Impaginato 243 Adv. Hort. Sci., 2021 35(3): 243­253 DOI: 10.36253/ahsc­8376 Genetic diversity assessment of ancient mulberry (Morus spp.) in Lebanon using morphological, chemical and molecular markers (SSR and ISSR) A. Kadri 1, 4, S. Saleh 2, A. Elbitar 3, A. Chehade 1 (*) 1 Lebanese Agricultural Research Institute, Tal Amara Station, Department of Plant Biotechnology, Plant Genetic Resources Unit, P.O. Box 287, Zahleh, Lebanon. 2 Lebanese University, Faculty of Sciences I, Applied Plant biotechnology, Hadath, Lebanon. 3 Lebanese Agricultural Research Institute, Tal Amara Station, Department of Plant Biotechnology, Plant Tissue Culture Unit, P.O. Box 287, Zahleh, Lebanon. 4 Lebanese University, Faculty of Sciences IV, Department of Life and Earth Sciences, Zahleh, Lebanon. Key words: Germplasm, microsatellite markers, morphological descriptors, poly­ morphism, principal component analysis. Abstract: Lebanon has ancient mulberry trees which are the remnants of the abundant orchards that dominated its lands during the nineteenth century. Lebanese mulberry germplasm has not been assessed yet. This study aims to collect local old rainfed mulberry accessions from different geographical regions and assess their diversity by using morphological and molecular mark­ ers (SSR and ISSR). Genetic diversity of 70 accessions of mulberry were evaluat­ ed by using 27 morphological traits. The dendrogram based on the morphologi­ cal attributes showed a relative separation of the different accessions based on fruits color and taste. Molecular analysis was performed for the accessions by using selected SSR and ISSR primers. The primers marked a high discriminating power (0.7 to 0.89). The dendrogram constructed on the base of UPGMA method showed 13 different groups. The clustering patterns indicated no loca­ tion nor local name specificity among mulberry accessions. The combination of SSR and ISSR primers was informative for estimating the extent of mulberry genetic diversity. It can be concluded that there is a high level of genetic diver­ sity within mulberry trees in Lebanon. These results will be useful for mulberry germplasm management in terms of biodiversity protection and as a valuable source of gene pool for crop improvement. 1. Introduction Mulberry belongs to the genus Morus of the family Moraceae. It is a (*) Corresponding author: alichehade@hotmail.com Citation: KADRI A., SALEH S., ELBITAR A., CHEHADE A., 2021 ­ Genetic diversity assessment of ancient mulberry (Morus spp.) in Lebanon using morpho‐ logical, chemical and molecular markers (SSR and ISSR). ­ Adv. Hort. Sci., 35(3): 243­253 Copyright: © 2021 Kadri A., Saleh S., Elbitar A., Chehade A. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 24 March 2020 Accepted for publication 10 June 2021 AHS Advances in Horticultural Science https://doi.org/10.36253/ahsc-8376 http://www.fupress.net/index.php/ahs/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ http://creativecommons.org/licenses/by/4.0/ Adv. Hort. Sci., 2021 35(3): 243­253 244 multipurpose tree with a significant ecological, nutri­ tional and economical high value. Mulberries are highly adaptable species in different soil and climatic conditions. They are generally quite tolerant to drought, pollution and poor soil. Therefore, they can be found in a wide area of tropical, subtropical, and temperate zones in Asia, Europe, North America, South America, and Africa (Kafkas et al., 2008). The genus Morus regroups 24 species (Thabti et al., 2014). The most widespread species in the Mediterranean climate areas are: Morus alba with fruit colors ranging from white to dark red, Morus rubra with mainly red/purple fruits and Morus nigra with dark purple to black fruits (Gerasopouls and Stravroulakis, 1997). Mulberry fruits have remarkable potential for pro­ viding various valuable industrial products of high economic value for human beings. They are used for direct fruit consumption (Morus alba, Morus indica, Morus nigra, and Morus laevigata). Most of mulberry species have distinct flavor with juicy and acidic char­ acteristics making them attractive for use in the pro­ cessing industry for products such as fruit juice, ice cream, jelly, and jam (Ercisli and Orhan, 2007). Interest in mulberry has increased considerably over the last 20 years as a healthy fruit. Morus species have great antioxidant potential due to their high content in phenolic compounds including flavonoids, anthocyanins, and carotenoids (Zhang and Ma, 2018). Mulberries present anticancer and anti­inflam­ matory properties and show as well significant effect on many chronic diseases like diabetes (Nakamura et al., 2009; Kwon et al., 2015; Qian et al., 2015). Mulberry is an economically important plant used for sericulture. It is the sole food plant for the domesticated silkworm, Bombyx mori (Zhao et al., 2009). The genus Morus, is cultivated extensively in East, Central and South Asia for silk production (Awasthi et al., 2004). Hence, mulberry is one of the most important components that decide the sustain­ ability of this industry (Liu et al., 2009). At the turn of the