





























1 

 

In ternationa l
Scholars
Journa ls

 

African Journal of Agricultural Marketing ISSN 2375-1061 Vol. 11 (1), pp. 001-006, January, 2023. Available 
online at www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

Full Length Research Paper 

 

Genetic diversity analysis of Iranian citrus 

varieties using micro satellite (SSR) based 

markers 
 

M. Jannati1, R. Fotouhi1, A. Pourjan Abad2* and Zivar Salehi3 
 

1
Department of Horticulture, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran. 

2
Agric-Natural Research Center of Yazd, Genomics Laboratory, Yazd, Iran. 

3
Department of Biology, Faculty of Sciences, University of Guilan, Rasht, Iran. 

 
Accepted 8 June, 2022 

 
Fifteen SSR Primer Pairs were used to estimate the level of polymorphism among 23 Citrus genotypes and four 
natural hybrids or bud mutation was selected from Kotra Germplasm Bank (IRAN) . All fifteen loci assayed in citrus 
plant possessed a high level of polymorphism, with the number of alleles per locus ranging from 4 in TAA41 to 12 at 
CAT01, ATC09, AG14 ( an average, 8.27 alleles were detected per locus ). Cluster analysis with SSR markers resulted 
in 2 cluster groups: Group A: Yuzo and Poncirus. Group B: There are three separate subgroups within Group B; (i) 
genus Fortunella sp (ii) Mandarin subgroup: Citrus reticulate (Citrus clemantin), Citrus sinensis (Pineapple, 
Washington Navel), Natural types (Siahvaraz, Shalmahaleh, Moallemkoh and Kotra 4 hybrids) and (iii) Citrus Limon 
(Amol lemon - pear, Eureka, Rough Lemon), Citrus aurantifolia, Citrus aurantium, Citrus medica and Citrus grandis. 
Microsatellite analysis clustered citron and sour orange cv cluster but these taxa were quiet distant from Fortunella 
SP. 
 
Key words: Citrus, microsatellite, phylogeny, polymorphism, germplasm bank, genetic diversity. 

 
INTRODUCTION 

 
Citrus plants are cultivated in the North and South of IRAN. 
Little is known about the genetic variability of Iranian 
cultivated citrus germplasm collection. Microsatellite or SSR 
(Simple Sequence Repeat) markers are co-dominant, 
multiallelic, highly polymorphic genetic markers and 
appropriate for genetic diversity studies. 

Citrus Cultivated since ancient times in its centre of origin 
in south eastern Asia, citrus production has spread over the 
centuries into most areas that have a suitable climate 
(Webber et al., 1967) . Today citrus is one of the most widely 
cultivated fruit in the world, and most major production areas 
are far removed from the original areas. Different Citrus 
species widely grown in more than 50 countries in the world. 
World production is increasing and has reached 70 million 
tones, according to FAO (Orford et al., 1995).  

Citrus taxonomy and phylogeny, however, are very 

complicated, controversial and confusing, mainly due to  
 
 
 

 
*Corresponding author. E-mail: ali1360405@gmail.com. Tel: 
+98 351 8249901. Fax: +98 3518247439 

 
 
 

 
sexual compatibility between Citrus and related genera, the 
high frequency of bud mutations and the long history of 
cultivation and wide dispersion. Citrus varieties show 
diversity in their morphological traits such as size and shape 
of canopy, color, size, type and ripening season of the fruits 
and the number of seeds per fruit (Orford et al., 1995).  

