133 1. Introduction Plants are naturally exposed to ultraviolet (UV) rays mostly at UV-A range (wave length, 320-400 nm), espe- cially on sunny days in summer. In contrast, the level of harmful UV-C (wave length >220 nm) and UV-B (wave length, 280-320 nm) reaching the ground surface which po- tentially damages living organisms including plants could be effectively blocked and minimized by the presence of ozone layer above the stratosphere (Staehelin et al., 2001). However, especially in the southern hemisphere, the area of seasonal depletion of the ozone layer often expands out- side the Antarctic region, occasionally allowing temporal increases in solar UV-B and relatively long-wave range of UV-C reaching the Earth’s surface (Staehelin et al., 2001). Therefore, from the global point of view, studies on the plant-damaging impact of UV rays have key importance to both biologists and environmental researchers. In general, irradiation with a high dose UV-C results in induction of programmed cell death in living plants. In seed- lings and protoplasts of Arabidopsis thaliana, a dose of UV-C around 10-50 kJ m-2 induces an oligonucleosomal DNA frag- mentation which is reminiscent of the apoptotic DNA ladder- ing often described in mammalian cells (Danon and Gallois, 1998). In addition, UV-C-dependent cell death development in Arabidopsis involves caspase-like activity which is also similar to the events in animal apoptosis (Danon et al., 2004). On the other hand, a pulse or low dose of UV-C radia- tion is frequently used for direct removal of germs from fresh produce (Stevens et al., 1998). For instance, exposure of fruit tissue slices of zucchini squash to low dose UV-C Impact of UV irradiation in leaves, fruits and suspension-cultured cells of Micro-Tom, tomato T. Hiramatsu,1 L.A. Terry,2 T. Kadono,1 T. Kawano1,3,4 * 1 Laboratory of Chemical Biology and Bioengineering, Faculty and Graduate School of Environmental Engineering, The University of Kitakyushu, Kitakyushu, Japan. 2 Plant Science Laboratory, Cranfield University, Bedfordshire Cranfield, MK43 0AL, United Kingdom. 3 Kitakyushu Research Center (LINV@Kitakyushu), Kitakyushu, Japan. 4 Université Paris Diderot, Sorbonne Paris Cité, Paris 7 Interdisciplinary Energy Research Institute (PIERI), Paris, France. Key words: ethylene, pathogenesis, redox, ripeness, salicylic acid, Solanum lycopersicum, ultraviolet. Abbreviations: ACC= 1-amincocyclopropane-1-carboxylic acid; ACS1a= 1-amincocyclopropane-1-carboxylic acid synthase; APX= cytosolic ascorbate peroxidise; CIA= chloroform and isoamyl alcohol; DNase= deoxyribonuclease; PAL= phenylalanine ammonia-lyase; PR= pathogenesis-related; ROS= reactive oxygen species; RT-PCR= reverse transcription polymerase chain reaction; SA= salicylic acid; UV, ultraviolet. Abstract: The present study aims to understand both positive and negative impacts of ultraviolet (UV) rays in living dwarf tomato plants (Solanum lycopersicum L. cv. Micro-Tom). This paper examines the impact of UV-C (254 nm) and UV-A (365 nm) on induction of cell death and expression patterns of pathogenesis-related (PR), stress-related and redox-related genes, namely, of 1-amincocyclopropane-1-carboxylic acid synthase (ACS1a), cytosolic ascorbate peroxidise (APX), phe- nylalanine ammonia-lyase (PAL), and pathogenesis-related genes (PR1 and PR-P2), in leaves, fruits (both green and red), and suspension-cultured cells of Micro-Tom. Effects of short exposure to UV-C, but not to UV-A, on induction of cell death (in cell suspension) and development of lesions accompanied by ion leakage (in the leaves) were observed while no morphological change was observed in the UV-treated green and red fruits. UV-dependent induction of PR genes (PR1 and PR-P2) in these samples suggested that UVs can be used for plant defense activation. In addition, expression of ACS1a was shown to be negatively and positively regulated by UV-C and UV-A, respectively. Thus UV-dependent post- harvest controls of fruit maturity and shelf-life are likely applicable (i.e. retardation and/or acceleration of maturation). Adv. Hort. Sci., 2014 28(3): 133-140 (*) Corresponding author: kawanotom@env.kitakyu-u.ac.jp Received for publication 25 June 2014 Accepted for publication 1 August 2014 134 reportedly lowers the microbial activity and prevents dete- rioration of fruit quality during subsequent storage at low temperatures, while a burst in respiration rate in the treated tissues is induced (Erkan et al., 2001). In addition to direct removal of pathogenic microbes from the plant surface by UV, researchers have reported attempts to use UV radiation for so-called ‘plant hormesis’ by which the susceptibility of plants to pathogens could be minimized and shelf-lives of fresh produce