Impaginato 403 Adv. Hort. Sci., 2019 33(3): 403-408 DOI: 10.13128/ahs-25648 Barcoding assessment of the Citrus species cultivated in eastern Afghanistan M. Gori 1, S. Pecchioli 1, E. Giordani 1, M.A. Saeedi 2, F.H. Wafa 2,, S. Biricolti 1 (*) 1 Dipartimento di Scienze e Tecnologie Agrarie, Alimentari, Ambientali e Forestali, Sezione Colture Arboree, Università degli Studi di Firenze, Viale delle Idee, 30, 50019 Sesto Fiorentino, Italy. 2 Afghanistan National Horticulture Development Organization (ANHDO), Taimani Street, 9, Kabul, Afghanistan. Keywords: Afghanistan, citrus, psbA-trnH spacer. Abstract: The establishment of a modern fruit culture in developing countries requests an accurate evaluation of the preexisting germplasm and its health status. This to prevent the possibility to introduce new germplasm which can be easily prey of the endemic diseases carried by asymptomatic host plants. Therefore, after the identification of cases of citrus plants affected by Tristeza virus, a survey of the germplasm cultivated in the Nangarhar valley and some nearby regions was run. The survey was focused on the identification of the main Citrus species widely cultivated using barcoding analysis of conserved sequences located in the plastid DNA. The sequences of matK and rbcl genes did not show any discriminatory ability while the analysis of the the non-coding psbA-trnH intergenic spacer (psbA‐trnH) showed a robust single nucleotide polymorphism (sNP) discriminating C. aurantium from C. sinensis in all analysed samples. These non-coding regions have no known function; thus, much of the variation may result from the spread of mutations unconstrained by selection. Because nucleotide variation in the psbA‐trnH spacer region is high, mutational hot spots may be useful to detect species-level variations. According to our study, the afghan citrus germplasm belong to the C. aurantium species which is commonly used in citrus culture as a rootstock. In Afghanistan it is widely culti- vated for fresh consumption, without topworking with selected varieties and this may be the reason why symptoms are often mild and cultivation can be anyhow carried on. 1. Introduction In developing countries, farmers are growing landraces or older improved varieties that are not optimized for today’s climate or produc- tion systems. Therefore, the replacement of the local germplasm tradi- tionally cultivated for long should be carried on by introducing elite vari- eties in order to complying with the rules of a modern cropping system. However, this change rises concerns about the adaptation of the elite (*) Corresponding author: stefano.biricolti@unifi.it Citation: GORI M., PECCHIOLI S., GIORDANI E., SAEEDI M.A., WAFA F.H., BIRICOLTI S., 2019 - Barcoding assessment of the Citrus species cultivated in eastern Afghanistan. - Adv. Hort. Sci., 33(3): 403- 408 Copyright: © 2019 Gori M., Pecchioli S., Giordani E., Saeedi M.A., Wafa F.H., Biricolti S. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 28 June 2019 Accepted for publication 1 August 2019 AHS Advances in Horticultural Science http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2019 33(3): 403-408 404 germplasm to the new conditions which may poses the farmers revenue at risk. The choices to be under- taken are very delicate and consequences may be devastating if not based on preliminary scientific investigations. Nangarhār (Pashto: راهرګنن ; Persian: راهرگنن ), Laghman and Kunar are three of the 34 provinces of Afghanistan, located in the eastern part of the coun- try. The lowlands in those regions benefit from a semi-tropical climate and have the highest propor- tion of high cropping intensity