	140	21	deir	deir	PROPN
ahs-3127	140	22	al	al	PROPN
ahs-3127	140	23	-	-	PUNCT
ahs-3127	140	24	zour	zour	ADJ
ahs-3127	140	25	22	22	NUM
ahs-3127	140	26	’	'	PUNCT
ahs-3127	140	27	plants	plant	NOUN
ahs-3127	140	28	.	.	PUNCT
ahs-3127	141	1	plants	plant	NOUN
ahs-3127	141	2	were	be	AUX
ahs-3127	141	3	under	under	ADP
ahs-3127	141	4	drip	drip	NOUN
ahs-3127	141	5	irrigation	irrigation	NOUN
ahs-3127	141	6	system	system	NOUN
ahs-3127	141	7	,	,	PUNCT
ahs-3127	141	8	where	where	SCONJ
ahs-3127	141	9	the	the	DET
ahs-3127	141	10	control	control	NOUN
ahs-3127	141	11	plants	plant	NOUN
ahs-3127	141	12	were	be	AUX
ahs-3127	141	13	given	give	VERB
ahs-3127	141	14	full	full	ADJ
ahs-3127	141	15	irrigation	irrigation	NOUN
ahs-3127	141	16	each	each	DET
ahs-3127	141	17	week	week	NOUN
ahs-3127	141	18	,	,	PUNCT
ahs-3127	141	19	and	and	CCONJ
ahs-3127	141	20	treated	treat	VERB
ahs-3127	141	21	plants	plant	NOUN
ahs-3127	141	22	have	have	AUX
ahs-3127	141	23	been	be	AUX
ahs-3127	141	24	given	give	VERB
ahs-3127	141	25	deficit	deficit	NOUN
ahs-3127	141	26	irrigation	irrigation	NOUN
ahs-3127	141	27	each	each	DET
ahs-3127	141	28	10	10	NUM
ahs-3127	141	29	days	day	NOUN
ahs-3127	141	30	.	.	PUNCT
ahs-3127	142	1	data	datum	NOUN
ahs-3127	142	2	represent	represent	VERB
ahs-3127	142	3	means	mean	NOUN
ahs-3127	142	4	and	and	CCONJ
ahs-3127	142	5	standard	standard	ADJ
ahs-3127	142	6	error	error	NOUN
ahs-3127	142	7	of	of	ADP
ahs-3127	142	8	three	three	NUM
ahs-3127	142	9	replications	replication	NOUN
ahs-3127	142	10	.	.	PUNCT
ahs-3127	143	1	fig	fig	NOUN
ahs-3127	143	2	.	.	PUNCT
ahs-3127	144	1	2	2	NUM
ahs-3127	144	2	the	the	DET
ahs-3127	144	3	inset	inset	NOUN
ahs-3127	144	4	graph	graph	NOUN
ahs-3127	144	5	-	-	PUNCT
ahs-3127	144	6	i	i	PRON
ahs-3127	144	7	shows	show	VERB
ahs-3127	144	8	floral	floral	ADJ
ahs-3127	144	9	buds	bud	NOUN
ahs-3127	144	10	emergence	emergence	VERB
ahs-3127	144	11	in	in	ADP
ahs-3127	144	12	days	day	NOUN
ahs-3127	144	13	after	after	ADP
ahs-3127	144	14	planting	planting	NOUN
ahs-3127	144	15	(	(	PUNCT
ahs-3127	144	16	dap	dap	PROPN
ahs-3127	144	17	)	)	PUNCT
ahs-3127	144	18	in	in	ADP
ahs-3127	144	19	control	control	NOUN
ahs-3127	144	20	and	and	CCONJ
ahs-3127	144	21	treated	treat	VERB
ahs-3127	144	22	‘	'	PUNCT
ahs-3127	144	23	aleppo	aleppo	PROPN
ahs-3127	144	24	118	118	NUM
ahs-3127	144	25	’	'	PUNCT
ahs-3127	144	26	and	and	CCONJ
ahs-3127	144	27	‘	'	PUNCT
ahs-3127	144	28	deir	deir	PROPN
ahs-3127	144	29	al	al	PROPN
ahs-3127	144	30	-	-	PUNCT
ahs-3127	144	31	zour	zour	ADJ
ahs-3127	144	32	22	22	NUM
ahs-3127	144	33	’	'	PUNCT
ahs-3127	144	34	plants	plant	NOUN
ahs-3127	144	35	.	.	PUNCT
ahs-3127	145	1	the	the	DET
ahs-3127	145	2	inset	inset	NOUN
ahs-3127	145	3	graph	graph	NOUN
ahs-3127	145	4	-	-	PUNCT
ahs-3127	145	5	ii	ii	NOUN
ahs-3127	145	6	represents	represent	VERB
ahs-3127	145	7	nawf	nawf	ADJ
ahs-3127	145	8	counts	count	NOUN
ahs-3127	145	9	in	in	ADP
ahs-3127	145	10	control	control	NOUN
ahs-3127	145	11	and	and	CCONJ
ahs-3127	145	12	treated	treat	VERB
ahs-3127	145	13	plants	plant	NOUN
ahs-3127	145	14	of	of	ADP
ahs-3127	145	15	both	both	DET
ahs-3127	145	16	cultivars	cultivar	NOUN
ahs-3127	145	17	.	.	PUNCT
ahs-3127	146	1	data	datum	NOUN
ahs-3127	146	2	were	be	AUX
ahs-3127	146	3	subjected	subject	VERB
ahs-3127	146	4	to	to	ADP
ahs-3127	146	5	duncan	duncan	PROPN
ahs-3127	146	6	’s	’s	PART
ahs-3127	146	7	test	test	NOUN
ahs-3127	146	8	with	with	ADP
ahs-3127	146	9	a	a	DET
ahs-3127	146	10	confidence	confidence	NOUN
ahs-3127	146	11	level	level	NOUN
ahs-3127	146	12	of	of	ADP
ahs-3127	146	13	95	95	NUM
ahs-3127	146	14	%	%	NOUN
ahs-3127	146	15	using	use	VERB
ahs-3127	146	16	statistica	statistica	PROPN
ahs-3127	146	17	program	program	NOUN
ahs-3127	146	18	.	.	PUNCT
ahs-3127	147	1	columns	column	NOUN
ahs-3127	147	2	sharing	share	VERB
ahs-3127	147	3	a	a	DET
ahs-3127	147	4	letter	letter	NOUN
ahs-3127	147	5	are	be	AUX
ahs-3127	147	6	not	not	PART
ahs-3127	147	7	significantly	significantly	ADV
ahs-3127	147	8	different	different	ADJ
ahs-3127	147	9	.	.	PUNCT
ahs-3127	148	1	data	datum	NOUN
ahs-3127	148	2	represent	represent	VERB
ahs-3127	148	3	means	mean	NOUN
ahs-3127	148	4	and	and	CCONJ
ahs-3127	148	5	standard	standard	ADJ
ahs-3127	148	6	error	error	NOUN
ahs-3127	148	7	of	of	ADP
ahs-3127	148	8	three	three	NUM
ahs-3127	148	9	replications	replication	NOUN
ahs-3127	148	10	.	.	PUNCT
ahs-3127	149	1	the	the	DET
ahs-3127	149	2	original	original	ADJ
ahs-3127	149	3	graph	graph	NOUN
ahs-3127	149	4	is	be	AUX
ahs-3127	149	5	the	the	DET
ahs-3127	149	6	percentages	percentage	NOUN
ahs-3127	149	7	of	of	ADP
ahs-3127	149	8	plants	plant	NOUN
ahs-3127	149	9	with	with	ADP
ahs-3127	149	10	flowers	flower	NOUN
ahs-3127	149	11	and	and	CCONJ
ahs-3127	149	12	plants	plant	NOUN
ahs-3127	149	13	with	with	ADP
ahs-3127	149	14	floral	floral	ADJ
ahs-3127	149	15	buds	bud	NOUN
ahs-3127	149	16	of	of	ADP
ahs-3127	149	17	both	both	DET
ahs-3127	149	18	control	control	NOUN
ahs-3127	149	19	and	and	CCONJ
ahs-3127	149	20	treated	treat	VERB
ahs-3127	149	21	aleppo	aleppo	PROPN
ahs-3127	149	22	118	118	NUM
ahs-3127	149	23	and	and	CCONJ
ahs-3127	149	24	deir	deir	PROPN
ahs-3127	149	25	al	al	PROPN
ahs-3127	149	26	-	-	PROPN
ahs-3127	149	27	zour	zour	ADJ
ahs-3127	149	28	22	22	NUM
ahs-3127	149	29	cultivars	cultivar	NOUN
ahs-3127	149	30	,	,	PUNCT
ahs-3127	149	31	five	five	NUM
ahs-3127	149	32	months	month	NOUN
ahs-3127	149	33	after	after	ADP
ahs-3127	149	34	planting	plant	VERB
ahs-3127	149	35	.	.	PUNCT
ahs-3127	150	1	data	datum	NOUN
ahs-3127	150	2	were	be	AUX
ahs-3127	150	3	subjected	subject	VERB
ahs-3127	150	4	to	to	ADP
ahs-3127	150	5	duncan	duncan	PROPN
ahs-3127	150	6	’s	’s	PART
ahs-3127	150	7	test	test	NOUN
ahs-3127	150	8	with	with	ADP
ahs-3127	150	9	a	a	DET
ahs-3127	150	10	confidence	confidence	NOUN
ahs-3127	150	11	level	level	NOUN
ahs-3127	150	12	of	of	ADP
ahs-3127	150	13	95	95	NUM
ahs-3127	150	14	%	%	NOUN
ahs-3127	150	15	using	use	VERB
ahs-3127	150	16	statistica	statistica	PROPN
ahs-3127	150	17	program	program	PROPN
ahs-3127	150	18	.	.	PUNCT
ahs-3127	151	1	line	line	NOUN
ahs-3127	151	2	markers	marker	NOUN
ahs-3127	151	3	sharing	share	VERB
ahs-3127	151	4	a	a	DET
ahs-3127	151	5	letter	letter	NOUN
ahs-3127	151	6	are	be	AUX
ahs-3127	151	7	not	not	PART
ahs-3127	151	8	significantly	significantly	ADV
ahs-3127	151	9	different	different	ADJ
ahs-3127	151	10	(	(	PUNCT
ahs-3127	151	11	capital	capital	NOUN
ahs-3127	151	12	letters	letter	NOUN
ahs-3127	151	13	for	for	ADP
ahs-3127	151	14	plants	plant	NOUN
ahs-3127	151	15	with	with	ADP
ahs-3127	151	16	floral	floral	ADJ
ahs-3127	151	17	buds	bud	NOUN
ahs-3127	151	18	and	and	CCONJ
ahs-3127	151	19	small	small	ADJ
ahs-3127	151	20	letters	letter	NOUN
ahs-3127	151	21	for	for	ADP
ahs-3127	151	22	plants	plant	NOUN
ahs-3127	151	23	with	with	ADP
ahs-3127	151	24	flowers	flower	NOUN
ahs-3127	151	25	.	.	PUNCT
ahs-3127	152	1	adv	adv	PROPN
ahs-3127	152	2	.	.	PUNCT
ahs-3127	152	3	hort	hort	PROPN
ahs-3127	152	4	.	.	PUNCT
ahs-3127	153	1	sci	sci	PROPN
ahs-3127	153	2	.	.	PROPN
ahs-3127	153	3	,	,	PUNCT
ahs-3127	153	4	2018	2018	NUM
ahs-3127	153	5	32(1	32(1	NUM
ahs-3127	153	6	):	):	PUNCT
ahs-3127	153	7	79	79	NUM
ahs-3127	153	8	-	-	SYM
ahs-3127	153	9	92	92	NUM
ahs-3127	153	10	84	84	NUM
ahs-3127	153	11	elongation	elongation	NOUN
ahs-3127	153	12	showed	show	VERB
ahs-3127	153	13	no	no	DET
ahs-3127	153	14	significant	significant	ADJ
ahs-3127	153	15	difference	difference	NOUN
ahs-3127	153	16	between	between	ADP
ahs-3127	153	17	control	control	NOUN
ahs-3127	153	18	and	and	CCONJ
ahs-3127	153	19	treated	treat	VERB
ahs-3127	153	20	plants	plant	NOUN
ahs-3127	153	21	in	in	ADP
ahs-3127	153	22	each	each	DET
ahs-3127	153	23	cultivar	cultivar	NOUN
ahs-3127	153	24	.	.	PUNCT
ahs-3127	154	1	furthermore	furthermore	ADV
ahs-3127	154	2	,	,	PUNCT
ahs-3127	154	3	no	no	DET
ahs-3127	154	4	significant	significant	ADJ
ahs-3127	154	5	difference	difference	NOUN
ahs-3127	154	6	was	be	AUX
ahs-3127	154	7	recorded	record	VERB
ahs-3127	154	8	in	in	ADP
ahs-3127	154	9	the	the	DET
ahs-3127	154	10	cultivar	cultivar	NOUN
ahs-3127	154	11	aleppo	aleppo	PROPN
ahs-3127	154	12	118	118	NUM
ahs-3127	154	13	.	.	PUNCT
ahs-3127	155	1	two	two	NUM
ahs-3127	155	2	fiber	fiber	NOUN
ahs-3127	155	3	properties	property	NOUN
ahs-3127	155	4	,	,	PUNCT
ahs-3127	155	5	fiber	fiber	NOUN
ahs-3127	155	6	cohesion	cohesion	NOUN
ahs-3127	155	7	and	and	CCONJ
ahs-3127	155	8	micronaire	micronaire	NOUN
ahs-3127	155	9	,	,	PUNCT
ahs-3127	155	10	exhibited	exhibit	VERB
ahs-3127	155	11	no	no	DET
ahs-3127	155	12	significant	significant	ADJ
ahs-3127	155	13	difference	difference	NOUN
ahs-3127	155	14	between	between	ADP
ahs-3127	155	15	cultivars	cultivar	NOUN
ahs-3127	155	16	and	and	CCONJ
ahs-3127	155	17	between	between	ADP
ahs-3127	155	18	treatments	treatment	NOUN
ahs-3127	155	19	.	.	PUNCT
ahs-3127	156	1	a	a	DET
ahs-3127	156	2	significant	significant	ADJ
ahs-3127	156	3	increase	increase	NOUN
ahs-3127	156	4	in	in	ADP
ahs-3127	156	5	fiber	fiber	NOUN
ahs-3127	156	6	maturity	maturity	NOUN
ahs-3127	156	7	was	be	AUX
ahs-3127	156	8	observed	observe	VERB
ahs-3127	156	9	in	in	ADP
ahs-3127	156	10	the	the	DET
ahs-3127	156	11	treated	treat	VERB
ahs-3127	156	12	plants	plant	NOUN
ahs-3127	156	13	of	of	ADP
ahs-3127	156	14	aleppo	aleppo	PROPN
ahs-3127	156	15	118	118	NUM
ahs-3127	156	16	cultivar	cultivar	NOUN
ahs-3127	156	17	,	,	PUNCT
ahs-3127	156	18	whereas	whereas	SCONJ
ahs-3127	156	19	,	,	PUNCT
ahs-3127	156	20	a	a	DET
ahs-3127	156	21	non	non	ADJ
ahs-3127	156	22	-	-	ADJ
ahs-3127	156	23	significant	significant	ADJ
ahs-3127	156	24	increase	increase	NOUN
ahs-3127	156	25	was	be	AUX
ahs-3127	156	26	recorded	record	VERB
ahs-3127	156	27	in	in	ADP
ahs-3127	156	28	treated	treat	VERB
ahs-3127	156	29	plants	plant	NOUN
ahs-3127	156	30	of	of	ADP
ahs-3127	156	31	‘	'	PUNCT
ahs-3127	156	32	deir	deir	PROPN
ahs-3127	156	33	al	al	PROPN
ahs-3127	156	34	-	-	PROPN
ahs-3127	156	35	zour	zour	NOUN
ahs-3127	156	36	22	22	NUM
ahs-3127	156	37	’	'	PUNCT
ahs-3127	156	38	(	(	PUNCT
ahs-3127	156	39	fig	fig	NOUN
ahs-3127	156	40	.	.	PUNCT
ahs-3127	157	1	3	3	NUM
ahs-3127	157	2	)	)	PUNCT
ahs-3127	157	3	.	.	PUNCT
ahs-3127	158	1	ftir	ftir	PROPN
ahs-3127	158	2	-	-	ADJ
ahs-3127	158	3	atr	atr	PROPN
ahs-3127	158	4	spectra	spectra	ADJ
ahs-3127	158	5	acquisition	acquisition	NOUN
ahs-3127	158	6	of	of	ADP
ahs-3127	158	7	the	the	DET
ahs-3127	158	8	cotton	cotton	NOUN
ahs-3127	158	9	fiber	fiber	NOUN
ahs-3127	158	10	.	.	PUNCT
ahs-3127	159	1	the	the	DET
ahs-3127	159	2	ftir	ftir	PROPN
ahs-3127	159	3	-	-	ADJ
ahs-3127	159	4	atr	atr	ADJ
ahs-3127	159	5	spectra	spectra	NOUN
ahs-3127	159	6	of	of	ADP
ahs-3127	159	7	fiber	fiber	NOUN
ahs-3127	159	8	samples	sample	NOUN
ahs-3127	159	9	from	from	ADP
ahs-3127	159	10	control	control	NOUN
ahs-3127	159	11	and	and	CCONJ
ahs-3127	159	12	treated	treat	VERB
ahs-3127	159	13	plants	plant	NOUN
ahs-3127	159	14	of	of	ADP
ahs-3127	159	15	aleppo	aleppo	PROPN
ahs-3127	159	16	118	118	NUM
ahs-3127	159	17	and	and	CCONJ
ahs-3127	159	18	deir	deir	PROPN
ahs-3127	159	19	al	al	PROPN
ahs-3127	159	20	-	-	PROPN
ahs-3127	159	21	zour	zour	NOUN
ahs-3127	159	22	22	22	NUM
ahs-3127	159	23	cultivars	cultivar	NOUN
ahs-3127	159	24	were	be	AUX
ahs-3127	159	25	recorded	record	VERB
ahs-3127	159	26	.	.	PUNCT
ahs-3127	160	1	the	the	DET
ahs-3127	160	2	spectra	spectra	NOUN
ahs-3127	160	3	showed	show	VERB
ahs-3127	160	4	a	a	DET
ahs-3127	160	5	typical	typical	ADJ
ahs-3127	160	6	characteristic	characteristic	ADJ
ahs-3127	160	7	reflectance	reflectance	NOUN
ahs-3127	160	8	bands	band	NOUN
ahs-3127	160	9	for	for	ADP
ahs-3127	160	10	common	common	ADJ
ahs-3127	160	11	cotton	cotton	NOUN
ahs-3127	160	12	fiber	fiber	NOUN
ahs-3127	160	13	substances	substance	NOUN
ahs-3127	160	14	.	.	PUNCT
ahs-3127	161	1	the	the	DET
ahs-3127	161	2	spectra	spectra	NOUN
ahs-3127	161	3	of	of	ADP
ahs-3127	161	4	fiber	fiber	NOUN
ahs-3127	161	5	samples	sample	NOUN
ahs-3127	161	6	from	from	ADP
ahs-3127	161	7	control	control	NOUN
ahs-3127	161	8	and	and	CCONJ
ahs-3127	161	9	treated	treat	VERB
ahs-3127	161	10	‘	'	PUNCT
ahs-3127	161	11	aleppo	aleppo	PROPN
ahs-3127	161	12	118	118	NUM
ahs-3127	161	13	’	'	PUNCT
ahs-3127	161	14	plants	plant	NOUN
ahs-3127	161	15	were	be	AUX
ahs-3127	161	16	aligned	align	VERB
ahs-3127	161	17	for	for	ADP
ahs-3127	161	18	comparison	comparison	NOUN
ahs-3127	161	19	and	and	CCONJ
ahs-3127	161	20	showed	show	VERB
ahs-3127	161	21	minimum	minimum	ADJ
ahs-3127	161	22	variation	variation	NOUN
ahs-3127	161	23	(	(	PUNCT
ahs-3127	161	24	fig	fig	NOUN
ahs-3127	161	25	.	.	PUNCT
ahs-3127	162	1	4	4	NUM
ahs-3127	162	2	a	a	PRON
ahs-3127	162	3	)	)	PUNCT
ahs-3127	162	4	.	.	PUNCT
ahs-3127	163	1	the	the	DET
ahs-3127	163	2	spectra	spectra	NOUN
ahs-3127	163	3	of	of	ADP
ahs-3127	163	4	fiber	fiber	NOUN
ahs-3127	163	5	from	from	ADP
ahs-3127	163	6	‘	'	PUNCT
ahs-3127	163	7	aleppo	aleppo	PROPN
ahs-3127	163	8	118	118	NUM
ahs-3127	163	9	’	'	PUNCT
ahs-3127	163	10	control	control	NOUN
ahs-3127	163	11	plants	plant	NOUN
ahs-3127	163	12	showed	show	VERB
ahs-3127	163	13	15	15	NUM
ahs-3127	163	14	distinctive	distinctive	ADJ
ahs-3127	163	15	bands	band	NOUN
ahs-3127	163	16	centered	center	VERB
ahs-3127	163	17	at	at	ADP
ahs-3127	163	18	3310	3310	NUM
ahs-3127	163	19	,	,	PUNCT
ahs-3127	163	20	2890	2890	NUM
ahs-3127	163	21	,	,	PUNCT
ahs-3127	163	22	1740	1740	NUM
ahs-3127	163	23	,	,	PUNCT
ahs-3127	163	24	1605	1605	NUM
ahs-3127	163	25	,	,	PUNCT
ahs-3127	163	26	1429	1429	NUM
ahs-3127	163	27	,	,	PUNCT
ahs-3127	163	28	1372	1372	NUM
ahs-3127	163	29	,	,	PUNCT
ahs-3127	163	30	1315	1315	NUM
ahs-3127	163	31	,	,	PUNCT
ahs-3127	163	32	1203	1203	NUM
ahs-3127	163	33	,	,	PUNCT
ahs-3127	163	34	1160	1160	NUM
ahs-3127	163	35	,	,	PUNCT
ahs-3127	163	36	1103	1103	NUM
ahs-3127	163	37	,	,	PUNCT
ahs-3127	163	38	1055	1055	NUM
ahs-3127	163	39	,	,	PUNCT
ahs-3127	163	40	1020	1020	NUM
ahs-3127	163	41	,	,	PUNCT
ahs-3127	163	42	675	675	NUM
ahs-3127	163	43	,	,	PUNCT
ahs-3127	163	44	554	554	NUM
ahs-3127	163	45	and	and	CCONJ
ahs-3127	163	46	431	431	NUM
ahs-3127	163	47	cm-1	cm-1	NOUN
ahs-3127	163	48	.	.	PUNCT
ahs-3127	164	1	the	the	DET
ahs-3127	164	2	vibration	vibration	NOUN
ahs-3127	164	3	at	at	ADP
ahs-3127	164	4	1429	1429	NUM
ahs-3127	164	5	cm-1	cm-1	PRON
ahs-3127	164	6	is	be	AUX
ahs-3127	164	7	designated	designate	VERB
ahs-3127	164	8	and	and	CCONJ
ahs-3127	164	9	assigned	assign	VERB
ahs-3127	164	10	as	as	ADP
ahs-3127	164	11	a	a	DET
ahs-3127	164	12	“	"	PUNCT
ahs-3127	164	13	crystalline	crystalline	ADJ
ahs-3127	164	14	”	"	PUNCT
ahs-3127	164	15	absorption	absorption	NOUN
ahs-3127	164	16	band	band	NOUN
ahs-3127	164	17	of	of	ADP
ahs-3127	164	18	the	the	DET
ahs-3127	164	19	fiber	fiber	NOUN
ahs-3127	164	20	(	(	PUNCT
ahs-3127	164	21	abidi	abidi	PROPN
ahs-3127	164	22	et	et	PROPN
ahs-3127	164	23	al	al	PROPN
ahs-3127	164	24	.	.	PROPN
ahs-3127	164	25	,	,	PUNCT
ahs-3127	164	26	2014	2014	NUM
ahs-3127	164	27	)	)	PUNCT
ahs-3127	164	28	.	.	PUNCT
ahs-3127	165	1	the	the	DET
ahs-3127	165	2	band	band	NOUN
ahs-3127	165	3	at	at	ADP
ahs-3127	165	4	1372	1372	NUM
ahs-3127	165	5	cm-1	cm-1	PART
ahs-3127	165	6	vibration	vibration	NOUN
ahs-3127	165	7	is	be	AUX
ahs-3127	165	8	assigned	assign	VERB
ahs-3127	165	9	to	to	ADP
ahs-3127	165	10	c	c	NOUN
ahs-3127	165	11	-	-	PUNCT
ahs-3127	165	12	h	h	NOUN
ahs-3127	165	13	bending	bending	NOUN
ahs-3127	165	14	,	,	PUNCT
ahs-3127	165	15	and	and	CCONJ
ahs-3127	165	16	it	it	PRON
ahs-3127	165	17	may	may	AUX
ahs-3127	165	18	be	be	AUX
ahs-3127	165	19	most	most	ADV
ahs-3127	165	20	suitable	suitable	ADJ
ahs-3127	165	21	for	for	ADP
ahs-3127	165	22	indicating	indicate	VERB
ahs-3127	165	23	cellulose	cellulose	NOUN
ahs-3127	165	24	crystallinity	crystallinity	NOUN
ahs-3127	165	25	associated	associate	VERB
ahs-3127	165	26	with	with	ADP
ahs-3127	165	27	the	the	DET
ahs-3127	165	28	band	band	NOUN
ahs-3127	165	29	at	at	ADP
ahs-3127	165	30	2890	2890	NUM
ahs-3127	165	31	cm-1	cm-1	NOUN
ahs-3127	165	32	.	.	PUNCT
ahs-3127	166	1	the	the	DET
ahs-3127	166	2	spectra	spectra	NOUN
ahs-3127	166	3	of	of	ADP
ahs-3127	166	4	control	control	NOUN
ahs-3127	166	5	and	and	CCONJ
ahs-3127	166	6	treated	treat	VERB
ahs-3127	166	7	samples	sample	NOUN
ahs-3127	166	8	were	be	AUX
ahs-3127	166	9	highly	highly	ADV
ahs-3127	166	10	similar	similar	ADJ
ahs-3127	166	11	except	except	SCONJ
ahs-3127	166	12	for	for	ADP
ahs-3127	166	13	the	the	DET
ahs-3127	166	14	band	band	NOUN
ahs-3127	166	15	at	at	ADP
ahs-3127	166	16	1740	1740	NUM
ahs-3127	166	17	cm-1	cm-1	NOUN
ahs-3127	166	18	which	which	PRON
ahs-3127	166	19	was	be	AUX
ahs-3127	166	20	absent	absent	ADJ
ahs-3127	166	21	in	in	ADP
ahs-3127	166	22	the	the	DET
ahs-3127	166	23	treated	treat	VERB
ahs-3127	166	24	sample	sample	NOUN
ahs-3127	166	25	.	.	PUNCT
ahs-3127	167	1	similar	similar	ADJ
ahs-3127	167	2	spectra	spectra	ADJ
ahs-3127	167	3	range	range	NOUN
ahs-3127	167	4	was	be	AUX
ahs-3127	167	5	observed	observe	VERB
ahs-3127	167	6	in	in	ADP
ahs-3127	167	7	deir	deir	PROPN
ahs-3127	167	8	al	al	PROPN
ahs-3127	167	9	-	-	PROPN
ahs-3127	167	10	zour	zour	PROPN
ahs-3127	167	11	22	22	NUM
ahs-3127	167	12	cultivar	cultivar	NOUN
ahs-3127	167	13	.	.	PUNCT
ahs-3127	168	1	however	however	ADV
ahs-3127	168	2	,	,	PUNCT
ahs-3127	168	3	few	few	ADJ
ahs-3127	168	4	noticeable	noticeable	ADJ
ahs-3127	168	5	new	new	ADJ
ahs-3127	168	6	bands	band	NOUN
ahs-3127	168	7	with	with	ADP
ahs-3127	168	8	distinctive	distinctive	ADJ
ahs-3127	168	9	structures	structure	NOUN
ahs-3127	168	10	were	be	AUX
ahs-3127	168	11	observed	observe	VERB
ahs-3127	168	12	in	in	ADP
ahs-3127	168	13	the	the	DET
ahs-3127	168	14	treated	treat	VERB
ahs-3127	168	15	sample	sample	NOUN
ahs-3127	168	16	at	at	ADP
ahs-3127	168	17	2890	2890	NUM
ahs-3127	168	18	,	,	PUNCT
ahs-3127	168	19	1740	1740	NUM
ahs-3127	168	20	,	,	PUNCT
ahs-3127	168	21	and	and	CCONJ
ahs-3127	168	22	1605	1605	NUM
ahs-3127	168	23	cm-1	cm-1	PROPN
ahs-3127	168	24	.	.	PUNCT
ahs-3127	169	1	the	the	DET
ahs-3127	169	2	band	band	NOUN
ahs-3127	169	3	centered	center	VERB
ahs-3127	169	4	at	at	ADP
ahs-3127	169	5	2890	2890	NUM
ahs-3127	169	6	cm-1	cm-1	NOUN
ahs-3127	169	7	contains	contain	VERB
ahs-3127	169	8	two	two	NUM
ahs-3127	169	9	prominent	prominent	ADJ
ahs-3127	169	10	peaks	peak	NOUN
ahs-3127	169	11	vibrations	vibration	NOUN
ahs-3127	169	12	at	at	ADP
ahs-3127	169	13	2910	2910	NUM
ahs-3127	169	14	and	and	CCONJ
ahs-3127	169	15	2847	2847	NUM
ahs-3127	169	16	cm-1	cm-1	NOUN
ahs-3127	169	17	,	,	PUNCT
ahs-3127	169	18	which	which	PRON
ahs-3127	169	19	are	be	AUX
ahs-3127	169	20	assigned	assign	VERB
ahs-3127	169	21	to	to	PART
ahs-3127	169	22	ch2	ch2	VERB
ahs-3127	169	23	asymmetrical	asymmetrical	ADJ
ahs-3127	169	24	and	and	CCONJ
ahs-3127	169	25	symmetrical	symmetrical	ADJ
ahs-3127	169	26	stretching	stretching	NOUN
ahs-3127	169	27	,	,	PUNCT
ahs-3127	169	28	cultivar	cultivar	NOUN
ahs-3127	169	29	plant	plant	NOUN
ahs-3127	169	30	height	height	NOUN
ahs-3127	169	31	(	(	PUNCT
ahs-3127	169	32	cm	cm	NOUN
ahs-3127	169	33	)	)	PUNCT
ahs-3127	169	34	root	root	NOUN
ahs-3127	169	35	depth	depth	NOUN
ahs-3127	169	36	(	(	PUNCT
ahs-3127	169	37	cm	cm	NOUN
ahs-3127	169	38	)	)	PUNCT
ahs-3127	169	39	no	no	NOUN
ahs-3127	169	40	.	.	PUNCT
ahs-3127	170	1	secondary	secondary	ADJ
ahs-3127	170	2	roots	root	NOUN
ahs-3127	170	3	control	control	VERB
ahs-3127	170	4	treatment	treatment	NOUN
ahs-3127	170	5	control	control	NOUN
ahs-3127	170	6	treatment	treatment	NOUN
ahs-3127	170	7	control	control	NOUN
ahs-3127	170	8	treatment	treatment	NOUN
ahs-3127	170	9	aleppo	aleppo	PROPN
ahs-3127	170	10	118	118	NUM
ahs-3127	170	11	99.3±3.5	99.3±3.5	NUM
ahs-3127	170	12	ab	ab	PROPN
ahs-3127	170	13	105.9±5.5	105.9±5.5	NUM
ahs-3127	170	14	a	a	DET
ahs-3127	170	15	19.8±2.2	19.8±2.2	NUM
ahs-3127	170	16	17.7±2.1	17.7±2.1	NUM
ahs-3127	170	17	10.4±0.8	10.4±0.8	NUM
ahs-3127	170	18	ab	ab	PROPN
ahs-3127	170	19	13.1±0.8	13.1±0.8	NUM
ahs-3127	170	20	a	a	DET
ahs-3127	170	21	deir	deir	PROPN
ahs-3127	170	22	al	al	PROPN
ahs-3127	170	23	-	-	PROPN
ahs-3127	170	24	zour	zour	PROPN
ahs-3127	171	1	22	22	NUM
ahs-3127	172	1	80.3±3.8	80.3±3.8	NUM
ahs-3127	172	2	c	c	NOUN
ahs-3127	172	3	87.6±5.1	87.6±5.1	NUM
ahs-3127	172	4	bc	bc	PROPN
ahs-3127	173	1	18.3±2.8	18.3±2.8	NUM
ahs-3127	173	2	17.0±0.7	17.0±0.7	NUM
ahs-3127	174	1	9.9±0.9	9.9±0.9	NUM
ahs-3127	174	2	b	b	NOUN
ahs-3127	174	3	11.4±1.1	11.4±1.1	NUM
ahs-3127	174	4	ab	ab	PROPN
ahs-3127	174	5	table	table	NOUN
ahs-3127	174	6	2	2	NUM
ahs-3127	174	7	end	end	NOUN
ahs-3127	174	8	of	of	ADP
ahs-3127	174	9	season	season	NOUN
ahs-3127	174	10	measurements	measurement	NOUN
ahs-3127	174	11	of	of	ADP
ahs-3127	174	12	plant	plant	NOUN
ahs-3127	174	13	stem	stem	NOUN
ahs-3127	174	14	height	height	NOUN
ahs-3127	174	15	,	,	PUNCT
ahs-3127	174	16	taproot	taproot	ADJ
ahs-3127	174	17	depth	depth	NOUN
ahs-3127	174	18	and	and	CCONJ
ahs-3127	174	19	number	number	NOUN
ahs-3127	174	20	of	of	ADP
ahs-3127	174	21	secondary	secondary	ADJ
ahs-3127	174	22	roots	root	NOUN
ahs-3127	174	23	in	in	ADP
ahs-3127	174	24	control	control	NOUN
ahs-3127	174	25	and	and	CCONJ
ahs-3127	174	26	treated	treat	VERB
ahs-3127	174	27	plants	plant	NOUN
ahs-3127	174	28	of	of	ADP
ahs-3127	174	29	aleppo	aleppo	PROPN
ahs-3127	174	30	118	118	NUM
ahs-3127	174	31	and	and	CCONJ
ahs-3127	174	32	deir	deir	PROPN
ahs-3127	174	33	al	al	PROPN
ahs-3127	174	34	-	-	PROPN
ahs-3127	174	35	zour	zour	PROPN
ahs-3127	174	36	22	22	NUM
ahs-3127	174	37	cultivars	cultivar	NOUN
ahs-3127	174	38	data	datum	NOUN
ahs-3127	174	39	were	be	AUX
ahs-3127	174	40	subjected	subject	VERB
ahs-3127	174	41	to	to	ADP
ahs-3127	174	42	duncan	duncan	PROPN
ahs-3127	174	43	’s	’s	PART
ahs-3127	174	44	test	test	NOUN
ahs-3127	174	45	with	with	ADP
ahs-3127	174	46	a	a	DET
ahs-3127	174	47	confidence	confidence	NOUN
ahs-3127	174	48	level	level	NOUN
ahs-3127	174	49	of	of	ADP
ahs-3127	174	50	95	95	NUM
ahs-3127	174	51	%	%	NOUN
ahs-3127	174	52	using	use	VERB
ahs-3127	174	53	statistica	statistica	PROPN
ahs-3127	174	54	program	program	PROPN
ahs-3127	174	55	.	.	PUNCT
ahs-3127	175	1	numbers	number	NOUN
ahs-3127	175	2	in	in	ADP
ahs-3127	175	3	rows	row	NOUN
ahs-3127	175	4	and	and	CCONJ
ahs-3127	175	5	columns	column	NOUN
ahs-3127	175	6	sharing	share	VERB
ahs-3127	175	7	a	a	DET
ahs-3127	175	8	letter	letter	NOUN
ahs-3127	175	9	in	in	ADP
ahs-3127	175	10	each	each	DET
ahs-3127	175	11	block	block	NOUN
ahs-3127	175	12	(	(	PUNCT
ahs-3127	175	13	plant	plant	NOUN
ahs-3127	175	14	height	height	NOUN
ahs-3127	175	15	and	and	CCONJ
ahs-3127	175	16	no	no	INTJ
ahs-3127	175	17	.	.	PUNCT
ahs-3127	176	1	secondary	secondary	ADJ
ahs-3127	176	2	roots	root	NOUN
ahs-3127	176	3	)	)	PUNCT
ahs-3127	176	4	are	be	AUX
ahs-3127	176	5	not	not	PART
ahs-3127	176	6	significantly	significantly	ADV
ahs-3127	176	7	different	different	ADJ
ahs-3127	176	8	.	.	PUNCT
ahs-3127	177	1	data	datum	NOUN
ahs-3127	177	2	represent	represent	VERB
ahs-3127	177	3	means	mean	NOUN
ahs-3127	177	4	and	and	CCONJ
ahs-3127	177	5	standard	standard	ADJ
ahs-3127	177	6	error	error	NOUN
ahs-3127	177	7	of	of	ADP
ahs-3127	177	8	three	three	NUM
ahs-3127	177	9	replications	replication	NOUN
ahs-3127	177	10	.	.	PUNCT
ahs-3127	178	1	fig	fig	NOUN
ahs-3127	178	2	.	.	PUNCT
ahs-3127	179	1	3	3	NUM
ahs-3127	179	2	fiber	fiber	NOUN
ahs-3127	179	3	properties	property	NOUN
ahs-3127	179	4	of	of	ADP
ahs-3127	179	5	control	control	NOUN
ahs-3127	179	6	and	and	CCONJ
ahs-3127	179	7	treated	treat	VERB
ahs-3127	179	8	aleppo	aleppo	PROPN
ahs-3127	179	9	118	118	NUM
ahs-3127	179	10	and	and	CCONJ
ahs-3127	179	11	deir	deir	PROPN
ahs-3127	179	12	alzour	alzour	VERB
ahs-3127	179	13	22	22	NUM
ahs-3127	179	14	cultivars	cultivar	NOUN
ahs-3127	179	15	.	.	PUNCT
ahs-3127	180	1	fiber	fiber	NOUN
ahs-3127	180	2	length	length	NOUN
ahs-3127	180	3	(	(	PUNCT
ahs-3127	180	4	a	a	NOUN
ahs-3127	180	5	)	)	PUNCT
ahs-3127	180	6	,	,	PUNCT
ahs-3127	180	7	fiber	fiber	NOUN
ahs-3127	180	8	strength	strength	NOUN
ahs-3127	180	9	(	(	PUNCT
ahs-3127	180	10	b	b	NOUN
ahs-3127	180	11	)	)	PUNCT
ahs-3127	180	12	,	,	PUNCT
ahs-3127	180	13	fiber	fiber	NOUN
ahs-3127	180	14	cohesion	cohesion	NOUN
ahs-3127	180	15	(	(	PUNCT
ahs-3127	180	16	c	c	NOUN
ahs-3127	180	17	)	)	PUNCT
ahs-3127	180	18	,	,	PUNCT
ahs-3127	180	19	fiber	fiber	NOUN
ahs-3127	180	20	elongation	elongation	NOUN
ahs-3127	180	21	(	(	PUNCT
ahs-3127	180	22	d	d	NOUN
ahs-3127	180	23	)	)	PUNCT
ahs-3127	180	24	,	,	PUNCT
ahs-3127	180	25	micronaire	micronaire	NOUN
ahs-3127	180	26	(	(	PUNCT
ahs-3127	180	27	e	e	NOUN
ahs-3127	180	28	)	)	PUNCT
ahs-3127	180	29	,	,	PUNCT
ahs-3127	180	30	and	and	CCONJ
ahs-3127	180	31	maturity	maturity	NOUN
ahs-3127	180	32	index	index	NOUN
ahs-3127	180	33	(	(	PUNCT
ahs-3127	180	34	f	f	NOUN
ahs-3127	180	35	)	)	PUNCT
ahs-3127	180	36	.	.	PUNCT
ahs-3127	181	1	data	datum	NOUN
ahs-3127	181	2	were	be	AUX
ahs-3127	181	3	subjected	subject	VERB
ahs-3127	181	4	to	to	ADP
ahs-3127	181	5	duncan	duncan	PROPN
ahs-3127	181	6	’s	’s	PART
ahs-3127	181	7	test	test	NOUN
ahs-3127	181	8	with	with	ADP
ahs-3127	181	9	a	a	DET
ahs-3127	181	10	confidence	confidence	NOUN
ahs-3127	181	11	level	level	NOUN
ahs-3127	181	12	of	of	ADP
ahs-3127	181	13	95	95	NUM
ahs-3127	181	14	%	%	NOUN
ahs-3127	181	15	using	use	VERB
ahs-3127	181	16	statistica	statistica	PROPN
ahs-3127	181	17	program	program	NOUN
ahs-3127	181	18	.	.	PUNCT
ahs-3127	182	1	columns	column	NOUN
ahs-3127	182	2	sharing	share	VERB
ahs-3127	182	3	a	a	DET
ahs-3127	182	4	letter	letter	NOUN
ahs-3127	182	5	are	be	AUX
ahs-3127	182	6	not	not	PART
ahs-3127	182	7	significantly	significantly	ADV
ahs-3127	182	8	different	different	ADJ
ahs-3127	182	9	.	.	PUNCT
ahs-3127	183	1	data	datum	NOUN
ahs-3127	183	2	represent	represent	VERB
ahs-3127	183	3	means	mean	NOUN
ahs-3127	183	4	and	and	CCONJ
ahs-3127	183	5	standard	standard	ADJ
ahs-3127	183	6	error	error	NOUN
ahs-3127	183	7	of	of	ADP
ahs-3127	183	8	three	three	NUM
ahs-3127	183	9	replications	replication	NOUN
ahs-3127	183	10	.	.	PUNCT
ahs-3127	184	1	jawdat	jawdat	PROPN
ahs-3127	184	2	et	et	PROPN
ahs-3127	184	3	al	al	PROPN
ahs-3127	184	4	.	.	PUNCT
ahs-3127	185	1	cotton	cotton	NOUN
ahs-3127	185	2	behaviour	behaviour	NOUN
ahs-3127	185	3	under	under	ADP
ahs-3127	185	4	water	water	NOUN
ahs-3127	185	5	stress	stress	NOUN
ahs-3127	185	6	85	85	NUM
ahs-3127	185	7	respectively	respectively	ADV
ahs-3127	185	8	.	.	PUNCT
ahs-3127	186	1	as	as	ADP
ahs-3127	186	2	for	for	ADP
ahs-3127	186	3	the	the	DET
ahs-3127	186	4	second	second	ADJ
ahs-3127	186	5	band	band	NOUN
ahs-3127	186	6	at	at	ADP
ahs-3127	186	7	1740	1740	NUM
ahs-3127	186	8	cm-1	cm-1	NOUN
ahs-3127	186	9	,	,	PUNCT
ahs-3127	186	10	which	which	PRON
ahs-3127	186	11	is	be	AUX
ahs-3127	186	12	assigned	assign	VERB
ahs-3127	186	13	to	to	ADP
ahs-3127	186	14	a	a	DET
ahs-3127	186	15	carboxylic	carboxylic	ADJ
ahs-3127	186	16	ester	ester	NOUN
ahs-3127	186	17	group	group	NOUN
ahs-3127	186	18	(	(	PUNCT
ahs-3127	186	19	c	c	NOUN
ahs-3127	186	20	=	=	NOUN
ahs-3127	186	21	o	o	NOUN
ahs-3127	186	22	stretching	stretching	NOUN
ahs-3127	186	23	)	)	PUNCT
ahs-3127	186	24	,	,	PUNCT
ahs-3127	186	25	a	a	DET
ahs-3127	186	26	clearer	clear	ADJ
ahs-3127	186	27	structure	structure	NOUN
ahs-3127	186	28	is	be	AUX
ahs-3127	186	29	noticed	notice	VERB
ahs-3127	186	30	in	in	ADP
ahs-3127	186	31	the	the	DET
ahs-3127	186	32	treated	treat	VERB
ahs-3127	186	33	sample	sample	NOUN
ahs-3127	186	34	in	in	ADP
ahs-3127	186	35	comparison	comparison	NOUN
ahs-3127	186	36	with	with	ADP
ahs-3127	186	37	the	the	DET
ahs-3127	186	38	control	control	NOUN
ahs-3127	186	39	.	.	PUNCT
ahs-3127	187	1	another	another	DET
ahs-3127	187	2	distinctive	distinctive	ADJ
ahs-3127	187	3	banding	banding	NOUN
ahs-3127	187	4	pattern	pattern	NOUN
ahs-3127	187	5	is	be	AUX
ahs-3127	187	6	observed	observe	VERB
ahs-3127	187	7	at	at	ADP
ahs-3127	187	8	1605	1605	NUM
ahs-3127	187	9	cm-1	cm-1	X
ahs-3127	187	10	(	(	PUNCT
ahs-3127	187	11	adsorbed	adsorb	VERB
ahs-3127	187	12	water	water	NOUN
ahs-3127	187	13	)	)	PUNCT
ahs-3127	187	14	,	,	PUNCT
ahs-3127	187	15	which	which	PRON
ahs-3127	187	16	is	be	AUX
ahs-3127	187	17	neither	neither	PRON
ahs-3127	187	18	seen	see	VERB
ahs-3127	187	19	in	in	ADP
ahs-3127	187	20	the	the	DET
