Impaginato 397 Evaluation of hot pepper (Capsicum spp.) genotypes for resistance to viruses and aphids in Rwanda B.W. Waweru 1, 2 (*), D.C. Kilalo 1 , J.W. Kimenju 1, P. Rukundo 2, D.W. Miano 1 1 Department of Plant Science and Crop Protection, College of Agriculture and Veterinary Sciences, University of Nairobi, P.O. Box 29053‐0625 Kangemi, Nairobi, Kenya. 2 Rwanda Agriculture and Animal Resources Development Board, P.O. Box 5016, Kigali, Rwanda. Key words: aphids, Capsicum spp., field, genotypes, resistance, screenhouse, virus. Abstract: Hot pepper is an important crop in Rwanda but viral diseases and pests are major constraints to its production. Field experiments were conduct­ ed to evaluate the resistance of 18 hot pepper genotypes (4 commercials, 5 introduced and 9 local) to natural infection by viruses and aphid infestation, in two agro­ecological zones of Rwanda. Fourteen genotypes were further evalu­ ated for resistance to Cucumber mosaic virus (CMV) under screenhouse condi­ tions. Disease incidence and severity were recorded in all experiments while population of aphids was assessed in the field. Diseased leaf samples from each genotype in the field were analysed using polymerase chain reaction to detect the presence of viruses, while samples from the screenhouse were analysed using serological assay. Results showed significant (p<0.05) differences in dis­ ease incidence and severity among genotypes. Three genotypes namely PBC 462, 00767PPR and 0802PPR were rated as resistant to viral diseases while genotype HP 0117, PP9852­170 and PP9950­5197 were moderately resistant. All commercial and most of the local genotypes were susceptible compared to the introduced lines. There was no difference in genotype infestation by the aphids. The genotypes that are resistant to viruses are recommended for use by growers and in breeding programs. 1. Introduction Hot pepper (Capsicum spp.) is an important vegetable crop grown throughout the world. In Rwanda, it is produced for both local consump­ tion and export to the European market (NAEB, 2015). The crop plays an important role in poverty alleviation through income generation and cre­ ation of employment to both farmers and the hot pepper value chain actors. Hot pepper production has increased in recent years in Rwanda but, the average yield is still low at around 6.8 t ha­1 which is lower than (*) Corresponding author: bancywaweru@yahoo.com Citation: WAWERU B.W., KILALO D.C., KIMENJU J.W., RUKUNDO P., MIANO D.W., 2020 ­ Evaluation of hot pepper (Capsicum spp.) genotypes for resi‐ stance to viruses and aphids in Rwanda. ­ Adv. Hort. Sci., 34(4): 397­412 Copyright: © 2020 Waweru B.W., Kilalo D.C., Kimenju J.W., Rukundo P., Miano D.W. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 15 February 2020 Accepted for publication 19 June 2020 AHS Advances in Horticultural Science Adv. Hort. Sci., 2020 34(4): 397­412 DOI: 10.13128/ahsc­8094 http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2020 34(4): 397­412 398 50% of the country’s potential yield of 15 t ha­1 (RDB, 2010; FAO, 2017). The low and poor quality produce have been attributed to abiotic and biotic factors, of which diseases caused by viruses play a significant role (Skelton et al., 2018). Pepper is attacked by more than 68 viruses global­ ly, of which about 15 have been identified in Africa (Njukeng et al., 2013; Aliyu, 2014; Kenyon et al., 2014). Cucumber mosaic virus (CMV), Pepper veinal mottle virus (PVMV), Tobacco mosaic virus (TMV) and Potato virus Y (PVY) have been reported as the most prevalent in Sub­Saharan Africa (Dafalla, 2001). In Rwanda, Pepper vein yellows virus (PeVYV), PVMV and CMV have been detected in hot pepper (Skelton et al., 2018). The CMV is ranked among the most eco­ nomically important viruses of hot pepper not only in Rwanda but also in some other countries such as India where yield losses ranging from 10 to 50% are documented (Rahman et al., 2016). On the other hand, the crop is attacked by more than 21 insects which include aphids, whiteflies, thrips among others (Niranjanadevi et al., 2018). Aphids, whiteflies, and thrips are vectors of various viruses infecting hot pepper. These insect pests especially the aphids, are serious threat to hot pepper production not only due to losses caused through direct damage but also they are vectors of devastating viruses (Kenyon et al., 2014). Various management options have been pro­ posed to reduce virus diseases of hot pepper in the field. These measures include the use of virus­free planting materials, resistant varieties, borders crops, pesticides and roguing (Wang et al., 2006; Degri and Ayuba, 2016). Farmers in Rwanda mainly rely on insecticides to control insect­vectors. Unfortunately, the insecticides do not achieve 100% control of the vectors. Hence, the insect­vectors develop resistance against the active ingredient after repeated applica­ tion of the insecticides within a short time and more so the insecticides negatively affect the environment (Kenyon et al., 2014). The use of resistant cultivars offers the most economical, effective and durable solution in mitigating the negative effects due to dis­ eases and aphids in hot pepper production (Visalakshi and Pandiyan, 2018). Resistant varieties are highly preferred because they not only reduce the pest population and the virus inoculum in the farming system but they are also compliant with other methods (Frantz et al., 2004). Several studies have evaluated the resistance of wild and cultivated hot pepper genotypes to virus infection and aphids’ infestation leading to the release of virus­resistant lines in different parts of the world (Frantz et al., 2004; Appiah et al. , 2014; Choi et al. , 2018). However, information on hot pepper genotypes that are resistant to virus infection and vector infestation is not documented in Rwanda. The current study focused on local, commercial and introduced geno­ types that have not been evaluated before for the resistance to viruses or aphids in Rwanda. It is important to assess the genotypes in different environments in the field to identify the relative host resistance, as some genotypes found resistance at one location turns out to be susceptible to another place. Screenhouse assessment using artificial inocu­ lation techniques is important for validation of resis­ tance. In this study, both field and screenhouse experiments were conducted to (1) evaluate the reac­ tion of different hot pepper genotypes (local, com­ mercial and introduced) to natural virus infections and aphids’ infestations in two agro­ecological zones of Rwanda, and (2) evaluate the reaction of selected hot pepper genotypes to infection by Cucumber mosaic virus under screenhouse conditions. 2. Materials and Methods Reaction of hot pepper genotypes to virus infection and aphid infestation under field conditions Source of seeds A total of 18 hot pepper genotypes that included nine local collections obtained from Rwanda National Genbank, five introduced lines provided by World Vegetable Center, Eastern and Southern Africa­ Tanzania and four commercial varieties from seed companies were evaluated (Table 1). Previous studies indicate that the introduced genotype PP9950­5197 is resistant to CMV, PVY and Chilli veinal mottle virus while genotype ICPN 18­7 is resistant to PVY (Gniffke et al., 2013). Similar studies by Reddy et al. (2014) showed the introduced genotype PP9852­170 as resistant against CMV. California wonder (sweet pep­ per) variety which has been used as a susceptible control for viruses in previous studies (Murphy and Bowen, 2006) was also included in the present study. Study areas The study was conducted at Rubona and Gashora research fields belonging to the Rwanda Agriculture and Animal Resources Development Board (RAB) dur­ ing two successive growing seasons; long rains (end Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 399 March­July, 2018) and short rains (end October, 18­ March, 2019). Rubona station is located at an alti­ tude of 1692.9m, latitude S 2°28ʹ59.59ʺ and longi­ tude E29°46ʹ22.46ʺ, in midland AEZ. Gashora is located at an altitude of 1331.1m, latitude S 2°15ʹ22.11ʺ and longitude E30°17ʹ12.43ʺ, in lowland AEZ. The characteristics of the two AEZs are shown (Table 2). Raising of the seedlings Seeds of the different genotypes were sown and raised in trays containing sterilized sandy loam soil (1:2) in the screenhouse. At 2­3 leaf stage, the seedlings were transplanted into plastic potting bags (5 × 9 × 4 cm) containing steam­sterilized sandy loam soil and maintained for six weeks in the screenhouse. Before transplanting to the field, the seedlings were confirmed to be free from Pepper mild mottle virus (PMMoV), PVMV, TMV, PVY and CMV using DAS­ ELISA. The kits were obtained from Loewe Biochemica GmbH company, Germany) and used according to instructions from the manufacturer. Establishment of the field experiments The experiments were carried out in the open field and depended on natural virus infections and aphid infestation from the uncultivated fields. The experiments were laid out in a randomized complete block design (RCBD) with three replications. The blocking was done according to soil fertility gradient and nearness to the uncultivated land, such that each treatment had an equal chance of vector infestation. Each replicate had eighteen experimental plots, mea­ suring 2.5 m by 3 m each, with a 1 m wide path between the plots. An experimental plot contained 24 seedlings planted on 4 rows, at a spacing of 60 cm by 45 cm. At planting, approximately 500 g of organic manure was used per plant and 15 g of NPK (17:17:17) fertilizer was applied one week later. A month after transplanting, 3.5 g of urea (46:0:0) per Table 1 ­ List of genotypes evaluated for reaction to infection by viral diseases and aphids under field conditions in Rwanda 1 Code of the local genotypes as found in the database of Rwanda National GenBank; 2 Unknown species; RNGB= Rwanda National GenBank; WVC= World Vegetable Center. Genotype Species Type Source 00765PPR 1 C. annum Local RNGB 00767PPR C. baccatum Local RNGB 00774PPR C. annum Local RNGB 00775PPR C. chinense Local RNGB 00786PPR C. annum Local RNGB 00791PPR C. chinense Local RNGB 00792PPR C. frutescens Local RNGB 00802PPR ‐ 2 Local RNGB 00795PPR C. chinense Local RNGB PBC 462 C. annum Introduced WVC PP9950­5197 C. annum Introduced WVC HP 0117 C. annum Introduced WVC PP9852­170 C. annum Introduced WVC ICPN 18­7 C. annum Introduced WVC Long Red Cayenne C. annum Commercial Simlaw seed company Bird­eye hybrid (Oiseau pili pili) C. frutescens Commercial Technisem Company Red Scotch bonnet C. chinense Commercial Exporter California Wonder C. annum Commercial Kenya seed company Table 2 ­ Characteristics of the two agro­ecological zones of Rwanda where the study was conducted AEZ= Agro­ecological zone. Source: Verdoodt and Van Roanst, 2003. Site/District AEZ* Relief Elevation (m) Rainfall (mm) Temperature (°C) Rubona/ Huye Midlands Dissected plateaus 1600­1900 1100­1400 17­20 Gashora/Bugesera Lowlands Pediplains 900­1600 850­1100 20­21 Adv. Hort. Sci., 2020 34(4): 397­412 400 plant was applied. Both preventive and curative fungicidal sprays were applied at regular intervals to control fungal diseases. The spray regime was depen­ dent on symptom appearance and prevailing weath­ er conditions. Weeding was done two times in a month. Insecticides were not sprayed at all. Data collection During plant growth, data was collected at a 14­ days interval starting from two to ten weeks after planting (WAP) in the field. Ten plants were randomly selected from the middle rows of each plot and tagged. These plants were used for the assessment of viral disease incidence and symptom severity during the experimental period. Determination of disease incidence and symptom severity. Virus disease incidence was expressed as a percentage based on the proportion of infected/dis­ eased plants to the total number of plants observed per plot, as described by Galanihe et al. (2004). Symptom severity was scored for the ten tagged plants in a plot based on a scale of 1­5 as described by Olawale et al. (2015) with slight modifications, where: 1 = no symptoms; 2 = mild symptoms of mosaic/mottling/yellowing on few leaves (<25% of the plant affected); 3 = moderate symptoms of mosa­ ic/puckering/mottling/vein clearing/yellowing on many leaves (26­50% of the plant affected); 4 = severe symptoms of mosaic/puckering/mottling/vein clearing/yellowing/stunting (51­75% of the plant affected) and 5 = severe symptoms of mosaic/puck­ ering/mottling/vein clearing/yellowing/ stunting/ necrosis (>75% of the plant). Percentage severity was calculated as the sum of all disease rating per geno­ type expressed as a percentage of the total number of observations multiplied by maximum disease scor­ ing scale (5). Determination of the area under disease progress curve. The area under the disease progress curve (AUDPC) was estimated to compare different responses of the tested hot pepper genotypes. Estimated percentages of symptom severity recorded at different times during the experimental period were used to calculate AUDPC using the following equation as described by Campbell and Madden (1990). AUDPC Σ n­1 = (Yi+ Yi+1)/2 (ti+1– ti) where Σ = summation; n = number of successive readings, Yi = disease severity at time ti and Yi+1= dis­ ease severity at time ti+1. Detection of the viruses. Detection of the suspect­ ed viruses in the experimental plots was carried out using RT­PCR. At 10 WAP, approximately five young leaves from diseased plants of the eighteen geno­ types were collected and placed in envelopes con­ taining silica gel. The samples were later transported to the Phytopathology Laboratory of RAB at Rubona and stored at room temperature for 4­5 days to dry. Later, the samples were grounded in liquid nitrogen to fine powders that were stored at ­80°C until ana­ lyzed. In total, 68 symptomatic leaf samples were col­ lected from Rubona and Gashora’s experimental sites. Total ribonucleic acid was extracted from 100 mg of frozen powdered hot pepper leaf tissues using acetyl trimethyl ammonium bromide (CTAB) method as described by Allen et al. (2006) with modifications. Amplification of CMV, PVMV, PeVYV was done using One Taq One­step RT­PCR Kit (Catalogue E531S5, New England Biolabs Inc.), following the manufactur­ er’s instructions. Amplified products were generated using virus­specific primers that were designed dur­ ing this study based on the nucleotide sequence data of CMV­R1 (GenBank accession no. MG470800.1), PVMV­R1(MG470801.1), PeVYV­R1 (MG470802.1). The CMV primers amplified a fragment of ∼502 bp, PVMV a fragment of ∼502 bp and PeVYV a fragment of ∼498 bp (Table 3). Thermal cycling conditions were: 48°C at 15 min Table 3 ­ Primers used for detection of Cucumber mosaic virus, Pepper veinal mottle virus, and Pepper yellows virus * Primers developed during this study. Virus Primer * Sequence Amplification size (bp) CMV MG470800_1F 5'­GCTTCGCAATACGTTTTGACGG­3' 502 CMV MG470800_1R 5'­TACGACCAGCACTGGTTGATTC­3' 502 PVMV MG470801_1F 5’­AAGCCCTCATTGAAGGTCAACG­3’ 502 PVMV MG470801_1R 5’­ATCAACCATCACCCACATACCG­3’ 502 PeVYV MG470802_1F 5'­AGTACGTCTTCGAGACTACTGC­3’ 498 PeVYV MG470802_1R 5'­TCTATAGTAGAGAGGTCGATCC­3' 498 Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 401 for RT; followed by 1 min at 94°C for initial denatura­ tion; 40 cycles of 94°C for 15 s, 54°C for 30 s and 68°C for 45 s for denaturation, annealing, and extension, respectively. The final extension was at 68°C for 5 min. These conditions were similar for the three viruses. The PCR products were separated by elec­ trophoresis in 1.2% agarose gel stained with ethidi­ um bromide at 100 V for 40 min in 1 × Tris­Acetate­ EDTA (TAE) buffer. Gels were visualized under UV light. Assessment of aphid population. Monitoring of aphid