irrigated land in the country. The riverine farms, situated along valley bot- toms of varying widths, produce a range of crops throughout the year. Semitropical crops such as cit- rus, sugar canes and henna are produced around Jalalabad. High potential for fruits production occurs in those regions despite the still ongoing conflict. Promoting commercial orchards, establishment through professional nurseries, farmers investment, extension service with technical input from neighbor- ing countries and research are therefore welcome to develop the potential for fruit production and mar- keting in the Afghan eastern region (Giordani et al., 2014). A screening of the health status of the Afghan germplasm of Citrus was undertaken to ensure multi- plication of not only the best-selected varieties or ecotypes but also to avoid reproduction and distribu- tion of virus-infected fruit tree. In 2012 a first report showed the occurrence of Citrus Tristeza Virus (CTV) in plants sampled in the National Collection Experimental Farm in Jalalabad (Nangarhar Province) (Rehman et al., 2012). A successive investigation showed that CTV was detected in several samples collected in some farms located in the Nangarhar val- ley, a warning that CTV could spread rapidly if sensi- tive citrus cultivars would be introduced in the area. However, citrus cultivation is still thriving in Nangarhar valley despite the widespread presence of CTV. Different possibilities are therefore to be consid- ered: 1) the local germplasm is made up of low reac- tive host species which do not heavily show the symptoms of the disease; 2) mild CTV isolates estab- lished in the area; 3) an unknown source of resis- tance to CTV is occurring in the area. Before intro- ducing new rootstocks resistant to such disease, another survey was conducted in order to identify the main species of Citrus. This is to address the choices to be undertaken for the establishment of a modern cropping system according to the market demand and to prevent the diffusion of quarantine diseases. Usually, identification of the cultivated species relies on the use of phenotypic descriptors (UPOV). Phenotypic descriptors are often subjected to the observer’s opinion and the environment can deeply affect the behavior of the plant, determining errors in the species attribution. A more reliable system to identify species is based on the genetic analysis and particularly on the DNA barcoding procedure which consists in the compari- son of highly conserved sequences located in the ribosomal nuclear (Sun et al., 2015) or plastid DNA (Taberlet et al., 1991; Penjor et al., 2010, 2013). Being highly conserved, such fragments accumulate mutations slowly and it is possible to design universal primers which can be used to distinguish plenty of species. Furthermore, many databases (PubMed, GenBank, OMIM) collect and store millions of sequences, which can be compared by means of spe- cific software (BLAST) with unknown sequences (Zhang et al., 2000). When properly queried a DNA database provides, along with the alignment, a simi- larity index which can be useful for identifying species or even sub-species, depending on the prox- imity of the taxonomic entities. Therefore, due to the restrictions to accessibility to a conflicting area, a barcoding analysis has been carried out in order to identify the species of Citrus which are commonly grown in the eastern area of Afghanistan in order to better address the choices for a modern fruit culture. 