could be extended (Stevens et al., 1996, 1998). To date, various fruits and vegetables including sweet potatoes (Stevens et al., 1990, 1999), apples (Lu et al., 2007), peaches (Stevens et al., 1998; Lu et al., 2007), and tomatoes (Liu et al., 1993) have been tested for UV-mediated disease resistance controls. In most of the cases, resistance against pathogens was induced by UV-C (Stevens et al., 1999). It is likely that treatment with UV rays (including UV- C) builds up the “immunity” against microbial infection in living plants, thus the UV hormesis effects described above may be, at least partially, attributed to stimulation of plants’ innate immunity. The innate immune system of plants against pathogenic microbes is known to be elicited in response to recognition of pathogen-derived molecules by plant cells, as reviewed elsewhere (Dangl and Jones, 2001; Chisholm et al., 2006; Yoshioka et al., 2008). Recognition of such elicitors by the host cells’ transmembrane receptors (Jones and Dangl, 2006; Altenbach and Robatzek, 2007) or resis- tance (R) proteins (Allen et al., 2004; Chisholm et al., 2006; Dodds et al., 2006) reportedly initiates the cellular signaling cascades which finally activate the defense mechanisms. Micro-Tom, a dwarf cultivar of tomato (Solanum lyco- persicum L.), originally produced for ornamental purpos- es, has been proposed as preferred plant material for mo- lecular biological research, mainly because of its compact habitat and short life cycle (Meissner et al., 1997; Eyal and Levy, 2002; Marti et al., 2006). Recently, AbuQamar et al. (2009) suggested that Micro-Tom is a good model for studying the crosstalk between biotic and abiotic stress responses through regulation of gene expression. In the present study, cellular damage (viz. cell death in- crease in suspension culture and increase in ion leakage at tis- sue level) and preceding changes in the gene expression pat- terns, especially those of defence-related, redox-related, DNA maintenance-related and fruit maturation-related genes, are shown to be induced by UV-A and UV-C in the leaves, fruits and suspension-cultured cells of Micro-Tom. The signalling mechanisms contributing to the regulation of UV responses are also discussed by analogy to plant immunity responses. Furthermore, the discussion addresses UV-dependent exten- sion of the storage life of tomato fruits through stimulation of plant immunity mechanism by post-harvest exposure to UVs. 2. Materials and Methods Plant materials Following the protocols described elsewhere (Kadono et al., 2009), seeds of tomato (Solanum lycopersicum L., cv. Micro-Tom) were allowed to germinate on a wet paper towel in a transparent plastic container placed in a light-cycle- conditioned incubator (12 h light and 12 h dark at 23°C). Immediatly after germination the resulting plantlets were re-planted in plastic pots filled with a standard soil mixture and watered daily in the light-cycle-controlled incubator for three months. From the adult plants, leaflets, green imma- ture and red ripe fruits (minimum size, 15 mm in diameter) were harvested before and after irradiation with UV lights. Preparation of cell suspension culture Again, following protocols described elsewhere (Ka- dono et al., 2009), cell suspension culture derived from Micro-Tom was prepared. Briefly, the leaf slices were taken from a seedling of Micro-Tom grown in vitro and placed on a MS agar plate containing 2,4-dichlorophe- noxyacetic acid (0.2 μg ml-1) to promote the formation of calli. Suspension culture of cells was initiated by addition of the sliced calli into the MS liquid medium (pH 5.8). The cells suspended in 30 ml of media in 100 ml-conical flasks were kept on gyratory shakers (at 130 rpm) at 23°C in darkness, with occasional sub-cultures by innoculating the fresh media with 3 ml of confluent culture. After about six months of continuous propagation of the cells with constant sub-culturing (initially twice a month and later once a week), a stable cell line was obtained. For experimental purposes, the culture was pre-condi- tioned as follows. The confluent culture was used to inocu- late the fresh MS liquid medium (3 ml culture to 30 ml me- dium) and pre-cultured for three days. Then 6.5 ml of each pre-culture was transferred to 100 ml of fresh MS liquid medium (in a 500 ml conical flask) and further cultured for three days. The resultant three-day-old large scale culture (at log-phase) was harvested and used for the experiments. UV treatments Intact and/or excised leaves (leaflets and leaf disks), green and red fruits, and suspension-cultured cells of Micro- Tom were irradiated with UV-C (254 nm) or UV-A (365 nm) using a handy UV trans-illuminator (SLUV-4, As-one, Osa- ka, Japan). The