Impaginato 53 1. Introduction Calla and Peruvian lily are commonly cultivated in Tuscany (Italy) and they represent one of the main cut flower productions. Calla lily [Zantedeschia aethiopica (L.) Spreng] is known to be susceptible to at least 13 virus species, mainly belonging to Potyviridae, Bunyaviridae, and Tombusviridae (Huang et al., 2007). Peruvian lily (Alstroemeria spp.) has become one of the most popular cut flowers world- wide. It has been reported as the natural host of vari- ous plant viruses, including members of Potyviridae, Betaflexiviridae or Bunyaviridae (Park et al., 2010). In Tuscany, virus surveys were carried out on vari- ous woody plants such as grapevine (Rizzo et al., 2012; 2015 a) but to our knowledge no reports are available for Calla and Peruvian lily in Italy. In order to evaluate the health status of these plants in Tuscan nurseries, various viruses were assayed, belonging to the following families: Betaflexiviridae [Alstroemeria carla virus (AlCV), Lily symptomless virus (LSV)], Bromoviridae [Cucumber mosaic virus (CMV)], Bunyaviridae [Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), Tomato spotted wilt virus (TSWV)], Comoviridae [Arabis mosaic virus (ArMV), Broad bean wilt virus 1 (BBWV-1), Broad bean wilt virus 2 (BBWV-2)], Potyviridae [Alstroemeria mosaic virus (AlMV), Bean yellow mosaic virus (BYMV), Dasheen mosaic virus (DsMV), Konjac mosaic virus (KoMV), Lily mottle virus (LMoV), Turnip mosaic virus (TuMV), Zantedeschia mosaic virus (ZaMV), Zantedeschia mild mosaic virus (ZaMMV)], Tombusviridae [Carnation mottle virus (CarnMV)] and unassigned [Tobacco rattle virus (TRV)]. An additional aim of this survey was to evi- dence new viral records in Italy for these widespread cultivations, due to the intense international exchanges that characterize the commercialization of lily. 2. Materials and Methods Tests were carried out on 90 Z. aethiopica plants and 48 Alstroemeria spp. plants collected from 12 Tuscan nurseries in two years. Plants showed symp- Adv. Hort. Sci., 2016 30(1): 53-56 DOI: 10.13128/ahs-18702 Occurrence of viruses in Calla and Peruvian lily in Tuscan nurseries and evidence of new viral records in Italy A. Luvisi 1,2 (*), D. Rizzo 3, L. Stefani 3, A. Panattoni 2, A. Materazzi 2 1 Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Centro Ecotekne Università del Salento, Via Provinciale Lecce Monteroni, 73100 Lecce, Italy. 2 Dipartimento di Scienze Agrarie, Alimentari e Agro-ambientali, Università di Pisa, Via del Borghetto, 80, 56124 Pisa, Italy. 3 Servizio Fitosanitario Regionale, Regione Toscana, Via Ciliegiole, 99, 51100 Pistoia, Italy. Key words: Alstroemeria, RT-PCR, Zantedeschia. Abstract: In order to evaluate the health status of Calla and Peruvian lily in Tuscan nurseries, 18 viruses belonging to six families and one unassigned virus were assayed. Tests were carried out on 90 Zantedeschia aethiopica plants and 48 Alstroemeria spp. plants collected from 12 Tuscan nurseries in two years, via RT-PCR tests. Z. aethiopica was mainly affected by viruses belonging to the Potyviridae family, with the main infection caused by Dasheen mosaic