id	sid	tid	token	lemma	pos
ahs-8094	1	1	impaginato	impaginato	VERB
ahs-8094	1	2	397	397	NUM
ahs-8094	1	3	evaluation	evaluation	NOUN
ahs-8094	1	4	of	of	ADP
ahs-8094	1	5	hot	hot	ADJ
ahs-8094	1	6	pepper	pepper	NOUN
ahs-8094	1	7	(	(	PUNCT
ahs-8094	1	8	capsicum	capsicum	NOUN
ahs-8094	1	9	spp	spp	NOUN
ahs-8094	1	10	.	.	PUNCT
ahs-8094	1	11	)	)	PUNCT
ahs-8094	1	12	genotypes	genotype	NOUN
ahs-8094	1	13	for	for	ADP
ahs-8094	1	14	resistance	resistance	NOUN
ahs-8094	1	15	to	to	ADP
ahs-8094	1	16	viruses	virus	NOUN
ahs-8094	1	17	and	and	CCONJ
ahs-8094	1	18	aphids	aphid	NOUN
ahs-8094	1	19	in	in	ADP
ahs-8094	1	20	rwanda	rwanda	PROPN
ahs-8094	1	21	b.w	b.w	PROPN
ahs-8094	1	22	.	.	PROPN
ahs-8094	1	23	waweru	waweru	PROPN
ahs-8094	1	24	1	1	NUM
ahs-8094	1	25	,	,	PUNCT
ahs-8094	1	26	2	2	NUM
ahs-8094	1	27	(	(	PUNCT
ahs-8094	1	28	*	*	NOUN
ahs-8094	1	29	)	)	PUNCT
ahs-8094	1	30	,	,	PUNCT
ahs-8094	1	31	d.c	d.c	PROPN
ahs-8094	1	32	.	.	PROPN
ahs-8094	1	33	kilalo	kilalo	PROPN
ahs-8094	1	34	1	1	NUM
ahs-8094	1	35	,	,	PUNCT
ahs-8094	1	36	j.w	j.w	PROPN
ahs-8094	1	37	.	.	PROPN
ahs-8094	1	38	kimenju	kimenju	PROPN
ahs-8094	1	39	1	1	NUM
ahs-8094	1	40	,	,	PUNCT
ahs-8094	1	41	p.	p.	NOUN
ahs-8094	1	42	rukundo	rukundo	NOUN
ahs-8094	1	43	2	2	NUM
ahs-8094	1	44	,	,	PUNCT
ahs-8094	1	45	d.w	d.w	PROPN
ahs-8094	1	46	.	.	PROPN
ahs-8094	1	47	miano	miano	PROPN
ahs-8094	1	48	1	1	NUM
ahs-8094	1	49	1	1	NUM
ahs-8094	1	50	department	department	NOUN
ahs-8094	1	51	of	of	ADP
ahs-8094	1	52	plant	plant	NOUN
ahs-8094	1	53	science	science	NOUN
ahs-8094	1	54	and	and	CCONJ
ahs-8094	1	55	crop	crop	NOUN
ahs-8094	1	56	protection	protection	NOUN
ahs-8094	1	57	,	,	PUNCT
ahs-8094	1	58	college	college	NOUN
ahs-8094	1	59	of	of	ADP
ahs-8094	1	60	agriculture	agriculture	NOUN
ahs-8094	1	61	and	and	CCONJ
ahs-8094	1	62	veterinary	veterinary	ADJ
ahs-8094	1	63	sciences	science	NOUN
ahs-8094	1	64	,	,	PUNCT
ahs-8094	1	65	university	university	PROPN
ahs-8094	1	66	of	of	ADP
ahs-8094	1	67	nairobi	nairobi	PROPN
ahs-8094	1	68	,	,	PUNCT
ahs-8094	1	69	p.o	p.o	PROPN
ahs-8094	1	70	.	.	PROPN
ahs-8094	1	71	box	box	PROPN
ahs-8094	1	72	29053‐0625	29053‐0625	NUM
ahs-8094	1	73	kangemi	kangemi	NOUN
ahs-8094	1	74	,	,	PUNCT
ahs-8094	1	75	nairobi	nairobi	PROPN
ahs-8094	1	76	,	,	PUNCT
ahs-8094	1	77	kenya	kenya	PROPN
ahs-8094	1	78	.	.	PUNCT
ahs-8094	2	1	2	2	NUM
ahs-8094	2	2	rwanda	rwanda	PROPN
ahs-8094	2	3	agriculture	agriculture	NOUN
ahs-8094	2	4	and	and	CCONJ
ahs-8094	2	5	animal	animal	NOUN
ahs-8094	2	6	resources	resource	NOUN
ahs-8094	2	7	development	development	PROPN
ahs-8094	2	8	board	board	PROPN
ahs-8094	2	9	,	,	PUNCT
ahs-8094	2	10	p.o	p.o	PROPN
ahs-8094	2	11	.	.	PROPN
ahs-8094	2	12	box	box	PROPN
ahs-8094	2	13	5016	5016	NUM
ahs-8094	2	14	,	,	PUNCT
ahs-8094	2	15	kigali	kigali	PROPN
ahs-8094	2	16	,	,	PUNCT
ahs-8094	2	17	rwanda	rwanda	PROPN
ahs-8094	2	18	.	.	PUNCT
ahs-8094	3	1	key	key	ADJ
ahs-8094	3	2	words	word	NOUN
ahs-8094	3	3	:	:	PUNCT
ahs-8094	3	4	aphids	aphid	NOUN
ahs-8094	3	5	,	,	PUNCT
ahs-8094	3	6	capsicum	capsicum	NOUN
ahs-8094	3	7	spp	spp	NOUN
ahs-8094	3	8	.	.	PROPN
ahs-8094	3	9	,	,	PUNCT
ahs-8094	3	10	field	field	NOUN
ahs-8094	3	11	,	,	PUNCT
ahs-8094	3	12	genotypes	genotype	NOUN
ahs-8094	3	13	,	,	PUNCT
ahs-8094	3	14	resistance	resistance	NOUN
ahs-8094	3	15	,	,	PUNCT
ahs-8094	3	16	screenhouse	screenhouse	NOUN
ahs-8094	3	17	,	,	PUNCT
ahs-8094	3	18	virus	virus	NOUN
ahs-8094	3	19	.	.	PUNCT
ahs-8094	4	1	abstract	abstract	ADJ
ahs-8094	4	2	:	:	PUNCT
ahs-8094	4	3	hot	hot	ADJ
ahs-8094	4	4	pepper	pepper	NOUN
ahs-8094	4	5	is	be	AUX
ahs-8094	4	6	an	an	DET
ahs-8094	4	7	important	important	ADJ
ahs-8094	4	8	crop	crop	NOUN
ahs-8094	4	9	in	in	ADP
ahs-8094	4	10	rwanda	rwanda	PROPN
ahs-8094	4	11	but	but	CCONJ
ahs-8094	4	12	viral	viral	ADJ
ahs-8094	4	13	diseases	disease	NOUN
ahs-8094	4	14	and	and	CCONJ
ahs-8094	4	15	pests	pest	NOUN
ahs-8094	4	16	are	be	AUX
ahs-8094	4	17	major	major	ADJ
ahs-8094	4	18	constraints	constraint	NOUN
ahs-8094	4	19	to	to	ADP
ahs-8094	4	20	its	its	PRON
ahs-8094	4	21	production	production	NOUN
ahs-8094	4	22	.	.	PUNCT
ahs-8094	5	1	field	field	NOUN
ahs-8094	5	2	experiments	experiment	NOUN
ahs-8094	5	3	were	be	AUX
ahs-8094	5	4	conduct­	conduct­	NOUN
ahs-8094	5	5	ed	ed	NOUN
ahs-8094	5	6	to	to	PART
ahs-8094	5	7	evaluate	evaluate	VERB
ahs-8094	5	8	the	the	DET
ahs-8094	5	9	resistance	resistance	NOUN
ahs-8094	5	10	of	of	ADP
ahs-8094	5	11	18	18	NUM
ahs-8094	5	12	hot	hot	ADJ
ahs-8094	5	13	pepper	pepper	NOUN
ahs-8094	5	14	genotypes	genotype	NOUN
ahs-8094	5	15	(	(	PUNCT
ahs-8094	5	16	4	4	NUM
ahs-8094	5	17	commercials	commercial	NOUN
ahs-8094	5	18	,	,	PUNCT
ahs-8094	5	19	5	5	NUM
ahs-8094	5	20	introduced	introduce	VERB
ahs-8094	5	21	and	and	CCONJ
ahs-8094	5	22	9	9	NUM
ahs-8094	5	23	local	local	ADJ
ahs-8094	5	24	)	)	PUNCT
ahs-8094	5	25	to	to	ADP
ahs-8094	5	26	natural	natural	ADJ
ahs-8094	5	27	infection	infection	NOUN
ahs-8094	5	28	by	by	ADP
ahs-8094	5	29	viruses	virus	NOUN
ahs-8094	5	30	and	and	CCONJ
ahs-8094	5	31	aphid	aphid	NOUN
ahs-8094	5	32	infestation	infestation	NOUN
ahs-8094	5	33	,	,	PUNCT
ahs-8094	5	34	in	in	ADP
ahs-8094	5	35	two	two	NUM
ahs-8094	5	36	agro­ecological	agro­ecological	ADJ
ahs-8094	5	37	zones	zone	NOUN
ahs-8094	5	38	of	of	ADP
ahs-8094	5	39	rwanda	rwanda	PROPN
ahs-8094	5	40	.	.	PUNCT
ahs-8094	6	1	fourteen	fourteen	NUM
ahs-8094	6	2	genotypes	genotype	NOUN
ahs-8094	6	3	were	be	AUX
ahs-8094	6	4	further	far	ADV
ahs-8094	6	5	evalu­	evalu­	PROPN
ahs-8094	6	6	ated	ate	VERB
ahs-8094	6	7	for	for	ADP
ahs-8094	6	8	resistance	resistance	NOUN
ahs-8094	6	9	to	to	ADP
ahs-8094	6	10	cucumber	cucumber	PROPN
ahs-8094	6	11	mosaic	mosaic	PROPN
ahs-8094	6	12	virus	virus	NOUN
ahs-8094	6	13	(	(	PUNCT
ahs-8094	6	14	cmv	cmv	NOUN
ahs-8094	6	15	)	)	PUNCT
ahs-8094	6	16	under	under	ADP
ahs-8094	6	17	screenhouse	screenhouse	PROPN
ahs-8094	6	18	condi­	condi­	PROPN
ahs-8094	6	19	tions	tion	NOUN
ahs-8094	6	20	.	.	PUNCT
ahs-8094	7	1	disease	disease	NOUN
ahs-8094	7	2	incidence	incidence	NOUN
ahs-8094	7	3	and	and	CCONJ
ahs-8094	7	4	severity	severity	NOUN
ahs-8094	7	5	were	be	AUX
ahs-8094	7	6	recorded	record	VERB
ahs-8094	7	7	in	in	ADP
ahs-8094	7	8	all	all	DET
ahs-8094	7	9	experiments	experiment	NOUN
ahs-8094	7	10	while	while	SCONJ
ahs-8094	7	11	population	population	NOUN
ahs-8094	7	12	of	of	ADP
ahs-8094	7	13	aphids	aphid	NOUN
ahs-8094	7	14	was	be	AUX
ahs-8094	7	15	assessed	assess	VERB
ahs-8094	7	16	in	in	ADP
ahs-8094	7	17	the	the	DET
ahs-8094	7	18	field	field	NOUN
ahs-8094	7	19	.	.	PUNCT
ahs-8094	8	1	diseased	disease	VERB
ahs-8094	8	2	leaf	leaf	NOUN
ahs-8094	8	3	samples	sample	NOUN
ahs-8094	8	4	from	from	ADP
ahs-8094	8	5	each	each	DET
ahs-8094	8	6	genotype	genotype	NOUN
ahs-8094	8	7	in	in	ADP
ahs-8094	8	8	the	the	DET
ahs-8094	8	9	field	field	NOUN
ahs-8094	8	10	were	be	AUX
ahs-8094	8	11	analysed	analyse	VERB
ahs-8094	8	12	using	use	VERB
ahs-8094	8	13	polymerase	polymerase	NOUN
ahs-8094	8	14	chain	chain	NOUN
ahs-8094	8	15	reaction	reaction	NOUN
ahs-8094	8	16	to	to	PART
ahs-8094	8	17	detect	detect	VERB
ahs-8094	8	18	the	the	DET
ahs-8094	8	19	presence	presence	NOUN
ahs-8094	8	20	of	of	ADP
ahs-8094	8	21	viruses	virus	NOUN
ahs-8094	8	22	,	,	PUNCT
ahs-8094	8	23	while	while	SCONJ
ahs-8094	8	24	samples	sample	NOUN
ahs-8094	8	25	from	from	ADP
ahs-8094	8	26	the	the	DET
ahs-8094	8	27	screenhouse	screenhouse	NOUN
ahs-8094	8	28	were	be	AUX
ahs-8094	8	29	analysed	analyse	VERB
ahs-8094	8	30	using	use	VERB
ahs-8094	8	31	serological	serological	ADJ
ahs-8094	8	32	assay	assay	NOUN
ahs-8094	8	33	.	.	PUNCT
ahs-8094	9	1	results	result	NOUN
ahs-8094	9	2	showed	show	VERB
ahs-8094	9	3	significant	significant	ADJ
ahs-8094	9	4	(	(	PUNCT
ahs-8094	9	5	p<0.05	p<0.05	NOUN
ahs-8094	9	6	)	)	PUNCT
ahs-8094	9	7	differences	difference	NOUN
ahs-8094	9	8	in	in	ADP
ahs-8094	9	9	dis­	dis­	ADJ
ahs-8094	9	10	ease	ease	NOUN
ahs-8094	9	11	incidence	incidence	NOUN
ahs-8094	9	12	and	and	CCONJ
ahs-8094	9	13	severity	severity	NOUN
ahs-8094	9	14	among	among	ADP
ahs-8094	9	15	genotypes	genotype	NOUN
ahs-8094	9	16	.	.	PUNCT
ahs-8094	10	1	three	three	NUM
ahs-8094	10	2	genotypes	genotype	NOUN
ahs-8094	10	3	namely	namely	ADV
ahs-8094	10	4	pbc	pbc	PROPN
ahs-8094	10	5	462	462	NUM
ahs-8094	10	6	,	,	PUNCT
ahs-8094	10	7	00767ppr	00767ppr	NOUN
ahs-8094	10	8	and	and	CCONJ
ahs-8094	10	9	0802ppr	0802ppr	NOUN
ahs-8094	10	10	were	be	AUX
ahs-8094	10	11	rated	rate	VERB
ahs-8094	10	12	as	as	ADV
ahs-8094	10	13	resistant	resistant	ADJ
ahs-8094	10	14	to	to	ADP
ahs-8094	10	15	viral	viral	ADJ
ahs-8094	10	16	diseases	disease	NOUN
ahs-8094	10	17	while	while	SCONJ
ahs-8094	10	18	genotype	genotype	NOUN
ahs-8094	10	19	hp	hp	PROPN
ahs-8094	10	20	0117	0117	NUM
ahs-8094	10	21	,	,	PUNCT
ahs-8094	10	22	pp9852­170	pp9852­170	PROPN
ahs-8094	10	23	and	and	CCONJ
ahs-8094	10	24	pp9950­5197	pp9950­5197	NOUN
ahs-8094	10	25	were	be	AUX
ahs-8094	10	26	moderately	moderately	ADV
ahs-8094	10	27	resistant	resistant	ADJ
ahs-8094	10	28	.	.	PUNCT
ahs-8094	11	1	all	all	DET
ahs-8094	11	2	commercial	commercial	ADJ
ahs-8094	11	3	and	and	CCONJ
ahs-8094	11	4	most	most	ADJ
ahs-8094	11	5	of	of	ADP
ahs-8094	11	6	the	the	DET
ahs-8094	11	7	local	local	ADJ
ahs-8094	11	8	genotypes	genotype	NOUN
ahs-8094	11	9	were	be	AUX
ahs-8094	11	10	susceptible	susceptible	ADJ
ahs-8094	11	11	compared	compare	VERB
ahs-8094	11	12	to	to	ADP
ahs-8094	11	13	the	the	DET
ahs-8094	11	14	introduced	introduce	VERB
ahs-8094	11	15	lines	line	NOUN
ahs-8094	11	16	.	.	PUNCT
ahs-8094	12	1	there	there	PRON
ahs-8094	12	2	was	be	VERB
ahs-8094	12	3	no	no	DET
ahs-8094	12	4	difference	difference	NOUN
ahs-8094	12	5	in	in	ADP
ahs-8094	12	6	genotype	genotype	NOUN
ahs-8094	12	7	infestation	infestation	NOUN
ahs-8094	12	8	by	by	ADP
ahs-8094	12	9	the	the	DET
ahs-8094	12	10	aphids	aphid	NOUN
ahs-8094	12	11	.	.	PUNCT
ahs-8094	13	1	the	the	DET
ahs-8094	13	2	genotypes	genotype	NOUN
ahs-8094	13	3	that	that	PRON
ahs-8094	13	4	are	be	AUX
ahs-8094	13	5	resistant	resistant	ADJ
ahs-8094	13	6	to	to	ADP
ahs-8094	13	7	viruses	virus	NOUN
ahs-8094	13	8	are	be	AUX
ahs-8094	13	9	recommended	recommend	VERB
ahs-8094	13	10	for	for	ADP
ahs-8094	13	11	use	use	NOUN
ahs-8094	13	12	by	by	ADP
ahs-8094	13	13	growers	grower	NOUN
ahs-8094	13	14	and	and	CCONJ
ahs-8094	13	15	in	in	ADP
ahs-8094	13	16	breeding	breeding	NOUN
ahs-8094	13	17	programs	program	NOUN
ahs-8094	13	18	.	.	PUNCT
ahs-8094	14	1	1	1	X
ahs-8094	14	2	.	.	X
ahs-8094	14	3	introduction	introduction	NOUN
ahs-8094	14	4	hot	hot	ADJ
ahs-8094	14	5	pepper	pepper	NOUN
ahs-8094	14	6	(	(	PUNCT
ahs-8094	14	7	capsicum	capsicum	NOUN
ahs-8094	14	8	spp	spp	NOUN
ahs-8094	14	9	.	.	PUNCT
ahs-8094	14	10	)	)	PUNCT
ahs-8094	14	11	is	be	AUX
ahs-8094	14	12	an	an	DET
ahs-8094	14	13	important	important	ADJ
ahs-8094	14	14	vegetable	vegetable	NOUN
ahs-8094	14	15	crop	crop	NOUN
ahs-8094	14	16	grown	grow	VERB
ahs-8094	14	17	throughout	throughout	ADP
ahs-8094	14	18	the	the	DET
ahs-8094	14	19	world	world	NOUN
ahs-8094	14	20	.	.	PUNCT
ahs-8094	15	1	in	in	ADP
ahs-8094	15	2	rwanda	rwanda	PROPN
ahs-8094	15	3	,	,	PUNCT
ahs-8094	15	4	it	it	PRON
ahs-8094	15	5	is	be	AUX
ahs-8094	15	6	produced	produce	VERB
ahs-8094	15	7	for	for	ADP
ahs-8094	15	8	both	both	PRON
ahs-8094	15	9	local	local	ADJ
ahs-8094	15	10	consump­	consump­	PROPN
ahs-8094	15	11	tion	tion	NOUN
ahs-8094	15	12	and	and	CCONJ
ahs-8094	15	13	export	export	NOUN
ahs-8094	15	14	to	to	ADP
ahs-8094	15	15	the	the	DET
ahs-8094	15	16	european	european	ADJ
ahs-8094	15	17	market	market	NOUN
ahs-8094	15	18	(	(	PUNCT
ahs-8094	15	19	naeb	naeb	NOUN
ahs-8094	15	20	,	,	PUNCT
ahs-8094	15	21	2015	2015	NUM
ahs-8094	15	22	)	)	PUNCT
ahs-8094	15	23	.	.	PUNCT
ahs-8094	16	1	the	the	DET
ahs-8094	16	2	crop	crop	NOUN
ahs-8094	16	3	plays	play	VERB
ahs-8094	16	4	an	an	DET
ahs-8094	16	5	important	important	ADJ
ahs-8094	16	6	role	role	NOUN
ahs-8094	16	7	in	in	ADP
ahs-8094	16	8	poverty	poverty	NOUN
ahs-8094	16	9	alleviation	alleviation	NOUN
ahs-8094	16	10	through	through	ADP
ahs-8094	16	11	income	income	NOUN
ahs-8094	16	12	generation	generation	NOUN
ahs-8094	16	13	and	and	CCONJ
ahs-8094	16	14	cre­	cre­	PROPN
ahs-8094	16	15	ation	ation	PROPN
ahs-8094	16	16	of	of	ADP
ahs-8094	16	17	employment	employment	NOUN
ahs-8094	16	18	to	to	ADP
ahs-8094	16	19	both	both	DET
ahs-8094	16	20	farmers	farmer	NOUN
ahs-8094	16	21	and	and	CCONJ
ahs-8094	16	22	the	the	DET
ahs-8094	16	23	hot	hot	ADJ
ahs-8094	16	24	pepper	pepper	NOUN
ahs-8094	16	25	value	value	NOUN
ahs-8094	16	26	chain	chain	NOUN
ahs-8094	16	27	actors	actor	NOUN
ahs-8094	16	28	.	.	PUNCT
ahs-8094	17	1	hot	hot	ADJ
ahs-8094	17	2	pepper	pepper	NOUN
ahs-8094	17	3	production	production	NOUN
ahs-8094	17	4	has	have	AUX
ahs-8094	17	5	increased	increase	VERB
ahs-8094	17	6	in	in	ADP
ahs-8094	17	7	recent	recent	ADJ
ahs-8094	17	8	years	year	NOUN
ahs-8094	17	9	in	in	ADP
ahs-8094	17	10	rwanda	rwanda	PROPN
ahs-8094	17	11	but	but	CCONJ
ahs-8094	17	12	,	,	PUNCT
ahs-8094	17	13	the	the	DET
ahs-8094	17	14	average	average	ADJ
ahs-8094	17	15	yield	yield	NOUN
ahs-8094	17	16	is	be	AUX
ahs-8094	17	17	still	still	ADV
ahs-8094	17	18	low	low	ADJ
ahs-8094	17	19	at	at	ADP
ahs-8094	17	20	around	around	ADP
ahs-8094	17	21	6.8	6.8	NUM
ahs-8094	17	22	t	t	NOUN
ahs-8094	17	23	ha­1	ha­1	NOUN
ahs-8094	17	24	which	which	PRON
ahs-8094	17	25	is	be	AUX
ahs-8094	17	26	lower	low	ADJ
ahs-8094	17	27	than	than	ADP
ahs-8094	17	28	(	(	PUNCT
ahs-8094	17	29	*	*	NOUN
ahs-8094	17	30	)	)	PUNCT
ahs-8094	17	31	corresponding	corresponding	ADJ
ahs-8094	17	32	author	author	NOUN
ahs-8094	17	33	:	:	PUNCT
ahs-8094	18	1	bancywaweru@yahoo.com	bancywaweru@yahoo.com	X
ahs-8094	18	2	citation	citation	NOUN
ahs-8094	18	3	:	:	PUNCT
ahs-8094	18	4	waweru	waweru	PROPN
ahs-8094	18	5	b.w	b.w	PROPN
ahs-8094	18	6	.	.	PROPN
ahs-8094	18	7	,	,	PUNCT
ahs-8094	18	8	kilalo	kilalo	PROPN
ahs-8094	18	9	d.c	d.c	PROPN
ahs-8094	18	10	.	.	PROPN
ahs-8094	18	11	,	,	PUNCT
ahs-8094	18	12	kimenju	kimenju	PROPN
ahs-8094	19	1	j.w	j.w	PROPN
ahs-8094	19	2	.	.	PROPN
ahs-8094	19	3	,	,	PUNCT
ahs-8094	19	4	rukundo	rukundo	PROPN
ahs-8094	19	5	p.	p.	PROPN
ahs-8094	19	6	,	,	PUNCT
ahs-8094	19	7	miano	miano	PROPN
ahs-8094	19	8	d.w	d.w	PROPN
ahs-8094	19	9	.	.	PROPN
ahs-8094	19	10	,	,	PUNCT
ahs-8094	19	11	2020	2020	NUM
ahs-8094	19	12	­	­	VERB
ahs-8094	19	13	evaluation	evaluation	NOUN
ahs-8094	19	14	of	of	ADP
ahs-8094	19	15	hot	hot	ADJ
ahs-8094	19	16	pepper	pepper	NOUN
ahs-8094	19	17	(	(	PUNCT
ahs-8094	19	18	capsicum	capsicum	NOUN
ahs-8094	19	19	spp	spp	NOUN
ahs-8094	19	20	.	.	PUNCT
ahs-8094	19	21	)	)	PUNCT
ahs-8094	20	1	genotypes	genotype	NOUN
ahs-8094	20	2	for	for	ADP
ahs-8094	20	3	resi‐	resi‐	ADJ
ahs-8094	20	4	stance	stance	NOUN
ahs-8094	20	5	to	to	ADP
ahs-8094	20	6	viruses	virus	NOUN
ahs-8094	20	7	and	and	CCONJ
ahs-8094	20	8	aphids	aphid	NOUN
ahs-8094	20	9	in	in	ADP
ahs-8094	20	10	rwanda	rwanda	PROPN
ahs-8094	20	11	.	.	PUNCT
ahs-8094	21	1	­	­	PROPN
ahs-8094	21	2	adv	adv	PROPN
ahs-8094	21	3	.	.	PUNCT
ahs-8094	22	1	hort	hort	PROPN
ahs-8094	22	2	.	.	PUNCT
ahs-8094	23	1	sci	sci	PROPN
ahs-8094	23	2	.	.	PROPN
ahs-8094	23	3	,	,	PUNCT
ahs-8094	23	4	34(4	34(4	NUM
ahs-8094	23	5	):	):	PUNCT
ahs-8094	23	6	397­412	397­412	NUM
ahs-8094	23	7	copyright	copyright	NOUN
ahs-8094	23	8	:	:	PUNCT
ahs-8094	23	9	©	©	PROPN
ahs-8094	23	10	2020	2020	NUM
ahs-8094	23	11	waweru	waweru	PROPN
ahs-8094	23	12	b.w	b.w	PROPN
ahs-8094	23	13	.	.	PROPN
ahs-8094	23	14	,	,	PUNCT
ahs-8094	23	15	kilalo	kilalo	PROPN
ahs-8094	23	16	d.c	d.c	PROPN
ahs-8094	23	17	.	.	PROPN
ahs-8094	23	18	,	,	PUNCT
ahs-8094	23	19	kimenju	kimenju	PROPN
ahs-8094	24	1	j.w	j.w	PROPN
ahs-8094	24	2	.	.	PROPN
ahs-8094	24	3	,	,	PUNCT
ahs-8094	24	4	rukundo	rukundo	PROPN
ahs-8094	24	5	p.	p.	PROPN
ahs-8094	24	6	,	,	PUNCT
ahs-8094	24	7	miano	miano	PROPN
ahs-8094	24	8	d.w	d.w	PROPN
ahs-8094	24	9	.	.	PUNCT
ahs-8094	25	1	this	this	PRON
ahs-8094	25	2	is	be	AUX
ahs-8094	25	3	an	an	DET
ahs-8094	25	4	open	open	ADJ
ahs-8094	25	5	access	access	NOUN
ahs-8094	25	6	,	,	PUNCT
ahs-8094	25	7	peer	peer	NOUN
ahs-8094	25	8	reviewed	review	VERB
ahs-8094	25	9	article	article	NOUN
ahs-8094	25	10	published	publish	VERB
ahs-8094	25	11	by	by	ADP
ahs-8094	25	12	firenze	firenze	PROPN
ahs-8094	25	13	university	university	PROPN
ahs-8094	25	14	press	press	NOUN
ahs-8094	25	15	(	(	PUNCT
ahs-8094	25	16	http://www.fupress.net/index.php/ahs/	http://www.fupress.net/index.php/ahs/	PROPN
ahs-8094	25	17	)	)	PUNCT
ahs-8094	25	18	and	and	CCONJ
ahs-8094	25	19	distributed	distribute	VERB
ahs-8094	25	20	under	under	ADP
ahs-8094	25	21	the	the	DET
ahs-8094	25	22	terms	term	NOUN
ahs-8094	25	23	of	of	ADP
ahs-8094	25	24	the	the	DET
ahs-8094	25	25	creative	creative	ADJ
ahs-8094	25	26	commons	common	NOUN
ahs-8094	25	27	attribution	attribution	NOUN
ahs-8094	25	28	license	license	NOUN
ahs-8094	25	29	,	,	PUNCT
ahs-8094	25	30	which	which	PRON
ahs-8094	25	31	permits	permit	VERB
ahs-8094	25	32	unrestricted	unrestricted	ADJ
ahs-8094	25	33	use	use	NOUN
ahs-8094	25	34	,	,	PUNCT
ahs-8094	25	35	distribution	distribution	NOUN
ahs-8094	25	36	,	,	PUNCT
ahs-8094	25	37	and	and	CCONJ
ahs-8094	25	38	reproduction	reproduction	NOUN
ahs-8094	25	39	in	in	ADP
ahs-8094	25	40	any	any	DET
ahs-8094	25	41	medium	medium	NOUN
ahs-8094	25	42	,	,	PUNCT
ahs-8094	25	43	provided	provide	VERB
ahs-8094	25	44	the	the	DET
ahs-8094	25	45	original	original	ADJ
ahs-8094	25	46	author	author	NOUN
ahs-8094	25	47	and	and	CCONJ
ahs-8094	25	48	source	source	NOUN
ahs-8094	25	49	are	be	AUX
ahs-8094	25	50	credited	credit	VERB
ahs-8094	25	51	.	.	PUNCT
ahs-8094	26	1	data	datum	NOUN
ahs-8094	26	2	availability	availability	NOUN
ahs-8094	26	3	statement	statement	NOUN
ahs-8094	26	4	:	:	PUNCT
ahs-8094	26	5	all	all	DET
ahs-8094	26	6	relevant	relevant	ADJ
ahs-8094	26	7	data	datum	NOUN
ahs-8094	26	8	are	be	AUX
ahs-8094	26	9	within	within	ADP
ahs-8094	26	10	the	the	DET
ahs-8094	26	11	paper	paper	NOUN
ahs-8094	26	12	and	and	CCONJ
ahs-8094	26	13	its	its	PRON
ahs-8094	26	14	supporting	support	VERB
ahs-8094	26	15	information	information	NOUN
ahs-8094	26	16	files	file	NOUN
ahs-8094	26	17	.	.	PUNCT
ahs-8094	27	1	competing	compete	VERB
ahs-8094	27	2	interests	interest	NOUN
ahs-8094	27	3	:	:	PUNCT
ahs-8094	27	4	the	the	DET
ahs-8094	27	5	authors	author	NOUN
ahs-8094	27	6	declare	declare	VERB
ahs-8094	27	7	no	no	DET
ahs-8094	27	8	competing	compete	VERB
ahs-8094	27	9	interests	interest	NOUN
ahs-8094	27	10	.	.	PUNCT
ahs-8094	28	1	received	receive	VERB
ahs-8094	28	2	for	for	ADP
ahs-8094	28	3	publication	publication	NOUN
ahs-8094	28	4	15	15	NUM
ahs-8094	28	5	february	february	PROPN
ahs-8094	28	6	2020	2020	NUM
ahs-8094	28	7	accepted	accept	VERB
ahs-8094	28	8	for	for	ADP
ahs-8094	28	9	publication	publication	NOUN
ahs-8094	28	10	19	19	NUM
ahs-8094	28	11	june	june	PROPN
ahs-8094	28	12	2020	2020	NUM
ahs-8094	28	13	ahs	ahs	PROPN
ahs-8094	28	14	advances	advance	NOUN
ahs-8094	28	15	in	in	ADP
ahs-8094	28	16	horticultural	horticultural	ADJ
ahs-8094	28	17	science	science	PROPN
ahs-8094	28	18	adv	adv	PROPN
ahs-8094	28	19	.	.	PUNCT
ahs-8094	28	20	hort	hort	PROPN
ahs-8094	28	21	.	.	PUNCT
ahs-8094	29	1	sci	sci	PROPN
ahs-8094	29	2	.	.	PROPN
ahs-8094	29	3	,	,	PUNCT
ahs-8094	29	4	2020	2020	NUM
ahs-8094	29	5	34(4	34(4	NUM
ahs-8094	29	6	):	):	PUNCT
ahs-8094	29	7	397­412	397­412	NUM
ahs-8094	29	8	doi	doi	NOUN
ahs-8094	29	9	:	:	PUNCT
ahs-8094	29	10	10.13128	10.13128	NUM
ahs-8094	29	11	/	/	SYM
ahs-8094	29	12	ahsc­8094	ahsc­8094	NOUN
ahs-8094	29	13	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-8094	29	14	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-8094	29	15	http://creativecommons.org/licenses/by/4.0/	http://creativecommons.org/licenses/by/4.0/	PROPN
ahs-8094	29	16	adv	adv	PROPN
ahs-8094	29	17	.	.	PUNCT
ahs-8094	29	18	hort	hort	PROPN
ahs-8094	29	19	.	.	PUNCT
ahs-8094	30	1	sci	sci	PROPN
ahs-8094	30	2	.	.	PROPN
ahs-8094	30	3	,	,	PUNCT
ahs-8094	30	4	2020	2020	NUM
ahs-8094	30	5	34(4	34(4	NUM
ahs-8094	30	6	):	):	PUNCT
ahs-8094	30	7	397­412	397­412	NUM
ahs-8094	30	8	398	398	NUM
ahs-8094	30	9	50	50	NUM
ahs-8094	30	10	%	%	NOUN
ahs-8094	30	11	of	of	ADP
ahs-8094	30	12	the	the	DET
ahs-8094	30	13	country	country	NOUN
ahs-8094	30	14	’s	’s	PART
ahs-8094	30	15	potential	potential	ADJ
ahs-8094	30	16	yield	yield	NOUN
ahs-8094	30	17	of	of	ADP
ahs-8094	30	18	15	15	NUM
ahs-8094	30	19	t	t	NOUN
ahs-8094	30	20	ha­1	ha­1	NOUN
ahs-8094	30	21	(	(	PUNCT
ahs-8094	30	22	rdb	rdb	PROPN
ahs-8094	30	23	,	,	PUNCT
ahs-8094	30	24	2010	2010	NUM
ahs-8094	30	25	;	;	PUNCT
ahs-8094	30	26	fao	fao	PROPN
ahs-8094	30	27	,	,	PUNCT
ahs-8094	30	28	2017	2017	NUM
ahs-8094	30	29	)	)	PUNCT
ahs-8094	30	30	.	.	PUNCT
ahs-8094	31	1	the	the	DET
ahs-8094	31	2	low	low	ADJ
ahs-8094	31	3	and	and	CCONJ
ahs-8094	31	4	poor	poor	ADJ
ahs-8094	31	5	quality	quality	NOUN
ahs-8094	31	6	produce	produce	NOUN
ahs-8094	31	7	have	have	AUX
ahs-8094	31	8	been	be	AUX
ahs-8094	31	9	attributed	attribute	VERB
ahs-8094	31	10	to	to	ADP
ahs-8094	31	11	abiotic	abiotic	ADJ
ahs-8094	31	12	and	and	CCONJ
ahs-8094	31	13	biotic	biotic	ADJ
ahs-8094	31	14	factors	factor	NOUN
ahs-8094	31	15	,	,	PUNCT
ahs-8094	31	16	of	of	ADP
ahs-8094	31	17	which	which	PRON
ahs-8094	31	18	diseases	disease	NOUN
ahs-8094	31	19	caused	cause	VERB
ahs-8094	31	20	by	by	ADP
ahs-8094	31	21	viruses	virus	NOUN
ahs-8094	31	22	play	play	VERB
ahs-8094	31	23	a	a	DET
ahs-8094	31	24	significant	significant	ADJ
ahs-8094	31	25	role	role	NOUN
ahs-8094	31	26	(	(	PUNCT
ahs-8094	31	27	skelton	skelton	PROPN
ahs-8094	31	28	et	et	PROPN
ahs-8094	31	29	al	al	PROPN
ahs-8094	31	30	.	.	PROPN
ahs-8094	31	31	,	,	PUNCT
ahs-8094	31	32	2018	2018	NUM
ahs-8094	31	33	)	)	PUNCT
ahs-8094	31	34	.	.	PUNCT
ahs-8094	32	1	pepper	pepper	NOUN
ahs-8094	32	2	is	be	AUX
ahs-8094	32	3	attacked	attack	VERB
ahs-8094	32	4	by	by	ADP
ahs-8094	32	5	more	more	ADJ
ahs-8094	32	6	than	than	ADP
ahs-8094	32	7	68	68	NUM
ahs-8094	32	8	viruses	virus	NOUN
ahs-8094	32	9	global­	global­	NOUN
ahs-8094	32	10	ly	ly	NOUN
ahs-8094	32	11	,	,	PUNCT
ahs-8094	32	12	of	of	ADP
ahs-8094	32	13	which	which	PRON
ahs-8094	32	14	about	about	ADP
ahs-8094	32	15	15	15	NUM
ahs-8094	32	16	have	have	AUX
ahs-8094	32	17	been	be	AUX
ahs-8094	32	18	identified	identify	VERB
ahs-8094	32	19	in	in	ADP
ahs-8094	32	20	africa	africa	PROPN
ahs-8094	32	21	(	(	PUNCT
ahs-8094	32	22	njukeng	njukeng	PROPN
ahs-8094	32	23	et	et	PROPN
ahs-8094	32	24	al	al	PROPN
ahs-8094	32	25	.	.	PROPN
ahs-8094	32	26	,	,	PUNCT
ahs-8094	32	27	2013	2013	NUM
ahs-8094	32	28	;	;	PUNCT
ahs-8094	32	29	aliyu	aliyu	NOUN
ahs-8094	32	30	,	,	PUNCT
ahs-8094	32	31	2014	2014	NUM
ahs-8094	32	32	;	;	PUNCT
ahs-8094	32	33	kenyon	kenyon	PROPN
ahs-8094	32	34	et	et	PROPN
ahs-8094	32	35	al	al	PROPN
ahs-8094	32	36	.	.	PROPN
ahs-8094	32	37	,	,	PUNCT
ahs-8094	32	38	2014	2014	NUM
ahs-8094	32	39	)	)	PUNCT
ahs-8094	32	40	.	.	PUNCT
ahs-8094	33	1	cucumber	cucumber	PROPN
ahs-8094	33	2	mosaic	mosaic	PROPN
ahs-8094	33	3	virus	virus	NOUN
ahs-8094	33	4	(	(	PUNCT
ahs-8094	33	5	cmv	cmv	PROPN
ahs-8094	33	6	)	)	PUNCT
ahs-8094	33	7	,	,	PUNCT
ahs-8094	33	8	pepper	pepper	NOUN
ahs-8094	33	9	veinal	veinal	ADJ
ahs-8094	33	10	mottle	mottle	NOUN
ahs-8094	33	11	virus	virus	NOUN
ahs-8094	33	12	(	(	PUNCT
ahs-8094	33	13	pvmv	pvmv	PROPN
ahs-8094	33	14	)	)	PUNCT
ahs-8094	33	15	,	,	PUNCT
ahs-8094	33	16	tobacco	tobacco	NOUN
ahs-8094	33	17	mosaic	mosaic	ADJ
ahs-8094	33	18	virus	virus	NOUN
ahs-8094	33	19	(	(	PUNCT
ahs-8094	33	20	tmv	tmv	NOUN
ahs-8094	33	21	)	)	PUNCT
ahs-8094	33	22	and	and	CCONJ
ahs-8094	33	23	potato	potato	NOUN
ahs-8094	33	24	virus	virus	NOUN
ahs-8094	33	25	y	y	PROPN
ahs-8094	33	26	(	(	PUNCT
ahs-8094	33	27	pvy	pvy	PROPN
ahs-8094	33	28	)	)	PUNCT
ahs-8094	33	29	have	have	AUX
ahs-8094	33	30	been	be	AUX
ahs-8094	33	31	reported	report	VERB
ahs-8094	33	32	as	as	ADP
ahs-8094	33	33	the	the	DET
ahs-8094	33	34	most	most	ADV
ahs-8094	33	35	prevalent	prevalent	ADJ
ahs-8094	33	36	in	in	ADP
ahs-8094	33	37	sub­saharan	sub­saharan	PROPN
ahs-8094	33	38	africa	africa	PROPN
ahs-8094	33	39	(	(	PUNCT
ahs-8094	33	40	dafalla	dafalla	PROPN
ahs-8094	33	41	,	,	PUNCT
ahs-8094	33	42	2001	2001	NUM
ahs-8094	33	43	)	)	PUNCT
ahs-8094	33	44	.	.	PUNCT
ahs-8094	34	1	in	in	ADP
ahs-8094	34	2	rwanda	rwanda	PROPN
ahs-8094	34	3	,	,	PUNCT
ahs-8094	34	4	pepper	pepper	NOUN
ahs-8094	34	5	vein	vein	ADJ
ahs-8094	34	6	yellows	yellow	NOUN
ahs-8094	34	7	virus	virus	NOUN
ahs-8094	34	8	(	(	PUNCT
ahs-8094	34	9	pevyv	pevyv	NOUN
ahs-8094	34	10	)	)	PUNCT
ahs-8094	34	11	,	,	PUNCT
ahs-8094	34	12	pvmv	pvmv	NOUN
ahs-8094	34	13	and	and	CCONJ
ahs-8094	34	14	cmv	cmv	NOUN
ahs-8094	34	15	have	have	AUX
ahs-8094	34	16	been	be	AUX
ahs-8094	34	17	detected	detect	VERB
ahs-8094	34	18	in	in	ADP
ahs-8094	34	19	hot	hot	ADJ
ahs-8094	34	20	pepper	pepper	NOUN
ahs-8094	34	21	(	(	PUNCT
ahs-8094	34	22	skelton	skelton	PROPN
ahs-8094	34	23	et	et	PROPN
ahs-8094	34	24	al	al	PROPN
ahs-8094	34	25	.	.	PROPN
ahs-8094	34	26	,	,	PUNCT
ahs-8094	34	27	2018	2018	NUM
ahs-8094	34	28	)	)	PUNCT
ahs-8094	34	29	.	.	PUNCT
ahs-8094	35	1	the	the	DET
ahs-8094	35	2	cmv	cmv	NOUN
ahs-8094	35	3	is	be	AUX
ahs-8094	35	4	ranked	rank	VERB
ahs-8094	35	5	among	among	ADP
ahs-8094	35	6	the	the	DET
ahs-8094	35	7	most	most	ADV
ahs-8094	35	8	eco­	eco­	ADJ
ahs-8094	35	9	nomically	nomically	ADV
ahs-8094	35	10	important	important	ADJ
ahs-8094	35	11	viruses	virus	NOUN
ahs-8094	35	12	of	of	ADP
ahs-8094	35	13	hot	hot	ADJ
ahs-8094	35	14	pepper	pepper	NOUN
ahs-8094	35	15	not	not	PART
ahs-8094	35	16	only	only	ADV
ahs-8094	35	17	in	in	ADP
ahs-8094	35	18	rwanda	rwanda	PROPN
ahs-8094	35	19	but	but	CCONJ
ahs-8094	35	20	also	also	ADV
ahs-8094	35	21	in	in	ADP
ahs-8094	35	22	some	some	DET
ahs-8094	35	23	other	other	ADJ
ahs-8094	35	24	countries	country	NOUN
ahs-8094	35	25	such	such	ADJ
ahs-8094	35	26	as	as	ADP
ahs-8094	35	27	india	india	PROPN
ahs-8094	35	28	where	where	SCONJ
ahs-8094	35	29	yield	yield	VERB
ahs-8094	35	30	losses	loss	NOUN
ahs-8094	35	31	ranging	range	VERB
ahs-8094	35	32	from	from	ADP
ahs-8094	35	33	10	10	NUM
ahs-8094	35	34	to	to	PART
ahs-8094	35	35	50	50	NUM
ahs-8094	35	36	%	%	NOUN
ahs-8094	35	37	are	be	AUX
ahs-8094	35	38	documented	document	VERB
ahs-8094	35	39	(	(	PUNCT
ahs-8094	35	40	rahman	rahman	PROPN
ahs-8094	35	41	et	et	PROPN
ahs-8094	35	42	al	al	PROPN
ahs-8094	35	43	.	.	PROPN
ahs-8094	35	44	,	,	PUNCT
ahs-8094	35	45	2016	2016	NUM
ahs-8094	35	46	)	)	PUNCT
ahs-8094	35	47	.	.	PUNCT
ahs-8094	36	1	on	on	ADP
ahs-8094	36	2	the	the	DET
ahs-8094	36	3	other	other	ADJ
ahs-8094	36	4	hand	hand	NOUN
ahs-8094	36	5	,	,	PUNCT
ahs-8094	36	6	the	the	DET
ahs-8094	36	7	crop	crop	NOUN
ahs-8094	36	8	is	be	AUX
ahs-8094	36	9	attacked	attack	VERB
ahs-8094	36	10	by	by	ADP
ahs-8094	36	11	more	more	ADJ
ahs-8094	36	12	than	than	ADP
ahs-8094	36	13	21	21	NUM
ahs-8094	36	14	insects	insect	NOUN
ahs-8094	36	15	which	which	PRON
ahs-8094	36	16	include	include	VERB
ahs-8094	36	17	aphids	aphid	NOUN
ahs-8094	36	18	,	,	PUNCT
ahs-8094	36	19	whiteflies	whitefly	NOUN
ahs-8094	36	20	,	,	PUNCT
ahs-8094	36	21	thrips	thrip	NOUN
ahs-8094	36	22	among	among	ADP
ahs-8094	36	23	others	other	NOUN
ahs-8094	36	24	(	(	PUNCT
ahs-8094	36	25	niranjanadevi	niranjanadevi	PROPN
ahs-8094	36	26	et	et	PROPN
ahs-8094	36	27	al	al	PROPN
ahs-8094	36	28	.	.	PROPN
ahs-8094	36	29	,	,	PUNCT
ahs-8094	36	30	2018	2018	NUM
ahs-8094	36	31	)	)	PUNCT
ahs-8094	36	32	.	.	PUNCT
ahs-8094	37	1	aphids	aphids	PROPN
ahs-8094	37	2	,	,	PUNCT
ahs-8094	37	3	whiteflies	whitefly	NOUN
ahs-8094	37	4	,	,	PUNCT
ahs-8094	37	5	and	and	CCONJ
ahs-8094	37	6	thrips	thrip	NOUN
ahs-8094	37	7	are	be	AUX
ahs-8094	37	8	vectors	vector	NOUN
ahs-8094	37	9	of	of	ADP
ahs-8094	37	10	various	various	ADJ
ahs-8094	37	11	viruses	virus	NOUN
ahs-8094	37	12	infecting	infect	VERB
ahs-8094	37	13	hot	hot	ADJ
ahs-8094	37	14	pepper	pepper	NOUN
ahs-8094	37	15	.	.	PUNCT
ahs-8094	38	1	these	these	DET
ahs-8094	38	2	insect	insect	NOUN
ahs-8094	38	3	pests	pest	NOUN
ahs-8094	38	4	especially	especially	ADV
ahs-8094	38	5	the	the	DET
ahs-8094	38	6	aphids	aphid	NOUN
ahs-8094	38	7	,	,	PUNCT
ahs-8094	38	8	are	be	AUX
ahs-8094	38	9	serious	serious	ADJ
ahs-8094	38	10	threat	threat	NOUN
ahs-8094	38	11	to	to	ADP
ahs-8094	38	12	hot	hot	ADJ
ahs-8094	38	13	pepper	pepper	NOUN
ahs-8094	38	14	production	production	NOUN
ahs-8094	38	15	not	not	PART
ahs-8094	38	16	only	only	ADV
ahs-8094	38	17	due	due	ADJ
ahs-8094	38	18	to	to	ADP
ahs-8094	38	19	losses	loss	NOUN
ahs-8094	38	20	caused	cause	VERB
ahs-8094	38	21	through	through	ADP
ahs-8094	38	22	direct	direct	ADJ
ahs-8094	38	23	damage	damage	NOUN
ahs-8094	38	24	but	but	CCONJ
ahs-8094	38	25	also	also	ADV
ahs-8094	38	26	they	they	PRON
ahs-8094	38	27	are	be	AUX
ahs-8094	38	28	vectors	vector	NOUN
ahs-8094	38	29	of	of	ADP
ahs-8094	38	30	devastating	devastate	VERB
ahs-8094	38	31	viruses	virus	NOUN
ahs-8094	38	32	(	(	PUNCT
ahs-8094	38	33	kenyon	kenyon	PROPN
ahs-8094	38	34	et	et	PROPN
ahs-8094	38	35	al	al	PROPN
ahs-8094	38	36	.	.	PROPN
ahs-8094	38	37	,	,	PUNCT
ahs-8094	38	38	2014	2014	NUM
ahs-8094	38	39	)	)	PUNCT
ahs-8094	38	40	.	.	PUNCT
ahs-8094	39	1	various	various	ADJ
ahs-8094	39	2	management	management	NOUN
ahs-8094	39	3	options	option	NOUN
ahs-8094	39	4	have	have	AUX
ahs-8094	39	5	been	be	AUX
ahs-8094	39	6	pro­	pro­	NOUN
ahs-8094	39	7	posed	pose	VERB
ahs-8094	39	8	to	to	PART
ahs-8094	39	9	reduce	reduce	VERB
ahs-8094	39	10	virus	virus	NOUN
ahs-8094	39	11	diseases	disease	NOUN
ahs-8094	39	12	of	of	ADP
ahs-8094	39	13	hot	hot	ADJ
ahs-8094	39	14	pepper	pepper	NOUN
ahs-8094	39	15	in	in	ADP
ahs-8094	39	16	the	the	DET
ahs-8094	39	17	field	field	NOUN
ahs-8094	39	18	.	.	PUNCT
ahs-8094	40	1	these	these	DET
ahs-8094	40	2	measures	measure	NOUN
ahs-8094	40	3	include	include	VERB
ahs-8094	40	4	the	the	DET
ahs-8094	40	5	use	use	NOUN
ahs-8094	40	6	of	of	ADP
ahs-8094	40	7	virus­free	virus­free	ADJ
ahs-8094	40	8	planting	planting	NOUN
ahs-8094	40	9	materials	material	NOUN
ahs-8094	40	10	,	,	PUNCT
ahs-8094	40	11	resistant	resistant	ADJ
ahs-8094	40	12	varieties	variety	NOUN
ahs-8094	40	13	,	,	PUNCT
ahs-8094	40	14	borders	border	NOUN
ahs-8094	40	15	crops	crop	NOUN
ahs-8094	40	16	,	,	PUNCT
ahs-8094	40	17	pesticides	pesticide	NOUN
ahs-8094	40	18	and	and	CCONJ
ahs-8094	40	19	roguing	rogue	VERB
ahs-8094	40	20	(	(	PUNCT
ahs-8094	40	21	wang	wang	PROPN
ahs-8094	40	22	et	et	PROPN
ahs-8094	40	23	al	al	PROPN
ahs-8094	40	24	.	.	PROPN
ahs-8094	40	25	,	,	PUNCT
ahs-8094	40	26	2006	2006	NUM
ahs-8094	40	27	;	;	PUNCT
ahs-8094	40	28	degri	degri	NOUN
ahs-8094	40	29	and	and	CCONJ
ahs-8094	40	30	ayuba	ayuba	PROPN
ahs-8094	40	31	,	,	PUNCT
ahs-8094	40	32	2016	2016	NUM
ahs-8094	40	33	)	)	PUNCT
ahs-8094	40	34	.	.	PUNCT
ahs-8094	41	1	farmers	farmer	NOUN
ahs-8094	41	2	in	in	ADP
ahs-8094	41	3	rwanda	rwanda	PROPN
ahs-8094	41	4	mainly	mainly	ADV
ahs-8094	41	5	rely	rely	VERB
ahs-8094	41	6	on	on	ADP
ahs-8094	41	7	insecticides	insecticide	NOUN
ahs-8094	41	8	to	to	PART
ahs-8094	41	9	control	control	VERB
ahs-8094	41	10	insect­vectors	insect­vector	NOUN
ahs-8094	41	11	.	.	PUNCT
ahs-8094	42	1	unfortunately	unfortunately	ADV
ahs-8094	42	2	,	,	PUNCT
ahs-8094	42	3	the	the	DET
ahs-8094	42	4	insecticides	insecticide	NOUN
ahs-8094	42	5	do	do	AUX
ahs-8094	42	6	not	not	PART
ahs-8094	42	7	achieve	achieve	VERB
ahs-8094	42	8	100	100	NUM
ahs-8094	42	9	%	%	NOUN
ahs-8094	42	10	control	control	NOUN
ahs-8094	42	11	of	of	ADP
ahs-8094	42	12	the	the	DET
ahs-8094	42	13	vectors	vector	NOUN
ahs-8094	42	14	.	.	PUNCT
ahs-8094	43	1	hence	hence	ADV
ahs-8094	43	2	,	,	PUNCT
ahs-8094	43	3	the	the	DET
ahs-8094	43	4	insect­vectors	insect­vector	NOUN
ahs-8094	43	5	develop	develop	VERB
ahs-8094	43	6	resistance	resistance	NOUN
ahs-8094	43	7	against	against	ADP
ahs-8094	43	8	the	the	DET
ahs-8094	43	9	active	active	ADJ
ahs-8094	43	10	ingredient	ingredient	NOUN
ahs-8094	43	11	after	after	ADP
ahs-8094	43	12	repeated	repeat	VERB
ahs-8094	43	13	applica­	applica­	PROPN
ahs-8094	43	14	tion	tion	NOUN
ahs-8094	43	15	of	of	ADP
ahs-8094	43	16	the	the	DET
ahs-8094	43	17	insecticides	insecticide	NOUN
ahs-8094	43	18	within	within	ADP
ahs-8094	43	19	a	a	DET
ahs-8094	43	20	short	short	ADJ
ahs-8094	43	21	time	time	NOUN
ahs-8094	43	22	and	and	CCONJ
ahs-8094	43	23	more	more	ADJ
ahs-8094	43	24	so	so	SCONJ
ahs-8094	43	25	the	the	DET
ahs-8094	43	26	insecticides	insecticide	NOUN
ahs-8094	43	27	negatively	negatively	ADV
ahs-8094	43	28	affect	affect	VERB
ahs-8094	43	29	the	the	DET
ahs-8094	43	30	environment	environment	NOUN
ahs-8094	43	31	(	(	PUNCT
ahs-8094	43	32	kenyon	kenyon	PROPN
ahs-8094	43	33	et	et	PROPN
ahs-8094	43	34	al	al	PROPN
ahs-8094	43	35	.	.	PROPN
ahs-8094	43	36	,	,	PUNCT
ahs-8094	43	37	2014	2014	NUM
ahs-8094	43	38	)	)	PUNCT
ahs-8094	43	39	.	.	PUNCT
ahs-8094	44	1	the	the	DET
ahs-8094	44	2	use	use	NOUN
ahs-8094	44	3	of	of	ADP
ahs-8094	44	4	resistant	resistant	ADJ
ahs-8094	44	5	cultivars	cultivar	NOUN
ahs-8094	44	6	offers	offer	VERB
ahs-8094	44	7	the	the	DET
ahs-8094	44	8	most	most	ADV
ahs-8094	44	9	economical	economical	ADJ
ahs-8094	44	10	,	,	PUNCT
ahs-8094	44	11	effective	effective	ADJ
ahs-8094	44	12	and	and	CCONJ
ahs-8094	44	13	durable	durable	ADJ
ahs-8094	44	14	solution	solution	NOUN
ahs-8094	44	15	in	in	ADP
ahs-8094	44	16	mitigating	mitigate	VERB
ahs-8094	44	17	the	the	DET
ahs-8094	44	18	negative	negative	ADJ
ahs-8094	44	19	effects	effect	NOUN
ahs-8094	44	20	due	due	ADJ
ahs-8094	44	21	to	to	ADP
ahs-8094	44	22	dis­	dis­	ADJ
ahs-8094	44	23	eases	ease	VERB
ahs-8094	44	24	and	and	CCONJ
ahs-8094	44	25	aphids	aphid	NOUN
ahs-8094	44	26	in	in	ADP
ahs-8094	44	27	hot	hot	ADJ
ahs-8094	44	28	pepper	pepper	NOUN
ahs-8094	44	29	production	production	NOUN
ahs-8094	44	30	(	(	PUNCT
ahs-8094	44	31	visalakshi	visalakshi	NOUN
ahs-8094	44	32	and	and	CCONJ
ahs-8094	44	33	pandiyan	pandiyan	NOUN
ahs-8094	44	34	,	,	PUNCT
ahs-8094	44	35	2018	2018	NUM
ahs-8094	44	36	)	)	PUNCT
ahs-8094	44	37	.	.	PUNCT
ahs-8094	45	1	resistant	resistant	ADJ
ahs-8094	45	2	varieties	variety	NOUN
ahs-8094	45	3	are	be	AUX
ahs-8094	45	4	highly	highly	ADV
ahs-8094	45	5	preferred	preferred	ADJ
ahs-8094	45	6	because	because	SCONJ
ahs-8094	45	7	they	they	PRON
ahs-8094	45	8	not	not	PART
ahs-8094	45	9	only	only	ADV
ahs-8094	45	10	reduce	reduce	VERB
ahs-8094	45	11	the	the	DET
ahs-8094	45	12	pest	p	ADJ
ahs-8094	45	13	population	population	NOUN
ahs-8094	45	14	and	and	CCONJ
ahs-8094	45	15	the	the	DET
ahs-8094	45	16	virus	virus	NOUN
ahs-8094	45	17	inoculum	inoculum	NOUN
ahs-8094	45	18	in	in	ADP
ahs-8094	45	19	the	the	DET
ahs-8094	45	20	farming	farming	NOUN
ahs-8094	45	21	system	system	NOUN
ahs-8094	45	22	but	but	CCONJ
ahs-8094	45	23	they	they	PRON
ahs-8094	45	24	are	be	AUX
ahs-8094	45	25	also	also	ADV
ahs-8094	45	26	compliant	compliant	ADJ
ahs-8094	45	27	with	with	ADP
ahs-8094	45	28	other	other	ADJ
ahs-8094	45	29	methods	method	NOUN
ahs-8094	45	30	(	(	PUNCT
ahs-8094	45	31	frantz	frantz	PROPN
ahs-8094	45	32	et	et	PROPN
ahs-8094	45	33	al	al	PROPN
ahs-8094	45	34	.	.	PROPN
ahs-8094	45	35	,	,	PUNCT
ahs-8094	45	36	2004	2004	NUM
ahs-8094	45	37	)	)	PUNCT
ahs-8094	45	38	.	.	PUNCT
ahs-8094	46	1	several	several	ADJ
ahs-8094	46	2	studies	study	NOUN
ahs-8094	46	3	have	have	AUX
ahs-8094	46	4	evaluated	evaluate	VERB
ahs-8094	46	5	the	the	DET
ahs-8094	46	6	resistance	resistance	NOUN
ahs-8094	46	7	of	of	ADP
ahs-8094	46	8	wild	wild	ADJ
ahs-8094	46	9	and	and	CCONJ
ahs-8094	46	10	cultivated	cultivate	VERB
ahs-8094	46	11	hot	hot	ADJ
ahs-8094	46	12	pepper	pepper	NOUN
ahs-8094	46	13	genotypes	genotype	NOUN
ahs-8094	46	14	to	to	PART
ahs-8094	46	15	virus	virus	VERB
ahs-8094	46	16	infection	infection	NOUN
ahs-8094	46	17	and	and	CCONJ
ahs-8094	46	18	aphids	aphids	PROPN
ahs-8094	46	19	’	'	PUNCT
ahs-8094	46	20	infestation	infestation	NOUN
ahs-8094	46	21	leading	lead	VERB
ahs-8094	46	22	to	to	ADP
ahs-8094	46	23	the	the	DET
ahs-8094	46	24	release	release	NOUN
ahs-8094	46	25	of	of	ADP
ahs-8094	46	26	virus­resistant	virus­resistant	ADJ
ahs-8094	46	27	lines	line	NOUN
ahs-8094	46	28	in	in	ADP
ahs-8094	46	29	different	different	ADJ
ahs-8094	46	30	parts	part	NOUN
ahs-8094	46	31	of	of	ADP
ahs-8094	46	32	the	the	DET
ahs-8094	46	33	world	world	NOUN
ahs-8094	46	34	(	(	PUNCT
ahs-8094	46	35	frantz	frantz	PROPN
ahs-8094	46	36	et	et	PROPN
ahs-8094	46	37	al	al	PROPN
ahs-8094	46	38	.	.	PROPN
ahs-8094	46	39	,	,	PUNCT
ahs-8094	46	40	2004	2004	NUM
ahs-8094	46	41	;	;	PUNCT
ahs-8094	46	42	appiah	appiah	PROPN
ahs-8094	46	43	et	et	PROPN
ahs-8094	46	44	al	al	PROPN
ahs-8094	46	45	.	.	PROPN
ahs-8094	46	46	,	,	PUNCT
ahs-8094	46	47	2014	2014	NUM
ahs-8094	46	48	;	;	PUNCT
ahs-8094	46	49	choi	choi	NOUN
ahs-8094	46	50	et	et	PROPN
ahs-8094	46	51	al	al	PROPN
ahs-8094	46	52	.	.	PROPN
ahs-8094	46	53	,	,	PUNCT
ahs-8094	46	54	2018	2018	NUM
ahs-8094	46	55	)	)	PUNCT
ahs-8094	46	56	.	.	PUNCT
ahs-8094	47	1	however	however	ADV
ahs-8094	47	2	,	,	PUNCT
ahs-8094	47	3	information	information	NOUN
ahs-8094	47	4	on	on	ADP
ahs-8094	47	5	hot	hot	ADJ
ahs-8094	47	6	pepper	pepper	NOUN
ahs-8094	47	7	genotypes	genotype	NOUN
ahs-8094	47	8	that	that	PRON
ahs-8094	47	9	are	be	AUX
ahs-8094	47	10	resistant	resistant	ADJ
ahs-8094	47	11	to	to	ADP
ahs-8094	47	12	virus	virus	NOUN
ahs-8094	47	13	infection	infection	NOUN
ahs-8094	47	14	and	and	CCONJ
ahs-8094	47	15	vector	vector	NOUN
ahs-8094	47	16	infestation	infestation	NOUN
ahs-8094	47	17	is	be	AUX
ahs-8094	47	18	not	not	PART
ahs-8094	47	19	documented	document	VERB
ahs-8094	47	20	in	in	ADP
ahs-8094	47	21	rwanda	rwanda	PROPN
ahs-8094	47	22	.	.	PUNCT
ahs-8094	48	1	the	the	DET
ahs-8094	48	2	current	current	ADJ
ahs-8094	48	3	study	study	NOUN
ahs-8094	48	4	focused	focus	VERB
ahs-8094	48	5	on	on	ADP
ahs-8094	48	6	local	local	ADJ
ahs-8094	48	7	,	,	PUNCT
ahs-8094	48	8	commercial	commercial	ADJ
ahs-8094	48	9	and	and	CCONJ
ahs-8094	48	10	introduced	introduce	VERB
ahs-8094	48	11	geno­	geno­	NOUN
ahs-8094	48	12	types	type	NOUN
ahs-8094	48	13	that	that	PRON
ahs-8094	48	14	have	have	AUX
ahs-8094	48	15	not	not	PART
ahs-8094	48	16	been	be	AUX
ahs-8094	48	17	evaluated	evaluate	VERB
ahs-8094	48	18	before	before	ADV
ahs-8094	48	19	for	for	ADP
ahs-8094	48	20	the	the	DET
ahs-8094	48	21	resistance	resistance	NOUN
ahs-8094	48	22	to	to	ADP
ahs-8094	48	23	viruses	virus	NOUN
ahs-8094	48	24	or	or	CCONJ
ahs-8094	48	25	aphids	aphid	NOUN
ahs-8094	48	26	in	in	ADP
ahs-8094	48	27	rwanda	rwanda	PROPN
ahs-8094	48	28	.	.	PUNCT
ahs-8094	49	1	it	it	PRON
ahs-8094	49	2	is	be	AUX
ahs-8094	49	3	important	important	ADJ
ahs-8094	49	4	to	to	PART
ahs-8094	49	5	assess	assess	VERB
ahs-8094	49	6	the	the	DET
ahs-8094	49	7	genotypes	genotype	NOUN
ahs-8094	49	8	in	in	ADP
ahs-8094	49	9	different	different	ADJ
ahs-8094	49	10	environments	environment	NOUN
ahs-8094	49	11	in	in	ADP
ahs-8094	49	12	the	the	DET
ahs-8094	49	13	field	field	NOUN
ahs-8094	49	14	to	to	PART
ahs-8094	49	15	identify	identify	VERB
ahs-8094	49	16	the	the	DET
ahs-8094	49	17	relative	relative	ADJ
ahs-8094	49	18	host	host	NOUN
ahs-8094	49	19	resistance	resistance	NOUN
ahs-8094	49	20	,	,	PUNCT
ahs-8094	49	21	as	as	SCONJ
ahs-8094	49	22	some	some	DET
ahs-8094	49	23	genotypes	genotype	NOUN
ahs-8094	49	24	found	find	VERB
ahs-8094	49	25	resistance	resistance	NOUN
ahs-8094	49	26	at	at	ADP
ahs-8094	49	27	one	one	NUM
ahs-8094	49	28	location	location	NOUN
ahs-8094	49	29	turns	turn	VERB
ahs-8094	49	30	out	out	ADP
ahs-8094	49	31	to	to	PART
ahs-8094	49	32	be	be	AUX
ahs-8094	49	33	susceptible	susceptible	ADJ
ahs-8094	49	34	to	to	ADP
ahs-8094	49	35	another	another	DET
ahs-8094	49	36	place	place	NOUN
ahs-8094	49	37	.	.	PUNCT
ahs-8094	50	1	screenhouse	screenhouse	PROPN
ahs-8094	50	2	assessment	assessment	NOUN
ahs-8094	50	3	using	use	VERB
ahs-8094	50	4	artificial	artificial	ADJ
ahs-8094	50	5	inocu­	inocu­	NUM
ahs-8094	50	6	lation	lation	NOUN
ahs-8094	50	7	techniques	technique	NOUN
ahs-8094	50	8	is	be	AUX
ahs-8094	50	9	important	important	ADJ
ahs-8094	50	10	for	for	ADP
ahs-8094	50	11	validation	validation	NOUN
ahs-8094	50	12	of	of	ADP
ahs-8094	50	13	resis­	resis­	DET
ahs-8094	50	14	tance	tance	NOUN
ahs-8094	50	15	.	.	PUNCT
ahs-8094	51	1	in	in	ADP
ahs-8094	51	2	this	this	DET
ahs-8094	51	3	study	study	NOUN
ahs-8094	51	4	,	,	PUNCT
ahs-8094	51	5	both	both	PRON
ahs-8094	51	6	field	field	NOUN
ahs-8094	51	7	and	and	CCONJ
ahs-8094	51	8	screenhouse	screenhouse	ADJ
ahs-8094	51	9	experiments	experiment	NOUN
ahs-8094	51	10	were	be	AUX
ahs-8094	51	11	conducted	conduct	VERB
ahs-8094	51	12	to	to	ADP
ahs-8094	51	13	(	(	PUNCT
ahs-8094	51	14	1	1	X
ahs-8094	51	15	)	)	PUNCT
ahs-8094	51	16	evaluate	evaluate	VERB
ahs-8094	51	17	the	the	DET
ahs-8094	51	18	reac­	reac­	NUM
ahs-8094	51	19	tion	tion	NOUN
ahs-8094	51	20	of	of	ADP
ahs-8094	51	21	different	different	ADJ
ahs-8094	51	22	hot	hot	ADJ
ahs-8094	51	23	pepper	pepper	NOUN
ahs-8094	51	24	genotypes	genotype	NOUN
ahs-8094	51	25	(	(	PUNCT
ahs-8094	51	26	local	local	ADJ
ahs-8094	51	27	,	,	PUNCT
ahs-8094	51	28	com­	com­	NOUN
ahs-8094	51	29	mercial	mercial	NOUN
ahs-8094	51	30	and	and	CCONJ
ahs-8094	51	31	introduced	introduce	VERB
ahs-8094	51	32	)	)	PUNCT
ahs-8094	51	33	to	to	ADP
ahs-8094	51	34	natural	natural	ADJ
ahs-8094	51	35	virus	virus	NOUN
ahs-8094	51	36	infections	infection	NOUN
ahs-8094	51	37	and	and	CCONJ
ahs-8094	51	38	aphids	aphid	NOUN
ahs-8094	51	39	’	'	PUNCT
ahs-8094	51	40	infestations	infestation	NOUN
ahs-8094	51	41	in	in	ADP
ahs-8094	51	42	two	two	NUM
ahs-8094	51	43	agro­ecological	agro­ecological	ADJ
ahs-8094	51	44	zones	zone	NOUN
ahs-8094	51	45	of	of	ADP
ahs-8094	51	46	rwanda	rwanda	PROPN
ahs-8094	51	47	,	,	PUNCT
ahs-8094	51	48	and	and	CCONJ
ahs-8094	51	49	(	(	PUNCT
ahs-8094	51	50	2	2	X
ahs-8094	51	51	)	)	PUNCT
ahs-8094	51	52	evaluate	evaluate	VERB
ahs-8094	51	53	the	the	DET
ahs-8094	51	54	reaction	reaction	NOUN
ahs-8094	51	55	of	of	ADP
ahs-8094	51	56	selected	select	VERB
ahs-8094	51	57	hot	hot	ADJ
ahs-8094	51	58	pepper	pepper	NOUN
ahs-8094	51	59	genotypes	genotype	NOUN
ahs-8094	51	60	to	to	ADP
ahs-8094	51	61	infection	infection	NOUN
ahs-8094	51	62	by	by	ADP
ahs-8094	51	63	cucumber	cucumber	PROPN
ahs-8094	51	64	mosaic	mosaic	PROPN
ahs-8094	51	65	virus	virus	NOUN
ahs-8094	51	66	under	under	ADP
ahs-8094	51	67	screenhouse	screenhouse	NOUN
ahs-8094	51	68	conditions	condition	NOUN
ahs-8094	51	69	.	.	PUNCT
ahs-8094	52	1	2	2	X
ahs-8094	52	2	.	.	X
ahs-8094	52	3	materials	material	NOUN
ahs-8094	52	4	and	and	CCONJ
ahs-8094	52	5	methods	method	NOUN
ahs-8094	52	6	reaction	reaction	NOUN
ahs-8094	52	7	of	of	ADP
ahs-8094	52	8	hot	hot	ADJ
ahs-8094	52	9	pepper	pepper	NOUN
ahs-8094	52	10	genotypes	genotype	NOUN
ahs-8094	52	11	to	to	PART
ahs-8094	52	12	virus	virus	VERB
ahs-8094	52	13	infection	infection	NOUN
ahs-8094	52	14	and	and	CCONJ
ahs-8094	52	15	aphid	aphid	NOUN
ahs-8094	52	16	infestation	infestation	NOUN
ahs-8094	52	17	under	under	ADP
ahs-8094	52	18	field	field	NOUN
ahs-8094	52	19	conditions	condition	NOUN
ahs-8094	52	20	source	source	NOUN
ahs-8094	52	21	of	of	ADP
ahs-8094	52	22	seeds	seed	NOUN
ahs-8094	52	23	a	a	DET
ahs-8094	52	24	total	total	NOUN
ahs-8094	52	25	of	of	ADP
ahs-8094	52	26	18	18	NUM
ahs-8094	52	27	hot	hot	ADJ
ahs-8094	52	28	pepper	pepper	NOUN
ahs-8094	52	29	genotypes	genotype	NOUN
ahs-8094	52	30	that	that	PRON
ahs-8094	52	31	included	include	VERB
ahs-8094	52	32	nine	nine	NUM
ahs-8094	52	33	local	local	ADJ
ahs-8094	52	34	collections	collection	NOUN
ahs-8094	52	35	obtained	obtain	VERB
ahs-8094	52	36	from	from	ADP
ahs-8094	52	37	rwanda	rwanda	PROPN
ahs-8094	52	38	national	national	PROPN
ahs-8094	52	39	genbank	genbank	PROPN
ahs-8094	52	40	,	,	PUNCT
ahs-8094	52	41	five	five	NUM
ahs-8094	52	42	introduced	introduce	VERB
ahs-8094	52	43	lines	line	NOUN
ahs-8094	52	44	provided	provide	VERB
ahs-8094	52	45	by	by	ADP
ahs-8094	52	46	world	world	NOUN
ahs-8094	52	47	vegetable	vegetable	NOUN
ahs-8094	52	48	center	center	NOUN
ahs-8094	52	49	,	,	PUNCT
ahs-8094	52	50	eastern	eastern	ADJ
ahs-8094	52	51	and	and	CCONJ
ahs-8094	52	52	southern	southern	ADJ
ahs-8094	52	53	africa­	africa­	PROPN
ahs-8094	52	54	tanzania	tanzania	PROPN
ahs-8094	52	55	and	and	CCONJ
ahs-8094	52	56	four	four	NUM
ahs-8094	52	57	commercial	commercial	ADJ
ahs-8094	52	58	varieties	variety	NOUN
ahs-8094	52	59	from	from	ADP
ahs-8094	52	60	seed	seed	NOUN
ahs-8094	52	61	companies	company	NOUN
ahs-8094	52	62	were	be	AUX
ahs-8094	52	63	evaluated	evaluate	VERB
ahs-8094	52	64	(	(	PUNCT
ahs-8094	52	65	table	table	NOUN
ahs-8094	52	66	1	1	NUM
ahs-8094	52	67	)	)	PUNCT
ahs-8094	52	68	.	.	PUNCT
ahs-8094	53	1	previous	previous	ADJ
ahs-8094	53	2	studies	study	NOUN
ahs-8094	53	3	indicate	indicate	VERB
ahs-8094	53	4	that	that	SCONJ
ahs-8094	53	5	the	the	DET
ahs-8094	53	6	introduced	introduce	VERB
ahs-8094	53	7	genotype	genotype	NOUN
ahs-8094	53	8	pp9950­5197	pp9950­5197	NOUN
ahs-8094	53	9	is	be	AUX
ahs-8094	53	10	resistant	resistant	ADJ
ahs-8094	53	11	to	to	ADP
ahs-8094	53	12	cmv	cmv	NOUN
ahs-8094	53	13	,	,	PUNCT
ahs-8094	53	14	pvy	pvy	NOUN
ahs-8094	53	15	and	and	CCONJ
ahs-8094	53	16	chilli	chilli	PROPN
ahs-8094	53	17	veinal	veinal	ADJ
ahs-8094	53	18	mottle	mottle	NOUN
ahs-8094	53	19	virus	virus	NOUN
ahs-8094	53	20	while	while	SCONJ
ahs-8094	53	21	genotype	genotype	NOUN
ahs-8094	53	22	icpn	icpn	PROPN
ahs-8094	53	23	18­7	18­7	NUM
ahs-8094	53	24	is	be	AUX
ahs-8094	53	25	resistant	resistant	ADJ
ahs-8094	53	26	to	to	ADP
ahs-8094	53	27	pvy	pvy	NOUN
ahs-8094	53	28	(	(	PUNCT
ahs-8094	53	29	gniffke	gniffke	NOUN
ahs-8094	53	30	et	et	PROPN
ahs-8094	53	31	al	al	PROPN
ahs-8094	53	32	.	.	PROPN
ahs-8094	53	33	,	,	PUNCT
ahs-8094	53	34	2013	2013	NUM
ahs-8094	53	35	)	)	PUNCT
ahs-8094	53	36	.	.	PUNCT
ahs-8094	54	1	similar	similar	ADJ
ahs-8094	54	2	studies	study	NOUN
ahs-8094	54	3	by	by	ADP
ahs-8094	54	4	reddy	reddy	PROPN
ahs-8094	54	5	et	et	PROPN
ahs-8094	54	6	al	al	PROPN
ahs-8094	54	7	.	.	PROPN
ahs-8094	55	1	(	(	PUNCT
ahs-8094	55	2	2014	2014	NUM
ahs-8094	55	3	)	)	PUNCT
ahs-8094	55	4	showed	show	VERB
ahs-8094	55	5	the	the	DET
ahs-8094	55	6	introduced	introduce	VERB
ahs-8094	55	7	genotype	genotype	NOUN
ahs-8094	55	8	pp9852­170	pp9852­170	NOUN
ahs-8094	55	9	as	as	ADP
ahs-8094	55	10	resistant	resistant	ADJ
ahs-8094	55	11	against	against	ADP
ahs-8094	55	12	cmv	cmv	NOUN
ahs-8094	55	13	.	.	PUNCT
ahs-8094	56	1	california	california	PROPN
ahs-8094	56	2	wonder	wonder	PROPN
ahs-8094	56	3	(	(	PUNCT
ahs-8094	56	4	sweet	sweet	ADJ
ahs-8094	56	5	pep­	pep­	NOUN
ahs-8094	56	6	per	per	ADP
ahs-8094	56	7	)	)	PUNCT
ahs-8094	56	8	variety	variety	NOUN
ahs-8094	56	9	which	which	PRON
ahs-8094	56	10	has	have	AUX
ahs-8094	56	11	been	be	AUX
ahs-8094	56	12	used	use	VERB
ahs-8094	56	13	as	as	ADP
ahs-8094	56	14	a	a	DET
ahs-8094	56	15	susceptible	susceptible	ADJ
ahs-8094	56	16	control	control	NOUN
ahs-8094	56	17	for	for	ADP
ahs-8094	56	18	viruses	virus	NOUN
ahs-8094	56	19	in	in	ADP
ahs-8094	56	20	previous	previous	ADJ
ahs-8094	56	21	studies	study	NOUN
ahs-8094	56	22	(	(	PUNCT
ahs-8094	56	23	murphy	murphy	NOUN
ahs-8094	56	24	and	and	CCONJ
ahs-8094	56	25	bowen	bowen	PROPN
ahs-8094	56	26	,	,	PUNCT
ahs-8094	56	27	2006	2006	NUM
ahs-8094	56	28	)	)	PUNCT
ahs-8094	56	29	was	be	AUX
ahs-8094	56	30	also	also	ADV
ahs-8094	56	31	included	include	VERB
ahs-8094	56	32	in	in	ADP
ahs-8094	56	33	the	the	DET
ahs-8094	56	34	present	present	ADJ
ahs-8094	56	35	study	study	NOUN
ahs-8094	56	36	.	.	PUNCT
ahs-8094	57	1	study	study	NOUN
ahs-8094	57	2	areas	area	NOUN
ahs-8094	57	3	the	the	DET
ahs-8094	57	4	study	study	NOUN
ahs-8094	57	5	was	be	AUX
ahs-8094	57	6	conducted	conduct	VERB
ahs-8094	57	7	at	at	ADP
ahs-8094	57	8	rubona	rubona	ADJ
ahs-8094	57	9	and	and	CCONJ
ahs-8094	57	10	gashora	gashora	VERB
ahs-8094	57	11	research	research	NOUN
ahs-8094	57	12	fields	field	NOUN
ahs-8094	57	13	belonging	belong	VERB
ahs-8094	57	14	to	to	ADP
ahs-8094	57	15	the	the	DET
ahs-8094	57	16	rwanda	rwanda	PROPN
ahs-8094	57	17	agriculture	agriculture	NOUN
ahs-8094	57	18	and	and	CCONJ
ahs-8094	57	19	animal	animal	NOUN
ahs-8094	57	20	resources	resource	NOUN
ahs-8094	57	21	development	development	PROPN
ahs-8094	57	22	board	board	PROPN
ahs-8094	57	23	(	(	PUNCT
ahs-8094	57	24	rab	rab	PROPN
ahs-8094	57	25	)	)	PUNCT
ahs-8094	57	26	dur­	dur­	NOUN
ahs-8094	57	27	ing	e	VERB
ahs-8094	57	28	two	two	NUM
ahs-8094	57	29	successive	successive	ADJ
ahs-8094	57	30	growing	grow	VERB
ahs-8094	57	31	seasons	season	NOUN
ahs-8094	57	32	;	;	PUNCT
ahs-8094	57	33	long	long	ADJ
ahs-8094	57	34	rains	rain	NOUN
ahs-8094	57	35	(	(	PUNCT
ahs-8094	57	36	end	end	NOUN
ahs-8094	57	37	waweru	waweru	PROPN
ahs-8094	57	38	et	et	PROPN
ahs-8094	57	39	al	al	PROPN
ahs-8094	57	40	.	.	PROPN
ahs-8094	57	41	‐	‐	NOUN
ahs-8094	57	42	evaluation	evaluation	NOUN
ahs-8094	57	43	of	of	ADP
ahs-8094	57	44	hot	hot	ADJ
ahs-8094	57	45	pepper	pepper	NOUN
ahs-8094	57	46	genotypes	genotype	NOUN
ahs-8094	57	47	in	in	ADP
ahs-8094	57	48	rwanda	rwanda	PROPN
ahs-8094	57	49	399	399	NUM
ahs-8094	57	50	march­july	march­july	ADV
ahs-8094	57	51	,	,	PUNCT
ahs-8094	57	52	2018	2018	NUM
ahs-8094	57	53	)	)	PUNCT
ahs-8094	57	54	and	and	CCONJ
ahs-8094	57	55	short	short	ADJ
ahs-8094	57	56	rains	rain	NOUN
ahs-8094	57	57	(	(	PUNCT
ahs-8094	57	58	end	end	NOUN
ahs-8094	57	59	october	october	PROPN
ahs-8094	57	60	,	,	PUNCT
ahs-8094	57	61	18­	18­	NUM
ahs-8094	57	62	march	march	NOUN
ahs-8094	57	63	,	,	PUNCT
ahs-8094	57	64	2019	2019	NUM
ahs-8094	57	65	)	)	PUNCT
ahs-8094	57	66	.	.	PUNCT
ahs-8094	58	1	rubona	rubona	PROPN
ahs-8094	58	2	station	station	NOUN
ahs-8094	58	3	is	be	AUX
ahs-8094	58	4	located	locate	VERB
ahs-8094	58	5	at	at	ADP
ahs-8094	58	6	an	an	DET
ahs-8094	58	7	alti­	alti­	PROPN
ahs-8094	58	8	tude	tude	NOUN
ahs-8094	58	9	of	of	ADP
ahs-8094	58	10	1692.9	1692.9	NUM
ahs-8094	58	11	m	m	NOUN
ahs-8094	58	12	,	,	PUNCT
ahs-8094	58	13	latitude	latitude	NOUN
ahs-8094	58	14	s	s	PART
ahs-8094	58	15	2	2	NUM
ahs-8094	58	16	°	°	NOUN
ahs-8094	58	17	28ʹ59.59ʺ	28ʹ59.59ʺ	NUM
ahs-8094	58	18	and	and	CCONJ
ahs-8094	58	19	longi­	longi­	PROPN
ahs-8094	58	20	tude	tude	NOUN
ahs-8094	58	21	e29	e29	PROPN
ahs-8094	58	22	°	°	SYM
ahs-8094	58	23	46ʹ22.46ʺ	46ʹ22.46ʺ	PROPN
ahs-8094	58	24	,	,	PUNCT
ahs-8094	58	25	in	in	ADP
ahs-8094	58	26	midland	midland	PROPN
ahs-8094	58	27	aez	aez	PROPN
ahs-8094	58	28	.	.	PUNCT
ahs-8094	59	1	gashora	gashora	NOUN
ahs-8094	59	2	is	be	AUX
ahs-8094	59	3	located	locate	VERB
ahs-8094	59	4	at	at	ADP
ahs-8094	59	5	an	an	DET
ahs-8094	59	6	altitude	altitude	NOUN
ahs-8094	59	7	of	of	ADP
ahs-8094	59	8	1331.1	1331.1	NUM
ahs-8094	59	9	m	m	NOUN
ahs-8094	59	10	,	,	PUNCT
ahs-8094	59	11	latitude	latitude	NOUN
ahs-8094	59	12	s	s	PART
ahs-8094	59	13	2	2	NUM
ahs-8094	59	14	°	°	NOUN
ahs-8094	59	15	15ʹ22.11ʺ	15ʹ22.11ʺ	NUM
ahs-8094	59	16	and	and	CCONJ
ahs-8094	59	17	longitude	longitude	ADJ