century, Lebanon was known for its high­quality silk industry. Bestowed with an ideal climate and a fertile soil, mulberries were plant­ ed everywhere in Lebanon and mulberry production flourished (Firro, 2009). The silk tradition in Lebanon is more than two thousand years old. It goes back to the period of the famous purple dye (Ourjouan) extracted from the Murex shell by the Phoenicians of Sidon and Tyre and used to produce imperial purple silk (Khater, 2009). In the 19th century, silk industry constituted almost 80% of Lebanon’s economy. By the early 20th century, 70% to 80% of the cultivable land of the country mountainous regions (Mount Lebanon) became devoted to mulberry orchards. Due to the high demands in silk production, mulberry tree has an unsurpassed economic impact on rural com­ munities. After 1940’s, when silk began to be import­ ed from the Far East, the sericulture industry declined sharply. Mulberry cultivation became mar­ ginalized. However, Lebanon still has very old rainfed mulberry trees which are the remnants of the abun­ dant orchards that were once shaping the landscape of many villages. Mulberry trees are found in differ­ ent Lebanese villages, mostly located at orchards periphery or in small gardens. In Lebanon, mulberry genotypes are very diverse, as they were sometimes obtained in the past from seeds or from cuttings. This process has led to a great number of landraces adapted to different conditions and different uses throughout the country. In Lebanon, there are many local traditional accessions but no named cultivars. Mulberries are distinguished and denominated according to the fruit color: “Abyad” (white mulberry), “Mwachah” (purple mul­ berry), “Shami” and “Aswad” (black mulberries). Mulberry genetic diversity is progressively being lost in farmers’ fields and in nature. The threat results from the interaction of several factors and is processing at an alarming rate. The most crucial fac­ tors are urbanization, climatic changes, out breaks of new diseases and pests, and the frequent occurrence of natural calamities. Little information is available about the genetic diversity of Lebanese mulberries. To protect mulberry in Lebanon, a marginalized species, conservation programs should be initiated. In this study, we have collected local mulberry acces­ sions from different geographical regions of Lebanon and assessed their genetic diversity by using agro­ morphological traits as well as molecular markers (SSR and ISSR). 2. Materials and Methods Field survey Samples of fruits for morphological and chemical analyses were collected from local trees of mulberry Morus from 21 sites covering different Lebanese regions (the North plain, Bekaa plain, Mount Kadri et al. ‐ Genetic diversity assessment of mulbery in Lebanon 245 Lebanon, the South). These sites are subjected to dif­ ferent climatic conditions (precipitation, tempera­ ture) and agricultural practices. They are situated at an altitude between 30 and 1620 m, a latitude rang­ ing from N33° 16’ 166” to N34° 21 ‘51.5” and a longi­ tude between E36°10’ 849” and E35° 01’ 38.7” (Fig. 1). The number of individual trees sampled per site (population) ranged from two to sixteen cultivars. In total, 70 accessions of mulberry were studied. Collected samples consisted of mature fruits (approx­ imately 500 g) and vegetative materials (young leaves, mature leaves and branches). The studied accessions included ‘Abyad’ (white mulberry), ‘Mwachah’ (purple mulberry), ‘Shami’ and ‘Aswad’ (black mulberries). Morphological and chemical characterizations The characterization of the vegetative materials and the fruits was based on descriptors for investiga­ tion of mulberry germplasm’s morphology produced by Agriculture and Consumer Protection FAO (Sohn, 2003). Thus 27 morphological characters were stud­ ied for the mulberry accessions. These studied traits included 13 qualitative characters (for the leaf: shape, margin, base, apex, surface, color, glossiness, phytotaxis, bud shape and color; for the fruit parts: shape, color, taste, seed color) and 14 quantitative characters (for the vegetative parts: leaf length, width and thickness, petiole length, bud length, internode length; for the fruit parts: fruit length, diameter and weight, peduncle length, juice percent­ age (volume of the juice*100/weight of the fruits), sugar quantity (using refractometer), pH and acidity (by titration reaction). Molecular characterization DNA extraction. Genomic DNA was extracted from mulberry young fresh leaves using cetyl trimethyl ammonium bromide (CTAB) procedure described by FAO/IAEA (2007). The DNA quantity and quality was visually quantified using the agarose gel elec­ trophoresis method as described by Maniatis et al. (1982). DNA samples were stored at ­20°C. PCR amplification of the DNA with ISSR primers. Six primers (UBC807, UBC810, UBC826, UBC827, UBC864 and BI3) were tested for DNA amplification (Emir, 2013). The ISSR (Inter Simple Sequence Repeat) amplification was carried out as per Vijayan and Chatterjee (2003) using 20 µl reaction mixture containing 2 µl of 10 X PCR buffer (750 mM