ahs-3127	187	21	treated	treat	VERB
ahs-3127	187	22	aleppo	aleppo	PROPN
ahs-3127	187	23	118	118	NUM
ahs-3127	187	24	cultivar	cultivar	NOUN
ahs-3127	187	25	and	and	CCONJ
ahs-3127	187	26	nor	nor	CCONJ
ahs-3127	187	27	observed	observe	VERB
ahs-3127	187	28	in	in	ADP
ahs-3127	187	29	deir	deir	PROPN
ahs-3127	187	30	alzour	alzour	PROPN
ahs-3127	187	31	22	22	NUM
ahs-3127	187	32	cultivar	cultivar	NOUN
ahs-3127	187	33	control	control	NOUN
ahs-3127	187	34	sample	sample	NOUN
ahs-3127	187	35	.	.	PUNCT
ahs-3127	188	1	this	this	DET
ahs-3127	188	2	band	band	NOUN
ahs-3127	188	3	contains	contain	VERB
ahs-3127	188	4	two	two	NUM
ahs-3127	188	5	prominent	prominent	ADJ
ahs-3127	188	6	peaks	peak	NOUN
ahs-3127	188	7	vibrations	vibration	NOUN
ahs-3127	188	8	at	at	ADP
ahs-3127	188	9	1577	1577	NUM
ahs-3127	188	10	and	and	CCONJ
ahs-3127	188	11	1540	1540	NUM
ahs-3127	188	12	cm-1	cm-1	X
ahs-3127	188	13	(	(	PUNCT
ahs-3127	188	14	fig	fig	NOUN
ahs-3127	188	15	.	.	PUNCT
ahs-3127	189	1	4	4	NUM
ahs-3127	189	2	b	b	NOUN
ahs-3127	189	3	)	)	PUNCT
ahs-3127	189	4	.	.	PUNCT
ahs-3127	190	1	measurement	measurement	NOUN
ahs-3127	190	2	of	of	ADP
ahs-3127	190	3	crystallinity	crystallinity	NOUN
ahs-3127	190	4	by	by	ADP
ahs-3127	190	5	conventional	conventional	ADJ
ahs-3127	190	6	x	x	NOUN
ahs-3127	190	7	-	-	NOUN
ahs-3127	190	8	ray	ray	NOUN
ahs-3127	190	9	powder	powder	NOUN
ahs-3127	190	10	diffractometry	diffractometry	NOUN
ahs-3127	190	11	.	.	PUNCT
ahs-3127	191	1	fiber	fiber	NOUN
ahs-3127	191	2	analysis	analysis	NOUN
ahs-3127	191	3	using	use	VERB
ahs-3127	191	4	the	the	DET
ahs-3127	191	5	xrd	xrd	NOUN
ahs-3127	191	6	procedure	procedure	NOUN
ahs-3127	191	7	showed	show	VERB
ahs-3127	191	8	a	a	DET
ahs-3127	191	9	typical	typical	ADJ
ahs-3127	191	10	cellulose	cellulose	NOUN
ahs-3127	191	11	pattern	pattern	NOUN
ahs-3127	191	12	in	in	ADP
ahs-3127	191	13	both	both	PRON
ahs-3127	191	14	control	control	NOUN
ahs-3127	191	15	and	and	CCONJ
ahs-3127	191	16	treated	treat	VERB
ahs-3127	191	17	plants	plant	NOUN
ahs-3127	191	18	for	for	ADP
ahs-3127	191	19	each	each	DET
ahs-3127	191	20	cultivar	cultivar	NOUN
ahs-3127	191	21	(	(	PUNCT
ahs-3127	191	22	fig	fig	NOUN
ahs-3127	191	23	.	.	PUNCT
ahs-3127	191	24	5	5	NUM
ahs-3127	191	25	)	)	PUNCT
ahs-3127	191	26	.	.	PUNCT
ahs-3127	192	1	the	the	DET
ahs-3127	192	2	amount	amount	NOUN
ahs-3127	192	3	of	of	ADP
ahs-3127	192	4	crystalline	crystalline	NOUN
ahs-3127	192	5	cellulose	cellulose	NOUN
ahs-3127	192	6	in	in	ADP
ahs-3127	192	7	studied	studied	ADJ
ahs-3127	192	8	samples	sample	NOUN
ahs-3127	192	9	was	be	AUX
ahs-3127	192	10	between	between	ADP
ahs-3127	192	11	66	66	NUM
ahs-3127	192	12	-	-	SYM
ahs-3127	192	13	75	75	NUM
ahs-3127	192	14	%	%	NOUN
ahs-3127	192	15	(	(	PUNCT
ahs-3127	192	16	table	table	NOUN
ahs-3127	192	17	3	3	NUM
ahs-3127	192	18	)	)	PUNCT
ahs-3127	192	19	.	.	PUNCT
ahs-3127	193	1	as	as	SCONJ
ahs-3127	193	2	seen	see	VERB
ahs-3127	193	3	in	in	ADP
ahs-3127	193	4	table	table	NOUN
ahs-3127	193	5	3	3	NUM
ahs-3127	193	6	,	,	PUNCT
ahs-3127	193	7	there	there	PRON
ahs-3127	193	8	was	be	VERB
ahs-3127	193	9	a	a	DET
ahs-3127	193	10	minor	minor	ADJ
ahs-3127	193	11	difference	difference	NOUN
ahs-3127	193	12	between	between	ADP
ahs-3127	193	13	the	the	DET
ahs-3127	193	14	ci	ci	NOUN
ahs-3127	193	15	values	value	NOUN
ahs-3127	193	16	of	of	ADP
ahs-3127	193	17	the	the	DET
ahs-3127	193	18	treated	treat	VERB
ahs-3127	193	19	and	and	CCONJ
ahs-3127	193	20	control	control	NOUN
ahs-3127	193	21	‘	'	PUNCT
ahs-3127	193	22	deir	deir	PROPN
ahs-3127	193	23	al	al	PROPN
ahs-3127	193	24	-	-	PROPN
ahs-3127	193	25	zour	zour	ADJ
ahs-3127	193	26	22	22	NUM
ahs-3127	193	27	’	'	PUNCT
ahs-3127	193	28	samples	sample	NOUN
ahs-3127	193	29	.	.	PUNCT
ahs-3127	194	1	however	however	ADV
ahs-3127	194	2	,	,	PUNCT
ahs-3127	194	3	there	there	PRON
ahs-3127	194	4	is	be	VERB
ahs-3127	194	5	no	no	DET
ahs-3127	194	6	variation	variation	NOUN
ahs-3127	194	7	between	between	ADP
ahs-3127	194	8	control	control	NOUN
ahs-3127	194	9	and	and	CCONJ
ahs-3127	194	10	treated	treat	VERB
ahs-3127	194	11	samples	sample	NOUN
ahs-3127	194	12	of	of	ADP
ahs-3127	194	13	aleppo	aleppo	PROPN
ahs-3127	194	14	118	118	NUM
ahs-3127	194	15	cultivar	cultivar	NOUN
ahs-3127	194	16	.	.	PUNCT
ahs-3127	195	1	thermogravimetry	thermogravimetry	NOUN
ahs-3127	195	2	analysis	analysis	NOUN
ahs-3127	195	3	(	(	PUNCT
ahs-3127	195	4	tga	tga	NOUN
ahs-3127	195	5	)	)	PUNCT
ahs-3127	195	6	and	and	CCONJ
ahs-3127	195	7	differential	differential	NOUN
ahs-3127	195	8	scanning	scanning	NOUN
ahs-3127	195	9	calorimetry	calorimetry	NOUN
ahs-3127	195	10	(	(	PUNCT
ahs-3127	195	11	dsc	dsc	NOUN
ahs-3127	195	12	)	)	PUNCT
ahs-3127	195	13	.	.	PUNCT
ahs-3127	196	1	typical	typical	ADJ
ahs-3127	196	2	dynamic	dynamic	ADJ
ahs-3127	196	3	tga	tga	NOUN
ahs-3127	196	4	thermograms	thermogram	NOUN
ahs-3127	196	5	of	of	ADP
ahs-3127	196	6	the	the	DET
ahs-3127	196	7	studied	study	VERB
ahs-3127	196	8	samples	sample	NOUN
ahs-3127	196	9	have	have	AUX
ahs-3127	196	10	been	be	AUX
ahs-3127	196	11	recorded	record	VERB
ahs-3127	196	12	and	and	CCONJ
ahs-3127	196	13	are	be	AUX
ahs-3127	196	14	shown	show	VERB
ahs-3127	196	15	in	in	ADP
ahs-3127	196	16	figure	figure	NOUN
ahs-3127	196	17	6	6	NUM
ahs-3127	196	18	a.	a.	NOUN
ahs-3127	196	19	the	the	DET
ahs-3127	196	20	tga	tga	PROPN
ahs-3127	196	21	thermograms	thermograms	PROPN
ahs-3127	196	22	show	show	VERB
ahs-3127	196	23	a	a	DET
ahs-3127	196	24	slight	slight	ADJ
ahs-3127	196	25	decrease	decrease	NOUN
ahs-3127	196	26	in	in	ADP
ahs-3127	196	27	the	the	DET
ahs-3127	196	28	weight	weight	NOUN
ahs-3127	196	29	and	and	CCONJ
ahs-3127	196	30	one	one	NUM
ahs-3127	196	31	significant	significant	ADJ
ahs-3127	196	32	step	step	NOUN
ahs-3127	196	33	at	at	ADP
ahs-3127	196	34	high	high	ADJ
ahs-3127	196	35	temperature	temperature	NOUN
ahs-3127	196	36	.	.	PUNCT
ahs-3127	197	1	differential	differential	ADJ
ahs-3127	197	2	scanning	scan	VERB
ahs-3127	197	3	calorimetry	calorimetry	NOUN
ahs-3127	197	4	(	(	PUNCT
ahs-3127	197	5	dsc	dsc	NOUN
ahs-3127	197	6	)	)	PUNCT
ahs-3127	197	7	was	be	AUX
ahs-3127	197	8	used	use	VERB
ahs-3127	197	9	to	to	PART
ahs-3127	197	10	locate	locate	VERB
ahs-3127	197	11	a	a	DET
ahs-3127	197	12	possible	possible	ADJ
ahs-3127	197	13	glass	glass	NOUN
ahs-3127	197	14	transition	transition	NOUN
ahs-3127	197	15	temperature	temperature	NOUN
ahs-3127	197	16	(	(	PUNCT
ahs-3127	197	17	tg	tg	PROPN
ahs-3127	197	18	)	)	PUNCT
ahs-3127	197	19	of	of	ADP
ahs-3127	197	20	the	the	DET
ahs-3127	197	21	samples	sample	NOUN
ahs-3127	197	22	.	.	PUNCT
ahs-3127	198	1	the	the	DET
ahs-3127	198	2	glass	glass	NOUN
ahs-3127	198	3	transition	transition	NOUN
ahs-3127	198	4	temperature	temperature	NOUN
ahs-3127	198	5	could	could	AUX
ahs-3127	198	6	not	not	PART
ahs-3127	198	7	be	be	AUX
ahs-3127	198	8	observed	observe	VERB
ahs-3127	198	9	in	in	ADP
ahs-3127	198	10	all	all	DET
ahs-3127	198	11	dsc	dsc	NOUN
ahs-3127	198	12	thermograms	thermogram	NOUN
ahs-3127	198	13	.	.	PUNCT
ahs-3127	199	1	the	the	DET
ahs-3127	199	2	endothermic	endothermic	PROPN
ahs-3127	199	3	peak	peak	NOUN
ahs-3127	199	4	at	at	ADP
ahs-3127	199	5	around	around	ADP
ahs-3127	199	6	100oc	100oc	PROPN
ahs-3127	199	7	could	could	AUX
ahs-3127	199	8	be	be	AUX
ahs-3127	199	9	due	due	ADJ
ahs-3127	199	10	to	to	ADP
ahs-3127	199	11	evaporation	evaporation	NOUN
ahs-3127	199	12	of	of	ADP
ahs-3127	199	13	adsorbed	adsorb	VERB
ahs-3127	199	14	water	water	NOUN
ahs-3127	199	15	(	(	PUNCT
ahs-3127	199	16	fig	fig	NOUN
ahs-3127	199	17	.	.	PUNCT
ahs-3127	200	1	6	6	NUM
ahs-3127	200	2	b	b	NOUN
ahs-3127	200	3	)	)	PUNCT
ahs-3127	200	4	.	.	PUNCT
ahs-3127	201	1	scanning	scan	VERB
ahs-3127	201	2	electron	electron	NOUN
ahs-3127	201	3	microscopy	microscopy	NOUN
ahs-3127	201	4	(	(	PUNCT
ahs-3127	201	5	sem	sem	NOUN
ahs-3127	201	6	)	)	PUNCT
ahs-3127	201	7	.	.	PUNCT
ahs-3127	202	1	sem	sem	NOUN
ahs-3127	202	2	images	image	NOUN
ahs-3127	202	3	reveal	reveal	VERB
ahs-3127	202	4	the	the	DET
ahs-3127	202	5	longitudinal	longitudinal	ADJ
ahs-3127	202	6	morphology	morphology	NOUN
ahs-3127	202	7	of	of	ADP
ahs-3127	202	8	fibers	fiber	NOUN
ahs-3127	202	9	coming	come	VERB
ahs-3127	202	10	from	from	ADP
ahs-3127	202	11	control	control	NOUN
ahs-3127	202	12	and	and	CCONJ
ahs-3127	202	13	treated	treat	VERB
ahs-3127	202	14	plants	plant	NOUN
ahs-3127	202	15	of	of	ADP
ahs-3127	202	16	aleppo	aleppo	PROPN
ahs-3127	202	17	118	118	NUM
ahs-3127	202	18	and	and	CCONJ
ahs-3127	202	19	deir	deir	PROPN
ahs-3127	202	20	al	al	PROPN
ahs-3127	202	21	-	-	PROPN
ahs-3127	202	22	zour	zour	PROPN
ahs-3127	202	23	22	22	NUM
ahs-3127	202	24	cultivars	cultivar	NOUN
ahs-3127	202	25	under	under	ADP
ahs-3127	202	26	three	three	NUM
ahs-3127	202	27	magnifications	magnification	NOUN
ahs-3127	202	28	table	table	NOUN
ahs-3127	202	29	3	3	NUM
ahs-3127	202	30	fiber	fiber	NOUN
ahs-3127	202	31	crystalline	crystalline	NOUN
ahs-3127	202	32	index	index	NOUN
ahs-3127	202	33	in	in	ADP
ahs-3127	202	34	control	control	NOUN
ahs-3127	202	35	and	and	CCONJ
ahs-3127	202	36	treated	treat	VERB
ahs-3127	202	37	aleppo	aleppo	PROPN
ahs-3127	202	38	118	118	NUM
ahs-3127	202	39	and	and	CCONJ
ahs-3127	202	40	deir	deir	PROPN
ahs-3127	202	41	al	al	PROPN
ahs-3127	202	42	-	-	PROPN
ahs-3127	202	43	zour	zour	PROPN
ahs-3127	202	44	22	22	NUM
ahs-3127	202	45	cultivars	cultivar	NOUN
ahs-3127	202	46	fig	fig	NOUN
ahs-3127	202	47	.	.	PUNCT
ahs-3127	203	1	4	4	NUM
ahs-3127	203	2	ftir	ftir	ADJ
ahs-3127	203	3	-	-	ADJ
ahs-3127	203	4	atr	atr	ADJ
ahs-3127	203	5	spectra	spectra	NOUN
ahs-3127	203	6	of	of	ADP
ahs-3127	203	7	the	the	DET
ahs-3127	203	8	cotton	cotton	NOUN
ahs-3127	203	9	fibers	fiber	NOUN
ahs-3127	203	10	obtained	obtain	VERB
ahs-3127	203	11	from	from	ADP
ahs-3127	203	12	(	(	PUNCT
ahs-3127	203	13	a	a	NOUN
ahs-3127	203	14	)	)	PUNCT
ahs-3127	203	15	‘	'	PUNCT
ahs-3127	203	16	aleppo	aleppo	X
ahs-3127	203	17	118	118	NUM
ahs-3127	203	18	’	'	PUNCT
ahs-3127	203	19	control	control	NOUN
ahs-3127	203	20	and	and	CCONJ
ahs-3127	203	21	treated	treat	VERB
ahs-3127	203	22	plants	plant	NOUN
ahs-3127	203	23	and	and	CCONJ
ahs-3127	203	24	(	(	PUNCT
ahs-3127	203	25	b	b	NOUN
ahs-3127	203	26	)	)	PUNCT
ahs-3127	203	27	‘	'	PUNCT
ahs-3127	203	28	deir	deir	NOUN
ahs-3127	203	29	alzour	alzour	NOUN
ahs-3127	203	30	22	22	NUM
ahs-3127	203	31	’	'	PUNCT
ahs-3127	203	32	control	control	NOUN
ahs-3127	203	33	and	and	CCONJ
ahs-3127	203	34	treated	treat	VERB
ahs-3127	203	35	at	at	ADP
ahs-3127	203	36	room	room	NOUN
ahs-3127	203	37	temperature	temperature	NOUN
ahs-3127	203	38	in	in	ADP
ahs-3127	203	39	the	the	DET
ahs-3127	203	40	range	range	NOUN
ahs-3127	203	41	400	400	NUM
ahs-3127	203	42	-	-	SYM
ahs-3127	203	43	4000	4000	NUM
ahs-3127	203	44	cm-1	cm-1	NOUN
ahs-3127	203	45	.	.	PUNCT
ahs-3127	204	1	the	the	DET
ahs-3127	204	2	recorded	record	VERB
ahs-3127	204	3	spectra	spectra	NOUN
ahs-3127	204	4	were	be	AUX
ahs-3127	204	5	repeated	repeat	VERB
ahs-3127	204	6	three	three	NUM
ahs-3127	204	7	times	time	NOUN
ahs-3127	204	8	and	and	CCONJ
ahs-3127	204	9	showed	show	VERB
ahs-3127	204	10	a	a	DET
ahs-3127	204	11	typical	typical	ADJ
ahs-3127	204	12	and	and	CCONJ
ahs-3127	204	13	characteristic	characteristic	ADJ
ahs-3127	204	14	absorption	absorption	NOUN
ahs-3127	204	15	bands	band	NOUN
ahs-3127	204	16	for	for	ADP
ahs-3127	204	17	common	common	ADJ
ahs-3127	204	18	cotton	cotton	NOUN
ahs-3127	204	19	fibers	fiber	NOUN
ahs-3127	204	20	substances	substance	NOUN
ahs-3127	204	21	.	.	PUNCT
ahs-3127	205	1	fig	fig	NOUN
ahs-3127	205	2	.	.	PUNCT
ahs-3127	206	1	5	5	NUM
ahs-3127	206	2	x	x	X
ahs-3127	206	3	-	-	NOUN
ahs-3127	206	4	ray	ray	NOUN
ahs-3127	206	5	powder	powder	NOUN
ahs-3127	206	6	diffraction	diffraction	NOUN
ahs-3127	206	7	patterns	pattern	NOUN
ahs-3127	206	8	of	of	ADP
ahs-3127	206	9	fibers	fiber	NOUN
ahs-3127	206	10	in	in	ADP
ahs-3127	206	11	control	control	NOUN
ahs-3127	206	12	and	and	CCONJ
ahs-3127	206	13	treated	treat	VERB
ahs-3127	206	14	aleppo	aleppo	PROPN
ahs-3127	206	15	118	118	NUM
ahs-3127	206	16	and	and	CCONJ
ahs-3127	206	17	deir	deir	PROPN
ahs-3127	206	18	al	al	PROPN
ahs-3127	206	19	-	-	PROPN
ahs-3127	206	20	zour	zour	ADJ
ahs-3127	206	21	22	22	NUM
ahs-3127	206	22	cultivars	cultivar	NOUN
ahs-3127	206	23	.	.	PUNCT
ahs-3127	207	1	cultivar	cultivar	NOUN
ahs-3127	207	2	crystallinity	crystallinity	NOUN
ahs-3127	207	3	index	index	NOUN
ahs-3127	207	4	(	(	PUNCT
ahs-3127	207	5	%	%	INTJ
ahs-3127	207	6	)	)	PUNCT
ahs-3127	207	7	control	control	NOUN
ahs-3127	207	8	treatment	treatment	NOUN
ahs-3127	207	9	aleppo	aleppo	PROPN
ahs-3127	207	10	118	118	NUM
ahs-3127	207	11	66.5±3.0	66.5±3.0	NUM
ahs-3127	207	12	66.8±3.0	66.8±3.0	NUM
ahs-3127	207	13	deir	deir	PROPN
ahs-3127	207	14	al	al	PROPN
ahs-3127	207	15	-	-	PROPN
ahs-3127	207	16	zour	zour	PROPN
ahs-3127	208	1	22	22	NUM
ahs-3127	208	2	73.7±3.0	73.7±3.0	NUM
ahs-3127	208	3	68.5±3.0	68.5±3.0	NUM
ahs-3127	208	4	adv	adv	PROPN
ahs-3127	208	5	.	.	PUNCT
ahs-3127	208	6	hort	hort	PROPN
ahs-3127	208	7	.	.	PUNCT
ahs-3127	209	1	sci	sci	PROPN
ahs-3127	209	2	.	.	PROPN
ahs-3127	209	3	,	,	PUNCT
ahs-3127	209	4	2018	2018	NUM
ahs-3127	209	5	32(1	32(1	NUM
ahs-3127	209	6	):	):	PUNCT
ahs-3127	209	7	79	79	NUM
ahs-3127	209	8	-	-	SYM
ahs-3127	209	9	92	92	NUM
ahs-3127	209	10	86	86	NUM
ahs-3127	209	11	(	(	PUNCT
ahs-3127	209	12	1.00	1.00	NUM
ahs-3127	209	13	kx	kx	PROPN
ahs-3127	209	14	,	,	PUNCT
ahs-3127	209	15	3.00	3.00	NUM
ahs-3127	209	16	kx	kx	NOUN
ahs-3127	209	17	and	and	CCONJ
ahs-3127	209	18	20.00	20.00	NUM
ahs-3127	209	19	kx	kx	NOUN
ahs-3127	209	20	)	)	PUNCT
ahs-3127	209	21	(	(	PUNCT
ahs-3127	209	22	fig	fig	NOUN
ahs-3127	209	23	.	.	PUNCT
ahs-3127	209	24	7	7	NUM
ahs-3127	209	25	)	)	PUNCT
ahs-3127	209	26	.	.	PUNCT
ahs-3127	210	1	images	image	NOUN
ahs-3127	210	2	of	of	ADP
ahs-3127	210	3	the	the	DET
ahs-3127	210	4	two	two	NUM
ahs-3127	210	5	cultivars	cultivar	NOUN
ahs-3127	210	6	show	show	VERB
ahs-3127	210	7	the	the	DET
ahs-3127	210	8	ribbon	ribbon	NOUN
ahs-3127	210	9	fiber	fiber	NOUN
ahs-3127	210	10	shape	shape	NOUN
ahs-3127	210	11	rolled	roll	VERB
ahs-3127	210	12	in	in	ADP
ahs-3127	210	13	a	a	DET
ahs-3127	210	14	helicoid	helicoid	NOUN
ahs-3127	210	15	manner	manner	NOUN
ahs-3127	210	16	,	,	PUNCT
ahs-3127	210	17	a	a	DET
ahs-3127	210	18	typical	typical	ADJ
ahs-3127	210	19	cotton	cotton	NOUN
ahs-3127	210	20	morphological	morphological	ADJ
ahs-3127	210	21	feature	feature	NOUN
ahs-3127	210	22	.	.	PUNCT
ahs-3127	211	1	the	the	DET
ahs-3127	211	2	spiral	spiral	ADJ
ahs-3127	211	3	and	and	CCONJ
ahs-3127	211	4	twisting	twisting	NOUN
ahs-3127	211	5	fiber	fiber	NOUN
ahs-3127	211	6	nature	nature	NOUN
ahs-3127	211	7	is	be	AUX
ahs-3127	211	8	present	present	ADJ
ahs-3127	211	9	in	in	ADP
ahs-3127	211	10	both	both	DET
ahs-3127	211	11	cultivars	cultivar	NOUN
ahs-3127	211	12	under	under	ADP
ahs-3127	211	13	both	both	DET
ahs-3127	211	14	conditions	condition	NOUN
ahs-3127	211	15	.	.	PUNCT
ahs-3127	212	1	expression	expression	NOUN
ahs-3127	212	2	analysis	analysis	NOUN
ahs-3127	212	3	of	of	ADP
ahs-3127	212	4	dreb1a	dreb1a	NOUN
ahs-3127	212	5	,	,	PUNCT
ahs-3127	212	6	tps	tps	NOUN
ahs-3127	212	7	and	and	CCONJ
ahs-3127	212	8	hspcb	hspcb	PROPN
ahs-3127	212	9	drought	drought	NOUN
ahs-3127	212	10	-	-	PUNCT
ahs-3127	212	11	related	relate	VERB
ahs-3127	212	12	genes	gene	NOUN
ahs-3127	212	13	fold	fold	VERB
ahs-3127	212	14	expression	expression	NOUN
ahs-3127	212	15	of	of	ADP
ahs-3127	212	16	three	three	NUM
ahs-3127	212	17	drought	drought	NOUN
ahs-3127	212	18	-	-	PUNCT
ahs-3127	212	19	related	relate	VERB
ahs-3127	212	20	genes	gene	NOUN
ahs-3127	212	21	in	in	ADP
ahs-3127	212	22	cotton	cotton	NOUN
ahs-3127	212	23	(	(	PUNCT
ahs-3127	212	24	dreb1a	dreb1a	NOUN
ahs-3127	212	25	,	,	PUNCT
ahs-3127	212	26	tps	tps	NOUN
ahs-3127	212	27	and	and	CCONJ
ahs-3127	212	28	hspcb	hspcb	PROPN
ahs-3127	212	29	)	)	PUNCT
ahs-3127	212	30	was	be	AUX
ahs-3127	212	31	analyzed	analyze	VERB
ahs-3127	212	32	,	,	PUNCT
ahs-3127	212	33	assisted	assist	VERB
ahs-3127	212	34	by	by	ADP
ahs-3127	212	35	ghef1α5	ghef1α5	NOUN
ahs-3127	212	36	gene	gene	NOUN
ahs-3127	212	37	expression	expression	NOUN
ahs-3127	212	38	for	for	ADP
ahs-3127	212	39	normalization	normalization	NOUN
ahs-3127	212	40	(	(	PUNCT
ahs-3127	212	41	fig	fig	NOUN
ahs-3127	212	42	.	.	PUNCT
ahs-3127	213	1	8)	8)	NUM
ahs-3127	213	2	.	.	PUNCT
ahs-3127	213	3	leaf	leaf	NOUN
ahs-3127	213	4	samples	sample	NOUN
ahs-3127	213	5	of	of	ADP
ahs-3127	213	6	control	control	NOUN
ahs-3127	213	7	and	and	CCONJ
ahs-3127	213	8	treated	treat	VERB
ahs-3127	213	9	plants	plant	NOUN
ahs-3127	213	10	of	of	ADP
ahs-3127	213	11	both	both	DET
ahs-3127	213	12	cultivars	cultivar	NOUN
ahs-3127	213	13	were	be	AUX
ahs-3127	213	14	harvested	harvest	VERB
ahs-3127	213	15	at	at	ADP
ahs-3127	213	16	two	two	NUM
ahs-3127	213	17	points	point	NOUN
ahs-3127	213	18	(	(	PUNCT
ahs-3127	213	19	stages	stage	NOUN
ahs-3127	213	20	)	)	PUNCT
ahs-3127	213	21	,	,	PUNCT
ahs-3127	213	22	s1	s1	NOUN
ahs-3127	213	23	and	and	CCONJ
ahs-3127	213	24	s2	s2	PROPN
ahs-3127	213	25	.	.	PUNCT
ahs-3127	214	1	where	where	SCONJ
ahs-3127	214	2	s1	s1	NOUN
ahs-3127	214	3	represents	represent	VERB
ahs-3127	214	4	leaf	leaf	NOUN
ahs-3127	214	5	material	material	NOUN
ahs-3127	214	6	harvested	harvest	VERB
ahs-3127	214	7	at	at	ADP
ahs-3127	214	8	40	40	NUM
ahs-3127	214	9	dap	dap	NOUN
ahs-3127	214	10	(	(	PUNCT
ahs-3127	214	11	during	during	ADP
ahs-3127	214	12	floral	floral	ADJ
ahs-3127	214	13	bud	bud	NOUN
ahs-3127	214	14	to	to	PART
ahs-3127	214	15	flower	flower	VERB
ahs-3127	214	16	transition	transition	NOUN
ahs-3127	214	17	stage	stage	NOUN
ahs-3127	214	18	)	)	PUNCT
ahs-3127	214	19	and	and	CCONJ
ahs-3127	214	20	s2	s2	NOUN
ahs-3127	214	21	represents	represent	VERB
ahs-3127	214	22	leaf	leaf	NOUN
ahs-3127	214	23	material	material	NOUN
ahs-3127	214	24	harvested	harvest	VERB
ahs-3127	214	25	at	at	ADP
ahs-3127	214	26	60	60	NUM
ahs-3127	214	27	dap	dap	NOUN
ahs-3127	214	28	(	(	PUNCT
ahs-3127	214	29	bolls	boll	VERB
ahs-3127	214	30	opening	opening	NOUN
ahs-3127	214	31	and	and	CCONJ
ahs-3127	214	32	maturation	maturation	NOUN
ahs-3127	214	33	)	)	PUNCT
ahs-3127	214	34	.	.	PUNCT
ahs-3127	215	1	gene	gene	NOUN
ahs-3127	215	2	expression	expression	NOUN
ahs-3127	215	3	analysis	analysis	NOUN
ahs-3127	215	4	showed	show	VERB
ahs-3127	215	5	an	an	DET
ahs-3127	215	6	activation	activation	NOUN
ahs-3127	215	7	of	of	ADP
ahs-3127	215	8	the	the	DET
ahs-3127	215	9	studied	study	VERB
ahs-3127	215	10	genes	gene	NOUN
ahs-3127	215	11	in	in	ADP
ahs-3127	215	12	treated	treat	VERB
ahs-3127	215	13	plants	plant	NOUN
ahs-3127	215	14	compared	compare	VERB
ahs-3127	215	15	to	to	ADP
ahs-3127	215	16	the	the	DET
ahs-3127	215	17	controls	control	NOUN
ahs-3127	215	18	of	of	ADP
ahs-3127	215	19	both	both	DET
ahs-3127	215	20	cultivars	cultivar	NOUN
ahs-3127	215	21	during	during	ADP
ahs-3127	215	22	s1	s1	NOUN
ahs-3127	215	23	.	.	PUNCT
ahs-3127	216	1	the	the	DET
ahs-3127	216	2	s2	s2	NOUN
ahs-3127	216	3	stage	stage	NOUN
ahs-3127	216	4	,	,	PUNCT
ahs-3127	216	5	experienced	experience	VERB
ahs-3127	216	6	a	a	DET
ahs-3127	216	7	drop	drop	NOUN
ahs-3127	216	8	in	in	ADP
ahs-3127	216	9	genes	gene	NOUN
ahs-3127	216	10	activity	activity	NOUN
ahs-3127	216	11	in	in	ADP
ahs-3127	216	12	both	both	DET
ahs-3127	216	13	treated	treat	VERB
ahs-3127	216	14	cultivars	cultivar	NOUN
ahs-3127	216	15	.	.	PUNCT
ahs-3127	217	1	analysis	analysis	NOUN
ahs-3127	217	2	showed	show	VERB
ahs-3127	217	3	a	a	DET
ahs-3127	217	4	major	major	ADJ
ahs-3127	217	5	significant	significant	ADJ
ahs-3127	217	6	drop	drop	NOUN
ahs-3127	217	7	in	in	ADP
ahs-3127	217	8	gene	gene	NOUN
ahs-3127	217	9	activity	activity	NOUN
ahs-3127	217	10	(	(	PUNCT
ahs-3127	217	11	hspcb	hspcb	NOUN
ahs-3127	217	12	and	and	CCONJ
ahs-3127	217	13	tps	tps	NOUN
ahs-3127	217	14	)	)	PUNCT
ahs-3127	217	15	in	in	ADP
ahs-3127	217	16	treated	treat	VERB
ahs-3127	217	17	‘	'	PUNCT
ahs-3127	217	18	deir	deir	PROPN
ahs-3127	217	19	al	al	PROPN
ahs-3127	217	20	-	-	PROPN
ahs-3127	217	21	zour	zour	ADJ
ahs-3127	217	22	22	22	NUM
ahs-3127	217	23	’	'	PUNCT
ahs-3127	217	24	plants	plant	NOUN
ahs-3127	217	25	(	(	PUNCT
ahs-3127	217	26	s2	s2	PROPN
ahs-3127	217	27	)	)	PUNCT
ahs-3127	217	28	compared	compare	VERB
ahs-3127	217	29	to	to	ADP
ahs-3127	217	30	samples	sample	NOUN
ahs-3127	217	31	of	of	ADP
ahs-3127	217	32	the	the	DET
ahs-3127	217	33	earlier	early	ADJ
ahs-3127	217	34	stage	stage	NOUN
ahs-3127	217	35	(	(	PUNCT
ahs-3127	217	36	s1	s1	NOUN
ahs-3127	217	37	)	)	PUNCT
ahs-3127	217	38	.	.	PUNCT
ahs-3127	218	1	exceptionally	exceptionally	ADV
ahs-3127	218	2	,	,	PUNCT
ahs-3127	218	3	dreb	dreb	VERB
ahs-3127	218	4	1a	1a	PROPN
ahs-3127	218	5	gene	gene	NOUN
ahs-3127	218	6	showed	show	VERB
ahs-3127	218	7	a	a	DET
ahs-3127	218	8	slight	slight	ADJ
ahs-3127	218	9	decrease	decrease	NOUN
ahs-3127	218	10	in	in	ADP
ahs-3127	218	11	gene	gene	NOUN
ahs-3127	218	12	expression	expression	NOUN
ahs-3127	218	13	keeping	keep	VERB
ahs-3127	218	14	its	its	PRON
ahs-3127	218	15	high	high	ADJ
ahs-3127	218	16	activity	activity	NOUN
ahs-3127	218	17	in	in	ADP
ahs-3127	218	18	treated	treat	VERB
ahs-3127	218	19	plants	plant	NOUN
ahs-3127	219	1	~4	~4	PUNCT
ahs-3127	219	2	fold	fold	VERB
ahs-3127	219	3	higher	high	ADJ
ahs-3127	219	4	than	than	ADP
ahs-3127	219	5	the	the	DET
ahs-3127	219	6	config	config	NOUN
ahs-3127	219	7	.	.	PUNCT
ahs-3127	220	1	6	6	NUM
ahs-3127	220	2	(	(	PUNCT
ahs-3127	220	3	a	a	X
ahs-3127	220	4	)	)	PUNCT
ahs-3127	220	5	tga	tga	NOUN
ahs-3127	220	6	thermograms	thermogram	NOUN
ahs-3127	220	7	of	of	ADP
ahs-3127	220	8	cotton	cotton	NOUN
ahs-3127	220	9	fibers	fiber	NOUN
ahs-3127	220	10	in	in	ADP
ahs-3127	220	11	presence	presence	NOUN
ahs-3127	220	12	of	of	ADP
ahs-3127	220	13	nitrogen	nitrogen	NOUN
ahs-3127	220	14	.	.	PUNCT
ahs-3127	221	1	(	(	PUNCT
ahs-3127	221	2	b	b	X
ahs-3127	221	3	)	)	PUNCT
ahs-3127	221	4	dsc	dsc	NOUN
ahs-3127	221	5	thermograms	thermogram	NOUN
ahs-3127	221	6	of	of	ADP
ahs-3127	221	7	cotton	cotton	NOUN
ahs-3127	221	8	fibers	fiber	NOUN
ahs-3127	221	9	in	in	ADP
ahs-3127	221	10	presence	presence	NOUN
ahs-3127	221	11	of	of	ADP
ahs-3127	221	12	nitrogen	nitrogen	NOUN
ahs-3127	221	13	.	.	PUNCT
ahs-3127	222	1	fig	fig	NOUN
ahs-3127	222	2	.	.	PUNCT
ahs-3127	223	1	7	7	NUM
ahs-3127	223	2	sem	sem	NOUN
ahs-3127	223	3	images	image	NOUN
ahs-3127	223	4	of	of	ADP
ahs-3127	223	5	cotton	cotton	NOUN
ahs-3127	223	6	fibers	fiber	NOUN
ahs-3127	223	7	.	.	PUNCT
ahs-3127	224	1	a	a	DET
ahs-3127	224	2	,	,	PUNCT
ahs-3127	224	3	b	b	NOUN
ahs-3127	224	4	and	and	CCONJ
ahs-3127	224	5	c.	c.	NOUN
ahs-3127	224	6	fibers	fiber	NOUN
ahs-3127	224	7	of	of	ADP
ahs-3127	224	8	control	control	NOUN
ahs-3127	224	9	‘	'	PUNCT
ahs-3127	224	10	aleppo	aleppo	PROPN
ahs-3127	224	11	118	118	NUM
ahs-3127	224	12	’	'	PUNCT
ahs-3127	224	13	under	under	ADP
ahs-3127	224	14	1.00	1.00	NUM
ahs-3127	224	15	,	,	PUNCT
ahs-3127	224	16	3.00	3.00	NUM
ahs-3127	224	17	and	and	CCONJ
ahs-3127	224	18	20.00	20.00	NUM
ahs-3127	224	19	kx	kx	PROPN
ahs-3127	224	20	magnifications	magnification	NOUN
ahs-3127	224	21	.	.	PUNCT
ahs-3127	225	1	d	d	X
ahs-3127	225	2	,	,	PUNCT
ahs-3127	225	3	e	e	PROPN
ahs-3127	225	4	and	and	CCONJ
ahs-3127	225	5	f.	f.	PROPN
ahs-3127	225	6	fibers	fiber	NOUN
ahs-3127	225	7	of	of	ADP
ahs-3127	225	8	treated	treat	VERB
ahs-3127	225	9	‘	'	PUNCT
ahs-3127	225	10	aleppo	aleppo	PROPN
ahs-3127	225	11	118	118	NUM
ahs-3127	225	12	’	'	PUNCT
ahs-3127	225	13	under	under	ADP
ahs-3127	225	14	1.00	1.00	NUM
ahs-3127	225	15	,	,	PUNCT
ahs-3127	225	16	3.00	3.00	NUM
ahs-3127	225	17	and	and	CCONJ
ahs-3127	225	18	20.00	20.00	NUM
ahs-3127	225	19	kx	kx	PROPN
ahs-3127	225	20	magnifications	magnification	NOUN
ahs-3127	225	21	.	.	PUNCT
ahs-3127	226	1	g	g	NOUN
ahs-3127	226	2	,	,	PUNCT
ahs-3127	226	3	h	h	NOUN
ahs-3127	226	4	and	and	CCONJ
ahs-3127	226	5	i.	i.	NOUN
ahs-3127	226	6	fibers	fiber	NOUN
ahs-3127	226	7	of	of	ADP
ahs-3127	226	8	control	control	NOUN
ahs-3127	226	9	‘	'	PUNCT
ahs-3127	226	10	deir	deir	PROPN
ahs-3127	226	11	al	al	PROPN
ahs-3127	226	12	zour	zour	PROPN
ahs-3127	226	13	22	22	NUM
ahs-3127	226	14	’	'	PUNCT
ahs-3127	226	15	under	under	ADP
ahs-3127	226	16	1.00	1.00	NUM
ahs-3127	226	17	,	,	PUNCT
ahs-3127	226	18	3.00	3.00	NUM
ahs-3127	226	19	and	and	CCONJ
ahs-3127	226	20	20.00	20.00	NUM
ahs-3127	226	21	kx	kx	PROPN
ahs-3127	226	22	magnifications	magnification	NOUN
ahs-3127	226	23	.	.	PUNCT
ahs-3127	227	1	j	j	PROPN
ahs-3127	227	2	,	,	PUNCT
ahs-3127	227	3	k	k	PROPN
ahs-3127	227	4	and	and	CCONJ
ahs-3127	227	5	l.	l.	PROPN
ahs-3127	227	6	fibers	fiber	NOUN
ahs-3127	227	7	of	of	ADP
ahs-3127	227	8	treated	treat	VERB
ahs-3127	227	9	‘	'	PUNCT
ahs-3127	227	10	deir	deir	PROPN
ahs-3127	227	11	al	al	PROPN
ahs-3127	227	12	zour	zour	PROPN
ahs-3127	227	13	22	22	NUM
ahs-3127	227	14	’	'	PUNCT
ahs-3127	227	15	under	under	ADP
ahs-3127	227	16	1.00	1.00	NUM
ahs-3127	227	17	,	,	PUNCT
ahs-3127	227	18	3.00	3.00	NUM
ahs-3127	227	19	and	and	CCONJ
ahs-3127	227	20	20.00	20.00	NUM
ahs-3127	227	21	kx	kx	PROPN
ahs-3127	227	22	magnifications	magnification	NOUN
ahs-3127	227	23	.	.	PUNCT
ahs-3127	228	1	jawdat	jawdat	PROPN
ahs-3127	228	2	et	et	PROPN
ahs-3127	228	3	al	al	PROPN
ahs-3127	228	4	.	.	PUNCT
ahs-3127	229	1	cotton	cotton	NOUN
ahs-3127	229	2	behaviour	behaviour	NOUN
ahs-3127	229	3	under	under	ADP
ahs-3127	229	4	water	water	NOUN
ahs-3127	229	5	stress	stress	NOUN
ahs-3127	229	6	87	87	NUM
ahs-3127	229	7	trols	trol	NOUN
ahs-3127	229	8	.	.	PUNCT
ahs-3127	230	1	on	on	ADP
ahs-3127	230	2	the	the	DET
ahs-3127	230	3	other	other	ADJ
ahs-3127	230	4	hand	hand	NOUN
ahs-3127	230	5	,	,	PUNCT
ahs-3127	230	6	aleppo	aleppo	PROPN
ahs-3127	230	7	118	118	NUM
ahs-3127	230	8	cultivar	cultivar	NOUN
ahs-3127	230	9	showed	show	VERB
ahs-3127	230	10	an	an	DET
ahs-3127	230	11	almost	almost	ADV
ahs-3127	230	12	steady	steady	ADJ
ahs-3127	230	13	expression	expression	NOUN
ahs-3127	230	14	pattern	pattern	NOUN
ahs-3127	230	15	of	of	ADP
ahs-3127	230	16	the	the	DET
ahs-3127	230	17	three	three	NUM
ahs-3127	230	18	genes	gene	NOUN
ahs-3127	230	19	in	in	ADP
ahs-3127	230	20	the	the	DET
ahs-3127	230	21	two	two	NUM
ahs-3127	230	22	stages	stage	NOUN
ahs-3127	230	23	(	(	PUNCT
ahs-3127	230	24	high	high	ADJ
ahs-3127	230	25	expression	expression	NOUN
ahs-3127	230	26	in	in	ADP
ahs-3127	230	27	s1	s1	NOUN
ahs-3127	230	28	and	and	CCONJ
ahs-3127	230	29	low	low	ADJ
ahs-3127	230	30	in	in	ADP
ahs-3127	230	31	s2	s2	PROPN
ahs-3127	230	32	)	)	PUNCT
ahs-3127	230	33	.	.	PUNCT
ahs-3127	231	1	this	this	DET
ahs-3127	231	2	continuous	continuous	ADJ
ahs-3127	231	3	high	high	ADJ
ahs-3127	231	4	expression	expression	NOUN
ahs-3127	231	5	activity	activity	NOUN
ahs-3127	231	6	of	of	ADP
ahs-3127	231	7	dreb	dreb	PROPN
ahs-3127	231	8	1a	1a	PROPN
ahs-3127	231	9	needs	need	VERB
ahs-3127	231	10	to	to	PART
ahs-3127	231	11	be	be	AUX
ahs-3127	231	12	further	far	ADV
ahs-3127	231	13	investigated	investigate	VERB
ahs-3127	231	14	in	in	ADP
ahs-3127	231	15	‘	'	PUNCT
ahs-3127	231	16	deir	deir	X
ahs-3127	231	17	alzour	alzour	NOUN
ahs-3127	231	18	22	22	NUM
ahs-3127	231	19	’	'	PUNCT
ahs-3127	231	20	to	to	PART
ahs-3127	231	21	study	study	VERB
ahs-3127	231	22	its	its	PRON
ahs-3127	231	23	relation	relation	NOUN
ahs-3127	231	24	to	to	PART
ahs-3127	231	25	water	water	NOUN
ahs-3127	231	26	deficit	deficit	NOUN
ahs-3127	231	27	tolerance	tolerance	NOUN
ahs-3127	231	28	.	.	PUNCT
ahs-3127	232	1	4	4	X
ahs-3127	232	2	.	.	X
ahs-3127	232	3	discussion	discussion	NOUN
ahs-3127	232	4	and	and	CCONJ
ahs-3127	232	5	conclusions	conclusion	NOUN
ahs-3127	232	6	this	this	DET
ahs-3127	232	7	study	study	NOUN
ahs-3127	232	8	overlooks	overlook	VERB
ahs-3127	232	9	the	the	DET
ahs-3127	232	10	behavior	behavior	NOUN
ahs-3127	232	11	of	of	ADP
ahs-3127	232	12	two	two	NUM
ahs-3127	232	13	accredited	accredited	ADJ
ahs-3127	232	14	cotton	cotton	NOUN
ahs-3127	232	15	cultivars	cultivar	NOUN
ahs-3127	232	16	subjected	subject	VERB
ahs-3127	232	17	to	to	ADP
ahs-3127	232	18	two	two	NUM
ahs-3127	232	19	irrigation	irrigation	NOUN
ahs-3127	232	20	regimes	regime	NOUN
ahs-3127	232	21	along	along	ADP
ahs-3127	232	22	their	their	PRON
ahs-3127	232	23	life	life	NOUN
ahs-3127	232	24	cycle	cycle	NOUN
ahs-3127	232	25	.	.	PUNCT
