Layout 1 INTRODUCTION Cyanobacterial harmful algal blooms represent one of the most conspicuous waterborne microbial hazards to freshwater and marine ecosystems (Codd et al., 2005; Paerl et al., 2011). This hazard results from the production of cyanotoxins, harmful secondary metabolites, which can have deleterious effects within reservoirs and in down- stream receiving water systems during releases (Paerl and Otten, 2013). Harmful cyanobacterial blooms have in- creased globally in frequency and intensity in recent decades. Eutrophication and warmer temperatures are often cited as key factors which promote these events (Hudnell and Dortch, 2008; Paerl and Huisman, 2008; Gkelis et al., 2014). In Greece, the warm Mediterranean climate favors cyanobacterial blooms in eutrophic waters, which may start in spring and last until December; in- creased temperatures due to global warming may further enhance cyanobacteria dominance and promote toxic over non-toxic strains (Gkelis et al., 2014). After the elucidation of cyanotoxins genes clusters, several studies have applied molecular methods for mon- itoring the presence of toxic cyanobacteria and the genes involved in the biosynthesis of cyanotoxins (Hisbergues et al., 2003; Vasconcelos et al., 2010; Gkelis and Zaout- sos, 2014). Furthermore, molecular methods based on 16S rRNA gene amplification are widely employed for the analysis of natural samples and/or monitoring freshwaters (Kormas et al., 2011; Loza et al., 2013). Bottled water can come from a variety of sources in- cluding natural aquifers, springs, glacier run-off, and mu- nicipal water supplies, and these sources could potentially be contaminated with microcystins (CFIA, 2011). To our knowledge, only two studies on levels of microcystins in bottled water have been published. Those studies, per- formed in Italy (Ferretti et al., 2007) and Canada (CFIA, 2011; CFIA, 2012), analysed domestic bottled water sam- ples for the presence of microcystins and nodularin, and did not detect cyanotoxins. This work presents the results of a small scale monitoring program for drinking natural mineral water and highlights the necessity to initiate re- search and possibly establish official monitoring pro- grams in cases where similar results are obtained in order to cope with the new demands for drinking water. METHODS Sample collection and preparation The bottled natural mineral water originated from a water source (250 m depth), which is located in the Pre- fecture of Central Macedonia, Northern Greece (N: 40°15’4.88” and E: 22°32’12.71”) with a water tempera- ture ranging between 16°C in winter and spring and 18°C in autumn and summer. Water samples were collected Advances in Oceanography and Limnology, 2017; 8(1): 87-91 ARTICLE DOI: 10.4081/aiol.2017.6280 This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License (CC BY-NC 4.0). Can cyanobacteria infect underground water sources? Indications from small scale monitoring of a natural drinking water source Spyros Gkelis,1* Aristidis Vlamis1,2 1Department of Botany, School of Biology, Aristotle University of Thessaloniki, GR-541 24 Thessaloniki, Greece; 2Department of Pharmacology, Veterinary School, University of Santiago de Compostela, Lugo 27002, Spain *Corresponding author: sgkelis@bio.auth.gr ABSTRACT The expansion of harmful cyanobacterial blooms is of worldwide concern as they have increased globally in frequency and intensity in recent decades. A cyanobacterial colony was found in a bottle of natural mineral water of a small water company in July 2012, which led to a further examination for a period of five months (July-November 2012) of both the bottled filtered water and the originating groundwater source (N. Greece) for the occurrence of Cyanobacteria. Cyanobacteria occurrence was monitored by microscopy and cyanospecific 16S rDNA amplification; potentially toxic species occurrence was screened by mcyA gene (known to take part in the MC-biosynthetic gene cluster) amplification. The highest abundance of cyanobacterial cells without the simultaneous presence of the mcyA gene, was measured in July, in contrast to October when the presence of cyanobacteria was only identified by tracing cyanospecific 16S rDNA and the mcyA gene region in the underground water source. The results of this small scale monitoring