advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology layout 1 introduction research of algae in serbia began over 130 years ago, with the publication of ‘fragmenta phycologiae bosniaco-serbicae’ by scharschmidt (1883), who listed 46 algal species. the species were determined in samples of washed silt from herbarium specimens of the waterwheel plant (aldrovanda vesiculosa (l.)) collected by the famous lecturer and botanist, doctor josif pančić (blaženčić, 1986). over 50 species, mostly belonging to the green algae and cyanobacteria, were identified by magnus, simić and katić during the late 19th and early 20th centuries (milovanović, 1949). another notable name in this initial period of algal research was nedeljko košanin (blaženčić, 1986). world war i prevented further investigations of algae and cyanobacteria in serbia, however, during the 1930s and 1940s exploration continued in the form of complex hydrobiological studies. a bibliographic review of the few serbian algological studies until 1947 was presented by milovanović (1949). this period is also important because it can be seen as the cradle of almost all of the subsequent trends in algal research (blaženčić, 1986). after world war ii, favorable conditions for more advanced, and continuous studies in this scientific area were created. during this period, the spatial distribution, seasonal dynamics and ecology of algae and cyanobacteria were investigated in springs, streams, rivers, ponds, swamps, canals, lakes and mineral waters, i.e., in most aquatic ecosystems in serbia, which resulted in a wealth of data (blaženčić, 1986). since the 1970s the field of research has been expanding as methods and techniques have been modernized. an increasing number of hydrobiologists, microbiologists and botanists are providing their contributions to the study of cyanobacteria in serbia (blaženčić, 1985). undoubtedly the greatest contribution to the knowledge of algae and cyanobacteria has been given through the meticulous advances in oceanography and limnology, 2017; 8(1): 153-160 article doi: 10.4081/aiol.2017.6360 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). review of 130 years of research on cyanobacteria in aquatic ecosystems in serbia presented in a serbian cyanobacterial database zorica svirčev,1,2 nada tokodi,1* damjana drobac1 1department of biology and ecology, faculty of sciences, university of novi sad, trg dositeja obradovića 3, 21000 novi sad, serbia; 2department of biochemistry and pharmacy, faculty of science and engineering, åbo akademi university, tykistökatu 6 a, 20520 turku, finland *corresponding author: nada.tokodi@dbe.uns.ac.rs abstract the presence of toxic cyanobacteria in aquatic ecosystems in the territory of the republic of serbia was surveyed over a period of several decades. increasing attention is being paid to some negative consequences that may be caused by these microorganisms. information from available literary sources regarding the distribution and frequency of cyanobacteria and their toxins over a period of 130 years, together with the effects on humans and wildlife in aquatic ecosystems, were gathered and incorporated into a serbian cyanobacterial database created for the cyanocost action. this database encompasses information on 65 aquatic ecosystems, including rivers, lakes, ponds, canals, irrigation reservoirs, reservoirs used for drinking water supply and reservoirs used for other purposes. cyanobacterial blooms were found in almost 80% of the investigated aquatic ecosystems. the analysis of the research showed the presence of more than 70 species, including blooms of 24 species from 13 genera. five species of cyanobacteria: microcystis aeruginosa, aphanizomenon flos-aquae, planktothrix agardhii, microcystis flos-aquae and planktothrix rubescens frequently formed blooms in the investigated waterbodies and cyanotoxins were also detected in some of them, which had certain negative effects. here, we present an overview of data contained in the serbian cyanobacterial database, concerning cyanobacterial distribution, cyanotoxin production and associated biological effects in different types of water bodies from the republic of serbia. also, recent important and major cases of cyanobacterial blooming in reservoirs used for drinking water supply at vrutci and ćelije, the aleksandrovac irrigation reservoir, the ponjavica river and lake palić, including systematic research on the lake ludoš and few fishponds are further described. it can be concluded that cyanobacteria and cyanotoxins are omnipresent in different water bodies throughout the republic of serbia. for these reasons it is imperative to continue with the monitoring of cyanobacteria and cyanotoxins, as well as to continuously supplement the established database with new information. the serbian cyanobacterial database represents a treasury of information on cyanobacteria and their toxins, and serves as a model for other countries in the region and beyond. key words: cyanobacterial blooms; cyanotoxins; database; historical overview. received: 25 october 2016. accepted: 23 january 2017. non -co mmerc ial us e o nly z. svirčev et al.154 work of prof. jelena blaženčić who performed systematic analysis and assessment of numerous aquatic ecosystems in serbia. most recently, available data on the presence of cyanobacteria and their toxins in aquatic ecosystems in the republic of serbia were gathered and incorporated into the serbian cyanobacterial database (scdb) (https://cloud.pmf.uns.ac.rs/index.php/s/v6tervcvcauaxqn), as a result of the cyanocost action. the objective of the present paper was to analyze, present and supplement available data from scdb. data overview data on cyanobacterial occurrence, cyanotoxin production and the possible impact on humans and aquatic ecosystems in the republic of serbia were evaluated in over 70 data sources (tab. 1). a comprehensive review of research articles, project reports, conference abstracts, dissertations, books, annual and news reports was performed, and collected data were entered into the scdb. the analysis of the research showed that 65 different aquatic ecosystems had been investigated during the last 130 years. the microalgal and cyanobacterial research summarized in the scdb consisted of over 250 analyses, of which most (about 150) were conducted since the year 2000. these analyses included determination of cyanobacteria, cyanotoxin detection and the documentation of associated biological effects and health incidents (svirčev et al., 2014a). qualitative determination of cyanobacteria showed the presence of more than 70 species in the investigated aquatic ecosystems, with 24 species from 13 genera being recorded in blooms, the most frequent being microcystis aeruginosa (kützing), aphanizomenon flos-aquae ralfs ex bornet & flahaul, planktothrix agardhii (gomont) k. anagnostidis & j. komárek, microcystis flos-aquae (wittrock) kirchner and planktothrix rubescens (de candolle ex gomont) k. anagnostidis & j. komárek (svirčev et al., 2014a). all the latin genera and species names are taken from the original publications. for the currently accepted nomenclature of the species cited in this paper, refer to the supplementary tab. 1. cyanobacterial blooms were found in almost 80% of the investigated aquatic ecosystems. this paper summarizes their distribution, cyanotoxin production and associated biological effects in different types of waterbodies from the republic of serbia. canals the canals in the vojvodina region (kralja aleksandra canal and kralja petra canal) were explored during the 1930s, when a bloom of m. aeruginosa was recorded (protić, 1935). the cyanobacterium anabaena flos-aquae (dolichospermum flos-aquae (brébisson ex bornet & flahault) p. wacklin, l. hoffmann & j. komárek) also formed a mass occurrence in the kralja petra canal (protić, 1936). recently, most research was done on the canal danube-tisa-danube system where the presence of a common cyanotoxin, microcystin (mc), was detected. the highest concentrations (up to 347 µg l–1 mc-lr equivalents) were found in the autumn of 2006 at the locality of bačko gradište where the cyanobacterial species a. flos-aquae, aph. flos-aquae, m. aeruginosa, m. flosaquae and oscillatoria agardhii (planktothrix agardhii) occurred (simeunović, 2009). ponds very limited data are available on the occurrence of cyanobacteria and cyanotoxins in marsh-wetland ecosystems (jakovljević and stanković, 1931-1932; milovanović, 1970; pujin et al., 1987; maslać et al., 1992; subakov-simić et al., 2004; fužinato et al., 2010; cvijan and fužinato, 2011, 2012). recent data from 2006 showed the first ocurrence of the invasive and potentially toxic cyanobacterial species cylindrospermopsis raciborskii (woloszynska) seenayya & subba raju in slatina, a salt marsh pond (cvijan and fužinato, 2012). the presence of the cyanobacterial species m. aeruginosa in rakina bara (jakovljević and stanković, 1931-1932), aph. flos-aquae in carska bara (pujin et al., 1987) and arthrospira tab. 1. overview of the data in serbian cyanobacterial database (1930-2012). location cyanobacteria cyanotoxins biological effects reference canals (4) over 70 species found, microcystin (mc) artemia salina bioassay over 70 literature sources: ponds (7) frequently blooming: analyses: fish histopathology peer-reviewed papers (24) rivers (13) microcystis aeruginosa ppi animal mortality international documents fishponds (8) aphanizomenon flos-aquae elisa epidemiological survey (english) (10) reservoirs for irrigation (11) planktothrix agardhii hplc national documents lakes (6) microcystis flos-aquae detection in: (non-english) (40) reservoirs for drinking water planktothrix rubescens water newspaper/internet reports (3) supply (12) soil own document (1) reservoirs with other purposes (4) -plant tissues fish tissues non -co mmerc ial us e o nly research on cyanobacteria in serbia 155 fusiformis (voronikhin) j. komárek & j.w.g. lund in slatina (fužinato et al., 2010) causes some concerns as these species are known cyanotoxin-producers. rivers interestingly, there are a large number of data on cyanobacterial blooming in river ecosystems. one of the most publicized incidents happened in 2009 when the mortalities of fish and hundreds of cows and pigs which drank water from ponjavica, the river near the town of pančevo, occurred. the detected cyanobacterial species belonged to the genera anabaena, aphanizomenon, aphanocapsa, aphanothece, chroococcus, cylindrospermopsis, geitlerinema, jaaginema, limnothrix, microcystis, phormidium, planktothrix and raphidiopsis. during 2008 and 2009 in the ponjavica river, mcs (concentrations given as mc-lr equivalents in elisa) were detected in the water (up to 4.84 mg l–1), sediment (5.7 mg per 100 g), macrophytes (up to 5.0 mg per 100 g) and fish (up to 3.3 mg per 100 g), and the dominance of the invasive cyanobacterium cyl. raciborskii was found (karadžić, 2011; natić, 2012; karadžić et al., 2013). mcs may have contributed to the deaths of animals, however, the exact cause of death has not been determined. mcs were also found in rivers krivaja, tamiš, tisa and begej, with the maximum concentrations of 80, 33, 32 and 22 µg mc-lr equivalents l–1 respectively, where aph. flos-aquae, m. flos-aquae and o. agardhii bloomed (simeunović, 2009). these and other bloom-forming cyanobacteria, such as a. flos-aquae, m. aeruginosa and oscillatoria rubescens (planktothrix rubescens), were recorded in many rivers throughout the republic of serbia (obušković, 1982, 1987, 1989, 1991; sedmak and svirčev, 2011). fishponds research on the occurrence of cyanobacteria in fishponds began with the investigations of the ečka, kolut and živača fishponds where m. aeruginosa formed blooms (milovanović and živković, 1953, 1959; milovanović, 1963), while anabaena was found blooming in the futog i fishpond (ristić et al., 1979). in kapetanski rit the presence of the invasive cyanobacterial species cyl. raciborskii was noted (ćirić et al., 2010). in the last five years, more attention has been turned to possible effects of cyanobacteria and their toxins on the quality of fish meat and cyanotoxin accumulation in fish tissues, that could consequently endanger the health of consumers. in fishponds with the code bo during 2010 and 2011, mass occurrences of cyanobacterial species aph. flos-aquae, m. aeruginosa, phormidium foveolarum (leptolyngbya foveolara (gomont) anagnostidis & komárek ), jaaginema subtilissimum (kützing ex forti) anagnostidis & komárek, pseudanabaena limnetica (lemmermann) komárek and geitlerinema amphibium (c. agardh ex gomont) anagnostidis were recorded. toxicity in an artemia salina (l.) bioassay was detected in two of the six fishponds, when the maximum concentration of mcs in water amounted to 52 mc-lr equivalents l–1 in protein phosphatase inhibition (ppi) assay and 18 µg l–1 in an enzyme-linked immunosorbent assay (elisa). besides water, mcs were found in the muscle and liver of fish, as well as in aquatic plants and sludge (world bank report, dm 4307 2011). during the summer of 2011 in another fishpond, encoded mu (fig. 1a), mass occurrences of g. amphibium, j. subtilissimum, m. aeruginosa, o. agardhii and phor. foveolarum were recorded (world bank report, dm 4307 2011). the toxicity of water samples from the fishpond was confirmed by a. salina bioassay, and the presence of mcs and saxitoxin(s) in water was identified by a ppi assay and elisa, respectively (tokodi et al., 2013, 2014; drobac, 2015; drobac et al., 2016). the highest concentrations of mcs (181 µg mc-lr equivalents l–1 in the ppi assay) were detected in a water sample from september 2011 (tokodi et al., 2014). the variant mc-rr was also detected in the muscle of fish cyprinus carpio (l.) grown in the fishponds where high cyanobacterial occurrence was detected (drobac, 2015; drobac et al., 2016). additionally, pathological alterations in the fish tissues of liver, kidneys, gills, intestine and muscle were also observed (drobac, 2015; drobac et al., 2016). the observed adverse effects and accumulation of cyanotoxins in fish tissues show that cyanobacteria and their toxins in fishponds could be hazardous to fish quality, the economy, the consumers’ health and the environment in general. reservoirs used for irrigation cyanobacteria and mcs were recorded in reservoirs in serbia which are used for irrigation. of 13 blooming species, the most frequently observed were aph. flosaquae (borkovac, bukulja, manđelos, mrtva tisa, pavlovci, provala, zobnatica), o. agardhii (borkovac, mrtva tisa, pavlovci, zobnatica), a. flos-aquae (bukulja, jegrička, pavlovci) and m. flos-aquae (koviljski rit, pavlovci) (đukić et al., 1991a, 1991b; simeunović, 2009; karadžić et al., 2010; sedmak and svirčev, 2011; svirčev et al., 2013a). the highest concentration of 280 µg l–1 mc-lr equivalents in water was recorded in 2007 in mrtva tisa (simeunović, 2009) when aph. flos-aquae and o. agardhii were abundant (fig. 1b). cyl. raciborskii was detected in september 2010 in the aleksandrovac reservoir which is used for irrigation (simić et al., 2011). an extensive fish mortality in aleksandrovac occurred on 20 december 2012 and was associated with the presence of cyl. raciborskii blooming a few weeks before the incident. almost the entire fish popnon -co mmerc ial us e o nly z. svirčev et al.156 ulation was killed (over 1.7 tonnes) including the species c. carpio, silurus glanis (l.), ctenopharyngodon idella (valenciennes), hypophthalmichthys molitrix (valenciennes), abramis brama (l.), carassius gibelio (bloch), aspius aspius (l.), and squalius cephalus (l.). a. salina bioassay showed high toxicity of water samples from aleksandrovac. however, the most common cyanotoxins (mcs, cylindrospermopsin, and saxitoxin) were not detected. it is possible that some other unknown or undetected toxic metabolites of this cyanobacterium were present and were a potential cause of the fish mortality in aleksandrovac (drobac, 2015; svirčev et al., 2016a). information about cyanotoxins in reservoirs used for irrigation is important because it is known that irrigation from water sources containing cyanobacteria and cyanotoxins may affect agricultural plants and lead to accumulation of these toxins. therefore, the health risks to people and animals due to the consumption of agricultural products irrigated with cyanotoxin-containing water must be taken seriously (codd et al., 1999; crush et al., 2008; saqrane et al., 2009; chen et al., 2010; drobac, 2015). lakes in gazivode lake, sjeničko lake and veliki zaton lake anabaena circinalis (dolichospermum circinale (rabenhorst ex bornet & flahault) p. wacklin, l. hoffmann & j. komárek), a. flos-aquae and o. rubescens were observed in mass occurrences (shllaku and landner, 1992; miljković et al., 2004; sedmak and svirčev, 2011). detection of mcs was performed only in the lakes palić and ludoš. research from 2005 to 2007 shows the presence of mcs in lake palić, and the highest mc concentration, 389 µg mc-lr equivalents l–1, was detected in the autumn of 2006. the most frequently blooming species was m. aeruginosa, followed by anabaena spiroides (dolichospermum spiroides (klebhan) p. wacklin, l. hoffmann & j. komárek), a. circinalis, m. flos-aquae and microcystis wesenbergii (komárek) komárek ex komárek (simeunović, 2009). in lake palić, fish mortality was observed by the author seleši (1982), and this recurred in later years as well. in 2009 there was an extensive mortality of fish with loss of over 12 tonnes of fish stocks. reasons cited included the lack of dissolved oxygen due to an excessive production of algae followed by their decay (http://www.zjzs.org.rs/page.php?id=286). furthermore, in 2012 the invasive cyl. raciborskii was also found in this lake (institute of public health of serbia, 2013). in lake ludoš, mc concentrations reached up to 604 fig. 1. cyanobacterial blooming in fishpond (code mu) (a); reservoir used for irrigation (mrtva tisa) (b); lake (lake ludoš) (c); and reservoir used for drinking water supply (vrutci) (d). non -co mmerc ial us e o nly research on cyanobacteria in serbia 157 µg mc-lr equivalents l–1 in the summer of 2006, and the species that bloomed during the study period were aph. flos-aquae, m. aeruginosa, m. flos-aquae, m. wesenbergii and p. agardhii (simeunović, 2009). research on lake ludoš during 2011 indicated not only mcs in the water, but also their accumulation in macrophytes (phragmites communis trin., typha latifolia (l.) and nymphaea elegans hook.) and in the tissues (intestine, muscles, kidney, gills and gonads) of prussian carp (c. gibelio). histopathological changes in different organs of prussian carp (liver, kidney, gills and intestines) from lake ludoš were associated with the high abundacies of potentially toxic cyanobacterial species limnothrix redekei (van goor) meffert and p. limnetica that were found in the center of the lake (fig. 1c). given that lake ludoš is a ramsar site, the stability of this aquatic ecosystem is of great and global importance (tokodi, 2016). reservoirs used for drinking water supply unlike the vojvodina region, where groundwater is used for water supply, central serbia has a large number of surface reservoirs used for drinking water supply. there are more than 20 reservoirs used as sources of drinking water, and constant mass occurrences of cyanobacteria have been observed in nine of them (svirčev et al., 2007). in the following serbian drinking water supply reservoirs: bovan, bresnica, garaši, grlište, grošnica, gruža, krajkovac and pridvorica, the emergence of the bloomforming cyanobacteria anabaena solitaria (dolichospermum solitarium (klebahn) p. wacklin, l. hoffmann & j. komárek), aph. flos-aquae, gomphosphaeria lacustris (snowella lacustris (chodat) komárek & hindák), gomphosphaeria aponina kützing, p. limnetica and m. aeruginosa has been documented, as has the presence of cyanotoxins in some of the reservoirs (sedmak and svirčev, 2011; svirčev et al., 2014a). in ćelije, the reservoir used for drinking water supply for the city of kruševac, a bloom of a. circinalis, aph. flos-aquae and m. aeruginosa was observed in 2004. mc was found in water samples from the reservoir (650 µg mc-lr l–1) and in the tap water (2.5 µg l–1) (svirčev et al., 2009). in addition to the mentioned species, aphanizomenon issatschenkoi (cuspidothrix issatschenkoi (usachev) p. rajaniemi, komárek, r. willame, p. hrouzek, k. kastovská, l. hoffmann & k. sivonen) (2001) and j. subtilissimum were detected in ćelije (2007) (svirčev et al., 2009; sedmak and svirčev, 2011). in gruža, along with a bloom of aph. flos-aquae, ultrastructural, apoptotic and necrotic changes in the liver of perch (perca fluviatilis (l.)) were observed, as well as an impact on antioxidant biomarkers (perendija et al., 2011). recently, cyanobacterial blooms of p. rubescens have occurred in vrutci reservoir used for the water supply of the city of užice (fig. 1d), where 70.000 inhabitants were potentially exposed to cyanotoxins in december 2013. based on the number of cells per ml and concentration of mcs, according to world health organization (who, 1999), water from reservoir vrutci could be classified as a high-risk water for recreation and drinking water abstraction purposes. the results from a. salina bioassay showed significant toxicity of the cyanobacterial biomass. modest fish mortality was observed during the cyanobacterial bloom, and mcs were detected in fish, including the muscle of frozen fish from 2013 which could indicate the presence of cyanobacteria even before the confirmed bloom. furthermore, a questionnaire and epidemiological results showed that health problems possibly related to cyanotoxins (diseases of digestive system, skin and subcutaneous tissue) occurred already at least two years prior to the incident. this might be a sign that the population of the city of užice could have been exposed to the cyanobacteria and cyanotoxins even two years before the observed bloom in 2013 (svirčev et al., 2016b). chronic exposure to cyanotoxins (e.g. mcs) from drinking water could present a risk factor for primary liver cancer and possibly even other types of cancer (svirčev et al., 2010; drobac, 2015). epidemiological studies conducted in serbia have revealed a significant correlation between an increased incidence of several cancers (brain; heart, mediastinum and pleural; ovarian; testicular; gastric; colorectal; retroperitoneal and peritoneal; leukemia; malignant skin melanoma; and primary liver cancer) and cyanobacterial blooms in reservoirs used for drinking water supply (svirčev et al., 2009, 2013b, 2014b; drobac, et al. 2011; drobac, 2015). reservoirs used for other purposes reservoirs used for hydropower generation have been poorly investigated. three cyanobacterial species were noted: m. aeruginosa, aph. flos-aquae and o. rubescens. only o. rubescens formed mass occurrences in investigated reservoirs (milovanović, 1973; obušković, 1983; sedmak and svirčev, 2011). conclusions based on the reviewed data from our scdb it can be concluded that cyanobacteria and cyanotoxins are omnipresent in different waterbodies throughout the republic of serbia. a systematic review and meta-analyses of the available literature is useful for an understanding of cyanobacterial biodiversity in serbian waters. some information is also available concerning the impact of cyanotoxins on other organisms, including humans. as a set of systemized data unique in the balkan peninsula, the database represents a possible model for other counnon -co mmerc ial us e o nly z. svirčev et al.158 tries in the region and beyond. such databases encopassing all previous research (including monitoring and case reports), as well as continuous supplementation with the new available data are valuable in order to provide a timely and adequate reaction to toxic and noxious cyanobacteria, and thus prevent potential negative consequences. acknowlegdments the authors would like to acknowledge the funding from the ministry of education, science and technological development of the serbian government (project number: 176020) and cost action es1105 ‘cyanocost cyanobacterial blooms and toxins in water resources: occurrence, impacts and management’ for adding value to this study through networking and knowledge-sharing with european experts in the field. the authors wish to thank prof. jelena blaženčić for inspiration and scientific advice. references blaženčić j, 1986. [review of development of algology in serbia from 1883 to 1983].[article in serbian]. glasnik instituta za botaniku i botaničke bašte univerziteta u beogradu 20:99-108. blaženčić j, martinović-vitanović v, cvijan m, filipi-matutinović s, 1985. [bibliografija radova o algama i algološkim istraživanjima u sr srbiji od 1947. do 1980. godine].[article in serbian]. glasnik instituta za botaniku i botaničke bašte univerziteta u beogradu 19:233-266. chen j, dai j, zhang h, wang c, zhou g, han z, liu z, 2010. bioaccumulation of microcystin and its oxidative stress in the apple (malus pumila). ecotoxicology 19:796-803. ćirić m, marković z, dulić z, subakov-simić g, 2010. first report of cyanobacterium cylindrospermopsis raciborskii from carp ponds in serbia, p. 14. in: proceedings 8th int. conf. on toxic cyanobacteria (ictc8), istanbul, turkey. codd ga, metcalf js, beattie ka, 1999. retention of microcystis aeruginosa and microcystin by salad lettuce (lactuca sativa) after spray irrigation with water containing cyanobacteria. toxicon 37:1181-1185. crush je, briggs lr, sprosen jm, nichols sn, 2008. effect of irrigation with lake water containing microcystins on microcystin content and growth of ryegrass, clover, rape, and lettuce. environ. toxicol. 23:246-252. cvijan m, fužinato s, 2011. the first finding of cylindrospermopsis raciborskii (woloszińska) seenayya et subba raju 1972 (cyanoprokaryota) in serbia. arch. biol. sci. 63:507-510. cvijan m, fužinato s, 2012. cylindrospermopsis raciborskii (cyanoprokaryota)-potential invasive and toxic species in serbia. botanica serbica 36:3-8. drobac d, 2015. [putevi izloženosti čoveka cijanotoksinima i njihov uticaj na zdravlje].[phd thesis in serbian], university of novi sad, serbia. drobac d, svirčev z, tokodi n, vidović m, baltić v, božićkrstić v, lazić d, pavlica t, 2011. microcystins potential risk factors in carcinogenesis of primary liver cancer in serbia. geographica pannonica 13:70-80. drobac d, tokodi n, lujić j, marinović z, subakov-simić g, dulić t, važić t, nybom s, meriluoto j, codd ga, svirčev z, 2016. cyanobacteria and cyanotoxins in fishponds and their effects on fish tissue. harmful algae 55:66-76. đukić n, pujin v, maletin s, gajin s, gantar m, petrović o, ratajac r, seleši đ, matavulj m, 1991a. lentic waters eutrophication in vojvodina part i “borkovac”. zbornik radova instituta za biologiju 31:4-6. đukić n, pujin v, maletin s, gajin s, gantar m, petrović o, ratajac r, seleši đ, matavulj m, 1991b. lentic waters eutrophication in vojvodina part i “zobnatica”. zbornik radova instituta za biologiju 31:39-40. fužinato s, fodora a, subakov-simić g, 2010. arthrospira fusiformis (voronichina) komarek et lund (cyanoprokaryota) a new species for europe. algological studies 134:17-24. institute of public health of serbia, 2013. [monitoring kvaliteta vode jezera palić i ludaš i potoka kereš u 2012. godini].[report in serbian]. institute of public health of serbia, belgrade. jakovljević s, stanković s, 1931-1932. [particularites limnologiques des eaux kartiques de la region de belgrad].[article in french]. glasnik botaničkog zavoda i bašte univerziteta u beogradu 2:1-19. karadžić v, 2011. [eutrofikacija i njene posledice na primeru reke ponjavice (opština pančevo)].[phd thesis in serbian]. university of belgrade, serbia. karadžić v, subakov-simić g, krizmanić j, natić d, 2010. phytoplankton and eutrophication development in the water supply reservoirs garaši and bukulja (serbia). desalination 255:91-96. karadžić v, subakov-simić g, natić d, ržaničanin a, ćirić m, gačić z, 2013. changes in the phytoplankton community and dominance of cylindrospermopsis raciborskii (wolosz.) subba raju in a temperate lowland river (ponjavica, serbia). hydrobiologia 711:43-60. maslać m, obušković lj, jakovčev d, cakić p, tucović v, 1992. [previous investigations of opovo channel, one in the system of channels of pančevo, p. 28-33].[article in serbian]. in: konferencija o aktuelnim problemima zaštite voda “zaštita voda 92”, subotica. miljković d, vučković m, gotović d, milenković p, zarkov n, roški đ, 2004. water supply problems of majdanpek, p. 575-579].[article in serbian]. in: konferencija o aktuelnim problemima zaštite voda “zaštita voda 04“, borsko jezero. milovanović d, 1949. [bibliografski pregled algoloških istraživanja u srbiji do 1947. godine].[article in serbian]. glasnik prirodnjačkog muzeja u beogradu serija b: biološke nauke b 1-2:323-329. milovanović d, 1963. phytoplankton and primary production in fish ponds “koluta”. arch. biol. sci. 6:3-16. milovanović d, 1970. limnotypological changes of some waters as a consequence of meliorative works in river dunav hydrosystem near apatin. ekologija 5:55-70. milovanović d, 1973. phytoplankton structural changes in the first years of đerdap reservoir existence. arch. biol. sci. 25:75-83. milovanović d, živković a, 1953. plankton production investigations in ečka fish ponds. proceedings san 29:197-264. non -co mmerc ial us e o nly research on cyanobacteria in serbia 159 milovanović d, živković, a, 1959. phytoplankton production in živača fishpond (ii contribution to limnology of lentic waters in panonia valley). arch. biol. sci. 2:1-17. natić d, jovanović d, knežević t, karadžić v, bulat z, matović v, 2012. microcystin-lr in surface water of ponjavica river. vojnosanit. pregl. 69:753-758. obušković lj, 1982. phytoplankton and saprobiological characteristics of rivers bosut, spačva i studva. vodoprivreda 14:247-249. obušković lj, 1983. [das phytoplankton des stausees “eisernes tor” (đerdap) im jahre 1973].[article in german]. hidrobiologia 17:341-347. obušković lj, 1987. [phytoplankton and saprobiological characteristics of river sava in 1984, p. 426-430].[article in serbian]. in: proceedings conf. river sava, protection and water use, zagreb. obušković lj, 1989. [phytoplankton and saprobiological characteristics of river danube in 1988, p. 30-36].[article in serbian]. in: proceedings konferencija o aktuelnim problemima zaštite voda “zaštita voda 89”, rovinj. obušković lj, 1991. [phytoplankton and saprobiological characteristics of river ponjavice (south banat) as indicator of increased eutrophication, p. 332-337].[article in serbian]. in: proceedings konferencija o aktuelnim problemima zaštite voda “zaštita voda 91”, neum. perendija b, despotović s, radovanović t, gavrić j, borkovićmitić s, pavlović s, ognjanović b, simić s, pajović s, saičić z, 2011. biochemical and ultrastructural changes in the liver of european perch (perca fluviatilis l.) in response to cyanobacterial bloom in the gruža reservoir. arch. biol. sci. 63:979-989. protić đ, 1935. [hidrobiološke studije na kanalu kralja petra i kanalu kralja aleksandra. drugi deo].[article in serbian]. spomenik srpske kraljevske akademije 80:1-35. protić đ, 1936. [hidrobiološke studije na kanalu kralja petra. treći deo].[article in serbian]. spomenik srpske kraljevske akademije 85:59-87. pujin v, ratajac v, đukić n, svirčev z, kilibarda p, 1987. [saisonmassige variationen des zusammemensetzung des planktons und der bodenbesiedlung in der carska bara (jugoslawien) ].[article in german]. tiscia (szeged) 22:83-91. ristić o, gajin s, gantar m, matavulj m, 1979. [microbiological studies of some fish ponds in vojvodina, p. 19231935].[article in serbian]. in: proceedings ii congr. ecologists in yugoslavia, zagreb. saqurane s, ouahid y, el ghazali i, oudra b, bouarab l, del campo f, 2009. physiological changes in triticum durum, zea mays, pisum sativum and lens esculenta cultivars, caused by irrigation with water contaminated with microcystins: a laboratory experimental approach. toxicon 53:786-796. scharschmidt g, 1883. fragmenta phycologiae bosniaco serbicae].[article in german]. magyar novenytani lapok 75: 33-39. sedmak b, svirčev z, 2011. [cijanobakterije i njihovi toksiniekološki i toksikološki rizici i cvetanje cijanobakterija u srbiji].[book in slovenian]. visoka šola za varstvo okolja, velenje, slovenia: 134 pp. seleši đ, 1982. limnological investigations of lake ludoš. vode vojvodine 10:345-368. shllaku l, landner l, 1992. environment in kosovo: environmental problems related to mineral exploitation. stockholm, sweden, who. simeunović j, 2009. [ekofiziološke karakteristike potencijalno toksičnih i toksičnih vodenih sojeva cijanobakterija na području vojvodine].[phd thesis in serbian], university of novi sad, serbia. simić s, mišćević s, đorđević n, popović n, 2011. cyanobacteria in aleksandrovac lake before and after revitalisation. in: proceedings 16th conf. cyanobacteria and human health, academy of studenica, novi sad, serbia. subakov-simić g, plemić n, karadžić v, cvijan m, krizmanić j, 2004. [qualitative and quantitative analysis of phytoplankton in slatina near opovo, p. 327-330].[article in serbian]. in: proceedings konferencija o aktuelnim problemima zaštite voda “zaštita voda 04”, borsko jezero. svirčev z, simeunović j, subakov-simić g, krstić s, vidović, m, 2007. freshwater cyanobacterial blooms and cyanotoxin production in serbia in the past 25 years. geographica pannonica 11:12-21. svirčev z, krstić s, miladinov-mikov m, baltić v, vidović m, 2009. freshwater cyanobacterial blooms and primary liver cancer epidemiological studies in serbia. j. environ. sci. heal. c 27:36-55. svirčev z, baltić v, gantar m, juković m, stojanović d, baltić m, 2010. molecular aspects of microcystin-induced hepatotoxicity and hepatocarcinogenesis. j. environ. sci. heal. c 28:39-59. svirčev z, simeunović j, subakov-simić g, krstić s, pantelić d, dulić t, 2013a. cyanobacterial blooms and their toxicity in vojvodina lakes, serbia. int. j. environ. heal. r. 7:745-758. svirčev z, drobac d, tokodi n, vidović m, simeunović j, miladinov-mikov m, baltić v, 2013b. epidemiology of primary liver cancer in serbia and possible connection with cyanobacterial blooms. j. environ. sci. heal. c 31:181-200. svirčev z, tokodi n, drobac d, codd ga, 2014a. cyanobacteria in aquatic ecosystems in serbia: effects on water quality, human health and biodiversity. syst. biodivers. 12: 261-270. svirčev z, drobac d, tokodi n, lužanin z, munjas am, nikolin b, vuleta d, meriluoto j, 2014b. epidemiology of cancers in serbia and possible connection with cyanobacterial blooms. j. environ. sci. heal. c 32:319-337. svirčev z, obradović v, codd ga, marjanović p, spoof l, drobac d, tokodi n, petković a, nenin t, simeunović j, važić t, meriluoto j, 2016a. massive fish mortality and cylindrospermopsis raciborskii bloom in aleksandrovac lake. ecotoxicology 25:1353-1363. svirčev z, drobac d, tokodi n, đenić d, simeunović j, hiskia a, kaloudis t, mijović b, šušak s, protić m, vidović m, onjia a, nybom s, važić t, palanački malešević t, dulić t, pantelić d, vukašinović m, meriluoto j, 2016b. lessons from the užice case: how to complement analytical data. in: j. meriluoto, l. spoof and g.a. codd (eds.), handbook of cyanobacterial monitoring and cyanotoxin analysis. j. wiley & sons, chichester: 576 pp. tokodi n, drobac d, simeunović j, svirčev z, 2013. assessment of acute cyanotoxicity using artemia salina bioassay in water samples from fishponds. in: 17th international ecoconference, 10th environmental protection of urban and suburban settlements. 25-28 september 2013, novi sad, serbia. non -co mmerc ial us e o nly z. svirčev et al.160 tokodi n, drobac d, simeunović j, svirčev z. 2014. microcystin concentrations in fishpond waters. matice srpska j. nat. sci. 127:35-42. tokodi n, 2016. [toksične cijanobakterije sa teritorije republike srbije].[phd thesis in serbian], university of novi sad, serbia. who, 1999. toxic cyanobacteria in water: a guide to their public health consequences, monitoring, and management. world health organization, geneva, switzerland. world bank report, 2011. introducing daphnia grazing to control global warming associated cyanobacterial toxic blooms in fishing pond. report dm 4307. in: world health organization 1998. guidelines for drinking-water quality, 2nd ed. addendum to vol. 2. who, geneva, switzerland. non -co mmerc ial us e o nly layout 1 introduction cyanobacterial harmful algal blooms represent one of the most conspicuous waterborne microbial hazards to freshwater and marine ecosystems (codd et al., 2005; paerl et al., 2011). this hazard results from the production of cyanotoxins, harmful secondary metabolites, which can have deleterious effects within reservoirs and in downstream receiving water systems during releases (paerl and otten, 2013). harmful cyanobacterial blooms have increased globally in frequency and intensity in recent decades. eutrophication and warmer temperatures are often cited as key factors which promote these events (hudnell and dortch, 2008; paerl and huisman, 2008; gkelis et al., 2014). in greece, the warm mediterranean climate favors cyanobacterial blooms in eutrophic waters, which may start in spring and last until december; increased temperatures due to global warming may further enhance cyanobacteria dominance and promote toxic over non-toxic strains (gkelis et al., 2014). after the elucidation of cyanotoxins genes clusters, several studies have applied molecular methods for monitoring the presence of toxic cyanobacteria and the genes involved in the biosynthesis of cyanotoxins (hisbergues et al., 2003; vasconcelos et al., 2010; gkelis and zaoutsos, 2014). furthermore, molecular methods based on 16s rrna gene amplification are widely employed for the analysis of natural samples and/or monitoring freshwaters (kormas et al., 2011; loza et al., 2013). bottled water can come from a variety of sources including natural aquifers, springs, glacier run-off, and municipal water supplies, and these sources could potentially be contaminated with microcystins (cfia, 2011). to our knowledge, only two studies on levels of microcystins in bottled water have been published. those studies, performed in italy (ferretti et al., 2007) and canada (cfia, 2011; cfia, 2012), analysed domestic bottled water samples for the presence of microcystins and nodularin, and did not detect cyanotoxins. this work presents the results of a small scale monitoring program for drinking natural mineral water and highlights the necessity to initiate research and possibly establish official monitoring programs in cases where similar results are obtained in order to cope with the new demands for drinking water. methods sample collection and preparation the bottled natural mineral water originated from a water source (250 m depth), which is located in the prefecture of central macedonia, northern greece (n: 40°15’4.88” and e: 22°32’12.71”) with a water temperature ranging between 16°c in winter and spring and 18°c in autumn and summer. water samples were collected advances in oceanography and limnology, 2017; 8(1): 87-91 article doi: 10.4081/aiol.2017.6280 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). can cyanobacteria infect underground water sources? indications from small scale monitoring of a natural drinking water source spyros gkelis,1* aristidis vlamis1,2 1department of botany, school of biology, aristotle university of thessaloniki, gr-541 24 thessaloniki, greece; 2department of pharmacology, veterinary school, university of santiago de compostela, lugo 27002, spain *corresponding author: sgkelis@bio.auth.gr abstract the expansion of harmful cyanobacterial blooms is of worldwide concern as they have increased globally in frequency and intensity in recent decades. a cyanobacterial colony was found in a bottle of natural mineral water of a small water company in july 2012, which led to a further examination for a period of five months (july-november 2012) of both the bottled filtered water and the originating groundwater source (n. greece) for the occurrence of cyanobacteria. cyanobacteria occurrence was monitored by microscopy and cyanospecific 16s rdna amplification; potentially toxic species occurrence was screened by mcya gene (known to take part in the mc-biosynthetic gene cluster) amplification. the highest abundance of cyanobacterial cells without the simultaneous presence of the mcya gene, was measured in july, in contrast to october when the presence of cyanobacteria was only identified by tracing cyanospecific 16s rdna and the mcya gene region in the underground water source. the results of this small scale monitoring program indicate the potential existence of an emerging danger for human health in a relatively manageable product such as the bottled natural mineral water. key words: microcystis; microcystin; bottled water; natural mineral water. received: 12 september 2016. accepted: 16 march 2017. non -co mmerc ial us e o nly s. gkelis and a. vlamis88 monthly between july and december 2012 from two drilling points (sup1 and sup2) used for the production of bottled natural mineral water. the final product which had undergone filtration was also sampled (bottled filtered water-bf). aliquots of these were preserved with both lugol’s solution (1% v/v) and formaldehyde (2% v/v). water samples were stored in polyethylene bottles and transferred to the laboratory (<5 h) under cool and dark conditions. immediately upon reception in the laboratory, 1.5 l of water was filtered on a whatman gf/c filters and the filter was stored at -20°c for further analysis. phytoplankton analysis fresh and preserved samples were examined using an inverted microscope (olympus ix71) with phase-contrast. species were identified using komárek and anagnostidis (1999). the abundance of cyanobacterial cells was determined in accordance with utermöhl (1958), using 50 ml sedimentation chambers, thus detection limit was 20 cells l–1. transepts were counted and the variation coefficient was always kept under 20%. phytoplankton abundance is presented in number of cells l–1. molecular detection dna was extracted using the protocol described in atashpaz et al. (2010) for gram negative bacteria, after slicing the filters with a sterile scalpel. in order to identify cyanobacteria and potentially mc-producing cyanobacteria we used two different sets of primers, respectively: the 16s 27f (5’-agagtttgatcctggctcag-3’) /16s 1494r (5’tacggttaccttgttacgac -3’) primer pair which amplifies a 1367-bp fragment of 16s rdna in all cyanobacteria (neilan et al., 1997) and the mcya cd1f (5’aaaattaaaagccgtatcaaa-3’) /mcya cd1r (5’aaaagtgttttattagcggctcat-3’) primer pair (hisbergues et al., 2003), which was designed to amplify a 297-bp fragment of the mcya gene from mc-synthesizing cyanobacteria strains and was previously proved to be suitable to detect mc-producing cells from the genera anabaena, microcystis and, planktothrix (hisbergues et al., 2003). samples giving positive results in this assay have been shown to have a high probability of producing mcs (hisbergues et al., 2003; vasconcelos et al., 2010). we chose to detect a gene target known to be involved in the biosynthesis of mc, as this is the most frequent cyanotoxin in greece (gkelis and zaoutsos, 2014; gkelis et al., 2015b) and worldwide. pcr was carried out on the dna extracts using the primer pairs presented previously. all pcr reactions were prepared as described in gkelis and zaoutsos (2014). thermal cycling was carried out using an eppendorf mastercycler pro (eppendorf). amplification was performed according to the protocols described by neilan et al. (1997) and hisbergues et al. (2003) for 16s rrna and mcya, respectively. dna extracted from microcystis aeruginosa m6 strain (see vasconcelos et al., 2010) was used as positive control for the amplification of mcya gene target and water as negative control. pcr products were separated by 1.5% (w/v) agarose gel in 1x tae buffer. the gels were stained with ethidium bromide and photographed under uv transillumination. results and discussion cyanobacteria were detected by microscopy only in the bottled sample bf/a, collected on the 5th of july 2012 (tab. 1). a colonial form of microcystis-like cyanobacteria was found, which could not be further identified (fig. 1). cells were spherical with an average diameter tab. 1. microscopic and molecular detection of cyanobacteria in the water samples collected during the study. sampling date sample microscopic analysis μolecular analysis cells l–1 dna cyanobacteria 16s rrna mcya gene 05-07-12 sup (1) sup (2) bf/ a* 50,000 + + bf/ b + + 18-09-12 sup (1) sup (2) bf 31-10-12 sup (1) + + + bf + + 29-11-12 sup (1) sup (2) + bf + bf, bottled filtered water; sup (1), source underground water (old drill); sup (2), source underground water-(new drill); *sample bf/ a is from the same production line with bf/ b but sampled at a different time of the day. non -co mmerc ial us e o nly cyanobacteria in underground water sources 89 of 8.53μm (n=30, min 6.54 μm, max 11.6 μm). cyanobacterial abundance in this sample was 50,000 cells l–1, whereas in bf/b, collected on the same day and drilling source but at a different time, no cyanobacteria cells were found (tab. 1). no presence of cyanobacteria was observed by microscopy in any of the other samples, both bottled and from the underground water source. although the presence of algae and cyanobacteria in underground habitats (reisser, 2007) and the ability of soil and deep subsurface cyanobacteria to actively follow a moving water pocket in order to exploit it (garcia-pichel and pringault, 2001) has been shown, to the best of our knowledge this is the first report of planktonic cyanobacteria found in an underground drinking-water source. recently, pazouki et al. (2016) demonstrated that cyanobacteria can be found in water filtered through bank filtration, especially species with cell size <10 μm, such as the microcystis cells. in our case the source of the cyanobacterial colony we found remains unknown; however, it has been found that in the nearby river-reservoir system of aliakmon-polyphytos, microcystis aeruginosa can be dispersed in short distances through the wind (chrisostomou et al., 2009). furthermore, airborne cyanobacteria have been found in the nearby city of thessaloniki (genitsaris et al., 2011). nevertheless, since the source of the cyanobacterial colony was not found the possibility of opportunistic airborne contamination during the bottling cannot be excluded. dna was below the detection limit in seven out of the twelve samples analyzed (tab. 1). a pcr product of about 1370 bp was obtained using the 16s 27f/16s 1484r primer pair in four samples (including sample bf/a of 05-07-2012, where cyanobacteria were identified by microscopy). the 300 bp mcya-cd 1f/mcya-cd 1r primer pair pcr product, indicating the presence of mcya gene, was identified only in one out of the twelve samples assayed (tab. 1). in the studied water source the highest cyanobacterial abundance of 50.000 cells l–1 was observed in july without the simultaneous presence of the mcya gene responsible for mc production. at the end of october, however, the presence of cyanobacteria was only traced through the detection of 16s rdna as well as traces of the gene mcya. similar results were reported by davis et al. (2009) in lake agawam in july where the presence of toxic microcystis cells did not coincide with the presence of mc and also in lake champlain where mcs were detectable in october but without the presence of toxic microcystis cells at the same time. gkelis and zaoutsos (2014) found that the mcya region was amplified only where microcystis spp. were dominant and mc concentrations were >40 μg l–1. conjointly, gkelis et al. (2014) in a 14-month monitoring of lake pamvotis found that mcya was amplified only in two samples, where microcystis aeruginosa was dominant, whereas mcyb and mcye regions were amplified in almost all samples. several studies report that cyanobacteria can produce toxins at low temperatures but in combination with other important factors such as presence of light and nutrients’ availability (quiblier et al., 2013). the low temperatures (max. 18°c) of the studied groundwater source together with the absence of one of the genes responsible for cyanobacterial toxicity (mcya) in most of the samples suggest that the detected cyanobacteria do not probably constitute an important hazard for this specific source, also due to the limited input of nutrients and the absence of light. nevertheless, since traces of the mcya gene were detected in one sample, there is still a possibility that mcs could have been produced in the studied water source, since cyanotoxins are intracellular toxins contained within living cells (sivonen and jones, 1999) and cyanobacterial cells were found in high abundances in one sample. in this case, the biggest problem in bottled drinking natural mineral waters arises from the fact that the only treatment option in order to maintain the product type ‘natural mineral water’, is filtering, as filters can retain a big proportion of the microalgae but not the potential toxins produced by them resulting in human intoxication. our finding, although scarce, raises the question of monitoring algae in underground water sources. at present, none of the european countries have established monitoring program for cyanotoxins in potable minerals waters so far, and only some countries have done so for drinking water such as spain, france, the czech republic and poland (burch, 2008). in greece, there are very few official monitoring programs in place (kaloudis et al., 2013; gkelis et al., 2015a) for cyanobacterial blooms and toxins produced in freshwaters, whereas there is also no legislafig. 1. microphotograph of the microcystis-like colony found in the bottled filtered water bf/ a sample. non -co mmerc ial us e o nly s. gkelis and a. vlamis90 tion with regard to monitoring of these quality parameters (cook et al., 2005). moreover, there are no legally established maximum allowable concentrations for cyanotoxins in potable mineral water. the only relevant reference is in the national hygienic regulation a1β/4841/1979 (fek 696/β΄/1979), where the absence of microalgae is required for bottled waters intended for human consumption. a very small number of water treatment plants in greece control cyanobacterial growth, measure cyanotoxins or use water treatments for toxin removal: the athens water supply and sewerage company implements some measures for control and monitoring of cyanobacteria and cyanotoxins (kaloudis et al., 2013). other water utilities are small, at a local level, and they do not implement such measures, with the possible exception of the thessaloniki water supply and sewerage company (thessaloniki) (kaloudis, personal communication). conclusions the results of this small scale monitoring program demonstrated for the first time the presence of cyanobacteria in bottled natural mineral drinking water. while it seems unlikely that the use of bottled water would constitute any major hazard with regard to cyanotoxin exposure, our findings call for further research to investigate the presence, heterotrophic growth and significance of cyanobacterial colonies and/or biofilms in water distribution systems, such as wells. acknowledgments we thank prof. vitor vasconcelos for providing freezedried material of cyanobacteria strains used as positive control in pcr studies. av would like to thank dr. panagiota katikou for providing useful information on cyanotoxins. the authors acknowledge cyanocost-cost es 1105 for sharing of knowledge and networking and thank the two anonymous reviewers for helpful suggestions. references atashpaz s, khani s, barzegari a, barar j, vahed sz, azarbaijani r, omidi y, 2010. a robust universal method for extraction of genomic dna from bacterial species. microbiology 79:538-542. burch md, 2008. effective doses, guidelines and regulations. in: h.k. hudnell (ed.), cyanobacterial harmful algal blooms: state of the science and research needs. adv. exp. med. biol. 610:831-854. canadian food inspection agency (cfia), 2011. microcystins in bottled water. food safety action plan report. tschem-10/11, pp. 1-8 canadian food inspection agency (cfia), 2012. microcystins and nodularin in bottled water. food safety action plan report. ts-chem-11/12, pp. 1-8. chrisostomou a, moustaka-gouni m, sgardelis s, lanaras t, 2009. air-dispersed phytoplankton in a mediterranean river-reservoir system (aliakmon-polyphytos, greece). j. plankton res. 31:877-884. cook cm, moustaka-gouni m, gkelis s, lanaras t, 2005. greece: cyanotoxin risk assessment, risk management and regulation, p. 69-75. in: i. chorus (ed.), current approaches to cyanotoxin risk assessment, risk management and regulations in different countries. series wabolu 02/05. umweltbundesamt, dessau. codd ga, lindsay j, young fm, morrison lf, metcalf js, 2005. harmful cyanobacteria: from mass mortalities to management measures, p. 1-23. in: j. huisman, h.c.p. matthijs and p.m. visser (eds.), harmful cyanobacteria. springer, dordrecht. davis tw, berry dl, boyer gl, gobler cj, 2009. the effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of microcystis during cyanobacteria blooms. harmful algae 8:715-725. ferretti e, lucentini l, veschetti e, bonadonna l, stammati a, turco l, ottaviani m, 2007. screening and identification of unknown contaminants in water destined to human consumption: a case study. microchem. j. 85:57-64. garcia-pichel f, pringault o, 2001. cyanobacteria track water in desert soils. nature 412:380-381. genitsaris s, kormas ka, moustaka-gouni m, 2011. airborne algae and cyanobacteria: occurrence and related health effects. front. biosci. 3:772-787. gkelis s, chronis i, kagalou i, 2015a. monitoring a newly reborn patient: phytoplankton based water quality and cyanotoxin occurrence in a reconstructed shallow mediterranean lake. proceedings aslo aquatic sciences meet., granada. abstract id27076. gkelis s, lanaras t, sivonen k, 2015b. cyanobacterial toxic and bioactive peptides in freshwater bodies of greece: concentrations, occurrence patterns, and implications for human health. mar. drugs 13:6319-6335. gkelis s, papadimitriou t, zaoutsos n, leonardos i, 2014. anthropogenic and climate-induced change favors toxic cyanobacteria blooms: evidence from monitoring a highly eutrophic, urban mediterranean lake. harmful algae 39:322-333. gkelis s, zaoutsos n, 2014. cyanotoxin occurrence and potentially toxin producing cyanobacteria in freshwaters of greece: a multi-disciplinary approach. toxicon 78:1-9. hisbergues m, christiansen g, rouhiainen l, sivonen k, borner t, 2003. pcr-based identification of microcystinproducing genotypes of different cyanobacterial genera. arch. microbiol. 180:402-410. hudnell kh, dortch q, 2008. a synopsis of research needs identified at the interagency, international symposium on cyanobacterial harmful algal blooms (isoc-hab). adv. exp. med. biol. 619:17-43. kaloudis t, zervou ks, tsimeli k, triantis t, fotiou t, hiskia a, 2013. determination of microcystins and nodularin (cyanobacterial toxins) in water by lc–ms/ms. monitoring of lake marathonas, a water reservoir of athens, greece. j. hazard. mat. 263:105-115. komárek j, anagnostidis k, 1999. [cyanoprokaryota 1. teil: non -co mmerc ial us e o nly cyanobacteria in underground water sources 91 chroococcales], pp. 548. in: h. ettl, g. gärtner, h. heynig, and d. mollenhauer (eds.), [süsswasserflora von mitteleuropa 19/1].[book in german]. gustav fischer verlag, jena. kormas ka, gkelis s, vardaka e, moustaka-gouni m, 2011. morphological and molecular analysis of bloom-forming cyanobacteria in two eutrophic, shallow mediterranean lakes. limnologica 41:167-173. loza v, perona e, mateo p, 2013. molecular fingerprinting of cyanobacteria from river biofilms as a water quality monitoring tool. applied environ. microbiol. 79:1459-1472. neilan ba, jacobs d, deldot t, blackall ll, hawkins pr, cox pt, goodman ae, 1997. rrna sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus microcystis. int. j. syst. bacteriol. 47:693-697. paerl hw, hall ns, calandrino es, 2011. controlling harmful cyanobacterial blooms in a world experiencing anthropogenic and climatic-induced change. sci. total environ. 409:1739-1745. paerl hw, huisman j, 2008. blooms like it hot. science 320: 57-58. paerl hw, otten gt, 2013. harmful cyanobacterial blooms, causes, consequences, and controls. microb. ecol. 65: 995-1010. pazouki p, prévost m , mcquaid n, barbeau b, de boutray ml, zamyadi a, dorner s, 2016. breakthrough of cyanobacteria in bank filtration. water res. 102:170-179. quiblier c, wood s, echenique-subiabre i, heath m, villeneuve a, humbert j-f, 2013. a review of current knowledge on toxic benthic freshwater cyanobacteria-ecology, toxin production and risk management. water res. 47:5464-5479. reisser w, 2007. the hidden life of algae underground, p. 4758. in: j. seckbach (ed.), algae and cyanobacteria in extreme environments. springer, dordrecht. sivonen k, jones g, 1999. cyanobacterial toxins, p. 113-153. in: i. chorus and j. bartram (eds.), toxic cyanobacteria in water: a guide to their public health consequences, monitoring and management. world health organization, e & fn spon. utermöhl h, 1958. [zur vervollkommung der quantitativinen phytoplankton-methodik].[article in german]. int. ver. theor. angew. limnol. 9:1-38. vasconcelos v, martins a, vale m, antunes a, azevedo j, welker m, lopez o, montejano g, 2010. first report on the occurrence of microcystins in planktonic cyanobacteria from central mexico. toxicon 56:425-431. non -co mmerc ial us e o nly layout 1 introduction about 50,000 reservoirs with dams higher than 15 m exist in the world and many huge dam construction projects are in the planning phase (wcd, 2000). especially in the tropics and sub-tropics, the number of recently constructed reservoirs is high. the area covered by those reservoirs is increasing and already makes up an area of about 500,000 km², which equals one third of the surface area of non-artificial surface water bodies (wcd, 2000). by impounding rivers through the construction of dams, riverine systems and biochemical cycles are disrupted (friedl and wüest, 2002). suspended solids and transported material are trapped and settle in the reservoirs (odhiambo and boss, 2004). the sediment quality and amount of sediment have a direct influence on the management of the reservoir as well as on water quality in the reservoir. it is therefore necessary to characterise and manage the accumulated sediment volumes. as the spatial dimensions of many of the reservoirs are huge, it is still a problem to obtain representative data for several quality parameters of the sediment. echo sounding systems have been found to allow for a timeand cost-saving data acquisition, especially when they are used on larger spatial scales (freitas et al., 2006; anderson et al., 2008; poulain et al., 2011). they represent the most promising approach to extensive sediment classification apart from traditional point sampling techniques like grab sampling and sediment coring. multibeam echo sounders (mbs) and swath systems provide the highest coverage of area in relation to needed vessel time, but are inherently more expensive than single beam echo sounders (sbs). in regards of seabed classification literature shows successful studies for mbs (bentrem et al., 2002; preston, 2009; hamilton and parnum, 2011) and sbs (tęgowski, 2005; anderson and pacheco, 2011; poulain et al., 2011), both systems have advantages and disadvantages. mbs and sbs provide high accuracy during seabed classification. however, the sbs need dense line spacing for comparable spatial results. the sbs features the advantage that the second bottom echo can also be integrated in the seabed classification (parnum et al., 2009). systems like the simrad ea 400 use two frequencies at the same time, which may improve the sediment classification due to a lower second frequency, which allows for a better classification of the volume characteristics due to deeper sediment penetration. independent from the selected echo sounder, the classification of sediment parameters is still largely limited to physical parameters, such as grain size distribution. few readvances in oceanography and limnology, 2016; 7(1): 93-105 article doi: 10.4081/aiol.2016.5623 investigation of echo sounding parameters for the characterisation of bottom sediments in a sub-tropical reservoir stephan hilgert,* adrian wagner, lisa kiemle, stephan fuchs institute for water and river basin management (iwg), division of aquatic environmental engineering (isww), karlsruhe institute of technology (kit), gotthard-franz-str.3, bld. 50.31, 76131 karlsruhe, germany *corresponding author: stephan.hilgert@kit.edu abstract the increasing number of reservoirs around the world today reaches a surface area of around 500,000 km², equalling one third of that of non-artificial surface water bodies. by impounding rivers through the construction of dams, riverine systems and biochemical cycles are disrupted. different types of transported materials are trapped behind the dams and form layers of sediment. a comprehensive combination of two frequencies with four pulse lengths were tested in order to classify multiple physical and chemical sediment parameters in the vossoroca reservoir in the southeast of brazil, paraná state. a number of core and grab samples was taken and analysed for a variety of chemical and physical parameters. these data served as ground truthing for the hydro-acoustic assessment of the sediment. eight hydro-acoustic parameters were derived from the echo signals obtained with an ea 400 system using the sonar5-pro software. the major objective of defining the optimal survey parameters for the echo sounder as well as determining the difference between core and grab samples was reached by correlating the various single parameters and identifying the best combinations. density and grain size distribution represented the best detectable sediment features with r-values of 0.94 and 0.95. the lower 38 khz frequency generally had a better performance than the 200 khz frequency. results show that core samples reached a significantly higher quality of correlation for sediment characterisation. additionally, it was found that shorter pulse lengths yield a better characterisation. the results underline the potential of single beam echo sounders for extensive sediment characterisation. this methodology may be used for future mass balance estimations of large reservoirs. key words: echo sounding; sediment characterisation; pulse length; sediment sampling; sbc, reservoir. received: november 2015. accepted: june 2016. non -co mmerc ial us e o nly 94 s. hilgert et al. sults have been published so far with respect to correlations between other sediment parameters, e.g. organic content, iron content, phosphate content, and loss on ignition, and hydro-acoustic parameters. next to the influence of the named sediment parameters, this study investigates different pulse length in order to find optimal configurations for seabed classification. apart from the best echo sounder configuration for the detection of the parameters listed, the influence of the sediment sampling method was investigated. since grab and core sampling produce different sediment sample types, a significant influence on the ground truthing results can be expected. most of the data published refer to the correlation of hydro-acoustic information with grab samples taken by e.g. an ekman dredge (bentrem et al., 2002; amiri-simkooei et al., 2011; anderson and pacheco, 2011; poulain et al., 2011; anderson and martinez, 2015). several well-established commercial echo sounding systems and related software for lakebed classification are available on the market (i.e., qtc view, etc.), internal data processing, however, is a black box to the user. we used a combination of a kongsberg ea 400 single beam echo sounder with frequencies of 200 and 38 khz and the sediment classification tool of the sonar5-pro post-processing software for lakebed characterization. the formulas for the seabed classification used in the sonar5-pro software are openly documented and intermediary results can be exported and processed e.g. in a combination with matlab (mathworks®) (balk et al., 2011). the data were collected in march and november 2011 during two surveys of the vossoroca reservoir in the southeast of brazil. during the first campaign, bathymetry of the entire reservoir was obtained in a rather dense grid. the maximum depth of the reservoir was found to reach 17 metres. subsequently, a 3d model was created, which served to plan the following survey in november. eight different hydro-acoustic parameters were derived from the echo signals for later correlation with the sediment properties at the corresponding locations. the sediment properties included physical parameters, such as grain size distribution, but also chemical parameters, such as phosphorus and iron contents. in addition to the standardised ‘first echo division method’ and ‘first/second bottom ratio method’ (burczynski, 1999), further signal parameters extracted by the sediment classification tool of the sonar5pro software were tested with respect to their correlations with sediment parameters obtained by ground truthing and at changed pulse durations. this study was aimed at finding the optimal echo sounder configuration for the characterisation of sediments using a non-commercial software. additionally, the influence of the sediment sampling method was analysed. methods study area the vossoroca reservoir is located in southern brazil in the state of paraná, approximately 50 km southeast of curitiba in the ‘serra do mar’ mountain range at approximately 833 m asl. the annual rainfall is about 1900 mm, the climate is subtropical. the reservoir ,which covers an area of about 5 km² and has a capacity of 33.6 x 106 m³ (republic of brazil, 1969), was created in 1940 to control water flow for the chaminé hydroelectric power plant located 7 km downstream. the average water depth is about 8 m, maximum depth is about 17 m. the catchment area of the reservoir has a size of 151 km² (republic of brazil, 1969) and is predominantly rural. the immediate surroundings of the reservoir are used for recreation, whereas the upstream area of the basin is mainly used by agriculture. the major part of the reservoir belongs to the nature protection area of guaratuba. bathymetric survey covered the entire lake except for the very shallow parts (less than 1.30 m). in these areas, no proper echo signal could be received and the risk of running aground was too high. fig. 1 shows the bathymetric measurement grid. point sampling focused on the left arm and the central part of the reservoir to facilitate the sampling process (fig. 2). hydro-acoustic data acquisition a kongsberg ea 400 single beam echo sounder with frequencies of 200 and 38 khz was used for the acquisition of hydro-acoustic data. tab. 1 reports the echo sounder characteristics. the ea 400 features opening angles of 7° for 200 khz and longitudinal and transverse angles of 13° and 21°, respectively, at 38 khz. the survey was carried out to characterise the lakebed under very shallow conditions (2-17 m depth). the transducer was mounted vertically (0°angle) on the starboard side of a small aluminium vessel, 67 cm below the water surface to prevent surface bubbles from interfering with the meastab. 1. overview of the ea 400 echo sounder characteristics. frequency opening angle (longitudinal) opening angle (transverse) pulse length (ms) power input (w) 200 khz 7° 7° 0.064; 0.128; 0.256; 0.512 100-1000 38 khz 13° 21° 0.256; 0.512; 1.024; 2.058 100-1000 non -co mmerc ial us e o nly hydro-acoustic sediment characterisation 95 urements. the average vessel speed was about 2 m s–1. due to the calm weather and, hence, the absence of waves, the influence of pitch, roll, and heave could be neglected. every day before the acoustic measurements, the actual water level of the reservoir was determined with the help of a reference pole. in this way, the acoustic signals could be referenced to the same water level and merged and compared. in addition, a temperature and a conductivity profile were recorded daily and both data were included in signal correction during post-processing. the temperature and conductivity profiles were used to correct the sound speed in the water phase during postprocessing. a leica gps 1200+ was used during all measurements. a rtk base station was positioned on a close by hill to allow for high precision of the positioning, below 1 m accuracy. the gps was connected to the notebook and transmitted the position signal to the ea 400 software. the ground at each position was sounded for the duration of at least 300 pings using the ea 400 echo sounder. as the survey focused on the potential of the echo sounder to obtain sediment characteristics, variable pulse length combinations at both frequencies were used, thus resulting in a data set of 300 pings per configuration and four configurations at each of the 32 positions. eight different hydro acoustic parameters were derived from the echo signals for later correlation with the sediment properties at the corresponding locations. bathymetric survey the bathymetric survey of the entire reservoir was made along a pre-defined survey grid. the transverse lines of the general survey grid had a track distance of approximately 50 to 100 m, while the western arm of the reservoir was surveyed at higher resolution. higher numbers of transverse lines were chosen to allow for better detecfig. 1. driven raster of the bathymetric survey in the vossoroca reservoir; the grey lines represent the driven tracks of the boat. non -co mmerc ial us e o nly 96 s. hilgert et al. tion of steep slopes. in addition to the longitudinal and transverse lines, a route close to the reservoir banks was driven to obtain a more complete data set of the shallow parts of the reservoir. to drive the boat along the pre-defined grid lines, a compass was installed on the boat for undelayed course correction. while measuring, the boat was kept as calm as possible, fast acceleration and swinging were prevented in order to reduce distorted signal detection. small changes in in heave, role or pitch were neglected during the bathymetric study. the measurements were carried out at both frequencies with a pulse length of 0.256 ms and a ping rate of 20 pings per second. the power input was set to 100 w to prevent non-harmonic distortions at 200 khz. sediment characterisation depth distribution of the digital lake model was used as a basis for the positioning of the sediment sampling points. the positions were selected in transect lines perpendicular to the general geomorphological shape and the former river bed (fig. 2). in case of very steep slopes or other inaccessible locations, the sample sites were shifted from the transects to the next possible position. during the second survey, 11 sediment cores and 21 grab samples were collected at 32 different positions. bathymetric information was used to select sampling positions, including not only the depth spectrum, but also site characteristics. to increase the density of the sampling points, the left arm and the central part of the reservoir were selected for detailed investigation. all sampling points were located in this part of the reservoir. the vessel was anchored with three anchors to ensure a stable position during the sampling and echo sounding phase. no movement of the boat occurred during data acquisition. ensonification of the sediment with the echo sounder was carried out before disturbing the sediment by taking core or grab samples. four different configurations were used fig. 2. positions of the core and grab sampling sites in the vossoroca reservoir. non -co mmerc ial us e o nly hydro-acoustic sediment characterisation 97 in order to find the best setting for sediment characterisation (tab. 2). all configurations were set to an input power of 100 w. as the variability of the signal between two successive pings may be high (burczynski, 1999), the echo sounder was set to all configurations one after another and each sampling position was ensonified for the duration of approximately one minute with 5 pings per second, resulting in a minimum of 300 pings per sampling point and configuration. bottom detection was carried out using the sonar5-pro bottom detection tool (balk et al., 2011). as a threshold for bottom detection, -36 db was chosen, as it showed best results for the automatic detection of the sediment water interface. each detected bottom line was controlled manually on pixel level to ensure correctness of bottom detection (e.g., to exclude trunks). post-processing of the echo sounder data resulted in a set of eight parameters for each ping (fig. 3). afterwards, all erroneous and extreme values were sorted out and mean values of the 300 pings were calculated for all eight parameters. this processing step was conducted in matlab r2014a (mathworks®). according to the different phases of bottom ensonification, the signal of an echo is divided into two parts (e1’ and e1) as shown in fig. 3 (burczynski, 1999). the first part covers the attack phase (duration: one pulse length from the bottom detection point) and the second the decay phase (duration: three pulse lengths from the end of the attack phase). as that part of the echo, which is created during the attack phase, is mainly caused by the bottom surface, the energy of this part of the echo (e1’) can be used as a measure of acoustic hardness or reflectivity. the part of the echo created during the decay phase is caused by diffuse backscattering from the sediment volume. as scattering depends on bottom roughness, the energy of this second part of the echo (e1) is generally described as acoustic roughness (burczynski, 1999). fig. 3. division of the first (left side) and second (right side) bottom echo into six basic hydro-acoustic parameters. tab. 2. overview of the four ea 400 echo sounder configurations with different pulse lengths. frequency (khz) configuration a configuration b configuration c configuration d pulse length (ms) pulse length (ms) pulse length (ms) pulse length (ms) 38 0.256 0.256 0.256 0.512 200 0.064 0.128 0.256 0.512 non -co mmerc ial us e o nly 98 s. hilgert et al. using the sonar 5 seabed classification tool, the attack value (hardness/ attsv1/ e1’) and decay values (roughness/ decsv1/ e1) were exported for the first bottom echo as well as for the second bottom echo, respectively the first multiple reflection (attsv2 and decsv2) (fig. 3). attsv2 and decsv2 sum up to the e2 value for the entire second bottom echo. attsv1 (e1’) and decsv1 (e1) describe the average volume backscattering strength sv1 [db] during the attack and decay phases of the first echo, respectively (orlowski, 1984). to calculate the average volume backscattering strength during either attack or decay phase, the echo strengths (sv1i) of each single sample belonging to that phase are converted into intensities, summarised, divided by the number of samples, and converted back into a db value (equations 1 and 2) (balk et al., 2011). this was performed for the first as well as for the second bottom echo. (eq.1) (eq. 2) in addition to the ‘basic’ attack and decay values, two values derived from the ‘first echo division method’ (e1’/e1) and the ‘first/second bottom ratio method’ (e1/e2) (orlowski, 1984) were exported. as further parameters, one value representing the reflected energy of the entire first bottom echo ‘attdecsv1’ (e1) and one value for the entire second bottom echo ‘attdecsv2’ (e2) were calculated (fig. 3). to obtain the average backscattering strength of the entire first second bottom echoes, respectively, attsvx and decsvx of the first and second echoes are converted into intensities. then, they are weighted using the attack and decay samples (na and nd), summarised, divided by (na + nd), and converted back into a db value using equations 3 and 4 (balk et al., 2011). (eq. 3) (eq. 4) in sonar 5 the number of attack samples (na) is 8, but the first sample that should be integrated into the decsv value is used for the calculation of neither attsv nor decsv. thus, the number of decay samples (nd) is 23 instead of 24, which must be considered in the formula when calculating e2 (poulain et al., 2011). sediment data acquisition (ground truthing) eleven sediment cores were taken from water depths between 2 and 15.7 metres. an elongated version (80 cm) of the ‘mondsee’ gravity corer by uwitech (niederreiter, 2012) was used to allow for a higher core penetration depth, as it was expected that the lower frequency is able to deeper penetrate soft sediment (dunbar et al., 1999). in addition to core sampling, 21 grab samples were taken using a petersen grab sampler (us environmental protection agency (epa), 2001). the material was put into a whirl paks® (nasco) sampling bag of two litres in volume until analysis. steep slopes and rocky sea beds proved to be harder to sample properly, as both sampling devices may tilt during sampling or rocks prevent the jaws from closing. unlike the uwitech corer, the grabber samples the top 15 cm of the deposits only and the fine fraction can be washed out partly during grabber recovery. sediment samples from both coring and grabbing were analysed for granulometry, loss on ignition (loi), organic carbon content, and wet bulk density (cores only) (harris et al., 2008). sediment sample fractions smaller than 63 µm were separated and additionally analysed for the contents of iron, phosphorus, and manganese. determination of granulometry was accomplished by wet sieving of the samples (deutsches institut fuer normung e.v., 2005), as the use of water guarantees that agglomerates dissolve and the particles are classified as the correct grain size. to obtain five classes of grain size, sieves with mesh widths of 2 mm, 500 µm, 250 µm, and 63 µm were used. the loi was measured according to din en 15169:2007, deutsches institut fuer normung e.v., (2007). between 2-5 g of each air-dried sample were filled into ceramic pots and weighed on a high-precision scale. they were then dried for 12 h at 105°c, cooled to room temperature in a desiccator, and weighed again. afterwards, the samples were burnt for two hours in a muffle furnace at 550°c, cooled down, and weighed again to determine the loi. as the sediment structure of the inner core is assumed not to be disturbed during core sampling, the wet bulk density of core samples in contrast to grab samples can be determined. this assumption was made, based on the visual findings that only the outer millimetres were affected by the impact of the tube and that the inner part of the 9 cm diameter was intact. the water saturated upper layer of the sediment settled again in most cases after the impact of the corer. a cylinder of fixed volume (17.6 cm³) was used to cut material out of the undisturbed inner core sample. from the weight of the fresh core material and the volume of the cylinder, the wet bulk density of the sediment was calculated. density was determined for each visual distinctive core layer and a vertical average was calculated for later correlation. due to the high share of fine particles in the sediment, non -co mmerc ial us e o nly hydro-acoustic sediment characterisation 99 chemical analyses concentrated on the silt and clay fractions. total carbon was determined using an eltra cs 2000 carbon sulfur determinator. the organic carbon content was calculated by subtracting the inorganic carbon content from the total carbon. total phosphorus was determined in the form of phosphate by molybdate blue analysis according to din 38405-11. the iron content was measured using flame atomic absorption spectrometry (perkin-elmer 1100b) and manganese content was measured using graphite furnace atomic absorption spectrometry (perkin-elmer simaa 6000). results sediment data (ground truthing) in all samples taken the silt and clay fraction was predominant. it accounted for an average weight of 74%, with a minimum of 15.5% and a maximum of 99.7%. however, about half of the sediment samples consisted almost completely (>90%) of silt and clay, whereas the other half contained considerable percentages of coarser fractions (fine, medium, and coarse sand and gravel). the loi ranged from 2.9% to 18.7%. wet bulk density values of the core samples varied from 1.08 g cm–³ to 1.61 g cm–³. the density of the cores correlated with various other sediment parameters, e.g. the share of particles smaller than 63 µm (r=-0.79), loss on ignition (r=-0.88), phosphorus (r=-0.80) and mn contents (r=-0.72). principal results of sediment analysis of all samples are given in tab. 3. hydro-acoustic survey to obtain a gapless 3d surface of the lake ground, the data of the bathymetric survey in the defined grid (100x50 m) were interpolated using the inverse distance weighting (idw) method (arcgis 10.2, esri). the bathymetric map shows a general depth gradient from the two major inflows to the dam with a depth maximum in front of the dam (fig. 4). the old river beds are still visible and represent the deepest depressions for each cross-section of the side arms. small branches have relatively shallow depths. the outer shape as well as the depth distribution illustrate the high morphometric complexity of the vossoroca reservoir. relationships between sediment and hydro-acoustic parameters to assess the use of the hydro-acoustic parameters for sediment characterisation and prediction, all combinations of relevant parameters were correlated. prior to the regression analyses, the sediment data sets were checked for normal distribution using the shapiro-wilk and kolmogorov-smirnov tests. with a confidence level of 5%, p-values of 0.77 for the kolmogorov-smirnov test and around 6.2 for the shapiro-wilk test were reached, which confirmed the normal distribution of the data sets. consequently, the analyses applied are statistically legitimate. tabs. 4 and 5 list the pearson r-values for the core samples and the grab samples. the 38 and 200 khz frequencies are shown next to each other for direct comparison. rvalues above the significance level are highlighted (core samples: p<0.05 for r=0.63, n=10; grab samples: p<0.01, r=0.55, n=21). for both sample types, the average performance of the lower frequency is clearly higher. in addition, the correlation with core samples reaches higher levels of conformance. the best detectable parameter is ‘density’. independently of the hydro-acoustic parameters, it reaches an average r-value of 0.62 and maximum r-values of 0.94. additionally, high correlations are reached between the particle composition and most hydroacoustic parameters. here, the best couple, % <63 µm with e1, reaches an r-value of 0.95. tab. 3. sediment key parameters from cores and grabs taken in vossoroca reservoir (n=32). mean max. min. sd cv depth (m) 8.8 15.6 2.1 3.6 0.4 loi (%) 12.1 18.7 2.9 4.4 0.4 org. carbon (%) 2.8 6.5 0.4 1.3 0.5 wet bulk density (g cm–3) 1.2 1.61 1.08 0.2 0.2 phosphorus (mg kg–1) 822 1,344 224 329 0.4 mn (mg kg–1) 341 488 190 71.3 0.2 fe (g kg–1) 42 68.3 11.4 12.6 0.3 proportion of particles <63 µm (%) 74 99.7 15.5 32.6 0.5 proportion of particles <250 µm >63 µm (%) 10.2 95.2 0.1 17.6 1.7 proportion of particles <500 µm >250 µm (%) 8.6 36.8 0 11.2 1.3 proportion of particles <2 mm >500 µm (%) 8.1 42.5 0 12.9 1.6 proportion of particles >2 mm (%) 1.7 15 0 3.2 1.9 cv, coefficient of variation. non -co mmerc ial us e o nly 100 s. hilgert et al. fig. 4. bathymetric map of the vossoroca reservoir. tab. 4. pearson r-values for the sediment and acoustic parameters based on the results obtained from the core samples of the vossoroca reservoir; in each case, the correlation for the best performing pulse length is shown only; statistical significance is given for r >0.63 p<0.05, n=10). density total p loi % <63 µm total c fe mn khz 200 38 200 38 200 38 200 38 200 38 200 38 200 38 e1’ -0.31 -0.92 -0.24 0.79 0.33 0.84 0.42 0.90 0.33 0.70 -0.42 0.69 0.19 0.72 e1 -0.64 -0.73 0.66 0.80 0.64 0.67 0.91 0.95 0.32 0.30 0.74 0.86 0.29 0.38 attdecsv1 -0.50 -0.93 0.26 0.81 0.50 0.84 0.55 0.94 0.38 0.69 -0.32 0.73 0.15 0.73 attsv2 0.65 -0.49 -0.76 0.27 -0.56 0.49 -0.82 -0.41 -0.25 0.74 -0.25 -0.56 -0.39 0.73 decsv2 -0.34 -0.94 -0.42 0.80 0.36 0.85 0.50 0.89 0.34 0.77 -0.45 0.66 -0.20 0.85 e2 0.39 -0.94 -0.54 0.77 0.31 0.86 -0.57 0.84 0.29 0.77 -0.60 0.61 -0.29 0.84 e1’/e1 -0.49 0.68 0.48 -0.48 0.39 -0.65 0.80 -0.50 -0.24 -0.72 0.78 0.53 -0.18 -0.77 e1/e2 0.67 -0.46 -0.72 0.38 -0.66 0.58 -0.91 -0.38 0.33 0.81 -0.81 -0.37 -0.33 0.80 non -co mmerc ial us e o nly hydro-acoustic sediment characterisation 101 even though some of the best correlations for grab samples reach the same range (best value: r=0.89), average values for certain parameters are clearly lower than the core sample results (tab. 5). e1/e2 is the best performing hydro-acoustic parameter at 200 khz frequency for the core samples with an average correlation of 63% over all pulse lengths and sediment parameters. for the 38 khz frequency, the best overall parameters are e1’, attdecsv1, and decsv2 with an average performance of 79%. for the correlation with the sediment characteristics obtained from grab samples, the e1 parameter produced the best results at both frequencies, with 68% at 200 khz and 67% at 38 khz. the best performing parameter couples for core samples averaged over all pulse lengths are e1/e2 with % <63 µm, with 74% at 200 khz frequency, and e1 combined with % <63 µm resulting in a correlation of 95%. for the grab samples, the best single sediment parameter is % <63 µm with 73% over all pulse lengths at 38 khz combined with the e1 parameter. the best detectable sediment parameter at 200 khz is the organic carbon content with 85% based on the attdecsv1 values. effect of pulse duration at all sampling positions, the listed pulse lengths (tab. 2) were used one after the other to investigate differences of the correlations with sediment parameters. since the pulse length has an influence on the hydroacoustic resolution, a variation in correlation performance can be expected (guillard et al., 2009). fig. 5 compares the effect of different pulse lengths on the r²values for selected hydro-acoustic features obtained using the 200 and 38 khz frequencies with core samples for ground truthing. for the 200 khz frequency, the shortest pulse length produces the best correlations independent of the sediment parameter. this accounts for the e1 as well as for the e1/e2 parameter, which includes energy patterns of the second bottom echo. the same result is shown by the e1 parameter for the 38 khz frequency, with the correlation being significantly better with shorter pulse length. different results are obtained for the e1/e2 parameter at 38 khz. all hydro-acoustic features measured at 38 khz, inclusive of the second bottom signal (attsv2, decsv2, e2, e1/e2), show better correlations for the longer pulse duration. cores versus grabs fig. 6 illustrates the overall result of correlations of hydro-acoustic values with sediment data obtained from core samples being significantly higher. this holds for both frequencies used in this survey. while the difference between core-related results and grab-related results is high for the attsv2-parameter, the difference is only marginal for the e1’ parameter. as the part of the signal processed for the e1’ parameter represents the first layer of the sediment only, the small difference between core and grab results is in accordance with the sampling depth of the grab sampling device (0-20 cm). both sampling techniques will produce comparable sediment samples for the upper sediment layer. in contrast to this, the results for all acoustic parameters, including deeper layers of the sediment, differ considerably between core and grab samples. in these cases, the correlation with the sediment parameters obtained from the core samples and, hence, from deeper layers fit well to the values of the hydro-acoustic survey. discussion combining two frequencies, various pulse lengths and multiple physical and chemical sediment parameters surveyed in the vossoroca reservoir in brazil resulted in a set of good and moderately correlated parameters. significant differences between the 200 and 38 khz frequencies and the tested sediment parameters were found. among these parameters were wet bulk density, granulometry, phostab. 