ahs-8094	59	18	e30	e30	NOUN
ahs-8094	59	19	°	°	NOUN
ahs-8094	59	20	17ʹ12.43ʺ	17ʹ12.43ʺ	NUM
ahs-8094	59	21	,	,	PUNCT
ahs-8094	59	22	in	in	ADP
ahs-8094	59	23	lowland	lowland	NOUN
ahs-8094	59	24	aez	aez	PROPN
ahs-8094	59	25	.	.	PUNCT
ahs-8094	60	1	the	the	DET
ahs-8094	60	2	characteristics	characteristic	NOUN
ahs-8094	60	3	of	of	ADP
ahs-8094	60	4	the	the	DET
ahs-8094	60	5	two	two	NUM
ahs-8094	60	6	aezs	aezs	NOUN
ahs-8094	60	7	are	be	AUX
ahs-8094	60	8	shown	show	VERB
ahs-8094	60	9	(	(	PUNCT
ahs-8094	60	10	table	table	NOUN
ahs-8094	60	11	2	2	NUM
ahs-8094	60	12	)	)	PUNCT
ahs-8094	60	13	.	.	PUNCT
ahs-8094	61	1	raising	raise	VERB
ahs-8094	61	2	of	of	ADP
ahs-8094	61	3	the	the	DET
ahs-8094	61	4	seedlings	seedling	NOUN
ahs-8094	61	5	seeds	seed	NOUN
ahs-8094	61	6	of	of	ADP
ahs-8094	61	7	the	the	DET
ahs-8094	61	8	different	different	ADJ
ahs-8094	61	9	genotypes	genotype	NOUN
ahs-8094	61	10	were	be	AUX
ahs-8094	61	11	sown	sow	VERB
ahs-8094	61	12	and	and	CCONJ
ahs-8094	61	13	raised	raise	VERB
ahs-8094	61	14	in	in	ADP
ahs-8094	61	15	trays	tray	NOUN
ahs-8094	61	16	containing	contain	VERB
ahs-8094	61	17	sterilized	sterilize	VERB
ahs-8094	61	18	sandy	sandy	ADJ
ahs-8094	61	19	loam	loam	NOUN
ahs-8094	61	20	soil	soil	NOUN
ahs-8094	61	21	(	(	PUNCT
ahs-8094	61	22	1:2	1:2	NUM
ahs-8094	61	23	)	)	PUNCT
ahs-8094	61	24	in	in	ADP
ahs-8094	61	25	the	the	DET
ahs-8094	61	26	screenhouse	screenhouse	NOUN
ahs-8094	61	27	.	.	PUNCT
ahs-8094	62	1	at	at	ADP
ahs-8094	62	2	2­3	2­3	NUM
ahs-8094	62	3	leaf	leaf	NOUN
ahs-8094	62	4	stage	stage	NOUN
ahs-8094	62	5	,	,	PUNCT
ahs-8094	62	6	the	the	DET
ahs-8094	62	7	seedlings	seedling	NOUN
ahs-8094	62	8	were	be	AUX
ahs-8094	62	9	transplanted	transplant	VERB
ahs-8094	62	10	into	into	ADP
ahs-8094	62	11	plastic	plastic	ADJ
ahs-8094	62	12	potting	potting	NOUN
ahs-8094	62	13	bags	bag	NOUN
ahs-8094	62	14	(	(	PUNCT
ahs-8094	62	15	5	5	NUM
ahs-8094	62	16	×	×	NOUN
ahs-8094	62	17	9	9	NUM
ahs-8094	62	18	×	×	NOUN
ahs-8094	62	19	4	4	NUM
ahs-8094	62	20	cm	cm	NOUN
ahs-8094	62	21	)	)	PUNCT
ahs-8094	62	22	containing	contain	VERB
ahs-8094	62	23	steam­sterilized	steam­sterilize	VERB
ahs-8094	62	24	sandy	sandy	ADJ
ahs-8094	62	25	loam	loam	NOUN
ahs-8094	62	26	soil	soil	NOUN
ahs-8094	62	27	and	and	CCONJ
ahs-8094	62	28	maintained	maintain	VERB
ahs-8094	62	29	for	for	ADP
ahs-8094	62	30	six	six	NUM
ahs-8094	62	31	weeks	week	NOUN
ahs-8094	62	32	in	in	ADP
ahs-8094	62	33	the	the	DET
ahs-8094	62	34	screenhouse	screenhouse	NOUN
ahs-8094	62	35	.	.	PUNCT
ahs-8094	63	1	before	before	ADP
ahs-8094	63	2	transplanting	transplant	VERB
ahs-8094	63	3	to	to	ADP
ahs-8094	63	4	the	the	DET
ahs-8094	63	5	field	field	NOUN
ahs-8094	63	6	,	,	PUNCT
ahs-8094	63	7	the	the	DET
ahs-8094	63	8	seedlings	seedling	NOUN
ahs-8094	63	9	were	be	AUX
ahs-8094	63	10	confirmed	confirm	VERB
ahs-8094	63	11	to	to	PART
ahs-8094	63	12	be	be	AUX
ahs-8094	63	13	free	free	ADJ
ahs-8094	63	14	from	from	ADP
ahs-8094	63	15	pepper	pepper	NOUN
ahs-8094	63	16	mild	mild	ADJ
ahs-8094	63	17	mottle	mottle	NOUN
ahs-8094	63	18	virus	virus	NOUN
ahs-8094	63	19	(	(	PUNCT
ahs-8094	63	20	pmmov	pmmov	NOUN
ahs-8094	63	21	)	)	PUNCT
ahs-8094	63	22	,	,	PUNCT
ahs-8094	63	23	pvmv	pvmv	NOUN
ahs-8094	63	24	,	,	PUNCT
ahs-8094	63	25	tmv	tmv	NOUN
ahs-8094	63	26	,	,	PUNCT
ahs-8094	63	27	pvy	pvy	NOUN
ahs-8094	63	28	and	and	CCONJ
ahs-8094	63	29	cmv	cmv	NOUN
ahs-8094	63	30	using	use	VERB
ahs-8094	63	31	das­	das­	NOUN
ahs-8094	63	32	elisa	elisa	PROPN
ahs-8094	63	33	.	.	PUNCT
ahs-8094	64	1	the	the	DET
ahs-8094	64	2	kits	kit	NOUN
ahs-8094	64	3	were	be	AUX
ahs-8094	64	4	obtained	obtain	VERB
ahs-8094	64	5	from	from	ADP
ahs-8094	64	6	loewe	loewe	PROPN
ahs-8094	64	7	biochemica	biochemica	PROPN
ahs-8094	64	8	gmbh	gmbh	PROPN
ahs-8094	64	9	company	company	PROPN
ahs-8094	64	10	,	,	PUNCT
ahs-8094	64	11	germany	germany	PROPN
ahs-8094	64	12	)	)	PUNCT
ahs-8094	64	13	and	and	CCONJ
ahs-8094	64	14	used	use	VERB
ahs-8094	64	15	according	accord	VERB
ahs-8094	64	16	to	to	ADP
ahs-8094	64	17	instructions	instruction	NOUN
ahs-8094	64	18	from	from	ADP
ahs-8094	64	19	the	the	DET
ahs-8094	64	20	manufacturer	manufacturer	NOUN
ahs-8094	64	21	.	.	PUNCT
ahs-8094	65	1	establishment	establishment	NOUN
ahs-8094	65	2	of	of	ADP
ahs-8094	65	3	the	the	DET
ahs-8094	65	4	field	field	NOUN
ahs-8094	65	5	experiments	experiment	VERB
ahs-8094	65	6	the	the	DET
ahs-8094	65	7	experiments	experiment	NOUN
ahs-8094	65	8	were	be	AUX
ahs-8094	65	9	carried	carry	VERB
ahs-8094	65	10	out	out	ADP
ahs-8094	65	11	in	in	ADP
ahs-8094	65	12	the	the	DET
ahs-8094	65	13	open	open	ADJ
ahs-8094	65	14	field	field	NOUN
ahs-8094	65	15	and	and	CCONJ
ahs-8094	65	16	depended	depend	VERB
ahs-8094	65	17	on	on	ADP
ahs-8094	65	18	natural	natural	ADJ
ahs-8094	65	19	virus	virus	NOUN
ahs-8094	65	20	infections	infection	NOUN
ahs-8094	65	21	and	and	CCONJ
ahs-8094	65	22	aphid	aphid	NOUN
ahs-8094	65	23	infestation	infestation	NOUN
ahs-8094	65	24	from	from	ADP
ahs-8094	65	25	the	the	DET
ahs-8094	65	26	uncultivated	uncultivated	ADJ
ahs-8094	65	27	fields	field	NOUN
ahs-8094	65	28	.	.	PUNCT
ahs-8094	66	1	the	the	DET
ahs-8094	66	2	experiments	experiment	NOUN
ahs-8094	66	3	were	be	AUX
ahs-8094	66	4	laid	lay	VERB
ahs-8094	66	5	out	out	ADP
ahs-8094	66	6	in	in	ADP
ahs-8094	66	7	a	a	DET
ahs-8094	66	8	randomized	randomized	ADJ
ahs-8094	66	9	complete	complete	ADJ
ahs-8094	66	10	block	block	NOUN
ahs-8094	66	11	design	design	NOUN
ahs-8094	66	12	(	(	PUNCT
ahs-8094	66	13	rcbd	rcbd	NOUN
ahs-8094	66	14	)	)	PUNCT
ahs-8094	66	15	with	with	ADP
ahs-8094	66	16	three	three	NUM
ahs-8094	66	17	replications	replication	NOUN
ahs-8094	66	18	.	.	PUNCT
ahs-8094	67	1	the	the	DET
ahs-8094	67	2	blocking	blocking	NOUN
ahs-8094	67	3	was	be	AUX
ahs-8094	67	4	done	do	VERB
ahs-8094	67	5	according	accord	VERB
ahs-8094	67	6	to	to	ADP
ahs-8094	67	7	soil	soil	NOUN
ahs-8094	67	8	fertility	fertility	NOUN
ahs-8094	67	9	gradient	gradient	NOUN
ahs-8094	67	10	and	and	CCONJ
ahs-8094	67	11	nearness	nearness	NOUN
ahs-8094	67	12	to	to	ADP
ahs-8094	67	13	the	the	DET
ahs-8094	67	14	uncultivated	uncultivated	ADJ
ahs-8094	67	15	land	land	NOUN
ahs-8094	67	16	,	,	PUNCT
ahs-8094	67	17	such	such	ADJ
ahs-8094	67	18	that	that	SCONJ
ahs-8094	67	19	each	each	DET
ahs-8094	67	20	treatment	treatment	NOUN
ahs-8094	67	21	had	have	VERB
ahs-8094	67	22	an	an	DET
ahs-8094	67	23	equal	equal	ADJ
ahs-8094	67	24	chance	chance	NOUN
ahs-8094	67	25	of	of	ADP
ahs-8094	67	26	vector	vector	NOUN
ahs-8094	67	27	infestation	infestation	NOUN
ahs-8094	67	28	.	.	PUNCT
ahs-8094	68	1	each	each	DET
ahs-8094	68	2	replicate	replicate	NOUN
ahs-8094	68	3	had	have	VERB
ahs-8094	68	4	eighteen	eighteen	NUM
ahs-8094	68	5	experimental	experimental	ADJ
ahs-8094	68	6	plots	plot	NOUN
ahs-8094	68	7	,	,	PUNCT
ahs-8094	68	8	mea­	mea­	NOUN
ahs-8094	68	9	suring	sure	VERB
ahs-8094	68	10	2.5	2.5	NUM
ahs-8094	68	11	m	m	NOUN
ahs-8094	68	12	by	by	ADP
ahs-8094	68	13	3	3	NUM
ahs-8094	68	14	m	m	NOUN
ahs-8094	68	15	each	each	PRON
ahs-8094	68	16	,	,	PUNCT
ahs-8094	68	17	with	with	ADP
ahs-8094	68	18	a	a	DET
ahs-8094	68	19	1	1	NUM
ahs-8094	68	20	m	m	NOUN
ahs-8094	68	21	wide	wide	ADJ
ahs-8094	68	22	path	path	NOUN
ahs-8094	68	23	between	between	ADP
ahs-8094	68	24	the	the	DET
ahs-8094	68	25	plots	plot	NOUN
ahs-8094	68	26	.	.	PUNCT
ahs-8094	69	1	an	an	DET
ahs-8094	69	2	experimental	experimental	ADJ
ahs-8094	69	3	plot	plot	NOUN
ahs-8094	69	4	contained	contain	VERB
ahs-8094	69	5	24	24	NUM
ahs-8094	69	6	seedlings	seedling	NOUN
ahs-8094	69	7	planted	plant	VERB
ahs-8094	69	8	on	on	ADP
ahs-8094	69	9	4	4	NUM
ahs-8094	69	10	rows	row	NOUN
ahs-8094	69	11	,	,	PUNCT
ahs-8094	69	12	at	at	ADP
ahs-8094	69	13	a	a	DET
ahs-8094	69	14	spacing	spacing	NOUN
ahs-8094	69	15	of	of	ADP
ahs-8094	69	16	60	60	NUM
ahs-8094	69	17	cm	cm	NOUN
ahs-8094	69	18	by	by	ADP
ahs-8094	69	19	45	45	NUM
ahs-8094	69	20	cm	cm	NOUN
ahs-8094	69	21	.	.	PUNCT
ahs-8094	70	1	at	at	ADP
ahs-8094	70	2	planting	planting	NOUN
ahs-8094	70	3	,	,	PUNCT
ahs-8094	70	4	approximately	approximately	ADV
ahs-8094	70	5	500	500	NUM
ahs-8094	70	6	g	g	NOUN
ahs-8094	70	7	of	of	ADP
ahs-8094	70	8	organic	organic	ADJ
ahs-8094	70	9	manure	manure	NOUN
ahs-8094	70	10	was	be	AUX
ahs-8094	70	11	used	use	VERB
ahs-8094	70	12	per	per	ADP
ahs-8094	70	13	plant	plant	NOUN
ahs-8094	70	14	and	and	CCONJ
ahs-8094	70	15	15	15	NUM
ahs-8094	70	16	g	g	NOUN
ahs-8094	70	17	of	of	ADP
ahs-8094	70	18	npk	npk	NOUN
ahs-8094	70	19	(	(	PUNCT
ahs-8094	70	20	17:17:17	17:17:17	NUM
ahs-8094	70	21	)	)	PUNCT
ahs-8094	70	22	fertilizer	fertilizer	NOUN
ahs-8094	70	23	was	be	AUX
ahs-8094	70	24	applied	apply	VERB
ahs-8094	70	25	one	one	NUM
ahs-8094	70	26	week	week	NOUN
ahs-8094	70	27	later	later	ADV
ahs-8094	70	28	.	.	PUNCT
ahs-8094	71	1	a	a	DET
ahs-8094	71	2	month	month	NOUN
ahs-8094	71	3	after	after	ADP
ahs-8094	71	4	transplanting	transplant	VERB
ahs-8094	71	5	,	,	PUNCT
ahs-8094	71	6	3.5	3.5	NUM
ahs-8094	71	7	g	g	NOUN
ahs-8094	71	8	of	of	ADP
ahs-8094	71	9	urea	urea	NOUN
ahs-8094	71	10	(	(	PUNCT
ahs-8094	71	11	46:0:0	46:0:0	NUM
ahs-8094	71	12	)	)	PUNCT
ahs-8094	71	13	per	per	ADP
ahs-8094	71	14	table	table	NOUN
ahs-8094	71	15	1	1	NUM
ahs-8094	71	16	­	­	NOUN
ahs-8094	71	17	list	list	NOUN
ahs-8094	71	18	of	of	ADP
ahs-8094	71	19	genotypes	genotype	NOUN
ahs-8094	71	20	evaluated	evaluate	VERB
ahs-8094	71	21	for	for	ADP
ahs-8094	71	22	reaction	reaction	NOUN
ahs-8094	71	23	to	to	ADP
ahs-8094	71	24	infection	infection	NOUN
ahs-8094	71	25	by	by	ADP
ahs-8094	71	26	viral	viral	ADJ
ahs-8094	71	27	diseases	disease	NOUN
ahs-8094	71	28	and	and	CCONJ
ahs-8094	71	29	aphids	aphid	NOUN
ahs-8094	71	30	under	under	ADP
ahs-8094	71	31	field	field	NOUN
ahs-8094	71	32	conditions	condition	NOUN
ahs-8094	71	33	in	in	ADP
ahs-8094	71	34	rwanda	rwanda	PROPN
ahs-8094	71	35	1	1	NUM
ahs-8094	71	36	code	code	NOUN
ahs-8094	71	37	of	of	ADP
ahs-8094	71	38	the	the	DET
ahs-8094	71	39	local	local	ADJ
ahs-8094	71	40	genotypes	genotype	NOUN
ahs-8094	71	41	as	as	SCONJ
ahs-8094	71	42	found	find	VERB
ahs-8094	71	43	in	in	ADP
ahs-8094	71	44	the	the	DET
ahs-8094	71	45	database	database	NOUN
ahs-8094	71	46	of	of	ADP
ahs-8094	71	47	rwanda	rwanda	PROPN
ahs-8094	71	48	national	national	PROPN
ahs-8094	71	49	genbank	genbank	PROPN
ahs-8094	71	50	;	;	PUNCT
ahs-8094	71	51	2	2	NUM
ahs-8094	71	52	unknown	unknown	ADJ
ahs-8094	71	53	species	specie	NOUN
ahs-8094	71	54	;	;	PUNCT
ahs-8094	71	55	rngb=	rngb=	NUM
ahs-8094	71	56	rwanda	rwanda	PROPN
ahs-8094	71	57	national	national	PROPN
ahs-8094	71	58	genbank	genbank	PROPN
ahs-8094	71	59	;	;	PUNCT
ahs-8094	71	60	wvc=	wvc=	PROPN
ahs-8094	71	61	world	world	NOUN
ahs-8094	71	62	vegetable	vegetable	NOUN
ahs-8094	71	63	center	center	NOUN
ahs-8094	71	64	.	.	PUNCT
ahs-8094	72	1	genotype	genotype	NOUN
ahs-8094	72	2	species	specie	NOUN
ahs-8094	72	3	type	type	NOUN
ahs-8094	72	4	source	source	NOUN
ahs-8094	72	5	00765ppr	00765ppr	NOUN
ahs-8094	72	6	1	1	NUM
ahs-8094	72	7	c.	c.	PROPN
ahs-8094	72	8	annum	annum	PROPN
ahs-8094	72	9	local	local	ADJ
ahs-8094	72	10	rngb	rngb	PROPN
ahs-8094	72	11	00767ppr	00767ppr	NOUN
ahs-8094	72	12	c.	c.	PROPN
ahs-8094	72	13	baccatum	baccatum	PROPN
ahs-8094	72	14	local	local	PROPN
ahs-8094	72	15	rngb	rngb	PROPN
ahs-8094	72	16	00774ppr	00774ppr	NUM
ahs-8094	72	17	c.	c.	PROPN
ahs-8094	72	18	annum	annum	PROPN
ahs-8094	72	19	local	local	PROPN
ahs-8094	72	20	rngb	rngb	PROPN
ahs-8094	72	21	00775ppr	00775ppr	PROPN
ahs-8094	72	22	c.	c.	PROPN
ahs-8094	72	23	chinense	chinense	PROPN
ahs-8094	72	24	local	local	ADJ
ahs-8094	72	25	rngb	rngb	PROPN
ahs-8094	72	26	00786ppr	00786ppr	VERB
ahs-8094	72	27	c.	c.	PROPN
ahs-8094	72	28	annum	annum	PROPN
ahs-8094	72	29	local	local	PROPN
ahs-8094	72	30	rngb	rngb	PROPN
ahs-8094	73	1	00791ppr	00791ppr	PROPN
ahs-8094	73	2	c.	c.	PROPN
ahs-8094	73	3	chinense	chinense	PROPN
ahs-8094	73	4	local	local	ADJ
ahs-8094	73	5	rngb	rngb	PROPN
ahs-8094	73	6	00792ppr	00792ppr	PROPN
ahs-8094	73	7	c.	c.	PROPN
ahs-8094	73	8	frutescens	frutescens	PROPN
ahs-8094	73	9	local	local	ADJ
ahs-8094	73	10	rngb	rngb	PROPN
ahs-8094	73	11	00802ppr	00802ppr	NOUN
ahs-8094	73	12	‐	‐	NOUN
ahs-8094	73	13	2	2	NUM
ahs-8094	73	14	local	local	ADJ
ahs-8094	73	15	rngb	rngb	NOUN
ahs-8094	73	16	00795ppr	00795ppr	PROPN
ahs-8094	73	17	c.	c.	PROPN
ahs-8094	73	18	chinense	chinense	PROPN
ahs-8094	73	19	local	local	PROPN
ahs-8094	73	20	rngb	rngb	PROPN
ahs-8094	73	21	pbc	pbc	PROPN
ahs-8094	73	22	462	462	PROPN
ahs-8094	73	23	c.	c.	PROPN
ahs-8094	73	24	annum	annum	PROPN
ahs-8094	73	25	introduced	introduce	VERB
ahs-8094	73	26	wvc	wvc	PROPN
ahs-8094	73	27	pp9950­5197	pp9950­5197	PROPN
ahs-8094	73	28	c.	c.	PROPN
ahs-8094	73	29	annum	annum	PROPN
ahs-8094	73	30	introduced	introduce	VERB
ahs-8094	73	31	wvc	wvc	PROPN
ahs-8094	73	32	hp	hp	PROPN
ahs-8094	73	33	0117	0117	NUM
ahs-8094	73	34	c.	c.	PROPN
ahs-8094	73	35	annum	annum	PROPN
ahs-8094	73	36	introduced	introduce	VERB
ahs-8094	73	37	wvc	wvc	PROPN
ahs-8094	73	38	pp9852­170	pp9852­170	PROPN
ahs-8094	73	39	c.	c.	PROPN
ahs-8094	73	40	annum	annum	PROPN
ahs-8094	73	41	introduced	introduce	VERB
ahs-8094	73	42	wvc	wvc	PROPN
ahs-8094	73	43	icpn	icpn	PROPN
ahs-8094	73	44	18­7	18­7	PROPN
ahs-8094	73	45	c.	c.	PROPN
ahs-8094	73	46	annum	annum	PROPN
ahs-8094	73	47	introduced	introduce	VERB
ahs-8094	73	48	wvc	wvc	PROPN
ahs-8094	73	49	long	long	ADJ
ahs-8094	73	50	red	red	ADJ
ahs-8094	73	51	cayenne	cayenne	PROPN
ahs-8094	73	52	c.	c.	PROPN
ahs-8094	73	53	annum	annum	PROPN
ahs-8094	73	54	commercial	commercial	PROPN
ahs-8094	73	55	simlaw	simlaw	NOUN
ahs-8094	73	56	seed	seed	NOUN
ahs-8094	73	57	company	company	NOUN
ahs-8094	73	58	bird­eye	bird­eye	NOUN
ahs-8094	73	59	hybrid	hybrid	NOUN
ahs-8094	73	60	(	(	PUNCT
ahs-8094	73	61	oiseau	oiseau	PROPN
ahs-8094	73	62	pili	pili	NOUN
ahs-8094	73	63	pili	pili	NOUN
ahs-8094	73	64	)	)	PUNCT
ahs-8094	74	1	c.	c.	PROPN
ahs-8094	74	2	frutescens	frutescen	VERB
ahs-8094	74	3	commercial	commercial	PROPN
ahs-8094	74	4	technisem	technisem	PROPN
ahs-8094	74	5	company	company	PROPN
ahs-8094	74	6	red	red	PROPN
ahs-8094	74	7	scotch	scotch	PROPN
ahs-8094	74	8	bonnet	bonnet	PROPN
ahs-8094	74	9	c.	c.	PROPN
ahs-8094	74	10	chinense	chinense	PROPN
ahs-8094	74	11	commercial	commercial	ADJ
ahs-8094	74	12	exporter	exporter	PROPN
ahs-8094	74	13	california	california	PROPN
ahs-8094	74	14	wonder	wonder	PROPN
ahs-8094	74	15	c.	c.	PROPN
ahs-8094	74	16	annum	annum	PROPN
ahs-8094	74	17	commercial	commercial	PROPN
ahs-8094	74	18	kenya	kenya	PROPN
ahs-8094	74	19	seed	seed	NOUN
ahs-8094	74	20	company	company	NOUN
ahs-8094	74	21	table	table	NOUN
ahs-8094	74	22	2	2	NUM
ahs-8094	74	23	­	­	NOUN
ahs-8094	74	24	characteristics	characteristic	NOUN
ahs-8094	74	25	of	of	ADP
ahs-8094	74	26	the	the	DET
ahs-8094	74	27	two	two	NUM
ahs-8094	74	28	agro­ecological	agro­ecological	ADJ
ahs-8094	74	29	zones	zone	NOUN
ahs-8094	74	30	of	of	ADP
ahs-8094	74	31	rwanda	rwanda	PROPN
ahs-8094	74	32	where	where	SCONJ
ahs-8094	74	33	the	the	DET
ahs-8094	74	34	study	study	NOUN
ahs-8094	74	35	was	be	AUX
ahs-8094	74	36	conducted	conduct	VERB
ahs-8094	74	37	aez=	aez=	NUM
ahs-8094	74	38	agro­ecological	agro­ecological	ADJ
ahs-8094	74	39	zone	zone	NOUN
ahs-8094	74	40	.	.	PUNCT
ahs-8094	75	1	source	source	NOUN
ahs-8094	75	2	:	:	PUNCT
ahs-8094	75	3	verdoodt	verdoodt	NOUN
ahs-8094	75	4	and	and	CCONJ
ahs-8094	75	5	van	van	PROPN
ahs-8094	75	6	roanst	roanst	PROPN
ahs-8094	75	7	,	,	PUNCT
ahs-8094	75	8	2003	2003	NUM
ahs-8094	75	9	.	.	PUNCT
ahs-8094	76	1	site	site	NOUN
ahs-8094	76	2	/	/	SYM
ahs-8094	76	3	district	district	PROPN
ahs-8094	76	4	aez	aez	NOUN
ahs-8094	76	5	*	*	NOUN
ahs-8094	76	6	relief	relief	NOUN
ahs-8094	76	7	elevation	elevation	NOUN
ahs-8094	76	8	(	(	PUNCT
ahs-8094	76	9	m	m	NOUN
ahs-8094	76	10	)	)	PUNCT
ahs-8094	76	11	rainfall	rainfall	NOUN
ahs-8094	76	12	(	(	PUNCT
ahs-8094	76	13	mm	mm	NOUN
ahs-8094	76	14	)	)	PUNCT
ahs-8094	76	15	temperature	temperature	NOUN
ahs-8094	76	16	(	(	PUNCT
ahs-8094	76	17	°	°	ADP
ahs-8094	76	18	c	c	NOUN
ahs-8094	76	19	)	)	PUNCT
ahs-8094	76	20	rubona/	rubona/	PROPN
ahs-8094	76	21	huye	huye	PROPN
ahs-8094	76	22	midlands	midlands	PROPN
ahs-8094	76	23	dissected	dissect	VERB
ahs-8094	76	24	plateaus	plateaus	NOUN
ahs-8094	76	25	1600­1900	1600­1900	NUM
ahs-8094	76	26	1100­1400	1100­1400	NUM
ahs-8094	76	27	17­20	17­20	NUM
ahs-8094	76	28	gashora	gashora	NOUN
ahs-8094	76	29	/	/	SYM
ahs-8094	76	30	bugesera	bugesera	NOUN
ahs-8094	76	31	lowlands	lowland	NOUN
ahs-8094	76	32	pediplains	pediplain	VERB
ahs-8094	76	33	900­1600	900­1600	PROPN
ahs-8094	76	34	850­1100	850­1100	PROPN
ahs-8094	76	35	20­21	20­21	NUM
ahs-8094	76	36	adv	adv	PROPN
ahs-8094	76	37	.	.	PUNCT
ahs-8094	77	1	hort	hort	PROPN
ahs-8094	77	2	.	.	PUNCT
ahs-8094	78	1	sci	sci	PROPN
ahs-8094	78	2	.	.	PROPN
ahs-8094	78	3	,	,	PUNCT
ahs-8094	78	4	2020	2020	NUM
ahs-8094	78	5	34(4	34(4	NUM
ahs-8094	78	6	):	):	PUNCT
ahs-8094	78	7	397­412	397­412	NUM
ahs-8094	78	8	400	400	NUM
ahs-8094	78	9	plant	plant	NOUN
ahs-8094	78	10	was	be	AUX
ahs-8094	78	11	applied	apply	VERB
ahs-8094	78	12	.	.	PUNCT
ahs-8094	79	1	both	both	PRON
ahs-8094	79	2	preventive	preventive	ADJ
ahs-8094	79	3	and	and	CCONJ
ahs-8094	79	4	curative	curative	ADJ
ahs-8094	79	5	fungicidal	fungicidal	ADJ
ahs-8094	79	6	sprays	spray	NOUN
ahs-8094	79	7	were	be	AUX
ahs-8094	79	8	applied	apply	VERB
ahs-8094	79	9	at	at	ADP
ahs-8094	79	10	regular	regular	ADJ
ahs-8094	79	11	intervals	interval	NOUN
ahs-8094	79	12	to	to	PART
ahs-8094	79	13	control	control	VERB
ahs-8094	79	14	fungal	fungal	ADJ
ahs-8094	79	15	diseases	disease	NOUN
ahs-8094	79	16	.	.	PUNCT
ahs-8094	80	1	the	the	DET
ahs-8094	80	2	spray	spray	NOUN
ahs-8094	80	3	regime	regime	NOUN
ahs-8094	80	4	was	be	AUX
ahs-8094	80	5	depen­	depen­	ADP
ahs-8094	80	6	dent	dent	NOUN
ahs-8094	80	7	on	on	ADP
ahs-8094	80	8	symptom	symptom	NOUN
ahs-8094	80	9	appearance	appearance	NOUN
ahs-8094	80	10	and	and	CCONJ
ahs-8094	80	11	prevailing	prevail	VERB
ahs-8094	80	12	weath­	weath­	NOUN
ahs-8094	80	13	er	er	INTJ
ahs-8094	80	14	conditions	condition	NOUN
ahs-8094	80	15	.	.	PUNCT
ahs-8094	81	1	weeding	weed	VERB
ahs-8094	81	2	was	be	AUX
ahs-8094	81	3	done	do	VERB
ahs-8094	81	4	two	two	NUM
ahs-8094	81	5	times	time	NOUN
ahs-8094	81	6	in	in	ADP
ahs-8094	81	7	a	a	DET
ahs-8094	81	8	month	month	NOUN
ahs-8094	81	9	.	.	PUNCT
ahs-8094	82	1	insecticides	insecticide	NOUN
ahs-8094	82	2	were	be	AUX
ahs-8094	82	3	not	not	PART
ahs-8094	82	4	sprayed	spray	VERB
ahs-8094	82	5	at	at	ADV
ahs-8094	82	6	all	all	ADV
ahs-8094	82	7	.	.	PUNCT
ahs-8094	83	1	data	datum	NOUN
ahs-8094	83	2	collection	collection	NOUN
ahs-8094	83	3	during	during	ADP
ahs-8094	83	4	plant	plant	NOUN
ahs-8094	83	5	growth	growth	NOUN
ahs-8094	83	6	,	,	PUNCT
ahs-8094	83	7	data	datum	NOUN
ahs-8094	83	8	was	be	AUX
ahs-8094	83	9	collected	collect	VERB
ahs-8094	83	10	at	at	ADP
ahs-8094	83	11	a	a	DET
ahs-8094	83	12	14­	14­	NUM
ahs-8094	83	13	days	day	NOUN
ahs-8094	83	14	interval	interval	NOUN
ahs-8094	83	15	starting	start	VERB
ahs-8094	83	16	from	from	ADP
ahs-8094	83	17	two	two	NUM
ahs-8094	83	18	to	to	PART
ahs-8094	83	19	ten	ten	NUM
ahs-8094	83	20	weeks	week	NOUN
ahs-8094	83	21	after	after	ADP
ahs-8094	83	22	planting	plant	VERB
ahs-8094	83	23	(	(	PUNCT
ahs-8094	83	24	wap	wap	PROPN
ahs-8094	83	25	)	)	PUNCT
ahs-8094	83	26	in	in	ADP
ahs-8094	83	27	the	the	DET
ahs-8094	83	28	field	field	NOUN
ahs-8094	83	29	.	.	PUNCT
ahs-8094	84	1	ten	ten	NUM
ahs-8094	84	2	plants	plant	NOUN
ahs-8094	84	3	were	be	AUX
ahs-8094	84	4	randomly	randomly	ADV
ahs-8094	84	5	selected	select	VERB
ahs-8094	84	6	from	from	ADP
ahs-8094	84	7	the	the	DET
ahs-8094	84	8	middle	middle	ADJ
ahs-8094	84	9	rows	row	NOUN
ahs-8094	84	10	of	of	ADP
ahs-8094	84	11	each	each	DET
ahs-8094	84	12	plot	plot	NOUN
ahs-8094	84	13	and	and	CCONJ
ahs-8094	84	14	tagged	tag	VERB
ahs-8094	84	15	.	.	PUNCT
ahs-8094	85	1	these	these	DET
ahs-8094	85	2	plants	plant	NOUN
ahs-8094	85	3	were	be	AUX
ahs-8094	85	4	used	use	VERB
ahs-8094	85	5	for	for	ADP
ahs-8094	85	6	the	the	DET
ahs-8094	85	7	assessment	assessment	NOUN
ahs-8094	85	8	of	of	ADP
ahs-8094	85	9	viral	viral	ADJ
ahs-8094	85	10	disease	disease	NOUN
ahs-8094	85	11	incidence	incidence	NOUN
ahs-8094	85	12	and	and	CCONJ
ahs-8094	85	13	symptom	symptom	NOUN
ahs-8094	85	14	severity	severity	NOUN
ahs-8094	85	15	during	during	ADP
ahs-8094	85	16	the	the	DET
ahs-8094	85	17	experimental	experimental	ADJ
ahs-8094	85	18	period	period	NOUN
ahs-8094	85	19	.	.	PUNCT
ahs-8094	86	1	determination	determination	NOUN
ahs-8094	86	2	of	of	ADP
ahs-8094	86	3	disease	disease	NOUN
ahs-8094	86	4	incidence	incidence	NOUN
ahs-8094	86	5	and	and	CCONJ
ahs-8094	86	6	symptom	symptom	NOUN
ahs-8094	86	7	severity	severity	NOUN
ahs-8094	86	8	.	.	PUNCT
ahs-8094	87	1	virus	virus	NOUN
ahs-8094	87	2	disease	disease	NOUN
ahs-8094	87	3	incidence	incidence	NOUN
ahs-8094	87	4	was	be	AUX
ahs-8094	87	5	expressed	express	VERB
ahs-8094	87	6	as	as	ADP
ahs-8094	87	7	a	a	DET
ahs-8094	87	8	percentage	percentage	NOUN
ahs-8094	87	9	based	base	VERB
ahs-8094	87	10	on	on	ADP
ahs-8094	87	11	the	the	DET
ahs-8094	87	12	proportion	proportion	NOUN
ahs-8094	87	13	of	of	ADP
ahs-8094	87	14	infected	infected	ADJ
ahs-8094	87	15	/	/	SYM
ahs-8094	87	16	dis­	dis­	PROPN
ahs-8094	87	17	eased	ease	VERB
ahs-8094	87	18	plants	plant	NOUN
ahs-8094	87	19	to	to	ADP
ahs-8094	87	20	the	the	DET
ahs-8094	87	21	total	total	ADJ
ahs-8094	87	22	number	number	NOUN
ahs-8094	87	23	of	of	ADP
ahs-8094	87	24	plants	plant	NOUN
ahs-8094	87	25	observed	observe	VERB
ahs-8094	87	26	per	per	ADP
ahs-8094	87	27	plot	plot	NOUN
ahs-8094	87	28	,	,	PUNCT
ahs-8094	87	29	as	as	SCONJ
ahs-8094	87	30	described	describe	VERB
ahs-8094	87	31	by	by	ADP
ahs-8094	87	32	galanihe	galanihe	PROPN
ahs-8094	87	33	et	et	PROPN
ahs-8094	87	34	al	al	PROPN
ahs-8094	87	35	.	.	PROPN
ahs-8094	88	1	(	(	PUNCT
ahs-8094	88	2	2004	2004	NUM
ahs-8094	88	3	)	)	PUNCT
ahs-8094	88	4	.	.	PUNCT
ahs-8094	89	1	symptom	symptom	NOUN
ahs-8094	89	2	severity	severity	NOUN
ahs-8094	89	3	was	be	AUX
ahs-8094	89	4	scored	score	VERB
ahs-8094	89	5	for	for	ADP
ahs-8094	89	6	the	the	DET
ahs-8094	89	7	ten	ten	NUM
ahs-8094	89	8	tagged	tag	VERB
ahs-8094	89	9	plants	plant	NOUN
ahs-8094	89	10	in	in	ADP
ahs-8094	89	11	a	a	DET
ahs-8094	89	12	plot	plot	NOUN
ahs-8094	89	13	based	base	VERB
ahs-8094	89	14	on	on	ADP
ahs-8094	89	15	a	a	DET
ahs-8094	89	16	scale	scale	NOUN
ahs-8094	89	17	of	of	ADP
ahs-8094	89	18	1­5	1­5	NUM
ahs-8094	89	19	as	as	SCONJ
ahs-8094	89	20	described	describe	VERB
ahs-8094	89	21	by	by	ADP
ahs-8094	89	22	olawale	olawale	PROPN
ahs-8094	89	23	et	et	PROPN
ahs-8094	89	24	al	al	PROPN
ahs-8094	89	25	.	.	PROPN
ahs-8094	90	1	(	(	PUNCT
ahs-8094	90	2	2015	2015	NUM
ahs-8094	90	3	)	)	PUNCT
ahs-8094	90	4	with	with	ADP
ahs-8094	90	5	slight	slight	ADJ
ahs-8094	90	6	modifications	modification	NOUN
ahs-8094	90	7	,	,	PUNCT
ahs-8094	90	8	where	where	SCONJ
ahs-8094	90	9	:	:	PUNCT
ahs-8094	90	10	1	1	X
ahs-8094	90	11	=	=	SYM
ahs-8094	90	12	no	no	DET
ahs-8094	90	13	symptoms	symptom	NOUN
ahs-8094	90	14	;	;	PUNCT
ahs-8094	90	15	2	2	NUM
ahs-8094	90	16	=	=	SYM
ahs-8094	90	17	mild	mild	ADJ
ahs-8094	90	18	symptoms	symptom	NOUN
ahs-8094	90	19	of	of	ADP
ahs-8094	90	20	mosaic	mosaic	ADJ
ahs-8094	90	21	/	/	SYM
ahs-8094	90	22	mottling	mottling	NOUN
ahs-8094	90	23	/	/	SYM
ahs-8094	90	24	yellowing	yellow	VERB
ahs-8094	90	25	on	on	ADP
ahs-8094	90	26	few	few	ADJ
ahs-8094	90	27	leaves	leave	NOUN
ahs-8094	90	28	(	(	PUNCT
ahs-8094	90	29	<	<	X
ahs-8094	90	30	25	25	NUM
ahs-8094	90	31	%	%	NOUN
ahs-8094	90	32	of	of	ADP
ahs-8094	90	33	the	the	DET
ahs-8094	90	34	plant	plant	NOUN
ahs-8094	90	35	affected	affect	VERB
ahs-8094	90	36	)	)	PUNCT
ahs-8094	90	37	;	;	PUNCT
ahs-8094	90	38	3	3	NUM
ahs-8094	90	39	=	=	SYM
ahs-8094	90	40	moderate	moderate	ADJ
ahs-8094	90	41	symptoms	symptom	NOUN
ahs-8094	90	42	of	of	ADP
ahs-8094	90	43	mosa­	mosa­	PROPN
ahs-8094	90	44	ic	ic	PROPN
ahs-8094	90	45	/	/	SYM
ahs-8094	90	46	puckering	puckering	NOUN
ahs-8094	90	47	/	/	SYM
ahs-8094	90	48	mottling	mottling	NOUN
ahs-8094	90	49	/	/	SYM
ahs-8094	90	50	vein	vein	NOUN
ahs-8094	90	51	clearing	clearing	NOUN
ahs-8094	90	52	/	/	SYM
ahs-8094	90	53	yellowing	yellow	VERB
ahs-8094	90	54	on	on	ADP
ahs-8094	90	55	many	many	ADJ
ahs-8094	90	56	leaves	leave	NOUN
ahs-8094	90	57	(	(	PUNCT
ahs-8094	90	58	26­50	26­50	NUM
ahs-8094	90	59	%	%	NOUN
ahs-8094	90	60	of	of	ADP
ahs-8094	90	61	the	the	DET
ahs-8094	90	62	plant	plant	NOUN
ahs-8094	90	63	affected	affect	VERB
ahs-8094	90	64	)	)	PUNCT
ahs-8094	90	65	;	;	PUNCT
ahs-8094	90	66	4	4	NUM
ahs-8094	90	67	=	=	NOUN
ahs-8094	90	68	severe	severe	ADJ
ahs-8094	90	69	symptoms	symptom	NOUN
ahs-8094	90	70	of	of	ADP
ahs-8094	90	71	mosaic	mosaic	ADJ
ahs-8094	90	72	/	/	SYM
ahs-8094	90	73	puckering	pucker	VERB
ahs-8094	90	74	/	/	SYM
ahs-8094	90	75	mottling	mottling	NOUN
ahs-8094	90	76	/	/	SYM
ahs-8094	90	77	vein	vein	NOUN
ahs-8094	90	78	clearing	clearing	NOUN
ahs-8094	90	79	/	/	SYM
ahs-8094	90	80	yellowing	yellow	VERB
ahs-8094	90	81	/	/	SYM
ahs-8094	90	82	stunting	stunting	NOUN
ahs-8094	90	83	(	(	PUNCT
ahs-8094	90	84	51­75	51­75	NUM
ahs-8094	90	85	%	%	NOUN
ahs-8094	90	86	of	of	ADP
ahs-8094	90	87	the	the	DET
ahs-8094	90	88	plant	plant	NOUN
ahs-8094	90	89	affected	affect	VERB
ahs-8094	90	90	)	)	PUNCT
ahs-8094	90	91	and	and	CCONJ
ahs-8094	90	92	5	5	NUM
ahs-8094	90	93	=	=	NOUN
ahs-8094	90	94	severe	severe	ADJ
ahs-8094	90	95	symptoms	symptom	NOUN
ahs-8094	90	96	of	of	ADP
ahs-8094	90	97	mosaic	mosaic	ADJ
ahs-8094	90	98	/	/	SYM
ahs-8094	90	99	puck­	puck­	PRON
ahs-8094	90	100	ering	ere	VERB
ahs-8094	90	101	/	/	SYM
ahs-8094	90	102	mottling	mottling	NOUN
ahs-8094	90	103	/	/	SYM
ahs-8094	90	104	vein	vein	NOUN
ahs-8094	90	105	clearing	clearing	NOUN
ahs-8094	90	106	/	/	SYM
ahs-8094	90	107	yellowing/	yellowing/	NUM
ahs-8094	90	108	stunting/	stunting/	VERB
ahs-8094	90	109	necrosis	necrosis	NOUN
ahs-8094	90	110	(	(	PUNCT
ahs-8094	90	111	>	>	SYM
ahs-8094	90	112	75	75	NUM
ahs-8094	90	113	%	%	NOUN
ahs-8094	90	114	of	of	ADP
ahs-8094	90	115	the	the	DET
ahs-8094	90	116	plant	plant	NOUN
ahs-8094	90	117	)	)	PUNCT
ahs-8094	90	118	.	.	PUNCT
ahs-8094	91	1	percentage	percentage	NOUN
ahs-8094	91	2	severity	severity	NOUN
ahs-8094	91	3	was	be	AUX
ahs-8094	91	4	calculated	calculate	VERB
ahs-8094	91	5	as	as	ADP
ahs-8094	91	6	the	the	DET
ahs-8094	91	7	sum	sum	NOUN
ahs-8094	91	8	of	of	ADP
ahs-8094	91	9	all	all	DET
ahs-8094	91	10	disease	disease	NOUN
ahs-8094	91	11	rating	rating	NOUN
ahs-8094	91	12	per	per	ADP
ahs-8094	91	13	geno­	geno­	DET
ahs-8094	91	14	type	type	NOUN
ahs-8094	91	15	expressed	express	VERB
ahs-8094	91	16	as	as	ADP
ahs-8094	91	17	a	a	DET
ahs-8094	91	18	percentage	percentage	NOUN
ahs-8094	91	19	of	of	ADP
ahs-8094	91	20	the	the	DET
ahs-8094	91	21	total	total	ADJ
ahs-8094	91	22	number	number	NOUN
ahs-8094	91	23	of	of	ADP
ahs-8094	91	24	observations	observation	NOUN
ahs-8094	91	25	multiplied	multiply	VERB
ahs-8094	91	26	by	by	ADP
ahs-8094	91	27	maximum	maximum	ADJ
ahs-8094	91	28	disease	disease	NOUN
ahs-8094	91	29	scor­	scor­	ADP
ahs-8094	91	30	ing	ing	ADJ
ahs-8094	91	31	scale	scale	NOUN
ahs-8094	91	32	(	(	PUNCT
ahs-8094	91	33	5	5	NUM
ahs-8094	91	34	)	)	PUNCT
ahs-8094	91	35	.	.	PUNCT
ahs-8094	92	1	determination	determination	NOUN
ahs-8094	92	2	of	of	ADP
ahs-8094	92	3	the	the	DET
ahs-8094	92	4	area	area	NOUN
ahs-8094	92	5	under	under	ADP
ahs-8094	92	6	disease	disease	NOUN
ahs-8094	92	7	progress	progress	NOUN
ahs-8094	92	8	curve	curve	NOUN
ahs-8094	92	9	.	.	PUNCT
ahs-8094	93	1	the	the	DET
ahs-8094	93	2	area	area	NOUN
ahs-8094	93	3	under	under	ADP
ahs-8094	93	4	the	the	DET
ahs-8094	93	5	disease	disease	NOUN
ahs-8094	93	6	progress	progress	NOUN
ahs-8094	93	7	curve	curve	NOUN
ahs-8094	93	8	(	(	PUNCT
ahs-8094	93	9	audpc	audpc	NOUN
ahs-8094	93	10	)	)	PUNCT
ahs-8094	93	11	was	be	AUX
ahs-8094	93	12	estimated	estimate	VERB
ahs-8094	93	13	to	to	PART
ahs-8094	93	14	compare	compare	VERB
ahs-8094	93	15	different	different	ADJ
ahs-8094	93	16	responses	response	NOUN
ahs-8094	93	17	of	of	ADP
ahs-8094	93	18	the	the	DET
ahs-8094	93	19	tested	test	VERB
ahs-8094	93	20	hot	hot	ADJ
ahs-8094	93	21	pepper	pepper	NOUN
ahs-8094	93	22	genotypes	genotype	NOUN
ahs-8094	93	23	.	.	PUNCT
ahs-8094	94	1	estimated	estimate	VERB
ahs-8094	94	2	percentages	percentage	NOUN
ahs-8094	94	3	of	of	ADP
ahs-8094	94	4	symptom	symptom	NOUN
ahs-8094	94	5	severity	severity	NOUN
ahs-8094	94	6	recorded	record	VERB
ahs-8094	94	7	at	at	ADP
ahs-8094	94	8	different	different	ADJ
ahs-8094	94	9	times	time	NOUN
ahs-8094	94	10	during	during	ADP
ahs-8094	94	11	the	the	DET
ahs-8094	94	12	experimental	experimental	ADJ
ahs-8094	94	13	period	period	NOUN
ahs-8094	94	14	were	be	AUX
ahs-8094	94	15	used	use	VERB
ahs-8094	94	16	to	to	PART
ahs-8094	94	17	calculate	calculate	VERB
ahs-8094	94	18	audpc	audpc	NOUN
ahs-8094	94	19	using	use	VERB
ahs-8094	94	20	the	the	DET
ahs-8094	94	21	following	follow	VERB
ahs-8094	94	22	equation	equation	NOUN
ahs-8094	94	23	as	as	SCONJ
ahs-8094	94	24	described	describe	VERB
ahs-8094	94	25	by	by	ADP
ahs-8094	94	26	campbell	campbell	PROPN
ahs-8094	94	27	and	and	CCONJ
ahs-8094	94	28	madden	madden	PROPN
ahs-8094	94	29	(	(	PUNCT
ahs-8094	94	30	1990	1990	NUM
ahs-8094	94	31	)	)	PUNCT
ahs-8094	94	32	.	.	PUNCT
ahs-8094	95	1	audpc	audpc	NOUN
ahs-8094	95	2	σ	σ	NUM
ahs-8094	95	3	n­1	n­1	PROPN
ahs-8094	95	4	=	=	SYM
ahs-8094	95	5	(	(	PUNCT
ahs-8094	95	6	yi+	yi+	PROPN
ahs-8094	95	7	yi+1)/2	yi+1)/2	PROPN
ahs-8094	95	8	(	(	PUNCT
ahs-8094	95	9	ti+1	ti+1	NOUN
ahs-8094	95	10	–	–	PUNCT
ahs-8094	95	11	ti	ti	NOUN
ahs-8094	95	12	)	)	PUNCT
ahs-8094	95	13	where	where	SCONJ
ahs-8094	95	14	σ	σ	NOUN
ahs-8094	95	15	=	=	NOUN
ahs-8094	95	16	summation	summation	NOUN
ahs-8094	95	17	;	;	PUNCT
ahs-8094	95	18	n	n	NOUN
ahs-8094	95	19	=	=	NOUN
ahs-8094	95	20	number	number	NOUN
ahs-8094	95	21	of	of	ADP
ahs-8094	95	22	successive	successive	ADJ
ahs-8094	95	23	readings	reading	NOUN
ahs-8094	95	24	,	,	PUNCT
ahs-8094	95	25	yi	yi	NOUN
ahs-8094	95	26	=	=	PUNCT
ahs-8094	95	27	disease	disease	NOUN
ahs-8094	95	28	severity	severity	NOUN
ahs-8094	95	29	at	at	ADP
ahs-8094	95	30	time	time	NOUN
ahs-8094	95	31	ti	ti	NOUN
ahs-8094	95	32	and	and	CCONJ
ahs-8094	95	33	yi+1=	yi+1=	PROPN
ahs-8094	95	34	dis­	dis­	ADJ
ahs-8094	95	35	ease	ease	NOUN
ahs-8094	95	36	severity	severity	NOUN
ahs-8094	95	37	at	at	ADP
ahs-8094	95	38	time	time	NOUN
ahs-8094	95	39	ti+1	ti+1	PROPN
ahs-8094	95	40	.	.	PUNCT
ahs-8094	96	1	detection	detection	NOUN
ahs-8094	96	2	of	of	ADP
ahs-8094	96	3	the	the	DET
ahs-8094	96	4	viruses	virus	NOUN
ahs-8094	96	5	.	.	PUNCT
ahs-8094	97	1	detection	detection	NOUN
ahs-8094	97	2	of	of	ADP
ahs-8094	97	3	the	the	DET
ahs-8094	97	4	suspect­	suspect­	NOUN
ahs-8094	97	5	ed	ed	PROPN
ahs-8094	97	6	viruses	virus	NOUN
ahs-8094	97	7	in	in	ADP
ahs-8094	97	8	the	the	DET
ahs-8094	97	9	experimental	experimental	ADJ
ahs-8094	97	10	plots	plot	NOUN
ahs-8094	97	11	was	be	AUX
ahs-8094	97	12	carried	carry	VERB
ahs-8094	97	13	out	out	ADP
ahs-8094	97	14	using	use	VERB
ahs-8094	97	15	rt­pcr	rt­pcr	NOUN
ahs-8094	97	16	.	.	PUNCT
ahs-8094	98	1	at	at	ADP
ahs-8094	98	2	10	10	NUM
ahs-8094	98	3	wap	wap	PROPN
ahs-8094	98	4	,	,	PUNCT
ahs-8094	98	5	approximately	approximately	ADV
ahs-8094	98	6	five	five	NUM
ahs-8094	98	7	young	young	ADJ
ahs-8094	98	8	leaves	leave	NOUN
ahs-8094	98	9	from	from	ADP
ahs-8094	98	10	diseased	diseased	ADJ
ahs-8094	98	11	plants	plant	NOUN
ahs-8094	98	12	of	of	ADP
ahs-8094	98	13	the	the	DET
ahs-8094	98	14	eighteen	eighteen	NUM
ahs-8094	98	15	geno­	geno­	NUM
ahs-8094	98	16	types	type	NOUN
ahs-8094	98	17	were	be	AUX
ahs-8094	98	18	collected	collect	VERB
ahs-8094	98	19	and	and	CCONJ
ahs-8094	98	20	placed	place	VERB
ahs-8094	98	21	in	in	ADP
ahs-8094	98	22	envelopes	envelope	NOUN
ahs-8094	98	23	con­	con­	PROPN
ahs-8094	98	24	taining	taine	VERB
ahs-8094	98	25	silica	silica	NOUN
ahs-8094	98	26	gel	gel	NOUN
ahs-8094	98	27	.	.	PUNCT
ahs-8094	99	1	the	the	DET
ahs-8094	99	2	samples	sample	NOUN
ahs-8094	99	3	were	be	AUX
ahs-8094	99	4	later	later	ADV
ahs-8094	99	5	transported	transport	VERB
ahs-8094	99	6	to	to	ADP
ahs-8094	99	7	the	the	DET
ahs-8094	99	8	phytopathology	phytopathology	NOUN
ahs-8094	99	9	laboratory	laboratory	NOUN
ahs-8094	99	10	of	of	ADP
ahs-8094	99	11	rab	rab	PROPN
ahs-8094	99	12	at	at	ADP
ahs-8094	99	13	rubona	rubona	PROPN
ahs-8094	99	14	and	and	CCONJ
ahs-8094	99	15	stored	store	VERB
ahs-8094	99	16	at	at	ADP
ahs-8094	99	17	room	room	NOUN
ahs-8094	99	18	temperature	temperature	NOUN
ahs-8094	99	19	for	for	ADP
ahs-8094	99	20	4­5	4­5	NUM
ahs-8094	99	21	days	day	NOUN
ahs-8094	99	22	to	to	PART
ahs-8094	99	23	dry	dry	VERB
ahs-8094	99	24	.	.	PUNCT
ahs-8094	100	1	later	later	ADV
ahs-8094	100	2	,	,	PUNCT
ahs-8094	100	3	the	the	DET
ahs-8094	100	4	samples	sample	NOUN
ahs-8094	100	5	were	be	AUX
ahs-8094	100	6	grounded	ground	VERB
ahs-8094	100	7	in	in	ADP
ahs-8094	100	8	liquid	liquid	ADJ
ahs-8094	100	9	nitrogen	nitrogen	NOUN
ahs-8094	100	10	to	to	ADP
ahs-8094	100	11	fine	fine	ADJ
ahs-8094	100	12	powders	powder	NOUN
ahs-8094	100	13	that	that	PRON
ahs-8094	100	14	were	be	AUX
ahs-8094	100	15	stored	store	VERB
ahs-8094	100	16	at	at	ADP
ahs-8094	100	17	­80	­80	PROPN
ahs-8094	100	18	°	°	ADP
ahs-8094	100	19	c	c	PROPN
ahs-8094	100	20	until	until	SCONJ
ahs-8094	100	21	ana­	ana­	NOUN
ahs-8094	100	22	lyzed	lyze	VERB
ahs-8094	100	23	.	.	PUNCT
ahs-8094	101	1	in	in	ADP
ahs-8094	101	2	total	total	ADJ
ahs-8094	101	3	,	,	PUNCT
ahs-8094	101	4	68	68	NUM
ahs-8094	101	5	symptomatic	symptomatic	ADJ
ahs-8094	101	6	leaf	leaf	NOUN
ahs-8094	101	7	samples	sample	NOUN
ahs-8094	101	8	were	be	AUX
ahs-8094	101	9	col­	col­	NOUN
ahs-8094	101	10	lected	lecte	VERB
ahs-8094	101	11	from	from	ADP
ahs-8094	101	12	rubona	rubona	PROPN
ahs-8094	101	13	and	and	CCONJ
ahs-8094	101	14	gashora	gashora	NOUN
ahs-8094	101	15	’s	’s	PART
ahs-8094	101	16	experimental	experimental	ADJ
ahs-8094	101	17	sites	site	NOUN
ahs-8094	101	18	.	.	PUNCT
ahs-8094	102	1	total	total	ADJ
ahs-8094	102	2	ribonucleic	ribonucleic	ADJ
ahs-8094	102	3	acid	acid	NOUN
ahs-8094	102	4	was	be	AUX
ahs-8094	102	5	extracted	extract	VERB
ahs-8094	102	6	from	from	ADP
ahs-8094	102	7	100	100	NUM
ahs-8094	102	8	mg	mg	ADP
ahs-8094	102	9	of	of	ADP
ahs-8094	102	10	frozen	frozen	ADJ
ahs-8094	102	11	powdered	powdered	ADJ
ahs-8094	102	12	hot	hot	ADJ
ahs-8094	102	13	pepper	pepper	NOUN
ahs-8094	102	14	leaf	leaf	NOUN
ahs-8094	102	15	tissues	tissue	NOUN
ahs-8094	102	16	using	use	VERB
ahs-8094	102	17	acetyl	acetyl	NOUN
ahs-8094	102	18	trimethyl	trimethyl	PROPN
ahs-8094	102	19	ammonium	ammonium	NOUN
ahs-8094	102	20	bromide	bromide	NOUN
ahs-8094	102	21	(	(	PUNCT
ahs-8094	102	22	ctab	ctab	NOUN
ahs-8094	102	23	)	)	PUNCT
ahs-8094	102	24	method	method	NOUN
ahs-8094	102	25	as	as	SCONJ
ahs-8094	102	26	described	describe	VERB
ahs-8094	102	27	by	by	ADP
ahs-8094	102	28	allen	allen	PROPN
ahs-8094	102	29	et	et	PROPN
ahs-8094	102	30	al	al	PROPN
ahs-8094	102	31	.	.	PROPN
ahs-8094	103	1	(	(	PUNCT
ahs-8094	103	2	2006	2006	NUM
ahs-8094	103	3	)	)	PUNCT
ahs-8094	103	4	with	with	ADP
ahs-8094	103	5	modifications	modification	NOUN
ahs-8094	103	6	.	.	PUNCT
ahs-8094	104	1	amplification	amplification	NOUN
ahs-8094	104	2	of	of	ADP
ahs-8094	104	3	cmv	cmv	NOUN
ahs-8094	104	4	,	,	PUNCT
ahs-8094	104	5	pvmv	pvmv	NOUN
ahs-8094	104	6	,	,	PUNCT
ahs-8094	104	7	pevyv	pevyv	NOUN
ahs-8094	104	8	was	be	AUX
ahs-8094	104	9	done	do	VERB
ahs-8094	104	10	using	use	VERB
ahs-8094	104	11	one	one	NUM
ahs-8094	104	12	taq	taq	NOUN
ahs-8094	104	13	one­step	one­step	NOUN
ahs-8094	104	14	rt­pcr	rt­pcr	NOUN
ahs-8094	104	15	kit	kit	NOUN
ahs-8094	104	16	(	(	PUNCT
ahs-8094	104	17	catalogue	catalogue	NOUN
ahs-8094	104	18	e531s5	e531s5	PROPN
ahs-8094	104	19	,	,	PUNCT
ahs-8094	104	20	new	new	PROPN
ahs-8094	104	21	england	england	PROPN
ahs-8094	104	22	biolabs	biolabs	PROPN
ahs-8094	104	23	inc	inc	PROPN
ahs-8094	104	24	.	.	PROPN
ahs-8094	104	25	)	)	PUNCT
ahs-8094	104	26	,	,	PUNCT
ahs-8094	104	27	following	follow	VERB
ahs-8094	104	28	the	the	DET
ahs-8094	104	29	manufactur­	manufactur­	ADJ
ahs-8094	104	30	er	er	INTJ
ahs-8094	104	31	’s	’s	PART
ahs-8094	104	32	instructions	instruction	NOUN
ahs-8094	104	33	.	.	PUNCT
ahs-8094	105	1	amplified	amplify	VERB
ahs-8094	105	2	products	product	NOUN
ahs-8094	105	3	were	be	AUX
ahs-8094	105	4	generated	generate	VERB
ahs-8094	105	5	using	use	VERB
ahs-8094	105	6	virus­specific	virus­specific	ADJ
ahs-8094	105	7	primers	primer	NOUN
ahs-8094	105	8	that	that	PRON
ahs-8094	105	9	were	be	AUX
ahs-8094	105	10	designed	design	VERB
ahs-8094	105	11	dur­	dur­	ADJ
ahs-8094	105	12	ing	e	VERB
ahs-8094	105	13	this	this	DET
ahs-8094	105	14	study	study	NOUN
ahs-8094	105	15	based	base	VERB
ahs-8094	105	16	on	on	ADP
ahs-8094	105	17	the	the	DET
ahs-8094	105	18	nucleotide	nucleotide	ADJ
ahs-8094	105	19	sequence	sequence	NOUN
ahs-8094	105	20	data	datum	NOUN
ahs-8094	105	21	of	of	ADP
ahs-8094	105	22	cmv­r1	cmv­r1	PROPN
ahs-8094	105	23	(	(	PUNCT
ahs-8094	105	24	genbank	genbank	PROPN
ahs-8094	105	25	accession	accession	NOUN
ahs-8094	105	26	no	no	INTJ
ahs-8094	105	27	.	.	PUNCT
ahs-8094	106	1	mg470800.1	mg470800.1	NUM
ahs-8094	106	2	)	)	PUNCT
ahs-8094	106	3	,	,	PUNCT
ahs-8094	106	4	pvmv­r1(mg470801.1	pvmv­r1(mg470801.1	PROPN
ahs-8094	106	5	)	)	PUNCT
ahs-8094	106	6	,	,	PUNCT
ahs-8094	106	7	pevyv­r1	pevyv­r1	PROPN
ahs-8094	106	8	(	(	PUNCT
ahs-8094	106	9	mg470802.1	mg470802.1	NUM
ahs-8094	106	10	)	)	PUNCT
ahs-8094	106	11	.	.	PUNCT
ahs-8094	107	1	the	the	DET
ahs-8094	107	2	cmv	cmv	NOUN
ahs-8094	107	3	primers	primer	NOUN
ahs-8094	107	4	amplified	amplify	VERB
ahs-8094	107	5	a	a	DET
ahs-8094	107	6	fragment	fragment	NOUN
ahs-8094	107	7	of	of	ADP
ahs-8094	107	8	∼502	∼502	PUNCT
ahs-8094	107	9	bp	bp	PROPN
ahs-8094	107	10	,	,	PUNCT
ahs-8094	107	11	pvmv	pvmv	NOUN
ahs-8094	107	12	a	a	DET
ahs-8094	107	13	fragment	fragment	NOUN
ahs-8094	107	14	of	of	ADP
ahs-8094	107	15	∼502	∼502	INTJ
ahs-8094	107	16	bp	bp	PROPN
ahs-8094	107	17	and	and	CCONJ
ahs-8094	107	18	pevyv	pevyv	VERB
ahs-8094	107	19	a	a	DET
ahs-8094	107	20	fragment	fragment	NOUN
ahs-8094	107	21	of	of	ADP
ahs-8094	107	22	∼498	∼498	NOUN
ahs-8094	107	23	bp	bp	PROPN
ahs-8094	107	24	(	(	PUNCT
ahs-8094	107	25	table	table	NOUN
ahs-8094	107	26	3	3	NUM
ahs-8094	107	27	)	)	PUNCT
ahs-8094	107	28	.	.	PUNCT
ahs-8094	108	1	thermal	thermal	ADJ
ahs-8094	108	2	cycling	cycling	NOUN
ahs-8094	108	3	conditions	condition	NOUN
ahs-8094	108	4	were	be	AUX
ahs-8094	108	5	:	:	PUNCT
ahs-8094	108	6	48	48	NUM
ahs-8094	108	7	°	°	NUM
ahs-8094	108	8	c	c	NOUN
ahs-8094	108	9	at	at	ADP
ahs-8094	108	10	15	15	NUM
ahs-8094	108	11	min	min	NOUN
ahs-8094	108	12	table	table	NOUN
ahs-8094	108	13	3	3	NUM
ahs-8094	108	14	­	­	NOUN
ahs-8094	108	15	primers	primer	NOUN
ahs-8094	108	16	used	use	VERB
ahs-8094	108	17	for	for	ADP
ahs-8094	108	18	detection	detection	NOUN
ahs-8094	108	19	of	of	ADP
ahs-8094	108	20	cucumber	cucumber	PROPN
ahs-8094	108	21	mosaic	mosaic	PROPN
ahs-8094	108	22	virus	virus	NOUN
ahs-8094	108	23	,	,	PUNCT
ahs-8094	108	24	pepper	pepper	NOUN
ahs-8094	108	25	veinal	veinal	ADJ
ahs-8094	108	26	mottle	mottle	NOUN
ahs-8094	108	27	virus	virus	NOUN
ahs-8094	108	28	,	,	PUNCT
ahs-8094	108	29	and	and	CCONJ
ahs-8094	108	30	pepper	pepper	NOUN
ahs-8094	108	31	yellows	yellow	NOUN
ahs-8094	108	32	virus	virus	NOUN
ahs-8094	108	33	*	*	PUNCT
ahs-8094	108	34	primers	primer	NOUN
ahs-8094	108	35	developed	develop	VERB
ahs-8094	108	36	during	during	ADP
ahs-8094	108	37	this	this	DET
ahs-8094	108	38	study	study	NOUN
ahs-8094	108	39	.	.	PUNCT
ahs-8094	109	1	virus	virus	NOUN
ahs-8094	109	2	primer	primer	NOUN
ahs-8094	109	3	*	*	PUNCT
ahs-8094	109	4	sequence	sequence	NOUN
ahs-8094	109	5	amplification	amplification	NOUN
ahs-8094	109	6	size	size	NOUN
ahs-8094	109	7	(	(	PUNCT
ahs-8094	109	8	bp	bp	PROPN
ahs-8094	109	9	)	)	PUNCT
ahs-8094	109	10	cmv	cmv	NOUN
ahs-8094	109	11	mg470800_1f	mg470800_1f	NOUN
ahs-8094	109	12	5'­gcttcgcaatacgttttgacgg­3	5'­gcttcgcaatacgttttgacgg­3	NUM
ahs-8094	109	13	'	'	PART
ahs-8094	109	14	502	502	NUM
ahs-8094	109	15	cmv	cmv	NOUN
ahs-8094	109	16	mg470800_1r	mg470800_1r	NUM
ahs-8094	109	17	5'­tacgaccagcactggttgattc­3	5'­tacgaccagcactggttgattc­3	NUM
ahs-8094	109	18	'	'	PART
ahs-8094	109	19	502	502	NUM
ahs-8094	109	20	pvmv	pvmv	NOUN
ahs-8094	109	21	mg470801_1f	mg470801_1f	ADP
ahs-8094	109	22	5’­aagccctcattgaaggtcaacg­3	5’­aagccctcattgaaggtcaacg­3	NUM
ahs-8094	109	23	’	'	PUNCT
ahs-8094	109	24	502	502	NUM
ahs-8094	109	25	pvmv	pvmv	NOUN
ahs-8094	109	26	mg470801_1r	mg470801_1r	VERB
ahs-8094	109	27	5’­atcaaccatcacccacataccg­3	5’­atcaaccatcacccacataccg­3	NUM
ahs-8094	109	28	’	'	PUNCT
ahs-8094	109	29	502	502	NUM
ahs-8094	109	30	pevyv	pevyv	VERB
ahs-8094	109	31	mg470802_1f	mg470802_1f	NOUN
ahs-8094	109	32	5'­agtacgtcttcgagactactgc­3	5'­agtacgtcttcgagactactgc­3	NUM
ahs-8094	109	33	’	'	PUNCT
ahs-8094	109	34	498	498	NUM
ahs-8094	109	35	pevyv	pevyv	NOUN
ahs-8094	109	36	mg470802_1r	mg470802_1r	PROPN
ahs-8094	109	37	5'­tctatagtagagaggtcgatcc­3	5'­tctatagtagagaggtcgatcc­3	NUM
ahs-8094	109	38	'	'	PUNCT
ahs-8094	109	39	498	498	NUM
ahs-8094	109	40	waweru	waweru	PROPN
ahs-8094	109	41	et	et	PROPN
ahs-8094	109	42	al	al	PROPN
ahs-8094	109	43	.	.	PROPN
ahs-8094	110	1	‐	‐	NOUN
ahs-8094	110	2	evaluation	evaluation	NOUN
ahs-8094	110	3	of	of	ADP
ahs-8094	110	4	hot	hot	ADJ
ahs-8094	110	5	pepper	pepper	NOUN
ahs-8094	110	6	genotypes	genotype	NOUN
ahs-8094	110	7	in	in	ADP
ahs-8094	110	8	rwanda	rwanda	PROPN
ahs-8094	110	9	401	401	NUM
ahs-8094	110	10	for	for	ADP
ahs-8094	110	11	rt	rt	PROPN
ahs-8094	110	12	;	;	PUNCT
ahs-8094	110	13	followed	follow	VERB
ahs-8094	110	14	by	by	ADP
ahs-8094	110	15	1	1	NUM
ahs-8094	110	16	min	min	NOUN
ahs-8094	110	17	at	at	ADP
ahs-8094	110	18	94	94	NUM
ahs-8094	110	19	°	°	ADP
ahs-8094	110	20	c	c	NOUN
ahs-8094	110	21	for	for	ADP
ahs-8094	110	22	initial	initial	ADJ
ahs-8094	110	23	denatura­	denatura­	NOUN
ahs-8094	110	24	tion	tion	NOUN
ahs-8094	110	25	;	;	PUNCT
ahs-8094	110	26	40	40	NUM
ahs-8094	110	27	cycles	cycle	NOUN
ahs-8094	110	28	of	of	ADP
ahs-8094	110	29	94	94	NUM
ahs-8094	110	30	°	°	ADP
ahs-8094	110	31	c	c	NOUN
ahs-8094	110	32	for	for	ADP
ahs-8094	110	33	15	15	NUM
ahs-8094	110	34	s	s	NOUN
ahs-8094	110	35	,	,	PUNCT
ahs-8094	110	36	54	54	NUM
ahs-8094	110	37	°	°	NUM
ahs-8094	110	38	c	c	NOUN
ahs-8094	110	39	for	for	ADP
ahs-8094	110	40	30	30	NUM
ahs-8094	110	41	s	s	NOUN
ahs-8094	110	42	and	and	CCONJ
ahs-8094	110	43	68	68	NUM
ahs-8094	110	44	°	°	NOUN
ahs-8094	110	45	c	c	NOUN
ahs-8094	110	46	for	for	ADP
ahs-8094	110	47	45	45	NUM
ahs-8094	110	48	s	s	NOUN
ahs-8094	110	49	for	for	ADP
ahs-8094	110	50	denaturation	denaturation	NOUN
ahs-8094	110	51	,	,	PUNCT
ahs-8094	110	52	annealing	annealing	NOUN
ahs-8094	110	53	,	,	PUNCT
ahs-8094	110	54	and	and	CCONJ
ahs-8094	110	55	extension	extension	NOUN
ahs-8094	110	56	,	,	PUNCT
ahs-8094	110	57	respectively	respectively	ADV
ahs-8094	110	58	.	.	PUNCT
ahs-8094	111	1	the	the	DET
ahs-8094	111	2	final	final	ADJ
ahs-8094	111	3	extension	extension	NOUN
ahs-8094	111	4	was	be	AUX
ahs-8094	111	5	at	at	ADP
ahs-8094	111	6	68	68	NUM
ahs-8094	111	7	°	°	NOUN
ahs-8094	111	8	c	c	NOUN
ahs-8094	111	9	for	for	ADP
ahs-8094	111	10	5	5	NUM
ahs-8094	111	11	min	min	NOUN
ahs-8094	111	12	.	.	PUNCT
ahs-8094	112	1	these	these	DET
ahs-8094	112	2	conditions	condition	NOUN
ahs-8094	112	3	were	be	AUX
ahs-8094	112	4	similar	similar	ADJ
ahs-8094	112	5	for	for	ADP
ahs-8094	112	6	the	the	DET
ahs-8094	112	7	three	three	NUM
ahs-8094	112	8	viruses	virus	NOUN
ahs-8094	112	9	.	.	PUNCT
ahs-8094	113	1	the	the	DET
ahs-8094	113	2	pcr	pcr	PROPN
ahs-8094	113	3	products	product	NOUN
ahs-8094	113	4	were	be	AUX
ahs-8094	113	5	separated	separate	VERB
ahs-8094	113	6	by	by	ADP
ahs-8094	113	7	elec­	elec­	ADJ
ahs-8094	113	8	trophoresis	trophoresis	NOUN
ahs-8094	113	9	in	in	ADP
ahs-8094	113	10	1.2	1.2	NUM
ahs-8094	113	11	%	%	NOUN
ahs-8094	113	12	agarose	agarose	NOUN
ahs-8094	113	13	gel	gel	NOUN
ahs-8094	113	14	stained	stain	VERB
ahs-8094	113	15	with	with	ADP
ahs-8094	113	16	ethidi­	ethidi­	PROPN
ahs-8094	113	17	um	um	INTJ
ahs-8094	113	18	bromide	bromide	NOUN
ahs-8094	113	19	at	at	ADP
ahs-8094	113	20	100	100	NUM
ahs-8094	113	21	v	v	NOUN
ahs-8094	113	22	for	for	ADP
ahs-8094	113	23	40	40	NUM
ahs-8094	113	24	min	min	NOUN
ahs-8094	113	25	in	in	ADP
ahs-8094	113	26	1	1	NUM
ahs-8094	113	27	×	×	NOUN
ahs-8094	113	28	tris­acetate­	tris­acetate­	X
ahs-8094	113	29	edta	edta	NOUN
ahs-8094	113	30	(	(	PUNCT
ahs-8094	113	31	tae	tae	NOUN
ahs-8094	113	32	)	)	PUNCT
ahs-8094	113	33	buffer	buffer	NOUN
ahs-8094	113	34	.	.	PUNCT
ahs-8094	114	1	gels	gel	NOUN
ahs-8094	114	2	were	be	AUX
ahs-8094	114	3	visualized	visualize	VERB
ahs-8094	114	4	under	under	ADP
ahs-8094	114	5	uv	uv	NOUN
ahs-8094	114	6	light	light	NOUN
ahs-8094	114	7	.	.	PUNCT
ahs-8094	115	1	assessment	assessment	NOUN
ahs-8094	115	2	of	of	ADP
ahs-8094	115	3	aphid	aphid	NOUN
ahs-8094	115	4	population	population	NOUN
ahs-8094	115	5	.	.	PUNCT
ahs-8094	116	1	monitoring	monitoring	NOUN
ahs-8094	116	2	of	of	ADP
ahs-8094	116	3	aphid	aphid	NOUN
ahs-8094	116	4	populations	population	NOUN
ahs-8094	116	5	was	be	AUX
ahs-8094	116	6	done	do	VERB
ahs-8094	116	7	at	at	ADP
ahs-8094	116	8	a	a	DET
ahs-8094	116	9	14­days	14­days	NUM
ahs-8094	116	10	interval	interval	NOUN
ahs-8094	116	11	starting	start	VERB
ahs-8094	116	12	from	from	ADP
ahs-8094	116	13	2nd	2nd	ADJ
ahs-8094	116	14	to	to	ADP
ahs-8094	116	15	12th	12th	PROPN
ahs-8094	116	16	wap	wap	PROPN
ahs-8094	116	17	.	.	PUNCT
ahs-8094	117	1	un­winged	un­winged	PROPN
ahs-8094	117	2	aphids	aphid	NOUN
ahs-8094	117	3	were	be	AUX
ahs-8094	117	4	monitored	monitor	VERB
ahs-8094	117	5	on	on	ADP
ahs-8094	117	6	four	four	NUM
ahs-8094	117	7	plants	plant	NOUN
ahs-8094	117	8	that	that	PRON
ahs-8094	117	9	were	be	AUX
ahs-8094	117	10	randomly	randomly	ADV
ahs-8094	117	11	selected	select	VERB
ahs-8094	117	12	from	from	ADP
ahs-8094	117	13	the	the	DET
ahs-8094	117	14	center	center	NOUN
ahs-8094	117	15	of	of	ADP
ahs-8094	117	16	each	each	DET
ahs-8094	117	17	plot	plot	NOUN
ahs-8094	117	18	.	.	PUNCT
ahs-8094	118	1	observations	observation	NOUN
ahs-8094	118	2	were	be	AUX
ahs-8094	118	3	carried	carry	VERB
ahs-8094	118	4	out	out	ADP
ahs-8094	118	5	on	on	ADP
ahs-8094	118	6	six	six	NUM
ahs-8094	118	7	leaves	leave	NOUN
ahs-8094	118	8	(	(	PUNCT
ahs-8094	118	9	2	2	NUM
ahs-8094	118	10	upper	upper	ADJ
ahs-8094	118	11	,	,	PUNCT
ahs-8094	118	12	2	2	NUM
ahs-8094	118	13	middle	middle	ADJ
ahs-8094	118	14	and	and	CCONJ
ahs-8094	118	15	2	2	NUM
ahs-8094	118	16	lower	low	ADJ
ahs-8094	118	17	leaves	leave	NOUN
ahs-8094	118	18	)	)	PUNCT
ahs-8094	118	19	per	per	ADP
ahs-8094	118	20	plant	plant	NOUN
ahs-8094	118	21	.	.	PUNCT
ahs-8094	119	1	a	a	DET
ahs-8094	119	2	small	small	ADJ
ahs-8094	119	3	camel­brush	camel­brush	NOUN
ahs-8094	119	4	was	be	AUX
ahs-8094	119	5	used	use	VERB
ahs-8094	119	6	to	to	PART
ahs-8094	119	7	dislodge	dislodge	VERB
ahs-8094	119	8	and	and	CCONJ
ahs-8094	119	9	collect	collect	VERB
ahs-8094	119	10	aphids	aphid	NOUN
ahs-8094	119	11	present	present	ADJ
ahs-8094	119	12	into	into	ADP
ahs-8094	119	13	small­plastic	small­plastic	ADJ
ahs-8094	119	14	bottles	bottle	NOUN
ahs-8094	119	15	containing	contain	VERB
ahs-8094	119	16	70	70	NUM
ahs-8094	119	17	%	%	NOUN
ahs-8094	119	18	ethanol	ethanol	NOUN
ahs-8094	119	19	and	and	CCONJ
ahs-8094	119	20	transported	transport	VERB
ahs-8094	119	21	to	to	ADP
ahs-8094	119	22	the	the	DET
ahs-8094	119	23	phytopathology	phytopathology	NOUN
ahs-8094	119	24	laboratory	laboratory	NOUN
ahs-8094	119	25	of	of	ADP
ahs-8094	119	26	rab	rab	PROPN
ahs-8094	119	27	at	at	ADP
ahs-8094	119	28	rubona	rubona	PROPN
ahs-8094	119	29	for	for	ADP
ahs-8094	119	30	identification	identification	NOUN
ahs-8094	119	31	and	and	CCONJ
ahs-8094	119	32	counting	counting	NOUN
ahs-8094	119	33	.	.	PUNCT
ahs-8094	120	1	winged	wing	VERB
ahs-8094	120	2	aphids	aphid	NOUN
ahs-8094	120	3	were	be	AUX
ahs-8094	120	4	captured	capture	VERB
ahs-8094	120	5	using	use	VERB
ahs-8094	120	6	yellow	yellow	ADJ
ahs-8094	120	7	water	water	NOUN
ahs-8094	120	8	traps	trap	NOUN
ahs-8094	120	9	(	(	PUNCT
ahs-8094	120	10	ywt	ywt	NOUN
ahs-8094	120	11	)	)	PUNCT
ahs-8094	120	12	made	make	VERB
ahs-8094	120	13	from	from	ADP
ahs-8094	120	14	yellow	yellow	ADJ
ahs-8094	120	15	plastic	plastic	NOUN
ahs-8094	120	16	containers	container	NOUN
ahs-8094	120	17	that	that	PRON
ahs-8094	120	18	were	be	AUX
ahs-8094	120	19	placed	place	VERB
ahs-8094	120	20	in	in	ADP
ahs-8094	120	21	the	the	DET
ahs-8094	120	22	middle	middle	NOUN
ahs-8094	120	23	of	of	ADP
ahs-8094	120	24	each	each	DET
ahs-8094	120	25	plot	plot	NOUN
ahs-8094	120	26	and	and	CCONJ
ahs-8094	120	27	filled	fill	VERB
ahs-8094	120	28	with	with	ADP
ahs-8094	120	29	1.5	1.5	NUM
ahs-8094	120	30	litre	litre	NOUN
ahs-8094	120	31	of	of	ADP
ahs-8094	120	32	tap	tap	NOUN
ahs-8094	120	33	water	water	NOUN
ahs-8094	120	34	(	(	PUNCT
ahs-8094	120	35	blackman	blackman	NOUN
ahs-8094	120	36	and	and	CCONJ
ahs-8094	120	37	eastop	eastop	ADJ
ahs-8094	120	38	,	,	PUNCT
ahs-8094	120	39	2000	2000	NUM
ahs-8094	120	40	)	)	PUNCT
ahs-8094	120	41	.	.	PUNCT
ahs-8094	121	1	five	five	NUM
ahs-8094	121	2	millilitre	millilitre	NOUN
ahs-8094	121	3	of	of	ADP
ahs-8094	121	4	formaldehyde	formaldehyde	NOUN
ahs-8094	121	5	(	(	PUNCT
ahs-8094	121	6	10	10	NUM
ahs-8094	121	7	%	%	NOUN
ahs-8094	121	8	)	)	PUNCT
ahs-8094	121	9	was	be	AUX
ahs-8094	121	10	added	add	VERB
ahs-8094	121	11	per	per	ADP
ahs-8094	121	12	trap	trap	NOUN
ahs-8094	121	13	to	to	PART
ahs-8094	121	14	preserve	preserve	VERB
ahs-8094	121	15	the	the	DET
ahs-8094	121	16	insect	insect	NOUN
ahs-8094	121	17	.	.	PUNCT
ahs-8094	122	1	the	the	DET
ahs-8094	122	2	collected	collect	VERB
ahs-8094	122	3	aphids	aphid	NOUN
ahs-8094	122	4	were	be	AUX
ahs-8094	122	5	counted	count	VERB
ahs-8094	122	6	and	and	CCONJ
ahs-8094	122	7	identified	identify	VERB
ahs-8094	122	8	to	to	ADP
ahs-8094	122	9	species	specie	NOUN
ahs-8094	122	10	level	level	NOUN
ahs-8094	122	11	using	use	VERB
ahs-8094	122	12	existing	exist	VERB
ahs-8094	122	13	entomological	entomological	ADJ
ahs-8094	122	14	keys	key	NOUN
ahs-8094	122	15	and	and	CCONJ
ahs-8094	122	16	stereomicroscope	stereomicroscope	NOUN
ahs-8094	122	17	based	base	VERB
ahs-8094	122	18	on	on	ADP
ahs-8094	122	19	their	their	PRON
ahs-8094	122	20	morphological	morphological	ADJ
ahs-8094	122	21	features	feature	NOUN
ahs-8094	122	22	as	as	SCONJ
ahs-8094	122	23	described	describe	VERB
ahs-8094	122	24	by	by	ADP
ahs-8094	122	25	martin	martin	PROPN
ahs-8094	122	26	(	(	PUNCT
ahs-8094	122	27	1983	1983	NUM
ahs-8094	122	28	)	)	PUNCT
ahs-8094	122	29	and	and	CCONJ
