id	sid	tid	token	lemma	pos
ahs-7374	1	1	impaginato	impaginato	PROPN
ahs-7374	1	2	403	403	NUM
ahs-7374	1	3	adv	adv	PROPN
ahs-7374	1	4	.	.	PUNCT
ahs-7374	1	5	hort	hort	PROPN
ahs-7374	1	6	.	.	PUNCT
ahs-7374	2	1	sci	sci	PROPN
ahs-7374	2	2	.	.	PROPN
ahs-7374	2	3	,	,	PUNCT
ahs-7374	2	4	2019	2019	NUM
ahs-7374	2	5	33(3	33(3	NOUN
ahs-7374	2	6	):	):	PUNCT
ahs-7374	2	7	403	403	NUM
ahs-7374	2	8	-	-	SYM
ahs-7374	2	9	408	408	NUM
ahs-7374	2	10	doi	doi	NOUN
ahs-7374	2	11	:	:	PUNCT
ahs-7374	2	12	10.13128	10.13128	NUM
ahs-7374	2	13	/	/	SYM
ahs-7374	2	14	ahs-25648	ahs-25648	NOUN
ahs-7374	2	15	barcoding	barcode	VERB
ahs-7374	2	16	assessment	assessment	NOUN
ahs-7374	2	17	of	of	ADP
ahs-7374	2	18	the	the	DET
ahs-7374	2	19	citrus	citrus	NOUN
ahs-7374	2	20	species	specie	NOUN
ahs-7374	2	21	cultivated	cultivate	VERB
ahs-7374	2	22	in	in	ADP
ahs-7374	2	23	eastern	eastern	ADJ
ahs-7374	2	24	afghanistan	afghanistan	PROPN
ahs-7374	2	25	m.	m.	PROPN
ahs-7374	2	26	gori	gori	PROPN
ahs-7374	2	27	1	1	NUM
ahs-7374	2	28	,	,	PUNCT
ahs-7374	2	29	s.	s.	PROPN
ahs-7374	2	30	pecchioli	pecchioli	PROPN
ahs-7374	2	31	1	1	NUM
ahs-7374	2	32	,	,	PUNCT
ahs-7374	2	33	e.	e.	PROPN
ahs-7374	2	34	giordani	giordani	PROPN
ahs-7374	2	35	1	1	NUM
ahs-7374	2	36	,	,	PUNCT
ahs-7374	2	37	m.a	m.a	PROPN
ahs-7374	2	38	.	.	PROPN
ahs-7374	2	39	saeedi	saeedi	PROPN
ahs-7374	2	40	2	2	NUM
ahs-7374	2	41	,	,	PUNCT
ahs-7374	2	42	f.h	f.h	PROPN
ahs-7374	2	43	.	.	PROPN
ahs-7374	2	44	wafa	wafa	PROPN
ahs-7374	2	45	2	2	NUM
ahs-7374	2	46	,	,	PUNCT
ahs-7374	2	47	,	,	PUNCT
ahs-7374	2	48	s.	s.	PROPN
ahs-7374	2	49	biricolti	biricolti	PROPN
ahs-7374	2	50	1	1	NUM
ahs-7374	2	51	(	(	PUNCT
ahs-7374	2	52	*	*	NOUN
ahs-7374	2	53	)	)	PUNCT
ahs-7374	2	54	1	1	NUM
ahs-7374	2	55	dipartimento	dipartimento	NOUN
ahs-7374	2	56	di	di	X
ahs-7374	2	57	scienze	scienze	PROPN
ahs-7374	2	58	e	e	PROPN
ahs-7374	2	59	tecnologie	tecnologie	PROPN
ahs-7374	2	60	agrarie	agrarie	PROPN
ahs-7374	2	61	,	,	PUNCT
ahs-7374	2	62	alimentari	alimentari	X
ahs-7374	2	63	,	,	PUNCT
ahs-7374	2	64	ambientali	ambientali	PROPN
ahs-7374	2	65	e	e	PROPN
ahs-7374	2	66	forestali	forestali	PROPN
ahs-7374	2	67	,	,	PUNCT
ahs-7374	2	68	sezione	sezione	NOUN
ahs-7374	2	69	colture	colture	PROPN
ahs-7374	2	70	arboree	arboree	PROPN
ahs-7374	2	71	,	,	PUNCT
ahs-7374	2	72	università	università	PROPN
ahs-7374	2	73	degli	degli	PROPN
ahs-7374	2	74	studi	studi	PROPN
ahs-7374	2	75	di	di	PROPN
ahs-7374	2	76	firenze	firenze	PROPN
ahs-7374	2	77	,	,	PUNCT
ahs-7374	2	78	viale	viale	NOUN
ahs-7374	2	79	delle	delle	NOUN
ahs-7374	2	80	idee	idee	PROPN
ahs-7374	2	81	,	,	PUNCT
ahs-7374	2	82	30	30	NUM
ahs-7374	2	83	,	,	PUNCT
ahs-7374	2	84	50019	50019	NUM
ahs-7374	2	85	sesto	sesto	PROPN
ahs-7374	2	86	fiorentino	fiorentino	PROPN
ahs-7374	2	87	,	,	PUNCT
ahs-7374	2	88	italy	italy	PROPN
ahs-7374	2	89	.	.	PROPN
ahs-7374	2	90	2	2	NUM
ahs-7374	2	91	afghanistan	afghanistan	PROPN
ahs-7374	2	92	national	national	PROPN
ahs-7374	2	93	horticulture	horticulture	PROPN
ahs-7374	2	94	development	development	PROPN
ahs-7374	2	95	organization	organization	NOUN
ahs-7374	2	96	(	(	PUNCT
ahs-7374	2	97	anhdo	anhdo	PROPN
ahs-7374	2	98	)	)	PUNCT
ahs-7374	2	99	,	,	PUNCT
ahs-7374	2	100	taimani	taimani	PROPN
ahs-7374	2	101	street	street	PROPN
ahs-7374	2	102	,	,	PUNCT
ahs-7374	2	103	9	9	NUM
ahs-7374	2	104	,	,	PUNCT
ahs-7374	2	105	kabul	kabul	PROPN
ahs-7374	2	106	,	,	PUNCT
ahs-7374	2	107	afghanistan	afghanistan	PROPN
ahs-7374	2	108	.	.	PUNCT
ahs-7374	3	1	keywords	keyword	NOUN
ahs-7374	3	2	:	:	PUNCT
ahs-7374	3	3	afghanistan	afghanistan	PROPN
ahs-7374	3	4	,	,	PUNCT
ahs-7374	3	5	citrus	citrus	NOUN
ahs-7374	3	6	,	,	PUNCT
ahs-7374	3	7	psba	psba	NOUN
ahs-7374	3	8	-	-	PUNCT
ahs-7374	3	9	trnh	trnh	NOUN
ahs-7374	3	10	spacer	spacer	NOUN
ahs-7374	3	11	.	.	PUNCT
ahs-7374	4	1	abstract	abstract	ADJ
ahs-7374	4	2	:	:	PUNCT
ahs-7374	4	3	the	the	DET
ahs-7374	4	4	establishment	establishment	NOUN
ahs-7374	4	5	of	of	ADP
ahs-7374	4	6	a	a	DET
ahs-7374	4	7	modern	modern	ADJ
ahs-7374	4	8	fruit	fruit	NOUN
ahs-7374	4	9	culture	culture	NOUN
ahs-7374	4	10	in	in	ADP
ahs-7374	4	11	developing	develop	VERB
ahs-7374	4	12	countries	country	NOUN
ahs-7374	4	13	requests	request	VERB
ahs-7374	4	14	an	an	DET
ahs-7374	4	15	accurate	accurate	ADJ
ahs-7374	4	16	evaluation	evaluation	NOUN
ahs-7374	4	17	of	of	ADP
ahs-7374	4	18	the	the	DET
ahs-7374	4	19	preexisting	preexist	VERB
ahs-7374	4	20	germplasm	germplasm	NOUN
ahs-7374	4	21	and	and	CCONJ
ahs-7374	4	22	its	its	PRON
ahs-7374	4	23	health	health	NOUN
ahs-7374	4	24	status	status	NOUN
ahs-7374	4	25	.	.	PUNCT
ahs-7374	5	1	this	this	PRON
ahs-7374	5	2	to	to	PART
ahs-7374	5	3	prevent	prevent	VERB
ahs-7374	5	4	the	the	DET
ahs-7374	5	5	possibility	possibility	NOUN
ahs-7374	5	6	to	to	PART
ahs-7374	5	7	introduce	introduce	VERB
ahs-7374	5	8	new	new	ADJ
ahs-7374	5	9	germplasm	germplasm	NOUN
ahs-7374	5	10	which	which	PRON
ahs-7374	5	11	can	can	AUX
ahs-7374	5	12	be	be	AUX
ahs-7374	5	13	easily	easily	ADV
ahs-7374	5	14	prey	prey	NOUN
ahs-7374	5	15	of	of	ADP
ahs-7374	5	16	the	the	DET
ahs-7374	5	17	endemic	endemic	ADJ
ahs-7374	5	18	diseases	disease	NOUN
ahs-7374	5	19	carried	carry	VERB
ahs-7374	5	20	by	by	ADP
ahs-7374	5	21	asymptomatic	asymptomatic	ADJ
ahs-7374	5	22	host	host	NOUN
ahs-7374	5	23	plants	plant	NOUN
ahs-7374	5	24	.	.	PUNCT
ahs-7374	6	1	therefore	therefore	ADV
ahs-7374	6	2	,	,	PUNCT
ahs-7374	6	3	after	after	ADP
ahs-7374	6	4	the	the	DET
ahs-7374	6	5	identification	identification	NOUN
ahs-7374	6	6	of	of	ADP
ahs-7374	6	7	cases	case	NOUN
ahs-7374	6	8	of	of	ADP
ahs-7374	6	9	citrus	citrus	NOUN
ahs-7374	6	10	plants	plant	NOUN
ahs-7374	6	11	affected	affect	VERB
ahs-7374	6	12	by	by	ADP
ahs-7374	6	13	tristeza	tristeza	PROPN
ahs-7374	6	14	virus	virus	NOUN
ahs-7374	6	15	,	,	PUNCT
ahs-7374	6	16	a	a	DET
ahs-7374	6	17	survey	survey	NOUN
ahs-7374	6	18	of	of	ADP
ahs-7374	6	19	the	the	DET
ahs-7374	6	20	germplasm	germplasm	NOUN
ahs-7374	6	21	cultivated	cultivate	VERB
ahs-7374	6	22	in	in	ADP
ahs-7374	6	23	the	the	DET
ahs-7374	6	24	nangarhar	nangarhar	PROPN
ahs-7374	6	25	valley	valley	NOUN
ahs-7374	6	26	and	and	CCONJ
ahs-7374	6	27	some	some	DET
ahs-7374	6	28	nearby	nearby	ADJ
ahs-7374	6	29	regions	region	NOUN
ahs-7374	6	30	was	be	AUX
ahs-7374	6	31	run	run	VERB
ahs-7374	6	32	.	.	PUNCT
ahs-7374	7	1	the	the	DET
ahs-7374	7	2	survey	survey	NOUN
ahs-7374	7	3	was	be	AUX
ahs-7374	7	4	focused	focus	VERB
ahs-7374	7	5	on	on	ADP
ahs-7374	7	6	the	the	DET
ahs-7374	7	7	identification	identification	NOUN
ahs-7374	7	8	of	of	ADP
ahs-7374	7	9	the	the	DET
ahs-7374	7	10	main	main	ADJ
ahs-7374	7	11	citrus	citrus	NOUN
ahs-7374	7	12	species	specie	NOUN
ahs-7374	7	13	widely	widely	ADV
ahs-7374	7	14	cultivated	cultivate	VERB
ahs-7374	7	15	using	use	VERB
ahs-7374	7	16	barcoding	barcode	VERB
ahs-7374	7	17	analysis	analysis	NOUN
ahs-7374	7	18	of	of	ADP
ahs-7374	7	19	conserved	conserve	VERB
ahs-7374	7	20	sequences	sequence	NOUN
ahs-7374	7	21	located	locate	VERB
ahs-7374	7	22	in	in	ADP
ahs-7374	7	23	the	the	DET
ahs-7374	7	24	plastid	plastid	ADJ
ahs-7374	7	25	dna	dna	NOUN
ahs-7374	7	26	.	.	PUNCT
ahs-7374	8	1	the	the	DET
ahs-7374	8	2	sequences	sequence	NOUN
ahs-7374	8	3	of	of	ADP
ahs-7374	8	4	matk	matk	PROPN
ahs-7374	8	5	and	and	CCONJ
ahs-7374	8	6	rbcl	rbcl	NOUN
ahs-7374	8	7	genes	gene	NOUN
ahs-7374	8	8	did	do	AUX
ahs-7374	8	9	not	not	PART
ahs-7374	8	10	show	show	VERB
ahs-7374	8	11	any	any	DET
ahs-7374	8	12	discriminatory	discriminatory	ADJ
ahs-7374	8	13	ability	ability	NOUN
ahs-7374	8	14	while	while	SCONJ
ahs-7374	8	15	the	the	DET
ahs-7374	8	16	analysis	analysis	NOUN
ahs-7374	8	17	of	of	ADP
ahs-7374	8	18	the	the	DET
ahs-7374	8	19	the	the	DET
ahs-7374	8	20	non	non	ADJ
ahs-7374	8	21	-	-	ADJ
ahs-7374	8	22	coding	code	VERB
ahs-7374	8	23	psba	psba	NOUN
ahs-7374	8	24	-	-	PUNCT
ahs-7374	8	25	trnh	trnh	NOUN
ahs-7374	8	26	intergenic	intergenic	ADJ
ahs-7374	8	27	spacer	spacer	NOUN
ahs-7374	8	28	(	(	PUNCT
ahs-7374	8	29	psba‐trnh	psba‐trnh	PROPN
ahs-7374	8	30	)	)	PUNCT
ahs-7374	8	31	showed	show	VERB
ahs-7374	8	32	a	a	DET
ahs-7374	8	33	robust	robust	ADJ
ahs-7374	8	34	single	single	ADJ
ahs-7374	8	35	nucleotide	nucleotide	NOUN
ahs-7374	8	36	polymorphism	polymorphism	NOUN
ahs-7374	8	37	(	(	PUNCT
ahs-7374	8	38	snp	snp	ADJ
ahs-7374	8	39	)	)	PUNCT
ahs-7374	8	40	discriminating	discriminate	VERB
ahs-7374	8	41	c.	c.	PROPN
ahs-7374	8	42	aurantium	aurantium	PROPN
ahs-7374	8	43	from	from	ADP
ahs-7374	8	44	c.	c.	PROPN
ahs-7374	8	45	sinensis	sinensis	NOUN
ahs-7374	8	46	in	in	ADP
ahs-7374	8	47	all	all	DET
ahs-7374	8	48	analysed	analyse	VERB
ahs-7374	8	49	samples	sample	NOUN
ahs-7374	8	50	.	.	PUNCT
ahs-7374	9	1	these	these	DET
ahs-7374	9	2	non	non	ADJ
ahs-7374	9	3	-	-	ADJ
ahs-7374	9	4	coding	coding	ADJ
ahs-7374	9	5	regions	region	NOUN
ahs-7374	9	6	have	have	VERB
ahs-7374	9	7	no	no	DET
ahs-7374	9	8	known	know	VERB
ahs-7374	9	9	function	function	NOUN
ahs-7374	9	10	;	;	PUNCT
ahs-7374	9	11	thus	thus	ADV
ahs-7374	9	12	,	,	PUNCT
ahs-7374	9	13	much	much	ADJ
ahs-7374	9	14	of	of	ADP
ahs-7374	9	15	the	the	DET
ahs-7374	9	16	variation	variation	NOUN
ahs-7374	9	17	may	may	AUX
ahs-7374	9	18	result	result	VERB
ahs-7374	9	19	from	from	ADP
ahs-7374	9	20	the	the	DET
ahs-7374	9	21	spread	spread	NOUN
ahs-7374	9	22	of	of	ADP
ahs-7374	9	23	mutations	mutation	NOUN
ahs-7374	9	24	unconstrained	unconstraine	VERB
ahs-7374	9	25	by	by	ADP
ahs-7374	9	26	selection	selection	NOUN
ahs-7374	9	27	.	.	PUNCT
ahs-7374	10	1	because	because	SCONJ
ahs-7374	10	2	nucleotide	nucleotide	ADJ
ahs-7374	10	3	variation	variation	NOUN
ahs-7374	10	4	in	in	ADP
ahs-7374	10	5	the	the	DET
ahs-7374	10	6	psba‐trnh	psba‐trnh	NOUN
ahs-7374	10	7	spacer	spacer	NOUN
ahs-7374	10	8	region	region	NOUN
ahs-7374	10	9	is	be	AUX
ahs-7374	10	10	high	high	ADJ
ahs-7374	10	11	,	,	PUNCT
ahs-7374	10	12	mutational	mutational	ADJ
ahs-7374	10	13	hot	hot	ADJ
ahs-7374	10	14	spots	spot	NOUN
ahs-7374	10	15	may	may	AUX
ahs-7374	10	16	be	be	AUX
ahs-7374	10	17	useful	useful	ADJ
ahs-7374	10	18	to	to	PART
ahs-7374	10	19	detect	detect	VERB
ahs-7374	10	20	species	specie	NOUN
ahs-7374	10	21	-	-	PUNCT
ahs-7374	10	22	level	level	NOUN
ahs-7374	10	23	variations	variation	NOUN
ahs-7374	10	24	.	.	PUNCT
ahs-7374	11	1	according	accord	VERB
ahs-7374	11	2	to	to	ADP
ahs-7374	11	3	our	our	PRON
ahs-7374	11	4	study	study	NOUN
ahs-7374	11	5	,	,	PUNCT
ahs-7374	11	6	the	the	DET
ahs-7374	11	7	afghan	afghan	ADJ
ahs-7374	11	8	citrus	citrus	NOUN
ahs-7374	11	9	germplasm	germplasm	NOUN
ahs-7374	11	10	belong	belong	VERB
ahs-7374	11	11	to	to	ADP
ahs-7374	11	12	the	the	DET
ahs-7374	11	13	c.	c.	PROPN
ahs-7374	11	14	aurantium	aurantium	PROPN
ahs-7374	11	15	species	specie	NOUN
ahs-7374	11	16	which	which	PRON
ahs-7374	11	17	is	be	AUX
ahs-7374	11	18	commonly	commonly	ADV
ahs-7374	11	19	used	use	VERB
ahs-7374	11	20	in	in	ADP
ahs-7374	11	21	citrus	citrus	NOUN
ahs-7374	11	22	culture	culture	NOUN
ahs-7374	11	23	as	as	ADP
ahs-7374	11	24	a	a	DET
ahs-7374	11	25	rootstock	rootstock	NOUN
ahs-7374	11	26	.	.	PUNCT
ahs-7374	12	1	in	in	ADP
ahs-7374	12	2	afghanistan	afghanistan	PROPN
ahs-7374	12	3	it	it	PRON
ahs-7374	12	4	is	be	AUX
ahs-7374	12	5	widely	widely	ADV
ahs-7374	12	6	cultivated	cultivate	VERB
ahs-7374	12	7	for	for	ADP
ahs-7374	12	8	fresh	fresh	ADJ
ahs-7374	12	9	consumption	consumption	NOUN
ahs-7374	12	10	,	,	PUNCT
ahs-7374	12	11	without	without	ADP
ahs-7374	12	12	topworking	topworke	VERB
ahs-7374	12	13	with	with	ADP
ahs-7374	12	14	selected	select	VERB
ahs-7374	12	15	varieties	variety	NOUN
ahs-7374	12	16	and	and	CCONJ
ahs-7374	12	17	this	this	PRON
ahs-7374	12	18	may	may	AUX
ahs-7374	12	19	be	be	AUX
ahs-7374	12	20	the	the	DET
ahs-7374	12	21	reason	reason	NOUN
ahs-7374	12	22	why	why	SCONJ
ahs-7374	12	23	symptoms	symptom	NOUN
ahs-7374	12	24	are	be	AUX
ahs-7374	12	25	often	often	ADV
ahs-7374	12	26	mild	mild	ADJ
ahs-7374	12	27	and	and	CCONJ
ahs-7374	12	28	cultivation	cultivation	NOUN
ahs-7374	12	29	can	can	AUX
ahs-7374	12	30	be	be	AUX
ahs-7374	12	31	anyhow	anyhow	ADV
ahs-7374	12	32	carried	carry	VERB
ahs-7374	12	33	on	on	ADP
ahs-7374	12	34	.	.	PUNCT
ahs-7374	13	1	1	1	X
ahs-7374	13	2	.	.	X
ahs-7374	13	3	introduction	introduction	NOUN
ahs-7374	13	4	in	in	ADP
ahs-7374	13	5	developing	develop	VERB
ahs-7374	13	6	countries	country	NOUN
ahs-7374	13	7	,	,	PUNCT
ahs-7374	13	8	farmers	farmer	NOUN
ahs-7374	13	9	are	be	AUX
ahs-7374	13	10	growing	grow	VERB
ahs-7374	13	11	landraces	landrace	NOUN
ahs-7374	13	12	or	or	CCONJ
ahs-7374	13	13	older	old	ADJ
ahs-7374	13	14	improved	improved	ADJ
ahs-7374	13	15	varieties	variety	NOUN
ahs-7374	13	16	that	that	PRON
ahs-7374	13	17	are	be	AUX
ahs-7374	13	18	not	not	PART
ahs-7374	13	19	optimized	optimize	VERB
ahs-7374	13	20	for	for	ADP
ahs-7374	13	21	today	today	NOUN
ahs-7374	13	22	’s	’s	PART
ahs-7374	13	23	climate	climate	NOUN
ahs-7374	13	24	or	or	CCONJ
ahs-7374	13	25	production	production	NOUN
ahs-7374	13	26	systems	system	NOUN
ahs-7374	13	27	.	.	PUNCT
ahs-7374	14	1	therefore	therefore	ADV
ahs-7374	14	2	,	,	PUNCT
ahs-7374	14	3	the	the	DET
ahs-7374	14	4	replacement	replacement	NOUN
ahs-7374	14	5	of	of	ADP
ahs-7374	14	6	the	the	DET
ahs-7374	14	7	local	local	ADJ
ahs-7374	14	8	germplasm	germplasm	NOUN
ahs-7374	14	9	traditionally	traditionally	ADV
ahs-7374	14	10	cultivated	cultivate	VERB
ahs-7374	14	11	for	for	ADP
ahs-7374	14	12	long	long	ADJ
ahs-7374	14	13	should	should	AUX
ahs-7374	14	14	be	be	AUX
ahs-7374	14	15	carried	carry	VERB
ahs-7374	14	16	on	on	ADP
ahs-7374	14	17	by	by	ADP
ahs-7374	14	18	introducing	introduce	VERB
ahs-7374	14	19	elite	elite	ADJ
ahs-7374	14	20	varieties	variety	NOUN
ahs-7374	14	21	in	in	ADP
ahs-7374	14	22	order	order	NOUN
ahs-7374	14	23	to	to	ADP
ahs-7374	14	24	complying	comply	VERB
ahs-7374	14	25	with	with	ADP
ahs-7374	14	26	the	the	DET
ahs-7374	14	27	rules	rule	NOUN
ahs-7374	14	28	of	of	ADP
ahs-7374	14	29	a	a	DET
ahs-7374	14	30	modern	modern	ADJ
ahs-7374	14	31	cropping	cropping	NOUN
ahs-7374	14	32	system	system	NOUN
ahs-7374	14	33	.	.	PUNCT
ahs-7374	15	1	however	however	ADV
ahs-7374	15	2	,	,	PUNCT
ahs-7374	15	3	this	this	DET
ahs-7374	15	4	change	change	NOUN
ahs-7374	15	5	rises	rise	VERB
ahs-7374	15	6	concerns	concern	NOUN
ahs-7374	15	7	about	about	ADP
ahs-7374	15	8	the	the	DET
ahs-7374	15	9	adaptation	adaptation	NOUN
ahs-7374	15	10	of	of	ADP
ahs-7374	15	11	the	the	DET
ahs-7374	15	12	elite	elite	ADJ
ahs-7374	15	13	(	(	PUNCT
ahs-7374	15	14	*	*	NOUN
ahs-7374	15	15	)	)	PUNCT
ahs-7374	15	16	corresponding	corresponding	ADJ
ahs-7374	15	17	author	author	NOUN
ahs-7374	15	18	:	:	PUNCT
ahs-7374	15	19	stefano.biricolti@unifi.it	stefano.biricolti@unifi.it	PROPN
ahs-7374	15	20	citation	citation	NOUN
ahs-7374	15	21	:	:	PUNCT
ahs-7374	15	22	gori	gori	PROPN
ahs-7374	15	23	m.	m.	PROPN
ahs-7374	15	24	,	,	PUNCT
ahs-7374	15	25	pecchioli	pecchioli	PROPN
ahs-7374	15	26	s.	s.	PROPN
ahs-7374	15	27	,	,	PUNCT
ahs-7374	15	28	giordani	giordani	PROPN
ahs-7374	15	29	e.	e.	PROPN
ahs-7374	15	30	,	,	PUNCT
ahs-7374	15	31	saeedi	saeedi	PROPN
ahs-7374	15	32	m.a	m.a	PROPN
ahs-7374	15	33	.	.	PROPN
ahs-7374	15	34	,	,	PUNCT
ahs-7374	15	35	wafa	wafa	PROPN
ahs-7374	15	36	f.h	f.h	PROPN
ahs-7374	15	37	.	.	PROPN
ahs-7374	15	38	,	,	PUNCT
ahs-7374	15	39	biricolti	biricolti	PROPN
ahs-7374	15	40	s.	s.	PROPN
ahs-7374	15	41	,	,	PUNCT
ahs-7374	15	42	2019	2019	NUM
ahs-7374	15	43	barcoding	barcoding	NOUN
ahs-7374	15	44	assessment	assessment	NOUN
ahs-7374	15	45	of	of	ADP
ahs-7374	15	46	the	the	DET
ahs-7374	15	47	citrus	citrus	NOUN
ahs-7374	15	48	species	specie	NOUN
ahs-7374	15	49	cultivated	cultivate	VERB
ahs-7374	15	50	in	in	ADP
ahs-7374	15	51	eastern	eastern	ADJ
ahs-7374	15	52	afghanistan	afghanistan	PROPN
ahs-7374	15	53	.	.	PUNCT
ahs-7374	16	1	adv	adv	PROPN
ahs-7374	16	2	.	.	PUNCT
ahs-7374	17	1	hort	hort	PROPN
ahs-7374	17	2	.	.	PUNCT
ahs-7374	18	1	sci	sci	PROPN
ahs-7374	18	2	.	.	PROPN
ahs-7374	18	3	,	,	PUNCT
ahs-7374	18	4	33(3	33(3	NUM
ahs-7374	18	5	):	):	PUNCT
ahs-7374	18	6	403408	403408	NUM
ahs-7374	18	7	copyright	copyright	NOUN
ahs-7374	18	8	:	:	PUNCT
ahs-7374	18	9	©	©	PROPN
ahs-7374	18	10	2019	2019	NUM
ahs-7374	18	11	gori	gori	PROPN
ahs-7374	18	12	m.	m.	NOUN
ahs-7374	18	13	,	,	PUNCT
ahs-7374	18	14	pecchioli	pecchioli	PROPN
ahs-7374	18	15	s.	s.	PROPN
ahs-7374	18	16	,	,	PUNCT
ahs-7374	18	17	giordani	giordani	PROPN
ahs-7374	18	18	e.	e.	PROPN
ahs-7374	18	19	,	,	PUNCT
ahs-7374	18	20	saeedi	saeedi	PROPN
ahs-7374	18	21	m.a	m.a	PROPN
ahs-7374	18	22	.	.	PROPN
ahs-7374	18	23	,	,	PUNCT
ahs-7374	18	24	wafa	wafa	PROPN
ahs-7374	18	25	f.h	f.h	PROPN
ahs-7374	18	26	.	.	PROPN
ahs-7374	18	27	,	,	PUNCT
ahs-7374	18	28	biricolti	biricolti	PROPN
ahs-7374	18	29	s.	s.	PROPN
ahs-7374	18	30	this	this	PRON
ahs-7374	18	31	is	be	AUX
ahs-7374	18	32	an	an	DET
