Impaginato 115 1. Introduction Over the last 20 years, low-input and organic agri- culture has increased worldwide to preserve agro- ecosystem functionality (Postma-Blaauw et al., 2010). The main point of such an agriculture is a sys- temic approach to integrate sustainable yield and crop quality together with high-energy efficiency and low environmental impact (Pimentel et al., 2005; Moonen and Bàrberi, 2008). In the framework of this view, the natural roles of microorganisms, such as arbuscular mycorrhizas in improving soil fertility have gained a growing interest for the use of such micror- ganisms as ecosystem engineers and biofertilizers (Fitter et al., 2011). Although arbuscolar mycorrhizal fungi normally infect most species of plants, some plants taxa do not usually form generally recognis- able mycorrhizas. Among them, the family of Brassicaceae have been considered to be nonmicor- rhyzal plants (Lambers and Teste, 2013), probably because their roots released anti-fungal metabolites such as isothiocyanates in the surrounding environ- ment (Tester et al., 1987). Isothiocyanates are pro- duced by hydrolization of glucosinolates that are a group of secondary metabolites present in Brassicaceae (Halkier and Gershenzon, 2006). The endophyte fungus Piriformospora indica (P. indica), a basidiomycete of the order Sebacinales, was isolated from the Indian Thar desert in 1997 (Varma et al., 1999). P. indica has received a great attention over the last few decades due to its ability to promote plant growth, protection and stress toler- ance in colonized plants (Verma et al., 1998; Banhara et al., 2015). P. indica is similar to arbuscular mycor- rhizal fungi, but it is a facultative symbiont and can be easily grown on various synthetic media. Likewise, P. indica has a wide host range, colonizes the host roots, grows inter and intracellularly, and forms pear- shaped chlamydospores within the cortex, improving the growth of many plant species, enhancing nutrient uptake, enabling plants to cope with environmental conditions, and to survive under abiotic stresses. It also confers resistance to toxins, pathogenic microor- ganisms, and increases seed biomass yield (Oelmuller et al., 2009). Among others, P. indica is able to colo- Adv. Hort. Sci., 2017 31(2): 115-119 DOI: 10.13128/ahs-20664 Fungal colonization improved growth and modulated the expression of myrosinases in black cabbage R. Del Carratore 1 (*), A. Podda 2, B.E. Maserti 2 1 Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Area della ricerca CNR, Via Moruzzi, 1, 56124 Pisa, Italy. 2 Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, Area della ricerca CNR, Via Madonna del Piano, 10, 50019 Sesto Fiorentino (FI), Italy. Key words: Brassica oleracea, colonization, Piriformospora indica. Abstract: The role of beneficial microorganisms, such as mycorrhizas, in improving the resistance to environmental stress of colonized plants is well-known. Plants of Brassicaceae family are of large economic importance, especially for the syn- thesis of anticarcinogenic compounds such as glucosinolates and their derivatives isothiocyanates. The endophyte fun- gus Piriformospora indica is able to colonize them and improves their growth and response to environmental stress. However, no information are available on the impact of colonization on glucosinolate metabolism. In this work, coloniza- tion of black cabbage (Brassica oleracea cv. Acephala sabellica) is reported as well as the effects on plant growth and on the expression of myrosinase encoding genes, the isothyocianate producing enzymes. Results indicate that P. indica suc- cessfully colonized black cabbage as validated by the expression of the marker gene Ptef1. Colonized plants showed increase of biomass weights and shoot length respect to the uncolonized plants and a decrease of myrosinase gene expression. This last finding indicates that P. indica might affect the resistance against biotic stress of black cabbage. (*) Corresponding author: rdc@ifc.cnr.it Received for publication 3 May 2017 Accepted for publication 21 June 2017 Copyright: © 2017 Author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2017 31(2): 115-119 116 nize plants of Brassicaceae family (Sherameti et al., 2005) and improves their growth and response to environmental stimuli. P. indica triggered local and systemic root responses in Arabidopsis thaliana (Pedrotti et al., 2013). In Chinese cabbage (Brassica rapa), it has been reported that P. indica colonization confers drought tolerance