ahs-8094	122	30	blackman	blackman	NOUN
ahs-8094	122	31	and	and	CCONJ
ahs-8094	122	32	eastop	eastop	ADJ
ahs-8094	122	33	(	(	PUNCT
ahs-8094	122	34	2000	2000	NUM
ahs-8094	122	35	)	)	PUNCT
ahs-8094	122	36	.	.	PUNCT
ahs-8094	123	1	reaction	reaction	NOUN
ahs-8094	123	2	of	of	ADP
ahs-8094	123	3	hot	hot	ADJ
ahs-8094	123	4	pepper	pepper	NOUN
ahs-8094	123	5	genotypes	genotype	NOUN
ahs-8094	123	6	to	to	PART
ahs-8094	123	7	cucumber	cucumber	PROPN
ahs-8094	123	8	mosa‐	mosa‐	NOUN
ahs-8094	123	9	ic	ic	PROPN
ahs-8094	123	10	virus	virus	PROPN
ahs-8094	123	11	under	under	ADP
ahs-8094	123	12	controlled	control	VERB
ahs-8094	123	13	conditions	condition	NOUN
ahs-8094	123	14	genotypes	genotype	NOUN
ahs-8094	123	15	tested	test	VERB
ahs-8094	123	16	fourteen	fourteen	NUM
ahs-8094	123	17	hot	hot	ADJ
ahs-8094	123	18	pepper	pepper	NOUN
ahs-8094	123	19	genotypes	genotype	NOUN
ahs-8094	123	20	selected	select	VERB
ahs-8094	123	21	from	from	ADP
ahs-8094	123	22	the	the	DET
ahs-8094	123	23	field	field	NOUN
ahs-8094	123	24	trials	trial	NOUN
ahs-8094	123	25	were	be	AUX
ahs-8094	123	26	evaluated	evaluate	VERB
ahs-8094	123	27	for	for	ADP
ahs-8094	123	28	resistance	resistance	NOUN
ahs-8094	123	29	to	to	ADP
ahs-8094	123	30	cmv	cmv	NOUN
ahs-8094	123	31	in	in	ADP
ahs-8094	123	32	the	the	DET
ahs-8094	123	33	screenhouse	screenhouse	NOUN
ahs-8094	123	34	.	.	PUNCT
ahs-8094	124	1	the	the	DET
ahs-8094	124	2	experiment	experiment	NOUN
ahs-8094	124	3	was	be	AUX
ahs-8094	124	4	carried	carry	VERB
ahs-8094	124	5	out	out	ADP
ahs-8094	124	6	to	to	PART
ahs-8094	124	7	validate	validate	VERB
ahs-8094	124	8	the	the	DET
ahs-8094	124	9	genotypes	genotype	NOUN
ahs-8094	124	10	resistance	resistance	NOUN
ahs-8094	124	11	to	to	ADP
ahs-8094	124	12	virus	virus	NOUN
ahs-8094	124	13	infection	infection	NOUN
ahs-8094	124	14	under	under	ADP
ahs-8094	124	15	controlled	control	VERB
ahs-8094	124	16	conditions	condition	NOUN
ahs-8094	124	17	.	.	PUNCT
ahs-8094	125	1	the	the	DET
ahs-8094	125	2	genotypes	genotype	NOUN
ahs-8094	125	3	tested	test	VERB
ahs-8094	125	4	included	include	VERB
ahs-8094	125	5	;	;	PUNCT
ahs-8094	125	6	seven	seven	NUM
ahs-8094	125	7	local	local	ADJ
ahs-8094	125	8	collections	collection	NOUN
ahs-8094	125	9	(	(	PUNCT
ahs-8094	125	10	00765ppr	00765ppr	NOUN
ahs-8094	125	11	,	,	PUNCT
ahs-8094	125	12	00767ppr	00767ppr	NOUN
ahs-8094	125	13	,	,	PUNCT
ahs-8094	125	14	00774ppr	00774ppr	NOUN
ahs-8094	125	15	,	,	PUNCT
ahs-8094	125	16	00786ppr	00786ppr	NOUN
ahs-8094	125	17	,	,	PUNCT
ahs-8094	125	18	000792ppr	000792ppr	NOUN
ahs-8094	125	19	,	,	PUNCT
ahs-8094	125	20	00795ppr	00795ppr	NOUN
ahs-8094	125	21	and	and	CCONJ
ahs-8094	125	22	00802ppr	00802ppr	NOUN
ahs-8094	125	23	)	)	PUNCT
ahs-8094	125	24	,	,	PUNCT
ahs-8094	125	25	five	five	NUM
ahs-8094	125	26	introduced	introduce	VERB
ahs-8094	125	27	lines	line	NOUN
ahs-8094	125	28	(	(	PUNCT
ahs-8094	125	29	pbc	pbc	PROPN
ahs-8094	125	30	462	462	NUM
ahs-8094	125	31	,	,	PUNCT
ahs-8094	125	32	pp9950­5197	pp9950­5197	PROPN
ahs-8094	125	33	,	,	PUNCT
ahs-8094	125	34	hp0117	hp0117	PROPN
ahs-8094	125	35	,	,	PUNCT
ahs-8094	125	36	pp9852­170	pp9852­170	NOUN
ahs-8094	125	37	and	and	CCONJ
ahs-8094	125	38	icpn	icpn	PROPN
ahs-8094	125	39	18­7	18­7	NUM
ahs-8094	125	40	)	)	PUNCT
ahs-8094	125	41	and	and	CCONJ
ahs-8094	125	42	two	two	NUM
ahs-8094	125	43	commercial	commercial	ADJ
ahs-8094	125	44	varieties	variety	NOUN
ahs-8094	125	45	(	(	PUNCT
ahs-8094	125	46	long	long	ADJ
ahs-8094	125	47	red	red	ADJ
ahs-8094	125	48	cayenne	cayenne	NOUN
ahs-8094	125	49	and	and	CCONJ
ahs-8094	125	50	red	red	ADJ
ahs-8094	125	51	scotch	scotch	NOUN
ahs-8094	125	52	bonnet	bonnet	NOUN
ahs-8094	125	53	)	)	PUNCT
ahs-8094	125	54	as	as	SCONJ
ahs-8094	125	55	indicated	indicate	VERB
ahs-8094	125	56	in	in	ADP
ahs-8094	125	57	table	table	NOUN
ahs-8094	125	58	1	1	NUM
ahs-8094	125	59	.	.	PUNCT
ahs-8094	125	60	inoculation	inoculation	NOUN
ahs-8094	125	61	of	of	ADP
ahs-8094	125	62	cmv	cmv	ADJ
ahs-8094	125	63	fifty	fifty	NUM
ahs-8094	125	64	seedlings	seedling	NOUN
ahs-8094	125	65	of	of	ADP
ahs-8094	125	66	each	each	DET
ahs-8094	125	67	genotype	genotype	NOUN
ahs-8094	125	68	were	be	AUX
ahs-8094	125	69	raised	raise	VERB
ahs-8094	125	70	in	in	ADP
ahs-8094	125	71	the	the	DET
ahs-8094	125	72	screenhouse	screenhouse	NOUN
ahs-8094	125	73	.	.	PUNCT
ahs-8094	126	1	before	before	ADP
ahs-8094	126	2	inoculation	inoculation	NOUN
ahs-8094	126	3	,	,	PUNCT
ahs-8094	126	4	the	the	DET
ahs-8094	126	5	seedlings	seedling	NOUN
ahs-8094	126	6	were	be	AUX
ahs-8094	126	7	confirmed	confirm	VERB
ahs-8094	126	8	to	to	PART
ahs-8094	126	9	be	be	AUX
ahs-8094	126	10	free	free	ADJ
ahs-8094	126	11	of	of	ADP
ahs-8094	126	12	viruses	virus	NOUN
ahs-8094	126	13	using	use	VERB
ahs-8094	126	14	das­elisa	das­elisa	NOUN
ahs-8094	126	15	as	as	SCONJ
ahs-8094	126	16	described	describe	VERB
ahs-8094	126	17	in	in	ADP
ahs-8094	126	18	materials	material	NOUN
ahs-8094	126	19	and	and	CCONJ
ahs-8094	126	20	methods	method	NOUN
ahs-8094	126	21	.	.	PUNCT
ahs-8094	127	1	at	at	ADP
ahs-8094	127	2	the	the	DET
ahs-8094	127	3	5­6	5­6	PROPN
ahs-8094	127	4	leaf	leaf	NOUN
ahs-8094	127	5	stage	stage	NOUN
ahs-8094	127	6	,	,	PUNCT
ahs-8094	127	7	the	the	DET
ahs-8094	127	8	plants	plant	NOUN
ahs-8094	127	9	were	be	AUX
ahs-8094	127	10	mechanically	mechanically	ADV
ahs-8094	127	11	inoculated	inoculate	VERB
ahs-8094	127	12	with	with	ADP
ahs-8094	127	13	a	a	DET
ahs-8094	127	14	local	local	ADJ
ahs-8094	127	15	isolate	isolate	NOUN
ahs-8094	127	16	of	of	ADP
ahs-8094	127	17	cmv	cmv	NOUN
ahs-8094	127	18	.	.	PUNCT
ahs-8094	128	1	the	the	DET
ahs-8094	128	2	virus	virus	NOUN
ahs-8094	128	3	was	be	AUX
ahs-8094	128	4	propagated	propagate	VERB
ahs-8094	128	5	and	and	CCONJ
ahs-8094	128	6	maintained	maintain	VERB
ahs-8094	128	7	in	in	ADP
ahs-8094	128	8	a	a	DET
ahs-8094	128	9	hot	hot	ADJ
ahs-8094	128	10	pepper	pepper	NOUN
ahs-8094	128	11	cultivar	cultivar	NOUN
ahs-8094	128	12	scotch	scotch	NOUN
ahs-8094	128	13	bon­	bon­	NOUN
ahs-8094	128	14	net	net	NOUN
ahs-8094	128	15	in	in	ADP
ahs-8094	128	16	the	the	DET
ahs-8094	128	17	screenhouse	screenhouse	NOUN
ahs-8094	128	18	.	.	PUNCT
ahs-8094	129	1	infected	infected	ADJ
ahs-8094	129	2	leaves	leave	NOUN
ahs-8094	129	3	were	be	AUX
ahs-8094	129	4	harvest­	harvest­	PROPN
ahs-8094	129	5	ed	ed	NOUN
ahs-8094	129	6	and	and	CCONJ
ahs-8094	129	7	homogenized	homogenize	VERB
ahs-8094	129	8	(	(	PUNCT
ahs-8094	129	9	1	1	NUM
ahs-8094	129	10	:	:	SYM
ahs-8094	129	11	10	10	NUM
ahs-8094	129	12	w	w	PROPN
ahs-8094	129	13	/	/	SYM
ahs-8094	129	14	v	v	NOUN
ahs-8094	129	15	)	)	PUNCT
ahs-8094	129	16	in	in	ADP
ahs-8094	129	17	0.1	0.1	NUM
ahs-8094	129	18	m	m	NOUN
ahs-8094	129	19	phosphate	phosphate	NOUN
ahs-8094	129	20	buffer	buffer	NOUN
ahs-8094	129	21	(	(	PUNCT
ahs-8094	129	22	ph7.0	ph7.0	X
ahs-8094	129	23	)	)	PUNCT
ahs-8094	129	24	containing	contain	VERB
ahs-8094	129	25	0.01	0.01	NUM
ahs-8094	129	26	%	%	NOUN
ahs-8094	129	27	of	of	ADP
ahs-8094	129	28	sodium	sodium	NOUN
ahs-8094	129	29	sulfite	sulfite	NOUN
ahs-8094	129	30	.	.	PUNCT
ahs-8094	130	1	the	the	DET
ahs-8094	130	2	sap	sap	PROPN
ahs-8094	130	3	was	be	AUX
ahs-8094	130	4	sieved	sieve	VERB
ahs-8094	130	5	to	to	PART
ahs-8094	130	6	remove	remove	VERB
ahs-8094	130	7	plant	plant	NOUN
ahs-8094	130	8	debris	debris	NOUN
ahs-8094	130	9	and	and	CCONJ
ahs-8094	130	10	0.06	0.06	NUM
ahs-8094	130	11	%	%	NOUN
ahs-8094	130	12	of	of	ADP
ahs-8094	130	13	silicon	silicon	NOUN
ahs-8094	130	14	carbide	carbide	NOUN
ahs-8094	130	15	was	be	AUX
ahs-8094	130	16	added	add	VERB
ahs-8094	130	17	to	to	PART
ahs-8094	130	18	enhance	enhance	VERB
ahs-8094	130	19	injury	injury	NOUN
ahs-8094	130	20	and	and	CCONJ
ahs-8094	130	21	increase	increase	VERB
ahs-8094	130	22	points	point	NOUN
ahs-8094	130	23	of	of	ADP
ahs-8094	130	24	entry	entry	NOUN
ahs-8094	130	25	of	of	ADP
ahs-8094	130	26	the	the	DET
ahs-8094	130	27	virus	virus	NOUN
ahs-8094	130	28	.	.	PUNCT
ahs-8094	131	1	two	two	NUM
ahs-8094	131	2	leaves	leave	NOUN
ahs-8094	131	3	per	per	ADP
ahs-8094	131	4	test	test	NOUN
ahs-8094	131	5	plant	plant	NOUN
ahs-8094	131	6	were	be	AUX
ahs-8094	131	7	rub­inoculated	rub­inoculate	VERB
ahs-8094	131	8	with	with	ADP
ahs-8094	131	9	sap	sap	PROPN
ahs-8094	131	10	extract	extract	NOUN
ahs-8094	131	11	as	as	SCONJ
ahs-8094	131	12	described	describe	VERB
ahs-8094	131	13	by	by	ADP
ahs-8094	131	14	noordam	noordam	NOUN
ahs-8094	131	15	(	(	PUNCT
ahs-8094	131	16	1973	1973	NUM
ahs-8094	131	17	)	)	PUNCT
ahs-8094	131	18	.	.	PUNCT
ahs-8094	132	1	after	after	ADP
ahs-8094	132	2	5	5	NUM
ahs-8094	132	3	mins	min	NOUN
ahs-8094	132	4	the	the	DET
ahs-8094	132	5	inoc­	inoc­	PROPN
ahs-8094	132	6	ulated	ulated	ADJ
ahs-8094	132	7	plants	plant	NOUN
ahs-8094	132	8	were	be	AUX
ahs-8094	132	9	rinsed	rinse	VERB
ahs-8094	132	10	with	with	ADP
ahs-8094	132	11	distilled	distil	VERB
ahs-8094	132	12	water	water	NOUN
ahs-8094	132	13	to	to	PART
ahs-8094	132	14	remove	remove	VERB
ahs-8094	132	15	the	the	DET
ahs-8094	132	16	excess	excess	NOUN
ahs-8094	132	17	of	of	ADP
ahs-8094	132	18	the	the	DET
ahs-8094	132	19	inoculum	inoculum	NOUN
ahs-8094	132	20	.	.	PUNCT
ahs-8094	133	1	inoculated	inoculate	VERB
ahs-8094	133	2	plants	plant	NOUN
ahs-8094	133	3	were	be	AUX
ahs-8094	133	4	maintained	maintain	VERB
ahs-8094	133	5	in	in	ADP
ahs-8094	133	6	an	an	DET
ahs-8094	133	7	insect	insect	NOUN
ahs-8094	133	8	free	free	ADJ
ahs-8094	133	9	screenhouse	screenhouse	NOUN
ahs-8094	133	10	(	(	PUNCT
ahs-8094	133	11	aver­	aver­	PROPN
ahs-8094	133	12	age	age	NOUN
ahs-8094	133	13	27.8	27.8	NUM
ahs-8094	133	14	°	°	NOUN
ahs-8094	133	15	c	c	NOUN
ahs-8094	133	16	temp	temp	NOUN
ahs-8094	133	17	,	,	PUNCT
ahs-8094	133	18	70.8	70.8	NUM
ahs-8094	133	19	%	%	NOUN
ahs-8094	133	20	relative	relative	ADJ
ahs-8094	133	21	humidity	humidity	NOUN
ahs-8094	133	22	)	)	PUNCT
ahs-8094	133	23	.	.	PUNCT
ahs-8094	134	1	in	in	ADP
ahs-8094	134	2	total	total	ADJ
ahs-8094	134	3	,	,	PUNCT
ahs-8094	134	4	forty­eight	forty­eight	NOUN
ahs-8094	134	5	plants	plant	NOUN
ahs-8094	134	6	of	of	ADP
ahs-8094	134	7	each	each	DET
ahs-8094	134	8	genotype	genotype	NOUN
ahs-8094	134	9	were	be	AUX
ahs-8094	134	10	mechanical­	mechanical­	PRON
ahs-8094	134	11	ly	ly	AUX
ahs-8094	134	12	inoculated	inoculate	VERB
ahs-8094	134	13	with	with	ADP
ahs-8094	134	14	cmv	cmv	NOUN
ahs-8094	134	15	.	.	PUNCT
ahs-8094	135	1	ten	ten	NUM
ahs-8094	135	2	healthy	healthy	ADJ
ahs-8094	135	3	plants	plant	NOUN
ahs-8094	135	4	of	of	ADP
ahs-8094	135	5	each	each	DET
ahs-8094	135	6	genotype	genotype	NOUN
ahs-8094	135	7	inoculated	inoculate	VERB
ahs-8094	135	8	with	with	ADP
ahs-8094	135	9	phosphate	phosphate	ADJ
ahs-8094	135	10	buffer	buffer	NOUN
ahs-8094	135	11	alone	alone	ADV
ahs-8094	135	12	(	(	PUNCT
ahs-8094	135	13	with	with	ADP
ahs-8094	135	14	no	no	DET
ahs-8094	135	15	inoculum	inoculum	NOUN
ahs-8094	135	16	)	)	PUNCT
ahs-8094	135	17	were	be	AUX
ahs-8094	135	18	maintained	maintain	VERB
ahs-8094	135	19	as	as	ADP
ahs-8094	135	20	control	control	NOUN
ahs-8094	135	21	.	.	PUNCT
ahs-8094	136	1	the	the	DET
ahs-8094	136	2	symptoms	symptom	NOUN
ahs-8094	136	3	development	development	VERB
ahs-8094	136	4	on	on	ADP
ahs-8094	136	5	inoculated	inoculate	VERB
ahs-8094	136	6	plants	plant	NOUN
ahs-8094	136	7	were	be	AUX
ahs-8094	136	8	recorded	record	VERB
ahs-8094	136	9	up	up	ADP
ahs-8094	136	10	to	to	PART
ahs-8094	136	11	3	3	NUM
ahs-8094	136	12	weeks	week	NOUN
ahs-8094	136	13	’	'	PUNCT
ahs-8094	136	14	post­inoculation	post­inoculation	NOUN
ahs-8094	136	15	.	.	PUNCT
ahs-8094	137	1	at	at	ADP
ahs-8094	137	2	this	this	DET
ahs-8094	137	3	time	time	NOUN
ahs-8094	137	4	all	all	DET
ahs-8094	137	5	the	the	DET
ahs-8094	137	6	plants	plant	NOUN
ahs-8094	137	7	from	from	ADP
ahs-8094	137	8	the	the	DET
ahs-8094	137	9	susceptible	susceptible	ADJ
ahs-8094	137	10	local	local	ADJ
ahs-8094	137	11	check	check	NOUN
ahs-8094	137	12	showed	show	VERB
ahs-8094	137	13	typical	typical	ADJ
ahs-8094	137	14	symptoms	symptom	NOUN
ahs-8094	137	15	of	of	ADP
ahs-8094	137	16	cmv	cmv	NOUN
ahs-8094	137	17	.	.	PUNCT
ahs-8094	138	1	the	the	DET
ahs-8094	138	2	incidence	incidence	NOUN
ahs-8094	138	3	and	and	CCONJ
ahs-8094	138	4	symptoms	symptom	NOUN
ahs-8094	138	5	severity	severity	NOUN
ahs-8094	138	6	of	of	ADP
ahs-8094	138	7	cmv	cmv	NOUN
ahs-8094	138	8	were	be	AUX
ahs-8094	138	9	evaluated	evaluate	VERB
ahs-8094	138	10	on	on	ADP
ahs-8094	138	11	all	all	DET
ahs-8094	138	12	plants	plant	NOUN
ahs-8094	138	13	as	as	SCONJ
ahs-8094	138	14	described	describe	VERB
ahs-8094	138	15	in	in	ADP
ahs-8094	138	16	materials	material	NOUN
ahs-8094	138	17	and	and	CCONJ
ahs-8094	138	18	methods	method	NOUN
ahs-8094	138	19	.	.	PUNCT
ahs-8094	139	1	detection	detection	NOUN
ahs-8094	139	2	of	of	ADP
ahs-8094	139	3	cmv	cmv	NOUN
ahs-8094	139	4	the	the	DET
ahs-8094	139	5	confirmation	confirmation	NOUN
ahs-8094	139	6	of	of	ADP
ahs-8094	139	7	cmv	cmv	ADJ
ahs-8094	139	8	infection	infection	NOUN
ahs-8094	139	9	was	be	AUX
ahs-8094	139	10	performed	perform	VERB
ahs-8094	139	11	using	use	VERB
ahs-8094	139	12	das­elisa	das­elisa	NOUN
ahs-8094	139	13	following	follow	VERB
ahs-8094	139	14	the	the	DET
ahs-8094	139	15	procedures	procedure	NOUN
ahs-8094	139	16	described	describe	VERB
ahs-8094	139	17	by	by	ADP
ahs-8094	139	18	clark	clark	PROPN
ahs-8094	139	19	and	and	CCONJ
ahs-8094	139	20	adam	adam	PROPN
ahs-8094	139	21	(	(	PUNCT
ahs-8094	139	22	1977	1977	NUM
ahs-8094	139	23	)	)	PUNCT
ahs-8094	139	24	on	on	ADP
ahs-8094	139	25	representative	representative	ADJ
ahs-8094	139	26	samples	sample	NOUN
ahs-8094	139	27	from	from	ADP
ahs-8094	139	28	each	each	DET
ahs-8094	139	29	hot	hot	ADJ
ahs-8094	139	30	pepper	pepper	NOUN
ahs-8094	139	31	genotypes	genotype	NOUN
ahs-8094	139	32	.	.	PUNCT
ahs-8094	140	1	the	the	DET
ahs-8094	140	2	kits	kit	NOUN
ahs-8094	140	3	were	be	AUX
ahs-8094	140	4	obtained	obtain	VERB
ahs-8094	140	5	from	from	ADP
ahs-8094	140	6	deutsche	deutsche	PROPN
ahs-8094	140	7	sammlung	sammlung	PROPN
ahs-8094	140	8	von	von	PROPN
ahs-8094	140	9	mikro­	mikro­	PROPN
ahs-8094	140	10	organismen	organisman	NOUN
ahs-8094	140	11	und	und	VERB
ahs-8094	140	12	zellkulturen	zellkulturen	PROPN
ahs-8094	140	13	(	(	PUNCT
ahs-8094	140	14	dsmz	dsmz	PROPN
ahs-8094	140	15	,	,	PUNCT
ahs-8094	140	16	germany	germany	PROPN
ahs-8094	140	17	)	)	PUNCT
ahs-8094	140	18	and	and	CCONJ
ahs-8094	140	19	used	use	VERB
ahs-8094	140	20	according	accord	VERB
ahs-8094	140	21	to	to	ADP
ahs-8094	140	22	instructions	instruction	NOUN
ahs-8094	140	23	from	from	ADP
ahs-8094	140	24	the	the	DET
ahs-8094	140	25	manufactur­	manufactur­	ADJ
ahs-8094	140	26	er	er	INTJ
ahs-8094	140	27	.	.	PUNCT
ahs-8094	141	1	a	a	DET
ahs-8094	141	2	healthy	healthy	ADJ
ahs-8094	141	3	sample	sample	NOUN
ahs-8094	141	4	and	and	CCONJ
ahs-8094	141	5	extraction	extraction	NOUN
ahs-8094	141	6	buffer	buffer	NOUN
ahs-8094	141	7	were	be	AUX
ahs-8094	141	8	used	use	VERB
ahs-8094	141	9	as	as	ADP
ahs-8094	141	10	negative	negative	ADJ
ahs-8094	141	11	controls	control	NOUN
ahs-8094	141	12	.	.	PUNCT
ahs-8094	142	1	a	a	DET
ahs-8094	142	2	positive	positive	ADJ
ahs-8094	142	3	control	control	NOUN
ahs-8094	142	4	was	be	AUX
ahs-8094	142	5	provided	provide	VERB
ahs-8094	142	6	with	with	ADP
ahs-8094	142	7	the	the	DET
ahs-8094	142	8	kit	kit	NOUN
ahs-8094	142	9	.	.	PUNCT
ahs-8094	143	1	absorbance	absorbance	NOUN
ahs-8094	143	2	values	value	NOUN
ahs-8094	143	3	were	be	AUX
ahs-8094	143	4	read	read	VERB
ahs-8094	143	5	at	at	ADP
ahs-8094	143	6	405	405	NUM
ahs-8094	143	7	nm	nm	NOUN
ahs-8094	143	8	using	use	VERB
ahs-8094	143	9	a	a	DET
ahs-8094	143	10	microplate	microplate	NOUN
ahs-8094	143	11	reader	reader	NOUN
ahs-8094	143	12	(	(	PUNCT
ahs-8094	143	13	biotek	biotek	PROPN
ahs-8094	143	14	elx800	elx800	PROPN
ahs-8094	143	15	,	,	PUNCT
ahs-8094	143	16	usa	usa	PROPN
ahs-8094	143	17	)	)	PUNCT
ahs-8094	143	18	.	.	PUNCT
ahs-8094	144	1	due	due	ADP
ahs-8094	144	2	to	to	ADP
ahs-8094	144	3	a	a	DET
ahs-8094	144	4	large	large	ADJ
ahs-8094	144	5	number	number	NOUN
ahs-8094	144	6	of	of	ADP
ahs-8094	144	7	plants	plant	NOUN
ahs-8094	144	8	,	,	PUNCT
ahs-8094	144	9	only	only	ADV
ahs-8094	144	10	representative	representative	ADJ
ahs-8094	144	11	sam­	sam­	NOUN
ahs-8094	144	12	ples	ple	NOUN
ahs-8094	144	13	(	(	PUNCT
ahs-8094	144	14	7	7	X
ahs-8094	144	15	)	)	PUNCT
ahs-8094	144	16	were	be	AUX
ahs-8094	144	17	collected	collect	VERB
ahs-8094	144	18	from	from	ADP
ahs-8094	144	19	each	each	DET
ahs-8094	144	20	genotype	genotype	NOUN
ahs-8094	144	21	and	and	CCONJ
ahs-8094	144	22	anal­	anal­	PRON
ahs-8094	144	23	ysed	yse	VERB
ahs-8094	144	24	.	.	PUNCT
ahs-8094	145	1	a	a	DET
ahs-8094	145	2	sample	sample	NOUN
ahs-8094	145	3	was	be	AUX
ahs-8094	145	4	considered	consider	VERB
ahs-8094	145	5	positive	positive	ADJ
ahs-8094	145	6	when	when	SCONJ
ahs-8094	145	7	the	the	DET
ahs-8094	145	8	absorbance	absorbance	NOUN
ahs-8094	145	9	value	value	NOUN
ahs-8094	145	10	at	at	ADP
ahs-8094	145	11	405	405	NUM
ahs-8094	145	12	nm	nm	NOUN
ahs-8094	145	13	(	(	PUNCT
ahs-8094	145	14	a405	a405	PROPN
ahs-8094	145	15	)	)	PUNCT
ahs-8094	145	16	exceeded	exceed	VERB
ahs-8094	145	17	the	the	DET
ahs-8094	145	18	mean	mean	NOUN
ahs-8094	145	19	of	of	ADP
ahs-8094	145	20	negative	negative	ADJ
ahs-8094	145	21	controls	control	NOUN
ahs-8094	145	22	by	by	ADP
ahs-8094	145	23	a	a	DET
ahs-8094	145	24	factor	factor	NOUN
ahs-8094	145	25	of	of	ADP
ahs-8094	145	26	two	two	NUM
ahs-8094	145	27	.	.	PUNCT
ahs-8094	146	1	classification	classification	NOUN
ahs-8094	146	2	of	of	ADP
ahs-8094	146	3	the	the	DET
ahs-8094	146	4	hot	hot	ADJ
ahs-8094	146	5	pepper	pepper	NOUN
ahs-8094	146	6	genotypes	genotype	NOUN
ahs-8094	146	7	for	for	ADP
ahs-8094	146	8	resis‐	resis‐	NOUN
ahs-8094	146	9	tance	tance	NOUN
ahs-8094	146	10	to	to	ADP
ahs-8094	146	11	viral	viral	ADJ
ahs-8094	146	12	diseases	disease	NOUN
ahs-8094	146	13	the	the	DET
ahs-8094	146	14	rating	rating	NOUN
ahs-8094	146	15	of	of	ADP
ahs-8094	146	16	the	the	DET
ahs-8094	146	17	genotypes	genotype	NOUN
ahs-8094	146	18	was	be	AUX
ahs-8094	146	19	done	do	VERB
ahs-8094	146	20	as	as	SCONJ
ahs-8094	146	21	described	describe	VERB
ahs-8094	146	22	by	by	ADP
ahs-8094	146	23	rahman	rahman	PROPN
ahs-8094	146	24	et	et	PROPN
ahs-8094	146	25	al	al	PROPN
ahs-8094	146	26	.	.	PROPN
ahs-8094	147	1	(	(	PUNCT
ahs-8094	147	2	2016	2016	NUM
ahs-8094	147	3	)	)	PUNCT
ahs-8094	147	4	.	.	PUNCT
ahs-8094	148	1	based	base	VERB
ahs-8094	148	2	on	on	ADP
ahs-8094	148	3	disease	disease	NOUN
ahs-8094	148	4	incidence	incidence	NOUN
ahs-8094	148	5	and	and	CCONJ
ahs-8094	148	6	severity	severity	NOUN
ahs-8094	148	7	indices	index	NOUN
ahs-8094	148	8	for	for	ADP
ahs-8094	148	9	both	both	DET
ahs-8094	148	10	field	field	NOUN
ahs-8094	148	11	and	and	CCONJ
ahs-8094	148	12	402	402	NUM
ahs-8094	148	13	adv	adv	PROPN
ahs-8094	148	14	.	.	PUNCT
ahs-8094	148	15	hort	hort	PROPN
ahs-8094	148	16	.	.	PUNCT
ahs-8094	149	1	sci	sci	PROPN
ahs-8094	149	2	.	.	PROPN
ahs-8094	149	3	,	,	PUNCT
ahs-8094	149	4	2020	2020	NUM
ahs-8094	149	5	34(4	34(4	NUM
ahs-8094	149	6	):	):	PUNCT
ahs-8094	149	7	397­412	397­412	NUM
ahs-8094	149	8	screenhouse	screenhouse	NOUN
ahs-8094	149	9	experiments	experiment	NOUN
ahs-8094	149	10	,	,	PUNCT
ahs-8094	149	11	each	each	DET
ahs-8094	149	12	genotype	genotype	NOUN
ahs-8094	149	13	was	be	AUX
ahs-8094	149	14	allo­	allo­	AUX
ahs-8094	149	15	cated	cat	VERB
ahs-8094	149	16	a	a	DET
ahs-8094	149	17	score	score	NOUN
ahs-8094	149	18	of	of	ADP
ahs-8094	149	19	1	1	NUM
ahs-8094	149	20	to	to	PART
ahs-8094	149	21	4	4	NUM
ahs-8094	149	22	.	.	PUNCT
ahs-8094	149	23	scoring	score	VERB
ahs-8094	149	24	for	for	ADP
ahs-8094	149	25	virus	virus	NOUN
ahs-8094	149	26	incidence	incidence	NOUN
ahs-8094	149	27	was	be	AUX
ahs-8094	149	28	:	:	PUNCT
ahs-8094	149	29	<	<	X
ahs-8094	149	30	20	20	NUM
ahs-8094	149	31	%	%	NOUN
ahs-8094	149	32	=	=	NOUN
ahs-8094	149	33	1	1	NUM
ahs-8094	149	34	,	,	PUNCT
ahs-8094	149	35	21­30%=2	21­30%=2	NOUN
ahs-8094	149	36	,	,	PUNCT
ahs-8094	149	37	31­50%=3	31­50%=3	PROPN
ahs-8094	149	38	and	and	CCONJ
ahs-8094	149	39	>	>	NOUN
ahs-8094	149	40	51%=4	51%=4	NUM
ahs-8094	149	41	.	.	PUNCT
ahs-8094	150	1	whereas	whereas	ADV
ahs-8094	150	2	,	,	PUNCT
ahs-8094	150	3	disease	disease	NOUN
ahs-8094	150	4	severity	severity	NOUN
ahs-8094	150	5	:	:	PUNCT
ahs-8094	150	6	<	<	X
ahs-8094	150	7	1=1	1=1	NUM
ahs-8094	150	8	,	,	PUNCT
ahs-8094	150	9	1.1­2.0=2	1.1­2.0=2	NUM
ahs-8094	150	10	,	,	PUNCT
ahs-8094	150	11	2.1­3.0=3	2.1­3.0=3	NUM
ahs-8094	150	12	and	and	CCONJ
ahs-8094	150	13	>	>	NOUN
ahs-8094	150	14	3.0=4	3.0=4	NUM
ahs-8094	150	15	.	.	PUNCT
ahs-8094	151	1	based	base	VERB
ahs-8094	151	2	on	on	ADP
ahs-8094	151	3	cumulative	cumulative	ADJ
ahs-8094	151	4	scores	score	NOUN
ahs-8094	151	5	i.e.	i.e.	X
ahs-8094	151	6	incidence	incidence	NOUN
ahs-8094	151	7	and	and	CCONJ
ahs-8094	151	8	severity	severity	NOUN
ahs-8094	151	9	indices	index	NOUN
ahs-8094	151	10	,	,	PUNCT
ahs-8094	151	11	the	the	DET
ahs-8094	151	12	genotypes	genotype	NOUN
ahs-8094	151	13	were	be	AUX
ahs-8094	151	14	categorized	categorize	VERB
ahs-8094	151	15	into	into	ADP
ahs-8094	151	16	four	four	NUM
ahs-8094	151	17	groups	group	NOUN
ahs-8094	151	18	:	:	PUNCT
ahs-8094	151	19	<	<	X
ahs-8094	151	20	3=	3=	NUM
ahs-8094	151	21	resistant	resistant	ADJ
ahs-8094	151	22	(	(	PUNCT
ahs-8094	151	23	r	r	NOUN
ahs-8094	151	24	)	)	PUNCT
ahs-8094	151	25	,	,	PUNCT
ahs-8094	151	26	4­6	4­6	NUM
ahs-8094	151	27	=	=	SYM
ahs-8094	151	28	moderately	moderately	ADV
ahs-8094	151	29	resistant	resistant	ADJ
ahs-8094	151	30	(	(	PUNCT
ahs-8094	151	31	mr	mr	PROPN
ahs-8094	151	32	)	)	PUNCT
ahs-8094	151	33	and	and	CCONJ
ahs-8094	151	34	7­8	7­8	NUM
ahs-8094	151	35	=	=	PUNCT
ahs-8094	151	36	susceptible	susceptible	ADJ
ahs-8094	151	37	(	(	PUNCT
ahs-8094	151	38	s	s	NOUN
ahs-8094	151	39	)	)	PUNCT
ahs-8094	151	40	.	.	PUNCT
ahs-8094	152	1	the	the	DET
ahs-8094	152	2	scores	score	NOUN
ahs-8094	152	3	for	for	ADP
ahs-8094	152	4	the	the	DET
ahs-8094	152	5	field	field	NOUN
ahs-8094	152	6	experiments	experiment	NOUN
ahs-8094	152	7	were	be	AUX
ahs-8094	152	8	made	make	VERB
ahs-8094	152	9	on	on	ADP
ahs-8094	152	10	pooled	pooled	ADJ
ahs-8094	152	11	data	datum	NOUN
ahs-8094	152	12	obtained	obtain	VERB
ahs-8094	152	13	from	from	ADP
ahs-8094	152	14	the	the	DET
ahs-8094	152	15	two	two	NUM
ahs-8094	152	16	sites	site	NOUN
ahs-8094	152	17	and	and	CCONJ
ahs-8094	152	18	both	both	PRON
ahs-8094	152	19	cropping	crop	VERB
ahs-8094	152	20	sea­	sea­	NOUN
ahs-8094	152	21	sons	son	NOUN
ahs-8094	152	22	than	than	ADP
ahs-8094	152	23	data	datum	NOUN
ahs-8094	152	24	of	of	ADP
ahs-8094	152	25	individual	individual	ADJ
ahs-8094	152	26	site	site	NOUN
ahs-8094	152	27	or	or	CCONJ
ahs-8094	152	28	season	season	NOUN
ahs-8094	152	29	.	.	PUNCT
ahs-8094	153	1	data	datum	NOUN
ahs-8094	153	2	analysis	analysis	NOUN
ahs-8094	153	3	data	datum	NOUN
ahs-8094	153	4	on	on	ADP
ahs-8094	153	5	disease	disease	NOUN
ahs-8094	153	6	incidence	incidence	NOUN
ahs-8094	153	7	(	(	PUNCT
ahs-8094	153	8	%	%	INTJ
ahs-8094	153	9	)	)	PUNCT
ahs-8094	153	10	and	and	CCONJ
ahs-8094	153	11	symptom	symptom	NOUN
ahs-8094	153	12	severity	severity	NOUN
ahs-8094	153	13	were	be	AUX
ahs-8094	153	14	square­root	square­root	NOUN
ahs-8094	153	15	transformed	transform	VERB
ahs-8094	153	16	,	,	PUNCT
ahs-8094	153	17	and	and	CCONJ
ahs-8094	153	18	aphids	aphid	NOUN
ahs-8094	153	19	’	'	PUNCT
ahs-8094	153	20	populations	population	NOUN
ahs-8094	153	21	were	be	AUX
ahs-8094	153	22	log­transformed	log­transforme	VERB
ahs-8094	153	23	before	before	ADP
ahs-8094	153	24	subjecting	subject	VERB
ahs-8094	153	25	to	to	ADP
ahs-8094	153	26	the	the	DET
ahs-8094	153	27	analysis	analysis	NOUN
ahs-8094	153	28	of	of	ADP
ahs-8094	153	29	variance	variance	NOUN
ahs-8094	153	30	(	(	PUNCT
ahs-8094	153	31	anova	anova	PROPN
ahs-8094	153	32	)	)	PUNCT
ahs-8094	153	33	.	.	PUNCT
ahs-8094	154	1	means	mean	NOUN
ahs-8094	154	2	of	of	ADP
ahs-8094	154	3	values	value	NOUN
ahs-8094	154	4	regarding	regard	VERB
ahs-8094	154	5	audpc	audpc	NOUN
ahs-8094	154	6	were	be	AUX
ahs-8094	154	7	worked	work	VERB
ahs-8094	154	8	out	out	ADP
ahs-8094	154	9	using	use	VERB
ahs-8094	154	10	the	the	DET
ahs-8094	154	11	microsoft	microsoft	PROPN
ahs-8094	154	12	excel	excel	PROPN
ahs-8094	154	13	program	program	NOUN
ahs-8094	154	14	.	.	PUNCT
ahs-8094	155	1	the	the	DET
ahs-8094	155	2	audpc	audpc	NOUN
ahs-8094	155	3	values	value	NOUN
ahs-8094	155	4	were	be	AUX
ahs-8094	155	5	directly	directly	ADV
ahs-8094	155	6	subject	subject	ADJ
ahs-8094	155	7	to	to	ADP
ahs-8094	155	8	anova	anova	PROPN
ahs-8094	155	9	.	.	PUNCT
ahs-8094	156	1	data	datum	NOUN
ahs-8094	156	2	were	be	AUX
ahs-8094	156	3	analyzed	analyze	VERB
ahs-8094	156	4	using	use	VERB
ahs-8094	156	5	sas	sas	PROPN
ahs-8094	156	6	statistical	statistical	ADJ
ahs-8094	156	7	software	software	NOUN
ahs-8094	156	8	program	program	NOUN
ahs-8094	156	9	and	and	CCONJ
ahs-8094	156	10	the	the	DET
ahs-8094	156	11	means	mean	NOUN
ahs-8094	156	12	were	be	AUX
ahs-8094	156	13	separated	separate	VERB
ahs-8094	156	14	using	use	VERB
ahs-8094	156	15	the	the	DET
ahs-8094	156	16	least	least	ADJ
ahs-8094	156	17	significant	significant	ADJ
ahs-8094	156	18	difference	difference	NOUN
ahs-8094	156	19	(	(	PUNCT
ahs-8094	156	20	lsd	lsd	NOUN
ahs-8094	156	21	)	)	PUNCT
ahs-8094	156	22	test	test	NOUN
ahs-8094	156	23	at	at	ADP
ahs-8094	156	24	p=0.05	p=0.05	NOUN
ahs-8094	156	25	.	.	PUNCT
ahs-8094	157	1	3	3	X
ahs-8094	157	2	.	.	X
ahs-8094	157	3	results	result	VERB
ahs-8094	157	4	reaction	reaction	NOUN
ahs-8094	157	5	of	of	ADP
ahs-8094	157	6	the	the	DET
ahs-8094	157	7	hot	hot	ADJ
ahs-8094	157	8	pepper	pepper	NOUN
ahs-8094	157	9	genotypes	genotype	NOUN
ahs-8094	157	10	to	to	PART
ahs-8094	157	11	virus	virus	VERB
ahs-8094	157	12	infec‐	infec‐	NOUN
ahs-8094	157	13	tion	tion	NOUN
ahs-8094	157	14	and	and	CCONJ
ahs-8094	157	15	aphid	aphid	NOUN
ahs-8094	157	16	infestation	infestation	NOUN
ahs-8094	157	17	under	under	ADP
ahs-8094	157	18	field	field	NOUN
ahs-8094	157	19	conditions	condition	NOUN
ahs-8094	157	20	weather	weather	NOUN
ahs-8094	157	21	conditions	condition	NOUN
ahs-8094	157	22	at	at	ADP
ahs-8094	157	23	the	the	DET
ahs-8094	157	24	experimental	experimental	ADJ
ahs-8094	157	25	sites	site	NOUN
ahs-8094	157	26	the	the	DET
ahs-8094	157	27	average	average	ADJ
ahs-8094	157	28	monthly	monthly	ADJ
ahs-8094	157	29	rainfall	rainfall	NOUN
ahs-8094	157	30	,	,	PUNCT
ahs-8094	157	31	minimum	minimum	NOUN
ahs-8094	157	32	and	and	CCONJ
ahs-8094	157	33	maxi­	maxi­	NOUN
ahs-8094	157	34	mum	mum	PROPN
ahs-8094	157	35	air	air	NOUN
ahs-8094	157	36	temperature	temperature	NOUN
ahs-8094	157	37	during	during	ADP
ahs-8094	157	38	the	the	DET
ahs-8094	157	39	two	two	NUM
ahs-8094	157	40	cropping	cropping	NOUN
ahs-8094	157	41	sea­	sea­	NOUN
ahs-8094	157	42	sons	son	NOUN
ahs-8094	157	43	(	(	PUNCT
ahs-8094	157	44	march­july	march­july	ADV
ahs-8094	157	45	,	,	PUNCT
ahs-8094	157	46	2018	2018	NUM
ahs-8094	157	47	and	and	CCONJ
ahs-8094	157	48	october	october	PROPN
ahs-8094	157	49	2018­march	2018­march	NUM
ahs-8094	157	50	,	,	PUNCT
ahs-8094	157	51	2019	2019	NUM
ahs-8094	157	52	)	)	PUNCT
ahs-8094	157	53	at	at	ADP
ahs-8094	157	54	gashora	gashora	NOUN
ahs-8094	157	55	and	and	CCONJ
ahs-8094	157	56	rubona	rubona	ADJ
ahs-8094	157	57	experimental	experimental	ADJ
ahs-8094	157	58	sites	site	NOUN
ahs-8094	157	59	are	be	AUX
ahs-8094	157	60	shown	show	VERB
ahs-8094	157	61	in	in	ADP
ahs-8094	157	62	figure	figure	NOUN
ahs-8094	157	63	1	1	NUM
ahs-8094	157	64	.	.	PUNCT
ahs-8094	158	1	in	in	ADP
ahs-8094	158	2	rubona	rubona	PROPN
ahs-8094	158	3	,	,	PUNCT
ahs-8094	158	4	temperatures	temperature	NOUN
ahs-8094	158	5	ranged	range	VERB
ahs-8094	158	6	from	from	ADP
ahs-8094	158	7	14.4	14.4	NUM
ahs-8094	158	8	­24.2	­24.2	NOUN
ahs-8094	158	9	°	°	ADP
ahs-8094	158	10	c	c	NOUN
ahs-8094	158	11	in	in	ADP
ahs-8094	158	12	season	season	NOUN
ahs-8094	158	13	one	one	NUM
ahs-8094	158	14	and	and	CCONJ
ahs-8094	158	15	15.2­24.9	15.2­24.9	NUM
ahs-8094	158	16	°	°	NOUN
ahs-8094	158	17	c	c	NOUN
ahs-8094	158	18	in	in	ADP
ahs-8094	158	19	season	season	NOUN
ahs-8094	158	20	two	two	NUM
ahs-8094	158	21	.	.	PUNCT
ahs-8094	159	1	at	at	ADP
ahs-8094	159	2	gashora	gashora	NOUN
ahs-8094	159	3	,	,	PUNCT
ahs-8094	159	4	there	there	PRON
ahs-8094	159	5	were	be	VERB
ahs-8094	159	6	wide	wide	ADJ
ahs-8094	159	7	variations	variation	NOUN
ahs-8094	159	8	between	between	ADP
ahs-8094	159	9	the	the	DET
ahs-8094	159	10	minimum	minimum	ADJ
ahs-8094	159	11	and	and	CCONJ
ahs-8094	159	12	maximum	maximum	ADJ
ahs-8094	159	13	temperatures	temperature	NOUN
ahs-8094	159	14	from	from	ADP
ahs-8094	159	15	12.9­27.7	12.9­27.7	NOUN
ahs-8094	159	16	°	°	ADP
ahs-8094	159	17	c	c	NOUN
ahs-8094	159	18	in	in	ADP
ahs-8094	159	19	season	season	NOUN
ahs-8094	159	20	one	one	NUM
ahs-8094	159	21	and	and	CCONJ
ahs-8094	159	22	13.7­28.2	13.7­28.2	NOUN
ahs-8094	159	23	°	°	NOUN
ahs-8094	159	24	c	c	NOUN
ahs-8094	159	25	in	in	ADP
ahs-8094	159	26	season	season	NOUN
ahs-8094	159	27	two	two	NUM
ahs-8094	159	28	.	.	PUNCT
ahs-8094	160	1	incidence	incidence	NOUN
ahs-8094	160	2	of	of	ADP
ahs-8094	160	3	virus	virus	NOUN
ahs-8094	160	4	diseases	disease	NOUN
ahs-8094	160	5	there	there	PRON
ahs-8094	160	6	were	be	VERB
ahs-8094	160	7	significant	significant	ADJ
ahs-8094	160	8	differences	difference	NOUN
ahs-8094	160	9	in	in	ADP
ahs-8094	160	10	disease	disease	NOUN
ahs-8094	160	11	inci­	inci­	NOUN
ahs-8094	160	12	dence	dence	NOUN
ahs-8094	160	13	between	between	ADP
ahs-8094	160	14	sites	site	NOUN
ahs-8094	160	15	(	(	PUNCT
ahs-8094	160	16	p=	p=	NOUN
ahs-8094	160	17	<	<	X
ahs-8094	160	18	.0001	.0001	X
ahs-8094	160	19	)	)	PUNCT
ahs-8094	160	20	,	,	PUNCT
ahs-8094	160	21	seasons	season	NOUN
ahs-8094	160	22	(	(	PUNCT
ahs-8094	160	23	p=	p=	NOUN
ahs-8094	160	24	<	<	X
ahs-8094	160	25	.0001	.0001	NOUN
ahs-8094	160	26	)	)	PUNCT
ahs-8094	160	27	and	and	CCONJ
ahs-8094	160	28	among	among	ADP
ahs-8094	160	29	genotypes	genotype	NOUN
ahs-8094	160	30	(	(	PUNCT
ahs-8094	160	31	p	p	NOUN
ahs-8094	160	32	=	=	X
ahs-8094	160	33	<	<	X
ahs-8094	160	34	.0001	.0001	X
ahs-8094	160	35	)	)	PUNCT
ahs-8094	160	36	.	.	PUNCT
ahs-8094	161	1	the	the	DET
ahs-8094	161	2	differences	difference	NOUN
ahs-8094	161	3	were	be	AUX
ahs-8094	161	4	observed	observe	VERB
ahs-8094	161	5	from	from	ADP
ahs-8094	161	6	4th	4th	ADJ
ahs-8094	161	7	wap	wap	PROPN
ahs-8094	161	8	and	and	CCONJ
ahs-8094	161	9	increased	increase	VERB
ahs-8094	161	10	with	with	ADP
ahs-8094	161	11	time	time	NOUN
ahs-8094	161	12	,	,	PUNCT
ahs-8094	161	13	ranging	range	VERB
ahs-8094	161	14	from	from	ADP
ahs-8094	161	15	3	3	NUM
ahs-8094	161	16	%	%	NOUN
ahs-8094	161	17	to	to	PART
ahs-8094	161	18	100	100	NUM
ahs-8094	161	19	%	%	NOUN
ahs-8094	161	20	at	at	ADP
ahs-8094	161	21	10	10	NUM
ahs-8094	161	22	wap	wap	NOUN
ahs-8094	161	23	in	in	ADP
ahs-8094	161	24	both	both	DET
ahs-8094	161	25	seasons	season	NOUN
ahs-8094	161	26	and	and	CCONJ
ahs-8094	161	27	locations	location	NOUN
ahs-8094	161	28	(	(	PUNCT
ahs-8094	161	29	tables	table	NOUN
ahs-8094	161	30	4	4	NUM
ahs-8094	161	31	and	and	CCONJ
ahs-8094	161	32	5	5	NUM
ahs-8094	161	33	)	)	PUNCT
ahs-8094	161	34	.	.	PUNCT
ahs-8094	162	1	at	at	ADP
ahs-8094	162	2	rubona	rubona	PROPN
ahs-8094	162	3	,	,	PUNCT
ahs-8094	162	4	higher	high	ADJ
ahs-8094	162	5	disease	disease	NOUN
ahs-8094	162	6	incidence	incidence	NOUN
ahs-8094	162	7	was	be	AUX
ahs-8094	162	8	recorded	record	VERB
ahs-8094	162	9	from	from	ADP
ahs-8094	162	10	both	both	CCONJ
ahs-8094	162	11	commercial	commercial	ADJ
ahs-8094	162	12	and	and	CCONJ
ahs-8094	162	13	local	local	ADJ
ahs-8094	162	14	genotypes	genotype	NOUN
ahs-8094	162	15	,	,	PUNCT
ahs-8094	162	16	except	except	SCONJ
ahs-8094	162	17	for	for	ADP
ahs-8094	162	18	00767ppr	00767ppr	NOUN
ahs-8094	162	19	and	and	CCONJ
ahs-8094	162	20	00802ppr	00802ppr	NOUN
ahs-8094	162	21	compared	compare	VERB
ahs-8094	162	22	to	to	ADP
ahs-8094	162	23	introduced	introduce	VERB
ahs-8094	162	24	genotypes	genotype	NOUN
ahs-8094	162	25	in	in	ADP
ahs-8094	162	26	all	all	DET
ahs-8094	162	27	sampling	sample	VERB
ahs-8094	162	28	periods	period	NOUN
ahs-8094	162	29	(	(	PUNCT
ahs-8094	162	30	table	table	NOUN
ahs-8094	162	31	4	4	NUM
ahs-8094	162	32	)	)	PUNCT
ahs-8094	162	33	.	.	PUNCT
ahs-8094	163	1	in	in	ADP
ahs-8094	163	2	season	season	NOUN
ahs-8094	163	3	one	one	NUM
ahs-8094	163	4	,	,	PUNCT
ahs-8094	163	5	genotype	genotype	NOUN
ahs-8094	163	6	00767ppr	00767ppr	NOUN
ahs-8094	163	7	was	be	AUX
ahs-8094	163	8	the	the	DET
ahs-8094	163	9	least	least	ADV
ahs-8094	163	10	infected	infect	VERB
ahs-8094	163	11	with	with	ADP
ahs-8094	163	12	the	the	DET
ahs-8094	163	13	viruses	virus	NOUN
ahs-8094	163	14	as	as	ADP
ahs-8094	163	15	the	the	DET
ahs-8094	163	16	disease	disease	NOUN
ahs-8094	163	17	incidence	incidence	NOUN
ahs-8094	163	18	(	(	PUNCT
ahs-8094	163	19	di	di	NOUN
ahs-8094	163	20	)	)	PUNCT
ahs-8094	163	21	level	level	NOUN
ahs-8094	163	22	was	be	AUX
ahs-8094	163	23	only	only	ADV
ahs-8094	163	24	3	3	NUM
ahs-8094	163	25	%	%	NOUN
ahs-8094	163	26	,	,	PUNCT
ahs-8094	163	27	followed	follow	VERB
ahs-8094	163	28	by	by	ADP
ahs-8094	163	29	00802ppr	00802ppr	NOUN
ahs-8094	163	30	with	with	ADP
ahs-8094	163	31	10	10	NUM
ahs-8094	163	32	%	%	NOUN
ahs-8094	163	33	,	,	PUNCT
ahs-8094	164	1	pp9950­	pp9950­	CCONJ
ahs-8094	164	2	5197	5197	NUM
ahs-8094	164	3	with	with	ADP
ahs-8094	164	4	20	20	NUM
ahs-8094	164	5	%	%	NOUN
ahs-8094	164	6	and	and	CCONJ
ahs-8094	164	7	pbc	pbc	PROPN
ahs-8094	164	8	462	462	NUM
ahs-8094	164	9	with	with	ADP
ahs-8094	164	10	30	30	NUM
ahs-8094	164	11	%	%	NOUN
ahs-8094	164	12	at	at	ADP
ahs-8094	164	13	10	10	NUM
ahs-8094	164	14	wap	wap	NOUN
ahs-8094	164	15	(	(	PUNCT
ahs-8094	164	16	table	table	NOUN
ahs-8094	164	17	4	4	NUM
ahs-8094	164	18	)	)	PUNCT
ahs-8094	164	19	.	.	PUNCT
ahs-8094	165	1	the	the	DET
ahs-8094	165	2	remaining	remain	VERB
ahs-8094	165	3	genotypes	genotype	NOUN
ahs-8094	165	4	had	have	VERB
ahs-8094	165	5	di	di	NOUN
ahs-8094	165	6	greater	great	ADJ
ahs-8094	165	7	than	than	ADP
ahs-8094	165	8	60	60	NUM
ahs-8094	165	9	%	%	NOUN
ahs-8094	165	10	.	.	PUNCT
ahs-8094	166	1	in	in	ADP
ahs-8094	166	2	season	season	NOUN
ahs-8094	166	3	two	two	NUM
ahs-8094	166	4	,	,	PUNCT
ahs-8094	166	5	disease	disease	NOUN
ahs-8094	166	6	incidence	incidence	NOUN
ahs-8094	166	7	levels	level	NOUN
ahs-8094	166	8	were	be	AUX
ahs-8094	166	9	generally	generally	ADV
ahs-8094	166	10	lower	low	ADJ
ahs-8094	166	11	in	in	ADP
ahs-8094	166	12	all	all	DET
ahs-8094	166	13	genotypes	genotype	NOUN
ahs-8094	166	14	compared	compare	VERB
ahs-8094	166	15	to	to	PART
ahs-8094	166	16	season	season	NOUN
ahs-8094	166	17	one	one	NUM
ahs-8094	166	18	.	.	PUNCT
ahs-8094	167	1	the	the	DET
ahs-8094	167	2	least	least	ADV
ahs-8094	167	3	infected	infected	ADJ
ahs-8094	167	4	genotype	genotype	NOUN
ahs-8094	167	5	was	be	AUX
ahs-8094	167	6	pbc	pbc	PROPN
ahs-8094	167	7	462	462	NUM
ahs-8094	167	8	with	with	ADP
ahs-8094	167	9	di	di	NOUN
ahs-8094	167	10	of	of	ADP
ahs-8094	167	11	3	3	NUM
ahs-8094	167	12	%	%	NOUN
ahs-8094	167	13	followed	follow	VERB
ahs-8094	167	14	by	by	ADP
ahs-8094	167	15	00802ppr	00802ppr	NOUN
ahs-8094	167	16	and	and	CCONJ
ahs-8094	167	17	pp9852­170	pp9852­170	NOUN
ahs-8094	168	1	both	both	PRON
ahs-8094	168	2	having	have	VERB
ahs-8094	168	3	10	10	NUM
ahs-8094	168	4	%	%	NOUN
ahs-8094	168	5	.	.	PUNCT
ahs-8094	169	1	this	this	PRON
ahs-8094	169	2	was	be	AUX
ahs-8094	169	3	followed	follow	VERB
ahs-8094	169	4	by	by	ADP
ahs-8094	169	5	six	six	NUM
ahs-8094	169	6	genotypes	genotype	NOUN
ahs-8094	169	7	(	(	PUNCT
ahs-8094	169	8	pp9950­5197	pp9950­5197	PROPN
ahs-8094	169	9	,	,	PUNCT
ahs-8094	169	10	pbc	pbc	PROPN
ahs-8094	169	11	462	462	NUM
ahs-8094	169	12	,	,	PUNCT
ahs-8094	169	13	icpn	icpn	PROPN
ahs-8094	169	14	18­7	18­7	NUM
ahs-8094	169	15	,	,	PUNCT
ahs-8094	169	16	00767ppr	00767ppr	NOUN
ahs-8094	169	17	,	,	PUNCT
ahs-8094	169	18	00786ppr	00786ppr	NOUN
ahs-8094	169	19	,	,	PUNCT
ahs-8094	169	20	00765ppr	00765ppr	NOUN
ahs-8094	169	21	)	)	PUNCT
ahs-8094	169	22	with	with	ADP
ahs-8094	169	23	incidence	incidence	ADJ
ahs-8094	169	24	levels	level	NOUN
ahs-8094	169	25	of	of	ADP
ahs-8094	169	26	≤	≤	NUM
ahs-8094	169	27	35	35	NUM
ahs-8094	169	28	%	%	NOUN
ahs-8094	169	29	compared	compare	VERB
ahs-8094	169	30	to	to	ADP
ahs-8094	169	31	the	the	DET
ahs-8094	169	32	remaining	remain	VERB
ahs-8094	169	33	genotypes	genotype	NOUN
ahs-8094	169	34	that	that	PRON
ahs-8094	169	35	showed	show	VERB
ahs-8094	169	36	di	di	NOUN
ahs-8094	169	37	of	of	ADP
ahs-8094	169	38	≥55	≥55	NOUN
ahs-8094	169	39	%	%	NOUN
ahs-8094	169	40	at	at	ADP
ahs-8094	169	41	10	10	NUM
ahs-8094	169	42	wap	wap	NOUN
ahs-8094	169	43	(	(	PUNCT
ahs-8094	169	44	table	table	NOUN
ahs-8094	169	45	4	4	NUM
ahs-8094	169	46	)	)	PUNCT
ahs-8094	169	47	.	.	PUNCT
ahs-8094	170	1	on	on	ADP
ahs-8094	170	2	the	the	DET
ahs-8094	170	3	other	other	ADJ
ahs-8094	170	4	hand	hand	NOUN
ahs-8094	170	5	,	,	PUNCT
ahs-8094	170	6	a	a	DET
ahs-8094	170	7	similar	similar	ADJ
ahs-8094	170	8	trend	trend	NOUN
ahs-8094	170	9	was	be	AUX
ahs-8094	170	10	observed	observe	VERB
ahs-8094	170	11	at	at	ADP
ahs-8094	170	12	gashora	gashora	NOUN
ahs-8094	170	13	,	,	PUNCT
ahs-8094	170	14	where	where	SCONJ
ahs-8094	170	15	higher	high	ADJ
ahs-8094	170	16	disease	disease	NOUN
ahs-8094	170	17	incidence	incidence	NOUN
ahs-8094	170	18	levels	level	NOUN
ahs-8094	170	19	were	be	AUX
ahs-8094	170	20	recorded	record	VERB
ahs-8094	170	21	in	in	ADP
ahs-8094	170	22	season	season	NOUN
ahs-8094	170	23	one	one	NUM
ahs-8094	170	24	compared	compare	VERB
ahs-8094	170	25	to	to	ADP
ahs-8094	170	26	two	two	NUM
ahs-8094	170	27	(	(	PUNCT
ahs-8094	170	28	table	table	NOUN
ahs-8094	170	29	5	5	NUM
ahs-8094	170	30	)	)	PUNCT
ahs-8094	170	31	.	.	PUNCT
ahs-8094	171	1	genotype	genotype	PROPN
ahs-8094	171	2	pbc	pbc	PROPN
ahs-8094	171	3	462	462	NUM
ahs-8094	171	4	was	be	AUX
ahs-8094	171	5	the	the	DET
ahs-8094	171	6	least	least	ADV
ahs-8094	171	7	infected	infect	VERB
ahs-8094	171	8	with	with	ADP
ahs-8094	171	9	di	di	NOUN
ahs-8094	171	10	of	of	ADP
ahs-8094	171	11	13	13	NUM
ahs-8094	171	12	%	%	NOUN
ahs-8094	171	13	,	,	PUNCT
ahs-8094	171	14	followed	follow	VERB
ahs-8094	171	15	by	by	ADP
ahs-8094	171	16	icpn	icpn	PROPN
ahs-8094	171	17	18­7	18­7	NUM
ahs-8094	171	18	with	with	ADP
ahs-8094	171	19	30	30	NUM
ahs-8094	171	20	%	%	NOUN
ahs-8094	171	21	,	,	PUNCT
ahs-8094	171	22	pp9950­	pp9950­	CCONJ
ahs-8094	171	23	5197	5197	NUM
ahs-8094	171	24	with	with	ADP
ahs-8094	171	25	47	47	NUM
ahs-8094	171	26	%	%	NOUN
ahs-8094	171	27	and	and	CCONJ
ahs-8094	171	28	the	the	DET
ahs-8094	171	29	remaining	remain	VERB
ahs-8094	171	30	genotypes	genotype	NOUN
ahs-8094	171	31	had	have	VERB
ahs-8094	171	32	incidence	incidence	NOUN
ahs-8094	171	33	levels	level	NOUN
ahs-8094	171	34	greater	great	ADJ
ahs-8094	171	35	than	than	ADP
ahs-8094	171	36	70	70	NUM
ahs-8094	171	37	%	%	NOUN
ahs-8094	171	38	in	in	ADP
ahs-8094	171	39	season	season	NOUN
ahs-8094	171	40	one	one	NUM
ahs-8094	171	41	(	(	PUNCT
ahs-8094	171	42	table	table	NOUN
ahs-8094	171	43	5	5	NUM
ahs-8094	171	44	)	)	PUNCT
ahs-8094	171	45	.	.	PUNCT
ahs-8094	172	1	in	in	ADP
ahs-8094	172	2	season	season	NOUN
ahs-8094	172	3	two	two	NUM
ahs-8094	172	4	,	,	PUNCT
ahs-8094	172	5	5	5	NUM
ahs-8094	172	6	genotypes	genotype	NOUN
ahs-8094	172	7	(	(	PUNCT
ahs-8094	172	8	00767ppr	00767ppr	NOUN
ahs-8094	172	9	,	,	PUNCT
ahs-8094	172	10	pp9950­5197	pp9950­5197	PROPN
ahs-8094	172	11	,	,	PUNCT
ahs-8094	172	12	pbc	pbc	PROPN
ahs-8094	172	13	462	462	NUM
ahs-8094	172	14	,	,	PUNCT
ahs-8094	172	15	pp9852­170	pp9852­170	PROPN
ahs-8094	172	16	and	and	CCONJ
ahs-8094	172	17	icpn	icpn	PROPN
ahs-8094	172	18	18­7	18­7	NUM
ahs-8094	172	19	)	)	PUNCT
ahs-8094	172	20	showed	show	VERB
ahs-8094	172	21	di	di	NOUN
ahs-8094	172	22	levels	level	NOUN
ahs-8094	172	23	of	of	ADP
ahs-8094	172	24	≤	≤	NUM
ahs-8094	172	25	50	50	NUM
ahs-8094	172	26	%	%	NOUN
ahs-8094	172	27	.	.	PUNCT
ahs-8094	173	1	in	in	ADP
ahs-8094	173	2	both	both	DET
ahs-8094	173	3	sites	site	NOUN
ahs-8094	173	4	,	,	PUNCT
ahs-8094	173	5	the	the	DET
ahs-8094	173	6	highest	high	ADJ
ahs-8094	173	7	spread	spread	NOUN
ahs-8094	173	8	of	of	ADP
ahs-8094	173	9	viral	viral	ADJ
ahs-8094	173	10	diseases	disease	NOUN
ahs-8094	173	11	was	be	AUX
ahs-8094	173	12	recorded	record	VERB
ahs-8094	173	13	on	on	ADP
ahs-8094	173	14	both	both	DET
ahs-8094	173	15	com­	com­	NOUN
ahs-8094	173	16	mercial	mercial	NOUN
ahs-8094	173	17	and	and	CCONJ
ahs-8094	173	18	local	local	ADJ
ahs-8094	173	19	except	except	SCONJ
ahs-8094	173	20	for	for	ADP
ahs-8094	173	21	the	the	DET
ahs-8094	173	22	genotype	genotype	NOUN
ahs-8094	173	23	00767ppr	00767ppr	NOUN
ahs-8094	173	24	and	and	CCONJ
ahs-8094	173	25	00802ppr	00802ppr	NOUN
ahs-8094	173	26	.	.	PUNCT
ahs-8094	174	1	at	at	ADP
ahs-8094	174	2	10	10	NUM
ahs-8094	174	3	wap	wap	PROPN
ahs-8094	174	4	,	,	PUNCT
ahs-8094	174	5	all	all	DET
ahs-8094	174	6	the	the	DET
ahs-8094	174	7	genotypes	genotype	NOUN
ahs-8094	174	8	had	have	AUX
ahs-8094	174	9	developed	develop	VERB
ahs-8094	174	10	symptoms	symptom	NOUN
ahs-8094	174	11	of	of	ADP
ahs-8094	174	12	viral	viral	ADJ
ahs-8094	174	13	diseases	disease	NOUN
ahs-8094	174	14	but	but	CCONJ
ahs-8094	174	15	,	,	PUNCT
ahs-8094	174	16	high	high	ADJ
ahs-8094	174	17	vari­	vari­	NOUN
ahs-8094	174	18	ability	ability	NOUN
ahs-8094	174	19	existed	exist	VERB
ahs-8094	174	20	between	between	ADP
ahs-8094	174	21	genotypes	genotype	NOUN
ahs-8094	174	22	.	.	PUNCT
ahs-8094	175	1	the	the	DET
ahs-8094	175	2	interactions	interaction	NOUN
ahs-8094	175	3	of	of	ADP
ahs-8094	175	4	site	site	NOUN
ahs-8094	175	5	and	and	CCONJ
ahs-8094	175	6	season	season	NOUN
ahs-8094	175	7	(	(	PUNCT
ahs-8094	175	8	p	p	X
ahs-8094	175	9	=	=	X
ahs-8094	175	10	<	<	X
ahs-8094	175	11	.0001	.0001	X
ahs-8094	175	12	)	)	PUNCT
ahs-8094	175	13	,	,	PUNCT
ahs-8094	175	14	site	site	NOUN
ahs-8094	175	15	and	and	CCONJ
ahs-8094	175	16	genotype	genotype	NOUN
ahs-8094	175	17	(	(	PUNCT
ahs-8094	175	18	p	p	NOUN
ahs-8094	175	19	=	=	X
ahs-8094	175	20	<	<	X
ahs-8094	175	21	.0001	.0001	X
ahs-8094	175	22	)	)	PUNCT
ahs-8094	175	23	,	,	PUNCT
ahs-8094	175	24	season	season	NOUN
ahs-8094	175	25	and	and	CCONJ
ahs-8094	175	26	genotype	genotype	NOUN
ahs-8094	175	27	(	(	PUNCT
ahs-8094	175	28	p	p	X
ahs-8094	175	29	=	=	NOUN
ahs-8094	175	30	0.0025	0.0025	NUM
ahs-8094	175	31	)	)	PUNCT
ahs-8094	175	32	were	be	AUX
ahs-8094	175	33	also	also	ADV
ahs-8094	175	34	highly	highly	ADV
ahs-8094	175	35	significant	significant	ADJ
ahs-8094	175	36	.	.	PUNCT
ahs-8094	176	1	these	these	DET
ahs-8094	176	2	results	result	NOUN
ahs-8094	176	3	indicated	indicate	VERB
ahs-8094	176	4	that	that	SCONJ
ahs-8094	176	5	the	the	DET
ahs-8094	176	6	incidence	incidence	NOUN
ahs-8094	176	7	of	of	ADP
ahs-8094	176	8	viral	viral	ADJ
ahs-8094	176	9	diseases	disease	NOUN
ahs-8094	176	10	was	be	AUX
ahs-8094	176	11	dependent	dependent	ADJ
ahs-8094	176	12	on	on	ADP
ahs-8094	176	13	the	the	DET
ahs-8094	176	14	site	site	NOUN
ahs-8094	176	15	and	and	CCONJ
ahs-8094	176	16	season	season	NOUN
ahs-8094	176	17	the	the	DET
ahs-8094	176	18	experiments	experiment	NOUN
ahs-8094	176	19	were	be	AUX
ahs-8094	176	20	conducted	conduct	VERB
ahs-8094	176	21	.	.	PUNCT
ahs-8094	177	1	area	area	NOUN
ahs-8094	177	2	under	under	ADP
ahs-8094	177	3	disease	disease	NOUN
ahs-8094	177	4	progress	progress	NOUN
ahs-8094	177	5	curve	curve	VERB
ahs-8094	177	6	the	the	DET
ahs-8094	177	7	total	total	ADJ
ahs-8094	177	8	amount	amount	NOUN
ahs-8094	177	9	of	of	ADP
ahs-8094	177	10	disease	disease	NOUN
ahs-8094	177	11	that	that	PRON
ahs-8094	177	12	occurred	occur	VERB
ahs-8094	177	13	in	in	ADP
ahs-8094	177	14	the	the	DET
ahs-8094	177	15	experiments	experiment	NOUN
ahs-8094	177	16	was	be	AUX
ahs-8094	177	17	estimated	estimate	VERB
ahs-8094	177	18	and	and	CCONJ
ahs-8094	177	19	presented	present	VERB
ahs-8094	177	20	as	as	ADP
ahs-8094	177	21	the	the	DET
ahs-8094	177	22	area	area	NOUN
ahs-8094	177	23	under	under	ADP
ahs-8094	177	24	the	the	DET
ahs-8094	177	25	disease	disease	NOUN
ahs-8094	177	26	progress	progress	NOUN
ahs-8094	177	27	curve	curve	NOUN
ahs-8094	177	28	(	(	PUNCT
ahs-8094	177	29	audpc	audpc	NOUN
ahs-8094	177	30	)	)	PUNCT
ahs-8094	177	31	.	.	PUNCT
ahs-8094	178	1	the	the	DET
ahs-8094	178	2	mean	mean	ADJ
ahs-8094	178	3	audpc	audpc	NOUN
ahs-8094	178	4	values	value	NOUN
ahs-8094	178	5	differed	differ	VERB
ahs-8094	178	6	significantly	significantly	ADV
ahs-8094	178	7	within	within	ADP
ahs-8094	178	8	sites	site	NOUN
ahs-8094	178	9	fig	fig	NOUN
ahs-8094	178	10	.	.	PUNCT
ahs-8094	179	1	1	1	NUM
ahs-8094	179	2	­	­	VERB
ahs-8094	179	3	the	the	DET
ahs-8094	179	4	microclimate	microclimate	NOUN
ahs-8094	179	5	of	of	ADP
ahs-8094	179	6	the	the	DET
ahs-8094	179	7	experimental	experimental	ADJ
ahs-8094	179	8	sites	site	NOUN
ahs-8094	179	9	during	during	ADP
ahs-8094	179	10	the	the	DET
ahs-8094	179	11	two	two	NUM
ahs-8094	179	12	cropping	cropping	NOUN
ahs-8094	179	13	seasons	season	NOUN
ahs-8094	179	14	.	.	PUNCT
ahs-8094	180	1	temp­	temp­	PRON
ahs-8094	180	2	temperature	temperature	NOUN
ahs-8094	180	3	,	,	PUNCT
ahs-8094	180	4	min­	min­	NOUN
ahs-8094	180	5	minimum	minimum	NOUN
ahs-8094	180	6	,	,	PUNCT
ahs-8094	180	7	max­maximum	max­maximum	NOUN
ahs-8094	180	8	.	.	PUNCT
ahs-8094	181	1	waweru	waweru	PROPN
ahs-8094	181	2	et	et	PROPN
ahs-8094	181	3	al	al	PROPN
ahs-8094	181	4	.	.	PROPN
ahs-8094	182	1	‐	‐	NOUN
ahs-8094	182	2	evaluation	evaluation	NOUN
ahs-8094	182	3	of	of	ADP
ahs-8094	182	4	hot	hot	ADJ
ahs-8094	182	5	pepper	pepper	NOUN
ahs-8094	182	6	genotypes	genotype	NOUN
ahs-8094	182	7	in	in	ADP
ahs-8094	182	8	rwanda	rwanda	PROPN
ahs-8094	182	9	403	403	NUM
ahs-8094	182	10	and	and	CCONJ
ahs-8094	182	11	thus	thus	ADV
ahs-8094	182	12	,	,	PUNCT
ahs-8094	182	13	data	datum	NOUN
ahs-8094	182	14	were	be	AUX
ahs-8094	182	15	not	not	PART
ahs-8094	182	16	pooled	pool	VERB
ahs-8094	182	17	together	together	ADV
ahs-8094	182	18	.	.	PUNCT
ahs-8094	183	1	in	in	ADP
ahs-8094	183	2	rubona	rubona	PROPN
ahs-8094	183	3	,	,	PUNCT
ahs-8094	183	4	the	the	DET
ahs-8094	183	5	total	total	ADJ
ahs-8094	183	6	amount	amount	NOUN
ahs-8094	183	7	of	of	ADP
ahs-8094	183	8	disease	disease	NOUN
ahs-8094	183	9	was	be	AUX
ahs-8094	183	10	significantly	significantly	ADV
ahs-8094	183	11	(	(	PUNCT
ahs-8094	183	12	p	p	X
ahs-8094	183	13	<	<	X
ahs-8094	183	14	0.0001	0.0001	NUM
ahs-8094	183	15	)	)	PUNCT
ahs-8094	183	16	higher	high	ADJ
ahs-8094	183	17	in	in	ADP
ahs-8094	183	18	season	season	NOUN
ahs-8094	183	19	one	one	NUM
ahs-8094	183	20	with	with	ADP
ahs-8094	183	21	mean	mean	ADJ
ahs-8094	183	22	audpc	audpc	NOUN
ahs-8094	183	23	val­	val­	NOUN
ahs-8094	183	24	ues	ue	NOUN
ahs-8094	183	25	of	of	ADP
ahs-8094	183	26	230.9	230.9	NUM
ahs-8094	183	27	compared	compare	VERB
ahs-8094	183	28	to	to	ADP
ahs-8094	183	29	season	season	NOUN
ahs-8094	183	30	two	two	NUM
ahs-8094	183	31	that	that	PRON
ahs-8094	183	32	recorded	record	VERB
ahs-8094	183	33	117.1	117.1	NUM
ahs-8094	183	34	.	.	PUNCT
ahs-8094	184	1	in	in	ADP
ahs-8094	184	2	both	both	DET
ahs-8094	184	3	seasons	season	NOUN
ahs-8094	184	4	,	,	PUNCT
ahs-8094	184	5	all	all	DET
ahs-8094	184	6	commercial	commercial	ADJ
ahs-8094	184	7	and	and	CCONJ
ahs-8094	184	8	local	local	ADJ
ahs-8094	184	9	genotypes	genotype	NOUN
ahs-8094	184	10	(	(	PUNCT
ahs-8094	184	11	except	except	SCONJ
ahs-8094	184	12	00767ppr	00767ppr	NOUN
ahs-8094	184	13	and	and	CCONJ
ahs-8094	184	14	00802ppr	00802ppr	NOUN
ahs-8094	184	15	)	)	PUNCT
ahs-8094	184	16	record­	record­	PROPN
ahs-8094	184	17	ed	ed	PROPN
ahs-8094	184	18	high	high	ADJ
ahs-8094	184	19	levels	level	NOUN
ahs-8094	184	20	of	of	ADP
ahs-8094	184	21	disease	disease	NOUN
ahs-8094	184	22	compared	compare	VERB
ahs-8094	184	23	to	to	ADP
ahs-8094	184	24	introduced	introduce	VERB
ahs-8094	184	25	genotypes	genotype	NOUN
ahs-8094	184	26	(	(	PUNCT
ahs-8094	184	27	table	table	NOUN
ahs-8094	184	28	6	6	NUM
ahs-8094	184	29	)	)	PUNCT
ahs-8094	184	30	.	.	PUNCT
ahs-8094	185	1	genotypes	genotype	NOUN
ahs-8094	185	2	00767ppr	00767ppr	NOUN
ahs-8094	185	3	,	,	PUNCT
ahs-8094	185	4	00802ppr	00802ppr	PROPN
ahs-8094	185	5	,	,	PUNCT
ahs-8094	185	6	pbc	pbc	PROPN
ahs-8094	185	7	462	462	NUM
ahs-8094	185	8	and	and	CCONJ
ahs-8094	185	9	pp9950­5197	pp9950­5197	AUX
ahs-8094	185	10	consistently	consistently	ADV
ahs-8094	185	11	recorded	record	VERB
ahs-8094	185	12	lower	low	ADJ
ahs-8094	185	13	audpc	audpc	NOUN
ahs-8094	185	14	values	value	NOUN
ahs-8094	185	15	of	of	ADP
ahs-8094	185	16	less	less	ADJ
ahs-8094	185	17	than	than	ADP
ahs-8094	185	18	100	100	NUM
ahs-8094	185	19	in	in	ADP
ahs-8094	185	20	both	both	DET
ahs-8094	185	21	seasons	season	NOUN
ahs-8094	185	22	.	.	PUNCT
ahs-8094	186	1	besides	besides	SCONJ
ahs-8094	186	2	,	,	PUNCT
ahs-8094	186	3	genotypes	genotype	NOUN
ahs-8094	186	4	00786ppr	00786ppr	NOUN
ahs-8094	186	5	,	,	PUNCT
ahs-8094	186	6	pp9950­	pp9950­	CCONJ
ahs-8094	186	7	5197	5197	NUM
ahs-8094	186	8	,	,	PUNCT
ahs-8094	186	9	pp9852­170	pp9852­170	NOUN
ahs-8094	186	10	and	and	CCONJ
ahs-8094	186	11	icpn	icpn	PROPN
ahs-8094	186	12	18­7	18­7	NUM
ahs-8094	186	13	recorded	record	VERB
ahs-8094	186	14	values	value	NOUN
ahs-8094	186	15	of	of	ADP
ahs-8094	186	16	less	less	ADJ
ahs-8094	186	17	than	than	ADP
ahs-8094	186	18	100	100	NUM
ahs-8094	186	19	but	but	CCONJ
ahs-8094	186	20	only	only	ADV
ahs-8094	186	21	in	in	ADP
ahs-8094	186	22	season	season	NOUN
ahs-8094	186	23	two	two	NUM
ahs-8094	186	24	.	.	PUNCT
ahs-8094	187	1	in	in	ADP
ahs-8094	187	2	gashora	gashora	PROPN
ahs-8094	187	3	,	,	PUNCT
ahs-8094	187	4	the	the	DET
ahs-8094	187	5	audpc	audpc	NOUN
ahs-8094	187	6	values	value	NOUN
ahs-8094	187	7	were	be	AUX
ahs-8094	187	8	higher	high	ADJ
ahs-8094	187	9	in	in	ADP
ahs-8094	187	10	both	both	DET
ahs-8094	187	11	seasons	season	NOUN
ahs-8094	187	12	compared	compare	VERB
ahs-8094	187	13	to	to	ADP
ahs-8094	187	14	rubona	rubona	PROPN
ahs-8094	187	15	.	.	PUNCT
ahs-8094	188	1	however	however	ADV
ahs-8094	188	2	,	,	PUNCT
ahs-8094	188	3	a	a	DET
ahs-8094	188	4	similar	similar	ADJ
ahs-8094	188	5	trend	trend	NOUN
ahs-8094	188	6	was	be	AUX
ahs-8094	188	7	observed	observe	VERB
ahs-8094	188	8	where	where	SCONJ
ahs-8094	188	9	the	the	DET
ahs-8094	188	10	amount	amount	NOUN
ahs-8094	188	11	of	of	ADP
ahs-8094	188	12	diseases	disease	NOUN
ahs-8094	188	13	was	be	AUX
ahs-8094	188	14	more	more	ADJ
ahs-8094	188	15	in	in	ADP
ahs-8094	188	16	season	season	NOUN
ahs-8094	188	17	one	one	NUM
ahs-8094	188	18	with	with	ADP
ahs-8094	188	19	values	value	NOUN
ahs-8094	188	20	of	of	ADP
ahs-8094	188	21	243.9	243.9	NUM
ahs-8094	188	22	than	than	ADP
ahs-8094	188	23	season	season	NOUN
ahs-8094	188	24	two	two	NUM
ahs-8094	188	25	198.9	198.9	NUM
ahs-8094	188	26	(	(	PUNCT
ahs-8094	188	27	table	table	NOUN
