Impaginato 89 Adv. Hort. Sci., 2023 37(1): 89­99 DOI: 10.36253/ahsc­14180 Ethanol fermentation­ and ethylene physiology­related gene expression profiles in Red Delicious apples stored under variable hypoxic conditions and protocols E. Salamé 1, S. Brizzolara 1 (*), M. Rodrigues 2, M. Iob 3, P. Tonutti 1, B. Ruperti 2 1 Crop Science Research Center, Scuola Superiore Sant’Anna, Piazza Martiri della Libertà, 33, 56127 Pisa, Italy. 2 Department of Agronomy, Food, Natural Resources, Animals and Environment, Via dell’Università, 16, 35020 Legnaro (PD), Italy. 3 Marvil Engeneering, Zona Produttiva Schwemm, 8, 39040 Magré Sulla Strada del Vino (BZ), Italy. Key words: Dynamic Controlled Atmosphere, ERF, low oxygen, Malus domestica, postharvest. Abstract: Dynamic Controlled Atmosphere (DCA) is beneficial in maintaining specific quality parameters but, due to the extreme oxygen levels applied, can cause adverse effects on the fruit by inducing excessive anaerobic metabolism and the production of off­flavors. The metabolic adaptation and responses of apples (Malus domestica Borkh.) cv. Red Delicious to static or dynamic oxygen concentrations (0.3 and 0.8%, with sequential shifts) during cold storage for 7 months were studied by monitoring quality parameters and the expression of genes involved in sugar, fermentative metabolism, and ethylene physiology. Ethanol content reached the highest levels (around 400 mg/kg FW) under 0.3% oxygen concentration and fruit firmness appeared to be reduced in samples accumulating the highest levels of ethanol. The oxygen switch was effective in reducing the ethanol concentrations with timing­dependent variable effects. The expression of fermentative (alcohol dehydrogenase, lactate dehydroge‐ nase, pyruvate decarboxylase) and sugar metabolism (β‐amylase; phosphofruc‐ tokinase; sucrose synthase) genes resulted to be differently affected by the hypoxic conditions imposed, in particular during the early stages of storage. Sucrose synthase expression appeared to be highly sensitive to changes in low oxygen concentration. Ethylene biosynthesis (ACC synthase and oxidase) genes showed marked differences in their expression in relation to the static and dynamic protocols and the hypoxic conditions, as well as six Ethylene Responsive Factors (ERF) genes, some of them possibly involved in the oxygen sensing mechanism operating in fruit tissues. (*) Corresponding author: stefano.brizzolara@santannapisa.it Citation: SALAMÉ E., BRIZZOLARA S., RODRIGUES M., IOB M., TONUTTI P., RUPERTI B., 2023 ­ Ethanol fermentation‐ and ethylene physiology‐related gene expression profiles in Red Delicious apples stored under variable hypoxic conditions and protocols. ­ Adv. Hort. Sci., 37(1): 89­99. Copyright: © 2023 Salamé E., Brizzolara S., Rodrigues M., Iob M., Tonutti P., Ruperti B. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 12 January 2023 Accepted for publication 18 February 2023 AHS Advances in Horticultural Science https://doi.org/10.36253/ahsc-14180 http://www.fupress.net/index.php/ahs/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2023 37(1): 89­99 90 1. Introduction Dynamic Controlled Atmosphere (DCA) represents one of the latest technical innovations for the long storage of apples (and few other fruit crops) (Tonutti, 2015). With this technology, fruits are kept under extremely low oxygen concentrations (0.4 kPa or lower) that are beneficial for maintaining specific quality parameters (e.g., flesh firmness, acidity). However, by activating anaerobic metabolism, an accumulation of ethanol takes place. Low concentra­ tions of ethanol are desirable in terms of improving organoleptic traits, reducing the incidence of chilling injuries (e.g., superficial scald) and limiting ethylene biosynthesis (Dixon and Hewett, 2000; Scott et al., 2000; Weber et al., 2020). Yet, the accumulation of excessive ethanol results in the appearance of off­fla­ vors and physiological disorders (Pedreschi et al., 2009). Thus, based on different stress indicators (chlorophyll fluorescence ­CF­, respiratory quotient ­ RQ­, and ethanol concentration), oxygen must be promptly adjusted (increased) to reach “safe” con­ centrations. The imposed extreme hypoxic conditions induce selective responses of apple tissues starting from the modulation of gene expression involved in particular in primary metabolism and hormone (mainly ethylene) physiology (Cukrov et al., 2019). In Granny Smith, one of the apple cultivar most fre­ quently stored in DCA, differential expression of sucrose synthase (SuSy), alcohol dehydrogenase (ADH) and pyruvate­related metabolism (lactate dehydrogenase, LDH, pyruvate decarboxylase, PDC, and alanine aminotransferase, AlaAT) genes was detected when comparing 0.4 with 0.8 kPa oxygen concentration (Cukrov et al., 2016). When, according to the DCA protocol, oxygen level is increased from the lowest applied concentrations, molecular and metabolic rearrangements rapidly occur, with changes in both primary and secondary metabolism (Brizzolara et al., 2019), indicating that highly reac­ tive mechanisms and oxygen sensors are present in apple cortex. The expression of genes involved in fer­ mentative metabolisms (e.g., ADH), in secondary metabolism (e.g., phenylpropanoid pathway), hor­ monal responses and regulatory mechanisms (ethyl­ ene biosynthesis, ERFs) resulted to be affected by the oxygen switch. The duration of the storage and the oxygen con­ centrations applied obviously play a key role in deter­ mining the fruit metabolic responses and the dynam­ ics of fermentative metabolite accumulation. In addi­ tion, apple varieties react differently to extremely low oxygen conditions during storage, in particular in terms of fermentation, ethanol production and accu­ mulation (Thewes et al., 2019; Brizzolara et al., 2020; Thewes et al., 2021 a; Park et al., 2022). Zanella and Stürz (2015) showed that, differently from eight other varieties, ‘Red Delicious’ apples react signifi­ cantly and accumulate higher ethanol levels under hypoxia, and in a specific comparison between Granny Smith and Red delicious (Brizzolara et al., 2017), it was reported that the latter considerably accumulated ethanol under both ULO (0.9 kPa oxy­ gen) and DCA (0.2­0.55 kPa oxygen) conditions, as also observed by Lumpkin et al. (2014). Among important commercial apple varieties, the responses of Red Delicious to controlled atmosphere (CA) and DCA still need to be compared and clarified, which makes this cultivar a genotype of interest in terms of both applied aspects and physiological stud­ ies related to DCA conditions and different oxygen regimes and concentration adjustment protocols. 2. Materials and Methods Experimental design and sampling Organic apple (Malus domestica Borkh., cv. Red delicious) fruit were harvested in correspondence of an average TSS value of 10.8°Brix. Fruit were selected for their uniformity and absence of physical defects/decay and then kept for 3 days of acclima­ tion at low temperature (0°C). Control atmosphere storage was applied by divid­ ing the fruit into two groups in two different cold chambers. The first group (about 300 fruit) was ini­ tially stored under oxygen concentration of 0.3% (0.3ox) while the second group (60 fruit) was stored under the safer oxygen concentration of 0.8% (0.8ox) for a total period of 218 DIA (days in atmosphere). Samples were collected at harvest and T0 sampling was carried out after 24h in atmosphere (1 DIA). To simulate the dynamic changes in oxygen concentra­ tions applied during a DCA storage, at T1 (10 DIA) 60 fruit originally stored under 0.3ox were shifted to 0.8% oxygen level and kept under these conditions for the whole period of storage (218 DIA). These sam­ ples were called Shift 1 and were sampled successive­ ly at the following time points. At T2 (20 DIA), anoth­ er 60 fruit were moved from 0.3% to 0.8% oxygen and were called Shift 2. Shift 3 was performed at T3 (31 DIA) and Shift 4 took place at T4 (110 DIA). A Salamé et al. ‐ DCA storage of Red Delicious apples 91 schematic diagram of the experimental design is reported in figure 1. At each sampling point, three biological replicates taken from three different fruit for each treatment were considered. Samples of cor­ tex tissue were collected, immediately frozen in liq­ uid nitrogen, and stored at ­80°C. Flesh firmness, total soluble sugars content and ethanol quantification Flesh firmness was measured at harvest (T0) and at the end of the storage at T5 (218 DIA). Measurements were taken at the two opposite sides of the equatorial part using a fruit penetrometer (mod. FT 327, 3­27 Lbs) with a large plunger tip (11 mm­diameter) after removing 1 mm of the peel. Total soluble solid content (TSS, °Brix) was deter­ mined in the flesh juice of apples using a portable refractometer (Sinergica Soluzioni, Pescara, Italy); measurements were performed at harvest and the end of the storage at T5 (218 DIA) on pulp juice sam­ ples taken from the opposite sides of the fruit. Ethanol content was measured by using a TectroniK (Tectronik, Padova, Italy) Senzytec analyser, following the instructions of the manufacturer and using 100µL of juice obtained by collectively pressing portions (approximately 1/3) of the cortex of three apples rep­ resenting the biological replicate. RNA extraction and cDNA synthesis Total RNA was isolated from cortex tissue using ‘SIGMA ­Aldrich’ RNA extraction kit following the manufacturer instructions. Total RNA was quantified (ng/μL) using UV spectrophotometry calibrated with RNase­free water. RNA purity was assessed by evalu­ ating the absorbance ratio at 260/280 and 260/230 nm. Ribosomal RNA bands integrity was verified using GelRed™­stained 1% agarose gel (Aranda et al., 2012). RNA was reverse­transcribed into first­strand cDNA using 4 µL ReadyScript™ (Sigma, RDRT­ 500RxN), starting from 400 ng of total RNA in a final volume of 20 µL using DEPC treated water. The reac­ tion was incubated at 25°C for 5 minutes, then at 46°C for 20 min and then heated at 95°C for 1 min and finally at 4°C for 15 min. The synthetized cDNA was diluted 1:5 by adding sterile water. Gene expression analysis by real‐time PCR Quantitative Real­time PCR was performed using three biological replicates and two technical repli­ cates for each sample. Based on the paper by Cukrov et al. (2016), primer pairs of genes related to sucrose/starch metabolism (β‐amylase, MdBAM; phosphofructokinase, MdPFK; sucrose synthase, MdSuSy), the fermentative/pyruvic acid metabolism (alcohol