stimulating antioxidant enzymes, the expression of drought-related genes and the plastid-localized Ca(2+)-sensing receptor (CAS) protein in the leaves (Sun et al., 2010). Black cabbage, (Brassica oleracea cv. acephala sabellia) a variety of kale largely used in Italian cuisine, especial- ly in Tuscany, where has been grown for centuries (Appleman et al., 2008), is generally considered a nonmicorrhyzal plants (Lambers and Teste, 2013). In this work, with purpose to assess whether P. indica colonizes black cabbage and to study the colonization effects on this cultivar, seedlings were inoculated with P. indica; morphological parameters and the expression of myrosinase encoding genes were stud- ied. 2. Materials and Methods Growth conditions of plants and fungus, and estima- tion of plant growth Seeds of Brassica oleracea L. ssp. oleracea convar acephala (DC.) Alef. var. sabellica L. were surface- sterilized with 75% alcohol three times for 10 min, and then placed on a Petri dish containing sterilized water. Plates were incubated at 22°C under continu- ous illumination (for seed germination). After 7 days, seedlings were transferred in Petri dish plates with solid (1.5% agar) complete medium (CM) (Pham et al., 2004). Six seedlings were used per plate. Piriformospora indica growth conditions P. indica cultures, DSM11827, Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany (Lahrmanna et al., 2013) were propagated at 28°C in liquid CM for two days than plated in agar CM (Fig. 1A). The amount of 200 mg of fungal mycelium were used to colonize the seeds. 0.1 ml of CM medium containing fungal mycelium were positioned 1 cm away from each seedling. The same amount of autoclaved mycelium was used as control. Plant growth was monitored day by day. Histograms report biomass weight and shoot length as mean±SD. The statistical significance of dif- ferential findings between samples was determined by ANOVA using NIA software; p<0.05 was consid- ered statistically significant. RNA extraction and genes expression Pitef1 expres- sion Brassica leaves were disrupted by liquid nitrogen and then suspended in the double volume of PBS. Total RNA extraction and cDNA synthesis were per- formed from 50 mg of lised leaves samples, modify- ing the protocol of the Taqman Gene Expression Cells-to-CT TM Kit (Applied Biosystems) as reported in Podda et al. (2014). Two μL of the cDNA were used for sqRT-PCR amplification performed with GoTaq Green Mastermix (Promega, USA). The following standard thermal profile was used for all PCRs: 94°C for 3 min; 35 cycles of 90°C for 30 s, 59°C for 40 s, and 72°C for 40 s; 72°C for 7 min as final extension. PCR products were separated by 1% agarose gel elec- trophoresis and stained with GelRed (Biotium). cDNA fragments were purified from gels and sequenced by BMR-Genomics (Italy). Transcript levels were mea- sured by Scion Image program and normalized with the constitutive reference actin gene (Wang et al., 2016). Three independent biological replicates were used. In order to verify the colonization level, the presence of P. indica Transcription Elongation Factor Pitef (Butehorn et al., 2000) was tested in the P. indi- ca leaves before or after fungal colonization. The following primers have been used: Fig. 1 - P. indica grown in liquid (left panel) or agar medium (right panel) (A); control (- P. indica) or colonized (+ P. indica) black cabbage seedlings grown on 1.5% agar (B); Pitef1 expression in -P.indica (left panel) or + P.indica plants (right panel) (C). Del Carratore et al. - Black cabbage colonization by P. indica 117 3. Results and Discussion P. indica growth and black cabbage colonization In order to evaluate the effects of P. indica colo- nization in black cabbage, the protocol used by Dolatabadi and Goltapeh, (2013) has been optimized for this kale variety. The fungus P. indica was grown in liquid medium (Fig 1 A, left panel) and then trans- ferred on agar complete medium (Fig 1 A, right panel). Then 7 week-old black cabbage seedlings were inoculated with P. indica mycelium in sterilized conditions in tubes. To validate the successfully colo- nization, the expression of Pitef1 was assessed as the gene has been demonstrated to be useful for esti- mating the amount of active mycelium introduced in seedlings (Butehorn et al., 2000). A strong expression of Pitef1 was observed in leaves of colonized seedlings of black cabbage one and three weeks after fungal inoculation whereas no transcript was observed in not-colonized seedlings (Fig. 1C). Evaluation