id	sid	tid	token	lemma	pos
aiol-6350	1	1	layout	layout	NOUN
aiol-6350	1	2	1	1	NUM
aiol-6350	1	3	introduction	introduction	NOUN
aiol-6350	1	4	over	over	ADP
aiol-6350	1	5	the	the	DET
aiol-6350	1	6	past	past	ADJ
aiol-6350	1	7	centuries	century	NOUN
aiol-6350	1	8	accelerated	accelerate	VERB
aiol-6350	1	9	land	land	NOUN
aiol-6350	1	10	use	use	NOUN
aiol-6350	1	11	change	change	NOUN
aiol-6350	1	12	and	and	CCONJ
aiol-6350	1	13	over	over	ADP
aiol-6350	1	14	-	-	PUNCT
aiol-6350	1	15	enrichment	enrichment	NOUN
aiol-6350	1	16	of	of	ADP
aiol-6350	1	17	nutrients	nutrient	NOUN
aiol-6350	1	18	mainly	mainly	ADV
aiol-6350	1	19	associated	associate	VERB
aiol-6350	1	20	with	with	ADP
aiol-6350	1	21	urban	urban	ADJ
aiol-6350	1	22	,	,	PUNCT
aiol-6350	1	23	agricultural	agricultural	ADJ
aiol-6350	1	24	and	and	CCONJ
aiol-6350	1	25	industrial	industrial	ADJ
aiol-6350	1	26	activities	activity	NOUN
aiol-6350	1	27	have	have	AUX
aiol-6350	1	28	promoted	promote	VERB
aiol-6350	1	29	eutrophication	eutrophication	NOUN
aiol-6350	1	30	of	of	ADP
aiol-6350	1	31	freshwater	freshwater	NOUN
aiol-6350	1	32	ecosystems	ecosystem	NOUN
aiol-6350	1	33	(	(	PUNCT
aiol-6350	1	34	chamoglou	chamoglou	NOUN
aiol-6350	1	35	et	et	PROPN
aiol-6350	1	36	al	al	PROPN
aiol-6350	1	37	.	.	PROPN
aiol-6350	1	38	,	,	PUNCT
aiol-6350	1	39	2014	2014	NUM
aiol-6350	1	40	)	)	PUNCT
aiol-6350	1	41	.	.	PUNCT
aiol-6350	2	1	recent	recent	ADJ
aiol-6350	2	2	research	research	NOUN
aiol-6350	2	3	suggests	suggest	VERB
aiol-6350	2	4	that	that	SCONJ
aiol-6350	2	5	eutrophication	eutrophication	NOUN
aiol-6350	2	6	and	and	CCONJ
aiol-6350	2	7	climate	climate	NOUN
aiol-6350	2	8	change	change	NOUN
aiol-6350	2	9	are	be	AUX
aiol-6350	2	10	two	two	NUM
aiol-6350	2	11	processes	process	NOUN
aiol-6350	2	12	that	that	PRON
aiol-6350	2	13	increase	increase	VERB
aiol-6350	2	14	rates	rate	NOUN
aiol-6350	2	15	of	of	ADP
aiol-6350	2	16	primary	primary	ADJ
aiol-6350	2	17	production	production	NOUN
aiol-6350	2	18	,	,	PUNCT
aiol-6350	2	19	shifting	shift	VERB
aiol-6350	2	20	algal	algal	ADJ
aiol-6350	2	21	community	community	NOUN
aiol-6350	2	22	towards	towards	ADP
aiol-6350	2	23	bloom	bloom	NOUN
aiol-6350	2	24	-	-	PUNCT
aiol-6350	2	25	forming	form	VERB
aiol-6350	2	26	and	and	CCONJ
aiol-6350	2	27	cyanobacterial	cyanobacterial	ADJ
aiol-6350	2	28	species	specie	NOUN
aiol-6350	2	29	(	(	PUNCT
aiol-6350	2	30	o’neil	o’neil	X
aiol-6350	2	31	et	et	PROPN
aiol-6350	2	32	al	al	PROPN
aiol-6350	2	33	.	.	PROPN
aiol-6350	2	34	,	,	PUNCT
aiol-6350	2	35	2012	2012	NUM
aiol-6350	2	36	;	;	PUNCT
aiol-6350	2	37	papadimitriou	papadimitriou	VERB
aiol-6350	2	38	et	et	PROPN
aiol-6350	2	39	al	al	PROPN
aiol-6350	2	40	.	.	PROPN
aiol-6350	2	41	,	,	PUNCT
aiol-6350	2	42	2013	2013	NUM
aiol-6350	2	43	;	;	PUNCT
aiol-6350	2	44	gkelis	gkelis	PROPN
aiol-6350	2	45	et	et	PROPN
aiol-6350	2	46	al	al	PROPN
aiol-6350	2	47	.	.	PROPN
aiol-6350	2	48	,	,	PUNCT
aiol-6350	2	49	2014	2014	NUM
aiol-6350	2	50	)	)	PUNCT
aiol-6350	2	51	.	.	PUNCT
aiol-6350	3	1	cyanobacterial	cyanobacterial	ADJ
aiol-6350	3	2	harmful	harmful	ADJ
aiol-6350	3	3	algal	algal	ADJ
aiol-6350	3	4	blooms	bloom	NOUN
aiol-6350	3	5	(	(	PUNCT
aiol-6350	3	6	or	or	CCONJ
aiol-6350	3	7	cyanohabs	cyanohab	NOUN
aiol-6350	3	8	)	)	PUNCT
aiol-6350	3	9	represent	represent	VERB
aiol-6350	3	10	one	one	NUM
aiol-6350	3	11	of	of	ADP
aiol-6350	3	12	the	the	DET
aiol-6350	3	13	most	most	ADV
aiol-6350	3	14	conspicuous	conspicuous	ADJ
aiol-6350	3	15	waterborne	waterborne	ADJ
aiol-6350	3	16	microbial	microbial	ADJ
aiol-6350	3	17	hazards	hazard	NOUN
aiol-6350	3	18	to	to	ADP
aiol-6350	3	19	human	human	ADJ
aiol-6350	3	20	and	and	CCONJ
aiol-6350	3	21	agricultural	agricultural	ADJ
aiol-6350	3	22	water	water	NOUN
aiol-6350	3	23	supplies	supply	NOUN
aiol-6350	3	24	,	,	PUNCT
aiol-6350	3	25	fisheries	fishery	NOUN
aiol-6350	3	26	production	production	NOUN
aiol-6350	3	27	,	,	PUNCT
aiol-6350	3	28	and	and	CCONJ
aiol-6350	3	29	freshwater	freshwater	NOUN
aiol-6350	3	30	and	and	CCONJ
aiol-6350	3	31	marine	marine	ADJ
aiol-6350	3	32	ecosystems	ecosystem	NOUN
aiol-6350	3	33	(	(	PUNCT
aiol-6350	3	34	codd	codd	NOUN
aiol-6350	3	35	et	et	PROPN
aiol-6350	3	36	al	al	PROPN
aiol-6350	3	37	.	.	PROPN
aiol-6350	3	38	,	,	PUNCT
aiol-6350	3	39	2005	2005	NUM
aiol-6350	3	40	;	;	PUNCT
aiol-6350	3	41	paerl	paerl	PROPN
aiol-6350	3	42	et	et	PROPN
aiol-6350	3	43	al	al	PROPN
aiol-6350	3	44	.	.	PROPN
aiol-6350	3	45	,	,	PUNCT
aiol-6350	3	46	2011	2011	NUM
aiol-6350	3	47	)	)	PUNCT
aiol-6350	3	48	.	.	PUNCT
aiol-6350	4	1	this	this	DET
aiol-6350	4	2	hazard	hazard	NOUN
aiol-6350	4	3	results	result	VERB
aiol-6350	4	4	from	from	ADP
aiol-6350	4	5	the	the	DET
aiol-6350	4	6	production	production	NOUN
aiol-6350	4	7	of	of	ADP
aiol-6350	4	8	cyanotoxins	cyanotoxin	NOUN
aiol-6350	4	9	,	,	PUNCT
aiol-6350	4	10	harmful	harmful	ADJ
aiol-6350	4	11	secondary	secondary	ADJ
aiol-6350	4	12	metabolites	metabolite	NOUN
aiol-6350	4	13	,	,	PUNCT
aiol-6350	4	14	such	such	ADJ
aiol-6350	4	15	as	as	ADP
aiol-6350	4	16	microcystins	microcystin	NOUN
aiol-6350	4	17	(	(	PUNCT
aiol-6350	4	18	mcs	mcs	NOUN
aiol-6350	4	19	)	)	PUNCT
aiol-6350	4	20	,	,	PUNCT
aiol-6350	4	21	saxitoxin	saxitoxin	PROPN
aiol-6350	4	22	(	(	PUNCT
aiol-6350	4	23	stx	stx	PROPN
aiol-6350	4	24	)	)	PUNCT
aiol-6350	4	25	,	,	PUNCT
aiol-6350	4	26	anatoxin	anatoxin	NOUN
aiol-6350	4	27	-	-	PUNCT
aiol-6350	4	28	a	a	PRON
aiol-6350	4	29	(	(	PUNCT
aiol-6350	4	30	atx	atx	NOUN
aiol-6350	4	31	-	-	PUNCT
aiol-6350	4	32	a	a	NOUN
aiol-6350	4	33	)	)	PUNCT
aiol-6350	4	34	,	,	PUNCT
aiol-6350	4	35	and	and	CCONJ
aiol-6350	4	36	cylindrospermopsins	cylindrospermopsin	NOUN
aiol-6350	4	37	(	(	PUNCT
aiol-6350	4	38	cyns	cyns	PROPN
aiol-6350	4	39	)	)	PUNCT
aiol-6350	4	40	,	,	PUNCT
aiol-6350	4	41	which	which	PRON
aiol-6350	4	42	can	can	AUX
aiol-6350	4	43	have	have	VERB
aiol-6350	4	44	deleterious	deleterious	ADJ
aiol-6350	4	45	effects	effect	NOUN
aiol-6350	4	46	within	within	ADP
aiol-6350	4	47	reservoirs	reservoir	NOUN
aiol-6350	4	48	and	and	CCONJ
aiol-6350	4	49	in	in	ADP
aiol-6350	4	50	downstream	downstream	ADJ
aiol-6350	4	51	receiving	receive	VERB
aiol-6350	4	52	water	water	NOUN
aiol-6350	4	53	systems	system	NOUN
aiol-6350	4	54	during	during	ADP
aiol-6350	4	55	releases	release	NOUN
aiol-6350	4	56	(	(	PUNCT
aiol-6350	4	57	paerl	paerl	PROPN
aiol-6350	4	58	and	and	CCONJ
aiol-6350	4	59	otten	otten	PROPN
aiol-6350	4	60	,	,	PUNCT
aiol-6350	4	61	2013	2013	NUM
aiol-6350	4	62	)	)	PUNCT
aiol-6350	4	63	and	and	CCONJ
aiol-6350	4	64	pose	pose	VERB
aiol-6350	4	65	a	a	DET
aiol-6350	4	66	threat	threat	NOUN
aiol-6350	4	67	for	for	ADP
aiol-6350	4	68	living	live	VERB
aiol-6350	4	69	organisms	organism	NOUN
aiol-6350	4	70	including	include	VERB
aiol-6350	4	71	humans	human	NOUN
aiol-6350	4	72	(	(	PUNCT
aiol-6350	4	73	testai	testai	PROPN
aiol-6350	4	74	et	et	PROPN
aiol-6350	4	75	al	al	PROPN
aiol-6350	4	76	.	.	PROPN
aiol-6350	4	77	,	,	PUNCT
aiol-6350	4	78	2016	2016	NUM
aiol-6350	4	79	)	)	PUNCT
aiol-6350	4	80	.	.	PUNCT
aiol-6350	5	1	numerous	numerous	ADJ
aiol-6350	5	2	factors	factor	NOUN
aiol-6350	5	3	such	such	ADJ
aiol-6350	5	4	as	as	ADP
aiol-6350	5	5	water	water	NOUN
aiol-6350	5	6	temperature	temperature	NOUN
aiol-6350	5	7	,	,	PUNCT
aiol-6350	5	8	light	light	ADJ
aiol-6350	5	9	attenuation	attenuation	NOUN
aiol-6350	5	10	,	,	PUNCT
aiol-6350	5	11	vertical	vertical	ADJ
aiol-6350	5	12	water	water	NOUN
aiol-6350	5	13	mixing	mixing	NOUN
aiol-6350	5	14	and	and	CCONJ
aiol-6350	5	15	turbidity	turbidity	NOUN
aiol-6350	5	16	,	,	PUNCT
aiol-6350	5	17	flushing	flush	VERB
aiol-6350	5	18	rates	rate	NOUN
aiol-6350	5	19	,	,	PUNCT
aiol-6350	5	20	residence	residence	NOUN
aiol-6350	5	21	time	time	NOUN
aiol-6350	5	22	,	,	PUNCT
aiol-6350	5	23	nutrient	nutrient	ADJ
aiol-6350	5	24	levels	level	NOUN
aiol-6350	5	25	and	and	CCONJ
aiol-6350	5	26	ratios	ratio	NOUN
aiol-6350	5	27	affect	affect	VERB
aiol-6350	5	28	phytoplankton	phytoplankton	NOUN
aiol-6350	5	29	assemblage	assemblage	NOUN
aiol-6350	5	30	and	and	CCONJ
aiol-6350	5	31	biomass	biomass	NOUN
aiol-6350	5	32	composition	composition	NOUN
aiol-6350	5	33	(	(	PUNCT
aiol-6350	5	34	i.e.	i.e.	X
aiol-6350	5	35	,	,	PUNCT
aiol-6350	5	36	n2fixing	n2fixing	NOUN
aiol-6350	5	37	vs	vs	ADP
aiol-6350	5	38	non	non	ADJ
aiol-6350	5	39	-	-	ADJ
aiol-6350	5	40	fixing	fixing	ADJ
aiol-6350	5	41	cyanobacteria	cyanobacteria	NOUN
aiol-6350	5	42	)	)	PUNCT
aiol-6350	5	43	(	(	PUNCT
aiol-6350	5	44	dokulil	dokulil	NOUN
aiol-6350	5	45	and	and	CCONJ
aiol-6350	5	46	teubner	teubner	NOUN
aiol-6350	5	47	,	,	PUNCT
aiol-6350	5	48	2000	2000	NUM
aiol-6350	5	49	;	;	PUNCT
aiol-6350	5	50	reynolds	reynolds	PROPN
aiol-6350	5	51	et	et	PROPN
aiol-6350	5	52	al	al	PROPN
aiol-6350	5	53	.	.	PROPN
aiol-6350	5	54	,	,	PUNCT
aiol-6350	5	55	2002	2002	NUM
aiol-6350	5	56	;	;	PUNCT
aiol-6350	5	57	o’neil	o’neil	PROPN
aiol-6350	5	58	et	et	PROPN
aiol-6350	5	59	al	al	PROPN
aiol-6350	5	60	.	.	PROPN
aiol-6350	5	61	,	,	PUNCT
aiol-6350	5	62	2012	2012	NUM
aiol-6350	5	63	;	;	PUNCT
aiol-6350	5	64	pearl	pearl	NOUN
aiol-6350	5	65	,	,	PUNCT
aiol-6350	5	66	2014	2014	NUM
aiol-6350	5	67	)	)	PUNCT
aiol-6350	5	68	.	.	PUNCT
aiol-6350	6	1	the	the	DET
aiol-6350	6	2	warm	warm	ADJ
aiol-6350	6	3	mediterranean	mediterranean	PROPN
aiol-6350	6	4	climate	climate	NOUN
aiol-6350	6	5	favors	favor	VERB
aiol-6350	6	6	cyanobacteria	cyanobacteria	NOUN
aiol-6350	6	7	blooms	bloom	NOUN
aiol-6350	6	8	in	in	ADP
aiol-6350	6	9	eutrophic	eutrophic	ADJ
aiol-6350	6	10	waters	water	NOUN
aiol-6350	6	11	,	,	PUNCT
aiol-6350	6	12	which	which	PRON
aiol-6350	6	13	may	may	AUX
aiol-6350	6	14	start	start	VERB
aiol-6350	6	15	in	in	ADP
aiol-6350	6	16	spring	spring	NOUN
aiol-6350	6	17	and	and	CCONJ
aiol-6350	6	18	last	last	ADJ
aiol-6350	6	19	until	until	ADP
aiol-6350	6	20	december	december	PROPN
aiol-6350	6	21	or	or	CCONJ
aiol-6350	6	22	even	even	ADV
aiol-6350	6	23	throughout	throughout	ADP
aiol-6350	6	24	the	the	DET
aiol-6350	6	25	year	year	NOUN
aiol-6350	6	26	in	in	ADP
aiol-6350	6	27	hypertrophic	hypertrophic	ADJ
aiol-6350	6	28	lakes	lake	NOUN
aiol-6350	6	29	(	(	PUNCT
aiol-6350	6	30	cook	cook	VERB
aiol-6350	6	31	et	et	PROPN
aiol-6350	6	32	al	al	PROPN
aiol-6350	6	33	.	.	PROPN
aiol-6350	6	34	,	,	PUNCT
aiol-6350	6	35	2004	2004	NUM
aiol-6350	6	36	;	;	PUNCT
aiol-6350	6	37	gkelis	gkelis	PROPN
aiol-6350	6	38	et	et	PROPN
aiol-6350	6	39	al	al	PROPN
aiol-6350	6	40	.	.	PROPN
aiol-6350	6	41	,	,	PUNCT
aiol-6350	6	42	2014	2014	NUM
aiol-6350	6	43	)	)	PUNCT
aiol-6350	6	44	.	.	PUNCT
aiol-6350	7	1	in	in	ADP
aiol-6350	7	2	greece	greece	PROPN
aiol-6350	7	3	,	,	PUNCT
aiol-6350	7	4	extensive	extensive	ADJ
aiol-6350	7	5	cyanohabs	cyanohab	NOUN
aiol-6350	7	6	dominated	dominate	VERB
aiol-6350	7	7	by	by	ADP
aiol-6350	7	8	microcystis	microcystis	PROPN
aiol-6350	7	9	,	,	PUNCT
aiol-6350	7	10	dolichospermum	dolichospermum	ADJ
aiol-6350	7	11	(	(	PUNCT
aiol-6350	7	12	anabaena	anabaena	NOUN
aiol-6350	7	13	)	)	PUNCT
aiol-6350	7	14	,	,	PUNCT
aiol-6350	7	15	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	7	16	,	,	PUNCT
aiol-6350	7	17	aphanizomenon	aphanizomenon	NOUN
aiol-6350	7	18	,	,	PUNCT
aiol-6350	7	19	planktothrix	planktothrix	VERB
aiol-6350	7	20	,	,	PUNCT
aiol-6350	7	21	and	and	CCONJ
aiol-6350	7	22	limnothrix	limnothrix	VERB
aiol-6350	7	23	species	specie	NOUN
aiol-6350	7	24	occur	occur	VERB
aiol-6350	7	25	at	at	ADP
aiol-6350	7	26	eutrophic	eutrophic	ADJ
aiol-6350	7	27	freshwaters	freshwater	NOUN
aiol-6350	7	28	,	,	PUNCT
aiol-6350	7	29	producing	produce	VERB
aiol-6350	7	30	mcs	mcs	PROPN
aiol-6350	7	31	,	,	PUNCT
aiol-6350	7	32	stx	stx	NOUN
aiol-6350	7	33	and	and	CCONJ
aiol-6350	7	34	cyn	cyn	PROPN
aiol-6350	7	35	(	(	PUNCT
aiol-6350	7	36	gkelis	gkelis	PROPN
aiol-6350	7	37	et	et	PROPN
aiol-6350	7	38	al	al	PROPN
aiol-6350	7	39	.	.	PROPN
aiol-6350	7	40	,	,	PUNCT
aiol-6350	7	41	2005	2005	NUM
aiol-6350	7	42	;	;	PUNCT
aiol-6350	7	43	2014	2014	NUM
aiol-6350	7	44	;	;	PUNCT
aiol-6350	7	45	2015	2015	NUM
aiol-6350	7	46	;	;	PUNCT
aiol-6350	7	47	gkelis	gkelis	PROPN
aiol-6350	7	48	advances	advance	NOUN
aiol-6350	7	49	in	in	ADP
aiol-6350	7	50	oceanography	oceanography	NOUN
aiol-6350	7	51	and	and	CCONJ
aiol-6350	7	52	limnology	limnology	NOUN
aiol-6350	7	53	,	,	PUNCT
aiol-6350	7	54	2017	2017	NUM
aiol-6350	7	55	;	;	PUNCT
aiol-6350	8	1	8(1	8(1	NOUN
aiol-6350	8	2	):	):	PUNCT
aiol-6350	8	3	33	33	NUM
aiol-6350	8	4	-	-	SYM
aiol-6350	8	5	51	51	NUM
aiol-6350	8	6	article	article	NOUN
aiol-6350	8	7	doi	doi	NOUN
aiol-6350	8	8	:	:	PUNCT
aiol-6350	8	9	10.4081	10.4081	NUM
aiol-6350	8	10	/	/	SYM
aiol-6350	8	11	aiol.2017.6350	aiol.2017.6350	NOUN
aiol-6350	8	12	this	this	DET
aiol-6350	8	13	work	work	NOUN
aiol-6350	8	14	is	be	AUX
aiol-6350	8	15	licensed	license	VERB
aiol-6350	8	16	under	under	ADP
aiol-6350	8	17	a	a	DET
aiol-6350	8	18	creative	creative	ADJ
aiol-6350	8	19	commons	common	NOUN
aiol-6350	8	20	attribution	attribution	NOUN
aiol-6350	8	21	-	-	PUNCT
aiol-6350	8	22	noncommercial	noncommercial	ADJ
aiol-6350	8	23	4.0	4.0	NUM
aiol-6350	8	24	international	international	ADJ
aiol-6350	8	25	license	license	NOUN
aiol-6350	8	26	(	(	PUNCT
aiol-6350	8	27	cc	cc	NOUN
aiol-6350	8	28	by	by	ADP
aiol-6350	8	29	-	-	PUNCT
aiol-6350	8	30	nc	nc	PROPN
aiol-6350	8	31	4.0	4.0	NUM
aiol-6350	8	32	)	)	PUNCT
aiol-6350	8	33	.	.	PUNCT
aiol-6350	9	1	monitoring	monitor	VERB
aiol-6350	9	2	a	a	DET
aiol-6350	9	3	newly	newly	ADV
aiol-6350	9	4	re	re	VERB
aiol-6350	9	5	-	-	VERB
aiol-6350	9	6	born	bear	VERB
aiol-6350	9	7	patient	patient	NOUN
aiol-6350	9	8	:	:	PUNCT
aiol-6350	9	9	water	water	NOUN
aiol-6350	9	10	quality	quality	NOUN
aiol-6350	9	11	and	and	CCONJ
aiol-6350	9	12	cyanotoxin	cyanotoxin	NOUN
aiol-6350	9	13	occurrence	occurrence	NOUN
aiol-6350	9	14	in	in	ADP
aiol-6350	9	15	a	a	DET
aiol-6350	9	16	reconstructed	reconstruct	VERB
aiol-6350	9	17	shallow	shallow	ADJ
aiol-6350	9	18	mediterranean	mediterranean	PROPN
aiol-6350	9	19	lake	lake	PROPN
aiol-6350	9	20	spyros	spyros	PROPN
aiol-6350	9	21	gkelis,1	gkelis,1	X
aiol-6350	9	22	*	*	PUNCT
aiol-6350	9	23	manthos	manthos	PROPN
aiol-6350	9	24	panou,1	panou,1	NOUN
aiol-6350	9	25	ioannis	ioannis	PROPN
aiol-6350	9	26	chronis,1	chronis,1	PROPN
aiol-6350	9	27	sevasti	sevasti	PROPN
aiol-6350	9	28	-	-	PUNCT
aiol-6350	9	29	kiriaki	kiriaki	NOUN
aiol-6350	9	30	zervou,2	zervou,2	NOUN
aiol-6350	9	31	christophoros	christophoro	NOUN
aiol-6350	9	32	christophoridis,2	christophoridis,2	VERB
aiol-6350	9	33	korina	korina	PROPN
aiol-6350	9	34	manolidi,2	manolidi,2	PROPN
aiol-6350	9	35	chrysoula	chrysoula	PROPN
aiol-6350	9	36	ntislidou,1	ntislidou,1	ADJ
aiol-6350	9	37	theodoros	theodoro	NOUN
aiol-6350	9	38	m.	m.	NOUN
aiol-6350	9	39	triantis,2	triantis,2	PART
aiol-6350	9	40	triantafyllos	triantafyllos	PROPN
aiol-6350	9	41	kaloudis,3	kaloudis,3	PROPN
aiol-6350	9	42	anastasia	anastasia	PROPN
aiol-6350	9	43	hiskia,2	hiskia,2	VERB
aiol-6350	9	44	ifigenia	ifigenia	PROPN
aiol-6350	9	45	kagalou,4	kagalou,4	PROPN
aiol-6350	9	46	maria	maria	PROPN
aiol-6350	9	47	lazaridou1	lazaridou1	PROPN
aiol-6350	10	1	1school	1school	NUM
aiol-6350	10	2	of	of	ADP
aiol-6350	10	3	biology	biology	NOUN
aiol-6350	10	4	,	,	PUNCT
aiol-6350	10	5	aristotle	aristotle	PROPN
aiol-6350	10	6	university	university	PROPN
aiol-6350	10	7	of	of	ADP
aiol-6350	10	8	thessaloniki	thessaloniki	PROPN
aiol-6350	10	9	,	,	PUNCT
aiol-6350	10	10	541	541	NUM
aiol-6350	10	11	24	24	NUM
aiol-6350	10	12	thessaloniki	thessaloniki	PROPN
aiol-6350	10	13	,	,	PUNCT
aiol-6350	10	14	greece	greece	PROPN
aiol-6350	10	15	;	;	PUNCT
aiol-6350	10	16	2institute	2institute	NUM
aiol-6350	10	17	of	of	ADP
aiol-6350	10	18	nanoscience	nanoscience	NOUN
aiol-6350	10	19	and	and	CCONJ
aiol-6350	10	20	nanotechnology	nanotechnology	PROPN
aiol-6350	10	21	,	,	PUNCT
aiol-6350	10	22	ncsr	ncsr	X
aiol-6350	10	23	“	"	PUNCT
aiol-6350	10	24	demokritos	demokritos	ADJ
aiol-6350	10	25	”	"	PUNCT
aiol-6350	10	26	,	,	PUNCT
aiol-6350	10	27	athens	athens	PROPN
aiol-6350	10	28	,	,	PUNCT
aiol-6350	10	29	greece	greece	PROPN
aiol-6350	10	30	;	;	PUNCT
aiol-6350	10	31	3water	3water	NUM
aiol-6350	10	32	quality	quality	NOUN
aiol-6350	10	33	department	department	NOUN
aiol-6350	10	34	,	,	PUNCT
aiol-6350	10	35	athens	athens	PROPN
aiol-6350	10	36	water	water	PROPN
aiol-6350	10	37	supply	supply	PROPN
aiol-6350	10	38	and	and	CCONJ
aiol-6350	10	39	sewerage	sewerage	NOUN
aiol-6350	10	40	company	company	NOUN
aiol-6350	10	41	,	,	PUNCT
aiol-6350	10	42	athens	athens	PROPN
aiol-6350	10	43	,	,	PUNCT
aiol-6350	10	44	greece	greece	PROPN
aiol-6350	10	45	;	;	PUNCT
aiol-6350	10	46	4management	4management	NUM
aiol-6350	10	47	body	body	NOUN
aiol-6350	10	48	of	of	ADP
aiol-6350	10	49	ecodevelopment	ecodevelopment	NOUN
aiol-6350	10	50	area	area	NOUN
aiol-6350	10	51	of	of	ADP
aiol-6350	10	52	karla	karla	PROPN
aiol-6350	10	53	,	,	PUNCT
aiol-6350	10	54	mavrovouni	mavrovouni	NOUN
aiol-6350	10	55	,	,	PUNCT
aiol-6350	10	56	kefalovriso	kefalovriso	PROPN
aiol-6350	10	57	,	,	PUNCT
aiol-6350	10	58	velestino	velestino	PROPN
aiol-6350	10	59	,	,	PUNCT
aiol-6350	10	60	stefanovikio	stefanovikio	VERB
aiol-6350	10	61	37500	37500	NUM
aiol-6350	10	62	,	,	PUNCT
aiol-6350	10	63	greece	greece	PROPN
aiol-6350	10	64	*	*	PUNCT
aiol-6350	10	65	corresponding	correspond	VERB
aiol-6350	10	66	author	author	NOUN
aiol-6350	10	67	:	:	PUNCT
aiol-6350	10	68	sgkelis@bio.auth.gr	sgkelis@bio.auth.gr	NOUN
aiol-6350	10	69	abstract	abstract	PROPN
aiol-6350	10	70	lake	lake	PROPN
aiol-6350	10	71	karla	karla	PROPN
aiol-6350	10	72	(	(	PUNCT
aiol-6350	10	73	central	central	PROPN
aiol-6350	10	74	greece	greece	PROPN
aiol-6350	10	75	)	)	PUNCT
aiol-6350	10	76	is	be	AUX
aiol-6350	10	77	a	a	DET
aiol-6350	10	78	unique	unique	ADJ
aiol-6350	10	79	example	example	NOUN
aiol-6350	10	80	at	at	ADP
aiol-6350	10	81	european	european	ADJ
aiol-6350	10	82	scale	scale	NOUN
aiol-6350	10	83	of	of	ADP
aiol-6350	10	84	a	a	DET
aiol-6350	10	85	shallow	shallow	PROPN
aiol-6350	10	86	lake	lake	NOUN
aiol-6350	10	87	ecosystem	ecosystem	PROPN
aiol-6350	10	88	that	that	PRON
aiol-6350	10	89	was	be	AUX
aiol-6350	10	90	dried	dry	VERB
aiol-6350	10	91	in	in	ADP
aiol-6350	10	92	the	the	DET
aiol-6350	10	93	1960s	1960	NOUN
aiol-6350	10	94	and	and	CCONJ
aiol-6350	10	95	in	in	ADP
aiol-6350	10	96	2009	2009	NUM
aiol-6350	10	97	started	start	VERB
aiol-6350	10	98	to	to	PART
aiol-6350	10	99	be	be	AUX
aiol-6350	10	100	restored	restore	VERB
aiol-6350	10	101	.	.	PUNCT
aiol-6350	11	1	the	the	DET
aiol-6350	11	2	lake	lake	NOUN
aiol-6350	11	3	is	be	AUX
aiol-6350	11	4	listed	list	VERB
aiol-6350	11	5	in	in	ADP
aiol-6350	11	6	the	the	DET
aiol-6350	11	7	network	network	NOUN
aiol-6350	11	8	of	of	ADP
aiol-6350	11	9	the	the	DET
aiol-6350	11	10	greek	greek	NOUN
aiol-6350	11	11	protected	protect	VERB
aiol-6350	11	12	areas	area	NOUN
aiol-6350	11	13	as	as	SCONJ
aiol-6350	11	14	it	it	PRON
aiol-6350	11	15	is	be	AUX
aiol-6350	11	16	considered	consider	VERB
aiol-6350	11	17	a	a	DET
aiol-6350	11	18	vital	vital	ADJ
aiol-6350	11	19	aquatic	aquatic	ADJ
aiol-6350	11	20	ecosystem	ecosystem	NOUN
aiol-6350	11	21	,	,	PUNCT
aiol-6350	11	22	in	in	ADP
aiol-6350	11	23	terms	term	NOUN
aiol-6350	11	24	of	of	ADP
aiol-6350	11	25	biodiversity	biodiversity	NOUN
aiol-6350	11	26	.	.	PUNCT
aiol-6350	12	1	it	it	PRON
aiol-6350	12	2	has	have	AUX
aiol-6350	12	3	,	,	PUNCT
aiol-6350	12	4	however	however	ADV
aiol-6350	12	5	,	,	PUNCT
aiol-6350	12	6	already	already	ADV
aiol-6350	12	7	been	be	AUX
aiol-6350	12	8	adversely	adversely	ADV
aiol-6350	12	9	affected	affect	VERB
aiol-6350	12	10	by	by	ADP
aiol-6350	12	11	both	both	CCONJ
aiol-6350	12	12	agricultural	agricultural	ADJ
aiol-6350	12	13	and	and	CCONJ
aiol-6350	12	14	industrial	industrial	ADJ
aiol-6350	12	15	land	land	NOUN
aiol-6350	12	16	uses	use	VERB
aiol-6350	12	17	in	in	ADP
aiol-6350	12	18	the	the	DET
aiol-6350	12	19	surrounding	surround	VERB
aiol-6350	12	20	area	area	NOUN
aiol-6350	12	21	,	,	PUNCT
aiol-6350	12	22	leading	lead	VERB
aiol-6350	12	23	to	to	ADP
aiol-6350	12	24	eutrophication	eutrophication	NOUN
aiol-6350	12	25	and	and	CCONJ
aiol-6350	12	26	shifting	shift	VERB
aiol-6350	12	27	algal	algal	ADJ
aiol-6350	12	28	community	community	NOUN
aiol-6350	12	29	towards	towards	ADP
aiol-6350	12	30	bloom	bloom	NOUN
aiol-6350	12	31	-	-	PUNCT
aiol-6350	12	32	forming	form	VERB
aiol-6350	12	33	toxic	toxic	ADJ
aiol-6350	12	34	cyanobacterial	cyanobacterial	ADJ
aiol-6350	12	35	species	specie	NOUN
aiol-6350	12	36	.	.	PUNCT
aiol-6350	13	1	after	after	ADP
aiol-6350	13	2	repeated	repeat	VERB
aiol-6350	13	3	heavyblooms	heavybloom	NOUN
aiol-6350	13	4	,	,	PUNCT
aiol-6350	13	5	cyanotoxin	cyanotoxin	NOUN
aiol-6350	13	6	occurrence	occurrence	NOUN
aiol-6350	13	7	and	and	CCONJ
aiol-6350	13	8	mass	mass	ADJ
aiol-6350	13	9	fish	fish	NOUN
aiol-6350	13	10	kills	kill	NOUN
aiol-6350	13	11	,	,	PUNCT
aiol-6350	13	12	the	the	DET
aiol-6350	13	13	local	local	ADJ
aiol-6350	13	14	ecosystem	ecosystem	NOUN
aiol-6350	13	15	management	management	NOUN
aiol-6350	13	16	authority	authority	NOUN
aiol-6350	13	17	has	have	AUX
aiol-6350	13	18	implemented	implement	VERB
aiol-6350	13	19	a	a	DET
aiol-6350	13	20	water	water	NOUN
aiol-6350	13	21	quality	quality	NOUN
aiol-6350	13	22	monitoring	monitoring	NOUN
aiol-6350	13	23	program	program	NOUN
aiol-6350	13	24	(	(	PUNCT
aiol-6350	13	25	july	july	PROPN
aiol-6350	13	26	2013	2013	NUM
aiol-6350	13	27	july	july	PROPN
aiol-6350	13	28	2015	2015	NUM
aiol-6350	13	29	)	)	PUNCT
aiol-6350	13	30	to	to	PART
aiol-6350	13	31	assess	assess	VERB
aiol-6350	13	32	environmental	environmental	ADJ
aiol-6350	13	33	pressures	pressure	NOUN
aiol-6350	13	34	and	and	CCONJ
aiol-6350	13	35	the	the	DET
aiol-6350	13	36	response	response	NOUN
aiol-6350	13	37	of	of	ADP
aiol-6350	13	38	aquatic	aquatic	ADJ
aiol-6350	13	39	biota	biota	NOUN
aiol-6350	13	40	in	in	ADP
aiol-6350	13	41	the	the	DET
aiol-6350	13	42	lake	lake	NOUN
aiol-6350	13	43	.	.	PUNCT
aiol-6350	14	1	microscopic	microscopic	ADJ
aiol-6350	14	2	,	,	PUNCT
aiol-6350	14	3	immunological	immunological	ADJ
aiol-6350	14	4	,	,	PUNCT
aiol-6350	14	5	and	and	CCONJ
aiol-6350	14	6	molecular	molecular	ADJ
aiol-6350	14	7	techniques	technique	NOUN
aiol-6350	14	8	combined	combine	VERB
aiol-6350	14	9	with	with	ADP
aiol-6350	14	10	physico	physico	NOUN
aiol-6350	14	11	-	-	PUNCT
aiol-6350	14	12	chemical	chemical	NOUN
aiol-6350	14	13	parameters	parameter	NOUN
aiol-6350	14	14	,	,	PUNCT
aiol-6350	14	15	complemented	complement	VERB
aiol-6350	14	16	by	by	ADP
aiol-6350	14	17	liquid	liquid	ADJ
aiol-6350	14	18	chromatography	chromatography	NOUN
aiol-6350	14	19	tandem	tandem	PROPN
aiol-6350	14	20	mass	mass	PROPN
aiol-6350	14	21	spectrometry	spectrometry	NOUN
aiol-6350	14	22	(	(	PUNCT
aiol-6350	14	23	lc	lc	PROPN
aiol-6350	14	24	-	-	PUNCT
aiol-6350	14	25	ms	ms	PROPN
aiol-6350	14	26	/	/	SYM
aiol-6350	14	27	ms	ms	PROPN
aiol-6350	14	28	)	)	PUNCT
aiol-6350	14	29	,	,	PUNCT
aiol-6350	14	30	were	be	AUX
aiol-6350	14	31	used	use	VERB
aiol-6350	14	32	to	to	PART
aiol-6350	14	33	monitor	monitor	VERB
aiol-6350	14	34	cyanobacteria	cyanobacteria	NOUN
aiol-6350	14	35	blooms	bloom	NOUN
aiol-6350	14	36	and	and	CCONJ
aiol-6350	14	37	the	the	DET
aiol-6350	14	38	associated	associated	ADJ
aiol-6350	14	39	cyanotoxin	cyanotoxin	NOUN
aiol-6350	14	40	production	production	NOUN
aiol-6350	14	41	from	from	ADP
aiol-6350	14	42	three	three	NUM
aiol-6350	14	43	different	different	ADJ
aiol-6350	14	44	sites	site	NOUN
aiol-6350	14	45	in	in	ADP
aiol-6350	14	46	lake	lake	PROPN
aiol-6350	14	47	karla	karla	PROPN
aiol-6350	14	48	and	and	CCONJ
aiol-6350	14	49	from	from	ADP
aiol-6350	14	50	the	the	DET
aiol-6350	14	51	adjacent	adjacent	ADJ
aiol-6350	14	52	kalamaki	kalamaki	PROPN
aiol-6350	14	53	reservoir	reservoir	PROPN
aiol-6350	14	54	.	.	PUNCT
aiol-6350	15	1	water	water	NOUN
aiol-6350	15	2	quality	quality	NOUN
aiol-6350	15	3	was	be	AUX
aiol-6350	15	4	also	also	ADV
aiol-6350	15	5	assessed	assess	VERB
aiol-6350	15	6	by	by	ADP
aiol-6350	15	7	the	the	DET
aiol-6350	15	8	structure	structure	NOUN
aiol-6350	15	9	of	of	ADP
aiol-6350	15	10	benthic	benthic	ADJ
aiol-6350	15	11	invertebrate	invertebrate	NOUN
aiol-6350	15	12	community	community	NOUN
aiol-6350	15	13	on	on	ADP
aiol-6350	15	14	the	the	DET
aiol-6350	15	15	sediment	sediment	NOUN
aiol-6350	15	16	.	.	PUNCT
aiol-6350	16	1	cyanobacteria	cyanobacteria	PROPN
aiol-6350	16	2	were	be	AUX
aiol-6350	16	3	the	the	DET
aiol-6350	16	4	main	main	ADJ
aiol-6350	16	5	phytoplankton	phytoplankton	NOUN
aiol-6350	16	6	component	component	NOUN
aiol-6350	16	7	,	,	PUNCT
aiol-6350	16	8	representing	represent	VERB
aiol-6350	16	9	more	more	ADJ
aiol-6350	16	10	than	than	ADP
aiol-6350	16	11	70	70	NUM
aiol-6350	16	12	%	%	NOUN
aiol-6350	16	13	of	of	ADP
aiol-6350	16	14	the	the	DET
aiol-6350	16	15	total	total	ADJ
aiol-6350	16	16	phytoplankton	phytoplankton	NOUN
aiol-6350	16	17	abundance	abundance	NOUN
aiol-6350	16	18	;	;	PUNCT
aiol-6350	16	19	dominant	dominant	ADJ
aiol-6350	16	20	taxa	taxa	NOUN
aiol-6350	16	21	belonged	belong	VERB
aiol-6350	16	22	to	to	PART
aiol-6350	16	23	cylindrospermopsis	cylindrospermopsis	VERB
aiol-6350	16	24	raciborskii	raciborskii	PROPN
aiol-6350	16	25	,	,	PUNCT
aiol-6350	16	26	limnothrix	limnothrix	VERB
aiol-6350	16	27	redekei	redekei	NOUN
aiol-6350	16	28	,	,	PUNCT
aiol-6350	16	29	anabaenopsis	anabaenopsis	NOUN
aiol-6350	16	30	elenkinii	elenkinii	NOUN
aiol-6350	16	31	,	,	PUNCT
aiol-6350	16	32	and	and	CCONJ
aiol-6350	16	33	microcystis	microcystis	PROPN
aiol-6350	16	34	spp	spp	NOUN
aiol-6350	16	35	.	.	PUNCT
aiol-6350	17	1	euglenophytes	euglenophyte	NOUN
aiol-6350	17	2	(	(	PUNCT
aiol-6350	17	3	euglena	euglena	ADJ
aiol-6350	17	4	)	)	PUNCT
aiol-6350	17	5	,	,	PUNCT
aiol-6350	17	6	diatoms	diatom	NOUN
aiol-6350	17	7	(	(	PUNCT
aiol-6350	17	8	nitzschia	nitzschia	ADV
aiol-6350	17	9	)	)	PUNCT
aiol-6350	17	10	,	,	PUNCT
aiol-6350	17	11	and	and	CCONJ
aiol-6350	17	12	chlorophytes	chlorophyte	NOUN
aiol-6350	17	13	(	(	PUNCT
aiol-6350	17	14	scenedesmus	scenedesmus	PROPN
aiol-6350	17	15	)	)	PUNCT
aiol-6350	17	16	were	be	AUX
aiol-6350	17	17	also	also	ADV
aiol-6350	17	18	important	important	ADJ
aiol-6350	17	19	phytoplankton	phytoplankton	NOUN
aiol-6350	17	20	constituents	constituent	NOUN
aiol-6350	17	21	.	.	PUNCT
aiol-6350	18	1	lc	lc	PROPN
aiol-6350	18	2	-	-	PUNCT
aiol-6350	18	3	ms	ms	PROPN
aiol-6350	18	4	/	/	SYM
aiol-6350	18	5	ms	ms	PROPN
aiol-6350	18	6	confirmed	confirm	VERB
aiol-6350	18	7	the	the	DET
aiol-6350	18	8	co	co	NOUN
aiol-6350	18	9	-	-	NOUN
aiol-6350	18	10	occurrence	occurrence	NOUN
aiol-6350	18	11	of	of	ADP
aiol-6350	18	12	microcystins	microcystin	NOUN
aiol-6350	18	13	,	,	PUNCT
aiol-6350	18	14	cylindrospermopsin	cylindrospermopsin	VERB
aiol-6350	18	15	,	,	PUNCT
aiol-6350	18	16	saxitoxin	saxitoxin	PROPN
aiol-6350	18	17	,	,	PUNCT
aiol-6350	18	18	neo	neo	NOUN
aiol-6350	18	19	-	-	PUNCT
aiol-6350	18	20	saxitoxin	saxitoxin	PRON
aiol-6350	18	21	and	and	CCONJ
aiol-6350	18	22	anatoxin	anatoxin	PROPN
aiol-6350	18	23	-	-	PUNCT
aiol-6350	18	24	a.	a.	NOUN
aiol-6350	18	25	the	the	DET
aiol-6350	18	26	occurrence	occurrence	NOUN
aiol-6350	18	27	of	of	ADP
aiol-6350	18	28	cyanotoxins	cyanotoxin	NOUN
aiol-6350	18	29	in	in	ADP
aiol-6350	18	30	relation	relation	NOUN
aiol-6350	18	31	to	to	ADP
aiol-6350	18	32	the	the	DET
aiol-6350	18	33	persistent	persistent	ADJ
aiol-6350	18	34	and	and	CCONJ
aiol-6350	18	35	dominant	dominant	ADJ
aiol-6350	18	36	cyanobacteria	cyanobacteria	NOUN
aiol-6350	18	37	and	and	CCONJ
aiol-6350	18	38	the	the	DET
aiol-6350	18	39	impact	impact	NOUN
aiol-6350	18	40	of	of	ADP
aiol-6350	18	41	cyanobacterial	cyanobacterial	ADJ
aiol-6350	18	42	harmful	harmful	ADJ
aiol-6350	18	43	algal	algal	ADJ
aiol-6350	18	44	blooms	bloom	NOUN
aiol-6350	18	45	on	on	ADP
aiol-6350	18	46	the	the	DET
aiol-6350	18	47	newly	newly	ADV
aiol-6350	18	48	constructed	construct	VERB
aiol-6350	18	49	lake	lake	NOUN
aiol-6350	18	50	along	along	ADP
aiol-6350	18	51	with	with	ADP
aiol-6350	18	52	the	the	DET
aiol-6350	18	53	land	land	NOUN
aiol-6350	18	54	uses	use	NOUN
aiol-6350	18	55	and	and	CCONJ
aiol-6350	18	56	the	the	DET
aiol-6350	18	57	emergent	emergent	ADJ
aiol-6350	18	58	mitigation	mitigation	NOUN
aiol-6350	18	59	measures	measure	NOUN
aiol-6350	18	60	are	be	AUX
aiol-6350	18	61	discussed	discuss	VERB
aiol-6350	18	62	.	.	PUNCT
aiol-6350	19	1	key	key	ADJ
aiol-6350	19	2	words	word	NOUN
aiol-6350	19	3	:	:	PUNCT
aiol-6350	19	4	cyanobacteria	cyanobacteria	NOUN
aiol-6350	19	5	;	;	PUNCT
aiol-6350	19	6	microcystins	microcystin	NOUN
aiol-6350	19	7	;	;	PUNCT
aiol-6350	19	8	saxitoxin	saxitoxin	NUM
aiol-6350	19	9	;	;	PUNCT
aiol-6350	19	10	anatoxin	anatoxin	NOUN
aiol-6350	19	11	-	-	PUNCT
aiol-6350	19	12	a	a	NOUN
aiol-6350	19	13	;	;	PUNCT
aiol-6350	19	14	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	19	15	;	;	PUNCT
aiol-6350	19	16	nutrient	nutrient	NOUN
aiol-6350	19	17	loads	load	NOUN
aiol-6350	19	18	.	.	PUNCT
aiol-6350	20	1	received	receive	VERB
aiol-6350	20	2	:	:	PUNCT
aiol-6350	20	3	17	17	NUM
aiol-6350	20	4	october	october	PROPN
aiol-6350	20	5	2016	2016	NUM
aiol-6350	20	6	.	.	PUNCT
aiol-6350	21	1	accepted	accept	VERB
aiol-6350	21	2	:	:	PUNCT
aiol-6350	21	3	8	8	NUM
aiol-6350	21	4	march	march	PROPN
aiol-6350	21	5	2017	2017	NUM
aiol-6350	21	6	.	.	PUNCT
aiol-6350	22	1	s.	s.	PROPN
aiol-6350	22	2	gkelis	gkelis	PROPN
aiol-6350	22	3	et	et	PROPN
aiol-6350	22	4	al.34	al.34	PROPN
aiol-6350	22	5	and	and	CCONJ
aiol-6350	22	6	zaoutsos	zaoutsos	NOUN
aiol-6350	22	7	,	,	PUNCT
aiol-6350	22	8	2014	2014	NUM
aiol-6350	22	9	)	)	PUNCT
aiol-6350	22	10	.	.	PUNCT
aiol-6350	23	1	at	at	ADP
aiol-6350	23	2	present	present	ADJ
aiol-6350	23	3	,	,	PUNCT
aiol-6350	23	4	prediction	prediction	NOUN
aiol-6350	23	5	,	,	PUNCT
aiol-6350	23	6	prevention	prevention	NOUN
aiol-6350	23	7	and	and	CCONJ
aiol-6350	23	8	successful	successful	ADJ
aiol-6350	23	9	elimination	elimination	NOUN
aiol-6350	23	10	of	of	ADP
aiol-6350	23	11	cyanobacterial	cyanobacterial	ADJ
aiol-6350	23	12	blooms	bloom	NOUN
aiol-6350	23	13	are	be	AUX
aiol-6350	23	14	still	still	ADV
aiol-6350	23	15	difficult	difficult	ADJ
aiol-6350	23	16	(	(	PUNCT
aiol-6350	23	17	pearl	pearl	NOUN
aiol-6350	23	18	,	,	PUNCT
aiol-6350	23	19	2014	2014	NUM
aiol-6350	23	20	;	;	PUNCT
aiol-6350	23	21	cirés	ciré	NOUN
aiol-6350	23	22	and	and	CCONJ
aiol-6350	23	23	ballot	ballot	NOUN
aiol-6350	23	24	,	,	PUNCT
aiol-6350	23	25	2016	2016	NUM
aiol-6350	23	26	)	)	PUNCT
aiol-6350	23	27	despite	despite	SCONJ
aiol-6350	23	28	the	the	DET
aiol-6350	23	29	extensive	extensive	ADJ
aiol-6350	23	30	studies	study	NOUN
aiol-6350	23	31	and	and	CCONJ
aiol-6350	23	32	present	present	ADJ
aiol-6350	23	33	knowledge	knowledge	NOUN
aiol-6350	23	34	on	on	ADP
aiol-6350	23	35	cyanobacteria	cyanobacteria	NOUN
aiol-6350	23	36	ecology	ecology	NOUN
aiol-6350	23	37	(	(	PUNCT
aiol-6350	23	38	dokulil	dokulil	NOUN
aiol-6350	23	39	and	and	CCONJ
aiol-6350	23	40	teubner	teubner	NOUN
aiol-6350	23	41	,	,	PUNCT
aiol-6350	23	42	2000	2000	NUM
aiol-6350	23	43	;	;	PUNCT
aiol-6350	23	44	o’neil	o’neil	PROPN
aiol-6350	23	45	et	et	PROPN
aiol-6350	23	46	al	al	PROPN
aiol-6350	23	47	.	.	PROPN
aiol-6350	23	48	,	,	PUNCT
aiol-6350	23	49	2012	2012	NUM
aiol-6350	23	50	;	;	PUNCT
aiol-6350	23	51	pearl	pearl	NOUN
aiol-6350	23	52	,	,	PUNCT
aiol-6350	23	53	2014	2014	NUM
aiol-6350	23	54	)	)	PUNCT
aiol-6350	23	55	.	.	PUNCT
aiol-6350	24	1	lake	lake	PROPN
aiol-6350	24	2	karla	karla	PROPN
aiol-6350	24	3	(	(	PUNCT
aiol-6350	24	4	central	central	PROPN
aiol-6350	24	5	greece	greece	PROPN
aiol-6350	24	6	)	)	PUNCT
aiol-6350	24	7	is	be	AUX
aiol-6350	24	8	a	a	DET
aiol-6350	24	9	unique	unique	ADJ
aiol-6350	24	10	example	example	NOUN
aiol-6350	24	11	at	at	ADP
aiol-6350	24	12	european	european	ADJ
aiol-6350	24	13	scale	scale	NOUN
aiol-6350	24	14	of	of	ADP
aiol-6350	24	15	a	a	DET
aiol-6350	24	16	shallow	shallow	PROPN
aiol-6350	24	17	lake	lake	NOUN
aiol-6350	24	18	ecosystem	ecosystem	PROPN
aiol-6350	24	19	that	that	PRON
aiol-6350	24	20	was	be	AUX
aiol-6350	24	21	dried	dry	VERB
aiol-6350	24	22	in	in	ADP
aiol-6350	24	23	1960s	1960	NOUN
aiol-6350	24	24	and	and	CCONJ
aiol-6350	24	25	is	be	AUX
aiol-6350	24	26	currently	currently	ADV
aiol-6350	24	27	undergoing	undergo	VERB
aiol-6350	24	28	its	its	PRON
aiol-6350	24	29	final	final	ADJ
aiol-6350	24	30	re	re	NOUN
aiol-6350	24	31	-	-	NOUN
aiol-6350	24	32	construction	construction	ADJ
aiol-6350	24	33	phase	phase	NOUN
aiol-6350	24	34	for	for	ADP
aiol-6350	24	35	establishing	establish	VERB
aiol-6350	24	36	a	a	DET
aiol-6350	24	37	‘	'	PUNCT
aiol-6350	24	38	new	new	ADJ
aiol-6350	24	39	’	'	PUNCT
aiol-6350	24	40	ecosystem	ecosystem	NOUN
aiol-6350	24	41	(	(	PUNCT
aiol-6350	24	42	sidiropoulos	sidiropoulo	NOUN
aiol-6350	24	43	et	et	PROPN
aiol-6350	24	44	al	al	PROPN
aiol-6350	24	45	.	.	PROPN
aiol-6350	24	46	,	,	PUNCT
aiol-6350	24	47	2012	2012	NUM
aiol-6350	24	48	)	)	PUNCT
aiol-6350	24	49	.	.	PUNCT
aiol-6350	25	1	lake	lake	PROPN
aiol-6350	25	2	karla	karla	PROPN
aiol-6350	25	3	is	be	AUX
aiol-6350	25	4	one	one	NUM
aiol-6350	25	5	of	of	ADP
aiol-6350	25	6	the	the	DET
aiol-6350	25	7	most	most	ADV
aiol-6350	25	8	important	important	ADJ
aiol-6350	25	9	environmental	environmental	ADJ
aiol-6350	25	10	projects	project	NOUN
aiol-6350	25	11	in	in	ADP
aiol-6350	25	12	the	the	DET
aiol-6350	25	13	region	region	NOUN
aiol-6350	25	14	,	,	PUNCT
aiol-6350	25	15	possibly	possibly	ADV
aiol-6350	25	16	in	in	ADP
aiol-6350	25	17	the	the	DET
aiol-6350	25	18	whole	whole	ADJ
aiol-6350	25	19	country	country	NOUN
aiol-6350	25	20	,	,	PUNCT
aiol-6350	25	21	that	that	PRON
aiol-6350	25	22	has	have	AUX
aiol-6350	25	23	been	be	AUX
aiol-6350	25	24	planned	plan	VERB
aiol-6350	25	25	to	to	PART
aiol-6350	25	26	reverse	reverse	VERB
aiol-6350	25	27	the	the	DET
aiol-6350	25	28	adverse	adverse	ADJ
aiol-6350	25	29	environmental	environmental	ADJ
aiol-6350	25	30	conditions	condition	NOUN
aiol-6350	25	31	,	,	PUNCT
aiol-6350	25	32	caused	cause	VERB
aiol-6350	25	33	by	by	ADP
aiol-6350	25	34	the	the	DET
aiol-6350	25	35	lake	lake	NOUN
aiol-6350	25	36	drainage	drainage	NOUN
aiol-6350	25	37	(	(	PUNCT
aiol-6350	25	38	loukas	loukas	INTJ
aiol-6350	25	39	et	et	PROPN
aiol-6350	25	40	al	al	PROPN
aiol-6350	25	41	.	.	PROPN
aiol-6350	25	42	,	,	PUNCT
aiol-6350	25	43	2007	2007	NUM
aiol-6350	25	44	)	)	PUNCT
aiol-6350	25	45	.	.	PUNCT
aiol-6350	26	1	its	its	PRON
aiol-6350	26	2	restoration	restoration	NOUN
aiol-6350	26	3	was	be	AUX
aiol-6350	26	4	considered	consider	VERB
aiol-6350	26	5	of	of	ADP
aiol-6350	26	6	high	high	ADJ
aiol-6350	26	7	importance	importance	NOUN
aiol-6350	26	8	by	by	ADP
aiol-6350	26	9	the	the	DET
aiol-6350	26	10	european	european	PROPN
aiol-6350	26	11	union	union	PROPN
aiol-6350	26	12	as	as	SCONJ
aiol-6350	26	13	it	it	PRON
aiol-6350	26	14	would	would	AUX
aiol-6350	26	15	offer	offer	VERB
aiol-6350	26	16	multi	multi	NOUN
aiol-6350	26	17	-	-	ADJ
aiol-6350	26	18	services	service	NOUN
aiol-6350	26	19	i.e.	i.e.	X
aiol-6350	26	20	social	social	ADJ
aiol-6350	26	21	,	,	PUNCT
aiol-6350	26	22	economic	economic	ADJ
aiol-6350	26	23	and	and	CCONJ
aiol-6350	26	24	ecological	ecological	ADJ
aiol-6350	26	25	sustainable	sustainable	ADJ
aiol-6350	26	26	development	development	NOUN
aiol-6350	26	27	to	to	ADP
aiol-6350	26	28	the	the	DET
aiol-6350	26	29	region	region	NOUN
aiol-6350	26	30	and	and	CCONJ
aiol-6350	26	31	not	not	PART
aiol-6350	26	32	just	just	ADV
aiol-6350	26	33	creating	create	VERB
aiol-6350	26	34	a	a	DET
aiol-6350	26	35	new	new	ADJ
aiol-6350	26	36	reservoir	reservoir	NOUN
aiol-6350	26	37	.	.	PUNCT
aiol-6350	27	1	lake	lake	PROPN
aiol-6350	27	2	karla	karla	PROPN
aiol-6350	27	3	is	be	AUX
aiol-6350	27	4	listed	list	VERB
aiol-6350	27	5	in	in	ADP
aiol-6350	27	6	the	the	DET
aiol-6350	27	7	network	network	NOUN
aiol-6350	27	8	of	of	ADP
aiol-6350	27	9	the	the	DET
aiol-6350	27	10	greek	greek	NOUN
aiol-6350	27	11	protected	protect	VERB
aiol-6350	27	12	areas	area	NOUN
aiol-6350	27	13	(	(	PUNCT
aiol-6350	27	14	it	it	PRON
aiol-6350	27	15	is	be	AUX
aiol-6350	27	16	a	a	DET
aiol-6350	27	17	natura	natura	NOUN
aiol-6350	27	18	site	site	NOUN
aiol-6350	27	19	(	(	PUNCT
aiol-6350	27	20	gr1420004	gr1420004	PROPN
aiol-6350	27	21	)	)	PUNCT
aiol-6350	27	22	,	,	PUNCT
aiol-6350	27	23	a	a	DET
aiol-6350	27	24	ramsar	ramsar	NOUN
aiol-6350	27	25	site	site	NOUN
aiol-6350	27	26	,	,	PUNCT
aiol-6350	27	27	and	and	CCONJ
aiol-6350	27	28	a	a	DET
aiol-6350	27	29	special	special	ADJ
aiol-6350	27	30	protected	protect	VERB
aiol-6350	27	31	area	area	NOUN
aiol-6350	27	32	site	site	NOUN
aiol-6350	27	33	for	for	ADP
aiol-6350	27	34	birds	bird	NOUN
aiol-6350	27	35	)	)	PUNCT
aiol-6350	27	36	.	.	PUNCT
aiol-6350	28	1	it	it	PRON
aiol-6350	28	2	has	have	AUX
aiol-6350	28	3	,	,	PUNCT
aiol-6350	28	4	however	however	ADV
aiol-6350	28	5	,	,	PUNCT
aiol-6350	28	6	experienced	experienced	ADJ
aiol-6350	28	7	adverse	adverse	ADJ
aiol-6350	28	8	effects	effect	NOUN
aiol-6350	28	9	already	already	ADV
aiol-6350	28	10	from	from	ADP
aiol-6350	28	11	the	the	DET
aiol-6350	28	12	first	first	ADJ
aiol-6350	28	13	year	year	NOUN
aiol-6350	28	14	of	of	ADP
aiol-6350	28	15	its	its	PRON
aiol-6350	28	16	refilling	refilling	NOUN
aiol-6350	28	17	,	,	PUNCT
aiol-6350	28	18	as	as	ADP
aiol-6350	28	19	toxinproducing	toxinproduce	VERB
aiol-6350	28	20	cyanobacterial	cyanobacterial	ADJ
aiol-6350	28	21	blooms	bloom	NOUN
aiol-6350	28	22	(	(	PUNCT
aiol-6350	28	23	oikonomou	oikonomou	ADV
aiol-6350	28	24	et	et	NOUN
aiol-6350	28	25	al	al	PROPN
aiol-6350	28	26	.	.	PROPN
aiol-6350	28	27	,	,	PUNCT
aiol-6350	28	28	2012	2012	NUM
aiol-6350	28	29	;	;	PUNCT
aiol-6350	28	30	gkelis	gkelis	PROPN
aiol-6350	28	31	and	and	CCONJ
aiol-6350	28	32	zaoutsos	zaoutsos	NOUN
aiol-6350	28	33	,	,	PUNCT
aiol-6350	28	34	2014	2014	NUM
aiol-6350	28	35	)	)	PUNCT
aiol-6350	28	36	and	and	CCONJ
aiol-6350	28	37	fish	fish	NOUN
aiol-6350	28	38	mortalities	mortality	NOUN
aiol-6350	28	39	or	or	CCONJ
aiol-6350	28	40	considerable	considerable	ADJ
aiol-6350	28	41	amounts	amount	NOUN
aiol-6350	28	42	of	of	ADP
aiol-6350	28	43	mcs	mcs	PROPN
aiol-6350	28	44	in	in	ADP
aiol-6350	28	45	fish	fish	NOUN
aiol-6350	28	46	species	specie	NOUN
aiol-6350	28	47	have	have	AUX
aiol-6350	28	48	been	be	AUX
aiol-6350	28	49	detected	detect	VERB
aiol-6350	28	50	(	(	PUNCT
aiol-6350	28	51	papadimitriou	papadimitriou	VERB
aiol-6350	28	52	et	et	PROPN
aiol-6350	28	53	al	al	PROPN
aiol-6350	28	54	.	.	PROPN
aiol-6350	28	55	,	,	PUNCT
aiol-6350	28	56	2013	2013	NUM
aiol-6350	28	57	)	)	PUNCT
aiol-6350	28	58	.	.	PUNCT
aiol-6350	29	1	in	in	ADP
aiol-6350	29	2	this	this	DET
aiol-6350	29	3	work	work	NOUN
aiol-6350	29	4	our	our	PRON
aiol-6350	29	5	goal	goal	NOUN
aiol-6350	29	6	was	be	AUX
aiol-6350	29	7	to	to	PART
aiol-6350	29	8	assess	assess	VERB
aiol-6350	29	9	the	the	DET
aiol-6350	29	10	water	water	NOUN
aiol-6350	29	11	quality	quality	NOUN
aiol-6350	29	12	in	in	ADP
aiol-6350	29	13	the	the	DET
aiol-6350	29	14	mediterranean	mediterranean	NOUN
aiol-6350	29	15	,	,	PUNCT
aiol-6350	29	16	shallow	shallow	ADJ
aiol-6350	29	17	,	,	PUNCT
aiol-6350	29	18	eutrophic	eutrophic	ADJ
aiol-6350	29	19	lake	lake	NOUN
aiol-6350	29	20	karla	karla	PROPN
aiol-6350	29	21	and	and	CCONJ
aiol-6350	29	22	the	the	DET
aiol-6350	29	23	adjacent	adjacent	ADJ
aiol-6350	29	24	kalamaki	kalamaki	PROPN
aiol-6350	29	25	reservoir	reservoir	PROPN
aiol-6350	29	26	(	(	PUNCT
aiol-6350	29	27	central	central	PROPN
aiol-6350	29	28	greece	greece	PROPN
aiol-6350	29	29	)	)	PUNCT
aiol-6350	29	30	in	in	ADP
aiol-6350	29	31	relation	relation	NOUN
aiol-6350	29	32	to	to	ADP
aiol-6350	29	33	critical	critical	ADJ
aiol-6350	29	34	environmental	environmental	ADJ
aiol-6350	29	35	parameters	parameter	NOUN
aiol-6350	29	36	using	use	VERB
aiol-6350	29	37	a	a	DET
aiol-6350	29	38	multi	multi	ADJ
aiol-6350	29	39	-	-	ADJ
aiol-6350	29	40	approach	approach	ADJ
aiol-6350	29	41	methodology	methodology	NOUN
aiol-6350	29	42	.	.	PUNCT
aiol-6350	30	1	physico	physico	NOUN
aiol-6350	30	2	-	-	PUNCT
aiol-6350	30	3	chemical	chemical	NOUN
aiol-6350	30	4	parameters	parameter	NOUN
aiol-6350	30	5	combined	combine	VERB
aiol-6350	30	6	with	with	ADP
aiol-6350	30	7	biotic	biotic	ADJ
aiol-6350	30	8	parameters	parameter	NOUN
aiol-6350	30	9	(	(	PUNCT
aiol-6350	30	10	phytoplankton	phytoplankton	NOUN
aiol-6350	30	11	and	and	CCONJ
aiol-6350	30	12	benthic	benthic	ADJ
aiol-6350	30	13	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	30	14	)	)	PUNCT
aiol-6350	30	15	,	,	PUNCT
aiol-6350	30	16	immunological	immunological	ADJ
aiol-6350	30	17	(	(	PUNCT
aiol-6350	30	18	elisa	elisa	NOUN
aiol-6350	30	19	)	)	PUNCT
aiol-6350	30	20	,	,	PUNCT
aiol-6350	30	21	analytical	analytical	ADJ
aiol-6350	30	22	(	(	PUNCT
aiol-6350	30	23	lc	lc	PROPN
aiol-6350	30	24	-	-	PUNCT
aiol-6350	30	25	ms	ms	PROPN
aiol-6350	30	26	/	/	SYM
aiol-6350	30	27	ms	ms	NOUN
aiol-6350	30	28	)	)	PUNCT
aiol-6350	30	29	and	and	CCONJ
aiol-6350	30	30	molecular	molecular	ADJ
aiol-6350	30	31	techniques	technique	NOUN
aiol-6350	30	32	(	(	PUNCT
aiol-6350	30	33	pcr	pcr	NOUN
aiol-6350	30	34	)	)	PUNCT
aiol-6350	30	35	were	be	AUX
aiol-6350	30	36	used	use	VERB
aiol-6350	30	37	to	to	PART
aiol-6350	30	38	monitor	monitor	VERB
aiol-6350	30	39	cyanobacteria	cyanobacteria	NOUN
aiol-6350	30	40	blooms	bloom	NOUN
aiol-6350	30	41	and	and	CCONJ
aiol-6350	30	42	the	the	DET
aiol-6350	30	43	associated	associated	ADJ
aiol-6350	30	44	cyanotoxin	cyanotoxin	NOUN
aiol-6350	30	45	production	production	NOUN
aiol-6350	30	46	on	on	ADP
aiol-6350	30	47	a	a	DET
aiol-6350	30	48	seasonal	seasonal	ADJ
aiol-6350	30	49	basis	basis	NOUN
aiol-6350	30	50	for	for	ADP
aiol-6350	30	51	two	two	NUM
aiol-6350	30	52	years	year	NOUN
aiol-6350	30	53	.	.	PUNCT
aiol-6350	31	1	methods	method	NOUN
aiol-6350	31	2	study	study	PROPN
aiol-6350	31	3	area	area	NOUN
aiol-6350	31	4	the	the	DET
aiol-6350	31	5	study	study	NOUN
aiol-6350	31	6	was	be	AUX
aiol-6350	31	7	conducted	conduct	VERB
aiol-6350	31	8	in	in	ADP
aiol-6350	31	9	lake	lake	PROPN
aiol-6350	31	10	karla	karla	PROPN
aiol-6350	31	11	located	locate	VERB
aiol-6350	31	12	in	in	ADP
aiol-6350	31	13	central	central	PROPN
aiol-6350	31	14	greece	greece	PROPN
aiol-6350	31	15	(	(	PUNCT
aiol-6350	31	16	39	39	NUM
aiol-6350	31	17	°	°	NUM
aiol-6350	31	18	29΄02΄΄ν	29΄02΄΄ν	NOUN
aiol-6350	31	19	,	,	PUNCT
aiol-6350	31	20	22	22	NUM
aiol-6350	31	21	°	°	NUM
aiol-6350	31	22	51΄41΄΄ε	51΄41΄΄ε	NUM
aiol-6350	31	23	)	)	PUNCT
aiol-6350	31	24	.	.	PUNCT
aiol-6350	32	1	lake	lake	PROPN
aiol-6350	32	2	karla	karla	PROPN
aiol-6350	32	3	is	be	AUX
aiol-6350	32	4	an	an	DET
aiol-6350	32	5	ancient	ancient	ADJ
aiol-6350	32	6	lake	lake	NOUN
aiol-6350	32	7	known	know	VERB
aiol-6350	32	8	from	from	ADP
aiol-6350	32	9	the	the	DET
aiol-6350	32	10	homeric	homeric	ADJ
aiol-6350	32	11	epics	epic	NOUN
aiol-6350	32	12	as	as	ADP
aiol-6350	32	13	lake	lake	PROPN
aiol-6350	32	14	boebeïs	boebeïs	PROPN
aiol-6350	32	15	(	(	PUNCT
aiol-6350	32	16	iliad	iliad	PROPN
aiol-6350	32	17	ii.715	ii.715	PROPN
aiol-6350	32	18	)	)	PUNCT
aiol-6350	32	19	,	,	PUNCT
aiol-6350	32	20	which	which	PRON
aiol-6350	32	21	was	be	AUX
aiol-6350	32	22	dried	dry	VERB
aiol-6350	32	23	up	up	ADP
aiol-6350	32	24	in	in	ADP
aiol-6350	32	25	1962	1962	NUM
aiol-6350	32	26	for	for	ADP
aiol-6350	32	27	reclaiming	reclaim	VERB
aiol-6350	32	28	agricultural	agricultural	ADJ
aiol-6350	32	29	land	land	NOUN
aiol-6350	32	30	and	and	CCONJ
aiol-6350	32	31	fight	fight	VERB
aiol-6350	32	32	floods	flood	NOUN
aiol-6350	32	33	and	and	CCONJ
aiol-6350	32	34	malaria	malaria	NOUN
aiol-6350	32	35	.	.	PUNCT
aiol-6350	33	1	its	its	PRON
aiol-6350	33	2	refilling	refilling	NOUN
aiol-6350	33	3	started	start	VERB
aiol-6350	33	4	at	at	ADP
aiol-6350	33	5	2010	2010	NUM
aiol-6350	33	6	and	and	CCONJ
aiol-6350	33	7	the	the	DET
aiol-6350	33	8	suggested	suggest	VERB
aiol-6350	33	9	plan	plan	NOUN
aiol-6350	33	10	proposed	propose	VERB
aiol-6350	33	11	the	the	DET
aiol-6350	33	12	creation	creation	NOUN
aiol-6350	33	13	of	of	ADP
aiol-6350	33	14	a	a	DET
aiol-6350	33	15	reservoir	reservoir	NOUN
aiol-6350	33	16	of	of	ADP
aiol-6350	33	17	about	about	ADV
aiol-6350	33	18	38	38	NUM
aiol-6350	33	19	km2	km2	NOUN
aiol-6350	33	20	.	.	PUNCT
aiol-6350	34	1	it	it	PRON
aiol-6350	34	2	has	have	VERB
aiol-6350	34	3	a	a	DET
aiol-6350	34	4	288	288	NUM
aiol-6350	34	5	-	-	PUNCT
aiol-6350	34	6	km	km	NOUN
aiol-6350	34	7	perimeter	perimeter	NOUN
aiol-6350	34	8	and	and	CCONJ
aiol-6350	34	9	occupies	occupy	VERB
aiol-6350	34	10	ca	ca	NOUN
aiol-6350	34	11	.	.	PROPN
aiol-6350	35	1	1/4	1/4	NUM
aiol-6350	35	2	of	of	ADP
aiol-6350	35	3	the	the	DET
aiol-6350	35	4	old	old	ADJ
aiol-6350	35	5	lake	lake	PROPN
aiol-6350	35	6	karla	karla	PROPN
aiol-6350	35	7	which	which	PRON
aiol-6350	35	8	covered	cover	VERB
aiol-6350	35	9	180	180	NUM
aiol-6350	35	10	km2	km2	NOUN
aiol-6350	35	11	.	.	PUNCT
aiol-6350	36	1	the	the	DET
aiol-6350	36	2	hydrological	hydrological	ADJ
aiol-6350	36	3	basin	basin	NOUN
aiol-6350	36	4	of	of	ADP
aiol-6350	36	5	lake	lake	PROPN
aiol-6350	36	6	karla	karla	PROPN
aiol-6350	36	7	covers	cover	VERB
aiol-6350	36	8	1660	1660	NUM
aiol-6350	36	9	km2	km2	NOUN
aiol-6350	36	10	and	and	CCONJ
aiol-6350	36	11	the	the	DET
aiol-6350	36	12	maximum	maximum	ADJ
aiol-6350	36	13	water	water	NOUN
aiol-6350	36	14	volume	volume	NOUN
aiol-6350	36	15	is	be	AUX
aiol-6350	36	16	estimated	estimate	VERB
aiol-6350	36	17	at	at	ADP
aiol-6350	36	18	184,000,000	184,000,000	NUM
aiol-6350	36	19	m3	m3	NOUN
aiol-6350	36	20	.	.	PUNCT
aiol-6350	37	1	elevation	elevation	NOUN
aiol-6350	37	2	ranges	range	VERB
aiol-6350	37	3	from	from	ADP
aiol-6350	37	4	50	50	NUM
aiol-6350	37	5	m	m	NOUN
aiol-6350	37	6	to	to	ADP
aiol-6350	37	7	more	more	ADJ
aiol-6350	37	8	than	than	ADP
aiol-6350	37	9	2000	2000	NUM
aiol-6350	37	10	m	m	NOUN
aiol-6350	37	11	,	,	PUNCT
aiol-6350	37	12	and	and	CCONJ
aiol-6350	37	13	the	the	DET
aiol-6350	37	14	mean	mean	ADJ
aiol-6350	37	15	elevation	elevation	NOUN
aiol-6350	37	16	of	of	ADP
aiol-6350	37	17	the	the	DET
aiol-6350	37	18	region	region	NOUN
aiol-6350	37	19	is	be	AUX
aiol-6350	37	20	about	about	ADV
aiol-6350	37	21	230	230	NUM
aiol-6350	37	22	m.	m.	NOUN
aiol-6350	37	23	it	it	PRON
aiol-6350	37	24	is	be	AUX
aiol-6350	37	25	a	a	DET
aiol-6350	37	26	shallow	shallow	ADJ
aiol-6350	37	27	lake	lake	NOUN
aiol-6350	37	28	with	with	ADP
aiol-6350	37	29	a	a	DET
aiol-6350	37	30	current	current	ADJ
aiol-6350	37	31	(	(	PUNCT
aiol-6350	37	32	2013	2013	NUM
aiol-6350	37	33	-	-	SYM
aiol-6350	37	34	2015	2015	NUM
aiol-6350	37	35	)	)	PUNCT
aiol-6350	37	36	maximum	maximum	ADJ
aiol-6350	37	37	water	water	NOUN
aiol-6350	37	38	depth	depth	NOUN
aiol-6350	37	39	of	of	ADP
aiol-6350	37	40	1	1	NUM
aiol-6350	37	41	-	-	SYM
aiol-6350	37	42	1.5	1.5	NUM
aiol-6350	37	43	m.	m.	NOUN
aiol-6350	37	44	the	the	DET
aiol-6350	37	45	hydrological	hydrological	ADJ
aiol-6350	37	46	regime	regime	NOUN
aiol-6350	37	47	of	of	ADP
aiol-6350	37	48	the	the	DET
aiol-6350	37	49	lake	lake	NOUN
aiol-6350	37	50	is	be	AUX
aiol-6350	37	51	determined	determine	VERB
aiol-6350	37	52	by	by	ADP
aiol-6350	37	53	inputs	input	NOUN
aiol-6350	37	54	(	(	PUNCT
aiol-6350	37	55	rainfall	rainfall	NOUN
aiol-6350	37	56	on	on	ADP
aiol-6350	37	57	the	the	DET
aiol-6350	37	58	lake	lake	NOUN
aiol-6350	37	59	and	and	CCONJ
aiol-6350	37	60	tributary	tributary	NOUN
aiol-6350	37	61	inflows	inflow	NOUN
aiol-6350	37	62	)	)	PUNCT
aiol-6350	37	63	and	and	CCONJ
aiol-6350	37	64	the	the	DET
aiol-6350	37	65	outputs	output	NOUN
aiol-6350	37	66	(	(	PUNCT
aiol-6350	37	67	evaporation	evaporation	NOUN
aiol-6350	37	68	)	)	PUNCT
aiol-6350	37	69	.	.	PUNCT
aiol-6350	38	1	at	at	ADP
aiol-6350	38	2	present	present	ADJ
aiol-6350	38	3	,	,	PUNCT
aiol-6350	38	4	the	the	DET
aiol-6350	38	5	main	main	ADJ
aiol-6350	38	6	water	water	NOUN
aiol-6350	38	7	source	source	NOUN
aiol-6350	38	8	for	for	ADP
aiol-6350	38	9	lake	lake	PROPN
aiol-6350	38	10	karla	karla	PROPN
aiol-6350	38	11	is	be	AUX
aiol-6350	38	12	pinios	pinio	NOUN
aiol-6350	38	13	river	river	NOUN
aiol-6350	38	14	.	.	PUNCT
aiol-6350	39	1	according	accord	VERB
aiol-6350	39	2	to	to	ADP
aiol-6350	39	3	the	the	DET
aiol-6350	39	4	revised	revise	VERB
aiol-6350	39	5	restoration	restoration	NOUN
aiol-6350	39	6	plan	plan	NOUN
aiol-6350	39	7	,	,	PUNCT
aiol-6350	39	8	two	two	NUM
aiol-6350	39	9	main	main	ADJ
aiol-6350	39	10	ditches	ditch	NOUN
aiol-6350	39	11	transfer	transfer	VERB
aiol-6350	39	12	the	the	DET
aiol-6350	39	13	flood	flood	NOUN
aiol-6350	39	14	runoff	runoff	NOUN
aiol-6350	39	15	of	of	ADP
aiol-6350	39	16	pinios	pinio	NOUN
aiol-6350	39	17	river	river	PROPN
aiol-6350	39	18	to	to	ADP
aiol-6350	39	19	the	the	DET
aiol-6350	39	20	reservoir	reservoir	NOUN
aiol-6350	39	21	,	,	PUNCT
aiol-6350	39	22	as	as	SCONJ
aiol-6350	39	23	it	it	PRON
aiol-6350	39	24	is	be	AUX
aiol-6350	39	25	located	locate	VERB
aiol-6350	39	26	in	in	ADP
aiol-6350	39	27	the	the	DET
aiol-6350	39	28	lower	low	ADJ
aiol-6350	39	29	part	part	NOUN
aiol-6350	39	30	of	of	ADP
aiol-6350	39	31	karla	karla	NOUN
aiol-6350	39	32	basin	basin	PROPN
aiol-6350	39	33	simulating	simulate	VERB
aiol-6350	39	34	the	the	DET
aiol-6350	39	35	pre	pre	ADJ
aiol-6350	39	36	-	-	ADJ
aiol-6350	39	37	disturbance	disturbance	ADJ
aiol-6350	39	38	conditions	condition	NOUN
aiol-6350	39	39	.	.	PUNCT
aiol-6350	40	1	also	also	ADV
aiol-6350	40	2	,	,	PUNCT
aiol-6350	40	3	four	four	NUM
aiol-6350	40	4	collector	collector	NOUN
aiol-6350	40	5	channels	channel	NOUN
aiol-6350	40	6	concentrate	concentrate	VERB
aiol-6350	40	7	the	the	DET
aiol-6350	40	8	surface	surface	NOUN
aiol-6350	40	9	runoff	runoff	NOUN
aiol-6350	40	10	from	from	ADP
aiol-6350	40	11	the	the	DET
aiol-6350	40	12	higher	high	ADJ
aiol-6350	40	13	elevation	elevation	NOUN
aiol-6350	40	14	zones	zone	NOUN
aiol-6350	40	15	of	of	ADP
aiol-6350	40	16	the	the	DET
aiol-6350	40	17	watershed	watershed	NOUN
aiol-6350	40	18	and	and	CCONJ
aiol-6350	40	19	directly	directly	ADV
aiol-6350	40	20	divert	divert	VERB
aiol-6350	40	21	it	it	PRON
aiol-6350	40	22	into	into	ADP
aiol-6350	40	23	the	the	DET
aiol-6350	40	24	reservoir	reservoir	NOUN
aiol-6350	40	25	.	.	PUNCT
aiol-6350	41	1	the	the	DET
aiol-6350	41	2	surface	surface	NOUN
aiol-6350	41	3	runoff	runoff	NOUN
aiol-6350	41	4	of	of	ADP
aiol-6350	41	5	the	the	DET
aiol-6350	41	6	lower	low	ADJ
aiol-6350	41	7	elevation	elevation	NOUN
aiol-6350	41	8	areas	area	NOUN
aiol-6350	41	9	will	will	AUX
aiol-6350	41	10	be	be	AUX
aiol-6350	41	11	pumped	pump	VERB
aiol-6350	41	12	into	into	ADP
aiol-6350	41	13	the	the	DET
aiol-6350	41	14	reservoir	reservoir	NOUN
aiol-6350	41	15	.	.	PUNCT
aiol-6350	42	1	so	so	ADV
aiol-6350	42	2	,	,	PUNCT
aiol-6350	42	3	the	the	DET
aiol-6350	42	4	maximum	maximum	ADJ
aiol-6350	42	5	allowable	allowable	ADJ
aiol-6350	42	6	volume	volume	NOUN
aiol-6350	42	7	of	of	ADP
aiol-6350	42	8	the	the	DET
aiol-6350	42	9	reservoir	reservoir	NOUN
aiol-6350	42	10	will	will	AUX
aiol-6350	42	11	reach	reach	VERB
aiol-6350	42	12	up	up	ADP
aiol-6350	42	13	to	to	PART
aiol-6350	42	14	180	180	NUM
aiol-6350	42	15	hm3	hm3	NOUN
aiol-6350	42	16	,	,	PUNCT
aiol-6350	42	17	but	but	CCONJ
aiol-6350	42	18	only	only	ADV
aiol-6350	42	19	the	the	DET
aiol-6350	42	20	60	60	NUM
aiol-6350	42	21	hm3	hm3	NOUN
aiol-6350	42	22	will	will	AUX
aiol-6350	42	23	be	be	AUX
aiol-6350	42	24	available	available	ADJ
aiol-6350	42	25	to	to	PART
aiol-6350	42	26	fulfill	fulfill	VERB
aiol-6350	42	27	irrigation	irrigation	NOUN
aiol-6350	42	28	needs	need	NOUN
aiol-6350	42	29	of	of	ADP
aiol-6350	42	30	the	the	DET
aiol-6350	42	31	surrounding	surround	VERB
aiol-6350	42	32	agricultures	agriculture	NOUN
aiol-6350	42	33	because	because	SCONJ
aiol-6350	42	34	of	of	ADP
aiol-6350	42	35	the	the	DET
aiol-6350	42	36	environmental	environmental	ADJ
aiol-6350	42	37	restraints	restraint	NOUN
aiol-6350	42	38	,	,	PUNCT
aiol-6350	42	39	as	as	SCONJ
aiol-6350	42	40	the	the	DET
aiol-6350	42	41	primary	primary	ADJ
aiol-6350	42	42	service	service	NOUN
aiol-6350	42	43	of	of	ADP
aiol-6350	42	44	the	the	DET
aiol-6350	42	45	reservoir	reservoir	NOUN
aiol-6350	42	46	will	will	AUX
aiol-6350	42	47	be	be	AUX
aiol-6350	42	48	the	the	DET
aiol-6350	42	49	establishment	establishment	NOUN
aiol-6350	42	50	of	of	ADP
aiol-6350	42	51	a	a	DET
aiol-6350	42	52	new	new	ADJ
aiol-6350	42	53	wetland	wetland	NOUN
aiol-6350	42	54	.	.	PUNCT
aiol-6350	43	1	the	the	DET
aiol-6350	43	2	lake	lake	NOUN
aiol-6350	43	3	also	also	ADV
aiol-6350	43	4	receives	receive	VERB
aiol-6350	43	5	the	the	DET
aiol-6350	43	6	surface	surface	NOUN
aiol-6350	43	7	runoff	runoff	NOUN
aiol-6350	43	8	from	from	ADP
aiol-6350	43	9	the	the	DET
aiol-6350	43	10	surrounding	surround	VERB
aiol-6350	43	11	area	area	NOUN
aiol-6350	43	12	which	which	PRON
aiol-6350	43	13	is	be	AUX
aiol-6350	43	14	mainly	mainly	ADV
aiol-6350	43	15	agricultural	agricultural	ADJ
aiol-6350	43	16	and	and	CCONJ
aiol-6350	43	17	stockbreeding	stockbreede	VERB
aiol-6350	43	18	and	and	CCONJ
aiol-6350	43	19	the	the	DET
aiol-6350	43	20	inflows	inflow	NOUN
aiol-6350	43	21	of	of	ADP
aiol-6350	43	22	perennial	perennial	ADJ
aiol-6350	43	23	streams	stream	NOUN
aiol-6350	43	24	that	that	PRON
aiol-6350	43	25	drain	drain	NOUN
aiol-6350	43	26	from	from	ADP
aiol-6350	43	27	the	the	DET
aiol-6350	43	28	surrounding	surround	VERB
aiol-6350	43	29	mountainous	mountainous	ADJ
aiol-6350	43	30	land	land	NOUN
aiol-6350	43	31	(	(	PUNCT
aiol-6350	43	32	sidiropoulos	sidiropoulo	NOUN
aiol-6350	43	33	et	et	PROPN
aiol-6350	43	34	al	al	PROPN
aiol-6350	43	35	.	.	PROPN
aiol-6350	43	36	,	,	PUNCT
aiol-6350	43	37	2012	2012	NUM
aiol-6350	43	38	)	)	PUNCT
aiol-6350	43	39	.	.	PUNCT
aiol-6350	44	1	the	the	DET
aiol-6350	44	2	lake	lake	NOUN
aiol-6350	44	3	has	have	VERB
aiol-6350	44	4	no	no	DET
aiol-6350	44	5	natural	natural	ADJ
aiol-6350	44	6	outflow	outflow	NOUN
aiol-6350	44	7	and	and	CCONJ
aiol-6350	44	8	the	the	DET
aiol-6350	44	9	constructed	construct	VERB
aiol-6350	44	10	channel	channel	NOUN
aiol-6350	44	11	draining	drain	VERB
aiol-6350	44	12	to	to	ADP
aiol-6350	44	13	the	the	DET
aiol-6350	44	14	adjacent	adjacent	ADJ
aiol-6350	44	15	pagasitikos	pagasitikos	PROPN
aiol-6350	44	16	bay	bay	PROPN
aiol-6350	44	17	is	be	AUX
aiol-6350	44	18	closed	close	VERB
aiol-6350	44	19	for	for	ADP
aiol-6350	44	20	the	the	DET
aiol-6350	44	21	present	present	NOUN
aiol-6350	44	22	.	.	PUNCT
aiol-6350	45	1	kalamaki	kalamaki	PROPN
aiol-6350	45	2	is	be	AUX
aiol-6350	45	3	the	the	DET
aiol-6350	45	4	oldest	old	ADJ
aiol-6350	45	5	and	and	CCONJ
aiol-6350	45	6	the	the	DET
aiol-6350	45	7	largest	large	ADJ
aiol-6350	45	8	reservoir	reservoir	NOUN
aiol-6350	45	9	in	in	ADP
aiol-6350	45	10	the	the	DET
aiol-6350	45	11	basin	basin	NOUN
aiol-6350	45	12	of	of	ADP