In the past, studies on relationships between genera 
and species were carried out based mainly on mor-
phological and characteristics. Numerous classification 
systems have been formulated, among which those of 
Swingle (1943) and Tanaka (1977) have been the most 
widely accepted. Even these two researchers, however, 
have quite different concepts with respect to species 
classification, as Swingle included only 16 species in 
Citrus while Tanaka described 162. Later phylogenetic 
analysis by Scora (1975) and Barrett and Rhodes (1976) 
suggested that there were only 3 true species within the 
cultivated Citrus, that is, citron (Citrus medica L.), 
mandarin (C. reticulata Blanco) and pummelo [C. grandis 
(L.) Osb.] (in 1988 Scora added another true species: C. 
halimii Stone). In addition, other genotypes were derived 
from hybridization between these true species (Scora, 
1988). More recently, biochemical data (Potvin et al., 



2 

 

  
 
 
 

 
Table 1. Cultivars, species, natural hybrids and bud mutation used in this study.  

 
  Type of cultivar  

 Common name Genus and species Natural hybrid or bud mutation 

 Yuzo Citrus junos Sieb  
 Trifoliate Orange Poncirus trifoliata  

 Kumquat Fortunella Sp.  

 Clemantin Citrus reticulata Blanco  

 Satsuma Mandarin Citrus unshiu Marcovich  

 King or Sweet Orange Citrus nobilis  

 Pineapple Orange Citrus sinensis (L.) Osbeck  

 Washington Navel Orange Citrus sinensis  

 Siahvaraz Citrus sinensis Bud mutation 

 Moallemkoh Citrus sinensis Bud mutation 

 Kotra 2 - 4 - Natural hybrid 

 Kotra 1 - 4 - Natural hybrid 

 Shalmahaleh - Natural hybrid 

 Mexican Lime Citrus aurantifolia  

 Sweet Lime Citrus aurantifolia (L.)  

 Sour Orange Citrus aurantium (L.)  

 Amol Lemon-Pear Near to Citrus limon Bud mutation or natural hybrid 

 Citrus King (Pumelo) Citrus grandis (L.) Osb  

 Cluster Lemon Citrus limon Burn.f  

 Rough Lemon Citrus limon Burn.f  

 Eureka Lemon Citrus limon  

 Etrag Citron Citrus medica (L.)  

 Nova Near to Citrus reticulata Complex hybrid of Mandarin 
 

 

1983), protein electrophoresis (Handa et al., 1986), 
isozymes (Torres et al., 1978; Fang et al., 1993; Herrero 
et al., 1996), microsatellites (Kijas et al., 1995), organeller 
genome analysis (Green et al., 1986; Yamamoto et al., 
1993) and (Fang et al., 1997; Fang et al., 1998) have 
been used to examine relationships among Citrus taxa. 
Microsatellites, or simple sequence repeats (SSRs), are 
short sequence elements composed of tandem repeat 
units one to seven base pairs (bp) in length (Tautz, 
1989). These repeats sequences have been shown to be 
highly polymorphic within and between species, a 
property that has permitted their application as molecular 
markers in population genetics (Goldstein et al., 1999), 
systematics (Goldstein and Pollock, 1997), and genome 
mapping (Weissenbach et al., 1992).  

Microsatellites are present in high numbers in 
mammals and in plant genomes too, but appear to be 
less abundant than in mammalian or insect systems (Van 
Treuren et al., 1997). Thomas et al., 1994 distinguished 
20 grapevines varieties by using four microsatellite loci. 
They proposed the use of microsatellites for establishing 
an international database for description of grapevine 
varieties, based on its high level of polymorphism, co-
dominance, simplicity of analysis and repeatability 
(Thomas et al., 1994). 

 

 

Little is known about the genetic variability of the 
Iranian Citrus Germplasm Collections. We investigated 
the phylogenetic relationships among 23 citrus plants of 
the Kotra Germplasm Bank (IRAN) and studied the origin 
of some important Citrus species of this Collection, using 
microsatellites markers. 
 

 
MATERIALS AND METHODS 
 
Plant materials and DNA isolation 
 
In this study, 23 cultivars, species, natural hybrids or bud mutations 
were used (Table 1), which held at Germplasm Collection of Kotra 
(Iran) . From each accession, 50 mg of young expanding leaves 
were collected and stored at -80°C before DNA isolation. Genomic 
DNA was isolated from leaf samples in accordance with the CTAB 
(Hexadecyltrimethyl ammonium bromide) method described by 
Doyle and Doyle (1987). DNA was quantified by comparing it with 
lambda DNA (Promega Corporation, Madison, Wis) on ethidium 
bromide stained agarose gels. 

