Impaginato 239 1. Introduction A variety of horticultural products is grown in Afghanistan with the potential to be (re)developed into valuable export commodities and brands. The primary engine of the Afghan economy is its agricul- ture industry, which engages approximately 80% of the working population. Fruit trees, such as peach, plum, apricot or almond and grape are therefore of significant economic importance to the country, with importing or local exchange of plant material for propagation or commercial growing of these fruits likely. The absence of certain viruses is an essential pre-requisite for virus-free certification of plant material in general in many parts of the world (Golino and Savino, 2005; Barba et al., 2015). In Afghanistan, there is a tremendous increase in fruit tree nursery production and regulation of phytosani- tary certification of plant propagation material is therefore of major importance. In 2005 the Ministry of Agriculture, Irrigation and Livestock (MAIL) stated in the agriculture master plan that the rejuvenation of the horticulture sector would be a government priority. Thriving in the 1970s, this sector has become incapable of compet- ing in the international market. Three interconnected problems have been identified for the industry: 1) the existing orchards are run-down and production is Adv. Hort. Sci., 2016 30(4): 239-248 DOI: 10.13128/ahs-20350 The phytosanitary status of the National Collection of fruits and nuts of Afghanistan and the private Mother Stock Nurseries: a virus survey S. Rehman 1, J. Ahmad 1, C. Lanzoni 2, C. Rubies Autonell 2, C. Ratti 2 (*) 1 Plant Biotecnology Laboratory, Seed and Planting Material Certification Directorate, Ministry of Agriculture, Irrigation and Livestock, Kabul, Afghanistan. 2 Dipartimento di Scienze Agrarie, Università di Bologna, Via G. Fanin, 40, 40127 Bologna, Italy. Key words: germplasm, plant pathology, virus disease. Abstract: The horticultural industry is a vital component of the agriculture sector of Afghanistan, the primary engine of the country’s recovering economy which engages approximately 80% of the working population. This sector was thriving in the 1970s, but is today incapable of competing in the international market. To recover and develop the horticulture of the country, the European Community (EC) supports the PHDP (Perennial Horticulture Development Project), to provide true to type/ecotype and healthy planting materials, and the Plant Biotechnology Laboratory, to ensure the health status of local germplasm. This laboratory started screening the health status of the Afghan Germplasm National Collections in order to ensure the multiplication of not only the best-selected varieties or ecotype, but also to avoid production and distribution of virus-infected trees. Inspection for symptoms and sample collection for viral diseases was carried out in all the National Collection fields, including cherry, pear, peach, plum, apricot, almond, apple, grape and citrus plants, located in different areas of the country. Stone fruit plants infected by Apple chlorotic leaf spot virus or Prunus necrotic ringspot virus have been identified in the National Collection experimental farms located in different provinces of Afghanistan. Moreover, many grape plants included in the National Collection located in Herat and Kandahar resulted infected by Grapevine fanleaf virus, but only few imported plants by Grapevine leafroll associated virus 1, Grapevine leafroll associated virus 3 or Grapevine virus A. Finally, in Jalalabad (Nangarhar province) citrus plants showing vein fleck- ing, yellowing and plant decline symptoms were found to be infected by Citrus tristeza virus. Some of the identified viral isolates have been characterized molecularly, amplifying a fragment corresponding to the coat protein gene from a selection of positive samples. The presence of those viruses in different accessions of the national collection is of concern for Afghan horticulture. Implementation of the certification schemes is therefore necessary to quarantine the production and for the employment of virus-free propagating material. (*) Corresponding author: claudio.ratti@unibo.it Received for publication 4 February 2016 Accepted for publication 16 February 2016 Copyright: © 2016 Author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2016 30(4): 239-248 240 dwindling in quantity and quality; 2) nursery owners lack access to quality inputs and services; and 3) the regulatory framework to develop and support a com- petitive horticulture industry is minimal. To support and develop the horticultural industry of the country, a nursery certification system was started in 2006 from the complete collection Afghanistan’s