ahs-8094	188	28	6	6	NUM
ahs-8094	188	29	)	)	PUNCT
ahs-8094	188	30	.	.	PUNCT
ahs-8094	189	1	introduced	introduce	VERB
ahs-8094	189	2	and	and	CCONJ
ahs-8094	189	3	the	the	DET
ahs-8094	189	4	two	two	NUM
ahs-8094	189	5	local	local	ADJ
ahs-8094	189	6	genotypes	genotype	NOUN
ahs-8094	189	7	(	(	PUNCT
ahs-8094	189	8	00767ppr	00767ppr	NOUN
ahs-8094	189	9	and	and	CCONJ
ahs-8094	189	10	00802ppr	00802ppr	NOUN
ahs-8094	189	11	)	)	PUNCT
ahs-8094	189	12	had	have	VERB
ahs-8094	189	13	low	low	ADJ
ahs-8094	189	14	audpc	audpc	NOUN
ahs-8094	189	15	values	value	NOUN
ahs-8094	189	16	compared	compare	VERB
ahs-8094	189	17	to	to	ADP
ahs-8094	189	18	the	the	DET
ahs-8094	189	19	rest	rest	NOUN
ahs-8094	189	20	of	of	ADP
ahs-8094	189	21	the	the	DET
ahs-8094	189	22	geno­	geno­	NOUN
ahs-8094	189	23	types	type	NOUN
ahs-8094	189	24	.	.	PUNCT
ahs-8094	190	1	genotypes	genotype	NOUN
ahs-8094	190	2	pbc	pbc	PROPN
ahs-8094	190	3	462	462	NUM
ahs-8094	190	4	and	and	CCONJ
ahs-8094	190	5	pp9950­5197	pp9950­5197	VERB
ahs-8094	190	6	record­	record­	PROPN
ahs-8094	190	7	ed	ed	NOUN
ahs-8094	190	8	values	value	NOUN
ahs-8094	190	9	of	of	ADP
ahs-8094	190	10	less	less	ADJ
ahs-8094	190	11	than	than	ADP
ahs-8094	190	12	100	100	NUM
ahs-8094	190	13	in	in	ADP
ahs-8094	190	14	both	both	DET
ahs-8094	190	15	seasons	season	NOUN
ahs-8094	190	16	,	,	PUNCT
ahs-8094	190	17	while	while	SCONJ
ahs-8094	190	18	genotypes	genotype	NOUN
ahs-8094	190	19	00767ppr	00767ppr	NOUN
ahs-8094	190	20	,	,	PUNCT
ahs-8094	190	21	pp9852­170	pp9852­170	NOUN
ahs-8094	190	22	and	and	CCONJ
ahs-8094	190	23	icpn	icpn	PROPN
ahs-8094	190	24	18­7	18­7	PROPN
ahs-8094	190	25	had	have	VERB
ahs-8094	190	26	audpc	audpc	NOUN
ahs-8094	190	27	values	value	NOUN
ahs-8094	190	28	of	of	ADP
ahs-8094	190	29	less	less	ADJ
ahs-8094	190	30	than	than	ADP
ahs-8094	190	31	100	100	NUM
ahs-8094	190	32	in	in	ADP
ahs-8094	190	33	season	season	NOUN
ahs-8094	190	34	two	two	NUM
ahs-8094	190	35	only	only	ADV
ahs-8094	190	36	.	.	PUNCT
ahs-8094	191	1	on	on	ADP
ahs-8094	191	2	the	the	DET
ahs-8094	191	3	other	other	ADJ
ahs-8094	191	4	hand	hand	NOUN
ahs-8094	191	5	,	,	PUNCT
ahs-8094	191	6	genotypes	genotype	NOUN
ahs-8094	191	7	00792ppr	00792ppr	NOUN
ahs-8094	191	8	,	,	PUNCT
ahs-8094	191	9	00795ppr	00795ppr	NOUN
ahs-8094	191	10	and	and	CCONJ
ahs-8094	191	11	the	the	DET
ahs-8094	191	12	four	four	NUM
ahs-8094	191	13	commercial	commercial	ADJ
ahs-8094	191	14	genotypes	genotype	NOUN
ahs-8094	191	15	were	be	AUX
ahs-8094	191	16	the	the	DET
ahs-8094	191	17	most	most	ADJ
ahs-8094	191	18	infect­	infect­	NOUN
ahs-8094	191	19	ed	ed	NOUN
ahs-8094	191	20	with	with	ADP
ahs-8094	191	21	the	the	DET
ahs-8094	191	22	viral	viral	ADJ
ahs-8094	191	23	diseases	disease	NOUN
ahs-8094	191	24	in	in	ADP
ahs-8094	191	25	both	both	DET
ahs-8094	191	26	sites	site	NOUN
ahs-8094	191	27	during	during	ADP
ahs-8094	191	28	the	the	DET
ahs-8094	191	29	two	two	NUM
ahs-8094	191	30	seasons	season	NOUN
ahs-8094	191	31	.	.	PUNCT
ahs-8094	192	1	detection	detection	NOUN
ahs-8094	192	2	of	of	ADP
ahs-8094	192	3	the	the	DET
ahs-8094	192	4	viruses	virus	NOUN
ahs-8094	192	5	in	in	ADP
ahs-8094	192	6	hot	hot	ADJ
ahs-8094	192	7	pepper	pepper	NOUN
ahs-8094	192	8	genotypes	genotype	NOUN
ahs-8094	192	9	three	three	NUM
ahs-8094	192	10	viruses	virus	NOUN
ahs-8094	192	11	were	be	AUX
ahs-8094	192	12	detected	detect	VERB
ahs-8094	192	13	in	in	ADP
ahs-8094	192	14	the	the	DET
ahs-8094	192	15	samples	sample	NOUN
ahs-8094	192	16	ana­	ana­	NOUN
ahs-8094	192	17	lyzed	lyze	VERB
ahs-8094	192	18	namely	namely	ADV
ahs-8094	192	19	cmv	cmv	NOUN
ahs-8094	192	20	,	,	PUNCT
ahs-8094	192	21	pevyv	pevyv	NOUN
ahs-8094	192	22	and	and	CCONJ
ahs-8094	192	23	pvmv	pvmv	NOUN
ahs-8094	192	24	.	.	PUNCT
ahs-8094	193	1	cucumber	cucumber	PROPN
ahs-8094	193	2	mosaic	mosaic	PROPN
ahs-8094	193	3	virus	virus	NOUN
ahs-8094	193	4	infection	infection	NOUN
ahs-8094	193	5	was	be	AUX
ahs-8094	193	6	the	the	DET
ahs-8094	193	7	most	most	ADV
ahs-8094	193	8	abundant	abundant	ADJ
ahs-8094	193	9	in	in	ADP
ahs-8094	193	10	both	both	DET
ahs-8094	193	11	sites	site	NOUN
ahs-8094	193	12	,	,	PUNCT
ahs-8094	193	13	detected	detect	VERB
ahs-8094	193	14	in	in	ADP
ahs-8094	193	15	53.1	53.1	NUM
ahs-8094	193	16	%	%	NOUN
ahs-8094	193	17	of	of	ADP
ahs-8094	193	18	the	the	DET
ahs-8094	193	19	samples	sample	NOUN
ahs-8094	193	20	in	in	ADP
ahs-8094	193	21	rubona	rubona	NOUN
ahs-8094	193	22	and	and	CCONJ
ahs-8094	193	23	75	75	NUM
ahs-8094	193	24	%	%	NOUN
ahs-8094	193	25	in	in	ADP
ahs-8094	193	26	gashora	gashora	NOUN
ahs-8094	193	27	,	,	PUNCT
ahs-8094	193	28	followed	follow	VERB
ahs-8094	193	29	by	by	ADP
ahs-8094	193	30	pevyv	pevyv	NOUN
ahs-8094	193	31	with	with	ADP
ahs-8094	193	32	31.3	31.3	NUM
ahs-8094	193	33	%	%	NOUN
ahs-8094	193	34	and	and	CCONJ
ahs-8094	193	35	2.8	2.8	NUM
ahs-8094	193	36	%	%	NOUN
ahs-8094	193	37	,	,	PUNCT
ahs-8094	193	38	respectively	respectively	ADV
ahs-8094	193	39	(	(	PUNCT
ahs-8094	193	40	fig	fig	NOUN
ahs-8094	193	41	.	.	PUNCT
ahs-8094	194	1	2	2	NUM
ahs-8094	194	2	)	)	PUNCT
ahs-8094	194	3	.	.	PUNCT
ahs-8094	195	1	the	the	DET
ahs-8094	195	2	pvmv	pvmv	PROPN
ahs-8094	195	3	infections	infection	NOUN
ahs-8094	195	4	were	be	AUX
ahs-8094	195	5	the	the	DET
ahs-8094	195	6	least	least	ADV
ahs-8094	195	7	abundant	abundant	ADJ
ahs-8094	195	8	and	and	CCONJ
ahs-8094	195	9	only	only	ADV
ahs-8094	195	10	detected	detect	VERB
ahs-8094	195	11	in	in	ADP
ahs-8094	195	12	21.9	21.9	NUM
ahs-8094	195	13	%	%	NOUN
ahs-8094	195	14	of	of	ADP
ahs-8094	195	15	the	the	DET
ahs-8094	195	16	samples	sample	NOUN
ahs-8094	195	17	in	in	ADP
ahs-8094	195	18	rubona	rubona	PROPN
ahs-8094	195	19	.	.	PUNCT
ahs-8094	196	1	double	double	ADJ
ahs-8094	196	2	infections	infection	NOUN
ahs-8094	196	3	of	of	ADP
ahs-8094	196	4	cmv+pevyv	cmv+pevyv	NOUN
ahs-8094	196	5	were	be	AUX
ahs-8094	196	6	common	common	ADJ
ahs-8094	196	7	and	and	CCONJ
ahs-8094	196	8	detected	detect	VERB
ahs-8094	196	9	in	in	ADP
ahs-8094	196	10	both	both	DET
ahs-8094	196	11	sites	site	NOUN
ahs-8094	196	12	,	,	PUNCT
ahs-8094	196	13	12.5	12.5	NUM
ahs-8094	196	14	%	%	NOUN
ahs-8094	196	15	in	in	ADP
ahs-8094	196	16	rubona	rubona	NOUN
ahs-8094	196	17	and	and	CCONJ
ahs-8094	196	18	2.7	2.7	NUM
ahs-8094	196	19	%	%	NOUN
ahs-8094	196	20	in	in	ADP
ahs-8094	196	21	gashora	gashora	NOUN
ahs-8094	196	22	,	,	PUNCT
ahs-8094	196	23	followed	follow	VERB
ahs-8094	196	24	table	table	NOUN
ahs-8094	196	25	4	4	NUM
ahs-8094	196	26	­	­	NOUN
ahs-8094	196	27	incidence	incidence	NOUN
ahs-8094	196	28	(	(	PUNCT
ahs-8094	196	29	%	%	NOUN
ahs-8094	196	30	)	)	PUNCT
ahs-8094	196	31	of	of	ADP
ahs-8094	196	32	viral	viral	ADJ
ahs-8094	196	33	diseases	disease	NOUN
ahs-8094	196	34	recorded	record	VERB
ahs-8094	196	35	on	on	ADP
ahs-8094	196	36	eighteen	eighteen	NUM
ahs-8094	196	37	hot	hot	ADJ
ahs-8094	196	38	pepper	pepper	NOUN
ahs-8094	196	39	genotypes	genotype	NOUN
ahs-8094	196	40	grown	grow	VERB
ahs-8094	196	41	under	under	ADP
ahs-8094	196	42	field	field	NOUN
ahs-8094	196	43	conditions	condition	NOUN
ahs-8094	196	44	during	during	ADP
ahs-8094	196	45	two	two	NUM
ahs-8094	196	46	seasons	season	NOUN
ahs-8094	196	47	at	at	ADP
ahs-8094	196	48	rubona	rubona	PROPN
ahs-8094	196	49	station	station	NOUN
ahs-8094	196	50	,	,	PUNCT
ahs-8094	196	51	huye	huye	PROPN
ahs-8094	196	52	district	district	PROPN
ahs-8094	196	53	in	in	ADP
ahs-8094	196	54	rwanda	rwanda	PROPN
ahs-8094	196	55	the	the	DET
ahs-8094	196	56	values	value	NOUN
ahs-8094	196	57	represent	represent	VERB
ahs-8094	196	58	means	mean	NOUN
ahs-8094	196	59	of	of	ADP
ahs-8094	196	60	un­transformed	un­transformed	PROPN
ahs-8094	196	61	data	datum	NOUN
ahs-8094	196	62	.	.	PUNCT
ahs-8094	197	1	means	mean	VERB
ahs-8094	197	2	comparison	comparison	NOUN
ahs-8094	197	3	done	do	VERB
ahs-8094	197	4	by	by	ADP
ahs-8094	197	5	least	least	ADJ
ahs-8094	197	6	significant	significant	ADJ
ahs-8094	197	7	difference	difference	NOUN
ahs-8094	197	8	(	(	PUNCT
ahs-8094	197	9	lsd	lsd	NOUN
ahs-8094	197	10	)	)	PUNCT
ahs-8094	197	11	test	test	NOUN
ahs-8094	197	12	on	on	ADP
ahs-8094	197	13	transformed	transform	VERB
ahs-8094	197	14	data	datum	NOUN
ahs-8094	197	15	.	.	PUNCT
ahs-8094	198	1	data	datum	NOUN
ahs-8094	198	2	transformed	transform	VERB
ahs-8094	198	3	by	by	ADP
ahs-8094	198	4	square	square	ADJ
ahs-8094	198	5	root	root	NOUN
ahs-8094	198	6	(	(	PUNCT
ahs-8094	198	7	x+1	x+1	NUM
ahs-8094	198	8	)	)	PUNCT
ahs-8094	198	9	.	.	PUNCT
ahs-8094	198	10	means	mean	VERB
ahs-8094	198	11	with	with	ADP
ahs-8094	198	12	the	the	DET
ahs-8094	198	13	same	same	ADJ
ahs-8094	198	14	letters	letter	NOUN
ahs-8094	198	15	within	within	ADP
ahs-8094	198	16	a	a	DET
ahs-8094	198	17	column	column	NOUN
ahs-8094	198	18	are	be	AUX
ahs-8094	198	19	not	not	PART
ahs-8094	198	20	significantly	significantly	ADV
ahs-8094	198	21	different	different	ADJ
ahs-8094	198	22	(	(	PUNCT
ahs-8094	198	23	p<0.05	p<0.05	NOUN
ahs-8094	198	24	)	)	PUNCT
ahs-8094	198	25	.	.	PUNCT
ahs-8094	199	1	n=	n=	ADJ
ahs-8094	199	2	10	10	NUM
ahs-8094	199	3	replicated	replicate	VERB
ahs-8094	199	4	thrice	thrice	NOUN
ahs-8094	199	5	.	.	PUNCT
ahs-8094	200	1	wap=	wap=	NUM
ahs-8094	200	2	weeks	week	NOUN
ahs-8094	200	3	after	after	ADP
ahs-8094	200	4	planting	plant	VERB
ahs-8094	200	5	;	;	PUNCT
ahs-8094	200	6	1	1	NUM
ahs-8094	200	7	genotypes	genotype	NOUN
ahs-8094	200	8	collected	collect	VERB
ahs-8094	200	9	from	from	ADP
ahs-8094	200	10	farmers	farmer	NOUN
ahs-8094	200	11	’	’	PART
ahs-8094	200	12	field	field	NOUN
ahs-8094	200	13	and	and	CCONJ
ahs-8094	200	14	conserved	conserve	VERB
ahs-8094	200	15	in	in	ADP
ahs-8094	200	16	rwanda	rwanda	PROPN
ahs-8094	200	17	national	national	PROPN
ahs-8094	200	18	genbank	genbank	PROPN
ahs-8094	200	19	;	;	PUNCT
ahs-8094	200	20	2	2	NUM
ahs-8094	200	21	genotypes	genotype	NOUN
ahs-8094	200	22	from	from	ADP
ahs-8094	200	23	world	world	NOUN
ahs-8094	200	24	vegetable	vegetable	NOUN
ahs-8094	200	25	center	center	NOUN
ahs-8094	200	26	;	;	PUNCT
ahs-8094	200	27	3	3	NUM
ahs-8094	200	28	varieties	variety	NOUN
ahs-8094	200	29	obtained	obtain	VERB
ahs-8094	200	30	from	from	ADP
ahs-8094	200	31	seed	seed	NOUN
ahs-8094	200	32	companies	company	NOUN
ahs-8094	200	33	and	and	CCONJ
ahs-8094	200	34	are	be	AUX
ahs-8094	200	35	grown	grow	VERB
ahs-8094	200	36	for	for	ADP
ahs-8094	200	37	commercial	commercial	ADJ
ahs-8094	200	38	purposes	purpose	NOUN
ahs-8094	200	39	in	in	ADP
ahs-8094	200	40	rwanda	rwanda	PROPN
ahs-8094	200	41	.	.	PUNCT
ahs-8094	201	1	genotype	genotype	NOUN
ahs-8094	201	2	type	type	NOUN
ahs-8094	201	3	season	season	NOUN
ahs-8094	201	4	one	one	NUM
ahs-8094	201	5	(	(	PUNCT
ahs-8094	201	6	march	march	PROPN
ahs-8094	201	7	to	to	ADP
ahs-8094	201	8	june	june	PROPN
ahs-8094	201	9	,	,	PUNCT
ahs-8094	201	10	18	18	NUM
ahs-8094	201	11	)	)	PUNCT
ahs-8094	201	12	season	season	NOUN
ahs-8094	201	13	two	two	NUM
ahs-8094	201	14	(	(	PUNCT
ahs-8094	201	15	mid­oct	mid­oct	PROPN
ahs-8094	201	16	.	.	PROPN
ahs-8094	201	17	18	18	NUM
ahs-8094	201	18	to	to	ADP
ahs-8094	201	19	march	march	PROPN
ahs-8094	201	20	,	,	PUNCT
ahs-8094	201	21	19	19	NUM
ahs-8094	201	22	)	)	PUNCT
ahs-8094	202	1	2wap	2wap	NUM
ahs-8094	202	2	4wap	4wap	NUM
ahs-8094	202	3	6wap	6wap	NUM
ahs-8094	202	4	8wap	8wap	NUM
ahs-8094	202	5	10wap	10wap	NOUN
ahs-8094	203	1	2wap	2wap	NUM
ahs-8094	203	2	4wap	4wap	NUM
ahs-8094	203	3	6wap	6wap	NUM
ahs-8094	203	4	8wap	8wap	NUM
ahs-8094	203	5	10wap	10wap	ADJ
ahs-8094	203	6	00765ppr	00765ppr	NOUN
ahs-8094	203	7	local	local	ADJ
ahs-8094	203	8	1	1	NUM
ahs-8094	203	9	0	0	NUM
ahs-8094	203	10	0	0	NUM
ahs-8094	203	11	43	43	NUM
ahs-8094	203	12	a	a	DET
ahs-8094	203	13	97	97	NUM
ahs-8094	203	14	a	a	DET
ahs-8094	203	15	100	100	NUM
ahs-8094	203	16	a	a	DET
ahs-8094	203	17	0	0	NUM
ahs-8094	203	18	3	3	NUM
ahs-8094	203	19	b	b	SYM
ahs-8094	203	20	10	10	NUM
ahs-8094	203	21	bc	bc	PROPN
ahs-8094	203	22	23	23	NUM
ahs-8094	203	23	abd	abd	NOUN
ahs-8094	203	24	33	33	NUM
ahs-8094	203	25	bcdef	bcdef	ADJ
ahs-8094	203	26	00767ppr	00767ppr	NOUN
ahs-8094	203	27	local	local	ADJ
ahs-8094	203	28	0	0	NUM
ahs-8094	203	29	0	0	NUM
ahs-8094	203	30	0	0	NUM
ahs-8094	204	1	e	e	NOUN
ahs-8094	204	2	3	3	NUM
ahs-8094	204	3	f	f	PROPN
ahs-8094	204	4	3	3	NUM
ahs-8094	204	5	f	f	NOUN
ahs-8094	204	6	0	0	NUM
ahs-8094	204	7	0	0	NUM
ahs-8094	204	8	b	b	SYM
ahs-8094	204	9	3	3	NUM
ahs-8094	204	10	c	c	NOUN
ahs-8094	204	11	10	10	NUM
ahs-8094	204	12	bcd	bcd	PROPN
ahs-8094	204	13	17	17	NUM
ahs-8094	204	14	def	def	ADJ
ahs-8094	204	15	00774ppr	00774ppr	NOUN
ahs-8094	204	16	local	local	ADJ
ahs-8094	204	17	0	0	NUM
ahs-8094	204	18	3	3	NUM
ahs-8094	204	19	33	33	NUM
ahs-8094	204	20	abc	abc	PROPN
ahs-8094	204	21	90	90	NUM
ahs-8094	204	22	ab	ab	PROPN
ahs-8094	204	23	97	97	NUM
ahs-8094	204	24	ab	ab	NOUN
ahs-8094	204	25	0	0	NUM
ahs-8094	204	26	0	0	SYM
ahs-8094	204	27	b	b	PROPN
ahs-8094	204	28	17	17	NUM
ahs-8094	204	29	ab	ab	PROPN
ahs-8094	204	30	36	36	NUM
ahs-8094	204	31	a	a	DET
ahs-8094	204	32	60	60	NUM
ahs-8094	204	33	abcd	abcd	NOUN
ahs-8094	204	34	00775ppr	00775ppr	PROPN
ahs-8094	204	35	local	local	ADJ
ahs-8094	204	36	0	0	NUM
ahs-8094	204	37	10	10	NUM
ahs-8094	204	38	33	33	NUM
ahs-8094	204	39	abc	abc	PROPN
ahs-8094	204	40	70	70	NUM
ahs-8094	204	41	bc	bc	PROPN
ahs-8094	204	42	87	87	NUM
ahs-8094	204	43	abc	abc	PROPN
ahs-8094	204	44	0	0	NUM
ahs-8094	204	45	0	0	NUM
ahs-8094	204	46	b	b	SYM
ahs-8094	204	47	7	7	NUM
ahs-8094	204	48	bc	bc	PROPN
ahs-8094	204	49	20	20	NUM
ahs-8094	204	50	abcd	abcd	PROPN
ahs-8094	204	51	77	77	NUM
ahs-8094	204	52	ab	ab	PROPN
ahs-8094	204	53	00786ppr	00786ppr	VERB
ahs-8094	204	54	local	local	ADJ
ahs-8094	204	55	0	0	NUM
ahs-8094	204	56	10	10	NUM
ahs-8094	204	57	37	37	NUM
ahs-8094	204	58	ab	ab	NUM
ahs-8094	204	59	77	77	NUM
ahs-8094	204	60	abc	abc	PROPN
ahs-8094	204	61	90	90	NUM
ahs-8094	204	62	ab	ab	NOUN
ahs-8094	204	63	0	0	NUM
ahs-8094	204	64	3	3	NUM
ahs-8094	204	65	b	b	SYM
ahs-8094	204	66	7	7	NUM
ahs-8094	204	67	bc	bc	PROPN
ahs-8094	204	68	20	20	NUM
ahs-8094	204	69	abcd	abcd	PROPN
ahs-8094	204	70	30	30	NUM
ahs-8094	204	71	cdef	cdef	NOUN
ahs-8094	204	72	00791ppr	00791ppr	NOUN
ahs-8094	204	73	local	local	ADJ
ahs-8094	204	74	0	0	NUM
ahs-8094	204	75	3	3	NUM
ahs-8094	204	76	33	33	NUM
ahs-8094	204	77	abc	abc	PROPN
ahs-8094	204	78	80	80	NUM
ahs-8094	204	79	abc	abc	PROPN
ahs-8094	204	80	93	93	NUM
ahs-8094	204	81	ab	ab	NOUN
ahs-8094	204	82	0	0	NUM
ahs-8094	204	83	0	0	NUM
ahs-8094	204	84	b	b	X
ahs-8094	204	85	0	0	NUM
ahs-8094	204	86	c	c	PROPN
ahs-8094	204	87	23	23	NUM
ahs-8094	204	88	abcd	abcd	PROPN
ahs-8094	204	89	97	97	NUM
ahs-8094	204	90	a	a	DET
ahs-8094	204	91	00792ppr	00792ppr	NUM
ahs-8094	204	92	local	local	ADJ
ahs-8094	204	93	0	0	NUM
ahs-8094	204	94	7	7	NUM
ahs-8094	204	95	30	30	NUM
ahs-8094	204	96	abcd	abcd	NOUN
ahs-8094	204	97	87	87	NUM
ahs-8094	205	1	ab	ab	PROPN
ahs-8094	205	2	97	97	NUM
ahs-8094	205	3	ab	ab	NOUN
ahs-8094	205	4	0	0	NUM
ahs-8094	205	5	0	0	NUM
ahs-8094	205	6	b	b	NOUN
ahs-8094	205	7	0	0	NUM
ahs-8094	205	8	c	c	NOUN
ahs-8094	205	9	33	33	NUM
ahs-8094	205	10	ab	ab	PROPN
ahs-8094	205	11	70	70	NUM
ahs-8094	205	12	abc	abc	PROPN
ahs-8094	205	13	00802ppr	00802ppr	NOUN
ahs-8094	205	14	local	local	ADJ
ahs-8094	205	15	0	0	NUM
ahs-8094	205	16	0	0	NUM
ahs-8094	205	17	0	0	NUM
ahs-8094	206	1	e	e	NOUN
ahs-8094	206	2	3	3	NUM
ahs-8094	206	3	f	f	PROPN
ahs-8094	206	4	10	10	NUM
ahs-8094	206	5	f	f	NOUN
ahs-8094	206	6	0	0	NUM
ahs-8094	206	7	0	0	NUM
ahs-8094	206	8	b	b	SYM
ahs-8094	206	9	3	3	NUM
ahs-8094	206	10	c	c	NOUN
ahs-8094	206	11	7	7	NUM
ahs-8094	206	12	bcd	bcd	PROPN
ahs-8094	206	13	10	10	NUM
ahs-8094	206	14	f	f	PROPN
ahs-8094	206	15	00795ppr	00795ppr	NOUN
ahs-8094	206	16	local	local	ADJ
ahs-8094	206	17	0	0	NUM
ahs-8094	206	18	0	0	NUM
ahs-8094	206	19	30	30	NUM
ahs-8094	206	20	abcd	abcd	NOUN
ahs-8094	206	21	83	83	NUM
ahs-8094	206	22	ab	ab	NUM
ahs-8094	206	23	97	97	NUM
ahs-8094	206	24	ab	ab	NOUN
ahs-8094	206	25	0	0	NUM
ahs-8094	206	26	0	0	NUM
ahs-8094	206	27	b	b	NOUN
ahs-8094	206	28	0	0	NUM
ahs-8094	206	29	c	c	PROPN
ahs-8094	206	30	20	20	NUM
ahs-8094	206	31	abcd	abcd	PROPN
ahs-8094	206	32	83	83	NUM
ahs-8094	206	33	a	a	DET
ahs-8094	206	34	pbc	pbc	PROPN
ahs-8094	206	35	462	462	NUM
ahs-8094	206	36	introduced	introduce	VERB
ahs-8094	206	37	2	2	NUM
ahs-8094	206	38	0	0	NUM
ahs-8094	206	39	0	0	NUM
ahs-8094	206	40	0	0	NUM
ahs-8094	207	1	e	e	NOUN
ahs-8094	207	2	13	13	NUM
ahs-8094	207	3	de	de	SYM
ahs-8094	207	4	30	30	NUM
ahs-8094	207	5	e	e	NOUN
ahs-8094	207	6	0	0	NUM
ahs-8094	207	7	0	0	NUM
ahs-8094	207	8	b	b	NOUN
ahs-8094	207	9	0	0	NUM
ahs-8094	207	10	c	c	NOUN
ahs-8094	207	11	3	3	NUM
ahs-8094	207	12	cd	cd	NOUN
ahs-8094	207	13	3	3	NUM
ahs-8094	207	14	f	f	PROPN
ahs-8094	207	15	pp9950­5197	pp9950­5197	NOUN
ahs-8094	207	16	introduced	introduce	VERB
ahs-8094	207	17	0	0	NUM
ahs-8094	207	18	0	0	NUM
ahs-8094	207	19	7	7	NUM
ahs-8094	207	20	de	de	PROPN
ahs-8094	207	21	10	10	NUM
ahs-8094	207	22	f	f	PROPN
ahs-8094	207	23	20	20	NUM
ahs-8094	207	24	ef	ef	NOUN
ahs-8094	207	25	0	0	NUM
ahs-8094	207	26	3	3	NUM
ahs-8094	207	27	b	b	SYM
ahs-8094	207	28	3	3	NUM
ahs-8094	207	29	c	c	NOUN
ahs-8094	207	30	3	3	NUM
ahs-8094	207	31	cd	cd	NOUN
ahs-8094	207	32	13	13	NUM
ahs-8094	207	33	ef	ef	PROPN
ahs-8094	207	34	hp	hp	PROPN
ahs-8094	207	35	0117	0117	NUM
ahs-8094	207	36	introduced	introduce	VERB
ahs-8094	207	37	0	0	NUM
ahs-8094	207	38	0	0	NUM
ahs-8094	207	39	10	10	NUM
ahs-8094	207	40	cde	cde	NOUN
ahs-8094	207	41	37	37	NUM
ahs-8094	207	42	de	de	PROPN
ahs-8094	207	43	63	63	NUM
ahs-8094	207	44	d	d	NOUN
ahs-8094	207	45	0	0	NUM
ahs-8094	207	46	0	0	NUM
ahs-8094	207	47	b	b	NOUN
ahs-8094	207	48	0	0	NUM
ahs-8094	207	49	c	c	NOUN
ahs-8094	207	50	7	7	NUM
ahs-8094	207	51	bcd	bcd	PROPN
ahs-8094	207	52	13	13	NUM
ahs-8094	207	53	ef	ef	PROPN
ahs-8094	207	54	pp9852­170	pp9852­170	PROPN
ahs-8094	207	55	introduced	introduce	VERB
ahs-8094	207	56	0	0	NUM
ahs-8094	207	57	0	0	NUM
ahs-8094	207	58	7	7	NUM
ahs-8094	207	59	de	de	SYM
ahs-8094	207	60	37	37	NUM
ahs-8094	207	61	de	de	X
ahs-8094	207	62	63	63	NUM
ahs-8094	207	63	d	d	NOUN
ahs-8094	207	64	0	0	NUM
ahs-8094	207	65	0	0	NUM
ahs-8094	207	66	b	b	NOUN
ahs-8094	207	67	0	0	NUM
ahs-8094	207	68	c	c	PROPN
ahs-8094	207	69	3	3	NUM
ahs-8094	207	70	cd	cd	PROPN
ahs-8094	207	71	10	10	NUM
ahs-8094	207	72	f	f	PROPN
ahs-8094	207	73	icpn	icpn	PROPN
ahs-8094	207	74	18­7	18­7	NUM
ahs-8094	207	75	introduced	introduce	VERB
ahs-8094	207	76	0	0	NUM
ahs-8094	207	77	0	0	NUM
ahs-8094	207	78	13	13	NUM
ahs-8094	207	79	bcde	bcde	NOUN
ahs-8094	207	80	40	40	NUM
ahs-8094	207	81	d	d	SYM
ahs-8094	207	82	63	63	NUM
ahs-8094	208	1	d	d	NOUN
ahs-8094	208	2	0	0	NUM
ahs-8094	208	3	0	0	NUM
ahs-8094	208	4	b	b	NOUN
ahs-8094	208	5	0	0	NUM
ahs-8094	209	1	c	c	NOUN
ahs-8094	209	2	0	0	PUNCT
ahs-8094	210	1	d	d	NOUN
ahs-8094	210	2	14	14	NUM
ahs-8094	210	3	f	f	NOUN
ahs-8094	210	4	long	long	ADV
ahs-8094	210	5	red	red	ADJ
ahs-8094	210	6	cayenne	cayenne	NOUN
ahs-8094	210	7	commercial	commercial	NOUN
ahs-8094	210	8	3	3	NUM
ahs-8094	210	9	0	0	NUM
ahs-8094	210	10	0	0	NUM
ahs-8094	210	11	23	23	NUM
ahs-8094	210	12	abcde	abcde	VERB
ahs-8094	210	13	77	77	NUM
ahs-8094	210	14	abc	abc	PROPN
ahs-8094	210	15	90	90	NUM
ahs-8094	210	16	ab	ab	NOUN
ahs-8094	210	17	0	0	NUM
ahs-8094	210	18	3	3	NUM
ahs-8094	210	19	b	b	SYM
ahs-8094	210	20	10	10	NUM
ahs-8094	210	21	bc	bc	PROPN
ahs-8094	210	22	27	27	NUM
ahs-8094	210	23	abcd	abcd	PROPN
ahs-8094	210	24	57	57	NUM
ahs-8094	210	25	abcde	abcde	NOUN
ahs-8094	210	26	bird	bird	PROPN
ahs-8094	210	27	eye	eye	NOUN
ahs-8094	210	28	hybrid	hybrid	ADJ
ahs-8094	210	29	commercial	commercial	NOUN
ahs-8094	210	30	0	0	NUM
ahs-8094	210	31	0	0	NUM
ahs-8094	210	32	7	7	NUM
ahs-8094	210	33	de	de	SYM
ahs-8094	210	34	40	40	NUM
ahs-8094	210	35	d	d	SYM
ahs-8094	210	36	70	70	NUM
ahs-8094	210	37	cd	cd	NOUN
ahs-8094	210	38	0	0	NUM
ahs-8094	210	39	0	0	NUM
ahs-8094	210	40	b	b	SYM
ahs-8094	210	41	10	10	NUM
ahs-8094	210	42	bc	bc	PROPN
ahs-8094	210	43	33	33	NUM
ahs-8094	210	44	ab	ab	PROPN
ahs-8094	210	45	73	73	NUM
ahs-8094	210	46	abc	abc	PROPN
ahs-8094	210	47	red	red	PROPN
ahs-8094	210	48	scotch	scotch	PROPN
ahs-8094	210	49	bonnet	bonnet	PROPN
ahs-8094	210	50	commercial	commercial	NOUN
ahs-8094	210	51	0	0	NUM
ahs-8094	210	52	3	3	NUM
ahs-8094	210	53	33	33	NUM
ahs-8094	210	54	abc	abc	PROPN
ahs-8094	210	55	57	57	NUM
ahs-8094	210	56	cd	cd	PROPN
ahs-8094	210	57	80	80	NUM
ahs-8094	210	58	bcd	bcd	NOUN
ahs-8094	210	59	0	0	NUM
ahs-8094	210	60	0	0	NUM
ahs-8094	210	61	b	b	SYM
ahs-8094	210	62	10	10	NUM
ahs-8094	210	63	bc	bc	PROPN
ahs-8094	210	64	23	23	NUM
ahs-8094	210	65	abd	abd	PROPN
ahs-8094	210	66	70	70	NUM
ahs-8094	210	67	abc	abc	PROPN
ahs-8094	210	68	california	california	PROPN
ahs-8094	210	69	wonder	wonder	PROPN
ahs-8094	210	70	commercial	commercial	ADJ
ahs-8094	210	71	0	0	NUM
ahs-8094	210	72	0	0	NUM
ahs-8094	210	73	37	37	NUM
ahs-8094	210	74	ab	ab	PROPN
ahs-8094	210	75	83	83	NUM
ahs-8094	210	76	ab	ab	PROPN
ahs-8094	210	77	100	100	NUM
ahs-8094	210	78	a	a	DET
ahs-8094	210	79	0	0	NUM
ahs-8094	210	80	13	13	NUM
ahs-8094	210	81	a	a	DET
ahs-8094	210	82	23	23	NUM
ahs-8094	210	83	a	a	DET
ahs-8094	210	84	30	30	NUM
ahs-8094	210	85	abc	abc	PROPN
ahs-8094	210	86	83	83	NUM
ahs-8094	210	87	a	a	DET
ahs-8094	210	88	lsd	lsd	NOUN
ahs-8094	210	89	(	(	PUNCT
ahs-8094	210	90	0.05	0.05	NUM
ahs-8094	210	91	)	)	PUNCT
ahs-8094	210	92	10	10	NUM
ahs-8094	210	93	24	24	NUM
ahs-8094	210	94	26	26	NUM
ahs-8094	210	95	19	19	NUM
ahs-8094	210	96	5	5	NUM
ahs-8094	210	97	11	11	NUM
ahs-8094	210	98	28	28	NUM
ahs-8094	210	99	46	46	NUM
ahs-8094	210	100	p­value	p­value	NOUN
ahs-8094	210	101	0.3699	0.3699	NUM
ahs-8094	210	102	0.0027	0.0027	NUM
ahs-8094	210	103	<	<	X
ahs-8094	210	104	.0001	.0001	X
ahs-8094	210	105	<	<	X
ahs-8094	210	106	.0001	.0001	X
ahs-8094	210	107	0.0002	0.0002	NUM
ahs-8094	210	108	0.0167	0.0167	NUM
ahs-8094	210	109	<	<	X
ahs-8094	210	110	.0001	.0001	X
ahs-8094	210	111	<	<	X
ahs-8094	210	112	.0001	.0001	X
ahs-8094	210	113	adv	adv	PROPN
ahs-8094	210	114	.	.	PUNCT
ahs-8094	210	115	hort	hort	PROPN
ahs-8094	210	116	.	.	PUNCT
ahs-8094	211	1	sci	sci	PROPN
ahs-8094	211	2	.	.	PROPN
ahs-8094	211	3	,	,	PUNCT
ahs-8094	211	4	2020	2020	NUM
ahs-8094	211	5	34(4	34(4	NUM
ahs-8094	211	6	):	):	PUNCT
ahs-8094	211	7	397­412	397­412	NUM
ahs-8094	211	8	404	404	NUM
ahs-8094	211	9	genotype	genotype	NOUN
ahs-8094	211	10	season	season	NOUN
ahs-8094	211	11	one	one	NUM
ahs-8094	211	12	(	(	PUNCT
ahs-8094	211	13	march	march	PROPN
ahs-8094	211	14	to	to	ADP
ahs-8094	211	15	june	june	PROPN
ahs-8094	211	16	,	,	PUNCT
ahs-8094	211	17	18	18	NUM
ahs-8094	211	18	)	)	PUNCT
ahs-8094	211	19	season	season	NOUN
ahs-8094	211	20	two	two	NUM
ahs-8094	211	21	(	(	PUNCT
ahs-8094	211	22	mid­oct	mid­oct	PROPN
ahs-8094	211	23	.	.	PROPN
ahs-8094	211	24	18	18	NUM
ahs-8094	211	25	to	to	ADP
ahs-8094	211	26	march	march	PROPN
ahs-8094	211	27	,	,	PUNCT
ahs-8094	211	28	19	19	NUM
ahs-8094	211	29	)	)	PUNCT
ahs-8094	211	30	type	type	NOUN
ahs-8094	211	31	2wap	2wap	NUM
ahs-8094	211	32	4wap	4wap	NUM
ahs-8094	211	33	6wap	6wap	NUM
ahs-8094	211	34	8wap	8wap	NUM
ahs-8094	211	35	10wap	10wap	NOUN
ahs-8094	212	1	2wap	2wap	NUM
ahs-8094	212	2	4wap	4wap	NUM
ahs-8094	212	3	6wap	6wap	NUM
ahs-8094	212	4	8wap	8wap	NUM
ahs-8094	212	5	10wap	10wap	ADJ
ahs-8094	212	6	00765ppr	00765ppr	NOUN
ahs-8094	212	7	local	local	ADJ
ahs-8094	212	8	1	1	NUM
ahs-8094	212	9	0	0	NUM
ahs-8094	212	10	0	0	NUM
ahs-8094	212	11	0	0	NUM
ahs-8094	213	1	d	d	NOUN
ahs-8094	213	2	90	90	NUM
ahs-8094	213	3	a	a	DET
ahs-8094	213	4	97	97	NUM
ahs-8094	213	5	ab	ab	NOUN
ahs-8094	213	6	0	0	NUM
ahs-8094	213	7	0	0	NUM
ahs-8094	213	8	3	3	NUM
ahs-8094	213	9	33becd	33becd	NUM
ahs-8094	213	10	70	70	NUM
ahs-8094	213	11	abc	abc	PROPN
ahs-8094	213	12	00767ppr	00767ppr	NOUN
ahs-8094	213	13	local	local	ADJ
ahs-8094	213	14	0	0	NUM
ahs-8094	213	15	0	0	NUM
ahs-8094	213	16	17	17	NUM
ahs-8094	213	17	cd	cd	NOUN
ahs-8094	213	18	40	40	NUM
ahs-8094	213	19	bc	bc	PROPN
ahs-8094	213	20	87	87	NUM
ahs-8094	213	21	abc	abc	PROPN
ahs-8094	213	22	0	0	NUM
ahs-8094	213	23	0	0	NUM
ahs-8094	213	24	0	0	NUM
ahs-8094	213	25	0	0	NUM
ahs-8094	214	1	e	e	NOUN
ahs-8094	214	2	10	10	NUM
ahs-8094	214	3	f	f	NOUN
ahs-8094	214	4	00774ppr	00774ppr	NOUN
ahs-8094	214	5	local	local	ADJ
ahs-8094	214	6	0	0	NUM
ahs-8094	214	7	3	3	NUM
ahs-8094	214	8	17	17	NUM
ahs-8094	214	9	cd	cd	NOUN
ahs-8094	214	10	90	90	NUM
ahs-8094	214	11	a	a	DET
ahs-8094	214	12	100	100	NUM
ahs-8094	214	13	a	a	DET
ahs-8094	214	14	0	0	NUM
ahs-8094	214	15	0	0	NUM
ahs-8094	214	16	10	10	NUM
ahs-8094	214	17	63	63	NUM
ahs-8094	214	18	ab	ab	NUM
ahs-8094	214	19	83	83	NUM
ahs-8094	214	20	ab	ab	PROPN
ahs-8094	214	21	00775ppr	00775ppr	PROPN
ahs-8094	214	22	local	local	ADJ
ahs-8094	214	23	0	0	NUM
ahs-8094	214	24	0	0	NUM
ahs-8094	214	25	13	13	NUM
ahs-8094	214	26	cd	cd	NOUN
ahs-8094	214	27	77	77	NUM
ahs-8094	214	28	ab	ab	PROPN
ahs-8094	214	29	97	97	NUM
ahs-8094	214	30	ab	ab	NOUN
ahs-8094	214	31	0	0	NUM
ahs-8094	214	32	0	0	NUM
ahs-8094	214	33	3	3	NUM
ahs-8094	214	34	13	13	NUM
ahs-8094	214	35	de	de	SYM
ahs-8094	214	36	53	53	NUM
ahs-8094	214	37	bcde	bcde	NOUN
ahs-8094	214	38	00786ppr	00786ppr	VERB
ahs-8094	214	39	local	local	ADJ
ahs-8094	214	40	0	0	NUM
ahs-8094	214	41	3	3	NUM
ahs-8094	214	42	13	13	NUM
ahs-8094	214	43	cd	cd	NOUN
ahs-8094	214	44	100	100	NUM
ahs-8094	214	45	a	a	DET
ahs-8094	214	46	100	100	NUM
ahs-8094	214	47	a	a	DET
ahs-8094	214	48	0	0	NUM
ahs-8094	214	49	0	0	NUM
ahs-8094	214	50	0	0	NUM
ahs-8094	214	51	57	57	NUM
ahs-8094	214	52	bc	bc	PROPN
ahs-8094	214	53	73	73	NUM
ahs-8094	214	54	a	a	DET
ahs-8094	214	55	00791ppr	00791ppr	NUM
ahs-8094	214	56	local	local	ADJ
ahs-8094	214	57	0	0	NUM
ahs-8094	214	58	0	0	NUM
ahs-8094	214	59	17	17	NUM
ahs-8094	214	60	cd	cd	NOUN
ahs-8094	214	61	97	97	NUM
ahs-8094	214	62	a	a	DET
ahs-8094	214	63	100	100	NUM
ahs-8094	214	64	a	a	DET
ahs-8094	214	65	0	0	NUM
ahs-8094	214	66	0	0	NUM
ahs-8094	214	67	0	0	NUM
ahs-8094	214	68	17	17	NUM
ahs-8094	214	69	cde	cde	NOUN
ahs-8094	214	70	83	83	NUM
ahs-8094	214	71	ab	ab	PROPN
ahs-8094	214	72	00792ppr	00792ppr	PROPN
ahs-8094	214	73	local	local	ADJ
ahs-8094	214	74	0	0	NUM
ahs-8094	214	75	7	7	NUM
ahs-8094	214	76	23	23	NUM
ahs-8094	214	77	abc	abc	PROPN
ahs-8094	214	78	100	100	NUM
ahs-8094	214	79	a	a	DET
ahs-8094	214	80	100	100	NUM
ahs-8094	214	81	a	a	DET
ahs-8094	214	82	0	0	NUM
ahs-8094	214	83	0	0	NUM
ahs-8094	214	84	10	10	NUM
ahs-8094	214	85	60	60	NUM
ahs-8094	214	86	ab	ab	PROPN
ahs-8094	214	87	87	87	NUM
ahs-8094	214	88	ab	ab	PROPN
ahs-8094	214	89	00802ppr	00802ppr	NOUN
ahs-8094	214	90	local	local	ADJ
ahs-8094	214	91	0	0	NUM
ahs-8094	214	92	0	0	NUM
ahs-8094	214	93	0	0	NUM
ahs-8094	215	1	d	d	NOUN
ahs-8094	215	2	43	43	NUM
ahs-8094	215	3	b	b	SYM
ahs-8094	215	4	63	63	NUM
ahs-8094	215	5	cd	cd	NOUN
ahs-8094	215	6	0	0	NUM
ahs-8094	215	7	0	0	NUM
ahs-8094	215	8	0	0	NUM
ahs-8094	215	9	40	40	NUM
ahs-8094	215	10	bcde	bcde	NOUN
ahs-8094	215	11	60	60	NUM
ahs-8094	215	12	bcd	bcd	PROPN
ahs-8094	215	13	00795ppr	00795ppr	NOUN
ahs-8094	215	14	local	local	ADJ
ahs-8094	215	15	0	0	NUM
ahs-8094	215	16	3	3	NUM
ahs-8094	215	17	17	17	NUM
ahs-8094	215	18	cd	cd	PROPN
ahs-8094	215	19	97	97	NUM
ahs-8094	215	20	a	a	DET
ahs-8094	215	21	100	100	NUM
ahs-8094	215	22	a	a	DET
ahs-8094	215	23	0	0	NUM
ahs-8094	215	24	0	0	NUM
ahs-8094	215	25	0	0	NUM
ahs-8094	215	26	27	27	NUM
ahs-8094	215	27	bcde	bcde	VERB
ahs-8094	215	28	80	80	NUM
ahs-8094	215	29	ab	ab	PROPN
ahs-8094	215	30	pbc	pbc	PROPN
ahs-8094	215	31	462	462	NUM
ahs-8094	215	32	introduced	introduce	VERB
ahs-8094	215	33	2	2	NUM
ahs-8094	215	34	0	0	NUM
ahs-8094	215	35	0	0	NUM
ahs-8094	215	36	0	0	NUM
ahs-8094	216	1	d	d	NOUN
ahs-8094	216	2	0	0	PUNCT
ahs-8094	217	1	d	d	NOUN
ahs-8094	217	2	13	13	NUM
ahs-8094	217	3	f	f	NOUN
ahs-8094	217	4	0	0	NUM
ahs-8094	217	5	0	0	NUM
ahs-8094	217	6	0	0	NUM
ahs-8094	217	7	7	7	NUM
ahs-8094	217	8	efg	efg	NOUN
ahs-8094	217	9	20	20	NUM
ahs-8094	217	10	ef	ef	PROPN
ahs-8094	217	11	pp9950­5197	pp9950­5197	PROPN
ahs-8094	217	12	introduced	introduce	VERB
ahs-8094	217	13	0	0	NUM
ahs-8094	217	14	0	0	NUM
ahs-8094	217	15	0	0	NUM
ahs-8094	218	1	d	d	NOUN
ahs-8094	218	2	10	10	NUM
ahs-8094	218	3	d	d	NUM
ahs-8094	218	4	47	47	NUM
ahs-8094	218	5	de	de	SYM
ahs-8094	218	6	0	0	NUM
ahs-8094	218	7	0	0	NUM
ahs-8094	218	8	0	0	NUM
ahs-8094	218	9	3	3	NUM
ahs-8094	218	10	de	de	SYM
ahs-8094	218	11	13	13	NUM
ahs-8094	218	12	f	f	PROPN
ahs-8094	218	13	hp	hp	PROPN
ahs-8094	218	14	0117	0117	NUM
ahs-8094	218	15	introduced	introduce	VERB
ahs-8094	218	16	0	0	NUM
ahs-8094	218	17	0	0	NUM
ahs-8094	218	18	0	0	NUM
ahs-8094	219	1	d	d	SYM
ahs-8094	219	2	17	17	NUM
ahs-8094	219	3	bcd	bcd	PROPN
ahs-8094	219	4	70	70	NUM
ahs-8094	219	5	cd	cd	NOUN
ahs-8094	219	6	0	0	NUM
ahs-8094	219	7	0	0	NUM
ahs-8094	219	8	7	7	NUM
ahs-8094	219	9	33	33	NUM
ahs-8094	219	10	bcde	bcde	NOUN
ahs-8094	219	11	53	53	NUM
ahs-8094	219	12	bcde	bcde	PROPN
ahs-8094	219	13	pp9852­170	pp9852­170	PROPN
ahs-8094	219	14	introduced	introduce	VERB
ahs-8094	219	15	0	0	NUM
ahs-8094	219	16	0	0	NUM
ahs-8094	219	17	0	0	NUM
ahs-8094	220	1	d	d	SYM
ahs-8094	220	2	17	17	NUM
ahs-8094	220	3	bcd	bcd	PROPN
ahs-8094	220	4	73	73	NUM
ahs-8094	220	5	bc	bc	PROPN
ahs-8094	220	6	0	0	NUM
ahs-8094	220	7	0	0	NUM
ahs-8094	220	8	3	3	NUM
ahs-8094	220	9	23	23	NUM
ahs-8094	220	10	bcde	bcde	VERB
ahs-8094	220	11	33	33	NUM
ahs-8094	220	12	cdef	cdef	NOUN
ahs-8094	220	13	icpn	icpn	NOUN
ahs-8094	220	14	18­7	18­7	NUM
ahs-8094	220	15	introduced	introduce	VERB
ahs-8094	220	16	0	0	NUM
ahs-8094	220	17	0	0	NUM
ahs-8094	220	18	7	7	NUM
ahs-8094	220	19	cd	cd	NOUN
ahs-8094	220	20	14	14	NUM
ahs-8094	220	21	cd	cd	PROPN
ahs-8094	220	22	30	30	NUM
ahs-8094	220	23	ef	ef	NOUN
ahs-8094	220	24	0	0	NUM
ahs-8094	220	25	0	0	NUM
ahs-8094	220	26	0	0	NUM
ahs-8094	220	27	7	7	NUM
ahs-8094	220	28	de	de	SYM
ahs-8094	220	29	23	23	NUM
ahs-8094	220	30	def	def	ADJ
ahs-8094	220	31	long	long	ADJ
ahs-8094	220	32	red	red	ADJ
ahs-8094	220	33	cayenne	cayenne	NOUN
ahs-8094	220	34	commercial	commercial	NOUN
ahs-8094	220	35	3	3	NUM
ahs-8094	220	36	0	0	NUM
ahs-8094	220	37	3	3	NUM
ahs-8094	220	38	13	13	NUM
ahs-8094	220	39	cd	cd	NOUN
ahs-8094	220	40	87	87	NUM
ahs-8094	220	41	a	a	DET
ahs-8094	220	42	100	100	NUM
ahs-8094	220	43	a	a	DET
ahs-8094	220	44	0	0	NUM
ahs-8094	220	45	0	0	NUM
ahs-8094	220	46	10	10	NUM
ahs-8094	220	47	100	100	NUM
ahs-8094	220	48	a	a	DET
ahs-8094	220	49	100	100	NUM
ahs-8094	220	50	a	a	DET
ahs-8094	220	51	bird	bird	NOUN
ahs-8094	220	52	eye	eye	NOUN
ahs-8094	220	53	hybrid	hybrid	ADJ
ahs-8094	220	54	commercial	commercial	NOUN
ahs-8094	220	55	0	0	NUM
ahs-8094	220	56	7	7	NUM
ahs-8094	220	57	37	37	NUM
ahs-8094	220	58	ab	ab	PROPN
ahs-8094	220	59	100	100	NUM
ahs-8094	220	60	a	a	DET
ahs-8094	220	61	100	100	NUM
ahs-8094	220	62	a	a	DET
ahs-8094	220	63	0	0	NUM
ahs-8094	220	64	0	0	NUM
ahs-8094	220	65	10	10	NUM
ahs-8094	220	66	43	43	NUM
ahs-8094	220	67	bcd	bcd	PROPN
ahs-8094	220	68	60	60	NUM
ahs-8094	220	69	bcd	bcd	PROPN
ahs-8094	220	70	red	red	ADJ
ahs-8094	220	71	scotch	scotch	NOUN
ahs-8094	220	72	bonnet	bonnet	NOUN
ahs-8094	220	73	commercial	commercial	NOUN
ahs-8094	220	74	0	0	NUM
ahs-8094	220	75	0	0	NUM
ahs-8094	220	76	20	20	NUM
ahs-8094	220	77	bc	bc	PROPN
ahs-8094	220	78	90	90	NUM
ahs-8094	220	79	a	a	DET
ahs-8094	220	80	100	100	NUM
ahs-8094	220	81	a	a	DET
ahs-8094	220	82	0	0	NUM
ahs-8094	220	83	0	0	NUM
ahs-8094	220	84	3	3	NUM
ahs-8094	220	85	33	33	NUM
ahs-8094	220	86	bcde	bcde	NOUN
ahs-8094	220	87	70	70	NUM
ahs-8094	220	88	abc	abc	PROPN
ahs-8094	220	89	california	california	PROPN
ahs-8094	220	90	wonder	wonder	PROPN
ahs-8094	220	91	commercial	commercial	ADJ
ahs-8094	220	92	0	0	NUM
ahs-8094	220	93	13	13	NUM
ahs-8094	220	94	40	40	NUM
ahs-8094	220	95	a	a	DET
ahs-8094	220	96	93	93	NUM
ahs-8094	220	97	a	a	DET
ahs-8094	220	98	100	100	NUM
ahs-8094	220	99	a	a	DET
ahs-8094	220	100	0	0	NUM
ahs-8094	220	101	0	0	NUM
ahs-8094	220	102	20	20	NUM
ahs-8094	220	103	100	100	NUM
ahs-8094	220	104	a	a	DET
ahs-8094	220	105	100	100	NUM
ahs-8094	220	106	a	a	DET
ahs-8094	220	107	lsd	lsd	NOUN
ahs-8094	220	108	(	(	PUNCT
ahs-8094	220	109	0.05	0.05	NUM
ahs-8094	220	110	)	)	PUNCT
ahs-8094	220	111	9	9	NUM
ahs-8094	220	112	18	18	NUM
ahs-8094	220	113	29	29	NUM
ahs-8094	220	114	24	24	NUM
ahs-8094	220	115	13	13	NUM
ahs-8094	220	116	40	40	NUM
ahs-8094	220	117	39	39	NUM
ahs-8094	220	118	p­value	p­value	NOUN
ahs-8094	220	119	0.2336	0.2336	NUM
ahs-8094	220	120	0.0006	0.0006	NUM
ahs-8094	220	121	<	<	X
ahs-8094	220	122	.0001	.0001	X
ahs-8094	220	123	<	<	X
ahs-8094	220	124	.0001	.0001	X
ahs-8094	220	125	0.1196	0.1196	NUM
ahs-8094	220	126	<	<	X
ahs-8094	220	127	.0001	.0001	X
ahs-8094	220	128	<	<	X
ahs-8094	220	129	.0001	.0001	X
ahs-8094	220	130	table	table	NOUN
ahs-8094	220	131	5	5	NUM
ahs-8094	220	132	­	­	NOUN
ahs-8094	220	133	incidence	incidence	NOUN
ahs-8094	220	134	(	(	PUNCT
ahs-8094	220	135	%	%	NOUN
ahs-8094	220	136	)	)	PUNCT
ahs-8094	220	137	of	of	ADP
ahs-8094	220	138	viral	viral	ADJ
ahs-8094	220	139	diseases	disease	NOUN
ahs-8094	220	140	recorded	record	VERB
ahs-8094	220	141	on	on	ADP
ahs-8094	220	142	eighteen	eighteen	NUM
ahs-8094	220	143	hot	hot	ADJ
ahs-8094	220	144	pepper	pepper	NOUN
ahs-8094	220	145	genotypes	genotype	NOUN
ahs-8094	220	146	grown	grow	VERB
ahs-8094	220	147	under	under	ADP
ahs-8094	220	148	field	field	NOUN
ahs-8094	220	149	conditions	condition	NOUN
ahs-8094	220	150	during	during	ADP
ahs-8094	220	151	two	two	NUM
ahs-8094	220	152	seasons	season	NOUN
ahs-8094	220	153	at	at	ADP
ahs-8094	220	154	gashora	gashora	NOUN
ahs-8094	220	155	station	station	NOUN
ahs-8094	220	156	,	,	PUNCT
ahs-8094	220	157	bugesera	bugesera	PROPN
ahs-8094	220	158	district	district	NOUN
ahs-8094	220	159	in	in	ADP
ahs-8094	220	160	rwanda	rwanda	PROPN
ahs-8094	220	161	the	the	DET
ahs-8094	220	162	values	value	NOUN
ahs-8094	220	163	represent	represent	VERB
ahs-8094	220	164	means	mean	NOUN
ahs-8094	220	165	of	of	ADP
ahs-8094	220	166	un­transformed	un­transformed	PROPN
ahs-8094	220	167	data	datum	NOUN
ahs-8094	220	168	.	.	PUNCT
ahs-8094	221	1	means	mean	VERB
ahs-8094	221	2	comparison	comparison	NOUN
ahs-8094	221	3	done	do	VERB
ahs-8094	221	4	by	by	ADP
ahs-8094	221	5	least	least	ADJ
ahs-8094	221	6	significant	significant	ADJ
ahs-8094	221	7	difference	difference	NOUN
ahs-8094	221	8	(	(	PUNCT
ahs-8094	221	9	lsd	lsd	NOUN
ahs-8094	221	10	)	)	PUNCT
ahs-8094	221	11	test	test	NOUN
ahs-8094	221	12	on	on	ADP
ahs-8094	221	13	transformed	transform	VERB
ahs-8094	221	14	data	datum	NOUN
ahs-8094	221	15	.	.	PUNCT
ahs-8094	222	1	data	datum	NOUN
ahs-8094	222	2	transformed	transform	VERB
ahs-8094	222	3	by	by	ADP
ahs-8094	222	4	square	square	ADJ
ahs-8094	222	5	root	root	NOUN
ahs-8094	222	6	(	(	PUNCT
ahs-8094	222	7	x+1	x+1	NUM
ahs-8094	222	8	)	)	PUNCT
ahs-8094	222	9	;	;	PUNCT
ahs-8094	222	10	means	mean	VERB
ahs-8094	222	11	with	with	ADP
ahs-8094	222	12	the	the	DET
ahs-8094	222	13	same	same	ADJ
ahs-8094	222	14	letters	letter	NOUN
ahs-8094	222	15	within	within	ADP
ahs-8094	222	16	a	a	DET
ahs-8094	222	17	column	column	NOUN
ahs-8094	222	18	are	be	AUX
ahs-8094	222	19	not	not	PART
ahs-8094	222	20	significantly	significantly	ADV
ahs-8094	222	21	different	different	ADJ
ahs-8094	222	22	(	(	PUNCT
ahs-8094	222	23	p<0.05	p<0.05	NOUN
ahs-8094	222	24	)	)	PUNCT
ahs-8094	222	25	.	.	PUNCT
ahs-8094	223	1	n=	n=	ADJ
ahs-8094	223	2	10	10	NUM
ahs-8094	223	3	replicated	replicate	VERB
ahs-8094	223	4	thrice	thrice	NOUN
ahs-8094	223	5	;	;	PUNCT
ahs-8094	223	6	wap=	wap=	NUM
ahs-8094	223	7	weeks	week	NOUN
ahs-8094	223	8	after	after	ADP
ahs-8094	223	9	planting	plant	VERB
ahs-8094	223	10	;	;	PUNCT
ahs-8094	223	11	1	1	NUM
ahs-8094	223	12	genotypes	genotype	NOUN
ahs-8094	223	13	collected	collect	VERB
ahs-8094	223	14	from	from	ADP
ahs-8094	223	15	farmers	farmer	NOUN
ahs-8094	223	16	’	’	PART
ahs-8094	223	17	field	field	NOUN
ahs-8094	223	18	and	and	CCONJ
ahs-8094	223	19	conserved	conserve	VERB
ahs-8094	223	20	in	in	ADP
ahs-8094	223	21	rwanda	rwanda	PROPN
ahs-8094	223	22	national	national	PROPN
ahs-8094	223	23	genbank	genbank	PROPN
ahs-8094	223	24	;	;	PUNCT
ahs-8094	223	25	2	2	NUM
ahs-8094	223	26	genotypes	genotype	NOUN
ahs-8094	223	27	from	from	ADP
ahs-8094	223	28	world	world	NOUN
ahs-8094	223	29	vegetable	vegetable	NOUN
ahs-8094	223	30	center	center	NOUN
ahs-8094	223	31	;	;	PUNCT
ahs-8094	223	32	3	3	NUM
ahs-8094	223	33	varieties	variety	NOUN
ahs-8094	223	34	obtained	obtain	VERB
ahs-8094	223	35	from	from	ADP
ahs-8094	223	36	seed	seed	NOUN
ahs-8094	223	37	companies	company	NOUN
ahs-8094	223	38	and	and	CCONJ
ahs-8094	223	39	are	be	AUX
ahs-8094	223	40	grown	grow	VERB
ahs-8094	223	41	for	for	ADP
ahs-8094	223	42	commercial	commercial	ADJ
ahs-8094	223	43	purposes	purpose	NOUN
ahs-8094	223	44	in	in	ADP
ahs-8094	223	45	rwanda	rwanda	PROPN
ahs-8094	223	46	.	.	PUNCT
ahs-8094	224	1	genotype	genotype	NOUN
ahs-8094	224	2	audpc	audpc	NOUN
ahs-8094	224	3	in	in	ADP
ahs-8094	224	4	rubona	rubona	PROPN
ahs-8094	224	5	site	site	NOUN
ahs-8094	224	6	audpc	audpc	NOUN
ahs-8094	224	7	in	in	ADP
ahs-8094	224	8	gashora	gashora	PROPN
ahs-8094	224	9	site	site	NOUN
ahs-8094	224	10	pooled	pool	VERB
ahs-8094	224	11	season	season	NOUN
ahs-8094	224	12	one	one	NUM
ahs-8094	224	13	season	season	NOUN
ahs-8094	224	14	two	two	NUM
ahs-8094	224	15	season	season	NOUN
ahs-8094	224	16	one	one	NUM
ahs-8094	224	17	season	season	NOUN
ahs-8094	224	18	two	two	NUM
ahs-8094	224	19	00765ppr	00765ppr	NOUN
ahs-8094	224	20	240	240	NUM
ahs-8094	224	21	cdef	cdef	NOUN
ahs-8094	224	22	86	86	NUM
ahs-8094	224	23	bcd	bcd	PROPN
ahs-8094	224	24	264	264	NUM
ahs-8094	224	25	c	c	NOUN
ahs-8094	224	26	203	203	NUM
ahs-8094	224	27	cdefg	cdefg	PROPN
ahs-8094	224	28	197cd	197cd	ADJ
ahs-8094	224	29	00767ppr	00767ppr	NOUN
ahs-8094	224	30	9	9	NUM
ahs-8094	224	31	h	h	NOUN
ahs-8094	224	32	33	33	NUM
ahs-8094	224	33	cd	cd	NOUN
ahs-8094	224	34	146	146	NUM
ahs-8094	225	1	d	d	SYM
ahs-8094	225	2	22	22	NUM
ahs-8094	225	3	h	h	NOUN
ahs-8094	225	4	52	52	NUM
ahs-8094	225	5	e	e	NOUN
ahs-8094	225	6	00774ppr	00774ppr	NOUN
ahs-8094	225	7	294	294	NUM
ahs-8094	225	8	abc	abc	PROPN
ahs-8094	225	9	178	178	NUM
ahs-8094	225	10	ab	ab	PROPN
ahs-8094	225	11	298	298	NUM
ahs-8094	225	12	bc	bc	PROPN
ahs-8094	225	13	334	334	NUM
ahs-8094	225	14	abc	abc	PROPN
ahs-8094	225	15	279	279	NUM
ahs-8094	225	16	abc	abc	PROPN
ahs-8094	225	17	00775ppr	00775ppr	PROPN
ahs-8094	225	18	281	281	NUM
ahs-8094	225	19	bcd	bcd	PROPN
ahs-8094	225	20	191	191	NUM
ahs-8094	225	21	ab	ab	PROPN
ahs-8094	225	22	315	315	NUM
ahs-8094	225	23	bc	bc	PROPN
ahs-8094	225	24	129	129	NUM
ahs-8094	225	25	efgh	efgh	NOUN
ahs-8094	225	26	233	233	NUM
ahs-8094	225	27	bc	bc	PROPN
ahs-8094	225	28	00786ppr	00786ppr	VERB
ahs-8094	225	29	364	364	NUM
ahs-8094	225	30	ab	ab	NUM
ahs-8094	225	31	95	95	NUM
ahs-8094	225	32	bcd	bcd	PROPN
ahs-8094	225	33	311	311	NUM
ahs-8094	225	34	bc	bc	PROPN
ahs-8094	225	35	272	272	NUM
ahs-8094	225	36	cde	cde	PROPN
ahs-8094	225	37	261	261	NUM
ahs-8094	225	38	abc	abc	PROPN
ahs-8094	225	39	00791ppr	00791ppr	NOUN
ahs-8094	225	40	320	320	NUM
ahs-8094	225	41	abc	abc	PROPN
ahs-8094	225	42	207	207	NUM
ahs-8094	225	43	ab	ab	PROPN
ahs-8094	225	44	316	316	NUM
ahs-8094	225	45	abc	abc	PROPN
ahs-8094	225	46	191	191	NUM
ahs-8094	225	47	cdefg	cdefg	NOUN
ahs-8094	225	48	259	259	NUM
ahs-8094	225	49	abc	abc	PROPN
ahs-8094	225	50	00792ppr	00792ppr	NUM
ahs-8094	226	1	398	398	NUM
ahs-8094	226	2	a	a	DET
ahs-8094	226	3	199	199	NUM
ahs-8094	226	4	ab	ab	PROPN
ahs-8094	226	5	388	388	NUM
ahs-8094	226	6	a	a	DET
ahs-8094	226	7	300	300	NUM
ahs-8094	226	8	bcd	bcd	PROPN
ahs-8094	226	9	321	321	NUM
ahs-8094	226	10	ab	ab	PROPN
ahs-8094	226	11	00802ppr	00802ppr	NOUN
ahs-8094	226	12	21	21	NUM
ahs-8094	226	13	h	h	NOUN
ahs-8094	226	14	34	34	NUM
ahs-8094	226	15	cd	cd	NOUN
ahs-8094	226	16	149	149	NUM
ahs-8094	226	17	d	d	NUM
ahs-8094	226	18	169	169	NUM
ahs-8094	226	19	defgh	defgh	NOUN
ahs-8094	226	20	93	93	NUM
ahs-8094	226	21	e	e	NOUN
ahs-8094	226	22	00795ppr	00795ppr	NOUN
ahs-8094	226	23	273	273	NUM
ahs-8094	226	24	bcde	bcde	VERB
ahs-8094	226	25	179	179	NUM
ahs-8094	226	26	ab	ab	PROPN
ahs-8094	226	27	333	333	NUM
ahs-8094	226	28	abc	abc	PROPN
ahs-8094	226	29	240	240	NUM
ahs-8094	226	30	cdef	cdef	NOUN
ahs-8094	226	31	257	257	NUM
ahs-8094	226	32	abc	abc	PROPN
ahs-8094	226	33	pbc	pbc	PROPN
ahs-8094	226	34	462	462	NUM
ahs-8094	226	35	63	63	NUM
ahs-8094	226	36	gh	gh	PROPN
ahs-8094	226	37	15	15	NUM
ahs-8094	226	38	d	d	NOUN
ahs-8094	226	39	78	78	NUM
ahs-8094	226	40	d	d	SYM
ahs-8094	226	41	57	57	NUM
ahs-8094	226	42	gh	gh	PROPN
ahs-8094	226	43	55	55	NUM
ahs-8094	226	44	e	e	NOUN
ahs-8094	226	45	pp9950­5197	pp9950­5197	NOUN
ahs-8094	226	46	62	62	NUM
ahs-8094	226	47	gh	gh	PROPN
ahs-8094	226	48	52	52	NUM
ahs-8094	226	49	cd	cd	NOUN
ahs-8094	226	50	83	83	NUM
ahs-8094	226	51	d	d	SYM
ahs-8094	226	52	30	30	NUM
ahs-8094	226	53	h	h	NOUN
ahs-8094	226	54	56	56	NUM
ahs-8094	226	55	e	e	NOUN
ahs-8094	226	56	hp	hp	X
ahs-8094	226	57	0117	0117	NUM
ahs-8094	226	58	165	165	NUM
ahs-8094	226	59	efg	efg	NOUN
ahs-8094	226	60	46	46	NUM
ahs-8094	226	61	cd	cd	PROPN
ahs-8094	226	62	128	128	NUM
ahs-8094	226	63	d	d	NOUN
ahs-8094	226	64	131	131	NUM
ahs-8094	226	65	efgh	efgh	ADV
ahs-8094	226	66	117	117	NUM
ahs-8094	226	67	de	de	X
ahs-8094	226	68	pp9852­170	pp9852­170	NOUN
ahs-8094	226	69	148	148	NUM
ahs-8094	226	70	fg	fg	PROPN
ahs-8094	226	71	27	27	NUM
ahs-8094	226	72	cd	cd	NOUN
ahs-8094	226	73	137	137	NUM
ahs-8094	226	74	d	d	NUM
ahs-8094	226	75	97	97	NUM
ahs-8094	226	76	fgh	fgh	NOUN
ahs-8094	226	77	102	102	NUM
ahs-8094	226	78	de	de	X
ahs-8094	226	79	icpn	icpn	PROPN
ahs-8094	226	80	18­7	18­7	NUM
ahs-8094	226	81	179	179	NUM
ahs-8094	226	82	def	def	ADJ
ahs-8094	226	83	16	16	NUM
ahs-8094	227	1	d	d	NOUN
ahs-8094	227	2	93.6	93.6	NUM
ahs-8094	227	3	d	d	SYM
ahs-8094	227	4	63	63	NUM
ahs-8094	227	5	gh	gh	PROPN
ahs-8094	227	6	89	89	NUM
ahs-8094	227	7	e	e	NOUN
ahs-8094	227	8	long	long	ADJ
ahs-8094	227	9	red	red	ADJ
ahs-8094	227	10	cayenne	cayenne	NOUN
ahs-8094	227	11	308	308	NUM
ahs-8094	227	12	abc	abc	PROPN
ahs-8094	227	13	146	146	NUM
ahs-8094	227	14	abc	abc	PROPN
ahs-8094	227	15	344	344	NUM
ahs-8094	227	16	ab	ab	PROPN
ahs-8094	227	17	448	448	NUM
ahs-8094	227	18	a	a	DET
ahs-8094	227	19	316	316	NUM
ahs-8094	227	20	ab	ab	PROPN
ahs-8094	227	21	bird­eye	bird­eye	NOUN
ahs-8094	227	22	312	312	NUM
ahs-8094	227	23	abc	abc	PROPN
ahs-8094	227	24	179	179	NUM
ahs-8094	227	25	ab	ab	PROPN
ahs-8094	227	26	346	346	NUM
ahs-8094	227	27	ab	ab	PROPN
ahs-8094	227	28	251	251	NUM
ahs-8094	227	29	cde	cde	PROPN
ahs-8094	227	30	276	276	NUM
ahs-8094	227	31	abc	abc	PROPN
ahs-8094	227	32	red	red	PROPN
ahs-8094	227	33	scotch	scotch	PROPN
ahs-8094	227	34	bonnet	bonnet	NOUN
ahs-8094	227	35	331	331	NUM
ahs-8094	227	36	abc	abc	PROPN
ahs-8094	227	37	177	177	NUM
ahs-8094	227	38	ab	ab	PROPN
ahs-8094	227	39	350	350	NUM
ahs-8094	227	40	ab	ab	PROPN
ahs-8094	227	41	198	198	NUM
ahs-8094	227	42	cdefg	cdefg	NOUN
ahs-8094	227	43	264	264	NUM
ahs-8094	227	44	abc	abc	PROPN
ahs-8094	227	45	california	california	PROPN
ahs-8094	227	46	wonder	wonder	VERB
ahs-8094	227	47	379	379	NUM
ahs-8094	227	48	ab	ab	PROPN
ahs-8094	227	49	248	248	NUM
ahs-8094	227	50	a	a	DET
ahs-8094	227	51	312	312	NUM
ahs-8094	227	52	bc	bc	PROPN
ahs-8094	227	53	445	445	PROPN
ahs-8094	227	54	ab	ab	PROPN
ahs-8094	227	55	346	346	NUM
ahs-8094	227	56	a	a	DET
ahs-8094	227	57	lsd	lsd	NOUN
ahs-8094	227	58	(	(	PUNCT
ahs-8094	227	59	0.05	0.05	NUM
ahs-8094	227	60	)	)	PUNCT
ahs-8094	227	61	109.2	109.2	NUM
ahs-8094	227	62	123.7	123.7	NUM
ahs-8094	227	63	72.9	72.9	NUM
ahs-8094	227	64	149.5	149.5	NUM
ahs-8094	227	65	99.9	99.9	NUM
ahs-8094	227	66	p­value	p­value	NOUN
ahs-8094	227	67	<	<	X
ahs-8094	227	68	0.0001	0.0001	NUM
ahs-8094	227	69	0.0011	0.0011	NUM
ahs-8094	227	70	<	<	X
ahs-8094	227	71	0.0001	0.0001	NUM
ahs-8094	227	72	<	<	X
ahs-8094	227	73	0.0001	0.0001	NUM
ahs-8094	227	74	<	<	NOUN
ahs-8094	227	75	0.0001	0.0001	NUM
ahs-8094	227	76	table	table	NOUN
ahs-8094	227	77	6	6	NUM
ahs-8094	227	78	­	­	NOUN
ahs-8094	227	79	means	mean	NOUN
ahs-8094	227	80	of	of	ADP
ahs-8094	227	81	the	the	DET
ahs-8094	227	82	area	area	NOUN
ahs-8094	227	83	under	under	ADP
ahs-8094	227	84	disease	disease	NOUN
ahs-8094	227	85	progress	progress	NOUN
ahs-8094	227	86	curve	curve	NOUN
ahs-8094	227	87	(	(	PUNCT
ahs-8094	227	88	audpc	audpc	NOUN
ahs-8094	227	89	)	)	PUNCT
ahs-8094	227	90	of	of	ADP
ahs-8094	227	91	viral	viral	ADJ
ahs-8094	227	92	diseases	disease	NOUN
ahs-8094	227	93	recorded	record	VERB
ahs-8094	227	94	on	on	ADP
ahs-8094	227	95	eighteen	eighteen	NUM
ahs-8094	227	96	genotypes	genotype	NOUN
ahs-8094	227	97	of	of	ADP
ahs-8094	227	98	hot	hot	ADJ
ahs-8094	227	99	pepper	pepper	NOUN
ahs-8094	227	100	dur­	dur­	NOUN
ahs-8094	227	101	ing	e	VERB
ahs-8094	227	102	two	two	NUM
ahs-8094	227	103	seasons	season	NOUN
ahs-8094	227	104	in	in	ADP
ahs-8094	227	105	rubona	rubona	ADJ
ahs-8094	227	106	and	and	CCONJ
ahs-8094	227	107	gashora	gashora	NOUN
ahs-8094	227	108	sites	site	NOUN
ahs-8094	227	109	the	the	DET
ahs-8094	227	110	values	value	NOUN
ahs-8094	227	111	represent	represent	VERB
ahs-8094	227	112	means	mean	NOUN
ahs-8094	227	113	of	of	ADP
ahs-8094	227	114	three	three	NUM
ahs-8094	227	115	replicates	replicate	NOUN
ahs-8094	227	116	.	.	PUNCT
ahs-8094	228	1	means	mean	VERB
ahs-8094	228	2	with	with	ADP
ahs-8094	228	3	the	the	DET
ahs-8094	228	4	same	same	ADJ
ahs-8094	228	5	letters	letter	NOUN
ahs-8094	228	6	within	within	ADP
ahs-8094	228	7	a	a	DET
ahs-8094	228	8	column	column	NOUN
ahs-8094	228	9	are	be	AUX
ahs-8094	228	10	not	not	PART
ahs-8094	228	11	significantly	significantly	ADV
ahs-8094	228	12	different	different	ADJ
ahs-8094	228	13	(	(	PUNCT
ahs-8094	228	14	p<0.05	p<0.05	NOUN
ahs-8094	228	15	)	)	PUNCT
ahs-8094	228	16	.	.	PUNCT
ahs-8094	229	1	means	mean	VERB
ahs-8094	229	2	comparison	comparison	NOUN
ahs-8094	229	3	done	do	VERB
ahs-8094	229	4	by	by	ADP
ahs-8094	229	5	least	least	ADJ
ahs-8094	229	6	significant	significant	ADJ
ahs-8094	229	7	difference	difference	NOUN
ahs-8094	229	8	(	(	PUNCT
ahs-8094	229	9	lsd	lsd	NOUN
ahs-8094	229	10	)	)	PUNCT
ahs-8094	229	11	test	test	NOUN
ahs-8094	229	12	.	.	PUNCT
ahs-8094	230	1	waweru	waweru	PROPN
ahs-8094	230	2	et	et	PROPN
ahs-8094	230	3	al	al	PROPN
ahs-8094	230	4	.	.	PROPN
ahs-8094	231	1	‐	‐	NOUN
ahs-8094	231	2	evaluation	evaluation	NOUN
ahs-8094	231	3	of	of	ADP
ahs-8094	231	4	hot	hot	ADJ
ahs-8094	231	5	pepper	pepper	NOUN
ahs-8094	231	6	genotypes	genotype	NOUN
ahs-8094	231	7	in	in	ADP
ahs-8094	231	8	rwanda	rwanda	PROPN
ahs-8094	231	9	405	405	NUM
ahs-8094	231	10	by	by	ADP
ahs-8094	231	11	cmv+pvmv	cmv+pvmv	NOUN
ahs-8094	231	12	detected	detect	VERB
ahs-8094	231	13	in	in	ADP
ahs-8094	231	14	9.4	9.4	NUM
ahs-8094	231	15	%	%	NOUN
ahs-8094	231	16	of	of	ADP
ahs-8094	231	17	the	the	DET
ahs-8094	231	18	samples	sample	NOUN
ahs-8094	231	19	test­	test­	PROPN
ahs-8094	231	20	ed	ed	NOUN
ahs-8094	231	21	in	in	ADP
ahs-8094	231	22	rubona	rubona	PROPN
ahs-8094	231	23	.	.	PUNCT
ahs-8094	232	1	triple	triple	ADJ
ahs-8094	232	2	infection	infection	NOUN
ahs-8094	232	3	of	of	ADP
ahs-8094	232	4	cmv+pevyv+pvmv	cmv+pevyv+pvmv	PROPN
ahs-8094	232	5	was	be	AUX
ahs-8094	232	6	detected	detect	VERB
ahs-8094	232	7	in	in	ADP
ahs-8094	232	8	9.4	9.4	NUM
ahs-8094	232	9	%	%	NOUN
ahs-8094	232	10	of	of	ADP
ahs-8094	232	11	the	the	DET
ahs-8094	232	12	samples	sample	NOUN
ahs-8094	232	13	from	from	ADP
ahs-8094	232	14	rubona	rubona	PROPN
ahs-8094	232	15	.	.	PUNCT
ahs-8094	233	1	all	all	DET
ahs-8094	233	2	hot	hot	ADJ
ahs-8094	233	3	pepper	pepper	NOUN
ahs-8094	233	4	genotypes	genotype	NOUN
ahs-8094	233	5	were	be	AUX
ahs-8094	233	6	infected	infect	VERB
ahs-8094	233	7	by	by	ADP
ahs-8094	233	8	cmv	cmv	PROPN
ahs-8094	233	9	.	.	PUNCT
ahs-8094	234	1	assessment	assessment	NOUN
ahs-8094	234	2	of	of	ADP
ahs-8094	234	3	aphids	aphid	NOUN
ahs-8094	234	4	aphid	aphid	NOUN
ahs-8094	234	5	populations	population	NOUN
ahs-8094	234	6	differed	differ	VERB
ahs-8094	234	7	significantly	significantly	ADV
ahs-8094	234	8	between	between	ADP
ahs-8094	234	9	sites	site	NOUN
ahs-8094	234	10	(	(	PUNCT
ahs-8094	234	11	p<0.0001	p<0.0001	NOUN
ahs-8094	234	12	)	)	PUNCT
ahs-8094	234	13	,	,	PUNCT
ahs-8094	234	14	season	season	NOUN
ahs-8094	234	15	(	(	PUNCT
ahs-8094	234	16	p=0.0075	p=0.0075	PROPN
ahs-8094	234	17	)	)	PUNCT
ahs-8094	234	18	and	and	CCONJ
ahs-8094	234	19	thus	thus	ADV
ahs-8094	234	20	,	,	PUNCT
ahs-8094	234	21	data	datum	NOUN
ahs-8094	234	22	were	be	AUX
ahs-8094	234	23	analysed	analyse	VERB
ahs-8094	234	24	separately	separately	ADV
ahs-8094	234	25	.	.	PUNCT
ahs-8094	235	1	in	in	ADP
ahs-8094	235	2	both	both	DET
ahs-8094	235	3	seasons	season	NOUN
ahs-8094	235	4	,	,	PUNCT
ahs-8094	235	5	the	the	DET
ahs-8094	235	6	aphid	aphid	NOUN
ahs-8094	235	7	population	population	NOUN
ahs-8094	235	8	was	be	AUX
ahs-8094	235	9	significantly	significantly	ADV
ahs-8094	235	10	(	(	PUNCT
ahs-8094	235	11	p<.0001	p<.0001	NOUN
ahs-8094	235	12	)	)	PUNCT
ahs-8094	235	13	higher	high	ADJ
ahs-8094	235	14	in	in	ADP
ahs-8094	235	15	rubona	rubona	NOUN
ahs-8094	235	16	compared	compare	VERB
ahs-8094	235	17	to	to	ADP
ahs-8094	235	18	gashora	gashora	NOUN
ahs-8094	235	19	(	(	PUNCT
ahs-8094	235	20	table	table	NOUN
ahs-8094	235	21	7	7	NUM
ahs-8094	235	22	)	)	PUNCT
ahs-8094	235	23	.	.	PUNCT
ahs-8094	236	1	three	three	NUM
ahs-8094	236	2	species	specie	NOUN
ahs-8094	236	3	of	of	ADP
ahs-8094	236	4	aphids	aphid	NOUN
ahs-8094	236	5	were	be	AUX
ahs-8094	236	6	observed	observe	VERB
ahs-8094	236	7	.	.	PUNCT
ahs-8094	237	1	these	these	PRON
ahs-8094	237	2	were	be	AUX
ahs-8094	237	3	aphis	aphis	PROPN
ahs-8094	237	4	gosypii	gosypii	PROPN
ahs-8094	237	5	glover	glover	PROPN
ahs-8094	237	6	,	,	PUNCT
ahs-8094	237	7	macrosiphum	macrosiphum	ADP
ahs-8094	237	8	euphorbiae	euphorbiae	PROPN
ahs-8094	237	9	thomas	thomas	PROPN
ahs-8094	237	10	and	and	CCONJ
ahs-8094	237	11	acyrthosiphon	acyrthosiphon	PROPN
ahs-8094	237	12	pisum	pisum	NOUN
ahs-8094	237	13	(	(	PUNCT
ahs-8094	237	14	harris	harris	PROPN
ahs-8094	237	15	)	)	PUNCT
ahs-8094	237	16	.	.	PUNCT
ahs-8094	238	1	the	the	DET
ahs-8094	238	2	a.	a.	NOUN
ahs-8094	238	3	gosypii	gosypii	PROPN
ahs-8094	238	4	and	and	CCONJ
ahs-8094	238	5	m.	m.	NOUN
ahs-8094	238	6	euphorbiae	euphorbiae	PROPN
ahs-8094	238	7	were	be	AUX
ahs-8094	238	8	the	the	DET
ahs-8094	238	9	most	most	ADV
ahs-8094	238	10	abundant	abundant	ADJ
ahs-8094	238	11	in	in	ADP
ahs-8094	238	12	both	both	DET
ahs-8094	238	13	sites	site	NOUN
ahs-8094	238	14	,	,	PUNCT
ahs-8094	238	15	while	while	SCONJ
ahs-8094	238	16	a.	a.	NOUN
ahs-8094	238	17	pisum	pisum	NOUN
ahs-8094	238	18	was	be	AUX
ahs-8094	238	19	observed	observe	VERB
ahs-8094	238	20	in	in	ADP
ahs-8094	238	21	gashora	gashora	NOUN
ahs-8094	238	22	only	only	ADV
