Impaginato 275 Adv. Hort. Sci., 2017 31(4): 275-280 DOI: 10.13128/ahs-20694 ‘Superior Seedless’ grapevine grafted on three rootstocks grown on calcare- ous soil under diluted brackish water irrigation. II. Expression of antioxidant genes I.M. Qrunfleh 1 (*), S. Abu-Romman 2, T.G. Ammari 3 1 Department of Plant Production and Protection, Faculty of Agricultural Technology, Al-Balqa Applied University, Al-Salt 19117, Jordan. 2 Department of Biotechnology, Faculty of Agricultural Technology, Al- Balqa Applied University, Al-Salt 19117, Jordan. 3 Department of Water Resources and Environmental Management, Faculty of Agricultural Technology, Al-Balqa Applied University, Al-Salt 19117, Jordan. Key words: 41B, P1103, R110, ROS, salinity. Abstract: Grapevine rootstocks that can absorb brackish water and maintain satisfactory growth of the grapevine scion might be a feasible management practice in areas suffering scarce water resources. The objective of this study was to evaluate the expression of antioxidant genes in ‘Superior Seedless’ leaves grafted on R110 (Vitis berlandieri x V. rupestris), 41B (V. berlandieri x V. vinifera) and P1103 (V. berlandieri x V. rupestris) in response to diluted brack- ish water irrigation at three levels: 1.5, 3.0 and 5.0 dS m-1 in addition to the 0.8 dS m-1 control. Results revealed that after salinity exposure for two weeks, the transcript levels of APX, Mn-SOD and MDAR increased in ‘Superior Seedless’ leaves grafted on the different rootstocks. However, their expression levels in response to salinity were noticeably higher in plants grafted on P1103 and R110 compared to 41B. The expression of CAT gene showed obvious enhanced level in plants grafted on P1103 in response to salt exposure. Meanwhile, the expres- sion of CAT gene in ‘Superior Seedless’ scion grafted on 41B or R110 showed almost unchanged level in control and stressed conditions. Down-regulation of CuZn-SOD was recorded in leaves of ‘Superior Seedless’ grafted on P1103. Slight up-regulation of this gene in response to saline condition was recorded when scion was grafted on 41B or R110. The expression of GPX was enhanced in scion grafted on P1103 and 41B. On the other hand, scion grafted on R110 showed decreased expression of GPX in response to salt treatment. Grapevine root- stocks that have V. rupestris and V. berlandieri in their parentage are good can- didates for salinity tolerance. (*) Corresponding author: iqrunf@bau.edu.jo Citation: QRUNFLEH I.M., ABU-ROMMAN S., AMMARI T.G., 2017 - ‘Superior Seedless’ grapevine grafted on three rootstocks grown on calcareous soil under diluted brackish water irrigation. II. Expression of antioxidant genes - Adv. Hort. Sci., 31(4): 275-280 Copyright: © 2017 Qrunfleh I.M., Abu-Romman S., Ammari T.G. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distribuited under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 28 May 2017 Accepted for publication 29 September 2017 AHS Advances in Horticultural Science Adv. Hort. Sci., 2017 31(4): 275-280 276 1. Introduction Grapes (Vitis sp.) are considered as one of the world’s major commercially grown fruit crops. In Jordan, grapes are ranked in second place after olives regarding the total area planted. The total area plant- ed with grapes is 3806 ha (FAO, 2014). More than half of that area is under irrigation and Jordan is now ranked as the world’s second water-poorest country. Irrigation with low quality water during the whole growing season of the crops, even the tolerant ones, does not always produce high yield. Mixing low quali- ty water; such as dam brackish water, with conven- tional quality irrigation water in ratios to keep the salinity of the irrigation water below the threshold of the target crop might be an acceptable management practice and was used by many researchers (Abdel Gawad and Ghaibeh, 2001). Alternating conventional quality water with brackish water is another manage- ment practice. Its application would be easier because it does not need containers for mixing two different sources of irrigation water. The convention- al quality irrigation water can be used during the sen- sitive stages of plant growth and the brackish water during the non-sensitive or less sensitive stages. Considerable yields