aiol-6350	45	13	lake	lake	PROPN
aiol-6350	45	14	karla	karla	PROPN
aiol-6350	45	15	.	.	PUNCT
aiol-6350	46	1	today	today	NOUN
aiol-6350	46	2	’s	’s	PART
aiol-6350	46	3	purpose	purpose	NOUN
aiol-6350	46	4	of	of	ADP
aiol-6350	46	5	kalamaki	kalamaki	PROPN
aiol-6350	46	6	reservoir	reservoir	PROPN
aiol-6350	46	7	is	be	AUX
aiol-6350	46	8	to	to	PART
aiol-6350	46	9	keep	keep	VERB
aiol-6350	46	10	water	water	NOUN
aiol-6350	46	11	for	for	ADP
aiol-6350	46	12	irrigation	irrigation	NOUN
aiol-6350	46	13	of	of	ADP
aiol-6350	46	14	the	the	DET
aiol-6350	46	15	surrounding	surround	VERB
aiol-6350	46	16	agricultural	agricultural	ADJ
aiol-6350	46	17	area	area	NOUN
aiol-6350	46	18	.	.	PUNCT
aiol-6350	47	1	this	this	DET
aiol-6350	47	2	reservoir	reservoir	NOUN
aiol-6350	47	3	is	be	AUX
aiol-6350	47	4	not	not	PART
aiol-6350	47	5	included	include	VERB
aiol-6350	47	6	in	in	ADP
aiol-6350	47	7	national	national	ADJ
aiol-6350	47	8	monitoring	monitoring	NOUN
aiol-6350	47	9	program	program	NOUN
aiol-6350	47	10	(	(	PUNCT
aiol-6350	47	11	egy	egy	PROPN
aiol-6350	47	12	,	,	PUNCT
aiol-6350	47	13	2013	2013	NUM
aiol-6350	47	14	)	)	PUNCT
aiol-6350	47	15	and	and	CCONJ
aiol-6350	47	16	it	it	PRON
aiol-6350	47	17	is	be	AUX
aiol-6350	47	18	not	not	PART
aiol-6350	47	19	characterised	characterise	VERB
aiol-6350	47	20	as	as	ADP
aiol-6350	47	21	water	water	NOUN
aiol-6350	47	22	body	body	NOUN
aiol-6350	47	23	in	in	ADP
aiol-6350	47	24	the	the	DET
aiol-6350	47	25	national	national	ADJ
aiol-6350	47	26	inventory	inventory	NOUN
aiol-6350	47	27	.	.	PUNCT
aiol-6350	48	1	however	however	ADV
aiol-6350	48	2	,	,	PUNCT
aiol-6350	48	3	it	it	PRON
aiol-6350	48	4	is	be	AUX
aiol-6350	48	5	connected	connect	VERB
aiol-6350	48	6	with	with	ADP
aiol-6350	48	7	lake	lake	PROPN
aiol-6350	48	8	karla	karla	PROPN
aiol-6350	48	9	with	with	ADP
aiol-6350	48	10	a	a	DET
aiol-6350	48	11	complex	complex	ADJ
aiol-6350	48	12	irrigation	irrigation	NOUN
aiol-6350	48	13	and	and	CCONJ
aiol-6350	48	14	drainage	drainage	NOUN
aiol-6350	48	15	network	network	NOUN
aiol-6350	48	16	and	and	CCONJ
aiol-6350	48	17	therefore	therefore	ADV
aiol-6350	48	18	directly	directly	ADV
aiol-6350	48	19	affects	affect	VERB
aiol-6350	48	20	the	the	DET
aiol-6350	48	21	physico	physico	NOUN
aiol-6350	48	22	-	-	PUNCT
aiol-6350	48	23	chemical	chemical	ADJ
aiol-6350	48	24	and	and	CCONJ
aiol-6350	48	25	biological	biological	ADJ
aiol-6350	48	26	quality	quality	NOUN
aiol-6350	48	27	of	of	ADP
aiol-6350	48	28	karla	karla	NOUN
aiol-6350	48	29	’s	’s	PART
aiol-6350	48	30	basin	basin	NOUN
aiol-6350	48	31	because	because	SCONJ
aiol-6350	48	32	the	the	DET
aiol-6350	48	33	water	water	NOUN
aiol-6350	48	34	that	that	PRON
aiol-6350	48	35	circulates	circulate	VERB
aiol-6350	48	36	in	in	ADP
aiol-6350	48	37	the	the	DET
aiol-6350	48	38	basin	basin	NOUN
aiol-6350	48	39	,	,	PUNCT
aiol-6350	48	40	remains	remain	VERB
aiol-6350	48	41	for	for	ADP
aiol-6350	48	42	a	a	DET
aiol-6350	48	43	long	long	ADJ
aiol-6350	48	44	time	time	NOUN
aiol-6350	48	45	in	in	ADP
aiol-6350	48	46	kalamaki	kalamaki	PROPN
aiol-6350	48	47	reservoir	reservoir	PROPN
aiol-6350	48	48	.	.	PUNCT
aiol-6350	49	1	sample	sample	NOUN
aiol-6350	49	2	collection	collection	NOUN
aiol-6350	49	3	,	,	PUNCT
aiol-6350	49	4	preparation	preparation	NOUN
aiol-6350	49	5	and	and	CCONJ
aiol-6350	49	6	chemical	chemical	NOUN
aiol-6350	49	7	analysis	analysis	NOUN
aiol-6350	49	8	sampling	sample	VERB
aiol-6350	49	9	was	be	AUX
aiol-6350	49	10	taking	take	VERB
aiol-6350	49	11	place	place	NOUN
aiol-6350	49	12	bimonthly	bimonthly	ADV
aiol-6350	49	13	for	for	ADP
aiol-6350	49	14	the	the	DET
aiol-6350	49	15	warm	warm	ADJ
aiol-6350	49	16	period	period	NOUN
aiol-6350	49	17	of	of	ADP
aiol-6350	49	18	the	the	DET
aiol-6350	49	19	year	year	NOUN
aiol-6350	49	20	(	(	PUNCT
aiol-6350	49	21	may	may	AUX
aiol-6350	49	22	-	-	PUNCT
aiol-6350	49	23	september	september	PROPN
aiol-6350	49	24	)	)	PUNCT
aiol-6350	49	25	and	and	CCONJ
aiol-6350	49	26	seasonally	seasonally	ADV
aiol-6350	49	27	for	for	ADP
aiol-6350	49	28	the	the	DET
aiol-6350	49	29	cold	cold	ADJ
aiol-6350	49	30	period	period	NOUN
aiol-6350	49	31	(	(	PUNCT
aiol-6350	49	32	november	november	PROPN
aiol-6350	49	33	-	-	PUNCT
aiol-6350	49	34	may	may	PROPN
aiol-6350	49	35	)	)	PUNCT
aiol-6350	49	36	during	during	ADP
aiol-6350	49	37	a	a	DET
aiol-6350	49	38	two	two	NUM
aiol-6350	49	39	-	-	PUNCT
aiol-6350	49	40	year	year	NOUN
aiol-6350	49	41	survey	survey	NOUN
aiol-6350	49	42	(	(	PUNCT
aiol-6350	49	43	july	july	PROPN
aiol-6350	49	44	2013	2013	NUM
aiol-6350	49	45	-	-	PUNCT
aiol-6350	49	46	july	july	PROPN
aiol-6350	49	47	2015	2015	NUM
aiol-6350	49	48	)	)	PUNCT
aiol-6350	49	49	.	.	PUNCT
aiol-6350	50	1	water	water	NOUN
aiol-6350	50	2	samples	sample	NOUN
aiol-6350	50	3	were	be	AUX
aiol-6350	50	4	collected	collect	VERB
aiol-6350	50	5	from	from	ADP
aiol-6350	50	6	the	the	DET
aiol-6350	50	7	whole	whole	ADJ
aiol-6350	50	8	water	water	NOUN
aiol-6350	50	9	column	column	NOUN
aiol-6350	50	10	from	from	ADP
aiol-6350	50	11	three	three	NUM
aiol-6350	50	12	sampling	sample	VERB
aiol-6350	50	13	stations	station	NOUN
aiol-6350	50	14	in	in	ADP
aiol-6350	50	15	lake	lake	PROPN
aiol-6350	50	16	karla	karla	PROPN
aiol-6350	50	17	(	(	PUNCT
aiol-6350	50	18	kl1	kl1	PROPN
aiol-6350	50	19	,	,	PUNCT
aiol-6350	50	20	kl2	kl2	PROPN
aiol-6350	50	21	,	,	PUNCT
aiol-6350	50	22	kl3	kl3	PROPN
aiol-6350	50	23	)	)	PUNCT
aiol-6350	50	24	and	and	CCONJ
aiol-6350	50	25	from	from	ADP
aiol-6350	50	26	the	the	DET
aiol-6350	50	27	surface	surface	NOUN
aiol-6350	50	28	of	of	ADP
aiol-6350	50	29	one	one	NUM
aiol-6350	50	30	offshore	offshore	ADJ
aiol-6350	50	31	station	station	NOUN
aiol-6350	50	32	in	in	ADP
aiol-6350	50	33	kalamaki	kalamaki	PROPN
aiol-6350	50	34	reservoir	reservoir	PROPN
aiol-6350	50	35	(	(	PUNCT
aiol-6350	50	36	kk	kk	PROPN
aiol-6350	50	37	)	)	PUNCT
aiol-6350	50	38	(	(	PUNCT
aiol-6350	50	39	fig	fig	NOUN
aiol-6350	50	40	.	.	NOUN
aiol-6350	51	1	1	1	NUM
aiol-6350	51	2	)	)	PUNCT
aiol-6350	51	3	using	use	VERB
aiol-6350	51	4	a	a	DET
aiol-6350	51	5	1m	1m	NUM
aiol-6350	51	6	-	-	PUNCT
aiol-6350	51	7	long	long	ADJ
aiol-6350	51	8	niskin	niskin	NOUN
aiol-6350	51	9	-	-	PUNCT
aiol-6350	51	10	type	type	NOUN
aiol-6350	51	11	sampler	sampler	NOUN
aiol-6350	51	12	and	and	CCONJ
aiol-6350	51	13	a	a	DET
aiol-6350	51	14	plastic	plastic	ADJ
aiol-6350	51	15	10l	10l	NOUN
aiol-6350	51	16	vessel	vessel	NOUN
aiol-6350	51	17	,	,	PUNCT
aiol-6350	51	18	respectively	respectively	ADV
aiol-6350	51	19	.	.	PUNCT
aiol-6350	52	1	after	after	ADP
aiol-6350	52	2	august	august	PROPN
aiol-6350	52	3	2013	2013	NUM
aiol-6350	52	4	,	,	PUNCT
aiol-6350	52	5	the	the	DET
aiol-6350	52	6	water	water	NOUN
aiol-6350	52	7	level	level	NOUN
aiol-6350	52	8	fell	fall	VERB
aiol-6350	52	9	in	in	ADP
aiol-6350	52	10	lake	lake	PROPN
aiol-6350	52	11	karla	karla	PROPN
aiol-6350	52	12	(	(	PUNCT
aiol-6350	52	13	kl1	kl1	PROPN
aiol-6350	52	14	,	,	PUNCT
aiol-6350	52	15	kl2	kl2	PROPN
aiol-6350	52	16	,	,	PUNCT
aiol-6350	52	17	and	and	CCONJ
aiol-6350	52	18	kl3	kl3	PROPN
aiol-6350	52	19	stations	station	NOUN
aiol-6350	52	20	)	)	PUNCT
aiol-6350	52	21	and	and	CCONJ
aiol-6350	52	22	varied	vary	VERB
aiol-6350	52	23	between	between	ADP
aiol-6350	52	24	0.8	0.8	NUM
aiol-6350	52	25	-	-	SYM
aiol-6350	52	26	1.2	1.2	NUM
aiol-6350	52	27	m.	m.	NOUN
aiol-6350	52	28	in	in	ADP
aiol-6350	52	29	lake	lake	PROPN
aiol-6350	52	30	kalamaki	kalamaki	PROPN
aiol-6350	52	31	(	(	PUNCT
aiol-6350	52	32	kk	kk	NOUN
aiol-6350	52	33	station	station	NOUN
aiol-6350	52	34	)	)	PUNCT
aiol-6350	52	35	depth	depth	NOUN
aiol-6350	52	36	varied	varied	ADJ
aiol-6350	52	37	between	between	ADP
aiol-6350	52	38	0.4	0.4	NUM
aiol-6350	52	39	-	-	SYM
aiol-6350	52	40	0.9	0.9	NUM
aiol-6350	52	41	m.	m.	NOUN
aiol-6350	52	42	after	after	SCONJ
aiol-6350	52	43	the	the	DET
aiol-6350	52	44	water	water	NOUN
aiol-6350	52	45	level	level	NOUN
aiol-6350	52	46	decrease	decrease	NOUN
aiol-6350	52	47	in	in	ADP
aiol-6350	52	48	karla	karla	NOUN
aiol-6350	52	49	no	no	DET
aiol-6350	52	50	vessel	vessel	NOUN
aiol-6350	52	51	could	could	AUX
aiol-6350	52	52	enter	enter	VERB
aiol-6350	52	53	the	the	DET
aiol-6350	52	54	lake	lake	NOUN
aiol-6350	52	55	,	,	PUNCT
aiol-6350	52	56	therefore	therefore	ADV
aiol-6350	52	57	sampling	sample	VERB
aiol-6350	52	58	was	be	AUX
aiol-6350	52	59	performed	perform	VERB
aiol-6350	52	60	by	by	ADP
aiol-6350	52	61	walking	walk	VERB
aiol-6350	52	62	.	.	PUNCT
aiol-6350	53	1	while	while	SCONJ
aiol-6350	53	2	sampling	sample	VERB
aiol-6350	53	3	,	,	PUNCT
aiol-6350	53	4	extra	extra	ADJ
aiol-6350	53	5	care	care	NOUN
aiol-6350	53	6	was	be	AUX
aiol-6350	53	7	taken	take	VERB
aiol-6350	53	8	to	to	PART
aiol-6350	53	9	avoid	avoid	VERB
aiol-6350	53	10	sediment	sediment	ADJ
aiol-6350	53	11	resuspension	resuspension	NOUN
aiol-6350	53	12	(	(	PUNCT
aiol-6350	53	13	after	after	ADP
aiol-6350	53	14	reaching	reach	VERB
aiol-6350	53	15	the	the	DET
aiol-6350	53	16	sampling	sample	VERB
aiol-6350	53	17	point	point	NOUN
aiol-6350	53	18	researchers	researcher	NOUN
aiol-6350	53	19	waited	wait	VERB
aiol-6350	53	20	10	10	NUM
aiol-6350	53	21	min	min	NOUN
aiol-6350	53	22	before	before	ADP
aiol-6350	53	23	collecting	collect	VERB
aiol-6350	53	24	the	the	DET
aiol-6350	53	25	samwater	samwater	ADJ
aiol-6350	53	26	quality	quality	NOUN
aiol-6350	53	27	and	and	CCONJ
aiol-6350	53	28	cyanotoxins	cyanotoxin	NOUN
aiol-6350	53	29	in	in	ADP
aiol-6350	53	30	the	the	DET
aiol-6350	53	31	reconstructed	reconstructed	ADJ
aiol-6350	53	32	lake	lake	PROPN
aiol-6350	53	33	karla	karla	PROPN
aiol-6350	53	34	35	35	NUM
aiol-6350	53	35	ple	ple	NOUN
aiol-6350	53	36	)	)	PUNCT
aiol-6350	53	37	.	.	PUNCT
aiol-6350	54	1	water	water	NOUN
aiol-6350	54	2	transparency	transparency	NOUN
aiol-6350	54	3	was	be	AUX
aiol-6350	54	4	measured	measure	VERB
aiol-6350	54	5	using	use	VERB
aiol-6350	54	6	a	a	DET
aiol-6350	54	7	20	20	NUM
aiol-6350	54	8	-	-	PUNCT
aiol-6350	54	9	cm	cm	NOUN
aiol-6350	54	10	secchi	secchi	PROPN
aiol-6350	54	11	disk	disk	NOUN
aiol-6350	54	12	.	.	PUNCT
aiol-6350	55	1	temperature	temperature	NOUN
aiol-6350	55	2	,	,	PUNCT
aiol-6350	55	3	ph	ph	NOUN
aiol-6350	55	4	,	,	PUNCT
aiol-6350	55	5	conductivity	conductivity	NOUN
aiol-6350	55	6	,	,	PUNCT
aiol-6350	55	7	turbidity	turbidity	NOUN
aiol-6350	55	8	,	,	PUNCT
aiol-6350	55	9	and	and	CCONJ
aiol-6350	55	10	dissolved	dissolve	VERB
aiol-6350	55	11	oxygen	oxygen	NOUN
aiol-6350	55	12	were	be	AUX
aiol-6350	55	13	measured	measure	VERB
aiol-6350	55	14	in	in	ADP
aiol-6350	55	15	situ	situ	NOUN
aiol-6350	55	16	using	use	VERB
aiol-6350	55	17	the	the	DET
aiol-6350	55	18	aquaread	aquaread	ADJ
aiol-6350	55	19	ap-2000	ap-2000	PROPN
aiol-6350	55	20	probe	probe	NOUN
aiol-6350	55	21	(	(	PUNCT
aiol-6350	55	22	kent	kent	PROPN
aiol-6350	55	23	,	,	PUNCT
aiol-6350	55	24	gb	gb	PROPN
aiol-6350	55	25	)	)	PUNCT
aiol-6350	55	26	.	.	PUNCT
aiol-6350	56	1	concentrations	concentration	NOUN
aiol-6350	56	2	of	of	ADP
aiol-6350	56	3	total	total	ADJ
aiol-6350	56	4	phosphorus	phosphorus	NOUN
aiol-6350	56	5	(	(	PUNCT
aiol-6350	56	6	tp	tp	NOUN
aiol-6350	56	7	)	)	PUNCT
aiol-6350	56	8	in	in	ADP
aiol-6350	56	9	lake	lake	NOUN
aiol-6350	56	10	water	water	NOUN
aiol-6350	56	11	and	and	CCONJ
aiol-6350	56	12	nitrate	nitrate	NOUN
aiol-6350	56	13	(	(	PUNCT
aiol-6350	56	14	no3	no3	NOUN
aiol-6350	56	15	-	-	PUNCT
aiol-6350	56	16	n	n	NUM
aiol-6350	56	17	)	)	PUNCT
aiol-6350	56	18	,	,	PUNCT
aiol-6350	56	19	nitrite	nitrite	NOUN
aiol-6350	56	20	(	(	PUNCT
aiol-6350	56	21	no2n	no2n	PROPN
aiol-6350	56	22	)	)	PUNCT
aiol-6350	56	23	,	,	PUNCT
aiol-6350	56	24	ammonia	ammonia	NOUN
aiol-6350	56	25	(	(	PUNCT
aiol-6350	56	26	nh4	nh4	NOUN
aiol-6350	56	27	-	-	PUNCT
aiol-6350	56	28	n	n	CCONJ
aiol-6350	56	29	)	)	PUNCT
aiol-6350	56	30	,	,	PUNCT
aiol-6350	56	31	and	and	CCONJ
aiol-6350	56	32	soluble	soluble	ADJ
aiol-6350	56	33	reactive	reactive	ADJ
aiol-6350	56	34	phosphorus	phosphorus	NOUN
aiol-6350	56	35	(	(	PUNCT
aiol-6350	56	36	srp	srp	PROPN
aiol-6350	56	37	)	)	PUNCT
aiol-6350	56	38	in	in	ADP
aiol-6350	56	39	filtrates	filtrate	NOUN
aiol-6350	56	40	were	be	AUX
aiol-6350	56	41	processed	process	VERB
aiol-6350	56	42	and	and	CCONJ
aiol-6350	56	43	analyzed	analyze	VERB
aiol-6350	56	44	in	in	ADP
aiol-6350	56	45	situ	situ	NOUN
aiol-6350	56	46	spectrophotometrically	spectrophotometrically	ADV
aiol-6350	56	47	using	use	VERB
aiol-6350	56	48	aqua	aqua	PROPN
aiol-6350	56	49	nova	nova	PROPN
aiol-6350	56	50	60a	60a	PUNCT
aiol-6350	56	51	and	and	CCONJ
aiol-6350	56	52	merck	merck	PROPN
aiol-6350	56	53	standards	standard	NOUN
aiol-6350	56	54	.	.	PUNCT
aiol-6350	57	1	three	three	NUM
aiol-6350	57	2	sub	sub	NOUN
aiol-6350	57	3	-	-	NOUN
aiol-6350	57	4	samples	sample	NOUN
aiol-6350	57	5	of	of	ADP
aiol-6350	57	6	500	500	NUM
aiol-6350	57	7	ml	ml	NOUN
aiol-6350	57	8	each	each	PRON
aiol-6350	57	9	(	(	PUNCT
aiol-6350	57	10	two	two	NUM
aiol-6350	57	11	fixed	fix	VERB
aiol-6350	57	12	with	with	ADP
aiol-6350	57	13	lugol	lugol	NOUN
aiol-6350	57	14	’s	’s	PART
aiol-6350	57	15	solution	solution	NOUN
aiol-6350	57	16	and	and	CCONJ
aiol-6350	57	17	formaldehyde	formaldehyde	NOUN
aiol-6350	57	18	and	and	CCONJ
aiol-6350	57	19	one	one	NUM
aiol-6350	57	20	retained	retain	VERB
aiol-6350	57	21	fresh	fresh	ADJ
aiol-6350	57	22	)	)	PUNCT
aiol-6350	57	23	were	be	AUX
aiol-6350	57	24	collected	collect	VERB
aiol-6350	57	25	in	in	ADP
aiol-6350	57	26	polyethylene	polyethylene	NOUN
aiol-6350	57	27	bottles	bottle	NOUN
aiol-6350	57	28	and	and	CCONJ
aiol-6350	57	29	used	use	VERB
aiol-6350	57	30	for	for	ADP
aiol-6350	57	31	microscopic	microscopic	ADJ
aiol-6350	57	32	analysis	analysis	NOUN
aiol-6350	57	33	.	.	PUNCT
aiol-6350	58	1	sub	sub	NOUN
aiol-6350	58	2	-	-	NOUN
aiol-6350	58	3	samples	sample	NOUN
aiol-6350	58	4	(	(	PUNCT
aiol-6350	58	5	50	50	NUM
aiol-6350	58	6	-	-	SYM
aiol-6350	58	7	300	300	NUM
aiol-6350	58	8	ml	ml	NOUN
aiol-6350	58	9	)	)	PUNCT
aiol-6350	58	10	were	be	AUX
aiol-6350	58	11	filtered	filter	VERB
aiol-6350	58	12	through	through	ADP
aiol-6350	58	13	whatman	whatman	NOUN
aiol-6350	58	14	gf	gf	PROPN
aiol-6350	58	15	/	/	SYM
aiol-6350	58	16	c	c	NOUN
aiol-6350	58	17	filters	filter	NOUN
aiol-6350	58	18	.	.	PUNCT
aiol-6350	59	1	filter	filter	NOUN
aiol-6350	59	2	papers	paper	NOUN
aiol-6350	59	3	and	and	CCONJ
aiol-6350	59	4	filtrates	filtrate	NOUN
aiol-6350	59	5	were	be	AUX
aiol-6350	59	6	stored	store	VERB
aiol-6350	59	7	at	at	ADP
aiol-6350	59	8	-20	-20	NUM
aiol-6350	59	9	°	°	NOUN
aiol-6350	59	10	c	c	NOUN
aiol-6350	59	11	for	for	ADP
aiol-6350	59	12	subsequent	subsequent	ADJ
aiol-6350	59	13	cyanotoxin	cyanotoxin	NOUN
aiol-6350	59	14	analysis	analysis	NOUN
aiol-6350	59	15	and	and	CCONJ
aiol-6350	59	16	dna	dna	NOUN
aiol-6350	59	17	extraction	extraction	NOUN
aiol-6350	59	18	.	.	PUNCT
aiol-6350	60	1	the	the	DET
aiol-6350	60	2	carlson	carlson	PROPN
aiol-6350	60	3	trophic	trophic	PROPN
aiol-6350	60	4	state	state	PROPN
aiol-6350	60	5	index	index	NOUN
aiol-6350	60	6	(	(	PUNCT
aiol-6350	60	7	tsi	tsi	PROPN
aiol-6350	60	8	)	)	PUNCT
aiol-6350	60	9	was	be	AUX
aiol-6350	60	10	used	use	VERB
aiol-6350	60	11	as	as	ADP
aiol-6350	60	12	an	an	DET
aiol-6350	60	13	additional	additional	ADJ
aiol-6350	60	14	estimator	estimator	NOUN
aiol-6350	60	15	of	of	ADP
aiol-6350	60	16	eutrophication	eutrophication	NOUN
aiol-6350	60	17	based	base	VERB
aiol-6350	60	18	on	on	ADP
aiol-6350	60	19	abiotic	abiotic	ADJ
aiol-6350	60	20	characteristics	characteristic	NOUN
aiol-6350	60	21	of	of	ADP
aiol-6350	60	22	the	the	DET
aiol-6350	60	23	freshwaters	freshwater	NOUN
aiol-6350	60	24	surveyed	survey	VERB
aiol-6350	60	25	;	;	PUNCT
aiol-6350	60	26	it	it	PRON
aiol-6350	60	27	was	be	AUX
aiol-6350	60	28	calculated	calculate	VERB
aiol-6350	60	29	based	base	VERB
aiol-6350	60	30	on	on	ADP
aiol-6350	60	31	tp	tp	NOUN
aiol-6350	60	32	using	use	VERB
aiol-6350	60	33	the	the	DET
aiol-6350	60	34	simplified	simplified	ADJ
aiol-6350	60	35	equation	equation	NOUN
aiol-6350	60	36	given	give	VERB
aiol-6350	60	37	by	by	ADP
aiol-6350	60	38	cooke	cooke	PROPN
aiol-6350	60	39	et	et	PROPN
aiol-6350	60	40	al	al	PROPN
aiol-6350	60	41	.	.	PROPN
aiol-6350	60	42	,	,	PUNCT
aiol-6350	60	43	(	(	PUNCT
aiol-6350	60	44	1986	1986	NUM
aiol-6350	60	45	):	):	PUNCT
aiol-6350	61	1	tsi=14.42*ln[tp]=4.15	tsi=14.42*ln[tp]=4.15	X
aiol-6350	61	2	.	.	PUNCT
aiol-6350	62	1	benthic	benthic	ADJ
aiol-6350	62	2	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	62	3	were	be	AUX
aiol-6350	62	4	sampled	sample	VERB
aiol-6350	62	5	from	from	ADP
aiol-6350	62	6	the	the	DET
aiol-6350	62	7	soft	soft	ADJ
aiol-6350	62	8	bottom	bottom	NOUN
aiol-6350	62	9	of	of	ADP
aiol-6350	62	10	lake	lake	PROPN
aiol-6350	62	11	karla	karla	PROPN
aiol-6350	62	12	in	in	ADP
aiol-6350	62	13	three	three	NUM
aiol-6350	62	14	replicates	replicate	NOUN
aiol-6350	62	15	for	for	ADP
aiol-6350	62	16	each	each	DET
aiol-6350	62	17	sampling	sample	VERB
aiol-6350	62	18	station	station	NOUN
aiol-6350	62	19	(	(	PUNCT
aiol-6350	62	20	kl1	kl1	PROPN
aiol-6350	62	21	,	,	PUNCT
aiol-6350	62	22	kl2	kl2	PROPN
aiol-6350	62	23	,	,	PUNCT
aiol-6350	62	24	and	and	CCONJ
aiol-6350	62	25	kl3	kl3	PROPN
aiol-6350	62	26	)	)	PUNCT
aiol-6350	62	27	with	with	ADP
aiol-6350	62	28	an	an	DET
aiol-6350	62	29	ekman	ekman	NOUN
aiol-6350	62	30	-	-	PUNCT
aiol-6350	62	31	birge	birge	NOUN
aiol-6350	62	32	grab	grab	NOUN
aiol-6350	62	33	(	(	PUNCT
aiol-6350	62	34	225	225	NUM
aiol-6350	62	35	cm2	cm2	NOUN
aiol-6350	62	36	sampling	sampling	NOUN
aiol-6350	62	37	area	area	NOUN
aiol-6350	62	38	)	)	PUNCT
aiol-6350	62	39	.	.	PUNCT
aiol-6350	63	1	in	in	ADP
aiol-6350	63	2	kalamaki	kalamaki	PROPN
aiol-6350	63	3	reservoir	reservoir	PROPN
aiol-6350	63	4	,	,	PUNCT
aiol-6350	63	5	benthic	benthic	ADJ
aiol-6350	63	6	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	63	7	were	be	AUX
aiol-6350	63	8	collected	collect	VERB
aiol-6350	63	9	with	with	ADP
aiol-6350	63	10	a	a	DET
aiol-6350	63	11	handnet	handnet	NOUN
aiol-6350	63	12	because	because	SCONJ
aiol-6350	63	13	the	the	DET
aiol-6350	63	14	substrate	substrate	NOUN
aiol-6350	63	15	was	be	AUX
aiol-6350	63	16	coarse	coarse	ADJ
aiol-6350	63	17	:	:	PUNCT
aiol-6350	63	18	a	a	DET
aiol-6350	63	19	250	250	NUM
aiol-6350	63	20	mm	mm	NOUN
aiol-6350	63	21	×	×	NOUN
aiol-6350	63	22	230	230	NUM
aiol-6350	63	23	mm	mm	NOUN
aiol-6350	63	24	,	,	PUNCT
aiol-6350	63	25	d	d	ADJ
aiol-6350	63	26	-	-	PUNCT
aiol-6350	63	27	shaped	shape	VERB
aiol-6350	63	28	pond	pond	NOUN
aiol-6350	63	29	net	net	NOUN
aiol-6350	63	30	(	(	PUNCT
aiol-6350	63	31	0.9	0.9	NUM
aiol-6350	63	32	mm	mm	NOUN
aiol-6350	63	33	mesh	mesh	NOUN
aiol-6350	63	34	size	size	NOUN
aiol-6350	63	35	,	,	PUNCT
aiol-6350	63	36	iso	iso	NOUN
aiol-6350	63	37	7828:1985	7828:1985	NUM
aiol-6350	63	38	;	;	PUNCT
aiol-6350	63	39	en	en	X
aiol-6350	63	40	27828:1994	27828:1994	NUM
aiol-6350	63	41	)	)	PUNCT
aiol-6350	63	42	was	be	AUX
aiol-6350	63	43	used	use	VERB
aiol-6350	63	44	according	accord	VERB
aiol-6350	63	45	to	to	ADP
aiol-6350	63	46	the	the	DET
aiol-6350	63	47	semi	semi	ADJ
aiol-6350	63	48	-	-	ADJ
aiol-6350	63	49	quantitative	quantitative	ADJ
aiol-6350	63	50	3	3	NUM
aiol-6350	63	51	-	-	PUNCT
aiol-6350	63	52	min	min	NOUN
aiol-6350	63	53	kick	kick	NOUN
aiol-6350	63	54	/	/	SYM
aiol-6350	63	55	sweep	sweep	NOUN
aiol-6350	63	56	method	method	NOUN
aiol-6350	63	57	(	(	PUNCT
aiol-6350	63	58	armitage	armitage	NOUN
aiol-6350	63	59	and	and	CCONJ
aiol-6350	63	60	hogger	hogger	NOUN
aiol-6350	63	61	,	,	PUNCT
aiol-6350	63	62	1994	1994	NUM
aiol-6350	63	63	)	)	PUNCT
aiol-6350	63	64	.	.	PUNCT
aiol-6350	64	1	then	then	ADV
aiol-6350	64	2	,	,	PUNCT
aiol-6350	64	3	they	they	PRON
aiol-6350	64	4	were	be	AUX
aiol-6350	64	5	sieved	sieve	VERB
aiol-6350	64	6	with	with	ADP
aiol-6350	64	7	a	a	DET
aiol-6350	64	8	200	200	NUM
aiol-6350	64	9	-	-	PUNCT
aiol-6350	64	10	mm	mm	NOUN
aiol-6350	64	11	mesh	mesh	NOUN
aiol-6350	64	12	and	and	CCONJ
aiol-6350	64	13	fixed	fix	VERB
aiol-6350	64	14	in	in	ADP
aiol-6350	64	15	10	10	NUM
aiol-6350	64	16	%	%	NOUN
aiol-6350	64	17	v	v	ADP
aiol-6350	64	18	/	/	SYM
aiol-6350	64	19	v	v	NOUN
aiol-6350	64	20	neutralised	neutralised	ADJ
aiol-6350	64	21	formaldehyde	formaldehyde	NOUN
aiol-6350	64	22	.	.	PUNCT
aiol-6350	65	1	phytoplankton	phytoplankton	NOUN
aiol-6350	65	2	analysis	analysis	NOUN
aiol-6350	65	3	fresh	fresh	ADJ
aiol-6350	65	4	,	,	PUNCT
aiol-6350	65	5	lugol	lugol	NOUN
aiol-6350	65	6	and	and	CCONJ
aiol-6350	65	7	formaldehyde	formaldehyde	NOUN
aiol-6350	65	8	preserved	preserve	VERB
aiol-6350	65	9	samples	sample	NOUN
aiol-6350	65	10	were	be	AUX
aiol-6350	65	11	examined	examine	VERB
aiol-6350	65	12	using	use	VERB
aiol-6350	65	13	a	a	DET
aiol-6350	65	14	zeiss	zeiss	PROPN
aiol-6350	65	15	axio	axio	PROPN
aiol-6350	65	16	imager	imager	PROPN
aiol-6350	65	17	z2	z2	PROPN
aiol-6350	65	18	(	(	PUNCT
aiol-6350	65	19	carl	carl	PROPN
aiol-6350	65	20	zeiss	zeiss	PROPN
aiol-6350	65	21	,	,	PUNCT
aiol-6350	65	22	jena	jena	PROPN
aiol-6350	65	23	,	,	PUNCT
aiol-6350	65	24	germany	germany	PROPN
aiol-6350	65	25	)	)	PUNCT
aiol-6350	65	26	microscope	microscope	NOUN
aiol-6350	65	27	and	and	CCONJ
aiol-6350	65	28	an	an	DET
aiol-6350	65	29	inverted	inverted	ADJ
aiol-6350	65	30	microscope	microscope	NOUN
aiol-6350	65	31	(	(	PUNCT
aiol-6350	65	32	olympus	olympus	PROPN
aiol-6350	65	33	ix71	ix71	PROPN
aiol-6350	65	34	)	)	PUNCT
aiol-6350	65	35	.	.	PUNCT
aiol-6350	66	1	phytoplankton	phytoplankton	NOUN
aiol-6350	66	2	species	specie	NOUN
aiol-6350	66	3	were	be	AUX
aiol-6350	66	4	identified	identify	VERB
aiol-6350	66	5	using	use	VERB
aiol-6350	66	6	taxonomic	taxonomic	ADJ
aiol-6350	66	7	keys	key	NOUN
aiol-6350	66	8	(	(	PUNCT
aiol-6350	66	9	komárek	komárek	NOUN
aiol-6350	66	10	and	and	CCONJ
aiol-6350	66	11	anagnostidis	anagnostidi	NOUN
aiol-6350	66	12	,	,	PUNCT
aiol-6350	66	13	1999	1999	NUM
aiol-6350	66	14	,	,	PUNCT
aiol-6350	66	15	2005	2005	NUM
aiol-6350	66	16	;	;	PUNCT
aiol-6350	66	17	komárek	komárek	PROPN
aiol-6350	66	18	,	,	PUNCT
aiol-6350	66	19	2013	2013	NUM
aiol-6350	66	20	)	)	PUNCT
aiol-6350	66	21	.	.	PUNCT
aiol-6350	67	1	phytoplankton	phytoplankton	NOUN
aiol-6350	67	2	abundance	abundance	NOUN
aiol-6350	67	3	was	be	AUX
aiol-6350	67	4	determined	determine	VERB
aiol-6350	67	5	in	in	ADP
aiol-6350	67	6	lugol	lugol	NOUN
aiol-6350	67	7	samples	sample	NOUN
aiol-6350	67	8	with	with	ADP
aiol-6350	67	9	the	the	DET
aiol-6350	67	10	utermöhl	utermöhl	NOUN
aiol-6350	67	11	method	method	NOUN
aiol-6350	67	12	(	(	PUNCT
aiol-6350	67	13	utermöhl	utermöhl	NOUN
aiol-6350	67	14	,	,	PUNCT
aiol-6350	67	15	1958	1958	NUM
aiol-6350	67	16	)	)	PUNCT
aiol-6350	67	17	.	.	PUNCT
aiol-6350	68	1	mean	mean	VERB
aiol-6350	68	2	cell	cell	NOUN
aiol-6350	68	3	or	or	CCONJ
aiol-6350	68	4	filament	filament	NOUN
aiol-6350	68	5	volume	volume	NOUN
aiol-6350	68	6	was	be	AUX
aiol-6350	68	7	calculated	calculate	VERB
aiol-6350	68	8	using	use	VERB
aiol-6350	68	9	geometric	geometric	ADJ
aiol-6350	68	10	formulae	formulae	NOUN
aiol-6350	68	11	after	after	ADP
aiol-6350	68	12	measuring	measure	VERB
aiol-6350	68	13	the	the	DET
aiol-6350	68	14	dimensions	dimension	NOUN
aiol-6350	68	15	of	of	ADP
aiol-6350	68	16	at	at	ADV
aiol-6350	68	17	least	least	ADV
aiol-6350	68	18	30	30	NUM
aiol-6350	68	19	individuals	individual	NOUN
aiol-6350	68	20	(	(	PUNCT
aiol-6350	68	21	cells	cell	NOUN
aiol-6350	68	22	or	or	CCONJ
aiol-6350	68	23	filaments	filament	NOUN
aiol-6350	68	24	)	)	PUNCT
aiol-6350	68	25	of	of	ADP
aiol-6350	68	26	each	each	DET
aiol-6350	68	27	species	specie	NOUN
aiol-6350	68	28	with	with	ADP
aiol-6350	68	29	an	an	DET
aiol-6350	68	30	axio	axio	ADJ
aiol-6350	68	31	cam	cam	NOUN
aiol-6350	68	32	mrc5	mrc5	VERB
aiol-6350	68	33	digital	digital	ADJ
aiol-6350	68	34	camera	camera	NOUN
aiol-6350	68	35	(	(	PUNCT
aiol-6350	68	36	carl	carl	PROPN
aiol-6350	68	37	zeiss	zeiss	PROPN
aiol-6350	68	38	)	)	PUNCT
aiol-6350	68	39	.	.	PUNCT
aiol-6350	69	1	the	the	DET
aiol-6350	69	2	calculated	calculate	VERB
aiol-6350	69	3	biovolume	biovolume	PROPN
aiol-6350	69	4	concentrations	concentration	NOUN
aiol-6350	69	5	were	be	AUX
aiol-6350	69	6	expressed	express	VERB
aiol-6350	69	7	as	as	ADP
aiol-6350	69	8	biomass	biomass	NOUN
aiol-6350	69	9	per	per	ADP
aiol-6350	69	10	liter	liter	NOUN
aiol-6350	69	11	(	(	PUNCT
aiol-6350	69	12	mg	mg	PROPN
aiol-6350	69	13	l–1	l–1	PROPN
aiol-6350	69	14	)	)	PUNCT
aiol-6350	69	15	by	by	ADP
aiol-6350	69	16	assuming	assume	VERB
aiol-6350	69	17	a	a	DET
aiol-6350	69	18	specific	specific	ADJ
aiol-6350	69	19	density	density	NOUN
aiol-6350	69	20	of	of	ADP
aiol-6350	69	21	1	1	NUM
aiol-6350	69	22	g	g	NOUN
aiol-6350	69	23	cm–3	cm–3	PROPN
aiol-6350	69	24	.	.	PUNCT
aiol-6350	70	1	species	specie	NOUN
aiol-6350	70	2	and	and	CCONJ
aiol-6350	70	3	taxonomical	taxonomical	ADJ
aiol-6350	70	4	groups	group	NOUN
aiol-6350	70	5	comprising	comprise	VERB
aiol-6350	70	6	fig	fig	NOUN
aiol-6350	70	7	.	.	PUNCT
aiol-6350	71	1	1	1	X
aiol-6350	71	2	.	.	X
aiol-6350	71	3	map	map	NOUN
aiol-6350	71	4	of	of	ADP
aiol-6350	71	5	lake	lake	PROPN
aiol-6350	71	6	karla	karla	PROPN
aiol-6350	71	7	and	and	CCONJ
aiol-6350	71	8	kalamaki	kalamaki	PROPN
aiol-6350	71	9	reservoir	reservoir	PROPN
aiol-6350	71	10	showing	show	VERB
aiol-6350	71	11	the	the	DET
aiol-6350	71	12	four	four	NUM
aiol-6350	71	13	sampling	sample	VERB
aiol-6350	71	14	stations	station	NOUN
aiol-6350	71	15	(	(	PUNCT
aiol-6350	71	16	kk	kk	PROPN
aiol-6350	71	17	,	,	PUNCT
aiol-6350	71	18	kl1	kl1	PROPN
aiol-6350	71	19	,	,	PUNCT
aiol-6350	71	20	kl2	kl2	PROPN
aiol-6350	71	21	,	,	PUNCT
aiol-6350	71	22	kl3	kl3	PROPN
aiol-6350	71	23	)	)	PUNCT
aiol-6350	71	24	.	.	PUNCT
aiol-6350	72	1	insert	insert	PROPN
aiol-6350	72	2	,	,	PUNCT
aiol-6350	72	3	map	map	NOUN
aiol-6350	72	4	of	of	ADP
aiol-6350	72	5	greece	greece	PROPN
aiol-6350	72	6	(	(	PUNCT
aiol-6350	72	7	solid	solid	ADJ
aiol-6350	72	8	square	square	NOUN
aiol-6350	72	9	indicates	indicate	VERB
aiol-6350	72	10	the	the	DET
aiol-6350	72	11	location	location	NOUN
aiol-6350	72	12	of	of	ADP
aiol-6350	72	13	the	the	DET
aiol-6350	72	14	two	two	NUM
aiol-6350	72	15	waterbodies	waterbodie	NOUN
aiol-6350	72	16	)	)	PUNCT
aiol-6350	72	17	.	.	PUNCT
aiol-6350	73	1	s.	s.	PROPN
aiol-6350	73	2	gkelis	gkeli	VERB
aiol-6350	73	3	et	et	NOUN
aiol-6350	73	4	al.36	al.36	VERB
aiol-6350	73	5	more	more	ADJ
aiol-6350	73	6	than	than	ADP
aiol-6350	73	7	10	10	NUM
aiol-6350	73	8	%	%	NOUN
aiol-6350	73	9	(	(	PUNCT
aiol-6350	73	10	w	w	NOUN
aiol-6350	73	11	/	/	SYM
aiol-6350	73	12	w	w	NOUN
aiol-6350	73	13	)	)	PUNCT
aiol-6350	73	14	of	of	ADP
aiol-6350	73	15	the	the	DET
aiol-6350	73	16	total	total	ADJ
aiol-6350	73	17	phytoplankton	phytoplankton	NOUN
aiol-6350	73	18	biomass	biomass	NOUN
aiol-6350	73	19	were	be	AUX
aiol-6350	73	20	considered	consider	VERB
aiol-6350	73	21	to	to	PART
aiol-6350	73	22	be	be	AUX
aiol-6350	73	23	dominant	dominant	ADJ
aiol-6350	73	24	.	.	PUNCT
aiol-6350	74	1	phytoplankton	phytoplankton	NOUN
aiol-6350	74	2	species	specie	NOUN
aiol-6350	74	3	were	be	AUX
aiol-6350	74	4	classified	classify	VERB
aiol-6350	74	5	to	to	ADP
aiol-6350	74	6	functional	functional	ADJ
aiol-6350	74	7	groups	group	NOUN
aiol-6350	74	8	according	accord	VERB
aiol-6350	74	9	to	to	ADP
aiol-6350	74	10	reynolds	reynolds	PROPN
aiol-6350	74	11	et	et	PROPN
aiol-6350	74	12	al	al	PROPN
aiol-6350	74	13	.	.	PROPN
aiol-6350	75	1	(	(	PUNCT
aiol-6350	75	2	2002	2002	NUM
aiol-6350	75	3	)	)	PUNCT
aiol-6350	75	4	.	.	PUNCT
aiol-6350	76	1	cyanobacterial	cyanobacterial	ADJ
aiol-6350	76	2	biomass	biomass	NOUN
aiol-6350	76	3	was	be	AUX
aiol-6350	76	4	used	use	VERB
aiol-6350	76	5	to	to	PART
aiol-6350	76	6	assess	assess	VERB
aiol-6350	76	7	the	the	DET
aiol-6350	76	8	water	water	NOUN
aiol-6350	76	9	quality	quality	NOUN
aiol-6350	76	10	by	by	ADP
aiol-6350	76	11	using	use	VERB
aiol-6350	76	12	:	:	PUNCT
aiol-6350	76	13	i	i	PRON
aiol-6350	76	14	)	)	PUNCT
aiol-6350	76	15	the	the	DET
aiol-6350	76	16	two	two	NUM
aiol-6350	76	17	most	most	ADV
aiol-6350	76	18	relevant	relevant	ADJ
aiol-6350	76	19	grades	grade	NOUN
aiol-6350	76	20	(	(	PUNCT
aiol-6350	76	21	‘	'	PUNCT
aiol-6350	76	22	tolerable	tolerable	ADJ
aiol-6350	76	23	’	'	PUNCT
aiol-6350	76	24	and	and	CCONJ
aiol-6350	76	25	‘	'	PUNCT
aiol-6350	76	26	bad	bad	ADJ
aiol-6350	76	27	’	'	PUNCT
aiol-6350	76	28	corresponding	correspond	VERB
aiol-6350	76	29	to	to	ADP
aiol-6350	76	30	>	>	X
aiol-6350	76	31	8	8	NUM
aiol-6350	76	32	and	and	CCONJ
aiol-6350	76	33	>	>	SYM
aiol-6350	76	34	16	16	NUM
aiol-6350	76	35	mg	mg	ADJ
aiol-6350	77	1	l–1	l–1	PROPN
aiol-6350	77	2	of	of	ADP
aiol-6350	77	3	phytoplankton	phytoplankton	NOUN
aiol-6350	77	4	biomass	biomass	NOUN
aiol-6350	77	5	,	,	PUNCT
aiol-6350	77	6	respectively	respectively	ADV
aiol-6350	77	7	)	)	PUNCT
aiol-6350	77	8	given	give	VERB
aiol-6350	77	9	in	in	ADP
aiol-6350	77	10	padisák	padisák	NOUN
aiol-6350	77	11	et	et	PROPN
aiol-6350	77	12	al	al	PROPN
aiol-6350	77	13	.	.	PROPN
aiol-6350	77	14	(	(	PUNCT
aiol-6350	77	15	2006	2006	NUM
aiol-6350	77	16	)	)	PUNCT
aiol-6350	77	17	for	for	ADP
aiol-6350	77	18	the	the	DET
aiol-6350	77	19	big	big	ADJ
aiol-6350	77	20	shallow	shallow	ADJ
aiol-6350	77	21	lakes	lake	NOUN
aiol-6350	77	22	of	of	ADP
aiol-6350	77	23	central	central	ADJ
aiol-6350	77	24	europe	europe	PROPN
aiol-6350	77	25	;	;	PUNCT
aiol-6350	77	26	and	and	CCONJ
aiol-6350	77	27	ii	ii	X
aiol-6350	77	28	)	)	PUNCT
aiol-6350	77	29	the	the	DET
aiol-6350	77	30	good	good	ADJ
aiol-6350	77	31	/	/	SYM
aiol-6350	77	32	moderate	moderate	ADJ
aiol-6350	77	33	(	(	PUNCT
aiol-6350	77	34	g	g	NOUN
aiol-6350	77	35	/	/	SYM
aiol-6350	77	36	m	m	NOUN
aiol-6350	77	37	)	)	PUNCT
aiol-6350	77	38	grade	grade	NOUN
aiol-6350	77	39	(	(	PUNCT
aiol-6350	77	40	corresponding	correspond	VERB
aiol-6350	77	41	to	to	ADP
aiol-6350	77	42	≤1	≤1	PROPN
aiol-6350	77	43	mg	mg	PROPN
aiol-6350	77	44	l–1	l–1	PROPN
aiol-6350	77	45	of	of	ADP
aiol-6350	77	46	phytoplankton	phytoplankton	NOUN
aiol-6350	77	47	biomass	biomass	NOUN
aiol-6350	77	48	)	)	PUNCT
aiol-6350	77	49	given	give	VERB
aiol-6350	77	50	by	by	ADP
aiol-6350	77	51	the	the	DET
aiol-6350	77	52	mediterranean	mediterranean	PROPN
aiol-6350	77	53	geographical	geographical	ADJ
aiol-6350	77	54	intercalibration	intercalibration	NOUN
aiol-6350	77	55	group	group	NOUN
aiol-6350	77	56	(	(	PUNCT
aiol-6350	77	57	jrc	jrc	PROPN
aiol-6350	77	58	european	european	PROPN
aiol-6350	77	59	commission	commission	PROPN
aiol-6350	77	60	,	,	PUNCT
aiol-6350	77	61	2009	2009	NUM
aiol-6350	77	62	)	)	PUNCT
aiol-6350	77	63	;	;	PUNCT
aiol-6350	77	64	cyanobacteria	cyanobacteria	NOUN
aiol-6350	77	65	biomass	biomass	NOUN
aiol-6350	77	66	accounted	account	VERB
aiol-6350	77	67	for	for	ADP
aiol-6350	77	68	more	more	ADJ
aiol-6350	77	69	than	than	ADP
aiol-6350	77	70	80	80	NUM
aiol-6350	77	71	%	%	NOUN
aiol-6350	77	72	of	of	ADP
aiol-6350	77	73	the	the	DET
aiol-6350	77	74	whole	whole	ADJ
aiol-6350	77	75	phytoplankton	phytoplankton	NOUN
aiol-6350	77	76	biomass	biomass	NOUN
aiol-6350	77	77	,	,	PUNCT
aiol-6350	77	78	thus	thus	ADV
aiol-6350	77	79	was	be	AUX
aiol-6350	77	80	considered	consider	VERB
aiol-6350	77	81	representative	representative	ADJ
aiol-6350	77	82	.	.	PUNCT
aiol-6350	78	1	cyanobacterial	cyanobacterial	ADJ
aiol-6350	78	2	biomass	biomass	NOUN
aiol-6350	78	3	was	be	AUX
aiol-6350	78	4	also	also	ADV
aiol-6350	78	5	compared	compare	VERB
aiol-6350	78	6	to	to	ADP
aiol-6350	78	7	the	the	DET
aiol-6350	78	8	world	world	PROPN
aiol-6350	78	9	health	health	PROPN
aiol-6350	78	10	organization	organization	NOUN
aiol-6350	78	11	guidance	guidance	NOUN
aiol-6350	78	12	levels	level	NOUN
aiol-6350	78	13	2	2	NUM
aiol-6350	78	14	and	and	CCONJ
aiol-6350	78	15	3	3	NUM
aiol-6350	78	16	for	for	ADP
aiol-6350	78	17	recreational	recreational	ADJ
aiol-6350	78	18	waters	water	NOUN
aiol-6350	78	19	(	(	PUNCT
aiol-6350	78	20	who	who	PRON
aiol-6350	78	21	,	,	PUNCT
aiol-6350	78	22	2003	2003	NUM
aiol-6350	78	23	)	)	PUNCT
aiol-6350	78	24	,	,	PUNCT
aiol-6350	78	25	which	which	PRON
aiol-6350	78	26	correspond	correspond	VERB
aiol-6350	78	27	to	to	ADP
aiol-6350	78	28	10	10	NUM
aiol-6350	78	29	and	and	CCONJ
aiol-6350	78	30	200	200	NUM
aiol-6350	78	31	mg	mg	PROPN
aiol-6350	78	32	l–1	l–1	PROPN
aiol-6350	78	33	,	,	PUNCT
aiol-6350	78	34	respectively	respectively	ADV
aiol-6350	78	35	,	,	PUNCT
aiol-6350	78	36	after	after	ADP
aiol-6350	78	37	converting	convert	VERB
aiol-6350	78	38	cyanobacterial	cyanobacterial	ADJ
aiol-6350	78	39	cell	cell	NOUN
aiol-6350	78	40	concentration	concentration	NOUN
aiol-6350	78	41	(	(	PUNCT
aiol-6350	78	42	cells	cell	NOUN
aiol-6350	78	43	ml–1	ml–1	NOUN
aiol-6350	78	44	)	)	PUNCT
aiol-6350	78	45	to	to	PART
aiol-6350	78	46	biovolume	biovolume	VERB
aiol-6350	78	47	(	(	PUNCT
aiol-6350	78	48	mg	mg	PROPN
aiol-6350	78	49	l–1	l–1	PROPN
aiol-6350	78	50	)	)	PUNCT
aiol-6350	78	51	according	accord	VERB
aiol-6350	78	52	to	to	ADP
aiol-6350	78	53	bartram	bartram	PROPN
aiol-6350	78	54	et	et	PROPN
aiol-6350	78	55	al	al	PROPN
aiol-6350	78	56	.	.	PROPN
aiol-6350	79	1	(	(	PUNCT
aiol-6350	79	2	1999	1999	NUM
aiol-6350	79	3	)	)	PUNCT
aiol-6350	79	4	.	.	PUNCT
aiol-6350	80	1	benthic	benthic	ADJ
aiol-6350	80	2	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	80	3	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	80	4	were	be	AUX
aiol-6350	80	5	sorted	sort	VERB
aiol-6350	80	6	and	and	CCONJ
aiol-6350	80	7	identified	identify	VERB
aiol-6350	80	8	to	to	ADP
aiol-6350	80	9	genus	genus	NOUN
aiol-6350	80	10	or	or	CCONJ
aiol-6350	80	11	species	specie	NOUN
aiol-6350	80	12	level	level	NOUN
aiol-6350	80	13	.	.	PUNCT
aiol-6350	81	1	chironomids	chironomid	NOUN
aiol-6350	81	2	and	and	CCONJ
aiol-6350	81	3	oligochaetes	oligochaete	NOUN
aiol-6350	81	4	were	be	AUX
aiol-6350	81	5	slide	slide	NOUN
aiol-6350	81	6	-	-	PUNCT
aiol-6350	81	7	mounted	mount	VERB
aiol-6350	81	8	prior	prior	ADV
aiol-6350	81	9	to	to	ADP
aiol-6350	81	10	determination	determination	NOUN
aiol-6350	81	11	.	.	PUNCT
aiol-6350	82	1	for	for	ADP
aiol-6350	82	2	the	the	DET
aiol-6350	82	3	identification	identification	NOUN
aiol-6350	82	4	of	of	ADP
aiol-6350	82	5	chironomids	chironomid	NOUN
aiol-6350	82	6	(	(	PUNCT
aiol-6350	82	7	larvae	larvae	NOUN
aiol-6350	82	8	and	and	CCONJ
aiol-6350	82	9	pupae	pupae	NOUN
aiol-6350	82	10	)	)	PUNCT
aiol-6350	83	1	and	and	CCONJ
aiol-6350	83	2	oligochaetes	oligochaete	VERB
aiol-6350	83	3	the	the	DET
aiol-6350	83	4	keys	key	NOUN
aiol-6350	83	5	of	of	ADP
aiol-6350	83	6	wiederholm	wiederholm	NOUN
aiol-6350	83	7	(	(	PUNCT
aiol-6350	83	8	1983	1983	NUM
aiol-6350	83	9	and	and	CCONJ
aiol-6350	83	10	1986	1986	NUM
aiol-6350	83	11	)	)	PUNCT
aiol-6350	83	12	and	and	CCONJ
aiol-6350	83	13	of	of	ADP
aiol-6350	83	14	timm	timm	PROPN
aiol-6350	83	15	(	(	PUNCT
aiol-6350	83	16	2009	2009	NUM
aiol-6350	83	17	)	)	PUNCT
aiol-6350	83	18	were	be	AUX
aiol-6350	83	19	used	use	VERB
aiol-6350	83	20	,	,	PUNCT
aiol-6350	83	21	respectively	respectively	ADV
aiol-6350	83	22	.	.	PUNCT
aiol-6350	84	1	immature	immature	ADJ
aiol-6350	84	2	stages	stage	NOUN
aiol-6350	84	3	were	be	AUX
aiol-6350	84	4	identified	identify	VERB
aiol-6350	84	5	by	by	ADP
aiol-6350	84	6	the	the	DET
aiol-6350	84	7	particular	particular	ADJ
aiol-6350	84	8	characters	character	NOUN
aiol-6350	84	9	of	of	ADP
aiol-6350	84	10	the	the	DET
aiol-6350	84	11	setae	setae	NOUN
aiol-6350	84	12	.	.	PUNCT
aiol-6350	85	1	dna	dna	PROPN
aiol-6350	85	2	extraction	extraction	NOUN
aiol-6350	85	3	and	and	CCONJ
aiol-6350	85	4	molecular	molecular	ADJ
aiol-6350	85	5	analyses	analysis	NOUN
aiol-6350	85	6	in	in	ADP
aiol-6350	85	7	order	order	NOUN
aiol-6350	85	8	to	to	PART
aiol-6350	85	9	identify	identify	VERB
aiol-6350	85	10	potentially	potentially	ADV
aiol-6350	85	11	toxic	toxic	ADJ
aiol-6350	85	12	cyanobacteria	cyanobacteria	NOUN
aiol-6350	85	13	,	,	PUNCT
aiol-6350	85	14	different	different	ADJ
aiol-6350	85	15	primer	primer	NOUN
aiol-6350	85	16	pairs	pair	NOUN
aiol-6350	85	17	,	,	PUNCT
aiol-6350	85	18	previously	previously	ADV
aiol-6350	85	19	described	describe	VERB
aiol-6350	85	20	in	in	ADP
aiol-6350	85	21	the	the	DET
aiol-6350	85	22	literature	literature	NOUN
aiol-6350	85	23	,	,	PUNCT
aiol-6350	85	24	were	be	AUX
aiol-6350	85	25	used	use	VERB
aiol-6350	85	26	to	to	PART
aiol-6350	85	27	detect	detect	VERB
aiol-6350	85	28	different	different	ADJ
aiol-6350	85	29	gene	gene	NOUN
aiol-6350	85	30	targets	target	NOUN
aiol-6350	85	31	known	know	VERB
aiol-6350	85	32	to	to	PART
aiol-6350	85	33	be	be	AUX
aiol-6350	85	34	involved	involve	VERB
aiol-6350	85	35	either	either	CCONJ
aiol-6350	85	36	in	in	ADP
aiol-6350	85	37	the	the	DET
aiol-6350	85	38	biosynthesis	biosynthesis	NOUN
aiol-6350	85	39	of	of	ADP
aiol-6350	85	40	mc	mc	PROPN
aiol-6350	85	41	,	,	PUNCT
aiol-6350	85	42	cyn	cyn	PROPN
aiol-6350	85	43	or	or	CCONJ
aiol-6350	85	44	stx	stx	PROPN
aiol-6350	85	45	.	.	PROPN
aiol-6350	86	1	dna	dna	PROPN
aiol-6350	86	2	was	be	AUX
aiol-6350	86	3	extracted	extract	VERB
aiol-6350	86	4	using	use	VERB
aiol-6350	86	5	the	the	DET
aiol-6350	86	6	protocol	protocol	NOUN
aiol-6350	86	7	described	describe	VERB
aiol-6350	86	8	in	in	ADP
aiol-6350	86	9	atashpaz	atashpaz	PROPN
aiol-6350	86	10	et	et	PROPN
aiol-6350	86	11	al	al	PROPN
aiol-6350	86	12	.	.	PROPN
aiol-6350	87	1	(	(	PUNCT
aiol-6350	87	2	2010	2010	NUM
aiol-6350	87	3	)	)	PUNCT
aiol-6350	87	4	for	for	ADP
aiol-6350	87	5	gram	gram	NOUN
aiol-6350	87	6	negative	negative	ADJ
aiol-6350	87	7	bacteria	bacteria	NOUN
aiol-6350	87	8	,	,	PUNCT
aiol-6350	87	9	after	after	ADP
aiol-6350	87	10	slicing	slice	VERB
aiol-6350	87	11	the	the	DET
aiol-6350	87	12	two	two	NUM
aiol-6350	87	13	offshore	offshore	ADJ
aiol-6350	87	14	sampling	sample	VERB
aiol-6350	87	15	stations	station	NOUN
aiol-6350	87	16	(	(	PUNCT
aiol-6350	87	17	station	station	NOUN
aiol-6350	87	18	3	3	NUM
aiol-6350	87	19	and	and	CCONJ
aiol-6350	87	20	station	station	NOUN
aiol-6350	87	21	4	4	NUM
aiol-6350	87	22	)	)	PUNCT
aiol-6350	87	23	filters	filter	NOUN
aiol-6350	87	24	with	with	ADP
aiol-6350	87	25	a	a	DET
aiol-6350	87	26	sterile	sterile	ADJ
aiol-6350	87	27	scalpel	scalpel	NOUN
aiol-6350	87	28	.	.	PUNCT
aiol-6350	88	1	pcr	pcr	PROPN
aiol-6350	88	2	was	be	AUX
aiol-6350	88	3	carried	carry	VERB
aiol-6350	88	4	out	out	ADP
aiol-6350	88	5	on	on	ADP
aiol-6350	88	6	the	the	DET
aiol-6350	88	7	dna	dna	PROPN
aiol-6350	88	8	extracts	extract	NOUN
aiol-6350	88	9	using	use	VERB
aiol-6350	88	10	the	the	DET
aiol-6350	88	11	primer	primer	NOUN
aiol-6350	88	12	pairs	pair	NOUN
aiol-6350	88	13	shown	show	VERB
aiol-6350	88	14	in	in	ADP
aiol-6350	88	15	tab	tab	NOUN
aiol-6350	88	16	.	.	PUNCT
aiol-6350	89	1	1	1	NUM
aiol-6350	89	2	and	and	CCONJ
aiol-6350	89	3	pcr	pcr	ADJ
aiol-6350	89	4	conditions	condition	NOUN
aiol-6350	89	5	described	describe	VERB
aiol-6350	89	6	in	in	ADP
aiol-6350	89	7	detail	detail	NOUN
aiol-6350	89	8	by	by	ADP
aiol-6350	89	9	gkelis	gkelis	PROPN
aiol-6350	89	10	and	and	CCONJ
aiol-6350	89	11	zaoutsos	zaoutsos	PROPN
aiol-6350	89	12	(	(	PUNCT
aiol-6350	89	13	2014	2014	NUM
aiol-6350	89	14	)	)	PUNCT
aiol-6350	89	15	.	.	PUNCT
aiol-6350	90	1	all	all	DET
aiol-6350	90	2	primer	primer	NOUN
aiol-6350	90	3	pairs	pair	NOUN
aiol-6350	90	4	were	be	AUX
aiol-6350	90	5	specific	specific	ADJ
aiol-6350	90	6	for	for	ADP
aiol-6350	90	7	the	the	DET
aiol-6350	90	8	gene	gene	NOUN
aiol-6350	90	9	region	region	NOUN
aiol-6350	90	10	each	each	DET
aiol-6350	90	11	one	one	NUM
aiol-6350	90	12	amplifies	amplify	VERB
aiol-6350	90	13	.	.	PUNCT
aiol-6350	91	1	thermal	thermal	ADJ
aiol-6350	91	2	cycling	cycling	NOUN
aiol-6350	91	3	was	be	AUX
aiol-6350	91	4	carried	carry	VERB
aiol-6350	91	5	out	out	ADP
aiol-6350	91	6	using	use	VERB
aiol-6350	91	7	an	an	DET
aiol-6350	91	8	eppendorf	eppendorf	ADJ
aiol-6350	91	9	mastercycler	mastercycler	ADJ
aiol-6350	91	10	pro	pro	X
aiol-6350	91	11	(	(	PUNCT
aiol-6350	91	12	eppendorf	eppendorf	NOUN
aiol-6350	91	13	)	)	PUNCT
aiol-6350	91	14	.	.	PUNCT
aiol-6350	92	1	pcr	pcr	ADJ
aiol-6350	92	2	products	product	NOUN
aiol-6350	92	3	were	be	AUX
aiol-6350	92	4	separated	separate	VERB
aiol-6350	92	5	by	by	ADP
aiol-6350	92	6	1.5	1.5	NUM
aiol-6350	92	7	%	%	NOUN
aiol-6350	92	8	(	(	PUNCT
aiol-6350	92	9	w	w	NOUN
aiol-6350	92	10	/	/	SYM
aiol-6350	92	11	v	v	NOUN
aiol-6350	92	12	)	)	PUNCT
aiol-6350	92	13	agarose	agarose	NOUN
aiol-6350	92	14	gel	gel	NOUN
aiol-6350	92	15	in	in	ADP
aiol-6350	92	16	1x	1x	NUM
aiol-6350	92	17	tae	tae	NOUN
aiol-6350	92	18	buffer	buffer	NOUN
aiol-6350	92	19	.	.	PUNCT
aiol-6350	93	1	the	the	DET
aiol-6350	93	2	gels	gel	NOUN
aiol-6350	93	3	were	be	AUX
aiol-6350	93	4	stained	stain	VERB
aiol-6350	93	5	with	with	ADP
aiol-6350	93	6	ethidium	ethidium	NOUN
aiol-6350	93	7	bromide	bromide	NOUN
aiol-6350	93	8	and	and	CCONJ
aiol-6350	93	9	photographed	photograph	VERB
aiol-6350	93	10	under	under	ADP
aiol-6350	93	11	uv	uv	PROPN
aiol-6350	93	12	transillumination	transillumination	NOUN
aiol-6350	93	13	.	.	PUNCT
aiol-6350	94	1	dna	dna	PROPN
aiol-6350	94	2	extracted	extract	VERB
aiol-6350	94	3	from	from	ADP
aiol-6350	94	4	microcystis	microcystis	PROPN
aiol-6350	94	5	aeruginosa	aeruginosa	PROPN
aiol-6350	94	6	m6	m6	PROPN
aiol-6350	94	7	strain	strain	NOUN
aiol-6350	94	8	was	be	AUX
aiol-6350	94	9	used	use	VERB
aiol-6350	94	10	as	as	ADP
aiol-6350	94	11	positive	positive	ADJ
aiol-6350	94	12	control	control	NOUN
aiol-6350	94	13	for	for	ADP
aiol-6350	94	14	the	the	DET
aiol-6350	94	15	amplification	amplification	NOUN
aiol-6350	94	16	of	of	ADP
aiol-6350	94	17	mcya	mcya	NOUN
aiol-6350	94	18	,	,	PUNCT
aiol-6350	94	19	mcyb	mcyb	NOUN
aiol-6350	94	20	and	and	CCONJ
aiol-6350	94	21	mcye	mcye	ADJ
aiol-6350	94	22	/	/	SYM
aiol-6350	94	23	ndaf	ndaf	ADJ
aiol-6350	94	24	gene	gene	NOUN
aiol-6350	94	25	targets	target	NOUN
aiol-6350	94	26	;	;	PUNCT
aiol-6350	94	27	dna	dna	NOUN
aiol-6350	94	28	from	from	AUX
aiol-6350	94	29	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	94	30	raciborskii	raciborskii	PROPN
aiol-6350	94	31	aqs	aqs	PROPN
aiol-6350	94	32	strain	strain	NOUN
aiol-6350	94	33	was	be	AUX
aiol-6350	94	34	used	use	VERB
aiol-6350	94	35	as	as	ADP
aiol-6350	94	36	positive	positive	ADJ
aiol-6350	94	37	control	control	NOUN
aiol-6350	94	38	for	for	ADP
aiol-6350	94	39	the	the	DET
aiol-6350	94	40	amplification	amplification	NOUN
aiol-6350	94	41	of	of	ADP
aiol-6350	94	42	the	the	DET
aiol-6350	94	43	ps	ps	PROPN
aiol-6350	94	44	(	(	PUNCT
aiol-6350	94	45	peptide	peptide	NOUN
aiol-6350	94	46	syntethase	syntethase	NOUN
aiol-6350	94	47	)	)	PUNCT
aiol-6350	94	48	and	and	CCONJ
aiol-6350	94	49	pks	pks	NOUN
aiol-6350	94	50	(	(	PUNCT
aiol-6350	94	51	polyketide	polyketide	NOUN
aiol-6350	94	52	synthase	synthase	NOUN
aiol-6350	94	53	)	)	PUNCT
aiol-6350	94	54	genetic	genetic	ADJ
aiol-6350	94	55	determinants	determinant	NOUN
aiol-6350	94	56	;	;	PUNCT
aiol-6350	94	57	dna	dna	NOUN
aiol-6350	94	58	from	from	ADP
aiol-6350	94	59	aphanizomenon	aphanizomenon	NOUN
aiol-6350	94	60	gracile	gracile	PROPN
aiol-6350	94	61	a040	a040	PROPN
aiol-6350	94	62	strain	strain	NOUN
aiol-6350	94	63	was	be	AUX
aiol-6350	94	64	used	use	VERB
aiol-6350	94	65	as	as	ADP
aiol-6350	94	66	positive	positive	ADJ
aiol-6350	94	67	control	control	NOUN
aiol-6350	94	68	for	for	ADP
aiol-6350	94	69	the	the	DET
aiol-6350	94	70	detection	detection	NOUN
aiol-6350	94	71	of	of	ADP
aiol-6350	94	72	sxti	sxti	NOUN
aiol-6350	94	73	target	target	NOUN
aiol-6350	94	74	gene	gene	NOUN
aiol-6350	94	75	(	(	PUNCT
aiol-6350	94	76	see	see	VERB
aiol-6350	94	77	vasconcelos	vasconcelos	PROPN
aiol-6350	94	78	et	et	PROPN
aiol-6350	94	79	al	al	PROPN
aiol-6350	94	80	.	.	PROPN
aiol-6350	94	81	,	,	PUNCT
aiol-6350	94	82	2010	2010	NUM
aiol-6350	94	83	)	)	PUNCT
aiol-6350	94	84	.	.	PUNCT
aiol-6350	95	1	dna	dna	PROPN
aiol-6350	95	2	of	of	ADP
aiol-6350	95	3	control	control	NOUN
aiol-6350	95	4	strains	strain	NOUN
aiol-6350	95	5	was	be	AUX
aiol-6350	95	6	extracted	extract	VERB
aiol-6350	95	7	as	as	SCONJ
aiol-6350	95	8	described	describe	VERB
aiol-6350	95	9	earlier	early	ADV
aiol-6350	95	10	from	from	ADP
aiol-6350	95	11	lyophilized	lyophilized	ADJ
aiol-6350	95	12	biomass	biomass	NOUN
aiol-6350	95	13	provided	provide	VERB
aiol-6350	95	14	by	by	ADP
aiol-6350	95	15	prof	prof	PROPN
aiol-6350	95	16	.	.	PUNCT
aiol-6350	96	1	vitor	vitor	PROPN
aiol-6350	96	2	vasconcelos	vasconcelos	PROPN
aiol-6350	96	3	(	(	PUNCT
aiol-6350	96	4	ciimar	ciimar	PROPN
aiol-6350	96	5	,	,	PUNCT
aiol-6350	96	6	university	university	PROPN
aiol-6350	96	7	of	of	ADP
aiol-6350	96	8	porto	porto	PROPN
aiol-6350	96	9	,	,	PUNCT
aiol-6350	96	10	portugal	portugal	PROPN
aiol-6350	96	11	)	)	PUNCT
aiol-6350	96	12	.	.	PUNCT
aiol-6350	97	1	cyanotoxin	cyanotoxin	PROPN
aiol-6350	97	2	analysis	analysis	NOUN
aiol-6350	97	3	the	the	DET
aiol-6350	97	4	abraxis	abraxis	ADJ
aiol-6350	97	5	microcystin	microcystin	NOUN
aiol-6350	97	6	(	(	PUNCT
aiol-6350	97	7	520011	520011	NUM
aiol-6350	97	8	)	)	PUNCT
aiol-6350	97	9	,	,	PUNCT
aiol-6350	97	10	saxitoxin	saxitoxin	PROPN
aiol-6350	97	11	(	(	PUNCT
aiol-6350	97	12	52255b	52255b	NUM
aiol-6350	97	13	)	)	PUNCT
aiol-6350	97	14	,	,	PUNCT
aiol-6350	97	15	and	and	CCONJ
aiol-6350	97	16	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	97	17	(	(	PUNCT
aiol-6350	97	18	522011	522011	NUM
aiol-6350	97	19	)	)	PUNCT
aiol-6350	97	20	microtiter	microtiter	NOUN
aiol-6350	97	21	plate	plate	NOUN
aiol-6350	97	22	kits	kit	NOUN
aiol-6350	97	23	were	be	AUX
aiol-6350	97	24	used	use	VERB
aiol-6350	97	25	to	to	PART
aiol-6350	97	26	determine	determine	VERB
aiol-6350	97	27	the	the	DET
aiol-6350	97	28	presence	presence	NOUN
aiol-6350	97	29	of	of	ADP
aiol-6350	97	30	mcs	mcs	PROPN
aiol-6350	97	31	,	,	PUNCT
aiol-6350	97	32	stxs	stxs	NOUN
aiol-6350	97	33	,	,	PUNCT
aiol-6350	97	34	and	and	CCONJ
aiol-6350	97	35	cyns	cyn	NOUN
aiol-6350	97	36	,	,	PUNCT
aiol-6350	97	37	respectively	respectively	ADV
aiol-6350	97	38	in	in	ADP
aiol-6350	97	39	sampling	sample	VERB
aiol-6350	97	40	stations	station	NOUN
aiol-6350	97	41	kl1	kl1	PROPN
aiol-6350	97	42	,	,	PUNCT
aiol-6350	97	43	kl3	kl3	PROPN
aiol-6350	97	44	,	,	PUNCT
aiol-6350	97	45	and	and	CCONJ
aiol-6350	97	46	kk	kk	PROPN
aiol-6350	97	47	.	.	PUNCT
aiol-6350	97	48	toxins	toxin	NOUN
aiol-6350	97	49	from	from	ADP
aiol-6350	97	50	filters	filter	NOUN
aiol-6350	97	51	(	(	PUNCT
aiol-6350	97	52	i.e.	i.e.	X
aiol-6350	97	53	,	,	PUNCT
aiol-6350	97	54	representing	represent	VERB
aiol-6350	97	55	the	the	DET
aiol-6350	97	56	intracellular	intracellular	ADJ
aiol-6350	97	57	fraction	fraction	NOUN
aiol-6350	97	58	)	)	PUNCT
aiol-6350	97	59	were	be	AUX
aiol-6350	97	60	extracted	extract	VERB
aiol-6350	97	61	by	by	ADP
aiol-6350	97	62	eight	eight	NUM
aiol-6350	97	63	ml	ml	NOUN
aiol-6350	97	64	of	of	ADP
aiol-6350	97	65	water	water	NOUN
aiol-6350	97	66	in	in	ADP
aiol-6350	97	67	glass	glass	NOUN
aiol-6350	97	68	tubes	tube	NOUN
aiol-6350	97	69	,	,	PUNCT
aiol-6350	97	70	immersed	immerse	VERB
aiol-6350	97	71	in	in	ADP
aiol-6350	97	72	ice	ice	NOUN
aiol-6350	97	73	and	and	CCONJ
aiol-6350	97	74	sonicated	sonicate	VERB
aiol-6350	97	75	for	for	ADP
aiol-6350	97	76	10	10	NUM
aiol-6350	97	77	min	min	NOUN
aiol-6350	97	78	,	,	PUNCT
aiol-6350	97	79	after	after	ADP
aiol-6350	97	80	slicing	slice	VERB
aiol-6350	97	81	the	the	DET
aiol-6350	97	82	filters	filter	NOUN
aiol-6350	97	83	with	with	ADP
aiol-6350	97	84	a	a	DET
aiol-6350	97	85	sterile	sterile	ADJ
aiol-6350	97	86	scalpel	scalpel	NOUN
aiol-6350	97	87	.	.	PUNCT
aiol-6350	98	1	after	after	ADP
aiol-6350	98	2	sonication	sonication	NOUN
aiol-6350	98	3	,	,	PUNCT
aiol-6350	98	4	the	the	DET
aiol-6350	98	5	mixture	mixture	NOUN
aiol-6350	98	6	tab	tab	NOUN
aiol-6350	98	7	.	.	PUNCT
aiol-6350	99	1	1	1	X
aiol-6350	99	2	.	.	X
aiol-6350	99	3	pcr	pcr	ADJ
aiol-6350	99	4	primers	primer	NOUN
aiol-6350	99	5	used	use	VERB
aiol-6350	99	6	in	in	ADP
aiol-6350	99	7	the	the	DET
aiol-6350	99	8	analyses	analysis	NOUN
aiol-6350	99	9	of	of	ADP
aiol-6350	99	10	water	water	NOUN
aiol-6350	99	11	samples	sample	NOUN
aiol-6350	99	12	collected	collect	VERB
aiol-6350	99	13	from	from	ADP
aiol-6350	99	14	lake	lake	PROPN
aiol-6350	99	15	karla	karla	PROPN
aiol-6350	99	16	and	and	CCONJ
aiol-6350	99	17	kalamaki	kalamaki	PROPN
aiol-6350	99	18	reservoir	reservoir	PROPN
aiol-6350	99	19	for	for	ADP
aiol-6350	99	20	the	the	DET
aiol-6350	99	21	detection	detection	NOUN
aiol-6350	99	22	of	of	ADP
aiol-6350	99	23	genes	gene	NOUN
aiol-6350	99	24	involved	involve	VERB
aiol-6350	99	25	in	in	ADP
aiol-6350	99	26	mc	mc	PROPN
aiol-6350	99	27	,	,	PUNCT
aiol-6350	99	28	cyn	cyn	PROPN
aiol-6350	99	29	and	and	CCONJ
aiol-6350	99	30	stx	stx	PROPN
aiol-6350	99	31	production	production	NOUN
aiol-6350	99	32	.	.	PUNCT
aiol-6350	100	1	primer	primer	NOUN
aiol-6350	100	2	target	target	NOUN
aiol-6350	100	3	-	-	PUNCT
aiol-6350	100	4	gene	gene	NOUN
aiol-6350	100	5	sequence	sequence	NOUN
aiol-6350	100	6	(	(	PUNCT
aiol-6350	100	7	5’–3	5’–3	NUM
aiol-6350	100	8	’	'	PUNCT
aiol-6350	100	9	)	)	PUNCT
aiol-6350	100	10	size	size	NOUN
aiol-6350	100	11	(	(	PUNCT
aiol-6350	100	12	bp	bp	PROPN
aiol-6350	100	13	)	)	PUNCT
aiol-6350	100	14	reference	reference	NOUN
aiol-6350	100	15	mcya	mcya	NOUN
aiol-6350	100	16	-	-	PUNCT
aiol-6350	100	17	cd1f	cd1f	NOUN
aiol-6350	100	18	mcya	mcya	NOUN
aiol-6350	100	19	aaaattaaaagccgtatcaaa	aaaattaaaagccgtatcaaa	NOUN
aiol-6350	100	20	mcya	mcya	NOUN
aiol-6350	100	21	-	-	PUNCT
aiol-6350	100	22	cd1r	cd1r	ADJ
aiol-6350	100	23	aaaagtgttttattagcggctcat	aaaagtgttttattagcggctcat	NOUN
aiol-6350	100	24	297	297	NUM
aiol-6350	100	25	hisbergues	hisbergue	NOUN
aiol-6350	100	26	et	et	PROPN
aiol-6350	100	27	al	al	PROPN
aiol-6350	100	28	.	.	PROPN
aiol-6350	100	29	,	,	PUNCT
aiol-6350	100	30	2003	2003	NUM
aiol-6350	100	31	mcyb2959f	mcyb2959f	NOUN
aiol-6350	100	32	tgggaagatgttcttcaggtatccaa	tgggaagatgttcttcaggtatccaa	NOUN
aiol-6350	100	33	mcyb3278r	mcyb3278r	PROPN
aiol-6350	100	34	mcyb	mcyb	PROPN
aiol-6350	100	35	agagtggaaacaatatgataagctac	agagtggaaacaatatgataagctac	PROPN
aiol-6350	100	36	320	320	NUM
aiol-6350	100	37	nonneman	nonneman	NOUN
aiol-6350	100	38	and	and	CCONJ
aiol-6350	100	39	zimba	zimba	ADJ
aiol-6350	100	40	,	,	PUNCT
aiol-6350	100	41	2002	2002	NUM
aiol-6350	100	42	pkef1	pkef1	NOUN
aiol-6350	100	43	mcye	mcye	PROPN
aiol-6350	100	44	cgcaaacccgatttacag	cgcaaacccgatttacag	PROPN
aiol-6350	100	45	pker1	pker1	NOUN
aiol-6350	101	1	cccctaccatcttcatcttc	cccctaccatcttcatcttc	NOUN
aiol-6350	101	2	755	755	NUM
aiol-6350	101	3	ouahid	ouahid	NOUN
aiol-6350	101	4	et	et	PROPN
aiol-6350	101	5	al	al	PROPN
aiol-6350	101	6	.	.	PROPN
aiol-6350	101	7	,	,	PUNCT
aiol-6350	101	8	2005	2005	NUM
aiol-6350	101	9	hepf	hepf	ADJ
aiol-6350	101	10	tttggggttaacttttttgggcatagtc	tttggggttaacttttttgggcatagtc	NOUN
aiol-6350	101	11	hepr	hepr	PROPN
aiol-6350	101	12	mcye	mcye	PROPN
aiol-6350	101	13	/	/	SYM
aiol-6350	101	14	ndaf	ndaf	NOUN
aiol-6350	101	15	aattcttgaggctgtaaatcgggttt	aattcttgaggctgtaaatcgggttt	NOUN
aiol-6350	101	16	472	472	NUM
aiol-6350	101	17	jungblut	jungblut	NOUN
aiol-6350	101	18	and	and	CCONJ
aiol-6350	101	19	neilan	neilan	ADJ
aiol-6350	101	20	,	,	PUNCT
aiol-6350	101	21	2006	2006	NUM
aiol-6350	101	22	psm13	psm13	NOUN
aiol-6350	101	23	ps	ps	NOUN
aiol-6350	101	24	ggcaaattgtgatagccacgagc	ggcaaattgtgatagccacgagc	NOUN
aiol-6350	101	25	psm14	psm14	VERB
aiol-6350	101	26	gatggaacatcgctcactggtg	gatggaacatcgctcactggtg	NOUN
aiol-6350	101	27	597	597	NUM
aiol-6350	101	28	schembri	schembri	NOUN
aiol-6350	101	29	et	et	NOUN
aiol-6350	101	30	al	al	PROPN
aiol-6350	101	31	.	.	PROPN
aiol-6350	101	32	,	,	PUNCT
aiol-6350	101	33	2001	2001	NUM
aiol-6350	101	34	pksk18	pksk18	NOUN
aiol-6350	101	35	cctcgcacatagccatttgc	cctcgcacatagccatttgc	VERB
aiol-6350	101	36	pksm4	pksm4	ADJ
aiol-6350	101	37	pks	pks	NOUN
aiol-6350	101	38	gaagctctggaatccggtaa	gaagctctggaatccggtaa	ADJ
aiol-6350	101	39	422	422	NUM
aiol-6350	101	40	fergusson	fergusson	NOUN
aiol-6350	101	41	and	and	CCONJ
aiol-6350	101	42	saint	saint	NOUN
aiol-6350	101	43	,	,	PUNCT
aiol-6350	101	44	2003	2003	NUM
aiol-6350	101	45	sxt1	sxt1	PROPN
aiol-6350	101	46	-	-	PUNCT
aiol-6350	101	47	f	f	PROPN
aiol-6350	101	48	sxti	sxti	PROPN
aiol-6350	101	49	gcttactaccacgatagtgctgccg	gcttactaccacgatagtgctgccg	PROPN
aiol-6350	101	50	sxt1	sxt1	PROPN
aiol-6350	101	51	-	-	PUNCT
aiol-6350	101	52	r	r	NOUN
aiol-6350	101	53	ggttcgccgcggacattaaa	ggttcgccgcggacattaaa	NOUN
aiol-6350	101	54	1669	1669	NUM
aiol-6350	101	55	kellmann	kellmann	PROPN
aiol-6350	101	56	et	et	PROPN
aiol-6350	101	57	al	al	PROPN
aiol-6350	101	58	.	.	PROPN
aiol-6350	101	59	,	,	PUNCT
aiol-6350	101	60	2008	2008	NUM
aiol-6350	101	61	water	water	NOUN
aiol-6350	101	62	quality	quality	NOUN
aiol-6350	101	63	and	and	CCONJ
aiol-6350	101	64	cyanotoxins	cyanotoxin	NOUN
aiol-6350	101	65	in	in	ADP
aiol-6350	101	66	the	the	DET
aiol-6350	101	67	reconstructed	reconstructed	ADJ
aiol-6350	101	68	lake	lake	PROPN
aiol-6350	101	69	karla	karla	PROPN
aiol-6350	101	70	37	37	NUM
aiol-6350	101	71	was	be	AUX
aiol-6350	101	72	stirred	stir	VERB
aiol-6350	101	73	for	for	ADP
aiol-6350	101	74	30	30	NUM
aiol-6350	101	75	min	min	NOUN
aiol-6350	101	76	at	at	ADP
aiol-6350	101	77	room	room	NOUN
aiol-6350	101	78	temperature	temperature	NOUN
aiol-6350	101	79	,	,	PUNCT
aiol-6350	101	80	centrifuged	centrifuge	VERB
aiol-6350	101	81	for	for	ADP
aiol-6350	101	82	10	10	NUM
aiol-6350	101	83	min	min	NOUN
aiol-6350	101	84	at	at	ADP
aiol-6350	101	85	13,000	13,000	NUM
aiol-6350	101	86	g	g	NOUN
aiol-6350	101	87	and	and	CCONJ
aiol-6350	101	88	the	the	DET
aiol-6350	101	89	supernatant	supernatant	NOUN
aiol-6350	101	90	was	be	AUX
aiol-6350	101	91	collected	collect	VERB
aiol-6350	101	92	.	.	PUNCT
aiol-6350	102	1	the	the	DET
aiol-6350	102	2	pellet	pellet	NOUN
aiol-6350	102	3	was	be	AUX
aiol-6350	102	4	resuspended	resuspend	VERB
aiol-6350	102	5	in	in	ADP
aiol-6350	102	6	eight	eight	NUM
aiol-6350	102	7	ml	ml	NOUN
aiol-6350	102	8	of	of	ADP
aiol-6350	102	9	water	water	NOUN
aiol-6350	102	10	and	and	CCONJ
aiol-6350	102	11	re	re	VERB
aiol-6350	102	12	-	-	VERB
aiol-6350	102	13	extracted	extract	VERB
aiol-6350	102	14	.	.	PUNCT
aiol-6350	103	1	the	the	DET
aiol-6350	103	2	resulting	result	VERB
aiol-6350	103	3	solutions	solution	NOUN
aiol-6350	103	4	were	be	AUX
aiol-6350	103	5	pooled	pool	VERB
aiol-6350	103	6	together	together	ADV
aiol-6350	103	7	,	,	PUNCT
aiol-6350	103	8	dried	dry	VERB
aiol-6350	103	9	in	in	ADP
aiol-6350	103	10	an	an	DET
aiol-6350	103	11	air	air	NOUN
aiol-6350	103	12	stream	stream	NOUN
aiol-6350	103	13	,	,	PUNCT
aiol-6350	103	14	and	and	CCONJ
aiol-6350	103	15	the	the	DET
aiol-6350	103	16	residue	residue	NOUN
aiol-6350	103	17	was	be	AUX
aiol-6350	103	18	dissolved	dissolve	VERB
aiol-6350	103	19	in	in	ADP
aiol-6350	103	20	1	1	NUM
aiol-6350	103	21	ml	ml	NOUN
aiol-6350	103	22	milli	milli	ADJ