of black cabbage growth parameters The effects of colonization on growth parameters, biomass weights and shoot lengths, were measured in the inoculated plants in the first three weeks of growth. Colonization by P. indica resulted in a rapid enhancement of about 30% of root and shoot bio- mass respect to the not colonized plants, just after one week from the inoculation (Fig. 2 A, B). Results are in agreement with those reported by Dolatabadi and Goltapeh, (2013) who found that P. indica and Sebacina vermifera improved the growth of B. oler- acea and other brassicaceae plants. Satheesan et al., (2012) reported improved growth of Centella asiatica after inoculation by P. indica. Expression of TGG1, TGG2, PEN2 in the leaves An increase of glucosinolates was found within ten days from germination in black cabbage. Glucosinolates are secondary metabolites present in Brassicaceae (Yi et al., 2015). When plants are dam- aged due to insect herbivore attack, glucosinolates are hydrolyzed quickly with myrosinase (β-thiogluco- side glucohydrolase or thioglucosidase) resulting in production of isothiocyanates, thiocyanates, nitriles and others compounds (Bones and Rossiter, 2006; Hopkins et al., 2009). No information are available in the literature on the modulation of glucosinolate by products in the leaves during fungal colonization. Fig. 2 - Influence of P. indica on black cabbage growth parameters during three weeks from the inoculation. Picture of the plants after one week from the inoculation (A); Biomass weight (mg) or shoot length (mm), at 0, 1 and 3 weeks after P. indica colonization (B).Values are the mean of ten independent experiments for each condition (control or inoculated) ±SD. Asterisk means signifi- cant difference at p≤0.05. F 5’ Rew 5’ Pitef1 ATTGCCTGCAAGTTCTCCGA CTTCGTAACCTTGCCACCCT TGG1 TCTTAACGTGTGGGATGGCT CCTCCTTTGTTCACTCCCCT TGG2 AGATGTGCTGGACGAACTCA CGGCGTAACAGGTAGGATCA PEN2 GCATCATCATCCAACAGCGT ACGCCTTGATCAGTTCTCCA Actin AATGGTACCGGAATGGTCAA AGTTGCTCACAACACCATGC Adv. Hort. Sci., 2017 31(2): 115-119 118 Thus, in this work the expression of TGG1 and TGG2, which encode myrosinases hydrolysing aliphatic glu- cosinolates or PEN2, encoding the enzymes hydrolysing indole glucosinolates was evaluated. Intriguingly, a decrease of TGG1, TGG2 and PEN2 expression was observed at three weeks of coloniza- tion (Fig. 3). Similar results have been reported by Witzel et al. (2015) in Arabidopsis thaliana infected by Verticillium longisporum. As the glucosinolate- myrosinase system is relevant for defence against insect-herbivore (Winde and Wittstock, 2011), the decrease of the expression of the genes relative to this pathway, is of particular importance and should be further investigated for extensive periods. Although P. indica colonization improves plant growth and resistance to abiotic stress (Sun et al., 2010), a negative impact on defence response path- way might increase the susceptibility of colonized black cabbage against biotic stress. Acknowledgements This study was supported by funds of the Regione Toscana ‘‘PRAF 2012–2015 MISURA 1.2 e’’ program (call “Agrifood”, project VOLATOSCA)”. References APPLEMAN N., LINDEGREN S., LEAHY K., 2008 - A16: Food and Wine. - Random House, Ten Speed Press, pp. 288. BANHARA A., DING Y., KÜHNER R., ZUCCARO A., PARNISKE M., 2015 - Colonization of root cells and plant growth promotion by Piriformospora indica occurs indepen- dently of plant common symbiosis genes. - Front. Plant Sci., 6. BONES A.M., ROSSITER J.T., 2006 - The enzymic and chemi- cally induced decomposition of glucosinolates. - Phytochemistry, 67: 1053-1067. BUTEHORN B., RHODY D., FRANKEN P., 2000 - Isolation and characterisation of Pitef1 encoding the translation elongation factor EF-1 alpha of the root endophyte Piriformospora indica. - Plant Biol., 2: 687-692. DOLATABADI K.H., GOLTAPEH M.E., 2013 - Effect of inocu- lation with Piriformospora indica and Sebacina ver- mifera on growth of selected Brassicaceae plants under greenhouse conditions. - J. Hortic. Res., 21: 115-124. FITTER A.H., HELGASON T., HODGE A., 2011 - Nutritional exchanges in the arbuscular mycorrhizal symbiosis: implications for sustainable agriculture. - Fungal Biol. Rev., 25: 68-72. HALKIER B.A., GERSHENZON J., 2006 - Biology and Biochemistry of Glucosinolates. - Ann. Rev. Plant Biol., 57: 303-333. HOPKINS R.J., VAN DAM N.M., VAN LOON J.J.A., 2009 - Role of glucosinolates in insect-plant relationships and ultitrophic interactions. - Ann. Rev. Entomol., 548: 57- 83. LAHRMANNA