were obtained using saline irrigation water (4-12 dS m-1) in crops that had been previously defined as moderately sensitive to salt stress (Bustan et al., 2004). Furthermore, in some crops (e.g., tomato) the reduction in the fresh yield was compensated by an increase in fruit dry weight and other quality parameters (Mizrahi et al., 1988). Bustan et al. (2005) reported that the combination of fresh (1.2 dS m-1) and brackish (7 dS m-1) irrigation water increased the yield level of melon to that of fresh water plants whereas it brought about the improvement of fruit quality typical to brackish water plants, thus providing an attractive approach to opti- mize late-summer melon production. Plants subjected to saline environment use differ- ent mechanisms to overcome such abiotic stress. To avoid a disorder of ion homeostasis under saline con- ditions, plant cells have to maintain a low Na+ con- centration and keep a high H+ concentration in the cytosol where enzymes for metabolism are located (Zörb et al., 2005). Usually, plants use different ways to maintain a low cytosolic sodium concentration, including restricting Na+ influx, maintaining active Na+ efflux, and compartmentalizing Na+ into the vacuole, etc. (Rubio et al., 1995). These mechanisms involve a number of Na+/H+ antiporter proteins that are local- ized in plant plasma and vacuolar membranes (Vasekina et al., 2005). They catalyze the exchange of Na+ for H+ across membranes and the energy needed is generated by the H+-adenosine triphosphatase and H+-pyrophosphatase (Niu et al., 1995; Shi and Zhu, 2002). Plants exposed to salt stress showed enhanced formation of reactive oxygen species (ROS) such as superoxide anion, hydrogen peroxide and singlet oxy- gen (Mittler, 2002). The harmful effects of these mol- ecules are referred to as oxidative stress (Halliwell, 2006). Plants have evolved an enzymatic antioxidant system to reduce the ROS levels. This enzymatic sys- tem includes superoxide dismutase, catalase, ascor- bate peroxidase and glutathione peroxidase (Apel and Hirt, 2004). The development of salt-tolerant crops is a practical solution to sustain agricultural productivity. Because of the complexity of the trait, traditional crop-breeding programs aimed at improv- ing tolerance to salinity have limited success. Therefore, understanding the cellular and molecular bases of salinity-tolerance mechanisms is essential for marker-assisted selection and genetic engineering of salt tolerance in economic crops. Understanding the responses of plants to the major environmental stressor salinity is an important topic for the biotech- nological application of functional mechanisms of stress adaptation. Plant engineering strategies for cellular and metabolic reprogramming to increase the efficiency of plant adaptive processes may either focus on (1) conferring stress tolerance by directly re- programming ion transport processes and primary metabolism or (2) by modulating signaling and regu- latory pathways of the adaptive mechanisms. The second approach seems to be more perspective because it is likely that signaling and regulatory fac- tors orchestrate as key signaling components the transcriptional and translational control of group (1) adaptive mechanisms (Diédhiou et al., 2008; Popova et al., 2008). Most knowledge on molecular mechanisms involved in plant salt responses and adaptation has been derived from analyses of the glycophytic mod- els Arabidopsis thaliana and rice. Such knowledge is lacking in Vitis species, therefore detecting expres- sion changes of antioxidant defense genes is the objective of this study. Since the understanding of a plants response to a stress requires an evaluation of stress induced changes in gene expression, the expression of major defense genes (superoxide dis- Qrunfleh et al. - ‘Superior Seedless’ grown under diluted brackish water irrigation. II. Expression of antioxidant genes 277 mutase, ascorbate peroxidase, catalase, glutathione peroxidase, monodehydroascorbate reductase) in ‘Superior Seedless’ grafted on different rootstocks has been examined by RT-PCR. 2. Materials and Methods Plant material Three grape rootstocks were evaluated in this study: R110 (Vitis berlandieri x V. rupestris), 41B (V. berlandieri