populations was done at a 14­days interval starting from 2nd to 12th WAP. Un­winged aphids were monitored on four plants that were randomly selected from the center of each plot. Observations were carried out on six leaves (2 upper, 2 middle and 2 lower leaves) per plant. A small camel­brush was used to dislodge and collect aphids present into small­plastic bottles containing 70% ethanol and transported to the Phytopathology Laboratory of RAB at Rubona for identification and counting. Winged aphids were captured using yellow water traps (YWT) made from yellow plastic containers that were placed in the middle of each plot and filled with 1.5 litre of tap water (Blackman and Eastop, 2000). Five millilitre of formaldehyde (10%) was added per trap to preserve the insect. The collected aphids were counted and identified to species level using existing entomological keys and stereomicroscope based on their morphological features as described by Martin (1983) and Blackman and Eastop (2000). Reaction of hot pepper genotypes to Cucumber mosa‐ ic virus under controlled conditions Genotypes tested Fourteen hot pepper genotypes selected from the field trials were evaluated for resistance to CMV in the screenhouse. The experiment was carried out to validate the genotypes resistance to virus infection under controlled conditions. The genotypes tested included; seven local collections (00765PPR, 00767PPR, 00774PPR, 00786PPR, 000792PPR, 00795PPR and 00802PPR), five introduced lines (PBC 462, PP9950­5197, HP0117, PP9852­170 and ICPN 18­7) and two commercial varieties (Long Red Cayenne and Red Scotch Bonnet) as indicated in Table 1. Inoculation of CMV Fifty seedlings of each genotype were raised in the screenhouse. Before inoculation, the seedlings were confirmed to be free of viruses using DAS­ELISA as described in Materials and Methods. At the 5­6 leaf stage, the plants were mechanically inoculated with a local isolate of CMV. The virus was propagated and maintained in a hot pepper cultivar Scotch bon­ net in the screenhouse. Infected leaves were harvest­ ed and homogenized (1: 10 w/v) in 0.1 M phosphate buffer (pH7.0) containing 0.01% of sodium sulfite. The sap was sieved to remove plant debris and 0.06% of silicon carbide was added to enhance injury and increase points of entry of the virus. Two leaves per test plant were rub­inoculated with sap extract as described by Noordam (1973). After 5 mins the inoc­ ulated plants were rinsed with distilled water to remove the excess of the inoculum. Inoculated plants were maintained in an insect free screenhouse (aver­ age 27.8°C temp, 70.8% relative humidity). In total, forty­eight plants of each genotype were mechanical­ ly inoculated with CMV. Ten healthy plants of each genotype inoculated with phosphate buffer alone (with no inoculum) were maintained as control. The symptoms development on inoculated plants were recorded up to 3 weeks’ post­inoculation. At this time all the plants from the susceptible local check showed typical symptoms of CMV. The incidence and symptoms severity of CMV were evaluated on all plants as described in Materials and Methods. Detection of CMV The confirmation of CMV infection was performed using DAS­ELISA following the procedures described by Clark and Adam (1977) on representative samples from each hot pepper genotypes. The kits were obtained from Deutsche Sammlung Von Mikro­ organismen und Zellkulturen (DSMZ, Germany) and used according to instructions from the manufactur­ er. A healthy sample and extraction buffer were used as negative controls. A positive control was provided with the kit. Absorbance values were read at 405 nm using a microplate reader (BioTek ELX800, USA). Due to a large number of plants, only representative sam­ ples (7) were collected from each genotype and anal­ ysed. A sample was considered positive when the absorbance value at 405 nm (A405) exceeded the mean of negative controls by a factor of two. Classification of the hot pepper genotypes for resis‐ tance to viral diseases The rating of the genotypes was done as described by Rahman et al. (2016). Based on disease incidence and severity indices for both field and 402 Adv. Hort. Sci., 2020 34(4): 397­412 screenhouse experiments, each genotype was allo­ cated a score of 1 to 4. Scoring for virus incidence was: <20% =1, 21­30%=2, 31­50%=3 and >51%=4. Whereas, disease severity: <1=1, 1.1­2.0=2, 2.1­3.0=3 and >3.0=4. Based on cumulative scores i.e. incidence and severity indices, the genotypes were categorized into four groups: <3= resistant (R), 4­6 = moderately resistant (MR) and 7­8 = susceptible (S). The scores for the field experiments were made on pooled data obtained from the two sites and both cropping sea­ sons than data of individual site or season. Data analysis Data on disease incidence (%) and symptom severity were square­root transformed, and aphids’ populations were log­transformed before subjecting to the analysis of variance (ANOVA). Means of values regarding AUDPC were worked out using the Microsoft excel program. The AUDPC values were directly subject to ANOVA. Data were analyzed using SAS statistical software program and the means were separated using the least significant difference (LSD) test at p=0.05. 3. Results Reaction of the hot pepper genotypes to virus infec‐ tion and aphid infestation under field conditions Weather conditions at the experimental sites The average monthly rainfall, minimum and maxi­ mum air temperature during the two cropping sea­ sons (March­July, 2018 and October 2018­March, 2019) at Gashora and Rubona experimental sites are shown in figure 1. In Rubona, temperatures ranged from 14.4 ­24.2°C in season one and 15.2­24.9°C in season two. At Gashora, there were wide variations between the minimum and maximum temperatures from 12.9­27.7°C in season one and 13.7­28.2°C in season two. Incidence of virus diseases There were significant differences in disease inci­ dence between sites (p= <.0001), seasons (p= <.0001) and among genotypes (p = <.0001). The differences were observed from 4th WAP and increased with time, ranging from 3% to 100% at 10 WAP in both seasons and locations (Tables 4 and 5). At Rubona, higher disease incidence was recorded from both commercial and local genotypes, except for 00767PPR and 00802PPR compared to introduced genotypes in all sampling periods (Table 4). In season one, genotype 00767PPR was the least infected with the viruses as the disease incidence (DI) level was only 3%, followed by 00802PPR with 10%, PP9950­ 5197 with 20% and PBC 462 with 30% at 10 WAP (Table 4). The remaining genotypes had DI greater than 60%. In season two, disease incidence levels were generally lower in all genotypes compared to season one. The least infected genotype was PBC 462 with DI of 3% followed by 00802PPR and PP9852­170 both having 10%. This was followed by six genotypes (PP9950­5197, PBC 462, ICPN 18­7, 00767PPR, 00786PPR, 00765PPR) with incidence levels of ≤ 35% compared to the remaining genotypes that showed DI of ≥55% at 10 WAP (Table 4). On the other hand, a similar trend was observed at Gashora, where higher disease incidence levels were recorded in season one compared to two (Table 5). Genotype PBC 462 was the least infected with DI of 13%, followed by ICPN 18­7 with 30%, PP9950­ 5197 with 47% and the remaining genotypes had incidence levels greater than 70% in season one (Table 5). In season two, 5 genotypes (00767PPR, PP9950­5197, PBC 462, PP9852­170 and ICPN 18­7) showed DI levels of ≤ 50%. In both sites, the highest spread of viral diseases was recorded on both com­ mercial and local except for the genotype 00767PPR and 00802PPR. At 10 WAP, all the genotypes had developed symptoms of viral diseases but, high vari­ ability existed between genotypes. The interactions of site and season (p = <.0001), site and genotype (p = <.0001), season and genotype (p = 0.0025) were also highly significant. These results indicated that the incidence of viral diseases was dependent on the site and season the experiments were conducted. Area under disease progress curve The total amount of disease that occurred in the experiments was estimated and presented as the area under the disease progress curve (AUDPC). The mean AUDPC values differed significantly within sites Fig. 1 ­ The microclimate of the experimental sites during the two cropping seasons. Temp­ Temperature, Min­ Minimum, Max­Maximum. Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 403 and thus, data were not pooled together. In Rubona, the total amount of disease was significantly (p< 0.0001) higher in season one with mean AUDPC val­ ues of 230.9 compared to season two that recorded 117.1. In both seasons, all commercial and local genotypes (except 00767PPR and 00802PPR) record­ ed high levels of disease compared to introduced genotypes (Table 6). Genotypes 00767PPR, 00802PPR, PBC 462 and PP9950­5197 consistently recorded lower AUDPC values of less than 100 in both seasons. Besides, genotypes 00786PPR, PP9950­ 5197, PP9852­170 and ICPN 18­7 recorded values of less than 100 but only in season two. In Gashora, the AUDPC values were higher in both seasons compared to Rubona. However, a similar trend was observed where the amount of diseases was more in season one with values of 243.9 than season two 198.9 (Table 6). Introduced and the two local genotypes (00767PPR and 00802PPR) had low AUDPC values compared to the rest of the geno­ types. Genotypes PBC 462 and PP9950­5197 record­ ed values of less than 100 in both seasons, while genotypes 00767PPR, PP9852­170 and ICPN 18­7 had AUDPC values of less than 100 in season two only. On the other hand, genotypes 00792PPR, 00795PPR and the four commercial genotypes were the most infect­ ed with the viral diseases in both sites during the two seasons. Detection of the viruses in hot pepper genotypes Three viruses were detected in the samples ana­ lyzed namely CMV, PeVYV and PVMV. Cucumber mosaic virus infection was the most abundant in both sites, detected in 53.1% of the samples in Rubona and 75% in Gashora, followed by PeVYV with 31.3% and 2.8%, respectively (Fig. 2). The PVMV infections were the least abundant and only detected in 21.9% of the samples in Rubona. Double infections of CMV+PeVYV were common and detected in both sites, 12.5% in Rubona and 2.7% in Gashora, followed Table 4 ­ Incidence (%) of viral diseases recorded on eighteen hot pepper genotypes grown under field conditions during two seasons at Rubona Station, Huye District in Rwanda The values represent means of un­transformed data. Means comparison done by least significant difference (LSD) test on transformed data. Data transformed by square root (X+1). Means with the same letters within a column are not significantly different (P<0.05). n= 10 replicated thrice. WAP= Weeks after planting; 1 Genotypes collected from farmers’ field and conserved in Rwanda National GenBank; 2 Genotypes from World Vegetable Center; 3 Varieties obtained from seed companies and are grown for commercial purposes in Rwanda. Genotype Type Season one (March to June, 18) Season two (Mid­Oct. 18 to March, 19) 2WAP 4WAP 6WAP 8WAP 10WAP 2WAP 4WAP 6WAP 8WAP 10WAP 00765PPR Local 1 0 0 43 a 97 a 100 a 0 3 b 10 bc 23 abd 33 bcdef 00767PPR Local 0 0 0 e 3 f 3 f 0 0 b 3 c 10 bcd 17 def 00774PPR Local 0 3 33 abc 90 ab 97 ab 0 0 b 17 ab 36 a 60 abcd 00775PPR Local 0 10 33 abc 70 bc 87 abc 0 0 b 7 bc 20 abcd 77 ab 00786PPR Local 0 10 37 ab 77 abc 90 ab 0 3 b 7 bc 20 abcd 30 cdef 00791PPR Local 0 3 33 abc 80 abc 93 ab 0 0 b 0 c 23 abcd 97 a 00792PPR Local 0 7 30 abcd 87 ab 97 ab 0 0 b 0 c 33 ab 70 abc 00802PPR Local 0 0 0 e 3 f 10 f 0 0 b 3 c 7 bcd 10 f 00795PPR Local 0 0 30 abcd 83 ab 97 ab 0 0 b 0 c 20 abcd 83 a PBC 462 Introduced 2 0 0 0 e 13 de 30 e 0 0 b 0 c 3 cd 3 f PP9950­5197 Introduced 0 0 7 de 10 f 20 ef 0 3 b 3 c 3 cd 13 ef HP 0117 Introduced 0 0 10 cde 37 de 63 d 0 0 b 0 c 7 bcd 13 ef PP9852­170 Introduced 0 0 7 de 37 de 63 d 0 0 b 0 c 3 cd 10 f ICPN 18­7 Introduced 0 0 13 bcde 40 d 63 d 0 0 b 0 c 0 d 14 f Long red cayenne Commercial 3 0 0 23 abcde 77 abc 90 ab 0 3 b 10 bc 27 abcd 57 abcde Bird eye hybrid Commercial 0 0 7 de 40 d 70 cd 0 0 b 10 bc 33 ab 73 abc Red Scotch bonnet Commercial 0 3 33 abc 57 cd 80 bcd 0 0 b 10 bc 23 abd 70 abc California Wonder Commercial 0 0 37 ab 83 ab 100 a 0 13 a 23 a 30 abc 83 a LSD (0.05) 10 24 26 19 5 11 28 46 P­Value 0.3699 0.0027 <.0001 <.0001 0.0002 0.0167 <.0001 <.0001 Adv. Hort. Sci., 2020 34(4): 397­412 404 Genotype Season one (March to June, 18) Season two (Mid­Oct. 18 to March, 19) Type 2WAP 4WAP 6WAP 8WAP 10WAP 2WAP 4WAP 6WAP 8WAP 10WAP 00765PPR Local 1 0 0 0 d 90 a 97 ab 0 0 3 33becd 70 abc 00767PPR Local 0 0 17 cd 40 bc 87 abc 0 0 0 0 e 10 f 00774PPR Local 0 3 17 cd 90 a 100 a 0 0 10 63 ab 83 ab 00775PPR Local 0 0 13 cd 77 ab 97 ab 0 0 3 13 de 53 bcde 00786PPR Local 0 3 13 cd 100 a 100 a 0 0 0 57 bc 73 a 00791PPR Local 0 0 17 cd 97 a 100 a 0 0 0 17 cde 83 ab 00792PPR Local 0 7 23 abc 100 a 100 a 0 0 10 60 ab 87 ab 00802PPR Local 0 0 0 d 43 b 63 cd 0 0 0 40 bcde 60 bcd 00795PPR Local 0 3 17 cd 97 a 100 a 0 0 0 27 bcde 80 ab PBC 462 Introduced 2 0 0 0 d 0 d 13 f 0 0 0 7 efg 20 ef PP9950­5197 Introduced 0 0 0 d 10 d 47 de 0 0 0 3 de 13 f HP 0117 Introduced 0 0 0 d 17 bcd 70 cd 0 0 7 33 bcde 53 bcde PP9852­170 Introduced 0 0 0 d 17 bcd 73 bc 0 0 3 23 bcde 33 cdef ICPN 18­7 Introduced 0 0 7 cd 14 cd 30 ef 0 0 0 7 de 23 def Long red cayenne Commercial 3 0 3 13 cd 87 a 100 a 0 0 10 100 a 100 a Bird eye hybrid Commercial 0 7 37 ab 100 a 100 a 0 0 10 43 bcd 60 bcd Red Scotch bonnet Commercial 0 0 20 bc 90 a 100 a 0 0 3 33 bcde 70 abc California Wonder Commercial 0 13 40 a 93 a 100 a 0 0 20 100 a 100 a LSD (0.05) 9 18 29 24 13 40 39 P­Value 0.2336 0.0006 <.0001 <.0001 0.1196 <.0001 <.0001 Table 5 ­ Incidence (%) of viral diseases recorded on eighteen hot pepper genotypes grown under field conditions during two seasons at Gashora Station, Bugesera District in Rwanda The values represent means of un­transformed data. Means comparison done by least significant difference (LSD) test on transformed data. Data transformed by square root (X+1); Means with the same letters within a column are not significantly different (P<0.05). n= 10 replicated thrice; WAP= Weeks after planting; 1 Genotypes collected from farmers’ field and conserved in Rwanda National GenBank; 2 Genotypes from World Vegetable Center; 3 Varieties obtained from seed companies and are grown for commercial purposes in Rwanda. Genotype AUDPC in Rubona site AUDPC in Gashora site Pooled Season one Season two Season one Season two 00765PPR 240 cdef 86 bcd 264 c 203 cdefg 197cd 00767PPR 9 h 33 cd 146 d 22 h 52 e 00774PPR 294 abc 178 ab 298 bc 334 abc 279 abc 00775PPR 281 bcd 191 ab 315 bc 129 efgh 233 bc 00786PPR 364 ab 95 bcd 311 bc 272 cde 261 abc 00791PPR 320 abc 207 ab 316 abc 191 cdefg 259 abc 00792PPR 398 a 199 ab 388 a 300 bcd 321 ab 00802PPR 21 h 34 cd 149 d 169 defgh 93 e 00795PPR 273 bcde 179 ab 333 abc 240 cdef 257 abc PBC 462 63 gh 15 d 78 d 57 gh 55 e PP9950­5197 62 gh 52 cd 83 d 30 h 56 e HP 0117 165 efg 46 cd 128 d 131 efgh 117 de PP9852­170 148 fg 27 cd 137 d 97 fgh 102 de ICPN 18­7 179 def 16 d 93.6 d 63 gh 89 e Long red cayenne 308 abc 146 abc 344 ab 448 a 316 ab Bird­eye 312 abc 179 ab 346 ab 251 cde 276 abc Red Scotch bonnet 331 abc 177 ab 350 ab 198 cdefg 264 abc California Wonder 379 ab 248 a 312 bc 445 ab 346 a LSD (0.05) 109.2 123.7 72.9 149.5 99.9 P­value < 0.0001 0.0011 < 0.0001 < 0.0001 < 0.0001 Table 6 ­ Means of the area under disease progress curve (AUDPC) of viral diseases recorded on eighteen genotypes of hot pepper dur­ ing two seasons in Rubona and Gashora sites The values represent means of three replicates. Means with the same letters within a column are not significantly different (P<0.05). Means comparison done by Least significant difference (LSD) test. Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 405 by CMV+PVMV detected in 9.4% of the samples test­ ed in Rubona. Triple infection of CMV+PeVYV+PVMV was detected in 9.4% of the samples from Rubona. All hot pepper genotypes were infected by CMV. Assessment of aphids Aphid populations differed significantly between sites (p<0.0001), season (p=0.0075) and thus, data were analysed separately. In both seasons, the aphid population was significantly (p<.0001) higher in Rubona compared to Gashora (Table 7). Three species of aphids were observed. These were Aphis gosypii Glover, Macrosiphum euphorbiae Thomas and Acyrthosiphon pisum (Harris). The A. gosypii and M. euphorbiae were the most abundant in both sites, while A. pisum was observed in Gashora only. All genotypes were infested by aphids but the dif­ ference in numbers were not significant (p = 0.0923) among the genotypes (Table 8). The mean number of aphids per plant ranged from 4 to 108 in Rubona and 4 to 19 in Gashora, while the mean number of aphids per leaf ranged from 0.8 to 18 and 0.6 to 3.2, respec­ Fig. 2 ­ Overall incidence of viruses detected in leaf samples of hot pepper genotypes from Rubona and Gashora in Rwanda. Table 7 ­ Mean number of aphids captured in hot pepper fields during two cropping seasons in Rubona and Gashora experimental sites The values represent means and standard errors of three replicates. NS= Not significant at 0.05 level. Season Rubona site Gashora site A. gosypii M. euphorbiae Total aphids A. gosypii M. euphorbiae A. Pisum Total aphids Feb­June 2018 167 ± 30 a 10 ± 1 b 177 ± 30 a 32 ± 6 a 0 ± 0 b 11 ± 1 a 43 ± 5 a Oct. 2018 ­March 2019 48 ± 4 b 80 ± 11 a 128 ± 10 a 26 ± 5 a 28 ± 2 a 0 ± 0 b 54 ± 6 a LSD (0.05) 59 21 62 16 5 2 16 P­value 0.0017 <0.0001 NS NS < 0.0001 <0.0001 NS Table 8 ­ Number of aphids associated with different hot pepper genotypes in Rubona and Gashora's experimental sites The values represent means of untransformed data. NS= Not significant at 0.05 level. Genotype Rubona site Gashora site Mean aphids/plant Total aphids Aphids/plant Aphids/leaf Total aphids Aphids/plant Aphids/leaf 00765PPR 178.3 32.8 5.5 53.3 11.7 1.9 22.3 00767PPR 64.8 5.5 0.9 29 5.2 0.8 5.3 00774PPR 178.5 31.5 5.3 37.3 6.2 1 18.8 00775PPR 125.2 19.2 3.2 56 11.3 1.9 15.3 00786PPR 258.3 54.8 9 56.3 9.5 1.6 32.2 00791PPR 117.2 20.3 3.4 66.3 11.8 2 16.1 00792PPR 125.2 18.3 3 45 9.5 1.6 13.9 00802PPR 113 21.3 3.6 36.3 6.7 1.1 14 00795PPR 100.8 10.1 1.7 65.5 14 2.3 12.1 PBC 462 120 19.5 3.2 38 5.7 0.9 12.6 PP9950­5197 117.5 19.3 3.2 62.2 11 1.8 15.1 HP 0117 289.5 108 18 29.7 5.5 0.9 56.8 PP9852­170 205.8 42.2 7 94.5 19.3 3.2 30.8 ICPN 18­7 136.2 25.3 4.2 35 6.2 1 15.8 Long Red Cayenne 171 33.8 5.6 59.8 11 1.8 22.4 Bird­eye 72.2 4.8 0.8 26 4 0.6 4.4 Scotch Bonnet 83.7 10.2 1.7 50.7 9.7 1.6 9.92 California Wonder 287.8 79.2 13 40.5 7.8 1.3 43.5 P­value (0.05) NS NS NS NS NS NS NS Adv. Hort. Sci., 2020 34(4): 397­412 406 tively. Except HP 0117 and California wonder at Rubona site, the rest of the genotypes showed low numbers of aphids which did not exceed recom­ mended chemical control action thresholds of 10 aphids per leaf. The population exhibited a negative correlation with minimum (r = ­0.04, ­0.22) and maxi­ mum temperature (0.50, ­0.73) while, the correlation was positive with average rainfall (0.37, 0.68) in Rubona and Gashora, respectively. These correlations were not significant at the 5 percent level (data not shown). Classification of hot pepper genotypes for resistance to viral diseases under field conditions Commercial genotypes were more susceptible to virus infections than the new lines from World Vegetable Center. Various degrees of symptoms were observed on most genotypes during the evalua­ tion period. These included leaf mosaic, crinkling, chlorosis, vein banding, and leaf deformation. Based on incidence and severity indices from both locations and seasons only five genotypes rated resistant to viral diseases i.e. 00767PPR, 00802PPR, PBC 462, PP9950­5197 and ICPN 18­7 with total scores between 2­3; three moderately resistant 00765PPR, HP 0117 and PP9852­170 with scores between 4­6; and nine susceptible 00775PPR, 00786PPR, 00774PPR, 00786PPR, 00792PPR, Long Red Cayenne, Bird Eye Hybrid, Red Scotch Bonnet, and California Wonder with scores between 7­9 (Table 9). Two local genotypes (00767PPR, and 00802PPR) and three introduced genotypes (PBC 462, PP9950­5197 and ICPN 18­7) showed resistance to viral diseases in both locations. Reaction of hot pepper genotypes to CMV under arti‐ ficial inoculation conditions Disease incidence A significant difference (p<0.05) in disease inci­ dence and symptoms severity was observed between the genotypes tested (Table 10). Infected plants showed systemic symptoms of CMV infection includ­ ing leaf mosaic, mottle, crinkling, small and deformed leaves, and stunting with varying degrees of severity (Fig. 3). Six genotypes (Red Scotch Bonnet, 00795PPR, 00792PPR, 00786PPR, 00774PPR, and Long red cayenne) developed symptoms thirteen days’ post­inoculation (dpi) and the first three Table 9 ­ Classification of the hot pepper genotypes based on incidence (%) and severity indices of virus­induced diseases under field conditions The values represent means of un­transformed data. Means comparison done by Least significant difference (LSD) test on transformed data. Means with the same letters within a column are not significantly different (P<0.05). Incidence scores; 20% =1, 21­30%=2, 31­ 50%=3 and >51%=4. Severity scores; <1=1, 1.1­2.0=2, 2.1­3.0=3 and >3.0=4. Cumulative scores i.e. incidence + severity indices; < 3= resi­ stant (R), 4­6 = moderately resistant (MR) and 7­8 = susceptible (S). Genotype Incidence (%) Severity indices Cumulative rating Host reactionSeason one Season two Pooled Rating Season one Season two Pooled Rating 00765PPR 97 51.5 74.3 ab 4 2.4 1.6 2 d 2 6 MR 00767PPR 45 11.5 28.3 e 2 1 0.3 0.7 ef 1 3 R 00774PPR 96.5 71.5 84 a 4 2.8 2.7 2.8 abc 3 7 S 00775PPR 83.5 65 74.3 ab 4 2.6 2.2 2.4 cd 3 7 S 00786PPR 88.5 51.5 70 abc 4 2.9 2.1 2.5 bcd 3 7 S 00791PPR 90 90 90 a 4 2.9 2.7 2.8 abc 3 7 S 00792PPR 93.5 78.5 86 a 4 3.5 3 3.3 a 4 8 S 00802PPR 33 24 28.5 e 2 0.8 1.1 1 ef 1 3 R 00795PPR 91.5 81.5 86.5 a 4 2.8 2.9 2.9 abc 3 7 S PBC 462 13 11.5 12.3 e 1 0.2 0.4 0.3 f 1 2 R PP9950­5197 28.5 13 20.6 e 1 0.7 0.5 0.6 ef 1 2 R HP 0117 53.5 33 43.3 cde 3 1.2 0.9 1.1 e 2 5 MR PP9852­170 55 21.5 38.3 cde 3 1.2 0.7 1 ef 1 4 MR ICPN 18­7 35 15 25 e 2 0.6 0.5 0.6 ef 1 3 R Long Red Cayenne 88.5 78.5 83.5 a 4 3 3.3 3.2 ab 4 8 S Bird­eye 76.5 55 65.8 abcd 4 3 2.5 2.8 abc 3 7 S Scotch bonnet 80 71.5 75.6 ab 4 3 2.3 2.7 abcd 3 7 S California Wonder 91.5 68.5 75.6 a 4 2.9 2.9 2.9 abc 3 7 S LSD 33.6 0.7 P­value 0.0004 <.0001 Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 407 showed high levels of CMV infection (Table 10). Introduced genotypes PBC462, PP9950­5197, HP 0117, PP9852­170, ICPN18­7, and local genotype 00765PPR displayed symptoms at seventeen dpi while the remaining two local genotypes 00767PPR and 0802PPR showed symptoms at nineteen dpi. A total of six genotypes namely 00765PPR, 00792PPR, 00795PPR, 00774PPR, Long red cayenne and Red scotch bonnet had disease incidence between 50­ 100%, severity 2.7­5 at nineteen dpi and thus rated as susceptible to CMV (Table 10). Genotypes PP9950­ 5197, 00786PPR, HP 0117 and ICPN 18­7 had moder­ ate levels of infection displaying 22­35.4% disease incidence at nineteen dpi and thus classified as mod­ erately resistant to CMV. Among the 14 hot pepper genotypes tested, only four including two local (00767PPR, 0802PPR) and two introduced (PBC 462 and PP9852­170) showed resistant reaction against CMV with disease incidence ranging from 2­18.8% and severity 1.0­1.2 at nineteen dpi. A positive reac­ tion to CMV was revealed by ELISA for the tested samples from all genotypes. Table 10 ­ Reaction of hot pepper genotypes against Cucumber mosaic virus under screenhouse conditions The values represent