5. pearson r-values for the sediment and acoustic parameters based on the results obtained from the grab samples of the vossoroca reservoir; in each case, the correlation for the best performing pulse length is shown only; statistical significance is given for r >0.55 (p 0.01, n=21). total p loi % <63 µm total c fe mn khz 200 38 200 38 200 38 200 38 200 38 200 38 e1’ 0.61 0.52 0.45 0.52 -0.47 0.72 0.89 0.29 0.51 0.43 -0.25 0.26 e1 0.75 0.75 0.72 0.73 0.72 0.79 0.80 0.66 0.73 0.73 0.36 0.39 attdecsv1 0.61 0.65 0.46 0.58 0.40 0.78 0.89 0.40 0.51 0.57 0.23 0.45 attsv2 0.38 -0.21 0.22 -0.21 -0.21 0.14 0.79 -0.52 0.32 -0.12 -0.32 0.17 decsv2 0.55 0.60 0.40 0.56 -0.37 0.73 0.89 0.39 0.47 0.53 0.21 0.36 e2 0.52 0.58 0.36 0.53 -0.35 0.72 0.88 0.37 0.44 0.51 0.18 0.36 e1’´/e1 0.73 0.47 0.64 0.40 0.63 0.34 0.84 0.61 0.72 0.52 0.29 0.26 e1/e2 -0.78 -0.37 -0.74 -0.43 -0.79 -0.28 -0.73 -0.57 -0.74 -0.40 -0.40 0.09 non -co mmerc ial us e o nly 102 s. hilgert et al. phorus content, organic c as well as iron and manganese contents. comparison of the correlations of sediment parameters obtained from core or grab sampling revealed that core samples are clearly better suited for ground truthing. additionally, analysis of the correlation performance of a range of tested pulse lengths showed that most echo features produce better results at shorter pulse lengths. in additional experiments, depth dependence on seabed classification was investigated, but since the results did not show any clear tendencies, they are not presented in this article. as most of the available literature does not focus on the acoustic determination of sediment properties like carbon content or total p content, data available for comparison are scarce. still, the results can be compared partly with the results from anderson and pacheco (2011). comparable are the r-values at 200 and 38 khz for the acoustic parameters e1’/e1 and e1/e2 and the sediment parameters clay content, loi, and total p. the results show similar tendencies. while the 200 khz frequency can detect the granulometric properties, the 38 khz fails to reach a significant level of correlation (tab. 4). the loi and total p content are largely described by the e1/e2 parameter, but not by the e1´/e1. this is in conflict with the results fig. 5. comparison of r2-values obtained with different pulse lengths for selected hydro-acoustic features using 200 and 38 khz frequencies and core samples for ground truthing. non -co mmerc ial us e o nly hydro-acoustic sediment characterisation 103 of anderson and pacheco (2011). thirty eight khz r-values for loi and p content show different patterns, as the e1´/e1 parameter produces better results compared to the e1/e2. in general, the p content could be correlated with high r-values, which contradicts the results presented by anderson and pacheco, 2011. even if the exact values differ from the results of anderson and pacheco (2011), it can be stated that the granulometric properties of the sediment can be related directly to the acoustic parameters. taking into account other acoustic parameters (e1’, e1, e2) and their correlations with granulometric features, even higher correlations of up to 93 % were found (tab. 4). the best correlations were obtained for the wet bulk density and the share of particles <63 µm. the negative correlation with the wet bulk density can be attributed to the presence of gas bubbles in the sediment matrix. bubbles cause a lower wet bulk density and a higher reflection intensity, since accumulations of gas bubbles represent strong reflectors of sound impulses (anderson et al., 1998; anderson and martinez, 2015). this assumption fits to the strongly positive correlation with the share of the silt and clay fraction. finer sediment layers are prone to have an increased content of organic carbon and, hence, a higher potential productivity of gas in the sediment. averaging of the correlation results for silt and clay at 38 khz in anderson and pacheco, 2011 yielded -0.31, which is very close to the r-value of -0.28 obtained here. additionally, the correlations for total p (r=-0.37, 38 khz) and loi (r=-0.43, 38 khz) reproduce the published results well. it can be concluded that i) correlation and ii) the coefficient values yielded similar results for comparable parameter combinations. in contrast to literature, this study shows highly significant correlations for total p (r >0.93) (attdecsv1, decsv2, e2) and various sediment attributes (tab. 4). in general, the results at 38 khz frequency produce slightly higher correlation coefficients than at 200 khz frequency. for the grain size parameters, the coefficients have similar values (van walree et al., 2005). this agreement between the hydro-acoustic response of the phosphorus content and the particle size distribution seems to be reasonable, since most phosphorus species are primarily bound to the silt and clay fraction. furtherfig. 6. comparison of the correlation results of the eight hydro-acoustic parameters with % <63 µm for both frequencies and cores and grabs. the bars show the average r2-value while the error bars represent the maximum and minimum values from the different configurations. non -co mmerc ial us e o nly 104 s. hilgert et al. more, the density of the sediment was clearly better detected by the 38 khz frequency, reaching correlations of 95% (bentrem et al., 2002). the better correlation is due to the position of the density measurements in the cores. sampling material was extracted from around 10 cm below the sediment / water interface, which reduces the potential share of the sediment volume represented in the returned 200 khz acoustic signal, because the 200 khz frequency is not able to penetrate the sediment very deeply. especially a shorter pulse length reduces the signal-relevant sediment depth. grab sampling for ground truthing is a widely spread standard method. however, the presented results show a significant difference between ground truthing results from cores and grabs (fig. 6). this especially applies to physical sediment parameters, but also to the loi and organic c. differences between cores and grabs are highest for all correlations, including second bottom-echo features, and lowest for the e1’ parameter. the results can be explained by the fact that the sediment relevant to the e1’ parameter is the same for both sampling approaches, while the sediment volume ensonified during the e1 phase (4 * τ=up to 3 m) cannot be sampled with a grab sampler. since the influence of the sediment volume properties increases from the first to the second bottom echo, the difference between cores and grabs is enhanced. here, the internal sediment layering plays an important role (ostrovsky and tęgowski, 2010). due to the higher penetration depth of the 38 khz frequency, the influence of the sediment volume is even stronger. for this reason, divergence between core and grab results is larger than at the 200 khz frequency. additionally, it must be stated that the sediment type may play a major role regarding the influence of the sampling method. in the presented case, sediment could be properly sampled with both techniques. however, higher shares of coarse material (e.g., gravel) or lower cohesion of the sample volume may lead to biased results between core and grab samples. regarding the discrepancy between the ensonified footprint area and the surface sampled by the grabber or sediment corer, a potential bias might occur. during this study, the mean sampling depth was 8.8 m. for the 200 khz frequency, it caused a footprint of ~3.8 m² and for the 38 khz frequency of ~12.2 m². it can be assumed that, except for very narrow side arms, the sediment composition does not change significantly within 2-3.5 m. consequently, the relatively small sampling area of the corer and grabber can be neglected until a certain depth. for sediment investigations at greater depth, a higher number of sediment samples per sampling location seems to be advisable. based on the results presented, the echo sounder settings can be optimised for sediment characterisation. specific settings can be chosen for the sediment parameter to be determined. in dependence to the used frequency, a shorter pulse length will produce better classification results. optimal configurations allow for a good estimation (r=0.9-0.95) of the granulometry, bulk density or even loi. lower but still significant results were achieved for total p (r=0.81). additionally, the results show that core sampling produces significantly better results. the presented results prove that under the given conditions, sediment characteristics can be detected. especially in morphometrically complex systems, this will ensure improved sediment monitoring and, later on, better management strategies, as they are based on sediment information. here, information on the sediment type (granulometry) and potential organic content or even phosphorus content can help in planning sediment disposal. sediment information can also be used in the context of methane production, as the productivity of the sediment is linked to the amount of organic carbon in the sediment (sobek et al., 2012). conclusions • the exact configuration of the echo sounder has a strong influence on potential sediment characterisation and sediment feature correlation. • shorter pulse lengths produce better ground truthing results. • core samples produce significantly better results for ground truthing than grab samples, especially at the lower frequency and for decay-related hydro-acoustic features. • in addition to physical parameters, chemical parameters can be included in hydro-acoustic sediment characterisation. • the produced information may significantly improve sediment management even in large-scale reservoirs. acknowledgments many thanks go to the ufpr, dhs research team with prof. fernandes, prof. bleninger, and julio werner as well as to the technical staff of the dhs, who supported the research activities. we also thank prof. helge balk from the university of oslo for support with the sonar5-pro software. for the gps support, we thank prof. claudia krueger from the departamento de geomática, ufpr. additional thanks go to prof. fernandes, prof. bleninger, and prof. helge balk for reviewing this article. references amiri-simkooei ar, snellen m, simons dg, 2011. principal component analysis of single-beam echo-sounder signal features for seafloor classification. ieee j. ocean. eng. 36:259-272. non -co mmerc ial us e o nly hydro-acoustic sediment characterisation 105 anderson al, abegg f, hawkins ja, duncan me, lyons ap, 1998. bubble populations and acoustic interaction with the gassy floor of eckernförde bay. cont. shelf res. 18:18071838. anderson jt, van holliday d, kloser r, reid dg, simard y, 2008. acoustic seabed classification: current practice and future directions. ices j. mar. sci. 65:1004-1011. anderson ma, martinez d, 2015. methane gas in lake bottom sediments quantified using acoustic backscatter strength. j. soil. sediment. 15:1246-1255. anderson ma, pacheco p, 2011. characterization of bottom sediments in lakes using hydroacoustic methods and comparison with laboratory measurements. water res. 45:4399-4408. balk h, lindem t, sánchez-carnero n, 2011. sonar4 and sonar5 post processing systems. operator manual version 6.0.1. extension for seabed classification tool. bentrem fw, sample j, kalcic mt, duncan me, 2002. highfrequency acoustic sediment classification in shallow water. oceans-ieee 1:7-11. burczynski j, 1999. bottom classification. available from: www.biosonicsinc.com deutsches institut fuer normung e.v., 2005. aggregates test methods. determination of particle size distribution by wet sieving. beuth verlag gmbh. deutsches institut fuer normung e.v., 2007. characterization of waste. determination of loss on ignition in waste, sludge and sediments. beuth verlag gmbh. dunbar ja, allen pm, higley pd, 1999. multifrequency acoustic profiling for water reservoir sedimentation studies. j. sediment. res. 69:521-527. freitas r, sampaio l, oliveira j, rodrigues am, quintino v, 2006. validation of soft bottom benthic habitats identified by single-beam acoustics. mar. pollut. bull. 53:72-79. friedl g, wüest a, 2002. disrupting biogeochemical cycles consequences of damming. aquat. sci. 64:55-65. guillard j, godlewska m, colon m, doroszczyk l, dlugoszewski b, 2009. standartization of hydroacoustic methods effect of pulse duration. in: proc. 3rd int. conf. and exhibition of underwater acoustic measurements: technologies & results, nafplion, greece. hamilton lj, parnum i, 2011. acoustic seabed segmentation from direct statistical clustering of entire multibeam sonar backscatter curves. cont. shelf res. 31:138-148. harris mm, avera we, abelev a, bentrem fw, bibee ld, 2008. sensing shallow seafloor and sediment properties. recent history. oceans-ieee 2008(suppl.):1-11. niederreiter r, 2012. uwitech sampling equipments. available from: www.uwitec.at/html/frame.html odhiambo bk, boss sk, 2004. integrated echo sounder, gps, and gis for reservoir sedimentation studies: examples from two arkansas lakes. j. am. water resour. as. 40:981-997. orlowski a, 1984. application of multiple echoes energy measurements for evaluation of sea bottom type. oceanologia 1984:61-78. ostrovsky i, tęgowski j, 2010. hydroacoustic analysis of spatial and temporal variability of bottom sediment characteristics in lake kinneret in relation to water level fluctuation. geomar. lett. 30:261-269. parnum i, siwabessy j, gavrilov a, parsons m, 2009. a comparison of single beam and multibeam sonar systems in seafloor habitat mapping, p. 155-162. in: proc. 3rd int. conf. and exhibition of underwater acoustic measurements: technologies & results, nafplion, greece. poulain t, argillier c, gevrey m, guillard j, 2011. identifying lakebed nature: is it feasible with a combination of echosounder and sonar5-pro? adv. oceanogr. limnol. 2:49-53. preston jm, 2009. automated acoustic seabed classification of multibeam images of stanton banks. app. acoust. 70:12771287. republic of brazil canambra engineering consultant, united nations development programme,1969. power study of south brazil. sobek s, delsontro t, wongfun n, wehrli b, 2012. extreme organic carbon burial fuels intense methane bubbling in a temperate reservoir. geophys. res. lett. 39:l01401. tęgowski j, 2005. acoustical classification of the bottom sediments in the southern baltic sea. quatern. int.130:153-161. us environmental protection agency, 2001. measurement and monitoring technologies for the 21st century. available from: https://clu-in.org/programs/21m2/ van walree pa, tęgowski j, laban c, simons dg, 2005. acoustic seafloor discrimination with echo shape parameters: a comparison with the ground truth. cont. shelf res. 25:2273-2293. wcd (world commission on dams), 2000. dams and development: a new framework for decision-making. earthscan publications, london. non -co mmerc ial us e o nly layout 1 cost (european cooperation in science and technology) is a funding agency for research and innovation networks. cost actions help connect research initiatives across europe and enable scientists to grow their ideas by sharing them with their peers. this boosts their research, career and innovation. www.cost.eu this themed issue results from international collaboration within cost action es1105 “cyanocost cyanobacterial blooms and toxins in water resources: occurrence, impacts and management” (www.cyanocost.net) running from 2012 to 2016. the cyanocost action is acknowledged for adding value to this work through networking and knowledge sharing with european experts. the action has involved 32 countries. state of the art research and management capabilities in europe on cyanobacteria have benefited from input from the basic and applied life sciences, the human and animal health sectors, water engineers, economists and planners. many of these professional groups have been brought together and they interacted favourably within the framework of cyanocost. the general goals of the action have been to widen awareness, spread relevant technical competence, and share risk management experience and expertise in the field. the action has developed and provided tools to end-users (public health and environment authorities, water utilities, aquaculture, tourism and recreation sectors) by pooling and coordinating expertise from throughout europe and has contributed to harmonizing methods and practices, thereby protecting public health, enterprises and investments. the 13 papers published in this themed issue are grouped under six thematic topics and the contents of the papers are briefly explained below. the descriptions of the papers have been kindly compiled by the guest editors. cyanobacteria occurrence rare occurrence of nine microcystis species (chroococcales, cyanobacteria) in a single lake (lake dojran, fyr macedonia) by krstić, aleksovski and komárek presents an ecological and thorough taxonomic study of the plankton community in lake dojran. it revealed the co-existence of nine microcystis species, provided detailed morphological features, and corroborated the necessity to change the accepted morphospecies concept into a separation of microcystis taxa as distinct species. cyanobacteria and cyanotoxin environmental occurrence and monitoring a comparative study of the metabolic profiles of common nuisance cyanobacteria in southern perialpine lakes by cerasino, capelli and salmaso used target and non-target metabolite profiling to identify differences in the production of known cyanotoxins and other secondary metabolites, primarily non-ribosomal peptides, in 14 strains of 5 cyanobacterial species from several perialpine lakes. monitoring a newly re-born patient: water quality and cyanotoxin occurrence in a reconstructed shallow mediterranean lake by gkelis, panou, chronis, zervou, christophoridis, manolidi, triantis, kaloudis, hiskia, kagalou and lazaridou discusses cyanobacterial abundance and diversity, toxin levels, physico-chemical and ecological characteristics in the recently reconstructed lake karla in greece, showing immediately occurring problems with cyanobacterial water blooms, toxin production and degradation of ecological status. molecular detection of hepatotoxic cyanobacteria in inland water bodies of the marmara region, turkey by köker, akçclaan-albay, albay and neilan for the first time identifies production of the cyanobacterial hepatotoxins microcystin (mc) and nodularin (nod) using pcr in combination with hplc in bloom samples and cyanobacterial strains isolated from lakes in marmara. advances in oceanography and limnology, 2017; 8(1): 1-3 article doi: 10.4081/aiol.2017.6674 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). foreword to the themed issue “cyanobacteria” triantafyllos kaloudis,1 jussi meriluoto,2,3* ludek blaha4 1department of water quality control, athens water supply and sewerage company, athens, greece; 2biochemistry, faculty of science and engineering, åbo akademi university, tykistökatu 6a, 20520 turku, finland; 3laboratory for paleoenvironmental reconstruction, faculty of sciences, university of novi sad, trg dositeja obradovica 2, 21000 novi sad, serbia; 4recetox, faculty of science, masaryk university, kamenice 5, 62500 brno, czech republic *corresponding author: jussi.meriluoto@abo.fi non -co mmerc ial us e o nly t. kaloudis et al.2 mc/nod were associated with microcystis aeruginosa, planktothrix rubescens and nodularia spumigena strains. mc/nod were detected also in a m. wesenbergii strain, while p. agardhii strains and blooms were mostly negative for hepatotoxin production. first report of cyanobacterial paralytic shellfish toxin biosynthesis genes and paralytic shellfish toxin production in polish freshwater lakes by savela, spoof, höysniemi, vehniäinen, mankiewicz-boczek, jurczak, kokociński and meriluoto is a broad study on the cyanobacterial community of 34 lakes in western poland. it identified an established subpopulation of potential paralytic shellfish toxin (pst) producers, through the analysis of pst biosynthesis genes by pcr and qpcr, and pst production by hplc-fld in environmental samples. cyanobacterial dynamics and toxins concentrations in lake alto flumendosa, sardinia, italy by stefanelli, scardala, cabras, orrù, vichi, testai, funari and manganelli presents the long-term characterization of a cyanobacterial community and mc production in lake alto flumendosa (sardinia). the research demonstrated the predominance of p. rubescens, microcystis botrys and woronichinia naegeliana, and the significant persistence of toxic populations. cyanobacteria and cyanotoxins in drinking water – occurrence, monitoring, removal methods can cyanobacteria infect underground water sources? indications from small scale monitoring of a natural drinking water source (short note) by gkelis and vlamis presents the results of a small scale monitoring program in a greek water company demonstrating for the first time the presence of cyanobacteria in bottled natural mineral drinking water. the results indicate a potential hazard in this kind of product. cyanobacteria and microcystin contamination in untreated and treated drinking water in ghana by addico, hardege, kohoutek, degraft-johnson and babica shows frequent occurrence of cyanobacteria and mcs in nontreated water in treatment plants in ghana. water treatment significantly eliminated both cyanobacteria and mcs but toxins (maxima around 0.8 microgram per liter) were still found in approximately 15-20% samples of the treated water. chlorination and ozonation differentially reduced the microcystin content and tumour promoting activity of a complex cyanobacterial extract by sovadinová, babica, adamovský, alpatova, tarabara, upham and bláha demonstrated that ozone effectively removed all mcs from an extract of microcystis sp., and significantly reduced the overall tumour promotional potency of the sample. chlorination was much less effective and high doses of chlorine further produced toxic by-products. cyanotoxin detection techniques non-competitive elisa with broad specificity for microcystins and nodularins by akter, vehniäinen, meriluoto, spoof and lamminmäki reports the development of an easy-to-perform assay for generic detection of mcs and nod. the recombinant anti-immunocomplex antibody based non-competitive elisa was capable of detecting eleven toxin variants (mc-lr, -dmlr, -rr, -dmrr, -yr, la -ly, -lf -lw, -wr, and nod-r) below the who guideline concentration for mc-lr. cyanobacteria and cyanotoxins long term monitoring/reviews for specific geographical regions assessment of cyanoprokaryote blooms and of cyanotoxins in bulgaria in a 15-years period (2000-2015) by stoyneva-gäertner, descy, latli, uzunov, pavlova, bratanova, babica, maršálek, meriluoto and spoof presents a summary of results from studies carried out on 120 water bodies in bulgaria, where the cyanoprokaryote diversity was quite high (210 taxa of 60 genera). blooms were recorded in 14 and cyanotoxins were detected in 16 water bodies including 3 drinking water reservoirs. review of 130 years of research on cyanobacteria in aquatic ecosystems in serbia presented in a serbian cyanobacterial database by svirčev, tokodi and drobac presents an overview of the unique database concerning cyanobacterial distribution, cyanotoxin production and associated biological effects in different types of water bodies throughout the republic of serbia. review/synoptic paper of cyanocost research and activities toxic cyanobacteria and cyanotoxins in european waters – recent progress achieved through the cyanocost action and challenges for further research presented by 21 authors is a review summarising the outcomes of recent european research concerning toxic cyanobacteria and cyanotoxins, with an emphasis on developments within the framework of cyanocost. it highlights achievements and challenges for the phycological and ecological studies, analytical and detection approaches, toxicological research, management of toxic blooms as well as practices for cyanotoxin removal. non -co mmerc ial us e o nly foreword 3 acknowledgments this publication is based upon work from cost action cyanocost, supported by cost (european cooperation in science and technology). we would like to express our sincere thanks to all the themed issue authors. we knew the cyanocost community has potential for scientific work of the very highest quality but we were still positively surprised when we saw the great interest for this themed issue expressed by numerous authors across europe. we believe that many of the articles will have long-lasting usefulness for the cyanocost community as well as for a broad audience of international researchers and experts. we want to acknowledge and congratulate the four guest editors of this themed issue, pavel babica, camilla capelli, damjana drobac and spyros gkelis, for their highly professional editorial work. the co-editorin-chief of advances in oceanography and limnology nico salmaso is cordially thanked for his help and goodwill in realising the themed issue. our further thanks go to those many people who have had various responsibilities within the cyanocost action: the working group leaders and deputy leaders, those who produced handbooks and another themed issue within the action (see the review paper by meriluoto et al. in this themed issue). we want to express our gratitude to those who were responsible for the financial and administrative parts of the action, those who organised meetings and training schools, those who prepared and hosted the short-term scientific missions, and all others making cyanocost a success story. science officer dr. deniz karaca, administrative officer ms. tania gonzalez ovin and rapporteur mr. dick blaauboer from the cost organisation are warmly thanked for their support. triantafyllos kaloudis chairman of cyanocost jussi meriluoto working group 1 leader of cyanocost ludek blaha vice-chairman of cyanocost funded by the horizon 2020 framework programme of the european union non -co mmerc ial us e o nly layout 1 introduction cyanobacteria are ubiquitous microorganisms, which cause environmental and health issues in lakes and reservoirs. the massive development of cyanobacteria alters the bio-chemical equilibrium in the water basin, possibly resulting in a deterioration of the water quality. environmental alterations caused by climate changes, eutrophication and hydrological changes are considered the major factors favoring the dominance and the spreading of cyanobacteria in freshwaters (schindler, 2006; paerl and huisman, 2009; schopf, 2012; hamilton et al., 2016). many blooms-forming cyanobacteria have the potential of producing toxic secondary metabolites, which cause serious illnesses in case of human exposure (by ingestion, inhalation or skin contact). for this reason, many countries have issued specific regulations for preventing human exposure to cyanobacterial toxins both from drinking and recreational activities (welker and von döhren, 2006; iarc, 2010; chorus, 2012). most of the bioactive metabolites produced by cyanobacteria can be classified in two major chemical classes: peptides and alkaloids. microcystins (mcs) and nodularins (nods) belong to the former class with mcs representing the most common toxins. anatoxins (atxs), cylindrospermopsins (cyns) and paralytic shellfish poisons (psps) represent instead the most common toxic alkaloids found in cyanobacteria. the just cited compounds have attracted a lot of interest by the research community which has led to the development of efficient analytical procedures, and standardized extraction and analysis protocols are already available or on the way to be so (codd, 1995; zurawell et al., 2005; van apeldoorn et al., 2007). other bioactive compounds, sometimes produced by cyanobacteria in comparable amounts with the toxins reported above, have gained less interest and, consequently, there is a very limited knowledge about their occurrence. for example, anabaenopeptins, aeruginosins, microginins and microviridins are metabolites that are potentially toxic for mammals (shin et al., 1995; neumann et al., 1997; advances in oceanography and limnology, 2017; 8(1): 22-32 article doi: 10.4081/aiol.2017.6381 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). a comparative study of the metabolic profiles of common nuisance cyanobacteria in southern perialpine lakes leonardo cerasino,1* camilla capelli,1,2 nico salmaso1 1department of sustainable agro-ecosystems and bioresources, iasma research and innovation centre, fondazione edmund mach (fem), via e. mach 1, 38010 san michele all’adige (tn); 2department of biology, university of florence, via madonna del piano, 6, 50019 sesto fiorentino (fi), italy *corresponding author: leonardo.cerasino@fmach.it abstract this work allowed the comparison of the metabolic profiles of the most important cyanobacteria species in southern perialpine lakes, namely aphanizomenon flos-aquae, dolichospermum lemmermannii, microcystis aeruginosa, planktothrix rubescens, and tychonema bourrellyi. monospecific cultures were obtained from samples of 3 different natural lakes (garda, idro, and caldonazzo). lcms/ms analyses were conducted on strains. a first set of experiments was aimed at assessing the presence of the best known toxins (microcystins, nodularins, (homo)anatoxin-a, cylindrospermopsins, paralytic shellfish poisons) in the cultures. results of this screening study revealed that m. aeruginosa and p. rubescens produced toxic peptides (microcystins), t. bourrellyi produced toxic alkaloids (anatoxin-a and possibly some paralytic shellfish toxins), aph. flos-aquae and d. lemmermannii did not produce any of the analyzed toxins. m. aeruginosa and p. rubescens showed typical microcystin production with lr form dominant in the former, and rrdm form dominant in the latter. a second set of experiments was aimed at comparing the capability of the 5 cyanobacterial species to produce peptidic secondary metabolites. for this purpose, an untargeted peptidomic analysis was conducted on the strains. the analysis allowed revealing globally 328 metabolites, spanning in a mass range between 400 and 2000 da. the majority of compounds with masses in the 5001200 da range (corresponding to the majority of peptidic secondary metabolites) resulted to be produced by m. aeruginosa and p. rubescens strains, thus indicating a higher ability of these species to produce non-ribosomal peptides compared to the others. 27 metabolites out of 328 could be putatively assigned to specific classes of compounds: microcystins, aeruginosins and anabaenopeptins were the most represented classes of compounds, and were mostly found in m. aeruginosa and p. rubescens strains. key words: cyanobacteria; perialpine lakes; metabolic profiles; cyanotoxins; lc-ms. received: november 2016. accepted: may 2017. non -co mmerc ial us e o nly metabolic profiles of cyanobacteria in perialpine lakes 23 murakami et al., 2000; blom et al., 2006; bubik et al., 2008; ersmak et al., 2008). since they can contribute to the total toxicity of a given cyanobacteria population, the lack of information about their presence can potentially bias a correct risk assessment. besides the health issue aspects, some of these metabolites have attracted interest for biotechnological applications, for example as source of new therapeutic agents (sivonen and borner, 2008; anas and harada, 2016). genetic diversity in cyanobacteria is reflected also in the secondary metabolites profiles. different species exhibit different metabolic profiles, but also different strains of the same species can show substantial differences in the metabolites profile (moore, 1996; janse et al., 2005; kardinaal et al., 2007; yepremian et al., 2007; rohrlack et al., 2008; agha et al., 2014). in addition, genetically identical organisms can exist as different chemotypes. this might be due to the high plasticity of the metabolic pathways, which can re-arrange with no or minimal genetic changes (fischbach et al., 2008; nikolouli and mossialos, 2012). lakes in the southern perialpine region are experiencing a change in their cyanobacteria composition and structure. five toxic species are commonly found in these lakes: aphanizomenon flos-aquae ralfs ex bornet & flahault, dolichospermum lemmermannii (richter) p.wacklin, l.hoffmann & j.komárek, microcystis aeruginosa (kützing) kützing, planktothrix rubescens (de candolle ex gomont) anagnostidis & komárek, and tychonema bourrellyi (j.w.g.lund) anagnostidis & komárek. t. bourellyi has appeared in recent years and is replacing other species (salmaso et al., 2016). changes in cyanobacteria populations lead to changes in toxic potential, as different species have a very different toxin diversity. these changes have therefore a great impact on the management of the risk connected with cyanobacterial blooms. t. bourrellyi for example is an atx producer that is becoming dominant in lakes formerly dominated by mc producers (salmaso et al., 2016). in order to have a clear picture of the toxic potential of these five species, we have conducted a detailed investigation aimed at identification of the toxins produced by them. we used sensitive and selective lc-ms/ms techniques for the analysis of a broad spectrum of known toxins (mcs, nods, atxs, cyns, and psps). in order to get more information on the secondary metabolites of these species and possibly identify additional bioactive ones, we analyzed the peptidomic profiles of the five species. methods isolation of strains and culturing methods samples were collected from three lakes located in the eastern italian perialpine area: lakes garda, idro and caldonazzo. strains of p. rubescens, t. bourrellyi, and d. lemmermannii were isolated from lake garda in summer/early autumn of 2014. strains of aph. flos-aquae and m. aeruginosa were isolated, respectively, in april 2014 from lake idro and in august 2015 from lake caldonazzo. water samples were collected in the deepest point of the basins, by vertical tows from 30 m to the surface with 25 cm diameter plankton net (80 µm mesh) and maintained at 20°c until processed (within 24 h). single strains were isolated under a macroscope (wild m420) using a microcapillary and identified according to komárek and anagnostidis (2005). after 3-4 washings in z8 medium (kotai, 1972), strains were grown, under nonaxenic conditions, in microtiter plates filled with 3 ml z8 medium, and then transferred to the final volume of 150 ml z8 medium in cell culture flasks (cellstar, greiner bio-one gmbh, kremsmünster, austria). aph. flos-aquae was grown in z8 medium without nitrogen (kotai, 1972). all cultures were grown in climatic simulation chamber (proclimatic, imola, bo, italy) at 20°c, using continuous light (25 µmol m–2 s–1) in the case of p. rubescens, t. bourrellyi, and aph. flos-aquae, and a 16:8 h light:dark photoperiod in the case of d. lemmermannii and m. aeruginosa. culturing conditions were those allowing an optimal growth for each cyanobacterial species. metabolites extraction and lc-ms/ms analysis all solvents and reagents used in the following procedures were of lc-ms grade and where all provided by sigma-aldrich (milan, italy), if not otherwise specified. lc-ms/ms analysis were performed using a waters acquity uplc system, directly coupled to a sciex 4000 qtrap hybrid mass spectrometer equipped with a turbo ion spray interface. biomass was harvested from the culture by filtration (between 200 and 250 ml) on 1.2 µm gf/c filters (whatman-ge healthcare life sciences, little chalfont, uk). extraction of metabolites was achieved by extraction with 6 ml of acetonitrile/water mixture (60/40 v/v) containing 0.1% formic acid; the sample was firstly homogenized (omni th probe homogenizer, omni-inc., kennesaw, ga, usa) for 5 min and then sonicated (omniruptor4000 probe sonicator, omni-inc.) for 4 min, using 160w power in pulsed mode (50%). the solution was separated from the pellet by centrifugation (eba 20, hettich, tuttlingen, germany) for 6 min at 9850 g. the pellet was then treated with a second aliquot of extraction mixture (6 ml) and sonicated. after centrifugation, the two aliquots were put together and concentrated in a centrifugal evaporator (mivacduo, genevac ltd., ipswich, uk) down to approximately 2 ml. acetonitrile was then added up to reach a 60/40 ratio between organic solvent and water. the solution was then filtered on 0.2 µm pore size rc syringe filters (phenomenex, castel maggiore, bo, italy), and analyzed by lc-ms/ms. non -co mmerc ial us e o nly l. cerasino et al.24 targeted mcs and nods analysis was performed using reverse phase chromatography, using a phenomenex kinetex xb-c18 column (1.7 μm particle size, 2.1×50 mm). the mass detector was operated in the positive electro spray mode (esi+) using the multiple reaction monitoring (mrm) scanning mode. the method was optimized for the detection of commercially available analytical standards mc-rr, [d-asp3]-rr, yr, lr, [dasp3]-lr, wr, la, ly, lw, lf, nod-r (sigma-aldrich co., st. louis, mo, usa) and their variants (demethylated forms), and could potentially detect up to 40 mc congeners. a detailed description of the method is reported in cerasino et al. (2016). targeted alkaloids analysis was performed by hilic, using an ascentis express oh5 column (2.7 µm particle size, 50x2.1 mm, sigmaaldrich co., usa). elution was achieved by a binary gradient of eluents a (1% acetonitrile in water, containing 10 mm ammonium formate and 10 mm formic acid) and b (95% acetonitrile in water, containing 10 mm ammonium formate and 10 mm formic acid) according to the following scheme: t=0 (90% b), t=5 min (50% b), t=7 min (90% b), t=8 min (90% b). flow rate was 0.3 ml min–1 and total run time was 8 min. standard injection volume was 2 µl. mass detector was operated in scheduled mrm mode using positive electrospray ionization (esi+). general settings were as follows: ion spray voltage 5000 v, entrance potential 10 v, cell exit potential 10 v, and interface heater temperature 300°c. for toxin identification, two transitions were monitored for each analyte (tab. 1). the method was set up using certified analytical standards: homoatx (novakits, france), atx (tocris, uk), cyn (vinci biochem, italy), saxitoxin (stx), decarbamoyl stx (dcstx), neostx, gonyautoxin 1 (gtx 1), gtx4, gtx5, c1 and c2, (nrc-cnrc, canada). a reference chromatogram is provided in fig. 1. retention times of analytes showed excellent stability over time. the method was suitable for the quantification of these toxins, at least in the working range between 0.2 and 200 µgl–1. nevertheless, only a semi-quantitative analysis was performed in this investigation owing to the heterogeneity of the cultures. a tentative detection of other psp congeners not available as pure standards was performed, using transitions and mssettings (cf. tab. 1) taken from relevant literature (dell’aversano et al., 2005; halme et al., 2012). untargeted metabolic profiling experiments were contab. 1. chromatographic and mass spectrometric parameters for alkaloids’ targeted analysis. [m+h]+ indicates the observed “quasimolecular” ion for any given toxin. it usually corresponds to the precursor ion in mrm transitions. in some cases, however, other ions are used as precursor because the intensity of the [m+h]+ adducts is too low (c1/2 and c3/4 toxins). for each compound two mrm transitions have been monitored. in the case of the pairs of isomeric compounds gtx1/4 and c1/2, the two transitions of the pairs coincide. limits of quantification (loq) are also reported for each compound. toxin rt (min) [m+h]+ precursor ion (m/z) product ions (m/z) dp (v) ce (v) loq (µgl–1) hatx 0.82 180 180 145 60 23 2.0 135 60 23 atx 0.98 166 166 149 60 21 0.5 131 60 24 cyn 2.50 416 416 194 80 53 2.0 336 80 32 gtx1/4 3.48 (gtx1)+3.72 (gtx4) 412 412 332 40 20 15.0 412 332 ([m+h-so3]+) 314 86 27 c1/2 3.66 (c1)+3.93 (c2) 476 493 ([m+h+nh3]+) 396 40 13 10.0 476 396 ([m+h-so3]+) 298 80 27 neostx 4.08 316 316 298 70 25 30.0 220 70 25 gtx5 4.10 380 380 300 50 21 5.0 282 50 25 stx 4.10 300 300 204 80 35 10.0 138 80 40 dcstx 4.17 257 257 239 80 25 20.0 126 80 29 dcneostx* 273 273 255, 225, 179 70 25 gtx2/3* 396 396 378, 316 70 25 dcgtx2/3* 353 353 335, 273 70 25 gtx5* 380 380 300, 282 70 25 c3/4* 492 412 ([m+h-so3]+) 332, 314, 138 70 25 *compounds which are tentatively analyzed. non -co mmerc ial us e o nly metabolic profiles of cyanobacteria in perialpine lakes 25 ducted using the same column and eluents of mc/nod analysis. differently from mc target analysis, a 15-min gradient was employed: the starting eluent was 20% b, increased to 90% b at 11 min, and finally restored at 20% b at 15 min. the flow rate was 0.25 ml min−1. the mass detector was operated in the positive electro spray mode (esi+) using the information depended acquisition (ida) mode: a full scan experiment (enhanced mass, ems) in the range 400 1100 da, was used as survey scan; the most intense peaks in ems (with charge state between 1 and 3) were automatically selected and underwent a high-resolution experiment (enhanced resolution, er) and a fragmentation experiment (enhanced product ion). ida threshold was set at 500,000 cps. epi spectra were acquired from 50 to 1000 da with a scan speed of 1000 da s−1 and a collision energy (ce) of 20 v and energy spread (ces) of 10 v. general settings were as follows: ion spray voltage 5000 v, entrance and cell exit potentials 10 v, and interface heater temperature 350°c. the detection of peptidic compounds was enhanced by enabling, in the acquisition software, the built-in algorithm for automatic optimization of ce for each putative peptide according to the specific m/z and charge values. data acquisition and processing were accomplished using analyst 1.5.2 and peakview 2.2 softwares (ab sciex). after acquisition, spectra were manually filtered to get rid of background organic contaminants (by comparison with a blank sample), and only compounds with high quality er and epi data were further considered (a threshold of 30% quality was normally used in peakview). data analysis common and distinctive chemical compounds synthesized by the single species (irrespective of strains) and strains were represented and evaluated by using venn’s diagrams. differences in mass values between species and strains were evaluated by 1-way anova on log-transformed data (sokal and rohlf, 1995). the relationships among the single strains based on the putative assigned compounds found in the untargeted metabolic analysis were evaluated by principal coordinate analysis (pcoa) applied to a dissimilarity matrix computed using the bray & curtis index. the same dissimilarity matrix was used to identify groups of strains by a cluster analysis (ward’s method) (legendre and legendre, 1998). statistical analyses were carried out using the r statistical software (r core team, 2016). results targeted toxin analysis the strains were analyzed with lc-ms/ms methods specifically built and tested for detecting the most common fig. 1. representative chromatogram of a standard mixture of alkaloids. phe is the aminoacid phenylalanine, which is not toxic but is isobaric with atx and can be potentially confused with the toxin. non -co mmerc ial us e o nly l. cerasino et al.26 alkaloid and peptidic toxins with high specificity and sensitivity (cerasino et al., 2016). the results are reported in a schematic view in tab. 2. among the 14 strains, 2 out of 3 strains of t. bourrellyi tested positive for atx: tbour02 and tbour05. the lc-ms chromatogram of tbour05 strain is reported in fig. 2. in the same cultures we could detect two adjacent peaks at about 4.2 min for the transition 412/138 (fig. 2), which could suggest the presence of c3/4 tab. 2. comparative results of the toxin diversity found in the considered strains, obtained with targeted analysis for alkaloids and mcs. in the last column, the number of metabolites found with the untargeted analysis is reported. the presence of c3/4 in strains of t. bourrellyi is suspected but has not been confirmed (see text for details). targeted analysis untargeted analysis species (lake) strain code alkaloids mc (%) metabolites n. aph. flos-aquae (idro) aflos01 19 aflos03 22 aflos04 26 d. lemmermannii (garda) dlemm14 49 dlemm16 74 dlemm21 42 m. aeruginosa (caldonazzo) microc1 lr (96.6), lrdm (3.2), yr (0.2) 36 microc2 lr (90.8), lrdm (9.1), yr (0.1) 46 p. rubescens (garda) prube11 rrdm (83.1), lrdm (16.6), htyrrdm (0.2), rr (0.1) 49 prube17 rrdm (89.4), lrdm (10.1), rr (0.3), htyrrdm(0.1), lr (0.1) 63 prube23 rrdm (99.6), lrdm (0.3), rr (0.1) 39 t. bourrellyi (garda) tbour02 atx, c3/4(?) 27 tbour04 29 tbour05 atx, c3/4(?) 35 fig. 2. chromatogram of the t. bourrellyi strain tbour05, analyzed with the alkaloids-targeted method. the most intense peak (rt 1.0 min) corresponds to atx. the peaks at rt=4.2 min, are approx. 60 times less intense than atx and have been tentatively attributed to the c3/4 toxins. the insert contains the epi (enhanced product ion) spectrum generated by the ion with mass of 412 da. non -co mmerc ial us e o nly metabolic profiles of cyanobacteria in perialpine lakes 27 toxins (tab. 1). however, the lack of the other transitions typical of these toxins (412/332 and 412/314) makes this attribution uncertain. the lack of a specific analytical standard did not allow a certain attribution. looking at data reported in literature about the most common psp (for example dell’aversano et al., 2005), the mass of 412 da could indicate either the [m+h]+ ion of gtx1/4 or the [mso3+h]+ ion of the c3/4 toxins (tab. 1). excluding the gtx1/4, because retention time and fragmentation did not match with those of the pure standard (tab. 1), we are led to hypothesize that the compounds can correspond actually to the c3/4 toxins. the fragmentation pattern of the compounds (reported in the insert of fig. 2), shows two peaks which are consistent with the attribution: 412 and 394 da, respectively attributable to the [m-so3+h]+ and [m-so3h2o+h]+ ions of c3/4. the other intense peaks in the ms/ms spectrum (204, 186 and 138 da) have been described also for other psp (namely stx) and are therefore not diagnostic for a particular molecule, but, instead, can confirm the presence of a similar or identical chemical backbone. the absence of fragments corresponding to the loss of two so3 groups, as in the case of other di-sulfated psp, is however in contrast with this attribution. all the other strains did not show any alkaloids. peptidic toxins were found exclusively in p. rubescens and m. aeruginosa strains (tab. 2). these two species showed a typical mc diversity: rrdm variant was the most abundant in p. rubescens (over 83%), followed by lrdm, htyrrdm, rr and lr. rrdm and lrdm variants together accounted for more than 95.5% of the total mc content. in one strain (prube23), the two less abundant congeners (htyrrdm and lr) were not detected. mc-lr, instead, was the prominent variant in m. aeruginosa strains (more than 90% of the total), with small amounts of two other congeners, namely lrdm and yr (tab. 2). metabolic profiling the untargeted analysis provided a list of metabolites (328 different compounds in total) characterized by a dyad of values: mass and rt (retention time). in the individual strains, we found a variable number of metabolites (tab. 2), from a minimum of 19 to a maximum of 74. most of the peptidic secondary metabolites produced by cyanobacteria were comprised in the considered mass range (400-1100 da). analyzing the distribution of masses, we noted substantial differences among strains (anova, f13,542=13.0, p<0.001; fig. 3) and species fig. 3. boxplot showing the distribution of molecular mass values coming from the untargeted metabolic analysis among the considered 14 strains. boxes represent 25-75th percentiles (first and third quartiles) with median (line in the middle of the rectangle), whereas the top and lower hinges are versions of the first and third quartile computed as in r core team (2016), function boxplot.stats. fig. 4. venn diagram showing the distribution of the compounds found in the untargeted metabolic analysis among the five different cyanobacterial species. the diagram is based on the couples of m/z (mass to charge ratio) and rt (retention time) values. aflos, aphanizomenon flos-aquae; dlemm, dolichospermum lemmermannii; micro, microcystis aeruginosa; prube, planktothrix rubescens; tbour, tychonema bourrellyi. non -co mmerc ial us e o nly l. cerasino et al.28 (groups of strains in fig. 3; anova, f4,551=39.9, p < 0.001). in m. aeruginosa and p. rubescens we found compounds in a wide range of masses, meaning that they produce compounds with very different molecular weights. on the opposite, in aph. flos-aquae and d. lemmermanii, we found that the majority of the compounds were in the lower part of the mass range, meaning they produce mainly low molecular weight compounds. in t. bourrellyi, finally, we found an intermediate situation. when attributing the 328 compounds to the producing species (fig. 4) and to the respective strains (supplementary fig. 1), we found only two compounds common to all species, one having mass 470.2 da (rt 8.12 min), and the other mass 482.3 da (rt 8.80 min). most of the compounds (268 out of 328) were exclusively produced by a single species: d. lemmermannii and p. rubescens had the highest number of exclusive compounds (83 and 70, respectively); m. aeruginosa and t. bourrellyi had lower figures (47 and 44); aph. flos-aquae had the lowest (21). only 62 were the compounds produced by two or more species. as a first attempt to identify some of the compounds, we compared the molecular weights of a subset of the 328 compounds (having molecular masses between 500 and 1200 da; the list is reported in supplementary tab. 1) with those of known compounds. we used online resources (e.g., norine: http://bioinfo.lifl.fr/nrp/) (flissi et al., 2016), and literature (czarnecki et al., 2006; welker et al., 2006; rounge et al., 2007; ersmark et al., 2008; rohrlack et al., 2008; briand et al., 2016; spoof et al., 2016) for finding possible matches. we restricted the search in the mass range typical of cyanobacteria peptidic secondary metabolites: aeruginosins (600-700 da), microginins (700-800 da), anabaenopeptins (800 900 da), microcystins and cyanopeptolins (900-1100 da). based on molecular weight equivalence and consistency of the ms/ms data (fragmentation characteristics and isotopic pattern), we were able to identify 7 potential peptides. for additional 20, an unambiguous attribution was not possible because, although compounds with the same molecular weight were found in databases, either they had not yet been characterized or multiple alternatives were possible; these compounds were generically indicated with the name of the class (aeruginosin, anabaenopeptin, cyanopeptolin, microcystin, etc.) or with “peptide” when the attribution to one class of peptides was not possible (6 compounds) (tab. 3). the molecular weights of these 27 compounds were comprised between approx. 590 and 1180 da. the most represented peptides were cyanopeptolins (7 compounds), followed by anabaenopeptins (6 compounds), and by aeruginosins and microcystins (6 compounds each). interestingly, most of these compounds were found in p. rubescens (17) and m. aeruginosa (10); fewer compounds were found in t. bourrellyi (3) and d. lemmermannii (1), and none in aph. flos-aquae. the pcoa analysis of the distribution of these compounds found in the untargeted metabolic survey allowed us to determine a greater uniformity of metabolites in m. aeruginosa and p. rubescens compared to d. lemmermannii and t. bourrellyi (fig. 5a). however, at a higher level of dissimilarity, the strains tbour05 and dlemm14 were not included in their respective species groups (fig. 5 a,b). fig. 5. a) principal coordinate analysis performed on the distribution of putative secondary metabolites within the cyanobacteria strains. the first and second axes account for the 23% and 21% of the total variance, respectively. the continuous and dashed lines enclose together groups of strains at different level of dissimilarity based on the results of the (b) cluster analysis. non -co mmerc ial us e o nly metabolic profiles of cyanobacteria in perialpine lakes 29 discussion the five cyanobacterial species considered in this investigation are known to produce toxins. in particular, based on the analysis of isolated strains (bernard et al., 2016), aph. flos-aquae and t. bourrellyi were reported as atx producers (sivonen et al., 1989; osswald et al., 2009; salmaso et al., 2015; 2016; shams et al., 2015), whereas m. aeruginosa and p. rubescens were mainly reported as mc producers (metcalf and codd, 2012), and d. lemmermannii as mcs and anatoxin-a(s) producer (sivonen et al., 1992; onodera et al., 1997). our targeted analysis confirmed this behavior for m. aeruginosa and p. rubescens, but not for aph. flos-aquae and d. lemmermanii. this was not unexpected, considered that recent investigations had already shown that the populations isolated in the italian district do not have the capability to produce atx. t. bourrellyi was found to produce atx, as reported also in recent papers (salmaso et al., 2015, 2016; shams et al., 2015). moreover, based on evidences collected in this work, this species was possibly able to synthesize psp toxins, possibly sulfated variants (like c3/4 toxins). m. aeruginosa and p. rubescens strains produced mixtures of different mcs (tab. 2). the most abundant congeners were lr in m. aeruginosa and rrdm in p. rubescens. the relative abundances and identities of congeners were in accordance with previous observations (cerasino and salmaso, 2012; salmaso et al., 2014; cerasino et al., 2016), reporting demethylated mcs (either rr, lr or htyr) as dominant in planktothrix and lr in microcystis. the untargeted analysis revealed the presence in the strains of 328 compounds with molecular mass between tab. 3. list of putative compounds found in the analyzed strains. compounds are ordered according to the molecular mass values. most of the m/z values correspond to single charged [m+h] adducts; in some cases, marked with an asterisk, m/z values correspond to double charged [m+2h] adducts. molecular mass observed m/z and rt putative compound strain diagnostic fragmentation peaks# 592.3 593.3 at 1.37 aeruginosin prube11, prube17 140, 120, 642.4 643.4 at 4.89 aeruginosin 101 dlemm16, tbour05 309, 221, 86 650.4 651.3 at 1.92 aeruginosin 102 prube11, prube23 150, 140, 86, 698.3 699.2 at 0.83 anabaenopeptin tbour04, microc2, prube11 120, 74 714.3 715.3 at 1.23 aeruginosin 126b prube17, prube23 164, 150 816.3 817.3 at 4.82 anabaenopeptin prube11, prube17, prube23 120, 72 830.3 831.3 at 1.09 anabaenopeptin microc1 243, 150, 120 836.4 837.4 at 1.25 anabaenopeptin b prube11 201, 175 850.3 851.3 at 1.57 anabaenopeptin f prube17, prube23 201, 175 855.3 856.3 at 5.03 anabaenopetin microc2 243, 120 983.4 984.4 at 4.06 cyanopeptolin microc1, microc2 243, 150 987.4 988.4 at 7.54 microcystin asp3dhb7-ly prube11 375, 213, 135, 107, 86 996.4 997.4 at 3.21 microcystin (l-meala7)lr prube17 375, 213 997.4 998.4 at 4.61 cyanopeptolin microc1, microc2 243, 150, 120 1008.5 1009.5 at 5.17 microcystin microc1, microc2 375, 213, 135 1010.6 506.8 at 5.41* cyanopeptolin prube17, microc2 243, 215, 150, 120 1011.4 1012.4 at 3.56 cyanopeptolin prube17 243, 150, 120 1023.5 1024.5 at 4.15 cyanopeptolin microc1, microc2 150, 120 1030.5 1031.5 at 5.91 microcystin prube11 375, 213, 135 1039.5 520.7 at 4.20* cyanopeptolin microc2 150 1093.5 1094.5 at 2.53 cyanopeptolin prube11, prube17, prube23, tbour05 150, 107, 84 1107.6 554.8 at 3.60* peptide prube11, prube17, prube23 164, 107, 84 1121.7 561.8 at 4.18* peptide prube23, prube11 339, 164, 107 1123.7 562.3 at 3.04* peptide prube17 150, 120, 84 1163.6 582.8 at 3.85* peptide prube17 164 1179.6 590.7 at 3.40* peptide prube11, prube17 164 1182.7 592.3 at 0.88* peptide microc2 120 #diagnostic fragmentation peaks: 70 pro-immonium, 72 val-immonium, 74 thr-immonium, 84 lys-immonium, 86 leu-immonium, 107 [ch2phoh], 120 phe-immonium, 135 [phch2ch(och3)], 140 choi immonium, 150 metyr, 164 mehty, 175 [arg+h], 201 [arg-co], 213 [glu-mdha+h], 215 [ahp-phe h2o co], 221 [leu-choi], 243 [ahp-phe h2o], 309 [choi-arg nh2+h], 339 [meto-mehty+h], 375 [adda-glu-medha+h] (choi: 2carboxy-6-hydroxyoctahydroindole; mdha:n-methyldehydroalanine; adda: 3-amino-9-methoxy-2,6,8-trimethyl-10-phenyldeca-4,6-dienoic acid); *double charged [m+2h] adducts. non -co mmerc ial us e o nly l. cerasino et al.30 400 and 2000 da. among them, we can have both primary and secondary metabolites. many of these have fragmentation peaks typical of peptides (immonium ions fragments in the lower mass range) in their ms/ms spectra. these compounds could be either ribosomal or non-ribosomal. microcystis and planktothrix exhibit a greater ability to produce molecules having molecular weight above 550 da, as can be clearly seen in fig. 3. this net difference compared to the other species can be related to their remarkable ability to produce different classes of peptidic secondary metabolites (included toxic mcs), as demonstrated by the mass of data available in the literature (czarnecki et al., 2006; welker et al., 2006; rounge et al., 2007; ersmark et al., 2008; rohrlack et al., 2008; briand et al., 2016; spoof et al., 2016). this is confirmed by the fact that, among the 27 peptides reported in tab. 3, the majority have been found in planktothrix and microcystis strains. aphanizomenon and dolichospermum produced much fewer peptides, as their secondary metabolism seems to be more oriented on the production of alkaloids (i.e. atx and hatx). tychonema constitutes an intermediate situation (fig. 3) as it exhibits a higher ability in producing peptides compared to the aphanizomenon and dolichospermum. finally, we need to consider that p. rubescens, t. bourrellyi and aph. flos-aquae have been grown under different light conditions compared to d. lemmermannii and m. aeruginosa; therefore, the metabolism of these two groups of organisms could have been differently influenced by this variable. conclusions the paper allowed the comparison of the toxic potential of five cyanobacterial species common in the lakes of the subalpine italian district (namely aph. flosaquae, d. lemmermannii, m. aeruginosa, p. rubescens, and t. bourrellyi). p. rubescens and m. aeruginosa resulted to be mc producers with typical mc diversities. aph. flos-aquae and d. lemmermannii resulted to be not toxic. finally, t. bourrellyi resulted to produce atx and possibly (at a minor extent) still not fully characterized psp toxins. the comparison of the peptidomic profiles allowed us to classify p. rubescens and m. aeruginosa as extraordinary non-ribosomal peptides producers. a preliminary attempt aimed at identifying the peptidic compounds has revealed that anabaenopeptins and cyanopeptolins were the most represented, but many other peptides are still to be structurally determined. as demonstrated by recent reports (svirčev et al., 2016), the toxic potential of cyanobacteria can be only partially verified by current analytical techniques. efforts to develop more comprehensive but specific methodologies are therefore still needed. acknowledgments we thank the european cooperation in science and technology cost action es1105 cyanocost for networking and knowledge-transfer support. references agha r, lezcano má, labrador mdm, cires s, quesada a, 2014. seasonal dynamics and sedimentation patterns of microcystis oligopeptide chemotypes reveal subpopulations with different ecological traits. limnol. oceanogr. 59:861-871. anas arj, harada k, 2016. evaluation of serine protease inhibitors as potent fviia-stf inhibitors in the blood coagulation cascade. lett. drug des. discov. 13:3-23. bernard c, ballot a, thomazeau s, maloufi s, furey a, mankiewicz-boczek j, pawlik-skowronska b, capelli c, salmaso n, 2016. appendix 2. cyanobacteria associated with the production of cyanotoxins, p. 503-527. in: j. meriluoto, l. spoof and g.a. codd (eds.), handbook on cyanobacterial monitoring and cyanotoxin analysis. wiley & sons, hoboken. blom jf, baumann h i, codd ga, jüttner f, 2006. sensitivity and adaptation of aquatic organisms to oscillapeptin j and [d-asp3, (e)-dhb7]microcystin-rr. arch. hydrobiol. 167: 547-559. briand e, bormans m, gugger m, dorrestein pc, gerwick wh, 2016. changes in secondary metabolic profiles of microcystis aeruginosa strains in response to intraspecific interactions. environ. microbiol. 18:384-400. bubik a, sedmak b, novinec m, lenarčič b, lah tt, 2008. cytotoxic and peptidase inhibitory activities of selected nonhepatotoxic cyclic peptides from cyanobacteria. biol. chem. 389:1339-1346. cerasino l, salmaso n, 2012. diversity and distribution of cyanobacterial toxins in the italian subalpine lacustrine district. oceanol. hydrobiol. stud. 41:54-63. cerasino l, shams s, boscaini a, salmaso n, 2016. multiannual trend of microcystin production in the toxic cyanobacterium planktothrix rubescens in lake garda (italy). chem. ecol. 32:492-506. chorus i, 2012. current approaches to cyanotoxin risk assessment, risk management and regulations in different countries. federal environment agency, dessau-roßlau: 151 pp. codd ga, 1995. cyanobacterial toxins: occurrence, properties and biological significance. water sci. technol. 32:149-156. czarnecki o, henning m, lippert i, welker m, 2006. identification of peptide metabolites of microcystis (cyanobacteria) that inhibit trypsin-like activity in planktonic herbivorous daphnia (cladocera). environ. microbiol. 8:77-87. dell’aversano c, hess p, quilliam ma, 2005. hydrophilic interaction liquid chromatography-mass spectrometry for the analysis of paralytic shellfish poisoning (psp) toxins. j. chrom. a 1081:190-201. ersmark k, del valle jr, hanessian s, 2008. chemistry and biology of the aeruginosin family of serine protease inhibitors. angew. chem. int. ed. 47:1202-1223. fischbach ma., walsh ct, clardy j, 2008. the evolution of non -co mmerc ial us e o nly metabolic profiles of cyanobacteria in perialpine lakes 31 gene collectives: how natural selection drives chemical innovation. proc. natl. acad. sci. usa 105:4601-4608. flissi a, dufresne y, michalik j, tonon l, janot s, noé l, jacques p, leclère v, pupin m, 2016. norine, the knowledgebase dedicated to non-ribosomal peptides, is now open to crowdsourcing. nucl. acids res. 44(d1): d1113-d1118. halme m, rapinoja ml, karjalainen m., vanninen p, 2012. verification and quantification of saxitoxin from algal samples using fast and validated hydrophilic interaction liquid chromatography-tandem mass spectrometry method. j. chrom. b 880:50-57. hamilton dp, salmaso n, paerl hw, 2016. mitigating harmful cyanobacterial blooms: strategies for control of nitrogen and phosphorus loads. aquat. ecol. 50:351-366. iarc, 2010. cyanobacterial peptide toxins, p. 327-412. in: evaluation of carcinogenic risks to humans, vol. 94, ingested nitrate and nitrite, and cyanobacterial peptide toxins, iarc monographs. international agency for research on cancer, lyon. janse i, kardinaal wea, kamst-van agterveld m, meima m, visser pm, zwart g, 2005. contrasting microcystin production and cyanobacterial population dynamics in two planktothrix-dominated freshwater lakes. environ. microbiol. 7:1514-1524. kardinaal wea, janse i, kamst-van agterveld m, meima m, snoek j, mur lr, huisman j, zwart g, visser pm, 2007. microcystis genotype succession in relation to microcystin concentrations in freshwater lakes. aquat. microb. ecol. 48:1-12. komárek j, anagnostidis k, 2005. [cyanoprokaryota. part 2: oscillatoriales]. [süßwasserflora von mitteleuropa, band 19/2.[book in german]. springer spektrum, dodrecht. kotai j, 1972. instructions for preparation of modified nutrient solution z8 for algae. norwegian institute for water research b-11769, oslo: 6 pp. legendre p, legendre l, 1998. numerical ecology. 24. elsevier, amsterdam: 852 pp. metcalf js, codd ga, 2012. cyanotoxins, p. 651-675. in: b.a. whitton (ed.), ecology of cyanobacteria ii. their diversity in time and space. springer, dodrecht. moore r, 1996. cyclic peptides and depsipeptides from cyanobacteria: a review. j. ind. microbiol. 16:134-143. murakami m, suzuki s, itou y, kodani s, ishida k, 2000. new anabaenopeptins, potent carboxypeptidase-a inhibitors from the cyanobacterium aphanizomenon flos-aquae. j. nat. prod. 83:1280-1282. neumann u, forchert a, flury t, weckesser j, 1997. microginin fr1, a linear peptide from a water bloom of microcystis species. fems microbiology lett. 153:475-478. nikolouli k, mossialos d, 2012. bioactive compounds synthesized by non-ribosomal peptide synthetases and type-i polyketide synthases discovered through genome-mining and metagenomics. biotechnol. lett. 34:1393-1403. onodera h, oshima y, henriksen p, yasumoto t, 1997. confirmation of anatoxin�a(s), in the cyanobacterium anabaena lemmermannii, as the cause of bird kills in danish lakes. toxicon 35:1645-1648. osswald j, rellàn s, gago-martinez a, vasconcelos v, 2009. production of anatoxin-a by cyanobacterial strains isolated from portuguese fresh water systems. ecotoxicology 18:1110-1115. paerl hw, huisman j, 2009. climate change: a catalyst for global expansion of harmful cyanobacterial blooms. environ. microbiol. rep. 1:27-37. r core team, 2016. r: a language and environment for statistical computing. r foundation for statistical computing, vienna, austria. url https://www.r-project.org/ rohrlack t, edvardsen b, skulberg r, halstvedt cb, utkilen hc, ptacnik r, skulberg om, 2008. oligopeptide chemotypes of the toxic freshwater cyanobacterium planktothrix can form subpopulations with dissimilar ecological traits. limnol. oceanogr. 53:1279-1293. rounge tb, rohrlack t, tooming-klunderud a, kristensen t, jakobsen ks, 2007. comparison of cyanopeptolin genes in planktothrix, microcystis, and anabaena strains: evidence for independent evolution within each genus. appl. environ. microbiol. 73:7322-7330. salmaso n, capelli c, shams s, cerasino l, 2015. expansion of bloom-forming dolichospermum lemmermannii (nostocales, cyanobacteria) to the deep lakes south of the alps: colonization patterns, driving forces and implications for water use. harmful algae 50:76-87. salmaso n, cerasino l, boscaini a, capelli c, 2016. planktic tychonema (cyanobacteria) in the large lakes south of the alps: phylogenetic assessment and toxigenic potential. fems microbiology ecology. http://www.ncbi.nlm.nih.gov/ pubmed/27402712. salmaso n, copetti d, cerasino l, shams s, capelli c, boscaini a, valsecchi l, pozzoni f, guzzella l, 2014. variability of microcystin cell quota in metapopulations of planktothrix rubescens: causes and implications for water management. toxicon 90:82-96. schindler dw, 2006. recent advances in the understanding and management of eutrophication. limnol. oceanogr. 51:356-363. schopf jw, 2012. the fossil record of cyanobacteria, p. 15-36. in: b.a. whitton (ed.), ecology of cyanobacteria ii: their diversity in space and time. springer, dordrecht. shams s, capelli c, cerasino l, ballot a, dietrich dr, sivonen k, salmaso n, 2015. anatoxin-a producing tychonema (cyanobacteria) in european waterbodies. water res. 69:68-79. shin hj, murakami m, matsuda h, ishida k, yamaguchi k, 1995. oscillapeptin, an elastase and chymotrypsin inhibitor from the cyanobacterium oscillatoria agardhii (nies-204). tetrahedron lett. 36:5235-5238. sivonen k, himberg k, luukkainen r, niemelä si, poon gk, codd ga, 1989. preliminary characterization of neurotoxic cyanobacteria blooms and strains from finland. environ. toxicol. 4:339-352. sivonen k, skulberg om, namikoshi m, evans wr, carmichael ww, rinehart kl, 1992. two methyl ester derivatives of microcystins, cyclic heptapeptide hepatotoxins, isolated from anabaena flos�aquae strain cya 83/1. toxicon 30, 11:1465-1471. sivonen k, borner t, 2008. bioactive compounds produced by cyanobacteria, p. 159-197. in: a. herrero and e. flores (eds.), the cyanobacteria: molecular biology, genomics and evolution. caister academic press. sokal rr, rohlf fj. 1995. biometry: the principles and practices non -co mmerc ial us e o nly l. cerasino et al.32 of statistics in biological research. w. h. freeman: 887 pp. spoof l, blaszczyk a, meriluoto j, ceglowska m, mazurmarzec h, 2016. structures and activity of new anabaenopeptins produced by baltic sea cyanobacteria. mar. drugs 14:8. svirčev z, obradović v, codd ga, marjanović p, spoof l, drobac d, petković a, nenin t, simeunović j, važić t, meriluoto j, 2016. ecotoxicology 25:1353-1363. van apeldoorn me, van egmond hp, speijers gja, bakker gj, 2007. toxins of cyanobacteria. mol. nutr. food res. 51:7-60. welker m, maršálek b, šejnohová l, von doehren h, 2006. detection and identification of oligopeptides in microcystis (cyanobacteria) colonies: toward an understanding of metabolic diversity. peptides 27:2090-2103. welker m, von döhren h, 2006. cyanobacterial peptides nature’s own combinatorial biosynthesis. fems microbiol rev. 30:530-63. yepremian c, gugger mf, briand e, catherine a, berger c, quiblier c, bernard c, 2007. microcystin ecotypes in a perennial planktothrix agardhii bloom. water res. 41:44464456. zurawell rw, chen h, burke jm, prepas ee, 2005. hepatotoxic cyanobacteria: a review of the biological importance of microcystins in freshwater environments. j. toxicol. environ. health b crit. rev. 8:1-37. non -co mmerc ial us e o nly advances in oceanography and limnology layout 1 introduction the anthropogenic impact is significantly altering aquatic ecosystems (vörösmarty et al., 2010; elliott and elliott, 2013), by means of a plethora of pressures that include chemical pollution and wastewater discharge, eutrophication, hypoxia, utilization of living resources, habitat destruction and climate change effects (halpern et al., 2008). aquatic sediments, acting as repositories of materials and solutes deposited from or diffused through the water column, accumulate chemical and biological contaminants (ridgway and shimmield, 2002). this holds true also for microbiological pollutants, including autochthonous and pathogenic microbes of fecal origin, that reach the aquatic environment by a variety of routes and can spread diseases to human and aquatic populations, with important socio-economic, sanitary and environmental consequences (stewart et al., 2008). a number of studies have so far investigated the presence and distribution of fecal bacteria in aquatic sediments. the majority of these studies have addressed the traditional fecal indicators, such as total coliforms, escherichia coli and intestinal enterococci, which are worldwide used for assessments of aquatic ecosystems quality (field and samadpour, 2007 and references therein; liang et al., 2015). these studies have shown that substantial populations of fecal bacteria can be often retrieved in lagoon, estuarine and coastal sediments (an et al., 2002; luna et al., 2010; pachepsky and shelton, 2011; perini et al., 2015), suggesting that sediments are environmental reservoirs of fecal bacteria. however, the reliability of these indicators has been recently questioned, as they can persist and regrow in the environment, they are recovered also in absence of obvious fecal sources, and following the discovery of environmentally-adapted populations of e. coli (luo et al., 2011; byappanahalli et al., 2012). altogether, these issues have stimulated new studies, aimed at identifying alternative and more reliable indicators of fecal pollution, able to identify risks to human health and improve monitoring strategies (stewart et al., 2008). kreader (1995) pioneered the use of fecal anaerobes within the genus bacteroides as more reliable fecal indicators, and highlighted their potential to distinguish human from non-human sources of pollution. since then, several studies have been performed to discover and test new indicators of fecal pollution in water (reviewed in advances in oceanography and limnology, 2016; 7(2): 115-124 article doi: 10.4081/aiol.2016.5948 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). next generation sequencing reveals distinct fecal pollution signatures in aquatic sediments across gradients of anthropogenic influence gian marco luna,1 grazia m. quero,2 laura perini2 1cnr-ismar institute of marine sciences, national research council, largo fiera della pesca 2, 60125 ancona, italy; 2cnr-ismar institute of marine sciences, national research council, arsenale tesa 104, 30122 venezia, italy *corresponding author: gianmarco.luna@ismar.cnr.it abstract aquatic sediments are the repository of a variety of anthropogenic pollutants, including bacteria of fecal origin, that reach the aquatic environment from a variety of sources. although fecal bacteria can survive for long periods of time in aquatic sediments, the microbiological quality of sediments is almost entirely neglected when performing quality assessments of aquatic ecosystems. here we investigated the relative abundance, patterns and diversity of fecal bacterial populations in two coastal areas in the northern adriatic sea (italy): the po river prodelta (prp, an estuarine area receiving significant contaminant discharge from one of the largest european rivers) and the lagoon of venice (lv, a transitional environment impacted by a multitude of anthropogenic stressors). from both areas, several indicators of fecal and sewage contamination were determined in the sediments using next generation sequencing (ngs) of 16s rdna amplicons. at both areas, fecal contamination was high, with fecal bacteria accounting for up to 3.96% and 1.12% of the sediment bacterial assemblages in prp and lv, respectively. the magnitude of the fecal signature was highest in the prp site, highlighting the major role of the po river in spreading microbial contaminants into the adjacent coastal area. in the lv site, fecal pollution was highest in the urban area, and almost disappeared when moving to the open sea. our analysis revealed a large number of fecal operational taxonomic units (otu, 960 and 181 in prp and lv, respectively) and showed a different fecal signature in the two areas, suggesting a diverse contribution of human and non-human sources of contamination. these results highlight the potential of ngs techniques to gain insights into the origin and fate of different fecal bacteria populations in aquatic sediments. key words: 16s rdna; fecal bacteria; aquatic sediments; sewage; lagoon. received: april 2016. accepted: june 2016. non -co mmerc ial us e o nly 116 next generation sequencing of fecal bacteria mclellan and eren, 2014), while studies of alternative fecal indicators in aquatic sediments have been rare (kim and wuertz, 2015). on the light of the recognized role of aquatic sediments as reservoir of fecal bacteria, the urgency of expanding our poor knowledge in the sedimentary environment becomes manifestly evident. recent studies have shown the usefulness of next generation sequencing (ngs) technologies in water quality assessments (vierheilig et al., 2015). ngs techniques can provide insights into the ecology of microbe-mediated processes (such as biodegradation of contaminants and algal blooms) influencing water quality, but can also be extremely useful to identify an array of other taxa that could serve as indicators of fecal contamination in aquatic environments (tan et al., 2015). this holds true for those ngs methods that target small subunit rrna hypervariable regions, which are able to resolve microbial community composition in environmental samples, and to provide information on source-specific phylotypes and/or assemblages of phylotypes (newton et al., 2011, 2013). fisher et al. (2015) have recently shown the potential of sequencing the v6 region of the 16s rrna genes to discern between human versus non-human fecal sources. cumulatively, these emerging studies show the potential of ngs as powerful tool in detecting alternative fecal indicators also in aquatic sediments. we report here the results of an investigation, carried out in two different aquatic environments in the northern adriatic sea (italy), with the aim of assessing the presence and spatial distribution of traditional and alternative (feces-associated and sewer infrastructure-associated) fecal indicators by using ngs methods targeting the 16s rrna bacterial gene. this study is, to the best of our knowledge, among the first performed so far to explore the presence and spatial variability of alternative fecal indicators in different aquatic sediments, providing potentially useful insights for tracking the source and fate of fecal bacteria in aquatic sediments. methods description of the study areas sediments were collected in two coastal areas located in the northern adriatic sea: the po river prodelta (hereafter defined prp) and the lagoon of venice (hereafter defined lv), supposed to be exposed to different types of fecal contamination. the prp receives a significant discharge of contaminants from one of the largest rivers in europe (boldrin et al., 2005). the river discharges a mean of 1500 m3 s–1 of freshwater (with peaks up to >10,000 m3 s–1 during floods), that produces a freshwater plume able to influence the microbial diversity and functioning of the adjacent coastal ecosystem (manini et al., 2004, quero et al., 2015). the po experiences typically major floods, which transport large amounts of suspended sediments and associated pollutants to the sea, that can be stored or transported offshore to the adjacent marine areas (correggiari et al., 2005). many studies have shown that the coastal area in front of the delta is severely chemically polluted, as the river carries yearly tons of anthropogenic chemicals collected from the po valley and the river tributaries, including emerging contaminants (casatta et al., 2015). the lv, among the largest lagoons in the mediterranean, is a microtidal, semi-closed lagoon connected to the adriatic sea by three openings (inlets), influenced by a tidal semidiurnal regime (cucco and umgiesser, 2006). the tidal regime governs the water exchange with the adjacent open sea, and largely influences the renewal capacity of the lagoon basin. the lv is historically impacted by a multitude of anthropogenic stressors, among which one of the largest industrial plants of italy located on the nearby mainland, touristic and commercial ports, several small tributaries (that carry around 30-35 m3 s–1 of freshwater; zuliani et al., 2005), agricultural and municipal wastes. as far as the fecal contamination is concerned, an important source of contamination is the city of venice which, due to its history and unique building architecture, has never been provided with a modern and efficient sewage treatment system (sfriso and facca, 2013). consequently, only partially treated effluents from a large number of domestic and commercial inputs are discharged daily into the city canals, determining a diffuse contamination and the accumulation of fecal bacteria in sediments and live macroalgae (quero et al., 2015; perini et al., 2015). sampling activities in the prp area, sampling was performed between 10th and 14th june 2013 in front of the outlets of the main branches of the river delta. the sampling design included 11 stations (fig. 1), distributed along coast-to-open sea transects, at depths comprised between 9.5 and 20.5 meters. the geographic coordinates (as longitude and latitude) and water depths of the stations were as follows: 1 (12.543 e, 44.99 n, 12 m), 2 (12.556 e, 44.993 n, 20.5 m), 3 (12.571 e, 44.968 n, 9.5 m), 4 (12.576 e, 44.971 n, 15 m), 5 (12.581 e, 44.974 n, 19 m), 6 (12.573 e, 44.955 n, 10.5 m), 7 (12.585 e, 44.952 n, 14 m), 8 (12.558 e, 44.929 n, 11 m), 9 (12.573 e, 44.919 n, 14.6 m), 10 (12.538 e, 44.891 n, 14.8 m) and 11 (12.558 e, 44.886 n, 17.5 m). the sampling transects were in front of the outlets of the main branches of the river delta. the spatial distribution of the stations was thought to follow the possible deposition route of pollutants transported by an exceptional flood event, like the one that occurred in the third week of may 2013, with a maximum flow rate of 6830 m3 s–1. more details about the sampling activities and the characteristics of the sampling stations in the prp are reported in quero et al. (2015). non -co mmerc ial us e o nly 117g.m. luna et al. in the lv area, sampling was performed during the autumn season (21st-22th october 2014), chosen as the period of highest river runoff, expected to increase the load of fecal bacteria within the lagoon. the sampling design included 5 sampling stations (fig. 1), at depths comprised between 5.4 and 16 m, distributed across a gradient of putative contamination from the inner part of the lagoon to the open sea. the geographic coordinates (longitude and latitude) and water depth of the stations were as follows: industrial port (12.219 e, 45.438 n, 5.4 m), inner lagoon (12.258 e, 45.448 n, 7.2 m), cruise port (12.311 e, 45.436 n, 12.1 m), city centre (12.352 e, 45.431 n, 7.1 m) and open sea (12.508 e, 45.313 n, 16 m). in both areas, sediments were collected using a van veen grab sampler (sampling surface 0.1 m2), onboard small research vessels (a privately operated one in the prp area, and the ‘litus’ boat operated by ismar-cnr in the lv one). once onboard, the uppermost 0-2 cm layer of sediment was immediately placed, using sterile spatulas, in sterile containers for their immediate transport at 4°c to the laboratory, where the samples were stored at -20°c until analysis. analyses of fecal bacteria using illumina sequencing of the 16s rrna gene dna was extracted from one gram of each sediment sample using the powersoil® dna isolation kit (mobio fig. 1. the two study sites in the northern adriatic sea (italy), with indication and name of the sampling stations (blue dots). latitude (n) and longitude (e) are reported; lv, lagoon of venice; prp, po river prodelta. non -co mmerc ial us e o nly 118 next generation sequencing of fecal bacteria laboratories inc., california), according to the manufacturer’s instructions with some slight modifications to increase the dna yield and quality. these modifications included two additional vortexing steps (following the one which is recommended by the manufacturer) at the maximum speed for 2 min, each one being preceded by an incubation at 70°c for 5 min, and by one more washing step with solution c5 as an additional removal step for contaminants. the concentration of each dna extract was determined spectrophotometrically using nanodrop ( thermo scientific) and the dna was stored at -80°c until pcr. illumina miseq v3 sequencing were carried out on the hypervariable v3 and v4 regions of the 16s rrna gene by amplifying using the 341f (5′−cctacgggnggcwgcag−3′) and 785r (5′−gactachvgggtatctaatcc−3′) universal bacterial primers (eiler et al., 2012). paired-end reads were quality checked (with default settings and minimum quality score of 20) and analyzed with qiime v1.8.0 software package (quantitative insights into microbial ecology; caporaso et al., 2010). reads were clustered into otus by using uclust v1.2.22 (edgar, 2010) with a >97% similarity threshold with an open-reference otu picking strategy and default settings. chimeras were detected by using usearch v6.1 (edgar, 2010). chimera checking and taxonomy assignment was performed using greengenes 13.8 as reference database (desantis et al., 2006). to account for differences in the sequencing effort among samples, abundances in each sample were normalized to the number of sequences of the sample showing the lowest number of reads. the sequences of the prp area have been submitted to the sra (sequence read archive; accession numbers srp061637), while those for the lv are currently being submitted. data elaboration and statistical analyses within each of the bacterial assemblage, we searched for those otus identified as belonging to the traditional fecal indicator taxa (i.e., the family enterobacteriaceae, that includes the genus escherichia, and the genus enterococcus), and those otus belonging to the alternative fecal indicator taxa, according to the approach proposed by newton et al. (2013). as alternative indicators, we searched for otus belonging to five feces-associated bacterial families (bacteroidaceae, porphyromonadaceae, clostridiaceae, lachnospiraceae and ruminococcaceae) and three sewer infrastructure-associated bacterial genera (acinetobacter, arcobacter and trichococcus), that we used here as signatures of fecal (human and non-human) and sewage contamination, respectively. this distinction was based on the study by newton et al. (2013), who reported that five feces-associated bacterial families were prevalent (up to 85% of the total sequences) in the feces of animals and humans while, on the other hand, three sewer infrastructure-associated genera were very abundant in the sewage samples while not prevalent in human feces (only 33 sequences recovered out of a >1.2 million sequences of a human fecal dataset). vandewalle et al. (2012) reported that only a small fraction of otus in sewage matched sequences from human fecal samples, and suggested that these sewage-associated taxa, that thrive within the sewer system, may serve as useful adjuncts to fecal indicators for tracking sewage pollution in surface waters. the spearman-rank correlation analysis was performed to test for relationships between the relative abundance of traditional and alternative fecal indicators. correlation coefficients (r) were considered significant at p-values less than 0.05. differences in the composition of fecal bacterial communities between the sampling areas, and between groups of stations within each of the two areas, were assessed by using the analysis of similarity (anosim) tool based on a bray-curtis similarity matrix. the presence of statistical differences between samples is indicated by a significance level at p-values less than 0.05. to assess differences in the composition of indicator otus between the sampling areas, we applied univariate distance-based permutational analyses of variance (permanova). the statistical analyses were carried out using a sampling design, that considered the area as fixed factor as source of variance, with 2 levels (prp and lv). the anosim and permanova analyses were performed using the primer 6 software (http://www.primer-e.com/). results relative abundance of traditional, fecesand sewage-associated indicators at both areas, sequence analyses of the sediment samples revealed evidences for a marked and diffuse fecal signature that was, however, significantly different between the two areas (anosim, r=0.314, p<0.05). in the prp area, the relative abundance of traditional indicators (fig. 2a) accounted for 0.01 to 0.19% of the bacterial assemblage in the case of enterobacteriaceae, and for 0 (no sequences detected) to 0.01% in the case of enterococcus. in the same study area, the relative abundance of alternative fecal indicators was quite higher than that of traditional indicators. the contribution of the feces-associated indicators (fig. 2c) was in the range 0.08-2.13% (lachnospiraceae), 0.17-0.53% (clostridiaceae), 0-0.14% (porphyromonadaceae), 0-0.04% (bacteroidaceae) and 0.08-0.63% (ruminococcaceae), while the contribution of the sewage-associated indicators (fig. 2e) was in the range 0-0.17% (arcobacter), 0.06-0.57% (acinetobacter), with only one or two sequences per sample assigned to the trichococcus genus (only at the stations 4, 5, 6 and non -co mmerc ial us e o nly 119g.m. luna et al. 8). the cumulative contribution of all the sequences belonging to the traditional, fecesand sewage-associated indicators was in the range 0.49-3.96% of the bacterial assemblages (on average 1.63%). in the lv area, the level of fecal contamination was overall reduced when compared to the prp area. as far as the traditional indicators are concerned, these were observed in the lv area at all stations (fig. 2b), in the range 0-0.05% (enterobacteriaceae) and 0.004-0.03% (enterococcus). the relative abundance of the feces-associated indicators (fig. 2d) was higher and accounted for 0.050.40% (lachnospiraceae), 0.01-0.29% (clostridiaceae), 0-0.02% (porphyromonadaceae), 0-0.02% (bacteroidaceae) and 0.001-0.27% (ruminococcaceae), while the contribution of the sewage-associated indicators (fig. 2f) was in the range 0.01-0.11% (arcobacter), 00.06% (acinetobacter), with no sequences assigned to the genus trichococcus. the cumulative contribution of all of the sequences belonging to the traditional and alternative indicators accounted from 0.08 to 1.12% of the bacterial assemblage (on average 0.60%). spatial patterns of fecal indicators in the two areas in the prp area, the fecal contamination in stations located closer to the coast (stations 1, 3, 4, 5, 6, 8 and 10; average relative abundance 2.0%) was two-fold higher that in offshore stations (2, 7, 9 and 11; average 0.99%). the highest abundance of fecal indicators as a whole (i.e., summing up traditional and alternative indicators) was observed in the stations located right in front of the main outlet of the po river (stations 4, 5, and 6; up to 3.96% in the station 6). the relative abundance of traditional indicators didn’t show significant correlation either with the fecesor with the sewage-associated indicators (p≥0.05 for both relationships), whereas the fecesand sewage-associated indicators were significantly and positively related (r=0.83, p<0.01). in the lv area, the fecal contamination was much higher inside the lagoon (stations ind. port, inner lagoon, cruise port and city centre; average relative abundance 0.73%), and only weakly detectable in the open sea station (relative abundance 0.08%). within the lagoon, the highest abundance of fecal indicators as a whole was observed in the station located closer to the city center of venice (1.12%), followed by the two stations located close to the industrial area (station ind. port, 0.64%) and the mainland (inner lagoon, 0.70%). in the lv area the different types of fecal indicators were positively and significantly correlated (r=0.82, p<0.05 between traditional and feces-associated indicators; r=0.92, p<0.01 between traditional and sewage-associated indicators). the fecesand sewage-associated indicators were also significantly and positively correlated (r=0.751, p<0.05). traditional, fecal and sewage indicator otus the number of otus that were affiliated with each of the fecal indicator groups varied widely between areas and among stations in each area, ranging from 0 to 266 fig. 2. bar plots of the relative abundance of 16s rdna sequences belonging to: a, b) the traditional fecal indicator bacterial taxa (enterobacteriaceae and enterococcus); c, d) the feces-associated bacterial families (lachnospiraceae, clostridiaceae, porphyromonadaceae, bacteroidaceae and ruminococcaceae); and e, f) the sewage-associated bacterial genera (arcobacter, acinetobacter and trichococcus) in the sediments of the two sites. in the lv site: ip, industrial port; il, inner lagoon; cp, cruise port; cc, city centre; os, open sea. non -co mmerc ial us e o nly 120 next generation sequencing of fecal bacteria otus depending on the fecal indicator (tab. 1). the results of univariate permanova revealed a significant effect of the factor area (p<0.01). in the prp area, the results are summarized by grouping the stations located closer to the coast (1, 3, 4, 5, 6, 8 and 10) and those located more offshore (stations 2, 7, 9 and 11). this choice was supported by the anosim analysis, that demonstrated significant differences, in terms of otu community composition, between these two groups of stations (anosim, p<0.05). in this area, the cumulative number of otus (i.e., the sum of all otus recorded at all stations) belonging to the traditional indicators was 46 for enterobacteriaceae and 4 for enterococcus (only observed in the more coastal stations). the number of otus within the feces-associated indicators was much higher: 176 and 98 for lachnospiraceae (coastal and offshore stations, respectively), 169 and 141 (clostridiaceae), 55 and 36 (porphyromonadaceae), 22 and 9 (bacteroidaceae), 132 and 93 (ruminococcaceae). the number of otus associated with the sewage-associated indicators was 3 and 0 for trichococcus (coastal and offshore stations, respectively), 69 and 54 (acinetobacter), 19 and 34 (arcobacter). overall, in the prp area the number of otus in the coastal stations was higher than in the offshore ones, with only one exception (i.e., arcobacter otus more abundant in offshore than in coastal stations). in lv area, the cumulative number of otus belonging to the traditional indicators was 5 and 2 (for enterobacteriaceae and enterococcus, respectively). the cumulative