aiol-6350	103	23	-	-	ADJ
aiol-6350	103	24	q	q	NOUN
aiol-6350	103	25	water	water	NOUN
aiol-6350	103	26	;	;	PUNCT
aiol-6350	103	27	then	then	ADV
aiol-6350	103	28	,	,	PUNCT
aiol-6350	103	29	they	they	PRON
aiol-6350	103	30	were	be	AUX
aiol-6350	103	31	applied	apply	VERB
aiol-6350	103	32	to	to	ADP
aiol-6350	103	33	the	the	DET
aiol-6350	103	34	above	above	ADJ
aiol-6350	103	35	mentioned	mention	VERB
aiol-6350	103	36	elisa	elisa	NOUN
aiol-6350	103	37	kits	kit	NOUN
aiol-6350	103	38	following	follow	VERB
aiol-6350	103	39	the	the	DET
aiol-6350	103	40	manufacturer	manufacturer	NOUN
aiol-6350	103	41	’s	’s	PART
aiol-6350	103	42	instructions	instruction	NOUN
aiol-6350	103	43	.	.	PUNCT
aiol-6350	104	1	extracellular	extracellular	ADJ
aiol-6350	104	2	cyanotoxins	cyanotoxin	NOUN
aiol-6350	104	3	were	be	AUX
aiol-6350	104	4	measured	measure	VERB
aiol-6350	104	5	by	by	ADP
aiol-6350	104	6	applying	apply	VERB
aiol-6350	104	7	the	the	DET
aiol-6350	104	8	filtrates	filtrate	NOUN
aiol-6350	104	9	to	to	PART
aiol-6350	104	10	elisa	elisa	VERB
aiol-6350	104	11	.	.	PUNCT
aiol-6350	105	1	all	all	DET
aiol-6350	105	2	microtiter	microtiter	ADJ
aiol-6350	105	3	plates	plate	NOUN
aiol-6350	105	4	were	be	AUX
aiol-6350	105	5	read	read	VERB
aiol-6350	105	6	at	at	ADP
aiol-6350	105	7	450	450	NUM
aiol-6350	105	8	nm	nm	NOUN
aiol-6350	105	9	and	and	CCONJ
aiol-6350	105	10	b	b	X
aiol-6350	105	11	/	/	SYM
aiol-6350	105	12	b0	b0	NOUN
aiol-6350	105	13	values	value	NOUN
aiol-6350	105	14	(	(	PUNCT
aiol-6350	105	15	%	%	INTJ
aiol-6350	105	16	)	)	PUNCT
aiol-6350	105	17	were	be	AUX
aiol-6350	105	18	calculated	calculate	VERB
aiol-6350	105	19	.	.	PUNCT
aiol-6350	106	1	samples	sample	NOUN
aiol-6350	106	2	with	with	ADP
aiol-6350	106	3	a	a	DET
aiol-6350	106	4	coefficient	coefficient	NOUN
aiol-6350	106	5	of	of	ADP
aiol-6350	106	6	variation	variation	NOUN
aiol-6350	106	7	percentage	percentage	NOUN
aiol-6350	106	8	of	of	ADP
aiol-6350	106	9	>	>	SYM
aiol-6350	106	10	15	15	NUM
aiol-6350	106	11	%	%	NOUN
aiol-6350	106	12	were	be	AUX
aiol-6350	106	13	not	not	PART
aiol-6350	106	14	accepted	accept	VERB
aiol-6350	106	15	.	.	PUNCT
aiol-6350	107	1	dilutions	dilution	NOUN
aiol-6350	107	2	of	of	ADP
aiol-6350	107	3	extracts	extract	NOUN
aiol-6350	107	4	until	until	SCONJ
aiol-6350	107	5	they	they	PRON
aiol-6350	107	6	fit	fit	VERB
aiol-6350	107	7	each	each	DET
aiol-6350	107	8	kit	kit	NOUN
aiol-6350	107	9	’s	’s	PART
aiol-6350	107	10	standard	standard	ADJ
aiol-6350	107	11	curve	curve	NOUN
aiol-6350	107	12	range	range	NOUN
aiol-6350	107	13	were	be	AUX
aiol-6350	107	14	preformed	preform	VERB
aiol-6350	107	15	when	when	SCONJ
aiol-6350	107	16	necessary	necessary	ADJ
aiol-6350	107	17	.	.	PUNCT
aiol-6350	108	1	results	result	NOUN
aiol-6350	108	2	are	be	AUX
aiol-6350	108	3	given	give	VERB
aiol-6350	108	4	in	in	ADP
aiol-6350	108	5	μg	μg	PROPN
aiol-6350	108	6	of	of	ADP
aiol-6350	108	7	toxin	toxin	NOUN
aiol-6350	108	8	-	-	PUNCT
aiol-6350	108	9	equivalent	equivalent	NOUN
aiol-6350	108	10	(	(	PUNCT
aiol-6350	108	11	eq	eq	NOUN
aiol-6350	108	12	.	.	PUNCT
aiol-6350	108	13	)	)	PUNCT
aiol-6350	108	14	per	per	ADP
aiol-6350	108	15	l	l	NOUN
aiol-6350	108	16	of	of	ADP
aiol-6350	108	17	water	water	NOUN
aiol-6350	108	18	(	(	PUNCT
aiol-6350	108	19	e.g.	e.g.	ADV
aiol-6350	108	20	,	,	PUNCT
aiol-6350	108	21	eq	eq	NOUN
aiol-6350	108	22	.	.	PROPN
aiol-6350	109	1	μg	μg	PROPN
aiol-6350	109	2	mc	mc	PROPN
aiol-6350	109	3	l–1	l–1	PROPN
aiol-6350	109	4	)	)	PUNCT
aiol-6350	109	5	.	.	PUNCT
aiol-6350	110	1	the	the	DET
aiol-6350	110	2	detection	detection	NOUN
aiol-6350	110	3	limits	limit	VERB
aiol-6350	110	4	for	for	ADP
aiol-6350	110	5	mc	mc	PROPN
aiol-6350	110	6	,	,	PUNCT
aiol-6350	110	7	stx	stx	PROPN
aiol-6350	110	8	,	,	PUNCT
aiol-6350	110	9	and	and	CCONJ
aiol-6350	110	10	cyn	cyn	PROPN
aiol-6350	110	11	assays	assay	NOUN
aiol-6350	110	12	,	,	PUNCT
aiol-6350	110	13	are	be	AUX
aiol-6350	110	14	0.10	0.10	NUM
aiol-6350	110	15	μg	μg	PROPN
aiol-6350	110	16	l–1	l–1	PROPN
aiol-6350	110	17	,	,	PUNCT
aiol-6350	110	18	0.015	0.015	NUM
aiol-6350	110	19	μg	μg	PROPN
aiol-6350	110	20	l–1	l–1	PROPN
aiol-6350	110	21	,	,	PUNCT
aiol-6350	110	22	and	and	CCONJ
aiol-6350	110	23	0.040	0.040	NUM
aiol-6350	110	24	μg	μg	PROPN
aiol-6350	110	25	l–1	l–1	PROPN
aiol-6350	110	26	,	,	PUNCT
aiol-6350	110	27	respectively	respectively	ADV
aiol-6350	110	28	.	.	PUNCT
aiol-6350	111	1	in	in	ADP
aiol-6350	111	2	order	order	NOUN
aiol-6350	111	3	to	to	PART
aiol-6350	111	4	confirm	confirm	VERB
aiol-6350	111	5	the	the	DET
aiol-6350	111	6	elisa	elisa	NOUN
aiol-6350	111	7	results	result	NOUN
aiol-6350	111	8	and	and	CCONJ
aiol-6350	111	9	verify	verify	VERB
aiol-6350	111	10	the	the	DET
aiol-6350	111	11	identities	identity	NOUN
aiol-6350	111	12	of	of	ADP
aiol-6350	111	13	cyanotoxins	cyanotoxin	NOUN
aiol-6350	111	14	,	,	PUNCT
aiol-6350	111	15	13	13	NUM
aiol-6350	111	16	out	out	ADP
aiol-6350	111	17	of	of	ADP
aiol-6350	111	18	the	the	DET
aiol-6350	111	19	previously	previously	ADV
aiol-6350	111	20	mentioned	mention	VERB
aiol-6350	111	21	filter	filter	NOUN
aiol-6350	111	22	-	-	PUNCT
aiol-6350	111	23	extracts	extract	NOUN
aiol-6350	111	24	(	(	PUNCT
aiol-6350	111	25	intracellular	intracellular	ADJ
aiol-6350	111	26	toxins	toxin	NOUN
aiol-6350	111	27	)	)	PUNCT
aiol-6350	111	28	were	be	AUX
aiol-6350	111	29	analyzed	analyze	VERB
aiol-6350	111	30	without	without	ADP
aiol-6350	111	31	further	further	ADJ
aiol-6350	111	32	pretreatment	pretreatment	NOUN
aiol-6350	111	33	,	,	PUNCT
aiol-6350	111	34	using	use	VERB
aiol-6350	111	35	liquid	liquid	ADJ
aiol-6350	111	36	chromatography	chromatography	NOUN
aiol-6350	111	37	-	-	PUNCT
aiol-6350	111	38	tandem	tandem	NOUN
aiol-6350	111	39	mass	mass	ADJ
aiol-6350	111	40	spectrometry	spectrometry	NOUN
aiol-6350	111	41	(	(	PUNCT
aiol-6350	111	42	lc	lc	PROPN
aiol-6350	111	43	-	-	PUNCT
aiol-6350	111	44	ms	ms	PROPN
aiol-6350	111	45	/	/	SYM
aiol-6350	111	46	ms	ms	NOUN
aiol-6350	111	47	)	)	PUNCT
aiol-6350	111	48	.	.	PUNCT
aiol-6350	112	1	determination	determination	NOUN
aiol-6350	112	2	was	be	AUX
aiol-6350	112	3	carried	carry	VERB
aiol-6350	112	4	out	out	ADP
aiol-6350	112	5	on	on	ADP
aiol-6350	112	6	a	a	DET
aiol-6350	112	7	finnigan	finnigan	ADJ
aiol-6350	112	8	tsq	tsq	NOUN
aiol-6350	112	9	quantum	quantum	NOUN
aiol-6350	112	10	discovery	discovery	NOUN
aiol-6350	112	11	max	max	PROPN
aiol-6350	112	12	triple	triple	ADJ
aiol-6350	112	13	-	-	PUNCT
aiol-6350	112	14	stage	stage	NOUN
aiol-6350	112	15	quadrupole	quadrupole	NOUN
aiol-6350	112	16	mass	mass	NOUN
aiol-6350	112	17	spectrometer	spectrometer	NOUN
aiol-6350	112	18	(	(	PUNCT
aiol-6350	112	19	thermo	thermo	NOUN
aiol-6350	112	20	fischer	fischer	PROPN
aiol-6350	112	21	scientific	scientific	PROPN
aiol-6350	112	22	,	,	PUNCT
aiol-6350	112	23	waltham	waltham	PROPN
aiol-6350	112	24	,	,	PUNCT
aiol-6350	112	25	ma	ma	PROPN
aiol-6350	112	26	,	,	PUNCT
aiol-6350	112	27	usa	usa	PROPN
aiol-6350	112	28	)	)	PUNCT
aiol-6350	112	29	,	,	PUNCT
aiol-6350	112	30	equipped	equip	VERB
aiol-6350	112	31	with	with	ADP
aiol-6350	112	32	electrospray	electrospray	ADJ
aiol-6350	112	33	ionization	ionization	NOUN
aiol-6350	112	34	(	(	PUNCT
aiol-6350	112	35	esi	esi	NOUN
aiol-6350	112	36	)	)	PUNCT
aiol-6350	112	37	source	source	NOUN
aiol-6350	112	38	.	.	PUNCT
aiol-6350	113	1	separation	separation	NOUN
aiol-6350	113	2	of	of	ADP
aiol-6350	113	3	target	target	NOUN
aiol-6350	113	4	analytes	analyte	NOUN
aiol-6350	113	5	was	be	AUX
aiol-6350	113	6	achieved	achieve	VERB
aiol-6350	113	7	with	with	ADP
aiol-6350	113	8	a	a	DET
aiol-6350	113	9	finnigan	finnigan	ADJ
aiol-6350	113	10	surveyor	surveyor	NOUN
aiol-6350	113	11	lc	lc	PROPN
aiol-6350	113	12	system	system	NOUN
aiol-6350	113	13	,	,	PUNCT
aiol-6350	113	14	equipped	equip	VERB
aiol-6350	113	15	with	with	ADP
aiol-6350	113	16	a	a	DET
aiol-6350	113	17	finnigan	finnigan	ADJ
aiol-6350	113	18	surveyor	surveyor	NOUN
aiol-6350	113	19	as	as	ADP
aiol-6350	113	20	autosampler	autosampler	NOUN
aiol-6350	113	21	(	(	PUNCT
aiol-6350	113	22	thermo	thermo	NOUN
aiol-6350	113	23	fischer	fischer	PROPN
aiol-6350	113	24	scientific	scientific	PROPN
aiol-6350	113	25	)	)	PUNCT
aiol-6350	113	26	.	.	PUNCT
aiol-6350	114	1	detection	detection	NOUN
aiol-6350	114	2	was	be	AUX
aiol-6350	114	3	performed	perform	VERB
aiol-6350	114	4	in	in	ADP
aiol-6350	114	5	multiple	multiple	ADJ
aiol-6350	114	6	reaction	reaction	NOUN
aiol-6350	114	7	monitoring	monitoring	NOUN
aiol-6350	114	8	(	(	PUNCT
aiol-6350	114	9	mrm	mrm	PROPN
aiol-6350	114	10	)	)	PUNCT
aiol-6350	114	11	mode	mode	NOUN
aiol-6350	114	12	.	.	PUNCT
aiol-6350	115	1	xcalibur	xcalibur	PROPN
aiol-6350	115	2	software	software	PROPN
aiol-6350	115	3	2.1	2.1	NUM
aiol-6350	115	4	sp	sp	ADP
aiol-6350	115	5	1160	1160	NUM
aiol-6350	115	6	was	be	AUX
aiol-6350	115	7	used	use	VERB
aiol-6350	115	8	to	to	PART
aiol-6350	115	9	control	control	VERB
aiol-6350	115	10	the	the	DET
aiol-6350	115	11	mass	mass	NOUN
aiol-6350	115	12	spectrometer	spectrometer	NOUN
aiol-6350	115	13	and	and	CCONJ
aiol-6350	115	14	for	for	ADP
aiol-6350	115	15	data	data	NOUN
aiol-6350	115	16	acquisition	acquisition	NOUN
aiol-6350	115	17	.	.	PUNCT
aiol-6350	116	1	the	the	DET
aiol-6350	116	2	determination	determination	NOUN
aiol-6350	116	3	of	of	ADP
aiol-6350	116	4	cyn	cyn	PROPN
aiol-6350	116	5	,	,	PUNCT
aiol-6350	116	6	atx	atx	PROPN
aiol-6350	116	7	-	-	PUNCT
aiol-6350	116	8	a	a	NOUN
aiol-6350	116	9	,	,	PUNCT
aiol-6350	116	10	and	and	CCONJ
aiol-6350	116	11	mcs	mcs	PROPN
aiol-6350	116	12	(	(	PUNCT
aiol-6350	116	13	[	[	X
aiol-6350	116	14	dasp3]mc	dasp3]mc	X
aiol-6350	116	15	-	-	PUNCT
aiol-6350	116	16	rr	rr	NOUN
aiol-6350	116	17	,	,	PUNCT
aiol-6350	116	18	mc	mc	PROPN
aiol-6350	116	19	-	-	PUNCT
aiol-6350	116	20	rr	rr	PROPN
aiol-6350	116	21	,	,	PUNCT
aiol-6350	116	22	mc	mc	PROPN
aiol-6350	116	23	-	-	PUNCT
aiol-6350	116	24	yr	yr	PROPN
aiol-6350	116	25	,	,	PUNCT
aiol-6350	116	26	mc	mc	PROPN
aiol-6350	116	27	-	-	PUNCT
aiol-6350	116	28	htyr	htyr	PROPN
aiol-6350	116	29	,	,	PUNCT
aiol-6350	116	30	[	[	X
aiol-6350	116	31	dasp3]mc	dasp3]mc	X
aiol-6350	116	32	-	-	PUNCT
aiol-6350	116	33	lr	lr	NOUN
aiol-6350	116	34	,	,	PUNCT
aiol-6350	116	35	mc	mc	PROPN
aiol-6350	116	36	-	-	PUNCT
aiol-6350	116	37	lr	lr	PROPN
aiol-6350	116	38	,	,	PUNCT
aiol-6350	116	39	mc	mc	PROPN
aiol-6350	116	40	-	-	PROPN
aiol-6350	116	41	hilr	hilr	PROPN
aiol-6350	116	42	,	,	PUNCT
aiol-6350	116	43	mc	mc	PROPN
aiol-6350	116	44	-	-	PUNCT
aiol-6350	116	45	wr	wr	PROPN
aiol-6350	116	46	,	,	PUNCT
aiol-6350	116	47	mc	mc	PROPN
aiol-6350	116	48	-	-	PUNCT
aiol-6350	116	49	la	la	PROPN
aiol-6350	116	50	,	,	PUNCT
aiol-6350	116	51	mc	mc	PROPN
aiol-6350	116	52	-	-	PUNCT
aiol-6350	116	53	ly	ly	PROPN
aiol-6350	116	54	,	,	PUNCT
aiol-6350	116	55	mc	mc	PROPN
aiol-6350	116	56	-	-	PUNCT
aiol-6350	116	57	lw	lw	PROPN
aiol-6350	116	58	,	,	PUNCT
aiol-6350	116	59	mc	mc	PROPN
aiol-6350	116	60	-	-	PUNCT
aiol-6350	116	61	lf	lf	PROPN
aiol-6350	116	62	)	)	PUNCT
aiol-6350	116	63	was	be	AUX
aiol-6350	116	64	carried	carry	VERB
aiol-6350	116	65	out	out	ADP
aiol-6350	116	66	according	accord	VERB
aiol-6350	116	67	to	to	ADP
aiol-6350	116	68	the	the	DET
aiol-6350	116	69	lc	lc	PROPN
aiol-6350	116	70	-	-	PUNCT
aiol-6350	116	71	ms	ms	PROPN
aiol-6350	116	72	/	/	SYM
aiol-6350	116	73	ms	ms	PROPN
aiol-6350	116	74	method	method	NOUN
aiol-6350	116	75	described	describe	VERB
aiol-6350	116	76	by	by	ADP
aiol-6350	116	77	zervou	zervou	PROPN
aiol-6350	116	78	et	et	PROPN
aiol-6350	116	79	al	al	PROPN
aiol-6350	116	80	.	.	PROPN
aiol-6350	117	1	(	(	PUNCT
aiol-6350	117	2	2017	2017	NUM
aiol-6350	117	3	)	)	PUNCT
aiol-6350	117	4	.	.	PUNCT
aiol-6350	118	1	the	the	DET
aiol-6350	118	2	same	same	ADJ
aiol-6350	118	3	extracts	extract	NOUN
aiol-6350	118	4	were	be	AUX
aiol-6350	118	5	also	also	ADV
aiol-6350	118	6	analysed	analyse	VERB
aiol-6350	118	7	for	for	ADP
aiol-6350	118	8	stx	stx	NOUN
aiol-6350	118	9	and	and	CCONJ
aiol-6350	118	10	neostx	neostx	NOUN
aiol-6350	118	11	with	with	ADP
aiol-6350	118	12	an	an	DET
aiol-6350	118	13	in	in	ADP
aiol-6350	118	14	-	-	PUNCT
aiol-6350	118	15	house	house	NOUN
aiol-6350	118	16	developed	develop	VERB
aiol-6350	118	17	method	method	NOUN
aiol-6350	118	18	(	(	PUNCT
aiol-6350	118	19	moustakagouni	moustakagouni	PROPN
aiol-6350	118	20	et	et	PROPN
aiol-6350	118	21	.	.	PUNCT
aiol-6350	119	1	al	al	PROPN
aiol-6350	119	2	.	.	PROPN
aiol-6350	119	3	,	,	PUNCT
aiol-6350	119	4	2016	2016	NUM
aiol-6350	119	5	)	)	PUNCT
aiol-6350	119	6	,	,	PUNCT
aiol-6350	119	7	using	use	VERB
aiol-6350	119	8	a	a	DET
aiol-6350	119	9	sequant	sequant	NOUN
aiol-6350	119	10	zic	zic	PROPN
aiol-6350	119	11	-	-	PUNCT
aiol-6350	119	12	hydrophilic	hydrophilic	ADJ
aiol-6350	119	13	interaction	interaction	NOUN
aiol-6350	119	14	chromatographιc	chromatographιc	NOUN
aiol-6350	119	15	(	(	PUNCT
aiol-6350	119	16	hilic	hilic	NOUN
aiol-6350	119	17	)	)	PUNCT
aiol-6350	119	18	column	column	NOUN
aiol-6350	119	19	(	(	PUNCT
aiol-6350	119	20	150	150	NUM
aiol-6350	119	21	x	x	SYM
aiol-6350	119	22	2.1	2.1	NUM
aiol-6350	119	23	mm	mm	NOUN
aiol-6350	119	24	,	,	PUNCT
aiol-6350	119	25	3.5	3.5	NUM
aiol-6350	119	26	µm	µm	NOUN
aiol-6350	119	27	column	column	NOUN
aiol-6350	119	28	)	)	PUNCT
aiol-6350	119	29	supplied	supply	VERB
aiol-6350	119	30	by	by	ADP
aiol-6350	119	31	merck	merck	PROPN
aiol-6350	119	32	.	.	PUNCT
aiol-6350	120	1	the	the	DET
aiol-6350	120	2	method	method	NOUN
aiol-6350	120	3	limits	limit	NOUN
aiol-6350	120	4	of	of	ADP
aiol-6350	120	5	detection	detection	NOUN
aiol-6350	120	6	(	(	PUNCT
aiol-6350	120	7	lod	lod	PROPN
aiol-6350	120	8	)	)	PUNCT
aiol-6350	120	9	and	and	CCONJ
aiol-6350	120	10	method	method	NOUN
aiol-6350	120	11	limits	limit	NOUN
aiol-6350	120	12	of	of	ADP
aiol-6350	120	13	quantification	quantification	NOUN
aiol-6350	120	14	(	(	PUNCT
aiol-6350	120	15	loq	loq	PROPN
aiol-6350	120	16	)	)	PUNCT
aiol-6350	120	17	for	for	ADP
aiol-6350	120	18	each	each	DET
aiol-6350	120	19	cyanotoxin	cyanotoxin	NOUN
aiol-6350	120	20	analyzed	analyze	VERB
aiol-6350	120	21	referring	refer	VERB
aiol-6350	120	22	to	to	ADP
aiol-6350	120	23	50	50	NUM
aiol-6350	120	24	ml	ml	NOUN
aiol-6350	120	25	of	of	ADP
aiol-6350	120	26	water	water	NOUN
aiol-6350	120	27	concentrated	concentrate	VERB
aiol-6350	120	28	to	to	ADP
aiol-6350	120	29	a	a	DET
aiol-6350	120	30	final	final	ADJ
aiol-6350	120	31	volume	volume	NOUN
aiol-6350	120	32	of	of	ADP
aiol-6350	120	33	1	1	NUM
aiol-6350	120	34	ml	ml	NOUN
aiol-6350	120	35	are	be	AUX
aiol-6350	120	36	given	give	VERB
aiol-6350	120	37	in	in	ADP
aiol-6350	120	38	supplementary	supplementary	ADJ
aiol-6350	120	39	tab	tab	NOUN
aiol-6350	120	40	.	.	PUNCT
aiol-6350	121	1	1	1	X
aiol-6350	121	2	.	.	X
aiol-6350	121	3	a	a	DET
aiol-6350	121	4	representative	representative	ADJ
aiol-6350	121	5	chromatogram	chromatogram	NOUN
aiol-6350	121	6	of	of	ADP
aiol-6350	121	7	sample	sample	NOUN
aiol-6350	121	8	kκ	kκ	PROPN
aiol-6350	121	9	(	(	PUNCT
aiol-6350	121	10	26	26	NUM
aiol-6350	121	11	-	-	SYM
aiol-6350	121	12	7	7	NUM
aiol-6350	121	13	-	-	NUM
aiol-6350	121	14	2013	2013	NUM
aiol-6350	121	15	)	)	PUNCT
aiol-6350	121	16	is	be	AUX
aiol-6350	121	17	given	give	VERB
aiol-6350	121	18	in	in	ADP
aiol-6350	121	19	supplementary	supplementary	ADJ
aiol-6350	121	20	fig	fig	NOUN
aiol-6350	121	21	.	.	PUNCT
aiol-6350	122	1	1	1	X
aiol-6350	122	2	.	.	X
aiol-6350	122	3	cyanotoxin	cyanotoxin	NOUN
aiol-6350	122	4	concentrations	concentration	NOUN
aiol-6350	122	5	are	be	AUX
aiol-6350	122	6	given	give	VERB
aiol-6350	122	7	in	in	ADP
aiol-6350	122	8	μg	μg	PROPN
aiol-6350	122	9	l–1	l–1	PROPN
aiol-6350	122	10	.	.	PUNCT
aiol-6350	123	1	statistical	statistical	ADJ
aiol-6350	123	2	analyses	analysis	NOUN
aiol-6350	123	3	a	a	DET
aiol-6350	123	4	one	one	NUM
aiol-6350	123	5	-	-	PUNCT
aiol-6350	123	6	way	way	NOUN
aiol-6350	123	7	anova	anova	PROPN
aiol-6350	123	8	test	test	PROPN
aiol-6350	123	9	was	be	AUX
aiol-6350	123	10	used	use	VERB
aiol-6350	123	11	to	to	PART
aiol-6350	123	12	compare	compare	VERB
aiol-6350	123	13	the	the	DET
aiol-6350	123	14	means	mean	NOUN
aiol-6350	123	15	of	of	ADP
aiol-6350	123	16	physical	physical	ADJ
aiol-6350	123	17	,	,	PUNCT
aiol-6350	123	18	chemical	chemical	NOUN
aiol-6350	123	19	and	and	CCONJ
aiol-6350	123	20	biological	biological	ADJ
aiol-6350	123	21	parameters	parameter	NOUN
aiol-6350	123	22	among	among	ADP
aiol-6350	123	23	sampling	sample	VERB
aiol-6350	123	24	stations	station	NOUN
aiol-6350	123	25	,	,	PUNCT
aiol-6350	123	26	after	after	ADP
aiol-6350	123	27	check	check	NOUN
aiol-6350	123	28	for	for	ADP
aiol-6350	123	29	normality	normality	NOUN
aiol-6350	123	30	(	(	PUNCT
aiol-6350	123	31	shapiro	shapiro	NOUN
aiol-6350	123	32	-	-	PUNCT
aiol-6350	123	33	wilk	wilk	PROPN
aiol-6350	123	34	test	test	NOUN
aiol-6350	123	35	)	)	PUNCT
aiol-6350	123	36	and	and	CCONJ
aiol-6350	123	37	equality	equality	NOUN
aiol-6350	123	38	of	of	ADP
aiol-6350	123	39	variances	variance	NOUN
aiol-6350	123	40	(	(	PUNCT
aiol-6350	123	41	levene	levene	NOUN
aiol-6350	123	42	statistic	statistic	PROPN
aiol-6350	123	43	)	)	PUNCT
aiol-6350	123	44	.	.	PUNCT
aiol-6350	124	1	spearman	spearman	NOUN
aiol-6350	124	2	’s	’s	PART
aiol-6350	124	3	rank	rank	NOUN
aiol-6350	124	4	correlation	correlation	NOUN
aiol-6350	124	5	coefficient	coefficient	NOUN
aiol-6350	124	6	(	(	PUNCT
aiol-6350	124	7	r	r	NOUN
aiol-6350	124	8	)	)	PUNCT
aiol-6350	124	9	was	be	AUX
aiol-6350	124	10	used	use	VERB
aiol-6350	124	11	to	to	PART
aiol-6350	124	12	determine	determine	VERB
aiol-6350	124	13	correlation	correlation	NOUN
aiol-6350	124	14	between	between	ADP
aiol-6350	124	15	variables	variable	NOUN
aiol-6350	124	16	.	.	PUNCT
aiol-6350	125	1	analyses	analysis	NOUN
aiol-6350	125	2	were	be	AUX
aiol-6350	125	3	performed	perform	VERB
aiol-6350	125	4	with	with	ADP
aiol-6350	125	5	spss	spss	PROPN
aiol-6350	125	6	23.0	23.0	NUM
aiol-6350	125	7	(	(	PUNCT
aiol-6350	125	8	ibm	ibm	PROPN
aiol-6350	125	9	spss	spss	PROPN
aiol-6350	125	10	statistics	statistic	NOUN
aiol-6350	125	11	)	)	PUNCT
aiol-6350	125	12	.	.	PUNCT
aiol-6350	126	1	results	result	VERB
aiol-6350	126	2	physical	physical	ADJ
aiol-6350	126	3	-	-	PUNCT
aiol-6350	126	4	chemical	chemical	NOUN
aiol-6350	126	5	parameters	parameter	NOUN
aiol-6350	126	6	there	there	PRON
aiol-6350	126	7	was	be	VERB
aiol-6350	126	8	a	a	DET
aiol-6350	126	9	strong	strong	ADJ
aiol-6350	126	10	seasonal	seasonal	ADJ
aiol-6350	126	11	cycle	cycle	NOUN
aiol-6350	126	12	of	of	ADP
aiol-6350	126	13	water	water	NOUN
aiol-6350	126	14	temperature	temperature	NOUN
aiol-6350	126	15	ranging	range	VERB
aiol-6350	126	16	from	from	ADP
aiol-6350	126	17	14	14	NUM
aiol-6350	126	18	°	°	ADP
aiol-6350	126	19	c	c	NOUN
aiol-6350	126	20	to	to	ADP
aiol-6350	126	21	31	31	NUM
aiol-6350	126	22	°	°	ADP
aiol-6350	126	23	c	c	NOUN
aiol-6350	126	24	except	except	SCONJ
aiol-6350	126	25	in	in	ADP
aiol-6350	126	26	february	february	PROPN
aiol-6350	126	27	2015	2015	NUM
aiol-6350	126	28	where	where	SCONJ
aiol-6350	126	29	temperature	temperature	NOUN
aiol-6350	126	30	fell	fall	VERB
aiol-6350	126	31	to	to	ADP
aiol-6350	126	32	5	5	NUM
aiol-6350	126	33	°	°	ADP
aiol-6350	126	34	c	c	X
aiol-6350	126	35	(	(	PUNCT
aiol-6350	126	36	fig	fig	NOUN
aiol-6350	126	37	.	.	PUNCT
aiol-6350	127	1	2a	2a	NUM
aiol-6350	127	2	)	)	PUNCT
aiol-6350	127	3	.	.	PUNCT
aiol-6350	128	1	the	the	DET
aiol-6350	128	2	ph	ph	ADJ
aiol-6350	128	3	values	value	NOUN
aiol-6350	128	4	ranged	range	VERB
aiol-6350	128	5	from	from	ADP
aiol-6350	128	6	7.1	7.1	NUM
aiol-6350	128	7	to	to	ADP
aiol-6350	128	8	9.5	9.5	NUM
aiol-6350	128	9	,	,	PUNCT
aiol-6350	128	10	with	with	ADP
aiol-6350	128	11	a	a	DET
aiol-6350	128	12	maximum	maximum	NOUN
aiol-6350	128	13	of	of	ADP
aiol-6350	128	14	10.6	10.6	NUM
aiol-6350	128	15	in	in	ADP
aiol-6350	128	16	september	september	PROPN
aiol-6350	128	17	2014	2014	NUM
aiol-6350	128	18	at	at	ADP
aiol-6350	128	19	kl1	kl1	NOUN
aiol-6350	128	20	station	station	NOUN
aiol-6350	128	21	(	(	PUNCT
aiol-6350	128	22	fig	fig	NOUN
aiol-6350	128	23	.	.	PUNCT
aiol-6350	128	24	2b	2b	NUM
aiol-6350	128	25	)	)	PUNCT
aiol-6350	128	26	.	.	PUNCT
aiol-6350	129	1	dissolved	dissolve	VERB
aiol-6350	129	2	oxygen	oxygen	NOUN
aiol-6350	129	3	varied	varied	ADJ
aiol-6350	129	4	noticeably	noticeably	ADV
aiol-6350	129	5	in	in	ADP
aiol-6350	129	6	time	time	NOUN
aiol-6350	129	7	and	and	CCONJ
aiol-6350	129	8	space	space	NOUN
aiol-6350	129	9	,	,	PUNCT
aiol-6350	129	10	decreasing	decrease	VERB
aiol-6350	129	11	to	to	ADP
aiol-6350	129	12	<	<	X
aiol-6350	129	13	7	7	NUM
aiol-6350	129	14	mg	mg	ADP
aiol-6350	129	15	l–1	l–1	NOUN
aiol-6350	129	16	at	at	ADP
aiol-6350	129	17	some	some	DET
aiol-6350	129	18	stations	station	NOUN
aiol-6350	129	19	during	during	ADP
aiol-6350	129	20	the	the	DET
aiol-6350	129	21	warm	warm	ADJ
aiol-6350	129	22	months	month	NOUN
aiol-6350	129	23	(	(	PUNCT
aiol-6350	129	24	fig	fig	NOUN
aiol-6350	129	25	.	.	PUNCT
aiol-6350	130	1	2c	2c	NUM
aiol-6350	130	2	)	)	PUNCT
aiol-6350	130	3	.	.	PUNCT
aiol-6350	131	1	conductivity	conductivity	NOUN
aiol-6350	131	2	was	be	AUX
aiol-6350	131	3	very	very	ADV
aiol-6350	131	4	high	high	ADJ
aiol-6350	131	5	throughout	throughout	ADP
aiol-6350	131	6	the	the	DET
aiol-6350	131	7	whole	whole	ADJ
aiol-6350	131	8	study	study	NOUN
aiol-6350	131	9	period	period	NOUN
aiol-6350	131	10	,	,	PUNCT
aiol-6350	131	11	significantly	significantly	ADV
aiol-6350	131	12	higher	higher	ADV
aiol-6350	131	13	(	(	PUNCT
aiol-6350	131	14	anova	anova	PROPN
aiol-6350	131	15	,	,	PUNCT
aiol-6350	131	16	p<0.05	p<0.05	NOUN
aiol-6350	131	17	)	)	PUNCT
aiol-6350	131	18	in	in	ADP
aiol-6350	131	19	lake	lake	PROPN
aiol-6350	131	20	karla	karla	PROPN
aiol-6350	131	21	compared	compare	VERB
aiol-6350	131	22	to	to	ADP
aiol-6350	131	23	kalamaki	kalamaki	PROPN
aiol-6350	131	24	reservoir	reservoir	PROPN
aiol-6350	131	25	(	(	PUNCT
aiol-6350	131	26	fig	fig	NOUN
aiol-6350	131	27	.	.	PUNCT
aiol-6350	132	1	2d	2d	NUM
aiol-6350	132	2	)	)	PUNCT
aiol-6350	132	3	.	.	PUNCT
aiol-6350	133	1	water	water	NOUN
aiol-6350	133	2	transparency	transparency	NOUN
aiol-6350	133	3	was	be	AUX
aiol-6350	133	4	low	low	ADJ
aiol-6350	133	5	(	(	PUNCT
aiol-6350	133	6	<	<	X
aiol-6350	133	7	35	35	NUM
aiol-6350	133	8	cm	cm	NOUN
aiol-6350	133	9	)	)	PUNCT
aiol-6350	133	10	throughout	throughout	ADP
aiol-6350	133	11	the	the	DET
aiol-6350	133	12	whole	whole	ADJ
aiol-6350	133	13	study	study	NOUN
aiol-6350	133	14	period	period	NOUN
aiol-6350	133	15	(	(	PUNCT
aiol-6350	133	16	fig	fig	NOUN
aiol-6350	133	17	.	.	PUNCT
aiol-6350	134	1	2e	2e	NUM
aiol-6350	134	2	)	)	PUNCT
aiol-6350	134	3	.	.	PUNCT
aiol-6350	135	1	turbidity	turbidity	NOUN
aiol-6350	135	2	was	be	AUX
aiol-6350	135	3	relatively	relatively	ADV
aiol-6350	135	4	low	low	ADJ
aiol-6350	135	5	until	until	ADP
aiol-6350	135	6	mid-2014	mid-2014	NOUN
aiol-6350	135	7	where	where	SCONJ
aiol-6350	135	8	a	a	DET
aiol-6350	135	9	sharp	sharp	ADJ
aiol-6350	135	10	peak	peak	NOUN
aiol-6350	135	11	was	be	AUX
aiol-6350	135	12	recorded	record	VERB
aiol-6350	135	13	,	,	PUNCT
aiol-6350	135	14	after	after	ADP
aiol-6350	135	15	which	which	PRON
aiol-6350	135	16	it	it	PRON
aiol-6350	135	17	stayed	stay	VERB
aiol-6350	135	18	high	high	ADJ
aiol-6350	135	19	for	for	ADP
aiol-6350	135	20	the	the	DET
aiol-6350	135	21	rest	rest	NOUN
aiol-6350	135	22	of	of	ADP
aiol-6350	135	23	the	the	DET
aiol-6350	135	24	study	study	NOUN
aiol-6350	135	25	period	period	NOUN
aiol-6350	135	26	(	(	PUNCT
aiol-6350	135	27	fig	fig	NOUN
aiol-6350	135	28	.	.	PUNCT
aiol-6350	135	29	2f	2f	NUM
aiol-6350	135	30	)	)	PUNCT
aiol-6350	135	31	.	.	PUNCT
aiol-6350	136	1	with	with	ADP
aiol-6350	136	2	regard	regard	NOUN
aiol-6350	136	3	to	to	ADP
aiol-6350	136	4	nutrient	nutrient	ADJ
aiol-6350	136	5	concentrations	concentration	NOUN
aiol-6350	136	6	,	,	PUNCT
aiol-6350	136	7	nitrite	nitrite	NOUN
aiol-6350	136	8	nitrogen	nitrogen	NOUN
aiol-6350	136	9	(	(	PUNCT
aiol-6350	136	10	no2	no2	NOUN
aiol-6350	136	11	-	-	PUNCT
aiol-6350	136	12	n	n	CCONJ
aiol-6350	136	13	)	)	PUNCT
aiol-6350	136	14	was	be	AUX
aiol-6350	136	15	very	very	ADV
aiol-6350	136	16	low	low	ADJ
aiol-6350	136	17	and	and	CCONJ
aiol-6350	136	18	reached	reach	VERB
aiol-6350	136	19	undetectable	undetectable	ADJ
aiol-6350	136	20	concentrations	concentration	NOUN
aiol-6350	136	21	in	in	ADP
aiol-6350	136	22	all	all	DET
aiol-6350	136	23	stations	station	NOUN
aiol-6350	136	24	until	until	ADP
aiol-6350	136	25	may	may	PROPN
aiol-6350	136	26	2014	2014	NUM
aiol-6350	136	27	,	,	PUNCT
aiol-6350	136	28	after	after	ADP
aiol-6350	136	29	which	which	PRON
aiol-6350	136	30	it	it	PRON
aiol-6350	136	31	rose	rise	VERB
aiol-6350	136	32	and	and	CCONJ
aiol-6350	136	33	reached	reach	VERB
aiol-6350	136	34	a	a	DET
aiol-6350	136	35	peak	peak	NOUN
aiol-6350	136	36	of	of	ADP
aiol-6350	136	37	2.5	2.5	NUM
aiol-6350	136	38	mg	mg	NOUN
aiol-6350	136	39	l–1	l–1	PROPN
aiol-6350	136	40	at	at	ADP
aiol-6350	136	41	may	may	PROPN
aiol-6350	136	42	2015	2015	NUM
aiol-6350	136	43	(	(	PUNCT
aiol-6350	136	44	fig	fig	NOUN
aiol-6350	136	45	.	.	PUNCT
aiol-6350	137	1	3a	3a	NUM
aiol-6350	137	2	)	)	PUNCT
aiol-6350	137	3	.	.	PUNCT
aiol-6350	138	1	nitrate	nitrate	NOUN
aiol-6350	138	2	(	(	PUNCT
aiol-6350	138	3	no3	no3	NOUN
aiol-6350	138	4	-	-	PUNCT
aiol-6350	138	5	n	n	CCONJ
aiol-6350	138	6	)	)	PUNCT
aiol-6350	138	7	and	and	CCONJ
aiol-6350	138	8	ammonia	ammonia	NOUN
aiol-6350	138	9	(	(	PUNCT
aiol-6350	138	10	nh4	nh4	NOUN
aiol-6350	138	11	-	-	PUNCT
aiol-6350	138	12	n	n	CCONJ
aiol-6350	138	13	)	)	PUNCT
aiol-6350	138	14	nitrogen	nitrogen	NOUN
aiol-6350	138	15	were	be	AUX
aiol-6350	138	16	very	very	ADV
aiol-6350	138	17	high	high	ADJ
aiol-6350	138	18	and	and	CCONJ
aiol-6350	138	19	exhibited	exhibit	VERB
aiol-6350	138	20	temporal	temporal	ADJ
aiol-6350	138	21	and	and	CCONJ
aiol-6350	138	22	spatial	spatial	ADJ
aiol-6350	138	23	variation	variation	NOUN
aiol-6350	138	24	(	(	PUNCT
aiol-6350	138	25	fig	fig	NOUN
aiol-6350	138	26	.	.	PUNCT
aiol-6350	139	1	3	3	NUM
aiol-6350	139	2	b	b	NOUN
aiol-6350	139	3	,	,	PUNCT
aiol-6350	139	4	c	c	NOUN
aiol-6350	139	5	)	)	PUNCT
aiol-6350	139	6	.	.	PUNCT
aiol-6350	140	1	ammonia	ammonia	NOUN
aiol-6350	140	2	nitrogen	nitrogen	NOUN
aiol-6350	140	3	was	be	AUX
aiol-6350	140	4	the	the	DET
aiol-6350	140	5	most	most	ADV
aiol-6350	140	6	important	important	ADJ
aiol-6350	140	7	form	form	NOUN
aiol-6350	140	8	in	in	ADP
aiol-6350	140	9	the	the	DET
aiol-6350	140	10	din	din	NOUN
aiol-6350	140	11	pool	pool	NOUN
aiol-6350	140	12	.	.	PUNCT
aiol-6350	141	1	din	din	NOUN
aiol-6350	141	2	concentration	concentration	NOUN
aiol-6350	141	3	ranged	range	VERB
aiol-6350	141	4	from	from	ADP
aiol-6350	141	5	500	500	NUM
aiol-6350	141	6	μg	μg	NOUN
aiol-6350	141	7	l–1	l–1	PROPN
aiol-6350	141	8	at	at	ADP
aiol-6350	141	9	the	the	DET
aiol-6350	141	10	beginning	beginning	NOUN
aiol-6350	141	11	of	of	ADP
aiol-6350	141	12	the	the	DET
aiol-6350	141	13	study	study	NOUN
aiol-6350	141	14	to	to	ADP
aiol-6350	141	15	>	>	SYM
aiol-6350	141	16	15	15	NUM
aiol-6350	141	17	mg	mg	PROPN
aiol-6350	141	18	l–1	l–1	PROPN
aiol-6350	141	19	(	(	PUNCT
aiol-6350	141	20	july	july	PROPN
aiol-6350	141	21	-	-	PUNCT
aiol-6350	141	22	november	november	PROPN
aiol-6350	141	23	2015	2015	NUM
aiol-6350	141	24	)	)	PUNCT
aiol-6350	141	25	(	(	PUNCT
aiol-6350	141	26	fig	fig	NOUN
aiol-6350	141	27	.	.	PUNCT
aiol-6350	142	1	2d	2d	NOUN
aiol-6350	142	2	)	)	PUNCT
aiol-6350	142	3	.	.	PUNCT
aiol-6350	143	1	srp	srp	PROPN
aiol-6350	143	2	and	and	CCONJ
aiol-6350	143	3	tp	tp	NOUN
aiol-6350	143	4	concentrations	concentration	NOUN
aiol-6350	143	5	were	be	AUX
aiol-6350	143	6	high	high	ADJ
aiol-6350	143	7	and	and	CCONJ
aiol-6350	143	8	varied	varied	ADJ
aiol-6350	143	9	between	between	ADP
aiol-6350	143	10	undetectable	undetectable	ADJ
aiol-6350	143	11	concentrations	concentration	NOUN
aiol-6350	143	12	(	(	PUNCT
aiol-6350	143	13	novembermay	novembermay	NOUN
aiol-6350	143	14	2014	2014	NUM
aiol-6350	143	15	)	)	PUNCT
aiol-6350	143	16	and	and	CCONJ
aiol-6350	143	17	3	3	NUM
aiol-6350	143	18	mg	mg	NOUN
aiol-6350	143	19	l–1	l–1	PROPN
aiol-6350	143	20	(	(	PUNCT
aiol-6350	143	21	in	in	ADP
aiol-6350	143	22	september	september	PROPN
aiol-6350	143	23	2013	2013	NUM
aiol-6350	143	24	)	)	PUNCT
aiol-6350	143	25	(	(	PUNCT
aiol-6350	143	26	fig	fig	NOUN
aiol-6350	143	27	.	.	PUNCT
aiol-6350	144	1	3	3	NUM
aiol-6350	144	2	e	e	NOUN
aiol-6350	144	3	,	,	PUNCT
aiol-6350	144	4	f	f	NOUN
aiol-6350	144	5	)	)	PUNCT
aiol-6350	144	6	.	.	PUNCT
aiol-6350	145	1	the	the	DET
aiol-6350	145	2	din	din	PROPN
aiol-6350	145	3	/	/	SYM
aiol-6350	145	4	srp	srp	PROPN
aiol-6350	145	5	was	be	AUX
aiol-6350	145	6	generally	generally	ADV
aiol-6350	145	7	low	low	ADJ
aiol-6350	145	8	and	and	CCONJ
aiol-6350	145	9	below	below	ADP
aiol-6350	145	10	the	the	DET
aiol-6350	145	11	10	10	NUM
aiol-6350	145	12	threshold	threshold	NOUN
aiol-6350	145	13	,	,	PUNCT
aiol-6350	145	14	except	except	SCONJ
aiol-6350	145	15	between	between	ADP
aiol-6350	145	16	july	july	PROPN
aiol-6350	145	17	-	-	PUNCT
aiol-6350	145	18	november	november	PROPN
aiol-6350	145	19	2014	2014	NUM
aiol-6350	145	20	(	(	PUNCT
aiol-6350	145	21	fig	fig	NOUN
aiol-6350	145	22	.	.	PUNCT
aiol-6350	145	23	4a	4a	NUM
aiol-6350	145	24	)	)	PUNCT
aiol-6350	145	25	.	.	PUNCT
aiol-6350	146	1	phytoplankton	phytoplankton	NOUN
aiol-6350	146	2	a	a	DET
aiol-6350	146	3	total	total	NOUN
aiol-6350	146	4	of	of	ADP
aiol-6350	146	5	44	44	NUM
aiol-6350	146	6	phytoplankton	phytoplankton	NOUN
aiol-6350	146	7	species	specie	NOUN
aiol-6350	146	8	were	be	AUX
aiol-6350	146	9	identified	identify	VERB
aiol-6350	146	10	in	in	ADP
aiol-6350	146	11	the	the	DET
aiol-6350	146	12	lake	lake	NOUN
aiol-6350	146	13	water	water	NOUN
aiol-6350	146	14	samples	sample	NOUN
aiol-6350	146	15	during	during	ADP
aiol-6350	146	16	the	the	DET
aiol-6350	146	17	study	study	NOUN
aiol-6350	146	18	period	period	NOUN
aiol-6350	146	19	(	(	PUNCT
aiol-6350	146	20	tab	tab	NOUN
aiol-6350	146	21	.	.	NOUN
aiol-6350	146	22	2	2	NUM
aiol-6350	146	23	)	)	PUNCT
aiol-6350	146	24	.	.	PUNCT
aiol-6350	147	1	cyanobacteria	cyanobacteria	PROPN
aiol-6350	147	2	were	be	AUX
aiol-6350	147	3	the	the	DET
aiol-6350	147	4	taxonomic	taxonomic	ADJ
aiol-6350	147	5	group	group	NOUN
aiol-6350	147	6	with	with	ADP
aiol-6350	147	7	the	the	DET
aiol-6350	147	8	highest	high	ADJ
aiol-6350	147	9	number	number	NOUN
aiol-6350	147	10	of	of	ADP
aiol-6350	147	11	species	specie	NOUN
aiol-6350	147	12	(	(	PUNCT
aiol-6350	147	13	23	23	NUM
aiol-6350	147	14	)	)	PUNCT
aiol-6350	147	15	,	,	PUNCT
aiol-6350	147	16	followed	follow	VERB
aiol-6350	147	17	by	by	ADP
aiol-6350	147	18	chlorophytes	chlorophyte	NOUN
aiol-6350	147	19	(	(	PUNCT
aiol-6350	147	20	13	13	NUM
aiol-6350	147	21	)	)	PUNCT
aiol-6350	147	22	,	,	PUNCT
aiol-6350	147	23	diatoms	diatom	NOUN
aiol-6350	147	24	(	(	PUNCT
aiol-6350	147	25	6	6	NUM
aiol-6350	147	26	)	)	PUNCT
aiol-6350	147	27	,	,	PUNCT
aiol-6350	147	28	cryptophytes	cryptophyte	NOUN
aiol-6350	147	29	(	(	PUNCT
aiol-6350	147	30	1	1	NUM
aiol-6350	147	31	)	)	PUNCT
aiol-6350	147	32	,	,	PUNCT
aiol-6350	147	33	and	and	CCONJ
aiol-6350	147	34	euglenophytes	euglenophyte	NOUN
aiol-6350	147	35	(	(	PUNCT
aiol-6350	147	36	1	1	NUM
aiol-6350	147	37	)	)	PUNCT
aiol-6350	147	38	.	.	PUNCT
aiol-6350	148	1	cyanobacteria	cyanobacteria	PROPN
aiol-6350	148	2	dominated	dominate	VERB
aiol-6350	148	3	the	the	DET
aiol-6350	148	4	phytoplankton	phytoplankton	NOUN
aiol-6350	148	5	’s	’s	PART
aiol-6350	148	6	biomass	biomass	NOUN
aiol-6350	148	7	(	(	PUNCT
aiol-6350	148	8	fig	fig	NOUN
aiol-6350	148	9	.	.	PUNCT
aiol-6350	149	1	5	5	NUM
aiol-6350	149	2	)	)	PUNCT
aiol-6350	149	3	.	.	PUNCT
aiol-6350	150	1	phytoplankton	phytoplankton	NOUN
aiol-6350	150	2	blooms	bloom	NOUN
aiol-6350	150	3	were	be	AUX
aiol-6350	150	4	observed	observe	VERB
aiol-6350	150	5	in	in	ADP
aiol-6350	150	6	lake	lake	PROPN
aiol-6350	150	7	karla	karla	PROPN
aiol-6350	150	8	and	and	CCONJ
aiol-6350	150	9	kalamaki	kalamaki	PROPN
aiol-6350	150	10	reservoir	reservoir	PROPN
aiol-6350	150	11	almost	almost	ADV
aiol-6350	150	12	throughout	throughout	ADP
aiol-6350	150	13	the	the	DET
aiol-6350	150	14	whole	whole	ADJ
aiol-6350	150	15	monitoring	monitoring	NOUN
aiol-6350	150	16	period	period	NOUN
aiol-6350	150	17	with	with	ADP
aiol-6350	150	18	cyanobacteria	cyanobacteria	NOUN
aiol-6350	150	19	consisting	consist	VERB
aiol-6350	150	20	on	on	ADP
aiol-6350	150	21	average	average	ADJ
aiol-6350	150	22	ca	ca	NOUN
aiol-6350	150	23	.	.	PUNCT
aiol-6350	150	24	85	85	NUM
aiol-6350	150	25	%	%	NOUN
aiol-6350	150	26	of	of	ADP
aiol-6350	150	27	the	the	DET
aiol-6350	150	28	total	total	ADJ
aiol-6350	150	29	phytoplankton	phytoplankton	NOUN
aiol-6350	150	30	biomass	biomass	NOUN
aiol-6350	150	31	(	(	PUNCT
aiol-6350	150	32	fig	fig	NOUN
aiol-6350	150	33	.	.	PUNCT
aiol-6350	151	1	5	5	NUM
aiol-6350	151	2	)	)	PUNCT
aiol-6350	151	3	.	.	PUNCT
aiol-6350	152	1	total	total	ADJ
aiol-6350	152	2	cyanobacterial	cyanobacterial	ADJ
aiol-6350	152	3	biomass	biomass	NOUN
aiol-6350	152	4	ranged	range	VERB
aiol-6350	152	5	from	from	ADP
aiol-6350	152	6	15	15	NUM
aiol-6350	152	7	to	to	PART
aiol-6350	152	8	230	230	NUM
aiol-6350	152	9	mg	mg	NOUN
aiol-6350	152	10	l–1	l–1	NOUN
aiol-6350	152	11	reaching	reach	VERB
aiol-6350	152	12	its	its	PRON
aiol-6350	152	13	peak	peak	NOUN
aiol-6350	152	14	at	at	ADP
aiol-6350	152	15	september	september	PROPN
aiol-6350	152	16	2013	2013	NUM
aiol-6350	152	17	(	(	PUNCT
aiol-6350	152	18	kl1	kl1	NOUN
aiol-6350	152	19	and	and	CCONJ
aiol-6350	152	20	kk	kk	PROPN
aiol-6350	152	21	stations	station	NOUN
aiol-6350	152	22	)	)	PUNCT
aiol-6350	152	23	,	,	PUNCT
aiol-6350	152	24	february	february	PROPN
aiol-6350	152	25	2013	2013	NUM
aiol-6350	152	26	(	(	PUNCT
aiol-6350	152	27	kk	kk	PROPN
aiol-6350	152	28	)	)	PUNCT
aiol-6350	152	29	and	and	CCONJ
aiol-6350	152	30	july	july	PROPN
aiol-6350	152	31	2014	2014	NUM
aiol-6350	152	32	(	(	PUNCT
aiol-6350	152	33	kl1	kl1	PROPN
aiol-6350	152	34	)	)	PUNCT
aiol-6350	152	35	(	(	PUNCT
aiol-6350	152	36	fig	fig	NOUN
aiol-6350	152	37	.	.	PUNCT
aiol-6350	153	1	6	6	NUM
aiol-6350	153	2	)	)	PUNCT
aiol-6350	153	3	.	.	PUNCT
aiol-6350	154	1	the	the	DET
aiol-6350	154	2	biomass	biomass	NOUN
aiol-6350	154	3	temporal	temporal	ADJ
aiol-6350	154	4	variation	variation	NOUN
aiol-6350	154	5	was	be	AUX
aiol-6350	154	6	not	not	PART
aiol-6350	154	7	the	the	DET
aiol-6350	154	8	same	same	ADJ
aiol-6350	154	9	in	in	ADP
aiol-6350	154	10	the	the	DET
aiol-6350	154	11	two	two	NUM
aiol-6350	154	12	years	year	NOUN
aiol-6350	154	13	of	of	ADP
aiol-6350	154	14	monitoring	monitoring	NOUN
aiol-6350	154	15	:	:	PUNCT
aiol-6350	154	16	after	after	SCONJ
aiol-6350	154	17	the	the	DET
aiol-6350	154	18	warm	warm	ADJ
aiol-6350	154	19	period	period	NOUN
aiol-6350	154	20	of	of	ADP
aiol-6350	154	21	2013	2013	NUM
aiol-6350	154	22	showed	show	VERB
aiol-6350	154	23	a	a	DET
aiol-6350	154	24	decrease	decrease	NOUN
aiol-6350	154	25	in	in	ADP
aiol-6350	154	26	november	november	PROPN
aiol-6350	154	27	to	to	PART
aiol-6350	154	28	reach	reach	VERB
aiol-6350	154	29	high	high	ADJ
aiol-6350	154	30	values	value	NOUN
aiol-6350	155	1	durs	durs	PROPN
aiol-6350	155	2	.	.	PUNCT
aiol-6350	155	3	gkelis	gkelis	PROPN
aiol-6350	155	4	et	et	PROPN
aiol-6350	155	5	al.38	al.38	PROPN
aiol-6350	155	6	fig	fig	PROPN
aiol-6350	155	7	.	.	PUNCT
aiol-6350	156	1	2	2	X
aiol-6350	156	2	.	.	X
aiol-6350	156	3	physical	physical	ADJ
aiol-6350	156	4	and	and	CCONJ
aiol-6350	156	5	chemical	chemical	NOUN
aiol-6350	156	6	parameters	parameter	NOUN
aiol-6350	156	7	in	in	ADP
aiol-6350	156	8	lake	lake	PROPN
aiol-6350	156	9	karla	karla	PROPN
aiol-6350	156	10	(	(	PUNCT
aiol-6350	156	11	kl1	kl1	PROPN
aiol-6350	156	12	,	,	PUNCT
aiol-6350	156	13	kl2	kl2	PROPN
aiol-6350	156	14	,	,	PUNCT
aiol-6350	156	15	kl3	kl3	PROPN
aiol-6350	156	16	)	)	PUNCT
aiol-6350	156	17	and	and	CCONJ
aiol-6350	156	18	kalamaki	kalamaki	PROPN
aiol-6350	156	19	reservoir	reservoir	PROPN
aiol-6350	156	20	(	(	PUNCT
aiol-6350	156	21	kk	kk	PROPN
aiol-6350	156	22	)	)	PUNCT
aiol-6350	156	23	from	from	ADP
aiol-6350	156	24	july	july	PROPN
aiol-6350	156	25	2013	2013	NUM
aiol-6350	156	26	to	to	ADP
aiol-6350	156	27	july	july	PROPN
aiol-6350	156	28	2015	2015	NUM
aiol-6350	156	29	.	.	PUNCT
aiol-6350	157	1	a	a	DET
aiol-6350	157	2	)	)	PUNCT
aiol-6350	157	3	temperature	temperature	NOUN
aiol-6350	157	4	;	;	PUNCT
aiol-6350	157	5	b	b	X
aiol-6350	157	6	)	)	PUNCT
aiol-6350	157	7	ph	ph	VERB
aiol-6350	157	8	;	;	PUNCT
aiol-6350	157	9	c	c	X
aiol-6350	157	10	)	)	PUNCT
aiol-6350	157	11	dissolved	dissolve	VERB
aiol-6350	157	12	oxygen	oxygen	NOUN
aiol-6350	157	13	;	;	PUNCT
aiol-6350	157	14	d	d	X
aiol-6350	157	15	)	)	PUNCT
aiol-6350	157	16	conductivity	conductivity	NOUN
aiol-6350	157	17	;	;	PUNCT
aiol-6350	157	18	e	e	X
aiol-6350	157	19	)	)	PUNCT
aiol-6350	157	20	transparency	transparency	NOUN
aiol-6350	157	21	;	;	PUNCT
aiol-6350	157	22	f	f	X
aiol-6350	157	23	)	)	PUNCT
aiol-6350	157	24	,	,	PUNCT
aiol-6350	157	25	turbidity	turbidity	NOUN
aiol-6350	157	26	.	.	PUNCT
aiol-6350	158	1	water	water	NOUN
aiol-6350	158	2	quality	quality	NOUN
aiol-6350	158	3	and	and	CCONJ
aiol-6350	158	4	cyanotoxins	cyanotoxin	NOUN
aiol-6350	158	5	in	in	ADP
aiol-6350	158	6	the	the	DET
aiol-6350	158	7	reconstructed	reconstructed	ADJ
aiol-6350	158	8	lake	lake	NOUN
aiol-6350	158	9	karla	karla	PROPN
aiol-6350	158	10	39	39	NUM
aiol-6350	158	11	ing	e	VERB
aiol-6350	158	12	the	the	DET
aiol-6350	158	13	cold	cold	ADJ
aiol-6350	158	14	period	period	NOUN
aiol-6350	158	15	(	(	PUNCT
aiol-6350	158	16	february	february	NOUN
aiol-6350	158	17	-	-	PUNCT
aiol-6350	158	18	may	may	PROPN
aiol-6350	158	19	)	)	PUNCT
aiol-6350	158	20	of	of	ADP
aiol-6350	158	21	2014	2014	NUM
aiol-6350	158	22	.	.	PUNCT
aiol-6350	159	1	the	the	DET
aiol-6350	159	2	rapid	rapid	ADJ
aiol-6350	159	3	decrease	decrease	NOUN
aiol-6350	159	4	of	of	ADP
aiol-6350	159	5	temperature	temperature	NOUN
aiol-6350	159	6	in	in	ADP
aiol-6350	159	7	november	november	PROPN
aiol-6350	159	8	2014	2014	NUM
aiol-6350	159	9	combined	combine	VERB
aiol-6350	159	10	with	with	ADP
aiol-6350	159	11	the	the	DET
aiol-6350	159	12	high	high	ADJ
aiol-6350	159	13	turbidity	turbidity	NOUN
aiol-6350	159	14	coincided	coincide	VERB
aiol-6350	159	15	with	with	ADP
aiol-6350	159	16	the	the	DET
aiol-6350	159	17	lower	low	ADJ
aiol-6350	159	18	biomass	biomass	NOUN
aiol-6350	159	19	values	value	NOUN
aiol-6350	159	20	(	(	PUNCT
aiol-6350	159	21	except	except	SCONJ
aiol-6350	159	22	kl1	kl1	PROPN
aiol-6350	159	23	station	station	NOUN
aiol-6350	159	24	)	)	PUNCT
aiol-6350	159	25	in	in	ADP
aiol-6350	159	26	the	the	DET
aiol-6350	159	27	warm	warm	ADJ
aiol-6350	159	28	period	period	NOUN
aiol-6350	159	29	in	in	ADP
aiol-6350	159	30	2014	2014	NUM
aiol-6350	159	31	;	;	PUNCT
aiol-6350	159	32	biomass	biomass	NOUN
aiol-6350	159	33	remained	remain	VERB
aiol-6350	159	34	low	low	ADJ
aiol-6350	159	35	until	until	ADP
aiol-6350	159	36	the	the	DET
aiol-6350	159	37	end	end	NOUN
aiol-6350	159	38	of	of	ADP
aiol-6350	159	39	the	the	DET
aiol-6350	159	40	monitoring	monitoring	NOUN
aiol-6350	159	41	program	program	NOUN
aiol-6350	159	42	in	in	ADP
aiol-6350	159	43	july	july	PROPN
aiol-6350	159	44	2015	2015	NUM
aiol-6350	159	45	.	.	PUNCT
aiol-6350	160	1	biomass	biomass	NOUN
aiol-6350	160	2	was	be	AUX
aiol-6350	160	3	negatively	negatively	ADV
aiol-6350	160	4	but	but	CCONJ
aiol-6350	160	5	not	not	PART
aiol-6350	160	6	highly	highly	ADV
aiol-6350	160	7	correlated	correlate	VERB
aiol-6350	160	8	with	with	ADP
aiol-6350	160	9	ph	ph	VERB
aiol-6350	160	10	,	,	PUNCT
aiol-6350	160	11	do	do	VERB
aiol-6350	160	12	,	,	PUNCT
aiol-6350	160	13	no3	no3	PROPN
aiol-6350	160	14	-	-	PUNCT
aiol-6350	160	15	n	n	NOUN
aiol-6350	160	16	,	,	PUNCT
aiol-6350	160	17	no2	no2	NOUN
aiol-6350	160	18	-	-	PUNCT
aiol-6350	160	19	n	n	NOUN
aiol-6350	160	20	,	,	PUNCT
aiol-6350	160	21	and	and	CCONJ
aiol-6350	160	22	conductivity	conductivity	NOUN
aiol-6350	160	23	(	(	PUNCT
aiol-6350	160	24	supplementary	supplementary	ADJ
aiol-6350	160	25	tab	tab	NOUN
aiol-6350	160	26	.	.	PUNCT
aiol-6350	161	1	2	2	NUM
aiol-6350	161	2	)	)	PUNCT
aiol-6350	161	3	.	.	PUNCT
aiol-6350	162	1	the	the	DET
aiol-6350	162	2	biomass	biomass	NOUN
aiol-6350	162	3	was	be	AUX
aiol-6350	162	4	significantly	significantly	ADV
aiol-6350	162	5	higher	high	ADJ
aiol-6350	162	6	(	(	PUNCT
aiol-6350	162	7	p<0.05	p<0.05	NOUN
aiol-6350	162	8	)	)	PUNCT
aiol-6350	162	9	in	in	ADP
aiol-6350	162	10	kalamaki	kalamaki	PROPN
aiol-6350	162	11	reservoir	reservoir	PROPN
aiol-6350	162	12	(	(	PUNCT
aiol-6350	162	13	kk	kk	PROPN
aiol-6350	162	14	)	)	PUNCT
aiol-6350	162	15	and	and	CCONJ
aiol-6350	162	16	lake	lake	PROPN
aiol-6350	162	17	karla	karla	PROPN
aiol-6350	162	18	kl1	kl1	PROPN
aiol-6350	162	19	station	station	NOUN
aiol-6350	162	20	compared	compare	VERB
aiol-6350	162	21	to	to	ADP
aiol-6350	162	22	kl2	kl2	PROPN
aiol-6350	162	23	and	and	CCONJ
aiol-6350	162	24	kl3	kl3	PROPN
aiol-6350	162	25	stations	station	NOUN
aiol-6350	162	26	.	.	PUNCT
aiol-6350	163	1	all	all	DET
aiol-6350	163	2	biomass	biomass	NOUN
aiol-6350	163	3	values	value	NOUN
aiol-6350	163	4	exceeded	exceed	VERB
aiol-6350	163	5	the	the	DET
aiol-6350	163	6	good	good	ADJ
aiol-6350	163	7	/	/	SYM
aiol-6350	163	8	moderate	moderate	ADJ
aiol-6350	163	9	and	and	CCONJ
aiol-6350	163	10	bad	bad	ADJ
aiol-6350	163	11	threshold	threshold	NOUN
aiol-6350	163	12	for	for	ADP
aiol-6350	163	13	ecological	ecological	ADJ
aiol-6350	163	14	status	status	NOUN
aiol-6350	163	15	,	,	PUNCT
aiol-6350	163	16	as	as	ADV
aiol-6350	163	17	well	well	ADV
aiol-6350	163	18	as	as	ADP
aiol-6350	163	19	the	the	DET
aiol-6350	163	20	who	who	PRON
aiol-6350	163	21	guidance	guidance	NOUN
aiol-6350	163	22	level	level	NOUN
aiol-6350	163	23	2	2	NUM
aiol-6350	163	24	;	;	PUNCT
aiol-6350	163	25	during	during	ADP
aiol-6350	163	26	the	the	DET
aiol-6350	163	27	warm	warm	ADJ
aiol-6350	163	28	period	period	NOUN
aiol-6350	163	29	the	the	DET
aiol-6350	163	30	biomass	biomass	NOUN
aiol-6350	163	31	also	also	ADV
aiol-6350	163	32	exceeded	exceed	VERB
aiol-6350	163	33	the	the	DET
aiol-6350	163	34	who	who	PRON
aiol-6350	163	35	guidance	guidance	NOUN
aiol-6350	163	36	level	level	NOUN
aiol-6350	163	37	3	3	NUM
aiol-6350	163	38	(	(	PUNCT
aiol-6350	163	39	fig	fig	NOUN
aiol-6350	163	40	.	.	PUNCT
aiol-6350	164	1	4b	4b	PROPN
aiol-6350	164	2	)	)	PUNCT
aiol-6350	164	3	.	.	PUNCT
aiol-6350	165	1	in	in	ADP
aiol-6350	165	2	both	both	DET
aiol-6350	165	3	waterbodies	waterbodie	NOUN
aiol-6350	165	4	nitrogen	nitrogen	NOUN
aiol-6350	165	5	-	-	PUNCT
aiol-6350	165	6	fixing	fix	VERB
aiol-6350	165	7	nostocales	nostocale	NOUN
aiol-6350	165	8	cyanobacteria	cyanobacteria	NOUN
aiol-6350	165	9	were	be	AUX
aiol-6350	165	10	dominant	dominant	ADJ
aiol-6350	165	11	throughout	throughout	ADP
aiol-6350	165	12	the	the	DET
aiol-6350	165	13	study	study	NOUN
aiol-6350	165	14	period	period	NOUN
aiol-6350	165	15	tab	tab	NOUN
aiol-6350	165	16	.	.	PUNCT
aiol-6350	166	1	2	2	X
aiol-6350	166	2	.	.	X
aiol-6350	166	3	phytoplankton	phytoplankton	NOUN
aiol-6350	166	4	taxa	taxa	NOUN
aiol-6350	166	5	identified	identify	VERB
aiol-6350	166	6	in	in	ADP
aiol-6350	166	7	lake	lake	PROPN
aiol-6350	166	8	karla	karla	PROPN
aiol-6350	166	9	and	and	CCONJ
aiol-6350	166	10	kalamaki	kalamaki	PROPN
aiol-6350	166	11	reservoir	reservoir	PROPN
aiol-6350	166	12	during	during	ADP
aiol-6350	166	13	the	the	DET
aiol-6350	166	14	study	study	NOUN
aiol-6350	166	15	period	period	NOUN
aiol-6350	166	16	.	.	PUNCT
aiol-6350	167	1	taxa	taxa	NOUN
aiol-6350	167	2	cyanobacteria	cyanobacteria	NOUN
aiol-6350	167	3	(	(	PUNCT
aiol-6350	167	4	23	23	NUM
aiol-6350	167	5	)	)	PUNCT
aiol-6350	167	6	anabaenopsis	anabaenopsis	NOUN
aiol-6350	167	7	elenkinii	elenkinii	NOUN
aiol-6350	167	8	v.v.miller	v.v.miller	NOUN
aiol-6350	167	9	1923	1923	NUM
aiol-6350	167	10	aphanizomenon	aphanizomenon	NOUN
aiol-6350	167	11	sp	sp	PROPN
aiol-6350	167	12	.	.	PROPN
aiol-6350	167	13	aphanocapsa	aphanocapsa	PROPN
aiol-6350	167	14	sp	sp	PROPN
aiol-6350	167	15	.	.	PROPN
aiol-6350	167	16	arthrospira	arthrospira	PROPN
aiol-6350	167	17	sp	sp	PROPN
aiol-6350	167	18	.	.	PROPN
aiol-6350	167	19	chroococcus	chroococcus	PROPN
aiol-6350	167	20	sp	sp	PROPN
aiol-6350	167	21	.	.	PROPN
aiol-6350	167	22	cuspidothrix	cuspidothrix	PROPN
aiol-6350	167	23	issatchenkoi	issatchenkoi	NOUN
aiol-6350	167	24	(	(	PUNCT
aiol-6350	167	25	usacev	usacev	ADJ
aiol-6350	167	26	)	)	PUNCT
aiol-6350	167	27	rajaniemi	rajaniemi	NOUN
aiol-6350	167	28	,	,	PUNCT
aiol-6350	167	29	komárek	komárek	PROPN
aiol-6350	167	30	,	,	PUNCT
aiol-6350	167	31	willame	willame	ADJ
aiol-6350	167	32	,	,	PUNCT
aiol-6350	167	33	hrouzek	hrouzek	NOUN
aiol-6350	167	34	,	,	PUNCT
aiol-6350	167	35	kastovská	kastovská	ADJ
aiol-6350	167	36	,	,	PUNCT
aiol-6350	167	37	hoffmann	hoffmann	PROPN
aiol-6350	167	38	et	et	PROPN
aiol-6350	167	39	sivonen	sivonen	PROPN
aiol-6350	167	40	2005	2005	NUM
aiol-6350	167	41	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	167	42	raciborskii	raciborskii	ADJ
aiol-6350	167	43	(	(	PUNCT
aiol-6350	167	44	woloszynska	woloszynska	NOUN
aiol-6350	167	45	)	)	PUNCT
aiol-6350	167	46	seenayya	seenayya	PROPN
aiol-6350	167	47	et	et	PROPN
aiol-6350	167	48	subba	subba	PROPN
aiol-6350	167	49	raju	raju	PROPN
aiol-6350	167	50	1972	1972	NUM
aiol-6350	167	51	dolichospermum	dolichospermum	PROPN
aiol-6350	167	52	spp	spp	NOUN
aiol-6350	167	53	.	.	PUNCT
aiol-6350	168	1	gloeocapsa	gloeocapsa	NOUN
aiol-6350	168	2	sp	sp	PROPN
aiol-6350	168	3	.	.	PUNCT
aiol-6350	168	4	gomphosphaeria	gomphosphaeria	PROPN
aiol-6350	168	5	sp	sp	PROPN
aiol-6350	168	6	.	.	PROPN
aiol-6350	168	7	limnothrix	limnothrix	PROPN
aiol-6350	168	8	redekei	redekei	NOUN
aiol-6350	168	9	(	(	PUNCT
aiol-6350	168	10	van	van	PROPN
aiol-6350	168	11	goor	goor	PROPN
aiol-6350	168	12	)	)	PUNCT
aiol-6350	168	13	meffert	meffert	ADJ
aiol-6350	168	14	1988	1988	NUM
aiol-6350	168	15	merismopedia	merismopedia	PROPN
aiol-6350	168	16	sp	sp	PROPN
aiol-6350	168	17	.	.	PROPN
aiol-6350	168	18	microcystis	microcystis	PROPN
aiol-6350	168	19	aeruginosa	aeruginosa	PROPN
aiol-6350	168	20	(	(	PUNCT
aiol-6350	168	21	kützing	kützing	NOUN
aiol-6350	168	22	)	)	PUNCT
aiol-6350	168	23	kützing	kütze	VERB
aiol-6350	168	24	1846	1846	NUM
aiol-6350	168	25	microcystis	microcystis	PROPN
aiol-6350	168	26	flos	flos	PROPN
aiol-6350	168	27	-	-	PUNCT
aiol-6350	168	28	aquae	aquae	PROPN
aiol-6350	168	29	(	(	PUNCT
aiol-6350	168	30	wittrock	wittrock	NOUN
aiol-6350	168	31	)	)	PUNCT
aiol-6350	168	32	kirchner	kirchner	PROPN
aiol-6350	168	33	1898	1898	NUM
aiol-6350	168	34	microcystis	microcystis	PROPN
aiol-6350	168	35	sp	sp	PROPN
aiol-6350	168	36	.	.	PROPN
aiol-6350	168	37	planktolyngbya	planktolyngbya	PROPN
aiol-6350	168	38	cf	cf	X
aiol-6350	168	39	.	.	PUNCT
aiol-6350	169	1	limnetica	limnetica	PROPN
aiol-6350	169	2	planktothrix	planktothrix	VERB
aiol-6350	169	3	agardhii	agardhii	NOUN
aiol-6350	169	4	(	(	PUNCT
aiol-6350	169	5	gomont	gomont	NOUN
aiol-6350	169	6	)	)	PUNCT
aiol-6350	169	7	anagnostidis	anagnostidi	NOUN
aiol-6350	169	8	et	et	NOUN
aiol-6350	169	9	komárek	komárek	NOUN
aiol-6350	169	10	1988	1988	NUM
aiol-6350	169	11	pseudanabaena	pseudanabaena	NOUN
aiol-6350	169	12	limnetica	limnetica	NOUN
aiol-6350	169	13	(	(	PUNCT
aiol-6350	169	14	lemmermann	lemmermann	PROPN
aiol-6350	169	15	)	)	PUNCT
aiol-6350	169	16	komárek	komárek	NOUN
aiol-6350	169	17	1974	1974	NUM
aiol-6350	170	1	pseudanabaena	pseudanabaena	NOUN
aiol-6350	170	2	mucicola	mucicola	NOUN
aiol-6350	170	3	(	(	PUNCT
aiol-6350	170	4	naumann	naumann	NOUN
aiol-6350	170	5	et	et	PROPN
aiol-6350	170	6	huber	huber	PROPN
aiol-6350	170	7	-	-	PUNCT
aiol-6350	170	8	pestalozzi	pestalozzi	NOUN
aiol-6350	170	9	)	)	PUNCT
aiol-6350	170	10	schwabe	schwabe	NOUN
aiol-6350	170	11	1964	1964	NUM
aiol-6350	170	12	radiocystis	radiocystis	PROPN
aiol-6350	170	13	geminata	geminata	PROPN
aiol-6350	170	14	skuja	skuja	PROPN
aiol-6350	170	15	1948	1948	NUM
aiol-6350	170	16	snowella	snowella	NOUN
aiol-6350	170	17	litoralis	litoralis	PROPN
aiol-6350	170	18	(	(	PUNCT
aiol-6350	170	19	häyrén	häyrén	PROPN
aiol-6350	170	20	)	)	PUNCT
aiol-6350	171	1	komárek	komárek	NOUN
aiol-6350	171	2	et	et	PROPN
aiol-6350	171	3	hindák	hindák	ADJ
aiol-6350	171	4	1988	1988	NUM
aiol-6350	171	5	sphaerospermopsis	sphaerospermopsis	NOUN
aiol-6350	171	6	aphanizomenoides	aphanizomenoide	NOUN
aiol-6350	171	7	(	(	PUNCT
aiol-6350	171	8	forti	forti	NOUN
aiol-6350	171	9	)	)	PUNCT
aiol-6350	171	10	zapomelová	zapomelová	NOUN
aiol-6350	171	11	,	,	PUNCT
aiol-6350	171	12	jezberová	jezberová	PROPN
aiol-6350	171	13	,	,	PUNCT
aiol-6350	171	14	hrouzek	hrouzek	PROPN
aiol-6350	171	15	,	,	PUNCT
aiol-6350	171	16	hisem	hisem	NOUN
aiol-6350	171	17	,	,	PUNCT
aiol-6350	171	18	reháková	reháková	VERB
aiol-6350	171	19	et	et	NOUN
aiol-6350	171	20	komárková	komárková	NOUN
aiol-6350	171	21	2012	2012	NUM
aiol-6350	171	22	synechococcus	synechococcus	NOUN
aiol-6350	171	23	sp	sp	NOUN
aiol-6350	171	24	.	.	PROPN
aiol-6350	171	25	chlorophyta	chlorophyta	NOUN
aiol-6350	171	26	(	(	PUNCT
aiol-6350	171	27	13	13	NUM
aiol-6350	171	28	)	)	PUNCT
aiol-6350	171	29	chlamydomonas	chlamydomonas	NOUN
aiol-6350	171	30	sp	sp	PROPN
aiol-6350	171	31	.	.	PUNCT
aiol-6350	171	32	chlorella	chlorella	PROPN
aiol-6350	171	33	sp	sp	PROPN
aiol-6350	171	34	.	.	PUNCT
aiol-6350	171	35	chlorococcum	chlorococcum	PROPN
aiol-6350	171	36	citriforme	citriforme	PROPN
aiol-6350	171	37	archibald	archibald	PROPN
aiol-6350	171	38	et	et	PROPN
aiol-6350	171	39	bold	bold	ADJ
aiol-6350	171	40	1970	1970	NUM
aiol-6350	171	41	coelastrum	coelastrum	PROPN
aiol-6350	171	42	sp	sp	PROPN
aiol-6350	171	43	.	.	PROPN
aiol-6350	171	44	desmodesmus	desmodesmus	PROPN
aiol-6350	171	45	communis	communis	PROPN
aiol-6350	171	46	(	(	PUNCT
aiol-6350	171	47	e.	e.	PROPN
aiol-6350	171	48	hegewald	hegewald	PROPN
aiol-6350	171	49	)	)	PUNCT
aiol-6350	171	50	e.hegewald	e.hegewald	PROPN
aiol-6350	172	1	2000	2000	NUM
aiol-6350	172	2	dictyosphaerium	dictyosphaerium	NOUN
aiol-6350	172	3	pulchellum	pulchellum	PROPN
aiol-6350	172	4	h.c	h.c	PROPN
aiol-6350	172	5	.	.	PUNCT
aiol-6350	172	6	wood	wood	NOUN
aiol-6350	172	7	1873	1873	NUM
aiol-6350	172	8	gloeocystis	gloeocystis	PROPN
aiol-6350	172	9	sp	sp	PROPN
aiol-6350	172	10	.	.	PUNCT
aiol-6350	172	11	monoraphidium	monoraphidium	PROPN
aiol-6350	172	12	sp	sp	PROPN
aiol-6350	172	13	.	.	PROPN
aiol-6350	172	14	pediastrum	pediastrum	PROPN
aiol-6350	172	15	boryanum	boryanum	PROPN
aiol-6350	172	16	(	(	PUNCT
aiol-6350	172	17	turpin	turpin	PROPN
aiol-6350	172	18	)	)	PUNCT
aiol-6350	172	19	meneghini	meneghini	ADJ
aiol-6350	172	20	1840	1840	NUM
aiol-6350	172	21	selenastrum	selenastrum	PROPN
aiol-6350	172	22	sp	sp	PROPN
aiol-6350	172	23	.	.	PROPN
aiol-6350	172	24	spirogyra	spirogyra	PROPN
aiol-6350	172	25	sp	sp	PROPN
aiol-6350	172	26	.	.	PROPN
aiol-6350	172	27	tetraëdron	tetraëdron	PROPN
aiol-6350	172	28	minimum	minimum	NOUN
aiol-6350	172	29	(	(	PUNCT
aiol-6350	172	30	a.braun	a.braun	ADJ
aiol-6350	172	31	)	)	PUNCT
aiol-6350	172	32	hansgirg	hansgirg	NOUN
aiol-6350	172	33	1888	1888	NUM
aiol-6350	172	34	tetrastrum	tetrastrum	NOUN
aiol-6350	172	35	komarekii	komarekii	PROPN
aiol-6350	172	36	hindák	hindák	PROPN
aiol-6350	172	37	1977	1977	NUM
aiol-6350	172	38	diatoms	diatom	NOUN
aiol-6350	172	39	(	(	PUNCT
aiol-6350	172	40	6	6	NUM
aiol-6350	172	41	)	)	PUNCT
aiol-6350	172	42	aulacoseira	aulacoseira	PROPN
aiol-6350	172	43	granulatα	granulatα	NOUN
aiol-6350	172	44	(	(	PUNCT
aiol-6350	172	45	ehrenberg	ehrenberg	PROPN
aiol-6350	172	46	)	)	PUNCT
aiol-6350	172	47	simonsen	simonsen	VERB
aiol-6350	172	48	1979	1979	NUM
aiol-6350	172	49	cyclotella	cyclotella	NOUN
aiol-6350	172	50	sp	sp	PROPN
aiol-6350	172	51	.	.	PROPN
aiol-6350	172	52	nitzschia	nitzschia	PROPN
aiol-6350	172	53	acicularis	acicularis	PROPN
aiol-6350	172	54	(	(	PUNCT
aiol-6350	172	55	kützing	kützing	PROPN
aiol-6350	172	56	)	)	PUNCT
aiol-6350	172	57	w.	w.	PROPN
aiol-6350	172	58	smith	smith	PROPN
aiol-6350	172	59	1853	1853	NUM
aiol-6350	173	1	nitzschia	nitzschia	PROPN
aiol-6350	173	2	closterium	closterium	PROPN
aiol-6350	173	3	(	(	PUNCT
aiol-6350	173	4	ehrenberg	ehrenberg	PROPN
aiol-6350	173	5	)	)	PUNCT
aiol-6350	173	6	w.	w.	PROPN
aiol-6350	173	7	smith	smith	PROPN
aiol-6350	173	8	1853	1853	NUM
aiol-6350	173	9	stephanodiscus	stephanodiscus	PROPN
aiol-6350	173	10	sp	sp	PROPN
aiol-6350	173	11	.	.	PROPN
aiol-6350	173	12	synedra	synedra	PROPN
aiol-6350	173	13	sp	sp	PROPN
aiol-6350	173	14	.	.	PROPN
aiol-6350	173	15	cryptophyta	cryptophyta	NOUN
aiol-6350	173	16	(	(	PUNCT
aiol-6350	173	17	1	1	NUM
aiol-6350	173	18	)	)	PUNCT
aiol-6350	173	19	rhodomonas	rhodomonas	PROPN
aiol-6350	173	20	sp	sp	PROPN
aiol-6350	173	21	.	.	PROPN
aiol-6350	173	22	euglenophyta	euglenophyta	NOUN
aiol-6350	173	23	(	(	PUNCT
aiol-6350	173	24	1	1	X
aiol-6350	173	25	)	)	PUNCT
aiol-6350	173	26	euglena	euglena	ADJ
aiol-6350	173	27	acus	acus	PROPN
aiol-6350	173	28	s.	s.	PROPN
aiol-6350	173	29	gkelis	gkelis	PROPN
aiol-6350	173	30	et	et	PROPN
aiol-6350	173	31	al.40	al.40	PROPN
aiol-6350	173	32	fig	fig	PROPN
aiol-6350	173	33	.	.	PUNCT
aiol-6350	174	1	3	3	X
aiol-6350	174	2	.	.	X
aiol-6350	174	3	nutrient	nutrient	NOUN
aiol-6350	174	4	loads	load	NOUN
aiol-6350	174	5	in	in	ADP
aiol-6350	174	6	lake	lake	PROPN
aiol-6350	174	7	karla	karla	PROPN
aiol-6350	174	8	(	(	PUNCT
aiol-6350	174	9	kl1	kl1	PROPN
aiol-6350	174	10	,	,	PUNCT
aiol-6350	174	11	kl2	kl2	PROPN
aiol-6350	174	12	,	,	PUNCT
aiol-6350	174	13	kl3	kl3	PROPN
aiol-6350	174	14	)	)	PUNCT
aiol-6350	174	15	and	and	CCONJ
aiol-6350	174	16	kalamaki	kalamaki	PROPN
aiol-6350	174	17	reservoir	reservoir	PROPN
aiol-6350	174	18	(	(	PUNCT
aiol-6350	174	19	kk	kk	PROPN
aiol-6350	174	20	)	)	PUNCT
aiol-6350	174	21	from	from	ADP
aiol-6350	174	22	july	july	PROPN
aiol-6350	174	23	2013	2013	NUM
aiol-6350	174	24	to	to	ADP
aiol-6350	174	25	july	july	PROPN
aiol-6350	174	26	2015	2015	NUM
aiol-6350	174	27	.	.	PUNCT
aiol-6350	175	1	a	a	DET
aiol-6350	175	2	)	)	PUNCT
aiol-6350	175	3	nitrite	nitrite	NOUN
aiol-6350	175	4	nitrogen	nitrogen	NOUN
aiol-6350	175	5	(	(	PUNCT
aiol-6350	175	6	no2	no2	NOUN
aiol-6350	175	7	-	-	PUNCT
aiol-6350	175	8	n	n	NUM
aiol-6350	175	9	)	)	PUNCT
aiol-6350	175	10	;	;	PUNCT
aiol-6350	175	11	b	b	X
aiol-6350	175	12	)	)	PUNCT
aiol-6350	175	13	nitrate	nitrate	NOUN
aiol-6350	175	14	nitrogen	nitrogen	NOUN
aiol-6350	175	15	(	(	PUNCT
aiol-6350	175	16	no3	no3	NOUN
aiol-6350	175	17	-	-	PUNCT
aiol-6350	175	18	n	n	NUM
aiol-6350	175	19	)	)	PUNCT
aiol-6350	175	20	;	;	PUNCT
aiol-6350	175	21	c	c	X
aiol-6350	175	22	)	)	PUNCT
aiol-6350	175	23	ammonia	ammonia	NOUN
aiol-6350	175	24	nitrogen	nitrogen	NOUN
aiol-6350	175	25	(	(	PUNCT