Tris­HCl pH 8.8; 0.1% Tween­20), 0.2 mM dNTP, 2 Mm MgCl2, 200 nM Primer, 50 ng genomic DNA and 1 U Taq DNA polymerase (MBI Fermentas Inc, Hanover, MD­ 21076, USA). The PCR schedule included an initial cycle at 94°C for 2 min followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, 72°C for 2 min and a final extension of 10 min at 72°C. The PCR products were resolved by electrophoresis on a 1.5% agarose gel in 1 X Tris Boric Acid buffer (TBE), stained with ethidium bromide (0.5 μg/ml) and visualized under UV light. PCR amplification of the DNA with SSR primers. Microsatellite polymorphisms were identified using three SSR primers (primers: MulSTR1, MulSTR2 and MulSTR3) (Tikader et al., 2009). Microsatellite ampli­ fication reactions were performed in a final volume of 25 µL in the presence of 2.5 µl of buffer, 200 µM of each dNTP, 0.4 µM of each primer pair, 1 unit (U) of Taq DNA polymerase, 50 ng template DNA, and 2 mM MgCl2. The amplification reaction consisted of an initial denaturation step at 94°C for 4 min, followed by 45 cycles of 1 min denaturation at 94°C, 65 sec annealing at 50°C, 90 sec extension at 72°C with a final extension of 72°C for 10 min using thermal cycles. The PCR amplification products were separat­ ed on a 6% denatured polyacrylamide gel and visual­ ized by silver staining. Data analysis For qualitative traits, scores were attributed Fig. 1 ­ Geographic distribution of the studied mulberry acces­ sions as visualized with DIVA­GIS program (Hijmans et al., 2001). Adv. Hort. Sci., 2021 35(3): 243­253 246 according to FAO mulberry descriptors. A phenotypic diversity index, hsj (Shanon index) (Magurran, 1988) was calculated for each site to describe the pheno­ typic diversity of mulberry. The following formula was used for calculating hsj for each trait with n cate­ gories hsj=Ʃ PiLnPi where pi is the relative frequency in the ith category for the jth trait. The average diver­ sity (H) over k traits of each site was estimated as: H=Ʃ hsj/k. Traits evaluation was performed by using the Principal Component Analysis (PCA). The relation­ ships between mulberry leaves and fruits based on their quantitative and qualitative traits were studied using Hierarchical Cluster Analyses executed using Euclidean Distance following the Ward’s method implemented in PAST software (Hammer et al., 2001). To assess the information given by SSR and ISSR markers, the following parameters were calculated: number of alleles per locus, percentage of observed heterozygosity (Ho), expected heterozygosity (He= 1­ Σpi2, where pi is the frequency of the ith allele) and the power of discrimination (PD = 1 ­Σgi2, where gi is the frequency of the ith genotype). Genetic distances were calculated according to Jaccard (1908). Trees were produced by clustering the data with the unweighted pair­group method (UPGMA) with SAHN­ clustering and tree programs of PAST software (Saporta, 1990). 3. Results Mulberry trees were distributed over various agro­climatic areas of Lebanon (Fig. 1, Table 1). A total of 70 mulberry accessions were studied belong­ ing to ‘Abyad’ (22 accessions), ‘Mwachah’ (25 acces­ sions), ‘Shami’ (20 accessions) and ‘Aswad’ (3 acces­ sions). Among mulberry species found in Lebanon, Morus alba was the dominant species in cultivation (95%). Around 85% of the surveyed mulberry trees were rainfed, old and inherited from family. Morphological analysis Leaves morphological characterization. Mulberry trees tend to have short trunks with large, low, spreading limbs. Leaves were alternately arranged and simple. The majority of cultivars had a cordate leaf shape, except the leaves of two accessions were reniform (‘Abyad’ and ‘Shami’) and two other were cordate to oval (‘Abyad’ and ‘Mwashah’). All leaves Table 1 ­ Climatic and geographic characteristics of the 21 locations surveyed to characterize the Lebanese mulberry trees Site Latitude (N) Longitude (E) Altitude (m) Annual average temperature (°C) Annual Rainfalls (mm) Varieties Number of accessions Douris 33°59'588" 36°10'849" 1131 14.9 441 Abyad Mwachah 4 Rayak 33°51'751" 35°59'591" 927 15.1 544 Aswad 2 Nabishet 33°52'10.4" 36°06'34.7" 1233 13.6 570 Abyad Mwachah Sami 6 Jenta 33°51'23.5" 36°06'26.2" 1114 13.2 580 Abyad Mwachah 2 Britel 33°56'02" 36°08'54.3" 1154 14.7 471 Abyad Mwachah Shami 4 El borjein 33°39'27.2" 35°29'11.3" 1620 12.7 630 Shami 1 Baassir 33°39'30.1" 35°26'54.7" 1094 12.9 630 Abyad Mwachah Shami 2 Hawsh Nabi 33°55'28.6" 36°04'23.8" 990 15.2 544 Abyad Mwachah 2 Hawsh Refaa 33°55'23.7" 36°02'34.2" 971 15.1 530 Abyad Mwachah 5 Kfar Dabash 33°56'43.2" 36°02'13.7" 1079 15.1 540 Abyad Mwachah 1 Chmistar 33°57'49.6" 36°01'07" 1145 14.9 550 Shami 2 Beit Chama 33°55'07" 36°01'25" 1011 15.2 541 Abyad Mwachah 1 Tamnen taata 33°52'43.3" 35°59'45.9" 937 15.1 542 Abyad Mwachah 1 Chlifa 34°05'109" 36°06'098" 1012 14.7 461 Abyad Mwachah Shami 5 Flaoue 34°04'934" 36°03'761" 1139 14.6 461 Abyad Mwachah Shami 3 Dayr Lahmar 34°07'077" 36°07'940" 1012 14.5 461 Baladi 1 Zahle 33°48'59.9" 35°57'32.6" 882 15.2 646 Abyad Mwachah Shami 5 Ali ennahry 33°51'21.04" 35°01'38.7" 958 15.1 544 Shami 1 Sour 