2. Materials and Methods Plant material Afghan citrus seeds have been collected in three areas where citrus fruit trees are intensively cultivat- ed (Laghman, Kunar and Nangarhar) in Eastern Afghanistan (Fig. 1). We used seeds because they can Fig. 1 - Map of Afghanistan showing the provinces where citrus production is located and where the survey was carried on. Gori et al. ‐ Barcoding assessment of the afghan Citrus population 405 be easily transported. Furthermore, most Citrus species are characterized by adventitious embryony and seeds originate individuals which are true clones of the mother plant because rarely zygotic embryo survives. Most sequences for DNA barcoding, being located in the plastid or mitochondrial DNA, are inherited only from the maternal line, therefore ger- minating seeds produce plants whose organelle genomes are not affected by the pollen donor plant, but are expected to be exactly the same as the seed donor plant. In each area, some plants were selected and batch of seeds have been collected from single fruit. In Table 1 the origin of the seeds is reported. Each batch was labeled and delivered to the Plant Pathology Department of the University of Bologna. The seeds were germinated in pots and leaf sam- ples were collected. For each seed batch, a single seedling has been selected for DNA barcoding analy- sis. Before starting the present work, Citrus barcod- ing sequences (ITS 1 and 2, matK, rbcl, psbA‐trnH intergenic spacer) were retrieved from GenBank. The dataset was used to compare with the results of sequencing and to assign the analysed samples to a Citrus species. Since the available sequences are few and showed heavy discrepancies, casting doubts about the reliability of the data retrieved online (Bengtsson-Palme et al., 2016), we decided to pro- vide robust references by analyzing accessions whose origin was absolutely certain. Therefore we have sampled sour orange along with other Citrus species from private and public collections (Vivai Oscar Tintori, Orto Botanico “Giardino dei Semplici” of the University of Florence, Istituto Agronomico per l’Oltremare) in order to be compared with the sam- ples coming from Afghanistan (Table 2). PCR amplification and primers Total DNA was extracted from the selected plants following the guidelines of the DNA Invisorb DNA extraction kit producer (Stratec Italy). DNA has been electrophoresed on an agarose gel to validate quality and quantity. Universal primers for PCR amplification, used in the present study have been retrieved in lit- erature (Chen et al., 2010; Luo et al 2010; Penjor et al., 2013; Mahadani and Ghosh, 2014; Uchoi et al., 2016; Wattoo et al., 2016; Bailey et al., 2018; Zhao et Table 1 - List of the samples coming from Afghanistan Table 2 - Citrus species used as control, coming from public and private collections in Tuscany Sample Province District Village Variety AF-1 a Laghman Mehtarlam Chardehi Local AF-2 a Laghman Mehtarlam Chardehi Local AF-5 a Laghman Mehtarlam Chardehi Local AF-7 a Kunar Asadabad Landi Tesha Local AF-8 a Kunar Asadabad Landi Tesha Local AF-9 a Kunar Asadabad Landi Tesha Local AF-11 a Kunar Asadabad Landi Tesha Local AF-18 a Nangarhar Surkhroad Naghrak Local AF-19 a Nangarhar Surkhroad Naghrak Local AF-21 a Nangarhar Surkhroad Sabzabad Local AF-22 a Nangarhar Surkhroad Sabzabad Local AF-limon Nangarhar PHDC-Center Citrus volkamar Sample no. Species or cultivar Province Origin of the accession 1 Citrus sinensis (Washington Navel) Pescia (Italy) Oscar Tintori 2 Citrus sinensis (ovale calabrese) Pescia (Italy) Oscar Tintori 3 Citrus sinensis (Tarocco) Pescia (Italy) Oscar Tintori 4 Citrus aurantium Lucca (Italy) Botanical garden 5 Citrus aurantium Firenze (Italy) IAO 6 Citrus aurantium (Foetifera) Pescia (Italy) Oscar Tintori 7 Citrus aurantium (tipo) Pescia (Italy) Oscar