ahs-3127	233	1	it	it	PRON
ahs-3127	233	2	is	be	AUX
ahs-3127	233	3	anticipated	anticipate	VERB
ahs-3127	233	4	that	that	SCONJ
ahs-3127	233	5	water	water	NOUN
ahs-3127	233	6	scarcity	scarcity	NOUN
ahs-3127	233	7	in	in	ADP
ahs-3127	233	8	the	the	DET
ahs-3127	233	9	mediterranean	mediterranean	PROPN
ahs-3127	233	10	region	region	NOUN
ahs-3127	233	11	will	will	AUX
ahs-3127	233	12	increase	increase	VERB
ahs-3127	233	13	under	under	ADP
ahs-3127	233	14	climatic	climatic	ADJ
ahs-3127	233	15	change	change	NOUN
ahs-3127	233	16	and	and	CCONJ
ahs-3127	233	17	this	this	PRON
ahs-3127	233	18	can	can	AUX
ahs-3127	233	19	be	be	AUX
ahs-3127	233	20	addressed	address	VERB
ahs-3127	233	21	by	by	ADP
ahs-3127	233	22	evaluating	evaluate	VERB
ahs-3127	233	23	the	the	DET
ahs-3127	233	24	impacts	impact	NOUN
ahs-3127	233	25	of	of	ADP
ahs-3127	233	26	climate	climate	NOUN
ahs-3127	233	27	change	change	NOUN
ahs-3127	233	28	on	on	ADP
ahs-3127	233	29	water	water	NOUN
ahs-3127	233	30	resources	resource	NOUN
ahs-3127	233	31	and	and	CCONJ
ahs-3127	233	32	their	their	PRON
ahs-3127	233	33	management	management	NOUN
ahs-3127	233	34	,	,	PUNCT
ahs-3127	233	35	the	the	DET
ahs-3127	233	36	adaptive	adaptive	ADJ
ahs-3127	233	37	capacity	capacity	NOUN
ahs-3127	233	38	and	and	CCONJ
ahs-3127	233	39	the	the	DET
ahs-3127	233	40	policy	policy	NOUN
ahs-3127	233	41	responses	response	NOUN
ahs-3127	233	42	(	(	PUNCT
ahs-3127	233	43	iglesias	iglesias	PROPN
ahs-3127	233	44	et	et	PROPN
ahs-3127	233	45	al	al	PROPN
ahs-3127	233	46	.	.	PROPN
ahs-3127	233	47	,	,	PUNCT
ahs-3127	233	48	2011	2011	NUM
ahs-3127	233	49	)	)	PUNCT
ahs-3127	233	50	.	.	PUNCT
ahs-3127	234	1	improving	improve	VERB
ahs-3127	234	2	water	water	NOUN
ahs-3127	234	3	resources	resource	NOUN
ahs-3127	234	4	management	management	NOUN
ahs-3127	234	5	is	be	AUX
ahs-3127	234	6	challenged	challenge	VERB
ahs-3127	234	7	by	by	ADP
ahs-3127	234	8	the	the	DET
ahs-3127	234	9	physiology	physiology	NOUN
ahs-3127	234	10	and	and	CCONJ
ahs-3127	234	11	biology	biology	NOUN
ahs-3127	234	12	of	of	ADP
ahs-3127	234	13	the	the	DET
ahs-3127	234	14	crop	crop	NOUN
ahs-3127	234	15	,	,	PUNCT
ahs-3127	234	16	irrigation	irrigation	NOUN
ahs-3127	234	17	practices	practice	NOUN
ahs-3127	234	18	,	,	PUNCT
ahs-3127	234	19	environment	environment	NOUN
ahs-3127	234	20	,	,	PUNCT
ahs-3127	234	21	farmers	farmer	NOUN
ahs-3127	234	22	’	’	PART
ahs-3127	234	23	perspectives	perspective	NOUN
ahs-3127	234	24	,	,	PUNCT
ahs-3127	234	25	and	and	CCONJ
ahs-3127	234	26	government	government	NOUN
ahs-3127	234	27	funding	funding	NOUN
ahs-3127	234	28	.	.	PUNCT
ahs-3127	235	1	increasing	increase	VERB
ahs-3127	235	2	crop	crop	NOUN
ahs-3127	235	3	water	water	NOUN
ahs-3127	235	4	productivity	productivity	NOUN
ahs-3127	235	5	,	,	PUNCT
ahs-3127	235	6	i.e.	i.e.	X
ahs-3127	235	7	producing	produce	VERB
ahs-3127	235	8	more	more	ADJ
ahs-3127	235	9	food	food	NOUN
ahs-3127	235	10	,	,	PUNCT
ahs-3127	235	11	income	income	NOUN
ahs-3127	235	12	,	,	PUNCT
ahs-3127	235	13	better	well	ADJ
ahs-3127	235	14	livelihoods	livelihood	NOUN
ahs-3127	235	15	and	and	CCONJ
ahs-3127	235	16	ecosystem	ecosystem	NOUN
ahs-3127	235	17	services	service	NOUN
ahs-3127	235	18	with	with	ADP
ahs-3127	235	19	less	less	ADJ
ahs-3127	235	20	water	water	NOUN
ahs-3127	235	21	(	(	PUNCT
ahs-3127	235	22	molden	molden	PROPN
ahs-3127	235	23	et	et	PROPN
ahs-3127	235	24	al	al	PROPN
ahs-3127	235	25	.	.	PROPN
ahs-3127	235	26	,	,	PUNCT
ahs-3127	235	27	2010	2010	NUM
ahs-3127	235	28	)	)	PUNCT
ahs-3127	235	29	,	,	PUNCT
ahs-3127	235	30	has	have	AUX
ahs-3127	235	31	been	be	AUX
ahs-3127	235	32	a	a	DET
ahs-3127	235	33	major	major	ADJ
ahs-3127	235	34	interest	interest	NOUN
ahs-3127	235	35	to	to	ADP
ahs-3127	235	36	agronomists	agronomist	NOUN
ahs-3127	235	37	,	,	PUNCT
ahs-3127	235	38	farmers	farmer	NOUN
ahs-3127	235	39	,	,	PUNCT
ahs-3127	235	40	environmentalists	environmentalist	NOUN
ahs-3127	235	41	and	and	CCONJ
ahs-3127	235	42	economists	economist	NOUN
ahs-3127	235	43	.	.	PUNCT
ahs-3127	236	1	our	our	PRON
ahs-3127	236	2	research	research	NOUN
ahs-3127	236	3	is	be	AUX
ahs-3127	236	4	mainly	mainly	ADV
ahs-3127	236	5	interested	interested	ADJ
ahs-3127	236	6	in	in	ADP
ahs-3127	236	7	understanding	understand	VERB
ahs-3127	236	8	the	the	DET
ahs-3127	236	9	responses	response	NOUN
ahs-3127	236	10	of	of	ADP
ahs-3127	236	11	two	two	NUM
ahs-3127	236	12	credited	credit	VERB
ahs-3127	236	13	syrian	syrian	ADJ
ahs-3127	236	14	cotton	cotton	NOUN
ahs-3127	236	15	cultivars	cultivar	NOUN
ahs-3127	236	16	grown	grow	VERB
ahs-3127	236	17	under	under	ADP
ahs-3127	236	18	water	water	NOUN
ahs-3127	236	19	-	-	PUNCT
ahs-3127	236	20	shortage	shortage	NOUN
ahs-3127	236	21	stress	stress	NOUN
ahs-3127	236	22	conditions	condition	NOUN
ahs-3127	236	23	,	,	PUNCT
ahs-3127	236	24	motivated	motivate	VERB
ahs-3127	236	25	by	by	ADP
ahs-3127	236	26	the	the	DET
ahs-3127	236	27	concept	concept	NOUN
ahs-3127	236	28	of	of	ADP
ahs-3127	236	29	reaching	reach	VERB
ahs-3127	236	30	a	a	DET
ahs-3127	236	31	better	well	ADJ
ahs-3127	236	32	quality	quality	NOUN
ahs-3127	236	33	and	and	CCONJ
ahs-3127	236	34	quantity	quantity	NOUN
ahs-3127	236	35	of	of	ADP
ahs-3127	236	36	cotton	cotton	NOUN
ahs-3127	236	37	fiber	fiber	NOUN
ahs-3127	236	38	coupled	couple	VERB
ahs-3127	236	39	with	with	ADP
ahs-3127	236	40	saving	save	VERB
ahs-3127	236	41	ground	ground	NOUN
ahs-3127	236	42	water	water	NOUN
ahs-3127	236	43	resources	resource	NOUN
ahs-3127	236	44	in	in	ADP
ahs-3127	236	45	a	a	DET
ahs-3127	236	46	cotton	cotton	NOUN
ahs-3127	236	47	growing	grow	VERB
ahs-3127	236	48	country	country	NOUN
ahs-3127	236	49	.	.	PUNCT
ahs-3127	237	1	recently	recently	ADV
ahs-3127	237	2	,	,	PUNCT
ahs-3127	237	3	drip	drip	VERB
ahs-3127	237	4	irrigation	irrigation	NOUN
ahs-3127	237	5	systems	system	NOUN
ahs-3127	237	6	have	have	AUX
ahs-3127	237	7	been	be	AUX
ahs-3127	237	8	widely	widely	ADV
ahs-3127	237	9	employed	employ	VERB
ahs-3127	237	10	,	,	PUNCT
ahs-3127	237	11	due	due	ADP
ahs-3127	237	12	to	to	ADP
ahs-3127	237	13	their	their	PRON
ahs-3127	237	14	improvement	improvement	NOUN
ahs-3127	237	15	of	of	ADP
ahs-3127	237	16	water	water	NOUN
ahs-3127	237	17	use	use	NOUN
ahs-3127	237	18	efficiency	efficiency	NOUN
ahs-3127	237	19	(	(	PUNCT
ahs-3127	237	20	patanè	patanè	NOUN
ahs-3127	237	21	et	et	PROPN
ahs-3127	237	22	al	al	PROPN
ahs-3127	237	23	.	.	PROPN
ahs-3127	237	24	,	,	PUNCT
ahs-3127	237	25	2011	2011	NUM
ahs-3127	237	26	)	)	PUNCT
ahs-3127	237	27	.	.	PUNCT
ahs-3127	238	1	hence	hence	ADV
ahs-3127	238	2	,	,	PUNCT
ahs-3127	238	3	our	our	PRON
ahs-3127	238	4	field	field	NOUN
ahs-3127	238	5	experiments	experiment	NOUN
ahs-3127	238	6	were	be	AUX
ahs-3127	238	7	irrigated	irrigate	VERB
ahs-3127	238	8	using	use	VERB
ahs-3127	238	9	the	the	DET
ahs-3127	238	10	drip	drip	NOUN
ahs-3127	238	11	irrigation	irrigation	NOUN
ahs-3127	238	12	system	system	NOUN
ahs-3127	238	13	to	to	PART
ahs-3127	238	14	reduce	reduce	VERB
ahs-3127	238	15	water	water	NOUN
ahs-3127	238	16	runoff	runoff	NOUN
ahs-3127	238	17	losses	loss	NOUN
ahs-3127	238	18	.	.	PUNCT
ahs-3127	239	1	two	two	NUM
ahs-3127	239	2	credited	credit	VERB
ahs-3127	239	3	cotton	cotton	NOUN
ahs-3127	239	4	local	local	ADJ
ahs-3127	239	5	cultivars	cultivar	NOUN
ahs-3127	239	6	,	,	PUNCT
ahs-3127	239	7	aleppo	aleppo	PROPN
ahs-3127	239	8	118	118	NUM
ahs-3127	239	9	and	and	CCONJ
ahs-3127	239	10	deir	deir	PROPN
ahs-3127	239	11	al	al	PROPN
ahs-3127	239	12	-	-	PROPN
ahs-3127	239	13	zour	zour	PROPN
ahs-3127	239	14	22	22	NUM
ahs-3127	239	15	,	,	PUNCT
ahs-3127	239	16	have	have	AUX
ahs-3127	239	17	been	be	AUX
ahs-3127	239	18	investigated	investigate	VERB
ahs-3127	239	19	in	in	ADP
ahs-3127	239	20	our	our	PRON
ahs-3127	239	21	study	study	NOUN
ahs-3127	239	22	.	.	PUNCT
ahs-3127	240	1	the	the	DET
ahs-3127	240	2	two	two	NUM
ahs-3127	240	3	cultivars	cultivar	NOUN
ahs-3127	240	4	are	be	AUX
ahs-3127	240	5	assigned	assign	VERB
ahs-3127	240	6	by	by	ADP
ahs-3127	240	7	the	the	DET
ahs-3127	240	8	ministry	ministry	PROPN
ahs-3127	240	9	of	of	ADP
ahs-3127	240	10	agriculture	agriculture	PROPN
ahs-3127	240	11	to	to	PART
ahs-3127	240	12	be	be	AUX
ahs-3127	240	13	grown	grow	VERB
ahs-3127	240	14	in	in	ADP
ahs-3127	240	15	their	their	PRON
ahs-3127	240	16	pertinent	pertinent	ADJ
ahs-3127	240	17	environments	environment	NOUN
ahs-3127	240	18	in	in	ADP
ahs-3127	240	19	the	the	DET
ahs-3127	240	20	syrian	syrian	ADJ
ahs-3127	240	21	land	land	NOUN
ahs-3127	240	22	.	.	PUNCT
ahs-3127	241	1	‘	'	PUNCT
ahs-3127	241	2	deir	deir	PROPN
ahs-3127	241	3	al	al	PROPN
ahs-3127	241	4	-	-	PROPN
ahs-3127	241	5	zour	zour	NOUN
ahs-3127	241	6	22	22	NUM
ahs-3127	241	7	’	'	PUNCT
ahs-3127	241	8	is	be	AUX
ahs-3127	241	9	the	the	DET
ahs-3127	241	10	featured	feature	VERB
ahs-3127	241	11	cultivar	cultivar	NOUN
ahs-3127	241	12	for	for	ADP
ahs-3127	241	13	cultivation	cultivation	NOUN
ahs-3127	241	14	in	in	ADP
ahs-3127	241	15	deir	deir	PROPN
ahs-3127	241	16	al	al	PROPN
ahs-3127	241	17	-	-	PROPN
ahs-3127	241	18	zour	zour	PROPN
ahs-3127	241	19	province	province	NOUN
ahs-3127	241	20	,	,	PUNCT
ahs-3127	241	21	along	along	ADP
ahs-3127	241	22	the	the	DET
ahs-3127	241	23	euphrates	euphrate	NOUN
ahs-3127	241	24	,	,	PUNCT
ahs-3127	241	25	where	where	SCONJ
ahs-3127	241	26	high	high	ADJ
ahs-3127	241	27	temperature	temperature	NOUN
ahs-3127	241	28	is	be	AUX
ahs-3127	241	29	the	the	DET
ahs-3127	241	30	dominant	dominant	ADJ
ahs-3127	241	31	feature	feature	NOUN
ahs-3127	241	32	of	of	ADP
ahs-3127	241	33	the	the	DET
ahs-3127	241	34	area	area	NOUN
ahs-3127	241	35	especially	especially	ADV
ahs-3127	241	36	during	during	ADP
ahs-3127	241	37	the	the	DET
ahs-3127	241	38	growing	grow	VERB
ahs-3127	241	39	season	season	NOUN
ahs-3127	241	40	.	.	PUNCT
ahs-3127	242	1	‘	'	PUNCT
ahs-3127	242	2	aleppo	aleppo	PROPN
ahs-3127	242	3	118	118	NUM
ahs-3127	242	4	’	'	PUNCT
ahs-3127	242	5	,	,	PUNCT
ahs-3127	242	6	an	an	DET
ahs-3127	242	7	early	early	ADJ
ahs-3127	242	8	maturity	maturity	NOUN
ahs-3127	242	9	cultivar	cultivar	NOUN
ahs-3127	242	10	,	,	PUNCT
ahs-3127	242	11	is	be	AUX
ahs-3127	242	12	cultivated	cultivate	VERB
ahs-3127	242	13	in	in	ADP
ahs-3127	242	14	the	the	DET
ahs-3127	242	15	arid	arid	NOUN
ahs-3127	242	16	and	and	CCONJ
ahs-3127	242	17	semi	semi	ADJ
ahs-3127	242	18	-	-	ADJ
ahs-3127	242	19	arid	arid	ADJ
ahs-3127	242	20	northernwest	northernw	ADJ
ahs-3127	242	21	regions	region	NOUN
ahs-3127	242	22	of	of	ADP
ahs-3127	242	23	syria	syria	PROPN
ahs-3127	242	24	,	,	PUNCT
ahs-3127	242	25	mostly	mostly	ADV
ahs-3127	242	26	in	in	ADP
ahs-3127	242	27	aleppo	aleppo	PROPN
ahs-3127	242	28	province	province	NOUN
ahs-3127	242	29	.	.	PUNCT
ahs-3127	243	1	control	control	NOUN
ahs-3127	243	2	(	(	PUNCT
ahs-3127	243	3	full	full	ADJ
ahs-3127	243	4	irrigation	irrigation	NOUN
ahs-3127	243	5	)	)	PUNCT
ahs-3127	243	6	and	and	CCONJ
ahs-3127	243	7	treated	treat	VERB
ahs-3127	243	8	(	(	PUNCT
ahs-3127	243	9	deficit	deficit	NOUN
ahs-3127	243	10	irrigation	irrigation	NOUN
ahs-3127	243	11	)	)	PUNCT
ahs-3127	243	12	plants	plant	NOUN
ahs-3127	243	13	of	of	ADP
ahs-3127	243	14	both	both	DET
ahs-3127	243	15	cultivars	cultivar	NOUN
ahs-3127	243	16	were	be	AUX
ahs-3127	243	17	tested	test	VERB
ahs-3127	243	18	using	use	VERB
ahs-3127	243	19	some	some	DET
ahs-3127	243	20	physiological	physiological	ADJ
ahs-3127	243	21	,	,	PUNCT
ahs-3127	243	22	morphological	morphological	ADJ
ahs-3127	243	23	,	,	PUNCT
ahs-3127	243	24	molecular	molecular	ADJ
ahs-3127	243	25	,	,	PUNCT
ahs-3127	243	26	and	and	CCONJ
ahs-3127	243	27	biochemical	biochemical	ADJ
ahs-3127	243	28	parameters	parameter	NOUN
ahs-3127	243	29	.	.	PUNCT
ahs-3127	244	1	the	the	DET
ahs-3127	244	2	restricted	restrict	VERB
ahs-3127	244	3	water	water	NOUN
ahs-3127	244	4	regime	regime	NOUN
ahs-3127	244	5	applied	apply	VERB
ahs-3127	244	6	on	on	ADP
ahs-3127	244	7	our	our	PRON
ahs-3127	244	8	treated	treat	VERB
ahs-3127	244	9	plants	plant	NOUN
ahs-3127	244	10	showed	show	VERB
ahs-3127	244	11	mild	mild	ADJ
ahs-3127	244	12	,	,	PUNCT
ahs-3127	244	13	non	non	ADJ
ahs-3127	244	14	-	-	ADJ
ahs-3127	244	15	significant	significant	ADJ
ahs-3127	244	16	effects	effect	NOUN
ahs-3127	244	17	on	on	ADP
ahs-3127	244	18	chlorophyll	chlorophyll	NOUN
ahs-3127	244	19	a	a	PRON
ahs-3127	244	20	and	and	CCONJ
ahs-3127	244	21	b	b	NOUN
ahs-3127	244	22	content	content	NOUN
ahs-3127	244	23	,	,	PUNCT
ahs-3127	244	24	which	which	PRON
ahs-3127	244	25	indicates	indicate	VERB
ahs-3127	244	26	a	a	DET
ahs-3127	244	27	weak	weak	ADJ
ahs-3127	244	28	impact	impact	NOUN
ahs-3127	244	29	of	of	ADP
ahs-3127	244	30	the	the	DET
ahs-3127	244	31	water	water	NOUN
ahs-3127	244	32	-	-	PUNCT
ahs-3127	244	33	shortage	shortage	NOUN
ahs-3127	244	34	stress	stress	NOUN
ahs-3127	244	35	regime	regime	NOUN
ahs-3127	244	36	on	on	ADP
ahs-3127	244	37	the	the	DET
ahs-3127	244	38	photosynthesis	photosynthesis	NOUN
ahs-3127	244	39	process	process	NOUN
ahs-3127	244	40	.	.	PUNCT
ahs-3127	245	1	however	however	ADV
ahs-3127	245	2	,	,	PUNCT
ahs-3127	245	3	the	the	DET
ahs-3127	245	4	cultivar	cultivar	NOUN
ahs-3127	245	5	aleppo	aleppo	PROPN
ahs-3127	245	6	118	118	NUM
ahs-3127	245	7	showed	show	VERB
ahs-3127	245	8	a	a	DET
ahs-3127	245	9	slight	slight	ADJ
ahs-3127	245	10	reduction	reduction	NOUN
ahs-3127	245	11	in	in	ADP
ahs-3127	245	12	chlorophyll	chlorophyll	NOUN
ahs-3127	245	13	a	a	DET
ahs-3127	245	14	/	/	SYM
ahs-3127	245	15	b	b	NOUN
ahs-3127	245	16	ratio	ratio	NOUN
ahs-3127	245	17	in	in	ADP
ahs-3127	245	18	treated	treat	VERB
ahs-3127	245	19	plants	plant	NOUN
ahs-3127	245	20	compared	compare	VERB
ahs-3127	245	21	to	to	ADP
ahs-3127	245	22	a	a	DET
ahs-3127	245	23	larger	large	ADJ
ahs-3127	245	24	reduction	reduction	NOUN
ahs-3127	245	25	in	in	ADP
ahs-3127	245	26	treated	treat	VERB
ahs-3127	245	27	plants	plant	NOUN
ahs-3127	245	28	of	of	ADP
ahs-3127	245	29	‘	'	PUNCT
ahs-3127	245	30	deir	deir	PROPN
ahs-3127	245	31	al	al	PROPN
ahs-3127	245	32	-	-	PROPN
ahs-3127	245	33	zour	zour	NOUN
ahs-3127	245	34	22	22	NUM
ahs-3127	245	35	’	'	PUNCT
ahs-3127	245	36	,	,	PUNCT
ahs-3127	245	37	which	which	PRON
ahs-3127	245	38	indicate	indicate	VERB
ahs-3127	245	39	the	the	DET
ahs-3127	245	40	presence	presence	NOUN
ahs-3127	245	41	of	of	ADP
ahs-3127	245	42	higher	high	ADJ
ahs-3127	245	43	chlorophyll	chlorophyll	NOUN
ahs-3127	245	44	b	b	NOUN
ahs-3127	245	45	content	content	NOUN
ahs-3127	245	46	in	in	ADP
ahs-3127	245	47	treated	treat	VERB
ahs-3127	245	48	‘	'	PUNCT
ahs-3127	245	49	deir	deir	PROPN
ahs-3127	245	50	al	al	PROPN
ahs-3127	245	51	-	-	PROPN
ahs-3127	245	52	zour	zour	ADJ
ahs-3127	245	53	22	22	NUM
ahs-3127	245	54	’	'	PUNCT
ahs-3127	245	55	plants	plant	NOUN
ahs-3127	245	56	.	.	PUNCT
ahs-3127	246	1	this	this	PRON
ahs-3127	246	2	in	in	ADP
ahs-3127	246	3	turn	turn	NOUN
ahs-3127	246	4	may	may	AUX
ahs-3127	246	5	suggest	suggest	VERB
ahs-3127	246	6	a	a	DET
ahs-3127	246	7	slower	slow	ADJ
ahs-3127	246	8	degradation	degradation	NOUN
ahs-3127	246	9	process	process	NOUN
ahs-3127	246	10	of	of	ADP
ahs-3127	246	11	chl	chl	PROPN
ahs-3127	246	12	b	b	PROPN
ahs-3127	246	13	coming	come	VERB
ahs-3127	246	14	from	from	ADP
ahs-3127	246	15	a	a	DET
ahs-3127	246	16	decrease	decrease	NOUN
ahs-3127	246	17	in	in	ADP
ahs-3127	246	18	the	the	DET
ahs-3127	246	19	enzymatic	enzymatic	ADJ
ahs-3127	246	20	activities	activity	NOUN
ahs-3127	246	21	that	that	PRON
ahs-3127	246	22	are	be	AUX
ahs-3127	246	23	known	know	VERB
ahs-3127	246	24	to	to	PART
ahs-3127	246	25	render	render	VERB
ahs-3127	246	26	the	the	DET
ahs-3127	246	27	conversion	conversion	NOUN
ahs-3127	246	28	of	of	ADP
ahs-3127	246	29	chl	chl	PROPN
ahs-3127	246	30	b	b	PROPN
ahs-3127	246	31	to	to	AUX
ahs-3127	246	32	chl	chl	PROPN
ahs-3127	246	33	a	a	DET
ahs-3127	246	34	(	(	PUNCT
ahs-3127	246	35	folly	folly	NOUN
ahs-3127	246	36	and	and	CCONJ
ahs-3127	246	37	engel	engel	PROPN
ahs-3127	246	38	,	,	PUNCT
ahs-3127	246	39	1999	1999	NUM
ahs-3127	246	40	)	)	PUNCT
ahs-3127	246	41	.	.	PUNCT
ahs-3127	247	1	it	it	PRON
ahs-3127	247	2	is	be	AUX
ahs-3127	247	3	suggested	suggest	VERB
ahs-3127	247	4	that	that	SCONJ
ahs-3127	247	5	drought	drought	NOUN
ahs-3127	247	6	stress	stress	NOUN
ahs-3127	247	7	has	have	VERB
ahs-3127	247	8	to	to	PART
ahs-3127	247	9	be	be	AUX
ahs-3127	247	10	prolonged	prolong	VERB
ahs-3127	247	11	and	and	CCONJ
ahs-3127	247	12	severe	severe	ADJ
ahs-3127	247	13	before	before	SCONJ
ahs-3127	247	14	the	the	DET
ahs-3127	247	15	chloroplast	chloroplast	NOUN
ahs-3127	247	16	start	start	VERB
ahs-3127	247	17	to	to	PART
ahs-3127	247	18	break	break	VERB
ahs-3127	247	19	down	down	ADP
ahs-3127	247	20	(	(	PUNCT
ahs-3127	247	21	jiang	jiang	PROPN
ahs-3127	247	22	et	et	PROPN
ahs-3127	247	23	al	al	PROPN
ahs-3127	247	24	.	.	PROPN
ahs-3127	247	25	,	,	PUNCT
ahs-3127	247	26	2010	2010	NUM
ahs-3127	247	27	)	)	PUNCT
ahs-3127	247	28	.	.	PUNCT
ahs-3127	248	1	another	another	DET
ahs-3127	248	2	non	non	ADJ
ahs-3127	248	3	-	-	ADJ
ahs-3127	248	4	significant	significant	ADJ
ahs-3127	248	5	drop	drop	NOUN
ahs-3127	248	6	was	be	AUX
ahs-3127	248	7	also	also	ADV
ahs-3127	248	8	observed	observe	VERB
ahs-3127	248	9	in	in	ADP
ahs-3127	248	10	the	the	DET
ahs-3127	248	11	osmotic	osmotic	ADJ
ahs-3127	248	12	potential	potential	ADJ
ahs-3127	248	13	values	value	NOUN
ahs-3127	248	14	of	of	ADP
ahs-3127	248	15	treated	treat	VERB
ahs-3127	248	16	plants	plant	NOUN
ahs-3127	248	17	in	in	ADP
ahs-3127	248	18	both	both	DET
ahs-3127	248	19	cultivars	cultivar	NOUN
ahs-3127	248	20	.	.	PUNCT
ahs-3127	249	1	however	however	ADV
ahs-3127	249	2	,	,	PUNCT
ahs-3127	249	3	the	the	DET
ahs-3127	249	4	cultivar	cultivar	NOUN
ahs-3127	249	5	aleppo	aleppo	PROPN
ahs-3127	249	6	118	118	NUM
ahs-3127	249	7	showed	show	VERB
ahs-3127	249	8	a	a	DET
ahs-3127	249	9	greater	great	ADJ
ahs-3127	249	10	osmotic	osmotic	ADJ
ahs-3127	249	11	adjustment	adjustment	NOUN
ahs-3127	249	12	value	value	NOUN
ahs-3127	249	13	which	which	PRON
ahs-3127	249	14	may	may	AUX
ahs-3127	249	15	indicate	indicate	VERB
ahs-3127	249	16	its	its	PRON
ahs-3127	249	17	stronger	strong	ADJ
ahs-3127	249	18	turgor	turgor	ADJ
ahs-3127	249	19	maintenance	maintenance	NOUN
ahs-3127	249	20	mechanism	mechanism	NOUN
ahs-3127	249	21	.	.	PUNCT
ahs-3127	250	1	osmotic	osmotic	ADJ
ahs-3127	250	2	adjustment	adjustment	NOUN
ahs-3127	250	3	has	have	AUX
ahs-3127	250	4	been	be	AUX
ahs-3127	250	5	also	also	ADV
ahs-3127	250	6	associated	associate	VERB
ahs-3127	250	7	with	with	ADP
ahs-3127	250	8	maintenance	maintenance	NOUN
ahs-3127	250	9	of	of	ADP
ahs-3127	250	10	membranes	membrane	NOUN
ahs-3127	250	11	and	and	CCONJ
ahs-3127	250	12	protein	protein	NOUN
ahs-3127	250	13	structure	structure	NOUN
ahs-3127	250	14	,	,	PUNCT
ahs-3127	250	15	protection	protection	NOUN
ahs-3127	250	16	against	against	ADP
ahs-3127	250	17	oxidative	oxidative	ADJ
ahs-3127	250	18	damage	damage	NOUN
ahs-3127	250	19	(	(	PUNCT
ahs-3127	250	20	dacosta	dacosta	PROPN
ahs-3127	250	21	and	and	CCONJ
ahs-3127	250	22	huang	huang	PROPN
ahs-3127	250	23	,	,	PUNCT
ahs-3127	250	24	2006	2006	NUM
ahs-3127	250	25	)	)	PUNCT
ahs-3127	250	26	.	.	PUNCT
ahs-3127	251	1	it	it	PRON
ahs-3127	251	2	has	have	AUX
ahs-3127	251	3	been	be	AUX
ahs-3127	251	4	reported	report	VERB
ahs-3127	251	5	that	that	SCONJ
ahs-3127	251	6	the	the	PRON
ahs-3127	251	7	greater	great	ADJ
ahs-3127	251	8	the	the	DET
ahs-3127	251	9	stress	stress	NOUN
ahs-3127	251	10	duration	duration	NOUN
ahs-3127	251	11	(	(	PUNCT
ahs-3127	251	12	increasing	increase	VERB
ahs-3127	251	13	the	the	DET
ahs-3127	251	14	number	number	NOUN
ahs-3127	251	15	of	of	ADP
ahs-3127	251	16	stress	stress	NOUN
ahs-3127	251	17	cycles	cycle	NOUN
ahs-3127	251	18	)	)	PUNCT
ahs-3127	251	19	,	,	PUNCT
ahs-3127	251	20	the	the	PRON
ahs-3127	251	21	larger	large	ADJ
ahs-3127	251	22	the	the	DET
ahs-3127	251	23	osmotic	osmotic	ADJ
ahs-3127	251	24	adjustfig	adjustfig	NOUN
ahs-3127	251	25	.	.	PUNCT
ahs-3127	252	1	8	8	NUM
ahs-3127	252	2	fold	fold	ADJ
ahs-3127	252	3	expression	expression	NOUN
ahs-3127	252	4	of	of	ADP
ahs-3127	252	5	dreb1a	dreb1a	NOUN
ahs-3127	252	6	,	,	PUNCT
ahs-3127	252	7	tps	tps	NOUN
ahs-3127	252	8	and	and	CCONJ
ahs-3127	252	9	hspcb	hspcb	NOUN
ahs-3127	252	10	genes	gene	NOUN
ahs-3127	252	11	in	in	ADP
ahs-3127	252	12	leaves	leave	NOUN
ahs-3127	252	13	of	of	ADP
ahs-3127	252	14	treated	treat	VERB
ahs-3127	252	15	‘	'	PUNCT
ahs-3127	252	16	aleppo	aleppo	PROPN
ahs-3127	252	17	118	118	NUM
ahs-3127	252	18	’	'	PUNCT
ahs-3127	252	19	and	and	CCONJ
ahs-3127	252	20	‘	'	PUNCT
ahs-3127	252	21	deir	deir	PROPN
ahs-3127	252	22	al	al	PROPN
ahs-3127	252	23	-	-	PUNCT
ahs-3127	252	24	zour	zour	ADJ
ahs-3127	252	25	22	22	NUM
ahs-3127	252	26	’	'	PUNCT
ahs-3127	252	27	plants	plant	NOUN
ahs-3127	252	28	.	.	PUNCT
ahs-3127	253	1	leaf	leaf	NOUN
ahs-3127	253	2	samples	sample	NOUN
ahs-3127	253	3	were	be	AUX
ahs-3127	253	4	collected	collect	VERB
ahs-3127	253	5	in	in	ADP
ahs-3127	253	6	two	two	NUM
ahs-3127	253	7	stages	stage	NOUN
ahs-3127	253	8	,	,	PUNCT
ahs-3127	253	9	s1	s1	NOUN
ahs-3127	253	10	(	(	PUNCT
ahs-3127	253	11	during	during	ADP
ahs-3127	253	12	floral	floral	ADJ
ahs-3127	253	13	bud	bud	NOUN
ahs-3127	253	14	to	to	PART
ahs-3127	253	15	flower	flower	VERB
ahs-3127	253	16	transition	transition	NOUN
ahs-3127	253	17	stage	stage	NOUN
ahs-3127	253	18	)	)	PUNCT
ahs-3127	253	19	and	and	CCONJ
ahs-3127	253	20	s2	s2	PROPN
ahs-3127	253	21	(	(	PUNCT
ahs-3127	253	22	bolls	boll	VERB
ahs-3127	253	23	opening	opening	NOUN
ahs-3127	253	24	and	and	CCONJ
ahs-3127	253	25	maturation	maturation	NOUN
ahs-3127	253	26	)	)	PUNCT
ahs-3127	253	27	.	.	PUNCT
ahs-3127	254	1	data	datum	NOUN
ahs-3127	254	2	were	be	AUX
ahs-3127	254	3	subjected	subject	VERB
ahs-3127	254	4	to	to	ADP
ahs-3127	254	5	duncan	duncan	PROPN
ahs-3127	254	6	’s	’s	PART
ahs-3127	254	7	test	test	NOUN
ahs-3127	254	8	with	with	ADP
ahs-3127	254	9	a	a	DET
ahs-3127	254	10	confidence	confidence	NOUN
ahs-3127	254	11	level	level	NOUN
ahs-3127	254	12	of	of	ADP
ahs-3127	254	13	95	95	NUM
ahs-3127	254	14	%	%	NOUN
ahs-3127	254	15	using	use	VERB
ahs-3127	254	16	statistica	statistica	PROPN
ahs-3127	254	17	program	program	PROPN
ahs-3127	254	18	.	.	PUNCT
ahs-3127	255	1	significant	significant	ADJ
ahs-3127	255	2	fold	fold	ADJ
ahs-3127	255	3	expression	expression	NOUN
ahs-3127	255	4	change	change	NOUN
ahs-3127	255	5	of	of	ADP
ahs-3127	255	6	tps	tps	NOUN
ahs-3127	255	7	and	and	CCONJ
ahs-3127	255	8	hspcb	hspcb	PROPN
ahs-3127	255	9	genes	gene	NOUN
ahs-3127	255	10	was	be	AUX
ahs-3127	255	11	observed	observe	VERB
ahs-3127	255	12	between	between	ADP
ahs-3127	255	13	s1	s1	NOUN
ahs-3127	255	14	and	and	CCONJ
ahs-3127	255	15	s2	s2	PROPN
ahs-3127	255	16	treated	treat	VERB
ahs-3127	255	17	‘	'	PUNCT
ahs-3127	255	18	deir	deir	PROPN
ahs-3127	255	19	al	al	PROPN
ahs-3127	255	20	-	-	PROPN
ahs-3127	255	21	zour	zour	NOUN
ahs-3127	255	22	22	22	NUM
ahs-3127	255	23	’	'	PUNCT
ahs-3127	255	24	.	.	PUNCT
ahs-3127	256	1	data	datum	NOUN
ahs-3127	256	2	represent	represent	VERB
ahs-3127	256	3	means	mean	NOUN
ahs-3127	256	4	and	and	CCONJ
ahs-3127	256	5	standard	standard	ADJ
ahs-3127	256	6	deviation	deviation	NOUN
ahs-3127	256	7	of	of	ADP
ahs-3127	256	8	three	three	NUM
ahs-3127	256	9	replications	replication	NOUN
ahs-3127	256	10	.	.	PUNCT
ahs-3127	257	1	adv	adv	PROPN
ahs-3127	257	2	.	.	PUNCT
ahs-3127	257	3	hort	hort	PROPN
ahs-3127	257	4	.	.	PUNCT
ahs-3127	258	1	sci	sci	PROPN
ahs-3127	258	2	.	.	PROPN
ahs-3127	258	3	,	,	PUNCT
ahs-3127	258	4	2018	2018	NUM
ahs-3127	258	5	32(1	32(1	NUM
ahs-3127	258	6	):	):	PUNCT
ahs-3127	258	7	79	79	NUM
ahs-3127	258	8	-	-	SYM
ahs-3127	258	9	92	92	NUM
ahs-3127	258	10	88	88	NUM
ahs-3127	258	11	ment	ment	NOUN
ahs-3127	258	12	in	in	ADP
ahs-3127	258	13	cotton	cotton	NOUN
ahs-3127	258	14	leaves	leave	NOUN
ahs-3127	258	15	(	(	PUNCT
ahs-3127	258	16	oosterhuis	oosterhuis	ADJ
ahs-3127	258	17	and	and	CCONJ
ahs-3127	258	18	wullschleger	wullschleger	ADJ
ahs-3127	258	19	,	,	PUNCT
ahs-3127	258	20	1987	1987	NUM
ahs-3127	258	21	)	)	PUNCT
ahs-3127	258	22	.	.	PUNCT
ahs-3127	259	1	the	the	DET
ahs-3127	259	2	morphology	morphology	NOUN
ahs-3127	259	3	and	and	CCONJ
ahs-3127	259	4	phenology	phenology	NOUN
ahs-3127	259	5	of	of	ADP
ahs-3127	259	6	plants	plant	NOUN
ahs-3127	259	7	can	can	AUX
ahs-3127	259	8	be	be	AUX
ahs-3127	259	9	significant	significant	ADJ
ahs-3127	259	10	indicators	indicator	NOUN
ahs-3127	259	11	of	of	ADP
ahs-3127	259	12	drought	drought	NOUN
ahs-3127	259	13	tolerance	tolerance	NOUN
ahs-3127	259	14	.	.	PUNCT
ahs-3127	260	1	changes	change	NOUN
ahs-3127	260	2	in	in	ADP
ahs-3127	260	3	plant	plant	NOUN
ahs-3127	260	4	growth	growth	NOUN
ahs-3127	260	5	rate	rate	NOUN
ahs-3127	260	6	and/or	and/or	CCONJ
ahs-3127	260	7	in	in	ADP
ahs-3127	260	8	flowering	flowering	NOUN
ahs-3127	260	9	time	time	NOUN
ahs-3127	260	10	are	be	AUX
ahs-3127	260	11	two	two	NUM
ahs-3127	260	12	common	common	ADJ
ahs-3127	260	13	strategies	strategy	NOUN
ahs-3127	260	14	that	that	PRON
ahs-3127	260	15	plants	plant	VERB
ahs-3127	260	16	use	use	VERB
ahs-3127	260	17	to	to	PART
ahs-3127	260	18	cope	cope	VERB
ahs-3127	260	19	with	with	ADP
ahs-3127	260	20	drought	drought	NOUN
ahs-3127	260	21	(	(	PUNCT
ahs-3127	260	22	schmalenbach	schmalenbach	NOUN
ahs-3127	260	23	et	et	PROPN
ahs-3127	260	24	al	al	PROPN
ahs-3127	260	25	.	.	PROPN
ahs-3127	260	26	,	,	PUNCT
ahs-3127	260	27	2014	2014	NUM
ahs-3127	260	28	)	)	PUNCT
ahs-3127	260	29	.	.	PUNCT
ahs-3127	261	1	the	the	DET
ahs-3127	261	2	allotetraploid	allotetraploid	VERB
ahs-3127	261	3	g.	g.	PROPN
ahs-3127	261	4	hirsutum	hirsutum	PROPN
ahs-3127	261	5	l.	l.	PROPN
ahs-3127	261	6	species	species	PROPN
ahs-3127	261	7	has	have	VERB
ahs-3127	261	8	a	a	DET
ahs-3127	261	9	distinct	distinct	ADJ
ahs-3127	261	10	growth	growth	NOUN
ahs-3127	261	11	manner	manner	NOUN
ahs-3127	261	12	in	in	ADP
ahs-3127	261	13	which	which	PRON
ahs-3127	261	14	the	the	DET
ahs-3127	261	15	plant	plant	NOUN
ahs-3127	261	16	keeps	keep	VERB
ahs-3127	261	17	a	a	DET
ahs-3127	261	18	systematic	systematic	ADJ
ahs-3127	261	19	morphological	morphological	ADJ
ahs-3127	261	20	architecture	architecture	NOUN
ahs-3127	261	21	(	(	PUNCT
ahs-3127	261	22	khan	khan	PROPN
ahs-3127	261	23	,	,	PUNCT
ahs-3127	261	24	2003	2003	NUM
ahs-3127	261	25	)	)	PUNCT
ahs-3127	261	26	that	that	PRON
ahs-3127	261	27	can	can	AUX
ahs-3127	261	28	be	be	AUX
ahs-3127	261	29	useful	useful	ADJ
ahs-3127	261	30	in	in	ADP
ahs-3127	261	31	monitoring	monitor	VERB
ahs-3127	261	32	growth	growth	NOUN
ahs-3127	261	33	and	and	CCONJ
ahs-3127	261	34	developmental	developmental	ADJ
ahs-3127	261	35	changes	change	NOUN
ahs-3127	261	36	under	under	ADP
ahs-3127	261	37	diverse	diverse	ADJ
ahs-3127	261	38	environmental	environmental	ADJ
ahs-3127	261	39	conditions	condition	NOUN
ahs-3127	261	40	(	(	PUNCT
ahs-3127	261	41	jawdat	jawdat	NOUN
ahs-3127	261	42	et	et	PROPN
ahs-3127	261	43	al	al	PROPN
ahs-3127	261	44	.	.	PROPN
ahs-3127	261	45	,	,	PUNCT
ahs-3127	261	46	2012	2012	NUM
ahs-3127	261	47	)	)	PUNCT
ahs-3127	261	48	.	.	PUNCT
ahs-3127	262	1	in	in	ADP
ahs-3127	262	2	general	general	ADJ
ahs-3127	262	3	,	,	PUNCT
ahs-3127	262	4	physiological	physiological	ADJ
ahs-3127	262	5	processes	process	NOUN
ahs-3127	262	6	are	be	AUX
ahs-3127	262	7	induced	induce	VERB
ahs-3127	262	8	in	in	ADP
ahs-3127	262	9	plants	plant	NOUN
ahs-3127	262	10	under	under	ADP
ahs-3127	262	11	stress	stress	NOUN
ahs-3127	262	12	conditions	condition	NOUN
ahs-3127	262	13	to	to	PART
ahs-3127	262	14	reduce	reduce	VERB
ahs-3127	262	15	the	the	DET
ahs-3127	262	16	cellular	cellular	ADJ
ahs-3127	262	17	damage	damage	NOUN
ahs-3127	262	18	and	and	CCONJ
ahs-3127	262	19	to	to	PART
ahs-3127	262	20	alter	alter	VERB
ahs-3127	262	21	developmental	developmental	ADJ
ahs-3127	262	22	timing	timing	NOUN
ahs-3127	262	23	to	to	PART
ahs-3127	262	24	complete	complete	VERB
ahs-3127	262	25	their	their	PRON
ahs-3127	262	26	life	life	NOUN
ahs-3127	262	27	cycle	cycle	NOUN
ahs-3127	262	28	fittingly	fittingly	ADV
ahs-3127	262	29	(	(	PUNCT
ahs-3127	262	30	yaish	yaish	PROPN
ahs-3127	262	31	et	et	PROPN
ahs-3127	262	32	al	al	PROPN
ahs-3127	262	33	.	.	PROPN
ahs-3127	262	34	,	,	PUNCT
ahs-3127	262	35	2011	2011	NUM
ahs-3127	262	36	)	)	PUNCT