 

PCRs and electrophoresis 
 
Fifteen primer pairs (TAA15, TAA27, TAA41 CAC23, CAC15, 

CAC33, CAC39, CCT01, CAT01, ATC09, AG14, CTT01, CT21, 

TC26 and CT19) (MWG Biothec, Germany) were used in this 



3 

 

 
 
 

 
Table 2. SSR loci characterization, size of amplified fragments; primer pairs repeat motifs and total number of alleles.  

 

 Locus code Repeat Forward Primer Reverse Primer Alleles Size range (bp) 
       

 TAA15 TAA GAAAGGGTTACTTGACCAGGC CTTCCCAGCTGCACAAGC 5 123 - 130 

 TAA27 TAA GGATGAAAAATGCTCAAAATG TAGTACCCACAGGGAAGAGAGC 10 158 - 230 

 TAA41 TAA AATGCTGAAGATAATCCGCG TGCCTTGCTCTCCACTCC 4 242 - 265 

 CAC23 CAC ATCACAATTACTAGCAGCGCC TTGCCATTGTAGCATGTTGG 6 105 - 135 

 CAC15 CAC TAAATCTCCACTCTGCAAAAGC GATAGGAAGCGTCGTAGACCC 10 135 - 190 

 CAC33 CAC GGTGATGCTGCTACTGATGC CAATTGTGAATTTGTGATTCCG 8 77 - 109 

 CAC39 CAC AGAAGCCATCTCTTCTGCTGC AATTCAGTCCCATTCCATTCC 6 120 - 165 

 CCT01 CCT TCAACACCTCGAACAGAAGG CCCACATGCTAGCACAAAGA 8 93 - 119 

 CAT01 CAT GCTTTCGATCCCTCCACATA GATCCCTACAATCCTTGGTCC 12 138 - 172 

 ATC09 ATC TTCCTTATGTAATTGCTCTTTG TGTGAGTGTTTGTGCGTGTG 12 130 - 210 

 AG14 AG AAAGGGAAAGCCCTAATCTCA CTTCCTCTTGCGGAGTGTTC 12 110 - 172 

 CTT01 CTT TCAGACATTGAGTTGCTCG TAACCACTTAGGCTTCGGCA 7 226 -252 

 CT21 CT CGAACTCATTAAAAGCCGAAAC CAACAACCACCACTCTCACG 8 130 - 170 

 TC26 TC CTTCCTCTTGCGGAGTGTTC GAGGGAAAGCCCTAATCTCA 7 93 - 119 
 CT19 CT CGCCAAGCTTACCACTCACTAC GCCACGATTTGTAGGGGATAG 9 175 - 205  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

A 1 2 3 4 5 6 7 8 9 10111213141516 171819 20212223 

 
Figure 1. Microsatellite polymorphism (locus CAC15) A is size marker. Lane 1 = Yuzu; Lane 
2 = Rough Lemon; Lane 3 = Clemantin; 4 = Etrag Citron; 5 = Sour Orange; 6 = Satsuma 
Mandarin; 7 = Kumquat; 8 = Amol Lemon-Pear; 9 = Siahvaraz; 10 = Cluster lemon; 11 = 
Trifoliate Orange; 12 = Pinapple Orange; 13 = Citrus king (Pumelo); 14 = Washington Navel 
Orange; 15 = Eureka Lemon; 16 = Sweet Lime; 17 =cluster sour orange; 18 = Moallemkoh; 
19 = Shalmahaleh; 20 = Kotra 2-4; 21 = Nova; 22 = Kotra 1-4; 23 = Mexican Lime. 

