Impaginato 247 Adv. Hort. Sci., 2022 36(3): 247­251 DOI: 10.36253/ahsc­12347 Evaluation of Hemerocallis germplasm using single nucleotide polymorphisms of nrITS and chloroplast interspacer region S.Y. Park 1, Y.H. Joung 1, J.K. Suh 2, M.S. Roh 2, 3 (*) 1 School of Biological Sciences and Technology, Chonnam National University, 500‐757 Gwangju, Korea. 2 Department of Environmental Horticulture, College of Bioresource Science, Dankook University, Cheonan, 330‐714 Chungnam, Korea. 3 Current address: The Institute of Natural Resource Development, Mokpo National University, Muan, 58554 Jeonnam, Korea. Key words: Daylily, haplotype, nocturnal flowering, polymerase chain reaction, sequence analysis. Abstract: This study was initiated to distinguish nocturnal (night) flowering Hemerocallis species from day flowering species based on the single nucleotide polymorphisms (SNPs) of nuclear internal transcribed spacers 1, 2 in a riboso­ mal RNA gene (nrITS) and a chloroplast interspacer region (cpIS). Four noctur­ nal flowering species, H. citrina, H. thunbergii, H. minor, and H. lilioasphodelus were collected including Korea, and compared with day flowering species that included H. vespertina and H. hongdoensis. Based on the haplotypes of nrITS and cpIS, nocturnal species cannot be distinguished from day flowering species. Discrepancies in flowering time and haplotypes among H. minor accessions sug­ gest that more germplasm with diverse geographic origins should be evaluated and identification of other genes is required to effectively distinguish nocturnal species from day flowering species. 1. Introduction There are about 15­26 species/varieties in the genus Hemerocallis (USDA, ARS, National Genetic Resources Program, 2015). Using amplified fragment length polymorphisms (AFLP) markers, H. fulva L. were grouped separately from the nocturnal species H. thunbergii Baker and H. lilioas‐ phodelus L., while nocturnal H. minor Mill. and H. citrina Baroni, were grouped together in a different sub­cluster (Tomkins et al., 2001). The flowers of nocturnal Hemerocallis open late in the afternoon and wither the next morning (Fig. 1) (Chen and Noguchi, 2000). However, Gulia et al. (2009) classified H. minor as a diurnal species rather than a nocturnal species, confirming the study by Krestova and Nesterova (2003) that H. minor flowered in the morning under sunny weather at >16°C and with­ (*) Corresponding author: marksroh@gmail.com Citation: PARK S.Y., JOUNG Y.H., SUH J.K., ROH M.S., 2022 ­ Evaluation of Hemerocallis germpla‐ sm using single nucleotide polymorphisms of nrITS and chloroplast interspacer region. ­ Adv. Hort. Sci., 36(3): 247­251 Copyright: © 2022 Park S.Y., Joung Y.H., Suh J.K., Roh M.S. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 24 November 2021 Accepted for publication 31 August 2022 AHS Advances in Horticultural Science Short note https://doi.org/10.36253/ahsc-12347 http://www.fupress.net/index.php/ahs/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2022 36(3): 247­251 248 ered in the afternoon. Molecular markers have not previously been test­ ed to determine timing of flowering among Hemerocallis species. Therefore, this study was con­ ducted to investigate the use of SNPs of nuclear internal transcribed spacers 1, 2 in a ribosomal RNA gene (nrITS) and a chloroplast interspacer region (cpIS) to evaluate the genetic relationships between nocturnal and day flowering species of Hemerocallis. 