id	sid	tid	token	lemma	pos
aiol-6280	1	1	layout	layout	NOUN
aiol-6280	1	2	1	1	NUM
aiol-6280	1	3	introduction	introduction	NOUN
aiol-6280	1	4	cyanobacterial	cyanobacterial	ADJ
aiol-6280	1	5	harmful	harmful	ADJ
aiol-6280	1	6	algal	algal	ADJ
aiol-6280	1	7	blooms	bloom	NOUN
aiol-6280	1	8	represent	represent	VERB
aiol-6280	1	9	one	one	NUM
aiol-6280	1	10	of	of	ADP
aiol-6280	1	11	the	the	DET
aiol-6280	1	12	most	most	ADV
aiol-6280	1	13	conspicuous	conspicuous	ADJ
aiol-6280	1	14	waterborne	waterborne	ADJ
aiol-6280	1	15	microbial	microbial	ADJ
aiol-6280	1	16	hazards	hazard	NOUN
aiol-6280	1	17	to	to	ADP
aiol-6280	1	18	freshwater	freshwater	NOUN
aiol-6280	1	19	and	and	CCONJ
aiol-6280	1	20	marine	marine	ADJ
aiol-6280	1	21	ecosystems	ecosystem	NOUN
aiol-6280	1	22	(	(	PUNCT
aiol-6280	1	23	codd	codd	NOUN
aiol-6280	1	24	et	et	PROPN
aiol-6280	1	25	al	al	PROPN
aiol-6280	1	26	.	.	PROPN
aiol-6280	1	27	,	,	PUNCT
aiol-6280	1	28	2005	2005	NUM
aiol-6280	1	29	;	;	PUNCT
aiol-6280	1	30	paerl	paerl	PROPN
aiol-6280	1	31	et	et	PROPN
aiol-6280	1	32	al	al	PROPN
aiol-6280	1	33	.	.	PROPN
aiol-6280	1	34	,	,	PUNCT
aiol-6280	1	35	2011	2011	NUM
aiol-6280	1	36	)	)	PUNCT
aiol-6280	1	37	.	.	PUNCT
aiol-6280	2	1	this	this	DET
aiol-6280	2	2	hazard	hazard	NOUN
aiol-6280	2	3	results	result	VERB
aiol-6280	2	4	from	from	ADP
aiol-6280	2	5	the	the	DET
aiol-6280	2	6	production	production	NOUN
aiol-6280	2	7	of	of	ADP
aiol-6280	2	8	cyanotoxins	cyanotoxin	NOUN
aiol-6280	2	9	,	,	PUNCT
aiol-6280	2	10	harmful	harmful	ADJ
aiol-6280	2	11	secondary	secondary	ADJ
aiol-6280	2	12	metabolites	metabolite	NOUN
aiol-6280	2	13	,	,	PUNCT
aiol-6280	2	14	which	which	PRON
aiol-6280	2	15	can	can	AUX
aiol-6280	2	16	have	have	VERB
aiol-6280	2	17	deleterious	deleterious	ADJ
aiol-6280	2	18	effects	effect	NOUN
aiol-6280	2	19	within	within	ADP
aiol-6280	2	20	reservoirs	reservoir	NOUN
aiol-6280	2	21	and	and	CCONJ
aiol-6280	2	22	in	in	ADP
aiol-6280	2	23	downstream	downstream	ADJ
aiol-6280	2	24	receiving	receive	VERB
aiol-6280	2	25	water	water	NOUN
aiol-6280	2	26	systems	system	NOUN
aiol-6280	2	27	during	during	ADP
aiol-6280	2	28	releases	release	NOUN
aiol-6280	2	29	(	(	PUNCT
aiol-6280	2	30	paerl	paerl	PROPN
aiol-6280	2	31	and	and	CCONJ
aiol-6280	2	32	otten	otten	PROPN
aiol-6280	2	33	,	,	PUNCT
aiol-6280	2	34	2013	2013	NUM
aiol-6280	2	35	)	)	PUNCT
aiol-6280	2	36	.	.	PUNCT
aiol-6280	3	1	harmful	harmful	ADJ
aiol-6280	3	2	cyanobacterial	cyanobacterial	ADJ
aiol-6280	3	3	blooms	bloom	NOUN
aiol-6280	3	4	have	have	AUX
aiol-6280	3	5	increased	increase	VERB
aiol-6280	3	6	globally	globally	ADV
aiol-6280	3	7	in	in	ADP
aiol-6280	3	8	frequency	frequency	NOUN
aiol-6280	3	9	and	and	CCONJ
aiol-6280	3	10	intensity	intensity	NOUN
aiol-6280	3	11	in	in	ADP
aiol-6280	3	12	recent	recent	ADJ
aiol-6280	3	13	decades	decade	NOUN
aiol-6280	3	14	.	.	PUNCT
aiol-6280	4	1	eutrophication	eutrophication	NOUN
aiol-6280	4	2	and	and	CCONJ
aiol-6280	4	3	warmer	warm	ADJ
aiol-6280	4	4	temperatures	temperature	NOUN
aiol-6280	4	5	are	be	AUX
aiol-6280	4	6	often	often	ADV
aiol-6280	4	7	cited	cite	VERB
aiol-6280	4	8	as	as	ADP
aiol-6280	4	9	key	key	ADJ
aiol-6280	4	10	factors	factor	NOUN
aiol-6280	4	11	which	which	PRON
aiol-6280	4	12	promote	promote	VERB
aiol-6280	4	13	these	these	DET
aiol-6280	4	14	events	event	NOUN
aiol-6280	4	15	(	(	PUNCT
aiol-6280	4	16	hudnell	hudnell	NOUN
aiol-6280	4	17	and	and	CCONJ
aiol-6280	4	18	dortch	dortch	NOUN
aiol-6280	4	19	,	,	PUNCT
aiol-6280	4	20	2008	2008	NUM
aiol-6280	4	21	;	;	PUNCT
aiol-6280	4	22	paerl	paerl	PROPN
aiol-6280	4	23	and	and	CCONJ
aiol-6280	4	24	huisman	huisman	NOUN
aiol-6280	4	25	,	,	PUNCT
aiol-6280	4	26	2008	2008	NUM
aiol-6280	4	27	;	;	PUNCT
aiol-6280	4	28	gkelis	gkelis	PROPN
aiol-6280	4	29	et	et	PROPN
aiol-6280	4	30	al	al	PROPN
aiol-6280	4	31	.	.	PROPN
aiol-6280	4	32	,	,	PUNCT
aiol-6280	4	33	2014	2014	NUM
aiol-6280	4	34	)	)	PUNCT
aiol-6280	4	35	.	.	PUNCT
aiol-6280	5	1	in	in	ADP
aiol-6280	5	2	greece	greece	PROPN
aiol-6280	5	3	,	,	PUNCT
aiol-6280	5	4	the	the	DET
aiol-6280	5	5	warm	warm	ADJ
aiol-6280	5	6	mediterranean	mediterranean	PROPN
aiol-6280	5	7	climate	climate	NOUN
aiol-6280	5	8	favors	favor	VERB
aiol-6280	5	9	cyanobacterial	cyanobacterial	ADJ
aiol-6280	5	10	blooms	bloom	NOUN
aiol-6280	5	11	in	in	ADP
aiol-6280	5	12	eutrophic	eutrophic	ADJ
aiol-6280	5	13	waters	water	NOUN
aiol-6280	5	14	,	,	PUNCT
aiol-6280	5	15	which	which	PRON
aiol-6280	5	16	may	may	AUX
aiol-6280	5	17	start	start	VERB
aiol-6280	5	18	in	in	ADP
aiol-6280	5	19	spring	spring	NOUN
aiol-6280	5	20	and	and	CCONJ
aiol-6280	5	21	last	last	ADJ
aiol-6280	5	22	until	until	ADP
aiol-6280	5	23	december	december	PROPN
aiol-6280	5	24	;	;	PUNCT
aiol-6280	5	25	increased	increase	VERB
aiol-6280	5	26	temperatures	temperature	NOUN
aiol-6280	5	27	due	due	ADJ
aiol-6280	5	28	to	to	ADP
aiol-6280	5	29	global	global	ADJ
aiol-6280	5	30	warming	warming	NOUN
aiol-6280	5	31	may	may	AUX
aiol-6280	5	32	further	far	ADV
aiol-6280	5	33	enhance	enhance	VERB
aiol-6280	5	34	cyanobacteria	cyanobacteria	NOUN
aiol-6280	5	35	dominance	dominance	NOUN
aiol-6280	5	36	and	and	CCONJ
aiol-6280	5	37	promote	promote	VERB
aiol-6280	5	38	toxic	toxic	ADJ
aiol-6280	5	39	over	over	ADP
aiol-6280	5	40	non	non	ADJ
aiol-6280	5	41	-	-	ADJ
aiol-6280	5	42	toxic	toxic	ADJ
aiol-6280	5	43	strains	strain	NOUN
aiol-6280	5	44	(	(	PUNCT
aiol-6280	5	45	gkelis	gkelis	PROPN
aiol-6280	5	46	et	et	PROPN
aiol-6280	5	47	al	al	PROPN
aiol-6280	5	48	.	.	PROPN
aiol-6280	5	49	,	,	PUNCT
aiol-6280	5	50	2014	2014	NUM
aiol-6280	5	51	)	)	PUNCT
aiol-6280	5	52	.	.	PUNCT
aiol-6280	6	1	after	after	ADP
aiol-6280	6	2	the	the	DET
aiol-6280	6	3	elucidation	elucidation	NOUN
aiol-6280	6	4	of	of	ADP
aiol-6280	6	5	cyanotoxins	cyanotoxin	NOUN
aiol-6280	6	6	genes	gene	NOUN
aiol-6280	6	7	clusters	cluster	NOUN
aiol-6280	6	8	,	,	PUNCT
aiol-6280	6	9	several	several	ADJ
aiol-6280	6	10	studies	study	NOUN
aiol-6280	6	11	have	have	AUX
aiol-6280	6	12	applied	apply	VERB
aiol-6280	6	13	molecular	molecular	ADJ
aiol-6280	6	14	methods	method	NOUN
aiol-6280	6	15	for	for	ADP
aiol-6280	6	16	monitoring	monitor	VERB
aiol-6280	6	17	the	the	DET
aiol-6280	6	18	presence	presence	NOUN
aiol-6280	6	19	of	of	ADP
aiol-6280	6	20	toxic	toxic	ADJ
aiol-6280	6	21	cyanobacteria	cyanobacteria	NOUN
aiol-6280	6	22	and	and	CCONJ
aiol-6280	6	23	the	the	DET
aiol-6280	6	24	genes	gene	NOUN
aiol-6280	6	25	involved	involve	VERB
aiol-6280	6	26	in	in	ADP
aiol-6280	6	27	the	the	DET
aiol-6280	6	28	biosynthesis	biosynthesis	NOUN
aiol-6280	6	29	of	of	ADP
aiol-6280	6	30	cyanotoxins	cyanotoxin	NOUN
aiol-6280	6	31	(	(	PUNCT
aiol-6280	6	32	hisbergues	hisbergue	NOUN
aiol-6280	6	33	et	et	PROPN
aiol-6280	6	34	al	al	PROPN
aiol-6280	6	35	.	.	PROPN
aiol-6280	6	36	,	,	PUNCT
aiol-6280	6	37	2003	2003	NUM
aiol-6280	6	38	;	;	PUNCT
aiol-6280	6	39	vasconcelos	vasconcelos	PROPN
aiol-6280	6	40	et	et	PROPN
aiol-6280	6	41	al	al	PROPN
aiol-6280	6	42	.	.	PROPN
aiol-6280	6	43	,	,	PUNCT
aiol-6280	6	44	2010	2010	NUM
aiol-6280	6	45	;	;	PUNCT
aiol-6280	6	46	gkelis	gkelis	PROPN
aiol-6280	6	47	and	and	CCONJ
aiol-6280	6	48	zaoutsos	zaoutsos	NOUN
aiol-6280	6	49	,	,	PUNCT
aiol-6280	6	50	2014	2014	NUM
aiol-6280	6	51	)	)	PUNCT
aiol-6280	6	52	.	.	PUNCT
aiol-6280	7	1	furthermore	furthermore	ADV
aiol-6280	7	2	,	,	PUNCT
aiol-6280	7	3	molecular	molecular	ADJ
aiol-6280	7	4	methods	method	NOUN
aiol-6280	7	5	based	base	VERB
aiol-6280	7	6	on	on	ADP
aiol-6280	7	7	16s	16s	PROPN
aiol-6280	7	8	rrna	rrna	PROPN
aiol-6280	7	9	gene	gene	NOUN
aiol-6280	7	10	amplification	amplification	NOUN
aiol-6280	7	11	are	be	AUX
aiol-6280	7	12	widely	widely	ADV
aiol-6280	7	13	employed	employ	VERB
aiol-6280	7	14	for	for	ADP
aiol-6280	7	15	the	the	DET
aiol-6280	7	16	analysis	analysis	NOUN
aiol-6280	7	17	of	of	ADP
aiol-6280	7	18	natural	natural	ADJ
aiol-6280	7	19	samples	sample	NOUN
aiol-6280	7	20	and/or	and/or	CCONJ
aiol-6280	7	21	monitoring	monitor	VERB
aiol-6280	7	22	freshwaters	freshwater	NOUN
aiol-6280	7	23	(	(	PUNCT
aiol-6280	7	24	kormas	kormas	PROPN
aiol-6280	7	25	et	et	PROPN
aiol-6280	7	26	al	al	PROPN
aiol-6280	7	27	.	.	PROPN
aiol-6280	7	28	,	,	PUNCT
aiol-6280	7	29	2011	2011	NUM
aiol-6280	7	30	;	;	PUNCT
aiol-6280	7	31	loza	loza	PROPN
aiol-6280	7	32	et	et	PROPN
aiol-6280	7	33	al	al	PROPN
aiol-6280	7	34	.	.	PROPN
aiol-6280	7	35	,	,	PUNCT
aiol-6280	7	36	2013	2013	NUM
aiol-6280	7	37	)	)	PUNCT
aiol-6280	7	38	.	.	PUNCT
aiol-6280	8	1	bottled	bottled	ADJ
aiol-6280	8	2	water	water	NOUN
aiol-6280	8	3	can	can	AUX
aiol-6280	8	4	come	come	VERB
aiol-6280	8	5	from	from	ADP
aiol-6280	8	6	a	a	DET
aiol-6280	8	7	variety	variety	NOUN
aiol-6280	8	8	of	of	ADP
aiol-6280	8	9	sources	source	NOUN
aiol-6280	8	10	including	include	VERB
aiol-6280	8	11	natural	natural	ADJ
aiol-6280	8	12	aquifers	aquifer	NOUN
aiol-6280	8	13	,	,	PUNCT
aiol-6280	8	14	springs	spring	NOUN
aiol-6280	8	15	,	,	PUNCT
aiol-6280	8	16	glacier	glacier	NOUN
aiol-6280	8	17	run	run	NOUN
aiol-6280	8	18	-	-	PUNCT
aiol-6280	8	19	off	off	NOUN
aiol-6280	8	20	,	,	PUNCT
aiol-6280	8	21	and	and	CCONJ
aiol-6280	8	22	municipal	municipal	ADJ
aiol-6280	8	23	water	water	NOUN
aiol-6280	8	24	supplies	supply	NOUN
aiol-6280	8	25	,	,	PUNCT
aiol-6280	8	26	and	and	CCONJ
aiol-6280	8	27	these	these	DET
aiol-6280	8	28	sources	source	NOUN
aiol-6280	8	29	could	could	AUX
aiol-6280	8	30	potentially	potentially	ADV
aiol-6280	8	31	be	be	AUX
aiol-6280	8	32	contaminated	contaminate	VERB
aiol-6280	8	33	with	with	ADP
aiol-6280	8	34	microcystins	microcystin	NOUN
aiol-6280	8	35	(	(	PUNCT
aiol-6280	8	36	cfia	cfia	NOUN
aiol-6280	8	37	,	,	PUNCT
aiol-6280	8	38	2011	2011	NUM
aiol-6280	8	39	)	)	PUNCT
aiol-6280	8	40	.	.	PUNCT
aiol-6280	9	1	to	to	ADP
aiol-6280	9	2	our	our	PRON
aiol-6280	9	3	knowledge	knowledge	NOUN
aiol-6280	9	4	,	,	PUNCT
aiol-6280	9	5	only	only	ADV
aiol-6280	9	6	two	two	NUM
aiol-6280	9	7	studies	study	NOUN
aiol-6280	9	8	on	on	ADP
aiol-6280	9	9	levels	level	NOUN
aiol-6280	9	10	of	of	ADP
aiol-6280	9	11	microcystins	microcystin	NOUN
aiol-6280	9	12	in	in	ADP
aiol-6280	9	13	bottled	bottled	ADJ
aiol-6280	9	14	water	water	NOUN
aiol-6280	9	15	have	have	AUX
aiol-6280	9	16	been	be	AUX
aiol-6280	9	17	published	publish	VERB
aiol-6280	9	18	.	.	PUNCT
aiol-6280	10	1	those	those	DET
aiol-6280	10	2	studies	study	NOUN
aiol-6280	10	3	,	,	PUNCT
aiol-6280	10	4	performed	perform	VERB
aiol-6280	10	5	in	in	ADP
aiol-6280	10	6	italy	italy	PROPN
aiol-6280	10	7	(	(	PUNCT
aiol-6280	10	8	ferretti	ferretti	PROPN
aiol-6280	10	9	et	et	PROPN
aiol-6280	10	10	al	al	PROPN
aiol-6280	10	11	.	.	PROPN
aiol-6280	10	12	,	,	PUNCT
aiol-6280	10	13	2007	2007	NUM
aiol-6280	10	14	)	)	PUNCT
aiol-6280	10	15	and	and	CCONJ
aiol-6280	10	16	canada	canada	PROPN
aiol-6280	10	17	(	(	PUNCT
aiol-6280	10	18	cfia	cfia	PROPN
aiol-6280	10	19	,	,	PUNCT
aiol-6280	10	20	2011	2011	NUM
aiol-6280	10	21	;	;	PUNCT
aiol-6280	10	22	cfia	cfia	NOUN
aiol-6280	10	23	,	,	PUNCT
aiol-6280	10	24	2012	2012	NUM
aiol-6280	10	25	)	)	PUNCT
aiol-6280	10	26	,	,	PUNCT
aiol-6280	10	27	analysed	analyse	VERB
aiol-6280	10	28	domestic	domestic	ADJ
aiol-6280	10	29	bottled	bottled	ADJ
aiol-6280	10	30	water	water	NOUN
aiol-6280	10	31	samples	sample	NOUN
aiol-6280	10	32	for	for	ADP
aiol-6280	10	33	the	the	DET
aiol-6280	10	34	presence	presence	NOUN
aiol-6280	10	35	of	of	ADP
aiol-6280	10	36	microcystins	microcystin	NOUN
aiol-6280	10	37	and	and	CCONJ
aiol-6280	10	38	nodularin	nodularin	NOUN
aiol-6280	10	39	,	,	PUNCT
aiol-6280	10	40	and	and	CCONJ
aiol-6280	10	41	did	do	AUX
aiol-6280	10	42	not	not	PART
aiol-6280	10	43	detect	detect	VERB
aiol-6280	10	44	cyanotoxins	cyanotoxin	NOUN
aiol-6280	10	45	.	.	PUNCT
aiol-6280	11	1	this	this	DET
aiol-6280	11	2	work	work	NOUN
aiol-6280	11	3	presents	present	VERB
aiol-6280	11	4	the	the	DET
aiol-6280	11	5	results	result	NOUN
aiol-6280	11	6	of	of	ADP
aiol-6280	11	7	a	a	DET
aiol-6280	11	8	small	small	ADJ
aiol-6280	11	9	scale	scale	NOUN
aiol-6280	11	10	monitoring	monitoring	NOUN
aiol-6280	11	11	program	program	NOUN
aiol-6280	11	12	for	for	ADP
aiol-6280	11	13	drinking	drink	VERB
aiol-6280	11	14	natural	natural	ADJ
aiol-6280	11	15	mineral	mineral	NOUN
aiol-6280	11	16	water	water	NOUN
aiol-6280	11	17	and	and	CCONJ
aiol-6280	11	18	highlights	highlight	NOUN
aiol-6280	11	19	the	the	DET
aiol-6280	11	20	necessity	necessity	NOUN
aiol-6280	11	21	to	to	PART
aiol-6280	11	22	initiate	initiate	VERB
aiol-6280	11	23	research	research	NOUN
aiol-6280	11	24	and	and	CCONJ
aiol-6280	11	25	possibly	possibly	ADV
aiol-6280	11	26	establish	establish	VERB
aiol-6280	11	27	official	official	ADJ
aiol-6280	11	28	monitoring	monitoring	NOUN
aiol-6280	11	29	programs	program	NOUN
aiol-6280	11	30	in	in	ADP
aiol-6280	11	31	cases	case	NOUN
aiol-6280	11	32	where	where	SCONJ
aiol-6280	11	33	similar	similar	ADJ
aiol-6280	11	34	results	result	NOUN
aiol-6280	11	35	are	be	AUX
aiol-6280	11	36	obtained	obtain	VERB
aiol-6280	11	37	in	in	ADP
aiol-6280	11	38	order	order	NOUN
aiol-6280	11	39	to	to	PART
aiol-6280	11	40	cope	cope	VERB
aiol-6280	11	41	with	with	ADP
aiol-6280	11	42	the	the	DET
aiol-6280	11	43	new	new	ADJ
aiol-6280	11	44	demands	demand	NOUN
aiol-6280	11	45	for	for	ADP
aiol-6280	11	46	drinking	drinking	NOUN
aiol-6280	11	47	water	water	NOUN
aiol-6280	11	48	.	.	PUNCT
aiol-6280	12	1	methods	method	NOUN
aiol-6280	12	2	sample	sample	VERB
aiol-6280	12	3	collection	collection	NOUN
aiol-6280	12	4	and	and	CCONJ
aiol-6280	12	5	preparation	preparation	NOUN
aiol-6280	12	6	the	the	DET
aiol-6280	12	7	bottled	bottled	ADJ
aiol-6280	12	8	natural	natural	ADJ
aiol-6280	12	9	mineral	mineral	NOUN
aiol-6280	12	10	water	water	NOUN
aiol-6280	12	11	originated	originate	VERB
aiol-6280	12	12	from	from	ADP
aiol-6280	12	13	a	a	DET
aiol-6280	12	14	water	water	NOUN
aiol-6280	12	15	source	source	NOUN
aiol-6280	12	16	(	(	PUNCT
aiol-6280	12	17	250	250	NUM
aiol-6280	12	18	m	m	NOUN
aiol-6280	12	19	depth	depth	NOUN
aiol-6280	12	20	)	)	PUNCT
aiol-6280	12	21	,	,	PUNCT
aiol-6280	12	22	which	which	PRON
aiol-6280	12	23	is	be	AUX
aiol-6280	12	24	located	locate	VERB
aiol-6280	12	25	in	in	ADP
aiol-6280	12	26	the	the	DET
aiol-6280	12	27	prefecture	prefecture	NOUN
aiol-6280	12	28	of	of	ADP
aiol-6280	12	29	central	central	ADJ
aiol-6280	12	30	macedonia	macedonia	PROPN
aiol-6280	12	31	,	,	PUNCT
aiol-6280	12	32	northern	northern	PROPN
aiol-6280	12	33	greece	greece	PROPN
aiol-6280	12	34	(	(	PUNCT
aiol-6280	12	35	n	n	CCONJ
aiol-6280	12	36	:	:	PUNCT
aiol-6280	12	37	40	40	NUM
aiol-6280	12	38	°	°	NUM
aiol-6280	12	39	15’4.88	15’4.88	NUM
aiol-6280	12	40	”	"	PUNCT
aiol-6280	12	41	and	and	CCONJ
aiol-6280	12	42	e	e	NOUN
aiol-6280	12	43	:	:	PUNCT
aiol-6280	12	44	22	22	NUM
aiol-6280	12	45	°	°	NUM
aiol-6280	12	46	32’12.71	32’12.71	NUM
aiol-6280	12	47	”	"	PUNCT
aiol-6280	12	48	)	)	PUNCT
aiol-6280	12	49	with	with	ADP
aiol-6280	12	50	a	a	DET
aiol-6280	12	51	water	water	NOUN
aiol-6280	12	52	temperature	temperature	NOUN
aiol-6280	12	53	ranging	range	VERB
aiol-6280	12	54	between	between	ADP
aiol-6280	12	55	16	16	NUM
aiol-6280	12	56	°	°	SYM
aiol-6280	12	57	c	c	NOUN
aiol-6280	12	58	in	in	ADP
aiol-6280	12	59	winter	winter	NOUN
aiol-6280	12	60	and	and	CCONJ
aiol-6280	12	61	spring	spring	NOUN
aiol-6280	12	62	and	and	CCONJ
aiol-6280	12	63	18	18	NUM
aiol-6280	12	64	°	°	NOUN
aiol-6280	12	65	c	c	NOUN
aiol-6280	12	66	in	in	ADP
aiol-6280	12	67	autumn	autumn	NOUN
aiol-6280	12	68	and	and	CCONJ
aiol-6280	12	69	summer	summer	NOUN
aiol-6280	12	70	.	.	PUNCT
aiol-6280	13	1	water	water	NOUN
aiol-6280	13	2	samples	sample	NOUN
aiol-6280	13	3	were	be	AUX
aiol-6280	13	4	collected	collect	VERB
aiol-6280	13	5	advances	advance	NOUN
aiol-6280	13	6	in	in	ADP
aiol-6280	13	7	oceanography	oceanography	NOUN
aiol-6280	13	8	and	and	CCONJ
aiol-6280	13	9	limnology	limnology	NOUN
aiol-6280	13	10	,	,	PUNCT
aiol-6280	13	11	2017	2017	NUM
aiol-6280	13	12	;	;	PUNCT
aiol-6280	13	13	8(1	8(1	NOUN
aiol-6280	13	14	):	):	PUNCT
aiol-6280	13	15	87	87	NUM
aiol-6280	13	16	-	-	SYM
aiol-6280	13	17	91	91	NUM
aiol-6280	13	18	article	article	NOUN
aiol-6280	13	19	doi	doi	NOUN
aiol-6280	13	20	:	:	PUNCT
aiol-6280	13	21	10.4081	10.4081	NUM
aiol-6280	13	22	/	/	SYM
aiol-6280	13	23	aiol.2017.6280	aiol.2017.6280	NOUN
aiol-6280	13	24	this	this	DET
aiol-6280	13	25	work	work	NOUN
aiol-6280	13	26	is	be	AUX
aiol-6280	13	27	licensed	license	VERB
aiol-6280	13	28	under	under	ADP
aiol-6280	13	29	a	a	DET
aiol-6280	13	30	creative	creative	ADJ
aiol-6280	13	31	commons	common	NOUN
aiol-6280	13	32	attribution	attribution	NOUN
aiol-6280	13	33	-	-	PUNCT
aiol-6280	13	34	noncommercial	noncommercial	ADJ
aiol-6280	13	35	4.0	4.0	NUM
aiol-6280	13	36	international	international	ADJ
aiol-6280	13	37	license	license	NOUN
aiol-6280	13	38	(	(	PUNCT
aiol-6280	13	39	cc	cc	NOUN
aiol-6280	13	40	by	by	ADP
aiol-6280	13	41	-	-	PUNCT