fruit and nut trees crop varieties by the Perennial Horticulture Development Project (PHDP) funded by European Union (EU). One of the main causes for the decrease in production is deleterious pests and diseases, especially plant viruses and virus- like diseases present in Afghanistan. Virus infection in plants is particularly difficult to detect as viral infection may be sectorial or latent, with symptoms masked or even absent under certain conditions. Virus-free certification is currently imple- mented using conventional techniques for virus detection in vegetal material such as biological index- ing, serological or molecular assays. Biological index- ing requires, in many instances, grafting in green- house facilities which is expensive and time consum- ing. Serological assays and molecular techniques, particularly ELISA and RT-PCR, have been tested in several laboratories and shown to be efficient for detection and quantification of virus infection in pome and stone fruits (Gambino and Gribaudo, 2006; Faggioli et al., 2013). In a country such as Afghanistan, the establishment of a laboratory where sensitive, reliable and specific techniques for routine detection of selected viruses of fruit trees can performed is therefore essential for virus-free certification. Many viral diseases can affect fruit trees, resulting in latent or symptomatic infection. According to their effect on the cultivated host, presence of the most important viruses in propagation plant material is regulated at international level. In particular, Plum pox virus (PPV) is the causal agent of Sharka, the most damaging virus disease of stonefruits. Some strains of Apple chlorotic leafspot virus (ACLSV) can also induce serious diseases in stone fruits. Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) are of considerable economic significance in stonefruits as well, while Citrus tristeza virus (CTV) is considered to be the most destructive virus of citrus crops. Apple mosaic virus (ApMV), Apple stem groov- ing virus (ASGV) and Apple stem pitting virus (ASPV) are spread worldwide and able to causes significant losses in mixed infections (Hadidi et al., 2011; Barba et al., 2015). Arabis mosaic virus (ArMV), Grapevine fleck virus (GFkV). Grapevine fanleaf virus (GFLV), Grapevine virus A (GVA) and “grapevine leafroll-associated viruses” (GLRaVs) such as Grapevine leafroll associat- ed virus 1, 2 and 3 (GLRaV-1, GLRaV-2 and GLRaV-3) are of great economic impact in grape and their absence in propagation material is an essential requirement in the certification schemes of most countries (Martelli, 2014). National collection centres were established in six agro-ecological zones in Afghanistan to collect germplasm. After registration and cataloguing, the mother stock nurseries were established from the same planting material to ensure the availability of high quality and healthy planting material to nursery growers and farmers. Theoretical and practical knowledge are essential to develop a complete profile for viral diseases in order to improve the quality of planting material within the national fruit tree germplasm (Rizzo et al., 2012, 2015). We therefore developed an in-depth study regarding the detection and identification of viral pathogens through the use of advance and sen- sitive methodologies and techniques to characterize identified plant viral pathogens and to develop con- trol strategies for the management of diseases. These efforts are aimed at improving the quality of planting material and will ensure access to quality and certified planting material for nursery growers and orchard owners for the establishment of new orchard/motherstock nurseries, as well as for the rehabilitation of existing orchards. Screening agricul- tural products according to the protocols and regula- tions of global plant quarantine will also positively affect the import and export of Afghan agricultural entities. Following the standards of international san- itary and phytosanitary rules and regulations is the only way to compete in the international market. 