intensities of UV-A and UV-C were moni- tored with UV meters (UVX-25, UVP Inc., Upland, CA; YK-34UV, Lutoron Electronic Enterprise Co., Ltd., Taipei, Taiwan) and the intensity of UV-A and UV-C applied to the surfaces of plant materials were adjusted to 2.2 mW cm-2, therefore the doses of UV irradiation were controlled by al- tering the length of irradiation time. Leaflets and fruits were exposed to UV rays immediately after harvest. To prevent water loss from the leafy samples during UV irradiation and incubation, leaflets and leaf discs were floated on ultrapure water in Petri dishes. For treatment of the cultured cells, 1 ml of cell suspension was added to each well on 12-well mi- croplates and used for irradiation with UV rays. Irradiation time varied as indicated in the Results section. Measurement of ion leakage from leaf discs Measurements of ion leakage were performed using the discs of leaflets floated on the ultrapure water. Leaf discs were irradiated with UV rays for 30 min and further in- 135 cubated in darkness for up to 24 h. Each single well on a 12-well microplate was filled with 5 ml of ultrapure water and used to float three leaf discs (diameter, 9 mm) freshly prepared from the leaflets. Using a handheld conductiv- ity meter (CD502A, Custom, Tokyo, Japan), monitoring of the changes in conductivity in the bathing liquid (with 1 h intervals up to 10 h) were carried out following 24 h of post-UV incubation. An increase in conductivity reflects the leakage of ions from the UV-dependently damaged leaves. The extent of ion leakage was expressed as the ra- tio (percentage) of recorded conductivity to the maximal conductivity obtained after boiling the samples. Evaluation of cell death Analysis of induced cell death in suspension culture was carried out as described elsewhere (Iwase et al., 2014). Following UV-treatments, 200 μl-aliquots of cell suspen- sion were sampled and transferred into 1.5 ml tubes and statically incubated in darkness (for 2 h unless indicated). Then, 0.1 % (w/v) Evans blue was added to the cell sus- pension and further incubated for an additional 1 h. Fol- lowing repeated washes with fresh media, counting of the stained cells was performed under microscopes (SMZ800 and Labophoto, Nikon, Tokyo, Japan; VHX-100, Keyence, Tokyo, Japan) and the level of cell death was quantified. For statistical analysis, three to four different digital im- ages of cells under the microscope (each covering 50-100 cells to be counted) were acquired and analyzed. RNA isolation following UV irradiation Isolation of RNA followed by reverse-trancriptase poly- merase chain reaction (RT-PCR) was carried out basically as described (Kunihiro et al., 2011). Leaflets and fruits were subjected to irradiation with UV rays for 30 min, and were sampled and frozen in liquid N 2 at 0, 1 and 10 h after irradia- tion. Post-UV incubation was carried out in darkness. Cell suspensions on 12-well microplates subjected to 15 min of irradiation with UV rays were further incubated for 1 h in the darkness. Cells were then harvested by filtering through 40-μm pore nylon mesh and washed with fresh liquid culture medium. The obtained samples were frozen in liquid N 2 . These frozen samples were ground using a pestle and mortar and transferred to plastic tubes and extracted with the RNA extraction buffer containing 100 mM Tris-HCl (pH 8), 100 mM ethylenediaminetetraacetic acid, 100 mM LiCl, and 1% sodium dodecyl sulfate. Then aliquots of 1:1 mixture of phenol and CIA (chloroform:isoamyl alcohol at 24:1) were added and samples were subjected to centrifuga- tion at 14,000 g for 10 min at 4°C. The upper layer collected in separate tubes were further subjected to extraction with aliquots of phenol and CIA and centrifugation. The resul- tant upper layer was again collected in new tubes and mixed with 1/3 volume of 10 M LiCl and kept at -30°C for 2 h. Fol- lowing centrifugation, the resultant pellets were collected and re-suspended in 2 M LiCl and spin-collected. The pellet formed was dissolved in TE buffer and added with 1/2 vol- ume of both phenol and CIA. The samples were subjected to 10 min of centrifugation and the upper layer was collected and mixed with the aliquot of CIA, and further centrifuged. For precipitation of RNA, the upper layer was collected and mixed with 1/10 volume of 3 M sodium acetate and 2.5 vol- ume of absolute ethanol, and centrifuged. The pellet washed with 70% ethanol was spin-collected, dried and dissolved in diethylpyrocarbonate-treated water. RT-PCR Prior to analysis with RT-PCR, genomic DNA concomi- tantly present in the total RNA preparations was eliminated with RNase-free Cloned DNase I (Takara Bio Inc., Otsu, Japan). First-strand cDNA synthesis was performed using SuperScriptTM