Layout 1
INTRODUCTION
Cyanobacterial harmful algal blooms represent one of
the most conspicuous waterborne microbial hazards to
freshwater and marine ecosystems (Codd et al., 2005;
Paerl et al., 2011). This hazard results from the production
of cyanotoxins, harmful secondary metabolites, which can
have deleterious effects within reservoirs and in down-
stream receiving water systems during releases (Paerl and
Otten, 2013). Harmful cyanobacterial blooms have in-
creased globally in frequency and intensity in recent
decades. Eutrophication and warmer temperatures are
often cited as key factors which promote these events
(Hudnell and Dortch, 2008; Paerl and Huisman, 2008;
Gkelis et al., 2014). In Greece, the warm Mediterranean
climate favors cyanobacterial blooms in eutrophic waters,
which may start in spring and last until December; in-
creased temperatures due to global warming may further
enhance cyanobacteria dominance and promote toxic over
non-toxic strains (Gkelis et al., 2014).
After the elucidation of cyanotoxins genes clusters,
several studies have applied molecular methods for mon-
itoring the presence of toxic cyanobacteria and the genes
involved in the biosynthesis of cyanotoxins (Hisbergues
et al., 2003; Vasconcelos et al., 2010; Gkelis and Zaout-
sos, 2014). Furthermore, molecular methods based on 16S
rRNA gene amplification are widely employed for the
analysis of natural samples and/or monitoring freshwaters
(Kormas et al., 2011; Loza et al., 2013).
Bottled water can come from a variety of sources in-
cluding natural aquifers, springs, glacier run-off, and mu-
nicipal water supplies, and these sources could potentially
be contaminated with microcystins (CFIA, 2011). To our
knowledge, only two studies on levels of microcystins in
bottled water have been published. Those studies, per-
formed in Italy (Ferretti et al., 2007) and Canada (CFIA,
2011; CFIA, 2012), analysed domestic bottled water sam-
ples for the presence of microcystins and nodularin, and
did not detect cyanotoxins. This work presents the results
of a small scale monitoring program for drinking natural
mineral water and highlights the necessity to initiate re-
search and possibly establish official monitoring pro-
grams in cases where similar results are obtained in order
to cope with the new demands for drinking water.
METHODS
Sample collection and preparation
The bottled natural mineral water originated from a
water source (250 m depth), which is located in the Pre-
fecture of Central Macedonia, Northern Greece (N:
40°15’4.88” and E: 22°32’12.71”) with a water tempera-
ture ranging between 16°C in winter and spring and 18°C
in autumn and summer. Water samples were collected
Advances in Oceanography and Limnology, 2017; 8(1): 87-91 ARTICLE
DOI: 10.4081/aiol.2017.6280
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License (CC BY-NC 4.0).
Can cyanobacteria infect underground water sources?
Indications from small scale monitoring of a natural drinking water source
Spyros Gkelis,1* Aristidis Vlamis1,2
1Department of Botany, School of Biology, Aristotle University of Thessaloniki, GR-541 24 Thessaloniki, Greece; 2Department of
Pharmacology, Veterinary School, University of Santiago de Compostela, Lugo 27002, Spain
*Corresponding author: sgkelis@bio.auth.gr
ABSTRACT
The expansion of harmful cyanobacterial blooms is of worldwide concern as they have increased globally in frequency and intensity
in recent decades. A cyanobacterial colony was found in a bottle of natural mineral water of a small water company in July 2012, which
led to a further examination for a period of five months (July-November 2012) of both the bottled filtered water and the originating
groundwater source (N. Greece) for the occurrence of Cyanobacteria. Cyanobacteria occurrence was monitored by microscopy and
cyanospecific 16S rDNA amplification; potentially toxic species occurrence was screened by mcyA gene (known to take part in the
MC-biosynthetic gene cluster) amplification. The highest abundance of cyanobacterial cells without the simultaneous presence of the
mcyA gene, was measured in July, in contrast to October when the presence of cyanobacteria was only identified by tracing cyanospecific
16S rDNA and the mcyA gene region in the underground water source. The results of this small scale monitoring program indicate the
potential existence of an emerging danger for human health in a relatively manageable product such as the bottled natural mineral water.
Key words: Microcystis; microcystin; bottled water; natural mineral water.
Received: 12 September 2016. Accepted: 16 March 2017.
No
n-
co
mm
er
cia
l u
se
on
ly
S. Gkelis and A. Vlamis88
monthly between July and December 2012 from two
drilling points (SUP1 and SUP2) used for the production
of bottled natural mineral water. The final product which
had undergone filtration was also sampled (bottled filtered
water-BF). Aliquots of these were preserved with both
Lugol’s solution (1% v/v) and formaldehyde (2% v/v).