ahs-8094	238	23	.	.	PUNCT
ahs-8094	239	1	all	all	DET
ahs-8094	239	2	genotypes	genotype	NOUN
ahs-8094	239	3	were	be	AUX
ahs-8094	239	4	infested	infest	VERB
ahs-8094	239	5	by	by	ADP
ahs-8094	239	6	aphids	aphid	NOUN
ahs-8094	239	7	but	but	CCONJ
ahs-8094	239	8	the	the	DET
ahs-8094	239	9	dif­	dif­	NOUN
ahs-8094	239	10	ference	ference	NOUN
ahs-8094	239	11	in	in	ADP
ahs-8094	239	12	numbers	number	NOUN
ahs-8094	239	13	were	be	AUX
ahs-8094	239	14	not	not	PART
ahs-8094	239	15	significant	significant	ADJ
ahs-8094	239	16	(	(	PUNCT
ahs-8094	239	17	p	p	X
ahs-8094	239	18	=	=	NOUN
ahs-8094	239	19	0.0923	0.0923	NUM
ahs-8094	239	20	)	)	PUNCT
ahs-8094	239	21	among	among	ADP
ahs-8094	239	22	the	the	DET
ahs-8094	239	23	genotypes	genotype	NOUN
ahs-8094	239	24	(	(	PUNCT
ahs-8094	239	25	table	table	NOUN
ahs-8094	239	26	8)	8)	NUM
ahs-8094	239	27	.	.	PUNCT
ahs-8094	240	1	the	the	DET
ahs-8094	240	2	mean	mean	ADJ
ahs-8094	240	3	number	number	NOUN
ahs-8094	240	4	of	of	ADP
ahs-8094	240	5	aphids	aphid	NOUN
ahs-8094	240	6	per	per	ADP
ahs-8094	240	7	plant	plant	NOUN
ahs-8094	240	8	ranged	range	VERB
ahs-8094	240	9	from	from	ADP
ahs-8094	240	10	4	4	NUM
ahs-8094	240	11	to	to	PART
ahs-8094	240	12	108	108	NUM
ahs-8094	240	13	in	in	ADP
ahs-8094	240	14	rubona	rubona	PROPN
ahs-8094	240	15	and	and	CCONJ
ahs-8094	240	16	4	4	NUM
ahs-8094	240	17	to	to	PART
ahs-8094	240	18	19	19	NUM
ahs-8094	240	19	in	in	ADP
ahs-8094	240	20	gashora	gashora	NOUN
ahs-8094	240	21	,	,	PUNCT
ahs-8094	240	22	while	while	SCONJ
ahs-8094	240	23	the	the	DET
ahs-8094	240	24	mean	mean	ADJ
ahs-8094	240	25	number	number	NOUN
ahs-8094	240	26	of	of	ADP
ahs-8094	240	27	aphids	aphid	NOUN
ahs-8094	240	28	per	per	ADP
ahs-8094	240	29	leaf	leaf	NOUN
ahs-8094	240	30	ranged	range	VERB
ahs-8094	240	31	from	from	ADP
ahs-8094	240	32	0.8	0.8	NUM
ahs-8094	240	33	to	to	PART
ahs-8094	240	34	18	18	NUM
ahs-8094	240	35	and	and	CCONJ
ahs-8094	240	36	0.6	0.6	NUM
ahs-8094	240	37	to	to	ADP
ahs-8094	240	38	3.2	3.2	NUM
ahs-8094	240	39	,	,	PUNCT
ahs-8094	240	40	respec­	respec­	NUM
ahs-8094	240	41	fig	fig	NOUN
ahs-8094	240	42	.	.	PUNCT
ahs-8094	241	1	2	2	NUM
ahs-8094	241	2	­	­	VERB
ahs-8094	241	3	overall	overall	ADJ
ahs-8094	241	4	incidence	incidence	NOUN
ahs-8094	241	5	of	of	ADP
ahs-8094	241	6	viruses	virus	NOUN
ahs-8094	241	7	detected	detect	VERB
ahs-8094	241	8	in	in	ADP
ahs-8094	241	9	leaf	leaf	NOUN
ahs-8094	241	10	samples	sample	NOUN
ahs-8094	241	11	of	of	ADP
ahs-8094	241	12	hot	hot	ADJ
ahs-8094	241	13	pepper	pepper	NOUN
ahs-8094	241	14	genotypes	genotype	NOUN
ahs-8094	241	15	from	from	ADP
ahs-8094	241	16	rubona	rubona	NOUN
ahs-8094	241	17	and	and	CCONJ
ahs-8094	241	18	gashora	gashora	NOUN
ahs-8094	241	19	in	in	ADP
ahs-8094	241	20	rwanda	rwanda	PROPN
ahs-8094	241	21	.	.	PUNCT
ahs-8094	242	1	table	table	NOUN
ahs-8094	242	2	7	7	NUM
ahs-8094	242	3	­	­	NOUN
ahs-8094	242	4	mean	mean	NOUN
ahs-8094	242	5	number	number	NOUN
ahs-8094	242	6	of	of	ADP
ahs-8094	242	7	aphids	aphid	NOUN
ahs-8094	242	8	captured	capture	VERB
ahs-8094	242	9	in	in	ADP
ahs-8094	242	10	hot	hot	ADJ
ahs-8094	242	11	pepper	pepper	NOUN
ahs-8094	242	12	fields	field	NOUN
ahs-8094	242	13	during	during	ADP
ahs-8094	242	14	two	two	NUM
ahs-8094	242	15	cropping	crop	VERB
ahs-8094	242	16	seasons	season	NOUN
ahs-8094	242	17	in	in	ADP
ahs-8094	242	18	rubona	rubona	PROPN
ahs-8094	242	19	and	and	CCONJ
ahs-8094	242	20	gashora	gashora	VERB
ahs-8094	242	21	experimental	experimental	ADJ
ahs-8094	242	22	sites	site	NOUN
ahs-8094	242	23	the	the	DET
ahs-8094	242	24	values	value	NOUN
ahs-8094	242	25	represent	represent	VERB
ahs-8094	242	26	means	mean	NOUN
ahs-8094	242	27	and	and	CCONJ
ahs-8094	242	28	standard	standard	ADJ
ahs-8094	242	29	errors	error	NOUN
ahs-8094	242	30	of	of	ADP
ahs-8094	242	31	three	three	NUM
ahs-8094	242	32	replicates	replicate	NOUN
ahs-8094	242	33	.	.	PUNCT
ahs-8094	243	1	ns=	ns=	VERB
ahs-8094	243	2	not	not	PART
ahs-8094	243	3	significant	significant	ADJ
ahs-8094	243	4	at	at	ADP
ahs-8094	243	5	0.05	0.05	NUM
ahs-8094	243	6	level	level	NOUN
ahs-8094	243	7	.	.	PUNCT
ahs-8094	244	1	season	season	NOUN
ahs-8094	244	2	rubona	rubona	PROPN
ahs-8094	244	3	site	site	PROPN
ahs-8094	244	4	gashora	gashora	PROPN
ahs-8094	244	5	site	site	NOUN
ahs-8094	244	6	a.	a.	PROPN
ahs-8094	244	7	gosypii	gosypii	PROPN
ahs-8094	244	8	m.	m.	PROPN
ahs-8094	244	9	euphorbiae	euphorbiae	PROPN
ahs-8094	244	10	total	total	ADJ
ahs-8094	244	11	aphids	aphid	NOUN
ahs-8094	244	12	a.	a.	PROPN
ahs-8094	244	13	gosypii	gosypii	PROPN
ahs-8094	244	14	m.	m.	PROPN
ahs-8094	244	15	euphorbiae	euphorbiae	PROPN
ahs-8094	244	16	a.	a.	NOUN
ahs-8094	244	17	pisum	pisum	NOUN
ahs-8094	244	18	total	total	NOUN
ahs-8094	244	19	aphids	aphid	NOUN
ahs-8094	244	20	feb­june	feb­june	PROPN
ahs-8094	244	21	2018	2018	NUM
ahs-8094	244	22	167	167	NUM
ahs-8094	244	23	±	±	NUM
ahs-8094	244	24	30	30	NUM
ahs-8094	244	25	a	a	DET
ahs-8094	244	26	10	10	NUM
ahs-8094	244	27	±	±	NUM
ahs-8094	244	28	1	1	NUM
ahs-8094	244	29	b	b	NUM
ahs-8094	244	30	177	177	NUM
ahs-8094	244	31	±	±	NUM
ahs-8094	244	32	30	30	NUM
ahs-8094	244	33	a	a	DET
ahs-8094	244	34	32	32	NUM
ahs-8094	244	35	±	±	NUM
ahs-8094	244	36	6	6	NUM
ahs-8094	244	37	a	a	DET
ahs-8094	244	38	0	0	NUM
ahs-8094	244	39	±	±	NUM
ahs-8094	244	40	0	0	NUM
ahs-8094	244	41	b	b	SYM
ahs-8094	244	42	11	11	NUM
ahs-8094	244	43	±	±	NUM
ahs-8094	244	44	1	1	NUM
ahs-8094	244	45	a	a	DET
ahs-8094	244	46	43	43	NUM
ahs-8094	244	47	±	±	NUM
ahs-8094	244	48	5	5	NUM
ahs-8094	244	49	a	a	DET
ahs-8094	244	50	oct	oct	PROPN
ahs-8094	244	51	.	.	PROPN
ahs-8094	244	52	2018	2018	NUM
ahs-8094	244	53	­march	­march	NOUN
ahs-8094	244	54	2019	2019	NUM
ahs-8094	244	55	48	48	NUM
ahs-8094	244	56	±	±	NUM
ahs-8094	244	57	4	4	NUM
ahs-8094	244	58	b	b	SYM
ahs-8094	244	59	80	80	NUM
ahs-8094	244	60	±	±	NUM
ahs-8094	244	61	11	11	NUM
ahs-8094	244	62	a	a	DET
ahs-8094	244	63	128	128	NUM
ahs-8094	244	64	±	±	NUM
ahs-8094	244	65	10	10	NUM
ahs-8094	244	66	a	a	DET
ahs-8094	244	67	26	26	NUM
ahs-8094	244	68	±	±	NUM
ahs-8094	244	69	5	5	NUM
ahs-8094	244	70	a	a	DET
ahs-8094	244	71	28	28	NUM
ahs-8094	244	72	±	±	NUM
ahs-8094	244	73	2	2	NUM
ahs-8094	244	74	a	a	DET
ahs-8094	244	75	0	0	NUM
ahs-8094	244	76	±	±	NUM
ahs-8094	244	77	0	0	NUM
ahs-8094	244	78	b	b	SYM
ahs-8094	244	79	54	54	NUM
ahs-8094	244	80	±	±	NUM
ahs-8094	244	81	6	6	NUM
ahs-8094	244	82	a	a	DET
ahs-8094	244	83	lsd	lsd	NOUN
ahs-8094	244	84	(	(	PUNCT
ahs-8094	244	85	0.05	0.05	NUM
ahs-8094	244	86	)	)	PUNCT
ahs-8094	244	87	59	59	NUM
ahs-8094	244	88	21	21	NUM
ahs-8094	244	89	62	62	NUM
ahs-8094	244	90	16	16	NUM
ahs-8094	244	91	5	5	NUM
ahs-8094	244	92	2	2	NUM
ahs-8094	244	93	16	16	NUM
ahs-8094	244	94	p­value	p­value	NOUN
ahs-8094	244	95	0.0017	0.0017	NUM
ahs-8094	244	96	<	<	NOUN
ahs-8094	244	97	0.0001	0.0001	NUM
ahs-8094	244	98	ns	ns	NUM
ahs-8094	244	99	ns	ns	ADJ
ahs-8094	244	100	<	<	X
ahs-8094	244	101	0.0001	0.0001	NUM
ahs-8094	244	102	<	<	NOUN
ahs-8094	244	103	0.0001	0.0001	NUM
ahs-8094	244	104	ns	ns	NUM
ahs-8094	244	105	table	table	NOUN
ahs-8094	244	106	8	8	NUM
ahs-8094	244	107	­	­	NOUN
ahs-8094	244	108	number	number	NOUN
ahs-8094	244	109	of	of	ADP
ahs-8094	244	110	aphids	aphid	NOUN
ahs-8094	244	111	associated	associate	VERB
ahs-8094	244	112	with	with	ADP
ahs-8094	244	113	different	different	ADJ
ahs-8094	244	114	hot	hot	ADJ
ahs-8094	244	115	pepper	pepper	NOUN
ahs-8094	244	116	genotypes	genotype	NOUN
ahs-8094	244	117	in	in	ADP
ahs-8094	244	118	rubona	rubona	PROPN
ahs-8094	244	119	and	and	CCONJ
ahs-8094	244	120	gashora	gashora	NOUN
ahs-8094	244	121	's	's	PART
ahs-8094	244	122	experimental	experimental	ADJ
ahs-8094	244	123	sites	site	NOUN
ahs-8094	244	124	the	the	DET
ahs-8094	244	125	values	value	NOUN
ahs-8094	244	126	represent	represent	VERB
ahs-8094	244	127	means	mean	NOUN
ahs-8094	244	128	of	of	ADP
ahs-8094	244	129	untransformed	untransformed	ADJ
ahs-8094	244	130	data	datum	NOUN
ahs-8094	244	131	.	.	PUNCT
ahs-8094	245	1	ns=	ns=	VERB
ahs-8094	245	2	not	not	PART
ahs-8094	245	3	significant	significant	ADJ
ahs-8094	245	4	at	at	ADP
ahs-8094	245	5	0.05	0.05	NUM
ahs-8094	245	6	level	level	NOUN
ahs-8094	245	7	.	.	PUNCT
ahs-8094	246	1	genotype	genotype	NOUN
ahs-8094	246	2	rubona	rubona	PROPN
ahs-8094	246	3	site	site	PROPN
ahs-8094	246	4	gashora	gashora	PROPN
ahs-8094	246	5	site	site	NOUN
ahs-8094	246	6	mean	mean	VERB
ahs-8094	246	7	aphids	aphids	PROPN
ahs-8094	246	8	/	/	SYM
ahs-8094	246	9	plant	plant	NOUN
ahs-8094	246	10	total	total	NOUN
ahs-8094	246	11	aphids	aphid	NOUN
ahs-8094	246	12	aphids	aphids	VERB
ahs-8094	246	13	/	/	SYM
ahs-8094	246	14	plant	plant	NOUN
ahs-8094	246	15	aphids	aphid	NOUN
ahs-8094	246	16	/	/	SYM
ahs-8094	246	17	leaf	leaf	NOUN
ahs-8094	246	18	total	total	NOUN
ahs-8094	246	19	aphids	aphid	NOUN
ahs-8094	246	20	aphids	aphids	VERB
ahs-8094	246	21	/	/	SYM
ahs-8094	246	22	plant	plant	NOUN
ahs-8094	246	23	aphids	aphid	NOUN
ahs-8094	246	24	/	/	SYM
ahs-8094	246	25	leaf	leaf	NOUN
ahs-8094	246	26	00765ppr	00765ppr	NOUN
ahs-8094	246	27	178.3	178.3	NUM
ahs-8094	246	28	32.8	32.8	NUM
ahs-8094	246	29	5.5	5.5	NUM
ahs-8094	246	30	53.3	53.3	NUM
ahs-8094	246	31	11.7	11.7	NUM
ahs-8094	246	32	1.9	1.9	NUM
ahs-8094	246	33	22.3	22.3	NUM
ahs-8094	246	34	00767ppr	00767ppr	NOUN
ahs-8094	246	35	64.8	64.8	NUM
ahs-8094	246	36	5.5	5.5	NUM
ahs-8094	246	37	0.9	0.9	NUM
ahs-8094	246	38	29	29	NUM
ahs-8094	246	39	5.2	5.2	NUM
ahs-8094	246	40	0.8	0.8	NUM
ahs-8094	246	41	5.3	5.3	NUM
ahs-8094	246	42	00774ppr	00774ppr	NOUN
ahs-8094	246	43	178.5	178.5	NUM
ahs-8094	247	1	31.5	31.5	NUM
ahs-8094	247	2	5.3	5.3	NUM
ahs-8094	247	3	37.3	37.3	NUM
ahs-8094	247	4	6.2	6.2	NUM
ahs-8094	247	5	1	1	NUM
ahs-8094	247	6	18.8	18.8	NUM
ahs-8094	247	7	00775ppr	00775ppr	NUM
ahs-8094	247	8	125.2	125.2	NUM
ahs-8094	247	9	19.2	19.2	NUM
ahs-8094	247	10	3.2	3.2	NUM
ahs-8094	247	11	56	56	NUM
ahs-8094	247	12	11.3	11.3	NUM
ahs-8094	247	13	1.9	1.9	NUM
ahs-8094	247	14	15.3	15.3	NUM
ahs-8094	247	15	00786ppr	00786ppr	NOUN
ahs-8094	247	16	258.3	258.3	NUM
ahs-8094	247	17	54.8	54.8	NUM
ahs-8094	247	18	9	9	NUM
ahs-8094	247	19	56.3	56.3	NUM
ahs-8094	247	20	9.5	9.5	NUM
ahs-8094	247	21	1.6	1.6	NUM
ahs-8094	247	22	32.2	32.2	NUM
ahs-8094	247	23	00791ppr	00791ppr	NOUN
ahs-8094	247	24	117.2	117.2	NUM
ahs-8094	247	25	20.3	20.3	NUM
ahs-8094	247	26	3.4	3.4	NUM
ahs-8094	247	27	66.3	66.3	NUM
ahs-8094	247	28	11.8	11.8	NUM
ahs-8094	247	29	2	2	NUM
ahs-8094	247	30	16.1	16.1	NUM
ahs-8094	247	31	00792ppr	00792ppr	NOUN
ahs-8094	247	32	125.2	125.2	NUM
ahs-8094	247	33	18.3	18.3	NUM
ahs-8094	247	34	3	3	NUM
ahs-8094	247	35	45	45	NUM
ahs-8094	247	36	9.5	9.5	NUM
ahs-8094	247	37	1.6	1.6	NUM
ahs-8094	247	38	13.9	13.9	NUM
ahs-8094	247	39	00802ppr	00802ppr	NOUN
ahs-8094	247	40	113	113	NUM
ahs-8094	247	41	21.3	21.3	NUM
ahs-8094	247	42	3.6	3.6	NUM
ahs-8094	247	43	36.3	36.3	NUM
ahs-8094	247	44	6.7	6.7	NUM
ahs-8094	247	45	1.1	1.1	NUM
ahs-8094	247	46	14	14	NUM
ahs-8094	247	47	00795ppr	00795ppr	NOUN
ahs-8094	247	48	100.8	100.8	NUM
ahs-8094	247	49	10.1	10.1	NUM
ahs-8094	247	50	1.7	1.7	NUM
ahs-8094	247	51	65.5	65.5	NUM
ahs-8094	247	52	14	14	NUM
ahs-8094	247	53	2.3	2.3	NUM
ahs-8094	247	54	12.1	12.1	NUM
ahs-8094	247	55	pbc	pbc	PROPN
ahs-8094	247	56	462	462	NUM
ahs-8094	247	57	120	120	NUM
ahs-8094	247	58	19.5	19.5	NUM
ahs-8094	247	59	3.2	3.2	NUM
ahs-8094	247	60	38	38	NUM
ahs-8094	247	61	5.7	5.7	NUM
ahs-8094	247	62	0.9	0.9	NUM
ahs-8094	247	63	12.6	12.6	NUM
ahs-8094	247	64	pp9950­5197	pp9950­5197	NOUN
ahs-8094	247	65	117.5	117.5	NUM
ahs-8094	247	66	19.3	19.3	NUM
ahs-8094	247	67	3.2	3.2	NUM
ahs-8094	247	68	62.2	62.2	NUM
ahs-8094	247	69	11	11	NUM
ahs-8094	247	70	1.8	1.8	NUM
ahs-8094	247	71	15.1	15.1	NUM
ahs-8094	247	72	hp	hp	NOUN
ahs-8094	247	73	0117	0117	NUM
ahs-8094	247	74	289.5	289.5	NUM
ahs-8094	247	75	108	108	NUM
ahs-8094	247	76	18	18	NUM
ahs-8094	247	77	29.7	29.7	NUM
ahs-8094	247	78	5.5	5.5	NUM
ahs-8094	247	79	0.9	0.9	NUM
ahs-8094	247	80	56.8	56.8	NUM
ahs-8094	247	81	pp9852­170	pp9852­170	NOUN
ahs-8094	247	82	205.8	205.8	NUM
ahs-8094	247	83	42.2	42.2	NUM
ahs-8094	247	84	7	7	NUM
ahs-8094	247	85	94.5	94.5	NUM
ahs-8094	247	86	19.3	19.3	NUM
ahs-8094	247	87	3.2	3.2	NUM
ahs-8094	247	88	30.8	30.8	NUM
ahs-8094	247	89	icpn	icpn	NOUN
ahs-8094	247	90	18­7	18­7	NUM
ahs-8094	247	91	136.2	136.2	NUM
ahs-8094	247	92	25.3	25.3	NUM
ahs-8094	247	93	4.2	4.2	NUM
ahs-8094	247	94	35	35	NUM
ahs-8094	247	95	6.2	6.2	NUM
ahs-8094	247	96	1	1	NUM
ahs-8094	247	97	15.8	15.8	NUM
ahs-8094	247	98	long	long	ADJ
ahs-8094	247	99	red	red	ADJ
ahs-8094	247	100	cayenne	cayenne	NOUN
ahs-8094	247	101	171	171	NUM
ahs-8094	247	102	33.8	33.8	NUM
ahs-8094	247	103	5.6	5.6	NUM
ahs-8094	247	104	59.8	59.8	NUM
ahs-8094	247	105	11	11	NUM
ahs-8094	247	106	1.8	1.8	NUM
ahs-8094	247	107	22.4	22.4	NUM
ahs-8094	247	108	bird­eye	bird­eye	NOUN
ahs-8094	247	109	72.2	72.2	NUM
ahs-8094	247	110	4.8	4.8	NUM
ahs-8094	247	111	0.8	0.8	NUM
ahs-8094	247	112	26	26	NUM
ahs-8094	247	113	4	4	NUM
ahs-8094	247	114	0.6	0.6	NUM
ahs-8094	247	115	4.4	4.4	NUM
ahs-8094	247	116	scotch	scotch	NOUN
ahs-8094	247	117	bonnet	bonnet	NOUN
ahs-8094	247	118	83.7	83.7	NUM
ahs-8094	247	119	10.2	10.2	NUM
ahs-8094	247	120	1.7	1.7	NUM
ahs-8094	247	121	50.7	50.7	NUM
ahs-8094	247	122	9.7	9.7	NUM
ahs-8094	247	123	1.6	1.6	NUM
ahs-8094	247	124	9.92	9.92	NUM
ahs-8094	247	125	california	california	PROPN
ahs-8094	247	126	wonder	wonder	VERB
ahs-8094	247	127	287.8	287.8	NUM
ahs-8094	247	128	79.2	79.2	NUM
ahs-8094	247	129	13	13	NUM
ahs-8094	247	130	40.5	40.5	NUM
ahs-8094	247	131	7.8	7.8	NUM
ahs-8094	247	132	1.3	1.3	NUM
ahs-8094	247	133	43.5	43.5	NUM
ahs-8094	247	134	p­value	p­value	NOUN
ahs-8094	247	135	(	(	PUNCT
ahs-8094	247	136	0.05	0.05	NUM
ahs-8094	247	137	)	)	PUNCT
ahs-8094	247	138	ns	ns	NUM
ahs-8094	247	139	ns	ns	NUM
ahs-8094	247	140	ns	ns	NUM
ahs-8094	247	141	ns	ns	NUM
ahs-8094	247	142	ns	ns	NUM
ahs-8094	247	143	ns	ns	NUM
ahs-8094	247	144	ns	ns	PROPN
ahs-8094	247	145	adv	adv	PROPN
ahs-8094	247	146	.	.	PUNCT
ahs-8094	248	1	hort	hort	PROPN
ahs-8094	248	2	.	.	PUNCT
ahs-8094	249	1	sci	sci	PROPN
ahs-8094	249	2	.	.	PROPN
ahs-8094	249	3	,	,	PUNCT
ahs-8094	249	4	2020	2020	NUM
ahs-8094	249	5	34(4	34(4	NUM
ahs-8094	249	6	):	):	PUNCT
ahs-8094	249	7	397­412	397­412	NUM
ahs-8094	249	8	406	406	NUM
ahs-8094	249	9	tively	tively	ADV
ahs-8094	249	10	.	.	PUNCT
ahs-8094	250	1	except	except	SCONJ
ahs-8094	250	2	hp	hp	PROPN
ahs-8094	250	3	0117	0117	NUM
ahs-8094	250	4	and	and	CCONJ
ahs-8094	250	5	california	california	PROPN
ahs-8094	250	6	wonder	wonder	NOUN
ahs-8094	250	7	at	at	ADP
ahs-8094	250	8	rubona	rubona	PROPN
ahs-8094	250	9	site	site	NOUN
ahs-8094	250	10	,	,	PUNCT
ahs-8094	250	11	the	the	DET
ahs-8094	250	12	rest	rest	NOUN
ahs-8094	250	13	of	of	ADP
ahs-8094	250	14	the	the	DET
ahs-8094	250	15	genotypes	genotype	NOUN
ahs-8094	250	16	showed	show	VERB
ahs-8094	250	17	low	low	ADJ
ahs-8094	250	18	numbers	number	NOUN
ahs-8094	250	19	of	of	ADP
ahs-8094	250	20	aphids	aphid	NOUN
ahs-8094	250	21	which	which	PRON
ahs-8094	250	22	did	do	AUX
ahs-8094	250	23	not	not	PART
ahs-8094	250	24	exceed	exceed	VERB
ahs-8094	250	25	recom­	recom­	PROPN
ahs-8094	250	26	mended	mend	VERB
ahs-8094	250	27	chemical	chemical	NOUN
ahs-8094	250	28	control	control	NOUN
ahs-8094	250	29	action	action	NOUN
ahs-8094	250	30	thresholds	threshold	NOUN
ahs-8094	250	31	of	of	ADP
ahs-8094	250	32	10	10	NUM
ahs-8094	250	33	aphids	aphid	NOUN
ahs-8094	250	34	per	per	ADP
ahs-8094	250	35	leaf	leaf	NOUN
ahs-8094	250	36	.	.	PUNCT
ahs-8094	251	1	the	the	DET
ahs-8094	251	2	population	population	NOUN
ahs-8094	251	3	exhibited	exhibit	VERB
ahs-8094	251	4	a	a	DET
ahs-8094	251	5	negative	negative	ADJ
ahs-8094	251	6	correlation	correlation	NOUN
ahs-8094	251	7	with	with	ADP
ahs-8094	251	8	minimum	minimum	NOUN
ahs-8094	251	9	(	(	PUNCT
ahs-8094	251	10	r	r	NOUN
ahs-8094	251	11	=	=	SYM
ahs-8094	251	12	­0.04	­0.04	NOUN
ahs-8094	251	13	,	,	PUNCT
ahs-8094	251	14	­0.22	­0.22	PUNCT
ahs-8094	251	15	)	)	PUNCT
ahs-8094	251	16	and	and	CCONJ
ahs-8094	251	17	maxi­	maxi­	NOUN
ahs-8094	251	18	mum	mum	PROPN
ahs-8094	251	19	temperature	temperature	NOUN
ahs-8094	251	20	(	(	PUNCT
ahs-8094	251	21	0.50	0.50	NUM
ahs-8094	251	22	,	,	PUNCT
ahs-8094	251	23	­0.73	­0.73	NOUN
ahs-8094	251	24	)	)	PUNCT
ahs-8094	251	25	while	while	SCONJ
ahs-8094	251	26	,	,	PUNCT
ahs-8094	251	27	the	the	DET
ahs-8094	251	28	correlation	correlation	NOUN
ahs-8094	251	29	was	be	AUX
ahs-8094	251	30	positive	positive	ADJ
ahs-8094	251	31	with	with	ADP
ahs-8094	251	32	average	average	ADJ
ahs-8094	251	33	rainfall	rainfall	NOUN
ahs-8094	251	34	(	(	PUNCT
ahs-8094	251	35	0.37	0.37	NUM
ahs-8094	251	36	,	,	PUNCT
ahs-8094	251	37	0.68	0.68	NUM
ahs-8094	251	38	)	)	PUNCT
ahs-8094	251	39	in	in	ADP
ahs-8094	251	40	rubona	rubona	PROPN
ahs-8094	251	41	and	and	CCONJ
ahs-8094	251	42	gashora	gashora	NOUN
ahs-8094	251	43	,	,	PUNCT
ahs-8094	251	44	respectively	respectively	ADV
ahs-8094	251	45	.	.	PUNCT
ahs-8094	252	1	these	these	DET
ahs-8094	252	2	correlations	correlation	NOUN
ahs-8094	252	3	were	be	AUX
ahs-8094	252	4	not	not	PART
ahs-8094	252	5	significant	significant	ADJ
ahs-8094	252	6	at	at	ADP
ahs-8094	252	7	the	the	DET
ahs-8094	252	8	5	5	NUM
ahs-8094	252	9	percent	percent	NOUN
ahs-8094	252	10	level	level	NOUN
ahs-8094	252	11	(	(	PUNCT
ahs-8094	252	12	data	datum	NOUN
ahs-8094	252	13	not	not	PART
ahs-8094	252	14	shown	show	VERB
ahs-8094	252	15	)	)	PUNCT
ahs-8094	252	16	.	.	PUNCT
ahs-8094	253	1	classification	classification	NOUN
ahs-8094	253	2	of	of	ADP
ahs-8094	253	3	hot	hot	ADJ
ahs-8094	253	4	pepper	pepper	NOUN
ahs-8094	253	5	genotypes	genotype	NOUN
ahs-8094	253	6	for	for	ADP
ahs-8094	253	7	resistance	resistance	NOUN
ahs-8094	253	8	to	to	ADP
ahs-8094	253	9	viral	viral	ADJ
ahs-8094	253	10	diseases	disease	NOUN
ahs-8094	253	11	under	under	ADP
ahs-8094	253	12	field	field	NOUN
ahs-8094	253	13	conditions	condition	NOUN
ahs-8094	253	14	commercial	commercial	ADJ
ahs-8094	253	15	genotypes	genotype	NOUN
ahs-8094	253	16	were	be	AUX
ahs-8094	253	17	more	more	ADV
ahs-8094	253	18	susceptible	susceptible	ADJ
ahs-8094	253	19	to	to	ADP
ahs-8094	253	20	virus	virus	NOUN
ahs-8094	253	21	infections	infection	NOUN
ahs-8094	253	22	than	than	ADP
ahs-8094	253	23	the	the	DET
ahs-8094	253	24	new	new	ADJ
ahs-8094	253	25	lines	line	NOUN
ahs-8094	253	26	from	from	ADP
ahs-8094	253	27	world	world	NOUN
ahs-8094	253	28	vegetable	vegetable	NOUN
ahs-8094	253	29	center	center	NOUN
ahs-8094	253	30	.	.	PUNCT
ahs-8094	254	1	various	various	ADJ
ahs-8094	254	2	degrees	degree	NOUN
ahs-8094	254	3	of	of	ADP
ahs-8094	254	4	symptoms	symptom	NOUN
ahs-8094	254	5	were	be	AUX
ahs-8094	254	6	observed	observe	VERB
ahs-8094	254	7	on	on	ADP
ahs-8094	254	8	most	most	ADJ
ahs-8094	254	9	genotypes	genotype	NOUN
ahs-8094	254	10	during	during	ADP
ahs-8094	254	11	the	the	DET
ahs-8094	254	12	evalua­	evalua­	PROPN
ahs-8094	254	13	tion	tion	PROPN
ahs-8094	254	14	period	period	NOUN
ahs-8094	254	15	.	.	PUNCT
ahs-8094	255	1	these	these	PRON
ahs-8094	255	2	included	include	VERB
ahs-8094	255	3	leaf	leaf	NOUN
ahs-8094	255	4	mosaic	mosaic	NOUN
ahs-8094	255	5	,	,	PUNCT
ahs-8094	255	6	crinkling	crinkling	NOUN
ahs-8094	255	7	,	,	PUNCT
ahs-8094	255	8	chlorosis	chlorosis	NOUN
ahs-8094	255	9	,	,	PUNCT
ahs-8094	255	10	vein	vein	ADJ
ahs-8094	255	11	banding	banding	NOUN
ahs-8094	255	12	,	,	PUNCT
ahs-8094	255	13	and	and	CCONJ
ahs-8094	255	14	leaf	leaf	NOUN
ahs-8094	255	15	deformation	deformation	NOUN
ahs-8094	255	16	.	.	PUNCT
ahs-8094	256	1	based	base	VERB
ahs-8094	256	2	on	on	ADP
ahs-8094	256	3	incidence	incidence	NOUN
ahs-8094	256	4	and	and	CCONJ
ahs-8094	256	5	severity	severity	NOUN
ahs-8094	256	6	indices	index	NOUN
ahs-8094	256	7	from	from	ADP
ahs-8094	256	8	both	both	DET
ahs-8094	256	9	locations	location	NOUN
ahs-8094	256	10	and	and	CCONJ
ahs-8094	256	11	seasons	season	NOUN
ahs-8094	256	12	only	only	ADV
ahs-8094	256	13	five	five	NUM
ahs-8094	256	14	genotypes	genotype	NOUN
ahs-8094	256	15	rated	rate	VERB
ahs-8094	256	16	resistant	resistant	ADJ
ahs-8094	256	17	to	to	ADP
ahs-8094	256	18	viral	viral	ADJ
ahs-8094	256	19	diseases	disease	NOUN
ahs-8094	256	20	i.e.	i.e.	X
ahs-8094	256	21	00767ppr	00767ppr	NOUN
ahs-8094	256	22	,	,	PUNCT
ahs-8094	256	23	00802ppr	00802ppr	PROPN
ahs-8094	256	24	,	,	PUNCT
ahs-8094	256	25	pbc	pbc	PROPN
ahs-8094	256	26	462	462	NUM
ahs-8094	256	27	,	,	PUNCT
ahs-8094	256	28	pp9950­5197	pp9950­5197	PROPN
ahs-8094	256	29	and	and	CCONJ
ahs-8094	256	30	icpn	icpn	PROPN
ahs-8094	256	31	18­7	18­7	PROPN
ahs-8094	256	32	with	with	ADP
ahs-8094	256	33	total	total	ADJ
ahs-8094	256	34	scores	score	NOUN
ahs-8094	256	35	between	between	ADP
ahs-8094	256	36	2­3	2­3	NUM
ahs-8094	256	37	;	;	PUNCT
ahs-8094	256	38	three	three	NUM
ahs-8094	256	39	moderately	moderately	ADV
ahs-8094	256	40	resistant	resistant	ADJ
ahs-8094	256	41	00765ppr	00765ppr	NOUN
ahs-8094	256	42	,	,	PUNCT
ahs-8094	256	43	hp	hp	NOUN
ahs-8094	256	44	0117	0117	NUM
ahs-8094	256	45	and	and	CCONJ
ahs-8094	256	46	pp9852­170	pp9852­170	NOUN
ahs-8094	256	47	with	with	ADP
ahs-8094	256	48	scores	score	NOUN
ahs-8094	256	49	between	between	ADP
ahs-8094	256	50	4­6	4­6	NUM
ahs-8094	256	51	;	;	PUNCT
ahs-8094	256	52	and	and	CCONJ
ahs-8094	256	53	nine	nine	NUM
ahs-8094	256	54	susceptible	susceptible	ADJ
ahs-8094	256	55	00775ppr	00775ppr	NOUN
ahs-8094	256	56	,	,	PUNCT
ahs-8094	256	57	00786ppr	00786ppr	NOUN
ahs-8094	256	58	,	,	PUNCT
ahs-8094	256	59	00774ppr	00774ppr	NOUN
ahs-8094	256	60	,	,	PUNCT
ahs-8094	256	61	00786ppr	00786ppr	NOUN
ahs-8094	256	62	,	,	PUNCT
ahs-8094	256	63	00792ppr	00792ppr	NOUN
ahs-8094	256	64	,	,	PUNCT
ahs-8094	256	65	long	long	ADJ
ahs-8094	256	66	red	red	ADJ
ahs-8094	256	67	cayenne	cayenne	NOUN
ahs-8094	256	68	,	,	PUNCT
ahs-8094	256	69	bird	bird	NOUN
ahs-8094	256	70	eye	eye	NOUN
ahs-8094	256	71	hybrid	hybrid	NOUN
ahs-8094	256	72	,	,	PUNCT
ahs-8094	256	73	red	red	ADJ
ahs-8094	256	74	scotch	scotch	NOUN
ahs-8094	256	75	bonnet	bonnet	NOUN
ahs-8094	256	76	,	,	PUNCT
ahs-8094	256	77	and	and	CCONJ
ahs-8094	256	78	california	california	PROPN
ahs-8094	256	79	wonder	wonder	VERB
ahs-8094	256	80	with	with	ADP
ahs-8094	256	81	scores	score	NOUN
ahs-8094	256	82	between	between	ADP
ahs-8094	256	83	7­9	7­9	NUM
ahs-8094	256	84	(	(	PUNCT
ahs-8094	256	85	table	table	NOUN
ahs-8094	256	86	9	9	NUM
ahs-8094	256	87	)	)	PUNCT
ahs-8094	256	88	.	.	PUNCT
ahs-8094	257	1	two	two	NUM
ahs-8094	257	2	local	local	ADJ
ahs-8094	257	3	genotypes	genotype	NOUN
ahs-8094	257	4	(	(	PUNCT
ahs-8094	257	5	00767ppr	00767ppr	NOUN
ahs-8094	257	6	,	,	PUNCT
ahs-8094	257	7	and	and	CCONJ
ahs-8094	257	8	00802ppr	00802ppr	NOUN
ahs-8094	257	9	)	)	PUNCT
ahs-8094	257	10	and	and	CCONJ
ahs-8094	257	11	three	three	NUM
ahs-8094	257	12	introduced	introduce	VERB
ahs-8094	257	13	genotypes	genotype	NOUN
ahs-8094	257	14	(	(	PUNCT
ahs-8094	257	15	pbc	pbc	PROPN
ahs-8094	257	16	462	462	NUM
ahs-8094	257	17	,	,	PUNCT
ahs-8094	257	18	pp9950­5197	pp9950­5197	PROPN
ahs-8094	257	19	and	and	CCONJ
ahs-8094	257	20	icpn	icpn	PROPN
ahs-8094	257	21	18­7	18­7	NUM
ahs-8094	257	22	)	)	PUNCT
ahs-8094	257	23	showed	show	VERB
ahs-8094	257	24	resistance	resistance	NOUN
ahs-8094	257	25	to	to	ADP
ahs-8094	257	26	viral	viral	ADJ
ahs-8094	257	27	diseases	disease	NOUN
ahs-8094	257	28	in	in	ADP
ahs-8094	257	29	both	both	DET
ahs-8094	257	30	locations	location	NOUN
ahs-8094	257	31	.	.	PUNCT
ahs-8094	258	1	reaction	reaction	NOUN
ahs-8094	258	2	of	of	ADP
ahs-8094	258	3	hot	hot	ADJ
ahs-8094	258	4	pepper	pepper	NOUN
ahs-8094	258	5	genotypes	genotype	NOUN
ahs-8094	258	6	to	to	PART
ahs-8094	258	7	cmv	cmv	VERB
ahs-8094	258	8	under	under	ADP
ahs-8094	258	9	arti‐	arti‐	PROPN
ahs-8094	258	10	ficial	ficial	ADJ
ahs-8094	258	11	inoculation	inoculation	NOUN
ahs-8094	258	12	conditions	condition	NOUN
ahs-8094	258	13	disease	disease	NOUN
ahs-8094	258	14	incidence	incidence	VERB
ahs-8094	258	15	a	a	DET
ahs-8094	258	16	significant	significant	ADJ
ahs-8094	258	17	difference	difference	NOUN
ahs-8094	258	18	(	(	PUNCT
ahs-8094	258	19	p<0.05	p<0.05	NOUN
ahs-8094	258	20	)	)	PUNCT
ahs-8094	258	21	in	in	ADP
ahs-8094	258	22	disease	disease	NOUN
ahs-8094	258	23	inci­	inci­	NOUN
ahs-8094	258	24	dence	dence	NOUN
ahs-8094	258	25	and	and	CCONJ
ahs-8094	258	26	symptoms	symptom	NOUN
ahs-8094	258	27	severity	severity	NOUN
ahs-8094	258	28	was	be	AUX
ahs-8094	258	29	observed	observe	VERB
ahs-8094	258	30	between	between	ADP
ahs-8094	258	31	the	the	DET
ahs-8094	258	32	genotypes	genotype	NOUN
ahs-8094	258	33	tested	test	VERB
ahs-8094	258	34	(	(	PUNCT
ahs-8094	258	35	table	table	NOUN
ahs-8094	258	36	10	10	NUM
ahs-8094	258	37	)	)	PUNCT
ahs-8094	258	38	.	.	PUNCT
ahs-8094	259	1	infected	infect	VERB
ahs-8094	259	2	plants	plant	NOUN
ahs-8094	259	3	showed	show	VERB
ahs-8094	259	4	systemic	systemic	ADJ
ahs-8094	259	5	symptoms	symptom	NOUN
ahs-8094	259	6	of	of	ADP
ahs-8094	259	7	cmv	cmv	NOUN
ahs-8094	259	8	infection	infection	NOUN
ahs-8094	259	9	includ­	includ­	PROPN
ahs-8094	259	10	ing	ing	ADJ
ahs-8094	259	11	leaf	leaf	NOUN
ahs-8094	259	12	mosaic	mosaic	NOUN
ahs-8094	259	13	,	,	PUNCT
ahs-8094	259	14	mottle	mottle	NOUN
ahs-8094	259	15	,	,	PUNCT
ahs-8094	259	16	crinkling	crinkling	NOUN
ahs-8094	259	17	,	,	PUNCT
ahs-8094	259	18	small	small	ADJ
ahs-8094	259	19	and	and	CCONJ
ahs-8094	259	20	deformed	deformed	ADJ
ahs-8094	259	21	leaves	leave	NOUN
ahs-8094	259	22	,	,	PUNCT
ahs-8094	259	23	and	and	CCONJ
ahs-8094	259	24	stunting	stunt	VERB
ahs-8094	259	25	with	with	ADP
ahs-8094	259	26	varying	vary	VERB
ahs-8094	259	27	degrees	degree	NOUN
ahs-8094	259	28	of	of	ADP
ahs-8094	259	29	severity	severity	NOUN
ahs-8094	259	30	(	(	PUNCT
ahs-8094	259	31	fig	fig	NOUN
ahs-8094	259	32	.	.	PUNCT
ahs-8094	260	1	3	3	NUM
ahs-8094	260	2	)	)	PUNCT
ahs-8094	260	3	.	.	PUNCT
ahs-8094	261	1	six	six	NUM
ahs-8094	261	2	genotypes	genotype	NOUN
ahs-8094	261	3	(	(	PUNCT
ahs-8094	261	4	red	red	ADJ
ahs-8094	261	5	scotch	scotch	NOUN
ahs-8094	261	6	bonnet	bonnet	NOUN
ahs-8094	261	7	,	,	PUNCT
ahs-8094	261	8	00795ppr	00795ppr	NOUN
ahs-8094	261	9	,	,	PUNCT
ahs-8094	261	10	00792ppr	00792ppr	NOUN
ahs-8094	261	11	,	,	PUNCT
ahs-8094	261	12	00786ppr	00786ppr	NOUN
ahs-8094	261	13	,	,	PUNCT
ahs-8094	261	14	00774ppr	00774ppr	NOUN
ahs-8094	261	15	,	,	PUNCT
ahs-8094	261	16	and	and	CCONJ
ahs-8094	261	17	long	long	ADJ
ahs-8094	261	18	red	red	ADJ
ahs-8094	261	19	cayenne	cayenne	NOUN
ahs-8094	261	20	)	)	PUNCT
ahs-8094	261	21	developed	develop	VERB
ahs-8094	261	22	symptoms	symptom	NOUN
ahs-8094	261	23	thirteen	thirteen	NUM
ahs-8094	261	24	days	day	NOUN
ahs-8094	261	25	’	'	PUNCT
ahs-8094	261	26	post­inoculation	post­inoculation	NOUN
ahs-8094	261	27	(	(	PUNCT
ahs-8094	261	28	dpi	dpi	NOUN
ahs-8094	261	29	)	)	PUNCT
ahs-8094	261	30	and	and	CCONJ
ahs-8094	261	31	the	the	DET
ahs-8094	261	32	first	first	ADJ
ahs-8094	261	33	three	three	NUM
ahs-8094	261	34	table	table	NOUN
ahs-8094	261	35	9	9	NUM
ahs-8094	261	36	­	­	NOUN
ahs-8094	261	37	classification	classification	NOUN
ahs-8094	261	38	of	of	ADP
ahs-8094	261	39	the	the	DET
ahs-8094	261	40	hot	hot	ADJ
ahs-8094	261	41	pepper	pepper	NOUN
ahs-8094	261	42	genotypes	genotype	NOUN
ahs-8094	261	43	based	base	VERB
ahs-8094	261	44	on	on	ADP
ahs-8094	261	45	incidence	incidence	NOUN
ahs-8094	261	46	(	(	PUNCT
ahs-8094	261	47	%	%	INTJ
ahs-8094	261	48	)	)	PUNCT
ahs-8094	261	49	and	and	CCONJ
ahs-8094	261	50	severity	severity	NOUN
ahs-8094	261	51	indices	index	NOUN
ahs-8094	261	52	of	of	ADP
ahs-8094	261	53	virus­induced	virus­induce	VERB
ahs-8094	261	54	diseases	disease	NOUN
ahs-8094	261	55	under	under	ADP
ahs-8094	261	56	field	field	NOUN
ahs-8094	261	57	conditions	condition	NOUN
ahs-8094	261	58	the	the	DET
ahs-8094	261	59	values	value	NOUN
ahs-8094	261	60	represent	represent	VERB
ahs-8094	261	61	means	mean	NOUN
ahs-8094	261	62	of	of	ADP
ahs-8094	261	63	un­transformed	un­transformed	PROPN
ahs-8094	261	64	data	datum	NOUN
ahs-8094	261	65	.	.	PUNCT
ahs-8094	262	1	means	mean	VERB
ahs-8094	262	2	comparison	comparison	NOUN
ahs-8094	262	3	done	do	VERB
ahs-8094	262	4	by	by	ADP
ahs-8094	262	5	least	least	ADJ
ahs-8094	262	6	significant	significant	ADJ
ahs-8094	262	7	difference	difference	NOUN
ahs-8094	262	8	(	(	PUNCT
ahs-8094	262	9	lsd	lsd	NOUN
ahs-8094	262	10	)	)	PUNCT
ahs-8094	262	11	test	test	NOUN
ahs-8094	262	12	on	on	ADP
ahs-8094	262	13	transformed	transform	VERB
ahs-8094	262	14	data	datum	NOUN
ahs-8094	262	15	.	.	PUNCT
ahs-8094	263	1	means	mean	VERB
ahs-8094	263	2	with	with	ADP
ahs-8094	263	3	the	the	DET
ahs-8094	263	4	same	same	ADJ
ahs-8094	263	5	letters	letter	NOUN
ahs-8094	263	6	within	within	ADP
ahs-8094	263	7	a	a	DET
ahs-8094	263	8	column	column	NOUN
ahs-8094	263	9	are	be	AUX
ahs-8094	263	10	not	not	PART
ahs-8094	263	11	significantly	significantly	ADV
ahs-8094	263	12	different	different	ADJ
ahs-8094	263	13	(	(	PUNCT
ahs-8094	263	14	p<0.05	p<0.05	NOUN
ahs-8094	263	15	)	)	PUNCT
ahs-8094	263	16	.	.	PUNCT
ahs-8094	264	1	incidence	incidence	NOUN
ahs-8094	264	2	scores	score	NOUN
ahs-8094	264	3	;	;	PUNCT
ahs-8094	264	4	20	20	NUM
ahs-8094	264	5	%	%	NOUN
ahs-8094	264	6	=	=	NOUN
ahs-8094	264	7	1	1	NUM
ahs-8094	264	8	,	,	PUNCT
ahs-8094	264	9	21­30%=2	21­30%=2	NOUN
ahs-8094	264	10	,	,	PUNCT
ahs-8094	264	11	31­	31­	NUM
ahs-8094	264	12	50%=3	50%=3	NUM
ahs-8094	264	13	and	and	CCONJ
ahs-8094	264	14	>	>	X
ahs-8094	264	15	51%=4	51%=4	NUM
ahs-8094	264	16	.	.	PUNCT
ahs-8094	265	1	severity	severity	NOUN
ahs-8094	265	2	scores	score	NOUN
ahs-8094	265	3	;	;	PUNCT
ahs-8094	265	4	<	<	X
ahs-8094	265	5	1=1	1=1	NUM
ahs-8094	265	6	,	,	PUNCT
ahs-8094	265	7	1.1­2.0=2	1.1­2.0=2	NUM
ahs-8094	265	8	,	,	PUNCT
ahs-8094	265	9	2.1­3.0=3	2.1­3.0=3	NUM
ahs-8094	265	10	and	and	CCONJ
ahs-8094	265	11	>	>	NOUN
ahs-8094	265	12	3.0=4	3.0=4	NUM
ahs-8094	265	13	.	.	PUNCT
ahs-8094	266	1	cumulative	cumulative	ADJ
ahs-8094	266	2	scores	score	NOUN
ahs-8094	266	3	i.e.	i.e.	X
ahs-8094	266	4	incidence	incidence	NOUN
ahs-8094	266	5	+	+	CCONJ
ahs-8094	266	6	severity	severity	NOUN
ahs-8094	266	7	indices	index	NOUN
ahs-8094	266	8	;	;	PUNCT
ahs-8094	266	9	<	<	X
ahs-8094	266	10	3=	3=	NUM
ahs-8094	266	11	resi­	resi­	PROPN
ahs-8094	266	12	stant	stant	NOUN
ahs-8094	266	13	(	(	PUNCT
ahs-8094	266	14	r	r	NOUN
ahs-8094	266	15	)	)	PUNCT
ahs-8094	266	16	,	,	PUNCT
ahs-8094	266	17	4­6	4­6	NUM
ahs-8094	266	18	=	=	SYM
ahs-8094	266	19	moderately	moderately	ADV
ahs-8094	266	20	resistant	resistant	ADJ
ahs-8094	266	21	(	(	PUNCT
ahs-8094	266	22	mr	mr	PROPN
ahs-8094	266	23	)	)	PUNCT
ahs-8094	266	24	and	and	CCONJ
ahs-8094	266	25	7­8	7­8	NUM
ahs-8094	266	26	=	=	PUNCT
ahs-8094	266	27	susceptible	susceptible	ADJ
ahs-8094	266	28	(	(	PUNCT
ahs-8094	266	29	s	s	NOUN
ahs-8094	266	30	)	)	PUNCT
ahs-8094	266	31	.	.	PUNCT
ahs-8094	267	1	genotype	genotype	NOUN
ahs-8094	267	2	incidence	incidence	NOUN
ahs-8094	267	3	(	(	PUNCT
ahs-8094	267	4	%	%	INTJ
ahs-8094	267	5	)	)	PUNCT
ahs-8094	267	6	severity	severity	NOUN
ahs-8094	267	7	indices	index	NOUN
ahs-8094	267	8	cumulative	cumulative	ADJ
ahs-8094	267	9	rating	rating	NOUN
ahs-8094	267	10	host	host	NOUN
ahs-8094	267	11	reactionseason	reactionseason	NOUN
ahs-8094	267	12	one	one	NUM
ahs-8094	267	13	season	season	NOUN
ahs-8094	267	14	two	two	NUM
ahs-8094	267	15	pooled	pool	VERB
ahs-8094	267	16	rating	rating	NOUN
ahs-8094	267	17	season	season	NOUN
ahs-8094	267	18	one	one	NUM
ahs-8094	267	19	season	season	NOUN
ahs-8094	267	20	two	two	NUM
ahs-8094	267	21	pooled	pool	VERB
ahs-8094	267	22	rating	rating	NOUN
ahs-8094	267	23	00765ppr	00765ppr	NOUN
ahs-8094	267	24	97	97	NUM
ahs-8094	267	25	51.5	51.5	NUM
ahs-8094	267	26	74.3	74.3	NUM
ahs-8094	267	27	ab	ab	PROPN
ahs-8094	267	28	4	4	NUM
ahs-8094	267	29	2.4	2.4	NUM
ahs-8094	267	30	1.6	1.6	NUM
ahs-8094	267	31	2	2	NUM
ahs-8094	267	32	d	d	SYM
ahs-8094	267	33	2	2	NUM
ahs-8094	267	34	6	6	NUM
ahs-8094	267	35	mr	mr	PROPN
ahs-8094	267	36	00767ppr	00767ppr	NOUN
ahs-8094	267	37	45	45	NUM
ahs-8094	267	38	11.5	11.5	NUM
ahs-8094	267	39	28.3	28.3	NUM
ahs-8094	267	40	e	e	NOUN
ahs-8094	267	41	2	2	NUM
ahs-8094	267	42	1	1	NUM
ahs-8094	267	43	0.3	0.3	NUM
ahs-8094	267	44	0.7	0.7	NUM
ahs-8094	267	45	ef	ef	PROPN
ahs-8094	267	46	1	1	NUM
ahs-8094	267	47	3	3	NUM
ahs-8094	267	48	r	r	NOUN
ahs-8094	267	49	00774ppr	00774ppr	NOUN
ahs-8094	267	50	96.5	96.5	NUM
ahs-8094	267	51	71.5	71.5	NUM
ahs-8094	267	52	84	84	NUM
ahs-8094	267	53	a	a	DET
ahs-8094	267	54	4	4	NUM
ahs-8094	267	55	2.8	2.8	NUM
ahs-8094	267	56	2.7	2.7	NUM
ahs-8094	267	57	2.8	2.8	NUM
ahs-8094	267	58	abc	abc	NOUN
ahs-8094	267	59	3	3	NUM
ahs-8094	267	60	7	7	NUM
ahs-8094	267	61	s	s	NOUN
ahs-8094	267	62	00775ppr	00775ppr	NOUN
ahs-8094	267	63	83.5	83.5	NUM
ahs-8094	267	64	65	65	NUM
ahs-8094	267	65	74.3	74.3	NUM
ahs-8094	267	66	ab	ab	PROPN
ahs-8094	267	67	4	4	NUM
ahs-8094	267	68	2.6	2.6	NUM
ahs-8094	267	69	2.2	2.2	NUM
ahs-8094	267	70	2.4	2.4	NUM
ahs-8094	267	71	cd	cd	NOUN
ahs-8094	267	72	3	3	NUM
ahs-8094	267	73	7	7	NUM
ahs-8094	267	74	s	s	NOUN
ahs-8094	267	75	00786ppr	00786ppr	NOUN
ahs-8094	267	76	88.5	88.5	NUM
ahs-8094	267	77	51.5	51.5	NUM
ahs-8094	267	78	70	70	NUM
ahs-8094	267	79	abc	abc	PROPN
ahs-8094	267	80	4	4	NUM
ahs-8094	267	81	2.9	2.9	NUM
ahs-8094	267	82	2.1	2.1	NUM
ahs-8094	267	83	2.5	2.5	NUM
ahs-8094	267	84	bcd	bcd	NOUN
ahs-8094	267	85	3	3	NUM
ahs-8094	267	86	7	7	NUM
ahs-8094	267	87	s	s	PART
ahs-8094	267	88	00791ppr	00791ppr	NOUN
ahs-8094	267	89	90	90	NUM
ahs-8094	267	90	90	90	NUM
ahs-8094	267	91	90	90	NUM
ahs-8094	267	92	a	a	DET
ahs-8094	267	93	4	4	NUM
ahs-8094	267	94	2.9	2.9	NUM
ahs-8094	267	95	2.7	2.7	NUM
ahs-8094	267	96	2.8	2.8	NUM
ahs-8094	267	97	abc	abc	NOUN
ahs-8094	267	98	3	3	NUM
ahs-8094	267	99	7	7	NUM
ahs-8094	267	100	s	s	NOUN
ahs-8094	267	101	00792ppr	00792ppr	NOUN
ahs-8094	267	102	93.5	93.5	NUM
ahs-8094	267	103	78.5	78.5	NUM
ahs-8094	267	104	86	86	NUM
ahs-8094	267	105	a	a	DET
ahs-8094	267	106	4	4	NUM
ahs-8094	267	107	3.5	3.5	NUM
ahs-8094	267	108	3	3	NUM
ahs-8094	267	109	3.3	3.3	NUM
ahs-8094	267	110	a	a	DET
ahs-8094	267	111	4	4	NUM
ahs-8094	267	112	8	8	NUM
ahs-8094	267	113	s	s	NOUN
ahs-8094	267	114	00802ppr	00802ppr	NOUN
ahs-8094	267	115	33	33	NUM
ahs-8094	267	116	24	24	NUM
ahs-8094	267	117	28.5	28.5	NUM
ahs-8094	267	118	e	e	NOUN
ahs-8094	267	119	2	2	NUM
ahs-8094	267	120	0.8	0.8	NUM
ahs-8094	267	121	1.1	1.1	NUM
ahs-8094	267	122	1	1	NUM
ahs-8094	267	123	ef	ef	PROPN
ahs-8094	267	124	1	1	NUM
ahs-8094	267	125	3	3	NUM
ahs-8094	267	126	r	r	NOUN
ahs-8094	267	127	00795ppr	00795ppr	NOUN
ahs-8094	267	128	91.5	91.5	NUM
ahs-8094	267	129	81.5	81.5	NUM
ahs-8094	267	130	86.5	86.5	NUM
ahs-8094	267	131	a	a	DET
ahs-8094	267	132	4	4	NUM
ahs-8094	267	133	2.8	2.8	NUM
ahs-8094	267	134	2.9	2.9	NUM
ahs-8094	267	135	2.9	2.9	NUM
ahs-8094	267	136	abc	abc	PROPN
ahs-8094	267	137	3	3	NUM
ahs-8094	267	138	7	7	PROPN
ahs-8094	267	139	s	s	NOUN
ahs-8094	267	140	pbc	pbc	PROPN
ahs-8094	267	141	462	462	NUM
ahs-8094	267	142	13	13	NUM
ahs-8094	267	143	11.5	11.5	NUM
ahs-8094	267	144	12.3	12.3	NUM
ahs-8094	267	145	e	e	NOUN
ahs-8094	267	146	1	1	NUM
ahs-8094	267	147	0.2	0.2	NUM
ahs-8094	267	148	0.4	0.4	NUM
ahs-8094	267	149	0.3	0.3	NUM
ahs-8094	267	150	f	f	NOUN
ahs-8094	267	151	1	1	NUM
ahs-8094	267	152	2	2	NUM
ahs-8094	267	153	r	r	NOUN
ahs-8094	267	154	pp9950­5197	pp9950­5197	NOUN
ahs-8094	267	155	28.5	28.5	NUM
ahs-8094	267	156	13	13	NUM
ahs-8094	267	157	20.6	20.6	NUM
ahs-8094	267	158	e	e	NOUN
ahs-8094	267	159	1	1	NUM
ahs-8094	267	160	0.7	0.7	NUM
ahs-8094	267	161	0.5	0.5	NUM
ahs-8094	267	162	0.6	0.6	NUM
ahs-8094	267	163	ef	ef	PROPN
ahs-8094	267	164	1	1	NUM
ahs-8094	267	165	2	2	NUM
ahs-8094	267	166	r	r	NOUN
ahs-8094	267	167	hp	hp	NOUN
ahs-8094	267	168	0117	0117	NUM
ahs-8094	267	169	53.5	53.5	NUM
ahs-8094	267	170	33	33	NUM
ahs-8094	267	171	43.3	43.3	NUM
ahs-8094	267	172	cde	cde	NOUN
ahs-8094	267	173	3	3	NUM
ahs-8094	267	174	1.2	1.2	NUM
ahs-8094	267	175	0.9	0.9	NUM
ahs-8094	267	176	1.1	1.1	NUM
ahs-8094	267	177	e	e	NOUN
ahs-8094	267	178	2	2	NUM
ahs-8094	267	179	5	5	NUM
ahs-8094	267	180	mr	mr	PROPN
ahs-8094	267	181	pp9852­170	pp9852­170	PROPN
ahs-8094	267	182	55	55	NUM
ahs-8094	267	183	21.5	21.5	NUM
ahs-8094	267	184	38.3	38.3	NUM
ahs-8094	267	185	cde	cde	NOUN
ahs-8094	267	186	3	3	NUM
ahs-8094	267	187	1.2	1.2	NUM
ahs-8094	267	188	0.7	0.7	NUM
ahs-8094	267	189	1	1	NUM
ahs-8094	267	190	ef	ef	PROPN
ahs-8094	267	191	1	1	NUM
ahs-8094	267	192	4	4	NUM
ahs-8094	267	193	mr	mr	PROPN
ahs-8094	267	194	icpn	icpn	PROPN
ahs-8094	267	195	18­7	18­7	NUM
ahs-8094	267	196	35	35	NUM
ahs-8094	267	197	15	15	NUM
ahs-8094	267	198	25	25	NUM
ahs-8094	267	199	e	e	NOUN
ahs-8094	267	200	2	2	NUM
ahs-8094	267	201	0.6	0.6	NUM
ahs-8094	267	202	0.5	0.5	NUM
ahs-8094	267	203	0.6	0.6	NUM
ahs-8094	267	204	ef	ef	PROPN
ahs-8094	267	205	1	1	NUM
ahs-8094	267	206	3	3	NUM
ahs-8094	267	207	r	r	NOUN
ahs-8094	267	208	long	long	ADJ
ahs-8094	267	209	red	red	ADJ
ahs-8094	267	210	cayenne	cayenne	NOUN
ahs-8094	267	211	88.5	88.5	NUM
ahs-8094	267	212	78.5	78.5	NUM
ahs-8094	267	213	83.5	83.5	NUM
ahs-8094	267	214	a	a	DET
ahs-8094	267	215	4	4	NUM
ahs-8094	267	216	3	3	NUM
ahs-8094	267	217	3.3	3.3	NUM
ahs-8094	267	218	3.2	3.2	NUM
ahs-8094	267	219	ab	ab	NOUN
ahs-8094	267	220	4	4	NUM
ahs-8094	267	221	8	8	NUM
ahs-8094	267	222	s	s	NOUN
ahs-8094	267	223	bird­eye	bird­eye	NOUN
ahs-8094	267	224	76.5	76.5	NUM
ahs-8094	267	225	55	55	NUM
ahs-8094	267	226	65.8	65.8	NUM
ahs-8094	267	227	abcd	abcd	NOUN
ahs-8094	267	228	4	4	NUM
ahs-8094	267	229	3	3	NUM
ahs-8094	267	230	2.5	2.5	NUM
ahs-8094	267	231	2.8	2.8	NUM
ahs-8094	267	232	abc	abc	NOUN
ahs-8094	267	233	3	3	NUM
ahs-8094	267	234	7	7	NUM
ahs-8094	267	235	s	s	NOUN
ahs-8094	267	236	scotch	scotch	NOUN
ahs-8094	267	237	bonnet	bonnet	NOUN
ahs-8094	267	238	80	80	NUM
ahs-8094	267	239	71.5	71.5	NUM
ahs-8094	267	240	75.6	75.6	NUM
ahs-8094	267	241	ab	ab	PROPN
ahs-8094	267	242	4	4	NUM
ahs-8094	267	243	3	3	NUM
ahs-8094	267	244	2.3	2.3	NUM
ahs-8094	267	245	2.7	2.7	NUM
ahs-8094	267	246	abcd	abcd	NOUN
ahs-8094	267	247	3	3	NUM
ahs-8094	267	248	7	7	NUM
ahs-8094	267	249	s	s	PART
ahs-8094	267	250	california	california	PROPN
ahs-8094	267	251	wonder	wonder	VERB
ahs-8094	267	252	91.5	91.5	NUM
ahs-8094	267	253	68.5	68.5	NUM
ahs-8094	267	254	75.6	75.6	NUM
ahs-8094	267	255	a	a	DET
ahs-8094	267	256	4	4	NUM
ahs-8094	267	257	2.9	2.9	NUM
ahs-8094	267	258	2.9	2.9	NUM
ahs-8094	267	259	2.9	2.9	NUM
ahs-8094	267	260	abc	abc	PROPN
ahs-8094	267	261	3	3	NUM
ahs-8094	267	262	7	7	NUM
ahs-8094	267	263	s	s	NOUN
ahs-8094	267	264	lsd	lsd	NOUN
ahs-8094	267	265	33.6	33.6	NUM
ahs-8094	267	266	0.7	0.7	NUM
ahs-8094	267	267	p­value	p­value	NOUN
ahs-8094	267	268	0.0004	0.0004	NUM
ahs-8094	267	269	<	<	X
ahs-8094	267	270	.0001	.0001	X
ahs-8094	267	271	waweru	waweru	PROPN
ahs-8094	267	272	et	et	PROPN
ahs-8094	267	273	al	al	PROPN
ahs-8094	267	274	.	.	PROPN
ahs-8094	268	1	‐	‐	NOUN
ahs-8094	268	2	evaluation	evaluation	NOUN
ahs-8094	268	3	of	of	ADP
ahs-8094	268	4	hot	hot	ADJ
ahs-8094	268	5	pepper	pepper	NOUN
ahs-8094	268	6	genotypes	genotype	NOUN
ahs-8094	268	7	in	in	ADP
ahs-8094	268	8	rwanda	rwanda	PROPN
ahs-8094	268	9	407	407	NUM
ahs-8094	268	10	showed	show	VERB
ahs-8094	268	11	high	high	ADJ
ahs-8094	268	12	levels	level	NOUN
ahs-8094	268	13	of	of	ADP
ahs-8094	268	14	cmv	cmv	NOUN
ahs-8094	268	15	infection	infection	NOUN
ahs-8094	268	16	(	(	PUNCT
ahs-8094	268	17	table	table	NOUN
ahs-8094	268	18	10	10	NUM
ahs-8094	268	19	)	)	PUNCT
ahs-8094	268	20	.	.	PUNCT
ahs-8094	269	1	introduced	introduce	VERB
ahs-8094	269	2	genotypes	genotype	NOUN
ahs-8094	269	3	pbc462	pbc462	PROPN
ahs-8094	269	4	,	,	PUNCT
ahs-8094	269	5	pp9950­5197	pp9950­5197	PROPN
ahs-8094	269	6	,	,	PUNCT
ahs-8094	269	7	hp	hp	PROPN
ahs-8094	269	8	0117	0117	NUM
ahs-8094	269	9	,	,	PUNCT
ahs-8094	269	10	pp9852­170	pp9852­170	PROPN
ahs-8094	269	11	,	,	PUNCT
ahs-8094	269	12	icpn18­7	icpn18­7	NOUN
ahs-8094	269	13	,	,	PUNCT
ahs-8094	269	14	and	and	CCONJ
ahs-8094	269	15	local	local	ADJ
ahs-8094	269	16	genotype	genotype	NOUN
ahs-8094	269	17	00765ppr	00765ppr	NOUN
ahs-8094	269	18	displayed	display	VERB
ahs-8094	269	19	symptoms	symptom	NOUN
ahs-8094	269	20	at	at	ADP
ahs-8094	269	21	seventeen	seventeen	NUM
ahs-8094	269	22	dpi	dpi	NOUN
ahs-8094	269	23	while	while	SCONJ
ahs-8094	269	24	the	the	DET
ahs-8094	269	25	remaining	remain	VERB
ahs-8094	269	26	two	two	NUM
ahs-8094	269	27	local	local	ADJ
ahs-8094	269	28	genotypes	genotype	NOUN
ahs-8094	269	29	00767ppr	00767ppr	NOUN
ahs-8094	269	30	and	and	CCONJ
ahs-8094	269	31	0802ppr	0802ppr	NOUN
ahs-8094	269	32	showed	show	VERB
ahs-8094	269	33	symptoms	symptom	NOUN
ahs-8094	269	34	at	at	ADP
ahs-8094	269	35	nineteen	nineteen	NUM
ahs-8094	269	36	dpi	dpi	NOUN
ahs-8094	269	37	.	.	PUNCT
ahs-8094	270	1	a	a	DET
ahs-8094	270	2	total	total	NOUN
ahs-8094	270	3	of	of	ADP
ahs-8094	270	4	six	six	NUM
ahs-8094	270	5	genotypes	genotype	NOUN
ahs-8094	270	6	namely	namely	ADV
ahs-8094	270	7	00765ppr	00765ppr	NOUN
ahs-8094	270	8	,	,	PUNCT
ahs-8094	270	9	00792ppr	00792ppr	NOUN
ahs-8094	270	10	,	,	PUNCT
ahs-8094	270	11	00795ppr	00795ppr	NOUN
ahs-8094	270	12	,	,	PUNCT
ahs-8094	270	13	00774ppr	00774ppr	NOUN
ahs-8094	270	14	,	,	PUNCT
ahs-8094	270	15	long	long	ADJ
ahs-8094	270	16	red	red	ADJ
ahs-8094	270	17	cayenne	cayenne	NOUN
ahs-8094	270	18	and	and	CCONJ
ahs-8094	270	19	red	red	ADJ
ahs-8094	270	20	scotch	scotch	NOUN
ahs-8094	270	21	bonnet	bonnet	NOUN
ahs-8094	270	22	had	have	VERB
ahs-8094	270	23	disease	disease	NOUN
ahs-8094	270	24	incidence	incidence	NOUN
ahs-8094	270	25	between	between	ADP
ahs-8094	270	26	50­	50­	NUM
ahs-8094	270	27	100	100	NUM
ahs-8094	270	28	%	%	NOUN
ahs-8094	270	29	,	,	PUNCT
ahs-8094	270	30	severity	severity	NOUN
ahs-8094	270	31	2.7­5	2.7­5	NUM
ahs-8094	270	32	at	at	ADP
ahs-8094	270	33	nineteen	nineteen	NUM
ahs-8094	270	34	dpi	dpi	NOUN
ahs-8094	270	35	and	and	CCONJ
ahs-8094	270	36	thus	thus	ADV
ahs-8094	270	37	rated	rate	VERB
ahs-8094	270	38	as	as	ADV
ahs-8094	270	39	susceptible	susceptible	ADJ
ahs-8094	270	40	to	to	ADP
ahs-8094	270	41	cmv	cmv	NOUN
ahs-8094	270	42	(	(	PUNCT
ahs-8094	270	43	table	table	NOUN
ahs-8094	270	44	10	10	NUM
ahs-8094	270	45	)	)	PUNCT
ahs-8094	270	46	.	.	PUNCT
ahs-8094	271	1	genotypes	genotype	NOUN
ahs-8094	271	2	pp9950­	pp9950­	CCONJ
ahs-8094	271	3	5197	5197	NUM
ahs-8094	271	4	,	,	PUNCT
ahs-8094	271	5	00786ppr	00786ppr	NOUN
ahs-8094	271	6	,	,	PUNCT
ahs-8094	271	7	hp	hp	NOUN
ahs-8094	271	8	0117	0117	NUM
ahs-8094	271	9	and	and	CCONJ
ahs-8094	271	10	icpn	icpn	PROPN
ahs-8094	271	11	18­7	18­7	PROPN
ahs-8094	271	12	had	have	VERB
ahs-8094	271	13	moder­	moder­	ADJ
ahs-8094	271	14	ate	ate	NOUN
ahs-8094	271	15	levels	level	NOUN
ahs-8094	271	16	of	of	ADP
ahs-8094	271	17	infection	infection	NOUN
ahs-8094	271	18	displaying	display	VERB
ahs-8094	271	19	22­35.4	22­35.4	NUM
ahs-8094	271	20	%	%	NOUN
ahs-8094	271	21	disease	disease	NOUN
ahs-8094	271	22	incidence	incidence	NOUN
ahs-8094	271	23	at	at	ADP
ahs-8094	271	24	nineteen	nineteen	NUM
ahs-8094	271	25	dpi	dpi	NOUN
ahs-8094	271	26	and	and	CCONJ
ahs-8094	271	27	thus	thus	ADV
ahs-8094	271	28	classified	classify	VERB
ahs-8094	271	29	as	as	SCONJ
ahs-8094	271	30	mod­	mod­	NOUN
ahs-8094	271	31	erately	erately	ADV
ahs-8094	271	32	resistant	resistant	ADJ
ahs-8094	271	33	to	to	ADP
ahs-8094	271	34	cmv	cmv	NOUN
ahs-8094	271	35	.	.	PUNCT
ahs-8094	272	1	among	among	ADP
ahs-8094	272	2	the	the	DET
ahs-8094	272	3	14	14	NUM
ahs-8094	272	4	hot	hot	ADJ
ahs-8094	272	5	pepper	pepper	NOUN
ahs-8094	272	6	genotypes	genotype	NOUN
ahs-8094	272	7	tested	test	VERB
ahs-8094	272	8	,	,	PUNCT
ahs-8094	272	9	only	only	ADV
ahs-8094	272	10	four	four	NUM
ahs-8094	272	11	including	include	VERB
ahs-8094	272	12	two	two	NUM
ahs-8094	272	13	local	local	ADJ
ahs-8094	272	14	(	(	PUNCT
ahs-8094	272	15	00767ppr	00767ppr	NOUN
ahs-8094	272	16	,	,	PUNCT
ahs-8094	272	17	0802ppr	0802ppr	NOUN
ahs-8094	272	18	)	)	PUNCT
ahs-8094	272	19	and	and	CCONJ
ahs-8094	272	20	two	two	NUM
ahs-8094	272	21	introduced	introduce	VERB
ahs-8094	272	22	(	(	PUNCT
ahs-8094	272	23	pbc	pbc	PROPN
ahs-8094	272	24	462	462	PROPN
ahs-8094	272	25	and	and	CCONJ
ahs-8094	272	26	pp9852­170	pp9852­170	PROPN
ahs-8094	272	27	)	)	PUNCT
ahs-8094	272	28	showed	show	VERB
ahs-8094	272	29	resistant	resistant	ADJ
ahs-8094	272	30	reaction	reaction	NOUN
ahs-8094	272	31	against	against	ADP
ahs-8094	272	32	cmv	cmv	NOUN
ahs-8094	272	33	with	with	ADP
ahs-8094	272	34	disease	disease	NOUN
ahs-8094	272	35	incidence	incidence	NOUN
ahs-8094	272	36	ranging	range	VERB
ahs-8094	272	37	from	from	ADP
ahs-8094	272	38	2­18.8	2­18.8	NUM
ahs-8094	272	39	%	%	NOUN
ahs-8094	272	40	and	and	CCONJ
ahs-8094	272	41	severity	severity	NOUN
ahs-8094	272	42	1.0­1.2	1.0­1.2	NUM
ahs-8094	272	43	at	at	ADP
ahs-8094	272	44	nineteen	nineteen	NUM
ahs-8094	272	45	dpi	dpi	NOUN
ahs-8094	272	46	.	.	PUNCT
ahs-8094	273	1	a	a	DET
ahs-8094	273	2	positive	positive	ADJ
ahs-8094	273	3	reac­	reac­	PROPN
ahs-8094	273	4	tion	tion	NOUN
ahs-8094	273	5	to	to	ADP
ahs-8094	273	6	cmv	cmv	PROPN
ahs-8094	273	7	was	be	AUX
ahs-8094	273	8	revealed	reveal	VERB
ahs-8094	273	9	by	by	ADP
ahs-8094	273	10	elisa	elisa	NOUN
ahs-8094	273	11	for	for	ADP
ahs-8094	273	12	the	the	DET
ahs-8094	273	13	tested	test	VERB
ahs-8094	273	14	samples	sample	NOUN
ahs-8094	273	15	from	from	ADP
ahs-8094	273	16	all	all	DET
ahs-8094	273	17	genotypes	genotype	NOUN
ahs-8094	273	18	.	.	PUNCT
ahs-8094	274	1	table	table	NOUN
ahs-8094	274	2	10	10	NUM
ahs-8094	274	3	­	­	NOUN
ahs-8094	274	4	reaction	reaction	NOUN
ahs-8094	274	5	of	of	ADP
ahs-8094	274	6	hot	hot	ADJ
ahs-8094	274	7	pepper	pepper	NOUN
ahs-8094	274	8	genotypes	genotype	NOUN
ahs-8094	274	9	against	against	ADP
ahs-8094	274	10	cucumber	cucumber	PROPN
ahs-8094	274	11	mosaic	mosaic	PROPN
ahs-8094	274	12	virus	virus	NOUN
ahs-8094	274	13	under	under	ADP
ahs-8094	274	14	screenhouse	screenhouse	PROPN
ahs-8094	274	15	conditions	condition	NOUN
ahs-8094	274	16	the	the	DET
ahs-8094	274	17	values	value	NOUN
ahs-8094	274	18	represent	represent	VERB
ahs-8094	274	19	means	mean	NOUN
ahs-8094	274	20	of	of	ADP
ahs-8094	274	21	un­transformed	un­transformed	PROPN
ahs-8094	274	22	data	datum	NOUN
ahs-8094	274	23	.	.	PUNCT
ahs-8094	275	1	means	mean	VERB
ahs-8094	275	2	comparison	comparison	NOUN
ahs-8094	275	3	done	do	VERB
ahs-8094	275	4	by	by	ADP
ahs-8094	275	5	least	least	ADJ
ahs-8094	275	6	significant	significant	ADJ
ahs-8094	275	7	difference	difference	NOUN
ahs-8094	275	8	(	(	PUNCT
ahs-8094	275	9	lsd	lsd	NOUN
ahs-8094	275	10	)	)	PUNCT
ahs-8094	275	11	test	test	NOUN
ahs-8094	275	12	on	on	ADP
ahs-8094	275	13	transformed	transform	VERB
ahs-8094	275	14	data	datum	NOUN
ahs-8094	275	15	.	.	PUNCT
ahs-8094	276	1	data	datum	NOUN
ahs-8094	276	2	transformed	transform	VERB
ahs-8094	276	3	by	by	ADP
ahs-8094	276	4	square	square	ADJ
ahs-8094	276	5	root	root	NOUN
ahs-8094	276	6	(	(	PUNCT
ahs-8094	276	7	x	x	SYM
ahs-8094	276	8	+	+	NOUN
ahs-8094	276	9	1	1	NUM
ahs-8094	276	10	)	)	PUNCT
ahs-8094	276	11	.	.	PUNCT
ahs-8094	276	12	means	mean	VERB
ahs-8094	276	13	with	with	ADP
ahs-8094	276	14	the	the	DET
ahs-8094	276	15	same	same	ADJ
ahs-8094	276	16	letters	letter	NOUN
ahs-8094	276	17	within	within	ADP
ahs-8094	276	18	a	a	DET
ahs-8094	276	19	column	column	NOUN
ahs-8094	276	20	are	be	AUX
ahs-8094	276	21	not	not	PART
ahs-8094	276	22	significantly	significantly	ADV
ahs-8094	276	23	different	different	ADJ
ahs-8094	276	24	(	(	PUNCT
ahs-8094	276	25	p<0.05	p<0.05	NOUN
ahs-8094	276	26	)	)	PUNCT
ahs-8094	276	27	.	.	PUNCT
ahs-8094	277	1	incidence	incidence	NOUN
ahs-8094	277	2	scores	score	NOUN
ahs-8094	277	3	:	:	PUNCT
ahs-8094	277	4	20	20	NUM
ahs-8094	277	5	%	%	NOUN
ahs-8094	277	6	=	=	NOUN
ahs-8094	277	7	1	1	NUM
ahs-8094	277	8	,	,	PUNCT
ahs-8094	277	9	21­30%=2	21­30%=2	NOUN
ahs-8094	277	10	,	,	PUNCT
ahs-8094	277	11	31­50%=3	31­50%=3	PROPN
ahs-8094	277	12	and	and	CCONJ
ahs-8094	277	13	>	>	NOUN
ahs-8094	277	14	51%=4	51%=4	NUM
ahs-8094	277	15	.	.	PUNCT
ahs-8094	278	1	severity	severity	NOUN
ahs-8094	278	2	scores	score	NOUN
ahs-8094	278	3	:	:	PUNCT
ahs-8094	278	4	<	<	X
ahs-8094	278	5	1=1	1=1	NUM
ahs-8094	278	6	,	,	PUNCT
ahs-8094	278	7	1.1­2.0=2	1.1­2.0=2	NUM
ahs-8094	278	8	,	,	PUNCT
ahs-8094	278	9	2.1­3.0=3	2.1­3.0=3	NUM
ahs-8094	278	10	and	and	CCONJ
ahs-8094	278	11	>	>	NOUN
ahs-8094	278	12	3.0=4	3.0=4	NUM
ahs-8094	278	13	.	.	PUNCT
ahs-8094	279	1	cumulative	cumulative	ADJ
ahs-8094	279	2	scores	score	NOUN
ahs-8094	279	3	i.e.	i.e.	X
ahs-8094	279	4	incidence	incidence	NOUN
ahs-8094	279	5	+	+	CCONJ
ahs-8094	279	6	severity	severity	NOUN
ahs-8094	279	7	indices	index	NOUN
ahs-8094	279	8	:	:	PUNCT
ahs-8094	279	9	<	<	X
ahs-8094	279	10	3=	3=	NUM
ahs-8094	279	11	resistant	resistant	ADJ
ahs-8094	279	12	(	(	PUNCT
ahs-8094	279	13	r	r	NOUN
ahs-8094	279	14	)	)	PUNCT
ahs-8094	279	15	,	,	PUNCT
ahs-8094	279	16	4­6	4­6	NUM
ahs-8094	279	17	=	=	SYM
ahs-8094	279	18	moderately	moderately	ADV
ahs-8094	279	19	resistant	resistant	ADJ
ahs-8094	279	20	(	(	PUNCT
ahs-8094	279	21	mr	mr	PROPN
ahs-8094	279	22	)	)	PUNCT
ahs-8094	279	23	and	and	CCONJ
ahs-8094	279	24	7­8	7­8	NUM
ahs-8094	279	25	=	=	PUNCT
ahs-8094	279	26	susceptible	susceptible	ADJ
ahs-8094	279	27	(	(	PUNCT
ahs-8094	279	28	s	s	NOUN
ahs-8094	279	29	)	)	PUNCT
ahs-8094	279	30	.	.	PUNCT
ahs-8094	280	1	n	n	NOUN
ahs-8094	280	2	=	=	SYM
ahs-8094	280	3	16	16	NUM
ahs-8094	280	4	replicated	replicate	VERB
ahs-8094	280	5	three	three	NUM
ahs-8094	280	6	times	time	NOUN
ahs-8094	280	7	.	.	PUNCT
ahs-8094	281	1	dpi=	dpi=	ADJ
ahs-8094	281	2	days	day	NOUN
ahs-8094	281	3	post­inoculations	post­inoculation	NOUN
ahs-8094	281	4	.	.	PUNCT
ahs-8094	282	1	genotype	genotype	NOUN
ahs-8094	282	2	incidence	incidence	NOUN
ahs-8094	282	3	(	(	PUNCT
ahs-8094	282	4	%	%	INTJ
ahs-8094	282	5	)	)	PUNCT
ahs-8094	282	6	severity	severity	NOUN
ahs-8094	282	7	indices	index	NOUN
ahs-8094	282	8	cumulative	cumulative	ADJ
ahs-8094	282	9	rating	rating	NOUN
ahs-8094	282	10	host	host	NOUN
ahs-8094	282	11	reaction13dpi	reaction13dpi	PROPN
ahs-8094	282	12	15dpi	15dpi	PROPN
ahs-8094	282	13	17dpi	17dpi	PROPN
ahs-8094	282	14	19dpi	19dpi	NOUN
ahs-8094	282	15	rating	rating	NOUN
ahs-8094	282	16	13dpi	13dpi	NOUN
ahs-8094	282	17	15dpi	15dpi	NUM
ahs-8094	282	18	17dpi	17dpi	PROPN
ahs-8094	282	19	19dpi	19dpi	NOUN
ahs-8094	282	20	rating	rating	NOUN
ahs-8094	282	21	00765ppr	00765ppr	NOUN
ahs-8094	282	22	0.0	0.0	NUM
ahs-8094	282	23	d	d	NOUN
ahs-8094	282	24	0.0	0.0	NUM
ahs-8094	282	25	d	d	SYM
ahs-8094	282	26	60.4	60.4	NUM
ahs-8094	282	27	bc	bc	PROPN
ahs-8094	283	1	77.1	77.1	NUM
ahs-8094	283	2	b	b	NOUN
ahs-8094	283	3	4	4	NUM
ahs-8094	283	4	1.0	1.0	NUM
ahs-8094	283	5	c	c	NOUN
ahs-8094	283	6	1.0	1.0	NUM
ahs-8094	283	7	d	d	SYM
ahs-8094	283	8	1.8	1.8	NUM
ahs-8094	283	9	d	d	NUM
ahs-8094	283	10	2.7	2.7	NUM
ahs-8094	283	11	c	c	NOUN
ahs-8094	283	12	3	3	NUM