ahs-3127	262	37	.	.	PUNCT
ahs-3127	263	1	stress	stress	NOUN
ahs-3127	263	2	-	-	PUNCT
ahs-3127	263	3	mediated	mediate	VERB
ahs-3127	263	4	flowering	flowering	NOUN
ahs-3127	263	5	has	have	AUX
ahs-3127	263	6	been	be	AUX
ahs-3127	263	7	reported	report	VERB
ahs-3127	263	8	in	in	ADP
ahs-3127	263	9	several	several	ADJ
ahs-3127	263	10	plant	plant	NOUN
ahs-3127	263	11	species	specie	NOUN
ahs-3127	263	12	;	;	PUNCT
ahs-3127	263	13	stresses	stress	NOUN
ahs-3127	263	14	like	like	ADP
ahs-3127	263	15	ultraviolet	ultraviolet	PROPN
ahs-3127	263	16	c	c	PROPN
ahs-3127	263	17	,	,	PUNCT
ahs-3127	263	18	poor	poor	ADJ
ahs-3127	263	19	nutrition	nutrition	NOUN
ahs-3127	263	20	,	,	PUNCT
ahs-3127	263	21	low	low	ADJ
ahs-3127	263	22	temperature	temperature	NOUN
ahs-3127	263	23	and	and	CCONJ
ahs-3127	263	24	drought	drought	NOUN
ahs-3127	263	25	(	(	PUNCT
ahs-3127	263	26	wada	wada	PROPN
ahs-3127	263	27	and	and	CCONJ
ahs-3127	263	28	takeno	takeno	NOUN
ahs-3127	263	29	,	,	PUNCT
ahs-3127	263	30	2010	2010	NUM
ahs-3127	263	31	)	)	PUNCT
ahs-3127	263	32	.	.	PUNCT
ahs-3127	264	1	our	our	PRON
ahs-3127	264	2	results	result	NOUN
ahs-3127	264	3	noted	note	VERB
ahs-3127	264	4	earliness	earliness	NOUN
ahs-3127	264	5	in	in	ADP
ahs-3127	264	6	treated	treat	VERB
ahs-3127	264	7	plants	plant	NOUN
ahs-3127	264	8	of	of	ADP
ahs-3127	264	9	both	both	DET
ahs-3127	264	10	varieties	variety	NOUN
ahs-3127	264	11	and	and	CCONJ
ahs-3127	264	12	a	a	DET
ahs-3127	264	13	tendency	tendency	NOUN
ahs-3127	264	14	of	of	ADP
ahs-3127	264	15	‘	'	PUNCT
ahs-3127	264	16	aleppo	aleppo	PROPN
ahs-3127	264	17	118	118	NUM
ahs-3127	264	18	’	'	PUNCT
ahs-3127	264	19	to	to	PART
ahs-3127	264	20	bear	bear	VERB
ahs-3127	264	21	higher	high	ADJ
ahs-3127	264	22	percentage	percentage	NOUN
ahs-3127	264	23	of	of	ADP
ahs-3127	264	24	flowers	flower	NOUN
ahs-3127	264	25	and	and	CCONJ
ahs-3127	264	26	floral	floral	ADJ
ahs-3127	264	27	buds	bud	NOUN
ahs-3127	264	28	toward	toward	ADP
ahs-3127	264	29	the	the	DET
ahs-3127	264	30	end	end	NOUN
ahs-3127	264	31	of	of	ADP
ahs-3127	264	32	season	season	NOUN
ahs-3127	264	33	.	.	PUNCT
ahs-3127	265	1	‘	'	PUNCT
ahs-3127	265	2	aleppo	aleppo	PROPN
ahs-3127	265	3	118	118	NUM
ahs-3127	265	4	’	'	PUNCT
ahs-3127	265	5	has	have	AUX
ahs-3127	265	6	been	be	AUX
ahs-3127	265	7	reported	report	VERB
ahs-3127	265	8	to	to	PART
ahs-3127	265	9	show	show	VERB
ahs-3127	265	10	excessive	excessive	ADJ
ahs-3127	265	11	vegetative	vegetative	ADJ
ahs-3127	265	12	growth	growth	NOUN
ahs-3127	265	13	under	under	ADP
ahs-3127	265	14	excess	excess	ADJ
ahs-3127	265	15	water	water	NOUN
ahs-3127	265	16	and	and	CCONJ
ahs-3127	265	17	nitrogen	nitrogen	NOUN
ahs-3127	265	18	compared	compare	VERB
ahs-3127	265	19	to	to	ADP
ahs-3127	265	20	other	other	ADJ
ahs-3127	265	21	local	local	ADJ
ahs-3127	265	22	cultivars	cultivar	NOUN
ahs-3127	265	23	(	(	PUNCT
ahs-3127	265	24	cra	cra	PROPN
ahs-3127	265	25	,	,	PUNCT
ahs-3127	265	26	personal	personal	ADJ
ahs-3127	265	27	communication	communication	NOUN
ahs-3127	265	28	)	)	PUNCT
ahs-3127	265	29	.	.	PUNCT
ahs-3127	266	1	this	this	PRON
ahs-3127	266	2	may	may	AUX
ahs-3127	266	3	suggest	suggest	VERB
ahs-3127	266	4	that	that	SCONJ
ahs-3127	266	5	water	water	NOUN
ahs-3127	266	6	status	status	NOUN
ahs-3127	266	7	(	(	PUNCT
ahs-3127	266	8	excess	excess	ADJ
ahs-3127	266	9	and	and	CCONJ
ahs-3127	266	10	shortage	shortage	NOUN
ahs-3127	266	11	)	)	PUNCT
ahs-3127	266	12	may	may	AUX
ahs-3127	266	13	hold	hold	VERB
ahs-3127	266	14	back	back	ADP
ahs-3127	266	15	or	or	CCONJ
ahs-3127	266	16	trigger	trigger	VERB
ahs-3127	266	17	floral	floral	ADJ
ahs-3127	266	18	cues	cue	NOUN
ahs-3127	266	19	,	,	PUNCT
ahs-3127	266	20	and	and	CCONJ
ahs-3127	266	21	this	this	PRON
ahs-3127	266	22	needs	need	VERB
ahs-3127	266	23	to	to	PART
ahs-3127	266	24	be	be	AUX
ahs-3127	266	25	investigated	investigate	VERB
ahs-3127	266	26	fully	fully	ADV
ahs-3127	266	27	taking	take	VERB
ahs-3127	266	28	into	into	ADP
ahs-3127	266	29	consideration	consideration	NOUN
ahs-3127	266	30	our	our	PRON
ahs-3127	266	31	result	result	NOUN
ahs-3127	266	32	of	of	ADP
ahs-3127	266	33	the	the	DET
ahs-3127	266	34	higher	high	ADJ
ahs-3127	266	35	osmotic	osmotic	ADJ
ahs-3127	266	36	adjustment	adjustment	NOUN
ahs-3127	266	37	in	in	ADP
ahs-3127	266	38	‘	'	PUNCT
ahs-3127	266	39	aleppo	aleppo	PROPN
ahs-3127	266	40	118	118	NUM
ahs-3127	266	41	’	'	PUNCT
ahs-3127	266	42	compared	compare	VERB
ahs-3127	266	43	to	to	ADP
ahs-3127	266	44	‘	'	PUNCT
ahs-3127	266	45	deir	deir	PROPN
ahs-3127	266	46	al	al	PROPN
ahs-3127	266	47	-	-	PROPN
ahs-3127	266	48	zour	zour	NOUN
ahs-3127	266	49	22	22	NUM
ahs-3127	266	50	’	'	PUNCT
ahs-3127	266	51	.	.	PUNCT
ahs-3127	267	1	the	the	DET
ahs-3127	267	2	small	small	ADJ
ahs-3127	267	3	increase	increase	NOUN
ahs-3127	267	4	in	in	ADP
ahs-3127	267	5	stem	stem	NOUN
ahs-3127	267	6	height	height	NOUN
ahs-3127	267	7	in	in	ADP
ahs-3127	267	8	treated	treat	VERB
ahs-3127	267	9	plants	plant	NOUN
ahs-3127	267	10	of	of	ADP
ahs-3127	267	11	both	both	DET
ahs-3127	267	12	cultivars	cultivar	NOUN
ahs-3127	267	13	can	can	AUX
ahs-3127	267	14	be	be	AUX
ahs-3127	267	15	explained	explain	VERB
ahs-3127	267	16	that	that	SCONJ
ahs-3127	267	17	plants	plant	NOUN
ahs-3127	267	18	accumulate	accumulate	VERB
ahs-3127	267	19	reserves	reserve	NOUN
ahs-3127	267	20	in	in	ADP
ahs-3127	267	21	shoots	shoot	NOUN
ahs-3127	267	22	and	and	CCONJ
ahs-3127	267	23	stems	stem	VERB
ahs-3127	267	24	to	to	PART
ahs-3127	267	25	cope	cope	VERB
ahs-3127	267	26	with	with	ADP
ahs-3127	267	27	water	water	NOUN
ahs-3127	267	28	stress	stress	NOUN
ahs-3127	267	29	(	(	PUNCT
ahs-3127	267	30	chavez	chavez	PROPN
ahs-3127	267	31	et	et	PROPN
ahs-3127	267	32	al	al	PROPN
ahs-3127	267	33	.	.	PROPN
ahs-3127	267	34	,	,	PUNCT
ahs-3127	267	35	2002	2002	NUM
ahs-3127	267	36	)	)	PUNCT
ahs-3127	267	37	.	.	PUNCT
ahs-3127	268	1	the	the	DET
ahs-3127	268	2	water	water	NOUN
ahs-3127	268	3	deficit	deficit	NOUN
ahs-3127	268	4	regime	regime	NOUN
ahs-3127	268	5	,	,	PUNCT
ahs-3127	268	6	applied	apply	VERB
ahs-3127	268	7	in	in	ADP
ahs-3127	268	8	our	our	PRON
ahs-3127	268	9	study	study	NOUN
ahs-3127	268	10	through	through	ADP
ahs-3127	268	11	drip	drip	NOUN
ahs-3127	268	12	irrigation	irrigation	NOUN
ahs-3127	268	13	,	,	PUNCT
ahs-3127	268	14	encouraged	encourage	VERB
ahs-3127	268	15	the	the	DET
ahs-3127	268	16	increase	increase	NOUN
ahs-3127	268	17	in	in	ADP
ahs-3127	268	18	number	number	NOUN
ahs-3127	268	19	of	of	ADP
ahs-3127	268	20	secondary	secondary	ADJ
ahs-3127	268	21	roots	root	NOUN
ahs-3127	268	22	in	in	ADP
ahs-3127	268	23	treated	treat	VERB
ahs-3127	268	24	plants	plant	NOUN
ahs-3127	268	25	of	of	ADP
ahs-3127	268	26	both	both	DET
ahs-3127	268	27	cultivars	cultivar	NOUN
ahs-3127	268	28	on	on	ADP
ahs-3127	268	29	the	the	DET
ahs-3127	268	30	expenses	expense	NOUN
ahs-3127	268	31	of	of	ADP
ahs-3127	268	32	a	a	DET
ahs-3127	268	33	decrease	decrease	NOUN
ahs-3127	268	34	in	in	ADP
ahs-3127	268	35	tap	tap	NOUN
ahs-3127	268	36	root	root	NOUN
ahs-3127	268	37	length	length	NOUN
ahs-3127	268	38	.	.	PUNCT
ahs-3127	269	1	fiber	fiber	NOUN
ahs-3127	269	2	quality	quality	NOUN
ahs-3127	269	3	,	,	PUNCT
ahs-3127	269	4	which	which	PRON
ahs-3127	269	5	is	be	AUX
ahs-3127	269	6	a	a	DET
ahs-3127	269	7	result	result	NOUN
ahs-3127	269	8	of	of	ADP
ahs-3127	269	9	interactions	interaction	NOUN
ahs-3127	269	10	between	between	ADP
ahs-3127	269	11	genetics	genetic	NOUN
ahs-3127	269	12	and	and	CCONJ
ahs-3127	269	13	environment	environment	NOUN
ahs-3127	269	14	,	,	PUNCT
ahs-3127	269	15	controls	control	VERB
ahs-3127	269	16	fiber	fiber	NOUN
ahs-3127	269	17	prices	price	NOUN
ahs-3127	269	18	of	of	ADP
ahs-3127	269	19	cotton	cotton	NOUN
ahs-3127	269	20	textile	textile	NOUN
ahs-3127	269	21	products	product	NOUN
ahs-3127	269	22	(	(	PUNCT
ahs-3127	269	23	wang	wang	PROPN
ahs-3127	269	24	et	et	PROPN
ahs-3127	269	25	al	al	PROPN
ahs-3127	269	26	.	.	PROPN
ahs-3127	269	27	,	,	PUNCT
ahs-3127	269	28	2014	2014	NUM
ahs-3127	269	29	)	)	PUNCT
ahs-3127	269	30	.	.	PUNCT
ahs-3127	270	1	the	the	DET
ahs-3127	270	2	quest	quest	NOUN
ahs-3127	270	3	for	for	ADP
ahs-3127	270	4	cotton	cotton	NOUN
ahs-3127	270	5	growers	grower	NOUN
ahs-3127	270	6	is	be	AUX
ahs-3127	270	7	the	the	DET
ahs-3127	270	8	balance	balance	NOUN
ahs-3127	270	9	between	between	ADP
ahs-3127	270	10	fiber	fiber	NOUN
ahs-3127	270	11	quality	quality	NOUN
ahs-3127	270	12	and	and	CCONJ
ahs-3127	270	13	quantity	quantity	NOUN
ahs-3127	270	14	.	.	PUNCT
ahs-3127	271	1	achieving	achieve	VERB
ahs-3127	271	2	such	such	DET
ahs-3127	271	3	a	a	DET
ahs-3127	271	4	balance	balance	NOUN
ahs-3127	271	5	in	in	ADP
ahs-3127	271	6	cotton	cotton	NOUN
ahs-3127	271	7	cultivation	cultivation	NOUN
ahs-3127	271	8	regions	region	NOUN
ahs-3127	271	9	with	with	ADP
ahs-3127	271	10	growing	grow	VERB
ahs-3127	271	11	water	water	NOUN
ahs-3127	271	12	shortages	shortage	NOUN
ahs-3127	271	13	is	be	AUX
ahs-3127	271	14	a	a	DET
ahs-3127	271	15	main	main	ADJ
ahs-3127	271	16	concern	concern	NOUN
ahs-3127	271	17	to	to	ADP
ahs-3127	271	18	the	the	DET
ahs-3127	271	19	agricultural	agricultural	ADJ
ahs-3127	271	20	and	and	CCONJ
ahs-3127	271	21	industrial	industrial	ADJ
ahs-3127	271	22	sectors	sector	NOUN
ahs-3127	271	23	.	.	PUNCT
ahs-3127	272	1	an	an	DET
ahs-3127	272	2	escalating	escalate	VERB
ahs-3127	272	3	number	number	NOUN
ahs-3127	272	4	of	of	ADP
ahs-3127	272	5	publications	publication	NOUN
ahs-3127	272	6	aim	aim	VERB
ahs-3127	272	7	at	at	ADP
ahs-3127	272	8	understanding	understand	VERB
ahs-3127	272	9	the	the	DET
ahs-3127	272	10	mechanism	mechanism	NOUN
ahs-3127	272	11	of	of	ADP
ahs-3127	272	12	cotton	cotton	NOUN
ahs-3127	272	13	fiber	fiber	NOUN
ahs-3127	272	14	development	development	NOUN
ahs-3127	272	15	and	and	CCONJ
ahs-3127	272	16	adaptation	adaptation	NOUN
ahs-3127	272	17	to	to	ADP
ahs-3127	272	18	abiotic	abiotic	ADJ
ahs-3127	272	19	stresses	stress	NOUN
ahs-3127	272	20	,	,	PUNCT
ahs-3127	272	21	such	such	ADJ
ahs-3127	272	22	as	as	ADP
ahs-3127	272	23	drought	drought	NOUN
ahs-3127	272	24	,	,	PUNCT
ahs-3127	272	25	for	for	ADP
ahs-3127	272	26	the	the	DET
ahs-3127	272	27	improvement	improvement	NOUN
ahs-3127	272	28	of	of	ADP
ahs-3127	272	29	cotton	cotton	NOUN
ahs-3127	272	30	fiber	fiber	NOUN
ahs-3127	272	31	yields	yield	NOUN
ahs-3127	272	32	and	and	CCONJ
ahs-3127	272	33	quality	quality	NOUN
ahs-3127	272	34	(	(	PUNCT
ahs-3127	272	35	zhu	zhu	X
ahs-3127	272	36	et	et	PROPN
ahs-3127	272	37	al	al	PROPN
ahs-3127	272	38	.	.	PROPN
ahs-3127	272	39	,	,	PUNCT
ahs-3127	272	40	2011	2011	NUM
ahs-3127	272	41	;	;	PUNCT
ahs-3127	272	42	deeba	deeba	NOUN
ahs-3127	272	43	et	et	PROPN
ahs-3127	272	44	al	al	PROPN
ahs-3127	272	45	.	.	PROPN
ahs-3127	272	46	,	,	PUNCT
ahs-3127	272	47	2012	2012	NUM
ahs-3127	272	48	;	;	PUNCT
ahs-3127	272	49	padmalatha	padmalatha	NOUN
ahs-3127	272	50	et	et	PROPN
ahs-3127	272	51	al	al	PROPN
ahs-3127	272	52	.	.	PROPN
ahs-3127	272	53	,	,	PUNCT
ahs-3127	272	54	2012	2012	NUM
ahs-3127	272	55	;	;	PUNCT
ahs-3127	272	56	bowman	bowman	PROPN
ahs-3127	272	57	et	et	PROPN
ahs-3127	272	58	al	al	PROPN
ahs-3127	272	59	.	.	PROPN
ahs-3127	272	60	,	,	PUNCT
ahs-3127	272	61	2013	2013	NUM
ahs-3127	272	62	;	;	PUNCT
ahs-3127	272	63	riaz	riaz	PROPN
ahs-3127	272	64	et	et	PROPN
ahs-3127	272	65	al	al	PROPN
ahs-3127	272	66	.	.	PROPN
ahs-3127	272	67	,	,	PUNCT
ahs-3127	272	68	2013	2013	NUM
ahs-3127	272	69	;	;	PUNCT
ahs-3127	272	70	wang	wang	PROPN
ahs-3127	272	71	et	et	PROPN
ahs-3127	272	72	al	al	PROPN
ahs-3127	272	73	.	.	PROPN
ahs-3127	272	74	,	,	PUNCT
ahs-3127	272	75	2013	2013	NUM
ahs-3127	272	76	;	;	PUNCT
ahs-3127	272	77	zhang	zhang	PROPN
ahs-3127	272	78	et	et	PROPN
ahs-3127	272	79	al	al	PROPN
ahs-3127	272	80	.	.	PROPN
ahs-3127	272	81	,	,	PUNCT
ahs-3127	272	82	2013	2013	NUM
ahs-3127	272	83	;	;	PUNCT
ahs-3127	272	84	sekmen	sekman	NOUN
ahs-3127	272	85	et	et	PROPN
ahs-3127	272	86	al	al	PROPN
ahs-3127	272	87	.	.	PROPN
ahs-3127	272	88	,	,	PUNCT
ahs-3127	272	89	2014	2014	NUM
ahs-3127	272	90	;	;	PUNCT
ahs-3127	272	91	xie	xie	PROPN
ahs-3127	272	92	et	et	PROPN
ahs-3127	272	93	al	al	PROPN
ahs-3127	272	94	.	.	PROPN
ahs-3127	272	95	,	,	PUNCT
ahs-3127	272	96	2015	2015	NUM
ahs-3127	272	97	)	)	PUNCT
ahs-3127	272	98	.	.	PUNCT
ahs-3127	273	1	cotton	cotton	NOUN
ahs-3127	273	2	growth	growth	NOUN
ahs-3127	273	3	and	and	CCONJ
ahs-3127	273	4	yield	yield	NOUN
ahs-3127	273	5	are	be	AUX
ahs-3127	273	6	severely	severely	ADV
ahs-3127	273	7	affected	affect	VERB
ahs-3127	273	8	by	by	ADP
ahs-3127	273	9	excessive	excessive	ADJ
ahs-3127	273	10	water	water	NOUN
ahs-3127	273	11	-	-	PUNCT
ahs-3127	273	12	shortage	shortage	NOUN
ahs-3127	273	13	stress	stress	NOUN
ahs-3127	273	14	,	,	PUNCT
ahs-3127	273	15	especially	especially	ADV
ahs-3127	273	16	at	at	ADP
ahs-3127	273	17	critical	critical	ADJ
ahs-3127	273	18	growth	growth	NOUN
ahs-3127	273	19	stages	stage	NOUN
ahs-3127	273	20	such	such	ADJ
ahs-3127	273	21	as	as	ADP
ahs-3127	273	22	the	the	DET
ahs-3127	273	23	flowering	flowering	NOUN
ahs-3127	273	24	phase	phase	NOUN
ahs-3127	273	25	(	(	PUNCT
ahs-3127	273	26	dağdelen	dağdelen	VERB
ahs-3127	273	27	et	et	PROPN
ahs-3127	273	28	al	al	PROPN
ahs-3127	273	29	.	.	PROPN
ahs-3127	273	30	,	,	PUNCT
ahs-3127	273	31	2009	2009	NUM
ahs-3127	273	32	)	)	PUNCT
ahs-3127	273	33	.	.	PUNCT
ahs-3127	274	1	soil	soil	NOUN
ahs-3127	274	2	water	water	NOUN
ahs-3127	274	3	was	be	AUX
ahs-3127	274	4	found	find	VERB
ahs-3127	274	5	to	to	PART
ahs-3127	274	6	be	be	AUX
ahs-3127	274	7	correlated	correlate	VERB
ahs-3127	274	8	with	with	ADP
ahs-3127	274	9	fiber	fiber	NOUN
ahs-3127	274	10	strength	strength	NOUN
ahs-3127	274	11	,	,	PUNCT
ahs-3127	274	12	elongation	elongation	NOUN
ahs-3127	274	13	(	(	PUNCT
ahs-3127	274	14	johnson	johnson	PROPN
ahs-3127	274	15	et	et	PROPN
ahs-3127	274	16	al	al	PROPN
ahs-3127	274	17	.	.	PROPN
ahs-3127	274	18	,	,	PUNCT
ahs-3127	274	19	2002	2002	NUM
ahs-3127	274	20	)	)	PUNCT
ahs-3127	274	21	and	and	CCONJ
ahs-3127	274	22	fiber	fiber	NOUN
ahs-3127	274	23	maturity	maturity	NOUN
ahs-3127	274	24	(	(	PUNCT
ahs-3127	274	25	davidonis	davidoni	NOUN
ahs-3127	274	26	et	et	PROPN
ahs-3127	274	27	al	al	PROPN
ahs-3127	274	28	.	.	PROPN
ahs-3127	274	29	,	,	PUNCT
ahs-3127	274	30	2004	2004	NUM
ahs-3127	274	31	)	)	PUNCT
ahs-3127	274	32	.	.	PUNCT
ahs-3127	275	1	our	our	PRON
ahs-3127	275	2	results	result	NOUN
ahs-3127	275	3	showed	show	VERB
ahs-3127	275	4	that	that	SCONJ
ahs-3127	275	5	two	two	NUM
ahs-3127	275	6	fiber	fiber	NOUN
ahs-3127	275	7	properties	property	NOUN
ahs-3127	275	8	,	,	PUNCT
ahs-3127	275	9	cohesion	cohesion	NOUN
ahs-3127	275	10	and	and	CCONJ
ahs-3127	275	11	micronaire	micronaire	NOUN
ahs-3127	275	12	,	,	PUNCT
ahs-3127	275	13	had	have	VERB
ahs-3127	275	14	no	no	DET
ahs-3127	275	15	significant	significant	ADJ
ahs-3127	275	16	differences	difference	NOUN
ahs-3127	275	17	between	between	ADP
ahs-3127	275	18	control	control	NOUN
ahs-3127	275	19	and	and	CCONJ
ahs-3127	275	20	treated	treat	VERB
ahs-3127	275	21	plants	plant	NOUN
ahs-3127	275	22	of	of	ADP
ahs-3127	275	23	the	the	DET
ahs-3127	275	24	two	two	NUM
ahs-3127	275	25	cultivars	cultivar	NOUN
ahs-3127	275	26	.	.	PUNCT
ahs-3127	276	1	it	it	PRON
ahs-3127	276	2	is	be	AUX
ahs-3127	276	3	with	with	ADP
ahs-3127	276	4	fiber	fiber	NOUN
ahs-3127	276	5	cohesion	cohesion	NOUN
ahs-3127	276	6	,	,	PUNCT
ahs-3127	276	7	a	a	DET
ahs-3127	276	8	property	property	NOUN
ahs-3127	276	9	that	that	PRON
ahs-3127	276	10	causes	cause	VERB
ahs-3127	276	11	materials	material	NOUN
ahs-3127	276	12	to	to	PART
ahs-3127	276	13	cling	cling	VERB
ahs-3127	276	14	together	together	ADV
ahs-3127	276	15	,	,	PUNCT
ahs-3127	276	16	yarn	yarn	NOUN
ahs-3127	276	17	spinning	spinning	NOUN
ahs-3127	276	18	from	from	ADP
ahs-3127	276	19	staple	staple	NOUN
ahs-3127	276	20	fiber	fiber	NOUN
ahs-3127	276	21	is	be	AUX
ahs-3127	276	22	possible	possible	ADJ
ahs-3127	276	23	(	(	PUNCT
ahs-3127	276	24	wakelyn	wakelyn	NOUN
ahs-3127	276	25	,	,	PUNCT
ahs-3127	276	26	2007	2007	NUM
ahs-3127	276	27	)	)	PUNCT
ahs-3127	276	28	.	.	PUNCT
ahs-3127	277	1	a	a	DET
ahs-3127	277	2	previous	previous	ADJ
ahs-3127	277	3	study	study	NOUN
ahs-3127	277	4	showed	show	VERB
ahs-3127	277	5	fiber	fiber	NOUN
ahs-3127	277	6	cohesion	cohesion	NOUN
ahs-3127	277	7	stability	stability	NOUN
ahs-3127	277	8	of	of	ADP
ahs-3127	277	9	‘	'	PUNCT
ahs-3127	277	10	deir	deir	PROPN
ahs-3127	277	11	al	al	PROPN
ahs-3127	277	12	-	-	PROPN
ahs-3127	277	13	zour	zour	NOUN
ahs-3127	277	14	22	22	NUM
ahs-3127	277	15	’	'	PUNCT
ahs-3127	277	16	between	between	ADP
ahs-3127	277	17	seasons	season	NOUN
ahs-3127	277	18	and	and	CCONJ
ahs-3127	277	19	locations	location	NOUN
ahs-3127	277	20	;	;	PUNCT
ahs-3127	277	21	whereas	whereas	ADV
ahs-3127	277	22	,	,	PUNCT
ahs-3127	277	23	‘	'	PUNCT
ahs-3127	277	24	aleppo	aleppo	X
ahs-3127	277	25	118	118	NUM
ahs-3127	277	26	’	'	PUNCT
ahs-3127	277	27	showed	show	VERB
ahs-3127	277	28	cohesion	cohesion	NOUN
ahs-3127	277	29	stability	stability	NOUN
ahs-3127	277	30	between	between	ADP
ahs-3127	277	31	seasons	season	NOUN
ahs-3127	277	32	in	in	ADP
ahs-3127	277	33	one	one	NUM
ahs-3127	277	34	location	location	NOUN
ahs-3127	277	35	(	(	PUNCT
ahs-3127	277	36	jawdat	jawdat	PROPN
ahs-3127	277	37	et	et	PROPN
ahs-3127	277	38	al	al	PROPN
ahs-3127	277	39	.	.	PROPN
ahs-3127	277	40	,	,	PUNCT
ahs-3127	277	41	2012	2012	NUM
ahs-3127	277	42	)	)	PUNCT
ahs-3127	277	43	.	.	PUNCT
ahs-3127	278	1	as	as	ADP
ahs-3127	278	2	for	for	ADP
ahs-3127	278	3	fiber	fiber	NOUN
ahs-3127	278	4	micronaire	micronaire	NOUN
ahs-3127	278	5	,	,	PUNCT
ahs-3127	278	6	it	it	PRON
ahs-3127	278	7	reflects	reflect	VERB
ahs-3127	278	8	fiber	fiber	NOUN
ahs-3127	278	9	fineness	fineness	NOUN
ahs-3127	278	10	and	and	CCONJ
ahs-3127	278	11	is	be	AUX
ahs-3127	278	12	a	a	DET
ahs-3127	278	13	measure	measure	NOUN
ahs-3127	278	14	of	of	ADP
ahs-3127	278	15	internal	internal	ADJ
ahs-3127	278	16	fiber	fiber	NOUN
ahs-3127	278	17	thickness	thickness	NOUN
ahs-3127	278	18	and	and	CCONJ
ahs-3127	278	19	deposits	deposit	NOUN
ahs-3127	278	20	of	of	ADP
ahs-3127	278	21	cellulose	cellulose	NOUN
ahs-3127	278	22	.	.	PUNCT
ahs-3127	279	1	it	it	PRON
ahs-3127	279	2	has	have	VERB
ahs-3127	279	3	a	a	DET
ahs-3127	279	4	desired	desire	VERB
ahs-3127	279	5	value	value	NOUN
ahs-3127	279	6	range	range	NOUN
ahs-3127	279	7	in	in	ADP
ahs-3127	279	8	the	the	DET
ahs-3127	279	9	international	international	ADJ
ahs-3127	279	10	market	market	NOUN
ahs-3127	279	11	between	between	ADP
ahs-3127	279	12	3.5	3.5	NUM
ahs-3127	279	13	and	and	CCONJ
ahs-3127	279	14	4.9	4.9	NUM
ahs-3127	279	15	(	(	PUNCT
ahs-3127	279	16	jawdat	jawdat	PROPN
ahs-3127	279	17	et	et	PROPN
ahs-3127	279	18	al	al	PROPN
ahs-3127	279	19	.	.	PROPN
ahs-3127	279	20	,	,	PUNCT
ahs-3127	279	21	2012	2012	NUM
ahs-3127	279	22	)	)	PUNCT
ahs-3127	279	23	.	.	PUNCT
ahs-3127	280	1	fiber	fiber	NOUN
ahs-3127	280	2	micronaire	micronaire	NOUN
ahs-3127	280	3	,	,	PUNCT
ahs-3127	280	4	showed	show	VERB
ahs-3127	280	5	stability	stability	NOUN
ahs-3127	280	6	in	in	ADP
ahs-3127	280	7	both	both	DET
ahs-3127	280	8	‘	'	PUNCT
ahs-3127	280	9	aleppo	aleppo	PROPN
ahs-3127	280	10	118	118	NUM
ahs-3127	280	11	’	'	PUNCT
ahs-3127	280	12	and	and	CCONJ
ahs-3127	280	13	‘	'	PUNCT
ahs-3127	280	14	deir	deir	PROPN
ahs-3127	280	15	al	al	PROPN
ahs-3127	280	16	-	-	PROPN
ahs-3127	280	17	zour	zour	NOUN
ahs-3127	280	18	22	22	NUM
ahs-3127	280	19	’	'	PUNCT
ahs-3127	280	20	between	between	ADP
ahs-3127	280	21	seasons	season	NOUN
ahs-3127	280	22	and	and	CCONJ
ahs-3127	280	23	locations	location	NOUN
ahs-3127	280	24	(	(	PUNCT
ahs-3127	280	25	jawdat	jawdat	NOUN
ahs-3127	280	26	et	et	PROPN
ahs-3127	280	27	al	al	PROPN
ahs-3127	280	28	.	.	PROPN
ahs-3127	280	29	,	,	PUNCT
ahs-3127	280	30	2012	2012	NUM
ahs-3127	280	31	)	)	PUNCT
ahs-3127	280	32	.	.	PUNCT
ahs-3127	281	1	this	this	PRON
ahs-3127	281	2	indicates	indicate	VERB
ahs-3127	281	3	that	that	SCONJ
ahs-3127	281	4	environmental	environmental	ADJ
ahs-3127	281	5	factors	factor	NOUN
ahs-3127	281	6	including	include	VERB
ahs-3127	281	7	water	water	NOUN
ahs-3127	281	8	deficit	deficit	NOUN
ahs-3127	281	9	have	have	VERB
ahs-3127	281	10	weak	weak	ADJ
ahs-3127	281	11	impact	impact	NOUN
ahs-3127	281	12	on	on	ADP
ahs-3127	281	13	the	the	DET
ahs-3127	281	14	two	two	NUM
ahs-3127	281	15	fiber	fiber	NOUN
ahs-3127	281	16	properties	property	NOUN
ahs-3127	281	17	,	,	PUNCT
ahs-3127	281	18	cohesion	cohesion	NOUN
ahs-3127	281	19	and	and	CCONJ
ahs-3127	281	20	micronaire	micronaire	NOUN
ahs-3127	281	21	.	.	PUNCT
ahs-3127	282	1	deficit	deficit	NOUN
ahs-3127	282	2	irrigation	irrigation	NOUN
ahs-3127	282	3	showed	show	VERB
ahs-3127	282	4	no	no	DET
ahs-3127	282	5	significant	significant	ADJ
ahs-3127	282	6	effect	effect	NOUN
ahs-3127	282	7	on	on	ADP
ahs-3127	282	8	fiber	fiber	NOUN
ahs-3127	282	9	length	length	NOUN
ahs-3127	282	10	and	and	CCONJ
ahs-3127	282	11	strength	strength	NOUN
ahs-3127	282	12	in	in	ADP
ahs-3127	282	13	aleppo	aleppo	PROPN
ahs-3127	282	14	118	118	NUM
ahs-3127	282	15	cultivar	cultivar	NOUN
ahs-3127	282	16	.	.	PUNCT
ahs-3127	283	1	however	however	ADV
ahs-3127	283	2	,	,	PUNCT
ahs-3127	283	3	it	it	PRON
ahs-3127	283	4	had	have	VERB
ahs-3127	283	5	significant	significant	ADJ
ahs-3127	283	6	impact	impact	NOUN
ahs-3127	283	7	on	on	ADP
ahs-3127	283	8	the	the	DET
ahs-3127	283	9	two	two	NUM
ahs-3127	283	10	fiber	fiber	NOUN
ahs-3127	283	11	properties	property	NOUN
ahs-3127	283	12	,	,	PUNCT
ahs-3127	283	13	causing	cause	VERB
ahs-3127	283	14	increment	increment	NOUN
ahs-3127	283	15	in	in	ADP
ahs-3127	283	16	both	both	DET
ahs-3127	283	17	strength	strength	NOUN
ahs-3127	283	18	and	and	CCONJ
ahs-3127	283	19	length	length	NOUN
ahs-3127	283	20	of	of	ADP
ahs-3127	283	21	fiber	fiber	NOUN
ahs-3127	283	22	in	in	ADP
ahs-3127	283	23	treated	treat	VERB
ahs-3127	283	24	plants	plant	NOUN
ahs-3127	283	25	of	of	ADP
ahs-3127	283	26	deir	deir	PROPN
ahs-3127	283	27	al	al	PROPN
ahs-3127	283	28	-	-	PROPN
ahs-3127	283	29	zour	zour	PROPN
ahs-3127	283	30	22	22	NUM
ahs-3127	283	31	cultivar	cultivar	NOUN
ahs-3127	283	32	.	.	PUNCT
ahs-3127	284	1	fiber	fiber	NOUN
ahs-3127	284	2	strength	strength	NOUN
ahs-3127	284	3	is	be	AUX
ahs-3127	284	4	an	an	DET
ahs-3127	284	5	indicator	indicator	NOUN
ahs-3127	284	6	of	of	ADP
ahs-3127	284	7	fiber	fiber	NOUN
ahs-3127	284	8	resistance	resistance	NOUN
ahs-3127	284	9	to	to	ADP
ahs-3127	284	10	stretching	stretch	VERB
ahs-3127	284	11	(	(	PUNCT
ahs-3127	284	12	wang	wang	PROPN
ahs-3127	284	13	et	et	PROPN
ahs-3127	284	14	al	al	PROPN
ahs-3127	284	15	.	.	PROPN
ahs-3127	284	16	,	,	PUNCT
ahs-3127	284	17	2014	2014	NUM
ahs-3127	284	18	)	)	PUNCT
ahs-3127	284	19	and	and	CCONJ
ahs-3127	284	20	is	be	AUX
ahs-3127	284	21	determined	determine	VERB
ahs-3127	284	22	by	by	ADP
ahs-3127	284	23	environmental	environmental	ADJ
ahs-3127	284	24	conditions	condition	NOUN
ahs-3127	284	25	and	and	CCONJ
ahs-3127	284	26	cultivar	cultivar	NOUN
ahs-3127	284	27	traits	trait	NOUN
ahs-3127	284	28	(	(	PUNCT
ahs-3127	284	29	zhou	zhou	X
ahs-3127	284	30	et	et	PROPN
ahs-3127	284	31	al	al	PROPN
ahs-3127	284	32	.	.	PROPN
ahs-3127	284	33	,	,	PUNCT
ahs-3127	284	34	2011	2011	NUM
ahs-3127	284	35	)	)	PUNCT
ahs-3127	284	36	.	.	PUNCT
ahs-3127	285	1	it	it	PRON
ahs-3127	285	2	has	have	AUX
ahs-3127	285	3	been	be	AUX
ahs-3127	285	4	found	find	VERB
ahs-3127	285	5	that	that	SCONJ
ahs-3127	285	6	fiber	fiber	NOUN
ahs-3127	285	7	strength	strength	NOUN
ahs-3127	285	8	is	be	AUX
ahs-3127	285	9	correlated	correlate	VERB
ahs-3127	285	10	with	with	ADP
ahs-3127	285	11	daily	daily	ADJ
ahs-3127	285	12	mean	mean	ADJ
ahs-3127	285	13	temperature	temperature	NOUN
ahs-3127	285	14	during	during	ADP
ahs-3127	285	15	fiber	fiber	NOUN
ahs-3127	285	16	development	development	NOUN
ahs-3127	285	17	(	(	PUNCT
ahs-3127	285	18	hanson	hanson	NOUN
ahs-3127	285	19	and	and	CCONJ
ahs-3127	285	20	ewing	ewing	PROPN
ahs-3127	285	21	,	,	PUNCT
ahs-3127	285	22	1956	1956	NUM
ahs-3127	285	23	;	;	PUNCT
ahs-3127	286	1	ma	ma	PROPN
ahs-3127	286	2	et	et	PROPN
ahs-3127	286	3	al	al	PROPN
ahs-3127	286	4	.	.	PROPN
ahs-3127	286	5	,	,	PUNCT
ahs-3127	286	6	2006	2006	NUM
ahs-3127	286	7	;	;	PUNCT
ahs-3127	286	8	wang	wang	PROPN
ahs-3127	286	9	et	et	PROPN
ahs-3127	286	10	al	al	PROPN
ahs-3127	286	11	.	.	PROPN
ahs-3127	286	12	,	,	PUNCT
ahs-3127	286	13	2009	2009	NUM
ahs-3127	286	14	)	)	PUNCT
ahs-3127	286	15	.	.	PUNCT
ahs-3127	287	1	this	this	PRON
ahs-3127	287	2	has	have	AUX
ahs-3127	287	3	been	be	AUX
ahs-3127	287	4	also	also	ADV
ahs-3127	287	5	observed	observe	VERB
ahs-3127	287	6	on	on	ADP
ahs-3127	287	7	a	a	DET
ahs-3127	287	8	previous	previous	ADJ
ahs-3127	287	9	study	study	NOUN
ahs-3127	287	10	where	where	SCONJ
ahs-3127	287	11	a	a	DET
ahs-3127	287	12	difference	difference	NOUN
ahs-3127	287	13	of	of	ADP
ahs-3127	287	14	4	4	NUM
ahs-3127	287	15	-	-	SYM
ahs-3127	287	16	5	5	NUM
ahs-3127	287	17	°	°	NOUN
ahs-3127	287	18	c	c	NOUN
ahs-3127	287	19	showed	show	VERB
ahs-3127	287	20	a	a	DET
ahs-3127	287	21	significant	significant	ADJ
ahs-3127	287	22	effect	effect	NOUN
ahs-3127	287	23	on	on	ADP
ahs-3127	287	24	fiber	fiber	NOUN
ahs-3127	287	25	strength	strength	NOUN
ahs-3127	287	26	in	in	ADP
ahs-3127	287	27	both	both	DET
ahs-3127	287	28	‘	'	PUNCT
ahs-3127	287	29	aleppo	aleppo	PROPN
ahs-3127	287	30	118	118	NUM
ahs-3127	287	31	’	'	PUNCT
ahs-3127	287	32	and	and	CCONJ
ahs-3127	287	33	‘	'	PUNCT
ahs-3127	287	34	deir	deir	PROPN
ahs-3127	287	35	al	al	PROPN
ahs-3127	287	36	-	-	PROPN
ahs-3127	287	37	zour	zour	NOUN
ahs-3127	287	38	22	22	NUM
ahs-3127	287	39	’	'	PUNCT
ahs-3127	287	40	(	(	PUNCT
ahs-3127	287	41	jawdat	jawdat	PROPN
ahs-3127	287	42	et	et	PROPN
ahs-3127	287	43	al	al	PROPN
ahs-3127	287	44	.	.	PROPN
ahs-3127	287	45	,	,	PUNCT
ahs-3127	287	46	2012	2012	NUM
ahs-3127	287	47	)	)	PUNCT
ahs-3127	287	48	.	.	PUNCT
ahs-3127	288	1	however	however	ADV
ahs-3127	288	2	,	,	PUNCT
ahs-3127	288	3	this	this	DET
ahs-3127	288	4	temperature	temperature	NOUN
ahs-3127	288	5	difference	difference	NOUN
ahs-3127	288	6	did	do	AUX
ahs-3127	288	7	not	not	PART
ahs-3127	288	8	affect	affect	VERB
ahs-3127	288	9	fiber	fiber	NOUN
ahs-3127	288	10	length	length	NOUN
ahs-3127	288	11	in	in	ADP
ahs-3127	288	12	both	both	DET
ahs-3127	288	13	cultivars	cultivar	NOUN
ahs-3127	288	14	(	(	PUNCT
ahs-3127	288	15	jawdat	jawdat	NOUN
ahs-3127	288	16	et	et	PROPN
ahs-3127	288	17	al	al	PROPN
ahs-3127	288	18	.	.	PROPN
ahs-3127	288	19	,	,	PUNCT
ahs-3127	288	20	2012	2012	NUM
ahs-3127	288	21	)	)	PUNCT
ahs-3127	288	22	.	.	PUNCT
ahs-3127	289	1	this	this	PRON
ahs-3127	289	2	shows	show	VERB
ahs-3127	289	3	the	the	DET
ahs-3127	289	4	impact	impact	NOUN
ahs-3127	289	5	of	of	ADP
ahs-3127	289	6	each	each	PRON
ahs-3127	289	7	of	of	ADP
ahs-3127	289	8	water	water	NOUN
ahs-3127	289	9	deficit	deficit	NOUN
ahs-3127	289	10	and	and	CCONJ
ahs-3127	289	11	temperature	temperature	NOUN
ahs-3127	289	12	on	on	ADP
ahs-3127	289	13	fiber	fiber	NOUN
ahs-3127	289	14	strength	strength	NOUN
ahs-3127	289	15	of	of	ADP
ahs-3127	289	16	‘	'	PUNCT
ahs-3127	289	17	deir	deir	PROPN
ahs-3127	289	18	al	al	PROPN
ahs-3127	289	19	-	-	PROPN
ahs-3127	289	20	zour	zour	NOUN
ahs-3127	289	21	22	22	NUM
ahs-3127	289	22	’	'	PUNCT
ahs-3127	289	23	compared	compare	VERB
ahs-3127	289	24	to	to	ADP
ahs-3127	289	25	the	the	DET
ahs-3127	289	26	impact	impact	NOUN
ahs-3127	289	27	of	of	ADP
ahs-3127	289	28	only	only	ADJ
ahs-3127	289	29	temperature	temperature	NOUN
ahs-3127	289	30	on	on	ADP
ahs-3127	289	31	fiber	fiber	NOUN
ahs-3127	289	32	strength	strength	NOUN
ahs-3127	289	33	of	of	ADP
ahs-3127	289	34	‘	'	PUNCT
ahs-3127	289	35	aleppo	aleppo	PROPN
ahs-3127	289	36	118	118	NUM
ahs-3127	289	37	’	'	PUNCT
ahs-3127	289	38	.	.	PUNCT
ahs-3127	290	1	fiber	fiber	NOUN
ahs-3127	290	2	maturity	maturity	NOUN
ahs-3127	290	3	can	can	AUX
ahs-3127	290	4	be	be	AUX
ahs-3127	290	5	defined	define	VERB
ahs-3127	290	6	as	as	ADP
ahs-3127	290	7	the	the	DET
ahs-3127	290	8	relative	relative	ADJ
ahs-3127	290	9	wall	wall	PROPN
ahs-3127	290	10	thickness	thickness	PROPN
ahs-3127	290	11	and	and	CCONJ
ahs-3127	290	12	wall	wall	PROPN
ahs-3127	290	13	development	development	PROPN
ahs-3127	290	14	(	(	PUNCT
ahs-3127	290	15	wakelyn	wakelyn	NOUN
ahs-3127	290	16	,	,	PUNCT