number of the fecal-associated indicator otus was larger compared to the traditional ones, corresponding to 38 (lachnospiraceae, range among sampling stations 4-18), 37 (clostridiaceae, range 5-18), 16 (porphyromonadaceae, range 0-10), 18 (bacteroidaceae, range 0-9) and 22 otus (ruminococcaceae, range 0-10). at the same time, the number of otus belonging to the sewage-associated indicators was 12 for acinetobacter (range 0-5) and 31 for arcobacter (range 4-20), with no otus belonging to trichococcus. the highest number of otus was observed in the lagoon stations (namely, at stations ind. port, inner lagoon and city centre. the station located in the open sea showed only 14 otus for the entire pool of fecal indicators (traditional, fecesand sewage-associated). discussion in this study, we aimed at examining the presence, prevalence and spatial distribution of traditional and alternative fecal indicators in a range of aquatic sediments, collected in transitional, estuarine and coastal marine areas along gradients of anthropogenic influence. we used ngs of 16s rrna gene amplicons to identify and track fecal indicator bacteria within complex benthic microbial assemblages, by taking advantage of the method recently proposed by newton et al. (2013), that allows to potentially discriminate between feces-associated and sewageassociated bacteria. the presence and distribution patterns of alternative indicators in the sediments were then compared with those of traditional indicators (escherichia coli, within the enterobacteriaceae family, and enterococci) that are utilized worldwide to assess fecal pollution tab. 1. number of otus affiliated with the different fecal indicator bacteria in the two study sites. for the po river prodelta site, results are summarized by summing all the otus observed at stations 1, 3, 4, 5, 6, 8 and 10 (stations close to the coast) and those observed at stations 2, 7, 9 and 11 (offshore stations). prp lv microbial number of otus number of otus cumulative indicator stations close offshore cumulative stations within the lagoon no. of otus to the coast stations no. of otus ip il cp cc open sea traditional enterobacteriaceae 27 28 46 1 5 1 3 0 5 enterococcus 4 0 4 1 1 1 3 1 2 feces-associated lachnospiraceae 176 98 266 17 18 9 9 4 38 clostridiaceae 169 141 231 10 16 18 10 5 37 porphyromonadaceae 55 36 70 3 7 2 10 0 16 bacteroidaceae 22 9 28 3 9 4 8 0 18 ruminococcaceae 132 93 187 6 10 10 6 0 22 sewage-associated trichococcus 3 0 3 0 0 0 0 0 0 acinetobacter 69 54 85 5 4 1 3 0 12 arcobacter 19 34 40 20 9 8 17 4 31 prp, po river prodelta; lv, lagoon of venice; otu, operational taxonomic units; ip, industrial port; il, inner lagoon; cp, cruise port; cc, city centre; os, open sea. non -co mmerc ial us e o nly 121g.m. luna et al. in aquatic environments. recently, a large body of studies have identified and tested alternative indicators of fecal pollution in aquatic systems, by exploiting the ngs technologies to provide unprecedented inventories of microbial communities in aquatic samples (mclellan and eren, 2014). however, while a large number of studies have investigated the presence and spatial patterns of alternative indicators in water (savichtcheva and okabe, 2006; liang et al., 2015), similar studies in sediments have been rare (kim and wuertz, 2015). this lack of knowledge is surprising, given the recognized role of aquatic sediments as reservoir of fecal bacteria (luna et al., 2010), and their potential to favor the persistence of fecal microbes and to contaminate the overlying water through resuspension, which likely poses important public health and environmental threats. at both study areas, we found evidences for an extensive microbial pollution that was testified, despite at different extent, by the presence of traditional, fecesand sewage-associated indicators. these indicators accounted cumulatively for a variable fraction of benthic assemblages with peaks, as in the case of the most polluted sediments, up to 3.96%. at both study areas, the magnitude of the fecal signature decreased with increasing distance from the sources of pollution, which underlines the usefulness of this approach, that includes also the alternative indicators, to track the fecal pollution in aquatic sediments. the presence of fecal pollution in the two sites was not unexpected, since they are both subjected to a significant anthropogenic pressure, and likely receive important loads of fecal bacteria. the prp coastal area receives a significant discharge of sediments and pollutants from the largest italian river, especially after the floods that occur on a seasonal (biannual) frequency and, also, as episodic short-term events (palinkas et al., 2005). its drainage basin contributes to more than 35% of the national agricultural, livestock and industrial production, that originates organic loads estimated in 114×106 inhabitant equivalents (casatta et al., 2015). however, while the presence of chemical pollutants in the coastal area near the mouth of the po river has been largely reported (romano et al., 2013), this is the first report on the presence of extensive fecal pollution in these sediments. the largest fecal contamination was observed in the stations located in front of mouth of the pila distributary, which is the main outlet of the river and can discharge up to 70% of the sediment load delivered to the sea. however, the fecal signature was also observed in stations located downstream of this main mouth, that suggests either a fecal input from the other minor distributaries, and/or the potential of fecal bacteria of being distributed over a large coastal area. this bacterial spread may occur when the high fluvial discharge coincides with energetic physical oceanographic conditions, preventing deposition in shallow waters and favoring sediment dispersion in seabed deposits located offshore and downstream of the mouth (palinkas et al., 2005). our finding of a large reservoir of fecal bacteria in the po prodelta sediments poses a claim for potential health consequences, given the potential of sediment bacteria of being re-suspended and transported southward, where several bathing beaches and touristic destinations are present. nevertheless we point out here that further studies are needed to investigate the ability of the different fecal bacterial populations, including the fecesand sewage-associated bacteria, to persist or decay once they reach the marine environment, and of being potentially transported toward adjacent coastal areas in presence of specific hydrological conditions. the finding of a diffuse fecal contamination in the lv area, especially in the stations more exposed to anthropogenic impacts, likely depends on the wide variety of human impacts, in the form of large industrial plants, touristic and commercial ports, rivers, agricultural and municipal wastes, that have affected this vulnerable transitional environment in the last years (micheletti et al., 2011). our results show that the highest fecal contamination is observed in the area closer to the city of venice, confirming recent findings of a chronic fecal pollution (perini et al., 2015), but also that other areas of the venice lagoon, located closer to the mainland, receive important loads of bacteria of fecal origin. this may be due to multiple delivery routes discharging in the inner part of the lagoon, that include runoff, outfall discharge, sewer overflows (that causes untreated sewage to be released), presence of tributaries, and other human activities. it is worth noticing that a signal, despite weak, of fecal contamination was observed also in the sediments of the open sea station. we speculate that the presence of fecal pollutants in this area, which is relatively far by obvious sources of pollution, could be the consequence of fecal discharges by offshore point sources and/or by the underwater submarine wastewater pipes present in the area (scroccaro et al., 2010), that may disperse microbial pollutants over vast marine areas. we report here that different aquatic sediments subjected to anthropogenic influence contain important proportions of traditional indicator bacteria, as well as fecal bacteria representing signatures of fecal (human and animal) and sewage sources. at both areas, the relative abundance of fecaland sewage-associated bacteria always exceeded that of the traditional indicators. sediments are a potentially favorable environment for fecal microorganisms survival, and this may be especially true for many of the alternative indicators (such as bacteroidales), that do not survive well in water due to their obligate anaerobic physiology (bae and wuertz, 2015) but may persist longer in low-oxygen or anoxic layers that are common in sediments. in both areas, we found that the fecal signature was more evident than the sewage signature. however, the avnon -co mmerc ial us e o nly 122 next generation sequencing of fecal bacteria erage ratio of the fecal pollution signature to the sewage pollution signature was different in the two areas. in prp, the average contribution of the feces-associated taxa was 1.244%, a percentage 3.9-fold higher than that of the sewage-associated taxa (0.320%). conversely, in the lv area, the average contribution of feces-associated taxa was 0.602% (excluding the open sea station), a percentage 7.05-fold higher than that of the sewage-associated indicators (0.085%). the prevalence of different fecal bacterial signatures in the two areas suggests the presence of different fecal sources. the higher ratio of fecesto sewage-associated bacteria observed in the lagoon of venice suggests that human/animal sources of pollution are more important than sewage in polluting this area while, in the po prodelta area, the sewage pollution appears to be an important source. the sewage pollution in the prp area is particularly evident in the acinetobacter signature which is, on average, 14-fold more abundant than in the lv site. this genus is the most important in sewage (newton et al., 2013), and its recovery in sediments suggests that it may be a reliable signature of sewage pollution also in the benthic environment. it remains to be determined whether members of this genus are adapted to survive in aquatic sediments, and how long are their decay rates once they reach the sedimentary environment. the importance of sewage in contributing to pollution in the po prodelta is also confirmed by the recovery of another sewage-associated genus (trichococcus) that, though with only a few sequences per sample, was observed only in this area and not in the venice lagoon. a very large number of fecal otus, accounting for a total of 960 and 181 otus (in the prp and lv areas, respectively), were observed in the sediments under scrutiny. the largest number of otus was observed in the po prodelta area. this may suggest the existence, in this area, of multiple delivery mechanisms containing multiple fecal sources, that likely originate from the large drainage basin, and resulting in more complex fecal otu signatures than those observed in the lv sediments. in many cases and at both areas, fecal bacteria populations were dominated by few dominant otus. a closer examination of the top most abundant fecal otus in the two sites provided additional insights, useful to potentially distinguish among different sources of pollution. in the prp area, the traditional indicators showed dominance of one enterobacteriaceae otu (range 5-177 sequences per sediment sample) that showed 100% blast identity with escherichia coli strain 732 (accession number cp015138). the enterococci populations, that were poorly represented at this area, were dominated by one otu affiliated with enterococcus casseliflavus isolated from cow rumen (accession number kt630829), suggesting that cattle may be an important route of fecal pollution in this area. conversely, in the lv area, the dominant enterobacteriaceae otu was affiliated with yersinia kristensenii (accession number hg938308.1) while the dominant enterococcal otu, especially abundant in the station closer to the city center, showed a top blast match with catellicoccus marimammalium (accession number kf251005.1) isolated from gulls’ feces. in the venice urban area, populations of urban gulls have increased exponentially in the last years (rock, 2012). our findings indicate that they can contribute as an additional source of fecal contamination in the lagoon, which deserves further investigations. as far as the fecaland sewage-associated otus are concerned, the same analysis of the identity of the dominant otus revealed also interesting additional insights. the dominant acinetobacter otus in the lv area, particularly abundant in the station closer to the city center, showed a top blast match with an uncultured acinetobacter (hq742373.1) associated with the human intestine, confirming human fecal pollution as an important contamination route in the city (perini et al., 2015). conversely, the analyses of some of the dominant lachnospiraceae otus showed, at both prp and lv areas, top blast identities with several uncultured bacteria, which were observed in a variety of sediments and also in coastal sediments vegetated by seagrasses (jensen et al., 2007), apparently far from fecal pollution sources. these preliminary findings suggest that some of members within this family may be part of the natural benthic assemblages, and are thus not reliable indicators of fecal pollution. it is evident that, given also the much higher complexity of benthic microbial assemblages when compared with the planktonic ones, there is still much to be deciphered when using this type of community approaches to track fecal pollution in aquatic sediments. overall, our results demonstrate that the coupled analyses of the diversity and magnitude of the three fecal signatures (traditional, fecaland sewage-associated bacteria) are useful to discern among different pollution sources in the sediments of transitional, estuarine and coastal areas. conclusions we have shown that a wide range of aquatic sediments in areas exposed to anthropogenic stressors host important proportions of traditional indicator bacteria, but also of alternative bacterial taxa that more specifically track the presence of fecal (human and animal) and sewage pollution. the magnitude and pattern of the complex fecal signature followed the expected gradients of microbial pollution, and provided information useful to identify the main sources of pollution in the two study sites. our results also emphasize the opportunities that ngs techniques now offer to disentangle complex fecal pollution signals, and to source track and identify alternative fecal indicators in lagoon and marine sediments. non -co mmerc ial us e o nly 123g.m. luna et al. acknowledgments this work was possible thanks to funds granted to gml by the programme ritmare (sp3-wp2-a2 strumenti innovativi per la valutazione degli effetti di contaminanti emergenti sulle comunità biologiche), the ipa project balmas ballast water management system for adriatic sea protection (project code 1° str/0005) funded by eu, the short term mobility (stm) program funded by the cnr, and partially to funds granted to gmq by the malware metagenomic study of microbial invasive species introduced by ballast waters project (funded by lifewatch italia). we sincerely thank dr. francesca garaventa (ismar-cnr) for her help in sampling the prp site, and similarly the crew of the research boat ‘litus’ and dr. mauro bastianini (ismar-cnr) for making sample collection possible in the lv site. references an yj, kampbell dh, breidenbach gp, 2002. escherichia coli and total coliforms in water and sediments at lake marinas. environ. pollut. 120:771-778. bae s, wuertz s, 2015. decay of host-associated bacteroidales cells and dna in continuous-flow freshwater and seawater microcosms of identical experimental design and temperature as measured by pma-qpcr and qpcr. wat. res. 70: 205-213. byappanahalli mn, nevers mb, korajkic a, staley zr, harwood vj, 2012. enterococci in the environment. microbiol. mol. biol. rev. 76:685-706. boldrin a, langone l, miserocchi s, turchetto m, acri f, 2005. po river plume on the adriatic continental shelf: dispersion and sedimentation of dissolved and suspended matter during different river discharge rates. mar. geol. 222:135-158. caporaso jg, kuczynski j, stombaugh j, bittinger k, bushman fd, costello ek, fierer n, pena ag, goodrich jk, gordon ji, huttley ga, kelley st, knights d, koenig je, ley re, lozupone ca, mcdonald d, muegge bd, pirrung m, reeder j, sevinsky jr, turnbaugh pj, walters wa, widmann j, yatsunenko t, zaneveld j, knight r, 2010. qiime allows analysis of high-throughput community sequencing data. nat. methods 7:335-336. casatta n, stefani f, pozzoni f, guzzella l, marziali l, mascolo g, viganò l, 2015. endocrine-disrupting chemicals in coastal lagoons of the po river delta: sediment contamination, bioaccumulation and effects on manila clams. environ. sci. pollut. res. int. 23:10477-10493. correggiari a, cattaneo a, trincardi f, 2005. the modern po delta system: lobe switching and asymmetric prodelta growth. mar. geol. 222:49-74. cucco a, umgiesser g, 2006. modeling the venice lagoon residence time. ecol. model. 193:34-51. desantis tz, hugenholtz p, larsen n, rojas m, brodie el, keller k, et al., 2006. greengenes, a chimera-checked 16s rrna gene database and workbench compatible with arb. appl. environ. microbiol. 72:5069-5072. edgar rc, 2010. search and clustering orders of magnitude faster than blast. bioinformatics 26:2460-2461. eiler a, heinrich f, bertilsson s, 2012. coherent dynamics and association networks among lake bacterioplankton taxa. isme j. 6:330-342. elliott je, elliott kh, 2013. tracking marine pollution. science 340: 556-558. field kg, samadpour m, 2007. fecal source tracking, the indicator paradigm, and managing water quality. water res. 41:3517-3538. fisher jc, eren am, green hc, shanks oc, morrison hg, vineis jh, sogin ml, mclellan sl, 2015. comparison of sewage and animal fecal microbiomes by using oligotyping reveals potential human fecal indicators in multiple taxonomic groups. appl. environ. microbiol. 81:7023-7033. halpern bs, walbridge s, selkoe ka, kappel cv, micheli f, d’agrosa c, et al., 2008. a global map of human impact on marine ecosystems. science 319:948-952. jensen si, kühl m, priemé a, 2007. different bacterial communities associated with the roots and bulk sediment of the seagrass zostera marina. fems microbiol. ecol. 62:108-117. kim m, wuertz s, 2015. survival and persistence of host-associated bacteroidales cells and dna in comparison with escherichia coli and enterococcus in freshwater sediments as quantified by pma-qpcr and qpcr. water res. 87:182-192. kreader ca, 1995. design and evaluation of bacteroides dna probes for the specific detection of human fecal pollution. appl. environ. microbiol. 61: 1171-1179. liang l, goh sg, vergara ggrv, fang hm, rezaeinejad s, chang sy, bayen s, lee wa, sobsey md, rose jb, gin kyh, 2015. alternative fecal indicators and their empirical relationships with enteric viruses, salmonella enterica, and pseudomonas aeruginosa in surface waters of a tropical urban catchment. appl. environ. microbiol. 81:850-860. luna gm, vignaroli c, rinaldi c, pusceddu a, nicoletti l, gabellini m, danovaro r, biavasco f, 2010. extraintestinal escherichia coli carrying virulence genes in coastal marine sediments. appl. environ. microbiol. 76:5659-5668. luo c, walk st, gordon dm, feldgarden m, tiedje jm, konstantinidis kt, 2011. genome sequencing of environmental escherichia coli expands understanding of the ecology and speciation of the model bacterial species. p. natl. acad. sci. usa 108:7200-7205. manini e, luna gm, danovaro r, 2004. benthic bacterial response to variable estuarine water inputs. fems microbiol. ecol. 50:185-194. mclellan sl, eren am, 2014. discovering new indicators of fecal pollution. trends microbiol. 22:697-706. micheletti s, gottardo a, critto a, chiarato a, marcomini a, 2011. environmental quality of transitional waters: the lagoon of venice case study. environ. int. 37:31-41. newton rj, bootsma mj, morrison hg, sogin ml, mclellan sl, 2013. a microbial signature approach to identify fecal pollution in the waters off an urbanized coast of lake michigan. microb. ecol. 65:1011-1023. newton rj, vandewalle jl, borchardt ma, gorelick mh, mclellan sl, 2011. lachnospiraceae and bacteroidales alternative fecal indicators reveal chronic human sewage contamination in an urban harbor. appl. environ. microbiol. 77: 6972-6981 non -co mmerc ial us e o nly 124 next generation sequencing of fecal bacteria pachepsky ya, shelton dr, 2011. escherichia coli and fecal coliforms in freshwater and estuarine sediments. crit. rev. environ. sci. technol. 41: 067-1110. palinkas cm, nittrouer ca, wheatcroft ra, langone l, 2005. the use of 7 be to identify event and seasonal sedimentation near the po river delta, adriatic sea. mar. geol. 222:95-112. perini l, quero gm, garcía es, luna gm, 2015. distribution of escherichia coli in a coastal lagoon (venice, italy): temporal patterns, genetic diversity and the role of tidal forcing. water res. 87:155-165. quero gm, cassin d, botter m, perini l, luna gm, 2015. patterns of benthic bacterial diversity in coastal areas contaminated by heavy metals, polycyclic aromatic hydrocarbons (pahs) and polychlorinated biphenyls (pcbs). front. microbiol. 6:1053. ridgway j, shimmield g, 2002. estuaries as repositories of historical contamination and their impact on shelf seas. est. coast. shelf sci. 55: 903-928. rock p, 2012. urban gulls. why current control methods always fail. riv. ital. ornitol. 82: 58-65. romano s, langone l, frignani m, albertazzi s, focaccia p, bellucci lg, ravaioli m, 2013. historical pattern and mass balance of trace metals in sediments of the northwestern adriatic sea shelf. mar. poll. bull. 76: 32-41. savichtcheva o, okabe s, 2006. alternative indicators of fecal pollution: relations with pathogens and conventional indicators, current methodologies for direct pathogen monitoring and future application perspectives. water res. 40: 2463-2476. scroccaro i, ostoich m, umgiesser g, de pascalis f, colugnati l, mattassi g, vazzoler m, cuomo m, 2010. submarine wastewater discharges: dispersion modelling in the northern adriatic sea. environ. sci. pollut. res. 17: 844-855. sfriso a, facca c, 2013. annual growth and environmental relationships of the invasive species sargassum muticum and undaria pinnatifida in the lagoon of venice. est. coast. shelf sci. 129:162-172. stewart jr, gast rj, fujioka rs, solo-gabriele hm, meschke js, amaral-zettler la, del castillo e, polz mf, collier tk, strom ms, sinigalliano cd, moeller pdr, 2008. the coastal environment and human health: microbial indicators, pathogens, sentinels and reservoirs. environ. health 7:s3. tan b, ng c, nshimyimana jp, loh ll, gin ky-h, thompson jr, 2015. next-generation sequencing (ngs) for assessment of microbial water quality: current progress, challenges, and future opportunities. front. microbiol. 6:1027. vandewalle jl, goetz gw, huse sm, morrison hg, sogin ml, hoffmann rg, yan k, mclellan sl, 2012. acinetobacter, aeromonas and trichococcus populations dominate the microbial community within urban sewer infrastructure. environ. microbiol. 14: 2538-2552. vierheilig j, savio d, ley re, mach rl, farnleitner ah, reischer gh, 2015. potential applications of next generation dna sequencing of 16s rrna gene amplicons in microbial water quality monitoring. wat sci technol 72:1962-1972. vörösmarty cj, mcintyre pb, gessner mo, dudgeon d, prusevich a, green p, glidden s, bunn se, sullivan ca, liermann cr, davies pm, 2010. global threats to human water security and river biodiversity. nature 67:555-561. zuliani a, zaggia l, collavini f, zonta r, 2005. freshwater discharge from the drainage basin to the venice lagoon (italy). environ. internat. 31:929-938. non -co mmerc ial us e o nly advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology advances in oceanography and limnology layout 1 introduction analysis of subfossil cladocera (crustacea: branchiopoda) is widely used in paleolimnology given its potential to reconstruct past environmental conditions (korhola and rautio, 2001; nevalainen and rautio, 2014; zawiska et al., 2015). cladocerans are used as indicators of several abiotic and biotic environmental variables (rumes et al., 2011; chen et al., 2014), as they are very sensitive to changes in total phosphorus concentrations (amsinck et al., 2005; chen et al., 2010), water depth (korhola et al., 2005; nevalainen et al., 2011; gałka et al., 2014), temperature (lotter et al., 1997; korhola, 1999; mirosław-grabowska and zawisza, 2013; nevalainen et al., 2013; zawiska et al., 2015), ph (locke and sprules, 2000; zawiska et al., 2013). the crucial step in subfossil cladocera analysis is the correct taxonomical identification of the remaisns at the species level, which is usually based on the use of light microscope (magnification 100-400x) and several determination keys ( alonso, 1996; szeroczyńska and sarmajakorjonen, 2007; korosi and smol, 2012). as the light microscopy allows to observe the remains in two dimensions, the body sculpture appears to be only a pattern on the surface of the carapace. the microstructural characteristics of the chitinous remains can be observed in threedimensional appearance only by scanning electron microscope (sem), which enables to create images by scanning the surface with a focused beam of electrons (goldstein et al., 2003). the magnifications obtained with sem are much greater than those of light microscopy and reach 100,000x. sem is commonly used in taxonomy of living cladocera to describe morphological features such as the limb setae, the lateral pores or the shell denticles (sinev et al., 2005; sinev and elmoor-loureiro, 2010). cladocera for sem observations are usually collected from water by using a plankton net and dried using either a wide range of alcohol percentages (70%, 90%, 95%, 100%) (duigan, 1992; nandini et al., 2009), or the strong reagent hexamethyldisilazane (laforsch and tollrian, 2000; sousa et al., 2015; juračka et al., 2016). saha et al. (2011) recently presented a new simplified procedure, where specimens collected from water samples are washed in distilled water, dried in the room temperature for 30 mins, coated with gold palladium and examined with sem. sem images are also frequently used in paleolimnology to study sediment properties, such as the origin of carbonates (terrestrial or autogenic), porosity, composition of lamination and microfossil taxa identification (kemp et al., 2001; martín-serrano et al., 2009; wetzel, 2013; kirillova et al., 2016). they are also very useful in observing small morphological details of microorganism and advances in oceanography and limnology, 2016; 7(2): 177-183 article doi: 10.4081/aiol.2016.6218 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). exploring the world of micro sculptures subfossil cladocera remains under the sem izabela zawiska,1* edyta zawisza,2 marta wojewódka,2 artem y. sinev3 1department of geoecology and climatology, institute of geography and spatial organization, polish academy of sciences, twarda 51/55, pl-00-818 warsaw, poland; 2institute of geological sciences, polish academy of sciences, twarda 51/55, pl-00-818 warsaw, poland; 3department of invertebrate zoology, biological faculty, lomonosov moscow state university, leninskie gory, 119991 moscow, russia *corresponding author: izawiska@twarda.pan.pl abstract the scanning electron microscope (sem) is widely used for the identification of microstructural characteristics and morphology of different microorganisms. common procedures are based and developed for remains of living species. this paper presents an effective method for drying and preparing subfossil cladocera remains for sem observation, which has been recently adapted and tested on several samples originating from different american and european lakes. this method results to be fast and cheap, as it excludes the use of expensive and toxic reagents. moreover, it allows to recognize the micro sculpture and other species specific characteristics present on the different body parts of the cladocera remains. the present contribution provides 29 high quality pictures of 12 cladoceran species at magnification between 200x and 11,000x. sem images reveal that the patterns observed on the shells under the light microscope actually are always three dimensional structures. key words: sem; subfossil cladocera; micro sculpture; chitin. received: august 2016. accepted: december 2016. non co mmerc ial us e o nly 178 i. zawiska et al. often help to identify remains such as diatoms (battarbee, 2001) or testate amoebae (beyens and meisterfeld, 2001). therefore, the methodology for preparing the subfossil remains of these organism for sem observation is well established (jiang et al., 2015). on the contrary, cladocera subfossil remains are still rarely observed under the sem (kirillova et al., 2016). in fact, although cladocera skeleton is composed of fairly hard chitin, the typical thickness variation depending on the species, body part and lake environment conditions, make the cladocera preparation for sem more complicated and time-consuming (andrademorraye et al., 2004). the sediment samples should be firstly prepared according to standard procedure (frey, 1986), then remains have to be picked up from the samples and washed several time with distilled water. after that remains should be put to osmium tetroxide for 2 h, washed in distilled water again and submitted to the ethanol dehydration sequence (andrade-morraye et al., 2004). when the remains are acquired from unconsolidated sediments they have to be submitted to dehydration in graded alcohols solutions (kirillova et al., 2016). in our research we aimed at testing whether the simplified method proposed by saha et al. (2011) for aquatic samples could be applied also to subfossil cladocera remains in order to obtain good quality pictures. methods subfossil cladocera remains for sem observation were obtained from sediment samples using two approaches. in the first one fresh sediment from different lakes located in central and south america was analysed (i.e. from lake comendador, lake chicabal, lake quexil (guatemala), lake emiliano zapata (yucatan peninsula, mexico), lake los negritos, lake verde (salvador), lake madre vieja, (honduras), lake san martin, (argentina). remains were picked directly from the unconsolidated upper first cm of surface sediments (1 cm3), diluted with distilled water and put into a petri dish. cladocera remains were pick out using a pipette (in the drop of water) under the dissecting microscope and directly put on the sem microscope stubs covered with a carbon adhesive tape. in the second approach the sediment samples for sem observation were obtained from european lakes, i.e. atnsjøen (norway), czechowskie (poland) and suchar iv (poland). samples were taken from sediment cores and chemically prepared for subfossil cladocera analysis according to standard procedures (szeroczyńska and sarmaja-korjonen, 2007). the amount 1 cm3 of fresh sediment was treated with hot 10% koh for 20 min using a magnetic stirrer in order to deflocculate the material and remove humic substances. thereafter the carbonates were removed using 10% hcl. the remaining material was sieved through 33 µm mesh and diluted in 10 cm3 distilled water. the subfossil remains were removed consecutively with a pipette from the cleaned sediment and directly put on the sem microscope stubs covered with a carbon adhesive tape. the remains obtained from both superficial fresh sediments and cleaned core material were left to dry at the room temperature for 48 hs. when dried they were put into the sputter coater sc7620 for 120 s and coated with a gold-palladium. the sample coating with an electric conducting material is necessary in order to avoid the accumulation of electrostatic charge at the sample surface (sinev et al., 2005; sinev and elmoor-loureiro, 2010). after the specimens were coated they were put into the scanning electron microscope (jeol jsm-6610lv) chamber and observed in high vacuum, using sei mode, voltage 20 kv. results figures 1-8 show 29 good quality images of subfossil cladocera remains belonging to 12 cladocera species. the pictures were taken at magnification ranging from 200x to 11,000x. the remains from both fresh sediments and from the sediment cores have different state of preservation, independently from the age of the sample. the remains of chydorus spp. (leach) preserved well and therefore easier to be photographed, compared to the other observed cladocera species (figs. 1 and 2). the sem pictures allowed to observe magnificent sculpture of ceriodaphnia spp. (dana) and simpocephallus ephippia (schoedler) (figs. 3 and 4). the delicate structure of alonella excisa (fischer) shell and leydigiopsis ornata (daday) (fig. 5), the deep carvings of graptoleberis testudinaria (fischer) and monospilus dispar (sars) (fig. 6), as well as characteristic triangle on the paralona pigra (sars) shell are well documented (fig. 1). the sem pictures revealed the three-dimensional aspect of the head pores of alona ossiani (sinev), bosmina (e.) coregoni (baird) and bosmina (e.) longispina (leydig) (fig. 7). on the contrary, the specimens form lake suchar iv showed high level of degradation, and diminished sculpture of the remains (fig. 8). this might be possibly due to the fact that these sediment samples were prepared for subfossil cladocera analysis already five years ago. discussion the simplified procedure of preparing specimens for sem observation proposed by saha et al. (2011) was tested on different remains of cladocera species from several american and european lakes. this procedure is based on the concept developed for the remains of living species (sinev et al., 2005; van damme and dumont, non co mmerc ial us e o nly exploring the world of micro sculptures subfossil cladocera remains under the sem 179 fig. 1. sem images of cladocera remains. a) chydorus sphericus shell, magnification 270x (lake comendador, guatemala). b) chydorus sphericus shell sculpture, magnification 4000x (lake comendador, guatemala). c) paralona pigra shell, magnification 330x (lake san martin, argentina). d) paralona pigra shell, triangular anterior accessory flange on the anteriror-ventral margin, magnification 950x (lake san martin, argentina). e) chydorus spp., magnification 500x (lake comendador, guatemala). f) chydorus spp., magnification 270x (lake comendador, guatemala). fig. 2. sem images of cladocera remains of ceriodaphnia spp. ephippium (lake emiliano zapata, yucatan peninsula, mexico). magnification: a) 160x; b) 650x; c) 900x; d) 4000x. non co mmerc ial us e o nly 180 i. zawiska et al. 2007; sinev and elmoor-loureiro, 2010; kotov, 2013; sousa et al., 2015). the time for drying the remains suggested by saha et al. (2011) was not long enough in the case of fragmented parts of the cladoceran body found in the studied samples. since most of them were very small and difficult to pick out from the sediment sample with a needle, they were put on the stage with a pipette, in a fairly large drop of water. therefore the prolongation of the drying time was necessary. from all types of examined cladocera remains, ephippia showed the best reservation of structure and ornamentation, as their chitinous envelope is thick and less prone for mechanic destruction. it was also noted that not all subfossil cladocera remains were suitable for sem observation, as some were so thin that the specimens were barely visible. in addition, it was recognized that the subfossil material for sem observation should be pick out from the freshly prepared sediment sample, as the remains slowly degrade and the chitin structure become less prominent after sediment preparation (fig. 8). the sem images clearly showed that the patterns on the shells observed under the light microscope always correspond to three dimensional structures. conclusions the simplified method of preparing subfossil cladocera was applied on different samples from several lakes. the presented method resulted to be simple, cheap and allowed to create high quality images of all types of refig. 3. sem images of cladocera remains of simpocephalus spp. ephippium (lake chicabal, guatemala). magnification: a) 150x; b) 950x; c) 3500x. fig. 4. sem images of cladocera remains. a) alonella excisa shell, magnification 400x (lake quexil, guatemala). b) alonella excisa shell sculpture, magnification 1300x (lake quexil, guatemala). c) leidigiopsis ornata head, magnification 230x (lake los negritos, salvador). d) leidigiopsis ornata head sculpture, magnification 1600x (lake los negritos, salvador). non co mmerc ial us e o nly exploring the world of micro sculptures subfossil cladocera remains under the sem 181 mains even in fairly high magnifications up to 11,000x. although the procedure developed for the remains of living species revealed to be effective also for subfossil cladocera, it appeared necessary to prolong the drying time when working with subfossil remains. moreover, the samples should be prepared just before the sem analysis, in order to prevent the degradation of the micro sculpture after the cleaning procedure. fig. 5. sem images of cladocera remains. a) graptoleberis testudinaria shell, magnification 300x (lake verde, salvador). b) graptoleberis testudinaria head, magnification 370x (lake verde, salvador). c) monospilus dispar head, magnification 400x (czechowskie lake, poland). fig. 6. sem images of cladocera remains of alona ossiani head (lake madre vieja, honduras). magnification: a) 190x; b) 1600x; c,d) 11,000x. fig. 7. sem images of cladocera remains from lake atnsjøen, norway. a) bosmina e.coregoni head, magnification 500x. b) bosmina e.coregoni head pore, magnification 3300x. c) bosmina e. longispina head, magnification 800x. fig. 8. sem images of cladocera decaying remains from sediment from lake suchar iv (poland) prepared for subfossil cladocera analysis 4 years ago. magnification: a) 500x; b) 330 x. non co mmerc ial us e o nly 182 i. zawiska et al. acknowledgments the research was founded by polish national science centre, grant ncn 2014/13/b/st10/02534 and by the eea and norway grants (grant no. 459 fss/2013/iic/w/0022). the presented work was made possible thanks to the support of institute of geography and spatial organization and institute of geological sciences, polish academy of sciences. references alonso m, 1996. [crustacea, branchiopoda].[in spanish]. museo nacional de ciencias naturales, consejo superior de investigaciones cientificas, madrid, spain. amsinck sl, jeppesen e, landkildehus f, 2005. relationships between environmental variables and zooplankton subfossils in the surface sediments of 36 shallow coastal brackish lakes with special emphasis on the role of fish. j. paleolimnol. 33:39-51. andrade-morraye m, eskinazi-sant’anna em, rocha o, 2004. a method for preparing remains of cladocera (crustacea) and chironomid (diptera: insecta) for scanning electron microscopy. braz. j. biol. 64:911-912. battarbee rw, 2001. diatoms. in: j.p. smol, b. birks john and w.m. last (eds.), tracking environmental change using lake sediments. 3. terrestrial, algal, and siliceous indicators. kluwer academic publishers, dodrecht. beyens l, meisterfeld r, 2001. protozoa. testate amoebae. in: j.p. smol, b. birks john and w.m. last (eds.), tracking environmental change using lake sediments. 3. terrestrial, algal, and siliceous indicators. kluwer academic publishers, dodrecht. chen g, dalton c, taylor d, 2010. cladocera as indicators of trophic state in irish lakes. j. paleolimnol. 44:465-481. chen wy, tao s, adams jm, jacques fmb, ferguson dk, zhou z-k, 2014. large-scale dataset from china gives new insights into leaf margin-temperature relationships. palaeogeogr. palaeoclimatol. palaeoecol. 402:73-80. duigan ca, 1992. the ecology and distribution of the littoral freshwater chydoridae (branchiopoda, anomopoda) of ireland, with taxonomic comments on some species. hydrobiologia 241:1-70. frey dg, 1986. cladocera analysis, p. 667-692. in: b.e. berglund (ed.), handbook of holocene palaeoecology and palaeohydrology. john wiley & sons, chichester. gałka m, tobolski k, zawisza e, goslar t, 2014. postglacial history of vegetation, human activity and lake-level changes at jezioro linówek in northeast poland, based on multiproxy data. veg. hist. archaeobot. 23:123-152. goldstein j, newbury de, joy dc, lyman ce, echlin p, lifshin e, sawyer l, michael jr, 2003. introduction, p. 1-20. in: j. goldstein, d.e. newbury, d.c. joy, c.e. lyman, p. echlin, e. lifshin, l. sawyer, j.r michael (eds.), scanning electron microscopy and x-ray microanalysis. 3rd ed. springer, boston. jiang w, pan h, wang f, jiang m, deng x, li j, 2015. a rapid sample processing method to observe diatoms via scanning electron microscopy. j. appl. phycol. 27:243-248. juračka pj, sacherová v, dobiášovská i, bovšková d, novosadová z, kořínek v, petrusek a, 2016. simplification of preparation techniques for scanning electron microscopy of cladocera: preparing filtering limbs and ephippia for efficient studies of ultrastructure. crustaceana 89:47-62. kemp aes, dean j, pearce rb, pike j, 2001. recognition and analysis of beddingand sediment fabric features, p. 7-22. in: w.m. last and j.p. smol (eds.), tracking environmental change using lake sediments: physical and geochemical methods. springer, dordrecht. kirillova iv, van der plicht j, gubin sv, kotov aa, 2016. taphonomic phenomenon of ancient hair from glacial beringia: perspectives for palaeoecological reconstructions. boreas 45:455-469. korhola a, 1999. distribution patterns of cladocera in subarctic fennoscandian lakes and their potential in environmental reconstruction. ecography 22:357-373. korhola a, rautio m, 2001. cladocera and other branchiopod crustaceans, p. 5-41. in: w.m. last and j.p. smol (eds.), tracking environmental change using lake sediments. 4. zoological indicators. springer, dordrecht. korhola a, tikkanen m, weckström j, 2005. quantification of holocene lake-level changes in finnish lapland using a cladocera lake depth transfer model. journal of paleolimnology 34:175-190. korosi jb, smol jp, 2012. an illustrated guide to the identification of cladoceran subfossils from lake sediments in northeastern north america: part 1 the daphniidae, leptodoridae, bosminidae, polyphemidae, holopedidae, sididae, and macrothricidae. j. paleolimnol. 48:571-586. kotov aa, 2013. morphology and phylogeny of the anomopoda (crustacea: cladocera). kmk scientific publishers, moscow: 638 pp. laforsch c, tollrian r, 2000. a new preparation technique of daphnids for scanning electron microscopy using hexamethyldisilazane. arch. hydrobiol. 149:587-596. locke a, sprules wg, 2000. effects of acidic ph and phytoplankton on survival and condition of bosmina longirostris and daphnia pulex. hydrobiologia 437:187-196. lotter a, birks hj, hofmann w, marchetto a, 1997. modern diatom, cladocera, chironomid, and chrysophyte cyst assemblages as quantitative indicators for the reconstruction of past environmental conditions in the alps. i. climate. j. paleolimnol 18: 395-420. martín-serrano a, garcía-cortés a, galán l, gallardo-millán jl, martín-alfageme s, rubio fm, ibarra pi, granda a, pérezgonzález a, garcía-lobón jl, 2009. morphotectonic setting of maar lakes in the campo de calatrava volcanic field (central spain, sw europe). sediment. geol. 222:52-63. mirosław-grabowska j, zawisza e, 2013. late glacial-early holocene environmental changes in charzykowskie lake (northern poland) based on oxygen and carbon isotopes and cladocera data. quatern. int. 328-329:156-166. nandini s, silva-briano m, garcía garcía g, sarma sss, adabache-ortiz a, galván de la rosa r, 2009. first record of the temperate species daphnia curvirostris eylmann, 1887 emend. johnson, 1952 (cladocera: daphniidae) in mexico and its demographic characteristics in relation to algal food density. limnology 10:87-94. nevalainen l, luoto tp, kultti s, sarmaja-korjonen k, 2013. non co mmerc ial us e o nly exploring the world of micro sculptures subfossil cladocera remains under the sem 183 spatio-temporal distribution of sedimentary cladocera (crustacea: branchiopoda) in relation to climate. j. biogeogr. 40:1548-1559. nevalainen l, rautio m, 2014. spectral absorbance of benthic cladoceran carapaces as a new method for inferring past uv exposure of aquatic biota. quaternary sci. rev. 84:109-115. nevalainen l, sarmaja-korjonen k, luoto tp, 2011. sedimentary cladocera as indicators of past water-level changes in shallow northern lakes. quaternary res. 75:430-437. rumes b, eggermont h, verschuren d, 2011. distribution and faunal richness of cladocera in western uganda crater lakes. hydrobiologia 676:39-56. sinev ay, elmoor-loureiro lm, 2010. three new species of chydorid cladocerans of subfamily aloninae (branchipoda: anomopoda: chydoridae) from brazil. zootaxa 2390:1-25. sinev ay, van damme k, kotov a, 2005. redescription of tropical-temperate cladocerans alona diaphana king, 1853 and alona davidi richard, 1895 and their translocation to leberis smirnov, 1989 (branchiopoda: anomopoda: chydoridae). arthropoda selecta 14:183-205. sousa fd, elmoor-loureiro lm, debastiani-junior jr, mugnai r, senna a, 2015. new records of anthalona acuta van damme, sinev & dumont 2011 and anthalona brandorffi (sinev & hollwedel, 2002) in brazil, with description of a new species of the simplex-branch (crustacea: cladocera: chydoridae). zootaxa 4044:224-240. szeroczyńska k, sarmaja-korjonen k, 2007. atlas of subfossil cladocera from central and northern europe. friends of the lower vistula society: 84 pp. van damme k, dumont hj, 2007. limb morphology of the carnivorous anomopods anchistropus emarginatus sars, 1862 and pseudochydorus globosus (baird, 1843) (crustacea: branchiopoda: anomopoda). ann. limnol-int. j. lim. 43:271-284. wetzel a, 2013. formation of methane-related authigenic carbonates within the bioturbated zone an example from the upwelling area off vietnam. palaeogeogr. palaeoclimatol. palaeoecol. 386:23-33. zawiska i, słowiński m, correa-metrio a, obremska m, luoto t, nevalainen l, woszczyk m, milecka k, 2015. the response of a shallow lake and its catchment to late glacial climate changes a case study from eastern poland. catena 126:1-10. zawiska i, zawisza e, woszczyk m, szeroczyńska k, spychalski w, correa-metrio a,2013. cladocera and geochemical evidence from sediment cores show trophic changes in polish dystrophic lakes. hydrobiologia 715:181-193. non co mmerc ial us e o nly advances in oceanography and limnology layout 1 introduction bottom trawling, along with dredging and dumping, represents one among the most severe physical disturbances generated by human activities at sea (thrush and dayton, 2002). typically, bottom trawling is carried out using heavy ground ropes and chains to drive fish and crustaceans from the seabed into nets (johnson et al., 2015). trawling is carried out on many types of grounds, from shallow waters down to the deep continental margins (puig et al., 2012), by small and large vessels, and for a wide range of target species, including fish and crustaceans (hinz et al., 2009). these characteristics make bottom trawling one of the preferred methods of industrial fisheries worldwide but, at the same time, one among the human activities at sea most impacting highly vulnerable benthic marine ecosystems (e.g., cold-water corals or coralligenous bottoms; fowler, 2003; althaus et al., 2009; bruckner, 2009; heifetz et al., 2009; bongiorni et al., 2010). recently, not irrelevant damages determined by bottom trawling have been also documented on benthic communities and processes in deep-sea soft bottoms (pusceddu et al., 2014). previous investigations carried out in shallow marine ecosystems have revealed that bottom trawling can generate a plethora of direct and indirect effects on pelagic and benthic environments and biota (kaiser, 1998; smith et al., 2003; thrush and dayton, 2002; queiros et al., 2006; hiddink et al., 2007; smith et al., 2013). as well as having a direct impact on the stocks of the target species and the by-catch, bottom trawling can also alter the structure and physico-chemical characteristics of the trawled sediment and of the overlying water column (jennings et al., 2001; smith et al., 2003; pusceddu et al., 2005b, 2005c; puig et al., 2012). in the pelagic realm, bottom trawling can increase turbidity, internal nutrient loads, oxygen consumption, and possibly enhance phytoplankton primary production (riemann and hoffmann, 1991; palanques et al., 2001; durrieu de madron et al., 2005). advances in oceanography and limnology, 2015; 6(1/2): 21-32 original article doi: 10.4081/aiol.2015.5448 quantity and biochemical composition of particulate organic matter in a highly trawled area (thermaikos gulf, eastern mediterranean sea) antonio pusceddu,1* silvia bianchelli,2 roberto danovaro2 1dipartimento di scienze della vita e dell’ambiente, università degli studi di cagliari, via fiorelli 1, 09126 cagliari; 2dipartimento di scienze della vita e dell’ambiente, università politecnica delle marche, via brecce bianche, 60131 ancona, italy *corresponding author: apusceddu@unica.it abstract bottom trawling represents nowadays one of the most severe anthropogenic disturbances at sea, and determines large impacts on benthic communities and processes. bottom trawling determines also local sediment resuspension and the effects of the injection of large amounts of surface sediments into the water column have been repeatedly investigated. few studies have assessed the consequences of sediment resuspension caused by bottom trawling on the quantity, biochemical composition and bioavailability of suspended organic particles and how these eventually rival those exerted by natural storms. to provide insights on this poorly addressed issue, we investigated concentrations and biochemical composition of total and enzymatically digestible pools of particulate organic matter (pom) in the thermaikos gulf (mediterranean sea) under calm sea conditions, during intensive trawling activities, and after a severe storm. we show here that sediment resuspension caused by trawling can cause large effects on pom quantity, biochemical composition and bioavailability. both during trawling and after the storm, the relative importance of the carbohydrate pools increased (in the upper water column) and the total lipid concentrations decreased (in the intermediate and bottom layers) when compared to values measured during calm conditions. these results would suggest that bottom trawling could inject in the upper water column pom pools more refractory in nature (e.g., carbohydrates) than those present in calm or after-storm conditions. by contrast, we show also that the bioavailable fraction of biopolymeric c increased significantly during trawling in the upper water column of the shallowest stations and in the bottom water column layer of the deepest ones. these results provide evidence that bottom trawling can influence the overall trophic status of coastal waters, exerting effects similar or stronger than those caused by natural storms, though of variable amplitude depending on the water depth. since bottom trawling is carried out worldwide and natural storms at sea can be frequent and intense, we claim for the need of assessing new adapting management strategies of bottom trawling in order to mitigate the synergistic impacts of anthropogenic and natural sediment resuspension on coastal biogeochemical cycles. key words: particulate organic matter; bottom trawling; eutrophication; mediterranean sea. received: july 2015. accepted: october 2015. non -co mmerc ial us e o nly 22bottom trawling impacts on particulate organic matter bottom trawling can play also a key role in sustaining high productivity on some continental margins by accelerating sedimentary c degradation (polymenakou et al., 2005), nutrient turnover and, thus, enhancing phytoplankton blooms (fanning et al., 1982; christensen, 1989). one of the evident effects of bottom trawling consists in sediment resuspension which generates visible and highly turbid plumes of suspended particles, with concentrations up to several hundred mg l–1 near the seabed (schoellhamer, 1996; durrieu de madron et al., 2005). the injection of large amounts of surface sediments into the water column, particularly when trawling is carried out over soft bottoms (black and parry, 1994; pilskaln et al., 1998), has been hypothesized to rival storms as the main agent for sediment resuspension and transport on the middle and outer continental shelf of the middle atlantic bight (churchill, 1989). whether indeed sediment resuspension induced by bottom trawling has more or less relevance than natural resuspension (as in the case of storms) in fuelling the water column with regenerated nutrients and suspended organic particles available as food for suspension feeders, remains to date a still largely unexplored issue. to provide insights on this issue, we investigated concentrations and biochemical composition of both total and bioavailable (i.e., enzymatically hydrolizable) pools of suspended organic particles in the thermaikos gulf (mediterranean sea) along a putative decreasing gradient of anthropogenic influence, during three periods: september 2001 (calm sea conditions and no trawling), october 2001 (trawling period), and february 2002 (no trawling, after a severe storm). more in details, we tested the null hypothesis by which the quantity, biochemical composition and bioavailability of suspended particles along the whole water column are not affected by bottom trawling or severe storms at the sea surface. methods study area and sampling the thermaikos gulf (fig. 1) is a micro-tidal environment, located in the north western aegean sea (eastern mediterranean), from 39°30’n to 40°38’n and 22°30’e to 23°19’e, with depths ranging from 30 to 200 m. the main circulation is characterized by more saline waters entering the outer shelf of the gulf over the eastern part, then turning towards the northeast in the inner part; less saline waters flow southerly along the western coastline (poulos et al., 2000). the thermaikos gulf is characterized by an extended shelf (180 km long and 55 km wide) of very smooth relief and by meso-eutrophic conditions (zervakis et al., 2005). the area under scrutiny, in particular, is characterized in its inner part by strong anthropogenic influences, due to the thessaloniki city’s harbour and the adjacent industrial zone. moreover, the gulf receives important riverine inputs from three major rivers (axios, aliakmon and pinios rivers; karageorgis and anagnostou, 2001). five sampling stations (namely ip01, ip10, ip17, ip38, ip41 at 30, 41, 55, 51, and 54 m depth, respectively) were located along the coast and positioned along a northto-south transect characterised by seasonally intensive bottom trawling activities (fig. 1). at each station, water samples were collected at 2 m, 20 m and about 1 m above the bottom, in september, october 2001 and in february 2002. these periods were selected as putatively representative of calm conditions and no trawling (september 2001), calm conditions with trawling (october 2001) and no trawling after a prolonged period of severe storms (february 2002). water samples were collected by means of a rosette sampler equipped with 15 l niskin bottles. after pre-filtration through a 200 µm mesh net to remove larger zooplankton, the water samples were filtered onto whatman gf/f filters (pre-combusted at 450°c, 4 h), immediately after collection. filters were stored at -20°c, until analyses. data obtained from the bottom layer of the water colfig. 1. study area and location of the sampling stations. non -co mmerc ial us e o nly 23 a. pusceddu et al. umn have been already partially discussed elsewhere (pusceddu et al., 2005b). in this study we extended the analysis including also the data obtained from the intermediate and surface layers of the water column, to document, if any, the effects of natural and anthropogenic sediment resuspension on the quantity and food availability of (re)suspended organic particles along the entire water column. biochemical composition of particulate organic matter concentrations of total particulate proteins (tprt), total particulate carbohydrates (tcho) and total particulate lipids (tlip) were determined according to hartree (1972) modified by rice (1982) (proteins), dubois et al. (1956) (carbohydrates), and marsh and weinstein (1966) and bligh and dyer (1959) (lipids), respectively. concentrations of the hydrolysable fractions of particulate proteins (hprt) and carbohydrates (hcho) were measured according to dell’anno et al. (2000), slightly modified for particulate samples (pusceddu et al., 2005c). filters were homogenised in 0.1 m na-phosphate buffer (ph 7.5), sonicated three times for 1 min (with intervals of 30 s) before enzyme addition. duplicate filters from each water depth (i.e., treated samples) were added to 100 µl of proteinasek (1 mg ml–1) and 100 µl of protease (600 µg ml–1). an equal volume of na-p buffer solution, without enzymes (i.e., control samples), was added to another set of filters. all the samples were incubated for 1 h at 37°c, under gentle agitation; they were filtered subsequently onto gf/f filters and rinsed twice with 5 ml of cold 0.1 m na-p buffer (ph 7.5), in order to remove the digested protein fraction and the surplus of enzymes. filters muffled at 450°c for 4 h and processed as described above were utilised as blanks. hydrolysable protein analyses from these samples were carried out spectrophotometrically as described above. difference in protein concentration between the control and treated samples were assumed to represent the concentration of proteins actually hydrolysed by proteases (hydrolysed proteins, hprt). for the enzymatic digestion of particulate carbohydrates, the filters were homogenised with 0.1 m na-phosphate, 0.1 m edta (ph 5.0) and sonicated three times for 1 min (with intervals of 30 s). replicate filters (n=3, treated samples) were added to 100 µl of α-amylase, 50 µl of β-glucosidase, 100 µl of proteinase-k and 100 µl of lipase (stock solution of all enzymes was 1 mg ml–1). another set of filters were treated by adding 0.1m na phosphate, instead of enzyme solutions, and utilised as a control. filters muffled at 450°c for 4 h and processed as described above, were utilised as blanks. after incubation, all the samples were centrifuged at 2000 g for 10 min and an aliquot of the supernatant was used to determine carbohydrates released from pom hydrolysis. soluble carbohydrates were determined from the supernatant of the control sample. carbohydrates from all the supernatants were analysed spectrophotometrically, as described above. the actual fraction of enzymatically hydrolysed carbohydrates (hcho) was obtained on the basis of the difference between the carbohydrate concentrations determined in the supernatant of samples containing enzymes and the soluble fraction of the control. total and hydrolysable carbohydrate and protein and total lipid concentrations were converted into carbon equivalents, using 0.40, 0.49 and 0.75 mgc mg–1 conversion factors, respectively (fabiano et al., 1995). the sum of the total protein, carbohydrate and lipid carbon equivalents was reported as particulate biopolymeric organic carbon (bpc, fabiano and pusceddu, 1998). particulate bioavailable organic carbon (baoc), as a proxy of the organic carbon potentially available for consumers (pusceddu et al., 2003, 2009), was defined as the sum of carbon equivalents of hydrolysable carbohydrates and proteins (danovaro et al., 2001). statistical analyses to test the null hypothesis that the quantity, biochemical composition and bioavailability of suspended particles along the whole water column are not affected by bottom trawling nor by severe storms at the sea surface, three-way permutational analyses of variance (permanova; anderson, 2001; mcardle and anderson, 2001) were carried out separately for each variable. the design included three orthogonal factors: period (p, 3 fixed levels: calm, trawling, storm), station (s, 5 fixed levels: ip01, ip10, ip17, ip38, ip41), and water depth (d, 3 fixed levels: surface, intermediate, bottom), with n=3 for the combination of factors. in the multivariate context, variations in the biochemical composition of suspended particles were assessed separately for the three water column layers using a 2-way design with period (p, 3 fixed levels: calm, trawling, storm), and station (s, 5 fixed levels: ip01, ip10, ip17, ip38, ip41) as orthogonal sources of variance. the analyses were based on euclidean distances of previously normalized data, using 4999 random permutations of the appropriate units (anderson and ter braak, 2003). because of the restricted number of unique permutations in the pairwise tests, p values were obtained from monte carlo samplings (anderson and robinson, 2003). significant differences among water layers in each station and sampling period, as well as differences among sampling periods in each station and water column layer were then assessed using snk post-hoc tests. canonical analysis of principal coordinates (cap) was used in the multivariate context to ascertain the allocation of experimental groups to those established a priori. results from the cap were then used to visualize, using biplots, differences among experimental groups (i.e., among periods and stations). the permanova and cap analyses were performed using the routines included in the primer 6+ software (clarke and gorley, 2006). non -co mmerc ial us e o nly 24bottom trawling impacts on particulate organic matter results total protein, carbohydrate, lipid, biopolymeric c, hydrolysable protein and carbohydrate and bioavailable organic carbon concentrations at each stations, water depth and sampling period are reported in tab. 1. the results of the permanova tests revealed a significant interaction of the three tested factors for all of the investigated variables (tab. 2). therefore, in order to identify the eventual significance of the major factor under scrutiny (i.e., trawling vs storm effects), we used post-hoc snk tests to discriminate differences in the concentration of suspended organic matter concentrations: i) among sampling depths during each period and at each station; ii) among sampling periods at each station and water column layer. the results of the post-hoc tests carried out to identify changes in the vertical distribution of suspended particles in the water column during the three different conditions (tab. 3) reveal: i) the presence during calm conditions in september of a nepheloid layer (i.e., significantly higher concentrations in the bottom layer of the water column) in almost all stations; ii) a more homogeneous distribution of pom (i.e., values in intermediate and surface layers higher than or similar to those in the bottom layer) during trawling activities in october and, though to a lesser extent, after-storm in february. these trends apply to almost all investigated variables and appear to be particularly evident at the shallowest stations ip01 and ip10. the post-hoc tests carried out to identify variations in the concentration of suspended organic compounds among sampling periods in each water column layer and in all sampling stations (tab. 4) reveal that: i) the stronger effects of bottom trawling when compared to calm and after-storm conditions are generally most evident in the intermediate and bottom layers of the water column, especially for the carbohydrate pools; ii) in some stations (i.e., ip10, ip17, ip38) and pre-eminently for the protein pools, suspended particle concentrations during trawling in october are similar to those observed after-storm in february and consistently higher than those during calm conditions in september. the results of the 2-way permanova conducted to identify variations in the biochemical composition of particulate organic matter among calm, trawling and afterstorm conditions and among sampling stations in each of the three layers of the water column reveal the presence of a significant period × station interaction for each water column layer (tab. 5). the bi-plots produced after the cap analysis to better ascertain, separately for each layer of the water column, changes in the biochemical composition of particulate organic matter during the three sampling periods reveal: i) in the surface layer of the water column a clear segregation of trawling conditions at all stations, with exception of ip17 and ip38, mostly driven by increasing concentrations of carbohydrate pools, whereas storm conditions mostly overlap with calm conditions (fig. 2a); ii) in the intermediate and bottom layers of the water column a general segregation of trawling and storm (slightly overlapped one each other) from calm conditions, mostly explained by decreasing concentrations of total particulate lipids and increasing concentrations of total and hydrolisable carbohydrate and protein pools during trawling and after storm (fig. 2b-c); iii) in the bottom layer of the water column, the best segregation among trawling, after-storm and calm conditions in the deepest stations (i.e., ip38 and ip41) (fig. 2c). in the surface layer of the water column of all stations, with exception of ip17 and ip38, the bioavailable fraction of particulate biopolymeric c is much higher during trawling activities than in calm and after-storm conditions (fig. 3a). the positive effect of trawling activities on the bioavailability of particulate biopolymeric c observed in the surface layer of the water column is smoother in the intermediate layer of the water column, where it is evident only in the deepest station ip41 (fig. 3b). a higher bioavailability of particulate biopolymeric c during trawling activities when compared to calm and after-storm conditions is again evident in the bottom layer of the water column, in the deepest stations ip38 and ip41 (fig. 3c). discussion we show here that sediment resuspension caused by intensive bottom trawling can determine effects on particulate organic matter (pom) quantity, biochemical composition and bioavailability which are similar or even stronger than those eventually exerted by storms at the sea surface. on the one hand, this result is in accordance with previous findings from the middle atlantic bight, which postulated that bottom trawling can rival natural resuspension induced by storm conditions (churchill, 1989). previous studies, conducted in the thermaikos gulf and, comparatively, in the gulf of lions (nw mediterranean sea), reported changes in the quantitative characteristics of sinking pom, resulting in increased total suspended matter concentrations and gross sedimentation rates through alternate cycles of resuspension and sedimentation associated with natural temporal variability (grémare et al., 2003; karageorgis and anagnostou, 2001; fernandes et al., 2009; zeri et al., 2009). our results show also that the bottom layer of the water column in the thermaikos gulf during calm conditions is characterised generally by concentrations of pom (and almost all its biochemical constituents) higher than those in the intermediate and upper layers. the presence of such a nepheloid layer indicates that natural background levels of sediment resuspension in the thermaikos gulf could be relatively high. in this sense, we must therenon -co mmerc ial us e o nly 25 a. pusceddu et al. ta b. 1 .t ot al a nd h yd ro liz ab le p ro te in , t ot al a nd h yd ro liz ab le c ar bo hy dr at e, to ta l l ip id , b io po ly m er ic c (b pc ), an d bi oa va ila bl e c c on ce nt ra tio ns a t a ) s ur fa ce (2 m ), b ) i nt er m ed ia te (2 0 m ) a nd c ) b ot to m d ep th s i n th e th er m ai ko s g ul f u nd er c al m (s ep te m be r 2 00 1) , d ur in g tra w lin g (o ct ob er 2 00 1) a nd a fte r s to rm (f eb ru ar y 20 02 ) c on di tio ns . pr ot ei n c ar bo hy dr at e to ta l l ip id b io po ly m er ic c b io av ai la bl e c s ta tio n c on di tio n to ta l h yd ro liz ab le to ta l h yd ro liz ab le µ g l –1 sd µg l –1 sd µ g l –1 sd µg l –1 sd µ g l –1 sd µ gc l –1 s d µ gc l –1 s d % o f b pc a ) i p0 1 c al m 8 3. 7 1 .3 2 0. 4 1 .5 6 7. 7 1 .9 1 4. 7 0 .1 2 3. 1 0 .0 8 5. 4 1 .4 3 3. 2 0 .8 3 8. 8 t r aw lin g 1 00 .2 0 .5 5 1. 3 4 .0 8 0. 0 5 .4 2 8. 2 0 .3 2 3. 2 3 .3 9 8. 5 4 .9 5 3. 8 4 .5 5 4. 6 st or m 1 17 .8 7 .5 8. 8 0 .1 10 6. 7 3. 2 8 .5 2. 1 2 3. 2 3 .3 11 7. 8 7. 5 2 5. 1 3 .4 2 1. 3 ip 10 c al m 3 8. 1 2 .1 2. 1 0 .3 3 2. 3 1 .4 0. 0 0 .0 1 0. 1 0 .0 3 9. 1 1 .6 8 .6 0. 2 2 1. 9 tr aw lin g 99 .6 8 .4 6 6. 6 12 .2 1 26 .2 16 .3 3 8. 4 2 .0 9 .4 4. 7 10 3. 8 1 5. 7 52 .5 1 1. 8 50 .6 st or m 1 08 .5 6 .6 3. 8 0 .1 10 7. 1 4. 9 1 .0 0. 0 9 .3 4. 7 10 0. 5 1 0. 2 6 .8 5. 1 6 .7 ip 17 c al m 5 1. 0 0 .3 1 1. 2 1 .7 2 9. 1 1 .6 6. 5 1 .7 1 4. 3 2 .4 4 7. 3 2 .6 1 8. 8 3 .3 3 9. 7 tr aw lin g 59 .5 2 .0 0. 6 0 .0 6 7. 0 10 .8 0 .0 0. 0 7 .2 1. 4 6 1. 3 6 .3 5 .7 1. 0 9 .3 st or m 80 .4 4 .4 1. 0 0 .0 9 5. 9 4 .5 6. 9 2 .4 7 .2 1. 4 8 3. 1 4 .9 8 .6 2. 0 1 0. 4 ip 38 c al m 5 5. 5 0 .3 9. 4 0 .4 4 6. 9 7 .4 3 3. 1 0 .3 1 1. 3 2 .4 5 4. 4 4 .9 2 6. 3 2 .1 4 8. 3 tr aw lin g 65 .9 2 .3 1 0. 0 0 .6 8 0. 9 22 .4 1 1. 6 0 .0 7 .2 0. 0 7 0. 0 10 .1 14 .9 0 .3 2 1. 3 st or m 1 32 .1 8 .7 8 3. 3 4 .7 4 8. 4 2 .1 1. 0 0 .0 3 .1 1. 7 8 6. 4 6 .4 4 3. 5 3 .6 5 0. 4 ip 41 c al m 5 7. 6 6 .2 1 6. 0 0 .5 3 8. 6 2 .2 4. 9 0 .8 1 4. 1 2 .1 5 4. 3 5 .5 2 0. 3 2 .1 3 7. 5 tr aw lin g 76 .1 1 6. 8 23 .2 4 .1 9 8. 8 23 .4 5 4. 8 0 .4 3 .1 1. 7 7 9. 1 18 .9 35 .6 3 .5 4 5. 0 st or m 84 .0 1 8. 2 26 .5 2 .2 7 7. 2 10 .4 1 2. 3 3 .3 5 .0 0. 0 7 5. 8 13 .1 21 .6 2 .4 2 8. 5 b ) i p0 1 c al m 12 8. 4 3 1. 9 46 .8 0 .8 7 1. 3 2 .4 5. 2 0 .1 3 0. 9 2 .9 11 4. 7 1 8. 7 48 .2 2 .6 4 2. 1 tr aw lin g 1 32 .7 0 .5 4 5. 0 0 .2 9 1. 3 3 .1 0. 0 0 .0 2 1. 8 1 .4 11 7. 9 2. 5 3 8. 4 1 .2 3 2. 6 st or m 1 26 .1 2 .3 1 9. 8 3 .2 9 7. 4 1 .4 1. 0 0 .0 2 1. 8 1 .4 11 7. 1 2. 8 2 6. 5 2 .7 2 2. 6 ip 10 c al m 4 8. 6 0 .7 1. 9 0 .3 3 6. 5 2 .8 0. 6 0 .0 8 .9 1. 0 4 5. 0 2 .2 7 .8 0. 9 1 7. 4 tr aw lin g 77 .7 1 .0 4 8. 5 3 .3 11 3. 6 1 8. 6 0 .0 0. 0 7 .3 1. 0 8 9. 0 8 .7 2 9. 3 2 .4 3 2. 9 st or m 84 .4 0 .9 1. 0 0 .0 7 4. 8 3 .2 1. 0 0 .0 7 .3 1. 0 7 6. 8 2 .5 6 .4 0. 7 8 .3 ip 17 c al m 3 7. 0 6 .4 0. 0 0 .0 2 7. 3 3 .6 5. 7 0 .6 1 3. 7 1 .0 3 9. 3 5 .3 1 2. 6 1 .0 3 2. 0 tr aw lin g 72 .3 0 .7 1 8. 7 0 .6 8 4. 8 2 .1 0. 0 0 .0 3 .6 2. 4 7 2. 1 3 .0 1 1. 9 2 .1 1 6. 5 st or m 70 .3 3 .3 7. 8 0 .4 9 3. 5 1 .2 3 2. 5 3 .5 3 .6 2. 4 7 4. 6 3 .9 1 9. 5 3 .4 2 6. 2 ip 38 c al m 8 1. 0 2 .8 1 8. 9 6 .6 4 8. 3 4 .1 1 1. 9 0 .7 1 5. 8 2 .0 7 0. 9 4 .5 2 5. 9 5 .1 3 6. 6 tr aw lin g 61 .4 5 .4 3. 2 0 .2 10 4. 1 8. 8 6 7. 8 1 .9 5 .0 1. 4 7 5. 5 7 .3 3 2. 4 1 .9 4 2. 9 st or m 1 05 .5 1 .3 4 7. 1 12 .7 65 .1 2 .2 2 1. 1 0 .1 3 .1 2. 4 8 0. 1 3 .3 3 3. 8 8 .0 4 2. 2 ip 41 c al m 11 3. 2 3. 7 0 .0 0. 0 4 9. 5 2 .9 0. 0 0 .0 1 6. 6 1 .0 8 7. 7 3 .7 1 2. 4 0 .8 1 4. 2 tr aw lin g 63 .8 4 .7 2 2. 2 5 .5 11 5. 0 9. 7 5 0. 6 14 .0 3 .1 2. 4 7 9. 6 8 .0 3 3. 4 10 .1 4 2. 0 st or m 70 .9 9 .1 2 3. 8 0 .3 9 3. 1 1 .3 1. 0 0 .0 2 .1 1. 2 7 3. 5 5 .9 1 3. 6 1 .0 1 8. 5 c ) i p0 1 c al m 17 3. 3 6. 1 7 6. 7 3 .7 15 0. 6 5. 8 7 3. 5 5 .3 4 0. 4 1 .0 17 5. 4 6. 0 9 7. 3 4 .7 5 5. 4 tr aw lin g 1 35 .1 10 .3 1 8. 8 1 .1 12 3. 4 1 7. 6 42 .0 0 .9 2 2. 2 1 .9 13 2. 2 1 3. 5 42 .6 2 .3 3 2. 2 st or m 1 85 .9 5 .2 4 6. 0 1 .9 15 1. 5 1 1. 0 67 .6 4 .1 2 2. 2 1 .9 16 8. 3 8. 4 6 6. 2 4 .0 3 9. 3 ip 10 c al m 8 4. 9 8 .0 1 2. 9 0 .7 8 5. 6 2 .2 3 9. 3 1 .9 2 9. 9 0 .5 9 8. 3 5 .2 4 4. 5 1 .4 4 5. 3 tr aw lin g 1 08 .2 1 .4 2 3. 8 5 .7 15 3. 0 3 6. 1 40 .2 9 .3 1 0. 0 2 .9 12 1. 7 1 7. 3 35 .3 8 .7 2 9. 0 st or m 1 05 .2 7 .5 2 8. 4 4 .9 10 5. 1 2. 5 1 .0 0. 0 1 0. 0 2 .9 10 1. 1 6. 8 2 1. 8 4 .5 2 1. 6 ip 17 c al m 7 6. 0 0 .9 2 1. 2 0 .7 8 4. 1 2 .5 4 8. 9 8 .2 2 7. 6 0 .0 9 1. 6 1 .5 5 0. 7 3 .7 5 5. 3 tr aw lin g 1 05 .9 6 .6 2 1. 1 2 .8 9 8. 1 14 .1 2 7. 3 6 .1 1 .3 0. 8 9 1. 7 9 .8 2 1. 8 4 .7 2 3. 8 st or m 1 35 .1 13 .1 5 0. 0 0 .8 14 9. 0 4. 2 1 .0 0. 0 4 .0 0. 4 12 8. 7 8. 4 2 7. 9 0 .7 2 1. 6 ip 38 c al m 10 3. 5 0. 5 2 6. 2 9 .6 7 4. 3 8 .0 4 4. 0 1 .0 1 7. 5 2 .9 9 3. 5 5 .6 4 3. 6 7 .2 4 6. 6 tr aw lin g 1 12 .8 4 .2 6 4. 0 6 .2 17 4. 5 4. 6 10 9. 8 1 9. 3 4 .0 0. 4 12 8. 1 4. 2 7 8. 2 11 .0 6 1. 0 st or m 1 28 .4 6 .6 5 3. 0 1 .3 11 4. 6 5. 6 7 9. 6 5 .4 6 .0 0. 0 11 3. 3 5. 5 6 2. 3 2 .8 5 5. 0 ip 41 c al m 8 8. 9 14 .6 1 .0 0. 1 6 5. 9 0 .2 2 5. 7 5 .5 3 4. 3 3 .8 9 5. 7 10 .1 36 .5 5 .1 3 8. 1 tr aw lin g 77 .3 4 .7 1 6. 1 1 .4 13 9. 0 7. 5 9 7. 0 7 .5 6 .0 0. 0 9 8. 0 5 .3 5 1. 2 3 .6 5 2. 2 st or m 1 00 .5 5 .6 3 9. 7 8 .0 5 7. 4 3 .4 7. 5 0 .6 6 .7 1. 9 7 7. 2 5 .5 2 7. 5 5 .6 3 5. 6 sd , s ta nd ar d de vi at io n (n =3 ). non -co mmerc ial us e o nly 26bottom trawling impacts on particulate organic matter tab. 2. results of 3-way permanova testing for differences in the investigated variables among sampling periods, stations and sampling depths. source df ms f p total protein period (p) 2 8.2 134.9 *** station (s) 4 12.1 199.4 *** depth (d) 2 14.1 232.4 *** p x s 8 1.5 24.2 *** p x d 4 1.3 21.7 *** s x d 8 1.2 19.1 *** p x s x d 16 0.6 9.9 *** residual 90 0.1 hydrolysable protein period (p) 2 4.0 117.6 *** station (s) 4 5.7 165.0 *** depth (d) 2 4.5 131.1 *** p x s 8 5.1 148.0 *** p x d 4 1.3 38.4 *** s x d 8 1.1 31.8 *** p x s x d 16 2.3 66.9 *** residual 90 0.0 total carbohydrate period (p) 2 21.4 292.7 *** station (s) 4 2.0 26.7 *** depth (d) 2 17.3 236.3 *** p x s 8 2.9 39.8 *** p x d 4 0.4 5.8 ** s x d 8 1.1 14.6 *** p x s x d 16 0.5 7.4 *** residual 90 0.1 hydrolysable carbohydrate period (p) 2 7.1 270.2 *** station (s) 4 4.5 173.7 *** depth (d) 2 19.7 755.9 *** p x s 8 2.9 109.4 *** p x d 4 0.7 25.2 *** s x d 8 1.7 66.0 *** p x s x d 16 1.3 49.6 *** residual 90 0.0 total lipid period (p) 2 21.2 397.8 *** station (s) 4 14.1 264.8 *** depth (d) 2 4.0 75.2 *** p x s 8 0.4 8.5 *** p x d 4 3.2 60.8 *** s x d 8 0.4 7.7 *** p x s x d 16 0.2 3.3 ** residual 90 0.1 biopolymeric c period (p) 2 4.9 66.8 *** station (s) 4 11.6 156.8 *** depth (d) 2 20.9 282.8 *** p x s 8 1.5 19.7 *** p x d 4 1.2 15.7 *** s x d 8 0.8 11.4 *** p x s x d 16 0.4 5.6 *** residual 90 0.1 bioavailable organic c period (p) 2 2.0 39.3 *** station (s) 4 9.3 183.6 *** depth (d) 2 19.6 387.0 *** p x s 8 2.4 47.8 *** p x d 4 1.1 21.5 *** s x d 8 0.6 12.8 *** p x s x d 16 1.3 25.2 *** residual 90 0.1 df, degrees of freedom; ms, mean square; f, f value; ***p<0.001; **p<0.01. fig. 2. bi-plots after cap analysis illustrating spatial (among stations) and temporal (among calm, trawling and after-storm conditions) variations in the biochemical composition of particulate organic matter in the thermaikos gulf, in the superficial (a), intermediate (b) and bottom (c) water layers. vectors are proportional to the correlation of variables with the two major axes. tprt, total proteins; tcho, total carbohydrates; tlip, total lipids; hprt, hydrolysable proteins; hcho, hydrolysable carbohydrates. non -co mmerc ial us e o nly 27 a. pusceddu et al. tab. 4. visual representation of post-hoc tests carried out to ascertain variations in the concentration of particulate organic compounds in the thermaikos gulf during calm (september, c), trawling (october 2001, t) and after storm (february 2002, s) conditions in the three water column layers. green/white, yellow, light blue and red cells indicate missing effects of both trawling and storm, stronger effects of storm, similar effects of storm and trawling, stronger effects of trawling, respectively. water layer variable ip1 ip10 ip17 ip38 ip41 surface total protein s>t>c s,t>c s,t>c s,t>c ns hydrolysable protein t>c>s t>s>c c>s>t s>c,t s,t>c total carbohydrate s>t>c s,t>c s>t>c ns s,t>c hydrolysable carbohydrate t>c>s t>s>c s>c>t c>t>s t>s>c total lipid ns ns c>t,s c>t>s c>t,s biopolymeric c s>t>c s,t>c s>t>c s>c ns bioavailable organic c t>c>s t>c>s c>s>t s>c>t t>c intermediate total protein t>s s>t>c s,t>c s>c>t c>t,s hydrolysable protein c>t>s t>c>s t>s>c s>c>t s,t>c total carbohydrate s>t>c t>s>c t>s>c t>s>c t>s>c hydrolysable carbohydrate c>s>t c>s>t s>c>t t>s>c t>s>c total lipid c>t,s ns c>t,s c>t,s c>t,s biopolymeric c ns s,t>c s,t>c s>c c>s bioavailable organic c c,t>s t>c>s s>c>t ns t>s>c bottom total protein c,s>t s,t>c t>s>c s>t>c s>t hydrolysable protein c>s>t s,t>c s>t,c s,t>c s>t>c total carbohydrate ns t>s>c s>t,c t>s>c t>s>c hydrolysable carbohydrate c,s>t c,t>s c>t>s s,t>c t>c>s total lipid c>t,s c>t,s c>s>t c>s>t c>s,t biopolymeric c c,s>t ns s>t,c t>s>c c,t>s bioavailable organic c c>s>t c>s c>t,s s,t>c t>c,s ns, not significant. tab. 3. visual representation of post-hoc tests carried out to ascertain variations in the distribution of particulate organic compounds in the water column of the thermaikos gulf during calm (september 2001), trawling (october 2001) and after storm (february 2002) conditions. green, yellow and red cells indicate missing, weak and strong signatures, respectively, of sediment resuspension in the upper water column layer. condition (period) variable ip01 ip10 ip17 ip38 ip41 calm (sept 2001) total protein b>s b>i>s b>s>i b>i>s b,i>s hydrolysable protein b>i>s b>i,s b>s>i b>s s>b>i total carbohydrate b>i,s b>i,s b>i,s b>i,s b>i>s hydrolysable carbohydrate b>s>i b>i>s b>i,s b>s>i b>s>i total lipid b>i>s b>i,s b>i,s b>s b>i,s biopolymeric c b>i,s b>i>s b>i,s b>i>s b,i>s bioavailable organic c b>i>s b>i,s b>s>i b>i,s b>s>i trawling (oct 2001) total protein b,i>s b,s>i b>i>s b>i,s b>i hydrolysable protein s>i>b s,i>b b,i>s b>s>i ns total carbohydrate b>i>s ns b>s b>i,s b>i hydrolysable carbohydrate b>s>i b,s>i b>s,i b>i>s b>i,s total lipid ns ns s>b s>b b>i,s biopolymeric c b,i>s b>i b>i,s b>i,s b>i bioavailable organic c s>b,i s>i b>i>s b>i>s b>s after storm (feb 2002) total protein b>s,i b,s>i b>s>i b,s>i b>i hydrolysable protein b>i>s b>s>i b>i>s s>i,b i>b total carbohydrate b>s>i b,s>i b>i,s b>i>s i>s>b hydrolysable carbohydrate b>s>i ns i>s>b b>i>s b,s>i total lipid ns ns s>b b>s b,s>i biopolymeric c b>s,i b,s>i b>s,i b>s,i ns bioavailable organic c b>s,i b>s,i b>i>s b>s,i b,s>i b, bottom; i, intermediate; s, surface. non -co mmerc ial us e o nly 28bottom trawling impacts on particulate organic matter fore acknowledge that a certain (unknown) proportion of variance among calm, trawling, and after-storm conditions is most likely associated to natural temporal variability in the pom quantity and biochemical composition in the thermaikos gulf. indeed, variations in the concentration of pom along the water column, as well as in its biochemical composition, can be the result of biological processes, including among the others primary productivity and particle consumption (fabiano and pusceddu, 1998; fabiano et al., 2001). moreover, concentration and composition of pom can be affected, in particular along the continental shelf, by rivers discharge (goñi et al., 2013). this latter, however, was most likely not the case as the analysis of meteorological data in the region during the study period revealed a very dry season in autumn 2001, accompanied by very low levels of river discharge (tragou et al., 2005) differences in the environmental characteristics among the sampling periods appeared to be particularly relevant between september-october 2001 and february 2002. in fact, the hydrological characteristics of the thermaikos gulf did not change markedly from september (calm conditions) to october 2001 (during trawling), when pronounced thermoclines and haloclines were recorded at ca. 35-40 m depth in the whole study area (tragou et al., 2005; zervakis et al., 2005). on the other hand, a series of cold fronts that passed over the region in late january 2002 completely homogenised the thermohaline structure of the water column in february 2002 (tragou et al., 2005; zervakis et al., 2005). moreover, during this period, a low salinity, low temperature water front occurred along the western boundary of the gulf, characterised by strong, vertically homogeneous southward velocities of up to 20 cm s–1 (zervakis et al., 2005). these large differences would make in principle difficult interpreting the differences in pom characteristics among the september-october 2001 and february 2002 periods. however, the lack of significant variations in the physicochemical characteristics from calm to trawling conditions, at least, allows us to corroborate the hypothesis by which bottom trawling is a major factor stimulating sediment resuspension and, as a consequence, increasing pom concentrations in the water column as well as significantly modifying its biochemical composition and bioavailability for consumers. this result is indeed consistent with previous investigations carried out by means of both correlative and manipulative approaches, which generally demonstrated that bottom trawling can significantly inject large amounts of sediments and associated pom into the overlying water column (durrieu de madron et al., 2005; pusceddu et al., 2005a, 2005c; martín et al., 2014b). our results paradigmatically demonstrate that along with the well-known mechanisms of pelagic-benthic coupling associated with sedimentation processes of pom (graf, 1992), the reverse exchange of material (i.e., benthicpelagic coupling, sensu marcus and boero, 1998) stimulated by sediment resuspension caused by anthropogenic and, to a lesser extent, natural processes can have important consequences on pom stocks in the water column. we report here also that the transition from calm to trawling and to after-storm conditions is characterised by clear changes in the biochemical composition of pom. in particular, we show that both during trawling in october and after-storm in february, the relative importance of total and hydrolysable carbohydrates increases significantly when compared to values measured during calm conditions. at the same time, suspended pom during trawling and after the storm is also characterised by lipid tab. 5. results of permanova analysis testing for differences in the biochemical composition of particulate organic matter considering all investigated variables in the three layers of the water column. source df ms f p surface period 2 34.302 85.383 *** station 4 15.271 38.012 *** period x station 8 9.7823 24.349 *** residual 30 0.40175 total 44 intermediate period 2 27.632 102.07 *** station 4 21.758 80.37 *** period x station 8 8.6978 32.128 *** residual 30 0.27072 total 44 bottom period 2 28.789 106.5 *** station 4 21.519 79.606 *** period x station 8 8.5294 31.553 *** residual 30 0.27032 total 44 df, degrees of freedom; ms, means square; f, f value; ***p<0.001. non -co mmerc ial us e o nly 29 a. pusceddu et al. concentrations significantly lower than those in calm conditions. the gross biochemical composition of pom is the result of a complex multiple-source array of biotic and abiotic factors (danovaro et al., 2000) and variations in the relative importance of protein, carbohydrate and lipid contents can be highly indicative of changes in the labile vs refractory nature of particles (fabiano et al., 2001). carbohydrates are usually associated with organic matter pre-eminently refractory in nature (grémare et al., 2003; pusceddu et al., 2009), so that our results strongly suggests that sediment resuspension caused by trawling and, though to a lesser extent, by storms can lower the food availability of suspended organic particles. this hypothesis is also corroborated by the significant decrease, during trawling, in the concentration of particulate lipids, whose major fraction is generally highly labile (carreira et al., 2010). altogether these results would suggest that om particles resuspended after bottom trawling could more refractory in nature than those present in the water column in calm or after-storm conditions. nevertheless, we report here that, in contrast with what hypothesized from the gross biochemical composition only, the bioavailable fraction of particulate biopolymeric c increases significantly during trawling, though not consistently at all stations and water layer. this apparent incongruence is due to the fact that while total protein, lipid and carbohydrate pools include generally a very heterogeneous complex of organic compounds which are not fig. 3. variations in the bioavailable fraction of particulate organic matter (in terms of percentage fraction of biopolymeric c enzymatically digestible) in the thermaikos gulf during calm (september 2001), trawling (october 2001) and after-storm (february 2002) conditions. non -co mmerc ial us e o nly 30bottom trawling impacts on particulate organic matter equally reactive to degradation (pusceddu et al., 2009), the enzymatically digestible fractions of protein and carbohydrate pools (i.e., the bioavailable fraction of organic c; dell’anno et al., 2000; pusceddu et al., 2003) are more reliable descriptors of organic matter food availability to consumers than the gross biochemical composition alone (fabiano and pusceddu, 1998; pusceddu et al., 1999; danovaro et al., 2001). the apparent positive effect of bottom trawling on the bioavailability of suspended pom is however, most clearly confined to the bottom layer of the deepest stations investigated in this study. this result does not allow us concluding that sediment resuspension induced by trawling can cause the injection of labile organic compounds in the whole water column, nor that the faster mobilisation rates of organic c buried in the sediment after trawling in coastal sediments is a major factor contributing to coastal eutrophication (polymenakou et al,. 2005; pusceddu et al., 2005c). previous studies carried out in the field and under laboratory conditions have demonstrated that sediment resuspension caused by storms or trawling activities can enhance either suspended or sedimentary pom quantity and bioavailability (pusceddu et al., 2005a, 2005b, 2005c). in particular, benthic microbes exposed to o2-rich waters caused by sediment disturbance induced by trawling can stimulate a faster mobilisation of organic c buried in the sediment, injecting more labile molecules into the system (polymenakou et al., 2005). other studies have also demonstrated that bottom trawling in coastal waters creates plumes of resuspended sediments which last just a few hours in the water column (schoellhamer, 1996; palanques et al., 2001; durrieu de madron et al., 2005). nevertheless, volumes moved from the sediment to the water column can be huge if trawling activities are chronic as observed in several regions of the mediterranean sea (martín et al., 2014a). in such conditions we can hypothesize that the overall enhancement of c cycling in the water column and in the upper layers of the sediment exposed to chronic bottom trawling might stimulate an increase of available nutrients able, in turn, to sustain increased levels of primary productivity, ultimately leading to a potential internal eutrophication process (polymenoakou et al., 2005). overall, the results of this study are very different from what, instead, observed in deep-sea sediments exposed to chronic trawling activities, where the lack of a conspicuous re-deposition from the water column determines a dramatic lowering of organic c sedimentary contents and turnover rates (pusceddu et al., 2014). conclusions although limited to a very short-term analysis, likely biased by the uncontrolled seasonal variations in the quantity and biochemical composition of pom, our results corroborate the most recent literature which demonstrates that bottom trawling represents a major threat not only for commercially exploited target species and the associated by-catch, but can have also important consequences on the biogeochemical cycling of organic c. our results have also shown that the effects of intensive trawling activities can rival those (temporarily) exerted by natural events (e.g., storms). bottom trawling represents the most common fishing practice worldwide, it is being carried out at progressively deeper depths (puig et al., 2012) and is exerting severe consequences on the submersed seascape (martín et al., 2014a) as well on the biodiversity and functioning of marine ecosystems (pusceddu et al., 2014). since bottom trawling is carried out worldwide and natural storms at sea can be frequent and intense, we claim for the need of assessing new adapting management strategies of bottom trawling in order to mitigate the synergistic impacts of anthropogenic and natural sediment resuspension on coastal biogeochemical cycles.. acknowledgments this work has been supported by the project interpol (evk3-2000–0023) of the european commission. references althaus f, williams a, schlacher ta, kloser rj, green ma, barker ba, bax nj, brodie p, schlacher-hoenlinger ma, 2009. impacts of bottom trawling on deep-coral ecosystems of seamounts are long-lasting. mar. ecol. prog. ser. 397: 279-294. anderson mj, 2001. a new method for non-parametric multivariate analysis of variance. austral. ecol. 26:32-46. anderson mj, robinson j, 2003. generalised discriminant analysis based on distances. aust. n.z. j. stat. 45:301-318. anderson mj, ter braak cjf, 2003. permutation tests for multifactorial analysis of variance. j. stat. comput. sim. 73: 85-113. black kp, parry gd, 1994. sediment transport rates and sediment disturbance due to scallop dredging in port phillip bay. mem. queensl. mus. 36:327-341. bligh eg, dyer wj, 1959. a rapid method for total lipid extraction and purification. can. j. biochem. physiol. 37:911-917. bongiorni l, mea m, gambi c, pusceddu a, taviani m, danovaro r, 2010. deep-water scleractinian corals promote higher biodiversity in deep-sea meiofaunal assemblages along continental margins. biol. conserv. 143:1687-1700. bruckner aw, 2009. rate and extent of decline in corallium (pink and red coral) populations: existing data meet the requirements for a cites appendix ii listing. mar. ecol. progr. ser. 397:319-332. carreira rs, araújo mp, costa tlf, ansari nr, pires lcm, 2010. lipid biomarkers in deep sea sediments from the campos basin, se brazilian continental margin. org. geochem. 41:879-884. non -co mmerc ial us e o nly 31 a. pusceddu et al. christensen jp, 1989. sulfate reduction and carbon oxidation rates in continental shelf sediments, an examination of offshelf carbon transport. cont. shelf res. 9:223-246. churchill jh, 1989. the effect of commercial trawling on sediment resuspension and transport over the middle atlantic bight continental shelf. cont. shelf res. 9:841-864. clarke kr, gorley rn, 2006. primer v6: user manual/tutorial. primer-e, plymouth, p.190. danovaro r, dell’anno a, pusceddu a, marrale d, della croce n, fabiano m, tselepides a, 2000. biochemical composition of pico-, nanoand micro-particulate organic matter and bacterioplankton biomass in the oligotrophic cretan sea (ne mediterranean). progr. oceanogr. 