2. Materials and Methods The nocturnal flowering species Hemerocallis thunbergii, H. minor, H. lilioasphodelus, and H. citri‐ na, and the day flowering species H. hongdoensis M.G. Chung & S.S. Kang, H. vespertina H. Hara, H. dumortierii C. Morren and hybrid ‘Stella de Oro’ were collected from Korea (K), China (C), United Kingdom (UK), United States of America (UA) and Germany (GE) (Table 1). Samples were designated as, for example, K1 (mother plant)/1­3 (seedling 1, 2, 3 from mother plant K1). Genomic DNA was isolated from young leaves using DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). Polymerase chain reaction (PCR) for nrITS was performed with a 18S rRNA gene specific forward primer ITS1 (5’­TAG AGG AAG GAG AAG TCG TAA CAA GG­3’) and primer ITS2 (5’­ GATTTTCAGTCCTCTGCTC­ TAC­3’). The reaction mix consisted of 12.5 μl of 2X F­ star Taq Smartmix (SolGent Co., Daejeon, Korea), 2 μl of each primer (0.4 μM final concentration), and 2 μl of genomic DNA. For cpIS, forward primer (5’ ­TCGT­ GAGGGTTCAAGTCCCTCT­3’) and reverse primer (5’­ GATTTTCAGTCCTCTGCTCTAC­3’) were used. The reaction mix consisted of 12.5 μl of 2X F­star Taq Smartmix (SolGent Co., Korea), 2 μl of each primer (0.4 μM final concentration), and 2 μl of genomic DNA (50 ng) and 5 μl of 5× Band Doctor buffer (SolGent), and made up to the 25 μl final vol­ ume with PCR ultrapure water. The PCR conditions were: 2 min at 95°C, followed by 35 cycles of 20 sec at 95°C, 40 sec at 65°C, and 1 min at 72°C, followed by 5 min of 72°C using an ABI Veriti Dx Thermal Cycler (Life Technologies, Grand Island, NY, USA). PCR products were direct sequenced as described by Park et al. (2014). Sequences were registered in the National Center for Biotechnology Information GenBank (NCBI, http://www.ncbi.nlm.nih.gov/). 3. Results and Discussion Based on the sequences of nrITS, three haplo­ types were identified: T I­1, T I­2, and T II (Table 2) and based on the sequences of cpIS, 7 haplotypes were identified: T I, TI­1, TII, TIII, TIV, TV, and TVI (Table 3). Sequences of cpIS were more informative to separate accessions than those of nrITS, suggest­ ing that the ITS region in Hemerocallis may not be useful as a potential source for species identification, although accessions of cultivated origin Kolkwitzia amabilis (Graebn.) Christenh were derived from the accession of known wild origin (AA816­84A) (Park et al., 2014). Nocturnal flowering H. citrina, H. thunbergii and H. lilioasphodelus flower in the afternoon and wither the following morning (Table 1, Fig. 1). The difference between two types of floral morphology of H. thun‐ bergii, based on the presence or absence of bracts subtending the flower buds; K7 lacked bracts while K8­9 had bracts was detected in the haplotype of cpIS, with K7 belonging to type I­1 and K8­9 belong­ ing to type I that may result from that the sequence of the ITS 2 region is more variable than that of the ITS 1 region (Ma et al., 2014). Nocturnal flowering H. thunbergii accessions collected from the same loca­ tion in Korea (K8­9, and K 8­13) should be evaluated Fig. 1 ­ Nocturnal H. thunbergii accession 7 collected from Korea (K7) showing flower opening at 4, 5, and 6 pm and closed by 10 AM following day. http://www.ncbi.nlm.nih.gov/ Park et al. ‐ Hemerocallis germplasm evaluation 249 further since these accessions were grouped togeth­ er with other H. thunbergii accessions (K1­3). There is no correlation between these nrITS hap­ lotypes and timing of flowering observed in