aiol-6350	175	26	nh4	nh4	NOUN
aiol-6350	175	27	-	-	PUNCT
aiol-6350	175	28	n	n	CCONJ
aiol-6350	175	29	)	)	PUNCT
aiol-6350	175	30	;	;	PUNCT
aiol-6350	175	31	d	d	X
aiol-6350	175	32	)	)	PUNCT
aiol-6350	175	33	dissolved	dissolve	VERB
aiol-6350	175	34	inorganic	inorganic	ADJ
aiol-6350	175	35	nitrogen	nitrogen	NOUN
aiol-6350	175	36	(	(	PUNCT
aiol-6350	175	37	din	din	NOUN
aiol-6350	175	38	)	)	PUNCT
aiol-6350	175	39	;	;	PUNCT
aiol-6350	175	40	e	e	X
aiol-6350	175	41	)	)	PUNCT
aiol-6350	175	42	soluble	soluble	ADJ
aiol-6350	175	43	reactive	reactive	ADJ
aiol-6350	175	44	phosphorus	phosphorus	NOUN
aiol-6350	175	45	(	(	PUNCT
aiol-6350	175	46	srp	srp	PROPN
aiol-6350	175	47	)	)	PUNCT
aiol-6350	175	48	;	;	PUNCT
aiol-6350	175	49	f	f	X
aiol-6350	175	50	)	)	PUNCT
aiol-6350	175	51	total	total	ADJ
aiol-6350	175	52	phosphorus	phosphorus	NOUN
aiol-6350	175	53	(	(	PUNCT
aiol-6350	175	54	tp	tp	NOUN
aiol-6350	175	55	)	)	PUNCT
aiol-6350	175	56	.	.	PUNCT
aiol-6350	176	1	water	water	NOUN
aiol-6350	176	2	quality	quality	NOUN
aiol-6350	176	3	and	and	CCONJ
aiol-6350	176	4	cyanotoxins	cyanotoxin	NOUN
aiol-6350	176	5	in	in	ADP
aiol-6350	176	6	the	the	DET
aiol-6350	176	7	reconstructed	reconstructed	ADJ
aiol-6350	176	8	lake	lake	NOUN
aiol-6350	176	9	karla	karla	PROPN
aiol-6350	176	10	41	41	NUM
aiol-6350	176	11	(	(	PUNCT
aiol-6350	176	12	figs	fig	NOUN
aiol-6350	176	13	.	.	X
aiol-6350	176	14	5	5	NUM
aiol-6350	176	15	and	and	CCONJ
aiol-6350	176	16	6	6	NUM
aiol-6350	176	17	)	)	PUNCT
aiol-6350	176	18	.	.	PUNCT
aiol-6350	177	1	in	in	ADP
aiol-6350	177	2	lake	lake	PROPN
aiol-6350	177	3	karla	karla	PROPN
aiol-6350	177	4	,	,	PUNCT
aiol-6350	177	5	the	the	DET
aiol-6350	177	6	dominant	dominant	ADJ
aiol-6350	177	7	cyanobacteria	cyanobacteria	NOUN
aiol-6350	177	8	were	be	AUX
aiol-6350	177	9	anabaenopsis	anabaenopsis	NOUN
aiol-6350	177	10	elenkinii	elenkinii	NOUN
aiol-6350	177	11	,	,	PUNCT
aiol-6350	177	12	sphaerospermopsis	sphaerospermopsis	NOUN
aiol-6350	177	13	aphanizomenoides	aphanizomenoide	NOUN
aiol-6350	177	14	(	(	PUNCT
aiol-6350	177	15	functional	functional	ADJ
aiol-6350	177	16	group	group	NOUN
aiol-6350	177	17	h1	h1	PROPN
aiol-6350	177	18	)	)	PUNCT
aiol-6350	177	19	,	,	PUNCT
aiol-6350	177	20	limnothrix	limnothrix	VERB
aiol-6350	177	21	redekei	redekei	VERB
aiol-6350	177	22	and	and	CCONJ
aiol-6350	177	23	planktothrix	planktothrix	VERB
aiol-6350	177	24	cf	cf	NOUN
aiol-6350	177	25	.	.	PUNCT
aiol-6350	178	1	agardhii	agardhii	PROPN
aiol-6350	178	2	(	(	PUNCT
aiol-6350	178	3	functional	functional	ADJ
aiol-6350	178	4	group	group	NOUN
aiol-6350	178	5	s1	s1	PROPN
aiol-6350	178	6	)	)	PUNCT
aiol-6350	178	7	,	,	PUNCT
aiol-6350	178	8	and	and	CCONJ
aiol-6350	178	9	cylindrospermopsis	cylindrospermopsis	VERB
aiol-6350	178	10	raciborskii	raciborskii	ADJ
aiol-6350	178	11	(	(	PUNCT
aiol-6350	178	12	functional	functional	ADJ
aiol-6350	178	13	group	group	NOUN
aiol-6350	178	14	sn	sn	PROPN
aiol-6350	178	15	)	)	PUNCT
aiol-6350	178	16	.	.	PUNCT
aiol-6350	179	1	during	during	ADP
aiol-6350	179	2	the	the	DET
aiol-6350	179	3	warm	warm	ADJ
aiol-6350	179	4	period	period	NOUN
aiol-6350	179	5	microcystis	microcystis	PROPN
aiol-6350	179	6	aeruginosa	aeruginosa	NOUN
aiol-6350	179	7	(	(	PUNCT
aiol-6350	179	8	functional	functional	ADJ
aiol-6350	179	9	group	group	NOUN
aiol-6350	179	10	m	m	PROPN
aiol-6350	179	11	)	)	PUNCT
aiol-6350	179	12	was	be	AUX
aiol-6350	179	13	also	also	ADV
aiol-6350	179	14	dominant	dominant	ADJ
aiol-6350	179	15	in	in	ADP
aiol-6350	179	16	kl2	kl2	PROPN
aiol-6350	179	17	and	and	CCONJ
aiol-6350	179	18	kl3	kl3	PROPN
aiol-6350	179	19	,	,	PUNCT
aiol-6350	179	20	whereas	whereas	SCONJ
aiol-6350	179	21	in	in	ADP
aiol-6350	179	22	july	july	PROPN
aiol-6350	179	23	2015	2015	NUM
aiol-6350	179	24	in	in	ADP
aiol-6350	179	25	kl2	kl2	PROPN
aiol-6350	179	26	there	there	PRON
aiol-6350	179	27	was	be	VERB
aiol-6350	179	28	an	an	DET
aiol-6350	179	29	almost	almost	ADV
aiol-6350	179	30	100	100	NUM
aiol-6350	179	31	%	%	NOUN
aiol-6350	179	32	dominance	dominance	NOUN
aiol-6350	179	33	of	of	ADP
aiol-6350	179	34	dolichospermum	dolichospermum	PROPN
aiol-6350	179	35	(	(	PUNCT
aiol-6350	179	36	anabaena	anabaena	NOUN
aiol-6350	179	37	)	)	PUNCT
aiol-6350	179	38	cf	cf	NOUN
aiol-6350	179	39	.	.	PUNCT
aiol-6350	180	1	smithii	smithii	NOUN
aiol-6350	180	2	(	(	PUNCT
aiol-6350	180	3	fig	fig	NOUN
aiol-6350	180	4	.	.	PUNCT
aiol-6350	180	5	6	6	NUM
aiol-6350	180	6	)	)	PUNCT
aiol-6350	180	7	.	.	PUNCT
aiol-6350	181	1	in	in	ADP
aiol-6350	181	2	kalamaki	kalamaki	PROPN
aiol-6350	181	3	reservoir	reservoir	PROPN
aiol-6350	181	4	a.	a.	PROPN
aiol-6350	181	5	elenkinii	elenkinii	PROPN
aiol-6350	181	6	,	,	PUNCT
aiol-6350	181	7	c.	c.	PROPN
aiol-6350	181	8	raciborskii	raciborskii	PROPN
aiol-6350	181	9	,	,	PUNCT
aiol-6350	181	10	and	and	CCONJ
aiol-6350	181	11	sph	sph	PROPN
aiol-6350	181	12	.	.	PROPN
aiol-6350	181	13	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	181	14	were	be	AUX
aiol-6350	181	15	dominant	dominant	ADJ
aiol-6350	181	16	from	from	ADP
aiol-6350	181	17	july	july	PROPN
aiol-6350	181	18	2013	2013	NUM
aiol-6350	181	19	to	to	ADP
aiol-6350	181	20	september	september	PROPN
aiol-6350	181	21	2014	2014	NUM
aiol-6350	181	22	;	;	PUNCT
aiol-6350	181	23	in	in	ADP
aiol-6350	181	24	may	may	PROPN
aiol-6350	181	25	2015	2015	NUM
aiol-6350	181	26	d.	d.	PROPN
aiol-6350	181	27	cf	cf	PROPN
aiol-6350	181	28	.	.	PUNCT
aiol-6350	182	1	smithii	smithii	PROPN
aiol-6350	182	2	became	become	VERB
aiol-6350	182	3	dominant	dominant	ADJ
aiol-6350	182	4	whereas	whereas	SCONJ
aiol-6350	182	5	in	in	ADP
aiol-6350	182	6	july	july	PROPN
aiol-6350	182	7	2015	2015	NUM
aiol-6350	182	8	lyngbya	lyngbya	PROPN
aiol-6350	182	9	sp	sp	NOUN
aiol-6350	182	10	.	.	PROPN
aiol-6350	182	11	occurred	occur	VERB
aiol-6350	182	12	and	and	CCONJ
aiol-6350	182	13	became	become	VERB
aiol-6350	182	14	dominant	dominant	ADJ
aiol-6350	182	15	for	for	ADP
aiol-6350	182	16	the	the	DET
aiol-6350	182	17	first	first	ADJ
aiol-6350	182	18	time	time	NOUN
aiol-6350	182	19	(	(	PUNCT
aiol-6350	182	20	fig	fig	NOUN
aiol-6350	182	21	.	.	PUNCT
aiol-6350	182	22	6	6	NUM
aiol-6350	182	23	)	)	PUNCT
aiol-6350	182	24	.	.	PUNCT
aiol-6350	183	1	cyanobacteria	cyanobacteria	PROPN
aiol-6350	183	2	dominated	dominate	VERB
aiol-6350	183	3	kalamaki	kalamaki	PROPN
aiol-6350	183	4	reservoir	reservoir	PROPN
aiol-6350	183	5	even	even	ADV
aiol-6350	183	6	in	in	ADP
aiol-6350	183	7	the	the	DET
aiol-6350	183	8	cold	cold	ADJ
aiol-6350	183	9	period	period	NOUN
aiol-6350	183	10	.	.	PUNCT
aiol-6350	184	1	a.	a.	NOUN
aiol-6350	184	2	elenkinii	elenkinii	PROPN
aiol-6350	184	3	,	,	PUNCT
aiol-6350	184	4	c.	c.	PROPN
aiol-6350	184	5	raciborskii	raciborskii	PROPN
aiol-6350	184	6	,	,	PUNCT
aiol-6350	184	7	sph	sph	PROPN
aiol-6350	184	8	.	.	PROPN
aiol-6350	184	9	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	184	10	,	,	PUNCT
aiol-6350	184	11	and	and	CCONJ
aiol-6350	184	12	dolichospermum	dolichospermum	PROPN
aiol-6350	184	13	spp	spp	NOUN
aiol-6350	184	14	.	.	PUNCT
aiol-6350	184	15	accounted	account	VERB
aiol-6350	184	16	for	for	ADP
aiol-6350	184	17	the	the	DET
aiol-6350	184	18	higher	high	ADJ
aiol-6350	184	19	biomass	biomass	NOUN
aiol-6350	184	20	in	in	ADP
aiol-6350	184	21	kl1	kl1	PROPN
aiol-6350	184	22	and	and	CCONJ
aiol-6350	184	23	kk	kk	PROPN
aiol-6350	184	24	.	.	PROPN
aiol-6350	185	1	apart	apart	ADV
aiol-6350	185	2	from	from	ADP
aiol-6350	185	3	cyanobacteria	cyanobacteria	PROPN
aiol-6350	185	4	,	,	PUNCT
aiol-6350	185	5	the	the	DET
aiol-6350	185	6	chlorophytes	chlorophyte	NOUN
aiol-6350	185	7	fig	fig	NOUN
aiol-6350	185	8	.	.	PUNCT
aiol-6350	186	1	4	4	X
aiol-6350	186	2	.	.	NUM
aiol-6350	186	3	dissolved	dissolve	VERB
aiol-6350	186	4	inorganic	inorganic	ADJ
aiol-6350	186	5	nitrogen	nitrogen	NOUN
aiol-6350	186	6	(	(	PUNCT
aiol-6350	186	7	din	din	NOUN
aiol-6350	186	8	)	)	PUNCT
aiol-6350	186	9	to	to	ADP
aiol-6350	186	10	soluble	soluble	ADJ
aiol-6350	186	11	reactive	reactive	ADJ
aiol-6350	186	12	phosphorus	phosphorus	NOUN
aiol-6350	186	13	(	(	PUNCT
aiol-6350	186	14	srp	srp	PROPN
aiol-6350	186	15	)	)	PUNCT
aiol-6350	186	16	ratio	ratio	NOUN
aiol-6350	186	17	(	(	PUNCT
aiol-6350	186	18	a	a	NOUN
aiol-6350	186	19	)	)	PUNCT
aiol-6350	186	20	and	and	CCONJ
aiol-6350	186	21	cyanobacteria	cyanobacteria	NOUN
aiol-6350	186	22	biomass	biomass	NOUN
aiol-6350	186	23	(	(	PUNCT
aiol-6350	186	24	b	b	NOUN
aiol-6350	186	25	)	)	PUNCT
aiol-6350	186	26	in	in	ADP
aiol-6350	186	27	water	water	NOUN
aiol-6350	186	28	samples	sample	NOUN
aiol-6350	186	29	collected	collect	VERB
aiol-6350	186	30	in	in	ADP
aiol-6350	186	31	lake	lake	PROPN
aiol-6350	186	32	karla	karla	PROPN
aiol-6350	186	33	(	(	PUNCT
aiol-6350	186	34	kl1	kl1	PROPN
aiol-6350	186	35	,	,	PUNCT
aiol-6350	186	36	kl2	kl2	PROPN
aiol-6350	186	37	,	,	PUNCT
aiol-6350	186	38	kl3	kl3	PROPN
aiol-6350	186	39	)	)	PUNCT
aiol-6350	186	40	and	and	CCONJ
aiol-6350	186	41	kalamaki	kalamaki	PROPN
aiol-6350	186	42	reservoir	reservoir	PROPN
aiol-6350	186	43	(	(	PUNCT
aiol-6350	186	44	kk	kk	PROPN
aiol-6350	186	45	)	)	PUNCT
aiol-6350	186	46	from	from	ADP
aiol-6350	186	47	july	july	PROPN
aiol-6350	186	48	2013	2013	NUM
aiol-6350	186	49	to	to	ADP
aiol-6350	186	50	july	july	PROPN
aiol-6350	186	51	2015	2015	NUM
aiol-6350	186	52	.	.	PUNCT
aiol-6350	187	1	dotted	dotted	ADJ
aiol-6350	187	2	lines	line	NOUN
aiol-6350	187	3	represent	represent	VERB
aiol-6350	187	4	the	the	DET
aiol-6350	187	5	thresholds	threshold	NOUN
aiol-6350	187	6	for	for	ADP
aiol-6350	187	7	ecological	ecological	ADJ
aiol-6350	187	8	status	status	NOUN
aiol-6350	187	9	based	base	VERB
aiol-6350	187	10	on	on	ADP
aiol-6350	187	11	cyanobacterial	cyanobacterial	ADJ
aiol-6350	187	12	biomass	biomass	NOUN
aiol-6350	187	13	given	give	VERB
aiol-6350	187	14	by	by	ADP
aiol-6350	187	15	padisák	padisák	NOUN
aiol-6350	187	16	et	et	PROPN
aiol-6350	187	17	al	al	PROPN
aiol-6350	187	18	.	.	PROPN
aiol-6350	188	1	(	(	PUNCT
aiol-6350	188	2	2006	2006	NUM
aiol-6350	188	3	)	)	PUNCT
aiol-6350	188	4	and	and	CCONJ
aiol-6350	188	5	the	the	DET
aiol-6350	188	6	mediterranean	mediterranean	PROPN
aiol-6350	188	7	geographical	geographical	ADJ
aiol-6350	188	8	intercalibration	intercalibration	NOUN
aiol-6350	188	9	group	group	NOUN
aiol-6350	188	10	(	(	PUNCT
aiol-6350	188	11	jrc	jrc	PROPN
aiol-6350	188	12	european	european	PROPN
aiol-6350	188	13	commission	commission	PROPN
aiol-6350	188	14	,	,	PUNCT
aiol-6350	188	15	2009	2009	NUM
aiol-6350	188	16	)	)	PUNCT
aiol-6350	188	17	;	;	PUNCT
aiol-6350	188	18	long	long	ADV
aiol-6350	188	19	-	-	PUNCT
aiol-6350	188	20	dashed	dash	VERB
aiol-6350	188	21	lines	line	NOUN
aiol-6350	188	22	represent	represent	VERB
aiol-6350	188	23	who	who	PRON
aiol-6350	188	24	guidance	guidance	VERB
aiol-6350	188	25	levels	level	NOUN
aiol-6350	188	26	for	for	ADP
aiol-6350	188	27	cyanobacterial	cyanobacterial	ADJ
aiol-6350	188	28	concentrations	concentration	NOUN
aiol-6350	188	29	in	in	ADP
aiol-6350	188	30	recreational	recreational	ADJ
aiol-6350	188	31	waters	water	NOUN
aiol-6350	188	32	(	(	PUNCT
aiol-6350	188	33	who	who	PRON
aiol-6350	188	34	,	,	PUNCT
aiol-6350	188	35	2003	2003	NUM
aiol-6350	188	36	)	)	PUNCT
aiol-6350	188	37	.	.	PUNCT
aiol-6350	189	1	s.	s.	PROPN
aiol-6350	189	2	gkelis	gkelis	PROPN
aiol-6350	189	3	et	et	PROPN
aiol-6350	189	4	al.42	al.42	PROPN
aiol-6350	189	5	monoraphidium	monoraphidium	PROPN
aiol-6350	189	6	sp	sp	PROPN
aiol-6350	189	7	.	.	PUNCT
aiol-6350	190	1	(	(	PUNCT
aiol-6350	190	2	functional	functional	ADJ
aiol-6350	190	3	group	group	NOUN
aiol-6350	190	4	x1	x1	PROPN
aiol-6350	190	5	)	)	PUNCT
aiol-6350	190	6	and	and	CCONJ
aiol-6350	190	7	tetrastrum	tetrastrum	PROPN
aiol-6350	190	8	komarekii	komarekii	PROPN
aiol-6350	190	9	and	and	CCONJ
aiol-6350	190	10	the	the	DET
aiol-6350	190	11	diatoms	diatom	NOUN
aiol-6350	190	12	nitzschia	nitzschia	ADV
aiol-6350	190	13	acicularis	acicularis	VERB
aiol-6350	190	14	and	and	CCONJ
aiol-6350	190	15	nitzschia	nitzschia	ADV
aiol-6350	190	16	closterium	closterium	NOUN
aiol-6350	190	17	(	(	PUNCT
aiol-6350	190	18	functional	functional	ADJ
aiol-6350	190	19	group	group	NOUN
aiol-6350	190	20	x1	x1	PROPN
aiol-6350	190	21	)	)	PUNCT
aiol-6350	190	22	were	be	AUX
aiol-6350	190	23	occasionally	occasionally	ADV
aiol-6350	190	24	dominant	dominant	ADJ
aiol-6350	190	25	in	in	ADP
aiol-6350	190	26	both	both	DET
aiol-6350	190	27	water	water	NOUN
aiol-6350	190	28	bodies	body	NOUN
aiol-6350	190	29	.	.	PUNCT
aiol-6350	191	1	benthic	benthic	ADJ
aiol-6350	191	2	invertebrates	invertebrate	NOUN
aiol-6350	191	3	in	in	ADP
aiol-6350	191	4	lake	lake	PROPN
aiol-6350	191	5	karla	karla	PROPN
aiol-6350	191	6	,	,	PUNCT
aiol-6350	191	7	only	only	ADV
aiol-6350	191	8	four	four	NUM
aiol-6350	191	9	taxa	taxa	NOUN
aiol-6350	191	10	(	(	PUNCT
aiol-6350	191	11	annelida	annelida	PROPN
aiol-6350	191	12	,	,	PUNCT
aiol-6350	191	13	lymnaea	lymnaea	NOUN
aiol-6350	191	14	sp	sp	PROPN
aiol-6350	191	15	.	.	PROPN
aiol-6350	191	16	,	,	PUNCT
aiol-6350	191	17	chironominae	chironominae	NOUN
aiol-6350	191	18	,	,	PUNCT
aiol-6350	191	19	and	and	CCONJ
aiol-6350	191	20	tanypodinae	tanypodinae	NOUN
aiol-6350	191	21	)	)	PUNCT
aiol-6350	191	22	were	be	AUX
aiol-6350	191	23	recorded	record	VERB
aiol-6350	191	24	;	;	PUNCT
aiol-6350	191	25	in	in	ADP
aiol-6350	191	26	kalamaki	kalamaki	PROPN
aiol-6350	191	27	reservoir	reservoir	PROPN
aiol-6350	191	28	3	3	NUM
aiol-6350	191	29	of	of	ADP
aiol-6350	191	30	the	the	DET
aiol-6350	191	31	four	four	NUM
aiol-6350	191	32	taxa	taxa	NOUN
aiol-6350	191	33	were	be	AUX
aiol-6350	191	34	found	find	VERB
aiol-6350	191	35	(	(	PUNCT
aiol-6350	191	36	lymnaea	lymnaea	PROPN
aiol-6350	191	37	sp	sp	PROPN
aiol-6350	191	38	.	.	PROPN
aiol-6350	191	39	was	be	AUX
aiol-6350	191	40	absent	absent	ADJ
aiol-6350	191	41	)	)	PUNCT
aiol-6350	191	42	.	.	PUNCT
aiol-6350	192	1	molecular	molecular	ADJ
aiol-6350	192	2	detection	detection	NOUN
aiol-6350	192	3	pcr	pcr	NOUN
aiol-6350	192	4	products	product	NOUN
aiol-6350	192	5	indicating	indicate	VERB
aiol-6350	192	6	the	the	DET
aiol-6350	192	7	presence	presence	NOUN
aiol-6350	192	8	of	of	ADP
aiol-6350	192	9	mcya	mcya	NOUN
aiol-6350	192	10	,	,	PUNCT
aiol-6350	192	11	mcyb	mcyb	PROPN
aiol-6350	192	12	,	,	PUNCT
aiol-6350	192	13	and	and	CCONJ
aiol-6350	192	14	mcye	mcye	ADJ
aiol-6350	192	15	/	/	SYM
aiol-6350	192	16	ndaf	ndaf	NOUN
aiol-6350	192	17	genes	gene	NOUN
aiol-6350	192	18	were	be	AUX
aiol-6350	192	19	obtained	obtain	VERB
aiol-6350	192	20	for	for	ADP
aiol-6350	192	21	most	most	ADJ
aiol-6350	192	22	of	of	ADP
aiol-6350	192	23	the	the	DET
aiol-6350	192	24	samples	sample	NOUN
aiol-6350	192	25	tested	test	VERB
aiol-6350	192	26	(	(	PUNCT
aiol-6350	192	27	tab	tab	NOUN
aiol-6350	192	28	.	.	PUNCT
aiol-6350	193	1	3	3	NUM
aiol-6350	193	2	)	)	PUNCT
aiol-6350	193	3	.	.	PUNCT
aiol-6350	194	1	only	only	ADV
aiol-6350	194	2	two	two	NUM
aiol-6350	194	3	of	of	ADP
aiol-6350	194	4	the	the	DET
aiol-6350	194	5	assayed	assayed	ADJ
aiol-6350	194	6	environmental	environmental	ADJ
aiol-6350	194	7	samples	sample	NOUN
aiol-6350	194	8	gave	give	VERB
aiol-6350	194	9	positive	positive	ADJ
aiol-6350	194	10	pcr	pcr	ADJ
aiol-6350	194	11	results	result	NOUN
aiol-6350	194	12	for	for	ADP
aiol-6350	194	13	each	each	PRON
aiol-6350	194	14	of	of	ADP
aiol-6350	194	15	the	the	DET
aiol-6350	194	16	psm13	psm13	NOUN
aiol-6350	194	17	/	/	SYM
aiol-6350	194	18	psm14	psm14	NOUN
aiol-6350	194	19	and	and	CCONJ
aiol-6350	194	20	pksm4	pksm4	ADJ
aiol-6350	194	21	/	/	SYM
aiol-6350	194	22	pksk18	pksk18	NOUN
aiol-6350	194	23	primer	primer	NOUN
aiol-6350	194	24	pairs	pair	NOUN
aiol-6350	194	25	,	,	PUNCT
aiol-6350	194	26	thus	thus	ADV
aiol-6350	194	27	,	,	PUNCT
aiol-6350	194	28	suggesting	suggest	VERB
aiol-6350	194	29	the	the	DET
aiol-6350	194	30	presence	presence	NOUN
aiol-6350	194	31	of	of	ADP
aiol-6350	194	32	cyn	cyn	PROPN
aiol-6350	194	33	producing	produce	VERB
aiol-6350	194	34	cyanobacteria	cyanobacteria	NOUN
aiol-6350	194	35	.	.	PUNCT
aiol-6350	195	1	eight	eight	NUM
aiol-6350	195	2	water	water	NOUN
aiol-6350	195	3	samples	sample	NOUN
aiol-6350	195	4	,	,	PUNCT
aiol-6350	195	5	mainly	mainly	ADV
aiol-6350	195	6	from	from	ADP
aiol-6350	195	7	kalamaki	kalamaki	PROPN
aiol-6350	195	8	reservoir	reservoir	PROPN
aiol-6350	195	9	,	,	PUNCT
aiol-6350	195	10	dominated	dominate	VERB
aiol-6350	195	11	by	by	ADP
aiol-6350	195	12	a.	a.	NOUN
aiol-6350	195	13	elenkinii	elenkinii	PROPN
aiol-6350	195	14	,	,	PUNCT
aiol-6350	195	15	sph	sph	PROPN
aiol-6350	195	16	.	.	PROPN
aiol-6350	195	17	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	195	18	,	,	PUNCT
aiol-6350	195	19	and	and	CCONJ
aiol-6350	195	20	c.	c.	PROPN
aiol-6350	195	21	raciborskii	raciborskii	PROPN
aiol-6350	195	22	,	,	PUNCT
aiol-6350	195	23	gave	give	VERB
aiol-6350	195	24	a	a	DET
aiol-6350	195	25	pcr	pcr	ADJ
aiol-6350	195	26	product	product	NOUN
aiol-6350	195	27	of	of	ADP
aiol-6350	195	28	about	about	ADV
aiol-6350	195	29	1500	1500	NUM
aiol-6350	195	30	bp	bp	NOUN
aiol-6350	195	31	using	use	VERB
aiol-6350	195	32	the	the	DET
aiol-6350	195	33	sxt1f	sxt1f	PROPN
aiol-6350	195	34	/	/	SYM
aiol-6350	195	35	sxt1r	sxt1r	NOUN
aiol-6350	195	36	primer	primer	NOUN
aiol-6350	195	37	pair	pair	NOUN
aiol-6350	195	38	for	for	ADP
aiol-6350	195	39	the	the	DET
aiol-6350	195	40	presence	presence	NOUN
aiol-6350	195	41	of	of	ADP
aiol-6350	195	42	the	the	DET
aiol-6350	195	43	sxti	sxti	NOUN
aiol-6350	195	44	gene	gene	NOUN
aiol-6350	195	45	(	(	PUNCT
aiol-6350	195	46	tab	tab	NOUN
aiol-6350	195	47	.	.	PUNCT
aiol-6350	195	48	3	3	NUM
aiol-6350	195	49	)	)	PUNCT
aiol-6350	195	50	.	.	PUNCT
aiol-6350	196	1	cyanotoxins	cyanotoxin	NOUN
aiol-6350	196	2	mcs	mcs	PROPN
aiol-6350	196	3	were	be	AUX
aiol-6350	196	4	detected	detect	VERB
aiol-6350	196	5	by	by	ADP
aiol-6350	196	6	elisa	elisa	NOUN
aiol-6350	196	7	in	in	ADP
aiol-6350	196	8	water	water	NOUN
aiol-6350	196	9	samples	sample	NOUN
aiol-6350	196	10	collected	collect	VERB
aiol-6350	196	11	in	in	ADP
aiol-6350	196	12	the	the	DET
aiol-6350	196	13	warm	warm	ADJ
aiol-6350	196	14	period	period	NOUN
aiol-6350	196	15	,	,	PUNCT
aiol-6350	196	16	whereas	whereas	SCONJ
aiol-6350	196	17	in	in	ADP
aiol-6350	196	18	the	the	DET
aiol-6350	196	19	cold	cold	ADJ
aiol-6350	196	20	period	period	NOUN
aiol-6350	196	21	they	they	PRON
aiol-6350	196	22	were	be	AUX
aiol-6350	196	23	below	below	ADP
aiol-6350	196	24	detection	detection	NOUN
aiol-6350	196	25	limit	limit	NOUN
aiol-6350	196	26	(	(	PUNCT
aiol-6350	196	27	fig	fig	NOUN
aiol-6350	196	28	.	.	PUNCT
aiol-6350	197	1	7	7	NUM
aiol-6350	197	2	a	a	DET
aiol-6350	197	3	,	,	PUNCT
aiol-6350	197	4	b	b	NOUN
aiol-6350	197	5	)	)	PUNCT
aiol-6350	197	6	.	.	PUNCT
aiol-6350	198	1	intracellular	intracellular	ADJ
aiol-6350	198	2	mclr	mclr	NOUN
aiol-6350	198	3	eq	eq	NOUN
aiol-6350	198	4	.	.	PROPN
aiol-6350	198	5	concentration	concentration	NOUN
aiol-6350	198	6	ranged	range	VERB
aiol-6350	198	7	from	from	ADP
aiol-6350	198	8	1	1	NUM
aiol-6350	198	9	μg	μg	X
aiol-6350	198	10	l–1	l–1	PROPN
aiol-6350	198	11	to	to	ADP
aiol-6350	198	12	8	8	NUM
aiol-6350	198	13	μg	μg	PROPN
aiol-6350	198	14	l–1	l–1	PROPN
aiol-6350	198	15	(	(	PUNCT
aiol-6350	198	16	lake	lake	PROPN
aiol-6350	198	17	karla	karla	PROPN
aiol-6350	198	18	)	)	PUNCT
aiol-6350	198	19	or	or	CCONJ
aiol-6350	198	20	11.5	11.5	NUM
aiol-6350	198	21	μg	μg	NOUN
aiol-6350	198	22	l–1	l–1	PROPN
aiol-6350	198	23	(	(	PUNCT
aiol-6350	198	24	kalamaki	kalamaki	PROPN
aiol-6350	198	25	reservoir	reservoir	PROPN
aiol-6350	198	26	)	)	PUNCT
aiol-6350	198	27	(	(	PUNCT
aiol-6350	198	28	fig	fig	NOUN
aiol-6350	198	29	.	.	PUNCT
aiol-6350	199	1	7a	7a	NUM
aiol-6350	199	2	)	)	PUNCT
aiol-6350	199	3	while	while	SCONJ
aiol-6350	199	4	extracellular	extracellular	ADJ
aiol-6350	199	5	mc	mc	PROPN
aiol-6350	199	6	concentrations	concentration	NOUN
aiol-6350	199	7	exhibited	exhibit	VERB
aiol-6350	199	8	similar	similar	ADJ
aiol-6350	199	9	seasonal	seasonal	ADJ
aiol-6350	199	10	and	and	CCONJ
aiol-6350	199	11	temporal	temporal	ADJ
aiol-6350	199	12	pattern	pattern	NOUN
aiol-6350	199	13	with	with	ADP
aiol-6350	199	14	concentrations	concentration	NOUN
aiol-6350	199	15	ranging	range	VERB
aiol-6350	199	16	from	from	ADP
aiol-6350	199	17	1	1	NUM
aiol-6350	199	18	μg	μg	PROPN
aiol-6350	199	19	l–1	l–1	PROPN
aiol-6350	199	20	eq	eq	NOUN
aiol-6350	199	21	.	.	PUNCT
aiol-6350	200	1	to	to	ADP
aiol-6350	200	2	4	4	NUM
aiol-6350	200	3	μg	μg	NOUN
aiol-6350	200	4	l–1	l–1	PROPN
aiol-6350	200	5	(	(	PUNCT
aiol-6350	200	6	fig	fig	NOUN
aiol-6350	200	7	.	.	PUNCT
aiol-6350	200	8	7b	7b	NOUN
aiol-6350	200	9	)	)	PUNCT
aiol-6350	200	10	.	.	PUNCT
aiol-6350	201	1	a	a	DET
aiol-6350	201	2	maximum	maximum	ADJ
aiol-6350	201	3	total	total	NOUN
aiol-6350	201	4	(	(	PUNCT
aiol-6350	201	5	sum	sum	NOUN
aiol-6350	201	6	of	of	ADP
aiol-6350	201	7	intracellular	intracellular	NOUN
aiol-6350	201	8	and	and	CCONJ
aiol-6350	201	9	extracellular	extracellular	ADJ
aiol-6350	201	10	)	)	PUNCT
aiol-6350	201	11	mc	mc	PROPN
aiol-6350	201	12	concentration	concentration	NOUN
aiol-6350	201	13	of	of	ADP
aiol-6350	201	14	14.4	14.4	NUM
aiol-6350	201	15	μg	μg	NOUN
aiol-6350	201	16	l–1	l–1	PROPN
aiol-6350	201	17	eq	eq	PROPN
aiol-6350	201	18	.	.	PROPN
aiol-6350	201	19	was	be	AUX
aiol-6350	201	20	recorded	record	VERB
aiol-6350	201	21	at	at	ADP
aiol-6350	201	22	kk	kk	PROPN
aiol-6350	201	23	station	station	NOUN
aiol-6350	201	24	on	on	ADP
aiol-6350	201	25	september	september	PROPN
aiol-6350	201	26	2013	2013	NUM
aiol-6350	201	27	.	.	PUNCT
aiol-6350	202	1	the	the	DET
aiol-6350	202	2	mc	mc	PROPN
aiol-6350	202	3	and	and	CCONJ
aiol-6350	202	4	cyn	cyn	PROPN
aiol-6350	202	5	intracellular	intracellular	ADJ
aiol-6350	202	6	concentrations	concentration	NOUN
aiol-6350	202	7	were	be	AUX
aiol-6350	202	8	positively	positively	ADV
aiol-6350	202	9	correlated	correlate	VERB
aiol-6350	202	10	with	with	ADP
aiol-6350	202	11	temperature	temperature	NOUN
aiol-6350	202	12	and	and	CCONJ
aiol-6350	202	13	srp	srp	PROPN
aiol-6350	202	14	(	(	PUNCT
aiol-6350	202	15	supplementary	supplementary	ADJ
aiol-6350	202	16	tab	tab	NOUN
aiol-6350	202	17	.	.	PUNCT
aiol-6350	203	1	2	2	NUM
aiol-6350	203	2	)	)	PUNCT
aiol-6350	203	3	.	.	PUNCT
aiol-6350	204	1	cyn	cyn	PROPN
aiol-6350	204	2	was	be	AUX
aiol-6350	204	3	found	find	VERB
aiol-6350	204	4	in	in	ADP
aiol-6350	204	5	the	the	DET
aiol-6350	204	6	warm	warm	ADJ
aiol-6350	204	7	periods	period	NOUN
aiol-6350	204	8	at	at	ADP
aiol-6350	204	9	stations	station	NOUN
aiol-6350	204	10	kl1	kl1	NOUN
aiol-6350	204	11	and	and	CCONJ
aiol-6350	204	12	kk	kk	PROPN
aiol-6350	204	13	and	and	CCONJ
aiol-6350	204	14	in	in	ADP
aiol-6350	204	15	november	november	PROPN
aiol-6350	204	16	2013	2013	NUM
aiol-6350	204	17	at	at	ADP
aiol-6350	204	18	kk	kk	PROPN
aiol-6350	204	19	(	(	PUNCT
aiol-6350	204	20	fig	fig	NOUN
aiol-6350	204	21	.	.	PUNCT
aiol-6350	205	1	7c	7c	NUM
aiol-6350	205	2	)	)	PUNCT
aiol-6350	205	3	.	.	PUNCT
aiol-6350	206	1	all	all	DET
aiol-6350	206	2	those	those	DET
aiol-6350	206	3	samples	sample	NOUN
aiol-6350	206	4	were	be	AUX
aiol-6350	206	5	dominated	dominate	VERB
aiol-6350	206	6	by	by	ADP
aiol-6350	206	7	a.	a.	NOUN
aiol-6350	206	8	elenkinii	elenkinii	PROPN
aiol-6350	206	9	,	,	PUNCT
aiol-6350	206	10	sph	sph	PROPN
aiol-6350	206	11	.	.	PROPN
aiol-6350	206	12	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	206	13	,	,	PUNCT
aiol-6350	206	14	and	and	CCONJ
aiol-6350	206	15	c.	c.	PROPN
aiol-6350	206	16	raciborskii	raciborskii	PROPN
aiol-6350	206	17	.	.	PUNCT
aiol-6350	207	1	stx	stx	NOUN
aiol-6350	207	2	was	be	AUX
aiol-6350	207	3	found	find	VERB
aiol-6350	207	4	in	in	ADP
aiol-6350	207	5	some	some	DET
aiol-6350	207	6	samples	sample	NOUN
aiol-6350	207	7	in	in	ADP
aiol-6350	207	8	the	the	DET
aiol-6350	207	9	warm	warm	ADJ
aiol-6350	207	10	period	period	NOUN
aiol-6350	207	11	in	in	ADP
aiol-6350	207	12	very	very	ADV
aiol-6350	207	13	low	low	ADJ
aiol-6350	207	14	concentrations	concentration	NOUN
aiol-6350	207	15	,	,	PUNCT
aiol-6350	207	16	close	close	ADJ
aiol-6350	207	17	to	to	ADP
aiol-6350	207	18	the	the	DET
aiol-6350	207	19	detection	detection	NOUN
aiol-6350	207	20	limit	limit	NOUN
aiol-6350	207	21	,	,	PUNCT
aiol-6350	207	22	with	with	ADP
aiol-6350	207	23	the	the	DET
aiol-6350	207	24	exception	exception	NOUN
aiol-6350	207	25	of	of	ADP
aiol-6350	207	26	july	july	PROPN
aiol-6350	207	27	2014	2014	NUM
aiol-6350	207	28	in	in	ADP
aiol-6350	207	29	kalamaki	kalamaki	PROPN
aiol-6350	207	30	reservoir	reservoir	PROPN
aiol-6350	207	31	where	where	SCONJ
aiol-6350	207	32	it	it	PRON
aiol-6350	207	33	reached	reach	VERB
aiol-6350	207	34	0.17	0.17	NUM
aiol-6350	207	35	μg	μg	PROPN
aiol-6350	207	36	l–1	l–1	PROPN
aiol-6350	207	37	eq	eq	PROPN
aiol-6350	207	38	.	.	PUNCT
aiol-6350	208	1	(	(	PUNCT
aiol-6350	208	2	fig	fig	NOUN
aiol-6350	208	3	.	.	PUNCT
aiol-6350	209	1	7d	7d	NUM
aiol-6350	209	2	)	)	PUNCT
aiol-6350	209	3	.	.	PUNCT
aiol-6350	210	1	in	in	ADP
aiol-6350	210	2	this	this	DET
aiol-6350	210	3	sample	sample	NOUN
aiol-6350	210	4	,	,	PUNCT
aiol-6350	210	5	a.	a.	NOUN
aiol-6350	210	6	elenkinii	elenkinii	PROPN
aiol-6350	210	7	,	,	PUNCT
aiol-6350	210	8	sph	sph	PROPN
aiol-6350	210	9	.	.	PROPN
aiol-6350	210	10	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	210	11	,	,	PUNCT
aiol-6350	210	12	and	and	CCONJ
aiol-6350	210	13	c.	c.	PROPN
aiol-6350	210	14	raciborskii	raciborskii	PROPN
aiol-6350	210	15	were	be	AUX
aiol-6350	210	16	also	also	ADV
aiol-6350	210	17	the	the	DET
aiol-6350	210	18	dominant	dominant	ADJ
aiol-6350	210	19	species	specie	NOUN
aiol-6350	210	20	.	.	PUNCT
aiol-6350	211	1	fig	fig	NOUN
aiol-6350	211	2	.	.	PUNCT
aiol-6350	212	1	5	5	NUM
aiol-6350	212	2	.	.	NOUN
aiol-6350	212	3	relative	relative	ADJ
aiol-6350	212	4	biomass	biomass	NOUN
aiol-6350	212	5	(	(	PUNCT
aiol-6350	212	6	%	%	NOUN
aiol-6350	212	7	)	)	PUNCT
aiol-6350	212	8	of	of	ADP
aiol-6350	212	9	cyanobacteria	cyanobacteria	NOUN
aiol-6350	212	10	and	and	CCONJ
aiol-6350	212	11	other	other	ADJ
aiol-6350	212	12	algae	algae	NOUN
aiol-6350	212	13	in	in	ADP
aiol-6350	212	14	water	water	NOUN
aiol-6350	212	15	samples	sample	NOUN
aiol-6350	212	16	collected	collect	VERB
aiol-6350	212	17	from	from	ADP
aiol-6350	212	18	lake	lake	PROPN
aiol-6350	212	19	karla	karla	PROPN
aiol-6350	212	20	and	and	CCONJ
aiol-6350	212	21	kalamaki	kalamaki	PROPN
aiol-6350	212	22	reservoir	reservoir	PROPN
aiol-6350	212	23	between	between	ADP
aiol-6350	212	24	july	july	PROPN
aiol-6350	212	25	2013	2013	NUM
aiol-6350	212	26	and	and	CCONJ
aiol-6350	212	27	july	july	PROPN
aiol-6350	212	28	2015	2015	NUM
aiol-6350	212	29	.	.	PUNCT
aiol-6350	213	1	values	value	NOUN
aiol-6350	213	2	represent	represent	VERB
aiol-6350	213	3	means	mean	NOUN
aiol-6350	213	4	of	of	ADP
aiol-6350	213	5	the	the	DET
aiol-6350	213	6	four	four	NUM
aiol-6350	213	7	sampling	sample	VERB
aiol-6350	213	8	stations	station	NOUN
aiol-6350	213	9	.	.	PUNCT
aiol-6350	214	1	water	water	NOUN
aiol-6350	214	2	quality	quality	NOUN
aiol-6350	214	3	and	and	CCONJ
aiol-6350	214	4	cyanotoxins	cyanotoxin	NOUN
aiol-6350	214	5	in	in	ADP
aiol-6350	214	6	the	the	DET
aiol-6350	214	7	reconstructed	reconstructed	ADJ
aiol-6350	214	8	lake	lake	NOUN
aiol-6350	214	9	karla	karla	PROPN
aiol-6350	214	10	43	43	NUM
aiol-6350	214	11	lc	lc	PROPN
aiol-6350	214	12	-	-	PUNCT
aiol-6350	214	13	ms	ms	PROPN
aiol-6350	214	14	/	/	SYM
aiol-6350	214	15	ms	ms	NOUN
aiol-6350	214	16	analysis	analysis	NOUN
aiol-6350	214	17	confirmed	confirm	VERB
aiol-6350	214	18	the	the	DET
aiol-6350	214	19	presence	presence	NOUN
aiol-6350	214	20	of	of	ADP
aiol-6350	214	21	cyn	cyn	PROPN
aiol-6350	214	22	in	in	ADP
aiol-6350	214	23	some	some	DET
aiol-6350	214	24	cases	case	NOUN
aiol-6350	214	25	,	,	PUNCT
aiol-6350	214	26	with	with	ADP
aiol-6350	214	27	concentrations	concentration	NOUN
aiol-6350	214	28	ranging	range	VERB
aiol-6350	214	29	from	from	ADP
aiol-6350	214	30	0.5	0.5	NUM
aiol-6350	214	31	μg	μg	NOUN
aiol-6350	214	32	l–1	l–1	PROPN
aiol-6350	214	33	to	to	ADP
aiol-6350	214	34	12.1	12.1	NUM
aiol-6350	214	35	μg	μg	PROPN
aiol-6350	214	36	l–1	l–1	PROPN
aiol-6350	214	37	(	(	PUNCT
aiol-6350	214	38	tab	tab	NOUN
aiol-6350	214	39	.	.	PUNCT
aiol-6350	214	40	4	4	NUM
aiol-6350	214	41	)	)	PUNCT
aiol-6350	214	42	.	.	PUNCT
aiol-6350	215	1	it	it	PRON
aiol-6350	215	2	also	also	ADV
aiol-6350	215	3	revealed	reveal	VERB
aiol-6350	215	4	the	the	DET
aiol-6350	215	5	presence	presence	NOUN
aiol-6350	215	6	of	of	ADP
aiol-6350	215	7	atx	atx	NOUN
aiol-6350	215	8	-	-	PUNCT
aiol-6350	215	9	a	a	NOUN
aiol-6350	215	10	in	in	ADP
aiol-6350	215	11	3	3	NUM
aiol-6350	215	12	out	out	ADP
aiol-6350	215	13	of	of	ADP
aiol-6350	215	14	13	13	NUM
aiol-6350	215	15	samples	sample	NOUN
aiol-6350	215	16	analyzed	analyze	VERB
aiol-6350	215	17	,	,	PUNCT
aiol-6350	215	18	with	with	ADP
aiol-6350	215	19	concentrations	concentration	NOUN
aiol-6350	215	20	ranging	range	VERB
aiol-6350	215	21	from	from	ADP
aiol-6350	215	22	0.8	0.8	NUM
aiol-6350	215	23	μg	μg	PROPN
aiol-6350	215	24	l–1	l–1	PROPN
aiol-6350	215	25	to	to	ADP
aiol-6350	215	26	5.4	5.4	NUM
aiol-6350	215	27	μg	μg	PROPN
aiol-6350	215	28	l–1	l–1	PROPN
aiol-6350	215	29	(	(	PUNCT
aiol-6350	215	30	tab	tab	NOUN
aiol-6350	215	31	.	.	PUNCT
aiol-6350	215	32	4	4	NUM
aiol-6350	215	33	)	)	PUNCT
aiol-6350	215	34	.	.	PUNCT
aiol-6350	216	1	again	again	ADV
aiol-6350	216	2	,	,	PUNCT
aiol-6350	216	3	in	in	ADP
aiol-6350	216	4	those	those	DET
aiol-6350	216	5	samples	sample	NOUN
aiol-6350	216	6	a.	a.	NOUN
aiol-6350	216	7	elenkinii	elenkinii	PROPN
aiol-6350	216	8	,	,	PUNCT
aiol-6350	216	9	sph	sph	PROPN
aiol-6350	216	10	.	.	PROPN
aiol-6350	216	11	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	216	12	,	,	PUNCT
aiol-6350	216	13	and	and	CCONJ
aiol-6350	216	14	c.	c.	PROPN
aiol-6350	216	15	raciborskii	raciborskii	PROPN
aiol-6350	216	16	were	be	AUX
aiol-6350	216	17	the	the	DET
aiol-6350	216	18	dominant	dominant	ADJ
aiol-6350	216	19	species	specie	NOUN
aiol-6350	216	20	.	.	PUNCT
aiol-6350	217	1	stx	stx	NOUN
aiol-6350	217	2	was	be	AUX
aiol-6350	217	3	found	find	VERB
aiol-6350	217	4	in	in	ADP
aiol-6350	217	5	all	all	PRON
aiol-6350	217	6	of	of	ADP
aiol-6350	217	7	the	the	DET
aiol-6350	217	8	samples	sample	NOUN
aiol-6350	217	9	analysed	analyse	VERB
aiol-6350	217	10	,	,	PUNCT
aiol-6350	217	11	whereas	whereas	SCONJ
aiol-6350	217	12	neo	neo	NOUN
aiol-6350	217	13	-	-	NOUN
aiol-6350	217	14	stx	stx	NOUN
aiol-6350	217	15	was	be	AUX
aiol-6350	217	16	found	find	VERB
aiol-6350	217	17	in	in	ADP
aiol-6350	217	18	7/13	7/13	NUM
aiol-6350	217	19	samples	sample	NOUN
aiol-6350	217	20	.	.	PUNCT
aiol-6350	218	1	[	[	X
aiol-6350	218	2	d	d	X
aiol-6350	218	3	-	-	PUNCT
aiol-6350	218	4	asp3	asp3	ADV
aiol-6350	218	5	]	]	X
aiol-6350	218	6	mc	mc	PROPN
aiol-6350	218	7	-	-	PUNCT
aiol-6350	218	8	rr	rr	PROPN
aiol-6350	218	9	,	,	PUNCT
aiol-6350	218	10	mc	mc	PROPN
aiol-6350	218	11	-	-	PUNCT
aiol-6350	218	12	rr	rr	PROPN
aiol-6350	218	13	,	,	PUNCT
aiol-6350	218	14	mc	mc	PROPN
aiol-6350	218	15	-	-	PUNCT
aiol-6350	218	16	yr	yr	PROPN
aiol-6350	218	17	,	,	PUNCT
aiol-6350	218	18	and	and	CCONJ
aiol-6350	218	19	mc	mc	PROPN
aiol-6350	218	20	-	-	PUNCT
aiol-6350	218	21	lr	lr	PROPN
aiol-6350	218	22	were	be	AUX
aiol-6350	218	23	found	find	VERB
aiol-6350	218	24	in	in	ADP
aiol-6350	218	25	trace	trace	NOUN
aiol-6350	218	26	amounts	amount	NOUN
aiol-6350	218	27	during	during	ADP
aiol-6350	218	28	the	the	DET
aiol-6350	218	29	warm	warm	ADJ
aiol-6350	218	30	periods	period	NOUN
aiol-6350	218	31	at	at	ADP
aiol-6350	218	32	stations	station	NOUN
aiol-6350	218	33	kl1	kl1	NOUN
aiol-6350	218	34	and	and	CCONJ
aiol-6350	218	35	kk	kk	PROPN
aiol-6350	218	36	;	;	PUNCT
aiol-6350	218	37	in	in	ADP
aiol-6350	218	38	november	november	PROPN
aiol-6350	218	39	2013	2013	NUM
aiol-6350	218	40	at	at	ADP
aiol-6350	218	41	kk	kk	PROPN
aiol-6350	218	42	,	,	PUNCT
aiol-6350	218	43	mc	mc	PROPN
aiol-6350	218	44	-	-	PUNCT
aiol-6350	218	45	yr	yr	PROPN
aiol-6350	218	46	and	and	CCONJ
aiol-6350	218	47	mclr	mclr	NOUN
aiol-6350	218	48	were	be	AUX
aiol-6350	218	49	found	find	VERB
aiol-6350	218	50	in	in	ADP
aiol-6350	218	51	concentrations	concentration	NOUN
aiol-6350	218	52	below	below	ADP
aiol-6350	218	53	the	the	DET
aiol-6350	218	54	quantification	quantification	NOUN
aiol-6350	218	55	limit	limit	NOUN
aiol-6350	218	56	(	(	PUNCT
aiol-6350	218	57	tab	tab	NOUN
aiol-6350	218	58	.	.	NOUN
aiol-6350	218	59	4	4	NUM
aiol-6350	218	60	)	)	PUNCT
aiol-6350	218	61	.	.	PUNCT
aiol-6350	219	1	in	in	ADP
aiol-6350	219	2	july	july	PROPN
aiol-6350	219	3	2013	2013	NUM
aiol-6350	219	4	cyn	cyn	PROPN
aiol-6350	219	5	,	,	PUNCT
aiol-6350	219	6	atx	atx	PROPN
aiol-6350	219	7	-	-	PUNCT
aiol-6350	219	8	a	a	PROPN
aiol-6350	219	9	,	,	PUNCT
aiol-6350	219	10	stx	stx	NOUN
aiol-6350	219	11	and/or	and/or	CCONJ
aiol-6350	219	12	neostx	neostx	ADJ
aiol-6350	219	13	,	,	PUNCT
aiol-6350	219	14	and	and	CCONJ
aiol-6350	219	15	mcs	mcs	PROPN
aiol-6350	219	16	co	co	VERB
aiol-6350	219	17	-	-	VERB
aiol-6350	219	18	existed	exist	VERB
aiol-6350	219	19	in	in	ADP
aiol-6350	219	20	kl1	kl1	PROPN
aiol-6350	219	21	and	and	CCONJ
aiol-6350	219	22	kk	kk	PROPN
aiol-6350	219	23	.	.	PROPN
aiol-6350	219	24	ecological	ecological	ADJ
aiol-6350	219	25	classification	classification	NOUN
aiol-6350	219	26	according	accord	VERB
aiol-6350	219	27	to	to	ADP
aiol-6350	219	28	the	the	DET
aiol-6350	219	29	water	water	NOUN
aiol-6350	219	30	frame	frame	NOUN
aiol-6350	219	31	directive	directive	NOUN
aiol-6350	219	32	terminology	terminology	NOUN
aiol-6350	219	33	,	,	PUNCT
aiol-6350	219	34	the	the	DET
aiol-6350	219	35	ecological	ecological	ADJ
aiol-6350	219	36	status	status	NOUN
aiol-6350	219	37	of	of	ADP
aiol-6350	219	38	modified	modified	ADJ
aiol-6350	219	39	lakes	lake	NOUN
aiol-6350	219	40	is	be	AUX
aiol-6350	219	41	expressed	express	VERB
aiol-6350	219	42	as	as	ADP
aiol-6350	219	43	ecological	ecological	ADJ
aiol-6350	219	44	potential	potential	NOUN
aiol-6350	219	45	and	and	CCONJ
aiol-6350	219	46	the	the	DET
aiol-6350	219	47	goal	goal	NOUN
aiol-6350	219	48	is	be	AUX
aiol-6350	219	49	to	to	PART
aiol-6350	219	50	achieve	achieve	VERB
aiol-6350	219	51	at	at	ADP
aiol-6350	219	52	least	least	ADJ
aiol-6350	219	53	tab	tab	NOUN
aiol-6350	219	54	.	.	PUNCT
aiol-6350	220	1	3	3	X
aiol-6350	220	2	.	.	X
aiol-6350	220	3	pcr	pcr	ADJ
aiol-6350	220	4	amplification	amplification	NOUN
aiol-6350	220	5	of	of	ADP
aiol-6350	220	6	regions	region	NOUN
aiol-6350	220	7	targeting	target	VERB
aiol-6350	220	8	genes	gene	NOUN
aiol-6350	220	9	responsible	responsible	ADJ
aiol-6350	220	10	for	for	ADP
aiol-6350	220	11	mc	mc	PROPN
aiol-6350	220	12	(	(	PUNCT
aiol-6350	220	13	mcya	mcya	PROPN
aiol-6350	220	14	,	,	PUNCT
aiol-6350	220	15	mcyb	mcyb	PROPN
aiol-6350	220	16	,	,	PUNCT
aiol-6350	220	17	and	and	CCONJ
aiol-6350	220	18	mcye	mcye	ADJ
aiol-6350	220	19	/	/	SYM
aiol-6350	220	20	ndaf	ndaf	NOUN
aiol-6350	220	21	)	)	PUNCT
aiol-6350	220	22	,	,	PUNCT
aiol-6350	220	23	cyn	cyn	PROPN
aiol-6350	220	24	(	(	PUNCT
aiol-6350	220	25	ps	ps	PROPN
aiol-6350	220	26	,	,	PUNCT
aiol-6350	220	27	pks	pks	NOUN
aiol-6350	220	28	)	)	PUNCT
aiol-6350	220	29	and	and	CCONJ
aiol-6350	220	30	stx	stx	NOUN
aiol-6350	220	31	(	(	PUNCT
aiol-6350	220	32	stxi	stxi	VERB
aiol-6350	220	33	)	)	PUNCT
aiol-6350	220	34	production	production	NOUN
aiol-6350	220	35	,	,	PUNCT
aiol-6350	220	36	in	in	ADP
aiol-6350	220	37	the	the	DET
aiol-6350	220	38	water	water	NOUN
aiol-6350	220	39	samples	sample	NOUN
aiol-6350	220	40	collected	collect	VERB
aiol-6350	220	41	from	from	ADP
aiol-6350	220	42	lake	lake	PROPN
aiol-6350	220	43	karla	karla	PROPN
aiol-6350	220	44	(	(	PUNCT
aiol-6350	220	45	kl1	kl1	PROPN
aiol-6350	220	46	,	,	PUNCT
aiol-6350	220	47	kl3	kl3	PROPN
aiol-6350	220	48	)	)	PUNCT
aiol-6350	220	49	and	and	CCONJ
aiol-6350	220	50	kalamaki	kalamaki	PROPN
aiol-6350	220	51	reservoir	reservoir	PROPN
aiol-6350	220	52	(	(	PUNCT
aiol-6350	220	53	kk	kk	PROPN
aiol-6350	220	54	)	)	PUNCT
aiol-6350	220	55	.	.	PUNCT
aiol-6350	221	1	collection	collection	NOUN
aiol-6350	221	2	sampling	sample	VERB
aiol-6350	221	3	cyanotoxin	cyanotoxin	NOUN
aiol-6350	221	4	genes	gene	NOUN
aiol-6350	221	5	date	date	NOUN
aiol-6350	221	6	station	station	NOUN
aiol-6350	221	7	mcya	mcya	PROPN
aiol-6350	221	8	mcyb	mcyb	PROPN
aiol-6350	221	9	mcye	mcye	PROPN
aiol-6350	221	10	/	/	SYM
aiol-6350	221	11	ndaf	ndaf	NOUN
aiol-6350	221	12	ps	ps	NOUN
aiol-6350	221	13	pks	pks	NOUN
aiol-6350	221	14	sxti	sxti	PROPN
aiol-6350	221	15	26	26	NUM
aiol-6350	221	16	-	-	SYM
aiol-6350	221	17	07	07	NUM
aiol-6350	221	18	-	-	SYM
aiol-6350	221	19	13	13	NUM
aiol-6350	221	20	kl1	kl1	NOUN
aiol-6350	221	21	+	+	CCONJ
aiol-6350	221	22	+	+	CCONJ
aiol-6350	221	23	+	+	CCONJ
aiol-6350	221	24	kl2	kl2	PROPN
aiol-6350	221	25	+	+	CCONJ
aiol-6350	221	26	+	+	CCONJ
aiol-6350	221	27	kl3	kl3	NOUN
aiol-6350	221	28	+	+	X
aiol-6350	222	1	+	+	CCONJ
aiol-6350	223	1	+	+	NUM
aiol-6350	223	2	kl4	kl4	NOUN
aiol-6350	223	3	+	+	CCONJ
aiol-6350	224	1	+	+	CCONJ
aiol-6350	224	2	+	+	NUM
aiol-6350	224	3	11	11	NUM
aiol-6350	224	4	-	-	SYM
aiol-6350	224	5	09	09	NUM
aiol-6350	224	6	-	-	SYM
aiol-6350	224	7	13	13	NUM
aiol-6350	224	8	kl1	kl1	NOUN
aiol-6350	224	9	+	+	CCONJ
aiol-6350	225	1	+	+	PUNCT
aiol-6350	225	2	+	+	CCONJ
aiol-6350	225	3	+	+	CCONJ
aiol-6350	225	4	kl2	kl2	PROPN
aiol-6350	225	5	+	+	CCONJ
aiol-6350	225	6	+	+	CCONJ
aiol-6350	225	7	+	+	CCONJ
aiol-6350	225	8	kl3	kl3	ADJ
aiol-6350	225	9	+	+	X
aiol-6350	225	10	+	+	PUNCT
aiol-6350	225	11	+	+	CCONJ
aiol-6350	225	12	kk	kk	X
aiol-6350	225	13	+	+	X
aiol-6350	225	14	+	+	PUNCT
aiol-6350	225	15	+	+	CCONJ
aiol-6350	225	16	+	+	NUM
aiol-6350	225	17	22	22	NUM
aiol-6350	225	18	-	-	SYM
aiol-6350	225	19	11	11	NUM
aiol-6350	225	20	-	-	SYM
aiol-6350	225	21	13	13	NUM
aiol-6350	225	22	kl1	kl1	NOUN
aiol-6350	225	23	+	+	CCONJ
aiol-6350	225	24	+	+	CCONJ
aiol-6350	225	25	+	+	CCONJ
aiol-6350	225	26	kl2	kl2	PROPN
aiol-6350	225	27	+	+	CCONJ
aiol-6350	225	28	+	+	CCONJ
aiol-6350	225	29	+	+	CCONJ
aiol-6350	225	30	kl3	kl3	NOUN
aiol-6350	226	1	+	+	CCONJ
aiol-6350	226	2	kk	kk	X
aiol-6350	226	3	+	+	CCONJ
aiol-6350	227	1	+	+	CCONJ
aiol-6350	227	2	+	+	CCONJ
aiol-6350	227	3	21	21	NUM
aiol-6350	227	4	-	-	SYM
aiol-6350	227	5	02	02	NUM
aiol-6350	227	6	-	-	SYM
aiol-6350	227	7	14	14	NUM
aiol-6350	227	8	kl1	kl1	NOUN
aiol-6350	227	9	+	+	CCONJ
aiol-6350	227	10	+	+	CCONJ
aiol-6350	227	11	+	+	CCONJ
aiol-6350	227	12	kl2	kl2	PROPN
aiol-6350	227	13	+	+	CCONJ
aiol-6350	228	1	+	+	PUNCT
aiol-6350	228	2	+	+	CCONJ
aiol-6350	228	3	+	+	CCONJ
aiol-6350	228	4	kl3	kl3	ADJ
aiol-6350	228	5	+	+	X
aiol-6350	228	6	+	+	PUNCT
aiol-6350	228	7	+	+	CCONJ
aiol-6350	228	8	kk	kk	X
aiol-6350	228	9	+	+	CCONJ
aiol-6350	229	1	+	+	CCONJ
aiol-6350	229	2	+	+	NUM
aiol-6350	229	3	15	15	NUM
aiol-6350	229	4	-	-	SYM
aiol-6350	229	5	05	05	NUM
aiol-6350	229	6	-	-	SYM
aiol-6350	229	7	14	14	NUM
aiol-6350	229	8	kl1	kl1	NOUN
aiol-6350	229	9	+	+	CCONJ
aiol-6350	229	10	+	+	CCONJ
aiol-6350	229	11	+	+	CCONJ
aiol-6350	229	12	kl2	kl2	PROPN
aiol-6350	229	13	+	+	CCONJ
aiol-6350	229	14	+	+	CCONJ
aiol-6350	229	15	+	+	CCONJ
aiol-6350	229	16	kl3	kl3	ADJ
aiol-6350	229	17	+	+	X
aiol-6350	230	1	+	+	PUNCT
aiol-6350	230	2	+	+	CCONJ
aiol-6350	230	3	kk	kk	X
aiol-6350	230	4	+	+	CCONJ
aiol-6350	231	1	+	+	CCONJ
aiol-6350	231	2	+	+	NUM
aiol-6350	231	3	04	04	NUM
aiol-6350	231	4	-	-	PUNCT
aiol-6350	231	5	07	07	NUM
aiol-6350	231	6	-	-	PUNCT
aiol-6350	231	7	14	14	NUM
aiol-6350	231	8	kl1	kl1	NOUN
aiol-6350	231	9	+	+	CCONJ
aiol-6350	231	10	+	+	CCONJ
aiol-6350	231	11	+	+	CCONJ
aiol-6350	231	12	kl2	kl2	PROPN
aiol-6350	231	13	+	+	CCONJ
aiol-6350	231	14	+	+	CCONJ
aiol-6350	231	15	kl3	kl3	NOUN
aiol-6350	231	16	+	+	X
aiol-6350	232	1	+	+	PUNCT
aiol-6350	232	2	+	+	CCONJ
aiol-6350	232	3	kk	kk	X
aiol-6350	232	4	+	+	CCONJ
aiol-6350	233	1	+	+	CCONJ
aiol-6350	233	2	+	+	NUM
aiol-6350	233	3	04	04	NUM
aiol-6350	233	4	-	-	PUNCT
aiol-6350	233	5	09	09	NUM
aiol-6350	233	6	-	-	SYM
aiol-6350	233	7	14	14	NUM
aiol-6350	233	8	kl1	kl1	NOUN
aiol-6350	233	9	+	+	CCONJ
aiol-6350	233	10	+	+	CCONJ
aiol-6350	233	11	+	+	CCONJ
aiol-6350	233	12	kl2	kl2	PROPN
aiol-6350	233	13	+	+	CCONJ
aiol-6350	233	14	+	+	CCONJ
aiol-6350	233	15	+	+	CCONJ
aiol-6350	233	16	kl3	kl3	ADJ
aiol-6350	233	17	+	+	X
aiol-6350	234	1	+	+	PUNCT
aiol-6350	234	2	+	+	CCONJ
aiol-6350	234	3	kk	kk	X
aiol-6350	234	4	+	+	CCONJ
aiol-6350	235	1	+	+	CCONJ
aiol-6350	235	2	+	+	CCONJ
aiol-6350	235	3	07	07	NUM
aiol-6350	235	4	-	-	SYM
aiol-6350	235	5	11	11	NUM
aiol-6350	235	6	-	-	SYM
aiol-6350	235	7	14	14	NUM
aiol-6350	235	8	kl1	kl1	NOUN
aiol-6350	235	9	+	+	CCONJ
aiol-6350	235	10	+	+	CCONJ
aiol-6350	235	11	+	+	CCONJ
aiol-6350	235	12	kl2	kl2	PROPN
aiol-6350	235	13	+	+	CCONJ
aiol-6350	235	14	kl3	kl3	NOUN
aiol-6350	235	15	+	+	X
aiol-6350	236	1	+	+	CCONJ
aiol-6350	236	2	+	+	CCONJ
aiol-6350	236	3	kk	kk	X
aiol-6350	236	4	+	+	X
aiol-6350	237	1	+	+	PUNCT
aiol-6350	237	2	+	+	CCONJ
aiol-6350	237	3	+	+	NUM
aiol-6350	237	4	21	21	NUM
aiol-6350	237	5	-	-	SYM
aiol-6350	237	6	02	02	NUM
aiol-6350	237	7	-	-	SYM
aiol-6350	237	8	15	15	NUM
aiol-6350	237	9	kl1	kl1	NOUN
aiol-6350	237	10	+	+	CCONJ
aiol-6350	237	11	kl2	kl2	PROPN
aiol-6350	237	12	kl3	kl3	PROPN
aiol-6350	238	1	+	+	CCONJ
aiol-6350	238	2	kk	kk	X
aiol-6350	238	3	+	+	CCONJ
aiol-6350	238	4	15	15	NUM
aiol-6350	238	5	-	-	SYM
aiol-6350	238	6	05	05	NUM
aiol-6350	238	7	-	-	SYM
aiol-6350	238	8	15	15	NUM
aiol-6350	238	9	kl1	kl1	NOUN
aiol-6350	238	10	kl2	kl2	NOUN
aiol-6350	238	11	+	+	CCONJ
aiol-6350	239	1	+	+	CCONJ
aiol-6350	239	2	+	+	CCONJ
aiol-6350	239	3	kl3	kl3	ADJ
aiol-6350	239	4	kk	kk	X
aiol-6350	239	5	+	+	CCONJ
aiol-6350	240	1	+	+	PUNCT
aiol-6350	241	1	+	+	PUNCT
aiol-6350	241	2	+	+	CCONJ
aiol-6350	241	3	+	+	NUM
aiol-6350	241	4	01	01	NUM
aiol-6350	241	5	-	-	SYM
aiol-6350	241	6	07	07	NUM
aiol-6350	241	7	-	-	PUNCT
aiol-6350	241	8	15	15	NUM
aiol-6350	241	9	kl1	kl1	NOUN
aiol-6350	241	10	+	+	CCONJ
aiol-6350	241	11	+	+	CCONJ
aiol-6350	241	12	kl2	kl2	PROPN
aiol-6350	241	13	+	+	CCONJ
aiol-6350	241	14	+	+	CCONJ
aiol-6350	241	15	kl3	kl3	NOUN
aiol-6350	242	1	+	+	CCONJ
aiol-6350	242	2	kk	kk	X
aiol-6350	242	3	+	+	X
aiol-6350	243	1	+	+	PUNCT
aiol-6350	244	1	+	+	CCONJ
aiol-6350	244	2	+	+	CCONJ
aiol-6350	244	3	s.	s.	PROPN
aiol-6350	244	4	gkelis	gkelis	PROPN
aiol-6350	244	5	et	et	NOUN
aiol-6350	244	6	al.44	al.44	NOUN
aiol-6350	244	7	good	good	ADJ
aiol-6350	244	8	ecological	ecological	ADJ
aiol-6350	244	9	potential	potential	NOUN
aiol-6350	244	10	.	.	PUNCT
aiol-6350	245	1	considering	consider	VERB
aiol-6350	245	2	the	the	DET
aiol-6350	245	3	parameters	parameter	NOUN
aiol-6350	245	4	:	:	PUNCT
aiol-6350	245	5	i	i	NOUN
aiol-6350	245	6	)	)	PUNCT
aiol-6350	245	7	very	very	ADV
aiol-6350	245	8	high	high	ADJ
aiol-6350	245	9	phytoplankton	phytoplankton	NOUN
aiol-6350	245	10	biomass	biomass	NOUN
aiol-6350	245	11	(	(	PUNCT
aiol-6350	245	12	fig	fig	NOUN
aiol-6350	245	13	.	.	PUNCT
aiol-6350	246	1	4b	4b	PROPN
aiol-6350	246	2	)	)	PUNCT
aiol-6350	246	3	;	;	PUNCT
aiol-6350	246	4	ii	ii	X
aiol-6350	246	5	)	)	PUNCT
aiol-6350	246	6	dominance	dominance	NOUN
aiol-6350	246	7	of	of	ADP
aiol-6350	246	8	cyanobacteria	cyanobacteria	NOUN
aiol-6350	246	9	in	in	ADP
aiol-6350	246	10	phytoplankton	phytoplankton	NOUN
aiol-6350	246	11	(	(	PUNCT
aiol-6350	246	12	fig	fig	NOUN
aiol-6350	246	13	.	.	PUNCT
aiol-6350	247	1	5	5	NUM
aiol-6350	247	2	)	)	PUNCT
aiol-6350	248	1	;	;	PUNCT
aiol-6350	248	2	iii	iii	X
aiol-6350	248	3	)	)	PUNCT
aiol-6350	248	4	functional	functional	ADJ
aiol-6350	248	5	groups	group	NOUN
aiol-6350	248	6	dominating	dominate	VERB
aiol-6350	248	7	the	the	DET
aiol-6350	248	8	phytoplankton	phytoplankton	NOUN
aiol-6350	248	9	(	(	PUNCT
aiol-6350	248	10	fig	fig	NOUN
aiol-6350	248	11	.	.	PUNCT
aiol-6350	248	12	6	6	NUM
aiol-6350	248	13	)	)	PUNCT
aiol-6350	248	14	;	;	PUNCT
aiol-6350	248	15	iv	iv	X
aiol-6350	248	16	)	)	PUNCT
aiol-6350	248	17	low	low	ADJ
aiol-6350	248	18	diversity	diversity	NOUN
aiol-6350	248	19	of	of	ADP
aiol-6350	248	20	macroinvertebrate	macroinvertebrate	ADJ
aiol-6350	248	21	taxa	taxa	NOUN
aiol-6350	248	22	;	;	PUNCT
aiol-6350	248	23	v	v	NOUN
aiol-6350	248	24	)	)	PUNCT
aiol-6350	248	25	frequency	frequency	NOUN
aiol-6350	248	26	and	and	CCONJ
aiol-6350	248	27	intensity	intensity	NOUN
aiol-6350	248	28	of	of	ADP
aiol-6350	248	29	water	water	NOUN
aiol-6350	248	30	blooms	bloom	NOUN
aiol-6350	248	31	;	;	PUNCT
aiol-6350	248	32	and	and	CCONJ
aiol-6350	248	33	vi	vi	X
aiol-6350	248	34	)	)	PUNCT
aiol-6350	248	35	presence	presence	NOUN
aiol-6350	248	36	of	of	ADP
aiol-6350	248	37	multiple	multiple	ADJ
aiol-6350	248	38	cyanotoxins	cyanotoxin	NOUN
aiol-6350	248	39	(	(	PUNCT
aiol-6350	248	40	fig	fig	NOUN
aiol-6350	248	41	.	.	PUNCT
aiol-6350	249	1	7	7	NUM
aiol-6350	249	2	,	,	PUNCT
aiol-6350	249	3	tab	tab	NOUN
aiol-6350	249	4	.	.	NOUN
aiol-6350	250	1	4	4	NUM
aiol-6350	250	2	)	)	PUNCT
aiol-6350	250	3	,	,	PUNCT
aiol-6350	250	4	the	the	DET
aiol-6350	250	5	ecological	ecological	ADJ
aiol-6350	250	6	potential	potential	NOUN
aiol-6350	250	7	in	in	ADP
aiol-6350	250	8	lake	lake	PROPN
aiol-6350	250	9	karla	karla	PROPN
aiol-6350	250	10	and	and	CCONJ
aiol-6350	250	11	kalamaki	kalamaki	PROPN
aiol-6350	250	12	reservoir	reservoir	PROPN
aiol-6350	250	13	is	be	AUX
aiol-6350	250	14	classified	classify	VERB
aiol-6350	250	15	as	as	ADP
aiol-6350	250	16	poor	poor	ADJ
aiol-6350	250	17	.	.	PUNCT
aiol-6350	251	1	discussion	discussion	NOUN
aiol-6350	251	2	this	this	DET
aiol-6350	251	3	study	study	NOUN
aiol-6350	251	4	presents	present	VERB
aiol-6350	251	5	the	the	DET
aiol-6350	251	6	simultaneous	simultaneous	ADJ
aiol-6350	251	7	investigation	investigation	NOUN
aiol-6350	251	8	of	of	ADP
aiol-6350	251	9	the	the	DET
aiol-6350	251	10	phytoplankton	phytoplankton	NOUN
aiol-6350	251	11	,	,	PUNCT
aiol-6350	251	12	macroinvertebrate	macroinvertebrate	NOUN
aiol-6350	251	13	community	community	NOUN
aiol-6350	251	14	,	,	PUNCT
aiol-6350	251	15	and	and	CCONJ
aiol-6350	251	16	the	the	DET
aiol-6350	251	17	presence	presence	NOUN
aiol-6350	251	18	of	of	ADP
aiol-6350	251	19	cyanotoxins	cyanotoxin	NOUN
aiol-6350	251	20	in	in	ADP
aiol-6350	251	21	relation	relation	NOUN
aiol-6350	251	22	with	with	ADP
aiol-6350	251	23	key	key	ADJ
aiol-6350	251	24	limnological	limnological	ADJ
aiol-6350	251	25	features	feature	NOUN
aiol-6350	251	26	(	(	PUNCT
aiol-6350	251	27	nutrients	nutrient	NOUN
aiol-6350	251	28	,	,	PUNCT
aiol-6350	251	29	temperature	temperature	NOUN
aiol-6350	251	30	,	,	PUNCT
aiol-6350	251	31	ph	ph	NOUN
aiol-6350	251	32	,	,	PUNCT
aiol-6350	251	33	etc	etc	X
aiol-6350	251	34	.	.	X
aiol-6350	251	35	)	)	PUNCT
aiol-6350	251	36	in	in	ADP
aiol-6350	251	37	a	a	DET
aiol-6350	251	38	recently	recently	ADV
aiol-6350	251	39	restored	restore	VERB
aiol-6350	251	40	,	,	PUNCT
aiol-6350	251	41	highly	highly	ADV
aiol-6350	251	42	eutrophic	eutrophic	ADJ
aiol-6350	251	43	to	to	ADP
aiol-6350	251	44	hypertrophic	hypertrophic	ADJ
aiol-6350	251	45	(	(	PUNCT
aiol-6350	251	46	chamoglou	chamoglou	NOUN
aiol-6350	251	47	et	et	PROPN
aiol-6350	251	48	al	al	PROPN
aiol-6350	251	49	.	.	PROPN
aiol-6350	251	50	,	,	PUNCT
aiol-6350	251	51	2014	2014	NUM
aiol-6350	251	52	;	;	PUNCT
aiol-6350	251	53	theologou	theologou	NOUN
aiol-6350	251	54	et	et	PROPN
aiol-6350	251	55	al	al	PROPN
aiol-6350	251	56	.	.	PROPN
aiol-6350	251	57	,	,	PUNCT
aiol-6350	251	58	2016	2016	NUM
aiol-6350	251	59	)	)	PUNCT
aiol-6350	251	60	shallow	shallow	PROPN
aiol-6350	251	61	mediterranean	mediterranean	PROPN
aiol-6350	251	62	lake	lake	PROPN
aiol-6350	251	63	.	.	PUNCT
aiol-6350	252	1	in	in	ADP
aiol-6350	252	2	lake	lake	PROPN
aiol-6350	252	3	karla	karla	PROPN
aiol-6350	252	4	and	and	CCONJ
aiol-6350	252	5	kalamaki	kalamaki	PROPN
aiol-6350	252	6	reservoir	reservoir	PROPN
aiol-6350	252	7	dense	dense	ADJ
aiol-6350	252	8	blooms	bloom	NOUN
aiol-6350	252	9	dominated	dominate	VERB
aiol-6350	252	10	by	by	ADP
aiol-6350	252	11	cyanobacteria	cyanobacteria	NOUN
aiol-6350	252	12	were	be	AUX
aiol-6350	252	13	observed	observe	VERB
aiol-6350	252	14	throughout	throughout	ADP
aiol-6350	252	15	the	the	DET
aiol-6350	252	16	year	year	NOUN
aiol-6350	252	17	,	,	PUNCT
aiol-6350	252	18	in	in	ADP
aiol-6350	252	19	accordance	accordance	NOUN
aiol-6350	252	20	with	with	ADP
aiol-6350	252	21	previous	previous	ADJ
aiol-6350	252	22	findings	finding	NOUN
aiol-6350	252	23	in	in	ADP
aiol-6350	252	24	other	other	ADJ
aiol-6350	252	25	eutrophic	eutrophic	ADJ
aiol-6350	252	26	freshwaters	freshwater	NOUN
aiol-6350	252	27	of	of	ADP
aiol-6350	252	28	greece	greece	PROPN
aiol-6350	252	29	(	(	PUNCT
aiol-6350	252	30	cook	cook	VERB
aiol-6350	252	31	et	et	PROPN
aiol-6350	252	32	al	al	PROPN
aiol-6350	252	33	.	.	PROPN
aiol-6350	252	34	,	,	PUNCT
aiol-6350	252	35	2004	2004	NUM
aiol-6350	252	36	;	;	PUNCT
aiol-6350	252	37	gkelis	gkelis	PROPN
aiol-6350	252	38	et	et	PROPN
aiol-6350	252	39	al	al	PROPN
aiol-6350	252	40	.	.	PROPN
aiol-6350	252	41	,	,	PUNCT
aiol-6350	252	42	2014	2014	NUM
aiol-6350	252	43	)	)	PUNCT
aiol-6350	252	44	.	.	PUNCT
aiol-6350	253	1	mediterranean	mediterranean	PROPN
aiol-6350	253	2	lakes	lake	NOUN
aiol-6350	253	3	are	be	AUX
aiol-6350	253	4	subjected	subject	VERB
aiol-6350	253	5	to	to	ADP
aiol-6350	253	6	large	large	ADJ
aiol-6350	253	7	variations	variation	NOUN
aiol-6350	253	8	in	in	ADP
aiol-6350	253	9	water	water	NOUN
aiol-6350	253	10	level	level	NOUN
aiol-6350	253	11	,	,	PUNCT
aiol-6350	253	12	determined	determine	VERB
aiol-6350	253	13	by	by	ADP
aiol-6350	253	14	naturally	naturally	ADV
aiol-6350	253	15	intraand	intraand	X
aiol-6350	253	16	inter	inter	ADJ
aiol-6350	253	17	-	-	ADJ
aiol-6350	253	18	annual	annual	ADJ
aiol-6350	253	19	variations	variation	NOUN
aiol-6350	253	20	in	in	ADP
aiol-6350	253	21	rainfall	rainfall	NOUN
aiol-6350	253	22	and	and	CCONJ
aiol-6350	253	23	groundwater	groundwater	NOUN
aiol-6350	253	24	discharge	discharge	VERB
aiol-6350	253	25	or	or	CCONJ
aiol-6350	253	26	recharge	recharge	VERB
aiol-6350	253	27	in	in	ADP
aiol-6350	253	28	alternating	alternate	VERB
aiol-6350	253	29	drought	drought	NOUN
aiol-6350	253	30	and	and	CCONJ
aiol-6350	253	31	wet	wet	ADJ
aiol-6350	253	32	periods	period	NOUN
aiol-6350	253	33	(	(	PUNCT
aiol-6350	253	34	beklioglu	beklioglu	NOUN
aiol-6350	253	35	et	et	PROPN
aiol-6350	253	36	al	al	PROPN
aiol-6350	253	37	.	.	PROPN
aiol-6350	253	38	,	,	PUNCT
aiol-6350	253	39	2007	2007	NUM
aiol-6350	253	40	)	)	PUNCT
aiol-6350	253	41	.	.	PUNCT
aiol-6350	254	1	temperature	temperature	NOUN
aiol-6350	254	2	variations	variation	NOUN
aiol-6350	254	3	may	may	AUX
aiol-6350	254	4	have	have	VERB
aiol-6350	254	5	considerable	considerable	ADJ
aiol-6350	254	6	further	further	ADJ
aiol-6350	254	7	effects	effect	NOUN
aiol-6350	254	8	on	on	ADP
aiol-6350	254	9	the	the	DET
aiol-6350	254	10	lake	lake	NOUN
aiol-6350	254	11	’s	’s	PART
aiol-6350	254	12	ecosystem	ecosystem	NOUN
aiol-6350	254	13	structure	structure	NOUN
aiol-6350	254	14	and	and	CCONJ
aiol-6350	254	15	dynamics	dynamic	NOUN
aiol-6350	254	16	;	;	PUNCT
aiol-6350	254	17	for	for	ADP
aiol-6350	254	18	example	example	NOUN
aiol-6350	254	19	,	,	PUNCT
aiol-6350	254	20	their	their	PRON
aiol-6350	254	21	response	response	NOUN
aiol-6350	254	22	to	to	ADP
aiol-6350	254	23	eutrophication	eutrophication	NOUN
aiol-6350	254	24	seems	seem	VERB
aiol-6350	254	25	to	to	PART
aiol-6350	254	26	be	be	AUX
aiol-6350	254	27	quite	quite	ADV
aiol-6350	254	28	different	different	ADJ
aiol-6350	254	29	from	from	ADP
aiol-6350	254	30	that	that	PRON
aiol-6350	254	31	of	of	ADP
aiol-6350	254	32	the	the	DET
aiol-6350	254	33	cold	cold	ADJ
aiol-6350	254	34	temperate	temperate	NOUN
aiol-6350	254	35	in	in	ADP
aiol-6350	254	36	northern	northern	ADJ
aiol-6350	254	37	europe	europe	PROPN
aiol-6350	254	38	:	:	PUNCT
aiol-6350	254	39	nutrients	nutrient	NOUN
aiol-6350	254	40	can	can	AUX
aiol-6350	254	41	limit	limit	VERB
aiol-6350	254	42	phytoplankton	phytoplankton	NOUN
aiol-6350	254	43	biomass	biomass	NOUN
aiol-6350	254	44	throughout	throughout	ADP
aiol-6350	254	45	the	the	DET
aiol-6350	254	46	year	year	NOUN
aiol-6350	254	47	at	at	ADP
aiol-6350	254	48	low	low	ADJ
aiol-6350	254	49	latitudes	latitude	NOUN
aiol-6350	254	50	(	(	PUNCT
aiol-6350	254	51	moustakagouni	moustakagouni	PROPN
aiol-6350	254	52	et	et	PROPN
aiol-6350	254	53	al	al	PROPN
aiol-6350	254	54	.	.	PROPN
aiol-6350	254	55	,	,	PUNCT
aiol-6350	254	56	2014	2014	NUM
aiol-6350	254	57	)	)	PUNCT
aiol-6350	254	58	.	.	PUNCT
aiol-6350	255	1	prolonged	prolong	VERB
aiol-6350	255	2	hydraulic	hydraulic	ADJ
aiol-6350	255	3	retention	retention	NOUN
aiol-6350	255	4	time	time	NOUN
aiol-6350	255	5	because	because	SCONJ
aiol-6350	255	6	of	of	ADP
aiol-6350	255	7	drought	drought	NOUN
aiol-6350	255	8	,	,	PUNCT
aiol-6350	255	9	results	result	NOUN
aiol-6350	255	10	in	in	ADP
aiol-6350	255	11	increased	increase	VERB
aiol-6350	255	12	salinity	salinity	NOUN
aiol-6350	255	13	with	with	ADP
aiol-6350	255	14	secondary	secondary	ADJ
aiol-6350	255	15	effects	effect	NOUN
aiol-6350	255	16	on	on	ADP
aiol-6350	255	17	biota	biota	NOUN
aiol-6350	255	18	,	,	PUNCT
aiol-6350	255	19	ion	ion	NOUN
aiol-6350	255	20	toxicity	toxicity	NOUN
aiol-6350	255	21	and	and	CCONJ
aiol-6350	255	22	osmotic	osmotic	ADJ
aiol-6350	255	23	stress	stress	NOUN
aiol-6350	255	24	(	(	PUNCT
aiol-6350	255	25	jeppesen	jeppesen	PROPN
aiol-6350	255	26	et	et	PROPN
aiol-6350	255	27	al	al	PROPN
aiol-6350	255	28	.	.	PROPN
aiol-6350	255	29	,	,	PUNCT
aiol-6350	255	30	2007	2007	NUM
aiol-6350	255	31	)	)	PUNCT
aiol-6350	255	32	.	.	PUNCT
aiol-6350	256	1	such	such	ADJ
aiol-6350	256	2	conditions	condition	NOUN
aiol-6350	256	3	can	can	AUX
aiol-6350	256	4	significantly	significantly	ADV
aiol-6350	256	5	reduce	reduce	VERB
aiol-6350	256	6	the	the	DET
aiol-6350	256	7	resilience	resilience	NOUN
aiol-6350	256	8	of	of	ADP
aiol-6350	256	9	the	the	DET
aiol-6350	256	10	lake	lake	NOUN
aiol-6350	256	11	ecosystems	ecosystem	NOUN
aiol-6350	256	12	affecting	affect	VERB
aiol-6350	256	13	also	also	ADV
aiol-6350	256	14	their	their	PRON
aiol-6350	256	15	goods	good	NOUN
aiol-6350	256	16	and	and	CCONJ
aiol-6350	256	17	services	service	NOUN
aiol-6350	256	18	(	(	PUNCT
aiol-6350	256	19	kagalou	kagalou	PROPN
aiol-6350	256	20	,	,	PUNCT
aiol-6350	256	21	2010	2010	NUM
aiol-6350	256	22	)	)	PUNCT
aiol-6350	256	23	.	.	PUNCT
aiol-6350	257	1	our	our	PRON
aiol-6350	257	2	results	result	NOUN
aiol-6350	257	3	indicate	indicate	VERB
aiol-6350	257	4	that	that	SCONJ
aiol-6350	257	5	n	n	NOUN
aiol-6350	257	6	and	and	CCONJ
aiol-6350	257	7	p	p	NOUN
aiol-6350	257	8	inflows	inflow	NOUN
aiol-6350	257	9	combined	combine	VERB
aiol-6350	257	10	with	with	ADP
aiol-6350	257	11	extremely	extremely	ADV
aiol-6350	257	12	high	high	ADJ
aiol-6350	257	13	water	water	NOUN
aiol-6350	257	14	retention	retention	NOUN