aiol-6280	13	42	nc	nc	PROPN
aiol-6280	13	43	4.0	4.0	NUM
aiol-6280	13	44	)	)	PUNCT
aiol-6280	13	45	.	.	PUNCT
aiol-6280	14	1	can	can	AUX
aiol-6280	14	2	cyanobacteria	cyanobacteria	VERB
aiol-6280	14	3	infect	infect	VERB
aiol-6280	14	4	underground	underground	ADJ
aiol-6280	14	5	water	water	NOUN
aiol-6280	14	6	sources	source	NOUN
aiol-6280	14	7	?	?	PUNCT
aiol-6280	15	1	indications	indication	NOUN
aiol-6280	15	2	from	from	ADP
aiol-6280	15	3	small	small	ADJ
aiol-6280	15	4	scale	scale	NOUN
aiol-6280	15	5	monitoring	monitoring	NOUN
aiol-6280	15	6	of	of	ADP
aiol-6280	15	7	a	a	DET
aiol-6280	15	8	natural	natural	ADJ
aiol-6280	15	9	drinking	drinking	NOUN
aiol-6280	15	10	water	water	NOUN
aiol-6280	15	11	source	source	NOUN
aiol-6280	15	12	spyros	spyros	PROPN
aiol-6280	15	13	gkelis,1	gkelis,1	X
aiol-6280	15	14	*	*	PUNCT
aiol-6280	15	15	aristidis	aristidis	PROPN
aiol-6280	15	16	vlamis1,2	vlamis1,2	PROPN
aiol-6280	15	17	1department	1department	NUM
aiol-6280	15	18	of	of	ADP
aiol-6280	15	19	botany	botany	NOUN
aiol-6280	15	20	,	,	PUNCT
aiol-6280	15	21	school	school	NOUN
aiol-6280	15	22	of	of	ADP
aiol-6280	15	23	biology	biology	NOUN
aiol-6280	15	24	,	,	PUNCT
aiol-6280	15	25	aristotle	aristotle	PROPN
aiol-6280	15	26	university	university	PROPN
aiol-6280	15	27	of	of	ADP
aiol-6280	15	28	thessaloniki	thessaloniki	PROPN
aiol-6280	15	29	,	,	PUNCT
aiol-6280	15	30	gr-541	gr-541	X
aiol-6280	15	31	24	24	NUM
aiol-6280	15	32	thessaloniki	thessaloniki	PROPN
aiol-6280	15	33	,	,	PUNCT
aiol-6280	15	34	greece	greece	PROPN
aiol-6280	15	35	;	;	PUNCT
aiol-6280	15	36	2department	2department	NUM
aiol-6280	15	37	of	of	ADP
aiol-6280	15	38	pharmacology	pharmacology	NOUN
aiol-6280	15	39	,	,	PUNCT
aiol-6280	15	40	veterinary	veterinary	ADJ
aiol-6280	15	41	school	school	NOUN
aiol-6280	15	42	,	,	PUNCT
aiol-6280	15	43	university	university	NOUN
aiol-6280	15	44	of	of	ADP
aiol-6280	15	45	santiago	santiago	PROPN
aiol-6280	15	46	de	de	PROPN
aiol-6280	15	47	compostela	compostela	PROPN
aiol-6280	15	48	,	,	PUNCT
aiol-6280	15	49	lugo	lugo	PROPN
aiol-6280	15	50	27002	27002	NUM
aiol-6280	15	51	,	,	PUNCT
aiol-6280	15	52	spain	spain	PROPN
aiol-6280	15	53	*	*	PUNCT
aiol-6280	15	54	corresponding	correspond	VERB
aiol-6280	15	55	author	author	NOUN
aiol-6280	15	56	:	:	PUNCT
aiol-6280	15	57	sgkelis@bio.auth.gr	sgkelis@bio.auth.gr	NOUN
aiol-6280	15	58	abstract	abstract	NOUN
aiol-6280	15	59	the	the	DET
aiol-6280	15	60	expansion	expansion	NOUN
aiol-6280	15	61	of	of	ADP
aiol-6280	15	62	harmful	harmful	ADJ
aiol-6280	15	63	cyanobacterial	cyanobacterial	ADJ
aiol-6280	15	64	blooms	bloom	NOUN
aiol-6280	15	65	is	be	AUX
aiol-6280	15	66	of	of	ADP
aiol-6280	15	67	worldwide	worldwide	ADJ
aiol-6280	15	68	concern	concern	NOUN
aiol-6280	15	69	as	as	SCONJ
aiol-6280	15	70	they	they	PRON
aiol-6280	15	71	have	have	AUX
aiol-6280	15	72	increased	increase	VERB
aiol-6280	15	73	globally	globally	ADV
aiol-6280	15	74	in	in	ADP
aiol-6280	15	75	frequency	frequency	NOUN
aiol-6280	15	76	and	and	CCONJ
aiol-6280	15	77	intensity	intensity	NOUN
aiol-6280	15	78	in	in	ADP
aiol-6280	15	79	recent	recent	ADJ
aiol-6280	15	80	decades	decade	NOUN
aiol-6280	15	81	.	.	PUNCT
aiol-6280	16	1	a	a	DET
aiol-6280	16	2	cyanobacterial	cyanobacterial	ADJ
aiol-6280	16	3	colony	colony	NOUN
aiol-6280	16	4	was	be	AUX
aiol-6280	16	5	found	find	VERB
aiol-6280	16	6	in	in	ADP
aiol-6280	16	7	a	a	DET
aiol-6280	16	8	bottle	bottle	NOUN
aiol-6280	16	9	of	of	ADP
aiol-6280	16	10	natural	natural	ADJ
aiol-6280	16	11	mineral	mineral	NOUN
aiol-6280	16	12	water	water	NOUN
aiol-6280	16	13	of	of	ADP
aiol-6280	16	14	a	a	DET
aiol-6280	16	15	small	small	ADJ
aiol-6280	16	16	water	water	NOUN
aiol-6280	16	17	company	company	NOUN
aiol-6280	16	18	in	in	ADP
aiol-6280	16	19	july	july	PROPN
aiol-6280	16	20	2012	2012	NUM
aiol-6280	16	21	,	,	PUNCT
aiol-6280	16	22	which	which	PRON
aiol-6280	16	23	led	lead	VERB
aiol-6280	16	24	to	to	ADP
aiol-6280	16	25	a	a	DET
aiol-6280	16	26	further	further	ADJ
aiol-6280	16	27	examination	examination	NOUN
aiol-6280	16	28	for	for	ADP
aiol-6280	16	29	a	a	DET
aiol-6280	16	30	period	period	NOUN
aiol-6280	16	31	of	of	ADP
aiol-6280	16	32	five	five	NUM
aiol-6280	16	33	months	month	NOUN
aiol-6280	16	34	(	(	PUNCT
aiol-6280	16	35	july	july	PROPN
aiol-6280	16	36	-	-	PUNCT
aiol-6280	16	37	november	november	PROPN
aiol-6280	16	38	2012	2012	NUM
aiol-6280	16	39	)	)	PUNCT
aiol-6280	16	40	of	of	ADP
aiol-6280	16	41	both	both	CCONJ
aiol-6280	16	42	the	the	DET
aiol-6280	16	43	bottled	bottled	ADJ
aiol-6280	16	44	filtered	filter	VERB
aiol-6280	16	45	water	water	NOUN
aiol-6280	16	46	and	and	CCONJ
aiol-6280	16	47	the	the	DET
aiol-6280	16	48	originating	originating	NOUN
aiol-6280	16	49	groundwater	groundwater	NOUN
aiol-6280	16	50	source	source	NOUN
aiol-6280	16	51	(	(	PUNCT
aiol-6280	16	52	n.	n.	PROPN
aiol-6280	16	53	greece	greece	PROPN
aiol-6280	16	54	)	)	PUNCT
aiol-6280	16	55	for	for	ADP
aiol-6280	16	56	the	the	DET
aiol-6280	16	57	occurrence	occurrence	NOUN
aiol-6280	16	58	of	of	ADP
aiol-6280	16	59	cyanobacteria	cyanobacteria	NOUN
aiol-6280	16	60	.	.	PUNCT
aiol-6280	17	1	cyanobacteria	cyanobacteria	NOUN
aiol-6280	17	2	occurrence	occurrence	NOUN
aiol-6280	17	3	was	be	AUX
aiol-6280	17	4	monitored	monitor	VERB
aiol-6280	17	5	by	by	ADP
aiol-6280	17	6	microscopy	microscopy	NOUN
aiol-6280	17	7	and	and	CCONJ
aiol-6280	17	8	cyanospecific	cyanospecific	ADJ
aiol-6280	17	9	16s	16	NOUN
aiol-6280	17	10	rdna	rdna	NOUN
aiol-6280	17	11	amplification	amplification	NOUN
aiol-6280	17	12	;	;	PUNCT
aiol-6280	17	13	potentially	potentially	ADV
aiol-6280	17	14	toxic	toxic	ADJ
aiol-6280	17	15	species	species	NOUN
aiol-6280	17	16	occurrence	occurrence	NOUN
aiol-6280	17	17	was	be	AUX
aiol-6280	17	18	screened	screen	VERB
aiol-6280	17	19	by	by	ADP
aiol-6280	17	20	mcya	mcya	NOUN
aiol-6280	17	21	gene	gene	NOUN
aiol-6280	17	22	(	(	PUNCT
aiol-6280	17	23	known	know	VERB
aiol-6280	17	24	to	to	PART
aiol-6280	17	25	take	take	VERB
aiol-6280	17	26	part	part	NOUN
aiol-6280	17	27	in	in	ADP
aiol-6280	17	28	the	the	DET
aiol-6280	17	29	mc	mc	PROPN
aiol-6280	17	30	-	-	PUNCT
aiol-6280	17	31	biosynthetic	biosynthetic	ADJ
aiol-6280	17	32	gene	gene	NOUN
aiol-6280	17	33	cluster	cluster	NOUN
aiol-6280	17	34	)	)	PUNCT
aiol-6280	17	35	amplification	amplification	NOUN
aiol-6280	17	36	.	.	PUNCT
aiol-6280	18	1	the	the	DET
aiol-6280	18	2	highest	high	ADJ
aiol-6280	18	3	abundance	abundance	NOUN
aiol-6280	18	4	of	of	ADP
aiol-6280	18	5	cyanobacterial	cyanobacterial	ADJ
aiol-6280	18	6	cells	cell	NOUN
aiol-6280	18	7	without	without	ADP
aiol-6280	18	8	the	the	DET
aiol-6280	18	9	simultaneous	simultaneous	ADJ
aiol-6280	18	10	presence	presence	NOUN
aiol-6280	18	11	of	of	ADP
aiol-6280	18	12	the	the	DET
aiol-6280	18	13	mcya	mcya	NOUN
aiol-6280	18	14	gene	gene	NOUN
aiol-6280	18	15	,	,	PUNCT
aiol-6280	18	16	was	be	AUX
aiol-6280	18	17	measured	measure	VERB
aiol-6280	18	18	in	in	ADP
aiol-6280	18	19	july	july	PROPN
aiol-6280	18	20	,	,	PUNCT
aiol-6280	18	21	in	in	ADP
aiol-6280	18	22	contrast	contrast	NOUN
aiol-6280	18	23	to	to	ADP
aiol-6280	18	24	october	october	PROPN
aiol-6280	18	25	when	when	SCONJ
aiol-6280	18	26	the	the	DET
aiol-6280	18	27	presence	presence	NOUN
aiol-6280	18	28	of	of	ADP
aiol-6280	18	29	cyanobacteria	cyanobacteria	NOUN
aiol-6280	18	30	was	be	AUX
aiol-6280	18	31	only	only	ADV
aiol-6280	18	32	identified	identify	VERB
aiol-6280	18	33	by	by	ADP
aiol-6280	18	34	tracing	trace	VERB
aiol-6280	18	35	cyanospecific	cyanospecific	ADJ
aiol-6280	18	36	16s	16	NOUN
aiol-6280	18	37	rdna	rdna	PROPN
aiol-6280	18	38	and	and	CCONJ
aiol-6280	18	39	the	the	DET
aiol-6280	18	40	mcya	mcya	NOUN
aiol-6280	18	41	gene	gene	NOUN
aiol-6280	18	42	region	region	NOUN
aiol-6280	18	43	in	in	ADP
aiol-6280	18	44	the	the	DET
aiol-6280	18	45	underground	underground	ADJ
aiol-6280	18	46	water	water	NOUN
aiol-6280	18	47	source	source	NOUN
aiol-6280	18	48	.	.	PUNCT
aiol-6280	19	1	the	the	DET
aiol-6280	19	2	results	result	NOUN
aiol-6280	19	3	of	of	ADP
aiol-6280	19	4	this	this	DET
aiol-6280	19	5	small	small	ADJ
aiol-6280	19	6	scale	scale	NOUN
aiol-6280	19	7	monitoring	monitoring	NOUN
aiol-6280	19	8	program	program	NOUN
aiol-6280	19	9	indicate	indicate	VERB
aiol-6280	19	10	the	the	DET
aiol-6280	19	11	potential	potential	ADJ
aiol-6280	19	12	existence	existence	NOUN
aiol-6280	19	13	of	of	ADP
aiol-6280	19	14	an	an	DET
aiol-6280	19	15	emerging	emerge	VERB
aiol-6280	19	16	danger	danger	NOUN
aiol-6280	19	17	for	for	ADP
aiol-6280	19	18	human	human	ADJ
aiol-6280	19	19	health	health	NOUN
aiol-6280	19	20	in	in	ADP
aiol-6280	19	21	a	a	DET
aiol-6280	19	22	relatively	relatively	ADV
aiol-6280	19	23	manageable	manageable	ADJ
aiol-6280	19	24	product	product	NOUN
aiol-6280	19	25	such	such	ADJ
aiol-6280	19	26	as	as	ADP
aiol-6280	19	27	the	the	DET
aiol-6280	19	28	bottled	bottled	ADJ
aiol-6280	19	29	natural	natural	ADJ
aiol-6280	19	30	mineral	mineral	NOUN
aiol-6280	19	31	water	water	NOUN
aiol-6280	19	32	.	.	PUNCT
aiol-6280	20	1	key	key	ADJ
aiol-6280	20	2	words	word	NOUN
aiol-6280	20	3	:	:	PUNCT
aiol-6280	20	4	microcystis	microcystis	NOUN
aiol-6280	20	5	;	;	PUNCT
aiol-6280	20	6	microcystin	microcystin	NOUN
aiol-6280	20	7	;	;	PUNCT
aiol-6280	20	8	bottled	bottled	ADJ
aiol-6280	20	9	water	water	NOUN
aiol-6280	20	10	;	;	PUNCT
aiol-6280	20	11	natural	natural	ADJ
aiol-6280	20	12	mineral	mineral	NOUN
aiol-6280	20	13	water	water	NOUN
aiol-6280	20	14	.	.	PUNCT
aiol-6280	21	1	received	receive	VERB
aiol-6280	21	2	:	:	PUNCT
aiol-6280	21	3	12	12	NUM
aiol-6280	21	4	september	september	PROPN
aiol-6280	21	5	2016	2016	NUM
aiol-6280	21	6	.	.	PUNCT
aiol-6280	22	1	accepted	accept	VERB
aiol-6280	22	2	:	:	PUNCT
aiol-6280	22	3	16	16	NUM
aiol-6280	22	4	march	march	PROPN
aiol-6280	22	5	2017	2017	NUM
aiol-6280	22	6	.	.	PUNCT
aiol-6280	23	1	non	non	ADJ
aiol-6280	23	2	-co	-co	PROPN
aiol-6280	23	3	mmerc	mmerc	PROPN
aiol-6280	23	4	ial	ial	PROPN
aiol-6280	23	5	us	us	PROPN
aiol-6280	23	6	e	e	NOUN
aiol-6280	23	7	o	o	PROPN
aiol-6280	23	8	nly	nly	ADV
aiol-6280	23	9	s.	s.	PROPN
aiol-6280	23	10	gkelis	gkelis	PROPN
aiol-6280	23	11	and	and	CCONJ
aiol-6280	23	12	a.	a.	NOUN
aiol-6280	23	13	vlamis88	vlamis88	NOUN
aiol-6280	23	14	monthly	monthly	ADV
aiol-6280	23	15	between	between	ADP
aiol-6280	23	16	july	july	PROPN
aiol-6280	23	17	and	and	CCONJ
aiol-6280	23	18	december	december	PROPN
aiol-6280	23	19	2012	2012	NUM
aiol-6280	23	20	from	from	ADP
aiol-6280	23	21	two	two	NUM
aiol-6280	23	22	drilling	drilling	NOUN
aiol-6280	23	23	points	point	NOUN
aiol-6280	23	24	(	(	PUNCT
aiol-6280	23	25	sup1	sup1	NOUN
aiol-6280	23	26	and	and	CCONJ
aiol-6280	23	27	sup2	sup2	PROPN
aiol-6280	23	28	)	)	PUNCT
aiol-6280	23	29	used	use	VERB
aiol-6280	23	30	for	for	ADP
aiol-6280	23	31	the	the	DET
aiol-6280	23	32	production	production	NOUN
aiol-6280	23	33	of	of	ADP
aiol-6280	23	34	bottled	bottled	ADJ
aiol-6280	23	35	natural	natural	ADJ
aiol-6280	23	36	mineral	mineral	NOUN
aiol-6280	23	37	water	water	NOUN
aiol-6280	23	38	.	.	PUNCT
aiol-6280	24	1	the	the	DET
aiol-6280	24	2	final	final	ADJ
aiol-6280	24	3	product	product	NOUN
aiol-6280	24	4	which	which	PRON
aiol-6280	24	5	had	have	VERB
aiol-6280	24	6	undergone	undergo	VERB
aiol-6280	24	7	filtration	filtration	NOUN
aiol-6280	24	8	was	be	AUX
aiol-6280	24	9	also	also	ADV
aiol-6280	24	10	sampled	sample	VERB
aiol-6280	24	11	(	(	PUNCT
aiol-6280	24	12	bottled	bottled	ADJ
aiol-6280	24	13	filtered	filter	VERB
aiol-6280	24	14	water	water	NOUN
aiol-6280	24	15	-	-	PUNCT
aiol-6280	24	16	bf	bf	NOUN
aiol-6280	24	17	)	)	PUNCT
aiol-6280	24	18	.	.	PUNCT
aiol-6280	25	1	aliquots	aliquot	NOUN
aiol-6280	25	2	of	of	ADP
aiol-6280	25	3	these	these	PRON
aiol-6280	25	4	were	be	AUX
aiol-6280	25	5	preserved	preserve	VERB
aiol-6280	25	6	with	with	ADP
aiol-6280	25	7	both	both	DET
aiol-6280	25	8	lugol	lugol	NOUN
aiol-6280	25	9	’s	’s	PART
aiol-6280	25	10	solution	solution	NOUN
aiol-6280	25	11	(	(	PUNCT
aiol-6280	25	12	1	1	NUM
aiol-6280	25	13	%	%	NOUN
aiol-6280	25	14	v	v	ADP
aiol-6280	25	15	/	/	SYM
aiol-6280	25	16	v	v	NOUN
aiol-6280	25	17	)	)	PUNCT
aiol-6280	25	18	and	and	CCONJ
aiol-6280	25	19	formaldehyde	formaldehyde	NOUN
aiol-6280	25	20	(	(	PUNCT
aiol-6280	25	21	2	2	NUM
aiol-6280	25	22	%	%	NOUN
aiol-6280	25	23	v	v	NOUN
aiol-6280	25	24	/	/	SYM
aiol-6280	25	25	v	v	NOUN
aiol-6280	25	26	)	)	PUNCT
aiol-6280	25	27	.	.	PUNCT
aiol-6280	26	1	water	water	NOUN
aiol-6280	26	2	samples	sample	NOUN
aiol-6280	26	3	were	be	AUX
aiol-6280	26	4	stored	store	VERB
aiol-6280	26	5	in	in	ADP
aiol-6280	26	6	polyethylene	polyethylene	NOUN
aiol-6280	26	7	bottles	bottle	NOUN
aiol-6280	26	8	and	and	CCONJ
aiol-6280	26	9	transferred	transfer	VERB
aiol-6280	26	10	to	to	ADP
aiol-6280	26	11	the	the	DET
aiol-6280	26	12	laboratory	laboratory	NOUN
aiol-6280	26	13	(	(	PUNCT
aiol-6280	26	14	<	<	X
aiol-6280	26	15	5	5	NUM
aiol-6280	26	16	h	h	NOUN
aiol-6280	26	17	)	)	PUNCT
aiol-6280	26	18	under	under	ADP
aiol-6280	26	19	cool	cool	ADJ
aiol-6280	26	20	and	and	CCONJ
aiol-6280	26	21	dark	dark	ADJ
aiol-6280	26	22	conditions	condition	NOUN
aiol-6280	26	23	.	.	PUNCT
aiol-6280	27	1	immediately	immediately	ADV
aiol-6280	27	2	upon	upon	SCONJ
aiol-6280	27	3	reception	reception	NOUN
aiol-6280	27	4	in	in	ADP
aiol-6280	27	5	the	the	DET
aiol-6280	27	6	laboratory	laboratory	NOUN
aiol-6280	27	7	,	,	PUNCT
aiol-6280	27	8	1.5	1.5	NUM
aiol-6280	27	9	l	l	NOUN
aiol-6280	27	10	of	of	ADP
aiol-6280	27	11	water	water	NOUN
aiol-6280	27	12	was	be	AUX
aiol-6280	27	13	filtered	filter	VERB
aiol-6280	27	14	on	on	ADP
aiol-6280	27	15	a	a	DET
aiol-6280	27	16	whatman	whatman	NOUN
aiol-6280	27	17	gf	gf	X
aiol-6280	27	18	/	/	SYM
aiol-6280	27	19	c	c	NOUN
aiol-6280	27	20	filters	filter	NOUN
aiol-6280	27	21	and	and	CCONJ
aiol-6280	27	22	the	the	DET
aiol-6280	27	23	filter	filter	NOUN
aiol-6280	27	24	was	be	AUX
aiol-6280	27	25	stored	store	VERB
aiol-6280	27	26	at	at	ADP
aiol-6280	27	27	-20	-20	NUM
aiol-6280	27	28	°	°	NOUN
aiol-6280	27	29	c	c	NOUN
aiol-6280	27	30	for	for	ADP
aiol-6280	27	31	further	further	ADJ
aiol-6280	27	32	analysis	analysis	NOUN
aiol-6280	27	33	.	.	PUNCT
aiol-6280	28	1	phytoplankton	phytoplankton	NOUN
aiol-6280	28	2	analysis	analysis	NOUN
aiol-6280	28	3	fresh	fresh	ADJ
aiol-6280	28	4	and	and	CCONJ
aiol-6280	28	5	preserved	preserve	VERB
aiol-6280	28	6	samples	sample	NOUN
aiol-6280	28	7	were	be	AUX
aiol-6280	28	8	examined	examine	VERB
aiol-6280	28	9	using	use	VERB
aiol-6280	28	10	an	an	DET
aiol-6280	28	11	inverted	inverted	ADJ
aiol-6280	28	12	microscope	microscope	NOUN
aiol-6280	28	13	(	(	PUNCT
aiol-6280	28	14	olympus	olympus	PROPN
aiol-6280	28	15	ix71	ix71	PROPN
aiol-6280	28	16	)	)	PUNCT
aiol-6280	28	17	with	with	ADP
aiol-6280	28	18	phase	phase	NOUN
aiol-6280	28	19	-	-	PUNCT
aiol-6280	28	20	contrast	contrast	NOUN
aiol-6280	28	21	.	.	PUNCT
aiol-6280	29	1	species	specie	NOUN
aiol-6280	29	2	were	be	AUX
aiol-6280	29	3	identified	identify	VERB
aiol-6280	29	4	using	use	VERB
aiol-6280	29	5	komárek	komárek	NOUN
aiol-6280	29	6	and	and	CCONJ
aiol-6280	29	7	anagnostidis	anagnostidis	ADJ
aiol-6280	29	8	(	(	PUNCT
aiol-6280	29	9	1999	1999	NUM
aiol-6280	29	10	)	)	PUNCT
aiol-6280	29	11	.	.	PUNCT
aiol-6280	30	1	the	the	DET
aiol-6280	30	2	abundance	abundance	NOUN
aiol-6280	30	3	of	of	ADP
aiol-6280	30	4	cyanobacterial	cyanobacterial	ADJ
aiol-6280	30	5	cells	cell	NOUN
aiol-6280	30	6	was	be	AUX
aiol-6280	30	7	determined	determine	VERB
aiol-6280	30	8	in	in	ADP
aiol-6280	30	9	accordance	accordance	NOUN
aiol-6280	30	10	with	with	ADP
aiol-6280	30	11	utermöhl	utermöhl	NOUN
aiol-6280	30	12	(	(	PUNCT
aiol-6280	30	13	1958	1958	NUM
aiol-6280	30	14	)	)	PUNCT
aiol-6280	30	15	,	,	PUNCT
aiol-6280	30	16	using	use	VERB
aiol-6280	30	17	50	50	NUM
aiol-6280	30	18	ml	ml	NOUN
aiol-6280	30	19	sedimentation	sedimentation	NOUN
aiol-6280	30	20	chambers	chamber	NOUN
aiol-6280	30	21	,	,	PUNCT
aiol-6280	30	22	thus	thus	ADV
aiol-6280	30	23	detection	detection	NOUN
aiol-6280	30	24	limit	limit	NOUN
aiol-6280	30	25	was	be	AUX
aiol-6280	30	26	20	20	NUM
aiol-6280	30	27	cells	cell	NOUN
aiol-6280	30	28	l–1	l–1	PROPN
aiol-6280	30	29	.	.	PUNCT
aiol-6280	31	1	transepts	transept	NOUN
aiol-6280	31	2	were	be	AUX
aiol-6280	31	3	counted	count	VERB
aiol-6280	31	4	and	and	CCONJ
aiol-6280	31	5	the	the	DET
aiol-6280	31	6	variation	variation	NOUN
aiol-6280	31	7	coefficient	coefficient	NOUN
aiol-6280	31	8	was	be	AUX
aiol-6280	31	9	always	always	ADV
aiol-6280	31	10	kept	keep	VERB
aiol-6280	31	11	under	under	ADP
aiol-6280	31	12	20	20	NUM
aiol-6280	31	13	%	%	NOUN
aiol-6280	31	14	.	.	PUNCT
aiol-6280	32	1	phytoplankton	phytoplankton	NOUN
aiol-6280	32	2	abundance	abundance	NOUN
aiol-6280	32	3	is	be	AUX
aiol-6280	32	4	presented	present	VERB
aiol-6280	32	5	in	in	ADP
aiol-6280	32	6	number	number	NOUN