virus (DsMV) and Zantedeschia mild mosaic virus (ZaMMV). Even if Alstroemeria spp. plants were affected by Potyviridae family virus- es too, higher infection rates were recorded for Betaflexiviridae, where Lily symptomless virus infected more than half of plants. This is the first known report of Lily mottle virus (LMoV) in Alstroemeria spp. and Z. aethiopica or ZaMMV in Alstroemeria spp. in Italy. (*) Corresponding author: andrea.luvisi@unisalento.it Received for publication 24 November 2015 Accepted for publication 22 February 2016 Copyright: © 2016 Author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Adv. Hort. Sci., 2016 30(1): 53-56 54 toms such as foliar chlorosis, yellow spot and stripes. Total RNA was extracted from foliar tissue (2 g) using RNeasy Plant Mini Kit (Qiagen, Netherlands) protocol, modified according to MacKenzie et al. (1997). Tissues (2 g) were ground using a Tissue lyser (Qiagen) adding 5 ml of grinding buffer (4.0 M guani- dine isothiocyanate, 0.2 M sodium acetate pH 5.0, 25 mM EDTA, 2.5% PVP-40 and 2.0% sodium bisulfate) just before use. The homogenate (1 ml) was trans- ferred to a 1.5 ml tube and 100 μl of 20% sarkosyl were added. After 2 min centrifugation, 600 μl were transferred to a QIAshredder spin column (Qiagen) placed in a 2 ml collection tube. The subsequent steps of RNA extraction were according to the manu- facturer’s protocol. The extracted RNA was then retro-transcribed into cDNA using the iScript cDNA Synthesis kit (Biorad, USA). For each sample, 2 µl of cDNA were amplified in a total volume of 20 μl con- taining 1X HotMaster Buffer, 0.5 μg/μl BSA and 1 U of HotMaster Taq DNA Polymerase (Eppendorf, Germany). Primers and RT-PCR parameters were cho- sen following the protocols reported in Table 1. 18S rRNA was used as internal control (Osman and Rowhani, 2006). Finally, 10 μl of the amplification mix was electrophoresed in a 1.5% agarose gel in TAE buffer [40 mM Tris base, 20 mM sodium acetate, 1 mM EDTA pH (8.0)]. The amplified cDNA fragments were visualized on a UV transilluminator. Data were analyzed using Sigma-Plot software (version 11; Systat Software, San Jose, CA). The soft- ware was used to perform analysis of variance (ANOVA). Data expressed in percent were converted to arcsin values. P <0.05 was considered to be signifi- cant. 3. Results The health status of Calla and Peruvian lily as determined by the present survey is reported in Table 2. Z. aethiopica was mainly affected by viruses belonging to the Potyviridae family. More than two plants out of three were infected by DsMV and 50% Table 1 - List of references for primers and RT-PCR conditions Target RT-PCR assay Comoviridae ArMV Faggioli et al., 2005 BBWV-1 Ferrer et al., 2008 BBWV-2 Ferrer et al., 2008 Betaflexiviridae AlCV Spence et al., 2000 LSV Lim et al., 2009 Bromoviridae CMV Faggioli et al., 2005 Bunyaviridae IYSV Kritzman et al., 2000 INSV Liu et al., 2009 TSWV Mumford et al., 1994 Potyviridae AlMV Spence et al., 2000 BYMV Ganesh Selvaraj et al., 2009 DsMV Wen-Chi et al., 2010 KoMV Wen-Chi et al., 2010 LMoV Lim et al., 2009 TuMV Wen-Chi et al., 2010 ZaMV Kwon et al., 2003 