aiol-6350	257	15	time	time	NOUN
aiol-6350	257	16	in	in	ADP
aiol-6350	257	17	lake	lake	PROPN
aiol-6350	257	18	karla	karla	PROPN
aiol-6350	257	19	and	and	CCONJ
aiol-6350	257	20	kalamaki	kalamaki	PROPN
aiol-6350	257	21	reservoir	reservoir	PROPN
aiol-6350	257	22	(	(	PUNCT
aiol-6350	257	23	chamoglou	chamoglou	NOUN
aiol-6350	257	24	et	et	PROPN
aiol-6350	257	25	al	al	PROPN
aiol-6350	257	26	.	.	PROPN
aiol-6350	257	27	,	,	PUNCT
aiol-6350	257	28	2014	2014	NUM
aiol-6350	257	29	)	)	PUNCT
aiol-6350	257	30	were	be	AUX
aiol-6350	257	31	the	the	DET
aiol-6350	257	32	main	main	ADJ
aiol-6350	257	33	drivers	driver	NOUN
aiol-6350	257	34	of	of	ADP
aiol-6350	257	35	the	the	DET
aiol-6350	257	36	phytoplankton	phytoplankton	NOUN
aiol-6350	257	37	succession	succession	NOUN
aiol-6350	257	38	and	and	CCONJ
aiol-6350	257	39	dominance	dominance	NOUN
aiol-6350	257	40	.	.	PUNCT
aiol-6350	258	1	the	the	DET
aiol-6350	258	2	nostocales	nostocale	NOUN
aiol-6350	258	3	dominance	dominance	NOUN
aiol-6350	258	4	can	can	AUX
aiol-6350	258	5	be	be	AUX
aiol-6350	258	6	linked	link	VERB
aiol-6350	258	7	to	to	ADP
aiol-6350	258	8	the	the	DET
aiol-6350	258	9	nutrient	nutrient	ADJ
aiol-6350	258	10	availability	availability	NOUN
aiol-6350	258	11	:	:	PUNCT
aiol-6350	258	12	the	the	DET
aiol-6350	258	13	din	din	PROPN
aiol-6350	258	14	/	/	SYM
aiol-6350	258	15	srp	srp	PROPN
aiol-6350	258	16	ratio	ratio	NOUN
aiol-6350	258	17	was	be	AUX
aiol-6350	258	18	<	<	X
aiol-6350	258	19	10	10	NUM
aiol-6350	258	20	for	for	ADP
aiol-6350	258	21	the	the	DET
aiol-6350	258	22	most	most	ADJ
aiol-6350	258	23	part	part	NOUN
aiol-6350	258	24	of	of	ADP
aiol-6350	258	25	the	the	DET
aiol-6350	258	26	monitoring	monitoring	NOUN
aiol-6350	258	27	period	period	NOUN
aiol-6350	258	28	,	,	PUNCT
aiol-6350	258	29	being	be	AUX
aiol-6350	258	30	close	close	ADJ
aiol-6350	258	31	to	to	ADP
aiol-6350	258	32	zero	zero	NUM
aiol-6350	258	33	in	in	ADP
aiol-6350	258	34	the	the	DET
aiol-6350	258	35	beginning	beginning	NOUN
aiol-6350	258	36	of	of	ADP
aiol-6350	258	37	the	the	DET
aiol-6350	258	38	monitoring	monitoring	NOUN
aiol-6350	258	39	,	,	PUNCT
aiol-6350	258	40	which	which	PRON
aiol-6350	258	41	probably	probably	ADV
aiol-6350	258	42	triggered	trigger	VERB
aiol-6350	258	43	the	the	DET
aiol-6350	258	44	increase	increase	NOUN
aiol-6350	258	45	of	of	ADP
aiol-6350	258	46	nitrogen	nitrogen	NOUN
aiol-6350	258	47	-	-	PUNCT
aiol-6350	258	48	fixing	fix	VERB
aiol-6350	258	49	cyanobacteria	cyanobacteria	NOUN
aiol-6350	258	50	that	that	PRON
aiol-6350	258	51	dominate	dominate	VERB
aiol-6350	258	52	under	under	ADP
aiol-6350	258	53	such	such	ADJ
aiol-6350	258	54	conditions	condition	NOUN
aiol-6350	258	55	(	(	PUNCT
aiol-6350	258	56	villena	villena	PROPN
aiol-6350	258	57	and	and	CCONJ
aiol-6350	258	58	romo	romo	PROPN
aiol-6350	258	59	,	,	PUNCT
aiol-6350	258	60	2003	2003	NUM
aiol-6350	258	61	;	;	PUNCT
aiol-6350	258	62	kagalou	kagalou	PROPN
aiol-6350	258	63	et	et	PROPN
aiol-6350	258	64	al	al	PROPN
aiol-6350	258	65	.	.	PROPN
aiol-6350	258	66	,	,	PUNCT
aiol-6350	258	67	2008	2008	NUM
aiol-6350	258	68	;	;	PUNCT
aiol-6350	258	69	kolzau	kolzau	NOUN
aiol-6350	258	70	et	et	PROPN
aiol-6350	258	71	al	al	PROPN
aiol-6350	258	72	.	.	PROPN
aiol-6350	258	73	,	,	PUNCT
aiol-6350	258	74	2014	2014	NUM
aiol-6350	258	75	)	)	PUNCT
aiol-6350	258	76	.	.	PUNCT
aiol-6350	259	1	the	the	DET
aiol-6350	259	2	cyanobacteria	cyanobacteria	NOUN
aiol-6350	259	3	that	that	PRON
aiol-6350	259	4	formed	form	VERB
aiol-6350	259	5	blooms	bloom	NOUN
aiol-6350	259	6	belong	belong	VERB
aiol-6350	259	7	to	to	ADP
aiol-6350	259	8	the	the	DET
aiol-6350	259	9	functional	functional	ADJ
aiol-6350	259	10	groups	group	NOUN
aiol-6350	259	11	h1	h1	PROPN
aiol-6350	259	12	,	,	PUNCT
aiol-6350	259	13	s1	s1	NOUN
aiol-6350	259	14	,	,	PUNCT
aiol-6350	259	15	and	and	CCONJ
aiol-6350	259	16	sn	sn	PROPN
aiol-6350	259	17	(	(	PUNCT
aiol-6350	259	18	reynolds	reynolds	PROPN
aiol-6350	259	19	et	et	PROPN
aiol-6350	259	20	al	al	PROPN
aiol-6350	259	21	.	.	PROPN
aiol-6350	259	22	,	,	PUNCT
aiol-6350	259	23	2002	2002	NUM
aiol-6350	259	24	;	;	PUNCT
aiol-6350	259	25	mantzouki	mantzouki	PROPN
aiol-6350	259	26	et	et	PROPN
aiol-6350	259	27	al	al	PROPN
aiol-6350	259	28	.	.	PROPN
aiol-6350	259	29	,	,	PUNCT
aiol-6350	259	30	2016	2016	NUM
aiol-6350	259	31	)	)	PUNCT
aiol-6350	259	32	.	.	PUNCT
aiol-6350	260	1	l.	l.	PROPN
aiol-6350	260	2	redekei	redekei	PROPN
aiol-6350	260	3	,	,	PUNCT
aiol-6350	260	4	p.	p.	NOUN
aiol-6350	260	5	agardhii	agardhii	VERB
aiol-6350	260	6	,	,	PUNCT
aiol-6350	260	7	and	and	CCONJ
aiol-6350	260	8	c.	c.	PROPN
aiol-6350	260	9	raciborskii	raciborskii	PROPN
aiol-6350	260	10	(	(	PUNCT
aiol-6350	260	11	s1	s1	NOUN
aiol-6350	260	12	and	and	CCONJ
aiol-6350	260	13	sn	sn	PROPN
aiol-6350	260	14	species	specie	NOUN
aiol-6350	260	15	)	)	PUNCT
aiol-6350	260	16	are	be	AUX
aiol-6350	260	17	particularly	particularly	ADV
aiol-6350	260	18	tolerant	tolerant	ADJ
aiol-6350	260	19	in	in	ADP
aiol-6350	260	20	low	low	ADJ
aiol-6350	260	21	irradiance	irradiance	NOUN
aiol-6350	260	22	(	(	PUNCT
aiol-6350	260	23	mischke	mischke	ADJ
aiol-6350	260	24	and	and	CCONJ
aiol-6350	260	25	nixdorf	nixdorf	PROPN
aiol-6350	260	26	,	,	PUNCT
aiol-6350	260	27	2003	2003	NUM
aiol-6350	260	28	)	)	PUNCT
aiol-6350	260	29	and	and	CCONJ
aiol-6350	260	30	this	this	PRON
aiol-6350	260	31	could	could	AUX
aiol-6350	260	32	account	account	VERB
aiol-6350	260	33	for	for	ADP
aiol-6350	260	34	their	their	PRON
aiol-6350	260	35	dominance	dominance	NOUN
aiol-6350	260	36	in	in	ADP
aiol-6350	260	37	the	the	DET
aiol-6350	260	38	turbid	turbid	ADJ
aiol-6350	260	39	environment	environment	NOUN
aiol-6350	260	40	and	and	CCONJ
aiol-6350	260	41	during	during	ADP
aiol-6350	260	42	the	the	DET
aiol-6350	260	43	cold	cold	ADJ
aiol-6350	260	44	period	period	NOUN
aiol-6350	260	45	.	.	PUNCT
aiol-6350	261	1	c.	c.	PROPN
aiol-6350	261	2	raciborskii	raciborskii	PROPN
aiol-6350	261	3	,	,	PUNCT
aiol-6350	261	4	particularly	particularly	ADV
aiol-6350	261	5	,	,	PUNCT
aiol-6350	261	6	although	although	SCONJ
aiol-6350	261	7	generally	generally	ADV
aiol-6350	261	8	considered	consider	VERB
aiol-6350	261	9	to	to	PART
aiol-6350	261	10	thrive	thrive	VERB
aiol-6350	261	11	in	in	ADP
aiol-6350	261	12	warm	warm	ADJ
aiol-6350	261	13	(	(	PUNCT
aiol-6350	261	14	>	>	X
aiol-6350	261	15	25	25	NUM
aiol-6350	261	16	°	°	NUM
aiol-6350	261	17	c	c	NOUN
aiol-6350	261	18	)	)	PUNCT
aiol-6350	261	19	waters	water	NOUN
aiol-6350	261	20	(	(	PUNCT
aiol-6350	261	21	see	see	VERB
aiol-6350	261	22	dokulil	dokulil	PROPN
aiol-6350	261	23	,	,	PUNCT
aiol-6350	261	24	2016	2016	NUM
aiol-6350	261	25	and	and	CCONJ
aiol-6350	261	26	references	reference	NOUN
aiol-6350	261	27	therein	therein	ADV
aiol-6350	261	28	)	)	PUNCT
aiol-6350	261	29	,	,	PUNCT
aiol-6350	261	30	has	have	AUX
aiol-6350	261	31	been	be	AUX
aiol-6350	261	32	reported	report	VERB
aiol-6350	261	33	to	to	PART
aiol-6350	261	34	grow	grow	VERB
aiol-6350	261	35	at	at	ADP
aiol-6350	261	36	17	17	NUM
aiol-6350	261	37	°	°	NOUN
aiol-6350	261	38	c	c	NOUN
aiol-6350	261	39	in	in	ADP
aiol-6350	261	40	german	german	ADJ
aiol-6350	261	41	waters	water	NOUN
aiol-6350	261	42	(	(	PUNCT
aiol-6350	261	43	mischke	mischke	ADJ
aiol-6350	261	44	,	,	PUNCT
aiol-6350	261	45	2003	2003	NUM
aiol-6350	261	46	)	)	PUNCT
aiol-6350	261	47	and	and	CCONJ
aiol-6350	261	48	recently	recently	ADV
aiol-6350	261	49	dokulil	dokulil	NOUN
aiol-6350	261	50	(	(	PUNCT
aiol-6350	261	51	2016	2016	NUM
aiol-6350	261	52	)	)	PUNCT
aiol-6350	261	53	showed	show	VERB
aiol-6350	261	54	its	its	PRON
aiol-6350	261	55	ability	ability	NOUN
aiol-6350	261	56	to	to	PART
aiol-6350	261	57	survive	survive	VERB
aiol-6350	261	58	in	in	ADP
aiol-6350	261	59	the	the	DET
aiol-6350	261	60	vegetative	vegetative	ADJ
aiol-6350	261	61	form	form	NOUN
aiol-6350	261	62	at	at	ADP
aiol-6350	261	63	water	water	NOUN
aiol-6350	261	64	temperatures	temperature	NOUN
aiol-6350	261	65	below	below	ADP
aiol-6350	261	66	12	12	NUM
aiol-6350	261	67	°	°	NOUN
aiol-6350	261	68	c	c	NOUN
aiol-6350	261	69	.	.	PUNCT
aiol-6350	262	1	its	its	PRON
aiol-6350	262	2	presence	presence	NOUN
aiol-6350	262	3	in	in	ADP
aiol-6350	262	4	lake	lake	PROPN
aiol-6350	262	5	kalamaki	kalamaki	PROPN
aiol-6350	262	6	in	in	ADP
aiol-6350	262	7	temperatures	temperature	NOUN
aiol-6350	262	8	as	as	ADV
aiol-6350	262	9	low	low	ADJ
aiol-6350	262	10	as	as	ADP
aiol-6350	262	11	12	12	NUM
aiol-6350	262	12	°	°	NOUN
aiol-6350	262	13	c	c	NOUN
aiol-6350	262	14	may	may	AUX
aiol-6350	262	15	be	be	AUX
aiol-6350	262	16	further	further	ADJ
aiol-6350	262	17	evidence	evidence	NOUN
aiol-6350	262	18	of	of	ADP
aiol-6350	262	19	the	the	DET
aiol-6350	262	20	wide	wide	ADJ
aiol-6350	262	21	tolerance	tolerance	NOUN
aiol-6350	262	22	spectrum	spectrum	NOUN
aiol-6350	262	23	of	of	ADP
aiol-6350	262	24	c.	c.	PROPN
aiol-6350	262	25	raciborskii	raciborskii	PROPN
aiol-6350	262	26	,	,	PUNCT
aiol-6350	262	27	which	which	PRON
aiol-6350	262	28	enables	enable	VERB
aiol-6350	262	29	it	it	PRON
aiol-6350	262	30	to	to	PART
aiol-6350	262	31	survive	survive	VERB
aiol-6350	262	32	and	and	CCONJ
aiol-6350	262	33	thrive	thrive	VERB
aiol-6350	262	34	in	in	ADP
aiol-6350	262	35	novel	novel	ADJ
aiol-6350	262	36	environments	environment	NOUN
aiol-6350	262	37	(	(	PUNCT
aiol-6350	262	38	rzymski	rzymski	ADJ
aiol-6350	262	39	and	and	CCONJ
aiol-6350	262	40	poniedziałek	poniedziałek	ADJ
aiol-6350	262	41	,	,	PUNCT
aiol-6350	262	42	tab	tab	NOUN
aiol-6350	262	43	.	.	PUNCT
aiol-6350	263	1	4	4	NUM
aiol-6350	263	2	.	.	X
aiol-6350	263	3	cyanotoxin	cyanotoxin	NOUN
aiol-6350	263	4	occurrence	occurrence	NOUN
aiol-6350	263	5	and	and	CCONJ
aiol-6350	263	6	concentration	concentration	NOUN
aiol-6350	263	7	(	(	PUNCT
aiol-6350	263	8	intracellular	intracellular	NOUN
aiol-6350	263	9	)	)	PUNCT
aiol-6350	263	10	in	in	ADP
aiol-6350	263	11	water	water	NOUN
aiol-6350	263	12	samples	sample	NOUN
aiol-6350	263	13	collected	collect	VERB
aiol-6350	263	14	from	from	ADP
aiol-6350	263	15	lake	lake	PROPN
aiol-6350	263	16	karla	karla	PROPN
aiol-6350	263	17	(	(	PUNCT
aiol-6350	263	18	kl1	kl1	PROPN
aiol-6350	263	19	,	,	PUNCT
aiol-6350	263	20	kl3	kl3	PROPN
aiol-6350	263	21	)	)	PUNCT
aiol-6350	263	22	and	and	CCONJ
aiol-6350	263	23	kalamaki	kalamaki	PROPN
aiol-6350	263	24	reservoir	reservoir	PROPN
aiol-6350	263	25	(	(	PUNCT
aiol-6350	263	26	kk	kk	PROPN
aiol-6350	263	27	)	)	PUNCT
aiol-6350	263	28	as	as	SCONJ
aiol-6350	263	29	determined	determine	VERB
aiol-6350	263	30	by	by	ADP
aiol-6350	263	31	lc	lc	PROPN
aiol-6350	263	32	-	-	PUNCT
aiol-6350	263	33	ms	ms	PROPN
aiol-6350	263	34	/	/	SYM
aiol-6350	263	35	ms	ms	NOUN
aiol-6350	263	36	analysis	analysis	NOUN
aiol-6350	263	37	.	.	PUNCT
aiol-6350	264	1	collection	collection	NOUN
aiol-6350	264	2	sampling	sample	VERB
aiol-6350	264	3	toxin	toxin	NOUN
aiol-6350	264	4	concentration	concentration	NOUN
aiol-6350	264	5	(	(	PUNCT
aiol-6350	264	6	µg	µg	ADV
aiol-6350	264	7	l–1	l–1	NOUN
aiol-6350	264	8	)	)	PUNCT
aiol-6350	264	9	date	date	NOUN
aiol-6350	264	10	station	station	NOUN
aiol-6350	264	11	cyn	cyn	PROPN
aiol-6350	264	12	atx	atx	PROPN
aiol-6350	264	13	-	-	PUNCT
aiol-6350	264	14	a	a	DET
aiol-6350	264	15	stx	stx	NOUN
aiol-6350	264	16	neo	neo	NOUN
aiol-6350	264	17	-	-	NOUN
aiol-6350	264	18	stx	stx	NOUN
aiol-6350	264	19	[	[	X
aiol-6350	264	20	d	d	X
aiol-6350	264	21	-	-	PUNCT
aiol-6350	264	22	asp3	asp3	ADV
aiol-6350	264	23	]	]	X
aiol-6350	264	24	mc	mc	PROPN
aiol-6350	264	25	-	-	PUNCT
aiol-6350	264	26	rr	rr	PROPN
aiol-6350	264	27	mc	mc	PROPN
aiol-6350	264	28	-	-	PROPN
aiol-6350	264	29	yr	yr	PROPN
aiol-6350	264	30	mc	mc	PROPN
aiol-6350	264	31	-	-	PUNCT
aiol-6350	264	32	lr	lr	PROPN
aiol-6350	264	33	mc	mc	PROPN
aiol-6350	264	34	-	-	PROPN
aiol-6350	264	35	rr	rr	PROPN
aiol-6350	264	36	26	26	NUM
aiol-6350	264	37	-	-	PUNCT
aiol-6350	264	38	07	07	NUM
aiol-6350	264	39	-	-	SYM
aiol-6350	264	40	13	13	NUM
aiol-6350	264	41	kl1	kl1	NOUN
aiol-6350	264	42	2.6	2.6	NUM
aiol-6350	264	43	0.8	0.8	NUM
aiol-6350	264	44	<	<	X
aiol-6350	264	45	loq	loq	PROPN
aiol-6350	264	46	<	<	PROPN
aiol-6350	264	47	loq	loq	PROPN
aiol-6350	264	48	n.d	n.d	PROPN
aiol-6350	264	49	.	.	PROPN
aiol-6350	265	1	<	<	PROPN
aiol-6350	265	2	loq	loq	PROPN
aiol-6350	265	3	n.d	n.d	PROPN
aiol-6350	265	4	.	.	PROPN
aiol-6350	266	1	<	<	PROPN
aiol-6350	266	2	loq	loq	PROPN
aiol-6350	266	3	kk	kk	PROPN
aiol-6350	266	4	10.1	10.1	NUM
aiol-6350	266	5	5.4	5.4	NUM
aiol-6350	266	6	<	<	X
aiol-6350	266	7	loq	loq	PROPN
aiol-6350	266	8	n.d	n.d	PROPN
aiol-6350	266	9	.	.	PROPN
aiol-6350	266	10	n.d	n.d	PROPN
aiol-6350	266	11	.	.	PROPN
aiol-6350	267	1	<	<	PROPN
aiol-6350	267	2	loq	loq	PROPN
aiol-6350	267	3	n.d	n.d	PROPN
aiol-6350	267	4	.	.	PROPN
aiol-6350	268	1	<	<	PROPN
aiol-6350	268	2	loq	loq	PROPN
aiol-6350	268	3	kl3	kl3	PROPN
aiol-6350	268	4	n.d	n.d	PROPN
aiol-6350	268	5	.	.	PROPN
aiol-6350	268	6	n.d	n.d	PROPN
aiol-6350	268	7	.	.	PROPN
aiol-6350	269	1	<	<	X
aiol-6350	269	2	loq	loq	PROPN
aiol-6350	269	3	<	<	PROPN
aiol-6350	269	4	loq	loq	PROPN
aiol-6350	269	5	<	<	PROPN
aiol-6350	269	6	loq	loq	PROPN
aiol-6350	269	7	n.d	n.d	PROPN
aiol-6350	269	8	.	.	PROPN
aiol-6350	270	1	<	<	X
aiol-6350	270	2	loq	loq	PROPN
aiol-6350	270	3	<	<	PROPN
aiol-6350	270	4	loq	loq	PROPN
aiol-6350	270	5	11	11	NUM
aiol-6350	270	6	-	-	SYM
aiol-6350	270	7	09	09	NUM
aiol-6350	270	8	-	-	SYM
aiol-6350	270	9	13	13	NUM
aiol-6350	270	10	kl1	kl1	PROPN
aiol-6350	270	11	n.d	n.d	PROPN
aiol-6350	270	12	.	.	PROPN
aiol-6350	270	13	n.d	n.d	PROPN
aiol-6350	270	14	.	.	PROPN
aiol-6350	271	1	<	<	PROPN
aiol-6350	271	2	loq	loq	PROPN
aiol-6350	271	3	n.d	n.d	PROPN
aiol-6350	271	4	.	.	PROPN
aiol-6350	271	5	n.d	n.d	PROPN
aiol-6350	271	6	.	.	PROPN
aiol-6350	271	7	n.d	n.d	PROPN
aiol-6350	271	8	.	.	PROPN
aiol-6350	272	1	<	<	PROPN
aiol-6350	272	2	loq	loq	PROPN
aiol-6350	272	3	n.d	n.d	PROPN
aiol-6350	272	4	.	.	PROPN
aiol-6350	272	5	kl3	kl3	PROPN
aiol-6350	272	6	n.d	n.d	PROPN
aiol-6350	272	7	.	.	PROPN
aiol-6350	272	8	n.d	n.d	PROPN
aiol-6350	272	9	.	.	PROPN
aiol-6350	273	1	<	<	X
aiol-6350	273	2	loq	loq	PROPN
aiol-6350	273	3	<	<	PROPN
aiol-6350	273	4	loq	loq	PROPN
aiol-6350	273	5	n.d	n.d	PROPN
aiol-6350	273	6	.	.	PROPN
aiol-6350	273	7	n.d	n.d	PROPN
aiol-6350	273	8	.	.	PROPN
aiol-6350	273	9	n.d	n.d	PROPN
aiol-6350	273	10	.	.	PROPN
aiol-6350	273	11	n.d	n.d	PROPN
aiol-6350	273	12	.	.	PROPN
aiol-6350	273	13	kk	kk	PROPN
aiol-6350	273	14	0.5	0.5	NUM
aiol-6350	273	15	n.d	n.d	PROPN
aiol-6350	273	16	.	.	PROPN
aiol-6350	274	1	<	<	X
aiol-6350	274	2	loq	loq	PROPN
aiol-6350	274	3	<	<	PROPN
aiol-6350	274	4	loq	loq	PROPN
aiol-6350	274	5	n.d	n.d	PROPN
aiol-6350	274	6	.	.	PROPN
aiol-6350	274	7	n.d	n.d	PROPN
aiol-6350	274	8	.	.	PROPN
aiol-6350	274	9	n.d	n.d	PROPN
aiol-6350	274	10	.	.	PROPN
aiol-6350	275	1	<	<	AUX
aiol-6350	275	2	loq	loq	PROPN
aiol-6350	275	3	22	22	NUM
aiol-6350	275	4	-	-	SYM
aiol-6350	275	5	11	11	NUM
aiol-6350	275	6	-	-	SYM
aiol-6350	275	7	13	13	NUM
aiol-6350	275	8	kl1	kl1	PROPN
aiol-6350	275	9	n.d	n.d	PROPN
aiol-6350	275	10	.	.	PROPN
aiol-6350	275	11	n.d	n.d	PROPN
aiol-6350	275	12	.	.	PROPN
aiol-6350	276	1	<	<	X
aiol-6350	276	2	loq	loq	PROPN
aiol-6350	276	3	<	<	PROPN
aiol-6350	276	4	loq	loq	PROPN
aiol-6350	276	5	n.d	n.d	PROPN
aiol-6350	276	6	.	.	PROPN
aiol-6350	276	7	n.d	n.d	PROPN
aiol-6350	276	8	.	.	PROPN
aiol-6350	276	9	n.d	n.d	PROPN
aiol-6350	276	10	.	.	PROPN
aiol-6350	276	11	n.d	n.d	PROPN
aiol-6350	276	12	.	.	PROPN
aiol-6350	276	13	kk	kk	PROPN
aiol-6350	276	14	1.0	1.0	NUM
aiol-6350	276	15	n.d	n.d	PROPN
aiol-6350	276	16	.	.	PROPN
aiol-6350	277	1	<	<	PROPN
aiol-6350	277	2	loq	loq	PROPN
aiol-6350	277	3	n.d	n.d	PROPN
aiol-6350	277	4	.	.	PROPN
aiol-6350	277	5	n.d	n.d	PROPN
aiol-6350	277	6	.	.	PROPN
aiol-6350	277	7	n.d	n.d	PROPN
aiol-6350	277	8	.	.	PROPN
aiol-6350	278	1	<	<	X
aiol-6350	278	2	loq	loq	PROPN
aiol-6350	278	3	<	<	PROPN
aiol-6350	278	4	loq	loq	PROPN
aiol-6350	278	5	21	21	NUM
aiol-6350	278	6	-	-	PUNCT
aiol-6350	278	7	02	02	NUM
aiol-6350	278	8	-	-	PUNCT
aiol-6350	278	9	14	14	NUM
aiol-6350	278	10	kl3	kl3	PROPN
aiol-6350	278	11	n.d	n.d	PROPN
aiol-6350	278	12	.	.	PROPN
aiol-6350	278	13	n.d	n.d	PROPN
aiol-6350	278	14	.	.	PROPN
aiol-6350	279	1	<	<	X
aiol-6350	279	2	loq	loq	PROPN
aiol-6350	279	3	<	<	PROPN
aiol-6350	279	4	loq	loq	PROPN
aiol-6350	279	5	n.d	n.d	PROPN
aiol-6350	279	6	.	.	PROPN
aiol-6350	279	7	n.d	n.d	PROPN
aiol-6350	279	8	.	.	PROPN
aiol-6350	279	9	n.d	n.d	PROPN
aiol-6350	279	10	.	.	PROPN
aiol-6350	279	11	n.d	n.d	PROPN
aiol-6350	279	12	.	.	PROPN
aiol-6350	279	13	04	04	NUM
aiol-6350	279	14	-	-	PUNCT
aiol-6350	279	15	07	07	NUM
aiol-6350	279	16	-	-	PUNCT
aiol-6350	279	17	14	14	NUM
aiol-6350	279	18	kl1	kl1	NOUN
aiol-6350	279	19	12.1	12.1	NUM
aiol-6350	279	20	2.2	2.2	NUM
aiol-6350	279	21	<	<	X
aiol-6350	279	22	loq	loq	PROPN
aiol-6350	279	23	n.d	n.d	PROPN
aiol-6350	279	24	.	.	PROPN
aiol-6350	279	25	n.d	n.d	PROPN
aiol-6350	279	26	.	.	PROPN
aiol-6350	280	1	<	<	PROPN
aiol-6350	280	2	loq	loq	PROPN
aiol-6350	280	3	n.d	n.d	PROPN
aiol-6350	280	4	.	.	PROPN
aiol-6350	281	1	<	<	PROPN
aiol-6350	281	2	loq	loq	PROPN
aiol-6350	281	3	kk	kk	PROPN
aiol-6350	281	4	<	<	PROPN
aiol-6350	281	5	loq	loq	PROPN
aiol-6350	281	6	n.d	n.d	PROPN
aiol-6350	281	7	.	.	PROPN
aiol-6350	282	1	<	<	X
aiol-6350	282	2	loq	loq	PROPN
aiol-6350	282	3	<	<	PROPN
aiol-6350	282	4	loq	loq	PROPN
aiol-6350	282	5	n.d	n.d	PROPN
aiol-6350	282	6	.	.	PROPN
aiol-6350	282	7	n.d	n.d	PROPN
aiol-6350	282	8	.	.	PROPN
aiol-6350	282	9	n.d	n.d	PROPN
aiol-6350	282	10	.	.	PROPN
aiol-6350	282	11	n.d	n.d	PROPN
aiol-6350	282	12	.	.	PROPN
aiol-6350	282	13	04	04	NUM
aiol-6350	282	14	-	-	PUNCT
aiol-6350	282	15	09	09	NUM
aiol-6350	282	16	-	-	SYM
aiol-6350	282	17	14	14	NUM
aiol-6350	282	18	kk	kk	NOUN
aiol-6350	282	19	<	<	PROPN
aiol-6350	282	20	loq	loq	PROPN
aiol-6350	282	21	n.d	n.d	PROPN
aiol-6350	282	22	.	.	PROPN
aiol-6350	283	1	<	<	PROPN
aiol-6350	283	2	loq	loq	PROPN
aiol-6350	283	3	n.d	n.d	PROPN
aiol-6350	283	4	.	.	PROPN
aiol-6350	283	5	n.d	n.d	PROPN
aiol-6350	283	6	.	.	PROPN
aiol-6350	283	7	n.d	n.d	PROPN
aiol-6350	283	8	.	.	PROPN
aiol-6350	283	9	n.d	n.d	PROPN
aiol-6350	283	10	.	.	PROPN
aiol-6350	283	11	n.d	n.d	PROPN
aiol-6350	283	12	.	.	PROPN
aiol-6350	283	13	07	07	NUM
aiol-6350	283	14	-	-	PUNCT
aiol-6350	283	15	11	11	NUM
aiol-6350	283	16	-	-	SYM
aiol-6350	283	17	14	14	NUM
aiol-6350	283	18	kl1	kl1	PROPN
aiol-6350	283	19	n.d	n.d	PROPN
aiol-6350	283	20	.	.	PROPN
aiol-6350	283	21	n.d	n.d	PROPN
aiol-6350	283	22	.	.	PROPN
aiol-6350	284	1	<	<	PROPN
aiol-6350	284	2	loq	loq	PROPN
aiol-6350	284	3	n.d	n.d	PROPN
aiol-6350	284	4	.	.	PROPN
aiol-6350	284	5	n.d	n.d	PROPN
aiol-6350	284	6	.	.	PROPN
aiol-6350	284	7	n.d	n.d	PROPN
aiol-6350	284	8	.	.	PROPN
aiol-6350	284	9	n.d	n.d	PROPN
aiol-6350	284	10	.	.	PROPN
aiol-6350	284	11	n.d	n.d	PROPN
aiol-6350	284	12	.	.	PROPN
aiol-6350	284	13	loq	loq	PROPN
aiol-6350	284	14	,	,	PUNCT
aiol-6350	284	15	limit	limit	NOUN
aiol-6350	284	16	of	of	ADP
aiol-6350	284	17	quantification	quantification	NOUN
aiol-6350	284	18	;	;	PUNCT
aiol-6350	284	19	n.d	n.d	PROPN
aiol-6350	284	20	.	.	PROPN
aiol-6350	284	21	,	,	PUNCT
aiol-6350	284	22	not	not	PART
aiol-6350	284	23	detected	detect	VERB
aiol-6350	284	24	.	.	PUNCT
aiol-6350	285	1	water	water	NOUN
aiol-6350	285	2	quality	quality	NOUN
aiol-6350	285	3	and	and	CCONJ
aiol-6350	285	4	cyanotoxins	cyanotoxin	NOUN
aiol-6350	285	5	in	in	ADP
aiol-6350	285	6	the	the	DET
aiol-6350	285	7	reconstructed	reconstructed	ADJ
aiol-6350	285	8	lake	lake	NOUN
aiol-6350	285	9	karla	karla	PROPN
aiol-6350	285	10	45	45	NUM
aiol-6350	285	11	2014	2014	NUM
aiol-6350	285	12	)	)	PUNCT
aiol-6350	285	13	.	.	PUNCT
aiol-6350	286	1	furthermore	furthermore	ADV
aiol-6350	286	2	,	,	PUNCT
aiol-6350	286	3	s1	s1	NOUN
aiol-6350	286	4	and	and	CCONJ
aiol-6350	286	5	sn	sn	PROPN
aiol-6350	286	6	species	specie	NOUN
aiol-6350	286	7	are	be	AUX
aiol-6350	286	8	only	only	ADV
aiol-6350	286	9	sensitive	sensitive	ADJ
aiol-6350	286	10	to	to	ADP
aiol-6350	286	11	flushing	flush	VERB
aiol-6350	286	12	(	(	PUNCT
aiol-6350	286	13	mantzouki	mantzouki	PROPN
aiol-6350	286	14	et	et	PROPN
aiol-6350	286	15	al	al	PROPN
aiol-6350	286	16	.	.	PROPN
aiol-6350	286	17	,	,	PUNCT
aiol-6350	286	18	2016	2016	NUM
aiol-6350	286	19	)	)	PUNCT
aiol-6350	286	20	,	,	PUNCT
aiol-6350	286	21	which	which	PRON
aiol-6350	286	22	never	never	ADV
aiol-6350	286	23	occurred	occur	VERB
aiol-6350	286	24	during	during	ADP
aiol-6350	286	25	the	the	DET
aiol-6350	286	26	monitoring	monitoring	NOUN
aiol-6350	286	27	period	period	NOUN
aiol-6350	286	28	or	or	CCONJ
aiol-6350	286	29	earlier	early	ADV
aiol-6350	286	30	(	(	PUNCT
aiol-6350	286	31	chamoglou	chamoglou	NOUN
aiol-6350	286	32	et	et	PROPN
aiol-6350	286	33	al	al	PROPN
aiol-6350	286	34	.	.	PROPN
aiol-6350	286	35	,	,	PUNCT
aiol-6350	286	36	2014	2014	NUM
aiol-6350	286	37	)	)	PUNCT
aiol-6350	286	38	.	.	PUNCT
aiol-6350	287	1	in	in	ADP
aiol-6350	287	2	shallow	shallow	PROPN
aiol-6350	287	3	mediterranean	mediterranean	PROPN
aiol-6350	287	4	lakes	lake	NOUN
aiol-6350	287	5	,	,	PUNCT
aiol-6350	287	6	cyanobacterial	cyanobacterial	ADJ
aiol-6350	287	7	blooms	bloom	NOUN
aiol-6350	287	8	and	and	CCONJ
aiol-6350	287	9	their	their	PRON
aiol-6350	287	10	long	long	ADJ
aiol-6350	287	11	persistence	persistence	NOUN
aiol-6350	287	12	are	be	AUX
aiol-6350	287	13	more	more	ADV
aiol-6350	287	14	expected	expect	VERB
aiol-6350	287	15	at	at	ADP
aiol-6350	287	16	low	low	ADJ
aiol-6350	287	17	flushing	flush	VERB
aiol-6350	287	18	rates	rate	NOUN
aiol-6350	287	19	(	(	PUNCT
aiol-6350	287	20	romo	romo	NOUN
aiol-6350	287	21	et	et	NOUN
aiol-6350	287	22	al	al	PROPN
aiol-6350	287	23	.	.	PROPN
aiol-6350	287	24	,	,	PUNCT
aiol-6350	287	25	2004	2004	NUM
aiol-6350	287	26	)	)	PUNCT
aiol-6350	287	27	.	.	PUNCT
aiol-6350	288	1	a.	a.	NOUN
aiol-6350	288	2	elenkinii	elenkinii	PROPN
aiol-6350	288	3	and	and	CCONJ
aiol-6350	288	4	sph	sph	PROPN
aiol-6350	288	5	.	.	PROPN
aiol-6350	289	1	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	289	2	(	(	PUNCT
aiol-6350	289	3	h1	h1	PROPN
aiol-6350	289	4	species	specie	NOUN
aiol-6350	289	5	)	)	PUNCT
aiol-6350	289	6	are	be	AUX
aiol-6350	289	7	only	only	ADV
aiol-6350	289	8	sensitive	sensitive	ADJ
aiol-6350	289	9	to	to	ADP
aiol-6350	289	10	low	low	ADJ
aiol-6350	289	11	light	light	ADJ
aiol-6350	289	12	,	,	PUNCT
aiol-6350	289	13	low	low	ADJ
aiol-6350	289	14	phosphorus	phosphorus	NOUN
aiol-6350	289	15	and	and	CCONJ
aiol-6350	289	16	mixing	mixing	NOUN
aiol-6350	289	17	(	(	PUNCT
aiol-6350	289	18	reynolds	reynolds	PROPN
aiol-6350	289	19	et	et	PROPN
aiol-6350	289	20	al	al	PROPN
aiol-6350	289	21	.	.	PROPN
aiol-6350	289	22	,	,	PUNCT
aiol-6350	289	23	2002	2002	NUM
aiol-6350	289	24	;	;	PUNCT
aiol-6350	289	25	mantzouki	mantzouki	PROPN
aiol-6350	289	26	et	et	PROPN
aiol-6350	289	27	al	al	PROPN
aiol-6350	289	28	.	.	PROPN
aiol-6350	289	29	,	,	PUNCT
aiol-6350	289	30	2016	2016	NUM
aiol-6350	289	31	)	)	PUNCT
aiol-6350	289	32	,	,	PUNCT
aiol-6350	289	33	conditions	condition	NOUN
aiol-6350	289	34	rarely	rarely	ADV
aiol-6350	289	35	met	meet	VERB
aiol-6350	289	36	in	in	ADP
aiol-6350	289	37	lake	lake	PROPN
aiol-6350	289	38	karla	karla	PROPN
aiol-6350	289	39	and	and	CCONJ
aiol-6350	289	40	kalamaki	kalamaki	PROPN
aiol-6350	289	41	reservoir	reservoir	PROPN
aiol-6350	289	42	,	,	PUNCT
aiol-6350	289	43	enabling	enable	VERB
aiol-6350	289	44	them	they	PRON
aiol-6350	289	45	to	to	PART
aiol-6350	289	46	dominate	dominate	VERB
aiol-6350	289	47	phytoplankton	phytoplankton	NOUN
aiol-6350	289	48	.	.	PUNCT
aiol-6350	290	1	l.	l.	PROPN
aiol-6350	290	2	redekei	redekei	PROPN
aiol-6350	290	3	,	,	PUNCT
aiol-6350	290	4	p.	p.	NOUN
aiol-6350	290	5	agardhii	agardhii	VERB
aiol-6350	290	6	a.	a.	NOUN
aiol-6350	290	7	elenkinii	elenkinii	PROPN
aiol-6350	290	8	and	and	CCONJ
aiol-6350	290	9	sph	sph	PROPN
aiol-6350	290	10	.	.	PROPN
aiol-6350	291	1	aphanizomenoides	aphanizomenoide	NOUN
aiol-6350	291	2	were	be	AUX
aiol-6350	291	3	found	find	VERB
aiol-6350	291	4	dominant	dominant	ADJ
aiol-6350	291	5	also	also	ADV
aiol-6350	291	6	during	during	ADP
aiol-6350	291	7	previous	previous	ADJ
aiol-6350	291	8	short	short	ADJ
aiol-6350	291	9	-	-	PUNCT
aiol-6350	291	10	term	term	NOUN
aiol-6350	291	11	studies	study	NOUN
aiol-6350	291	12	(	(	PUNCT
aiol-6350	291	13	papadimitriou	papadimitriou	VERB
aiol-6350	291	14	et	et	PROPN
aiol-6350	291	15	al	al	PROPN
aiol-6350	291	16	.	.	PROPN
aiol-6350	291	17	,	,	PUNCT
aiol-6350	291	18	2013	2013	NUM
aiol-6350	291	19	;	;	PUNCT
aiol-6350	291	20	gkelis	gkelis	PROPN
aiol-6350	291	21	and	and	CCONJ
aiol-6350	291	22	zaoutsos	zaoutsos	NOUN
aiol-6350	291	23	,	,	PUNCT
aiol-6350	291	24	2014	2014	NUM
aiol-6350	291	25	)	)	PUNCT
aiol-6350	291	26	.	.	PUNCT
aiol-6350	292	1	microcystis	microcystis	PROPN
aiol-6350	292	2	species	specie	NOUN
aiol-6350	292	3	,	,	PUNCT
aiol-6350	292	4	usually	usually	ADV
aiol-6350	292	5	forming	form	VERB
aiol-6350	292	6	blooms	bloom	NOUN
aiol-6350	292	7	in	in	ADP
aiol-6350	292	8	freshwater	freshwater	NOUN
aiol-6350	292	9	of	of	ADP
aiol-6350	292	10	greece	greece	PROPN
aiol-6350	292	11	(	(	PUNCT
aiol-6350	292	12	gkelis	gkelis	PROPN
aiol-6350	292	13	et	et	PROPN
aiol-6350	292	14	al	al	PROPN
aiol-6350	292	15	.	.	PROPN
aiol-6350	292	16	,	,	PUNCT
aiol-6350	292	17	2005	2005	NUM
aiol-6350	292	18	,	,	PUNCT
aiol-6350	292	19	2014	2014	NUM
aiol-6350	292	20	,	,	PUNCT
aiol-6350	292	21	2015	2015	NUM
aiol-6350	292	22	)	)	PUNCT
aiol-6350	292	23	,	,	PUNCT
aiol-6350	292	24	also	also	ADV
aiol-6350	292	25	present	present	ADJ
aiol-6350	292	26	in	in	ADP
aiol-6350	292	27	lake	lake	PROPN
aiol-6350	292	28	karla	karla	PROPN
aiol-6350	292	29	’s	’s	PART
aiol-6350	292	30	phytoplankton	phytoplankton	NOUN
aiol-6350	292	31	,	,	PUNCT
aiol-6350	292	32	never	never	ADV
aiol-6350	292	33	dominated	dominate	VERB
aiol-6350	292	34	a	a	DET
aiol-6350	292	35	bloom	bloom	NOUN
aiol-6350	292	36	during	during	ADP
aiol-6350	292	37	the	the	DET
aiol-6350	292	38	monitoring	monitoring	NOUN
aiol-6350	292	39	period	period	NOUN
aiol-6350	292	40	,	,	PUNCT
aiol-6350	292	41	although	although	SCONJ
aiol-6350	292	42	such	such	ADJ
aiol-6350	292	43	blooms	bloom	NOUN
aiol-6350	292	44	have	have	AUX
aiol-6350	292	45	been	be	AUX
aiol-6350	292	46	reported	report	VERB
aiol-6350	292	47	previously	previously	ADV
aiol-6350	292	48	(	(	PUNCT
aiol-6350	292	49	gkelis	gkelis	PROPN
aiol-6350	292	50	and	and	CCONJ
aiol-6350	292	51	zaoutsos	zaoutsos	NOUN
aiol-6350	292	52	,	,	PUNCT
aiol-6350	292	53	2014	2014	NUM
aiol-6350	292	54	)	)	PUNCT
aiol-6350	292	55	.	.	PUNCT
aiol-6350	293	1	the	the	DET
aiol-6350	293	2	high	high	ADJ
aiol-6350	293	3	salinity	salinity	NOUN
aiol-6350	293	4	in	in	ADP
aiol-6350	293	5	lake	lake	PROPN
aiol-6350	293	6	karla	karla	PROPN
aiol-6350	293	7	could	could	AUX
aiol-6350	293	8	also	also	ADV
aiol-6350	293	9	have	have	AUX
aiol-6350	293	10	affected	affect	VERB
aiol-6350	293	11	microcystis	microcystis	NOUN
aiol-6350	293	12	and/or	and/or	CCONJ
aiol-6350	293	13	other	other	ADJ
aiol-6350	293	14	species	specie	NOUN
aiol-6350	293	15	as	as	SCONJ
aiol-6350	293	16	it	it	PRON
aiol-6350	293	17	is	be	AUX
aiol-6350	293	18	known	know	VERB
aiol-6350	293	19	that	that	PRON
aiol-6350	293	20	has	have	VERB
aiol-6350	293	21	a	a	DET
aiol-6350	293	22	negative	negative	ADJ
aiol-6350	293	23	impact	impact	NOUN
aiol-6350	293	24	on	on	ADP
aiol-6350	293	25	the	the	DET
aiol-6350	293	26	diversity	diversity	NOUN
aiol-6350	293	27	of	of	ADP
aiol-6350	293	28	different	different	ADJ
aiol-6350	293	29	biota	biota	NOUN
aiol-6350	293	30	(	(	PUNCT
aiol-6350	293	31	padisák	padisák	NOUN
aiol-6350	293	32	et	et	PROPN
aiol-6350	293	33	al	al	PROPN
aiol-6350	293	34	.	.	PROPN
aiol-6350	293	35	,	,	PUNCT
aiol-6350	293	36	2006	2006	NUM
aiol-6350	293	37	)	)	PUNCT
aiol-6350	293	38	.	.	PUNCT
aiol-6350	294	1	since	since	SCONJ
aiol-6350	294	2	microcystis	microcystis	PROPN
aiol-6350	294	3	species	specie	NOUN
aiol-6350	294	4	are	be	AUX
aiol-6350	294	5	favoured	favour	VERB
aiol-6350	294	6	by	by	ADP
aiol-6350	294	7	high	high	ADJ
aiol-6350	294	8	irradiance	irradiance	NOUN
aiol-6350	294	9	,	,	PUNCT
aiol-6350	294	10	high	high	ADJ
aiol-6350	294	11	temperatures	temperature	NOUN
aiol-6350	294	12	,	,	PUNCT
aiol-6350	294	13	and	and	CCONJ
aiol-6350	294	14	they	they	PRON
aiol-6350	294	15	are	be	AUX
aiol-6350	294	16	tolerant	tolerant	ADJ
aiol-6350	294	17	to	to	ADP
aiol-6350	294	18	dark	dark	ADJ
aiol-6350	294	19	anoxic	anoxic	ADJ
aiol-6350	294	20	conditions	condition	NOUN
aiol-6350	294	21	(	(	PUNCT
aiol-6350	294	22	šejnohová	šejnohová	X
aiol-6350	294	23	and	and	CCONJ
aiol-6350	294	24	maršálek	maršálek	NOUN
aiol-6350	294	25	,	,	PUNCT
aiol-6350	294	26	2012	2012	NUM
aiol-6350	294	27	)	)	PUNCT
aiol-6350	294	28	,	,	PUNCT
aiol-6350	294	29	being	be	AUX
aiol-6350	294	30	sensitive	sensitive	ADJ
aiol-6350	294	31	only	only	ADV
aiol-6350	294	32	to	to	ADP
aiol-6350	294	33	flushing	flush	VERB
aiol-6350	294	34	(	(	PUNCT
aiol-6350	294	35	reynolds	reynolds	PROPN
aiol-6350	294	36	et	et	PROPN
aiol-6350	294	37	al	al	PROPN
aiol-6350	294	38	.	.	PROPN
aiol-6350	294	39	,	,	PUNCT
aiol-6350	294	40	2002	2002	NUM
aiol-6350	294	41	)	)	PUNCT
aiol-6350	294	42	or	or	CCONJ
aiol-6350	294	43	mixing	mix	VERB
aiol-6350	294	44	(	(	PUNCT
aiol-6350	294	45	visser	visser	PROPN
aiol-6350	294	46	et	et	PROPN
aiol-6350	294	47	al	al	PROPN
aiol-6350	294	48	.	.	PROPN
aiol-6350	294	49	,	,	PUNCT
aiol-6350	294	50	2016	2016	NUM
aiol-6350	294	51	)	)	PUNCT
aiol-6350	294	52	,	,	PUNCT
aiol-6350	294	53	it	it	PRON
aiol-6350	294	54	possible	possible	ADJ
aiol-6350	294	55	that	that	SCONJ
aiol-6350	294	56	microcystis	microcystis	NOUN
aiol-6350	294	57	-	-	PUNCT
aiol-6350	294	58	dominated	dominate	VERB
aiol-6350	294	59	blooms	bloom	NOUN
aiol-6350	294	60	will	will	AUX
aiol-6350	294	61	occur	occur	VERB
aiol-6350	294	62	in	in	ADP
aiol-6350	294	63	the	the	DET
aiol-6350	294	64	future	future	NOUN
aiol-6350	294	65	in	in	ADP
aiol-6350	294	66	lake	lake	PROPN
aiol-6350	294	67	karla	karla	PROPN
aiol-6350	294	68	.	.	PUNCT
aiol-6350	295	1	apart	apart	ADV
aiol-6350	295	2	from	from	ADP
aiol-6350	295	3	phytoplankton	phytoplankton	NOUN
aiol-6350	295	4	,	,	PUNCT
aiol-6350	295	5	only	only	ADV
aiol-6350	295	6	four	four	NUM
aiol-6350	295	7	and	and	CCONJ
aiol-6350	295	8	three	three	NUM
aiol-6350	295	9	benthic	benthic	ADJ
aiol-6350	295	10	macroinvertebrate	macroinvertebrate	NOUN
aiol-6350	295	11	taxa	taxa	NOUN
aiol-6350	295	12	were	be	AUX
aiol-6350	295	13	recorded	record	VERB
aiol-6350	295	14	in	in	ADP
aiol-6350	295	15	lake	lake	PROPN
aiol-6350	295	16	karla	karla	PROPN
aiol-6350	295	17	and	and	CCONJ
aiol-6350	295	18	in	in	ADP
aiol-6350	295	19	kalamaki	kalamaki	PROPN
aiol-6350	295	20	reservoir	reservoir	PROPN
aiol-6350	295	21	,	,	PUNCT
aiol-6350	295	22	respectively	respectively	ADV
aiol-6350	295	23	,	,	PUNCT
aiol-6350	295	24	compared	compare	VERB
aiol-6350	295	25	to	to	ADP
aiol-6350	295	26	the	the	DET
aiol-6350	295	27	12	12	NUM
aiol-6350	295	28	taxa	taxa	NOUN
aiol-6350	295	29	which	which	PRON
aiol-6350	295	30	had	have	AUX
aiol-6350	295	31	been	be	AUX
aiol-6350	295	32	recorded	record	VERB
aiol-6350	295	33	in	in	ADP
aiol-6350	295	34	the	the	DET
aiol-6350	295	35	-	-	PUNCT
aiol-6350	295	36	sole	sole	ADJ
aiol-6350	295	37	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	295	38	’	'	PUNCT
aiol-6350	295	39	study	study	NOUN
aiol-6350	295	40	existingby	existingby	ADP
aiol-6350	295	41	ananiadis	ananiadi	NOUN
aiol-6350	295	42	(	(	PUNCT
aiol-6350	295	43	1956	1956	NUM
aiol-6350	295	44	)	)	PUNCT
aiol-6350	295	45	,	,	PUNCT
aiol-6350	295	46	showing	show	VERB
aiol-6350	295	47	a	a	DET
aiol-6350	295	48	serious	serious	ADJ
aiol-6350	295	49	deterioration	deterioration	NOUN
aiol-6350	295	50	of	of	ADP
aiol-6350	295	51	the	the	DET
aiol-6350	295	52	water	water	NOUN
aiol-6350	295	53	quality	quality	NOUN
aiol-6350	295	54	.	.	PUNCT
aiol-6350	296	1	a	a	DET
aiol-6350	296	2	comparison	comparison	NOUN
aiol-6350	296	3	of	of	ADP
aiol-6350	296	4	the	the	DET
aiol-6350	296	5	benthic	benthic	ADJ
aiol-6350	296	6	fig	fig	NOUN
aiol-6350	296	7	.	.	PUNCT
aiol-6350	297	1	6	6	NUM
aiol-6350	297	2	.	.	X
aiol-6350	297	3	biomass	biomass	NOUN
aiol-6350	297	4	of	of	ADP
aiol-6350	297	5	each	each	DET
aiol-6350	297	6	phytoplankton	phytoplankton	NOUN
aiol-6350	297	7	taxon	taxon	ADJ
aiol-6350	297	8	per	per	ADP
aiol-6350	297	9	sampling	sample	VERB
aiol-6350	297	10	period	period	NOUN
aiol-6350	297	11	in	in	ADP
aiol-6350	297	12	water	water	NOUN
aiol-6350	297	13	samples	sample	NOUN
aiol-6350	297	14	collected	collect	VERB
aiol-6350	297	15	from	from	ADP
aiol-6350	297	16	lake	lake	PROPN
aiol-6350	297	17	karla	karla	PROPN
aiol-6350	297	18	and	and	CCONJ
aiol-6350	297	19	kalamaki	kalamaki	PROPN
aiol-6350	297	20	reservoir	reservoir	PROPN
aiol-6350	297	21	between	between	ADP
aiol-6350	297	22	july	july	PROPN
aiol-6350	297	23	2013	2013	NUM
aiol-6350	297	24	and	and	CCONJ
aiol-6350	297	25	july	july	PROPN
aiol-6350	297	26	2015	2015	NUM
aiol-6350	297	27	.	.	PUNCT
aiol-6350	298	1	only	only	ADV
aiol-6350	298	2	taxa	taxa	NOUN
aiol-6350	298	3	contributing	contribute	VERB
aiol-6350	298	4	>	>	X
aiol-6350	298	5	2	2	NUM
aiol-6350	298	6	%	%	NOUN
aiol-6350	298	7	to	to	ADP
aiol-6350	298	8	the	the	DET
aiol-6350	298	9	total	total	ADJ
aiol-6350	298	10	biomass	biomass	NOUN
aiol-6350	298	11	are	be	AUX
aiol-6350	298	12	shown	show	VERB
aiol-6350	298	13	.	.	PUNCT
aiol-6350	299	1	s.	s.	PROPN
aiol-6350	299	2	gkelis	gkelis	PROPN
aiol-6350	299	3	et	et	PROPN
aiol-6350	299	4	al.46	al.46	PROPN
aiol-6350	299	5	macroinvertebrate	macroinvertebrate	VERB
aiol-6350	299	6	diversity	diversity	NOUN
aiol-6350	299	7	with	with	ADP
aiol-6350	299	8	lake	lake	NOUN
aiol-6350	299	9	paralimni	paralimni	NOUN
aiol-6350	299	10	,	,	PUNCT
aiol-6350	299	11	another	another	DET
aiol-6350	299	12	shallow	shallow	ADJ
aiol-6350	299	13	lake	lake	NOUN
aiol-6350	299	14	that	that	PRON
aiol-6350	299	15	dried	dry	VERB
aiol-6350	299	16	up	up	ADP
aiol-6350	299	17	several	several	ADJ
aiol-6350	299	18	times	time	NOUN
aiol-6350	299	19	because	because	SCONJ
aiol-6350	299	20	of	of	ADP
aiol-6350	299	21	the	the	DET
aiol-6350	299	22	drought	drought	NOUN
aiol-6350	299	23	(	(	PUNCT
aiol-6350	299	24	lakes	lake	NOUN
aiol-6350	299	25	network	network	NOUN
aiol-6350	299	26	,	,	PUNCT
aiol-6350	299	27	2016	2016	NUM
aiol-6350	299	28	)	)	PUNCT
aiol-6350	299	29	,	,	PUNCT
aiol-6350	299	30	using	use	VERB
aiol-6350	299	31	the	the	DET
aiol-6350	299	32	shannonwiener	shannonwiener	ADJ
aiol-6350	299	33	index	index	NOUN
aiol-6350	299	34	(	(	PUNCT
aiol-6350	299	35	shw	shw	PROPN
aiol-6350	299	36	)	)	PUNCT
aiol-6350	299	37	showed	show	VERB
aiol-6350	299	38	that	that	SCONJ
aiol-6350	299	39	lake	lake	NOUN
aiol-6350	299	40	paralimni	paralimni	NOUN
aiol-6350	299	41	(	(	PUNCT
aiol-6350	299	42	shw	shw	PROPN
aiol-6350	299	43	=	=	SYM
aiol-6350	299	44	1.59	1.59	NUM
aiol-6350	299	45	)	)	PUNCT
aiol-6350	299	46	has	have	VERB
aiol-6350	299	47	higher	high	ADJ
aiol-6350	299	48	biodiversity	biodiversity	NOUN
aiol-6350	299	49	than	than	ADP
aiol-6350	299	50	lake	lake	PROPN
aiol-6350	299	51	karla	karla	PROPN
aiol-6350	299	52	(	(	PUNCT
aiol-6350	299	53	shw	shw	PROPN
aiol-6350	299	54	=	=	NOUN
aiol-6350	299	55	0.73	0.73	NUM
aiol-6350	299	56	)	)	PUNCT
aiol-6350	299	57	and	and	CCONJ
aiol-6350	299	58	kalamaki	kalamaki	PROPN
aiol-6350	299	59	reservoir	reservoir	PROPN
aiol-6350	299	60	(	(	PUNCT
aiol-6350	299	61	shw	shw	PROPN
aiol-6350	299	62	=	=	SYM
aiol-6350	299	63	1.25	1.25	NUM
aiol-6350	299	64	)	)	PUNCT
aiol-6350	299	65	(	(	PUNCT
aiol-6350	299	66	ntislidou	ntislidou	NOUN
aiol-6350	299	67	,	,	PUNCT
aiol-6350	299	68	unpuplished	unpuplished	ADJ
aiol-6350	299	69	data	datum	NOUN
aiol-6350	299	70	)	)	PUNCT
aiol-6350	299	71	.	.	PUNCT
aiol-6350	300	1	concerning	concern	VERB
aiol-6350	300	2	the	the	DET
aiol-6350	300	3	cyanotoxin	cyanotoxin	NOUN
aiol-6350	300	4	production	production	NOUN
aiol-6350	300	5	,	,	PUNCT
aiol-6350	300	6	the	the	DET
aiol-6350	300	7	main	main	ADJ
aiol-6350	300	8	finding	finding	NOUN
aiol-6350	300	9	of	of	ADP
aiol-6350	300	10	our	our	PRON
aiol-6350	300	11	study	study	NOUN
aiol-6350	300	12	was	be	AUX
aiol-6350	300	13	the	the	DET
aiol-6350	300	14	occurrence	occurrence	NOUN
aiol-6350	300	15	of	of	ADP
aiol-6350	300	16	multiple	multiple	ADJ
aiol-6350	300	17	cyanotoxins	cyanotoxin	NOUN
aiol-6350	300	18	in	in	ADP
aiol-6350	300	19	several	several	ADJ
aiol-6350	300	20	samples	sample	NOUN
aiol-6350	300	21	of	of	ADP
aiol-6350	300	22	lake	lake	NOUN
aiol-6350	300	23	karla	karla	PROPN
aiol-6350	300	24	and	and	CCONJ
aiol-6350	300	25	kalamaki	kalamaki	PROPN
aiol-6350	300	26	reservoir	reservoir	PROPN
aiol-6350	300	27	.	.	PUNCT
aiol-6350	301	1	it	it	PRON
aiol-6350	301	2	is	be	AUX
aiol-6350	301	3	known	know	VERB
aiol-6350	301	4	that	that	SCONJ
aiol-6350	301	5	multiple	multiple	ADJ
aiol-6350	301	6	types	type	NOUN
aiol-6350	301	7	of	of	ADP
aiol-6350	301	8	cyanotoxins	cyanotoxin	NOUN
aiol-6350	301	9	can	can	AUX
aiol-6350	301	10	be	be	AUX
aiol-6350	301	11	produced	produce	VERB
aiol-6350	301	12	by	by	ADP
aiol-6350	301	13	individual	individual	ADJ
aiol-6350	301	14	cyanobacterial	cyanobacterial	ADJ
aiol-6350	301	15	strains	strain	NOUN
aiol-6350	301	16	and	and	CCONJ
aiol-6350	301	17	can	can	AUX
aiol-6350	301	18	co	co	VERB
aiol-6350	301	19	-	-	VERB
aiol-6350	301	20	occur	occur	VERB
aiol-6350	301	21	in	in	ADP
aiol-6350	301	22	environmental	environmental	ADJ
aiol-6350	301	23	populations	population	NOUN
aiol-6350	301	24	,	,	PUNCT
aiol-6350	301	25	e.g.	e.g.	ADV
aiol-6350	301	26	mcs	mcs	PROPN
aiol-6350	301	27	plus	plus	PROPN
aiol-6350	301	28	atx	atx	PROPN
aiol-6350	301	29	-	-	PUNCT
aiol-6350	301	30	a	a	NOUN
aiol-6350	301	31	,	,	PUNCT
aiol-6350	301	32	mcs	mcs	PROPN
aiol-6350	301	33	plus	plus	CCONJ
aiol-6350	301	34	atx	atx	PROPN
aiol-6350	301	35	-	-	PUNCT
aiol-6350	301	36	a(s	a(s	PROPN
aiol-6350	301	37	)	)	PUNCT
aiol-6350	301	38	,	,	PUNCT
aiol-6350	301	39	and	and	CCONJ
aiol-6350	301	40	nodularin	nodularin	NOUN
aiol-6350	301	41	plus	plus	CCONJ
aiol-6350	301	42	mcs	mcs	PROPN
aiol-6350	301	43	(	(	PUNCT
aiol-6350	301	44	see	see	VERB
aiol-6350	301	45	codd	codd	NOUN
aiol-6350	301	46	et	et	PROPN
aiol-6350	301	47	al	al	PROPN
aiol-6350	301	48	.	.	PROPN
aiol-6350	301	49	,	,	PUNCT
aiol-6350	301	50	2005	2005	NUM
aiol-6350	301	51	)	)	PUNCT
aiol-6350	301	52	.	.	PUNCT
aiol-6350	302	1	co	co	NOUN
aiol-6350	302	2	-	-	NOUN
aiol-6350	302	3	occurrence	occurrence	NOUN
aiol-6350	302	4	of	of	ADP
aiol-6350	302	5	mcs	mcs	PROPN
aiol-6350	302	6	and	and	CCONJ
aiol-6350	302	7	cyns	cyns	PROPN
aiol-6350	302	8	has	have	AUX
aiol-6350	302	9	been	be	AUX
aiol-6350	302	10	found	find	VERB
aiol-6350	302	11	in	in	ADP
aiol-6350	302	12	france	france	PROPN
aiol-6350	302	13	(	(	PUNCT
aiol-6350	302	14	brient	brient	PROPN
aiol-6350	302	15	et	et	PROPN
aiol-6350	302	16	al	al	PROPN
aiol-6350	302	17	.	.	PROPN
aiol-6350	302	18	,	,	PUNCT
aiol-6350	302	19	2009	2009	NUM
aiol-6350	302	20	)	)	PUNCT
aiol-6350	302	21	whereas	whereas	SCONJ
aiol-6350	302	22	co	co	NOUN
aiol-6350	302	23	-	-	NOUN
aiol-6350	302	24	occurrence	occurrence	NOUN
aiol-6350	302	25	of	of	ADP
aiol-6350	302	26	mcs	mcs	PROPN
aiol-6350	302	27	and	and	CCONJ
aiol-6350	302	28	stxs	stxs	NOUN
aiol-6350	302	29	in	in	ADP
aiol-6350	302	30	brazil	brazil	PROPN
aiol-6350	302	31	(	(	PUNCT
aiol-6350	302	32	costa	costa	PROPN
aiol-6350	302	33	et	et	PROPN
aiol-6350	302	34	al	al	PROPN
aiol-6350	302	35	.	.	PROPN
aiol-6350	302	36	,	,	PUNCT
aiol-6350	302	37	2006	2006	NUM
aiol-6350	302	38	)	)	PUNCT
aiol-6350	302	39	.	.	PUNCT
aiol-6350	303	1	in	in	ADP
aiol-6350	303	2	lake	lake	PROPN
aiol-6350	303	3	karla	karla	PROPN
aiol-6350	303	4	,	,	PUNCT
aiol-6350	303	5	however	however	ADV
aiol-6350	303	6	,	,	PUNCT
aiol-6350	303	7	we	we	PRON
aiol-6350	303	8	found	find	VERB
aiol-6350	303	9	that	that	SCONJ
aiol-6350	303	10	mcs	mcs	PROPN
aiol-6350	303	11	,	,	PUNCT
aiol-6350	303	12	stx	stx	NOUN
aiol-6350	303	13	,	,	PUNCT
aiol-6350	303	14	neostx	neostx	ADJ
aiol-6350	303	15	,	,	PUNCT
aiol-6350	303	16	and	and	CCONJ
aiol-6350	303	17	atx	atx	NOUN
aiol-6350	303	18	-	-	PUNCT
aiol-6350	303	19	a	a	PRON
aiol-6350	303	20	can	can	AUX
aiol-6350	303	21	co	co	VERB
aiol-6350	303	22	-	-	VERB
aiol-6350	303	23	occur	occur	ADJ
aiol-6350	303	24	,	,	PUNCT
aiol-6350	303	25	and	and	CCONJ
aiol-6350	303	26	to	to	ADP
aiol-6350	303	27	the	the	DET
aiol-6350	303	28	best	good	ADJ
aiol-6350	303	29	of	of	ADP
aiol-6350	303	30	our	our	PRON
aiol-6350	303	31	knowledge	knowledge	NOUN
aiol-6350	303	32	,	,	PUNCT
aiol-6350	303	33	this	this	PRON
aiol-6350	303	34	has	have	AUX
aiol-6350	303	35	been	be	AUX
aiol-6350	303	36	reported	report	VERB
aiol-6350	303	37	only	only	ADV
aiol-6350	303	38	once	once	ADV
aiol-6350	303	39	in	in	ADP
aiol-6350	303	40	freshwaters	freshwater	NOUN
aiol-6350	303	41	from	from	ADP
aiol-6350	303	42	the	the	DET
aiol-6350	303	43	midwestern	midwestern	ADJ
aiol-6350	303	44	united	united	PROPN
aiol-6350	303	45	states	states	PROPN
aiol-6350	303	46	(	(	PUNCT
aiol-6350	303	47	graham	graham	PROPN
aiol-6350	303	48	et	et	PROPN
aiol-6350	303	49	al	al	PROPN
aiol-6350	303	50	.	.	PROPN
aiol-6350	303	51	,	,	PUNCT
aiol-6350	303	52	2010	2010	NUM
aiol-6350	303	53	)	)	PUNCT
aiol-6350	303	54	.	.	PUNCT
aiol-6350	304	1	the	the	DET
aiol-6350	304	2	cyn	cyn	PROPN
aiol-6350	304	3	concentrations	concentration	NOUN
aiol-6350	304	4	we	we	PRON
aiol-6350	304	5	found	find	VERB
aiol-6350	304	6	here	here	ADV
aiol-6350	304	7	are	be	AUX
aiol-6350	304	8	within	within	ADP
aiol-6350	304	9	the	the	DET
aiol-6350	304	10	fig	fig	NOUN
aiol-6350	304	11	.	.	PUNCT
aiol-6350	305	1	7	7	X
aiol-6350	305	2	.	.	X
aiol-6350	305	3	cyanotoxin	cyanotoxin	NOUN
aiol-6350	305	4	concentrations	concentration	NOUN
aiol-6350	305	5	detected	detect	VERB
aiol-6350	305	6	by	by	ADP
aiol-6350	305	7	elisa	elisa	NOUN
aiol-6350	305	8	in	in	ADP
aiol-6350	305	9	water	water	NOUN
aiol-6350	305	10	samples	sample	NOUN
aiol-6350	305	11	collected	collect	VERB
aiol-6350	305	12	from	from	ADP
aiol-6350	305	13	lake	lake	PROPN
aiol-6350	305	14	karla	karla	PROPN
aiol-6350	305	15	and	and	CCONJ
aiol-6350	305	16	kalamaki	kalamaki	PROPN
aiol-6350	305	17	reservoir	reservoir	PROPN
aiol-6350	305	18	between	between	ADP
aiol-6350	305	19	july	july	PROPN
aiol-6350	305	20	2013	2013	NUM
aiol-6350	305	21	and	and	CCONJ
aiol-6350	305	22	july	july	PROPN
aiol-6350	305	23	2015	2015	NUM
aiol-6350	305	24	.	.	PUNCT
aiol-6350	306	1	a	a	PRON
aiol-6350	306	2	)	)	PUNCT
aiol-6350	306	3	intracellular	intracellular	ADJ
aiol-6350	306	4	mcs	mcs	NOUN
aiol-6350	306	5	;	;	PUNCT
aiol-6350	306	6	b	b	X
aiol-6350	306	7	)	)	PUNCT
aiol-6350	306	8	extracellular	extracellular	ADJ
aiol-6350	306	9	mcs	mcs	NOUN
aiol-6350	306	10	;	;	PUNCT
aiol-6350	306	11	c	c	X
aiol-6350	306	12	)	)	PUNCT
aiol-6350	306	13	cyn	cyn	NOUN
aiol-6350	306	14	;	;	PUNCT
aiol-6350	306	15	d	d	X
aiol-6350	306	16	)	)	PUNCT
aiol-6350	306	17	stx	stx	NOUN
aiol-6350	306	18	.	.	PUNCT
aiol-6350	306	19	water	water	NOUN
aiol-6350	306	20	quality	quality	NOUN
aiol-6350	306	21	and	and	CCONJ
aiol-6350	306	22	cyanotoxins	cyanotoxin	NOUN
aiol-6350	306	23	in	in	ADP
aiol-6350	306	24	the	the	DET
aiol-6350	306	25	reconstructed	reconstructed	ADJ
aiol-6350	306	26	lake	lake	NOUN
aiol-6350	306	27	karla	karla	PROPN
aiol-6350	306	28	47	47	NUM
aiol-6350	306	29	range	range	NOUN
aiol-6350	306	30	obtained	obtain	VERB
aiol-6350	306	31	in	in	ADP
aiol-6350	306	32	previous	previous	ADJ
aiol-6350	306	33	studies	study	NOUN
aiol-6350	306	34	(	(	PUNCT
aiol-6350	306	35	brient	brient	PROPN
aiol-6350	306	36	et	et	PROPN
aiol-6350	306	37	al	al	PROPN
aiol-6350	306	38	.	.	PROPN
aiol-6350	306	39	,	,	PUNCT
aiol-6350	306	40	2009	2009	NUM
aiol-6350	306	41	;	;	PUNCT
aiol-6350	306	42	kokociński	kokociński	NOUN
aiol-6350	306	43	et	et	PROPN
aiol-6350	306	44	al	al	PROPN
aiol-6350	306	45	.	.	PROPN
aiol-6350	306	46	,	,	PUNCT
aiol-6350	306	47	2009	2009	NUM
aiol-6350	306	48	;	;	PUNCT
aiol-6350	306	49	berry	berry	NOUN
aiol-6350	306	50	and	and	CCONJ
aiol-6350	306	51	lind	lind	PROPN
aiol-6350	306	52	,	,	PUNCT
aiol-6350	306	53	2010	2010	NUM
aiol-6350	306	54	)	)	PUNCT
aiol-6350	306	55	,	,	PUNCT
aiol-6350	306	56	although	although	SCONJ
aiol-6350	306	57	a	a	DET
aiol-6350	306	58	value	value	NOUN
aiol-6350	306	59	similar	similar	ADJ
aiol-6350	306	60	to	to	ADP
aiol-6350	306	61	the	the	DET
aiol-6350	306	62	maximum	maximum	ADJ
aiol-6350	306	63	concentration	concentration	NOUN
aiol-6350	306	64	detected	detect	VERB
aiol-6350	306	65	in	in	ADP
aiol-6350	306	66	lake	lake	PROPN
aiol-6350	306	67	karla	karla	PROPN
aiol-6350	306	68	has	have	AUX
aiol-6350	306	69	only	only	ADV
aiol-6350	306	70	been	be	AUX
aiol-6350	306	71	reported	report	VERB
aiol-6350	306	72	in	in	ADP
aiol-6350	306	73	germany	germany	PROPN
aiol-6350	306	74	(	(	PUNCT
aiol-6350	306	75	rücker	rücker	PROPN
aiol-6350	306	76	et	et	PROPN
aiol-6350	306	77	al	al	PROPN
aiol-6350	306	78	.	.	PROPN
aiol-6350	306	79	,	,	PUNCT
aiol-6350	306	80	2007	2007	NUM
aiol-6350	306	81	)	)	PUNCT
aiol-6350	306	82	as	as	ADP
aiol-6350	306	83	dissolved	dissolve	VERB
aiol-6350	306	84	cyn	cyn	NOUN
aiol-6350	306	85	.	.	PUNCT
aiol-6350	307	1	studies	study	NOUN
aiol-6350	307	2	suggest	suggest	VERB
aiol-6350	307	3	that	that	SCONJ
aiol-6350	307	4	cyn	cyn	PROPN
aiol-6350	307	5	is	be	AUX
aiol-6350	307	6	dominantly	dominantly	ADV
aiol-6350	307	7	extracellular	extracellular	ADJ
aiol-6350	307	8	(	(	PUNCT
aiol-6350	307	9	bormans	borman	NOUN
aiol-6350	307	10	et	et	PROPN
aiol-6350	307	11	al	al	PROPN
aiol-6350	307	12	.	.	PROPN
aiol-6350	307	13	,	,	PUNCT
aiol-6350	307	14	2014	2014	NUM
aiol-6350	307	15	)	)	PUNCT
aiol-6350	307	16	therefore	therefore	ADV
aiol-6350	307	17	the	the	DET
aiol-6350	307	18	intracelullar	intracelullar	ADJ
aiol-6350	307	19	concentrations	concentration	NOUN
aiol-6350	307	20	found	find	VERB
aiol-6350	307	21	here	here	ADV
aiol-6350	307	22	may	may	AUX
aiol-6350	307	23	be	be	AUX
aiol-6350	307	24	an	an	DET
aiol-6350	307	25	underestimation	underestimation	NOUN
aiol-6350	307	26	of	of	ADP
aiol-6350	307	27	the	the	DET
aiol-6350	307	28	total	total	ADJ
aiol-6350	307	29	cyn	cyn	NOUN
aiol-6350	307	30	present	present	NOUN
aiol-6350	307	31	in	in	ADP
aiol-6350	307	32	the	the	DET
aiol-6350	307	33	lakes	lake	NOUN
aiol-6350	307	34	.	.	PUNCT
aiol-6350	308	1	stxs	stxs	PROPN
aiol-6350	308	2	,	,	PUNCT
aiol-6350	308	3	generally	generally	ADV
aiol-6350	308	4	reported	report	VERB
aiol-6350	308	5	to	to	PART
aiol-6350	308	6	occur	occur	VERB
aiol-6350	308	7	more	more	ADV
aiol-6350	308	8	rarely	rarely	ADV
aiol-6350	308	9	in	in	ADP
aiol-6350	308	10	freshwaters	freshwater	NOUN
aiol-6350	308	11	,	,	PUNCT
aiol-6350	308	12	have	have	AUX
aiol-6350	308	13	been	be	AUX
aiol-6350	308	14	found	find	VERB
aiol-6350	308	15	in	in	ADP
aiol-6350	308	16	several	several	ADJ
aiol-6350	308	17	countries	country	NOUN
aiol-6350	308	18	(	(	PUNCT
aiol-6350	308	19	testai	testai	PROPN
aiol-6350	308	20	et	et	PROPN
aiol-6350	308	21	al	al	PROPN
aiol-6350	308	22	.	.	PROPN
aiol-6350	308	23	,	,	PUNCT
aiol-6350	308	24	2016	2016	NUM
aiol-6350	308	25	)	)	PUNCT
aiol-6350	308	26	.	.	PUNCT
aiol-6350	309	1	stx	stx	PROPN
aiol-6350	309	2	concentrations	concentration	NOUN
aiol-6350	309	3	in	in	ADP
aiol-6350	309	4	lake	lake	PROPN
aiol-6350	309	5	karla	karla	PROPN
aiol-6350	309	6	are	be	AUX
aiol-6350	309	7	similar	similar	ADJ
aiol-6350	309	8	to	to	ADP
aiol-6350	309	9	those	those	PRON
aiol-6350	309	10	reported	report	VERB
aiol-6350	309	11	by	by	ADP
aiol-6350	309	12	clemente	clemente	PROPN
aiol-6350	309	13	et	et	PROPN
aiol-6350	309	14	al	al	PROPN
aiol-6350	309	15	.	.	PROPN
aiol-6350	310	1	(	(	PUNCT
aiol-6350	310	2	2010	2010	NUM
aiol-6350	310	3	)	)	PUNCT
aiol-6350	310	4	and	and	CCONJ
aiol-6350	310	5	previously	previously	ADV
aiol-6350	310	6	found	find	VERB
aiol-6350	310	7	in	in	ADP
aiol-6350	310	8	the	the	DET
aiol-6350	310	9	lake	lake	NOUN
aiol-6350	310	10	(	(	PUNCT
aiol-6350	310	11	gkelis	gkelis	PROPN
aiol-6350	310	12	and	and	CCONJ
aiol-6350	310	13	zaoutsos	zaoutsos	NOUN
aiol-6350	310	14	,	,	PUNCT
aiol-6350	310	15	2014	2014	NUM
aiol-6350	310	16	)	)	PUNCT
aiol-6350	310	17	,	,	PUNCT
aiol-6350	310	18	however	however	ADV
aiol-6350	310	19	the	the	DET
aiol-6350	310	20	neostx/	neostx/	NUM
aiol-6350	310	21	stx	stx	NOUN
aiol-6350	310	22	frequency	frequency	NOUN
aiol-6350	310	23	(	(	PUNCT
aiol-6350	310	24	100	100	NUM
aiol-6350	310	25	%	%	NOUN
aiol-6350	310	26	of	of	ADP
aiol-6350	310	27	the	the	DET
aiol-6350	310	28	samples	sample	NOUN
aiol-6350	310	29	analysed	analyse	VERB
aiol-6350	310	30	by	by	ADP
aiol-6350	310	31	lc	lc	PROPN
aiol-6350	310	32	-	-	PUNCT
aiol-6350	310	33	ms	ms	PROPN
aiol-6350	310	34	/	/	SYM
aiol-6350	310	35	ms	ms	NOUN
aiol-6350	310	36	)	)	PUNCT
aiol-6350	310	37	is	be	AUX
aiol-6350	310	38	one	one	NUM
aiol-6350	310	39	of	of	ADP
aiol-6350	310	40	the	the	DET
aiol-6350	310	41	highest	high	ADJ
aiol-6350	310	42	ever	ever	ADV
aiol-6350	310	43	reported	report	VERB
aiol-6350	310	44	.	.	PUNCT
aiol-6350	311	1	atx	atx	NOUN
aiol-6350	311	2	-	-	PUNCT
aiol-6350	311	3	a	a	DET
aiol-6350	311	4	occurrence	occurrence	NOUN
aiol-6350	311	5	was	be	AUX
aiol-6350	311	6	reported	report	VERB
aiol-6350	311	7	for	for	ADP
aiol-6350	311	8	the	the	DET
aiol-6350	311	9	first	first	ADJ
aiol-6350	311	10	time	time	NOUN
aiol-6350	311	11	in	in	ADP
aiol-6350	311	12	a	a	DET
aiol-6350	311	13	greek	greek	ADJ
aiol-6350	311	14	freshwater	freshwater	NOUN
aiol-6350	311	15	in	in	ADP
aiol-6350	311	16	a	a	DET
aiol-6350	311	17	previous	previous	ADJ
aiol-6350	311	18	study	study	NOUN
aiol-6350	311	19	by	by	ADP
aiol-6350	311	20	dimitrakopoulos	dimitrakopoulos	PROPN
aiol-6350	311	21	et	et	PROPN
aiol-6350	311	22	al	al	PROPN
aiol-6350	311	23	.	.	PROPN
aiol-6350	312	1	(	(	PUNCT
aiol-6350	312	2	2010	2010	NUM
aiol-6350	312	3	)	)	PUNCT
aiol-6350	312	4	although	although	SCONJ
aiol-6350	312	5	it	it	PRON
aiol-6350	312	6	did	do	AUX
aiol-6350	312	7	not	not	PART
aiol-6350	312	8	specifically	specifically	ADV
aiol-6350	312	9	report	report	VERB
aiol-6350	312	10	which	which	PRON
aiol-6350	312	11	freshwaters	freshwater	NOUN
aiol-6350	312	12	were	be	AUX
aiol-6350	312	13	sampled	sample	VERB
aiol-6350	312	14	.	.	PUNCT
aiol-6350	313	1	the	the	DET
aiol-6350	313	2	atx	atx	PROPN
aiol-6350	313	3	-	-	PUNCT
aiol-6350	313	4	a	a	DET
aiol-6350	313	5	concentrations	concentration	NOUN
aiol-6350	313	6	we	we	PRON
aiol-6350	313	7	found	find	VERB
aiol-6350	313	8	here	here	ADV
aiol-6350	313	9	are	be	AUX
aiol-6350	313	10	similar	similar	ADJ
aiol-6350	313	11	to	to	ADP
aiol-6350	313	12	those	those	PRON
aiol-6350	313	13	recently	recently	ADV
aiol-6350	313	14	reported	report	VERB
aiol-6350	313	15	by	by	ADP
aiol-6350	313	16	toporowska	toporowska	PROPN
aiol-6350	313	17	et	et	PROPN
aiol-6350	313	18	al	al	PROPN
aiol-6350	313	19	.	.	PUNCT
aiol-6350	314	1	(	(	PUNCT
aiol-6350	314	2	2016	2016	NUM
aiol-6350	314	3	)	)	PUNCT
aiol-6350	314	4	.	.	PUNCT
aiol-6350	315	1	mc	mc	PROPN
aiol-6350	315	2	concentrations	concentration	NOUN
aiol-6350	315	3	during	during	ADP
aiol-6350	315	4	the	the	DET
aiol-6350	315	5	monitoring	monitoring	NOUN
aiol-6350	315	6	period	period	NOUN
aiol-6350	315	7	were	be	AUX
aiol-6350	315	8	in	in	ADP
aiol-6350	315	9	the	the	DET
aiol-6350	315	10	range	range	NOUN
aiol-6350	315	11	reported	report	VERB
aiol-6350	315	12	previously	previously	ADV
aiol-6350	315	13	(	(	PUNCT
aiol-6350	315	14	papadimitriou	papadimitriou	VERB
aiol-6350	315	15	et	et	PROPN
aiol-6350	315	16	al	al	PROPN
aiol-6350	315	17	.	.	PROPN
aiol-6350	315	18	,	,	PUNCT
aiol-6350	315	19	2013	2013	NUM
aiol-6350	315	20	)	)	PUNCT
aiol-6350	315	21	,	,	PUNCT
aiol-6350	315	22	much	much	ADV
aiol-6350	315	23	lower	low	ADJ
aiol-6350	315	24	than	than	ADP
aiol-6350	315	25	the	the	DET
aiol-6350	315	26	ones	one	NOUN
aiol-6350	315	27	found	find	VERB
aiol-6350	315	28	at	at	ADP
aiol-6350	315	29	off	off	ADP
aiol-6350	315	30	-	-	PUNCT
aiol-6350	315	31	shore	shore	NOUN
aiol-6350	315	32	stations	station	NOUN
aiol-6350	315	33	(	(	PUNCT
aiol-6350	315	34	gkelis	gkelis	NOUN
aiol-6350	315	35	and	and	CCONJ
aiol-6350	315	36	zaoutsos	zaoutsos	NOUN
aiol-6350	315	37	,	,	PUNCT
aiol-6350	315	38	2014	2014	NUM
aiol-6350	315	39	)	)	PUNCT
aiol-6350	315	40	.	.	PUNCT
aiol-6350	316	1	in	in	ADP
aiol-6350	316	2	our	our	PRON
aiol-6350	316	3	study	study	NOUN
aiol-6350	316	4	cyn	cyn	NOUN
aiol-6350	316	5	and	and	CCONJ
aiol-6350	316	6	stx	stx	NOUN
aiol-6350	316	7	was	be	AUX
aiol-6350	316	8	detected	detect	VERB
aiol-6350	316	9	in	in	ADP
aiol-6350	316	10	blooms	bloom	NOUN
aiol-6350	316	11	consisting	consist	VERB
aiol-6350	316	12	of	of	ADP
aiol-6350	316	13	mixed	mixed	ADJ
aiol-6350	316	14	populations	population	NOUN
aiol-6350	316	15	of	of	ADP
aiol-6350	316	16	a.	a.	NOUN
aiol-6350	316	17	elenkinii	elenkinii	PROPN
aiol-6350	316	18	,	,	PUNCT
aiol-6350	316	19	sph	sph	PROPN
aiol-6350	316	20	.	.	PROPN
aiol-6350	316	21	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	316	22	,	,	PUNCT
aiol-6350	316	23	and	and	CCONJ
aiol-6350	316	24	c.	c.	PROPN
aiol-6350	316	25	raciborskii	raciborskii	PROPN
aiol-6350	316	26	,	,	PUNCT
aiol-6350	316	27	in	in	ADP
aiol-6350	316	28	line	line	NOUN
aiol-6350	316	29	with	with	ADP
aiol-6350	316	30	our	our	PRON
aiol-6350	316	31	previous	previous	ADJ
aiol-6350	316	32	findings	finding	NOUN
aiol-6350	316	33	in	in	ADP
aiol-6350	316	34	lake	lake	PROPN
aiol-6350	316	35	karla	karla	PROPN
aiol-6350	316	36	(	(	PUNCT
aiol-6350	316	37	gkelis	gkelis	PROPN
aiol-6350	316	38	and	and	CCONJ
aiol-6350	316	39	zaoutsos	zaoutsos	NOUN
aiol-6350	316	40	,	,	PUNCT
aiol-6350	316	41	2014	2014	NUM
aiol-6350	316	42	)	)	PUNCT
aiol-6350	316	43	.	.	PUNCT
aiol-6350	317	1	recently	recently	ADV
aiol-6350	317	2	it	it	PRON
aiol-6350	317	3	was	be	AUX
aiol-6350	317	4	shown	show	VERB
aiol-6350	317	5	that	that	SCONJ
aiol-6350	317	6	aphanizomenon	aphanizomenon	NOUN
aiol-6350	317	7	seems	seem	VERB
aiol-6350	317	8	to	to	PART
aiol-6350	317	9	be	be	AUX
aiol-6350	317	10	the	the	DET
aiol-6350	317	11	main	main	ADJ
aiol-6350	317	12	cyanobacterial	cyanobacterial	ADJ
aiol-6350	317	13	genus	genus	NOUN
aiol-6350	317	14	responsible	responsible	ADJ
aiol-6350	317	15	for	for	ADP
aiol-6350	317	16	the	the	DET
aiol-6350	317	17	production	production	NOUN
aiol-6350	317	18	of	of	ADP
aiol-6350	317	19	cyn	cyn	PROPN
aiol-6350	317	20	in	in	ADP
aiol-6350	317	21	polish	polish	ADJ
aiol-6350	317	22	lakes	lake	NOUN
aiol-6350	317	23	(	(	PUNCT
aiol-6350	317	24	mankiewicz	mankiewicz	NOUN
aiol-6350	317	25	-	-	PUNCT
aiol-6350	317	26	boczek	boczek	NOUN
aiol-6350	317	27	et	et	NOUN
aiol-6350	317	28	al	al	PROPN
aiol-6350	317	29	.	.	PROPN
aiol-6350	317	30	,	,	PUNCT
aiol-6350	317	31	2012	2012	NUM