aiol-6280	32	7	of	of	ADP
aiol-6280	32	8	cells	cell	NOUN
aiol-6280	32	9	l–1	l–1	PROPN
aiol-6280	32	10	.	.	PUNCT
aiol-6280	33	1	molecular	molecular	ADJ
aiol-6280	33	2	detection	detection	NOUN
aiol-6280	33	3	dna	dna	NOUN
aiol-6280	33	4	was	be	AUX
aiol-6280	33	5	extracted	extract	VERB
aiol-6280	33	6	using	use	VERB
aiol-6280	33	7	the	the	DET
aiol-6280	33	8	protocol	protocol	NOUN
aiol-6280	33	9	described	describe	VERB
aiol-6280	33	10	in	in	ADP
aiol-6280	33	11	atashpaz	atashpaz	PROPN
aiol-6280	33	12	et	et	PROPN
aiol-6280	33	13	al	al	PROPN
aiol-6280	33	14	.	.	PROPN
aiol-6280	34	1	(	(	PUNCT
aiol-6280	34	2	2010	2010	NUM
aiol-6280	34	3	)	)	PUNCT
aiol-6280	34	4	for	for	ADP
aiol-6280	34	5	gram	gram	NOUN
aiol-6280	34	6	negative	negative	ADJ
aiol-6280	34	7	bacteria	bacteria	NOUN
aiol-6280	34	8	,	,	PUNCT
aiol-6280	34	9	after	after	ADP
aiol-6280	34	10	slicing	slice	VERB
aiol-6280	34	11	the	the	DET
aiol-6280	34	12	filters	filter	NOUN
aiol-6280	34	13	with	with	ADP
aiol-6280	34	14	a	a	DET
aiol-6280	34	15	sterile	sterile	ADJ
aiol-6280	34	16	scalpel	scalpel	NOUN
aiol-6280	34	17	.	.	PUNCT
aiol-6280	35	1	in	in	ADP
aiol-6280	35	2	order	order	NOUN
aiol-6280	35	3	to	to	PART
aiol-6280	35	4	identify	identify	VERB
aiol-6280	35	5	cyanobacteria	cyanobacteria	NOUN
aiol-6280	35	6	and	and	CCONJ
aiol-6280	35	7	potentially	potentially	ADV
aiol-6280	35	8	mc	mc	PROPN
aiol-6280	35	9	-	-	PUNCT
aiol-6280	35	10	producing	produce	VERB
aiol-6280	35	11	cyanobacteria	cyanobacteria	NOUN
aiol-6280	35	12	we	we	PRON
aiol-6280	35	13	used	use	VERB
aiol-6280	35	14	two	two	NUM
aiol-6280	35	15	different	different	ADJ
aiol-6280	35	16	sets	set	NOUN
aiol-6280	35	17	of	of	ADP
aiol-6280	35	18	primers	primer	NOUN
aiol-6280	35	19	,	,	PUNCT
aiol-6280	35	20	respectively	respectively	ADV
aiol-6280	35	21	:	:	PUNCT
aiol-6280	35	22	the	the	DET
aiol-6280	35	23	16s	16s	PROPN
aiol-6280	35	24	27f	27f	PROPN
aiol-6280	35	25	(	(	PUNCT
aiol-6280	35	26	5’-agagtttgatcctggctcag-3	5’-agagtttgatcctggctcag-3	NUM
aiol-6280	35	27	’	'	PUNCT
aiol-6280	35	28	)	)	PUNCT
aiol-6280	35	29	/16s	/16s	PUNCT
aiol-6280	36	1	1494r	1494r	NOUN
aiol-6280	36	2	(	(	PUNCT
aiol-6280	36	3	5’tacggttaccttgttacgac	5’tacggttaccttgttacgac	NUM
aiol-6280	36	4	-3	-3	ADJ
aiol-6280	36	5	’	'	PUNCT
aiol-6280	36	6	)	)	PUNCT
aiol-6280	36	7	primer	primer	NOUN
aiol-6280	36	8	pair	pair	NOUN
aiol-6280	36	9	which	which	PRON
aiol-6280	36	10	amplifies	amplify	VERB
aiol-6280	36	11	a	a	DET
aiol-6280	36	12	1367	1367	NUM
aiol-6280	36	13	-	-	PUNCT
aiol-6280	36	14	bp	bp	NOUN
aiol-6280	36	15	fragment	fragment	NOUN
aiol-6280	36	16	of	of	ADP
aiol-6280	36	17	16s	16s	PROPN
aiol-6280	36	18	rdna	rdna	PROPN
aiol-6280	36	19	in	in	ADP
aiol-6280	36	20	all	all	DET
aiol-6280	36	21	cyanobacteria	cyanobacteria	NOUN
aiol-6280	36	22	(	(	PUNCT
aiol-6280	36	23	neilan	neilan	NOUN
aiol-6280	36	24	et	et	PROPN
aiol-6280	36	25	al	al	PROPN
aiol-6280	36	26	.	.	PROPN
aiol-6280	36	27	,	,	PUNCT
aiol-6280	36	28	1997	1997	NUM
aiol-6280	36	29	)	)	PUNCT
aiol-6280	36	30	and	and	CCONJ
aiol-6280	36	31	the	the	DET
aiol-6280	36	32	mcya	mcya	NOUN
aiol-6280	36	33	cd1f	cd1f	PROPN
aiol-6280	36	34	(	(	PUNCT
aiol-6280	36	35	5’aaaattaaaagccgtatcaaa-3	5’aaaattaaaagccgtatcaaa-3	NUM
aiol-6280	36	36	’	'	PUNCT
aiol-6280	36	37	)	)	PUNCT
aiol-6280	36	38	/mcya	/mcya	PUNCT
aiol-6280	37	1	cd1r	cd1r	PROPN
aiol-6280	37	2	(	(	PUNCT
aiol-6280	37	3	5’aaaagtgttttattagcggctcat-3	5’aaaagtgttttattagcggctcat-3	NUM
aiol-6280	37	4	’	'	PUNCT
aiol-6280	37	5	)	)	PUNCT
aiol-6280	37	6	primer	primer	NOUN
aiol-6280	37	7	pair	pair	NOUN
aiol-6280	37	8	(	(	PUNCT
aiol-6280	37	9	hisbergues	hisbergue	NOUN
aiol-6280	37	10	et	et	PROPN
aiol-6280	37	11	al	al	PROPN
aiol-6280	37	12	.	.	PROPN
aiol-6280	37	13	,	,	PUNCT
aiol-6280	37	14	2003	2003	NUM
aiol-6280	37	15	)	)	PUNCT
aiol-6280	37	16	,	,	PUNCT
aiol-6280	37	17	which	which	PRON
aiol-6280	37	18	was	be	AUX
aiol-6280	37	19	designed	design	VERB
aiol-6280	37	20	to	to	PART
aiol-6280	37	21	amplify	amplify	VERB
aiol-6280	37	22	a	a	DET
aiol-6280	37	23	297	297	NUM
aiol-6280	37	24	-	-	PUNCT
aiol-6280	37	25	bp	bp	NOUN
aiol-6280	37	26	fragment	fragment	NOUN
aiol-6280	37	27	of	of	ADP
aiol-6280	37	28	the	the	DET
aiol-6280	37	29	mcya	mcya	NOUN
aiol-6280	37	30	gene	gene	NOUN
aiol-6280	37	31	from	from	ADP
aiol-6280	37	32	mc	mc	PROPN
aiol-6280	37	33	-	-	PUNCT
aiol-6280	37	34	synthesizing	synthesize	VERB
aiol-6280	37	35	cyanobacteria	cyanobacteria	NOUN
aiol-6280	37	36	strains	strain	NOUN
aiol-6280	37	37	and	and	CCONJ
aiol-6280	37	38	was	be	AUX
aiol-6280	37	39	previously	previously	ADV
aiol-6280	37	40	proved	prove	VERB
aiol-6280	37	41	to	to	PART
aiol-6280	37	42	be	be	AUX
aiol-6280	37	43	suitable	suitable	ADJ
aiol-6280	37	44	to	to	PART
aiol-6280	37	45	detect	detect	VERB
aiol-6280	37	46	mc	mc	PROPN
aiol-6280	37	47	-	-	PUNCT
aiol-6280	37	48	producing	produce	VERB
aiol-6280	37	49	cells	cell	NOUN
aiol-6280	37	50	from	from	ADP
aiol-6280	37	51	the	the	DET
aiol-6280	37	52	genera	genera	NOUN
aiol-6280	37	53	anabaena	anabaena	NOUN
aiol-6280	37	54	,	,	PUNCT
aiol-6280	37	55	microcystis	microcystis	PROPN
aiol-6280	37	56	and	and	CCONJ
aiol-6280	37	57	,	,	PUNCT
aiol-6280	37	58	planktothrix	planktothrix	VERB
aiol-6280	37	59	(	(	PUNCT
aiol-6280	37	60	hisbergues	hisbergue	NOUN
aiol-6280	37	61	et	et	PROPN
aiol-6280	37	62	al	al	PROPN
aiol-6280	37	63	.	.	PROPN
aiol-6280	37	64	,	,	PUNCT
aiol-6280	37	65	2003	2003	NUM
aiol-6280	37	66	)	)	PUNCT
aiol-6280	37	67	.	.	PUNCT
aiol-6280	38	1	samples	sample	NOUN
aiol-6280	38	2	giving	give	VERB
aiol-6280	38	3	positive	positive	ADJ
aiol-6280	38	4	results	result	NOUN
aiol-6280	38	5	in	in	ADP
aiol-6280	38	6	this	this	DET
aiol-6280	38	7	assay	assay	NOUN
aiol-6280	38	8	have	have	AUX
aiol-6280	38	9	been	be	AUX
aiol-6280	38	10	shown	show	VERB
aiol-6280	38	11	to	to	PART
aiol-6280	38	12	have	have	VERB
aiol-6280	38	13	a	a	DET
aiol-6280	38	14	high	high	ADJ
aiol-6280	38	15	probability	probability	NOUN
aiol-6280	38	16	of	of	ADP
aiol-6280	38	17	producing	produce	VERB
aiol-6280	38	18	mcs	mcs	PROPN
aiol-6280	38	19	(	(	PUNCT
aiol-6280	38	20	hisbergues	hisbergue	NOUN
aiol-6280	38	21	et	et	PROPN
aiol-6280	38	22	al	al	PROPN
aiol-6280	38	23	.	.	PROPN
aiol-6280	38	24	,	,	PUNCT
aiol-6280	38	25	2003	2003	NUM
aiol-6280	38	26	;	;	PUNCT
aiol-6280	38	27	vasconcelos	vasconcelos	PROPN
aiol-6280	38	28	et	et	PROPN
aiol-6280	38	29	al	al	PROPN
aiol-6280	38	30	.	.	PROPN
aiol-6280	38	31	,	,	PUNCT
aiol-6280	38	32	2010	2010	NUM
aiol-6280	38	33	)	)	PUNCT
aiol-6280	38	34	.	.	PUNCT
aiol-6280	39	1	we	we	PRON
aiol-6280	39	2	chose	choose	VERB
aiol-6280	39	3	to	to	PART
aiol-6280	39	4	detect	detect	VERB
aiol-6280	39	5	a	a	DET
aiol-6280	39	6	gene	gene	NOUN
aiol-6280	39	7	target	target	NOUN
aiol-6280	39	8	known	know	VERB
aiol-6280	39	9	to	to	PART
aiol-6280	39	10	be	be	AUX
aiol-6280	39	11	involved	involve	VERB
aiol-6280	39	12	in	in	ADP
aiol-6280	39	13	the	the	DET
aiol-6280	39	14	biosynthesis	biosynthesis	NOUN
aiol-6280	39	15	of	of	ADP
aiol-6280	39	16	mc	mc	PROPN
aiol-6280	39	17	,	,	PUNCT
aiol-6280	39	18	as	as	SCONJ
aiol-6280	39	19	this	this	PRON
aiol-6280	39	20	is	be	AUX
aiol-6280	39	21	the	the	DET
aiol-6280	39	22	most	most	ADV
aiol-6280	39	23	frequent	frequent	ADJ
aiol-6280	39	24	cyanotoxin	cyanotoxin	NOUN
aiol-6280	39	25	in	in	ADP
aiol-6280	39	26	greece	greece	PROPN
aiol-6280	39	27	(	(	PUNCT
aiol-6280	39	28	gkelis	gkelis	PROPN
aiol-6280	39	29	and	and	CCONJ
aiol-6280	39	30	zaoutsos	zaoutsos	NOUN
aiol-6280	39	31	,	,	PUNCT
aiol-6280	39	32	2014	2014	NUM
aiol-6280	39	33	;	;	PUNCT
aiol-6280	39	34	gkelis	gkelis	PROPN
aiol-6280	39	35	et	et	PROPN
aiol-6280	39	36	al	al	PROPN
aiol-6280	39	37	.	.	PROPN
aiol-6280	39	38	,	,	PUNCT
aiol-6280	39	39	2015b	2015b	NUM
aiol-6280	39	40	)	)	PUNCT
aiol-6280	39	41	and	and	CCONJ
aiol-6280	39	42	worldwide	worldwide	ADV
aiol-6280	39	43	.	.	PUNCT
aiol-6280	40	1	pcr	pcr	PROPN
aiol-6280	40	2	was	be	AUX
aiol-6280	40	3	carried	carry	VERB
aiol-6280	40	4	out	out	ADP
aiol-6280	40	5	on	on	ADP
aiol-6280	40	6	the	the	DET
aiol-6280	40	7	dna	dna	PROPN
aiol-6280	40	8	extracts	extract	NOUN
aiol-6280	40	9	using	use	VERB
aiol-6280	40	10	the	the	DET
aiol-6280	40	11	primer	primer	NOUN
aiol-6280	40	12	pairs	pair	NOUN
aiol-6280	40	13	presented	present	VERB
aiol-6280	40	14	previously	previously	ADV
aiol-6280	40	15	.	.	PUNCT
aiol-6280	41	1	all	all	DET
aiol-6280	41	2	pcr	pcr	ADJ
aiol-6280	41	3	reactions	reaction	NOUN
aiol-6280	41	4	were	be	AUX
aiol-6280	41	5	prepared	prepare	VERB
aiol-6280	41	6	as	as	SCONJ
aiol-6280	41	7	described	describe	VERB
aiol-6280	41	8	in	in	ADP
aiol-6280	41	9	gkelis	gkelis	PROPN
aiol-6280	41	10	and	and	CCONJ
aiol-6280	41	11	zaoutsos	zaoutsos	PROPN
aiol-6280	41	12	(	(	PUNCT
aiol-6280	41	13	2014	2014	NUM
aiol-6280	41	14	)	)	PUNCT
aiol-6280	41	15	.	.	PUNCT
aiol-6280	42	1	thermal	thermal	ADJ
aiol-6280	42	2	cycling	cycling	NOUN
aiol-6280	42	3	was	be	AUX
aiol-6280	42	4	carried	carry	VERB
aiol-6280	42	5	out	out	ADP
aiol-6280	42	6	using	use	VERB
aiol-6280	42	7	an	an	DET
aiol-6280	42	8	eppendorf	eppendorf	ADJ
aiol-6280	42	9	mastercycler	mastercycler	ADJ
aiol-6280	42	10	pro	pro	X
aiol-6280	42	11	(	(	PUNCT
aiol-6280	42	12	eppendorf	eppendorf	NOUN
aiol-6280	42	13	)	)	PUNCT
aiol-6280	42	14	.	.	PUNCT
aiol-6280	43	1	amplification	amplification	NOUN
aiol-6280	43	2	was	be	AUX
aiol-6280	43	3	performed	perform	VERB
aiol-6280	43	4	according	accord	VERB
aiol-6280	43	5	to	to	ADP
aiol-6280	43	6	the	the	DET
aiol-6280	43	7	protocols	protocol	NOUN
aiol-6280	43	8	described	describe	VERB
aiol-6280	43	9	by	by	ADP
aiol-6280	43	10	neilan	neilan	PROPN
aiol-6280	43	11	et	et	PROPN
aiol-6280	43	12	al	al	PROPN
aiol-6280	43	13	.	.	PROPN
aiol-6280	44	1	(	(	PUNCT
aiol-6280	44	2	1997	1997	NUM
aiol-6280	44	3	)	)	PUNCT
aiol-6280	44	4	and	and	CCONJ
aiol-6280	44	5	hisbergues	hisbergue	NOUN
aiol-6280	44	6	et	et	PROPN
aiol-6280	44	7	al	al	PROPN
aiol-6280	44	8	.	.	PROPN
aiol-6280	45	1	(	(	PUNCT
aiol-6280	45	2	2003	2003	NUM
aiol-6280	45	3	)	)	PUNCT
aiol-6280	45	4	for	for	ADP
aiol-6280	45	5	16s	16s	PROPN
aiol-6280	45	6	rrna	rrna	PROPN
aiol-6280	45	7	and	and	CCONJ
aiol-6280	45	8	mcya	mcya	NOUN
aiol-6280	45	9	,	,	PUNCT
aiol-6280	45	10	respectively	respectively	ADV
aiol-6280	45	11	.	.	PUNCT
aiol-6280	46	1	dna	dna	PROPN
aiol-6280	46	2	extracted	extract	VERB
aiol-6280	46	3	from	from	ADP
aiol-6280	46	4	microcystis	microcystis	PROPN
aiol-6280	46	5	aeruginosa	aeruginosa	PROPN
aiol-6280	46	6	m6	m6	PROPN
aiol-6280	46	7	strain	strain	NOUN
aiol-6280	46	8	(	(	PUNCT
aiol-6280	46	9	see	see	VERB
aiol-6280	46	10	vasconcelos	vasconcelos	PROPN
aiol-6280	46	11	et	et	PROPN
aiol-6280	46	12	al	al	PROPN
aiol-6280	46	13	.	.	PROPN
aiol-6280	46	14	,	,	PUNCT
aiol-6280	46	15	2010	2010	NUM
aiol-6280	46	16	)	)	PUNCT
aiol-6280	46	17	was	be	AUX
aiol-6280	46	18	used	use	VERB
aiol-6280	46	19	as	as	ADP
aiol-6280	46	20	positive	positive	ADJ
aiol-6280	46	21	control	control	NOUN
aiol-6280	46	22	for	for	ADP
aiol-6280	46	23	the	the	DET
aiol-6280	46	24	amplification	amplification	NOUN
aiol-6280	46	25	of	of	ADP
aiol-6280	46	26	mcya	mcya	NOUN
aiol-6280	46	27	gene	gene	NOUN
aiol-6280	46	28	target	target	NOUN
aiol-6280	46	29	and	and	CCONJ
aiol-6280	46	30	water	water	NOUN
aiol-6280	46	31	as	as	ADP
aiol-6280	46	32	negative	negative	ADJ
aiol-6280	46	33	control	control	NOUN
aiol-6280	46	34	.	.	PUNCT
aiol-6280	47	1	pcr	pcr	ADJ
aiol-6280	47	2	products	product	NOUN
aiol-6280	47	3	were	be	AUX
aiol-6280	47	4	separated	separate	VERB
aiol-6280	47	5	by	by	ADP
aiol-6280	47	6	1.5	1.5	NUM
aiol-6280	47	7	%	%	NOUN
aiol-6280	47	8	(	(	PUNCT
aiol-6280	47	9	w	w	NOUN
aiol-6280	47	10	/	/	SYM
aiol-6280	47	11	v	v	NOUN
aiol-6280	47	12	)	)	PUNCT
aiol-6280	47	13	agarose	agarose	NOUN
aiol-6280	47	14	gel	gel	NOUN
aiol-6280	47	15	in	in	ADP
aiol-6280	47	16	1x	1x	NUM
aiol-6280	47	17	tae	tae	NOUN
aiol-6280	47	18	buffer	buffer	NOUN
aiol-6280	47	19	.	.	PUNCT
aiol-6280	48	1	the	the	DET
aiol-6280	48	2	gels	gel	NOUN
aiol-6280	48	3	were	be	AUX
aiol-6280	48	4	stained	stain	VERB
aiol-6280	48	5	with	with	ADP
aiol-6280	48	6	ethidium	ethidium	NOUN
aiol-6280	48	7	bromide	bromide	NOUN
aiol-6280	48	8	and	and	CCONJ
aiol-6280	48	9	photographed	photograph	VERB
aiol-6280	48	10	under	under	ADP
aiol-6280	48	11	uv	uv	PROPN
aiol-6280	48	12	transillumination	transillumination	NOUN
aiol-6280	48	13	.	.	PUNCT
aiol-6280	49	1	results	result	NOUN
aiol-6280	49	2	and	and	CCONJ
aiol-6280	49	3	discussion	discussion	NOUN
aiol-6280	49	4	cyanobacteria	cyanobacteria	NOUN
aiol-6280	49	5	were	be	AUX
aiol-6280	49	6	detected	detect	VERB
aiol-6280	49	7	by	by	ADP
aiol-6280	49	8	microscopy	microscopy	NOUN
aiol-6280	49	9	only	only	ADV
aiol-6280	49	10	in	in	ADP
aiol-6280	49	11	the	the	DET
aiol-6280	49	12	bottled	bottled	ADJ
aiol-6280	49	13	sample	sample	PROPN
aiol-6280	49	14	bf	bf	PROPN
aiol-6280	49	15	/	/	SYM
aiol-6280	49	16	a	a	PRON
aiol-6280	49	17	,	,	PUNCT
aiol-6280	49	18	collected	collect	VERB
aiol-6280	49	19	on	on	ADP
aiol-6280	49	20	the	the	DET
aiol-6280	49	21	5th	5th	NOUN
aiol-6280	49	22	of	of	ADP
aiol-6280	49	23	july	july	PROPN
aiol-6280	49	24	2012	2012	NUM
aiol-6280	49	25	(	(	PUNCT
aiol-6280	49	26	tab	tab	NOUN
aiol-6280	49	27	.	.	NOUN
aiol-6280	49	28	1	1	NUM
aiol-6280	49	29	)	)	PUNCT
aiol-6280	49	30	.	.	PUNCT
aiol-6280	50	1	a	a	DET
aiol-6280	50	2	colonial	colonial	ADJ
aiol-6280	50	3	form	form	NOUN
aiol-6280	50	4	of	of	ADP
aiol-6280	50	5	microcystis	microcystis	ADJ
aiol-6280	50	6	-	-	PUNCT
aiol-6280	50	7	like	like	ADJ
aiol-6280	50	8	cyanobacteria	cyanobacteria	NOUN
aiol-6280	50	9	was	be	AUX
aiol-6280	50	10	found	find	VERB
aiol-6280	50	11	,	,	PUNCT
aiol-6280	50	12	which	which	PRON
aiol-6280	50	13	could	could	AUX
aiol-6280	50	14	not	not	PART
aiol-6280	50	15	be	be	AUX
aiol-6280	50	16	further	far	ADV
aiol-6280	50	17	identified	identify	VERB
aiol-6280	50	18	(	(	PUNCT
aiol-6280	50	19	fig	fig	NOUN
aiol-6280	50	20	.	.	PUNCT
aiol-6280	51	1	1	1	NUM
aiol-6280	51	2	)	)	PUNCT
aiol-6280	51	3	.	.	PUNCT
aiol-6280	52	1	cells	cell	NOUN
aiol-6280	52	2	were	be	AUX
aiol-6280	52	3	spherical	spherical	ADJ
aiol-6280	52	4	with	with	ADP
aiol-6280	52	5	an	an	DET
aiol-6280	52	6	average	average	ADJ
aiol-6280	52	7	diameter	diameter	NOUN
aiol-6280	52	8	tab	tab	NOUN
aiol-6280	52	9	.	.	PUNCT
aiol-6280	53	1	1	1	X
aiol-6280	53	2	.	.	X
aiol-6280	53	3	microscopic	microscopic	ADJ
aiol-6280	53	4	and	and	CCONJ
aiol-6280	53	5	molecular	molecular	ADJ
aiol-6280	53	6	detection	detection	NOUN
aiol-6280	53	7	of	of	ADP
aiol-6280	53	8	cyanobacteria	cyanobacteria	NOUN
aiol-6280	53	9	in	in	ADP
aiol-6280	53	10	the	the	DET
aiol-6280	53	11	water	water	NOUN
aiol-6280	53	12	samples	sample	NOUN
aiol-6280	53	13	collected	collect	VERB
aiol-6280	53	14	during	during	ADP
aiol-6280	53	15	the	the	DET
aiol-6280	53	16	study	study	NOUN
aiol-6280	53	17	.	.	PUNCT
aiol-6280	54	1	sampling	sample	VERB
aiol-6280	54	2	date	date	NOUN
aiol-6280	54	3	sample	sample	NOUN
aiol-6280	54	4	microscopic	microscopic	ADJ
aiol-6280	54	5	analysis	analysis	NOUN
aiol-6280	54	6	μolecular	μolecular	ADJ
aiol-6280	54	7	analysis	analysis	NOUN
aiol-6280	54	8	cells	cell	NOUN
aiol-6280	54	9	l–1	l–1	PROPN
aiol-6280	54	10	dna	dna	PROPN
aiol-6280	54	11	cyanobacteria	cyanobacteria	PROPN
aiol-6280	54	12	16s	16s	PROPN
aiol-6280	54	13	rrna	rrna	PROPN
aiol-6280	54	14	mcya	mcya	PROPN
aiol-6280	54	15	gene	gene	NOUN
aiol-6280	54	16	05	05	NUM
aiol-6280	54	17	-	-	SYM
aiol-6280	54	18	07	07	NUM
aiol-6280	54	19	-	-	PUNCT
aiol-6280	54	20	12	12	NUM
aiol-6280	54	21	sup	sup	NOUN
aiol-6280	54	22	(	(	PUNCT
aiol-6280	54	23	1	1	NUM
aiol-6280	54	24	)	)	PUNCT
aiol-6280	54	25	sup	sup	NOUN
aiol-6280	54	26	(	(	PUNCT
aiol-6280	54	27	2	2	NUM
aiol-6280	54	28	)	)	PUNCT
aiol-6280	54	29	bf/	bf/	VERB
aiol-6280	54	30	a	a	DET
aiol-6280	54	31	*	*	PROPN
aiol-6280	54	32	50,000	50,000	NUM
aiol-6280	54	33	+	+	CCONJ
aiol-6280	54	34	+	+	CCONJ
aiol-6280	54	35	bf/	bf/	VERB
aiol-6280	54	36	b	b	NOUN
aiol-6280	54	37	+	+	CCONJ
aiol-6280	54	38	+	+	NUM
aiol-6280	54	39	18	18	NUM
aiol-6280	54	40	-	-	SYM
aiol-6280	54	41	09	09	NUM
aiol-6280	54	42	-	-	PUNCT
aiol-6280	54	43	12	12	NUM
aiol-6280	54	44	sup	sup	NOUN
aiol-6280	54	45	(	(	PUNCT
aiol-6280	54	46	1	1	NUM
aiol-6280	54	47	)	)	PUNCT
aiol-6280	54	48	sup	sup	NOUN
aiol-6280	54	49	(	(	PUNCT
aiol-6280	54	50	2	2	NUM
aiol-6280	54	51	)	)	PUNCT
aiol-6280	54	52	bf	bf	NOUN
aiol-6280	54	53	31	31	NUM
aiol-6280	54	54	-	-	SYM
aiol-6280	54	55	10	10	NUM
aiol-6280	54	56	-	-	SYM
aiol-6280	54	57	12	12	NUM
aiol-6280	54	58	sup	sup	NOUN
aiol-6280	54	59	(	(	PUNCT
aiol-6280	54	60	1	1	NUM
aiol-6280	54	61	)	)	PUNCT
aiol-6280	54	62	+	+	PUNCT
aiol-6280	55	1	+	+	PUNCT
aiol-6280	55	2	+	+	NUM
aiol-6280	55	3	bf	bf	NOUN
aiol-6280	55	4	+	+	X
aiol-6280	55	5	+	+	CCONJ
aiol-6280	55	6	29	29	NUM
aiol-6280	55	7	-	-	SYM
aiol-6280	55	8	11	11	NUM