2. Materials and Methods Plant material Plant material was collected from the National Collection Centres (NCCs) and Mother Stock Nurseries (MSNs) from 2009 to 2015. In total, more than 12,000 samples were collected from different species and tested for different viruses. In particular, almond, apricot, cherry, peach and plum samples were tested for the presence of ACLSV, ApMV, PDV, PNRSV and PPV; apple and pear samples for ACLSV, ApMV, ASGV and ASPV; citrus samples for CTV; and grape samples for ArMV, GVA, GFkV, GFLV, GLRaV-1, GLRaV-2 and GLRaV-3. Rehman et al. - Phytosanitary status of Afghanistan fruits and nuts collection. A virus survay 241 About 32% of the fruit tree samples were collect- ed from the six NCCs located in Kabul (apricot and plum), Balkh (apricot and almond), Kunduz (almond), Herat (grape and plum), Kandahar (grape and pome- granate) and Nangarhar (citrus and pomegranate). Moreover, samples were also collected from MSNs (26%) and from private orchards (nearly 40%) (Fig. 1). Each year stone fruit samples were collected dur- ing the vegetative stage in spring or summer, between March and September, according to the cli- matic conditions of each location. Similarly, apple and pear samples were collected in May, June, July or September; citrus in March, May or November; and grape in dormant stage in January, October or December. The collecting method consisted of sampling leaves (in the case of stone and pome fruits), shoots or canes (grape) or leaves and flowers (citrus) homo- geneously distributed around the canopy of the plant. All collected material was maintained under refrigeration (below 10°C) during transport from the field to the laboratory, then kept at -20°C until analy- ses. Serological and molecular analyses All samples were ground in “Universal” extraction bags (12x15 cm) using the HOMEX 6 homogenizer (Bioreba) then analysed by DAS-ELISA using reagent kits from Bioreba (Reinach, Switzerland) specific for each virus assayed and following the manufacturer’s instructions. Samples that resulted positive by DAS-ELISA test were subsequently analysed by RT-PCR reaction using specific primer pairs (Table 1). Fig. 1 - Location of the six national collection centres and of the 57 mother stock nurseries in Afghanistan. Virus Primers Primers sequences (5’ - 3’) Size of amplif. (bp) Cycling (temp./time)* N° of cycles Reference Denat. Anneal. Exten. ACLSV Sense TTCATGGAAAGACAGGGGCAA 677 94°C/20 s 58°C/20 s 72°C/20 s 35 Menzel et al., 2002 Antisense AAGTCTACAGGCTATTTATTATAAGTCTAA PNRSV MG1 ATGGTTTGCCGAATTTGC 675 94°C/60 s 55°C/45 s 72°C/60 s 35 Glasa et al., 2002 MG2 ACTCTAGATCTCAAGCAGGTC GFLV M3 ATGCTGGATATCGTGACCCTGT 118 94°C/10 s 54°C/10 s 72°C/45 s 35 Gambino and Gribaudo, 2006 M4 GAAGGTATGCCTGCTTCAGTGG CTV CTVF TAATGGACGACGAACAAAGA 655 94°C/40 s 56°C/40 s 72°C/60 s 30 Rehman et al., 2012 CTVR CCAAGCTGCCTGACATTAGT Table 1 - List of primer pairs, size of amplicons, and RT-PCR conditions used to confirm viral infection in all samples resulting positive to the DAS-ELISA test * PCR amplifications were performed at 94°C for 5 min for initial denaturation and 72°C for 5 min for final extension. Adv. Hort. Sci., 2016 30(4): 239-248 242 Total RNAs were extracted from each sample using CTAB RNA extraction method, as previous reported (Ratti et al., 2004). Complementary DNA (cDNA) was synthesized using M-MLV reverse tran- scriptase (Promega, USA) in a final volume of 5.0 µl. RNA (1.0 µl), mixed with M-MLV 5x buffer, 0.5 µl 10 mM dNTPs, 1.0 µl 10nmol/ml specific reverse primer, 0.25 µl of 200 U/µl M-MLV and 2.25 µl of nuclease- free water, then incubated at 4 2°C (or 37°C for ACLSV and PNRSV) for 1 h. For PCR amplification, 5.0 µl of cDNA template, 5.0 µl of 5x Green GoTaq Buffer, 1.5 µl of 25 mM MgCl2, 1.0 µl 10 nmol/ml of specific forward primer, 0.5 µl of 10 mM dNTPs and 0.2 µl of 5 U/µl GoTaq Polymerase (Promega, USA) were mixed in a total volume of 25 µl. The number of cycles and cycling conditions for each primer set are given in Table 1. The amplified PCR products were analysed in 1% agarose gel stained by ethidium-bro- mide and visualized under UV light after elec- trophoresis. 3. Results DAS-ELISA analyses All apple and pear plants analysed (180 samples) resulted free from ACLSV, ApMV, ASGV and ASPV. Symptoms such as yellowing, leaf distortion and puckering were observed in some stone fruit plants during collection of the 5521 samples that were test- ed by DAS-ELISA (Fig. 2). Among them, 23 (0.4%) samples collected from several MSNs in Kabul, Khandahar, Parwan, Herat and Baghlan provinces resulted positive to ACLSV. In particular, there were two plants of European plum (Clone 364/local name Alu BokharaShalili), one cross of Myrobalan and Japanese plum (4031/Grangej Zard), 17 plants of peach (five from 804/Turki Sorkh, five from 812/Dir Ras and seven from 811/TurkiZard), one plant of almond (159/Sattarbai Bakhmali) and two plants of apricot (373/Shakarpara and 4037/Aqa Banu). Two (0.03%) almond samples, both collected from the NCC in Balkh province, resulted infected by ApMV; in was interesting that one of them also tested positive to PNRSV. Analyses against PNRSV evidenced 38 sam- ples (0.6%), collected from NCCs or MSNs located in Balkh, Herat, Kabul, Khandaharand Paktya as infected by the virus (13 almond, five plum, nine peach, and 11 cherry plants). Finally, one plum sample (cv. Alu