ZaMMV Wen-Chi et al., 2010 Tombusviridae CarnMV Cevik et al., 2010 Unassigned TRV Wei et al., 2009 Table 2 - Health status of Calla lily (Zantedeschia aethiopica) and Peruvian lily (Alstroemeria spp.) expressed as percenta- ge of infected plants Target Zantedeschia aethiopica Alstroemeria spp. Comoviridae ArMV - - BBWV-1 - - BBWV-2 - - Betaflexiviridae AlCV - - LSV - 56.3 a Bromoviridae CMV - 12.5 b Bunyaviridae IYSV - - INSV 3.3 c * - TSWV 3.3 c - Potyviridae AlMV - - DsMV 66.7 a 13.5 b KoMV - - LMoV 16.7 b 12.5 b TuMV - - ZaMMV 50.0 a 6.3 c Tombusviridae CarnMV - - Unassigned TRV - - * Values in the same column followed by the same letter do not differ significantly according to Duncan’s multiple range test (P=0.05). Luvisi et al. - Occurrence of viruses in Calla and Peruvian lily in Tuscan nurseries 55 of tested plants were infected by ZaMMV. Lower infection rates were reported for viruses belonging to Bunyaviridae. Even if Alstroemeria spp. plants were affected by Potyviridae viruses too, higher infection rates were recorded for Betaflexiviridae, where LSV infected more than half of plants. Further infections were caused by Bromoviridae viruses. Comoviridae, Tombusviridae or TRV infections were not found in both plants. In Z. aethiopica, mixed infections were set at 40% for DsMV/ZaMMV, 6.7% for DsMV/LMoV/ZaMMV and 3.3% for DsMV/LMoV(data not shown). In Alstroemeria spp., mixed infections were set at 6.3% for LSV/ZaMMV, LSV/LMoV, DsMV/ZaMMV, CMV/LSV or CMV/DsMV/LSV. With regard to Alstroemeria spp., the sequence obtained from a ZaMMV amplicon (GenBank acces- sion no. KF156666 (Table 3) had 99% nucleotide iden- tity with the corresponding fragment of a reference ZaMMV isolate (GenBank accession no. AY626825). Further isolates of LMoV were detected (GenBank accessions no. KF156667, KF156668, KF156669). Each further isolate had 99% nucleotide identity with the corresponding fragment of a reference ZaMMV iso- late. All four isolates are different but had 99% nucleotide identity. The sequence obtained from LMoV amplicon (GenBank accession no. KF156662) (Table 3) had 94% nucleotide identity with the corresponding fragment of a reference LMoV isolate (GenBank accession no. JN703466). The same LMoV amplicon was obtained from a Z. aethiopica sample as well. Further isolates of LMoV were detected in both species with 100% nucleotide identity with KF156662 (GenBank acces- sions no. KF156663, KF156664, KF156665). 4. Conclusions Various viral infections, mainly due to viruses belonging to two families, Betaflexiviridae and Potyviridae, seem to affect Calla and Peruvian lily in Tuscan nurseries. Most detected viruses are fre- quently reported for both plants and mixed infection of virus belonging to Potyviridae are quite common in Z. aethiopica (Huang et al., 2007). However, some evidence is rarer. To our knowledge this is the first report of LMoV in Alstroemeria spp. and Z. aethiopica or ZaMMV in Alstroemeria spp. in Italy, while ZaMMV was recent- ly identified in Taiwan (Huang and Chang, 2005) and in Italy (Rizzo et al., 2015 b). This report puts in evidence how widespread the virus is within these