ahs-8094	283	13	7	7	NUM
ahs-8094	283	14	s	s	NOUN
ahs-8094	283	15	00767ppr	00767ppr	NOUN
ahs-8094	283	16	0.0	0.0	NUM
ahs-8094	283	17	d	d	NOUN
ahs-8094	283	18	0.0	0.0	NUM
ahs-8094	283	19	d	d	NOUN
ahs-8094	283	20	0.0	0.0	NUM
ahs-8094	283	21	g	g	PROPN
ahs-8094	283	22	2.1	2.1	NUM
ahs-8094	283	23	h	h	NOUN
ahs-8094	283	24	1	1	NUM
ahs-8094	283	25	1.0	1.0	NUM
ahs-8094	283	26	c	c	NOUN
ahs-8094	283	27	1.0	1.0	NUM
ahs-8094	283	28	d	d	SYM
ahs-8094	283	29	1.0	1.0	NUM
ahs-8094	283	30	e	e	NOUN
ahs-8094	283	31	1.0	1.0	NUM
ahs-8094	283	32	f	f	NOUN
ahs-8094	283	33	1	1	NUM
ahs-8094	283	34	2	2	NUM
ahs-8094	283	35	r	r	NOUN
ahs-8094	283	36	00774ppr	00774ppr	NOUN
ahs-8094	283	37	10.4	10.4	NUM
ahs-8094	283	38	cd	cd	PROPN
ahs-8094	283	39	41.7	41.7	NUM
ahs-8094	283	40	c	c	PROPN
ahs-8094	283	41	41.7	41.7	NUM
ahs-8094	283	42	cd	cd	NOUN
ahs-8094	283	43	50.0	50.0	NUM
ahs-8094	283	44	de	de	PROPN
ahs-8094	283	45	3	3	NUM
ahs-8094	283	46	1.1	1.1	NUM
ahs-8094	283	47	c	c	NOUN
ahs-8094	283	48	1.4	1.4	NUM
ahs-8094	283	49	cd	cd	NOUN
ahs-8094	283	50	2.1	2.1	NUM
ahs-8094	283	51	d	d	NOUN
ahs-8094	283	52	3.1	3.1	NUM
ahs-8094	283	53	c	c	NOUN
ahs-8094	283	54	4	4	NUM
ahs-8094	283	55	7	7	NUM
ahs-8094	283	56	s	s	NOUN
ahs-8094	283	57	00786ppr	00786ppr	NOUN
ahs-8094	283	58	4.2	4.2	NUM
ahs-8094	283	59	cd	cd	NOUN
ahs-8094	283	60	8.3	8.3	NUM
ahs-8094	283	61	d	d	SYM
ahs-8094	283	62	22.9	22.9	NUM
ahs-8094	283	63	def	def	VERB
ahs-8094	283	64	25	25	NUM
ahs-8094	283	65	fg	fg	PROPN
ahs-8094	283	66	2	2	NUM
ahs-8094	283	67	1.1	1.1	NUM
ahs-8094	283	68	c	c	NOUN
ahs-8094	283	69	1.1	1.1	NUM
ahs-8094	283	70	cd	cd	NOUN
ahs-8094	283	71	1.3	1.3	NUM
ahs-8094	283	72	e	e	NOUN
ahs-8094	283	73	1.4	1.4	NUM
ahs-8094	283	74	ef	ef	PROPN
ahs-8094	283	75	2	2	NUM
ahs-8094	283	76	4	4	NUM
ahs-8094	283	77	mr	mr	PROPN
ahs-8094	283	78	00792ppr	00792ppr	NUM
ahs-8094	283	79	75.0	75.0	NUM
ahs-8094	283	80	b	b	NOUN
ahs-8094	283	81	75	75	NUM
ahs-8094	283	82	bc	bc	PROPN
ahs-8094	283	83	75.0	75.0	NUM
ahs-8094	283	84	ab	ab	PROPN
ahs-8094	283	85	75	75	NUM
ahs-8094	283	86	b	b	NOUN
ahs-8094	283	87	4	4	NUM
ahs-8094	283	88	2.3	2.3	NUM
ahs-8094	283	89	ab	ab	PROPN
ahs-8094	283	90	2.8	2.8	NUM
ahs-8094	283	91	b	b	PROPN
ahs-8094	283	92	3.2	3.2	NUM
ahs-8094	283	93	bc	bc	PROPN
ahs-8094	283	94	4.0	4.0	NUM
ahs-8094	283	95	b	b	SYM
ahs-8094	283	96	4	4	NUM
ahs-8094	283	97	8	8	NUM
ahs-8094	283	98	s	s	NOUN
ahs-8094	283	99	00802ppr	00802ppr	NOUN
ahs-8094	283	100	0.0	0.0	NUM
ahs-8094	283	101	d	d	NOUN
ahs-8094	283	102	0.0	0.0	NUM
ahs-8094	283	103	d	d	NOUN
ahs-8094	283	104	0.0	0.0	NUM
ahs-8094	283	105	g	g	NOUN
ahs-8094	283	106	18.8	18.8	NUM
ahs-8094	283	107	fgh	fgh	NOUN
ahs-8094	283	108	1	1	NUM
ahs-8094	283	109	1.0	1.0	NUM
ahs-8094	283	110	c	c	NOUN
ahs-8094	283	111	1.0	1.0	NUM
ahs-8094	283	112	d	d	SYM
ahs-8094	283	113	1.0	1.0	NUM
ahs-8094	283	114	e	e	NOUN
ahs-8094	283	115	1.2	1.2	NUM
ahs-8094	283	116	f	f	NOUN
ahs-8094	283	117	2	2	NUM
ahs-8094	283	118	3	3	NUM
ahs-8094	283	119	r	r	NOUN
ahs-8094	283	120	00795ppr	00795ppr	NOUN
ahs-8094	283	121	75.0	75.0	NUM
ahs-8094	283	122	b	b	NOUN
ahs-8094	283	123	75.0	75.0	NUM
ahs-8094	283	124	b	b	SYM
ahs-8094	283	125	81.3	81.3	NUM
ahs-8094	283	126	ab	ab	PROPN
ahs-8094	283	127	100.0	100.0	NUM
ahs-8094	283	128	a	a	DET
ahs-8094	283	129	4	4	NUM
ahs-8094	283	130	2	2	NUM
ahs-8094	283	131	b	b	NOUN
ahs-8094	283	132	2.7	2.7	NUM
ahs-8094	283	133	b	b	SYM
ahs-8094	283	134	3.7	3.7	NUM
ahs-8094	283	135	ab	ab	PROPN
ahs-8094	283	136	5.0	5.0	NUM
ahs-8094	283	137	a	a	DET
ahs-8094	283	138	4	4	NUM
ahs-8094	283	139	8	8	NUM
ahs-8094	283	140	s	s	NOUN
ahs-8094	283	141	pbc	pbc	PROPN
ahs-8094	283	142	462	462	NUM
ahs-8094	283	143	0.0	0.0	NUM
ahs-8094	283	144	d	d	NOUN
ahs-8094	283	145	0.0	0.0	NUM
ahs-8094	283	146	d	d	SYM
ahs-8094	283	147	4.2	4.2	NUM
ahs-8094	283	148	efg	efg	PROPN
ahs-8094	283	149	12.5	12.5	NUM
ahs-8094	283	150	gh	gh	PROPN
ahs-8094	283	151	1	1	NUM
ahs-8094	283	152	1.0	1.0	NUM
ahs-8094	283	153	c	c	NOUN
ahs-8094	283	154	1.0	1.0	NUM
ahs-8094	283	155	d	d	SYM
ahs-8094	283	156	1.0	1.0	NUM
ahs-8094	283	157	e	e	NOUN
ahs-8094	283	158	1.2	1.2	NUM
ahs-8094	283	159	f	f	NOUN
ahs-8094	283	160	2	2	NUM
ahs-8094	283	161	3	3	NUM
ahs-8094	283	162	r	r	NOUN
ahs-8094	283	163	pp9950­5197	pp9950­5197	NOUN
ahs-8094	283	164	0.0	0.0	NUM
ahs-8094	283	165	d	d	NOUN
ahs-8094	283	166	0.0	0.0	NUM
ahs-8094	283	167	d	d	SYM
ahs-8094	283	168	8.3	8.3	NUM
ahs-8094	283	169	efg	efg	NOUN
ahs-8094	283	170	22.9	22.9	NUM
ahs-8094	283	171	fg	fg	PROPN
ahs-8094	283	172	2	2	NUM
ahs-8094	283	173	1.0	1.0	NUM
ahs-8094	283	174	c	c	NOUN
ahs-8094	283	175	1.0	1.0	NUM
ahs-8094	283	176	d	d	SYM
ahs-8094	283	177	1.0	1.0	NUM
ahs-8094	283	178	e	e	NOUN
ahs-8094	283	179	1.3	1.3	NUM
ahs-8094	283	180	f	f	NOUN
ahs-8094	283	181	2	2	NUM
ahs-8094	283	182	4	4	NUM
ahs-8094	283	183	mr	mr	PROPN
ahs-8094	283	184	hp	hp	PROPN
ahs-8094	283	185	0117	0117	NUM
ahs-8094	283	186	0.0	0.0	NUM
ahs-8094	283	187	d	d	NOUN
ahs-8094	283	188	0.0	0.0	NUM
ahs-8094	283	189	d	d	SYM
ahs-8094	283	190	2.1	2.1	NUM
ahs-8094	283	191	fg	fg	PROPN
ahs-8094	283	192	35.4	35.4	NUM
ahs-8094	283	193	ef	ef	PROPN
ahs-8094	283	194	3	3	NUM
ahs-8094	283	195	1.0	1.0	NUM
ahs-8094	283	196	c	c	NOUN
ahs-8094	283	197	1.0	1.0	NUM
ahs-8094	283	198	d	d	SYM
ahs-8094	283	199	1.0	1.0	NUM
ahs-8094	283	200	e	e	NOUN
ahs-8094	283	201	1.5	1.5	NUM
ahs-8094	283	202	def	def	ADJ
ahs-8094	283	203	2	2	NUM
ahs-8094	283	204	5	5	NUM
ahs-8094	283	205	mr	mr	PROPN
ahs-8094	283	206	pp9852­170	pp9852­170	PROPN
ahs-8094	283	207	0.0	0.0	NUM
ahs-8094	283	208	d	d	NOUN
ahs-8094	283	209	0.0	0.0	NUM
ahs-8094	283	210	d	d	SYM
ahs-8094	283	211	2.1	2.1	NUM
ahs-8094	283	212	fg	fg	PROPN
ahs-8094	283	213	14.6	14.6	NUM
ahs-8094	283	214	gh	gh	PROPN
ahs-8094	283	215	1	1	NUM
ahs-8094	283	216	1.0	1.0	NUM
ahs-8094	283	217	c	c	NOUN
ahs-8094	283	218	1.0	1.0	NUM
ahs-8094	283	219	d	d	SYM
ahs-8094	283	220	1.0	1.0	NUM
ahs-8094	283	221	e	e	NOUN
ahs-8094	283	222	1.2	1.2	NUM
ahs-8094	283	223	f	f	NOUN
ahs-8094	283	224	2	2	NUM
ahs-8094	283	225	3	3	NUM
ahs-8094	283	226	r	r	NOUN
ahs-8094	283	227	icpn	icpn	NOUN
ahs-8094	283	228	18­7	18­7	NUM
ahs-8094	283	229	0.0	0.0	NUM
ahs-8094	283	230	d	d	NOUN
ahs-8094	283	231	0.0	0.0	NUM
ahs-8094	283	232	d	d	SYM
ahs-8094	283	233	25.0	25.0	NUM
ahs-8094	283	234	de	de	SYM
ahs-8094	283	235	56.3	56.3	NUM
ahs-8094	283	236	cd	cd	NOUN
ahs-8094	283	237	4	4	NUM
ahs-8094	283	238	1.0	1.0	NUM
ahs-8094	283	239	c	c	NOUN
ahs-8094	283	240	1.0	1.0	NUM
ahs-8094	283	241	d	d	SYM
ahs-8094	283	242	1.0	1.0	NUM
ahs-8094	283	243	e	e	NOUN
ahs-8094	283	244	2.0	2.0	NUM
ahs-8094	283	245	de	de	SYM
ahs-8094	283	246	2	2	NUM
ahs-8094	283	247	6	6	NUM
ahs-8094	283	248	mr	mr	PROPN
ahs-8094	283	249	long	long	ADJ
ahs-8094	283	250	red	red	ADJ
ahs-8094	283	251	cayenne	cayenne	NOUN
ahs-8094	283	252	16.7	16.7	NUM
ahs-8094	283	253	c	c	PROPN
ahs-8094	283	254	29.2	29.2	NUM
ahs-8094	283	255	c	c	NOUN
ahs-8094	283	256	89.6	89.6	NUM
ahs-8094	283	257	a	a	DET
ahs-8094	283	258	97.9	97.9	NUM
ahs-8094	283	259	a	a	DET
ahs-8094	283	260	4	4	NUM
ahs-8094	283	261	1.2	1.2	NUM
ahs-8094	283	262	c	c	NOUN
ahs-8094	283	263	1.5	1.5	NUM
ahs-8094	283	264	c	c	NOUN
ahs-8094	283	265	2.7	2.7	NUM
ahs-8094	283	266	c	c	NOUN
ahs-8094	283	267	4.5	4.5	NUM
ahs-8094	283	268	ab	ab	PROPN
ahs-8094	283	269	4	4	NUM
ahs-8094	283	270	8	8	NUM
ahs-8094	283	271	s	s	NOUN
ahs-8094	283	272	red	red	ADJ
ahs-8094	283	273	scotch	scotch	NOUN
ahs-8094	283	274	bonnet	bonnet	NOUN
ahs-8094	283	275	91.7	91.7	NUM
ahs-8094	283	276	a	a	DET
ahs-8094	283	277	93.8	93.8	NUM
ahs-8094	283	278	a	a	DET
ahs-8094	283	279	93.8	93.8	NUM
ahs-8094	283	280	a	a	DET
ahs-8094	283	281	100.0	100.0	NUM
ahs-8094	283	282	a	a	DET
ahs-8094	283	283	4	4	NUM
ahs-8094	283	284	2.4	2.4	NUM
ahs-8094	283	285	a	a	DET
ahs-8094	283	286	3.3	3.3	NUM
ahs-8094	283	287	a	a	DET
ahs-8094	283	288	4.1	4.1	NUM
ahs-8094	283	289	a	a	DET
ahs-8094	283	290	4.8	4.8	NUM
ahs-8094	283	291	a	a	DET
ahs-8094	283	292	4	4	NUM
ahs-8094	283	293	8	8	NUM
ahs-8094	283	294	s	s	NOUN
ahs-8094	283	295	lsd	lsd	NOUN
ahs-8094	283	296	(	(	PUNCT
ahs-8094	283	297	0.05	0.05	NUM
ahs-8094	283	298	)	)	PUNCT
ahs-8094	283	299	12.6	12.6	NUM
ahs-8094	283	300	15.3	15.3	NUM
ahs-8094	283	301	21.4	21.4	NUM
ahs-8094	283	302	19.8	19.8	NUM
ahs-8094	283	303	0.3	0.3	NUM
ahs-8094	283	304	0.5	0.5	NUM
ahs-8094	283	305	0.6	0.6	NUM
ahs-8094	283	306	0.7	0.7	NUM
ahs-8094	283	307	p	p	NOUN
ahs-8094	283	308	value	value	NOUN
ahs-8094	283	309	<	<	X
ahs-8094	283	310	.0001	.0001	X
ahs-8094	283	311	<	<	X
ahs-8094	283	312	.0001	.0001	X
ahs-8094	283	313	<	<	X
ahs-8094	283	314	.0001	.0001	X
ahs-8094	283	315	<	<	X
ahs-8094	283	316	.0001	.0001	X
ahs-8094	283	317	<	<	X
ahs-8094	283	318	.0001	.0001	X
ahs-8094	283	319	<	<	X
ahs-8094	283	320	.0001	.0001	X
ahs-8094	283	321	<	<	X
ahs-8094	283	322	.0001	.0001	X
ahs-8094	283	323	<	<	X
ahs-8094	283	324	.0001	.0001	X
ahs-8094	283	325	fig	fig	NOUN
ahs-8094	283	326	.	.	PUNCT
ahs-8094	284	1	3	3	NUM
ahs-8094	284	2	­	­	NOUN
ahs-8094	284	3	symptoms	symptom	NOUN
ahs-8094	284	4	of	of	ADP
ahs-8094	284	5	cucumber	cucumber	PROPN
ahs-8094	284	6	mosaic	mosaic	PROPN
ahs-8094	284	7	virus	virus	NOUN
ahs-8094	284	8	on	on	ADP
ahs-8094	284	9	different	different	ADJ
ahs-8094	284	10	hot	hot	ADJ
ahs-8094	284	11	pepper	pepper	NOUN
ahs-8094	284	12	genotypes	genotype	NOUN
ahs-8094	284	13	.	.	PUNCT
ahs-8094	285	1	(	(	PUNCT
ahs-8094	285	2	a	a	X
ahs-8094	285	3	)	)	PUNCT
ahs-8094	285	4	leaf	leaf	NOUN
ahs-8094	285	5	mosaic	mosaic	NOUN
ahs-8094	285	6	,	,	PUNCT
ahs-8094	285	7	crinkling	crinkling	NOUN
ahs-8094	285	8	and	and	CCONJ
ahs-8094	285	9	distortion	distortion	NOUN
ahs-8094	285	10	in	in	ADP
ahs-8094	285	11	commercial	commercial	ADJ
ahs-8094	285	12	genotype	genotype	NOUN
ahs-8094	285	13	scotch	scotch	NOUN
ahs-8094	285	14	bonnet	bonnet	NOUN
ahs-8094	285	15	,	,	PUNCT
ahs-8094	285	16	(	(	PUNCT
ahs-8094	285	17	b	b	NOUN
ahs-8094	285	18	)	)	PUNCT
ahs-8094	285	19	mottling	mottling	NOUN
ahs-8094	285	20	in	in	ADP
ahs-8094	285	21	local	local	ADJ
ahs-8094	285	22	genotype	genotype	NOUN
ahs-8094	285	23	00774ppr	00774ppr	NOUN
ahs-8094	285	24	,	,	PUNCT
ahs-8094	285	25	(	(	PUNCT
ahs-8094	285	26	c	c	NOUN
ahs-8094	285	27	)	)	PUNCT
ahs-8094	285	28	leaf	leaf	NOUN
ahs-8094	285	29	distortion	distortion	NOUN
ahs-8094	285	30	and	and	CCONJ
ahs-8094	285	31	stunting	stunt	VERB
ahs-8094	285	32	in	in	ADP
ahs-8094	285	33	local	local	ADJ
ahs-8094	285	34	genotype	genotype	NOUN
ahs-8094	285	35	00795ppr	00795ppr	NOUN
ahs-8094	285	36	,	,	PUNCT
ahs-8094	285	37	(	(	PUNCT
ahs-8094	285	38	d	d	NOUN
ahs-8094	285	39	)	)	PUNCT
ahs-8094	285	40	leaf	leaf	NOUN
ahs-8094	285	41	mosaic	mosaic	NOUN
ahs-8094	285	42	in	in	ADP
ahs-8094	285	43	introduced	introduce	VERB
ahs-8094	285	44	genotype	genotype	NOUN
ahs-8094	285	45	icpn18­7	icpn18­7	NOUN
ahs-8094	285	46	.	.	PUNCT
ahs-8094	286	1	adv	adv	PROPN
ahs-8094	286	2	.	.	PUNCT
ahs-8094	287	1	hort	hort	PROPN
ahs-8094	287	2	.	.	PUNCT
ahs-8094	288	1	sci	sci	PROPN
ahs-8094	288	2	.	.	PROPN
ahs-8094	288	3	,	,	PUNCT
ahs-8094	288	4	2020	2020	NUM
ahs-8094	288	5	34(4	34(4	NUM
ahs-8094	288	6	):	):	PUNCT
ahs-8094	288	7	397­412	397­412	NUM
ahs-8094	288	8	408	408	NUM
ahs-8094	288	9	4	4	NUM
ahs-8094	288	10	.	.	PUNCT
ahs-8094	288	11	discussion	discussion	NOUN
ahs-8094	288	12	and	and	CCONJ
ahs-8094	288	13	conclusions	conclusion	NOUN
ahs-8094	288	14	host	host	NOUN
ahs-8094	288	15	plant	plant	NOUN
ahs-8094	288	16	resistance	resistance	NOUN
ahs-8094	288	17	is	be	AUX
ahs-8094	288	18	an	an	DET
ahs-8094	288	19	important	important	ADJ
ahs-8094	288	20	factor	factor	NOUN
ahs-8094	288	21	in	in	ADP
ahs-8094	288	22	the	the	DET
ahs-8094	288	23	integrated	integrate	VERB
ahs-8094	288	24	management	management	NOUN
ahs-8094	288	25	of	of	ADP
ahs-8094	288	26	pests	pest	NOUN
ahs-8094	288	27	.	.	PUNCT
ahs-8094	289	1	the	the	DET
ahs-8094	289	2	present	present	ADJ
ahs-8094	289	3	study	study	NOUN
ahs-8094	289	4	was	be	AUX
ahs-8094	289	5	undertaken	undertake	VERB
ahs-8094	289	6	to	to	PART
ahs-8094	289	7	identify	identify	VERB
ahs-8094	289	8	genotypes	genotype	NOUN
ahs-8094	289	9	that	that	PRON
ahs-8094	289	10	can	can	AUX
ahs-8094	289	11	be	be	AUX
ahs-8094	289	12	used	use	VERB
ahs-8094	289	13	in	in	ADP
ahs-8094	289	14	production	production	NOUN
ahs-8094	289	15	or	or	CCONJ
ahs-8094	289	16	as	as	ADP
ahs-8094	289	17	sources	source	NOUN
ahs-8094	289	18	of	of	ADP
ahs-8094	289	19	resistance	resistance	NOUN
ahs-8094	289	20	to	to	ADP
ahs-8094	289	21	viruses	virus	NOUN
ahs-8094	289	22	and	and	CCONJ
ahs-8094	289	23	aphids	aphid	NOUN
ahs-8094	289	24	in	in	ADP
ahs-8094	289	25	hot	hot	ADJ
ahs-8094	289	26	pepper	pepper	NOUN
ahs-8094	289	27	breeding	breeding	NOUN
ahs-8094	289	28	programs	program	NOUN
ahs-8094	289	29	.	.	PUNCT
ahs-8094	290	1	all	all	DET
ahs-8094	290	2	the	the	DET
ahs-8094	290	3	genotypes	genotype	NOUN
ahs-8094	290	4	tested	test	VERB
ahs-8094	290	5	in	in	ADP
ahs-8094	290	6	this	this	DET
ahs-8094	290	7	study	study	NOUN
ahs-8094	290	8	were	be	AUX
ahs-8094	290	9	infected	infect	VERB
ahs-8094	290	10	by	by	ADP
ahs-8094	290	11	the	the	DET
ahs-8094	290	12	viruses	virus	NOUN
ahs-8094	290	13	observed	observe	VERB
ahs-8094	290	14	either	either	CCONJ
ahs-8094	290	15	in	in	ADP
ahs-8094	290	16	the	the	DET
ahs-8094	290	17	field	field	NOUN
ahs-8094	290	18	or	or	CCONJ
ahs-8094	290	19	screen­	screen­	NOUN
ahs-8094	290	20	house	house	NOUN
ahs-8094	290	21	however	however	ADV
ahs-8094	290	22	,	,	PUNCT
ahs-8094	290	23	there	there	PRON
ahs-8094	290	24	were	be	VERB
ahs-8094	290	25	some	some	DET
ahs-8094	290	26	resistant	resistant	ADJ
ahs-8094	290	27	geno­	geno­	NOUN
ahs-8094	290	28	types	type	NOUN
ahs-8094	290	29	found	find	VERB
ahs-8094	290	30	based	base	VERB
ahs-8094	290	31	on	on	ADP
ahs-8094	290	32	incidence	incidence	NOUN
ahs-8094	290	33	and	and	CCONJ
ahs-8094	290	34	symptoms	symptom	NOUN
ahs-8094	290	35	sever­	sever­	VERB
ahs-8094	290	36	ity	ity	PROPN
ahs-8094	290	37	of	of	ADP
ahs-8094	290	38	the	the	DET
ahs-8094	290	39	viral	viral	ADJ
ahs-8094	290	40	diseases	disease	NOUN
ahs-8094	290	41	.	.	PUNCT
ahs-8094	291	1	in	in	ADP
ahs-8094	291	2	the	the	DET
ahs-8094	291	3	field	field	NOUN
ahs-8094	291	4	,	,	PUNCT
ahs-8094	291	5	five	five	NUM
ahs-8094	291	6	genotypes	genotype	NOUN
ahs-8094	291	7	00802ppr	00802ppr	NOUN
ahs-8094	291	8	,	,	PUNCT
ahs-8094	291	9	c.	c.	PROPN
ahs-8094	291	10	bacca‐	bacca‐	PROPN
ahs-8094	291	11	tum	tum	PROPN
ahs-8094	291	12	00767ppr	00767ppr	NOUN
ahs-8094	291	13	,	,	PUNCT
ahs-8094	291	14	c.	c.	PROPN
ahs-8094	291	15	annuum	annuum	PROPN
ahs-8094	291	16	pbc	pbc	PROPN
ahs-8094	291	17	462	462	NUM
ahs-8094	291	18	,	,	PUNCT
ahs-8094	291	19	pp9950­5197	pp9950­5197	PROPN
ahs-8094	291	20	and	and	CCONJ
ahs-8094	291	21	icpn	icpn	PROPN
ahs-8094	291	22	18­7	18­7	NUM
ahs-8094	291	23	were	be	AUX
ahs-8094	291	24	resistant	resistant	ADJ
ahs-8094	291	25	to	to	ADP
ahs-8094	291	26	the	the	DET
ahs-8094	291	27	viral	viral	ADJ
ahs-8094	291	28	diseases	disease	NOUN
ahs-8094	291	29	while	while	SCONJ
ahs-8094	291	30	c.	c.	PROPN
ahs-8094	291	31	annuum	annuum	PROPN
ahs-8094	291	32	00765ppr	00765ppr	PROPN
ahs-8094	291	33	,	,	PUNCT
ahs-8094	291	34	hp	hp	ADJ
ahs-8094	291	35	0117	0117	NUM
ahs-8094	291	36	and	and	CCONJ
ahs-8094	291	37	pp9852­	pp9852­	NOUN
ahs-8094	291	38	170	170	NUM
ahs-8094	291	39	were	be	AUX
ahs-8094	291	40	moderately	moderately	ADV
ahs-8094	291	41	resistant	resistant	ADJ
ahs-8094	291	42	.	.	PUNCT
ahs-8094	292	1	the	the	DET
ahs-8094	292	2	rest	rest	NOUN
ahs-8094	292	3	of	of	ADP
ahs-8094	292	4	the	the	DET
ahs-8094	292	5	geno­	geno­	NOUN
ahs-8094	292	6	types	type	NOUN
ahs-8094	292	7	were	be	AUX
ahs-8094	292	8	susceptible	susceptible	ADJ
ahs-8094	292	9	to	to	ADP
ahs-8094	292	10	the	the	DET
ahs-8094	292	11	viral	viral	ADJ
ahs-8094	292	12	diseases	disease	NOUN
ahs-8094	292	13	.	.	PUNCT
ahs-8094	293	1	these	these	DET
ahs-8094	293	2	variations	variation	NOUN
ahs-8094	293	3	among	among	ADP
ahs-8094	293	4	the	the	DET
ahs-8094	293	5	genotypes	genotype	NOUN
ahs-8094	293	6	might	might	AUX
ahs-8094	293	7	be	be	AUX
ahs-8094	293	8	due	due	ADJ
ahs-8094	293	9	to	to	ADP
ahs-8094	293	10	vari­	vari­	X
ahs-8094	293	11	ous	ous	ADJ
ahs-8094	293	12	factors	factor	NOUN
ahs-8094	293	13	that	that	PRON
ahs-8094	293	14	include	include	VERB
ahs-8094	293	15	genetic	genetic	ADJ
ahs-8094	293	16	make­up	make­up	PROPN
ahs-8094	293	17	,	,	PUNCT
ahs-8094	293	18	the	the	DET
ahs-8094	293	19	strain	strain	NOUN
ahs-8094	293	20	of	of	ADP
ahs-8094	293	21	the	the	DET
ahs-8094	293	22	virus	virus	NOUN
ahs-8094	293	23	and	and	CCONJ
ahs-8094	293	24	their	their	PRON
ahs-8094	293	25	combinations	combination	NOUN
ahs-8094	293	26	,	,	PUNCT
ahs-8094	293	27	time	time	NOUN
ahs-8094	293	28	of	of	ADP
ahs-8094	293	29	infection	infection	NOUN
ahs-8094	293	30	and	and	CCONJ
ahs-8094	293	31	prevailing	prevailing	ADJ
ahs-8094	293	32	environmental	environmental	ADJ
ahs-8094	293	33	conditions	condition	NOUN
ahs-8094	293	34	(	(	PUNCT
ahs-8094	293	35	visalakshi	visalakshi	NOUN
ahs-8094	293	36	and	and	CCONJ
ahs-8094	293	37	pandiyan	pandiyan	NOUN
ahs-8094	293	38	,	,	PUNCT
ahs-8094	293	39	2018	2018	NUM
ahs-8094	293	40	)	)	PUNCT
ahs-8094	293	41	.	.	PUNCT
ahs-8094	294	1	such	such	ADJ
ahs-8094	294	2	variations	variation	NOUN
ahs-8094	294	3	reveal	reveal	VERB
ahs-8094	294	4	the	the	DET
ahs-8094	294	5	diversity	diversity	NOUN
ahs-8094	294	6	present	present	ADJ
ahs-8094	294	7	within	within	ADP
ahs-8094	294	8	the	the	DET
ahs-8094	294	9	genotypes	genotype	NOUN
ahs-8094	294	10	that	that	PRON
ahs-8094	294	11	needs	need	VERB
ahs-8094	294	12	to	to	PART
ahs-8094	294	13	be	be	AUX
ahs-8094	294	14	exploited	exploit	VERB
ahs-8094	294	15	.	.	PUNCT
ahs-8094	295	1	in	in	ADP
ahs-8094	295	2	previous	previous	ADJ
ahs-8094	295	3	studies	study	NOUN
ahs-8094	295	4	under	under	ADP
ahs-8094	295	5	field	field	NOUN
ahs-8094	295	6	condi­	condi­	PROPN
ahs-8094	295	7	tions	tion	NOUN
ahs-8094	295	8	,	,	PUNCT
ahs-8094	295	9	various	various	ADJ
ahs-8094	295	10	genotypes	genotype	NOUN
ahs-8094	295	11	from	from	ADP
ahs-8094	295	12	c.	c.	PROPN
ahs-8094	295	13	baccatum	baccatum	PROPN
ahs-8094	295	14	,	,	PUNCT
ahs-8094	295	15	c.	c.	PROPN
ahs-8094	295	16	annu‐	annu‐	PROPN
ahs-8094	295	17	um	um	INTJ
ahs-8094	295	18	and	and	CCONJ
ahs-8094	295	19	c.	c.	PROPN
ahs-8094	295	20	frutescens	frutescen	NOUN
ahs-8094	295	21	species	specie	NOUN
ahs-8094	295	22	have	have	AUX
ahs-8094	295	23	displayed	display	VERB
ahs-8094	295	24	variable	variable	ADJ
ahs-8094	295	25	resistance	resistance	NOUN
ahs-8094	295	26	to	to	ADP
ahs-8094	295	27	some	some	DET
ahs-8094	295	28	viruses	virus	NOUN
ahs-8094	295	29	such	such	ADJ
ahs-8094	295	30	as	as	ADP
ahs-8094	295	31	pvmv	pvmv	NOUN
ahs-8094	295	32	,	,	PUNCT
ahs-8094	295	33	tmv	tmv	NOUN
ahs-8094	295	34	,	,	PUNCT
ahs-8094	295	35	cmv	cmv	NOUN
ahs-8094	295	36	,	,	PUNCT
ahs-8094	295	37	pepper	pepper	NOUN
ahs-8094	295	38	mild	mild	ADJ
ahs-8094	295	39	mottle	mottle	NOUN
ahs-8094	295	40	virus	virus	NOUN
ahs-8094	295	41	,	,	PUNCT
ahs-8094	295	42	chili	chili	NOUN
ahs-8094	295	43	veinal	veinal	ADJ
ahs-8094	295	44	mottle	mottle	NOUN
ahs-8094	295	45	virus	virus	NOUN
ahs-8094	295	46	and	and	CCONJ
ahs-8094	295	47	leaf	leaf	NOUN
ahs-8094	295	48	curl	curl	NOUN
ahs-8094	295	49	virus	virus	NOUN
ahs-8094	295	50	(	(	PUNCT
ahs-8094	295	51	appiah	appiah	PROPN
ahs-8094	295	52	et	et	PROPN
ahs-8094	295	53	al	al	PROPN
ahs-8094	295	54	.	.	PROPN
ahs-8094	295	55	,	,	PUNCT
ahs-8094	295	56	2014	2014	NUM
ahs-8094	295	57	;	;	PUNCT
ahs-8094	295	58	rahman	rahman	PROPN
ahs-8094	295	59	et	et	PROPN
ahs-8094	295	60	al	al	PROPN
ahs-8094	295	61	.	.	PROPN
ahs-8094	295	62	,	,	PUNCT
ahs-8094	295	63	2016	2016	NUM
ahs-8094	295	64	;	;	PUNCT
ahs-8094	295	65	bandla	bandla	NOUN
ahs-8094	295	66	and	and	CCONJ
ahs-8094	295	67	beena	beena	NOUN
ahs-8094	295	68	,	,	PUNCT
ahs-8094	295	69	2018	2018	NUM
ahs-8094	295	70	;	;	PUNCT
ahs-8094	295	71	fajinmi	fajinmi	PROPN
ahs-8094	295	72	et	et	PROPN
ahs-8094	295	73	al	al	PROPN
ahs-8094	295	74	.	.	PROPN
ahs-8094	295	75	,	,	PUNCT
ahs-8094	295	76	2018	2018	NUM
ahs-8094	295	77	)	)	PUNCT
ahs-8094	295	78	.	.	PUNCT
ahs-8094	296	1	for	for	ADP
ahs-8094	296	2	instance	instance	NOUN
ahs-8094	296	3	,	,	PUNCT
ahs-8094	296	4	c.	c.	PROPN
ahs-8094	296	5	baccatum	baccatum	PROPN
ahs-8094	296	6	pi	pi	PROPN
ahs-8094	296	7	439381­1­3	439381­1­3	NUM
ahs-8094	296	8	was	be	AUX
ahs-8094	296	9	report­	report­	NOUN
ahs-8094	296	10	ed	ed	NOUN
ahs-8094	296	11	as	as	ADV
ahs-8094	296	12	resistant	resistant	ADJ
ahs-8094	296	13	to	to	ADP
ahs-8094	296	14	cmv	cmv	NOUN
ahs-8094	296	15	and	and	CCONJ
ahs-8094	296	16	pmmov	pmmov	VERB
ahs-8094	296	17	under	under	ADP
ahs-8094	296	18	field	field	NOUN
ahs-8094	296	19	con­	con­	NOUN
ahs-8094	296	20	ditions	dition	NOUN
ahs-8094	296	21	(	(	PUNCT
ahs-8094	296	22	suzuki	suzuki	PROPN
ahs-8094	296	23	et	et	PROPN
ahs-8094	296	24	al	al	PROPN
ahs-8094	296	25	.	.	PROPN
ahs-8094	296	26	,	,	PUNCT
ahs-8094	296	27	2003	2003	NUM
ahs-8094	296	28	)	)	PUNCT
ahs-8094	296	29	.	.	PUNCT
ahs-8094	297	1	our	our	PRON
ahs-8094	297	2	result	result	NOUN
ahs-8094	297	3	,	,	PUNCT
ahs-8094	297	4	reports	report	VERB
ahs-8094	297	5	some	some	DET
ahs-8094	297	6	additional	additional	ADJ
ahs-8094	297	7	sources	source	NOUN
ahs-8094	297	8	of	of	ADP
ahs-8094	297	9	resistance	resistance	NOUN
ahs-8094	297	10	from	from	ADP
ahs-8094	297	11	c.	c.	PROPN
ahs-8094	297	12	baccatum	baccatum	PROPN
ahs-8094	297	13	and	and	CCONJ
ahs-8094	297	14	c.	c.	PROPN
ahs-8094	297	15	annuum	annuum	PROPN
ahs-8094	297	16	species	specie	NOUN
ahs-8094	297	17	that	that	PRON
ahs-8094	297	18	could	could	AUX
ahs-8094	297	19	be	be	AUX
ahs-8094	297	20	valuable	valuable	ADJ
ahs-8094	297	21	in	in	ADP
ahs-8094	297	22	hot	hot	ADJ
ahs-8094	297	23	pepper	pepper	NOUN
ahs-8094	297	24	breeding	breeding	NOUN
ahs-8094	297	25	programs	program	NOUN
ahs-8094	297	26	as	as	ADV
ahs-8094	297	27	well	well	ADV
ahs-8094	297	28	as	as	ADP
ahs-8094	297	29	cultivation	cultivation	NOUN
ahs-8094	297	30	if	if	SCONJ
ahs-8094	297	31	preferred	prefer	VERB
ahs-8094	297	32	by	by	ADP
ahs-8094	297	33	farmers	farmer	NOUN
ahs-8094	297	34	.	.	PUNCT
ahs-8094	298	1	the	the	DET
ahs-8094	298	2	cmv	cmv	NOUN
ahs-8094	298	3	,	,	PUNCT
ahs-8094	298	4	pvmv	pvmv	NOUN
ahs-8094	298	5	and	and	CCONJ
ahs-8094	298	6	pevyv	pevyv	NOUN
ahs-8094	298	7	were	be	AUX
ahs-8094	298	8	detected	detect	VERB
ahs-8094	298	9	in	in	ADP
ahs-8094	298	10	leaf	leaf	NOUN
ahs-8094	298	11	samples	sample	NOUN
ahs-8094	298	12	collected	collect	VERB
ahs-8094	298	13	from	from	ADP
ahs-8094	298	14	fields	field	NOUN
ahs-8094	298	15	and	and	CCONJ
ahs-8094	298	16	cmv	cmv	NOUN
ahs-8094	298	17	was	be	AUX
ahs-8094	298	18	the	the	DET
ahs-8094	298	19	most	most	ADV
ahs-8094	298	20	abundant	abundant	ADJ
ahs-8094	298	21	.	.	PUNCT
ahs-8094	299	1	these	these	DET
ahs-8094	299	2	three	three	NUM
ahs-8094	299	3	viruses	virus	NOUN
ahs-8094	299	4	have	have	AUX
ahs-8094	299	5	also	also	ADV
ahs-8094	299	6	been	be	AUX
ahs-8094	299	7	report­	report­	PROPN
ahs-8094	299	8	ed	ed	NOUN
ahs-8094	299	9	to	to	PART
ahs-8094	299	10	infect	infect	VERB
ahs-8094	299	11	pepper	pepper	NOUN
ahs-8094	299	12	previously	previously	ADV
ahs-8094	299	13	in	in	ADP
ahs-8094	299	14	rwanda	rwanda	PROPN
ahs-8094	299	15	(	(	PUNCT
ahs-8094	299	16	skelton	skelton	PROPN
ahs-8094	299	17	et	et	PROPN
ahs-8094	299	18	al	al	PROPN
ahs-8094	299	19	.	.	PROPN
ahs-8094	299	20	,	,	PUNCT
ahs-8094	299	21	2018	2018	NUM
ahs-8094	299	22	)	)	PUNCT
ahs-8094	299	23	.	.	PUNCT
ahs-8094	300	1	the	the	DET
ahs-8094	300	2	high	high	ADJ
ahs-8094	300	3	incidence	incidence	NOUN
ahs-8094	300	4	of	of	ADP
ahs-8094	300	5	cmv	cmv	NOUN
ahs-8094	300	6	in	in	ADP
ahs-8094	300	7	the	the	DET
ahs-8094	300	8	field	field	NOUN
ahs-8094	300	9	could	could	AUX
ahs-8094	300	10	be	be	AUX
ahs-8094	300	11	attributed	attribute	VERB
ahs-8094	300	12	to	to	ADP
ahs-8094	300	13	several	several	ADJ
ahs-8094	300	14	factors	factor	NOUN
ahs-8094	300	15	including	include	VERB
ahs-8094	300	16	wide	wide	ADJ
ahs-8094	300	17	host	host	NOUN
ahs-8094	300	18	range	range	NOUN
ahs-8094	300	19	,	,	PUNCT
ahs-8094	300	20	climatic	climatic	ADJ
ahs-8094	300	21	conditions	condition	NOUN
ahs-8094	300	22	and	and	CCONJ
ahs-8094	300	23	efficiency	efficiency	NOUN
ahs-8094	300	24	of	of	ADP
ahs-8094	300	25	vec­	vec­	NOUN
ahs-8094	300	26	tor	tor	NOUN
ahs-8094	300	27	transmission	transmission	NOUN
ahs-8094	300	28	as	as	SCONJ
ahs-8094	300	29	reported	report	VERB
ahs-8094	300	30	by	by	ADP
ahs-8094	300	31	shah	shah	PROPN
ahs-8094	300	32	et	et	PROPN
ahs-8094	300	33	al	al	PROPN
ahs-8094	300	34	.	.	PROPN
ahs-8094	301	1	(	(	PUNCT
ahs-8094	301	2	2009	2009	NUM
ahs-8094	301	3	)	)	PUNCT
ahs-8094	301	4	.	.	PUNCT
ahs-8094	302	1	appiah	appiah	PROPN
ahs-8094	302	2	et	et	PROPN
ahs-8094	302	3	al	al	PROPN
ahs-8094	302	4	.	.	PROPN
ahs-8094	302	5	(	(	PUNCT
ahs-8094	302	6	2014	2014	NUM
ahs-8094	302	7	)	)	PUNCT
ahs-8094	302	8	in	in	ADP
ahs-8094	302	9	their	their	PRON
ahs-8094	302	10	study	study	NOUN
ahs-8094	302	11	also	also	ADV
ahs-8094	302	12	observed	observe	VERB
ahs-8094	302	13	a	a	DET
ahs-8094	302	14	high	high	ADJ
ahs-8094	302	15	incidence	incidence	NOUN
ahs-8094	302	16	of	of	ADP
ahs-8094	302	17	cmv	cmv	NOUN
ahs-8094	302	18	in	in	ADP
ahs-8094	302	19	the	the	DET
ahs-8094	302	20	range	range	NOUN
ahs-8094	302	21	of	of	ADP
ahs-8094	302	22	75	75	NUM
ahs-8094	302	23	%	%	NOUN
ahs-8094	302	24	to	to	ADP
ahs-8094	302	25	83.3	83.3	NUM
ahs-8094	302	26	%	%	NOUN
ahs-8094	302	27	on	on	ADP
ahs-8094	302	28	pepper	pepper	NOUN
ahs-8094	302	29	cultivars	cultivar	NOUN
ahs-8094	302	30	.	.	PUNCT
ahs-8094	303	1	all	all	DET
ahs-8094	303	2	genotypes	genotype	NOUN
ahs-8094	303	3	evaluated	evaluate	VERB
ahs-8094	303	4	were	be	AUX
ahs-8094	303	5	infected	infect	VERB
ahs-8094	303	6	with	with	ADP
ahs-8094	303	7	cmv	cmv	NOUN
ahs-8094	303	8	and	and	CCONJ
ahs-8094	303	9	almost	almost	ADV
ahs-8094	303	10	half	half	NOUN
ahs-8094	303	11	of	of	ADP
ahs-8094	303	12	them	they	PRON
ahs-8094	303	13	showed	show	VERB
ahs-8094	303	14	multiple	multiple	ADJ
ahs-8094	303	15	(	(	PUNCT
ahs-8094	303	16	double	double	ADJ
ahs-8094	303	17	or	or	CCONJ
ahs-8094	303	18	triple	triple	ADJ
ahs-8094	303	19	)	)	PUNCT
ahs-8094	303	20	infections	infection	NOUN
ahs-8094	303	21	of	of	ADP
ahs-8094	303	22	cmv	cmv	NOUN
ahs-8094	303	23	with	with	ADP
ahs-8094	303	24	either	either	DET
ahs-8094	303	25	pvmv	pvmv	NOUN
ahs-8094	303	26	or	or	CCONJ
ahs-8094	303	27	pevyv	pevyv	NOUN
ahs-8094	303	28	or	or	CCONJ
ahs-8094	303	29	both	both	PRON
ahs-8094	303	30	,	,	PUNCT
ahs-8094	303	31	which	which	PRON
ahs-8094	303	32	could	could	AUX
ahs-8094	303	33	have	have	VERB
ahs-8094	303	34	serious	serious	ADJ
ahs-8094	303	35	consequences	consequence	NOUN
ahs-8094	303	36	in	in	ADP
ahs-8094	303	37	their	their	PRON
ahs-8094	303	38	management	management	NOUN
ahs-8094	303	39	.	.	PUNCT
ahs-8094	304	1	mixed	mix	VERB
ahs-8094	304	2	infections	infection	NOUN
ahs-8094	304	3	of	of	ADP
ahs-8094	304	4	cmv	cmv	NOUN
ahs-8094	304	5	and	and	CCONJ
ahs-8094	304	6	pvmv	pvmv	NOUN
ahs-8094	304	7	in	in	ADP
ahs-8094	304	8	pepper	pepper	NOUN
ahs-8094	304	9	have	have	AUX
ahs-8094	304	10	been	be	AUX
ahs-8094	304	11	reported	report	VERB
ahs-8094	304	12	in	in	ADP
ahs-8094	304	13	previous	previous	ADJ
ahs-8094	304	14	studies	study	NOUN
ahs-8094	304	15	(	(	PUNCT
ahs-8094	304	16	aliyu	aliyu	NOUN
ahs-8094	304	17	,	,	PUNCT
ahs-8094	304	18	2014	2014	NUM
ahs-8094	304	19	;	;	PUNCT
ahs-8094	304	20	appiah	appiah	PROPN
ahs-8094	304	21	et	et	PROPN
ahs-8094	304	22	al	al	PROPN
ahs-8094	304	23	.	.	PROPN
ahs-8094	304	24	2014	2014	NUM
ahs-8094	304	25	)	)	PUNCT
ahs-8094	304	26	.	.	PUNCT
ahs-8094	305	1	mixed	mixed	ADJ
ahs-8094	305	2	infections	infection	NOUN
ahs-8094	305	3	in	in	ADP
ahs-8094	305	4	pepper	pepper	NOUN
ahs-8094	305	5	plants	plant	NOUN
ahs-8094	305	6	increase	increase	VERB
ahs-8094	305	7	the	the	DET
ahs-8094	305	8	severity	severity	NOUN
ahs-8094	305	9	of	of	ADP
ahs-8094	305	10	disease	disease	NOUN
ahs-8094	305	11	symptoms	symptom	NOUN
ahs-8094	305	12	leading	lead	VERB
ahs-8094	305	13	to	to	ADP
ahs-8094	305	14	signifi­	signifi­	PROPN
ahs-8094	305	15	ca	can	AUX
ahs-8094	305	16	nt	not	PART
ahs-8094	305	17	yield	yield	VERB
ahs-8094	305	18	losses	loss	NOUN
ahs-8094	305	19	(	(	PUNCT
ahs-8094	305	20	arogundade	arogundade	VERB
ahs-8094	305	21	et	et	PROPN
ahs-8094	305	22	al	al	PROPN
ahs-8094	305	23	.	.	PROPN
ahs-8094	305	24	,	,	PUNCT
ahs-8094	305	25	2012	2012	NUM
ahs-8094	305	26	)	)	PUNCT
ahs-8094	305	27	.	.	PUNCT
ahs-8094	306	1	thus	thus	ADV
ahs-8094	306	2	,	,	PUNCT
ahs-8094	306	3	understanding	understand	VERB
ahs-8094	306	4	the	the	DET
ahs-8094	306	5	interactions	interaction	NOUN
ahs-8094	306	6	of	of	ADP
ahs-8094	306	7	these	these	DET
ahs-8094	306	8	viruses	virus	NOUN
ahs-8094	306	9	is	be	AUX
ahs-8094	306	10	crucial	crucial	ADJ
ahs-8094	306	11	for	for	ADP
ahs-8094	306	12	the	the	DET
ahs-8094	306	13	development	development	NOUN
ahs-8094	306	14	of	of	ADP
ahs-8094	306	15	efficient	efficient	ADJ
ahs-8094	306	16	and	and	CCONJ
ahs-8094	306	17	sustain­	sustain­	ADJ
ahs-8094	306	18	able	able	ADJ
ahs-8094	306	19	management	management	NOUN
ahs-8094	306	20	strategies	strategy	NOUN
ahs-8094	306	21	such	such	ADJ
ahs-8094	306	22	as	as	ADP
ahs-8094	306	23	resistant	resistant	ADJ
ahs-8094	306	24	vari­	vari­	NOUN
ahs-8094	306	25	eties	etie	NOUN
ahs-8094	306	26	(	(	PUNCT
ahs-8094	306	27	syller	syller	NOUN
ahs-8094	306	28	,	,	PUNCT
ahs-8094	306	29	2012	2012	NUM
ahs-8094	306	30	)	)	PUNCT
ahs-8094	306	31	.	.	PUNCT
ahs-8094	307	1	results	result	NOUN
ahs-8094	307	2	from	from	ADP
ahs-8094	307	3	screenhouse	screenhouse	NOUN
ahs-8094	307	4	showed	show	VERB
ahs-8094	307	5	that	that	SCONJ
ahs-8094	307	6	all	all	DET
ahs-8094	307	7	geno­	geno­	ADJ
ahs-8094	307	8	types	type	NOUN
ahs-8094	307	9	developed	develop	VERB
ahs-8094	307	10	symptoms	symptom	NOUN
ahs-8094	307	11	to	to	ADP
ahs-8094	307	12	cmv	cmv	NOUN
ahs-8094	307	13	infection	infection	NOUN
ahs-8094	307	14	albeit	albeit	SCONJ
ahs-8094	307	15	at	at	ADP
ahs-8094	307	16	different	different	ADJ
ahs-8094	307	17	levels	level	NOUN
ahs-8094	307	18	of	of	ADP
ahs-8094	307	19	severity	severity	NOUN
ahs-8094	307	20	and	and	CCONJ
ahs-8094	307	21	time	time	NOUN
ahs-8094	307	22	,	,	PUNCT
ahs-8094	307	23	confirming	confirm	VERB
ahs-8094	307	24	the	the	DET
ahs-8094	307	25	virulence	virulence	NOUN
ahs-8094	307	26	of	of	ADP
ahs-8094	307	27	the	the	DET
ahs-8094	307	28	local	local	ADJ
ahs-8094	307	29	cmv	cmv	NOUN
ahs-8094	307	30	isolate	isolate	NOUN
ahs-8094	307	31	used	use	VERB
ahs-8094	307	32	.	.	PUNCT
ahs-8094	308	1	the	the	DET
ahs-8094	308	2	plants	plant	NOUN
ahs-8094	308	3	developed	develop	VERB
ahs-8094	308	4	systemic	systemic	ADJ
ahs-8094	308	5	symptoms	symptom	NOUN
ahs-8094	308	6	including	include	VERB
ahs-8094	308	7	mosaic	mosaic	ADJ
ahs-8094	308	8	,	,	PUNCT
ahs-8094	308	9	mottle	mottle	NOUN
ahs-8094	308	10	,	,	PUNCT
ahs-8094	308	11	leaf	leaf	NOUN
ahs-8094	308	12	crinkling	crinkling	NOUN
ahs-8094	308	13	and	and	CCONJ
ahs-8094	308	14	distortion	distortion	NOUN
ahs-8094	308	15	and	and	CCONJ
ahs-8094	308	16	stunting	stunting	NOUN
ahs-8094	308	17	which	which	PRON
ahs-8094	308	18	were	be	AUX
ahs-8094	308	19	similar	similar	ADJ
ahs-8094	308	20	to	to	ADP
ahs-8094	308	21	symptoms	symptom	NOUN
ahs-8094	308	22	described	describe	VERB
ahs-8094	308	23	by	by	ADP
ahs-8094	308	24	rahman	rahman	PROPN
ahs-8094	308	25	et	et	PROPN
ahs-8094	308	26	al	al	PROPN
ahs-8094	308	27	.	.	PROPN
ahs-8094	309	1	(	(	PUNCT
ahs-8094	309	2	2016	2016	NUM
ahs-8094	309	3	)	)	PUNCT
ahs-8094	309	4	.	.	PUNCT
ahs-8094	310	1	two	two	NUM
ahs-8094	310	2	local	local	ADJ
ahs-8094	310	3	genotypes	genotype	NOUN
ahs-8094	310	4	0802ppr	0802ppr	NOUN
ahs-8094	310	5	and	and	CCONJ
ahs-8094	310	6	c.	c.	PROPN
ahs-8094	310	7	baccatum	baccatum	PROPN
ahs-8094	310	8	00767ppr	00767ppr	NOUN
ahs-8094	310	9	,	,	PUNCT
ahs-8094	310	10	and	and	CCONJ
ahs-8094	310	11	two	two	NUM
ahs-8094	310	12	introduced	introduce	VERB
ahs-8094	310	13	genotypes	genotype	NOUN
ahs-8094	310	14	c.	c.	PROPN
ahs-8094	310	15	annuum	annuum	PROPN
ahs-8094	310	16	pbc	pbc	PROPN
ahs-8094	310	17	462	462	NUM
ahs-8094	310	18	and	and	CCONJ
ahs-8094	310	19	pp9852­170	pp9852­170	PROPN
ahs-8094	310	20	were	be	AUX
ahs-8094	310	21	found	find	VERB
ahs-8094	310	22	resistant	resistant	ADJ
ahs-8094	310	23	to	to	ADP
ahs-8094	310	24	cmv	cmv	NOUN
ahs-8094	310	25	while	while	SCONJ
ahs-8094	310	26	one	one	NUM
ahs-8094	310	27	local	local	ADJ
ahs-8094	310	28	c.	c.	NOUN
ahs-8094	310	29	annuum	annuum	PROPN
ahs-8094	310	30	genotypes	genotype	NOUN
ahs-8094	310	31	00786ppr	00786ppr	VERB
ahs-8094	310	32	and	and	CCONJ
ahs-8094	310	33	three	three	NUM
ahs-8094	310	34	introduced	introduce	VERB
ahs-8094	310	35	geno­	geno­	NOUN
ahs-8094	310	36	types	type	NOUN
ahs-8094	310	37	pp9950­5197	pp9950­5197	VERB
ahs-8094	310	38	,	,	PUNCT
ahs-8094	310	39	hp	hp	PROPN
ahs-8094	310	40	0117	0117	NUM
ahs-8094	310	41	and	and	CCONJ
ahs-8094	310	42	icpn	icpn	PROPN
ahs-8094	310	43	18­7	18­7	NUM
ahs-8094	310	44	were	be	AUX
ahs-8094	310	45	moderately	moderately	ADV
ahs-8094	310	46	resistant	resistant	ADJ
ahs-8094	310	47	.	.	PUNCT
ahs-8094	311	1	the	the	DET
ahs-8094	311	2	previously	previously	ADV
ahs-8094	311	3	published	publish	VERB
ahs-8094	311	4	resis­	resis­	NOUN
ahs-8094	311	5	tant	tant	ADJ
ahs-8094	311	6	genotypes	genotype	NOUN
ahs-8094	311	7	(	(	PUNCT
ahs-8094	311	8	pp9852­170	pp9852­170	NOUN
ahs-8094	311	9	and	and	CCONJ
ahs-8094	311	10	pp9950­5197	pp9950­5197	PROPN
ahs-8094	311	11	)	)	PUNCT
ahs-8094	311	12	to	to	PART
ahs-8094	311	13	cmv	cmv	VERB
ahs-8094	311	14	in	in	ADP
ahs-8094	311	15	screenhouse	screenhouse	NOUN
ahs-8094	311	16	conditions	condition	NOUN
ahs-8094	311	17	were	be	AUX
ahs-8094	311	18	also	also	ADV
ahs-8094	311	19	resistant	resistant	ADJ
ahs-8094	311	20	in	in	ADP
ahs-8094	311	21	our	our	PRON
ahs-8094	311	22	study	study	NOUN
ahs-8094	311	23	(	(	PUNCT
ahs-8094	311	24	gniffke	gniffke	NOUN
ahs-8094	311	25	,	,	PUNCT
ahs-8094	311	26	et	et	PROPN
ahs-8094	311	27	al	al	PROPN
ahs-8094	311	28	.	.	PROPN
ahs-8094	311	29	,	,	PUNCT
ahs-8094	311	30	2013	2013	NUM
ahs-8094	311	31	;	;	PUNCT
ahs-8094	311	32	reddy	reddy	PROPN
ahs-8094	311	33	,	,	PUNCT
ahs-8094	311	34	et	et	PROPN
ahs-8094	311	35	al	al	PROPN
ahs-8094	311	36	.	.	PROPN
ahs-8094	311	37	,	,	PUNCT
ahs-8094	311	38	2014	2014	NUM
ahs-8094	311	39	)	)	PUNCT
ahs-8094	311	40	.	.	PUNCT
ahs-8094	312	1	however	however	ADV
ahs-8094	312	2	,	,	PUNCT
ahs-8094	312	3	genotype	genotype	NOUN
ahs-8094	312	4	icpn	icpn	PROPN
ahs-8094	312	5	18­7	18­7	NUM
ahs-8094	312	6	that	that	PRON
ahs-8094	312	7	was	be	AUX
ahs-8094	312	8	previously	previously	ADV
ahs-8094	312	9	reported	report	VERB
ahs-8094	312	10	as	as	ADP
ahs-8094	312	11	susceptible	susceptible	ADJ
ahs-8094	312	12	to	to	ADP
ahs-8094	312	13	cmv	cmv	NOUN
ahs-8094	312	14	was	be	AUX
ahs-8094	312	15	moderately	moderately	ADV
ahs-8094	312	16	resistant	resistant	ADJ
ahs-8094	312	17	in	in	ADP
ahs-8094	312	18	the	the	DET
ahs-8094	312	19	current	current	ADJ
ahs-8094	312	20	study	study	NOUN
ahs-8094	312	21	(	(	PUNCT
ahs-8094	312	22	gniffke	gniffke	NOUN
ahs-8094	312	23	,	,	PUNCT
ahs-8094	312	24	et	et	PROPN
ahs-8094	312	25	al	al	PROPN
ahs-8094	312	26	.	.	PROPN
ahs-8094	312	27	,	,	PUNCT
ahs-8094	312	28	2013	2013	NUM
ahs-8094	312	29	)	)	PUNCT
ahs-8094	312	30	.	.	PUNCT
ahs-8094	313	1	the	the	DET
ahs-8094	313	2	reason	reason	NOUN
ahs-8094	313	3	for	for	ADP
ahs-8094	313	4	these	these	DET
ahs-8094	313	5	differences	difference	NOUN
ahs-8094	313	6	could	could	AUX
ahs-8094	313	7	be	be	AUX
ahs-8094	313	8	attributed	attribute	VERB
ahs-8094	313	9	to	to	ADP
ahs-8094	313	10	the	the	DET
ahs-8094	313	11	use	use	NOUN
ahs-8094	313	12	of	of	ADP
ahs-8094	313	13	different	different	ADJ
ahs-8094	313	14	strain	strain	NOUN
ahs-8094	313	15	of	of	ADP
ahs-8094	313	16	cmv	cmv	NOUN
ahs-8094	313	17	.	.	PUNCT
ahs-8094	314	1	various	various	ADJ
ahs-8094	314	2	sources	source	NOUN
ahs-8094	314	3	of	of	ADP
ahs-8094	314	4	resistance	resistance	NOUN
ahs-8094	314	5	to	to	ADP
ahs-8094	314	6	cmv	cmv	NOUN
ahs-8094	314	7	in	in	ADP
ahs-8094	314	8	pepper	pepper	NOUN
ahs-8094	314	9	have	have	AUX
ahs-8094	314	10	been	be	AUX
ahs-8094	314	11	identified	identify	VERB
ahs-8094	314	12	in	in	ADP
ahs-8094	314	13	c.	c.	PROPN
ahs-8094	314	14	annuum	annuum	PROPN
ahs-8094	314	15	,	,	PUNCT
ahs-8094	314	16	c.	c.	PROPN
ahs-8094	314	17	baccatum	baccatum	PROPN
ahs-8094	314	18	and	and	CCONJ
ahs-8094	314	19	c.	c.	PROPN
ahs-8094	314	20	frutescens	frutescen	VERB
ahs-8094	314	21	species	specie	NOUN
ahs-8094	314	22	(	(	PUNCT
ahs-8094	314	23	grube	grube	PROPN
ahs-8094	314	24	et	et	PROPN
ahs-8094	314	25	al	al	PROPN
ahs-8094	314	26	.	.	PROPN
ahs-8094	314	27	,	,	PUNCT
ahs-8094	314	28	2000	2000	NUM
ahs-8094	314	29	;	;	PUNCT
ahs-8094	314	30	chaim	chaim	PROPN
ahs-8094	314	31	et	et	PROPN
ahs-8094	314	32	al	al	PROPN
ahs-8094	314	33	.	.	PROPN
ahs-8094	314	34	,	,	PUNCT
ahs-8094	314	35	2001	2001	NUM
ahs-8094	314	36	;	;	PUNCT
ahs-8094	314	37	caranta	caranta	PROPN
ahs-8094	314	38	et	et	PROPN
ahs-8094	314	39	al	al	PROPN
ahs-8094	314	40	.	.	PROPN
ahs-8094	314	41	,	,	PUNCT
ahs-8094	314	42	2002	2002	NUM
ahs-8094	314	43	;	;	PUNCT
ahs-8094	314	44	suzuki	suzuki	PROPN
ahs-8094	314	45	et	et	PROPN
ahs-8094	314	46	al	al	PROPN
ahs-8094	314	47	.	.	PROPN
ahs-8094	314	48	,	,	PUNCT
ahs-8094	314	49	2003	2003	NUM
ahs-8094	314	50	;	;	PUNCT
ahs-8094	314	51	rahman	rahman	PROPN
ahs-8094	314	52	et	et	PROPN
ahs-8094	314	53	al	al	PROPN
ahs-8094	314	54	.	.	PROPN
ahs-8094	314	55	,	,	PUNCT
ahs-8094	314	56	2016	2016	NUM
ahs-8094	314	57	)	)	PUNCT
ahs-8094	314	58	.	.	PUNCT
ahs-8094	315	1	the	the	DET
ahs-8094	315	2	present	present	ADJ
ahs-8094	315	3	findings	finding	NOUN
ahs-8094	315	4	prove	prove	VERB
ahs-8094	315	5	that	that	SCONJ
ahs-8094	315	6	natural	natural	ADJ
ahs-8094	315	7	resistance	resistance	NOUN
ahs-8094	315	8	or	or	CCONJ
ahs-8094	315	9	tol­	tol­	ADJ
ahs-8094	315	10	erance	erance	NOUN
ahs-8094	315	11	exists	exist	VERB
ahs-8094	315	12	in	in	ADP
ahs-8094	315	13	tested	test	VERB
ahs-8094	315	14	c.	c.	PROPN
ahs-8094	315	15	annuum	annuum	PROPN
ahs-8094	315	16	and	and	CCONJ
ahs-8094	315	17	c.	c.	PROPN
ahs-8094	315	18	baccatum	baccatum	PROPN
ahs-8094	315	19	genotypes	genotype	NOUN
ahs-8094	315	20	.	.	PUNCT
ahs-8094	316	1	as	as	ADP
ahs-8094	316	2	different	different	ADJ
ahs-8094	316	3	strains	strain	NOUN
ahs-8094	316	4	of	of	ADP
ahs-8094	316	5	cmv	cmv	NOUN
ahs-8094	316	6	exist	exist	NOUN
ahs-8094	316	7	,	,	PUNCT
ahs-8094	316	8	it	it	PRON
ahs-8094	316	9	is	be	AUX
ahs-8094	316	10	desirable	desirable	ADJ
ahs-8094	316	11	to	to	PART
ahs-8094	316	12	test	test	VERB
ahs-8094	316	13	the	the	DET
ahs-8094	316	14	identified	identify	VERB
ahs-8094	316	15	pepper	pepper	NOUN
ahs-8094	316	16	genotypes	genotype	NOUN
ahs-8094	316	17	against	against	ADP
ahs-8094	316	18	multiple	multiple	ADJ
ahs-8094	316	19	strains	strain	NOUN
ahs-8094	316	20	of	of	ADP
ahs-8094	316	21	cmv	cmv	NOUN
ahs-8094	316	22	to	to	PART
ahs-8094	316	23	validate	validate	VERB
ahs-8094	316	24	their	their	PRON
ahs-8094	316	25	resis­	resis­	NOUN
ahs-8094	316	26	tance	tance	NOUN
ahs-8094	316	27	.	.	PUNCT
ahs-8094	317	1	in	in	ADP
ahs-8094	317	2	both	both	PRON
ahs-8094	317	3	field	field	NOUN
ahs-8094	317	4	and	and	CCONJ
ahs-8094	317	5	screenhouse	screenhouse	ADJ
ahs-8094	317	6	experiments	experiment	NOUN
ahs-8094	317	7	,	,	PUNCT
ahs-8094	317	8	geno­	geno­	DET
ahs-8094	317	9	type	type	NOUN
ahs-8094	317	10	00767ppr	00767ppr	NOUN
ahs-8094	317	11	,	,	PUNCT
ahs-8094	317	12	0802ppr	0802ppr	NOUN
ahs-8094	317	13	and	and	CCONJ
ahs-8094	317	14	pbc	pbc	PROPN
ahs-8094	317	15	462	462	NUM
ahs-8094	317	16	were	be	AUX
ahs-8094	317	17	consis­	consis­	NUM
ahs-8094	317	18	tently	tently	ADV
ahs-8094	317	19	resistant	resistant	ADJ
ahs-8094	317	20	to	to	ADP
ahs-8094	317	21	viral	viral	ADJ
ahs-8094	317	22	diseases	disease	NOUN
ahs-8094	317	23	while	while	SCONJ
ahs-8094	317	24	genotype	genotype	NOUN
ahs-8094	317	25	hp	hp	PROPN
ahs-8094	317	26	0117	0117	NUM
ahs-8094	317	27	was	be	AUX
ahs-8094	317	28	moderately	moderately	ADV
ahs-8094	317	29	resistant	resistant	ADJ
ahs-8094	317	30	,	,	PUNCT
ahs-8094	317	31	providing	provide	VERB
ahs-8094	317	32	evidence	evidence	NOUN
ahs-8094	317	33	that	that	SCONJ
ahs-8094	317	34	the	the	DET
ahs-8094	317	35	reactions	reaction	NOUN
ahs-8094	317	36	of	of	ADP
ahs-8094	317	37	these	these	DET
ahs-8094	317	38	genotypes	genotype	NOUN
ahs-8094	317	39	to	to	ADP
ahs-8094	317	40	the	the	DET
ahs-8094	317	41	virus	virus	NOUN
ahs-8094	317	42	might	might	AUX
ahs-8094	317	43	be	be	AUX
ahs-8094	317	44	due	due	ADJ
ahs-8094	317	45	to	to	ADP
ahs-8094	317	46	genetic	genetic	ADJ
ahs-8094	317	47	factors	factor	NOUN
ahs-8094	317	48	.	.	PUNCT
ahs-8094	318	1	however	however	ADV
ahs-8094	318	2	,	,	PUNCT
ahs-8094	318	3	unlike	unlike	ADP
ahs-8094	318	4	under	under	ADP
ahs-8094	318	5	field	field	NOUN
ahs-8094	318	6	conditions	condition	NOUN
ahs-8094	318	7	where	where	SCONJ
ahs-8094	318	8	genotypes	genotype	NOUN
ahs-8094	318	9	pp9950­5197	pp9950­5197	VERB
ahs-8094	318	10	and	and	CCONJ
ahs-8094	318	11	icpn	icpn	PROPN
ahs-8094	318	12	18­7	18­7	NUM
ahs-8094	318	13	were	be	AUX
ahs-8094	318	14	categorized	categorize	VERB
ahs-8094	318	15	as	as	ADV
ahs-8094	318	16	resistant	resistant	ADJ
ahs-8094	318	17	to	to	ADP
ahs-8094	318	18	viral	viral	ADJ
ahs-8094	318	19	waweru	waweru	PROPN
ahs-8094	318	20	et	et	PROPN
ahs-8094	318	21	al	al	PROPN
ahs-8094	318	22	.	.	PROPN
ahs-8094	319	1	‐	‐	NOUN
ahs-8094	319	2	evaluation	evaluation	NOUN
ahs-8094	319	3	of	of	ADP
ahs-8094	319	4	hot	hot	ADJ
ahs-8094	319	5	pepper	pepper	NOUN
ahs-8094	319	6	genotypes	genotype	NOUN
ahs-8094	319	7	in	in	ADP
ahs-8094	319	8	rwanda	rwanda	PROPN
ahs-8094	319	9	409	409	NUM
ahs-8094	319	10	diseases	disease	NOUN
ahs-8094	319	11	,	,	PUNCT
ahs-8094	319	12	they	they	PRON
ahs-8094	319	13	reacted	react	VERB
ahs-8094	319	14	differently	differently	ADV
ahs-8094	319	15	when	when	SCONJ
ahs-8094	319	16	subjected	subject	VERB
ahs-8094	319	17	to	to	ADP
ahs-8094	319	18	the	the	DET
ahs-8094	319	19	artificial	artificial	ADJ
ahs-8094	319	20	inoculation	inoculation	NOUN
ahs-8094	319	21	with	with	ADP
ahs-8094	319	22	cmv	cmv	NOUN
ahs-8094	319	23	and	and	CCONJ
ahs-8094	319	24	grouped	group	VERB
ahs-8094	319	25	as	as	ADV
ahs-8094	319	26	resistant	resistant	ADJ
ahs-8094	319	27	.	.	PUNCT
ahs-8094	320	1	this	this	PRON
ahs-8094	320	2	might	might	AUX
ahs-8094	320	3	be	be	AUX
ahs-8094	320	4	due	due	ADJ
ahs-8094	320	5	to	to	ADP
ahs-8094	320	6	disease	disease	NOUN
ahs-8094	320	7	escape	escape	NOUN
ahs-8094	320	8	in	in	ADP
ahs-8094	320	9	the	the	DET
ahs-8094	320	10	field	field	NOUN
ahs-8094	320	11	.	.	PUNCT
ahs-8094	321	1	similar	similar	ADJ
ahs-8094	321	2	observations	observation	NOUN
ahs-8094	321	3	were	be	AUX
ahs-8094	321	4	made	make	VERB
ahs-8094	321	5	by	by	ADP
ahs-8094	321	6	ashfaq	ashfaq	NOUN
ahs-8094	321	7	et	et	PROPN
ahs-8094	321	8	al	al	PROPN
ahs-8094	321	9	.	.	PROPN
ahs-8094	322	1	(	(	PUNCT
ahs-8094	322	2	2014	2014	NUM
ahs-8094	322	3	)	)	PUNCT
ahs-8094	322	4	,	,	PUNCT
ahs-8094	322	5	where	where	SCONJ
ahs-8094	322	6	two	two	NUM
ahs-8094	322	7	chili	chili	NOUN
ahs-8094	322	8	genotypes	genotype	NOUN
ahs-8094	322	9	c­7	c­7	PROPN
ahs-8094	322	10	and	and	CCONJ
ahs-8094	322	11	c­8	c­8	PRON
ahs-8094	322	12	showed	show	VERB
ahs-8094	322	13	a	a	DET
ahs-8094	322	14	different	different	ADJ
ahs-8094	322	15	reaction	reaction	NOUN
ahs-8094	322	16	to	to	ADP
ahs-8094	322	17	cmv	cmv	VERB
ahs-8094	322	18	under	under	ADP
ahs-8094	322	19	controlled	control	VERB
ahs-8094	322	20	and	and	CCONJ
ahs-8094	322	21	uncontrolled	uncontrolled	ADJ
ahs-8094	322	22	conditions	condition	NOUN
ahs-8094	322	23	.	.	PUNCT
ahs-8094	323	1	on	on	ADP
ahs-8094	323	2	the	the	DET
ahs-8094	323	3	other	other	ADJ
ahs-8094	323	4	hand	hand	NOUN
ahs-8094	323	5	,	,	PUNCT
ahs-8094	323	6	genotype	genotype	NOUN
ahs-8094	323	7	pp9852­170	pp9852­170	PROPN
ahs-8094	323	8	was	be	AUX
ahs-8094	323	9	resistant	resistant	ADJ
ahs-8094	323	10	to	to	ADP
ahs-8094	323	11	cmv	cmv	VERB
ahs-8094	323	12	under	under	ADP
ahs-8094	323	13	controlled	control	VERB
ahs-8094	323	14	conditions	condition	NOUN
ahs-8094	323	15	while	while	SCONJ
ahs-8094	323	16	in	in	ADP
ahs-8094	323	17	the	the	DET
ahs-8094	323	18	field	field	NOUN
ahs-8094	323	19	,	,	PUNCT
ahs-8094	323	20	it	it	PRON
ahs-8094	323	21	was	be	AUX
ahs-8094	323	22	grouped	group	VERB
ahs-8094	323	23	as	as	ADP
ahs-8094	323	24	moderately	moderately	ADV
ahs-8094	323	25	resistant	resistant	ADJ
ahs-8094	323	26	to	to	ADP
ahs-8094	323	27	viral	viral	ADJ
ahs-8094	323	28	diseases	disease	NOUN
ahs-8094	323	29	.	.	PUNCT
ahs-8094	324	1	this	this	PRON
ahs-8094	324	2	may	may	AUX
ahs-8094	324	3	be	be	AUX
ahs-8094	324	4	due	due	ADJ
ahs-8094	324	5	to	to	ADP
ahs-8094	324	6	the	the	DET
ahs-8094	324	7	complex	complex	ADJ
ahs-8094	324	8	nature	nature	NOUN
ahs-8094	324	9	of	of	ADP
ahs-8094	324	10	the	the	DET
ahs-8094	324	11	virus­	virus­	NOUN
ahs-8094	324	12	es	es	NOUN
ahs-8094	324	13	’	'	PUNCT
ahs-8094	324	14	infection	infection	NOUN
ahs-8094	324	15	in	in	ADP
ahs-8094	324	16	the	the	DET
ahs-8094	324	17	field	field	NOUN
ahs-8094	324	18	where	where	SCONJ
ahs-8094	324	19	more	more	ADJ
ahs-8094	324	20	than	than	ADP
ahs-8094	324	21	two	two	NUM
ahs-8094	324	22	viruses	virus	NOUN
ahs-8094	324	23	occur	occur	VERB
ahs-8094	324	24	in	in	ADP
ahs-8094	324	25	combination	combination	NOUN
ahs-8094	324	26	.	.	PUNCT
ahs-8094	325	1	as	as	SCONJ
ahs-8094	325	2	was	be	AUX
ahs-8094	325	3	evident	evident	ADJ
ahs-8094	325	4	in	in	ADP
ahs-8094	325	5	this	this	DET
ahs-8094	325	6	study	study	NOUN
ahs-8094	325	7	where	where	SCONJ
ahs-8094	325	8	single	single	ADJ
ahs-8094	325	9	and	and	CCONJ
ahs-8094	325	10	mixed	mixed	ADJ
ahs-8094	325	11	infections	infection	NOUN
ahs-8094	325	12	of	of	ADP
ahs-8094	325	13	cmv	cmv	NOUN
ahs-8094	325	14	,	,	PUNCT
ahs-8094	325	15	pvmv	pvmv	NOUN
ahs-8094	325	16	,	,	PUNCT
ahs-8094	325	17	and	and	CCONJ
ahs-8094	325	18	pevyv	pevyv	NOUN
ahs-8094	325	19	were	be	AUX
ahs-8094	325	20	observed	observe	VERB
ahs-8094	325	21	and	and	CCONJ
ahs-8094	325	22	their	their	PRON
ahs-8094	325	23	presence	presence	NOUN
ahs-8094	325	24	might	might	AUX
ahs-8094	325	25	have	have	AUX
ahs-8094	325	26	contributed	contribute	VERB
ahs-8094	325	27	towards	towards	ADP
ahs-8094	325	28	variations	variation	NOUN
ahs-8094	325	29	in	in	ADP
ahs-8094	325	30	the	the	DET
ahs-8094	325	31	reaction	reaction	NOUN
ahs-8094	325	32	of	of	ADP
ahs-8094	325	33	the	the	DET
ahs-8094	325	34	host	host	NOUN
ahs-8094	325	35	in	in	ADP
ahs-8094	325	36	the	the	DET
ahs-8094	325	37	field	field	NOUN
ahs-8094	325	38	.	.	PUNCT
ahs-8094	326	1	these	these	DET
ahs-8094	326	2	variations	variation	NOUN
ahs-8094	326	3	in	in	ADP
ahs-8094	326	4	the	the	DET
ahs-8094	326	5	obser­	obser­	PROPN
ahs-8094	326	6	vation	vation	NOUN
ahs-8094	326	7	may	may	AUX
ahs-8094	326	8	also	also	ADV
ahs-8094	326	9	be	be	AUX
ahs-8094	326	10	due	due	ADJ
ahs-8094	326	11	to	to	ADP
ahs-8094	326	12	variations	variation	NOUN
ahs-8094	326	13	in	in	ADP
ahs-8094	326	14	inoculum	inoculum	NOUN
ahs-8094	326	15	load	load	NOUN
ahs-8094	326	16	and	and	CCONJ
ahs-8094	326	17	environmental	environmental	ADJ
ahs-8094	326	18	conditions	condition	NOUN
ahs-8094	326	19	that	that	PRON
ahs-8094	326	20	might	might	AUX
ahs-8094	326	21	have	have	VERB
ahs-8094	326	22	inter­	inter­	NUM
ahs-8094	326	23	fered	fere	VERB
ahs-8094	326	24	with	with	ADP
ahs-8094	326	25	plant	plant	NOUN
ahs-8094	326	26	behaviour	behaviour	NOUN
ahs-8094	326	27	.	.	PUNCT
ahs-8094	327	1	the	the	DET
ahs-8094	327	2	categorization	categorization	NOUN
ahs-8094	327	3	of	of	ADP
ahs-8094	327	4	genotypes	genotype	NOUN
ahs-8094	327	5	into	into	ADP
ahs-8094	327	6	resistant	resistant	ADJ
ahs-8094	327	7	,	,	PUNCT
ahs-8094	327	8	moderately	moderately	ADV
ahs-8094	327	9	resistant	resistant	ADJ
ahs-8094	327	10	and	and	CCONJ
ahs-8094	327	11	susceptible	susceptible	ADJ
ahs-8094	327	12	was	be	AUX
ahs-8094	327	13	based	base	VERB
ahs-8094	327	14	on	on	ADP
ahs-8094	327	15	the	the	DET
ahs-8094	327	16	incidence	incidence	NOUN
ahs-8094	327	17	and	and	CCONJ
ahs-8094	327	18	severity	severity	NOUN
ahs-8094	327	19	of	of	ADP
ahs-8094	327	20	the	the	DET
ahs-8094	327	21	viral	viral	ADJ
ahs-8094	327	22	diseases	disease	NOUN
ahs-8094	327	23	on	on	ADP
ahs-8094	327	24	the	the	DET
ahs-8094	327	25	host	host	NOUN
ahs-8094	327	26	.	.	PUNCT
ahs-8094	328	1	however	however	ADV
ahs-8094	328	2	,	,	PUNCT
ahs-8094	328	3	it	it	PRON
ahs-8094	328	4	is	be	AUX
ahs-8094	328	5	noteworthy	noteworthy	ADJ
ahs-8094	328	6	that	that	SCONJ
ahs-8094	328	7	the	the	DET
ahs-8094	328	8	genotypes	genotype	NOUN
ahs-8094	328	9	00802ppr	00802ppr	NOUN
ahs-8094	328	10	,	,	PUNCT
ahs-8094	328	11	00767ppr	00767ppr	NOUN
ahs-8094	328	12	,	,	PUNCT
ahs-8094	328	13	pbc	pbc	PROPN
ahs-8094	328	14	462	462	NUM
ahs-8094	328	15	,	,	PUNCT
ahs-8094	328	16	pp9950­5197	pp9950­5197	PROPN
ahs-8094	328	17	and	and	CCONJ
ahs-8094	328	18	icpn	icpn	PROPN
ahs-8094	328	19	18­7	18­7	NUM
ahs-8094	328	20	classified	classify	VERB
ahs-8094	328	21	as	as	ADP
ahs-8094	328	22	resistant	resistant	ADJ
ahs-8094	328	23	to	to	ADP
ahs-8094	328	24	viral	viral	ADJ
ahs-8094	328	25	diseases	disease	NOUN
ahs-8094	328	26	had	have	VERB
ahs-8094	328	27	the	the	DET
ahs-8094	328	28	lowest	low	ADJ
ahs-8094	328	29	audpc	audpc	NOUN
ahs-8094	328	30	values	value	NOUN
ahs-8094	328	31	of	of	ADP
ahs-8094	328	32	less	less	ADJ
ahs-8094	328	33	than	than	ADP
ahs-8094	328	34	100	100	NUM
ahs-8094	328	35	in	in	ADP
ahs-8094	328	36	the	the	DET
ahs-8094	328	37	field	field	NOUN
ahs-8094	328	38	while	while	SCONJ
ahs-8094	328	39	the	the	DET
ahs-8094	328	40	highest	high	ADJ
ahs-8094	328	41	audpc	audpc	NOUN
ahs-8094	328	42	value	value	NOUN
ahs-8094	328	43	was	be	AUX
ahs-8094	328	44	recorded	record	VERB
ahs-8094	328	45	in	in	ADP
ahs-8094	328	46	sus­	sus­	PROPN
ahs-8094	328	47	ceptible	ceptible	PROPN
ahs-8094	328	48	check	check	PROPN
ahs-8094	328	49	california	california	PROPN
ahs-8094	328	50	wonder	wonder	PROPN
ahs-8094	328	51	346	346	NUM
ahs-8094	328	52	.	.	PUNCT
ahs-8094	329	1	lower	low	ADJ
ahs-8094	329	2	audpc	audpc	NOUN
ahs-8094	329	3	values	value	NOUN
ahs-8094	329	4	indicate	indicate	VERB
ahs-8094	329	5	a	a	DET
ahs-8094	329	6	lower	low	ADJ
ahs-8094	329	7	disease	disease	NOUN
ahs-8094	329	8	development	development	NOUN
ahs-8094	329	9	rate	rate	NOUN
ahs-8094	329	10	.	.	PUNCT
ahs-8094	330	1	these	these	DET
ahs-8094	330	2	genotypes	genotype	NOUN
ahs-8094	330	3	had	have	VERB
ahs-8094	330	4	low	low	ADJ
ahs-8094	330	5	audpc	audpc	NOUN
ahs-8094	330	6	values	value	NOUN
ahs-8094	330	7	which	which	PRON