 

 
research (Table 2). PCRs were performed in a final volume of 10 L, 
containing the following: 20 mmol Tris–HCl/L (pH 8.4); 50 mmol 
KCl/L; 1.5, 2.5, or 5 mmol MgCl2/L, depending on the primers; 0.1 
mmol/L of each dNTP (deoxynucleoside triphosphate); 0.8 mol/L of 
each primer; 20 ng of genomic DNA; and 1 U Taq polymerase 
(Invitrogen, Carlsbad, Calif). The following temperature profile was 
used: 95°C for 1 min, then 35 cycles of 94°C for 45 s, 45 – 63°C for 
45 s and 72°C for 75 s), ending with 72°C for 7 min (Progene; 
Techne, Cambridge, UK). PCR products were separated by 
electrophoresis in 6% acrylamide gels, stained with ethidium 
bromide (0.8 g/mL), using 1× TBE (89 mmol Tris/L, 89 mmol boric 
acid/L and 2 mmol EDTA/L (pH 8.0) buffer and visualized under 
ultra-violet light. Molecular sizes of the amplified fragments were 
estimated using a 100-bp ladder (Invitrogen) (Soriano et al., 2005) 
(Figure 1). 

 
 

 
PIC (polymorphism information content) value 
 
In order to determine the informativeness of the microsatellites, the 

PIC values were calculated. PIC value was calculated according to 

the formula: 
 

PIC = 1-P
2
ij 

 

 
Polymorphism analysis 
 
For a single locus, the presence of amplified fragments was scored 

as 0.5 if the Individual was heterozygous, 1 if it was homozygous, 

and 0 if the allele was not present. According to these observations, 



4 

 

  
 
 

 
Table 3. PIC value of different Iranian Citrus germplasm. 

 

   PIC
*
    

SSR Natural hybrids Grape fruit Lemons Mandarins Citrus Mean PIC 

TAA15 0.69 0.50 0.50 0.50 0.50 0.65 

TAA27 0.62 0.75 0.76 0.72 0.72 0.85 

TAA41 0.0 0.81 0.48 0.55 0.50 0.52 

CAC23 0.0 0.38 0.58 0.56 0.0 0.71 

CAC15 0.72 0.63 0.85 0.83 0.72 0.86 

CAC33 0.65 0.61 0.68 0.54 0.52 0.78 

CAC39 0.67 0.50 0.50 0.69 0.50 0.72 

CCT01 0.69 0.62 0.61 0.52 0.41 0.75 

CAT01 0.85 0.81 0.80 0.87 0.27 0.89 

ATC09 0.67 0.63 0.69 0.53 0.50 0.76 

AG14 0.59 0.38 0.85 0.67 0.0 0.87 

CTT01 0.58 0.53 0.56 0.68 0.53 0.74 

CT21 0.81 0.75 0.78 0.67 0.50 0.73 

TC26 0.89 0.50 0.82 0.67 0.0 0.83 

CT19 0.71 0.76 0.78 0.59 0.48 0.79 

Mean PIC 0.64 0.61 0.68 0.63 0.41   
 

*Polymorphic information content. 
 

 

a similarity matrix was generated using the Nei’s genetic distance 
(Nei, 1972). Similarity data were processed through the unweighted 
pair-group  method  (UPGMA)  cluster  analysis  conducted  using 
NTSYS program (Exeter Software, Setauket, N.Y.) (Rohlf, 1993), 
program, applying the Jaccard (1908) and Dice (Sneath and Sokal, 
1973) coefficients. The goodness of fit measured by the cophenetic 
correlation unweighted pair-group method, arithmetic average 
(UPGMA) cluster analysis and finally depicted in a dendrogram  
(Figure 1). 
 

 

RESULTS 

 

Microsatellite polymorphism and accession 

variability 

 
Microsatellites analysis clustered Citron and sour orange 
cv cluster but these taxa were quiet distant from 
Fortunella SP.  