33°16'166" 35°13'133" 30 20.2 697 Abyad Mwachah Shami 4 Kfar Chakhna 34°21'51.5" 35°51'50.7" 198 13.9 754 Shami 2 Hasbaiya 33°32'74" 35°64'373" 467 15.1 590 Abyad Mwachah Shami 16 Kadri et al. ‐ Genetic diversity assessment of mulbery in Lebanon 247 had dentate margins. They presented mainly a cor­ date base and an acute apex. Leaf surface of 70% of the accessions was slightly rough. Only nine acces­ sions of ‘Shami’ presented rough surfaces. Leaves generally presented an average length between 6.83 and 18.9 cm and width between 3.94 and 17.02 cm. Petiole length average was between 0.72 and 5.07 cm. Leaves of black mulberry acces­ sions ‘Shami’ (0.02 and 0.03 cm) were thicker than those of white mulberries (0.01 cm). Fruits morphological characterization. For the 70 accessions, the pomological characteristics investi­ gated showed a great diversity. Concerning the fruit shape, 35.7% of the mulberry fruits had oblong shape, 27.1% were round, 24.2% were reniform, and 13% were oval. For the local variety ‘Mwashah’, near­ ly half of the accessions had oblong shape while the majority of ‘Shami’ had round one. White mulberry ‘Abyad’ presented mainly oblong and reniform shape. The accessions showed significant differences in the fruit weight ranging from 1.1 g (‘Abyad’ from Doris) to 7.9 g (‘Mwashah’ from Hawshrefaa). Fruit length varied from 1.7 (‘Shami’ from Flewa) to 4.9 cm (‘Mwashah’ from Hawshrefaa­Bekaa) and fruit width from 1.1 (‘Abyad’ from Doris) to 2 cm (‘Shami’ from Baaser). Minimum length of fruit peduncle was 0.11 (‘Shami’ from Flewa) and maximum length 1.28 cm (‘Aswad’ from Tyr). Fruit color of mulberry accessions was diverse: ‘Abyad’ accessions were white and ‘Mwachah’ acces­ sions were violet. The fruit color of ‘Shami’ acces­ sions were darker and varied between red­purple to black or black. Seed color varied between light yellow and yellow­brown; ‘Mwashah’ fruits had mainly light yellow seeds and ‘Shami’ presented yellow­brown seeds. The percentage of juice yields differed within the accessions of the same local variety. The lowest and greatest juice yields varied from 30.1% (‘Abyad’ from Nabishit) to 72.3% (‘Shami’ from Baaser) and 73.1% (‘Abyad’ from Shlifa). As for the chemical characteris­ tics of mulberry accessions, sugar content ranged from 7 (‘Mwashah’ from Janta) to 19.5 Brix (‘Aswad’ from Tal Amara). pH varied widely from 2.29 (‘Abyad’ from Hasbaya) to 6.42 (‘Abyad’ from Douris). Titrable acidity was very diverse in the different mulberry accessions. Titrable acidity values were from 0.01 (‘Mwashah’ from Zahle) to 0.14 g/l (‘Shami’ from Flewa). Morphological characterization PCA The characterization of the collected mulberry accessions using different morphological characters showed high level of variation among the accessions. The Principal Component Analysis (PCA) revealed that the first 3 components explained 37% of the total variation, based on the 27 morphological char­ acters (Table 2). The first component represented 18 % of the total variation and included fruit and leaves characteristics. It comprised fruit length, color, taste, pH, acidity and peduncle length, besides to the peti­ ole length, glossiness and thickness of leaves. The second component represented 10% of the total vari­ ation and is mainly influenced by leaf width. The third component was characterized by a percentage of variation of 9% and is dominated by the bud length character. Table 2 ­ Principal component analysis (PCA) of the 27 morpho­ logical characters evaluated for the 70 different mulber­ ry accessions. The characters in bold are discriminant Variables Factor 1 Factor 2 Factor 3 Fruit length ­0.622011 ­0.428543 0.385704 Fruit weight ­0.422828 ­0.548276 0.534493 Fruit diameter ­0.279504 ­0.469198 0.362977 Peduncle Length ­0.639179 ­0.10646 ­0.393485 Percentage of 0.126663 0.055644 0.121337 sugar quantity 0.050968 ­0.124287 ­0.168429 pH ­0.720232 0.290375 0.027219 Acidity 0.605034 ­0.131547 0.165099 Leaf length ­0.014178 ­0.543281 ­0.48354 Leaf width ­0.038798 ­0.719527 ­0.23667 Petiole length ­0.700726 ­0.161604 ­0.190875 Leaf thickness ­0.739758 ­0.294618 0.241539 Date of maturity ­0.085013 ­0.253214 0.241209 Bud length 0.069769 ­0.177441 ­0.629778 Bud width 0.136856 ­0.265182 ­0.59383 Bud shape ­0.192576 0.061054 ­0.048574 Internodal distan­ ­0.141876 ­0.525259 ­0.327898 Leaf shape ­0.109165 ­0.008143 ­0.223988 Leaf base ­0.074223 0.208101 0.302694 Leaf apex 0.007149 ­0.251893 ­0.077977 Leaf surface ­0.50104 0.446809 ­0.164365 Leaf color ­0.260375 ­0.135751 0.031335 Leaf glossiness 0.670155 0.023403 ­0.053846 Fruit shape ­0.498979 ­0.040292 0.105085 Fruit color ­0.6271 0.204057 ­0.072799 Fruit taste 0.663459 0.058647 0.089481 Seed color ­0.210256 ­0.238095 0.409438 Exp.Var 4.797.858 2.719.786 247.986 Prp.Tot 0.177698 0.100733 0.091847 248 Adv. Hort. Sci., 2021 35(3): 243­253 Classification of accessions based on morphological attributes The accessions could be separated into groups based on the 11 most discriminant traits. The hierar­ chical cluster analysis classified mulberry accessions in 6 groups at ­6 similarity of Euclidean