ahs-7374	18	33	open	open	ADJ
ahs-7374	18	34	access	access	NOUN
ahs-7374	18	35	,	,	PUNCT
ahs-7374	18	36	peer	peer	NOUN
ahs-7374	18	37	reviewed	review	VERB
ahs-7374	18	38	article	article	NOUN
ahs-7374	18	39	published	publish	VERB
ahs-7374	18	40	by	by	ADP
ahs-7374	18	41	firenze	firenze	PROPN
ahs-7374	18	42	university	university	PROPN
ahs-7374	18	43	press	press	NOUN
ahs-7374	18	44	(	(	PUNCT
ahs-7374	18	45	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-7374	18	46	)	)	PUNCT
ahs-7374	18	47	and	and	CCONJ
ahs-7374	18	48	distributed	distribute	VERB
ahs-7374	18	49	under	under	ADP
ahs-7374	18	50	the	the	DET
ahs-7374	18	51	terms	term	NOUN
ahs-7374	18	52	of	of	ADP
ahs-7374	18	53	the	the	DET
ahs-7374	18	54	creative	creative	ADJ
ahs-7374	18	55	commons	common	NOUN
ahs-7374	18	56	attribution	attribution	NOUN
ahs-7374	18	57	license	license	NOUN
ahs-7374	18	58	,	,	PUNCT
ahs-7374	18	59	which	which	PRON
ahs-7374	18	60	permits	permit	VERB
ahs-7374	18	61	unrestricted	unrestricted	ADJ
ahs-7374	18	62	use	use	NOUN
ahs-7374	18	63	,	,	PUNCT
ahs-7374	18	64	distribution	distribution	NOUN
ahs-7374	18	65	,	,	PUNCT
ahs-7374	18	66	and	and	CCONJ
ahs-7374	18	67	reproduction	reproduction	NOUN
ahs-7374	18	68	in	in	ADP
ahs-7374	18	69	any	any	DET
ahs-7374	18	70	medium	medium	NOUN
ahs-7374	18	71	,	,	PUNCT
ahs-7374	18	72	provided	provide	VERB
ahs-7374	18	73	the	the	DET
ahs-7374	18	74	original	original	ADJ
ahs-7374	18	75	author	author	NOUN
ahs-7374	18	76	and	and	CCONJ
ahs-7374	18	77	source	source	NOUN
ahs-7374	18	78	are	be	AUX
ahs-7374	18	79	credited	credit	VERB
ahs-7374	18	80	.	.	PUNCT
ahs-7374	19	1	data	datum	NOUN
ahs-7374	19	2	availability	availability	NOUN
ahs-7374	19	3	statement	statement	NOUN
ahs-7374	19	4	:	:	PUNCT
ahs-7374	19	5	all	all	DET
ahs-7374	19	6	relevant	relevant	ADJ
ahs-7374	19	7	data	datum	NOUN
ahs-7374	19	8	are	be	AUX
ahs-7374	19	9	within	within	ADP
ahs-7374	19	10	the	the	DET
ahs-7374	19	11	paper	paper	NOUN
ahs-7374	19	12	and	and	CCONJ
ahs-7374	19	13	its	its	PRON
ahs-7374	19	14	supporting	support	VERB
ahs-7374	19	15	information	information	NOUN
ahs-7374	19	16	files	file	NOUN
ahs-7374	19	17	.	.	PUNCT
ahs-7374	20	1	competing	compete	VERB
ahs-7374	20	2	interests	interest	NOUN
ahs-7374	20	3	:	:	PUNCT
ahs-7374	20	4	the	the	DET
ahs-7374	20	5	authors	author	NOUN
ahs-7374	20	6	declare	declare	VERB
ahs-7374	20	7	no	no	DET
ahs-7374	20	8	competing	compete	VERB
ahs-7374	20	9	interests	interest	NOUN
ahs-7374	20	10	.	.	PUNCT
ahs-7374	21	1	received	receive	VERB
ahs-7374	21	2	for	for	ADP
ahs-7374	21	3	publication	publication	NOUN
ahs-7374	21	4	28	28	NUM
ahs-7374	21	5	june	june	PROPN
ahs-7374	21	6	2019	2019	NUM
ahs-7374	21	7	accepted	accept	VERB
ahs-7374	21	8	for	for	ADP
ahs-7374	21	9	publication	publication	NOUN
ahs-7374	21	10	1	1	NUM
ahs-7374	21	11	august	august	PROPN
ahs-7374	21	12	2019	2019	NUM
ahs-7374	21	13	ahs	ahs	NOUN
ahs-7374	21	14	advances	advance	NOUN
ahs-7374	21	15	in	in	ADP
ahs-7374	21	16	horticultural	horticultural	ADJ
ahs-7374	21	17	science	science	NOUN
ahs-7374	21	18	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-7374	21	19	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-7374	21	20	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-7374	21	21	adv	adv	PROPN
ahs-7374	21	22	.	.	PUNCT
ahs-7374	21	23	hort	hort	PROPN
ahs-7374	21	24	.	.	PUNCT
ahs-7374	22	1	sci	sci	PROPN
ahs-7374	22	2	.	.	PROPN
ahs-7374	22	3	,	,	PUNCT
ahs-7374	22	4	2019	2019	NUM
ahs-7374	22	5	33(3	33(3	NOUN
ahs-7374	22	6	):	):	PUNCT
ahs-7374	22	7	403	403	NUM
ahs-7374	22	8	-	-	SYM
ahs-7374	22	9	408	408	NUM
ahs-7374	22	10	404	404	NUM
ahs-7374	22	11	germplasm	germplasm	NOUN
ahs-7374	22	12	to	to	ADP
ahs-7374	22	13	the	the	DET
ahs-7374	22	14	new	new	ADJ
ahs-7374	22	15	conditions	condition	NOUN
ahs-7374	22	16	which	which	PRON
ahs-7374	22	17	may	may	AUX
ahs-7374	22	18	poses	pose	VERB
ahs-7374	22	19	the	the	DET
ahs-7374	22	20	farmers	farmer	NOUN
ahs-7374	22	21	revenue	revenue	NOUN
ahs-7374	22	22	at	at	ADP
ahs-7374	22	23	risk	risk	NOUN
ahs-7374	22	24	.	.	PUNCT
ahs-7374	23	1	the	the	DET
ahs-7374	23	2	choices	choice	NOUN
ahs-7374	23	3	to	to	PART
ahs-7374	23	4	be	be	AUX
ahs-7374	23	5	undertaken	undertake	VERB
ahs-7374	23	6	are	be	AUX
ahs-7374	23	7	very	very	ADV
ahs-7374	23	8	delicate	delicate	ADJ
ahs-7374	23	9	and	and	CCONJ
ahs-7374	23	10	consequences	consequence	NOUN
ahs-7374	23	11	may	may	AUX
ahs-7374	23	12	be	be	AUX
ahs-7374	23	13	devastating	devastating	ADJ
ahs-7374	23	14	if	if	SCONJ
ahs-7374	23	15	not	not	PART
ahs-7374	23	16	based	base	VERB
ahs-7374	23	17	on	on	ADP
ahs-7374	23	18	preliminary	preliminary	ADJ
ahs-7374	23	19	scientific	scientific	ADJ
ahs-7374	23	20	investigations	investigation	NOUN
ahs-7374	23	21	.	.	PUNCT
ahs-7374	24	1	nangarhār	nangarhār	NOUN
ahs-7374	24	2	(	(	PUNCT
ahs-7374	24	3	pashto	pashto	NOUN
ahs-7374	24	4	:	:	PUNCT
ahs-7374	24	5	راهرګنن	راهرګنن	ADJ
ahs-7374	24	6	;	;	PUNCT
ahs-7374	24	7	persian	persian	ADJ
ahs-7374	24	8	:	:	PUNCT
ahs-7374	24	9	راهرگنن	راهرگنن	ADJ
ahs-7374	24	10	)	)	PUNCT
ahs-7374	24	11	,	,	PUNCT
ahs-7374	24	12	laghman	laghman	PROPN
ahs-7374	24	13	and	and	CCONJ
ahs-7374	24	14	kunar	kunar	NOUN
ahs-7374	24	15	are	be	AUX
ahs-7374	24	16	three	three	NUM
ahs-7374	24	17	of	of	ADP
ahs-7374	24	18	the	the	DET
ahs-7374	24	19	34	34	NUM
ahs-7374	24	20	provinces	province	NOUN
ahs-7374	24	21	of	of	ADP
ahs-7374	24	22	afghanistan	afghanistan	PROPN
ahs-7374	24	23	,	,	PUNCT
ahs-7374	24	24	located	locate	VERB
ahs-7374	24	25	in	in	ADP
ahs-7374	24	26	the	the	DET
ahs-7374	24	27	eastern	eastern	ADJ
ahs-7374	24	28	part	part	NOUN
ahs-7374	24	29	of	of	ADP
ahs-7374	24	30	the	the	DET
ahs-7374	24	31	country	country	NOUN
ahs-7374	24	32	.	.	PUNCT
ahs-7374	25	1	the	the	DET
ahs-7374	25	2	lowlands	lowland	NOUN
ahs-7374	25	3	in	in	ADP
ahs-7374	25	4	those	those	DET
ahs-7374	25	5	regions	region	NOUN
ahs-7374	25	6	benefit	benefit	VERB
ahs-7374	25	7	from	from	ADP
ahs-7374	25	8	a	a	DET
ahs-7374	25	9	semi	semi	ADJ
ahs-7374	25	10	-	-	ADJ
ahs-7374	25	11	tropical	tropical	ADJ
ahs-7374	25	12	climate	climate	NOUN
ahs-7374	25	13	and	and	CCONJ
ahs-7374	25	14	have	have	VERB
ahs-7374	25	15	the	the	DET
ahs-7374	25	16	highest	high	ADJ
ahs-7374	25	17	proportion	proportion	NOUN
ahs-7374	25	18	of	of	ADP
ahs-7374	25	19	high	high	ADJ
ahs-7374	25	20	cropping	cropping	NOUN
ahs-7374	25	21	intensity	intensity	NOUN
ahs-7374	25	22	irrigated	irrigate	VERB
ahs-7374	25	23	land	land	NOUN
ahs-7374	25	24	in	in	ADP
ahs-7374	25	25	the	the	DET
ahs-7374	25	26	country	country	NOUN
ahs-7374	25	27	.	.	PUNCT
ahs-7374	26	1	the	the	DET
ahs-7374	26	2	riverine	riverine	NOUN
ahs-7374	26	3	farms	farm	NOUN
ahs-7374	26	4	,	,	PUNCT
ahs-7374	26	5	situated	situate	VERB
ahs-7374	26	6	along	along	ADP
ahs-7374	26	7	valley	valley	NOUN
ahs-7374	26	8	bottoms	bottom	NOUN
ahs-7374	26	9	of	of	ADP
ahs-7374	26	10	varying	vary	VERB
ahs-7374	26	11	widths	width	NOUN
ahs-7374	26	12	,	,	PUNCT
ahs-7374	26	13	produce	produce	VERB
ahs-7374	26	14	a	a	DET
ahs-7374	26	15	range	range	NOUN
ahs-7374	26	16	of	of	ADP
ahs-7374	26	17	crops	crop	NOUN
ahs-7374	26	18	throughout	throughout	ADP
ahs-7374	26	19	the	the	DET
ahs-7374	26	20	year	year	NOUN
ahs-7374	26	21	.	.	PUNCT
ahs-7374	27	1	semitropical	semitropical	ADJ
ahs-7374	27	2	crops	crop	NOUN
ahs-7374	27	3	such	such	ADJ
ahs-7374	27	4	as	as	ADP
ahs-7374	27	5	citrus	citrus	NOUN
ahs-7374	27	6	,	,	PUNCT
ahs-7374	27	7	sugar	sugar	NOUN
ahs-7374	27	8	canes	cane	NOUN
ahs-7374	27	9	and	and	CCONJ
ahs-7374	27	10	henna	henna	NOUN
ahs-7374	27	11	are	be	AUX
ahs-7374	27	12	produced	produce	VERB
ahs-7374	27	13	around	around	ADP
ahs-7374	27	14	jalalabad	jalalabad	PROPN
ahs-7374	27	15	.	.	PUNCT
ahs-7374	28	1	high	high	ADJ
ahs-7374	28	2	potential	potential	NOUN
ahs-7374	28	3	for	for	ADP
ahs-7374	28	4	fruits	fruit	NOUN
ahs-7374	28	5	production	production	NOUN
ahs-7374	28	6	occurs	occur	VERB
ahs-7374	28	7	in	in	ADP
ahs-7374	28	8	those	those	DET
ahs-7374	28	9	regions	region	NOUN
ahs-7374	28	10	despite	despite	SCONJ
ahs-7374	28	11	the	the	DET
ahs-7374	28	12	still	still	ADV
ahs-7374	28	13	ongoing	ongoing	ADJ
ahs-7374	28	14	conflict	conflict	NOUN
ahs-7374	28	15	.	.	PUNCT
ahs-7374	29	1	promoting	promote	VERB
ahs-7374	29	2	commercial	commercial	ADJ
ahs-7374	29	3	orchards	orchard	NOUN
ahs-7374	29	4	,	,	PUNCT
ahs-7374	29	5	establishment	establishment	NOUN
ahs-7374	29	6	through	through	ADP
ahs-7374	29	7	professional	professional	ADJ
ahs-7374	29	8	nurseries	nursery	NOUN
ahs-7374	29	9	,	,	PUNCT
ahs-7374	29	10	farmers	farmer	NOUN
ahs-7374	29	11	investment	investment	NOUN
ahs-7374	29	12	,	,	PUNCT
ahs-7374	29	13	extension	extension	NOUN
ahs-7374	29	14	service	service	NOUN
ahs-7374	29	15	with	with	ADP
ahs-7374	29	16	technical	technical	ADJ
ahs-7374	29	17	input	input	NOUN
ahs-7374	29	18	from	from	ADP
ahs-7374	29	19	neighboring	neighboring	NOUN
ahs-7374	29	20	countries	country	NOUN
ahs-7374	29	21	and	and	CCONJ
ahs-7374	29	22	research	research	NOUN
ahs-7374	29	23	are	be	AUX
ahs-7374	29	24	therefore	therefore	ADV
ahs-7374	29	25	welcome	welcome	ADJ
ahs-7374	29	26	to	to	PART
ahs-7374	29	27	develop	develop	VERB
ahs-7374	29	28	the	the	DET
ahs-7374	29	29	potential	potential	NOUN
ahs-7374	29	30	for	for	ADP
ahs-7374	29	31	fruit	fruit	NOUN
ahs-7374	29	32	production	production	NOUN
ahs-7374	29	33	and	and	CCONJ
ahs-7374	29	34	marketing	marketing	NOUN
ahs-7374	29	35	in	in	ADP
ahs-7374	29	36	the	the	DET
ahs-7374	29	37	afghan	afghan	ADJ
ahs-7374	29	38	eastern	eastern	ADJ
ahs-7374	29	39	region	region	NOUN
ahs-7374	29	40	(	(	PUNCT
ahs-7374	29	41	giordani	giordani	PROPN
ahs-7374	29	42	et	et	PROPN
ahs-7374	29	43	al	al	PROPN
ahs-7374	29	44	.	.	PROPN
ahs-7374	29	45	,	,	PUNCT
ahs-7374	29	46	2014	2014	NUM
ahs-7374	29	47	)	)	PUNCT
ahs-7374	29	48	.	.	PUNCT
ahs-7374	30	1	a	a	DET
ahs-7374	30	2	screening	screening	NOUN
ahs-7374	30	3	of	of	ADP
ahs-7374	30	4	the	the	DET
ahs-7374	30	5	health	health	NOUN
ahs-7374	30	6	status	status	NOUN
ahs-7374	30	7	of	of	ADP
ahs-7374	30	8	the	the	DET
ahs-7374	30	9	afghan	afghan	ADJ
ahs-7374	30	10	germplasm	germplasm	NOUN
ahs-7374	30	11	of	of	ADP
ahs-7374	30	12	citrus	citrus	NOUN
ahs-7374	30	13	was	be	AUX
ahs-7374	30	14	undertaken	undertake	VERB
ahs-7374	30	15	to	to	PART
ahs-7374	30	16	ensure	ensure	VERB
ahs-7374	30	17	multiplication	multiplication	NOUN
ahs-7374	30	18	of	of	ADP
ahs-7374	30	19	not	not	PART
ahs-7374	30	20	only	only	ADV
ahs-7374	30	21	the	the	DET
ahs-7374	30	22	best	well	ADV
ahs-7374	30	23	-	-	PUNCT
ahs-7374	30	24	selected	select	VERB
ahs-7374	30	25	varieties	variety	NOUN
ahs-7374	30	26	or	or	CCONJ
ahs-7374	30	27	ecotypes	ecotype	NOUN
ahs-7374	30	28	but	but	CCONJ
ahs-7374	30	29	also	also	ADV
ahs-7374	30	30	to	to	PART
ahs-7374	30	31	avoid	avoid	VERB
ahs-7374	30	32	reproduction	reproduction	NOUN
ahs-7374	30	33	and	and	CCONJ
ahs-7374	30	34	distribution	distribution	NOUN
ahs-7374	30	35	of	of	ADP
ahs-7374	30	36	virus	virus	NOUN
ahs-7374	30	37	-	-	PUNCT
ahs-7374	30	38	infected	infect	VERB
ahs-7374	30	39	fruit	fruit	NOUN
ahs-7374	30	40	tree	tree	NOUN
ahs-7374	30	41	.	.	PUNCT
ahs-7374	31	1	in	in	ADP
ahs-7374	31	2	2012	2012	NUM
ahs-7374	31	3	a	a	DET
ahs-7374	31	4	first	first	ADJ
ahs-7374	31	5	report	report	NOUN
ahs-7374	31	6	showed	show	VERB
ahs-7374	31	7	the	the	DET
ahs-7374	31	8	occurrence	occurrence	NOUN
ahs-7374	31	9	of	of	ADP
ahs-7374	31	10	citrus	citrus	PROPN
ahs-7374	31	11	tristeza	tristeza	PROPN
ahs-7374	31	12	virus	virus	PROPN
ahs-7374	31	13	(	(	PUNCT
ahs-7374	31	14	ctv	ctv	PROPN
ahs-7374	31	15	)	)	PUNCT
ahs-7374	31	16	in	in	ADP
ahs-7374	31	17	plants	plant	NOUN
ahs-7374	31	18	sampled	sample	VERB
ahs-7374	31	19	in	in	ADP
ahs-7374	31	20	the	the	DET
ahs-7374	31	21	national	national	ADJ
ahs-7374	31	22	collection	collection	NOUN
ahs-7374	31	23	experimental	experimental	ADJ
ahs-7374	31	24	farm	farm	NOUN
ahs-7374	31	25	in	in	ADP
ahs-7374	31	26	jalalabad	jalalabad	PROPN
ahs-7374	31	27	(	(	PUNCT
ahs-7374	31	28	nangarhar	nangarhar	PROPN
ahs-7374	31	29	province	province	PROPN
ahs-7374	31	30	)	)	PUNCT
ahs-7374	32	1	(	(	PUNCT
ahs-7374	32	2	rehman	rehman	NOUN
ahs-7374	32	3	et	et	PROPN
ahs-7374	32	4	al	al	PROPN
ahs-7374	32	5	.	.	PROPN
ahs-7374	32	6	,	,	PUNCT
ahs-7374	32	7	2012	2012	NUM
ahs-7374	32	8	)	)	PUNCT
ahs-7374	32	9	.	.	PUNCT
ahs-7374	33	1	a	a	DET
ahs-7374	33	2	successive	successive	ADJ
ahs-7374	33	3	investigation	investigation	NOUN
ahs-7374	33	4	showed	show	VERB
ahs-7374	33	5	that	that	SCONJ
ahs-7374	33	6	ctv	ctv	PROPN
ahs-7374	33	7	was	be	AUX
ahs-7374	33	8	detected	detect	VERB
ahs-7374	33	9	in	in	ADP
ahs-7374	33	10	several	several	ADJ
ahs-7374	33	11	samples	sample	NOUN
ahs-7374	33	12	collected	collect	VERB
ahs-7374	33	13	in	in	ADP
ahs-7374	33	14	some	some	DET
ahs-7374	33	15	farms	farm	NOUN
ahs-7374	33	16	located	locate	VERB
ahs-7374	33	17	in	in	ADP
ahs-7374	33	18	the	the	DET
ahs-7374	33	19	nangarhar	nangarhar	PROPN
ahs-7374	33	20	valley	valley	NOUN
ahs-7374	33	21	,	,	PUNCT
ahs-7374	33	22	a	a	DET
ahs-7374	33	23	warning	warning	NOUN
ahs-7374	33	24	that	that	SCONJ
ahs-7374	33	25	ctv	ctv	PROPN
ahs-7374	33	26	could	could	AUX
ahs-7374	33	27	spread	spread	VERB
ahs-7374	33	28	rapidly	rapidly	ADV
ahs-7374	33	29	if	if	SCONJ
ahs-7374	33	30	sensitive	sensitive	ADJ
ahs-7374	33	31	citrus	citrus	NOUN
ahs-7374	33	32	cultivars	cultivar	NOUN
ahs-7374	33	33	would	would	AUX
ahs-7374	33	34	be	be	AUX
ahs-7374	33	35	introduced	introduce	VERB
ahs-7374	33	36	in	in	ADP
ahs-7374	33	37	the	the	DET
ahs-7374	33	38	area	area	NOUN
ahs-7374	33	39	.	.	PUNCT
ahs-7374	34	1	however	however	ADV
ahs-7374	34	2	,	,	PUNCT
ahs-7374	34	3	citrus	citrus	ADJ
ahs-7374	34	4	cultivation	cultivation	NOUN
ahs-7374	34	5	is	be	AUX
ahs-7374	34	6	still	still	ADV
ahs-7374	34	7	thriving	thrive	VERB
ahs-7374	34	8	in	in	ADP
ahs-7374	34	9	nangarhar	nangarhar	PROPN
ahs-7374	34	10	valley	valley	NOUN
ahs-7374	34	11	despite	despite	SCONJ
ahs-7374	34	12	the	the	DET
ahs-7374	34	13	widespread	widespread	ADJ
ahs-7374	34	14	presence	presence	NOUN
ahs-7374	34	15	of	of	ADP
ahs-7374	34	16	ctv	ctv	PROPN
ahs-7374	34	17	.	.	PUNCT
ahs-7374	35	1	different	different	ADJ
ahs-7374	35	2	possibilities	possibility	NOUN
ahs-7374	35	3	are	be	AUX
ahs-7374	35	4	therefore	therefore	ADV
ahs-7374	35	5	to	to	PART
ahs-7374	35	6	be	be	AUX
ahs-7374	35	7	considered	consider	VERB
ahs-7374	35	8	:	:	PUNCT
ahs-7374	35	9	1	1	X
ahs-7374	35	10	)	)	PUNCT
ahs-7374	35	11	the	the	DET
ahs-7374	35	12	local	local	ADJ
ahs-7374	35	13	germplasm	germplasm	NOUN
ahs-7374	35	14	is	be	AUX
ahs-7374	35	15	made	make	VERB
ahs-7374	35	16	up	up	ADP
ahs-7374	35	17	of	of	ADP
ahs-7374	35	18	low	low	ADJ
ahs-7374	35	19	reactive	reactive	ADJ
ahs-7374	35	20	host	host	NOUN
ahs-7374	35	21	species	specie	NOUN
ahs-7374	35	22	which	which	PRON
ahs-7374	35	23	do	do	AUX
ahs-7374	35	24	not	not	PART
ahs-7374	35	25	heavily	heavily	ADV
ahs-7374	35	26	show	show	VERB
ahs-7374	35	27	the	the	DET
ahs-7374	35	28	symptoms	symptom	NOUN
ahs-7374	35	29	of	of	ADP
ahs-7374	35	30	the	the	DET
ahs-7374	35	31	disease	disease	NOUN
ahs-7374	35	32	;	;	PUNCT
ahs-7374	35	33	2	2	X
ahs-7374	35	34	)	)	PUNCT
ahs-7374	35	35	mild	mild	ADJ
ahs-7374	35	36	ctv	ctv	NOUN
ahs-7374	35	37	isolates	isolate	NOUN
ahs-7374	35	38	established	establish	VERB
ahs-7374	35	39	in	in	ADP
ahs-7374	35	40	the	the	DET
ahs-7374	35	41	area	area	NOUN
ahs-7374	35	42	;	;	PUNCT
ahs-7374	35	43	3	3	X
ahs-7374	35	44	)	)	PUNCT
ahs-7374	35	45	an	an	DET
ahs-7374	35	46	unknown	unknown	ADJ
ahs-7374	35	47	source	source	NOUN
ahs-7374	35	48	of	of	ADP
ahs-7374	35	49	resistance	resistance	NOUN
ahs-7374	35	50	to	to	ADP
ahs-7374	35	51	ctv	ctv	PROPN
ahs-7374	35	52	is	be	AUX
ahs-7374	35	53	occurring	occur	VERB
ahs-7374	35	54	in	in	ADP
ahs-7374	35	55	the	the	DET
ahs-7374	35	56	area	area	NOUN
ahs-7374	35	57	.	.	PUNCT
ahs-7374	36	1	before	before	ADP
ahs-7374	36	2	introducing	introduce	VERB
ahs-7374	36	3	new	new	ADJ
ahs-7374	36	4	rootstocks	rootstock	NOUN
ahs-7374	36	5	resistant	resistant	ADJ
ahs-7374	36	6	to	to	ADP
ahs-7374	36	7	such	such	ADJ
ahs-7374	36	8	disease	disease	NOUN
ahs-7374	36	9	,	,	PUNCT
ahs-7374	36	10	another	another	DET
ahs-7374	36	11	survey	survey	NOUN
ahs-7374	36	12	was	be	AUX
ahs-7374	36	13	conducted	conduct	VERB
ahs-7374	36	14	in	in	ADP
ahs-7374	36	15	order	order	NOUN
ahs-7374	36	16	to	to	PART
ahs-7374	36	17	identify	identify	VERB
ahs-7374	36	18	the	the	DET
ahs-7374	36	19	main	main	ADJ
ahs-7374	36	20	species	specie	NOUN
ahs-7374	36	21	of	of	ADP
ahs-7374	36	22	citrus	citrus	NOUN
ahs-7374	36	23	.	.	PUNCT
ahs-7374	37	1	this	this	PRON
ahs-7374	37	2	is	be	AUX
ahs-7374	37	3	to	to	PART
ahs-7374	37	4	address	address	VERB
ahs-7374	37	5	the	the	DET
ahs-7374	37	6	choices	choice	NOUN
ahs-7374	37	7	to	to	PART
ahs-7374	37	8	be	be	AUX