program indicate the potential existence of an emerging danger for human health in a relatively manageable product such as the bottled natural mineral water. Key words: Microcystis; microcystin; bottled water; natural mineral water. Received: 12 September 2016. Accepted: 16 March 2017. Non -co mmerc ial us e o nly S. Gkelis and A. Vlamis88 monthly between July and December 2012 from two drilling points (SUP1 and SUP2) used for the production of bottled natural mineral water. The final product which had undergone filtration was also sampled (bottled filtered water-BF). Aliquots of these were preserved with both Lugol’s solution (1% v/v) and formaldehyde (2% v/v). Water samples were stored in polyethylene bottles and transferred to the laboratory (<5 h) under cool and dark conditions. Immediately upon reception in the laboratory, 1.5 L of water was filtered on a Whatman GF/C filters and the filter was stored at -20°C for further analysis. Phytoplankton analysis Fresh and preserved samples were examined using an inverted microscope (Olympus IX71) with phase-contrast. Species were identified using Komárek and Anagnostidis (1999). The abundance of cyanobacterial cells was deter- mined in accordance with Utermöhl (1958), using 50 mL sedimentation chambers, thus detection limit was 20 cells L–1. Transepts were counted and the variation coefficient was always kept under 20%. Phytoplankton abundance is presented in number of cells L–1. Molecular detection DNA was extracted using the protocol described in Atashpaz et al. (2010) for Gram negative bacteria, after slicing the filters with a sterile scalpel. In order to identify cyanobacteria and potentially MC-producing cyanobac- teria we used two different sets of primers, respectively: the 16S 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) /16S 1494R (5’- TACGGTTACCTTGTTACGAC -3’) primer pair which amplifies a 1367-bp fragment of 16S rDNA in all cyanobacteria (Neilan et al., 1997) and the mcyA CD1F (5’- AAAATTAAAAGCCGTATCAAA-3’) /mcyA CD1R (5’- AAAAGTGTTTTATTAGCGGCT- CAT-3’) primer pair (Hisbergues et al., 2003), which was designed to amplify a 297-bp fragment of the mcyA gene from MC-synthesizing cyanobacteria strains and was pre- viously proved to be suitable to detect MC-producing cells from the genera Anabaena, Microcystis and, Plank- tothrix (Hisbergues et al., 2003). Samples giving positive results in this assay have been shown to have a high prob- ability of producing MCs (Hisbergues et al., 2003; Vas- concelos et al., 2010). We chose to detect a gene target known to be involved in the biosynthesis of MC, as this is the most frequent cyanotoxin in Greece (Gkelis and Za- outsos, 2014; Gkelis et al., 2015b) and worldwide. PCR was carried out on the DNA extracts using the primer pairs presented previously. All PCR reactions were prepared as described in Gkelis and Zaoutsos (2014). Thermal cycling was carried out using an Eppendorf Mas- terCycler Pro (Eppendorf). Amplification was performed according to the protocols described by Neilan et al. (1997) and Hisbergues et al. (2003) for 16S rRNA and mcyA, respectively. DNA extracted from Microcystis aeruginosa M6 strain (see Vasconcelos et al., 2010) was used as positive control for the amplification of mcyA gene target and water as negative control. PCR products were separated by 1.5% (w/v) agarose gel in 1X TAE buffer. The gels were stained with ethidium bromide and photographed under UV transillumination. RESULTS AND DISCUSSION Cyanobacteria were detected by microscopy only in the bottled sample BF/A, collected on the 5th of July 2012 (Tab. 1). A colonial form of Microcystis-like cyanobac- teria was found, which could not be further identified (Fig. 1). Cells were spherical with an average diameter Tab. 1. Microscopic and molecular detection of cyanobacteria in the water samples collected during the study. Sampling date Sample Microscopic analysis Μolecular analysis Cells L–1 DNA Cyanobacteria 16S rRNA mcyA gene 05-07-12 SUP (1) - - - - SUP (2) - - - - BF/ A* 50,000 + + - BF/ B - + + - 18-09-12 SUP (1) - - - - SUP (2) - - - - BF - - - - 31-10-12 SUP (1) - + + + BF - + + - 29-11-12 SUP (1) - - - - SUP (2) - + - - BF - + - - BF, Bottled filtered water; SUP (1), source underground water (old drill); SUP (2), source underground water-(new drill); *sample