means of un­transformed data. Means comparison done by Least significant difference (LSD) test on transformed data. Data transformed by square root (X + 1). Means with the same letters within a column are not significantly different (P<0.05). Incidence scores: 20% =1, 21­30%=2, 31­50%=3 and >51%=4. Severity scores: <1=1, 1.1­2.0=2, 2.1­3.0=3 and >3.0=4. Cumulative scores i.e. incidence + severity indices: < 3= resistant (R), 4­6 = moderately resistant (MR) and 7­8 = susceptible (S). n = 16 replicated three times. Dpi= Days post­inoculations. Genotype Incidence (%) Severity indices Cumulative rating Host reaction13dpi 15dpi 17dpi 19dpi Rating 13dpi 15dpi 17dpi 19dpi Rating 00765PPR 0.0 d 0.0 d 60.4 bc 77.1 b 4 1.0 c 1.0 d 1.8 d 2.7 c 3 7 S 00767PPR 0.0 d 0.0 d 0.0 g 2.1 h 1 1.0 c 1.0 d 1.0 e 1.0 f 1 2 R 00774PPR 10.4 cd 41.7 c 41.7 cd 50.0 de 3 1.1 c 1.4 cd 2.1 d 3.1 c 4 7 S 00786PPR 4.2 cd 8.3 d 22.9 def 25 fg 2 1.1 c 1.1 cd 1.3 e 1.4 ef 2 4 MR 00792PPR 75.0 b 75 bc 75.0 ab 75 b 4 2.3 ab 2.8 b 3.2 bc 4.0 b 4 8 S 00802PPR 0.0 d 0.0 d 0.0 g 18.8 fgh 1 1.0 c 1.0 d 1.0 e 1.2 f 2 3 R 00795PPR 75.0 b 75.0 b 81.3 ab 100.0 a 4 2 b 2.7 b 3.7 ab 5.0 a 4 8 S PBC 462 0.0 d 0.0 d 4.2 efg 12.5 gh 1 1.0 c 1.0 d 1.0 e 1.2 f 2 3 R PP9950­5197 0.0 d 0.0 d 8.3 efg 22.9 fg 2 1.0 c 1.0 d 1.0 e 1.3 f 2 4 MR HP 0117 0.0 d 0.0 d 2.1 fg 35.4 ef 3 1.0 c 1.0 d 1.0 e 1.5 def 2 5 MR PP9852­170 0.0 d 0.0 d 2.1 fg 14.6 gh 1 1.0 c 1.0 d 1.0 e 1.2 f 2 3 R ICPN 18­7 0.0 d 0.0 d 25.0 de 56.3 cd 4 1.0 c 1.0 d 1.0 e 2.0 de 2 6 MR Long red cayenne 16.7 c 29.2 c 89.6 a 97.9 a 4 1.2 c 1.5 c 2.7 c 4.5 ab 4 8 S Red Scotch bonnet 91.7 a 93.8 a 93.8 a 100.0 a 4 2.4 a 3.3 a 4.1 a 4.8 a 4 8 S LSD (0.05) 12.6 15.3 21.4 19.8 0.3 0.5 0.6 0.7 P value <.0001 <.0001 <.0001 <.0001 <.0001 <.0001 <.0001 <.0001 Fig. 3 ­ Symptoms of Cucumber mosaic virus on different hot pepper genotypes. (a) leaf mosaic, crinkling and distortion in commercial genotype Scotch Bonnet, (b) mottling in local genotype 00774PPR, (c) leaf distortion and stunting in local genotype 00795PPR, (d) leaf mosaic in introduced genotype ICPN18­7. Adv. Hort. Sci., 2020 34(4): 397­412 408 4. Discussion and Conclusions Host plant resistance is an important factor in the integrated management of pests. The present study was undertaken to identify genotypes that can be used in production or as sources of resistance to viruses and aphids in hot pepper breeding programs. All the genotypes tested in this study were infected by the viruses observed either in the field or screen­ house however, there were some resistant geno­ types found based on incidence and symptoms sever­ ity of the viral diseases. In the field, five genotypes 00802PPR, C. bacca‐ tum 00767PPR, C. annuum PBC 462, PP9950­5197 and ICPN 18­7 were resistant to the viral diseases while C. annuum 00765PPR, HP 0117 and PP9852­ 170 were moderately resistant. The rest of the geno­ types were susceptible to the viral diseases. These variations among the genotypes might be due to vari­ ous factors that include genetic make­up, the strain of the virus and their combinations, time of infection and prevailing environmental conditions (Visalakshi and Pandiyan, 2018). Such variations reveal the diversity present within the genotypes that needs to be exploited. In previous studies under field condi­ tions, various genotypes from C. baccatum, C. annu‐ um and C. frutescens species have displayed variable resistance to some viruses such as PVMV, TMV, CMV, Pepper mild mottle virus, Chili veinal mottle virus and Leaf curl virus (Appiah et al., 2014; Rahman et al., 2016; Bandla and Beena, 2018; Fajinmi et al., 2018). For instance, C. baccatum PI 439381­1­3 was report­ ed as resistant to CMV and PMMoV under field con­ ditions (Suzuki et al., 2003). Our result, reports some additional sources of resistance from C. baccatum and C. annuum species that could be valuable in hot pepper breeding programs as well as cultivation if preferred by farmers. The CMV, PVMV and PeVYV were detected in leaf samples collected from fields and CMV was the most abundant. These three viruses have also been report­ ed to infect pepper previously in Rwanda (Skelton et al., 2018). The high incidence of CMV in the field could be attributed to several factors including wide host range, climatic conditions and efficiency of vec­ tor transmission as reported by Shah et al. (2009). Appiah et al. (2014) in their study also observed a high incidence of CMV in the range of 75% to 83.3% on pepper cultivars. All genotypes evaluated were infected with CMV and almost half of them showed multiple (double or triple) infections of CMV with either PVMV or PeVYV or both, which could have serious consequences in their management. Mixed infections of CMV and PVMV in pepper have been reported in previous studies (Aliyu, 2014; Appiah et al. 2014). Mixed infections in pepper plants increase the severity of disease symptoms leading to signifi­ cant yield losses (Arogundade et al., 2012). Thus, understanding the interactions of these viruses is crucial for the development of efficient and sustain­ able management strategies such as resistant vari­ eties (Syller, 2012). Results from screenhouse showed that all geno­ types developed symptoms to CMV infection albeit at different levels of severity and time, confirming the virulence of the local CMV isolate used. The plants developed systemic symptoms including mosaic, mottle, leaf crinkling and distortion and stunting which were similar to symptoms described by Rahman et al. (2016). Two local genotypes 0802PPR and C. baccatum 00767PPR, and two introduced genotypes C. annuum PBC 462 and PP9852­170 were found resistant to CMV while one local C. annuum genotypes 00786PPR and three introduced geno­ types PP9950­5197, HP 0117 and ICPN 18­7 were moderately resistant. The previously published resis­ tant genotypes (PP9852­170 and PP9950­5197) to CMV in screenhouse conditions were also resistant in our study (Gniffke, et al., 2013; Reddy, et al., 2014). However, genotype ICPN 18­7 that was previously reported as susceptible to CMV was moderately resistant in the current study (Gniffke, et al., 2013). The reason for these differences could be attributed to the use of different strain of CMV. Various sources of resistance to CMV in pepper have been identified in C. annuum, C. baccatum and C. frutescens species (Grube et al., 2000; Chaim et al., 2001; Caranta et al., 2002; Suzuki et al., 2003; Rahman et al., 2016). The present findings prove that natural resistance or tol­ erance exists in tested C. annuum and C. baccatum genotypes. As different strains of CMV exist, it is desirable to test the identified pepper genotypes against multiple strains of CMV to validate their resis­ tance. In both field and screenhouse experiments, geno­ type 00767PPR, 0802PPR and PBC 462 were consis­ tently resistant to viral diseases while genotype HP 0117 was moderately resistant, providing evidence that the reactions of these genotypes to the virus might be due to genetic factors. However, unlike under field conditions where genotypes PP9950­5197 and ICPN 18­7 were categorized as resistant to viral Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 409 diseases, they reacted differently when subjected to the artificial inoculation with CMV and grouped as resistant. This might be due to disease escape in the field. Similar observations were made by Ashfaq et al. (2014), where two chili genotypes C­7 and C­8 showed a different reaction to CMV under controlled and uncontrolled conditions. On the other hand, genotype PP9852­170 was resistant to CMV under controlled conditions while in the field, it was grouped as moderately resistant to viral diseases. This may be due to the complex nature of the virus­ es’ infection in the field where more than two viruses occur in combination. As was evident in this study where single and mixed infections of CMV, PVMV, and PeVYV were observed and their presence might