ahs-7374	37	9	undertaken	undertake	VERB
ahs-7374	37	10	for	for	ADP
ahs-7374	37	11	the	the	DET
ahs-7374	37	12	establishment	establishment	NOUN
ahs-7374	37	13	of	of	ADP
ahs-7374	37	14	a	a	DET
ahs-7374	37	15	modern	modern	ADJ
ahs-7374	37	16	cropping	cropping	NOUN
ahs-7374	37	17	system	system	NOUN
ahs-7374	37	18	according	accord	VERB
ahs-7374	37	19	to	to	ADP
ahs-7374	37	20	the	the	DET
ahs-7374	37	21	market	market	NOUN
ahs-7374	37	22	demand	demand	NOUN
ahs-7374	37	23	and	and	CCONJ
ahs-7374	37	24	to	to	PART
ahs-7374	37	25	prevent	prevent	VERB
ahs-7374	37	26	the	the	DET
ahs-7374	37	27	diffusion	diffusion	NOUN
ahs-7374	37	28	of	of	ADP
ahs-7374	37	29	quarantine	quarantine	NOUN
ahs-7374	37	30	diseases	disease	NOUN
ahs-7374	37	31	.	.	PUNCT
ahs-7374	38	1	usually	usually	ADV
ahs-7374	38	2	,	,	PUNCT
ahs-7374	38	3	identification	identification	NOUN
ahs-7374	38	4	of	of	ADP
ahs-7374	38	5	the	the	DET
ahs-7374	38	6	cultivated	cultivate	VERB
ahs-7374	38	7	species	specie	NOUN
ahs-7374	38	8	relies	rely	VERB
ahs-7374	38	9	on	on	ADP
ahs-7374	38	10	the	the	DET
ahs-7374	38	11	use	use	NOUN
ahs-7374	38	12	of	of	ADP
ahs-7374	38	13	phenotypic	phenotypic	ADJ
ahs-7374	38	14	descriptors	descriptor	NOUN
ahs-7374	38	15	(	(	PUNCT
ahs-7374	38	16	upov	upov	NOUN
ahs-7374	38	17	)	)	PUNCT
ahs-7374	38	18	.	.	PUNCT
ahs-7374	39	1	phenotypic	phenotypic	ADJ
ahs-7374	39	2	descriptors	descriptor	NOUN
ahs-7374	39	3	are	be	AUX
ahs-7374	39	4	often	often	ADV
ahs-7374	39	5	subjected	subject	VERB
ahs-7374	39	6	to	to	ADP
ahs-7374	39	7	the	the	DET
ahs-7374	39	8	observer	observer	NOUN
ahs-7374	39	9	’s	’s	PART
ahs-7374	39	10	opinion	opinion	NOUN
ahs-7374	39	11	and	and	CCONJ
ahs-7374	39	12	the	the	DET
ahs-7374	39	13	environment	environment	NOUN
ahs-7374	39	14	can	can	AUX
ahs-7374	39	15	deeply	deeply	ADV
ahs-7374	39	16	affect	affect	VERB
ahs-7374	39	17	the	the	DET
ahs-7374	39	18	behavior	behavior	NOUN
ahs-7374	39	19	of	of	ADP
ahs-7374	39	20	the	the	DET
ahs-7374	39	21	plant	plant	NOUN
ahs-7374	39	22	,	,	PUNCT
ahs-7374	39	23	determining	determine	VERB
ahs-7374	39	24	errors	error	NOUN
ahs-7374	39	25	in	in	ADP
ahs-7374	39	26	the	the	DET
ahs-7374	39	27	species	species	NOUN
ahs-7374	39	28	attribution	attribution	NOUN
ahs-7374	39	29	.	.	PUNCT
ahs-7374	40	1	a	a	DET
ahs-7374	40	2	more	more	ADV
ahs-7374	40	3	reliable	reliable	ADJ
ahs-7374	40	4	system	system	NOUN
ahs-7374	40	5	to	to	PART
ahs-7374	40	6	identify	identify	VERB
ahs-7374	40	7	species	specie	NOUN
ahs-7374	40	8	is	be	AUX
ahs-7374	40	9	based	base	VERB
ahs-7374	40	10	on	on	ADP
ahs-7374	40	11	the	the	DET
ahs-7374	40	12	genetic	genetic	ADJ
ahs-7374	40	13	analysis	analysis	NOUN
ahs-7374	40	14	and	and	CCONJ
ahs-7374	40	15	particularly	particularly	ADV
ahs-7374	40	16	on	on	ADP
ahs-7374	40	17	the	the	DET
ahs-7374	40	18	dna	dna	NOUN
ahs-7374	40	19	barcoding	barcoding	NOUN
ahs-7374	40	20	procedure	procedure	NOUN
ahs-7374	40	21	which	which	PRON
ahs-7374	40	22	consists	consist	VERB
ahs-7374	40	23	in	in	ADP
ahs-7374	40	24	the	the	DET
ahs-7374	40	25	comparison	comparison	NOUN
ahs-7374	40	26	of	of	ADP
ahs-7374	40	27	highly	highly	ADV
ahs-7374	40	28	conserved	conserve	VERB
ahs-7374	40	29	sequences	sequence	NOUN
ahs-7374	40	30	located	locate	VERB
ahs-7374	40	31	in	in	ADP
ahs-7374	40	32	the	the	DET
ahs-7374	40	33	ribosomal	ribosomal	NOUN
ahs-7374	40	34	nuclear	nuclear	NOUN
ahs-7374	40	35	(	(	PUNCT
ahs-7374	40	36	sun	sun	PROPN
ahs-7374	40	37	et	et	PROPN
ahs-7374	40	38	al	al	PROPN
ahs-7374	40	39	.	.	PROPN
ahs-7374	40	40	,	,	PUNCT
ahs-7374	40	41	2015	2015	NUM
ahs-7374	40	42	)	)	PUNCT
ahs-7374	40	43	or	or	CCONJ
ahs-7374	40	44	plastid	plastid	ADJ
ahs-7374	40	45	dna	dna	NOUN
ahs-7374	40	46	(	(	PUNCT
ahs-7374	40	47	taberlet	taberlet	NOUN
ahs-7374	40	48	et	et	PROPN
ahs-7374	40	49	al	al	PROPN
ahs-7374	40	50	.	.	PROPN
ahs-7374	40	51	,	,	PUNCT
ahs-7374	40	52	1991	1991	NUM
ahs-7374	40	53	;	;	PUNCT
ahs-7374	40	54	penjor	penjor	ADP
ahs-7374	40	55	et	et	PROPN
ahs-7374	40	56	al	al	PROPN
ahs-7374	40	57	.	.	PROPN
ahs-7374	40	58	,	,	PUNCT
ahs-7374	40	59	2010	2010	NUM
ahs-7374	40	60	,	,	PUNCT
ahs-7374	40	61	2013	2013	NUM
ahs-7374	40	62	)	)	PUNCT
ahs-7374	40	63	.	.	PUNCT
ahs-7374	41	1	being	be	AUX
ahs-7374	41	2	highly	highly	ADV
ahs-7374	41	3	conserved	conserve	VERB
ahs-7374	41	4	,	,	PUNCT
ahs-7374	41	5	such	such	ADJ
ahs-7374	41	6	fragments	fragment	NOUN
ahs-7374	41	7	accumulate	accumulate	VERB
ahs-7374	41	8	mutations	mutation	NOUN
ahs-7374	41	9	slowly	slowly	ADV
ahs-7374	41	10	and	and	CCONJ
ahs-7374	41	11	it	it	PRON
ahs-7374	41	12	is	be	AUX
ahs-7374	41	13	possible	possible	ADJ
ahs-7374	41	14	to	to	PART
ahs-7374	41	15	design	design	VERB
ahs-7374	41	16	universal	universal	ADJ
ahs-7374	41	17	primers	primer	NOUN
ahs-7374	41	18	which	which	PRON
ahs-7374	41	19	can	can	AUX
ahs-7374	41	20	be	be	AUX
ahs-7374	41	21	used	use	VERB
ahs-7374	41	22	to	to	PART
ahs-7374	41	23	distinguish	distinguish	VERB
ahs-7374	41	24	plenty	plenty	NOUN
ahs-7374	41	25	of	of	ADP
ahs-7374	41	26	species	specie	NOUN
ahs-7374	41	27	.	.	PUNCT
ahs-7374	42	1	furthermore	furthermore	ADV
ahs-7374	42	2	,	,	PUNCT
ahs-7374	42	3	many	many	ADJ
ahs-7374	42	4	databases	database	NOUN
ahs-7374	42	5	(	(	PUNCT
ahs-7374	42	6	pubmed	pubmed	PROPN
ahs-7374	42	7	,	,	PUNCT
ahs-7374	42	8	genbank	genbank	PROPN
ahs-7374	42	9	,	,	PUNCT
ahs-7374	42	10	omim	omim	PROPN
ahs-7374	42	11	)	)	PUNCT
ahs-7374	42	12	collect	collect	VERB
ahs-7374	42	13	and	and	CCONJ
ahs-7374	42	14	store	store	VERB
ahs-7374	42	15	millions	million	NOUN
ahs-7374	42	16	of	of	ADP
ahs-7374	42	17	sequences	sequence	NOUN
ahs-7374	42	18	,	,	PUNCT
ahs-7374	42	19	which	which	PRON
ahs-7374	42	20	can	can	AUX
ahs-7374	42	21	be	be	AUX
ahs-7374	42	22	compared	compare	VERB
ahs-7374	42	23	by	by	ADP
ahs-7374	42	24	means	mean	NOUN
ahs-7374	42	25	of	of	ADP
ahs-7374	42	26	specific	specific	ADJ
ahs-7374	42	27	software	software	NOUN
ahs-7374	42	28	(	(	PUNCT
ahs-7374	42	29	blast	blast	NOUN
ahs-7374	42	30	)	)	PUNCT
ahs-7374	42	31	with	with	ADP
ahs-7374	42	32	unknown	unknown	ADJ
ahs-7374	42	33	sequences	sequence	NOUN
ahs-7374	42	34	(	(	PUNCT
ahs-7374	42	35	zhang	zhang	X
ahs-7374	42	36	et	et	PROPN
ahs-7374	42	37	al	al	PROPN
ahs-7374	42	38	.	.	PROPN
ahs-7374	42	39	,	,	PUNCT
ahs-7374	42	40	2000	2000	NUM
ahs-7374	42	41	)	)	PUNCT
ahs-7374	42	42	.	.	PUNCT
ahs-7374	43	1	when	when	SCONJ
ahs-7374	43	2	properly	properly	ADV
ahs-7374	43	3	queried	query	VERB
ahs-7374	43	4	a	a	DET
ahs-7374	43	5	dna	dna	PROPN
ahs-7374	43	6	database	database	NOUN
ahs-7374	43	7	provides	provide	VERB
ahs-7374	43	8	,	,	PUNCT
ahs-7374	43	9	along	along	ADP
ahs-7374	43	10	with	with	ADP
ahs-7374	43	11	the	the	DET
ahs-7374	43	12	alignment	alignment	NOUN
ahs-7374	43	13	,	,	PUNCT
ahs-7374	43	14	a	a	DET
ahs-7374	43	15	similarity	similarity	NOUN
ahs-7374	43	16	index	index	NOUN
ahs-7374	43	17	which	which	PRON
ahs-7374	43	18	can	can	AUX
ahs-7374	43	19	be	be	AUX
ahs-7374	43	20	useful	useful	ADJ
ahs-7374	43	21	for	for	ADP
ahs-7374	43	22	identifying	identify	VERB
ahs-7374	43	23	species	specie	NOUN
ahs-7374	43	24	or	or	CCONJ
ahs-7374	43	25	even	even	ADV
ahs-7374	43	26	sub	sub	NOUN
ahs-7374	43	27	-	-	NOUN
ahs-7374	43	28	species	specie	NOUN
ahs-7374	43	29	,	,	PUNCT
ahs-7374	43	30	depending	depend	VERB
ahs-7374	43	31	on	on	ADP
ahs-7374	43	32	the	the	DET
ahs-7374	43	33	proximity	proximity	NOUN
ahs-7374	43	34	of	of	ADP
ahs-7374	43	35	the	the	DET
ahs-7374	43	36	taxonomic	taxonomic	ADJ
ahs-7374	43	37	entities	entity	NOUN
ahs-7374	43	38	.	.	PUNCT
ahs-7374	44	1	therefore	therefore	ADV
ahs-7374	44	2	,	,	PUNCT
ahs-7374	44	3	due	due	ADP
ahs-7374	44	4	to	to	ADP
ahs-7374	44	5	the	the	DET
ahs-7374	44	6	restrictions	restriction	NOUN
ahs-7374	44	7	to	to	ADP
ahs-7374	44	8	accessibility	accessibility	NOUN
ahs-7374	44	9	to	to	ADP
ahs-7374	44	10	a	a	DET
ahs-7374	44	11	conflicting	conflicting	ADJ
ahs-7374	44	12	area	area	NOUN
ahs-7374	44	13	,	,	PUNCT
ahs-7374	44	14	a	a	DET
ahs-7374	44	15	barcoding	barcode	VERB
ahs-7374	44	16	analysis	analysis	NOUN
ahs-7374	44	17	has	have	AUX
ahs-7374	44	18	been	be	AUX
ahs-7374	44	19	carried	carry	VERB
ahs-7374	44	20	out	out	ADP
ahs-7374	44	21	in	in	ADP
ahs-7374	44	22	order	order	NOUN
ahs-7374	44	23	to	to	PART
ahs-7374	44	24	identify	identify	VERB
ahs-7374	44	25	the	the	DET
ahs-7374	44	26	species	specie	NOUN
ahs-7374	44	27	of	of	ADP
ahs-7374	44	28	citrus	citrus	NOUN
ahs-7374	44	29	which	which	PRON
ahs-7374	44	30	are	be	AUX
ahs-7374	44	31	commonly	commonly	ADV
ahs-7374	44	32	grown	grow	VERB
ahs-7374	44	33	in	in	ADP
ahs-7374	44	34	the	the	DET
ahs-7374	44	35	eastern	eastern	ADJ
ahs-7374	44	36	area	area	NOUN
ahs-7374	44	37	of	of	ADP
ahs-7374	44	38	afghanistan	afghanistan	PROPN
ahs-7374	44	39	in	in	ADP
ahs-7374	44	40	order	order	NOUN
ahs-7374	44	41	to	to	PART
ahs-7374	44	42	better	well	ADV
ahs-7374	44	43	address	address	VERB
ahs-7374	44	44	the	the	DET
ahs-7374	44	45	choices	choice	NOUN
ahs-7374	44	46	for	for	ADP
ahs-7374	44	47	a	a	DET
ahs-7374	44	48	modern	modern	ADJ
ahs-7374	44	49	fruit	fruit	NOUN
ahs-7374	44	50	culture	culture	NOUN
ahs-7374	44	51	.	.	PUNCT
ahs-7374	45	1	2	2	X
ahs-7374	45	2	.	.	X
ahs-7374	45	3	materials	material	NOUN
ahs-7374	45	4	and	and	CCONJ
ahs-7374	45	5	methods	method	NOUN
ahs-7374	45	6	plant	plant	NOUN
ahs-7374	45	7	material	material	NOUN
ahs-7374	45	8	afghan	afghan	ADJ
ahs-7374	45	9	citrus	citrus	NOUN
ahs-7374	45	10	seeds	seed	NOUN
ahs-7374	45	11	have	have	AUX
ahs-7374	45	12	been	be	AUX
ahs-7374	45	13	collected	collect	VERB
ahs-7374	45	14	in	in	ADP
ahs-7374	45	15	three	three	NUM
ahs-7374	45	16	areas	area	NOUN
ahs-7374	45	17	where	where	SCONJ
ahs-7374	45	18	citrus	citrus	NOUN
ahs-7374	45	19	fruit	fruit	NOUN
ahs-7374	45	20	trees	tree	NOUN
ahs-7374	45	21	are	be	AUX
ahs-7374	45	22	intensively	intensively	ADV
ahs-7374	45	23	cultivated	cultivate	VERB
ahs-7374	45	24	(	(	PUNCT
ahs-7374	45	25	laghman	laghman	PROPN
ahs-7374	45	26	,	,	PUNCT
ahs-7374	45	27	kunar	kunar	NOUN
ahs-7374	45	28	and	and	CCONJ
ahs-7374	45	29	nangarhar	nangarhar	PROPN
ahs-7374	45	30	)	)	PUNCT
ahs-7374	45	31	in	in	ADP
ahs-7374	45	32	eastern	eastern	ADJ
ahs-7374	45	33	afghanistan	afghanistan	PROPN
ahs-7374	45	34	(	(	PUNCT
ahs-7374	45	35	fig	fig	NOUN
ahs-7374	45	36	.	.	PUNCT
ahs-7374	46	1	1	1	NUM
ahs-7374	46	2	)	)	PUNCT
ahs-7374	46	3	.	.	PUNCT
ahs-7374	47	1	we	we	PRON
ahs-7374	47	2	used	use	VERB
ahs-7374	47	3	seeds	seed	NOUN
ahs-7374	47	4	because	because	SCONJ
ahs-7374	47	5	they	they	PRON
ahs-7374	47	6	can	can	AUX
ahs-7374	47	7	fig	fig	VERB
ahs-7374	47	8	.	.	PUNCT
ahs-7374	48	1	1	1	NUM
ahs-7374	48	2	map	map	NOUN
ahs-7374	48	3	of	of	ADP
ahs-7374	48	4	afghanistan	afghanistan	PROPN
ahs-7374	48	5	showing	show	VERB
ahs-7374	48	6	the	the	DET
ahs-7374	48	7	provinces	province	NOUN
ahs-7374	48	8	where	where	SCONJ
ahs-7374	48	9	citrus	citrus	NOUN
ahs-7374	48	10	production	production	NOUN
ahs-7374	48	11	is	be	AUX
ahs-7374	48	12	located	locate	VERB
ahs-7374	48	13	and	and	CCONJ
ahs-7374	48	14	where	where	SCONJ
ahs-7374	48	15	the	the	DET
ahs-7374	48	16	survey	survey	NOUN
ahs-7374	48	17	was	be	AUX
ahs-7374	48	18	carried	carry	VERB
ahs-7374	48	19	on	on	ADP
ahs-7374	48	20	.	.	PUNCT
ahs-7374	49	1	gori	gori	PROPN
ahs-7374	49	2	et	et	PROPN
ahs-7374	49	3	al	al	PROPN
ahs-7374	49	4	.	.	PROPN
ahs-7374	50	1	‐	‐	ADJ
ahs-7374	50	2	barcoding	barcoding	NOUN
ahs-7374	50	3	assessment	assessment	NOUN
ahs-7374	50	4	of	of	ADP
ahs-7374	50	5	the	the	DET
ahs-7374	50	6	afghan	afghan	ADJ
ahs-7374	50	7	citrus	citrus	NOUN
ahs-7374	50	8	population	population	NOUN
ahs-7374	50	9	405	405	NUM
ahs-7374	50	10	be	be	AUX
ahs-7374	50	11	easily	easily	ADV
ahs-7374	50	12	transported	transport	VERB
ahs-7374	50	13	.	.	PUNCT
ahs-7374	51	1	furthermore	furthermore	ADV
ahs-7374	51	2	,	,	PUNCT
ahs-7374	51	3	most	most	ADJ
ahs-7374	51	4	citrus	citrus	NOUN
ahs-7374	51	5	species	specie	NOUN
ahs-7374	51	6	are	be	AUX
ahs-7374	51	7	characterized	characterize	VERB
ahs-7374	51	8	by	by	ADP
ahs-7374	51	9	adventitious	adventitious	ADJ
ahs-7374	51	10	embryony	embryony	NOUN
ahs-7374	51	11	and	and	CCONJ
ahs-7374	51	12	seeds	seed	NOUN
ahs-7374	51	13	originate	originate	VERB
ahs-7374	51	14	individuals	individual	NOUN
ahs-7374	51	15	which	which	PRON
ahs-7374	51	16	are	be	AUX
ahs-7374	51	17	true	true	ADJ
ahs-7374	51	18	clones	clone	NOUN
ahs-7374	51	19	of	of	ADP
ahs-7374	51	20	the	the	DET
ahs-7374	51	21	mother	mother	NOUN
ahs-7374	51	22	plant	plant	NOUN
ahs-7374	51	23	because	because	SCONJ
ahs-7374	51	24	rarely	rarely	ADV
ahs-7374	51	25	zygotic	zygotic	ADJ
ahs-7374	51	26	embryo	embryo	NOUN
ahs-7374	51	27	survives	survive	VERB
ahs-7374	51	28	.	.	PUNCT
ahs-7374	52	1	most	most	ADJ
ahs-7374	52	2	sequences	sequence	NOUN
ahs-7374	52	3	for	for	ADP
ahs-7374	52	4	dna	dna	PROPN
ahs-7374	52	5	barcoding	barcoding	NOUN
ahs-7374	52	6	,	,	PUNCT
ahs-7374	52	7	being	be	AUX
ahs-7374	52	8	located	locate	VERB
ahs-7374	52	9	in	in	ADP
ahs-7374	52	10	the	the	DET
ahs-7374	52	11	plastid	plastid	ADJ
ahs-7374	52	12	or	or	CCONJ
ahs-7374	52	13	mitochondrial	mitochondrial	ADJ
ahs-7374	52	14	dna	dna	NOUN
ahs-7374	52	15	,	,	PUNCT
ahs-7374	52	16	are	be	AUX
ahs-7374	52	17	inherited	inherit	VERB
ahs-7374	52	18	only	only	ADV
ahs-7374	52	19	from	from	ADP
ahs-7374	52	20	the	the	DET
ahs-7374	52	21	maternal	maternal	ADJ
ahs-7374	52	22	line	line	NOUN
ahs-7374	52	23	,	,	PUNCT
ahs-7374	52	24	therefore	therefore	ADV
ahs-7374	52	25	germinating	germinate	VERB
ahs-7374	52	26	seeds	seed	NOUN
ahs-7374	52	27	produce	produce	VERB
ahs-7374	52	28	plants	plant	NOUN
ahs-7374	52	29	whose	whose	DET
ahs-7374	52	30	organelle	organelle	NOUN
ahs-7374	52	31	genomes	genome	NOUN
ahs-7374	52	32	are	be	AUX
ahs-7374	52	33	not	not	PART
ahs-7374	52	34	affected	affect	VERB
ahs-7374	52	35	by	by	ADP
ahs-7374	52	36	the	the	DET
ahs-7374	52	37	pollen	pollen	NOUN
ahs-7374	52	38	donor	donor	NOUN
ahs-7374	52	39	plant	plant	NOUN
ahs-7374	52	40	,	,	PUNCT
ahs-7374	52	41	but	but	CCONJ
ahs-7374	52	42	are	be	AUX
ahs-7374	52	43	expected	expect	VERB
ahs-7374	52	44	to	to	PART
ahs-7374	52	45	be	be	AUX
ahs-7374	52	46	exactly	exactly	ADV
ahs-7374	52	47	the	the	DET
ahs-7374	52	48	same	same	ADJ
ahs-7374	52	49	as	as	ADP
ahs-7374	52	50	the	the	DET
ahs-7374	52	51	seed	seed	NOUN
ahs-7374	52	52	donor	donor	NOUN
ahs-7374	52	53	plant	plant	NOUN
ahs-7374	52	54	.	.	PUNCT
ahs-7374	53	1	in	in	ADP
ahs-7374	53	2	each	each	DET
ahs-7374	53	3	area	area	NOUN
ahs-7374	53	4	,	,	PUNCT
ahs-7374	53	5	some	some	DET
ahs-7374	53	6	plants	plant	NOUN
ahs-7374	53	7	were	be	AUX
ahs-7374	53	8	selected	select	VERB
ahs-7374	53	9	and	and	CCONJ
ahs-7374	53	10	batch	batch	NOUN
ahs-7374	53	11	of	of	ADP
ahs-7374	53	12	seeds	seed	NOUN
ahs-7374	53	13	have	have	AUX
ahs-7374	53	14	been	be	AUX
ahs-7374	53	15	collected	collect	VERB
ahs-7374	53	16	from	from	ADP
ahs-7374	53	17	single	single	ADJ
ahs-7374	53	18	fruit	fruit	NOUN
ahs-7374	53	19	.	.	PUNCT
ahs-7374	54	1	in	in	ADP
ahs-7374	54	2	table	table	NOUN
ahs-7374	54	3	1	1	NUM
ahs-7374	54	4	the	the	DET
ahs-7374	54	5	origin	origin	NOUN
ahs-7374	54	6	of	of	ADP
ahs-7374	54	7	the	the	DET
ahs-7374	54	8	seeds	seed	NOUN
ahs-7374	54	9	is	be	AUX
ahs-7374	54	10	reported	report	VERB
ahs-7374	54	11	.	.	PUNCT
ahs-7374	55	1	each	each	DET
ahs-7374	55	2	batch	batch	NOUN
ahs-7374	55	3	was	be	AUX
ahs-7374	55	4	labeled	label	VERB
ahs-7374	55	5	and	and	CCONJ
ahs-7374	55	6	delivered	deliver	VERB
ahs-7374	55	7	to	to	ADP
ahs-7374	55	8	the	the	DET
ahs-7374	55	9	plant	plant	NOUN
ahs-7374	55	10	pathology	pathology	NOUN
ahs-7374	55	11	department	department	NOUN
ahs-7374	55	12	of	of	ADP
ahs-7374	55	13	the	the	DET
ahs-7374	55	14	university	university	PROPN
ahs-7374	55	15	of	of	ADP
ahs-7374	55	16	bologna	bologna	PROPN
ahs-7374	55	17	.	.	PUNCT
ahs-7374	56	1	the	the	DET
ahs-7374	56	2	seeds	seed	NOUN
ahs-7374	56	3	were	be	AUX
ahs-7374	56	4	germinated	germinate	VERB
ahs-7374	56	5	in	in	ADP
ahs-7374	56	6	pots	pot	NOUN
ahs-7374	56	7	and	and	CCONJ
ahs-7374	56	8	leaf	leaf	NOUN
ahs-7374	56	9	samples	sample	NOUN
ahs-7374	56	10	were	be	AUX
ahs-7374	56	11	collected	collect	VERB
ahs-7374	56	12	.	.	PUNCT
ahs-7374	57	1	for	for	ADP
ahs-7374	57	2	each	each	DET
ahs-7374	57	3	seed	seed	NOUN
ahs-7374	57	4	batch	batch	NOUN
ahs-7374	57	5	,	,	PUNCT
ahs-7374	57	6	a	a	DET
ahs-7374	57	7	single	single	ADJ
ahs-7374	57	8	seedling	seedling	NOUN
ahs-7374	57	9	has	have	AUX
ahs-7374	57	10	been	be	AUX
ahs-7374	57	11	selected	select	VERB
ahs-7374	57	12	for	for	ADP
ahs-7374	57	13	dna	dna	NOUN
ahs-7374	57	14	barcoding	barcode	VERB
ahs-7374	57	15	analysis	analysis	NOUN
ahs-7374	57	16	.	.	PUNCT
ahs-7374	58	1	before	before	ADP
ahs-7374	58	2	starting	start	VERB
ahs-7374	58	3	the	the	DET
ahs-7374	58	4	present	present	ADJ
ahs-7374	58	5	work	work	NOUN
ahs-7374	58	6	,	,	PUNCT
