119 1. Introduction Cochliobolus sativus (Ito & Kurib.) Drechsl. ex Dast. [anamorph: Bipolaris sorokiniana (Sacc. in Sorok.) Shoem.] is an ascomycetous fungus that causes spot blotch (SB) of barley, Hordeum vulgare L., a disease responsible for large economic losses in barley-growing areas (Mathre, 1990). Although the production of conidia is expected to produce genetically identical clones, the high rate of ap- pearance of new races with the ability to infect previously resistant varieties of barley suggests that C. sativus may have high mutation rates in avirulence genes, which deter- mine race (Kumar et al., 2002). General symptoms of SB include light brown lesions with whitish gray centers and chlorotic margins (Kumar et al., 2002). Most varieties grown around the world are susceptible to C. sativus, although partial resistance has been reported (Arabi, 2005; Zhou and Steffenson, 2013). Genetic control of SB resistance is governed by quanti- tative traits. Two quantitative trait loci (QTLs) have been mapped to chromosomes 1S and 5S (Steffenson et al., 1996). However, in the case of the host-specific toxin pro- duced by C. sativus, the fungus which incites SB of bar- ley, the toxin will produce all the symptoms characteristic of the disease; sensitivity to the toxin is correlated with susceptibility to the pathogen and toxin production by the pathogen is directly related to its ability to cause disease (Kumar et al., 2002). Although the most effective control strategy for SB is cultivating resistant varieties, it has often achieved only short-term success due to the frequent breakdown of new- ly introduced resistance (Poudyal et al., 2005; Gontariu and Enea, 2012). This resistance breakdown has been at- tributed to genetic variability in C. sativus (Gilchrist et al., 1995). Different mechanisms have been suggested to explain the frequent generation of race variants, includ- ing heterokaryosis, parasexuality and mutations (Kumar et al., 2002; Arabi and Jawhar, 2007). However, the activity of the retrotransposon microsatellite amplified polymor- phism (REMAP) is another possible mechanism that has been suggested which uses 1 LTR primer in combination with a primer designed for annealing at the 3’ end of a stretch of a simple sequence repeat (SSR) and detects retrotransposons inserted near SSRs (Chadha and Gopal- akrishna, 2005; Biswas et al., 2010). Our overall question was how stable C. sativus isolates would be both genotypically and phenotypically during several serial transfers in one growing season. Therefore, the objective of this work was (i) to determine phenotypic variation of the two major pathotypes of C. sativus in Syria, Pt1 and Pt4 during seven serial transfers on barely plants and (ii) to investigate genetic variation of the isolates col- lected in each generation using DNA fingerprinting. Cultural and genetic evaluation of Cochliobolus sativus during successive passages through susceptible barley M.I.E. Arabi, M. Jawhar (1) Department of Molecular Biology and Biotechnology, AECS, Damascus, Syria. Key words: Cochliobolus sativus, Hordeum vulgare, phenotypes, spot blotch. Abstract: The objective of this work was to assess the stability of retrotransposons DNA elements and several key phenotypic traits important for virulence of Cochliobolus sativus after serially transferring through sus- ceptible barley plants. A significant increase in virulence was observed in offspring isolates generated from the aggressive isolate Pt4, in contrast to the lack of significant changes in those obtained from the weakly ag- gressive isolate Pt1 after seven successive passages. No apparent differences in phenotypes, including mycelial growth, conidiation and conidial germination were observed among isolates from the same