aiol-6280	55	9	-	-	SYM
aiol-6280	55	10	12	12	NUM
aiol-6280	55	11	sup	sup	NOUN
aiol-6280	55	12	(	(	PUNCT
aiol-6280	55	13	1	1	NUM
aiol-6280	55	14	)	)	PUNCT
aiol-6280	55	15	sup	sup	NOUN
aiol-6280	55	16	(	(	PUNCT
aiol-6280	55	17	2	2	NUM
aiol-6280	55	18	)	)	PUNCT
aiol-6280	55	19	+	+	NOUN
aiol-6280	55	20	bf	bf	NOUN
aiol-6280	55	21	+	+	CCONJ
aiol-6280	55	22	bf	bf	NOUN
aiol-6280	55	23	,	,	PUNCT
aiol-6280	55	24	bottled	bottled	ADJ
aiol-6280	55	25	filtered	filter	VERB
aiol-6280	55	26	water	water	NOUN
aiol-6280	55	27	;	;	PUNCT
aiol-6280	55	28	sup	sup	NOUN
aiol-6280	55	29	(	(	PUNCT
aiol-6280	55	30	1	1	NUM
aiol-6280	55	31	)	)	PUNCT
aiol-6280	55	32	,	,	PUNCT
aiol-6280	55	33	source	source	VERB
aiol-6280	55	34	underground	underground	ADJ
aiol-6280	55	35	water	water	NOUN
aiol-6280	55	36	(	(	PUNCT
aiol-6280	55	37	old	old	ADJ
aiol-6280	55	38	drill	drill	NOUN
aiol-6280	55	39	)	)	PUNCT
aiol-6280	55	40	;	;	PUNCT
aiol-6280	55	41	sup	sup	NOUN
aiol-6280	55	42	(	(	PUNCT
aiol-6280	55	43	2	2	NUM
aiol-6280	55	44	)	)	PUNCT
aiol-6280	55	45	,	,	PUNCT
aiol-6280	55	46	source	source	VERB
aiol-6280	55	47	underground	underground	ADJ
aiol-6280	55	48	water-(new	water-(new	ADJ
aiol-6280	55	49	drill	drill	NOUN
aiol-6280	55	50	)	)	PUNCT
aiol-6280	55	51	;	;	PUNCT
aiol-6280	55	52	*	*	PUNCT
aiol-6280	55	53	sample	sample	NOUN
aiol-6280	55	54	bf/	bf/	VERB
aiol-6280	55	55	a	a	PRON
aiol-6280	55	56	is	be	AUX
aiol-6280	55	57	from	from	ADP
aiol-6280	55	58	the	the	DET
aiol-6280	55	59	same	same	ADJ
aiol-6280	55	60	production	production	NOUN
aiol-6280	55	61	line	line	NOUN
aiol-6280	55	62	with	with	ADP
aiol-6280	55	63	bf/	bf/	NOUN
aiol-6280	55	64	b	b	PROPN
aiol-6280	55	65	but	but	CCONJ
aiol-6280	55	66	sampled	sample	VERB
aiol-6280	55	67	at	at	ADP
aiol-6280	55	68	a	a	DET
aiol-6280	55	69	different	different	ADJ
aiol-6280	55	70	time	time	NOUN
aiol-6280	55	71	of	of	ADP
aiol-6280	55	72	the	the	DET
aiol-6280	55	73	day	day	NOUN
aiol-6280	55	74	.	.	PUNCT
aiol-6280	56	1	non	non	ADJ
aiol-6280	56	2	-co	-co	PROPN
aiol-6280	56	3	mmerc	mmerc	PROPN
aiol-6280	56	4	ial	ial	PROPN
aiol-6280	56	5	us	us	PROPN
aiol-6280	56	6	e	e	NOUN
aiol-6280	56	7	o	o	NOUN
aiol-6280	56	8	nly	nly	ADV
aiol-6280	56	9	cyanobacteria	cyanobacteria	VERB
aiol-6280	56	10	in	in	ADP
aiol-6280	56	11	underground	underground	ADJ
aiol-6280	56	12	water	water	NOUN
aiol-6280	56	13	sources	source	NOUN
aiol-6280	56	14	89	89	NUM
aiol-6280	56	15	of	of	ADP
aiol-6280	56	16	8.53μm	8.53μm	NUM
aiol-6280	56	17	(	(	PUNCT
aiol-6280	56	18	n=30	n=30	PROPN
aiol-6280	56	19	,	,	PUNCT
aiol-6280	56	20	min	min	PROPN
aiol-6280	56	21	6.54	6.54	NUM
aiol-6280	56	22	μm	μm	NOUN
aiol-6280	56	23	,	,	PUNCT
aiol-6280	56	24	max	max	PROPN
aiol-6280	56	25	11.6	11.6	NUM
aiol-6280	56	26	μm	μm	NUM
aiol-6280	56	27	)	)	PUNCT
aiol-6280	56	28	.	.	PUNCT
aiol-6280	57	1	cyanobacterial	cyanobacterial	ADJ
aiol-6280	57	2	abundance	abundance	NOUN
aiol-6280	57	3	in	in	ADP
aiol-6280	57	4	this	this	DET
aiol-6280	57	5	sample	sample	NOUN
aiol-6280	57	6	was	be	AUX
aiol-6280	57	7	50,000	50,000	NUM
aiol-6280	57	8	cells	cell	NOUN
aiol-6280	57	9	l–1	l–1	PROPN
aiol-6280	57	10	,	,	PUNCT
aiol-6280	57	11	whereas	whereas	SCONJ
aiol-6280	57	12	in	in	ADP
aiol-6280	57	13	bf	bf	PROPN
aiol-6280	57	14	/	/	SYM
aiol-6280	57	15	b	b	NOUN
aiol-6280	57	16	,	,	PUNCT
aiol-6280	57	17	collected	collect	VERB
aiol-6280	57	18	on	on	ADP
aiol-6280	57	19	the	the	DET
aiol-6280	57	20	same	same	ADJ
aiol-6280	57	21	day	day	NOUN
aiol-6280	57	22	and	and	CCONJ
aiol-6280	57	23	drilling	drilling	NOUN
aiol-6280	57	24	source	source	NOUN
aiol-6280	57	25	but	but	CCONJ
aiol-6280	57	26	at	at	ADP
aiol-6280	57	27	a	a	DET
aiol-6280	57	28	different	different	ADJ
aiol-6280	57	29	time	time	NOUN
aiol-6280	57	30	,	,	PUNCT
aiol-6280	57	31	no	no	DET
aiol-6280	57	32	cyanobacteria	cyanobacteria	NOUN
aiol-6280	57	33	cells	cell	NOUN
aiol-6280	57	34	were	be	AUX
aiol-6280	57	35	found	find	VERB
aiol-6280	57	36	(	(	PUNCT
aiol-6280	57	37	tab	tab	NOUN
aiol-6280	57	38	.	.	NOUN
aiol-6280	57	39	1	1	NUM
aiol-6280	57	40	)	)	PUNCT
aiol-6280	57	41	.	.	PUNCT
aiol-6280	58	1	no	no	DET
aiol-6280	58	2	presence	presence	NOUN
aiol-6280	58	3	of	of	ADP
aiol-6280	58	4	cyanobacteria	cyanobacteria	NOUN
aiol-6280	58	5	was	be	AUX
aiol-6280	58	6	observed	observe	VERB
aiol-6280	58	7	by	by	ADP
aiol-6280	58	8	microscopy	microscopy	NOUN
aiol-6280	58	9	in	in	ADP
aiol-6280	58	10	any	any	PRON
aiol-6280	58	11	of	of	ADP
aiol-6280	58	12	the	the	DET
aiol-6280	58	13	other	other	ADJ
aiol-6280	58	14	samples	sample	NOUN
aiol-6280	58	15	,	,	PUNCT
aiol-6280	58	16	both	both	CCONJ
aiol-6280	58	17	bottled	bottled	ADJ
aiol-6280	58	18	and	and	CCONJ
aiol-6280	58	19	from	from	ADP
aiol-6280	58	20	the	the	DET
aiol-6280	58	21	underground	underground	ADJ
aiol-6280	58	22	water	water	NOUN
aiol-6280	58	23	source	source	NOUN
aiol-6280	58	24	.	.	PUNCT
aiol-6280	59	1	although	although	SCONJ
aiol-6280	59	2	the	the	DET
aiol-6280	59	3	presence	presence	NOUN
aiol-6280	59	4	of	of	ADP
aiol-6280	59	5	algae	algae	NOUN
aiol-6280	59	6	and	and	CCONJ
aiol-6280	59	7	cyanobacteria	cyanobacteria	NOUN
aiol-6280	59	8	in	in	ADP
aiol-6280	59	9	underground	underground	ADJ
aiol-6280	59	10	habitats	habitat	NOUN
aiol-6280	59	11	(	(	PUNCT
aiol-6280	59	12	reisser	reisser	NOUN
aiol-6280	59	13	,	,	PUNCT
aiol-6280	59	14	2007	2007	NUM
aiol-6280	59	15	)	)	PUNCT
aiol-6280	59	16	and	and	CCONJ
aiol-6280	59	17	the	the	DET
aiol-6280	59	18	ability	ability	NOUN
aiol-6280	59	19	of	of	ADP
aiol-6280	59	20	soil	soil	NOUN
aiol-6280	59	21	and	and	CCONJ
aiol-6280	59	22	deep	deep	ADJ
aiol-6280	59	23	subsurface	subsurface	NOUN
aiol-6280	59	24	cyanobacteria	cyanobacteria	NOUN
aiol-6280	59	25	to	to	PART
aiol-6280	59	26	actively	actively	ADV
aiol-6280	59	27	follow	follow	VERB
aiol-6280	59	28	a	a	DET
aiol-6280	59	29	moving	move	VERB
aiol-6280	59	30	water	water	NOUN
aiol-6280	59	31	pocket	pocket	NOUN
aiol-6280	59	32	in	in	ADP
aiol-6280	59	33	order	order	NOUN
aiol-6280	59	34	to	to	PART
aiol-6280	59	35	exploit	exploit	VERB
aiol-6280	59	36	it	it	PRON
aiol-6280	59	37	(	(	PUNCT
aiol-6280	59	38	garcia	garcia	PROPN
aiol-6280	59	39	-	-	PUNCT
aiol-6280	59	40	pichel	pichel	PROPN
aiol-6280	59	41	and	and	CCONJ
aiol-6280	59	42	pringault	pringault	NOUN
aiol-6280	59	43	,	,	PUNCT
aiol-6280	59	44	2001	2001	NUM
aiol-6280	59	45	)	)	PUNCT
aiol-6280	59	46	has	have	AUX
aiol-6280	59	47	been	be	AUX
aiol-6280	59	48	shown	show	VERB
aiol-6280	59	49	,	,	PUNCT
aiol-6280	59	50	to	to	ADP
aiol-6280	59	51	the	the	DET
aiol-6280	59	52	best	good	ADJ
aiol-6280	59	53	of	of	ADP
aiol-6280	59	54	our	our	PRON
aiol-6280	59	55	knowledge	knowledge	NOUN
aiol-6280	59	56	this	this	PRON
aiol-6280	59	57	is	be	AUX
aiol-6280	59	58	the	the	DET
aiol-6280	59	59	first	first	ADJ
aiol-6280	59	60	report	report	NOUN
aiol-6280	59	61	of	of	ADP
aiol-6280	59	62	planktonic	planktonic	ADJ
aiol-6280	59	63	cyanobacteria	cyanobacteria	NOUN
aiol-6280	59	64	found	find	VERB
aiol-6280	59	65	in	in	ADP
aiol-6280	59	66	an	an	DET
aiol-6280	59	67	underground	underground	ADJ
aiol-6280	59	68	drinking	drinking	NOUN
aiol-6280	59	69	-	-	PUNCT
aiol-6280	59	70	water	water	NOUN
aiol-6280	59	71	source	source	NOUN
aiol-6280	59	72	.	.	PUNCT
aiol-6280	60	1	recently	recently	ADV
aiol-6280	60	2	,	,	PUNCT
aiol-6280	60	3	pazouki	pazouki	PROPN
aiol-6280	60	4	et	et	PROPN
aiol-6280	60	5	al	al	PROPN
aiol-6280	60	6	.	.	PUNCT
aiol-6280	61	1	(	(	PUNCT
aiol-6280	61	2	2016	2016	NUM
aiol-6280	61	3	)	)	PUNCT
aiol-6280	61	4	demonstrated	demonstrate	VERB
aiol-6280	61	5	that	that	SCONJ
aiol-6280	61	6	cyanobacteria	cyanobacteria	NOUN
aiol-6280	61	7	can	can	AUX
aiol-6280	61	8	be	be	AUX
aiol-6280	61	9	found	find	VERB
aiol-6280	61	10	in	in	ADP
aiol-6280	61	11	water	water	NOUN
aiol-6280	61	12	filtered	filter	VERB
aiol-6280	61	13	through	through	ADP
aiol-6280	61	14	bank	bank	NOUN
aiol-6280	61	15	filtration	filtration	NOUN
aiol-6280	61	16	,	,	PUNCT
aiol-6280	61	17	especially	especially	ADV
aiol-6280	61	18	species	specie	NOUN
aiol-6280	61	19	with	with	ADP
aiol-6280	61	20	cell	cell	NOUN
aiol-6280	61	21	size	size	NOUN
aiol-6280	61	22	<	<	X
aiol-6280	61	23	10	10	NUM
aiol-6280	61	24	μm	μm	NOUN
aiol-6280	61	25	,	,	PUNCT
aiol-6280	61	26	such	such	ADJ
aiol-6280	61	27	as	as	ADP
aiol-6280	61	28	the	the	DET
aiol-6280	61	29	microcystis	microcystis	ADJ
aiol-6280	61	30	cells	cell	NOUN
aiol-6280	61	31	.	.	PUNCT
aiol-6280	62	1	in	in	ADP
aiol-6280	62	2	our	our	PRON
aiol-6280	62	3	case	case	NOUN
aiol-6280	62	4	the	the	DET
aiol-6280	62	5	source	source	NOUN
aiol-6280	62	6	of	of	ADP
aiol-6280	62	7	the	the	DET
aiol-6280	62	8	cyanobacterial	cyanobacterial	ADJ
aiol-6280	62	9	colony	colony	NOUN
aiol-6280	62	10	we	we	PRON
aiol-6280	62	11	found	find	VERB
aiol-6280	62	12	remains	remain	VERB
aiol-6280	62	13	unknown	unknown	ADJ
aiol-6280	62	14	;	;	PUNCT
aiol-6280	62	15	however	however	ADV
aiol-6280	62	16	,	,	PUNCT
aiol-6280	62	17	it	it	PRON
aiol-6280	62	18	has	have	AUX
aiol-6280	62	19	been	be	AUX
aiol-6280	62	20	found	find	VERB
aiol-6280	62	21	that	that	SCONJ
aiol-6280	62	22	in	in	ADP
aiol-6280	62	23	the	the	DET
aiol-6280	62	24	nearby	nearby	ADJ
aiol-6280	62	25	river	river	NOUN
aiol-6280	62	26	-	-	PUNCT
aiol-6280	62	27	reservoir	reservoir	NOUN
aiol-6280	62	28	system	system	NOUN
aiol-6280	62	29	of	of	ADP
aiol-6280	62	30	aliakmon	aliakmon	NOUN
aiol-6280	62	31	-	-	PUNCT
aiol-6280	62	32	polyphytos	polyphyto	NOUN
aiol-6280	62	33	,	,	PUNCT
aiol-6280	62	34	microcystis	microcystis	ADJ
aiol-6280	62	35	aeruginosa	aeruginosa	NOUN
aiol-6280	62	36	can	can	AUX
aiol-6280	62	37	be	be	AUX
aiol-6280	62	38	dispersed	disperse	VERB
aiol-6280	62	39	in	in	ADP
aiol-6280	62	40	short	short	ADJ
aiol-6280	62	41	distances	distance	NOUN
aiol-6280	62	42	through	through	ADP
aiol-6280	62	43	the	the	DET
aiol-6280	62	44	wind	wind	NOUN
aiol-6280	62	45	(	(	PUNCT
aiol-6280	62	46	chrisostomou	chrisostomou	PROPN
aiol-6280	62	47	et	et	PROPN
aiol-6280	62	48	al	al	PROPN
aiol-6280	62	49	.	.	PROPN
aiol-6280	62	50	,	,	PUNCT
aiol-6280	62	51	2009	2009	NUM
aiol-6280	62	52	)	)	PUNCT
aiol-6280	62	53	.	.	PUNCT
aiol-6280	63	1	furthermore	furthermore	ADV
aiol-6280	63	2	,	,	PUNCT
aiol-6280	63	3	airborne	airborne	ADJ
aiol-6280	63	4	cyanobacteria	cyanobacteria	NOUN
aiol-6280	63	5	have	have	AUX
aiol-6280	63	6	been	be	AUX
aiol-6280	63	7	found	find	VERB
aiol-6280	63	8	in	in	ADP
aiol-6280	63	9	the	the	DET
aiol-6280	63	10	nearby	nearby	ADJ
aiol-6280	63	11	city	city	NOUN
aiol-6280	63	12	of	of	ADP
aiol-6280	63	13	thessaloniki	thessaloniki	PROPN
aiol-6280	63	14	(	(	PUNCT
aiol-6280	63	15	genitsaris	genitsaris	PROPN
aiol-6280	63	16	et	et	PROPN
aiol-6280	63	17	al	al	PROPN
aiol-6280	63	18	.	.	PROPN
aiol-6280	63	19	,	,	PUNCT
aiol-6280	63	20	2011	2011	NUM
aiol-6280	63	21	)	)	PUNCT
aiol-6280	63	22	.	.	PUNCT
aiol-6280	64	1	nevertheless	nevertheless	ADV
aiol-6280	64	2	,	,	PUNCT
aiol-6280	64	3	since	since	SCONJ
aiol-6280	64	4	the	the	DET
aiol-6280	64	5	source	source	NOUN
aiol-6280	64	6	of	of	ADP
aiol-6280	64	7	the	the	DET
aiol-6280	64	8	cyanobacterial	cyanobacterial	ADJ
aiol-6280	64	9	colony	colony	NOUN
aiol-6280	64	10	was	be	AUX
aiol-6280	64	11	not	not	PART
aiol-6280	64	12	found	find	VERB
aiol-6280	64	13	the	the	DET
aiol-6280	64	14	possibility	possibility	NOUN
aiol-6280	64	15	of	of	ADP
aiol-6280	64	16	opportunistic	opportunistic	ADJ
aiol-6280	64	17	airborne	airborne	ADJ
aiol-6280	64	18	contamination	contamination	NOUN
aiol-6280	64	19	during	during	ADP
aiol-6280	64	20	the	the	DET
aiol-6280	64	21	bottling	bottling	NOUN
aiol-6280	64	22	can	can	AUX
aiol-6280	64	23	not	not	PART
aiol-6280	64	24	be	be	AUX
aiol-6280	64	25	excluded	exclude	VERB
aiol-6280	64	26	.	.	PUNCT
aiol-6280	65	1	dna	dna	PROPN
aiol-6280	65	2	was	be	AUX
aiol-6280	65	3	below	below	ADP
aiol-6280	65	4	the	the	DET
aiol-6280	65	5	detection	detection	NOUN
aiol-6280	65	6	limit	limit	NOUN
aiol-6280	65	7	in	in	ADP
aiol-6280	65	8	seven	seven	NUM
aiol-6280	65	9	out	out	ADP
aiol-6280	65	10	of	of	ADP
aiol-6280	65	11	the	the	DET
aiol-6280	65	12	twelve	twelve	NUM
aiol-6280	65	13	samples	sample	NOUN
aiol-6280	65	14	analyzed	analyze	VERB
aiol-6280	65	15	(	(	PUNCT
aiol-6280	65	16	tab	tab	NOUN
aiol-6280	65	17	.	.	NOUN
aiol-6280	65	18	1	1	NUM
aiol-6280	65	19	)	)	PUNCT
aiol-6280	65	20	.	.	PUNCT
aiol-6280	66	1	a	a	DET
aiol-6280	66	2	pcr	pcr	ADJ
aiol-6280	66	3	product	product	NOUN
aiol-6280	66	4	of	of	ADP
aiol-6280	66	5	about	about	ADV
aiol-6280	66	6	1370	1370	NUM
aiol-6280	66	7	bp	bp	PROPN
aiol-6280	66	8	was	be	AUX
aiol-6280	66	9	obtained	obtain	VERB
aiol-6280	66	10	using	use	VERB
aiol-6280	66	11	the	the	DET
aiol-6280	66	12	16s	16	NOUN
aiol-6280	66	13	27f/16s	27f/16s	NUM
aiol-6280	66	14	1484r	1484r	NUM
aiol-6280	66	15	primer	primer	NOUN
aiol-6280	66	16	pair	pair	NOUN
aiol-6280	66	17	in	in	ADP
aiol-6280	66	18	four	four	NUM
aiol-6280	66	19	samples	sample	NOUN
aiol-6280	66	20	(	(	PUNCT
aiol-6280	66	21	including	include	VERB
aiol-6280	66	22	sample	sample	NOUN
aiol-6280	66	23	bf	bf	NOUN
aiol-6280	66	24	/	/	SYM
aiol-6280	66	25	a	a	PRON
aiol-6280	66	26	of	of	ADP
aiol-6280	66	27	05	05	NUM
aiol-6280	66	28	-	-	PUNCT
aiol-6280	66	29	07	07	NUM
aiol-6280	66	30	-	-	PUNCT
aiol-6280	66	31	2012	2012	NUM
aiol-6280	66	32	,	,	PUNCT
aiol-6280	66	33	where	where	SCONJ
aiol-6280	66	34	cyanobacteria	cyanobacteria	NOUN
aiol-6280	66	35	were	be	AUX
aiol-6280	66	36	identified	identify	VERB
aiol-6280	66	37	by	by	ADP
aiol-6280	66	38	microscopy	microscopy	NOUN
aiol-6280	66	39	)	)	PUNCT
aiol-6280	66	40	.	.	PUNCT
aiol-6280	67	1	the	the	DET
aiol-6280	67	2	300	300	NUM
aiol-6280	67	3	bp	bp	PROPN
aiol-6280	67	4	mcya	mcya	NOUN
aiol-6280	67	5	-	-	PUNCT
aiol-6280	67	6	cd	cd	PROPN
aiol-6280	67	7	1f	1f	NUM
aiol-6280	67	8	/	/	SYM
aiol-6280	67	9	mcya	mcya	NOUN
aiol-6280	67	10	-	-	PUNCT
aiol-6280	67	11	cd	cd	NOUN
aiol-6280	67	12	1r	1r	NUM
aiol-6280	67	13	primer	primer	NOUN
aiol-6280	67	14	pair	pair	NOUN
aiol-6280	67	15	pcr	pcr	NOUN
aiol-6280	67	16	product	product	NOUN
aiol-6280	67	17	,	,	PUNCT
aiol-6280	67	18	indicating	indicate	VERB
aiol-6280	67	19	the	the	DET
aiol-6280	67	20	presence	presence	NOUN
aiol-6280	67	21	of	of	ADP
aiol-6280	67	22	mcya	mcya	NOUN
aiol-6280	67	23	gene	gene	NOUN
aiol-6280	67	24	,	,	PUNCT
aiol-6280	67	25	was	be	AUX
aiol-6280	67	26	identified	identify	VERB
aiol-6280	67	27	only	only	ADV
aiol-6280	67	28	in	in	ADP
aiol-6280	67	29	one	one	NUM
aiol-6280	67	30	out	out	ADP
aiol-6280	67	31	of	of	ADP
aiol-6280	67	32	the	the	DET
aiol-6280	67	33	twelve	twelve	NUM
aiol-6280	67	34	samples	sample	NOUN
aiol-6280	67	35	assayed	assay	VERB
aiol-6280	67	36	(	(	PUNCT
aiol-6280	67	37	tab	tab	NOUN
aiol-6280	67	38	.	.	NOUN
aiol-6280	67	39	1	1	NUM
aiol-6280	67	40	)	)	PUNCT
aiol-6280	67	41	.	.	PUNCT
aiol-6280	68	1	in	in	ADP
aiol-6280	68	2	the	the	DET
aiol-6280	68	3	studied	study	VERB
aiol-6280	68	4	water	water	NOUN
aiol-6280	68	5	source	source	NOUN
aiol-6280	68	6	the	the	DET
aiol-6280	68	7	highest	high	ADJ
aiol-6280	68	8	cyanobacterial	cyanobacterial	ADJ
aiol-6280	68	9	abundance	abundance	NOUN
aiol-6280	68	10	of	of	ADP
aiol-6280	68	11	50.000	50.000	NUM
aiol-6280	68	12	cells	cell	NOUN
aiol-6280	68	13	l–1	l–1	PROPN
aiol-6280	68	14	was	be	AUX
aiol-6280	68	15	observed	observe	VERB
aiol-6280	68	16	in	in	ADP
aiol-6280	68	17	july	july	PROPN
aiol-6280	68	18	without	without	ADP
aiol-6280	68	19	the	the	DET
aiol-6280	68	20	simultaneous	simultaneous	ADJ
aiol-6280	68	21	presence	presence	NOUN
aiol-6280	68	22	of	of	ADP
aiol-6280	68	23	the	the	DET
aiol-6280	68	24	mcya	mcya	NOUN
aiol-6280	68	25	gene	gene	NOUN
aiol-6280	68	26	responsible	responsible	ADJ
aiol-6280	68	27	for	for	ADP
aiol-6280	68	28	mc	mc	PROPN
aiol-6280	68	29	production	production	NOUN
aiol-6280	68	30	.	.	PUNCT
aiol-6280	69	1	at	at	ADP
aiol-6280	69	2	the	the	DET
aiol-6280	69	3	end	end	NOUN
aiol-6280	69	4	of	of	ADP
aiol-6280	69	5	october	october	PROPN
aiol-6280	69	6	,	,	PUNCT
aiol-6280	69	7	however	however	ADV
aiol-6280	69	8	,	,	PUNCT
aiol-6280	69	9	the	the	DET
aiol-6280	69	10	presence	presence	NOUN
aiol-6280	69	11	of	of	ADP
aiol-6280	69	12	cyanobacteria	cyanobacteria	NOUN
aiol-6280	69	13	was	be	AUX
aiol-6280	69	14	only	only	ADV
aiol-6280	69	15	traced	trace	VERB
aiol-6280	69	16	through	through	ADP
aiol-6280	69	17	the	the	DET
aiol-6280	69	18	detection	detection	NOUN
aiol-6280	69	19	of	of	ADP
aiol-6280	69	20	16s	16s	PROPN
aiol-6280	69	21	rdna	rdna	PROPN
aiol-6280	69	22	as	as	ADV
aiol-6280	69	23	well	well	ADV
aiol-6280	69	24	as	as	ADP
aiol-6280	69	25	traces	trace	NOUN
aiol-6280	69	26	of	of	ADP
aiol-6280	69	27	the	the	DET
aiol-6280	69	28	gene	gene	NOUN
aiol-6280	69	29	mcya	mcya	NOUN
aiol-6280	69	30	.	.	PUNCT
aiol-6280	70	1	similar	similar	ADJ
aiol-6280	70	2	results	result	NOUN
aiol-6280	70	3	were	be	AUX
aiol-6280	70	4	reported	report	VERB
aiol-6280	70	5	by	by	ADP