ahs-3127	290	17	2007	2007	NUM
ahs-3127	290	18	)	)	PUNCT
ahs-3127	290	19	.	.	PUNCT
ahs-3127	291	1	in	in	ADP
ahs-3127	291	2	our	our	PRON
ahs-3127	291	3	work	work	NOUN
ahs-3127	291	4	,	,	PUNCT
ahs-3127	291	5	we	we	PRON
ahs-3127	291	6	observed	observe	VERB
ahs-3127	291	7	an	an	DET
ahs-3127	291	8	increase	increase	NOUN
ahs-3127	291	9	in	in	ADP
ahs-3127	291	10	fiber	fiber	NOUN
ahs-3127	291	11	maturity	maturity	NOUN
ahs-3127	291	12	factor	factor	NOUN
ahs-3127	291	13	values	value	NOUN
ahs-3127	291	14	in	in	ADP
ahs-3127	291	15	treated	treat	VERB
ahs-3127	291	16	jawdat	jawdat	PROPN
ahs-3127	291	17	et	et	PROPN
ahs-3127	291	18	al	al	PROPN
ahs-3127	291	19	.	.	PUNCT
ahs-3127	292	1	cotton	cotton	NOUN
ahs-3127	292	2	behaviour	behaviour	NOUN
ahs-3127	292	3	under	under	ADP
ahs-3127	292	4	water	water	NOUN
ahs-3127	292	5	stress	stress	NOUN
ahs-3127	292	6	89	89	NUM
ahs-3127	292	7	plants	plant	NOUN
ahs-3127	292	8	compared	compare	VERB
ahs-3127	292	9	to	to	ADP
ahs-3127	292	10	the	the	DET
ahs-3127	292	11	controls	control	NOUN
ahs-3127	292	12	,	,	PUNCT
ahs-3127	292	13	which	which	PRON
ahs-3127	292	14	suggests	suggest	VERB
ahs-3127	292	15	that	that	SCONJ
ahs-3127	292	16	water	water	NOUN
ahs-3127	292	17	deficit	deficit	NOUN
ahs-3127	292	18	did	do	AUX
ahs-3127	292	19	not	not	PART
ahs-3127	292	20	affect	affect	VERB
ahs-3127	292	21	the	the	DET
ahs-3127	292	22	maturity	maturity	NOUN
ahs-3127	292	23	of	of	ADP
ahs-3127	292	24	cotton	cotton	NOUN
ahs-3127	292	25	fiber	fiber	NOUN
ahs-3127	292	26	in	in	ADP
ahs-3127	292	27	a	a	DET
ahs-3127	292	28	negative	negative	ADJ
ahs-3127	292	29	way	way	NOUN
ahs-3127	292	30	and	and	CCONJ
ahs-3127	292	31	hence	hence	ADV
ahs-3127	292	32	their	their	PRON
ahs-3127	292	33	quality	quality	NOUN
ahs-3127	292	34	as	as	ADP
ahs-3127	292	35	related	relate	VERB
ahs-3127	292	36	to	to	ADP
ahs-3127	292	37	dye	dye	NOUN
ahs-3127	292	38	-	-	PUNCT
ahs-3127	292	39	ability	ability	NOUN
ahs-3127	292	40	and	and	CCONJ
ahs-3127	292	41	ease	ease	NOUN
ahs-3127	292	42	of	of	ADP
ahs-3127	292	43	processing	processing	NOUN
ahs-3127	292	44	.	.	PUNCT
ahs-3127	293	1	the	the	DET
ahs-3127	293	2	ftir	ftir	PROPN
ahs-3127	293	3	-	-	ADJ
ahs-3127	293	4	atr	atr	ADJ
ahs-3127	293	5	spectra	spectra	NOUN
ahs-3127	293	6	of	of	ADP
ahs-3127	293	7	the	the	DET
ahs-3127	293	8	cotton	cotton	NOUN
ahs-3127	293	9	fibers	fiber	NOUN
ahs-3127	293	10	obtained	obtain	VERB
ahs-3127	293	11	from	from	ADP
ahs-3127	293	12	control	control	NOUN
ahs-3127	293	13	and	and	CCONJ
ahs-3127	293	14	treated	treat	VERB
ahs-3127	293	15	aleppo	aleppo	PROPN
ahs-3127	293	16	118	118	NUM
ahs-3127	293	17	and	and	CCONJ
ahs-3127	293	18	deir	deir	PROPN
ahs-3127	293	19	al	al	PROPN
ahs-3127	293	20	-	-	PROPN
ahs-3127	293	21	zour	zour	NOUN
ahs-3127	293	22	22	22	NUM
ahs-3127	293	23	cultivars	cultivar	NOUN
ahs-3127	293	24	showed	show	VERB
ahs-3127	293	25	similar	similar	ADJ
ahs-3127	293	26	spectra	spectra	ADJ
ahs-3127	293	27	range	range	NOUN
ahs-3127	293	28	except	except	SCONJ
ahs-3127	293	29	for	for	ADP
ahs-3127	293	30	few	few	ADJ
ahs-3127	293	31	noticeable	noticeable	ADJ
ahs-3127	293	32	bands	band	NOUN
ahs-3127	293	33	.	.	PUNCT
ahs-3127	294	1	this	this	PRON
ahs-3127	294	2	can	can	AUX
ahs-3127	294	3	be	be	AUX
ahs-3127	294	4	due	due	ADJ
ahs-3127	294	5	to	to	ADP
ahs-3127	294	6	a	a	DET
ahs-3127	294	7	reduction	reduction	NOUN
ahs-3127	294	8	in	in	ADP
ahs-3127	294	9	surface	surface	NOUN
ahs-3127	294	10	water	water	NOUN
ahs-3127	294	11	adsorption	adsorption	NOUN
ahs-3127	294	12	which	which	PRON
ahs-3127	294	13	leads	lead	VERB
ahs-3127	294	14	to	to	ADP
ahs-3127	294	15	stronger	strong	ADJ
ahs-3127	294	16	fibers	fiber	NOUN
ahs-3127	294	17	.	.	PUNCT
ahs-3127	295	1	the	the	DET
ahs-3127	295	2	minimized	minimized	ADJ
ahs-3127	295	3	accessibility	accessibility	NOUN
ahs-3127	295	4	of	of	ADP
ahs-3127	295	5	water	water	NOUN
ahs-3127	295	6	molecules	molecule	NOUN
ahs-3127	295	7	to	to	ADP
ahs-3127	295	8	the	the	DET
ahs-3127	295	9	internal	internal	ADJ
ahs-3127	295	10	hydroxyl	hydroxyl	NOUN
ahs-3127	295	11	groups	group	NOUN
ahs-3127	295	12	can	can	AUX
ahs-3127	295	13	be	be	AUX
ahs-3127	295	14	mostly	mostly	ADV
ahs-3127	295	15	due	due	ADJ
ahs-3127	295	16	to	to	ADP
ahs-3127	295	17	the	the	DET
ahs-3127	295	18	formation	formation	NOUN
ahs-3127	295	19	of	of	ADP
ahs-3127	295	20	cellulose	cellulose	NOUN
ahs-3127	295	21	macromolecules	macromolecule	NOUN
ahs-3127	295	22	that	that	PRON
ahs-3127	295	23	induce	induce	VERB
ahs-3127	295	24	a	a	DET
ahs-3127	295	25	re	re	NOUN
ahs-3127	295	26	-	-	NOUN
ahs-3127	295	27	organization	organization	NOUN
ahs-3127	295	28	of	of	ADP
ahs-3127	295	29	cellulose	cellulose	NOUN
ahs-3127	295	30	and	and	CCONJ
ahs-3127	295	31	also	also	ADV
ahs-3127	295	32	increase	increase	VERB
ahs-3127	295	33	the	the	DET
ahs-3127	295	34	ordered	order	VERB
ahs-3127	295	35	cellulose	cellulose	NOUN
ahs-3127	295	36	(	(	PUNCT
ahs-3127	295	37	or	or	CCONJ
ahs-3127	295	38	crystalline	crystalline	NOUN
ahs-3127	295	39	)	)	PUNCT
ahs-3127	295	40	portion	portion	NOUN
ahs-3127	295	41	to	to	PART
ahs-3127	295	42	produce	produce	VERB
ahs-3127	295	43	a	a	DET
ahs-3127	295	44	stronger	strong	ADJ
ahs-3127	295	45	fiber	fiber	NOUN
ahs-3127	295	46	(	(	PUNCT
ahs-3127	295	47	liu	liu	PROPN
ahs-3127	295	48	,	,	PUNCT
ahs-3127	295	49	2013	2013	NUM
ahs-3127	295	50	)	)	PUNCT
ahs-3127	295	51	in	in	ADP
ahs-3127	295	52	deir	deir	PROPN
ahs-3127	295	53	al	al	PROPN
ahs-3127	295	54	-	-	PROPN
ahs-3127	295	55	zour	zour	PROPN
ahs-3127	295	56	22	22	NUM
ahs-3127	295	57	treated	treat	VERB
ahs-3127	295	58	cultivar	cultivar	NOUN
ahs-3127	295	59	.	.	PUNCT
ahs-3127	296	1	results	result	NOUN
ahs-3127	296	2	of	of	ADP
ahs-3127	296	3	xrd	xrd	NOUN
ahs-3127	296	4	showed	show	VERB
ahs-3127	296	5	minor	minor	ADJ
ahs-3127	296	6	ci	ci	NOUN
ahs-3127	296	7	variation	variation	NOUN
ahs-3127	296	8	between	between	ADP
ahs-3127	296	9	fibers	fiber	NOUN
ahs-3127	296	10	from	from	ADP
ahs-3127	296	11	control	control	NOUN
ahs-3127	296	12	and	and	CCONJ
ahs-3127	296	13	treated	treat	VERB
ahs-3127	296	14	deir	deir	PROPN
ahs-3127	296	15	al	al	PROPN
ahs-3127	296	16	-	-	PROPN
ahs-3127	296	17	zour	zour	NOUN
ahs-3127	296	18	22	22	NUM
ahs-3127	296	19	.	.	PUNCT
ahs-3127	297	1	both	both	CCONJ
ahs-3127	297	2	tga	tga	PROPN
ahs-3127	297	3	and	and	CCONJ
ahs-3127	297	4	dsc	dsc	NOUN
ahs-3127	297	5	showed	show	VERB
ahs-3127	297	6	no	no	DET
ahs-3127	297	7	variation	variation	NOUN
ahs-3127	297	8	between	between	ADP
ahs-3127	297	9	fibers	fiber	NOUN
ahs-3127	297	10	of	of	ADP
ahs-3127	297	11	treated	treat	VERB
ahs-3127	297	12	and	and	CCONJ
ahs-3127	297	13	control	control	VERB
ahs-3127	297	14	plants	plant	NOUN
ahs-3127	297	15	in	in	ADP
ahs-3127	297	16	both	both	DET
ahs-3127	297	17	cultivars	cultivar	NOUN
ahs-3127	297	18	.	.	PUNCT
ahs-3127	298	1	our	our	PRON
ahs-3127	298	2	work	work	NOUN
ahs-3127	298	3	has	have	AUX
ahs-3127	298	4	also	also	ADV
ahs-3127	298	5	investigated	investigate	VERB
ahs-3127	298	6	gene	gene	NOUN
ahs-3127	298	7	fold	fold	NOUN
ahs-3127	298	8	change	change	NOUN
ahs-3127	298	9	in	in	ADP
ahs-3127	298	10	expression	expression	NOUN
ahs-3127	298	11	of	of	ADP
ahs-3127	298	12	the	the	DET
ahs-3127	298	13	transcription	transcription	NOUN
ahs-3127	298	14	factor	factor	NOUN
ahs-3127	298	15	gene	gene	NOUN
ahs-3127	298	16	(	(	PUNCT
ahs-3127	298	17	dreb1a	dreb1a	PROPN
ahs-3127	298	18	)	)	PUNCT
ahs-3127	298	19	,	,	PUNCT
ahs-3127	298	20	the	the	DET
ahs-3127	298	21	molecular	molecular	ADJ
ahs-3127	298	22	chaperone	chaperone	NOUN
ahs-3127	298	23	gene	gene	NOUN
ahs-3127	298	24	(	(	PUNCT
ahs-3127	298	25	hspcb	hspcb	PROPN
ahs-3127	298	26	)	)	PUNCT
ahs-3127	298	27	(	(	PUNCT
ahs-3127	298	28	sotirios	sotirio	NOUN
ahs-3127	298	29	et	et	PROPN
ahs-3127	298	30	al	al	PROPN
ahs-3127	298	31	.	.	PROPN
ahs-3127	298	32	,	,	PUNCT
ahs-3127	298	33	2006	2006	NUM
ahs-3127	298	34	)	)	PUNCT
ahs-3127	298	35	,	,	PUNCT
ahs-3127	298	36	and	and	CCONJ
ahs-3127	298	37	the	the	DET
ahs-3127	298	38	trehalose	trehalose	ADJ
ahs-3127	298	39	biosynthesis	biosynthesis	NOUN
ahs-3127	298	40	gene	gene	NOUN
ahs-3127	298	41	(	(	PUNCT
ahs-3127	298	42	tps	tps	NOUN
ahs-3127	298	43	)	)	PUNCT
ahs-3127	298	44	(	(	PUNCT
ahs-3127	298	45	kosmas	kosmas	PROPN
ahs-3127	298	46	et	et	PROPN
ahs-3127	298	47	al	al	PROPN
ahs-3127	298	48	.	.	PROPN
ahs-3127	298	49	,	,	PUNCT
ahs-3127	298	50	2006	2006	NUM
ahs-3127	298	51	)	)	PUNCT
ahs-3127	298	52	.	.	PUNCT
ahs-3127	299	1	the	the	DET
ahs-3127	299	2	two	two	NUM
ahs-3127	299	3	genes	gene	NOUN
ahs-3127	299	4	hspcb	hspcb	VERB
ahs-3127	299	5	and	and	CCONJ
ahs-3127	299	6	tps	tps	NOUN
ahs-3127	299	7	have	have	AUX
ahs-3127	299	8	been	be	AUX
ahs-3127	299	9	found	find	VERB
ahs-3127	299	10	in	in	ADP
ahs-3127	299	11	few	few	ADJ
ahs-3127	299	12	studies	study	NOUN
ahs-3127	299	13	to	to	PART
ahs-3127	299	14	be	be	AUX
ahs-3127	299	15	expressed	express	VERB
ahs-3127	299	16	differently	differently	ADV
ahs-3127	299	17	between	between	ADP
ahs-3127	299	18	drought	drought	NOUN
ahs-3127	299	19	-	-	PUNCT
ahs-3127	299	20	tolerant	tolerant	ADJ
ahs-3127	299	21	and	and	CCONJ
ahs-3127	299	22	drought	drought	NOUN
ahs-3127	299	23	-	-	PUNCT
ahs-3127	299	24	sensitive	sensitive	ADJ
ahs-3127	299	25	cotton	cotton	NOUN
ahs-3127	299	26	genotypes	genotype	NOUN
ahs-3127	299	27	.	.	PUNCT
ahs-3127	300	1	while	while	SCONJ
ahs-3127	300	2	the	the	DET
ahs-3127	300	3	hspcb	hspcb	NOUN
ahs-3127	300	4	showed	show	VERB
ahs-3127	300	5	differential	differential	ADJ
ahs-3127	300	6	expression	expression	NOUN
ahs-3127	300	7	during	during	ADP
ahs-3127	300	8	the	the	DET
ahs-3127	300	9	drought	drought	NOUN
ahs-3127	300	10	period	period	NOUN
ahs-3127	300	11	in	in	ADP
ahs-3127	300	12	leaves	leave	NOUN
ahs-3127	300	13	of	of	ADP
ahs-3127	300	14	drought	drought	NOUN
ahs-3127	300	15	tolerant	tolerant	ADJ
ahs-3127	300	16	genotypes	genotype	NOUN
ahs-3127	300	17	and	and	CCONJ
ahs-3127	300	18	not	not	PART
ahs-3127	300	19	in	in	ADP
ahs-3127	300	20	the	the	DET
ahs-3127	300	21	sensitive	sensitive	ADJ
ahs-3127	300	22	ones	one	NOUN
ahs-3127	300	23	(	(	PUNCT
ahs-3127	300	24	nepomuceno	nepomuceno	PROPN
ahs-3127	300	25	et	et	PROPN
ahs-3127	300	26	al	al	PROPN
ahs-3127	300	27	.	.	PROPN
ahs-3127	300	28	,	,	PUNCT
ahs-3127	300	29	2002	2002	NUM
ahs-3127	300	30	;	;	PUNCT
ahs-3127	300	31	voloudakis	voloudaki	NOUN
ahs-3127	300	32	et	et	PROPN
ahs-3127	300	33	al	al	PROPN
ahs-3127	300	34	.	.	PROPN
ahs-3127	300	35	,	,	PUNCT
ahs-3127	300	36	2002	2002	NUM
ahs-3127	300	37	)	)	PUNCT
ahs-3127	300	38	,	,	PUNCT
ahs-3127	300	39	the	the	DET
ahs-3127	300	40	tps	tps	NOUN
ahs-3127	300	41	gene	gene	NOUN
ahs-3127	300	42	was	be	AUX
ahs-3127	300	43	induced	induce	VERB
ahs-3127	300	44	during	during	ADP
ahs-3127	300	45	the	the	DET
ahs-3127	300	46	water	water	NOUN
ahs-3127	300	47	stress	stress	NOUN
ahs-3127	300	48	period	period	NOUN
ahs-3127	300	49	in	in	ADP
ahs-3127	300	50	both	both	CCONJ
ahs-3127	300	51	tolerant	tolerant	ADJ
ahs-3127	300	52	and	and	CCONJ
ahs-3127	300	53	sensitive	sensitive	ADJ
ahs-3127	300	54	cultivars	cultivar	NOUN
ahs-3127	300	55	(	(	PUNCT
ahs-3127	300	56	nepomuceno	nepomuceno	PROPN
ahs-3127	300	57	et	et	PROPN
ahs-3127	300	58	al	al	PROPN
ahs-3127	300	59	.	.	PROPN
ahs-3127	300	60	,	,	PUNCT
ahs-3127	300	61	2002	2002	NUM
ahs-3127	300	62	)	)	PUNCT
ahs-3127	300	63	.	.	PUNCT
ahs-3127	301	1	interestingly	interestingly	ADV
ahs-3127	301	2	,	,	PUNCT
ahs-3127	301	3	our	our	PRON
ahs-3127	301	4	study	study	NOUN
ahs-3127	301	5	showed	show	VERB
ahs-3127	301	6	a	a	DET
ahs-3127	301	7	significant	significant	ADJ
ahs-3127	301	8	reduction	reduction	NOUN
ahs-3127	301	9	in	in	ADP
ahs-3127	301	10	hspcb	hspcb	PROPN
ahs-3127	301	11	and	and	CCONJ
ahs-3127	301	12	tps	tps	NOUN
ahs-3127	301	13	genes	gene	NOUN
ahs-3127	301	14	activity	activity	NOUN
ahs-3127	301	15	in	in	ADP
ahs-3127	301	16	leaves	leave	NOUN
ahs-3127	301	17	during	during	ADP
ahs-3127	301	18	bolls	boll	NOUN
ahs-3127	301	19	opening	opening	NOUN
ahs-3127	301	20	and	and	CCONJ
ahs-3127	301	21	maturation	maturation	NOUN
ahs-3127	301	22	in	in	ADP
ahs-3127	301	23	both	both	DET
ahs-3127	301	24	cultivars	cultivar	NOUN
ahs-3127	301	25	.	.	PUNCT
ahs-3127	302	1	whereas	whereas	ADV
ahs-3127	302	2	,	,	PUNCT
ahs-3127	302	3	dreb	dreb	VERB
ahs-3127	302	4	1a	1a	PROPN
ahs-3127	302	5	gene	gene	NOUN
ahs-3127	302	6	kept	keep	VERB
ahs-3127	302	7	a	a	DET
ahs-3127	302	8	high	high	ADJ
ahs-3127	302	9	active	active	ADJ
ahs-3127	302	10	mode	mode	NOUN
ahs-3127	302	11	in	in	ADP
ahs-3127	302	12	leaves	leave	NOUN
ahs-3127	302	13	of	of	ADP
ahs-3127	302	14	treated	treat	VERB
ahs-3127	302	15	‘	'	PUNCT
ahs-3127	302	16	deir	deir	PROPN
ahs-3127	302	17	al	al	PROPN
ahs-3127	302	18	-	-	PROPN
ahs-3127	302	19	zour	zour	ADJ
ahs-3127	302	20	22	22	NUM
ahs-3127	302	21	’	'	PUNCT
ahs-3127	302	22	plants	plant	NOUN
ahs-3127	302	23	compared	compare	VERB
ahs-3127	302	24	to	to	ADP
ahs-3127	302	25	‘	'	PUNCT
ahs-3127	302	26	aleppo	aleppo	PROPN
ahs-3127	302	27	118	118	NUM
ahs-3127	302	28	’	'	PUNCT
ahs-3127	302	29	treated	treat	VERB
ahs-3127	302	30	plants	plant	NOUN
ahs-3127	302	31	during	during	ADP
ahs-3127	302	32	that	that	DET
ahs-3127	302	33	stage	stage	NOUN
ahs-3127	302	34	.	.	PUNCT
ahs-3127	303	1	dehydration	dehydration	NOUN
ahs-3127	303	2	-	-	PUNCT
ahs-3127	303	3	responsive	responsive	ADJ
ahs-3127	303	4	element	element	NOUN
ahs-3127	303	5	binding	bind	VERB
ahs-3127	303	6	proteins	protein	NOUN
ahs-3127	303	7	(	(	PUNCT
ahs-3127	303	8	drebs	drebs	NOUN
ahs-3127	303	9	)	)	PUNCT
ahs-3127	303	10	are	be	AUX
ahs-3127	303	11	transcription	transcription	NOUN
ahs-3127	303	12	factors	factor	NOUN
ahs-3127	303	13	known	know	VERB
ahs-3127	303	14	to	to	PART
ahs-3127	303	15	activate	activate	VERB
ahs-3127	303	16	the	the	DET
ahs-3127	303	17	expression	expression	NOUN
ahs-3127	303	18	of	of	ADP
ahs-3127	303	19	abiotic	abiotic	ADJ
ahs-3127	303	20	stress	stress	NOUN
ahs-3127	303	21	-	-	PUNCT
ahs-3127	303	22	responsive	responsive	ADJ
ahs-3127	303	23	genes	gene	NOUN
ahs-3127	303	24	in	in	ADP
ahs-3127	303	25	divergent	divergent	ADJ
ahs-3127	303	26	species	specie	NOUN
ahs-3127	303	27	via	via	ADP
ahs-3127	303	28	specific	specific	ADJ
ahs-3127	303	29	binding	binding	NOUN
ahs-3127	303	30	to	to	ADP
ahs-3127	303	31	the	the	DET
ahs-3127	303	32	dehydration	dehydration	NOUN
ahs-3127	303	33	-	-	PUNCT
ahs-3127	303	34	responsive	responsive	ADJ
ahs-3127	303	35	element	element	NOUN
ahs-3127	303	36	/	/	SYM
ahs-3127	303	37	c	c	NOUN
ahs-3127	303	38	-	-	PUNCT
ahs-3127	303	39	repeat	repeat	NOUN
ahs-3127	303	40	(	(	PUNCT
ahs-3127	303	41	dre	dre	NOUN
ahs-3127	303	42	/	/	SYM
ahs-3127	303	43	crt	crt	ADJ
ahs-3127	303	44	)	)	PUNCT
ahs-3127	303	45	cis	cis	NOUN
ahs-3127	303	46	-	-	PUNCT
ahs-3127	303	47	acting	act	VERB
ahs-3127	303	48	element	element	NOUN
ahs-3127	303	49	in	in	ADP
ahs-3127	303	50	promoters	promoter	NOUN
ahs-3127	303	51	of	of	ADP
ahs-3127	303	52	target	target	NOUN
ahs-3127	303	53	genes	gene	NOUN
ahs-3127	303	54	(	(	PUNCT
ahs-3127	303	55	mizoi	mizoi	NOUN
ahs-3127	303	56	et	et	PROPN
ahs-3127	303	57	al	al	PROPN
ahs-3127	303	58	.	.	PROPN
ahs-3127	303	59	,	,	PUNCT
ahs-3127	303	60	2012	2012	NUM
ahs-3127	303	61	)	)	PUNCT
ahs-3127	303	62	.	.	PUNCT
ahs-3127	304	1	in	in	ADP
ahs-3127	304	2	arabidopsis	arabidopsis	NOUN
ahs-3127	304	3	,	,	PUNCT
ahs-3127	304	4	the	the	DET
ahs-3127	304	5	overexpression	overexpression	NOUN
ahs-3127	304	6	of	of	ADP
ahs-3127	304	7	dreb1a	dreb1a	PROPN
ahs-3127	304	8	revealed	reveal	VERB
ahs-3127	304	9	both	both	PRON
ahs-3127	304	10	freezing	freezing	NOUN
ahs-3127	304	11	and	and	CCONJ
ahs-3127	304	12	dehydration	dehydration	NOUN
ahs-3127	304	13	tolerance	tolerance	NOUN
ahs-3127	304	14	in	in	ADP
ahs-3127	304	15	transgenic	transgenic	NOUN
ahs-3127	304	16	plants	plant	NOUN
ahs-3127	304	17	(	(	PUNCT
ahs-3127	304	18	liu	liu	PROPN
ahs-3127	304	19	et	et	PROPN
ahs-3127	304	20	al	al	PROPN
ahs-3127	304	21	.	.	PROPN
ahs-3127	304	22	,	,	PUNCT
ahs-3127	304	23	1998	1998	NUM
ahs-3127	304	24	)	)	PUNCT
ahs-3127	304	25	.	.	PUNCT
ahs-3127	305	1	a	a	DET
ahs-3127	305	2	better	well	ADJ
ahs-3127	305	3	drought	drought	NOUN
ahs-3127	305	4	and	and	CCONJ
ahs-3127	305	5	salt	salt	NOUN
ahs-3127	305	6	tolerance	tolerance	NOUN
ahs-3127	305	7	was	be	AUX
ahs-3127	305	8	observed	observe	VERB
ahs-3127	305	9	in	in	ADP
ahs-3127	305	10	transgenic	transgenic	NOUN
ahs-3127	305	11	wheat	wheat	NOUN
ahs-3127	305	12	plants	plant	NOUN
ahs-3127	305	13	with	with	ADP
ahs-3127	305	14	dreb1	dreb1	PRON
ahs-3127	305	15	from	from	ADP
ahs-3127	305	16	glycine	glycine	NOUN
ahs-3127	305	17	max	max	PROPN
ahs-3127	305	18	(	(	PUNCT
ahs-3127	305	19	shiqing	shiqe	VERB
ahs-3127	305	20	et	et	PROPN
ahs-3127	305	21	al	al	PROPN
ahs-3127	305	22	.	.	PROPN
ahs-3127	305	23	,	,	PUNCT
ahs-3127	305	24	2005	2005	NUM
ahs-3127	305	25	)	)	PUNCT
ahs-3127	305	26	.	.	PUNCT
ahs-3127	306	1	the	the	DET
ahs-3127	306	2	overexpression	overexpression	NOUN
ahs-3127	306	3	of	of	ADP
ahs-3127	306	4	oryza	oryza	PROPN
ahs-3127	306	5	sativa	sativa	NOUN
ahs-3127	306	6	dreb1	dreb1	PROPN
ahs-3127	306	7	in	in	ADP
ahs-3127	306	8	rice	rice	NOUN
ahs-3127	306	9	transgenic	transgenic	NOUN
ahs-3127	306	10	plants	plant	NOUN
ahs-3127	306	11	has	have	AUX
ahs-3127	306	12	also	also	ADV
ahs-3127	306	13	showed	show	VERB
ahs-3127	306	14	improved	improved	ADJ
ahs-3127	306	15	tolerance	tolerance	NOUN
ahs-3127	306	16	to	to	ADP
ahs-3127	306	17	drought	drought	NOUN
ahs-3127	306	18	,	,	PUNCT
ahs-3127	306	19	salt	salt	NOUN
ahs-3127	306	20	and	and	CCONJ
ahs-3127	306	21	low	low	ADJ
ahs-3127	306	22	temperature	temperature	NOUN
ahs-3127	306	23	stresses	stress	NOUN
ahs-3127	306	24	(	(	PUNCT
ahs-3127	306	25	dubouzet	dubouzet	NOUN
ahs-3127	306	26	et	et	PROPN
ahs-3127	306	27	al	al	PROPN
ahs-3127	306	28	.	.	PROPN
ahs-3127	306	29	,	,	PUNCT
ahs-3127	306	30	2003	2003	NUM
ahs-3127	306	31	;	;	PUNCT
ahs-3127	306	32	ito	ito	PROPN
ahs-3127	306	33	et	et	PROPN
ahs-3127	306	34	al	al	PROPN
ahs-3127	306	35	.	.	PROPN
ahs-3127	306	36	,	,	PUNCT
ahs-3127	306	37	2006	2006	NUM
ahs-3127	306	38	)	)	PUNCT
ahs-3127	306	39	.	.	PUNCT
ahs-3127	307	1	a	a	DET
ahs-3127	307	2	group	group	NOUN
ahs-3127	307	3	of	of	ADP
ahs-3127	307	4	researchers	researcher	NOUN
ahs-3127	307	5	found	find	VERB
ahs-3127	307	6	that	that	SCONJ
ahs-3127	307	7	dreb	dreb	VERB
ahs-3127	307	8	1a	1a	NOUN
ahs-3127	307	9	was	be	AUX
ahs-3127	307	10	induced	induce	VERB
ahs-3127	307	11	at	at	ADP
ahs-3127	307	12	a	a	DET
ahs-3127	307	13	high	high	ADJ
ahs-3127	307	14	level	level	NOUN
ahs-3127	307	15	in	in	ADP
ahs-3127	307	16	pistils	pistil	NOUN
ahs-3127	307	17	,	,	PUNCT
ahs-3127	307	18	three	three	NUM
ahs-3127	307	19	days	day	NOUN
ahs-3127	307	20	after	after	ADP
ahs-3127	307	21	drought	drought	NOUN
ahs-3127	307	22	treatment	treatment	NOUN
ahs-3127	307	23	which	which	PRON
ahs-3127	307	24	suggests	suggest	VERB
ahs-3127	307	25	its	its	PRON
ahs-3127	307	26	possible	possible	ADJ
ahs-3127	307	27	role	role	NOUN
ahs-3127	307	28	as	as	ADP
ahs-3127	307	29	an	an	DET
ahs-3127	307	30	early	early	ADJ
ahs-3127	307	31	drought	drought	NOUN
ahs-3127	307	32	response	response	NOUN
ahs-3127	307	33	regulator	regulator	NOUN
ahs-3127	307	34	in	in	ADP
ahs-3127	307	35	the	the	DET
ahs-3127	307	36	arabidopsis	arabidopsis	NOUN
ahs-3127	307	37	flower	flower	NOUN
ahs-3127	307	38	(	(	PUNCT
ahs-3127	307	39	su	su	PROPN
ahs-3127	307	40	et	et	PROPN
ahs-3127	307	41	al	al	PROPN
ahs-3127	307	42	.	.	PROPN
ahs-3127	307	43	,	,	PUNCT
ahs-3127	307	44	2013	2013	NUM
ahs-3127	307	45	)	)	PUNCT
ahs-3127	307	46	.	.	PUNCT
ahs-3127	308	1	our	our	PRON
ahs-3127	308	2	study	study	NOUN
ahs-3127	308	3	adds	add	VERB
ahs-3127	308	4	to	to	ADP
ahs-3127	308	5	such	such	ADJ
ahs-3127	308	6	findings	finding	NOUN
ahs-3127	308	7	and	and	CCONJ
ahs-3127	308	8	points	point	NOUN
ahs-3127	308	9	to	to	PART
ahs-3127	308	10	dreb	dreb	VERB
ahs-3127	308	11	1a	1a	NUM
ahs-3127	308	12	constant	constant	ADJ
ahs-3127	308	13	upregulation	upregulation	NOUN
ahs-3127	308	14	in	in	ADP
ahs-3127	308	15	leaves	leave	NOUN
ahs-3127	308	16	of	of	ADP
ahs-3127	308	17	‘	'	PUNCT
ahs-3127	308	18	deir	deir	PROPN
ahs-3127	308	19	al	al	PROPN
ahs-3127	308	20	-	-	PROPN
ahs-3127	308	21	zour	zour	NOUN
ahs-3127	308	22	22	22	NUM
ahs-3127	308	23	’	'	PUNCT
ahs-3127	308	24	under	under	ADP
ahs-3127	308	25	drought	drought	NOUN
ahs-3127	308	26	stress	stress	NOUN
ahs-3127	308	27	,	,	PUNCT
ahs-3127	308	28	during	during	ADP
ahs-3127	308	29	flowering	flowering	NOUN
ahs-3127	308	30	and	and	CCONJ
ahs-3127	308	31	boll	boll	NOUN
ahs-3127	308	32	maturation	maturation	NOUN
ahs-3127	308	33	.	.	PUNCT
ahs-3127	309	1	our	our	PRON
ahs-3127	309	2	study	study	NOUN
ahs-3127	309	3	has	have	AUX
ahs-3127	309	4	presented	present	VERB
ahs-3127	309	5	the	the	DET
ahs-3127	309	6	responses	response	NOUN
ahs-3127	309	7	of	of	ADP
ahs-3127	309	8	two	two	NUM
ahs-3127	309	9	accredited	accredited	ADJ
ahs-3127	309	10	cotton	cotton	NOUN
ahs-3127	309	11	cultivars	cultivar	NOUN
ahs-3127	309	12	,	,	PUNCT
ahs-3127	309	13	aleppo	aleppo	PROPN
ahs-3127	309	14	118	118	NUM
ahs-3127	309	15	and	and	CCONJ
ahs-3127	309	16	deir	deir	PROPN
ahs-3127	309	17	alzour	alzour	PROPN
ahs-3127	309	18	22	22	NUM
ahs-3127	309	19	which	which	PRON
ahs-3127	309	20	have	have	AUX
ahs-3127	309	21	shown	show	VERB
ahs-3127	309	22	different	different	ADJ
ahs-3127	309	23	behavior	behavior	NOUN
ahs-3127	309	24	under	under	ADP
ahs-3127	309	25	water	water	NOUN
ahs-3127	309	26	shortage	shortage	NOUN
ahs-3127	309	27	.	.	PUNCT
ahs-3127	310	1	both	both	DET
ahs-3127	310	2	cultivars	cultivar	NOUN
ahs-3127	310	3	have	have	AUX
ahs-3127	310	4	shown	show	VERB
ahs-3127	310	5	early	early	ADJ
ahs-3127	310	6	flowering	flowering	NOUN
ahs-3127	310	7	.	.	PUNCT
ahs-3127	311	1	however	however	ADV
ahs-3127	311	2	,	,	PUNCT
ahs-3127	311	3	a	a	DET
ahs-3127	311	4	larger	large	ADJ
ahs-3127	311	5	percentage	percentage	NOUN
ahs-3127	311	6	of	of	ADP
ahs-3127	311	7	treated	treat	VERB
ahs-3127	311	8	‘	'	PUNCT
ahs-3127	311	9	aleppo	aleppo	PROPN
ahs-3127	311	10	118	118	NUM
ahs-3127	311	11	’	'	PUNCT
ahs-3127	311	12	plants	plant	NOUN
ahs-3127	311	13	kept	keep	VERB
ahs-3127	311	14	flowering	flower	VERB
ahs-3127	311	15	towards	towards	ADP
ahs-3127	311	16	end	end	NOUN
ahs-3127	311	17	of	of	ADP
ahs-3127	311	18	season	season	NOUN
ahs-3127	311	19	compared	compare	VERB
ahs-3127	311	20	to	to	AUX
ahs-3127	311	21	treated	treat	VERB
ahs-3127	311	22	‘	'	PUNCT
ahs-3127	311	23	deir	deir	PROPN
ahs-3127	311	24	al	al	PROPN
ahs-3127	311	25	-	-	PROPN
ahs-3127	311	26	zour	zour	ADJ
ahs-3127	311	27	22	22	NUM
ahs-3127	311	28	’	'	PUNCT
ahs-3127	311	29	plants	plant	NOUN
ahs-3127	311	30	.	.	PUNCT
ahs-3127	312	1	this	this	PRON
ahs-3127	312	2	may	may	AUX
ahs-3127	312	3	indicate	indicate	VERB
ahs-3127	312	4	a	a	DET
ahs-3127	312	5	potential	potential	ADJ
ahs-3127	312	6	survival	survival	NOUN
ahs-3127	312	7	mechanism	mechanism	NOUN
ahs-3127	312	8	and	and	CCONJ
ahs-3127	312	9	fruiting	fruit	VERB
ahs-3127	312	10	cycle	cycle	NOUN
ahs-3127	312	11	extension	extension	NOUN
ahs-3127	312	12	in	in	ADP
ahs-3127	312	13	aleppo	aleppo	PROPN
ahs-3127	312	14	118	118	NUM
ahs-3127	312	15	cultivar	cultivar	NOUN
ahs-3127	312	16	under	under	ADP
ahs-3127	312	17	water	water	NOUN
ahs-3127	312	18	deficit	deficit	NOUN
ahs-3127	312	19	regime	regime	NOUN
ahs-3127	312	20	,	,	PUNCT
ahs-3127	312	21	compared	compare	VERB
ahs-3127	312	22	to	to	ADP
ahs-3127	312	23	the	the	DET
ahs-3127	312	24	cultivar	cultivar	NOUN
ahs-3127	312	25	deir	deir	PROPN
ahs-3127	312	26	al	al	PROPN
ahs-3127	312	27	-	-	PROPN
ahs-3127	312	28	zour	zour	PROPN
ahs-3127	312	29	22	22	NUM
ahs-3127	312	30	.	.	PUNCT
ahs-3127	313	1	aleppo	aleppo	PROPN
ahs-3127	313	2	118	118	NUM
ahs-3127	313	3	cultivar	cultivar	NOUN
ahs-3127	313	4	displayed	display	VERB
ahs-3127	313	5	more	more	ADV
ahs-3127	313	6	consistent	consistent	ADJ
ahs-3127	313	7	fiber	fiber	NOUN
ahs-3127	313	8	quality	quality	NOUN
ahs-3127	313	9	between	between	ADP
ahs-3127	313	10	control	control	NOUN
ahs-3127	313	11	and	and	CCONJ
ahs-3127	313	12	treated	treat	VERB
ahs-3127	313	13	plants	plant	NOUN
ahs-3127	313	14	,	,	PUNCT
ahs-3127	313	15	while	while	SCONJ
ahs-3127	313	16	‘	'	PUNCT
ahs-3127	313	17	deir	deir	PROPN
ahs-3127	313	18	al	al	PROPN
ahs-3127	313	19	-	-	PROPN
ahs-3127	313	20	zour	zour	NOUN
ahs-3127	313	21	22	22	NUM
ahs-3127	313	22	’	'	PUNCT
ahs-3127	313	23	showed	show	VERB
ahs-3127	313	24	variation	variation	NOUN
ahs-3127	313	25	in	in	ADP
ahs-3127	313	26	fiber	fiber	NOUN
ahs-3127	313	27	length	length	NOUN
ahs-3127	313	28	and	and	CCONJ
ahs-3127	313	29	strength	strength	NOUN
ahs-3127	313	30	between	between	ADP
ahs-3127	313	31	control	control	NOUN
ahs-3127	313	32	and	and	CCONJ
ahs-3127	313	33	treated	treat	VERB
ahs-3127	313	34	plants	plant	NOUN
ahs-3127	313	35	.	.	PUNCT
ahs-3127	314	1	both	both	DET
ahs-3127	314	2	cultivars	cultivar	NOUN
ahs-3127	314	3	kept	keep	VERB
ahs-3127	314	4	consistent	consistent	ADJ
ahs-3127	314	5	micronaire	micronaire	NOUN
ahs-3127	314	6	and	and	CCONJ
ahs-3127	314	7	cohesion	cohesion	NOUN
ahs-3127	314	8	under	under	ADP
ahs-3127	314	9	normal	normal	ADJ
ahs-3127	314	10	and	and	CCONJ
ahs-3127	314	11	water	water	NOUN
ahs-3127	314	12	deficit	deficit	NOUN
ahs-3127	314	13	conditions	condition	NOUN
ahs-3127	314	14	.	.	PUNCT
ahs-3127	315	1	two	two	NUM
ahs-3127	315	2	critical	critical	ADJ
ahs-3127	315	3	stages	stage	NOUN
ahs-3127	315	4	in	in	ADP
ahs-3127	315	5	cotton	cotton	NOUN
ahs-3127	315	6	life	life	NOUN
ahs-3127	315	7	cycle	cycle	NOUN
ahs-3127	315	8	,	,	PUNCT
ahs-3127	315	9	flowering	flowering	NOUN
ahs-3127	315	10	and	and	CCONJ
ahs-3127	315	11	boll	boll	NOUN
ahs-3127	315	12	development	development	NOUN
ahs-3127	315	13	,	,	PUNCT
ahs-3127	315	14	were	be	AUX
ahs-3127	315	15	screened	screen	VERB
ahs-3127	315	16	for	for	ADP
ahs-3127	315	17	hspcb	hspcb	NOUN
ahs-3127	315	18	,	,	PUNCT
ahs-3127	315	19	tps	tps	NOUN
ahs-3127	315	20	and	and	CCONJ
ahs-3127	315	21	dreb	dreb	VERB
ahs-3127	315	22	1a	1a	NUM
ahs-3127	315	23	gene	gene	NOUN
ahs-3127	315	24	activity	activity	NOUN
ahs-3127	315	25	using	use	VERB
ahs-3127	315	26	leaf	leaf	NOUN
ahs-3127	315	27	material	material	NOUN
ahs-3127	315	28	.	.	PUNCT
ahs-3127	316	1	results	result	NOUN
ahs-3127	316	2	have	have	AUX
ahs-3127	316	3	demonstrated	demonstrate	VERB
ahs-3127	316	4	an	an	DET
ahs-3127	316	5	increase	increase	NOUN
ahs-3127	316	6	in	in	ADP
ahs-3127	316	7	fold	fold	ADJ
ahs-3127	316	8	expression	expression	NOUN
ahs-3127	316	9	of	of	ADP
ahs-3127	316	10	these	these	DET
ahs-3127	316	11	genes	gene	NOUN
ahs-3127	316	12	in	in	ADP
ahs-3127	316	13	the	the	DET
ahs-3127	316	14	flowering	flower	VERB
ahs-3127	316	15	stage	stage	NOUN
ahs-3127	316	16	of	of	ADP
ahs-3127	316	17	treated	treat	VERB
ahs-3127	316	18	plants	plant	NOUN
ahs-3127	316	19	compared	compare	VERB
ahs-3127	316	20	to	to	ADP
ahs-3127	316	21	the	the	DET
ahs-3127	316	22	controls	control	NOUN
ahs-3127	316	23	.	.	PUNCT
ahs-3127	317	1	a	a	DET
ahs-3127	317	2	large	large	ADJ
ahs-3127	317	3	regression	regression	NOUN
ahs-3127	317	4	in	in	ADP
ahs-3127	317	5	genes	gene	NOUN
ahs-3127	317	6	activity	activity	NOUN
ahs-3127	317	7	was	be	AUX
ahs-3127	317	8	noticed	notice	VERB
ahs-3127	317	9	during	during	ADP
ahs-3127	317	10	boll	boll	NOUN
ahs-3127	317	11	development	development	NOUN
ahs-3127	317	12	except	except	SCONJ
ahs-3127	317	13	for	for	ADP
ahs-3127	317	14	dreb1a	dreb1a	ADJ
ahs-3127	317	15	gene	gene	NOUN
ahs-3127	317	16	in	in	ADP
ahs-3127	317	17	treated	treat	VERB
ahs-3127	317	18	‘	'	PUNCT
ahs-3127	317	19	deir	deir	PROPN
ahs-3127	317	20	al	al	PROPN
ahs-3127	317	21	-	-	PROPN
ahs-3127	317	22	zour	zour	ADJ
ahs-3127	317	23	22	22	NUM
ahs-3127	317	24	’	'	PUNCT
ahs-3127	317	25	plants	plant	NOUN
ahs-3127	317	26	.	.	PUNCT
ahs-3127	318	1	dreb1a	dreb1a	NOUN
ahs-3127	318	2	gene	gene	NOUN
ahs-3127	318	3	showed	show	VERB
ahs-3127	318	4	continuous	continuous	ADJ
ahs-3127	318	5	activation	activation	NOUN
ahs-3127	318	6	in	in	ADP
ahs-3127	318	7	the	the	DET
ahs-3127	318	8	two	two	NUM
ahs-3127	318	9	stages	stage	NOUN
ahs-3127	318	10	and	and	CCONJ
ahs-3127	318	11	can	can	AUX
ahs-3127	318	12	be	be	AUX
ahs-3127	318	13	considered	consider	VERB
ahs-3127	318	14	a	a	DET