H. citrina; collected from China (C2) and the United Kingdom (UK5), both belonging to type I, from Germany (GE4), belonging to type II, and from the United Kingdom (UK1), belonging to type III. This requires further examination collecting more accessions from differ­ ent collection sites. Further, in cpIS, day flowering H. hongdoensis and H. vespertina belonged to type I and II, respectively. When T was assigned for the ambiguous code C or T at the positions 78, 86, 99, 113, and 120 of nrITS sequence for type I­1, and A was assigned for A or G at 231, types I­1 and I­2 can be combined and all accessions can be assigned as type I, separated from H. minor (UK6 and GE3) as type II (Tables 1 and 2). They may be derived from different geographic ori­ gins of K14 or UA5 which were collected from Korea, belonging to type I­2, and exhibit some degree of genetic variation revealed in this study using univer­ sal primers for nrITS. However, different strains or populations of H. minor may exist since H. minor Table 1 ­ Accession information on Hemerocallis taxa (mother plants and their seedlings) with flowering characteristics. Haplotype based on the sequence analysis of nrITS and cpIS are indicated Scientific name Mother plant (leaf) Seedlings a Flowering time b Source, Country Haplotype (T) c nrITS cpIS H. thunbergii K1 d K1/1­3 N Jungseon­gun, Korea I­2 I H. thunbergii K2 K2/1­3 N I­2 I H. thunbergii K3 K3/1­3 N I­2 I H. thunbergii K7 N J.W. Chang, Gomyeong­dong, Jecheon­si, Chungcheongbuk­do, Korea I­2 I­1 H. thunbergii K8,9 e N E.J. Kim, Gomsi­gil, Ungdam­ri, Paju­gun, Kyunggi­do, Korea I­2 I Ka8­13 d N E.J. Kim, M.S. Roh, Gomsi­gil, Ungdam­ri, Paju­gun, Kyunggi­do, Korea I­2 IV H. thunbergii K11 N Hantaek Botanical Garden, Korea I­2 I H. thunbergii UK3, 4 N Royal Botanical Garden Edinburgh, UK (19300128A f) I­2 I H. thunbergii UA7 ­ N United States National Arboretum, Washington, DC, USA (USNA; NA54757.3 collected from Korea) I­2 I H. minor ­ K14/1­3 D Hantaek Botanical Garden, Korea I­2 I­1 H. minor UK6 UK6/1­3 N? Royal Botanical Garden Edinburgh, UK II V H. minor GE3/1­3 N? Botanischer Garten Leipzig (XX­O­LZ­AD439/2006) II V H. minor UA5 ­ D USNA; NA31800.1 I­2 I H. lilioasphodelus ­ C1/1 N X.W. Wu, China I­2 I C1/2­3 I­1 I H. liliasphodelus UA6 ­ N USNA; NA54879.3 I­2 I H. citrina ­ C2/1­3 N X.W. Wu, China I­2 I H. citrina UK1 N Royal Botanical Garden Edinburgh, UK (19685548A u) I­2 III H. citrina UK5 N Royal Botanical Garden Edinburgh, UK I­2 I H. citrina GE4/1­3 N Botanischer Garten Leipzig (XX­O­LZ­AW78/1998, 2000) I­2 II H. citrina ‘April Flower’ ­ C3/1­3 X.W. Wu, China I­2 I H. vespertina K12 K12/1­3 D Hantaek Botanical Garden, Korea I­2 II H. dumortierii C. Morren K13 D Hantaek Botanical Garden, Korea I­2 VI H. hongdoensis ­ K15/1­3 D Hantaek Botanical Garden, Korea I­2 I ‘Stella de Oro’ UA2 UA2/1­3 D M.S. Roh, Ann Arbor, MI., USA I­1 I a Seedlings 1, 2, 3 from mother plant K1. Designations of accession of mother plant and three seedlings are indicated as K1 and K1/1­3, respectively. b Flower opens in the morning and withers in the late afternoon (day, D) or opens in the late afternoon and withers early on the next morning (night, N). Flowering characteristics were not evaluated in this study for H. minor collected from Royal Botanical Garden Edinburgh, UK and Botanischer Garten Leipzig (XX­O­LZ­AD439/2006). c Refer to Table 2 for nrITS and Table 3 for cpIS haplotypes and single nucleotide polymorphisms. d Collected