BF/ A is from the same production line with BF/ B but sampled at a different time of the day. Non -co mmerc ial us e o nly Cyanobacteria in underground water sources 89 of 8.53μm (n=30, min 6.54 μm, max 11.6 μm). Cyanobacterial abundance in this sample was 50,000 cells L–1, whereas in BF/B, collected on the same day and drilling source but at a different time, no cyanobacteria cells were found (Tab. 1). No presence of cyanobacteria was observed by microscopy in any of the other samples, both bottled and from the underground water source. Al- though the presence of algae and cyanobacteria in under- ground habitats (Reisser, 2007) and the ability of soil and deep subsurface cyanobacteria to actively follow a mov- ing water pocket in order to exploit it (Garcia-Pichel and Pringault, 2001) has been shown, to the best of our knowledge this is the first report of planktonic cyanobac- teria found in an underground drinking-water source. Re- cently, Pazouki et al. (2016) demonstrated that cyanobacteria can be found in water filtered through bank filtration, especially species with cell size <10 μm, such as the Microcystis cells. In our case the source of the cyanobacterial colony we found remains unknown; how- ever, it has been found that in the nearby River-Reservoir System of Aliakmon-Polyphytos, Microcystis aeruginosa can be dispersed in short distances through the wind (Chrisostomou et al., 2009). Furthermore, airborne cyanobacteria have been found in the nearby city of Thessaloniki (Genitsaris et al., 2011). Nevertheless, since the source of the cyanobacterial colony was not found the possibility of opportunistic airborne contamination during the bottling cannot be excluded. DNA was below the detection limit in seven out of the twelve samples analyzed (Tab. 1). A PCR product of about 1370 bp was obtained using the 16S 27F/16S 1484R primer pair in four samples (including sample BF/A of 05-07-2012, where cyanobacteria were identified by mi- croscopy). The 300 bp mcyA-Cd 1F/mcyA-Cd 1R primer pair PCR product, indicating the presence of mcyA gene, was identified only in one out of the twelve samples as- sayed (Tab. 1). In the studied water source the highest cyanobacterial abundance of 50.000 cells L–1 was ob- served in July without the simultaneous presence of the mcyA gene responsible for MC production. At the end of October, however, the presence of cyanobacteria was only traced through the detection of 16S rDNA as well as traces of the gene mcyA. Similar results were reported by Davis et al. (2009) in Lake Agawam in July where the presence of toxic Microcystis cells did not coincide with the pres- ence of MC and also in Lake Champlain where MCs were detectable in October but without the presence of toxic Microcystis cells at the same time. Gkelis and Zaoutsos (2014) found that the mcyA region was amplified only where Microcystis spp. were dominant and MC concen- trations were >40 μg L–1. Conjointly, Gkelis et al. (2014) in a 14-month monitoring of Lake Pamvotis found that mcyA was amplified only in two samples, where Micro- cystis aeruginosa was dominant, whereas mcyB and mcyE regions were amplified in almost all samples. Several studies report that cyanobacteria can produce toxins at low temperatures but in combination with other important factors such as presence of light and nutrients’ availability (Quiblier et al., 2013). The low temperatures (max. 18°C) of the studied groundwater source together with the absence of one of the genes responsible for cyanobacterial toxicity (mcyA) in most of the samples suggest that the detected cyanobacteria do not probably constitute an important hazard for this specific source, also due to the limited input of nutrients and the absence of light. Nevertheless, since traces of the mcyA gene were detected in one sample, there is still a possibility that MCs could have been produced in the studied water source, since cyanotoxins are intracellular toxins contained within living cells (Sivonen and Jones, 1999) and cyanobacterial cells were found in high abundances in one sample. In this case, the biggest problem in bottled drinking natural min- eral waters arises from the fact that the only treatment op- tion in order to maintain the product type ‘Natural Mineral Water’, is filtering, as filters can retain a big