common plants and the need for constant monitoring of the health status for flower production. Even if some of viruses that affect Calla and Peruvian lily may be eradicated by thermothera- py (Panattoni et al., 2013) and heat treatment may help in Bromoviridae control (Luvisi et al., 2015), pre- vention represents the preferred method of virus control. References CEVIK B., BAKIR T., KOCA G., 2010 - First report of Carnation mottle virus in Turkey. - Plant Pathol., 59: 394. FAGGIOLI F., FERRETTI L., ALBANESE G., SCIARRONI R., PASQUINI G., LUMIA V., BARBA M., 2005 - Distribution of olive tree viruses in Italy as revealed by one-step RT- PCR. - J. Plant Pathol., 87: 49-55. Table 3 - Sequence of isolates of Zantedeschia mild mosaic virus and Lily mottle virus isolate detected in Italy Zantedeschia mild mosaic virus isolate 2079 polyprotein gene, partial cds (GenBank: KF156666) TCATTGAGTACCAACCCCAACAGTCCGATCTGTTTAATACTCGCGCGTCACAAACCCAATTCAATAATTGGTATGATGCGATCAAAAATGAG- TATGGGGTTGATGATAGTCAGATGCAGAGAATCATGAATGGCTTCATGGTGTGGTGTCTCGAGAATGGGACATCACCAAACATAAATGGCGTGTGGGT- TATGATGGATGGGGATGAACAAGTAGAATTTCCACTAAAACCAATGGTGGAGAATGCCAAGCCTACGCTGCGTCAAATAATGCACCACTTTTCAGACG- CAGCCGAGGCTTACATTGAACTTAGGAATGCCGCTGCCCCATATATGCCTAGATATGGGTTGCTGCGGAACTTAAGAGACAGAGGTCTAGCACGCTTCG- CATTCGACTTCTATGAAGTCACTTCAAAGACACCAGATCGTGCTAGAGAAGCTGTAGCGCAGATGAAGGCAGCAGCGCTAAACAATGTTTCCACAAG- GATGTTTGGATTGGATGGAAATATTGCAACTGCCACGGAGAACACTGAAAGGCACACTGCTAAGGATGTAAGTCCGAGCATGCACTCGCTACTCGG- GATCTCAGCCTTGCAGTAAAGGAGCTGGAAACAGCCCACAGTTATTGTCTTGCGATAGGGTTTAAATAGCCGTACTATTGTCGTTGCTAGATGTTG- CAGTGTGGGCCTCCCACCTTAAGGTTTATCAGTGTGGCTTTCCACCTAGTTCCTTACATTGCGCATAGTATGTGT Lily mottle virus isolate 2409 coat protein gene, partial cds (GenBank: KF156662.1) TGCTGGGGCCTCTAGCTCCACACAAACGAGTCGCCCAACACGTCCAGAGATTGCCGCGGTCGATGTAGCACCACAACAGAGCTCTGAGGCTA- GAGTGCGTGATCGTGATGTTGATGCTGGCACCGTGGGAACATACCAAATCCCTCGACTGAAAGCACTGGCAACAAAGATTAACGTACCCAAGGT- CAAGGGGCGAACAATAGTGAACACTGGGCACCTTGTGAACTACAACCCAGACCAAACAGATATTTCAAATACAAGGTCAACCCAGAAGCAATTTGA- GACCTGGCATAACGCTGTGAAAGATGAGTATGGTCTCAACGACGAGAGTATGGCTCTCGCAATGAATGGTCTGATGGTTTGGTGCATAGAGAATGG- CACCTCACCAAACATAAATGGCGTGTGGCTCATGATGGACGGAGATCAGCAAGTTGAATTTCCTTTACGTCCTATACTTGAACACGCAAAACC- GACGCTGCGCCAAATTATGGCGCATTTCTCAAACCTCGCTGAAGCTTATATTGAGAAGCAAAATTTGGAGAAACCGTACATGCCTAGGTACGGCCTT- CAGCGAAATCTCACCGATTTCAATCTAGCACGATTTGCTTTTGATTTCTATGA Adv. Hort. Sci., 2016 30(1): 53-56 56 FERRER R., ESCRIU F., LUIS-ARTEAGA M., GUERRI J., MORENO P., RUBIO L., 2008 - New molecular methods for identification of Broad bean wilt virus 1. - Mol. Cell. Probes, 22: 223-227. GANESH SELVARAJ D., POKORNY R., HOLKOVA L., 2009 - Comparative analysis of ELISA, one step RT-PCR and IC- RT-PCR for the detection of bean yellow Mosaic virus in gladiolus. - Commun. Agric. Appl. Biol. Sci., 74: 853- 859. HUANG C.H., CHANG Y.C., 2005 - Identification and molec- ular characterization of Zantedeschia mild mosaic virus, a new calla-lilly-infecting potyvirus. - Arch. Virol., 150: 1221-1230. HUANG C.H., HU W.C., YANG T.C., CHANG Y.C., 2007 - Zantedeschia mild mosaic virus, a new widespread virus in calla lily, detected by ELISA, dot-blot