ahs-3127	318	15	candidate	candidate	NOUN
ahs-3127	318	16	gene	gene	NOUN
ahs-3127	318	17	to	to	PART
ahs-3127	318	18	support	support	VERB
ahs-3127	318	19	water	water	NOUN
ahs-3127	318	20	deficit	deficit	NOUN
ahs-3127	318	21	stress	stress	NOUN
ahs-3127	318	22	tolerance	tolerance	NOUN
ahs-3127	318	23	mechanism	mechanism	NOUN
ahs-3127	318	24	in	in	ADP
ahs-3127	318	25	this	this	DET
ahs-3127	318	26	cultivar	cultivar	NOUN
ahs-3127	318	27	.	.	PUNCT
ahs-3127	319	1	the	the	DET
ahs-3127	319	2	question	question	NOUN
ahs-3127	319	3	of	of	ADP
ahs-3127	319	4	which	which	DET
ahs-3127	319	5	cultivar	cultivar	NOUN
ahs-3127	319	6	is	be	AUX
ahs-3127	319	7	more	more	ADV
ahs-3127	319	8	droughttolerant	droughttolerant	ADJ
ahs-3127	319	9	than	than	ADP
ahs-3127	319	10	the	the	DET
ahs-3127	319	11	other	other	ADJ
ahs-3127	319	12	is	be	AUX
ahs-3127	319	13	to	to	PART
ahs-3127	319	14	be	be	AUX
ahs-3127	319	15	deeply	deeply	ADV
ahs-3127	319	16	investigated	investigate	VERB
ahs-3127	319	17	in	in	ADP
ahs-3127	319	18	both	both	DET
ahs-3127	319	19	cultivars	cultivar	NOUN
ahs-3127	319	20	,	,	PUNCT
ahs-3127	319	21	since	since	SCONJ
ahs-3127	319	22	each	each	DET
ahs-3127	319	23	cultivar	cultivar	NOUN
ahs-3127	319	24	has	have	AUX
ahs-3127	319	25	shown	show	VERB
ahs-3127	319	26	different	different	ADJ
ahs-3127	319	27	approach	approach	NOUN
ahs-3127	319	28	towards	towards	ADP
ahs-3127	319	29	water	water	NOUN
ahs-3127	319	30	-	-	PUNCT
ahs-3127	319	31	shortage	shortage	NOUN
ahs-3127	319	32	stress	stress	NOUN
ahs-3127	319	33	tolerance	tolerance	NOUN
ahs-3127	319	34	.	.	PUNCT
ahs-3127	320	1	acknowledgements	acknowledgement	NOUN
ahs-3127	320	2	the	the	DET
ahs-3127	320	3	authors	author	NOUN
ahs-3127	320	4	would	would	AUX
ahs-3127	320	5	like	like	VERB
ahs-3127	320	6	to	to	PART
ahs-3127	320	7	thank	thank	VERB
ahs-3127	320	8	the	the	DET
ahs-3127	320	9	director	director	NOUN
ahs-3127	320	10	general	general	ADJ
ahs-3127	320	11	of	of	ADP
ahs-3127	320	12	aecs	aec	NOUN
ahs-3127	320	13	and	and	CCONJ
ahs-3127	320	14	the	the	DET
ahs-3127	320	15	head	head	NOUN
ahs-3127	320	16	of	of	ADP
ahs-3127	320	17	molecular	molecular	ADJ
ahs-3127	320	18	biology	biology	NOUN
ahs-3127	320	19	and	and	CCONJ
ahs-3127	320	20	biotechnology	biotechnology	NOUN
ahs-3127	320	21	department	department	NOUN
ahs-3127	320	22	for	for	ADP
ahs-3127	320	23	their	their	PRON
ahs-3127	320	24	support	support	NOUN
ahs-3127	320	25	.	.	PUNCT
ahs-3127	321	1	the	the	DET
ahs-3127	321	2	adv	adv	PROPN
ahs-3127	321	3	.	.	PUNCT
ahs-3127	321	4	hort	hort	PROPN
ahs-3127	321	5	.	.	PUNCT
ahs-3127	322	1	sci	sci	PROPN
ahs-3127	322	2	.	.	PROPN
ahs-3127	322	3	,	,	PUNCT
ahs-3127	322	4	2018	2018	NUM
ahs-3127	322	5	32(1	32(1	NUM
ahs-3127	322	6	):	):	PUNCT
ahs-3127	322	7	79	79	NUM
ahs-3127	322	8	-	-	SYM
ahs-3127	322	9	92	92	NUM
ahs-3127	322	10	90	90	NUM
ahs-3127	322	11	authors	author	NOUN
ahs-3127	322	12	would	would	AUX
ahs-3127	322	13	like	like	VERB
ahs-3127	322	14	to	to	PART
ahs-3127	322	15	extend	extend	VERB
ahs-3127	322	16	their	their	PRON
ahs-3127	322	17	thanks	thank	NOUN
ahs-3127	322	18	to	to	ADP
ahs-3127	322	19	mrs	mrs	PROPN
ahs-3127	322	20	.	.	PROPN
ahs-3127	322	21	intissar	intissar	PROPN
ahs-3127	322	22	kara	kara	PROPN
ahs-3127	322	23	joli	joli	PROPN
ahs-3127	322	24	for	for	ADP
ahs-3127	322	25	lab	lab	NOUN
ahs-3127	322	26	assistance	assistance	NOUN
ahs-3127	322	27	,	,	PUNCT
ahs-3127	322	28	dr	dr	PROPN
ahs-3127	322	29	.	.	PROPN
ahs-3127	322	30	moufak	moufak	PROPN
ahs-3127	322	31	roukaya	roukaya	PROPN
ahs-3127	322	32	for	for	ADP
ahs-3127	322	33	xrd	xrd	NOUN
ahs-3127	322	34	analysis	analysis	NOUN
ahs-3127	322	35	,	,	PUNCT
ahs-3127	322	36	the	the	DET
ahs-3127	322	37	physics	physics	PROPN
ahs-3127	322	38	department	department	PROPN
ahs-3127	322	39	for	for	ADP
ahs-3127	322	40	sem	sem	PROPN
ahs-3127	322	41	imaging	imaging	NOUN
ahs-3127	322	42	and	and	CCONJ
ahs-3127	322	43	the	the	DET
ahs-3127	322	44	agrarian	agrarian	ADJ
ahs-3127	322	45	office	office	NOUN
ahs-3127	322	46	at	at	ADP
ahs-3127	322	47	the	the	DET
ahs-3127	322	48	aecs	aec	NOUN
ahs-3127	322	49	for	for	ADP
ahs-3127	322	50	land	land	NOUN
ahs-3127	322	51	and	and	CCONJ
ahs-3127	322	52	drip	drip	VERB
ahs-3127	322	53	irrigation	irrigation	NOUN
ahs-3127	322	54	preparation	preparation	NOUN
ahs-3127	322	55	.	.	PUNCT
ahs-3127	323	1	references	reference	NOUN
ahs-3127	323	2	abidi	abidi	PROPN
ahs-3127	323	3	n.	n.	PROPN
ahs-3127	323	4	,	,	PUNCT
ahs-3127	323	5	cabrales	cabrales	PROPN
ahs-3127	323	6	l.	l.	PROPN
ahs-3127	323	7	,	,	PUNCT
ahs-3127	323	8	haigler	haigler	NOUN
ahs-3127	323	9	c.h	c.h	PROPN
ahs-3127	323	10	.	.	PROPN
ahs-3127	323	11	,	,	PUNCT
ahs-3127	323	12	2014	2014	NUM
ahs-3127	323	13	changes	change	NOUN
ahs-3127	323	14	in	in	ADP
ahs-3127	323	15	the	the	DET
ahs-3127	323	16	cell	cell	NOUN
ahs-3127	323	17	wall	wall	NOUN
ahs-3127	323	18	and	and	CCONJ
ahs-3127	323	19	cellulose	cellulose	NOUN
ahs-3127	323	20	content	content	NOUN
ahs-3127	323	21	of	of	ADP
ahs-3127	323	22	developing	develop	VERB
ahs-3127	323	23	cotton	cotton	NOUN
ahs-3127	323	24	fibers	fiber	NOUN
ahs-3127	323	25	investigated	investigate	VERB
ahs-3127	323	26	by	by	ADP
ahs-3127	323	27	ftir	ftir	PROPN
ahs-3127	323	28	spectroscopy	spectroscopy	PROPN
ahs-3127	323	29	.	.	PUNCT
ahs-3127	324	1	carbohydr	carbohydr	NOUN
ahs-3127	324	2	.	.	PUNCT
ahs-3127	325	1	polym	polym	NOUN
ahs-3127	325	2	.	.	PUNCT
ahs-3127	325	3	,	,	PUNCT
ahs-3127	325	4	100(0	100(0	NUM
ahs-3127	325	5	):	):	PUNCT
ahs-3127	325	6	9	9	NUM
ahs-3127	325	7	-	-	SYM
ahs-3127	325	8	16	16	NUM
ahs-3127	325	9	.	.	PUNCT
ahs-3127	326	1	artico	artico	PROPN
ahs-3127	326	2	s.	s.	PROPN
ahs-3127	326	3	,	,	PUNCT
ahs-3127	326	4	nardeli	nardeli	PROPN
ahs-3127	326	5	s.m	s.m	PROPN
ahs-3127	326	6	.	.	PROPN
ahs-3127	326	7	,	,	PUNCT
ahs-3127	326	8	brilhante	brilhante	PROPN
ahs-3127	326	9	o.	o.	PROPN
ahs-3127	326	10	,	,	PUNCT
ahs-3127	326	11	grossi	grossi	ADJ
ahs-3127	326	12	-	-	PUNCT
ahs-3127	326	13	de	de	X
ahs-3127	326	14	-	-	PROPN
ahs-3127	326	15	sa	sa	PROPN
ahs-3127	326	16	m.f	m.f	PROPN
ahs-3127	326	17	.	.	PROPN
ahs-3127	326	18	,	,	PUNCT
ahs-3127	326	19	alves	alves	PROPN
ahs-3127	326	20	-	-	PUNCT
ahs-3127	326	21	ferreira	ferreira	PROPN
ahs-3127	326	22	m.	m.	PROPN
ahs-3127	326	23	,	,	PUNCT
ahs-3127	326	24	2010	2010	NUM
ahs-3127	326	25	identification	identification	NOUN
ahs-3127	326	26	and	and	CCONJ
ahs-3127	326	27	evaluation	evaluation	NOUN
ahs-3127	326	28	of	of	ADP
ahs-3127	326	29	new	new	ADJ
ahs-3127	326	30	reference	reference	NOUN
ahs-3127	326	31	genes	gene	NOUN
ahs-3127	326	32	in	in	ADP
ahs-3127	326	33	gossypium	gossypium	NOUN
ahs-3127	326	34	hirsutum	hirsutum	NOUN
ahs-3127	326	35	for	for	ADP
ahs-3127	326	36	accurate	accurate	ADJ
ahs-3127	326	37	normalization	normalization	NOUN
ahs-3127	326	38	of	of	ADP
ahs-3127	326	39	real	real	ADJ
ahs-3127	326	40	-	-	PUNCT
ahs-3127	326	41	time	time	NOUN
ahs-3127	326	42	quantitative	quantitative	ADJ
ahs-3127	326	43	rt	rt	ADJ
ahs-3127	326	44	-	-	PUNCT
ahs-3127	326	45	pcr	pcr	ADJ
ahs-3127	326	46	data	datum	NOUN
ahs-3127	326	47	.	.	PUNCT
ahs-3127	327	1	bmc	bmc	ADJ
ahs-3127	327	2	plant	plant	NOUN
ahs-3127	327	3	biol	biol	PROPN
ahs-3127	327	4	.	.	PUNCT
ahs-3127	328	1	,	,	PUNCT
ahs-3127	328	2	10	10	NUM
ahs-3127	328	3	:	:	SYM
ahs-3127	328	4	49	49	NUM
ahs-3127	328	5	.	.	PUNCT
ahs-3127	329	1	bowman	bowman	PROPN
ahs-3127	329	2	m.j	m.j	PROPN
ahs-3127	329	3	.	.	PROPN
ahs-3127	329	4	,	,	PUNCT
ahs-3127	329	5	park	park	PROPN
ahs-3127	329	6	w.	w.	PROPN
ahs-3127	329	7	,	,	PUNCT
ahs-3127	329	8	bauer	bauer	PROPN
ahs-3127	329	9	p.j	p.j	PROPN
ahs-3127	329	10	.	.	PROPN
ahs-3127	329	11	,	,	PUNCT
ahs-3127	329	12	udall	udall	PROPN
ahs-3127	329	13	j.a	j.a	PROPN
ahs-3127	329	14	.	.	PROPN
ahs-3127	329	15	,	,	PUNCT
ahs-3127	329	16	page	page	NOUN
ahs-3127	329	17	j.t	j.t	PROPN
ahs-3127	329	18	.	.	PROPN
ahs-3127	329	19	,	,	PUNCT
ahs-3127	329	20	raney	raney	PROPN
ahs-3127	329	21	j.	j.	PROPN
ahs-3127	329	22	,	,	PUNCT
ahs-3127	329	23	scheffler	scheffler	PROPN
ahs-3127	329	24	b.e	b.e	PROPN
ahs-3127	329	25	.	.	PROPN
ahs-3127	329	26	,	,	PUNCT
ahs-3127	329	27	jones	jones	PROPN
ahs-3127	329	28	d.c	d.c	PROPN
ahs-3127	329	29	.	.	PROPN
ahs-3127	329	30	,	,	PUNCT
ahs-3127	329	31	campbell	campbell	PROPN
ahs-3127	329	32	b.t	b.t	PROPN
ahs-3127	329	33	.	.	PROPN
ahs-3127	329	34	,	,	PUNCT
ahs-3127	329	35	2013	2013	NUM
ahs-3127	329	36	rna	rna	NOUN
ahs-3127	329	37	-	-	PUNCT
ahs-3127	329	38	seq	seq	NOUN
ahs-3127	329	39	transcriptome	transcriptome	NOUN
ahs-3127	329	40	profiling	profiling	NOUN
ahs-3127	329	41	of	of	ADP
ahs-3127	329	42	upland	upland	NOUN
ahs-3127	329	43	cotton	cotton	NOUN
ahs-3127	329	44	(	(	PUNCT
ahs-3127	329	45	gossypium	gossypium	NOUN
ahs-3127	329	46	hirsutum	hirsutum	PROPN
ahs-3127	329	47	l.	l.	PROPN
ahs-3127	329	48	)	)	PUNCT
ahs-3127	329	49	root	root	NOUN
ahs-3127	329	50	tissue	tissue	NOUN
ahs-3127	329	51	under	under	ADP
ahs-3127	329	52	water	water	NOUN
ahs-3127	329	53	-	-	PUNCT
ahs-3127	329	54	deficit	deficit	NOUN
ahs-3127	329	55	stress	stress	NOUN
ahs-3127	329	56	.	.	PUNCT
ahs-3127	330	1	plos	plos	PROPN
ahs-3127	330	2	one	one	NUM
ahs-3127	330	3	,	,	PUNCT
ahs-3127	330	4	8	8	NUM
ahs-3127	330	5	(	(	PUNCT
ahs-3127	330	6	12	12	NUM
ahs-3127	330	7	):	):	PUNCT
ahs-3127	330	8	e82634	e82634	PROPN
ahs-3127	330	9	.	.	PUNCT
ahs-3127	331	1	cha	cha	PROPN
ahs-3127	331	2	-	-	PUNCT
ahs-3127	331	3	um	um	INTJ
ahs-3127	331	4	s.	s.	PROPN
ahs-3127	331	5	,	,	PUNCT
ahs-3127	331	6	supaibulwatana	supaibulwatana	PROPN
ahs-3127	331	7	k.	k.	PROPN
ahs-3127	331	8	,	,	PUNCT
ahs-3127	331	9	kirdmanee	kirdmanee	PROPN
ahs-3127	331	10	c.	c.	PROPN
ahs-3127	331	11	,	,	PUNCT
ahs-3127	331	12	2006	2006	NUM
ahs-3127	331	13	water	water	NOUN
ahs-3127	331	14	relation	relation	NOUN
ahs-3127	331	15	,	,	PUNCT
ahs-3127	331	16	photosynthetic	photosynthetic	ADJ
ahs-3127	331	17	ability	ability	NOUN
ahs-3127	331	18	and	and	CCONJ
ahs-3127	331	19	growth	growth	NOUN
ahs-3127	331	20	of	of	ADP
ahs-3127	331	21	thai	thai	ADJ
ahs-3127	331	22	jasmine	jasmine	PROPN
ahs-3127	331	23	rice	rice	PROPN
ahs-3127	331	24	(	(	PUNCT
ahs-3127	331	25	oryza	oryza	PROPN
ahs-3127	331	26	sativa	sativa	PROPN
ahs-3127	331	27	l.	l.	PROPN
ahs-3127	331	28	ssp	ssp	PROPN
ahs-3127	331	29	.	.	PUNCT
ahs-3127	332	1	indica	indica	PROPN
ahs-3127	332	2	cv	cv	PROPN
ahs-3127	332	3	.	.	PROPN
ahs-3127	332	4	kdml	kdml	PROPN
ahs-3127	332	5	105	105	NUM
ahs-3127	332	6	)	)	PUNCT
ahs-3127	332	7	to	to	PART
ahs-3127	332	8	salt	salt	VERB
ahs-3127	332	9	stress	stress	NOUN
ahs-3127	332	10	by	by	ADP
ahs-3127	332	11	application	application	NOUN
ahs-3127	332	12	of	of	ADP
ahs-3127	332	13	exogenous	exogenous	ADJ
ahs-3127	332	14	glycinebetaine	glycinebetaine	NOUN
ahs-3127	332	15	and	and	CCONJ
ahs-3127	332	16	choline	choline	NOUN
ahs-3127	332	17	.	.	PUNCT
ahs-3127	333	1	j.	j.	PROPN
ahs-3127	333	2	agro	agro	PROPN
ahs-3127	333	3	.	.	PUNCT
ahs-3127	334	1	crop	crop	PROPN
ahs-3127	334	2	sci	sci	PROPN
ahs-3127	334	3	.	.	PROPN
ahs-3127	334	4	,	,	PUNCT
ahs-3127	334	5	192(1	192(1	NUM
ahs-3127	334	6	):	):	PUNCT
ahs-3127	334	7	25	25	NUM
ahs-3127	334	8	-	-	SYM
ahs-3127	334	9	36	36	NUM
ahs-3127	334	10	.	.	PUNCT
ahs-3127	335	1	chavez	chavez	PROPN
ahs-3127	335	2	m.m	m.m	PROPN
ahs-3127	335	3	.	.	PROPN
ahs-3127	335	4	,	,	PUNCT
ahs-3127	335	5	pereira	pereira	PROPN
ahs-3127	335	6	j.s	j.s	PROPN
ahs-3127	335	7	.	.	PROPN
ahs-3127	335	8	,	,	PUNCT
ahs-3127	335	9	maroco	maroco	PROPN
ahs-3127	335	10	j.	j.	PROPN
ahs-3127	335	11	,	,	PUNCT
ahs-3127	335	12	rodrigues	rodrigues	PROPN
ahs-3127	335	13	m.l	m.l	PROPN
ahs-3127	335	14	.	.	PROPN
ahs-3127	335	15	,	,	PUNCT
ahs-3127	336	1	ricardo	ricardo	PROPN
ahs-3127	336	2	c.p.p	c.p.p	PROPN
ahs-3127	336	3	.	.	PROPN
ahs-3127	336	4	,	,	PUNCT
ahs-3127	336	5	osorio	osorio	PROPN
ahs-3127	336	6	m.l	m.l	PROPN
ahs-3127	336	7	.	.	PROPN
ahs-3127	336	8	,	,	PUNCT
ahs-3127	336	9	carvalho	carvalho	PROPN
ahs-3127	336	10	i.	i.	PROPN
ahs-3127	336	11	,	,	PUNCT
ahs-3127	336	12	faria	faria	PROPN
ahs-3127	336	13	t.	t.	PROPN
ahs-3127	336	14	,	,	PUNCT
ahs-3127	336	15	pinheiro	pinheiro	PROPN
ahs-3127	336	16	c.	c.	PROPN
ahs-3127	336	17	,	,	PUNCT
ahs-3127	336	18	2002	2002	NUM
ahs-3127	336	19	how	how	SCONJ
ahs-3127	336	20	plants	plant	NOUN
ahs-3127	336	21	cope	cope	VERB
ahs-3127	336	22	with	with	ADP
ahs-3127	336	23	water	water	NOUN
ahs-3127	336	24	stress	stress	NOUN
ahs-3127	336	25	.	.	PUNCT
ahs-3127	337	1	photosynthesis	photosynthesis	NOUN
ahs-3127	337	2	and	and	CCONJ
ahs-3127	337	3	growth	growth	NOUN
ahs-3127	337	4	.	.	PUNCT
ahs-3127	338	1	ann	ann	PROPN
ahs-3127	338	2	.	.	PUNCT
ahs-3127	338	3	bot	bot	PROPN
ahs-3127	338	4	.	.	PUNCT
ahs-3127	338	5	,	,	PUNCT
ahs-3127	338	6	89	89	NUM
ahs-3127	338	7	:	:	PUNCT
ahs-3127	338	8	907	907	NUM
ahs-3127	338	9	-	-	SYM
ahs-3127	338	10	916	916	NUM
ahs-3127	338	11	.	.	PUNCT
ahs-3127	339	1	dacosta	dacosta	PROPN
ahs-3127	339	2	m.	m.	PROPN
ahs-3127	339	3	,	,	PUNCT
ahs-3127	339	4	huang	huang	PROPN
ahs-3127	339	5	b.	b.	PROPN
ahs-3127	339	6	,	,	PUNCT
ahs-3127	339	7	2006	2006	NUM
ahs-3127	339	8	osmotic	osmotic	ADJ
ahs-3127	339	9	adjustment	adjustment	NOUN
ahs-3127	339	10	associated	associate	VERB
ahs-3127	339	11	with	with	ADP
ahs-3127	339	12	variation	variation	NOUN
ahs-3127	339	13	in	in	ADP
ahs-3127	339	14	bentgrass	bentgrass	NOUN
ahs-3127	339	15	tolerance	tolerance	NOUN
ahs-3127	339	16	to	to	ADP
ahs-3127	339	17	drought	drought	NOUN
ahs-3127	339	18	stress	stress	NOUN
ahs-3127	339	19	.	.	PUNCT
ahs-3127	340	1	j.	j.	PROPN
ahs-3127	340	2	amer	amer	PROPN
ahs-3127	340	3	.	.	PUNCT
ahs-3127	340	4	soc	soc	PROPN
ahs-3127	340	5	.	.	PUNCT
ahs-3127	341	1	hort	hort	PROPN
ahs-3127	341	2	.	.	PUNCT
ahs-3127	342	1	sci	sci	PROPN
ahs-3127	342	2	.	.	PROPN
ahs-3127	342	3	,	,	PUNCT
ahs-3127	342	4	131	131	NUM
ahs-3127	342	5	(	(	PUNCT
ahs-3127	342	6	3	3	NUM
ahs-3127	342	7	):	):	PUNCT
ahs-3127	342	8	338	338	NUM
ahs-3127	342	9	-	-	SYM
ahs-3127	342	10	344	344	NUM
ahs-3127	342	11	.	.	PUNCT
ahs-3127	343	1	dağdelen	dağdelen	PROPN
ahs-3127	343	2	n.	n.	PROPN
ahs-3127	343	3	,	,	PUNCT
ahs-3127	343	4	başal	başal	PROPN
ahs-3127	343	5	h.	h.	PROPN
ahs-3127	343	6	,	,	PUNCT
ahs-3127	343	7	yılmaz	yılmaz	PROPN
ahs-3127	343	8	e.	e.	PROPN
ahs-3127	343	9	,	,	PUNCT
ahs-3127	343	10	gürbüz	gürbüz	PROPN
ahs-3127	343	11	t.	t.	PROPN
ahs-3127	343	12	,	,	PUNCT
ahs-3127	343	13	akçay	akçay	PROPN
ahs-3127	343	14	s.	s.	PROPN
ahs-3127	343	15	,	,	PUNCT
ahs-3127	343	16	2009	2009	NUM
ahs-3127	343	17	different	different	ADJ
ahs-3127	343	18	drip	drip	NOUN
ahs-3127	343	19	irrigation	irrigation	NOUN
ahs-3127	343	20	regimes	regime	NOUN
ahs-3127	343	21	affect	affect	VERB
ahs-3127	343	22	cotton	cotton	NOUN
ahs-3127	343	23	yield	yield	NOUN
ahs-3127	343	24	,	,	PUNCT
ahs-3127	343	25	water	water	NOUN
ahs-3127	343	26	use	use	NOUN
ahs-3127	343	27	efficiency	efficiency	NOUN
ahs-3127	343	28	and	and	CCONJ
ahs-3127	343	29	fiber	fiber	NOUN
ahs-3127	343	30	quality	quality	NOUN
ahs-3127	343	31	in	in	ADP
ahs-3127	343	32	western	western	ADJ
ahs-3127	343	33	turkey	turkey	NOUN
ahs-3127	343	34	.	.	PUNCT
ahs-3127	344	1	agric	agric	PROPN
ahs-3127	344	2	.	.	PUNCT
ahs-3127	345	1	water	water	NOUN
ahs-3127	345	2	manage	manage	NOUN
ahs-3127	345	3	.	.	PUNCT
ahs-3127	345	4	,	,	PUNCT
ahs-3127	345	5	96(1	96(1	NUM
ahs-3127	345	6	):	):	PUNCT
ahs-3127	345	7	111	111	NUM
ahs-3127	345	8	-	-	SYM
ahs-3127	345	9	120	120	NUM
ahs-3127	345	10	.	.	PUNCT
ahs-3127	346	1	davidonis	davidonis	PROPN
ahs-3127	346	2	g.h	g.h	PROPN
ahs-3127	346	3	.	.	PROPN
ahs-3127	346	4	,	,	PUNCT
ahs-3127	346	5	johnson	johnson	PROPN
ahs-3127	346	6	a.s	a.s	PROPN
ahs-3127	346	7	.	.	PROPN
ahs-3127	346	8	,	,	PUNCT
ahs-3127	346	9	landivar	landivar	PROPN
ahs-3127	346	10	j.a	j.a	PROPN
ahs-3127	346	11	.	.	PROPN
ahs-3127	346	12	,	,	PUNCT
ahs-3127	346	13	fernandez	fernandez	PROPN
ahs-3127	346	14	c.j	c.j	PROPN
ahs-3127	346	15	.	.	PROPN
ahs-3127	346	16	,	,	PUNCT
ahs-3127	346	17	2004	2004	NUM
ahs-3127	346	18	cotton	cotton	NOUN
ahs-3127	346	19	fiber	fiber	NOUN
ahs-3127	346	20	quality	quality	NOUN
ahs-3127	346	21	is	be	AUX
ahs-3127	346	22	related	relate	VERB
ahs-3127	346	23	to	to	ADP
ahs-3127	346	24	boll	boll	NOUN
ahs-3127	346	25	location	location	NOUN
ahs-3127	346	26	and	and	CCONJ
ahs-3127	346	27	planting	planting	NOUN
ahs-3127	346	28	date	date	NOUN
ahs-3127	346	29	.	.	PUNCT
ahs-3127	347	1	agron	agron	PROPN
ahs-3127	347	2	.	.	PUNCT
ahs-3127	348	1	j.	j.	PROPN
ahs-3127	348	2	,	,	PUNCT
ahs-3127	348	3	96(1	96(1	PROPN
ahs-3127	348	4	):	):	PUNCT
ahs-3127	348	5	42	42	NUM
ahs-3127	348	6	-	-	SYM
ahs-3127	348	7	47	47	NUM
ahs-3127	348	8	.	.	PUNCT
ahs-3127	349	1	deeba	deeba	PROPN
ahs-3127	349	2	f.	f.	PROPN
ahs-3127	349	3	,	,	PUNCT
ahs-3127	349	4	pandey	pandey	PROPN
ahs-3127	349	5	a.k	a.k	PROPN
ahs-3127	349	6	.	.	PROPN
ahs-3127	349	7	,	,	PUNCT
ahs-3127	349	8	ranjan	ranjan	PROPN
ahs-3127	349	9	s.	s.	PROPN
ahs-3127	349	10	,	,	PUNCT
ahs-3127	349	11	mishra	mishra	PROPN
ahs-3127	349	12	a.	a.	PROPN
ahs-3127	349	13	,	,	PUNCT
ahs-3127	349	14	singh	singh	PROPN
ahs-3127	349	15	r.	r.	PROPN
ahs-3127	349	16	,	,	PUNCT
ahs-3127	349	17	sharma	sharma	PROPN
ahs-3127	349	18	y.k	y.k	PROPN
ahs-3127	349	19	.	.	PROPN
ahs-3127	349	20	,	,	PUNCT
ahs-3127	349	21	shirke	shirke	PROPN
ahs-3127	349	22	p.a	p.a	PROPN
ahs-3127	349	23	.	.	PROPN
ahs-3127	349	24	,	,	PUNCT
ahs-3127	349	25	pandey	pandey	PROPN
ahs-3127	349	26	v.	v.	PROPN
ahs-3127	349	27	,	,	PUNCT
ahs-3127	349	28	2012	2012	NUM
ahs-3127	349	29	physiological	physiological	ADJ
ahs-3127	349	30	and	and	CCONJ
ahs-3127	349	31	proteomic	proteomic	ADJ
ahs-3127	349	32	responses	response	NOUN
ahs-3127	349	33	of	of	ADP
ahs-3127	349	34	cotton	cotton	NOUN
ahs-3127	349	35	(	(	PUNCT
ahs-3127	349	36	gossypium	gossypium	PROPN
ahs-3127	349	37	herbaceum	herbaceum	PROPN
ahs-3127	349	38	l.	l.	PROPN
ahs-3127	349	39	)	)	PUNCT
ahs-3127	349	40	to	to	ADP
ahs-3127	349	41	drought	drought	NOUN
ahs-3127	349	42	stress	stress	NOUN
ahs-3127	349	43	.	.	PUNCT
ahs-3127	350	1	plant	plant	NOUN
ahs-3127	350	2	physiol	physiol	PROPN
ahs-3127	350	3	.	.	PUNCT
ahs-3127	351	1	biochem	biochem	PROPN
ahs-3127	351	2	.	.	PUNCT
ahs-3127	351	3	,	,	PUNCT
ahs-3127	352	1	53(0	53(0	PROPN
ahs-3127	352	2	):	):	PUNCT
ahs-3127	352	3	6	6	NUM
ahs-3127	352	4	-	-	SYM
ahs-3127	352	5	18	18	NUM
ahs-3127	352	6	.	.	PUNCT
ahs-3127	353	1	dubouzet	dubouzet	PROPN
ahs-3127	353	2	j.g	j.g	PROPN
ahs-3127	353	3	.	.	PROPN
ahs-3127	353	4	,	,	PUNCT
ahs-3127	353	5	sakuma	sakuma	PROPN
ahs-3127	353	6	y.	y.	PROPN
ahs-3127	353	7	,	,	PUNCT
ahs-3127	353	8	ito	ito	PROPN
ahs-3127	353	9	y.	y.	PROPN
ahs-3127	353	10	,	,	PUNCT
ahs-3127	353	11	kasuga	kasuga	ADJ
ahs-3127	353	12	m.	m.	NOUN
ahs-3127	353	13	,	,	PUNCT
ahs-3127	353	14	dubouzet	dubouzet	NOUN
ahs-3127	353	15	e.g.	e.g.	ADV
ahs-3127	353	16	,	,	PUNCT
ahs-3127	353	17	miura	miura	PROPN
ahs-3127	353	18	s.	s.	PROPN
ahs-3127	353	19	,	,	PUNCT
ahs-3127	353	20	seki	seki	PROPN
ahs-3127	353	21	m.	m.	PROPN
ahs-3127	353	22	,	,	PUNCT
ahs-3127	353	23	shinozaki	shinozaki	PROPN
ahs-3127	353	24	k.	k.	PROPN
ahs-3127	353	25	,	,	PUNCT
ahs-3127	353	26	yamaguchi	yamaguchi	PROPN
ahs-3127	353	27	-	-	PUNCT
ahs-3127	353	28	shinozaki	shinozaki	PROPN
ahs-3127	353	29	k.	k.	PROPN
ahs-3127	353	30	,	,	PUNCT
ahs-3127	353	31	2003	2003	NUM
ahs-3127	353	32	osdreb	osdreb	NOUN
ahs-3127	353	33	genes	gene	NOUN
ahs-3127	353	34	in	in	ADP
ahs-3127	353	35	rice	rice	NOUN
ahs-3127	353	36	,	,	PUNCT
ahs-3127	353	37	oryza	oryza	PROPN
ahs-3127	353	38	sativa	sativa	PROPN
ahs-3127	353	39	l.	l.	PROPN
ahs-3127	353	40	,	,	PUNCT
ahs-3127	353	41	encode	encode	ADJ
ahs-3127	353	42	transcription	transcription	NOUN
ahs-3127	353	43	activators	activator	NOUN
ahs-3127	353	44	that	that	PRON
ahs-3127	353	45	function	function	VERB
ahs-3127	353	46	in	in	ADP
ahs-3127	353	47	drought-	drought-	PROPN
ahs-3127	353	48	,	,	PUNCT
ahs-3127	353	49	high	high	ADJ
ahs-3127	353	50	-	-	PUNCT
ahs-3127	353	51	saltand	saltand	NOUN
ahs-3127	353	52	cold	cold	ADJ
ahs-3127	353	53	-	-	PUNCT
ahs-3127	353	54	responsive	responsive	ADJ
ahs-3127	353	55	gene	gene	NOUN
ahs-3127	353	56	expression	expression	NOUN
ahs-3127	353	57	.	.	PUNCT
ahs-3127	354	1	plant	plant	NOUN
ahs-3127	354	2	j.	j.	PROPN
ahs-3127	354	3	,	,	PUNCT
ahs-3127	354	4	33(4	33(4	NUM
ahs-3127	354	5	):	):	PUNCT
ahs-3127	354	6	751	751	NUM
ahs-3127	354	7	-	-	SYM
ahs-3127	354	8	763	763	NUM
ahs-3127	354	9	.	.	PUNCT
ahs-3127	355	1	fernie	fernie	PROPN
ahs-3127	355	2	a.r	a.r	PROPN
ahs-3127	355	3	.	.	PROPN
ahs-3127	355	4	,	,	PUNCT
ahs-3127	355	5	schauer	schauer	PROPN
ahs-3127	355	6	n.	n.	PROPN
ahs-3127	355	7	,	,	PUNCT
ahs-3127	355	8	2009	2009	NUM
ahs-3127	355	9	metabolomics	metabolomic	NOUN
ahs-3127	355	10	-	-	PUNCT
ahs-3127	355	11	assisted	assist	VERB
ahs-3127	355	12	breeding	breeding	NOUN
ahs-3127	355	13	:	:	PUNCT
ahs-3127	355	14	a	a	DET
ahs-3127	355	15	viable	viable	ADJ
ahs-3127	355	16	option	option	NOUN
ahs-3127	355	17	for	for	ADP
ahs-3127	355	18	crop	crop	NOUN
ahs-3127	355	19	improvement	improvement	NOUN
ahs-3127	355	20	?	?	PUNCT
ahs-3127	356	1	trends	trend	NOUN
ahs-3127	356	2	genet	genet	PROPN
ahs-3127	356	3	.	.	PUNCT
ahs-3127	356	4	,	,	PUNCT
ahs-3127	356	5	25(1	25(1	NUM
ahs-3127	356	6	):	):	PUNCT
ahs-3127	356	7	39	39	NUM
ahs-3127	356	8	-	-	SYM
ahs-3127	356	9	48	48	NUM
ahs-3127	356	10	.	.	PUNCT
ahs-3127	357	1	folly	folly	PROPN
ahs-3127	357	2	p.	p.	PROPN
ahs-3127	357	3	,	,	PUNCT
ahs-3127	357	4	engel	engel	PROPN
ahs-3127	357	5	n.	n.	PROPN
ahs-3127	357	6	,	,	PUNCT
ahs-3127	357	7	1999	1999	NUM
ahs-3127	357	8	chlorophyll	chlorophyll	VERB
ahs-3127	357	9	b	b	NOUN
ahs-3127	357	10	to	to	PART
ahs-3127	357	11	chlorophyll	chlorophyll	VERB
ahs-3127	357	12	a	a	DET
ahs-3127	357	13	conversion	conversion	NOUN
ahs-3127	357	14	precedes	precede	VERB
ahs-3127	357	15	chlorophyll	chlorophyll	ADJ
ahs-3127	357	16	degradation	degradation	NOUN
ahs-3127	357	17	in	in	ADP
ahs-3127	357	18	hordeum	hordeum	PROPN
ahs-3127	357	19	vulgare	vulgare	PROPN
ahs-3127	357	20	l.	l.	PROPN
ahs-3127	357	21	j.	j.	PROPN
ahs-3127	357	22	biol	biol	PROPN
ahs-3127	357	23	.	.	PUNCT
ahs-3127	358	1	chem	chem	PROPN
ahs-3127	358	2	.	.	PUNCT
ahs-3127	358	3	,	,	PUNCT
ahs-3127	358	4	274(31	274(31	NUM
ahs-3127	358	5	):	):	PUNCT
ahs-3127	358	6	2181121816	2181121816	NUM
ahs-3127	358	7	.	.	PUNCT
ahs-3127	359	1	fukai	fukai	PROPN
ahs-3127	359	2	s.	s.	PROPN
ahs-3127	359	3	,	,	PUNCT
ahs-3127	359	4	cooper	cooper	PROPN
ahs-3127	359	5	m.	m.	PROPN
ahs-3127	359	6	,	,	PUNCT
ahs-3127	359	7	1995	1995	NUM
ahs-3127	359	8	development	development	NOUN
ahs-3127	359	9	of	of	ADP
ahs-3127	359	10	droughtresistant	droughtresistant	ADJ
ahs-3127	359	11	cultivars	cultivar	NOUN
ahs-3127	359	12	using	use	VERB
ahs-3127	359	13	physiomorphological	physiomorphological	ADJ
ahs-3127	359	14	traits	trait	NOUN
ahs-3127	359	15	in	in	ADP
ahs-3127	359	16	rice	rice	NOUN
ahs-3127	359	17	.	.	PUNCT
ahs-3127	360	1	field	field	NOUN
ahs-3127	360	2	crops	crop	NOUN
ahs-3127	360	3	res	re	NOUN
ahs-3127	360	4	.	.	PUNCT
ahs-3127	360	5	,	,	PUNCT
ahs-3127	360	6	40(2	40(2	NUM
ahs-3127	360	7	):	):	PUNCT
ahs-3127	360	8	67	67	NUM
ahs-3127	360	9	-	-	SYM
ahs-3127	360	10	86	86	NUM
ahs-3127	360	11	.	.	PUNCT
ahs-3127	361	1	hanson	hanson	PROPN
ahs-3127	361	2	r.g	r.g	PROPN
ahs-3127	361	3	.	.	PROPN
ahs-3127	361	4	,	,	PUNCT
ahs-3127	361	5	ewing	ewing	PROPN
ahs-3127	361	6	e.c	e.c	PROPN
ahs-3127	361	7	.	.	PROPN
ahs-3127	361	8	,	,	PUNCT
ahs-3127	361	9	1956	1956	NUM
ahs-3127	361	10	effect	effect	NOUN
ahs-3127	361	11	of	of	ADP
ahs-3127	361	12	environmental	environmental	ADJ
ahs-3127	361	13	factors	factor	NOUN
ahs-3127	361	14	on	on	ADP
ahs-3127	361	15	fiber	fiber	NOUN
ahs-3127	361	16	properties	property	NOUN
ahs-3127	361	17	and	and	CCONJ
ahs-3127	361	18	yield	yield	NOUN
ahs-3127	361	19	of	of	ADP
ahs-3127	361	20	deltapine	deltapine	NOUN
ahs-3127	361	21	cottons	cotton	NOUN
ahs-3127	361	22	.	.	PUNCT
ahs-3127	362	1	agron	agron	PROPN
ahs-3127	362	2	.	.	PUNCT
ahs-3127	363	1	j.	j.	PROPN
ahs-3127	363	2	,	,	PUNCT
ahs-3127	363	3	48	48	NUM
ahs-3127	363	4	(	(	PUNCT
ahs-3127	363	5	12	12	NUM
ahs-3127	363	6	):	):	PUNCT
ahs-3127	363	7	573	573	NUM
ahs-3127	363	8	-	-	SYM
ahs-3127	363	9	581	581	NUM
ahs-3127	363	10	.	.	PUNCT
ahs-3127	364	1	iglesias	iglesias	PROPN
ahs-3127	364	2	a.	a.	PROPN
ahs-3127	364	3	,	,	PUNCT
ahs-3127	364	4	garrote	garrote	NOUN
ahs-3127	364	5	l.	l.	PROPN
ahs-3127	364	6	,	,	PUNCT
ahs-3127	364	7	diz	diz	PROPN
ahs-3127	364	8	a.	a.	NOUN
ahs-3127	364	9	,	,	PUNCT
ahs-3127	364	10	schlickenrieder	schlickenrieder	PROPN
ahs-3127	364	11	j.	j.	PROPN
ahs-3127	364	12	,	,	PUNCT
ahs-3127	364	13	martin	martin	PROPN
ahs-3127	364	14	-	-	PUNCT
ahs-3127	364	15	carrasco	carrasco	PROPN
ahs-3127	364	16	f.	f.	PROPN
ahs-3127	364	17	,	,	PUNCT
ahs-3127	364	18	2011	2011	NUM
ahs-3127	364	19	re	re	ADJ
ahs-3127	364	20	-	-	ADJ
ahs-3127	364	21	thinking	thinking	ADJ
ahs-3127	364	22	water	water	NOUN
ahs-3127	364	23	policy	policy	NOUN
ahs-3127	364	24	priorities	priority	NOUN
ahs-3127	364	25	in	in	ADP
ahs-3127	364	26	the	the	DET
ahs-3127	364	27	mediterranean	mediterranean	PROPN
ahs-3127	364	28	region	region	NOUN
ahs-3127	364	29	in	in	ADP
ahs-3127	364	30	view	view	NOUN
ahs-3127	364	31	of	of	ADP
ahs-3127	364	32	climate	climate	NOUN
ahs-3127	364	33	change	change	NOUN
ahs-3127	364	34	.	.	PUNCT
ahs-3127	365	1	environ	environ	PROPN
ahs-3127	365	2	.	.	PUNCT
ahs-3127	366	1	sci	sci	PROPN
ahs-3127	366	2	.	.	PUNCT
ahs-3127	366	3	policy	policy	PROPN
ahs-3127	366	4	,	,	PUNCT
ahs-3127	366	5	14(7	14(7	NUM
ahs-3127	366	6	):	):	PUNCT
ahs-3127	366	7	744	744	NUM
ahs-3127	366	8	-	-	SYM
ahs-3127	366	9	757	757	NOUN
ahs-3127	366	10	.	.	PUNCT
ahs-3127	367	1	ito	ito	PROPN
ahs-3127	367	2	y.	y.	PROPN
ahs-3127	367	3	,	,	PUNCT
ahs-3127	367	4	katsura	katsura	PROPN
ahs-3127	367	5	k.	k.	PROPN
ahs-3127	367	6	,	,	PUNCT
ahs-3127	367	7	maruyama	maruyama	PROPN
ahs-3127	367	8	k.	k.	PROPN
ahs-3127	367	9	,	,	PUNCT
ahs-3127	367	10	taji	taji	PROPN
ahs-3127	367	11	t.	t.	PROPN
ahs-3127	367	12	,	,	PUNCT
ahs-3127	367	13	kobayashi	kobayashi	PROPN
ahs-3127	367	14	m.	m.	PROPN
ahs-3127	367	15	,	,	PUNCT
ahs-3127	367	16	seki	seki	PROPN
ahs-3127	367	17	m.	m.	PROPN
ahs-3127	367	18	,	,	PUNCT
ahs-3127	367	19	shinozaki	shinozaki	PROPN
ahs-3127	367	20	k.	k.	PROPN
ahs-3127	367	21	,	,	PUNCT
ahs-3127	367	22	yamaguchi	yamaguchi	PROPN
ahs-3127	367	23	-	-	PUNCT
ahs-3127	367	24	shinozaki	shinozaki	PROPN
ahs-3127	367	25	k.	k.	PROPN
ahs-3127	367	26	,	,	PUNCT
ahs-3127	367	27	2006	2006	NUM
ahs-3127	367	28	functional	functional	ADJ
ahs-3127	367	29	analysis	analysis	NOUN
ahs-3127	367	30	of	of	ADP
ahs-3127	367	31	rice	rice	NOUN
ahs-3127	367	32	dreb1	dreb1	PROPN
ahs-3127	367	33	/	/	SYM
ahs-3127	367	34	cbf	cbf	PROPN
ahs-3127	367	35	-	-	PUNCT
ahs-3127	367	36	type	type	NOUN
ahs-3127	367	37	transcription	transcription	NOUN
ahs-3127	367	38	factors	factor	NOUN
ahs-3127	367	39	involved	involve	VERB
ahs-3127	367	40	in	in	ADP
ahs-3127	367	41	cold	cold	ADJ
ahs-3127	367	42	-	-	PUNCT
ahs-3127	367	43	responsive	responsive	ADJ
ahs-3127	367	44	gene	gene	NOUN
ahs-3127	367	45	expression	expression	NOUN
ahs-3127	367	46	in	in	ADP
ahs-3127	367	47	transgenic	transgenic	NOUN
ahs-3127	367	48	rice	rice	NOUN
ahs-3127	367	49	.	.	PUNCT
ahs-3127	368	1	plant	plant	NOUN
ahs-3127	368	2	cell	cell	NOUN
ahs-3127	368	3	physiol	physiol	PROPN
ahs-3127	368	4	.	.	PUNCT
ahs-3127	369	1	,	,	PUNCT
ahs-3127	369	2	47(1	47(1	NUM
ahs-3127	369	3	):	):	PUNCT
ahs-3127	369	4	141	141	NUM
ahs-3127	369	5	-	-	SYM
ahs-3127	369	6	153	153	NUM
ahs-3127	369	7	.	.	PUNCT
ahs-3127	370	1	jawdat	jawdat	PROPN
ahs-3127	370	2	d.	d.	PROPN
ahs-3127	370	3	,	,	PUNCT
ahs-3127	370	4	hilali	hilali	PROPN
ahs-3127	370	5	m.a	m.a	PROPN
ahs-3127	370	6	.	.	PROPN
ahs-3127	370	7	,	,	PUNCT
ahs-3127	370	8	ayyoubi	ayyoubi	PROPN
ahs-3127	370	9	z.	z.	PROPN
ahs-3127	370	10	,	,	PUNCT
ahs-3127	370	11	elias	elias	PROPN
ahs-3127	370	12	r.	r.	PROPN
ahs-3127	370	13	,	,	PUNCT
ahs-3127	370	14	al	al	PROPN
ahs-3127	370	15	-	-	PUNCT
ahs-3127	370	16	rayan	rayan	PROPN
ahs-3127	370	17	r.	r.	PROPN
ahs-3127	370	18	,	,	PUNCT
ahs-3127	370	19	al	al	PROPN
ahs-3127	370	20	-	-	PUNCT
ahs-3127	370	21	salti	salti	PROPN
ahs-3127	370	22	m.n	m.n	PROPN
ahs-3127	370	23	.	.	PROPN