proportion of the microalgae but not the potential toxins produced by them resulting in human intoxication. Our finding, although scarce, raises the question of monitoring algae in underground water sources. At pres- ent, none of the European countries have established mon- itoring program for cyanotoxins in potable minerals waters so far, and only some countries have done so for drinking water such as Spain, France, the Czech Republic and Poland (Burch, 2008). In Greece, there are very few offi- cial monitoring programs in place (Kaloudis et al., 2013; Gkelis et al., 2015a) for cyanobacterial blooms and toxins produced in freshwaters, whereas there is also no legisla- Fig. 1. Microphotograph of the Microcystis-like colony found in the bottled filtered water BF/ A sample. Non -co mmerc ial us e o nly S. Gkelis and A. Vlamis90 tion with regard to monitoring of these quality parameters (Cook et al., 2005). Moreover, there are no legally estab- lished maximum allowable concentrations for cyanotoxins in potable mineral water. The only relevant reference is in the National Hygienic Regulation A1β/4841/1979 (FEK 696/Β΄/1979), where the absence of microalgae is required for bottled waters intended for human consumption. A very small number of water treatment plants in Greece control cyanobacterial growth, measure cyanotoxins or use water treatments for toxin removal: The Athens Water Supply and Sewerage Company implements some measures for control and monitoring of cyanobacteria and cyanotoxins (Kaloudis et al., 2013). Other water utilities are small, at a local level, and they do not implement such measures, with the possible exception of the Thessaloniki Water Supply and Sewerage Company (Thessaloniki) (Kaloudis, per- sonal communication). CONCLUSIONS The results of this small scale monitoring program demonstrated for the first time the presence of cyanobac- teria in bottled natural mineral drinking water. While it seems unlikely that the use of bottled water would con- stitute any major hazard with regard to cyanotoxin expo- sure, our findings call for further research to investigate the presence, heterotrophic growth and significance of cyanobacterial colonies and/or biofilms in water distribu- tion systems, such as wells. ACKNOWLEDGMENTS We thank Prof. Vitor Vasconcelos for providing freeze- dried material of cyanobacteria strains used as positive con- trol in PCR studies. AV would like to thank Dr. Panagiota Katikou for providing useful information on cyanotoxins. The authors acknowledge CYANOCOST-COST ES 1105 for sharing of knowledge and networking and thank the two anonymous reviewers for helpful suggestions. REFERENCES Atashpaz S, Khani S, Barzegari A, Barar J, Vahed SZ, Azarbai- jani R, Omidi Y, 2010. A robust universal method for extrac- tion of genomic DNA from bacterial species. Microbiology 79:538-542. Burch MD, 2008. Effective doses, guidelines and regulations. In: H.K. Hudnell (ed.), Cyanobacterial harmful algal blooms: State of the science and research needs. Adv. Exp. Med. Biol. 610:831-854. Canadian Food Inspection Agency (CFIA), 2011. Microcystins in bottled water. Food Safety Action Plan Report. TS- CHEM-10/11, pp. 1-8 Canadian Food Inspection Agency (CFIA), 2012. Microcystins and nodularin in Bottled Water. Food Safety Action Plan Re- port. TS-CHEM-11/12, pp. 1-8. Chrisostomou A, Moustaka-Gouni M, Sgardelis S, Lanaras T, 2009. Air-dispersed phytoplankton in a Mediterranean River-Reservoir System (Aliakmon-Polyphytos, Greece). J. Plankton Res. 31:877-884. Cook CM, Moustaka-Gouni M, Gkelis S, Lanaras T, 2005. Greece: cyanotoxin risk assessment, risk management and regulation, p. 69-75. In: I. Chorus (ed.), Current approaches to cyanotoxin risk assessment, risk management and regu- lations in different countries. Series WaBoLu 02/05. Umweltbundesamt, Dessau. Codd GA, Lindsay J, Young FM, Morrison LF, Metcalf JS, 2005. Harmful cyanobacteria: from mass mortalities to man- agement measures, p. 1-23. In: J. Huisman, H.C.P. Matthijs and P.M. Visser (eds.), Harmful cyanobacteria. Springer, Dordrecht. Davis TW, Berry DL, Boyer GL, Gobler CJ, 2009. The effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of Microcystis during cyanobac- teria blooms. Harmful Algae 8:715-725. Ferretti E, Lucentini L, Veschetti E, Bonadonna L, Stammati A, Turco L, Ottaviani M, 2007. Screening and identification of unknown contaminants in water destined to human con- sumption: A case study. Microchem. J. 85:57-64. Garcia-Pichel F, Pringault O, 2001. Cyanobacteria track water in desert soils. Nature 412:380-381. Genitsaris S, Kormas KA, Moustaka-Gouni M, 2011. Airborne algae and cyanobacteria: occurrence and related health ef- fects. Front. Biosci. 