The present study showed the utility of microsatellite 
markers for the detection of polymorphisms among the 
Iranian citrus germplasm. The identification of similarity 
group could be useful for the selection of parental plants 
to be used in the breeding programs.  

All fifteen loci assayed in citrus plant possessed a high 
level of polymorphism, with the number of alleles per 
locus ranging from 4 in TAA41 to 12 at CAT01, ATC09, 
AG14 (an average, 8.27 alleles were detected per locus).  

Where Pij is the frequency of the jth microsatellite allele 
for loci. This value is referred to as heterozygosity and 
gene diversity (Weir 1990, Anderson et al, 1993).  

The most highly polymorphic loci were: CAT01 (12 

alleles, PIC=0.89), AG14 (12 alleles, PIC = 0.87), TAA27 

 
 

 

(10 alleles, PIC = 0.85) (Table 3). 
 

 

Cluster analysis 

 

UPGMA cluster analysis of the similarity matrix obtained 
from 23 SSR alleles (Nei 1972) resulted in a dendrogram 
of genetic relationships that grouped cultivars in agree-
ment with their geographic origins and pedigrees (Figure 
2), producing 2 main clusters. The first cluster Included 
Yuzo and Poncirus . The second cluster was subdivided 
into 3 sub-clusters (i) genus Fortunella sp (ii) Mandarin 
subgroup: Citrus reticulate (Citrus clemantin), Citrus 
sinensis (Pineapple, Washington Navel), Natural types 
(Siahvaraz, Shalmahaleh, Moallemkoh and Kotra 4 
hybrids) and (iii) Citrus limon (Amol lemon-pear, Eureka, 
Rough Lemon), Citrus aurantifolia, Citrus aurantium, 
Citrus medica and Citrus grandis.  

Microsatellite analysis clustered Citron and sour orange 

cv cluster but these taxa were quiet distant from 
Fortunella SP. 
 

 

DISCUSSION 

 

The transportability of the microsatellites among species 
belonging to different genera or even families has been 
previously reported (Dirlewanger et al., 2002).  

In our work microsatellite markers were used to study 

genetic diversity in 23 citrus plants of the Kotra Germ-
plasm Collection, IRAN (Yuzo, Rough Lemon, Clemantin, 

Etrag Citron, Sour Orange, Satsuma Mandarin, Kumquat, 



5 

 

  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. Dendrogram of the 23 citrus cultivars included in this study generated by unweighted pair-group method (UPGMA) cluster 

analysis from the similarity matrix obtained using Nei’s (1972) genetic distance. 
 

 

Amol Lemon-Pear, Siahvaraz; ,Cluster lemon, Trifoliate 
Orange, Pineapple Orange, Citrus king (Pumelo), 
Washington Navel Orange, Eureka Lemon, Sweet Lime, 
Moallemkoh, Shalmahaleh, Kotra 2 - 4, Nova, Kotra 1 - 4, 
Kumquate, Mexican Lime and Sour Orange var. Cluster). 
According to Wang et al. (1994), in plant nuclear DNA the 
dinucleotides sequence (AT)n is the most abundant, fol-
lowed by (A)n/(T)n and (AG)n/(CT)n. In our experiments, 
CAT01, ATC09, AG14 gave excellent fingerprint patterns, 
suggesting that these repeats are abundant in citrus 
plants. In the study of Gulsen and Roose (2001) cpDNA 
indicated that Fortunella sp had totally different 

microsatellite patterns from the other taxa analysed. 
Although Fortunella is well differentiated from Citrus on 

the basis of detailed morphological studies, apparently 
there has not been the same level of divergence at the 
molecular level. Our experiments indicated that the genus 
Citrus is quiet distant from the related genus Poncirus. 