III reverse transcriptase (Invitrogen Corpora- tion, CA). The reaction mixtures (20 μl/tube) contained total RNA (2 μg), oligo-(dT) 20 (2.5 mM), and dNTP mixture (2 mM). The tubes were heated to 65°C for 5 min, cooled and kept at 4°C for 1 min using Program Temp Control System PC-320 (ASTEC, Fukuoka, Japan). To the reaction mixture, 4 μl of 5x First-Strand buffer, 1 μl of 0.1 M dithiothreitol, 1 μl of RNaseOUT recombinant RNase inhibitor and 1 μl of SuperScriptTM III reverse transcriptase (200 units μl-1) were added and incubated at 50°C for 60 min. The reaction was terminated by heating at 70°C for 15 min and cooling at 4°C for 15 min. The resultant cDNA solution was used for PCR performed with 60 ng of first-strand cDNA and Takara ExTaqTM (Takara Bio Inc., Otsu, Japan). For each sample, 30 cycles of PCR were performed with denaturing at 94°C for 1 min, annealing for 1 min and elongation at 72°C for 1 min. Sequences of the primers used and anealing tempera- tures employed are listed in Table 1. Table 1 - List of primers used for RT-PCR Genes studied Accession numbers * Forward primers Reverse primers Tm (˚C) Actin U60481 cacactgtccctatttacga gtaataacttgtccatcagg 51.3 ACS1a U72389 gctttgggttagtttcagctc gttcatgaactcatgatccaatc 56.5 APX DQ096286 gagtacctcaaggctgttgacaaatg gagcctcagcaragtcagcaaag 60.0 PR-P2 X58548 ggagagagttaacaagttgtgtg gagtagtattaaaagttagctcg 60.0 PR1 DQ159948 cttctcatggtattagcc ccaccatccgttgttgc 50.3 PAL M83314 gacacacaagttgaagcatcac cacatcttggttgtgttgctc 56.5 * Accession numbers were of NCBI GenBank. Tm= melting temperature used for annealing. 136 3. Results Cellular damage On the UV-C-treated leaves, the damaging impact of UV-C at cellular level could be visualized as spotted le- sions appeared (Fig. 1). Such visible damage was not ob- served on the UV-A-treated leaves. In addition to visible symptoms, UV-C irradiation resulted in a marked increase in ion leakage from leaf disc preparations (Fig. 2). Leak- age of ions indicates that the cellular membrane is one of the targets of the damaging impact of UV-C irradiation. After irradiations with UV rays at 2.2 mW cm-2, sus- pension-cultured cells of Micro-Tom showed development of cell death depending on the type of UVs, exposure time and the length of post-exposure incubation (Fig. 3). Com- pared to UV-A, impact of UV-C irradiation was shown to be much more severe, requiring shorter irradiation time and post-irradiation incubation. UV-responsive gene expressions The genes examined were 1-amincocyclopropane- 1-carboxylic acid (ACC) synthase gene (ACS1a), ascor- bate peroxidise gene (APX, cytosolic isoform), pathogen- esis-related (PR) genes PR1 and PR-P2, and phenylalanine ammonia-lyase gene (PAL) as possible targets of UV im- pact, and actin gene as non-inducible reference. Fig. 1 - Development of UV-induced symptoms (lesions) on the leaves of Micro-Tom after the UV-irradiation. Leaflets were irradiated with UV rays for 30 min and further incubated in darkness on ultrapure water. Lesions on the leaves were observed under microscopes. Typical images from three repeated experiments are shown. Fig. 2 - Measurement of ion leakage from the UV-irradiated leaf discs of Micro-Tom. Leaf discs were irradiated with UV rays for 30 min and further incubated in darkness on ultrapure water. The percentage of ion leakage was calculated as a ratio to conduc- tivity after boiling of the leaf samples. Each data point and error bar reflect the mean and S.D., respectively (n = 3). Fig. 3 - UV-induced cell death in suspension cultured cells. (A) Effect of irradiation time on the UV-induced cell death. (B) Progress of cell death after the UV-A-irradiation. (C) Progress of cell death after the UV-C-irradiation. Cell death was judged by Ev- ans blue staining under microscopes. Each data point and error bar reflect the mean and S.D., respectively (n = 3). 137 In the cell suspension culture of Micro-Tom, expres- sion of APX, PR-P2, PAL, and actin were shown to be maintained at active level even prior to the irradiation with UV rays (Fig. 4 A, dark control). In the leaf samples of Micro-Tom, ACS1a, APX, PAL, PR-1 and actin were shown to be expressed without UV irradiations (Fig. 4 B). Similarly, mature red fruit samples revealed high expres- sions of ACS1a, APX, PR-1 and actin, prior to the irradia- tion with UV rays (Fig. 5 B). In contrast, in the green fruit samples, only APX and actin were expressed in the dark control (Fig. 5 A). Among the genes tested, ACS1a was the only gene UV- dependently activated in the cell suspension culture. Ex- pression of ACS1a was induced by both UV-A and UV-C (Fig. 4 A). UV-A-dependent activations of PR1 in the green fruits and leaves, of ACS1a in the green fruits and cell sus- pension culture, and of