3:772-787. Gkelis S, Chronis I, Kagalou I, 2015a. Monitoring a newly re- born patient: Phytoplankton based water quality and cyan- otoxin occurrence in a reconstructed shallow Mediterranean lake. Proceedings ASLO Aquatic Sciences Meet., Granada. Abstract ID27076. Gkelis S, Lanaras T, Sivonen K, 2015b. Cyanobacterial toxic and bioactive peptides in freshwater bodies of Greece: con- centrations, occurrence patterns, and implications for human health. Mar. Drugs 13:6319-6335. Gkelis S, Papadimitriou T, Zaoutsos N, Leonardos I, 2014. An- thropogenic and climate-induced change favors toxic cyanobacteria blooms: Evidence from monitoring a highly eu- trophic, urban Mediterranean lake. Harmful Algae 39:322-333. Gkelis S, Zaoutsos N, 2014. Cyanotoxin occurrence and poten- tially toxin producing cyanobacteria in freshwaters of Greece: A multi-disciplinary approach. Toxicon 78:1-9. Hisbergues M, Christiansen G, Rouhiainen L, Sivonen K, Borner T, 2003. PCR-based identification of microcystin- producing genotypes of different cyanobacterial genera. Arch. Microbiol. 180:402-410. Hudnell KH, Dortch Q, 2008. A synopsis of research needs iden- tified at the interagency, International symposium on cyanobacterial harmful algal blooms (ISOC-HAB). Adv. Exp. Med. Biol. 619:17-43. Kaloudis T, Zervou KS, Tsimeli K, Triantis T, Fotiou T, Hiskia A, 2013. Determination of microcystins and nodularin (cyanobacterial toxins) in water by LC–MS/MS. Monitoring of Lake Marathonas, a water reservoir of Athens, Greece. J. Hazard. Mat. 263:105-115. Komárek J, Anagnostidis K, 1999. [Cyanoprokaryota 1. Teil: Non -co mmerc ial us e o nly Cyanobacteria in underground water sources 91 Chroococcales], pp. 548. In: H. Ettl, G. Gärtner, H. Heynig, and D. Mollenhauer (eds.), [Süsswasserflora von Mitteleu- ropa 19/1].[Book in German]. Gustav Fischer Verlag, Jena. Kormas KA, Gkelis S, Vardaka E, Moustaka-Gouni M, 2011. Morphological and molecular analysis of bloom-forming Cyanobacteria in two eutrophic, shallow Mediterranean lakes. Limnologica 41:167-173. Loza V, Perona E, Mateo P, 2013. Molecular fingerprinting of cyanobacteria from river biofilms as a water quality moni- toring tool. Applied Environ. Microbiol. 79:1459-1472. Neilan BA, Jacobs D, Deldot T, Blackall LL, Hawkins PR, Cox PT, Goodman AE, 1997. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. Int. J. Syst. Bacteriol. 47:693-697. Paerl HW, Hall NS, Calandrino ES, 2011. Controlling harmful cyanobacterial blooms in a world experiencing anthro- pogenic and climatic-induced change. Sci. Total Environ. 409:1739-1745. Paerl HW, Huisman J, 2008. Blooms like it hot. Science 320: 57-58. Paerl HW, Otten GT, 2013. Harmful cyanobacterial blooms, causes, consequences, and controls. Microb. Ecol. 65: 995-1010. Pazouki P, Prévost M , McQuaid N, Barbeau B, de Boutray M- L, Zamyadi A, Dorner S, 2016. Breakthrough of cyanobac- teria in bank filtration. Water Res. 102:170-179. Quiblier C, Wood S, Echenique-Subiabre I, Heath M, Villeneuve A, Humbert J-F, 2013. A review of current knowledge on toxic benthic freshwater cyanobacteria-Ecology, toxin pro- duction and risk management. Water Res. 47:5464-5479. Reisser W, 2007. The hidden life of algae underground, p. 47- 58. In: J. Seckbach (ed.), Algae and cyanobacteria in ex- treme environments. Springer, Dordrecht. Sivonen K, Jones G, 1999. Cyanobacterial toxins, p. 113-153. In: I. Chorus and J. Bartram (eds.), Toxic cyanobacteria in water: A guide to their public health consequences, moni- toring and management. World Health Organization, E & FN Spon. Utermöhl H, 1958. [Zur Vervollkommung der quantitativinen phytoplankton-Methodik].[Article in German]. Int. Ver. Theor. Angew. Limnol. 9:1-38. Vasconcelos V, Martins A, Vale M, Antunes A, Azevedo J, Welker M, Lopez O, Montejano G, 2010. First report on the occurrence of microcystins in planktonic cyanobacteria from Central Mexico. Toxicon 56:425-431. Non -co mmerc ial us e o nly