dehydrogenase, MdADH; lactate dehydroge‐ nase, MdLDH; pyruvate decarboxylase, MdPDC; ala‐ nine aminotransferase, MdAlaAT), ethylene biosyn­ thesis (ACC synthase, MdACS; ACC oxidase, MdACO), and 6 Ethylene Responsive Factors (ERFs) were used (Table 1). Actin was used as a housekeeping gene. Reaction mixtures were prepared, under sterile conditions, for the target and reference genes, con­ taining each 5 μL of 2XSYBR® Green qPCR ReadyMix™ (SIGMA), 1 μL of each primer (Forward and Reverse) (10 µM), 2 µL RNase­free water and 1 μL of cDNA. The automated thermal cycler was programmed according to the following conditions: initial denatu­ ration of 95°C for 30 sec followed by 40 cycles of: denaturation at 95°C for 10 sec, primer annealing (according to primer Tm) for 30 sec and extension at 72°C for 30 sec. Finally, melt­curve stage at 65°C for 0.5 sec followed by 95°C for 0.5 sec. The Ct­values generated were used to evaluate the results of the gene expression levels comparing the expression of each target gene to the housekeep­ ing gene (Actin). For samples under static 0.8ox, data were expressed with the 2­ΔΔCt method (Livak and Schmittgen, 2001) and normalized to the correspond­ ing sample at T1 (1 DIA). Data of samples under 0.3ox and the shifts were expressed as fold change of the expression level using the formula: FC=Log2(2‐ΔΔCt) normalized to the corresponding sample of 0.8ox at each time point starting from 10 DIA. Statistical analysis For gene expression, data analysis was performed on six replicates (3 biological x 2 technical replicates). RStudio was used with external package “pcr” to cal­ culate the relative expression and fold change. For Fig. 1 ­ Red delicious DCA storage experimental design. The numbers indicate the days in atmosphere (DIA), ▽ Indicates the sampling with color coded for different samples, 0.3ox (Blue), 0.8ox (Purple), Sh1 (Red), Sh2 (Orange), Sh3 (Yellow) and Sh4 (Light blue). Adv. Hort. Sci., 2023 37(1): 89­99 92 fruit firmness, TSS and ethanol content 3 biological replicates were used. Internal statistical functions and external package “agricolae” were used to ana­ lyze the data (Kronthaler and Zoellner, 2021). All data were analyzed using t‐test for samples at 1 DIA to compare 0.3 to 0.8ox samples. One­way ANOVA and mean comparison with Least significant differ­ ence (LSD) post­hoc test (p≤0.05) was used to com­ pare different samples of shifts to the corresponding 0.8ox at each time point starting from 10 DIA. A Kruskal­Wallis test was applied to non­parametric data (p≤0.05). 3. Results Flesh firmness, TSS and ethanol production At the end of the storage period and after five days of shelf life at room temperature no physiologi­ cal disorders or external/internal defects were observed in all analysed samples collected from the different protocols. Concerning technological parameters, Table 2 reports apple firmness and TSS values for samples taken at harvest (T0) and at the end of the trial at 218 DIA. Results showed that samples stored for 30 Table 1 ­ Primers pairs used in the RT­qPCR analysis The table reports the genes nomenclature according to https://iris.angers.inra.fr/gddh13/, the primers sequence, length, GC content and melting temperature (Tm) Genes Primer sequence 5'­3' Length (bp) GC content (%) Tm (°C) ACC synthase MD15G1302200 F AAGTGGCGAACTGGAGTCGA 20 55 67.2 R GGTTTGATGGGTTCGTGACC 20 55 66.4 ACC oxidase MD10G1328100 F CAGTCGGATGGGACCAGAA 19 57.8 66.3 R GCTTGGAATTTCAGGCCAGA 20 50 66.3 Pyruvate decarboxylase MD04G1160100 F CAAGGCAGTAAAGCCGGTTA 20 50 63.9 R AAATCGGTCCAGCAAACAAG 20 45 63.9 Alcohol dehydrogenase MD10G1014200 F GGAAGCACTGAAGCCATGAT 20 50 64.2 R CTCCACGACAGAGGGAATGT 20 55 64.2 Lactate dehydrogenase MDP0000143956 F CATAAAACTCCTTCAGGCTCCA 22 45.4 64.1 R GTGSGGTCTTGGGTGAGGAT 22 55 63.9 Beta‐amylase 6 MD09G1103800 F CTATGTGCCGATCTTCGTGA 20 50 63.8 R ACTGCTTGAAACACGCTCCT 20 50 63.9 Sucrose synthase MD15G1223500 F TCCGTGTTCACTGCTACGAG 20 55 64.1 R GCCTCAAGAAGGTCCAACAG 20 55 63.8 Phosphofructokinase MD04G1042400 F AGTCGTGGAGTGGTGGAATC 20 55 64.1 R TAGAGGGTGAGGGCTTCAGA 20 55 63.9 Alanine aminotransferease MD09G1173000 F TGCTGTCCGAGGTGAAATCGTC 22 54.5 70.6 R AGCCCGGATTCGCCTTTAACTC 22 54.5 69.9 Ethylene response factor MD11G1306500 variant F CGGTGGTGCTATAATCTCCG 20 55 64.2 R GGAATTGAGTCGGTGTGAGTAGTT 24 45.8 64.3 Ethylene response factor MD11G1306500 F CTCCCTTCGCCAAGTTCG 18 61.1 65.9 R TTGAGTCGGTGCGATTAACC 20 50 64.9 Ethylene response factor MD16G1162900 F CCAGAAGCCCAAACCATCAG 20 55 66.7 R TTCCTCGGCGGTGTTGTA 18 55.5 65.4 Ethylene response factor MD13G1163300 F GGTGGGGAAATGTATGCTAAGA 22 45.4 63.7 R GTCATCCAGCATCCACAGG 19 57.8 64.4 Ethylene response factor MD17G1152400 F CTTCTGCAAAGCGTTCTGTG 20 50 63.7 R GGCAGGATCGGATGGAG 17 64.7 64.5 Ethylene response factor MD09G1174400 F TTCTGCAAAGCGTTCCATC 19 47.3 64 R TTCATTGGCAGGGAAGGTG 19 52.6 66 Actin MD04G1127400 F TGACCGAATGAGCAAGGAAATTA 25 40 67.4 R TACTCAGCTTTGGCAATCCACATC 24 45.8 68 Salamé et al. ‐ DCA storage of Red Delicious apples 93 (Sh3) and 110 (Sh4) days under 0.3% oxygen before being shifted to 0.8% oxygen showed the lowest val­ ues of firmness at the end of the trial. While 0.8ox, Sh1 and Sh2 samples maintained firmness values not significantly different from those detected in T0 sam­ ples. No significant difference (p=0.414, alpha level ≤ 0.05) was recorded for TSS levels over time or between the different applied protocols. Ethanol levels have been monitored along the entire experimental period to assess the activation of fermentative metabolism under static and dynamic CA storage (Fig. 2). 