PAL and PR-P2 in the green fruits were observed (Fig. 4 and 5). UV-C-dependent activation of PR1 in green fruits and leaves, of PR-P2 in the leaves, of PAL in green fruit tissue, and of ACS1a in the green fruits and also in the cell suspension culture were observed (Fig. 4 and 5). Although PR1 was shown to be responsive to both UV-A and UV-C in green fruit tissue, the temporal profiles of induced gene expression largely differed. In green fruits, UV-A and UV-C were shown to be rapid and slow inducers of PR1 expression, respectively (Fig 5). Since, most of the genes examined were active in the dark control of red fruit samples, drastic activation of gene expression could not be observed, except for the case of enhancement of PR-P2 expression which was originally active in the dark control. APX was shown to be active in all materials even prior to UV irradiation, thus only the suppressive impacts of UV irradiations could be expected with this gene. Suppression of APX expression was observed in the UV-C-treated red fruit samples at 10 h after irradiation. Similarly, follow- ing irradiation with UV-C, expressions of PR-P2 and PAL, which were constitutively active in the cell suspension, were eventually suppressed. Expression of ACS1a in the leaves and red fruits was shown to be suppressed by UV-A irradiation. Expression of ACS1a, PR-P2, and PR1, origi- nally active in red fruits, were shown to be suppressed by UV-C treatments. 4. Discussion and Conclusions Cell death or defense activation? A number of researchers have documented toxic im- pacts of UV rays in living plants including the damages to DNA, inhibition of photosynthesis, generation of reactive oxygen species (ROS) (Roldán-Arjona and Ariza, 2009). On the other hand, there have been some attempts to devel- op the UV irradiation protocol for so-called ‘plant horme- sis’ by which the susceptibility of plants to invading patho- gen is minimized and thus shelf-life of fresh produces is likely extended (Lu et al., 2007). For example, Kunz et al. (2008) demonstrated that UV-C-induced DNA damage in Arabidopsis accompanies the dose- and time-dependent development of resistance against Hyaloperonospora par- asitica. Interestingly, it has been shown that, even in the absence of UV-C, plant nucleotide excision repair mutants displayed the identical type of resistance to H. parasitica, suggesting a positive role for UV-C-mediated DNA dam- aging events in plant immunity activation. APX, one of the typical antioxidant genes, encodes for the enzyme capable of H 2 O 2 elimination, thus protecting Fig. 4 - RT-PCR analysis of UV-responsive gene expressions in cell sus- pension and green leaves. Typical RT-PCR profiles of gene ex- pressions in UV-irradiated cell suspension (A) and leaf samples (B) are shown. Actin was used as an internal control. Note: com- parison of the density of bands on several gels were performed after gathering the images of gels on the black background. Fig. 5 - RT-PCR analysis of UV-responsive gene expressions in green fruits and red ripe fruits. Typical RT-PCR profiles of gene expres- sions in UV-irradiated green fruits (A) and red ripe fruits (B) are shown. Actin was used as an internal control. Note: comparison of the density of bands on several gels were performed after gath- ering the images of gels on the black background. 138 the plants from the damaging impacts of ROS. PR genes (viz., PR-P2 and PR1) and PAL are related to the actions and production of salicylic acid (SA). SA is a hormone- like natural signaling molecule involved in the defense re- sponse against infection by pathogens in higher plants. SA acts by stimulating the production of PR proteins through a complex signaling mechanism involving ROS, calcium and protein phosphorylation in the early stages (Kawano et al., 1998; Kawano and Bouteau, 2013). In Solanace- ae plants including tobacco and tomato, the increase in PAL expression reportedly results in accumulation of SA (Kawano et al., 2004). Here, the short exposure to UV-C but not to UV-A result- ed in an acute increase in cell death in the cell suspension culture (Fig. 3). Development of lesions (visible symptoms), (Fig. 1) accompanied by ion leakage (sign of membrane damage) (Fig. 2) was induced in the UV-C-treated leaf sam- ples. In contrast, no visible damage was observed in the UV- treated green and red fruits. It is noteworthy that UV-A or sub-lethal low dose UV-C was shown to induce the defense- related genes (PR1 and PR-P2 genes) in the leaves (Fig. 4 B) and green fruit tissues (Fig. 5 A). The above data imply that cell death (possibly apoptot- ic, data not shown) and plant protection mechanisms (ex- pression of antioxidant genes and PR genes) are induced by high and low doses of