ahs-7374	58	7	citrus	citrus	NOUN
ahs-7374	58	8	barcoding	barcode	VERB
ahs-7374	58	9	sequences	sequence	NOUN
ahs-7374	58	10	(	(	PUNCT
ahs-7374	58	11	its	its	PRON
ahs-7374	58	12	1	1	NUM
ahs-7374	58	13	and	and	CCONJ
ahs-7374	58	14	2	2	NUM
ahs-7374	58	15	,	,	PUNCT
ahs-7374	58	16	matk	matk	PROPN
ahs-7374	58	17	,	,	PUNCT
ahs-7374	58	18	rbcl	rbcl	NOUN
ahs-7374	58	19	,	,	PUNCT
ahs-7374	58	20	psba‐trnh	psba‐trnh	ADJ
ahs-7374	58	21	intergenic	intergenic	ADJ
ahs-7374	58	22	spacer	spacer	NOUN
ahs-7374	58	23	)	)	PUNCT
ahs-7374	58	24	were	be	AUX
ahs-7374	58	25	retrieved	retrieve	VERB
ahs-7374	58	26	from	from	ADP
ahs-7374	58	27	genbank	genbank	PROPN
ahs-7374	58	28	.	.	PUNCT
ahs-7374	59	1	the	the	DET
ahs-7374	59	2	dataset	dataset	NOUN
ahs-7374	59	3	was	be	AUX
ahs-7374	59	4	used	use	VERB
ahs-7374	59	5	to	to	PART
ahs-7374	59	6	compare	compare	VERB
ahs-7374	59	7	with	with	ADP
ahs-7374	59	8	the	the	DET
ahs-7374	59	9	results	result	NOUN
ahs-7374	59	10	of	of	ADP
ahs-7374	59	11	sequencing	sequence	VERB
ahs-7374	59	12	and	and	CCONJ
ahs-7374	59	13	to	to	PART
ahs-7374	59	14	assign	assign	VERB
ahs-7374	59	15	the	the	DET
ahs-7374	59	16	analysed	analyse	VERB
ahs-7374	59	17	samples	sample	NOUN
ahs-7374	59	18	to	to	ADP
ahs-7374	59	19	a	a	DET
ahs-7374	59	20	citrus	citrus	NOUN
ahs-7374	59	21	species	specie	NOUN
ahs-7374	59	22	.	.	PUNCT
ahs-7374	60	1	since	since	SCONJ
ahs-7374	60	2	the	the	DET
ahs-7374	60	3	available	available	ADJ
ahs-7374	60	4	sequences	sequence	NOUN
ahs-7374	60	5	are	be	AUX
ahs-7374	60	6	few	few	ADJ
ahs-7374	60	7	and	and	CCONJ
ahs-7374	60	8	showed	show	VERB
ahs-7374	60	9	heavy	heavy	ADJ
ahs-7374	60	10	discrepancies	discrepancy	NOUN
ahs-7374	60	11	,	,	PUNCT
ahs-7374	60	12	casting	cast	VERB
ahs-7374	60	13	doubts	doubt	NOUN
ahs-7374	60	14	about	about	ADP
ahs-7374	60	15	the	the	DET
ahs-7374	60	16	reliability	reliability	NOUN
ahs-7374	60	17	of	of	ADP
ahs-7374	60	18	the	the	DET
ahs-7374	60	19	data	datum	NOUN
ahs-7374	60	20	retrieved	retrieve	VERB
ahs-7374	60	21	online	online	ADV
ahs-7374	60	22	(	(	PUNCT
ahs-7374	60	23	bengtsson	bengtsson	NOUN
ahs-7374	60	24	-	-	PUNCT
ahs-7374	60	25	palme	palme	PROPN
ahs-7374	60	26	et	et	NOUN
ahs-7374	60	27	al	al	PROPN
ahs-7374	60	28	.	.	PROPN
ahs-7374	60	29	,	,	PUNCT
ahs-7374	60	30	2016	2016	NUM
ahs-7374	60	31	)	)	PUNCT
ahs-7374	60	32	,	,	PUNCT
ahs-7374	60	33	we	we	PRON
ahs-7374	60	34	decided	decide	VERB
ahs-7374	60	35	to	to	PART
ahs-7374	60	36	provide	provide	VERB
ahs-7374	60	37	robust	robust	ADJ
ahs-7374	60	38	references	reference	NOUN
ahs-7374	60	39	by	by	ADP
ahs-7374	60	40	analyzing	analyze	VERB
ahs-7374	60	41	accessions	accession	NOUN
ahs-7374	60	42	whose	whose	DET
ahs-7374	60	43	origin	origin	NOUN
ahs-7374	60	44	was	be	AUX
ahs-7374	60	45	absolutely	absolutely	ADV
ahs-7374	60	46	certain	certain	ADJ
ahs-7374	60	47	.	.	PUNCT
ahs-7374	61	1	therefore	therefore	ADV
ahs-7374	61	2	we	we	PRON
ahs-7374	61	3	have	have	AUX
ahs-7374	61	4	sampled	sample	VERB
ahs-7374	61	5	sour	sour	ADJ
ahs-7374	61	6	orange	orange	NOUN
ahs-7374	61	7	along	along	ADP
ahs-7374	61	8	with	with	ADP
ahs-7374	61	9	other	other	ADJ
ahs-7374	61	10	citrus	citrus	NOUN
ahs-7374	61	11	species	specie	NOUN
ahs-7374	61	12	from	from	ADP
ahs-7374	61	13	private	private	ADJ
ahs-7374	61	14	and	and	CCONJ
ahs-7374	61	15	public	public	ADJ
ahs-7374	61	16	collections	collection	NOUN
ahs-7374	61	17	(	(	PUNCT
ahs-7374	61	18	vivai	vivai	PROPN
ahs-7374	61	19	oscar	oscar	PROPN
ahs-7374	61	20	tintori	tintori	PROPN
ahs-7374	61	21	,	,	PUNCT
ahs-7374	61	22	orto	orto	X
ahs-7374	61	23	botanico	botanico	NOUN
ahs-7374	61	24	“	"	PUNCT
ahs-7374	61	25	giardino	giardino	PROPN
ahs-7374	61	26	dei	dei	NOUN
ahs-7374	61	27	semplici	semplici	NOUN
ahs-7374	61	28	”	"	PUNCT
ahs-7374	61	29	of	of	ADP
ahs-7374	61	30	the	the	DET
ahs-7374	61	31	university	university	NOUN
ahs-7374	61	32	of	of	ADP
ahs-7374	61	33	florence	florence	NOUN
ahs-7374	61	34	,	,	PUNCT
ahs-7374	61	35	istituto	istituto	NOUN
ahs-7374	61	36	agronomico	agronomico	NOUN
ahs-7374	61	37	per	per	ADP
ahs-7374	61	38	l’oltremare	l’oltremare	NOUN
ahs-7374	61	39	)	)	PUNCT
ahs-7374	61	40	in	in	ADP
ahs-7374	61	41	order	order	NOUN
ahs-7374	61	42	to	to	PART
ahs-7374	61	43	be	be	AUX
ahs-7374	61	44	compared	compare	VERB
ahs-7374	61	45	with	with	ADP
ahs-7374	61	46	the	the	DET
ahs-7374	61	47	samples	sample	NOUN
ahs-7374	61	48	coming	come	VERB
ahs-7374	61	49	from	from	ADP
ahs-7374	61	50	afghanistan	afghanistan	PROPN
ahs-7374	61	51	(	(	PUNCT
ahs-7374	61	52	table	table	NOUN
ahs-7374	61	53	2	2	NUM
ahs-7374	61	54	)	)	PUNCT
ahs-7374	61	55	.	.	PUNCT
ahs-7374	62	1	pcr	pcr	ADJ
ahs-7374	62	2	amplification	amplification	NOUN
ahs-7374	62	3	and	and	CCONJ
ahs-7374	62	4	primers	primer	NOUN
ahs-7374	62	5	total	total	ADJ
ahs-7374	62	6	dna	dna	PROPN
ahs-7374	62	7	was	be	AUX
ahs-7374	62	8	extracted	extract	VERB
ahs-7374	62	9	from	from	ADP
ahs-7374	62	10	the	the	DET
ahs-7374	62	11	selected	select	VERB
ahs-7374	62	12	plants	plant	NOUN
ahs-7374	62	13	following	follow	VERB
ahs-7374	62	14	the	the	DET
ahs-7374	62	15	guidelines	guideline	NOUN
ahs-7374	62	16	of	of	ADP
ahs-7374	62	17	the	the	DET
ahs-7374	62	18	dna	dna	PROPN
ahs-7374	62	19	invisorb	invisorb	PROPN
ahs-7374	62	20	dna	dna	PROPN
ahs-7374	62	21	extraction	extraction	NOUN
ahs-7374	62	22	kit	kit	NOUN
ahs-7374	62	23	producer	producer	NOUN
ahs-7374	62	24	(	(	PUNCT
ahs-7374	62	25	stratec	stratec	PROPN
ahs-7374	62	26	italy	italy	PROPN
ahs-7374	62	27	)	)	PUNCT
ahs-7374	62	28	.	.	PUNCT
ahs-7374	63	1	dna	dna	PROPN
ahs-7374	63	2	has	have	AUX
ahs-7374	63	3	been	be	AUX
ahs-7374	63	4	electrophoresed	electrophorese	VERB
ahs-7374	63	5	on	on	ADP
ahs-7374	63	6	an	an	DET
ahs-7374	63	7	agarose	agarose	NOUN
ahs-7374	63	8	gel	gel	NOUN
ahs-7374	63	9	to	to	PART
ahs-7374	63	10	validate	validate	VERB
ahs-7374	63	11	quality	quality	NOUN
ahs-7374	63	12	and	and	CCONJ
ahs-7374	63	13	quantity	quantity	NOUN
ahs-7374	63	14	.	.	PUNCT
ahs-7374	64	1	universal	universal	ADJ
ahs-7374	64	2	primers	primer	NOUN
ahs-7374	64	3	for	for	ADP
ahs-7374	64	4	pcr	pcr	ADJ
ahs-7374	64	5	amplification	amplification	NOUN
ahs-7374	64	6	,	,	PUNCT
ahs-7374	64	7	used	use	VERB
ahs-7374	64	8	in	in	ADP
ahs-7374	64	9	the	the	DET
ahs-7374	64	10	present	present	ADJ
ahs-7374	64	11	study	study	NOUN
ahs-7374	64	12	have	have	AUX
ahs-7374	64	13	been	be	AUX
ahs-7374	64	14	retrieved	retrieve	VERB
ahs-7374	64	15	in	in	ADP
ahs-7374	64	16	literature	literature	NOUN
ahs-7374	64	17	(	(	PUNCT
ahs-7374	64	18	chen	chen	PROPN
ahs-7374	64	19	et	et	PROPN
ahs-7374	64	20	al	al	PROPN
ahs-7374	64	21	.	.	PROPN
ahs-7374	64	22	,	,	PUNCT
ahs-7374	64	23	2010	2010	NUM
ahs-7374	64	24	;	;	PUNCT
ahs-7374	64	25	luo	luo	PROPN
ahs-7374	64	26	et	et	PROPN
ahs-7374	64	27	al	al	PROPN
ahs-7374	64	28	2010	2010	NUM
ahs-7374	64	29	;	;	PUNCT
ahs-7374	64	30	penjor	penjor	ADP
ahs-7374	64	31	et	et	PROPN
ahs-7374	64	32	al	al	PROPN
ahs-7374	64	33	.	.	PROPN
ahs-7374	64	34	,	,	PUNCT
ahs-7374	64	35	2013	2013	NUM
ahs-7374	64	36	;	;	PUNCT
ahs-7374	64	37	mahadani	mahadani	PROPN
ahs-7374	64	38	and	and	CCONJ
ahs-7374	64	39	ghosh	ghosh	PROPN
ahs-7374	64	40	,	,	PUNCT
ahs-7374	64	41	2014	2014	NUM
ahs-7374	64	42	;	;	PUNCT
ahs-7374	64	43	uchoi	uchoi	NOUN
ahs-7374	64	44	et	et	PROPN
ahs-7374	64	45	al	al	PROPN
ahs-7374	64	46	.	.	PROPN
ahs-7374	64	47	,	,	PUNCT
ahs-7374	64	48	2016	2016	NUM
ahs-7374	64	49	;	;	PUNCT
ahs-7374	64	50	wattoo	wattoo	PROPN
ahs-7374	64	51	et	et	PROPN
ahs-7374	64	52	al	al	PROPN
ahs-7374	64	53	.	.	PROPN
ahs-7374	64	54	,	,	PUNCT
ahs-7374	64	55	2016	2016	NUM
ahs-7374	64	56	;	;	PUNCT
ahs-7374	64	57	bailey	bailey	PROPN
ahs-7374	64	58	et	et	PROPN
ahs-7374	64	59	al	al	PROPN
ahs-7374	64	60	.	.	PROPN
ahs-7374	64	61	,	,	PUNCT
ahs-7374	64	62	2018	2018	NUM
ahs-7374	64	63	;	;	PUNCT
ahs-7374	64	64	zhao	zhao	X
ahs-7374	64	65	et	et	NOUN
ahs-7374	64	66	table	table	NOUN
ahs-7374	64	67	1	1	NUM
ahs-7374	64	68	list	list	NOUN
ahs-7374	64	69	of	of	ADP
ahs-7374	64	70	the	the	DET
ahs-7374	64	71	samples	sample	NOUN
ahs-7374	64	72	coming	come	VERB
ahs-7374	64	73	from	from	ADP
ahs-7374	64	74	afghanistan	afghanistan	PROPN
ahs-7374	64	75	table	table	NOUN
ahs-7374	64	76	2	2	NUM
ahs-7374	64	77	citrus	citrus	NOUN
ahs-7374	64	78	species	specie	NOUN
ahs-7374	64	79	used	use	VERB
ahs-7374	64	80	as	as	ADP
ahs-7374	64	81	control	control	NOUN
ahs-7374	64	82	,	,	PUNCT
ahs-7374	64	83	coming	come	VERB
ahs-7374	64	84	from	from	ADP
ahs-7374	64	85	public	public	ADJ
ahs-7374	64	86	and	and	CCONJ
ahs-7374	64	87	private	private	ADJ
ahs-7374	64	88	collections	collection	NOUN
ahs-7374	64	89	in	in	ADP
ahs-7374	64	90	tuscany	tuscany	PROPN
ahs-7374	64	91	sample	sample	PROPN
ahs-7374	64	92	province	province	PROPN
ahs-7374	64	93	district	district	PROPN
ahs-7374	64	94	village	village	PROPN
ahs-7374	64	95	variety	variety	PROPN
ahs-7374	64	96	af-1	af-1	ADP
ahs-7374	64	97	a	a	DET
ahs-7374	64	98	laghman	laghman	NOUN
ahs-7374	64	99	mehtarlam	mehtarlam	PROPN
ahs-7374	64	100	chardehi	chardehi	PROPN
ahs-7374	64	101	local	local	PROPN
ahs-7374	64	102	af-2	af-2	PROPN
ahs-7374	65	1	a	a	DET
ahs-7374	65	2	laghman	laghman	PROPN
ahs-7374	65	3	mehtarlam	mehtarlam	PROPN
ahs-7374	65	4	chardehi	chardehi	PROPN
ahs-7374	65	5	local	local	PROPN
ahs-7374	65	6	af-5	af-5	ADV
ahs-7374	65	7	a	a	DET
ahs-7374	65	8	laghman	laghman	NOUN
ahs-7374	65	9	mehtarlam	mehtarlam	PROPN
ahs-7374	65	10	chardehi	chardehi	PROPN
ahs-7374	65	11	local	local	PROPN
ahs-7374	65	12	af-7	af-7	ADP
ahs-7374	65	13	a	a	DET
ahs-7374	65	14	kunar	kunar	NOUN
ahs-7374	65	15	asadabad	asadabad	PROPN
ahs-7374	65	16	landi	landi	PROPN
ahs-7374	65	17	tesha	tesha	PROPN
ahs-7374	65	18	local	local	ADJ
ahs-7374	65	19	af-8	af-8	ADP
ahs-7374	65	20	a	a	DET
ahs-7374	65	21	kunar	kunar	NOUN
ahs-7374	65	22	asadabad	asadabad	PROPN
ahs-7374	65	23	landi	landi	PROPN
ahs-7374	65	24	tesha	tesha	PROPN
ahs-7374	65	25	local	local	PROPN
ahs-7374	65	26	af-9	af-9	VERB
ahs-7374	65	27	a	a	DET
ahs-7374	65	28	kunar	kunar	NOUN
ahs-7374	65	29	asadabad	asadabad	PROPN
ahs-7374	65	30	landi	landi	PROPN
ahs-7374	65	31	tesha	tesha	PROPN
ahs-7374	65	32	local	local	PROPN
ahs-7374	65	33	af-11	af-11	PUNCT
ahs-7374	65	34	a	a	DET
ahs-7374	65	35	kunar	kunar	NOUN
ahs-7374	65	36	asadabad	asadabad	PROPN
ahs-7374	65	37	landi	landi	PROPN
ahs-7374	65	38	tesha	tesha	PROPN
ahs-7374	65	39	local	local	PROPN
ahs-7374	65	40	af-18	af-18	ADP
ahs-7374	65	41	a	a	DET
ahs-7374	65	42	nangarhar	nangarhar	PROPN
ahs-7374	65	43	surkhroad	surkhroad	PROPN
ahs-7374	65	44	naghrak	naghrak	PROPN
ahs-7374	65	45	local	local	PROPN
ahs-7374	65	46	af-19	af-19	ADP
ahs-7374	65	47	a	a	DET
ahs-7374	65	48	nangarhar	nangarhar	PROPN
ahs-7374	65	49	surkhroad	surkhroad	PROPN
ahs-7374	65	50	naghrak	naghrak	PROPN
ahs-7374	65	51	local	local	PROPN
ahs-7374	65	52	af-21	af-21	PROPN
ahs-7374	65	53	a	a	DET
ahs-7374	65	54	nangarhar	nangarhar	PROPN
ahs-7374	65	55	surkhroad	surkhroad	NOUN
ahs-7374	65	56	sabzabad	sabzabad	PROPN
ahs-7374	65	57	local	local	PROPN
ahs-7374	65	58	af-22	af-22	ADP
ahs-7374	65	59	a	a	DET
ahs-7374	65	60	nangarhar	nangarhar	PROPN
ahs-7374	65	61	surkhroad	surkhroad	NOUN
ahs-7374	65	62	sabzabad	sabzabad	PROPN
ahs-7374	65	63	local	local	ADJ
ahs-7374	65	64	af	af	PROPN
ahs-7374	65	65	-	-	PROPN
ahs-7374	65	66	limon	limon	PROPN
ahs-7374	65	67	nangarhar	nangarhar	PROPN
ahs-7374	65	68	phdc	phdc	PROPN
ahs-7374	65	69	-	-	PUNCT
ahs-7374	65	70	center	center	NOUN
ahs-7374	65	71	citrus	citrus	PROPN
ahs-7374	65	72	volkamar	volkamar	PROPN
ahs-7374	65	73	sample	sample	PROPN
ahs-7374	65	74	no	no	INTJ
ahs-7374	65	75	.	.	PUNCT
ahs-7374	66	1	species	specie	NOUN
ahs-7374	66	2	or	or	CCONJ
ahs-7374	66	3	cultivar	cultivar	NOUN
ahs-7374	66	4	province	province	NOUN
ahs-7374	66	5	origin	origin	NOUN
ahs-7374	66	6	of	of	ADP
ahs-7374	66	7	the	the	DET
ahs-7374	66	8	accession	accession	NOUN
ahs-7374	66	9	1	1	NUM
ahs-7374	66	10	citrus	citrus	NOUN
ahs-7374	66	11	sinensis	sinensis	NOUN
ahs-7374	66	12	(	(	PUNCT
ahs-7374	66	13	washington	washington	PROPN
ahs-7374	66	14	navel	navel	PROPN
ahs-7374	66	15	)	)	PUNCT
ahs-7374	66	16	pescia	pescia	PROPN
ahs-7374	66	17	(	(	PUNCT
ahs-7374	66	18	italy	italy	PROPN
ahs-7374	66	19	)	)	PUNCT
ahs-7374	66	20	oscar	oscar	NOUN
ahs-7374	66	21	tintori	tintori	ADJ
ahs-7374	66	22	2	2	NUM
ahs-7374	66	23	citrus	citrus	NOUN
ahs-7374	66	24	sinensis	sinensis	NOUN
ahs-7374	66	25	(	(	PUNCT
ahs-7374	66	26	ovale	ovale	PROPN
ahs-7374	66	27	calabrese	calabrese	PROPN
ahs-7374	66	28	)	)	PUNCT
ahs-7374	66	29	pescia	pescia	PROPN
ahs-7374	66	30	(	(	PUNCT
ahs-7374	66	31	italy	italy	PROPN
ahs-7374	66	32	)	)	PUNCT
ahs-7374	66	33	oscar	oscar	NOUN
ahs-7374	66	34	tintori	tintori	NOUN
ahs-7374	66	35	3	3	NUM
ahs-7374	66	36	citrus	citrus	NOUN
ahs-7374	66	37	sinensis	sinensis	NOUN
ahs-7374	66	38	(	(	PUNCT
ahs-7374	66	39	tarocco	tarocco	NOUN
ahs-7374	66	40	)	)	PUNCT
ahs-7374	66	41	pescia	pescia	PROPN
ahs-7374	66	42	(	(	PUNCT
ahs-7374	66	43	italy	italy	PROPN
ahs-7374	66	44	)	)	PUNCT
ahs-7374	66	45	oscar	oscar	NOUN
ahs-7374	66	46	tintori	tintori	NOUN
ahs-7374	66	47	4	4	NUM
ahs-7374	66	48	citrus	citrus	NOUN
ahs-7374	66	49	aurantium	aurantium	PROPN
ahs-7374	66	50	lucca	lucca	PROPN
ahs-7374	66	51	(	(	PUNCT
ahs-7374	66	52	italy	italy	PROPN
ahs-7374	66	53	)	)	PUNCT
ahs-7374	66	54	botanical	botanical	ADJ
ahs-7374	66	55	garden	garden	NOUN
ahs-7374	66	56	5	5	NUM
ahs-7374	66	57	citrus	citrus	NOUN
ahs-7374	66	58	aurantium	aurantium	PROPN
ahs-7374	66	59	firenze	firenze	PROPN
ahs-7374	66	60	(	(	PUNCT
ahs-7374	66	61	italy	italy	PROPN
ahs-7374	66	62	)	)	PUNCT
ahs-7374	66	63	iao	iao	VERB
ahs-7374	66	64	6	6	NUM
ahs-7374	66	65	citrus	citrus	NOUN
ahs-7374	66	66	aurantium	aurantium	NOUN
ahs-7374	66	67	(	(	PUNCT
ahs-7374	66	68	foetifera	foetifera	NOUN
ahs-7374	66	69	)	)	PUNCT
ahs-7374	66	70	pescia	pescia	PROPN
ahs-7374	66	71	(	(	PUNCT
ahs-7374	66	72	italy	italy	PROPN
ahs-7374	66	73	)	)	PUNCT
ahs-7374	66	74	oscar	oscar	VERB
ahs-7374	66	75	tintori	tintori	NOUN
ahs-7374	66	76	7	7	NUM
ahs-7374	66	77	citrus	citrus	NOUN
ahs-7374	66	78	aurantium	aurantium	NOUN
ahs-7374	66	79	(	(	PUNCT
ahs-7374	66	80	tipo	tipo	PROPN
ahs-7374	66	81	)	)	PUNCT
ahs-7374	66	82	pescia	pescia	PROPN
ahs-7374	66	83	(	(	PUNCT
ahs-7374	66	84	italy	italy	PROPN
ahs-7374	66	85	)	)	PUNCT
ahs-7374	66	86	oscar	oscar	NOUN
ahs-7374	66	87	tintori	tintori	NOUN
ahs-7374	66	88	8	8	NUM
ahs-7374	66	89	citrus	citrus	NOUN
ahs-7374	66	90	aurantium	aurantium	NOUN
ahs-7374	66	91	(	(	PUNCT
ahs-7374	66	92	dolce	dolce	X
ahs-7374	66	93	del	del	X
ahs-7374	66	94	gargano	gargano	PROPN
ahs-7374	66	95	)	)	PUNCT
ahs-7374	66	96	pescia	pescia	PROPN
ahs-7374	66	97	(	(	PUNCT
ahs-7374	66	98	italy	italy	PROPN
ahs-7374	66	99	)	)	PUNCT
ahs-7374	66	100	oscar	oscar	NOUN
ahs-7374	66	101	tintori	tintori	NOUN
ahs-7374	66	102	9	9	NUM
ahs-7374	66	103	citrus	citrus	NOUN
ahs-7374	66	104	aurantiifolia	aurantiifolia	PROPN
ahs-7374	66	105	(	(	PUNCT
ahs-7374	66	106	philippines	philippine	NOUN
ahs-7374	66	107	red	red	ADJ
ahs-7374	66	108	lime	lime	NOUN
ahs-7374	66	109	)	)	PUNCT
ahs-7374	66	110	pescia	pescia	PROPN
ahs-7374	66	111	(	(	PUNCT
ahs-7374	66	112	italy	italy	PROPN
ahs-7374	66	113	)	)	PUNCT
ahs-7374	66	114	oscar	oscar	NOUN
ahs-7374	66	115	tintori	tintori	NOUN
ahs-7374	66	116	10	10	NUM
ahs-7374	66	117	citrus	citrus	NOUN
ahs-7374	66	118	aurantiifolia	aurantiifolia	PROPN
ahs-7374	66	119	(	(	PUNCT
ahs-7374	66	120	mexico	mexico	PROPN
ahs-7374	66	121	)	)	PUNCT
ahs-7374	66	122	pescia	pescia	PROPN
ahs-7374	66	123	(	(	PUNCT
ahs-7374	66	124	italy	italy	PROPN
ahs-7374	66	125	)	)	PUNCT
ahs-7374	66	126	oscar	oscar	VERB
ahs-7374	66	127	tintori	tintori	NOUN
ahs-7374	66	128	11	11	NUM
ahs-7374	66	129	citrus	citrus	NOUN
ahs-7374	66	130	aurantium	aurantium	PROPN
ahs-7374	66	131	firenze	firenze	PROPN
ahs-7374	66	132	(	(	PUNCT
ahs-7374	66	133	italy	italy	PROPN
ahs-7374	66	134	)	)	PUNCT
ahs-7374	66	135	botanical	botanical	ADJ
ahs-7374	66	136	garden	garden	NOUN
ahs-7374	66	137	12	12	NUM
ahs-7374	66	138	citrus	citrus	NOUN
ahs-7374	66	139	limon	limon	PROPN
ahs-7374	66	140	firenze	firenze	PROPN
ahs-7374	66	141	(	(	PUNCT
ahs-7374	66	142	italy	italy	PROPN
ahs-7374	66	143	)	)	PUNCT
ahs-7374	66	144	botanical	botanical	ADJ
ahs-7374	66	145	garden	garden	NOUN
ahs-7374	66	146	13	13	NUM
ahs-7374	66	147	citrus	citrus	NOUN
ahs-7374	66	148	mitis	mitis	PROPN
ahs-7374	66	149	firenze	firenze	PROPN
ahs-7374	66	150	(	(	PUNCT
ahs-7374	66	151	italy	italy	PROPN
ahs-7374	66	152	)	)	PUNCT
ahs-7374	66	153	botanical	botanical	ADJ
ahs-7374	66	154	garden	garden	NOUN
ahs-7374	66	155	14	14	NUM
ahs-7374	66	156	citrus	citrus	NOUN
ahs-7374	66	157	histrix	histrix	PROPN
ahs-7374	66	158	firenze	firenze	PROPN
ahs-7374	66	159	(	(	PUNCT
ahs-7374	66	160	italy	italy	PROPN
ahs-7374	66	161	)	)	PUNCT