have contributed towards variations in the reaction of the host in the field. These variations in the obser­ vation may also be due to variations in inoculum load and environmental conditions that might have inter­ fered with plant behaviour. The categorization of genotypes into resistant, moderately resistant and susceptible was based on the incidence and severity of the viral diseases on the host. However, it is noteworthy that the genotypes 00802PPR, 00767PPR, PBC 462, PP9950­5197 and ICPN 18­7 classified as resistant to viral diseases had the lowest AUDPC values of less than 100 in the field while the highest AUDPC value was recorded in sus­ ceptible check California wonder 346. Lower AUDPC values indicate a lower disease development rate. These genotypes had low AUDPC values which implies that the plant defence mechanism against the viruses could be mediated by resistance (R) genes which are observed as complete resistance or extreme resistance (ER) and that the virus replication could have been hindered or gone undetectable among the infected cells (Ingvardsen et al., 2010). The reaction of pepper cultivar to the viral diseases is governed by the resistance genes which can be brought by a single gene or multiple genes (Kang et al., 2010; Kim et al., 2017). However, genes responsi­ ble for their resistance in particular for the two local accessions are unknown and mechanisms that under­ lie their resistance are yet to be understood. This is important information that could help to determine useful markers to support breeding processes. Aphid species are important agricultural pests because they have a broad host range and transmit many important plant viruses. In this study, three species of aphids were recorded in the pepper fields and the most abundant in both sites were A. gosypii and M. euphorbiae. These findings agree with previ­ ous studies by Meena et al. (2013) and Rajput et al. (2017) who reported the infestation of hot pepper fields with A. gosypii in India. Similar results on M. euphorbiae were reported by Djieto­Lordon et al. (2014) in Cameroon. The presence of A. pisum in Gashora was understandable since there was a pigeon peas field near the experimental plots. These polyphagous insects belong to the Hemiptera order and they are important pests because of the ability to transmit several viruses in pepper. According to Fajinmi et al. (2011); Dombrovsky et al. (2010) and Zitter and Murphy, (2009) A. gosypii efficiently trans­ mits CMV, PeVYV, and PVMV which were detected in this study. There was no difference in genotypes infestation by the aphids. Besides, complete genotype resistance to aphids’ infestation was not recorded in any of the genotypes tested. Bird­eye hybrid was the less pre­ ferred by the aphids (4.4 aphids/plant) followed by 00767PPR (5.3 aphids/plant) and Red scotch bonnet (9.9 aphids/plant) while the most preferred was genotype HP 0117 (56.8 aphids/plant) followed by California wonder (43.5 aphids/plant) and 00786PPR (32.2 aphids/plant). Unlike other plant species such as soybean where a lot has been done on resistance to aphids (Hill et al., 2004), only a few studies have been conducted on pepper (Frantz et al., 2004; Sun et al., 2018). Sun et al. (2018), in their studies, identi­ fied C. baccatum accession PB2013071 as highly resistant, while the accessions PB2013062 and PB2012022 as intermediate resistant to M. persicae under screen house conditions. Recently, quantita­ tive trait loci (QTLs) conferring resistance to M. persi‐ cae in pepper was detected (Sun et al., 2019). In the present study, prevailing weather conditions, espe­ cially at the Gashora site, negatively affected the population of aphids leading to low infestation on pepper plants. Thus, further efforts are needed to identify and validate the resistance of these geno­ types to aphids under controlled and uncontrolled conditions. Most of the varieties grown in the country includ­ ing the commonly grown commercial varieties were found to be susceptible to viral diseases. A relatively higher number of resistant lines from introduced material indicates that the World Vegetable Center germplasm collection has a wider genetic base than local material. Since viruses cause serious diseases of hot pepper around the world, the results of this study may be promising and could be used in the for­ Adv. Hort. Sci., 2020 34(4): 397­412 410 mulation of integrated control strategies for the management of these destructive 1diseases. The use of resistant pepper genotypes to manage the viral diseases can potentially replace or minimize the application of harmful pesticides and could be used as an important component of integrated pest man­ agement (IPM) which is a promising approach to sus­ tainable agriculture. In the present study, three genotypes 00767PPR, 00802PPR and PBC 462 consistently rated as resistant to viral diseases while genotype HP 0117, PP9852­170, PP9950­5197 and ICPN 18­7 were moderately resistant under field and screenhouse conditions. As revealed from the study, most of the local genotypes and all of the commercially grown pepper genotypes tested were susceptible. Therefore, the identified genotypes especially the ones from World Vegetable Center are recommended for adoption by growers. The two local collections 00767PPR and 00802PPR are not preferred cultivars for commercial production and thus, they can be utilized in breeding programs as potential sources for virus resistance. Farmers should be encouraged to use hot pepper varieties that are resistant to viruses as part of a management program to maximize yields. Further studies are needed to identify and validate resistance of the tested genotypes to aphids under controlled and uncontrolled conditions. Acknowledgements This work was funded by the United States Agency for International Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number BFS­G­11­00002, and the predecessor fund the Food Security and Crisis Mitigation II grant, award number EEM­G­00­04­00013; with additional support from Rwanda Agriculture and Animal Resources Development Board (RAB). We would like to thank the World Vegetable Center, Eastern and Southern Africa­Tanzania for the provision of the improved lines of hot pepper. We are also grateful to the Rwanda National Genbank for the provision of the local genotypes. References ALIYU T.H., 2014 ­ The incidence, severity, and occurrence of four viruses infecting pepper (Capsicum spp.) in the southern Guinea savannah Agro‐ecological zone of Nigeria. ­ Agric. Conspec. Sci., 79: 233­237. ALLEN G.C., FLORES­VERGARA M.A., KRASYNANSKI S., KUMAR S., THOMPSON W.F., 2006 ­ A modified proto‐ col for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. ­ Nat. Protoc., 1(5): 2320­2325. APPIAH A.S., QUARTEY E.K., AMOATEY H.M., NUNEKPEKU W., OWUSU­ANSAH M., OFORI S., 2014 ­ Response of nine cultivars of pepper (Capsicum spp.) to infection by four viruses under natural field conditions in the coastal savanna zone of Ghana. ­ Res. J. Appl. Sci. Eng. Tech., 7(5): 903­907. AROGUNDADE O., BALOGUN O.S., KAREEM K.T., 2012 ­ Occurrence and distribution of pepper veinal mottle virus and cucumber mosaic virus in pepper in Ibadan, Nigeria. ­ Virol. J., 9(1): 79. ASHFAQ M., IQBAL S., MUKHTAR T., SHAH H., 2014 ­ Screening for resistance to Cucumber mosaic cucu‐ movirus in chilli pepper. ­ J. Anim. & Plant Sci., 24(3): 791­795. BANDLA S., BEENA T., 2018 ­ Identification of host plant resistance to leaf curl in chilli (Capsicum frutescens L.). ­ Int. J. Curr. Microbiol. Appl. Sci., 7(8): 2483­2487. BENTO C.S., RODRIGUES R., ZERBINI J.F., SUDRE C.P., 2009 ­ Sources of resistance against the Pepper yellow mosa‐ ic virus in chili pepper. ­ Hortic. Bras., 27: 196­201. BLACKMAN R.L., EASTOP V.F., 2000 ­ Aphids on the World’s Crops: An Identification and Information Guide, 2nd Edition. ­ West Sussex, England, Wiley, pp. 466. CAMPBELL C.L., MADDEN L.V., 1990 ­ Introduction to