aiol-6280	70	6	davis	davis	PROPN
aiol-6280	70	7	et	et	PROPN
aiol-6280	70	8	al	al	PROPN
aiol-6280	70	9	.	.	PROPN
aiol-6280	71	1	(	(	PUNCT
aiol-6280	71	2	2009	2009	NUM
aiol-6280	71	3	)	)	PUNCT
aiol-6280	71	4	in	in	ADP
aiol-6280	71	5	lake	lake	PROPN
aiol-6280	71	6	agawam	agawam	PROPN
aiol-6280	71	7	in	in	ADP
aiol-6280	71	8	july	july	PROPN
aiol-6280	71	9	where	where	SCONJ
aiol-6280	71	10	the	the	DET
aiol-6280	71	11	presence	presence	NOUN
aiol-6280	71	12	of	of	ADP
aiol-6280	71	13	toxic	toxic	ADJ
aiol-6280	71	14	microcystis	microcystis	ADJ
aiol-6280	71	15	cells	cell	NOUN
aiol-6280	71	16	did	do	AUX
aiol-6280	71	17	not	not	PART
aiol-6280	71	18	coincide	coincide	VERB
aiol-6280	71	19	with	with	ADP
aiol-6280	71	20	the	the	DET
aiol-6280	71	21	presence	presence	NOUN
aiol-6280	71	22	of	of	ADP
aiol-6280	71	23	mc	mc	PROPN
aiol-6280	71	24	and	and	CCONJ
aiol-6280	71	25	also	also	ADV
aiol-6280	71	26	in	in	ADP
aiol-6280	71	27	lake	lake	PROPN
aiol-6280	71	28	champlain	champlain	PROPN
aiol-6280	71	29	where	where	SCONJ
aiol-6280	71	30	mcs	mcs	PROPN
aiol-6280	71	31	were	be	AUX
aiol-6280	71	32	detectable	detectable	ADJ
aiol-6280	71	33	in	in	ADP
aiol-6280	71	34	october	october	PROPN
aiol-6280	71	35	but	but	CCONJ
aiol-6280	71	36	without	without	ADP
aiol-6280	71	37	the	the	DET
aiol-6280	71	38	presence	presence	NOUN
aiol-6280	71	39	of	of	ADP
aiol-6280	71	40	toxic	toxic	ADJ
aiol-6280	71	41	microcystis	microcystis	ADJ
aiol-6280	71	42	cells	cell	NOUN
aiol-6280	71	43	at	at	ADP
aiol-6280	71	44	the	the	DET
aiol-6280	71	45	same	same	ADJ
aiol-6280	71	46	time	time	NOUN
aiol-6280	71	47	.	.	PUNCT
aiol-6280	72	1	gkelis	gkelis	PROPN
aiol-6280	72	2	and	and	CCONJ
aiol-6280	72	3	zaoutsos	zaoutsos	PROPN
aiol-6280	72	4	(	(	PUNCT
aiol-6280	72	5	2014	2014	NUM
aiol-6280	72	6	)	)	PUNCT
aiol-6280	72	7	found	find	VERB
aiol-6280	72	8	that	that	SCONJ
aiol-6280	72	9	the	the	DET
aiol-6280	72	10	mcya	mcya	NOUN
aiol-6280	72	11	region	region	NOUN
aiol-6280	72	12	was	be	AUX
aiol-6280	72	13	amplified	amplify	VERB
aiol-6280	72	14	only	only	ADV
aiol-6280	72	15	where	where	SCONJ
aiol-6280	72	16	microcystis	microcystis	PROPN
aiol-6280	72	17	spp	spp	NOUN
aiol-6280	72	18	.	.	PUNCT
aiol-6280	72	19	were	be	AUX
aiol-6280	72	20	dominant	dominant	ADJ
aiol-6280	72	21	and	and	CCONJ
aiol-6280	72	22	mc	mc	PROPN
aiol-6280	72	23	concentrations	concentration	NOUN
aiol-6280	72	24	were	be	AUX
aiol-6280	72	25	>	>	PUNCT
aiol-6280	72	26	40	40	NUM
aiol-6280	72	27	μg	μg	PROPN
aiol-6280	72	28	l–1	l–1	PROPN
aiol-6280	72	29	.	.	PUNCT
aiol-6280	73	1	conjointly	conjointly	ADV
aiol-6280	73	2	,	,	PUNCT
aiol-6280	73	3	gkelis	gkelis	PROPN
aiol-6280	73	4	et	et	PROPN
aiol-6280	73	5	al	al	PROPN
aiol-6280	73	6	.	.	PROPN
aiol-6280	74	1	(	(	PUNCT
aiol-6280	74	2	2014	2014	NUM
aiol-6280	74	3	)	)	PUNCT
aiol-6280	74	4	in	in	ADP
aiol-6280	74	5	a	a	DET
aiol-6280	74	6	14	14	NUM
aiol-6280	74	7	-	-	PUNCT
aiol-6280	74	8	month	month	NOUN
aiol-6280	74	9	monitoring	monitoring	NOUN
aiol-6280	74	10	of	of	ADP
aiol-6280	74	11	lake	lake	PROPN
aiol-6280	74	12	pamvotis	pamvotis	PROPN
aiol-6280	74	13	found	find	VERB
aiol-6280	74	14	that	that	SCONJ
aiol-6280	74	15	mcya	mcya	NOUN
aiol-6280	74	16	was	be	AUX
aiol-6280	74	17	amplified	amplify	VERB
aiol-6280	74	18	only	only	ADV
aiol-6280	74	19	in	in	ADP
aiol-6280	74	20	two	two	NUM
aiol-6280	74	21	samples	sample	NOUN
aiol-6280	74	22	,	,	PUNCT
aiol-6280	74	23	where	where	SCONJ
aiol-6280	74	24	microcystis	microcystis	ADJ
aiol-6280	74	25	aeruginosa	aeruginosa	NOUN
aiol-6280	74	26	was	be	AUX
aiol-6280	74	27	dominant	dominant	ADJ
aiol-6280	74	28	,	,	PUNCT
aiol-6280	74	29	whereas	whereas	SCONJ
aiol-6280	74	30	mcyb	mcyb	PROPN
aiol-6280	74	31	and	and	CCONJ
aiol-6280	74	32	mcye	mcye	ADJ
aiol-6280	74	33	regions	region	NOUN
aiol-6280	74	34	were	be	AUX
aiol-6280	74	35	amplified	amplify	VERB
aiol-6280	74	36	in	in	ADP
aiol-6280	74	37	almost	almost	ADV
aiol-6280	74	38	all	all	PRON
aiol-6280	74	39	samples	sample	NOUN
aiol-6280	74	40	.	.	PUNCT
aiol-6280	75	1	several	several	ADJ
aiol-6280	75	2	studies	study	NOUN
aiol-6280	75	3	report	report	VERB
aiol-6280	75	4	that	that	SCONJ
aiol-6280	75	5	cyanobacteria	cyanobacteria	NOUN
aiol-6280	75	6	can	can	AUX
aiol-6280	75	7	produce	produce	VERB
aiol-6280	75	8	toxins	toxin	NOUN
aiol-6280	75	9	at	at	ADP
aiol-6280	75	10	low	low	ADJ
aiol-6280	75	11	temperatures	temperature	NOUN
aiol-6280	75	12	but	but	CCONJ
aiol-6280	75	13	in	in	ADP
aiol-6280	75	14	combination	combination	NOUN
aiol-6280	75	15	with	with	ADP
aiol-6280	75	16	other	other	ADJ
aiol-6280	75	17	important	important	ADJ
aiol-6280	75	18	factors	factor	NOUN
aiol-6280	75	19	such	such	ADJ
aiol-6280	75	20	as	as	ADP
aiol-6280	75	21	presence	presence	NOUN
aiol-6280	75	22	of	of	ADP
aiol-6280	75	23	light	light	NOUN
aiol-6280	75	24	and	and	CCONJ
aiol-6280	75	25	nutrients	nutrient	NOUN
aiol-6280	75	26	’	'	PUNCT
aiol-6280	75	27	availability	availability	NOUN
aiol-6280	75	28	(	(	PUNCT
aiol-6280	75	29	quiblier	quiblier	NOUN
aiol-6280	75	30	et	et	PROPN
aiol-6280	75	31	al	al	PROPN
aiol-6280	75	32	.	.	PROPN
aiol-6280	75	33	,	,	PUNCT
aiol-6280	75	34	2013	2013	NUM
aiol-6280	75	35	)	)	PUNCT
aiol-6280	75	36	.	.	PUNCT
aiol-6280	76	1	the	the	DET
aiol-6280	76	2	low	low	ADJ
aiol-6280	76	3	temperatures	temperature	NOUN
aiol-6280	76	4	(	(	PUNCT
aiol-6280	76	5	max	max	PROPN
aiol-6280	76	6	.	.	PROPN
aiol-6280	76	7	18	18	NUM
aiol-6280	76	8	°	°	NUM
aiol-6280	76	9	c	c	NOUN
aiol-6280	76	10	)	)	PUNCT
aiol-6280	76	11	of	of	ADP
aiol-6280	76	12	the	the	DET
aiol-6280	76	13	studied	study	VERB
aiol-6280	76	14	groundwater	groundwater	NOUN
aiol-6280	76	15	source	source	NOUN
aiol-6280	76	16	together	together	ADV
aiol-6280	76	17	with	with	ADP
aiol-6280	76	18	the	the	DET
aiol-6280	76	19	absence	absence	NOUN
aiol-6280	76	20	of	of	ADP
aiol-6280	76	21	one	one	NUM
aiol-6280	76	22	of	of	ADP
aiol-6280	76	23	the	the	DET
aiol-6280	76	24	genes	gene	NOUN
aiol-6280	76	25	responsible	responsible	ADJ
aiol-6280	76	26	for	for	ADP
aiol-6280	76	27	cyanobacterial	cyanobacterial	ADJ
aiol-6280	76	28	toxicity	toxicity	NOUN
aiol-6280	76	29	(	(	PUNCT
aiol-6280	76	30	mcya	mcya	NOUN
aiol-6280	76	31	)	)	PUNCT
aiol-6280	76	32	in	in	ADP
aiol-6280	76	33	most	most	ADJ
aiol-6280	76	34	of	of	ADP
aiol-6280	76	35	the	the	DET
aiol-6280	76	36	samples	sample	NOUN
aiol-6280	76	37	suggest	suggest	VERB
aiol-6280	76	38	that	that	SCONJ
aiol-6280	76	39	the	the	DET
aiol-6280	76	40	detected	detect	VERB
aiol-6280	76	41	cyanobacteria	cyanobacteria	NOUN
aiol-6280	76	42	do	do	AUX
aiol-6280	76	43	not	not	PART
aiol-6280	76	44	probably	probably	ADV
aiol-6280	76	45	constitute	constitute	VERB
aiol-6280	76	46	an	an	DET
aiol-6280	76	47	important	important	ADJ
aiol-6280	76	48	hazard	hazard	NOUN
aiol-6280	76	49	for	for	ADP
aiol-6280	76	50	this	this	DET
aiol-6280	76	51	specific	specific	ADJ
aiol-6280	76	52	source	source	NOUN
aiol-6280	76	53	,	,	PUNCT
aiol-6280	76	54	also	also	ADV
aiol-6280	76	55	due	due	ADP
aiol-6280	76	56	to	to	ADP
aiol-6280	76	57	the	the	DET
aiol-6280	76	58	limited	limited	ADJ
aiol-6280	76	59	input	input	NOUN
aiol-6280	76	60	of	of	ADP
aiol-6280	76	61	nutrients	nutrient	NOUN
aiol-6280	76	62	and	and	CCONJ
aiol-6280	76	63	the	the	DET
aiol-6280	76	64	absence	absence	NOUN
aiol-6280	76	65	of	of	ADP
aiol-6280	76	66	light	light	NOUN
aiol-6280	76	67	.	.	PUNCT
aiol-6280	77	1	nevertheless	nevertheless	ADV
aiol-6280	77	2	,	,	PUNCT
aiol-6280	77	3	since	since	SCONJ
aiol-6280	77	4	traces	trace	NOUN
aiol-6280	77	5	of	of	ADP
aiol-6280	77	6	the	the	DET
aiol-6280	77	7	mcya	mcya	NOUN
aiol-6280	77	8	gene	gene	NOUN
aiol-6280	77	9	were	be	AUX
aiol-6280	77	10	detected	detect	VERB
aiol-6280	77	11	in	in	ADP
aiol-6280	77	12	one	one	NUM
aiol-6280	77	13	sample	sample	NOUN
aiol-6280	77	14	,	,	PUNCT
aiol-6280	77	15	there	there	PRON
aiol-6280	77	16	is	be	VERB
aiol-6280	77	17	still	still	ADV
aiol-6280	77	18	a	a	DET
aiol-6280	77	19	possibility	possibility	NOUN
aiol-6280	77	20	that	that	SCONJ
aiol-6280	77	21	mcs	mcs	PROPN
aiol-6280	77	22	could	could	AUX
aiol-6280	77	23	have	have	AUX
aiol-6280	77	24	been	be	AUX
aiol-6280	77	25	produced	produce	VERB
aiol-6280	77	26	in	in	ADP
aiol-6280	77	27	the	the	DET
aiol-6280	77	28	studied	study	VERB
aiol-6280	77	29	water	water	NOUN
aiol-6280	77	30	source	source	NOUN
aiol-6280	77	31	,	,	PUNCT
aiol-6280	77	32	since	since	SCONJ
aiol-6280	77	33	cyanotoxins	cyanotoxin	NOUN
aiol-6280	77	34	are	be	AUX
aiol-6280	77	35	intracellular	intracellular	ADJ
aiol-6280	77	36	toxins	toxin	NOUN
aiol-6280	77	37	contained	contain	VERB
aiol-6280	77	38	within	within	ADP
aiol-6280	77	39	living	living	NOUN
aiol-6280	77	40	cells	cell	NOUN
aiol-6280	77	41	(	(	PUNCT
aiol-6280	77	42	sivonen	sivonen	NOUN
aiol-6280	77	43	and	and	CCONJ
aiol-6280	77	44	jones	jones	PROPN
aiol-6280	77	45	,	,	PUNCT
aiol-6280	77	46	1999	1999	NUM
aiol-6280	77	47	)	)	PUNCT
aiol-6280	77	48	and	and	CCONJ
aiol-6280	77	49	cyanobacterial	cyanobacterial	ADJ
aiol-6280	77	50	cells	cell	NOUN
aiol-6280	77	51	were	be	AUX
aiol-6280	77	52	found	find	VERB
aiol-6280	77	53	in	in	ADP
aiol-6280	77	54	high	high	ADJ
aiol-6280	77	55	abundances	abundance	NOUN
aiol-6280	77	56	in	in	ADP
aiol-6280	77	57	one	one	NUM
aiol-6280	77	58	sample	sample	NOUN
aiol-6280	77	59	.	.	PUNCT
aiol-6280	78	1	in	in	ADP
aiol-6280	78	2	this	this	DET
aiol-6280	78	3	case	case	NOUN
aiol-6280	78	4	,	,	PUNCT
aiol-6280	78	5	the	the	DET
aiol-6280	78	6	biggest	big	ADJ
aiol-6280	78	7	problem	problem	NOUN
aiol-6280	78	8	in	in	ADP
aiol-6280	78	9	bottled	bottled	ADJ
aiol-6280	78	10	drinking	drinking	NOUN
aiol-6280	78	11	natural	natural	ADJ
aiol-6280	78	12	mineral	mineral	NOUN
aiol-6280	78	13	waters	water	NOUN
aiol-6280	78	14	arises	arise	VERB
aiol-6280	78	15	from	from	ADP
aiol-6280	78	16	the	the	DET
aiol-6280	78	17	fact	fact	NOUN
aiol-6280	78	18	that	that	SCONJ
aiol-6280	78	19	the	the	DET
aiol-6280	78	20	only	only	ADJ
aiol-6280	78	21	treatment	treatment	NOUN
aiol-6280	78	22	option	option	NOUN
aiol-6280	78	23	in	in	ADP
aiol-6280	78	24	order	order	NOUN
aiol-6280	78	25	to	to	PART
aiol-6280	78	26	maintain	maintain	VERB
aiol-6280	78	27	the	the	DET
aiol-6280	78	28	product	product	NOUN
aiol-6280	78	29	type	type	NOUN
aiol-6280	78	30	‘	'	PUNCT
aiol-6280	78	31	natural	natural	ADJ
aiol-6280	78	32	mineral	mineral	NOUN
aiol-6280	78	33	water	water	NOUN
aiol-6280	78	34	’	'	PUNCT
aiol-6280	78	35	,	,	PUNCT
aiol-6280	78	36	is	be	AUX
aiol-6280	78	37	filtering	filter	VERB
aiol-6280	78	38	,	,	PUNCT
aiol-6280	78	39	as	as	SCONJ
aiol-6280	78	40	filters	filter	NOUN
aiol-6280	78	41	can	can	AUX
aiol-6280	78	42	retain	retain	VERB
aiol-6280	78	43	a	a	DET
aiol-6280	78	44	big	big	ADJ
aiol-6280	78	45	proportion	proportion	NOUN
aiol-6280	78	46	of	of	ADP
aiol-6280	78	47	the	the	DET
aiol-6280	78	48	microalgae	microalgae	NOUN
aiol-6280	78	49	but	but	CCONJ
aiol-6280	78	50	not	not	PART
aiol-6280	78	51	the	the	DET
aiol-6280	78	52	potential	potential	ADJ
aiol-6280	78	53	toxins	toxin	NOUN
aiol-6280	78	54	produced	produce	VERB
aiol-6280	78	55	by	by	ADP
aiol-6280	78	56	them	they	PRON
aiol-6280	78	57	resulting	result	VERB
aiol-6280	78	58	in	in	ADP
aiol-6280	78	59	human	human	ADJ
aiol-6280	78	60	intoxication	intoxication	NOUN
aiol-6280	78	61	.	.	PUNCT
aiol-6280	79	1	our	our	PRON
aiol-6280	79	2	finding	finding	NOUN
aiol-6280	79	3	,	,	PUNCT
aiol-6280	79	4	although	although	SCONJ
aiol-6280	79	5	scarce	scarce	ADJ
aiol-6280	79	6	,	,	PUNCT
aiol-6280	79	7	raises	raise	VERB
aiol-6280	79	8	the	the	DET
aiol-6280	79	9	question	question	NOUN
aiol-6280	79	10	of	of	ADP
aiol-6280	79	11	monitoring	monitor	VERB
aiol-6280	79	12	algae	algae	NOUN
aiol-6280	79	13	in	in	ADP
aiol-6280	79	14	underground	underground	ADJ
aiol-6280	79	15	water	water	NOUN
aiol-6280	79	16	sources	source	NOUN
aiol-6280	79	17	.	.	PUNCT
aiol-6280	80	1	at	at	ADP
aiol-6280	80	2	present	present	ADJ
aiol-6280	80	3	,	,	PUNCT
aiol-6280	80	4	none	none	NOUN
aiol-6280	80	5	of	of	ADP
aiol-6280	80	6	the	the	DET
aiol-6280	80	7	european	european	ADJ
aiol-6280	80	8	countries	country	NOUN
aiol-6280	80	9	have	have	AUX
aiol-6280	80	10	established	establish	VERB
aiol-6280	80	11	monitoring	monitoring	NOUN
aiol-6280	80	12	program	program	NOUN
aiol-6280	80	13	for	for	ADP
aiol-6280	80	14	cyanotoxins	cyanotoxin	NOUN
aiol-6280	80	15	in	in	ADP
aiol-6280	80	16	potable	potable	ADJ
aiol-6280	80	17	minerals	mineral	NOUN
aiol-6280	80	18	waters	water	NOUN
aiol-6280	80	19	so	so	ADV
aiol-6280	80	20	far	far	ADV
aiol-6280	80	21	,	,	PUNCT
aiol-6280	80	22	and	and	CCONJ
aiol-6280	80	23	only	only	ADV
aiol-6280	80	24	some	some	DET
aiol-6280	80	25	countries	country	NOUN
aiol-6280	80	26	have	have	AUX
aiol-6280	80	27	done	do	VERB
aiol-6280	80	28	so	so	ADV
aiol-6280	80	29	for	for	ADP
aiol-6280	80	30	drinking	drinking	NOUN
aiol-6280	80	31	water	water	NOUN
aiol-6280	80	32	such	such	ADJ
aiol-6280	80	33	as	as	ADP
aiol-6280	80	34	spain	spain	PROPN
aiol-6280	80	35	,	,	PUNCT
aiol-6280	80	36	france	france	PROPN
aiol-6280	80	37	,	,	PUNCT
aiol-6280	80	38	the	the	DET
aiol-6280	80	39	czech	czech	PROPN
aiol-6280	80	40	republic	republic	NOUN
aiol-6280	80	41	and	and	CCONJ
aiol-6280	80	42	poland	poland	PROPN
aiol-6280	80	43	(	(	PUNCT
aiol-6280	80	44	burch	burch	PROPN
aiol-6280	80	45	,	,	PUNCT
aiol-6280	80	46	2008	2008	NUM
aiol-6280	80	47	)	)	PUNCT
aiol-6280	80	48	.	.	PUNCT
aiol-6280	81	1	in	in	ADP
aiol-6280	81	2	greece	greece	PROPN
aiol-6280	81	3	,	,	PUNCT
aiol-6280	81	4	there	there	PRON
aiol-6280	81	5	are	be	VERB
aiol-6280	81	6	very	very	ADV
aiol-6280	81	7	few	few	ADJ
aiol-6280	81	8	official	official	ADJ
aiol-6280	81	9	monitoring	monitoring	NOUN
aiol-6280	81	10	programs	program	NOUN
aiol-6280	81	11	in	in	ADP
aiol-6280	81	12	place	place	NOUN
aiol-6280	81	13	(	(	PUNCT
aiol-6280	81	14	kaloudis	kaloudis	VERB
aiol-6280	81	15	et	et	PROPN
aiol-6280	81	16	al	al	PROPN
aiol-6280	81	17	.	.	PROPN
aiol-6280	81	18	,	,	PUNCT
aiol-6280	81	19	2013	2013	NUM
aiol-6280	81	20	;	;	PUNCT
aiol-6280	81	21	gkelis	gkelis	PROPN
aiol-6280	81	22	et	et	PROPN
aiol-6280	81	23	al	al	PROPN
aiol-6280	81	24	.	.	PROPN
aiol-6280	81	25	,	,	PUNCT
aiol-6280	81	26	2015a	2015a	NUM
aiol-6280	81	27	)	)	PUNCT
aiol-6280	81	28	for	for	ADP
aiol-6280	81	29	cyanobacterial	cyanobacterial	ADJ
aiol-6280	81	30	blooms	bloom	NOUN
aiol-6280	81	31	and	and	CCONJ
aiol-6280	81	32	toxins	toxin	NOUN
aiol-6280	81	33	produced	produce	VERB
aiol-6280	81	34	in	in	ADP
aiol-6280	81	35	freshwaters	freshwater	NOUN
aiol-6280	81	36	,	,	PUNCT
aiol-6280	81	37	whereas	whereas	SCONJ
aiol-6280	81	38	there	there	PRON
aiol-6280	81	39	is	be	VERB
aiol-6280	81	40	also	also	ADV
aiol-6280	81	41	no	no	DET
aiol-6280	81	42	legislafig	legislafig	ADJ
aiol-6280	81	43	.	.	PUNCT
aiol-6280	82	1	1	1	X
aiol-6280	82	2	.	.	X
aiol-6280	82	3	microphotograph	microphotograph	NOUN
aiol-6280	82	4	of	of	ADP
aiol-6280	82	5	the	the	DET
aiol-6280	82	6	microcystis	microcystis	ADJ
aiol-6280	82	7	-	-	PUNCT
aiol-6280	82	8	like	like	ADJ
aiol-6280	82	9	colony	colony	NOUN
aiol-6280	82	10	found	find	VERB
aiol-6280	82	11	in	in	ADP
aiol-6280	82	12	the	the	DET
aiol-6280	82	13	bottled	bottle	VERB
aiol-6280	82	14	filtered	filter	VERB
aiol-6280	82	15	water	water	NOUN
aiol-6280	82	16	bf/	bf/	VERB
aiol-6280	82	17	a	a	DET
aiol-6280	82	18	sample	sample	NOUN
aiol-6280	82	19	.	.	PUNCT
aiol-6280	83	1	non	non	ADJ
aiol-6280	84	1	-co	-co	PROPN
aiol-6280	84	2	mmerc	mmerc	PROPN
aiol-6280	84	3	ial	ial	PROPN
aiol-6280	84	4	us	us	PROPN
aiol-6280	84	5	e	e	NOUN
aiol-6280	84	6	o	o	PROPN
aiol-6280	84	7	nly	nly	ADV
aiol-6280	84	8	s.	s.	PROPN
aiol-6280	84	9	gkelis	gkelis	PROPN
aiol-6280	84	10	and	and	CCONJ
aiol-6280	84	11	a.	a.	NOUN
aiol-6280	84	12	vlamis90	vlamis90	PROPN
aiol-6280	84	13	tion	tion	NOUN
aiol-6280	84	14	with	with	ADP
aiol-6280	84	15	regard	regard	NOUN
aiol-6280	84	16	to	to	ADP
aiol-6280	84	17	monitoring	monitoring	NOUN
aiol-6280	84	18	of	of	ADP
aiol-6280	84	19	these	these	DET
aiol-6280	84	20	quality	quality	NOUN
aiol-6280	84	21	parameters	parameter	NOUN
aiol-6280	84	22	(	(	PUNCT
aiol-6280	84	23	cook	cook	VERB
aiol-6280	84	24	et	et	PROPN
aiol-6280	84	25	al	al	PROPN
aiol-6280	84	26	.	.	PROPN
aiol-6280	84	27	,	,	PUNCT
aiol-6280	84	28	2005	2005	NUM
aiol-6280	84	29	)	)	PUNCT
aiol-6280	84	30	.	.	PUNCT
aiol-6280	85	1	moreover	moreover	ADV
aiol-6280	85	2	,	,	PUNCT
aiol-6280	85	3	there	there	PRON
aiol-6280	85	4	are	be	VERB
aiol-6280	85	5	no	no	DET
aiol-6280	85	6	legally	legally	ADV
aiol-6280	85	7	established	establish	VERB
aiol-6280	85	8	maximum	maximum	ADJ
aiol-6280	85	9	allowable	allowable	ADJ
aiol-6280	85	10	concentrations	concentration	NOUN
aiol-6280	85	11	for	for	ADP
aiol-6280	85	12	cyanotoxins	cyanotoxin	NOUN
aiol-6280	85	13	in	in	ADP
aiol-6280	85	14	potable	potable	ADJ
aiol-6280	85	15	mineral	mineral	NOUN
aiol-6280	85	16	water	water	NOUN