distance (Fig. 2, Table 3). ‘Shami’ accessions were classified separately into 3 main groups (G1, G4 and G5). The first group G1 included ‘Shami’ and 2 accessions of ‘Aswad’. G1, G4 and G5 accessions were characterized by a sour fruit taste and a dark black­purple or black­red fruit color. Fruits of G4 and G5 presented significantly the lowest pH mean values (3.78 and 3.85 respectively). G5 fruits presented the lowest sugar content (9.62 °Brix). Accessions of G4 and G5 had the shortest fruit length (2.32 cm and 2.45 cm respectively) and the shortest peduncle (0.24 cm and 0.46 cm respective­ ly). Regarding leaf characteristics, G4 and G5 acces­ sions were characterized by low mean value of leaf length, while G1 were characterized by a significantly high leaf length (17 cm). G1, G4 and G5 accessions had also the thickest limb (0.02 ­ 0.03cm) and the shortest peduncle (1.4 ­ 1.48 cm). The group G2 consisted of 12 accessions of ‘Abyad’ and one of ‘Mwashah’. These accessions were characterized by a white fruit color and a sweet taste. The group G3 consisted of 19 accessions of ‘Mwashah’ and 2 of ‘Shami’. They were characterized by purple fruits. They presented the highest value of fruit length (3 cm) and medium values for pH and Different letters were significantly different at the 0.05 level (Duncan's Multiple Range Test). Table 3 ­ Variability of the quantitative morphological fruit characteristics for the accessions clustered within the same group (G1, G2, G3, G4, G5 and G6) minimum, maximum and mean values (with standard deviation) Fig. 2 ­ Dendrogram of Jaccard distance based on the characters that presented high variability in the principle compo­ nent analysis, depicting the genetic relationship among the 70 different mulberry accessions. Group (number of accessions) Fruit length (cm) Fruit width (cm) Fruit weight (cm) Peduncle (cm) Percentage of juice (%) Sugar quantity (Brix) pH Acidity (g/l) 2.11< L<4.05 0.96< w <2.05 0.99< W <7.81 0.93< P <1.28 51.4< J <72.3 7< S<15 3.40.5. MulSTR3 presented higher polymorphism than MulSTR2, with a PD of 0.8 and an expected het­ erozygosity of 0.713. These two primers and especial­ ly MulSTR3 could be effectively used in genetic diver­ sity studies of mulberry. Classification of accessions based on molecular markers The allelic diversity data was used to produce a Table 4 ­ Primer sequences, number and sizes (bp) of the produced bands and discriminating power (Dp) of the six ISSR markers used in the study Primers Sequence Number of bands Band sizes (bp) Dp UBC­810 3´GAGAGAGAGAGAGAGAT 5´ 4 800­1500 0.80 UBC­807 3´AGAGAGAGAGAGAGAGT 5´ 5 900­1600 0.89 UBC­827 3´ACACACACACACACACAG 5´ 4 700­1700 0.85 BI3 3´ACACACACACACT 5´ 5 500­1500 0.75 UBC­826 3´ACACACACACACACACAC5´ ­ ­ ­ UBC­864 3´ ATGATGATGATGATGATG5´ ­ ­ ­ Table 5 ­ Primer sequences, number and sizes (bp) of the produced bands and discrimination power (Dp) of the three microsatellite markers used in the study Primers Sequence Number of bands Band sizes (bp) Dp MulSTR1 F: 5’GCCGTGTACCAGTGGAGTTTGCA 3’ ­ ­ ­ R:5’TGACCGTTTCTTCCACTTTACC­ MulSTR2 F:5´ CGTGGGGCTTAGGCTGAGTAGAGG 3 192­208 0.52 R:5´ CACCACCACTACTTCTCTTCTTCCAG MulSTR3 F: 5´ GGGTTGGGTAGATGGGCTTATGT­ 7 192­275 0.83 R:5´ CCCTATTAACTTTTTGGTCACCTCTA Adv. Hort. Sci., 2021 35(3): 243­253 250 dendrogram via the distance matrix­UPGMA (Fig. 3), thus revealing the genetic relationship among mul­ berry accessions. The dendrogram constructed on the base of the SSR and ISSR amplification product of the different mulberry accessions showed 14 differ­ ent groups at the Jaccard distance of similarity 0.34. Clusters G1, G2, G3, G5, G6 and G10 regrouped accessions of the three varieties ‘Mwashah’, ‘Shami’ and ‘Abyad’. G4 contained the three varieties as the previous groups in addition to an accession of ‘Aswad’. One single accession constructed individual­ ly the groups G7 (‘Shami’), G8 (‘Abyad’), G9 (‘Aswad’), G11 (‘Shami’) G12 (‘Abyad’), G13 (‘Mwashah’) and G14 (‘Abyad’). 4. Discussion and Conclusions The conservation of the genetic variability of the ancient Lebanese mulberry trees is of utmost impor­ tance for germplasm preservation and for future breeding programs. Lebanese mulberries germplasm has not been assessed yet. This study is the first genetic diversity assessment of the Lebanese mulber­ ry germplasm using a set of morphological traits and genetic markers. Our inventories recensed accessions of four vernacular names ‘Abyad’, ‘Mwachah’, ‘Shami’ and ‘Aswad’ across different Lebanese regions. This shows that a limited number of tradi­ tional varieties was cultivated since decades, howev­ er morphological and molecular characterization of these 70 accessions revealed high diversity of this germplasm collection. The results of morphological characterization revealed a high level of variation among mulberry characters. Among the 27 descriptors studied, 11 specific characters of fruits (Fruit taste, fruit length, fruit color, pH, titrable acidity and peduncle length) and leaves (petiole length, leaf thickness, leaf glossi­ ness, leaf width and bud length) revealed to be the most discriminating characters. The