hybridization and IC-RT-PCR. - Plant Pathol., 56: 183-189. KRITZMAN A., BECKELMAN H., ALEXANDROV S., COHEN J., LAMPEL M., ZEIDAN M., RACCAH B., GERA A., 2000 - Lisianthus leaf necrosis: A new disease of Lisianthus caused by Iris yellow spot virus. - Plan Dis., 84: 1185- 1189. KWON S.B., HA J.H., YOON J.Y., RYU K.H., 2003 - Zantedeschia mosaic virus causing leaf mosaic symp- tom in calla lily is a new potyvirus. - Arch. Virol., 147: 2281-2289. LIM H.J., BAE E.H., LEE Y.J., PARK S.H., LEE K.J., KIM S.R., 2009 - Detection of Lily symptomless virus, Lily mottle virus, and Cucumber mosaic virus from Lilium grown in Korea by RT-PCR. - Korean Journal of Microbiology, 45: 251-256. LIU H.Y., SEARS J.L., MOU B., 2009 - Spinach (Spinacia oler- acea) is a new natural host of impatiens necrotic spot virus in California. - Plant Dis., 93: 673. LUVISI A., PANATTONI A., MATERAZZI A., 2015 - Heat treatments for sustainable control of soil viruses. - Agron. Sustain. Dev., 35: 657-666. MACKENZIE D.J., MCLEAN M.A., MUKERJI S., GREEN M., 1997 - Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription- polymerase chain reaction. - Plant Dis., 81: 222-226. MUMFORD R.A., BARKER I., WOOD K.R., 1994 - The detec- tion of tomato spotted wilt virus using the polymerase chain reaction. - J. Virol. Methods, 46: 303-311. OSMAN F., ROWHANI A., 2006 - Application of a spotting sample preparation technique for the detection of pathogens in woody plants by RT-PCR and real-time PCR (TaqMan). - J. Virol. Methods, 133: 130-136. PANATTONI A., LUVISI A., TRIOLO E., 2013 - Elimination of viruses in plants: twenty years of progress. - Span. J Agric. Res., 11: 173-188. PARK T.H., HAN I.S., KIM J.B., 2010 - Review on the devel- opment of virus resistant plants in Alstroemeria. - J. Plant Biotechnol., 37: 370-378. RIZZO D., MATERAZZI A., STEFANI L., FARINA P., VANARELLI S., PANATTONI A., LUVISI A., 2015 a - Distribution of regulated viruses in cv. Sangiovese vineyards in Tuscany. - J. Plant Pathol., 97: 131-135. RIZZO D., PANATTONI A., STEFANI L., PAOLI M., NESI B., LAZZERESCHI S., VANARELLI S., FARINA P., DELLA BARTOLA M., MATERAZZI A., LUVISI A., 2015 b - First report of Zantedeschia mild mosaic virus on Zantedeschia Aethiopica (L) Spreng in Italy. - J. Plant Pathol., 92: 399. RIZZO D., STEFANI L., PAOLI M., TRIOLO E., PANATTONI A., LUVISI A., 2012 - The sustainability of old grapevine mother plants in relation to new mandatory diagnostic tests for virus control. - Adv. Hort. Sci., 26(3-4): 148- 150. SPENCE N.J., MILLS P.R., BARBARA D.J., 2000 - A surbey of viruses of Alstroemeria in the UK and the characteriza- tion of carlaviruses infecting Alstroemeria. - Eur. J. Plant Pathol., 106: 843-847. WEI T., LU G., CLOVER G.R.G., 2009 - A multiplex RT-PCR for the detection of Potato yellow vein virus, Tobacco rattle virus and Tomato infectious chlorosis virus in potato with a plant internal amplification control. - Plant Pathol., 58: 203-209. WEN-CHI H., CHIN-HSING H., SHU-CHUAN L., CHUN-I W., YA-CHUN C., 2010 - Detection of four calla potyviruses by multiplex RT-PCR using nad5 mRNA as an internal control. - Eur. J. Plant Pathol., 126: 43-52.