ahs-8094	330	8	implies	imply	VERB
ahs-8094	330	9	that	that	SCONJ
ahs-8094	330	10	the	the	DET
ahs-8094	330	11	plant	plant	NOUN
ahs-8094	330	12	defence	defence	NOUN
ahs-8094	330	13	mechanism	mechanism	NOUN
ahs-8094	330	14	against	against	ADP
ahs-8094	330	15	the	the	DET
ahs-8094	330	16	viruses	virus	NOUN
ahs-8094	330	17	could	could	AUX
ahs-8094	330	18	be	be	AUX
ahs-8094	330	19	mediated	mediate	VERB
ahs-8094	330	20	by	by	ADP
ahs-8094	330	21	resistance	resistance	NOUN
ahs-8094	330	22	(	(	PUNCT
ahs-8094	330	23	r	r	NOUN
ahs-8094	330	24	)	)	PUNCT
ahs-8094	330	25	genes	gene	NOUN
ahs-8094	330	26	which	which	PRON
ahs-8094	330	27	are	be	AUX
ahs-8094	330	28	observed	observe	VERB
ahs-8094	330	29	as	as	ADP
ahs-8094	330	30	complete	complete	ADJ
ahs-8094	330	31	resistance	resistance	NOUN
ahs-8094	330	32	or	or	CCONJ
ahs-8094	330	33	extreme	extreme	ADJ
ahs-8094	330	34	resistance	resistance	NOUN
ahs-8094	330	35	(	(	PUNCT
ahs-8094	330	36	er	er	INTJ
ahs-8094	330	37	)	)	PUNCT
ahs-8094	330	38	and	and	CCONJ
ahs-8094	330	39	that	that	SCONJ
ahs-8094	330	40	the	the	DET
ahs-8094	330	41	virus	virus	NOUN
ahs-8094	330	42	replication	replication	NOUN
ahs-8094	330	43	could	could	AUX
ahs-8094	330	44	have	have	AUX
ahs-8094	330	45	been	be	AUX
ahs-8094	330	46	hindered	hinder	VERB
ahs-8094	330	47	or	or	CCONJ
ahs-8094	330	48	gone	go	VERB
ahs-8094	330	49	undetectable	undetectable	ADJ
ahs-8094	330	50	among	among	ADP
ahs-8094	330	51	the	the	DET
ahs-8094	330	52	infected	infected	ADJ
ahs-8094	330	53	cells	cell	NOUN
ahs-8094	330	54	(	(	PUNCT
ahs-8094	330	55	ingvardsen	ingvardsen	NOUN
ahs-8094	330	56	et	et	PROPN
ahs-8094	330	57	al	al	PROPN
ahs-8094	330	58	.	.	PROPN
ahs-8094	330	59	,	,	PUNCT
ahs-8094	330	60	2010	2010	NUM
ahs-8094	330	61	)	)	PUNCT
ahs-8094	330	62	.	.	PUNCT
ahs-8094	331	1	the	the	DET
ahs-8094	331	2	reaction	reaction	NOUN
ahs-8094	331	3	of	of	ADP
ahs-8094	331	4	pepper	pepper	NOUN
ahs-8094	331	5	cultivar	cultivar	NOUN
ahs-8094	331	6	to	to	ADP
ahs-8094	331	7	the	the	DET
ahs-8094	331	8	viral	viral	ADJ
ahs-8094	331	9	diseases	disease	NOUN
ahs-8094	331	10	is	be	AUX
ahs-8094	331	11	governed	govern	VERB
ahs-8094	331	12	by	by	ADP
ahs-8094	331	13	the	the	DET
ahs-8094	331	14	resistance	resistance	NOUN
ahs-8094	331	15	genes	gene	NOUN
ahs-8094	331	16	which	which	PRON
ahs-8094	331	17	can	can	AUX
ahs-8094	331	18	be	be	AUX
ahs-8094	331	19	brought	bring	VERB
ahs-8094	331	20	by	by	ADP
ahs-8094	331	21	a	a	DET
ahs-8094	331	22	single	single	ADJ
ahs-8094	331	23	gene	gene	NOUN
ahs-8094	331	24	or	or	CCONJ
ahs-8094	331	25	multiple	multiple	ADJ
ahs-8094	331	26	genes	gene	NOUN
ahs-8094	331	27	(	(	PUNCT
ahs-8094	331	28	kang	kang	PROPN
ahs-8094	331	29	et	et	PROPN
ahs-8094	331	30	al	al	PROPN
ahs-8094	331	31	.	.	PROPN
ahs-8094	331	32	,	,	PUNCT
ahs-8094	331	33	2010	2010	NUM
ahs-8094	331	34	;	;	PUNCT
ahs-8094	331	35	kim	kim	PROPN
ahs-8094	331	36	et	et	PROPN
ahs-8094	331	37	al	al	PROPN
ahs-8094	331	38	.	.	PROPN
ahs-8094	331	39	,	,	PUNCT
ahs-8094	331	40	2017	2017	NUM
ahs-8094	331	41	)	)	PUNCT
ahs-8094	331	42	.	.	PUNCT
ahs-8094	332	1	however	however	ADV
ahs-8094	332	2	,	,	PUNCT
ahs-8094	332	3	genes	gene	NOUN
ahs-8094	332	4	responsi­	responsi­	NOUN
ahs-8094	332	5	ble	ble	ADJ
ahs-8094	332	6	for	for	ADP
ahs-8094	332	7	their	their	PRON
ahs-8094	332	8	resistance	resistance	NOUN
ahs-8094	332	9	in	in	ADP
ahs-8094	332	10	particular	particular	ADJ
ahs-8094	332	11	for	for	ADP
ahs-8094	332	12	the	the	DET
ahs-8094	332	13	two	two	NUM
ahs-8094	332	14	local	local	ADJ
ahs-8094	332	15	accessions	accession	NOUN
ahs-8094	332	16	are	be	AUX
ahs-8094	332	17	unknown	unknown	ADJ
ahs-8094	332	18	and	and	CCONJ
ahs-8094	332	19	mechanisms	mechanism	NOUN
ahs-8094	332	20	that	that	PRON
ahs-8094	332	21	under­	under­	PROPN
ahs-8094	332	22	lie	lie	VERB
ahs-8094	332	23	their	their	PRON
ahs-8094	332	24	resistance	resistance	NOUN
ahs-8094	332	25	are	be	AUX
ahs-8094	332	26	yet	yet	ADV
ahs-8094	332	27	to	to	PART
ahs-8094	332	28	be	be	AUX
ahs-8094	332	29	understood	understand	VERB
ahs-8094	332	30	.	.	PUNCT
ahs-8094	333	1	this	this	PRON
ahs-8094	333	2	is	be	AUX
ahs-8094	333	3	important	important	ADJ
ahs-8094	333	4	information	information	NOUN
ahs-8094	333	5	that	that	PRON
ahs-8094	333	6	could	could	AUX
ahs-8094	333	7	help	help	VERB
ahs-8094	333	8	to	to	PART
ahs-8094	333	9	determine	determine	VERB
ahs-8094	333	10	useful	useful	ADJ
ahs-8094	333	11	markers	marker	NOUN
ahs-8094	333	12	to	to	PART
ahs-8094	333	13	support	support	VERB
ahs-8094	333	14	breeding	breeding	NOUN
ahs-8094	333	15	processes	process	NOUN
ahs-8094	333	16	.	.	PUNCT
ahs-8094	334	1	aphid	aphid	NOUN
ahs-8094	334	2	species	specie	NOUN
ahs-8094	334	3	are	be	AUX
ahs-8094	334	4	important	important	ADJ
ahs-8094	334	5	agricultural	agricultural	ADJ
ahs-8094	334	6	pests	pest	NOUN
ahs-8094	334	7	because	because	SCONJ
ahs-8094	334	8	they	they	PRON
ahs-8094	334	9	have	have	VERB
ahs-8094	334	10	a	a	DET
ahs-8094	334	11	broad	broad	ADJ
ahs-8094	334	12	host	host	NOUN
ahs-8094	334	13	range	range	NOUN
ahs-8094	334	14	and	and	CCONJ
ahs-8094	334	15	transmit	transmit	VERB
ahs-8094	334	16	many	many	ADJ
ahs-8094	334	17	important	important	ADJ
ahs-8094	334	18	plant	plant	NOUN
ahs-8094	334	19	viruses	virus	NOUN
ahs-8094	334	20	.	.	PUNCT
ahs-8094	335	1	in	in	ADP
ahs-8094	335	2	this	this	DET
ahs-8094	335	3	study	study	NOUN
ahs-8094	335	4	,	,	PUNCT
ahs-8094	335	5	three	three	NUM
ahs-8094	335	6	species	specie	NOUN
ahs-8094	335	7	of	of	ADP
ahs-8094	335	8	aphids	aphid	NOUN
ahs-8094	335	9	were	be	AUX
ahs-8094	335	10	recorded	record	VERB
ahs-8094	335	11	in	in	ADP
ahs-8094	335	12	the	the	DET
ahs-8094	335	13	pepper	pepper	NOUN
ahs-8094	335	14	fields	field	NOUN
ahs-8094	335	15	and	and	CCONJ
ahs-8094	335	16	the	the	DET
ahs-8094	335	17	most	most	ADV
ahs-8094	335	18	abundant	abundant	ADJ
ahs-8094	335	19	in	in	ADP
ahs-8094	335	20	both	both	DET
ahs-8094	335	21	sites	site	NOUN
ahs-8094	335	22	were	be	AUX
ahs-8094	335	23	a.	a.	NOUN
ahs-8094	335	24	gosypii	gosypii	PROPN
ahs-8094	335	25	and	and	CCONJ
ahs-8094	335	26	m.	m.	NOUN
ahs-8094	335	27	euphorbiae	euphorbiae	PROPN
ahs-8094	335	28	.	.	PUNCT
ahs-8094	336	1	these	these	DET
ahs-8094	336	2	findings	finding	NOUN
ahs-8094	336	3	agree	agree	VERB
ahs-8094	336	4	with	with	ADP
ahs-8094	336	5	previ­	previ­	PROPN
ahs-8094	336	6	ous	ous	ADJ
ahs-8094	336	7	studies	study	NOUN
ahs-8094	336	8	by	by	ADP
ahs-8094	336	9	meena	meena	PROPN
ahs-8094	336	10	et	et	PROPN
ahs-8094	336	11	al	al	PROPN
ahs-8094	336	12	.	.	PROPN
ahs-8094	337	1	(	(	PUNCT
ahs-8094	337	2	2013	2013	NUM
ahs-8094	337	3	)	)	PUNCT
ahs-8094	337	4	and	and	CCONJ
ahs-8094	337	5	rajput	rajput	PROPN
ahs-8094	337	6	et	et	PROPN
ahs-8094	337	7	al	al	PROPN
ahs-8094	337	8	.	.	PROPN
ahs-8094	338	1	(	(	PUNCT
ahs-8094	338	2	2017	2017	NUM
ahs-8094	338	3	)	)	PUNCT
ahs-8094	338	4	who	who	PRON
ahs-8094	338	5	reported	report	VERB
ahs-8094	338	6	the	the	DET
ahs-8094	338	7	infestation	infestation	NOUN
ahs-8094	338	8	of	of	ADP
ahs-8094	338	9	hot	hot	ADJ
ahs-8094	338	10	pepper	pepper	NOUN
ahs-8094	338	11	fields	field	NOUN
ahs-8094	338	12	with	with	ADP
ahs-8094	338	13	a.	a.	NOUN
ahs-8094	338	14	gosypii	gosypii	PROPN
ahs-8094	338	15	in	in	ADP
ahs-8094	338	16	india	india	PROPN
ahs-8094	338	17	.	.	PUNCT
ahs-8094	339	1	similar	similar	ADJ
ahs-8094	339	2	results	result	NOUN
ahs-8094	339	3	on	on	ADP
ahs-8094	339	4	m.	m.	NOUN
ahs-8094	339	5	euphorbiae	euphorbiae	NOUN
ahs-8094	339	6	were	be	AUX
ahs-8094	339	7	reported	report	VERB
ahs-8094	339	8	by	by	ADP
ahs-8094	339	9	djieto­lordon	djieto­lordon	PROPN
ahs-8094	339	10	et	et	PROPN
ahs-8094	339	11	al	al	PROPN
ahs-8094	339	12	.	.	PROPN
ahs-8094	340	1	(	(	PUNCT
ahs-8094	340	2	2014	2014	NUM
ahs-8094	340	3	)	)	PUNCT
ahs-8094	340	4	in	in	ADP
ahs-8094	340	5	cameroon	cameroon	NOUN
ahs-8094	340	6	.	.	PUNCT
ahs-8094	341	1	the	the	DET
ahs-8094	341	2	presence	presence	NOUN
ahs-8094	341	3	of	of	ADP
ahs-8094	341	4	a.	a.	NOUN
ahs-8094	341	5	pisum	pisum	NOUN
ahs-8094	341	6	in	in	ADP
ahs-8094	341	7	gashora	gashora	NOUN
ahs-8094	341	8	was	be	AUX
ahs-8094	341	9	understandable	understandable	ADJ
ahs-8094	341	10	since	since	SCONJ
ahs-8094	341	11	there	there	PRON
ahs-8094	341	12	was	be	VERB
ahs-8094	341	13	a	a	DET
ahs-8094	341	14	pigeon	pigeon	NOUN
ahs-8094	341	15	peas	pea	NOUN
ahs-8094	341	16	field	field	NOUN
ahs-8094	341	17	near	near	ADP
ahs-8094	341	18	the	the	DET
ahs-8094	341	19	experimental	experimental	ADJ
ahs-8094	341	20	plots	plot	NOUN
ahs-8094	341	21	.	.	PUNCT
ahs-8094	342	1	these	these	DET
ahs-8094	342	2	polyphagous	polyphagous	ADJ
ahs-8094	342	3	insects	insect	NOUN
ahs-8094	342	4	belong	belong	VERB
ahs-8094	342	5	to	to	ADP
ahs-8094	342	6	the	the	DET
ahs-8094	342	7	hemiptera	hemiptera	NOUN
ahs-8094	342	8	order	order	NOUN
ahs-8094	342	9	and	and	CCONJ
ahs-8094	342	10	they	they	PRON
ahs-8094	342	11	are	be	AUX
ahs-8094	342	12	important	important	ADJ
ahs-8094	342	13	pests	pest	NOUN
ahs-8094	342	14	because	because	SCONJ
ahs-8094	342	15	of	of	ADP
ahs-8094	342	16	the	the	DET
ahs-8094	342	17	ability	ability	NOUN
ahs-8094	342	18	to	to	PART
ahs-8094	342	19	transmit	transmit	VERB
ahs-8094	342	20	several	several	ADJ
ahs-8094	342	21	viruses	virus	NOUN
ahs-8094	342	22	in	in	ADP
ahs-8094	342	23	pepper	pepper	NOUN
ahs-8094	342	24	.	.	PUNCT
ahs-8094	343	1	according	accord	VERB
ahs-8094	343	2	to	to	ADP
ahs-8094	343	3	fajinmi	fajinmi	PROPN
ahs-8094	343	4	et	et	PROPN
ahs-8094	343	5	al	al	PROPN
ahs-8094	343	6	.	.	PROPN
ahs-8094	344	1	(	(	PUNCT
ahs-8094	344	2	2011	2011	NUM
ahs-8094	344	3	)	)	PUNCT
ahs-8094	344	4	;	;	PUNCT
ahs-8094	344	5	dombrovsky	dombrovsky	PROPN
ahs-8094	344	6	et	et	PROPN
ahs-8094	344	7	al	al	PROPN
ahs-8094	344	8	.	.	PROPN
ahs-8094	345	1	(	(	PUNCT
ahs-8094	345	2	2010	2010	NUM
ahs-8094	345	3	)	)	PUNCT
ahs-8094	345	4	and	and	CCONJ
ahs-8094	345	5	zitter	zitter	NOUN
ahs-8094	345	6	and	and	CCONJ
ahs-8094	345	7	murphy	murphy	PROPN
ahs-8094	345	8	,	,	PUNCT
ahs-8094	345	9	(	(	PUNCT
ahs-8094	345	10	2009	2009	NUM
ahs-8094	345	11	)	)	PUNCT
ahs-8094	345	12	a.	a.	NOUN
ahs-8094	345	13	gosypii	gosypii	NOUN
ahs-8094	345	14	efficiently	efficiently	ADV
ahs-8094	345	15	trans­	trans­	X
ahs-8094	345	16	mits	mit	NOUN
ahs-8094	345	17	cmv	cmv	PROPN
ahs-8094	345	18	,	,	PUNCT
ahs-8094	345	19	pevyv	pevyv	NOUN
ahs-8094	345	20	,	,	PUNCT
ahs-8094	345	21	and	and	CCONJ
ahs-8094	345	22	pvmv	pvmv	NOUN
ahs-8094	345	23	which	which	PRON
ahs-8094	345	24	were	be	AUX
ahs-8094	345	25	detected	detect	VERB
ahs-8094	345	26	in	in	ADP
ahs-8094	345	27	this	this	DET
ahs-8094	345	28	study	study	NOUN
ahs-8094	345	29	.	.	PUNCT
ahs-8094	346	1	there	there	PRON
ahs-8094	346	2	was	be	VERB
ahs-8094	346	3	no	no	DET
ahs-8094	346	4	difference	difference	NOUN
ahs-8094	346	5	in	in	ADP
ahs-8094	346	6	genotypes	genotype	NOUN
ahs-8094	346	7	infestation	infestation	NOUN
ahs-8094	346	8	by	by	ADP
ahs-8094	346	9	the	the	DET
ahs-8094	346	10	aphids	aphid	NOUN
ahs-8094	346	11	.	.	PUNCT
ahs-8094	347	1	besides	besides	ADV
ahs-8094	347	2	,	,	PUNCT
ahs-8094	347	3	complete	complete	ADJ
ahs-8094	347	4	genotype	genotype	NOUN
ahs-8094	347	5	resistance	resistance	NOUN
ahs-8094	347	6	to	to	PART
ahs-8094	347	7	aphids	aphids	VERB
ahs-8094	347	8	’	'	PUNCT
ahs-8094	347	9	infestation	infestation	NOUN
ahs-8094	347	10	was	be	AUX
ahs-8094	347	11	not	not	PART
ahs-8094	347	12	recorded	record	VERB
ahs-8094	347	13	in	in	ADP
ahs-8094	347	14	any	any	PRON
ahs-8094	347	15	of	of	ADP
ahs-8094	347	16	the	the	DET
ahs-8094	347	17	genotypes	genotype	NOUN
ahs-8094	347	18	tested	test	VERB
ahs-8094	347	19	.	.	PUNCT
ahs-8094	348	1	bird­eye	bird­eye	PROPN
ahs-8094	348	2	hybrid	hybrid	NOUN
ahs-8094	348	3	was	be	AUX
ahs-8094	348	4	the	the	DET
ahs-8094	348	5	less	less	ADV
ahs-8094	348	6	pre­	pre­	NOUN
ahs-8094	348	7	ferred	ferre	VERB
ahs-8094	348	8	by	by	ADP
ahs-8094	348	9	the	the	DET
ahs-8094	348	10	aphids	aphid	NOUN
ahs-8094	348	11	(	(	PUNCT
ahs-8094	348	12	4.4	4.4	NUM
ahs-8094	348	13	aphids	aphids	PROPN
ahs-8094	348	14	/	/	SYM
ahs-8094	348	15	plant	plant	NOUN
ahs-8094	348	16	)	)	PUNCT
ahs-8094	348	17	followed	follow	VERB
ahs-8094	348	18	by	by	ADP
ahs-8094	348	19	00767ppr	00767ppr	NOUN
ahs-8094	348	20	(	(	PUNCT
ahs-8094	348	21	5.3	5.3	NUM
ahs-8094	348	22	aphids	aphids	PROPN
ahs-8094	348	23	/	/	SYM
ahs-8094	348	24	plant	plant	NOUN
ahs-8094	348	25	)	)	PUNCT
ahs-8094	348	26	and	and	CCONJ
ahs-8094	348	27	red	red	ADJ
ahs-8094	348	28	scotch	scotch	NOUN
ahs-8094	348	29	bonnet	bonnet	NOUN
ahs-8094	348	30	(	(	PUNCT
ahs-8094	348	31	9.9	9.9	NUM
ahs-8094	348	32	aphids	aphids	PROPN
ahs-8094	348	33	/	/	SYM
ahs-8094	348	34	plant	plant	NOUN
ahs-8094	348	35	)	)	PUNCT
ahs-8094	348	36	while	while	SCONJ
ahs-8094	348	37	the	the	DET
ahs-8094	348	38	most	most	ADV
ahs-8094	348	39	preferred	preferred	ADJ
ahs-8094	348	40	was	be	AUX
ahs-8094	348	41	genotype	genotype	NOUN
ahs-8094	348	42	hp	hp	ADJ
ahs-8094	348	43	0117	0117	NUM
ahs-8094	348	44	(	(	PUNCT
ahs-8094	348	45	56.8	56.8	NUM
ahs-8094	348	46	aphids	aphid	NOUN
ahs-8094	348	47	/	/	SYM
ahs-8094	348	48	plant	plant	NOUN
ahs-8094	348	49	)	)	PUNCT
ahs-8094	348	50	followed	follow	VERB
ahs-8094	348	51	by	by	ADP
ahs-8094	348	52	california	california	PROPN
ahs-8094	348	53	wonder	wonder	PROPN
ahs-8094	348	54	(	(	PUNCT
ahs-8094	348	55	43.5	43.5	NUM
ahs-8094	348	56	aphids	aphids	PROPN
ahs-8094	348	57	/	/	SYM
ahs-8094	348	58	plant	plant	NOUN
ahs-8094	348	59	)	)	PUNCT
ahs-8094	348	60	and	and	CCONJ
ahs-8094	348	61	00786ppr	00786ppr	NOUN
ahs-8094	348	62	(	(	PUNCT
ahs-8094	348	63	32.2	32.2	NUM
ahs-8094	348	64	aphids	aphid	NOUN
ahs-8094	348	65	/	/	SYM
ahs-8094	348	66	plant	plant	NOUN
ahs-8094	348	67	)	)	PUNCT
ahs-8094	348	68	.	.	PUNCT
ahs-8094	349	1	unlike	unlike	ADP
ahs-8094	349	2	other	other	ADJ
ahs-8094	349	3	plant	plant	NOUN
ahs-8094	349	4	species	specie	NOUN
ahs-8094	349	5	such	such	ADJ
ahs-8094	349	6	as	as	ADP
ahs-8094	349	7	soybean	soybean	NOUN
ahs-8094	349	8	where	where	SCONJ
ahs-8094	349	9	a	a	DET
ahs-8094	349	10	lot	lot	NOUN
ahs-8094	349	11	has	have	AUX
ahs-8094	349	12	been	be	AUX
ahs-8094	349	13	done	do	VERB
ahs-8094	349	14	on	on	ADP
ahs-8094	349	15	resistance	resistance	NOUN
ahs-8094	349	16	to	to	ADP
ahs-8094	349	17	aphids	aphids	PROPN
ahs-8094	349	18	(	(	PUNCT
ahs-8094	349	19	hill	hill	NOUN
ahs-8094	349	20	et	et	PROPN
ahs-8094	349	21	al	al	PROPN
ahs-8094	349	22	.	.	PROPN
ahs-8094	349	23	,	,	PUNCT
ahs-8094	349	24	2004	2004	NUM
ahs-8094	349	25	)	)	PUNCT
ahs-8094	349	26	,	,	PUNCT
ahs-8094	349	27	only	only	ADV
ahs-8094	349	28	a	a	DET
ahs-8094	349	29	few	few	ADJ
ahs-8094	349	30	studies	study	NOUN
ahs-8094	349	31	have	have	AUX
ahs-8094	349	32	been	be	AUX
ahs-8094	349	33	conducted	conduct	VERB
ahs-8094	349	34	on	on	ADP
ahs-8094	349	35	pepper	pepper	NOUN
ahs-8094	349	36	(	(	PUNCT
ahs-8094	349	37	frantz	frantz	PROPN
ahs-8094	349	38	et	et	PROPN
ahs-8094	349	39	al	al	PROPN
ahs-8094	349	40	.	.	PROPN
ahs-8094	349	41	,	,	PUNCT
ahs-8094	349	42	2004	2004	NUM
ahs-8094	349	43	;	;	PUNCT
ahs-8094	349	44	sun	sun	PROPN
ahs-8094	349	45	et	et	PROPN
ahs-8094	349	46	al	al	PROPN
ahs-8094	349	47	.	.	PROPN
ahs-8094	349	48	,	,	PUNCT
ahs-8094	349	49	2018	2018	NUM
ahs-8094	349	50	)	)	PUNCT
ahs-8094	349	51	.	.	PUNCT
ahs-8094	350	1	sun	sun	PROPN
ahs-8094	350	2	et	et	PROPN
ahs-8094	350	3	al	al	PROPN
ahs-8094	350	4	.	.	PROPN
ahs-8094	350	5	(	(	PUNCT
ahs-8094	350	6	2018	2018	NUM
ahs-8094	350	7	)	)	PUNCT
ahs-8094	350	8	,	,	PUNCT
ahs-8094	350	9	in	in	ADP
ahs-8094	350	10	their	their	PRON
ahs-8094	350	11	studies	study	NOUN
ahs-8094	350	12	,	,	PUNCT
ahs-8094	350	13	identi­	identi­	X
ahs-8094	350	14	fied	fie	VERB
ahs-8094	350	15	c.	c.	PROPN
ahs-8094	350	16	baccatum	baccatum	PROPN
ahs-8094	350	17	accession	accession	NOUN
ahs-8094	350	18	pb2013071	pb2013071	NOUN
ahs-8094	350	19	as	as	ADP
ahs-8094	350	20	highly	highly	ADV
ahs-8094	350	21	resistant	resistant	ADJ
ahs-8094	350	22	,	,	PUNCT
ahs-8094	350	23	while	while	SCONJ
ahs-8094	350	24	the	the	DET
ahs-8094	350	25	accessions	accession	NOUN
ahs-8094	350	26	pb2013062	pb2013062	NOUN
ahs-8094	350	27	and	and	CCONJ
ahs-8094	350	28	pb2012022	pb2012022	NOUN
ahs-8094	350	29	as	as	ADP
ahs-8094	350	30	intermediate	intermediate	ADJ
ahs-8094	350	31	resistant	resistant	ADJ
ahs-8094	350	32	to	to	ADP
ahs-8094	350	33	m.	m.	NOUN
ahs-8094	350	34	persicae	persicae	PROPN
ahs-8094	350	35	under	under	ADP
ahs-8094	350	36	screen	screen	NOUN
ahs-8094	350	37	house	house	NOUN
ahs-8094	350	38	conditions	condition	NOUN
ahs-8094	350	39	.	.	PUNCT
ahs-8094	351	1	recently	recently	ADV
ahs-8094	351	2	,	,	PUNCT
ahs-8094	351	3	quantita­	quantita­	ADP
ahs-8094	351	4	tive	tive	NOUN
ahs-8094	351	5	trait	trait	NOUN
ahs-8094	351	6	loci	loci	NOUN
ahs-8094	351	7	(	(	PUNCT
ahs-8094	351	8	qtls	qtls	PROPN
ahs-8094	351	9	)	)	PUNCT
ahs-8094	351	10	conferring	confer	VERB
ahs-8094	351	11	resistance	resistance	NOUN
ahs-8094	351	12	to	to	ADP
ahs-8094	351	13	m.	m.	NOUN
ahs-8094	351	14	persi‐	persi‐	PROPN
ahs-8094	352	1	cae	cae	PROPN
ahs-8094	352	2	in	in	ADP
ahs-8094	352	3	pepper	pepper	NOUN
ahs-8094	352	4	was	be	AUX
ahs-8094	352	5	detected	detect	VERB
ahs-8094	352	6	(	(	PUNCT
ahs-8094	352	7	sun	sun	PROPN
ahs-8094	352	8	et	et	PROPN
ahs-8094	352	9	al	al	PROPN
ahs-8094	352	10	.	.	PROPN
ahs-8094	352	11	,	,	PUNCT
ahs-8094	352	12	2019	2019	NUM
ahs-8094	352	13	)	)	PUNCT
ahs-8094	352	14	.	.	PUNCT
ahs-8094	353	1	in	in	ADP
ahs-8094	353	2	the	the	DET
ahs-8094	353	3	present	present	ADJ
ahs-8094	353	4	study	study	NOUN
ahs-8094	353	5	,	,	PUNCT
ahs-8094	353	6	prevailing	prevail	VERB
ahs-8094	353	7	weather	weather	NOUN
ahs-8094	353	8	conditions	condition	NOUN
ahs-8094	353	9	,	,	PUNCT
ahs-8094	353	10	espe­	espe­	VERB
ahs-8094	353	11	cially	cially	ADV
ahs-8094	353	12	at	at	ADP
ahs-8094	353	13	the	the	DET
ahs-8094	353	14	gashora	gashora	NOUN
ahs-8094	353	15	site	site	NOUN
ahs-8094	353	16	,	,	PUNCT
ahs-8094	353	17	negatively	negatively	ADV
ahs-8094	353	18	affected	affect	VERB
ahs-8094	353	19	the	the	DET
ahs-8094	353	20	population	population	NOUN
ahs-8094	353	21	of	of	ADP
ahs-8094	353	22	aphids	aphid	NOUN
ahs-8094	353	23	leading	lead	VERB
ahs-8094	353	24	to	to	ADP
ahs-8094	353	25	low	low	ADJ
ahs-8094	353	26	infestation	infestation	NOUN
ahs-8094	353	27	on	on	ADP
ahs-8094	353	28	pepper	pepper	NOUN
ahs-8094	353	29	plants	plant	NOUN
ahs-8094	353	30	.	.	PUNCT
ahs-8094	354	1	thus	thus	ADV
ahs-8094	354	2	,	,	PUNCT
ahs-8094	354	3	further	further	ADJ
ahs-8094	354	4	efforts	effort	NOUN
ahs-8094	354	5	are	be	AUX
ahs-8094	354	6	needed	need	VERB
ahs-8094	354	7	to	to	PART
ahs-8094	354	8	identify	identify	VERB
ahs-8094	354	9	and	and	CCONJ
ahs-8094	354	10	validate	validate	VERB
ahs-8094	354	11	the	the	DET
ahs-8094	354	12	resistance	resistance	NOUN
ahs-8094	354	13	of	of	ADP
ahs-8094	354	14	these	these	DET
ahs-8094	354	15	geno­	geno­	NOUN
ahs-8094	354	16	types	type	NOUN
ahs-8094	354	17	to	to	PART
ahs-8094	354	18	aphids	aphid	NOUN
ahs-8094	354	19	under	under	ADP
ahs-8094	354	20	controlled	control	VERB
ahs-8094	354	21	and	and	CCONJ
ahs-8094	354	22	uncontrolled	uncontrolled	ADJ
ahs-8094	354	23	conditions	condition	NOUN
ahs-8094	354	24	.	.	PUNCT
ahs-8094	355	1	most	most	ADJ
ahs-8094	355	2	of	of	ADP
ahs-8094	355	3	the	the	DET
ahs-8094	355	4	varieties	variety	NOUN
ahs-8094	355	5	grown	grow	VERB
ahs-8094	355	6	in	in	ADP
ahs-8094	355	7	the	the	DET
ahs-8094	355	8	country	country	NOUN
ahs-8094	355	9	includ­	includ­	PROPN
ahs-8094	355	10	ing	e	VERB
ahs-8094	355	11	the	the	DET
ahs-8094	355	12	commonly	commonly	ADV
ahs-8094	355	13	grown	grow	VERB
ahs-8094	355	14	commercial	commercial	ADJ
ahs-8094	355	15	varieties	variety	NOUN
ahs-8094	355	16	were	be	AUX
ahs-8094	355	17	found	find	VERB
ahs-8094	355	18	to	to	PART
ahs-8094	355	19	be	be	AUX
ahs-8094	355	20	susceptible	susceptible	ADJ
ahs-8094	355	21	to	to	ADP
ahs-8094	355	22	viral	viral	ADJ
ahs-8094	355	23	diseases	disease	NOUN
ahs-8094	355	24	.	.	PUNCT
ahs-8094	356	1	a	a	DET
ahs-8094	356	2	relatively	relatively	ADV
ahs-8094	356	3	higher	high	ADJ
ahs-8094	356	4	number	number	NOUN
ahs-8094	356	5	of	of	ADP
ahs-8094	356	6	resistant	resistant	ADJ
ahs-8094	356	7	lines	line	NOUN
ahs-8094	356	8	from	from	ADP
ahs-8094	356	9	introduced	introduce	VERB
ahs-8094	356	10	material	material	NOUN
ahs-8094	356	11	indicates	indicate	VERB
ahs-8094	356	12	that	that	SCONJ
ahs-8094	356	13	the	the	DET
ahs-8094	356	14	world	world	NOUN
ahs-8094	356	15	vegetable	vegetable	NOUN
ahs-8094	356	16	center	center	NOUN
ahs-8094	356	17	germplasm	germplasm	NOUN
ahs-8094	356	18	collection	collection	NOUN
ahs-8094	356	19	has	have	VERB
ahs-8094	356	20	a	a	DET
ahs-8094	356	21	wider	wide	ADJ
ahs-8094	356	22	genetic	genetic	ADJ
ahs-8094	356	23	base	base	NOUN
ahs-8094	356	24	than	than	ADP
ahs-8094	356	25	local	local	ADJ
ahs-8094	356	26	material	material	NOUN
ahs-8094	356	27	.	.	PUNCT
ahs-8094	357	1	since	since	SCONJ
ahs-8094	357	2	viruses	virus	NOUN
ahs-8094	357	3	cause	cause	VERB
ahs-8094	357	4	serious	serious	ADJ
ahs-8094	357	5	diseases	disease	NOUN
ahs-8094	357	6	of	of	ADP
ahs-8094	357	7	hot	hot	ADJ
ahs-8094	357	8	pepper	pepper	NOUN
ahs-8094	357	9	around	around	ADP
ahs-8094	357	10	the	the	DET
ahs-8094	357	11	world	world	NOUN
ahs-8094	357	12	,	,	PUNCT
ahs-8094	357	13	the	the	DET
ahs-8094	357	14	results	result	NOUN
ahs-8094	357	15	of	of	ADP
ahs-8094	357	16	this	this	DET
ahs-8094	357	17	study	study	NOUN
ahs-8094	357	18	may	may	AUX
ahs-8094	357	19	be	be	AUX
ahs-8094	357	20	promising	promise	VERB
ahs-8094	357	21	and	and	CCONJ
ahs-8094	357	22	could	could	AUX
ahs-8094	357	23	be	be	AUX
ahs-8094	357	24	used	use	VERB
ahs-8094	357	25	in	in	ADP
ahs-8094	357	26	the	the	DET
ahs-8094	357	27	for­	for­	PROPN
ahs-8094	357	28	adv	adv	PROPN
ahs-8094	357	29	.	.	PUNCT
ahs-8094	357	30	hort	hort	PROPN
ahs-8094	357	31	.	.	PUNCT
ahs-8094	358	1	sci	sci	PROPN
ahs-8094	358	2	.	.	PROPN
ahs-8094	358	3	,	,	PUNCT
ahs-8094	358	4	2020	2020	NUM
ahs-8094	358	5	34(4	34(4	NUM
ahs-8094	358	6	):	):	PUNCT
ahs-8094	358	7	397­412	397­412	NUM
ahs-8094	358	8	410	410	NUM
ahs-8094	358	9	mulation	mulation	NOUN
ahs-8094	358	10	of	of	ADP
ahs-8094	358	11	integrated	integrate	VERB
ahs-8094	358	12	control	control	NOUN
ahs-8094	358	13	strategies	strategy	NOUN
ahs-8094	358	14	for	for	ADP
ahs-8094	358	15	the	the	DET
ahs-8094	358	16	management	management	NOUN
ahs-8094	358	17	of	of	ADP
ahs-8094	358	18	these	these	DET
ahs-8094	358	19	destructive	destructive	ADJ
ahs-8094	358	20	1diseases	1disease	NOUN
ahs-8094	358	21	.	.	PUNCT
ahs-8094	359	1	the	the	DET
ahs-8094	359	2	use	use	NOUN
ahs-8094	359	3	of	of	ADP
ahs-8094	359	4	resistant	resistant	ADJ
ahs-8094	359	5	pepper	pepper	NOUN
ahs-8094	359	6	genotypes	genotype	NOUN
ahs-8094	359	7	to	to	PART
ahs-8094	359	8	manage	manage	VERB
ahs-8094	359	9	the	the	DET
ahs-8094	359	10	viral	viral	ADJ
ahs-8094	359	11	diseases	disease	NOUN
ahs-8094	359	12	can	can	AUX
ahs-8094	359	13	potentially	potentially	ADV
ahs-8094	359	14	replace	replace	VERB
ahs-8094	359	15	or	or	CCONJ
ahs-8094	359	16	minimize	minimize	VERB
ahs-8094	359	17	the	the	DET
ahs-8094	359	18	application	application	NOUN
ahs-8094	359	19	of	of	ADP
ahs-8094	359	20	harmful	harmful	ADJ
ahs-8094	359	21	pesticides	pesticide	NOUN
ahs-8094	359	22	and	and	CCONJ
ahs-8094	359	23	could	could	AUX
ahs-8094	359	24	be	be	AUX
ahs-8094	359	25	used	use	VERB
ahs-8094	359	26	as	as	ADP
ahs-8094	359	27	an	an	DET
ahs-8094	359	28	important	important	ADJ
ahs-8094	359	29	component	component	NOUN
ahs-8094	359	30	of	of	ADP
ahs-8094	359	31	integrated	integrate	VERB
ahs-8094	359	32	pest	pest	NOUN
ahs-8094	359	33	man­	man­	NOUN
ahs-8094	359	34	agement	agement	PROPN
ahs-8094	359	35	(	(	PUNCT
ahs-8094	359	36	ipm	ipm	NOUN
ahs-8094	359	37	)	)	PUNCT
ahs-8094	359	38	which	which	PRON
ahs-8094	359	39	is	be	AUX
ahs-8094	359	40	a	a	DET
ahs-8094	359	41	promising	promising	ADJ
ahs-8094	359	42	approach	approach	NOUN
ahs-8094	359	43	to	to	ADP
ahs-8094	359	44	sus­	sus­	NOUN
ahs-8094	359	45	tainable	tainable	ADJ
ahs-8094	359	46	agriculture	agriculture	NOUN
ahs-8094	359	47	.	.	PUNCT
ahs-8094	360	1	in	in	ADP
ahs-8094	360	2	the	the	DET
ahs-8094	360	3	present	present	ADJ
ahs-8094	360	4	study	study	NOUN
ahs-8094	360	5	,	,	PUNCT
ahs-8094	360	6	three	three	NUM
ahs-8094	360	7	genotypes	genotype	NOUN
ahs-8094	360	8	00767ppr	00767ppr	NOUN
ahs-8094	360	9	,	,	PUNCT
ahs-8094	360	10	00802ppr	00802ppr	NOUN
ahs-8094	360	11	and	and	CCONJ
ahs-8094	360	12	pbc	pbc	PROPN
ahs-8094	360	13	462	462	NUM
ahs-8094	360	14	consistently	consistently	ADV
ahs-8094	360	15	rated	rate	VERB
ahs-8094	360	16	as	as	ADV
ahs-8094	360	17	resistant	resistant	ADJ
ahs-8094	360	18	to	to	ADP
ahs-8094	360	19	viral	viral	ADJ
ahs-8094	360	20	diseases	disease	NOUN
ahs-8094	360	21	while	while	SCONJ
ahs-8094	360	22	genotype	genotype	NOUN
ahs-8094	360	23	hp	hp	PROPN
ahs-8094	360	24	0117	0117	NUM
ahs-8094	360	25	,	,	PUNCT
ahs-8094	360	26	pp9852­170	pp9852­170	PROPN
ahs-8094	360	27	,	,	PUNCT
ahs-8094	360	28	pp9950­5197	pp9950­5197	PROPN
ahs-8094	360	29	and	and	CCONJ
ahs-8094	360	30	icpn	icpn	PROPN
ahs-8094	360	31	18­7	18­7	NUM
ahs-8094	360	32	were	be	AUX
ahs-8094	360	33	moderately	moderately	ADV
ahs-8094	360	34	resistant	resistant	ADJ
ahs-8094	360	35	under	under	ADP
ahs-8094	360	36	field	field	NOUN
ahs-8094	360	37	and	and	CCONJ
ahs-8094	360	38	screenhouse	screenhouse	NOUN
ahs-8094	360	39	conditions	condition	NOUN
ahs-8094	360	40	.	.	PUNCT
ahs-8094	361	1	as	as	SCONJ
ahs-8094	361	2	revealed	reveal	VERB
ahs-8094	361	3	from	from	ADP
ahs-8094	361	4	the	the	DET
ahs-8094	361	5	study	study	NOUN
ahs-8094	361	6	,	,	PUNCT
ahs-8094	361	7	most	most	ADJ
ahs-8094	361	8	of	of	ADP
ahs-8094	361	9	the	the	DET
ahs-8094	361	10	local	local	ADJ
ahs-8094	361	11	genotypes	genotype	NOUN
ahs-8094	361	12	and	and	CCONJ
ahs-8094	361	13	all	all	PRON
ahs-8094	361	14	of	of	ADP
ahs-8094	361	15	the	the	DET
ahs-8094	361	16	commercially	commercially	ADV
ahs-8094	361	17	grown	grow	VERB
ahs-8094	361	18	pepper	pepper	NOUN
ahs-8094	361	19	genotypes	genotype	NOUN
ahs-8094	361	20	tested	test	VERB
ahs-8094	361	21	were	be	AUX
ahs-8094	361	22	susceptible	susceptible	ADJ
ahs-8094	361	23	.	.	PUNCT
ahs-8094	362	1	therefore	therefore	ADV
ahs-8094	362	2	,	,	PUNCT
ahs-8094	362	3	the	the	DET
ahs-8094	362	4	identified	identify	VERB
ahs-8094	362	5	genotypes	genotype	NOUN
ahs-8094	362	6	especially	especially	ADV
ahs-8094	362	7	the	the	DET
ahs-8094	362	8	ones	one	NOUN
ahs-8094	362	9	from	from	ADP
ahs-8094	362	10	world	world	NOUN
ahs-8094	362	11	vegetable	vegetable	NOUN
ahs-8094	362	12	center	center	NOUN
ahs-8094	362	13	are	be	AUX
ahs-8094	362	14	recommended	recommend	VERB
ahs-8094	362	15	for	for	ADP
ahs-8094	362	16	adoption	adoption	NOUN
ahs-8094	362	17	by	by	ADP
ahs-8094	362	18	growers	grower	NOUN
ahs-8094	362	19	.	.	PUNCT
ahs-8094	363	1	the	the	DET
ahs-8094	363	2	two	two	NUM
ahs-8094	363	3	local	local	ADJ
ahs-8094	363	4	collections	collection	NOUN
ahs-8094	363	5	00767ppr	00767ppr	NOUN
ahs-8094	363	6	and	and	CCONJ
ahs-8094	363	7	00802ppr	00802ppr	NOUN
ahs-8094	363	8	are	be	AUX
ahs-8094	363	9	not	not	PART
ahs-8094	363	10	preferred	preferred	ADJ
ahs-8094	363	11	cultivars	cultivar	NOUN
ahs-8094	363	12	for	for	ADP
ahs-8094	363	13	commercial	commercial	ADJ
ahs-8094	363	14	production	production	NOUN
ahs-8094	363	15	and	and	CCONJ
ahs-8094	363	16	thus	thus	ADV
ahs-8094	363	17	,	,	PUNCT
ahs-8094	363	18	they	they	PRON
ahs-8094	363	19	can	can	AUX
ahs-8094	363	20	be	be	AUX
ahs-8094	363	21	utilized	utilize	VERB
ahs-8094	363	22	in	in	ADP
ahs-8094	363	23	breeding	breeding	NOUN
ahs-8094	363	24	programs	program	NOUN
ahs-8094	363	25	as	as	ADP
ahs-8094	363	26	potential	potential	ADJ
ahs-8094	363	27	sources	source	NOUN
ahs-8094	363	28	for	for	ADP
ahs-8094	363	29	virus	virus	NOUN
ahs-8094	363	30	resistance	resistance	NOUN
ahs-8094	363	31	.	.	PUNCT
ahs-8094	364	1	farmers	farmer	NOUN
ahs-8094	364	2	should	should	AUX
ahs-8094	364	3	be	be	AUX
ahs-8094	364	4	encouraged	encourage	VERB
ahs-8094	364	5	to	to	PART
ahs-8094	364	6	use	use	VERB
ahs-8094	364	7	hot	hot	ADJ
ahs-8094	364	8	pepper	pepper	NOUN
ahs-8094	364	9	varieties	variety	NOUN
ahs-8094	364	10	that	that	PRON
ahs-8094	364	11	are	be	AUX
ahs-8094	364	12	resistant	resistant	ADJ
ahs-8094	364	13	to	to	ADP
ahs-8094	364	14	viruses	virus	NOUN
ahs-8094	364	15	as	as	ADP
ahs-8094	364	16	part	part	NOUN
ahs-8094	364	17	of	of	ADP
ahs-8094	364	18	a	a	DET
ahs-8094	364	19	management	management	NOUN
ahs-8094	364	20	program	program	NOUN
ahs-8094	364	21	to	to	PART
ahs-8094	364	22	maximize	maximize	VERB
ahs-8094	364	23	yields	yield	NOUN
ahs-8094	364	24	.	.	PUNCT
ahs-8094	365	1	further	further	ADJ
ahs-8094	365	2	studies	study	NOUN
ahs-8094	365	3	are	be	AUX
ahs-8094	365	4	needed	need	VERB
ahs-8094	365	5	to	to	PART
ahs-8094	365	6	identify	identify	VERB
ahs-8094	365	7	and	and	CCONJ
ahs-8094	365	8	validate	validate	VERB
ahs-8094	365	9	resistance	resistance	NOUN
ahs-8094	365	10	of	of	ADP
ahs-8094	365	11	the	the	DET
ahs-8094	365	12	tested	test	VERB
ahs-8094	365	13	genotypes	genotype	NOUN
ahs-8094	365	14	to	to	PART
ahs-8094	365	15	aphids	aphids	VERB
ahs-8094	365	16	under	under	ADP
ahs-8094	365	17	controlled	control	VERB
ahs-8094	365	18	and	and	CCONJ
ahs-8094	365	19	uncontrolled	uncontrolled	ADJ
ahs-8094	365	20	conditions	condition	NOUN
ahs-8094	365	21	.	.	PUNCT
ahs-8094	366	1	acknowledgements	acknowledgement	NOUN
ahs-8094	366	2	this	this	DET
ahs-8094	366	3	work	work	NOUN
ahs-8094	366	4	was	be	AUX
ahs-8094	366	5	funded	fund	VERB
ahs-8094	366	6	by	by	ADP
ahs-8094	366	7	the	the	DET
ahs-8094	366	8	united	united	PROPN
ahs-8094	366	9	states	states	PROPN
ahs-8094	366	10	agency	agency	PROPN
ahs-8094	366	11	for	for	ADP
ahs-8094	366	12	international	international	ADJ
ahs-8094	366	13	development	development	NOUN
ahs-8094	366	14	,	,	PUNCT
ahs-8094	366	15	as	as	ADP
ahs-8094	366	16	part	part	NOUN
ahs-8094	366	17	of	of	ADP
ahs-8094	366	18	the	the	DET
ahs-8094	366	19	feed	feed	NOUN
ahs-8094	366	20	the	the	DET
ahs-8094	366	21	future	future	ADJ
ahs-8094	366	22	initiative	initiative	NOUN
ahs-8094	366	23	,	,	PUNCT
ahs-8094	366	24	under	under	ADP
ahs-8094	366	25	the	the	DET
ahs-8094	366	26	cgiar	cgiar	ADJ
ahs-8094	366	27	fund	fund	NOUN
ahs-8094	366	28	,	,	PUNCT
ahs-8094	366	29	award	award	NOUN
ahs-8094	366	30	number	number	NOUN
ahs-8094	366	31	bfs­g­11­00002	bfs­g­11­00002	NOUN
ahs-8094	366	32	,	,	PUNCT
ahs-8094	366	33	and	and	CCONJ
ahs-8094	366	34	the	the	DET
ahs-8094	366	35	predecessor	predecessor	NOUN
ahs-8094	366	36	fund	fund	VERB
ahs-8094	366	37	the	the	DET
ahs-8094	366	38	food	food	NOUN
ahs-8094	366	39	security	security	NOUN
ahs-8094	366	40	and	and	CCONJ
ahs-8094	366	41	crisis	crisis	NOUN
ahs-8094	366	42	mitigation	mitigation	NOUN
ahs-8094	366	43	ii	ii	PROPN
ahs-8094	366	44	grant	grant	PROPN
ahs-8094	366	45	,	,	PUNCT
ahs-8094	366	46	award	award	NOUN
ahs-8094	366	47	number	number	NOUN
ahs-8094	366	48	eem­g­00­04­00013	eem­g­00­04­00013	PROPN
ahs-8094	366	49	;	;	PUNCT
ahs-8094	366	50	with	with	ADP
ahs-8094	366	51	additional	additional	ADJ
ahs-8094	366	52	support	support	NOUN
ahs-8094	366	53	from	from	ADP
ahs-8094	366	54	rwanda	rwanda	PROPN
ahs-8094	366	55	agriculture	agriculture	NOUN
ahs-8094	366	56	and	and	CCONJ
ahs-8094	366	57	animal	animal	NOUN
ahs-8094	366	58	resources	resource	NOUN
ahs-8094	366	59	development	development	PROPN
ahs-8094	366	60	board	board	PROPN
ahs-8094	366	61	(	(	PUNCT
ahs-8094	366	62	rab	rab	PROPN
ahs-8094	366	63	)	)	PUNCT
ahs-8094	366	64	.	.	PUNCT
ahs-8094	367	1	we	we	PRON
ahs-8094	367	2	would	would	AUX
ahs-8094	367	3	like	like	VERB
ahs-8094	367	4	to	to	PART
ahs-8094	367	5	thank	thank	VERB
ahs-8094	367	6	the	the	DET
ahs-8094	367	7	world	world	NOUN
ahs-8094	367	8	vegetable	vegetable	NOUN
ahs-8094	367	9	center	center	NOUN
ahs-8094	367	10	,	,	PUNCT
ahs-8094	367	11	eastern	eastern	ADJ
ahs-8094	367	12	and	and	CCONJ
ahs-8094	367	13	southern	southern	ADJ
ahs-8094	367	14	africa­tanzania	africa­tanzania	NOUN
ahs-8094	367	15	for	for	ADP
ahs-8094	367	16	the	the	DET
ahs-8094	367	17	provision	provision	NOUN
ahs-8094	367	18	of	of	ADP
ahs-8094	367	19	the	the	DET
ahs-8094	367	20	improved	improved	ADJ
ahs-8094	367	21	lines	line	NOUN
ahs-8094	367	22	of	of	ADP
ahs-8094	367	23	hot	hot	ADJ
ahs-8094	367	24	pepper	pepper	NOUN
ahs-8094	367	25	.	.	PUNCT
ahs-8094	368	1	we	we	PRON
ahs-8094	368	2	are	be	AUX
ahs-8094	368	3	also	also	ADV
ahs-8094	368	4	grateful	grateful	ADJ
ahs-8094	368	5	to	to	ADP
ahs-8094	368	6	the	the	DET
ahs-8094	368	7	rwanda	rwanda	PROPN
ahs-8094	368	8	national	national	PROPN
ahs-8094	368	9	genbank	genbank	PROPN
ahs-8094	368	10	for	for	ADP
ahs-8094	368	11	the	the	DET
ahs-8094	368	12	provision	provision	NOUN
ahs-8094	368	13	of	of	ADP
ahs-8094	368	14	the	the	DET
ahs-8094	368	15	local	local	ADJ
ahs-8094	368	16	genotypes	genotype	NOUN
ahs-8094	368	17	.	.	PUNCT
ahs-8094	369	1	references	reference	NOUN
ahs-8094	369	2	aliyu	aliyu	VERB
ahs-8094	369	3	t.h	t.h	PROPN
ahs-8094	369	4	.	.	PROPN
ahs-8094	369	5	,	,	PUNCT
ahs-8094	369	6	2014	2014	NUM
ahs-8094	369	7	­	­	VERB
ahs-8094	369	8	the	the	DET
ahs-8094	369	9	incidence	incidence	NOUN
ahs-8094	369	10	,	,	PUNCT
ahs-8094	369	11	severity	severity	NOUN
ahs-8094	369	12	,	,	PUNCT
ahs-8094	369	13	and	and	CCONJ
ahs-8094	369	14	occurrence	occurrence	NOUN
ahs-8094	369	15	of	of	ADP
ahs-8094	369	16	four	four	NUM
ahs-8094	369	17	viruses	virus	NOUN
ahs-8094	369	18	infecting	infect	VERB
ahs-8094	369	19	pepper	pepper	NOUN
ahs-8094	369	20	(	(	PUNCT
ahs-8094	369	21	capsicum	capsicum	NOUN
ahs-8094	369	22	spp	spp	NOUN
ahs-8094	369	23	.	.	PUNCT
ahs-8094	369	24	)	)	PUNCT
ahs-8094	370	1	in	in	ADP
ahs-8094	370	2	the	the	DET
ahs-8094	370	3	southern	southern	ADJ
ahs-8094	370	4	guinea	guinea	NOUN
ahs-8094	370	5	savannah	savannah	PROPN
ahs-8094	370	6	agro‐ecological	agro‐ecological	PROPN
ahs-8094	370	7	zone	zone	NOUN
ahs-8094	370	8	of	of	ADP
ahs-8094	370	9	nigeria	nigeria	PROPN
ahs-8094	370	10	.	.	PUNCT
ahs-8094	371	1	­	­	PROPN
ahs-8094	371	2	agric	agric	PROPN
ahs-8094	371	3	.	.	PUNCT
ahs-8094	371	4	conspec	conspec	PROPN
ahs-8094	371	5	.	.	PUNCT
ahs-8094	372	1	sci	sci	PROPN
ahs-8094	372	2	.	.	PROPN
ahs-8094	372	3	,	,	PUNCT
ahs-8094	372	4	79	79	NUM
ahs-8094	372	5	:	:	SYM
ahs-8094	373	1	233­237	233­237	NUM
ahs-8094	373	2	.	.	PUNCT
ahs-8094	374	1	allen	allen	PROPN
ahs-8094	374	2	g.c	g.c	PROPN
ahs-8094	374	3	.	.	PROPN
ahs-8094	374	4	,	,	PUNCT
ahs-8094	374	5	flores­vergara	flores­vergara	PROPN
ahs-8094	375	1	m.a	m.a	PROPN
ahs-8094	375	2	.	.	PROPN
ahs-8094	375	3	,	,	PUNCT
ahs-8094	375	4	krasynanski	krasynanski	PROPN
ahs-8094	375	5	s.	s.	PROPN
ahs-8094	375	6	,	,	PUNCT
ahs-8094	375	7	kumar	kumar	PROPN
ahs-8094	375	8	s.	s.	PROPN
ahs-8094	375	9	,	,	PUNCT
ahs-8094	375	10	thompson	thompson	PROPN
ahs-8094	375	11	w.f	w.f	PROPN
ahs-8094	375	12	.	.	PROPN
ahs-8094	375	13	,	,	PUNCT
ahs-8094	375	14	2006	2006	NUM
ahs-8094	375	15	­	­	VERB
ahs-8094	375	16	a	a	DET
ahs-8094	375	17	modified	modify	VERB
ahs-8094	375	18	proto‐	proto‐	PROPN
ahs-8094	375	19	col	col	NOUN
ahs-8094	375	20	for	for	ADP
ahs-8094	375	21	rapid	rapid	ADJ
ahs-8094	375	22	dna	dna	PROPN
ahs-8094	375	23	isolation	isolation	NOUN
ahs-8094	375	24	from	from	ADP
ahs-8094	375	25	plant	plant	NOUN
ahs-8094	375	26	tissues	tissue	NOUN
ahs-8094	375	27	using	use	VERB
ahs-8094	375	28	cetyltrimethylammonium	cetyltrimethylammonium	NOUN
ahs-8094	375	29	bromide	bromide	NOUN
ahs-8094	375	30	.	.	PUNCT
ahs-8094	376	1	­	­	PROPN
ahs-8094	376	2	nat	nat	PROPN
ahs-8094	376	3	.	.	PUNCT
ahs-8094	377	1	protoc	protoc	VERB
ahs-8094	377	2	.	.	PUNCT
ahs-8094	377	3	,	,	PUNCT
ahs-8094	377	4	1(5	1(5	NUM
ahs-8094	377	5	):	):	PUNCT
ahs-8094	377	6	2320­2325	2320­2325	PROPN
ahs-8094	377	7	.	.	PUNCT
ahs-8094	378	1	appiah	appiah	PROPN
ahs-8094	378	2	a.s	a.s	PROPN
ahs-8094	378	3	.	.	PROPN
ahs-8094	378	4	,	,	PUNCT
ahs-8094	378	5	quartey	quartey	PROPN
ahs-8094	378	6	e.k	e.k	PROPN
ahs-8094	378	7	.	.	PROPN
ahs-8094	378	8	,	,	PUNCT
ahs-8094	378	9	amoatey	amoatey	PROPN
ahs-8094	378	10	h.m	h.m	PROPN
ahs-8094	378	11	.	.	PROPN
ahs-8094	378	12	,	,	PUNCT
ahs-8094	378	13	nunekpeku	nunekpeku	PROPN
ahs-8094	378	14	w.	w.	PROPN
ahs-8094	378	15	,	,	PUNCT
ahs-8094	378	16	owusu­ansah	owusu­ansah	NOUN
ahs-8094	378	17	m.	m.	NOUN
ahs-8094	378	18	,	,	PUNCT
ahs-8094	378	19	ofori	ofori	ADV
ahs-8094	378	20	s.	s.	PROPN
ahs-8094	378	21	,	,	PUNCT
ahs-8094	378	22	2014	2014	NUM
ahs-8094	378	23	­	­	NUM
ahs-8094	378	24	response	response	NOUN
ahs-8094	378	25	of	of	ADP
ahs-8094	378	26	nine	nine	NUM
ahs-8094	378	27	cultivars	cultivar	NOUN
ahs-8094	378	28	of	of	ADP
ahs-8094	378	29	pepper	pepper	NOUN
ahs-8094	378	30	(	(	PUNCT
ahs-8094	378	31	capsicum	capsicum	NOUN
ahs-8094	378	32	spp	spp	NOUN
ahs-8094	378	33	.	.	PUNCT
ahs-8094	378	34	)	)	PUNCT
ahs-8094	379	1	to	to	ADP
ahs-8094	379	2	infection	infection	NOUN
ahs-8094	379	3	by	by	ADP
ahs-8094	379	4	four	four	NUM
ahs-8094	379	5	viruses	virus	NOUN
ahs-8094	379	6	under	under	ADP
ahs-8094	379	7	natural	natural	ADJ
ahs-8094	379	8	field	field	NOUN
ahs-8094	379	9	conditions	condition	NOUN
ahs-8094	379	10	in	in	ADP
ahs-8094	379	11	the	the	DET
ahs-8094	379	12	coastal	coastal	ADJ
ahs-8094	379	13	savanna	savanna	NOUN
ahs-8094	379	14	zone	zone	NOUN
ahs-8094	379	15	of	of	ADP
ahs-8094	379	16	ghana	ghana	PROPN
ahs-8094	379	17	.	.	PUNCT
ahs-8094	380	1	­	­	PROPN
ahs-8094	380	2	res	re	NOUN
ahs-8094	380	3	.	.	PUNCT
ahs-8094	381	1	j.	j.	PROPN
ahs-8094	381	2	appl	appl	PROPN
ahs-8094	381	3	.	.	PUNCT
ahs-8094	382	1	sci	sci	PROPN
ahs-8094	382	2	.	.	PUNCT
ahs-8094	383	1	eng	eng	PROPN
ahs-8094	383	2	.	.	PUNCT
ahs-8094	384	1	tech	tech	PROPN
ahs-8094	384	2	.	.	PUNCT
ahs-8094	384	3	,	,	PUNCT
ahs-8094	384	4	7(5	7(5	NUM
ahs-8094	384	5	):	):	PUNCT
ahs-8094	385	1	903­907	903­907	PROPN
ahs-8094	385	2	.	.	PUNCT
ahs-8094	386	1	arogundade	arogundade	PROPN
ahs-8094	386	2	o.	o.	PROPN
ahs-8094	386	3	,	,	PUNCT
ahs-8094	386	4	balogun	balogun	VERB
ahs-8094	386	5	o.s	o.s	PROPN
ahs-8094	386	6	.	.	PROPN
ahs-8094	386	7	,	,	PUNCT
ahs-8094	386	8	kareem	kareem	PROPN
ahs-8094	386	9	k.t	k.t	PROPN
ahs-8094	386	10	.	.	PROPN
ahs-8094	386	11	,	,	PUNCT
ahs-8094	386	12	2012	2012	NUM
ahs-8094	386	13	­	­	NUM
ahs-8094	386	14	occurrence	occurrence	NOUN
ahs-8094	386	15	and	and	CCONJ
ahs-8094	386	16	distribution	distribution	NOUN
ahs-8094	386	17	of	of	ADP
ahs-8094	386	18	pepper	pepper	NOUN
ahs-8094	386	19	veinal	veinal	ADJ
ahs-8094	386	20	mottle	mottle	NOUN
ahs-8094	386	21	virus	virus	NOUN
ahs-8094	386	22	and	and	CCONJ
ahs-8094	386	23	cucumber	cucumber	PROPN
ahs-8094	386	24	mosaic	mosaic	PROPN
ahs-8094	386	25	virus	virus	NOUN
ahs-8094	386	26	in	in	ADP
ahs-8094	386	27	pepper	pepper	NOUN
ahs-8094	386	28	in	in	ADP
ahs-8094	386	29	ibadan	ibadan	PROPN
ahs-8094	386	30	,	,	PUNCT
ahs-8094	386	31	nigeria	nigeria	PROPN
ahs-8094	386	32	.	.	PUNCT
ahs-8094	387	1	­	­	PROPN
ahs-8094	387	2	virol	virol	PROPN
ahs-8094	387	3	.	.	PUNCT
ahs-8094	388	1	j.	j.	PROPN
ahs-8094	388	2	,	,	PUNCT
ahs-8094	388	3	9(1	9(1	NUM
ahs-8094	388	4	):	):	PUNCT
ahs-8094	388	5	79	79	NUM
ahs-8094	388	6	.	.	PUNCT
ahs-8094	388	7	ashfaq	ashfaq	NOUN
ahs-8094	388	8	m.	m.	PROPN
ahs-8094	388	9	,	,	PUNCT
ahs-8094	388	10	iqbal	iqbal	PROPN
ahs-8094	388	11	s.	s.	PROPN
ahs-8094	388	12	,	,	PUNCT
ahs-8094	388	13	mukhtar	mukhtar	PROPN
ahs-8094	388	14	t.	t.	PROPN
ahs-8094	388	15	,	,	PUNCT
ahs-8094	388	16	shah	shah	PROPN
ahs-8094	388	17	h.	h.	PROPN
ahs-8094	388	18	,	,	PUNCT
ahs-8094	388	19	2014	2014	NUM
ahs-8094	388	20	­	­	NOUN
ahs-8094	388	21	screening	screen	VERB
ahs-8094	388	22	for	for	ADP
ahs-8094	388	23	resistance	resistance	NOUN
ahs-8094	388	24	to	to	ADP
ahs-8094	388	25	cucumber	cucumber	PROPN
ahs-8094	388	26	mosaic	mosaic	PROPN
ahs-8094	388	27	cucu‐	cucu‐	NOUN
ahs-8094	388	28	movirus	movirus	NOUN
ahs-8094	388	29	in	in	ADP
ahs-8094	388	30	chilli	chilli	NOUN
ahs-8094	388	31	pepper	pepper	NOUN
ahs-8094	388	32	.	.	PUNCT
ahs-8094	389	1	­	­	PROPN
ahs-8094	389	2	j.	j.	PROPN
ahs-8094	389	3	anim	anim	PROPN
ahs-8094	389	4	.	.	PUNCT
ahs-8094	389	5	&	&	CCONJ
ahs-8094	389	6	plant	plant	PROPN
ahs-8094	389	7	sci	sci	PROPN
ahs-8094	389	8	.	.	PROPN
ahs-8094	389	9	,	,	PUNCT
ahs-8094	389	10	24(3	24(3	NUM
ahs-8094	389	11	):	):	PUNCT
ahs-8094	389	12	791­795	791­795	NUM
ahs-8094	389	13	.	.	PUNCT
ahs-8094	390	1	bandla	bandla	PROPN
ahs-8094	390	2	s.	s.	PROPN
ahs-8094	390	3	,	,	PUNCT
ahs-8094	390	4	beena	beena	PROPN
ahs-8094	390	5	t.	t.	PROPN
ahs-8094	390	6	,	,	PUNCT
ahs-8094	390	7	2018	2018	NUM
ahs-8094	390	8	­	­	NOUN
ahs-8094	390	9	identification	identification	NOUN
ahs-8094	390	10	of	of	ADP
ahs-8094	390	11	host	host	NOUN
ahs-8094	390	12	plant	plant	NOUN
ahs-8094	390	13	resistance	resistance	NOUN
ahs-8094	390	14	to	to	ADP
ahs-8094	390	15	leaf	leaf	NOUN
ahs-8094	390	16	curl	curl	NOUN
ahs-8094	390	17	in	in	ADP
ahs-8094	390	18	chilli	chilli	NOUN
ahs-8094	390	19	(	(	PUNCT
ahs-8094	390	20	capsicum	capsicum	NOUN
ahs-8094	390	21	frutescens	frutescen	VERB
ahs-8094	390	22	l.	l.	PROPN
ahs-8094	390	23	)	)	PUNCT
ahs-8094	390	24	.	.	PUNCT
ahs-8094	391	1	­	­	PROPN
ahs-8094	391	2	int	int	PROPN
ahs-8094	391	3	.	.	PUNCT
ahs-8094	392	1	j.	j.	PROPN
ahs-8094	392	2	curr	curr	PROPN
ahs-8094	392	3	.	.	PUNCT
ahs-8094	393	1	microbiol	microbiol	PROPN
ahs-8094	393	2	.	.	PUNCT
ahs-8094	394	1	appl	appl	PROPN
ahs-8094	394	2	.	.	PUNCT
ahs-8094	395	1	sci	sci	PROPN
ahs-8094	395	2	.	.	PROPN
ahs-8094	395	3	,	,	PUNCT
ahs-8094	395	4	7(8	7(8	NUM
ahs-8094	395	5	):	):	PUNCT
ahs-8094	395	6	2483­2487	2483­2487	NUM
ahs-8094	395	7	.	.	PUNCT
ahs-8094	395	8	bento	bento	PROPN
ahs-8094	395	9	c.s	c.s	PROPN
ahs-8094	395	10	.	.	PROPN
ahs-8094	395	11	,	,	PUNCT
ahs-8094	395	12	rodrigues	rodrigues	PROPN
ahs-8094	395	13	r.	r.	PROPN
ahs-8094	395	14	,	,	PUNCT
ahs-8094	395	15	zerbini	zerbini	PROPN
ahs-8094	395	16	j.f	j.f	PROPN
ahs-8094	395	17	.	.	PROPN
ahs-8094	395	18	,	,	PUNCT
ahs-8094	395	19	sudre	sudre	PROPN
ahs-8094	396	1	c.p	c.p	PROPN
ahs-8094	396	2	.	.	PROPN
ahs-8094	396	3	,	,	PUNCT
ahs-8094	396	4	2009	2009	NUM
ahs-8094	396	5	­	­	NUM
ahs-8094	396	6	sources	source	NOUN
ahs-8094	396	7	of	of	ADP
ahs-8094	396	8	resistance	resistance	NOUN
ahs-8094	396	9	against	against	ADP
ahs-8094	396	10	the	the	DET
ahs-8094	396	11	pepper	pepper	NOUN
ahs-8094	396	12	yellow	yellow	ADJ
ahs-8094	396	13	mosa‐	mosa‐	NOUN
ahs-8094	396	14	ic	ic	PROPN
ahs-8094	396	15	virus	virus	PROPN
ahs-8094	396	16	in	in	ADP
ahs-8094	396	17	chili	chili	NOUN
ahs-8094	396	18	pepper	pepper	NOUN
ahs-8094	396	19	.	.	PUNCT
ahs-8094	397	1	­	­	PROPN
ahs-8094	397	2	hortic	hortic	ADJ
ahs-8094	397	3	.	.	PUNCT
ahs-8094	398	1	bras	bras	PROPN
ahs-8094	398	2	.	.	PUNCT
ahs-8094	398	3	,	,	PUNCT
ahs-8094	398	4	27	27	NUM
ahs-8094	398	5	:	:	PUNCT
ahs-8094	398	6	196­201	196­201	NUM
ahs-8094	398	7	.	.	PUNCT
ahs-8094	399	1	blackman	blackman	PROPN
ahs-8094	399	2	r.l	r.l	PROPN
ahs-8094	399	3	.	.	PROPN
ahs-8094	399	4	,	,	PUNCT
ahs-8094	399	5	eastop	eastop	ADJ
ahs-8094	399	6	v.f	v.f	PROPN
ahs-8094	399	7	.	.	PROPN
ahs-8094	399	8	,	,	PUNCT
ahs-8094	399	9	2000	2000	NUM
ahs-8094	399	10	­	­	VERB
ahs-8094	399	11	aphids	aphid	NOUN
ahs-8094	399	12	on	on	ADP
ahs-8094	399	13	the	the	DET
ahs-8094	399	14	world	world	NOUN
ahs-8094	399	15	’s	’s	PART
ahs-8094	399	16	crops	crop	NOUN
ahs-8094	399	17	:	:	PUNCT
ahs-8094	399	18	an	an	DET
ahs-8094	399	19	identification	identification	NOUN
ahs-8094	399	20	and	and	CCONJ
ahs-8094	399	21	information	information	NOUN
ahs-8094	399	22	guide	guide	NOUN
ahs-8094	399	23	,	,	PUNCT
ahs-8094	399	24	2nd	2nd	PROPN
ahs-8094	399	25	edition	edition	NOUN
ahs-8094	399	26	.	.	PUNCT
ahs-8094	400	1	­	­	PROPN
ahs-8094	400	2	west	west	PROPN
ahs-8094	400	3	sussex	sussex	PROPN
ahs-8094	400	4	,	,	PUNCT
ahs-8094	400	5	england	england	PROPN
ahs-8094	400	6	,	,	PUNCT
ahs-8094	400	7	wiley	wiley	PROPN
ahs-8094	400	8	,	,	PUNCT
ahs-8094	400	9	pp	pp	X
ahs-8094	400	10	.	.	PUNCT
ahs-8094	401	1	466	466	NUM
ahs-8094	401	2	.	.	PUNCT
ahs-8094	402	1	campbell	campbell	PROPN
ahs-8094	402	2	c.l	c.l	PROPN
ahs-8094	402	3	.	.	PROPN
ahs-8094	402	4	,	,	PUNCT
ahs-8094	402	5	madden	madden	PROPN
ahs-8094	402	6	l.v	l.v	PROPN
ahs-8094	402	7	.	.	PROPN
ahs-8094	402	8	,	,	PUNCT
ahs-8094	402	9	1990	1990	NUM
ahs-8094	402	10	­	­	VERB
ahs-8094	402	11	introduction	introduction	NOUN
ahs-8094	402	12	to	to	PART
ahs-8094	402	13	plant	plant	NOUN
ahs-8094	402	14	disease	disease	NOUN
ahs-8094	402	15	epidemiology	epidemiology	NOUN
ahs-8094	402	16	.	.	PUNCT
ahs-8094	403	1	­	­	PROPN
ahs-8094	403	2	wiley	wiley	PROPN
ahs-8094	403	3	,	,	PUNCT
ahs-8094	403	4	new	new	PROPN
ahs-8094	403	5	york	york	PROPN
ahs-8094	403	6	,	,	PUNCT
ahs-8094	403	7	usa	usa	PROPN
ahs-8094	403	8	.	.	PROPN
ahs-8094	403	9	caranta	caranta	PROPN
ahs-8094	403	10	c.	c.	PROPN
ahs-8094	403	11	,	,	PUNCT
ahs-8094	403	12	pflieger	pflieger	NOUN
ahs-8094	403	13	s.	s.	PROPN
ahs-8094	403	14	,	,	PUNCT
ahs-8094	403	15	lefebvre	lefebvre	PROPN
ahs-8094	403	16	v.	v.	PROPN
ahs-8094	403	17	,	,	PUNCT
ahs-8094	403	18	daubeze	daubeze	PROPN
ahs-8094	403	19	a.m.	a.m.	ADV
ahs-8094	403	20	,	,	PUNCT
ahs-8094	403	21	thabuis	thabuis	ADJ
ahs-8094	403	22	a.	a.	NOUN
ahs-8094	403	23	,	,	PUNCT
ahs-8094	403	24	palloix	palloix	PROPN
ahs-8094	403	25	a.	a.	PROPN
ahs-8094	403	26	,	,	PUNCT
ahs-8094	403	27	2002	2002	NUM
ahs-8094	403	28	­	­	NUM
ahs-8094	403	29	qtls	qtl	NOUN
ahs-8094	403	30	involved	involve	VERB
ahs-8094	403	31	in	in	ADP
ahs-8094	403	32	the	the	DET
ahs-8094	403	33	restriction	restriction	NOUN
ahs-8094	403	34	of	of	ADP
ahs-8094	403	35	cucumber	cucumber	PROPN
ahs-8094	403	36	mosaic	mosaic	PROPN
ahs-8094	403	37	virus	virus	NOUN
ahs-8094	403	38	(	(	PUNCT
ahs-8094	403	39	cmv	cmv	NOUN
ahs-8094	403	40	)	)	PUNCT
ahs-8094	403	41	long	long	ADJ
ahs-8094	403	42	dis‐	dis‐	ADP
ahs-8094	403	43	tance	tance	NOUN
ahs-8094	403	44	movement	movement	NOUN
ahs-8094	403	45	in	in	ADP
ahs-8094	403	46	pepper	pepper	NOUN
ahs-8094	403	47	.	.	PUNCT
ahs-8094	404	1	­	­	PROPN
ahs-8094	404	2	theor	theor	PROPN
ahs-8094	404	3	.	.	PUNCT
ahs-8094	405	1	appl	appl	PROPN
ahs-8094	405	2	.	.	PUNCT
ahs-8094	406	1	genet	genet	PROPN
ahs-8094	406	2	.	.	PUNCT
ahs-8094	406	3	,	,	PUNCT
ahs-8094	406	4	104	104	NUM
ahs-8094	406	5	:	:	PUNCT
ahs-8094	406	6	586­591	586­591	NOUN
ahs-8094	406	7	.	.	PUNCT
ahs-8094	407	1	chaim	chaim	PROPN
ahs-8094	407	2	a.b	a.b	PROPN
ahs-8094	407	3	.	.	PROPN
ahs-8094	407	4	,	,	PUNCT
ahs-8094	407	5	grube	grube	PROPN
ahs-8094	407	6	r.c	r.c	PROPN
ahs-8094	407	7	.	.	PROPN
ahs-8094	407	8	,	,	PUNCT
ahs-8094	407	9	lapidot	lapidot	NOUN
ahs-8094	407	10	m.	m.	NOUN
ahs-8094	407	11	,	,	PUNCT
ahs-8094	407	12	jahn	jahn	NOUN
ahs-8094	407	13	m.	m.	PROPN
ahs-8094	407	14	,	,	PUNCT
ahs-8094	407	15	paran	paran	PROPN
ahs-8094	407	16	i.	i.	PROPN
ahs-8094	407	17	,	,	PUNCT
ahs-8094	407	18	2001	2001	NUM
ahs-8094	407	19	­	­	VERB
ahs-8094	407	20	identification	identification	NOUN
ahs-8094	407	21	of	of	ADP
ahs-8094	407	22	quantitative	quantitative	ADJ
ahs-8094	407	23	trait	trait	NOUN
ahs-8094	407	24	loci	loci	NOUN
ahs-8094	407	25	associated	associate	VERB
ahs-8094	407	26	with	with	ADP
ahs-8094	407	27	resistance	resistance	NOUN
ahs-8094	407	28	to	to	ADP
ahs-8094	407	29	cucumber	cucumber	PROPN
ahs-8094	407	30	mosaic	mosaic	PROPN
ahs-8094	407	31	virus	virus	NOUN
ahs-8094	407	32	in	in	ADP
ahs-8094	407	33	capsicum	capsicum	NOUN
ahs-8094	407	34	annuum	annuum	NOUN
ahs-8094	407	35	.	.	PUNCT
ahs-8094	408	1	­	­	PROPN
ahs-8094	408	2	theor	theor	PROPN
ahs-8094	408	3	.	.	PUNCT
ahs-8094	409	1	appl	appl	PROPN
ahs-8094	409	2	.	.	PUNCT
ahs-8094	410	1	genet	genet	PROPN
ahs-8094	410	2	.	.	PUNCT
ahs-8094	411	1	,	,	PUNCT
ahs-8094	411	2	102	102	NUM
ahs-8094	411	3	:	:	SYM
ahs-8094	411	4	1213­1220	1213­1220	NUM
ahs-8094	411	5	.	.	PUNCT
ahs-8094	411	6	choi	choi	PROPN
ahs-8094	411	7	s.	s.	PROPN
ahs-8094	411	8	,	,	PUNCT
ahs-8094	411	9	lee	lee	PROPN
ahs-8094	411	10	j.h	j.h	PROPN
ahs-8094	411	11	.	.	PROPN
ahs-8094	411	12	,	,	PUNCT
ahs-8094	411	13	kang	kang	PROPN
ahs-8094	411	14	w.h	w.h	PROPN
ahs-8094	411	15	.	.	PROPN
ahs-8094	411	16	,	,	PUNCT
ahs-8094	411	17	kim	kim	PROPN
ahs-8094	411	18	j	j	PROPN
ahs-8094	411	19	,	,	PUNCT
ahs-8094	411	20	huy	huy	PROPN
ahs-8094	411	21	h.n	h.n	PROPN
ahs-8094	411	22	.	.	PROPN
ahs-8094	411	23	,	,	PUNCT
ahs-8094	411	24	park	park	PROPN
ahs-8094	411	25	s.w	s.w	PROPN
ahs-8094	411	26	,	,	PUNCT
ahs-8094	411	27	son	son	NOUN
ahs-8094	411	28	e.h	e.h	PROPN
ahs-8094	411	29	,	,	PUNCT
ahs-8094	411	30	kwon	kwon	VERB
ahs-8094	411	31	j.k	j.k	PROPN
ahs-8094	411	32	.	.	PROPN
ahs-8094	411	33	,	,	PUNCT
ahs-8094	411	34	kang	kang	PROPN
ahs-8094	411	35	b.c	b.c	PROPN
ahs-8094	411	36	.	.	PROPN
ahs-8094	411	37	,	,	PUNCT
ahs-8094	411	38	2018	2018	NUM
ahs-8094	411	39	­	­	VERB
ahs-8094	411	40	identification	identification	NOUN
ahs-8094	411	41	of	of	ADP
ahs-8094	411	42	cucumber	cucumber	PROPN
ahs-8094	411	43	mosaic	mosaic	PROPN
ahs-8094	411	44	resistance	resistance	NOUN
ahs-8094	411	45	2	2	NUM
ahs-8094	411	46	(	(	PUNCT
ahs-8094	411	47	cmr2	cmr2	PROPN
ahs-8094	411	48	)	)	PUNCT
ahs-8094	411	49	that	that	PRON
ahs-8094	411	50	confers	confer	VERB
ahs-8094	411	51	resistance	resistance	NOUN
ahs-8094	411	52	to	to	ADP
ahs-8094	411	53	a	a	DET
ahs-8094	411	54	new	new	ADJ
ahs-8094	411	55	cucumber	cucumber	NOUN
ahs-8094	411	56	mosaic	mosaic	PROPN
ahs-8094	411	57	virus	virus	NOUN
ahs-8094	411	58	isolate	isolate	PROPN
ahs-8094	411	59	p1	p1	PROPN
ahs-8094	411	60	(	(	PUNCT
ahs-8094	411	61	cmv‐p1	cmv‐p1	PROPN
ahs-8094	411	62	)	)	PUNCT
ahs-8094	411	63	in	in	ADP
ahs-8094	411	64	pepper	pepper	NOUN
ahs-8094	411	65	(	(	PUNCT
ahs-8094	411	66	capsicum	capsicum	NOUN
ahs-8094	411	67	spp	spp	NOUN
ahs-8094	411	68	.	.	PUNCT
ahs-8094	411	69	)	)	PUNCT
ahs-8094	411	70	.	.	PUNCT
ahs-8094	412	1	­	­	PROPN
ahs-8094	412	2	front	front	ADJ
ahs-8094	412	3	.	.	PUNCT
ahs-8094	413	1	plant	plant	NOUN
ahs-8094	413	2	sci	sci	PROPN
ahs-8094	413	3	.	.	PROPN
ahs-8094	413	4	,	,	PUNCT
ahs-8094	413	5	9	9	NUM
ahs-8094	413	6	:	:	SYM
ahs-8094	413	7	1106	1106	NUM
ahs-8094	413	8	.	.	PUNCT
ahs-8094	414	1	dafalla	dafalla	PROPN
ahs-8094	414	2	g.a	g.a	PROPN
ahs-8094	414	3	.	.	PROPN
ahs-8094	414	4	,	,	PUNCT
ahs-8094	414	5	2001	2001	NUM
ahs-8094	414	6	­	­	NUM
ahs-8094	414	7	situation	situation	NOUN
ahs-8094	414	8	of	of	ADP
ahs-8094	414	9	tomato	tomato	NOUN
ahs-8094	414	10	and	and	CCONJ
ahs-8094	414	11	pepper	pepper	NOUN
ahs-8094	414	12	viruses	virus	NOUN
ahs-8094	414	13	in	in	ADP
ahs-8094	414	14	africa	africa	PROPN
ahs-8094	414	15	,	,	PUNCT
ahs-8094	414	16	pp	pp	ADP
ahs-8094	414	17	18­24	18­24	NUM
ahs-8094	414	18	.	.	PUNCT
ahs-8094	415	1	‐	‐	ADV
ahs-8094	415	2	in	in	ADP
ahs-8094	415	3	:	:	PUNCT
ahs-8094	415	4	d’a	d’a	PROPN
ahs-8094	415	5	.	.	PUNCT
ahs-8094	416	1	hughes	hughes	PROPN