0.3ox samples already showed higher levels than those of the 0.8ox sample at 10 DIA, and a further increase from 10 to 20 DIA with values around 400 mg/kg FW up to 110 DIA (last sampling time for this specific treatment). On the other hand, 0.8ox samples showed a similar trend in terms of ethanol accumulation but with significantly lower amounts compared to 0.3ox samples and a decreasing trend after the highest concentrations detected at 20 and 31 DIA. Samples subjected to par­ tial re­oxygenation at different time points (Sh1, Sh2, Sh3 and Sh4) showed a different behaviour: Sh1 did not show significant difference from 0.3ox at 20 DIA , but displayed a reduced amount at 31 and at 110 DIA as also observed for Sh2. Interestingly, at 110 DIA ethanol levels were simi­ lar in all shifted and in 0.8ox samples. This was also observed at 218 DIA, except for Sh4 apples that dis­ played still significant higher levels (Fig. 2). Effect of different protocols on sugar metabolism‐ and fermentation‐related gene expression For gene expression data analysis, 0.8ox samples, kept under a static concentration throughout the experiment (from 1 to 218 DIA), were considered as a reference for the other storage protocols (0.3ox, Sh1, Sh2, Sh3 and Sh4). Consequently, the gene expres­ sion levels of these latter samples were expressed as fold change in relation to 0.8ox. Considering sugar metabolism, the expression lev­ els of three genes were monitored throughout stor­ age (Fig. 3). In 0.8ox samples, MdBAM gene revealed a significant up regulation, compared to T0, at 31 and 110 DIA. A significantly lower expression level was recorded in 0.3ox samples at 10 and 110 DIA. Sh1, Sh2, Sh3 and Sh4 samples had significantly lower lev­ els of expression at 110 DIA. At the last sampling time, 218 DIA, all shifted samples, except Sh3, revealed significantly higher expression values com­ pared to 0.8ox. MdPFK gene expression showed a steady state in samples stored at 0.8ox. A lower expression level of this gene was detected at 10 DIA in 0.3ox samples. Sh1 samples showed higher expres­ sion at 31 DIA, Sh2 had lower expression level at 31 DIA and higher at 110 and 218 DIA, while Sh3 sam­ ples showed higher expression levels at 218 DIA. Considering MdSuSY, in 0.8ox apples the expression showed a significant induction at 10 and 20 DIA, fol­ lowed by a basal expression level at all the other sampling points. Samples stored under 0.3ox revealed two marked and significant peaks of induc­ tion, at 10 and 110 DIA. Interestingly, Sh1 showed significantly reduced levels of expression at 20 DIA, while Sh2 and Sh4 revealed significantly higher expression at 218 DIA. Concerning the gene related to the fermenta­ tive/pyruvic acid metabolism (Fig. 4), MdLDH expres­ sion showed, in 0.8ox samples, a significant increase Fig. 2 ­ Ethanol content (mg/Kg FW). Samples stored in 0.3ox (Blue), 0.8ox (Purple), Sh1 (Red), Sh2 (Orange), Sh3 (Yellow) and Sh4 (Light blue) analysed from 10 to 218 days in atmosphere (DIA). Different letters indicate sig­ nificant differences among samples (ANOVA, LSD post­ hoc test (p ≤ 0.05). Different letters indicate significant differences among samples (ANOVA, LSD post­hoc test (p≤0.05). Table 2 ­ Firmness and total soluble solids (TSS). Mean values (±SE) of apple samples at harvest (T0) and after 218 DIA of static (0.8ox) and dynamic atmosphere storage (Shift 1­4) are reported in the table Samples DIA Firmness (N) TSS (°Brix) At harvest 0 75.10 ± 0.96 a 10.85 ± 0.45 Static 0.8ox 218 67.67 ± 2.85 ab 11.40 ± 0.06 Shift 1 218 62.52 ± 3.51 ab 11.76 ± 0.32 Shift 2 218 67.91 ± 0.73 ab 11.53 ± 0.24 Shift 3 218 58.10 ± 6.76 b 10.86 ± 0.13 Shift 4 218 61.30 ± 5.83 b 11.40 ± 0.06 94 Adv. Hort. Sci., 2023 37(1): 89­99 of expression only at 10 DIA. Compared to 0.8ox sam­ ples, 0.3ox treatment induced higher expression at 10 and 110 DIA, and a general up­regulation in shift­ ed samples at 218 DIA. MdPDC, involved in the pro­ duction of acetaldehyde, increased its expression at 20 and 31 DIA in 0.8ox samples. 0.3ox apples revealed an earlier increase in the expression of MdPDC gene, significant at 10 DIA. Among samples that underwent partial re­oxygenation, a general lower expression, always compared to 0.8ox, was observed at 110 DIA, followed by increased levels at 218 DIA. Acetaldehyde can be further converted to Fig. 4 ­ Relative expression of genes related to fermentative/pyruvic acid metabolism, lactate dehydrogenase, pyruvate decarboxylase, alcohol dehydrogenase and alanine aminotransferase. For samples 0.3ox (Blue), Sh1 (Red), Sh2 (Orange), Sh3 (Yellow) and Sh4 (Light blue) the expression level is reported from 1 to 218 days in atmosphere (DIA) as log2 FC normalized on 0.8ox expression level at each time point. The red line represents gene relative expression in 0.8ox samples. Black asterisks indicate significant dif­ ferences (ANOVA, LSD post­hoc test (p≤0.05) comparing each sample to 0.8ox level