Bokhara Shalili), from a MSN in Kabul, resulted infect- ed by PDV while none of the stone fruit samples test- ed resulted positive to PPV (Tables 2-6 and Fig. 3). Among the 895 grape samples analysed, one plant from the NCC in Kandahar (cv. Shir Ahmadi Herat) resulted infected by GVA and only one sample of the cv. Pizzutello bianco, imported from Italy and collected in the NCC in Herat, tested positive to GLRaV-1 (it also resulted as infected by GLRaV-3). Moreover, GLRaV-3 was detected in two samples (cv. Pizzutello bianco and Uva Palieri both imported from Italy), collected from the NNC in Herat. Regarding GFLV, all the 62 samples which resulted infected by the virus (6.9%) belong to Afghan cultivars, with the exception of the cv. Regina dei vigneti imported from Italy. All grape samples tested resulted negative to ArMV, GFkV and GLRaV-2 (Table 7) (Fig. 3). In addition, the Plant Biotechnology Laboratory analyzed 5400 citrus plants and 318 of them (5.9%) resulted infected by CTV. In particular, among the positive samples, eight plants, showing vein clearing and flecking, yellowing and plant decline symptoms (Fig. 4), were collected from the NCC in Jalalabad and belong to six different accessions: Kumquat cv. Fig. 2 - Yellowing observed in an apricot accession during sam- ple collection in a National Collection Centre. Rehman et al. - Phytosanitary status of Afghanistan fruits and nuts collection. A virus survay 243 Table 3 - Apricot samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive PPV North 174 0 0 0 205 0 174 0 53 0 82 0 78 0 766 0 Central 2 0 0 0 24 0 136 0 103 0 69 0 42 0 376 0 South 0 0 0 0 0 0 0 0 47 0 0 0 0 0 47 0 PDV North 174 0 0 0 205 0 174 0 53 0 82 0 78 0 766 0 Central 2 0 0 0 24 0 136 0 103 0 69 0 42 0 376 0 South 0 0 0 0 0 0 0 0 47 0 0 0 0 0 47 0 PNRSV North 174 6 (Balkh) 0 0 205 5 (Balkh) 174 0 53 0 82 0 78 0 766 11 Central 2 1 (Herat) 0 0 24 0 136 0 103 0 69 0 42 1 (Herat) 376 2 South 0 0 0 0 0 0 0 0 47 0 0 0 0 0 47 0 ApMV North 174 0 0 0 205 0 174 0 53 0 82 0 78 0 766 0 Central 2 0 0 0 24 0 136 0 103 0 69 0 42 0 376 0 South 0 0 0 0 0 0 0 0 47 0 0 0 0 0 47 0 ACLSV North 0 0 0 0 205 0 174 0 53 0 82 0 78 0 592 0 Central 0 0 0 0 24 0 136 0 103 0 69 0 42 1 (Herat) 374 1 South 0 0 0 0 0 0 0 0 47 0 0 0 0 0 47 0 Total 176 7 0 0 229 5 310 0 203 0 151 0 120 2 1189 14 Table 2 - Almond samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul Northern regions: Badakhshan, Baghlan, Balkh, Faryab, Jowzjan, Kunduz, Samangan, Sar-e Pol and Takhar. Central regions: Badghis, Bamiyan, Farah, Ghor, Herat, Kabul, Kapisa, Kunar, Laghman, Logar, Nangarhar, Nurestan, Panjshir, Parwan and Wardak. Southern regions: Daykundi, Ghazni, Helmand, Kandahar, Khost, Nimruz, Orūzgān, Paktia, Paktika, Zabul. Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive PPV North 0 0 0 0 0 0 68 0 0 0 40 0 80 0 188 0 Central 278 0 833 0 0 0 221 0 141 0 69 0 48 0 1590 0 South 0 0 0 0 0 0 0 0 29 0 0 0 0 0 29 0 PDV North 0 0 0 0 0 0 68 0 0 0 40 0 80 0 188 0 Central 278 0 833 0 0 0 221 0 141 0 69 0 48 0 1590 0 South 0 0 0 0 0 0 0 0 29 0 0 0 0 0 29 0 PNRSV North 0 0 0 0 0 0 68 0 0 0 40 0 80 0 188 0 Central 278 0 833 0 0 0 221 0 141 0 69 0 48 0 1590 0 South 0 0 0 0 0 0 0 0 29 0 0 0 0 0 29 0 ApMV North 0 0 0 0 0 0 68 0 0 0 40 0 80 0 188 0 Central 278 0 833 0 0 0 221 0 141 0 69 0 48 0 1590 0 South 0 0 0 0 0 0 0 0 29 0 0 0 0 0 29 0 ACLSV North 0 0 0 0 0 0 68 0 0 0 40 0 80 2 (Baghlan) 188 2 Central 0 0 0 0 318 0 221 0 141 0 69 0 48 0 797 0 South 0 0 0 0 0 0 0 0 29 0 0 0 0 0 29 0 Total 278 0 833 0 318 0 289 0 170 0 109 0 128 2 2125 2 See legend of Table 2 for provinces included in Northern, Central and Southern regions. Table 4 - Cherry samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul See legend of Table 2 for provinces included in Northern, Central and Southern regions. Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive PPV North 0 0 0 0 0 0 7 0 0 0 0 0 0 0 7 0 Central 0 0 0 0 0 0 1 0 93 0 58 0 35 0 187 0 South 0 0 0 0 0 0 0 0 18 0 0 0 0 0 18 0 PDV North 0 0 0 0 0 0 7 0 0 0 0 0 0 0 7 0 Central 0 0 0 0 0 0 1 0 93 0 58 0 35 0 187 0 South 0 0 0 0 0 0 0 0 18 0 0 0 0 0 18 0 PNRSV North 0 0 0 0 0 0 7 0 0 0 0 0 0 0 7 0 Central 0 0 0 0 0 0 1 0 93 6 (Kabul) 58 1 (Kabul) 35 3 (Herat) 187 10 South 0 0 0 0 0 0 0 0 18 1 (Paktya) 0 0 0 0 18 1 ApMV North 0 0 0 0 0 0 7 0 0 0 0 0 0 0 7 0 Central 0 0 0 0 0 0 1 0 93 0 58 0 35 0 187 0 South 0 0 0 0 0 0 0 0 18 0 0 0 0 0 18 0 ACLSV North 0 0 0 0 0 0 7 0 0 0 0 0 0 0 7 0 Central 0 0 0 0 0 0 1 0 93 0 58 0 35 0 187 0 South 0 0 0 0 0 0 0 0 18 0 0 0 0 0 18 0 Total 0 0 0 0 0 0 8 0 111 7 58 1 35 3 212 11 Adv. Hort. Sci., 2016 30(4): 239-248 244 Table 6 - Plum samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul See legend of Table 2 for provinces included in Northern, Central and Southern regions. Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive PPV North 0 0 0 0 0 0 48 0 31 0 0 0 45 0 124 0 Central 160 0 0 0 190 0 168 0 140 0 31 0 15 0 704 0 South 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PDV North 0 0 0 0 0 0 48 0 31 0 0 0 45 0 124 0 Central 160 0 0 0 190 0 168 0 140 0 31 0 15 0 704 0 South 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 PNRSV North 0 0 0 0 0 0 48 0 31 0 0 0 45 0 124 0 Central 160 5 (Herat) 0 0 190 0 168 0 140 0 31 0 15 0 704 5 South 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 ApMV North 0 0 0 0 0 0 48 0 31 0 0 0 45 0 124 0 Central 160 0 0 0 190 0 168 0 140 0 31 0 15 0 704 0 South 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ACLSV North 0 0 0 0 0 0 48 0 31 0 0 0 45 0 124 0 Central 0 0 0 0 190 0 168 0 140 2 (Kabul) 31 0 15 0 544 2 South 0 0 0 0 0 0 0 0 33 1 (Kandahar) 0 0 0 0 33 1 Total 160 5 0 0 190 0 216 0 204 3 31 0 60 0 861 8 Fig. 3 - Distribution, among Afghan provinces, of samples resulting positive to ACLSV, ApMV, CTV, GFLV, GLRaV-1, GLRaV-3, GVA, PDV or PNRSV. See legend of Table 2 for provinces included in Northern, Central and Southern regions. Table 5 - Peach samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive PPV North 0 0 0 0 0 0 75 0 41 0 9 0 65 0 190 0 Central 4 0 0 0 267 0 374 0 186 0 21 0 13 0 865 0 South 0 0 0 0 0 0 0 0 75 0 0 0 0 0 75 0 PDV North 0 0 0 0 0 0 75 0 41 0 9 0 65 0 190 0 Central 4 0 0 0 267 0 374 0 186 0 21 0 13 0 865 0 South 0 0 0 0 0 0 0 0 75 0 0 0 0 0 75 0 PNRSVNorth 0 0 0 0 0 0 75 0 41 0 9 0 65 0 190 0 Central 4 0 0 0 267 0 374 7 (Herat) 186 1 (Kabul) 21 0 13 0 865 8 South 0 0 0 0 0 0 0 0 75 1 (Kandahar) 0 0 0 0 75 1 ApMV North 0 0 0 0 0 0 75 0 41 0 9 0 65 0 190 0 Central 4 0 0 0 267 0 374 0 186 0 21 0 13 0 865 0 South 0 0 0 0 0 0 0 0 75 0 0 0 0 0 75 0 ACLSV North 0 0 0 0 0 0 75 0 41 0 9 0 65 0 190 0 Central 0 0 0 0 267 0 374 0 186 17 (Kabul) 21 0 13 0 861 17 South 0 0 0 0 0 0 0 0 75 0 0 0 0 0 75 0 Total 4 0 0 0 267 0 449 7 302 19 30 0 78 0 1130 26 Rehman et al. - Phytosanitary status of Afghanistan fruits and nuts collection. A virus survay 245 Margarita (isolates J4 and J8), Orange cv. Mahali (J61), Rough lemon cv. Mahali (J101) and Mandarin Group cvs. Fruter (J76), Tangelo Mapo and Clementine Di Nules. The other 312 plants positive to CTV were collected from private orchards located in the provinces of Kunar, Laghman, and Nangarhar (Table 8, Fig. 3). RT-PCR and molecular characterization Samples from stone fruit plants which resulted infected by ACLSV, or PNRSV following DAS-ELISA technique were analysed also by RT-PCR reaction. The results obtained confirmed the presence of each viral agent assayed in the samples tested. In particular, regarding ACLSV isolates, a 677-long nucleotide fragment, corresponding to partial coat protein gene, was amplified from all ELISA-positive samples by RT-PCR using ACLSV sense and antisense primers (Menzel et al., 2002). Eleven of the identified isolates of ACLSV were then characterized molecular- ly. Sequence analysis revealed similarity ranging from 83.6 to 100.0% within ACLSV isolates detected in Afghanistan. Blast analysis showed that sequences of two peach isolates, 812/Dir Ras, shared the highest nucleotide similarity (95.8 and 96.2%) with the GenBank ACLSV isolates Apr 3 from Jordan (AJ586631). Moreover, the same Afghan isolates showed nucleotide identity between 95.0 and 95.7% with isolates S4, PP23, PP63, and HL2 (JN849008, GU327991, GU328003 and GQ334211, respectively) from China. Sequence analysis of isolate 364/Alu Table 7 - Grape samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive GFLV Herat 0 0 0 0 156 19 117 13 271 22 0 0 0 0 544 54 Kandahar 0 0 0 0 0 0 0 0 268 0 0 0 0 268 0 ArMV Herat 0 0 0 0 156 0 117 0 271 0 0 0 0 0 544 0 Kandahar 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GVA Herat 83 0 0 0 156 0 117 0 271 0 0 0 0 0 627 0 Kandahar 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 GFkV Herat 83 0 0 0 156 0 117 0 271 0 0 0 0 0 627 0 Kandahar 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GLRaV-1 Herat 83 0 0 0 156 0 117 1 271 0 0 0 0 0 627 1 Kandahar 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GLRaV-2 Herat 83 0 0 0 156 0 117 0 271 0 0 0 0 0 627 0 Kandahar 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GLRaV-3 Herat 83 0 0 0 156 0 117 2 271 0 0 0 0 0 627 2 Kandahar 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Total 83 0 0 0 156 19 117 16 539 23 0 0 0 0 895 58 Fig. 4 - Vein clearing and yellowing symptoms observed in citrus accessions collected from the National Collection Centre in Jalalabad (Nangarhar province). Table 8 - Citrus samples tested and resulting positive by DAS-ELISA during the first seven