or received from Korea (K, Ka), United States of America (UA), United Kingdom (UK), Germany (GE), and China (C). e Samples of K8 and 9 and of Ka 8­13 were collected from the same location in 2011 and 2014, respectively. f Samples were of garden origin from Dendrologische Gartenerei in Pruhonce, Czech Republic via Peter Brownless. Adv. Hort. Sci., 2022 36(3): 247­251 250 flowers in the morning under sunny weather at >16oC and withers in the afternoon, as reported at the Botanical Garden Institute, Far East Branch, Russian Academy of Sciences (Krestova and Nesterova, 2003). The H. minor, received from the US National Arboretum (USNA; NA31800.1) original­ ly collected from Korea, flowers in the morning in Ann Arbor, MI, USA. Therefore, further investigation of Hemerocallis minor is needed to determine whether accessions collected from China, Korea and the far eastern part of Russia are of two different flowering types. Hemerocallis hybrid ‘Stella de Oro’ (UA2), day flowering landscape plant of unknown parentage, was grouped with H. minor collected from Korea (K14), but not with H. minor (UK6 and GE3) acces­ sions and their seedlings (K14/1­3) and UK6/1­3, based on the haplotypes of SNPs with a nrITS region (Table 2) and with cpIS (Table 3). Grouping of H. dumortieri (K13) with H. minor (UK6 and GE3) with nrITS region was also different from that with cpIS (Table 3). McGarty (2006) used AFLP markers from Hemerocallis species, and placed H. lilioasphodelus with H. thunbergii in one sub­group and H. citrina, H. minor, and H. dumortieri in another. This suggests that day and night flowering species cannot be sepa­ rated either by AFLP markers, or by SNPs from a nrITS region or cpIS, as attempted in this study. Difficulties with identifying species of Hemerocallis native to Korea may not be easy to resolve and flowering time in F1 hybrids between H. fulva (day flowering) and H. citrina (nocturnal flowering) showed discontinuous bimodal distribution (Hasegawa et al., 2006). Beyond the identification issue for the accessions H. thunbergii Ka8­13, grouping of species investigat­ ed in this study differs significantly between nrITS and cpIS (Tables 2 and 3). Difficulties with identifying species of Hemerocallis native to Korea may not be easy to resolve and flowering time in F1 hybrids between H. fulva (day flowering) and H. citrina (night flowering) showed discontinuous bimodal distribu­ tion (Hasegawa et al., 2006). Distinguishing nocturnal flowering forms of H. minor from day flowering forms is not possible due to the existence of two different genotypes collected from China, Korea and far eastern Russia and by testing the universal primers by SNPs of nrITS region and cpIS. However, these primers were used suc­ cessfully to identify mother plants and seedlings of Ligustrum quihoui Carrière (Ma et al . , 2014) . Table 2 ­ Haplotype based on single nucleotide polymorphisms (SNPs) and insertion and deletion (IN/Del) of a nuclear internal tran­ scribed spacer 1, 2 in a ribosomal RNA gene of Hemerocallis accessions Haplotype NCBI Registration Positions and codes of nucleotide Single nucleotide polymorphisms In/Del 78 86 99 113 120 170 206 210 231 254 432 568 597 435­441 I­1 KT189161 C/T C/T C C/T C/T A G A A/G A A G G C7 I­2 KT189162 C C C C C A G A A A A G G C6­7 II KT189163 C C T C C G C C C C G A A C7 Table 3 ­ Haplotypes based on single nucleotide polymorphisms (SNPs) and insertion and deletion (In/Del) of a chloroplast interspacer