first component of the PCA was dominated by the fruit characteris­ tics. A broad morphological diversity of the fruit was reported for mulberry germplasm (Yilmaz et al., 2012; Peris et al., 2014; Aljane and Sdiri, 2016; Krishna et al., 2020). In our study, fruits exhibited dis­ tinct variations. Fruits shapes were diverse. Fruit color, titrable acidity, sugar content, juice yield and pH content were the most discriminating characters to differentiate mulberry accessions. Similar results were reported and significant differences were observed between the fruit characteristics (Yilmaz et al., 2012; Peris et al., 2014; Aljane and Sdiri, 2016; Krishna et al., 2020). Fruit color is a desirable charac­ ter for commercial acceptance of a variety. Fruit Fig. 3 ­ Dendrogram constructed from SSR and ISSR markers, using PAST program, Jaccard distance and UPGMA clu­ stering of 70 mulberry accessions. Kadri et al. ‐ Genetic diversity assessment of mulbery in Lebanon 251 color of our accessions varied from white, red, purple to black. The percentage of juice yields were within the limits of Yilmaz et al. (2012) study (between 39% and 72%). All black mulberries had the highest fruit juice yield ratio, the highest acidity values and the lowest sugar content. This is consistent with previous researches (Ozdemir and Topuz, 1998; Gunes and Cekic, 2004; Aljane and Sdiri, 2016). Therefore, black mulberries are preferred for processing into juice. Black colored mulberry species received recently a great importance due to higher contents of phenolic compounds and to their delicious taste (Aljane and Sdiri, 2016). The dendrogram constructed on the base of the most discriminant morphological characters divided the accessions into 6 distinct groups. The evaluation of the relationship among accessions reduced their differentiation to fruit color and taste. A non­negligi­ ble variability of other traits influenced the grouping involving the length of the fruit, leaf and peduncle. The accessions grouping was marginally correlated to the accessions vernacular names with many excep­ tions. The dendrogram revealed that accessions with­ in each cluster belonged to different regions suggest­ ing that there was no clear relationship between accessions and geographical diversity. This is the case of the group G4 that included ‘Shami’ accessions growing in North Lebanon (Kfarchakhna) and in South Lebanon (Sour). Such results have been report­ ed in different crops by several studies, e.g. on chest­ nut (Marinoni et al., 2013), almond (Chalak et al., 2007; Halasz et al., 2019) and olives (Chehade et al., 2015). This variability could be attributed to the free exchange of planting material between different Lebanese villages and emphasizes the adaptability of mulberry to different ecological conditions. In this study, we evaluated the genetic diversity and the relationships among the collected mulberry accessions using SSR and ISSR markers. The results showed high polymorphism in all the amplified loci. The power of discrimination values was high showing that the studied loci are of high diversity. The observed SSR markers heterozygosity were high. Earlier studies using amplified fragment length poly­ morphism (Sharma et al., 2000), ISSR (Awasthi et al., 2004), and RAPD (Xiang et al., 1995; Feng et al., 1996; Zhao and Pan, 2000; Esha and Shirish, 2001) also showed a large genetic variation among differ­ ent mulberry genotypes. Such a high level of poly­ morphism reflects the outcrossing nature of the species. In this work, the ISSR profiles generated by (AC) and (GA) repeat anchored primers showed that these repeats are abundant in our accessions. Vijayan and Chatterjee (2003) observed amplification of (AC) rich repeat based ISSR primers. Awasthi et al. (2004) concluded that (CA)/(TG) repeats are abun­ dant in Morus genome. Cluster analysis of SSR and ISSR data using UPGMA revealed high genetic distances between the studied accessions. Five groups were constructed by one single accession. The other clusters regrouped accessions of ‘Mwashah’, ‘Shami’ and ‘Abyad’ within each group. The distanced genetic relationships among mulberry accessions are in consistence with their high heterozygosity due to their out­ breeding reproductive system (Dandin, 1998). Accessions from different varieties and from different sites were grouped together. The molecular results emphasized that genetic diversity among mulberry accessions is not influenced by their geographical ori­ gin nor by their local names. This finding is in agree­ ment with other researchers who studied genetic diversity using SSR markers on different crops, almonds (Distefano et al., 2013), mung bean (Wang et al., 2018) and torch Ginger (Ismail et al., 2019). The analysis of the genetic parameters showed the high diversity of mulberry in Lebanon. The comparison between morphological and mol­ ecular diversity indicated that morphological descrip­ tors provide different information than the molecular one. In comparison with other works in woody species there were also no correlation. For example, two ‘Shami’ accessions (code