Kotra 1 - 4 and Kotra 2 - 4 probably originated as nucellar 

seedling from the same tree. Siahvaraz has a much similarity to 
Washington Navel orange and probably originated from bud 
mutation. Shalmahaleh is a natural hybrid and has a greater 

similarity to Nova. Moallemkoh has 

 
 

 

a similarity to Washington navel Orange and Siahvaraz and 
is probably hybrid between them or as a bud mutation. 
Shalmahaleh, Nova, Etrag Citron and Citrus King (Pumelo) 
are very similar and Shalmahaleh is apparently as a hybrid 
origin, most probably of Nova and Etrag Citron or Nova and 
Citrus King (Pumelo). Amol Lemon -Pear is probably derived 
from hybridization between Rough Lemon and Citrus King 
and has a similarity to them.  

The percentage of PIC (polymorphic Information 
Content) in lemon, Mandarin, Grapefruit, Natural hybrid 
and sweet orange were 0.68, 0.63, 0.61, 0.64, 0.41 as 
observed by Novelli et al. (2000).  

Heterozygosity is important to both natural and cultured 

populations because (1) it provides a large spectrum of 

genotypes for adaptive response to changing conditions and 

(2) heterozygous individuals usually are superior to less 

heterozygous individuals in many economically important 

characteristics like growth, fertility and disease resistance. A 

set of informative SSR markers detected considerable levels 

of genetic variability in the Iranian citrus germplasm. The 

identification of similarity group could be useful for the 

selection of parental plants to be used in the breeding 

programs. 



6 

 

 
 
 

 

ACKNOWLEDGEMENTS 

 

We thank Prof. M. L. Roose for primers, Mr. Amin 

Ramezani for his helpful comments that improved the 

manuscript and Mr. Dalir Seffat for his technical 

assistance. 
 

 
REFERENCES 
 
Anderson JA, Churchill GA, Autrique JE, Tanksley SD , Sorreles ME 

(1993). Optimizing paternal selection for genetic linkage maps. 
Genome pp: 36:181-186. 

Barrett HC , Rhodes AM (1976). A numerical taxonomic study of affinity 
relationship in cultivated Citrus and its close relatives. Systematic 
Bot., 1:105-136. 

Dirlewanger E, Cosson P, Tavaud M, Aranzana MJ, Poizat C, Zanetto 
A, Arús P, Laigret F (2002). Development of microsatellite markers in 
peach [Prunus persica (L.) Batsch] and their use in genetic diversity 
analysis in peach and sweet cherry (Prunus avium L.) Theor. Appl. 
Genet. 105: 127–138.  

Doyle JJ, Doyle JL (1987). A rapid isolation procedure for small 
quantities of fresh leaf tissue. Phytochem. Bull. 19: 11–15. 
Fang DQ, RooseML, Krueger RR, Federici CT (1997). Fingerprinting 
trifoliate orange germplasm accessions with isozymes, RFLPs, and 
inter-simple sequence repeat markers. Theor. Appl. Genet. 95: 211 - 
219. 

Fang DQ, Zhang WC, Xiao SY (1993). Studies on taxonomy and 
evolution of Citrus and its related genera by isozyme analysis. (in 
Chinese with English abstract). Acta Phytotaxon Sinica, 31: 329-352. 

Fang DQ., Krueger RR, Roose ML (1998). Phylogenetic relationships 
among selected Citrus germplasm accessions revealed by inter-
simple sequence repeat (ISSR) markers. J. Am. Soc. Hort. Sci. 123: 
612-617. 

Goldstein DB, Pollock DD (1997). Launching microsatellites: A review of 
mutation processes and methods of phylogenetic inference. J. Hered. 
88: 335-342. 

Goldstein DB, Roemer GW, Smith DA, Reich DE, Wayne RK (1999). 
The use of microsatellite variation to infer population structure and 
demographic history in a natural model system. Genetics,151: 797-
801.  

Green RM, Vardi A, Galun E (1986). The plastome of Citrus. Physical 
map, variation among Citrus cultivars and species, and comparison 
with related genera. Theor. Appl. Genet., 72: 170-177. 

Handa T, Ishizawa Y, Oogaki C.1986. Phylogenic study of Fraction I 
protein in the genus Citrus and its close related genera. Jpn J Genet 
61:15-24. 