x V. vinifera) and P1103 (V. berlandieri x V. rupestris). The rootstocks were purchased from Les Pépiniéristes du Comtat, Sarrians, France. After being imported, ‘Superior Seedless’ bud cul- tivar was grafted on the rootstocks in a local nursery; Al-Bushra Nurseries, May, 2013. Grafted plant mate- rials were planted in polyethylene bags filled with peatmoss. The one year old grafted grapevine root- stocks were grown for several months to allow for the formation of a well developed root system before applying treatments. Fertilizers and fungicides were applied as necessary. Soil and water The soil was brought from the southern Jordan Valley. Soil was crushed and sieved through 1 cm sieve and plastic pots (the working volume of the pots was 44 L) were filled with 50 kg each in order to roughly have a bulk density of 1.14 g cm-3. The bulk density is within the typical range of bulk densities of agricultural soils. If bulk density was higher, infiltra- tion would be very slower and hydraulic conductivity would be slower as well. Low hydraulic conductivity would exacerbate the osmotic effect and create anoxic conditions. The pots were placed in a con- trolled greenhouse. Grafted grapevines were trans- planted in February and the growth was unified based on the number of buds and root length. The root system was cut back to 15 cm in length and the vegetative system was cut back to eight buds. The water was brought from Al-Karameh dam located in the Jordan Valley and stored in a galva- nized tank. Three levels of irrigation water salinity; in terms of electrical conductivity (EC), were applied: 1.5, 3.0 and 5.0 dS m-1 in addition to the 0.8 dS m-1 control. These three levels of diluted brackish water were used to find out the salt level that would result in a tolerable “adverse” effect to design alternate irri- gation that would contribute to water saving. These concentrations were selected based upon the thresh- old EC of grapes (i.e. EC<2 dS m-1). The treatments were prepared by mixing the dam water with tap water. A portable conductivity meter (Model Cond 3210, WTW, Germany) was used to measure the EC and to obtain the determined salinity levels. The twelve treatments were arranged in a randomized complete block design with three replicates. The grafted grapevines started to break the dormancy period during spring. Composite fertilizer (20:20:20), urea and ammonium sulphate were also applied to the grapevines and growth was again unified before applying the assigned treatments. Irrigation with the assigned treatments started in May. All pots received the same amount of water whenever irrigation was applied. Each pot received a total amount of irriga- tion water equal to 446 mm. Irrigation was scheduled according to evaporation readings from free water surface (in mm) taken every 48 hours and corrected using proper grapevine crop coefficient of 0.30 (according to Food and Agriculture Organization). DNA and RNA extraction Leaves were sampled starting from February until November, 2014 (every two weeks) and frozen in liq- uid nitrogen for analyzing DNA and RNA using kits (iNtRON, Korea). Total RNA was extracted from frozen leaf samples with the IQeasy™ Plus Plant RNA Extraction Mini Kit (iNtRON Biotechnology, Korea) according to user’s manual. RNA concentration and purity were estimated based on absorbance at 260 and 280 nm. Two microgram of RNA was used to reverse transcribe the first strand cDNA using Power cDNA Synthesis System (iNtRON Biotechnology, Korea) according to the manufacturer’s protocols with oligo (dT)15 as a primer in a reaction volume of 20 µl. The first strand cDNAs generated for all the sam- ples were used for semi-quantitative RT-PCR to moni- tor the transcript levels. The gene-specific primers for RT-PCR were designed based on the basis of the sequences published in GenBank using the software Primer-BLAST (http://www.ncbi.nlm.nih.gov/ tools/primer-blast/index.cgi?LINK_LOC=BlastHome). The EF-1α gene was selected as a reference gene. The primer sequences are listed in Table (1). The PCR reaction was performed using iNtRON i-MAXTM II sys- tem (iNtRON, Korea). The same thermal profile was used for all PCR reactions; PCR was initiated with enzyme activation at 95°C for 2 min followed