UV-C, respectively. Therefore, moderate doses of UV irradiation should be applicable to plants to confer tolerance to a variety of abiotic stresses (chiefly, oxidative stress) and innate plant immunity (rep- resented by the induced expression of PR genes). Possible involvement of SA signaling Our data are comparable to the work of Marco et al. (2008) who reported the ozone-induced gene expression controls in the leaves of three tomato cultivars (viz., Ni- kita, Alisa Craig and Valenciano). Similar to our data on UV-treated Micro-Tom, expression of APX is reportedly suppressed in the ozone-treated Nikita tomato (Marco et al., 2008). In addition, the tomato leaves chronically ex- posed to ozone showed activation of redox-related and defense-related genes such as PAL (Marco et al., 2008). Thus, ozone-induced gene expression patterns and the UV-induced gene expression patterns may share a com- mon regulatory mechanism. One of the key pathways that may be common to ozone response and UV response in tomato is the SA signaling pathway. Expressions of PR genes and EDS1, known fac- tors functioning upstream of SA-dependent expression of PR genes (Falk et al., 1999), were induced by ozone in three tomato cultivars (Marco et al., 2008). In the present investigation, activation of PAL and PR genes in the UV- treated Micro-Tom leaves (Fig. 4B) was observed, sug- gesting the possible involvement of a SA signaling path. Recently, in the culture of Arabidopsis cells, we ob- served that over-expression of bacterial salicylate hydrox- ylase gene (NahG) and pharmacological reagents target- ing either ROS or calcium signaling effectively blocked both the cell death induction by high-dose UV-C and in- duction of defense-related gene expressions by sub-lethal low-dose UV-C (Hiramatsu et al., unpublished results). Requirements for early calcium signaling, proven by ae- quorin luminescence and the action of calcium targeted pharmacological reagents, and generation of ROS, are commonly observed in various plant models during the re- sponses to SA (Kawano et al., 1998; Kawano and Muto, 2000; Kawano and Bouteau, 2013), pathogen-derived mol- ecules (Kadota et al., 2004), ozone (Kadono et al., 2006, 2010; Tran et al., 2013), peroxyacetyl nitrate (Yukihiro et al., 2012), toxic metal ions (Lin et al., 2005; Kagenishi et al., 2011; Kunihiro et al., 2011), and UV (Hiramatsu et al., unpublished results). Possible regulation of SA action by UV-C According to the work by Nawrath et al. (2002) using Arabidopsis thaliana, expression of EDS5, a member of multidrug and toxin extrusion transporter family, known to be involved in the accumulation of SA and PR1 transcript, is very low in unstressed plants but strongly induced by attacks by pathogens, treatment with SA, and irradiation with UV-C. EDS5 expression induced by pathogen infec- tion and UV-C exposure largely depends on the pathogen response proteins EDS1, PAD4, and NDR1, suggesting the requirements for the signal transduction pathways commonly employed in UV-C responses and defence re- sponses (Nawrath et al., 2002). This defense mechanism- dependently induced EDS5 transcript reportedly starts accumulating 2 h after exposure to UV-C, and the tran- scription level likely remains for two days, thus further contributing to the long-lasting SA responses. This view shall be studied in detail in our future experiments. Possible role of chlorophylls. Our data indicate that the response in green samples (leaves and immature fruits) and non-green samples (ripe fruits and suspension cultured cells) might differ in their modes of responses to UVs. While PR1 expression, one typical measure of stress responses, was induced by UV-C in green tissues, non-green samples (both the ripe fruits and cell suspensions) showed no induction of PR1 ex- pression (Fig. 4 and 5). It is tempting to speculate that the chlorophyll-related compounds may behave as secondary active signals for mediating the stress responses. One of such candidate compounds may be pheophorbide a de- rived from chlorophyll a, which is known to be produced in the ethylene-exposed green tomato fruits (Kawano et al., 1999). Recently, it was revealed that pheophorbide a plays a key role in both light-dependent and light-inde- pendent cell death mechanism in plants (Hirashima et al., 2009). This aspect is worth testing in future experiments. Regulation of ethylene production ACS1a coding for ACC synthase is a ripening-related gene responsible for production of ethylene precursor, ACC. Since ethylene promotes the ripening of fruits and senescence of leaves, UV-dependent changes in ACS1a expression may drastically affect the life-cycle of the 139 plants and shelf-life of the fruits. This ethylene biosynthe- sis-related gene was