aiol-6350	317	32	)	)	PUNCT
aiol-6350	317	33	.	.	PUNCT
aiol-6350	318	1	evidences	evidence	NOUN
aiol-6350	318	2	point	point	VERB
aiol-6350	318	3	to	to	ADP
aiol-6350	318	4	aph	aph	PROPN
aiol-6350	318	5	.	.	PUNCT
aiol-6350	318	6	gracile	gracile	PROPN
aiol-6350	318	7	as	as	ADP
aiol-6350	318	8	the	the	DET
aiol-6350	318	9	stx	stx	NOUN
aiol-6350	318	10	producer	producer	NOUN
aiol-6350	318	11	in	in	ADP
aiol-6350	318	12	europe	europe	PROPN
aiol-6350	318	13	(	(	PUNCT
aiol-6350	318	14	ballot	ballot	NOUN
aiol-6350	318	15	et	et	PROPN
aiol-6350	318	16	al	al	PROPN
aiol-6350	318	17	.	.	PROPN
aiol-6350	318	18	,	,	PUNCT
aiol-6350	318	19	2010	2010	NUM
aiol-6350	318	20	;	;	PUNCT
aiol-6350	318	21	cirés	ciré	NOUN
aiol-6350	318	22	et	et	PROPN
aiol-6350	318	23	al	al	PROPN
aiol-6350	318	24	.	.	PROPN
aiol-6350	318	25	,	,	PUNCT
aiol-6350	318	26	2014	2014	NUM
aiol-6350	318	27	)	)	PUNCT
aiol-6350	318	28	.	.	PUNCT
aiol-6350	319	1	gkelis	gkelis	PROPN
aiol-6350	319	2	and	and	CCONJ
aiol-6350	319	3	zaoutsos	zaoutsos	PROPN
aiol-6350	319	4	(	(	PUNCT
aiol-6350	319	5	2014	2014	NUM
aiol-6350	319	6	)	)	PUNCT
aiol-6350	319	7	suggested	suggest	VERB
aiol-6350	319	8	that	that	SCONJ
aiol-6350	319	9	c.	c.	PROPN
aiol-6350	319	10	raciborskii	raciborskii	VERB
aiol-6350	319	11	and	and	CCONJ
aiol-6350	319	12	aphanizomenon	aphanizomenon	NOUN
aiol-6350	319	13	(	(	PUNCT
aiol-6350	320	1	aph	aph	PROPN
aiol-6350	320	2	.	.	PUNCT
aiol-6350	320	3	cf	cf	NOUN
aiol-6350	320	4	.	.	PUNCT
aiol-6350	321	1	flos	flos	PROPN
aiol-6350	321	2	-	-	PUNCT
aiol-6350	321	3	aquae	aquae	PROPN
aiol-6350	321	4	)	)	PUNCT
aiol-6350	321	5	could	could	AUX
aiol-6350	321	6	be	be	AUX
aiol-6350	321	7	the	the	DET
aiol-6350	321	8	possible	possible	ADJ
aiol-6350	321	9	stx	stx	NOUN
aiol-6350	321	10	producers	producer	NOUN
aiol-6350	321	11	in	in	ADP
aiol-6350	321	12	greece	greece	PROPN
aiol-6350	321	13	.	.	PUNCT
aiol-6350	322	1	atx	atx	PROPN
aiol-6350	322	2	-	-	PUNCT
aiol-6350	322	3	a	a	PRON
aiol-6350	322	4	has	have	AUX
aiol-6350	322	5	been	be	AUX
aiol-6350	322	6	found	find	VERB
aiol-6350	322	7	in	in	ADP
aiol-6350	322	8	dolichospermum	dolichospermum	PROPN
aiol-6350	322	9	(	(	PUNCT
aiol-6350	322	10	anabaena	anabaena	NOUN
aiol-6350	322	11	)	)	PUNCT
aiol-6350	322	12	and	and	CCONJ
aiol-6350	322	13	aphanizomenon	aphanizomenon	NOUN
aiol-6350	322	14	populations	population	NOUN
aiol-6350	322	15	worldwide	worldwide	ADV
aiol-6350	322	16	(	(	PUNCT
aiol-6350	322	17	testai	testai	NOUN
aiol-6350	322	18	et	et	PROPN
aiol-6350	322	19	al	al	PROPN
aiol-6350	322	20	.	.	PROPN
aiol-6350	322	21	,	,	PUNCT
aiol-6350	322	22	2016	2016	NUM
aiol-6350	322	23	)	)	PUNCT
aiol-6350	322	24	.	.	PUNCT
aiol-6350	323	1	the	the	DET
aiol-6350	323	2	suspected	suspect	VERB
aiol-6350	323	3	cyn	cyn	NOUN
aiol-6350	323	4	or	or	CCONJ
aiol-6350	323	5	atx	atx	PROPN
aiol-6350	323	6	-	-	PUNCT
aiol-6350	323	7	a	a	DET
aiol-6350	323	8	production	production	NOUN
aiol-6350	323	9	of	of	ADP
aiol-6350	323	10	aph	aph	PROPN
aiol-6350	323	11	.	.	PUNCT
aiol-6350	324	1	flos	flos	PROPN
aiol-6350	324	2	-	-	PUNCT
aiol-6350	324	3	aquae	aquae	PROPN
aiol-6350	324	4	or	or	CCONJ
aiol-6350	324	5	mc	mc	PROPN
aiol-6350	324	6	production	production	NOUN
aiol-6350	324	7	of	of	ADP
aiol-6350	324	8	sph	sph	PROPN
aiol-6350	324	9	.	.	PUNCT
aiol-6350	324	10	aphanizomenoides	aphanizomenoides	PROPN
aiol-6350	324	11	is	be	AUX
aiol-6350	324	12	still	still	ADV
aiol-6350	324	13	uncertain	uncertain	ADJ
aiol-6350	324	14	(	(	PUNCT
aiol-6350	324	15	cirés	ciré	NOUN
aiol-6350	324	16	and	and	CCONJ
aiol-6350	324	17	ballot	ballot	NOUN
aiol-6350	324	18	,	,	PUNCT
aiol-6350	324	19	2016	2016	NUM
aiol-6350	324	20	)	)	PUNCT
aiol-6350	324	21	.	.	PUNCT
aiol-6350	325	1	further	further	ADJ
aiol-6350	325	2	studies	study	NOUN
aiol-6350	325	3	involving	involve	VERB
aiol-6350	325	4	strains	strain	NOUN
aiol-6350	325	5	and/or	and/or	CCONJ
aiol-6350	325	6	cyanotoxins	cyanotoxin	NOUN
aiol-6350	325	7	gene	gene	NOUN
aiol-6350	325	8	sequences	sequence	NOUN
aiol-6350	325	9	are	be	AUX
aiol-6350	325	10	needed	need	VERB
aiol-6350	325	11	to	to	PART
aiol-6350	325	12	identify	identify	VERB
aiol-6350	325	13	the	the	DET
aiol-6350	325	14	cyanotoxins	cyanotoxin	NOUN
aiol-6350	325	15	in	in	ADP
aiol-6350	325	16	lake	lake	PROPN
aiol-6350	325	17	karla	karla	PROPN
aiol-6350	325	18	and	and	CCONJ
aiol-6350	325	19	kalamaki	kalamaki	PROPN
aiol-6350	325	20	reservoir	reservoir	PROPN
aiol-6350	325	21	,	,	PUNCT
aiol-6350	325	22	as	as	SCONJ
aiol-6350	325	23	in	in	ADP
aiol-6350	325	24	all	all	DET
aiol-6350	325	25	cases	case	NOUN
aiol-6350	325	26	mixed	mixed	ADJ
aiol-6350	325	27	cyanobacteria	cyanobacteria	NOUN
aiol-6350	325	28	populations	population	NOUN
aiol-6350	325	29	co	co	VERB
aiol-6350	325	30	-	-	VERB
aiol-6350	325	31	occurred	occur	VERB
aiol-6350	325	32	with	with	ADP
aiol-6350	325	33	a	a	DET
aiol-6350	325	34	mixture	mixture	NOUN
aiol-6350	325	35	of	of	ADP
aiol-6350	325	36	cyanotoxins	cyanotoxin	NOUN
aiol-6350	325	37	.	.	PUNCT
aiol-6350	326	1	it	it	PRON
aiol-6350	326	2	has	have	AUX
aiol-6350	326	3	been	be	AUX
aiol-6350	326	4	well	well	ADV
aiol-6350	326	5	documented	document	VERB
aiol-6350	326	6	that	that	SCONJ
aiol-6350	326	7	environmental	environmental	ADJ
aiol-6350	326	8	factors	factor	NOUN
aiol-6350	326	9	such	such	ADJ
aiol-6350	326	10	as	as	ADP
aiol-6350	326	11	temperature	temperature	NOUN
aiol-6350	326	12	,	,	PUNCT
aiol-6350	326	13	ph	ph	VERB
aiol-6350	326	14	,	,	PUNCT
aiol-6350	326	15	dissolved	dissolve	VERB
aiol-6350	326	16	oxygen	oxygen	NOUN
aiol-6350	326	17	,	,	PUNCT
aiol-6350	326	18	and	and	CCONJ
aiol-6350	326	19	nutrient	nutrient	NOUN
aiol-6350	326	20	availability	availability	NOUN
aiol-6350	326	21	play	play	VERB
aiol-6350	326	22	an	an	DET
aiol-6350	326	23	important	important	ADJ
aiol-6350	326	24	role	role	NOUN
aiol-6350	326	25	in	in	ADP
aiol-6350	326	26	regulating	regulate	VERB
aiol-6350	326	27	the	the	DET
aiol-6350	326	28	structure	structure	NOUN
aiol-6350	326	29	and	and	CCONJ
aiol-6350	326	30	distribution	distribution	NOUN
aiol-6350	326	31	of	of	ADP
aiol-6350	326	32	phytoplankton	phytoplankton	NOUN
aiol-6350	326	33	communities	community	NOUN
aiol-6350	326	34	in	in	ADP
aiol-6350	326	35	lakes	lake	NOUN
aiol-6350	326	36	(	(	PUNCT
aiol-6350	326	37	dolman	dolman	PROPN
aiol-6350	326	38	et	et	PROPN
aiol-6350	326	39	al	al	PROPN
aiol-6350	326	40	.	.	PROPN
aiol-6350	326	41	,	,	PUNCT
aiol-6350	326	42	2012	2012	NUM
aiol-6350	326	43	;	;	PUNCT
aiol-6350	326	44	paerl	paerl	PROPN
aiol-6350	326	45	and	and	CCONJ
aiol-6350	326	46	paul	paul	PROPN
aiol-6350	326	47	,	,	PUNCT
aiol-6350	326	48	2012	2012	NUM
aiol-6350	326	49	)	)	PUNCT
aiol-6350	326	50	,	,	PUNCT
aiol-6350	326	51	whereas	whereas	SCONJ
aiol-6350	326	52	,	,	PUNCT
aiol-6350	326	53	their	their	PRON
aiol-6350	326	54	influence	influence	NOUN
aiol-6350	326	55	on	on	ADP
aiol-6350	326	56	cyanotoxin	cyanotoxin	NOUN
aiol-6350	326	57	production	production	NOUN
aiol-6350	326	58	is	be	AUX
aiol-6350	326	59	more	more	ADV
aiol-6350	326	60	complex	complex	ADJ
aiol-6350	326	61	(	(	PUNCT
aiol-6350	326	62	boopathi	boopathi	NOUN
aiol-6350	326	63	and	and	CCONJ
aiol-6350	326	64	ki	ki	PROPN
aiol-6350	326	65	,	,	PUNCT
aiol-6350	326	66	2014	2014	NUM
aiol-6350	326	67	)	)	PUNCT
aiol-6350	326	68	.	.	PUNCT
aiol-6350	327	1	our	our	PRON
aiol-6350	327	2	results	result	NOUN
aiol-6350	327	3	indicated	indicate	VERB
aiol-6350	327	4	that	that	SCONJ
aiol-6350	327	5	the	the	DET
aiol-6350	327	6	intracellular	intracellular	ADJ
aiol-6350	327	7	mc	mc	PROPN
aiol-6350	327	8	and	and	CCONJ
aiol-6350	327	9	cyn	cyn	PROPN
aiol-6350	327	10	concentration	concentration	NOUN
aiol-6350	327	11	was	be	AUX
aiol-6350	327	12	linked	link	VERB
aiol-6350	327	13	to	to	ADP
aiol-6350	327	14	water	water	NOUN
aiol-6350	327	15	temperature	temperature	NOUN
aiol-6350	327	16	and	and	CCONJ
aiol-6350	327	17	srp	srp	PROPN
aiol-6350	327	18	concentrations	concentration	NOUN
aiol-6350	327	19	.	.	PUNCT
aiol-6350	328	1	the	the	DET
aiol-6350	328	2	positive	positive	ADJ
aiol-6350	328	3	correlation	correlation	NOUN
aiol-6350	328	4	of	of	ADP
aiol-6350	328	5	mcs	mcs	PROPN
aiol-6350	328	6	to	to	ADP
aiol-6350	328	7	temperature	temperature	NOUN
aiol-6350	328	8	,	,	PUNCT
aiol-6350	328	9	and	and	CCONJ
aiol-6350	328	10	srp	srp	PROPN
aiol-6350	328	11	,	,	PUNCT
aiol-6350	328	12	found	find	VERB
aiol-6350	328	13	also	also	ADV
aiol-6350	328	14	recently	recently	ADV
aiol-6350	328	15	in	in	ADP
aiol-6350	328	16	lake	lake	PROPN
aiol-6350	328	17	pamvotis	pamvotis	PROPN
aiol-6350	328	18	(	(	PUNCT
aiol-6350	328	19	gkelis	gkelis	PROPN
aiol-6350	328	20	et	et	PROPN
aiol-6350	328	21	al	al	PROPN
aiol-6350	328	22	.	.	PROPN
aiol-6350	328	23	,	,	PUNCT
aiol-6350	328	24	2014	2014	NUM
aiol-6350	328	25	)	)	PUNCT
aiol-6350	328	26	can	can	AUX
aiol-6350	328	27	be	be	AUX
aiol-6350	328	28	explained	explain	VERB
aiol-6350	328	29	by	by	ADP
aiol-6350	328	30	the	the	DET
aiol-6350	328	31	fact	fact	NOUN
aiol-6350	328	32	that	that	SCONJ
aiol-6350	328	33	in	in	ADP
aiol-6350	328	34	high	high	ADJ
aiol-6350	328	35	concentrations	concentration	NOUN
aiol-6350	328	36	of	of	ADP
aiol-6350	328	37	phosphorus	phosphorus	NOUN
aiol-6350	328	38	(	(	PUNCT
aiol-6350	328	39	o	o	NOUN
aiol-6350	328	40	’	'	PUNCT
aiol-6350	328	41	neil	neil	PROPN
aiol-6350	328	42	et	et	PROPN
aiol-6350	328	43	al	al	PROPN
aiol-6350	328	44	.	.	PROPN
aiol-6350	328	45	,	,	PUNCT
aiol-6350	328	46	2012	2012	NUM
aiol-6350	328	47	)	)	PUNCT
aiol-6350	328	48	,	,	PUNCT
aiol-6350	328	49	or	or	CCONJ
aiol-6350	328	50	nitrogen	nitrogen	NOUN
aiol-6350	328	51	or	or	CCONJ
aiol-6350	328	52	joint	joint	ADJ
aiol-6350	328	53	nitrogen	nitrogen	NOUN
aiol-6350	328	54	-	-	PUNCT
aiol-6350	328	55	phosphorus	phosphorus	NOUN
aiol-6350	328	56	(	(	PUNCT
aiol-6350	328	57	dolman	dolman	NOUN
aiol-6350	328	58	et	et	PROPN
aiol-6350	328	59	al	al	PROPN
aiol-6350	328	60	.	.	PROPN
aiol-6350	328	61	,	,	PUNCT
aiol-6350	328	62	2012	2012	NUM
aiol-6350	328	63	)	)	PUNCT
aiol-6350	328	64	hepatotoxic	hepatotoxic	NOUN
aiol-6350	328	65	strains	strain	NOUN
aiol-6350	328	66	produce	produce	VERB
aiol-6350	328	67	more	more	ADJ
aiol-6350	328	68	mcs	mcs	PROPN
aiol-6350	328	69	.	.	PUNCT
aiol-6350	329	1	however	however	ADV
aiol-6350	329	2	,	,	PUNCT
aiol-6350	329	3	given	give	VERB
aiol-6350	329	4	the	the	DET
aiol-6350	329	5	very	very	ADV
aiol-6350	329	6	high	high	ADJ
aiol-6350	329	7	level	level	NOUN
aiol-6350	329	8	of	of	ADP
aiol-6350	329	9	srp	srp	PROPN
aiol-6350	329	10	throughout	throughout	ADP
aiol-6350	329	11	the	the	DET
aiol-6350	329	12	study	study	NOUN
aiol-6350	329	13	we	we	PRON
aiol-6350	329	14	can	can	AUX
aiol-6350	329	15	not	not	PART
aiol-6350	329	16	conclude	conclude	VERB
aiol-6350	329	17	that	that	SCONJ
aiol-6350	329	18	srp	srp	PROPN
aiol-6350	329	19	has	have	AUX
aiol-6350	329	20	been	be	AUX
aiol-6350	329	21	a	a	DET
aiol-6350	329	22	determining	determine	VERB
aiol-6350	329	23	factor	factor	NOUN
aiol-6350	329	24	.	.	PUNCT
aiol-6350	330	1	to	to	ADP
aiol-6350	330	2	date	date	NOUN
aiol-6350	330	3	,	,	PUNCT
aiol-6350	330	4	very	very	ADV
aiol-6350	330	5	few	few	ADJ
aiol-6350	330	6	studies	study	NOUN
aiol-6350	330	7	have	have	AUX
aiol-6350	330	8	investigated	investigate	VERB
aiol-6350	330	9	the	the	DET
aiol-6350	330	10	relationship	relationship	NOUN
aiol-6350	330	11	between	between	ADP
aiol-6350	330	12	cyn	cyn	PROPN
aiol-6350	330	13	concentration	concentration	NOUN
aiol-6350	330	14	and	and	CCONJ
aiol-6350	330	15	environmental	environmental	ADJ
aiol-6350	330	16	factors	factor	NOUN
aiol-6350	330	17	potentially	potentially	ADV
aiol-6350	330	18	affecting	affect	VERB
aiol-6350	330	19	its	its	PRON
aiol-6350	330	20	production	production	NOUN
aiol-6350	330	21	.	.	PUNCT
aiol-6350	331	1	experimental	experimental	ADJ
aiol-6350	331	2	studies	study	NOUN
aiol-6350	331	3	were	be	AUX
aiol-6350	331	4	focused	focus	VERB
aiol-6350	331	5	,	,	PUNCT
aiol-6350	331	6	e.g.	e.g.	ADV
aiol-6350	331	7	,	,	PUNCT
aiol-6350	331	8	on	on	ADP
aiol-6350	331	9	effects	effect	NOUN
aiol-6350	331	10	of	of	ADP
aiol-6350	331	11	temperature	temperature	NOUN
aiol-6350	331	12	(	(	PUNCT
aiol-6350	331	13	saker	saker	NOUN
aiol-6350	331	14	and	and	CCONJ
aiol-6350	331	15	griffiths	griffiths	PROPN
aiol-6350	331	16	,	,	PUNCT
aiol-6350	331	17	2000	2000	NUM
aiol-6350	331	18	)	)	PUNCT
aiol-6350	331	19	,	,	PUNCT
aiol-6350	331	20	nitrogen	nitrogen	NOUN
aiol-6350	331	21	(	(	PUNCT
aiol-6350	331	22	saker	saker	NOUN
aiol-6350	331	23	and	and	CCONJ
aiol-6350	331	24	neilan	neilan	NOUN
aiol-6350	331	25	,	,	PUNCT
aiol-6350	331	26	2001	2001	NUM
aiol-6350	331	27	)	)	PUNCT
aiol-6350	331	28	,	,	PUNCT
aiol-6350	331	29	or	or	CCONJ
aiol-6350	331	30	light	light	NOUN
aiol-6350	331	31	(	(	PUNCT
aiol-6350	331	32	dyble	dyble	ADJ
aiol-6350	331	33	et	et	PROPN
aiol-6350	331	34	al	al	PROPN
aiol-6350	331	35	.	.	PROPN
aiol-6350	331	36	,	,	PUNCT
aiol-6350	331	37	2006	2006	NUM
aiol-6350	331	38	;	;	PUNCT
aiol-6350	331	39	bormans	borman	NOUN
aiol-6350	331	40	et	et	PROPN
aiol-6350	331	41	al	al	PROPN
aiol-6350	331	42	.	.	PROPN
aiol-6350	331	43	,	,	PUNCT
aiol-6350	331	44	2014	2014	NUM
aiol-6350	331	45	)	)	PUNCT
aiol-6350	331	46	.	.	PUNCT
aiol-6350	332	1	our	our	PRON
aiol-6350	332	2	work	work	NOUN
aiol-6350	332	3	showed	show	VERB
aiol-6350	332	4	a	a	DET
aiol-6350	332	5	positive	positive	ADJ
aiol-6350	332	6	correlation	correlation	NOUN
aiol-6350	332	7	of	of	ADP
aiol-6350	332	8	cyn	cyn	NOUN
aiol-6350	332	9	to	to	ADP
aiol-6350	332	10	temperature	temperature	NOUN
aiol-6350	332	11	in	in	ADP
aiol-6350	332	12	line	line	NOUN
aiol-6350	332	13	with	with	ADP
aiol-6350	332	14	kokociński	kokociński	PROPN
aiol-6350	332	15	et	et	PROPN
aiol-6350	332	16	al	al	PROPN
aiol-6350	332	17	.	.	PROPN
aiol-6350	333	1	(	(	PUNCT
aiol-6350	333	2	2013	2013	NUM
aiol-6350	333	3	)	)	PUNCT
aiol-6350	333	4	;	;	PUNCT
aiol-6350	333	5	earlier	early	ADV
aiol-6350	333	6	experimental	experimental	ADJ
aiol-6350	333	7	studies	study	NOUN
aiol-6350	333	8	by	by	ADP
aiol-6350	333	9	saker	saker	PROPN
aiol-6350	333	10	and	and	CCONJ
aiol-6350	333	11	griffiths	griffiths	PROPN
aiol-6350	333	12	(	(	PUNCT
aiol-6350	333	13	2000	2000	NUM
aiol-6350	333	14	)	)	PUNCT
aiol-6350	333	15	and	and	CCONJ
aiol-6350	333	16	preußel	preußel	VERB
aiol-6350	333	17	et	et	PROPN
aiol-6350	333	18	al	al	PROPN
aiol-6350	333	19	.	.	PUNCT
aiol-6350	334	1	(	(	PUNCT
aiol-6350	334	2	2009	2009	NUM
aiol-6350	334	3	)	)	PUNCT
aiol-6350	334	4	found	find	VERB
aiol-6350	334	5	a	a	DET
aiol-6350	334	6	reduction	reduction	NOUN
aiol-6350	334	7	of	of	ADP
aiol-6350	334	8	cyn	cyn	NOUN
aiol-6350	334	9	production	production	NOUN
aiol-6350	334	10	at	at	ADP
aiol-6350	334	11	temperatures	temperature	NOUN
aiol-6350	334	12	over	over	ADP
aiol-6350	334	13	20	20	NUM
aiol-6350	334	14	°	°	NOUN
aiol-6350	334	15	c	c	NOUN
aiol-6350	334	16	and	and	CCONJ
aiol-6350	334	17	25	25	NUM
aiol-6350	334	18	°	°	NOUN
aiol-6350	334	19	c	c	NOUN
aiol-6350	334	20	,	,	PUNCT
aiol-6350	334	21	respectively	respectively	ADV
aiol-6350	334	22	.	.	PUNCT
aiol-6350	335	1	these	these	DET
aiol-6350	335	2	somewhat	somewhat	ADV
aiol-6350	335	3	contrasting	contrasting	ADJ
aiol-6350	335	4	results	result	NOUN
aiol-6350	335	5	could	could	AUX
aiol-6350	335	6	be	be	AUX
aiol-6350	335	7	due	due	ADJ
aiol-6350	335	8	to	to	ADP
aiol-6350	335	9	the	the	DET
aiol-6350	335	10	different	different	ADJ
aiol-6350	335	11	cyn	cyn	NOUN
aiol-6350	335	12	producers	producer	NOUN
aiol-6350	335	13	examined	examine	VERB
aiol-6350	335	14	and	and	CCONJ
aiol-6350	335	15	different	different	ADJ
aiol-6350	335	16	regulatory	regulatory	ADJ
aiol-6350	335	17	mechanisms	mechanism	NOUN
aiol-6350	335	18	of	of	ADP
aiol-6350	335	19	cyn	cyn	NOUN
aiol-6350	335	20	-	-	PUNCT
aiol-6350	335	21	producing	produce	VERB
aiol-6350	335	22	strains	strain	NOUN
aiol-6350	335	23	involved	involve	VERB
aiol-6350	335	24	as	as	ADP
aiol-6350	335	25	wiedner	wiedner	NOUN
aiol-6350	335	26	et	et	PROPN
aiol-6350	335	27	al	al	PROPN
aiol-6350	335	28	.	.	PUNCT
aiol-6350	336	1	(	(	PUNCT
aiol-6350	336	2	2008	2008	NUM
aiol-6350	336	3	)	)	PUNCT
aiol-6350	336	4	point	point	VERB
aiol-6350	336	5	out	out	ADP
aiol-6350	336	6	.	.	PUNCT
aiol-6350	337	1	in	in	ADP
aiol-6350	337	2	the	the	DET
aiol-6350	337	3	present	present	ADJ
aiol-6350	337	4	study	study	NOUN
aiol-6350	337	5	,	,	PUNCT
aiol-6350	337	6	the	the	DET
aiol-6350	337	7	phytoplankton	phytoplankton	NOUN
aiol-6350	337	8	biomass	biomass	NOUN
aiol-6350	337	9	(	(	PUNCT
aiol-6350	337	10	dominated	dominate	VERB
aiol-6350	337	11	by	by	ADP
aiol-6350	337	12	cyanobacteria	cyanobacteria	PROPN
aiol-6350	337	13	)	)	PUNCT
aiol-6350	337	14	and	and	CCONJ
aiol-6350	337	15	the	the	DET
aiol-6350	337	16	mcs	mcs	PROPN
aiol-6350	337	17	concentrations	concentration	NOUN
aiol-6350	337	18	were	be	AUX
aiol-6350	337	19	well	well	ADV
aiol-6350	337	20	above	above	ADP
aiol-6350	337	21	the	the	DET
aiol-6350	337	22	who	who	PRON
aiol-6350	337	23	guidance	guidance	NOUN
aiol-6350	337	24	level	level	NOUN
aiol-6350	337	25	2	2	NUM
aiol-6350	337	26	(	(	PUNCT
aiol-6350	337	27	who	who	PRON
aiol-6350	337	28	,	,	PUNCT
aiol-6350	337	29	2003	2003	NUM
aiol-6350	337	30	)	)	PUNCT
aiol-6350	337	31	for	for	ADP
aiol-6350	337	32	recreational	recreational	ADJ
aiol-6350	337	33	waters	water	NOUN
aiol-6350	337	34	,	,	PUNCT
aiol-6350	337	35	posing	pose	VERB
aiol-6350	337	36	a	a	DET
aiol-6350	337	37	moderate	moderate	ADJ
aiol-6350	337	38	health	health	NOUN
aiol-6350	337	39	risk	risk	NOUN
aiol-6350	337	40	throughout	throughout	ADP
aiol-6350	337	41	the	the	DET
aiol-6350	337	42	year	year	NOUN
aiol-6350	337	43	.	.	PUNCT
aiol-6350	338	1	in	in	ADP
aiol-6350	338	2	some	some	DET
aiol-6350	338	3	cases	case	NOUN
aiol-6350	338	4	(	(	PUNCT
aiol-6350	338	5	warm	warm	ADJ
aiol-6350	338	6	period	period	NOUN
aiol-6350	338	7	in	in	ADP
aiol-6350	338	8	lake	lake	PROPN
aiol-6350	338	9	karla	karla	PROPN
aiol-6350	338	10	and	and	CCONJ
aiol-6350	338	11	february	february	PROPN
aiol-6350	338	12	2013	2013	NUM
aiol-6350	338	13	in	in	ADP
aiol-6350	338	14	kalamaki	kalamaki	PROPN
aiol-6350	338	15	reservoir	reservoir	PROPN
aiol-6350	338	16	)	)	PUNCT
aiol-6350	338	17	,	,	PUNCT
aiol-6350	338	18	biomass	biomass	NOUN
aiol-6350	338	19	values	value	NOUN
aiol-6350	338	20	exceeded	exceed	VERB
aiol-6350	338	21	also	also	ADV
aiol-6350	338	22	the	the	DET
aiol-6350	338	23	guidance	guidance	NOUN
aiol-6350	338	24	level	level	NOUN
aiol-6350	338	25	3	3	NUM
aiol-6350	338	26	,	,	PUNCT
aiol-6350	338	27	without	without	ADP
aiol-6350	338	28	,	,	PUNCT
aiol-6350	338	29	however	however	ADV
aiol-6350	338	30	,	,	PUNCT
aiol-6350	338	31	the	the	DET
aiol-6350	338	32	mcs	mcs	PROPN
aiol-6350	338	33	concentration	concentration	NOUN
aiol-6350	338	34	being	be	AUX
aiol-6350	338	35	equally	equally	ADV
aiol-6350	338	36	high	high	ADJ
aiol-6350	338	37	.	.	PUNCT
aiol-6350	339	1	nevertheless	nevertheless	ADV
aiol-6350	339	2	,	,	PUNCT
aiol-6350	339	3	given	give	VERB
aiol-6350	339	4	the	the	DET
aiol-6350	339	5	co	co	NOUN
aiol-6350	339	6	-	-	NOUN
aiol-6350	339	7	occurrence	occurrence	NOUN
aiol-6350	339	8	of	of	ADP
aiol-6350	339	9	multiple	multiple	ADJ
aiol-6350	339	10	cyanotoxins	cyanotoxin	NOUN
aiol-6350	339	11	in	in	ADP
aiol-6350	339	12	lake	lake	PROPN
aiol-6350	339	13	karla	karla	PROPN
aiol-6350	339	14	,	,	PUNCT
aiol-6350	339	15	documented	document	VERB
aiol-6350	339	16	in	in	ADP
aiol-6350	339	17	our	our	PRON
aiol-6350	339	18	study	study	NOUN
aiol-6350	339	19	,	,	PUNCT
aiol-6350	339	20	and	and	CCONJ
aiol-6350	339	21	the	the	DET
aiol-6350	339	22	fish	fish	NOUN
aiol-6350	339	23	mortalities	mortality	NOUN
aiol-6350	339	24	(	(	PUNCT
aiol-6350	339	25	oikonomou	oikonomou	ADV
aiol-6350	339	26	et	et	NOUN
aiol-6350	339	27	al	al	PROPN
aiol-6350	339	28	.	.	PROPN
aiol-6350	339	29	,	,	PUNCT
aiol-6350	339	30	2012	2012	NUM
aiol-6350	339	31	)	)	PUNCT
aiol-6350	339	32	and	and	CCONJ
aiol-6350	339	33	mcs	mcs	PROPN
aiol-6350	339	34	accumulation	accumulation	NOUN
aiol-6350	339	35	in	in	ADP
aiol-6350	339	36	fish	fish	NOUN
aiol-6350	339	37	(	(	PUNCT
aiol-6350	339	38	papadimitriou	papadimitriou	VERB
aiol-6350	339	39	et	et	PROPN
aiol-6350	339	40	al	al	PROPN
aiol-6350	339	41	.	.	PROPN
aiol-6350	339	42	,	,	PUNCT
aiol-6350	339	43	2013	2013	NUM
aiol-6350	339	44	)	)	PUNCT
aiol-6350	339	45	it	it	PRON
aiol-6350	339	46	should	should	AUX
aiol-6350	339	47	be	be	AUX
aiol-6350	339	48	considered	consider	VERB
aiol-6350	339	49	that	that	DET
aiol-6350	339	50	guidance	guidance	NOUN
aiol-6350	339	51	level	level	NOUN
aiol-6350	339	52	3	3	NUM
aiol-6350	339	53	health	health	NOUN
aiol-6350	339	54	risks	risk	NOUN
aiol-6350	339	55	(	(	PUNCT
aiol-6350	339	56	who	who	PRON
aiol-6350	339	57	,	,	PUNCT
aiol-6350	339	58	2003	2003	NUM
aiol-6350	339	59	)	)	PUNCT
aiol-6350	339	60	are	be	AUX
aiol-6350	339	61	possible	possible	ADJ
aiol-6350	339	62	.	.	PUNCT
aiol-6350	340	1	therefore	therefore	ADV
aiol-6350	340	2	,	,	PUNCT
aiol-6350	340	3	the	the	DET
aiol-6350	340	4	recommended	recommend	VERB
aiol-6350	340	5	actions	action	NOUN
aiol-6350	340	6	(	(	PUNCT
aiol-6350	340	7	who	who	PRON
aiol-6350	340	8	,	,	PUNCT
aiol-6350	340	9	2003	2003	NUM
aiol-6350	340	10	)	)	PUNCT
aiol-6350	340	11	,	,	PUNCT
aiol-6350	340	12	including	include	VERB
aiol-6350	340	13	possible	possible	ADJ
aiol-6350	340	14	prohibition	prohibition	NOUN
aiol-6350	340	15	of	of	ADP
aiol-6350	340	16	watercontact	watercontact	NOUN
aiol-6350	340	17	activities	activity	NOUN
aiol-6350	340	18	,	,	PUNCT
aiol-6350	340	19	public	public	ADJ
aiol-6350	340	20	health	health	NOUN
aiol-6350	340	21	follow	follow	NOUN
aiol-6350	340	22	-	-	PUNCT
aiol-6350	340	23	up	up	ADP
aiol-6350	340	24	investigation	investigation	NOUN
aiol-6350	340	25	,	,	PUNCT
aiol-6350	340	26	and	and	CCONJ
aiol-6350	340	27	informing	inform	VERB
aiol-6350	340	28	of	of	ADP
aiol-6350	340	29	the	the	DET
aiol-6350	340	30	relevant	relevant	ADJ
aiol-6350	340	31	authorities	authority	NOUN
aiol-6350	340	32	,	,	PUNCT
aiol-6350	340	33	should	should	AUX
aiol-6350	340	34	be	be	AUX
aiol-6350	340	35	taken	take	VERB
aiol-6350	340	36	.	.	PUNCT
aiol-6350	341	1	it	it	PRON
aiol-6350	341	2	should	should	AUX
aiol-6350	341	3	be	be	AUX
aiol-6350	341	4	noted	note	VERB
aiol-6350	341	5	that	that	SCONJ
aiol-6350	341	6	the	the	DET
aiol-6350	341	7	frequency	frequency	NOUN
aiol-6350	341	8	of	of	ADP
aiol-6350	341	9	recurrent	recurrent	ADJ
aiol-6350	341	10	waterbloom	waterbloom	NOUN
aiol-6350	341	11	phenomena	phenomenon	NOUN
aiol-6350	341	12	,	,	PUNCT
aiol-6350	341	13	especially	especially	ADV
aiol-6350	341	14	during	during	ADP
aiol-6350	341	15	the	the	DET
aiol-6350	341	16	warm	warm	ADJ
aiol-6350	341	17	period	period	NOUN
aiol-6350	341	18	,	,	PUNCT
aiol-6350	341	19	could	could	AUX
aiol-6350	341	20	be	be	AUX
aiol-6350	341	21	much	much	ADV
aiol-6350	341	22	higher	high	ADJ
aiol-6350	341	23	than	than	ADP
aiol-6350	341	24	the	the	DET
aiol-6350	341	25	sampling	sampling	NOUN
aiol-6350	341	26	of	of	ADP
aiol-6350	341	27	this	this	DET
aiol-6350	341	28	monitoring	monitoring	NOUN
aiol-6350	341	29	program	program	NOUN
aiol-6350	341	30	,	,	PUNCT
aiol-6350	341	31	thus	thus	ADV
aiol-6350	341	32	a	a	DET
aiol-6350	341	33	quick	quick	ADJ
aiol-6350	341	34	and	and	CCONJ
aiol-6350	341	35	efficient	efficient	ADJ
aiol-6350	341	36	water	water	NOUN
aiol-6350	341	37	-	-	PUNCT
aiol-6350	341	38	bloom	bloom	NOUN
aiol-6350	341	39	early	early	ADJ
aiol-6350	341	40	warning	warning	NOUN
aiol-6350	341	41	system	system	NOUN
aiol-6350	341	42	should	should	AUX
aiol-6350	341	43	be	be	AUX
aiol-6350	341	44	implemented	implement	VERB
aiol-6350	341	45	.	.	PUNCT
aiol-6350	342	1	an	an	DET
aiol-6350	342	2	overall	overall	ADJ
aiol-6350	342	3	assessment	assessment	NOUN
aiol-6350	342	4	of	of	ADP
aiol-6350	342	5	the	the	DET
aiol-6350	342	6	monitoring	monitoring	NOUN
aiol-6350	342	7	in	in	ADP
aiol-6350	342	8	lake	lake	PROPN
aiol-6350	342	9	karla	karla	PROPN
aiol-6350	342	10	and	and	CCONJ
aiol-6350	342	11	kalamaki	kalamaki	PROPN
aiol-6350	342	12	reservoir	reservoir	PROPN
aiol-6350	342	13	indicates	indicate	VERB
aiol-6350	342	14	that	that	SCONJ
aiol-6350	342	15	,	,	PUNCT
aiol-6350	342	16	as	as	ADP
aiol-6350	342	17	in	in	ADP
aiol-6350	342	18	other	other	ADJ
aiol-6350	342	19	greek	greek	ADJ
aiol-6350	342	20	lakes	lake	NOUN
aiol-6350	342	21	(	(	PUNCT
aiol-6350	342	22	latinopoulos	latinopoulos	PROPN
aiol-6350	342	23	et	et	PROPN
aiol-6350	342	24	al	al	PROPN
aiol-6350	342	25	.	.	PROPN
aiol-6350	342	26	,	,	PUNCT
aiol-6350	342	27	2016	2016	NUM
aiol-6350	342	28	)	)	PUNCT
aiol-6350	342	29	,	,	PUNCT
aiol-6350	342	30	multiple	multiple	ADJ
aiol-6350	342	31	stressors	stressor	NOUN
aiol-6350	342	32	act	act	VERB
aiol-6350	342	33	synergistically	synergistically	ADV
aiol-6350	342	34	in	in	ADP
aiol-6350	342	35	degrading	degrade	VERB
aiol-6350	342	36	their	their	PRON
aiol-6350	342	37	ecological	ecological	ADJ
aiol-6350	342	38	status	status	NOUN
aiol-6350	342	39	.	.	PUNCT
aiol-6350	343	1	while	while	SCONJ
aiol-6350	343	2	the	the	DET
aiol-6350	343	3	diffuse	diffuse	PROPN
aiol-6350	343	4	pollution	pollution	NOUN
aiol-6350	343	5	from	from	ADP
aiol-6350	343	6	agriculture	agriculture	NOUN
aiol-6350	343	7	is	be	AUX
aiol-6350	343	8	the	the	DET
aiol-6350	343	9	single	single	ADJ
aiol-6350	343	10	most	most	ADV
aiol-6350	343	11	important	important	ADJ
aiol-6350	343	12	source	source	NOUN
aiol-6350	343	13	of	of	ADP
aiol-6350	343	14	pollution	pollution	NOUN
aiol-6350	343	15	in	in	ADP
aiol-6350	343	16	most	most	ADJ
aiol-6350	343	17	european	european	ADJ
aiol-6350	343	18	lakes	lake	NOUN
aiol-6350	343	19	nowadays	nowadays	ADV
aiol-6350	343	20	,	,	PUNCT
aiol-6350	343	21	greek	greek	NOUN
aiol-6350	343	22	lakes	lake	NOUN
aiol-6350	343	23	still	still	ADV
aiol-6350	343	24	face	face	VERB
aiol-6350	343	25	point	point	NOUN
aiol-6350	343	26	pollution	pollution	NOUN
aiol-6350	343	27	,	,	PUNCT
aiol-6350	343	28	particularly	particularly	ADV
aiol-6350	343	29	by	by	ADP
aiol-6350	343	30	nutrients	nutrient	NOUN
aiol-6350	343	31	(	(	PUNCT
aiol-6350	343	32	latinopoulos	latinopoulos	PROPN
aiol-6350	343	33	et	et	PROPN
aiol-6350	343	34	al	al	PROPN
aiol-6350	343	35	.	.	PROPN
aiol-6350	343	36	,	,	PUNCT
aiol-6350	343	37	2016	2016	NUM
aiol-6350	343	38	)	)	PUNCT
aiol-6350	343	39	.	.	PUNCT
aiol-6350	344	1	in	in	ADP
aiol-6350	344	2	lake	lake	PROPN
aiol-6350	344	3	karla	karla	PROPN
aiol-6350	344	4	,	,	PUNCT
aiol-6350	344	5	nutrient	nutrient	NOUN
aiol-6350	344	6	load	load	NOUN
aiol-6350	344	7	combining	combine	VERB
aiol-6350	344	8	both	both	CCONJ
aiol-6350	344	9	diffuse	diffuse	NOUN
aiol-6350	344	10	and	and	CCONJ
aiol-6350	344	11	point	point	VERB
aiol-6350	344	12	pollution	pollution	NOUN
aiol-6350	344	13	is	be	AUX
aiol-6350	344	14	8200	8200	NUM
aiol-6350	344	15	kg	kg	NOUN
aiol-6350	344	16	day–1	day–1	PROPN
aiol-6350	344	17	for	for	ADP
aiol-6350	344	18	n	n	PROPN
aiol-6350	344	19	and	and	CCONJ
aiol-6350	344	20	870	870	NUM
aiol-6350	344	21	kg	kg	NOUN
aiol-6350	344	22	day–1	day–1	X
aiol-6350	344	23	for	for	ADP
aiol-6350	344	24	p	p	PROPN
aiol-6350	344	25	,	,	PUNCT
aiol-6350	344	26	res	re	NOUN
aiol-6350	344	27	.	.	PUNCT
aiol-6350	345	1	gkelis	gkelis	PROPN
aiol-6350	345	2	et	et	NOUN
aiol-6350	345	3	al.48	al.48	PROPN
aiol-6350	345	4	spectively	spectively	ADV
aiol-6350	345	5	(	(	PUNCT
aiol-6350	345	6	egy	egy	PROPN
aiol-6350	345	7	,	,	PUNCT
aiol-6350	345	8	2013	2013	NUM
aiol-6350	345	9	)	)	PUNCT
aiol-6350	345	10	.	.	PUNCT
aiol-6350	346	1	thus	thus	ADV
aiol-6350	346	2	,	,	PUNCT
aiol-6350	346	3	a	a	DET
aiol-6350	346	4	drastic	drastic	ADJ
aiol-6350	346	5	reduction	reduction	NOUN
aiol-6350	346	6	of	of	ADP
aiol-6350	346	7	nutrient	nutrient	NOUN
aiol-6350	346	8	load	load	NOUN
aiol-6350	346	9	should	should	AUX
aiol-6350	346	10	be	be	AUX
aiol-6350	346	11	achieved	achieve	VERB
aiol-6350	346	12	‘	'	PUNCT
aiol-6350	346	13	at	at	ADP
aiol-6350	346	14	source	source	NOUN
aiol-6350	346	15	level	level	NOUN
aiol-6350	346	16	’	'	PUNCT
aiol-6350	346	17	and	and	CCONJ
aiol-6350	346	18	before	before	ADP
aiol-6350	346	19	entering	enter	VERB
aiol-6350	346	20	the	the	DET
aiol-6350	346	21	riparian	riparian	ADJ
aiol-6350	346	22	zone	zone	NOUN
aiol-6350	346	23	.	.	PUNCT
aiol-6350	347	1	controlling	control	VERB
aiol-6350	347	2	nutrients	nutrient	NOUN
aiol-6350	347	3	remains	remain	VERB
aiol-6350	347	4	the	the	DET
aiol-6350	347	5	basis	basis	NOUN
aiol-6350	347	6	for	for	ADP
aiol-6350	347	7	managing	manage	VERB
aiol-6350	347	8	blooms	bloom	NOUN
aiol-6350	347	9	,	,	PUNCT
aiol-6350	347	10	no	no	ADV
aiol-6350	347	11	matter	matter	ADV
aiol-6350	347	12	which	which	DET
aiol-6350	347	13	phytoplankton	phytoplankton	NOUN
aiol-6350	347	14	functional	functional	ADJ
aiol-6350	347	15	type	type	NOUN
aiol-6350	347	16	dominates	dominate	VERB
aiol-6350	347	17	(	(	PUNCT
aiol-6350	347	18	mantzouki	mantzouki	PROPN
aiol-6350	347	19	et	et	PROPN
aiol-6350	347	20	al	al	PROPN
aiol-6350	347	21	.	.	PROPN
aiol-6350	347	22	,	,	PUNCT
aiol-6350	347	23	2016	2016	NUM
aiol-6350	347	24	)	)	PUNCT
aiol-6350	347	25	,	,	PUNCT
aiol-6350	347	26	therefore	therefore	ADV
aiol-6350	347	27	the	the	DET
aiol-6350	347	28	decrease	decrease	NOUN
aiol-6350	347	29	of	of	ADP
aiol-6350	347	30	fertilizer	fertilizer	NOUN
aiol-6350	347	31	level	level	NOUN
aiol-6350	347	32	and	and	CCONJ
aiol-6350	347	33	the	the	DET
aiol-6350	347	34	control	control	NOUN
aiol-6350	347	35	of	of	ADP
aiol-6350	347	36	the	the	DET
aiol-6350	347	37	point	point	NOUN
aiol-6350	347	38	pollution	pollution	NOUN
aiol-6350	347	39	sources	source	NOUN
aiol-6350	347	40	are	be	AUX
aiol-6350	347	41	considered	consider	VERB
aiol-6350	347	42	as	as	ADP
aiol-6350	347	43	the	the	DET
aiol-6350	347	44	only	only	ADJ
aiol-6350	347	45	feasible	feasible	ADJ
aiol-6350	347	46	measures	measure	NOUN
aiol-6350	347	47	.	.	PUNCT
aiol-6350	348	1	furthermore	furthermore	ADV
aiol-6350	348	2	,	,	PUNCT
aiol-6350	348	3	in	in	ADP
aiol-6350	348	4	lake	lake	PROPN
aiol-6350	348	5	karla	karla	PROPN
aiol-6350	348	6	the	the	DET
aiol-6350	348	7	continuous	continuous	ADJ
aiol-6350	348	8	water	water	NOUN
aiol-6350	348	9	level	level	NOUN
aiol-6350	348	10	decline	decline	NOUN
aiol-6350	348	11	from	from	ADP
aiol-6350	348	12	the	the	DET
aiol-6350	348	13	suggested	suggest	VERB
aiol-6350	348	14	‘	'	PUNCT
aiol-6350	348	15	lower	low	ADJ
aiol-6350	348	16	ecological	ecological	ADJ
aiol-6350	348	17	water	water	NOUN
aiol-6350	348	18	level	level	NOUN
aiol-6350	348	19	’	'	PUNCT
aiol-6350	348	20	(	(	PUNCT
aiol-6350	348	21	i.e.	i.e.	X
aiol-6350	348	22	,	,	PUNCT
aiol-6350	348	23	46.4	46.4	NUM
aiol-6350	348	24	m	m	NOUN
aiol-6350	348	25	asl	asl	NOUN
aiol-6350	348	26	)	)	PUNCT
aiol-6350	348	27	causes	cause	VERB
aiol-6350	348	28	accumulation	accumulation	NOUN
aiol-6350	348	29	of	of	ADP
aiol-6350	348	30	nutrients	nutrient	NOUN
aiol-6350	348	31	which	which	PRON
aiol-6350	348	32	is	be	AUX
aiol-6350	348	33	strengthening	strengthen	VERB
aiol-6350	348	34	the	the	DET
aiol-6350	348	35	eutrophication	eutrophication	NOUN
aiol-6350	348	36	.	.	PUNCT
aiol-6350	349	1	we	we	PRON
aiol-6350	349	2	have	have	VERB
aiol-6350	349	3	not	not	PART
aiol-6350	349	4	evidence	evidence	NOUN
aiol-6350	349	5	yet	yet	ADV
aiol-6350	349	6	about	about	ADP
aiol-6350	349	7	the	the	DET
aiol-6350	349	8	extent	extent	NOUN
aiol-6350	349	9	of	of	ADP
aiol-6350	349	10	the	the	DET
aiol-6350	349	11	nutrient	nutrient	NOUN
aiol-6350	349	12	’s	’s	PART
aiol-6350	349	13	re	re	NOUN
aiol-6350	349	14	-	-	NOUN
aiol-6350	349	15	suspension	suspension	ADJ
aiol-6350	349	16	effect	effect	NOUN
aiol-6350	349	17	through	through	ADP
aiol-6350	349	18	the	the	DET
aiol-6350	349	19	sediment	sediment	NOUN
aiol-6350	349	20	but	but	CCONJ
aiol-6350	349	21	it	it	PRON
aiol-6350	349	22	is	be	AUX
aiol-6350	349	23	likely	likely	ADJ
aiol-6350	349	24	to	to	PART
aiol-6350	349	25	happen	happen	VERB
aiol-6350	349	26	(	(	PUNCT
aiol-6350	349	27	scheffer	scheffer	NOUN
aiol-6350	349	28	,	,	PUNCT
aiol-6350	349	29	2004	2004	NUM
aiol-6350	349	30	;	;	PUNCT
aiol-6350	349	31	christophoridis	christophoridis	PROPN
aiol-6350	349	32	et	et	PROPN
aiol-6350	349	33	.	.	PUNCT
aiol-6350	350	1	al	al	PROPN
aiol-6350	350	2	,	,	PUNCT
aiol-6350	350	3	2006	2006	NUM
aiol-6350	350	4	)	)	PUNCT
aiol-6350	350	5	since	since	SCONJ
aiol-6350	350	6	the	the	DET
aiol-6350	350	7	bottom	bottom	NOUN
aiol-6350	350	8	experienced	experience	VERB
aiol-6350	350	9	a	a	DET
aiol-6350	350	10	long	long	ADJ
aiol-6350	350	11	fertilization	fertilization	NOUN
aiol-6350	350	12	period	period	NOUN
aiol-6350	350	13	during	during	ADP
aiol-6350	350	14	the	the	DET
aiol-6350	350	15	dryness	dryness	NOUN
aiol-6350	350	16	time	time	NOUN
aiol-6350	350	17	.	.	PUNCT
aiol-6350	351	1	according	accord	VERB
aiol-6350	351	2	to	to	ADP
aiol-6350	351	3	the	the	DET
aiol-6350	351	4	present	present	ADJ
aiol-6350	351	5	nutrient	nutrient	NOUN
aiol-6350	351	6	and	and	CCONJ
aiol-6350	351	7	phytoplankton	phytoplankton	NOUN
aiol-6350	351	8	biomass	biomass	NOUN
aiol-6350	351	9	levels	level	NOUN
aiol-6350	351	10	,	,	PUNCT
aiol-6350	351	11	it	it	PRON
aiol-6350	351	12	becomes	become	VERB
aiol-6350	351	13	clear	clear	ADJ
aiol-6350	351	14	that	that	SCONJ
aiol-6350	351	15	lake	lake	PROPN
aiol-6350	351	16	karla	karla	PROPN
aiol-6350	351	17	is	be	AUX
aiol-6350	351	18	a	a	DET
aiol-6350	351	19	eutrophic	eutrophic	ADJ
aiol-6350	351	20	system	system	NOUN
aiol-6350	351	21	,	,	PUNCT
aiol-6350	351	22	with	with	ADP
aiol-6350	351	23	apparent	apparent	ADJ
aiol-6350	351	24	signals	signal	NOUN
aiol-6350	351	25	of	of	ADP
aiol-6350	351	26	hypertrophication	hypertrophication	NOUN
aiol-6350	351	27	during	during	ADP
aiol-6350	351	28	the	the	DET
aiol-6350	351	29	warm	warm	ADJ
aiol-6350	351	30	period	period	NOUN
aiol-6350	351	31	(	(	PUNCT
aiol-6350	351	32	chamoglou	chamoglou	NOUN
aiol-6350	351	33	et	et	PROPN
aiol-6350	351	34	al	al	PROPN
aiol-6350	351	35	.	.	PROPN
aiol-6350	351	36	,	,	PUNCT
aiol-6350	351	37	2014	2014	NUM
aiol-6350	351	38	;	;	PUNCT
aiol-6350	351	39	theologou	theologou	NOUN
aiol-6350	351	40	et	et	PROPN
aiol-6350	351	41	al	al	PROPN
aiol-6350	351	42	.	.	PROPN
aiol-6350	351	43	,	,	PUNCT
aiol-6350	351	44	2016	2016	NUM
aiol-6350	351	45	)	)	PUNCT
aiol-6350	351	46	.	.	PUNCT
aiol-6350	352	1	the	the	DET
aiol-6350	352	2	absence	absence	NOUN
aiol-6350	352	3	of	of	ADP
aiol-6350	352	4	any	any	DET
aiol-6350	352	5	outlet	outlet	NOUN
aiol-6350	352	6	,	,	PUNCT
aiol-6350	352	7	and	and	CCONJ
aiol-6350	352	8	thus	thus	ADV
aiol-6350	352	9	of	of	ADP
aiol-6350	352	10	any	any	DET
aiol-6350	352	11	flushing	flush	VERB
aiol-6350	352	12	process	process	NOUN
aiol-6350	352	13	,	,	PUNCT
aiol-6350	352	14	leads	lead	VERB
aiol-6350	352	15	to	to	ADP
aiol-6350	352	16	a	a	DET
aiol-6350	352	17	high	high	ADJ
aiol-6350	352	18	-	-	PUNCT
aiol-6350	352	19	water	water	NOUN
aiol-6350	352	20	residence	residence	NOUN
aiol-6350	352	21	time	time	NOUN
aiol-6350	352	22	,	,	PUNCT
aiol-6350	352	23	strengthening	strengthen	VERB
aiol-6350	352	24	the	the	DET
aiol-6350	352	25	eutrophic	eutrophic	ADJ
aiol-6350	352	26	conditions	condition	NOUN
aiol-6350	352	27	.	.	PUNCT
aiol-6350	353	1	in	in	ADP
aiol-6350	353	2	shallow	shallow	PROPN
aiol-6350	353	3	mediterranean	mediterranean	PROPN
aiol-6350	353	4	lakes	lake	NOUN
aiol-6350	353	5	,	,	PUNCT
aiol-6350	353	6	nutrient	nutrient	NOUN
aiol-6350	353	7	inputs	input	NOUN
aiol-6350	353	8	from	from	ADP
aiol-6350	353	9	the	the	DET
aiol-6350	353	10	catchment	catchment	NOUN
aiol-6350	353	11	occur	occur	VERB
aiol-6350	353	12	mainly	mainly	ADV
aiol-6350	353	13	in	in	ADP
aiol-6350	353	14	winter	winter	NOUN
aiol-6350	353	15	-	-	PUNCT
aiol-6350	353	16	spring	spring	NOUN
aiol-6350	353	17	due	due	ADP
aiol-6350	353	18	to	to	ADP
aiol-6350	353	19	high	high	ADJ
aiol-6350	353	20	precipitation	precipitation	NOUN
aiol-6350	353	21	,	,	PUNCT
aiol-6350	353	22	whereas	whereas	SCONJ
aiol-6350	353	23	when	when	SCONJ
aiol-6350	353	24	there	there	PRON
aiol-6350	353	25	is	be	VERB
aiol-6350	353	26	no	no	DET
aiol-6350	353	27	outflow	outflow	NOUN
aiol-6350	353	28	,	,	PUNCT
aiol-6350	353	29	they	they	PRON
aiol-6350	353	30	act	act	VERB
aiol-6350	353	31	as	as	ADP
aiol-6350	353	32	‘	'	PUNCT
aiol-6350	353	33	nutrient	nutrient	ADJ
aiol-6350	353	34	sinks	sink	NOUN
aiol-6350	353	35	’	'	PUNCT
aiol-6350	353	36	(	(	PUNCT
aiol-6350	353	37	chamoglou	chamoglou	NOUN
aiol-6350	353	38	et	et	PROPN
aiol-6350	353	39	al	al	PROPN
aiol-6350	353	40	.	.	PROPN
aiol-6350	353	41	,	,	PUNCT
aiol-6350	353	42	2014	2014	NUM
aiol-6350	353	43	)	)	PUNCT
aiol-6350	353	44	.	.	PUNCT
aiol-6350	354	1	the	the	DET
aiol-6350	354	2	reduction	reduction	NOUN
aiol-6350	354	3	of	of	ADP
aiol-6350	354	4	the	the	DET
aiol-6350	354	5	residence	residence	NOUN
aiol-6350	354	6	time	time	NOUN
aiol-6350	354	7	by	by	ADP
aiol-6350	354	8	regulating	regulate	VERB
aiol-6350	354	9	the	the	DET
aiol-6350	354	10	annual	annual	ADJ
aiol-6350	354	11	timing	timing	NOUN
aiol-6350	354	12	of	of	ADP
aiol-6350	354	13	the	the	DET
aiol-6350	354	14	inflows	inflow	NOUN
aiol-6350	354	15	and	and	CCONJ
aiol-6350	354	16	outflows	outflow	NOUN
aiol-6350	354	17	could	could	AUX
aiol-6350	354	18	certainly	certainly	ADV
aiol-6350	354	19	aim	aim	VERB
aiol-6350	354	20	at	at	ADP
aiol-6350	354	21	the	the	DET
aiol-6350	354	22	improvement	improvement	NOUN
aiol-6350	354	23	of	of	ADP
aiol-6350	354	24	water	water	NOUN
aiol-6350	354	25	quality	quality	NOUN
aiol-6350	354	26	in	in	ADP
aiol-6350	354	27	lake	lake	PROPN
aiol-6350	354	28	karla	karla	PROPN
aiol-6350	354	29	.	.	PUNCT
aiol-6350	355	1	this	this	PRON
aiol-6350	355	2	is	be	AUX
aiol-6350	355	3	considered	consider	VERB
aiol-6350	355	4	as	as	ADP
aiol-6350	355	5	an	an	DET
aiol-6350	355	6	emergent	emergent	ADJ
aiol-6350	355	7	issue	issue	NOUN
aiol-6350	355	8	concerning	concern	VERB
aiol-6350	355	9	the	the	DET
aiol-6350	355	10	future	future	ADJ
aiol-6350	355	11	management	management	NOUN
aiol-6350	355	12	process	process	NOUN
aiol-6350	355	13	.	.	PUNCT
aiol-6350	356	1	conclusions	conclusion	NOUN
aiol-6350	356	2	the	the	DET
aiol-6350	356	3	ecological	ecological	ADJ
aiol-6350	356	4	potential	potential	NOUN
aiol-6350	356	5	of	of	ADP
aiol-6350	356	6	lake	lake	PROPN
aiol-6350	356	7	karla	karla	PROPN
aiol-6350	356	8	and	and	CCONJ
aiol-6350	356	9	kalamaki	kalamaki	PROPN
aiol-6350	356	10	reservoir	reservoir	PROPN
aiol-6350	356	11	was	be	AUX
aiol-6350	356	12	less	less	ADJ
aiol-6350	356	13	than	than	ADP
aiol-6350	356	14	good	good	ADJ
aiol-6350	356	15	based	base	VERB
aiol-6350	356	16	on	on	ADP
aiol-6350	356	17	the	the	DET
aiol-6350	356	18	biological	biological	ADJ
aiol-6350	356	19	qualitative	qualitative	ADJ
aiol-6350	356	20	elements	element	NOUN
aiol-6350	356	21	(	(	PUNCT
aiol-6350	356	22	benthic	benthic	ADJ
aiol-6350	356	23	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	356	24	and	and	CCONJ
aiol-6350	356	25	mainly	mainly	ADV
aiol-6350	356	26	phytoplankton	phytoplankton	NOUN
aiol-6350	356	27	)	)	PUNCT
aiol-6350	356	28	and	and	CCONJ
aiol-6350	356	29	the	the	DET
aiol-6350	356	30	co	co	NOUN
aiol-6350	356	31	-	-	NOUN
aiol-6350	356	32	occurrence	occurrence	NOUN
aiol-6350	356	33	of	of	ADP
aiol-6350	356	34	multiple	multiple	ADJ
aiol-6350	356	35	cyanotoxins	cyanotoxin	NOUN
aiol-6350	356	36	,	,	PUNCT
aiol-6350	356	37	implying	imply	VERB
aiol-6350	356	38	an	an	DET
aiol-6350	356	39	intense	intense	ADJ
aiol-6350	356	40	deterioration	deterioration	NOUN
aiol-6350	356	41	of	of	ADP
aiol-6350	356	42	the	the	DET
aiol-6350	356	43	lake	lake	NOUN
aiol-6350	356	44	water	water	PROPN
aiol-6350	356	45	quality	quality	NOUN
aiol-6350	356	46	.	.	PUNCT
aiol-6350	357	1	our	our	PRON
aiol-6350	357	2	first	first	ADJ
aiol-6350	357	3	observations	observation	NOUN
aiol-6350	357	4	for	for	ADP
aiol-6350	357	5	this	this	DET
aiol-6350	357	6	deterioration	deterioration	NOUN
aiol-6350	357	7	,	,	PUNCT
aiol-6350	357	8	subject	subject	ADJ
aiol-6350	357	9	to	to	ADP
aiol-6350	357	10	further	further	ADJ
aiol-6350	357	11	investigation	investigation	NOUN
aiol-6350	357	12	,	,	PUNCT
aiol-6350	357	13	point	point	VERB
aiol-6350	357	14	to	to	ADP
aiol-6350	357	15	:	:	PUNCT
aiol-6350	357	16	i	i	X
aiol-6350	357	17	)	)	PUNCT
aiol-6350	357	18	the	the	DET
aiol-6350	357	19	quality	quality	NOUN
aiol-6350	357	20	of	of	ADP
aiol-6350	357	21	water	water	NOUN
aiol-6350	357	22	inflowing	inflowing	NOUN
aiol-6350	357	23	from	from	ADP
aiol-6350	357	24	the	the	DET
aiol-6350	357	25	ditches	ditch	NOUN
aiol-6350	357	26	to	to	ADP
aiol-6350	357	27	both	both	DET
aiol-6350	357	28	systems	system	NOUN
aiol-6350	357	29	,	,	PUNCT
aiol-6350	357	30	connected	connect	VERB
aiol-6350	357	31	to	to	ADP
aiol-6350	357	32	pinios	pinios	PROPN
aiol-6350	357	33	river	river	PROPN
aiol-6350	357	34	;	;	PUNCT
aiol-6350	357	35	ii	ii	X
aiol-6350	357	36	)	)	PUNCT
aiol-6350	357	37	the	the	DET
aiol-6350	357	38	quantitative	quantitative	ADJ
aiol-6350	357	39	management	management	NOUN
aiol-6350	357	40	of	of	ADP
aiol-6350	357	41	the	the	DET
aiol-6350	357	42	lake	lake	NOUN
aiol-6350	357	43	water	water	NOUN
aiol-6350	357	44	(	(	PUNCT
aiol-6350	357	45	i.e.	i.e.	X
aiol-6350	357	46	,	,	PUNCT
aiol-6350	357	47	the	the	DET
aiol-6350	357	48	irrigation	irrigation	NOUN
aiol-6350	357	49	/	/	SYM
aiol-6350	357	50	drainage	drainage	NOUN
aiol-6350	357	51	system	system	NOUN
aiol-6350	357	52	of	of	ADP
aiol-6350	357	53	karla	karla	PROPN
aiol-6350	357	54	’s	’s	PART
aiol-6350	357	55	basin	basin	NOUN
aiol-6350	357	56	via	via	ADP
aiol-6350	357	57	complex	complex	ADJ
aiol-6350	357	58	networks	network	NOUN
aiol-6350	357	59	and	and	CCONJ
aiol-6350	357	60	interaction	interaction	NOUN
aiol-6350	357	61	with	with	ADP
aiol-6350	357	62	fields	field	NOUN
aiol-6350	357	63	under	under	ADP
aiol-6350	357	64	intensive	intensive	ADJ
aiol-6350	357	65	agriculture	agriculture	NOUN
aiol-6350	357	66	)	)	PUNCT
aiol-6350	357	67	;	;	PUNCT
aiol-6350	357	68	and	and	CCONJ
aiol-6350	357	69	iii	iii	X
aiol-6350	357	70	)	)	PUNCT
aiol-6350	357	71	perhaps	perhaps	ADV
aiol-6350	357	72	the	the	DET
aiol-6350	357	73	absence	absence	NOUN
aiol-6350	357	74	of	of	ADP
aiol-6350	357	75	management	management	NOUN
aiol-6350	357	76	of	of	ADP
aiol-6350	357	77	the	the	DET
aiol-6350	357	78	reed	reed	NOUN
aiol-6350	357	79	bed	bed	NOUN
aiol-6350	357	80	in	in	ADP
aiol-6350	357	81	the	the	DET
aiol-6350	357	82	littoral	littoral	ADJ
aiol-6350	357	83	zone	zone	NOUN
aiol-6350	357	84	of	of	ADP
aiol-6350	357	85	the	the	DET
aiol-6350	357	86	lake	lake	NOUN
aiol-6350	357	87	.	.	PUNCT
aiol-6350	358	1	the	the	DET
aiol-6350	358	2	new	new	ADJ
aiol-6350	358	3	lake	lake	NOUN
aiol-6350	358	4	is	be	AUX
aiol-6350	358	5	in	in	ADP
aiol-6350	358	6	the	the	DET
aiol-6350	358	7	first	first	ADJ
aiol-6350	358	8	stage	stage	NOUN
aiol-6350	358	9	of	of	ADP
aiol-6350	358	10	water	water	NOUN
aiol-6350	358	11	filling	filling	NOUN
aiol-6350	358	12	and	and	CCONJ
aiol-6350	358	13	its	its	PRON
aiol-6350	358	14	wetland	wetland	NOUN
aiol-6350	358	15	systems	system	NOUN
aiol-6350	358	16	are	be	AUX
aiol-6350	358	17	not	not	PART
aiol-6350	358	18	yet	yet	ADV
aiol-6350	358	19	fully	fully	ADV
aiol-6350	358	20	functional	functional	ADJ
aiol-6350	358	21	in	in	ADP
aiol-6350	358	22	order	order	NOUN
aiol-6350	358	23	to	to	PART
aiol-6350	358	24	act	act	VERB
aiol-6350	358	25	as	as	ADP
aiol-6350	358	26	an	an	DET
aiol-6350	358	27	artificial	artificial	ADJ
aiol-6350	358	28	outflow	outflow	NOUN
aiol-6350	358	29	and	and	CCONJ
aiol-6350	358	30	reduce	reduce	VERB
aiol-6350	358	31	incoming	incoming	ADJ
aiol-6350	358	32	organic	organic	ADJ
aiol-6350	358	33	load	load	NOUN
aiol-6350	358	34	by	by	ADP
aiol-6350	358	35	abducting	abduct	VERB
aiol-6350	358	36	part	part	NOUN
aiol-6350	358	37	of	of	ADP
aiol-6350	358	38	the	the	DET
aiol-6350	358	39	lake	lake	NOUN
aiol-6350	358	40	’s	’s	PART
aiol-6350	358	41	water	water	NOUN
aiol-6350	358	42	through	through	ADP
aiol-6350	358	43	the	the	DET
aiol-6350	358	44	irrigation	irrigation	NOUN
aiol-6350	358	45	network	network	NOUN
aiol-6350	358	46	.	.	PUNCT
aiol-6350	359	1	a	a	DET
aiol-6350	359	2	permanent	permanent	ADJ
aiol-6350	359	3	quality	quality	NOUN
aiol-6350	359	4	and	and	CCONJ
aiol-6350	359	5	quantity	quantity	NOUN
aiol-6350	359	6	monitoring	monitor	VERB
aiol-6350	359	7	system	system	NOUN
aiol-6350	359	8	to	to	PART
aiol-6350	359	9	ensure	ensure	VERB
aiol-6350	359	10	immediate	immediate	ADJ
aiol-6350	359	11	intervention	intervention	NOUN
aiol-6350	359	12	when	when	SCONJ
aiol-6350	359	13	incoming	incoming	ADJ
aiol-6350	359	14	pollution	pollution	NOUN
aiol-6350	359	15	loads	load	NOUN
aiol-6350	359	16	are	be	AUX
aiol-6350	359	17	large	large	ADJ
aiol-6350	359	18	will	will	AUX
aiol-6350	359	19	help	help	VERB
aiol-6350	359	20	habitat	habitat	VERB
aiol-6350	359	21	protection	protection	NOUN
aiol-6350	359	22	in	in	ADP
aiol-6350	359	23	lake	lake	PROPN
aiol-6350	359	24	karla	karla	PROPN
aiol-6350	359	25	and	and	CCONJ
aiol-6350	359	26	kalamaki	kalamaki	PROPN
aiol-6350	359	27	reservoir	reservoir	PROPN
aiol-6350	359	28	.	.	PUNCT
aiol-6350	360	1	according	accord	VERB
aiol-6350	360	2	to	to	ADP
aiol-6350	360	3	the	the	DET
aiol-6350	360	4	national	national	ADJ
aiol-6350	360	5	management	management	NOUN
aiol-6350	360	6	plan	plan	NOUN
aiol-6350	360	7	(	(	PUNCT
aiol-6350	360	8	egy	egy	PROPN
aiol-6350	360	9	,	,	PUNCT
aiol-6350	360	10	2013	2013	NUM
aiol-6350	360	11	)	)	PUNCT
aiol-6350	360	12	,	,	PUNCT
aiol-6350	360	13	the	the	DET
aiol-6350	360	14	completion	completion	NOUN
aiol-6350	360	15	of	of	ADP
aiol-6350	360	16	works	work	NOUN
aiol-6350	360	17	rendering	render	VERB
aiol-6350	360	18	the	the	DET
aiol-6350	360	19	hydraulic	hydraulic	ADJ
aiol-6350	360	20	balance	balance	NOUN
aiol-6350	360	21	of	of	ADP
aiol-6350	360	22	karla	karla	NOUN
aiol-6350	360	23	and	and	CCONJ
aiol-6350	360	24	the	the	DET
aiol-6350	360	25	rationalisation	rationalisation	NOUN
aiol-6350	360	26	in	in	ADP
aiol-6350	360	27	the	the	DET
aiol-6350	360	28	consumption	consumption	NOUN
aiol-6350	360	29	of	of	ADP
aiol-6350	360	30	irrigatory	irrigatory	ADJ
aiol-6350	360	31	water	water	NOUN
aiol-6350	360	32	would	would	AUX
aiol-6350	360	33	help	help	VERB
aiol-6350	360	34	the	the	DET
aiol-6350	360	35	improvement	improvement	NOUN
aiol-6350	360	36	of	of	ADP
aiol-6350	360	37	the	the	DET
aiol-6350	360	38	water	water	NOUN
aiol-6350	360	39	quality	quality	NOUN
aiol-6350	360	40	and	and	CCONJ
aiol-6350	360	41	further	far	ADV
aiol-6350	360	42	the	the	DET
aiol-6350	360	43	ecological	ecological	ADJ
aiol-6350	360	44	status	status	NOUN
aiol-6350	360	45	.	.	PUNCT
aiol-6350	361	1	acknowledgments	acknowledgment	NOUN
aiol-6350	361	2	this	this	DET
aiol-6350	361	3	study	study	NOUN
aiol-6350	361	4	was	be	AUX
aiol-6350	361	5	partially	partially	ADV
aiol-6350	361	6	funded	fund	VERB
aiol-6350	361	7	by	by	ADP
aiol-6350	361	8	the	the	DET
aiol-6350	361	9	research	research	NOUN
aiol-6350	361	10	program	program	NOUN
aiol-6350	361	11	‘	'	PUNCT
aiol-6350	361	12	monitoring	monitoring	NOUN
aiol-6350	361	13	of	of	ADP
aiol-6350	361	14	water	water	NOUN
aiol-6350	361	15	quality	quality	NOUN
aiol-6350	361	16	parameters	parameter	NOUN
aiol-6350	361	17	’	'	PUNCT
aiol-6350	361	18	funded	fund	VERB
aiol-6350	361	19	by	by	ADP
aiol-6350	361	20	the	the	DET
aiol-6350	361	21	management	management	NOUN
aiol-6350	361	22	body	body	NOUN
aiol-6350	361	23	of	of	ADP
aiol-6350	361	24	ecodevelopment	ecodevelopment	NOUN
aiol-6350	361	25	area	area	NOUN
aiol-6350	361	26	of	of	ADP
aiol-6350	361	27	karla	karla	PROPN
aiol-6350	361	28	,	,	PUNCT
aiol-6350	361	29	mavrovouni	mavrovouni	NOUN
aiol-6350	361	30	,	,	PUNCT
aiol-6350	361	31	kefalovriso	kefalovriso	PROPN
aiol-6350	361	32	,	,	PUNCT
aiol-6350	361	33	velestino	velestino	PROPN
aiol-6350	361	34	,	,	PUNCT
aiol-6350	361	35	stefanovikio	stefanovikio	VERB
aiol-6350	361	36	(	(	PUNCT
aiol-6350	361	37	aristotle	aristotle	PROPN
aiol-6350	361	38	university	university	PROPN
aiol-6350	361	39	of	of	ADP
aiol-6350	361	40	thessaloniki	thessaloniki	PROPN
aiol-6350	361	41	research	research	PROPN
aiol-6350	361	42	committee	committee	PROPN
aiol-6350	361	43	contract	contract	NOUN
aiol-6350	361	44	no	no	DET
aiol-6350	361	45	89623	89623	NUM
aiol-6350	361	46	)	)	PUNCT
aiol-6350	361	47	and	and	CCONJ
aiol-6350	361	48	managed	manage	VERB
aiol-6350	361	49	by	by	ADP
aiol-6350	361	50	omikron	omikron	PROPN
aiol-6350	361	51	ltd	ltd	PROPN
aiol-6350	361	52	.	.	PUNCT
aiol-6350	362	1	the	the	DET
aiol-6350	362	2	authors	author	NOUN
aiol-6350	362	3	gratefully	gratefully	ADV
aiol-6350	362	4	acknowledge	acknowledge	VERB
aiol-6350	362	5	cyanocost	cyanocost	NOUN
aiol-6350	362	6	-	-	PUNCT
aiol-6350	362	7	cost	cost	NOUN
aiol-6350	362	8	es	es	NOUN
aiol-6350	362	9	1105	1105	NUM
aiol-6350	362	10	for	for	ADP
aiol-6350	362	11	sharing	sharing	NOUN
aiol-6350	362	12	of	of	ADP
aiol-6350	362	13	knowledge	knowledge	NOUN
aiol-6350	362	14	and	and	CCONJ
aiol-6350	362	15	networking	networking	NOUN
aiol-6350	362	16	.	.	PUNCT
aiol-6350	363	1	disclaimer	disclaimer	NOUN
aiol-6350	363	2	(	(	PUNCT
aiol-6350	363	3	t.	t.	NOUN
aiol-6350	363	4	kaloudis	kaloudis	PROPN
aiol-6350	363	5	):	):	PUNCT
aiol-6350	363	6	the	the	DET
aiol-6350	363	7	views	view	NOUN
aiol-6350	363	8	expressed	express	VERB
aiol-6350	363	9	in	in	ADP
aiol-6350	363	10	this	this	DET
aiol-6350	363	11	manuscript	manuscript	NOUN
aiol-6350	363	12	do	do	AUX
aiol-6350	363	13	not	not	PART
aiol-6350	363	14	necessarily	necessarily	ADV
aiol-6350	363	15	reflect	reflect	VERB
aiol-6350	363	16	the	the	DET
aiol-6350	363	17	views	view	NOUN
aiol-6350	363	18	of	of	ADP
aiol-6350	363	19	eydap	eydap	PROPN
aiol-6350	363	20	sa	sa	PROPN
aiol-6350	363	21	.	.	PUNCT
aiol-6350	364	1	author	author	PROPN
aiol-6350	364	2	contribution	contribution	PROPN
aiol-6350	364	3	:	:	PUNCT
aiol-6350	364	4	sg	sg	PROPN
aiol-6350	364	5	,	,	PUNCT
aiol-6350	364	6	ml	ml	NOUN
aiol-6350	364	7	,	,	PUNCT
aiol-6350	364	8	ik	ik	PROPN
aiol-6350	364	9	,	,	PUNCT
aiol-6350	364	10	conceived	conceive	VERB
aiol-6350	364	11	and	and	CCONJ
aiol-6350	364	12	designed	design	VERB
aiol-6350	364	13	the	the	DET
aiol-6350	364	14	study	study	NOUN
aiol-6350	364	15	;	;	PUNCT
aiol-6350	364	16	sg	sg	PROPN
aiol-6350	364	17	,	,	PUNCT
aiol-6350	364	18	ic	ic	PROPN
aiol-6350	364	19	,	,	PUNCT
aiol-6350	364	20	mp	mp	PROPN
aiol-6350	364	21	,	,	PUNCT
aiol-6350	364	22	collected	collect	VERB
aiol-6350	364	23	the	the	DET
aiol-6350	364	24	samples	sample	NOUN
aiol-6350	364	25	;	;	PUNCT
aiol-6350	364	26	ic	ic	PRON
aiol-6350	364	27	,	,	PUNCT
aiol-6350	364	28	performed	perform	VERB
aiol-6350	364	29	the	the	DET
aiol-6350	364	30	nutrients	nutrient	NOUN
aiol-6350	364	31	’	'	PUNCT
aiol-6350	364	32	analyses	analysis	NOUN
aiol-6350	364	33	;	;	PUNCT
aiol-6350	364	34	sg	sg	PROPN
aiol-6350	364	35	,	,	PUNCT
aiol-6350	364	36	mp	mp	PROPN
aiol-6350	364	37	,	,	PUNCT
aiol-6350	364	38	performed	perform	VERB
aiol-6350	364	39	the	the	DET
aiol-6350	364	40	phytoplankton	phytoplankton	NOUN
aiol-6350	364	41	,	,	PUNCT
aiol-6350	364	42	molecular	molecular	ADJ
aiol-6350	364	43	,	,	PUNCT
aiol-6350	364	44	and	and	CCONJ
aiol-6350	364	45	elisa	elisa	VERB
aiol-6350	364	46	analyses	analysis	NOUN
aiol-6350	364	47	;	;	PUNCT
aiol-6350	364	48	cn	cn	PROPN
aiol-6350	364	49	,	,	PUNCT
aiol-6350	364	50	performed	perform	VERB
aiol-6350	364	51	the	the	DET
aiol-6350	364	52	benthic	benthic	ADJ
aiol-6350	364	53	invertebrates	invertebrate	NOUN
aiol-6350	364	54	’	'	PUNCT
aiol-6350	364	55	analysis	analysis	NOUN
aiol-6350	364	56	;	;	PUNCT
aiol-6350	364	57	s	s	X
aiol-6350	364	58	-	-	PUNCT
aiol-6350	364	59	kz	kz	PROPN
aiol-6350	364	60	,	,	PUNCT
aiol-6350	364	61	cc	cc	PROPN
aiol-6350	364	62	,	,	PUNCT
aiol-6350	364	63	km	km	PROPN
aiol-6350	364	64	,	,	PUNCT
aiol-6350	364	65	tmt	tmt	PROPN
aiol-6350	364	66	,	,	PUNCT
aiol-6350	364	67	tk	tk	PROPN
aiol-6350	364	68	,	,	PUNCT
aiol-6350	364	69	ah	ah	INTJ
aiol-6350	364	70	,	,	PUNCT
aiol-6350	364	71	performed	perform	VERB
aiol-6350	364	72	the	the	DET
aiol-6350	364	73	lc	lc	PROPN
aiol-6350	364	74	-	-	PUNCT
aiol-6350	364	75	ms	ms	PROPN
aiol-6350	364	76	/	/	SYM
aiol-6350	364	77	ms	ms	PROPN
aiol-6350	364	78	analyses	analysis	NOUN
aiol-6350	364	79	;	;	PUNCT
aiol-6350	364	80	sg	sg	PROPN
aiol-6350	364	81	,	,	PUNCT
aiol-6350	364	82	mp	mp	PROPN
aiol-6350	364	83	,	,	PUNCT
aiol-6350	364	84	visualized	visualize	VERB
aiol-6350	364	85	the	the	DET
aiol-6350	364	86	data	datum	NOUN
aiol-6350	364	87	;	;	PUNCT
aiol-6350	364	88	sg	sg	AUX
aiol-6350	364	89	manuscript	manuscript	NOUN
aiol-6350	364	90	drafting	drafting	NOUN
aiol-6350	364	91	.	.	PUNCT
aiol-6350	365	1	all	all	DET
aiol-6350	365	2	authors	author	NOUN
aiol-6350	365	3	contributed	contribute	VERB
aiol-6350	365	4	in	in	ADP
aiol-6350	365	5	editing	editing	NOUN
aiol-6350	365	6	and/or	and/or	CCONJ
aiol-6350	365	7	reviewing	review	VERB
aiol-6350	365	8	the	the	DET
aiol-6350	365	9	manuscript	manuscript	NOUN
aiol-6350	365	10	.	.	PUNCT
aiol-6350	366	1	references	reference	NOUN
aiol-6350	366	2	ananiadis	ananiadis	PROPN
aiol-6350	366	3	ci	ci	PROPN
aiol-6350	366	4	,	,	PUNCT
aiol-6350	366	5	1956	1956	NUM
aiol-6350	366	6	.	.	PUNCT
aiol-6350	367	1	limnological	limnological	ADJ
aiol-6350	367	2	study	study	NOUN
aiol-6350	367	3	of	of	ADP
aiol-6350	367	4	lake	lake	PROPN
aiol-6350	367	5	karla	karla	PROPN
aiol-6350	367	6	.	.	PUNCT
aiol-6350	368	1	b.	b.	PROPN
aiol-6350	368	2	inst	inst	PROPN
aiol-6350	368	3	.	.	PUNCT
aiol-6350	369	1	ocean	ocean	NOUN
aiol-6350	369	2	.	.	PUNCT
aiol-6350	370	1	1083:1	1083:1	NUM
aiol-6350	370	2	-	-	SYM
aiol-6350	370	3	19	19	NUM
aiol-6350	370	4	.	.	PUNCT
aiol-6350	371	1	armitage	armitage	PROPN
aiol-6350	371	2	pd	pd	PROPN
aiol-6350	371	3	,	,	PUNCT
aiol-6350	371	4	hogger	hogger	PROPN
aiol-6350	371	5	j	j	PROPN
aiol-6350	371	6	,	,	PUNCT
aiol-6350	371	7	1994	1994	NUM
aiol-6350	371	8	.	.	PUNCT
aiol-6350	371	9	invertebrates	invertebrate	VERB
aiol-6350	371	10	ecology	ecology	NOUN
aiol-6350	371	11	and	and	CCONJ
aiol-6350	371	12	methods	method	NOUN
aiol-6350	371	13	of	of	ADP
aiol-6350	371	14	survey	survey	NOUN
aiol-6350	371	15	,	,	PUNCT
aiol-6350	371	16	p.	p.	NOUN
aiol-6350	371	17	85	85	NUM
aiol-6350	371	18	-	-	SYM
aiol-6350	371	19	97	97	NUM
aiol-6350	371	20	,	,	PUNCT
aiol-6350	371	21	151	151	NUM
aiol-6350	371	22	-	-	SYM
aiol-6350	371	23	159	159	NUM
aiol-6350	371	24	.	.	PUNCT
aiol-6350	372	1	in	in	ADP
aiol-6350	372	2	:	:	PUNCT
aiol-6350	372	3	n.	n.	PROPN
aiol-6350	372	4	holmes	holmes	PROPN
aiol-6350	372	5	,	,	PUNCT
aiol-6350	372	6	d.	d.	PROPN
aiol-6350	372	7	ward	ward	PROPN
aiol-6350	372	8	and	and	CCONJ
aiol-6350	372	9	p.	p.	PROPN
aiol-6350	372	10	jose	jose	PROPN
aiol-6350	372	11	,	,	PUNCT
aiol-6350	372	12	the	the	DET
aiol-6350	372	13	new	new	ADJ
aiol-6350	372	14	rivers	river	NOUN