B24 and HAS92) were in the same group in the morphological dendrogram however they belong to different groups in the mole­ cular one. One ‘Aswad’ (black mulberry, code B6) accession and another ‘Abyad’ (white mulberry, code B7) accession were in the same group in the molecu­ lar dendrogram but they were not in the morphologi­ cal one. It is probably that our markers sampled mainly a non­adaptive diversity. The results of this study revealed a large morpho­ logical diversity and a high genetic variation among the Lebanese mulberry accessions. The combination of SSR and ISSR primers was informative for estimat­ ing the extent of mulberry genetic diversity. Morphological and molecular clusters have distin­ guished different lines of mulberry which may help in the selection of the most diverse profile. This germplasm would enhance the local gene pool and expand genetic variation for mulberry breeding pro­ gram in the future. Adv. Hort. Sci., 2021 35(3): 243­253 252 Acknowledgements The authors would like to thank Dr. Michel Afram for his support. References ALJANE F., SDIRI N., 2016 ­ Morphological, phytochemical and antioxidant characteristics of white (Morus alba L.), red (Morus rubra L.) and black (Morus nigra L.) mul‐ berry fruits grown in arid regions of Tunisia. ‐ J. New Sci., 35(1): 1940­1947. AWASTHI A.K., NAGARAJA G.M., NAIK J.V., KANGINAKUDRU S., THANGAVELU K., NAGARAJU J., 2004 ­ Genetic diversity and relationships in mulberry (genus Morus) as revealed by RAPD and ISSR marker assays. ­ BMC Genet., 5: 1. CHALAK L., CHAHADE A., KADRI A., 2007 ­ Morphological characterization of cultivated almonds in Lebanon. ­ Fruits, 62(3): 1­13. CHEHADE A., EL BITAR A., KADRI A., CHOUEIRI E., NABBOUT R., YOUSSEF H., SMEHA M., AWADA A., AL CHAMI Z., DUBLA E., TRANI A., MONDELLI D., FAMIANI F., 2015 ­ In situ evaluation of the fruit and oil charac‐ teristics of the main Lebanese olive germplasm. ­ J. Sci. Food Agric., 96: 2532­2538. DANDIN S.B., 1998 ­ Mulberry a versatile biosource in the service of mankind. ­ Acta Sericol. Sin., 24: 109­113. DISTEFANO G., CARUSO M., LA MALFA S., FERRANTE T., DEL SIGNORE B., GENTILE A., SOTTILE F., 2013 ­ Genetic diversity and relationships among Italian and foreign almond germplasm as revealed by microsatellite mark‐ ers. ­ Sci. Hortic., 162: 305­312. EMIR J., 2013 ­ A novel and efficient protocol for the isola‐ tion of genomic DNA from mulberry (Morus L.). ­ Food Agric., 25: 124­131. ERCISLI S., ORHAN E., 2007 ­ Chemical composition of white (Morus alba), red (Morus rubra) and black (Morus nigra) mulberry fruits. ­ Food Chem., 103: 1380­ 1384. ESHA B., SHIRISH A.R., 2001 ­ Molecular distinction amongst varieties of Mulberry using RAPD and DAMD profiles. ­ BMC Plant Biol., 1: 3­11. FENG L.C., YANG G., YU M.D., KE Y., XIANG Z.H., 1996 ­ Studies on the genetic identities and relationships of mulberry cultivated species (Morus L.) via a random amplified polymorphic DNA assay. ­ Acta Sericologic Sinica, 22: 139­145. FIRRO K., 2009 ­ Silk and Agarian changes in Lebanon (1860‐1914). ­ Int. J. Middle East Stud., 22: 151­169. GERASOPOULS D., STRAVROULAKIS G., 1997 ­ Quality char‐ acteristics of four mulberry (Morus sp) cultivars in the area of Chania, Greece. ­ J. Sci. Food Agric., 73: 261­ 264. GUNES M., CEKIC C., 2004 ­ Some chemical and physical properties of fruit of different mulberry species com‐ monly grown in Anatolia. ­ Turkey. Asian J. Chem., 16 (3): 1849­1855. HALASZ L., KODAD O., GALIBA G.M., SKOLA I., ERCISLI S., LEDBETTER C.A., HEGEDUS A., 2019 ­ Genetic variability is preserved among strongly differentiated and geo‐ graphically diverse almond germplasm: an assessment by simple sequence repeat markers. ­Tree Genet. Genome, 15: 12. HAMMER Q., HARPER D., RYAN P., 2001 ­ PAST: Paleontological statistics software package for educa‐ tion and data analysis. ­ Palaeontol. Electronica, 4(1): 9. HIJMANS R.J., CRUZ M., ROJAS E., GUARINO L., 2001 ­ DIVA‐GIS, Version 1.4. A geographic information sys‐ tem for the management and analysis of genetic resources data. Manual. ­ International Potato Center and International Plant Genetic Resources Institute, Lima, Peru. ISMAIL N.A., RAFII M.Y., MAHMUD T.M.M., HANAFI M.M., MIAH G., 2019 ­ Genetic Diversity of Torch Ginger (Etlingera elatior) Germplasm Revealed by ISSR and SSR Markers. ­ �BioMed Res. Int., 2019: 1­14. JACCARD P., 1908 ­ Nouvelles recherches sur la distribution florale. ­ Bull. Soc. Vaud. Sci. Nat., 44: 223­270. KAFKAS S., ÖZEN M., DOĞAN Y.B., ÖZCAN B., ERCIŞLI S., SERÇE S., 2008 ­ Molecular characterization of mulber‐ ry accessions in Turkey by AFLP markers. ­ Sci. Hortic., 133: 593­597. KHATER A., 2009 ­ “House” to “Goddess of the House”: Gender, Class, and Silk in 19th‐century Mount Lebanon. ­ Int. J. Middle East Stud., 28: 325­348. KRISHNA H., SINGH D., SINGH R.S., KUMAR L., SHARMA B.D., SAROJ P.L., 2020 ­ Morphological and antioxidant characteristics of mulberry (Morus spp.) genotypes. ­ J. Saudi Soc. Agric. Sci., 19: 136­145. KWON Y.H., BISHAYEE K., RAHMAN A., HONG J.S., LIM S., HUH S., 2015 ­ Morus alba accumulates reactive oxy‐ gen species to initiate