by 32 cycles of 40s at 95°C, 40s at 56 °C and 1 min at 72°C. Different amplification cycles were tried and the product of the 32 cycles was selected to be present- ed. All RT-PCR products were loaded in ethidium bro- mide-stained 1.5 % (w/v) agarose gel. Adv. Hort. Sci., 2017 31(4): 275-280 278 3. Results and Discussion As an abiotic stress, salinity induces oxidative damage in plant cells through the increased genera- tion of Reactive Oxygen Species (ROS) in different cell compartments (Mittler, 2002). The activation of antioxidant defense system reduces the level of ROS and minimizes the impact of oxidative stress and its associated damage. Plant cells possess antioxidant enzymes which have the ability to detoxify toxic ROS (Apel and Hirt, 2004). Rootstock choice should be taken with careful consideration since the scion is dependent on the rootstock (Creasy and Creasy, 2009). Novel root- stocks are frequently used to confer resistance to environmental adversities in horticultural crops (Albacete et al., 2015). A promising approach to improve salt tolerance of horticultural species is the use of grafting on salt-tolerant rootstocks (Colla et al., 2010; Giuffrida et al., 2014; Simpson et al., 2015; Zrig et al., 2016). Grapevine rootstock selection is a key factor and could be considered an important strategy to mitigate salinity stress. Grape rootstocks do influence the scion cultivar in many growth and physiological aspects (Gu, 2003). However, some contradictions can be found in the literature in terms of the salt tolerance of grapevine rootstocks implying that various factors are involved, which eventually determine grapevine response to salt stress. For example, Southey and Jooste (1991) found that American hybrids performed poorly in response to salinity when used as rootstocks for the cultivar ‘Colombard’. In addition, Cavagnaro et al. (2006) con- cluded that Argentinean cultivars performed better than European cultivars in an in vitro salinity evalua- tion study. Regarding differences in ranking root- stocks, Dardeniz et al. (2006) indicated that 41B was the most salt resistant rootstock, followed by 140Ru and P1103, and the least resistant was 5 BB. On the other hand, Walker et al. (2002) showed that the highest salt resistance was obtained when P1003 was used as a rootstock. To determine whether NaCl-induced stress and rootstock type were able to regulate the expression levels of genes responsible for antioxidant defense response, a semi-quantitative RT-PCR assay was per- formed for the analysis of six major antioxidant enzyme genes (APX, CAT, CuZn-SOD, Mn-SOD, GPX, and MDAR) (Fig. 1). Table 1 - Primer pairs used in gene expression analysis Gene GeneBank ID Primer pairs (5'→3') Amplicon size (bp) Ascorbate peroxidase EU280159 F: GACAATGAAGCACCCAGAGGAG 542 (APX) R: AATGGGCTTCAGCATAGTCAGC CuZn-Superoxide Dismutase AF056622 F: CTGCTCCATCTCGTGTCTTTCT 452 (CuZn-SOD) R: ATCCACAATTGTTGCTTCAGCC Mn-Superoxide Dismutase NP_001268135 F: AGAAAATCGCTAGGGTTAGGGC 538 (Mn-SOD) R: TACCCAGCAATGGAACCAAGTT Catalase AF236127 F: AGGCCCAGTTCTTCTTGAGGAT 860 (CAT) R: AGGCAAGCATCTCATTCTCAGC Glutathione Peroxidase XM_002272900 F: ATGTCGAAGCAAATACAGCAGG 472 (GPX) R: TGAGAGGGGAAGTTGTTGGGTA Monodehydroascorbate reductase NP_001267971 F: TCATGTTTGTGTTGGAAGCGGA 868 (MDAR) R: GGACAGATCAAAGGCACGAGAG Elongation factor 1α XP_002277159 F: ATTGTGGTCATTGGCCATGTTG 566 (EF-1α) R: CCTTCGAAACCAGAGATGGGAA Fig. 1 - Semi-quantitative RT-PCR expression analysis of major antioxidant enzyme genes in ‘Superior Seedless’ grafted on different rootstocks and exposed to salinity for two weeks. The EF-1α gene was used as the internal control for normalization of loading. Qrunfleh et al. - ‘Superior Seedless’ grown under diluted brackish water irrigation. II. Expression of antioxidant genes 279 Plants utilize antioxidant enzymes, such as: super- oxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX), ascorbate peroxidase (APX) and monodehydroascorbate reductase (MDAR), as defense mechanisms against salinity and do have the ability to detoxify toxic ROS (Apel and Hirt, 2004). Their expression has been studied in many crops as previously mentioned in the introduction part. However, such knowledge is lacking in Vitis species, specifically