aiol-6350	372	15	and	and	CCONJ
aiol-6350	372	16	wildlife	wildlife	NOUN
aiol-6350	372	17	handbook	handbook	NOUN
aiol-6350	372	18	.	.	PUNCT
aiol-6350	373	1	rspb	rspb	PROPN
aiol-6350	373	2	sandy	sandy	PROPN
aiol-6350	373	3	bedfordshire	bedfordshire	PROPN
aiol-6350	373	4	uk	uk	PROPN
aiol-6350	373	5	:	:	PUNCT
aiol-6350	373	6	426	426	NUM
aiol-6350	373	7	pp	pp	ADJ
aiol-6350	373	8	.	.	PUNCT
aiol-6350	374	1	atashpaz	atashpaz	PROPN
aiol-6350	375	1	s	s	PROPN
aiol-6350	375	2	,	,	PUNCT
aiol-6350	375	3	khani	khani	PROPN
aiol-6350	375	4	s	s	PROPN
aiol-6350	375	5	,	,	PUNCT
aiol-6350	375	6	barzegari	barzegari	PRON
aiol-6350	375	7	a	a	X
aiol-6350	375	8	,	,	PUNCT
aiol-6350	375	9	barar	barar	PROPN
aiol-6350	375	10	j	j	PROPN
aiol-6350	375	11	,	,	PUNCT
aiol-6350	375	12	vahed	vahe	VERB
aiol-6350	375	13	sz	sz	PROPN
aiol-6350	375	14	,	,	PUNCT
aiol-6350	375	15	azarbaijani	azarbaijani	ADJ
aiol-6350	375	16	r	r	NOUN
aiol-6350	375	17	,	,	PUNCT
aiol-6350	375	18	omidi	omidi	VERB
aiol-6350	375	19	y	y	PROPN
aiol-6350	375	20	,	,	PUNCT
aiol-6350	375	21	2010	2010	NUM
aiol-6350	375	22	.	.	PUNCT
aiol-6350	376	1	a	a	DET
aiol-6350	376	2	robust	robust	ADJ
aiol-6350	376	3	universal	universal	ADJ
aiol-6350	376	4	method	method	NOUN
aiol-6350	376	5	for	for	ADP
aiol-6350	376	6	extraction	extraction	NOUN
aiol-6350	376	7	of	of	ADP
aiol-6350	376	8	genomic	genomic	ADJ
aiol-6350	376	9	dna	dna	NOUN
aiol-6350	376	10	from	from	ADP
aiol-6350	376	11	bacterial	bacterial	ADJ
aiol-6350	376	12	species	specie	NOUN
aiol-6350	376	13	.	.	PUNCT
aiol-6350	377	1	microbiology	microbiology	NOUN
aiol-6350	377	2	79:538	79:538	NOUN
aiol-6350	377	3	-	-	SYM
aiol-6350	377	4	542	542	NUM
aiol-6350	377	5	.	.	PUNCT
aiol-6350	378	1	ballot	ballot	NOUN
aiol-6350	378	2	a	a	PRON
aiol-6350	378	3	,	,	PUNCT
aiol-6350	378	4	fastner	fastner	NOUN
aiol-6350	378	5	j	j	PROPN
aiol-6350	378	6	,	,	PUNCT
aiol-6350	378	7	wiedner	wiedner	NOUN
aiol-6350	378	8	c	c	NOUN
aiol-6350	378	9	,	,	PUNCT
aiol-6350	378	10	2010	2010	NUM
aiol-6350	378	11	.	.	PUNCT
aiol-6350	379	1	paralytic	paralytic	ADJ
aiol-6350	379	2	shellfish	shellfish	NOUN
aiol-6350	379	3	poisoning	poisoning	NOUN
aiol-6350	379	4	toxin	toxin	NOUN
aiol-6350	379	5	-	-	PUNCT
aiol-6350	379	6	producing	produce	VERB
aiol-6350	379	7	cyanobacterium	cyanobacterium	NOUN
aiol-6350	379	8	aphanizomenon	aphanizomenon	NOUN
aiol-6350	379	9	gracile	gracile	NOUN
aiol-6350	379	10	in	in	ADP
aiol-6350	379	11	northeast	northeast	PROPN
aiol-6350	379	12	germany	germany	PROPN
aiol-6350	379	13	.	.	PUNCT
aiol-6350	380	1	appl	appl	PROPN
aiol-6350	380	2	.	.	PUNCT
aiol-6350	381	1	environ	environ	PROPN
aiol-6350	381	2	.	.	PUNCT
aiol-6350	381	3	microbiol	microbiol	PROPN
aiol-6350	381	4	.	.	PUNCT
aiol-6350	382	1	76:1173	76:1173	PROPN
aiol-6350	382	2	-	-	PUNCT
aiol-6350	382	3	1180	1180	NUM
aiol-6350	382	4	.	.	PUNCT
aiol-6350	383	1	bartram	bartram	PROPN
aiol-6350	383	2	j	j	PROPN
aiol-6350	383	3	,	,	PUNCT
aiol-6350	383	4	burch	burch	PROPN
aiol-6350	383	5	m	m	PROPN
aiol-6350	383	6	,	,	PUNCT
aiol-6350	383	7	falconer	falconer	NOUN
aiol-6350	383	8	ir	ir	PROPN
aiol-6350	383	9	,	,	PUNCT
aiol-6350	383	10	jones	jones	PROPN
aiol-6350	383	11	g	g	PROPN
aiol-6350	383	12	,	,	PUNCT
aiol-6350	383	13	kuiper	kuiper	PROPN
aiol-6350	383	14	-	-	PROPN
aiol-6350	383	15	goodman	goodman	PROPN
aiol-6350	383	16	t	t	PROPN
aiol-6350	383	17	,	,	PUNCT
aiol-6350	383	18	1999	1999	NUM
aiol-6350	383	19	.	.	PUNCT
aiol-6350	384	1	situation	situation	NOUN
aiol-6350	384	2	assessment	assessment	NOUN
aiol-6350	384	3	,	,	PUNCT
aiol-6350	384	4	planning	planning	NOUN
aiol-6350	384	5	and	and	CCONJ
aiol-6350	384	6	management	management	NOUN
aiol-6350	384	7	,	,	PUNCT
aiol-6350	384	8	pp	pp	ADP
aiol-6350	384	9	.	.	PUNCT
aiol-6350	385	1	179	179	NUM
aiol-6350	385	2	-	-	SYM
aiol-6350	385	3	209	209	NUM
aiol-6350	385	4	.	.	PUNCT
aiol-6350	386	1	in	in	ADP
aiol-6350	386	2	:	:	PUNCT
aiol-6350	386	3	i.	i.	NOUN
aiol-6350	386	4	chorus	chorus	PROPN
aiol-6350	386	5	and	and	CCONJ
aiol-6350	386	6	j.	j.	PROPN
aiol-6350	386	7	bartram	bartram	PROPN
aiol-6350	386	8	(	(	PUNCT
aiol-6350	386	9	eds	eds	PROPN
aiol-6350	386	10	.	.	PUNCT
aiol-6350	386	11	)	)	PUNCT
aiol-6350	386	12	,	,	PUNCT
aiol-6350	386	13	toxic	toxic	ADJ
aiol-6350	386	14	cyanobacteria	cyanobacteria	NOUN
aiol-6350	386	15	in	in	ADP
aiol-6350	386	16	water	water	NOUN
aiol-6350	386	17	.	.	PUNCT
aiol-6350	387	1	1st	1st	ADJ
aiol-6350	387	2	ed	ed	NOUN
aiol-6350	387	3	.	.	PUNCT
aiol-6350	388	1	world	world	PROPN
aiol-6350	388	2	health	health	PROPN
aiol-6350	388	3	organization	organization	PROPN
aiol-6350	388	4	,	,	PUNCT
aiol-6350	388	5	e.	e.	PROPN
aiol-6350	388	6	&	&	CCONJ
aiol-6350	388	7	f.n	f.n	PROPN
aiol-6350	388	8	.	.	PROPN
aiol-6350	388	9	spon	spon	PROPN
aiol-6350	388	10	.	.	PUNCT
aiol-6350	389	1	beklioglu	beklioglu	PROPN
aiol-6350	389	2	m	m	PROPN
aiol-6350	389	3	,	,	PUNCT
aiol-6350	389	4	romo	romo	PROPN
aiol-6350	389	5	s	s	PROPN
aiol-6350	389	6	,	,	PUNCT
aiol-6350	389	7	kagalou	kagalou	PROPN
aiol-6350	389	8	i	i	PRON
aiol-6350	389	9	,	,	PUNCT
aiol-6350	389	10	quintana	quintana	PROPN
aiol-6350	389	11	x	x	PROPN
aiol-6350	389	12	,	,	PUNCT
aiol-6350	389	13	becares	becare	VERB
aiol-6350	389	14	e	e	NOUN
aiol-6350	389	15	,	,	PUNCT
aiol-6350	389	16	2007	2007	NUM
aiol-6350	389	17	.	.	PUNCT
aiol-6350	390	1	state	state	NOUN
aiol-6350	390	2	of	of	ADP
aiol-6350	390	3	the	the	DET
aiol-6350	390	4	art	art	NOUN
aiol-6350	390	5	in	in	ADP
aiol-6350	390	6	the	the	DET
aiol-6350	390	7	functioning	functioning	NOUN
aiol-6350	390	8	of	of	ADP
aiol-6350	390	9	shallow	shallow	ADJ
aiol-6350	390	10	mediterranean	mediterranean	PROPN
aiol-6350	390	11	lakes	lake	NOUN
aiol-6350	390	12	:	:	PUNCT
aiol-6350	390	13	workshop	workshop	NOUN
aiol-6350	390	14	conclusions	conclusion	NOUN
aiol-6350	390	15	.	.	PUNCT
aiol-6350	391	1	hydrobiologia	hydrobiologia	VERB
aiol-6350	391	2	584:317	584:317	ADJ
aiol-6350	391	3	-	-	PUNCT
aiol-6350	391	4	26	26	NUM
aiol-6350	391	5	.	.	PUNCT
aiol-6350	392	1	water	water	NOUN
aiol-6350	392	2	quality	quality	NOUN
aiol-6350	392	3	and	and	CCONJ
aiol-6350	392	4	cyanotoxins	cyanotoxin	NOUN
aiol-6350	392	5	in	in	ADP
aiol-6350	392	6	the	the	DET
aiol-6350	392	7	reconstructed	reconstructed	ADJ
aiol-6350	392	8	lake	lake	NOUN
aiol-6350	392	9	karla	karla	PROPN
aiol-6350	392	10	49	49	NUM
aiol-6350	392	11	berry	berry	NOUN
aiol-6350	392	12	jp	jp	NOUN
aiol-6350	392	13	,	,	PUNCT
aiol-6350	392	14	lind	lind	PROPN
aiol-6350	392	15	o	o	PROPN
aiol-6350	392	16	,	,	PUNCT
aiol-6350	392	17	2010	2010	NUM
aiol-6350	392	18	.	.	PUNCT
aiol-6350	393	1	first	first	ADJ
aiol-6350	393	2	evidence	evidence	NOUN
aiol-6350	393	3	of	of	ADP
aiol-6350	393	4	“	"	PUNCT
aiol-6350	393	5	paralytic	paralytic	ADJ
aiol-6350	393	6	shellfish	shellfish	NOUN
aiol-6350	393	7	toxins	toxin	NOUN
aiol-6350	393	8	”	"	PUNCT
aiol-6350	393	9	and	and	CCONJ
aiol-6350	393	10	cylindrospermopsin	cylindrospermopsin	VERB
aiol-6350	393	11	in	in	ADP
aiol-6350	393	12	a	a	DET
aiol-6350	393	13	mexican	mexican	ADJ
aiol-6350	393	14	freshwater	freshwater	NOUN
aiol-6350	393	15	system	system	NOUN
aiol-6350	393	16	,	,	PUNCT
aiol-6350	393	17	lago	lago	NOUN
aiol-6350	393	18	catemaco	catemaco	NOUN
aiol-6350	393	19	,	,	PUNCT
aiol-6350	393	20	and	and	CCONJ
aiol-6350	393	21	apparent	apparent	ADJ
aiol-6350	393	22	bioaccumulation	bioaccumulation	NOUN
aiol-6350	393	23	of	of	ADP
aiol-6350	393	24	the	the	DET
aiol-6350	393	25	toxins	toxin	NOUN
aiol-6350	393	26	in	in	ADP
aiol-6350	393	27	“	"	PUNCT
aiol-6350	393	28	tegogolo	tegogolo	ADJ
aiol-6350	393	29	”	"	PUNCT
aiol-6350	393	30	snails	snail	NOUN
aiol-6350	393	31	(	(	PUNCT
aiol-6350	393	32	pomacea	pomacea	PROPN
aiol-6350	393	33	patula	patula	NOUN
aiol-6350	393	34	catemacensis	catemacensis	NOUN
aiol-6350	393	35	)	)	PUNCT
aiol-6350	393	36	.	.	PUNCT
aiol-6350	394	1	toxicon	toxicon	NOUN
aiol-6350	394	2	55:930	55:930	NUM
aiol-6350	394	3	-	-	SYM
aiol-6350	394	4	938	938	NUM
aiol-6350	394	5	.	.	PUNCT
aiol-6350	395	1	boopathi	boopathi	PROPN
aiol-6350	395	2	t	t	PROPN
aiol-6350	395	3	,	,	PUNCT
aiol-6350	395	4	ki	ki	PROPN
aiol-6350	395	5	j	j	PROPN
aiol-6350	395	6	-	-	PUNCT
aiol-6350	395	7	s	s	PROPN
aiol-6350	395	8	,	,	PUNCT
aiol-6350	395	9	2014	2014	NUM
aiol-6350	395	10	.	.	PUNCT
aiol-6350	396	1	impact	impact	NOUN
aiol-6350	396	2	of	of	ADP
aiol-6350	396	3	environmental	environmental	ADJ
aiol-6350	396	4	factors	factor	NOUN
aiol-6350	396	5	on	on	ADP
aiol-6350	396	6	the	the	DET
aiol-6350	396	7	regulation	regulation	NOUN
aiol-6350	396	8	of	of	ADP
aiol-6350	396	9	cyanotoxin	cyanotoxin	NOUN
aiol-6350	396	10	production	production	NOUN
aiol-6350	396	11	.	.	PUNCT
aiol-6350	397	1	toxins	toxin	NOUN
aiol-6350	397	2	6:1951	6:1951	NOUN
aiol-6350	397	3	-	-	SYM
aiol-6350	397	4	1978	1978	NUM
aiol-6350	397	5	.	.	PUNCT
aiol-6350	398	1	bormans	bormans	PROPN
aiol-6350	398	2	m	m	PROPN
aiol-6350	398	3	,	,	PUNCT
aiol-6350	398	4	lengronne	lengronne	PROPN
aiol-6350	398	5	m	m	PROPN
aiol-6350	398	6	,	,	PUNCT
aiol-6350	398	7	brient	brient	PROPN
aiol-6350	398	8	l	l	PROPN
aiol-6350	398	9	,	,	PUNCT
aiol-6350	398	10	duval	duval	PROPN
aiol-6350	398	11	c	c	PROPN
aiol-6350	398	12	,	,	PUNCT
aiol-6350	398	13	2014	2014	NUM
aiol-6350	398	14	.	.	PUNCT
aiol-6350	399	1	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	399	2	accumulation	accumulation	NOUN
aiol-6350	399	3	and	and	CCONJ
aiol-6350	399	4	release	release	NOUN
aiol-6350	399	5	by	by	ADP
aiol-6350	399	6	the	the	DET
aiol-6350	399	7	benthic	benthic	ADJ
aiol-6350	399	8	cyanobacterium	cyanobacterium	NOUN
aiol-6350	399	9	oscillatoria	oscillatoria	PROPN
aiol-6350	399	10	sp	sp	PROPN
aiol-6350	399	11	.	.	PUNCT
aiol-6350	399	12	pcc	pcc	PROPN
aiol-6350	399	13	6506	6506	NUM
aiol-6350	399	14	under	under	ADP
aiol-6350	399	15	different	different	ADJ
aiol-6350	399	16	light	light	ADJ
aiol-6350	399	17	conditions	condition	NOUN
aiol-6350	399	18	and	and	CCONJ
aiol-6350	399	19	growth	growth	NOUN
aiol-6350	399	20	phases	phase	NOUN
aiol-6350	399	21	.	.	PUNCT
aiol-6350	400	1	bull	bull	NOUN
aiol-6350	400	2	.	.	PUNCT
aiol-6350	401	1	environ	environ	PROPN
aiol-6350	401	2	.	.	PUNCT
aiol-6350	401	3	contam	contam	PROPN
aiol-6350	401	4	.	.	PUNCT
aiol-6350	402	1	toxicol	toxicol	PROPN
aiol-6350	402	2	.	.	PUNCT
aiol-6350	403	1	92:243	92:243	NUM
aiol-6350	403	2	-	-	PUNCT
aiol-6350	403	3	247	247	NUM
aiol-6350	403	4	.	.	PUNCT
aiol-6350	404	1	brient	brient	PROPN
aiol-6350	404	2	l	l	PROPN
aiol-6350	404	3	,	,	PUNCT
aiol-6350	404	4	lengronne	lengronne	PROPN
aiol-6350	404	5	m	m	PROPN
aiol-6350	404	6	,	,	PUNCT
aiol-6350	404	7	bormans	bormans	PROPN
aiol-6350	404	8	m	m	PROPN
aiol-6350	404	9	,	,	PUNCT
aiol-6350	404	10	fastner	fastner	PROPN
aiol-6350	404	11	j	j	PROPN
aiol-6350	404	12	,	,	PUNCT
aiol-6350	404	13	2009	2009	NUM
aiol-6350	404	14	.	.	PUNCT
aiol-6350	405	1	first	first	ADJ
aiol-6350	405	2	occurrence	occurrence	NOUN
aiol-6350	405	3	of	of	ADP
aiol-6350	405	4	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	405	5	in	in	ADP
aiol-6350	405	6	freshwater	freshwater	NOUN
aiol-6350	405	7	in	in	ADP
aiol-6350	405	8	france	france	PROPN
aiol-6350	405	9	.	.	PUNCT
aiol-6350	406	1	environ	environ	PROPN
aiol-6350	406	2	.	.	PUNCT
aiol-6350	407	1	toxicol	toxicol	PROPN
aiol-6350	407	2	.	.	PUNCT
aiol-6350	408	1	24:415	24:415	NUM
aiol-6350	408	2	-	-	SYM
aiol-6350	408	3	420	420	NUM
aiol-6350	408	4	.	.	PUNCT
aiol-6350	409	1	chamoglou	chamoglou	PROPN
aiol-6350	409	2	m	m	PROPN
aiol-6350	409	3	,	,	PUNCT
aiol-6350	409	4	papadimitriou	papadimitriou	VERB
aiol-6350	409	5	t	t	PROPN
aiol-6350	409	6	,	,	PUNCT
aiol-6350	409	7	kagalou	kagalou	PROPN
aiol-6350	409	8	i	i	PROPN
aiol-6350	409	9	,	,	PUNCT
aiol-6350	409	10	2014	2014	NUM
aiol-6350	409	11	.	.	PUNCT
aiol-6350	410	1	keys	key	NOUN
aiol-6350	410	2	-	-	VERB
aiol-6350	410	3	descriptors	descriptor	NOUN
aiol-6350	410	4	for	for	ADP
aiol-6350	410	5	the	the	DET
aiol-6350	410	6	functioning	functioning	NOUN
aiol-6350	410	7	of	of	ADP
aiol-6350	410	8	a	a	DET
aiol-6350	410	9	mediterranean	mediterranean	PROPN
aiol-6350	410	10	reservoir	reservoir	NOUN
aiol-6350	410	11	:	:	PUNCT
aiol-6350	410	12	the	the	DET
aiol-6350	410	13	case	case	NOUN
aiol-6350	410	14	of	of	ADP
aiol-6350	410	15	a	a	DET
aiol-6350	410	16	new	new	ADJ
aiol-6350	410	17	lake	lake	NOUN
aiol-6350	410	18	karla	karla	PROPN
aiol-6350	410	19	-	-	PUNCT
aiol-6350	410	20	greece	greece	PROPN
aiol-6350	410	21	.	.	PUNCT
aiol-6350	411	1	environ	environ	PROPN
aiol-6350	411	2	.	.	PUNCT
aiol-6350	411	3	process	process	NOUN
aiol-6350	411	4	.	.	PUNCT
aiol-6350	412	1	1:127	1:127	NUM
aiol-6350	412	2	-	-	SYM
aiol-6350	412	3	135	135	NUM
aiol-6350	412	4	.	.	PUNCT
aiol-6350	413	1	christophoridis	christophoridi	NOUN
aiol-6350	413	2	c	c	PROPN
aiol-6350	413	3	,	,	PUNCT
aiol-6350	413	4	fytianos	fytianos	PROPN
aiol-6350	413	5	k	k	PROPN
aiol-6350	413	6	2006	2006	NUM
aiol-6350	413	7	.	.	PUNCT
aiol-6350	414	1	conditions	condition	NOUN
aiol-6350	414	2	affecting	affect	VERB
aiol-6350	414	3	the	the	DET
aiol-6350	414	4	release	release	NOUN
aiol-6350	414	5	of	of	ADP
aiol-6350	414	6	phosphorus	phosphorus	NOUN
aiol-6350	414	7	from	from	ADP
aiol-6350	414	8	surface	surface	NOUN
aiol-6350	414	9	lake	lake	PROPN
aiol-6350	414	10	sediments	sediment	NOUN
aiol-6350	414	11	.	.	PUNCT
aiol-6350	415	1	j.	j.	PROPN
aiol-6350	415	2	environ	environ	PROPN
aiol-6350	415	3	.	.	PUNCT
aiol-6350	416	1	qual	qual	PROPN
aiol-6350	416	2	.	.	PUNCT
aiol-6350	417	1	35:1181	35:1181	NUM
aiol-6350	417	2	-	-	SYM
aiol-6350	417	3	1192	1192	NUM
aiol-6350	417	4	.	.	PUNCT
aiol-6350	418	1	cirés	cirés	PROPN
aiol-6350	418	2	s	s	PART
aiol-6350	418	3	,	,	PUNCT
aiol-6350	418	4	ballot	ballot	NOUN
aiol-6350	418	5	a	a	DET
aiol-6350	418	6	,	,	PUNCT
aiol-6350	418	7	2016	2016	NUM
aiol-6350	418	8	.	.	PUNCT
aiol-6350	419	1	a	a	DET
aiol-6350	419	2	review	review	NOUN
aiol-6350	419	3	of	of	ADP
aiol-6350	419	4	the	the	DET
aiol-6350	419	5	phylogeny	phylogeny	NOUN
aiol-6350	419	6	,	,	PUNCT
aiol-6350	419	7	ecology	ecology	NOUN
aiol-6350	419	8	and	and	CCONJ
aiol-6350	419	9	toxin	toxin	NOUN
aiol-6350	419	10	production	production	NOUN
aiol-6350	419	11	of	of	ADP
aiol-6350	419	12	bloom	bloom	NOUN
aiol-6350	419	13	-	-	PUNCT
aiol-6350	419	14	forming	form	VERB
aiol-6350	419	15	aphanizomenon	aphanizomenon	NOUN
aiol-6350	419	16	spp	spp	NOUN
aiol-6350	419	17	.	.	PUNCT
aiol-6350	420	1	and	and	CCONJ
aiol-6350	420	2	related	related	ADJ
aiol-6350	420	3	species	specie	NOUN
aiol-6350	420	4	within	within	ADP
aiol-6350	420	5	the	the	DET
aiol-6350	420	6	nostocales	nostocale	NOUN
aiol-6350	420	7	(	(	PUNCT
aiol-6350	420	8	cyanobacteria	cyanobacteria	NOUN
aiol-6350	420	9	)	)	PUNCT
aiol-6350	420	10	.	.	PUNCT
aiol-6350	421	1	harmful	harmful	ADJ
aiol-6350	421	2	algae	algae	NOUN
aiol-6350	421	3	54:21	54:21	NUM
aiol-6350	421	4	-	-	SYM
aiol-6350	421	5	43cirés	43cirés	NUM
aiol-6350	421	6	s	s	NOUN
aiol-6350	421	7	,	,	PUNCT
aiol-6350	421	8	wörmer	wörmer	NOUN
aiol-6350	421	9	l	l	NOUN
aiol-6350	421	10	,	,	PUNCT
aiol-6350	421	11	ballot	ballot	NOUN
aiol-6350	421	12	a	a	PRON
aiol-6350	421	13	,	,	PUNCT
aiol-6350	421	14	agha	agha	PROPN
aiol-6350	421	15	r	r	NOUN
aiol-6350	421	16	,	,	PUNCT
aiol-6350	421	17	wiedner	wiedner	NOUN
aiol-6350	421	18	c	c	NOUN
aiol-6350	421	19	,	,	PUNCT
aiol-6350	421	20	velázquez	velázquez	NOUN
aiol-6350	421	21	d	d	PROPN
aiol-6350	421	22	,	,	PUNCT
aiol-6350	421	23	casero	casero	PROPN
aiol-6350	421	24	mc	mc	PROPN
aiol-6350	421	25	,	,	PUNCT
aiol-6350	421	26	quesada	quesada	PROPN
aiol-6350	421	27	a	a	PROPN
aiol-6350	421	28	,	,	PUNCT
aiol-6350	421	29	2014	2014	NUM
aiol-6350	421	30	.	.	PUNCT
aiol-6350	422	1	phylogeography	phylogeography	NOUN
aiol-6350	422	2	of	of	ADP
aiol-6350	422	3	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	422	4	and	and	CCONJ
aiol-6350	422	5	paralytic	paralytic	ADJ
aiol-6350	422	6	shellfish	shellfish	NOUN
aiol-6350	422	7	toxin	toxin	NOUN
aiol-6350	422	8	-	-	PUNCT
aiol-6350	422	9	producing	produce	VERB
aiol-6350	422	10	nostocales	nostocale	NOUN
aiol-6350	422	11	cyanobacteria	cyanobacteria	NOUN
aiol-6350	422	12	from	from	ADP
aiol-6350	422	13	mediterranean	mediterranean	PROPN
aiol-6350	422	14	europe	europe	PROPN
aiol-6350	422	15	(	(	PUNCT
aiol-6350	422	16	spain	spain	PROPN
aiol-6350	422	17	)	)	PUNCT
aiol-6350	422	18	.	.	PUNCT
aiol-6350	423	1	appl	appl	PROPN
aiol-6350	423	2	.	.	PUNCT
aiol-6350	424	1	environ	environ	PROPN
aiol-6350	424	2	.	.	PUNCT
aiol-6350	424	3	microbiol	microbiol	PROPN
aiol-6350	424	4	.	.	PUNCT
aiol-6350	425	1	80:1359	80:1359	NUM
aiol-6350	425	2	-	-	SYM
aiol-6350	425	3	1370	1370	NUM
aiol-6350	425	4	.	.	PUNCT
aiol-6350	426	1	codd	codd	PROPN
aiol-6350	426	2	ga	ga	PROPN
aiol-6350	426	3	,	,	PUNCT
aiol-6350	426	4	lindsay	lindsay	PROPN
aiol-6350	426	5	j	j	PROPN
aiol-6350	426	6	,	,	PUNCT
aiol-6350	426	7	young	young	PROPN
aiol-6350	426	8	fm	fm	PROPN
aiol-6350	426	9	,	,	PUNCT
aiol-6350	426	10	morrison	morrison	PROPN
aiol-6350	426	11	lf	lf	PROPN
aiol-6350	426	12	,	,	PUNCT
aiol-6350	426	13	metcalf	metcalf	PROPN
aiol-6350	426	14	js	js	PROPN
aiol-6350	426	15	,	,	PUNCT
aiol-6350	426	16	2005	2005	NUM
aiol-6350	426	17	.	.	PUNCT
aiol-6350	427	1	harmful	harmful	ADJ
aiol-6350	427	2	cyanobacteria	cyanobacteria	NOUN
aiol-6350	427	3	:	:	PUNCT
aiol-6350	427	4	from	from	ADP
aiol-6350	427	5	mass	mass	ADJ
aiol-6350	427	6	mortalities	mortality	NOUN
aiol-6350	427	7	to	to	ADP
aiol-6350	427	8	management	management	NOUN
aiol-6350	427	9	measures	measure	NOUN
aiol-6350	427	10	,	,	PUNCT
aiol-6350	427	11	p.	p.	NOUN
aiol-6350	427	12	1	1	NUM
aiol-6350	427	13	-	-	SYM
aiol-6350	427	14	23	23	NUM
aiol-6350	427	15	.	.	PUNCT
aiol-6350	428	1	in	in	ADP
aiol-6350	428	2	:	:	PUNCT
aiol-6350	428	3	j.	j.	PROPN
aiol-6350	428	4	huisman	huisman	PROPN
aiol-6350	428	5	,	,	PUNCT
aiol-6350	428	6	h.c.p	h.c.p	PROPN
aiol-6350	428	7	.	.	PUNCT
aiol-6350	428	8	matthijs	matthijs	PROPN
aiol-6350	428	9	,	,	PUNCT
aiol-6350	428	10	p.m.	p.m.	NOUN
aiol-6350	428	11	visser	visser	NOUN
aiol-6350	428	12	(	(	PUNCT
aiol-6350	428	13	eds	eds	PROPN
aiol-6350	428	14	.	.	PUNCT
aiol-6350	428	15	)	)	PUNCT
aiol-6350	428	16	,	,	PUNCT
aiol-6350	428	17	harmful	harmful	ADJ
aiol-6350	428	18	cyanobacteria	cyanobacteria	NOUN
aiol-6350	428	19	.	.	PUNCT
aiol-6350	428	20	springer	springer	NOUN
aiol-6350	428	21	,	,	PUNCT
aiol-6350	428	22	dordrecht	dordrecht	PROPN
aiol-6350	428	23	.	.	PUNCT
aiol-6350	428	24	cook	cook	VERB
aiol-6350	428	25	cm	cm	NOUN
aiol-6350	428	26	,	,	PUNCT
aiol-6350	428	27	vardaka	vardaka	NOUN
aiol-6350	428	28	e	e	NOUN
aiol-6350	428	29	,	,	PUNCT
aiol-6350	428	30	lanaras	lanaras	PROPN
aiol-6350	428	31	t	t	PROPN
aiol-6350	428	32	,	,	PUNCT
aiol-6350	428	33	2004	2004	NUM
aiol-6350	428	34	.	.	PUNCT
aiol-6350	429	1	toxic	toxic	ADJ
aiol-6350	429	2	cyanobacteria	cyanobacteria	NOUN
aiol-6350	429	3	in	in	ADP
aiol-6350	429	4	greek	greek	NOUN
aiol-6350	429	5	freshwaters	freshwater	NOUN
aiol-6350	429	6	,	,	PUNCT
aiol-6350	429	7	1987–2000	1987–2000	NUM
aiol-6350	429	8	:	:	PUNCT
aiol-6350	429	9	occurrence	occurrence	NOUN
aiol-6350	429	10	,	,	PUNCT
aiol-6350	429	11	toxicity	toxicity	NOUN
aiol-6350	429	12	,	,	PUNCT
aiol-6350	429	13	and	and	CCONJ
aiol-6350	429	14	impacts	impact	NOUN
aiol-6350	429	15	in	in	ADP
aiol-6350	429	16	the	the	DET
aiol-6350	429	17	mediterranean	mediterranean	PROPN
aiol-6350	429	18	region	region	NOUN
aiol-6350	429	19	.	.	PUNCT
aiol-6350	430	1	acta	acta	PROPN
aiol-6350	430	2	hydroch	hydroch	PROPN
aiol-6350	430	3	.	.	PUNCT
aiol-6350	431	1	hydrob	hydrob	PROPN
aiol-6350	431	2	.	.	PUNCT
aiol-6350	432	1	32:107	32:107	NUM
aiol-6350	432	2	-	-	SYM
aiol-6350	432	3	124	124	NUM
aiol-6350	432	4	.	.	PUNCT
aiol-6350	433	1	cooke	cooke	PROPN
aiol-6350	433	2	gd	gd	PROPN
aiol-6350	433	3	,	,	PUNCT
aiol-6350	433	4	welch	welch	PROPN
aiol-6350	433	5	eg	eg	PROPN
aiol-6350	433	6	,	,	PUNCT
aiol-6350	433	7	peterson	peterson	PROPN
aiol-6350	433	8	sa	sa	PROPN
aiol-6350	433	9	,	,	PUNCT
aiol-6350	433	10	newroth	newroth	PROPN
aiol-6350	433	11	pr	pr	NOUN
aiol-6350	433	12	,	,	PUNCT
aiol-6350	433	13	1986	1986	NUM
aiol-6350	433	14	.	.	PUNCT
aiol-6350	434	1	limnology	limnology	NOUN
aiol-6350	434	2	,	,	PUNCT
aiol-6350	434	3	lake	lake	NOUN
aiol-6350	434	4	diagnosis	diagnosis	NOUN
aiol-6350	434	5	and	and	CCONJ
aiol-6350	434	6	selection	selection	NOUN
aiol-6350	434	7	of	of	ADP
aiol-6350	434	8	restoration	restoration	NOUN
aiol-6350	434	9	methods	method	NOUN
aiol-6350	434	10	,	,	PUNCT
aiol-6350	434	11	p.	p.	NOUN
aiol-6350	434	12	9	9	NUM
aiol-6350	434	13	-	-	SYM
aiol-6350	434	14	46	46	NUM
aiol-6350	434	15	.	.	PUNCT
aiol-6350	435	1	in	in	ADP
aiol-6350	435	2	:	:	PUNCT
aiol-6350	435	3	g.d	g.d	PROPN
aiol-6350	435	4	.	.	PROPN
aiol-6350	435	5	cooke	cooke	PROPN
aiol-6350	435	6	,	,	PUNCT
aiol-6350	435	7	e.g.	e.g.	ADV
aiol-6350	435	8	welch	welch	PROPN
aiol-6350	435	9	,	,	PUNCT
aiol-6350	435	10	s.a	s.a	PROPN
aiol-6350	435	11	.	.	PROPN
aiol-6350	435	12	peterson	peterson	PROPN
aiol-6350	435	13	and	and	CCONJ
aiol-6350	435	14	p.r	p.r	PROPN
aiol-6350	435	15	.	.	PROPN
aiol-6350	435	16	newroth	newroth	PROPN
aiol-6350	435	17	(	(	PUNCT
aiol-6350	435	18	eds	ed	NOUN
aiol-6350	435	19	.	.	PUNCT
aiol-6350	435	20	)	)	PUNCT
aiol-6350	435	21	,	,	PUNCT
aiol-6350	435	22	lake	lake	NOUN
aiol-6350	435	23	and	and	CCONJ
aiol-6350	435	24	reservoir	reservoir	PROPN
aiol-6350	435	25	restoration	restoration	NOUN
aiol-6350	435	26	.	.	PUNCT
aiol-6350	436	1	butterworth	butterworth	PROPN
aiol-6350	436	2	publ	publ	PROPN
aiol-6350	436	3	.	.	PUNCT
aiol-6350	436	4	,	,	PUNCT
aiol-6350	436	5	stoneham	stoneham	PROPN
aiol-6350	436	6	.	.	PROPN
aiol-6350	437	1	costa	costa	PROPN
aiol-6350	437	2	ias	ias	PROPN
aiol-6350	437	3	,	,	PUNCT
aiol-6350	437	4	azevedo	azevedo	PROPN
aiol-6350	437	5	smfo	smfo	PROPN
aiol-6350	437	6	,	,	PUNCT
aiol-6350	437	7	senna	senna	PROPN
aiol-6350	437	8	pac	pac	PROPN
aiol-6350	437	9	,	,	PUNCT
aiol-6350	437	10	bernardo	bernardo	PROPN
aiol-6350	437	11	rr	rr	PROPN
aiol-6350	437	12	,	,	PUNCT
aiol-6350	437	13	costa	costa	PROPN
aiol-6350	437	14	sm	sm	PROPN
aiol-6350	437	15	,	,	PUNCT
aiol-6350	437	16	chellappa	chellappa	VERB
aiol-6350	437	17	nt	not	PART
aiol-6350	437	18	,	,	PUNCT
aiol-6350	437	19	2006	2006	NUM
aiol-6350	437	20	.	.	PUNCT
aiol-6350	438	1	occurrence	occurrence	NOUN
aiol-6350	438	2	of	of	ADP
aiol-6350	438	3	toxin	toxin	NOUN
aiol-6350	438	4	-	-	PUNCT
aiol-6350	438	5	producing	produce	VERB
aiol-6350	438	6	cyanobacteria	cyanobacteria	NOUN
aiol-6350	438	7	blooms	bloom	NOUN
aiol-6350	438	8	in	in	ADP
aiol-6350	438	9	a	a	DET
aiol-6350	438	10	brazilian	brazilian	ADJ
aiol-6350	438	11	semiarid	semiarid	NOUN
aiol-6350	438	12	reservoir	reservoir	PROPN
aiol-6350	438	13	.	.	PUNCT
aiol-6350	439	1	braz	braz	PROPN
aiol-6350	439	2	.	.	PUNCT
aiol-6350	440	1	j.	j.	PROPN
aiol-6350	440	2	biol	biol	PROPN
aiol-6350	440	3	.	.	PUNCT
aiol-6350	441	1	66:211–219	66:211–219	NOUN
aiol-6350	441	2	.	.	PUNCT
aiol-6350	442	1	dimitrakopoulos	dimitrakopoulos	PROPN
aiol-6350	442	2	i	i	PRON
aiol-6350	442	3	,	,	PUNCT
aiol-6350	442	4	kaloudis	kaloudis	PROPN
aiol-6350	442	5	t	t	PROPN
aiol-6350	442	6	,	,	PUNCT
aiol-6350	442	7	hiskia	hiskia	NOUN
aiol-6350	442	8	a	a	NOUN
aiol-6350	442	9	,	,	PUNCT
aiol-6350	442	10	thomaidis	thomaidi	NOUN
aiol-6350	442	11	ns	n	VERB
aiol-6350	442	12	,	,	PUNCT
aiol-6350	442	13	koupparis	koupparis	PROPN
aiol-6350	442	14	ma	ma	PROPN
aiol-6350	442	15	,	,	PUNCT
aiol-6350	442	16	2010	2010	NUM
aiol-6350	442	17	.	.	PUNCT
aiol-6350	443	1	development	development	NOUN
aiol-6350	443	2	of	of	ADP
aiol-6350	443	3	a	a	DET
aiol-6350	443	4	fast	fast	ADJ
aiol-6350	443	5	and	and	CCONJ
aiol-6350	443	6	selective	selective	ADJ
aiol-6350	443	7	method	method	NOUN
aiol-6350	443	8	for	for	ADP
aiol-6350	443	9	the	the	DET
aiol-6350	443	10	sensitive	sensitive	ADJ
aiol-6350	443	11	determination	determination	NOUN
aiol-6350	443	12	of	of	ADP
aiol-6350	443	13	anatoxin	anatoxin	NOUN
aiol-6350	443	14	-	-	PUNCT
aiol-6350	443	15	a	a	NOUN
aiol-6350	443	16	in	in	ADP
aiol-6350	443	17	lake	lake	NOUN
aiol-6350	443	18	waters	water	NOUN
aiol-6350	443	19	using	use	VERB
aiol-6350	443	20	liquid	liquid	ADJ
aiol-6350	443	21	chromatography	chromatography	NOUN
aiol-6350	443	22	–	–	PUNCT
aiol-6350	443	23	tandem	tandem	NOUN
aiol-6350	443	24	mass	mass	ADJ
aiol-6350	443	25	spectrometry	spectrometry	NOUN
aiol-6350	443	26	and	and	CCONJ
aiol-6350	443	27	phenylalanine	phenylalanine	NOUN
aiol-6350	443	28	-	-	PROPN
aiol-6350	443	29	d	d	NOUN
aiol-6350	443	30	5	5	NUM
aiol-6350	443	31	as	as	ADP
aiol-6350	443	32	internal	internal	ADJ
aiol-6350	443	33	standard	standard	NOUN
aiol-6350	443	34	.	.	PUNCT
aiol-6350	444	1	anal	anal	PROPN
aiol-6350	444	2	.	.	PUNCT
aiol-6350	445	1	bioanal	bioanal	ADJ
aiol-6350	445	2	.	.	PUNCT
aiol-6350	445	3	chem	chem	NOUN
aiol-6350	445	4	.	.	PUNCT
aiol-6350	446	1	397:2245	397:2245	PROPN
aiol-6350	446	2	-	-	SYM
aiol-6350	446	3	2252	2252	NUM
aiol-6350	446	4	.	.	PUNCT
aiol-6350	447	1	dokulil	dokulil	PROPN
aiol-6350	447	2	mt	mt	PROPN
aiol-6350	447	3	,	,	PUNCT
aiol-6350	447	4	teubner	teubner	NOUN
aiol-6350	447	5	k	k	PROPN
aiol-6350	447	6	,	,	PUNCT
aiol-6350	447	7	2000	2000	NUM
aiol-6350	447	8	.	.	PUNCT
aiol-6350	448	1	cyanobacterial	cyanobacterial	ADJ
aiol-6350	448	2	dominance	dominance	NOUN
aiol-6350	448	3	in	in	ADP
aiol-6350	448	4	lakes	lake	NOUN
aiol-6350	448	5	.	.	PUNCT
aiol-6350	449	1	hydrobiologia	hydrobiologia	PROPN
aiol-6350	449	2	438:1	438:1	NUM
aiol-6350	449	3	-	-	SYM
aiol-6350	449	4	12	12	NUM
aiol-6350	449	5	.	.	PUNCT
aiol-6350	450	1	dokulil	dokulil	PROPN
aiol-6350	450	2	mt	mt	PROPN
aiol-6350	450	3	,	,	PUNCT
aiol-6350	450	4	2016	2016	NUM
aiol-6350	450	5	.	.	PUNCT
aiol-6350	451	1	vegetative	vegetative	ADJ
aiol-6350	451	2	survival	survival	NOUN
aiol-6350	451	3	of	of	ADP
aiol-6350	451	4	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	451	5	raciborskii	raciborskii	ADJ
aiol-6350	451	6	(	(	PUNCT
aiol-6350	451	7	cyanobacteria	cyanobacteria	NOUN
aiol-6350	451	8	)	)	PUNCT
aiol-6350	451	9	at	at	ADP
aiol-6350	451	10	low	low	ADJ
aiol-6350	451	11	temperature	temperature	NOUN
aiol-6350	451	12	and	and	CCONJ
aiol-6350	451	13	low	low	ADJ
aiol-6350	451	14	light	light	NOUN
aiol-6350	451	15	.	.	PUNCT
aiol-6350	452	1	hydrobiologia	hydrobiologia	PROPN
aiol-6350	452	2	764:241	764:241	PROPN
aiol-6350	452	3	-	-	NOUN
aiol-6350	452	4	247	247	NUM
aiol-6350	452	5	.	.	PUNCT
aiol-6350	453	1	dolman	dolman	PROPN
aiol-6350	453	2	am	am	PROPN
aiol-6350	453	3	,	,	PUNCT
aiol-6350	453	4	rücker	rücker	PROPN
aiol-6350	453	5	j	j	PROPN
aiol-6350	453	6	,	,	PUNCT
aiol-6350	453	7	pick	pick	VERB
aiol-6350	453	8	fr	fr	PROPN
aiol-6350	453	9	,	,	PUNCT
aiol-6350	453	10	fastner	fastner	PROPN
aiol-6350	453	11	j	j	PROPN
aiol-6350	453	12	,	,	PUNCT
aiol-6350	453	13	rohrlack	rohrlack	PROPN
aiol-6350	453	14	t	t	PROPN
aiol-6350	453	15	,	,	PUNCT
aiol-6350	453	16	mischke	mischke	PROPN
aiol-6350	453	17	u	u	PROPN
aiol-6350	453	18	,	,	PUNCT
aiol-6350	453	19	wiedner	wiedner	NOUN
aiol-6350	453	20	c	c	NOUN
aiol-6350	453	21	,	,	PUNCT
aiol-6350	453	22	2012	2012	NUM
aiol-6350	453	23	.	.	PUNCT
aiol-6350	454	1	cyanobacteria	cyanobacteria	NOUN
aiol-6350	454	2	and	and	CCONJ
aiol-6350	454	3	cyanotoxins	cyanotoxin	NOUN
aiol-6350	454	4	:	:	PUNCT
aiol-6350	454	5	the	the	DET
aiol-6350	454	6	influence	influence	NOUN
aiol-6350	454	7	of	of	ADP
aiol-6350	454	8	nitrogen	nitrogen	NOUN
aiol-6350	454	9	and	and	CCONJ
aiol-6350	454	10	phosphorus	phosphorus	NOUN
aiol-6350	454	11	.	.	PUNCT
aiol-6350	455	1	plos	plos	PROPN
aiol-6350	455	2	one	one	NUM
aiol-6350	455	3	7	7	NUM
aiol-6350	455	4	:	:	PUNCT
aiol-6350	455	5	e38757	e38757	PROPN
aiol-6350	455	6	.	.	NOUN
aiol-6350	455	7	dyble	dyble	PROPN
aiol-6350	455	8	j	j	PROPN
aiol-6350	455	9	,	,	PUNCT
aiol-6350	455	10	tester	tester	PROPN
aiol-6350	455	11	pa	pa	PROPN
aiol-6350	455	12	,	,	PUNCT
aiol-6350	455	13	litaker	litaker	NOUN
aiol-6350	455	14	rw	rw	NOUN
aiol-6350	455	15	,	,	PUNCT
aiol-6350	455	16	2006	2006	NUM
aiol-6350	455	17	.	.	PUNCT
aiol-6350	456	1	effects	effect	NOUN
aiol-6350	456	2	of	of	ADP
aiol-6350	456	3	light	light	NOUN
aiol-6350	456	4	on	on	ADP
aiol-6350	456	5	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	456	6	production	production	NOUN
aiol-6350	456	7	in	in	ADP
aiol-6350	456	8	the	the	DET
aiol-6350	456	9	cyanobacterial	cyanobacterial	ADJ
aiol-6350	456	10	hab	hab	NOUN
aiol-6350	456	11	species	specie	NOUN
aiol-6350	456	12	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	456	13	raciborskii	raciborskii	PRON
aiol-6350	456	14	.	.	PUNCT
aiol-6350	457	1	afr	afr	PROPN
aiol-6350	457	2	.	.	PUNCT
aiol-6350	458	1	j.	j.	PROPN
aiol-6350	458	2	mar	mar	PROPN
aiol-6350	458	3	.	.	PUNCT
aiol-6350	459	1	sci	sci	PROPN
aiol-6350	459	2	.	.	PUNCT
aiol-6350	460	1	28:309	28:309	NUM
aiol-6350	460	2	-	-	SYM
aiol-6350	460	3	312	312	NUM
aiol-6350	460	4	.	.	PUNCT
aiol-6350	460	5	egy	egy	PROPN
aiol-6350	460	6	,	,	PUNCT
aiol-6350	460	7	2013	2013	NUM
aiol-6350	460	8	.	.	PUNCT
aiol-6350	461	1	[	[	X
aiol-6350	461	2	river	river	NOUN
aiol-6350	461	3	basin	basin	NOUN
aiol-6350	461	4	management	management	NOUN
aiol-6350	461	5	plan	plan	NOUN
aiol-6350	461	6	of	of	ADP
aiol-6350	461	7	thessaly].[report	thessaly].[report	PROPN
aiol-6350	461	8	in	in	ADP
aiol-6350	461	9	greek	greek	NOUN
aiol-6350	461	10	]	]	PUNCT
aiol-6350	461	11	.	.	PUNCT
aiol-6350	462	1	accessed	access	VERB
aiol-6350	462	2	on	on	ADP
aiol-6350	462	3	:	:	SYM
aiol-6350	462	4	01/05/2017	01/05/2017	NUM
aiol-6350	462	5	.	.	PUNCT
aiol-6350	463	1	available	available	ADJ
aiol-6350	463	2	from	from	ADP
aiol-6350	463	3	:	:	PUNCT
aiol-6350	463	4	http://	http://	PROPN
aiol-6350	463	5	wfd.ypeka.gr/pdf/gr08_sxedio_diaxeirisis%20neron	wfd.ypeka.gr/pdf/gr08_sxedio_diaxeirisis%20neron	PROPN
aiol-6350	463	6	_	_	PUNCT
aiol-6350	463	7	ypogegrammeno.pdf	ypogegrammeno.pdf	X
aiol-6350	463	8	en	en	ADP
aiol-6350	463	9	27828	27828	NUM
aiol-6350	463	10	-	-	SYM
aiol-6350	463	11	1994	1994	NUM
aiol-6350	463	12	.	.	PUNCT
aiol-6350	464	1	water	water	NOUN
aiol-6350	464	2	quality	quality	NOUN
aiol-6350	464	3	;	;	PUNCT
aiol-6350	464	4	methods	method	NOUN
aiol-6350	464	5	of	of	ADP
aiol-6350	464	6	biological	biological	ADJ
aiol-6350	464	7	sampling	sampling	NOUN
aiol-6350	464	8	;	;	PUNCT
aiol-6350	464	9	guidance	guidance	NOUN
aiol-6350	464	10	on	on	ADP
aiol-6350	464	11	handnet	handnet	NOUN
aiol-6350	464	12	sampling	sampling	NOUN
aiol-6350	464	13	of	of	ADP
aiol-6350	464	14	aquatic	aquatic	ADJ
aiol-6350	464	15	benthic	benthic	ADJ
aiol-6350	464	16	macro	macro	NOUN
aiol-6350	464	17	-	-	NOUN
aiol-6350	464	18	invertebrates	invertebrate	NOUN
aiol-6350	464	19	(	(	PUNCT
aiol-6350	464	20	iso	iso	NOUN
aiol-6350	464	21	7828	7828	NUM
aiol-6350	464	22	,	,	PUNCT
aiol-6350	464	23	1985	1985	NUM
aiol-6350	464	24	)	)	PUNCT
aiol-6350	464	25	.	.	PUNCT
aiol-6350	465	1	fergusson	fergusson	PROPN
aiol-6350	465	2	km	km	PROPN
aiol-6350	465	3	,	,	PUNCT
aiol-6350	465	4	saint	saint	PROPN
aiol-6350	465	5	cp	cp	PROPN
aiol-6350	465	6	,	,	PUNCT
aiol-6350	465	7	2003	2003	NUM
aiol-6350	465	8	.	.	PUNCT
aiol-6350	466	1	multiplex	multiplex	PROPN
aiol-6350	466	2	pcr	pcr	PROPN
aiol-6350	466	3	assay	assay	VERB
aiol-6350	466	4	for	for	ADP
aiol-6350	466	5	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	466	6	raciborskii	raciborskii	ADJ
aiol-6350	466	7	and	and	CCONJ
aiol-6350	466	8	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	466	9	-	-	PUNCT
aiol-6350	466	10	producing	produce	VERB
aiol-6350	466	11	cyanobacteria	cyanobacteria	NOUN
aiol-6350	466	12	.	.	PUNCT
aiol-6350	467	1	environ	environ	PROPN
aiol-6350	467	2	.	.	PUNCT
aiol-6350	468	1	toxicol	toxicol	PROPN
aiol-6350	468	2	.	.	PUNCT
aiol-6350	469	1	18:120	18:120	NUM
aiol-6350	469	2	-	-	SYM
aiol-6350	469	3	125	125	NUM
aiol-6350	469	4	.	.	PUNCT
aiol-6350	470	1	gkelis	gkelis	PROPN
aiol-6350	470	2	s	s	PART
aiol-6350	470	3	,	,	PUNCT
aiol-6350	470	4	harjunpää	harjunpää	PROPN
aiol-6350	470	5	v	v	ADP
aiol-6350	470	6	,	,	PUNCT
aiol-6350	470	7	lanaras	lanaras	PROPN
aiol-6350	470	8	t	t	PROPN
aiol-6350	470	9	,	,	PUNCT
aiol-6350	470	10	sivonen	sivonen	NOUN
aiol-6350	470	11	k	k	PROPN
aiol-6350	470	12	,	,	PUNCT
aiol-6350	470	13	2005	2005	NUM
aiol-6350	470	14	.	.	PUNCT
aiol-6350	471	1	diversity	diversity	NOUN
aiol-6350	471	2	of	of	ADP
aiol-6350	471	3	hepatotoxic	hepatotoxic	NOUN
aiol-6350	471	4	microcystins	microcystin	NOUN
aiol-6350	471	5	and	and	CCONJ
aiol-6350	471	6	bioactive	bioactive	VERB
aiol-6350	471	7	anabaenopeptins	anabaenopeptin	NOUN
aiol-6350	471	8	in	in	ADP
aiol-6350	471	9	cyanobacterial	cyanobacterial	ADJ
aiol-6350	471	10	blooms	bloom	NOUN
aiol-6350	471	11	from	from	ADP
aiol-6350	471	12	greek	greek	ADJ
aiol-6350	471	13	freshwaters	freshwater	NOUN
aiol-6350	471	14	.	.	PUNCT
aiol-6350	472	1	environ	environ	PROPN
aiol-6350	472	2	.	.	PUNCT
aiol-6350	473	1	toxicol	toxicol	PROPN
aiol-6350	473	2	.	.	PUNCT
aiol-6350	474	1	20:249	20:249	NUM
aiol-6350	474	2	-	-	SYM
aiol-6350	474	3	256	256	NUM
aiol-6350	474	4	.	.	PUNCT
aiol-6350	475	1	gkelis	gkelis	PROPN
aiol-6350	475	2	s	s	PROPN
aiol-6350	475	3	,	,	PUNCT
aiol-6350	475	4	lanaras	lanaras	PROPN
aiol-6350	475	5	t	t	PROPN
aiol-6350	475	6	,	,	PUNCT
aiol-6350	475	7	sivonen	sivonen	NOUN
aiol-6350	475	8	k	k	PROPN
aiol-6350	475	9	,	,	PUNCT
aiol-6350	475	10	2015	2015	NUM
aiol-6350	475	11	.	.	PUNCT
aiol-6350	476	1	cyanobacterial	cyanobacterial	ADJ
aiol-6350	476	2	toxic	toxic	ADJ
aiol-6350	476	3	and	and	CCONJ
aiol-6350	476	4	bioactive	bioactive	VERB
aiol-6350	476	5	peptides	peptide	NOUN
aiol-6350	476	6	in	in	ADP
aiol-6350	476	7	freshwater	freshwater	NOUN
aiol-6350	476	8	bodies	body	NOUN
aiol-6350	476	9	of	of	ADP
aiol-6350	476	10	greece	greece	PROPN
aiol-6350	476	11	:	:	PUNCT
aiol-6350	476	12	concentrations	concentration	NOUN
aiol-6350	476	13	,	,	PUNCT
aiol-6350	476	14	occurrence	occurrence	NOUN
aiol-6350	476	15	patterns	pattern	NOUN
aiol-6350	476	16	,	,	PUNCT
aiol-6350	476	17	and	and	CCONJ
aiol-6350	476	18	implications	implication	NOUN
aiol-6350	476	19	for	for	ADP
aiol-6350	476	20	human	human	ADJ
aiol-6350	476	21	health	health	NOUN
aiol-6350	476	22	.	.	PUNCT
aiol-6350	477	1	mar	mar	PROPN
aiol-6350	477	2	.	.	PUNCT
aiol-6350	478	1	drugs	drug	NOUN
aiol-6350	478	2	13:6319	13:6319	NUM
aiol-6350	478	3	-	-	SYM
aiol-6350	478	4	6335	6335	NUM
aiol-6350	478	5	.	.	PUNCT
aiol-6350	479	1	gkelis	gkelis	PROPN
aiol-6350	479	2	s	s	PART
aiol-6350	479	3	,	,	PUNCT
aiol-6350	479	4	papadimitriou	papadimitriou	VERB
aiol-6350	479	5	t	t	PROPN
aiol-6350	479	6	,	,	PUNCT
aiol-6350	479	7	zaoutsos	zaoutsos	PROPN
aiol-6350	479	8	n	n	CCONJ
aiol-6350	479	9	,	,	PUNCT
aiol-6350	479	10	leonardos	leonardo	NOUN
aiol-6350	479	11	i	i	PRON
aiol-6350	479	12	,	,	PUNCT
aiol-6350	479	13	2014	2014	NUM
aiol-6350	479	14	.	.	PUNCT
aiol-6350	480	1	anthropogenic	anthropogenic	ADJ
aiol-6350	480	2	and	and	CCONJ
aiol-6350	480	3	climate	climate	NOUN
aiol-6350	480	4	-	-	PUNCT
aiol-6350	480	5	induced	induce	VERB
aiol-6350	480	6	change	change	NOUN
aiol-6350	480	7	favors	favor	VERB
aiol-6350	480	8	toxic	toxic	ADJ
aiol-6350	480	9	cyanobacteria	cyanobacteria	NOUN
aiol-6350	480	10	blooms	bloom	NOUN
aiol-6350	480	11	:	:	PUNCT
aiol-6350	480	12	evidence	evidence	NOUN
aiol-6350	480	13	from	from	ADP
aiol-6350	480	14	monitoring	monitor	VERB
aiol-6350	480	15	a	a	DET
aiol-6350	480	16	highly	highly	ADV
aiol-6350	480	17	eutrophic	eutrophic	ADJ
aiol-6350	480	18	,	,	PUNCT
aiol-6350	480	19	urban	urban	PROPN
aiol-6350	480	20	mediterranean	mediterranean	PROPN
aiol-6350	480	21	lake	lake	PROPN
aiol-6350	480	22	.	.	PUNCT
aiol-6350	481	1	harmful	harmful	ADJ
aiol-6350	481	2	algae	algae	NOUN
aiol-6350	481	3	39:322	39:322	PROPN
aiol-6350	481	4	-	-	SYM
aiol-6350	481	5	333	333	NUM
aiol-6350	481	6	.	.	PUNCT
aiol-6350	482	1	gkelis	gkelis	PROPN
aiol-6350	482	2	s	s	PROPN
aiol-6350	482	3	,	,	PUNCT
aiol-6350	482	4	zaoutsos	zaoutsos	NOUN
aiol-6350	482	5	n	n	CCONJ
aiol-6350	482	6	,	,	PUNCT
aiol-6350	482	7	2014	2014	NUM
aiol-6350	482	8	.	.	PUNCT
aiol-6350	483	1	cyanotoxin	cyanotoxin	NOUN
aiol-6350	483	2	occurrence	occurrence	NOUN
aiol-6350	483	3	and	and	CCONJ
aiol-6350	483	4	potentially	potentially	ADV
aiol-6350	483	5	toxin	toxin	NOUN
aiol-6350	483	6	producing	produce	VERB
aiol-6350	483	7	cyanobacteria	cyanobacteria	NOUN
aiol-6350	483	8	in	in	ADP
aiol-6350	483	9	freshwaters	freshwater	NOUN
aiol-6350	483	10	of	of	ADP
aiol-6350	483	11	greece	greece	PROPN
aiol-6350	483	12	:	:	PUNCT
aiol-6350	483	13	a	a	DET
aiol-6350	483	14	multi	multi	ADJ
aiol-6350	483	15	-	-	ADJ
aiol-6350	483	16	disciplinary	disciplinary	ADJ
aiol-6350	483	17	approach	approach	NOUN
aiol-6350	483	18	.	.	PUNCT
aiol-6350	484	1	toxicon	toxicon	NOUN
aiol-6350	485	1	78:1	78:1	NUM
aiol-6350	485	2	-	-	SYM
aiol-6350	485	3	9	9	NUM
aiol-6350	485	4	.	.	PUNCT
aiol-6350	486	1	graham	graham	PROPN
aiol-6350	486	2	j	j	PROPN
aiol-6350	486	3	,	,	PUNCT
aiol-6350	486	4	loftin	loftin	PROPN
aiol-6350	486	5	k	k	PROPN
aiol-6350	486	6	,	,	PUNCT
aiol-6350	486	7	meyer	meyer	PROPN
aiol-6350	486	8	m	m	PROPN
aiol-6350	486	9	,	,	PUNCT
aiol-6350	486	10	ziegler	ziegler	PROPN
aiol-6350	486	11	a	a	X
aiol-6350	486	12	,	,	PUNCT
aiol-6350	486	13	2010	2010	NUM
aiol-6350	486	14	.	.	PUNCT
aiol-6350	487	1	cyanotoxin	cyanotoxin	PROPN
aiol-6350	487	2	mixtures	mixture	NOUN
aiol-6350	487	3	and	and	CCONJ
aiol-6350	487	4	taste	taste	NOUN
aiol-6350	487	5	-	-	PUNCT
aiol-6350	487	6	and	and	CCONJ
aiol-6350	487	7	-	-	PUNCT
aiol-6350	487	8	odor	odor	NOUN
aiol-6350	487	9	-	-	PUNCT
aiol-6350	487	10	compounds	compound	NOUN
aiol-6350	487	11	in	in	ADP
aiol-6350	487	12	cyanobacterial	cyanobacterial	ADJ
aiol-6350	487	13	blooms	bloom	NOUN
aiol-6350	487	14	from	from	ADP
aiol-6350	487	15	the	the	DET
aiol-6350	487	16	midwestern	midwestern	ADJ
aiol-6350	487	17	united	united	PROPN
aiol-6350	487	18	states	states	PROPN
aiol-6350	487	19	.	.	PUNCT
aiol-6350	488	1	environ	environ	PROPN
aiol-6350	488	2	.	.	PUNCT
aiol-6350	489	1	scien	scien	PROPN
aiol-6350	489	2	.	.	PUNCT
aiol-6350	490	1	technol	technol	NOUN
aiol-6350	490	2	.	.	PUNCT
aiol-6350	491	1	44:7361	44:7361	NOUN
aiol-6350	491	2	-	-	PUNCT
aiol-6350	491	3	7368	7368	NUM
aiol-6350	491	4	.	.	PUNCT
aiol-6350	492	1	hisbergues	hisbergues	PROPN
aiol-6350	492	2	m	m	PROPN
aiol-6350	492	3	,	,	PUNCT
aiol-6350	492	4	christiansen	christiansen	PROPN
aiol-6350	492	5	g	g	PROPN
aiol-6350	492	6	,	,	PUNCT
aiol-6350	492	7	rouhiainen	rouhiainen	PROPN
aiol-6350	492	8	l	l	PROPN
aiol-6350	492	9	,	,	PUNCT
aiol-6350	492	10	sivonen	sivonen	PROPN
aiol-6350	492	11	k	k	PROPN
aiol-6350	492	12	,	,	PUNCT
aiol-6350	492	13	borner	borner	PROPN
aiol-6350	492	14	t	t	PROPN
aiol-6350	492	15	,	,	PUNCT
aiol-6350	492	16	2003	2003	NUM
aiol-6350	492	17	.	.	PUNCT
aiol-6350	493	1	pcr	pcr	NOUN
aiol-6350	493	2	-	-	PUNCT
aiol-6350	493	3	based	base	VERB
aiol-6350	493	4	identification	identification	NOUN
aiol-6350	493	5	of	of	ADP
aiol-6350	493	6	microcystinproducing	microcystinproduce	VERB
aiol-6350	493	7	genotypes	genotype	NOUN
aiol-6350	493	8	of	of	ADP
aiol-6350	493	9	different	different	ADJ
aiol-6350	493	10	cyanobacterial	cyanobacterial	ADJ
aiol-6350	493	11	genera	genera	NOUN
aiol-6350	493	12	.	.	PUNCT
aiol-6350	494	1	arch	arch	PROPN
aiol-6350	494	2	.	.	PUNCT
aiol-6350	495	1	microbiol	microbiol	PROPN
aiol-6350	495	2	.	.	PUNCT
aiol-6350	496	1	180:402	180:402	NUM
aiol-6350	496	2	-	-	SYM
aiol-6350	496	3	410	410	NUM
aiol-6350	496	4	.	.	PUNCT
aiol-6350	497	1	iso	iso	PROPN
aiol-6350	497	2	7828	7828	NUM
aiol-6350	497	3	,	,	PUNCT
aiol-6350	497	4	1985	1985	NUM
aiol-6350	497	5	.	.	PUNCT
aiol-6350	498	1	water	water	NOUN
aiol-6350	498	2	quality	quality	NOUN
aiol-6350	498	3	methods	method	NOUN
aiol-6350	498	4	of	of	ADP
aiol-6350	498	5	biological	biological	ADJ
aiol-6350	498	6	sampling	sampling	NOUN
aiol-6350	498	7	–	–	PUNCT
aiol-6350	498	8	guidance	guidance	NOUN
aiol-6350	498	9	on	on	ADP
aiol-6350	498	10	handnet	handnet	NOUN
aiol-6350	498	11	sampling	sampling	NOUN
aiol-6350	498	12	of	of	ADP
aiol-6350	498	13	aquatic	aquatic	ADJ
aiol-6350	498	14	benthic	benthic	ADJ
aiol-6350	498	15	macroinvertebrates	macroinvertebrate	NOUN
aiol-6350	498	16	.	.	PUNCT
aiol-6350	499	1	international	international	ADJ
aiol-6350	499	2	organization	organization	NOUN
aiol-6350	499	3	for	for	ADP
aiol-6350	499	4	standardization	standardization	NOUN
aiol-6350	499	5	.	.	PUNCT
aiol-6350	500	1	jeppesen	jeppesen	PROPN
aiol-6350	500	2	e	e	PROPN
aiol-6350	500	3	,	,	PUNCT
aiol-6350	500	4	søndergaard	søndergaard	NOUN
aiol-6350	500	5	m	m	PROPN
aiol-6350	500	6	,	,	PUNCT
aiol-6350	500	7	meerhoff	meerhoff	PROPN
aiol-6350	500	8	m	m	PROPN
aiol-6350	500	9	,	,	PUNCT
aiol-6350	500	10	lauridsen	lauridsen	PROPN
aiol-6350	500	11	tl	tl	PROPN
aiol-6350	500	12	,	,	PUNCT
aiol-6350	500	13	jensen	jensen	PROPN
aiol-6350	500	14	jp	jp	PROPN
aiol-6350	500	15	,	,	PUNCT
aiol-6350	500	16	2007	2007	NUM
aiol-6350	500	17	.	.	PUNCT
aiol-6350	501	1	shallow	shallow	PROPN
aiol-6350	501	2	lake	lake	PROPN
aiol-6350	501	3	restoration	restoration	NOUN
aiol-6350	501	4	by	by	ADP
aiol-6350	501	5	nutrient	nutrient	NOUN
aiol-6350	501	6	loading	loading	NOUN
aiol-6350	501	7	reduction	reduction	NOUN
aiol-6350	501	8	some	some	DET
aiol-6350	501	9	recent	recent	ADJ
aiol-6350	501	10	findings	finding	NOUN
aiol-6350	501	11	and	and	CCONJ
aiol-6350	501	12	challenges	challenge	NOUN
aiol-6350	501	13	ahead	ahead	ADV
aiol-6350	501	14	.	.	PUNCT
aiol-6350	502	1	hydrobiologia	hydrobiologia	VERB
aiol-6350	502	2	584:239	584:239	NUM
aiol-6350	502	3	-	-	PUNCT
aiol-6350	502	4	252	252	NUM
aiol-6350	502	5	.	.	PUNCT
aiol-6350	503	1	jrc	jrc	PROPN
aiol-6350	503	2	european	european	PROPN
aiol-6350	503	3	commission	commission	PROPN
aiol-6350	503	4	,	,	PUNCT
aiol-6350	503	5	2009	2009	NUM
aiol-6350	503	6	.	.	PUNCT
aiol-6350	504	1	water	water	NOUN
aiol-6350	504	2	framework	framework	NOUN
aiol-6350	504	3	directive	directive	NOUN
aiol-6350	504	4	intercalibration	intercalibration	NOUN
aiol-6350	504	5	technical	technical	ADJ
aiol-6350	504	6	report	report	NOUN
aiol-6350	504	7	.	.	PUNCT
aiol-6350	505	1	part	part	NOUN
aiol-6350	505	2	2	2	NUM
aiol-6350	505	3	:	:	PUNCT
aiol-6350	505	4	lakes	lake	NOUN
aiol-6350	505	5	.	.	PUNCT
aiol-6350	506	1	joint	joint	ADJ
aiol-6350	506	2	research	research	NOUN
aiol-6350	506	3	centre	centre	NOUN
aiol-6350	506	4	,	,	PUNCT
aiol-6350	506	5	european	european	PROPN
aiol-6350	506	6	commission	commission	PROPN
aiol-6350	506	7	.	.	PUNCT
aiol-6350	507	1	jungblut	jungblut	PROPN
aiol-6350	507	2	ad	ad	NOUN
aiol-6350	507	3	,	,	PUNCT
aiol-6350	507	4	neilan	neilan	ADJ
aiol-6350	507	5	ba	ba	PROPN
aiol-6350	507	6	,	,	PUNCT
aiol-6350	507	7	2006	2006	NUM
aiol-6350	507	8	.	.	PUNCT
aiol-6350	508	1	molecular	molecular	ADJ
aiol-6350	508	2	identification	identification	NOUN
aiol-6350	508	3	and	and	CCONJ
aiol-6350	508	4	evolution	evolution	NOUN
aiol-6350	508	5	of	of	ADP
aiol-6350	508	6	the	the	DET
aiol-6350	508	7	cyclic	cyclic	ADJ
aiol-6350	508	8	peptide	peptide	NOUN
aiol-6350	508	9	hepatotoxins	hepatotoxin	NOUN
aiol-6350	508	10	,	,	PUNCT
aiol-6350	508	11	microcystin	microcystin	NOUN
aiol-6350	508	12	and	and	CCONJ
aiol-6350	508	13	nodularin	nodularin	NOUN
aiol-6350	508	14	,	,	PUNCT
aiol-6350	508	15	synthetase	synthetase	NOUN
aiol-6350	508	16	genes	gene	NOUN
aiol-6350	508	17	in	in	ADP
aiol-6350	508	18	three	three	NUM
aiol-6350	508	19	orders	order	NOUN
aiol-6350	508	20	of	of	ADP
aiol-6350	508	21	cyanobacteria	cyanobacteria	NOUN
aiol-6350	508	22	.	.	PUNCT
aiol-6350	509	1	arch	arch	PROPN
aiol-6350	509	2	.	.	PUNCT
aiol-6350	510	1	microb	microb	PROPN
aiol-6350	510	2	.	.	PUNCT
aiol-6350	511	1	185:107	185:107	PROPN
aiol-6350	511	2	-	-	SYM
aiol-6350	511	3	114	114	NUM
aiol-6350	511	4	.	.	PUNCT
aiol-6350	512	1	kagalou	kagalou	PROPN
aiol-6350	512	2	i	i	PRON
aiol-6350	512	3	,	,	PUNCT
aiol-6350	512	4	2010	2010	NUM
aiol-6350	512	5	.	.	PUNCT
aiol-6350	513	1	classification	classification	NOUN
aiol-6350	513	2	and	and	CCONJ
aiol-6350	513	3	management	management	NOUN
aiol-6350	513	4	issues	issue	NOUN
aiol-6350	513	5	of	of	ADP
aiol-6350	513	6	greek	greek	ADJ
aiol-6350	513	7	lakes	lake	NOUN
aiol-6350	513	8	under	under	ADP
aiol-6350	513	9	the	the	DET
aiol-6350	513	10	european	european	ADJ
aiol-6350	513	11	water	water	NOUN
aiol-6350	513	12	framework	framework	NOUN
aiol-6350	513	13	directive	directive	NOUN
aiol-6350	513	14	:	:	PUNCT
aiol-6350	513	15	a	a	DET
aiol-6350	513	16	dpsir	dpsir	PROPN
aiol-6350	513	17	approach	approach	NOUN
aiol-6350	513	18	.	.	PUNCT
aiol-6350	514	1	j.	j.	PROPN
aiol-6350	514	2	environ	environ	PROPN
aiol-6350	514	3	.	.	PUNCT
aiol-6350	514	4	monitor	monitor	PROPN
aiol-6350	514	5	.	.	PUNCT
aiol-6350	515	1	12:2207	12:2207	PROPN
aiol-6350	515	2	-	-	SYM
aiol-6350	515	3	2215	2215	NUM
aiol-6350	515	4	.	.	PUNCT
aiol-6350	516	1	kagalou	kagalou	PROPN
aiol-6350	516	2	i	i	PRON
aiol-6350	516	3	,	,	PUNCT
aiol-6350	516	4	papastergiadou	papastergiadou	ADJ
aiol-6350	516	5	e	e	NOUN
aiol-6350	516	6	,	,	PUNCT
aiol-6350	516	7	leonardos	leonardo	NOUN
aiol-6350	516	8	i	i	PRON
aiol-6350	516	9	,	,	PUNCT
aiol-6350	516	10	2008	2008	NUM
aiol-6350	516	11	.	.	PUNCT
aiol-6350	517	1	long	long	ADJ
aiol-6350	517	2	term	term	NOUN
aiol-6350	517	3	changes	change	NOUN
aiol-6350	517	4	in	in	ADP
aiol-6350	517	5	the	the	DET
aiol-6350	517	6	eutrophication	eutrophication	NOUN
aiol-6350	517	7	process	process	NOUN
aiol-6350	517	8	in	in	ADP
aiol-6350	517	9	a	a	DET
aiol-6350	517	10	shallow	shallow	ADJ
aiol-6350	517	11	mediterranean	mediterranean	PROPN
aiol-6350	517	12	lake	lake	PROPN
aiol-6350	517	13	ecosystem	ecosystem	PROPN
aiol-6350	517	14	of	of	ADP
aiol-6350	517	15	w.	w.	PROPN
aiol-6350	517	16	greece	greece	PROPN
aiol-6350	517	17	.	.	PUNCT
aiol-6350	518	1	response	response	NOUN
aiol-6350	518	2	after	after	ADP
aiol-6350	518	3	the	the	DET
aiol-6350	518	4	reduction	reduction	NOUN
aiol-6350	518	5	of	of	ADP
aiol-6350	518	6	external	external	ADJ
aiol-6350	518	7	load	load	NOUN
aiol-6350	518	8	.	.	PUNCT
aiol-6350	519	1	j.	j.	PROPN
aiol-6350	519	2	environ	environ	PROPN
aiol-6350	519	3	.	.	PROPN
aiol-6350	520	1	manag	manag	PROPN
aiol-6350	520	2	.	.	PUNCT
aiol-6350	521	1	87:497	87:497	NUM
aiol-6350	521	2	-	-	PUNCT
aiol-6350	521	3	506	506	NUM
aiol-6350	521	4	.	.	PUNCT
aiol-6350	522	1	kellmann	kellmann	PROPN
aiol-6350	522	2	r	r	PROPN
aiol-6350	522	3	,	,	PUNCT
aiol-6350	522	4	mihali	mihali	PROPN
aiol-6350	522	5	tk	tk	PROPN
aiol-6350	522	6	,	,	PUNCT
aiol-6350	522	7	jeon	jeon	PROPN
aiol-6350	522	8	yj	yj	PROPN
aiol-6350	522	9	,	,	PUNCT
aiol-6350	522	10	pickford	pickford	PROPN
aiol-6350	522	11	r	r	NOUN
aiol-6350	522	12	,	,	PUNCT
aiol-6350	522	13	pomati	pomati	NOUN
aiol-6350	522	14	f	f	PROPN
aiol-6350	522	15	,	,	PUNCT
aiol-6350	522	16	neilan	neilan	ADJ
aiol-6350	522	17	s.	s.	PROPN
aiol-6350	522	18	gkelis	gkelis	PROPN
aiol-6350	522	19	et	et	PROPN
aiol-6350	522	20	al.50	al.50	PROPN
aiol-6350	522	21	ba	ba	PROPN
aiol-6350	522	22	,	,	PUNCT
aiol-6350	522	23	2008	2008	NUM
aiol-6350	522	24	.	.	PUNCT
aiol-6350	523	1	biosynthetic	biosynthetic	ADJ
aiol-6350	523	2	intermediate	intermediate	ADJ
aiol-6350	523	3	analysis	analysis	NOUN
aiol-6350	523	4	and	and	CCONJ
aiol-6350	523	5	functional	functional	ADJ
aiol-6350	523	6	homology	homology	NOUN
aiol-6350	523	7	reveal	reveal	VERB
aiol-6350	523	8	a	a	DET
aiol-6350	523	9	saxitoxin	saxitoxin	NOUN
aiol-6350	523	10	gene	gene	NOUN
aiol-6350	523	11	cluster	cluster	NOUN
aiol-6350	523	12	in	in	ADP
aiol-6350	523	13	cyanobacteria	cyanobacteria	PROPN
aiol-6350	523	14	.	.	PUNCT
aiol-6350	524	1	appl	appl	PROPN
aiol-6350	524	2	.	.	PUNCT
aiol-6350	525	1	environ	environ	PROPN
aiol-6350	525	2	.	.	PUNCT
aiol-6350	525	3	microb	microb	PROPN
aiol-6350	525	4	.	.	PUNCT
aiol-6350	526	1	74:4044	74:4044	X
aiol-6350	526	2	-	-	SYM
aiol-6350	526	3	4053	4053	NUM
aiol-6350	526	4	.	.	PUNCT
aiol-6350	527	1	kokociński	kokociński	PROPN
aiol-6350	527	2	m	m	PROPN
aiol-6350	527	3	,	,	PUNCT
aiol-6350	527	4	dziga	dziga	ADJ
aiol-6350	527	5	d	d	NOUN
aiol-6350	527	6	,	,	PUNCT
aiol-6350	527	7	spoof	spoof	PROPN
aiol-6350	527	8	l	l	PROPN
aiol-6350	527	9	,	,	PUNCT
aiol-6350	527	10	stefaniak	stefaniak	PROPN
aiol-6350	527	11	k	k	PROPN
aiol-6350	527	12	,	,	PUNCT
aiol-6350	527	13	jurczak	jurczak	PROPN
aiol-6350	527	14	t	t	PROPN
aiol-6350	527	15	,	,	PUNCT
aiol-6350	527	16	mankiewiczboczek	mankiewiczboczek	PROPN
aiol-6350	527	17	j	j	PROPN
aiol-6350	527	18	,	,	PUNCT
aiol-6350	527	19	meriluoto	meriluoto	PROPN
aiol-6350	527	20	j	j	PROPN
aiol-6350	527	21	,	,	PUNCT
aiol-6350	527	22	2009	2009	NUM
aiol-6350	527	23	.	.	PUNCT
aiol-6350	528	1	first	first	ADJ
aiol-6350	528	2	report	report	NOUN
aiol-6350	528	3	of	of	ADP
aiol-6350	528	4	the	the	DET
aiol-6350	528	5	cyanobacterial	cyanobacterial	ADJ
aiol-6350	528	6	toxin	toxin	NOUN
aiol-6350	528	7	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	528	8	in	in	ADP
aiol-6350	528	9	the	the	DET
aiol-6350	528	10	shallow	shallow	ADJ
aiol-6350	528	11	,	,	PUNCT
aiol-6350	528	12	eutrophic	eutrophic	ADJ
aiol-6350	528	13	lakes	lake	NOUN
aiol-6350	528	14	of	of	ADP
aiol-6350	528	15	western	western	ADJ
aiol-6350	528	16	poland	poland	PROPN
aiol-6350	528	17	.	.	PUNCT
aiol-6350	528	18	chemosphere	chemosphere	VERB
aiol-6350	528	19	74:669	74:669	NOUN
aiol-6350	528	20	-	-	SYM
aiol-6350	528	21	675	675	NUM
aiol-6350	528	22	.	.	PUNCT
aiol-6350	529	1	kokociński	kokociński	PROPN
aiol-6350	529	2	m	m	PROPN
aiol-6350	529	3	,	,	PUNCT
aiol-6350	529	4	mankiewiczboczek	mankiewiczboczek	PROPN
aiol-6350	529	5	j	j	PROPN
aiol-6350	529	6	,	,	PUNCT
aiol-6350	529	7	jurczak	jurczak	PROPN
aiol-6350	529	8	t	t	PROPN
aiol-6350	529	9	,	,	PUNCT
aiol-6350	529	10	spoof	spoof	PROPN
aiol-6350	529	11	l	l	PROPN
aiol-6350	529	12	,	,	PUNCT
aiol-6350	529	13	meriluoto	meriluoto	PROPN
aiol-6350	529	14	j	j	PROPN
aiol-6350	529	15	,	,	PUNCT
aiol-6350	529	16	rejmonczyk	rejmonczyk	NOUN
aiol-6350	529	17	e	e	NOUN
aiol-6350	529	18	,	,	PUNCT
aiol-6350	529	19	hautala	hautala	PROPN
aiol-6350	529	20	h	h	NOUN
aiol-6350	529	21	,	,	PUNCT
aiol-6350	529	22	vehniäinen	vehniäinen	NOUN
aiol-6350	529	23	m	m	NOUN
aiol-6350	529	24	,	,	PUNCT
aiol-6350	529	25	pawełczyk	pawełczyk	PROPN
aiol-6350	529	26	j	j	PROPN
aiol-6350	529	27	,	,	PUNCT
aiol-6350	529	28	soininen	soininen	PROPN
aiol-6350	529	29	j	j	PROPN
aiol-6350	529	30	,	,	PUNCT
aiol-6350	529	31	2013	2013	NUM
aiol-6350	529	32	.	.	PUNCT
aiol-6350	530	1	aphanizomenon	aphanizomenon	PROPN
aiol-6350	530	2	gracile	gracile	PROPN
aiol-6350	530	3	(	(	PUNCT
aiol-6350	530	4	nostocales	nostocale	NOUN
aiol-6350	530	5	)	)	PUNCT
aiol-6350	530	6	,	,	PUNCT
aiol-6350	530	7	a	a	DET
aiol-6350	530	8	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	530	9	producing	produce	VERB
aiol-6350	530	10	cyanobacterium	cyanobacterium	NOUN
aiol-6350	530	11	in	in	ADP
aiol-6350	530	12	polish	polish	ADJ
aiol-6350	530	13	lakes	lake	NOUN
aiol-6350	530	14	.	.	PUNCT
aiol-6350	531	1	environ	environ	PROPN
aiol-6350	531	2	.	.	PUNCT
aiol-6350	532	1	sci	sci	PROPN
aiol-6350	532	2	.	.	PROPN
aiol-6350	532	3	pollut	pollut	PROPN
aiol-6350	532	4	.	.	PUNCT
aiol-6350	533	1	res	re	NOUN
aiol-6350	533	2	.	.	PUNCT
aiol-6350	534	1	20:52435264	20:52435264	X
aiol-6350	534	2	.	.	PUNCT
aiol-6350	535	1	kolzau	kolzau	PROPN
aiol-6350	535	2	s	s	PROPN
aiol-6350	535	3	,	,	PUNCT
aiol-6350	535	4	wiedner	wiedner	NOUN
aiol-6350	535	5	c	c	NOUN
aiol-6350	535	6	,	,	PUNCT
aiol-6350	535	7	rücker	rücker	PROPN
aiol-6350	535	8	j	j	PROPN
aiol-6350	535	9	,	,	PUNCT
aiol-6350	535	10	köhler	köhler	PROPN
aiol-6350	535	11	j	j	PROPN
aiol-6350	535	12	,	,	PUNCT
aiol-6350	535	13	köhler	köhler	PROPN
aiol-6350	535	14	a	a	PROPN
aiol-6350	535	15	,	,	PUNCT
aiol-6350	535	16	dolman	dolman	PROPN
aiol-6350	535	17	am	am	PROPN
aiol-6350	535	18	,	,	PUNCT
aiol-6350	535	19	2014	2014	NUM
aiol-6350	535	20	.	.	PUNCT
aiol-6350	536	1	seasonal	seasonal	ADJ
aiol-6350	536	2	patterns	pattern	NOUN
aiol-6350	536	3	of	of	ADP
aiol-6350	536	4	nitrogen	nitrogen	NOUN
aiol-6350	536	5	and	and	CCONJ
aiol-6350	536	6	phosphorus	phosphorus	NOUN
aiol-6350	536	7	limitation	limitation	NOUN
aiol-6350	536	8	in	in	ADP
aiol-6350	536	9	four	four	NUM
aiol-6350	536	10	german	german	ADJ
aiol-6350	536	11	lakes	lake	NOUN
aiol-6350	536	12	and	and	CCONJ
aiol-6350	536	13	the	the	DET
aiol-6350	536	14	predictability	predictability	NOUN
aiol-6350	536	15	of	of	ADP
aiol-6350	536	16	limitation	limitation	NOUN
aiol-6350	536	17	status	status	NOUN
aiol-6350	536	18	from	from	ADP
aiol-6350	536	19	ambient	ambient	ADJ
aiol-6350	536	20	nutrient	nutrient	NOUN
aiol-6350	536	21	concentrations	concentration	NOUN
aiol-6350	536	22	.	.	PUNCT
aiol-6350	537	1	plos	plos	PROPN
aiol-6350	537	2	one	one	NUM
aiol-6350	537	3	9	9	NUM
aiol-6350	537	4	:	:	PUNCT
aiol-6350	537	5	e96065	e96065	PROPN
aiol-6350	537	6	.	.	PUNCT
aiol-6350	538	1	komárek	komárek	PROPN
aiol-6350	538	2	j	j	PROPN
aiol-6350	538	3	,	,	PUNCT
aiol-6350	538	4	2013	2013	NUM
aiol-6350	538	5	.	.	PUNCT
aiol-6350	539	1	[	[	X
aiol-6350	539	2	cyanoprokaryota	cyanoprokaryota	NOUN
aiol-6350	539	3	3	3	NUM
aiol-6350	539	4	.	.	PUNCT
aiol-6350	539	5	teil	teil	PROPN
aiol-6350	539	6	:	:	PUNCT
aiol-6350	539	7	heterocytous	heterocytous	ADJ
aiol-6350	539	8	genera	genera	NOUN
aiol-6350	539	9	]	]	X
aiol-6350	539	10	.	.	PUNCT
aiol-6350	540	1	in	in	ADP
aiol-6350	540	2	:	:	PUNCT
aiol-6350	540	3	b.	b.	PROPN
aiol-6350	540	4	büdel	büdel	PROPN
aiol-6350	540	5	,	,	PUNCT
aiol-6350	540	6	g.	g.	PROPN
aiol-6350	540	7	gärtner	gärtner	PROPN
aiol-6350	540	8	,	,	PUNCT
aiol-6350	540	9	l.	l.	PROPN
aiol-6350	540	10	krienitz	krienitz	PROPN
aiol-6350	540	11	and	and	CCONJ
aiol-6350	540	12	m.	m.	NOUN
aiol-6350	540	13	schagerl	schagerl	PROPN
aiol-6350	540	14	(	(	PUNCT
aiol-6350	540	15	eds	ed	NOUN
aiol-6350	540	16	.	.	PUNCT
aiol-6350	540	17	)	)	PUNCT
aiol-6350	540	18	,	,	PUNCT
aiol-6350	541	1	[	[	X
aiol-6350	541	2	süswasserflora	süswasserflora	PROPN
aiol-6350	541	3	von	von	PROPN
aiol-6350	541	4	mitteleuropa	mitteleuropa	PROPN
aiol-6350	541	5	,	,	PUNCT
aiol-6350	541	6	freshwater	freshwater	NOUN
aiol-6350	541	7	flora	flora	NOUN
aiol-6350	541	8	of	of	ADP
aiol-6350	541	9	central	central	ADJ
aiol-6350	541	10	europe].[book	europe].[book	NOUN
aiol-6350	541	11	in	in	ADP
aiol-6350	541	12	german	german	NOUN
aiol-6350	541	13	]	]	PUNCT
aiol-6350	541	14	.	.	PUNCT
aiol-6350	542	1	springer	springer	PROPN
aiol-6350	542	2	spektrum	spektrum	PROPN
aiol-6350	542	3	berlin	berlin	PROPN
aiol-6350	542	4	:	:	PUNCT
aiol-6350	542	5	1130	1130	NUM
aiol-6350	542	6	pp	pp	NOUN
aiol-6350	542	7	.	.	PUNCT
aiol-6350	543	1	komárek	komárek	PROPN
aiol-6350	543	2	j	j	PROPN
aiol-6350	543	3	,	,	PUNCT
aiol-6350	543	4	anagnostidis	anagnostidis	ADJ
aiol-6350	543	5	k	k	PROPN
aiol-6350	543	6	,	,	PUNCT
aiol-6350	543	7	1999	1999	NUM