apoptosis via foxo‐caspase 3‐ dependent pathway in neuroblastoma cells. ­ Mol. Cells., 38(7): 630­637. LIU J.F., MAUZERALL D.L., HOROWITZ L.W., GINOUX P., FIORE A., 2009 ­ Evaluating intercontinental transport of fine aerosols, global aerosol distribution and optical depth. ­ Atmos. Environ., 1: 14. MAGURRAN A.E., 1988 ­ Ecological diversity and its mea‐ surement. ­ Croom Helm, London, UK, pp. 179. MANIATIS T., FRITSCH E.F., SAMBROOK J., 1982 ­ Molecular cloning: A laboratory manual. ­ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, pp. 545. MARINONI D., AKKAK A., BETRAMO C., GUARALDO P., BOCCACCI P., BOUNOUS G., FERRARA A.M., EBONE A., VIOTTO E., BOTTA R., 2013 ­ Genetic and morphological characterization of chestnut (Castanea sativa Mill.) javascript:void(0) javascript:void(0) javascript:void(0) javascript:void(0) javascript:void(0) Kadri et al. ‐ Genetic diversity assessment of mulbery in Lebanon 253 germplasm in Piedmont (north‐western Italy). ­ Tree Genet Genomes, 9: 1017­1030. NAKAMURA M., NAKAMURA S., OKU T., 2009 ­ Suppressive response of confections containing the extractive from leaves of Morus alba on postprandial blood glucose and insulin in healthy human subjects. ­ Nutr Metab (Lond), 6: 29. OZDEMIR F., TOPUZ A., 1998 ­ Some chemical composition of mulberries grown in Antalya. ­ Derim, 15(1): 30­35. PERIS N.M., GACHERI K.M., THEOPHYLLUS M.M., LUCAS N., 2014 ­ Morphological characterization of mulberry (Morus spp.) accessions grown in Kenya. ‐ Sustain. Agric. Res., 3(1): 10. QIAN Z., WU Z., HUANG L., QIU H., WANG L., LI L., YAO L., KANG K., QU J., WU Y., LUO J., LIU J. J., YANG Y., YANG W., GOU D., 2015 ­ Mulberry fruit prevents LPS‐induced NF‐κB/pERK/MAPK signals in macrophages and sup‐ presses acute colitis and colorectal tumorigenesis in mice. ­ Sci Rep., 5: 17348. SAPORTA G., 1990 ­ Simultaneous analysis of qualitative and quantitative data . Atti della XXXV Riunione Scientifica. ­ Societa Italiana di Statistica, 14: 63­72. SHARMA A., SHARMA R., MACHII H., 2000 ­ Assessment of genetic diversity in a Morus germplasm collection using fluorescence‐based AFLP markers. ‐ Theor. Appl. Genet., 101: 1049­1055. SOHN K.W., 2003 ­ Conservation status of sericulture germplasm resources in the world. Conservation status of Mulberry (Morus spp.) genetic resources in the world. ­ Agriculture and Consumer Protection FAO, 43: 11. THABTI I., ELFALLEH W., TLILI N., ZIADI M., CAMPOS M.G., FERCHICHI A., 2014 ­ Phenols, flavonoids, and antioxi‐ dant and antibacterial activity of leaves and stem bark of Morus species. ­ Int. J. Food Prop., 17: 842­854. TIKADER A., VIJAYAN K., KAMBLE C.K., 2009 ­ Conservation and management of mulberry germplasm through bio‐ molecular approaches. ­ Biotech. Mol. Biol. Rev., 3(4): 92­104. VIJAYAN K., CHATTERJEE S.N., 2003 ­ SSR profiling of Indian cultivars of mulberry (Morus spp.) and its relevance to breeding programs. ­ Euphytica, 131: 53­63. WANG L., BAI P., YUAN X., CHEN H., WANG S., CHEN X., CHENG X., 2018 ­ Genetic diversity assessment of a set of introduced mung bean accessions (Vigna radiata L.). ­ Crop J., 6(2): 1­7. WANI S.A., BHAT M.A., MALIK G.N., ZAKI F.A., MIR M.R., WANI N., BHAT M.K., 2013 ­ Genetic diversity and rela‐ tionship assessment among mulberry (Morus spp.) genotypes by simple sequence repeat (SSR) marker pro‐ file. ­ Afr. J. Biotechnol., 12: 3181­3187. XIANG Z., ZHANG Z., YU M., 1995 ­ Preliminary report on the application of RAPD in systematics of Morus. ­ Acta Sericologic Sinica, 21: 208­213. YILMAZ K.U., ZENGIN Y., ERCISLI S., DEMIRTAS M. N., KAN T., NAZLI A.R., 2012 ­ Morphological diversity on fruit characteristics among some selected mulberry geno‐ types from Tukey. ­ J. Anim. Plant Sci., 22: 211­214. ZHANG H., MA Z.F., 2018 ­ Phytochemical and pharmaco‐ logical properties of Capparis spinosa as a medicinal plant. ­ Nutrients, 10(2): 116. ZHAO W.G, FANG R., PAN Y.L., YANG Y., CHUNG G.W., CHUNG M., PARK Y.J., 2009 ­ Analysis of genetic rela‐ tionships of mulberry (Morus L.) germplasm using sequence‐related amplified polymorphism (SRAP) markers. ­ Afr. J. Biotechnol., 8: 2604­2610. ZHAO W.G, PAN Y.L., 2000 ­ RAPD analysis for the germplasm resources of genus mulberry. ­ Acta Sericologic Sinica, 4: 1­8. https://www.ncbi.nlm.nih.gov/pubmed/?term=Qian%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Wu%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Huang%20L%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Qiu%20H%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20L%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Li%20L%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Yao%20L%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Kang%20K%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Qu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Wu%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Luo%20J%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20JJ%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20W%5BAuthor%5D&cauthor=true&cauthor_uid=26615818 https://www.ncbi.nlm.nih.gov/pubmed/?term=Gou%20D%5BAuthor%5D&cauthor=true&cauthor_uid=26615818