46:279-310. danovaro r, dell’anno a, fabiano m, 2001. bioavailability of organic matter in the sediments of the porcupine abyssal plain. mar. ecol. progr. ser. 220:25-32. dell’anno a, fabiano m, mei ml, danovaro r, 2000. enzymatically hydrolysed protein and carbohydrate pools in deep-sea sediments: estimates of the potential bioavailable fraction and methodological considerations. mar. ecol. progr. ser. 196:15-23. dubois m, gilles ka, hamilton jk, rebers pa, smith f, 1956. colorimetric method for determination of sugars and related substances. anal. chem. 28:350-356. durrieu de madron x, ferre b, le corre g, grenz c, conan p, pujo pay m, buscail r, bodiot o, 2005. trawling-induced resuspension and dispersal of muddy sediments and dissolved elements in the gulf of lion (nw mediterranean). cont. shelf res. 25:2387-2409. fabiano m, danovaro r, fraschetti s, 1995. a three-year time series of elemental and biochemical composition of organic matter in subtidal sediments of the ligurian sea (northwestern mediterranean). cont. shelf res. 15:1453-1469. fabiano m, pusceddu a, 1998. total and hydrolizable particulate organic matter (carbohydrates, proteins and lipids) at a coastal station in terra nova bay (ross sea, antarctica). polar biol. 19:125-132. fabiano m, pusceddu a, dell’anno a, armeni m, vanucci s, lampitt r, wolff g, danovaro r, 2001. fluxes of phytopigments and labile organic matter to the deep ocean in the ne atlantic ocean. progr. oceanogr. 50:89-104. fanning ka, carder kl, betzer pr, 1982. sediment resuspension by coastal waters: a potential mechanism for nutrient re-cycling on the ocean’s margins. deep sea res. 29:953-965. fernandes l, bhosle nb, prabhu matondkar sg, bhushan r, 2009. seasonal and spatial distribution of particulate organic matter in the bay of bengal. j. mar. sys. 77:137-147. fowler cw, 2003. tenets, principles, and criteria for management: the basis for systemic management. mar. fish. rev. 65:1-55. goñi ma, hatten ja, wheatcroft ra, borgeld jc, 2013. particulate organic matter export by two contrasting small mountainous rivers from the pacific northwest, u.s.a. j. geophys. res. biogeosci. 118:112-134. graf g, 1992. benthic-pelagic coupling: a benthic view. oceanogr. mar. biol. ann. rev. 30:149-190. grémare a, amouroux jm, cauwet g, charles f, courties c, de bovée f, dinet a, devenon jl, durrieu de madron x, ferre b, fraunie p, joux f, lantoine f, lebaron p, naudin jj, palanques a, pujo-pay m, zudaire l, 2003. the effects of a strong winter storm on physical and biological variables at a shelf site in the mediterranean. oceanol. acta 26:407-419. hartree ef, 1972. determination of proteins: a modification of the lowry method that gives a linear photometric response. anal. biochem. 48:422-427. heifetz j, stone rp, shotwell sk, 2009. damage and disturbance to coral and sponge habitat of the aleutian archipelago. mar. ecol. progr. ser. 397:295-303. hiddink jg, jennings s, kaiser mj, 2007. assessing and predicting the relative ecological impacts of disturbance on habitats with different sensitivities. j. appl. ecol. 44:405-413. hinz h, prieto v, kaiser mj, 2009. trawl disturbance on benthic communities: chronic effects and experimental predictions. ecol. appl. 19:761-773. jennings s, pinnegar jk, polunin nvc, warr kj, 2001. impacts of trawling disturbance on the trophic structure of benthic invertebrate communities. mar. ecol. progr. ser. 213:127-142. johnson af, gorelli g, jenkins sr, hiddink jg, hinz h, 2015. effects of bottom trawling on fish foraging and feeding. proc. r. soc. b 282:20142336. kaiser m, 1998. significance of bottom fishing disturbance. conserv. biol. 12:1230-1235. karageorgis ap, anagnostou cl, 2001. particulate matter spatial-temporal distribution and associated surface sediment properties: thermaikos gulf and sporades basin, nw aegean sea. cont. shelf res. 21:2141-2153. marcus nh, boero f, 1998. minireview: the importance of benthic-pelagic coupling and the forgotten role of life cycles in coastal aquatic systems. limnol. oceanogr. 43:763-768. marsh jb, weinstein db, 1966. a simple charring method for determination of lipids. j. lipid res. 7:574-576. martín j, puig p, palanques a, giamportone a, 2014a. commercial bottom trawling as a driver of sediment dynamics and deep seascape evolution in the anthropocene. anthropocene 7:1-15. martín j, puig p, palanques a, ribó m, 2014b. trawling-induced daily sediment resuspension in the flank of a mediterranean submarine canyon. deep sea res. ii 104:174-183. mcardle bh, anderson mj, 2001. fitting multivariate models to community data: a comment on distance-based redundancy analysis. ecology 82:290-297. palanques a, guillén j, puig p, 2001. impact of bottom trawling on water turbidity and muddy sediment of an unfished continental shelf. limnol. oceanogr. 46:1100-1110. pilskaln ch, churchill jh, mayer lm, 1998. resuspension of sediment by bottom trawling in the gulf of maine and potential geochemical consequences. conserv. biol. 12:1223-1229. polymenakou pn, pusceddu a, tselepides a, polychronaki t, giannakourou a, fiordelmondo c, hatziyanni e, danovaro r, 2005. benthic microbial abundance and activities in an intensively trawled ecosystem (thermaikos gulf, aegean sea). cont. shelf res. 25:2570-2584. poulos se, chronis gth, collins mb, lykousis v, 2000. thermaikos gulf coastal system, nw aegean sea: an overview of water/sediment fluxes in relation to air-land-ocean interactions and human activities. j. mar. syst. 25:47-76. puig p, canals m, company jb, martín j, amblas d, lastras g, palanques a, calafat am, 2012. ploughing the deep sea floor. nature 489:286-289. pusceddu a, bianchelli s, martín j, puig p, palanques a, masqué p, danovaro r, 2014. chronic and intensive bottom non -co mmerc ial us e o nly 32bottom trawling impacts on particulate organic matter trawling impairs deep-sea biodiversity and ecosystem functioning. proc. natl. acad. sci. 111:8861-8866. pusceddu a, dell’anno a, fabiano m, danovaro r, 2009. quantity and bioavailability of sediment organic matter as signatures of benthic trophic status. mar. ecol. progr. ser. 375:41-52. pusceddu a, dell’anno a, manini e, fabiano m, sarà g, danovaro r, 2003. enzymatically hydrolysable protein and carbohydrate sedimentary pools as indicators of the trophic state of ‘detritus sink’ systems: a case study in a mediterranean coastal lagoon. estuaries 26:641-650. pusceddu a, fiordelmondo c, danovaro r, 2005a. sediment resuspension effects on the benthic microbial loop in experimental microcosms. microb. ecol. 50:602-613. pusceddu a, fiordelmondo c, polymenakou p, polychronaki t, tselepides a, danovaro r, 2005b. effects of bottom trawling on the quantity and biochemical composition of organic matter in coastal marine sediments (thermaikos gulf, northwestern aegean sea). cont. shelf res. 25:2491-2505. pusceddu a, grémare a, escoubeyrou k, amouroux jm, fiordelmondo c, danovaro r, 2005c. impact of natural (storm) and anthropogenic (trawling) sediment resuspension on particulate organic matter in coastal environments. cont. shelf res. 25:2506-2520. pusceddu a, sarà g, armeni m, fabiano m, mazzola a, 1999. seas on a land spatial changes in the sediment organic matter of a semi-enclosed marine system (w-mediterranean sea). hydrobiologia 397:59-70. queiros am, hiddink jg, kaiser mj, hinz h, 2006. effects of chronic bottom trawling disturbance on benthic biomass, production and size spectra in different habitats. j. exp. mar. biol. ecol. 335:91-103. rice dl, 1982. the detritus nitrogen problem: new observations and perspectives from organic geochemistry. mar. ecol. progr. ser. 9:153-162. riemann b, hoffmann e, 1991. ecological consequences of dredging and bottom trawling in the limfjord, denmark. mar. ecol. progr. ser. 69:171-178. schoellhamer dh, 1996. anthropogenic sediment resuspension mechanisms in a shallow microtidal estuary. estuar. coas. shelf sci. 43:533-548. smith be, collie js, lengyel nl, 2013. effects of chronic bottom fishing on the benthic epifauna and diets of demersal fishes on northern georges bank. mar. ecol. prog. ser. 472:199-217. smith cj, rumohr h, karakassis i, papadopoulou kn, 2003. analysing the impact of bottom trawls on sedimentary seabeds with sediment profile imagery. j. exp. mar. biol. ecol. 285-286: 479-496. thrush sf, dayton pk, 2002. disturbance to marine benthic habitats by trawling and dredging: implication for marine biodiversity. annu. rev. ecol. syst. 33:449-473. tragou e, zervakis v, papageorgiou e, stavrakakis s, lykousis v, 2005. monitoring the physical forcing of resuspension events in the thermaikos gulf-nw aegean during 20012003. cont. shelf res. 25:2315-2331. zeri c, kontoyiannis h, giannakourou a, 2009. distribution, fluxes and bacterial consumption of total organic carbon in a populated mediterranean gulf. cont. shelf res. 29:886-895. zervakis v, karageorgis ap, kontoyiannis h, papadopoulos v, lykousis v, 2005. hydrology, circulation and distribution of particulate matter in thermaikos gulf (nw aegean sea), during september 2001-october 2001 and february 2002. cont. shelf res. 25:2332-2349. non -co mmerc ial us e o nly layout 1 introduction blooms of cyanobacteria (blue-green algae/ cyanoprokaryotes) have increased globally in recent decades (paerl and otten, 2013; harke et al., 2016). due to the ability of toxin production, some species affect livestocks and high cyanotoxin concentrations were linked to animal deaths and human health hazard through drinking and recreational waters (codd et al., 1999; carmichael et al., 2001; azevedo et al., 2002; backer et al., 2015). cyanobacteria can produce different types of toxic compounds, which include hepatotoxins, neurotoxins, cytotoxins, dermatotoxins and irritant toxins (bláha, 2009; westrick et al., 2010). the occurence of cyanotoxins have been reported in several cyanobacterial genera such as microcystis, nodularia, aphanizomenon, planktothrix, anabaena and cylindrospermopsis (sivonen et al., 1990; merel et. al., 2013; bernard et al., 2017). the most studied group of cyanobacterial toxins are the hepatotoxic cyclic peptides, which include the microcystins and nodularins. although they are similar in structure, nodularin has been isolated from only one species of cyanobacteria, nodularia spumigena mertens ex bornet & flahault, whereas microcystin can be produced by multiple cyanobacterial genera, most notably by microcystis, planktothrix or anabaena (sivonen and jones, 1999; bernard et al., 2017). over 100 microcystin variants and 10 nodularin variants have been identified (spoof et al., 2001; bortoli and volmer, 2014). cyanobacterial blooms occur in turkish inland waters, mostly lakes and reservoirs used as supplies of drinking water or recreation. aphanizomenon sp. was the first cyanobacteria to cause problems in filter system of drinking water treatment plant in kurtbogazi dam lake (ankara) in 1981 (guler aykulu, pers. comm.). during the 1990s many cyanobacterial blooms were detected in the marmara region. in 1994, blooms of anabaena spp. resulted in fish mortality in i̇znik lake (albay et al., 2003a). cyanotoxin research has started at the end of 1990s and increased in recent years (albay et al., 2003a,b; albay et al., 2005; akçaalan et al., 2006, 2014a, 2014b, 2016) it is well known that microscopic identification of cyanobacteria is time consuming and it requires taxonomic expertise. due to this limitation, molecular tools have been increasingly applied also to environmental studies (kurmayer and christiansen, 2009; bukowska et al., 2014). especially, because of the conserved nature of the 16s rrna gene, it is used to discriminate strains at the species level (neilan et al., 1997; moffitt and neilan, advances in oceanography and limnology, 2017; 8(1): 52-60 article doi: 10.4081/aiol.2017.6394 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). molecular detection of hepatotoxic cyanobacteria in inland water bodies of the marmara region, turkey latife köker,1 reyhan akçaalan,1 meriç albay,1 brett a. neilan2 1istanbul university, fisheries faculty, ordu cad. no:200 34470, laleli istanbul, turkey; 2school of biotechnology and biomolecular sciences, university of new south wales, 7 sydney 2052, australia *corresponding author: latifekoker@gmail.com abstract blooms of cyanobacteria are an increasingly frequent phenomenon in freshwater ecosystems worldwide as a result of eutrophication. many species can produce hepatotoxins that cause severe health hazards to humans. the aim of this study was to identify the bloom forming cyanobacteria species by molecular methods and to amplify genes responsible for hepatotoxin biosynthesis from the environmental samples and isolated strains of cyanobacteria from küçükçekmece lagoon, sapanca, i̇znik, manyas and taşkısı lakes. a total of 10 bloom samples and 11 isolated strains were examined and microcystis spp., planktothrix spp., nodularia spumigena, anabaenopsis elenkinii, sphaerospermopsis aphanizomenoides, cylindrospermopsis raciborskii were identified. hepatotoxin genes were detected in 60% of the bloom samples and 45% of the strains. two microcystis strains were obtained from küçükçekmece lagoon. while the strain assigned to microcystis flosaquae was non-toxic, microcystis aeruginosa strain produced microcystin. according to pcr results, the m. aeruginosa and planktothrix agardhii bloom samples of küçükçekmece lagoon contained the microcystin synthetase gene e (mcye) indicative of microcystin production, however, no microcystin was detected by hplc. the mcye gene was also found in microcystis wesenbergii isolated from taşkısı lake, and in all planktothrix rubescens bloom samples from sapanca lake. to our knowledge, this is the first detailed study for identifiying different toxic cyanobacteria species and their hepatotoxin production from several waterbodies in turkey using molecular methods. key words: 16s rrna, aminotransferase, nodularin, microcystin, cyanobacteria, cyanotoxin. received: november 2016. accepted: april 2017. non -co mmerc ial us e o nly molecular identification of hepatotoxic cyanobacteria in turkey 53 2001). jungblut and neilan (2006) developed a molecular method to detect both microcystin and nodularin-producing species by amplifying and sequencing of the aminotransferase (amt) domain of mcye and ndaf genes in the mcy and nda operons. the reason for choosing amt domain was its important role in synthesis of all microcystins and nodularins. due to the increased frequency of algal blooms in turkish lakes, it is important to understand the distribution of toxin-producing cyanobacteria in this area. the aims of the present study were to determine the bloom-forming cyanobacteria species using the 16s rrna gene as well as the potential toxicity using the mcye and ndaf genes indicative of microcystin/nodularin biosynthesis, occurring in lakes around the marmara region (küçükçekmece, sapanca, i̇znik, manyas and taşkısı). methods sampling sites cyanobacterial blooms have been collected from five lakes in marmara region (fig. 1). i̇znik lake, located in the southeast of marmara region, is the fifth biggest lake in turkey. cyanobacterial blooms occured because of heavy nutrient loading (albay et al., 2003a; akçaalan et al., 2006; tas and gonulol, 2007). the first bloom was formed by anabaena sp. in 1994. planktothrix rubescens (de candolle ex gomont) anagnostidis & komárek and nodularia spumigena were also detected (akçaalan et al., 2006; akçaalan et al., 2009). sapanca lake is an oligomesotrophic lake and planktothrix rubescens blooms have been observed in the metalimnion of the lake since the 1980s (akçaalan et al., 2006). the other studied area, küçükçekmece lagoon (istanbul, turkey), has a connection to the marmara sea via a narrow channel. the lagoon is in hypereutrophic conditions and microcystis aeruginosa (kützing) kützing blooms were observed from late spring to mid-autumn (albay et al., 2005) manyas lake is a eutrophic lake which is an important bird sanctuary, and in 1998 it was listed in the ramsar convention (çelik and ongun, 2006). taşkısı lake is a small, shallow lake situated in the eastern part of the marmara region (aykulu et al., 1999) (tab. 1). cyanobacteria identification freshly collected bloom samples were identified by inverted microscopy (axio observer z1, carl zeiss gmbh, jena, germany). 1-2 drops of fresh sample were fig. 1. location of sampling lakes in marmara region. non -co mmerc ial us e o nly l. köker et al.54 investigated according to taxonomical keys using filament/colony traits, presence and structure of mucilage, cell shape and size, whether having a specialized cell or not. cyanobacterial identification was done according to whitton and potts (2007), komárek (2013), komárek and anagnostidis (1986; 1999; 2005) and anagnostidis and komárek (1988). environmental samples during 2004-2009, ten bloom samples were collected from five lakes of marmara region (tab. 2). for cyanotoxin and molecular analysis, samples were collected using plankton net (20 µm mesh size, hydro-bios) and lyophilised and conserved at -20°c. cyanobacterial strains cyanobacterial strains used in the present study (tab. 3) were collected from blooms. single filaments and colonies of cyanobacteria were isolated by repeated washing with sterile media from a pasteur pipette and transferred 96-well plates filled with 200 µl bg 11 medium with or without nitrate according to presence or absence of heterocytes (rippka et al., 1979). dna extraction dna extraction from fresh cell pellets and lyophilized bloom samples was performed using xs extraction buffer containing 1% potassium-methylxanthogenate (800 mm ammonium acetate; 20 mm edta; 1% sds; 100 mm tris-hci, ph 7.4) (tillett and neilan, 2000). dna was dissolved in tris-edta buffer (10:1). concentrations of dna were determined using a nanodrop® nd-1000 spectrophotometer and dna extracts were stored at -20°c. pcr amplification and sequencing all pcr reactions were performed in 20 µl reaction volume containing pcr buffer (bioline, london, uk), 2.5 mm mgci2, 0.2 mm dntps (bioline), 10 pmol each of the forward and reverse primers and 0.2 u taq polymerase (bioline). the pcr amplification products were visualized using gel electrophoresis on 2% agarose, and staining with 0.5 µg ml–1 ethidium bromide for 10 min and documented with a gel doc xr camera using quantity one 4.6.1 software (bio-rad, hercules, ca, usa). 16s rdna amplification was performed using primers 27f and 809r (jungblut et al., 2005) with an initial denaturation step at 92 oc for 2 min followed by 35 cycles of 94°c for 10 s, 60°c for 20 s and 72°c for 1 min and a final extension step at 72°c for 5 min (jungblut et al., 2005). m. aeruginosa pcc7806 was used as positive control. hepatotoxin (hep) pcr reactions were performed using primers hepf and hepr targeting mcye/ndaf gene (jungblut and neilan, 2006). an initial denaturation step at 92°c for 2 min was followed by 35 cycles of 92°c for 20 s, 52°c for 30 s, and 72°c for 1 min, with a final extension step at 72°c for 5 min. the pcr products were sent to ramaciotti centre for genomics (university of new south wales, sydney australia) and sequencing was performed using the illumina miseq platform (illumina, san diego, ca, usa). using a pandaseq (ver. 2.4) nucleotide sequence were reconstructed (masella et al, 2012). overlapping regions were tab. 1. features of the studied lakes. waterbody surface area common use dominant cyanobacteria max. depth i̇znik lake 300 km2 recreation irrigation nodularia spumigena 65 m planktothrix rubescens cylindrospermopsis raciborskii dolichospermum sp. anabaenopsis sp. sapanca lake 46.8 km2 drinking water 55 m recreation planktothrix rubescens küçükçekmece lagoon 15.22 km2 recreation microcystis aeruginosa 20 m planktothrix agardhii microcystis wesenbergii manyas lake 159 km2 fisheries activities microcystis aeruginosa 3.4 m recreation microcystis wesenbergii irrigation sphaerospermopsis sp. dolichospermum flos-aquae cuspidothrix issatschenkoi taşkısı lake 0.75 km2 fisheries activities microcystis spp. 4.5 m dolichospermum sp. non -co mmerc ial us e o nly molecular identification of hepatotoxic cyanobacteria in turkey 55 aligned and scored. sequences were identified using the blastn search program (ncbi). hepatotoxin analysis microcystin/nodularin production of environmental blooms and isolated strains were measured by high performance liquid chromatography (hplc) with photodiode array (pda) detector (perkin elmer, usa) according to lawton (1994). lyophilized samples (10-50 mg) were extracted in 70% (v/v) aqueous methanol with ultrasonication and centrifuged at 14,000 x g for 5 min. clear supernatants were injected into the hplc column (waters symmetry c18, 3.9 × 150 mm, 5 μm particle size). elution mode was used: injection volume 25 µl, flow rate 1 ml min–1 and column temperature 40°c. mobile phases were milli-q water and acetonitrile both containing 0.1% (v/v) tfa. eluent absorbance was monitored from 200 to 300 nm and microcystins were detected at 238 nm. the limit of detection was 0.4 ng per injection corresponding to 0.001 µg mg−1 dw. results cyanobacteria species species identification was done by microscopy. since all blooms were mainly dominated by a single species,16s rdna results are very well correlated with microscopical examination. cyanobacteria that belong to three orders, chroococcales, nostocales and oscillatoriales, were detected. a total of nine species, anabaenopsis elenkinii v.v. miller, cylindrospermopsis raciborskii (woloszynska) seenayya & subba raju, sphaerospermopsis aphanizomenoides (previously denominated aphanizomenon aphanizomenoides forti), n. spumigena, m. aeruginosa, microcystis flos-aquae (wittrock) kirchner, microcystis wesenbergii (komárek) komárek ex komárek, p. rubescens, and planktothrix agardhii (gomont) anagnostidis & komárek were identified. the 16s rdna gene sequences obtained from both strains and environmental samples were assigned using blastn search of the natab. 2. hplc and hep pcr results for environmental bloom samples. code dominant species* place of collection date of collection hplc results hep pcr genbank accession (µg mg–1 d.w) results numbers e1 planktothrix agardhii küçükçekmece lagoon 27/10/2004 nd ky091680 e2 planktothrix agardhii küçükçekmece lagoon 03/11/2004 nd + ky091681 e3 planktothrix agardhii küçükçekmece lagoon 11/11/2004 nd ky091682 e4 microcystis aeruginosa küçükçekmece lagoon 04/10/2006 2.9 + ky091683 e5 planktothrix rubescens sapanca lake 06/02/2007 6.0 + ky091684 e6 planktothrix rubescens sapanca lake 21/02/2007 4.7 + ky091685 e7 microcystis aeruginosa küçükçekmece lagoon 28/09/2007 nd + ky091686 e8 planktothrix rubescens sapanca lake 23/01/2008 0.3 + ky091687 e9 anabaenopsis elenkinii i̇znik lake 16/05/2008 nd ky091688 e10 planktothrix rubescens sapanca lake 28/01/2009 1.1 + ky091689 *species: according to microscopic identification; nd, not detected. tab. 3. hplc and hep pcr results for cyanobacterial cultures. code cyanobacterial species* origin strain hplc results hep pcr genbank accession (µg mg–1 d.w) results numbers s1 microcystis aeruginosa küçükçekmece lagoon ifcc-ma03 6.8 + ky077257 s2 microcystis flos-aquae küçükçekmece lagoon ifcc-mf01 nd ky077258 s3 microcystis wesenbergii taşkısı lake ifcc-mw01 2.4 + ky077259 s4 anabaenopsis elenkinii i̇znik lake ifcc-ae01 nd ky077260 s5 sphaerospermopsis aphanizomenoides i̇znik lake ifcc-aa05 nd ky077261 s6 sphaerospermopsis aphanizomenoides i̇znik lake ifcc-aa01 nd ky077262 s7 cylindrospermopsis raciborskii manyas lake ifcc-cr01 nd ky077263 s8 nodularia spumigena i̇znik lake ifcc-ns01 3.2 + ky077264 s9 nodularia spumigena i̇znik lake ifcc-ns03 3.0 + ky077265 s10 planktothrix agardhii küçükçekmece lagoon ifcc-pa01 nd ky077266 s11 planktothrix rubescens sapanca lake ifcc-pr04 4.3 + ky077267 *species: according to microscopic identification; nd, not detected. non -co mmerc ial us e o nly l. köker et al.56 tional biotechnology information (ncbi) database (http://ncbi.nlm.nih.gov/blast/) (tabs. 2 and 3). the blast search showed 98-100% similarities. detection of hepatotoxin genes the hep pcr reaction resulted in amplification of a fragment in the expected size from two of three microcystis sp. strains, p. rubescens and two n. spumigena strains. no pcr product was obtained from strains assigned to p. agardhii, c. raciborskii, a. elenkinii and s. aphanizomenoides (tab. 3). the hep fragment was successfully amplified from five of seven planktothrix sp., one of two m. aeruginosa dominated environmental bloom samples. in culture samples, m. aeruginosa (s1) and m. flosaquae (s2) strains were isolated from same bloom recorded in küçükçekmece lagoon. while m. aeruginosa strain showed a hep-pcr product, m. flos-aquae was found negative (tab. 3). the other microcystis morphospecies, m. wesenbergii gave a positive result and showed hep-pcr product. the nostocalen species; s. aphanizomenoides and a. elenkinii did not give positive result as well as c. raciborskii strain. in environmental samples, the hep pcr reactions resulted in amplification of a 472-bp fragments for eight of ten samples. the mcye products were obtained from one of three p. agardhii bloom sample (e2), while no pcr products were obtained from p. agardhii (e1-e3) bloom samples. pcr-amplification of the amt domain was succesfully attained from all p. rubescens samples. to verify that the resulting amplicons, all pcr–amplified products from various lakes were sequenced. blast searches were used to identify similar sequences from genbank. detection of hepatotoxins cyanobacterial hepatotoxins were detected by hplcpda. total microcystin concentrations varied from 0.3 to 6.8 microcystin-lr equivalents µg mg–1 d.w. (tabs. 2 and 3). nodularin concentrations in ifcc-ns01 (s8) and ifcc-ns03 (s9) were 3.2 and 3.0 µg mg–1, respectively. the highest amount of microcystin (6.8 µg mg–1 d.w.) was found in m. aeruginosa (s1) strain. microcystin content of m. wesenbergii (s3) was found to be 2.4 µg mg–1. hplc analyses confirmed no microcystin presence in m. flos-aquae (s2), a. elenkinii (s4), s. aphanizomenoides (s5, s6), c. raciborskii (s7) and p. agardhii (s10) strains. in environmental samples, microcystins were not detected in p. agardhii (e1, e3) and a. elenkinii (e9) bloom samples. while mcye products were obtained from p. agardhii (e2) and m. aeruginosa (e7), microcystin was not detected by hplc. microcystin content of p. rubescens samples varied between 0.3-6 µg mg–1. discussion cyanobacteria species were shown to be the main component of phytoplankton community in lakes and reservoirs. earlier records on the algal flora of turkish waterbodies reported taxonomic lists, which were based on the microscopical monitoring and showed a diverse cyanobacteria community (aykulu and obalı, 1981; fakıoğlu et al., 2011). however, polyphasic approaches in classification of organisms are essential, since morphological characters are often unstable and incongruent with molecular tools. for example, the genus microcystis has several morphospecies sharing rather similar characteristics and discussions on the taxonomic assignment of these morphotypes is ongoing (bittencourt-oliveira, 2003). within the genus microcystis, typically two morphospecies (m. aeruginosa and m. flos-aquae) are found in the same population. according to the results of molecular methods used in this study, the mcye gene occurred in m. aeruginosa (s1) strain, but not in m. flos-aquae isolated from the same bloom. tillett et al. (2001) also did not find mcya gene occurrence among m. flos-aquae strains. however, mcya and b genes were detected in half of the colonies assigned to m. flos-aquae (total number was 8) isolated from lakes in europe. correspondingly, m. aeruginosa (n=149) had a higher proportion of colonies containing the mcya/b gene (via-ordorika et al., 2004). in this study, the third strain of microcystis isolated from taşkısı lake was assigned to m. wesenbergii (s3) and not only it contained the mcye gene but also produced microcystin (2.4 µg mg–1 d.w.). according to the study of viaordorika et al. (2004) this morphospecies was found non-toxic in all colonies (n=21) from european lakes. maršálek et al. (2001) showed that in czech republic m. wesenbergii contains little or no microcystin, similarly no microcystin was detected in colonies isolated from a czech reservoir (welker et al., 2007). also, molecular and chemical analysis did not show microcystin production in 250 individual colonies and 21 strains of m. wesenbergii isolated from chinese lakes (xu et al., 2008). however, otsuka et al (1999) found that m. wesenbergii has toxic and nontoxic strains. yosuno et al. (1998) also found that all m. wesenbergii (n=8) strains examined contained microcystin. likewise, in lake kastoria (greece), m. wesenbergii dominant bloom containing toxin producing genes such as mcya and mcyb was reported (gkelis et al., 2014). pavlova et al. (2014; 2015) found toxic bloom dominated by m. wesenbergii in lake dourankoulak, and highlighted that toxicity may vary between clones of the same strain. because of these contradictory results, it is necessary to analyse higher number of microcystis mornon -co mmerc ial us e o nly molecular identification of hepatotoxic cyanobacteria in turkey 57 phospecies to determine the relationship between toxigenicity and morphological characters. it is known that p. agardhii and p. rubescens have specific ecological niches. while p. rubescens occurs in oligoto mesotrophic physically stratified lakes (akçaalan et al., 2014a), p. agardhii become dominant in shallow, eutrophic and polymictic water bodies (kurmayer et al., 2004). in this study, p. rubescens was isolated from sapanca lake, which is a moderately deep, oligo-mesotrophic lake. in contrast, p. agardhii formed a bloom in a hypereutrophic lake in late autumn and polymictic conditions. similar to microcystis both toxic and nontoxic strains can be found in the same population of p. agardhii and p. rubescens (kurmayer et al., 2004; akçaalan et al., 2006). in general, the share of strains containing the mcya/b gene is highest in p. rubescens populations in contrast to p. agardhii. accordingly, our results showed that p. rubescens has active microcystin genes, while the strain isolated from p. agardhii bloom was found nontoxic. the strain of a. elenkinii was isolated from a bloom sample of i̇znik lake which was dominated by this species. both the bloom sample and isolated strain were found negative for the mcy genes as well as no microcystin was detected by hplc. this species generally cooccurs with other nostocalen cyanobacteria and toxicity is attained to all of them (maršálek et al., 2000; papadimitriou et al., 2013). however, there is no record of microcystin production of a isolated strain of a. elenkinii. c. raciborskii has been shown to produce hepatotoxic cylindrospermopsin and neurotoxic saxitoxins (wood and stirling, 2003; molica et al., 2005). this species originates from tropical regions and currently expands its distribution in temperate regions, therefore it may be considered an invasive species in european waterbodies (padisák, 1997; moreira et al., 2015). in this study c. raciborskii was isolated from shallow hypereutrophic manyas lake but did not contain the mcye gene. also, no cylindrospermopsin was detected according to molecular and analytical analysis (data not shown). there are some contradictory results between molecular and analytical methods. m. aeruginosa (e5) and p. agardhii (e2) contained the mcye gene, but did not produce microcystin as revealed by hplc. studies showed that cyanobacteria strains with mcy genes lacked detectable microcystins as a result of inactivation of the genes (neilan et al., 1999; nishizawa et al.,1999; kaebernick et al., 2001; tillett et al., 2001; mikalsen et al., 2003). samples used in this study were collected from waterbodies with different morphological and physicochemical characteristics. some cyanobacteria species have been found in both shallow and moderately deep lakes, some others prefer deep waterbodies. however, the distribution of species is governed mainly by trophic situation of the lakes. microcystis species together with p. agardhii formed blooms in eutrophic environment, such as manyas, küçükçekmece and taşkısı lake. nostocalen cyanobacteria species, on the other hand, prefer alkaline, meso-eutrophic waters of i̇znik lake (akçaalan et al., 2009, 2014b). especially nodularia spumigena is an euryhaline species living in hyposaline to brackish waters in turkey (kocasari et al., 2015; kızılkaya et al., 2016). similarly, a. elenkinii is also known as a hyposaline species (kemp, 2009; kotut and krienitz, 2011). the growth of these species might have been supported by high conductivity of the lake water. on the other hand, in typical freshwater sapanca lake, which is used for drinking water and has low nutrient concentration, toxic p. rubescens form massive blooms. the most important factors are the high water transparency, thermal stratification, a long water residence time and low nutrient availability, which have negative effect on other phytoplankton species in the lake (legnani et al., 2005; akçaalan et al., 2014a) conclusions in conclusion, applications of molecular and dna amplification methods provide a great advantage for monitoring toxic cyanobacterial blooms in the aquatic environments. it has a potential to identify the organisms and to detect their cyanotoxin production. this study, using different methods collaboratively, shows that toxic cyanobacteria blooms are very common in turkish inland waterbodies with different trophic levels. to our knowledge, this is the first detailed study identifying different toxic cyanobacteria species and their hepatotoxin production in turkey using molecular methods. acknowledgments this work was supported by scientific research projects coordination unit of istanbul university. project number 2846. we would like to thank ban group at the university of new south wales for their help in molecular work. the authors also would like to acknowledge the european cooperation in science and technology, cost action es 1105 “cyanocost” for adding value to this study through networking and knowledge sharing with european researchers. references akçaalan r, young fm, metcalf js, morrison lf, albay m, codd ga, 2006. microcystin analysis in single filaments of planktothrix spp. in laboratory cultures and environmental blooms. water. res. 40:1583-1590. non -co mmerc ial us e o nly l. köker et al.58 akçaalan r, marzur-marzec h, zalewska a, albay m, 2009. phenotypic and toxicological characterization of toxic nodularia spumigena from a freshwater lake in turkey. harmful algae 8:273-278. akçaalan r, köker l, gürevin c, albay m, 2014a. planktothrix rubescens: a perennial presence and toxicity in lake sapanca. turk. j. bot. 38:782-789. akçaalan r, köker l, oğuz a, spoof l, meriluoto j, albay m, 2014b. first report of cylindrospermopsin production by two cyanobacteria (dolichospermum mendotae and chrysosporum ovalisporum) in lake iznik, turkey. toxins 6:31733186. akçaalan r, köker l, albay m, 2016. do eutrophic waters prompt to toxic cyanobacteria in turkish black sea coast? j. environ. prot. ecol. 17: 584-592. albay m, akçaalan r, tufekci h, metcalf js, beattie ka, codd ga, 2003a. depth profiles of cyanobacterial hepatotoxins (microcystins) in three turkish freshwater lakes. hydrobiologia 505:89-95. albay m, akçaalan r, aykulu g, tufekci h beattie ka, codd ga, 2003b. occurrence of toxic cyanobacteria before and after copper sulphate treatment in a water reservoir, istanbul, turkey. algol. stud. 109:67-78. albay m, matthiensen a, codd ga, 2005. occurrence of toxic blue-green algae in the küçükçekmece lagoon (istanbul, turkey). environ. toxicol. 20:227-284. aykulu g, obalı o, 1981. phytoplankton biomass in the kurtboğazı dam lake. com. de fac. sci. univ. ankara c2 24:30-45. anagnostidis k, komárek j, 1988. modern approach to the classification system of cyanophytes. algol. stud./arch. hydrobiol. 50-53:327-472. aykulu g, dogan k, hasirci s, 1999. a study on the phytoplankton communities of lakes taskisi and poyrazlar (adapazari, turkey). istanbul university j. aquat. prod. special issue 157-184. azevedo, smfo, carmichael ww, jochimsen em, rinehart kl, lau s, shaw gr, eaglesham gk, 2002. human intoxication by microcystins during renal dialysis treatment in caruaru-brazil. toxicology 181-182:441-446. backer lc, manassaram-baptiste d, leprell r, bolton b, 2015. cyanobacteria and algae blooms: review of health and environmental data from the harmful algal bloom-related illness surveillance system (habiss) 2007-2011. toxins 7:1048-1064. bittencourt-oliveira m, 2003. detection of potential microcystin-producing cyanobacteria in brazilian reservoirs with a mcyb molecular marker. harmful algae 2:51-60. bláha l, babica p, maršálek b, 2009. toxins produced in cyanobacterial water blooms-toxicity and risks. interdiscip. toxicol. 2:36-41. bortoli s, volmer da, 2014. account: characterization and identification of microcystins by mass spectrometry. eur. j. mass spectrom. 20:1-19. bukowska a, bielczynska a, karnkowska a, chrost rj, jasser i, 2014. molecular (pcr-dgge) versus morphological approach: analysis of taxonomic composition of potentially toxic cyanobacteria in freshwater lakes. aquat biosyst. 10:2. carmichael ww, azevedo smfo, an js, molica rjr, jochimsen em, lau s, rinehart kl, shaw gr, eaglesham gk, 2001. human fatalities from cyanobacteria: chemical and biological evidence for cyanotoxins. environ. health. persp. 109:663-668. çelik k, ongun t, 2006. seasonal dynamics of phytoplankton assemblages across nutrient gradients in the shallow hypertrophic lake manyas, turkey. lake reserv. manage. 22:250-260. codd ga, bell sg, kaya k, ward cj, beattie ka, metcalf js. 1999. cyanobacterial toxins exposure routes and human health. eur. j. phycol. 34:405-415. fakıoğlı ö, atamanalp m, demir n, 2011. toxic blue-green algae in dam lakes. ankara üniversitesi çevrebilimleri 3:65-71. gkelis s, zaoutsos n, 2014. cyanotoxin occurrence and potentially toxin producing cyanobacteria in freshwaters of greece: a multi-disciplinary approach. toxicon 78:1-9. harke mj, steffen mm, gobler cj, otten tg, wilhelm sw, wood sa, paerl hw, 2016. a review of the global ecology, genomics, and biogeography of the toxic cyanobacterium, microcystis spp. harmful algae 54:4-20. jungblut ad, hawes i, mountfort d, hitzfeld b, dietrich dr, burns bp, neilan ba, 2005. diversity within cyanobacterial mat communities in variable salinity meltwater ponds of mcmurdo ice shelf, antarctica. environ. microbiol. 7:519-529. jungblut ad, neilan ba, 2006. molecular identification and evolution of the cyclic peptide hepatotoxins, microcystin and nodularin, synthetase genes in three orders of cyanobacteria. arch. microbiol. 185: 107-114. kaebernick m, rohrlack t, christoffersen k, neilan ba., 2001. aspontaneous mutant of microcystin biosynthesis: genetic charac-terization and effect on daphnia. environ. microbiol. 3:669-679. kemp as, 2009. freshwater cyanoprokaryota blooms in the swan coastal plain wetlands: ecology, taxonomy and toxicology. phd thesis, curtin university of technology, australia. kızılkaya it, demirel z, kesici k, kesici e, sukatar a, 2016. morphological, molecular and toxicologial characterization of nodularia spumigena mertens in jungens (1822) from brackishwater lake bafa (turkey). sinop uni j nat sci 1:39-52. kocasari fs, gulle i, kocasari s, pekkaya s, mor f, 2015. the occurrence and levels of cyanotoxin nodularin from nodularia spumigena in the alkaline and salty lake burdur, turkey. j. limnol. 74:530-536. komárek j, 2013. cyanoprokaryota. 3. heterocytous genera. springer verlag, berlin: 1130 pp. komárek j, anagnostidis k, 1986. modern approach to the classification system of cyanophytes. algol. stud./arch. hydrobiol 43:157-164. komárek j, anagnostidis k, 1999. [cyanoprokaryota. 1. teil: chroococcales, p. 1-548]. in: h. ettl, g. gardner, h. heynig and d. mollenheuer (eds.),[süsswasserflora von mitteleurope].[book in german]. gustav fischer verlag. komárek j, anagnostidis k, 2005. [süßwasserflora von mitteleuropa, bd. 19/2: cyanoprokaryota].[book in german]. springer spektrum, heidelberg: 759 pp. kotut k., krienitz l, 2011. does the potentially toxic cyanobacterium microcystis exist in the soda lakes of east africa? hydrobiologia 664:219-225. non -co mmerc ial us e o nly molecular identification of hepatotoxic cyanobacteria in turkey 59 kurmayer r, christiansen g, fastner j, börner t, 2004. abundance of active and inactive microcystin genotypes in populations of the toxic cyanobacterium planktothrix spp. environ. microbiol. 6:831-841. kurmayer r, christiansen g, 2009. the genetic basis of toxin production in cyanobacteria. freshwater rev. 2:31-50. lawton la, edwards c, codd ga, 1994. extraction and highperformance liquid chromatographic method for the determination of microcystin in raw and treated waters. analyst 119:1525-1530. legnani e, copetti d, oggioni a, tartari g, palumbo mt, morabito g, 2005. planktothrix rubescens’ seasonal dynamics and vertical distribution in lake pusiano (north italy). j. limnol. 64:61-73. masella ap, bartram ak, truszkowski jm, brown dg, neufeld jd, 2012. pandaseq: paired-end assembler for illumina sequences. bmc bioinformatics 13:31. maršálek b, bláha l, hindák f, 2000. review of toxicity of cyanobacteria in slovakia. biologia 55:645-652. maršálek b, bláha l, turánek j, neča j, 2001. microcystin-lr and total microcystin in cyanobacterial blooms in the czech republic 1993-1998, p. 56-62. in: i. chorus (ed.), cyanotoxins-occurence, causes, consequences. springer-verlag. merel s, villarín mc, chung k, snyder s, 2013. spatial and thematic distribution of research on cyanotoxins. toxicon 76:118-131. bernard c, ballot a, thomazeau s, maloufi s, furey a, mankiewicz�boczek j, pawlik�skowrońska b, capelli c, salmaso n, 2017. cyanobacteria associated with the production of cyanotoxins, appendix 2. in: j. meriluoto, l. spoof, and g. codd (eds.), handbook of cyanobacterial monitoring and cyanotoxin analysis. j. wiley & sons. mikalsen b, boison g, skulberg om, fastner j, davies w, gabrielsen tm, rudi k, jakobsen ks., 2003. natural variationin the microcystin synthetase operon mcyabc and impact on microcystin production in microcystis strains. j. bacteriol. 185:2774-2785. moffitt mc, neilan, ba, 2001. on the presence of peptide synthetaseand polyketide synthase genes in the cyanobacterial genus nodularia. fems microbiol. lett. 196:207-214. molica rjr, oliveira eja, carvalho pvvc, costa ansf, cunha mcc, melo gl, azevedo smfo, 2005. occurrence of saxitoxins and an anatoxin-a(s)-like anticholinesterase in brazilian drinking water supply. harmful algae 4:743-753. moreira c, fathalli a, vasconcelos v, antunes a, 2015. phylogeny and biogeography of the invasive cyanobacterium cylindrospermopsis raciborskii. arch. microbiol. 197:47-52. neilan ba, dittmann e, rouhiainen l, bass ra, schaub v, sivonen k, borner t, 1999. nonribosomal peptide synthesisand toxigenicity of cyanobacteria. j bacteriol 181:4089-4097. neilan ba, jacobs d, deldot t, blackall ll, hawkins pr, cox pt, goodman ae, 1997. rrna sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus microcystis. internat. j. syst. bacteriol. 47:693-697. nishizawa t, asayama m, fujii k, harada k, shirai m., 1999. genetic analysis of the peptide synthetase genes for a cyclic heptapeptide microcystin in microcystis spp. j biochem (tokyo) 126:520-529. otsuka s, suda s, li r, watanabe m, oyaizu h, matsumoto s, watanabe mm, 1999. phylogenetic relationships between toxic and non-toxic strains of the genus microcystis based on 16s to 23s internal transcribed spacer sequence. fems microbiol. lett. 172:15-21. padisák j, 1997. cylindrospermopsis raciborskii (woloszynska) seenayya et subba raju, an expanding, highly adaptive cyanobacterium: worldwide distribution and review of its ecology. arch. hydrobiol. 107:563-593. paerl h, otten t, 2013. harmful cyanobacterial blooms: causes, consequences, and controls. microb. ecol. 65:995-1010. papadimitriou t, katsiapi m, kormas ka, moustaka-gouni mik, 2013. artificially-born “killer” lake: phytoplankton based water quality and microcystin affected fish in a reconstructed lake. sci. total. environ. 452-453:116-124. pavlova v, stoyneva m, georgieva v, donchev d, spoof l, meriluoto j, bratanova z, karadjova i, 2014. new records of microcystins in some bulgarian water bodies of health and conservational importance. j. water resource prot. 6:446-453. pavlova v, stoyneva-gärtner m, uzunov b, bratanova z, lazarova a, karadjova i, 2015. microcystins-lr, -yr andrr in six bulgarian water bodies of health and conservational importance (2012-2014). j. water resource prot. 7:1375-1386. rippka r, deruelles j, waterbury j, herdman m, stanier r, 1979. generic assignments, strain histories and properties of pure cultures of cyanobacteria. j. gen. microbiol. 111:1-61. sivonen k, niemelä si, niemi rm, lepistö l, luoma th, räsänen la, 1990. toxic cyanobacteria (blue green algae) in finnish fresh and coastal waters. hydrobiologia 190:267-275. sivonen k, jones g, 1999. cyanobacterial toxins, p. 41-111. in: i. chorus and j. bartam (eds.), toxic cyanobacteria in water: a guide to their public health consequences, monitoring and management. e & fn spon. spoof l, karlsson k, meriluoto j, 2001. high-performance liquid chromatographic separation of microcystins and nodularin, cyanobacterial peptide toxins, on c18 and amide c16 sorbents. j. chromatogr. a 909:225-236. tas b, gonulol a, 2007. an ecologic and taxonomic study on phytoplankton of a shallow lake, turkey. j. environ. biol. 28:439-445. tillett d, neilan ba, 2000. xanthogenate nucleic acid isolation from cultured and environmental cyanobacteria. j. phycol. 36:251-258. tillett d, parker dl, neilan ba, 2001. detection of toxigenicity by a probe for the microcystin synthetase a gene (mcya) of the cyanobacterial genus microcystis: comparison of toxicities with 16s rrna and phycocyanin operon (phycocyanin intergenic spacer) phylogenies. appl. environ. microb. 67:2810-2818. via-ordorika l, fastner j, kurmayer r, hisbergues m, dittmann e, komárek j, erhard m, chorus i, 2004. distribution of microcystin-producing and non-microcystin-producing microcystis sp. in european freshwater bodies: detection of microcystins and microcystin genes in individual colonies. syst. appl. microbiol. 27:592-602. welker m, šejnohová l, némethová d, von dohren h, jarkovsky j, maršálek b, 2007. seasonal shifts in chemotype composition of microcystis sp. communities in the pelagial and the sediment of a shallow reservoir. limnol. oceanogr. 52:609-619. westrick ja, szlag dc, southwell bj, sinclair j, 2010. a review non -co mmerc ial us e o nly l. köker et al.60 of cyanobacteria and cyanotoxins removal/inactivation in drinking water treatment. anal. bioanal. chem. 397:17051714. whitton ba, potts m, 2007. the ecology of cyanobacteria: their diversity in time and space. springer science, berlin: 669 pp. wood sa, stirling dj, 2003. first identification of the cylindrospermopsin-producing cyanobacterium cylindrospermopsis raciborskii in new zealand. new zeal. j. mar. fresh. 37:821-828. xu y, wu z, yu b, peng x, yu g, wei z, wang g, li r, 2008. non-microcystin producing microcystis wesenbergii (komárek) komárek (cyanobacteria) representing a main waterbloom-forming species in chinese waters. environ. pollut. 156:162-167. yosuno m, sugaya y, kaya k, watanabe mm, 1998. variations in the toxicity of microcystis species to moina macrocopa. phycol. res. 46:31-36. non -co mmerc ial us e o nly layout 1 advances in oceanography and limnology, 2015; 6(1/2): 2-12 original article doi: 10.4081/aiol.2015.5451 introduction biological invasions, i.e., the successful establishment of non-indigenous species (nis) in a given area, are long known to be one of the most serious threats to the conservation of the world biological diversity. in fact, nis are known to threat the survival of indigenous species, populations, and communities through hybridisation, competition, parasitism, predation, and the structural changes they cause to the colonised habitats (ehrenfeld, 2010; simberloff et al., 2013). furthermore, they are also known to cause substantial economic damages, and can be harmful for human health (pimentel et al., 2005, keller et al., 2011). although biological invasions are a pervasive global phenomenon which widely interests all the existing ecosystems, some evidences suggest that inland waters are especially prone to be invaded (gherardi, 2007; chandra and gerhardt, 2008). this is possibly due to the pronounced dispersal abilities of most of inland-water taxa (incagnone et al., 2015), to the naiveté of lakes and other inland water ecosystems to the effects of invaders owing to their evolutionary isolation (cox and lima, 2006), and, eventually, to the pivotal importance that these habitats have always had for the human civilisation. anthropogenic alterations of the pre-existing biocoenoses, both in terrestrial and marine environments, are in fact known to have likely facilitated the establishment of several opportunistic newcomers (chytrý et al., 2008; airoldi et al., 2015; see also boggero et al., 2014). moreover, freshwater ecosystems are globally experiencing the highest loss of biodiversity due to human activities (naiman and dudgeon, 2011). in spite of some early warnings (elton, 1958), and of the sound evidences of the impacts that non-indigenous species have on the indigenous biota, little efforts were paid to take a census and to monitor non-indigenous species in european inland waters till the end of the xx century; in some instances, confronting alien species was even suspected to be a form of xenophobia (simberloff, 2003). such a delay in approaching biological invasions a review on the animal xenodiversity in sicilian inland waters (italy) federico marrone,* luigi naselli-flores department of biological, chemical and pharmaceutical sciences and technologies, university of palermo, via archirafi 18, 90123, palermo, italy *corresponding author: federico.marrone@unipa.it abstract this paper reviews the available knowledge about faunal xenodiversity in sicilian inland waters (italy). the aim is to provide an updated checklist and bibliography of those non-indigenous species (nis) which occur in the island, and to identify possible threats to its native biological diversity. data were collected through an extensive literature search which encompassed also local journals, books, congress abstracts, and other grey literature. all the collected data were critically revised and, when possible, verified by consulting available collections or through dedicated sampling surveys. only those data contained in reports indicating precise occurrence localities, which were confirmed by our own observations and\or by at least two independent sources including at least a peer-reviewed publication, were considered as certain. data in literature that did not meet these criteria were considered doubtful and reported separately as unverified data. the information provided by websites has been excluded as it often contains unfounded and\or erroneous data. the fauna of sicilian inland waters host at present 31 confirmed nis. in addition, the presence of further 11 taxa is dubious. among the verified data, invertebrate and vertebrate taxa are nearly equally represented, with 15 and 16 taxa, respectively. with 16 species, the phylum chordata is by far the most represented, followed by mollusca (8 species) and arthropoda (6 species). most of these species were detected in the last 30 years due to the lack of previous regular studies on sicilian freshwaters. with few exceptions (e.g., the recent introduction of xenopus laevis, the african clawed frog), nis’ effects on native biota have not extensively studied in the island yet. although the top-down effects caused by introduced vertebrate taxa are known to deeply modify the native structure of the biota, little information is available on the impacts caused by invertebrate taxa, especially the microscopic ones. the presence in sicily of 11 nonnative species of bony fish is probably the most impacting threat to autochthonous fauna through predation, competition and hybridisation. the results shown in the paper highlight the importance and the urgency of more exhaustive investigations on nis in sicilian inland waters with special regard to less charismatic taxa whose effects on the native biota have never been evaluated yet. key words: biological invasions; mediterranean biodiversity; non-indigenous species; translocated species; parautochthonous taxa; allochthonous taxa. received: july 2015. accepted: september 2015. non -co mmerc ial us e o nly 3 f. marrone and l. naselli-flores interested even those countries with a longer tradition in limnological studies, and only recently national and international studies on invasion biology have been conducted. these have led to the creation of dedicated checklists and databases, available on the web, aimed at providing a complete census of the non-indigenous biota of the continent (e.g., daisie: delivering alien invasive species inventories for europe, www.europe-aliens.org, or aquatic alien species in german inland and coastal waters, http://www.aquatic-aliens.de/). however, the completion of an exhaustive census of the nis is intrinsically difficult given the dynamic nature of the phenomenon, and it is especially hard for those less-charismatic taxa and\or small-bodied organisms, which are more difficult to notice or to correctly identify. furthermore, the recent evidences that cryptic species or lineages often are the protagonists of widely overlooked cryptic invasions (saltonstall, 2002; marrone et al., 2011; van bocxlaer et al., 2015), stress the need for the implementation of molecular identification tools when dealing with biological invasions (blanchet, 2012). based on all these hindering factors, the known distribution of non-indigenous species often reflects the distribution of researchers interested in invasion biology and\or taxonomists, rather than that of the organisms themselves. such is the case of the non-indigenous biota of sicilian inland-waters, which was to date understudied, with sparse data, often published in scarcely accessible literature. as a consequence, even in the most recent reviews addressed to the non-indigenous biota of european and italian inland waters, sicily has often been considered jointly with sardinia (nocita and zerunian, 2007; tricarico et al., 2010; bianco, 2014); this approach reflects the paucity of data available for the two islands rather than any theoretical, biological, or historical reason. in some cases, sicilian nis were even not included in the analyses at all (marr et al., 2013; boggero et al., 2014). moreover, due to the aforementioned constraints, those few studies where sicily was considered as an independent region (gherardi et al., 2008) show rather fragmentary checklists. the lack of comprehensive data on nis makes their management and control difficult. actually, not all the introduced nis are able to successfully establish populations in the invaded areas, and even less prove to be actually invasive (i.e., noxious to the native biota see the tens rule, cf. williamson, 1996). however, when the invasiveness of a certain taxon becomes evident, it is often too late to control or eradicate it in spite of the efforts invested. accordingly, it has been suggested that the nis are to be considered guilty until proven otherwise, and that a quick and dirty response, aimed at eliminating the nis at their very first colonisation outset is strongly advisable and, possibly, the only way to solve the problem (gherardi, 2006). a detailed and timely monitoring of the current xenodiversity and of the ongoing biological invasions is thus needed when facing the challenge of protecting the indigenous species and ecosystems from biotic homogenization. the present paper collects and reviews all the available literature on the nis occurring in the fauna of sicilian inland waters, with the explicit aim to provide sound and updated baseline data for future studies and desirable management activities. methods definitions and study area in this paper we describe the animal xenodiversity, i.e., the diversity of the non-indigenous fauna, occurring in sicilian inland waters (cf. leppäkoski et al., 2002). inland waters are here defined according to the water framework directive (directive 2000/60/ec): all standing or flowing waters on the surface of the land. in contrast with some published papers dealing with italian xenodiversity (gherardi et al., 2008; tricarico et al., 2010; boggero et al., 2014), we are hereby considering nis (non-indigenous species) all those taxa which are occurring outside of their natural distribution range and dispersal potential, and which were introduced to sicily by human activities (iucn, 2000); we are therefore here including also the translocated species, i.e., those species which are native (autochthonous) to the italian peninsula or sardinia but that would be naturally absent in sicily. within the nis, we distinguish among those taxa introduced before the year 1500, called parautochthonous taxa, and those which were introduced in sicily after that date, i.e., the allochthonous taxa (gazzetta ufficiale della repubblica italiana, 2015). a further important partition is between those taxa which are present in sicily with self-sustaining breeding populations (established species) and those which are present on the island, but whose successful breeding was not observed and that might thus not be able to constitute self-sustaining populations; the non-occasional presence of the latter is due to an ongoing introduction of specimens in the wild (sporadic species). among the nis, we here consider invasive species those widespread non-indigenous species that have adverse effects on the invaded habitats (cf. gherardi, 2006). to date, no data on the occurrence of nis on the small-circum-sicilian islands are available; accordingly, the present paper focuses on the sicilian mainland only. bibliographical review a checklist of the nis reported to occur in sicily was compiled from an extensive literature search through journals, books, congress abstracts, and other grey literature. unfortunately, given the difficulties in exhaustively tracing non -co mmerc ial us e o nly 4alien species in sicilian inland water the grey literature, we cannot exclude that some information might have been missed. all collected data were critically revised and, when possible, checked by consulting available collections or through dedicated sampling surveys. in the frame of this paper, we considered as verified data those reports indicating precise occurrence localities, which were confirmed by our own observations and\or by at least two independent sources, including at least a peerreviewed publication. the information which did not meet these criteria was here considered doubtful and the taxa were reported separately as unverified. the information provided by websites has been excluded as it often contains anecdotic and\or erroneous data. results updated checklist and origin of the nis occurring in sicilian inland waters the updated checklist of the nis occurring in sicilian inland waters is reported in tabs. 1 to 3. overall, 31 nis were confirmed to be positively present in sicily (tabs. 1 and 2). another group includes 11 taxa whose presence in sicily is dubious and\or whose non-indigenous status in sicily is nowadays considered controversial (tab. 3). by taking into account only the verified data, invertebrates and vertebrates are nearly equally represented, with 15 and 16 taxa respectively. the phylum chordata is by far the most represented, with 16 species, followed by mollusca (8 species) and arthropoda (6 species) (fig. 1). overall, the commonest source for the nis in sicilian inland waters is the nearctic region, followed by the westand east-palaearctic subregions; only single taxa colonised sicily from the neotropical, afrotropical, oriental or australian regions (for more details see tabs. 1 and 2; fig. 2). in good accordance, the vast majority of the nis occurring in sicily are allochthonous taxa introduced after the xvi century, with only a single mammal species being a parautochthonous taxon (i.e., the brown rat), and three taxa with no data on their first introduction (i.e., the isopod proasellus banyulensis, and the fish perca fluviatilis and carassius auratus, cf. tabs. 1 and 2). unfortunately, nearly no information is available on how deliberate were the introductions of most of the nis in the inland waters of sicily, with a few exception as the one of gambusia holbrooki introduced in sicily between 1925 and 1927 to keep under control malaria-spreading mosquitoes (consoli, 1928; veronesi et al., 1997). however, a markedly different pattern is scored between invertebrate and vertebrate taxa. with the only exception of the brown rat, rattus norvegicus, all the remaining vertebrate taxa were likely the object of intentional introductions for ornamental, fishing, or sanitary purposes; conversely, the opposite pattern is scored among the invertebrates, which are mostly inconspicuous species unintentionally released in the wild along with intentionallyintroduced aquatic vertebrate species and\or ornamental plants (mazza et al., 2015). invertebrate nis and putative nis all the invertebrate nis listed in tab. 1 are known to be successfully established in sicily, being present with locally abundant, self-sustaining populations. among them, the oldest records are those referring to the gastropod haitia acuta, whose arrive in sicily dates back at least to the xix century (sowerby, 1873-1874), followed by the crustaceans daphnia ambigua, d. parvula, and proasellus banyulensis, all of them first collected in sicily in the ’80s (calvo et al., 1993; stoch et al., 1996; marrone et al., 2005). all the other taxa were reported to be present on the island only in the xxi century or are even still unpublished records (tab. 1), thus suggesting a recent significant increase in the rate of successful invasions by invertebrate nis in sicilian inland waters. among the putative nis whose presence in sicily is inferred from unverified data, the reports of the gastropod helisoma anceps and of the crustacean moina affinis are likely based on the misidentification of congener species known to occur on the island, while the report of the bivalve corbicula fluminea from western sicily is possibly to be ascribed to the mislabelling of a museum specimen (tab. 3). finally, the non-indigenous status for the gastropod galba truncatula in sicily is questioned by recent studies (liberto et al., 2010) which suggest that this taxon might in fact be autochthonous on the island. vertebrate nis and putative nis most of the vertebrate nis occurring in sicily are present with established, widespread populations (tab. 2). however, there are some exceptions: the rainbow trout, oncorhynchus mykiss, for instance, is a sporadic species, known to be unable to breed in sicilian inland waters. the presence of this species in the rivers of the island is to be ascribed to the ongoing release of specimens for recreational fishing. to date, no evidences of the presence of reproducing populations of the locally abundant red-eared slider, trachemys scripta elegans, in sicily are available, although the species is known to successfully breed in italy and might find in sicily suitable bioclimatic conditions for its reproduction (ficetola et al., 2009). finally, the case of emys orbicularis s.l. is quite peculiar as, although no pure populations of this non-indigenous species are known to occur on the island, there are evidences of the introduction of single e. orbicularis galloitalica fritz, 1995 specimens in sicilian localities inhabited by the endemic sicilian pond turtle, emys trinacris fritz, fattizzo, guicking, tripepi, pennisi, lenk, joger and wink, 2005 (lenk et al., 1999); non -co mmerc ial us e o nly 5 f. marrone and l. naselli-flores this has led to the genetic introgression of e. orbicularis genes in eastern-sicilian populations of e. trinacris (vamberger et al., 2015). the identity of some non-indigenous fish species reported to be present in sicily is still to be ascertained (tabs. 2 and 3); this is the case of the pike (esox cf. lucius), whose taxonomical identity has to be carefully checked in the light of the relatively recent description of the southern pike, esox cisalpinus bianco and delmastro, 2011, and of the chub (squalius cf. cephalus), for which tab. 1. list of the non-indigenous invertebrate animal species known to occur in sicilian inland waters. taxon category origin introduction status source(s) allochthonous vs intentional vs established vs parautochthonous unintentional sporadic nematoda secernentea spirurida anguillicolae anguillicola crassus kuwahara, niimi and itagaki, 1974 a southeast asia u e 4, 12 mollusca gastropoda hydrobiidae potamopyrgus antipodarum (j.e. gray, 1843) a new zealand u e 6, 12 lymnaeidae radix auricularia (linnaeus, 1758) a eurasia u e 6, 13 physidae haitia acuta (draparnaud, 1805) a north america u e 6, 9 planorbidae ferrissia fragilis (tryon, 1863) a north america u e 14 helisoma duryi (wetherby, 1879) a north america n.a. e 2, 11, 12 thiaridae melanoides tuberculata (o.f. müller, 1774) a tropical africa and asia n.a. e 9, 11 bivalvia dreissenidae dreissena polymorpha (pallas, 1771) a ponto-caspian region n.a. e 16 unionidae sinanodonta woodiana (lea, 1834) a east asia n.a. e 16 arthropoda crustacea branchiopoda anomopoda daphniidae daphnia ambigua scourfield, 1947 a north america u e 1, 7, 8, 12 daphnia parvula fordyce, 1901 a north america u e 7, 8 copepoda cyclopoida ergasilidae neoergasilus japonicus (harada, 1930) a asia u e 19 malacostraca isopoda asellidae proasellus banyulensis (racovitza, 1919) n.a. europe u e 3, 8 decapoda cambaridae procambarus clarkii (girard, 1852) a north america i e 5, 10, 17, 18 hexapoda insecta diptera culicidae aedes albopictus (skuse, 1894) a southeast asia u e 15 a, allochthonous; p, parautochthonous; i, intentional; u, unintentional; e, established; s, sporadic; n.a., not available; 1, calvo et al., 1993; 2, manganelli et al., 1995; 3, stoch et al., 1996; 4,weidema, 2000; 5, d’angelo and lo valvo, 2003; 6, zettler and richard, 2003; 7, marrone et al., 2005; 8, ruffo and stoch, 2006; 9, cianfanelli et al., 2007; 10, naselli-flores et al., 2007; 11, reitano et al., 2007; 12, gherardi et al., 2008; 13, liberto et al., 2010; 14, marrone et al., 2011; 15, carminade et al., 2012; 16, colomba et al., 2013; 17, di leo et al., 2014; 18, bellante et al., 2015; 19, alfonso and marrone, upublished data. non -co mmerc ial us e o nly 6alien species in sicilian inland water no specimens collected in sicilian inland waters were, to our knowledge, ever studied or described and whose presence itself in the island is to be considered dubious. the only aquatic bird ever reported as a nis for sicily is the mute swan, cygnus olor (gmelin, 1789) (scalera, 2001). however, the specimens overwintering in sicily are likely coming from the southern balkans, where the species is autochthonous as breeding as well as wintering bird, and should therefore be considered autochthonous in sicily (b. massa, personal communication). discussion the animal xenodiversity of sicilian inland waters when comparing the checklists reported in tabs. 1 to tab. 2. list of the non-indigenous vertebrate animal species known to occur in sicilian inland waters. taxon category origin introduction status source(s) allochthonous vs intentional vs established vs parautochthonous unintentional sporadic chordata osteichthyes perciformes centrarchidae micropterus salmoides lacépède, 1802 a north america i e 7, 12, 16, 17, 18, 21, 25 percidae perca fluviatilis linnaeus, 1758 n.a. eurasia i e 2, 18, 25 cypriniformes cyprinidae carassius auratus (linnaeus, 1758) n.a. asia i e 2, 3, 6, 7, 8, 16, 17, 18, 21, 25 cyprinus carpio (linnaeus, 1758) p* eurasia i e 2, 3, 6, 7, 16, 17, 18, 21, 22, 25, 27 rutilus rubilio bonaparte, 1837 a southern italy i e 4, 6, 7, 8, 12, 16, 17, 18, 28 tinca tinca (linnaeus, 1758) p europe i e 2, 3, 6, 7, 16, 17, 25 siluriformes ictaluridae ameiurus melas (rafinesque, 1820) a north america i e 6, 7, 12, 17, 18, 21, 25 cyprinodontiformes poecilidae gambusia holbrooki girard, 1859 a north america i e 1, 3, 6, 7, 8, 9, 15, 16, 17, 18, 21, 22, 25, 27, 29 esociformes esocidae esox cf. lucius§ a n.a. i e 6, 7, 12, 16, 17, 25 salmoniformes salmonidae oncorhynchus mykiss walbaum, 1792 a north america i s 6, 7, 16, 17, 18, 21 salmo trutta linnaeus, 1758 a europe i e 7, 16, 17, 18, 21, 25, 26 amphibia anura pipidae xenopus laevis (daudin, 1802) a africa i e 14, 19, 20, 21, 23, 24 reptilia testudines emydidae emys orbicularis s.l. a peninsular italy i n.a. 11, 30 trachemys scripta elegans (wied, 1839) a north america i s 19, 22 mammalia rodentia myocastoridae myocastor coypus molina, 1872 a south america i e 17, 19, 21 muridae rattus norvegicus berkenhout, 1769 p asia u e 10, 13, 17, 19, 21 a, allochthonous; p, parautochthonous; i, intentional; u, unintentional; e, established; s, sporadic; n.a., not available or not applicable; *its parautochthony considered dubious by gherardi et al. (2008, and references therein); §no sound information on the identity of the pikes introduced in sicily is available (see text); 1, consoli, 1928; 2, faranda et al., 1977; 3, tigano, 1983; 4, tigano and ferrito, 1986; 5, lo valvo et al., 1993; 6, ferrito and tigano, 1995; 7, tigano and ferrito, 1996; 8, russo et al., 1997; 9, veronesi et al., 1997; 10, sarà, 1998; 11, lenk et al., 1999; 12, russo et al., 1999; 13, scalera, 2001; 14, lillo et al., 2005; 15, duchi, 2006a; 16, duchi, 2006b; 17, ruffo and stoch, 2006; 18, nocita and zerunian, 2007; 19, aa.vv., 2008; 20, faraone et al., 2008; 21, gherardi et al., 2008; 22, termine et al., 2008; 23, lillo et al., 2011; 24, lillo et al., 2013; 25, bianco, 2014; 26, duchi, 2014a; 27, duchi, 2014b; 28, duchi, 2014c; 29, duchi and miceli, 2014; 30, vamberger et al., 2015. non -co mmerc ial us e o nly 7 f. marrone and l. naselli-flores 3 with the information currently available in literature (scalera, 2001; ruffo and stoch, 2006; nocita and zerunian, 2007; cianfanelli et al., 2007; gherardi et al., 2008; bianco, 2014), a certain decoupling is obvious, with the latter lacking some taxa which are actually present in sicily, or conversely including others whose presence is dubious or to be excluded for the island. this is to be ascribed to the shortage of studies explicitly focused at investigating sicilian xenodiversity, with the few existing data scattered among often difficult-to-get pieces of literature. furthermore, most of the whole-country-scale reviews are focusing on allochthonous taxa only, leaving aside the parautochthonous and translocated species, which are possibly difficult to single out when working on large geographical scales, but which can be easily identified when the study area is of limited extension and geographically well-defined as the present case-study. the case of bony fishes is emblematic: although they tab. 3. checklist of the taxa whose presence in sicily and\or whose non-indigenous status is uncertain. taxon origin notes source(s) mollusca gastropoda lymnaeidae galba truncatula (o.f. müller, 1774) europe the species is considered autochthonous by liberto et al., 2010 5 planorbidae helisoma anceps (menke, 1830) north america it might have been confused with the congener h. duryi 5 (cf. cianfanelli et al., 2007) bivalvia corbiculidae corbicula fluminea (o.f. müller, 1774) southeast asia the report is based on a single specimen stored in the mollusc collection 2 of the hebrew university of jerusalem crustacea branchiopoda anomopoda moinidae moina affinis birge, 1893 north america possibly a misidentification for the congener species moina salina 1 or m. brachiata (cf. marrone et al., 2005) chordata osteichthyes cypriniformes cyprinidae carassius carassius linnaeus, 1758 europe taxon reported for sicily without providing precise locality data 6 nor relevant references squalius cf. cephalus § n.a. taxon reported for sicily without providing precise locality data 4 nor relevant references pseudorasbora parva asia taxon reported for sicily without providing precise locality data 7, 8 (temminck and schlegel, 1846) nor relevant references perciformes centrarchidae lepomis gibbosus (linnaeus, 1758) north america taxon reported for sicily without providing precise locality data 7, 8, 9 nor relevant references siluriformes ictaluridae ameiurus nebulosus (lesueur, 1819) north america taxon reported for sicily without providing precise locality data 7, 8, 9 nor relevant references reptilia testudines geoemydidae mauremys cf. sinensis (gray, 1834) asia no evidences on the occurrence of the species in the wild are available 10 aves anseriformes anatidae cygnus olor (gmelin, 1789) eurasia the individuals overwintering in sicily might come from the balkans, 3, 4 where the species is autochthonous. they should thus not be considered nis in sicily (b. massa, pers. comm.) §no sound information on the species-level identity of the taxon\taxa possibly introduced to sicily is available; n.a., not available or not applicable; 1, faranda, 1977; 2, mienis, 1991; 3, lo valvo et al., 1993; 4, scalera, 2001; 5, zettler and richard, 2003; 6, duchi, 2006b; 7, nocita and zerunian, 2007; 8,gherardi et al., 2008; 9, bianco, 2014; 10, panzeri et al., 2014. non -co mmerc ial us e o nly 8alien species in sicilian inland water are by far the most represented non-indigenous taxon occurring in sicily, only south-eastern sicilian inland water bodies have been investigated (ferrito and tigano, 1995; duchi, 2006b, and references therein) to date, and nearly no information is available for most of sicilian inland waters (but see russo et al., 1999; duchi, 2014c). as a consequence, no updated local reviews are available, and the italian lists are rather incomplete or include some taxa whose actual presence in the island is dubious or can be excluded (ruffo and stoch, 2006; nocita and zerunian, 2007; gherardi et al., 2008; tricarico et al., 2010; and, partly, bianco, 2014). furthermore, five out of the 11 fish species reported in tab. 2 are likely translocated taxa from peninsular italy, where they are autochthonous, and thus partly or completely overlooked by nocita and zerunian (2007), gherardi et al. (2008), and bianco (2014). when dealing with biological invasions, the translocation of fish and other animals among different freshwater ecosystems within the region should also be considered. quite often we actually observed fish introductions in temporary ponds where they can significantly alter and threaten the structure of the native biota (naselli flores and barone, 2012). the strong predominance of vertebrate over invertebrate taxa in tabs. 1-3 is likely an artefact due to the high visibility of the former, and to the inadequate number of taxonomists present in sicily for several aquatic invertebrate taxa. it is quite evident that the presence of a single non-indigenous insect species (i.e., the asian tiger mosquito, aedes albopictus) in the list here presented has to be ascribed to the paucity of information currently available on sicilian inland water insect communities rather than to the actual presence of a single nis belonging to this important and species-rich taxon. more accurate information is available for inland water molluscs and crustaceans, two among the best-studied invertebrate taxa in sicily; conversely, no information is available for other important taxa as porifera, cnidaria, or annelida, which include several species known to be introduced in italian and european inland waters and that might well be present in sicilian inland waters as well. in spite of the patent incompleteness of the currently available nis checklist, seven out of the 31 nis positively present in sicilian inland waters are listed among the 100 of the world’s worst invasive alien species (lowe et al., 2000), i.e. one mollusc (the zebra mussel, d. polymorpha), one insect (the asian tiger mosquito, a. albopictus), three fish (the brown trout s. trutta, the carp c. carpio, the large-mouth bass m. salmoides), one reptile (the redeared slider, t. scripta elegans), and one mammal (the coypu, m. coypus). at least two other heavily invasive species should be added to this list, i.e. the eastern mosquito-fish, gambusia holbrooki, and the african clawed frog, xenopus laevis, whose impact on native biotas is largely known and also verified for sicilian inland waters (lillo et al., 2011; duchi and micieli, 2014). overall, at least nine highly invasive species threatening the native inland water biota are present in sicily. unfortunately, only few studies have been to date addressed to the evaluation of the impact of nis on sicilian native species and ecosystems, and these are mostly dealing with fish (ferrito and tigano, 1996; russo et al., 1999; duchi, 2006a; duchi and micieli, 2014; duchi et fig. 1. histogram of the nis in sicilian inland waters by phylum. among brackets the number of confirmed species in the island. non -co mmerc ial us e o nly 9 f. marrone and l. naselli-flores al., 2014a); however, some information on the potential negative role of the red swamp crayfish (p. clarkii) in sicilian ecosystems as a vector for toxins and heavy metals is available (naselli-flores et al., 2007; bellante et al., 2015), as well as sound evidences on the threats exerted by the african clawed frogs on native amphibians (faraone et al., 2008; lillo et al., 2011) (tab. 4). is sicily a hot-spot for inland water xenodiversity? gherardi et al. (2008) and tricarico et al. (2010), based on a dataset including only those species which are allochthonous at the whole-country-level (i.e., without considering the parautochthonous and the translocated species), pointed out that northern italy is the hot-spot of italian inland water xenodiversity. conversely, boggero et al. (2014), based on a different dataset aimed at exploring the susceptibility to invasions of different habitats and regions, found out that the number of alien species (considering only the allochthonous taxa, according to the definitions used in this paper) is a correlate of temperature, so that sites in warmer areas host in average more alien species than those located in colder ones, which is likely due to a more intense touristic frequentation of the former. the apparent contrast among these results is due to the lacking or inadequacy of sampling surveys and published data for the southern regions of the country: when the mere number of different nis known to occur in different regions is compared, the best-studied areas (i.e., the central and northern italian ones) show the higher number of nis, which is in fact a function of the sampling and publishing efforts rather than a faithful mirror of the actual xenodiversity distribution pattern. conversely, when a balanced subset of soundly comparable study sites is infig. 2. histogram of the biogeographical regions of origin for the nis confirmed in sicilian inland waters. among brackets the number of species originating from any biogeographical region. melanoides tuberculata native range lies in both afrotropical and palaearctic regions, and is here reported under the bar named other distribution patterns. tab. 4. published data on the impact of nis on the sicilian autochthonous inland water biota. taxon recorded impact on the indigenous biota source procambarus clarkii vector of toxins and heavy metals to higher trophic levels naselli-flores et al., 2007; bellante et al., 2015 micropterus salmoides predation on salaria fluviatilis russo et al.. 1999 gambusia holbrooki competition with aphanius fasciatus duchi, 2006a; duchi and micieli, 2014 salmo trutta hybridization with salmo cettii duchi, 2014a xenopus laevis predation on indigenous amphibians lillo et al., 2011 non -co mmerc ial us e o nly 10alien species in sicilian inland water vestigated, the result is exactly the opposite, with the warmer southern italian regions being more prone to be successfully invaded than the central and northern ones. such a perspective makes even more urgent the need of properly investigating southern italian and sicilian inland water biota, possibly an actual but overlooked hot-spot of inland water animal xenodiversity in europe. acknowledgments bruno massa (palermo) is gratefully acknowledged for the comments he provided on the autochthonous status of the mute swan (cygnus olor) specimens wintering in sicily. two anonymous reviewers are acknowledged for their comments, which helped to improve a first draft of the manuscript. references aa.vv, 2008. atlante della biodiversità della sicilia: vertebrati terrestri. collana “studi e ricerche” 6, arpa sicilia, palermo, 536 pp. airoldi l, turon x, perkol-finkel s, rius m, 2015. corridors for aliens but not for natives: effects of marine urban sprawl at a regional scale. diversity distrib. 21:755-768. bellante a, maccarone v, buscaino g, buffa g, filiciotto f, traina a, del core m, mazzola s, sprovieri m, 2015. trace element concentrations in red swamp crayfish (procambarus clarkii) and surface sediments in lake preola and gorghi tondi natural reserve, sw sicily. environ. monit. assess. 187: 404. bianco pg, 2014. an update on the status of native and exotic freshwater fishes of italy. j. appl. ichthyol. 30:62-77. bianco pg, delmastro gb, 2011. recenti novità tassonomiche riguardanti i pesci d’acqua dolce autoctoni in italia e descrizione di una nuova specie di luccio. researches on wildlife conservation 2:(suppl.)1-13. blanchet s, 2012. the use of molecular tools in invasion biology: an emphasis on freshwater ecosystems. fish. manag. ecol. 19:120-132. boggero a, basset a, austoni m, barbone e, bartolozzi l, bertani i, campanaro a, cattaneo a, cianferoni f, corriero g, dŏrr am, elia ac, ficetola gf, kamburska l, la porta g, lauceri s, ludovisi a, gaino e, goretti e, lorenzoni m, manca m, marchetto a, morabito g, nonnis marzano f, oggioni a, pierri c, riccardi n, rossetti g, ungaro n, volta p, zaupa s, fontaneto d, 2014. weak effects of habitat type on susceptibility to invasive freshwater species: an italian case study. aquat. conserv. 24:841-852. calvo s, barone r, naselli-flores l, fradàorestano c, dongarrà g, lugaro a, genchi g, 1993. limnological studies on lakes and reservoirs of sicily. naturalista siciliano 27(suppl.):1-292. carminade c, medlock jm, ducheyne e, mcintyre km, leach s, baylis m, morse ap, 2012. suitability of european climate for the asian tiger mosquito aedes albopictus: recent trends and future scenarios. j. r. soc. interface 9:2708-2717. chandra s, gerhardt a, 2008. invasive species in aquatic ecosystems: issue of global concern. aquat. invasions 3:1-2. chytrý m, jarošík v, pyšek p, hájek o, knollová i, tichý l, danihelka j, 2008. separating habitat invasibility by alien plants from the actual level of invasion. ecology 89:1541-1553. cianfanelli s, lori e, bodon m, 2007. non-indigenous freshwater molluscs and their distribution in italy, p. 103-121. in: f. gherardi (ed.), biological invaders in inland waters: profiles, distribution, and threats. springer, dordrecht. colomba ms, liberto f, reitano a, grasso r, di franco d, sparacio i, 2013. on the presence of dreissena polymorpha pallas, 1771 and sinanodonta woodiana woodiana (lea, 1834) in sicily (bivalvia). biodivers. j. 4:571-580. consoli, n, 1928. gl’interventi di piccola bonifica nella lotta contro la malaria in sicilia. rivista sanitaria siciliana 18, francesco sanzo e c., industria tipografica editrice, palermo: 108 pp. cox jg, lima sl, 2006. naiveté and an aquatic – terrestrial dichotomy in the effects of introduced predators. trends ecol. evol. 21:674-680. d’angelo s, lo valvo m, 2003. on the presence of the red swamp crayfish procambarus clarkii (girard, 1852) (decapoda cambaridae) in sicily (italy). naturalista siciliano 27:325-327. di leo c, faraone fp, lo valvo m, 2014. a new record of the red swamp crayfish, procambarus clarkii (girard, 1852) (crustacea, cambaridae), in sicily, italy. biodivers. j. 5:425-428. duchi a, 2006a. osservazioni sui popolamenti di nono (aphanius fasciatus, valenciennes) e gambusia (gambusia holbrooki, girard) in provincia di ragusa. biologia ambientale 20:73-75. duchi a, 2006b. distribuzione della fauna ittica nelle acque interne dell’areale ibleo: la provincia di ragusa. biologia ambientale 20:291-294. duchi a, 2014a. relazione tra lunghezza e frequenza fenotipica di salmo cettii/salmo trutta ed i loro ibridi in un corso d’acqua siciliano (irminio, ragusa). ital. j. freshwater ichthyol. 1:207-210. duchi a, 2014b. indagini sulla fauna ittica dei corsi d’acqua presenti in alcuni siti di importanza comunitaria della piana di gela (cl, sicilia, italia). ital. j. freshwater ichthyol. 1:211214. duchi a, 2014c. ampliamento dell’areale della rovella (rutilus rubilio, bonaparte, 1837) in sicilia: nuove segnalazioni nell’areale ibleo ed in provincia di trapani. ital. j. freshwater ichthyol. 1:221-224. duchi a, micieli g, 2014. prima segnalazione di gambusia gambusia holbrooki girard, 1859 (cyprinodontiformes poecilidae) nel pantano longarini: un fattore di rischio per il popolamento di nono aphanius fasciatus valenciennes, 1821 (cyprinodontiformes cyprinodontidae). naturalista siciliano 38:115-117. ehrenfeld jg, 2010. ecosystem consequences of biological invasions. annu. rev. ecol. evol. syst. 41:59-80. elton cs, 1958. the ecology of invasions by animals and plants. university of chicago press, chicago and london (ed. june 2000): 196 pp. faranda f, 1977. primo censimento delle aree destinabili ad acquacoltura in sicilia. atti società peloritana scienze fisiche, matematiche e naturali 23(suppl.):1-113 non -co mmerc ial us e o nly 11 f. marrone and l. naselli-flores faraone fp, lillo f, giacalone g, lo valvo m, 2008. the large invasive population of xenopus laevis in sicily (italy). amphibia-reptilia 29:405-412. ferrito v, tigano c, 1995. the distribution of the ichthyofauna in the simeto basin (sicily). cybium 19:187-198. ferrito v, tigano c, 1996. decline of aphanius fasciatus (cyprinodontidae) and salaria fluviatilis (blenniidae) populations in freshwaters of eastern sicily. ichthyol. explor. freshwaters 7:181-184. ficetola f, thuiller w, padoa-schioppa e, 2009. from introduction to the establishment of alien species: bioclimatic differences between presence and reproduction locality in the slider turtle. diversity distrib. 15:108-116. gazzetta ufficiale, 2015. elenco delle specie alloctone escluse dalle previsioni dell’articolo 2, comma 2 -bis , della legge n. 157/1992. decreto 19 gennaio 2015. gazzetta ufficiale della repubblica italiana, serie 31, 07/02/2015, pp 5-6. accessed on: 27 august 2015. available from: http://www.minambiente.it/sites/default/files/archivio/allegati/biodiversita/ dim_07_02_2015_specie_alloctone.pdf gherardi f, 2006.bioinvasions in fresh waters and the nerodilemma. pol. j. ecol. 4:549-561. gherardi f, 2007. biological invaders in inland waters: profiles, distribution, and threats. springer, dordrecht: 733 pp. gherardi f, bertolino s, bodon m, casellato s, cianfanelli s, ferraguti m, lori e, mura g, nocita a, riccardi n, rossetti g, rota e, scalera r, zerunian s, tricarico e, 2008. animal xenodiversity in italian inland waters: distribution, modes of arrival, and pathways. biol. invasions 10:435-454. iucn, 2000. iucn guidelines for the prevention of biodiversity loss caused by alien invasive species. available from: https://portals.iucn.org/library/efiles/documents/rep-2000052.pdf keller rp, geist j, jeschke jm, kühn i, 2011. invasive species in europe: ecology, status, and policy. environ. sci. eur. 23:23. lenk p, fritz u, joger u, wink m, 1999. mitochondrial phylogeography of the european pond turtle, emys orbicularis (linnaeus 1758). mol. ecol. 8:1911-1922. leppäkoski e, gollasch s, olenin s, 2002. alien species in european waters, p. 1-6. in: e. leppäkoski, s. gollasch and s. olenin (eds.), invasive aquatic species of europe: distribution, impact and management. kluwer academic, dordrecht. liberto f, giglio s, reitano a, colomba ms, sparacio i, 2010. molluschi terrestri e dulciacquicoli di sicilia della collezione f. minà palumbo di castelbuono. monografie naturalistiche, 2. edizioni danaus, palermo: 136 pp. lillo f, marrone f, sicilia a, castelli g, zava b, 2005. an invasive population of xenopus laevis (daudin, 1802) in italy. herpetozoa 18:63-64. lillo f, faraone fp, lo valvo m, 2011. can the introduction of xenopus laevis affect native amphibian populations? reduction of reproductive occurrence in presence of the invasive species. biol. invasions 13:1533-1541. lillo f, dufresnes c, faraone fp, lo valvo m, stöck m, 2013. identification and potential origin of invasive clawed frogs xenopus (anura: pipidae) in sicily based on mitochondrial and nuclear dna. ital. j. zool. 80:566-573. lo valvo m, massa b, sarà m, 1993. uccelli e paesaggio in sicilia alle soglie del terzo millennio. naturalista siciliano 17 (suppl.):1-371. lowe s, browne m, boudjelas s, de poorter m, 2000. 100 of the world’s worst invasive alien species. a selection from the global invasive species database. aliens 12:1-12. manganelli g, bodon m, favilli l, giusti f, 1995.gastropoda pulmonata p. 1-60. in: a. minelli, s. ruffo and s. la posta (eds.), checklist delle specie della fauna italiana, 16. edizioni calderini, bologna. marr sm, olden jd, leprieur f, arismendi i, ćaleta m, morgan dl, nocita a, šanda r, tarkan as, garcía-berthou e, 2013. a global assessment of freshwater fish introductions in mediterranean-climate regions. hydrobiologia 719:317-329. marrone f, barone r, naselli-flores l, 2005. cladocera (branchiopoda: anomopoda, ctenopoda, and onychopoda) from sicilian inland waters: an updated review. crustaceana 78:1025-1039. marrone f, lo brutto s, arculeo m, 2011. cryptic invasion of a gastropod mollusc in southern europe: the case of ferrissia fragilis (pulmonata: ancylidae). biologia 66:484-490. mazza g, aquiloni l, inghilesi af, giuliani c, lazzaro l, ferretti g, lastrucci l, foggi b, tricarico e, 2015. aliens just a click away: the online aquarium trade in italy. management of biological invasions 6:253-261. mienis hk, 1991. some remarks concerning asiatic clams invading europe with a note on sample of corbicula fluminea (mueller, 1774) from trapani, sicily. notiziario sim 9:137139. naiman rj, dudgeon d, 2011. global alteration of freshwaters: influences on human and environmental well-being. ecol. res. 26:865-873. naselli-flores l, barone r, 2012. phytoplankton dynamics in permanent and temporary mediterranean waters: is the game hard to play because of hydrological disturbance? hydrobiologia 698:147-159. naselli-flores l, barone r, marrone f, d’angelo s, 2007. 