years of activity of the Plant Biotechnology Laboratory based in Kabul. Virus Region 2009 2010 2011 2012 2013 2014 2015 Total Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive Tested Positive CTV Nangarhar 0 0 193 6 263 2 1276 153 1554 110 131 0 492 0 3909 271 Laghman 0 0 0 0 0 0 180 9 200 4 0 0 296 3 676 16 Kunar 0 0 0 0 0 0 318 21 246 9 0 0 249 1 813 31 Total 0 0 193 6 263 2 1774 183 2000 123 131 0 1037 4 5398 318 Adv. Hort. Sci., 2016 30(4): 239-248 246 Bokhara Shalili, 804/Turki Sorkh and 811/Turki Zard proved that they are 99.6 to 100.0% identical with each other and share high (94.3 to 94.7%) nucleotide identity with the Iranian isolate T12Ja (KM586376). Lower nucleotide similarity (86.2%) was shown by one 804/Turki Sorkh isolate with the isolate 274-Chal (FN391009) from Greece. Finally, analysis of the sequence of isolates 804/Turki Sorkh, 811/Turki Zard and 812/Dir Ras revealed a high degree of identity (86.2 to 88.4%) with the corresponding nucleotide sequences of the isolate SK-92-pl (HQ398253) from Slovakia. RT-PCR reaction performed on samples infected by PNRSV, according to DAS-ELISA results, amplified a fragment of 675 nucleotides in length when PNRSV specific primer pair MG1/MG2 was used (Table 1). Regarding grape samples, specific PCR products of 118 nucleotides where also observed on DAS-ELISA positive samples, using specific primers pair M3/M4 against GFLV as reported in Table 1. Some of the citrus samples tested positive by DAS-ELISA were also tested using primers CTVF and CTVR allowing amplification of specific PCR products 655 nucleotides in length (Table 1). Moreover, six CTV isolates collected at the Jalalabad station were characterized. Sequence analysis revealed high simi- larity, ranging from 91.1 to 99.8%, within the CTV iso- lates detected. In accordance with the previously defined phylogenetic groups (Zemzami et al., 2002), nucleotide sequences of Afghan CTV isolates cluster in Group 1 (J4 and J8), Group 4 (J61 and J76) and Group 5 (J101). In particular, J4 and J8 isolates show, respectively, 99.4 and 99.2% identity with reference isolate T36 (M76485) from the USA (Florida). Furthermore, in Group 4, isolate J61 and J76 were more similar to ANO-1 isolate (DQ211658) from Egypt (98.5 and 98.0% identity, respectively) than to isolate 443-4 (AY791844) from Croatia (97.4 and 97.5%, respectively). Finally, isolate J101, in Group 5, shows 95.6% identity with isolates C268-2 (AY750770) and C269-6 (AY750775) from Argentina. 4. Discussion and Conclusions To improve Afghanistan’s agricultural sector, the EC supports the PHDP (Perennial Horticulture Development Project), for true to type/ecotype and healthy planting materials, and the Plant Biotechnology Laboratory, to ensure the health sta- tus of local germplasm. The laboratory started screening the health status of the Afghan Germplasm National Collection in order to ensure the multiplica- tion of not only the best-selected varieties or eco- type, but also to avoid production and distribution of virus-infected fruit trees. Symptom inspection and sample collection for viral diseases was carried out in all the National Collection fields, including peach, plum, apricot, almond, apple, grape and citrus plants, located in different areas of the country. During the first seven years of its activity, the Plant Biotechnology Laboratory based in Kabul, played a key role by satisfying the increasing need for certified propagation plant material to establish new plantations in Afghanistan. Moreover, it contributed to protecting the country from undesirable introduc- tion of pathogens due to increasing exchanges of propagation plant material among different countries and between different continents. Until now, the Plant Biotechnology Laboratory has verified the absence of PPV (the most devastating virus for stone fruit) in the Afghan germplasm and detected and verified the presence of several impor- tant plant viruses in stone fruits, citrus and grapevines. Further activity will be addressed to con- firming, by RT-PCR, infection by ApMV, PDV, GVA, GLRaV-1 and GLRaV-3 in almond, plum and grape accessions which resulted positive by DAS-ELISA, using specific primer pairs (Parakh et al., 1995; Menzel et al., 2002; Goszczynski and Jooste, 2003; Osman et al., 2008). The Plant Biotechnology Laboratory first reported ACLSV occurrence in peach, plum, almond and apri- cot plants in Afghanistan. According to the prelimi- nary results of sequence analysis, due to the relative low identity with other ACLSV isolates present in GenBank, our mother stock nurseries appear to be infected by several Afghan isolates of the virus, but further studies will be addressed to understanding if ACLSV has been introduced into