Water samples were stored in polyethylene bottles and
transferred to the laboratory (<5 h) under cool and dark
conditions. Immediately upon reception in the laboratory,
1.5 L of water was filtered on a Whatman GF/C filters and
the filter was stored at -20°C for further analysis.
Phytoplankton analysis
Fresh and preserved samples were examined using an
inverted microscope (Olympus IX71) with phase-contrast.
Species were identified using Komárek and Anagnostidis
(1999). The abundance of cyanobacterial cells was deter-
mined in accordance with Utermöhl (1958), using 50 mL
sedimentation chambers, thus detection limit was 20 cells
L–1. Transepts were counted and the variation coefficient
was always kept under 20%. Phytoplankton abundance is
presented in number of cells L–1.
Molecular detection
DNA was extracted using the protocol described in
Atashpaz et al. (2010) for Gram negative bacteria, after
slicing the filters with a sterile scalpel. In order to identify
cyanobacteria and potentially MC-producing cyanobac-
teria we used two different sets of primers, respectively:
the 16S 27F (5’-AGAGTTTGATCCTGGCTCAG-3’)
/16S 1494R (5’- TACGGTTACCTTGTTACGAC -3’)
primer pair which amplifies a 1367-bp fragment of 16S
rDNA in all cyanobacteria (Neilan et al., 1997) and the
mcyA CD1F (5’- AAAATTAAAAGCCGTATCAAA-3’)
/mcyA CD1R (5’- AAAAGTGTTTTATTAGCGGCT-
CAT-3’) primer pair (Hisbergues et al., 2003), which was
designed to amplify a 297-bp fragment of the mcyA gene
from MC-synthesizing cyanobacteria strains and was pre-
viously proved to be suitable to detect MC-producing
cells from the genera Anabaena, Microcystis and, Plank-
tothrix (Hisbergues et al., 2003). Samples giving positive
results in this assay have been shown to have a high prob-
ability of producing MCs (Hisbergues et al., 2003; Vas-
concelos et al., 2010). We chose to detect a gene target
known to be involved in the biosynthesis of MC, as this
is the most frequent cyanotoxin in Greece (Gkelis and Za-
outsos, 2014; Gkelis et al., 2015b) and worldwide.
PCR was carried out on the DNA extracts using the
primer pairs presented previously. All PCR reactions were
prepared as described in Gkelis and Zaoutsos (2014).
Thermal cycling was carried out using an Eppendorf Mas-
terCycler Pro (Eppendorf). Amplification was performed
according to the protocols described by Neilan et al.
(1997) and Hisbergues et al. (2003) for 16S rRNA and
mcyA, respectively. DNA extracted from Microcystis
aeruginosa M6 strain (see Vasconcelos et al., 2010) was
used as positive control for the amplification of mcyA
gene target and water as negative control. PCR products
were separated by 1.5% (w/v) agarose gel in 1X TAE
buffer. The gels were stained with ethidium bromide and
photographed under UV transillumination.
RESULTS AND DISCUSSION
Cyanobacteria were detected by microscopy only in
the bottled sample BF/A, collected on the 5th of July 2012
(Tab. 1). A colonial form of Microcystis-like cyanobac-
teria was found, which could not be further identified
(Fig. 1). Cells were spherical with an average diameter
Tab. 1. Microscopic and molecular detection of cyanobacteria in the water samples collected during the study.
Sampling date Sample Microscopic analysis Μolecular analysis
Cells L–1 DNA Cyanobacteria 16S rRNA mcyA gene
05-07-12 SUP (1) - - - -
SUP (2) - - - -
BF/ A* 50,000 + + -
BF/ B - + + -
18-09-12 SUP (1) - - - -
SUP (2) - - - -
BF - - - -
31-10-12 SUP (1) - + + +
BF - + + -
29-11-12 SUP (1) - - - -
SUP (2) - + - -
BF - + - -
BF, Bottled filtered water; SUP (1), source underground water (old drill); SUP (2), source underground water-(new drill); *sample BF/ A is from the
same production line with BF/ B but sampled at a different time of the day.
No
n-
co
mm
er
cia
l u
se
on
ly
Cyanobacteria in underground water sources 89
of 8.53μm (n=30, min 6.54 μm, max 11.6 μm).