100 milioni di microcystis spp. + 5 procambarus clarkii = 0 emys trinacris, ovvero tossine, invasori ed estinzione nei gorghi tondi, laghi salmastri della sicilia sud-occidentale, p. 76-77. proceedings joined meet. aiol-site, ancona, italy. nocita a, zerunian s, 2007. l’ittiofauna aliena nei fiumi e nei laghi d’italia. biologia ambientale, 21: 93-96. panzeri m, mori e, mazza g, menchetti m, 2014. records of introduced stripe-necked terrapins (mauremys species) in italy. acta herpetologica 9:227-230. pfenninger m, schwenk k, 2007. cryptic animal species are homogeneously distributed among taxa and biogeographical regions. bmc evol. biol. 7:121. pimentel d, zuniga r, morrison d, 2005. update on the environmental and economic costs associated with alien-invasive species in the united states. ecol. econ. 52:273-288. reitano a, liberto f, sparacio i, 2007. nuovi dati su molluschi terrestri e dulciacquicoli di sicilia. 1° contributo (gastropoda prosobranchia neotaenioglossa; gastropoda pulmonata basommatophora, stylommatophora). naturalista siciliano 31:311-330. ruffo s, stoch f, 2006. checklist and distribution of the italian fauna. 10,000 terrestrial and inland waters species. memorie del museo civico di storia naturale di verona, serie 2, sezione scienze della vita 17:1-307. russo g, violani c, zava b, 1997. observations on population dynamics of rutilus rubilio cyprinidae in a man-made hynon -co mmerc ial us e o nly 12alien species in sicilian inland water pertrophic basin (arancio lake, southwest sicily). ital. j. zool. 65(suppl.):549-551. russo g, la rocca s, violani c, zava b, 1999. contributions to the knowledge of sicilian freshwater fishes. ii. notes on some allochthonous species recently introduced. doriana 7:1-7. sarà m, 1998. i mammiferi delle isole del mediterraneo. l’epos società editrice, palermo,166 pp. saltonstall k, 2002. cryptic invasion by a non-native genotype of the common reed, phragmites australis, into north america. p. natl. acad. sci. usa 99:42445-42449. scalera r, 2001. invasioni biologiche. le introduzioni di vertebrati in italia: un problema tra conservazione e globalizzazione. collana verde, 103. corpo forestale dello stato. ministero delle politiche agricole e forestali, roma: 368 pp.. simberloff d, 2003. confronting introduced species: a form of xenophobia? biol. invasions 5:179-192. simberloff d, martin jl, genovesi p, maris v, wardle da, aronson j, courchamp f, galil b, garcía-berthou e, pascal m, pyšek p, sousa r, tabacchi e, vilà m, 2013. impacts of biological invasions: what’s what and the way forward. trends ecol. evol. 28:58-66. sowerby gb, 1873-1874. monograph of the genus physa, pp. 27. in: reeve, lovell, 1843-78, conchologica iconica. vol. 19. reeve, benham and reeve, london. stoch f, valentino f, volpi e, 1996. taxonomic and biogeographic analysis of the proasellus coxalis-group (crustacea, isopoda, asellidae) in sicily, with description of proasellus montalentii n.sp. hydrobiologia 317:247-258. termine r, canale ed, ientile r, cuti n, di grande cs, massa b, 2008. vertebrati della riserva naturale speciale e sito di importanza comunitaria lago di pergusa. naturalista siciliano 32:105-186. tigano c, 1983. dati preliminari sul popolamento ittico del fiume simeto (sicilia). boll. acc. gioenia sci. nat. 16:81-98. tigano c, ferrito v, 1986. sulla presenza di rutilus rubilio (bp. 1837) in sicilia (pisces, cyprinidae). animalia 13:109-124. van bocxlaer b, clewing c, mongindo etimosundja jp, kankonda a, ndeo ow, albrecht c, 2015. recurrent camouflaged invasions and dispersal of an asian freshwater gastropod in tropical africa. bmc evol. biol. 15:33. veronesi r, bellini r, celli g, 1997. ruolo di gambusia holbrooki nel contenimento dei culicidi e suo impatto sulle biocenosi acquatiche. biologia ambientale 3:24-40. vamberger m, stuckas h, sacco f, d’angelo s, arculeo m, cheylan m, corti c, lo valvo m, marrone f, wink m, fritz u, 2015. differences in gene flow in a twofold secondary contact zone of pond turtles in southern italy (testudines: emydidae: emys orbicularis galloitalica, e. o. hellenica, e. trinacris). zool. scripta 44:233-249. weidema ir, 2000. introduced species in the nordic countries. nord 13:1-242. williamson m, 1996. biological invasions. chapman and hall, london: 224 pp. zettler ml, richard d, 2003. kurze bemerkungen über süsswassermollusken siziliens unterbesonderer berücksichtigung von theodoxus meridionalis (philippi, 1836). malak. abh. 21:29.38. non -co mmerc ial us e o nly layout 1 advances in oceanography and limnology, 2015; 6(1/2): 1 editorial doi: 10.4081/aiol.2015.5684 with this first double issue of 2015, advances in oceanography and limnology (aiol journal) is facing an important regime shift. published in house until 2007 by the italian association of oceanography and limnology (aiol, www.aiol.info) as the proceedings of the aiol national congress, it has been transformed starting from 2011 in a regular scientific journal with the aim of offering a new publication outlet for oceanographers and limnologists. after five volumes (ten issues) published under the editorial responsibility of the former aiol president roberto danovaro between 2011 and 2014, the journal, still sponsored by aiol, has now passed to pagepress (www.pagepress.org). in september 2015, the presidency council of the aiol, corroborated by the vote of the aiol members assembly held in verbania (italy), has passed to us the editorial responsibility of the journal. we have enthusiastically accepted this challenge and we would like here to briefly explain how we intend to pave the way for a new deal of the aiol journal. the aiol journal was funded as an interdisciplinary journal, and we want to uphold its wide scope, which embraces both fundamental and applied oceanography and limnology, with focus on both single and multiple disciplines. in the modern scientific vision, the adoption of a multidisciplinary approach is essential for understanding the mechanisms of ecosystem functioning and their alteration caused by natural and anthropogenic influences. such a task requires a diversified editorial board, with associate editors specialized in different aquatic scientific disciplines, and yet strongly motivated to put together the different pieces that represent the core of the interdisciplinary approach. at present, the aiol journal relies on twin editors in chief, while a new, compact and agile group of associate editors will be added in the near future. the correct identification of referees is essential for an accurate evaluation of the submitted contributions. we are strongly aware that the selfless and invaluable scientific work of qualified referees are essential for the final quality and impact of the published papers and for the reputation of the aiol journal. with the 2015 issue, the aiol journal is now published as a new open access, peer-reviewed journal. in the intricate world of publishers, we admit we cannot now compete with highly reputed journal with a longer tradition of publication. we also know that this world is increasingly being populated by a plethora of open access journals from any part of the globe, which increases a lot the competition for attracting esteemed authors as well as receiving high quality papers. so, why the need of another open access journal? the response is astonishingly simple: our aim is to provide a new open-access, free of charge floor for the large community of world oceanographers and freshwater scientists, with an eye on the mediterranean community. this ambitious aim is possible by the free dedication and support of the italian association of oceanography and limnology. wide space is given to regular articles, review, short notes and opinion papers. proceedings that focus on topics that are timely and of interest to a significant number of aquatic scientists will be equally evaluated for their inclusion in specific issues. the publishing house is guaranteeing a fast and high quality editorial processing of the submitted papers. with this last issue, about 4 months were required from the date of submission and the online publication of papers. given its present infancy stage, the aiol journal is not yet fully indexed. the aiol presidency council in charge, of which we are honoured to be part of, fostered the publication of the 2015 issue under pagepress in order to save the publishing effort paid during the first four years of the journal’s life and ensure indexing agencies to follow up the journal. this will give advances in oceanography and limnology an opportunity to be monitored and, in a hopefully near future, to be ultimately ranked. we are conscious that making the aiol journal attractive for highly reputed authors will be the major part of the challenge. we will put a special effort to select high quality papers through a rigorous peer reviewing process, also profiting of the future board of international associate editors. we will also put a special effort for mining thematic reviews from esteemed oceanographers and limnologists all over the world, providing a comprehensive state of the art overview and, at the same time, indicating future directions and perspectives in a given field. the ultimate undisguised ambition is thus to give the aiol journal an international position in the wide panorama of the already available scientific literature with “water-oriented” aims and scope. antonio pusceddu nico salmaso editors, advances in oceanography and limnology a new deal for advances in oceanography and limnology (aiol journal) antonio pusceddu,1 nico salmaso2 1dipartimento di scienze della vita e dell’ambiente, università degli studi di cagliari, 09126 cagliari, italy; 2dipartimento agroecosistemi sostenibili e biorisorse, fondazione e. mach, san michele all’adige, trento, italy corresponding author: apusceddu@unica.it ; nico.salmaso@fmach.it layout 1 introduction subfossil cladocera (crustacea, branchiopoda) represent one of the most valuable biological proxies preserved in lake sediments that can be studied for reconstruction purposes (kohrola and rautio, 2011). they are widespread in both the pelagic and littoral zones of lakes of different geographical distribution, altitude and typology, where they often represent the dominant component of zooplankton in terms of biomass. the chitinous parts of their body are well preserved in lake sediments, and the taphonomic taxonomy is well established, thanks to the numerous studies that followed the first pioneer works by frey (1960). cladocera play a key ecological role in freshwater ecosystems, as they occupy an intermediate position in the food web between primary producers (phytoplankton) and primary consumers (invertebrates and fish). as a consequence, subfossil cladocera remains have the capability to track long term changes in both bottom-up drivers (such as nutrients, physical and chemical stressors) and top down regulators, such as invertebrate and fish predation (e.g., jeppesen et al., 2001; szeroczyńska, 2006; perga et al., 2015). the changes in taxonomical composition of subfossil cladocera, which mainly includes bosminidae and chydoridae, and secondly daphniidae, have been increasingly investigated during the last decades and successfully used to track past environmental changes related to nutrient enrichment (lotter et al., 1998; bigler et al. 2007; manca et al., 2007; nevalainen and luoto, in press), acidification and calcium decline (krause and dellin, 1986; paterson, 1994; jeziorski et al., 2008), chemical contamination (korosi and smol, 2012a; labaj et al., 2016), hydrological changes (korhola et al., 2005; nevalainen et al., 2011), submerged macrophytes (davidson et al., 2011a), and climate change (lotter et al., 1997; kamenik et al., 2007; korponai et al., 2011; nevalainen et al., 2013; zawiska et al., 2015). the strong response of cladocera remains to environmental variability led to inference methods for quantitative reconstruction of past lake water variables, especially phosphorus (brodersen et al., 1998), lake depth (davidson et al., 2011b; nevalainen et al., 2011), and water temperature (duigan and birks 2000; lotter et al., 2000). in addition, subfossil cladoceran remains preserved in lakes sediments have the very valuable capability to allow reconstructing past changes in the lake food-web induced by the predation pressure by planktivorous fish (e.g., korosi et al., 2013). information on past fish populations and predation pressure on lacustrine zooplankton is in many case scattered, partial, or controversial, as it often relies on imprecise historical data, or on catch records from sport or commercial fisheries, the latter being biased by temporal changes in the catches of certain species due to their fluctuating commercial value. within this context, changes in species composition and abundances of cladocera remains can support the indirect reconstruction of food web changes in both temperate and high altitude/high latitude lakes (which are mainly naturally fishless, but experienced historical legal or illegal fish introductions), thus fostering conservation and restoration actions (e.g., tiberti et al., 2014). recent investigations revealed that not only species composition and abundance, but also morphology of cladoceran remains can be used for ecological reconstructions. it is well established that invertebrate and fish predation can affect body size, morphology and pigmentation of cladocera (jeppesen et al., 2002; hansson, 2004; guilizzoni et al., 2006;). however, pigmentation has been recently used also to track changes in underwater uv radiation in relation to solar activity (nevalainen and rautio, 2014) and changes in water doc concentrations, the latter in relation to lake productivity (nevalainen et al, 2016) or changing land use within the lake catchment (e.g., advances in oceanography and limnology, 2016; 7(2): 125-130 doi: 10.4081/aiol.2016.6467 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). subfossil cladocera as a powerful tool for paleoecological reconstruction monica tolotti,1* manuela milan,2 krystyna szeroczyńska3 1sustainable agro-ecosystems and bioresources, research and innovation centre (cri), fondazione e. mach, via e. mach 1, 38010 san michele all'adige, tn, italy 2department of ecology and environmental sciences (emg), umeå university, linnaeus väg 6, 90187 umeå, sweden 3institute of geological sciences, polish academy of sciences, research centre warsaw, twarda 51/55, pl 00818 warsaw, poland *corresponding author: monica.tolotti@fmach.it key words: cladocera, paleoecology, lakes, sediments, human impact, climate change. received: december 2016. accepted: december 2016. non co mmerc ial us e o nly 126 m. tolotti, m. milan, and k. szeroczyńska a-forestation, water regulation). isotopic composition of cladoceran remains also revealed to be a very time-effective and promising tool for interpreting changes in lake food web and functionality (perga et al., 2010; perga, 2011). nevertheless, a set of factors still hamper the interpretation of sedimentary cladocera results, and, in turn, the exploitation of the great potential of this biological proxy for the reconstruction of past lake evolution. firstly, taxonomy of subfossil cladocera is well established for temperate and boreal regions of europe and north america (szeroczyńska and sarmaja-korionen, 2007; korosi and smol, 2012b), whereas only a few works has been published for tropical regions (cuna et al., 2014; sinev and zawisza, 2013; szeroczyńska et al., 2015). much work remains to be done also to evaluate how well taphonomic cladocera represent the living communities (kattel et al., 2007; alric and perga, 2011; kirillova et al., 2016), and how preservation of remain type and species in the sediment can be affected by water characteristics, such as oxygenation, ph and chemical composition. sedimentation dynamics can also affect spatial distribution of remains in the lake sediments (alric and perga, 2011). finally, the interpretation of sediment records is complicated by the reciprocal interactions between multiple drivers, such as climate and nutrients, which can produce additive, competitive or synergic effects (battarbee et al., 2012). although the multi-proxy paleoecological approach and the comparison of sediment records with limnological data (e.g. manca et al., 2007; bennion et al., 2015) can help disentangling the effects of multiple drivers, more studies are still necessary to make the interpretation of the cladocera sediment records more straightforward. the first subfossil cladocera workshop was initiated by prof. atte korhola in 1999 (helsinki) with the aim of getting together specialists, young researchers and students working on various aspects of cladocera remains in lake sediments in order to share knowledge, to foster discussion on new ecological findings and ideas, and to practice species identification at the microscope under the guidance of expert taxonomists. the xiv subfossil cladocera workshop was organized within this same spirit and held at levico terme (italy) from 5th to 8th april 2016. the 30 participants (fig. 1) from 9 countries (czech republic, finland, france, germany, hungary, italy, poland, russia, uk) were almost equally distributed between senior, young scientists and students, what promoted the transfer of knowledge and experience among generations. one special objective of this workshop was to stimulate the discussion on possible future developments of cladocera-based paleoecological reconstructions based on relatively new approaches, such as the “resurrection ecology” techniques, the study of isotopic signatures in body and ephippia remains, and the statistical treatment of multiproxy sediment data. thematic papers the thematic papers grouped in this volume represent the outcome of presentations and discussions held at the xiv subfossil cladocera workshop. the contributions focus on taxonomy, diversity, distribution of cladocera remains in lake sediments in europe and america, as well as on the subfossil cladocera capability to track past changes in both bottom-up and top-down drivers of lake ecological dynamics. several papers aimed at reconstructing the environmental evolution of temperate european lakes at secular (milan et al., 2016) or millennial (niska, 2016; szeroczyńska, 2016; zawisza et al., 2016) scales. the contribution by milan et al., (2016) showed how the multiproxy approach, and in particular the combination of biological proxies and geochemical analyses, could improve the understanding of the relation between cladoceran communities and hydrological variability. the paleolimnological studies at millennial scale investigated the relations between cladocera and environmental drivers in stages where human impact was still absent or negligible, thus allowing the discrimination of climate related effects. korponai et al. (2016) used subfossil cladocera to distinguish lentic and lotic stages in oxbow lakes along the river tisza (hungary), thus demonstrating the potential of cladoceran remains to reconstruct changes in the hydrological regimen of transitional water ecosystems. the thematic section of this volume tackled also the taxonomic issue. wojewódka et al. (2016) presented a first description of cladocera diversity in superficial sediments of 29 lakes of different altitude and size in central america, thus contributing to the improvement of the cladoceran taxonomy within this still scarcely investigated region. on the other side, zawiska et al. (2016) described a time and cost effective method to prepare subfossil cladocera for sem analysis, which allows the observation of taxonomically important details of the structure and ornamentation of carapace and spines. finally, several contributions studied the importance of morphological variability of cladocera remains in tracking long term environmental and ecological changes. leppänen and weckström (2016) explored the potential use of changes in size and preservation level of daphnia caudal spines to track fishing and forestry activities, as well as changes in water ph. milan et al. (2016) analyzed changes in bosminidae and daphniidae body size and appendages length to reconstruct major changes in the lake food-web, outlining nutrient enrichment and appearance of predator cladocera species as the major drivers of size changes. szeroczyńska (2016) related the presence of extreme eubosmina morphs, observed in a german lake, to stages of particularly pronounced water turbulence and turbidity. finally, bérubé tellier et al. (2016) demonstrated as varianon co mmerc ial us e o nly subfossil cladocera for paleoecology 127 tions in resting eggs (ephippia) pigmentation can be used to track changes in predation pressure by fish and changes in water doc concentration in relation to catchment land use. in conclusion, the thematic papers included in this volume consolidate the indicator value of subfossil cladocera in both classical and more novel paleolimnological approaches, outlining at the same time several research topics, which need to be further developed in the near future. fig. 1. the participants of the xiv subfossil cladocera workshop during the excursion at lake garda. non co mmerc ial us e o nly 128 m. tolotti, m. milan, and k. szeroczyńska references alric b, perga me, 2011. effects of production, sedimentation and taphonomic processes on the composition and size structure of sedimenting cladoceran remains in a large deep subalpine lake: paleo-ecological implications. hydrobiologia 676:101-116. battarbee rw, anderson nj, bennion h, simpson gl, 2012. combining limnological and palaeolimnological data to disentangle the effects of nutrient pollution and climate change on lake ecosystems: problems and potential. freshwater biol. 57:2091-2106. bennion h, davidson ta, sayer cd, simpson g, rose nl, sadler j, 2015. harnessing the potential of the multi-indicator palaeolimnological approach: an assessment of the nature and causes of ecological changes in a eutrophic shallow lake. freshwater biol. 60:1423-1442. bérubé tellier a, drevnick pe, bertolo a, 2016. brook trout (salvelinus fontinalis) extinction in small boreal lakes revealed by ephippia pigmentation: a preliminary analysis. adv. oceanol. limnol. 7:6215. bigler c, von gunten l, lotter af, hausmann s, blass a, ohlendorf c, sturm m, 2007. quantifying human-induced eutrophication in swiss mountain lakes since ad 1800 using diatoms. holocene 17:1141-1154. brodersen kp, whiteside mc, lindegaard c, 1998. reconstruction of trophic state in danish lakes using subfossil chydorid (cladocera) assemblages. can. j. fish. aquat. sci. 55:10931103. cuna e, zawisza e, caballero m, ruiz-fernández ac, lozanogarcía s, alcocer j, 2014. environmental impacts of little ice age cooling in central mexico recorded in the sediments of a tropical alpine lake. j. paleolimnol. 51:1-14. davidson ta, sayer c, perrow m, bramm m, jeppesen e, 2007. are the controls of species composition similar for contemporary and sub-fossil cladoceran assemblages? a study of 39 shallow lakes of contrasting trophic status. j. paleolimnol. 38:117-134. davidson ta, bennion h, jeppesen e, clarke gh, sayer cd, morley d, odgaard bv, rasmussen p, rawcliffe r, salgado j, simpson gl, amsinck sl, 2011a. the role of cladocerans in tracking long-term change in shallow lake trophic status. hydrobiologia 676:299-315. davidson t a, amsinck sl, bennike o, christoffersen k, landkildehus f, lauridsen tl, jeppesen e, 2011b. inferring a single variable from assemblages with multiple controls: getting into deep water with cladoceran lake depth transfer functions. hydrobiologia 676:299-315. duigan ca, birks hh, 2000. the late-glacial and earlyholocene palaeoecology of cladoceran microfossil assemblages at kråkenes, western norway, with a quantita tive reconstruction of temperature changes. j. paleolimnol. 23:67-76. frey d g, 1960. the ecological significance of cladoceran remains in lake sediments. ecology 41:684-699. frossard v, verneaux v, milelt l, jenny jp, arnaud f, magny m, perga me, 2014. reconstructing long-term changes (150 years) in the carbon cycle of a clear-water lake based on the stable carbon isotope composition (d13c) of chironomid and cladoceran subfossil remains. freshwater biol. 59:789-802. guilizzoni p, lami a, manca m, musazzi s, marchetto a, 2006. palaeoenvironmental changes inferred from biological remains in short lake sediment cores from the central alps and dolomites. in: a. lami and a. boggero (eds.), ecology of high altitude aquatic systems in the alps. hydrobiologia 562:167-191. hansson la, 2004. plasticity in pigmentation induced by conflicting threats from predation and uv radiation. ecology 85:1005-1016. jeppesen e, leavitt p, de meester l, jensen jp, 2001. functional ecology and palaeolimnology: using cladoceran remains to reconstruct anthropogenic impact. trends ecol. evol. 16:191-198. jeppesen e, jensen jp, amsinck s, landkildehus f, lauridsen t, mitchell sf, 2002. reconstructing the historical changes in daphnia mean size and planktivorous fish abundance in lakes from the size of daphnia ephippia in the sediment. j. paleolimnol. 27:133-143. jeppesen e, nõges p, davidson ta, haberman j, nõges t, blank k, lauridsen tl, søndergaard m, sayer c, laugaste r, johansson ls, bjerring r, amsinck sl, 2011. zooplankton as indicators in lakes: a scientific-based plea for including zooplankton in the ecological quality assessment of lakes according to the european water framework directive (wfd). hydrobiologia 676:279-297. jeziorski a, yan nd, paterson am, desellas am, turner ma, jeffries ds, keller b, weeber rc, mcnicol dk, palmer me, 2008. the widespread threat of calcium decline in fresh waters. science 322:1374-1377. kamenik c, szeroczyńska k, schmidt r, 2007. relationships among recent alpine cladocera remains and their environment: implications for climate-change studies. hydrobiologia 594:33-46. kattel gr, battarbee rw, mackay a, birks hb, 2007. are cladoceran fossils in lake sediment samples a biased reflection of the communities from which they are derived? j. paleolimnol. 38:157-181. kattel gr, battarbee rw, mackay a, birks hjb, 2008. recent ecological change in a remote scottish mountain loch: an evaluation of a cladocera-based temperature transfer-function. palaeogeogr. palaeoclim. palaeoecol. 259:51-76. kirillova iv, van der plicht j, gubin sv, zanina og, chernova of, lapteva eg, trofimova ss, zinovyev ev, zharov aa, fadeeva eo, van kolfschoten t, shidlovskiy fk, kotov aa, 2016. taphonomic phenomenon of ancient hair from glacial beringia: perspectives for palaeoecological reconstructions. boreas 45:455-469. korhola a, rautio m, 2001. cladocera and other branchiopod crustaceans, p. 5-41. in: j.p. smol, h.j.b. birks and w.m. last (eds.), tracking environmental change using lake sediments, zoological indicators. 4. kluwer, dordrecht. korhola a, tikkanen m, weckström j, 2005. quantification of holocene lake-level changes in finnish lapland using a cladocera–lake depth transfer model. j. paleolimnol. 34:175-190. korosi jb, smol jp, 2012a. examining the effects of climate change, acidic deposition, and copper sulphate poisoning on long-term changes in cladoceran assemblages. aquat. sci. 74:781-792. korosi jb, smol jp, 2012b. an illustrated guide to the identifinon co mmerc ial us e o nly subfossil cladocera for paleoecology 129 cation of cladoceran subfossils from lake sediments in northeastern north america: part 1 the daphniidae, leptodoridae, bosminidae, polyphemidae, holopedidae, sididae, and macrothricidae. j. paleolimnol. 48:571-586. korosi jb, kurek j, smol, jp, 2013. a review on utilizing bosmina size structure archived in lake sediments to infer historic shifts in predation regimes. j. plankton res. 35:444460. korponai j, magyari em, buczkó k, iepure s, namiotko t, czakó d, kövér c, braun m, 2011. cladocera response to late glacial to early holocene climate change in a south carpathian mountain lake. hydrobiologia 676:223-235. korponai j, gyulai i, braun m, kover c. papp i, forro l, 2016. reconstruction of flood events in an oxbow lake (marótzugi-holt-tisza, ne ungary) by using subfossil cladoceran remains and sediments. adv. oceanol. limnol. 7:6168. krause-dellin d, steinberg c, 1986. cladoceran remains as indicators of lake acidification. hydrobiologia 143:129-134. labaj al, korosi jb, kurek j, jeziorski a, keler wb, smol jp, 2016. response of bosmina size structure to the acidification and recovery of lakes near sudbury, canada. j. limnol. 75:22-29. leppänen jj, weckström, j, 2016. varying degradation of subfossil daphnia longispina during the past 250 years and the discovery of fossil helmet-type head shields: preliminary results. adv. oceanol. limnol. 7:6293. lotter af, birks hjb, hofmann w, marchetto a, 1997. modern diatom, cladocera, chironomid, and chrysophyte cyst assemblages as quantitative indicators for the reconstruction of past environmental conditions in the alps. i. climate. j. paleolimnol. 18:395-420. lotter af, birks hjb, hofmann w, marchetto a, 1998. modern diatom, cladocera, chironomid, and chrysophyte cyst assemblages as quantitative indicators for the reconstruction of past environmental conditions in the alps. ii. nutrients. j. paleolimnol. 19:443-463. lotter a, birks h, eicher u, hofmann w, schwander j, wick l, 2000. younger dryas and allerød summer temperatures at gerzensee (switzerland) inferred from fossil pollen and cladoceran assemblages. palaeogeogr. palaeoclim. palaeoecol. 159:349-361. lynn dv, hann bj, paterson m, 2015. littoral cladoceran community reassembly following the cessation of disturbance. j. paleolimnol. 54:121-135. manca m, torretta b, comoli p, amsinck sl, jeppesen e, 2007. major changes in trophic dynamics in large, deep sub-alpine lake maggiore from 1940s to 2002: a high resolution comparative palaeo-neolimnological study. freshwater biol. 52:2256-2269. milan m, bindler r, tolotti m, 2016. combining sediment cladocera remains and geochemistry to reveal the role of a large catchment in driving changes in a small subalpine lake (lake ledro, n-italy). adv. oceanol. limnol. 7:6399. nevalainen l, sarmaja-korjonen k, luoto tp, 2011. sedimentary cladocera as indicators of past water-level changes in shallow northern lakes. quaternary res. 75:430-437. nevalainen l, luoto tp, kultti s, sarmaja-korjonen k, 2013. spatio-temporal distribution of sedimentary cladocera (crustacea: branchiopoda) in relation to climate. j. biogeogr. 40:1548-1559. nevalainen l, rautio m, 2014. spectral absorbance of benthic cladoceran carapaces as a new method for inferring past uv exposure of aquatic biota. quaternary sci. rev. 84:109-115. nevalainen l, luoto tp (2016). relationship between cladoceran (crustacea) functional diversity and lake trophic gradients. funct. ecol. doi:10.1111/1365-2435.12737 (in press). nevalainen l, rantala mv, luoto tp, ojala ae, rautio m, 2016. long-term changes in pigmentation of arctic daphnia provide potential for reconstructing aquatic uv exposure. quaternary sc. rev. 144:44-50. niska m, 2016. the eemian/early vistulian development of the solniki paleolake (north-eastern poland) as shown by subfossil cladocera. adv. oceanol. limnol. 7:6217. paterson mj, 1994. paleolimnological reconstruction of recent changes in assemblages of cladocera from acidified lakes in the adirondack mountains (new york). j. paleolimnol. 11:189-200. perga me, 2011. taphonomic and early diagenetic effects on the c and n stable isotope composition of cladoceran remains: implications for paleoecological studies. j. paleolimnol. 46:203-213. perga me, desmet m, enters d, reyss jl, 2010. a century of bottom-upand top-down-driven changes on a lake planktonic food web: a paleoecological and paleoisotopic study of lake annecy, france. limnol. oceanogr. 55:803-816. perga me, frossard v, jenny jp, alric b, arnaud f, berthon v, black jl, domaizon i, giguet-covex c, kirkham a, magny m, manca m, marchetto a, millet l, paillès c pignol c, poulenard j, reyss jl, rimet f, sabatim p, 2015. high-resolution paleolimnology opens new management perspectives for lakes adaptation to climate warming. front. ecol. evol. 3:1-17. sinev a, zawisza e, 2013. comments on cladocerans of crater lakes of the nevado de toluca volcano (central mexico), with the description of a new species, alona manueli sp. nov. zootaxa 3647:390-400. szeroczyńska k, 2006. the significance of subfossil cladocera in stratigraphy of late glacial and holocene. studia quaternaria 23:37-45. szeroczyńska k, sarmaja-korjonen k, 2007. atlas of subfossil cladocera from central and northern europe. friends of the lower vistula society, świecie: 84 pp. szeroczyńska k, zawisza e, wojewódka m, 2015. initial time of two high altitude crater lakes (nevado de toluca, central mexico) recorded in subfossil cladocera. studia quaternaria 32:109-116. szeroczyńska k, 2016. long term subfossil cladocera record from the partly varved sediment of lake tiefer (ne germany). adv. oceanol. limnol. 7:6297. tiberti r, von hardenberg a, bogliani g, 2014. ecological impact of introduced fish in high altitude lakes: a case of study from the european alps. hydrobiologia 724:1-19. wojewódka m, zawisza e, cohuo s, macario-gonzález l, schwalb a, zawiska i, perez l, 2016. ecology of cladocera species from central america based on subfossil assemblages. adv. oceanol. limnol. 7:6266. zawiska i, słowiński m, correa-metrio a, obremska m, luoto tp, nevalainen l, woszczyk m, milecka k, 2015. the renon co mmerc ial us e o nly 130 m. tolotti, m. milan, and k. szeroczyńska sponse of a shallow lake and its catchment to late glacial climate changes a case study from eastern poland. catena 126:1-10. zawiska i, zawisza e, wojewódka m, sinev ay, 2016. exploring the world of micro sculptures subfossil cladocera remains under the sem. adv. oceanol. limnol. 7:6218. zawisza e, filbrandt-czaja a, correa-metrio a, 2016. subfossil cladocera and pollen as indicators of natural and anthropogenic trophic changes of lake jelonek (tuchola forest, n poland) during the holocene. adv. oceanol. limnol. 7:157-170. non co mmerc ial us e o nly layout 1 introduction cyanobacteria are a common and naturally occurring component of freshwater environments, although they can be found in all terrestrial and aquatic ecosystems (whitton, 2012). they are important primary producers and play a key role in ecosystem functioning and biodiversity. however, they can pose risks to environment and aquatic consumers through the production of cyanotoxins (ctx), a large group of toxins that comprise microcystins (mcs), which are the most numerous and studied chemical variants (buratti et al., 2017). during dense blooms, which are increasingly occurring due to eutrophication and climate changes (paerl and paul, 2012; planas and paquet, 2016), ctx can reach very high concentrations, affecting both humans and aquatic animals, as well as wild and livestock animals (funari and testai, 2008; moreira et al., 2013; hilborn and beasley, 2015; testai et al., 2016b; wood, 2016; buratti et al., 2017). reports of animal poisonings attributable to ctx have been documented worldwide for more than a century. a diverse range of animals has been affected from dogs, cattle and fish, to flamingos, bats and bees (carbis et al., 1995; frazier et al., 1998; briand et al., 2003; stewart et al., 2008). some animals appear to be attracted by cyanobacteria in water and dried crusts on top of the water, even when clean water was plainly accessible (codd et al., 1992; lopez rodas and costas, 1999). oral human exposure to ctx can occur through the ingestion of drinking water from a contaminated source or through the ingestion of inadveradvances in oceanography and limnology, 2017; 8(1): 71-86 article doi: 10.4081/aiol.2017.6352 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). cyanobacterial dynamics and toxins concentrations in lake alto flumendosa, sardinia, italy mara stefanelli,1,2 simona scardala,2 piera angela cabras,3 andrea orrù,3 susanna vichi,2 emanuela testai,2 enzo funari,2 maura manganelli2* 1inail (national institute for insurance against accidents at work), via roberto ferruzzi 38/40, 00143 rome; 2istituto superiore di sanità (national health institute), department of environment and health, viale regina elena 299, 00161 rome; 3istituto zooprofilattico sperimentale della sardegna (experimental zootechnic institute of sardinia), via fratelli kennedy 2, 08100 nuoro, italy *corresponding author: maura.manganelli@iss.it abstract seasonal blooms of cyanobacteria (cb) are a typical feature of lake alto flumendosa (sardinia, italy). the waters of this lake are used for drinking water supply, for agricultural and industrial uses, and fish farming activities. since cyanotoxins are not monitored in edible organisms, diet could be a relevant route of human exposure. cb also represent a threat for the health of wild and domestic animals that use lake water for beverage. therefore, to characterize the cb community and assess the risk for human and animal population, cb dynamic, mcyb+ fraction, and microcystins (mcs) concentration have been followed monthly for 18 months, in three stations. results confirmed the presence of several toxigenic species. planktothrix rubescens dominated between august 2011 and april 2012 (3.5×106 cells l–1), alternating with woronichinia naegeliana (8×106 cells l–1) and microcystis botrys (9×105 cells l–1). dolichospermum planctonicum was always present at low densities (104 cells l–1). mcs were detected, at values well below the 1 µg l–1 threshold of who for drinking water. the molecular analysis of mcyb gene for p. rubescens indicated the presence of a persistent toxic population (average 0.45 mcyb/16s rdna). highly significant linear regressions were found between p. rubescens and the sum of the demethylated mc variants, and between m. botrys and the sum of mc-lr and mc-la, also when co-occurring, suggesting that these two species were responsible for different mc patterns production. the regression lines indicated a quite stable mc cell quota. however, in some spotted samples very different values were obtained for both mc concentrations and cell quota (from 10-fold lower to 30-40-fold higher than the ‘average’) showing an unexpected significant variability in the rate of toxin production. the relatively low cell densities during the monitoring period is consistent with the low-to absent mc contamination level found in trout muscle; however, the analytical method was affected by low recovery, probably due to mc-protein binding. our results show that, during the study period, no risk of exposure for the human and animal population occurred. however, the persistence of a complex cb community characterised by a significant toxic fraction suggests the need for periodic monitoring activity. particularly, the hidden deep summer p. rubescens blooms, located where water is taken for drinking water supply, and m. botrys, able to produce the most toxic mc variants with high cell quota, should be kept under control. the documentation and interpretation of sudden changes in toxins concentrations deserve special attention. this is particularly relevant in proximity of fish farming plants and water catchment sites. key words: toxic cyanobacteria; cyanotoxins; microcystins; human and animal exposure; health risk. received: 19 october 2016. accepted: 3 march 2017.non -co mmerc ial us e o nly m. stefanelli et al.72 tently swallowed contaminated water during recreational activities (funari and testai, 2008; testai et al., 2016a). furthermore, humans can be orally exposed through the ingestion of cyanobacteria-based food supplements (saker et al., 2005; vichi et al., 2012) or food items such as fish and shellfish with bioaccumulated toxins (e.g., through filtration of contaminated water) (ibelings and chorus, 2007; berry, 2013). additional routes of exposure are dermal contact and accidental inhalation during recreational activities in waters subjected to a toxic bloom. in sardinia, more than 90% of the drinking water originates from artificial lakes which are generally eutrophic (lugliè et al., 2013), the ideal environment for cyanobacterial blooms. indeed, cyanobacteria have become dominant in many reservoirs over time (sechi and lugliè, 1992, 1996; aktan et al., 2009; pulina et al., 2011). however, only a few studies have assessed the presence of ctx, namely mcs (messineo et al., 2009; sulis et al., 2014; mariani et al., 2015). furthermore, a toxic strain of microcystis aeruginosa (kützing) kützing, associated with a fish kill event, was isolated in lake liscia (pellegrini et al., 1995), and a toxic bloom of planktothrix rubescens (formerly oscillatoria rubescens) (de candolle ex gomont) anagnostidis and komárek was documented in 1986 in the flumendosa reservoir (loizzo et al., 1988). in the last 30 years, the flumendosa reservoir has been used as the main water supply for civilian, agricultural and industrial uses in southern sardinia (botti et al., 2001). in addition, a trout farming plant is located nearby, whereas water is utilised also by wild animal and livestock for beverage. in the 1990s, cyanophyceae, together with bacillariophyceae and chlorophyceae, were the dominant classes in the flumendosa reservoir system (lugliè et al., 1997), with cb representing 90-100% of phytoplankton since 2002 (sulis et al., 2014). the cb with the highest density described so far are the planktothrix and microcystis genera, which have been responsible for the most frequent onset of blooms, while the dolichospermum genus, except for a bloom in 2003, appeared sporadically (sulis et al., 2014). to our knowledge, data on mcs in this lake have been assessed only in two occasions and were associated with the presence of p. rubescens (messineo et al., 2009; sulis et al., 2014). a recent 18-month study on four reservoirs in northern sardinia showed significantly different seasonal variations in cb community composition, with several toxigenic species, and large variability in mcs concentrations (mariani et al., 2015). the results highlighted the need to increase the knowledge of these aspects in each reservoir, whose use could affect human and animal health. in june 2010, a mass mortality of fish occurred in the flumendosa reservoir, concurrently with an extensive surface bloom of p. rubescens. the cause for fish mortality was potentially attributed to a combination of oxygen deficiency and cb toxins. following this event, our study was aimed: i) to characterize the cb community of the reservoir; ii) to verify the applicability of a linear model used in single species blooms to predict their toxicity (salmaso et al., 2014); and iii) to assess the potential risk for humans and animals. we followed the dynamics of cyanobacteria for 18 months and determined mcs concentrations, toxicity profile (mc variants concentration), frequency of toxic genotype and accumulation of mcs in farmed trout. methods description of the site and sampling strategy the reservoir of the alto flumendosa, located in centre-eastern sardinia (italy) (latitude: 39°42’38’’ n; longitude: 9°17’25’’ e) (fig. 1), is an artificial lake (volume 64×106 m3) with a surface area of 9 km2 (begliutti et al., 2007) and a maximal depth of around 50 m. it is a complex and multiuse water system, which interconnects with other reservoirs (flumendosa-campidano). the reservoirs are linked in a cascading sequence and from each one pressure pipelines and open channels guarantee water for residential use and irrigation of the campidano plain (sechi and sulis, 2009). once used for the production of electrical energy in three underground stations, the water is conveyed through a system of tunnels in the lake teaula, about 286 m asl, east of villagrande. at this point, waters are directed through the tortolì flat for irrigation and for civilian uses (e.g., drinking water) (cabras et al., 2013). water samples were collected in three sites: (1) zattere (maximum depth 50 m) at about 10 m from a trout’s floating cages farming plant; (2) middle site in the centre of the lake (maximum depth 25 m), in front of the water offtake site (collecting water also for drinking purposes); and (3) rio osiana (maximum depth 7 m) close to the inflow of a small temporary tributary stream (fig. 1). during our sampling period (october 2011 may 2013), the stream periodically underwent dry phases. after oct 2012, the site 3 was no longer sampled, since the values of the studied parameters were not different from the other sites. since in some periods some cb species density was very low, two different strategies of sampling were used to monitor their temporal dynamics: i) discrete samples were collected monthly in the whole sampling period (18 months) in the three stations at the surface (s1, s2, s3) and in the stations 1 and 2 at 20 m depths (p1, p2; depth of the water offtake site, which is important to check when p. rubescens occurs) (manganelli et al., 2016) using a van dorn bottle; ii) periodically, integrated samples were collected with a 20 µm phytoplankton net on a water column of 30 m (r1), 25 m (r2) and 7 m (r3). samples were collected and stored in acid clean polycarbonate bottles, in cold and dark conditions until the arrival in the laboratory where they were aliquoted for the different analysis. non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 73 five fish samples were collected from november 2011 to september 2012, every two-three months, from the trout farming plant (2-3 animals for sampling). physical measurements and chlorophyll-a analysis chlorophyll-a (chl-a) was extracted according to jespersen and christoffersen (1987). samples were filtered onto gf/f filters (whatman) and stored in 96% ethanol in the dark at room temperature over-night. the fluorescence of the extract was measured with a turner 10au-005 fluorimeter (holm-hansen et al., 1965). temperature was read from a thermometer inside the sampling bottle, as soon as the sample arrived at the surface, and ph was measured in the field with a ph meter probe. cyanobacteria abundance and isolation cyanobacteria taxonomic determination was carried out according to komárek and anagnostidis (1999, 2005) and komárek and zapomělová (2007). cyanobacteria abundance was determined by epifluorescence microscopy, since phycoerythrin and phycocyanin contained in cb, when examined under blue light excitation, fluoresce orange and red, respectively (walsby and avery, 1996; ernst et al., 2006). this technique, based on sample concentration on filters, allows the concentration of large volumes in few minutes and the counts of species present within a large range of densities (hallegraeff et al., 2004). fifty ml of formaldehyde-fixed samples (final concentration 4%) were filtered onto 5 µm black membrane filters (25 mm diameter) (whatman). the number of filaments and colonies was counted by autofluorescence under blue light with an upright microscope (olympus bx51) at 100x. two replicate filters per sample were counted, with a variation between filters generally well within 20%. the number of cells per filament/colony was determined by average on 50 filaments/colony on both filters, using an image analysis software (imagej, http://rsbweb.nih.gov/ij/). monoclonal strains of p. rubescens were isolated as follows. the filaments were plated on bg-11 medium 1% agar (difco) plates. the plates were then incubated at 14°c, at a photosynthetic photon flux density of 10 µmol m–2 s–1 in a light:dark cycle (16:8h). filaments were isolated by micromanipulation according to rippka (1988) fig. 1. the flumendosa reservoir and sampling sites. non -co mmerc ial us e o nly m. stefanelli et al.74 and incubated at the same conditions described above, in liquid bg-11 medium. we also tried to isolate colonial cyanobacteria, like woronichinia naegeliana (unger) elenkin, as described by sedmak et al. (2008). the samples were concentrated in test tubes under natural light. colonies floated towards the surface due to their buoyancy mechanism. the remaining phytoplankton together with zooplankton sank to the bottom. the surface layer with cyanobacterial material was collected and re-examined by microscopy resulting monospecific (over 99%). the colonies were then incubated in liquid bg-11 at the same conditions as above. however, all isolation attempts failed. w. naegeliana did not persist in culture more than one month and no further analysis was carried out. phytoplankton abundance samples for the identification and counting of phytoplankton other than cyanobacteria were fixed with formaldehyde (final concentration 4%) and/or lugol’s solution (final concentration 1%). ten ml samples were sedimented according to the utermhöl method (1958) and counted under an inverted microscope (olympus ix50) at 40x and 400x magnification, in bright-dark field. detection of microcystins elisa total (intraand extra-cellular content) mcs were analysed in untreated water samples by an enzyme-linked immunosorbent assay (elisa). after three freeze/thaw cycles, the samples were analysed using an elisa kit (microcystins adda-elisa microtiter plate, envirologix, portland, me, usa) according to the manufacturer’s protocol. microscope observation of freeze thawed samples confirmed the complete lysis of cells. the results were expressed as mc-lr equivalents (mc-eq). methanol extracts from fish samples were also tested, after being dried and re-dissolved in water, with minor modification from papadimitriou et al. (2012). briefly, 5 g of fish muscle from each animal were added with 10 ml methanol, homogenized, centrifuged at 4000 rpm for 10 min and the supernatant collected. the extraction step was repeated twice and the supernatant fractions were pooled. three aliquots of 5 ml each were gently evaporated to dryness at 45°c in rotavapor. the residue was reconstituted in 500 µl of distilled water. samples were considered positive when the mc concentration was higher than the detection limit of the method (0.10 μg l–1). lc-ms/ms analysis to discriminate the different mc variants, which have a different toxicity (funari and testai, 2008; buratti et al., 2017), samples have also been analysed by liquid chromatography tandem mass spectrometry (lc-ms/ms). the extraction procedure was different for water samples and complex matrix as tissues. water samples each sample was divided into two 500 ml aliquots: one was used to determine dissolved mcs and one to determine total mcs. for dissolved fraction detection, samples were filtered onto gf/c discs (whatman) in order to eliminate cells. the filtrate, acidified, was cleaned-up by solid-phase extraction (spe), as previously described (buratti et al., 2011). briefly, samples were purified and concentrated through ods spe cartridge, rinsed with 20% meoh (4 ml), then eluted with 4 ml meoh. the eluate was dried under a gentle nitrogen stream, and re-dissolved in 0.5 ml of acetonitrile:water (30:70) containing 0.1% (v/v) formic acid. to determine total mcs (dissolved plus intracellular mcs), the aliquot was freeze-thawed three times, to cause cell lysis with the consequent release of intracellular ctx and then treated as described above for the dissolved fraction. the intracellular content of mcs was calculated as the difference between total and dissolved concentration. fish fish tissues have been extracted as reported above for elisa assay. separation, identification and quantification of the mc variants (mc-lr, -la, -yr, -rr, -lf, -lw, -demlr, -dem-rr, for which standards were available) were performed with two micropump and an autosampler pe series 200 (perkin elmer inc., waltham, ma, usa), coupled to a triple-quadrupole mass spectrometer equipped with a turboionspray source (mds sciex, concord, canada). ms tuning and optimization were achieved by infusing mcs standards (alexis, san diego, ca, usa); detection was carried out using multiple reaction monitoring (mrm) mode. mcs separation, in mrm analysis, was conducted as previously described (buratti et al., 2011). all samples were run in mrm mode, utilizing the specific fragmentation reaction of single or doubly protonated mcs to m/z 135, the specific fragment associated to the adda fragment. the amount of mcs was quantified by the external standard quantification procedure, referring to a calibration straight line with 4–6 known amounts of the analytical standards in solvent (coefficient of determination, r2≥0.98), for water samples, and in the blank fish matrix, for fish samples, in order to exclude any interference due to matrix effect. indeed, salts that are hardly removed during extraction procedures and sample preparation may influence samples ionization, causing a quenching of the signal for some congeners whereas for others the signal can be overcompensated (vichi et al., 2012). in fish samples, recovery was also investigated non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 75 spiking preand post-extraction with known amounts of standard mcs. we found around 80% recovery for the different mc variants tested, except for mc-rr, mc-demrr and mc-la, for which recovery was never higher than 50%. for the applied method, the loq ranged between 2 ng l–1 (mc-rr) and 9 ng l–1 (mc-lw) for water samples, and between 5 ng g–1 (mc-lr) and 15 ng g–1 (mc-lf) for fish samples. molecular investigation each field sample (250-500 ml) was filtered on 0.2 µm supor membrane filters to harvest the cells; filters were stored at -20°c. total genomic dna was extracted using the commercial dneasy plant mini kit (qiagen), following the manufacturer’s instructions. genomic dna concentration was measured by a biophotometer (eppendorf), and purity was assessed by calculating the ratio of the absorbance at 260 nm and 280 nm. molecular analyses were performed exclusively on 83 samples, where the p. rubescens cells abundance, estimated by counting before storage and dna extraction, exceeded or was equal to the threshold of 104 cells l–1, in order to obtain reliable and consistent results. a preliminary qualitative pcr was carried out to identify the mc-producing genera planktothrix and microcystis, following the methods of rantala et al. (2006) and vaitomaa et al. (2003), based on the detection of the genus-specific mc synthetase gene e (mcye). the quantitative estimation of planktothrix cells and the fraction of individuals carrying mcs biosynthesis genes were further investigated by qpcr employing a stepone™ realtime pcr system (applied biosystems), according to ostermaier and kurmayer (2009). two independent taq nuclease assays (tnas) were used, one to quantify the general population of planktothrix using the 16s rdna region as specific genus marker, and the other one to quantify the potential mc-producing genotypes within the community by checking the amplification of the first adenylation domain of mcyb (mcyba1). genotypes of the unknown samples were quantified relating their threshold cycle (ct) to the starting cell concentration, by applying the standard curve methodology. for both 16s rdna and mcyb genes the standard curves were established using serial dilutions of dna extracted from known cell concentrations of p. rubescens strains ccap1460/3 and ccap1460/10. the serial dilutions and the samples were amplified simultaneously to determine their ct values under the same experimental conditions. each measurement was performed in triplicate. a similar qpcr approach was applied to quantify the toxic fraction of microcystis (vichi et al., 2012); however, some cross reactivity was observed when primers were tested in the presence of w. naegeliana cells, which often co-occurred with microcystis in the environmental samples, thus making this method unreliable for the quantitative estimation of microcystis mcy+ cells. statistics differences between set of data were tested with anova, with the software statistica 6 (statsoft, inc. ok, usa), after testing for normality. since data from surface sampling sites were not statistically different they have been averaged and average ± sd has been considered. correlation analysis between different variables has been calculated with the software sigmaplot 9.01 (systat) on all raw data. results temperature data of temperature are shown in fig. 2. the lake was generally stratified from march-april until december. cyanobacteria abundance and isolation several potentially toxic species were detected during the monitoring period, with a variable relative abundance over the year: planktothrix rubescens, woronichinia naegeliana, microcystis botrys teiling and dolichospermum planctonicum (brunnthaler) wacklin, l. hoffmann & komárek (fig. 3). p. rubescens was always present (fig. 3a); it dominated in both surface and 20 m depth samples, from november 2011 to summer months in 2012, being significantly lower in the remaining months. during the stratification period, with surface temperatures reaching a maximum of 22.5°c, the highest densities were at 20 m depth, with values oscillating between 1.5 to a maximum of 5×106 cells l–1, according to the typical seasonal dyfig. 2. temperature variation at the surface (s, average of the 3 surface sites ± sd) and 20 m depth (p, average of the 2 depth sites ± sd). aug 2012, nov 2012, feb 2013 no sampling. non -co mmerc ial us e o nly m. stefanelli et al.76 namic of this species. after july 2012, p. rubescens density was about one order of magnitude lower than in the previous year (fig. 3a). during the stratified period, sporadic samples in s1 were collected every 5 m from surface to -20 m, confirming that p. rubescens was homogenously distributed between -10 and -20 m with higher density than surface (data not shown). w. naegeliana was numerically dominant from september to december 2012 when it reached high values on the surface (4.3-7.5×106 cells l–1) and at 20 m depth (68×106 cells l–1), that is about one order of magnitude higher than in 2011 (fig. 3b). in the remaining months, it was totally absent or present at much lower densities. m. botrys was found from the beginning of the monitoring activity until january 2012 and from may to october 2012 in surface samples and sporadically in depths samples (fig. 3c). a peak of density (up to 8×105 cells l–1, sites s1 and s2) was observed in october 2011 at the surface, when it represented the dominant species among cb (45%); it sharply decreased to less than 5% of total cb community in the following months. d. planctonicum was always present at low densities (fig. 3d). in surface samples, it never exceeded 4×104 cells l–1; densities at depths were similar or lower. the lowest values were measured in samples collected in 2013. when integrated samples were considered, m. botrys was the only species virtually absent from the lake between december 2012 and may 2013, when it was again detectable at very low density (1.7×104 cells l–1) although only in r2 (tab. 1). p. rubescens and w. naegeliana were always present at very high density (up to 1.5×109 cells l–1 and 2.4×109 cells l–1 respectively). d. planctonicum was characterized by low densities (maximum 7×106 cells l–1). phytoplankton abundance the phytoplankton community showed a high variability in both cell abundance and species composition. it consisted of green algae like chlorella sp., scenedesmus sp. and chlorococcum sp., and diatoms like aulacoseira sp., fragilaria sp. and asterionella sp. in terms of cell number, they represented on average only ~ 30% of the community (median = 15%). however, their biomass was more relevant. indeed, two significant correlations, one for summer and one for winter (r=0.73 p<0.001 and r=0.90 p<0.001, respectively), identified by two ranges of temperature, were found between the density of the whole phytoplankton community (cb and algae) and chla, used as a proxy for biomass (fig. 4). excluding noncb algae from the number of cell data, correlations were no longer significant, implying that in this lake, even if fig. 3. seasonal variations in the densities of (a) p. rubescens, (b) w. naegeliana, (c) m. botrys and (d) dolichospermum sp. at the surface (s, average of the 3 surface sites ± sd and at 20 m depth (p, average of the 2 depth sites ± sd) (y axis log scale). aug 2012, nov 2012, feb 2013 no sampling. non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 77 cb were numerically more abundant than algae, chl-a could not be used as an index of cb abundance. detection of microcystins elisa the mcs concentrations in water were always detected in the range 0.1-1 µg l–1 (data not shown). the highest values were found in october 2011 in a surface sample, when the dominant species was m. botrys. lc-ms/ms mc-la, -lr, -dem-lr, -rr, -dem-rr were detected in all samples in different relative proportions, whereas the other tested congeners mc-lf, -ly end -lw were always below the detection limit (9 ng l–1). consistently with the elisa data, in all discrete samples mcs concentrations never exceeded 1 µg l–1 (supplementary tab. 1). the levels of mcs in integrated samples ranged between 0.4 and 100 μg l–1 (tab. 2). the highest value was measured in may 2012 when a 10-fold difference was observed between r1 and r3, although the relative proportion of the different variants was the same. the pattern of congeners in both discrete and integrated samples revealed that generally, but not always, mc-dem-rr accounted for ~92% (up to 100%) and mcdem-lr up to 11%, with the sum of the other variants <1% (tabs. 2 and 3). indeed, in some samples, the pattern of congeners was totally different, with mc-lr and mcla accounting for ~60% and 30%, respectively. the fit of linear models between single congeners and cyanobacterial species allowed distinguishing the potential producers of different mc variants. in discrete samples, highly significant correlations were observed between p. rubescens and mc-dem-rr and mc-dem-lr concentration (r2=0.81) (fig. 5a) and between m. botrys and mc-lr, -rr, -la (r2=0.86) (fig. 5b). in the integrated samples, no correlation between p. rubescens and dem-mc was observed when all data were included in the analysis. excluding the values measured in may 2012, which deviated from the main pattern, the relationship between mc concentrations and p. rubescens densities was significant (r2=0.67) (fig. 6a), with a slope not different from that obtained from the discrete samples (t-test t=0.34, p>0.5) (fig. 5a). the correlation between mc-lr and mc-la and m. botrys was still highly significant (r2=0.94) (fig. 6b). also in this case, the slopes of linear models computed on data measured in discrete and intefig. 4. variation of number of cells (phytoplankton including cyanobacteria) vs chl-a in surface sites (grey, warm season; black, cold season). tab. 1. cyanobacteria density (cells l–1×106) in integrated samples in the three sites. site date m. botrys p. rubescens w. naegeliana d. planctonicum r1 oct 2011 52.6 7.00 36.2 2.02 may 2012 nd 181 158 7.41 sept 2012 30.8 7.40 2390 0.68 oct 2012 7.04 9.87 755 0.77 dec 2012 nd 3.29 2150 2.51 jan 2013 nd 50.4 118 1.55 mar 2013 nd 94.1 13.3 0.001 apr 2013 nd 252 355 1.31 may 2013 nd 21.8 127 0.12 r2 oct 2011 71.9 13.1 100 1.63 may 2012 17.3 1510 486 5.27 apr 2013 nd 75.8 67.3 0.12 may 2013 0.02 14.8 93.3 0.07 r3 oct 2011 58.6 6.76 131 2.53 may 2012 3.52 1350 82.9 1.50 nd, not detected. non -co mmerc ial us e o nly m. stefanelli et al.78 grated samples were not statistically different (t=0.25, p>0.5). during the study, 10 strains of p. rubescens were isolated and grown in laboratory conditions. the strains were all toxic, producing only mc-dem-rr (94%±2%) and dem-lr (6%±2%). detection of mc in fish the application of elisa tests to fish muscle tissues showed a weak contamination of the examined samples (tab. 4). these results were not confirmed by the lcms/ms analyses that revealed at most not quantifiable traces of mc-lr and mc-dem-lr. molecular investigation the potential toxigenicity of the two genera microcystis and planktothrix was qualitatively confirmed by pcr in some randomly selected integrated samples with high cb cell densities. the environmental samples were amplified together with the reference strains of m. aeruginosa and p. rubescens, used as positive controls for the presence of the mcyb gene. the absence of any cross-reactivity between dna from planktothrix and microcystis and the selected primers was verified and excluded with preliminary pcr assays on each isolated environmental culture; in addition, no pcr product was obtained when the same primers were tested in samples dominated by w. naegeliana. no conclusions could be drawn on the potential toxigenicity of the w. naegeliana strains present in the lake, since no isolated reference strains (neither discriminating primers) were available. the quantitative estimate of the toxic genotypes performed on the planktothrix population by qpcr revealed a permanent and fairly constant fraction (about 40-50%) of mcyb+ cells throughout the monitoring period, with fig. 5. a) correlation between p. rubescens and mc-dem-lr + mc-dem-rr in discrete samples; the regression line is y=6.17×10–8(se 3.60×10–9) ∙ x + 8.61×10–5(se 5.65×10–3); r2=0.81, p<0.001. b) correlation between m. botrys and mclr + mc-rr + mc-la in discrete samples; the regression line is y=3.96×10–7(se 2.18×10–8) ∙ x + 3.68×10–3(se 3.38×10–3); r2=0.86, p<0.001. tab. 2. microcystins concentrations (µg l–1) in integrated samples in the three sites. site date microcystins rr dem-rr lr dem-lr la tot r1 oct 2011 nd 0.000 38.720 nd 9.180 47.900 may 2012 nd 92.097 nd 8.061 0.000 100.158 sept 2012 nd 0.865 10.381 0.266 2.573 14.085 oct 2012 0.447 nd 4.036 nd 1.345 5.829 dec 2012 nd nd 0.523 nd nd 0.523 jan 2013 nd 1.449 0.043 0.102 0.044 1.638 mar 2013 nd 4.476 nd nd nd 4.476 apr 2013 nd 6.673 0.194 1.490 nd 8.356 may 2013 nd 0.369 0.006 0.038 nd 0.413 r2 oct 2011 nd nd 39.940 nd 15.000 54.940 may 2012 nd 69.520 0.196 5.810 nd 75.526 apr 2013 nd 7.383 nd 1.372 nd 8.755 may 2013 0.012 0.692 0.015 0.057 nd 0.775 r3 oct 2011 nd nd 36.070 nd 11.880 47.950 may 2012 nd 8.338 0.221 1.181 nd 9.740 nd, not detected. non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 79 similar proportions in the surface and deep sampling sites (48±19% vs 40±15%), and in integrated samples (56±0.18%). cell quota based on the correlations between mc congeners and cb, the toxins cell quota were calculated for p. rubescens and m. botrys. the cell quota of the dem-mc produced by p. rubescens in the discrete samples averaged 0.104±0.274 pg mc cell–1 (tab. 5). the high average and s.d. were due to two values measured in december 2012, s1 and p1, in which the cell quota was 30-40 fold higher than the rest of the values which were quite homogeneous (1.44 and 1.91 vs 0.059±0.04 pg mc cell–1 in the remaining samples). when the cell quota was calculated considering only the potentially toxic fraction (mcyb+/16s rdna), the values increased, as expected (0.130±0.076 pg mc cell–1, respectively) (tab. 5). due to a snowfall during sampling, in december 2012 no sample was collected for molecular biology analysis and therefore it was not possible to verify whether the abnormally high cell quota was related to a population 100% composed of mcyb+ cells, or to other reasons. however, even in case of a 100% toxic population the cell quota would still be ~10 times higher than usual. only assuming a possible contribution by w. naegeliana, the cell quota would be in the range of the other values, 0.010 and 0.013 pg mc cell–1; however, this possibility is unlikely, based on what is known on woronichinia toxicity. to see if the toxic fraction of p. rubescens population was a better predictor of mc concentration than the whole population, the fit of linear model between mc variants and the potentially toxic cells (mcyb+ cells) was used, but the variability exfig. 6. a) correlation between p. rubescens and mc-dem-lr + mc-dem-rr in integrated samples; the regression line is y=3.71×10–8(se 8.18×10–9) ∙ x + 0.38(se 0.68); r2=0.67, p<0.001; data from may 2012 have been excluded from the regression. b) correlation between m. botrys and mc-lr + mc-rr + mc-la in integrated samples; the regression line is y=7.94×10– 7(se 5.44×10–8) ∙ x + 1.40(se 1.58) r2=0.94 p<0.001. tab. 3. percentage of the different microcystins variants in discrete samples. site date microcystins rr dem-rr lr dem-lr la s oct 2011 0 0 60 0 40 nov 2011 4 39 44 4 9 dec 2011 1 79 9 9 1 jan 2012 0 90 0 10 0 feb 2012 0 90 0 10 0 mar 2012 0 91 0 9 0 apr 2012 0 94 0 6 0 may 2012 0 100 0 0 0 jun 2012 0 100 0 0 0 jul 2012 0 27 9 0 64 sep 2012 0 16 59 0 25 oct 2012 0 9 62 0 29 dec 2012 0 68 24 0 7 jan 2013 0 100 0 0 0 mar 2013 na na na na na apr 2013 0 100 0 0 0 may 2013 0 100 0 0 0 p oct 2011 na na na na na nov 2011 na na na na na dec 2011 2 75 12 9 2 jan 2012 0 89 0 11 0 feb 2012 0 92 0 8 0 mar 2012 0 93 0 7 0 apr 2012 0 95 0 5 0 may 2012 0 92 0 8 0 jun 2012 0 92 0 8 0 jul 2012 0 92 0 8 0 sep 2012 na na na na na oct 2012 0 100 0 0 0 dec 2012 na na na na na jan 2013 na na na na na mar 2013 0 97 3 0 0 apr 2013 0 100 0 0 0 may 2013 na na na na na s, average of the 3 surface sites; p, average of the 2 depth sites; na, not available. non -co mmerc ial us e o nly m. stefanelli et al.80 plained by the regression was much lower (54% vs 81%) (data not shown). the cell quota calculated on the integrated samples were generally consistent with the average values determined in the discrete ones, except for the values obtained in may 2012 (tab. 6), which were out of range. indeed, the cell quota from the discrete sample was 0.069 pg mc cell–1, whereas the one in r1 was almost 10 times higher (0.554 pg mc cell–1) and in r3 10 times lower ( 0.007 pg mc cell–1). the cell quota of m. botrys in discrete samples averaged 0.771±1.280 pg mc cell–1 (median 0.303 pg mc cell–1) (tab. 5); in the integrated samples cell quota averaged 0.668±0.495 pg mc cell–1, very similar to the discrete sample values (tab. 6). discussion sardinia has a typical semiarid mediterranean climate, and relies for a 57% on a complex water distribution network of surface artificial reservoirs exploited for civilian, agricultural, and industrial purposes (isri, 2006), and accounting for about 90% when only drinking water is concerned (lugliè et al., 2013). therefore a good water management plan is essential. most of the sardinian reservoirs were eutrophic (total nitrogen, 594-2057 μg l–1; total phosphorus, 23-180 μg l–1), with phytoplankton communities dominated by cb (sechi and lugliè, 1996; begliutti et al., 2007; marchetto et al., 2009). the alto flumendosa reservoir maintains an intermediate trophic level between oligotrophy and mesotrophy, as shown by the nutrient concentrations reported by cabras et al. (2013) (supplementary tab. 2), which refer to the period of the monitoring activities described in this paper. the results reported in this latter work are consistent with other previous studies (begliutti et al., 2007; sulis et al., 2014). sulis et al. (2014), who used a very large chemical and phycological dataset for the flumendosa-campidano system to calibrate a model of water quality, described a variable phytoplankton community over the years (annual averages from 1996 to 2012), with a dominance of cb (>90%) from 2002 onward. our study, which was carried out between the end of 2011 and mid 2013 fully confirmed the dominance by cb, although in terms of biomass other phytoplankton groups were also relevant. the species composition of the cb community in the flumendosa reservoir has been previously described as dynamic, with alternating dominating species (lugliè et al., 1997; meregalli et al., 2002; begliutti et al., 2007). as reported by sulis et al. (2014), p. rubescens-agardhii has been continuosly dominant (>90%) between 2002 and 2009 (peak density 35×106 cells l–1), then decreased to ~20% of the whole phytoplankton community in 2010. microcystis spp. has also been always present, generally at the onset tab. 4. elisa and lc-ms/ms results for microcystins in fish tissues. date elisa lc-ms/ms (ng g–1) (ng g–1) rr dem-rr lr dem-lr la tot 08/11/11 trout1 0.054 nd nd nd nd nd nd trout2 0.144 nd nd traces traces nd nd trout3 0.936 nd nd traces traces nd nd 28/02/12 trout1 0.200 nd nd nd nd nd nd trout2 0.132 nd nd traces traces nd nd 24/04/12 trout1 0.092 nd nd nd nd nd nd trout2 * nd nd traces traces nd nd 6/06/12 juveniles 0.048 nd nd nd nd nd nd 25/09/12 trout1 0.046 nd nd traces traces nd nd trout2 0.152 nd nd traces nd nd nd *lost sample; nd, not detected. tab. 5. average of cell quota computed for different microcystins variants (pg cell–1) in p. rubescens and m. botrys in discrete samples (see text). computations refer to the whole sampling period. species p. rubescens p. rubescens mcyb+ m. botrys discrete samples 0.104 (0.055) 0.274 0.130 (0.128) 0.076 0.771 (0.303) 1.281 n=72 n=30 n=21 mean (median) sd. non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 81 of the blooms, while dolichospermum bloomed in 2003, but after that low densities were reported sporadically over the years (sulis et al., 2014). the overall density of cb community during our study was about 10 times lower than what was observed before (messineo et al., 2009; sulis et al., 2014), but an even more complex alternation of species was observed. p. rubescens was always present and generally dominant until summer 2012, with the typical trend of depth blooms in summer and more homogeneous distribution along the water column during the other seasons (kurmayer et al., 2016). these results confirmed the need to sample the metalimnetic layers, especially when they are the source of drinking water supply (manganelli et al., 2010, 2016). the dominating species alternating with p. rubescens was w. naegeliana, previously described in the lake only in 1995 and 1996 (meregalli et al., 2002). blooms of w. naegeliana, particularly in late summer and autumn, are not infrequent in temperate lakes, and have been reported in northern europe (including poland, the czech republic, sweden, finland, belgium, russia), north america (united states) and australia (komárek and anagnostidis, 1999; bucka and wilk-woźniak, 2002; annadottér et al., 2005; rajaniemiwacklin et al., 2005). furthermore, at the beginning of our study, m. botrys was the dominating species, then disappearing in the following months. in addition, d. planctonicum was never dominant but always present as supported by data from integrated samples on the 20 m water column, useful to detect the presence of cb species at low density. since during the winter months m. botrys was undetectable also in the integrated samples, its re-appearance during the summer months can be explained considering that colonies overwintered on the bottom sediments (reynolds et al., 1981). we tested whether cb abundance could be a good proxy for mc concentration in the lake, as it has been shown by many studies on planktothrix (briand et al., 2005; catherine et al., 2008; dolman et al., 2012; salmaso et al., 2014). a prerequisite for this relationship to be significant is the presence of a single dominant species (salmaso et al., 2014). in the present study, the toxic species occurring simultaneously were compared with the different mc-variants, analysed separately. the pattern of mc variants was demonstrated to be highly dependent on the potentially producing species: highly significant linear regressions were obtained between p. rubescens and the demethylated form of mc-rr and mclr, and between m. botrys and mc-la and mc-lr, in both discrete and integrated samples. each species was characterized by a different slope (t-test, t=2.79, p<0.01). the determination of linear regressions with the same slope in both type of samples, for each species, reinforces the validity of our results, since in the integrated samples values of cell density and mc concentration were well above the detection limits. in the elaboration of p. rubescens integrated data, results from may 2012 were not considered, being totally out of range. these results allowed to associate the potential producing species with the different mc variants and furthermore to obtain a model which explained more than 80% of the variation in mc concentration in this system. the association between p. rubescens and mc-dem-rr and -dem-lr was also confirmed by the 10 monoclonal isolated strains producing only the two variants, and is in line with data from other italian lakes (messineo et al., 2006; manganelli et al., 2010, 2016). even if no correlation between mcs and w. naegeliana was found, we cannot definitely rule out its ability to protab. 6. cell quota of microcystins variants (pg cell–1) in p. rubescens and m. botrys in integrated samples in the three sites. site date species p. rubescens p. rubescens mcyb+ m. botrys r1 oct 2011 0.000 0.000 0.911 may 2012 0.554 1.152 nd sept 2012 0.153 na 0.421 oct 2012 0.000 0.000 0.828 dec 2012 0.000 0.000 nd jan 2013 0.031 na nd mar 2013 0.048 0.075 nd apr 2013 0.032 0.057 nd may 2013 0.019 0.031 nd r2 oct 2011 0.000 0.000 0.764 may 2012 0.050 0.075 0.011 apr 2013 0.116 0.195 nd may 2013 0.050 0.070 1.526 r3 oct 2011 0.000 0.000 0.818 may 2012 0.007 0.012 0.063 na, not available; nd, not detected. non -co mmerc ial us e o nly m. stefanelli et al.82 duce some mc congener or other ctx. since w. naegeliana was simultaneously detected with other toxic species, no conclusive considerations on its toxicity have been reported so far. sivonen et al. (1990) reported that the neurotoxicity of bloom samples collected from finnish lakes was associated statistically with anabaena (dolichospermum) lemmermannii, anabaena (dolichospermum) flos-aquae and w. naegeliana. in other studies, various microcystins were found during blooms in which w. naegeliana was dominant (willame et al., 2005; baudin et al., 2006), and the presence of mcy genes in environmental samples characterized by the presence of this species was also reported (oberholster et al., 2006). however, up to now, there are no pure isolated cultures of w. naegeliana in the world cyanobacterial collection, and we also failed to maintain any culture after isolation. with respect to microcystis, and confirming our results on m. botrys, other studies in the field have observed significant correlations between the population abundances and mc concentrations (wang et al., 2010; horst et al., 2014, among others). the strong relationship between cb and mc in p. rubescens implies a high stability of population genetic structure over time (salmaso et al., 2014; kurmayer et al., 2016), which is indeed what we found in the flumendosa reservoir. but this is not always the case: in lake vico (central italy), where p. rubescens was dominant, the fraction of the mcyb+ cells was highly variable over time, especially during the blooms. in those conditions, the correlation between cell density and mc could explain only about 50% of mc variation (manganelli et al., 2016). the quantification of mcy genes of p. rubescens has been indicated as a better predictor of mc concentrations (ostermaier and kurmayer, 2010; hautala et al., 2013). however, in this study the application of the linear regression to the mcyb+ cells and mc reduced the percentage of mc variation explained, from >80% to ~50%, i.e., a value very close to what was observed by briand et al. (2008) in a population of p. agardhii and consistent with what we previously described in lake vico (manganelli et al., 2016). there are several possible explanations for this outcome, as summarized in kurmayer et al. (2016), such as other coexisting non identified toxic species, problems in the amplification of mcy genes or mutation inactivating mcy genes. or it could be also hypothesized that other factors, in addition to the genetic make up, influence the relationship between density and toxicity, and the relation between the whole population and mc, representing the environmental cell quota (ecq, sensu salmaso et al, 2014), includes those factors. since the relationship between mc content and the dynamics of the relative producer was quite strong, the slope of the linear regression could be a good estimate of the cell quota (salmaso et al., 2014), reducing the variability due to extreme values. a reliable estimate of the content of mc per cell can be very important when the possible risk for the population has to be assessed when only the density of cb is known. the ‘average’ density-based p. rubescens cell quota determined in this study were in the range of other values reported in literature (naselli-flores et al., 2007; briand et al., 2008; kosol et al., 2009; manganelli et al., 2010, 2016). interestingly, the cell quota determined for m. botrys were constantly about 10 times higher than p. rubescens and in the range of microcystis cell quota in the field estimated by yu et al. (2014) (0.001 and 1.326 pg cell–1 on the whole population and 0.012 and 1.876 pg cell–1 on the toxic cells). the high cell quota and the production of the more acutely toxic variants (mc-la and mc-lr, showing the lowest ld50 values) make m. botrys a highly toxic species, whose dynamic should be carefully monitored from spring to fall, for possible surface blooms. the levels of mc content during the study never exceeded 1 µg l–1 in all raw water discrete samples, excluding risk of acute and subchronic intoxication by drinking water for the population (who, 2004) and the domestic and wild animals (considering the action levels established by the california state epa, for dairy cows, beef, cattles and dogs; butler and linville, 2012). also the average cell quota was in the range of what is known for the cb species present. however, in the field some unpredictable events are possible (see may and december 2012) for which an exaggerated production of toxin per cell occurs (cell quota values up to 40 fold the average one in december) due to still unknown phenomena. the data used to compute these high values coincided with periods of high mc concentrations and p. rubescens density, making highly improbable the influence of measurement errors on the toxin quota estimates. a sudden increase in toxin concentration, in a time-frame of a few hours, has been observed in microcystis in the field and in laboratory experiment, and it has been associated to the fast increase in cell density and to faster mc production rate (wood et al., 2011, 2012). we speculate that the integrated sample could partly reproduce such a situation, since the ambient conditions of the cells change completely within few minutes, including a rapid increase of cell density. however, this explanation does not fit with the discrete december samples, as well as with the integrated r3 sample in may. this is definitely a field to explore, to define adequate strategies of management, since these situations are of particular concern when the risk for the exposed consumers has to be estimated. the relatively low cell densities found in the monitoring period is consistent with the low mc contamination level found in trout muscle. the discrepancy between the elisa and lc-ms/ms methods (estimated concentrations up to 0.9 ng g–1 and trace values, respectively) may non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 83 be explained by multiple reasons: i) the matrix effects affecting the elisa detection, interfering with the optical density detection; ii) the elisa kit can reveal the presence of those mcs congeners for which analytical standard are not available for lc-ms/ms; and iii) the presence of conjugation products in fish tissue, which can cross-react with anti-mc antibodies. the trace levels detected by lc-ms/ms might be due to better compensation of matrix effects by the use of an appropriate calibration curve. however, low recovery of some mc variants could result to underestimation of mc concentrations in the muscle samples. in this respect, as pointed out by a review on the occurrence of cyanotoxins in food items (testai et al., 2016a), the availability of reliable, validated methods for detecting mc in complex matrices is a priority to collect good quality data to be used in the estimation of the possible risk due to human consumption. in addition, in view of the variability in the rate of toxins production by the cb communities, and in order to have a reliable estimate of the average ingestion of potentially contaminated fish and shell-fish grown in a specific water body, it is necessary to measure cyanotoxin content in the edible parts of representative species. furthermore, the sampling should be carried out over an adequate period of time to take into account seasonal variations in cyanotoxins production and possible differences among fish species depending on their diet, as well as on their capacity of retention/detoxication and elimination of cyanotoxin residues. it has indeed been shown that the bioaccumulation of mcs was species specific, with a tenfold higher bioaccumulation in catfish rather than in carp (singh and asthana, 2014). conclusions toxic cyanobacteria blooms can be a serious problem for the surface water distribution system in sardinia. in the oligo-mesotrophic flumendosa reservoir, toxic cyanobacteria were continuously present, although with relatively low densities and variations over time. three different species were alternatively dominating, namely p. rubescens (producing the demethylated form of mcrr and mc-lr), m. botrys (producing mc-lr and -la) and w. naegeliana (whose toxicity is still unknown). particular attention should be paid to the not visible deep p. rubescens summer blooms, since they are located were water is taken for drinking water supply. m. botrys, although not detectable during winter, was abundant in summer, meaning that inocula of the population are always present and should be carefully monitored since it produces the most toxic variants with a high cell quota. our results show that due to the relatively low density of cb and limited mc concentration found in the lake during the study period, there is no immediate risk of exposure to mc for the human and animal population. however, a variable cb community, characterised by the persistence of a significant toxic fraction, and the evidence of spotted variable toxin production rates suggest the need to take the system under control to manage possible sudden changes in toxins concentrations. the validity of the linear model applied to separate mc variants, to be further verified, show the possibility to expand its use in more complex cb communities, to obtain slopes representative of the studied systems. acknowledgments we thank dr roberta boi for helping in collecting field samples and dr valentina rosu for the work done. the work was supported by a grant from the ministero del lavoro, della salute e delle politiche sociali; dipartimento per la sanità pubblica veterinaria, la nutrizione e la sicurezza degli alimenti, contract number izs sa 04/10 rc. the funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. the authors wish to thank the european cooperation in science and technology cost action es1105 cyanocost for networking and knowledge-transfer support. thanks to three anonymous reviewers who greatly improved the manuscript. references annadottér h, cronberg g, nystrand r, rylander r, 2005. endotoxins from cyanobacteria and gram-negative bacteria as the cause of an acute influenza-like reaction after inhalation of aerosols. ecohealth. 2:209-221. aktan y, lugliè a, sechi n, 2009. morphological plasticity of dominant species in response to nutrients dynamics in bidighinzu reservoir of sardinia, italy. turk. j. fish aq. sci. 9:137-144. baudin i, cagnard o, grandguillaume jj, do-quang z, 2006. algae and associated toxins & metabolites: methodology for risk assessment and risk management. water. pract. technol. 4:1-12. begliutti b, buscarinu p, marras g, sechi gm, sulis a, 2007. reservoirs water-quality characterization for optimization modelling under drought conditions. part i – reservoirs trophic state characterization, p. 239-261. in: g. rossi, t. vega and b. bonaccorso (eds.), methods and tools for drought analysis and management. springer, dordrecht. berry j, 2013. cyanobacteria toxins in food-webs: implications for human and environmental health, p. 531-589. in: a. rodriguez-morales (ed.), current topics in public health. botti p, dessena ma, fiori m, grillo sm, marcello a, matzuzzi c, pretti s, vacca s, 2001. the medio flumendosa reservoir. rendiconti seminario facoltà scienze università cagliari supplemento 71:209-220. briand e, gugger m, francois jc, bernard c, humbert jf, quiblier c, 2008. temporal variations in the dynamics of non -co mmerc ial us e o nly m. stefanelli et al.84 potentially microcystin-producing strains in a bloom-forming planktothrix agardhii (cyanobacterium) population. app. environ. microbiol. 74:3839-3848. briand jf, jacquet s, bernard c, humbert jf, 2003. health hazards for terrestrial vertebrates from toxic cyanobacteria in surface water ecosystems. vet. res. 34:361-377. briand jf, jacquet s, flinois c, avois-jacquet c, maisonnette c, leberre b, humbert jf. 2005. variations in the microcystin production of planktothrix rubescens (cyanobacteria) assessed from a four-year survey of lac du bourget (france) and from laboratory experiments. microb. ecol. 50:418-428. bucka h, wilk-woźniak e, 2002. a monograph of cosmopolitan and ubiquitous species among proand eukaryotic algae from water bodies in southern poland. karol starmach institute of freshwater biology, polish academy of sciences, kraków. buratti fm, manganelli m, vichi s, stefanelli m, scardala s, testai e, funari e, 2017. cyanotoxins: producing organisms, occurrence, toxicity, mechanism of action and human health toxicological risk evaluation. arch. toxicol. 91:1049-1130. buratti fm, scardala s, funari e, testai e, 2011. human glutathione transferases catalyzing the conjugation of the hepatoxin microcystin-lr. chem. res. toxicol. 