at the same sampling time. Red asterisks indicate significant differences (ANOVA, LSD post­hoc test (p ≤ 0.05) between 0.8ox samples at the specific time points and 0.8ox apples at 1 DIA. Fig. 3 ­ Relative expression of genes related to sugar metabolism and energy production β­amylase, phosphofructokinase, and sucrose synthase. For samples 0.3ox (Blue), Sh1 (Red), Sh2 (Orange), Sh3 (Yellow) and Sh4 (Light blue) the expression level is reported from 1 to 218 days in atmosphere (DIA) as log2 FC normalized on 0.8ox expression level at each time point. The red line repre­ sents gene relative expression in 0.8ox samples. Black asterisks indicate significant differences (ANOVA, LSD post­hoc test (p≤0.05) comparing each sample to 0.8ox level at the same sampling time. Red asterisks indicate significant differences (ANOVA, LSD post­hoc test (p≤0.05) between 0.8ox samples at the specific time points and 0.8ox apples at 1 DIA. Salamé et al. ‐ DCA storage of Red Delicious apples 95 ethanol under low oxygen levels by the enzyme coded by MdADH genes, and this is a crucial reaction in apple tissue under hypoxia. Compared to T0 sam­ ples, the selected MdADH gene showed a significant increase only at 218 DIA in 0.8ox sample. The applica­ tion of 0.3% oxygen resulted in general higher levels of expression until 31 DIA, significant at 10 and 31 DIA. At 110 DIA, a significant decrease in MdADH expression was recorded for 0.3ox apples as well as for all shifted samples. MdAlaAT is involved in the reversible transfer of an amino group from glutamate to pyruvate, which in turn forms 2­oxoglutarate and alanine. In 0.8ox sam­ ples, this gene showed a peak of expression at 110 DIA. The expression in 0.3ox samples is highly induced at 10 DIA, while it strongly decreased at 110 DIA, similarly to Sh2 and Sh3. Higher expression of this gene was detected at 218 in Sh4 sample (Fig. 4). Ethylene biosynthesis and ERFs gene expression The expression of two genes involved in ethylene biosynthesis, namely MdACS and MdACO, has been analysed (Fig. 5). These two genes appeared to be highly affected during storage under 0.8% oxygen concentration. The expression of both genes increased with time, constantly for MdACO, which also reached the highest recorded levels of expres­ sion, while, in the case of MdACS, a peak at 110 DIA was detected. Regarding MdACS gene expression, 0.3ox samples showed increased values (compared to 0.8ox) at 10 DIA, but lower levels at 20, 31 and 110 DIA, when also Sh2 and 3 showed low expression lev­ els. MdACO gene revealed marked higher levels in 0.3 ox samples at 10 DIA and in Sh1 samples at 20, 31, and 110 DIA. Lower expression levels were detected in 0.3ox apples at 20, 31 and 110 DIA. Interestingly, Sh1 samples showed higher levels of expression, compared to 0.8ox, at 20, 31, and 110 DIA. All shifted samples had lower expression level than 0.8ox apples at 218 DIA. The ethylene signalling and response pathway includes Ethylene Response Factors (ERFs), which belong to the transcription factor family APETALA2/ERF that plays important roles in stress­ related responses. The effect of the different applied storage protocols on the expression level of six ERF genes has been investigated throughout the experi­ ment (Fig. 6). In general, samples showed relatively similar responses in terms of ERF expression. Overall, considering 0.8ox samples a general increase of ERF genes expression was observed up to 110 DIA, which was significant at different time points for the differ­ ent analysed ERFs (MD09G1174400 gene at 110 DIA; MD13G1163300 gene at 10, 20 and 31 DIA; MD11G1306500 gene at 10, 20 and 31 DIA; MD16G1162900 gene at 10, 31 and 110 DIA; MD11G1306500 VARIANT gene at 10, 20 and 31 DIA; Fig. 5 ­ Relative expression of ethylene biosynthesis genes ACC­synthase and ACC­oxidase. For samples 0.3ox (Blue), Sh1 (Red), Sh2 (Orange), Sh3 (Yellow) and Sh4 (Light blue) the expression level is reported from 1 to 218 days in atmosphere (DIA) as log2 FC normalized on 0.8ox expression level at each time point. The red line represents gene relative expression in 0.8ox samples. Black asterisks indicate significant differences (ANOVA, LSD post­hoc test (p≤0.05) comparing each sample to 0.8ox level at the same sampling time. Red asterisks indicate significant differences (ANOVA, LSD post­hoc test (p≤ 0.05) between 0.8ox samples at the specific time points and 0.8ox apples at 1 DIA. Adv. Hort. Sci., 2023 37(1): 89­99 96 MD17G1152400 gene at 10 and 110 DIA). The expression of ERF genes in 0.3ox samples was instead characterized by significant lower levels at the different time points with only two exceptions: MD09G1174400 gene at 10 DIA and MD11G1306500 gene at 20 DIA, when significantly higher levels of expression than those of 0.8ox apples were recorded. On the other hand, considering apples subjected to partial re­oxygenation samplings, lower levels of expression were generally detected up to 31 DIA, with only two exceptions (MD11G1306500 and MD16G1162900) concerning Sh2 samples at 31 DIA, when a significantly higher level of expression was observed. After 110 DIA, the different samples revealed vari­ able patterns. Concerning MD09G1174400 and MD13G1163300 genes, Sh1 and Sh3 showed signifi­ cantly lower levels