parent isolate on artificial medium. Based on retrotransposon microsatellite amplified polymorphism (REMAP), parents and their generations were identical during the serial transfers. Taken together, our results suggest that all single- conidials of the parents and their generations were stable genotypically during seven serial transfers with a change in virulence of the aggressive isolate generations. Adv. Hort. Sci., 2014 28(3): 119-122 (1) Corresponding author: ascientific@aec.org.sy Received for publication 9 June 2014 Accepted for publication 15 September 2014 120 2. Materials and Methods Fungal isolates For the inoculation process, two major pathotypes of C. sativus in Syria, Pt1 and Pt4, were used in this study. They were identical in spore morphology and colony co- lour, but differed widely in DNA patterns and virulence. After extensive greenhouse and laboratory screening over a 10-year period, Pt4 was proven to be the most virulent isolate to all barley genotypes available so far (Arabi and Jawhar, 2003; 2007), therefore it was used in this study. Each isolate was grown separately in 9 cm Petri dishes containing potato dextrose agar (PDA, DIFCO, Detroit, MI. USA) and incubated for 10 days, at 22±1°C in the dark to allow mycelial growth. Inocula preparation, serial transfer and isolation methods After culturing Pt1 and Pt4 isolates on PDA medium, spores were collected by flooding each plate with 10 ml sterile water with 200 ppm of Tween 20, filtering through cheesecloth to remove mycelium and adjusting the con- centration of the spore suspension to 2x104 conidia/ml us- ing hemacytometer counts of conidia. The universal sus- ceptible control (cv. WI2291) plants from Australia were grown in pots filled with sterilized peatmoss, and arranged in a randomized complete block design with three repli- cates. Each experimental unit consisted of 10 seedlings. A full replicate consisted of 10 pots inoculated with Pt1 and Pt4 isolates. Pots were placed in a growth chamber at temperatures of 22±1°C (day) and 17±1°C (night) with a daylength of 12 h and a relative humidity (RH) of 80-90%. Plants were inoculated at growth stage (GS) 12 (Zadoks et al., 1974) by uniformly spraying each plant with 20 ml of conidial suspension with a hand-held sprayer. Plants were then placed in the dark at 95-100% R.H. for the first 18 h. Pt1 and Pt4 isolates and single-conidial isolates from each of the three replicates from the 1st to 7th passage gen- erations through barley plants were compared for viru- lence. Ten days after inoculation, one leaf per plant, for a total of three leaves per replicate, was sampled, surface sterilized and placed on a water agar plate. Three days later, a single conidium from each of the three plates was transferred to PDA for genotypic and phenotypic assays. The infection response based on the measurement of indi- vidual lesion size (dimension; mm) for each second leaf was assessed 10 days after inoculation according to Fetch and Steffenson (1999) scale. Each leaf was assessed sepa- rately and the assessments were performed by the same person in all experiments. In vitro phenotypic assays In vitro phenotypic assays were achieved by transferring plugs of mycelim (5 mm diameter) of each parent and gen- erations onto PDA media and incubation at room tempera- ture (22±1°C) in the dark. Conidial germination rate was re- corded after 24 h on glass cover slips as described previously (Arabi and Jawhar, 2001). Colony diameter was measured seven days post incubation. Conidia were harvested from 15-day cultures using sterile distilled water and counted with a hemocytometer. All the experiments were repeated three times with five replicates, and a representative set of data is presented. Statistical analysis was performed using