aiol-6280	85	17	.	.	PUNCT
aiol-6280	86	1	the	the	DET
aiol-6280	86	2	only	only	ADJ
aiol-6280	86	3	relevant	relevant	ADJ
aiol-6280	86	4	reference	reference	NOUN
aiol-6280	86	5	is	be	AUX
aiol-6280	86	6	in	in	ADP
aiol-6280	86	7	the	the	DET
aiol-6280	86	8	national	national	ADJ
aiol-6280	86	9	hygienic	hygienic	ADJ
aiol-6280	86	10	regulation	regulation	NOUN
aiol-6280	86	11	a1β/4841/1979	a1β/4841/1979	NOUN
aiol-6280	86	12	(	(	PUNCT
aiol-6280	86	13	fek	fek	PROPN
aiol-6280	86	14	696	696	NUM
aiol-6280	86	15	/	/	SYM
aiol-6280	86	16	β΄/1979	β΄/1979	NOUN
aiol-6280	86	17	)	)	PUNCT
aiol-6280	86	18	,	,	PUNCT
aiol-6280	86	19	where	where	SCONJ
aiol-6280	86	20	the	the	DET
aiol-6280	86	21	absence	absence	NOUN
aiol-6280	86	22	of	of	ADP
aiol-6280	86	23	microalgae	microalgae	NOUN
aiol-6280	86	24	is	be	AUX
aiol-6280	86	25	required	require	VERB
aiol-6280	86	26	for	for	ADP
aiol-6280	86	27	bottled	bottled	ADJ
aiol-6280	86	28	waters	water	NOUN
aiol-6280	86	29	intended	intend	VERB
aiol-6280	86	30	for	for	ADP
aiol-6280	86	31	human	human	ADJ
aiol-6280	86	32	consumption	consumption	NOUN
aiol-6280	86	33	.	.	PUNCT
aiol-6280	87	1	a	a	DET
aiol-6280	87	2	very	very	ADV
aiol-6280	87	3	small	small	ADJ
aiol-6280	87	4	number	number	NOUN
aiol-6280	87	5	of	of	ADP
aiol-6280	87	6	water	water	NOUN
aiol-6280	87	7	treatment	treatment	NOUN
aiol-6280	87	8	plants	plant	NOUN
aiol-6280	87	9	in	in	ADP
aiol-6280	87	10	greece	greece	PROPN
aiol-6280	87	11	control	control	PROPN
aiol-6280	87	12	cyanobacterial	cyanobacterial	ADJ
aiol-6280	87	13	growth	growth	NOUN
aiol-6280	87	14	,	,	PUNCT
aiol-6280	87	15	measure	measure	NOUN
aiol-6280	87	16	cyanotoxins	cyanotoxin	NOUN
aiol-6280	87	17	or	or	CCONJ
aiol-6280	87	18	use	use	VERB
aiol-6280	87	19	water	water	NOUN
aiol-6280	87	20	treatments	treatment	NOUN
aiol-6280	87	21	for	for	ADP
aiol-6280	87	22	toxin	toxin	NOUN
aiol-6280	87	23	removal	removal	NOUN
aiol-6280	87	24	:	:	PUNCT
aiol-6280	87	25	the	the	DET
aiol-6280	87	26	athens	athens	PROPN
aiol-6280	87	27	water	water	PROPN
aiol-6280	87	28	supply	supply	PROPN
aiol-6280	87	29	and	and	CCONJ
aiol-6280	87	30	sewerage	sewerage	NOUN
aiol-6280	87	31	company	company	NOUN
aiol-6280	87	32	implements	implement	VERB
aiol-6280	87	33	some	some	DET
aiol-6280	87	34	measures	measure	NOUN
aiol-6280	87	35	for	for	ADP
aiol-6280	87	36	control	control	NOUN
aiol-6280	87	37	and	and	CCONJ
aiol-6280	87	38	monitoring	monitoring	NOUN
aiol-6280	87	39	of	of	ADP
aiol-6280	87	40	cyanobacteria	cyanobacteria	NOUN
aiol-6280	87	41	and	and	CCONJ
aiol-6280	87	42	cyanotoxins	cyanotoxin	NOUN
aiol-6280	87	43	(	(	PUNCT
aiol-6280	87	44	kaloudis	kaloudis	VERB
aiol-6280	87	45	et	et	PROPN
aiol-6280	87	46	al	al	PROPN
aiol-6280	87	47	.	.	PROPN
aiol-6280	87	48	,	,	PUNCT
aiol-6280	87	49	2013	2013	NUM
aiol-6280	87	50	)	)	PUNCT
aiol-6280	87	51	.	.	PUNCT
aiol-6280	88	1	other	other	ADJ
aiol-6280	88	2	water	water	NOUN
aiol-6280	88	3	utilities	utility	NOUN
aiol-6280	88	4	are	be	AUX
aiol-6280	88	5	small	small	ADJ
aiol-6280	88	6	,	,	PUNCT
aiol-6280	88	7	at	at	ADP
aiol-6280	88	8	a	a	DET
aiol-6280	88	9	local	local	ADJ
aiol-6280	88	10	level	level	NOUN
aiol-6280	88	11	,	,	PUNCT
aiol-6280	88	12	and	and	CCONJ
aiol-6280	88	13	they	they	PRON
aiol-6280	88	14	do	do	AUX
aiol-6280	88	15	not	not	PART
aiol-6280	88	16	implement	implement	VERB
aiol-6280	88	17	such	such	ADJ
aiol-6280	88	18	measures	measure	NOUN
aiol-6280	88	19	,	,	PUNCT
aiol-6280	88	20	with	with	ADP
aiol-6280	88	21	the	the	DET
aiol-6280	88	22	possible	possible	ADJ
aiol-6280	88	23	exception	exception	NOUN
aiol-6280	88	24	of	of	ADP
aiol-6280	88	25	the	the	DET
aiol-6280	88	26	thessaloniki	thessaloniki	PROPN
aiol-6280	88	27	water	water	NOUN
aiol-6280	88	28	supply	supply	NOUN
aiol-6280	88	29	and	and	CCONJ
aiol-6280	88	30	sewerage	sewerage	NOUN
aiol-6280	88	31	company	company	NOUN
aiol-6280	88	32	(	(	PUNCT
aiol-6280	88	33	thessaloniki	thessaloniki	PROPN
aiol-6280	88	34	)	)	PUNCT
aiol-6280	88	35	(	(	PUNCT
aiol-6280	88	36	kaloudis	kaloudis	PROPN
aiol-6280	88	37	,	,	PUNCT
aiol-6280	88	38	personal	personal	ADJ
aiol-6280	88	39	communication	communication	NOUN
aiol-6280	88	40	)	)	PUNCT
aiol-6280	88	41	.	.	PUNCT
aiol-6280	89	1	conclusions	conclusion	NOUN
aiol-6280	89	2	the	the	DET
aiol-6280	89	3	results	result	NOUN
aiol-6280	89	4	of	of	ADP
aiol-6280	89	5	this	this	DET
aiol-6280	89	6	small	small	ADJ
aiol-6280	89	7	scale	scale	NOUN
aiol-6280	89	8	monitoring	monitoring	NOUN
aiol-6280	89	9	program	program	NOUN
aiol-6280	89	10	demonstrated	demonstrate	VERB
aiol-6280	89	11	for	for	ADP
aiol-6280	89	12	the	the	DET
aiol-6280	89	13	first	first	ADJ
aiol-6280	89	14	time	time	NOUN
aiol-6280	89	15	the	the	DET
aiol-6280	89	16	presence	presence	NOUN
aiol-6280	89	17	of	of	ADP
aiol-6280	89	18	cyanobacteria	cyanobacteria	NOUN
aiol-6280	89	19	in	in	ADP
aiol-6280	89	20	bottled	bottled	ADJ
aiol-6280	89	21	natural	natural	ADJ
aiol-6280	89	22	mineral	mineral	NOUN
aiol-6280	89	23	drinking	drinking	NOUN
aiol-6280	89	24	water	water	NOUN
aiol-6280	89	25	.	.	PUNCT
aiol-6280	90	1	while	while	SCONJ
aiol-6280	90	2	it	it	PRON
aiol-6280	90	3	seems	seem	VERB
aiol-6280	90	4	unlikely	unlikely	ADJ
aiol-6280	90	5	that	that	SCONJ
aiol-6280	90	6	the	the	DET
aiol-6280	90	7	use	use	NOUN
aiol-6280	90	8	of	of	ADP
aiol-6280	90	9	bottled	bottled	ADJ
aiol-6280	90	10	water	water	NOUN
aiol-6280	90	11	would	would	AUX
aiol-6280	90	12	constitute	constitute	VERB
aiol-6280	90	13	any	any	DET
aiol-6280	90	14	major	major	ADJ
aiol-6280	90	15	hazard	hazard	NOUN
aiol-6280	90	16	with	with	ADP
aiol-6280	90	17	regard	regard	NOUN
aiol-6280	90	18	to	to	ADP
aiol-6280	90	19	cyanotoxin	cyanotoxin	NOUN
aiol-6280	90	20	exposure	exposure	NOUN
aiol-6280	90	21	,	,	PUNCT
aiol-6280	90	22	our	our	PRON
aiol-6280	90	23	findings	finding	NOUN
aiol-6280	90	24	call	call	VERB
aiol-6280	90	25	for	for	ADP
aiol-6280	90	26	further	further	ADJ
aiol-6280	90	27	research	research	NOUN
aiol-6280	90	28	to	to	PART
aiol-6280	90	29	investigate	investigate	VERB
aiol-6280	90	30	the	the	DET
aiol-6280	90	31	presence	presence	NOUN
aiol-6280	90	32	,	,	PUNCT
aiol-6280	90	33	heterotrophic	heterotrophic	ADJ
aiol-6280	90	34	growth	growth	NOUN
aiol-6280	90	35	and	and	CCONJ
aiol-6280	90	36	significance	significance	NOUN
aiol-6280	90	37	of	of	ADP
aiol-6280	90	38	cyanobacterial	cyanobacterial	ADJ
aiol-6280	90	39	colonies	colony	NOUN
aiol-6280	90	40	and/or	and/or	CCONJ
aiol-6280	90	41	biofilms	biofilm	NOUN
aiol-6280	90	42	in	in	ADP
aiol-6280	90	43	water	water	NOUN
aiol-6280	90	44	distribution	distribution	NOUN
aiol-6280	90	45	systems	system	NOUN
aiol-6280	90	46	,	,	PUNCT
aiol-6280	90	47	such	such	ADJ
aiol-6280	90	48	as	as	ADP
aiol-6280	90	49	wells	well	NOUN
aiol-6280	90	50	.	.	PUNCT
aiol-6280	91	1	acknowledgments	acknowledgment	NOUN
aiol-6280	91	2	we	we	PRON
aiol-6280	91	3	thank	thank	VERB
aiol-6280	91	4	prof	prof	PROPN
aiol-6280	91	5	.	.	PUNCT
aiol-6280	92	1	vitor	vitor	PROPN
aiol-6280	92	2	vasconcelos	vasconcelos	PROPN
aiol-6280	92	3	for	for	ADP
aiol-6280	92	4	providing	provide	VERB
aiol-6280	92	5	freezedried	freezedrie	VERB
aiol-6280	92	6	material	material	NOUN
aiol-6280	92	7	of	of	ADP
aiol-6280	92	8	cyanobacteria	cyanobacteria	NOUN
aiol-6280	92	9	strains	strain	NOUN
aiol-6280	92	10	used	use	VERB
aiol-6280	92	11	as	as	ADP
aiol-6280	92	12	positive	positive	ADJ
aiol-6280	92	13	control	control	NOUN
aiol-6280	92	14	in	in	ADP
aiol-6280	92	15	pcr	pcr	ADJ
aiol-6280	92	16	studies	study	NOUN
aiol-6280	92	17	.	.	PUNCT
aiol-6280	93	1	av	av	PRON
aiol-6280	93	2	would	would	AUX
aiol-6280	93	3	like	like	VERB
aiol-6280	93	4	to	to	PART
aiol-6280	93	5	thank	thank	VERB
aiol-6280	93	6	dr	dr	PROPN
aiol-6280	93	7	.	.	PROPN
aiol-6280	93	8	panagiota	panagiota	PROPN
aiol-6280	93	9	katikou	katikou	PROPN
aiol-6280	93	10	for	for	ADP
aiol-6280	93	11	providing	provide	VERB
aiol-6280	93	12	useful	useful	ADJ
aiol-6280	93	13	information	information	NOUN
aiol-6280	93	14	on	on	ADP
aiol-6280	93	15	cyanotoxins	cyanotoxin	NOUN
aiol-6280	93	16	.	.	PUNCT
aiol-6280	94	1	the	the	DET
aiol-6280	94	2	authors	author	NOUN
aiol-6280	94	3	acknowledge	acknowledge	VERB
aiol-6280	94	4	cyanocost	cyanocost	NOUN
aiol-6280	94	5	-	-	PUNCT
aiol-6280	94	6	cost	cost	NOUN
aiol-6280	94	7	es	es	NOUN
aiol-6280	94	8	1105	1105	NUM
aiol-6280	94	9	for	for	ADP
aiol-6280	94	10	sharing	sharing	NOUN
aiol-6280	94	11	of	of	ADP
aiol-6280	94	12	knowledge	knowledge	NOUN
aiol-6280	94	13	and	and	CCONJ
aiol-6280	94	14	networking	networking	NOUN
aiol-6280	94	15	and	and	CCONJ
aiol-6280	94	16	thank	thank	VERB
aiol-6280	94	17	the	the	DET
aiol-6280	94	18	two	two	NUM
aiol-6280	94	19	anonymous	anonymous	ADJ
aiol-6280	94	20	reviewers	reviewer	NOUN
aiol-6280	94	21	for	for	ADP
aiol-6280	94	22	helpful	helpful	ADJ
aiol-6280	94	23	suggestions	suggestion	NOUN
aiol-6280	94	24	.	.	PUNCT
aiol-6280	95	1	references	reference	NOUN
aiol-6280	95	2	atashpaz	atashpaz	VERB
aiol-6280	95	3	s	s	PROPN
aiol-6280	95	4	,	,	PUNCT
aiol-6280	95	5	khani	khani	PROPN
aiol-6280	95	6	s	s	PROPN
aiol-6280	95	7	,	,	PUNCT
aiol-6280	95	8	barzegari	barzegari	PRON
aiol-6280	95	9	a	a	X
aiol-6280	95	10	,	,	PUNCT
aiol-6280	95	11	barar	barar	PROPN
aiol-6280	95	12	j	j	PROPN
aiol-6280	95	13	,	,	PUNCT
aiol-6280	95	14	vahed	vahe	VERB
aiol-6280	95	15	sz	sz	PROPN
aiol-6280	95	16	,	,	PUNCT
aiol-6280	95	17	azarbaijani	azarbaijani	ADJ
aiol-6280	95	18	r	r	NOUN
aiol-6280	95	19	,	,	PUNCT
aiol-6280	95	20	omidi	omidi	VERB
aiol-6280	95	21	y	y	PROPN
aiol-6280	95	22	,	,	PUNCT
aiol-6280	95	23	2010	2010	NUM
aiol-6280	95	24	.	.	PUNCT
aiol-6280	96	1	a	a	DET
aiol-6280	96	2	robust	robust	ADJ
aiol-6280	96	3	universal	universal	ADJ
aiol-6280	96	4	method	method	NOUN
aiol-6280	96	5	for	for	ADP
aiol-6280	96	6	extraction	extraction	NOUN
aiol-6280	96	7	of	of	ADP
aiol-6280	96	8	genomic	genomic	ADJ
aiol-6280	96	9	dna	dna	NOUN
aiol-6280	96	10	from	from	ADP
aiol-6280	96	11	bacterial	bacterial	ADJ
aiol-6280	96	12	species	specie	NOUN
aiol-6280	96	13	.	.	PUNCT
aiol-6280	97	1	microbiology	microbiology	NOUN
aiol-6280	97	2	79:538	79:538	NOUN
aiol-6280	97	3	-	-	SYM
aiol-6280	97	4	542	542	NUM
aiol-6280	97	5	.	.	PUNCT
aiol-6280	98	1	burch	burch	PROPN
aiol-6280	98	2	md	md	PROPN
aiol-6280	98	3	,	,	PUNCT
aiol-6280	98	4	2008	2008	NUM
aiol-6280	98	5	.	.	PUNCT
aiol-6280	99	1	effective	effective	ADJ
aiol-6280	99	2	doses	dose	NOUN
aiol-6280	99	3	,	,	PUNCT
aiol-6280	99	4	guidelines	guideline	NOUN
aiol-6280	99	5	and	and	CCONJ
aiol-6280	99	6	regulations	regulation	NOUN
aiol-6280	99	7	.	.	PUNCT
aiol-6280	100	1	in	in	ADP
aiol-6280	100	2	:	:	PUNCT
aiol-6280	100	3	h.k	h.k	PROPN
aiol-6280	100	4	.	.	PROPN
aiol-6280	100	5	hudnell	hudnell	PROPN
aiol-6280	100	6	(	(	PUNCT
aiol-6280	100	7	ed	ed	NOUN
aiol-6280	100	8	.	.	PUNCT
aiol-6280	100	9	)	)	PUNCT
aiol-6280	100	10	,	,	PUNCT
aiol-6280	100	11	cyanobacterial	cyanobacterial	ADJ
aiol-6280	100	12	harmful	harmful	ADJ
aiol-6280	100	13	algal	algal	ADJ
aiol-6280	100	14	blooms	bloom	NOUN
aiol-6280	100	15	:	:	PUNCT
aiol-6280	100	16	state	state	NOUN
aiol-6280	100	17	of	of	ADP
aiol-6280	100	18	the	the	DET
aiol-6280	100	19	science	science	NOUN
aiol-6280	100	20	and	and	CCONJ
aiol-6280	100	21	research	research	NOUN
aiol-6280	100	22	needs	need	NOUN
aiol-6280	100	23	.	.	PUNCT
aiol-6280	101	1	adv	adv	PROPN
aiol-6280	101	2	.	.	PUNCT
aiol-6280	102	1	exp	exp	PROPN
aiol-6280	102	2	.	.	PROPN
aiol-6280	102	3	med	med	PROPN
aiol-6280	102	4	.	.	PUNCT
aiol-6280	103	1	biol	biol	PROPN
aiol-6280	103	2	.	.	PUNCT
aiol-6280	104	1	610:831	610:831	X
aiol-6280	104	2	-	-	SYM
aiol-6280	104	3	854	854	NUM
aiol-6280	104	4	.	.	PUNCT
aiol-6280	105	1	canadian	canadian	ADJ
aiol-6280	105	2	food	food	PROPN
aiol-6280	105	3	inspection	inspection	NOUN
aiol-6280	105	4	agency	agency	NOUN
aiol-6280	105	5	(	(	PUNCT
aiol-6280	105	6	cfia	cfia	PROPN
aiol-6280	105	7	)	)	PUNCT
aiol-6280	105	8	,	,	PUNCT
aiol-6280	105	9	2011	2011	NUM
aiol-6280	105	10	.	.	PUNCT
aiol-6280	106	1	microcystins	microcystin	NOUN
aiol-6280	106	2	in	in	ADP
aiol-6280	106	3	bottled	bottled	ADJ
aiol-6280	106	4	water	water	NOUN
aiol-6280	106	5	.	.	PUNCT
aiol-6280	107	1	food	food	NOUN
aiol-6280	107	2	safety	safety	NOUN
aiol-6280	107	3	action	action	NOUN
aiol-6280	107	4	plan	plan	NOUN
aiol-6280	107	5	report	report	NOUN
aiol-6280	107	6	.	.	PUNCT
aiol-6280	108	1	tschem-10/11	tschem-10/11	NOUN
aiol-6280	108	2	,	,	PUNCT
aiol-6280	108	3	pp	pp	ADJ
aiol-6280	108	4	.	.	PUNCT
aiol-6280	109	1	1	1	NUM
aiol-6280	109	2	-	-	SYM
aiol-6280	109	3	8	8	NUM
aiol-6280	109	4	canadian	canadian	ADJ
aiol-6280	109	5	food	food	NOUN
aiol-6280	109	6	inspection	inspection	NOUN
aiol-6280	109	7	agency	agency	NOUN
aiol-6280	109	8	(	(	PUNCT
aiol-6280	109	9	cfia	cfia	PROPN
aiol-6280	109	10	)	)	PUNCT
aiol-6280	109	11	,	,	PUNCT
aiol-6280	109	12	2012	2012	NUM
aiol-6280	109	13	.	.	PUNCT
aiol-6280	110	1	microcystins	microcystin	NOUN
aiol-6280	110	2	and	and	CCONJ
aiol-6280	110	3	nodularin	nodularin	NOUN
aiol-6280	110	4	in	in	ADP
aiol-6280	110	5	bottled	bottled	ADJ
aiol-6280	110	6	water	water	NOUN
aiol-6280	110	7	.	.	PUNCT
aiol-6280	111	1	food	food	NOUN
aiol-6280	111	2	safety	safety	NOUN
aiol-6280	111	3	action	action	NOUN
aiol-6280	111	4	plan	plan	NOUN
aiol-6280	111	5	report	report	NOUN
aiol-6280	111	6	.	.	PUNCT
aiol-6280	112	1	ts	ts	NOUN
aiol-6280	112	2	-	-	PUNCT
aiol-6280	112	3	chem-11/12	chem-11/12	PROPN
aiol-6280	112	4	,	,	PUNCT
aiol-6280	112	5	pp	pp	ADJ
aiol-6280	112	6	.	.	PUNCT
aiol-6280	113	1	1	1	NUM
aiol-6280	113	2	-	-	SYM
aiol-6280	113	3	8	8	NUM
aiol-6280	113	4	.	.	PUNCT
aiol-6280	114	1	chrisostomou	chrisostomou	ADV
aiol-6280	114	2	a	a	DET
aiol-6280	114	3	,	,	PUNCT
aiol-6280	114	4	moustaka	moustaka	PROPN
aiol-6280	114	5	-	-	PUNCT
aiol-6280	114	6	gouni	gouni	PROPN
aiol-6280	114	7	m	m	PROPN
aiol-6280	114	8	,	,	PUNCT
aiol-6280	114	9	sgardelis	sgardelis	PROPN
aiol-6280	114	10	s	s	PROPN
aiol-6280	114	11	,	,	PUNCT
aiol-6280	114	12	lanaras	lanaras	PROPN
aiol-6280	114	13	t	t	PROPN
aiol-6280	114	14	,	,	PUNCT
aiol-6280	114	15	2009	2009	NUM
aiol-6280	114	16	.	.	PUNCT
aiol-6280	115	1	air	air	NOUN
aiol-6280	115	2	-	-	PUNCT
aiol-6280	115	3	dispersed	disperse	VERB
aiol-6280	115	4	phytoplankton	phytoplankton	NOUN
aiol-6280	115	5	in	in	ADP
aiol-6280	115	6	a	a	DET
aiol-6280	115	7	mediterranean	mediterranean	PROPN
aiol-6280	115	8	river	river	NOUN
aiol-6280	115	9	-	-	PUNCT
aiol-6280	115	10	reservoir	reservoir	NOUN
aiol-6280	115	11	system	system	NOUN
aiol-6280	115	12	(	(	PUNCT
aiol-6280	115	13	aliakmon	aliakmon	NOUN
aiol-6280	115	14	-	-	PUNCT
aiol-6280	115	15	polyphytos	polyphytos	NOUN
aiol-6280	115	16	,	,	PUNCT
aiol-6280	115	17	greece	greece	PROPN
aiol-6280	115	18	)	)	PUNCT
aiol-6280	115	19	.	.	PUNCT
aiol-6280	116	1	j.	j.	PROPN
aiol-6280	116	2	plankton	plankton	PROPN
aiol-6280	116	3	res	re	NOUN
aiol-6280	116	4	.	.	PUNCT
aiol-6280	117	1	31:877	31:877	PROPN
aiol-6280	117	2	-	-	PUNCT
aiol-6280	117	3	884	884	NUM
aiol-6280	117	4	.	.	PUNCT
aiol-6280	118	1	cook	cook	VERB
aiol-6280	118	2	cm	cm	NOUN
aiol-6280	118	3	,	,	PUNCT
aiol-6280	118	4	moustaka	moustaka	PROPN
aiol-6280	118	5	-	-	PUNCT
aiol-6280	118	6	gouni	gouni	PROPN
aiol-6280	118	7	m	m	PROPN
aiol-6280	118	8	,	,	PUNCT
aiol-6280	118	9	gkelis	gkelis	PROPN
aiol-6280	118	10	s	s	PROPN
aiol-6280	118	11	,	,	PUNCT
aiol-6280	118	12	lanaras	lanaras	PROPN
aiol-6280	118	13	t	t	PROPN
aiol-6280	118	14	,	,	PUNCT
aiol-6280	118	15	2005	2005	NUM
aiol-6280	118	16	.	.	PUNCT
aiol-6280	119	1	greece	greece	PROPN
aiol-6280	119	2	:	:	PUNCT
aiol-6280	119	3	cyanotoxin	cyanotoxin	PROPN
aiol-6280	119	4	risk	risk	NOUN
aiol-6280	119	5	assessment	assessment	NOUN
aiol-6280	119	6	,	,	PUNCT
aiol-6280	119	7	risk	risk	NOUN
aiol-6280	119	8	management	management	NOUN
aiol-6280	119	9	and	and	CCONJ
aiol-6280	119	10	regulation	regulation	NOUN
aiol-6280	119	11	,	,	PUNCT
aiol-6280	119	12	p.	p.	NOUN
aiol-6280	119	13	69	69	NUM
aiol-6280	119	14	-	-	SYM
aiol-6280	119	15	75	75	NUM
aiol-6280	119	16	.	.	PUNCT
aiol-6280	120	1	in	in	ADP
aiol-6280	120	2	:	:	PUNCT
aiol-6280	120	3	i.	i.	NOUN
aiol-6280	120	4	chorus	chorus	PROPN
aiol-6280	120	5	(	(	PUNCT
aiol-6280	120	6	ed	ed	NOUN
aiol-6280	120	7	.	.	PUNCT
aiol-6280	120	8	)	)	PUNCT
aiol-6280	120	9	,	,	PUNCT
aiol-6280	120	10	current	current	ADJ
aiol-6280	120	11	approaches	approach	NOUN
aiol-6280	120	12	to	to	ADP
aiol-6280	120	13	cyanotoxin	cyanotoxin	VERB
aiol-6280	120	14	risk	risk	NOUN
aiol-6280	120	15	assessment	assessment	NOUN
aiol-6280	120	16	,	,	PUNCT
aiol-6280	120	17	risk	risk	NOUN
aiol-6280	120	18	management	management	NOUN
aiol-6280	120	19	and	and	CCONJ
aiol-6280	120	20	regulations	regulation	NOUN
aiol-6280	120	21	in	in	ADP
aiol-6280	120	22	different	different	ADJ
aiol-6280	120	23	countries	country	NOUN
aiol-6280	120	24	.	.	PUNCT
aiol-6280	121	1	series	series	PROPN