in Vitis berlandieri and rupestris . Meanwhile, their expression is extensively studied in both vinifera rootstocks and cultivars (Carvalho et al., 2015). After salinity exposure for two weeks, the tran- script levels of APX , Mn-SOD and MDAR were increased in leaves of ‘Superior Seedless’ grafted on the different rootstocks. However, their expression levels in response to salinity were noticeably higher in plants grafted on P1103 and R110 compared to 41B. The expression of CAT gene showed obvious enhanced level in plants grafted on P1103 in response to salt exposure. However, the expression of CAT gene in ‘Superior Seedless’ scion grafted on 41B or R110 showed almost unchanged level in con- trol and stressed conditions. Down-regulation of CuZn-SOD was recorded in leaves of ‘Superior Seedless’ grafted on P1103, while, slight up-regulation of this gene in response to saline condition was recorded when scion was grafted on 41B or R110. In response to salinity stress, the expression of GPX was enhanced in scion grafted on P1103 and 41B. On the other hand, scion grafted on R110 showed decreased expression of GPX in response to salt treatment. The expression of these genes was evaluated every two weeks, and only the results after the first two weeks of the stress treatment were presented since no differences in expression were noticed at the other time points between different treatments. This indicates early differential responses to salt stress at the level of antioxidant defense genes. Such responses were previously reported in other plant species (Ellouzi et al., 2014; Ranjit et al., 2016). 4. Conclusions Rootstock choice is critical in determining grapevine performance and productivity under saline conditions. Expression levels of APX, Mn-SOD and MDAR were noticeably higher in plants grafted on P1103 and R110 compared to 41B. The expression of CAT and GPX genes showed obvious enhanced level in plants grafted only on P1103 in response to salt exposure. CuZn-SOD was down-regulated in leaves of ‘Superior Seedless’ grafted on P1103 and up-regulat- ed when scion was grafted on 41B or R110. Rootstocks with enhanced expression levels of antioxidant defense genes, such as superoxide dis- mutase (SOD) and catalase (CAT) can possibly elimi- nate or reduce detrimental effects of ROS. Thus, grapevine rootstocks that possess this defense line are more preferable to be utilized for soils subjected to salinity or grapevines irrigated with diluted brack- ish water. Moreover, additional studies are needed to investigate the salt-stress responses of enzymatic and non-enzymatic antioxidant components in grapevine grafted on contrasting rootstocks. Acknowledgements This research was funded by the Scientific Research Support Fund under the number Agr/2/04/2011. We wish especially to acknowledge the help of Ayah Awad for her technical assistance. References ABDEL GAWAD G., GHAIBEH A., 2001 - Use of low quality water for irrigation in the Middle East. - Proc. Symp. Sustainable Management of Irrigated Land for Salinity and Toxic Elements Control. US Salinity Laboratory Riverside, California, USA. ALBACETE A., ANDÚJAR C., DODD I., GIUFFRIDA F., HICHRI I., LUTTS S., THOMPSON A., ASINS M., 2015 - Rootstock-mediated variation in tomato vegetative growth under drought, salinity and soil impedance stresses. - Acta Horticulturae, 1086: 141-146 APEL K., HIRT H., 2004 - Reactive oxygen species: metabo- lism, oxidative stress, and signal transduction. - Annual Review of Plant Biology, 55: 373-399. BUSTAN A., COHEN S., DE MALACH Y., ZIMMERMANN P., GOLAN R., SAGI M., PASTERNAK D., 2005 - Effects of timing and duration of brackish irrigation water on fruit yield and quality of late summer melons. - Agric. Water Manag., 74(2): 123-134. BUSTAN A., SAGI M., DE MALACH Y., PASTERNAK D., 2004 - Effects of saline irrigation water and heat waves on potato production in an arid environment. - Field Crops Research, 90(2-3): 275-285. CARVALHO L., VIDIGAL P., AMÂNCIO S., 2015 - Oxidative stress homeostasis in grapevine (Vitis vinifera L.). - Frontiers in Environ. Sci., 3(20): 1-15. CAVAGNARO J., PONCE M., GUZMÁN J., CIRRINCIONE M., Adv. Hort. Sci., 2017 31(4): 275-280 280 2006 - Argentinean cultivars of Vitis vinifera grow bet- ter than