ahs-7374	66	162	botanical	botanical	ADJ
ahs-7374	66	163	garden	garden	NOUN
ahs-7374	66	164	15	15	NUM
ahs-7374	66	165	citrus	citrus	NOUN
ahs-7374	66	166	decumana	decumana	PROPN
ahs-7374	66	167	firenze	firenze	PROPN
ahs-7374	66	168	(	(	PUNCT
ahs-7374	66	169	italy	italy	PROPN
ahs-7374	66	170	)	)	PUNCT
ahs-7374	66	171	botanical	botanical	ADJ
ahs-7374	66	172	garden	garden	NOUN
ahs-7374	66	173	16	16	NUM
ahs-7374	66	174	citrus	citrus	NOUN
ahs-7374	66	175	grandis	grandis	PROPN
ahs-7374	66	176	firenze	firenze	PROPN
ahs-7374	66	177	(	(	PUNCT
ahs-7374	66	178	italy	italy	PROPN
ahs-7374	66	179	)	)	PUNCT
ahs-7374	66	180	botanical	botanical	ADJ
ahs-7374	66	181	garden	garden	NOUN
ahs-7374	66	182	17	17	NUM
ahs-7374	66	183	citrus	citrus	NOUN
ahs-7374	66	184	reticulata	reticulata	PROPN
ahs-7374	66	185	firenze	firenze	PROPN
ahs-7374	66	186	(	(	PUNCT
ahs-7374	66	187	italy	italy	PROPN
ahs-7374	66	188	)	)	PUNCT
ahs-7374	66	189	botanical	botanical	ADJ
ahs-7374	66	190	garden	garden	NOUN
ahs-7374	66	191	18	18	NUM
ahs-7374	66	192	citrus	citrus	NOUN
ahs-7374	66	193	lumia	lumia	NOUN
ahs-7374	66	194	firenze	firenze	PROPN
ahs-7374	66	195	(	(	PUNCT
ahs-7374	66	196	italy	italy	PROPN
ahs-7374	66	197	)	)	PUNCT
ahs-7374	66	198	botanical	botanical	ADJ
ahs-7374	66	199	garden	garden	NOUN
ahs-7374	66	200	19	19	NUM
ahs-7374	66	201	citrus	citrus	NOUN
ahs-7374	66	202	medica	medica	PROPN
ahs-7374	66	203	firenze	firenze	PROPN
ahs-7374	66	204	(	(	PUNCT
ahs-7374	66	205	italy	italy	PROPN
ahs-7374	66	206	)	)	PUNCT
ahs-7374	67	1	botanical	botanical	ADJ
ahs-7374	67	2	garden	garden	PROPN
ahs-7374	67	3	adv	adv	PROPN
ahs-7374	67	4	.	.	PUNCT
ahs-7374	67	5	hort	hort	PROPN
ahs-7374	67	6	.	.	PUNCT
ahs-7374	68	1	sci	sci	PROPN
ahs-7374	68	2	.	.	PROPN
ahs-7374	68	3	,	,	PUNCT
ahs-7374	68	4	2019	2019	NUM
ahs-7374	68	5	33(3	33(3	NOUN
ahs-7374	68	6	):	):	PUNCT
ahs-7374	68	7	403	403	NUM
ahs-7374	68	8	-	-	SYM
ahs-7374	68	9	408	408	NUM
ahs-7374	68	10	406	406	NUM
ahs-7374	68	11	al	al	PROPN
ahs-7374	68	12	.	.	PROPN
ahs-7374	68	13	,	,	PUNCT
ahs-7374	68	14	2018	2018	NUM
ahs-7374	68	15	)	)	PUNCT
ahs-7374	68	16	and	and	CCONJ
ahs-7374	68	17	are	be	AUX
ahs-7374	68	18	designed	design	VERB
ahs-7374	68	19	on	on	ADP
ahs-7374	68	20	the	the	DET
ahs-7374	68	21	sequence	sequence	NOUN
ahs-7374	68	22	of	of	ADP
ahs-7374	68	23	the	the	DET
ahs-7374	68	24	internal	internal	ADJ
ahs-7374	68	25	transcribed	transcribe	VERB
ahs-7374	68	26	sequence	sequence	NOUN
ahs-7374	68	27	1	1	NUM
ahs-7374	68	28	(	(	PUNCT
ahs-7374	68	29	its1	its1	PROPN
ahs-7374	68	30	)	)	PUNCT
ahs-7374	68	31	and	and	CCONJ
ahs-7374	68	32	2	2	NUM
ahs-7374	68	33	(	(	PUNCT
ahs-7374	68	34	its2	its2	PROPN
ahs-7374	68	35	)	)	PUNCT
ahs-7374	68	36	of	of	ADP
ahs-7374	68	37	the	the	DET
ahs-7374	68	38	nuclear	nuclear	ADJ
ahs-7374	68	39	ribosomal	ribosomal	NOUN
ahs-7374	68	40	dna	dna	NOUN
ahs-7374	68	41	,	,	PUNCT
ahs-7374	68	42	of	of	ADP
ahs-7374	68	43	the	the	DET
ahs-7374	68	44	maturase	maturase	NOUN
ahs-7374	68	45	k	k	PROPN
ahs-7374	68	46	(	(	PUNCT
ahs-7374	68	47	matk	matk	PROPN
ahs-7374	68	48	)	)	PUNCT
ahs-7374	68	49	,	,	PUNCT
ahs-7374	68	50	the	the	DET
ahs-7374	68	51	rubisco	rubisco	ADJ
ahs-7374	68	52	large	large	ADJ
ahs-7374	68	53	chain	chain	NOUN
ahs-7374	68	54	unit	unit	NOUN
ahs-7374	68	55	(	(	PUNCT
ahs-7374	68	56	rbcl	rbcl	NOUN
ahs-7374	68	57	)	)	PUNCT
ahs-7374	68	58	and	and	CCONJ
ahs-7374	68	59	of	of	ADP
ahs-7374	68	60	the	the	DET
ahs-7374	68	61	predominantly	predominantly	ADV
ahs-7374	68	62	non	non	ADJ
ahs-7374	68	63	-	-	ADJ
ahs-7374	68	64	coding	code	VERB
ahs-7374	68	65	psba	psba	NOUN
ahs-7374	68	66	-	-	PUNCT
ahs-7374	68	67	trnh	trnh	NOUN
ahs-7374	68	68	intergenic	intergenic	ADJ
ahs-7374	68	69	spacer	spacer	NOUN
ahs-7374	68	70	(	(	PUNCT
ahs-7374	68	71	table	table	NOUN
ahs-7374	68	72	3	3	NUM
ahs-7374	68	73	)	)	PUNCT
ahs-7374	68	74	.	.	PUNCT
ahs-7374	69	1	pcr	pcr	PROPN
ahs-7374	69	2	analyses	analysis	NOUN
ahs-7374	69	3	were	be	AUX
ahs-7374	69	4	performed	perform	VERB
ahs-7374	69	5	with	with	ADP
ahs-7374	69	6	a	a	DET
ahs-7374	69	7	thermal	thermal	ADJ
ahs-7374	69	8	cycler	cycler	NOUN
ahs-7374	69	9	primus	primus	PROPN
ahs-7374	69	10	96	96	NUM
ahs-7374	69	11	(	(	PUNCT
ahs-7374	69	12	peqlab	peqlab	NOUN
ahs-7374	69	13	)	)	PUNCT
ahs-7374	69	14	in	in	ADP
ahs-7374	69	15	a	a	DET
ahs-7374	69	16	25	25	NUM
ahs-7374	69	17	µl	µl	ADP
ahs-7374	69	18	volume	volume	NOUN
ahs-7374	69	19	containing	contain	VERB
ahs-7374	69	20	25	25	NUM
ahs-7374	69	21	ng	ng	PROPN
ahs-7374	69	22	total	total	ADJ
ahs-7374	69	23	dna	dna	PROPN
ahs-7374	69	24	,	,	PUNCT
ahs-7374	69	25	1x	1x	NUM
ahs-7374	69	26	taq	taq	NOUN
ahs-7374	69	27	buffer	buffer	NOUN
ahs-7374	69	28	,	,	PUNCT
ahs-7374	69	29	1,5	1,5	NUM
ahs-7374	69	30	mm	mm	NOUN
ahs-7374	69	31	mgcl2	mgcl2	PROPN
ahs-7374	69	32	,	,	PUNCT
ahs-7374	69	33	1	1	NUM
ahs-7374	69	34	unit	unit	NOUN
ahs-7374	69	35	gotaq	gotaq	PROPN
ahs-7374	69	36	(	(	PUNCT
ahs-7374	69	37	promega	promega	NOUN
ahs-7374	69	38	)	)	PUNCT
ahs-7374	69	39	and	and	CCONJ
ahs-7374	69	40	200	200	NUM
ahs-7374	69	41	nm	nm	NOUN
ahs-7374	69	42	of	of	ADP
ahs-7374	69	43	each	each	DET
ahs-7374	69	44	primer	primer	NOUN
ahs-7374	69	45	.	.	PUNCT
ahs-7374	70	1	pcr	pcr	ADJ
ahs-7374	70	2	conditions	condition	NOUN
ahs-7374	70	3	were	be	AUX
ahs-7374	70	4	95	95	NUM
ahs-7374	70	5	°	°	ADP
ahs-7374	70	6	c	c	NOUN
ahs-7374	70	7	for	for	ADP
ahs-7374	70	8	5	5	NUM
ahs-7374	70	9	min	min	NOUN
ahs-7374	70	10	,	,	PUNCT
ahs-7374	70	11	then	then	ADV
ahs-7374	70	12	35	35	NUM
ahs-7374	70	13	cycles	cycle	NOUN
ahs-7374	70	14	at	at	ADP
ahs-7374	70	15	95	95	NUM
ahs-7374	70	16	°	°	ADP
ahs-7374	70	17	c	c	NOUN
ahs-7374	70	18	for	for	ADP
ahs-7374	70	19	30	30	NUM
ahs-7374	70	20	seconds	second	NOUN
ahs-7374	70	21	followed	follow	VERB
ahs-7374	70	22	by	by	ADP
ahs-7374	70	23	30	30	NUM
ahs-7374	70	24	seconds	second	NOUN
ahs-7374	70	25	at	at	ADP
ahs-7374	70	26	a	a	DET
ahs-7374	70	27	temperature	temperature	NOUN
ahs-7374	70	28	ranging	range	VERB
ahs-7374	70	29	from	from	ADP
ahs-7374	70	30	50	50	NUM
ahs-7374	70	31	to	to	PART
ahs-7374	70	32	60	60	NUM
ahs-7374	70	33	°	°	ADP
ahs-7374	70	34	c	c	NOUN
ahs-7374	70	35	depending	depend	VERB
ahs-7374	70	36	on	on	ADP
ahs-7374	70	37	the	the	DET
ahs-7374	70	38	chosen	choose	VERB
ahs-7374	70	39	primer	primer	NOUN
ahs-7374	70	40	pair	pair	NOUN
ahs-7374	70	41	and	and	CCONJ
ahs-7374	70	42	an	an	DET
ahs-7374	70	43	extension	extension	NOUN
ahs-7374	70	44	cycle	cycle	NOUN
ahs-7374	70	45	at	at	ADP
ahs-7374	70	46	72	72	NUM
ahs-7374	70	47	°	°	ADP
ahs-7374	70	48	c	c	NOUN
ahs-7374	70	49	for	for	ADP
ahs-7374	70	50	50	50	NUM
ahs-7374	70	51	sec	sec	PROPN
ahs-7374	70	52	.	.	PUNCT
ahs-7374	71	1	a	a	DET
ahs-7374	71	2	final	final	ADJ
ahs-7374	71	3	extension	extension	NOUN
ahs-7374	71	4	at	at	ADP
ahs-7374	71	5	72	72	NUM
ahs-7374	71	6	°	°	ADP
ahs-7374	71	7	c	c	NOUN
ahs-7374	71	8	for	for	ADP
ahs-7374	71	9	5	5	NUM
ahs-7374	71	10	minutes	minute	NOUN
ahs-7374	71	11	was	be	AUX
ahs-7374	71	12	carried	carry	VERB
ahs-7374	71	13	on	on	ADP
ahs-7374	71	14	.	.	PUNCT
ahs-7374	72	1	the	the	DET
ahs-7374	72	2	amplification	amplification	NOUN
ahs-7374	72	3	products	product	NOUN
ahs-7374	72	4	were	be	AUX
ahs-7374	72	5	purified	purify	VERB
ahs-7374	72	6	with	with	ADP
ahs-7374	72	7	the	the	DET
ahs-7374	72	8	qiaquick	qiaquick	NOUN
ahs-7374	72	9	pcr	pcr	PROPN
ahs-7374	72	10	purification	purification	NOUN
ahs-7374	72	11	tubes	tube	NOUN
ahs-7374	72	12	(	(	PUNCT
ahs-7374	72	13	qiagen	qiagen	PROPN
ahs-7374	72	14	)	)	PUNCT
ahs-7374	72	15	and	and	CCONJ
ahs-7374	72	16	then	then	ADV
ahs-7374	72	17	sequenced	sequence	VERB
ahs-7374	72	18	.	.	PUNCT
ahs-7374	73	1	even	even	ADV
ahs-7374	73	2	though	though	SCONJ
ahs-7374	73	3	the	the	DET
ahs-7374	73	4	primers	primer	NOUN
ahs-7374	73	5	for	for	ADP
ahs-7374	73	6	barcoding	barcoding	NOUN
ahs-7374	73	7	are	be	AUX
ahs-7374	73	8	called	call	VERB
ahs-7374	73	9	“	"	PUNCT
ahs-7374	73	10	universal	universal	ADJ
ahs-7374	73	11	”	"	PUNCT
ahs-7374	73	12	,	,	PUNCT
ahs-7374	73	13	the	the	DET
ahs-7374	73	14	presence	presence	NOUN
ahs-7374	73	15	of	of	ADP
ahs-7374	73	16	conserved	conserve	VERB
ahs-7374	73	17	flanking	flanking	NOUN
ahs-7374	73	18	sites	site	NOUN
ahs-7374	73	19	complementary	complementary	ADJ
ahs-7374	73	20	to	to	ADP
ahs-7374	73	21	the	the	DET
ahs-7374	73	22	primers	primer	NOUN
ahs-7374	73	23	sequence	sequence	NOUN
ahs-7374	73	24	near	near	ADP
ahs-7374	73	25	the	the	DET
ahs-7374	73	26	variable	variable	ADJ
ahs-7374	73	27	part	part	NOUN
ahs-7374	73	28	and	and	CCONJ
ahs-7374	73	29	the	the	DET
ahs-7374	73	30	locus	locus	NOUN
ahs-7374	73	31	copy	copy	NOUN
ahs-7374	73	32	number	number	NOUN
ahs-7374	73	33	have	have	AUX
ahs-7374	73	34	been	be	AUX
ahs-7374	73	35	shown	show	VERB
ahs-7374	73	36	to	to	PART
ahs-7374	73	37	account	account	VERB
ahs-7374	73	38	for	for	ADP
ahs-7374	73	39	much	much	ADJ
ahs-7374	73	40	of	of	ADP
ahs-7374	73	41	the	the	DET
ahs-7374	73	42	variability	variability	NOUN
ahs-7374	73	43	of	of	ADP
ahs-7374	73	44	amplification	amplification	NOUN
ahs-7374	73	45	success	success	NOUN
ahs-7374	73	46	.	.	PUNCT
ahs-7374	74	1	therefore	therefore	ADV
ahs-7374	74	2	,	,	PUNCT
ahs-7374	74	3	the	the	DET
ahs-7374	74	4	all	all	DET
ahs-7374	74	5	primers	primer	NOUN
ahs-7374	74	6	have	have	AUX
ahs-7374	74	7	been	be	AUX
ahs-7374	74	8	tested	test	VERB
ahs-7374	74	9	by	by	ADP
ahs-7374	74	10	pcr	pcr	PROPN
ahs-7374	74	11	,	,	PUNCT
ahs-7374	74	12	amplifying	amplify	VERB
ahs-7374	74	13	and	and	CCONJ
ahs-7374	74	14	sequencing	sequence	VERB
ahs-7374	74	15	the	the	DET
ahs-7374	74	16	amplicons	amplicon	NOUN
ahs-7374	74	17	using	use	VERB
ahs-7374	74	18	a	a	DET
ahs-7374	74	19	set	set	NOUN
ahs-7374	74	20	of	of	ADP
ahs-7374	74	21	the	the	DET
ahs-7374	74	22	samples	sample	NOUN
ahs-7374	74	23	as	as	ADP
ahs-7374	74	24	templates	template	NOUN
ahs-7374	74	25	.	.	PUNCT
ahs-7374	75	1	to	to	PART
ahs-7374	75	2	perform	perform	VERB
ahs-7374	75	3	a	a	DET
ahs-7374	75	4	phylogenetic	phylogenetic	ADJ
ahs-7374	75	5	analysis	analysis	NOUN
ahs-7374	75	6	we	we	PRON
ahs-7374	75	7	have	have	AUX
ahs-7374	75	8	used	use	VERB
ahs-7374	75	9	the	the	DET
ahs-7374	75	10	mega7	mega7	NOUN
ahs-7374	75	11	software	software	NOUN
ahs-7374	75	12	package	package	NOUN
ahs-7374	75	13	(	(	PUNCT
ahs-7374	75	14	tamura	tamura	PROPN
ahs-7374	75	15	et	et	PROPN
ahs-7374	75	16	al	al	PROPN
ahs-7374	75	17	.	.	PROPN
ahs-7374	75	18	,	,	PUNCT
ahs-7374	75	19	2013	2013	NUM
ahs-7374	75	20	)	)	PUNCT
ahs-7374	75	21	which	which	PRON
ahs-7374	75	22	compares	compare	VERB
ahs-7374	75	23	the	the	DET
ahs-7374	75	24	sequence	sequence	NOUN
ahs-7374	75	25	calculating	calculate	VERB
ahs-7374	75	26	a	a	DET
ahs-7374	75	27	similarity	similarity	NOUN
ahs-7374	75	28	matrix	matrix	NOUN
ahs-7374	75	29	,	,	PUNCT
ahs-7374	75	30	transforms	transform	VERB
ahs-7374	75	31	similarity	similarity	NOUN
ahs-7374	75	32	coefficients	coefficient	NOUN
ahs-7374	75	33	into	into	ADP
ahs-7374	75	34	distances	distance	NOUN
ahs-7374	75	35	and	and	CCONJ
ahs-7374	75	36	makes	make	VERB
ahs-7374	75	37	a	a	DET
ahs-7374	75	38	clustering	clustering	NOUN
ahs-7374	75	39	using	use	VERB
ahs-7374	75	40	the	the	DET
ahs-7374	75	41	unweighted	unweighted	ADJ
ahs-7374	75	42	pair	pair	NOUN
ahs-7374	75	43	group	group	NOUN
ahs-7374	75	44	method	method	NOUN
ahs-7374	75	45	with	with	ADP
ahs-7374	75	46	arithmetic	arithmetic	ADJ
ahs-7374	75	47	mean	mean	NOUN
ahs-7374	75	48	(	(	PUNCT
ahs-7374	75	49	upgma	upgma	ADJ
ahs-7374	75	50	)	)	PUNCT
ahs-7374	75	51	algorithm	algorithm	NOUN
ahs-7374	75	52	.	.	PUNCT
ahs-7374	76	1	the	the	DET
ahs-7374	76	2	final	final	ADJ
ahs-7374	76	3	output	output	NOUN
ahs-7374	76	4	is	be	AUX
ahs-7374	76	5	represented	represent	VERB
ahs-7374	76	6	by	by	ADP
ahs-7374	76	7	a	a	DET
ahs-7374	76	8	dendrogram	dendrogram	NOUN
ahs-7374	76	9	which	which	PRON
ahs-7374	76	10	clusters	cluster	VERB
ahs-7374	76	11	the	the	DET
ahs-7374	76	12	samples	sample	NOUN
ahs-7374	76	13	.	.	PUNCT
ahs-7374	77	1	3	3	X
ahs-7374	77	2	.	.	NOUN
ahs-7374	77	3	results	result	VERB
ahs-7374	77	4	the	the	DET
ahs-7374	77	5	primers	primer	NOUN
ahs-7374	77	6	constructed	construct	VERB
ahs-7374	77	7	on	on	ADP
ahs-7374	77	8	the	the	DET
ahs-7374	77	9	sequence	sequence	NOUN
ahs-7374	77	10	of	of	ADP
ahs-7374	77	11	the	the	DET
ahs-7374	77	12	internal	internal	ADJ
ahs-7374	77	13	transcribed	transcribe	VERB
ahs-7374	77	14	sequence	sequence	NOUN
ahs-7374	77	15	1	1	NUM
ahs-7374	77	16	(	(	PUNCT
ahs-7374	77	17	its1	its1	PROPN
ahs-7374	77	18	)	)	PUNCT
ahs-7374	77	19	and	and	CCONJ
ahs-7374	77	20	2	2	NUM
ahs-7374	77	21	(	(	PUNCT
ahs-7374	77	22	its2	its2	PROPN
ahs-7374	77	23	)	)	PUNCT
ahs-7374	77	24	resulted	result	VERB
ahs-7374	77	25	in	in	ADP
ahs-7374	77	26	a	a	DET
ahs-7374	77	27	faint	faint	ADJ
ahs-7374	77	28	amplification	amplification	NOUN
ahs-7374	77	29	and	and	CCONJ
ahs-7374	77	30	were	be	AUX
ahs-7374	77	31	therefore	therefore	ADV
ahs-7374	77	32	discarded	discard	VERB
ahs-7374	77	33	,	,	PUNCT
ahs-7374	77	34	while	while	SCONJ
ahs-7374	77	35	primers	primer	NOUN
ahs-7374	77	36	designed	design	VERB
ahs-7374	77	37	on	on	ADP
ahs-7374	77	38	the	the	DET
ahs-7374	77	39	sequence	sequence	NOUN
ahs-7374	77	40	of	of	ADP
ahs-7374	77	41	the	the	DET
ahs-7374	77	42	maturase	maturase	NOUN
ahs-7374	77	43	k	k	PROPN
ahs-7374	77	44	(	(	PUNCT
ahs-7374	77	45	matk	matk	PROPN
ahs-7374	77	46	)	)	PUNCT
ahs-7374	77	47	and	and	CCONJ
ahs-7374	77	48	rubisco	rubisco	VERB
ahs-7374	77	49	large	large	ADJ
ahs-7374	77	50	chain	chain	NOUN
ahs-7374	77	51	unit	unit	NOUN
ahs-7374	77	52	(	(	PUNCT
ahs-7374	77	53	rbcl	rbcl	NOUN
ahs-7374	77	54	)	)	PUNCT
ahs-7374	77	55	genes	gene	NOUN
ahs-7374	77	56	were	be	AUX
ahs-7374	77	57	correctly	correctly	ADV
ahs-7374	77	58	amplified	amplify	VERB
ahs-7374	77	59	and	and	CCONJ
ahs-7374	77	60	sequenced	sequence	VERB
ahs-7374	77	61	.	.	PUNCT
ahs-7374	78	1	unfortunately	unfortunately	ADV
ahs-7374	78	2	,	,	PUNCT
ahs-7374	78	3	such	such	ADJ
ahs-7374	78	4	sequences	sequence	NOUN
ahs-7374	78	5	did	do	AUX
ahs-7374	78	6	not	not	PART
ahs-7374	78	7	show	show	VERB
ahs-7374	78	8	any	any	DET
ahs-7374	78	9	discriminatory	discriminatory	ADJ
ahs-7374	78	10	ability	ability	NOUN
ahs-7374	78	11	being	be	AUX
ahs-7374	78	12	completely	completely	ADV
ahs-7374	78	13	overlapping	overlap	VERB
ahs-7374	78	14	for	for	ADP
ahs-7374	78	15	most	most	ADV
ahs-7374	78	16	analysed	analyse	VERB
ahs-7374	78	17	samples	sample	NOUN
ahs-7374	78	18	(	(	PUNCT
ahs-7374	78	19	mahadani	mahadani	NOUN
ahs-7374	78	20	and	and	CCONJ
ahs-7374	78	21	ghosh	ghosh	PROPN
ahs-7374	78	22	,	,	PUNCT
ahs-7374	78	23	2014	2014	NUM
ahs-7374	78	24	)	)	PUNCT
ahs-7374	78	25	.	.	PUNCT
ahs-7374	79	1	on	on	ADP
ahs-7374	79	2	the	the	DET
ahs-7374	79	3	contrary	contrary	NOUN
ahs-7374	79	4	,	,	PUNCT
ahs-7374	79	5	the	the	DET
ahs-7374	79	6	primers	primer	NOUN
ahs-7374	79	7	of	of	ADP
ahs-7374	79	8	the	the	DET
ahs-7374	79	9	non	non	ADJ
ahs-7374	79	10	-	-	ADJ
ahs-7374	79	11	coding	code	VERB
ahs-7374	79	12	psba	psba	NOUN
ahs-7374	79	13	-	-	PUNCT
ahs-7374	79	14	trnh	trnh	NOUN
ahs-7374	79	15	intergenic	intergenic	ADJ
ahs-7374	79	16	spacer	spacer	NOUN
ahs-7374	79	17	showed	show	VERB
ahs-7374	79	18	either	either	CCONJ
ahs-7374	79	19	good	good	ADJ
ahs-7374	79	20	amplification	amplification	NOUN
ahs-7374	79	21	(	(	PUNCT
ahs-7374	79	22	a	a	DET
ahs-7374	79	23	fragment	fragment	NOUN
ahs-7374	79	24	of	of	ADP
ahs-7374	79	25	about	about	ADV
ahs-7374	79	26	525	525	NUM
ahs-7374	79	27	bp	bp	NOUN
ahs-7374	79	28	)	)	PUNCT
ahs-7374	79	29	and	and	CCONJ
ahs-7374	79	30	bidirectional	bidirectional	ADJ
ahs-7374	79	31	sequencing	sequence	VERB
ahs-7374	79	32	output	output	NOUN
ahs-7374	79	33	either	either	CCONJ
ahs-7374	79	34	a	a	DET
ahs-7374	79	35	good	good	ADJ
ahs-7374	79	36	discriminatory	discriminatory	ADJ
ahs-7374	79	37	capacity	capacity	NOUN
ahs-7374	79	38	.	.	PUNCT
ahs-7374	80	1	we	we	PRON
ahs-7374	80	2	found	find	VERB
ahs-7374	80	3	a	a	DET
ahs-7374	80	4	robust	robust	ADJ
ahs-7374	80	5	single	single	ADJ
ahs-7374	80	6	nucleotide	nucleotide	NOUN
ahs-7374	80	7	polymorphism	polymorphism	NOUN
ahs-7374	80	8	(	(	PUNCT
ahs-7374	80	9	snp	snp	PROPN
ahs-7374	80	10	)	)	PUNCT
ahs-7374	80	11	in	in	ADP
ahs-7374	80	12	the	the	DET
ahs-7374	80	13	psba‐trnh	psba‐trnh	NOUN
ahs-7374	80	14	spacer	spacer	NOUN
ahs-7374	80	15	(	(	PUNCT
ahs-7374	80	16	fig	fig	NOUN
ahs-7374	80	17	.	.	PUNCT
ahs-7374	81	1	2	2	NUM
ahs-7374	81	2	)	)	PUNCT
ahs-7374	81	3	which	which	PRON
ahs-7374	81	4	is	be	AUX
ahs-7374	81	5	capable	capable	ADJ
ahs-7374	81	6	to	to	ADP
ahs-7374	81	7	discriminating	discriminate	VERB
ahs-7374	81	8	c.	c.	PROPN
ahs-7374	81	9	aurantium	aurantium	PROPN
ahs-7374	81	10	(	(	PUNCT
ahs-7374	81	11	sour	sour	ADJ
ahs-7374	81	12	orange	orange	NOUN
ahs-7374	81	13	)	)	PUNCT
ahs-7374	81	14	from	from	ADP