Tintori 8 Citrus aurantium (dolce del Gargano) Pescia (Italy) Oscar Tintori 9 Citrus aurantiifolia (Philippines Red lime) Pescia (Italy) Oscar Tintori 10 Citrus aurantiifolia (Mexico) Pescia (Italy) Oscar Tintori 11 Citrus aurantium Firenze (Italy) Botanical garden 12 Citrus limon Firenze (Italy) Botanical garden 13 Citrus mitis Firenze (Italy) Botanical garden 14 Citrus histrix Firenze (Italy) Botanical garden 15 Citrus decumana Firenze (Italy) Botanical garden 16 Citrus grandis Firenze (Italy) Botanical garden 17 Citrus reticulata Firenze (Italy) Botanical garden 18 Citrus lumia Firenze (Italy) Botanical garden 19 Citrus medica Firenze (Italy) Botanical garden Adv. Hort. Sci., 2019 33(3): 403-408 406 al., 2018) and are designed on the sequence of the internal transcribed sequence 1 (ITS1) and 2 (ITS2) of the nuclear ribosomal DNA, of the maturase K (matK), the RuBisCo large chain unit (rbcl) and of the predominantly non-coding psbA-trnH intergenic spacer (Table 3). PCR analyses were performed with a thermal cycler Primus 96 (PeqLab) in a 25 µl volume containing 25 ng total DNA, 1x Taq buffer, 1,5 mM MgCl2, 1 unit GoTaq (Promega) and 200 nM of each primer. PCR conditions were 95°C for 5 min, then 35 cycles at 95°C for 30 seconds followed by 30 seconds at a temperature ranging from 50 to 60°C depending on the chosen primer pair and an extension cycle at 72°C for 50 sec. A final extension at 72°C for 5 min- utes was carried on. The amplification products were purified with the Qiaquick PCR purification tubes (Qiagen) and then sequenced. Even though the primers for barcoding are called “universal”, the presence of conserved flanking sites complementary to the primers sequence near the variable part and the locus copy number have been shown to account for much of the variability of amplification success. Therefore, the all primers have been tested by PCR, amplifying and sequencing the amplicons using a set of the samples as templates. To perform a phylogenetic analysis we have used the Mega7 software package (Tamura et al., 2013) which compares the sequence calculating a similarity matrix, transforms similarity coefficients into dis- tances and makes a clustering using the Unweighted Pair Group Method with Arithmetic mean (UPGMA) algorithm. The final output is represented by a den- drogram which clusters the samples. 3. Results The primers constructed on the sequence of the internal transcribed sequence 1 (ITS1) and 2 (ITS2) resulted in a faint amplification and were therefore discarded, while primers designed on the sequence of the maturase K (matK) and RuBisCo large chain unit (rbcl) genes were correctly amplified and sequenced. Unfortunately, such sequences did not show any discriminatory ability being completely overlapping for most analysed samples (Mahadani and Ghosh, 2014). On the contrary, the primers of the non-coding psbA-trnH intergenic spacer showed either good amplification (a fragment of about 525 bp) and bidirectional sequencing output either a good discriminatory capacity. We found a robust sin- gle nucleotide polymorphism (sNP) in the psbA‐trnH spacer (Fig. 2) which is capable to discriminating C. aurantium (sour orange) from C. sinensis showing this mutation in all analysed samples independently from the origin area. Despite the limited region of the genome analysed containing, as expected, a low number of mutations, all the samples of C. aurantium, indepen- dently from their origin, clustered together with a reasonable certainty (Fig. 3). The same occurs for the three C. sinensis samples which resulted in a well- Table 3 - Universal primers sequence for barcoding used in this study Name 5’ → 3’ primer