ahs-3127	370	24	,	,	PUNCT
ahs-3127	370	25	al	al	PROPN
ahs-3127	370	26	-	-	PUNCT
ahs-3127	370	27	safadi	safadi	PROPN
ahs-3127	370	28	b.	b.	PROPN
ahs-3127	370	29	,	,	PUNCT
ahs-3127	370	30	2012	2012	NUM
ahs-3127	370	31	response	response	NOUN
ahs-3127	370	32	of	of	ADP
ahs-3127	370	33	cotton	cotton	NOUN
ahs-3127	370	34	varieties	variety	NOUN
ahs-3127	370	35	to	to	ADP
ahs-3127	370	36	different	different	ADJ
ahs-3127	370	37	environments	environment	NOUN
ahs-3127	370	38	:	:	PUNCT
ahs-3127	370	39	flowering	flower	VERB
ahs-3127	370	40	behavior	behavior	NOUN
ahs-3127	370	41	and	and	CCONJ
ahs-3127	370	42	fiber	fiber	NOUN
ahs-3127	370	43	quality	quality	NOUN
ahs-3127	370	44	.	.	PUNCT
ahs-3127	371	1	pak	pak	PROPN
ahs-3127	371	2	.	.	PUNCT
ahs-3127	372	1	j.	j.	PROPN
ahs-3127	372	2	agri	agri	PROPN
ahs-3127	372	3	.	.	PUNCT
ahs-3127	373	1	sci	sci	PROPN
ahs-3127	373	2	.	.	PROPN
ahs-3127	373	3	,	,	PUNCT
ahs-3127	374	1	49(3	49(3	PROPN
ahs-3127	374	2	):	):	PUNCT
ahs-3127	374	3	289	289	NUM
ahs-3127	374	4	-	-	SYM
ahs-3127	374	5	298	298	NUM
ahs-3127	374	6	.	.	PUNCT
ahs-3127	375	1	jawdat	jawdat	PROPN
ahs-3127	375	2	d.	d.	PROPN
ahs-3127	375	3	,	,	PUNCT
ahs-3127	375	4	karajoli	karajoli	PROPN
ahs-3127	375	5	i.	i.	PROPN
ahs-3127	375	6	,	,	PUNCT
ahs-3127	375	7	2012	2012	NUM
ahs-3127	375	8	a	a	DET
ahs-3127	375	9	modified	modified	ADJ
ahs-3127	375	10	and	and	CCONJ
ahs-3127	375	11	inexpensive	inexpensive	ADJ
ahs-3127	375	12	protocol	protocol	NOUN
ahs-3127	375	13	for	for	ADP
ahs-3127	375	14	the	the	DET
ahs-3127	375	15	rapid	rapid	ADJ
ahs-3127	375	16	isolation	isolation	NOUN
ahs-3127	375	17	of	of	ADP
ahs-3127	375	18	rna	rna	NOUN
ahs-3127	375	19	from	from	ADP
ahs-3127	375	20	diverse	diverse	ADJ
ahs-3127	375	21	plant	plant	NOUN
ahs-3127	375	22	species	specie	NOUN
ahs-3127	375	23	.	.	PUNCT
ahs-3127	376	1	j.	j.	PROPN
ahs-3127	376	2	hortic	hortic	PROPN
ahs-3127	376	3	.	.	PUNCT
ahs-3127	377	1	sci	sci	PROPN
ahs-3127	377	2	.	.	PROPN
ahs-3127	377	3	,	,	PUNCT
ahs-3127	377	4	87(4	87(4	NUM
ahs-3127	377	5	):	):	PUNCT
ahs-3127	377	6	317	317	NUM
ahs-3127	377	7	-	-	SYM
ahs-3127	377	8	324	324	NUM
ahs-3127	377	9	.	.	PUNCT
ahs-3127	378	1	jiang	jiang	PROPN
ahs-3127	378	2	y.	y.	PROPN
ahs-3127	378	3	,	,	PUNCT
ahs-3127	378	4	watkins	watkins	PROPN
ahs-3127	378	5	e.	e.	PROPN
ahs-3127	378	6	,	,	PUNCT
ahs-3127	378	7	liu	liu	PROPN
ahs-3127	378	8	s.	s.	PROPN
ahs-3127	378	9	,	,	PUNCT
ahs-3127	378	10	yu	yu	PROPN
ahs-3127	378	11	x.	x.	PROPN
ahs-3127	378	12	,	,	PUNCT
ahs-3127	378	13	luo	luo	PROPN
ahs-3127	378	14	n.	n.	PROPN
ahs-3127	378	15	,	,	PUNCT
ahs-3127	378	16	2010	2010	NUM
ahs-3127	378	17	antioxidative	antioxidative	ADJ
ahs-3127	378	18	responses	response	NOUN
ahs-3127	378	19	and	and	CCONJ
ahs-3127	378	20	candidate	candidate	NOUN
ahs-3127	378	21	gene	gene	NOUN
ahs-3127	378	22	expression	expression	NOUN
ahs-3127	378	23	in	in	ADP
ahs-3127	378	24	prairie	prairie	ADJ
ahs-3127	378	25	junegrass	junegrass	NOUN
ahs-3127	378	26	under	under	ADP
ahs-3127	378	27	drought	drought	NOUN
ahs-3127	378	28	stress	stress	NOUN
ahs-3127	378	29	.	.	PUNCT
ahs-3127	379	1	j.	j.	PROPN
ahs-3127	379	2	amer	amer	PROPN
ahs-3127	379	3	.	.	PUNCT
ahs-3127	379	4	soc	soc	PROPN
ahs-3127	379	5	.	.	PUNCT
ahs-3127	380	1	hort	hort	PROPN
ahs-3127	380	2	.	.	PUNCT
ahs-3127	381	1	sci	sci	PROPN
ahs-3127	381	2	.	.	PROPN
ahs-3127	381	3	,	,	PUNCT
ahs-3127	381	4	135(4	135(4	NUM
ahs-3127	381	5	):	):	PUNCT
ahs-3127	381	6	303	303	NUM
ahs-3127	381	7	-	-	SYM
ahs-3127	381	8	309	309	NUM
ahs-3127	381	9	.	.	PUNCT
ahs-3127	382	1	johnson	johnson	PROPN
ahs-3127	382	2	r.m	r.m	PROPN
ahs-3127	382	3	.	.	PROPN
ahs-3127	382	4	,	,	PUNCT
ahs-3127	382	5	downer	downer	PROPN
ahs-3127	382	6	r.g	r.g	PROPN
ahs-3127	382	7	.	.	PROPN
ahs-3127	382	8	,	,	PUNCT
ahs-3127	382	9	bradow	bradow	PROPN
ahs-3127	382	10	j.m	j.m	PROPN
ahs-3127	382	11	.	.	PROPN
ahs-3127	382	12	,	,	PUNCT
ahs-3127	382	13	bauer	bauer	PROPN
ahs-3127	382	14	p.j	p.j	PROPN
ahs-3127	382	15	.	.	PROPN
ahs-3127	382	16	,	,	PUNCT
ahs-3127	382	17	sadler	sadler	PROPN
ahs-3127	382	18	e.j	e.j	PROPN
ahs-3127	382	19	.	.	PROPN
ahs-3127	382	20	,	,	PUNCT
ahs-3127	382	21	2002	2002	NUM
ahs-3127	382	22	variability	variability	NOUN
ahs-3127	382	23	in	in	ADP
ahs-3127	382	24	cotton	cotton	NOUN
ahs-3127	382	25	fiber	fiber	NOUN
ahs-3127	382	26	yield	yield	NOUN
ahs-3127	382	27	,	,	PUNCT
ahs-3127	382	28	fiber	fiber	NOUN
ahs-3127	382	29	quality	quality	NOUN
ahs-3127	382	30	,	,	PUNCT
ahs-3127	382	31	and	and	CCONJ
ahs-3127	382	32	soil	soil	NOUN
ahs-3127	382	33	properties	property	NOUN
ahs-3127	382	34	in	in	ADP
ahs-3127	382	35	a	a	DET
ahs-3127	382	36	southeastern	southeastern	ADJ
ahs-3127	382	37	coastal	coastal	ADJ
ahs-3127	382	38	plain	plain	NOUN
ahs-3127	382	39	.	.	PUNCT
ahs-3127	383	1	agron	agron	PROPN
ahs-3127	383	2	.	.	PUNCT
ahs-3127	384	1	j.	j.	PROPN
ahs-3127	384	2	,	,	PUNCT
ahs-3127	384	3	94(6	94(6	NUM
ahs-3127	384	4	):	):	PUNCT
ahs-3127	384	5	1305	1305	NUM
ahs-3127	384	6	-	-	SYM
ahs-3127	384	7	1316	1316	NUM
ahs-3127	384	8	.	.	PUNCT
ahs-3127	385	1	khan	khan	PROPN
ahs-3127	385	2	h.r	h.r	PROPN
ahs-3127	385	3	.	.	PROPN
ahs-3127	385	4	,	,	PUNCT
ahs-3127	385	5	paull	paull	PROPN
ahs-3127	385	6	j.g	j.g	PROPN
ahs-3127	385	7	.	.	PROPN
ahs-3127	385	8	,	,	PUNCT
ahs-3127	385	9	siddique	siddique	PROPN
ahs-3127	385	10	k.h.m	k.h.m	PROPN
ahs-3127	385	11	.	.	PROPN
ahs-3127	385	12	,	,	PUNCT
ahs-3127	385	13	stoddard	stoddard	PROPN
ahs-3127	385	14	f.l	f.l	PROPN
ahs-3127	385	15	.	.	PROPN
ahs-3127	385	16	,	,	PUNCT
ahs-3127	385	17	2010	2010	NUM
ahs-3127	385	18	faba	faba	NOUN
ahs-3127	385	19	bean	bean	NOUN
ahs-3127	385	20	breeding	breeding	NOUN
ahs-3127	385	21	for	for	ADP
ahs-3127	385	22	drought	drought	NOUN
ahs-3127	385	23	-	-	PUNCT
ahs-3127	385	24	affected	affect	VERB
ahs-3127	385	25	environments	environment	NOUN
ahs-3127	385	26	:	:	PUNCT
ahs-3127	385	27	a	a	DET
ahs-3127	385	28	physiological	physiological	ADJ
ahs-3127	385	29	and	and	CCONJ
ahs-3127	385	30	agronomic	agronomic	ADJ
ahs-3127	385	31	perspective	perspective	NOUN
ahs-3127	385	32	.	.	PUNCT
ahs-3127	386	1	field	field	NOUN
ahs-3127	386	2	crops	crop	NOUN
ahs-3127	386	3	res	re	NOUN
ahs-3127	386	4	.	.	PUNCT
ahs-3127	386	5	,	,	PUNCT
ahs-3127	386	6	115	115	NUM
ahs-3127	386	7	(	(	PUNCT
ahs-3127	386	8	3	3	NUM
ahs-3127	386	9	):	):	PUNCT
ahs-3127	386	10	279	279	NUM
ahs-3127	386	11	-	-	SYM
ahs-3127	386	12	286	286	NUM
ahs-3127	386	13	.	.	PUNCT
ahs-3127	387	1	khan	khan	PROPN
ahs-3127	387	2	u.q	u.q	PROPN
ahs-3127	387	3	.	.	PROPN
ahs-3127	387	4	,	,	PUNCT
ahs-3127	387	5	2003	2003	NUM
ahs-3127	387	6	monitoring	monitor	VERB
ahs-3127	387	7	the	the	DET
ahs-3127	387	8	growth	growth	NOUN
ahs-3127	387	9	and	and	CCONJ
ahs-3127	387	10	development	development	NOUN
ahs-3127	387	11	of	of	ADP
ahs-3127	387	12	cotton	cotton	NOUN
ahs-3127	387	13	plants	plant	NOUN
ahs-3127	387	14	using	use	VERB
ahs-3127	387	15	main	main	ADJ
ahs-3127	387	16	stem	stem	NOUN
ahs-3127	387	17	node	node	NOUN
ahs-3127	387	18	counts	count	NOUN
ahs-3127	387	19	.	.	PUNCT
ahs-3127	388	1	asian	asian	ADJ
ahs-3127	388	2	j.	j.	PROPN
ahs-3127	388	3	plant	plant	PROPN
ahs-3127	388	4	sci	sci	PROPN
ahs-3127	388	5	.	.	PROPN
ahs-3127	388	6	,	,	PUNCT
ahs-3127	388	7	2(8	2(8	NUM
ahs-3127	388	8	):	):	PUNCT
ahs-3127	388	9	593	593	NUM
ahs-3127	388	10	-	-	SYM
ahs-3127	388	11	596	596	NUM
ahs-3127	388	12	.	.	PUNCT
ahs-3127	389	1	kosmas	kosmas	PROPN
ahs-3127	389	2	s.	s.	PROPN
ahs-3127	389	3	,	,	PUNCT
ahs-3127	389	4	argyrokastritis	argyrokastritis	PROPN
ahs-3127	389	5	a.	a.	NOUN
ahs-3127	389	6	,	,	PUNCT
ahs-3127	389	7	loukas	loukas	PROPN
ahs-3127	389	8	m.	m.	NOUN
ahs-3127	389	9	,	,	PUNCT
ahs-3127	389	10	eliopoulos	eliopoulos	PROPN
ahs-3127	389	11	e.	e.	PROPN
ahs-3127	389	12	,	,	PUNCT
ahs-3127	389	13	tsakas	tsakas	PROPN
ahs-3127	389	14	s.	s.	PROPN
ahs-3127	389	15	,	,	PUNCT
ahs-3127	389	16	kaltsikes	kaltsikes	PROPN
ahs-3127	389	17	p.	p.	PROPN
ahs-3127	389	18	,	,	PUNCT
ahs-3127	389	19	2006	2006	NUM
ahs-3127	389	20	isolation	isolation	NOUN
ahs-3127	389	21	and	and	CCONJ
ahs-3127	389	22	characterization	characterization	NOUN
ahs-3127	389	23	of	of	ADP
ahs-3127	389	24	drought	drought	NOUN
ahs-3127	389	25	-	-	PUNCT
ahs-3127	389	26	related	relate	VERB
ahs-3127	389	27	trehalose	trehalose	ADV
ahs-3127	389	28	6	6	NUM
ahs-3127	389	29	-	-	PUNCT
ahs-3127	389	30	phosphate	phosphate	ADJ
ahs-3127	389	31	-	-	PUNCT
ahs-3127	389	32	synthase	synthase	NOUN
ahs-3127	389	33	gene	gene	NOUN
ahs-3127	389	34	from	from	ADP
ahs-3127	389	35	cultivated	cultivate	VERB
ahs-3127	389	36	cotton	cotton	NOUN
ahs-3127	389	37	(	(	PUNCT
ahs-3127	389	38	gossypium	gossypium	NOUN
ahs-3127	389	39	hirsutum	hirsutum	PROPN
ahs-3127	389	40	l.	l.	PROPN
ahs-3127	389	41	)	)	PUNCT
ahs-3127	389	42	.	.	PUNCT
ahs-3127	390	1	planta	planta	PROPN
ahs-3127	390	2	,	,	PUNCT
ahs-3127	390	3	223(2	223(2	NUM
ahs-3127	390	4	):	):	PUNCT
ahs-3127	390	5	329	329	NUM
ahs-3127	390	6	-	-	SYM
ahs-3127	390	7	339	339	NUM
ahs-3127	390	8	.	.	PUNCT
ahs-3127	391	1	liu	liu	PROPN
ahs-3127	391	2	q.	q.	PROPN
ahs-3127	391	3	,	,	PUNCT
ahs-3127	391	4	kasuga	kasuga	PROPN
ahs-3127	391	5	m.	m.	NOUN
ahs-3127	391	6	,	,	PUNCT
ahs-3127	391	7	sakuma	sakuma	PROPN
ahs-3127	391	8	y.	y.	PROPN
ahs-3127	391	9	,	,	PUNCT
ahs-3127	391	10	abe	abe	PROPN
ahs-3127	391	11	h.	h.	PROPN
ahs-3127	391	12	,	,	PUNCT
ahs-3127	391	13	miura	miura	PROPN
ahs-3127	391	14	s.	s.	PROPN
ahs-3127	391	15	,	,	PUNCT
ahs-3127	391	16	yamaguchi	yamaguchi	PROPN
ahs-3127	391	17	-	-	PUNCT
ahs-3127	391	18	shinozaki	shinozaki	PROPN
ahs-3127	391	19	k.	k.	PROPN
ahs-3127	391	20	,	,	PUNCT
ahs-3127	391	21	shinozaki	shinozaki	PROPN
ahs-3127	391	22	k.	k.	PROPN
ahs-3127	391	23	,	,	PUNCT
ahs-3127	391	24	1998	1998	NUM
ahs-3127	391	25	two	two	NUM
ahs-3127	391	26	transcription	transcription	NOUN
ahs-3127	391	27	factors	factor	NOUN
ahs-3127	391	28	,	,	PUNCT
ahs-3127	391	29	dreb1	dreb1	NOUN
ahs-3127	391	30	and	and	CCONJ
ahs-3127	391	31	dreb2	dreb2	PROPN
ahs-3127	391	32	,	,	PUNCT
ahs-3127	391	33	with	with	ADP
ahs-3127	391	34	an	an	DET
ahs-3127	391	35	erebp	erebp	ADJ
ahs-3127	391	36	/	/	SYM
ahs-3127	391	37	ap2	ap2	NOUN
ahs-3127	391	38	dna	dna	NOUN
ahs-3127	391	39	binding	bind	VERB
ahs-3127	391	40	domain	domain	NOUN
ahs-3127	391	41	separate	separate	VERB
ahs-3127	391	42	two	two	NUM
ahs-3127	391	43	cellular	cellular	ADJ
ahs-3127	391	44	signal	signal	NOUN
ahs-3127	391	45	transduction	transduction	NOUN
ahs-3127	391	46	pathways	pathway	NOUN
ahs-3127	391	47	in	in	ADP
ahs-3127	391	48	droughtand	droughtand	NOUN
ahs-3127	391	49	low	low	ADJ
ahs-3127	391	50	-	-	PUNCT
ahs-3127	391	51	temperature	temperature	NOUN
ahs-3127	391	52	-	-	PUNCT
ahs-3127	391	53	responsive	responsive	ADJ
ahs-3127	391	54	gene	gene	NOUN
ahs-3127	391	55	expression	expression	NOUN
ahs-3127	391	56	,	,	PUNCT
ahs-3127	391	57	respectively	respectively	ADV
ahs-3127	391	58	,	,	PUNCT
ahs-3127	391	59	in	in	ADP
ahs-3127	391	60	arabidopsis	arabidopsis	NOUN
ahs-3127	391	61	.	.	PUNCT
ahs-3127	391	62	plant	plant	NOUN
ahs-3127	391	63	cell	cell	NOUN
ahs-3127	391	64	,	,	PUNCT
ahs-3127	391	65	10(8	10(8	NUM
ahs-3127	391	66	):	):	PUNCT
ahs-3127	391	67	1391	1391	NUM
ahs-3127	391	68	-	-	SYM
ahs-3127	391	69	1406	1406	NUM
ahs-3127	391	70	.	.	PUNCT
ahs-3127	392	1	liu	liu	PROPN
ahs-3127	392	2	y.	y.	PROPN
ahs-3127	392	3	,	,	PUNCT
ahs-3127	392	4	2013	2013	NUM
ahs-3127	392	5	recent	recent	ADJ
ahs-3127	392	6	progress	progress	NOUN
ahs-3127	392	7	in	in	ADP
ahs-3127	392	8	fourier	fourier	ADJ
ahs-3127	392	9	transform	transform	NOUN
ahs-3127	392	10	infrared	infrared	ADJ
ahs-3127	392	11	(	(	PUNCT
ahs-3127	392	12	ftir	ftir	NOUN
ahs-3127	392	13	)	)	PUNCT
ahs-3127	392	14	spectroscopy	spectroscopy	NOUN
ahs-3127	392	15	study	study	NOUN
ahs-3127	392	16	of	of	ADP
ahs-3127	392	17	compositional	compositional	ADJ
ahs-3127	392	18	,	,	PUNCT
ahs-3127	392	19	structural	structural	ADJ
ahs-3127	392	20	jawdat	jawdat	NOUN
ahs-3127	392	21	et	et	PROPN
ahs-3127	392	22	al	al	PROPN
ahs-3127	392	23	.	.	PUNCT
ahs-3127	392	24	cotton	cotton	NOUN
ahs-3127	392	25	behaviour	behaviour	NOUN
ahs-3127	392	26	under	under	ADP
ahs-3127	392	27	water	water	NOUN
ahs-3127	392	28	stress	stress	NOUN
ahs-3127	392	29	91	91	NUM
ahs-3127	392	30	and	and	CCONJ
ahs-3127	392	31	physical	physical	ADJ
ahs-3127	392	32	attributes	attribute	NOUN
ahs-3127	392	33	of	of	ADP
ahs-3127	392	34	developmental	developmental	ADJ
ahs-3127	392	35	cotton	cotton	NOUN
ahs-3127	392	36	fibers	fiber	NOUN
ahs-3127	392	37	.	.	PUNCT
ahs-3127	393	1	materials	material	NOUN
ahs-3127	393	2	,	,	PUNCT
ahs-3127	393	3	6(1	6(1	NUM
ahs-3127	393	4	):	):	PUNCT
ahs-3127	393	5	299	299	NUM
ahs-3127	393	6	.	.	PUNCT
ahs-3127	394	1	ma	ma	PROPN
ahs-3127	394	2	f.	f.	PROPN
ahs-3127	394	3	,	,	PUNCT
ahs-3127	394	4	zhu	zhu	PROPN
ahs-3127	394	5	y.	y.	PROPN
ahs-3127	394	6	,	,	PUNCT
ahs-3127	394	7	cao	cao	PROPN
ahs-3127	394	8	w.	w.	PROPN
ahs-3127	394	9	,	,	PUNCT
ahs-3127	394	10	yang	yang	PROPN
ahs-3127	394	11	j.	j.	PROPN
ahs-3127	394	12	,	,	PUNCT
ahs-3127	394	13	zheng	zheng	PROPN
ahs-3127	394	14	z.	z.	PROPN
ahs-3127	394	15	,	,	PUNCT
ahs-3127	394	16	cheng	cheng	PROPN
ahs-3127	394	17	h.	h.	PROPN
ahs-3127	394	18	,	,	PUNCT
ahs-3127	394	19	mu	mu	PROPN
ahs-3127	394	20	c.	c.	PROPN
ahs-3127	394	21	,	,	PUNCT
ahs-3127	394	22	2006	2006	NUM
ahs-3127	394	23	modeling	model	VERB
ahs-3127	394	24	fiber	fiber	NOUN
ahs-3127	394	25	quality	quality	NOUN
ahs-3127	394	26	formation	formation	NOUN
ahs-3127	394	27	in	in	ADP
ahs-3127	394	28	cotton	cotton	NOUN
ahs-3127	394	29	.	.	PUNCT
ahs-3127	395	1	zuo	zuo	PROPN
ahs-3127	395	2	wu	wu	PROPN
ahs-3127	395	3	xue	xue	PROPN
ahs-3127	395	4	bao	bao	PROPN
ahs-3127	395	5	,	,	PUNCT
ahs-3127	395	6	32(3	32(3	NUM
ahs-3127	395	7	):	):	PUNCT
ahs-3127	395	8	442	442	NUM
ahs-3127	395	9	-	-	SYM
ahs-3127	395	10	448	448	NUM
ahs-3127	395	11	.	.	PUNCT
ahs-3127	396	1	meyre	meyre	PROPN
ahs-3127	396	2	d.	d.	PROPN
ahs-3127	396	3	,	,	PUNCT
ahs-3127	396	4	leonardi	leonardi	PROPN
ahs-3127	396	5	a.	a.	PROPN
ahs-3127	396	6	,	,	PUNCT
ahs-3127	396	7	brisson	brisson	PROPN
ahs-3127	396	8	g.	g.	PROPN
ahs-3127	396	9	,	,	PUNCT
ahs-3127	396	10	vartanian	vartanian	PROPN
ahs-3127	396	11	n.	n.	NOUN
ahs-3127	396	12	,	,	PUNCT
ahs-3127	396	13	2001	2001	NUM
ahs-3127	396	14	drought	drought	NOUN
ahs-3127	396	15	-	-	PUNCT
ahs-3127	396	16	adaptive	adaptive	ADJ
ahs-3127	396	17	mechanisms	mechanism	NOUN
ahs-3127	396	18	involved	involve	VERB
ahs-3127	396	19	in	in	ADP
ahs-3127	396	20	the	the	DET
ahs-3127	396	21	escape	escape	NOUN
ahs-3127	396	22	/	/	SYM
ahs-3127	396	23	tolerance	tolerance	NOUN
ahs-3127	396	24	strategies	strategy	NOUN
ahs-3127	396	25	of	of	ADP
ahs-3127	396	26	arabidopsis	arabidopsis	NOUN
ahs-3127	396	27	landsberg	landsberg	PROPN
ahs-3127	396	28	erecta	erecta	PROPN
ahs-3127	396	29	and	and	CCONJ
ahs-3127	396	30	columbia	columbia	PROPN
ahs-3127	396	31	ecotypes	ecotype	NOUN
ahs-3127	396	32	and	and	CCONJ
ahs-3127	396	33	their	their	PRON
ahs-3127	396	34	f1	f1	ADJ
ahs-3127	396	35	reciprocal	reciprocal	ADJ
ahs-3127	396	36	progeny	progeny	NOUN
ahs-3127	396	37	.	.	PUNCT
ahs-3127	397	1	j.	j.	PROPN
ahs-3127	397	2	plant	plant	PROPN
ahs-3127	397	3	physiol	physiol	PROPN
ahs-3127	397	4	.	.	PUNCT
ahs-3127	397	5	,	,	PUNCT
ahs-3127	397	6	158(9	158(9	NUM
ahs-3127	397	7	):	):	PUNCT
ahs-3127	397	8	1145	1145	NUM
ahs-3127	397	9	-	-	SYM
ahs-3127	397	10	1152	1152	NUM
ahs-3127	397	11	.	.	PUNCT
ahs-3127	398	1	mizoi	mizoi	NOUN
ahs-3127	398	2	j.	j.	PROPN
ahs-3127	398	3	,	,	PUNCT
ahs-3127	398	4	shinozaki	shinozaki	PROPN
ahs-3127	398	5	k.	k.	PROPN
ahs-3127	398	6	,	,	PUNCT
ahs-3127	398	7	yamaguchi	yamaguchi	PROPN
ahs-3127	398	8	-	-	PUNCT
ahs-3127	398	9	shinozaki	shinozaki	PROPN
ahs-3127	398	10	k.	k.	PROPN
ahs-3127	398	11	,	,	PUNCT
ahs-3127	398	12	2012	2012	NUM
ahs-3127	398	13	ap2	ap2	PROPN
ahs-3127	398	14	/	/	SYM
ahs-3127	398	15	erf	erf	NOUN
ahs-3127	398	16	family	family	NOUN
ahs-3127	398	17	transcription	transcription	NOUN
ahs-3127	398	18	factors	factor	NOUN
ahs-3127	398	19	in	in	ADP
ahs-3127	398	20	plant	plant	NOUN
ahs-3127	398	21	abiotic	abiotic	ADJ
ahs-3127	398	22	stress	stress	NOUN
ahs-3127	398	23	responses	response	NOUN
ahs-3127	398	24	.	.	PUNCT
ahs-3127	399	1	biochim	biochim	NOUN
ahs-3127	399	2	.	.	PUNCT
ahs-3127	400	1	biophys	biophy	NOUN
ahs-3127	400	2	.	.	PUNCT
ahs-3127	401	1	acta	acta	PROPN
ahs-3127	401	2	,	,	PUNCT
ahs-3127	401	3	1819(2	1819(2	PROPN
ahs-3127	401	4	):	):	PUNCT
ahs-3127	401	5	8696	8696	NUM
ahs-3127	401	6	.	.	PUNCT
ahs-3127	402	1	molden	molden	PROPN
ahs-3127	402	2	d.	d.	PROPN
ahs-3127	402	3	,	,	PUNCT
ahs-3127	402	4	oweis	oweis	PROPN
ahs-3127	402	5	t.	t.	PROPN
ahs-3127	402	6	,	,	PUNCT
ahs-3127	402	7	steduto	steduto	PROPN
ahs-3127	402	8	p.	p.	PROPN
ahs-3127	402	9	,	,	PUNCT
ahs-3127	402	10	bindraban	bindraban	PROPN
ahs-3127	402	11	p.	p.	PROPN
ahs-3127	402	12	,	,	PUNCT
ahs-3127	402	13	hanjra	hanjra	PROPN
ahs-3127	402	14	m.a	m.a	PROPN
ahs-3127	402	15	.	.	PROPN
ahs-3127	402	16	,	,	PUNCT
ahs-3127	402	17	kijne	kijne	PROPN
ahs-3127	402	18	j.	j.	PROPN
ahs-3127	402	19	,	,	PUNCT
ahs-3127	402	20	2010	2010	NUM
ahs-3127	402	21	improving	improve	VERB
ahs-3127	402	22	agricultural	agricultural	ADJ
ahs-3127	402	23	water	water	NOUN
ahs-3127	402	24	productivity	productivity	NOUN
ahs-3127	402	25	:	:	PUNCT
ahs-3127	402	26	between	between	ADP
ahs-3127	402	27	optimism	optimism	NOUN
ahs-3127	402	28	and	and	CCONJ
ahs-3127	402	29	caution	caution	NOUN
ahs-3127	402	30	.	.	PUNCT
ahs-3127	403	1	agric	agric	PROPN
ahs-3127	403	2	.	.	PUNCT
ahs-3127	404	1	water	water	NOUN
ahs-3127	404	2	manage	manage	NOUN
ahs-3127	404	3	.	.	PUNCT
ahs-3127	404	4	,	,	PUNCT
ahs-3127	404	5	97(4	97(4	NUM
ahs-3127	404	6	):	):	PUNCT
ahs-3127	404	7	528	528	NUM
ahs-3127	404	8	-	-	SYM
ahs-3127	404	9	535	535	NUM
ahs-3127	404	10	.	.	PUNCT
ahs-3127	405	1	nepomuceno	nepomuceno	PROPN
ahs-3127	405	2	a.l	a.l	PROPN
ahs-3127	405	3	.	.	PROPN
ahs-3127	405	4	,	,	PUNCT
ahs-3127	405	5	oosterhuis	oosterhuis	PROPN
ahs-3127	405	6	d.	d.	PROPN
ahs-3127	405	7	,	,	PUNCT
ahs-3127	405	8	stewart	stewart	PROPN
ahs-3127	405	9	j.m	j.m	PROPN
ahs-3127	405	10	.	.	PROPN
ahs-3127	405	11	,	,	PUNCT
ahs-3127	405	12	turley	turley	PROPN
ahs-3127	405	13	r.	r.	PROPN
ahs-3127	405	14	,	,	PUNCT
ahs-3127	405	15	neumaier	neumai	ADJ
ahs-3127	405	16	n.	n.	PROPN
ahs-3127	405	17	,	,	PUNCT
ahs-3127	405	18	farias	farias	PROPN
ahs-3127	405	19	j.r.b	j.r.b	NOUN
ahs-3127	405	20	.	.	PROPN
ahs-3127	405	21	,	,	PUNCT
ahs-3127	405	22	2002	2002	NUM
ahs-3127	405	23	expression	expression	NOUN
ahs-3127	405	24	of	of	ADP
ahs-3127	405	25	heat	heat	NOUN
ahs-3127	405	26	shock	shock	NOUN
ahs-3127	405	27	protein	protein	NOUN
ahs-3127	405	28	and	and	CCONJ
ahs-3127	405	29	trehalose-6	trehalose-6	NOUN
ahs-3127	405	30	-	-	ADJ
ahs-3127	405	31	phosphate	phosphate	ADJ
ahs-3127	405	32	synthase	synthase	NOUN
ahs-3127	405	33	homologues	homologue	NOUN
ahs-3127	405	34	induced	induce	VERB
ahs-3127	405	35	during	during	ADP
ahs-3127	405	36	water	water	NOUN
ahs-3127	405	37	deficit	deficit	NOUN
ahs-3127	405	38	in	in	ADP
ahs-3127	405	39	cotton	cotton	NOUN
ahs-3127	405	40	.	.	PUNCT
ahs-3127	406	1	braz	braz	PROPN
ahs-3127	406	2	.	.	PUNCT
ahs-3127	407	1	j.	j.	PROPN
ahs-3127	407	2	plant	plant	PROPN
ahs-3127	407	3	physiol	physiol	PROPN
ahs-3127	407	4	.	.	PUNCT
ahs-3127	408	1	,	,	PUNCT
ahs-3127	408	2	14	14	NUM
ahs-3127	408	3	:	:	SYM
ahs-3127	408	4	11	11	NUM
ahs-3127	408	5	-	-	SYM
ahs-3127	408	6	20	20	NUM
ahs-3127	408	7	.	.	PUNCT
ahs-3127	409	1	oosterhuis	oosterhuis	PROPN
ahs-3127	409	2	d.m	d.m	PROPN
ahs-3127	409	3	.	.	PROPN
ahs-3127	409	4	,	,	PUNCT
ahs-3127	409	5	wullschleger	wullschleger	ADJ
ahs-3127	409	6	s.d	s.d	PROPN
ahs-3127	409	7	.	.	PROPN
ahs-3127	409	8	,	,	PUNCT
ahs-3127	409	9	1987	1987	NUM
ahs-3127	409	10	osmotic	osmotic	ADJ
ahs-3127	409	11	adjustment	adjustment	NOUN
ahs-3127	409	12	in	in	ADP
ahs-3127	409	13	cotton	cotton	NOUN
ahs-3127	409	14	(	(	PUNCT
ahs-3127	409	15	gossypium	gossypium	NOUN
ahs-3127	409	16	hirsutum	hirsutum	PROPN
ahs-3127	409	17	l.	l.	PROPN
ahs-3127	409	18	)	)	PUNCT
ahs-3127	409	19	leaves	leave	NOUN
ahs-3127	409	20	and	and	CCONJ
ahs-3127	409	21	roots	root	NOUN
ahs-3127	409	22	in	in	ADP
ahs-3127	409	23	response	response	NOUN
ahs-3127	409	24	to	to	ADP
ahs-3127	409	25	water	water	NOUN
ahs-3127	409	26	stress	stress	NOUN
ahs-3127	409	27	.	.	PUNCT
ahs-3127	410	1	plant	plant	NOUN
ahs-3127	410	2	physiol	physiol	PROPN
ahs-3127	410	3	.	.	PUNCT
ahs-3127	410	4	,	,	PUNCT
ahs-3127	410	5	84(4	84(4	NUM
ahs-3127	410	6	):	):	PUNCT
ahs-3127	410	7	1154	1154	NUM
ahs-3127	410	8	-	-	SYM
ahs-3127	410	9	1157	1157	NUM
ahs-3127	410	10	.	.	PUNCT
ahs-3127	411	1	oweis	oweis	PROPN
ahs-3127	411	2	t.y	t.y	PROPN
ahs-3127	411	3	.	.	PROPN
ahs-3127	411	4	,	,	PUNCT
ahs-3127	411	5	farahani	farahani	PROPN
ahs-3127	411	6	h.j	h.j	PROPN
ahs-3127	411	7	.	.	PROPN
ahs-3127	411	8	,	,	PUNCT
ahs-3127	411	9	hachum	hachum	PROPN
ahs-3127	411	10	a.y	a.y	PROPN
ahs-3127	411	11	.	.	PROPN
ahs-3127	411	12	,	,	PUNCT
ahs-3127	411	13	2011	2011	NUM
ahs-3127	411	14	evapotranspiration	evapotranspiration	NOUN
ahs-3127	411	15	and	and	CCONJ
ahs-3127	411	16	water	water	NOUN
ahs-3127	411	17	use	use	NOUN
ahs-3127	411	18	of	of	ADP
ahs-3127	411	19	full	full	ADJ
ahs-3127	411	20	and	and	CCONJ
ahs-3127	411	21	deficit	deficit	NOUN
ahs-3127	411	22	irrigated	irrigate	VERB
ahs-3127	411	23	cotton	cotton	NOUN
ahs-3127	411	24	in	in	ADP
ahs-3127	411	25	the	the	DET
ahs-3127	411	26	mediterranean	mediterranean	PROPN
ahs-3127	411	27	environment	environment	NOUN
ahs-3127	411	28	in	in	ADP
ahs-3127	411	29	northern	northern	ADJ
ahs-3127	411	30	syria	syria	PROPN
ahs-3127	411	31	.	.	PUNCT
ahs-3127	412	1	agric	agric	PROPN
ahs-3127	412	2	.	.	PUNCT
ahs-3127	413	1	water	water	NOUN
ahs-3127	413	2	manage	manage	NOUN
ahs-3127	413	3	.	.	PUNCT
ahs-3127	413	4	,	,	PUNCT
ahs-3127	413	5	98(8	98(8	NUM
ahs-3127	413	6	):	):	PUNCT
ahs-3127	413	7	12391248	12391248	NUM
ahs-3127	413	8	.	.	PUNCT
ahs-3127	414	1	padmalatha	padmalatha	PROPN
ahs-3127	414	2	k.v	k.v	PROPN
ahs-3127	414	3	.	.	PROPN
ahs-3127	414	4	,	,	PUNCT
ahs-3127	414	5	dhandapani	dhandapani	PROPN
ahs-3127	414	6	g.	g.	PROPN
ahs-3127	414	7	,	,	PUNCT
ahs-3127	414	8	kanakachari	kanakachari	PROPN
ahs-3127	414	9	m.	m.	NOUN
ahs-3127	414	10	,	,	PUNCT
ahs-3127	414	11	kumar	kumar	PROPN
ahs-3127	414	12	s.	s.	PROPN
ahs-3127	414	13	,	,	PUNCT
ahs-3127	414	14	dass	dass	PROPN
ahs-3127	414	15	a.	a.	PROPN
ahs-3127	414	16	,	,	PUNCT
ahs-3127	414	17	patil	patil	PROPN
ahs-3127	414	18	d.p	d.p	PROPN
ahs-3127	414	19	.	.	PROPN
ahs-3127	414	20	,	,	PUNCT
ahs-3127	414	21	rajamani	rajamani	PROPN
ahs-3127	414	22	v.	v.	PROPN
ahs-3127	414	23	,	,	PUNCT
ahs-3127	414	24	kumar	kumar	PROPN
ahs-3127	414	25	k.	k.	PROPN
ahs-3127	414	26	,	,	PUNCT
ahs-3127	414	27	pathak	pathak	PROPN
ahs-3127	414	28	r.	r.	PROPN
ahs-3127	414	29	,	,	PUNCT
ahs-3127	414	30	rawat	rawat	PROPN
ahs-3127	414	31	b.	b.	PROPN
ahs-3127	414	32	,	,	PUNCT
ahs-3127	414	33	leelavathi	leelavathi	PROPN
ahs-3127	414	34	s.	s.	PROPN
ahs-3127	414	35	,	,	PUNCT
ahs-3127	414	36	reddy	reddy	PROPN
ahs-3127	414	37	p.s	p.s	PROPN
ahs-3127	414	38	.	.	PROPN
ahs-3127	414	39	,	,	PUNCT
ahs-3127	414	40	jain	jain	PROPN
ahs-3127	414	41	n.	n.	PROPN
ahs-3127	414	42	,	,	PUNCT
ahs-3127	414	43	powar	powar	PROPN
ahs-3127	414	44	k.n	k.n	PROPN
ahs-3127	414	45	.	.	PROPN
ahs-3127	414	46	,	,	PUNCT
ahs-3127	414	47	hiremath	hiremath	PROPN
ahs-3127	414	48	v.	v.	PROPN
ahs-3127	414	49	,	,	PUNCT
ahs-3127	414	50	katageri	katageri	PROPN
ahs-3127	414	51	i.s	i.s	PROPN
ahs-3127	414	52	.	.	PROPN
ahs-3127	414	53	,	,	PUNCT
ahs-3127	414	54	reddy	reddy	PROPN
ahs-3127	414	55	m.k	m.k	PROPN
ahs-3127	414	56	.	.	PROPN
ahs-3127	414	57	,	,	PUNCT
ahs-3127	414	58	solanke	solanke	PROPN
ahs-3127	414	59	a.u	a.u	PROPN
ahs-3127	414	60	.	.	PROPN
ahs-3127	414	61	,	,	PUNCT
ahs-3127	414	62	reddy	reddy	PROPN
ahs-3127	414	63	v.s.	v.s.	PROPN
ahs-3127	414	64	,	,	PUNCT
ahs-3127	414	65	kumar	kumar	PROPN
ahs-3127	414	66	p.a	p.a	PROPN
ahs-3127	414	67	.	.	PROPN
ahs-3127	414	68	,	,	PUNCT
ahs-3127	414	69	2012	2012	NUM
ahs-3127	414	70	genome	genome	NOUN
ahs-3127	414	71	-	-	PUNCT
ahs-3127	414	72	wide	wide	ADJ
ahs-3127	414	73	transcriptomic	transcriptomic	ADJ
ahs-3127	414	74	analysis	analysis	NOUN
ahs-3127	414	75	of	of	ADP
ahs-3127	414	76	cotton	cotton	NOUN
ahs-3127	414	77	under	under	ADP
ahs-3127	414	78	drought	drought	NOUN
ahs-3127	414	79	stress	stress	NOUN
ahs-3127	414	80	reveal	reveal	VERB
ahs-3127	414	81	significant	significant	ADJ
ahs-3127	414	82	down	down	ADP
ahs-3127	414	83	-	-	PUNCT
ahs-3127	414	84	regulation	regulation	NOUN
ahs-3127	414	85	of	of	ADP
ahs-3127	414	86	genes	gene	NOUN
ahs-3127	414	87	and	and	CCONJ
ahs-3127	414	88	pathways	pathway	NOUN
ahs-3127	414	89	involved	involve	VERB
ahs-3127	414	90	in	in	ADP
ahs-3127	414	91	fibre	fibre	NOUN
ahs-3127	414	92	elongation	elongation	NOUN
ahs-3127	414	93	and	and	CCONJ
ahs-3127	414	94	up	up	ADP
ahs-3127	414	95	-	-	PUNCT
ahs-3127	414	96	regulation	regulation	NOUN
ahs-3127	414	97	of	of	ADP
ahs-3127	414	98	defense	defense	NOUN
ahs-3127	414	99	responsive	responsive	ADJ
ahs-3127	414	100	genes	gene	NOUN
ahs-3127	414	101	.	.	PUNCT
ahs-3127	415	1	plant	plant	NOUN
ahs-3127	415	2	mol	mol	PROPN
ahs-3127	415	3	.	.	PUNCT
ahs-3127	416	1	biol	biol	PROPN
ahs-3127	416	2	.	.	PUNCT
ahs-3127	416	3	,	,	PUNCT
ahs-3127	417	1	78(3	78(3	NUM
ahs-3127	417	2	):	):	PUNCT
ahs-3127	417	3	223	223	NUM
ahs-3127	417	4	-	-	SYM
ahs-3127	417	5	246	246	NUM
ahs-3127	417	6	.	.	PUNCT
ahs-3127	418	1	patanè	patanè	PROPN
ahs-3127	418	2	c.	c.	PROPN
ahs-3127	418	3	,	,	PUNCT
ahs-3127	418	4	tringali	tringali	PROPN
ahs-3127	418	5	s.	s.	PROPN
ahs-3127	418	6	,	,	PUNCT
ahs-3127	418	7	sortino	sortino	PROPN
ahs-3127	418	8	o.	o.	NOUN
ahs-3127	418	9	,	,	PUNCT
ahs-3127	418	10	2011	2011	NUM
ahs-3127	418	11	effects	effect	NOUN
ahs-3127	418	12	of	of	ADP
ahs-3127	418	13	deficit	deficit	NOUN
ahs-3127	418	14	irrigation	irrigation	NOUN
ahs-3127	418	15	on	on	ADP
ahs-3127	418	16	biomass	biomass	NOUN
ahs-3127	418	17	,	,	PUNCT
ahs-3127	418	18	yield	yield	NOUN
ahs-3127	418	19	,	,	PUNCT
ahs-3127	418	20	water	water	NOUN
ahs-3127	418	21	productivity	productivity	NOUN
ahs-3127	418	22	and	and	CCONJ
ahs-3127	418	23	fruit	fruit	NOUN
ahs-3127	418	24	quality	quality	NOUN
ahs-3127	418	25	of	of	ADP
ahs-3127	418	26	processing	processing	NOUN
ahs-3127	418	27	tomato	tomato	NOUN
ahs-3127	418	28	under	under	ADP
ahs-3127	418	29	semi	semi	ADJ
ahs-3127	418	30	-	-	ADJ
ahs-3127	418	31	arid	arid	ADJ
ahs-3127	418	32	mediterranean	mediterranean	ADJ
ahs-3127	418	33	climate	climate	NOUN
ahs-3127	418	34	conditions	condition	NOUN
ahs-3127	418	35	.	.	PUNCT
ahs-3127	419	1	sci	sci	PROPN
ahs-3127	419	2	.	.	PROPN
ahs-3127	419	3	hort	hort	PROPN
ahs-3127	419	4	.	.	PROPN
ahs-3127	419	5	,	,	PUNCT
ahs-3127	419	6	129(4	129(4	NUM
ahs-3127	419	7	):	):	PUNCT
ahs-3127	419	8	590	590	NUM
ahs-3127	419	9	-	-	SYM
ahs-3127	419	10	596	596	NUM
ahs-3127	419	11	.	.	PUNCT
ahs-3127	420	1	reddy	reddy	PROPN
ahs-3127	420	2	a.r	a.r	PROPN
ahs-3127	420	3	.	.	PROPN
ahs-3127	420	4	,	,	PUNCT
ahs-3127	420	5	chaitanya	chaitanya	PROPN
ahs-3127	420	6	k.v	k.v	PROPN
ahs-3127	420	7	.	.	PROPN
ahs-3127	420	8	,	,	PUNCT
ahs-3127	420	9	vivekanandan	vivekanandan	PROPN
ahs-3127	420	10	m.	m.	PROPN
ahs-3127	420	11	,	,	PUNCT
ahs-3127	420	12	2004	2004	NUM
ahs-3127	420	13	drought	drought	NOUN
ahs-3127	420	14	-	-	PUNCT
ahs-3127	420	15	induced	induce	VERB
ahs-3127	420	16	responses	response	NOUN
ahs-3127	420	17	of	of	ADP
ahs-3127	420	18	photosynthesis	photosynthesis	NOUN
ahs-3127	420	19	and	and	CCONJ
ahs-3127	420	20	antioxidant	antioxidant	ADJ
ahs-3127	420	21	metabolism	metabolism	NOUN
ahs-3127	420	22	in	in	ADP
ahs-3127	420	23	higher	high	ADJ
ahs-3127	420	24	plants	plant	NOUN
ahs-3127	420	25	.	.	PUNCT
ahs-3127	421	1	j.	j.	PROPN
ahs-3127	421	2	plant	plant	PROPN
ahs-3127	421	3	physiol	physiol	PROPN
ahs-3127	421	4	.	.	PUNCT
ahs-3127	421	5	,	,	PUNCT
ahs-3127	421	6	161(11	161(11	NUM
ahs-3127	421	7	):	):	PUNCT
ahs-3127	421	8	1189	1189	NUM
ahs-3127	421	9	-	-	SYM
ahs-3127	421	10	1202	1202	NUM
ahs-3127	421	11	.	.	PUNCT
ahs-3127	422	1	riaz	riaz	PROPN
ahs-3127	422	2	m.	m.	PROPN
ahs-3127	422	3	,	,	PUNCT