shown to be activated by both UV-A and UV-C in the cell suspension culture and green fruits, suggesting that UV treatments may be available for post- harvest enhancement of fruit maturity. Interestingly, UV-A and UV-C irradiation to red fruits resulted in gradual low- ering of the ACS1a expression level (Fig. 5), suggesting that UVs are possibly applicable for retardation and pre- vention of ethylene-mediated fruit over-ripening and sof- tening. Acknowledgements This work was supported by the grant-in-aid from Kitakyushu Foundation for the Advancement of Industry, Science, and Technology (FAIS) and a grant of Regional Innovation Strategy Support Program implemented by Ministry of Education, Culture, Sports, Science and Tech- nology (MEXT), Japan. References ABUQAMAR S., LUO H., LALUK K., MICKELBART M.V., MENGISTE T., 2009 - Crosstalk between biotic and abiotic stress responses in tomato is mediated by the AIM1 tran- scription factor. - Plant J., 58: 347-360. ALLEN R.L., BITTNER-EDDY P.D., GRENVILLE-BRIGGS L.J., MEITZ J.C., REHMANY A.P., ROSE L.E., BEYNON J.L., 2004 - Host-parasite coevolutionary conflict between Arabidopsis and downy mildew. - Science, 306: 1957-1960. ALTENBACH D., ROBATZEK S., 2007 - Pattern recognition receptors: from the cell surface to intracellular dynamics. - Mol. Plant Microbe Interact., 20: 1031-1039. CHISHOLM S.T., COAKER G., DAY B., STASKAWICZ B.J., 2006 - Host-microbe interactions: shaping the evolution of the plant immune response. - Cell, 124: 803-814. DANGL J.L., JONES J.D.G., 2001 - Plant pathogens and in- tegrated defence responses to infection. - Nature, 411: 826- 833. DANON A., GALLOIS P., 1998 - UV-C radiation induces apop- totic-like changes in Arabidopsis thaliana. - FEBS Letters, 437: 131-136. DANON A., ROTARI V.I., GORDON A., MAILHAC N., GAL- LOIS P., 2004 - Ultraviolet-C overexposure induces pro- grammed cell death in Arabidopsis, which is mediated by caspase-like activities and which can be suppressed by cas- pase inhibitors, p35 and defender against apoptotic death. - J. Biol. Chem., 279: 779-787. DODDS P.N., LAWRENCE G.J., CATANZARITI A.M., THE T., WANG C.I.A., AYLIFFE M.A., KOBE B., ELLIS J.G., 2006 - Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax avirulence genes. - Proc. Natl. Acad. Sci. USA, 103(23): 8888-8893. ERKAN M., YI C., KRIZEK D.T., 2001 - UV-C irradiation re- duces microbial populations and deterioration in Cucurbita pepo fruit tissue. - Environ. Exper. Bot., 45: 1-9. EYAL E., LEVY A.A., 2002 - Tomato mutants as tools for func- tional genomics. - Curr. Opin. Plant Biol., 5: 112-117. FALK A., FEYS B.J., FROST L.N., JONES J.D.G., DANIELS M.J., PARKER J.E., 1999 - EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has ho- mology to eukaryotic lipases. - Proc. Natl. Acad. Sci. USA, 96: 3292-3297. HIRASHIMA M., TANAKA R., TANAKA A., 2009 - Light-in- dependent cell death induced by accumulation of pheophor- bide a in Arabidopsis thaliana. - Plant Cell Physiol., 50: 719- 772. IWASE J., FURUKAWA H., HIRAMATSU T., BOUTEAU F., MANCUSO S., TANAKA K., OKAZAKI T., KAWANO T., 2014 - Protection of tobacco cells from oxidative copper tox- icity by catalytically active metal-binding DNA oligomers. - J. of Exper. Bot., 65: 1391-1402. JONES J.D., DANGL J.L., 2006 - The plant immune system. - Nature, 444: 323-329. KADONO T., KAWANO T., YUASA T., IWAYA-INOUE M., 2009 - Effect of sugars on aluminum-induced oxidative burst and cell death in tomato suspension cells, pp. 201-204. - In: SHEN X., X. YANG, X. ZHANG, J.C. ZONG, L.J. KRIC- KA, and P.E. STANLEY (ed.) Bioluminescence and Chemi- luminescence: Light emission: Biology and scientific appli- cations. World Scientific Publishing, Singapore, pp. 504. KADONO T., TRAN D., ERRAKHI R., HIRAMATSU T., MEIMOUN P., BRIAND J., IWAYA-INOUE M., KAWANO T., BOUTEAU F., 2010 - Increased anion channel activity is an unavoidable event in ozone-induced programmed cell death. - PLoS ONE, 5: e13373. KADONO T., YAMAGUCHI Y., FURUICHI T., HIRONO M., GARREC J.P., KAWANO T., 2006 - Ozone-induced cell death mediated with oxidative and calcium signaling path- ways in tobacco Bel-W3 and Bel-B cell suspension cultures. - Plant Signal. Behav., 1: 312-322. KADOTA Y., GOH T., TOMATSU H., TAMAUCHI R., HI- GASHI K., MUTO S., KUCHITSU K., 2004 - Cryptogein- induced initial events in tobacco BY-2 cells: Pharmaco- logical characterization of molecular relationship among cytosolic Ca2+ transients, anion efflux and production of re- active oxygen species. - Plant Cell Physiol., 45(2): 160-170. KAGENISHI T., YOKAWA K., KADONO T., UEZU K., KAWANO T., 2011 - Copper-binding peptides from human prion protein and newly designed peroxidative biocatalysts. - Z Naturforsch., 66 c: 182-190. KAWANO T., ADACHI M., KURATA H., AZUMA R., SHI- MOKAWA K., 1999 - Calcium-dependent catabolism of phaeophorbide a in tomato fruit. - J. Japan Soc. Hort. Sci., 68: 810-816. KAWANO T., BOUTEAU F., 2013 - Crosstalk between intracel- lular and extracellular salicylic acid signaling events lead- ing to long-distance spread of signals. - Plant Cell Rep., 32: 1125-1138. KAWANO T., FURUICHI T., MUSO S., 2004 - Controlled free salicylic acid levels and corresponding signaling mecha- nisms in plants. - Plant Biotechnol., 21: 319-335. KAWANO T., MUTO S., 2000 - Mechanism of peroxidase ac- tions for salicylic acid-induced generation of active oxygen species and an increase in cytosolic calcium in tobacco sus- pension culture. - J. Exper. Bot., 51: 685-693. 