ahs-7374	81	15	c.	c.	NOUN
ahs-7374	81	16	sinensis	sinensis	NOUN
ahs-7374	81	17	showing	show	VERB
ahs-7374	81	18	this	this	DET
ahs-7374	81	19	mutation	mutation	NOUN
ahs-7374	81	20	in	in	ADP
ahs-7374	81	21	all	all	DET
ahs-7374	81	22	analysed	analyse	VERB
ahs-7374	81	23	samples	sample	NOUN
ahs-7374	81	24	independently	independently	ADV
ahs-7374	81	25	from	from	ADP
ahs-7374	81	26	the	the	DET
ahs-7374	81	27	origin	origin	NOUN
ahs-7374	81	28	area	area	NOUN
ahs-7374	81	29	.	.	PUNCT
ahs-7374	82	1	despite	despite	SCONJ
ahs-7374	82	2	the	the	DET
ahs-7374	82	3	limited	limited	ADJ
ahs-7374	82	4	region	region	NOUN
ahs-7374	82	5	of	of	ADP
ahs-7374	82	6	the	the	DET
ahs-7374	82	7	genome	genome	NOUN
ahs-7374	82	8	analysed	analyse	VERB
ahs-7374	82	9	containing	contain	VERB
ahs-7374	82	10	,	,	PUNCT
ahs-7374	82	11	as	as	SCONJ
ahs-7374	82	12	expected	expect	VERB
ahs-7374	82	13	,	,	PUNCT
ahs-7374	82	14	a	a	DET
ahs-7374	82	15	low	low	ADJ
ahs-7374	82	16	number	number	NOUN
ahs-7374	82	17	of	of	ADP
ahs-7374	82	18	mutations	mutation	NOUN
ahs-7374	82	19	,	,	PUNCT
ahs-7374	82	20	all	all	DET
ahs-7374	82	21	the	the	DET
ahs-7374	82	22	samples	sample	NOUN
ahs-7374	82	23	of	of	ADP
ahs-7374	82	24	c.	c.	PROPN
ahs-7374	82	25	aurantium	aurantium	PROPN
ahs-7374	82	26	,	,	PUNCT
ahs-7374	82	27	independently	independently	ADV
ahs-7374	82	28	from	from	ADP
ahs-7374	82	29	their	their	PRON
ahs-7374	82	30	origin	origin	NOUN
ahs-7374	82	31	,	,	PUNCT
ahs-7374	82	32	clustered	cluster	VERB
ahs-7374	82	33	together	together	ADV
ahs-7374	82	34	with	with	ADP
ahs-7374	82	35	a	a	DET
ahs-7374	82	36	reasonable	reasonable	ADJ
ahs-7374	82	37	certainty	certainty	NOUN
ahs-7374	82	38	(	(	PUNCT
ahs-7374	82	39	fig	fig	NOUN
ahs-7374	82	40	.	.	PUNCT
ahs-7374	83	1	3	3	NUM
ahs-7374	83	2	)	)	PUNCT
ahs-7374	83	3	.	.	PUNCT
ahs-7374	84	1	the	the	DET
ahs-7374	84	2	same	same	ADJ
ahs-7374	84	3	occurs	occur	VERB
ahs-7374	84	4	for	for	ADP
ahs-7374	84	5	the	the	DET
ahs-7374	84	6	three	three	NUM
ahs-7374	84	7	c.	c.	NOUN
ahs-7374	84	8	sinensis	sinensis	NOUN
ahs-7374	84	9	samples	sample	NOUN
ahs-7374	84	10	which	which	PRON
ahs-7374	84	11	resulted	result	VERB
ahs-7374	84	12	in	in	ADP
ahs-7374	84	13	a	a	DET
ahs-7374	84	14	welltable	welltable	ADJ
ahs-7374	84	15	3	3	NUM
ahs-7374	84	16	universal	universal	ADJ
ahs-7374	84	17	primers	primer	NOUN
ahs-7374	84	18	sequence	sequence	NOUN
ahs-7374	84	19	for	for	ADP
ahs-7374	84	20	barcoding	barcoding	NOUN
ahs-7374	84	21	used	use	VERB
ahs-7374	84	22	in	in	ADP
ahs-7374	84	23	this	this	DET
ahs-7374	84	24	study	study	NOUN
ahs-7374	84	25	name	name	NOUN
ahs-7374	84	26	5	5	NUM
ahs-7374	84	27	’	'	PUNCT
ahs-7374	84	28	→	→	SYM
ahs-7374	84	29	3	3	NUM
ahs-7374	84	30	’	'	PUNCT
ahs-7374	84	31	primer	primer	NOUN
ahs-7374	84	32	sequence	sequence	NOUN
ahs-7374	84	33	references	reference	NOUN
ahs-7374	84	34	matk	matk	PROPN
ahs-7374	84	35	f	f	PROPN
ahs-7374	85	1	cgtacagtacttttgtgtttacgag	cgtacagtacttttgtgtttacgag	PROPN
ahs-7374	85	2	jeanson	jeanson	PROPN
ahs-7374	85	3	et	et	PROPN
ahs-7374	85	4	al	al	PROPN
ahs-7374	85	5	.	.	PROPN
ahs-7374	85	6	,	,	PUNCT
ahs-7374	85	7	2011	2011	NUM
ahs-7374	85	8	matk	matk	PROPN
ahs-7374	85	9	r	r	NOUN
ahs-7374	85	10	acccagtccatctggaaatcttggttc	acccagtccatctggaaatcttggttc	PROPN
ahs-7374	85	11	jeanson	jeanson	PROPN
ahs-7374	85	12	et	et	PROPN
ahs-7374	85	13	al	al	PROPN
ahs-7374	85	14	.	.	PROPN
ahs-7374	85	15	,	,	PUNCT
ahs-7374	85	16	2011	2011	NUM
ahs-7374	85	17	rbcl_f1	rbcl_f1	VERB
ahs-7374	85	18	atgtcaccacaaacagagactaaagc	atgtcaccacaaacagagactaaagc	NOUN
ahs-7374	85	19	uchoi	uchoi	NOUN
ahs-7374	85	20	et	et	PROPN
ahs-7374	85	21	al	al	PROPN
ahs-7374	85	22	.	.	PROPN
ahs-7374	85	23	,	,	PUNCT
ahs-7374	85	24	2016	2016	NUM
ahs-7374	85	25	rbcl_r634	rbcl_r634	NOUN
ahs-7374	85	26	gaaacggtccctccaacgcat	gaaacggtccctccaacgcat	PROPN
ahs-7374	85	27	jeanson	jeanson	PROPN
ahs-7374	85	28	et	et	PROPN
ahs-7374	85	29	al	al	PROPN
ahs-7374	85	30	.	.	PROPN
ahs-7374	85	31	,	,	PUNCT
ahs-7374	85	32	2011	2011	NUM
ahs-7374	85	33	rbcl_r724	rbcl_r724	PROPN
ahs-7374	85	34	tcgcatgtccctgcagtagc	tcgcatgtccctgcagtagc	NOUN
ahs-7374	85	35	kress	kress	PROPN
ahs-7374	85	36	et	et	PROPN
ahs-7374	85	37	al	al	PROPN
ahs-7374	85	38	.	.	PROPN
ahs-7374	85	39	,	,	PUNCT
ahs-7374	85	40	2005	2005	NUM
ahs-7374	85	41	its1_5f_746	its1_5f_746	PROPN
ahs-7374	85	42	ggaagtaaaagtcgtaacaagg	ggaagtaaaagtcgtaacaagg	PROPN
ahs-7374	85	43	cheng	cheng	PROPN
ahs-7374	85	44	et	et	PROPN
ahs-7374	85	45	al	al	PROPN
ahs-7374	85	46	.	.	PROPN
ahs-7374	85	47	,	,	PUNCT
ahs-7374	85	48	2016	2016	NUM
ahs-7374	85	49	its1_4r_746	its1_4r_746	ADJ
ahs-7374	85	50	tcctccgcttattgatatgc	tcctccgcttattgatatgc	NOUN
ahs-7374	85	51	cheng	cheng	PROPN
ahs-7374	85	52	et	et	PROPN
ahs-7374	85	53	al	al	PROPN
ahs-7374	85	54	.	.	PROPN
ahs-7374	85	55	,	,	PUNCT
ahs-7374	85	56	2016	2016	NUM
ahs-7374	85	57	its2_s2_f497	its2_s2_f497	ADV
ahs-7374	85	58	atgcgatacttggtgtgaat	atgcgatacttggtgtgaat	VERB
ahs-7374	85	59	chen	chen	PROPN
ahs-7374	85	60	et	et	PROPN
ahs-7374	85	61	al	al	PROPN
ahs-7374	85	62	.	.	PROPN
ahs-7374	85	63	,	,	PUNCT
ahs-7374	85	64	2010	2010	NUM
ahs-7374	85	65	its2_s3r_497	its2_s3r_497	PROPN
ahs-7374	85	66	gacgcttctccagactacaat	gacgcttctccagactacaat	VERB
ahs-7374	85	67	chen	chen	PROPN
ahs-7374	85	68	et	et	PROPN
ahs-7374	85	69	al	al	PROPN
ahs-7374	85	70	.	.	PROPN
ahs-7374	85	71	,	,	PUNCT
ahs-7374	85	72	2010	2010	NUM
ahs-7374	85	73	psba‐trnh_fw	psba‐trnh_fw	VERB
ahs-7374	85	74	cgcgcatggtggattcacaatcc	cgcgcatggtggattcacaatcc	PROPN
ahs-7374	85	75	zhao	zhao	PROPN
ahs-7374	85	76	et	et	PROPN
ahs-7374	85	77	al	al	PROPN
ahs-7374	85	78	.	.	PROPN
ahs-7374	85	79	,	,	PUNCT
ahs-7374	85	80	2018	2018	NUM
ahs-7374	85	81	psba‐trnh_rev	psba‐trnh_rev	X
ahs-7374	85	82	gttatgcatgaacgtaatgctc	gttatgcatgaacgtaatgctc	NOUN
ahs-7374	85	83	zhao	zhao	PROPN
ahs-7374	85	84	et	et	PROPN
ahs-7374	85	85	al	al	PROPN
ahs-7374	85	86	.	.	PROPN
ahs-7374	85	87	,	,	PUNCT
ahs-7374	85	88	2018	2018	NUM
ahs-7374	85	89	matk1f	matk1f	PROPN
ahs-7374	85	90	accgtatcgcactatgtatc	accgtatcgcactatgtatc	NOUN
ahs-7374	85	91	penjor	penjor	ADP
ahs-7374	85	92	et	et	PROPN
ahs-7374	85	93	al	al	PROPN
ahs-7374	85	94	.	.	PROPN
ahs-7374	85	95	,	,	PUNCT
ahs-7374	85	96	2013	2013	NUM
ahs-7374	85	97	matk1r	matk1r	NOUN
ahs-7374	85	98	gaactagtcggatggagtag	gaactagtcggatggagtag	VERB
ahs-7374	85	99	penjor	penjor	ADV
ahs-7374	85	100	et	et	PROPN
ahs-7374	85	101	al	al	PROPN
ahs-7374	85	102	.	.	PROPN
ahs-7374	85	103	,	,	PUNCT
ahs-7374	85	104	2013	2013	NUM
ahs-7374	85	105	matk2f	matk2f	NUM
ahs-7374	85	106	acggttctttctccacgagt	acggttctttctccacgagt	ADV
ahs-7374	85	107	penjor	penjor	ADP
ahs-7374	85	108	et	et	PROPN
ahs-7374	85	109	al	al	PROPN
ahs-7374	85	110	.	.	PROPN
ahs-7374	85	111	,	,	PUNCT
ahs-7374	85	112	2013	2013	NUM
ahs-7374	85	113	matk3f	matk3f	PROPN
ahs-7374	85	114	ggtccgatttctctgattct	ggtccgatttctctgattct	NOUN
ahs-7374	85	115	penjor	penjor	NOUN
ahs-7374	85	116	et	et	PROPN
ahs-7374	85	117	al	al	PROPN
ahs-7374	85	118	.	.	PROPN
ahs-7374	85	119	,	,	PUNCT
ahs-7374	85	120	2013	2013	NUM
ahs-7374	85	121	matk2r	matk2r	NUM
ahs-7374	85	122	agaatcagagaaatcggacc	agaatcagagaaatcggacc	ADV
ahs-7374	85	123	penjor	penjor	ADP
ahs-7374	85	124	et	et	PROPN
ahs-7374	85	125	al	al	PROPN
ahs-7374	85	126	.	.	PROPN
ahs-7374	85	127	,	,	PUNCT
ahs-7374	85	128	2013	2013	NUM
ahs-7374	85	129	matk3r	matk3r	VERB
ahs-7374	85	130	actcgtggagaaagaaccgt	actcgtggagaaagaaccgt	PRON
ahs-7374	85	131	penjor	penjor	NOUN
ahs-7374	85	132	et	et	PROPN
ahs-7374	85	133	al	al	PROPN
ahs-7374	85	134	.	.	PROPN
ahs-7374	85	135	,	,	PUNCT
ahs-7374	85	136	2013	2013	NUM
ahs-7374	85	137	gori	gori	X
ahs-7374	85	138	et	et	PROPN
ahs-7374	85	139	al	al	PROPN
ahs-7374	85	140	.	.	PROPN
ahs-7374	86	1	‐	‐	ADJ
ahs-7374	86	2	barcoding	barcoding	NOUN
ahs-7374	86	3	assessment	assessment	NOUN
ahs-7374	86	4	of	of	ADP
ahs-7374	86	5	the	the	DET
ahs-7374	86	6	afghan	afghan	ADJ
ahs-7374	86	7	citrus	citrus	NOUN
ahs-7374	86	8	population	population	NOUN
ahs-7374	86	9	407	407	NUM
ahs-7374	86	10	separated	separate	VERB
ahs-7374	86	11	group	group	NOUN
ahs-7374	86	12	while	while	SCONJ
ahs-7374	86	13	the	the	DET
ahs-7374	86	14	sample	sample	NOUN
ahs-7374	86	15	c.	c.	PROPN
ahs-7374	86	16	limon	limon	PROPN
ahs-7374	86	17	need	need	VERB
ahs-7374	86	18	to	to	PART
ahs-7374	86	19	be	be	AUX
ahs-7374	86	20	better	well	ADV
ahs-7374	86	21	characterized	characterize	VERB
ahs-7374	86	22	with	with	ADP
ahs-7374	86	23	additional	additional	ADJ
ahs-7374	86	24	sequence	sequence	NOUN
ahs-7374	86	25	analysis	analysis	NOUN
ahs-7374	86	26	(	(	PUNCT
ahs-7374	86	27	penjor	penjor	NOUN
ahs-7374	86	28	et	et	PROPN
ahs-7374	86	29	al	al	PROPN
ahs-7374	86	30	.	.	PROPN
ahs-7374	86	31	,	,	PUNCT
ahs-7374	86	32	2010	2010	NUM
ahs-7374	86	33	,	,	PUNCT
ahs-7374	86	34	2013	2013	NUM
ahs-7374	86	35	)	)	PUNCT
ahs-7374	86	36	.	.	PUNCT
ahs-7374	87	1	4	4	X
ahs-7374	87	2	.	.	X
ahs-7374	87	3	discussion	discussion	NOUN
ahs-7374	87	4	and	and	CCONJ
ahs-7374	87	5	conclusions	conclusion	NOUN
ahs-7374	87	6	the	the	DET
ahs-7374	87	7	barcoding	barcode	VERB
ahs-7374	87	8	analysis	analysis	NOUN
ahs-7374	87	9	of	of	ADP
ahs-7374	87	10	the	the	DET
ahs-7374	87	11	afghan	afghan	ADJ
ahs-7374	87	12	germplasm	germplasm	NOUN
ahs-7374	87	13	and	and	CCONJ
ahs-7374	87	14	citrus	citrus	NOUN
ahs-7374	87	15	species	specie	NOUN
ahs-7374	87	16	has	have	AUX
ahs-7374	87	17	been	be	AUX
ahs-7374	87	18	carried	carry	VERB
ahs-7374	87	19	out	out	ADP
ahs-7374	87	20	with	with	ADP
ahs-7374	87	21	a	a	DET
ahs-7374	87	22	set	set	NOUN
ahs-7374	87	23	of	of	ADP
ahs-7374	87	24	primers	primer	NOUN
ahs-7374	87	25	targeting	target	VERB
ahs-7374	87	26	nuclear	nuclear	ADJ
ahs-7374	87	27	ribosomal	ribosomal	NOUN
ahs-7374	87	28	dna	dna	NOUN
ahs-7374	87	29	or	or	CCONJ
ahs-7374	87	30	chloroplast	chloroplast	NOUN
ahs-7374	87	31	genes	gene	NOUN
ahs-7374	87	32	(	(	PUNCT
ahs-7374	87	33	its1	its1	PROPN
ahs-7374	87	34	and	and	CCONJ
ahs-7374	87	35	2	2	NUM
ahs-7374	87	36	,	,	PUNCT
ahs-7374	87	37	matk	matk	PROPN
ahs-7374	87	38	,	,	PUNCT
ahs-7374	87	39	rbcl	rbcl	NOUN
ahs-7374	87	40	and	and	CCONJ
ahs-7374	87	41	psba	psba	NOUN
ahs-7374	87	42	-	-	PUNCT
ahs-7374	87	43	trnh	trnh	NOUN
ahs-7374	87	44	)	)	PUNCT
ahs-7374	87	45	.	.	PUNCT
ahs-7374	88	1	apart	apart	ADV
ahs-7374	88	2	from	from	ADP
ahs-7374	88	3	its	its	PRON
ahs-7374	88	4	1	1	NUM
ahs-7374	88	5	and	and	CCONJ
ahs-7374	88	6	2	2	NUM
ahs-7374	88	7	,	,	PUNCT
ahs-7374	88	8	all	all	DET
ahs-7374	88	9	the	the	DET
ahs-7374	88	10	primers	primer	NOUN
ahs-7374	88	11	enabled	enable	VERB
ahs-7374	88	12	amplification	amplification	NOUN
ahs-7374	88	13	and	and	CCONJ
ahs-7374	88	14	sequencing	sequencing	NOUN
ahs-7374	88	15	of	of	ADP
ahs-7374	88	16	all	all	DET
ahs-7374	88	17	the	the	DET
ahs-7374	88	18	samples	sample	NOUN
ahs-7374	88	19	.	.	PUNCT
ahs-7374	89	1	most	most	ADJ
ahs-7374	89	2	of	of	ADP
ahs-7374	89	3	the	the	DET
ahs-7374	89	4	citrus	citrus	NOUN
ahs-7374	89	5	species	specie	NOUN
ahs-7374	89	6	were	be	AUX
ahs-7374	89	7	correctly	correctly	ADV
ahs-7374	89	8	identified	identify	VERB
ahs-7374	89	9	even	even	ADV
ahs-7374	89	10	if	if	SCONJ
ahs-7374	89	11	the	the	DET
ahs-7374	89	12	comparison	comparison	NOUN
ahs-7374	89	13	of	of	ADP
ahs-7374	89	14	the	the	DET
ahs-7374	89	15	analysed	analyse	VERB
ahs-7374	89	16	dna	dna	NOUN
ahs-7374	89	17	fragments	fragment	NOUN
ahs-7374	89	18	with	with	ADP
ahs-7374	89	19	the	the	DET
ahs-7374	89	20	data	datum	NOUN
ahs-7374	89	21	available	available	ADJ
ahs-7374	89	22	in	in	ADP
ahs-7374	89	23	the	the	DET
ahs-7374	89	24	databases	database	NOUN
ahs-7374	89	25	showed	show	VERB
ahs-7374	89	26	several	several	ADJ
ahs-7374	89	27	discrepancies	discrepancy	NOUN
ahs-7374	89	28	.	.	PUNCT
ahs-7374	90	1	this	this	DET
ahs-7374	90	2	observation	observation	NOUN
ahs-7374	90	3	suggested	suggest	VERB
ahs-7374	90	4	to	to	PART
ahs-7374	90	5	introduce	introduce	VERB
ahs-7374	90	6	samples	sample	NOUN
ahs-7374	90	7	of	of	ADP
ahs-7374	90	8	certain	certain	ADJ
ahs-7374	90	9	origin	origin	NOUN
ahs-7374	90	10	in	in	ADP
ahs-7374	90	11	barcoding	barcode	VERB
ahs-7374	90	12	analysis	analysis	NOUN
ahs-7374	90	13	in	in	ADP
ahs-7374	90	14	order	order	NOUN
ahs-7374	90	15	to	to	PART
ahs-7374	90	16	avoid	avoid	VERB
ahs-7374	90	17	biases	bias	NOUN
ahs-7374	90	18	due	due	ADJ
ahs-7374	90	19	to	to	ADP
ahs-7374	90	20	errors	error	NOUN
ahs-7374	90	21	occurring	occur	VERB
ahs-7374	90	22	in	in	ADP
ahs-7374	90	23	the	the	DET
ahs-7374	90	24	sequences	sequence	NOUN
ahs-7374	90	25	uploaded	upload	VERB
ahs-7374	90	26	on	on	ADP
ahs-7374	90	27	the	the	DET
ahs-7374	90	28	database	database	NOUN
ahs-7374	90	29	.	.	PUNCT
ahs-7374	91	1	according	accord	VERB
ahs-7374	91	2	to	to	ADP
ahs-7374	91	3	the	the	DET
ahs-7374	91	4	results	result	NOUN
ahs-7374	91	5	of	of	ADP
ahs-7374	91	6	our	our	PRON
ahs-7374	91	7	analysis	analysis	NOUN
ahs-7374	91	8	,	,	PUNCT
ahs-7374	91	9	we	we	PRON
ahs-7374	91	10	can	can	AUX
ahs-7374	91	11	state	state	VERB
ahs-7374	91	12	with	with	ADP
ahs-7374	91	13	reasonable	reasonable	ADJ
ahs-7374	91	14	certainty	certainty	NOUN
ahs-7374	91	15	that	that	SCONJ
ahs-7374	91	16	all	all	DET
ahs-7374	91	17	the	the	DET
ahs-7374	91	18	afghan	afghan	ADJ
ahs-7374	91	19	citrus	citrus	NOUN
ahs-7374	91	20	samples	sample	NOUN
ahs-7374	91	21	are	be	AUX
ahs-7374	91	22	sour	sour	ADJ
ahs-7374	91	23	orange	orange	PROPN
ahs-7374	91	24	,	,	PUNCT
ahs-7374	91	25	which	which	PRON
ahs-7374	91	26	is	be	AUX
ahs-7374	91	27	commonly	commonly	ADV
ahs-7374	91	28	used	use	VERB
ahs-7374	91	29	as	as	ADP
ahs-7374	91	30	a	a	DET
ahs-7374	91	31	rootstock	rootstock	NOUN
ahs-7374	91	32	.	.	PUNCT
ahs-7374	92	1	the	the	DET
ahs-7374	92	2	wide	wide	ADJ
ahs-7374	92	3	diffusion	diffusion	NOUN
ahs-7374	92	4	of	of	ADP
ahs-7374	92	5	sour	sour	ADJ
ahs-7374	92	6	orange	orange	NOUN
ahs-7374	92	7	in	in	ADP
ahs-7374	92	8	those	those	DET
ahs-7374	92	9	regions	region	NOUN
ahs-7374	92	10	of	of	ADP
ahs-7374	92	11	afghanistan	afghanistan	PROPN
ahs-7374	92	12	is	be	AUX
ahs-7374	92	13	due	due	ADJ
ahs-7374	92	14	to	to	ADP
ahs-7374	92	15	the	the	DET
ahs-7374	92	16	fact	fact	NOUN
ahs-7374	92	17	that	that	SCONJ
ahs-7374	92	18	its	its	PRON
ahs-7374	92	19	fruits	fruit	NOUN
ahs-7374	92	20	are	be	AUX
ahs-7374	92	21	consumed	consume	VERB
ahs-7374	92	22	fresh	fresh	ADJ
ahs-7374	92	23	(	(	PUNCT
ahs-7374	92	24	http://anhdo.org.af/wpcontent/uploads/2017/06/citrus-market-trend.pdf	http://anhdo.org.af/wpcontent/uploads/2017/06/citrus-market-trend.pdf	PROPN
ahs-7374	92	25	)	)	PUNCT
ahs-7374	92	26	.	.	PUNCT
ahs-7374	93	1	the	the	DET
ahs-7374	93	2	plants	plant	NOUN
ahs-7374	93	3	are	be	AUX
ahs-7374	93	4	not	not	PART
ahs-7374	93	5	topworked	topworke	VERB
ahs-7374	93	6	,	,	PUNCT
ahs-7374	93	7	as	as	ADV
ahs-7374	93	8	usual	usual	ADJ
ahs-7374	93	9	,	,	PUNCT
ahs-7374	93	10	with	with	ADP
ahs-7374	93	11	selected	select	VERB
ahs-7374	93	12	c.	c.	NOUN
ahs-7374	93	13	sinensis	sinensis	NOUN
ahs-7374	93	14	varieties	variety	NOUN
ahs-7374	93	15	.	.	PUNCT
ahs-7374	94	1	grafting	grafting	NOUN
ahs-7374	94	2	would	would	AUX
ahs-7374	94	3	have	have	AUX
ahs-7374	94	4	shown	show	VERB
ahs-7374	94	5	heavily	heavily	ADV
ahs-7374	94	6	the	the	DET
ahs-7374	94	7	symptoms	symptom	NOUN
ahs-7374	94	8	of	of	ADP
ahs-7374	94	9	tristeza	tristeza	NOUN
ahs-7374	94	10	disease	disease	NOUN
ahs-7374	94	11	,	,	PUNCT
ahs-7374	94	12	while	while	SCONJ
ahs-7374	94	13	this	this	PRON
ahs-7374	94	14	does	do	AUX
ahs-7374	94	15	not	not	PART
ahs-7374	94	16	occur	occur	VERB
ahs-7374	94	17	in	in	ADP
ahs-7374	94	18	ungrafted	ungrafted	ADJ
ahs-7374	94	19	c.	c.	PROPN
ahs-7374	94	20	aurantium	aurantium	PROPN
ahs-7374	94	21	(	(	PUNCT
ahs-7374	94	22	gómezmuñoz	gómezmuñoz	PROPN
ahs-7374	94	23	et	et	PROPN
ahs-7374	94	24	al	al	PROPN
ahs-7374	94	25	.	.	PROPN
ahs-7374	94	26	,	,	PUNCT
ahs-7374	94	27	2017	2017	NUM
ahs-7374	94	28	)	)	PUNCT
ahs-7374	94	29	.	.	PUNCT
ahs-7374	95	1	in	in	ADP
ahs-7374	95	2	conclusion	conclusion	NOUN
ahs-7374	95	3	,	,	PUNCT
ahs-7374	95	4	stepwise	stepwise	ADJ
ahs-7374	95	5	replacement	replacement	NOUN
ahs-7374	95	6	of	of	ADP
ahs-7374	95	7	the	the	DET
ahs-7374	95	8	orange	orange	PROPN
ahs-7374	95	9	germplasm	germplasm	NOUN
ahs-7374	95	10	in	in	ADP
ahs-7374	95	11	afghanistan	afghanistan	PROPN
ahs-7374	95	12	with	with	ADP
ahs-7374	95	13	ctv	ctv	PROPN
ahs-7374	95	14	resistant	resistant	ADJ
ahs-7374	95	15	rootstocks	rootstock	NOUN
ahs-7374	95	16	is	be	AUX
ahs-7374	95	17	advisable	advisable	ADJ
ahs-7374	95	18	before	before	ADP
ahs-7374	95	19	grafting	graft	VERB
ahs-7374	95	20	with	with	ADP
ahs-7374	95	21	selected	select	VERB
ahs-7374	95	22	orange	orange	ADJ
ahs-7374	95	23	varieties	variety	NOUN
ahs-7374	95	24	to	to	PART
ahs-7374	95	25	prevent	prevent	VERB
ahs-7374	95	26	ctv	ctv	NOUN
ahs-7374	95	27	spreading	spread	VERB