European ones when cultured in vitro under salinity. - Biocell, 30(1): 1-7. COLLA G., ROUPHAEL Y., LEONARDI C., BIE Z., 2010 - Role of grafting in vegetable crops grown under saline con- ditions. - Sci. Hortic., 127: 147-155. CREASY G., CREASY L., 2009 - Grapes. Crop Production Science in Horticulture. CABI, Cambridge, MA, USA, pp. 312. DARDENIZ A., MÜFTÜOĞLU N., ALTAY H., 2006 - Determination of salt tolerance of some American grape rootstocks. - Bangladesh J. Bot., 35(2): 143-150. DIÉDHIOU C., POPOVA O., DIETZ K., GOLLDACK D., 2008 - The SNF1- type serine-threonine protein kinase SAPK4 regulates stress responsive gene expression in rice. - BMC Plant Biology, 8: 49. ELLOUZI H., HAMED B., HERNÁNDEZ I., CELA J., MÜLLER M., MAGNÉ C., ABDELLY C., MUNNÉ-BOSCH S., 2014 - A comparative study of the early osmotic, ionic, redox and hormonal signaling response in leaves and roots of two halophytes and a glycophyte to salinity. - Planta, 240(6): 1299-1317. FAO, 2014 - Statistical Pocketbook. World food and agricul- ture, 2014. - Food and Agriculture Organization of the United Nations (FAO), Rome, Italy. GIUFFRIDA F., CASSANITI C., LEONARDI C., 2014 - Tomato and eggplant scions influence the effect of rootstock under Na2SO4 salinity. - Acta Agriculturae Scandinavica, Section B - Soil & Plant Science, 64(8): 700-709. GU S., 2003 - Rootstock and mounding effect on growth and cold hardiness of ‘Gewürztraminer’ (Vitis vinifera) and bud dormancy of ‘Lacrosse’ and ‘Chambourcin’ (Vitis spp.). - Ph D. Dissertation, University of Nebraska, Lincoln, USA. HALLIWELL B., 2006 - Reactive oxygen species and antioxi- dant. Redox biology is a fundamental theme of aerobic life. - Plant Physiology, 141: 312-322. MITTLER R., 2002 - Oxidative stress, antioxidants and stress tolerance. - Trends Plant Sci., 7(9): 405-410. MIZRAHI Y., TALEISNIK E., KAGAN-ZUR V., ZOHAR Y., OFFENBACH R., MATAN E., GOLAN R., 1988 - A saline irrigation regime for improving tomato fruit quality without reducing yield. - J. Amer. Soc. Hort. Sci., 113(2): 202-205. NIU X., BRESSAN R., HASEGAWA P., PARDO J., 1995 - Ion homeostasis in NaCl stress environments. - Plant Physiology, 109(3): 735-742. POPOVA O., YANG O., DIETZ K., GOLLDACK D., 2008 - Differential transcript regulation in Arabidopsis thaliana and the halotolerant Lobularia maritima indi- cates genes with potential function in plant salt adap- tation. - Gene, 423(2): 142-148. RANJIT S.L., MANISH P., PENNA S., 2016 - Early osmotic, antioxidant, ionic, and redox responses to salinity in leaves and roots of Indian mustard (Brassica juncea L.). - Protoplasma, 253(1): 101-110. RUBIO F., GASSMANN W., SCHROEDER J., 1995 - Sodium- driven potassium uptake by the plant potassium trans- porter HKT1 and mutations conferring salt tolerance. - Science, 270: 1660-1663. SHI H., ZHU J., 2002 - Regulation of expression of the vac- uolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. - Plant Molecular Biology, 50(3): 543- 550. SIMPSON C.R., NELSON S.D., MELGAR J.C., JIFON J., SCHUS- TER G., VOLDER A., 2015 - Effects of salinity on physio- logical parameters of grafted and ungrafted citrus trees. - Scientia Horticulturae, 197: 483-489. SOUTHEY J., JOOSTE J., 1991 - The effect of grapevine root- stock on the performance of Vitis vinifera L. (cv. Colombard) on a relatively saline soil. - S. Afr. J. Enol. Vitic., 12(1): 32-41. VASEKINA A., YERSHOV P., RESHETOVA O., TIKHONOVA T., LUNIN V., TROFIMOVA M., BABAKOV A., 2005 - Vacuolar Na+/H+ antiporter from barley: identification and response to salt stress. - Biochemistry, 70(1): 100- 107. WALKER R., BLACKMORE D., CLINGELEFFER P., CORRELL R., 2002 - Rootstock effects on salt tolerance of irrigated field grown grapevines (Vitis vinifera L. cv. Sultana). 1. Yield and vigor inter-relationships. - Australian J. Grape and Wine Res., 8: 3-14. ZÖRB C., NOLL A., KARL S., LEIB K., YAN F., SCHUBERT S., 2005 - Molecular characterization of Na+/H+ antiporters (ZmNHX) of maize (Zea mays L.) and their expression under salt stress. - J. Plant Physiol., 162(1): 55-66. ZRIG A., MOHAMED H.B., TOUNEKTI T., KHEMIRA H., SERRA- NO M., VALERO D., VADEL A.M., 2016 - Effect of root- stock on salinity tolerance of sweet almond (cv. Mazzetto). - South African Journal of Botany, 102: 50-59.