of expression, while Sh2 had sig­ nificantly higher levels. For these two genes at 218 DIA only Sh2 revealed significantly higher levels of expression compared to 0.8ox samples, despite a general increasing trend in all apples subjected to partial re­oxygenation. As far as the MD11G1306500 gene is concerned, significant higher expression was detected for both Sh1 and Sh2 at 110 DIA, while only Sh3 had signifi­ cantly higher levels at 218 DIA. MD16G1162900 gene expression in shifted samples revealed significant lower levels at 110 DIA, while only Sh4 had signifi­ cantly higher levels at 218 DIA. In the case of MD11G1306500 VARIANT gene Sh1 and Sh2 had higher expression levels at 110 DIA, while only Sh2 and Sh4 showed significantly higher levels at 218 DIA. Lastly, MD17G1152400 gene had a significantly high­ er level of expression in samples of Sh1 and Sh2 at 110 DIA, while Sh3 apples had significantly lower Fig. 6 ­ Relative expression of genes belonging to Ethylene Response Factor (ERF) gene family. For samples 0.3ox (Blue), Sh1 (Red), Sh2 (Orange), Sh3 (Yellow) and Sh4 (Light blue) the expression level is reported from 1 to 218 days in atmosphere (DIA) as log2 FC normalized on 0.8ox expression level at each time point. The red line represents gene relative expression in 0.8ox samples. Black asterisks indicate significant differences (ANOVA, LSD post­hoc test (p≤0.05) comparing each sample to 0.8%ox level at the same sampling time. Red asterisks indicate significant differences (ANOVA, LSD post­hoc test (p≤0.05) between 0.8ox samples at the specific time points and 0.8ox apples at 1 DIA. Salamé et al. ‐ DCA storage of Red Delicious apples 97 expression for this gene. On the other hand, all shift­ ed samples showed significantly higher expression of this gene at 218 DIA compared to 0.8ox apples. A general trend was identified for all samples subjected to partial re­oxygenation: in general the expression level of the ERF gene was induced at 218 DIA. 4. Discussion and Conclusions An in­depth understanding of low oxygen responses in fruits is of fundamental importance for the optimisation of storage approaches and for the development of protocols aimed at maintaining opti­ mal quality while preventing the occurrence of physi­ ological disorders associated with long term storage. Metabolic adaptation responses to hypoxic condi­ tions have only recently started to be clarified in apple fruits and are gaining increasing interest since apples are routinely stored for very long periods of time thanks to the adoption of low oxygen (0.8 kPa oxygen, Ultra Low Oxygen, ULO) or dynamic con­ trolled atmosphere (DCA, 0.4 or lower kPa oxygen) protocols. Primary metabolism and ethylene physiol­ ogy are markedly affected by hypoxia with differ­ ences depending on the oxygen concentration and modulation, and the genotype. In this study we char­ acterized the ethanol accumulation and the expres­ sion pattern of sugar/fermentative metabolism­ and ethylene physiology­related genes of Red delicious apples in CA/DCA storage. Our goal was that of better understanding the behaviour and the responses (also in terms of specific quality parameters) of this apple variety in relation to two levels of low oxygen con­ centration and the variable (in terms of timing) switch from 0.3 to 0.8% oxygen levels. The storage under 0.3% oxygen resulted in an early significant accumulation of ethanol already at 10 DIA and that further increased at 20 DIA. This level remained rather stable as long as the fruit were kept at 0.3% oxygen atmosphere until 110 DIA. Although to a lesser extent, ethanol content also increased in 0.8ox samples, confirming what observed by Brizzolara et al. (2017). In these apples, ethanol con­ tent levelled off after three months of storage. The metabolization of ethanol seemed to be more sensi­ tive to re­oxygenation when apples had experienced a shorter period of DCA. In fact, the longest storage under 0.3% oxygen resulted in more stable ethanol levels in the cortex at the end of the storage period (218 DIA, Sh4 in Fig. 2). Considering one of the main parameters dictating the commercial life of apples, the samples Sh3 and Sh4 showed the lowest values of flesh firmness at the end of the trial. This behaviour could be associated to the highest levels of ethanol accumulated in these samples. In Braeburn apples ethanol production exceeding 472 μL·L­1 and the overproduction of anaerobic metabolites in Royal Gala resulted in a decrease of flesh firmness (Weber et al., 2020; Thewes et al., 2021 b). In persimmon, it has been observed that accelerated loss of flesh firm­ ness during storage was induced by ethanol treat­ ments applied to reduce astringency (Vilhena et al., 2022). These authors observed that this event is closely related to greater parenchyma degradation during storage caused by ethanol treatment. If this cellular event also occurs in apple fruit accumulating high ethanol levels following hypoxic storage condi­ tions remains to be elucidated. It is interesting to note that even in the samples with the highest ethanol content (0.3ox) no internal physiological disorders (e.g., flesh breakdown) were detected. The gene expression data confirmed that the molecular regulation of hypoxic responses