ahs-7374	95	28	.	.	PUNCT
ahs-7374	96	1	however	however	ADV
ahs-7374	96	2	,	,	PUNCT
ahs-7374	96	3	the	the	DET
ahs-7374	96	4	replacement	replacement	NOUN
ahs-7374	96	5	of	of	ADP
ahs-7374	96	6	sour	sour	ADJ
ahs-7374	96	7	orange	orange	PROPN
ahs-7374	96	8	,	,	PUNCT
ahs-7374	96	9	a	a	DET
ahs-7374	96	10	rootstock	rootstock	NOUN
ahs-7374	96	11	characterized	characterize	VERB
ahs-7374	96	12	by	by	ADP
ahs-7374	96	13	highly	highly	ADV
ahs-7374	96	14	desirable	desirable	ADJ
ahs-7374	96	15	agronomic	agronomic	ADJ
ahs-7374	96	16	features	feature	NOUN
ahs-7374	96	17	,	,	PUNCT
ahs-7374	96	18	with	with	ADP
ahs-7374	96	19	ctv	ctv	NOUN
ahs-7374	96	20	resistant	resistant	ADJ
ahs-7374	96	21	rootstocks	rootstock	NOUN
ahs-7374	96	22	should	should	AUX
ahs-7374	96	23	be	be	AUX
ahs-7374	96	24	carried	carry	VERB
ahs-7374	96	25	out	out	ADP
ahs-7374	96	26	after	after	ADP
ahs-7374	96	27	devising	devise	VERB
ahs-7374	96	28	the	the	DET
ahs-7374	96	29	whole	whole	ADJ
ahs-7374	96	30	production	production	NOUN
ahs-7374	96	31	chain	chain	NOUN
ahs-7374	96	32	,	,	PUNCT
ahs-7374	96	33	starting	start	VERB
ahs-7374	96	34	from	from	ADP
ahs-7374	96	35	the	the	DET
ahs-7374	96	36	adoption	adoption	NOUN
ahs-7374	96	37	of	of	ADP
ahs-7374	96	38	proper	proper	ADJ
ahs-7374	96	39	cropping	cropping	NOUN
ahs-7374	96	40	fig	fig	NOUN
ahs-7374	96	41	.	.	PUNCT
ahs-7374	97	1	2	2	NUM
ahs-7374	97	2	two	two	NUM
ahs-7374	97	3	haplotypes	haplotype	NOUN
ahs-7374	97	4	of	of	ADP
ahs-7374	97	5	c.	c.	PROPN
ahs-7374	97	6	aurantium	aurantium	PROPN
ahs-7374	97	7	and	and	CCONJ
ahs-7374	97	8	c.	c.	PROPN
ahs-7374	97	9	sinensis	sinensis	NOUN
ahs-7374	97	10	originated	originate	VERB
ahs-7374	97	11	by	by	ADP
ahs-7374	97	12	a	a	DET
ahs-7374	97	13	single	single	ADJ
ahs-7374	97	14	nucleotide	nucleotide	NOUN
ahs-7374	97	15	polymorphism	polymorphism	NOUN
ahs-7374	97	16	getting	get	VERB
ahs-7374	97	17	from	from	ADP
ahs-7374	97	18	the	the	DET
ahs-7374	97	19	sequencing	sequencing	NOUN
ahs-7374	97	20	of	of	ADP
ahs-7374	97	21	psba‐trnh	psba‐trnh	NOUN
ahs-7374	97	22	intergenic	intergenic	ADJ
ahs-7374	97	23	spacer	spacer	NOUN
ahs-7374	97	24	(	(	PUNCT
ahs-7374	97	25	psba‐trnh	psba‐trnh	PROPN
ahs-7374	97	26	)	)	PUNCT
ahs-7374	97	27	.	.	PUNCT
ahs-7374	98	1	fig	fig	NOUN
ahs-7374	98	2	.	.	PUNCT
ahs-7374	99	1	3	3	NUM
ahs-7374	99	2	upgma	upgma	PROPN
ahs-7374	99	3	dendrogram	dendrogram	NOUN
ahs-7374	99	4	representing	represent	VERB
ahs-7374	99	5	the	the	DET
ahs-7374	99	6	genetic	genetic	ADJ
ahs-7374	99	7	distances	distance	NOUN
ahs-7374	99	8	among	among	ADP
ahs-7374	99	9	the	the	DET
ahs-7374	99	10	analysed	analyse	VERB
ahs-7374	99	11	samples	sample	NOUN
ahs-7374	99	12	.	.	PUNCT
ahs-7374	100	1	http://anhdo.org.af/wp-content/uploads/2017/06/citrus-market-trend.pdf	http://anhdo.org.af/wp-content/uploads/2017/06/citrus-market-trend.pdf	PRON
ahs-7374	100	2	http://anhdo.org.af/wp-content/uploads/2017/06/citrus-market-trend.pdf	http://anhdo.org.af/wp-content/uploads/2017/06/citrus-market-trend.pdf	ADP
ahs-7374	100	3	408	408	NUM
ahs-7374	100	4	adv	adv	PROPN
ahs-7374	100	5	.	.	PUNCT
ahs-7374	100	6	hort	hort	PROPN
ahs-7374	100	7	.	.	PUNCT
ahs-7374	101	1	sci	sci	PROPN
ahs-7374	101	2	.	.	PROPN
ahs-7374	101	3	,	,	PUNCT
ahs-7374	101	4	2019	2019	NUM
ahs-7374	101	5	33(3	33(3	NOUN
ahs-7374	101	6	):	):	PUNCT
ahs-7374	101	7	403	403	NUM
ahs-7374	101	8	-	-	SYM
ahs-7374	101	9	408	408	NUM
ahs-7374	101	10	system	system	NOUN
ahs-7374	101	11	(	(	PUNCT
ahs-7374	101	12	irrigation	irrigation	NOUN
ahs-7374	101	13	,	,	PUNCT
ahs-7374	101	14	fertilization	fertilization	NOUN
ahs-7374	101	15	,	,	PUNCT
ahs-7374	101	16	soil	soil	NOUN
ahs-7374	101	17	management	management	NOUN
ahs-7374	101	18	,	,	PUNCT
ahs-7374	101	19	etc	etc	X
ahs-7374	101	20	.	.	X
ahs-7374	101	21	)	)	PUNCT
ahs-7374	102	1	in	in	ADP
ahs-7374	102	2	order	order	NOUN
ahs-7374	102	3	to	to	PART
ahs-7374	102	4	prevent	prevent	VERB
ahs-7374	102	5	that	that	SCONJ
ahs-7374	102	6	other	other	ADJ
ahs-7374	102	7	endemic	endemic	ADJ
ahs-7374	102	8	diseases	disease	NOUN
ahs-7374	102	9	can	can	AUX
ahs-7374	102	10	affect	affect	VERB
ahs-7374	102	11	the	the	DET
ahs-7374	102	12	newly	newly	ADV
ahs-7374	102	13	introduced	introduce	VERB
ahs-7374	102	14	germplasm	germplasm	NOUN
ahs-7374	102	15	.	.	PUNCT
ahs-7374	103	1	references	reference	NOUN
ahs-7374	103	2	bailey	bailey	PROPN
ahs-7374	103	3	j.b	j.b	PROPN
ahs-7374	103	4	.	.	PROPN
ahs-7374	103	5	,	,	PUNCT
ahs-7374	103	6	lamb	lamb	PROPN
ahs-7374	103	7	m.	m.	PROPN
ahs-7374	103	8	,	,	PUNCT
ahs-7374	103	9	walker	walker	PROPN
ahs-7374	103	10	m.	m.	PROPN
ahs-7374	103	11	,	,	PUNCT
ahs-7374	103	12	weed	weed	VERB
ahs-7374	103	13	c.	c.	NOUN
ahs-7374	103	14	,	,	PUNCT
ahs-7374	103	15	craven	craven	NOUN
ahs-7374	103	16	k.s	k.s	PROPN
ahs-7374	103	17	.	.	PROPN
ahs-7374	103	18	,	,	PUNCT
ahs-7374	103	19	2018	2018	NUM
ahs-7374	103	20	detection	detection	NOUN
ahs-7374	103	21	of	of	ADP
ahs-7374	103	22	potential	potential	ADJ
ahs-7374	103	23	fungal	fungal	ADJ
ahs-7374	103	24	pathogens	pathogen	NOUN
ahs-7374	103	25	fusarium	fusarium	NOUN
ahs-7374	103	26	falciforme	falciforme	NOUN
ahs-7374	103	27	and	and	CCONJ
ahs-7374	103	28	f.	f.	PROPN
ahs-7374	103	29	keratoplasticum	keratoplasticum	PROPN
ahs-7374	103	30	in	in	ADP
ahs-7374	103	31	unhatched	unhatche	VERB
ahs-7374	103	32	loggerhead	loggerhead	NOUN
ahs-7374	103	33	turtle	turtle	NOUN
ahs-7374	103	34	eggs	egg	NOUN
ahs-7374	103	35	using	use	VERB
ahs-7374	103	36	a	a	DET
ahs-7374	103	37	molecular	molecular	ADJ
ahs-7374	103	38	approach	approach	NOUN
ahs-7374	103	39	.	.	PUNCT
ahs-7374	104	1	‐	‐	PROPN
ahs-7374	104	2	endang	endang	PROPN
ahs-7374	104	3	.	.	PUNCT
ahs-7374	105	1	species	specie	NOUN
ahs-7374	105	2	res	re	NOUN
ahs-7374	105	3	.	.	PUNCT
ahs-7374	105	4	,	,	PUNCT
ahs-7374	105	5	36	36	NUM
ahs-7374	105	6	:	:	SYM
ahs-7374	105	7	111	111	NUM
ahs-7374	105	8	-	-	SYM
ahs-7374	105	9	119	119	NUM
ahs-7374	105	10	.	.	PUNCT
ahs-7374	106	1	bengtsson	bengtsson	NOUN
ahs-7374	106	2	-	-	PUNCT
ahs-7374	106	3	palme	palme	PROPN
ahs-7374	106	4	j.	j.	PROPN
ahs-7374	106	5	,	,	PUNCT
ahs-7374	106	6	boulund	boulund	PROPN
ahs-7374	106	7	f.	f.	PROPN
ahs-7374	106	8	,	,	PUNCT
ahs-7374	106	9	edström	edström	PROPN
ahs-7374	106	10	r.	r.	PROPN
ahs-7374	106	11	,	,	PUNCT
ahs-7374	106	12	feizi	feizi	NOUN
ahs-7374	106	13	a.	a.	NOUN
ahs-7374	106	14	,	,	PUNCT
ahs-7374	106	15	johnning	johnne	VERB
ahs-7374	106	16	a.	a.	PROPN
ahs-7374	106	17	,	,	PUNCT
ahs-7374	106	18	jonsson	jonsson	PROPN
ahs-7374	106	19	v.a	v.a	PROPN
ahs-7374	106	20	.	.	PROPN
ahs-7374	106	21	,	,	PUNCT
ahs-7374	106	22	karlsson	karlsson	PROPN
ahs-7374	106	23	f.h	f.h	PROPN
ahs-7374	106	24	.	.	PROPN
ahs-7374	106	25	,	,	PUNCT
ahs-7374	106	26	pal	pal	PROPN
ahs-7374	106	27	c.	c.	PROPN
ahs-7374	106	28	,	,	PUNCT
ahs-7374	106	29	buongermino	buongermino	PROPN
ahs-7374	106	30	pereira	pereira	PROPN
ahs-7374	106	31	m.	m.	PROPN
ahs-7374	106	32	,	,	PUNCT
ahs-7374	106	33	rehammar	rehammar	PROPN
ahs-7374	106	34	a.	a.	PROPN
ahs-7374	106	35	,	,	PUNCT
ahs-7374	106	36	sanchez	sanchez	PROPN
ahs-7374	106	37	j.	j.	PROPN
ahs-7374	106	38	,	,	PUNCT
ahs-7374	106	39	sanli	sanli	PROPN
ahs-7374	106	40	k.	k.	PROPN
ahs-7374	106	41	,	,	PUNCT
ahs-7374	106	42	thorell	thorell	PROPN
ahs-7374	106	43	k.	k.	PROPN
ahs-7374	106	44	,	,	PUNCT
ahs-7374	106	45	2016	2016	NUM
ahs-7374	106	46	strategies	strategy	NOUN
ahs-7374	106	47	to	to	PART
ahs-7374	106	48	improve	improve	VERB
ahs-7374	106	49	usability	usability	NOUN
ahs-7374	106	50	and	and	CCONJ
ahs-7374	106	51	preserve	preserve	VERB
ahs-7374	106	52	accuracy	accuracy	NOUN
ahs-7374	106	53	in	in	ADP
ahs-7374	106	54	biological	biological	ADJ
ahs-7374	106	55	sequence	sequence	NOUN
ahs-7374	106	56	databases	database	NOUN
ahs-7374	106	57	.	.	PUNCT
ahs-7374	107	1	proteomics	proteomic	NOUN
ahs-7374	107	2	,	,	PUNCT
ahs-7374	107	3	16(18	16(18	NUM
ahs-7374	107	4	):	):	PUNCT
ahs-7374	107	5	2454	2454	NUM
ahs-7374	107	6	-	-	SYM
ahs-7374	107	7	2460	2460	NUM
ahs-7374	107	8	.	.	PUNCT
ahs-7374	108	1	chen	chen	PROPN
ahs-7374	108	2	s.	s.	PROPN
ahs-7374	108	3	,	,	PUNCT
ahs-7374	108	4	yao	yao	PROPN
ahs-7374	108	5	h.	h.	PROPN
ahs-7374	108	6	,	,	PUNCT
ahs-7374	108	7	han	han	PROPN
ahs-7374	108	8	j.	j.	PROPN
ahs-7374	108	9	,	,	PUNCT
ahs-7374	108	10	liu	liu	PROPN
ahs-7374	108	11	c.	c.	PROPN
ahs-7374	108	12	,	,	PUNCT
ahs-7374	108	13	song	song	PROPN
ahs-7374	108	14	j.	j.	PROPN
ahs-7374	108	15	,	,	PUNCT
ahs-7374	108	16	shi	shi	PROPN
ahs-7374	108	17	l.	l.	PROPN
ahs-7374	108	18	,	,	PUNCT
ahs-7374	108	19	zhu	zhu	PROPN
ahs-7374	108	20	y.	y.	PROPN
ahs-7374	108	21	,	,	PUNCT
ahs-7374	108	22	2010	2010	NUM
ahs-7374	108	23	validation	validation	NOUN
ahs-7374	108	24	of	of	ADP
ahs-7374	108	25	the	the	DET
ahs-7374	108	26	its2	its2	PROPN
ahs-7374	108	27	region	region	NOUN
ahs-7374	108	28	as	as	ADP
ahs-7374	108	29	a	a	DET
ahs-7374	108	30	novel	novel	ADJ
ahs-7374	108	31	dna	dna	NOUN
ahs-7374	108	32	bar‐	bar‐	ADP
ahs-7374	108	33	code	code	NOUN
ahs-7374	108	34	for	for	ADP
ahs-7374	108	35	identifying	identify	VERB
ahs-7374	108	36	medicinal	medicinal	ADJ
ahs-7374	108	37	plant	plant	NOUN
ahs-7374	108	38	species	specie	NOUN
ahs-7374	108	39	.	.	PUNCT
ahs-7374	109	1	plos	plos	PROPN
ahs-7374	109	2	one	one	NUM
ahs-7374	109	3	,	,	PUNCT
ahs-7374	109	4	5	5	NUM
ahs-7374	109	5	(	(	PUNCT
ahs-7374	109	6	1	1	NUM
ahs-7374	109	7	)	)	PUNCT
ahs-7374	109	8	e8613	e8613	ADJ
ahs-7374	109	9	:	:	PUNCT
ahs-7374	109	10	1	1	NUM
ahs-7374	109	11	-	-	SYM
ahs-7374	109	12	8	8	NUM
ahs-7374	109	13	.	.	PUNCT
ahs-7374	110	1	cheng	cheng	PROPN
ahs-7374	110	2	t.	t.	PROPN
ahs-7374	110	3	,	,	PUNCT
ahs-7374	110	4	xu	xu	PROPN
ahs-7374	110	5	c.	c.	PROPN
ahs-7374	110	6	,	,	PUNCT
ahs-7374	110	7	lei	lei	PROPN
ahs-7374	110	8	l.	l.	PROPN
ahs-7374	110	9	,	,	PUNCT
ahs-7374	110	10	li	li	PROPN
ahs-7374	110	11	c.	c.	PROPN
ahs-7374	110	12	,	,	PUNCT
ahs-7374	110	13	zhang	zhang	PROPN
ahs-7374	110	14	y.	y.	PROPN
ahs-7374	110	15	,	,	PUNCT
ahs-7374	110	16	zhou	zhou	PROPN
ahs-7374	110	17	s.	s.	PROPN
ahs-7374	110	18	,	,	PUNCT
ahs-7374	110	19	2016	2016	NUM
ahs-7374	110	20	barcoding	barcode	VERB
ahs-7374	110	21	the	the	DET
ahs-7374	110	22	kingdom	kingdom	NOUN
ahs-7374	110	23	plantae	plantae	NOUN
ahs-7374	110	24	:	:	PUNCT
ahs-7374	110	25	new	new	ADJ
ahs-7374	110	26	pcr	pcr	ADJ
ahs-7374	110	27	primers	primer	NOUN
ahs-7374	110	28	for	for	ADP
ahs-7374	110	29	its	its	PRON
ahs-7374	110	30	regions	region	NOUN
ahs-7374	110	31	of	of	ADP
ahs-7374	110	32	plants	plant	NOUN
ahs-7374	110	33	with	with	ADP
ahs-7374	110	34	improved	improved	ADJ
ahs-7374	110	35	universality	universality	NOUN
ahs-7374	110	36	and	and	CCONJ
ahs-7374	110	37	specificity	specificity	NOUN
ahs-7374	110	38	.	.	PUNCT
ahs-7374	111	1	mol	mol	PROPN
ahs-7374	111	2	.	.	PUNCT
ahs-7374	112	1	ecol	ecol	PROPN
ahs-7374	112	2	.	.	PUNCT
ahs-7374	113	1	resour	resour	NOUN
ahs-7374	113	2	,	,	PUNCT
ahs-7374	113	3	16	16	NUM
ahs-7374	113	4	:	:	SYM
ahs-7374	113	5	138	138	NUM
ahs-7374	113	6	-	-	SYM
ahs-7374	113	7	149	149	NUM
ahs-7374	113	8	.	.	PUNCT
ahs-7374	114	1	giordani	giordani	PROPN
ahs-7374	114	2	e.	e.	PROPN
ahs-7374	114	3	,	,	PUNCT
ahs-7374	114	4	cullen	cullen	PROPN
ahs-7374	114	5	g.	g.	PROPN
ahs-7374	114	6	,	,	PUNCT
ahs-7374	114	7	degl’innocenti	degl’innocenti	SCONJ
ahs-7374	114	8	p.	p.	NOUN
ahs-7374	114	9	,	,	PUNCT
ahs-7374	114	10	masini	masini	PROPN
ahs-7374	114	11	g.	g.	PROPN
ahs-7374	114	12	,	,	PUNCT
ahs-7374	114	13	2014	2014	NUM
ahs-7374	114	14	local	local	ADJ
ahs-7374	114	15	fruits	fruit	NOUN
ahs-7374	114	16	and	and	CCONJ
ahs-7374	114	17	nuts	nut	NOUN
ahs-7374	114	18	as	as	ADP
ahs-7374	114	19	a	a	DET
ahs-7374	114	20	tool	tool	NOUN
ahs-7374	114	21	for	for	ADP
ahs-7374	114	22	the	the	DET
ahs-7374	114	23	develop‐	develop‐	NOUN
ahs-7374	114	24	ment	ment	NOUN
ahs-7374	114	25	of	of	ADP
ahs-7374	114	26	afghanistan	afghanistan	PROPN
ahs-7374	114	27	.	.	PUNCT
ahs-7374	115	1	junco	junco	NOUN
ahs-7374	115	2	,	,	PUNCT
ahs-7374	115	3	1	1	NUM
ahs-7374	115	4	:	:	PUNCT
ahs-7374	115	5	627	627	NUM
ahs-7374	115	6	-	-	SYM
ahs-7374	115	7	635	635	NUM
ahs-7374	115	8	.	.	PUNCT
ahs-7374	115	9	gómez	gómez	PROPN
ahs-7374	115	10	-	-	PUNCT
ahs-7374	115	11	muñoz	muñoz	PROPN
ahs-7374	115	12	n.	n.	PROPN
ahs-7374	115	13	,	,	PUNCT
ahs-7374	115	14	velázquez	velázquez	NOUN
ahs-7374	115	15	k.v	k.v	PROPN
ahs-7374	115	16	.	.	PROPN
ahs-7374	115	17	,	,	PUNCT
ahs-7374	115	18	maría	maría	PROPN
ahs-7374	115	19	c.	c.	PROPN
ahs-7374	115	20	,	,	PUNCT
ahs-7374	115	21	ruiz	ruiz	NOUN
ahs-7374	115	22	-	-	PUNCT
ahs-7374	115	23	ruiz	ruiz	NOUN
ahs-7374	115	24	s.	s.	PROPN
ahs-7374	115	25	,	,	PUNCT
ahs-7374	115	26	pina	pina	PROPN
ahs-7374	115	27	j.a	j.a	PROPN
ahs-7374	115	28	.	.	PROPN
ahs-7374	115	29	,	,	PUNCT
ahs-7374	115	30	flores	flores	PROPN
ahs-7374	115	31	r.	r.	PROPN
ahs-7374	115	32	,	,	PUNCT
ahs-7374	115	33	moreno	moreno	PROPN
ahs-7374	115	34	p.	p.	PROPN
ahs-7374	115	35	,	,	PUNCT
ahs-7374	115	36	guerri	guerri	PROPN
ahs-7374	115	37	j.	j.	PROPN
ahs-7374	115	38	,	,	PUNCT
ahs-7374	115	39	2017	2017	NUM
ahs-7374	115	40	the	the	DET
ahs-7374	115	41	resistance	resistance	NOUN
ahs-7374	115	42	of	of	ADP
ahs-7374	115	43	sour	sour	ADJ
ahs-7374	115	44	orange	orange	PROPN
ahs-7374	115	45	to	to	PART
ahs-7374	115	46	citrus	citrus	PROPN
ahs-7374	115	47	tristeza	tristeza	PROPN
ahs-7374	115	48	virus	virus	NOUN
ahs-7374	115	49	is	be	AUX
ahs-7374	115	50	mediated	mediate	VERB
ahs-7374	115	51	by	by	ADP
ahs-7374	115	52	both	both	CCONJ
ahs-7374	115	53	the	the	DET
ahs-7374	115	54	salicylic	salicylic	ADJ
ahs-7374	115	55	acid	acid	NOUN
ahs-7374	115	56	and	and	CCONJ
ahs-7374	115	57	rna	rna	NOUN
ahs-7374	115	58	silencing	silence	VERB
ahs-7374	115	59	defence	defence	NOUN
ahs-7374	115	60	pathways	pathway	NOUN
ahs-7374	115	61	.	.	PUNCT
ahs-7374	116	1	‐	‐	PROPN
ahs-7374	116	2	mol	mol	PROPN
ahs-7374	116	3	.	.	PUNCT
ahs-7374	116	4	plant	plant	NOUN
ahs-7374	116	5	pathol	pathol	NOUN
ahs-7374	116	6	.	.	PUNCT
ahs-7374	116	7	,	,	PUNCT
ahs-7374	116	8	18(9	18(9	NOUN
ahs-7374	116	9	):	):	PUNCT
ahs-7374	116	10	12531266	12531266	NUM
ahs-7374	116	11	.	.	PUNCT
ahs-7374	117	1	jeanson	jeanson	PROPN
ahs-7374	118	1	m.l	m.l	PROPN
ahs-7374	118	2	.	.	PROPN
ahs-7374	118	3	,	,	PUNCT
ahs-7374	118	4	labat	labat	PROPN
ahs-7374	118	5	j.n	j.n	PROPN
ahs-7374	118	6	.	.	PROPN
ahs-7374	118	7	,	,	PUNCT
ahs-7374	118	8	little	little	ADJ
ahs-7374	118	9	d.p	d.p	PROPN
ahs-7374	118	10	.	.	PROPN
ahs-7374	118	11	,	,	PUNCT
ahs-7374	118	12	2011	2011	NUM
ahs-7374	118	13	dna	dna	PROPN
ahs-7374	118	14	barcod‐	barcod‐	X
ahs-7374	118	15	ing	ing	ADJ
ahs-7374	118	16	:	:	PUNCT
ahs-7374	118	17	a	a	DET
ahs-7374	118	18	new	new	ADJ
ahs-7374	118	19	tool	tool	NOUN
ahs-7374	118	20	for	for	ADP
ahs-7374	118	21	palm	palm	NOUN
ahs-7374	118	22	taxonomists	taxonomist	NOUN
ahs-7374	118	23	?	?	PUNCT
ahs-7374	119	1	ann	ann	PROPN
ahs-7374	119	2	.	.	PUNCT
ahs-7374	119	3	bot	bot	PROPN
ahs-7374	119	4	.	.	PUNCT
ahs-7374	119	5	,	,	PUNCT
ahs-7374	119	6	108	108	NUM
ahs-7374	119	7	:	:	SYM
ahs-7374	119	8	1445	1445	NUM
ahs-7374	119	9	-	-	SYM
ahs-7374	119	10	1451	1451	NUM
ahs-7374	119	11	.	.	PUNCT
ahs-7374	120	1	kress	kress	PROPN
ahs-7374	120	2	w.j	w.j	PROPN
ahs-7374	120	3	.	.	PROPN
ahs-7374	120	4	,	,	PUNCT
ahs-7374	120	5	wurdack	wurdack	PROPN
ahs-7374	120	6	k.j	k.j	PROPN
ahs-7374	120	7	.	.	PROPN
ahs-7374	120	8	,	,	PUNCT
ahs-7374	120	9	zimmer	zimmer	PROPN
ahs-7374	120	10	e.a	e.a	PROPN
ahs-7374	120	11	.	.	PROPN
ahs-7374	120	12	,	,	PUNCT
ahs-7374	120	13	weigt	weigt	PROPN
ahs-7374	120	14	l.a	l.a	PROPN
ahs-7374	120	15	.	.	PROPN
ahs-7374	120	16	,	,	PUNCT
ahs-7374	120	17	janzen	janzen	PROPN
ahs-7374	120	18	d.h	d.h	PROPN
ahs-7374	120	19	.	.	PROPN
ahs-7374	120	20	,	,	PUNCT
ahs-7374	120	21	2005	2005	NUM
ahs-7374	120	22	use	use	NOUN
ahs-7374	120	23	of	of	ADP
ahs-7374	120	24	dna	dna	PROPN
ahs-7374	120	25	barcodes	barcode	NOUN
ahs-7374	120	26	to	to	PART
ahs-7374	120	27	identify	identify	VERB
ahs-7374	120	28	flowering	flower	VERB
ahs-7374	120	29	plants	plant	NOUN
ahs-7374	120	30	.	.	PUNCT
ahs-7374	121	1	‐	‐	ADJ
ahs-7374	121	2	proceedings	proceeding	NOUN
ahs-7374	121	3	of	of	ADP
ahs-7374	121	4	the	the	DET
ahs-7374	121	5	national	national	PROPN
ahs-7374	121	6	academy	academy	PROPN
ahs-7374	121	7	of	of	ADP
ahs-7374	121	8	sciences	sciences	PROPN
ahs-7374	121	9	(	(	PUNCT
ahs-7374	121	10	pnas	pnas	PROPN
ahs-7374	121	11	)	)	PUNCT
ahs-7374	121	12	,	,	PUNCT
ahs-7374	121	13	102	102	NUM
ahs-7374	121	14	(	(	PUNCT
ahs-7374	121	15	23	23	NUM
ahs-7374	121	16	):	):	PUNCT
ahs-7374	121	17	8369	8369	NUM
ahs-7374	121	18	-	-	SYM
ahs-7374	121	19	8374	8374	NUM
ahs-7374	121	20	.	.	PUNCT
ahs-7374	122	1	luo	luo	PROPN
ahs-7374	122	2	k.	k.	PROPN
ahs-7374	122	3	,	,	PUNCT
ahs-7374	122	4	chen	chen	PROPN
ahs-7374	122	5	s.l	s.l	PROPN
ahs-7374	122	6	.	.	PROPN