140 KAWANO T., SAHASHI N., TAKAHASHI K., UOZUMI N., MUTO S., 1998 - Salicylic acid induces extracellular super- oxide generation followed by an increase in cytosolic cal- cium ion in tobacco suspension culture: The earliest events in salicylic acid signal transduction. - Plant Cell Physiol., 39: 721-730. KUNIHIRO S., HIRAMATSU T., KAWANO T., 2011 - Involve- ment of salicylic acid signal transduction in aluminum-re- sponsive oxidative burst in Arabidopsis thaliana cell suspen- sion culture. - Plant Signal Behav., 6: 611-616. KUNZ B.A., DANDO P.K., GRICE D.M., MOHR P.G., SCHENK P.M., CAHILL D.M., 2008 - UV-Induced DNA damage promotes resistance to the biotrophic pathogen Hy- aloperonospora parasitica in Arabidopsis. - Plant Physiol., 148: 1021-1031. LIN C., YU Y., KADONO T., IWATA M., UMEMURA K., FURUICHI T., KUSE M., ISOBE M., YAMAMOTO Y., MATSUMOTO H., YOSHIZUKA K., KAWANO T., 2005 - Action of aluminum, novel TPC1-type channel inhibitor, against salicylate-induced and cold shock-induced calcium influx in tobacco BY-2 cells. - Biochem. Biophys. Res. Com- mun., 332: 823-830. LIU J., STEVENS C., KHAN V.A., LU J.Y., WILSON C.L., ADEYEYE O., 1993 - Application of ultraviolet-C light on storage rots and ripening of tomatoes. - J. Food Protect., 56: 868-873. LU J.Y., STEVENS.C., KHAN V.A., KABWE M., WILSON C.L., 2007 - The effect of ultraviolet irradiation on shelf-life and ripening of peaches and apples. - J. Food Qualit., 14: 299-305. MARCO F., CALVO E., CARRASCO P., SANZ M.J., 2008 - Analysis of molecular markers in three different tomato cul- tivars exposed to ozone stress. - Plant Cell Rep., 27: 197-207. MARTI E., GISBERT C., BISHOP G.J., DIXON M.S., GAR- CIA-MARTINEZ J.L., 2006 - Genetic and physiological characterization of tomato cv. Micro-Tom. - J. Exper. Bot., 57: 2037-2047. MEISSNER R., JACOBSON Y., MELAMED S., LEVYATUV S., SHALEV G., ASHRI A., ELKIND Y., LEVY A., 1997 - A new model system for tomato genetics. - Plant J., 12: 1465- 1472. NAWRATH C., HECK S., PARINTHAWONG N., MÉTRAUX J.P., 2002 - EDS5, an essential component of salicylic acid- dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. - Plant Cell, 14: 275-286. ROLDÁN-ARJONA T., ARIZA R.R., 2009 - Repair and toler- ance of oxidative DNA damage in plants. - Mutat. Res., 681: 169-179. STAEHELIN J., HARRIS N.R.P., APPENZELLER C., EBER- HARD J., 2001 - Ozone trends: a review. - Rev. Geophys, 39: 231-290. STEVENS C., KHAN V.A., LU J.Y., WILSON C.L., CHALUTZ E., DROBY S., KABWE M.K., HAUNG Z., ADEYEYE O., PUSEY L.P., TANG A.Y.A., 1999 - Induced resistance of sweetpotato to Fusarium root rot by UV-C hormesis. - Crop Protect., 18: 463-470. STEVENS C., KHAN V.A., LU J.Y., WILSON C.L., PUSEY P.L., KABWE M.K., IGWEGBE E.C.K., CHALUTZ E., DROBY S., 1998 - The germicidal and hormetic effects of UV-C light on reducing brown rot disease and yeast micro- flora of peaches. - Crop Protection, 17: 75-84. STEVENS C., KHAN V.A., TANG A.Y., LU J.Y., 1990 - The effect of ultraviolet radiation on mold rots and nutrients of stored sweet potatoes. - J. Food Protect., 53: 223-226. STEVENS C., WILSON C.L., LU J.Y., KHAN V.A., CHALUTZ E., DROBY S., KABWE M.K., HAUNG Z., ADEYEYE O., PUSEY L.P., WISNIEWSKI M.E., WEST M., 1996 - Plant hormesis induced by ultraviolet light-C for controlling post- harvest diseases of tree fruits. - Crop Protect., 15(2): 129- 134. TRAN D., ROSSI M., BILIGUI B., KAWANO T., MANCUSO S., BOUTEAU F., 2013 - Ozone-induced caspase-like ac- tivities are dependent on early ion channel regulations and ROS generation in Arabidopsis thaliana cells. - Plant Signal Behav., 8: e25170. YOSHIOKA H., BOUTEAU F., KAWANO T., 2008 - Discov- ery of oxidative burst in the field of plant immunity: Looking back at the early pioneering works and towards the future development. - Plant Signal. Behav., 3: 153-155. YUKIHIRO M., HIRAMATSU T., BOUTEAU F., KADONO T., KAWANO T., 2012 - Peroxyacetyl nitrate-induced oxida- tive and calcium signaling events leading to cell death in ozone-sensitive tobacco cell-line. - Plant Signal Behav., 7: 113-120.