ahs-8094	416	2	j.	j.	PROPN
ahs-8094	416	3	b.o	b.o	PROPN
ahs-8094	416	4	.	.	PROPN
ahs-8094	416	5	odu	odu	PROPN
ahs-8094	416	6	(	(	PUNCT
ahs-8094	416	7	eds	eds	PROPN
ahs-8094	416	8	.	.	PUNCT
ahs-8094	416	9	)	)	PUNCT
ahs-8094	416	10	proceedings	proceeding	NOUN
ahs-8094	416	11	of	of	ADP
ahs-8094	416	12	a	a	DET
ahs-8094	416	13	conference	conference	NOUN
ahs-8094	416	14	on	on	ADP
ahs-8094	416	15	“	"	PUNCT
ahs-8094	416	16	plant	plant	NOUN
ahs-8094	416	17	virology	virology	NOUN
ahs-8094	416	18	in	in	ADP
ahs-8094	416	19	sub	sub	NOUN
ahs-8094	416	20	saharan	saharan	PROPN
ahs-8094	416	21	africa	africa	PROPN
ahs-8094	416	22	”	"	PUNCT
ahs-8094	416	23	.	.	PUNCT
ahs-8094	417	1	international	international	PROPN
ahs-8094	417	2	institute	institute	PROPN
ahs-8094	417	3	of	of	ADP
ahs-8094	417	4	tropical	tropical	PROPN
ahs-8094	417	5	agriculture	agriculture	PROPN
ahs-8094	417	6	,	,	PUNCT
ahs-8094	417	7	iita	iita	PROPN
ahs-8094	417	8	,	,	PUNCT
ahs-8094	417	9	june	june	PROPN
ahs-8094	417	10	4­8	4­8	PROPN
ahs-8094	417	11	,	,	PUNCT
ahs-8094	417	12	ibadan	ibadan	PROPN
ahs-8094	417	13	,	,	PUNCT
ahs-8094	417	14	nigeria	nigeria	PROPN
ahs-8094	417	15	,	,	PUNCT
ahs-8094	417	16	pp	pp	ADJ
ahs-8094	417	17	.	.	PUNCT
ahs-8094	418	1	589	589	X
ahs-8094	418	2	.	.	PUNCT
ahs-8094	419	1	degri	degri	PROPN
ahs-8094	419	2	m.m	m.m	PROPN
ahs-8094	419	3	.	.	PROPN
ahs-8094	419	4	,	,	PUNCT
ahs-8094	419	5	ayuba	ayuba	PROPN
ahs-8094	419	6	j.	j.	PROPN
ahs-8094	419	7	,	,	PUNCT
ahs-8094	419	8	2016	2016	NUM
ahs-8094	419	9	­	­	NOUN
ahs-8094	419	10	effect	effect	NOUN
ahs-8094	419	11	of	of	ADP
ahs-8094	419	12	pepper	pepper	NOUN
ahs-8094	419	13	and	and	CCONJ
ahs-8094	419	14	cereals	cereal	NOUN
ahs-8094	419	15	intercropping	intercrop	VERB
ahs-8094	419	16	in	in	ADP
ahs-8094	419	17	the	the	DET
ahs-8094	419	18	management	management	NOUN
ahs-8094	419	19	of	of	ADP
ahs-8094	419	20	aphids	aphid	NOUN
ahs-8094	419	21	(	(	PUNCT
ahs-8094	419	22	aphis	aphis	PROPN
ahs-8094	419	23	gossypii	gossypii	PROPN
ahs-8094	419	24	glove	glove	PROPN
ahs-8094	419	25	)	)	PUNCT
ahs-8094	419	26	on	on	ADP
ahs-8094	419	27	pepper	pepper	NOUN
ahs-8094	419	28	(	(	PUNCT
ahs-8094	419	29	capscium	capscium	NOUN
ahs-8094	419	30	annum	annum	PROPN
ahs-8094	419	31	l.	l.	PROPN
ahs-8094	419	32	)	)	PUNCT
ahs-8094	419	33	.	.	PUNCT
ahs-8094	420	1	­	­	PROPN
ahs-8094	420	2	int	int	PROPN
ahs-8094	420	3	.	.	PUNCT
ahs-8094	421	1	j.	j.	PROPN
ahs-8094	421	2	res	res	PROPN
ahs-8094	421	3	.	.	PUNCT
ahs-8094	422	1	agric	agric	PROPN
ahs-8094	422	2	.	.	PUNCT
ahs-8094	423	1	for	for	ADP
ahs-8094	423	2	.	.	PROPN
ahs-8094	423	3	,	,	PUNCT
ahs-8094	423	4	3	3	NUM
ahs-8094	423	5	(	(	PUNCT
ahs-8094	423	6	4	4	NUM
ahs-8094	423	7	):	):	PUNCT
ahs-8094	423	8	23­27	23­27	NUM
ahs-8094	423	9	.	.	PUNCT
ahs-8094	424	1	waweru	waweru	PROPN
ahs-8094	424	2	et	et	PROPN
ahs-8094	424	3	al	al	PROPN
ahs-8094	424	4	.	.	PROPN
ahs-8094	424	5	‐	‐	NOUN
ahs-8094	424	6	evaluation	evaluation	NOUN
ahs-8094	424	7	of	of	ADP
ahs-8094	424	8	hot	hot	ADJ
ahs-8094	424	9	pepper	pepper	NOUN
ahs-8094	424	10	genotypes	genotype	NOUN
ahs-8094	424	11	in	in	ADP
ahs-8094	424	12	rwanda	rwanda	PROPN
ahs-8094	424	13	411	411	NUM
ahs-8094	424	14	djieto­lordon	djieto­lordon	PROPN
ahs-8094	424	15	c.	c.	PROPN
ahs-8094	424	16	,	,	PUNCT
ahs-8094	424	17	heumou	heumou	PROPN
ahs-8094	424	18	c.r	c.r	PROPN
ahs-8094	424	19	.	.	PROPN
ahs-8094	424	20	,	,	PUNCT
ahs-8094	424	21	azang	azang	PROPN
ahs-8094	424	22	p.s.e	p.s.e	AUX
ahs-8094	424	23	.	.	PROPN
ahs-8094	424	24	,	,	PUNCT
ahs-8094	424	25	alene	alene	PROPN
ahs-8094	424	26	c.d	c.d	PROPN
ahs-8094	424	27	.	.	PROPN
ahs-8094	424	28	,	,	PUNCT
ahs-8094	424	29	ngueng	ngueng	PROPN
ahs-8094	424	30	a.c	a.c	PROPN
ahs-8094	424	31	.	.	PROPN
ahs-8094	424	32	,	,	PUNCT
ahs-8094	424	33	ngassam	ngassam	PROPN
ahs-8094	424	34	p.	p.	NOUN
ahs-8094	424	35	,	,	PUNCT
ahs-8094	424	36	2014	2014	NUM
ahs-8094	424	37	­	­	NOUN
ahs-8094	424	38	assessment	assessment	NOUN
ahs-8094	424	39	of	of	ADP
ahs-8094	424	40	pest	pest	NOUN
ahs-8094	424	41	insects	insect	NOUN
ahs-8094	424	42	of	of	ADP
ahs-8094	424	43	capsicum	capsicum	NOUN
ahs-8094	424	44	annuum	annuum	PROPN
ahs-8094	424	45	l.1753	l.1753	PROPN
ahs-8094	424	46	(	(	PUNCT
ahs-8094	424	47	solanaceae	solanaceae	PROPN
ahs-8094	424	48	)	)	PUNCT
ahs-8094	424	49	in	in	ADP
ahs-8094	424	50	a	a	DET
ahs-8094	424	51	cultivation	cultivation	NOUN
ahs-8094	424	52	cycle	cycle	NOUN
ahs-8094	424	53	in	in	ADP
ahs-8094	424	54	yaoundé	yaoundé	PROPN
ahs-8094	424	55	.	.	PUNCT
ahs-8094	425	1	­	­	PROPN
ahs-8094	425	2	int	int	PROPN
ahs-8094	425	3	.	.	PUNCT
ahs-8094	426	1	j.	j.	PROPN
ahs-8094	426	2	biol	biol	PROPN
ahs-8094	426	3	.	.	PUNCT
ahs-8094	427	1	chem	chem	PROPN
ahs-8094	427	2	.	.	PUNCT
ahs-8094	428	1	sci	sci	PROPN
ahs-8094	428	2	.	.	PROPN
ahs-8094	428	3	,	,	PUNCT
ahs-8094	428	4	8(2	8(2	NUM
ahs-8094	428	5	):	):	PUNCT
ahs-8094	428	6	621­632	621­632	NOUN
ahs-8094	428	7	.	.	PUNCT
ahs-8094	429	1	dombrovsky	dombrovsky	ADJ
ahs-8094	429	2	a.	a.	NOUN
ahs-8094	429	3	,	,	PUNCT
ahs-8094	429	4	glanz	glanz	PROPN
ahs-8094	429	5	e.	e.	PROPN
ahs-8094	429	6	,	,	PUNCT
ahs-8094	429	7	pearlsman	pearlsman	NOUN
ahs-8094	429	8	m.	m.	NOUN
ahs-8094	429	9	,	,	PUNCT
ahs-8094	429	10	lachman	lachman	PROPN
ahs-8094	429	11	o.	o.	PROPN
ahs-8094	429	12	,	,	PUNCT
ahs-8094	429	13	antignus	antignus	ADJ
ahs-8094	429	14	y.	y.	NOUN
ahs-8094	429	15	,	,	PUNCT
ahs-8094	429	16	2010	2010	NUM
ahs-8094	429	17	­	­	NOUN
ahs-8094	429	18	characterization	characterization	NOUN
ahs-8094	429	19	of	of	ADP
ahs-8094	429	20	pepper	pepper	NOUN
ahs-8094	429	21	yel‐	yel‐	ADJ
ahs-8094	429	22	low	low	ADJ
ahs-8094	429	23	leaf	leaf	NOUN
ahs-8094	429	24	curl	curl	NOUN
ahs-8094	429	25	virus	virus	NOUN
ahs-8094	429	26	,	,	PUNCT
ahs-8094	429	27	a	a	DET
ahs-8094	429	28	tentative	tentative	ADJ
ahs-8094	429	29	new	new	ADJ
ahs-8094	429	30	polerovirus	polerovirus	NOUN
ahs-8094	429	31	species	specie	NOUN
ahs-8094	429	32	causing	cause	VERB
ahs-8094	429	33	a	a	DET
ahs-8094	429	34	yellowing	yellow	VERB
ahs-8094	429	35	disease	disease	NOUN
ahs-8094	429	36	of	of	ADP
ahs-8094	429	37	pepper	pepper	NOUN
ahs-8094	429	38	.	.	PUNCT
ahs-8094	430	1	­	­	PROPN
ahs-8094	430	2	phytoparasitica	phytoparasitica	PROPN
ahs-8094	430	3	,	,	PUNCT
ahs-8094	430	4	38	38	NUM
ahs-8094	430	5	:	:	PUNCT
ahs-8094	431	1	477­486	477­486	NUM
ahs-8094	431	2	.	.	PUNCT
ahs-8094	432	1	fajinmi	fajinmi	PROPN
ahs-8094	432	2	a.a	a.a	PROPN
ahs-8094	432	3	.	.	PROPN
ahs-8094	432	4	,	,	PUNCT
ahs-8094	432	5	odebode	odebode	PROPN
ahs-8094	432	6	c.a	c.a	PROPN
ahs-8094	432	7	.	.	PROPN
ahs-8094	432	8	,	,	PUNCT
ahs-8094	432	9	fajinmi	fajinmi	PROPN
ahs-8094	432	10	o.b	o.b	PROPN
ahs-8094	432	11	.	.	PROPN
ahs-8094	432	12	,	,	PUNCT
ahs-8094	432	13	2011	2011	NUM
ahs-8094	432	14	­	­	NOUN
ahs-8094	432	15	incidence	incidence	NOUN
ahs-8094	432	16	and	and	CCONJ
ahs-8094	432	17	distribution	distribution	NOUN
ahs-8094	432	18	of	of	ADP
ahs-8094	432	19	aphid	aphid	NOUN
ahs-8094	432	20	vectors	vector	NOUN
ahs-8094	432	21	of	of	ADP
ahs-8094	432	22	pepper	pepper	NOUN
ahs-8094	432	23	veinal	veinal	ADJ
ahs-8094	432	24	mottle	mottle	NOUN
ahs-8094	432	25	virus	virus	NOUN
ahs-8094	432	26	on	on	ADP
ahs-8094	432	27	bell	bell	PROPN
ahs-8094	432	28	pepper	pepper	NOUN
ahs-8094	432	29	.	.	PUNCT
ahs-8094	433	1	­	­	PROPN
ahs-8094	433	2	int	int	PROPN
ahs-8094	433	3	.	.	PUNCT
ahs-8094	434	1	j.	j.	PROPN
ahs-8094	434	2	entomol	entomol	PROPN
ahs-8094	434	3	.	.	PROPN
ahs-8094	434	4	,	,	PUNCT
ahs-8094	434	5	1(1):1­12	1(1):1­12	NUM
ahs-8094	434	6	.	.	PUNCT
ahs-8094	434	7	fajinmi	fajinmi	PROPN
ahs-8094	434	8	a.a	a.a	PROPN
ahs-8094	434	9	.	.	PROPN
ahs-8094	434	10	,	,	PUNCT
ahs-8094	434	11	omotayo	omotayo	PROPN
ahs-8094	434	12	a.	a.	PROPN
ahs-8094	434	13	,	,	PUNCT
ahs-8094	434	14	ribeiro	ribeiro	PROPN
ahs-8094	434	15	c.	c.	PROPN
ahs-8094	434	16	,	,	PUNCT
ahs-8094	434	17	oluleye	oluleye	NOUN
ahs-8094	434	18	a.k	a.k	PROPN
ahs-8094	434	19	.	.	PROPN
ahs-8094	434	20	,	,	PUNCT
ahs-8094	434	21	fajinmi	fajinmi	PROPN
ahs-8094	434	22	o.b	o.b	PROPN
ahs-8094	434	23	.	.	PROPN
ahs-8094	434	24	,	,	PUNCT
ahs-8094	434	25	2018	2018	NUM
ahs-8094	434	26	­	­	NUM
ahs-8094	434	27	evaluation	evaluation	NOUN
ahs-8094	434	28	of	of	ADP
ahs-8094	434	29	pepper	pepper	NOUN
ahs-8094	434	30	genotypes	genotype	NOUN
ahs-8094	434	31	for	for	ADP
ahs-8094	434	32	disease	disease	NOUN
ahs-8094	434	33	tolerance	tolerance	NOUN
ahs-8094	434	34	in	in	ADP
ahs-8094	434	35	southwest	southwest	PROPN
ahs-8094	434	36	nigeria	nigeria	PROPN
ahs-8094	434	37	.	.	PUNCT
ahs-8094	435	1	­	­	PROPN
ahs-8094	435	2	acta	acta	PROPN
ahs-8094	435	3	horticulturae	horticulturae	PROPN
ahs-8094	435	4	,	,	PUNCT
ahs-8094	435	5	1225	1225	NUM
ahs-8094	435	6	:	:	PUNCT
ahs-8094	435	7	457­464	457­464	NUM
ahs-8094	435	8	.	.	PUNCT
ahs-8094	436	1	fao	fao	ADJ
ahs-8094	436	2	,	,	PUNCT
ahs-8094	436	3	2017­	2017­	PROPN
ahs-8094	436	4	fao	fao	PROPN
ahs-8094	436	5	statistics	statistic	NOUN
ahs-8094	436	6	division	division	PROPN
ahs-8094	436	7	2017	2017	NUM
ahs-8094	436	8	.	.	PUNCT
ahs-8094	437	1	www.faostat.org	www.faostat.org	PROPN
ahs-8094	437	2	frantz	frantz	PROPN
ahs-8094	437	3	j.d	j.d	PROPN
ahs-8094	437	4	.	.	PROPN
ahs-8094	437	5	,	,	PUNCT
ahs-8094	437	6	gardner	gardner	PROPN
ahs-8094	437	7	j.	j.	PROPN
ahs-8094	437	8	,	,	PUNCT
ahs-8094	437	9	hoffmann	hoffmann	PROPN
ahs-8094	437	10	m.p	m.p	PROPN
ahs-8094	437	11	.	.	PROPN
ahs-8094	437	12	,	,	PUNCT
ahs-8094	437	13	jahn	jahn	PROPN
ahs-8094	437	14	m.m	m.m	PROPN
ahs-8094	437	15	.	.	PROPN
ahs-8094	437	16	,	,	PUNCT
ahs-8094	437	17	2004	2004	NUM
ahs-8094	437	18	­	­	VERB
ahs-8094	437	19	greenhouse	greenhouse	NOUN
ahs-8094	437	20	screening	screening	NOUN
ahs-8094	437	21	of	of	ADP
ahs-8094	437	22	capsicum	capsicum	NOUN
ahs-8094	437	23	accessions	accession	NOUN
ahs-8094	437	24	for	for	ADP
ahs-8094	437	25	resistance	resistance	NOUN
ahs-8094	437	26	to	to	ADP
ahs-8094	437	27	green	green	ADJ
ahs-8094	437	28	peach	peach	NOUN
ahs-8094	437	29	aphid	aphid	NOUN
ahs-8094	437	30	(	(	PUNCT
ahs-8094	437	31	myzus	myzus	NOUN
ahs-8094	437	32	persicae	persicae	NOUN
ahs-8094	437	33	)	)	PUNCT
ahs-8094	437	34	.	.	PUNCT
ahs-8094	438	1	­	­	PROPN
ahs-8094	438	2	hortsci	hortsci	PROPN
ahs-8094	438	3	.	.	PROPN
ahs-8094	438	4	,	,	PUNCT
ahs-8094	438	5	9(6	9(6	NUM
ahs-8094	438	6	):	):	PUNCT
ahs-8094	438	7	1332­1335	1332­1335	NUM
ahs-8094	438	8	.	.	PUNCT
ahs-8094	439	1	galanihe	galanihe	PROPN
ahs-8094	439	2	l.d	l.d	PROPN
ahs-8094	439	3	.	.	PROPN
ahs-8094	439	4	,	,	PUNCT
ahs-8094	439	5	priyantha	priyantha	PROPN
ahs-8094	439	6	m.g.d.l	m.g.d.l	PROPN
ahs-8094	439	7	.	.	PROPN
ahs-8094	439	8	,	,	PUNCT
ahs-8094	439	9	yapa	yapa	PROPN
ahs-8094	439	10	d.r	d.r	PROPN
ahs-8094	439	11	.	.	PROPN
ahs-8094	439	12	,	,	PUNCT
ahs-8094	439	13	bandara	bandara	PROPN
ahs-8094	439	14	h.m.s	h.m.s	PROPN
ahs-8094	439	15	.	.	PROPN
ahs-8094	439	16	,	,	PUNCT
ahs-8094	439	17	ranasinghe	ranasinghe	VERB
ahs-8094	439	18	j.	j.	PROPN
ahs-8094	439	19	2004	2004	NUM
ahs-8094	439	20	­	­	PROPN
ahs-8094	439	21	insect	insect	NOUN
ahs-8094	439	22	pest	pest	NOUN
ahs-8094	439	23	and	and	CCONJ
ahs-8094	439	24	diseases	disease	VERB
ahs-8094	439	25	incidences	incidence	NOUN
ahs-8094	439	26	of	of	ADP
ahs-8094	439	27	exotic	exotic	ADJ
ahs-8094	439	28	hybrid	hybrid	ADJ
ahs-8094	439	29	chilli	chilli	NOUN
ahs-8094	439	30	pepper	pepper	NOUN
ahs-8094	439	31	varieties	variety	NOUN
ahs-8094	439	32	grown	grow	VERB
ahs-8094	439	33	in	in	ADP
ahs-8094	439	34	the	the	DET
ahs-8094	439	35	low	low	ADJ
ahs-8094	439	36	country	country	NOUN
ahs-8094	439	37	dry	dry	ADJ
ahs-8094	439	38	zone	zone	NOUN
ahs-8094	439	39	of	of	ADP
ahs-8094	439	40	sri	sri	PROPN
ahs-8094	439	41	lanka	lanka	PROPN
ahs-8094	439	42	.	.	PUNCT
ahs-8094	440	1	­	­	PROPN
ahs-8094	440	2	annals	annal	NOUN
ahs-8094	440	3	of	of	ADP
ahs-8094	440	4	sri	sri	PROPN
ahs-8094	440	5	lanka	lanka	PROPN
ahs-8094	440	6	,	,	PUNCT
ahs-8094	440	7	6	6	NUM
ahs-8094	440	8	:	:	SYM
ahs-8094	440	9	99­106	99­106	NUM
ahs-8094	440	10	.	.	PUNCT
ahs-8094	441	1	gniffke	gniffke	PROPN
ahs-8094	441	2	p.a	p.a	PROPN
ahs-8094	441	3	.	.	PROPN
ahs-8094	441	4	,	,	PUNCT
ahs-8094	441	5	shieh	shieh	PROPN
ahs-8094	441	6	s.c	s.c	PROPN
ahs-8094	441	7	.	.	PROPN
ahs-8094	441	8	,	,	PUNCT
ahs-8094	441	9	lin	lin	PROPN
ahs-8094	441	10	s.w	s.w	PROPN
ahs-8094	441	11	.	.	PROPN
ahs-8094	441	12	,	,	PUNCT
ahs-8094	441	13	sheu	sheu	PROPN
ahs-8094	441	14	z.m	z.m	PROPN
ahs-8094	441	15	.	.	PROPN
ahs-8094	441	16	,	,	PUNCT
ahs-8094	441	17	chen	chen	PROPN
ahs-8094	441	18	j.r	j.r	PROPN
ahs-8094	441	19	.	.	PROPN
ahs-8094	441	20	,	,	PUNCT
ahs-8094	442	1	ho	ho	PROPN
ahs-8094	442	2	f.i	f.i	PROPN
ahs-8094	442	3	.	.	PROPN
ahs-8094	442	4	,	,	PUNCT
ahs-8094	442	5	tsai	tsai	PROPN
ahs-8094	442	6	w.s	w.s	PROPN
ahs-8094	442	7	.	.	PROPN
ahs-8094	442	8	,	,	PUNCT
ahs-8094	442	9	chou	chou	PROPN
ahs-8094	442	10	y.y	y.y	PROPN
ahs-8094	442	11	.	.	PROPN
ahs-8094	442	12	,	,	PUNCT
ahs-8094	442	13	wang	wang	PROPN
ahs-8094	442	14	j.f	j.f	PROPN
ahs-8094	442	15	.	.	PROPN
ahs-8094	442	16	,	,	PUNCT
ahs-8094	442	17	cho	cho	PROPN
ahs-8094	442	18	m.c	m.c	PROPN
ahs-8094	442	19	.	.	PROPN
ahs-8094	442	20	,	,	PUNCT
ahs-8094	442	21	roland	roland	PROPN
ahs-8094	442	22	s.	s.	PROPN
ahs-8094	442	23	,	,	PUNCT
ahs-8094	442	24	kenyon	kenyon	PROPN
ahs-8094	442	25	l.	l.	PROPN
ahs-8094	442	26	,	,	PUNCT
ahs-8094	442	27	ebert	ebert	PROPN
ahs-8094	442	28	a.w	a.w	PROPN
ahs-8094	442	29	.	.	PROPN
ahs-8094	442	30	,	,	PUNCT
ahs-8094	442	31	srinivasan	srinivasan	PROPN
ahs-8094	442	32	r.	r.	PROPN
ahs-8094	442	33	,	,	PUNCT
ahs-8094	442	34	kumar	kumar	PROPN
ahs-8094	442	35	s.	s.	PROPN
ahs-8094	442	36	,	,	PUNCT
ahs-8094	442	37	2013	2013	NUM
ahs-8094	442	38	­	­	NOUN
ahs-8094	442	39	pepper	pepper	NOUN
ahs-8094	442	40	research	research	NOUN
ahs-8094	442	41	and	and	CCONJ
ahs-8094	442	42	breeding	breeding	NOUN
ahs-8094	442	43	at	at	ADP
ahs-8094	442	44	avrdc‐the	avrdc‐the	DET
ahs-8094	442	45	world	world	NOUN
ahs-8094	442	46	vegetable	vegetable	NOUN
ahs-8094	442	47	center	center	NOUN
ahs-8094	442	48	.	.	PUNCT
ahs-8094	443	1	­	­	PROPN
ahs-8094	443	2	xv	xv	PROPN
ahs-8094	443	3	eucarpia	eucarpia	PROPN
ahs-8094	443	4	meeting	meeting	NOUN
ahs-8094	443	5	on	on	ADP
ahs-8094	443	6	genetics	genetic	NOUN
ahs-8094	443	7	and	and	CCONJ
ahs-8094	443	8	breeding	breeding	NOUN
ahs-8094	443	9	of	of	ADP
ahs-8094	443	10	capsicum	capsicum	NOUN
ahs-8094	443	11	and	and	CCONJ
ahs-8094	443	12	eggplant	eggplant	NOUN
ahs-8094	443	13	,	,	PUNCT
ahs-8094	443	14	2­4	2­4	NUM
ahs-8094	443	15	september	september	PROPN
ahs-8094	443	16	2013	2013	NUM
ahs-8094	443	17	,	,	PUNCT
ahs-8094	443	18	turin	turin	PROPN
ahs-8094	443	19	,	,	PUNCT
ahs-8094	443	20	italy	italy	PROPN
ahs-8094	443	21	,	,	PUNCT
ahs-8094	443	22	pp	pp	X
ahs-8094	443	23	.	.	PUNCT
ahs-8094	444	1	305­	305­	NUM
ahs-8094	444	2	311	311	NUM
ahs-8094	444	3	.	.	PUNCT
ahs-8094	445	1	grube	grube	PROPN
ahs-8094	445	2	r.c	r.c	PROPN
ahs-8094	445	3	.	.	PROPN
ahs-8094	445	4	,	,	PUNCT
ahs-8094	445	5	zhang	zhang	PROPN
ahs-8094	445	6	y.	y.	PROPN
ahs-8094	445	7	,	,	PUNCT
ahs-8094	445	8	murphy	murphy	PROPN
ahs-8094	445	9	j.f	j.f	PROPN
ahs-8094	445	10	.	.	PROPN
ahs-8094	445	11	,	,	PUNCT
ahs-8094	445	12	loaiza­figueroa	loaiza­figueroa	PROPN
ahs-8094	445	13	f.	f.	PROPN
ahs-8094	445	14	,	,	PUNCT
ahs-8094	445	15	lackney	lackney	NOUN
ahs-8094	445	16	v.k	v.k	PROPN
ahs-8094	445	17	.	.	PROPN
ahs-8094	445	18	,	,	PUNCT
ahs-8094	445	19	provvidenti	provvidenti	PROPN
ahs-8094	445	20	r.	r.	PROPN
ahs-8094	445	21	,	,	PUNCT
ahs-8094	445	22	2000	2000	NUM
ahs-8094	445	23	­	­	VERB
ahs-8094	445	24	new	new	ADJ
ahs-8094	445	25	source	source	NOUN
ahs-8094	445	26	of	of	ADP
ahs-8094	445	27	resistance	resistance	NOUN
ahs-8094	445	28	to	to	ADP
ahs-8094	445	29	cucumber	cucumber	PROPN
ahs-8094	445	30	mosaic	mosaic	PROPN
ahs-8094	445	31	virus	virus	NOUN
ahs-8094	445	32	in	in	ADP
ahs-8094	445	33	capsicum	capsicum	NOUN
ahs-8094	445	34	frutescens	frutescen	NOUN
ahs-8094	445	35	.	.	PUNCT
ahs-8094	446	1	­	­	PROPN
ahs-8094	446	2	plant	plant	PROPN
ahs-8094	446	3	dis	dis	PROPN
ahs-8094	446	4	.	.	PUNCT
ahs-8094	446	5	,	,	PUNCT
ahs-8094	446	6	84	84	NUM
ahs-8094	446	7	:	:	PUNCT
ahs-8094	446	8	885­891	885­891	NUM
ahs-8094	446	9	.	.	PUNCT
ahs-8094	447	1	hill	hill	PROPN
ahs-8094	447	2	c.b	c.b	PROPN
ahs-8094	447	3	.	.	PROPN
ahs-8094	447	4	,	,	PUNCT
ahs-8094	447	5	li	li	PROPN
ahs-8094	447	6	y.	y.	PROPN
ahs-8094	447	7	,	,	PUNCT
ahs-8094	447	8	hartman	hartman	PROPN
ahs-8094	447	9	g.l	g.l	PROPN
ahs-8094	447	10	.	.	PROPN
ahs-8094	447	11	,	,	PUNCT
ahs-8094	447	12	2004	2004	NUM
ahs-8094	447	13	­	­	VERB
ahs-8094	447	14	resistance	resistance	NOUN
ahs-8094	447	15	to	to	ADP
ahs-8094	447	16	the	the	DET
ahs-8094	447	17	soybean	soybean	NOUN
ahs-8094	447	18	aphid	aphid	NOUN
ahs-8094	447	19	in	in	ADP
ahs-8094	447	20	soybean	soybean	NOUN
ahs-8094	447	21	germplasm	germplasm	NOUN
ahs-8094	447	22	.	.	PUNCT
ahs-8094	448	1	­	­	PROPN
ahs-8094	448	2	crop	crop	PROPN
ahs-8094	448	3	sci	sci	PROPN
ahs-8094	448	4	.	.	PROPN
ahs-8094	448	5	,	,	PUNCT
ahs-8094	448	6	44	44	NUM
ahs-8094	448	7	:	:	SYM
ahs-8094	448	8	98­106	98­106	NUM
ahs-8094	448	9	.	.	PUNCT
ahs-8094	449	1	ingvardsen	ingvardsen	ADJ
ahs-8094	449	2	c.r	c.r	PROPN
ahs-8094	449	3	.	.	PROPN
ahs-8094	449	4	,	,	PUNCT
ahs-8094	449	5	xing	xing	PROPN
ahs-8094	449	6	y.	y.	PROPN
ahs-8094	449	7	,	,	PUNCT
ahs-8094	449	8	frei	frei	ADV
ahs-8094	449	9	u.k.k	u.k.k	NOUN
ahs-8094	449	10	.	.	PUNCT
ahs-8094	449	11	,	,	PUNCT
ahs-8094	449	12	lübberstedt	lübberstedt	PROPN
ahs-8094	449	13	t.	t.	PROPN
ahs-8094	449	14	,	,	PUNCT
ahs-8094	449	15	2010	2010	NUM
ahs-8094	449	16	­	­	VERB
ahs-8094	449	17	genetic	genetic	ADJ
ahs-8094	449	18	and	and	CCONJ
ahs-8094	449	19	physical	physical	ADJ
ahs-8094	449	20	fine	fine	ADJ
ahs-8094	449	21	mapping	mapping	NOUN
ahs-8094	449	22	of	of	ADP
ahs-8094	449	23	scmv2	scmv2	PROPN
ahs-8094	449	24	,	,	PUNCT
ahs-8094	449	25	a	a	DET
ahs-8094	449	26	potyvirus	potyvirus	NOUN
ahs-8094	449	27	resistance	resistance	NOUN
ahs-8094	449	28	gene	gene	NOUN
ahs-8094	449	29	in	in	ADP
ahs-8094	449	30	maize	maize	NOUN
ahs-8094	449	31	.	.	PUNCT
ahs-8094	450	1	­	­	PROPN
ahs-8094	450	2	theor	theor	PROPN
ahs-8094	450	3	.	.	PUNCT
ahs-8094	451	1	appl	appl	PROPN
ahs-8094	451	2	.	.	PUNCT
ahs-8094	452	1	genet	genet	PROPN
ahs-8094	452	2	.	.	PUNCT
ahs-8094	452	3	,	,	PUNCT
ahs-8094	452	4	120	120	NUM
ahs-8094	452	5	:	:	SYM
ahs-8094	452	6	1621­1634	1621­1634	NUM
ahs-8094	452	7	.	.	PUNCT
ahs-8094	453	1	kang	kang	PROPN
ahs-8094	453	2	w.h	w.h	PROPN
ahs-8094	453	3	.	.	PROPN
ahs-8094	453	4	,	,	PUNCT
ahs-8094	453	5	hoang	hoang	PROPN
ahs-8094	453	6	n.h	n.h	PROPN
ahs-8094	453	7	.	.	PROPN
ahs-8094	453	8	,	,	PUNCT
ahs-8094	453	9	yang	yang	PROPN
ahs-8094	453	10	h.b	h.b	PROPN
ahs-8094	453	11	.	.	PROPN
ahs-8094	453	12	,	,	PUNCT
ahs-8094	453	13	kwon	kwon	PROPN
ahs-8094	453	14	j.k	j.k	PROPN
ahs-8094	453	15	.	.	PROPN
ahs-8094	453	16	,	,	PUNCT
ahs-8094	454	1	jo	jo	PROPN
ahs-8094	454	2	s.h	s.h	PROPN
ahs-8094	454	3	.	.	PROPN
ahs-8094	454	4	,	,	PUNCT
ahs-8094	454	5	seo	seo	PROPN
ahs-8094	454	6	j.k	j.k	PROPN
ahs-8094	454	7	.	.	PROPN
ahs-8094	454	8	,	,	PUNCT
ahs-8094	454	9	2010	2010	NUM
ahs-8094	454	10	­	­	VERB
ahs-8094	454	11	molecular	molecular	ADJ
ahs-8094	454	12	mapping	mapping	NOUN
ahs-8094	454	13	and	and	CCONJ
ahs-8094	454	14	characteriza‐	characteriza‐	ADP
ahs-8094	454	15	tion	tion	NOUN
ahs-8094	454	16	of	of	ADP
ahs-8094	454	17	a	a	DET
ahs-8094	454	18	single	single	ADJ
ahs-8094	454	19	dominant	dominant	ADJ
ahs-8094	454	20	gene	gene	NOUN
ahs-8094	454	21	controlling	control	VERB
ahs-8094	454	22	cmv	cmv	NOUN
ahs-8094	454	23	resis‐	resis‐	NOUN
ahs-8094	454	24	tance	tance	NOUN
ahs-8094	454	25	in	in	ADP
ahs-8094	454	26	peppers	pepper	NOUN
ahs-8094	454	27	(	(	PUNCT
ahs-8094	454	28	capsicum	capsicum	NOUN
ahs-8094	454	29	annuum	annuum	PROPN
ahs-8094	454	30	l.	l.	PROPN
ahs-8094	454	31	)	)	PUNCT
ahs-8094	454	32	.	.	PUNCT
ahs-8094	455	1	­	­	PROPN
ahs-8094	455	2	theor	theor	PROPN
ahs-8094	455	3	.	.	PUNCT
ahs-8094	456	1	appl	appl	PROPN
ahs-8094	456	2	.	.	PUNCT
ahs-8094	457	1	genet	genet	PROPN
ahs-8094	457	2	.	.	PUNCT
ahs-8094	457	3	,	,	PUNCT
ahs-8094	458	1	120	120	NUM
ahs-8094	458	2	:	:	SYM
ahs-8094	458	3	1587­1596	1587­1596	NUM
ahs-8094	458	4	.	.	PUNCT
ahs-8094	459	1	kenyon	kenyon	PROPN
ahs-8094	459	2	l.	l.	PROPN
ahs-8094	459	3	,	,	PUNCT
ahs-8094	459	4	kumar	kumar	PROPN
ahs-8094	459	5	s.	s.	PROPN
ahs-8094	459	6	,	,	PUNCT
ahs-8094	459	7	wen­shi	wen­shi	PROPN
ahs-8094	459	8	tsai	tsai	PROPN
ahs-8094	459	9	jacqueline	jacqueline	PROPN
ahs-8094	459	10	d’a	d’a	PROPN
ahs-8094	459	11	.	.	PUNCT
ahs-8094	460	1	h.	h.	PROPN
ahs-8094	460	2	,	,	PUNCT
ahs-8094	460	3	2014	2014	NUM
ahs-8094	460	4	­	­	PROPN
ahs-8094	460	5	virus	virus	NOUN
ahs-8094	460	6	diseases	disease	NOUN
ahs-8094	460	7	of	of	ADP
ahs-8094	460	8	peppers	pepper	NOUN
ahs-8094	460	9	(	(	PUNCT
ahs-8094	460	10	capsicum	capsicum	NOUN
ahs-8094	460	11	spp	spp	NOUN
ahs-8094	460	12	.	.	PUNCT
ahs-8094	460	13	)	)	PUNCT
ahs-8094	460	14	and	and	CCONJ
ahs-8094	460	15	their	their	PRON
ahs-8094	460	16	control	control	NOUN
ahs-8094	460	17	.	.	PUNCT
ahs-8094	461	1	‐	‐	PROPN
ahs-8094	461	2	adv	adv	PROPN
ahs-8094	461	3	.	.	PUNCT
ahs-8094	461	4	virus	virus	NOUN
ahs-8094	461	5	res	re	NOUN
ahs-8094	461	6	.	.	PUNCT
ahs-8094	461	7	,	,	PUNCT
ahs-8094	461	8	90	90	NUM
ahs-8094	461	9	:	:	PUNCT
ahs-8094	461	10	297­354	297­354	NUM
ahs-8094	461	11	.	.	PUNCT
ahs-8094	462	1	kim	kim	PROPN
ahs-8094	462	2	s.b	s.b	PROPN
ahs-8094	462	3	.	.	PROPN
ahs-8094	462	4	,	,	PUNCT
ahs-8094	462	5	kang	kang	PROPN
ahs-8094	462	6	w.h	w.h	PROPN
ahs-8094	462	7	.	.	PROPN
ahs-8094	462	8	,	,	PUNCT
ahs-8094	462	9	huy	huy	PROPN
ahs-8094	462	10	h.n	h.n	PROPN
ahs-8094	462	11	.	.	PROPN
ahs-8094	462	12	,	,	PUNCT
ahs-8094	462	13	yeom	yeom	PROPN
ahs-8094	462	14	s.i	s.i	PROPN
ahs-8094	462	15	.	.	PROPN
ahs-8094	462	16	,	,	PUNCT
ahs-8094	462	17	an	an	DET
ahs-8094	462	18	j.t	j.t	PROPN
ahs-8094	462	19	.	.	PROPN
ahs-8094	462	20	,	,	PUNCT
ahs-8094	462	21	kim	kim	PROPN
ahs-8094	462	22	s.	s.	PROPN
ahs-8094	462	23	,	,	PUNCT
ahs-8094	462	24	kang	kang	PROPN
ahs-8094	462	25	m.y	m.y	PROPN
ahs-8094	462	26	.	.	PROPN
ahs-8094	462	27	,	,	PUNCT
ahs-8094	462	28	kim	kim	PROPN
ahs-8094	462	29	h.j	h.j	PROPN
ahs-8094	462	30	.	.	PROPN
ahs-8094	462	31	,	,	PUNCT
ahs-8094	462	32	jo	jo	PROPN
ahs-8094	463	1	y.d	y.d	PROPN
ahs-8094	463	2	.	.	PROPN
ahs-8094	463	3	,	,	PUNCT
ahs-8094	463	4	ha	ha	INTJ
ahs-8094	463	5	y.	y.	NOUN
ahs-8094	463	6	,	,	PUNCT
ahs-8094	463	7	choi	choi	PROPN
ahs-8094	463	8	d	d	PROPN
ahs-8094	463	9	,	,	PUNCT
ahs-8094	463	10	kang	kang	PROPN
ahs-8094	463	11	b.c	b.c	PROPN
ahs-8094	463	12	.	.	PROPN
ahs-8094	463	13	,	,	PUNCT
ahs-8094	463	14	2017	2017	NUM
ahs-8094	463	15	­	­	VERB
ahs-8094	463	16	divergent	divergent	ADJ
ahs-8094	463	17	evolution	evolution	NOUN
ahs-8094	463	18	of	of	ADP
ahs-8094	463	19	multiple	multiple	ADJ
ahs-8094	463	20	virus‐resistance	virus‐resistance	NOUN
ahs-8094	463	21	genes	gene	NOUN
ahs-8094	463	22	from	from	ADP
ahs-8094	463	23	a	a	DET
ahs-8094	463	24	progenitor	progenitor	NOUN
ahs-8094	463	25	in	in	ADP
ahs-8094	463	26	capsicum	capsicum	NOUN
ahs-8094	463	27	spp	spp	NOUN
ahs-8094	463	28	.	.	PUNCT
ahs-8094	464	1	­	­	VERB
ahs-8094	464	2	new	new	ADJ
ahs-8094	464	3	phytol	phytol	NOUN
ahs-8094	464	4	.	.	PUNCT
ahs-8094	465	1	,	,	PUNCT
ahs-8094	465	2	213	213	NUM
ahs-8094	465	3	:	:	PUNCT
ahs-8094	465	4	886­899	886­899	NUM
ahs-8094	465	5	.	.	PUNCT
ahs-8094	466	1	martin	martin	PROPN
ahs-8094	466	2	j.h	j.h	PROPN
ahs-8094	466	3	.	.	PROPN
ahs-8094	466	4	,	,	PUNCT
ahs-8094	466	5	1983	1983	NUM
ahs-8094	466	6	­	­	VERB
ahs-8094	466	7	the	the	DET
ahs-8094	466	8	identification	identification	NOUN
ahs-8094	466	9	of	of	ADP
ahs-8094	466	10	common	common	ADJ
ahs-8094	466	11	aphid	aphid	NOUN
ahs-8094	466	12	pest	pest	NOUN
ahs-8094	466	13	of	of	ADP
ahs-8094	466	14	tropics	tropic	NOUN
ahs-8094	466	15	.	.	PUNCT
ahs-8094	467	1	­	­	PROPN
ahs-8094	467	2	trop	trop	X
ahs-8094	467	3	.	.	PUNCT
ahs-8094	467	4	pest	pest	PROPN
ahs-8094	467	5	manag	manag	NOUN
ahs-8094	467	6	.	.	PUNCT
ahs-8094	467	7	,	,	PUNCT
ahs-8094	467	8	29	29	NUM
ahs-8094	468	1	:	:	PUNCT
ahs-8094	468	2	395­411	395­411	NUM
ahs-8094	468	3	.	.	PUNCT
ahs-8094	469	1	meena	meena	PROPN
ahs-8094	469	2	r.s	r.s	PROPN
ahs-8094	469	3	.	.	PROPN
ahs-8094	469	4	,	,	PUNCT
ahs-8094	469	5	ameta	ameta	PROPN
ahs-8094	469	6	o.p	o.p	PROPN
ahs-8094	469	7	.	.	PROPN
ahs-8094	469	8	,	,	PUNCT
ahs-8094	469	9	meena	meena	PROPN
ahs-8094	469	10	b.l	b.l	PROPN
ahs-8094	469	11	.	.	PROPN
ahs-8094	469	12	,	,	PUNCT
ahs-8094	469	13	2013	2013	NUM
ahs-8094	469	14	­	­	NUM
ahs-8094	469	15	population	population	NOUN
ahs-8094	469	16	dynamics	dynamic	NOUN
ahs-8094	469	17	of	of	ADP
ahs-8094	469	18	sucking	suck	VERB
ahs-8094	469	19	pests	pest	NOUN
ahs-8094	469	20	and	and	CCONJ
ahs-8094	469	21	their	their	PRON
ahs-8094	469	22	correlation	correlation	NOUN
ahs-8094	469	23	with	with	ADP
ahs-8094	469	24	weather	weather	NOUN
ahs-8094	469	25	parameters	parameter	NOUN
ahs-8094	469	26	in	in	ADP
ahs-8094	469	27	chilli	chilli	NOUN
ahs-8094	469	28	,	,	PUNCT
ahs-8094	469	29	capsicum	capsicum	NOUN
ahs-8094	469	30	annum	annum	NOUN
ahs-8094	469	31	l.	l.	PROPN
ahs-8094	469	32	crop	crop	PROPN
ahs-8094	469	33	.	.	PUNCT
ahs-8094	470	1	­	­	VERB
ahs-8094	470	2	the	the	DET
ahs-8094	470	3	bioscan	bioscan	NOUN
ahs-8094	470	4	,	,	PUNCT
ahs-8094	470	5	8(1	8(1	NOUN
ahs-8094	470	6	):	):	PUNCT
ahs-8094	470	7	177­180	177­180	NUM
ahs-8094	470	8	.	.	PUNCT
ahs-8094	471	1	murphy	murphy	PROPN
ahs-8094	471	2	j.f	j.f	PROPN
ahs-8094	471	3	.	.	PROPN
ahs-8094	471	4	,	,	PUNCT
ahs-8094	471	5	bowen	bowen	PROPN
ahs-8094	471	6	k.l	k.l	PROPN
ahs-8094	471	7	.	.	PROPN
ahs-8094	471	8	,	,	PUNCT
ahs-8094	471	9	2006	2006	NUM
ahs-8094	471	10	­	­	VERB
ahs-8094	471	11	synergistic	synergistic	ADJ
ahs-8094	471	12	disease	disease	NOUN
ahs-8094	471	13	in	in	ADP
ahs-8094	471	14	pepper	pepper	NOUN
ahs-8094	471	15	caused	cause	VERB
ahs-8094	471	16	by	by	ADP
ahs-8094	471	17	the	the	DET
ahs-8094	471	18	mixed	mixed	ADJ
ahs-8094	471	19	infection	infection	NOUN
ahs-8094	471	20	of	of	ADP
ahs-8094	471	21	cucumber	cucumber	PROPN
ahs-8094	471	22	mosaic	mosaic	PROPN
ahs-8094	471	23	virus	virus	NOUN
ahs-8094	471	24	and	and	CCONJ
ahs-8094	471	25	pepper	pepper	NOUN
ahs-8094	471	26	mottle	mottle	NOUN
ahs-8094	471	27	virus	virus	NOUN
ahs-8094	471	28	.	.	PUNCT
ahs-8094	472	1	­	­	PROPN
ahs-8094	472	2	phytopathology	phytopathology	NOUN
ahs-8094	472	3	,	,	PUNCT
ahs-8094	472	4	96	96	NUM
ahs-8094	472	5	:	:	SYM
ahs-8094	472	6	240­247	240­247	NUM
ahs-8094	472	7	.	.	PUNCT
ahs-8094	473	1	niranjanadevi	niranjanadevi	PROPN
ahs-8094	473	2	j.	j.	PROPN
ahs-8094	473	3	,	,	PUNCT
ahs-8094	473	4	murugan	murugan	PROPN
ahs-8094	473	5	m.	m.	PROPN
ahs-8094	473	6	,	,	PUNCT
ahs-8094	473	7	senthil	senthil	PROPN
ahs-8094	473	8	n.	n.	PROPN
ahs-8094	473	9	,	,	PUNCT
ahs-8094	473	10	shanthi	shanthi	PROPN
ahs-8094	473	11	m.	m.	PROPN
ahs-8094	473	12	,	,	PUNCT
ahs-8094	473	13	sathiyamurthy	sathiyamurthy	ADJ
ahs-8094	473	14	a.	a.	NOUN
ahs-8094	473	15	,	,	PUNCT
ahs-8094	473	16	2018	2018	NUM
ahs-8094	473	17	­	­	PROPN
ahs-8094	473	18	levels	level	NOUN
ahs-8094	473	19	of	of	ADP
ahs-8094	473	20	plant	plant	NOUN
ahs-8094	473	21	resis‐	resis‐	NOUN
ahs-8094	473	22	tance	tance	NOUN
ahs-8094	473	23	in	in	ADP
ahs-8094	473	24	chillies	chilli	NOUN
ahs-8094	473	25	capsicum	capsicum	NOUN
ahs-8094	473	26	spp	spp	NOUN
ahs-8094	473	27	against	against	ADP
ahs-8094	473	28	whitefly	whitefly	NOUN
ahs-8094	473	29	,	,	PUNCT
ahs-8094	473	30	bemisia	bemisia	ADJ
ahs-8094	473	31	tabaci	tabaci	NOUN
ahs-8094	473	32	.	.	PUNCT
ahs-8094	474	1	­	­	PROPN
ahs-8094	474	2	int	int	PROPN
ahs-8094	474	3	.	.	PUNCT
ahs-8094	475	1	j.	j.	PROPN
ahs-8094	475	2	curr	curr	PROPN
ahs-8094	475	3	.	.	PUNCT
ahs-8094	476	1	microbiol	microbiol	PROPN
ahs-8094	476	2	.	.	PUNCT
ahs-8094	477	1	appl	appl	PROPN
ahs-8094	477	2	.	.	PUNCT
ahs-8094	478	1	sci	sci	PROPN
ahs-8094	478	2	.	.	PROPN
ahs-8094	478	3	,	,	PUNCT
ahs-8094	478	4	7(1	7(1	NUM
ahs-8094	478	5	):	):	PUNCT
ahs-8094	478	6	1419­	1419­	PROPN
ahs-8094	478	7	1441	1441	NUM
ahs-8094	478	8	.	.	PUNCT
ahs-8094	479	1	njukeng	njukeng	PROPN
ahs-8094	479	2	p.a	p.a	PROPN
ahs-8094	479	3	.	.	PROPN
ahs-8094	479	4	,	,	PUNCT
ahs-8094	479	5	ngwakum	ngwakum	PROPN
ahs-8094	479	6	w.n	w.n	PROPN
ahs-8094	479	7	.	.	PROPN
ahs-8094	479	8	,	,	PUNCT
ahs-8094	479	9	mbong	mbong	PROPN
ahs-8094	479	10	g.a	g.a	PROPN
ahs-8094	479	11	.	.	PROPN
ahs-8094	479	12	,	,	PUNCT
ahs-8094	479	13	2013	2013	NUM
ahs-8094	479	14	­	­	VERB
ahs-8094	479	15	relative	relative	ADJ
ahs-8094	479	16	prevalence	prevalence	NOUN
ahs-8094	479	17	,	,	PUNCT
ahs-8094	479	18	incidence	incidence	NOUN
ahs-8094	479	19	and	and	CCONJ
ahs-8094	479	20	severity	severity	NOUN
ahs-8094	479	21	of	of	ADP
ahs-8094	479	22	two	two	NUM
ahs-8094	479	23	viru‐	viru‐	NOUN
ahs-8094	479	24	ses	se	NOUN
ahs-8094	479	25	infecting	infect	VERB
ahs-8094	479	26	cultivated	cultivate	VERB
ahs-8094	479	27	pepper	pepper	NOUN
ahs-8094	479	28	in	in	ADP
ahs-8094	479	29	the	the	DET
ahs-8094	479	30	western	western	ADJ
ahs-8094	479	31	highlands	highland	NOUN
ahs-8094	479	32	of	of	ADP
ahs-8094	479	33	cameroon	cameroon	PROPN
ahs-8094	479	34	.	.	PUNCT
ahs-8094	480	1	­	­	PROPN
ahs-8094	480	2	agric	agric	PROPN
ahs-8094	480	3	.	.	PUNCT
ahs-8094	481	1	sci	sci	PROPN
ahs-8094	481	2	.	.	PUNCT
ahs-8094	481	3	res	res	PROPN
ahs-8094	481	4	.	.	PUNCT
ahs-8094	482	1	j.	j.	PROPN
ahs-8094	482	2	,	,	PUNCT
ahs-8094	482	3	3(8	3(8	NUM
ahs-8094	482	4	):	):	PUNCT
ahs-8094	482	5	261­	261­	NUM
ahs-8094	482	6	266	266	NUM
ahs-8094	482	7	.	.	PUNCT
ahs-8094	483	1	noordam	noordam	PROPN
ahs-8094	483	2	d.	d.	PROPN
ahs-8094	483	3	,	,	PUNCT
ahs-8094	483	4	1973	1973	NUM
ahs-8094	483	5	­	­	VERB
ahs-8094	483	6	identification	identification	NOUN
ahs-8094	483	7	of	of	ADP
ahs-8094	483	8	plant	plant	NOUN
ahs-8094	483	9	viruses	virus	NOUN
ahs-8094	483	10	.	.	PUNCT
ahs-8094	484	1	methods	method	NOUN
ahs-8094	484	2	and	and	CCONJ
ahs-8094	484	3	experiments	experiment	NOUN
ahs-8094	484	4	.	.	PUNCT
ahs-8094	485	1	­	­	NUM
ahs-8094	485	2	centre	centre	NOUN
ahs-8094	485	3	for	for	ADP
ahs-8094	485	4	agricultural	agricultural	ADJ
ahs-8094	485	5	publishing	publishing	NOUN
ahs-8094	485	6	and	and	CCONJ
ahs-8094	485	7	documentation	documentation	NOUN
ahs-8094	485	8	,	,	PUNCT
ahs-8094	485	9	wageningen	wageningen	PROPN
ahs-8094	485	10	,	,	PUNCT
ahs-8094	485	11	the	the	DET
ahs-8094	485	12	netherlands	netherlands	PROPN
ahs-8094	485	13	,	,	PUNCT
ahs-8094	485	14	pp	pp	PROPN
ahs-8094	485	15	.	.	PUNCT
ahs-8094	485	16	207	207	NUM
ahs-8094	485	17	.	.	PUNCT
ahs-8094	486	1	olawale	olawale	PROPN
ahs-8094	486	2	a.	a.	PROPN
ahs-8094	486	3	,	,	PUNCT
ahs-8094	486	4	samuel	samuel	PROPN
ahs-8094	486	5	b.o	b.o	PROPN
ahs-8094	486	6	.	.	PROPN
ahs-8094	486	7	,	,	PUNCT
ahs-8094	486	8	solomon	solomon	PROPN
ahs-8094	486	9	a.s.o	a.s.o	PROPN
ahs-8094	486	10	.	.	PROPN
ahs-8094	486	11	,	,	PUNCT
ahs-8094	486	12	kumar	kumar	PROPN
ahs-8094	486	13	p.l	p.l	PROPN
ahs-8094	486	14	.	.	PROPN
ahs-8094	486	15	,	,	PUNCT
ahs-8094	486	16	2015	2015	NUM
ahs-8094	486	17	­	­	NOUN
ahs-8094	486	18	surveys	survey	NOUN
ahs-8094	486	19	of	of	ADP
ahs-8094	486	20	virus	virus	NOUN
ahs-8094	486	21	diseases	disease	NOUN
ahs-8094	486	22	on	on	ADP
ahs-8094	486	23	pepper	pepper	NOUN
ahs-8094	486	24	(	(	PUNCT
ahs-8094	486	25	capsicum	capsicum	NOUN
ahs-8094	486	26	spp	spp	NOUN
ahs-8094	486	27	.	.	PUNCT
ahs-8094	486	28	)	)	PUNCT
ahs-8094	487	1	in	in	ADP
ahs-8094	487	2	south‐west	south‐w	ADJ
ahs-8094	487	3	nigeria	nigeria	PROPN
ahs-8094	487	4	.	.	PUNCT
ahs-8094	488	1	­	­	PROPN
ahs-8094	488	2	afr	afr	PROPN
ahs-8094	488	3	.	.	PUNCT
ahs-8094	489	1	j.	j.	PROPN
ahs-8094	489	2	biotechnol	biotechnol	PROPN
ahs-8094	489	3	.	.	PROPN
ahs-8094	489	4	,	,	PUNCT
ahs-8094	489	5	14(48	14(48	NUM
ahs-8094	489	6	):	):	PUNCT
ahs-8094	489	7	3198­3205	3198­3205	NUM
ahs-8094	489	8	.	.	PUNCT
ahs-8094	490	1	rahman	rahman	PROPN
ahs-8094	490	2	m.s	m.s	PROPN
ahs-8094	490	3	.	.	PROPN
ahs-8094	490	4	,	,	PUNCT
ahs-8094	490	5	akanda	akanda	NOUN
ahs-8094	490	6	a.m.	a.m.	ADV
ahs-8094	490	7	,	,	PUNCT
ahs-8094	490	8	mian	mian	PROPN
ahs-8094	490	9	i.h	i.h	PROPN
ahs-8094	490	10	.	.	PROPN
ahs-8094	490	11	,	,	PUNCT
ahs-8094	490	12	bhuiyan	bhuiyan	PROPN
ahs-8094	490	13	m.k.a	m.k.a	PROPN
ahs-8094	490	14	.	.	PROPN
ahs-8094	490	15	,	,	PUNCT
ahs-8094	490	16	hossain	hossain	PROPN
ahs-8094	490	17	m.m	m.m	PROPN
ahs-8094	490	18	.	.	PROPN
ahs-8094	490	19	,	,	PUNCT
ahs-8094	490	20	2016	2016	NUM
ahs-8094	490	21	­	­	VERB
ahs-8094	490	22	new	new	ADJ
ahs-8094	490	23	sources	source	NOUN
ahs-8094	490	24	of	of	ADP
ahs-8094	490	25	resistance	resistance	NOUN
ahs-8094	490	26	to	to	ADP
ahs-8094	490	27	cucumber	cucumber	PROPN
ahs-8094	490	28	mosaic	mosaic	PROPN
ahs-8094	490	29	virus	virus	NOUN
ahs-8094	490	30	in	in	ADP
ahs-8094	490	31	capsicum	capsicum	NOUN
ahs-8094	490	32	annuum	annuum	NOUN
ahs-8094	490	33	.	.	PUNCT
ahs-8094	491	1	­	­	PROPN
ahs-8094	491	2	j.	j.	PROPN
ahs-8094	491	3	crop	crop	PROPN
ahs-8094	491	4	sci	sci	PROPN
ahs-8094	491	5	.	.	PROPN
ahs-8094	491	6	biotechnol	biotechnol	PROPN
ahs-8094	491	7	.	.	PUNCT
ahs-8094	491	8	,	,	PUNCT
ahs-8094	491	9	19	19	NUM
ahs-8094	491	10	(	(	PUNCT
ahs-8094	491	11	3	3	NUM
ahs-8094	491	12	)	)	PUNCT
ahs-8094	491	13	:	:	PUNCT
ahs-8094	492	1	249­258	249­258	X
ahs-8094	492	2	.	.	PUNCT
ahs-8094	493	1	rajput	rajput	PROPN
ahs-8094	493	2	v.s.	v.s.	PROPN
ahs-8094	493	3	,	,	PUNCT
ahs-8094	493	4	prajapati	prajapati	PROPN
ahs-8094	493	5	b.g	b.g	PROPN
ahs-8094	493	6	.	.	PROPN
ahs-8094	493	7	,	,	PUNCT
ahs-8094	493	8	pareek	pareek	PROPN
ahs-8094	493	9	a.	a.	NOUN
ahs-8094	493	10	,	,	PUNCT
ahs-8094	493	11	patel	patel	PROPN
ahs-8094	493	12	p.s	p.s	PROPN
ahs-8094	493	13	.	.	PROPN
ahs-8094	493	14	,	,	PUNCT
ahs-8094	493	15	2017	2017	NUM
ahs-8094	493	16	­	­	VERB
ahs-8094	493	17	studies	study	NOUN
ahs-8094	493	18	on	on	ADP
ahs-8094	493	19	population	population	NOUN
ahs-8094	493	20	dynamics	dynamic	NOUN
ahs-8094	493	21	of	of	ADP
ahs-8094	493	22	major	major	ADJ
ahs-8094	493	23	insect	insect	NOUN
ahs-8094	493	24	pests	pest	NOUN
ahs-8094	493	25	infesting	infest	VERB
ahs-8094	493	26	chilli	chilli	NOUN
ahs-8094	493	27	(	(	PUNCT
ahs-8094	493	28	capsicum	capsicum	NOUN
ahs-8094	493	29	annum	annum	PROPN
ahs-8094	493	30	l.	l.	PROPN
ahs-8094	493	31	)	)	PUNCT
ahs-8094	493	32	.	.	PUNCT
ahs-8094	494	1	‐	‐	ADJ
ahs-8094	494	2	int	int	NOUN
ahs-8094	494	3	.	.	PUNCT
ahs-8094	495	1	j.	j.	PROPN
ahs-8094	495	2	pure	pure	PROPN
ahs-8094	495	3	app	app	PROPN
ahs-8094	495	4	.	.	PUNCT
ahs-8094	496	1	biosci	biosci	PROPN
ahs-8094	496	2	.	.	PROPN
ahs-8094	496	3	,	,	PUNCT
ahs-8094	496	4	5(6	5(6	NUM
ahs-8094	496	5	):	):	PUNCT
ahs-8094	496	6	1465­1470	1465­1470	NUM
ahs-8094	496	7	.	.	PUNCT
ahs-8094	496	8	rdb	rdb	PROPN
ahs-8094	496	9	,	,	PUNCT
ahs-8094	496	10	2010	2010	NUM
ahs-8094	496	11	­	­	VERB
ahs-8094	496	12	rwanda	rwanda	PROPN
ahs-8094	496	13	export	export	NOUN
ahs-8094	496	14	catalogue	catalogue	NOUN
ahs-8094	496	15	.	.	PUNCT
ahs-8094	497	1	‐	‐	PROPN
ahs-8094	497	2	rwanda	rwanda	PROPN
ahs-8094	497	3	development	development	PROPN
ahs-8094	497	4	board	board	PROPN
ahs-8094	497	5	,	,	PUNCT
ahs-8094	497	6	pp	pp	ADV
ahs-8094	497	7	.	.	PUNCT
ahs-8094	498	1	46	46	NUM
ahs-8094	498	2	.	.	PUNCT
ahs-8094	499	1	http://www.rdb.rw/	http://www.rdb.rw/	PROPN
ahs-8094	499	2	uploads	upload	VERB
ahs-8094	499	3	/	/	SYM
ahs-8094	499	4	tx_sbdownloader	tx_sbdownloader	NOUN
ahs-8094	499	5	/	/	SYM
ahs-8094	499	6	rwandaexportcatalogue	rwandaexportcatalogue	NOUN
ahs-8094	499	7	.	.	PUNCT
ahs-8094	500	1	pdf	pdf	PROPN
ahs-8094	500	2	.	.	PUNCT
ahs-8094	501	1	reddy	reddy	PROPN
ahs-8094	501	2	m.k	m.k	PROPN
ahs-8094	501	3	.	.	PROPN
ahs-8094	501	4	,	,	PUNCT
ahs-8094	501	5	srivastava	srivastava	PROPN
ahs-8094	501	6	a.	a.	PROPN
ahs-8094	501	7	,	,	PUNCT
ahs-8094	501	8	kumar	kumar	PROPN
ahs-8094	501	9	s.	s.	PROPN
ahs-8094	501	10	,	,	PUNCT
ahs-8094	501	11	kumar	kumar	PROPN
ahs-8094	501	12	r.	r.	PROPN
ahs-8094	501	13	,	,	PUNCT
ahs-8094	501	14	chawda	chawda	PROPN
ahs-8094	501	15	n.	n.	PROPN
ahs-8094	501	16	,	,	PUNCT
ahs-8094	501	17	ebert	ebert	PROPN
ahs-8094	501	18	a.w	a.w	PROPN
ahs-8094	501	19	.	.	PROPN
ahs-8094	501	20	,	,	PUNCT
ahs-8094	501	21	vishwakarma	vishwakarma	PROPN
ahs-8094	501	22	m.	m.	NOUN
ahs-8094	501	23	,	,	PUNCT
ahs-8094	501	24	2014	2014	NUM
ahs-8094	501	25	­	­	NOUN
ahs-8094	501	26	chilli	chilli	NOUN
ahs-8094	501	27	(	(	PUNCT
ahs-8094	501	28	capsicum	capsicum	NOUN
ahs-8094	501	29	annuum	annuum	PROPN
ahs-8094	501	30	l.	l.	PROPN
ahs-8094	501	31	)	)	PUNCT
ahs-8094	501	32	breeding	breeding	NOUN
ahs-8094	501	33	in	in	ADP
ahs-8094	501	34	india	india	PROPN
ahs-8094	501	35	:	:	PUNCT
ahs-8094	501	36	an	an	DET
ahs-8094	501	37	over‐	over‐	NOUN
ahs-8094	501	38	view	view	NOUN
ahs-8094	501	39	.	.	PUNCT
ahs-8094	502	1	­	­	PROPN
ahs-8094	502	2	sabrao	sabrao	PROPN
ahs-8094	502	3	j.	j.	PROPN
ahs-8094	502	4	breed	breed	PROPN
ahs-8094	502	5	.	.	PUNCT
ahs-8094	503	1	genet	genet	NOUN
ahs-8094	503	2	.	.	PUNCT
ahs-8094	503	3	,	,	PUNCT
ahs-8094	503	4	46	46	NUM
ahs-8094	503	5	:	:	PUNCT
ahs-8094	503	6	160­173	160­173	NUM
ahs-8094	503	7	.	.	PUNCT
ahs-8094	504	1	shah	shah	PROPN
ahs-8094	504	2	h.	h.	PROPN
ahs-8094	504	3	,	,	PUNCT
ahs-8094	504	4	yasmin	yasmin	PROPN
ahs-8094	504	5	t.	t.	PROPN
ahs-8094	504	6	,	,	PUNCT
ahs-8094	504	7	fahim	fahim	PROPN
ahs-8094	504	8	m.	m.	NOUN
ahs-8094	504	9	,	,	PUNCT
ahs-8094	504	10	hameed	hameed	PROPN
ahs-8094	504	11	s.	s.	PROPN
ahs-8094	504	12	,	,	PUNCT
ahs-8094	504	13	haque	haque	PROPN
ahs-8094	504	14	m.i	m.i	PROPN
ahs-8094	504	15	.	.	PROPN
ahs-8094	504	16	,	,	PUNCT
ahs-8094	504	17	2009	2009	NUM
ahs-8094	504	18	­	­	NUM
ahs-8094	504	19	prevalence	prevalence	NOUN
ahs-8094	504	20	,	,	PUNCT
ahs-8094	504	21	occurrence	occurrence	NOUN
ahs-8094	504	22	and	and	CCONJ
ahs-8094	504	23	distribution	distribution	NOUN
ahs-8094	504	24	of	of	ADP
ahs-8094	504	25	chilli	chilli	NOUN
ahs-8094	504	26	veinal	veinal	ADJ
ahs-8094	504	27	mottle	mottle	NOUN
ahs-8094	504	28	virus	virus	NOUN
ahs-8094	504	29	in	in	ADP
ahs-8094	504	30	pakistan	pakistan	PROPN
ahs-8094	504	31	.	.	PUNCT
ahs-8094	505	1	­	­	PROPN
ahs-8094	505	2	pak	pak	PROPN
ahs-8094	505	3	.	.	PUNCT
ahs-8094	506	1	j.	j.	PROPN
ahs-8094	506	2	bot	bot	PROPN
ahs-8094	506	3	.	.	PROPN
ahs-8094	506	4	,	,	PUNCT
ahs-8094	506	5	41(2	41(2	NUM
ahs-8094	506	6	):	):	PUNCT
ahs-8094	506	7	955­	955­	NUM
ahs-8094	506	8	965	965	NUM
ahs-8094	506	9	.	.	PUNCT
ahs-8094	507	1	skelton	skelton	PROPN
ahs-8094	507	2	a.	a.	PROPN
ahs-8094	507	3	,	,	PUNCT
ahs-8094	507	4	uzayisenge	uzayisenge	PROPN
ahs-8094	507	5	b.	b.	PROPN
ahs-8094	507	6	,	,	PUNCT
ahs-8094	507	7	fowkes	fowke	VERB
ahs-8094	507	8	a.	a.	PROPN
ahs-8094	507	9	,	,	PUNCT
ahs-8094	507	10	adams	adams	PROPN
ahs-8094	507	11	i.	i.	PROPN
ahs-8094	507	12	,	,	PUNCT
ahs-8094	507	13	bux­	bux­	PROPN
ahs-8094	507	14	ton­kirk	ton­kirk	NUM
ahs-8094	507	15	a.	a.	NOUN
ahs-8094	507	16	,	,	PUNCT
ahs-8094	507	17	harju	harju	VERB
ahs-8094	507	18	v.	v.	ADV
ahs-8094	507	19	,	,	PUNCT
ahs-8094	507	20	forde	forde	PROPN
ahs-8094	507	21	s.	s.	PROPN
ahs-8094	507	22	,	,	PUNCT
ahs-8094	507	23	ward	ward	PROPN
ahs-8094	507	24	r.	r.	PROPN
ahs-8094	507	25	,	,	PUNCT
ahs-8094	507	26	ritchie	ritchie	PROPN
ahs-8094	507	27	b.	b.	PROPN
ahs-8094	507	28	,	,	PUNCT
ahs-8094	507	29	rutherford	rutherford	PROPN
ahs-8094	507	30	m.	m.	PROPN
ahs-8094	507	31	,	,	PUNCT
ahs-8094	507	32	offord	offord	PROPN
ahs-8094	507	33	l.	l.	PROPN
ahs-8094	507	34	,	,	PUNCT
ahs-8094	507	35	umulisa	umulisa	PROPN
ahs-8094	507	36	c.	c.	PROPN
ahs-8094	507	37	,	,	PUNCT
ahs-8094	507	38	waweru	waweru	PROPN
ahs-8094	507	39	b.	b.	PROPN
ahs-8094	507	40	,	,	PUNCT
ahs-8094	507	41	kagiraneza	kagiraneza	PROPN
ahs-8094	507	42	b.	b.	PROPN
ahs-8094	507	43	,	,	PUNCT
ahs-8094	507	44	karangwa	karangwa	PROPN
ahs-8094	507	45	p.	p.	PROPN
ahs-8094	507	46	,	,	PUNCT
ahs-8094	507	47	fox	fox	PROPN
ahs-8094	507	48	a.	a.	PROPN
ahs-8094	507	49	,	,	PUNCT
ahs-8094	507	50	2018	2018	NUM
ahs-8094	507	51	­	­	VERB
ahs-8094	507	52	first	first	ADJ
ahs-8094	507	53	http://www.faostat.org	http://www.faostat.org	PROPN
ahs-8094	507	54	adv	adv	PROPN
ahs-8094	507	55	.	.	PUNCT
ahs-8094	507	56	hort	hort	PROPN
ahs-8094	507	57	.	.	PUNCT
ahs-8094	508	1	sci	sci	PROPN
ahs-8094	508	2	.	.	PROPN
ahs-8094	508	3	,	,	PUNCT
ahs-8094	508	4	2020	2020	NUM
ahs-8094	508	5	34(4	34(4	NUM
ahs-8094	508	6	):	):	PUNCT
ahs-8094	508	7	397­412	397­412	NUM
ahs-8094	508	8	412	412	NUM
ahs-8094	508	9	report	report	NOUN
ahs-8094	508	10	of	of	ADP
ahs-8094	508	11	pepper	pepper	NOUN
ahs-8094	508	12	veinal	veinal	ADJ
ahs-8094	508	13	mottle	mottle	NOUN
ahs-8094	508	14	virus	virus	NOUN
ahs-8094	508	15	,	,	PUNCT
ahs-8094	508	16	pepper	pepper	NOUN
ahs-8094	508	17	yellows	yellow	NOUN
ahs-8094	508	18	virus	virus	NOUN
ahs-8094	508	19	and	and	CCONJ
ahs-8094	508	20	a	a	DET
ahs-8094	508	21	novel	novel	ADJ
ahs-8094	508	22	enamovirus	enamovirus	NOUN
ahs-8094	508	23	in	in	ADP
ahs-8094	508	24	hot	hot	ADJ
ahs-8094	508	25	pepper	pepper	NOUN
ahs-8094	508	26	(	(	PUNCT
ahs-8094	508	27	capsicum	capsicum	NOUN
ahs-8094	508	28	sp	sp	NOUN
ahs-8094	508	29	.	.	PUNCT
ahs-8094	508	30	)	)	PUNCT
ahs-8094	508	31	in	in	ADP
ahs-8094	508	32	rwanda	rwanda	PROPN
ahs-8094	508	33	.	.	PUNCT
ahs-8094	509	1	­	­	VERB
ahs-8094	509	2	new	new	ADJ
ahs-8094	509	3	dis	dis	PROPN
ahs-8094	509	4	.	.	PUNCT
ahs-8094	510	1	rep	rep	PROPN
ahs-8094	510	2	.	.	PROPN
ahs-8094	510	3	,	,	PUNCT
ahs-8094	510	4	37	37	NUM
ahs-8094	510	5	:	:	SYM
ahs-8094	510	6	5	5	NUM
ahs-8094	510	7	.	.	X
ahs-8094	510	8	sun	sun	NOUN
ahs-8094	510	9	m.	m.	NOUN
ahs-8094	510	10	,	,	PUNCT
ahs-8094	510	11	voorrips	voorrip	VERB
ahs-8094	510	12	r.e	r.e	PROPN
ahs-8094	510	13	.	.	PROPN
ahs-8094	510	14	,	,	PUNCT
ahs-8094	510	15	steenhuis­broers	steenhuis­broer	NOUN
ahs-8094	510	16	g.	g.	PROPN
ahs-8094	510	17	,	,	PUNCT
ahs-8094	510	18	westen­	westen­	PROPN
ahs-8094	510	19	de	de	PROPN
ahs-8094	510	20	w.v	w.v	PROPN
ahs-8094	510	21	.	.	PROPN
ahs-8094	510	22	,	,	PUNCT
ahs-8094	510	23	vosman	vosman	PROPN
ahs-8094	510	24	b.	b.	PROPN
ahs-8094	510	25	,	,	PUNCT
ahs-8094	510	26	2018	2018	NUM
ahs-8094	510	27	­	­	NUM
ahs-8094	510	28	reduced	reduce	VERB
ahs-8094	510	29	phloem	phloem	NOUN
ahs-8094	510	30	uptake	uptake	NOUN
ahs-8094	510	31	of	of	ADP
ahs-8094	510	32	myzus	myzus	NOUN
ahs-8094	510	33	persicae	persicae	NOUN
ahs-8094	510	34	on	on	ADP
ahs-8094	510	35	an	an	DET
ahs-8094	510	36	aphid	aphid	NOUN
ahs-8094	510	37	resistant	resistant	ADJ
ahs-8094	510	38	pepper	pepper	NOUN
ahs-8094	510	39	acces‐	acces‐	NOUN
ahs-8094	510	40	sion	sion	PROPN
ahs-8094	510	41	.	.	PUNCT
ahs-8094	511	1	­	­	NUM
ahs-8094	511	2	bmc	bmc	PROPN
ahs-8094	511	3	plant	plant	NOUN
ahs-8094	511	4	biol	biol	NOUN
ahs-8094	511	5	.	.	PUNCT
ahs-8094	512	1	,	,	PUNCT
ahs-8094	512	2	18	18	NUM
ahs-8094	512	3	:	:	SYM
ahs-8094	512	4	138	138	NUM
ahs-8094	512	5	.	.	PUNCT
ahs-8094	512	6	sun	sun	NOUN
ahs-8094	512	7	m.	m.	NOUN
ahs-8094	512	8	,	,	PUNCT
ahs-8094	512	9	voorrips	voorrip	VERB
ahs-8094	512	10	r.e	r.e	PROPN
ahs-8094	512	11	.	.	PROPN
ahs-8094	512	12	,	,	PUNCT
ahs-8094	512	13	westende	westende	PROPN
ahs-8094	512	14	w.v	w.v	PROPN
ahs-8094	512	15	.	.	PROPN
ahs-8094	512	16	,	,	PUNCT
ahs-8094	513	1	kaauwen	kaauwen	PROPN
ahs-8094	513	2	m.v	m.v	PROPN
ahs-8094	513	3	.	.	PROPN
ahs-8094	513	4	,	,	PUNCT
ahs-8094	513	5	visser	visser	PROPN
ahs-8094	513	6	r.g.f	r.g.f	PROPN
ahs-8094	513	7	.	.	PROPN
ahs-8094	513	8	,	,	PUNCT
ahs-8094	513	9	vosman	vosman	PROPN
ahs-8094	513	10	b.	b.	PROPN
ahs-8094	513	11	,	,	PUNCT
ahs-8094	513	12	2019	2019	NUM
ahs-8094	513	13	­	­	VERB
ahs-8094	513	14	aphid	aphid	NOUN
ahs-8094	513	15	resistance	resistance	NOUN
ahs-8094	513	16	in	in	ADP
ahs-8094	513	17	capsicum	capsicum	NOUN
ahs-8094	513	18	maps	map	NOUN
ahs-8094	513	19	to	to	ADP
ahs-8094	513	20	a	a	DET
ahs-8094	513	21	locus	locus	NOUN
ahs-8094	513	22	containing	contain	VERB
ahs-8094	513	23	lrr	lrr	ADJ
ahs-8094	513	24	-	-	PUNCT
ahs-8094	513	25	rlk	rlk	ADJ
ahs-8094	513	26	gene	gene	NOUN
ahs-8094	513	27	analogues	analogue	NOUN
ahs-8094	513	28	.	.	PUNCT
ahs-8094	514	1	­	­	PROPN
ahs-8094	514	2	theor	theor	PROPN
ahs-8094	514	3	.	.	PUNCT
ahs-8094	515	1	appl	appl	PROPN
ahs-8094	515	2	.	.	PUNCT
ahs-8094	516	1	genet	genet	PROPN
ahs-8094	516	2	.	.	PUNCT
ahs-8094	516	3	,	,	PUNCT
ahs-8094	516	4	133	133	NUM
ahs-8094	516	5	:	:	PUNCT
ahs-8094	516	6	227­237	227­237	NUM
ahs-8094	516	7	.	.	PUNCT
ahs-8094	517	1	suzuki	suzuki	PROPN
ahs-8094	517	2	k.	k.	PROPN
ahs-8094	517	3	,	,	PUNCT
ahs-8094	517	4	kurida	kurida	PROPN
ahs-8094	517	5	t.	t.	PROPN
ahs-8094	517	6	,	,	PUNCT
ahs-8094	517	7	miura	miura	PROPN
ahs-8094	517	8	y.	y.	PROPN
ahs-8094	517	9	,	,	PUNCT
ahs-8094	517	10	murai	murai	PROPN
ahs-8094	517	11	j.	j.	PROPN
ahs-8094	517	12	,	,	PUNCT
ahs-8094	517	13	2003	2003	NUM
ahs-8094	517	14	­	­	NOUN
ahs-8094	517	15	screening	screening	NOUN
ahs-8094	517	16	and	and	CCONJ
ahs-8094	517	17	field	field	NOUN
ahs-8094	517	18	trials	trial	NOUN
ahs-8094	517	19	of	of	ADP
ahs-8094	517	20	virus	virus	NOUN
ahs-8094	517	21	resistant	resistant	ADJ
ahs-8094	517	22	sources	source	NOUN
ahs-8094	517	23	in	in	ADP
ahs-8094	517	24	capsicum	capsicum	NOUN
ahs-8094	517	25	spp	spp	NOUN
ahs-8094	517	26	.	.	PUNCT
ahs-8094	518	1	­	­	PROPN
ahs-8094	518	2	plant	plant	PROPN
ahs-8094	518	3	dis	dis	PROPN
ahs-8094	518	4	.	.	PROPN
ahs-8094	518	5	,	,	PUNCT
ahs-8094	518	6	87	87	NUM
ahs-8094	518	7	:	:	PUNCT
ahs-8094	518	8	779­783	779­783	NUM
ahs-8094	518	9	.	.	PUNCT
ahs-8094	518	10	syller	syller	PROPN
ahs-8094	518	11	j.	j.	PROPN
ahs-8094	518	12	,	,	PUNCT
ahs-8094	518	13	2012	2012	NUM
ahs-8094	518	14	­	­	VERB
ahs-8094	518	15	facilitative	facilitative	ADJ
ahs-8094	518	16	and	and	CCONJ
ahs-8094	518	17	antagonistic	antagonistic	ADJ
ahs-8094	518	18	interactions	interaction	NOUN
ahs-8094	518	19	between	between	ADP
ahs-8094	518	20	plant	plant	NOUN
ahs-8094	518	21	viruses	virus	NOUN
ahs-8094	518	22	in	in	ADP
ahs-8094	518	23	mixed	mixed	ADJ
ahs-8094	518	24	infections	infection	NOUN
ahs-8094	518	25	.	.	PUNCT
ahs-8094	519	1	­	­	PROPN
ahs-8094	519	2	mol	mol	PROPN
ahs-8094	519	3	.	.	PUNCT
ahs-8094	519	4	plant	plant	NOUN
ahs-8094	519	5	pathol	pathol	NOUN
ahs-8094	519	6	.	.	PUNCT
ahs-8094	519	7	,	,	PUNCT
ahs-8094	519	8	13(2	13(2	PROPN
ahs-8094	519	9	):	):	PUNCT
ahs-8094	519	10	204­216	204­216	NOUN
ahs-8094	519	11	.	.	PUNCT
ahs-8094	520	1	verdoodt	verdoodt	PROPN
ahs-8094	520	2	a.	a.	PROPN
ahs-8094	520	3	,	,	PUNCT
ahs-8094	520	4	van	van	PROPN
ahs-8094	520	5	ranst	ranst	PROPN
ahs-8094	520	6	e.	e.	PROPN
ahs-8094	520	7	,	,	PUNCT
ahs-8094	520	8	2003	2003	NUM
ahs-8094	520	9	a	a	DET
ahs-8094	520	10	­	­	NUM
ahs-8094	520	11	land	land	NOUN
ahs-8094	520	12	evaluation	evaluation	NOUN
ahs-8094	520	13	for	for	ADP
ahs-8094	520	14	agricultural	agricultural	ADJ
ahs-8094	520	15	production	production	NOUN
ahs-8094	520	16	in	in	ADP
ahs-8094	520	17	the	the	DET
ahs-8094	520	18	tropics	tropic	NOUN
ahs-8094	520	19	:	:	PUNCT
ahs-8094	520	20	a	a	DET
ahs-8094	520	21	large	large	ADJ
ahs-8094	520	22	scale	scale	NOUN
ahs-8094	520	23	land	land	NOUN
ahs-8094	520	24	suitability	suitability	NOUN
ahs-8094	520	25	classification	classification	NOUN
ahs-8094	520	26	for	for	ADP
ahs-8094	520	27	rwanda	rwanda	PROPN
ahs-8094	520	28	.	.	PUNCT
ahs-8094	521	1	­	­	PROPN
ahs-8094	521	2	laboratory	laboratory	NOUN
ahs-8094	521	3	of	of	ADP
ahs-8094	521	4	soil	soil	NOUN
ahs-8094	521	5	science	science	NOUN
ahs-8094	521	6	,	,	PUNCT
ahs-8094	521	7	ghent	ghent	PROPN
ahs-8094	521	8	university	university	PROPN
ahs-8094	521	9	,	,	PUNCT
ahs-8094	521	10	ghent	ghent	NOUN
ahs-8094	521	11	,	,	PUNCT
ahs-8094	521	12	belgium	belgium	PROPN
ahs-8094	521	13	.	.	PUNCT
ahs-8094	522	1	visalakshi	visalakshi	PROPN
ahs-8094	522	2	m.	m.	PROPN
ahs-8094	522	3	,	,	PUNCT
ahs-8094	522	4	pandiyan	pandiyan	NOUN
ahs-8094	522	5	m.	m.	NOUN
ahs-8094	522	6	,	,	PUNCT
ahs-8094	522	7	2018	2018	NUM
ahs-8094	522	8	­	­	VERB
ahs-8094	522	9	crop	crop	NOUN
ahs-8094	522	10	improvement	improvement	NOUN
ahs-8094	522	11	in	in	ADP
ahs-8094	522	12	chillies	chilli	NOUN
ahs-8094	522	13	:	:	PUNCT
ahs-8094	522	14	an	an	DET
ahs-8094	522	15	overview	overview	NOUN
ahs-8094	522	16	.	.	PUNCT
ahs-8094	523	1	­	­	PROPN
ahs-8094	523	2	int	int	PROPN
ahs-8094	523	3	.	.	PUNCT
ahs-8094	524	1	j.	j.	PROPN
ahs-8094	524	2	chem	chem	PROPN
ahs-8094	524	3	.	.	PUNCT
ahs-8094	525	1	stud	stud	PROPN
ahs-8094	525	2	.	.	PUNCT
ahs-8094	525	3	,	,	PUNCT
ahs-8094	525	4	6(4	6(4	NUM
ahs-8094	525	5	):	):	PUNCT
ahs-8094	525	6	1736­	1736­	NUM
ahs-8094	525	7	1744	1744	NUM
ahs-8094	525	8	.	.	PUNCT
ahs-8094	526	1	wang	wang	PROPN
ahs-8094	526	2	x.	x.	PROPN
ahs-8094	526	3	,	,	PUNCT
ahs-8094	526	4	liu	liu	PROPN
ahs-8094	526	5	f.	f.	PROPN
ahs-8094	526	6	,	,	PUNCT
ahs-8094	526	7	zhou	zhou	PROPN
ahs-8094	526	8	g.	g.	PROPN
ahs-8094	526	9	,	,	PUNCT
ahs-8094	526	10	li	li	PROPN
ahs-8094	526	11	x.h	x.h	PROPN
ahs-8094	526	12	.	.	PROPN
ahs-8094	526	13	,	,	PUNCT
ahs-8094	526	14	li	li	PROPN
ahs-8094	526	15	z.	z.	PROPN
ahs-8094	526	16	,	,	PUNCT
ahs-8094	526	17	2006	2006	NUM
ahs-8094	526	18	­	­	VERB
ahs-8094	526	19	detection	detection	NOUN
ahs-8094	526	20	and	and	CCONJ
ahs-8094	526	21	molecular	molecular	ADJ
ahs-8094	526	22	characterization	characterization	NOUN
ahs-8094	526	23	of	of	ADP
ahs-8094	526	24	pepper	pepper	NOUN
ahs-8094	526	25	mild	mild	ADJ
ahs-8094	526	26	mottle	mottle	NOUN
ahs-8094	526	27	virus	virus	NOUN
ahs-8094	526	28	in	in	ADP
ahs-8094	526	29	china	china	PROPN
ahs-8094	526	30	.	.	PUNCT
ahs-8094	527	1	­	­	PROPN
ahs-8094	527	2	j.	j.	PROPN
ahs-8094	527	3	phytopathol	phytopathol	PROPN
ahs-8094	527	4	.	.	PUNCT
ahs-8094	527	5	,	,	PUNCT
ahs-8094	527	6	154	154	NUM
ahs-8094	527	7	:	:	PUNCT
ahs-8094	527	8	755­757	755­757	PROPN
ahs-8094	527	9	.	.	PUNCT
ahs-8094	528	1	zitter	zitter	PROPN
ahs-8094	528	2	t.a	t.a	PROPN
ahs-8094	528	3	.	.	PROPN
ahs-8094	528	4	,	,	PUNCT
ahs-8094	529	1	murphy	murphy	PROPN
ahs-8094	529	2	j.f	j.f	PROPN
ahs-8094	529	3	.	.	PROPN
ahs-8094	529	4	,	,	PUNCT
ahs-8094	529	5	2009	2009	NUM
ahs-8094	529	6	­	­	NUM
ahs-8094	529	7	cucumber	cucumber	PROPN
ahs-8094	529	8	mosaic	mosaic	PROPN
ahs-8094	529	9	virus	virus	NOUN
ahs-8094	529	10	.	.	PUNCT
ahs-8094	530	1	­	­	VERB
ahs-8094	530	2	the	the	DET
ahs-8094	530	3	plant	plant	NOUN
ahs-8094	530	4	health	health	NOUN
ahs-8094	530	5	instructor	instructor	NOUN
ahs-8094	530	6	,	,	PUNCT
ahs-8094	530	7	doi	doi	NOUN
ahs-8094	530	8	:	:	PUNCT
ahs-8094	530	9	10.1094	10.1094	NUM
ahs-8094	530	10	/	/	SYM
ahs-8094	530	11	phi­i­2009­	phi­i­2009­	PROPN
ahs-8094	530	12	0518­01	0518­01	NOUN
ahs-8094	530	13	.	.	PUNCT