is overall conserved among apple varieties: the up­regulation of MdPDC, MdADH and MdAlaAT in response to extreme levels of hypoxia (0.3 oxygen concentration) is readily activated and peaks at 10 DIA, after which is promptly and progressively levelled down until 110 DIA, when a general low level of expression (com­ pared to 0.8ox samples) is present in 0.3ox and shift­ ed samples. This possibly suggests a negative feed­ back exerted by ethanol on its own synthesis. In agreement with these findings, one of the genes encoding group VII ethylene response factors (MD09G1174400), with similarity to RAP2 proteins involved in low oxygen signalling in model systems (Licausi et al., 2011; Gibbs et al., 2011), displayed an expression pattern overlapping with that of the fer­ mentative metabolic genes with a transient up­regu­ lation at 10 DIA and low expression levels at 110 DIA. It is well known that under energy shortage condi­ tions, such as those induced by low oxygen condi­ tions, plant tissues and organs (including fruit) instead of using invertases and hexokinases to pro­ duce hexose­phosphates to form sucrose, an ATP consuming process, can use sucrose synthase as alternative energy saving pathway (Mustroph et al., 2014). The activation under hypoxic conditions of sucrose synthase was already reported by Cukrov et al. (2016) in Granny Smith apples, and our expression Adv. Hort. Sci., 2023 37(1): 89­99 98 data (showing a high induction at 10 DIA in 0.3ox and a prompt reduction of expression level in Sh1 apples at 31 DIA) confirm that this gene can be considered highly sensitive to oxygen levels also in cv. Red Delicious. A cultivar­specific behaviour is, instead, observed regarding beta­amylase and phosphofruc­ tokinase. In fact, these genes in Granny Smith apples follow a similar expression pattern compared to MdSuSY (Cukrov et al., 2016), not observed in the present trials on Red Delicious. As far as ethylene biosynthesis is concerned, the expression pattern of ACC oxidase detected in 0.8ox Red Delicious samples mirrors that observed in Granny Smith (Cukrov et al., 2016), while the tran­ sient higher expression levels observed for both ACC synthase and oxidase at 10 DIA under 0.3% oxygen appear to be a specific response of cv. Red Delicious apple. Interestingly, the transcription of both genes appeared to be re­activated exclusively in the first and second shift to 0.8ox (Sh1 and Sh2), performed after 10 and 20 DIA, respectively, and showed a peak at 31 DIA followed by lower expression levels. However, the increase of MdACS and MdACO tran­ script following the oxygen resupply reached a level significantly lower than that reached by apples that had been constantly kept at 0.8ox. It could be hypothesised that this may be due to the higher lev­ els of ethanol accumulated in the pulp of DCA stored apples, which might exert a suppressive action on ethylene biosynthesis as previously shown by some authors in different apple varieties (Pesis et al., 2005; Thewes et al., 2019; Weber et al., 2020; Thewes et al., 2021 a). Concluding, the recovery from anoxia in apple fruits is dependent on the length of exposure to the anoxic stress (Wood et al., 2022). Our data on ethanol accumulation and ethylene­related gene expression are in line with these findings, showing that longer periods of exposure to 0.3% oxygen result in the maintenance of higher levels of ethanol and on the prevention of transcription of ethylene biosyn­ thetic genes. The effect of low oxygen storage of Red Delicious apples on transcript abundance of several important genes related to hypoxic stress response in apple fruit revealed both similarity with Granny Smith apples stored under the same CA protocols, and spe­ cific responses of cv. Red Delicious. In both Red Delicious and Granny Smith apples two phases can be recognized in relation to fermentative metabolism: a first phase characterised by the activation of fermen­ tative pathways, and a second phase (from two months onward) in which a generalized de­activation of fermentative metabolism is observed. Acknowledgements This study was carried out by PT and SB within the Agritech National Research Center and received funding from the European Union Next­ GenerationEU (PIANO NAZIONALE DI RIPRESA E RESILIENZA (PNRR) – MISSIONE 4 COMPONENTE 2, INVESTIMENTO 1.4 – D.D. 1032 17/06/2022, CN00000022). This manuscript reflects only the authors views and opinions, neither the European Union nor the European Commission can be consid­ ered responsible for them. SB was supported by the special project of Scuola Superiore Sant’Anna ISVSTRATEGICO2019. This work has been supported by the networking activities “Oxygen sensing a novel mean for biology and technology of fruit quality” (CA:18210) which is implemented under the COST Action “Roxy­COST,” funded by the European Cooperation in Science & Technology (2019­2023). Funding was provided by Marvil Engeneering Srl through project “Rupe Comm17_01” and by University of Padova project BIRD173975/17. References ARANDA P.S., LAJOIE D.M., JORCYK C. L., 2012 ­ Bleach gel: a simple agarose gel for analyzing RNA quality. ‐ Elect., 33(2): 366­369. BRIZZOLARA S., CUKROV D., MERCADINI M., MARTINELLI F., RUPERTI B., TONUTTI P., 2019 ­ Short‐term