the STAT-ITCF program (Anonymous, 1988). REMAP analysis DNA extraction from parent and generation isolates was performed according to standard protocols (Leach et al., 1986). REMAP analysis and primer sequences were achieved using a standard method described by Kalendar et al. (1999). PCR reactions were performed in 25 μL re- action volume containing 1× Taq polymerase buffer (10 mmol Tris-HCl/L (pH 8.3), 50 mmol KCl/L, 2.5 mmol MgCl2/L, 0.01% gelatin), 0.5 U Taq polymerase (Eppen- dorf, Germany), 150 μmol of each dNTP/L, 0.4 μmol LTR1 primer/L, 0.6 μmol of ISSR primer/L (Table 1), and 50 ng of template DNA. A PCR was carried out in an Eppendorf DNA thermal master gradient cycler (Eppendorf Netheler- Hinz, Hamburg, Germany). The amplification conditions were as follows: 92°C for 5 min, followed by 40 cycles of 92°C for 45 s, 55°C for 45 s, and 72°C for 1 min; and a final extension step of 72°C for 10 min. Amplified prod- ucts were electrophoresed in a 2% agarose gel using 1 × Tris-borate-EDTA buffer (100 mmol Tris-HCl/L, pH 8.3, 83 mmol boric acid/L, 1 mmol EDTA/L) at 100V. The gels were stained with ethidium bromide solution and visual- ized under ultraviolet illumination. Sizes of the amplified products were determined relative to a 100-bp DNA ladder (MBI Fermentas, York, UK). 3. Discussion and Conclusions Disease symptoms (presence of necrosis and chloro- sis) were severe on the susceptible genotype WI2291 that was infected with pathogenic isolates after 10 days of in- oculation. Pt1 and their generations induced small round to oblong dark brown necrotic lesions, whereas, Pt4 and their generations induced solid dark brown necrotic le- sions with expanding chlorosis (the ‘classic’ spot blotch lesion) in highly compatible interactions. As offspring iso- lates from the most diseased plants were serially passaged Table 1 - REMAP primers used in the study Primer no. Sequence 1 (GA)8T+TGTTTCCCATGCGACGTTCCCCAACA 2 (AG)8T+GCATCAAAGGCATTGGAGGTG 3 (GA)8T+ GCATCAAAGGCATTGGAGGTG 4 (GA)8T+CACTAGTGATTCATTATGCTGAGTG 5 (AG)8T+GCATCAAAGGCATTGGAGGTG 6 (AG)8T+ CACTAGTGATTCATTATGCTGAGTG 7 (AG)8G+CCAATGGACTGGACATCCGATGGG 8 (AG)8T+ TGTTTCCCATGCGACGTTCCCCAACA 9 (AG)8G+ TGTTTCCCATGCGACGTTCCCCAACA 121 on barley, virulence of the aggressive isolate Pt4 was in- creased during seven transfers on plants, and the ability of weakly aggressive isolate Pt1 to maintain its virulence was observed (Table 2). All Pt4 isolates were highly virulent to cv. WI2291 with a mode of 4 (typifying >90% of the lesions observed on leaves), whereas, all Pt1 isolates were virulent exhibiting a mode of 2 (typifying >10% of the lesions observed on leaves), indicating that virulence was not significantly affected. Infection responses of WI2291 to C. sativus isolates Pt1 and Pt4, and their generations are summarized in Ta- ble 2. The pattern of continuous incremental increase in virulence has been reported in F. oxysporum f. sp. ciceris, on chickpea (Jiménez-Gasco et al., 2004), and in Magna- porthe oryzae on rice (Park et al., 2010). However, the pa- thosystems involving the genera of Cochliobolus and the involvement of host-specific toxins in pathogenicity and virulence are well documented (Olbe et al., 1995). The number of SB lesions (presence of necrosis and chlorosis) were always high in the virulent isolate Pt4 dur- ing the serial passages (Fig. 1). This can be attributed to a higher proportion of Pt4 spores being able to establish le- sions than Pt1 spores. This indicates that the more virulent Pt4 causes more lesions (per leaf) from a given inoculum dose than Pt1 as presented in figure 1. The existence of pathotypes expressing differential virulence on host geno- types is uncommon in species related to C. sativus. Differ- ential reactions, such as those expressed