aiol-6280	121	2	wabolu	wabolu	PROPN
aiol-6280	121	3	02/05	02/05	PROPN
aiol-6280	121	4	.	.	PUNCT
aiol-6280	122	1	umweltbundesamt	umweltbundesamt	PROPN
aiol-6280	122	2	,	,	PUNCT
aiol-6280	122	3	dessau	dessau	PROPN
aiol-6280	122	4	.	.	PROPN
aiol-6280	123	1	codd	codd	PROPN
aiol-6280	123	2	ga	ga	PROPN
aiol-6280	123	3	,	,	PUNCT
aiol-6280	123	4	lindsay	lindsay	PROPN
aiol-6280	123	5	j	j	PROPN
aiol-6280	123	6	,	,	PUNCT
aiol-6280	123	7	young	young	PROPN
aiol-6280	123	8	fm	fm	PROPN
aiol-6280	123	9	,	,	PUNCT
aiol-6280	123	10	morrison	morrison	PROPN
aiol-6280	123	11	lf	lf	PROPN
aiol-6280	123	12	,	,	PUNCT
aiol-6280	123	13	metcalf	metcalf	PROPN
aiol-6280	123	14	js	js	PROPN
aiol-6280	123	15	,	,	PUNCT
aiol-6280	123	16	2005	2005	NUM
aiol-6280	123	17	.	.	PUNCT
aiol-6280	124	1	harmful	harmful	ADJ
aiol-6280	124	2	cyanobacteria	cyanobacteria	NOUN
aiol-6280	124	3	:	:	PUNCT
aiol-6280	124	4	from	from	ADP
aiol-6280	124	5	mass	mass	ADJ
aiol-6280	124	6	mortalities	mortality	NOUN
aiol-6280	124	7	to	to	ADP
aiol-6280	124	8	management	management	NOUN
aiol-6280	124	9	measures	measure	NOUN
aiol-6280	124	10	,	,	PUNCT
aiol-6280	124	11	p.	p.	NOUN
aiol-6280	124	12	1	1	NUM
aiol-6280	124	13	-	-	SYM
aiol-6280	124	14	23	23	NUM
aiol-6280	124	15	.	.	PUNCT
aiol-6280	125	1	in	in	ADP
aiol-6280	125	2	:	:	PUNCT
aiol-6280	125	3	j.	j.	PROPN
aiol-6280	125	4	huisman	huisman	PROPN
aiol-6280	125	5	,	,	PUNCT
aiol-6280	125	6	h.c.p	h.c.p	PROPN
aiol-6280	125	7	.	.	PUNCT
aiol-6280	125	8	matthijs	matthijs	PROPN
aiol-6280	125	9	and	and	CCONJ
aiol-6280	125	10	p.m.	p.m.	NOUN
aiol-6280	125	11	visser	visser	NOUN
aiol-6280	125	12	(	(	PUNCT
aiol-6280	125	13	eds	ed	NOUN
aiol-6280	125	14	.	.	PUNCT
aiol-6280	125	15	)	)	PUNCT
aiol-6280	125	16	,	,	PUNCT
aiol-6280	125	17	harmful	harmful	ADJ
aiol-6280	125	18	cyanobacteria	cyanobacteria	NOUN
aiol-6280	125	19	.	.	PUNCT
aiol-6280	125	20	springer	springer	PROPN
aiol-6280	125	21	,	,	PUNCT
aiol-6280	125	22	dordrecht	dordrecht	PROPN
aiol-6280	125	23	.	.	PUNCT
aiol-6280	126	1	davis	davis	PROPN
aiol-6280	126	2	tw	tw	PROPN
aiol-6280	126	3	,	,	PUNCT
aiol-6280	126	4	berry	berry	VERB
aiol-6280	126	5	dl	dl	PROPN
aiol-6280	126	6	,	,	PUNCT
aiol-6280	126	7	boyer	boyer	PROPN
aiol-6280	126	8	gl	gl	PROPN
aiol-6280	126	9	,	,	PUNCT
aiol-6280	126	10	gobler	gobler	NOUN
aiol-6280	126	11	cj	cj	PROPN
aiol-6280	126	12	,	,	PUNCT
aiol-6280	126	13	2009	2009	NUM
aiol-6280	126	14	.	.	PUNCT
aiol-6280	127	1	the	the	DET
aiol-6280	127	2	effects	effect	NOUN
aiol-6280	127	3	of	of	ADP
aiol-6280	127	4	temperature	temperature	NOUN
aiol-6280	127	5	and	and	CCONJ
aiol-6280	127	6	nutrients	nutrient	NOUN
aiol-6280	127	7	on	on	ADP
aiol-6280	127	8	the	the	DET
aiol-6280	127	9	growth	growth	NOUN
aiol-6280	127	10	and	and	CCONJ
aiol-6280	127	11	dynamics	dynamic	NOUN
aiol-6280	127	12	of	of	ADP
aiol-6280	127	13	toxic	toxic	ADJ
aiol-6280	127	14	and	and	CCONJ
aiol-6280	127	15	non	non	ADJ
aiol-6280	127	16	-	-	ADJ
aiol-6280	127	17	toxic	toxic	ADJ
aiol-6280	127	18	strains	strain	NOUN
aiol-6280	127	19	of	of	ADP
aiol-6280	127	20	microcystis	microcystis	NOUN
aiol-6280	127	21	during	during	ADP
aiol-6280	127	22	cyanobacteria	cyanobacteria	NOUN
aiol-6280	127	23	blooms	bloom	NOUN
aiol-6280	127	24	.	.	PUNCT
aiol-6280	128	1	harmful	harmful	ADJ
aiol-6280	128	2	algae	algae	NOUN
aiol-6280	128	3	8:715	8:715	NUM
aiol-6280	128	4	-	-	SYM
aiol-6280	128	5	725	725	NUM
aiol-6280	128	6	.	.	PUNCT
aiol-6280	128	7	ferretti	ferretti	PROPN
aiol-6280	128	8	e	e	PROPN
aiol-6280	128	9	,	,	PUNCT
aiol-6280	128	10	lucentini	lucentini	ADJ
aiol-6280	128	11	l	l	NOUN
aiol-6280	128	12	,	,	PUNCT
aiol-6280	128	13	veschetti	veschetti	PROPN
aiol-6280	128	14	e	e	NOUN
aiol-6280	128	15	,	,	PUNCT
aiol-6280	128	16	bonadonna	bonadonna	PROPN
aiol-6280	128	17	l	l	PROPN
aiol-6280	128	18	,	,	PUNCT
aiol-6280	128	19	stammati	stammati	PROPN
aiol-6280	128	20	a	a	PRON
aiol-6280	128	21	,	,	PUNCT
aiol-6280	128	22	turco	turco	PROPN
aiol-6280	128	23	l	l	PROPN
aiol-6280	128	24	,	,	PUNCT
aiol-6280	128	25	ottaviani	ottaviani	PROPN
aiol-6280	128	26	m	m	PROPN
aiol-6280	128	27	,	,	PUNCT
aiol-6280	128	28	2007	2007	NUM
aiol-6280	128	29	.	.	PUNCT
aiol-6280	129	1	screening	screening	NOUN
aiol-6280	129	2	and	and	CCONJ
aiol-6280	129	3	identification	identification	NOUN
aiol-6280	129	4	of	of	ADP
aiol-6280	129	5	unknown	unknown	ADJ
aiol-6280	129	6	contaminants	contaminant	NOUN
aiol-6280	129	7	in	in	ADP
aiol-6280	129	8	water	water	NOUN
aiol-6280	129	9	destined	destine	VERB
aiol-6280	129	10	to	to	ADP
aiol-6280	129	11	human	human	ADJ
aiol-6280	129	12	consumption	consumption	NOUN
aiol-6280	129	13	:	:	PUNCT
aiol-6280	129	14	a	a	DET
aiol-6280	129	15	case	case	NOUN
aiol-6280	129	16	study	study	NOUN
aiol-6280	129	17	.	.	PUNCT
aiol-6280	130	1	microchem	microchem	PROPN
aiol-6280	130	2	.	.	PUNCT
aiol-6280	131	1	j.	j.	PROPN
aiol-6280	131	2	85:57	85:57	PROPN
aiol-6280	131	3	-	-	SYM
aiol-6280	131	4	64	64	NUM
aiol-6280	131	5	.	.	PUNCT
aiol-6280	132	1	garcia	garcia	PROPN
aiol-6280	132	2	-	-	PUNCT
aiol-6280	132	3	pichel	pichel	PROPN
aiol-6280	132	4	f	f	X
aiol-6280	132	5	,	,	PUNCT
aiol-6280	132	6	pringault	pringault	VERB
aiol-6280	132	7	o	o	NOUN
aiol-6280	132	8	,	,	PUNCT
aiol-6280	132	9	2001	2001	NUM
aiol-6280	132	10	.	.	PUNCT
aiol-6280	133	1	cyanobacteria	cyanobacteria	NOUN
aiol-6280	133	2	track	track	NOUN
aiol-6280	133	3	water	water	NOUN
aiol-6280	133	4	in	in	ADP
aiol-6280	133	5	desert	desert	NOUN
aiol-6280	133	6	soils	soil	NOUN
aiol-6280	133	7	.	.	PUNCT
aiol-6280	134	1	nature	nature	PROPN
aiol-6280	134	2	412:380	412:380	NOUN
aiol-6280	134	3	-	-	PUNCT
aiol-6280	134	4	381	381	NUM
aiol-6280	134	5	.	.	PUNCT
aiol-6280	135	1	genitsaris	genitsaris	PROPN
aiol-6280	135	2	s	s	PROPN
aiol-6280	135	3	,	,	PUNCT
aiol-6280	135	4	kormas	kormas	PROPN
aiol-6280	135	5	ka	ka	PROPN
aiol-6280	135	6	,	,	PUNCT
aiol-6280	135	7	moustaka	moustaka	PROPN
aiol-6280	135	8	-	-	PUNCT
aiol-6280	135	9	gouni	gouni	PROPN
aiol-6280	135	10	m	m	PROPN
aiol-6280	135	11	,	,	PUNCT
aiol-6280	135	12	2011	2011	NUM
aiol-6280	135	13	.	.	PUNCT
aiol-6280	136	1	airborne	airborne	ADJ
aiol-6280	136	2	algae	algae	NOUN
aiol-6280	136	3	and	and	CCONJ
aiol-6280	136	4	cyanobacteria	cyanobacteria	NOUN
aiol-6280	136	5	:	:	PUNCT
aiol-6280	136	6	occurrence	occurrence	NOUN
aiol-6280	136	7	and	and	CCONJ
aiol-6280	136	8	related	relate	VERB
aiol-6280	136	9	health	health	NOUN
aiol-6280	136	10	effects	effect	NOUN
aiol-6280	136	11	.	.	PUNCT
aiol-6280	137	1	front	front	ADJ
aiol-6280	137	2	.	.	PUNCT
aiol-6280	138	1	biosci	biosci	PROPN
aiol-6280	138	2	.	.	PUNCT
aiol-6280	139	1	3:772	3:772	NUM
aiol-6280	139	2	-	-	SYM
aiol-6280	139	3	787	787	NUM
aiol-6280	139	4	.	.	PUNCT
aiol-6280	140	1	gkelis	gkelis	PROPN
aiol-6280	140	2	s	s	PART
aiol-6280	140	3	,	,	PUNCT
aiol-6280	140	4	chronis	chronis	VERB
aiol-6280	140	5	i	i	PRON
aiol-6280	140	6	,	,	PUNCT
aiol-6280	140	7	kagalou	kagalou	PROPN
aiol-6280	140	8	i	i	PROPN
aiol-6280	140	9	,	,	PUNCT
aiol-6280	140	10	2015a	2015a	NUM
aiol-6280	140	11	.	.	PUNCT
aiol-6280	141	1	monitoring	monitor	VERB
aiol-6280	141	2	a	a	DET
aiol-6280	141	3	newly	newly	ADV
aiol-6280	141	4	reborn	reborn	ADJ
aiol-6280	141	5	patient	patient	NOUN
aiol-6280	141	6	:	:	PUNCT
aiol-6280	141	7	phytoplankton	phytoplankton	NOUN
aiol-6280	141	8	based	base	VERB
aiol-6280	141	9	water	water	NOUN
aiol-6280	141	10	quality	quality	NOUN
aiol-6280	141	11	and	and	CCONJ
aiol-6280	141	12	cyanotoxin	cyanotoxin	NOUN
aiol-6280	141	13	occurrence	occurrence	NOUN
aiol-6280	141	14	in	in	ADP
aiol-6280	141	15	a	a	DET
aiol-6280	141	16	reconstructed	reconstruct	VERB
aiol-6280	141	17	shallow	shallow	ADJ
aiol-6280	141	18	mediterranean	mediterranean	PROPN
aiol-6280	141	19	lake	lake	PROPN
aiol-6280	141	20	.	.	PUNCT
aiol-6280	142	1	proceedings	proceeding	NOUN
aiol-6280	142	2	aslo	aslo	PROPN
aiol-6280	142	3	aquatic	aquatic	PROPN
aiol-6280	142	4	sciences	sciences	PROPN
aiol-6280	142	5	meet	meet	VERB
aiol-6280	142	6	.	.	PUNCT
aiol-6280	142	7	,	,	PUNCT
aiol-6280	142	8	granada	granada	PROPN
aiol-6280	142	9	.	.	PUNCT
aiol-6280	143	1	abstract	abstract	ADJ
aiol-6280	143	2	id27076	id27076	PROPN
aiol-6280	143	3	.	.	PUNCT
aiol-6280	144	1	gkelis	gkelis	PROPN
aiol-6280	144	2	s	s	PROPN
aiol-6280	144	3	,	,	PUNCT
aiol-6280	144	4	lanaras	lanaras	PROPN
aiol-6280	144	5	t	t	PROPN
aiol-6280	144	6	,	,	PUNCT
aiol-6280	144	7	sivonen	sivonen	NOUN
aiol-6280	144	8	k	k	PROPN
aiol-6280	144	9	,	,	PUNCT
aiol-6280	144	10	2015b	2015b	NUM
aiol-6280	144	11	.	.	PUNCT
aiol-6280	145	1	cyanobacterial	cyanobacterial	ADJ
aiol-6280	145	2	toxic	toxic	ADJ
aiol-6280	145	3	and	and	CCONJ
aiol-6280	145	4	bioactive	bioactive	VERB
aiol-6280	145	5	peptides	peptide	NOUN
aiol-6280	145	6	in	in	ADP
aiol-6280	145	7	freshwater	freshwater	NOUN
aiol-6280	145	8	bodies	body	NOUN
aiol-6280	145	9	of	of	ADP
aiol-6280	145	10	greece	greece	PROPN
aiol-6280	145	11	:	:	PUNCT
aiol-6280	145	12	concentrations	concentration	NOUN
aiol-6280	145	13	,	,	PUNCT
aiol-6280	145	14	occurrence	occurrence	NOUN
aiol-6280	145	15	patterns	pattern	NOUN
aiol-6280	145	16	,	,	PUNCT
aiol-6280	145	17	and	and	CCONJ
aiol-6280	145	18	implications	implication	NOUN
aiol-6280	145	19	for	for	ADP
aiol-6280	145	20	human	human	ADJ
aiol-6280	145	21	health	health	NOUN
aiol-6280	145	22	.	.	PUNCT
aiol-6280	146	1	mar	mar	PROPN
aiol-6280	146	2	.	.	PUNCT
aiol-6280	147	1	drugs	drug	NOUN
aiol-6280	147	2	13:6319	13:6319	NUM
aiol-6280	147	3	-	-	SYM
aiol-6280	147	4	6335	6335	NUM
aiol-6280	147	5	.	.	PUNCT
aiol-6280	148	1	gkelis	gkelis	PROPN
aiol-6280	148	2	s	s	PART
aiol-6280	148	3	,	,	PUNCT
aiol-6280	148	4	papadimitriou	papadimitriou	VERB
aiol-6280	148	5	t	t	PROPN
aiol-6280	148	6	,	,	PUNCT
aiol-6280	148	7	zaoutsos	zaoutsos	PROPN
aiol-6280	148	8	n	n	CCONJ
aiol-6280	148	9	,	,	PUNCT
aiol-6280	148	10	leonardos	leonardo	NOUN
aiol-6280	148	11	i	i	PRON
aiol-6280	148	12	,	,	PUNCT
aiol-6280	148	13	2014	2014	NUM
aiol-6280	148	14	.	.	PUNCT
aiol-6280	149	1	anthropogenic	anthropogenic	ADJ
aiol-6280	149	2	and	and	CCONJ
aiol-6280	149	3	climate	climate	NOUN
aiol-6280	149	4	-	-	PUNCT
aiol-6280	149	5	induced	induce	VERB
aiol-6280	149	6	change	change	NOUN
aiol-6280	149	7	favors	favor	VERB
aiol-6280	149	8	toxic	toxic	ADJ
aiol-6280	149	9	cyanobacteria	cyanobacteria	NOUN
aiol-6280	149	10	blooms	bloom	NOUN
aiol-6280	149	11	:	:	PUNCT
aiol-6280	149	12	evidence	evidence	NOUN
aiol-6280	149	13	from	from	ADP
aiol-6280	149	14	monitoring	monitor	VERB
aiol-6280	149	15	a	a	DET
aiol-6280	149	16	highly	highly	ADV
aiol-6280	149	17	eutrophic	eutrophic	ADJ
aiol-6280	149	18	,	,	PUNCT
aiol-6280	149	19	urban	urban	PROPN
aiol-6280	149	20	mediterranean	mediterranean	PROPN
aiol-6280	149	21	lake	lake	PROPN
aiol-6280	149	22	.	.	PUNCT
aiol-6280	150	1	harmful	harmful	ADJ
aiol-6280	150	2	algae	algae	NOUN
aiol-6280	150	3	39:322	39:322	PROPN
aiol-6280	150	4	-	-	SYM
aiol-6280	150	5	333	333	NUM
aiol-6280	150	6	.	.	PUNCT
aiol-6280	151	1	gkelis	gkelis	PROPN
aiol-6280	151	2	s	s	PROPN
aiol-6280	151	3	,	,	PUNCT
aiol-6280	151	4	zaoutsos	zaoutsos	NOUN
aiol-6280	151	5	n	n	CCONJ
aiol-6280	151	6	,	,	PUNCT
aiol-6280	151	7	2014	2014	NUM
aiol-6280	151	8	.	.	PUNCT
aiol-6280	152	1	cyanotoxin	cyanotoxin	NOUN
aiol-6280	152	2	occurrence	occurrence	NOUN
aiol-6280	152	3	and	and	CCONJ
aiol-6280	152	4	potentially	potentially	ADV
aiol-6280	152	5	toxin	toxin	NOUN
aiol-6280	152	6	producing	produce	VERB
aiol-6280	152	7	cyanobacteria	cyanobacteria	NOUN
aiol-6280	152	8	in	in	ADP
aiol-6280	152	9	freshwaters	freshwater	NOUN
aiol-6280	152	10	of	of	ADP
aiol-6280	152	11	greece	greece	PROPN
aiol-6280	152	12	:	:	PUNCT
aiol-6280	152	13	a	a	DET
aiol-6280	152	14	multi	multi	ADJ
aiol-6280	152	15	-	-	ADJ
aiol-6280	152	16	disciplinary	disciplinary	ADJ
aiol-6280	152	17	approach	approach	NOUN
aiol-6280	152	18	.	.	PUNCT
aiol-6280	153	1	toxicon	toxicon	NOUN
aiol-6280	154	1	78:1	78:1	NUM
aiol-6280	154	2	-	-	SYM
aiol-6280	154	3	9	9	NUM
aiol-6280	154	4	.	.	PUNCT
aiol-6280	155	1	hisbergues	hisbergues	PROPN
aiol-6280	155	2	m	m	PROPN
aiol-6280	155	3	,	,	PUNCT
aiol-6280	155	4	christiansen	christiansen	PROPN
aiol-6280	155	5	g	g	PROPN
aiol-6280	155	6	,	,	PUNCT
aiol-6280	155	7	rouhiainen	rouhiainen	PROPN
aiol-6280	155	8	l	l	PROPN
aiol-6280	155	9	,	,	PUNCT
aiol-6280	155	10	sivonen	sivonen	PROPN
aiol-6280	155	11	k	k	PROPN
aiol-6280	155	12	,	,	PUNCT
aiol-6280	155	13	borner	borner	PROPN
aiol-6280	155	14	t	t	PROPN
aiol-6280	155	15	,	,	PUNCT
aiol-6280	155	16	2003	2003	NUM
aiol-6280	155	17	.	.	PUNCT
aiol-6280	156	1	pcr	pcr	NOUN
aiol-6280	156	2	-	-	PUNCT
aiol-6280	156	3	based	base	VERB
aiol-6280	156	4	identification	identification	NOUN
aiol-6280	156	5	of	of	ADP
aiol-6280	156	6	microcystinproducing	microcystinproduce	VERB
aiol-6280	156	7	genotypes	genotype	NOUN
aiol-6280	156	8	of	of	ADP
aiol-6280	156	9	different	different	ADJ
aiol-6280	156	10	cyanobacterial	cyanobacterial	ADJ
aiol-6280	156	11	genera	genera	NOUN
aiol-6280	156	12	.	.	PUNCT
aiol-6280	157	1	arch	arch	PROPN
aiol-6280	157	2	.	.	PUNCT
aiol-6280	158	1	microbiol	microbiol	PROPN
aiol-6280	158	2	.	.	PUNCT
aiol-6280	159	1	180:402	180:402	NUM
aiol-6280	159	2	-	-	SYM
aiol-6280	159	3	410	410	NUM
aiol-6280	159	4	.	.	PUNCT
aiol-6280	160	1	hudnell	hudnell	PROPN
aiol-6280	160	2	kh	kh	PROPN
aiol-6280	160	3	,	,	PUNCT
aiol-6280	160	4	dortch	dortch	VERB
aiol-6280	160	5	q	q	NOUN
aiol-6280	160	6	,	,	PUNCT
aiol-6280	160	7	2008	2008	NUM
aiol-6280	160	8	.	.	PUNCT
aiol-6280	161	1	a	a	DET
aiol-6280	161	2	synopsis	synopsis	NOUN
aiol-6280	161	3	of	of	ADP
aiol-6280	161	4	research	research	NOUN
aiol-6280	161	5	needs	need	NOUN
aiol-6280	161	6	identified	identify	VERB
aiol-6280	161	7	at	at	ADP
aiol-6280	161	8	the	the	DET
aiol-6280	161	9	interagency	interagency	NOUN
aiol-6280	161	10	,	,	PUNCT
aiol-6280	161	11	international	international	ADJ
aiol-6280	161	12	symposium	symposium	NOUN
aiol-6280	161	13	on	on	ADP
aiol-6280	161	14	cyanobacterial	cyanobacterial	ADJ
aiol-6280	161	15	harmful	harmful	ADJ
aiol-6280	161	16	algal	algal	ADJ
aiol-6280	161	17	blooms	bloom	NOUN
aiol-6280	161	18	(	(	PUNCT
aiol-6280	161	19	isoc	isoc	NOUN
aiol-6280	161	20	-	-	PUNCT
aiol-6280	161	21	hab	hab	NOUN
aiol-6280	161	22	)	)	PUNCT
aiol-6280	161	23	.	.	PUNCT
aiol-6280	162	1	adv	adv	PROPN
aiol-6280	162	2	.	.	PUNCT
aiol-6280	163	1	exp	exp	PROPN
aiol-6280	163	2	.	.	PROPN
aiol-6280	163	3	med	med	PROPN
aiol-6280	163	4	.	.	PUNCT
aiol-6280	164	1	biol	biol	PROPN
aiol-6280	164	2	.	.	PUNCT
aiol-6280	165	1	619:17	619:17	NUM
aiol-6280	165	2	-	-	SYM
aiol-6280	165	3	43	43	NUM
aiol-6280	165	4	.	.	PUNCT
aiol-6280	166	1	kaloudis	kaloudis	PROPN
aiol-6280	166	2	t	t	PROPN
aiol-6280	166	3	,	,	PUNCT
aiol-6280	166	4	zervou	zervou	PROPN
aiol-6280	166	5	ks	ks	PROPN
aiol-6280	166	6	,	,	PUNCT
aiol-6280	166	7	tsimeli	tsimeli	PROPN
aiol-6280	166	8	k	k	PROPN
aiol-6280	166	9	,	,	PUNCT
aiol-6280	166	10	triantis	triantis	PROPN
aiol-6280	166	11	t	t	PROPN
aiol-6280	166	12	,	,	PUNCT
aiol-6280	166	13	fotiou	fotiou	NOUN
aiol-6280	166	14	t	t	PROPN
aiol-6280	166	15	,	,	PUNCT
aiol-6280	166	16	hiskia	hiskia	NOUN
aiol-6280	166	17	a	a	PRON
aiol-6280	166	18	,	,	PUNCT
aiol-6280	166	19	2013	2013	NUM
aiol-6280	166	20	.	.	PUNCT
aiol-6280	167	1	determination	determination	NOUN
aiol-6280	167	2	of	of	ADP
aiol-6280	167	3	microcystins	microcystin	NOUN
aiol-6280	167	4	and	and	CCONJ
aiol-6280	167	5	nodularin	nodularin	NOUN
aiol-6280	167	6	(	(	PUNCT
aiol-6280	167	7	cyanobacterial	cyanobacterial	ADJ
aiol-6280	167	8	toxins	toxin	NOUN
aiol-6280	167	9	)	)	PUNCT
aiol-6280	167	10	in	in	ADP
aiol-6280	167	11	water	water	NOUN
aiol-6280	167	12	by	by	ADP
aiol-6280	167	13	lc	lc	PROPN
aiol-6280	167	14	–	–	PUNCT
aiol-6280	167	15	ms	ms	PROPN
aiol-6280	167	16	/	/	SYM
aiol-6280	167	17	ms	ms	PROPN
aiol-6280	167	18	.	.	PROPN
aiol-6280	167	19	monitoring	monitoring	NOUN
aiol-6280	167	20	of	of	ADP
aiol-6280	167	21	lake	lake	PROPN
aiol-6280	167	22	marathonas	marathonas	PROPN
aiol-6280	167	23	,	,	PUNCT
aiol-6280	167	24	a	a	DET
aiol-6280	167	25	water	water	NOUN
aiol-6280	167	26	reservoir	reservoir	NOUN
aiol-6280	167	27	of	of	ADP
aiol-6280	167	28	athens	athens	PROPN
aiol-6280	167	29	,	,	PUNCT
aiol-6280	167	30	greece	greece	PROPN
aiol-6280	167	31	.	.	PUNCT
aiol-6280	168	1	j.	j.	PROPN
aiol-6280	168	2	hazard	hazard	PROPN
aiol-6280	168	3	.	.	PUNCT
aiol-6280	169	1	mat	mat	NOUN
aiol-6280	169	2	.	.	PUNCT
aiol-6280	170	1	263:105	263:105	NUM
aiol-6280	170	2	-	-	PUNCT
aiol-6280	170	3	115	115	NUM
aiol-6280	170	4	.	.	PUNCT
aiol-6280	171	1	komárek	komárek	PROPN
aiol-6280	171	2	j	j	PROPN
aiol-6280	171	3	,	,	PUNCT
aiol-6280	171	4	anagnostidis	anagnostidis	ADJ
aiol-6280	171	5	k	k	PROPN
aiol-6280	171	6	,	,	PUNCT
aiol-6280	171	7	1999	1999	NUM
aiol-6280	171	8	.	.	PUNCT
aiol-6280	172	1	[	[	X
aiol-6280	172	2	cyanoprokaryota	cyanoprokaryota	NOUN