Cyanobacterial abundance in this sample was 50,000
cells L–1, whereas in BF/B, collected on the same day and
drilling source but at a different time, no cyanobacteria
cells were found (Tab. 1). No presence of cyanobacteria
was observed by microscopy in any of the other samples,
both bottled and from the underground water source. Al-
though the presence of algae and cyanobacteria in under-
ground habitats (Reisser, 2007) and the ability of soil and
deep subsurface cyanobacteria to actively follow a mov-
ing water pocket in order to exploit it (Garcia-Pichel and
Pringault, 2001) has been shown, to the best of our
knowledge this is the first report of planktonic cyanobac-
teria found in an underground drinking-water source. Re-
cently, Pazouki et al. (2016) demonstrated that
cyanobacteria can be found in water filtered through bank
filtration, especially species with cell size <10 μm, such
as the Microcystis cells. In our case the source of the
cyanobacterial colony we found remains unknown; how-
ever, it has been found that in the nearby River-Reservoir
System of Aliakmon-Polyphytos, Microcystis aeruginosa
can be dispersed in short distances through the wind
(Chrisostomou et al., 2009). Furthermore, airborne
cyanobacteria have been found in the nearby city of
Thessaloniki (Genitsaris et al., 2011). Nevertheless, since
the source of the cyanobacterial colony was not found
the possibility of opportunistic airborne contamination
during the bottling cannot be excluded.
DNA was below the detection limit in seven out of the
twelve samples analyzed (Tab. 1). A PCR product of about
1370 bp was obtained using the 16S 27F/16S 1484R
primer pair in four samples (including sample BF/A of
05-07-2012, where cyanobacteria were identified by mi-
croscopy). The 300 bp mcyA-Cd 1F/mcyA-Cd 1R primer
pair PCR product, indicating the presence of mcyA gene,
was identified only in one out of the twelve samples as-
sayed (Tab. 1). In the studied water source the highest
cyanobacterial abundance of 50.000 cells L–1 was ob-
served in July without the simultaneous presence of the
mcyA gene responsible for MC production. At the end of
October, however, the presence of cyanobacteria was only
traced through the detection of 16S rDNA as well as traces
of the gene mcyA. Similar results were reported by Davis
et al. (2009) in Lake Agawam in July where the presence
of toxic Microcystis cells did not coincide with the pres-
ence of MC and also in Lake Champlain where MCs were
detectable in October but without the presence of toxic
Microcystis cells at the same time. Gkelis and Zaoutsos
(2014) found that the mcyA region was amplified only
where Microcystis spp. were dominant and MC concen-
trations were >40 μg L–1. Conjointly, Gkelis et al. (2014)
in a 14-month monitoring of Lake Pamvotis found that
mcyA was amplified only in two samples, where Micro-
cystis aeruginosa was dominant, whereas mcyB and mcyE
regions were amplified in almost all samples.
Several studies report that cyanobacteria can produce
toxins at low temperatures but in combination with other
important factors such as presence of light and nutrients’
availability (Quiblier et al., 2013). The low temperatures
(max. 18°C) of the studied groundwater source together
with the absence of one of the genes responsible for
cyanobacterial toxicity (mcyA) in most of the samples
suggest that the detected cyanobacteria do not probably
constitute an important hazard for this specific source,
also due to the limited input of nutrients and the absence
of light. Nevertheless, since traces of the mcyA gene were
detected in one sample, there is still a possibility that MCs
could have been produced in the studied water source,
since cyanotoxins are intracellular toxins contained within
living cells (Sivonen and Jones, 1999) and cyanobacterial
cells were found in high abundances in one sample. In this
case, the biggest problem in bottled drinking natural min-
eral waters arises from the fact that the only treatment op-
tion in order to maintain the product type ‘Natural Mineral
Water’, is filtering, as filters can retain a big proportion
of the microalgae but not the potential toxins produced by
them resulting in human intoxication.
Our finding, although scarce, raises the question of
monitoring algae in underground water sources. At pres-
ent, none of the European countries have established mon-
itoring program for cyanotoxins in potable minerals waters
so far, and only some countries have done so for drinking
water such as Spain, France, the Czech Republic and
Poland (Burch, 2008). In Greece, there are very few offi-
cial monitoring programs in place (Kaloudis et al., 2013;
Gkelis et al., 2015a) for cyanobacterial blooms and toxins
produced in freshwaters, whereas there is also no legisla-
Fig. 1. Microphotograph of the Microcystis-like colony found
in the bottled filtered water BF/ A sample.