ahs-3127	422	4	farooq	farooq	PROPN
ahs-3127	422	5	j.	j.	PROPN
ahs-3127	422	6	,	,	PUNCT
ahs-3127	422	7	sakhawat	sakhawat	PROPN
ahs-3127	422	8	g.	g.	PROPN
ahs-3127	422	9	,	,	PUNCT
ahs-3127	422	10	mahmood	mahmood	PROPN
ahs-3127	422	11	a.	a.	PROPN
ahs-3127	422	12	,	,	PUNCT
ahs-3127	422	13	sadiq	sadiq	PROPN
ahs-3127	422	14	m.a	m.a	PROPN
ahs-3127	422	15	.	.	PROPN
ahs-3127	422	16	,	,	PUNCT
ahs-3127	422	17	yaseen	yaseen	PROPN
ahs-3127	422	18	m.	m.	NOUN
ahs-3127	422	19	,	,	PUNCT
ahs-3127	422	20	2013	2013	NUM
ahs-3127	422	21	genotypic	genotypic	NOUN
ahs-3127	422	22	variability	variability	NOUN
ahs-3127	422	23	for	for	ADP
ahs-3127	422	24	root	root	NOUN
ahs-3127	422	25	/	/	SYM
ahs-3127	422	26	shoot	shoot	NOUN
ahs-3127	422	27	parameters	parameter	NOUN
ahs-3127	422	28	under	under	ADP
ahs-3127	422	29	water	water	NOUN
ahs-3127	422	30	stress	stress	NOUN
ahs-3127	422	31	in	in	ADP
ahs-3127	422	32	some	some	DET
ahs-3127	422	33	advanced	advanced	ADJ
ahs-3127	422	34	lines	line	NOUN
ahs-3127	422	35	of	of	ADP
ahs-3127	422	36	cotton	cotton	NOUN
ahs-3127	422	37	(	(	PUNCT
ahs-3127	422	38	gossypium	gossypium	NOUN
ahs-3127	422	39	hirsutum	hirsutum	PROPN
ahs-3127	422	40	l.	l.	PROPN
ahs-3127	422	41	)	)	PUNCT
ahs-3127	422	42	.	.	PUNCT
ahs-3127	423	1	genet	genet	PROPN
ahs-3127	423	2	.	.	PUNCT
ahs-3127	424	1	mol	mol	PROPN
ahs-3127	424	2	.	.	PUNCT
ahs-3127	425	1	res	res	PROPN
ahs-3127	425	2	.	.	PROPN
ahs-3127	425	3	,	,	PUNCT
ahs-3127	425	4	12(1	12(1	NUM
ahs-3127	425	5	):	):	PUNCT
ahs-3127	425	6	552	552	NUM
ahs-3127	425	7	-	-	SYM
ahs-3127	425	8	561	561	NUM
ahs-3127	425	9	.	.	PUNCT
ahs-3127	426	1	schmalenbach	schmalenbach	PROPN
ahs-3127	426	2	i.	i.	PROPN
ahs-3127	426	3	,	,	PUNCT
ahs-3127	426	4	zhang	zhang	PROPN
ahs-3127	426	5	l.	l.	PROPN
ahs-3127	426	6	,	,	PUNCT
ahs-3127	426	7	reymond	reymond	NOUN
ahs-3127	426	8	m.	m.	NOUN
ahs-3127	426	9	,	,	PUNCT
ahs-3127	426	10	jimenezgomez	jimenezgomez	NOUN
ahs-3127	426	11	j.m	j.m	PROPN
ahs-3127	426	12	.	.	PROPN
ahs-3127	426	13	,	,	PUNCT
ahs-3127	426	14	2014	2014	NUM
ahs-3127	426	15	the	the	DET
ahs-3127	426	16	relationship	relationship	NOUN
ahs-3127	426	17	between	between	ADP
ahs-3127	426	18	flowering	flowering	NOUN
ahs-3127	426	19	time	time	NOUN
ahs-3127	426	20	and	and	CCONJ
ahs-3127	426	21	growth	growth	NOUN
ahs-3127	426	22	responses	response	NOUN
ahs-3127	426	23	to	to	ADP
ahs-3127	426	24	drought	drought	NOUN
ahs-3127	426	25	in	in	ADP
ahs-3127	426	26	the	the	DET
ahs-3127	426	27	arabidopsis	arabidopsis	NOUN
ahs-3127	426	28	landsberg	landsberg	ADV
ahs-3127	426	29	erecta	erecta	PROPN
ahs-3127	426	30	x	x	X
ahs-3127	426	31	antwerp-1	antwerp-1	NUM
ahs-3127	426	32	population	population	NOUN
ahs-3127	426	33	.	.	PUNCT
ahs-3127	427	1	front	front	ADJ
ahs-3127	427	2	.	.	PUNCT
ahs-3127	428	1	plant	plant	NOUN
ahs-3127	428	2	sci	sci	PROPN
ahs-3127	428	3	.	.	PROPN
ahs-3127	428	4	,	,	PUNCT
ahs-3127	428	5	5	5	NUM
ahs-3127	428	6	sekmen	sekman	NOUN
ahs-3127	428	7	a.h	a.h	PROPN
ahs-3127	428	8	.	.	PROPN
ahs-3127	428	9	,	,	PUNCT
ahs-3127	428	10	ozgur	ozgur	PROPN
ahs-3127	428	11	r.	r.	PROPN
ahs-3127	428	12	,	,	PUNCT
ahs-3127	428	13	uzilday	uzilday	PROPN
ahs-3127	428	14	b.	b.	PROPN
ahs-3127	428	15	,	,	PUNCT
ahs-3127	428	16	turkan	turkan	PROPN
ahs-3127	428	17	i.	i.	PROPN
ahs-3127	428	18	,	,	PUNCT
ahs-3127	428	19	2014	2014	NUM
ahs-3127	428	20	reactive	reactive	ADJ
ahs-3127	428	21	oxygen	oxygen	NOUN
ahs-3127	428	22	species	specie	NOUN
ahs-3127	428	23	scavenging	scavenge	VERB
ahs-3127	428	24	capacities	capacity	NOUN
ahs-3127	428	25	of	of	ADP
ahs-3127	428	26	cotton	cotton	NOUN
ahs-3127	428	27	(	(	PUNCT
ahs-3127	428	28	gossypium	gossypium	NOUN
ahs-3127	428	29	hirsutum	hirsutum	NOUN
ahs-3127	428	30	)	)	PUNCT
ahs-3127	428	31	cultivars	cultivar	NOUN
ahs-3127	428	32	under	under	ADP
ahs-3127	428	33	combined	combined	ADJ
ahs-3127	428	34	drought	drought	NOUN
ahs-3127	428	35	and	and	CCONJ
ahs-3127	428	36	heat	heat	NOUN
ahs-3127	428	37	induced	induce	VERB
ahs-3127	428	38	oxidative	oxidative	ADJ
ahs-3127	428	39	stress	stress	NOUN
ahs-3127	428	40	.	.	PUNCT
ahs-3127	429	1	environ	environ	PROPN
ahs-3127	429	2	.	.	PUNCT
ahs-3127	429	3	exp	exp	NOUN
ahs-3127	429	4	.	.	PUNCT
ahs-3127	429	5	botany	botany	NOUN
ahs-3127	429	6	,	,	PUNCT
ahs-3127	429	7	99(0	99(0	NUM
ahs-3127	429	8	):	):	PUNCT
ahs-3127	429	9	141	141	NUM
ahs-3127	429	10	-	-	SYM
ahs-3127	429	11	149	149	NUM
ahs-3127	429	12	.	.	PUNCT
ahs-3127	430	1	shiqing	shiqe	VERB
ahs-3127	430	2	g.	g.	PROPN
ahs-3127	430	3	,	,	PUNCT
ahs-3127	430	4	huijun	huijun	PROPN
ahs-3127	430	5	x.	x.	PROPN
ahs-3127	430	6	,	,	PUNCT
ahs-3127	430	7	xianguo	xianguo	PROPN
ahs-3127	430	8	c.	c.	PROPN
ahs-3127	430	9	,	,	PUNCT
ahs-3127	430	10	ming	ming	PROPN
ahs-3127	430	11	c.	c.	PROPN
ahs-3127	430	12	,	,	PUNCT
ahs-3127	430	13	zhaoshi	zhaoshi	PROPN
ahs-3127	430	14	x.	x.	PROPN
ahs-3127	430	15	,	,	PUNCT
ahs-3127	430	16	liancheng	liancheng	PROPN
ahs-3127	430	17	l.	l.	PROPN
ahs-3127	430	18	,	,	PUNCT
ahs-3127	430	19	xingguo	xingguo	PROPN
ahs-3127	430	20	y.	y.	PROPN
ahs-3127	430	21	,	,	PUNCT
ahs-3127	430	22	lipu	lipu	PROPN
ahs-3127	430	23	d.	d.	PROPN
ahs-3127	430	24	,	,	PUNCT
ahs-3127	430	25	xiaoyan	xiaoyan	PROPN
ahs-3127	430	26	h.	h.	PROPN
ahs-3127	430	27	,	,	PUNCT
ahs-3127	430	28	youzhi	youzhi	PROPN
ahs-3127	430	29	m.	m.	NOUN
ahs-3127	430	30	,	,	PUNCT
ahs-3127	430	31	2005	2005	NUM
ahs-3127	430	32	improvement	improvement	NOUN
ahs-3127	430	33	of	of	ADP
ahs-3127	430	34	wheat	wheat	NOUN
ahs-3127	430	35	drought	drought	NOUN
ahs-3127	430	36	and	and	CCONJ
ahs-3127	430	37	salt	salt	NOUN
ahs-3127	430	38	tolerance	tolerance	NOUN
ahs-3127	430	39	by	by	ADP
ahs-3127	430	40	expression	expression	NOUN
ahs-3127	430	41	of	of	ADP
ahs-3127	430	42	a	a	DET
ahs-3127	430	43	stress	stress	NOUN
ahs-3127	430	44	-	-	PUNCT
ahs-3127	430	45	inducible	inducible	ADJ
ahs-3127	430	46	transcription	transcription	NOUN
ahs-3127	430	47	factorgmdreb	factorgmdreb	NOUN
ahs-3127	430	48	of	of	ADP
ahs-3127	430	49	soybean	soybean	NOUN
ahs-3127	430	50	(	(	PUNCT
ahs-3127	430	51	glycine	glycine	NOUN
ahs-3127	430	52	max	max	PROPN
ahs-3127	430	53	)	)	PUNCT
ahs-3127	430	54	.	.	PUNCT
ahs-3127	431	1	chin	chin	PROPN
ahs-3127	431	2	.	.	PUNCT
ahs-3127	432	1	sci	sci	PROPN
ahs-3127	432	2	.	.	PUNCT
ahs-3127	432	3	bull	bull	PROPN
ahs-3127	432	4	.	.	PUNCT
ahs-3127	432	5	,	,	PUNCT
ahs-3127	433	1	50(23	50(23	NOUN
ahs-3127	433	2	):	):	PUNCT
ahs-3127	433	3	2714	2714	NUM
ahs-3127	433	4	-	-	SYM
ahs-3127	433	5	2723	2723	NUM
ahs-3127	433	6	.	.	PUNCT
ahs-3127	434	1	sotirios	sotirios	PROPN
ahs-3127	434	2	k.	k.	PROPN
ahs-3127	434	3	,	,	PUNCT
ahs-3127	434	4	argyrokastritis	argyrokastritis	PROPN
ahs-3127	434	5	a.	a.	NOUN
ahs-3127	434	6	,	,	PUNCT
ahs-3127	434	7	loukas	loukas	PROPN
ahs-3127	434	8	m.	m.	NOUN
ahs-3127	434	9	,	,	PUNCT
ahs-3127	434	10	eliopoulos	eliopoulos	PROPN
ahs-3127	434	11	e.	e.	PROPN
ahs-3127	434	12	,	,	PUNCT
ahs-3127	434	13	tsakas	tsakas	PROPN
ahs-3127	434	14	s.	s.	PROPN
ahs-3127	434	15	,	,	PUNCT
ahs-3127	434	16	kaltsikes	kaltsikes	PROPN
ahs-3127	434	17	p.	p.	PROPN
ahs-3127	434	18	,	,	PUNCT
ahs-3127	434	19	2006	2006	NUM
ahs-3127	434	20	isolation	isolation	NOUN
ahs-3127	434	21	and	and	CCONJ
ahs-3127	434	22	characterization	characterization	NOUN
ahs-3127	434	23	of	of	ADP
ahs-3127	434	24	stress	stress	NOUN
ahs-3127	434	25	related	relate	VERB
ahs-3127	434	26	heat	heat	NOUN
ahs-3127	434	27	shock	shock	NOUN
ahs-3127	434	28	protein	protein	NOUN
ahs-3127	434	29	calmodulin	calmodulin	NOUN
ahs-3127	434	30	bindinggene	bindinggene	NOUN
ahs-3127	434	31	from	from	ADP
ahs-3127	434	32	cultivated	cultivate	VERB
ahs-3127	434	33	cotton	cotton	NOUN
ahs-3127	434	34	(	(	PUNCT
ahs-3127	434	35	gossypium	gossypium	NOUN
ahs-3127	434	36	hirsutum	hirsutum	PROPN
ahs-3127	434	37	l.	l.	PROPN
ahs-3127	434	38	)	)	PUNCT
ahs-3127	434	39	.	.	PUNCT
ahs-3127	435	1	euphytica	euphytica	PROPN
ahs-3127	435	2	,	,	PUNCT
ahs-3127	435	3	147(3	147(3	NUM
ahs-3127	435	4	):	):	PUNCT
ahs-3127	435	5	343	343	NUM
ahs-3127	435	6	-	-	SYM
ahs-3127	435	7	351	351	NUM
ahs-3127	435	8	.	.	PUNCT
ahs-3127	436	1	su	su	PROPN
ahs-3127	436	2	z.	z.	PROPN
ahs-3127	436	3	,	,	PUNCT
ahs-3127	436	4	ma	ma	PROPN
ahs-3127	436	5	x.	x.	PROPN
ahs-3127	436	6	,	,	PUNCT
ahs-3127	436	7	guo	guo	PROPN
ahs-3127	436	8	h.	h.	PROPN
ahs-3127	436	9	,	,	PUNCT
ahs-3127	436	10	sukiran	sukiran	PROPN
ahs-3127	436	11	n.l	n.l	PROPN
ahs-3127	436	12	.	.	PROPN
ahs-3127	436	13	,	,	PUNCT
ahs-3127	436	14	guo	guo	PROPN
ahs-3127	436	15	b.	b.	PROPN
ahs-3127	436	16	,	,	PUNCT
ahs-3127	436	17	assmann	assmann	PROPN
ahs-3127	436	18	s.m	s.m	PROPN
ahs-3127	436	19	.	.	PROPN
ahs-3127	436	20	,	,	PUNCT
ahs-3127	436	21	ma	ma	PROPN
ahs-3127	436	22	h.	h.	PROPN
ahs-3127	436	23	,	,	PUNCT
ahs-3127	436	24	2013	2013	NUM
ahs-3127	436	25	flower	flower	NOUN
ahs-3127	436	26	development	development	NOUN
ahs-3127	436	27	under	under	ADP
ahs-3127	436	28	drought	drought	NOUN
ahs-3127	436	29	stress	stress	NOUN
ahs-3127	436	30	:	:	PUNCT
ahs-3127	436	31	morphological	morphological	ADJ
ahs-3127	436	32	and	and	CCONJ
ahs-3127	436	33	transcriptomic	transcriptomic	ADJ
ahs-3127	436	34	analyses	analysis	NOUN
ahs-3127	436	35	reveal	reveal	VERB
ahs-3127	436	36	acute	acute	ADJ
ahs-3127	436	37	responses	response	NOUN
ahs-3127	436	38	and	and	CCONJ
ahs-3127	436	39	long	long	ADJ
ahs-3127	436	40	-	-	PUNCT
ahs-3127	436	41	term	term	NOUN
ahs-3127	436	42	acclimation	acclimation	NOUN
ahs-3127	436	43	in	in	ADP
ahs-3127	436	44	arabidopsis	arabidopsis	NOUN
ahs-3127	436	45	.	.	PUNCT
ahs-3127	437	1	plant	plant	NOUN
ahs-3127	437	2	cell	cell	NOUN
ahs-3127	437	3	,	,	PUNCT
ahs-3127	437	4	25(10	25(10	NUM
ahs-3127	437	5	):	):	PUNCT
ahs-3127	437	6	3785	3785	NUM
ahs-3127	437	7	-	-	SYM
ahs-3127	437	8	3807	3807	NUM
ahs-3127	437	9	.	.	PUNCT
ahs-3127	438	1	tuberosa	tuberosa	PROPN
ahs-3127	438	2	r.	r.	PROPN
ahs-3127	438	3	,	,	PUNCT
ahs-3127	438	4	salvi	salvi	PROPN
ahs-3127	438	5	s.	s.	PROPN
ahs-3127	438	6	,	,	PUNCT
ahs-3127	438	7	2006	2006	NUM
ahs-3127	438	8	genomics	genomics	NOUN
ahs-3127	438	9	-	-	PUNCT
ahs-3127	438	10	based	base	VERB
ahs-3127	438	11	approaches	approach	NOUN
ahs-3127	438	12	to	to	PART
ahs-3127	438	13	improve	improve	VERB
ahs-3127	438	14	drought	drought	NOUN
ahs-3127	438	15	tolerance	tolerance	NOUN
ahs-3127	438	16	of	of	ADP
ahs-3127	438	17	crops	crop	NOUN
ahs-3127	438	18	.	.	PUNCT
ahs-3127	439	1	trends	trend	NOUN
ahs-3127	439	2	plant	plant	VERB
ahs-3127	439	3	sci	sci	PROPN
ahs-3127	439	4	.	.	PROPN
ahs-3127	439	5	,	,	PUNCT
ahs-3127	439	6	11(8	11(8	NUM
ahs-3127	439	7	):	):	PUNCT
ahs-3127	439	8	405	405	NUM
ahs-3127	439	9	-	-	SYM
ahs-3127	439	10	412	412	NUM
ahs-3127	439	11	.	.	PUNCT
ahs-3127	440	1	ünlü	ünlü	PROPN
ahs-3127	440	2	m.	m.	NOUN
ahs-3127	440	3	,	,	PUNCT
ahs-3127	440	4	kanber	kanber	PROPN
ahs-3127	440	5	r.	r.	PROPN
ahs-3127	440	6	,	,	PUNCT
ahs-3127	440	7	koç	koç	PROPN
ahs-3127	440	8	d.l	d.l	PROPN
ahs-3127	440	9	.	.	PROPN
ahs-3127	440	10	,	,	PUNCT
ahs-3127	440	11	tekin	tekin	PROPN
ahs-3127	440	12	s.	s.	PROPN
ahs-3127	440	13	,	,	PUNCT
ahs-3127	440	14	kapur	kapur	PROPN
ahs-3127	440	15	b.	b.	PROPN
ahs-3127	440	16	,	,	PUNCT
ahs-3127	440	17	2011	2011	NUM
ahs-3127	440	18	effects	effect	NOUN
ahs-3127	440	19	of	of	ADP
ahs-3127	440	20	deficit	deficit	NOUN
ahs-3127	440	21	irrigation	irrigation	NOUN
ahs-3127	440	22	on	on	ADP
ahs-3127	440	23	the	the	DET
ahs-3127	440	24	yield	yield	NOUN
ahs-3127	440	25	and	and	CCONJ
ahs-3127	440	26	yield	yield	VERB
ahs-3127	440	27	components	component	NOUN
ahs-3127	440	28	of	of	ADP
ahs-3127	440	29	drip	drip	NOUN
ahs-3127	440	30	irrigated	irrigate	VERB
ahs-3127	440	31	cotton	cotton	NOUN
ahs-3127	440	32	in	in	ADP
ahs-3127	440	33	a	a	DET
ahs-3127	440	34	mediterranean	mediterranean	PROPN
ahs-3127	440	35	environment	environment	NOUN
ahs-3127	440	36	.	.	PUNCT
ahs-3127	441	1	agric	agric	PROPN
ahs-3127	441	2	.	.	PUNCT
ahs-3127	442	1	water	water	NOUN
ahs-3127	442	2	manage	manage	NOUN
ahs-3127	442	3	.	.	PUNCT
ahs-3127	442	4	,	,	PUNCT
ahs-3127	442	5	98(4	98(4	NUM
ahs-3127	442	6	):	):	PUNCT
ahs-3127	442	7	597	597	NUM
ahs-3127	442	8	-	-	SYM
ahs-3127	442	9	605	605	NUM
ahs-3127	442	10	.	.	PUNCT
ahs-3127	443	1	voloudakis	voloudakis	PROPN
ahs-3127	443	2	a.e	a.e	PROPN
ahs-3127	443	3	.	.	PROPN
ahs-3127	443	4	,	,	PUNCT
ahs-3127	443	5	kosmas	kosmas	PROPN
ahs-3127	443	6	s.a	s.a	PROPN
ahs-3127	443	7	.	.	PROPN
ahs-3127	443	8	,	,	PUNCT
ahs-3127	443	9	tsakas	tsakas	PROPN
ahs-3127	443	10	s.	s.	PROPN
ahs-3127	443	11	,	,	PUNCT
ahs-3127	443	12	eliopoulos	eliopoulos	PROPN
ahs-3127	443	13	e.	e.	PROPN
ahs-3127	443	14	,	,	PUNCT
ahs-3127	443	15	loukas	loukas	PROPN
ahs-3127	443	16	m.	m.	NOUN
ahs-3127	443	17	,	,	PUNCT
ahs-3127	443	18	kosmidou	kosmidou	PROPN
ahs-3127	443	19	k.	k.	PROPN
ahs-3127	443	20	,	,	PUNCT
ahs-3127	443	21	2002	2002	NUM
ahs-3127	443	22	expression	expression	NOUN
ahs-3127	443	23	of	of	ADP
ahs-3127	443	24	selected	select	VERB
ahs-3127	443	25	drought	drought	NOUN
ahs-3127	443	26	-	-	PUNCT
ahs-3127	443	27	related	relate	VERB
ahs-3127	443	28	genes	gene	NOUN
ahs-3127	443	29	and	and	CCONJ
ahs-3127	443	30	physiological	physiological	ADJ
ahs-3127	443	31	response	response	NOUN
ahs-3127	443	32	of	of	ADP
ahs-3127	443	33	greek	greek	ADJ
ahs-3127	443	34	cotton	cotton	NOUN
ahs-3127	443	35	varieties	variety	NOUN
ahs-3127	443	36	.	.	PUNCT
ahs-3127	444	1	funct	funct	ADJ
ahs-3127	444	2	.	.	PUNCT
ahs-3127	445	1	plant	plant	NOUN
ahs-3127	445	2	biol	biol	PROPN
ahs-3127	445	3	.	.	PUNCT
ahs-3127	445	4	,	,	PUNCT
ahs-3127	445	5	29(10	29(10	NUM
ahs-3127	445	6	):	):	PUNCT
ahs-3127	445	7	1237	1237	NUM
ahs-3127	445	8	-	-	SYM
ahs-3127	445	9	1245	1245	NUM
ahs-3127	445	10	.	.	PUNCT
ahs-3127	446	1	wada	wada	PROPN
ahs-3127	446	2	k.c	k.c	PROPN
ahs-3127	446	3	.	.	PROPN
ahs-3127	446	4	,	,	PUNCT
ahs-3127	446	5	takeno	takeno	PROPN
ahs-3127	446	6	k.	k.	PROPN
ahs-3127	446	7	,	,	PUNCT
ahs-3127	446	8	2010	2010	NUM
ahs-3127	446	9	stress	stress	NOUN
ahs-3127	446	10	-	-	PUNCT
ahs-3127	446	11	induced	induce	VERB
ahs-3127	446	12	flowering	flowering	NOUN
ahs-3127	446	13	.	.	PUNCT
ahs-3127	447	1	plant	plant	NOUN
ahs-3127	447	2	signal	signal	NOUN
ahs-3127	447	3	behav	behav	NOUN
ahs-3127	447	4	,	,	PUNCT
ahs-3127	447	5	5(8	5(8	NUM
ahs-3127	447	6	):	):	PUNCT
ahs-3127	447	7	944	944	NUM
ahs-3127	447	8	-	-	SYM
ahs-3127	447	9	947	947	NUM
ahs-3127	447	10	.	.	PUNCT
ahs-3127	448	1	wakelyin	wakelyin	PROPN
ahs-3127	449	1	p.h	p.h	PROPN
ahs-3127	449	2	.	.	PROPN
ahs-3127	449	3	,	,	PUNCT
ahs-3127	449	4	2006	2006	NUM
ahs-3127	449	5	cotton	cotton	NOUN
ahs-3127	449	6	fiber	fiber	NOUN
ahs-3127	449	7	chemistry	chemistry	NOUN
ahs-3127	449	8	and	and	CCONJ
ahs-3127	449	9	technology	technology	NOUN
ahs-3127	449	10	.	.	PUNCT
ahs-3127	450	1	crc	crc	PROPN
ahs-3127	450	2	press	press	PROPN
ahs-3127	450	3	,	,	PUNCT
ahs-3127	450	4	boca	boca	PROPN
ahs-3127	450	5	raton	raton	PROPN
ahs-3127	450	6	,	,	PUNCT
ahs-3127	450	7	fl	fl	PROPN
ahs-3127	450	8	,	,	PUNCT
ahs-3127	450	9	usa	usa	PROPN
ahs-3127	450	10	,	,	PUNCT
ahs-3127	450	11	pp	pp	X
ahs-3127	450	12	.	.	PUNCT
ahs-3127	451	1	123	123	NUM
ahs-3127	451	2	.	.	PUNCT
ahs-3127	452	1	wang	wang	PROPN
ahs-3127	452	2	m.	m.	PROPN
ahs-3127	452	3	,	,	PUNCT
ahs-3127	452	4	wang	wang	PROPN
ahs-3127	452	5	q.	q.	PROPN
ahs-3127	452	6	,	,	PUNCT
ahs-3127	452	7	zhang	zhang	PROPN
ahs-3127	452	8	b.	b.	PROPN
ahs-3127	452	9	,	,	PUNCT
ahs-3127	452	10	2013	2013	NUM
ahs-3127	452	11	response	response	NOUN
ahs-3127	452	12	of	of	ADP
ahs-3127	452	13	mirnas	mirna	NOUN
ahs-3127	452	14	and	and	CCONJ
ahs-3127	452	15	their	their	PRON
ahs-3127	452	16	targets	target	NOUN
ahs-3127	452	17	to	to	PART
ahs-3127	452	18	salt	salt	NOUN
ahs-3127	452	19	and	and	CCONJ
ahs-3127	452	20	drought	drought	NOUN
ahs-3127	452	21	stresses	stress	NOUN
ahs-3127	452	22	in	in	ADP
ahs-3127	452	23	cotton	cotton	NOUN
ahs-3127	452	24	(	(	PUNCT
ahs-3127	452	25	gossypium	gossypium	NOUN
ahs-3127	452	26	hirsutum	hirsutum	PROPN
ahs-3127	452	27	l.	l.	PROPN
ahs-3127	452	28	)	)	PUNCT
ahs-3127	452	29	.	.	PUNCT
ahs-3127	453	1	gene	gene	NOUN
ahs-3127	453	2	,	,	PUNCT
ahs-3127	453	3	530(1	530(1	NUM
ahs-3127	453	4	):	):	PUNCT
ahs-3127	453	5	2632	2632	NUM
ahs-3127	453	6	.	.	PUNCT
ahs-3127	454	1	wang	wang	PROPN
ahs-3127	454	2	x.	x.	PROPN
ahs-3127	454	3	,	,	PUNCT
ahs-3127	454	4	zhang	zhang	PROPN
ahs-3127	454	5	l.	l.	PROPN
ahs-3127	454	6	,	,	PUNCT
ahs-3127	454	7	evers	evers	PROPN
ahs-3127	454	8	j.b	j.b	PROPN
ahs-3127	454	9	.	.	PROPN
ahs-3127	454	10	,	,	PUNCT
ahs-3127	454	11	mao	mao	PROPN
ahs-3127	454	12	l.	l.	PROPN
ahs-3127	454	13	,	,	PUNCT
ahs-3127	454	14	wei	wei	PROPN
ahs-3127	454	15	s.	s.	PROPN
ahs-3127	454	16	,	,	PUNCT
ahs-3127	454	17	pan	pan	PROPN
ahs-3127	454	18	x.	x.	PROPN
ahs-3127	454	19	,	,	PUNCT
ahs-3127	454	20	zhao	zhao	PROPN
ahs-3127	454	21	x.	x.	PROPN
ahs-3127	454	22	,	,	PUNCT
ahs-3127	454	23	van	van	PROPN
ahs-3127	454	24	der	der	PROPN
ahs-3127	454	25	werf	werf	PROPN
ahs-3127	454	26	w.	w.	PROPN
ahs-3127	454	27	,	,	PUNCT
ahs-3127	454	28	li	li	PROPN
ahs-3127	454	29	z.	z.	PROPN
ahs-3127	454	30	,	,	PUNCT
ahs-3127	454	31	2014	2014	NUM
ahs-3127	454	32	predicting	predict	VERB
ahs-3127	454	33	the	the	DET
ahs-3127	454	34	effects	effect	NOUN
ahs-3127	454	35	of	of	ADP
ahs-3127	454	36	environment	environment	NOUN
ahs-3127	454	37	and	and	CCONJ
ahs-3127	454	38	management	management	NOUN
ahs-3127	454	39	on	on	ADP
ahs-3127	454	40	cotton	cotton	NOUN
ahs-3127	454	41	fibre	fibre	NOUN
ahs-3127	454	42	growth	growth	NOUN
ahs-3127	454	43	and	and	CCONJ
ahs-3127	454	44	quality	quality	NOUN
ahs-3127	454	45	:	:	PUNCT
ahs-3127	454	46	a	a	DET
ahs-3127	454	47	functional	functional	ADJ
ahs-3127	454	48	-	-	PUNCT
ahs-3127	454	49	structural	structural	ADJ
ahs-3127	454	50	plant	plant	NOUN
ahs-3127	454	51	modelling	modelling	NOUN
ahs-3127	454	52	approach	approach	NOUN
ahs-3127	454	53	.	.	PUNCT
ahs-3127	455	1	aob	aob	PROPN
ahs-3127	455	2	plants	plant	NOUN
ahs-3127	455	3	,	,	PUNCT
ahs-3127	455	4	6	6	NUM
ahs-3127	455	5	(	(	PUNCT
ahs-3127	455	6	0	0	NUM
ahs-3127	455	7	):	):	PUNCT
ahs-3127	455	8	plu040-	plu040-	PROPN
ahs-3127	455	9	.	.	PUNCT
ahs-3127	456	1	wang	wang	PROPN
ahs-3127	456	2	y.	y.	PROPN
ahs-3127	456	3	,	,	PUNCT
ahs-3127	456	4	shu	shu	PROPN
ahs-3127	456	5	h.	h.	PROPN
ahs-3127	456	6	,	,	PUNCT
ahs-3127	456	7	chen	chen	PROPN
ahs-3127	456	8	b.	b.	PROPN
ahs-3127	456	9	,	,	PUNCT
ahs-3127	456	10	mcgiffen	mcgiffen	PROPN
ahs-3127	456	11	m.	m.	PROPN
ahs-3127	456	12	jr	jr	PROPN
ahs-3127	456	13	.	.	PROPN
ahs-3127	456	14	,	,	PUNCT
ahs-3127	456	15	zhang	zhang	PROPN
ahs-3127	456	16	w.	w.	PROPN
ahs-3127	456	17	,	,	PUNCT
ahs-3127	456	18	xu	xu	PROPN
ahs-3127	457	1	n.	n.	PROPN
ahs-3127	457	2	,	,	PUNCT
ahs-3127	457	3	zhou	zhou	PROPN
ahs-3127	457	4	z.	z.	PROPN
ahs-3127	457	5	,	,	PUNCT
ahs-3127	457	6	2009	2009	NUM
ahs-3127	457	7	the	the	DET
ahs-3127	457	8	rate	rate	NOUN
ahs-3127	457	9	of	of	ADP
ahs-3127	457	10	cellulose	cellulose	NOUN
ahs-3127	457	11	increase	increase	NOUN
ahs-3127	457	12	is	be	AUX
ahs-3127	457	13	highly	highly	ADV
ahs-3127	457	14	related	related	ADJ
ahs-3127	457	15	to	to	ADP
ahs-3127	457	16	cotton	cotton	NOUN
ahs-3127	457	17	fibre	fibre	NOUN
ahs-3127	457	18	strength	strength	NOUN
ahs-3127	457	19	and	and	CCONJ
ahs-3127	457	20	is	be	AUX
ahs-3127	457	21	significantly	significantly	ADV
ahs-3127	457	22	determined	determine	VERB
ahs-3127	457	23	by	by	ADP
ahs-3127	457	24	its	its	PRON
ahs-3127	457	25	genetic	genetic	ADJ
ahs-3127	457	26	background	background	NOUN
ahs-3127	457	27	and	and	CCONJ
ahs-3127	457	28	boll	boll	NOUN
ahs-3127	457	29	period	period	NOUN
ahs-3127	457	30	temperature	temperature	NOUN
ahs-3127	457	31	.	.	PUNCT
ahs-3127	458	1	plant	plant	NOUN
ahs-3127	458	2	growth	growth	NOUN
ahs-3127	458	3	regul	regul	NOUN
ahs-3127	458	4	.	.	PUNCT
ahs-3127	458	5	,	,	PUNCT
ahs-3127	458	6	57(3	57(3	NUM
ahs-3127	458	7	):	):	PUNCT
ahs-3127	458	8	203209	203209	NUM
ahs-3127	458	9	.	.	PUNCT
ahs-3127	459	1	xie	xie	PROPN
ahs-3127	459	2	f.	f.	PROPN
ahs-3127	459	3	,	,	PUNCT
ahs-3127	459	4	wang	wang	PROPN
ahs-3127	459	5	q.	q.	PROPN
ahs-3127	459	6	,	,	PUNCT
ahs-3127	459	7	sun	sun	PROPN
ahs-3127	459	8	r.	r.	PROPN
ahs-3127	459	9	,	,	PUNCT
ahs-3127	459	10	zhang	zhang	PROPN
ahs-3127	459	11	b.	b.	PROPN
ahs-3127	459	12	,	,	PUNCT
ahs-3127	459	13	2015	2015	NUM
ahs-3127	459	14	deep	deep	ADJ
ahs-3127	459	15	sequencadv	sequencadv	NOUN
ahs-3127	459	16	.	.	PUNCT
ahs-3127	460	1	hort	hort	PROPN
ahs-3127	460	2	.	.	PUNCT
ahs-3127	461	1	sci	sci	PROPN
ahs-3127	461	2	.	.	PROPN
ahs-3127	461	3	,	,	PUNCT
ahs-3127	461	4	2018	2018	NUM
ahs-3127	461	5	32(1	32(1	NUM
ahs-3127	461	6	):	):	PUNCT
ahs-3127	461	7	79	79	NUM
ahs-3127	461	8	-	-	SYM
ahs-3127	461	9	92	92	NUM
ahs-3127	461	10	92	92	NUM
ahs-3127	461	11	ing	ing	NOUN
ahs-3127	461	12	reveals	reveal	VERB
ahs-3127	461	13	important	important	ADJ
ahs-3127	461	14	roles	role	NOUN
ahs-3127	461	15	of	of	ADP
ahs-3127	461	16	micrornas	microrna	NOUN
ahs-3127	461	17	in	in	ADP
ahs-3127	461	18	response	response	NOUN
ahs-3127	461	19	to	to	ADP
ahs-3127	461	20	drought	drought	NOUN
ahs-3127	461	21	and	and	CCONJ
ahs-3127	461	22	salinity	salinity	NOUN
ahs-3127	461	23	stress	stress	NOUN
ahs-3127	461	24	in	in	ADP
ahs-3127	461	25	cotton	cotton	NOUN
ahs-3127	461	26	.	.	PUNCT
ahs-3127	462	1	j.	j.	PROPN
ahs-3127	462	2	exp	exp	PROPN
ahs-3127	462	3	.	.	PUNCT
ahs-3127	462	4	bot	bot	PROPN
ahs-3127	462	5	.	.	PUNCT
ahs-3127	462	6	,	,	PUNCT
ahs-3127	463	1	66(3	66(3	NOUN
ahs-3127	463	2	):	):	PUNCT
ahs-3127	463	3	789	789	NUM
ahs-3127	463	4	-	-	SYM
ahs-3127	463	5	804	804	NUM
ahs-3127	463	6	.	.	PUNCT
ahs-3127	464	1	yaish	yaish	PROPN
ahs-3127	464	2	m.w	m.w	PROPN
ahs-3127	464	3	.	.	PROPN
ahs-3127	464	4	,	,	PUNCT
ahs-3127	464	5	colasanti	colasanti	PROPN
ahs-3127	464	6	j.	j.	PROPN
ahs-3127	464	7	,	,	PUNCT
ahs-3127	464	8	rothstein	rothstein	PROPN
ahs-3127	464	9	s.j	s.j	PROPN
ahs-3127	464	10	.	.	PROPN
ahs-3127	464	11	,	,	PUNCT
ahs-3127	464	12	2011	2011	NUM
ahs-3127	464	13	the	the	DET
ahs-3127	464	14	role	role	NOUN
ahs-3127	464	15	of	of	ADP
ahs-3127	464	16	epigenetic	epigenetic	ADJ
ahs-3127	464	17	processes	process	NOUN
ahs-3127	464	18	in	in	ADP
ahs-3127	464	19	controlling	control	VERB
ahs-3127	464	20	flowering	flowering	NOUN
ahs-3127	464	21	time	time	NOUN
ahs-3127	464	22	in	in	ADP
ahs-3127	464	23	plants	plant	NOUN
ahs-3127	464	24	exposed	expose	VERB
ahs-3127	464	25	to	to	ADP
ahs-3127	464	26	stress	stress	NOUN
ahs-3127	464	27	.	.	PUNCT
ahs-3127	465	1	j.	j.	PROPN
ahs-3127	465	2	exp	exp	PROPN
ahs-3127	465	3	.	.	PUNCT
ahs-3127	465	4	bot	bot	PROPN
ahs-3127	465	5	.	.	PUNCT
ahs-3127	465	6	,	,	PUNCT
ahs-3127	465	7	62(11	62(11	NUM
ahs-3127	465	8	):	):	PUNCT
ahs-3127	465	9	37273735	37273735	NUM
ahs-3127	465	10	.	.	PUNCT
ahs-3127	466	1	zhang	zhang	PROPN
ahs-3127	466	2	j.	j.	PROPN
ahs-3127	466	3	,	,	PUNCT
ahs-3127	466	4	li	li	PROPN
ahs-3127	466	5	d.	d.	PROPN
ahs-3127	466	6	,	,	PUNCT
ahs-3127	466	7	zou	zou	PROPN
ahs-3127	466	8	d.	d.	PROPN
ahs-3127	466	9	,	,	PUNCT
ahs-3127	466	10	luo	luo	PROPN
ahs-3127	466	11	f.	f.	PROPN
ahs-3127	466	12	,	,	PUNCT
ahs-3127	466	13	wang	wang	PROPN
ahs-3127	466	14	x.	x.	PROPN
ahs-3127	466	15	,	,	PUNCT
ahs-3127	466	16	zheng	zheng	PROPN
ahs-3127	466	17	y.	y.	PROPN
ahs-3127	466	18	,	,	PUNCT
ahs-3127	466	19	li	li	PROPN
ahs-3127	466	20	x.	x.	PROPN
ahs-3127	466	21	,	,	PUNCT
ahs-3127	466	22	2013	2013	NUM
ahs-3127	466	23	a	a	DET
ahs-3127	466	24	cotton	cotton	NOUN
ahs-3127	466	25	gene	gene	NOUN
ahs-3127	466	26	encoding	encode	VERB
ahs-3127	466	27	a	a	DET
ahs-3127	466	28	plasma	plasma	NOUN
ahs-3127	466	29	membrane	membrane	NOUN
ahs-3127	466	30	aquaporin	aquaporin	NOUN
ahs-3127	466	31	is	be	AUX
ahs-3127	466	32	involved	involve	VERB
ahs-3127	466	33	in	in	ADP
ahs-3127	466	34	seedling	seedle	VERB
ahs-3127	466	35	development	development	NOUN
ahs-3127	466	36	and	and	CCONJ
ahs-3127	466	37	in	in	ADP
ahs-3127	466	38	response	response	NOUN
ahs-3127	466	39	to	to	ADP
ahs-3127	466	40	drought	drought	NOUN
ahs-3127	466	41	stress	stress	NOUN
ahs-3127	466	42	.	.	PUNCT
ahs-3127	467	1	acta	acta	PROPN
ahs-3127	467	2	biochim	biochim	PROPN
ahs-3127	467	3	.	.	PUNCT
ahs-3127	468	1	biophys	biophy	NOUN
ahs-3127	468	2	.	.	PUNCT
ahs-3127	469	1	sin	sin	NOUN
ahs-3127	469	2	.	.	PUNCT
ahs-3127	469	3	,	,	PUNCT
ahs-3127	469	4	45(2	45(2	NOUN
ahs-3127	469	5	):	):	PUNCT
ahs-3127	469	6	104	104	NUM
ahs-3127	469	7	-	-	SYM
ahs-3127	469	8	114	114	NUM
ahs-3127	469	9	.	.	PUNCT
ahs-3127	470	1	zhou	zhou	PROPN
ahs-3127	470	2	z.	z.	PROPN
ahs-3127	470	3	,	,	PUNCT
ahs-3127	470	4	meng	meng	PROPN
ahs-3127	470	5	y.	y.	PROPN
ahs-3127	470	6	,	,	PUNCT
ahs-3127	470	7	wang	wang	PROPN
ahs-3127	470	8	y.	y.	PROPN
ahs-3127	470	9	,	,	PUNCT
ahs-3127	470	10	chen	chen	PROPN
ahs-3127	470	11	b.	b.	PROPN
ahs-3127	470	12	,	,	PUNCT
ahs-3127	470	13	zhao	zhao	PROPN
ahs-3127	470	14	x.	x.	PROPN
ahs-3127	470	15	,	,	PUNCT
ahs-3127	470	16	oosterhuis	oosterhuis	PROPN
ahs-3127	470	17	d.m	d.m	PROPN
ahs-3127	470	18	.	.	PROPN
ahs-3127	470	19	,	,	PUNCT
ahs-3127	470	20	shu	shu	PROPN
ahs-3127	470	21	h.	h.	PROPN
ahs-3127	470	22	,	,	PUNCT
ahs-3127	470	23	2011	2011	NUM
ahs-3127	470	24	effect	effect	NOUN
ahs-3127	470	25	of	of	ADP
ahs-3127	470	26	planting	planting	NOUN
ahs-3127	470	27	date	date	NOUN
ahs-3127	470	28	and	and	CCONJ
ahs-3127	470	29	boll	boll	NOUN
ahs-3127	470	30	position	position	NOUN
ahs-3127	470	31	on	on	ADP
ahs-3127	470	32	fiber	fiber	NOUN
ahs-3127	470	33	strength	strength	NOUN
ahs-3127	470	34	of	of	ADP
ahs-3127	470	35	cotton	cotton	NOUN
ahs-3127	470	36	(	(	PUNCT
ahs-3127	470	37	gossypium	gossypium	NOUN
ahs-3127	470	38	hirsutum	hirsutum	PROPN
ahs-3127	470	39	l.	l.	PROPN
ahs-3127	470	40	)	)	PUNCT
ahs-3127	470	41	.	.	PUNCT
ahs-3127	471	1	am	be	AUX
ahs-3127	471	2	.	.	PUNCT
ahs-3127	472	1	j.	j.	PROPN
ahs-3127	472	2	exp	exp	PROPN
ahs-3127	472	3	.	.	PROPN
ahs-3127	472	4	agri	agri	NOUN
ahs-3127	472	5	.	.	PUNCT
ahs-3127	472	6	,	,	PUNCT
ahs-3127	472	7	1(4	1(4	NUM
ahs-3127	472	8	):	):	PUNCT
ahs-3127	472	9	331	331	NUM
ahs-3127	472	10	-	-	SYM
ahs-3127	472	11	342	342	NUM
ahs-3127	472	12	.	.	PUNCT
ahs-3127	473	1	zhu	zhu	PROPN
ahs-3127	473	2	l.-f	l.-f	NOUN
ahs-3127	473	3	.	.	PUNCT
ahs-3127	474	1	,	,	PUNCT
ahs-3127	474	2	he	he	PRON
ahs-3127	474	3	x.	x.	NOUN
ahs-3127	474	4	,	,	PUNCT
ahs-3127	474	5	yuan	yuan	PROPN
ahs-3127	474	6	d.-j	d.-j	PROPN
ahs-3127	474	7	.	.	PUNCT
ahs-3127	474	8	,	,	PUNCT
ahs-3127	474	9	xu	xu	PROPN
ahs-3127	474	10	l.	l.	PROPN
ahs-3127	474	11	,	,	PUNCT
ahs-3127	474	12	xu	xu	PROPN
ahs-3127	474	13	l.	l.	PROPN
ahs-3127	474	14	,	,	PUNCT
ahs-3127	474	15	tu	tu	PROPN
ahs-3127	474	16	l.-l	l.-l	PROPN
ahs-3127	474	17	.	.	PUNCT
ahs-3127	474	18	,	,	PUNCT
ahs-3127	474	19	shen	shen	PROPN
ahs-3127	475	1	g.x	g.x	PROPN
ahs-3127	476	1	.	.	PROPN
ahs-3127	476	2	,	,	PUNCT
ahs-3127	476	3	zhang	zhang	PROPN
ahs-3127	476	4	h.	h.	PROPN
ahs-3127	476	5	,	,	PUNCT
ahs-3127	476	6	zhang	zhang	PROPN
ahs-3127	476	7	x.-l	x.-l	PROPN
ahs-3127	476	8	.	.	PUNCT
ahs-3127	476	9	,	,	PUNCT
ahs-3127	476	10	2011	2011	NUM
ahs-3127	476	11	genome	genome	NOUN
ahs-3127	476	12	-	-	PUNCT
ahs-3127	476	13	wide	wide	ADJ
ahs-3127	476	14	identification	identification	NOUN
ahs-3127	476	15	of	of	ADP
ahs-3127	476	16	genes	gene	NOUN
ahs-3127	476	17	responsive	responsive	ADJ
ahs-3127	476	18	to	to	ADP
ahs-3127	476	19	aba	aba	PROPN
ahs-3127	476	20	and	and	CCONJ
ahs-3127	476	21	cold	cold	ADJ
ahs-3127	476	22	/	/	SYM
ahs-3127	476	23	salt	salt	NOUN
ahs-3127	476	24	stresses	stress	NOUN
ahs-3127	476	25	in	in	ADP
ahs-3127	476	26	gossypium	gossypium	NOUN
ahs-3127	476	27	hirsutum	hirsutum	NOUN
ahs-3127	476	28	by	by	ADP
ahs-3127	476	29	data	data	NOUN
ahs-3127	476	30	-	-	PUNCT
ahs-3127	476	31	mining	mining	NOUN
ahs-3127	476	32	and	and	CCONJ
ahs-3127	476	33	expression	expression	NOUN
ahs-3127	476	34	pattern	pattern	NOUN
ahs-3127	476	35	analysis	analysis	NOUN
ahs-3127	476	36	.	.	PUNCT
ahs-3127	476	37	agri	agri	NOUN
ahs-3127	476	38	.	.	PUNCT
ahs-3127	477	1	sci	sci	PROPN
ahs-3127	477	2	.	.	PUNCT
ahs-3127	478	1	china	china	PROPN
ahs-3127	478	2	,	,	PUNCT
ahs-3127	478	3	10(4	10(4	NUM
ahs-3127	478	4	):	):	PUNCT
ahs-3127	478	5	499	499	NUM
ahs-3127	478	6	-	-	SYM
ahs-3127	478	7	508	508	NUM
ahs-3127	478	8	.	.	PUNCT