sequence References matK f CGTACAGTACTTTTGTGTTTACGAG Jeanson et al., 2011 matK r ACCCAGTCCATCTGGAAATCTTGGTTC Jeanson et al., 2011 Rbcl_F1 ATGTCACCACAAACAGAGACTAAAGC Uchoi et al., 2016 Rbcl_R634 GAAACGGTCCCTCCAACGCAT Jeanson et al., 2011 Rbcl_R724 TCGCATGTCCCTGCAGTAGC Kress et al., 2005 ITS1_5F_746 GGAAGTAAAAGTCGTAACAAGG Cheng et al., 2016 ITS1_4R_746 TCCTCCGCTTATTGATATGC Cheng et al., 2016 ITS2_S2_F497 ATGCGATACTTGGTGTGAAT Chen et al., 2010 ITS2_S3R_497 GACGCTTCTCCAGACTACAAT Chen et al., 2010 psbA‐trnH_Fw CGCGCATGGTGGATTCACAATCC Zhao et al., 2018 psbA‐trnH_Rev GTTATGCATGAACGTAATGCTC Zhao et al., 2018 matK1F ACCGTATCGCACTATGTATC Penjor et al., 2013 matK1R GAACTAGTCGGATGGAGTAG Penjor et al., 2013 matK2F ACGGTTCTTTCTCCACGAGT Penjor et al., 2013 matK3F GGTCCGATTTCTCTGATTCT Penjor et al., 2013 matK2R AGAATCAGAGAAATCGGACC Penjor et al., 2013 matK3R ACTCGTGGAGAAAGAACCGT Penjor et al., 2013 Gori et al. ‐ Barcoding assessment of the afghan Citrus population 407 separated group while the sample C. limon need to be better characterized with additional sequence analysis (Penjor et al., 2010, 2013). 4. Discussion and Conclusions The barcoding analysis of the afghan germplasm and Citrus species has been carried out with a set of primers targeting nuclear ribosomal DNA or chloro- plast genes (ITS1 and 2, matK, rbcl and psbA-trnH). Apart from ITS 1 and 2, all the primers enabled ampli- fication and sequencing of all the samples. Most of the Citrus species were correctly identified even if the comparison of the analysed DNA fragments with the data available in the databases showed several discrepancies. This observation suggested to intro- duce samples of certain origin in barcoding analysis in order to avoid biases due to errors occurring in the sequences uploaded on the database. According to the results of our analysis, we can state with reason- able certainty that all the afghan Citrus samples are sour orange, which is commonly used as a rootstock. The wide diffusion of sour orange in those regions of Afghanistan is due to the fact that its fruits are consumed fresh (http://anhdo.org.af/wp- content/uploads/2017/06/Citrus-Market-Trend.pdf). The plants are not topworked, as usual, with selected C. sinensis varieties. Grafting would have shown heavily the symptoms of Tristeza disease, while this does not occur in ungrafted C. aurantium (Gómez- Muñoz et al., 2017). In conclusion, stepwise replace- ment of the orange germplasm in Afghanistan with CTV resistant rootstocks is advisable before grafting with selected orange varieties to prevent CTV spread- ing. However, the replacement of sour orange, a rootstock characterized by highly desirable agronom- ic features, with CTV resistant rootstocks should be carried out after devising the whole production chain, starting from the adoption of proper cropping Fig. 2 - Two haplotypes of C. aurantium and C. sinensis originated by a single nucleotide polymorphism getting from the sequencing of psbA‐trnH intergenic spacer (psbA‐trnH). Fig. 3 - UPGMA dendrogram representing the genetic distances among the analysed samples. http://anhdo.org.af/wp-content/uploads/2017/06/Citrus-Market-Trend.pdf http://anhdo.org.af/wp-content/uploads/2017/06/Citrus-Market-Trend.pdf 408 Adv. Hort. Sci., 2019 33(3): 403-408 system (irrigation, fertilization, soil management, etc.) in order to prevent that other endemic diseases can affect the newly introduced germplasm. References BAILEY J.B., LAMB M., WALKER M., WEED C., CRAVEN K.S., 2018 - Detection of potential fungal pathogens Fusarium falciforme and F. keratoplasticum in unhatched loggerhead turtle eggs using a molecular approach. ‐ Endang. Species Res., 36: 