ahs-7374	122	7	,	,	PUNCT
ahs-7374	122	8	chen	chen	PROPN
ahs-7374	122	9	k.l	k.l	PROPN
ahs-7374	122	10	.	.	PROPN
ahs-7374	122	11	,	,	PUNCT
ahs-7374	122	12	song	song	PROPN
ahs-7374	122	13	j.y	j.y	PROPN
ahs-7374	122	14	.	.	PROPN
ahs-7374	122	15	,	,	PUNCT
ahs-7374	122	16	yao	yao	PROPN
ahs-7374	122	17	h.	h.	PROPN
ahs-7374	122	18	,	,	PUNCT
ahs-7374	122	19	ma	ma	PROPN
ahs-7374	122	20	x.y	x.y	PROPN
ahs-7374	122	21	.	.	PROPN
ahs-7374	122	22	,	,	PUNCT
ahs-7374	122	23	zhu	zhu	PROPN
ahs-7374	122	24	y.j	y.j	PROPN
ahs-7374	122	25	.	.	PROPN
ahs-7374	122	26	,	,	PUNCT
ahs-7374	122	27	pang	pang	NOUN
ahs-7374	122	28	x.h	x.h	PROPN
ahs-7374	122	29	.	.	PROPN
ahs-7374	122	30	,	,	PUNCT
ahs-7374	122	31	yu	yu	PROPN
ahs-7374	122	32	h.	h.	PROPN
ahs-7374	122	33	,	,	PUNCT
ahs-7374	122	34	li	li	PROPN
ahs-7374	123	1	x.w	x.w	PROPN
ahs-7374	123	2	.	.	PROPN
ahs-7374	123	3	,	,	PUNCT
ahs-7374	123	4	liu	liu	PROPN
ahs-7374	123	5	z.	z.	PROPN
ahs-7374	123	6	,	,	PUNCT
ahs-7374	123	7	2010	2010	NUM
ahs-7374	123	8	assessment	assessment	NOUN
ahs-7374	123	9	of	of	ADP
ahs-7374	123	10	candidate	candidate	NOUN
ahs-7374	123	11	plant	plant	NOUN
ahs-7374	123	12	dna	dna	NOUN
ahs-7374	123	13	barcodes	barcode	NOUN
ahs-7374	123	14	using	use	VERB
ahs-7374	123	15	the	the	DET
ahs-7374	123	16	rutaceae	rutaceae	PROPN
ahs-7374	123	17	family	family	NOUN
ahs-7374	123	18	.	.	PUNCT
ahs-7374	124	1	sci	sci	PROPN
ahs-7374	124	2	.	.	PUNCT
ahs-7374	125	1	china	china	PROPN
ahs-7374	125	2	life	life	PROPN
ahs-7374	125	3	sci	sci	PROPN
ahs-7374	125	4	.	.	PROPN
ahs-7374	125	5	,	,	PUNCT
ahs-7374	125	6	53(6	53(6	PROPN
ahs-7374	125	7	):	):	PUNCT
ahs-7374	125	8	701	701	NUM
ahs-7374	125	9	-	-	SYM
ahs-7374	125	10	708	708	NUM
ahs-7374	125	11	.	.	PUNCT
ahs-7374	126	1	mahadani	mahadani	PROPN
ahs-7374	126	2	p.	p.	PROPN
ahs-7374	126	3	,	,	PUNCT
ahs-7374	126	4	gosh	gosh	PROPN
ahs-7374	126	5	s.h	s.h	PROPN
ahs-7374	126	6	.	.	PROPN
ahs-7374	126	7	,	,	PUNCT
ahs-7374	126	8	2014	2014	NUM
ahs-7374	126	9	utility	utility	NOUN
ahs-7374	126	10	of	of	ADP
ahs-7374	126	11	indels	indel	NOUN
ahs-7374	126	12	for	for	ADP
ahs-7374	126	13	species‐level	species‐level	ADJ
ahs-7374	126	14	identification	identification	NOUN
ahs-7374	126	15	of	of	ADP
ahs-7374	126	16	a	a	DET
ahs-7374	126	17	biologically	biologically	ADV
ahs-7374	126	18	complex	complex	ADJ
ahs-7374	126	19	plant	plant	NOUN
ahs-7374	126	20	group	group	NOUN
ahs-7374	126	21	:	:	PUNCT
ahs-7374	126	22	a	a	DET
ahs-7374	126	23	study	study	NOUN
ahs-7374	126	24	with	with	ADP
ahs-7374	126	25	intergeneric	intergeneric	ADJ
ahs-7374	126	26	spacer	spacer	NOUN
ahs-7374	126	27	in	in	ADP
ahs-7374	126	28	citrus	citrus	NOUN
ahs-7374	126	29	.	.	PUNCT
ahs-7374	127	1	mol	mol	PROPN
ahs-7374	127	2	.	.	PUNCT
ahs-7374	128	1	biol	biol	PROPN
ahs-7374	128	2	.	.	PUNCT
ahs-7374	129	1	rep	rep	PROPN
ahs-7374	129	2	.	.	PROPN
ahs-7374	129	3	,	,	PUNCT
ahs-7374	129	4	41	41	NUM
ahs-7374	129	5	:	:	PUNCT
ahs-7374	129	6	7217	7217	NUM
ahs-7374	129	7	-	-	SYM
ahs-7374	129	8	7222	7222	NUM
ahs-7374	129	9	.	.	PUNCT
ahs-7374	130	1	penjor	penjor	PROPN
ahs-7374	130	2	t.	t.	PROPN
ahs-7374	130	3	,	,	PUNCT
ahs-7374	130	4	anai	anai	PROPN
ahs-7374	130	5	t.	t.	PROPN
ahs-7374	130	6	,	,	PUNCT
ahs-7374	130	7	nagano	nagano	PROPN
ahs-7374	130	8	y.	y.	PROPN
ahs-7374	130	9	,	,	PUNCT
ahs-7374	130	10	matsumoto	matsumoto	PROPN
ahs-7374	130	11	r.	r.	PROPN
ahs-7374	130	12	,	,	PUNCT
ahs-7374	130	13	yamamoto	yamamoto	PROPN
ahs-7374	130	14	m.	m.	NOUN
ahs-7374	130	15	,	,	PUNCT
ahs-7374	130	16	2010	2010	NUM
ahs-7374	130	17	phylogenetic	phylogenetic	ADJ
ahs-7374	130	18	relationships	relationship	NOUN
ahs-7374	130	19	of	of	ADP
ahs-7374	130	20	citrus	citrus	NOUN
ahs-7374	130	21	and	and	CCONJ
ahs-7374	130	22	its	its	PRON
ahs-7374	130	23	relatives	relative	NOUN
ahs-7374	130	24	based	base	VERB
ahs-7374	130	25	on	on	ADP
ahs-7374	130	26	rbcl	rbcl	NOUN
ahs-7374	130	27	gene	gene	NOUN
ahs-7374	130	28	sequences	sequence	NOUN
ahs-7374	130	29	.	.	PUNCT
ahs-7374	131	1	tree	tree	NOUN
ahs-7374	131	2	genet	genet	PROPN
ahs-7374	131	3	.	.	PUNCT
ahs-7374	132	1	genomes	genome	NOUN
ahs-7374	132	2	,	,	PUNCT
ahs-7374	132	3	6	6	NUM
ahs-7374	132	4	:	:	SYM
ahs-7374	132	5	931	931	NUM
ahs-7374	132	6	-	-	SYM
ahs-7374	132	7	939	939	NUM
ahs-7374	132	8	.	.	PUNCT
ahs-7374	133	1	penjor	penjor	PROPN
ahs-7374	133	2	t.	t.	PROPN
ahs-7374	133	3	,	,	PUNCT
ahs-7374	133	4	yamamoto	yamamoto	PROPN
ahs-7374	133	5	m.	m.	PROPN
ahs-7374	133	6	,	,	PUNCT
ahs-7374	133	7	uehara	uehara	PROPN
ahs-7374	133	8	m.	m.	PROPN
ahs-7374	133	9	,	,	PUNCT
ahs-7374	133	10	ide	ide	ADJ
ahs-7374	133	11	m.	m.	NOUN
ahs-7374	133	12	,	,	PUNCT
ahs-7374	133	13	matsumoto	matsumoto	PROPN
ahs-7374	133	14	n.	n.	PROPN
ahs-7374	133	15	,	,	PUNCT
ahs-7374	133	16	matsumoto	matsumoto	PROPN
ahs-7374	133	17	r.	r.	PROPN
ahs-7374	133	18	,	,	PUNCT
ahs-7374	133	19	nagano	nagano	PROPN
ahs-7374	133	20	y.	y.	PROPN
ahs-7374	133	21	,	,	PUNCT
ahs-7374	133	22	2013	2013	NUM
ahs-7374	133	23	phylogenetic	phylogenetic	ADJ
ahs-7374	133	24	relationships	relationship	NOUN
ahs-7374	133	25	of	of	ADP
ahs-7374	133	26	citrus	citrus	NOUN
ahs-7374	133	27	and	and	CCONJ
ahs-7374	133	28	its	its	PRON
ahs-7374	133	29	relatives	relative	NOUN
ahs-7374	133	30	based	base	VERB
ahs-7374	133	31	on	on	ADP
ahs-7374	133	32	matk	matk	PROPN
ahs-7374	133	33	gene	gene	NOUN
ahs-7374	133	34	sequences	sequence	NOUN
ahs-7374	133	35	.	.	PUNCT
ahs-7374	134	1	plos	plos	PROPN
ahs-7374	134	2	one	one	NUM
ahs-7374	134	3	,	,	PUNCT
ahs-7374	134	4	8(4	8(4	NUM
ahs-7374	134	5	)	)	PUNCT
ahs-7374	134	6	e62574	e62574	NOUN
ahs-7374	134	7	:	:	PUNCT
ahs-7374	134	8	1	1	NUM
ahs-7374	134	9	-	-	SYM
ahs-7374	134	10	13	13	NUM
ahs-7374	134	11	.	.	PUNCT
ahs-7374	135	1	rehman	rehman	PROPN
ahs-7374	135	2	s.	s.	PROPN
ahs-7374	135	3	,	,	PUNCT
ahs-7374	135	4	ahmad	ahmad	PROPN
ahs-7374	135	5	j.	j.	PROPN
ahs-7374	135	6	,	,	PUNCT
ahs-7374	135	7	lanzoni	lanzoni	PROPN
ahs-7374	135	8	c.	c.	PROPN
ahs-7374	135	9	,	,	PUNCT
ahs-7374	135	10	rubies	ruby	NOUN
ahs-7374	135	11	autonell	autonell	VERB
ahs-7374	135	12	c.	c.	PROPN
ahs-7374	135	13	,	,	PUNCT
ahs-7374	135	14	ratti	ratti	PROPN
ahs-7374	135	15	c.	c.	PROPN
ahs-7374	135	16	,	,	PUNCT
ahs-7374	135	17	2012	2012	NUM
ahs-7374	135	18	first	first	ADJ
ahs-7374	135	19	report	report	NOUN
ahs-7374	135	20	of	of	ADP
ahs-7374	135	21	citrus	citrus	PROPN
ahs-7374	135	22	tristeza	tristeza	PROPN
ahs-7374	135	23	virus	virus	NOUN
ahs-7374	135	24	in	in	ADP
ahs-7374	135	25	national	national	ADJ
ahs-7374	135	26	germplasm	germplasm	NOUN
ahs-7374	135	27	of	of	ADP
ahs-7374	135	28	citrus	citrus	NOUN
ahs-7374	135	29	in	in	ADP
ahs-7374	135	30	afghanistan	afghanistan	PROPN
ahs-7374	135	31	.	.	PUNCT
ahs-7374	136	1	‐	‐	ADJ
ahs-7374	136	2	plant	plant	NOUN
ahs-7374	136	3	disease	disease	NOUN
ahs-7374	136	4	,	,	PUNCT
ahs-7374	136	5	96(2	96(2	NUM
ahs-7374	136	6	):	):	PUNCT
ahs-7374	136	7	296	296	NUM
ahs-7374	136	8	.	.	PUNCT
ahs-7374	137	1	sun	sun	PROPN
ahs-7374	137	2	y.l	y.l	PROPN
ahs-7374	137	3	.	.	PROPN
ahs-7374	137	4	,	,	PUNCT
ahs-7374	137	5	kang	kang	PROPN
ahs-7374	137	6	h.m	h.m	PROPN
ahs-7374	137	7	.	.	PROPN
ahs-7374	137	8	,	,	PUNCT
ahs-7374	137	9	han	han	PROPN
ahs-7374	137	10	s.h	s.h	PROPN
ahs-7374	137	11	.	.	PROPN
ahs-7374	137	12	,	,	PUNCT
ahs-7374	137	13	park	park	PROPN
ahs-7374	137	14	y.c	y.c	PROPN
ahs-7374	137	15	.	.	PROPN
ahs-7374	137	16	,	,	PUNCT
ahs-7374	137	17	hong	hong	PROPN
ahs-7374	137	18	s.k	s.k	PROPN
ahs-7374	137	19	.	.	PROPN
ahs-7374	137	20	,	,	PUNCT
ahs-7374	137	21	2015	2015	NUM
ahs-7374	137	22	taxonomy	taxonomy	NOUN
ahs-7374	137	23	and	and	CCONJ
ahs-7374	137	24	phylogeny	phylogeny	NOUN
ahs-7374	137	25	of	of	ADP
ahs-7374	137	26	the	the	DET
ahs-7374	137	27	genus	genus	ADJ
ahs-7374	137	28	citrus	citrus	NOUN
ahs-7374	137	29	based	base	VERB
ahs-7374	137	30	on	on	ADP
ahs-7374	137	31	the	the	DET
ahs-7374	137	32	nuclear	nuclear	ADJ
ahs-7374	137	33	ribosomal	ribosomal	NOUN
ahs-7374	137	34	dna	dna	NOUN
ahs-7374	137	35	its	its	PRON
ahs-7374	137	36	region	region	NOUN
ahs-7374	137	37	sequence	sequence	NOUN
ahs-7374	137	38	.	.	PUNCT
ahs-7374	138	1	pak	pak	PROPN
ahs-7374	138	2	.	.	PUNCT
ahs-7374	139	1	j.	j.	PROPN
ahs-7374	139	2	bot	bot	PROPN
ahs-7374	139	3	.	.	PUNCT
ahs-7374	139	4	,	,	PUNCT
ahs-7374	139	5	47(1	47(1	NUM
ahs-7374	139	6	):	):	PUNCT
ahs-7374	139	7	95	95	NUM
ahs-7374	139	8	-	-	SYM
ahs-7374	139	9	101	101	NUM
ahs-7374	139	10	.	.	PUNCT
ahs-7374	140	1	taberlet	taberlet	PROPN
ahs-7374	140	2	p.	p.	PROPN
ahs-7374	140	3	,	,	PUNCT
ahs-7374	140	4	gielly	gielly	PROPN
ahs-7374	140	5	l.	l.	PROPN
ahs-7374	140	6	,	,	PUNCT
ahs-7374	140	7	pautou	pautou	PROPN
ahs-7374	140	8	g.	g.	PROPN
ahs-7374	140	9	,	,	PUNCT
ahs-7374	140	10	bouvet	bouvet	PROPN
ahs-7374	140	11	g.	g.	PROPN
ahs-7374	140	12	,	,	PUNCT
ahs-7374	140	13	1991	1991	NUM
ahs-7374	140	14	universal	universal	ADJ
ahs-7374	140	15	primers	primer	NOUN
ahs-7374	140	16	for	for	ADP
ahs-7374	140	17	amplification	amplification	NOUN
ahs-7374	140	18	of	of	ADP
ahs-7374	140	19	3	3	NUM
ahs-7374	140	20	noncoding	noncoding	ADJ
ahs-7374	140	21	regions	region	NOUN
ahs-7374	140	22	of	of	ADP
ahs-7374	140	23	chloroplast	chloroplast	ADJ
ahs-7374	140	24	dna	dna	NOUN
ahs-7374	140	25	.	.	PUNCT
ahs-7374	141	1	plant	plant	PROPN
ahs-7374	141	2	mol	mol	PROPN
ahs-7374	141	3	.	.	PUNCT
ahs-7374	142	1	biol	biol	PROPN
ahs-7374	142	2	.	.	PUNCT
ahs-7374	142	3	,	,	PUNCT
ahs-7374	142	4	17(5	17(5	NUM
ahs-7374	142	5	):	):	PUNCT
ahs-7374	142	6	1105	1105	NUM
ahs-7374	142	7	-	-	SYM
ahs-7374	142	8	1109	1109	NUM
ahs-7374	142	9	.	.	PUNCT
ahs-7374	143	1	tamura	tamura	PROPN
ahs-7374	143	2	k.	k.	PROPN
ahs-7374	143	3	,	,	PUNCT
ahs-7374	143	4	stecher	stecher	PROPN
ahs-7374	143	5	g.	g.	PROPN
ahs-7374	143	6	,	,	PUNCT
ahs-7374	143	7	peterson	peterson	PROPN
ahs-7374	143	8	d.	d.	PROPN
ahs-7374	143	9	,	,	PUNCT
ahs-7374	143	10	filipski	filipski	PROPN
ahs-7374	143	11	a.	a.	PROPN
ahs-7374	143	12	,	,	PUNCT
ahs-7374	143	13	kumar	kumar	PROPN
ahs-7374	143	14	s.	s.	PROPN
ahs-7374	143	15	,	,	PUNCT
ahs-7374	143	16	2013	2013	NUM
ahs-7374	143	17	mega6	mega6	NOUN
ahs-7374	143	18	:	:	PUNCT
ahs-7374	143	19	molecular	molecular	ADJ
ahs-7374	143	20	evolutionary	evolutionary	ADJ
ahs-7374	143	21	genetics	genetic	NOUN
ahs-7374	143	22	analysis	analysis	NOUN
ahs-7374	143	23	version	version	NOUN
ahs-7374	143	24	6.0	6.0	NUM
ahs-7374	143	25	.	.	PUNCT
ahs-7374	143	26	mol	mol	ADP
ahs-7374	143	27	biol	biol	PROPN
ahs-7374	143	28	evol	evol	NOUN
ahs-7374	143	29	.	.	PUNCT
ahs-7374	143	30	,	,	PUNCT
ahs-7374	143	31	30(12	30(12	NUM
ahs-7374	143	32	):	):	PUNCT
ahs-7374	143	33	2725	2725	NUM
ahs-7374	143	34	-	-	SYM
ahs-7374	143	35	2729	2729	NUM
ahs-7374	143	36	.	.	PUNCT
ahs-7374	144	1	uchoi	uchoi	PROPN
ahs-7374	144	2	a.	a.	PROPN
ahs-7374	144	3	,	,	PUNCT
ahs-7374	144	4	malik	malik	PROPN
ahs-7374	144	5	s.k	s.k	PROPN
ahs-7374	144	6	.	.	PROPN
ahs-7374	144	7	,	,	PUNCT
ahs-7374	144	8	choudhary	choudhary	PROPN
ahs-7374	144	9	r.	r.	PROPN
ahs-7374	144	10	,	,	PUNCT
ahs-7374	144	11	kumar	kumar	PROPN
ahs-7374	144	12	s.	s.	PROPN
ahs-7374	144	13	,	,	PUNCT
ahs-7374	144	14	rohini	rohini	PROPN
ahs-7374	144	15	m.r	m.r	PROPN
ahs-7374	144	16	.	.	PROPN
ahs-7374	144	17	,	,	PUNCT
ahs-7374	144	18	pal	pal	PROPN
ahs-7374	144	19	d.	d.	PROPN
ahs-7374	144	20	,	,	PUNCT
ahs-7374	144	21	ercisli	ercisli	PROPN
ahs-7374	144	22	s.	s.	PROPN
ahs-7374	144	23	,	,	PUNCT
ahs-7374	144	24	chaudhury	chaudhury	PROPN
ahs-7374	144	25	r.	r.	PROPN
ahs-7374	144	26	,	,	PUNCT
ahs-7374	144	27	2016	2016	NUM
ahs-7374	144	28	inferring	infer	VERB
ahs-7374	144	29	phylogenetic	phylogenetic	ADJ
ahs-7374	144	30	relationships	relationship	NOUN
ahs-7374	144	31	of	of	ADP
ahs-7374	144	32	indian	indian	ADJ
ahs-7374	144	33	citron	citron	NOUN
ahs-7374	144	34	(	(	PUNCT
ahs-7374	144	35	citrus	citrus	PROPN
ahs-7374	144	36	medica	medica	PROPN
ahs-7374	144	37	l.	l.	PROPN
ahs-7374	144	38	)	)	PUNCT
ahs-7374	144	39	based	base	VERB
ahs-7374	144	40	on	on	ADP
ahs-7374	144	41	rbcl	rbcl	NOUN
ahs-7374	144	42	and	and	CCONJ
ahs-7374	144	43	matk	matk	NOUN
ahs-7374	144	44	sequences	sequence	NOUN
ahs-7374	144	45	of	of	ADP
ahs-7374	144	46	chloroplast	chloroplast	ADJ
ahs-7374	144	47	dna	dna	PROPN
ahs-7374	144	48	.	.	PUNCT
ahs-7374	145	1	biochem	biochem	PROPN
ahs-7374	145	2	.	.	PUNCT
ahs-7374	146	1	genet	genet	PROPN
ahs-7374	146	2	.	.	PUNCT
ahs-7374	146	3	,	,	PUNCT
ahs-7374	146	4	54	54	NUM
ahs-7374	146	5	:	:	PUNCT
ahs-7374	146	6	249	249	NUM
ahs-7374	146	7	-	-	SYM
ahs-7374	146	8	269	269	NUM
ahs-7374	146	9	.	.	PUNCT
ahs-7374	147	1	wattoo	wattoo	PROPN
ahs-7374	147	2	j.i	j.i	PROPN
ahs-7374	147	3	.	.	PROPN
ahs-7374	147	4	,	,	PUNCT
ahs-7374	147	5	saleem	saleem	PROPN
ahs-7374	147	6	m.z	m.z	PROPN
ahs-7374	147	7	.	.	PROPN
ahs-7374	147	8	,	,	PUNCT
ahs-7374	147	9	shahzad	shahzad	PROPN
ahs-7374	147	10	m.s	m.s	PROPN
ahs-7374	147	11	.	.	PROPN
ahs-7374	147	12	,	,	PUNCT
ahs-7374	147	13	arif	arif	PROPN
ahs-7374	147	14	a.	a.	PROPN
ahs-7374	147	15	,	,	PUNCT
ahs-7374	147	16	hameed	hameed	PROPN
ahs-7374	147	17	a.	a.	PROPN
ahs-7374	147	18	,	,	PUNCT
ahs-7374	147	19	saleem	saleem	PROPN
ahs-7374	147	20	m.a	m.a	PROPN
ahs-7374	147	21	.	.	PROPN
ahs-7374	147	22	,	,	PUNCT
ahs-7374	147	23	2016	2016	NUM
ahs-7374	147	24	dna	dna	NOUN
ahs-7374	147	25	barcoding	barcoding	NOUN
ahs-7374	147	26	:	:	PUNCT
ahs-7374	147	27	amplification	amplification	NOUN
ahs-7374	147	28	and	and	CCONJ
ahs-7374	147	29	sequence	sequence	NOUN
ahs-7374	147	30	analysis	analysis	NOUN
ahs-7374	147	31	of	of	ADP
ahs-7374	147	32	rbcl	rbcl	NOUN
ahs-7374	147	33	and	and	CCONJ
ahs-7374	147	34	matk	matk	NOUN
ahs-7374	147	35	genome	genome	NOUN
ahs-7374	147	36	regions	region	NOUN
ahs-7374	147	37	in	in	ADP
ahs-7374	147	38	three	three	NUM
ahs-7374	147	39	divergent	divergent	ADJ
ahs-7374	147	40	plant	plant	NOUN
ahs-7374	147	41	species	specie	NOUN
ahs-7374	147	42	.	.	PUNCT
ahs-7374	148	1	‐	‐	PROPN
ahs-7374	148	2	adv	adv	PROPN
ahs-7374	148	3	.	.	PUNCT
ahs-7374	148	4	life	life	PROPN
ahs-7374	148	5	sci	sci	PROPN
ahs-7374	148	6	.	.	PROPN
ahs-7374	148	7	,	,	PUNCT
ahs-7374	148	8	4(1	4(1	NOUN
ahs-7374	148	9	):	):	PUNCT
ahs-7374	148	10	3	3	NUM
ahs-7374	148	11	-	-	SYM
ahs-7374	148	12	7	7	NUM
ahs-7374	148	13	.	.	PUNCT
ahs-7374	148	14	zhang	zhang	PROPN
ahs-7374	148	15	z.	z.	PROPN
ahs-7374	148	16	,	,	PUNCT
ahs-7374	148	17	schwartz	schwartz	PROPN
ahs-7374	148	18	s.	s.	PROPN
ahs-7374	148	19	,	,	PUNCT
ahs-7374	148	20	wagner	wagner	PROPN
ahs-7374	148	21	l.	l.	PROPN
ahs-7374	148	22	,	,	PUNCT
ahs-7374	148	23	miller	miller	PROPN
ahs-7374	148	24	w.	w.	PROPN
ahs-7374	148	25	,	,	PUNCT
ahs-7374	148	26	2000	2000	NUM
ahs-7374	148	27	a	a	DET
ahs-7374	148	28	greedy	greedy	ADJ
ahs-7374	148	29	algorithm	algorithm	NOUN
ahs-7374	148	30	for	for	ADP
ahs-7374	148	31	aligning	align	VERB
ahs-7374	148	32	dna	dna	PROPN
ahs-7374	148	33	sequences	sequence	NOUN
ahs-7374	148	34	.	.	PUNCT
ahs-7374	149	1	j.	j.	PROPN
ahs-7374	149	2	comput	comput	PROPN
ahs-7374	149	3	.	.	PUNCT
ahs-7374	150	1	biol	biol	PROPN
ahs-7374	150	2	.	.	PUNCT
ahs-7374	150	3	,	,	PUNCT
ahs-7374	150	4	7(1	7(1	NUM
ahs-7374	150	5	-	-	SYM
ahs-7374	150	6	2	2	NUM
ahs-7374	150	7	):	):	PUNCT
ahs-7374	150	8	203	203	NUM
ahs-7374	150	9	-	-	SYM
ahs-7374	150	10	214	214	NUM
ahs-7374	150	11	.	.	PUNCT
ahs-7374	151	1	zhao	zhao	PROPN
ahs-7374	151	2	l.l	l.l	PROPN
ahs-7374	151	3	.	.	PROPN
ahs-7374	151	4	,	,	PUNCT
ahs-7374	151	5	feng	feng	PROPN
ahs-7374	151	6	s.j	s.j	PROPN
ahs-7374	151	7	.	.	PROPN
ahs-7374	151	8	,	,	PUNCT
ahs-7374	151	9	tian	tian	PROPN
ahs-7374	151	10	j.y	j.y	PROPN
ahs-7374	151	11	.	.	PROPN
ahs-7374	151	12	,	,	PUNCT
ahs-7374	151	13	wei	wei	PROPN
ahs-7374	151	14	a.z	a.z	PROPN
ahs-7374	151	15	.	.	PROPN
ahs-7374	151	16	,	,	PUNCT
ahs-7374	151	17	yang	yang	PROPN
ahs-7374	151	18	t.x	t.x	PROPN
ahs-7374	151	19	.	.	PROPN
ahs-7374	151	20	,	,	PUNCT
ahs-7374	151	21	2018	2018	NUM
ahs-7374	151	22	internal	internal	ADJ
ahs-7374	151	23	transcribed	transcribe	VERB
ahs-7374	151	24	spacer	spacer	NOUN
ahs-7374	151	25	2	2	NUM
ahs-7374	151	26	(	(	PUNCT
ahs-7374	151	27	its2	its2	PROPN
ahs-7374	151	28	)	)	PUNCT
ahs-7374	151	29	barcodes	barcode	VERB
ahs-7374	151	30	:	:	PUNCT
ahs-7374	151	31	a	a	DET
ahs-7374	151	32	useful	useful	ADJ
ahs-7374	151	33	tool	tool	NOUN
ahs-7374	151	34	for	for	ADP
ahs-7374	151	35	identifying	identify	VERB
ahs-7374	151	36	chinese	chinese	ADJ
ahs-7374	151	37	zanthoxylum	zanthoxylum	PROPN
ahs-7374	151	38	.	.	PUNCT
ahs-7374	152	1	appl	appl	PROPN
ahs-7374	152	2	.	.	PUNCT
ahs-7374	152	3	plant	plant	PROPN
ahs-7374	152	4	sci	sci	PROPN
ahs-7374	152	5	.	.	PROPN
ahs-7374	152	6	,	,	PUNCT
ahs-7374	152	7	6(6	6(6	NUM
ahs-7374	152	8	)	)	PUNCT
ahs-7374	153	1	e1157	e1157	NOUN
ahs-7374	153	2	:	:	PUNCT
ahs-7374	153	3	1	1	NUM
ahs-7374	153	4	-	-	SYM
ahs-7374	153	5	8	8	NUM
ahs-7374	153	6	.	.	PUNCT