aiol-6350	543	8	.	.	PUNCT
aiol-6350	544	1	[	[	PUNCT
aiol-6350	544	2	cyanoprokaryota	cyanoprokaryota	NOUN
aiol-6350	544	3	1	1	NUM
aiol-6350	544	4	.	.	PUNCT
aiol-6350	544	5	teil	teil	PROPN
aiol-6350	544	6	:	:	PUNCT
aiol-6350	544	7	chroococcales	chroococcale	NOUN
aiol-6350	544	8	]	]	PUNCT
aiol-6350	544	9	.	.	PUNCT
aiol-6350	545	1	in	in	ADP
aiol-6350	545	2	:	:	PUNCT
aiol-6350	545	3	h.	h.	PROPN
aiol-6350	545	4	ettl	ettl	PROPN
aiol-6350	545	5	,	,	PUNCT
aiol-6350	545	6	g.	g.	PROPN
aiol-6350	545	7	gärtner	gärtner	PROPN
aiol-6350	545	8	,	,	PUNCT
aiol-6350	545	9	h.	h.	PROPN
aiol-6350	545	10	heynig	heynig	PROPN
aiol-6350	545	11	,	,	PUNCT
aiol-6350	545	12	and	and	CCONJ
aiol-6350	545	13	d.	d.	PROPN
aiol-6350	545	14	mollenhauer	mollenhauer	PROPN
aiol-6350	545	15	(	(	PUNCT
aiol-6350	545	16	eds	ed	NOUN
aiol-6350	545	17	.	.	PUNCT
aiol-6350	545	18	)	)	PUNCT
aiol-6350	545	19	,	,	PUNCT
aiol-6350	546	1	[	[	X
aiol-6350	546	2	süsswasserflora	süsswasserflora	PROPN
aiol-6350	546	3	von	von	PROPN
aiol-6350	546	4	mitteleuropa	mitteleuropa	PROPN
aiol-6350	546	5	19/1].[book	19/1].[book	NUM
aiol-6350	546	6	in	in	ADP
aiol-6350	546	7	german	german	NOUN
aiol-6350	546	8	]	]	PUNCT
aiol-6350	546	9	.	.	PUNCT
aiol-6350	547	1	gustav	gustav	PROPN
aiol-6350	547	2	fischer	fischer	PROPN
aiol-6350	547	3	verlag	verlag	PROPN
aiol-6350	547	4	,	,	PUNCT
aiol-6350	547	5	jena	jena	PROPN
aiol-6350	547	6	:	:	PUNCT
aiol-6350	547	7	548	548	NUM
aiol-6350	547	8	pp	pp	ADP
aiol-6350	547	9	komárek	komárek	PROPN
aiol-6350	547	10	j	j	PROPN
aiol-6350	547	11	,	,	PUNCT
aiol-6350	547	12	anagnostidis	anagnostidis	ADJ
aiol-6350	547	13	k	k	PROPN
aiol-6350	547	14	,	,	PUNCT
aiol-6350	547	15	2005	2005	NUM
aiol-6350	547	16	.	.	PUNCT
aiol-6350	548	1	[	[	X
aiol-6350	548	2	cyanoprokaryota	cyanoprokaryota	NOUN
aiol-6350	548	3	2	2	NUM
aiol-6350	548	4	.	.	PUNCT
aiol-6350	548	5	teil	teil	PROPN
aiol-6350	548	6	:	:	PUNCT
aiol-6350	548	7	oscillatoriales	oscillatoriale	VERB
aiol-6350	548	8	]	]	PUNCT
aiol-6350	548	9	.	.	PUNCT
aiol-6350	549	1	in	in	ADP
aiol-6350	549	2	:	:	PUNCT
aiol-6350	549	3	h.	h.	PROPN
aiol-6350	549	4	ettl	ettl	PROPN
aiol-6350	549	5	,	,	PUNCT
aiol-6350	549	6	g.	g.	PROPN
aiol-6350	549	7	gärtner	gärtner	PROPN
aiol-6350	549	8	,	,	PUNCT
aiol-6350	549	9	h.	h.	PROPN
aiol-6350	549	10	heynig	heynig	PROPN
aiol-6350	549	11	,	,	PUNCT
aiol-6350	549	12	and	and	CCONJ
aiol-6350	549	13	d.	d.	PROPN
aiol-6350	549	14	mollenhauer	mollenhauer	PROPN
aiol-6350	549	15	(	(	PUNCT
aiol-6350	549	16	eds	ed	NOUN
aiol-6350	549	17	.	.	PUNCT
aiol-6350	549	18	)	)	PUNCT
aiol-6350	549	19	,	,	PUNCT
aiol-6350	550	1	[	[	X
aiol-6350	550	2	süsswasserflora	süsswasserflora	PROPN
aiol-6350	550	3	von	von	PROPN
aiol-6350	550	4	mitteleuropa	mitteleuropa	PROPN
aiol-6350	550	5	19/1].[book	19/1].[book	NUM
aiol-6350	550	6	in	in	ADP
aiol-6350	550	7	german	german	NOUN
aiol-6350	550	8	]	]	PUNCT
aiol-6350	550	9	.	.	PUNCT
aiol-6350	551	1	gustav	gustav	PROPN
aiol-6350	551	2	fischer	fischer	PROPN
aiol-6350	551	3	verlag	verlag	PROPN
aiol-6350	551	4	,	,	PUNCT
aiol-6350	551	5	jena	jena	PROPN
aiol-6350	551	6	:	:	PUNCT
aiol-6350	551	7	759	759	NUM
aiol-6350	551	8	pp	pp	NOUN
aiol-6350	551	9	.	.	PUNCT
aiol-6350	552	1	lakes	lake	NOUN
aiol-6350	552	2	network	network	PROPN
aiol-6350	552	3	,	,	PUNCT
aiol-6350	552	4	2016	2016	NUM
aiol-6350	552	5	.	.	PUNCT
aiol-6350	553	1	lake	lake	NOUN
aiol-6350	553	2	paralimni	paralimni	NOUN
aiol-6350	553	3	.	.	PUNCT
aiol-6350	553	4	accessed	access	VERB
aiol-6350	553	5	on	on	ADP
aiol-6350	553	6	:	:	PUNCT
aiol-6350	553	7	02/24/2017	02/24/2017	NUM
aiol-6350	553	8	.	.	PUNCT
aiol-6350	554	1	available	available	ADJ
aiol-6350	554	2	from	from	ADP
aiol-6350	554	3	:	:	PUNCT
aiol-6350	554	4	http://lakesnetwork.eu/english/lakes/lake-paralimni-2/	http://lakesnetwork.eu/english/lakes/lake-paralimni-2/	PROPN
aiol-6350	554	5	latinopoulos	latinopoulos	PROPN
aiol-6350	554	6	d	d	PROPN
aiol-6350	554	7	,	,	PUNCT
aiol-6350	554	8	ntislidou	ntislidou	NOUN
aiol-6350	554	9	c	c	PROPN
aiol-6350	554	10	,	,	PUNCT
aiol-6350	554	11	kagalou	kagalou	PROPN
aiol-6350	555	1	i	i	PROPN
aiol-6350	555	2	,	,	PUNCT
aiol-6350	555	3	2016	2016	NUM
aiol-6350	555	4	.	.	PUNCT
aiol-6350	556	1	multipurpose	multipurpose	NOUN
aiol-6350	556	2	plans	plan	NOUN
aiol-6350	556	3	for	for	ADP
aiol-6350	556	4	the	the	DET
aiol-6350	556	5	sustainability	sustainability	NOUN
aiol-6350	556	6	of	of	ADP
aiol-6350	556	7	the	the	DET
aiol-6350	556	8	greek	greek	NOUN
aiol-6350	556	9	lakes	lake	NOUN
aiol-6350	556	10	:	:	PUNCT
aiol-6350	556	11	emphasis	emphasis	NOUN
aiol-6350	556	12	on	on	ADP
aiol-6350	556	13	multiple	multiple	ADJ
aiol-6350	556	14	stressors	stressor	NOUN
aiol-6350	556	15	.	.	PUNCT
aiol-6350	557	1	environ	environ	X
aiol-6350	557	2	.	.	PUNCT
aiol-6350	557	3	process	process	NOUN
aiol-6350	557	4	.	.	PUNCT
aiol-6350	558	1	3:589	3:589	NUM
aiol-6350	558	2	.	.	PUNCT
aiol-6350	559	1	loukas	loukas	PROPN
aiol-6350	559	2	a	a	PRON
aiol-6350	559	3	,	,	PUNCT
aiol-6350	559	4	mylopoulos	mylopoulos	PROPN
aiol-6350	559	5	n	n	CCONJ
aiol-6350	559	6	,	,	PUNCT
aiol-6350	559	7	vasiliades	vasiliade	VERB
aiol-6350	559	8	l	l	PROPN
aiol-6350	559	9	,	,	PUNCT
aiol-6350	559	10	2007	2007	NUM
aiol-6350	559	11	.	.	PUNCT
aiol-6350	560	1	a	a	DET
aiol-6350	560	2	modelling	modelling	NOUN
aiol-6350	560	3	system	system	NOUN
aiol-6350	560	4	for	for	ADP
aiol-6350	560	5	the	the	DET
aiol-6350	560	6	evaluation	evaluation	NOUN
aiol-6350	560	7	of	of	ADP
aiol-6350	560	8	water	water	NOUN
aiol-6350	560	9	resources	resource	NOUN
aiol-6350	560	10	management	management	NOUN
aiol-6350	560	11	scenarios	scenario	NOUN
aiol-6350	560	12	in	in	ADP
aiol-6350	560	13	thessaly	thessaly	PROPN
aiol-6350	560	14	,	,	PUNCT
aiol-6350	560	15	greece	greece	PROPN
aiol-6350	560	16	.	.	PUNCT
aiol-6350	561	1	water	water	NOUN
aiol-6350	561	2	resour	resour	NOUN
aiol-6350	561	3	.	.	PUNCT
aiol-6350	562	1	manage	manage	VERB
aiol-6350	562	2	.	.	PUNCT
aiol-6350	563	1	21:1673	21:1673	NUM
aiol-6350	563	2	-	-	SYM
aiol-6350	563	3	702	702	NUM
aiol-6350	563	4	.	.	PUNCT
aiol-6350	563	5	mankiewicz	mankiewicz	NOUN
aiol-6350	563	6	-	-	PUNCT
aiol-6350	563	7	boczek	boczek	NOUN
aiol-6350	563	8	j	j	PROPN
aiol-6350	563	9	,	,	PUNCT
aiol-6350	563	10	kokocinski	kokocinski	PROPN
aiol-6350	563	11	m	m	PROPN
aiol-6350	563	12	,	,	PUNCT
aiol-6350	563	13	gagala	gagala	PROPN
aiol-6350	563	14	i	i	PRON
aiol-6350	563	15	,	,	PUNCT
aiol-6350	563	16	pawelczyk	pawelczyk	VERB
aiol-6350	563	17	j	j	PROPN
aiol-6350	563	18	,	,	PUNCT
aiol-6350	563	19	jurczak	jurczak	PROPN
aiol-6350	563	20	t	t	PROPN
aiol-6350	563	21	,	,	PUNCT
aiol-6350	563	22	dziadek	dziadek	PROPN
aiol-6350	563	23	j	j	PROPN
aiol-6350	563	24	,	,	PUNCT
aiol-6350	563	25	2012	2012	NUM
aiol-6350	563	26	.	.	PUNCT
aiol-6350	564	1	preliminary	preliminary	ADJ
aiol-6350	564	2	molecular	molecular	ADJ
aiol-6350	564	3	identification	identification	NOUN
aiol-6350	564	4	of	of	ADP
aiol-6350	564	5	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	564	6	-	-	PUNCT
aiol-6350	564	7	producing	produce	VERB
aiol-6350	564	8	cyanobacteria	cyanobacteria	NOUN
aiol-6350	564	9	in	in	ADP
aiol-6350	564	10	two	two	NUM
aiol-6350	564	11	polish	polish	ADJ
aiol-6350	564	12	lakes	lake	NOUN
aiol-6350	564	13	(	(	PUNCT
aiol-6350	564	14	central	central	ADJ
aiol-6350	564	15	europe	europe	PROPN
aiol-6350	564	16	)	)	PUNCT
aiol-6350	564	17	.	.	PUNCT
aiol-6350	565	1	microbiol	microbiol	PROPN
aiol-6350	565	2	.	.	PUNCT
aiol-6350	566	1	lett	lett	PROPN
aiol-6350	566	2	.	.	PUNCT
aiol-6350	567	1	326:173	326:173	NUM
aiol-6350	567	2	-	-	SYM
aiol-6350	567	3	179	179	NUM
aiol-6350	567	4	.	.	PUNCT
aiol-6350	568	1	mantzouki	mantzouki	PROPN
aiol-6350	568	2	e	e	NOUN
aiol-6350	568	3	,	,	PUNCT
aiol-6350	568	4	visser	visser	PROPN
aiol-6350	568	5	pm	pm	PROPN
aiol-6350	568	6	,	,	PUNCT
aiol-6350	568	7	bormans	bormans	PROPN
aiol-6350	568	8	m	m	PROPN
aiol-6350	568	9	,	,	PUNCT
aiol-6350	568	10	ibelings	ibeling	VERB
aiol-6350	568	11	bw	bw	NOUN
aiol-6350	568	12	.	.	PROPN
aiol-6350	568	13	2016	2016	NUM
aiol-6350	568	14	.	.	PUNCT
aiol-6350	569	1	understanding	understand	VERB
aiol-6350	569	2	the	the	DET
aiol-6350	569	3	key	key	ADJ
aiol-6350	569	4	ecological	ecological	ADJ
aiol-6350	569	5	traits	trait	NOUN
aiol-6350	569	6	of	of	ADP
aiol-6350	569	7	cyanobacteria	cyanobacteria	NOUN
aiol-6350	569	8	as	as	ADP
aiol-6350	569	9	a	a	DET
aiol-6350	569	10	basis	basis	NOUN
aiol-6350	569	11	for	for	ADP
aiol-6350	569	12	their	their	PRON
aiol-6350	569	13	management	management	NOUN
aiol-6350	569	14	and	and	CCONJ
aiol-6350	569	15	control	control	NOUN
aiol-6350	569	16	in	in	ADP
aiol-6350	569	17	changing	change	VERB
aiol-6350	569	18	lakes	lake	NOUN
aiol-6350	569	19	.	.	PUNCT
aiol-6350	570	1	aquat	aquat	PROPN
aiol-6350	570	2	.	.	PUNCT
aiol-6350	571	1	ecol	ecol	PROPN
aiol-6350	571	2	.	.	PUNCT
aiol-6350	572	1	50:333	50:333	ADV
aiol-6350	572	2	-	-	SYM
aiol-6350	572	3	350	350	NUM
aiol-6350	572	4	.	.	PUNCT
aiol-6350	572	5	mischke	mischke	PROPN
aiol-6350	572	6	u	u	PROPN
aiol-6350	572	7	,	,	PUNCT
aiol-6350	572	8	nixdorf	nixdorf	PROPN
aiol-6350	572	9	b	b	PROPN
aiol-6350	572	10	,	,	PUNCT
aiol-6350	572	11	2003	2003	NUM
aiol-6350	572	12	.	.	PUNCT
aiol-6350	573	1	equilibrium	equilibrium	NOUN
aiol-6350	573	2	phase	phase	NOUN
aiol-6350	573	3	conditions	condition	NOUN
aiol-6350	573	4	in	in	ADP
aiol-6350	573	5	shallow	shallow	ADJ
aiol-6350	573	6	german	german	ADJ
aiol-6350	573	7	lakes	lake	NOUN
aiol-6350	573	8	:	:	PUNCT
aiol-6350	573	9	how	how	SCONJ
aiol-6350	573	10	cyanoprokaryota	cyanoprokaryota	ADJ
aiol-6350	573	11	species	specie	NOUN
aiol-6350	573	12	establish	establish	VERB
aiol-6350	573	13	a	a	DET
aiol-6350	573	14	steady	steady	ADJ
aiol-6350	573	15	state	state	NOUN
aiol-6350	573	16	phase	phase	NOUN
aiol-6350	573	17	in	in	ADP
aiol-6350	573	18	late	late	ADJ
aiol-6350	573	19	summer	summer	NOUN
aiol-6350	573	20	.	.	PUNCT
aiol-6350	574	1	hydrobiologia	hydrobiologia	PROPN
aiol-6350	574	2	502:123	502:123	PROPN
aiol-6350	574	3	-	-	SYM
aiol-6350	574	4	132	132	NUM
aiol-6350	574	5	.	.	PUNCT
aiol-6350	575	1	mischke	mischke	PROPN
aiol-6350	575	2	u	u	PROPN
aiol-6350	575	3	,	,	PUNCT
aiol-6350	575	4	2003	2003	NUM
aiol-6350	575	5	.	.	PUNCT
aiol-6350	576	1	cyanobacteria	cyanobacteria	NOUN
aiol-6350	576	2	associations	association	NOUN
aiol-6350	576	3	in	in	ADP
aiol-6350	576	4	shallow	shallow	ADJ
aiol-6350	576	5	polytrophic	polytrophic	ADJ
aiol-6350	576	6	lakes	lake	NOUN
aiol-6350	576	7	:	:	PUNCT
aiol-6350	576	8	influence	influence	NOUN
aiol-6350	576	9	of	of	ADP
aiol-6350	576	10	environmental	environmental	ADJ
aiol-6350	576	11	factors	factor	NOUN
aiol-6350	576	12	.	.	PUNCT
aiol-6350	577	1	acta	acta	PROPN
aiol-6350	577	2	oecologica	oecologica	PROPN
aiol-6350	577	3	24	24	NUM
aiol-6350	577	4	:	:	PUNCT
aiol-6350	577	5	s11	s11	NOUN
aiol-6350	577	6	-	-	PUNCT
aiol-6350	577	7	s23	s23	NOUN
aiol-6350	577	8	.	.	PUNCT
aiol-6350	578	1	moustakagouni	moustakagouni	PROPN
aiol-6350	578	2	m	m	PROPN
aiol-6350	578	3	,	,	PUNCT
aiol-6350	578	4	michaloudi	michaloudi	PROPN
aiol-6350	578	5	e	e	NOUN
aiol-6350	578	6	,	,	PUNCT
aiol-6350	578	7	sommer	sommer	NOUN
aiol-6350	578	8	u	u	NOUN
aiol-6350	578	9	,	,	PUNCT
aiol-6350	578	10	2014	2014	NUM
aiol-6350	578	11	.	.	PUNCT
aiol-6350	579	1	modifying	modify	VERB
aiol-6350	579	2	the	the	DET
aiol-6350	579	3	peg	peg	NOUN
aiol-6350	579	4	model	model	NOUN
aiol-6350	579	5	for	for	ADP
aiol-6350	579	6	mediterranean	mediterranean	PROPN
aiol-6350	579	7	lakes	lake	NOUN
aiol-6350	579	8	–	–	PUNCT
aiol-6350	579	9	no	no	DET
aiol-6350	579	10	biological	biological	ADJ
aiol-6350	579	11	winter	winter	NOUN
aiol-6350	579	12	and	and	CCONJ
aiol-6350	579	13	strong	strong	ADJ
aiol-6350	579	14	fish	fish	NOUN
aiol-6350	579	15	predation	predation	NOUN
aiol-6350	579	16	.	.	PUNCT
aiol-6350	580	1	freshwater	freshwater	PROPN
aiol-6350	580	2	biol	biol	PROPN
aiol-6350	580	3	.	.	PUNCT
aiol-6350	581	1	59:11361144	59:11361144	X
aiol-6350	581	2	.	.	PUNCT
aiol-6350	582	1	moustaka	moustaka	PROPN
aiol-6350	582	2	-	-	PUNCT
aiol-6350	582	3	gouni	gouni	PROPN
aiol-6350	582	4	m	m	PROPN
aiol-6350	582	5	,	,	PUNCT
aiol-6350	582	6	hiskia	hiskia	VERB
aiol-6350	582	7	a	a	PRON
aiol-6350	582	8	,	,	PUNCT
aiol-6350	582	9	genitsaris	genitsaris	PROPN
aiol-6350	582	10	s	s	PROPN
aiol-6350	582	11	,	,	PUNCT
aiol-6350	582	12	katsiapi	katsiapi	PROPN
aiol-6350	582	13	m	m	PROPN
aiol-6350	582	14	,	,	PUNCT
aiol-6350	582	15	manolidi	manolidi	PROPN
aiol-6350	582	16	k	k	PROPN
aiol-6350	582	17	,	,	PUNCT
aiol-6350	582	18	zervou	zervou	PROPN
aiol-6350	582	19	s	s	PROPN
aiol-6350	582	20	-	-	PROPN
aiol-6350	582	21	k	k	NOUN
aiol-6350	582	22	,	,	PUNCT
aiol-6350	582	23	christophoridis	christophoridi	NOUN
aiol-6350	582	24	c	c	PROPN
aiol-6350	582	25	,	,	PUNCT
aiol-6350	582	26	triantis	triantis	PROPN
aiol-6350	582	27	tm	tm	PROPN
aiol-6350	582	28	,	,	PUNCT
aiol-6350	582	29	kaloudis	kaloudis	PROPN
aiol-6350	582	30	t	t	PROPN
aiol-6350	582	31	,	,	PUNCT
aiol-6350	582	32	orfanidis	orfanidis	PROPN
aiol-6350	582	33	s	s	PROPN
aiol-6350	582	34	,	,	PUNCT
aiol-6350	582	35	2016	2016	NUM
aiol-6350	582	36	.	.	PUNCT
aiol-6350	583	1	first	first	ADJ
aiol-6350	583	2	report	report	NOUN
aiol-6350	583	3	of	of	ADP
aiol-6350	583	4	aphanizomenon	aphanizomenon	NOUN
aiol-6350	583	5	favaloroi	favaloroi	NOUN
aiol-6350	583	6	occurrence	occurrence	NOUN
aiol-6350	583	7	in	in	ADP
aiol-6350	583	8	europe	europe	PROPN
aiol-6350	583	9	associated	associate	VERB
aiol-6350	583	10	with	with	ADP
aiol-6350	583	11	saxitoxins	saxitoxin	NOUN
aiol-6350	583	12	and	and	CCONJ
aiol-6350	583	13	a	a	DET
aiol-6350	583	14	massive	massive	ADJ
aiol-6350	583	15	fish	fish	NOUN
aiol-6350	583	16	kill	kill	NOUN
aiol-6350	583	17	in	in	ADP
aiol-6350	583	18	lake	lake	PROPN
aiol-6350	583	19	vistonis	vistonis	PROPN
aiol-6350	583	20	,	,	PUNCT
aiol-6350	583	21	greece	greece	PROPN
aiol-6350	583	22	.	.	PUNCT
aiol-6350	584	1	mar	mar	PROPN
aiol-6350	584	2	.	.	PROPN
aiol-6350	584	3	freshwater	freshwater	PROPN
aiol-6350	584	4	res	res	PROPN
aiol-6350	584	5	.	.	PUNCT
aiol-6350	585	1	doi	doi	PROPN
aiol-6350	585	2	:	:	PUNCT
aiol-6350	585	3	http://dx.doi.org/10.1071/mf16029	http://dx.doi.org/10.1071/mf16029	PROPN
aiol-6350	585	4	nonneman	nonneman	PROPN
aiol-6350	585	5	d	d	PROPN
aiol-6350	585	6	,	,	PUNCT
aiol-6350	585	7	zimba	zimba	NOUN
aiol-6350	585	8	p	p	X
aiol-6350	585	9	,	,	PUNCT
aiol-6350	585	10	2002	2002	NUM
aiol-6350	585	11	.	.	PUNCT
aiol-6350	586	1	a	a	DET
aiol-6350	586	2	pcr	pcr	NOUN
aiol-6350	586	3	-	-	PUNCT
aiol-6350	586	4	based	base	VERB
aiol-6350	586	5	test	test	NOUN
aiol-6350	586	6	to	to	PART
aiol-6350	586	7	assess	assess	VERB
aiol-6350	586	8	the	the	DET
aiol-6350	586	9	potential	potential	NOUN
aiol-6350	586	10	for	for	ADP
aiol-6350	586	11	microcystin	microcystin	ADJ
aiol-6350	586	12	occurrence	occurrence	NOUN
aiol-6350	586	13	in	in	ADP
aiol-6350	586	14	channel	channel	NOUN
aiol-6350	586	15	catfish	catfish	NOUN
aiol-6350	586	16	production	production	NOUN
aiol-6350	586	17	ponds	pond	NOUN
aiol-6350	586	18	.	.	PUNCT
aiol-6350	587	1	j.	j.	PROPN
aiol-6350	587	2	phycol	phycol	PROPN
aiol-6350	587	3	.	.	PUNCT
aiol-6350	588	1	38:230	38:230	NUM
aiol-6350	588	2	-	-	SYM
aiol-6350	588	3	234	234	NUM
aiol-6350	588	4	.	.	PUNCT
aiol-6350	589	1	o’neil	o’neil	PROPN
aiol-6350	589	2	jm	jm	PROPN
aiol-6350	589	3	,	,	PUNCT
aiol-6350	589	4	davis	davis	PROPN
aiol-6350	589	5	tw	tw	PROPN
aiol-6350	589	6	,	,	PUNCT
aiol-6350	589	7	burford	burford	PROPN
aiol-6350	589	8	ma	ma	PROPN
aiol-6350	589	9	,	,	PUNCT
aiol-6350	589	10	gobler	gobler	NOUN
aiol-6350	589	11	cj	cj	PROPN
aiol-6350	589	12	,	,	PUNCT
aiol-6350	589	13	2012	2012	NUM
aiol-6350	589	14	.	.	PUNCT
aiol-6350	590	1	the	the	DET
aiol-6350	590	2	rise	rise	NOUN
aiol-6350	590	3	of	of	ADP
aiol-6350	590	4	harmful	harmful	ADJ
aiol-6350	590	5	cyanobacteria	cyanobacteria	NOUN
aiol-6350	590	6	blooms	bloom	NOUN
aiol-6350	590	7	:	:	PUNCT
aiol-6350	590	8	the	the	DET
aiol-6350	590	9	potential	potential	ADJ
aiol-6350	590	10	roles	role	NOUN
aiol-6350	590	11	of	of	ADP
aiol-6350	590	12	eutrophication	eutrophication	NOUN
aiol-6350	590	13	and	and	CCONJ
aiol-6350	590	14	climate	climate	NOUN
aiol-6350	590	15	change	change	NOUN
aiol-6350	590	16	.	.	PUNCT
aiol-6350	591	1	harmful	harmful	ADJ
aiol-6350	591	2	algae	algae	NOUN
aiol-6350	591	3	14:313	14:313	NUM
aiol-6350	591	4	-	-	SYM
aiol-6350	591	5	334	334	NUM
aiol-6350	591	6	.	.	PUNCT
aiol-6350	592	1	oikonomou	oikonomou	PROPN
aiol-6350	592	2	a	a	PRON
aiol-6350	592	3	,	,	PUNCT
aiol-6350	592	4	katsiapi	katsiapi	PROPN
aiol-6350	592	5	m	m	PROPN
aiol-6350	592	6	,	,	PUNCT
aiol-6350	592	7	karayanni	karayanni	PROPN
aiol-6350	592	8	h	h	PROPN
aiol-6350	592	9	,	,	PUNCT
aiol-6350	592	10	moustaka	moustaka	PROPN
aiol-6350	592	11	-	-	PUNCT
aiol-6350	592	12	gouni	gouni	PROPN
aiol-6350	592	13	m	m	PROPN
aiol-6350	592	14	,	,	PUNCT
aiol-6350	592	15	kormas	kormas	PROPN
aiol-6350	592	16	,	,	PUNCT
aiol-6350	592	17	k	k	PROPN
aiol-6350	592	18	,	,	PUNCT
aiol-6350	592	19	2012	2012	NUM
aiol-6350	592	20	.	.	PUNCT
aiol-6350	593	1	plankton	plankton	NOUN
aiol-6350	593	2	microorganisms	microorganism	NOUN
aiol-6350	593	3	coinciding	coincide	VERB
aiol-6350	593	4	with	with	ADP
aiol-6350	593	5	two	two	NUM
aiol-6350	593	6	consecutive	consecutive	ADJ
aiol-6350	593	7	mass	mass	NOUN
aiol-6350	593	8	fish	fish	NOUN
aiol-6350	593	9	kills	kill	VERB
aiol-6350	593	10	in	in	ADP
aiol-6350	593	11	a	a	DET
aiol-6350	593	12	newly	newly	ADV
aiol-6350	593	13	reconstructed	reconstruct	VERB
aiol-6350	593	14	lake	lake	NOUN
aiol-6350	593	15	.	.	PUNCT
aiol-6350	594	1	sci	sci	PROPN
aiol-6350	594	2	.	.	PROPN
aiol-6350	594	3	world	world	PROPN
aiol-6350	594	4	j.	j.	PROPN
aiol-6350	594	5	2012:1	2012:1	NUM
aiol-6350	594	6	-	-	SYM
aiol-6350	594	7	14	14	NUM
aiol-6350	594	8	.	.	PUNCT
aiol-6350	595	1	ouahid	ouahid	PROPN
aiol-6350	595	2	y	y	PROPN
aiol-6350	595	3	,	,	PUNCT
aiol-6350	595	4	pérez	pérez	NOUN
aiol-6350	595	5	-	-	PUNCT
aiol-6350	595	6	silva	silva	NOUN
aiol-6350	595	7	g	g	PROPN
aiol-6350	595	8	,	,	PUNCT
aiol-6350	595	9	campo	campo	PROPN
aiol-6350	595	10	ffd	ffd	PROPN
aiol-6350	595	11	,	,	PUNCT
aiol-6350	595	12	2005	2005	NUM
aiol-6350	595	13	.	.	PUNCT
aiol-6350	596	1	identification	identification	NOUN
aiol-6350	596	2	of	of	ADP
aiol-6350	596	3	potentially	potentially	ADV
aiol-6350	596	4	toxic	toxic	ADJ
aiol-6350	596	5	environmental	environmental	ADJ
aiol-6350	596	6	microcystis	microcystis	NOUN
aiol-6350	596	7	by	by	ADP
aiol-6350	596	8	individual	individual	ADJ
aiol-6350	596	9	and	and	CCONJ
aiol-6350	596	10	multiple	multiple	ADJ
aiol-6350	596	11	pcr	pcr	ADJ
aiol-6350	596	12	amplification	amplification	NOUN
aiol-6350	596	13	of	of	ADP
aiol-6350	596	14	specific	specific	ADJ
aiol-6350	596	15	microcystin	microcystin	ADJ
aiol-6350	596	16	synthetase	synthetase	NOUN
aiol-6350	596	17	gene	gene	NOUN
aiol-6350	596	18	regions	region	NOUN
aiol-6350	596	19	.	.	PUNCT
aiol-6350	597	1	environ	environ	PROPN
aiol-6350	597	2	.	.	PUNCT
aiol-6350	598	1	toxicol	toxicol	PROPN
aiol-6350	598	2	.	.	PUNCT
aiol-6350	599	1	20:235	20:235	NUM
aiol-6350	599	2	-	-	SYM
aiol-6350	599	3	242	242	NUM
aiol-6350	599	4	.	.	PUNCT
aiol-6350	600	1	padisák	padisák	PROPN
aiol-6350	600	2	j	j	PROPN
aiol-6350	600	3	,	,	PUNCT
aiol-6350	600	4	borics	borics	NOUN
aiol-6350	600	5	g	g	NOUN
aiol-6350	600	6	,	,	PUNCT
aiol-6350	600	7	grigorszky	grigorszky	ADJ
aiol-6350	600	8	i	i	PRON
aiol-6350	600	9	,	,	PUNCT
aiol-6350	600	10	soróczki	soróczki	NOUN
aiol-6350	600	11	-	-	PUNCT
aiol-6350	600	12	pintér	pintér	NOUN
aiol-6350	600	13	é	é	PROPN
aiol-6350	600	14	,	,	PUNCT
aiol-6350	600	15	2006	2006	NUM
aiol-6350	600	16	.	.	PUNCT
aiol-6350	601	1	use	use	NOUN
aiol-6350	601	2	of	of	ADP
aiol-6350	601	3	phytoplankton	phytoplankton	NOUN
aiol-6350	601	4	assemblages	assemblage	NOUN
aiol-6350	601	5	for	for	ADP
aiol-6350	601	6	monitoring	monitor	VERB
aiol-6350	601	7	ecological	ecological	ADJ
aiol-6350	601	8	status	status	NOUN
aiol-6350	601	9	of	of	ADP
aiol-6350	601	10	lakes	lake	NOUN
aiol-6350	601	11	within	within	ADP
aiol-6350	601	12	the	the	DET
aiol-6350	601	13	water	water	NOUN
aiol-6350	601	14	framework	framework	NOUN
aiol-6350	601	15	directive	directive	NOUN
aiol-6350	601	16	:	:	PUNCT
aiol-6350	601	17	the	the	DET
aiol-6350	601	18	assemblage	assemblage	NOUN
aiol-6350	601	19	index	index	NOUN
aiol-6350	601	20	.	.	PUNCT
aiol-6350	602	1	hydrobiologia	hydrobiologia	NOUN
aiol-6350	602	2	,	,	PUNCT
aiol-6350	602	3	553:1	553:1	NOUN
aiol-6350	602	4	-	-	SYM
aiol-6350	602	5	14	14	NUM
aiol-6350	602	6	.	.	PUNCT
aiol-6350	603	1	paerl	paerl	PROPN
aiol-6350	603	2	hw	hw	PROPN
aiol-6350	603	3	,	,	PUNCT
aiol-6350	603	4	2014	2014	NUM
aiol-6350	603	5	.	.	PUNCT
aiol-6350	604	1	mitigating	mitigate	VERB
aiol-6350	604	2	harmful	harmful	ADJ
aiol-6350	604	3	cyanobacterial	cyanobacterial	ADJ
aiol-6350	604	4	blooms	bloom	NOUN
aiol-6350	604	5	in	in	ADP
aiol-6350	604	6	a	a	DET
aiol-6350	604	7	humanand	humanand	NOUN
aiol-6350	604	8	climatically	climatically	ADV
aiol-6350	604	9	-	-	PUNCT
aiol-6350	604	10	impacted	impact	VERB
aiol-6350	604	11	world	world	NOUN
aiol-6350	604	12	.	.	PUNCT
aiol-6350	605	1	life	life	NOUN
aiol-6350	605	2	.	.	PUNCT
aiol-6350	606	1	4:988	4:988	NOUN
aiol-6350	606	2	-	-	SYM
aiol-6350	606	3	1012	1012	NUM
aiol-6350	606	4	.	.	PUNCT
aiol-6350	607	1	paerl	paerl	PROPN
aiol-6350	607	2	hw	hw	PROPN
aiol-6350	607	3	,	,	PUNCT
aiol-6350	607	4	hall	hall	PROPN
aiol-6350	607	5	ns	ns	NOUN
aiol-6350	607	6	,	,	PUNCT
aiol-6350	607	7	calandrino	calandrino	NOUN
aiol-6350	607	8	es	es	NOUN
aiol-6350	607	9	,	,	PUNCT
aiol-6350	607	10	2011	2011	NUM
aiol-6350	607	11	.	.	PUNCT
aiol-6350	608	1	controlling	control	VERB
aiol-6350	608	2	harmful	harmful	ADJ
aiol-6350	608	3	cyanobacterial	cyanobacterial	ADJ
aiol-6350	608	4	blooms	bloom	NOUN
aiol-6350	608	5	in	in	ADP
aiol-6350	608	6	a	a	DET
aiol-6350	608	7	world	world	NOUN
aiol-6350	608	8	experiencing	experience	VERB
aiol-6350	608	9	anthropogenic	anthropogenic	ADJ
aiol-6350	608	10	and	and	CCONJ
aiol-6350	608	11	climatic	climatic	ADJ
aiol-6350	608	12	-	-	PUNCT
aiol-6350	608	13	induced	induce	VERB
aiol-6350	608	14	change	change	NOUN
aiol-6350	608	15	.	.	PUNCT
aiol-6350	609	1	sci	sci	PROPN
aiol-6350	609	2	.	.	PUNCT
aiol-6350	609	3	total	total	PROPN
aiol-6350	609	4	environ	environ	PROPN
aiol-6350	609	5	.	.	PUNCT
aiol-6350	610	1	409:1739	409:1739	NUM
aiol-6350	610	2	-	-	SYM
aiol-6350	610	3	1745	1745	NUM
aiol-6350	610	4	.	.	PUNCT
aiol-6350	611	1	paerl	paerl	PROPN
aiol-6350	611	2	hw	hw	PROPN
aiol-6350	611	3	,	,	PUNCT
aiol-6350	611	4	otten	otten	PROPN
aiol-6350	611	5	gt	gt	PROPN
aiol-6350	611	6	,	,	PUNCT
aiol-6350	611	7	2013	2013	NUM
aiol-6350	611	8	.	.	PUNCT
aiol-6350	612	1	harmful	harmful	ADJ
aiol-6350	612	2	cyanobacterial	cyanobacterial	ADJ
aiol-6350	612	3	blooms	bloom	NOUN
aiol-6350	612	4	,	,	PUNCT
aiol-6350	612	5	causes	cause	NOUN
aiol-6350	612	6	,	,	PUNCT
aiol-6350	612	7	consequences	consequence	NOUN
aiol-6350	612	8	,	,	PUNCT
aiol-6350	612	9	and	and	CCONJ
aiol-6350	612	10	controls	control	NOUN
aiol-6350	612	11	.	.	PUNCT
aiol-6350	613	1	microb	microb	PROPN
aiol-6350	613	2	.	.	PUNCT
aiol-6350	614	1	ecol	ecol	PROPN
aiol-6350	614	2	.	.	PUNCT
aiol-6350	615	1	65:995	65:995	NUM
aiol-6350	615	2	–	–	PUNCT
aiol-6350	615	3	1010	1010	NUM
aiol-6350	615	4	.	.	PUNCT
aiol-6350	616	1	paerl	paerl	PROPN
aiol-6350	616	2	hw	hw	PROPN
aiol-6350	616	3	,	,	PUNCT
aiol-6350	616	4	paul	paul	PROPN
aiol-6350	616	5	v	v	PROPN
aiol-6350	616	6	,	,	PUNCT
aiol-6350	616	7	2012	2012	NUM
aiol-6350	616	8	.	.	PUNCT
aiol-6350	617	1	climate	climate	NOUN
aiol-6350	617	2	change	change	NOUN
aiol-6350	617	3	:	:	PUNCT
aiol-6350	617	4	links	link	NOUN
aiol-6350	617	5	to	to	ADP
aiol-6350	617	6	global	global	ADJ
aiol-6350	617	7	expansion	expansion	NOUN
aiol-6350	617	8	of	of	ADP
aiol-6350	617	9	harmful	harmful	ADJ
aiol-6350	617	10	cyanobacteria	cyanobacteria	NOUN
aiol-6350	617	11	.	.	PUNCT
aiol-6350	618	1	water	water	NOUN
aiol-6350	618	2	res	re	NOUN
aiol-6350	618	3	.	.	PUNCT
aiol-6350	619	1	46:1349	46:1349	NUM
aiol-6350	619	2	-	-	SYM
aiol-6350	619	3	1363	1363	NUM
aiol-6350	619	4	.	.	PUNCT
aiol-6350	620	1	papadimitriou	papadimitriou	VERB
aiol-6350	620	2	t	t	PROPN
aiol-6350	620	3	,	,	PUNCT
aiol-6350	620	4	katsiapi	katsiapi	PROPN
aiol-6350	620	5	m	m	PROPN
aiol-6350	620	6	,	,	PUNCT
aiol-6350	620	7	kormas	kormas	PROPN
aiol-6350	620	8	ka	ka	PROPN
aiol-6350	620	9	,	,	PUNCT
aiol-6350	620	10	moustaka	moustaka	PROPN
aiol-6350	620	11	-	-	PUNCT
aiol-6350	620	12	gouni	gouni	PROPN
aiol-6350	620	13	m	m	PROPN
aiol-6350	620	14	,	,	PUNCT
aiol-6350	620	15	kagalou	kagalou	PROPN
aiol-6350	620	16	i	i	PRON
aiol-6350	620	17	,	,	PUNCT
aiol-6350	620	18	2013	2013	NUM
aiol-6350	620	19	.	.	PUNCT
aiol-6350	621	1	artificially	artificially	ADV
aiol-6350	621	2	-	-	PUNCT
aiol-6350	621	3	born	bear	VERB
aiol-6350	621	4	“	"	PUNCT
aiol-6350	621	5	killer	killer	NOUN
aiol-6350	621	6	”	"	PUNCT
aiol-6350	621	7	lake	lake	NOUN
aiol-6350	621	8	:	:	PUNCT
aiol-6350	621	9	phytoplankton	phytoplankton	NOUN
aiol-6350	621	10	based	base	VERB
aiol-6350	621	11	water	water	NOUN
aiol-6350	621	12	quality	quality	NOUN
aiol-6350	621	13	and	and	CCONJ
aiol-6350	621	14	microcystin	microcystin	NOUN
aiol-6350	621	15	affected	affected	ADJ
aiol-6350	621	16	fish	fish	NOUN
aiol-6350	621	17	in	in	ADP
aiol-6350	621	18	a	a	DET
aiol-6350	621	19	reconstructed	reconstructed	ADJ
aiol-6350	621	20	lake	lake	NOUN
aiol-6350	621	21	.	.	PUNCT
aiol-6350	622	1	sci	sci	PROPN
aiol-6350	622	2	.	.	PUNCT
aiol-6350	622	3	total	total	PROPN
aiol-6350	622	4	environ	environ	PROPN
aiol-6350	622	5	.	.	PUNCT
aiol-6350	623	1	452	452	NUM
aiol-6350	623	2	-	-	PUNCT
aiol-6350	623	3	453:116	453:116	NUM
aiol-6350	623	4	-	-	PUNCT
aiol-6350	623	5	124	124	NUM
aiol-6350	623	6	.	.	PUNCT
aiol-6350	624	1	preußel	preußel	VERB
aiol-6350	624	2	k	k	PROPN
aiol-6350	624	3	,	,	PUNCT
aiol-6350	624	4	wessel	wessel	PROPN
aiol-6350	624	5	g	g	PROPN
aiol-6350	624	6	,	,	PUNCT
aiol-6350	624	7	fastner	fastner	PROPN
aiol-6350	624	8	j	j	PROPN
aiol-6350	624	9	,	,	PUNCT
aiol-6350	624	10	chorus	chorus	VERB
aiol-6350	624	11	i	i	PRON
aiol-6350	624	12	,	,	PUNCT
aiol-6350	624	13	2009	2009	NUM
aiol-6350	624	14	.	.	PUNCT
aiol-6350	625	1	response	response	NOUN
aiol-6350	625	2	of	of	ADP
aiol-6350	625	3	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	625	4	production	production	NOUN
aiol-6350	625	5	and	and	CCONJ
aiol-6350	625	6	release	release	NOUN
aiol-6350	625	7	in	in	ADP
aiol-6350	625	8	aphanizomenon	aphanizomenon	NOUN
aiol-6350	625	9	flos	flos	PROPN
aiol-6350	625	10	-	-	PUNCT
aiol-6350	625	11	aquae	aquae	PROPN
aiol-6350	625	12	(	(	PUNCT
aiol-6350	625	13	cyanobacteria	cyanobacteria	PROPN
aiol-6350	625	14	)	)	PUNCT
aiol-6350	625	15	to	to	ADP
aiol-6350	625	16	varying	vary	VERB
aiol-6350	625	17	light	light	ADJ
aiol-6350	625	18	and	and	CCONJ
aiol-6350	625	19	temperature	temperature	NOUN
aiol-6350	625	20	conditions	condition	NOUN
aiol-6350	625	21	.	.	PUNCT
aiol-6350	626	1	harmful	harmful	ADJ
aiol-6350	626	2	algae	algae	NOUN
aiol-6350	626	3	8:645	8:645	PROPN
aiol-6350	626	4	-	-	SYM
aiol-6350	626	5	650	650	NUM
aiol-6350	626	6	.	.	PUNCT
aiol-6350	627	1	reynolds	reynolds	PROPN
aiol-6350	627	2	cs	cs	PROPN
aiol-6350	627	3	,	,	PUNCT
aiol-6350	627	4	huszar	huszar	NOUN
aiol-6350	627	5	v	v	PROPN
aiol-6350	627	6	,	,	PUNCT
aiol-6350	627	7	kruk	kruk	PROPN
aiol-6350	627	8	c	c	PROPN
aiol-6350	627	9	,	,	PUNCT
aiol-6350	627	10	naselli	naselli	ADJ
aiol-6350	627	11	-	-	PUNCT
aiol-6350	627	12	flores	flores	PROPN
aiol-6350	627	13	l	l	PROPN
aiol-6350	627	14	,	,	PUNCT
aiol-6350	627	15	melo	melo	PROPN
aiol-6350	627	16	s	s	PROPN
aiol-6350	627	17	,	,	PUNCT
aiol-6350	627	18	2002	2002	NUM
aiol-6350	627	19	.	.	PUNCT
aiol-6350	628	1	towards	towards	ADP
aiol-6350	628	2	a	a	DET
aiol-6350	628	3	functional	functional	ADJ
aiol-6350	628	4	classification	classification	NOUN
aiol-6350	628	5	of	of	ADP
aiol-6350	628	6	the	the	DET
aiol-6350	628	7	freshwater	freshwater	NOUN
aiol-6350	628	8	phytoplankton	phytoplankton	NOUN
aiol-6350	628	9	.	.	PUNCT
aiol-6350	629	1	j.	j.	PROPN
aiol-6350	629	2	plankton	plankton	PROPN
aiol-6350	629	3	res	re	NOUN
aiol-6350	629	4	.	.	PUNCT
aiol-6350	630	1	24:417	24:417	NUM
aiol-6350	630	2	-	-	PUNCT
aiol-6350	630	3	428	428	NUM
aiol-6350	630	4	.	.	PUNCT
aiol-6350	631	1	romo	romo	PROPN
aiol-6350	631	2	s	s	PROPN
aiol-6350	631	3	,	,	PUNCT
aiol-6350	631	4	miracle	miracle	PROPN
aiol-6350	631	5	mr	mr	PROPN
aiol-6350	631	6	,	,	PUNCT
aiol-6350	631	7	villena	villena	PROPN
aiol-6350	631	8	mj	mj	PROPN
aiol-6350	631	9	,	,	PUNCT
aiol-6350	631	10	rueda	rueda	PROPN
aiol-6350	631	11	m	m	PROPN
aiol-6350	631	12	,	,	PUNCT
aiol-6350	631	13	ferriol	ferriol	PROPN
aiol-6350	631	14	c	c	NOUN
aiol-6350	631	15	,	,	PUNCT
aiol-6350	631	16	vicente	vicente	PROPN
aiol-6350	631	17	e	e	PROPN
aiol-6350	631	18	,	,	PUNCT
aiol-6350	631	19	2004	2004	NUM
aiol-6350	631	20	.	.	PUNCT
aiol-6350	632	1	mesocosm	mesocosm	ADJ
aiol-6350	632	2	experiments	experiment	NOUN
aiol-6350	632	3	on	on	ADP
aiol-6350	632	4	nutrient	nutrient	NOUN
aiol-6350	632	5	and	and	CCONJ
aiol-6350	632	6	fish	fish	NOUN
aiol-6350	632	7	effects	effect	NOUN
aiol-6350	632	8	on	on	ADP
aiol-6350	632	9	shallow	shallow	PROPN
aiol-6350	632	10	lake	lake	NOUN
aiol-6350	632	11	food	food	NOUN
aiol-6350	632	12	webs	webs	NOUN
aiol-6350	632	13	in	in	ADP
aiol-6350	632	14	a	a	DET
aiol-6350	632	15	mediterranean	mediterranean	ADJ
aiol-6350	632	16	climate	climate	NOUN
aiol-6350	632	17	.	.	PUNCT
aiol-6350	633	1	freshwater	freshwater	PROPN
aiol-6350	633	2	biol	biol	PROPN
aiol-6350	633	3	.	.	PUNCT
aiol-6350	634	1	49:1593	49:1593	NUM
aiol-6350	634	2	-	-	SYM
aiol-6350	634	3	607	607	NUM
aiol-6350	634	4	.	.	PUNCT
aiol-6350	635	1	rücker	rücker	PROPN
aiol-6350	635	2	j	j	PROPN
aiol-6350	635	3	,	,	PUNCT
aiol-6350	635	4	stüken	stüken	VERB
aiol-6350	635	5	a	a	PRON
aiol-6350	635	6	,	,	PUNCT
aiol-6350	635	7	nixdorf	nixdorf	PROPN
aiol-6350	635	8	b	b	PROPN
aiol-6350	635	9	,	,	PUNCT
aiol-6350	635	10	fastner	fastner	PROPN
aiol-6350	635	11	j	j	PROPN
aiol-6350	635	12	,	,	PUNCT
aiol-6350	635	13	chorus	chorus	VERB
aiol-6350	635	14	i	i	PRON
aiol-6350	635	15	,	,	PUNCT
aiol-6350	635	16	wiedner	wiedner	NOUN
aiol-6350	635	17	c	c	NOUN
aiol-6350	635	18	,	,	PUNCT
aiol-6350	635	19	2007	2007	NUM
aiol-6350	635	20	.	.	PUNCT
aiol-6350	636	1	concentrations	concentration	NOUN
aiol-6350	636	2	of	of	ADP
aiol-6350	636	3	particulate	particulate	NOUN
aiol-6350	636	4	and	and	CCONJ
aiol-6350	636	5	dissolved	dissolve	VERB
aiol-6350	636	6	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	636	7	in	in	ADP
aiol-6350	636	8	21	21	NUM
aiol-6350	636	9	aphanizomenon	aphanizomenon	ADV
aiol-6350	636	10	-	-	PUNCT
aiol-6350	636	11	dominated	dominate	VERB
aiol-6350	636	12	temperate	temperate	ADJ
aiol-6350	636	13	lakes	lake	NOUN
aiol-6350	636	14	.	.	PUNCT
aiol-6350	637	1	toxicon	toxicon	PROPN
aiol-6350	637	2	50:800	50:800	NUM
aiol-6350	637	3	-	-	SYM
aiol-6350	637	4	809	809	NUM
aiol-6350	637	5	.	.	PUNCT
aiol-6350	638	1	rzymski	rzymski	VERB
aiol-6350	638	2	p	p	X
aiol-6350	638	3	,	,	PUNCT
aiol-6350	638	4	poniedziałek	poniedziałek	PROPN
aiol-6350	638	5	b	b	PROPN
aiol-6350	638	6	,	,	PUNCT
aiol-6350	638	7	2014	2014	NUM
aiol-6350	638	8	.	.	PUNCT
aiol-6350	639	1	in	in	ADP
aiol-6350	639	2	search	search	NOUN
aiol-6350	639	3	of	of	ADP
aiol-6350	639	4	environmental	environmental	ADJ
aiol-6350	639	5	role	role	NOUN
aiol-6350	639	6	of	of	ADP
aiol-6350	639	7	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	639	8	:	:	PUNCT
aiol-6350	639	9	a	a	DET
aiol-6350	639	10	review	review	NOUN
aiol-6350	639	11	on	on	ADP
aiol-6350	639	12	global	global	ADJ
aiol-6350	639	13	distribution	distribution	NOUN
aiol-6350	639	14	and	and	CCONJ
aiol-6350	639	15	ecology	ecology	NOUN
aiol-6350	639	16	of	of	ADP
aiol-6350	639	17	its	its	PRON
aiol-6350	639	18	producers	producer	NOUN
aiol-6350	639	19	.	.	PUNCT
aiol-6350	640	1	water	water	NOUN
aiol-6350	640	2	research	research	PROPN
aiol-6350	640	3	66:320	66:320	NUM
aiol-6350	640	4	-	-	SYM
aiol-6350	640	5	337	337	NUM
aiol-6350	640	6	.	.	PUNCT
aiol-6350	641	1	saker	saker	PROPN
aiol-6350	641	2	ml	ml	PROPN
aiol-6350	641	3	,	,	PUNCT
aiol-6350	641	4	griffiths	griffiths	PROPN
aiol-6350	641	5	dj	dj	PROPN
aiol-6350	641	6	,	,	PUNCT
aiol-6350	641	7	2000	2000	NUM
aiol-6350	641	8	.	.	PUNCT
aiol-6350	642	1	effects	effect	NOUN
aiol-6350	642	2	of	of	ADP
aiol-6350	642	3	temperature	temperature	NOUN
aiol-6350	642	4	on	on	ADP
aiol-6350	642	5	growth	growth	NOUN
aiol-6350	642	6	and	and	CCONJ
aiol-6350	642	7	cylindrospermopsin	cylindrospermopsin	VERB
aiol-6350	642	8	content	content	NOUN
aiol-6350	642	9	of	of	ADP
aiol-6350	642	10	seven	seven	NUM
aiol-6350	642	11	isolates	isolate	NOUN
aiol-6350	642	12	of	of	ADP
aiol-6350	642	13	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	642	14	raciborskii	raciborskii	ADJ
aiol-6350	642	15	(	(	PUNCT
aiol-6350	642	16	nostocales	nostocale	NOUN
aiol-6350	642	17	,	,	PUNCT
aiol-6350	642	18	cyanophyceae	cyanophyceae	PROPN
aiol-6350	642	19	)	)	PUNCT
aiol-6350	642	20	from	from	ADP
aiol-6350	642	21	water	water	NOUN
aiol-6350	642	22	bodies	body	NOUN
aiol-6350	642	23	in	in	ADP
aiol-6350	642	24	northern	northern	ADJ
aiol-6350	642	25	australia	australia	PROPN
aiol-6350	642	26	.	.	PUNCT
aiol-6350	643	1	phycologia	phycologia	PROPN
aiol-6350	643	2	39:349	39:349	NUM
aiol-6350	643	3	-	-	SYM
aiol-6350	643	4	354	354	NUM
aiol-6350	643	5	.	.	PUNCT
aiol-6350	643	6	water	water	NOUN
aiol-6350	643	7	quality	quality	NOUN
aiol-6350	643	8	and	and	CCONJ
aiol-6350	643	9	cyanotoxins	cyanotoxin	NOUN
aiol-6350	643	10	in	in	ADP
aiol-6350	643	11	the	the	DET
aiol-6350	643	12	reconstructed	reconstructed	ADJ
aiol-6350	643	13	lake	lake	NOUN
aiol-6350	643	14	karla	karla	PROPN
aiol-6350	643	15	51	51	NUM
aiol-6350	643	16	saker	saker	PROPN
aiol-6350	643	17	ml	ml	ADP
aiol-6350	643	18	,	,	PUNCT
aiol-6350	643	19	neilan	neilan	PROPN
aiol-6350	643	20	ba	ba	PROPN
aiol-6350	643	21	,	,	PUNCT
aiol-6350	643	22	2001	2001	NUM
aiol-6350	643	23	.	.	PUNCT
aiol-6350	644	1	varied	varied	ADJ
aiol-6350	644	2	diazotrophies	diazotrophie	NOUN
aiol-6350	644	3	,	,	PUNCT
aiol-6350	644	4	morphologies	morphology	NOUN
aiol-6350	644	5	and	and	CCONJ
aiol-6350	644	6	toxicities	toxicity	NOUN
aiol-6350	644	7	of	of	ADP
aiol-6350	644	8	genetically	genetically	ADV
aiol-6350	644	9	similar	similar	ADJ
aiol-6350	644	10	isolates	isolate	NOUN
aiol-6350	644	11	of	of	ADP
aiol-6350	644	12	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	644	13	raciborskii	raciborskii	ADJ
aiol-6350	644	14	(	(	PUNCT
aiol-6350	644	15	nostocales	nostocale	NOUN
aiol-6350	644	16	,	,	PUNCT
aiol-6350	644	17	cyanophyceae	cyanophyceae	PROPN
aiol-6350	644	18	)	)	PUNCT
aiol-6350	644	19	from	from	ADP
aiol-6350	644	20	water	water	NOUN
aiol-6350	644	21	bodies	body	NOUN
aiol-6350	644	22	in	in	ADP
aiol-6350	644	23	northern	northern	ADJ
aiol-6350	644	24	australia	australia	PROPN
aiol-6350	644	25	.	.	PUNCT
aiol-6350	645	1	appl	appl	PROPN
aiol-6350	645	2	.	.	PUNCT
aiol-6350	646	1	environ	environ	PROPN
aiol-6350	646	2	.	.	PUNCT
aiol-6350	646	3	microbiol	microbiol	PROPN
aiol-6350	646	4	.	.	PUNCT
aiol-6350	647	1	99:749	99:749	NUM
aiol-6350	647	2	-	-	PUNCT
aiol-6350	647	3	757	757	PROPN
aiol-6350	647	4	.	.	PUNCT
aiol-6350	648	1	scheffer	scheffer	PROPN
aiol-6350	648	2	m	m	PROPN
aiol-6350	648	3	,	,	PUNCT
aiol-6350	648	4	2004	2004	NUM
aiol-6350	648	5	.	.	PUNCT
aiol-6350	649	1	ecology	ecology	NOUN
aiol-6350	649	2	of	of	ADP
aiol-6350	649	3	shallow	shallow	ADJ
aiol-6350	649	4	lakes	lake	NOUN
aiol-6350	649	5	.	.	PUNCT
aiol-6350	650	1	springer	springer	NOUN
aiol-6350	650	2	science+business	science+business	NOUN
aiol-6350	650	3	media	medium	NOUN
aiol-6350	650	4	,	,	PUNCT
aiol-6350	650	5	dordrecht	dordrecht	NOUN
aiol-6350	650	6	:	:	PUNCT
aiol-6350	650	7	378	378	NUM
aiol-6350	650	8	pp	pp	NOUN
aiol-6350	650	9	.	.	PUNCT
aiol-6350	651	1	schembri	schembri	PROPN
aiol-6350	651	2	ma	ma	PROPN
aiol-6350	651	3	,	,	PUNCT
aiol-6350	651	4	neilan	neilan	PROPN
aiol-6350	651	5	ba	ba	PROPN
aiol-6350	651	6	,	,	PUNCT
aiol-6350	651	7	saint	saint	PROPN
aiol-6350	651	8	cp	cp	PROPN
aiol-6350	651	9	,	,	PUNCT
aiol-6350	651	10	2001	2001	NUM
aiol-6350	651	11	.	.	PUNCT
aiol-6350	652	1	identification	identification	NOUN
aiol-6350	652	2	of	of	ADP
aiol-6350	652	3	genes	gene	NOUN
aiol-6350	652	4	implicated	implicate	VERB
aiol-6350	652	5	in	in	ADP
aiol-6350	652	6	toxin	toxin	NOUN
aiol-6350	652	7	production	production	NOUN
aiol-6350	652	8	in	in	ADP
aiol-6350	652	9	the	the	DET
aiol-6350	652	10	cyanobacterium	cyanobacterium	NOUN
aiol-6350	652	11	cylindrospermopsis	cylindrospermopsis	NOUN
aiol-6350	652	12	raciborskii	raciborskii	PROPN
aiol-6350	652	13	.	.	PUNCT
aiol-6350	653	1	environ	environ	PROPN
aiol-6350	653	2	.	.	PUNCT
aiol-6350	654	1	toxicol.16:413	toxicol.16:413	NOUN
aiol-6350	654	2	-	-	PUNCT
aiol-6350	654	3	421	421	NUM
aiol-6350	654	4	.	.	PUNCT
aiol-6350	655	1	šejnohová	šejnohová	PROPN
aiol-6350	655	2	l	l	NOUN
aiol-6350	655	3	,	,	PUNCT
aiol-6350	655	4	maršálek	maršálek	NOUN
aiol-6350	655	5	b	b	PROPN
aiol-6350	655	6	,	,	PUNCT
aiol-6350	655	7	2012.microcystis	2012.microcystis	NUM
aiol-6350	655	8	,	,	PUNCT
aiol-6350	655	9	p.	p.	NOUN
aiol-6350	655	10	195	195	NUM
aiol-6350	655	11	-	-	SYM
aiol-6350	655	12	221	221	NUM
aiol-6350	655	13	.	.	PUNCT
aiol-6350	656	1	in	in	ADP
aiol-6350	656	2	:	:	PUNCT
aiol-6350	656	3	b.a	b.a	PROPN
aiol-6350	656	4	.	.	PROPN
aiol-6350	656	5	whitton	whitton	PROPN
aiol-6350	656	6	(	(	PUNCT
aiol-6350	656	7	ed	ed	NOUN
aiol-6350	656	8	.	.	PUNCT
aiol-6350	656	9	)	)	PUNCT
aiol-6350	656	10	,	,	PUNCT
aiol-6350	656	11	ecology	ecology	NOUN
aiol-6350	656	12	of	of	ADP
aiol-6350	656	13	cyanobacteria	cyanobacteria	PROPN
aiol-6350	656	14	.	.	PUNCT
aiol-6350	656	15	ii	ii	PROPN
aiol-6350	656	16	.	.	PUNCT
aiol-6350	657	1	their	their	PRON
aiol-6350	657	2	diversity	diversity	NOUN
aiol-6350	657	3	in	in	ADP
aiol-6350	657	4	space	space	NOUN
aiol-6350	657	5	and	and	CCONJ
aiol-6350	657	6	time	time	NOUN
aiol-6350	657	7	.	.	PUNCT
aiol-6350	658	1	springer	springer	NOUN
aiol-6350	658	2	,	,	PUNCT
aiol-6350	658	3	dordrecht	dordrecht	PROPN
aiol-6350	658	4	.	.	PUNCT
aiol-6350	659	1	sidiropoulos	sidiropoulos	PROPN
aiol-6350	659	2	p	p	NOUN
aiol-6350	659	3	,	,	PUNCT
aiol-6350	659	4	papadimitriou	papadimitriou	ADJ
aiol-6350	659	5	t	t	PROPN
aiol-6350	659	6	,	,	PUNCT
aiol-6350	659	7	stabouli	stabouli	PROPN
aiol-6350	659	8	z	z	PROPN
aiol-6350	659	9	,	,	PUNCT
aiol-6350	659	10	loukas	loukas	PROPN
aiol-6350	659	11	a	a	PRON
aiol-6350	659	12	,	,	PUNCT
aiol-6350	659	13	mylopoulos	mylopoulos	PROPN
aiol-6350	659	14	n	n	PROPN
aiol-6350	659	15	,	,	PUNCT
aiol-6350	659	16	kagalou	kagalou	PROPN
aiol-6350	659	17	i	i	PROPN
aiol-6350	659	18	,	,	PUNCT
aiol-6350	659	19	2012	2012	NUM
aiol-6350	659	20	.	.	PUNCT
aiol-6350	660	1	past	past	ADJ
aiol-6350	660	2	,	,	PUNCT
aiol-6350	660	3	present	present	ADJ
aiol-6350	660	4	and	and	CCONJ
aiol-6350	660	5	future	future	ADJ
aiol-6350	660	6	concepts	concept	NOUN
aiol-6350	660	7	for	for	ADP
aiol-6350	660	8	conservation	conservation	NOUN
aiol-6350	660	9	of	of	ADP
aiol-6350	660	10	the	the	DET
aiol-6350	660	11	re	re	ADJ
aiol-6350	660	12	-	-	ADJ
aiol-6350	660	13	constructed	construct	VERB
aiol-6350	660	14	lake	lake	NOUN
aiol-6350	660	15	karla	karla	PROPN
aiol-6350	660	16	(	(	PUNCT
aiol-6350	660	17	thessaly	thessaly	PROPN
aiol-6350	660	18	-	-	PUNCT
aiol-6350	660	19	greece	greece	PROPN
aiol-6350	660	20	)	)	PUNCT
aiol-6350	660	21	.	.	PUNCT
aiol-6350	661	1	fresenius	fresenius	PROPN
aiol-6350	661	2	environ	environ	PROPN
aiol-6350	661	3	.	.	PUNCT
aiol-6350	662	1	bull	bull	NOUN
aiol-6350	662	2	.	.	PUNCT
aiol-6350	663	1	21:3027	21:3027	NUM
aiol-6350	663	2	-	-	SYM
aiol-6350	663	3	34	34	NUM
aiol-6350	663	4	.	.	PUNCT
aiol-6350	664	1	testai	testai	PROPN
aiol-6350	664	2	e	e	PROPN
aiol-6350	664	3	,	,	PUNCT
aiol-6350	664	4	scardala	scardala	PROPN
aiol-6350	664	5	s	s	PROPN
aiol-6350	664	6	,	,	PUNCT
aiol-6350	664	7	vichi	vichi	NOUN
aiol-6350	664	8	s	s	PROPN
aiol-6350	664	9	,	,	PUNCT
aiol-6350	664	10	buratti	buratti	PROPN
aiol-6350	664	11	fm	fm	PROPN
aiol-6350	664	12	,	,	PUNCT
aiol-6350	664	13	funari	funari	ADJ
aiol-6350	664	14	e	e	NOUN
aiol-6350	664	15	,	,	PUNCT
aiol-6350	664	16	2016	2016	NUM
aiol-6350	664	17	.	.	PUNCT
aiol-6350	665	1	risk	risk	NOUN
aiol-6350	665	2	to	to	ADP
aiol-6350	665	3	human	human	ADJ
aiol-6350	665	4	health	health	NOUN
aiol-6350	665	5	associated	associate	VERB
aiol-6350	665	6	with	with	ADP
aiol-6350	665	7	the	the	DET
aiol-6350	665	8	environmental	environmental	ADJ
aiol-6350	665	9	occurrence	occurrence	NOUN
aiol-6350	665	10	of	of	ADP
aiol-6350	665	11	cyanobacterial	cyanobacterial	ADJ
aiol-6350	665	12	neurotoxic	neurotoxic	ADJ
aiol-6350	665	13	alkaloids	alkaloid	NOUN
aiol-6350	665	14	anatoxins	anatoxin	NOUN
aiol-6350	665	15	and	and	CCONJ
aiol-6350	665	16	saxitoxins	saxitoxin	NOUN
aiol-6350	665	17	.	.	PUNCT
aiol-6350	666	1	crit	crit	PROPN
aiol-6350	666	2	.	.	PUNCT
aiol-6350	667	1	rev	rev	PROPN
aiol-6350	667	2	.	.	PROPN
aiol-6350	668	1	toxicol	toxicol	PROPN
aiol-6350	668	2	.	.	PUNCT
aiol-6350	669	1	46:385	46:385	PROPN
aiol-6350	669	2	-	-	PUNCT
aiol-6350	669	3	419	419	NUM
aiol-6350	669	4	.	.	PUNCT
aiol-6350	670	1	theologou	theologou	NOUN
aiol-6350	670	2	i	i	PRON
aiol-6350	670	3	,	,	PUNCT
aiol-6350	670	4	kagalou	kagalou	PROPN
aiol-6350	670	5	i	i	PROPN
aiol-6350	670	6	,	,	PUNCT
aiol-6350	670	7	papadopoulou	papadopoulou	PROPN
aiol-6350	670	8	mp	mp	PROPN
aiol-6350	670	9	,	,	PUNCT
aiol-6350	670	10	karantzalos	karantzalos	PROPN
aiol-6350	670	11	k	k	PROPN
aiol-6350	670	12	,	,	PUNCT
aiol-6350	670	13	2016	2016	NUM
aiol-6350	670	14	.	.	PUNCT
aiol-6350	671	1	multitemporal	multitemporal	ADJ
aiol-6350	671	2	mapping	mapping	NOUN
aiol-6350	671	3	of	of	ADP
aiol-6350	671	4	chlorophyll	chlorophyll	NOUN
aiol-6350	671	5	-	-	PUNCT
aiol-6350	671	6	α	α	NOUN
aiol-6350	671	7	in	in	ADP
aiol-6350	671	8	lake	lake	PROPN
aiol-6350	671	9	karla	karla	PROPN
aiol-6350	671	10	from	from	ADP
aiol-6350	671	11	high	high	ADJ
aiol-6350	671	12	resolution	resolution	NOUN
aiol-6350	671	13	multispectral	multispectral	ADJ
aiol-6350	671	14	satellite	satellite	NOUN
aiol-6350	671	15	data	datum	NOUN
aiol-6350	671	16	.	.	PUNCT
aiol-6350	672	1	environ	environ	PROPN
aiol-6350	672	2	.	.	PUNCT
aiol-6350	672	3	process	process	NOUN
aiol-6350	672	4	.	.	PUNCT
aiol-6350	673	1	3:681	3:681	NUM
aiol-6350	673	2	.	.	PUNCT
aiol-6350	674	1	timm	timm	PROPN
aiol-6350	674	2	t	t	PROPN
aiol-6350	674	3	,	,	PUNCT
aiol-6350	674	4	2009	2009	NUM
aiol-6350	674	5	.	.	PUNCT
aiol-6350	675	1	a	a	DET
aiol-6350	675	2	guide	guide	NOUN
aiol-6350	675	3	to	to	ADP
aiol-6350	675	4	the	the	DET
aiol-6350	675	5	freshwater	freshwater	NOUN
aiol-6350	675	6	oligochaeta	oligochaeta	PROPN
aiol-6350	675	7	and	and	CCONJ
aiol-6350	675	8	polychaeta	polychaeta	VERB
aiol-6350	675	9	of	of	ADP
aiol-6350	675	10	northern	northern	ADJ
aiol-6350	675	11	and	and	CCONJ
aiol-6350	675	12	central	central	ADJ
aiol-6350	675	13	europe	europe	PROPN
aiol-6350	675	14	.	.	PUNCT
aiol-6350	676	1	lauterbornia	lauterbornia	NOUN
aiol-6350	676	2	66	66	NUM
aiol-6350	676	3	:	:	PUNCT
aiol-6350	676	4	1	1	NUM
aiol-6350	676	5	-	-	SYM
aiol-6350	676	6	235	235	NUM
aiol-6350	676	7	.	.	PUNCT
aiol-6350	676	8	toporowska	toporowska	PROPN
aiol-6350	676	9	m	m	PROPN
aiol-6350	676	10	,	,	PUNCT
aiol-6350	676	11	pawlik	pawlik	NOUN
aiol-6350	676	12	-	-	PUNCT
aiol-6350	676	13	skowrońska	skowrońska	PROPN
aiol-6350	676	14	b	b	NOUN
aiol-6350	676	15	,	,	PUNCT
aiol-6350	676	16	kalinowska	kalinowska	ADJ
aiol-6350	676	17	r	r	NOUN
aiol-6350	676	18	,	,	PUNCT
aiol-6350	676	19	2016	2016	NUM
aiol-6350	676	20	.	.	PUNCT
aiol-6350	677	1	mass	mass	NOUN
aiol-6350	677	2	development	development	NOUN
aiol-6350	677	3	of	of	ADP
aiol-6350	677	4	diazotrophic	diazotrophic	ADJ
aiol-6350	677	5	cyanobacteria	cyanobacteria	NOUN
aiol-6350	677	6	(	(	PUNCT
aiol-6350	677	7	nostocales	nostocale	NOUN
aiol-6350	677	8	)	)	PUNCT
aiol-6350	677	9	and	and	CCONJ
aiol-6350	677	10	production	production	NOUN
aiol-6350	677	11	of	of	ADP
aiol-6350	677	12	neurotoxic	neurotoxic	ADJ
aiol-6350	677	13	anatoxin	anatoxin	NOUN
aiol-6350	677	14	-	-	PUNCT
aiol-6350	677	15	a	a	NOUN
aiol-6350	677	16	in	in	ADP
aiol-6350	677	17	a	a	DET
aiol-6350	677	18	planktothrix	planktothrix	NOUN
aiol-6350	677	19	(	(	PUNCT
aiol-6350	677	20	oscillatoriales	oscillatoriale	NOUN
aiol-6350	677	21	)	)	PUNCT
aiol-6350	677	22	dominated	dominate	VERB
aiol-6350	677	23	temperate	temperate	ADJ
aiol-6350	677	24	lake	lake	NOUN
aiol-6350	677	25	.	.	PUNCT
aiol-6350	678	1	water	water	NOUN
aiol-6350	678	2	air	air	PROPN
aiol-6350	678	3	soil	soil	PROPN
aiol-6350	678	4	pollut	pollut	PROPN
aiol-6350	678	5	.	.	PUNCT
aiol-6350	679	1	227:321	227:321	NOUN
aiol-6350	679	2	.	.	PUNCT
aiol-6350	680	1	utermöhl	utermöhl	PROPN
aiol-6350	680	2	h	h	PROPN
aiol-6350	680	3	,	,	PUNCT
aiol-6350	680	4	1958	1958	NUM
aiol-6350	680	5	.	.	PUNCT
aiol-6350	681	1	[	[	X
aiol-6350	681	2	zur	zur	X
aiol-6350	681	3	vervollkommung	vervollkommung	ADJ
aiol-6350	681	4	der	der	NOUN
aiol-6350	681	5	quantitativinen	quantitativinen	PROPN
aiol-6350	681	6	phytoplankton	phytoplankton	NOUN
aiol-6350	681	7	-	-	PUNCT
aiol-6350	681	8	methodik].[article	methodik].[article	NOUN
aiol-6350	681	9	in	in	ADP
aiol-6350	681	10	german	german	NOUN
aiol-6350	681	11	]	]	PUNCT
aiol-6350	681	12	.	.	PUNCT
aiol-6350	682	1	int	int	PROPN
aiol-6350	682	2	.	.	PUNCT
aiol-6350	683	1	ver	ver	PROPN
aiol-6350	683	2	.	.	PUNCT
aiol-6350	684	1	theor	theor	PROPN
aiol-6350	684	2	.	.	PROPN
aiol-6350	684	3	angew	angew	PROPN
aiol-6350	684	4	.	.	PUNCT
aiol-6350	685	1	limnol	limnol	NOUN
aiol-6350	685	2	.	.	PUNCT
aiol-6350	686	1	9:1	9:1	NUM
aiol-6350	686	2	-	-	SYM
aiol-6350	686	3	38	38	NUM
aiol-6350	686	4	.	.	PUNCT
aiol-6350	687	1	vasconcelos	vasconcelos	PROPN
aiol-6350	687	2	v	v	PROPN
aiol-6350	687	3	,	,	PUNCT
aiol-6350	687	4	martins	martin	VERB
aiol-6350	687	5	a	a	PRON
aiol-6350	687	6	,	,	PUNCT
aiol-6350	687	7	vale	vale	PROPN
aiol-6350	687	8	m	m	PROPN
aiol-6350	687	9	,	,	PUNCT
aiol-6350	687	10	antunes	antunes	PROPN
aiol-6350	687	11	a	a	PROPN
aiol-6350	687	12	,	,	PUNCT
aiol-6350	687	13	azevedo	azevedo	PROPN
aiol-6350	687	14	j	j	PROPN
aiol-6350	687	15	,	,	PUNCT
aiol-6350	687	16	welker	welker	PROPN
aiol-6350	687	17	m	m	PROPN
aiol-6350	687	18	,	,	PUNCT
aiol-6350	687	19	lopez	lopez	PROPN
aiol-6350	687	20	o	o	NOUN
aiol-6350	687	21	,	,	PUNCT
aiol-6350	687	22	montejano	montejano	VERB
aiol-6350	687	23	g	g	NOUN
aiol-6350	687	24	,	,	PUNCT
aiol-6350	687	25	2010	2010	NUM
aiol-6350	687	26	.	.	PUNCT
aiol-6350	688	1	first	first	ADJ
aiol-6350	688	2	report	report	NOUN
aiol-6350	688	3	on	on	ADP
aiol-6350	688	4	the	the	DET
aiol-6350	688	5	occurrence	occurrence	NOUN
aiol-6350	688	6	of	of	ADP
aiol-6350	688	7	microcystins	microcystin	NOUN
aiol-6350	688	8	in	in	ADP
aiol-6350	688	9	planktonic	planktonic	ADJ
aiol-6350	688	10	cyanobacteria	cyanobacteria	NOUN
aiol-6350	688	11	from	from	ADP
aiol-6350	688	12	central	central	PROPN
aiol-6350	688	13	mexico	mexico	PROPN
aiol-6350	688	14	.	.	PUNCT
aiol-6350	689	1	toxicon	toxicon	PROPN
aiol-6350	689	2	56:425	56:425	NUM
aiol-6350	689	3	-	-	SYM
aiol-6350	689	4	431	431	NUM
aiol-6350	689	5	.	.	PUNCT
aiol-6350	690	1	villena	villena	PROPN
aiol-6350	690	2	mj	mj	PROPN
aiol-6350	690	3	,	,	PUNCT
aiol-6350	690	4	romo	romo	PROPN
aiol-6350	690	5	s	s	PROPN
aiol-6350	690	6	,	,	PUNCT
aiol-6350	690	7	2003	2003	NUM
aiol-6350	690	8	.	.	PUNCT
aiol-6350	691	1	phytoplankton	phytoplankton	NOUN
aiol-6350	691	2	changes	change	NOUN
aiol-6350	691	3	in	in	ADP
aiol-6350	691	4	a	a	DET
aiol-6350	691	5	shallow	shallow	ADJ
aiol-6350	691	6	mediterranean	mediterranean	PROPN
aiol-6350	691	7	lake	lake	PROPN
aiol-6350	691	8	(	(	PUNCT
aiol-6350	691	9	albufera	albufera	NOUN
aiol-6350	691	10	of	of	ADP
aiol-6350	691	11	valencia	valencia	PROPN
aiol-6350	691	12	,	,	PUNCT
aiol-6350	691	13	spain	spain	PROPN
aiol-6350	691	14	)	)	PUNCT
aiol-6350	691	15	after	after	ADP
aiol-6350	691	16	sewage	sewage	NOUN
aiol-6350	691	17	diversion	diversion	NOUN
aiol-6350	691	18	.	.	PUNCT
aiol-6350	692	1	hydrobiologia	hydrobiologia	NOUN
aiol-6350	692	2	.	.	PUNCT
aiol-6350	693	1	506:281	506:281	NUM
aiol-6350	693	2	-	-	SYM
aiol-6350	693	3	287	287	NUM
aiol-6350	693	4	.	.	PUNCT
aiol-6350	694	1	visser	visser	PROPN
aiol-6350	694	2	pm	pm	PROPN
aiol-6350	694	3	,	,	PUNCT
aiol-6350	694	4	ibelings	ibeling	NOUN
aiol-6350	694	5	bw	bw	PROPN
aiol-6350	694	6	,	,	PUNCT
aiol-6350	694	7	bormans	bormans	PROPN
aiol-6350	694	8	m	m	PROPN
aiol-6350	694	9	,	,	PUNCT
aiol-6350	694	10	huisman	huisman	PROPN
aiol-6350	694	11	j.	j.	PROPN
aiol-6350	694	12	2016	2016	NUM
aiol-6350	694	13	.	.	PUNCT
aiol-6350	695	1	artificial	artificial	ADJ
aiol-6350	695	2	mixing	mixing	NOUN
aiol-6350	695	3	to	to	PART
aiol-6350	695	4	control	control	VERB
aiol-6350	695	5	cyanobacterial	cyanobacterial	ADJ
aiol-6350	695	6	blooms	bloom	NOUN
aiol-6350	695	7	:	:	PUNCT
aiol-6350	695	8	a	a	DET
aiol-6350	695	9	review	review	NOUN
aiol-6350	695	10	.	.	PUNCT
aiol-6350	696	1	aquat	aquat	VERB
aiol-6350	696	2	.	.	PUNCT
aiol-6350	697	1	ecol	ecol	PROPN
aiol-6350	697	2	.	.	PUNCT
aiol-6350	698	1	50:423	50:423	NUM
aiol-6350	698	2	-	-	SYM
aiol-6350	698	3	441	441	NUM
aiol-6350	698	4	.	.	PUNCT
aiol-6350	699	1	who	who	PRON
aiol-6350	699	2	(	(	PUNCT
aiol-6350	699	3	world	world	NOUN
aiol-6350	699	4	health	health	NOUN
aiol-6350	699	5	organization	organization	PROPN
aiol-6350	699	6	)	)	PUNCT
aiol-6350	699	7	,	,	PUNCT
aiol-6350	699	8	2003	2003	NUM
aiol-6350	699	9	.	.	PUNCT
aiol-6350	700	1	guidelines	guideline	NOUN
aiol-6350	700	2	for	for	ADP
aiol-6350	700	3	safe	safe	ADJ
aiol-6350	700	4	recreational	recreational	ADJ
aiol-6350	700	5	water	water	NOUN
aiol-6350	700	6	environments	environment	NOUN
aiol-6350	700	7	.	.	PUNCT
aiol-6350	701	1	1	1	X
aiol-6350	701	2	.	.	X
aiol-6350	701	3	coastal	coastal	ADJ
aiol-6350	701	4	and	and	CCONJ
aiol-6350	701	5	fresh	fresh	ADJ
aiol-6350	701	6	waters	water	NOUN
aiol-6350	701	7	.	.	PUNCT
aiol-6350	702	1	who	who	PRON
aiol-6350	702	2	,	,	PUNCT
aiol-6350	702	3	geneva	geneva	PROPN
aiol-6350	702	4	.	.	PUNCT
aiol-6350	703	1	wiederholm	wiederholm	PROPN
aiol-6350	703	2	t	t	PROPN
aiol-6350	703	3	,	,	PUNCT
aiol-6350	703	4	1983	1983	NUM
aiol-6350	703	5	.	.	PUNCT
aiol-6350	704	1	chironomidae	chironomidae	NOUN
aiol-6350	704	2	of	of	ADP
aiol-6350	704	3	the	the	DET
aiol-6350	704	4	holarctic	holarctic	ADJ
aiol-6350	704	5	region	region	NOUN
aiol-6350	704	6	.	.	PUNCT
aiol-6350	705	1	keys	key	NOUN
aiol-6350	705	2	and	and	CCONJ
aiol-6350	705	3	diagnoses	diagnosis	NOUN
aiol-6350	705	4	.	.	PUNCT
aiol-6350	706	1	part	part	PROPN
aiol-6350	706	2	i.	i.	PROPN
aiol-6350	706	3	larvae	larvae	PROPN
aiol-6350	706	4	:	:	PUNCT
aiol-6350	706	5	entomol	entomol	PROPN
aiol-6350	706	6	.	.	PUNCT
aiol-6350	707	1	scand	scand	PROPN
aiol-6350	707	2	.	.	PUNCT
aiol-6350	708	1	supplement	supplement	NOUN
aiol-6350	708	2	,	,	PUNCT
aiol-6350	708	3	1	1	NUM
aiol-6350	708	4	-	-	SYM
aiol-6350	708	5	457	457	NUM
aiol-6350	708	6	.	.	PUNCT
aiol-6350	709	1	wiederholm	wiederholm	PROPN
aiol-6350	709	2	t	t	PROPN
aiol-6350	709	3	,	,	PUNCT
aiol-6350	709	4	1986	1986	NUM
aiol-6350	709	5	.	.	PUNCT
aiol-6350	710	1	chironomidae	chironomidae	NOUN
aiol-6350	710	2	of	of	ADP
aiol-6350	710	3	the	the	DET
aiol-6350	710	4	holarctic	holarctic	ADJ
aiol-6350	710	5	region	region	NOUN
aiol-6350	710	6	.	.	PUNCT
aiol-6350	711	1	keys	key	NOUN
aiol-6350	711	2	and	and	CCONJ
aiol-6350	711	3	diagnoses	diagnosis	NOUN
aiol-6350	711	4	.	.	PUNCT
aiol-6350	712	1	part	part	PROPN
aiol-6350	712	2	ii	ii	PROPN
aiol-6350	712	3	.	.	PUNCT
aiol-6350	712	4	pupae	pupae	NOUN
aiol-6350	712	5	:	:	PUNCT
aiol-6350	712	6	entomol	entomol	PROPN
aiol-6350	712	7	.	.	PUNCT
aiol-6350	713	1	scand	scand	PROPN
aiol-6350	713	2	.	.	PUNCT
aiol-6350	714	1	supplement	supplement	NOUN
aiol-6350	714	2	,	,	PUNCT
aiol-6350	714	3	1	1	NUM
aiol-6350	714	4	-	-	SYM
aiol-6350	714	5	482	482	NUM
aiol-6350	714	6	.	.	PUNCT
aiol-6350	715	1	wiedner	wiedner	NOUN
aiol-6350	715	2	c	c	NOUN
aiol-6350	715	3	,	,	PUNCT
aiol-6350	715	4	rücker	rücker	PROPN
aiol-6350	715	5	j	j	PROPN
aiol-6350	715	6	,	,	PUNCT
aiol-6350	715	7	fastner	fastner	PROPN
aiol-6350	715	8	j	j	PROPN
aiol-6350	715	9	,	,	PUNCT
aiol-6350	715	10	chorus	chorus	VERB
aiol-6350	715	11	i	i	PRON
aiol-6350	715	12	,	,	PUNCT
aiol-6350	715	13	nixdorf	nixdorf	PROPN
aiol-6350	715	14	b	b	PROPN
aiol-6350	715	15	,	,	PUNCT
aiol-6350	715	16	2008	2008	NUM
aiol-6350	715	17	.	.	PUNCT
aiol-6350	716	1	seasonal	seasonal	ADJ
aiol-6350	716	2	dynamics	dynamic	NOUN
aiol-6350	716	3	of	of	ADP
aiol-6350	716	4	cylindrospermopsin	cylindrospermopsin	NOUN
aiol-6350	716	5	and	and	CCONJ
aiol-6350	716	6	cyanobacteria	cyanobacteria	NOUN
aiol-6350	716	7	in	in	ADP
aiol-6350	716	8	two	two	NUM
aiol-6350	716	9	german	german	ADJ
aiol-6350	716	10	lakes	lake	NOUN
aiol-6350	716	11	.	.	PUNCT
aiol-6350	717	1	toxicon	toxicon	PROPN
aiol-6350	717	2	52:677–786	52:677–786	PROPN
aiol-6350	717	3	.	.	PUNCT
aiol-6350	718	1	zervou	zervou	PROPN
aiol-6350	718	2	s	s	PROPN
aiol-6350	718	3	-	-	PUNCT
aiol-6350	718	4	k	k	NOUN
aiol-6350	718	5	,	,	PUNCT
aiol-6350	718	6	christophoridis	christophoridi	NOUN
aiol-6350	718	7	c	c	AUX
aiol-6350	718	8	,	,	PUNCT
aiol-6350	718	9	kaloudis	kaloudis	PROPN
aiol-6350	718	10	t	t	PROPN
aiol-6350	718	11	,	,	PUNCT
aiol-6350	718	12	triantis	triantis	PROPN
aiol-6350	718	13	tm	tm	PROPN
aiol-6350	718	14	,	,	PUNCT
aiol-6350	718	15	hiskia	hiskia	VERB
aiol-6350	718	16	a	a	PRON
aiol-6350	718	17	,	,	PUNCT
aiol-6350	718	18	2017	2017	NUM
aiol-6350	718	19	.	.	PUNCT
aiol-6350	719	1	new	new	ADJ
aiol-6350	719	2	spe	spe	PROPN
aiol-6350	719	3	-	-	PUNCT
aiol-6350	719	4	lc	lc	PROPN
aiol-6350	719	5	-	-	PUNCT
aiol-6350	719	6	ms	ms	NOUN
aiol-6350	719	7	/	/	SYM
aiol-6350	719	8	ms	ms	PROPN
aiol-6350	719	9	method	method	NOUN
aiol-6350	719	10	for	for	ADP
aiol-6350	719	11	simultaneous	simultaneous	ADJ
aiol-6350	719	12	determination	determination	NOUN
aiol-6350	719	13	of	of	ADP
aiol-6350	719	14	multi	multi	ADJ
aiol-6350	719	15	-	-	ADJ
aiol-6350	719	16	class	class	ADJ
aiol-6350	719	17	cyanobacterial	cyanobacterial	ADJ
aiol-6350	719	18	and	and	CCONJ
aiol-6350	719	19	algal	algal	ADJ
aiol-6350	719	20	toxins	toxin	NOUN
aiol-6350	719	21	.	.	PUNCT
aiol-6350	720	1	j.	j.	PROPN
aiol-6350	720	2	hazard	hazard	PROPN
aiol-6350	720	3	.	.	PUNCT
aiol-6350	721	1	mater	mater	NOUN
aiol-6350	721	2	.	.	PUNCT
aiol-6350	722	1	323:56	323:56	NUM
aiol-6350	722	2	-	-	SYM
aiol-6350	722	3	66	66	NUM
aiol-6350	722	4	.	.	PUNCT