No
n-
co
mm
er
cia
l u
se
on
ly
S. Gkelis and A. Vlamis90
tion with regard to monitoring of these quality parameters
(Cook et al., 2005). Moreover, there are no legally estab-
lished maximum allowable concentrations for cyanotoxins
in potable mineral water. The only relevant reference is in
the National Hygienic Regulation A1β/4841/1979 (FEK
696/Β΄/1979), where the absence of microalgae is required
for bottled waters intended for human consumption. A very
small number of water treatment plants in Greece control
cyanobacterial growth, measure cyanotoxins or use water
treatments for toxin removal: The Athens Water Supply
and Sewerage Company implements some measures for
control and monitoring of cyanobacteria and cyanotoxins
(Kaloudis et al., 2013). Other water utilities are small, at a
local level, and they do not implement such measures, with
the possible exception of the Thessaloniki Water Supply
and Sewerage Company (Thessaloniki) (Kaloudis, per-
sonal communication).
CONCLUSIONS
The results of this small scale monitoring program
demonstrated for the first time the presence of cyanobac-
teria in bottled natural mineral drinking water. While it
seems unlikely that the use of bottled water would con-
stitute any major hazard with regard to cyanotoxin expo-
sure, our findings call for further research to investigate
the presence, heterotrophic growth and significance of
cyanobacterial colonies and/or biofilms in water distribu-
tion systems, such as wells.
ACKNOWLEDGMENTS
We thank Prof. Vitor Vasconcelos for providing freeze-
dried material of cyanobacteria strains used as positive con-
trol in PCR studies. AV would like to thank Dr. Panagiota
Katikou for providing useful information on cyanotoxins.
The authors acknowledge CYANOCOST-COST ES 1105
for sharing of knowledge and networking and thank the two
anonymous reviewers for helpful suggestions.
REFERENCES
Atashpaz S, Khani S, Barzegari A, Barar J, Vahed SZ, Azarbai-
jani R, Omidi Y, 2010. A robust universal method for extrac-
tion of genomic DNA from bacterial species. Microbiology
79:538-542.
Burch MD, 2008. Effective doses, guidelines and regulations.
In: H.K. Hudnell (ed.), Cyanobacterial harmful algal
blooms: State of the science and research needs. Adv. Exp.
Med. Biol. 610:831-854.
Canadian Food Inspection Agency (CFIA), 2011. Microcystins
in bottled water. Food Safety Action Plan Report. TS-
CHEM-10/11, pp. 1-8
Canadian Food Inspection Agency (CFIA), 2012. Microcystins
and nodularin in Bottled Water. Food Safety Action Plan Re-
port. TS-CHEM-11/12, pp. 1-8.
Chrisostomou A, Moustaka-Gouni M, Sgardelis S, Lanaras T,
2009. Air-dispersed phytoplankton in a Mediterranean
River-Reservoir System (Aliakmon-Polyphytos, Greece). J.
Plankton Res. 31:877-884.
Cook CM, Moustaka-Gouni M, Gkelis S, Lanaras T, 2005.
Greece: cyanotoxin risk assessment, risk management and
regulation, p. 69-75. In: I. Chorus (ed.), Current approaches
to cyanotoxin risk assessment, risk management and regu-
lations in different countries. Series WaBoLu 02/05.
Umweltbundesamt, Dessau.
Codd GA, Lindsay J, Young FM, Morrison LF, Metcalf JS,
2005. Harmful cyanobacteria: from mass mortalities to man-
agement measures, p. 1-23. In: J. Huisman, H.C.P. Matthijs
and P.M. Visser (eds.), Harmful cyanobacteria. Springer,
Dordrecht.
Davis TW, Berry DL, Boyer GL, Gobler CJ, 2009. The effects
of temperature and nutrients on the growth and dynamics of
toxic and non-toxic strains of Microcystis during cyanobac-
teria blooms. Harmful Algae 8:715-725.
Ferretti E, Lucentini L, Veschetti E, Bonadonna L, Stammati A,
Turco L, Ottaviani M, 2007. Screening and identification of
unknown contaminants in water destined to human con-
sumption: A case study. Microchem. J. 85:57-64.
Garcia-Pichel F, Pringault O, 2001. Cyanobacteria track water
in desert soils. Nature 412:380-381.
Genitsaris S, Kormas KA, Moustaka-Gouni M, 2011. Airborne
algae and cyanobacteria: occurrence and related health ef-
fects. Front. Biosci. 3:772-787.
Gkelis S, Chronis I, Kagalou I, 2015a. Monitoring a newly re-
born patient: Phytoplankton based water quality and cyan-
otoxin occurrence in a reconstructed shallow Mediterranean
lake. Proceedings ASLO Aquatic Sciences Meet., Granada.
Abstract ID27076.
Gkelis S, Lanaras T, Sivonen K, 2015b. Cyanobacterial toxic
and bioactive peptides in freshwater bodies of Greece: con-
centrations, occurrence patterns, and implications for human
health. Mar. Drugs 13:6319-6335.