by the pathotypes Pt1 and Pt4 on two-rowed genotypes (WI 2291), usually are a feature of gene-for-gene interactions (Flor, 1956) or an incompatibility system (Briggs and Johal, 1994). A hypothesis that these two differentially virulent C. sativus isolates are pathotypes that produce two different types of host-specific toxins may also be valid. Additionally, no significant differences were observed between the parental isolates and any isolates derived from them through the seven serial transfers for any of the phenotypic characters tested in vitro including mycelial growth, conidiation and conidial germination on PDA media (Fig. 2). These results are similar to those of Latter- el and Rossi (1986), who reported no changes in cultural characteristics in Magnaporthe oryzae isolates after serial transfers of the same isolates from stock cultures over a long period of time. To evaluate genotypic stability during serial transfers, REMAP fingerprinting technique was used. The REMAP haplotypes of seven generations were identical to their par- ent isolates (Fig. 3); this might be an indicator of the sta- bility of transposable elements during serial passages. The lack of molecular variation in offspring of Pt4 isolates with increased virulence (Table 2; Fig. 3) is consistent with the fact that mutation rates at virulence loci are higher than those at the molecular loci that define genotypes (Good- win et al., 1995). The results of this study demonstrate that the virulence of the offspring isolates generated from the aggressive isolate Pt4 significantly increased after seven successive Table 2 - Infection responses of barley cv. WI 2291 infected with par- ents and progeny isolates of Cochliobolus sativus based on the scale of Fetch and Steffenson (1999) Isolates Infection response Parent Passages 1 2 3 4 5 6 7 Pt1 Mode (z) 2 1 2 2 2 2 1 1 Range (y) 1-2 1-2 2 1-2 1-2 1-2 1-2 1-2 Pt4 Mode 4 4 4 4 4-5 4 4 4-5 Range 7-9 6 7 7-8 8-9 9 9 9 (z) Mode= The most common infection response observed on the barley cv. WI2291. (y) Range= The lowest and highest infection responses observed on the barley cv. WI2291. Fig. 1 - Number of lesions caused by Pt1 and Pt4 isolates after seven serial transfers barley cv. WI2291. Fig. 2 - Cultural characterization of two C. sativus isolates Pt1 and Pt4 after seven passages on PDA medium and through barley plants. Fig. 3 - Agarose gel electrophoresis of REMAP analysis Pt1 and Pt4 parent isolates after seven passages through barley cv. WI2291 using primer; (GA)8T+GCATCAAAGGCATTGGAGGTG. M–marker ladder 1Kb. 122 passages, in contrast to the lack of significant changes in those obtained from the weakly aggressive isolate Pt1. No apparent differences in phenotypes, including myce- lial growth, conidiation and conidial germination, were observed among isolates from the same parent isolate on artificial medium. All single-conidial of the parents and their generations were stable genotypically during the se- rial transfers with a change in virulence of the aggressive isolate generations. Acknowledgements The authors thank the Director General of AECS and the Head of Biotechnology Department for their help throughout the period of this research. References ANONYMOUS, 1988 - STAT-ITCF, Programme, MICROSTA, realized by ECOSOFT, 2nd Ver. - Institut Technique des Cere- als et des Fourrages, Paris, pp. 55. ARABI M.I.E., 2005 - Inheritance of partial resistance to spot blotch in barley. - Plant Breeding, 124: 605-607. ARABI M.I.E., JAWHAR M., 2001 - The response of Co- chliobolus sativus to ultraviolet - C - radiation. - Journal of Phytopathology, 149: 521-525. ARABI M.I.E., JAWHAR M., 2003 - Pathotypes of Cochliobolus sativus (spot blotch) on barley in Syria. - Journal of Plant Pa- thology, 85: 193-196. ARABI M.I.E., JAWHAR