111-119. BENGTSSON-PALME J., BOULUND F., EDSTRÖM R., FEIZI A., JOHNNING A., JONSSON V.A., KARLSSON F.H., PAL C., BUONGERMINO PEREIRA M., REHAMMAR A., SANCHEZ J., SANLI K., THORELL K., 2016 - Strategies to improve usability and preserve accuracy in biological sequence databases. - Proteomics, 16(18): 2454-2460. CHEN S., YAO H., HAN J., LIU C., SONG J., SHI L., ZHU Y., 2010 - Validation of the ITS2 region as a novel DNA bar‐ code for identifying medicinal plant species. - PLoS One, 5 (1) e8613: 1-8. CHENG T., XU C., LEI L., LI C., ZHANG Y., ZHOU S., 2016 - Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity. - Mol. Ecol. Resour, 16: 138-149. GIORDANI E., CULLEN G., DEGL’INNOCENTI P., MASINI G., 2014 - Local fruits and nuts as a tool for the develop‐ ment of Afghanistan. - JUNCO, 1: 627-635. GÓMEZ-MUÑOZ N., VELÁZQUEZ K.V., MARÍA C., RUIZ-RUIZ S., PINA J.A., FLORES R., MORENO P., GUERRI J., 2017 - The resistance of sour orange to Citrus tristeza virus is mediated by both the salicylic acid and RNA silencing defence pathways. ‐ Mol. Plant Pathol., 18(9): 1253- 1266. JEANSON M.L., LABAT J.N., LITTLE D.P., 2011 - DNA barcod‐ ing: a new tool for palm taxonomists? - Ann. Bot., 108: 1445-1451. KRESS W.J., WURDACK K.J., ZIMMER E.A., WEIGT L.A., JANZEN D.H., 2005 - Use of DNA barcodes to identify flowering plants. ‐ Proceedings of the National Academy of Sciences (PNAS), 102 (23): 8369-8374. LUO K., CHEN S.L., CHEN K.L., SONG J.Y., YAO H., MA X.Y., ZHU Y.J., PANG X.H., YU H., LI X.W., LIU Z., 2010 - Assessment of candidate plant DNA barcodes using the Rutaceae family. - Sci. China Life Sci., 53(6): 701-708. MAHADANI P., GOSH S.H., 2014 - Utility of indels for species‐level identification of a biologically complex plant group: a study with intergeneric spacer in Citrus. - Mol. Biol. Rep., 41: 7217-7222. PENJOR T., ANAI T., NAGANO Y., MATSUMOTO R., YAMAMOTO M., 2010 - Phylogenetic relationships of Citrus and its relatives based on rbcL gene sequences. - Tree Genet. Genomes, 6: 931-939. PENJOR T., YAMAMOTO M., UEHARA M., IDE M., MAT- SUMOTO N., MATSUMOTO R., NAGANO Y., 2013 - Phylogenetic relationships of Citrus and its relatives based on matK gene sequences. - PloS One, 8(4) e62574: 1-13. REHMAN S., AHMAD J., LANZONI C., RUBIES AUTONELL C., RATTI C., 2012 - First report of Citrus tristeza virus in national germplasm of citrus in Afghanistan. ‐ Plant Disease, 96(2): 296. SUN Y.L., KANG H.M., HAN S.H., PARK Y.C., HONG S.K., 2015 - Taxonomy and phylogeny of the genus Citrus based on the nuclear ribosomal DNA ITS region sequence. - Pak. J. Bot., 47(1): 95-101. TABERLET P., GIELLY L., PAUTOU G., BOUVET G., 1991 - Universal primers for amplification of 3 noncoding regions of chloroplast DNA. - Plant Mol. Biol., 17(5): 1105-1109. TAMURA K., STECHER G., PETERSON D., FILIPSKI A., KUMAR S., 2013 - MEGA6: Molecular evolutionary genetics analysis version 6.0. - Mol Biol Evol., 30(12): 2725-2729. UCHOI A., MALIK S.K., CHOUDHARY R., KUMAR S., ROHINI M.R., PAL D., ERCISLI S., CHAUDHURY R., 2016 - Inferring phylogenetic relationships of Indian Citron (Citrus medica L.) based on rbcL and matK sequences of chloroplast DNA. - Biochem. Genet., 54: 249-269. WATTOO J.I., SALEEM M.Z., SHAHZAD M.S., ARIF A., HAMEED A., SALEEM M.A., 2016 - DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species. ‐ Adv. Life Sci., 4(1): 3-7. ZHANG Z., SCHWARTZ S., WAGNER L., MILLER W., 2000 - A greedy algorithm for aligning DNA sequences. - J. Comput. Biol., 7(1-2): 203-214. ZHAO L.L., FENG S.J., TIAN J.Y., WEI A.Z., YANG T.X., 2018 - Internal transcribed spacer 2 (ITS2) barcodes: A useful tool for identifying Chinese Zanthoxylum. - Appl. Plant Sci., 6(6) e1157: 1-8.