U., DINGA Y., BANHARAB A., RATHC M., HAJIEZAEID M.R., DOHLEMANNA S., VON WIREND N., PARNISKEB M., ZUCCARO A., 2013 - Host-related meta- bolic cues affect colonization strategies of a root endo- phyte. - PNAS, 110: 13965-13970. LAMBERS H., TESTE F.P., 2013 - Interactions between arbuscular mycorrhizal and non-mycorrhizal plants: do non-mycorrhizal species at both extremes of nutrient availability play the same game? - Plant, Cell and Environment, 36: 1911-1915. MOONEN A.C., BàRBERI P., 2008 - Functional biodiversity: an agroecosystem approach. - Agriculture, Ecosystems & Environment, 127(1/2): 7-21. OELMULLER R., SHERAMETI I., TRIPATHI S., VARMA A., 2009 - Pirimorfospora indica, a cultivable root endo- phyte with multiple biotechnological application. - Symbiosis, 49: 1-17. PEDROTTI L., MUELLER M.J., WALLER F., 2013 - Piriformospora indica root colonization triggers local and systemic root responses and inhibits secondary col- onization of distal roots. - PlosOne, 8(7) e69352. PHAM G., KUMARI R., SINGH A., MALLA R., PRASAD R., SACHDEV M., KALDORF M., BUSCOT F., OELMÜLLER R., HAMPP R., SAXENA A.K., REXER K.-H., KOST G., VARMA A., 2004 - Axenic culture of symbiotic fungus Piriformospora indica, pp. 593-613. - In: VARMA A., L. ABBOTT, D. WERNER, and R. HAMPP (eds.) Plant Surface Microbiology. Springer, Berlin, Heidelberg, Germany, pp. 632. PIMENTEL D., HEPPERLY P., HANSON J., DOUDS D., SEIDEL R., 2005 - Environmental, energetic and economic com- parisons of organic and conventional farming systems. - Bioscience, 55: 573-582. PODDA A., SIMILI M., DEL CARRATORE R., MOUHAYA W., MORILLON R., MASERTI B.E., 2014 - Expression profiling Fig. 3 - Influence of P. indica on black cabbage myrosinases. Analysis of TGG1, TGG2 and PEN2 expression in leaves three weeks after colonization by sqRT-PCR. Actin was used as reference gene. Del Carratore et al. - Black cabbage colonization by P. indica 119 of two stress-inducible genes encoding for miraculin- like proteins in citrus plants under insect infestation or salinity stress. - J. Plant Physiol., 171: 45-54. POSTMA-BLAAUW M.B., DE GOEDE R.G., BLOEM J., FABER J.H., BRUSSAARD L., 2010 - Soil biota community struc- ture and abundance under agricultural intensification and extensification. - Ecology, 91: 460-473. SATHEESAN J., NARAYANAN A.K., SAKUNTHALA M., 2012 - Induction of root colonization by Piriformospora indica leads to enhanced asiaticoside production in Centella asiatica. - Mycorrhiza., 22: 195-202. SHERAMETI I., SHAHOLLARI B., VENUS Y., ALTSCHMIED L., VARMA A., OELMULLER R., 2005 - The endophytic fun- gus Piriformospora indica stimulates the expression of nitrate reductase and the starch-degrading enzyme glucan-water dikinase in tobacco and Arabidopsis roots through a homeodomain transcription factor that binds to a conserved motif in their promoters. - J. Biol. Chem., 280: 26241-26247. SUN C., JOHNSON J.M., CAI D., SHERAMETI I., OELMULLER R., LOU B., 2010 - Piriformospora indica confers drought tolerance in Chinese cabbage leaves by stimu- lating antioxidant enzymes, the expression of drought- related genes and the plastid-localized CAS protein. - J. Plant Physiol., 167: 1009-1017. TESTER M., SMITH S.E., SMITH F.A., 1987 - The phenome- non of “nonmycorrhizal plants”. - Can. J. Bot., 65: 419- 431. VARMA A., VERMA S., SUDHA A.G., SAHAY N., BUTEHORN B., FRANKEN P., 1999 - Piriformospora indica, a cul- tivable plant-growth-promoting root endophyte. - Appl. Environ. Microbiol., 65: 2741-2744. VERMA S., VARMA A., REXER K.H., HASSEL A., KOST G., SARABHOY A., BISEN P., BUTEHORN B., FRANKEN P., 1998 - Piriformospora indica, gen. et sp. nov., a new root-colonizing fungus. - Mycologia, 90: 896-903. WANG C., CUI H.M., HUANG T.H., LIU T.K., HOU X.L., LI Y., 2016 - Identification and validation of reference genes for RT-qPCR analysis in non-heading chinese cabbage flowers. - Front Plant Sci., 7: 811. WINDE I., WITTSTOCK U., 2011 - Insect herbivore counter adaptations to the plant glucosinolate-myrosinase sys- tem. - Phytochemistry, 72: 1566-1575. WITZEL K., HANSCHEN F.S., KLOPSCH R., RUPPEL S., SCHREINER M., GROSC R., 2015 - Verticillium longispo- rum infection induces organ-specific glucosinolate degradation in Arabidopsis thaliana. - Front Plant Sci., 6: 508. YI G.E., ROBIN A.H., YANG K., PARK J.I., KANG J.G., YANG T.J., NOU I.S., 2015 - Identification and expression analysis of glucosinolate biosynthetic genes and esti- mation of glucosinolate contents in edible organs of Brassica oleracea subspecies. - Molecules., 20: 13089- 13111.