Gkelis S, Papadimitriou T, Zaoutsos N, Leonardos I, 2014. An-
thropogenic and climate-induced change favors toxic
cyanobacteria blooms: Evidence from monitoring a highly eu-
trophic, urban Mediterranean lake. Harmful Algae 39:322-333.
Gkelis S, Zaoutsos N, 2014. Cyanotoxin occurrence and poten-
tially toxin producing cyanobacteria in freshwaters of
Greece: A multi-disciplinary approach. Toxicon 78:1-9.
Hisbergues M, Christiansen G, Rouhiainen L, Sivonen K,
Borner T, 2003. PCR-based identification of microcystin-
producing genotypes of different cyanobacterial genera.
Arch. Microbiol. 180:402-410.
Hudnell KH, Dortch Q, 2008. A synopsis of research needs iden-
tified at the interagency, International symposium on
cyanobacterial harmful algal blooms (ISOC-HAB). Adv.
Exp. Med. Biol. 619:17-43.
Kaloudis T, Zervou KS, Tsimeli K, Triantis T, Fotiou T, Hiskia
A, 2013. Determination of microcystins and nodularin
(cyanobacterial toxins) in water by LC–MS/MS. Monitoring
of Lake Marathonas, a water reservoir of Athens, Greece. J.
Hazard. Mat. 263:105-115.
Komárek J, Anagnostidis K, 1999. [Cyanoprokaryota 1. Teil:
No
n-
co
mm
er
cia
l u
se
on
ly
Cyanobacteria in underground water sources 91
Chroococcales], pp. 548. In: H. Ettl, G. Gärtner, H. Heynig,
and D. Mollenhauer (eds.), [Süsswasserflora von Mitteleu-
ropa 19/1].[Book in German]. Gustav Fischer Verlag, Jena.
Kormas KA, Gkelis S, Vardaka E, Moustaka-Gouni M, 2011.
Morphological and molecular analysis of bloom-forming
Cyanobacteria in two eutrophic, shallow Mediterranean
lakes. Limnologica 41:167-173.
Loza V, Perona E, Mateo P, 2013. Molecular fingerprinting of
cyanobacteria from river biofilms as a water quality moni-
toring tool. Applied Environ. Microbiol. 79:1459-1472.
Neilan BA, Jacobs D, Deldot T, Blackall LL, Hawkins PR, Cox
PT, Goodman AE, 1997. rRNA sequences and evolutionary
relationships among toxic and nontoxic cyanobacteria of the
genus Microcystis. Int. J. Syst. Bacteriol. 47:693-697.
Paerl HW, Hall NS, Calandrino ES, 2011. Controlling harmful
cyanobacterial blooms in a world experiencing anthro-
pogenic and climatic-induced change. Sci. Total Environ.
409:1739-1745.
Paerl HW, Huisman J, 2008. Blooms like it hot. Science 320:
57-58.
Paerl HW, Otten GT, 2013. Harmful cyanobacterial blooms,
causes, consequences, and controls. Microb. Ecol. 65:
995-1010.
Pazouki P, Prévost M , McQuaid N, Barbeau B, de Boutray M-
L, Zamyadi A, Dorner S, 2016. Breakthrough of cyanobac-
teria in bank filtration. Water Res. 102:170-179.
Quiblier C, Wood S, Echenique-Subiabre I, Heath M, Villeneuve
A, Humbert J-F, 2013. A review of current knowledge on
toxic benthic freshwater cyanobacteria-Ecology, toxin pro-
duction and risk management. Water Res. 47:5464-5479.
Reisser W, 2007. The hidden life of algae underground, p. 47-
58. In: J. Seckbach (ed.), Algae and cyanobacteria in ex-
treme environments. Springer, Dordrecht.
Sivonen K, Jones G, 1999. Cyanobacterial toxins, p. 113-153.
In: I. Chorus and J. Bartram (eds.), Toxic cyanobacteria in
water: A guide to their public health consequences, moni-
toring and management. World Health Organization, E &
FN Spon.
Utermöhl H, 1958. [Zur Vervollkommung der quantitativinen
phytoplankton-Methodik].[Article in German]. Int. Ver.
Theor. Angew. Limnol. 9:1-38.
Vasconcelos V, Martins A, Vale M, Antunes A, Azevedo J,
Welker M, Lopez O, Montejano G, 2010. First report on the
occurrence of microcystins in planktonic cyanobacteria from
Central Mexico. Toxicon 56:425-431.
No
n-
co
mm
er
cia
l u
se
on
ly