region of Hemerocallis accessions Haplotype NCBI registration Positions and codes of nucleotide Single nucleotide polymorphisms In/Del 26 216 243 246 291 315 37 302 I KT189164 T C C C A A T9 T7 I­1 KT189165 T C C C A A T9 T8 II KT189166 T C C C C A T9 T8 III KT189167 T C C A A A T9 T8 IV KT189168 C C A A A A T8 T8 V KT189169 C C C A A A T8 T8 VI KT189170 C A C A A A T10 T8 Park et al. ‐ Hemerocallis germplasm evaluation 251 Seedlings grouped in the haplotype with their moth­ er plants, except the mother plant (C1) and seedlings 2­3 of H. liloasphodelus (C1/2­3), which belonged to type I, type I­2 and I­1, respectively, in nr­ITS region (Tables 1 and 2). The current primers for nrITS region and cpIS cannot be used to differentiate noc­ turnal flowering species from day flowering species. Lee and Maki (2015) reported that cpDNA in the majority of cultivars were inherited from H. albo‐ marginata, although the leaf morphology was simi­ lar to H. sieboldiana, indicating that nrITS should fur­ ther be investigated. 4. Conclusions The sequence variations of nrITS region and cpIS cannot be used to distinguish nocturnal flowering species from day flowering Hemerocallis species. Markers other than those evaluated in this study should be evaluated. Genetic variations among seedlings or between mother plant and their seedlings were observed in H. lilioasphodelus (C1/1 vs. C1/2­3), requiring seedlings of H. lilioasphodelus to investigate to confirm the results of this study. Discrepancies in flowering time among H. minor accessions also suggest that more germplasm with diverse geographic origins should be evaluated. Acknowledgements Critical review and English editing of the manu­ script by Dr. C.J. Catanzaro, Virginia State University, VA, USA, is greatly appreciated. References CHEN X., NOGUCHI J., 2000 ­ 31. Hemerocallis Linnaeus, Sp. P1. 1:324. 1753. ­ Flora of China, 24: 161­165. GULIA S.K., SINGH B.P., CARTTER J., GRIESBACH R.J., 2009 ­ Daylily: Botany, propagation, breeding. ­ Hort. Rev., 35: 193­220. HASEGAWA M., YAHARA T., YASUMOTO A., HOTTA M., 2006 ­ Bimodal distribution of flowering time in a nat‐ ural hybrid population of daylily (Hemerocallis fulva) and night lily (Hemerocallis citrina). ­ J. Plant Res., 119: 63­68. KRESTOVA I.N., NESTEROVA S.V., 2003 ­ Flowering and pol‐ lination of the native daylily species (Hemerocallis) in the Botanical Garden Institute, Far East Branch, Russian Academy of Sciences. ­ Contemp. Problems Ecol., 6: 48­ 454. LEE S., MAKI M., 2015 ­ Origins of Hosta cultivars based on sequence variations in chloroplast DNA. ­ Hort. J., 84: 350­354. MA S.H., BURCHI G., SUH J.K., ROH M.S., JOUNG Y.H., 2014 ­ Identification of Ligustrum seedlings based on sequence analysis of an internal transcribed spacer. ­ Hort. Environ. Biotechnol., 55: 423­427. McGARTY T.P., 2006 ­ Phylogenetics, DNA, classification and the genus Hemerocallis. ­ http://www.telmarcgar­ dens.com. PARK S.E., BURCHI G., ROH M.S., JOUNG Y.H., 2014 ­ Characterization of Kolkwitzia amabilis accessions based on flowering and molecular markers. ­ Scientia Hort., 165: 190­195. TOMKINS J.P., WOOD T.C., BARNES L.S., WESTMAN A., WING R.A., 2001 ­ Evaluation of genetic variation in the daylily (Hemerocallis spp.) using AFLP markers. ­ Theor. Appl. Genet., 102: 489­496. USDA, ARS, NATIONAL GENETIC RESOURCES PROGRAM, 2015 ­ Germplasm Resources Information Network ‐ (GRIN) [Online Database]. National Germplasm Resources Laboratory, Beltsville, Maryland.