the country through infected propagation material. In any case, the pres- ence of ACLSV in important cultivars of peach and plum is a worrying aspect of the Afghan certification program. Similarly, our results identified, for the first time, PNRSV, ApMV, and PDV infected plants in Afghanistan. Even if the latter two viruses were detected by DAS-ELISA test, the presence of the viruses in accessions of the National Collection field is cause for worry for Afghan horticulture as all three viruses spread through infected propagating material and nursery productions (Mink, 1992). Moreover, PNRSV and PDV are also seed- and pollen-transmit- Rehman et al. - Phytosanitary status of Afghanistan fruits and nuts collection. A virus survay 247 ted and can be spread by pollinating insects (Kelley and Cameron, 1986; Aparicio et al., 1999; Glasa et al., 2002; Amari et al., 2007) while seed transmission of ApMV is known only in hazelnuts (Cameron and Thompson, 1985). A comparative sequence and phy- logenetic analysis will be performed (Zindović et al., 2015) to show if clustering of various isolates is asso- ciated or not with geographic and host origin. Regarding the detection of viruses in grape, according to our results the presence in the NCC in Kandahar of GVA and GLRaV-1, and GLRaV-3 in Herat seems to be restricted to only a few accessions. Early detection of these viruses by the Plant Biotechnology Laboratory avoided multiplication and therefore the spread of infected grape material in Afghanistan. In contrast, the noticeable presence of GFLV (nearly 7%) in local cultivars maintained at the NCC in Herat sug- gests the presence of the virus in Afghan germplasm of grape for some time. This hypothesis should be confirmed by studying the genetic variability of Afghan isolates in order to investigate the relation- ship among their geographical origin, sequence vari- ability, and grapevine cultivar (Meng et al., 2006; Vigne et al., 2009; Terlizzi et al., 2015). Finally, our analyses identified, for the first time, CTV infected plants in Afghanistan (Rehman et al., 2012). The presence of a dangerous viral disease such as CTV in many citrus trees (nearly 6% of the assayed plants) from NCCs, MSNs and private orchards represents a serious problem for the Afghan citrus industry. High sequence identity with many isolates from USA, Egypt, Croatia, and Argentina together with the large spread of the virus in Afghan citrus-cultivating areas suggests the introduction of the virus into the country a long time ago. The presence of this virus seems to be, therefore, endemic; further investiga- tions showed that infected plants did not exhibit quite as dramatic symptoms as those usually found in other citrus cultivation areas (e.g. Spain, Brazil, Argentina etc.) where the virus is extremely danger- ous and causes in some cases plants death (Rocha- Peña et al., 1995). A specific research program is in progress to investigate if a mild strain of CTV is pre- sent in the eastern region (Nangarhar, Kunar, Laghman) environment, if tolerant/resistant sour orange rootstock clones exist, or if the environmental (climate and soil conditions) influences the infectivity of CTV. Due to the economic importance of these crops, implementation of the certification schemes is there- fore necessary in Afghanistan in order to guarantee the production and employment of virus-free propa- gating material. It is well known that data regarding the presence and spread of different plant viruses are important for individual countries, their neighbours, and for the whole agricultural community where different virus- es can be spread by vegetative propagation via plant material. A continuous survey is therefore necessary to protect Afghanistan from the introduction and/or spread of dangerous pests. As previously experi- enced, most effective management programs require prompt removal of infected trees and replacement with healthy planting material from certified nurs- eries (Hadidi et al., 2011; Pallas et al., 2012). Establishment of rigid phytosanitary controls related to the importation of propagation material, as well as the eradication of infected trees, is therefore of great importance in Afghanistan. References AMARI K., BURGOS L., PALLÁS V., SÁNCHEZ-PINA M.A., 2007 - Prunus necrotic ringspot virus early invasion and its effects on apricot pollen grain performance. - Phytopathology, 97: 892-899. APARICIO F., SÁNCHEZ-PINA M.A., SÁNCHEZ-NAVARRO J.A., PALLÁS V., 1999 - Location of Prunus necrotic ringspot ilarvirus within pollen grains of infected nec- tarine trees: evidence from RT-PCR, dot-blot and in situ hybridisation. - Eur. J. Plant Pathol., 105(6): 623-627. BARBA M., ILARDI V., PASQUINI G., 2015 - Control of