Herrero, R., M.J. Asins, E.A. Carbonell and L. Navarro.1996. Genetic 
diversity in the orange subfamily Aurantioideae. I. Intraspecies and 
intragenus genetic variability. Theor. Appl. Genet. 92: 599-609. 

Soriano JM,  Romero C,  Vilanova S,  Llácer G, Badenes ML  (2005).  
Genome 48: 108–114.  

Kijas JMH, Fowler JCS, Thomas MR (1995). An evaluation of sequence 
tagged microsatellite site markers for genetic analysis within Citrus 
and related species. Genome 38: 349-355. 

Nei M (1972). Genetic distance between populations. Am. Naturalist, 

106: 283 – 292. 

  
  

 
 

 
Orford SJ, Steele Scott N , Timmis JN (1995). A hypervariable middle 

repetitive DNA sequence from citrus. Theor. Appl. Genet., 91:1248-
52. 

Potvin C, Bergeron Y, Simon JP (1983). A numerical taxonomic study of 
selected Citrus species (Rutaceae) based on biochemical characters. 
Syst. Bot. 8:127-133 

Scora RW (1975). On the history and origin of Citrus . Bul. Torrey Bot. 
Club, 102: 369-375 

Scora RW (1988). Biochemistry, taxonomy and evolution of modern 

cultivated Citrus, . In: Goren R , Mendel K (eds). Proc .6
th

 Int1. Citrus 
Congr. Margraf Pub1., Weikersheim, Germany. 1: 277-289.  

Scott NS (eds) Techniques on gene diagnosis and breeding in fruit 
trees. Fruit Trees Research Station, Okitsu, Japan, pp: 39-46  

Swingle WT (1943). The botany of Citrus and its wild relatives of the 
orange subfamily, In: Webber HJ , Batchelor LD (eds.). The Citrus 
industry, History, botany, and breeding. Univ. California Press, 
Berkeley, Calif., I: 129-474  

Tanaka T (1977). Fundamental discussion of Citrus classification. 
Studia Citrologia, 14: 1-6  

Tautz D (1989). Hypervariability of simple sequence repeats as a 
general source for polymorphic DNA markers. Nucleic Acids Res., 17: 
6463 - 6471 

Thomas MR, Scott NS (1994). Microsatellite repeats in grapevine reveal 
DNA polymorphisms when analysed as sequence-tagged sites 
(STSs). Theor. Appl. Genet. 86, 985-990 

Thomas MR, Cain PNS (1994). DNA typing of grapevines: a universal 
methodology and database for describing cultivars and evaluating 
genetic relatedness. Plant Mol. Biol. 25: 939-949 

Torres AM, Soost RK, Diedenhofen U (1978). Leaf isozymes as genetic 
markers in Citrus. Am. J. Bot. 65: 869 - 881  

Van Treuren R, Kuittinen H, Karkkainen K, Baena-Gonzalez E, 
Savolainen O (1997). Evolution of microsatellites in Arabis petraea 
and Arabis lyrata, outcrossing relatives of Arabidopsis thaliana. Mol. 
Biol. Evol. 14: 220-229  

Webber HJ, Reuther W, Lawton HW (1967). History and develop-ment 
of the citrus industry, In: Reuther W., Webber HJ, Batcher LD (Eds). 
The Citrus industry. University of California, Berkeley, 1: 1-39 

Weir BS (1990). Genetic data analysis .Methods for discrete genetic 
data. Sinauer associates, Sunderland, MA. 

Weissenbach X, Gyapay G, Dib C, Vignal A, Morisset J, Millasse P 
(1992). A second-generation linkage map of the human genome. 
Nature 359: 794-801 

Yamamoto M, Kobayashi S, Nakamura Y, Yamada Y (1993). 

Phylogenic relationships of Citrus revealed by diversity of cytoplasmic 

genomes. In: Hayashi T, Omura M 