respons‐ es of apple fruit to partial reoxygenation during extreme hypoxic storage conditions. ­ J. Agric. Food Chem., 67(17): 4754­4763. BRIZZOLARA S., MANGANARIS G.A., FOTOPOULOS V., WATKINS C.B., TONUTTI P., 2020 ­ Primary metabolism in fresh fruits during storage. ­ Front. Plant Sci., 11: 80. BRIZZOLARA S., SANTUCCI C., TENORI L., HERTOG M., NICOLAI B., STÜRZ S., ZANELLA A., TONUTTI P., 2017 ­ A metabolomics approach to elucidate apple fruit responses to static and dynamic controlled atmosphere storage. ­ Postharvest Biol. Technol., 127: 76­87. CUKROV D., BRIZZOLARA S., TONUTTI P., 2019 ­ Physiological and biochemical effects of controlled and modified atmospheres, pp. 425­442. ‐ In: YAHIA E.M., and A. CARRILLO­LOPEZ (eds.) Postharvest physiology and biochemistry of fruits and vegetables. Woodhead Salamé et al. ‐ DCA storage of Red Delicious apples 99 Publising­Elsevier, UK, pp. 510. CUKROV D., ZERMIANI M., BRIZZOLARA S., CESTARO A., LICAUSI F., LUCHINAT C., SANTUCCI C., TENORI L., VAN VEEN H., ZUCCOLO A., RUPERTI B., TONUTTI P., 2016 ‐ Extreme hypoxic conditions induce selective molecular responses and metabolic reset in detached apple fruit. ­ Front. Plant Sci., 7: 146. DIXON J., HEWETT E.W., 2000 ­ Factors affecting apple aroma/flavor volatile concentration: a review. ­ N. Z. J. Crop Hortic. Sci., 28: 155­173. GIBBS D.J., LEE S.C., ISA N.M., GRAMUGLIA S., FUKAO T., BASSEL G.W., CORREIA C.S., CORBINEAU F., THEODOULOU F.L., BAILEY­SERRES J., 2011 ‐ Homeostatic response to hypoxia is regulated by the N‐ end rule pathway in plants. ­ Nature, 479: 415­418. KRONTHALER F., ZÖLLNER S., 2021 ­ Data analysis with RStudio. ­ Springer, Berlin/Heidelberg, Germany. LICAUSI F., KOSMACZ M., WEITS D.A., GIUNTOLI B., GIORGI F.M., VOESENEK L.A., VAN DONGEN J.T., 2011 ­ Oxygen sensing in plants is mediated by an N‐end rule pathway for protein destabilization. ‐ Nature, 479(7373): 419­ 422. LIVAK K.J., SCHMITTGEN D.S., 2001 ­ Analysis of relative gene expression data using real‐time quantitative PCR and the 2− ΔΔCT method. ‐ Methods, 25(4): 402­408. LUMPKIN C., FELLMAN J.K., RUDELL D.R., MATTHEIS J., 2014 ­ ‘Scarlett Spur Red Delicious’ apple volatile pro‐ duction accompanying physiological disorder develop‐ ment during low pO2 controlled atmosphere storage. ­ J. Agric. Food Chem., 62: 1741­1754. MUSTROPH A., HESS N., SASIDHARAN R., 2014 ­ Hypoxic energy metabolism and PPi as an alternative energy currency, pp. 165­184. ‐ In: VAN DONGEN J. and F. LICAUSI (eds.) Low‐oxygen stress in plants. Oxygen sensing and adaptive responses to hypoxia. Springer, Vienna, Austria, pp. 426. PARK D., AL SHOFFE Y., ALGUL B.E., WATKINS C.B., 2022 ­ Fermentative metabolism of three apple cultivars dur‐ ing storage under low partial pressures of oxygen. ­ Postharvest Biol. Technol., 193: 112037. PEDRESCHI R., FRANCK C., LAMMERTYN J., ERBAN A., KOPKA J., HERTOG M., VERLINDEN B., NICOLAI B., 2009 ‐ Metabolic profiling of “Conference” pears under low oxygen stress. ­ Postharvest Biol. Technol., 51(2): 123­ 130. PESIS E., 2005 ­ The role of anaerobic metabolites, acetaldehyde, and ethanol, in fruit ripening, enhance‐ ment of fruit quality and fruit deterioration. ­ Postharvest Biol Technol., 37(1): 1­19. SCOTT K.J., YUEN C.M.C., GHAHRAMANI F., 2000 ­ Ethanol vapor ‐ a new anti‐scald treatment for apples. ­ Postharvest Biol. Technol., 6: 201­208. THEWES F.R., BALKEES B.M., BUCHELE F., WUNSCHE J.N., NEUWALD D.A., BRACKMANN A., 2021 a ­ Ethanol vapor treatment inhibits apple ripening at room tem‐ perature even with the presence of ethylene. ­ Postharvest Biol. Technol., 173: 111415. THEWES F.R., BRACKMANN A., NEUWALD D.A., 2019 ­ Dynamics of sugars, anaerobic metabolism enzymes and metabolites in apples stored under dynamic con‐ trolled atmosphere. ­ Sci. Hortic., 255: 145­152. THEWES F.R., THEWES F.R., BOTH V., SCHULTZ E.E., PAS­ QUETTI BERGHETTI M.R., LUDWIG V., BRACKMANN A., 2021 b ­ Static × dynamic controlled atmosphere: Impacts of aerobic and anaerobic metabolism on physi‐ ological disorders and overall quality of ‘Royal Gala’ apples. ‐ LWT, Food Sci. Technol., 141: 110922. TONUTTI P., 2015 ­ The technical evolution of CA storage protocols and the advancements in elucidating the fruit responses to low oxygen stress. ­ Acta Horticulturae, 1079: 53­60. VILHENA N.Q., TESSMER M.A., HERNANDO I., KLUGE R.A., QUILES A., SALVADOR A., 2022 ­ Structural changes caused by CO2 or ethanol deastringency treatments in cold‐stored ‘Giombo’ persimmon. ­ J. Agron.,12(10). WEBER A., NEUWALD D.A., KITTERMANN D., THEWES F.R., BOTH V., BRACKMANN A., 2020 ­ Influence of respirato‐ ry quotient dynamic controlled atmosphere (DCA‐RQ) and ethanol application on softening of Braeburn apples. ‐ Food Chem., 303: 125346. WOOD R.M., THEWES F.R., REYNAUD M., KITTEMANN D., SAUTTER C.K., WÜNSCHE J.N., NEUWALD D.A., 2022 ­ Apple fruit recovery from anoxia under controlled atmosphere storage. ­ Food Chem., 371: 131152. ZANELLA A., STÜRZ S., 2015 ‐ Optimizing postharvest life of horticultural products by means of dynamic CA: fruit physiology controls atmosphere composition during storage. ­ Acta Horticulturae, 1071: 59­68. https://www.sciencedirect.com/science/article/pii/S0925521422002058 https://www.sciencedirect.com/science/article/pii/S0925521422002058