24:926-933. butler ncj, linville r, 2012. toxicological summary and suggested action levels to reduce potential adverse health effects of six cyanotoxins. office of environmental health hazard assessment, california environmental protection agency, sacramento. cabras pa, rolesu s, orrù a, salati f, pintore a, garau p, funari e, lanni l, vodret b, 2013. [sviluppo di un modello di analisi del rischio di contaminazione da cianotossine in occasione di fioriture di cianobatteri tossici, ed eventuali riflessi sulle popolazioni animali domestiche e selvatiche e sull’ittiofauna di un lago della sardegna (lago alto flumendosa)].[report in italian]. ministero della salute; dipartimento per la sanità pubblica veterinaria, la nutrizione e la sicurezza degli alimenti. carbis cr, waldron dl, mitchell gf, anderson jw, mccauley i, 1995. recovery of hepatic function and latent mortalities in sheep exposed to the blue-green alga microcystis aeruginosa. vet. rec. 137(1):12-15. catherine a, quiblier c, yepremian c, got p, groleau a, vincon-leite b, bernard c, troussellier m, 2008. collapse of a planktothrix agardhii perennial bloom and microcystin dynamics in response to reduced phosphate concentrations in a temperate lake. fems microbiol. ecol. 65 (1):61–73. codd ga, edwards c, beattie ka, barr wm, gunn gj, 1992. fatal attraction to cyanobacteria? nature 359:110-111. dolman am, rücker j, pick fr, fastner j, rohrlack t, mischke u, wiedner c, 2012. cyanobacteria and cyanotoxins: the influence of nitrogen versus phosphorus. plos one 7:e38757. ernst b, neser s, o’brien e, hoeger sj, dietrich dr, 2006. determination of the filamentous cyanobacteria planktothrix rubescens in environmental water samples using an image processing system. harmful algae 5:281-289. frazier k, colvin b, styer e, hullinger g, garcia r, 1998. microcystin toxicosis in cattle due to overgrowth of blue-green algae. vet. hum. toxicol. 40:23-24. funari e, testai e, 2008. human health risk assessment related to cyanotoxins exposure. crit. rev. toxicol. 38:97-125. hallegraeff gm, anderson dm, cembella ad, 2004. manual on harmful marine microalgae monographs on oceanographic methodology 11. unesco, paris: 793 pp. hautala h, lamminmaki, u, spoof l, nybom s, meriluoto j, vehniainen m, 2013. quantitative pcr detection and improved sample preparation of microcystin-producing anabaena, microcystis and planktothrix. ecotoxicol. environ. saf. 87:49-56. hilborn ed, beasley val r, 2015. one health and cyanobacteria in freshwater systems: animal illnesses and deaths are sentinel events for human health risks. toxins. 71374-1395. holm-hansen o, lorenzen cj, holmes rw, strickland jdh, 1965. fluorometric determination of chlorophyll. j. cons. perm. int. explor. mer. 30:3-15. horst gp, sarnelle o, white jd, hamilton sk, kaul rb, bressie jd, 2014. nitrogen availability increases the toxin quota of a harmful cyanobacterium, microcystis aeruginosa. wat. res. 54:188-198. ibelings bw, chorus i, 2007. accumulation of cyanobacterial toxins in freshwater “seafood” and its consequences for public health, a review. environ. pollut. 150:177-192. isri, 2006. [le risorse idriche in sardegna. aggiornamento della valutazione intermedia].[in italian]. programma operativo della regione autonoma della sardegna.1. jespersen am, christoffersen k, 1987. measurements of chl-a from phytoplankton using ethanol as extraction solvent. arch. hydrobiol. 109: 445-454. komárek j, anagnostidis k, 1999. [cyanoprokaryota, 1: chroococcales]. in: h. ettl, g. gardner, h. heynig, d. mollenheuer (eds.), [süsswasserflora von mitteleuropa].[book in german]. gustav fischer, jena: 548 pp. komárek j, anagnostidis k, 2005. [cyanoprokaryota, 2: oscillatoriales]. in: b. büdel, l. krienitz, g. gärtner, m. schager (eds.), [süsswasserflora von mitteleuropa].[book in german]. elsevier, jena: 759 pp. komárek j, zapomělová e, 2007. planktic morphospecies of the cyanobacterial genus anabaena= subg. dolichospermum – 1. part: coiled types. fottea, olomouc 7:1-31. kosol s, schmidt j, kurmayer r, 2009. variation in peptide net production and growth among strains of the toxic cyanobacterium planktothrix spp. eur. j. phycol. 44:49-62. kurmayer r, deng l, entfellner e, 2016. role of toxic and bioactive secondary metabolites in colonization and bloom formation by filamentous cyanobacteria planktothrix. harmful algae 54:69-86. loizzo a, sechi n, volterra l, contu a, 1988. some features of a bloom of oscillatoria rubescens d.c. registered in two italian reservoirs. wat. air soil pollut. 38:263-271. lopez rodas v, costas e, 1999. preference of mice to consume microcystis aeruginosa (toxin-producing cyanobacteria): a possible explanation for numerous fatalities of livestock and wildlife. res. vet. sci. 67:107-110. lugliè a, gesuina l, manca b, sechi n, 1997. [studi limnologici sul lago alto flumendosa (sardegna centrale): stato trofico e fitoplancton].[article in italian]. boll. soc. sarda sci. nat. 31:83-100. lugliè a, padedda bm, bazzoni am, caddeo t, casiddu p, farina p, lai g, manca b, mariani ma, pulina s, satta ct, stacca d, sechi n, 2013. [aspetti dell’ecologia dei sistemi acquatici della sardegna e loro principali problematiche]. [article in italian]. proceedings assemblea generale e del non -co mmerc ial us e o nly cyanotoxins in a sardinian reservoir 85 symposium i mari delle isole (resèaux d’excellence des territoires insulaires – reti): 8 pp. manganelli m, scardala s, stefanelli m, vichi s, mattei d, bogialli s, ceccarelli p, corradetti e, petrucci i, gemma s, testai e, funari e, 2010. health risk evaluation associated to planktothrix rubescens: an integrated approach to design tailored monitoring programs for human exposure to cyanotoxins. wat. res. 44:1297-1306. manganelli m, stefanelli m, vichi s, andreani p, nascetti g, scialanca f, scardala s, testai e, funari e, 2016. cyanobacteria biennal dynamic in a volcanic mesotrophic lake in central italy: strategies to prevent dangerous human exposures to cyanotoxins. toxicon 115:28-40. marchetto a, padedda bm, mariani ma, lugliè a, sechi n, 2009. a numerical index for evaluating phytoplankton response to changes in nutrient levels in deep mediterranean reservoirs. j. limnol. 68:106 121. mariani ma, padedda bm, kaštovský j, buscarinu p, sechi n, virdis t, lugliè a, 2015. effects of trophic status on microcystin production and the dominance of cyanobacteria in the phytoplankton assemblage of mediterranean reservoirs. sci. rep. 5:1-16. meregalli m, trebeni f, manca b, lugliè a, 2002. [stato trofico e fitoplancton nel lago alto flumendosa].[article in italian]. atti associazione italiana oceanografia limnologica 15:87-96. messineo v, mattei d, melchiorre s, salvatore g, bogialli s, salzano r, mazza r, capelli g, bruno m, 2006. microcystin diversity in a planktothrix rubescens population from lake albano (central italy). toxicon 48:160-174. messineo v, bogialli s, melchiorre s, sechi n, lugliè, antonella gl, casiddu p, mariani ma, padedda bm, di corcia a, mazza r, carloni e, bruno m, 2009. cyanobacterial toxins in italian freshwaters. limnol. ecol. manag. inl. waters 39:95-106. moreira c, vasconcelos v, antunes a, 2013. phylogeny and biogeography of cyanobacteria and their produced toxins. mar. drugs 11:4350-4369. naselli-flores l, barone r, chorus i, kurmayer r, 2007. toxic cyanobacterial blooms in reservoirs under a semiarid mediterranean climate: the magnification of a problem. environ. toxicol. 22:399-404. oberholster pj, botha a-m, cloete te, 2006. toxic cyanobacterial blooms in a shallow, artificially mixed urban lake in colorado, usa. lakes & reservoirs 11:111-123. ostermaier v, kurmayer r, 2009. distribution and abundance of nontoxic mutants of cyanobacteria in lakes of the alps. microb. ecol. 58:323-333. ostermaier v, kurmayer r, 2010. application of real-time pcr to estimate toxin production by the cyanobacterium planktothrix sp. appl. environ. microbiol. 76:3495-3502. paerl hw, paul vj, 2012. climate change: links to global expansion of harmful cyanobacteria. wat. res. 46:1349-1363. papadimitriou t, kagalou i, leonardos id, 2012. seasonally accumulation of microcystins in the various tissues of an endemic and protected fish species (rutilus panosi) with different sizes. clean soil air water 40:402-407. pellegrini s, grilli caiola m, sechi n, 1995. microcystis from lake liscia (sardinia italy). paper presented at the 8th viii int. symp. phototrophic prokaryotes abstract, urbino. planas d, paquet s, 2016. importance of climate change-physical forcing on the increase of cyanobacterial blooms in a small, stratified lake. j. limnol. 75:201-214. pulina s, padedda bm, sechi n, lugliè a, 2011. the dominance of cyanobacteria in mediterranean hypereutrophic lagoons: a case study of cabras lagoon (sardinia, italy). scientia marina 75:111-120. rajaniemi-wacklin p, rantala a, mugnai ma, turicchia s, ventura s, komárková j, lepistö l, sivonen k, 2005. correspondence between phylogeny and morphology of snowella spp. and woronichinia naegeliana, cyanobacteria commonly occurring in lakes. j. phycol. 42:226-232. rantala a, rajaniemi-wacklin p, lyra c, lepistö l, rintala j, mankiewicz-boczek j, sivonen k, 2006. detection of microcystin-producing cyanobacteria in finnish lakes with genus-specific microcystin synthetase gene e (mcye) pcr and associations with environmental factors. appl. environ. microbiol. 72:6101-6110. reynolds cs, jaworsky ghm, cmiech ha, leedale gf, 1981. on the annual cycle of the blue-green algae microcystis aeruginosa kütz. emend. elenkin. philos. t. r. soc. b 293:419-477. rippka r, 1988. isolation and purification of cyanobacteria. method enzymol. 167:3-27. saker ml, jungblut ad, neilan ba, rawn dfk, vasconcelos vm, 2005. detection of microcystin synthetase genes in health food supplements containing the freshwater cyanobacterium aphanizomenon flos-aquae. toxicon 46:555-562. salmaso n, copetti d, cerasino d, shams s, capelli c, boscaini a, valsecchi a, pozzoni f, guzzella l, 2014. variability of microcystin cell quota in metapopulations of planktothrix rubescens: causes and implications for water management. toxicon 90:82-96. sechi gm, sulis a, 2009. water system management through a mixed optimization-simulation approach. j. wat. resour. plan. manag. 135:160-170. sechi n, lugliè a, 1992. limnological studies on man-made lakes in sardinia (italy). mem. ist. it. idrobiol. 50:365-381. sechi n, lugliè a, 1996. phytoplankton in sardinian reservoirs. g. bot. ital. 130:977-994. sedmak b, eleršek t, grach-pogrebinsky o, carmeli s, sever n, lah tt, 2008. ecotoxicologically relevant cyclic peptides from cyanobacterial bloom (planktothrix rubescens) – a threat to human and environmental health. radiol. oncol. 42:102-113. singh s, asthana, r, 2014. assessment of microcystin concentration in carp and catfish: a case study from lakshmikund pond, varanasi, india. bull. environ. contam. toxicol. 92:687-692. sivonen k, niemelä si, niemi rm, lepistö l, luoma th, räsänen la, 1990. toxic cyanobacteria (blue-green algae) in finnish fresh and coastal waters. hydrobiologia 3:256-275. stewart i, seawright aa, shaw gr, 2008. cyanobacterial poisoning in livestock, wild mammals and birds – an overview, p. 611-637. in: h.k. hudnell (ed.), cyanobacterial harmful algal blooms state of the science and research needs. springer, dordrecht. sulis a, buscarinu p, soru o, sechi gm, 2014. trophic state and toxic cyanobacteria density in optimization modeling of multi-reservoir water resource systems. toxins (basel) 6:1366-1384. non -co mmerc ial us e o nly m. stefanelli et al.86 testai e, buratti fm, funari e, manganelli m, vichi s, arnich n, biré r, fessard v, sialehaamoa a, 2016a. review and analysis of occurrence, exposure and toxicity of cyanobacteria toxins in food. efsa supporting publication 2016: en-998. 309 pp. available at: http://www.efsa.europa.eu/sites/default/files/ scientific_output/files/main_documents/998e.pdf testai e, scardala s, vichi s, buratti fm, funari e, 2016b. risk to human health associated with the environmental occurrence of cyanobacterial neurotoxic alkaloids anatoxins and saxitoxins. crit. rev. toxicol. 29:1-35. utermhöl h, 1958. [zur vervollkhung der quantitativen phytoplanktonmethodik].[article in german]. mitt. int. verein. theor. angew. limnol. 9:1-38. vaitomaa j, rantala a, halinen k, rouhiainen l, tallberg p, mokelke l, sivonen k, 2003. quantitative real-time pcr for determination of microcystin synthetase gene e copy numbers for microcystis and anabaena in lakes. appl. environ. microbiol. 69:7289-7297. vichi s, lavorini p, funari e, scardala s, testai e, 2012. contamination by microcystis and microcystins of blue-green algae food supplements (bgas) on the italian market and possible risk for the exposed population. food chem. toxicol. 50:4493-4499. walsby ae, avery a, 1996. measurement of filamentous cyanobacteria by image analysis. j. microbiol. meth. 26: 11-20. wang q, niu y, xie p, chen j, ma z, tao m, qi m, wu l, guo l, 2010. factors affecting temporal and spatial variations of microcystins in gonghu bay of lake taihu, with potential risk of microcystin contamination to human health. thescientificworldjo 10:1795-1809. whitton ba (ed.), 2012. ecology of cyanobacteria ii. their diversity in space and time. springer, dordrecht: 760 pp. who, 2004. guidelines for drinking water quality. 1. recommendations. world health organization, geneva. willame r, jurczak t, iffly jf, kull t, meriluoto j, hoffmann l, 2005. distribution of hepatotoxic cyanobacterial blooms in belgium and luxembourg. hydrobiologia 551:99-117. wood r, 2016. acute animal and human poisonings from cyanotoxin exposure a review of the literature. environ. int. 91:276-282. wood sa, dietrich dr, cary sc, hamilton dp, 2012. increasing microcystis cell density enhances microcystin synthesis: a mesocosm study. inland waters 2:17-22. wood sa, rueckert a, hamilton dp, cary sc, dietrich dr, 2011. switching toxin production on and off: intermittent microcystin synthesis in a microcystis bloom. environ. microbiol. rep. 3:118-124. yu g, zhu m, li r, tan w, jiang y, song g, 2014. variation of microcystis and microcystins coupling nitrogen and phosphorus nutrients in lake erhai, a drinking-water source in southwest plateau, china. environ. sci. pollut. res. int. 21:9887-9898. non -co mmerc ial us e o nly layout 1 introduction it has been observed that ephippia pigmentation is a plastic trait (gerrish and cacéres, 2003; hansson, 2004) which can be related to a trade-off between visual predation pressure (mellors, 1975; zaret and kerfoot, 1975; reinikainen, 2012) and better protection for eggs against different types of stress (zaret, 1972; hessen, 1996; gerrish, 2001). mellors (1975) documented that planktivorous fish put greater predation pressure on individuals carrying darker ephippia, but there is more to learn about ephippia pigmentation in different lake types, especially varying in predation degree. in this study, we used a set of model lakes with known typology (plante, 1996b) to document ephippia pigmentation variation. the establishment of la mauricie national park of canada (lmnpc) in 1970 allowed the protection of 536.5 km² of canadian shield of great ecological and cultural value. despite the cessation of major human disturbance (e.g., logging and fishing), the extinction of populations of brook trout (salvelinus fontinalis mitchill, 1814) in small lakes observed during the first half of the 20th century (see bertolo et al., 2008), continued after the establishment of the park. many factors might have caused these extinctions, including the introduction of non-native fishes and transient hypoxia/anoxia events due to beaver (castor canadensis kuhl, 1820) damming (bertolo et al., 2008). the creation of lmnpc was in fact followed by a rise of the beaver population into its territory (masson et al., 2001) due to the end of trapping activities (plante, 1996a). whereas the actual occurrence of most fish species, and especially the presence or absence of brook trout, is relatively well known for most lakes in the lmnpc, the picture is less clear for the period preceding 1970. the historical data referring to the period before the creation of the park, which were obtained from fishing advances in oceanography and limnology, 2016; 7(2): 197-205 article doi: 10.4081/aiol.2016.6215 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). brook trout (salvelinus fontinalis) extinction in small boreal lakes revealed by ephippia pigmentation: a preliminary analysis alexandre bérubé tellier,1* paul e. drevnick,2# andrea bertolo1 1département des sciences de l'environnement, université du québec à trois-rivières, 3351 bd des forges c.p.500, trois-rivières g9a 5h7, québec, canada; 2institut national de la recherche scientifique, centre eau terre environnement, université du québec 490 de la couronne, québec g1k 9a9, canada #present address: university of michigan, biological station, 440 church st., ann arbor, mi 48109, usa *corresponding author: alexandre.berube.tellier@uqtr.ca abstract ephippium pigmentation is a plastic trait which can be related to a trade-off between visual predation pressure and better protection of cladoceran eggs against different types of stress. experimental studies showed that planktivorous fish exert a greater predation pressure on individuals carrying darker ephippia, but little is known about the variation of ephippium pigmentation along gradients of fish predation pressure in natural conditions. for this study, our sampling design included four small boreal lakes with known fish assemblages. two of the lakes have viable brook trout (salvelinus fontinalis) populations, whereas the other two lakes experienced brook trout extinctions during the 20th century. cladoceran ephippia were extracted from sediment cores at layers corresponding to the documented postextinction phase (1990’s) and from an older layer (1950’s) for which the brook trout population status is not known precisely. our first objective was to determine whether brook trout extinction has a direct effect on both ephippium pigmentation and size. our second objective was to give a preliminary assessment of the status of brook trout populations in the 1950’s by comparing the variation in ephippia traits measured from this layer to those measured in the 1990’s, for which the extinction patterns are well known. cost-effective image analysis was used to assess variation in pigmentation levels in ephippia. this approach provided a proxy for the amount of melanin invested in each ephippium analysed. our study clearly shows that ephippium pigmentation may represent a better indicator of the presence of fish predators than ephippium size, a trait that showed a less clear pattern of variation between lakes with and without fish. for the 1990’s period, ephippia from fishless lakes were darker and showed a slight tendency to be larger than ephippia from lakes with brook trout. however, no clear differences in either ephippium size or pigmentation were observed between the 1990’s and 1950’s layers within each lake. this suggests that brook trout extinction already occurred before the 1950’s, or that brook trout population abundance was already extremely low before the 1990’s. our preliminary study shows that ephippium pigmentation can be used as a tool to quickly assess present and past predation levels on zooplankton when only sediment samples are available. key words: cladocerans; ephippia; extinction; pigmentation; predation; salvelinus fontinalis. received: july 2016. accepted: november 2016. non co mmerc ial us e o nly 198 a. bérubé tellier et al. clubs and other historical archives (plante, 1996b), do not always provide accurate information about the status of the fish community or the timing of extinction events. although the documented presence of viable brook trout populations in some lakes after the creation of lmnpc indicates that the species was also present before, identifying the exact moment of brook trout extinction events in other lakes remains a challenge. here we propose to use a paleolimnological approach to help solve this issue. paleolimnological tools can be used to indirectly infer the presence of planktivorous fish (jeppesen et al., 2002; davidson et al., 2011) at the moment of park creation by providing estimates of key traits of the zooplankton community related to predation pressure. in particular, sediments accumulated at the bottom of lakes contain cladoceran ephippia, which can give an approximate portrait of the size structure of the cladoceran assemblage and allow us to infer about the levels of predation in which they were produced (brooks and dodson, 1965; jeppesen et al., 2002). it has been observed that large cladocerans possess a wide range of phenotypic plasticity and genetic variation associated to body size, that are widely used as indicators of predation pressure from planktivorous fish (jeppesen et al., 2002; dzialowski et al., 2003). it has also been observed that more pigmented individuals are exposed to stronger predation pressure by visual predators (zaret and kerfoot, 1975). daphnia carrying darker ephippia are known to suffer greater predation than specimens with less pigmented ephippia (mellors, 1975). as a result, cladocerans tend to reduce the pigmentation of appendices and organs (zaret, 1972) or to reduce the size of darker body parts in the presence of planktivorous fish (reinikainen, 2012). a similar phenomenon is observable also for copepods, where the presence of carotenoids, while allowing a better protection against both uv radiation and parasites, makes them more conspicuous to predators (hansson, 2004; van der veen, 2005). therefore, in different species of both cladocerans and copepods it is possible to observe a trade-off between resistance to stress factors and vulnerability to visual predators, which involves chemical compounds responsible for pigmentation (van der veen, 2005). the main objective of this study was to determine whether brook trout extinction directly affects both ephippium pigmentation and size in two lakes of lmnpc, while secondarily giving a preliminary assessment of the timing of brook trout extinction in these lakes, by using a paleolimnological approach. cladoceran ephippia from sediment cores collected from two lakes in which brook trout populations went extinct were compared to those collected from two lakes with viable brook trout populations. the size and pigmentation of ephippia produced before the creation of lmnpc were compared in both types of lakes to those produced after its creation. based on historical records, all four study lakes possessed viable brook trout populations during the first half of the 20th century (i.e., before the creation of lmnpc), but intensive sampling conducted by park canada in the 1990’s confirmed the presence of viable brook trout populations in only two of the lakes (plante, 1996b). therefore, although we only have approximate and uncertain information about the timing of brook trout extinction, we have a clear picture of the fish assemblage for the period following the creation of lmnpc. this study was based on the analysis of both pigmentation and biometry of cladoceran ephippia deposited in the sediments during the 1950’s and 1990’s (based on 210pb core dating). two main hypotheses were tested concerning the expected patterns of planktivory between lakes that experienced brook trout extinction and lakes with viable brook trout populations. first, the ephippia produced in the 1990’s should be smaller in lakes with brook trout than in those that experienced its extinction. second, lakes with brook trout are expected to show lower levels of pigmentation in the ephippia produced in the 1990’s than those produced in the other lakes. these expected results should reflect the reduction of predatory pressure related to the extinction of brook trout. in contrast, no clear patterns are expected for the 1950’s period for neither ephippium size nor pigmentation, since we hypothesized that brook trout were present in all of the study lakes at that time and went extinct only after the creation of lmnpc. methods study site the four study lakes (alphonse, genévrier, giron and noir, tab. 1) are located in lmnpc, in the upper part of the mauricie region (46°46’n, 73°00’w, québec, canada). these are headwater lakes, located at an average elevation of 287 m asl, of relative small size (average of 12.2 hectares) and relatively shallow (average depth of 6.7 meters). lmnpc archives suggest that all lakes found on this territory were historically inhabited by brook trout (lacasse and magnan, 1994; plante, 1996b). lakes alphonse and giron still possess viable populations of brook trout that are currently exploited for sport fishing, whereas the brook trout populations of lakes genévrier and noir are now extinct. four introduced fish species (tab. 1) are present in lake giron in addition to brook trout, and brook trout of lake alphonse are in sympatry with a cyprinid fish (tab. 1). no other fish species are present in the two lakes where brook trout extinction has occurred, allowing the comparison of situations with complete absence of fish and situations with documented presence of fish (brook trout alone or accompanied by other non co mmerc ial us e o nly response of ephippium pigmentation to fish 199 planktivorous fishes). lake genévrier suffered a presumed extinction of its population in the 1980’s, with the last brook trout catches by lmnpc staff in 1984 (plante, 1996b; masson et al., 2001). in lake noir, there is no documented historical proof of natural presence of brook trout, but the fishing club’s archives indicate the lake was stocked with brook trout (at least) during the 1960’s (plante, 1996b). sediment sampling and radioisotopic dating short sediment cores were collected with an hth gravity corer (pylonex ab, umeå, sweden) at the deepest point of each lake during the ice-covered period in 2013. from each lake, duplicate sediment cores (approximately 30 cm length) were collected from one or two ice holes made within a 3m² area; one core was used for radioisotopic dating and the second for ephippia extraction and analysis. intact sediment cores were transported to lmnpc laboratories (saint-mathieu or saint-jean-despiles, according to proximity with the sampled lake), where the cores were vertically extruded and sectioned into 1-cm thick slices. the subsampled sections were placed into individual plastics bags and stored in the dark at 4°c until further manipulation. we ensured the parallel cores retrieved from each lake represented replicates of the same stratigraphic intervals by comparing the profiles of organic content obtained by loss on ignition (loi). to achieve this goal, 0.25g of dried sediment (100°c overnight) from each sediment layer were combusted for one hour at 550°c. loi manipulations were performed in two different laboratories, as one core was at the institut national de la recherche scientifique, centre eau terre environnement for dating and the other was at université du québec à trois-rivières for ephippial analysis. respectively, the top 16 and 12 sections of each core were analysed for organic matter, covering the period up to 1930. some of the layers from the core located in trois-rivières could not be analyzed since ephippial analysis consumed the available sediment amount. for sediment dating, core sections were freeze dried and analysed for gamma decay of radionuclides with an ortec hpge well detector (oak ridge, tn, usa). the resulting data were used to determine sediment dates and mass accumulation rates by applying the constant rate of supply (crs) model (appleby and oldfiel, 1983). radionuclides analysed included 210pb and 226ra, which together allowed the determination of unsupported 210pb (226ra minus 210pb) and supported 210pb (where 226ra and 210pb are in equilibrium) for the crs model. the artificially produced radionuclide 137cs, which has an expected peak in the study area in 1963 in association with nuclear weapons testing, was also analysed, in order to validate the 210pb chronology. image analysis of ephippia ephippia were manually isolated from sediments by examining the samples, with a dissecting scope. thereafter, ephippia were rinsed with demineralised water into a 100 µm sieve to eliminate residual particles. both the 1950’s and 1990’s layers for each of the four lakes were analysed for a total of eight samples, and an average of 20 ephippia were collected from each sample. each ephippium was digitized with a stereomicroscope nikon smz 745t joined to a ds-l3 camera unit under a standardized 50x zoom. even though pigmentation appeared symmetrical, the two sides of each ephippium were digitized in order to obtain an average of the data from both sides. microscope settings were standardized and each picture had the same preset threshold level for white balance, with constant lighting. biometric measures (length, width and total surface area of ephippia) were recorded with the dsl3 unit. digital pictures were thereafter processed with gimp 2.8.10 image manipulation software. each ephippium image was extracted from its background in order to analyze only the pixels from the ephippium. based on preliminary observations, two intensity colour thresholds have been selected for the pigmentation analysis (i.e., 75/255 and 125/255, fig. 1). these thresholds are in relation with a colour intensity scale of 255, in which 0 represents absolute black and 255 represents absolute white. the 75/255 tab. 1. main characteristics of the four study lakes, data measured in 1997 by the lmnpc (michel plante, lmnpc, unpublished results). lake average cladoceran chlorophyll a brook fish introduced doc area depth (ind l–1) (µg l–1) trout species species (mg l–1) (ha) (m) (n.) (n.) alphonse 13.2 5.5 0.76 0.95 present 2 1* 3.27 genévrier 4.0 8.0 0.72 1.17 extinct 0 0 4.66 giron 28.3 8.6 2.33 1.14 present 5 4** 4.69 noir 3.4 4.6 48.60 1.59 extinct 0 0 9.00 doc, dissolved organic carbon; *allegheny pearl dace (margariscus margarita); **allegheny pearl dace, common shiner (luxilus cornutus), northern redbelly dace (chrosomus eos) and brown bullhead (ameiurus nebulosus). whereas the latter is mainly benthivorous, all the other introduced species are potentially planktivorous. non co mmerc ial us e o nly 200 a. bérubé tellier et al. threshold enables quantification of the percentage of darkened pixels in the ephippium picture (located between 0 and 75 on the colour intensity scale of 255), while the 125/255 threshold provides the percentage of darkened and moderately darkened pixels in the picture (located between 0 and 125 on the colour intensity scale of 255). data registered represent the percentage of pixels from the selected image that are darker than the selected threshold (gerrish and caceres, 2003), and thus represent a proxy for the amount of melanin invested in the ephippium case. the selection of two different thresholds was motivated by the great range of variation in pigmentation among ephippia, where the variation in darker ephippia seemed better highlighted when using a threshold of 75 and that of the clearer ephippia by using a threshold of 125 (gerrish and caceres, 2003). we also used image analysis to extract measures of ephippia total area. ephippia were sorted into morphotypes (m1, m2 and m3, fig. 2) based on a visual examination of their characteristics, namely shape, the presence or absence of a spine, degree of symmetry, texture and length/width ratio. size and pigmentation were not used to classify ephippia, but instead used as dependent variables in the analyses. statistical analysis analyses were conducted only on the m1 morphotype to get a clearer picture of the observed variations. in order to take into account the nested nature of our sampling design (several ephippia per sample with two strata sampled in each lake), we used a mixed modelling approach to analyse our data. this approach not only allowed us to model properly the correlation among non-independent observations, but also to explicitly model heterogeneous variance if needed. to build our models, we applied the approach suggested by zuur et al. (2009) based on the comparison of the akaike information criterion (aic) among different models: i) we first selected the appropriate random term by comparing a full model fitted with all the independent fixed variables considered as important given the sampling design (lake type, stratum and their interaction), to an equivalent model with a random intercept for each study lake, and to another model with both a random intercept and slope for each study lake. restricted estimates maximum likelihood (reml) was used to calculate aic in this case; ii) we then selected the appropriate fixed terms by comparing the fit of the full model to a model without the interaction term and to a model without the stratum term (lake type only). maximum likelihood (ml) was used to calculate aic in this case; iii) once the random and the fixed terms were selected, the final model was refitted with reml to obtain a correct parameter estimation (zuur et al., 2009). all the models were fitted by using the lme()function in the nlme package in r. given that the preliminary exploration of the data suggested a problem of among-groups variance homogeneity, we included a heterogeneous variance term when needed by using the varident()function in the nlme package. three dependent variables were modelled with this approach: fig. 1. image analysis was used to find which percentage of the total pixels was darker than the threshold selected. a) original picture. b) picture processed with a threshold 75/255 and showing 34.5% dark pixels. c) picture processed with a threshold 125/255 and showing 64.4% dark pixels. non co mmerc ial us e o nly response of ephippium pigmentation to fish 201 ephippium surface (hereafter surface), percent ephippium pigmentation at threshold 75/255 (hereafter dark75) and 125/255 (hereafter dark125). all statistical analyses were performed in r 3.3.0 (r core team 2016). results the comparison of loi profiles for each lake strongly supports that duplicate cores have a similar stratigraphy (and also dates and mass sedimentation rates, supplementary fig. 1). for three lakes (alphonse, genévrier and noir), the accurate placement of the 137cs peak validated the 210pb dating. for lake giron, the peak for 137cs was later than expected (1990). dating the cores allowed the selection in each of the studied lakes of the 1950 and 1990 sediments layers, which represent the periods before and after park creation (supplementary fig. 2 and tab. 1). m1 resulted as the most ubiquitous morphotype (81% of analysed ephippia), being the only morphotype present in all of the study lakes, while m2 and m3 each accounted for 9% of the total ephippia and were found in one lake each. ephippium morphotype m1 was identified as belonging to species of the daphnia pulex leydig, 1860 group, based on two morphological identification keys created by vandekerkhove (2004) and mergeay et al. (2005). vandekerkhove’s key also permitted us to presume that the m3 morphotype is related to daphnia ambigua scoufield, 1946 species. however, the two identification keys did not provide enough information to identify the m2 morphotype. lakes with brook trout showed more diversity of morphotypes compared to fishless lakes, with lake alphonse containing both m1 and m2, and giron lake containing both m1 and m3. only the morphotype m1 was found in fishless lakes (genévrier and noir). since m1 resulted as the most common ephippium morphotype in all the studied lakes, statistical analyses were conducted only on the m1 morphotype to get a clearer picture of the observed variations. all selected models included a random intercept for the lake term and at least a term for heterogeneous variance: for both the surface and dark75 variables we included a term for heterogeneous variance across lakes, whereas for the dark125 variable, we also included a term for heterogeneous variance across strata. the visual representation by boxplots clearly illustrates this point (see the variables spread of boxplots among lakes in figs. 3 and 4). in all cases, the model selection for the fixed term ended up with a model including only the “lake type” factor, suggesting that neither the stratum, nor its interaction with the lake type were strong predictors for the three modelled variables. for the variable surface (fig. 3), the results of the t-test showed that lake type is not significantly related to dependent variable (p=0.174, tab. 2). in contrast, for both dark75 and dark125 variables (fig. 4), the results of the t-test showed that lake type is a significant predictor of the dependent variable (p=0.0238 and 0.0351 respectively, tab. 2), with darker ephippia found in fishless lakes and sediment layers. fig. 2. the three visually identified morphotypes (m1-m3). a) m1 (corresponding to d. pulex): spine, asymmetric shape, medium-sized margins, average length:width ratio of 1.42. b) m2: spine (broken on the picture), flare shape on both sides, narrow margin and average length/width ratio of 1.69. c) m3: no spine, spherical shape, large margins and average length:width ratio of 1.29; note the different scale for each picture (a 250 µm horizontal reference bar is presented on the bottom left of each specimen). non co mmerc ial us e o nly 202 a. bérubé tellier et al. discussion our study clearly indicated that ephippium pigmentation may be a better indicator of the presence of fish predation than ephippium size, a trait that showed a less clear pattern of variation between lakes with and without fish in our study system. as predicted, we found a sharp difference in pigmentation (both dark75 and dark125 variables) between ephippia collected from the 1990’s sediment layers from lakes with or without fish. ephippia collected from fishless lakes were significantly (both statistically, given the alpha level, and biologically, given the % variation between lake types) darker than ephippia from lakes with fish. although we did not directly analyze the optical properties of individual ephippia (nevalainen et al., 2016), the photographic approach used here (gerrish and cacéres, 2003) appeared to be sufficiently sensitive to track variations in ephippia pigmentation and to allow discriminating variations in fish predation pressure. small differences in size of ephippia between lake types were also detected, with ephippia showing a tendency to be larger in fishless lakes. unexpectedly, the same general pattern was also observed for the 1950’s period, suggesting that either brook trout extinction occurred before this period (e.g., at lake noir, for which no clear proof of brook trout presence is available for 1950), or that the population levels were already critically low before 1984 (e.g., at lake genévrier, when the last observation of brook trout is available), with resulting low predation pressure on zooplankton. the relatively small fig. 3. boxplot showing variations of ephippium surface according to lake and sediment layers (before and after park creation). lakes p1 (alphonse) and p2 (giron) have viable brook trout populations whereas lakes e3 (genévrier) and e4 (noir) were fishless in the 1990’s. grey: period before park creation; white: period after park creation. fig. 4. boxplots showing variations of the percentage of dark pixels at threshold 75 (panel a) and at threshold 125 (panel b) according to lake (viable or extinct) and sediment layer (before or after park creation). grey: period before park creation; white: period after park creation. non co mmerc ial us e o nly response of ephippium pigmentation to fish 203 size of the two fishless lakes could be related not only to a greater physical instability of these systems, but also to small fish population size, which could increase the vulnerability to stochastic events that could lead to extinction (dunham et al., 1999). it has already been shown that visual predators, such as brook trout, operate a strong selection pressure on large-sized cladocerans (brooks and dodson, 1965; galbraith, 1967), which in turn reduces of the average population body size (hart and bychek, 2011). predation pressure could eventually lead to a reduction in size at first reproduction, either by clonal replacement, or by phenotypic plasticity (latta et al., 2007), which could be mirrored by a reduction in average ephippium size. jeppesen et al. (2002), for example, observed a relationship between actual fish abundance and ephippia dorsal length in surface sediment. our data are in accordance with this hypothesis, with fishless lakes showing a tendency for larger ephippium size, compared to lakes with fish, which is related to adult body size. we also observed a high within-lake variability for this trait, which reduced the possibility to find significant differences given the low sample size of our study, and consequently, low power of our statistical analysis. nevertheless, the observation of clear differences in ephippium pigmentation between lake types highlights the sensitivity of this trait to variations in fish predation pressure. low levels of body pigmentation in the presence of visual predators have been observed in cladocerans (reinikainen, 2012), but to our knowledge this is the first study to show a similar phenomenon in ephippia. in fact, despite the great deal of variability in ephippium pigmentation among lakes (gerrish and cacéres, 2003), and the capability by visual predators of selectively removing individuals carrying darker ephippia (mellors, 1975), the relationship between population ephippium pigmentation and fish predation has not been established previously. since it has been shown that ephippium pigmentation is a strongly heritable trait (gerrish and cacéres, 2003), it is likely that the differences we observed between lake types are mainly due to clonal selection rather than plasticity per se. both selected measures of pigmentation (dark75 and dark125 variables) showed a significant relation to lake type. however, dark75 showed a clearer difference than dark125 in pigmentation variation between lake types (fig. 4). this finding suggests that lake type affected mainly the darkest range of pigmentation since dark75 was more selective than dark125 and integrated only the darkest pixels. this change might be related to an increased conspicuousness to visual predators when pigment concentration is higher (zaret and kerfoot, 1975). it was in fact observed that the quantity of pigmentation in the eyes of ceriodaphnia cornuta sars, 1885 is directly linked to predation risk, because its affects visibility (zaret, 1972). therefore, despite the high metabolic cost involved in melanin synthesis (hebert and emery, 1990), cladocerans produced darker ephippia in the absence of visual predators. this could be explained by the production of phenolic compounds associated to pigmentation, which can provide greater hardness and a better protection of the eggs to uv radiation, parasites and predation (zaret, 1972; hessen, 1996; gerrish, 2001; gerrish and caceres, 2003). in addition, ephippium pigmentation increases resistance to digestion by numerous planktivorous fish, fish-eating birds and mammals (mellors, 1975), which can provide cladocerans species a wider range of dispersal across a territory (proctor, 1964; proctor and malone 1965; mellors, 1975). therefore, it seems logical that in lakes where visual predators are absent, ephippium pigmentation is relatively high in order to increase hardness and enhance protection against uv radiation, parasites and predators. nevertheless, it is necessary to consider that pigmentation levels may be possibly driven by other factors affecting the uv risk in lakes, such as changes in dissolved organic carbon (doc) concentration (cooke et al., 2015) or in solar activity (nevalainen et al., 2016). in fact, variations in doc concentration, and in particular in its coloured or chromophoric component (cdom), can strongly control uv penetration in the water column, tab. 2. results for the fixed terms of the selected mixed linear models concerning the three studied variables. surface: ephippium total area expressed in pixels, dark75: percentage of dark pixels at threshold 75/255, dark125: percentage of dark pixels at threshold 125/255. variable value std. error df t-value p-value surface intercept 93,085.01 5783.30 124 16.10 <0.001 lake type (viable) -16,669.05 8038.32 2 -2.07 0.1738 dark75 intercept 66.98 3.80 124 17.61 <0.001 lake type (viable) -36.48 5.74 2 -6.36 0.0238 dark125 intercept 78.18 1.47 124 52.99 <0.001 lake type (viable) -12.15 2.34 2 -5.19 0.0351 df, degree of freedom. non co mmerc ial us e o nly 204 a. bérubé tellier et al. and can therefore potentially modulate pigmentation levels in cladocerans. similarly, variations in solar activity have been shown to be related to modulate uv-risk in fishless arctic ponds and, in turn, variations in ephippia melanization (nevalainen et al., 2016). however, in contrast to artic waters, which offer no strong protection against uv due to a lack of refugia, such as deep layers and shading macrophytes, our study lakes offer to zooplankton the possibility to avoid damaging uv radiation by changing their vertical or horizontal distribution during the day (williamson et al. 2011). thus, it is reasonable to suppose that ephippia pigmentation responded more strongly to fish predation than to variation in uvrisk in our systems. this might also explain why pigmentation levels tended to differ between our two fishless lakes, albeit the difference was clearly smaller than between fish and fishless lakes, with the brownwater lake noir (french for “black”) showing lower levels of ephippial pigmentation than lake genévrier, which has lower doc concentration. however, extrapolating actual doc concentration to the past decades has obvious limitations and more explicit analyses of the relationship between uv-risk and ephippial pigmentation along a gradient of doc concentration in natural lakes are necessary to elucidate this point. aic-based model selection did not support models including the time period or the interaction between the period and lake type, suggesting that ephippia produced before and after the creation of lmnpc have similar pigmentation levels in fishless lakes. however, a slight after vs before increase in pigmentation was observed at least for lake noir, suggesting a change in predation pressure. lake noir was mainly stocked with brook trout in the 1960’s, but there is no proof that populations were maintained in this lake until the park creation (plante, 1996b). even if they were present in the 1950’s, brook trout populations in this lake may not have been abundant enough to impose strong predation pressure on cladoceran populations. in that case, ephippia would not show the strong changes after the extinction of the remaining predators. the lack of time effect might also be related to physicochemical water status of those lakes, such as water turbidity (finlay et al., 2007), which can prevent efficient visual predation and thus hamper topdown effects on zooplankton (finlay et al., 2007). however, it is also important to note that our sampling design did not allow us to compare fishless lakes with lakes with brook trout only, because of the presence of one to three additional species of planktivorous fish in brook trout lakes. overall, this implies that the potential contrast between lake types is larger than between different time periods within lakes that experienced brook trout extinction. conclusions although this study did not show strong effects of lake types on average ephippium size, ephippium pigmentation was clearly correlated with the presence or absence of planktivorous fish in the 1990’s. our results also show that the level of planktivory in fishless lakes were very low in the 1950’s, suggesting either the absence of brook trout or very low population abundance. our study expanded the findings by jeppesen and co-workers (2002) by showing that the degree of ephippium pigmentation can be used in addition to ephippium size as a tool to quickly assess fish density in lakes when only sediment samples are available. complementary paleoecological analyses of other indicators of changes in the fish predation pressure (e.g., based on chaoborid mandibles, uutala 1990) are planned in order to strengthen these preliminary results on the impact of fish extinction in our study lakes. acknowledgments we would like to thank patricia bolduc, paméla magnan-baril, william brassard, freddy gutierrez trejo, chantal fournier, dany bouchard and joëlle guitard for their valuable help. we are greatly thankful to two anonymous reviewers for improving the first version of this work and to michel plante and his collaborators of lmnpc for their assistance with winter sampling and to parks canada for granting access to the study sites. references appelby pg, oldfield f, 1983. the assessement of 210pb data from sites with varying sediment accumulation rates. hydrobiologia 103:29-35. bertolo a, magnan p, plante m, 2008. liking the occurrence of brook trout with isolation and extinction in small boreal shield lakes. freshwater biol. 53:304-321. brooks jl, dodson si, 1965. predation, body size, and composition of plankton. science 150:28-35. cooke sl, fisher jm, kessler k, williamson ce, sanders rw, morris dp, porter ja, jeffrey wh, devaul princiotta s, pakulskim jd, 2015. direct and indirect effects of additions of chromophoric dissolved organic matter on zooplankton during large scale mesocom experiments in an oligotrophic lake. freshwater biol. 60:2362-2378. davidson ta, bennion h, jeppesen e, clarke gh, sayer cd, morley d, odgaard bv, rasmussen p, rawcliffe r, salgado j, simpson gl, amsinck sl, 2011. the role of cladocerans in tracking long-terme change in shallow lake trophic status. hydrobiologia 676:299-315. dunham j, peaock md, tracy cr, nielsen j, vinyard g, 1999. assessing extinction risk: integrating genetic information. conserv. ecol. 3:2. dzialowski ar, lennon jt, o’brien wj, smith vh, 2003. prednon co mmerc ial us e o nly response of ephippium pigmentation to fish 205 ator-induced phenotypic plasticity in the exotic cladoceran daphnia lumholtzi. freshwater biol. 48:1593-1602. finlay k, beisner be, patoine a, pinel-alloul b, 2007. regional ecosystem variability drives the importance of bottom-up and top-down factors for zooplankton size spectra. can. j. fish. aquat. sci. 64:516-529. gerrish ga, 2001. maintaining pigment variation in aquatic systems: the cause and consequences of pigment variation in daphnia pulicaria ephippial egg casings. ms thesis, university of illinois at urbana-champaign, usa. gerrish ga, cacéres ce, 2003. genetic versus environmental influence on pigment variation in the ephippia of daphnia pulicaria. freshwater biol. 48:1971-1982. hansson la, 2004. plasticity in pigmentation induced by conflicting threats from predation and uv radiation. ecology 85:1005-1016. hebert pdn, emery cj, 1990. the adaptative significance of cuticular pigmentation in daphnia. funct. ecol. 4:703-710. hessen do, 1996. competitive trade-off strategies in arctic daphnia linked to melanism and uv-b stress. polar biol. 16:573-579. jeppesen e, jensen jp, amsinck s, landkildehus f, lauridsen t, mitchell sf, 2002. reconstructing the historical changes in daphnia mean size and planktivorous fish abundance in lakes from the size of daphnia ephippia in the sediment. j. paleolimnol. 27:133-143. lacasse s, magnan p, 1994. [distribution post-glaciaire de l’omble de fontaine dans le bassin hydrographique du fleuve saint-laurent: impact des interventions humaines]. [book in french]. université du québec à trois-rivières, pour le ministère de l’environnement et de la faune du québec, trois-rivières, qc, canada: 83 pp. latta l, bakelar jw, knapp ra, pfrender me, 2007. rapid evolution in response to introduced predators ii. bmc evol. biol. 7:21. masson s, pinel-alloul b, east p, magnan p, hogue g, barabé a, 2001. [programme de surveillance des écosystèmes aquatiques du parc national de la mauricie].[in french]. groupe de recherche en limnologie et environnement aquatique pour parcs canada, services de conservation des écosystèmes, parc national de la mauricie, qc. mellors wk, 1975. selective predation of ephippial daphnia and the resistance of ephippial eggs to digestion. ecology 56:974-980. mergeay j, verschuren d, de meester l, 2005. daphnia species diversity in kenya and a key to the identification of their ephippia. hydrobiologia 542:261-274. nevelainen l, rantala mv, luoto tp, ojala a, rautio m, 2016. long-term changes in pigmentation of arctic daphnia provide potential for reconstructing aquatic uv exposure. quaternary sci. rev. 144:44-50. plante m, 1996a. [plan de conservation des écosystèmes aquatiques].[in french]. parc national de la mauricie, parcs canada, service de conservation des ressources naturelles, parc national de la mauricie, qc. plante m, 1996b. [les communautés de poisson du parc national de la mauricie, de l’origine à aujourd’hui].[in french]. parcs canada, service de conservation des ressources naturelles, parc national de la mauricie, qc. proctor vw, 1964. viability of crustacean eggs recovered from ducks. ecology 45:656-658. proctor vw, malone cr, 1965. further evidence of the passive dispersal of small aquatic organisms via the intestinal tract of birds. ecology 46:728-729. r core team, 2016. r: a language and environment for statistical computing. r fundation for statistical computing. vienna, austria. available from: https://.r-project.org/ reinikanen m, ahlen e, 2012. ressurected ceriodaphnia quadrangula highlight differences between phenoand genotypic expressions. ecol. evol. 2:2989-2998. utala aj, 1990. chaoborus (diptera: chaoboridae) mandibulespaleolimnological indicators of the historical status of fish populations in acid-sensitive lakes. j. paleolimnol. 4:139-151. van der veen it, 2005. costly carotenoids: a trade-off between predation and infection risk? j. evol. biol. 18:992-999. vandekerkhove j, declerck s, vanhove m, brendonck l, jeppesen e, conde porcuna jm, de meester l, 2004. use of ephippial morphology to assess richness of anomopods: potentials and pitfall. j. limnol. 63:75-84. williamson ce, fisher jm, bollens sm, overholt ep, breckenridge jk, 2011. toward a more comprehensive theory of zooplankton diel vertical migration: integrating ultraviolet radiation and water transparency into the biotic paradigm. limnol. oceanogr. 56:1603-1623. zaret mt, 1972. invisible prey, and the nature of polymorphism in the cladocera (class crustacea). limnol. oceanogr. 17:171-184. zaret mt, kerfoot wc, 1975. fish predation on bosmina longirostris: body-size selection versus visibility selection. ecology 56:232-237. zuur af, leno en, walker nj, saveliev a, smith gm, 2009. mixed effects models and extensions in ecology with r. statistics. springer, new york: 574 pp. non co mmerc ial us e o nly layout 1 advances in oceanography and limnology, 2016; 7(1): 36-50 article doi: 10.4081/aiol.2016.5791 introduction water temperature in lakes is governed by a complex heat budget resulting from the combination of different heat flux components that are mainly exchanged between the lake and the atmosphere. water temperature is the primary driver of vertical stratification in lakes, thus it significantly affects transport of mass (including nutrients and dissolved oxygen), energy, and momentum within the water column. it crucially controls several physical (e.g., thermal stratification, mixing processes), geochemical (e.g., chemical reaction rates, oxygen solubility), and ecological (e.g., metabolism, growth, and reproduction of organisms) processes, with considerable influences on the overall lake water quality, ecosystem functioning, and community composition (wetzel, 2001; gallina et al., 2013). it is therefore evident that any significant changes in water temperature may lead to alterations in the thermal regime of the lake and in the community structure of many freshwater habitats (winder and sommer, 2012; de senerpont domis et al., 2013; schabhüttl et al., 2013; butcher et al., 2015), with possible modifications of the biochemical compositions of some algae species (flaim et al., 2014). this is particularly relevant considering that lakes have been demonstrated to be highly sensitive to changes in environmental conditions (adrian et al., 2009; o’reilly et al., 2015). in the light of the above considerations, large efforts have been directed towards the development of models able to predict water temperature, with a particular attention to lake surface temperature (lst). several models of different type and complexity have been proposed to simulate water temperature, ranging from simple regression models (mccombie, 1959; webb, 1974; livingstone and lotter 1998; kettle et al., 2004; sharma et al., 2008) to more complex process-based numerical models (perroud et al., 2009; martynov et al., 2010; thiery et al., 2014). regressions models are attractive because they require little information, usually only air temperature, but generally they are not able to address some fundamental processes (e.g., the prediction of lake surface temperature using the air2water model: guidelines, challenges, and future perspectives sebastiano piccolroaz department of civil, environmental and mechanical engineering, university of trento, via mesiano 77, i-38123,trento, italy corresponding author: s.piccolroaz@unitn.it abstract water temperature plays a primary role in controlling a wide range of physical, geochemical and ecological processes in lakes, with considerable influences on lake water quality and ecosystem functioning. being able to reliably predict water temperature is therefore a desired goal, which stimulated the development of models of different type and complexity, ranging from simple regression-based models to more sophisticated process-based numerical models. however, both types of models suffer of some limitations: the first are not able to address some fundamental physical processes as e.g., thermal stratification, while the latter generally require a large amount of data in input, which are not always available. in this work, lake surface temperature is simulated by means of air2water, a hybrid physically-based/statistical model, which is able to provide a robust, predictive understanding of lst dynamics knowing air temperature only. this model showed performances that are comparable with those obtained by using process based models (a root mean square error on the order of 1°c, at daily scale), while retaining the simplicity and parsimony of regression-based models, thus making it a good candidate for long-term applications. the aim of the present work is to provide the reader with useful and practical guidelines for proper use of the air2water model and for critical analysis of results. two case studies have been selected for the analysis: lake superior and lake erie (usa). these are clear and emblematic examples of a deep and a shallow temperate lake characterized by markedly different thermal responses to external forcing, thus are ideal for making the results of the analysis the most general and comprehensive. particular attention is paid to assessing the influence of missing data on model performance, and to evaluating when an observed time series is sufficiently informative for proper model calibration or, conversely, data are too scarce thus leading to the risk of overfitting. the final aim of the work is to facilitate the use of the model also by scientists that do not necessarily have a solid background on modeling or physics. this work is also an attempt to foster the communication and interaction among colleagues of a branch of science, limnology, which suffer of significant fragmentation. this is summarized in the future perspectives and challenges concerning potential improvements of the air2water, with a particular emphasis on possible cross-sectoral applications key words: lake surface temperature; air2water; air temperature, thermal response; temperature modeling. received: february 2016. accepted: march 2016. non -co mmerc ial us e o nly 37s. piccolroaz effect of thermal stratification) and their use may be questionable especially when it is necessary to extrapolate temperature values beyond the limits of the measured time series, as is typically the case in climate change studies. on the other hand, deterministic models are designed to provide an exhaustive description of the thermal behaviour of the lake, but they require detailed time series of meteorological variables, which are not always available for long periods and with a sufficient accuracy. in order to overcome the limitations of traditional approaches, piccolroaz et al. (2013) recently developed air2water, a hybrid physically-based/statistical model, which is able to provide a robust, predictive understanding of lst dynamics knowing air temperature only. the hybrid formulation of the air2water model combines a physically based derivation of the governing equation with a stochastic calibration of the parameters. in this way, the information contained in the data is transferred directly to model parameters, whose calibrated values can provide significant information as to how the real system behaves (thanks to the physical-based structure of the model). the underlying rationale behind the development of this model is to take advantage of the fact that the governing laws of physics are generally well understood, to introduce opportune simplifications while retaining all the fundamental processes (and their physical meaning) involved. the purpose is to minimize data requirements and computational effort, which still represent the most common limitations, and to develop a as simple as possible but not simpler (citing a famous quote by albert einstein) mathematical tool able to provide a reliable description of a natural phenomenon on the basis of the data that are available. the model has been successfully tested considering lakes characterized by different morphometric characteristics and using different sources of data (see e.g., toffolon et al., 2014a, who applied the air2water model to 14 different lakes in the temperate region: 7 located in north america, 6 in europe, and 1 in asia). in all cases, air2water performed similarly to more complex process-based models (i.e., rmse on the order of 1°c for daily temperatures), even though these latter models generally require a much larger amount of information. the model has been shown to satisfactorily capture seasonal variations and inter-annual dynamics of lst, and to provide key information to investigate the role of stratification in controlling the thermal response of lakes (piccolroaz et al., 2015a). this work provides the reader with practical guidelines for proper use of the air2water model and for critical analysis of results, with the final goal of facilitating the use of the model by scientists that do not necessarily have a solid background on modelling or physics. however, this work should not be considered simply as a collection of best practices, but also as an attempt to foster communication among colleagues from different disciplines with a common interest in aquatic science. the reader will find answers to questions like: what is the meaning of model parameters, how are they derived, and how should we select their a priori range of variation?; what is the maximum allowable percentage of missing data to obtain reliable results?; how long should the calibration period be?; what version of the model should be used?; does lake depth affect model performance?. particular attention is given to analysing the effects of data scarcity on model performance in modelling lst. finally, future directions and perspectives concerning possible improvements of the air2water model are discussed, with a particular emphasis on cross-sectoral applications. methods study sites and available data the air2water model is applied to two lakes characterized by significantly different morphological and thermal characteristics: lake superior and lake erie (usa) (fig. 1). lake superior is the largest, deepest, and most northern of the great lakes, while lake erie is the smallest, shallowest, and most southern of the two lakes in this study (tab. 1). long-term data of air and surface water temperature are available from different sources. in this work the following sources of data are used: glsea daily lst retrieved from satellite imagery (i.e., skin temperature) provided by national oceanic and atmospheric administration (noaa) great lakes environmental research laboratory (glerl, webpage: http://www. glerl.noaa.gov/glsea/asc_ 1024/) and derived from noaa polar-orbiting satellites equipped with avhrr sensors, and daily air temperature at 2 meters above ground from era-interim reanalysis (provided by the european centre for medium-range weather forecasts, ecmwf and downloaded from http://apps.ecmwf.int/datasets/data/interim-full-daily/levtype=sfc/). both datasets cover the 20year period 1995-2014 and contain spatially distributed data (with resolution equal to about 1.3 km and 80 km in the two cases, respectively). the data have been postprocessed in order to evaluate lake-average values, i.e., temperature values have been aggregated at the lake scale. moreover, in order to allow the analyses, as presented in the results section, the missing data in the lst series have been replaced by interpolation with a moving average filter of 10 days. fig. 1 shows the typical annual cycles of air and water temperature for the two lakes, and suggests the existence of markedly different thermal behaviours: i) due to the higher latitude, air temperature over lake superior is generally colder than for lake erie (annual mean, minimum, and maximum equal to about 3.9°c vs 9.6°c, -13.9°c vs non -co mmerc ial us e o nly 38 the air2water model: guidelines, challenges, and perspectives -6.4°c, and 17.8°c vs 23.5°c, for the two lakes respectively) and the maximum air temperature occurs later (beginning of august vs middle of july); ii) the amplitude of the phase lag (hysteresis) between air and water temperature is more evident for lake superior than for lake erie indicating a larger thermal inertia due to the larger water volume; iii) consequently, the onset of direct thermal stratification (i.e., when tw≥4°c)) in lake superior occurs later in the year (end of may vs middle of april) as well as the period of maximum stratification (i.e., when tw is maximum; end vs beginning of august); iv) the shape of lst annual cycle deviates from the nearly sinusoidal pattern of air temperature in lake superior, contrary to what happens in the case of lake erie; and v) lake superior is generally colder than lake erie (mean annual lst equal to 6.5°c and 11.3°c in the two lakes, respectively). the choice of these two case studies is not only motivated by the large amount of high quality and freely available data, but also, and more importantly, by the fact that they are good examples of deep and shallow temperate lakes characterized by markedly different thermal responses to external forcing. this requisite is certainly of major importance in order to write as much as possible exhaustive and generally valid guidelines for best practices around the use of the air2water model. the air2water model the air2water model is based on a lumped heat budget of the surface volume of the lake at daily time scale, and is derived from the following volume-integrated heat equation: (eq. 1) from which the variation of water temperature (tw) in time (t: hereafter expressed in days) is directly dependent on the product between the heat flux into the upper water volume (hnet) and the surface area of the lake (a), and inversely dependent on the surface volume of water involved in the heat exchange with the atmosphere (vs: hereafter also referred to as the reactive volume), density (ρ) (1000 kg m–3), and specific heat capacity at constant pressure (cp) (4186 j kg–1 °c–1). hnet can be expressed as the combination of several contributions entering and exiting the upper water volume (vs) (see fig. 2 for a schematic, and supplementary material a for details), which are primarily controlled by: the net shortwave (hs) and longwave (ha) radiation actually absorbed by the surface volume (i.e., accounting for water reflectivity), the longwave radiation emitted from the lake (hw), the latent heat flux due to evaporation and condensation (hl), and the sensible heat flux due to convection (hc). heat flux due to precipitation, the heat exchanged with inlets/outlets, and the heat exchanged between surface volume and deep water or sediments can be considered as insignificant fig. 1. geographical location of lake superior and lake erie in the great lakes region and in north america. typical annual cycles (averaged over the period 1995 to 2014) of air and water temperature for the two lakes. tab. 1. main morphological characteristics of the investigated lakes. volume (km3) surface area (km3) maximum depth (m) average depth (m) geographic coordinates lake superior 12,000 82,100 406 147 47.7°n 87.5°w lake erie 480 25,667 64 19 42.2°n 81.2°w non -co mmerc ial us e o nly 39s. piccolroaz factors, and are not explicitly included in the formulation of air2water. however, their contribution is indirectly accounted for in the calibration of parameters. following livingstone and padisák (2007), air temperature can be considered as a proxy for the integrated effect of the external forcing, and it can be assumed, together with lst, as the key factor controlling the heat balance of the surface layer of the lake. this is the central concept of the air2water model. in particular, hnet is included in a linear form obtained by taylor expansion in terms of both air (ta) and water (tw) temperatures, as follows: (eq. 2) whereand t̄w are reference values (e.g., long term averages of ta and tw, respectively), and hnet,0=hnet | t̄a ,t̄w is the part of hnet that is independent on air and water temperatures. in general, however, hnet,0 can vary in time. as a first approximation, this is accounted for by defining hnet,0 as the sum of a constant value and a sinusoidal function of time with a period of 1 year, the latter term summarizing, albeit in a simplified form, the combined effect due to the variability of all meteorological variables other than air temperature (e.g., solar radiation, wind speed, air humidity, cloudiness) at annual time scale. equation (1) can be therefore rewritten as follows: (eq. 3) where the definition of parameters âi,i=1, 2, 3, 5, 6 can be derived from equation (2) once the single heat flux terms are evaluated through suitable empirical relationships (martin and mccutcheon, 1998). refer to supplementary material a for details about the linearization hnet of , and the definition of parameters âi. by introducing the dimensionless ratio δ=vs /vr (which can be also interpreted as the ratio between the average depth of the surface layer ds=vs /a and that of the reference layer dr=vr /a.), eq. (3) can be rewritten as the following ordinary differential equation, representing the full version of the air2water model: (eq. 4) where parameters ai,i=1, 2, 3, 5 are defined as ai=âia/(vr ρcp)=âi/(dr ρcp). in this form, the geometrical characteristics of the lake (surface area, volume, and depth) are not required to be explicitly specified, since are implicitly accounted for in the model parameters ai, which require calibration. in order to ensure proper model calibration excluding unrealistic solutions, the model parameters are allowed to vary within a physically plausible range, which can be easily estimated knowing (even approximately) the mean depth of the lake, as will be thoroughly discussed in the results section. equation (4) is numerically integrated with a daily time step (i.e., dt=1 day; see also the methods section for further details). finally, in order to account for the significant seasonal variability of the reactive volume as a consequence of thermal stratification, piccolroaz et al. (2013) assumed that the dimensionless ratio (δ) is a function of the difference between lst and a reference value of the deep water temperature (th), through the following empirical relationship: (eq. 5) where th can be assumed to be 4°c for dimictic lakes, and the minimum or maximum water temperature for warm and cold monomictic lakes, respectively, and a4, a7, and a8 are model parameters. from the first formula in equation (5) it is easy to see that the dimensionless ratio δ is theoretically defined in a range from 0 to 1, with δ decreasing for increasing thermal stratification (here represented by the difference tw–th), thus mimicking the fact that the surface water volume affected by the surface heat budget gets progressively thinner. conversely, δ=1 when the lake is isothermal (i.e., tw–th), suggesting that the reference volume can be interpreted as the maximum water volume involved in the heat exchange with the atmosphere during the year. the same considerations apply to the second formula in equation (5), which is valid when the lake is inversely stratified (i.e., when ). in this case, however, the possible effect of heat flux reduction due to ice cover is also included by a fictitious increase of the effective volume (see the second term on the right-hand side). in order to simulate ice formation at the surface, a lower bound is imposed on by introducing a threshold value. this threshold is generally 0°c when the water temperature is measured close to the surface, but it can be higher when temperature is measured at deeper depths. despite being simple, the parameterization of δ presented in equation (5) is suitable to reproduce fig. 2. main heat fluxes involved in the heat budget of the surface layer. see supplementary material a for the description of the single terms. non -co mmerc ial us e o nly 40 the air2water model: guidelines, challenges, and perspectives seasonal and interannual patterns of thermal stratification, as it has been clearly demonstrated for the cases of lake constance (toffolon et al., 2014a) and lake superior (piccolroaz et al., 2015a). equations (4) and (5) taken together constitute the air2water model in its full, 8-parameter version. two simplified versions of the model are also available: a 6-parameter version where δ=1 when the lake is inversely stratified; and a 4-parameter version which, beyond the above simplification, does not include the externally imposed sinusoidal forcing (i.e., a5=0). this latter version can be considered particularly appropriate when the annual cycles of tw and/or of ta are approximately sinusoidal: in fact, from basic principles of trigonometry, the sum of sinusoidal functions with the same period (i.e., 1 year) but different amplitude and phase, yields another sinusoid with different amplitude and phase but the same period. therefore, two sinusoids are enough, and the term can be removed. for the reason given in the results section (second paragraph), the whole analysis is performed considering only the 4and 6-parameter versions of the air2water model, without loss in generality. numerical solution and model calibration the second release of the air2water model is now available at https://github.com/spiccolroaz/air2water, where the source code (written in fortran 90/95), the precompiled executable files (linux/windows), a readme file, and an example application are freely downloadable (the code is published under the creative commons attribution-sharealike 3.0 license). in this new release, the main improvement concerns the numerical solution of the ordinary differential equation (4), which, together with equations (5), constitutes the air2water model. users can now choose among euler, runge-kutta 2nd order, rungekutta 4th order, and crank-nicolson numerical schemes. the first three schemes are explicit, and in summer, when δ→0, it may happen that a daily time step is too large to adequately integrate equation (4), possibly generating numerical instabilities. in order to avoid this situation and provide an accurate prediction of tw, an adaptive sub-stepping procedure has been implemented, in which the original integration time step of one day is divided into a number of equal sub-steps according to the stability conditions of the method (butcher, 2008). predictions of tw are anyway provided at daily time scale. conversely, the last numerical scheme is implicit, 2nd order accurate, and unconditionally stable: a sub-stepping procedure is not required and the daily time step is used for the whole simulation, making it generally faster (but less accurate than runge-kutta 4th order) than the previous schemes. in this case, in order to obtain a closed-form analytical expression of equation (4), is handled explicitly, thus only to the numerator of the right-hand side of equation (4) has been discretized according to the crank-nicolson scheme. model calibration is performed through a monte carlo-based optimization approach in which a large number of parameter sets are sampled and evaluated in terms of a given metric of model efficiency. here, the root mean square error (rmse) between observed and modelled values is considered as an optimization metric, meaning that at the end of the optimization loop the best set of parameters is identified as the one providing the smallest rmse. the sampling procedure is performed through the particle swarm optimization (pso) algorithm, a simple and powerful population-based stochastic optimization technique firstly proposed by kennedy and eberhart (1995) for solving engineering problems, and successively applied to a variety of different fields, including hydrology (gill et al., 2006; piccolroaz et al., 2015b). for further details about this optimization procedure, the reader is referred to supplementary material b. numerical integration of equation (4) requires that the series of air temperature (i.e., the external forcing) be continuous and at daily resolution. therefore gaps (in case they exist) must be reconstructed e.g., by replacement with the average value of all air temperature measurements available in the data set for the same specific day of the year when the data is missing. conversely, the time series of observed lst can contain missing data. in this case, missing data are not replaced, and they simply do not contribute to the evaluation of the prediction performance (e.g., through the evaluation of rmse between observed and simulated lst). this allows for using air2water with lst observational time series at any frequency (e.g., weekly, monthly, seasonal) that is not necessarily the daily, or simply with irregular time series. the effect on model performance of the presence of missing lst data will be analysed in detail in the results section. as a final note, besides rmse the user can choose between other metrics of model performance: the nash-sutcliffe efficiency index (nse, nash and sutcliffe, 1970) and the kling-gupta efficiency index (kge, gupta et al., 2009). in addition, model calibration can be performed using simple random sampling or the latin hypercube sampling technique (mckay et al., 1979) besides the pso, which are computationally more expensive but explore more uniformly the space of parameters, allowing for conducting sensitivity analyses of model parameters. results evaluating the a priori range of model parameters as mentioned in the methods section, to ensure proper model calibration, model parameters are required to be non -co mmerc ial us e o nly 41s. piccolroaz defined within a physically consistent a priori range of variation. this range should be sufficiently wide to allow for the existence of an optimal and physically plausible set of parameters, and at the same time it should not be indiscreetly large to avoid convergence to unrealistic solutions. suitable a priori ranges of variations for parameters ai,i=1, 2, 3, 5 can be evaluated on the basis of physical considerations, recalling that ai=âi/(dr ρcp). reliable estimates of âi and dr are therefore required. the possible range of variation of parameters âi can be obtained from equations (a11)-(a15) in supplementary material a, considering all possible values and combinations of the physical coefficients that appear in these equations (martin and mccutcheon, 1998). also the reference depth dr , i.e., the mean depth of the largest water volume involved in the surface heat budget of the lake during the year, see methods) can be assumed to vary within a range of possible values. reasonably, dr is bounded from above by the average depth of the lake (d=v/a, where v and a are volume and surface area of the lake, respectively), i.e., when dr=d the whole lake participates to the heat exchange with the atmosphere when the water column is well mixed. however, for the case of very shallow lakes (e.g., having the mean depth on the order of a few meters), fig. 3. estimate of the a priori range of variation of model parameters as a function of the mean depth of the lake , and regression relationships as determined by toffolon et al. (2014a) analyzing 14 lakes with different morphologies. non -co mmerc ial us e o nly 42 the air2water model: guidelines, challenges, and perspectives the effective volume participating to the heat budget may partially involve lake sediments making the effective volume larger than the mere lake water volume (toffolon et al., 2014a). this possibility is implicitly accounted for in the calibration of model parameters without the need of specifying any additional input information, but simply setting the upper bound of dr to be larger than d (10 m is a reasonable and safe choice). as for the lower bound of dr, experience suggests that a simple option is to linearly vary it from d=1 m for m to 50 m for m, which is certainly a conservative underestimate. in fact, in lake baikal (russia, the world’s deepest lake) d=744 m and 50 m only roughly represents the thickness of the epilimnion during strong thermal stratification (piccolroaz and toffolon, 2013), suggesting that the dr is certainly larger than this value. parameter , which is the phase of the sinusoidal term with amplitude a5 summing up all contributions to the heat budget with the exception of the direct effect of air temperature, simply varies from 0 to 1. parameter a4 controls the intensity of the stratification (thus the volume that is affected by the heat exchange), and, based on practical experience, its possible range of variation can be defined as in fig. 3d. fig. 3 shows the range of variation of all parameters as a function of d, evaluated based on the above considerations and setting the coefficients in equations (a11)(a15) according to typical values that they assume in the temperate region. note that in principle this estimate is coherent with the 6and 8-parameter versions of the model, while in the 4-parameter version the meaning of the parameters is slightly different as parameter a5 is absorbed into parameters a1, a2, and a3. in general, however, experience suggests that the same range of parameters can be safely used for all versions of the model. fig. 3 also shows the relationships between model parameters and lake average depth d as determined by toffolon et al. (2014a) where 14 temperate lakes were analysed which were characterized by significantly different morphologies, using the 4-and 8-parameter versions of the model (here the relationships obtained for the full 8-parameter version are assumed valid also for the 6-parameter version given the strong similarity between the two versions of the models). the regressions between model parameters and are d in tab. 2. from the combined analysis of fig. 3 and tab. 2, two main comments can be made: first, the regression lines are well within the physical a priori ranges of parameters, suggesting that these ranges are properly defined. the only exception is parameter a1 in the 6-parameter version, whose regression line is beneath the lower physical bound for d>300 m. however, for such deep lakes, previous results suggest that this relationship is likely not significant (see e.g., the case of lake baikal in the original paper by toffolon et al., 2014a), and in any case the overall dependence on d is weak. second, and perhaps more important, despite by definition parameters ai,i=1, 2, 3, 5, should depend inversely on depth, the regression lines do not simply scale with d–1 (see e.g., the exponents of the power laws in tab. 1). this is indicative that air2water is able to suitably reproduce the complex thermal behaviour of a lake, by transferring the information contained in the observed data directly to model parameters, which, in turn, have a significant dependence on lake depth. post-calibration analysis the optimal set of parameters resulting from the calibration procedure is required to be well centred within the a priori range of variation, in order to exclude any confinement effect due to bounds that are too narrow. this is expected to always be the case when using the a priori range of parameters discussed in the previous section. however, it is always preferable to perform an a posteriori sensitivity analysis, aimed at excluding the eventuality of parameter ranges that are too narrow and at the same time evaluating parameters’ identifiability and significance. this analysis is easily done producing and analysing the shape of the socalled dotty plot”, which are projections of the measure of model performance (in this case expressed through rmse) obtained after the calibration procedure within the hyperspace of parameters, onto single parameter axes (beven and freer, 2001; see fig. 4 for a schematic). preferably, dotty plots should be obtained using simple random sampling or latin hypercube sampling techniques for model calibration instead of pso, to avoid clustering around the best solution. if a dotty plot is sharp and well defined (as in fig. 4a) it means that the parameter is significant and well identifiable, while if it is flat and scattered (as in fig. 4b) it means that the parameter is not significant or the model is overparameterized. detailed discussions about parameters identifiability of the three versions of the air2water model can be found in piccolroaz et al. (2013) and toffolon et al. (2014a). parameters are well identifiable for all versions of the model (being slightly higher in the 4-parameter version tab. 2. equations of the regression relationships between model parameters and the mean depth of the lake found by toffolon et al. (2014a) analysing 14 lakes with different morphologies, and shown in fig. 3. parameter regression equation 4 parameters 6(8) parameters a1 –0.042+0.017 log (d) 0.488–0.096 log (d) a2 0.223 d–0.635 0.207 d–0.672 a3 0.175 d–0.540 0.262 d–0.659 a4 35.4 d–0.360 31.3 d–0.330 a5 – 0.843 d–0.732 a6 – 0.628–0.030 log (d) non -co mmerc ial us e o nly 43s. piccolroaz due to lower number of parameters), with the only exception of parameters a7 and a8 in the full, 8-parameter version. the main reason is that these parameters are not fully independent, and may produce significant interactions. a more appropriate parameterization of δ during inverse stratification and ice formation periods is currently under development. since a7 generally achieves relatively high values implying δ~1 for tw≤4°c (toffolon et al., 2014a), the following analysis is performed considering only the 4and 6-parameter versions, still retaining full generality. results of the 4and 6-parameter versions of the model for the cases of lakes superior and erie are presented in fig. 5 and fig. 6. in both cases, the calibration of the parameters was performed using two-thirds of the data set (13 years, from 1995 to 2007) and leaving one-third for the validation (7 years, from 2008 to 2014). fig. 5 shows scatterplots for the two lakes and the two versions of air2water during the calibration period. no systematic deviation (bias) is observed, and the dispersion along the diagonal does not exhibit significant trends. both these characteristics are confirmed by the relatively small values of rmse and values of the coefficient of determination (r2) close to one: rmse=1.00°c and r2=0.97 and rmse=0.93°c and r2=0.97 for lake superior (4and 6-parameter versions), and rmse=0.87°c and r2=0.99 and rmse=0.82°c and r2=0.99 for lake erie (same model versions). in figure 6 simulated lst is compared with observations during the validation period, showing close agreement overall. rmses in validation are: 0.90°c and 0.79°c for lake superior (4and 6-parameter versions), and 0.73°c and 0.68°c for lake erie (same model versions). fig. 6 displays the ability of the model to appropriately capture seasonal dynamics and interannual variability. this suggests that air2water is a valuable tool for long-term predictions of lst, in both deep and shallow lakes. the model shows slightly weaker performance in the case of lake superior due to its more complex thermal behaviour, which is significantly controlled by stratification and thermal inertia (piccolroaz et al., 2015a). furthermore, the relative worsening of the 4-parameter version relative to the 6-parameter version is higher in this case (rmse increases by 14% in validation) than in lake erie (rmse increases by 7%). this suggests that the hypotheses at the basis of the derivation of the simplest, 4-parameter version of the air2water model (see methods) are likely to be more appropriate in the case of shallow lakes, and anyway when air and water temperature annual cycles shows a nearly sinusoidal pattern (see methods and fig. 1). effects of missing data on model performance in this section, the effect on model performance of the presence of missing data in the time series of observed lst is analyzed and discussed. in fact, long-term continuous observations of lst are only rarely available, thus often limiting their practical use. for example, in lakes that freeze, offshore monitoring buoys are generally removed during winter to prevent damage from ice. also lst time series retrieved from satellite imagery, which are generally more continuous during the year, may have gaps during periods of cloudiness. finally, the constant and continuous in-situ monitoring of a lake requires sufficient funding and qualified personnel which are not always available, especially over long-term periods. the performance of the air2water model is evaluated by progressively increasing the number of gaps in the lst series, from 10% to 90%, by increments of 10%. percentages of missing data of 95%, 97%, 99%, and 99.5% are also considered, which roughly correspond to the availability of 18, 11 (monthly), 4 (seasonal), and 2 measurements per year, on average. in order to perform a robust statistical analysis, for each of the considered missing data scenarios an ensemble of 100 series of lst is obtained from the original, continuous series of observations, by randomly excluding the correspondent number of data. then, the model is calibrated on the basis of these artificially deteriorated 13-year series of data (1995 to 2007), and validated on the remaining 7-year period (2008 to 2014). in order to allow for a fair and unbiased comparison among model performance obtained for the different scenarios and for the reference (i.e., continuous time series, no gaps) simulation, the validation period is not modified and the same continuous series shown in fig. 6 is used in all cases. results of the analysis for both the 4and the 6-parameter versions of the model are shown in fig. 7. for each scenario, the rmses obtained for the ensemble of simulations are presented through a box plot, where the circle indicates the median value of the distribution. by comparing the median values with the rmses of the reference simulations (continuous lines), it is possible to conclude that, as a general tendency, no degradation of model performance will occur until a data gap of about 50%-60% fig. 4. schematic of (a) a sharp and well defined dotty plot and (b) a flat and scattered dotty plot. each black dot corresponds to one model simulation (one parameter set) and the red dot represents the optimal parameter set. non -co mmerc ial us e o nly 44 the air2water model: guidelines, challenges, and perspectives for the 6-parameter version, and until a data gap of about 70% for the 4-parameter version. in any case the whole box plot is within 10% of the reference value until a data gap of about 90%-95%. when the percentage of the data gap is larger, model performance diminishes, which occurs faster for the 6-parameter version of the model and for the deepest lake. in fact, when the data gap is significantly large the structure of the 6-parameter version of the model may become too complex (i.e., there are too many parameters) relative to the number of observations, thus running the risk of overfitting (vapnik, 1999). this is more evident in deep lakes, which are characterized by more complex thermal dynamics due to the significant role played by stratification and thermal inertia (piccolroaz et al., 2015a). it is possible to conclude that the 6-parameter version of the model is preferable to the 4-parameter version when the amount of missing data is lower than 95% (i.e., when data are available at about bi-weekly resolution, on average). up to 95% missing data, the model still performs reasonably well compared to the reference case when the lst series in calibration is complete. with more than 95% of data missing, the air2water model should be used cautiously, making a case by case assessment evaluating whether results are reasonable compared to the expected behaviour of the lake, and preferring the simplest 4-parameter version. in particular, this version of the model shows acceptable performance until the percentage of missing data reaches about 97% (i.e., when data are available at about monthly resolution, on average), and particularly for the shallow lake erie. as a final remark, note that some boxplots in fig. 6 are partially (and to a minor extent) beneath the reference value of rmse, which indicates that there are a few cases where the optimal set of parameters obtained with a less complete series of lst observations provide slightly better performances in validation. this is likely due to the specific time period considered in the analysis and to the quality of lst observations, and is not explored further here. how length of the calibration period and percentage of missing data affect model performance the analysis presented in the previous section is specific of a 13-year long calibration period, and here it is generalized by considering different lengths of the calibration period, with the aim to provide an overview of the consequences of data scarcity on model performance. the final aim is to provide the user of the air2water model with a criterion to assess whether the observational dataset used for model calibration is sufficiently informative to obtain a reliable calibration or not. the same analysis described above is therefore extended considering different lengths of the calibration period: 1, 2, 3, 5, 8, and 13 years (as a tribute to leonardo fibonacci). in order not to introduce biases in the results, when testing calibration periods shorter than 13 years, the sequences of years are randomly extracted from the original 13-year long series ranging from 1995 to 2007. then, in analogy with the previous analysis, an ensemble of 100 artificially deteriorated series of lst is randomly generated for each combination of percentage of gaps and length of the calibration period. 