aiol-6280	172	3	1	1	NUM
aiol-6280	172	4	.	.	PUNCT
aiol-6280	172	5	teil	teil	PROPN
aiol-6280	172	6	:	:	PUNCT
aiol-6280	172	7	non	non	ADJ
aiol-6280	172	8	-co	-co	PROPN
aiol-6280	172	9	mmerc	mmerc	PROPN
aiol-6280	172	10	ial	ial	PROPN
aiol-6280	172	11	us	us	PROPN
aiol-6280	172	12	e	e	NOUN
aiol-6280	172	13	o	o	NOUN
aiol-6280	172	14	nly	nly	ADV
aiol-6280	172	15	cyanobacteria	cyanobacteria	VERB
aiol-6280	172	16	in	in	ADP
aiol-6280	172	17	underground	underground	ADJ
aiol-6280	172	18	water	water	NOUN
aiol-6280	172	19	sources	source	NOUN
aiol-6280	172	20	91	91	NUM
aiol-6280	172	21	chroococcales	chroococcale	NOUN
aiol-6280	172	22	]	]	PUNCT
aiol-6280	172	23	,	,	PUNCT
aiol-6280	172	24	pp	pp	ADJ
aiol-6280	172	25	.	.	PUNCT
aiol-6280	173	1	548	548	NUM
aiol-6280	173	2	.	.	PUNCT
aiol-6280	174	1	in	in	ADP
aiol-6280	174	2	:	:	PUNCT
aiol-6280	174	3	h.	h.	PROPN
aiol-6280	174	4	ettl	ettl	PROPN
aiol-6280	174	5	,	,	PUNCT
aiol-6280	174	6	g.	g.	PROPN
aiol-6280	174	7	gärtner	gärtner	PROPN
aiol-6280	174	8	,	,	PUNCT
aiol-6280	174	9	h.	h.	PROPN
aiol-6280	174	10	heynig	heynig	PROPN
aiol-6280	174	11	,	,	PUNCT
aiol-6280	174	12	and	and	CCONJ
aiol-6280	174	13	d.	d.	PROPN
aiol-6280	174	14	mollenhauer	mollenhauer	PROPN
aiol-6280	174	15	(	(	PUNCT
aiol-6280	174	16	eds	ed	NOUN
aiol-6280	174	17	.	.	PUNCT
aiol-6280	174	18	)	)	PUNCT
aiol-6280	174	19	,	,	PUNCT
aiol-6280	175	1	[	[	X
aiol-6280	175	2	süsswasserflora	süsswasserflora	PROPN
aiol-6280	175	3	von	von	PROPN
aiol-6280	175	4	mitteleuropa	mitteleuropa	PROPN
aiol-6280	175	5	19/1].[book	19/1].[book	NUM
aiol-6280	175	6	in	in	ADP
aiol-6280	175	7	german	german	NOUN
aiol-6280	175	8	]	]	PUNCT
aiol-6280	175	9	.	.	PUNCT
aiol-6280	176	1	gustav	gustav	PROPN
aiol-6280	176	2	fischer	fischer	PROPN
aiol-6280	176	3	verlag	verlag	PROPN
aiol-6280	176	4	,	,	PUNCT
aiol-6280	176	5	jena	jena	PROPN
aiol-6280	176	6	.	.	PUNCT
aiol-6280	177	1	kormas	kormas	PROPN
aiol-6280	177	2	ka	ka	PROPN
aiol-6280	177	3	,	,	PUNCT
aiol-6280	177	4	gkelis	gkelis	PROPN
aiol-6280	177	5	s	s	PRON
aiol-6280	177	6	,	,	PUNCT
aiol-6280	177	7	vardaka	vardaka	NOUN
aiol-6280	177	8	e	e	NOUN
aiol-6280	177	9	,	,	PUNCT
aiol-6280	177	10	moustaka	moustaka	PROPN
aiol-6280	177	11	-	-	PUNCT
aiol-6280	177	12	gouni	gouni	PROPN
aiol-6280	177	13	m	m	PROPN
aiol-6280	177	14	,	,	PUNCT
aiol-6280	177	15	2011	2011	NUM
aiol-6280	177	16	.	.	PUNCT
aiol-6280	178	1	morphological	morphological	ADJ
aiol-6280	178	2	and	and	CCONJ
aiol-6280	178	3	molecular	molecular	ADJ
aiol-6280	178	4	analysis	analysis	NOUN
aiol-6280	178	5	of	of	ADP
aiol-6280	178	6	bloom	bloom	NOUN
aiol-6280	178	7	-	-	PUNCT
aiol-6280	178	8	forming	form	VERB
aiol-6280	178	9	cyanobacteria	cyanobacteria	NOUN
aiol-6280	178	10	in	in	ADP
aiol-6280	178	11	two	two	NUM
aiol-6280	178	12	eutrophic	eutrophic	NOUN
aiol-6280	178	13	,	,	PUNCT
aiol-6280	178	14	shallow	shallow	ADJ
aiol-6280	178	15	mediterranean	mediterranean	PROPN
aiol-6280	178	16	lakes	lake	NOUN
aiol-6280	178	17	.	.	PUNCT
aiol-6280	179	1	limnologica	limnologica	PROPN
aiol-6280	179	2	41:167	41:167	PROPN
aiol-6280	179	3	-	-	PUNCT
aiol-6280	179	4	173	173	PROPN
aiol-6280	179	5	.	.	PUNCT
aiol-6280	180	1	loza	loza	PROPN
aiol-6280	180	2	v	v	PROPN
aiol-6280	180	3	,	,	PUNCT
aiol-6280	180	4	perona	perona	PROPN
aiol-6280	180	5	e	e	PROPN
aiol-6280	180	6	,	,	PUNCT
aiol-6280	180	7	mateo	mateo	NOUN
aiol-6280	180	8	p	p	PRON
aiol-6280	180	9	,	,	PUNCT
aiol-6280	180	10	2013	2013	NUM
aiol-6280	180	11	.	.	PUNCT
aiol-6280	181	1	molecular	molecular	ADJ
aiol-6280	181	2	fingerprinting	fingerprinting	NOUN
aiol-6280	181	3	of	of	ADP
aiol-6280	181	4	cyanobacteria	cyanobacteria	NOUN
aiol-6280	181	5	from	from	ADP
aiol-6280	181	6	river	river	NOUN
aiol-6280	181	7	biofilms	biofilm	NOUN
aiol-6280	181	8	as	as	ADP
aiol-6280	181	9	a	a	DET
aiol-6280	181	10	water	water	NOUN
aiol-6280	181	11	quality	quality	NOUN
aiol-6280	181	12	monitoring	monitoring	NOUN
aiol-6280	181	13	tool	tool	NOUN
aiol-6280	181	14	.	.	PUNCT
aiol-6280	182	1	applied	apply	VERB
aiol-6280	182	2	environ	environ	PROPN
aiol-6280	182	3	.	.	PUNCT
aiol-6280	183	1	microbiol	microbiol	PROPN
aiol-6280	183	2	.	.	PUNCT
aiol-6280	184	1	79:1459	79:1459	NUM
aiol-6280	184	2	-	-	SYM
aiol-6280	184	3	1472	1472	NUM
aiol-6280	184	4	.	.	PUNCT
aiol-6280	185	1	neilan	neilan	PROPN
aiol-6280	185	2	ba	ba	PROPN
aiol-6280	185	3	,	,	PUNCT
aiol-6280	185	4	jacobs	jacobs	PROPN
aiol-6280	185	5	d	d	PROPN
aiol-6280	185	6	,	,	PUNCT
aiol-6280	185	7	deldot	deldot	PROPN
aiol-6280	185	8	t	t	PROPN
aiol-6280	185	9	,	,	PUNCT
aiol-6280	185	10	blackall	blackall	PROPN
aiol-6280	185	11	ll	ll	AUX
aiol-6280	185	12	,	,	PUNCT
aiol-6280	185	13	hawkins	hawkins	PROPN
aiol-6280	185	14	pr	pr	PROPN
aiol-6280	185	15	,	,	PUNCT
aiol-6280	185	16	cox	cox	PROPN
aiol-6280	185	17	pt	pt	PROPN
aiol-6280	185	18	,	,	PUNCT
aiol-6280	185	19	goodman	goodman	PROPN
aiol-6280	185	20	ae	ae	PROPN
aiol-6280	185	21	,	,	PUNCT
aiol-6280	185	22	1997	1997	NUM
aiol-6280	185	23	.	.	PUNCT
aiol-6280	186	1	rrna	rrna	PROPN
aiol-6280	186	2	sequences	sequence	NOUN
aiol-6280	186	3	and	and	CCONJ
aiol-6280	186	4	evolutionary	evolutionary	ADJ
aiol-6280	186	5	relationships	relationship	NOUN
aiol-6280	186	6	among	among	ADP
aiol-6280	186	7	toxic	toxic	ADJ
aiol-6280	186	8	and	and	CCONJ
aiol-6280	186	9	nontoxic	nontoxic	ADJ
aiol-6280	186	10	cyanobacteria	cyanobacteria	NOUN
aiol-6280	186	11	of	of	ADP
aiol-6280	186	12	the	the	DET
aiol-6280	186	13	genus	genus	ADJ
aiol-6280	186	14	microcystis	microcystis	NOUN
aiol-6280	186	15	.	.	PUNCT
aiol-6280	187	1	int	int	NOUN
aiol-6280	187	2	.	.	PUNCT
aiol-6280	188	1	j.	j.	PROPN
aiol-6280	188	2	syst	syst	PROPN
aiol-6280	188	3	.	.	PUNCT
aiol-6280	189	1	bacteriol	bacteriol	PROPN
aiol-6280	189	2	.	.	PUNCT
aiol-6280	190	1	47:693	47:693	NUM
aiol-6280	190	2	-	-	SYM
aiol-6280	190	3	697	697	NUM
aiol-6280	190	4	.	.	PUNCT
aiol-6280	191	1	paerl	paerl	PROPN
aiol-6280	191	2	hw	hw	PROPN
aiol-6280	191	3	,	,	PUNCT
aiol-6280	191	4	hall	hall	PROPN
aiol-6280	191	5	ns	ns	NOUN
aiol-6280	191	6	,	,	PUNCT
aiol-6280	191	7	calandrino	calandrino	NOUN
aiol-6280	191	8	es	es	NOUN
aiol-6280	191	9	,	,	PUNCT
aiol-6280	191	10	2011	2011	NUM
aiol-6280	191	11	.	.	PUNCT
aiol-6280	192	1	controlling	control	VERB
aiol-6280	192	2	harmful	harmful	ADJ
aiol-6280	192	3	cyanobacterial	cyanobacterial	ADJ
aiol-6280	192	4	blooms	bloom	NOUN
aiol-6280	192	5	in	in	ADP
aiol-6280	192	6	a	a	DET
aiol-6280	192	7	world	world	NOUN
aiol-6280	192	8	experiencing	experience	VERB
aiol-6280	192	9	anthropogenic	anthropogenic	ADJ
aiol-6280	192	10	and	and	CCONJ
aiol-6280	192	11	climatic	climatic	ADJ
aiol-6280	192	12	-	-	PUNCT
aiol-6280	192	13	induced	induce	VERB
aiol-6280	192	14	change	change	NOUN
aiol-6280	192	15	.	.	PUNCT
aiol-6280	193	1	sci	sci	PROPN
aiol-6280	193	2	.	.	PUNCT
aiol-6280	193	3	total	total	PROPN
aiol-6280	193	4	environ	environ	PROPN
aiol-6280	193	5	.	.	PUNCT
aiol-6280	194	1	409:1739	409:1739	NUM
aiol-6280	194	2	-	-	SYM
aiol-6280	194	3	1745	1745	NUM
aiol-6280	194	4	.	.	PUNCT
aiol-6280	195	1	paerl	paerl	PROPN
aiol-6280	195	2	hw	hw	PROPN
aiol-6280	195	3	,	,	PUNCT
aiol-6280	195	4	huisman	huisman	PROPN
aiol-6280	195	5	j	j	PROPN
aiol-6280	195	6	,	,	PUNCT
aiol-6280	195	7	2008	2008	NUM
aiol-6280	195	8	.	.	PUNCT
aiol-6280	196	1	blooms	bloom	NOUN
aiol-6280	196	2	like	like	ADP
aiol-6280	196	3	it	it	PRON
aiol-6280	196	4	hot	hot	ADJ
aiol-6280	196	5	.	.	PUNCT
aiol-6280	197	1	science	science	NOUN
aiol-6280	197	2	320	320	NUM
aiol-6280	197	3	:	:	PUNCT
aiol-6280	197	4	57	57	NUM
aiol-6280	197	5	-	-	SYM
aiol-6280	197	6	58	58	NUM
aiol-6280	197	7	.	.	PUNCT
aiol-6280	198	1	paerl	paerl	PROPN
aiol-6280	198	2	hw	hw	PROPN
aiol-6280	198	3	,	,	PUNCT
aiol-6280	198	4	otten	otten	PROPN
aiol-6280	198	5	gt	gt	PROPN
aiol-6280	198	6	,	,	PUNCT
aiol-6280	198	7	2013	2013	NUM
aiol-6280	198	8	.	.	PUNCT
aiol-6280	199	1	harmful	harmful	ADJ
aiol-6280	199	2	cyanobacterial	cyanobacterial	ADJ
aiol-6280	199	3	blooms	bloom	NOUN
aiol-6280	199	4	,	,	PUNCT
aiol-6280	199	5	causes	cause	NOUN
aiol-6280	199	6	,	,	PUNCT
aiol-6280	199	7	consequences	consequence	NOUN
aiol-6280	199	8	,	,	PUNCT
aiol-6280	199	9	and	and	CCONJ
aiol-6280	199	10	controls	control	NOUN
aiol-6280	199	11	.	.	PUNCT
aiol-6280	200	1	microb	microb	PROPN
aiol-6280	200	2	.	.	PUNCT
aiol-6280	201	1	ecol	ecol	PROPN
aiol-6280	201	2	.	.	PUNCT
aiol-6280	202	1	65	65	NUM
aiol-6280	202	2	:	:	PUNCT
aiol-6280	202	3	995	995	NUM
aiol-6280	202	4	-	-	SYM
aiol-6280	202	5	1010	1010	NUM
aiol-6280	202	6	.	.	PUNCT
aiol-6280	203	1	pazouki	pazouki	PROPN
aiol-6280	203	2	p	p	X
aiol-6280	203	3	,	,	PUNCT
aiol-6280	203	4	prévost	prévost	NUM
aiol-6280	203	5	m	m	PROPN
aiol-6280	203	6	,	,	PUNCT
aiol-6280	203	7	mcquaid	mcquaid	PROPN
aiol-6280	203	8	n	n	PROPN
aiol-6280	203	9	,	,	PUNCT
aiol-6280	203	10	barbeau	barbeau	PROPN
aiol-6280	203	11	b	b	PROPN
aiol-6280	203	12	,	,	PUNCT
aiol-6280	203	13	de	de	PROPN
aiol-6280	203	14	boutray	boutray	PROPN
aiol-6280	203	15	ml	ml	PROPN
aiol-6280	203	16	,	,	PUNCT
aiol-6280	203	17	zamyadi	zamyadi	PROPN
aiol-6280	203	18	a	a	NOUN
aiol-6280	203	19	,	,	PUNCT
aiol-6280	203	20	dorner	dorner	PROPN
aiol-6280	203	21	s	s	PROPN
aiol-6280	203	22	,	,	PUNCT
aiol-6280	203	23	2016	2016	NUM
aiol-6280	203	24	.	.	PUNCT
aiol-6280	204	1	breakthrough	breakthrough	NOUN
aiol-6280	204	2	of	of	ADP
aiol-6280	204	3	cyanobacteria	cyanobacteria	NOUN
aiol-6280	204	4	in	in	ADP
aiol-6280	204	5	bank	bank	NOUN
aiol-6280	204	6	filtration	filtration	NOUN
aiol-6280	204	7	.	.	PUNCT
aiol-6280	205	1	water	water	NOUN
aiol-6280	205	2	res	re	NOUN
aiol-6280	205	3	.	.	PUNCT
aiol-6280	206	1	102:170	102:170	NUM
aiol-6280	206	2	-	-	SYM
aiol-6280	206	3	179	179	NUM
aiol-6280	206	4	.	.	PUNCT
aiol-6280	207	1	quiblier	quiblier	NOUN
aiol-6280	207	2	c	c	NOUN
aiol-6280	207	3	,	,	PUNCT
aiol-6280	207	4	wood	wood	NOUN
aiol-6280	207	5	s	s	NOUN
aiol-6280	207	6	,	,	PUNCT
aiol-6280	207	7	echenique	echenique	ADJ
aiol-6280	207	8	-	-	PUNCT
aiol-6280	207	9	subiabre	subiabre	NOUN
aiol-6280	207	10	i	i	PROPN
aiol-6280	207	11	,	,	PUNCT
aiol-6280	207	12	heath	heath	PROPN
aiol-6280	207	13	m	m	PROPN
aiol-6280	207	14	,	,	PUNCT
aiol-6280	207	15	villeneuve	villeneuve	PROPN
aiol-6280	207	16	a	a	X
aiol-6280	207	17	,	,	PUNCT
aiol-6280	207	18	humbert	humbert	PROPN
aiol-6280	207	19	j	j	PROPN
aiol-6280	207	20	-	-	PROPN
aiol-6280	207	21	f	f	PROPN
aiol-6280	207	22	,	,	PUNCT
aiol-6280	207	23	2013	2013	NUM
aiol-6280	207	24	.	.	PUNCT
aiol-6280	208	1	a	a	DET
aiol-6280	208	2	review	review	NOUN
aiol-6280	208	3	of	of	ADP
aiol-6280	208	4	current	current	ADJ
aiol-6280	208	5	knowledge	knowledge	NOUN
aiol-6280	208	6	on	on	ADP
aiol-6280	208	7	toxic	toxic	ADJ
aiol-6280	208	8	benthic	benthic	ADJ
aiol-6280	208	9	freshwater	freshwater	NOUN
aiol-6280	208	10	cyanobacteria	cyanobacteria	NOUN
aiol-6280	208	11	-	-	PUNCT
aiol-6280	208	12	ecology	ecology	NOUN
aiol-6280	208	13	,	,	PUNCT
aiol-6280	208	14	toxin	toxin	NOUN
aiol-6280	208	15	production	production	NOUN
aiol-6280	208	16	and	and	CCONJ
aiol-6280	208	17	risk	risk	NOUN
aiol-6280	208	18	management	management	NOUN
aiol-6280	208	19	.	.	PUNCT
aiol-6280	209	1	water	water	NOUN
aiol-6280	209	2	res	re	NOUN
aiol-6280	209	3	.	.	PUNCT
aiol-6280	210	1	47:5464	47:5464	NUM
aiol-6280	210	2	-	-	SYM
aiol-6280	210	3	5479	5479	NUM
aiol-6280	210	4	.	.	PUNCT
aiol-6280	211	1	reisser	reisser	PROPN
aiol-6280	211	2	w	w	PROPN
aiol-6280	211	3	,	,	PUNCT
aiol-6280	211	4	2007	2007	NUM
aiol-6280	211	5	.	.	PUNCT
aiol-6280	212	1	the	the	DET
aiol-6280	212	2	hidden	hide	VERB
aiol-6280	212	3	life	life	NOUN
aiol-6280	212	4	of	of	ADP
aiol-6280	212	5	algae	algae	NOUN
aiol-6280	212	6	underground	underground	NOUN
aiol-6280	212	7	,	,	PUNCT
aiol-6280	212	8	p.	p.	NOUN
aiol-6280	212	9	4758	4758	NUM
aiol-6280	212	10	.	.	PUNCT
aiol-6280	213	1	in	in	ADP
aiol-6280	213	2	:	:	PUNCT
aiol-6280	213	3	j.	j.	PROPN
aiol-6280	213	4	seckbach	seckbach	PROPN
aiol-6280	213	5	(	(	PUNCT
aiol-6280	213	6	ed	ed	NOUN
aiol-6280	213	7	.	.	PUNCT
aiol-6280	213	8	)	)	PUNCT
aiol-6280	213	9	,	,	PUNCT
aiol-6280	213	10	algae	algae	NOUN
aiol-6280	213	11	and	and	CCONJ
aiol-6280	213	12	cyanobacteria	cyanobacteria	NOUN
aiol-6280	213	13	in	in	ADP
aiol-6280	213	14	extreme	extreme	ADJ
aiol-6280	213	15	environments	environment	NOUN
aiol-6280	213	16	.	.	PUNCT
aiol-6280	214	1	springer	springer	NOUN
aiol-6280	214	2	,	,	PUNCT
aiol-6280	214	3	dordrecht	dordrecht	PROPN
aiol-6280	214	4	.	.	PUNCT
aiol-6280	215	1	sivonen	sivonen	PROPN
aiol-6280	215	2	k	k	PROPN
aiol-6280	215	3	,	,	PUNCT
aiol-6280	215	4	jones	jones	PROPN
aiol-6280	215	5	g	g	PROPN
aiol-6280	215	6	,	,	PUNCT
aiol-6280	215	7	1999	1999	NUM
aiol-6280	215	8	.	.	PUNCT
aiol-6280	216	1	cyanobacterial	cyanobacterial	ADJ
aiol-6280	216	2	toxins	toxin	NOUN
aiol-6280	216	3	,	,	PUNCT
aiol-6280	216	4	p.	p.	NOUN
aiol-6280	216	5	113	113	NUM
aiol-6280	216	6	-	-	SYM
aiol-6280	216	7	153	153	NUM
aiol-6280	216	8	.	.	PUNCT
aiol-6280	217	1	in	in	ADP
aiol-6280	217	2	:	:	PUNCT
aiol-6280	217	3	i.	i.	NOUN
aiol-6280	217	4	chorus	chorus	PROPN
aiol-6280	217	5	and	and	CCONJ
aiol-6280	217	6	j.	j.	PROPN
aiol-6280	217	7	bartram	bartram	PROPN
aiol-6280	217	8	(	(	PUNCT
aiol-6280	217	9	eds	eds	PROPN
aiol-6280	217	10	.	.	PUNCT
aiol-6280	217	11	)	)	PUNCT
aiol-6280	217	12	,	,	PUNCT
aiol-6280	217	13	toxic	toxic	ADJ
aiol-6280	217	14	cyanobacteria	cyanobacteria	NOUN
aiol-6280	217	15	in	in	ADP
aiol-6280	217	16	water	water	NOUN
aiol-6280	217	17	:	:	PUNCT
aiol-6280	217	18	a	a	DET
aiol-6280	217	19	guide	guide	NOUN
aiol-6280	217	20	to	to	ADP
aiol-6280	217	21	their	their	PRON
aiol-6280	217	22	public	public	ADJ
aiol-6280	217	23	health	health	NOUN
aiol-6280	217	24	consequences	consequence	NOUN
aiol-6280	217	25	,	,	PUNCT
aiol-6280	217	26	monitoring	monitoring	NOUN
aiol-6280	217	27	and	and	CCONJ
aiol-6280	217	28	management	management	NOUN
aiol-6280	217	29	.	.	PUNCT
aiol-6280	218	1	world	world	PROPN
aiol-6280	218	2	health	health	PROPN
aiol-6280	218	3	organization	organization	PROPN
aiol-6280	218	4	,	,	PUNCT
aiol-6280	218	5	e	e	PROPN
aiol-6280	218	6	&	&	CCONJ
aiol-6280	218	7	fn	fn	PROPN
aiol-6280	218	8	spon	spon	ADV
aiol-6280	218	9	.	.	PUNCT
aiol-6280	219	1	utermöhl	utermöhl	PROPN
aiol-6280	219	2	h	h	PROPN
aiol-6280	219	3	,	,	PUNCT
aiol-6280	219	4	1958	1958	NUM
aiol-6280	219	5	.	.	PUNCT
aiol-6280	220	1	[	[	X
aiol-6280	220	2	zur	zur	X
aiol-6280	220	3	vervollkommung	vervollkommung	ADJ
aiol-6280	220	4	der	der	NOUN
aiol-6280	220	5	quantitativinen	quantitativinen	PROPN
aiol-6280	220	6	phytoplankton	phytoplankton	NOUN
aiol-6280	220	7	-	-	PUNCT
aiol-6280	220	8	methodik].[article	methodik].[article	NOUN
aiol-6280	220	9	in	in	ADP
aiol-6280	220	10	german	german	NOUN
aiol-6280	220	11	]	]	PUNCT
aiol-6280	220	12	.	.	PUNCT
aiol-6280	221	1	int	int	PROPN
aiol-6280	221	2	.	.	PUNCT
aiol-6280	222	1	ver	ver	PROPN
aiol-6280	222	2	.	.	PUNCT
aiol-6280	223	1	theor	theor	PROPN
aiol-6280	223	2	.	.	PROPN
aiol-6280	223	3	angew	angew	PROPN
aiol-6280	223	4	.	.	PUNCT
aiol-6280	224	1	limnol	limnol	NOUN
aiol-6280	224	2	.	.	PUNCT
aiol-6280	225	1	9:1	9:1	NUM
aiol-6280	225	2	-	-	SYM
aiol-6280	225	3	38	38	NUM
aiol-6280	225	4	.	.	PUNCT
aiol-6280	226	1	vasconcelos	vasconcelos	PROPN
aiol-6280	226	2	v	v	PROPN
aiol-6280	226	3	,	,	PUNCT
aiol-6280	226	4	martins	martin	VERB
aiol-6280	226	5	a	a	PRON
aiol-6280	226	6	,	,	PUNCT
aiol-6280	226	7	vale	vale	PROPN
aiol-6280	226	8	m	m	PROPN
aiol-6280	226	9	,	,	PUNCT
aiol-6280	226	10	antunes	antunes	PROPN
aiol-6280	226	11	a	a	PROPN
aiol-6280	226	12	,	,	PUNCT
aiol-6280	226	13	azevedo	azevedo	PROPN
aiol-6280	226	14	j	j	PROPN
aiol-6280	226	15	,	,	PUNCT
aiol-6280	226	16	welker	welker	PROPN
aiol-6280	226	17	m	m	PROPN
aiol-6280	226	18	,	,	PUNCT
aiol-6280	226	19	lopez	lopez	PROPN
aiol-6280	226	20	o	o	NOUN
aiol-6280	226	21	,	,	PUNCT
aiol-6280	226	22	montejano	montejano	VERB
aiol-6280	226	23	g	g	NOUN
aiol-6280	226	24	,	,	PUNCT
aiol-6280	226	25	2010	2010	NUM
aiol-6280	226	26	.	.	PUNCT
aiol-6280	227	1	first	first	ADJ
aiol-6280	227	2	report	report	NOUN
aiol-6280	227	3	on	on	ADP
aiol-6280	227	4	the	the	DET
aiol-6280	227	5	occurrence	occurrence	NOUN
aiol-6280	227	6	of	of	ADP
aiol-6280	227	7	microcystins	microcystin	NOUN
aiol-6280	227	8	in	in	ADP
aiol-6280	227	9	planktonic	planktonic	ADJ
aiol-6280	227	10	cyanobacteria	cyanobacteria	NOUN
aiol-6280	227	11	from	from	ADP
aiol-6280	227	12	central	central	PROPN
aiol-6280	227	13	mexico	mexico	PROPN
aiol-6280	227	14	.	.	PUNCT
aiol-6280	228	1	toxicon	toxicon	PROPN
aiol-6280	228	2	56:425	56:425	NUM
aiol-6280	228	3	-	-	SYM
aiol-6280	228	4	431	431	NUM
aiol-6280	228	5	.	.	PUNCT
aiol-6280	229	1	non	non	ADJ
aiol-6280	229	2	-co	-co	PROPN
aiol-6280	229	3	mmerc	mmerc	PROPN
aiol-6280	229	4	ial	ial	PROPN
aiol-6280	229	5	us	us	PROPN
aiol-6280	229	6	e	e	NOUN
aiol-6280	229	7	o	o	NOUN
aiol-6280	229	8	nly	nly	ADV