M., 2007 - Molecular and pathogenic variation identified among isolates of Cochliobolus sativus. - Australasian Plant Pathology, 36: 17-21. BISWAS M.K., XU Q., DENG X.X., 2010 - Utility of RAPD, ISSR, IRAP and REMAP markers for the genetic analysis of citrus spp. - Science Horticulture, 124: 254-261. BRIGGS S.P., JOHAL G.S., 1994 - Genetics patterns of plant host-parasite interactions. - Trends in Genetics, 10: 12-16. CHADHA S., GOPALAKRISHNA T., 2005 - Retrotransposon- microsatellite amplified polymorphism (REMAP) markers for genetic diversity assessment of the rice blast pathogen (Magnaporthe grisea). - Genome, 48: 943-945. FETCH T.C., STEFFENSON B.J., 1999 - Rating scales for assessing infection responses of barley infected with Co- chliobolus sativus. - Plant Disease, 83: 231-217. FLOR H.H., 1956 - The complementary genetic systems in flax and flax rust. - Advances in Genetics, 8: 29-54. GILCHRIST S., VIVAR F.L.H., GONZALEZ C., VELAQUEZ C., 1995 - Selecting sources of resistance to Cochliobolus sativus under subtropical conditions and preliminary loss. - Rachis, 14: 35-40. GONTARIU I., ENEA I.C., 2012 - Studies on the efficiency of some fungicide at two-row spring barley for fighting against spot blotch (Cochliobolus sativus Ito and Kurib) in the North-West Suceava Plateau. - Agriculture Journal, 7: 70-73. GOODWIN S.B., SUJKOWSKI L.S., FRY W.E., 1995 - Rap- id evolution of pathogenicity within clonal lineages of the potato late blight disease fungus. - Phytopathology, 85: 669-676. JIMÉNEZ-GASCO M.M., MILGROOM M.G., JIMÉNEZ-DI- AZ R.M., 2004 - Stepwise evolution of races in Fusarium oxysporum f. sp. ciceris inferred from fingerprinting with repetitive DNA sequences. - Phytopathology, 94: 228-235. KALENDAR R., GROB T., REGINA M., SUONIEM A., SCHULMAN A., 1999 - IRAP and REMAP: two new ret- rotransposon-based DNA fingerprinting techniques. - Theo- retical and Applied Genetics, 98: 704-711. KUMAR J., SCHAFER P.R., LANGEN G., BALTRUSCHAT H., STEIN E., NAGARAJAN S., KOGEL H.K., 2002 - Bi- polaris sorokiniana, a cereal pathogen of global concern: cy- tological and molecular approaches towards better control. - Molecular of Plant Pathology, 3: 185-195. LATTERELL F.M., ROSSI A.E., 1986 - Logevity and patho- genic stability of Pyricularia oryzae. - Phytopathology, 76: 231-235. LEACH J., FINKELSTEIN D.B., RAMBOSEK J.A., 1986 - Rapid miniprep of DNA from filamentous fungi. - Fungal Ge- netics Newsletter, 33: 32-33. MATHRE D., 1990 - Compendium of barley diseases. - APS Press, St. Paul, MN, USA, 2nd edition, pp. 90. OLBE M., SMMARIN M., GUSTAFSSON M., LUNDBORG, T., 1995 - Effect of the fungal pathogen Bipolaris sorokiniana toxin pre-heminthosporol on barley root plasma membrane vesicles. - Plant Pathology, 44: 625-635. PARK S.Y., CHI H.M., MILGROOM M.C., KIM H., HAN S., SKANG S., LE Y.H., 2010 - Genetic stability of Mag- naporthe oryzae during successive passages through rice plants and on artificial medium. - The Plant Pathology Jour- nal, 26: 313-320. POUDYAL S.D., DUVEILLER E., SHARMA R.C., 2005 - Ef- fects of seed treatment and foliar fungicides on Helminthospo- rium leaf blight and performance of wheat in warmer growing conditions. - Journal of Phytopathology, 153: 401-408. STEFFENSON B.J., HAYES P.M., KLEINHOFS A., 1996 - Genetics of seeding and adult plant resistance to net blotch (Pyrenophora teres f. teres) and spot blotch (Cochliobolus sativus) in barley. - Theoretical of Applied Genetics, 92: 552-558. ZADOKS J.C., CHANG T.T., KONZAK C.F., 1974 - A decimal code for the growth stages of cereals. - Weed Research, 14: 415-421. ZHOU H., STEFFENSON B., 2013 - Genome-wide association mapping reveals genetic architecture of durable spot blotch resistance in US barley breeding germplasm. - Molecular Breeding, 32: 139-154.