6 calfig. 5. scatter plot of observed against simulated lst during the calibration period (1995-2007) for (a) lake superior and (b) lake erie, and for the 4and 6parameter versions of the air2water model. non -co mmerc ial us e o nly 45s. piccolroaz ibration period lengths and 9 percentages of missing data are investigated for a total of 54 different combinations (hereafter referred to as scenarios) and 5400 model runs. results are presented in fig. 8, which shows the relative deterioration of each scenario with respect to the best performing case (through the ratio rmsei/min ({rmsei}54 i =1), where rmsei is the median root mean square error of the i-th scenario in validation, and ranges from 1 to 54), for the two lakes and the two versions of the model. results confirm and extend the previous analysis: a larger degradation (in relative terms) of model performance with increasing deterioration of the dataset is observed for the 6-parameter version (and, secondarily, for the deepest lake). in this case, at least 8 years of data with no more than 80% of missing data are required to avoid a worsening of more than 10% from the best scenario, for both lake superior and lake erie. conversely, with the 4-parameter version a calibration period of 2 or 3 years with up to 80% or 90% missing data is sufficient to obtain the same deterioration in model performance (again in relative terms), for lake superior and lake erie, respectively. furthermore, in general, similar model performances can be achieved with a lower number of total observations (i.e., larger percentage of missing data) if the calibration period is longer. in other words, a longer calibration period with fewer measurements may be more informative than a shorter calibration period with more data, suggesting the high value of disposing of a series of data characterized by significant interannual variability. as an example, model performance is roughly the same when fig. 6. comparison between simulated and observed surface water temperature during the validation period (2008–2014) for (a) lake superior and (b) lake erie, and for the 4and 6parameter versions of the air2water model. observed air temperature data are also presented. fig. 7. box plots of rmses values obtained in validation considering different percentages of missing data in the calibration time series of lst, for (a) lake superior and (b) lake erie. the circle indicates the median value of the distributions. for each missing data scenario, an ensemble of 100 artificially deteriorated series of lst is randomly generated. non -co mmerc ial us e o nly 46 the air2water model: guidelines, challenges, and perspectives considering a 13-year long period with 95% of gaps (i.e., 237 valid data) or a 8-year long period with 80% of gaps (i.e., 584 valid data; see fig. 8b). finally, rmsei obtained using the 4-paramters and 6parameters versions of the model are compared for the two lakes, making possible to draw a map of preference (in absolute terms) between the two versions of the model as a function of the different scenarios (see fig. 9). in both cases, the 4-paramters version of the air2water model is more performant, thus it is to be preferred, versus the 6parameter version when the calibration period is shorter than about 5 years, or when it is longer but with more than 97% of gaps. the same considerations about model overfitting discussed in the previous section apply also here. discussion in previous works, piccolroaz et al. (2013, 2015a) and toffolon et al. (2104a) have already demonstrated the high potential of the air2water model as a simple, yet effective, predictive tool for simulating lst when only air temperature data are available. the model is able to properly simulate the hysteresis loop between air and water temperature in both shallow and deep lakes, and to accurately capture seasonal and interannual fluctuations of lst. the model also allows for the simulation of stratification dynamics in lakes, without the need to introduce a complex description of the air-water interface processes fig. 8. air2water model performance (in terms of increasing rmse in validation) as a function of the amount of missing data and calibration period length, for lake superior and lake erie, and for the 4and 6parameter versions. non -co mmerc ial us e o nly 47s. piccolroaz based on a detailed quantification of the single heat flux components. furthermore, it has been successfully applied using different sources of data, as e.g., lst measured at buoys or retrieved from satellite and air temperature from observations or re-analysis, suggesting a high degree of flexibility concerning the possibility to use different types of data as input. this is possible because of the physically-based structure of the model allowing for the acquisition of information about the studied system directly from the data, through the calibration of model parameters. this process is further facilitated given the extreme simplicity of the air2water model, which makes it particularly prone to automatic calibration procedures within a monte carlo-like framework. in this way, model parameters assimilate the information contained in the observations, and in turn the user may learn how the real system behaves from the values of the parameters, identifying what are the most important processes controlling the thermal response of the lake. informativeness of observations is a crucial aspect that should be considered carefully in order to exclude an improper calibration of the model parameters, and an unreliable, or at least uncertain, prediction of lst. this critical detail is addressed in the results section, where air2water model users can find some recommended best practices for a proper use of the model. the simplicity and robustness of the air2water model suggest its possible use in different context and for different purposes, heading towards new challenges: • the investigation of the response of lakes to air temperature variations under climate change scenarios. in this perspective, the air2water model represents a valuable alternative tool to simpler regression models, which require the same data in input but are not able to address some fundamental processes (e.g., the hysteresis cycle between air and water temperature); but also to more complex process-based models, which require a significantly larger amount of input data without showing significantly better performances (see e.g., results in thiery et al., 2014). • the direct coupling with atmospheric circulation and weather forecasting models. recent attempts in this direction have been made adopting complex one-dimensional lake models (e.g., using k-e turbulence model as in goyette and perroud 2012), but have inevitably shown some limitations as e.g., expensive computational cost and the need of ground-truth information. simpler models have also been used to this aim (dating back to hostetler et al., 1993), but in any case requiring the entire set of meteorological data. again, the simplicity, parsimony, and robustness of air2water make it a good candidate for being adopted as a lumped lake model integrated in meteorological models. • the coupling with simple water quality, ecological and biogeochemical modules in order to investigate processes that are significantly controlled by water temperature, as e.g., nutrients, dissolved oxygen, and aquatic ecosystem dynamics. this would be a good opportunity to cross the boundaries (according to toffolon et al., 2014b) between the various disciplines of aquatic science facilitating the dialogue and collaboration between scientists from different background. indeed, fragmentation of limnology into expert, specialised fields, with limited interaction is a wellknown major issue of this branch of science (peters, 1990; lewis, 1995; salmaso and mosello, 2010). • the definition of regionalization relationships between model parameters and morphological characteristics of lakes, with the final aim to apply the model to ungauged lakes. expanding the analysis of toffolon et al. (2014a) that analysed 14 temperate lakes characterized by different morphology, by including additional lakes possibly at different latitudes (e.g., tropical and polar lakes) is particularly interesting. in this regard, the growing availability of collections of lakes’ observational data at the global scale is particularly attractive (e.g., global lake temperature collaboration gltc, sharma et al., 2015; global lake ecological observatory network gleon, weathers et al., 2013), also for testing the air2water model on lakes outside of the temperate zone (e.g., tropical or polar lakes). furthermore, the application of air2water globally may provide interesting insights into how lst in lakes around the world is expected to respond to climate change in the future, possibly identifying some meaningful hotspots as in o’reilly et al. (2015). fig. 9. diagram of preference between the 4and 6parameter versions of the air2water model as a function of the amount of missing data and calibration period length, for lake superior and lake erie. non -co mmerc ial us e o nly 48 the air2water model: guidelines, challenges, and perspectives conclusions the results of this work provide the reader with guidelines and best practices for using the air2water model, as a simple tool to predict lst when only air temperature is available. after having briefly recalled the derivation of the model and the meaning of parameters, the model is used to simulate lst in two lakes characterized by significantly different depths: lake superior and lake erie (usa). these two case studies are chosen as clear and emblematic examples of a deep and a shallow temperate lake characterized by markedly different thermal responses to external forcing, with the aim of making the results of the analysis as much as possible general and comprehensive. the whole analysis is carried out considering the 4and 6-parameter versions of the model. the full, 8-parameter version is not considered here, due to the sub-optimal parameterization of during inverse stratification and ice formation periods, whose improvement is currently under development. in this work, the possible user of the air2water model is provided with all the fundamental information for a proper use of the model: from the initial definition of appropriate a priori range of variations of model parameters to an effective post-processing analysis of results, passing through a sensitivity analysis about the influence of missing data on model performance. particular attention is paid to this last point, which can be summarized as follows: i) longer calibration periods with overall less number of measurements is likely to be more informative than shorter calibration periods with more data (suggesting the high value of disposing of time series with high interannual variability); ii) when the number of missing data increases, model performance diminishes more for the 6-parameter version, suggesting the risk of model overfitting; iii) for short calibration time series (e.g., shorter than about 5 years in this case), the 4-parameter version of the model is likely to be preferable anyway; and iv) as a secondary effect, model performance diminishes more for deeper lakes when data are missing, compared to shallow lakes, due to complex thermal behaviour that is chiefly influenced by lake depth. coherently with one of the main goals of this work, which is to foster the dialogue among the several branches of aquatic science, a flowchart of the main modelling steps is shown in fig. 10, which is intended to make the sequence of the operational phases at the basis of the use of air2water clearer and easier to follow also to users with different mathematical and/or technical backgrounds. indeed, the air2water model has been developed with the clear intention to offer a simple tool that can indifferently be used by physicists and biologists, modellers and experimentalists, possibly generating new collaborations towards an integrated understanding of how lst responds to climate forcing and what are the effects on the ecological status of the lake. in this perspective, everyone that is interested can collaborate to improve the model with comments, suggestions and contributions, which are highly welcomed and easy to share through https://github.com/spiccolroaz/air2water. acknowledgments the author is grateful to marco toffolon for discussions on an earlier version of the manuscript, to elisa calamita for preliminary analysis of the data, and to ulrike obertegger (edmund mach foundation, italy) for rewriting the post-processing script in r (available on https://github. com/spiccolroaz/air2water). the author is also thankful to noaa (national oceanic and atmospheric administration) for lst data used in this work (data can be downloaded from http://www.glerl.noaa.gov/glsea/asc_1024/) fig. 10. flowchart of the main modelling steps: input data, definition of the a priori ranges of model parameters, run of air2water within a monte carlo optimization framework, results. for a more detailed description of how to use the model, please refer to the file readme.txt in https://github.com/spiccolroaz/air2water. non -co mmerc ial us e o nly 49s. piccolroaz and to ecmwf (european centre for medium-range weather forecasts) for daily air temperature (data can be downloaded from http://apps.ecmwf.int/datasets/data/interim-full-daily/levtype=sfc/). finally, the author thanks the two anonymous reviewers for their constructive comments, which helped to improve the manuscript. references adrian r, o’reilly cm, zagarese h, baines sb, hessen do, keller w, livingstone dm, sommaruga r, straile, d, van donk e, weyhenmeyer ga, winder m, 2009. lakes as sentinels of climate change. limnol. oceanogr. 54:2283-2297. beven k, freer j, 2001. a dynamic topmodel. hydrol. process. 15:1992-2011 butcher jc, 2008. numerical methods for ordinary differential equations. 2nd ed. j. wiley & sons, london. butcher jb, nover d, johnson te, clark cm, 2015. sensitivity of lake thermal and mixing dynamics to climate change. climatic change. 129:295-305. de senerpont domis ln, elser jj, gsell as, huszar vlm, ibelings bw, jeppesen e, kosten s, mooij wm, roland f, sommer u, van donk e, winder m, lürling m, 2013. plankton dynamics under different climatic conditions in space and time. freshwater biol. 58:463-482. flaim g, obertegger u, anesi a, guella g, 2014. temperatureinduced changes in lipid biomarkers and mycosporine-like amino acids in the psychrophilic dinoflagellate peridinium aciculiferum. freshwater biol. 59:985-997. gallina n, salmaso n, morabito g, beniston m, 2013. phytoplankton configuration in six deep lakes in the peri-alpine region: are the key drivers related to eutrophication and climate? aquat. ecol. 47:177-193. gill mk, kaheil yh, khalil a, mckee m, bastidas l, 2006. multiobjective particle swarm optimization for parameter estimation in hydrology. water resour. res. 42:w07417. goyette s, perroud m, 2012. interfacing a onedimensional lake model with a single-column atmospheric model: application to the deep lake geneva, switzerland. water resour. res. 48:w04507. gupta hv, kling h, yilmaz kk, martinez gf, 2009. decomposition of the mean squared error and nse performance criteria: implications for improving hydrological modelling. j. hydrol. 377:80-91. hostetler sw, bates gt, giorgi f, 1993. interactive coupling of a lake thermal model with a regional climate model. j. geophys. res. 98:5045-5057. kennedy j, eberhart r, 1995. particle swarm optimization, p. 1942-1948. proc. ieee int. conf. on neural networks, university of western australia, perth, australia. kettle h, anderson rtnj, livingstone dm, 2004. empirical modeling of summer lake surface temperatures in southwest greenland. limnol. oceanogr. 49:271-282. lewis wm, 1995. limnology, as seen by limnologists. j. contemp. water res. educ. 98:4-8. livingstone dm, lotter af, 1998. the relationship between air and water temperatures in lakes of the swiss plateau: a case study with palaeolimnological implications. j. paleolimnol. 19:181-198. livingstone dm, padisák j, 2007. large-scale coherence in the response of lake surface-water temperatures to synopticscale climate forcing during summer. limnol. oceanogr. 52:896-902. martin jl, mccutcheon s, 1998. hydrodynamics and transport for water quality modeling. crc press. martynov a, sushama l, laprise r, 2010. simulation of temperate freezing lakes by one-dimensional lake models: performance assessment for interactive coupling with regional climate models. boreal environ. res. 15:143-164. mccombie am, 1959. some relations between air temperatures and the surface water temperatures of lakes. limnol. oceanogr. 4:252-258. mckay md, beckman rj, conover wj, 1979. a comparison of three methods for selecting values of input variables in the analysis of output from a computer code. technometrics. 21:239-245. nash je, sutcliffe jv, 1970. river flow forecasting through conceptual models 1. a discussion of principles. j. hydrol. 10: 282-290. o’reilly cm, sharma s, gray dk, hampton se, read js, rowley rj, schneider p, lenters jd, mcintyre pb, kraemer bm, weyhenmeyer ga, straile, d, dong b, adrian r, allan mg, anneville o, arvola l, austin j, bailey jl, baron js, brookes jd, de eyto e, dokulil mt, hamilton dp, havens k, hetherington al, higgins sn, hook s, izmest’eva lr, joehnk kd, kangur k, kasprzak p, kumagai m, kuusisto e, leshkevich g, livingstone dm, macintyre s, may l, melack jm, mueller-navarra dc, naumenko m, noges p, noges t, north rp, plisnier pd, rigosi a, rimmer a, rogora m, rudstam lg, rusak ja, salmaso n, samal nr, schindler de, schladow sg, schmid m, schmidt sr, silow e, soylu me, teubner k, verburg p, voutilainen a,watkinson a, williamson ce, zhang g, 2015. rapid and highly variable warming of lake surface waters around the globe. geophys. res. lett. 42:773-781. perroud ms, goyette s, martynov a, beniston m, anneville o, 2009. simulation of multiannual thermal profiles in deep lake geneva: a comparison of one-dimensional lake models. limnol. oceanogr. 54:1574-1594. peters rh, 1990. pathologies in limnology. mem. ist. ital. idrobiol. 47:181-217. piccolroaz s, toffolon m, 2013. deep water renewal in lake baikal: a model for long term analyses. j. geophys. res.oceans 118:6717-6733. piccolroaz s, toffolon m, majone b, 2013. a simple lumped model to convert air temperature into surface water temperature in lakes. hydrol. earth syst. sci. 17:3323-3338. piccolroaz s, toffolon m, majone b, 2015a. the role of stratification on lakes’ thermal response: the case of lake superior. water resour. res. 51:7270-7288. piccolroaz s, majone b, palmieri f, cassiani g, bellin a, 2015b. on the use of spatially distributed, time-lapse microgravity surveys to inform hydrological modeling, water resour. res. 51:7878-7894. salmaso n, mosello r, 2010. limnological research in the deep southern subalpine lakes: synthesis, directions and perspectives. adv. oceanogr. limnol. 1:29-66. schabhüttl s, hingsamer p, weigelhofer g, hein t, weigert a, striebel m, 2013. temperature and species richness effects non -co mmerc ial us e o nly 50 the air2water model: guidelines, challenges, and perspectives in phytoplankton communities. oecologia 171:527-536. sharma s, walker sc, jackson da, 2008. empirical modelling of lake water-temperature relationships: a comparison of approaches. freshwater biol. 53:897-911. sharma s, gray dk, read js, o’reilly cm, schneider p, qudrat a, gries c, stefanoff s, hampton se, hook s, lenters jd, livingstone dm, mcintyre pb, adrian r, allan mg, anneville o, arvola l, austin j, bailey j, baron js, brookes j, chen y, daly r, dokulil m, dong b, ewing k, de eyto e, hamilton dp, havens k, haydon s, hetzenauer h, heneberry j, hetherington al, higgins sn, hixson e, izmest’eva lr, jones bm, kangur k, kasprzak p, köster o, kraemer bm, kumagai m, kuusisto e, leshkevich g, may l, macintyre s, müller-navarra d, naumenko m, noges p, noges t, niederhauser p, north rp, paterson am, plisnier pd, rigosi a, rimmer a, rogora m, rudstam l, rusak ja, salmaso n, samal nr, schindler de, schladow g, schmidt sr, schultz t, silow ea, straile d, teubner k, verburg p, voutilainen a, watkinson a, weyhenmeyer ga, williamson ce, woo kh, 2015. a global database of lake surface temperatures collected by in situ and satellite methods from 1985-2009. sci. data 2:150008. thiery w, stepanenko vm, fang x, jöhnk kd, li z, martynov a, perroud m, subin, zm, darchambeau f, mironov d, van lipzig npm., 2014. lakemip kivu: evaluating the representation of a large, deep tropical lake by a set of 1-dimensional lake models. tellus ser. a 66:21390. toffolon m, piccolroaz s, majone b, soja am, peeters f, schmid m, wüest a, 2014a. prediction of surface water temperature from air temperature in lakes with different morphology, limnol. oceanogr. 59:2185-2202. toffolon m, piccolroaz s, bouffard d, 2014b. crossing the boundaries of physical limnology. eos 95:403. vapnik vn, 1999. an overview of statistical learning theory. ieee t. neural network 10:988-999. weathers kc, hanson pc, arzberger p, brentrup j, brookes jd, carey cc, gaiser e, hamilton dp, hong gs, ibelings bw, istvánovics v, jennings e, kim b, kratz tk, lin f-p, muraoka k, o’reilly c, piccolo mc, rose kc, ryder e, zhu g, 2013. the global lake ecological observatory network (gleon): the evolution of grassroots network science. bull. limnol. oceanogr. 22:71-73. webb ms, 1974. surface temperatures of lake erie. water resour. res. 10:199-210. wetzel rg, 2001. limnology: lake and river ecosystems. 3rd ed. academic press. winder m, sommer u, 2012. phytoplankton response to a changing climate. hydrobiologia 698:5-16. non -co mmerc ial us e o nly layout 1 introduction habitat complexity is defined as the heterogeneity in the arrangement of physical structure in the habitat surveyed (sensu lassau and hochuli, 2004) and it represents one among the most important ecological factor in shaping structure and community dynamics. among others, it influences fish abundance, diversity in terms of species richness and composition (jones, 1988; bell and galzin, 1984; roberts and ormond, 1987; bell et al., 1991; hixon and beets, 1993; warfe and barmuta, 2004; harvey et al., 2005; willis et al., 2005; mangano et al., 2017). a particular relationship has been reported for several natural environments between the habitat complexity and animal community structure or assemblage compositions (i.e. both numbers of individuals and numbers of species; luckhurst and luckhurst, 1978; roberts and ormond, 1987; mcclanahan, 1994; mccormick, 1994; öhman and rajasuriya, 1998; gratwicke and speight, 2005; garcia charton and pérez ruzafa, 2008; porporato et al., 2014; mangano et al., 2015). the main mechanism invoked to explain it, is a reduction of predation pressure due to the increased amount of refuge available to prey species (hixon and beets, 1993; macpherson, 1994; caley and st. john, 1996; almany, 2004a). increase in available refuges due to enhanced substrate topography also has been shown to reduce competition for space (hixon and menge, 1991; almany, 2004b) as well as adding to niche dimensionality (macarthur and levins, 1967), both of which potentially increase fish abundance and distribution. the same pattern among spatial complexity, fish abundance and species richness has also been reported for artificial habitats such as, for instance, extractive platforms (chang et al., 1977; higo et al., 1980; buckley, 1982; shulman, 1984; chandler et al., 1985; roberts and ormond, 1987; gorham and alevizon, 1989; hixon and beets, 1989; bohnsack et al., 1991; love and york, 2006). surprisingly, the largest amount of these evidence has been collected outside the mediterranean sea, where in spite of the large number of oil and gas extractive platforms, this aspect is still poorly studied (fabi et al., 2002, 2004; consoli et al., 2007, 2013; andaloro et al., 2011, 2012; scarcella et al., 2011; mangano and sarà, 2017). the extraction of fossil fuels from offshore fields has strongly increased over the last decades to meet the global growing demand for energy (ghisel, 1997; terlizzi et al., 2008), this implies that the number of offshore platforms has increased the world over and, most probably, it will further increase in the future (de luca, 1999; pulsipher and daniel, 2000). advances in oceanography and limnology, 2018; 9(2): 59-67 article doi: 10.4081/aiol.2018.7918 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). the influence of habitat complexity on fish assemblages associated with extractive platforms in the central mediterranean sea pierpaolo consoli,1 maria cristina mangano,2* gianluca sarà,2 teresa romeo,1,3 franco andaloro1 1stazione zoologica anton dohrn, centro interdipartimentale della sicilia, milazzo (me); 2department of earth and marine sciences, university of palermo; 3institute for environmental protection and research (ispra), bio-cit, palermo, italy *corresponding author: mariacristina.mangano@gmail.com abstract in this work the influence of habitat complexity on fish assemblages associated with extractive platforms in the mediterranean sea was investigated. more specifically, at large spatial scale we tested the differences in fish assemblage between 4-legs vs 8-legs platforms, whereas at medium scale we evaluated, within each platform, the differences between internal structures with increasing complexity degrees (respectively: the water volume without any pillar complexity “0”; the junction of two pillars “1”; the junction of four pillars “2”). both univariate and multivariate analyses showed highly significant differences for each of the tested factors, as well as for their interaction. in general, at both medium and large spatial scales, mean species richness and abundance were positively correlated with the increasing habitat complexity with the highest values associated with 8-legs platforms and with the most complex internal structures within each platform. according to our findings, a more complex structure is able to attract more fish species and specimens than a less complex one, supporting previous studies carried out on different man-made structures outside the mediterranean sea. the study will integrate the still poor available knowledge baseline on the attractive potential of extractive platforms with strong implications for the environmental management under the incoming light of decommission in the basin. key words: artificial habitat; underwater visual census; gas platform; species richness. received: november 2018. accepted: november 2018. non -co mmerc ial us e o nly p. consoli et al.60 then, understanding the role played by offshore platforms in shaping multi-level marine ecosystem’s dynamics is becoming pressing as offshore platforms are acquiring increasing importance worldwide for its implications on marine biodiversity (mangano and sarà, 2017). the aim of the present study was to evaluate the influence of habitat complexity on fish assemblages associated with extractive platforms in the ionian sea (mediterranean sea). the obtained outcomes integrate the still poor available knowledge baseline on the attractive potential of these human-made structures with interesting rebounds for the environmental management in a context foreseen of decommission in the basin. in doing so, we tested whether different complexity degrees affected the associated fish assemblages across two different spatial scales. accordingly, 1) we tested the difference in fish assemblage at large scale (̴ 10 km) between two different levels of complexity (4-legs vs 8-legs platforms) and 2), at medium scale (̴ 100 m) testing the difference in fish assemblage between internal structures, of such platforms, with different spatial complexity. methods study sites the study was carried out during one week in may 2006 at three offshore gas platforms (luna a, luna b and hera lacinia) located in the southern ionian sea (central mediterranean sea) respectively, 5.3, 6.2 and 2.6 km offshore (fig. 1). two of them (luna a and luna b) were 8-leg platforms while the third one (h. lacinia) was a 4leg platform. all these platforms lie on a sandy seabed and are fixed to the sea floor by concrete or steel legs, which are connected by an assemblage of cross beams. the platforms were colonized by several foulers that generally provide crevices, refuges and food to cryptic and nekto-benthic fish species. the most abundant sessile species was the bivalve mytilus galloprovincialis followed by balanids, ostrea sp., and arbacia lixula (p. consoli, personal observation). habitat complexity for each of the three platforms, internal structures with increasing complexity degrees (hereafter complexity 0, 1 and 2; fig. 2), were identified and corresponded to: 0=the water volume without any pillar; 1=the junction of two pillars; and 2=the junction of four pillars, respectively. fish species and their abundances were recorded by underwater visual censuses (uvc) by deploying the “mobile point count” (mpc) technique performed at a depth between 0 and 12 meters. this technique, specifically designed for offshore platforms by rilov and benayahu (2000) and applied by consoli et al. (2007, 2013) and andaloro et al. (2011, 2012) in the mediterranean sea, was chosen as it is highly reliable in studying species strictly associated with the pillars and to detect benthic and cryptic species (andaloro et al., 2011, 2012; consoli et al., 2007, 2013). the diver, turning around each unit and looking at towards the pillar, counted all fishes occurring up to 3 m from the pillar. first, the diver recorded the more conspicuous and easily identifiable fishes from a maximum distance of 3 meters from the pillar (so that to have an entire view of the census unit) and then straight after, approached to the pillar, and counted the benthic and crypto-benthic species. the total censused volume for complexity 0 corresponded to a cylinder of 7 m of diameter and 6 m height (~231 m3). as regard complexity 1 and 2, the censused water volume was obtained subtracting the volume of the pillars (1 m of diameter) from 231 m3. the resulting volumes for complexities 1 and 2 were 224 and 219 m3, respectively. as a main consequence, data of abundance were standardized to the maximum censused volume (231 m3) in order to compare censuses performed next to the different spatial complexity structures. fortyfig. 1. study area located in the ionian sea off crotone (calabria, italy). non -co mmerc ial us e o nly the influence of habitat complexity on fish assemblages associated with extractive platforms in the central mediterranean sea 61 eight censuses were performed for each level of medium scale complexity at each platform, leading to a total of 432 observations in the data set. statistical analyses the sampling design included 2 factors: i) large scale complexity (lsc) was a fixed factor in the analysis with 2 levels of large-scale complexities (as expressed by: 4-leg and 8-leg platforms). ii) medium scale complexity (msc) was a fixed factor in the analysis with 3 levels: complexity 0, 1 and 2 according to the rationale presented before and represented in fig. 2. on this basis, a two-ways permutational analysis of variance (permanova; anderson, 2001, mcardle and anderson, 2001) was performed on abundance data to test the null hypothesis of no significant differences between fish assemblages associated with increasing habitat complexities, at two different spatial scales. the analysis was based on bray-curtis dissimilarities, calculated on log-transformed fish assemblage matrix. each term of the analysis was tested using 9999 random permutations of appropriate units (anderson and ter braak, 2003). significant terms that were relevant to our hypothesis were investigated using a posteriori pair-wise comparison with the permanova t-statistic and 9999 permutations. furthermore, we tested the effect of response variables on community metrics and in doing so, we modelled overall fish abundance and species richness through a permutational univariate analyses of variance (permanova; anderson, 2001; mcardle and anderson, 2001). here we used the euclidean distance instead the bray-curtis similarity index. thus, the same f-statistics were calculated, but p-values were obtained by permutation. finally, the simper similarity percentage procedure (clarke, 1993) was used to identify the fish species that most contributed to the differences among spatial complexities at medium and large spatial scale. all the analyses were performed using primer 6 software package with permanova+add-on (anderson et al., 2008). results in tab. 1 mean abundances and standard errors of each species are showed for lsc and msc factors. overall 15 fish taxa belonging to 6 families were recorded in the study area. most of the recorded species were nektobenthonic, while only 5 pelagic species were observed. in term of species richness, sparids were the most important family being represented by six species whereas the most abundant species were boops boops, anthias anthias and chromis chromis. permanova of the total fish assemblage (abundance data) showed highly significant differences for each factor considered in the analysis (tab. 2) and also for the interaction between factors lsc and msc (permanova, p=0.001). furthermore, pairwise comparisons showed that significant differences occurred between fish assemblages in every msc comparisons within each lsc level (p<0.001). the greatest t-values were observed between msc 0-level and 2-level at both 4and 8-legs platforms (t=3.85 and t=5.26, respectively; tab. 2). permanova on overall abundance and species richness mirrored the results of multivariate analysis (tab. 2). according to the large-scale complexity, the highest values of both metrics were associated with 8-legs platforms (s=2.62 and 1.58, n=237 and 56, respectively at 8-legs and 4-legs platforms; fig. 3). fig. 2. internal structures with increasing degrees of complexity; identified and corresponded to: 0=the water volume without any pillar; 1=the junction of two pillars; and 2=the junction of four pillars, respectively. non -co mmerc ial us e o nly p. consoli et al.62 as regards mean species richness, significant differences were found, at each platform, among msc levels (tab. 2) and the highest values were always associated with structures of compl 2 (fig. 3; tab. 2). looking at the t value, the greatest differences occurred between complexity 0 2 (t=17.747 and t=9.7555, at 8legs and 4-legs platforms, respectively, tab. 2). a similar pattern was observed, at 8-legs platforms, also for the mean abundance, whereas, at the 4-legs platform, the highest value was associated with level 0 of msc (compl 0; fig. 3). simper procedure pinpointed some fish taxa as the major contributors to the dissimilarities among spatial complexities. high densities of boops boops, anthias anthias and chromis chromis characterized the censuses carried out nearby the most complex structures, both at large and medium spatial scale (tab. 3). discussion fish assemblages associated with increasing habitat complexities showed differences in terms of species richness, abundance and assemblages structure. this tab. 1.mean species abundances and standard errors (± se) per sample unit (230.91 m3) for each level (compl 0, 1 and 2) of complexity factors at 4-legs vs 8-legs platforms. platform ecological lsc 4-legs 8-legs complexity category msc compl 0 compl 1 compl 2 compl 0 compl 1 compl 2 mean se mean se mean se mean se mean se mean se anthias anthias nb 31.53 11.85 86.14 14.39 187.00 21.95 boops boops p 30.00 6.99 24.54 8.88 23.84 6.29 31.31 7.04 56.85 11.60 137.29 19.23 chromis chromis nb 0.42 0.42 1.83 0.62 18.90 5.21 5.81 1.78 18.77 3.05 57.75 7.92 diplodus sargus nb 0.07 0.04 0.01 0.01 0.01 0.01 diplodus vulgaris nb 0.02 0.02 0.51 0.16 0.94 0.38 0.82 0.31 1.01 0.22 oblada melanura p 0.94 0.59 0.09 0.09 0.81 0.46 13.69 4.10 0.43 0.43 0.92 0.83 sarpa salpa nb 0.04 0.04 0.01 0.01 seriola dumerili p 0.02 0.02 serranus cabrilla nb 0.02 0.02 0.11 0.06 0.01 0.01 serranus scriba nb 0.02 0.02 spicara flexuosa p 26.15 9.12 13.00 5.17 14.06 5.92 4.24 1.39 13.58 5.48 32.69 7.91 spondyliosoma cantharus nb 0.02 0.01 0.02 0.02 0.10 0.04 thalassoma pavo nb 1.35 0.48 1.74 0.46 0.01 0.01 2.74 0.59 10.98 1.42 trachurus spp. p 9.38 4.25 0.86 0.60 0.44 0.44 1.77 1.12 1.92 1.15 13.44 6.66 lsc, large scale complexity; msc, medium scale complexity; nb, necto-benthonic; p, pelagic. tab. 2.results of permanova tests analysing the effect of lsc and msc factors on fish assemblage (multivariate test), species richness and fish abundance (univariate tests). results of pair-wise tests performed for the interaction factor “lsc x msc” are also reported. source fish assemblage species richness abundance df ms f p ms f p ms f p lsc 1 75,363 4.0051 0.002 102.78 50.627 0.001 3.14e+06 54.959 0.001 msc 2 52,279 16.826 0.001 133.95 113.99 0.001 2.15e+06 25.179 0.001 lsc x msc 2 18,817 6.0562 0.001 10.616 9.0341 0.001 2.14e+06 25.024 0.001 res 426 3107 1.1751 1.82e+07 8-legs platforms t p t p t p compl 0. compl 1 3.8476 0.001 10.934 0.001 3.9496 0.001 compl 0. compl 2 5.2578 0.001 17.747 0.001 9.1615 0.001 compl 1. compl 2 2.754 0.001 5.2947 0.001 6.3641 0.001 4-legs platforms compl 0. compl 1 2.3831 0.001 2.8711 0.001 1.2443 0.226 compl 0. compl 2 3.8503 0.001 9.7555 0.001 0.31125 0.772 compl 1. compl 2 1.8512 0.009 3.9344 0.001 0.95222 0.349 df, degree of freedom; lsc, large scale complexity; msc, medium scale complexity. non -co mmerc ial us e o nly the influence of habitat complexity on fish assemblages associated with extractive platforms in the central mediterranean sea 63 result was observed at both investigated spatial scales. in particular, as far as medium spatial scale is concerned, a positive relationship was observed between increasing habitat complexity and mean species richness at both levels of large spatial complexity (4and 8-legs platforms). the same pattern was detected for mean fish abundance at the most complex platforms, while at 4-legs platform, a clear pattern was not observed since the highest values were not associated with the most complex internal structures. in this less complex platform, internal structure, corresponding to different degree of medium spatial scale complexities, are usually closer to each other compared with those at 8-legs platforms. then, fishes probably, could not be able to distinguish these different degrees of spatial complexities. mean fish abundance and species richness resulted positively correlated with increasing complexities also at large spatial scale. these results strengthen and confirm observations made in previous studies carried out on different man-made structures such as artificial reefs (roberts and ormond ,1987; hixon and beets, 1989; chang et al., 1977; higo et al., 1980; buckley, 1982; gorham and alevizon, 1989; bohnsack et al., 1991; charbonnel et al., 2002, gratwicke and speight, 2005), fringing reef (roberts and ormond 1987), shipwrecks (chandler et al., 1985; fagundes-netto et al., 2011; consoli et al., 2015) and extractive platforms (love et al., 2003, 2010, 2012; love and york, 2006; rilov and benayahu, 1998, 2000, 2002; rooker et al., 1997; consoli et al., 2013). all these studies proved a positive relationship between fish species-richness/abundance and the increasing habitat complexity. after all, it is well known that these artificial habitats promote the aggregation of fishes that would otherwise be dispersed across larger areas of the ocean, a result of peculiar interest in the mediterranean basin, locally characterized by a very peculiar hydrodynamic system (hastings et al., 1976; aabel et al., 1977; driessen, 1985; gallaway et al., 1981; bohnsack and sutherland, 1985; love and westphal, 1990; bull and kendall, 1994; kasprzak, 1998; minton and heath, 1998; jørgensen et al., 2002; løkkeborg et al., 2002; love et al., 2003; love and york, 2006; andaloro et al., 2011, 2012; consoli et al., 2007, 2013; capodici et al., 2018). in particular, as regard extractive platforms, as these structures extend throughout the entire water column, their effects are not confined to demersal fishes, but also involve pelagic species that congregate about them, attracted either by the solid reeflike nature of the supporting structures, or by the numerous smaller forage organisms in the area (bombace et al., 1999, fabi et al., 2002, relini et al., 1976, stanley and wilson, 1991). the reason is that fishes use these artificial structures, for shelter, feeding, spawning, and orientation (kojima, 1956; hunter and mitchell, 1967; gooding and magnuson, 1967; luckhurst and luckhurst, 1978; kakimoto, 1982; ogawa, 1982; steimle and ogren, 1982; yoshimuda, 1982; kellison and sedberry, 1998; rilov and fig. 3.mean number of species and specimens for each combination of levels of factor msc within each level of lsc. bars represent standard errors. non -co mmerc ial us e o nly p. consoli et al.64 benayahu, 1998; caselle et al., 2002; castriota et al., 2011; fabi et al., 2006; leitão et al., 2007). indeed, extractive platforms can furnish shelter for protection from predation, additional food supply and spawning substrate, and can act as a visual attractant for organisms not strictly dependent on hard bottoms (fabi et al., 1998). then, according to these findings, a more complex structure is able to attract more fish species and specimens than a less complex one. in particular, what we observed is that most of the pelagic and demersal fishes were particularly abundant where cross beams and vertical beams cross each other. at these junctions, there is a greater available surface that species such as c. chromis, a. anthias and b. boops use like shelter in case of strong tab. 3. simper of the fish taxa contributing most (%) to the dissimilarity, on large spatial scale, between 4-legs vs 8-legs platforms and, on medium scale, among internal structures with increasing complexity degrees (compl 0, 1 and 2). 4-legs vs 8-legs average dissimilarity=83.26 8-legs 4-legs taxa av. abund. av. abund. contribution % boops boops 5.24 2.84 29.94 anthias anthias 6.1 0 24.29 chromis chromis 3.26 1.29 15.28 spicara flexuosa 1.55 1.7 12.07 thalassoma pavo 1.24 0.53 6.57 oblada melanura 0.52 0.19 4.9 compl 0 compl 1 average dissimilarity=86.06 compl 0 compl 1 taxa av. abund. av. abund. contribution % boops boops 3.2 3.91 28.1 anthias anthias 1.14 4.1 23.82 chromis chromis 0.65 2.25 17.02 spicara flexuosa 1.26 1.36 10.11 thalassoma pavo 0.01 0.93 9.39 oblada melanura 0.98 0.06 5.74 compl 0 compl 2 average dissimilarity=87.07 compl 0 compl 2 taxa av. abund. av. abund. contribution % anthias anthias 1.14 6.96 24.31 boops boops 3.2 6.21 23.41 chromis chromis 0.65 4.9 21.04 thalassoma pavo 0.01 2.07 11.68 spicara flexuosa 1.26 2.19 8.49 oblada melanura 0.98 0.19 4.93 compl 1 compl 2 average dissimilarity=68.01 compl 1 compl 2 taxa av. abund. av. abund. contribution % boops boops 3.91 6.21 25.96 anthias anthias 4.1 6.96 25.08 chromis chromis 2.25 4.9 20.63 thalassoma pavo 0.93 2.07 10.91 spicara flexuosa 1.36 2.19 9.32 av. abund., average abundance. non -co mmerc ial us e o nly the influence of habitat complexity on fish assemblages associated with extractive platforms in the central mediterranean sea 65 currents. c. chromis and a. anthias also use junctions as refuges where to lay eggs: obviously in these places they can better defence the nest from the aggregation of thalassoma pavo specimens, which frequently attacked and destroyed the benthic nests of these two species. moreover, at medium spatial scale, more complex structures provide shelter from predation and current for juvenile and adult fishes: in fact, in case of strong water current many fish species were observed to take refuge on the undercurrent side of these more complex structures. once an industrial decision is made to cease oil and gas production, managers must decide what to do with the structure, a process known as decommissioning and over which a huge debate is animating both scientific communities, stakeholder and common opinion from scientific literature to media (jørgensen et al., 2002; love et al., 2003; schroeder et al., 2004; mangano and sarà, 2017; lucifredi, 2018). the process of decommissioning can be addressed in many ways, from the leaving most part of the structures in place to complete removal. oil and gas platforms have finite economic lives and in the next few decades, several platforms in mediterranean sea will be decommissioned being nearing the end of their economic lives. management decisions regarding the decommissioning of oil and gas platforms will be based on both biological and socioeconomic knowledge baseline (mangano and sarà, 2018), which are essential in evaluating the efficacy of any potential rigs-to-reef program. conclusions the present results could bear strong implications for the environmental management of decommissioned platforms in this basin because the possibility of knowing the attractive potential of an extractive platform could be an important issue in the decommissioning process aiding legislators and resource managers. moreover, further comparative, long-term and at larger spatial scale, studies should be funded in other mediterranean gas/oil platforms, in order to investigate specific cases and propose to maintain a platform rather than another at the end of its life and then lunch a rig-to-reef program enhancing fishery production. apart from the international recommendation on decommissioning options, (i.e. once the topside is removed total removal, partial removal, leave in place; ospar 1982, hamzah 2003) and some case studies from the north seas in a european context (e.g. the indefatigable – inde – field platforms decommissioning project), no specific regulation on decommissioning are prescribed in italy (legislative decree no 257/2016). under the light of the existing literature (mangano and sarà, 2017) future multi-criteria analysis for decommissioning options selection might take into account looking for potential alternative use (e.g. energy production), scientific (e.g. artificial reef monitoring) commercial (e.g. aquaculture, tourism and recreation) and multipurpose (all the above). references aabel jp, cripps s, kjeilen g, 1997. oil and gas production structures as artificial reefs, p. 391-404. in: a.c. jensen (ed.), proceedings of the 1st earrn conference, ancona, italy. european artificial reef research. southampton oceanography centre press, southampton. almany gr, 2004a. differential effects of habitat complexity, predators and competitors on abundance of juvenile and adult coral reef fishes. oecologia 141:105-113. almany gr, 2004b. does increased habitat complexity reduce predation and competition in coral reef fish assemblages? oikos 106:275-284. andaloro f, castriota l, ferraro m, romeo t, sarà g, consoli p, 2011. evaluating fish assemblages associated with gas platforms: evidence from visual census techniques and experimental fishing surveys. cienc. mar. 37:1-9. andaloro f, ferraro m, mostarda e, romeo t, consoli p, 2012. assessing the suitability of a remotely operated vehicle (rov) to study the fish community associated with offshore gas platforms in the ionian sea: a comparative analysis with underwater visual censuses (uvcs). helgoland mar. res. 67:241-250. anderson mj, 2001. a new method for non-parametric multivariate analysis of variance. austral ecology 26:32-46. anderson mj, gorley rn, clarke kr, 2008. permanova+ for primer: guide to software and statistical methods. plymouth, uk: primer-e. anderson mj, ter braak cjf, 2003. permutation tests for multifactorial analysis of variance. j. stat. comput. sim. 73: 85-113. bell jd, r galzin, 1984. influence of live coral cover on coral reef fish communities. mar. ecol. prog. ser. 15:265-274. bell ss, mccoy ed, mushinsky hr, 1991. habitat structure: the physical arrangement of objects in space. chapman and hall, london. bombace g, fabi f, rivas g, 1999. effetti sul popolamento ittico indotti da una piattaforma estrattiva dell’alto adriatico: prospettive di gestione delle risorse costiere. biol. mar. medit. 6:64-72. bohnsack ja, johnson dl, ambrose rf 1991. ecology of artificial reef habitats and fishes, p. 61-107. in: w, seaman jr and l.m. sprague (eds.), artificial habitats for marine and freshwater fisheries. academic press, san diego. bohnsack ja, sutherland dl, 1985. artificial reef research: a review with recommendations for future priorities. bull. mar. sci. 37:, 11-39. buckley rm 1982. marine habitat enhancement and urban recreational fishing in washington. mar. fish. rev. 44:28-37. bull as, kendall jj jr, 1994. an indication of the process: offshore platforms as artificial reefs in the gulf of mexico. bull mar sci 55: 1086-1098. caley mj, st. john j, 1996. refuge availability structures assemblages of tropical reef fishes. j. anim. ecol. 65:414-428. caselle je, love ms, fusaro c, schroeder d, 2002. trash or non -co mmerc ial us e o nly p. consoli et al.66 habitat? fish assemblages on offshore oilfield seafloor debris in the santa barbara channel, california. ices j. mar. sci. 59:258-265. castriota c, falautano m, finoia mg, consoli p, pedà c, esposito v, battaglia p, andaloro f. 2011. trophic relationships among scorpaeniform fishes associated with gas platforms. helgoland mar. res. 66:401-411. chandler cr, sanders rm jr, landry am jr, 1985. effects of three substrate variables on two artificial reef fish communities. bull. mar. sci. 37:129-142. chang k, lee sc, shao kt, 1977. evaluation of artificial reef efficiency based on the studies of model reef fish community installed in northern taiwan. bull. inst. zool. acad. sin. 16:23-36. charbonnel e, serre c, ruitton s, harmelin jg, jensen a, 2002. effects of increase habitat complexity on fish assemblages associated with large artificial reef units (french mediterranean coast). ices j. mar. sci. 59:208-213. clarke kr, 1993. non-parametric multivariate analyses of changes in community structure. aust. j. ecol. 18:117-143. capodici f, ciraolo g, cosoli s, maltese a, mangano mc, sarà g, 2018. downscaling hydrodynamics features to depict causes of major productivity of sicilian-maltese area and implications for resource management. sci. total environ. 628:815-825. consoli p, azzurro e, sarà g, ferraro m, andaloro f, 2007. fish diversity associated to gas platforms: evaluation of two underwater visual census. cienc. mar. 33:121-132. consoli p, martino a, romeo t, sinopoli m, perzia p, canese s, vivona p, andaloro f, 2015. the effect of shipwrecks on associated fish assemblages in the central mediterranean sea. j. mar. biol. assoc. uk 95:17-24. consoli p, romeo t, ferraro m, sarà g, andaloro f, 2013. factors affecting fish assemblages associated with gas platforms in the mediterranean sea. j. sea. res. 77:45-52. de luca m, 1999. international report. offshore 6:38-50. driessen pk, 1985. studing “neptune’s gallery”. sea technol. 26:34-38. fabi g, camilletti e, ciccotti e, luccarini f, lucchetti a, panfili m, solustri c, 1998. ruolo trofico della barriera artificiale di cesano-senigallia nei confronti di alcune specie ittiche. biol. mar. medit. 5:1812-1821. fabi g, grati f, lucchetti a, trovarelli l, 2002. evolution of the fish assemblage around a gas platform in the northern adriatic sea. ices j. mar. sci. 59:309-315. fabi g, grati f, puletti m, scarcella g 2004. effects on fish community induced by installation of two gas platforms in the adriatic sea. mar. ecol. prog. ser. 273:187-194. fabi g, manoukian s, spagnolo a, 2006. feeding behavior of three common fishes at an artificial reef in the northern adriatic sea. bull. mar. sci. 78:39-56. fagundes-netto eb, gaelzer lr, coutinho r, zalmon ir, 2011. influence of a shipwreck on a nearshore-reef fish assemblages off the coast of rio de janeiro, brazil. lat. am. j. aquat. res. 39:103-116. gallaway bj, martin lr, howard rl, boland gs, dennis gd, 1981. effects on artificial reef and demersal fish and macrocrustacean communities. mar. sci. 14:237-299. garcia charton ja, pérez ruzafa a, 2008. correlation between habitat structure and a rocky reef fish assemblage in the southwest mediterranean. mar. ecol. 19:111-128. ghisel rg, 1997. fifty years of offshore oil, gas development. hart publications, houston. gooding rm, magnusson jj, 1967. ecological significance of a drifting object to pelagic fishes. pac. sci. 21 486-497. gorham jc, alevizon ws, 1989. habitat complexity and the abundance of juvenile fishes residing on small scale artificial reefs. bull. mar. sci. 44:662-665. gratwicke b, speight mr 2005. the relationship between fish species richness, abundance and habitat complexity in a range of shallow tropical marine habitats. j. fish. biol. 66:650-667. hamzah ba, 2003. international rules on decommissioning of offshore installations: some observations. mar. pol. 27:339-348. harvey bc, white jl, nakamoto rj, 2005. habitat specific biomass, survival, and growth of rainbow trout (oncorhynchus mykiss) during summer in a small coastal stream. can. j. fish. aquat. sci. 62:650-658. hastings rw, ogren lh, mabry mt, 1976. observations on fish fauna associated with offshore platforms in the northeastern gulf of mexico. fish. bull. 74:387-340. higo n, hashi h, takahama i, tabata s, nagashima m, sakono s, kasmimizutara t, yamasaki t 1980. on the fish gathering effect of the artificial reefs ascertained by the diving observation vii at the sea off maskurazak city. mem. faculty fisheries, kagoshima univ. 29:51-63. hixon ma, beets jp, 1989. shelter characteristics and caribbean fish assemblages: experiments with artificial reefs. bull. mar. sci. 44:666-680. hixon ma, beets jp, 1993. predation, prey refuges, and the structure of coral-reef fish assemblages. ecol. monogr. 63:77-101. hixon ma, menge ba, 1991. species diversity: prey refuges modify the interactive effects of predation and competition. theor. popul. biol. 39:178-200. hunter jr, mitchell ct, 1967. association of fishes with flotsam in the offshore waters of central america. fish. bull. 66:13-29. jones gp, 1988. experimental evaluation of the effects of habitat structure and competitive interactions on the juveniles of two coral reef fishes. j. exp. mar. biol. ecol. 123:115-126. jørgensen t, løkkeborg s, soldal av, 2002. residence of fish in the vicinity of a decommissioned oil platform in the north sea. ices j. mar. sci. 59:288-293. kakimoto h, 1982. the stomach contents of species of fish caught in artificial reefs, p. 271-273. in: s.f vik (ed.), japanese artificial reef technology. tech. rep. 604. aquabio, inc., annapolis. kasprzak ra, 1998. use of oil and gas platforms as habitat in louisiana’s artificial reef program. gulf. mex. sci. 16:37-45. kellison gt, sedberry gr, 1998. the effects of artificial reef vertical profiles and hole diameter on fishes off south carolina. bull. mar. sci. 62:763-780. kojima s 1956. fishing for dolphins in the western part of the japan sea. ii. why do fish take shelter under floating materials? bull. jpn. soc. sci. fish. 21:1049-1052. lassau sa, hochuli df, 2004. effects of habitat complexity on ant assemblages. ecography 27:157-164. leitão f, santos mn, monteiro cc, 2007. contribution of artificial reefs to the diet of the white sea bream (diplodus sargus). ices j. mar. sci. 64:473-478. løkkeborg s, humborstad ob, jørgensen t, soldal av, 2002. non -co mmerc ial us e o nly the influence of habitat complexity on fish assemblages associated with extractive platforms in the central mediterranean sea 67 spazio-temporal variations in gillnet catch rates in the vicinity of north sea oil platforms. ices j. mar. sci 59:294-299. love ms, nishimoto mm, 2012. completion of fish assemblage surveys around manmade structures and natural reefs off california. boem ocs study 2012-020, marine science institute, university of california, santa barbara. love ms, nishimoto mm, schroeder dm, 2010. fish assemblages associated with platforms and natural reefs in areas where data are non-existent or limited. boem ocs study 2010-012, marine science institute, university of california, santa barbara. love ms, schroeder dm, nishimoto mm, 2003. the ecological role of oil and gas production platforms and natural outcrops on fishes in southern and central california: a synthesis of information. ocs study mms 2003-032, us department of the interior, us geological survey, biological resources division, seattle. love ms, york a, 2006. the role of bottom crossbeam complexity in influencing the fish assemblages at california oil and gas platforms. fish. bull. 104:542-549. love ms, westphal w, 1990. comparison of fishes taken by a sportfishing party vessel around oil platforms and adjacent natural reefs near santa barbara, california. fish. bull. 88:599-605. lucifredi a, 2018. [addio alle piattaforme].[article in italian]. le scienze 596:76-81. luckhurst be, luckhurst k, 1978. analysis of the influence of the substrate variables on coral reef fish communities. mar. biol. 49:317-323. macarthur rh, levins r, 1967. the limiting similarity, convergence and divergence of coexisting species. am. nat. 101:377-385. macpherson e, 1994. substrate utilization in a mediterranean littoral fish community. mar. ecol. prog. ser. 114:211-218. mangano mc, bottari t, caridi f, porporato emd, rinelli p, spanò n, johnson m, sarà g, 2017. the effectiveness of fish feeding behaviour in mirroring trawling-induced patterns. mar. environ. res. 131:195-204. mangano mc, kaiser mj, porporato emd, lambert gi, spanò n, 2015. trawling disturbance effects on the trophic ecology of two co-generic astropectinid species. mediterr. mar. sci. 16:538-549. mangano mc, sarà g, 2017. collating science-based evidence to inform public opinion on the environmental effects of marine drilling platforms in the mediterranean sea. j. environ. manage. 188:195-202. mcardle bh, anderson mj 2001. fitting multivariate models to community data: a comment on distance-based redundancy analysis. ecology 82:290-297. mcclanahan tr, 1994. kenyan coral reef lagoon: effects of fishing, substrate complexity, and sea urchins. coral reefs 13:231-241. mccormick mi, 1994. comparison of field methods for measuring surface topography and their associations with a tropical reef fish community. mar. ecol. prog. ser. 112: 7-96. minton v, heath sr, 1998. alabama’s artificial reef program: building oases in the desert gulf. mex. sci. 16:105-106. ogawa y, 1982. reef materials and designs: examples of their applications, p. 320-364. in: s.f vik (ed.), japanese artificial reef technology. tech. rep. 604. aquabio, inc., annapolis. öhman mc, rajasuriya a, 1998. relationships between habitat structure and fish communities on coral and sandstone reefs. environ. biol. fishes 53:19-31. ospar commission, 1992. convention for the protection of the marine environment of the north-east atlantic. available from: https://www.ospar.org/convention porporato em, mangano mc, de domenico f, giacobbe s, spanò n, 2014. first observation of pteroeides spinosum (anthozoa: octocorallia) fields in a sicilian coastal zone (central mediterranean sea). mar. biodivers. 44:589-592. pulsipher ag, daniel wb, 2000. onshore disposition of offshore oil and gas platforms: western politics and international standards. ocean coast. manage. 43:973-995. relini g, geraci s, montanari m, romairone v, 1976. [variazioni stagionali del fouling sulle piattaforme off-shore di ravenna e crotone].[article in italian]. boll. pesca 31:227-256. rilov g, benayahu y, 1998. vertical artificial structures as an alternative habitat for coral reef fishes in disturbed environments. mar. environ. res. 45:431-451. rilov g, benayahu y, 2000. fish assemblage on natural vs vertical artificial reefs: the rehabilitation perspective. mar. biol. 36:931-942. rilov g, benayahu y, 2002. rehabilitation of coral reef-fish communities: the importance of artificial-reef relief to recruitment rates. bull. mar. sci. 70:185-197. roberts cm, ormond rfg, 1987. habitat complexity and coral reef fish diversity and abundance on red sea fringing reefs. mar. ecol. prog. ser. 41:1-8. rooker jr, dokken qr, pattengill cv, holt gj, 1997. fish assemblages on artificial and natural reefs in the flower garden banks national marine sanctuary, usa. coral reefs 16:83-92. scarcella g, grati f, fabi g, 2011. temporal and spatial variation of the fish assemblage around a gas platform in the northern adriatic sea, italy. turk. j. fish. aquat. sci. 11:433-444. schroeder dm, love ms 2004. ecological and political issues surrounding decommissioning of offshore oil facilities in the southern california bight. ocean coast. manage. 47:21-48. stanley dr, wilson ca, 1991. factors affecting the abundance of selected fishes near oil and gas platforms in the northern gulf of mexico. fish. bull. 89:149-159. steimle fw, ogren l, 1982. food of fish collected on artificial reefs in the new york bight and off charleston, south carolina. mar. fish. rev. 44:49-52. terlizzi a, bevilacqua s, scuderi d, fiorentino d, guarnieri g, giangrande a, licciano m, felline s, fraschetti s, 2008. effects of offshore platforms on soft-bottom macro-benthic assemblages: a case study in a mediterranean gas field. mar. poll. bull. 56:1303-1309. yoshimuda n, 1982. discussion of installation planning, p. 137165. in: s.f vik (ed.), japanese artificial reef technology. tech. rep. 604. aquabio, inc., annapolis. warfe dm, barmuta la, 2004. habitat structural complexity mediates the foraging success of multiple predator species. oecologia 141:171-178. willis sc, winemiller ko, lopez-fernandez h, 2005. habitat structural complexity and morphological diversity of fish assemblages in a neotropical floodplain river. oecologia 142:284-295. non -co mmerc ial us e o nly layout 1 introduction the white sea is an inland sea located in the north of the european part of russia; it belongs to the arctic ocean. its area is 90.000 km2, and its maximum depth is 343 m. the white sea communicates with the vast barents sea, which has an impact on the formation of the ice cover on the inland sea, due to the warming of climatic conditions (gluhovskiy, 1991). it should be noted that, every year, the surface of the white sea in winter is almost completely covered by ice, and in spring the sea is completely free of ice. the formation of an ice cover in the water area of many water bodies (as well as the white sea) of the northern hemisphere is an integral part of the hydrological cycle. the data about the formation of the ice regime is necessary for planning and organizing the navigation period, as well as the possibility of transporting people and/or cargoes over the stable ice (assel et al., 2004; karetnikov and naumenko, 2008; salo and nazarova, 2011; andrews et al., 2018). this is particularly important for seas affected by commercial and economic activities. it is difficult to overestimate the importance of shipping in the white sea. a lot of shipping routes pass through the white sea, which connect the cities of russia located in its northern part with the central regions of russia. the largest port is arkhangelsk, from where flights go to other ports on the coast of the white sea – mezen, severodvinsk, belomorsk, and others. for example, delivering goods across the white sea to kandalaksha is vital for the city-forming enterprise. also, one of the most important ports is belomorsk, which is connected with the central regions of russia thanks to the white seabaltic canal. for the efficient organization of the transport logistics in the white sea, it is necessary to have not only information about the ice situation at sea, but also to know the patterns of annually recurring ice phenomena, the average dates of the formation and breaking of ice features (andrews et al., 2018). it should be noted that some studies of the white sea ice regime were carried out earlier. the first systematic observations of the state of the ice cover in the white sea coasts were initiated by the lighthouse service of the russian maritime department at lighthouses (1894-1898). in the period 1918-1985, systematic ice observations were carried out at 30 coastal stations. also, since 1909, observations of the ice cover were carried out from icebreakers and hunting vessels. and since 1927, air sorties have been undertaken to guide ships through the ice. the most complete information on the course of the ice regime in the white sea is collected in the works provided by the state oceanographic institute of the ussr (gluhovskiy, 1991), where various statistical characteristics of ice processes occurring in the white sea, based on aerial reconnaissance materials, ship observations made at coastal stations and posts for the period up to 1985 are described. all these materials are of great scientific and practical interest. however, many researchers (magnuson et al., 1990; latifovic and pouliot, 2007; brown and duguay, 2010; efremova et al., 2013; filazzola et al., 2020; hwang et al., 2020) noted that in recent decades around the world there have been significant changes in climatic conditions associated with global warming, which led to a change in the course of the ice regime on lakes and seas. for example, in the work of thoman et al. (2020), it is noted that in the cold season of 2017-2018, in the northern hemisphere, the extent of sea ice in the bering sea was less than any other winter in the past. in this context, we can assume that the previously obtained patterns of ice phenomena occurring in the white sea should be updated, taking into account the most recent cliarticle spatio-temporal regularities of the white sea ice regime formation vyacheslav baklagin northern water problems institute, karelian research centre, russian academy of sciences, petrozavodsk, russia abstract the paper presents the spatial and temporal regularities of the course of ice processes in the white sea, derived from satellite data observations, for the period 2004-2020. the dependences, defining indicative dates of the white sea ice regime of air temperature regime over its water area are given, which can be used for diagnostic and prognostic purposes. it was found that the rate of breaking (2.11%/day) of the sea ice cover is 1.24 times higher than the rate of formation (1.70%/day). it is noted that the connection with the barents sea has a significant impact on the course of the ice regime of the white sea, in particular on the beginning freeze-up phase and the beginning break-up phase. comparative analysis of seasonal variations in ice coverage in the white sea indicates that the course of the ice regime in recent years was slightly different from that recorded in the second half of the xx century. the average duration of the ice period decreased by 10 days, and the average values of the ice coverage decreased by 37% throughout the entire period of ice phenomena, which is in line with the global warming trend. also, the effects of an abnormally warm winter on the formation of the white sea ice regime in the 2019-2020 period are presented. the differences in the indicative dates of the ice regime, such as the dates of the beginning and the end of the period of ice phenomena in 2019-2020, compared to the average for the period 2004-2019, are +1 and -8 days, respectively. non -co mmerc ial us e o nly v. baklagin2 matic conditions. in addition, it should be noted that modern methods of monitoring the state of the ice cover of lakes and seas include the use of satellite observations (karetnikov and naumenko, 2008; baklagin, 2018; filazzola et al., 2020), which were not fully available to researchers in the xx century. satellite observations data on the state of the ice cover of water bodies (lakes and seas) make it possible to significantly expand and update knowledge and information about the formation of the ice regime of water bodies, since satellite observations have an undeniable advantage, due to the high spatial and temporal resolution of the obtained data compared with the observation methods which were used by researchers in the xx century. for example, owing to unfavourable weather conditions, the frequency of air reconnaissance missions to the white sea was only 1015 per year, and the information received from the coastal observation posts described only a small part of the sea area, that is, that in the visibility zone. conversely, satellite observations are conducted daily and cover the entire area of the white sea. this facilitates accurate assessment of the dynamics of ice formations change and, as a result, it is a determining factor for establishing patterns of ice processes. the purpose of this study is to establish the spatiotemporal regularities of the course of ice processes in the white sea, to clarify and update the statistical characteristics of the ice regime on the basis of modern satellite observation data (for the period 2004-2020), as well as to identify the dependences of the course of ice processes on temperature control over the white sea water area. materials and methods identification of the ice regime in the white sea the analysis and assessment of the course of ice regime in the white sea in this study was carried out on the basis of satellite data sets for the period 2004-2020, provided by the usa national aeronautics and space administration (nasa) (modis sensor, with a spatial resolution of up to 250 m), the national snow and ice data center (nsidc) (4-6 km), the center for satellite applications and research noaa nesdis (4-6 km). to assess the state of the sea ice cover, the ice coverage values for each day of the observed period were calculated as area ratio of ice formations to the total area of the water area. this characteristic is very often used during observations of the state of the ice cover of lakes (karetnikov and naumenko, 2008; baklagin, 2018, 2019). the methodology for the formation of a daily series of ice coverage values based on the listed sets of satellite data was the same as that used in lake onego (baklagin, 2018). for a comprehensive assessment of changes in ice coverage in each period of ice phenomena in this study, the sums of daily values of ice coverage, which correspond to the rici value described by karetnikov and naumenko (2008), were calculated for each period of ice phenomena (σice), following baklagin (2018). method of formation schemes of the development of ice processes in the white sea the formation schemes of the development of ice processes in the white sea was carried out by averaging the indicative dates of the period 2004-2020 for each section of the sea water area (corresponding to the spatial resolution of satellite data). in particular, the average indicative dates for each section of the sea area with geographic coordinates (lat, lon) were determined by the formulas: (1) (2) where (dicelat, lon)ave is the average duration of the period from the 1st of december to the beginning of complete ice formation in the section of sea area with geographic coordinates (lat, lon), days; (dicelat, lon)y is the duration of the period from the 1st of december to the beginning of complete ice formation in the section of sea area with geographic coordinates (lat, lon) in hydrological year y, days; (dfreelat, lon)ave is the average duration of the period from the 1st of april to complete ice clearance in the section of sea area with geographic coordinates (lat, lon), days; (dfreelat, lon)y is the duration of the period from the 1st of april to complete ice clearance in the section of sea area with geographic coordinates (lat, lon) in hydrological year y, days; sy is the starting year of the observed period; fy is the last year of the observed period. estimation of meteorological conditions above the white sea in calculating the indicative ice regime, the establishment of full freeze-up in the white sea was assumed to be achieved when the ice coverage was 90% and above. to assess the temperature regime over the white sea, we used daily data on the average daily air temperature for the period 2004–2020, which is provided by the national climatic data center noaa usa (ncdc noaa) (ftp://ftp.ncdc.noaa.gov/pub/data/noaa/). for this purpose, meteorological centers were selected that are equidistant from each other and located on the coast of the white sea (with the wmo index) (figure 1): the city of kandalaksha (222170), the village of shojna (22710), the village of umba (223240), the settlement of pjalica (223490), zizgin island (224380), the city of non -co mmerc ial us e o nly spatio-temporal regularities of the white sea ice regime formation 3 mezen (224710), the airport of talagi arkhangelsk (225500), the city of onega (226410). the estimation of the temperature regime over the water area of the white sea was carried out by averaging the data on the air temperature obtained at the centres listed above. statistical analysis the work establishes statistical relationships between the characteristics of the ice regime and temperature regime using correlation and regression analyses. the method of selection of significant input features of regression models includes the use of the “forward selection” procedure, based on an f-test (larose, 2006). it is assumed that the temperature regime of the air for the previous 6-month period has a significant impact on the onset of the considered indicative date of the ice regime. therefore, the input candidate features are the values of the average monthly air temperatures for each month (6 values). the algorithm for checking the significance of these input features is as follows: figure 1. the location of meteorological observation points on the coast of the white sea. non -co mmerc ial us e o nly v. baklagin4 1. as the first feature of the model, a t̅i is selected that best correlates with the considered indicative date of the ice regime. 2. then, all other input features t̅ i are sequentially checked for significance according to the following algorithm: a. a feature t̅i from the list of candidate features is included in the model as a new feature and the value of the statistic is calculated: (3) where ssrextra is an increase of the sum of squares regression taking into account the introduction of the feature xextra: (4) where ssrfull the sum of squares regression, taking into account the introduced feature xextra; ssrinitial the sum of the squares regression without taking into account the feature xextra; msefull the sum of squares error, taking into account the feature xextra, per one degree of freedom: (5) where n is the sample size, k is the number of model variables. b. the value of γ is compared with the value of f-test (fα), chosen for the significance level α = 0,05 and degrees of freedom: d1 = 1, d2=n – k – 2. if γ>fα, then a conclusion is made about the significance of xextra and this feature is included in the model, otherwise the feature is excluded. all of the above calculations were executed in excel 2010. results the analysis of satellite observation data showed that the white sea is almost completely covered by ice every year (on 93-99%). however, unlike for example lake onego, throughout the entire period of ice phenomena, the ice cover had breaks and cracks, which is explained by the presence of drifting ice arising from strong winds and tidal currents. statistical analysis of the indicative dates and durations of the phases of the white sea ice regime (figure 2, table 1) for the period 2004-2020 showed that the rate of breaking (2.11%/day) of the sea ice cover is 1.24 times higher than the rate of formation (1.70%/day). a similar pattern was shown for the two largest lakes in europe located in this geographical area, namely ladoga (1.5), and onego (1.65) (karetnikov and figure 2. dates of the beginning and the ending of phases and the duration (the number of days) of ice freezing (1), complete freezeup (2), and break-up (3) on the white sea for the period 2004-2020. non -co mmerc ial us e o nly spatio-temporal regularities of the white sea ice regime formation 5 naumenko, 2008; baklagin, 2018). the distinctive course of the ice regime of the white sea in 2019-2020 is due to abnormal warm winter conditions recorded all over the world (giss surface temperature analysis (gistemp), version 4 nasa goddard institute for space studies (https://data.giss.nasa.gov/gistemp/maps/index.html)). the accumulated sum of negative air temperatures over the water area of the white sea for the cold season was only -692°c, while the average value for the period 20042019 is -1067°c. at the same time, the sum of daily values of ice coverage (σice) for the period of ice phenomena in 2019-2020 was 4352%, with an average value of 9132% for the period 2004-2019. it should be noted that the minimum value of σice for the period 2004-2019 is 7141% (2007-2008), which indicates a significant update of the record minimum during the period of anomalous winter. it should also be noted that the differences in the indicative dates of the ice regime, such as the dates of the beginning and the end of the period of ice phenomena in 2019-2020, from the average for the period 2004-2019 are only +1 and -8 days, respectively. regression analysis made it possible to establish dependencies that determine the indicative dates of the ice regime of the white sea on the average monthly air temperatures over the seawater area, preceding these dates (table 2): (6) (7) (8) (9) where dfreezing is the duration of the period from the 1st of november to the beginning of ice phenomena formation, days; dice is the duration of the period from the 1st of december to the beginning of the complete freeze-up phase, days; dbreaking is the duration of the period from the 1st of march to the beginning of the ice cover break-up, days; dfree is the duration of the period from the 1st of april to complete ice clearance, days; t̅i is the average air temperature over the sea water area in the i-th month, °с. the analysis of the values of the accumulated sums of air temperature during the phases of ice phenomena in the white sea is given in table 3. a special fact is that the ice cover break-up of the white sea begins before the beginning of the warm season (period of positive air temperatures), which is not typical, for example, for onego and ladoga lakes. the statistical characteristics of the warm and cold seasons in the white sea are shown in table 4. the accumulated sums of negative air temperatures at the complete freeze-up phase ∑tice showed a strong negative correlation (r=-0.73; p<0.05) with the accumulated table 1. statistical characteristics of phases of the white sea ice regime for the period 2004–2020. characteristic average date mean value standard coefficient of the beginning of the duration, days deviation, days of variation, % and the end of the period freeze-up phase december 6 – february 2 59 21 35 complete freeze-up february 3 – march 21 46 22 48 break-up phase march 22 – may 8 48 11 24 period of ice phenomena december 6 – may 8 153 18 12 table 2. statistical details of regressions. equations the coefficient explained sum residual sum mean squared p-value observations of determination r2 of squares (ess) of squares (rss) error (mse) eq. 3 0,42 1337,41 1817,53 11,82 0,04954 17 eq. 4 0,76 1209,12 595,94 9,11 0,00114 17 eq. 5 0,46 2642,65 3123,80 14,43 0,01008 17 eq. 6 0,67 1209,12 595,94 6,52 0,00043 16 eq. 7 0,54 114949,05 99901,31 81,61 0,00085 17 eq. 8 0,61 21936,69 21936,69 30,53 0,00021 17 non -co mmerc ial us e o nly v. baklagin6 sums of positive air temperatures for the warm season preceding the period of ice phenomena ∑t+ (on the chaddock scale). furthermore, a strong negative correlation was observed (r=-0.78; p<0.05) between the accumulated sums of positive air temperatures at the complete ice clearance on the sea ∑tfree and the accumulated sums of temperatures for the cold season (period of negative air temperatures). similar statistical relationships between the accumulated sums of air temperatures at the beginning of the formation of ice cover ∑tfreezing and at the beginning of the break-up phase ∑tbreaking were not obtained. based on previous results, regression analysis made it possible to reveal the equations that determine the accumulated sums of air temperatures necessary for the onset of indicative dates of the ice regime of the white sea (table 2): (10) (11) the results of assessing the degree of influence of the accumulated sums of negative temperatures during the cold season ∑t_ on various indicators of the ice regime of the white sea based on the correlation analysis are as follows (table 5): weak (on the chaddock scale) correlation is observed between the accumulated sums of negative temperatures during the cold season ∑t_ and the duration period of ice phenomena l in the white sea; the correlation is somewhat stronger between the values of ∑t_ and the duration of freeze-up s in the white sea; the strongest correlation was observed between the values of ∑t_ and the sums of daily values of the ice coverage for the period of ice phenomena ∑ice. similar results were obtained earlier in the study of the ice regime of lake onego (baklagin, 2019). these results confirm that the ∑the ice value is the most sensitive to changes induced by the temperature regime. spatiotemporal statistical analysis of satellite data for the period 2004-2020 (figs 3, 4a) showed that the formation of the ice cover in the white sea proceeds from the tops of the bays to the centre of the white sea. the formation of ice features begins in early december in the table 3. values of the accumulated sums of air temperatures over the water area of the white sea at the indicative dates of the ice regime. characteristic accumulated sums of air temperatures over the waters of white sea: at the beginning at the complete at the beginning at the moment of the formation freeze-up phase of break-up phase of complete ice clearance of ice cover ∑tice, °c ∑tbreaking, °c on the sea ∑tfreezing, °c ∑tfree, °c mean value -112 -583 -884 61 standard deviation 62 119 323 49 coefficient of variation -0,55 -0,20 -0,36 0,81 table 4. statistical characteristics of warm and cold season on the white sea for the period 2004-2020. characteristic warm season cold season average date of the beginning and the end of the period april 14 november 5 november 6 april 13 accumulated sums of air temperatures,°c: min value 1460 -692 average value 1747 -1055 max value 2006 -1555 table 5. the results of the correlation analysis between the accumulated sums of negative temperatures in the cold season and various indicators of the ice regime of the white sea. variables observations the сorrelation student’s test p value (n) coefficient (r) (t) the duration period of ice phenomena 16 -0,37 -1,51 0,07537 the duration of complete freeze-up 17 -0,58 -2,77 0,00653 the sums of daily values of the ice coverage for the period of ice phenomena 16 -0,84 -5,81 0,00001 non -co mmerc ial us e o nly spatio-temporal regularities of the white sea ice regime formation 7 form of fast ice in the coastal zone of the mezen and onego bays (figure 3a, t1, 5-10%). by january, the area of ice features increases, and the waters of the mezen, onego and dvina bays are entirely covered with ice (figure 3a, t2, 35-45%). by february, the 92-98% of the white sea is covered by ice (figure 3a, t3). from early to mid-march, the ice sheet breaks down in the white sea funnel (figure 3a, t4, 82-84%). in mid-april, the ice sheet breaks in the waters of the basin, the white sea throat, and onego, dvina and kandalaksha bays (figure 3a, t5, 40-46%). finally, in mid-may, the water area of the mezen bay is freed from ice, thereby ending the period of ice cover in the white sea (figure 3a, t6). in general, mezen and onego bays are under the ice for the longest time (90-100 days a year), whereas in the white sea basin and the white sea throat and the dvina bay, the ice stays for a shorter time (80 days a year). the white sea funnel is covered with ice only 30-40 days a year. figure 3b shows a diagram of the seasonal variation of the white sea ice coverage, obtained by roughly digitizing the results of the analysis of ice aerial reconnaissance for the period 1951-1985 (gluhovskiy, 1991). unfortunately, we do not have the initial data that were used to construct this diagram (figure 4). therefore, it is possible to carry out only a visual assessment of the comparability of the ice coverage dynamics for the period of figure 3. seasonal variation of the white sea ice coverage (1 – minimum, 2 – maximum, 3 – average values): a) according to satellite observations for the period 2004-2020; b) according to air reconnaissance data 1951-1985 (gluhovskiy, 1991). figure 4. schemes of the development of ice processes in the white sea, averaged over the period 2004-2020, characterizing phases: a) freeze-up; b) break-up. non -co mmerc ial us e o nly v. baklagin8 ice phenomena in the white sea. it should be noted that the authors of the work (gluhovskiy, 1991) were somewhat limited in the time resolution of the data when plotting the seasonal variation diagram of the white sea ice coverage due to the irregularity of aerial reconnaissance missions; therefore, monthly intervals were used in plotting the diagram. it is noted that the seasonal course of ice cover in the white sea in recent years is slightly different from what could be observed in the second half of the xx century (figure 3). this is due to slight discrepancies between the indicative dates of the ice regime, in particular, later freeze-up (3 days) and earlier breakup (7 days). in addition, the average value of ice coverage for the entire period of ice phenomena has been reduced by 3-7%. the seasonal variations in ice coverage (figure 3a) showed that the minimum values in the period 2004-2020 were documented during the abnormal warm winter in 2019-2020. discussion the results obtained in this study indicate that the course of the ice regime in the white sea is similar to that of the largest lakes located in this geographic region (onego and ladoga). the duration of ice phenomena period in the white sea varied from 128 to 178 days, with the average value of 153 days (from december to may), complete freeze-up period from 3 to 94 days, with the average value of 46 days. while the average duration of the period of ice phenomena is 171, and that of complete freeze-up period is 90 days in lake onego (baklagin, 2019), they are respectively 172 and 34 days in lake ladoga (karetnikov and naumenko, 2008). the practice of equations (6)-(9) can be limited. the indicative dates of the ice regime in the white sea may occur earlier than the possibility of calculating the input parameters of the models. however, they can be served for diagnostic purposes. in this case, equations (10)-(11) allow to make a short-term forecast of the indicative dates of the ice regime of the white sea, based on the expected data on the air temperature. comparative analysis of seasonal variations in the ice cover of the white sea for the period 2004-2020 and 1951-1985 (figure 3), based on a visual assessment of the graphic material of the work by glukhovsky (1991), recognized a decrease in the duration of the period of ice phenomena in the white sea by about 10 days. the shortening of the average duration of the ice period is about 0.22 days per year for the white sea. in addition, the average values of the seasonal course of ice coverage are reduced by 3-7% within each month of the period of ice phenomena. this is consistent with the opinion of many researchers about a decrease in the duration of the period of ice phenomena on water bodies over the past decades, associated with the effects of global warming (assel et al., 2004; karetnikov and naumenko, 2008; efremova et al., 2013; comiso et al., 2017; andrews et al., 2018; ptak et al., 2019). for example, in the offshore waters of hudson bay, andrews et al. (2018) documented an increase of 0.97 days per year in the open water season between 1980 and 2014. stammerjohn et al. (2012) identified a shortening of the sea ice season by about 2.8 days per year in the kara and barents sea regions and in the east siberian sea and chukchi sea. a similar trend was noted by jensen et al. (2007) in 65 waterbodies across the great lakes region during a period of rapid climate warming (1975-2004); in this group of lakes, the average duration of the ice period decreased by 0.53 days per year. furthermore, compared to the second half of the xx century, baklagin (2019) identified a monthly shift in the indicative dates of the ice regime for lake onego between 2000 and 2018. correlation analysis showed that there is a strong negative correlation between the values of ∑ice and the accumulated sums of negative temperatures during the cold season over the water area of the white sea ∑t_. a similar result was recorded, for example, in lake onego (r=0.89) (baklagin, 2019). this fact indicates that the temperature regime of the air above the water area in the cold season has a decisive influence on the dynamics of areas and volumes of ice formations in the white sea. however, it should be noted that the temperature regime of the air over the white sea area does not always play the main role in the formation of the ice regime, unlike, for example, the baltic sea (sooäär and jaagus, 2007) and caspian sea (ivkina et al., 2017), the onego, ladoga lakes (karetnikov and naumenko, 2008; baklagin, 2019), and also lake baikal (kouraev et al., 2007). this is evidenced by the results of correlation and regression analysis when studying the regularities of the dates of the onset of the periods of ice formation dfreezing and the breaking of the ice cover dbreaking, while the dates of the end of these periods (dice, dfree) correlate well with the temperature regime of the air over the sea area. this is also evidenced by the analysis of the accumulated sums of air temperatures (table 3). in particular, at the beginning of the ice cover breaking ∑tbreaking , the break-up phase on the white sea occurs before the onset of the warm season (table 4), which indicates that the breaking of the ice cover is caused not only by the local meteorological conditions. we assume that flows of relatively warm waters of the barents sea have a significant impact on the beginning of the ice formation and the beginning of the ice breaking. this is also confirmed by the fact that the ice cover breaking (figure 4) starts from the white sea throat, at the junction with the barents sea. this is consistent with observations carried out in many other inland water bodies (karetnikov and naumenko, 2008; baklagin, 2018), where freezing and breaking did not occur evenly from the coast to the center of the sea (and vice versa). consistently, the northern coast of the white sea is the last to be covered with ice, even after the establishment of ice in the central part of the sea. thus, the forecast of indicative dates of the ice regime of the white sea can only be carried out by taking into account the influence of the barents sea. non -co mmerc ial us e o nly spatio-temporal regularities of the white sea ice regime formation 9 conclusions the regularities of the ice regime and the schemes of the development of ice processes in the white sea documented in this work significantly expand and supplement the data and knowledge in this geographical area, providing a basis for planning and organizing the navigation period. significant results include: the formation of the ice regime of the white sea is significantly influenced not only by the air temperature regime, but also by the direct communication with the barents sea, which affects the dates of the beginning of the formation of the ice cover and the beginning of its breaking. • results of research indicate that the course of the ice regime in the white sea is also subject to global warming trends. these trends are less pronounced in comparison with lake onego. • the abnormal winter 2019-2020 significantly influenced the course of the ice regime in the white sea. the value of the sum of daily values of ice coverage for the period of ice phenomena amounted to only 61% of the previous low record, and 49% of the mean value for the period 2004-2019. nevertheless, the differences between the dates of the beginning and the end of the ice phenomena in 2019-2020 and the corresponding average dates in the period 2004-2019 show insignificant values, namely +1 and -8 days respectively. corresponding author: vyacheslav baklagin. e-mail: slava.baklagin@mail.ru. key words: ice coverage; white sea; air temperature. conflict of interest: the author declares no potential conflict of interest. funding: the work was carried out within the framework of the theme of the state assignment no. аааа-а18-118032290034-5. availability of data and materials: all data generated or analyzed during this study are included in this published article. received: 12 may 2021. accepted: 12 october 2021. publisher’s note: all claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. ©copyright: the author(s), 2022 licensee pagepress, italy advances in oceanography and limnology, 2022; 13:9849 doi: 10.4081/aiol.2022.9849 this work is licensed under a creative commons attributionnoncommercial 4.0 international license (cc by-nc 4.0). references andrews j, babb d, barger dg, 2018. climate change and sea ice: shipping in hudson bay, hudson strait, and foxe basin (1980–2016). elem sci anth. 6:1-23. assel r, drobot s, croley ii te, 2004. improving 30-day great lakes ice cover outlooks. j. hydrometeorology. 