pome and stone fruit virus diseases. - Adv. Virus Res., 91: 47- 83. CAMERON H.R., THOMPSON M., 1985 - Seed transmission of apple mosaic virus in hazelnut. - Acta Horticulturae, 193: 131-132. FAGGIOLI F., ANACLERIO F., ANGELINI E., ANTONELLI M.G., BERTAZZON N., 2013 - Harmonization and validation of diagnostic protocols for the detection of grapevine viruses covered by phytosanitary rules. - Adv. Hort. Sci., 27(3): 107-108. GAMBINO G., GRIBAUDO I., 2006 - Simultaneous detection of nine grapevine viruses by multiplex RT-PCR with co- amplification of a plant RNA internal control. - Phytopathology, 96: 1223-1229. GLASA M., BETINOVA E., KUDELA O., SUBR Z., 2002 - Biological and molecular characterization of Prunus necrotic ringspot virus isolates and possible approaches to their phylogenetic typing. - Ann. Appl. Biol., 140: 279-283. GOLINO D.A., SAVINO V., 2005 - Certification and interna- tional regulation of planting material, 177-198. - In: WILCOX W.F., W.G. GUBLER, and J.K. UYEMOTO (eds.) Compendium of grape diseases. APS Press, St. Paul, Adv. Hort. Sci., 2016 30(3): 239-248 248 MN, USA, pp. 232. GOSZCZYNSKI D.E., JOOSTE A.E.C., 2003 - Identification of divergent variants of Grapevine virus A. - Eur. J. Plant Pathol., 109(4): 397-403. HADIDI A., BARBA M., CANDRESSE T., JELKMANN W., 2011 - Virus and virus-like diseases of pome and stone fruits. - APS press, St. Paul, MN, USA, pp. 428. KELLEY R.D., CAMERON H.R., 1986 - Location of prune dwarf and prunus necrotic rings spot viruses associated with sweet cherry pollen and seed. - Phytopathology, 76: 317-322. MARTELLI G.P., 2014 - Directory of virus and virus-like dis- eases of the grapevine and their agents. - J. Plant Pathol., 96(1 sup): 1-136. MENG B., REBELO A.R., FISHER H., 2006 - Genetic diversity analyses of grapevine Rupestris stem pitting-associated virus reveal distinct population structures in scion ver- sus rootstock varieties. - J. Gen.Virol., 87: 1725-1733. MENZEL W., JELKMANN W., MAISS E., 2002 - Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. - J. Virol. Methods, 99: 81-92. MINK G.I., 199 - Ilarvirus vectors. - Adv. Dis. Vector Res., 9: 261-281. OSMAN F., LEUTENEGGER C., GOLINO D., ROWHANI A., 2008 - Comparison of low-density arrays, RT-PCR and real-time TaqMan® RT-PCR in detection of grapevine viruses. - J. Virol. Methods, 149(2): 292-299. PALLAS V., APARICIO F., HERRANZ K., AMARI K., SANCHEZ- PINA M.A., MYRTA A., SANCHEZ-NAVARRO 2012 - Ilarviruses of Prunus spp.: A continued concern for fruit trees. - Phytopathology, 102, 1108-1120. PARAKH D.R., SHAMLOUL A.M., HADIDI A., SCOTT S.W., WATERWORTH H.E., HOWELL W.E., MINK G.I., 1995 - Detection of prune dwarf ilarvirus from infected stone fruits using reverse transcription-polymerase chain reaction. - Acta Horticulturae, 386: 421-430. RATTI C., BUDGE G., WARD L., CLOVER G., RUBIES- AUTONELL C., HENRY C., 2004 - Detection and relative quantitation of Soil-borne cereal mosaic virus (SBCMV) and Polymyxa graminis in winter wheat using real- time PCR [TaqMan (R)]. - J. Virol. Methods, 122: 95-103. REHMAN S., AHMAD J., LANZONI C., RUBIES AUTONELL C., RATTI C., 2012 - First report of Citrus tristeza virus in National Germplasm of Citrus in Afghanistan. - Plant Disease, 96(2): 296. RIZZO D., MATERAZZI A., STEFANI L., FARINA P., VANAREL- LI S., PANATTONI A., LUVISI A., 2015 - Distribution of regulated viruses in cv. Sangiovese vineyards in Tuscany. - J. Plant Pathol., 97(2): 131-135. RIZZO D., STEFANI L., PAOLI M., TRIOLO E., PANATTONI A., LUVISI A., 2012 - The sustainability of old grapevine mother plants in relation to new mandatory diagnostic tests for virus control. - Adv. Hort. Sci., 26(3-4): 148- 150. ROCHA-PEÑA M.A., 1995 - Citrus tristeza virus and its aphid vector Toxoptera citricida. - Plant Disease, 79: 437-445. TERLIZZI F., PISI A., FIORE N., ZAMORANO A., CREDI R., RATTI C., 2015 - Molecular characterization of the movement and coat protein genes of Grapevine fanleaf virus isolates from Italy. - J. Gen. Plant Pathol., 81(1): 63-67. VIGNE E., MARMONIER A., KOMAR V., LEMAIRE O., FUCHS M., 2009 - Genetic structure and variability of virus populations in cross protected grapevines superinfect- ed by Grapevine fanleaf virus. - Virus Res., 144: 154- 162. ZEMZAMI M., SOARES C.M., BAILEY A.M., NIBLETT C.L., NOLASCO G., 2002 - Molecular characterization and classification of Moroccan isolates of Citrus tristeza closterovirus. - Proceedings of the 15th Conference of the International Organization of Citrus Virologists, IOCV, Riverside, CA, USA, pp. 8-12. ZINDOVIĆ J., RUBIES AUTONELL C., RATTI C., 2015 - Molecular characterization of the coat protein gene of Prunus necrotic ringspot virus infecting peach in Montenegro. - Eur. J. Plant Pathol., 43: 881-891.