plant disease epidemiology. ­ Wiley, New York, USA. CARANTA C., PFLIEGER S., LEFEBVRE V., DAUBEZE A.M., THABUIS A., PALLOIX A., 2002 ­ QTLs involved in the restriction of Cucumber mosaic virus (CMV) long dis‐ tance movement in pepper. ­ Theor. Appl. Genet., 104: 586­591. CHAIM A.B., GRUBE R.C., LAPIDOT M., JAHN M., PARAN I., 2001 ­ Identification of quantitative trait loci associated with resistance to Cucumber mosaic virus in Capsicum annuum. ­ Theor. Appl. Genet., 102: 1213­1220. CHOI S., LEE J.H., KANG W.H., KIM J, HUY H.N., PARK S.W, SON E.H, KWON J.K., KANG B.C., 2018 ­ Identification of Cucumber mosaic resistance 2 (cmr2) that confers resistance to a new cucumber mosaic virus Isolate P1 (CMV‐P1) in pepper (Capsicum spp.). ­ Front. Plant Sci., 9: 1106. DAFALLA G.A., 2001 ­ Situation of tomato and pepper viruses in Africa, pp 18­24. ‐ In: D’A. HUGHES J. B.O. ODU (eds.) Proceedings of a Conference on “Plant Virology in Sub Saharan Africa”. International Institute of Tropical Agriculture, IITA, June 4­8, Ibadan, Nigeria, pp. 589. DEGRI M.M., AYUBA J., 2016 ­ Effect of pepper and cereals intercropping in the management of aphids (Aphis gossypii Glove) on pepper (Capscium annum L.). ­ Int. J. Res. Agric. For., 3 (4): 23­27. Waweru et al. ‐ Evaluation of hot pepper genotypes in Rwanda 411 DJIETO­LORDON C., HEUMOU C.R., AZANG P.S.E., ALENE C.D., NGUENG A.C., NGASSAM P., 2014 ­ Assessment of pest insects of Capsicum annuum L.1753 (Solanaceae) in a cultivation cycle in Yaoundé. ­ Int. J. Biol. Chem. Sci., 8(2): 621­632. DOMBROVSKY A., GLANZ E., PEARLSMAN M., LACHMAN O., ANTIGNUS Y., 2010 ­ Characterization of Pepper yel‐ low leaf curl virus, a tentative new Polerovirus species causing a yellowing disease of pepper. ­ Phytoparasitica, 38: 477­486. FAJINMI A.A., ODEBODE C.A., FAJINMI O.B., 2011 ­ Incidence and distribution of aphid vectors of Pepper veinal mottle virus on bell pepper. ­ Int. J. Entomol., 1(1):1­12. FAJINMI A.A., OMOTAYO A., RIBEIRO C., OLULEYE A.K., FAJINMI O.B., 2018 ­ Evaluation of pepper genotypes for disease tolerance in southwest Nigeria. ­ Acta Horticulturae, 1225: 457­464. FAO, 2017­ FAO Statistics Division 2017. www.Faostat.org FRANTZ J.D., GARDNER J., HOFFMANN M.P., JAHN M.M., 2004 ­ Greenhouse screening of capsicum accessions for resistance to green peach aphid (Myzus persicae). ­ HortSci., 9(6): 1332­1335. GALANIHE L.D., PRIYANTHA M.G.D.L., YAPA D.R., BANDARA H.M.S., RANASINGHE J. 2004 ­ Insect pest and diseases incidences of exotic hybrid chilli pepper varieties grown in the low country dry zone of Sri Lanka. ­ Annals of Sri Lanka, 6: 99­106. GNIFFKE P.A., SHIEH S.C., LIN S.W., SHEU Z.M., CHEN J.R., HO F.I., TSAI W.S., CHOU Y.Y., WANG J.F., CHO M.C., ROLAND S., KENYON L., EBERT A.W., SRINIVASAN R., KUMAR S., 2013 ­ Pepper research and breeding at AVRDC‐The World Vegetable Center. ­ XV EUCARPIA meeting on genetics and breeding of capsicum and eggplant, 2­4 September 2013, Turin, Italy, pp. 305­ 311. GRUBE R.C., ZHANG Y., MURPHY J.F., LOAIZA­FIGUEROA F., LACKNEY V.K., PROVVIDENTI R., 2000 ­ New source of resistance to Cucumber mosaic virus in Capsicum frutescens. ­ Plant Dis., 84: 885­891. HILL C.B., LI Y., HARTMAN G.L., 2004 ­ Resistance to the soybean aphid in soybean germplasm. ­ Crop Sci., 44: 98­106. INGVARDSEN C.R., XING Y., FREI U.K.K., LÜBBERSTEDT T., 2010 ­ Genetic and physical fine mapping of Scmv2, a potyvirus resistance gene in maize. ­ Theor. Appl. Genet., 120: 1621­1634. KANG W.H., HOANG N.H., YANG H.B., KWON J.K., JO S.H., SEO J.K., 2010 ­ Molecular mapping and characteriza‐ tion of a single dominant gene controlling CMV resis‐ tance in peppers (Capsicum annuum L.). ­ Theor. Appl. Genet., 120: 1587­1596. KENYON L., KUMAR S., WEN­SHI TSAI JACQUELINE D’A. H., 2014 ­ Virus diseases of peppers (Capsicum spp.) and their control. ‐ Adv. Virus Res., 90: 297­354. KIM S.B., KANG W.H., HUY H.N., YEOM S.I., AN J.T., KIM S., KANG M.Y., KIM H.J., JO Y.D., HA Y., CHOI D, KANG B.C., 2017 ­ Divergent evolution of multiple virus‐resistance genes from a progenitor in Capsicum spp. ­ New Phytol., 213: 886­899. MARTIN J.H., 1983 ­ The identification of common aphid pest of tropics. ­ Trop. Pest Manag., 29: 395­411. MEENA R.S., AMETA O.P., MEENA B.L., 2013 ­ Population dynamics of sucking pests and their correlation with weather parameters in chilli, Capsicum annum L. crop. ­ The Bioscan, 8(1): 177­180. MURPHY J.F., BOWEN K.L., 2006 ­ Synergistic disease in pepper caused by the mixed infection of Cucumber mosaic virus and Pepper mottle virus. ­ Phytopathology, 96: 240­247. NIRANJANADEVI J., MURUGAN M., SENTHIL N., SHANTHI M., SATHIYAMURTHY A., 2018 ­ Levels of plant resis‐ tance in chillies Capsicum spp against whitefly, Bemisia tabaci. ­ Int. J. Curr. Microbiol. Appl. Sci., 7(1): 1419­ 1441. NJUKENG P.A., NGWAKUM W.N., MBONG G.A., 2013 ­ Relative prevalence, incidence and severity of two viru‐ ses infecting cultivated pepper in the Western Highlands of Cameroon. ­ Agric. Sci. Res. J., 3(8): 261­ 266. NOORDAM D., 1973 ­ Identification of plant viruses. Methods and experiments. ­ Centre for Agricultural Publishing and Documentation, Wageningen, The Netherlands, pp. 207. OLAWALE A., SAMUEL B.O., SOLOMON A.S.O., KUMAR P.L., 2015 ­ Surveys of virus diseases on pepper (Capsicum spp.) in South‐west Nigeria . ­ Afr. J. Biotechnol., 14(48): 3198­3205. RAHMAN M.S., AKANDA A.M., MIAN I.H., BHUIYAN M.K.A., HOSSAIN M.M., 2016 ­ New Sources of Resistance to Cucumber mosaic virus in Capsicum annuum. ­ J. Crop Sci. Biotechnol., 19 (3) :249­258. RAJPUT V.S., PRAJAPATI B.G., PAREEK A., PATEL P.S., 2017 ­ Studies on population dynamics of major insect pests infesting chilli (Capsicum annum L.). ‐ Int. J. Pure App. Biosci., 5(6): 1465­1470. RDB, 2010 ­ Rwanda export catalogue. ‐ Rwanda Development Board, pp. 46. http://www.rdb.rw/ uploads/tx_sbdownloader/RwandaExportCatalogue. pdf. REDDY M.K., SRIVASTAVA A., KUMAR S., KUMAR R., CHAWDA N., EBERT A.W., VISHWAKARMA M., 2014 ­ Chilli (Capsicum annuum L.) breeding in India: An over‐ view. ­ SABRAO J. Breed. Genet., 46: 160­173. SHAH H., YASMIN T., FAHIM M., HAMEED S., HAQUE M.I., 2009 ­ Prevalence, occurrence and distribution of Chilli veinal mottle virus in Pakistan. ­ Pak. J. Bot., 41(2): 955­ 965. SKELTON A., UZAYISENGE B., FOWKES A., ADAMS I., BUX­ TON­KIRK A., HARJU V., FORDE S., WARD R., RITCHIE B., RUTHERFORD M., OFFORD L., UMULISA C., WAWERU B., KAGIRANEZA B., KARANGWA P., FOX A., 2018 ­ First http://www.Faostat.org Adv. Hort. Sci., 2020 34(4): 397­412 412 report of Pepper veinal mottle virus, Pepper yellows virus and a novel enamovirus in hot pepper (Capsicum sp.) in Rwanda. ­ New Dis. Rep., 37: 5. SUN M., VOORRIPS R.E., STEENHUIS­BROERS G., WESTEN­ DE W.V., VOSMAN B., 2018 ­ Reduced phloem uptake of Myzus persicae on an aphid resistant pepper acces‐ sion. ­ BMC Plant Biol., 18: 138. SUN M., VOORRIPS R.E., WESTENDE W.V., KAAUWEN M.V., VISSER R.G.F., VOSMAN B., 2019 ­ Aphid resistance in Capsicum maps to a locus containing LRR-RLK gene analogues. ­ Theor. Appl. Genet., 133: 227­237. SUZUKI K., KURIDA T., MIURA Y., MURAI J., 2003 ­ Screening and field trials of virus resistant sources in Capsicum spp. ­ Plant Dis., 87: 779­783. SYLLER J., 2012 ­ Facilitative and antagonistic interactions between plant viruses in mixed infections. ­ Mol. Plant Pathol., 13(2): 204­216. VERDOODT A., VAN RANST E., 2003 a ­ Land evaluation for agricultural production in the tropics: a large scale land suitability classification for Rwanda. ­ Laboratory of Soil Science, Ghent University, Ghent, Belgium. VISALAKSHI M., PANDIYAN M., 2018 ­ Crop improvement in chillies: An overview. ­ Int. J. Chem. Stud., 6(4): 1736­ 1744. WANG X., LIU F., ZHOU G., LI X.H., Li Z., 2006 ­ Detection and molecular characterization of Pepper mild mottle virus in China. ­ J. Phytopathol., 154: 755­757. ZITTER T.A., MURPHY J.F., 2009 ­ Cucumber mosaic virus. ­ The Plant Health Instructor, DOI: 10.1094/PHI­I­2009­ 0518­01.