5:713-717. baklagin vn, 2018. variability of the lake onega ice coverage in the period 2000-2018 according to the satellite data. ice and snow 58:552-558. baklagin vn, 2019. variations of indicative dates of ice regime on lake onego based on ground air temperature. advances in oceanography and limnology 10. brown lc, duguay cr, 2010. the response and role of ice cover in lake-climate interactions. progress in physical geography: earth and environment 34:671–704. comiso jc, meier wn, gersten r, 2017. variability and trends in the arctic sea ice cover: results from different techniques. j. geophys. res. oceans. 122:6883–6900. efremova tv, palshin ne, zdorovennov re, 2013. long-term characteristics of ice phenology in karelian lakes. estonian journal of earth sciences 62:33–41. filazzola a, blagrave k, imrit ma, sharma s, 2020. climate change drives increases in extreme events for lake ice in the northern hemisphere. geophysical research letters 47:1-10. gluhovskiy bh, 1991. [hydrometeorology and hydrochemistry of the seas of the ussr. white sea: 241 pp.][article in russian]. hwang b, aksenov y, blockley e, tsamados m, brown t, landy j, et al., 2020. impacts of climate change on arctic sea ice. mccip science review 2020:208-227. ivkina n, naurozbayeva z, klove b, 2017. influence of climate change on the ice regime of the caspian sea. central asian journal of water research 3:12-23. jensen op, benson bj, magnuson jj, card vm, futter mn, soranno pa, et al., 2007. spatial analysis of ice phenology trends across the laurentian great lakes region during a recent warming period. limnol. oceanogr. 52:2013–2026. karetnikov sg, naumenko ma, 2008. recent trends in lake ladoga ice cover. hydrobiology 599:41-48. kouraev av, semovski sv, shimaraev mn, mognard nm, legrésy b, rémy f, 2007. the ice regime of lake baikal from historical and satellite data: relationship to air temperature, dynamical, and other factors. limnol. oceanogr. 52:1268-1286. larose dt, 2006. data mining methods and models. j. wiley & sons, hoboken, usa: 322 pp. latifovic r, pouliotd, 2007. analysis of climate change impacts on lake ice phenology in canada using the historical satellite data record. remote sensing of environment 106:492–507. magnuson jj, benson bj, kratz tk, 1990. temporal coherence in the limnology of a suite of lakes in wisconsin, u.s.a. freshwater biology 23:145−159. ptak m, sojka m, nowak b, 2019. changes in ice regime of jagodne lake (north-eastern poland). acta sci. pol., formatio circumiectus 18:89–100. salo ya, nazarov le, 2011. [multiannual variability of the onega lake ice regime in conditions of variability of the regional climate.][article in russian] processes of the russian geographical society. 143:50-55. sooäär j, jaagus j, 2007. long-term changes in the sea ice non -co mmerc ial us e o nly v. baklagin10 regime in the baltic sea near the estonian coast. proc. estonian acad. sci. eng. 13:189–200. stammerjohn s, massom r, rind d, martinson d, 2012. regions of rapid sea ice change: an inter-hemispheric seasonal comparison. geophys. res. lett. 39:l06501. thoman rl, bhatt us, bieniek pa, brettschneider br, brubaker m, danielson sl, et al., 2020. the record low bering sea ice extent in 2018: context, impacts, and an assessment of the role of anthropogenic climate change. in: s.c. herring, n. christidis, a. hoell, m.p. hoerling, p.a. stott (eds.), explaining extremes of 2018 from a climate perspective. bull. amer. meteor. soc. 101:53-58. non -co mmerc ial us e o nly layout 1 introduction oxbow lakes are important components of the floodplain systems of lowland rivers. rivers supply these lakes with suspended matter and nutrients during flood events, while during inter-flood periods even oxbow lakes located close to the river become isolated and develop the characteristics of lentic ecosystems. as a result, oxbow lakes behave alternatively as lotic or lentic ecosystems in relation to the hydrological regime of the river. flood events in oxbow lakes can be reconstructed by sediment analyses by distinguishing lotic and lentic regimes (wolfe et al., 2006). zooplankton biodiversity and abundance is commonly poor in lotic environments (during floods), in comparison to lentic waters (between floods) (zsuga, 1998, 1999). these conditions are also well reflected by the remains of zooplankton species, especially cladocerans, which accumulate in sediment deposits. as a consequence, subfossil cladocera serve as a useful biological proxy for the evaluation of lake responses to environmental changes such as water level changes and trophic structure (korhola and rautio, 2001; korponai et al., 2010a, 2011; jeppesen et al., 2011). in hungary, a study by korponai et al. (2011) on cladoceran remains was used for reconstructing past changes in trophic status of lake balaton. goslar et al. (1999) found high frequency of bosmina longirostris (o.f. müller, 1785) during the german colonization of lake gościąź, and a decrease of this species after the demolition of the settlement. as b. longirostris prefers eutrophic conditions (korponai et al., 2010a, 2011), the authors concluded that the german settlers induced an increase in the lake’s eutrophic status, which is in line with results provided by other sediment proxies. galbarczyk-gąsiorowska et al. (2009) could relate changes in cladoceran communities to decreasing water level in stare biele mire in poland. planktonic cladocerans gradually disappeared while advances in oceanography and limnology, 2016; 7(2): 131-141 article doi: 10.4081/aiol.2016.6168 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). reconstruction of flood events in an oxbow lake (marótzugi-holt-tisza, ne hungary) by using subfossil cladoceran remains and sediments jános korponai,1,2* istván gyulai,3 mihály braun,4 csilla kövér,1 istván papp,5 lászló forró6 1mta pe limnoecology research group, egyetem u. 10, 8200 veszprém; 2department of chemistry and environmental sciences, university of west hungary, károly gáspár tér 4, 9700 szombathely; 3institute of biology and ecology, university of debrecen, egyetem tér 1, 4032 debrecen; 4laboratory of environmental studies, institute for nuclear research, hungarian academy of sciences, bem tér 18/c, 4026 debrecen; 5department of mineralogy and geology, university of debrecen, egyetem tér 1., 4032 debrecen; 6department of zoology, hungarian natural history museum, baross u. 13, 1088 budapest, hungary *corresponding author: korponai.janos@iif.hu abstract oxbow lakes are important components of the floodplain systems of lowland rivers. during flood events, oxbows are connected with the main river channel, and behave as lotic systems, while during inter-flood periods, these lakes can be considered as lentic ecosystems. rivers are generally poor in planktonic organisms and their sediments contain scarce biological remains in comparison to lentic water ecosystems. however, due to their alternating running and standing water regime, sedimentary biological remains of oxbow lakes can be used as proxies for tracking changes of past hydrological regimes. in this study we investigated how cladoceran communities respond to flood events, and whether flood events can be recognized by community analysis of cladoceran remains. a sediment core from marótzugi-holt-tisza oxbow lake was analyzed for identification of past flood events based on changes in the subfossil cladocera community. floods were defined based on the proportion of fine sand (50 µm grain size) in the oxbow sediments. if the fine sand portion was <3%, the water regime of the oxbow was considered as lentic, otherwise it was lotic. both organic and pigment contents were significantly higher in the core sections deposited during lentic stages. thirty-four cladocera species were determined in this core, all common to littoral habitats of eutrophic shallow lakes in hungary. one planktonic (bosmina longirostris) and four chydorid species (alona rectangula, acroperus harpae, alonella nana and chydorus sphaericus) were dominant throughout the core and contributed >90% of total remains. discriminant analysis on cladoceran data confirmed that lotic and lentic hydrological stages were characterized by different cladocera species associations. bosmina longirostris, chydorus sphaericus, alona rectangula, acroperus harpae, leydigia leydigi, a. quadrangularis and a. nana were mainly responsible for the differences between lotic and lentic species assemblages. our results revealed that cladocera remains can be used to track changes in the hydrological regime of oxbow lakes. key words: multiproxy reconstruction; oxbow lakes; lotic/lentic regimes; loi; sedimental pigments; subfossil cladocera. received: july 2016. accepted: november 2016. non co mmerc ial us e o nly 132 j. korponai et al. macrophyte-associated species appeared and increased until finally a poor cladoceran community developed, which consisted of very rare species able to tolerate specific conditions (i.e., low ph, low nutrient levels) in the peat phase. according to luoto et al. (2011), lotic conditions strongly affect cladoceran communities of boreal shallow lakes, so that sediment layers deposited during lotic stages may introduce errors in temperature and water-depth reconstructions. in oxbow lakes trophic status is typically higher between flood events (knowlton and johns, 1997). however, as cladoceran distribution can be affected by different abiotic factors, we hypothesize that flood events could also play an important role in driving changes in cladoceran communities of oxbows. the aim of this study is to verify the occurrence of past flood events through the analysis of cladoceran remains, and to reconstruct the effects of flood events on cladoceran communities. methods study area marótzugi-holt-tisza (holt=dead) is a small unprotected oxbow lake (length 1.8 km, width 60 m, area 10 ha) located at the left side of the river tisza (at the 568th river km), close to the gávavencsellő village in ne hungary (n 48.175611, e 21.612306, fig. 1). the river tisza is one of the largest rivers in central europe, and the largest water flow of the hungarian plain. it is 946 km long, and the catchment area is 157,186 km2. the water regime of the river tisza is very variable. the highest water levels occur at the time of snow melt between february and april. a second high water level stage frequently occurs in june, due to intense seasonal rainfalls. the lowest water levels are commonly measured from august to the end of september. from an economical point of view, the tisza is the most important river in hungary, since it provides the largest irrigation water supply for cultivated areas in the country (234-265 kha in 1970-80, lászlóffy, 1982). before its regulation, the river tisza was surrounded by large floodplains covering a total area of 19,637 km2, 4770 km2 of which were permanently inundated. therefore, the tisza floodplain occupied 21% of the country, while 5% was permanently inundated (botár and károlyi, 1971). in the late 19th century, a complex drainage system was constructed, consisting of floodgates, artificial river beds and channels. meanders were cut off, reducing the length of the river tisza from 1420 km to 946 km. altogether 112 meanders were isolated from the river-bed and fig. 1. map showing the location of the marótzugi-holt-tisza and the coring point. non co mmerc ial us e o nly reconstruction of flood events in an oxbow lake 133 converted into oxbow lakes (lászlóffy, 1982). by cutting the bends, the slope of the river-bed increased, thus increasing current velocity and kinetic energy of the river. this was supposed to prevent sediment build-up in the riverbed, as the rates of erosional and depositional processes became balanced. according to the present nomenclature, oxbows lying within the river floodplain are called unprotected (plesiopotamon), while those that are located outside of levees are defined as protected (paleopotamon). unprotected oxbows are frequently affected by floods therefore their sediments become laminated due to sedimentation of organic matter following floods. river canalization created 80 oxbow lakes from the river tisza. most of them are unprotected and highly affected by floods, which makes them ideal water ecosystems for studies on of flood events. previous studies on the sediments of the river tisza oxbows revealed that heavy metal pollution was a regular occurrence due to ore mining in maramures county in romania (braun et al., 2000, 2010). studies by korponai et al. (2010b, 2010c) showed that cladocera communities represent an outstanding portion of biodiversity of oxbows lakes. following the reclamation scheme, a large bend of the river tisza was isolated in 1860 and the marótzugi-holttisza oxbow was established (pálfai, 2001). this oxbow lake was chosen as a study site due to its known age and its favorable logistics. marótzugi-holt-tisza oxbow is unprotected and situated between dikes and the river channel. the biota of this lake is particularly rich, and has been registered as a national nature reserve and wildlife sanctuary (hortobágy national park). moreover, it was selected as part of the pilot project area for the phare-sponsored hungarian national biodiversity monitoring program (müller et al., 2000). coring a 463 cm long undisturbed sediment core was collected using a rod-operated piston corer from the deepest part of the oxbow (~2m depth, fig. 1) in spring in 2009. subsamples (1 cm3) were taken at 2 cm intervals and analyzed for grain size distribution, organic content, subfossil photosynthetic pigments and cladocera remains. sediment chronology historical records of major flood events at river tisza were used to determine the chronology of the sediment core. a public database of stream flow of the river tisza is available at http://www.hydroinfo.hu. daily stream flow has been recorded since 1856. the largest floods were determined by selecting events exceeding the highest flood warning level (iii level: 800 cm) at the staff gage at vásárosnamény. based on the time of establishment, the age of the core bottom was set at 1860. the next time horizon is the trace of a 1888 flood, which was one of the highest ever-recorded floods of river tisza (nyárády, 1900; lászlóffy, 1982; braun et al., 2000). braun et al. (2010) drilled a long sediment core in a nearby site of marótzugi-holt-tisza in 1997, and published a 137cs based chronology for marótzugi-holt-tisza. we could successfully apply the same 137cs chronology to our sediment core after parallelizing the loi profiles of the two cores. grain size and subfossil pigment analyses to determine the grain size distribution, sediment subsamples were oven-dried at 105°c for at least 24 h before recording dry mass. dried and grinded samples were mixed with 0.5 ml 0.002 m sodium-oxalate, then 2 ml concentrated glycerin were added. the samples were analyzed for particle size using a malvern mastersizer 2000. this system measures volumetric grain sizes between 0.12000 µm by analyzing in situ the angle of refraction of a laser beam that is aimed through the container holding the sediment-diluent mix. flood events were arbitrary defined as sediment layers containing more than 3% of fine sand (50 µm grain size). when the fine sand portion was less than 3% we defined the water regime of the oxbow as lentic, otherwise it was lotic. organic sediment content was determined as lost on ignition (loi) according to standardized methods (heiri et al., 2001). subfossil photosynthetic pigments were extracted with acetone and determined spectrophotometrically as chlorophyll degradation residues (spdu, subfossil pigment degradation units). the absorbance of the liquid phase was measured at 666 and 750 nm after sedimentation. the weight of the solid phase was measured after evaporating the acetone and drying until constant weight. spdu values were calculated according to vallentyne (1955). subfossil cladoceran subsamples for the subfossil cladoceran analysis were deflocculated in 10% koh. after the koh treatment, sediment samples were treated with 10% hcl in order to remove carbonaceous particles, and with 40% hf (for 2 h) to eliminate sand and clay fractions (frey, 1986). cladocera remains were collected by sieving through a 35 μm mesh (frey, 1986). only well preserved chitinous remains (headshields, carapaces, post-abdomens, post-abdominal claws, and ephippia) were considered to determine the density of cladocera species. fragments were counted only if unambiguous diagnostic marks were evident. the most frequent body parts of each taxon were used to estimate of the abundance of individuals as density (n. ind cm–3 of fresh sediment). the composition of the cladocera community was estimated based on the determination of at non co mmerc ial us e o nly 134 j. korponai et al. least 300 individuals in each subsample (korhola and rautio, 2001). taxonomical identification was carried out according to frey (1950, 1962, 1988, 1991), goulden and frey (1963), gulyás and forró (1999), sebestyén (1965, 1969, 1970, 1971), szeroczyńska and sarmaja-korjonen (2007), and whiteside et al. (1978). statistical analyses statistical analyses were carried out on cladocera logtransformed (log(x+1)) density data. we used hierarchical clustering on transformed data to reveal temporal changes in species structure. after calculating the euclidean distances, the ward agglomerative cluster analysis was applied. constrained cluster analysis was done to obtain homogeneous cladocera assemblage zones. clusters were formed on the basis of minimal within-group squared euclidean distances between objects (coniss, grimm, 1987). significant stratigraphic zones were determined by applying the broken stick model on coniss clustering. the classification of stages characterized by different water regime (lotic and lentic) was tested by linear discriminant analysis (lda) applied to transformed cladoceran data. differences in loi, spdu and lda during lotic and lentic stages were tested by kruskall-wallis (k-w) test. similarity percentage (simper) analysis based on braycurtis dissimilarity index was applied to outline cladoceran species responsible for community changes during lotic and lentic water regimes. lowess smoothing was applied for discriminant scores with 0.1 span. all statistical analyses were performed in the r statistical programming language (r development core team, 2010) using the rioja (juggins, 2009) and vegan (oksanen et al., 2016) packages. results sediment description and lithology the entire length of the sediment sequence was 463 cm, and four sections were distinguished on the basis of their different aspect (fig. 2). the oldest samples (463-201 cm depth) were characterized by alternating layers of coarse fig. 2. stratigraphy plot for medium and fine sand fractions in grain size distribution, loss on ignition (loi), sediment pigment degradation units (spdu), total cladocera abundances and discriminant (lda) scores in the sediment core of marótzugi-holt-tisza oxbow. red line: lowess smoothing of ld scores with 0.1 span; bold numbers indicate time horizons: 1888 largest historical flood; 1968 and 1986 according to 137cs based dating from braun et al. (2010), numbers in italics refer to inferred dates of major floods. non co mmerc ial us e o nly reconstruction of flood events in an oxbow lake 135 sand and clay silt. organic matter contents were low (around 2%) in the deepest layers (463-431 cm), which contained coarse calcareous concretions between 459-454 cm (fig. 2). from 431 cm to the top high clay content was found, generally accompanied by sandy and coarse layers of different thickness, and by thin black organic bands. organic matter (loi%) content varied between 3 and 9% of dry matter. two further subsections could be distinguished by loi (fig. 2). the lower subsection (431-130 cm depth) had lower loi content (~4%), while values increased up to 4-9% (mean=6%) above 130 cm depth. between 431 and 201 cm depth only coarse silt and sand layers were found (fig. 2). thick coarse sand and clay layers were found at 431-413, 410-380, and 375-369 cm depth, while thinner sand bands were recognized at 346348, and 331-330 cm. finally, an organic rich sand belt was found between 325 and 319 cm (fig. 2). thin sand bands were also recognized at 265, 255, 232, 210 cm (fig. 2). from 200 cm to the core top, eight thin black bands with high organic content were found at 127, 126, 125, 121, 116, 106, 101 and 100 cm, and further light brownish layers at 93-85, 73-70, and 68 cm. spdu content increased from 194 cm depth to the core top (fig. 2). average spdu was 0.167 1 g dm–1 between 462-190 cm and 3.439 g dm–1 from 190 cm to the core top. core chronology eleven large flood events were recognized in the hydrological history of the river tisza. the mark of a large disturbance in the sediment record was found at 454 cm as a calcareous concretion (fig. 2). digging new riverbed and isolating the river bend caused a large disturbance, and the corresponding sediment layer was therefore assumed as the time horizon of oxbow establishment in 1860. three thick coarse sandysilt layers at 431-413, 410-380, and 375-329 cm depth were interpreted as deposited between the 1870s and 1895. in fact, particularly large floods were historically recorded in 1876, 1881, 1888 and 1895. as peaks of medium size sand particle fractions mark the beginning of flood events (schweitzer et al., 2002), these layers were selected to indicate 1876, 1881, 1888 and 1895 years, respectively (fig. 2). sandy clay layers and peaks of medium size sand particle fractions at 340, 324, 315, 274, 258, 110, 70 and 42 cm were interpreted as markers of large historical floods in 1915, 1919, 1925, 1932, 1940, 1964, 1970 and 1979. the increase in loi and spdu values from 185 cm depth to the sediment top was interpreted as time horizon for the beginning of the building of a large dam and a reservoir close to the village tiszalök. this reservoir could stabilize the water regime of marótzugi oxbow, since the dam at tiszalök has a backwater effect in increasing the minimal water level which reaches the 628th river km. average sedimentation rates were estimated by applying a linear model to the core depth-flood profile. values were high, ranging between 3.05-3.62 cm y–1, below 75 cm depth, and gradually decreased down to 1.1 cm y–1 in the upper core section. during periods of enhanced flood frequency (i.e.,1881-95, 1932-40, 1940-50,1963-68, 1968-1970) sedimentation rates were particularly high, i.e., 4.3, 5.7, 7.3, 5.7 and 7 cm y–1 respectively. subfossil cladocera no cladocera remains were found in the deepest core section between 462 and 430 cm. very few remains were found in the sediment layers between 428-184 cm, while cladocera abundances gradually increased from the core bottom to the surface (fig. 2). overall, 34 cladocera species were found in the studied sediments sequence (fig. 3). all the species are characteristic for littoral habitats of eutrophic shallow lakes, with dense macrophytes belts. the hierarchical clustering grouped the identified cladoceran species according to their abundance into four clusters. only one species, the planktonic b. longirostris, was included in the first cluster, though remains of this species dominated the cladocera assemblages throughout the whole core (fig. 3). alona rectangula (sars, 1862) and chydorus sphaericus (o.f. müller, 1776) were the characterizing species of the second cluster. density of these euryecious species, which are very common in the majority of freshwaters, was high in layers between 110 and 70 cm depth. these species are. the third cluster included fourteen species, which were present throughout the core though with low abundances. rare species were grouped into the fourth cluster. four statistically significant zones were distinguished along the core on the basis of abundance of cladocera remains. cl-1 zone (462-184 cm) albeit a number of the deepest core layers were empty (fig. 2), remains of 30 cladoceran species were found in this zone (fig. 3). species abundances were very low (1-100 ind cm –3) except for b. longirostris, which reached a maximum of 300 ind cm–3 (fig. 2) at 312 cm. the zone was characterized by a variety of phytophilous chydorids, which were included in the second and third species cluster. pelagic b. longirostris was the dominant species, but c. sphaericus, a. rectangula, diparalona rostrata (koch, 1841), eurycercus lamellatus (o. f. müller, 1785), and acroperus harpae (baird, 1834) were also very abundant in this zone (fig. 3). cl-2 zone (184-112 cm) this zone was characterized by low numbers of cladocera remains, corresponding to total species densities varying between 0.5 and 516 ind cm–3 (fig. 3). the non co mmerc ial us e o nly 136 j. korponai et al. fig. 3. cladocera statigraphy for marótzugi-holt-tisza oxbow. bosm_long: bosmina longirostris, alon_nana: alonella nana, grap_test: graptoleberis testudinaria,acr_harp: acroperus harpae, alon_exig: alonella exigua, alon_cost: alona costata, sida_crys: sida crystallina, alon_affi: alona affinis, pleu_laev: pleuroxus laevis, alon_quad: alona quadrangularis, pleur_trig: pleuroxus trigonellus, eur_lame: eurycercus lamellatus, disp_rost: disparalona rostrata, alon_gutt: alona guttata, leyd_leyd: leydigia leydigi, chyd_spha: chydorus sphaericus, alon_rect: alona rectangula, alon_rust: alona rustica, ilio_sp: iliocryptus sp., kurz_lati: kurzia lattissima, mono_disp: monospilus dispar, alon_exci: alonella excisa, pleu_unci: pleuroxus uncinatus, lept_sp: leptodora kindti, pleu_adun: pleuroxus aduncus, chyd_pige: chydorus piger, simo_sp: simocephalus sp., pleu_trun: pleuroxus truncatus, leyd_acan: leydigia acanthocercoides, oxyu_tenn: oxyurella tenuicaudis, ceri_ephip: ceriodaphnia ephippia, camp_rect: camptocercus rectirostris, daph_sp.: daphnia sp., non co mmerc ial us e o nly reconstruction of flood events in an oxbow lake 137 number of cladocera species (26) in this zone was slightly lower with respect to zone 1. the most common species was again b. longispina, which accounted for an average of 80% of total cladoceran abundances. the following most abundant five species, i.e., c. sphaericus, a. rectangula, leydigia leydigi (schoedler, 1863), alona quadrangularis (o. f. müller, 1785) and a. harpae, accounted together only for 1% of cladocera, while other cladocerans species occurred with very low densities and their contribution remained below 1% (fig. 2). cl-3 zone (112-72 cm) cladoceran species richness was similar to the previous zone, as 28 species were identified from the remains. b. longirostris accounted for the highest portion (51%) of cladoceran abundance, while a. rectangula, c. sphaericus, and alonella nana (baird, 1850) were found with a slightly higher than 5% (fig. 3). cl-4 zone (72-0 cm) in the top zone, 28 cladocera species were identified, among which b. longirostris again showed an overwhelming dominance exceeding 90% of the total cladocera abundance. only c. sphaericus reached a 3% of the total cladocera abundance, while all the other species did no exceed 1% (fig. 3). simper analysis revealed that b. longirostris, c. sphaericus, a. recangula, a. harpae, l. leydigi, a. quadrangularis, and a. nana were the most important species in determining the dissimilarity of cladoceran assemblages during lotic and lentic stages in the oxbow lakes. the species number was somewhat higher in lentic layers than in lotic ones (31 and 28 respectively). remains of iliocryptus sp. (sars, 1862) and monospilus dispar (sars, 1862) were only found in lotic layers, while remains of alona rustica (scott, 1895), alonella excisa (fischer, 1854), chydorus piger (lilljeborg, 1853), kurzia latissima (kurz, 1875) and simopcephalus sp. (schoedler, 1858) occurred only in lentic ones, the others were common to both. lentic layers also contained more remains, and average cumulative density of lentic cladocerans was twice so high that of lotic ones (23,986 ind cm–3 and 11,685 ind cm–3, respectively). statistical analysis of water regime states linear discriminant analysis (lda) of subfossil cladoceran assemblages confirmed the differences between lotic and lentic water regime stages. group centroids of the lda scores of the different water regimes were well significantly separated (wilks’s λ=0.7866, df=1, p<0.05, fig. 4), and lda scores were significantly correlated with the proportion fine sand (r=-0.3695, t=-6.0434, df=231, p<0.001). lda scores were positive during lentic stages, while negative scores reflected lotic conditions. smoothed lda discriminant scores exhibited strong negative correlation with fine sand fraction (r=-0.4658, t=-8.0006, df=231, p<0.001). loi content correlated negatively with the fine sand fraction (r=-0.3288, t=-5.2918, df=231, p<0.001), and positively with lda scores (r=0.3169, t=5.0795, df=231, p<0.001). furthermore, spdu exhibited a weak negative correlation to the fine sand fraction (r=-0.1622, t=-2.4996, df=231, p<0.013), as well as a positive relation with discriminant scores (r=0.3168, t=5.0768, df=231, p<0.001). lotic sediment layers showed significantly lower loi and spdu values (loi: k-w test, χ2=9.9031, df=1, p<0.01; spdu: k-w test, χ2=6.7706, df=1, p<0.01). in order to test for significant differences in cladocera community composition between lotic and lentic stages, we redefined lotic and lentic regimes by lda scores. layers with negative lda scores were considered as lotic, while layers with positive lda scores were put into lentic groups. both loi and spdu contents were significantly higher in lda based lentic sediment layers (loi: k-w test, χ2=29.165, df=1, p<0.001); spdu: k-w test, χ2=42.352, df=1, p<0.001). discussion our sediment core was 120 cm longer than the core analyzed by braun et al. (2000, 2009), and it covered a time span of 150 years, i.e., from oxbow establishment to the present. the estimated average sedimentation rate (3.53 cm y–1) agrees with the values reported by braun et al. (2009). the sediment record represents two main developmental stages of marózugi-holt-tisza. from the oxbow establishment in 1860 to 1950 the water regime of the lake was determined by height and duration of floods (fig. 2). sedimentation rates were quite high, with a mean value of 3.6 cm y–1. the construction of a large dam for electricity generation and irrigation supply for the eastern part of hungary was started in 1950 and concluded in 1959 at kisköre (fig. 1). the dam has increased minimum water levels in the riverbed by 3 m and its effect can be recognized upstream for 623 river km (lászlóffy, 1982). this enhanced the groundwater inflow to the oxbow, which in turn stabilized its water regime and established stable lentic conditions (babka et al., 2011). increasing organic materials and pigment contents were measured in the sediments of marózugi-holt-tisza after 1950 (fig. 2). since meroand euplanktonic algae exhibit higher production in lentic or slow running waters (istvánovics and honti, 2011), and high organic material and pigment contents are found in sediments of highly productive lakes (korponai et al., 2010a, 2011), the increased loi and spdu content has been interpreted as a marker for to the development of lentic conditions in the oxbow since 1950. size distribution of sediment sand non co mmerc ial us e o nly 138 j. korponai et al. fractions was used for tracking flood events. the bulk of the suspended solids (ss) arrive and settle in the floodplain at the beginning of a flood (csépes et al., 2002; schweitzer et al., 2002), and loading depends on the intensity of flush. in fact, coarser fractions settle and accumulate in the floodplain regions closer to the riverbed, while finer particles settle in oxbows as ss (kiss and fejes, 2000). therefore, high proportions of medium and fine sand fractions in sediment of marotzugi-holt-tisza may correspond to major flood events. using the proportions of sand fractions of sediment layers to define lotic (during floods) and lentic stages (in periods between floods) of the oxbow studied, we found significantly higher loi and spdu contents in lentic stages in the sediment profile (fig. 2). reconstructed cladocera communities of marotzugiholt-tisza oxbow consisted of species which are very common in hungary, and can be collected from almost all types of lakes and ponds. the observed shifts in cladocera communities reflected environmental changes in the oxbow. absence of cladocera remains in the deepest core layers likely indicate that this sediment section represents the original riverbed (fig. 3). zsuga (1981) found no benthic cladocerans in the upper portion of river tisza, but she found some species with very low densities in the lower river stretch. moreover, investigations of the stream complex of the lower river tisza revealed structured zooplankton communities in slow-flowing streams and in oxbows (pujin et al., 1986; pujin and ratajac, 1988; ratajac, 1989, 1992). regime shifts from lotic to lentic conditions of large rivers in hungary (river danube and river tisza) could be associated to increasing zooplankton diversity and density (vadadi-fülöp et al., 2008, 2009; zsuga, 1998). as very few cladoceran remains were found in cl-1 zone, we interpreted this section as deposited during a lotic, flood-determined stage (fig. 3). since 1950, the oxbow has become more lentic, as confirmed by the pattern in the smoothed curve of lda scores, which serves as a proxy for water regime shift. in fact, lda scores remain negative during lotic stages, while become positive during lentic stages of the marótzugi-holt-tisza (fig. 2). oxbow lakes and shallow reservoirs typically show dense macrophytes beds with high cladoceran abundances (gulyás and forró, 1992; zsuga et al., 2004, korponai et fig. 4. distribution of discriminant (lda) scores in lentic and lotic status of sediment layers. non co mmerc ial us e o nly reconstruction of flood events in an oxbow lake 139 al., 2010a, 2010b, 2010c). remains of a. harpae, e. lamellatus, disparalona rostrata (koch, 1841), pleuroxus trigonellus (o. f. müller, 1785), and sida crystallina (o. f. müller, 1776) indicate presence of macrophytes in the oxbow (gulyás and forró, 1992; korhola and rautio, 2001; korponai et al., 2010a). large floods occurred mainly in spring and autumn, while lower water levels in summer promoted the development of the macrophyte belt in marótzugi-holt-tisza. as a consequence, remains of phytophyllous cladocerans were found also in the lotic layers of the core (figs. 2 and 3). cl-1 zone covers the timespan 1876-1950, that can be described as the period of regulation works at river tisza, when subsequent large floods inundated its floodplains covered them with thick sediment layers. during floods thick suspended solids layers buried all habitats that prevented recovery of cladoceran community from egg banks (vaničková et al., 2011), but resting eggs could been washed in with floods from other habitats allowing development of new populations after floods (havel et al., 2000). the low number of remains in this core section therefore can be explained by the slow recovery of the cladoceran community from sediment egg banks. in cl-2 and cl-3 zones (between 1950-1970) the co-occurrence of a high proportion of bosmina longirostris and of phytophyllous cladoceran species indicates the development of a macrophyte bed with large open water patches due to a lentic water regime (galbarczyk-gąsiorowska et al., 2009). in cl-4 zone, the absolute dominance of b. longirostris since 1970 is related to strong human impacts. in fact, small bodied cladocerans as b. longirostris typically dominate in eutrophic waters with high fish abundance (jeppesen et al., 2011; goslar et al.,1999; galbarczyk-gąsiorowska et al., 2009). the high proportion of b. longirostris in marótzugi-holt-tisza can be related to a fish effect, since this oxbow has been utilized as a fish pond since 1961. the majority of species composing the cladoceran assemblages found in the sediment studied were common throughout the whole core. we did not find remarkable differences in species compositions of lotic and lentic communities, but densities were higher during lentic conditions. three-fold more remains were found in lentic layers than in lotic ones. remains of mud dwellers, i.e., iliocryptus sp. and monospilus dispar, were found exclusively in lotic sediment layers. these species prefer sandy or muddy surfaces, which establish after floods (sebestyén, 1965, 1970, frey, 1986, 1988, kattel et al., 2007). species which were found in lentic layers of marótzugi-holt-tisza (a. rustica, a. excisa, c. piger, k. latissima and simocephalus sp.) were recorded from shallow lakes and ponds in hungary in macrophytes belts (korponai et al., 2010a). galbarczyk-gąsiorowska et al. (2009) found that remains of a. excisa, and k. latissima were associated with macrophyte occurrence in a lakebog transition zone in stare biele mire. although a large number of common species were found both in lotic and lentic layers, lda analysis confirmed separation of the two stages (fig. 4). for testing how cladocerans can indicate lotic/lentic states, we redefined lotic and lentic attributes of sediment layers by lda scores. the two lda-based regime were clearly different from each other, thus outlining that lotic and lentic water regimes can be distinguished based on their cladoceran communities . in order to understand how much ldabased lotic-lentic categories correspond to proportion of fine sand, we compared how many layers changed their attributes. we found that 71% of sediment layers kept their original status, 14% changed their own character from lotic to lentic, while 15% of layers turned from lentic to lotic. this means that if we determine lotic or lentic conditions based only on subfossil cladocera communities, our determination would be correct in 71% of cases. conclusions marótzugi-holt-tisza has gradually evolved from a lotic to a lentic (pond) system during the last ~150 years, and all the stages of this evolution were recorded in sediment studied. marótzugi-holt-tisza was lotic until 1950 but has now become a lentic system. this transition was determined by the frequent floods of river tisza and it was reflected by changes in the zooplankton community. lotic systems showed lower zooplankton densities, but were typically characterized by mud dweller species, as monospilus dispar and iliocryptus sp. bosmina longirostris can be regarded as indicator of human impact, since the studied oxbow has been intensively utilized as a fishpond for anglers. this work showed that flood events can drive changes in cladoceran communities, and that subfossil cladocera remains can be successfully used to track shifts from lotic to lentic water regimes in oxbow lakes. acknowledgments this study was financially supported by the hungarian national science foundation, otka-t 049098 and the hungarian national research and development program balöko 3b022/04, támop 4.2.2-08/1-2008-0020, támop 4.2.1/b-09/1/konv-2010-0006. references babka b, futó i, szabó s, 2011. clustering oxbow lakes in the upper-tisza region on the basis of stable isotope measurements. j. hydrol. 410:105-113. non co mmerc ial us e o nly 140 j. korponai et al. botár i, károlyi zs, 1971. [the regulation of the tisza. part i. (1846-1879)].[article in hungarian]. vizdok, budapest. braun m, papp i, korponai j, lukács v, gyulai i, forró l, hubay k, szalóki i, 2010. [traces of water level changes in the sediment of marótzug oxbow lake].[article in hungarian with english abstract]. hidrol. közl. 90:20-22. braun m, tóth a, alapi k, dévai g, lakatos g, posta j, szalóki i, 2000. environmental history of oxbow ponds: a sediment geochemical study of marót-zugi-holt-tisza. tiscia 5:133-138. csépes e, bancsi i, végvári p, aranyné rózsavári a, 2003. [investigation of alluvion in the middle section of river tisza (from kiköre to szolnok)].[article in hungarian]. proc. 21st ann. meet. hungarian hydrological society 2-3:1-10. frey dg, 1950. the taxonomic and phylogenetic significance of the head pores of the chydoridae (cladocera). int. rev. ges. hydrobiol. 44:27-50. frey dg, 1962. cladocera from the eemian interglacial of denmark. j. paleontol. 36:1133-1154. frey dg, 1986. cladocera analysis, p. 692-667. in: b.e. berglund (ed.), handbook of palaeooecology and palaeohydrology. j. wiley & sons, chichester. frey dg, 1988. littoral and offshore communities of diatoms, cladocerans and dipterous larvae, and their interpretation in paleolimnology. j. paleolimnol. 1:179-191. frey dg, 1991. first subfossil records of daphnia headshields and shells (anomopoda, daphniidae) about 10 000 years old from northernmost greenland, plus alona guttata (chydoridae). j. paleolimnol. 6:193-197. galbarczyk-gąsiorowska l, gąsiorowski m, szeroczyńska k, 2009. reconstruction of human influence during the last two centuries on two small oxbow lakes near warsaw (poland). hydrobiologia 631:173-183. goslar t, ralska-jasiewiczowa m, van geel łącka b, szeroczyńska k, chróst l, walnus a, 1999. anthropogenic changes in the sediment composition of lake gościąż (central poland), during the last 330 yrs. j. paleolimnol. 22:171-185. goulden ce, frey dg, 1963. the occurrence and significance of lateral head pores in the genus bosmina (cladocera). int. rev. ges. hydrobiol. 48:513-522. grimm ec, 1987. coniss: a fortran 77 program for stratigraphically constrained cluster analysis by the method of incremental sum of squares. comput. geosci. 13:13-35. gulyás p, forró l, 1999. [a guide for the identification of cladocera occurring in hungary].[book in hungarian]. kgi, budapest. gulyás p, forró l, 1992. composition and abundance of microcrustacean fauna in the upper reservoir (hídvégi-tó) of the kis-balaton. miscnea zool. hung. 7:39-51. havel je, eisenbacher em, black aa, 2000. diversity of crustacean zooplankton in riparian wetlands: colonization and egg banks. aquat ecol. 34:63-76. heiri o, lotter af, lemcke g, 2001. loss on ignition as a method for estimating organic and carbonate content in sediments: reproducibility and comparability of results. j. paleolimnol. 25:101-110. istvánovics v, honti m, 2011. phytoplankton growth in three rivers: the role of meroplankton and the benthic retention hypothesis. limnol. oceanogr. 56:1439-1452. jeppesen e, nõges p, davidson ta, haberman j, nõges t, blank k, lauridsen tl, søndergaard m, sayer c, laugaste r, johansson ls, bjerring r, amsinck sl, 2011. zooplankton as indicators in lakes: a scientific-based plea for including zooplankton in the ecological quality assessment of lakes according to the european water framework directive (wfd). hydrobiologia 676:279-297. juggins s, 2009. rioja: analysis of quaternary science data, r package ver. 0.5-6. available from: http://cran.r-project.org/ package=rioja. kattel gr, battarbee rw, mackay a, birks hjb, 2007. are cladoceran fossils in lake sediment samples a biased reflection of the communities from which they are derived? j.paleolimnol. 38:157-181. kiss t, fejes a, 2000. flood caused sedimentation on the foreshore of the river tisza. acta geograph. 37:51-55. knowlton me, jones jr, 1997. trophic structure of misouri river floodplain lakes in relation to basin type and connectivity. wetlands 17:468-475. korhola a, rautio m, 2001. 2. cladocera and other branchiopod crustaceans, p. 1-38. in: j.p. smol, h.j.b. birks and w. m. last (eds.), tracking environmental change using lake sediments, vol. 4. zoological indicators. kluwer academic publishers, dordrecht. korponai j, braun m, buczkó k, gyulai i, forró l, nédli j, papp i, 2010a. transition from shallow lake to a wetland: a multi-proxy case study in zalavári pond, lake balaton, hungary. hydrobiologia 641:225-244. korponai j, braun m, gyulai i, forró l, nédli j, papp i, 2010b. [are the cladocera remains in sediment suitable for reconstruction of diversity of cladoceran community of lakes?]. [article in hungarian with english abstract]. hidrol. közl. 90:66-68. korponai j, braun m, gyulai i, forró l, nédli j, papp i, 2010c. [paleolimnological reconstruction of naturally cut-off oxbow by geochemical and cladocera remains proxies].[article in hungarian with english abstract]. hidrol. közl. 90:68-70. korponai j, k. varga ka, lengré t, papp i, tóth a, braun m, 2011. paleolimnological reconstruction of the trophic state in lake balaton (hungary) using cladocera remains. hydrobiologia 676:237-248. lászlóffy w, 1982. [the river tisza].[book in hungarian]. akadémiai kiadó, budapest: 610 pp. luoto tp, nevalainen l, kultti s, sarmaja-korjonen k, 2011: an evaluation of the influence of water depth and river inflow on quantitative cladocera-based temperature and lake level inferences in a shallow boreal lake. hydrobiologia 676:143-154. müller z, dévai gy, miskolczi m, kiss b, tóth a, nagy s, grigorszky i, jakab t, 2000. [study on dragonflies as indicators of biotope heterogeneity in the active floodplain of river tisza between tiszabercel and gávavencsellő].[article in hungarian with english abstract]. hidrol. közl. 56:373-376. nyárádi l, 1900. [water regulation and floodprotection, p. 278294]. in: s. borovszky and j. sziklay (eds.), [counties and cities of hungarian kingdom].[book in hungarian]. budapest. oksanen j, blanchet gj, friendly m, kindt r, legendre p, mcglinn d, minchin pr, o’hara pb, simpson gl, solymos non co mmerc ial us e o nly reconstruction of flood events in an oxbow lake 141 p, stevens mhh, szoecs e, wagner h, 2016. vegan: community ecology package. r package version 2.4-1. available from: https://cran.r-project.org/package=vegan. pálfai i, 2001. [oxbow-lakes in hungary].[in hungarian with english abstract]. ministry for transport and water management: budapest, budapest. pujin v, ratajac r, 1988. structure and dynamics of zooplanktonin the dead theiss. tiscia 23:51-59. pujin v, ratajac r, djukić n, 1986. [ein beitrag zur limnologischen untersuchungen der carska bara].[article in german]. tiscia 21:69-80. r development core team, 2010. r: a language and environment for statistical computing. r foundation for statistical computing, vienna, austria. available from: http://www.rproject.org ratajac r, 1989. the composition and the dynamics in population of the dominant crustacea species in mrtva tisza. tiscia 24:49-57. ratajac r, 1992. the structure and dynamics of cladocera in the yugoslavian section of the river tisza. tiscia 26:59-61. schweitzer f, nagy i, alföldi l, 2002. [relationship between the formation of point bars and natural levees and flood bed sedimentation along the middle stretches of tisza river].[article in hungarian]. föld. ért. 51:257-278. sebestyén o, 1965. [cladocera studies in lake balaton iii. preliminary studies for lake history investigations].[article in hungarian with english abstract]. annal. biol. tihany 36:229-256. sebestyén o, 1969.[cladocera studies in lake balaton iv. quaternary remains in the sediment of lake balaton i].[article in hungarian with english abstract]. annal. biol. tihany. 36:229-256. sebestyén o, 1970. [cladocera studies in lake balaton iv. quaternary remains in the sediment of lake balaton ii].[article in hungarian with english abstract]. annal. biol. tihany. 37:247-279.). sebestyén o, 1971. [cladocera studies in lake balaton iv. quaternary remains in the sediment of lake balaton iii].[article in hungarian with english abstract]. annal. biol. tihany. 38:227-268. szeroczyńska k, sarmaja-korjonen k, 2007. atlas of subfossil cladocera from central and northern europe. friends of the lower vistula society, świecie, poland. vadadi-fülöp cs, 2009. zooplankton (cladocera, copepoda) dynamics in the river danube upstream and downstream of budapest, hungary. opusc. zool. budapest 40:87-98. vadadi-fülöp cs, mészáros g, jablonszky gy, hufnagel l, 2008. the zooplankton of the ráckeve-soroksár danube: spatio-temporal changes and similarity patterns. appl. ecol env. res. 6:121-148. vallentyne jr, 1955. sedimentary chlorophyll determination as a palaeobotanical method. can. j. bot. 33:304-313. vaníčková i, seda j, petrusek a, 2010. the stabilizing effect of resting egg banks of the daphnia longispina species complex for longitudinal taxon heterogeneity in long and narrow reservoirs. hydrobiologia 643:85-95. whiteside mc, williams jb, white cp, 1978. seasonal abundance and pattern of chydorid, cladocera in mud and vegetative habitats. ecology 59:1177-1188. wolfe bb, hall ri, last wm, edwards twd, english mc, karst-riddoch tl, paterson a, palmini r, 2006. reconstruction of multi-century flood histories from oxbow lake sediments, peace-athabasca delta, canada. hydrol. process. 20:4131-4153. zsuga k, 1981. benthic entomostraca fauna of the tisza and its tributaries. tiscia 16:183-190. zsuga k, 1998. spatial heterogeneity and mosaic-like structure of zooplankton in kisköre reservoir. int. rev. hydrobiol. 83:199-202. zsuga k, 1999. zooplankton investigations in the upper tisa region. tiscia monogr. ser. 4:393-399. zsuga k, tóth a, pekli j, udvari zs, 2004. [the changes in the zoopklankton of the watershed of the river tisza from 1950s to the present].[article in hungarian with english abstract]. hidrol. közl. 84:175-178. non co mmerc ial us e o nly advances in oceanography and limnology layout 1 introduction concerns regarding the presence of cyanobacterial toxins (cyanotoxins) in drinking water and associated health effects have raised research and public health interest worldwide. microcystins (mcs) are probably the most frequently found cyanotoxins which can be produced by various cyanobacterial genera including water bloomand scum-forming planktonic cyanobacteria such as dolichospermum (formerly anabaena), microcystis or planktothrix (manganelli et al., 2012). cyanobacteria representing these genera have been previosly identified in ghanaian water reservoirs along with other cyanobacterial species potentially producing mcs (addico et al., 2006, 2009, 2017). mcs are highly toxic for mammals with acute ld50 as low as 50-60 µg kg–1, mouse, i.p. (bláha et al., 2009; van apeldoorn et al., 2007). their acute effetcs are primarily manifested in liver but mcs have been shown to induce gastrointestinal and renal damage or neurological symptoms as well (manganelli et al., 2012). chronic exposures to mcs have been linked to tumor promoting and carcinogenic effects which is based on laboratory animal and in vitro experiments (svircev et al., 2010) and supported also by results of epidemiologic studies of human population consuming drinking water contaminated by these cyanotoxins (fleming et al., 2002; svircev et al., 2009, 2013, 2014; ueno et al., 1996; yu et al., 1995; zhou et al., 2002). in fact, mcs have been classified as possible human carcinogen (class 2b) by the international agency for research on cancer (grosse et al., advances in oceanography and limnology, 2017; 8(1): 92-106 article doi: 10.4081/aiol.2017.6323 this work is licensed under a creative commons attribution-noncommercial 4.0 international license (cc by-nc 4.0). cyanobacteria and microcystin contamination in untreated and treated drinking water in ghana gloria naa dzama addico,1* jörg d. hardege,2 jiří kohoutek,3 k.a.a. degraft-johnson,1 pavel babica3,4 1csir water research institute, achimota, accra, ghana; 2biological science department, university of hull, united kingdom; 3recetox research centre for toxic compounds in the environment, faculty of science, masaryk university, brno, czech republic; 4department of experimental phycology and ecotoxicology, institute of botany, czech academy of sciences, brno, czech republic *corresponding author: naadzama443@hotmail.com abstract although cyanobacterial blooms and cyanotoxins represent a worldwide-occurring phenomenon, there are large differences among different countries in cyanotoxin-related human health risk assessment, management practices and policies. while national standards, guideline values and detailed regulatory frameworks for effective management of cyanotoxin risks have been implemented in many industrialized countries, the extent of cyanobacteria occurrence and cyanotoxin contamination in certain geographical regions is underreported and not very well understood. such regions include major parts of tropical west and central africa, a region constisting of more than 25 countries occupying an area of 12 million km2, with a total population of 500 milion people. only few studies focusing on cyanotoxin occurrence in this region have been published so far, and reports dealing specifically with cyanotoxin contamination in drinking water are extremely scarce. in this study, we report seasonal data on cyanobacteria and microcystin (mc) contamination in drinking water reservoirs and adjacent treatment plants located in ghana, west africa. during january-june 2005, concentrations of mcs were monitored in four treatment plants supplying drinking water to major metropolitan areas in ghana: the treatment plants barekese and owabi, which serve kumasi metropolitan area, and the plants kpong and weija, providing water for accra-tema metropolitan area. hplc analyses showed that 65% samples of raw water at the intake of the treatment plants contained intracellular mcs (maximal detected concentration was 8.73 µg l–1), whereas dissolved toxins were detected in 33% of the samples. significant reduction of cyanobacterial cell counts and mc concentrations was achieved during the entire monitoring period by the applied conventional water treatment methods (alum flocculation, sedimentation, rapid sand filtration and chlorination), and mc concentration in the final treated water never exceeded 1 µg l–1 (who guideline limit for mc-lr in drinking water). however, cyanobacterial cells (93-3,055 cell ml–1) were frequently found in the final treated water and intracellular mcs were detected in 17% of the samples (maximal concentration 0.61 µg l–1), while dissolved mcs were present in 14% of the final treated water samples (maximal concentration 0.81 µg l–1). it indicates a borderline efficiency of the water treatment, thus mc concentrations in drinking water might exceed the who guideline limit if the treatment efficiency gets compromised. in addition, mc concentrations found in the raw water might represent significant human health risks for people living in areas with only a limited access to the treated or underground drinking water. key words: cyanobacteria; cyanotoxins; drinking water treatment; microcystins; water blooms. received: october 2016. accepted: may 2017.non -co mmerc ial us e o nly microcystins in drinking water in ghana 93 2006). in addition, other epidemiological studies associated exposures to toxic cyanobacterial blooms and mcs with chronic liver damage (chen et al., 2009; li et al., 2011; zhang et al., 2015), and mcs were also implicated in neurotoxicity and neurodegenerative diseases (feurstein et al., 2009, 2010). mcs are therefore regarded as human health hazard. exposure of human beings to mcs can occur via different routes, such as recreational and sport activities in contaminated water, consumption of contaminated fish products or food supplements, and consumption of contaminated drinking water (manganelli et al., 2012). the world health organization (who) set a provisional guideline limit of 1 µg l–1 of mc-lr in drinking water (who, 1998). negative health outcomes resulting from drinking of water contaminated with cyanobacteria or cyanotoxins have been reported worldwide (bláha et al., 2009; van apeldoorn et al., 2007; wood, 2016). the only documented case of cyanobacteria-associated poisoning in africa has been reported from harare, zimbabwe, where annual outbreaks of gastroenteritis among infants occurred after development of cyanobacteria blooms of microcystis aeruginosa (kützing) kützing and dolichospermum flos-aquae (bresson ex bornet & flauhault) in lake chievero (zilberg, 1966). however, there is also a documented case of threetime rise of gastroenteritis and 4.3-time increase of liver cancer incidence rate in harare during the period 19902001 (ndebele and magadza, 2006). although the extent to which this situation is linked to algal toxins is unclear, johansson and olsson (1998) reported that mc concentration in lake chievero was around 13.9 µg l–1 and mc was also detected in municipal tap water. in the last decades, mc occurrence has been investigated in some african countries, with mcs reported from northern africa (algeria, egypt, morocco, tunisia), eastern africa (ethiopia, kenya, mozambique, tanzania, uganda), southern africa (botswana, lesotho, south africa) (mowe et al., 2014; harke et al., 2016; ndlela et al., 2016). however, available data about cyanotoxin contamination are still very scarce for most african countries and being nearly absent for regions such as west and central africa (mowe et al., 2014; harke et al., 2016; ndlela et al., 2016). these are two large geographical areas with 26 countries and nearly half a billion inhabitants, where central africa is represented by nine countries populated by approximately 155 mil people, and west tropical africa by 17 countries with a combined population of about 344 mil people (unsd, 2014). toxic or potentially toxic cyanobacterial blooms seem to occur frequently in this geographical area (addico et al., 2006, 2009, 2017; akin-oriola et al., 2006; berger et al., 2006; haande et al., 2007; mhlanga et al., 2006; odokuma and isirima, 2007). nevertheless, mcs in this region have been so far reported from nigeria (chia et al., 2009a, 2009b; chia and kwaghe, 2015) and detected in water reservoirs brimsu, kwanyarko, kpong and weija in ghana (addico et al., 2006; addico et al., 2017). studies investigating cyanotoxins in drinking water and their removal during the water treatment have been even more scarce on the entire african continent, known to be conducted for example in egypt (mohamed and carmichael, 2000), algeria (nasri et al., 2004), south africa (harding et al., 2009), and recently in two drinking reservoirs in central ghana (addico et al., 2017). in the present study, we investigated seasonal occurrence and removal of cyanobacteria and mcs in four treatment plants supplying the two major metropolitan areas in ghana with drinking water. the study provides very rare but important information regarding the efficiency of drinking water treatment, concentrations and health risks of mcs in drinking water in the understudied geographical region of central and west tropical africa. methods study area the barekese reservoir is a mesotrophic reservoir (addico et al., 2009), which lies on latitude 6° 49′ 50.2″ n and longitude 1° 43′ 21.8″ w (fig. 1). this reservoir was formed in 1970, it has a surface area 6.4 km2 and maximal depth 15 m (amuzu, 1975). it is located on the river ofin, which flows through many farming areas before reaching the dam site (kumasi et al., 2011). the owabi reservoir, also mesotrophic (addico et al., 2009), is located on latitude 6° 44′ 35.7″ n and longitude 1°42′ 13.4″ w (fig. 1). it was constructed in 1928 and upgraded in 1954. the reservoir has a surface area about 3.5 km2 and a mean depth 7 m (akoto et al., 2014). the owabi reservoir is fed by seven rivers/streams, all of which flow through the densely populated kumasi metropolitan area and the central business and industrial areas. the owabi and barekese reservoirs are both situated in the ashanti region of ghana and serving as major water supplies to kumasi metropolitan area with a population over 2 mil people. the owabi reservoir is designed to produce up to 20% of the total potable water requirement (akoto et al., 2014), while the barekese treatment plant is providing about 80% of the total piped drinking water to the kumasi metropolis (kumasi et al., 2011). the kpong reservoir, described as mesotrophic (addico et al., 2009), is located in the eastern region of ghana on 6° 07′ 1.3″ n 0° 07′ 31.6″ e (fig. 1). it was constructed in 1981 on the volta river system mainly to provide hydroelectricity to supplement power generated from the volta river dam. it has a total surface area of 38 km2, maximal depth of 15 m with a mean depth of 5 m, and a mean annual flow 1183 m3 s–1 (ansa-asare and ansongnon -co mmerc ial us e o nly g.n.d. addico et al.94 asante, 1998; quarcoopome et al., 2011). the kpong reservoir apart from power generation is also used for drinking water production, irrigation, recreation and also well known for its fisheries, especially the tilapias. the weija reservoir, a eutrophic reservoir (addico et al., 2009), is situated in the greater accra region of ghana and lies on latitude 5° 34′ 7.1″ n and 0° 20′ 44.8″ w (fig. 1). it has a surface area of about 38 km2, a mean depth of 5 m and a mean annual flow of 54.2 m3 s–1 (ansaasare and ansong-asante, 1998, asante et al., 2008). the weija reservoir was built in 1977 on the densu river system. this river system is under intensive threat from heavy pollution mainly from domestic and agricultural wastes. major crops include maize, cassava, pineapples, pawpaw, banana, sugar cane and vegetables. fishing is also very intensive in the reservoir sometimes with the use of chemicals. the kpong and weija reservoirs are the two main drinking water supplies serving the accratema metropolitan area with a population about 2.3 mil people, with the kpong treatment plant providing approximately 47% and the weija plant about 53% of piped drinking water for the metropolis (stoler et al., 2012). drinking water treatment procedure the water treatment procedure in the studied treatment plants starts from the water intake. in most reservoirs, raw water was collected from depths between 5 to 7 m (addico et al., 2006), with the exception of the barekese plant, where the intake point is placed at the level 1.5-3 m from the surface (amuzu, 1975). raw water is sieved using a mesh to remove big objects like plant parts, twigs etc. this step is followed by flocculation using aluminium sulphate (alum) at a 100 mg l–1 dose, mixing and passing fig. 1. map of the reservoirs and treatment plants under the study. the barekese and owabi reservoirs are located in the ashanti region of ghana and supplying kumasi metropolitan area with drinking water. the kpong reservoir is located in eastern region of ghana, and the weija reservoir in greater accra region, both reservoirs are providing drinking water for accra-tema metropolitan area. non -co mmerc ial us e o nly microcystins in drinking water in ghana 95 through baffles to maximise contact time. the flocs are allowed to settle out of the water in sedimentation tanks. the exception is represented by the kpong reservoir water treatment plant, where alum flocculation is not regularly applied during water treatment and water is prechlorinated before the filtration step. filtration is then done by the rapid sand filtration method and the ph is adjusted to between 6.6 and 8.5 using lime. the final stage involves chlorination employing chlorine gas or calcium hypochlorite with a concentration of 0.5 to 1 mg l–1 of residual chlorine after a contact time of about 30 min (fig. 2). all samples from the water intake to chlorination step were collected consecutively and within the same day. it is important to mention that during one time of sampling at the owabi treatment plant, algaecide treatment with copper sulphate was simultaneously being applied in the reservoir. sampling and cyanobacteria determination samples for mc and cyanobacteria analysis were collected monthly from january-june 2005 from drinking water treatment plants at the barekese and owabi reservoirs, and biweekly at the weija and kpong reservoirs. water samples (1 l) were collected into clean plastic (pet) bottles from each treatment stage, namely: i) raw water at the intake; ii) flocculation (except the kpong treatment plant); iii) sedimentation tanks or clarifiers; iv) filtered water; and v) final chlorinated water. a total number of 127 samples were analysed for intracellular mcs in the four reservoirs, whilst 59 samples were analysed for dissolved mcs. the lower number of samples analysed for dissolved mcs was due to financial constraints during the field work in ghana and losses during the sample transport from ghana to the united kingdom. samples for microscopic determination of cyanobacterial species composition were collected from raw water and final treated water using plankton net (25 µm) or by simply filling a bucket. net samples were preserved for taxonomic work with formalin at the final concentration of 2% (v/v), whilst water samples were preserved in lugol’s solution for quantitative microscopical analysis as described in addico et al. (2006, 2009) using olympus bx51 and bx60 microscopes equipped with objectives 10, 20, 40, 60 and 100x (olympus). briefly, the aliquots of the samples were transferred into counting chambers for analysis, where all colonies and filaments were counted as individuals. the average number of cells was determined for 20 individuals and cell concentration was calculated. sub-samples for counting picocyanobacteria were filtered through a 0.2 μm nucleopore filter prestained with irgalan black. cells were stained with dapi (4-diamidino-2-phenylindole dihydrochloride) and counted under the fluorescence (excitation 330-385 nm, emission 510-560 nm). about 300-400 picocyanobacterial cells were counted for each sample. all data on abundance were expressed as number of cells per ml, including the cells inside colonies. identification of cyanobacteria species was carried out at the institute of botany of the czech academy of sciences, trebon, czech republic under the supervision prof. jiří komárek and using the recent taxonomical literature (komárek and anagnostidis, 1999, 2005). extraction of cell-bound (intracellular) mcs water samples (1 l) were filtered through preweighed gf/c filter (1.2 µm mesh, whatman). the cells collected on the filters were frozen overnight and freeze-dried. freeze-dried cells on filters were stored at -20°c until extracted for hplc analysis. extraction of cell-bound (intracellular) toxins from freeze-dried cells was done as described by harada et al. (1999). cells were extracted with 20 ml of 75% aqueous methanol (fastner et al., 1998) for 1 hour. this extraction step was repeated three times, the extracts from the individual steps were combined and then dried using a rotary evaporator. the concentrated extract was dissolved in 400 µl methanol prior to hplc analysis, filtered through 0.45 µm nylon syringe filter (millipore). fig. 2. summary of drinking water treatment process employed in ghanaian plants barekese, owabi, kpong and weija. non -co mmerc ial us e o nly g.n.d. addico et al.96 extraction of dissolved (extracellular) mcs filtrates of water samples (1 l) filtered through gf/c filter (see above) were processed according to harada et al. (1999). briefly, filtrates were treated with sodium thiosulphate (2 mg l–1), acidified with trifluoroacetic acid (tfa, 0.1%, v/v) and concentrated using solid phase extraction by ods cartridges (supelclean lc-18, 3 ml tube, supelco). cartridges were activated with 5 ml of methanol and rinsed with 5 ml of distilled water prior to the application of the sample. mcs were then eluted with 15 ml of 0.1% tfa in methanol, the eluate was evaporated to dryness by rotary vacuum evaporation (45 c) and then redissolved in 400 µl methanol in an ultrasonic bath. identification and quantification of mcs mcs were identified and quantified using high performance liquid chromatography (hplc agilent 1100 series) system, coupled with a diode array detector (dad). mcs were separated on a c-18 column luna 150×4.60 mm, 5 µm (phenomenex) at 30°c using a flow rate of 1 ml min–1. the binary gradient of the mobile phase consisted of (a) h2o+0.05% tfa and (b) acetonitrile +0.05% tfa, with a linear increase from 30 to 70% b between 0-30 min. the injection volume was 20 µl. chromatograms were recorded at 238 nm. uv spectra (200 to 300 nm) of all chromatographic peaks were carefully checked and compared to the spectra of mc standards: mc-lf, -lr, -lw, -rr and -ly (alexis biochemicals). peaks possessing the uv spectrum characteristic for mcs were quantified using a calibration curve (n=5, r2=0.999) of the corresponding standard with the matching retention time. unidentified peaks possessing the uv spectrum characteristic for mcs but not matching the retention time of the standards were quantified as mc-lr equivalents using the calibration curve of mc-lr (mcelhiney and lawton, 2005). the detection limit of the method (lod) was 0.01 µg l–1 for the individual mc variant. results cyanobacteria removal in this study, we complemented previous data on cyanobacterial concentrations in the raw water (addico et al., 2009) with a new data set on cyanobacterial cell counts in the final treated water, and also with mc analyses, in order to discuss relationships between mc occurrence, cyanobacterial diversity, and their removal during the drinking water treatment. as reported, all four reservoirs were dominated by cyanobacteria, which accounted for 70-90% of phytoplankton biomass (addico et al., 2009). detailed results of microscopical analyses of cyanobacterial species composition are summarized in tabs. 1-4, the complete list of the identified species is provided in the supplementary tab. 1. representatives of picocyanobacterial genera cyanogranis, aphanocapsa and geitlerinema were among the most aboundant species tab. 1. concentration of cyanobacterial cells (cell ml–1) in the water intake and in the final treated water at the barekese drinking water treatment plant during the jan-may 2005. barekese january february march april may average intake* final intake* final intake* final intake* final intake* final intake final removal (%) anabaena austro-africana 0 0 35 0 140 0 89 0 926 0 238 0 100.0 anabaena nygaardii 7768 0 9010 54 11,509 10 4923 0 1922 0 7026 13 99.8 chroococcus cronbergae 756 0 467 0 899 0 1281 0 874 0 855 0 100.0 cyanogranis ferruginea 201,870 98 229,018 1143 191,002 475 48,594 45 125,000 87 159,097 370 99.8 cylindrospermopsis raciborskii 1007 11 4005 28 2086 12 4272 0 2760 0 2826 10 99.6 merismopedia punctata 2987 0 1998 0 1254 0 995 0 1075 0 1662 0 100.0 merismopedia tenuissima 7098 0 5998 0 5990 0 3709 0 2136 0 4986 0 100.0 microcystis aeruginosa 501 0 429 0 557 0 400 0 566 0 491 0 100.0 oscillatoria princeps 5783 0 6602 0 4998 0 5340 0 7251 0 5995 0 100.0 planktolyngbya minor 3056 0 2955 0 1565 0 1427 0 5073 0 2815 0 100.0 planktothrix lacustris var. solitaria 2008 3 3090 14 3163 8 5146 14 2895 25 3260 13 99.6 planktothrix sp. 98 33 801 99 2675 10 1226 26 3925 34 1745 40 97.7 pseudanabaena recta 6780 0 6675 10 3727 4 3888 7 925 2 4399 5 99.9 radiocystis fernandoi 0 0 96 0 230 0 0 0 431 0 151 0 100.0 romeria elegans 56 0 0 0 18 0 53 1 36 5 33 1 96.3 total (cell ml–1) 239,768 145 271,179 1,348 229,813 519 81,343 93 155,795 153 229,813 153 removal (%) 99.9 99.5 99.8 99.9 99.9 99.9 *data adapted from addico et al. (2009). non -co mmerc ial us e o nly microcystins in drinking water in ghana 97 within the cyanobacterial communities in the studied reservoirs (tabs. 1-4). in the barekese and owabi reservoirs, which are located in the same ecological zone in the ashanti region (fig. 1), cyanogranis ferruginea (f. wawrik) hindak ex hindak accounted for the majority of cyanobacterial cells. c. ferruginea population in the raw water at the barekese treatment plant ranged between 60-85% of total cyanobacteria cell counts (tab. 1). this species was the most abundant in the treated water as well, accompanied also with planktothrix agardhii (gomont) k. anagnostidis & j. komárek, planktothrix lacustris (klebahn) i. umezaki & m. watanabe, and eventually by cylindrospermopsis raciborskii (woloszynska) seenayya & subba raju, pseudanabaena recta komárek & cronberg, anabaena nygaardii cronberg & komárek (tab. 1). concentrations of cyanobacterial cell in the final water from the barekese reservoir ranged between 93-1,348 cell ml–1. in the owabi treatment plant, c. ferruginea represented 95-97% of the total cyanobacteria cell counts (tab. 2). in addition to c. ferruginea, cyanobacteria aphanocapsa holstatica (lemmermann) g. cronberg & komárek, p. recta, and leptolyngbya sp. were detected most frequently in the treated water from owabi, with total cyanobacterial counts between 95-1099 cells ml–1 (tab. 2). geitlerinema unigranulatum (c. agardh ex gomont) anagnostidis was the most abundant cyanobacterium in the kpong reservoir, representing 65-78% of total cyanobacterial cell counts in the raw water samples (tab. 3). however, p. agardhii was in average the most abundant species found in the final water from the kpong reservoir, followed by g. unigranulatum and c. raciborskii, while other species were detected in the treated water only occassionally. total cyanobacterial cell counts in the final water were between 173-845 cell ml–1 during the sampling period (tab. 3). cyanobacterial community in the weija reservoir was the most diverse one (tab. 4), when the most abundant cyanobacterial species aphanocapsa nubilum komárek & h.j. kling accounted only for 18-26% of total cyanobacterial cell counts throughout six months of sampling, while being accompanied with merismopedia tenuissima lemmermann (14-19%), planktolyngbya minor (geitler & ruttner) komárek & cronberg (815%), p. recta (6-18%) and others. the most abundant species in the treated water was chroococcus cronbergae j. komárek & e. novelo, which penetrated into the final stage throughout the study, along with a. nubilum, m. aeruginosa, a. nygardii, p. agardhii and c. raciborskii. the cyanobacterial cell counts in the final water from the weija reservoir were found to be between 369-3,055 cell ml–1 (tab. 4). overall, the drinking water treatment process eliminated >97-99.9% of cyanobacterial cells, however, cyanobacteria were detected in 100% samples of treated water collected from all four treatment plants during the entire sampling period. mc removal commonly occurring mc variants identified in the examined reservoirs were mc-lr, -lf, -rr and -yr. the highest diversity of mc variants was observed in the weija reservoir, where also two additional peaks possessing mclike uv absorption spectrum were identified. out of the 26 samples of raw water, 17 samples (65%) contained intracellular mcs (fig. 3, tab. 5). during the water treatment process, concentrations of both intracellular as well as extracellular toxins generally decreased with the treatment tab. 2. concentration of cyanobacterial cells (cell ml–1) in the water intake and in the final treated water at the owabi drinking water treatment plant during the jan-may 2005. owabi january february march april may average intake* final intake* final intake* final intake* final intake* final intake final removal (%) anabaena nygaardii 65 0 0 0 0 0 16 0 0 0 16 0 100.0 aphanocapsa holsatica 2092 76 1980 66 2541 97 1997 45 2672 76 2256 72 96.8 chroococcus cronbergae 67 0 0 0 10 25 0 0 0 0 15 5 67.5 cyanogranis ferruginea 225,317 34 220,001 47 165,002 901 157,005 37 278,430 98 209,151 223 99.9 cylindrospermopsis raciborskii 24 0 15 0 24 0 45 0 23 0 26 0 100.0 leptolyngbya sp. 946 0 882 27 98 0 107 13 905 9 588 10 98.3 merismopedia tenuissima 62 0 77 0 102 0 91 0 75 0 81 0 100.0 planktolyngbya limnetica 772 0 1372 0 1532 0 2109 0 815 0 1320 0 100.0 planktolyngbya minor 2008 0 1247 0 2349 0 2129 0 3761 0 2299 0 100.0 pseudanabaena recta 1465 56 2165 35 1645 76 1705 0 868 20 1570 37 97.6 total (cell ml–1) 232,818 166 227,739 175 173,303 1099 165,204 95 287,549 203 227,739 175 removal (%) 99.9 99.9 99.4 99.9 99.9 99.9 *data adapted from addico et al. (2009). non -co mmerc ial us e o nly g.n.d. addico et al.98 step in all four individual treatment plants (fig. 3). statistically significant (p<0.05) correlation (spearman’s rank correlation coefficient ρ) between mc concentration and the order of treatment step was found: ρ=0.996 (barekese), ρ=0.861 (owabi), ρ=0.987 (kpong) and ρ=0.899 (weija) for intracellular toxins, and ρ=1 (barekese), ρ=0.911 (owabi), ρ=0.965 (kpong) and ρ=0.980 (weija) for dissolved toxins. however, increases in concentration of both intracellular and dissolved mc were observed in some cases after the flocculation/sedimentation steps of water treatment (fig. 3 and supplementary figs. 1-4). five samples of the treated water (17%) contained intracellular or fig. 3. combined data on mc concentrations at different stages of four drinking water treatment plants in ghana during jan-jun 2005. boxes plot median values (middle lines), 25th and 75th percentils (boxes), 10th and 90th percentils (error bars) and outliers (circles). ratio between median intracellular (ic) and dissolved (dis) mc concentrations was calculated for different treatment steps and ploted as a line graph. hash indicates significant difference between concentration of ic and dis mc at the particular step of drinking water treatment (p<0.05, mann-whitney test). asterisks indicate significant difference between mc concentration in the water intake and a particular treatment step (p<0.05, mann-whitney test). values below the method lod (0.01 µg l–1) were susbstituted with lod/2. tab. 3. concentration of cyanobacterial cells (cell ml–1) in the water intake and in the final treated water at the kpong drinking water treatment plant during the jan-may 2005. kpong january february march april may average intake* final intake* final intake* final intake* final intake* final intake final removal (%) chroococcus cronbergae 690 0 382 0 656 0 609 0 541 0 575 0 100.0 coelomoron tropicale 0 0 13 0 0 0 0 0 40 0 11 0 100.0 cylindrospermopsis cuspis 1226 0 1232 0 2401 0 1003 11 3980 0 1968 2 99.9 cylindrospermopsis raciborskii 2625 30 1806 39 2216 87 3873 35 2082 60 2520 50 98.0 geitlerinema unigranulatum 31,584 127 39,562 89 49,325 179 30,252 389 33,546 16 36854 160 99.6 merismopedia punctata 1204 0 924 0 840 0 550 0 1082 0 920 0 100.0 merismopedia tenuissima 2033 0 3693 0 2991 0 1563 0 3865 0 2829 0 100.0 planktolyngbya minor 55 0 61 0 90 0 61 0 1531 67 359 13 96.3 planktothrix agardhii 2475 65 4123 45 4070 293 2846 410 4352 41 3573 171 95.2 pseudanabaena recta 673 0 904 0 719 0 646 0 320 0 652 0 100.0 total (cell ml–1) 42,562 222 52,698 173 63,306 559 41,400 845 51,336 184 51,336 222 removal (%) 99.5 99.7 99.1 98.0 99.6 99.6 *data adapted from addico et al. (2009). non -co mmerc ial us e o nly microcystins in drinking water in ghana 99 particle-associated mcs (maximal detected concentration was 0.61 µg l–1), and two samples of the treated water (14%) contained dissolved mcs at concentrations 0.57 µg l–1 (kpong) and 0.81 µg l-1 (weija) (tab. 5). concentrations of intracellular toxins significantly correlated with the concentrations of the cyanobacterial cells in the treated water (ρ=0.561, p<0.01). in the barekese reservoir, mcs were detected during two out of six sampling months (tab. 5, supplementary fig. 1). in one instance (february 10th), intracellular mcs were found in the sedimentation step and then in the sample of treated water (0.45 µg l–1), while dissolved mcs were found in the flocculation stage (supplementary fig. 1). in april, intracellular mcs were detected in one sample of raw water at the concentration 0.46 µg l–1, which further increased in the flocculation stage, but then decreased below the detectable levels in the next treatment step (tab. 5, supplementary fig. 1). the owabi reservoir was found to be more contaminated with mcs. all raw water samples from the owabi treatment plant contained intracellular mcs (tab. 5, supplementary fig. 2). the highest detected concentration of intracellular mcs in the intake water from the owabi reservoir was 8.73 µg l–1, and intracellular toxins were detected also in the final water in one instance (0.07 µg l–1, march 17th). dissolved mcs could be found in samples from all treatment stages of the owabi treatment plant with the exception of the final stage (tab. 5, supplementary fig. 2). in the kpong reservoir, mcs were detected relatively less frequently. intracellular toxins were found only in two out of seven samples of intake water (tab. 5, supplementary fig. 3). however, the kpong drinking water treatment plant, which does not have a flocculation stage, had two out of eight samples contaminated with intracellular mcs at the final chlorination stage (0.13 and 0.46 µg l–1, march tab. 4. concentration of cyanobacterial cells (cell ml–1) in the water intake and in the final treated water at the weija drinking water treatment plant during the jan-may 2005. weijajanuary february march april may average intake* final intake* final intake* final intake* final intake* final intake final removal (%) anabaena austro-africana 398 0 330 0 1,075 0 961 0 2807 0 1,114 0 100.0 anabaena nygaardii 2104 21 7080 475 5173 67 6485 35 11,297 15 6428 123 98.1 anabaenopsis ambigua 177 0 763 0 738 0 792 0 45 0 503 0 100.0 anabaenopsis tanganyikae 34 0 109 69 60 0 879 64 557 0 328 27 91.9 aphanocapsa holsatica 6302 25 2677 0 821 0 2151 0 6350 0 3660 5 99.9 aphanocapsa nubilum 24,567 12 20,538 883 20,832 80 26,883 42 19,511 67 22,466 217 99.0 chroococcus cronbergae 3141 515 5398 515 5284 962 5989 483 4586 224 4880 540 88.9 coelomoron tropicale 52 0 20 0 0 0 0 0 0 0 14 0 100.0 cyanogranis ferruginea 0 0 80 0 1208 0 903 0 1773 0 793 0 100.0 cylindrospermopsis cuspis 10 23 12 14 96 0 76 0 87 0 56 7 86.8 cylindrospermopsis raciborskii 1284 17 5148 97 4565 41 5051 25 4112 12 4032 38 99.0 geitlerinema unigranulatum 8 0 6 0 0 0 0 0 9 0 5 0 100.0 lyngbya sp. 6 0 0 0 5 0 6 0 12 0 6 0 100.0 merismopedia punctata 1414 0 627 0 263 0 3006 0 1461 0 1354 0 100.0 merismopedia tenuissima 20,859 48 20,907 34 17,794 0 15,059 5 12,916 0 17,507 17 99.9 microcystis aeruginosa 692 53 1782 744 2958 66 3051 47 2183 33 2133 189 91.2 microcystis viridis 0 0 0 0 0 0 0 0 493 0 99 0 100.0 microcystis wesenbergii 250 0 0 0 562 0 0 0 318 0 226 0 100.0 planktolyngbya circumcreta 162 0 75 0 416 47 439 0 219 0 262 9 96.4 planktolyngbya limnetica 3645 0 2774 0 5060 0 1843 0 2220 0 3108 0 100.0 planktolyngbya minor 13,843 0 16,883 0 12,610 0 11,736 0 7069 0 12,428 0 100.0 planktothrix agardhii 2395 11 2903 224 1311 37 2181 66 1757 18 2109 71 96.6 planktothrix lacustris var. solitaria 8723 0 6873 0 5299 0 2443 0 6130 0 5893 0 100.0 pseudanabaena recta 13,446 0 15,838 0 18,835 0 9624 0 5058 0 12,560 0 100.0 radiocystis fernandoi 3992 0 3395 0 2516 0 3089 0 1330 0 2864 0 100.0 romeria elegans 0 0 20 0 8 0 1 0 10 0 8 0 100.0 total (cell ml) 107,500 725 114,231 3055 107,485 1300 102,643 767 92,304 369 107,485 767 removal (%) 99.3 97.3 98.8 99.3 99.6 99.3 *data adapted from addico et al. (2009). non -co mmerc ial us e o nly g.n.d. addico et al.100 ta b. 5 . s um m ar y of m c a na ly se s f ro m d iff er en t t re at m en t s te ps o f t he fo ur g ha na ia n tre at m en t p la nt s. in tr ac el lu la r m c s ( µg l –1 ) d is so lv ed m c s ( µg l –1 ) (r es er vo ir t re at m en t n um be r of sa m pl es c on ce nt ra tio n m ed ia n n um be r of sa m pl es c on ce nt ra tio n m ed ia n (s am pl in g pe ri od ) s te p to ta l >l o d > 1 µg l –1 ra ng e t ot al > l o d > 1 µg l –1 r an ge b ar ek es e in ta ke 4 1 (2 5% ) 0 < lo d -0 .4 6 < lo d 3 0 0 < lo d < lo d (1 0 ja n7 ju n) f lo cc ul at io n 5 1 (2 0% ) 1 (2 0% ) < lo d -1 5. 50