





























1 

 

In ternationa l
Scholars
Journa ls

 

African Journal of Environmental Economics and Management ISSN 2375-0707 Vol. 9 (3), pp. 001-007, March, 
2021. Available online at www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 
 

 

Full Length Research Paper 

 

Molecular diversity analysis of planctomycete-
like bacteria in inosine fermentation and 
municipal wastewater treatment systems 

 
Hao Zhang, Ying Xu, Yifeng Ding, Qingxiang Yang*, Siwei Ren, Xueling Li, Xuanyu 

Chen, Yuanyuan Xu and Hongxin Hao 
 

College of Life Sciences, Henan Normal University, Xinxiang 453007, China. 
 

Accepted 11 September, 2020 
 

In this study, the diversity of planctomycete-like bacteria in an inosine fermentation and a municipal 

wastewater treatment plants was investigated by denaturing gradient gel electrophoresis (DGGE) of nested 

polymerase chain reaction (nested PCR) amplified 16S rRNA gene fragments using planctomycete-specific 

forward primer and a bacteria universal reverse primer. The bacterial community structures in the two 

wastewater treatment systems were obviously different due to the different treatment processes and different 

wastewater characteristics. The highest similarity of the microbial community structure happened in the two 

samples from the acidification and the anaerobic tank in inosine fermentation plant reaching 67%. While the 

two samples from the anaerobic and the aerobic tank of municipal wastewater treatment plant reached 66%. 

Ten sequences were recovered from the DGGE gel and were assigned to Clostridia, Proteobacteria, 

Bacteroidete and Candidate division based on the phylogenetic analysis. The two sequences grouped into 

Candidate division had more than 92% similarities with the Planctomycete-like bacterial clones. However, no 

anaerobic ammonium oxidation (anammox) activities were detected in the samples of these two wastewater 

treatment plants. 

 
Key words: Planctomycete-like bacteria, wastewater treatment, denaturing gradient gel electrophoresis 
(DGGE). 

 
 
INTRODUCTION 

 
Planctomycetales is a separate division in domain 
bacteria with special characteristics of cell structure, 
genetics and physiology, etc. Researches on the  
 
 
 
*Corresponding  author.  E-mail:  yangqx66@163.com.  Tel/Fax:  
+86-373-332-5528. 
 
Abbreviations: DGGE, Denaturing gradient gel 
electrophoresis; PCR, polymerase chain reaction; Anammox, 
anaerobic ammonium oxidation; plant IF, inosine fermentation 
wastewater treatment plant; plant M, municipal wastewater 
treatment plant; ABR, anaerobic baffled reactor; UBF, upflow 
blanket filter; CASS, cyclic activated sludge system; HRT, 
hydraulic retention time; A/O, anoxic-aerobic; COD, chemical 
oxygen demand; TN, total nitrogen; TP, total phosphate; SS, 

suspended solid substances. 

 
 
 
 

 
molecular ecology indicated that this group of bacteria 
had a wide distribution in nature, such as ocean settlings, 
fresh water ecosystem, wastewater treatment reactors 
and soil (Jetten et al., 2003; Fuerst, 2004; Fuerst and 
Sagulenko, 2011). All of them played important roles in 
the cycle of inorganic or organic substances (Jenkins et 
al., 2002). Up to now, only four cultured genera of 
Planctomycetales including Planctomyces, Pirellula, 
Gemmata and Isosphaera have been described clearly 
and they are all aerobic chemoheterotrophs (Ward et al., 
2006). However, in recent years, the physiological groups 
of Planctomycetales have been expanded as the 
research being deepened. Members of them include not 
only chemoorganotrophs and obligate or facultative 
aerobes but also obligate anaerobes and autotrophs 
(Kulichevskaya et al., 2007; Shu and Jiao, 2008). 
Especially in 1995, the anaerobic ammonium oxidation 



2 

 

 
 
 

 

(anammox) process was first described in a denitrifying 
pilot bioreactor in the wastewater treatment plant of Gist-
Brocades (Mulder et al., 1995). At present, three 
uncultured genera of anammox bacteria belonging to a 
deep branching cluster within the Planctomycetales, 
Candidatus Brocadia, Candidatus Kuenenia and 
Candidatus Scalindua (Kuypers et al., 2003; Kuenen and 
Jetten, 2001; Schmid et al., 2003), have been paid close 
attentions by investigators due to their high efficiencies of 
removing nitrogen from nitrite and ammonium without 

requiring either organic matter or O2 in wastewater 

treatment processes (Alexandre et al., 2009). But our 
knowledge on Planctomycetales is still limited today. So, 
investigation of Planctomycete-like bacteria in different 
environments should have great significance due to their 
abundant metabolic diversity. However, few researches 
about it were involved in industrial wastewater treatment 
systems, except Chouari (Chouari et al., 2003) and 
Innerebner (Innerebner et al., 2007).  

Simultaneously, some molecular biological techniques 
such as polymerase chain reaction-denaturing gradient 
gel electrophoresis (PCR-DGGE), fluorescence in situ 
hybridization (FISH) and cloning of 16S rDNA have been 
developed and widely applied to analyze the genetic 
diversity of microbial communities in wastewater 
treatment systems giving much more information of 
microorganisms than traditional cultivation methods. 
DGGE resolves the differences of PCR-amplified regions 
of genes based on differences in nucleotide sequences 
(Lyautey et al., 2005) and the band patterns from DGGE 
map can directly reflect the genetic diversity of the 
microbes in certain samples (Sanz and Köchling, 2007). 
So, it has been widely used in molecular microbial 
ecology researches. To increase the sensitivity of such 
ecological analysis, the technique of nested PCR was 
developed to assess the diversity of the microbial species 
presence in low concentrations in environments (Liu et 
al., 2007).  

In this study, a municipal and a typical inosine 
fermentation wastewater treatment plant were selected 
as cases to investigate the distribution and diversity 
characteristics of planctomycete-like bacteria in biological 
treatment systems using nested PCR-DGGE technique. 
 

 
MATERIALS AND METHODS 
 
System characterization 
 
An inosine fermentation wastewater treatment plant (plant IF) and a 
municipal wastewater treatment plant (plant M) which locate in 
Xinxiang, Henan Province, China and have run stably for more than 
two years were selected as cases in this study. Plant IF produces  
700 tons of high-strength and 1,300 tons of low-strength of effluents 
every day. Its wastewater treatment system is composed of an ABR 
(Anaerobic Baffled Reactor), 4 UBF (Upflow Blanket Filter) reactors 
and a CASS (Cyclic Activated Sludge System) tank treating 2000 

m
3
 wastewater per day as indicated in Figure 1. The high strength 

of the original wastewater was first fed into an acidification basin 
and then was distributed into the 4 UBF reactors with hydraulic 

 
 
 
 

 
retention time (HRT) of 53 h. The CASS tank receives the treated 
effluents from the UBF reactors and the original low strength of 
wastewater. Plant M is a typical A/O (anoxic-aerobic) process 

treating 150, 000 m
3
 municipal wastewater per day. 

 
 
Analytical methods 

 
Water and activated sludge samples were collected from different 
units in the two wastewater treatment systems, immediately 
transported to the lab and stored at -20°C before the chemical and 

biological analysis (< 48 h). COD (chemical oxygen demand), NH4
+
-

N, total nitrogen (TN), total phosphate (TP) and suspended solid 
substances (SS) were detected as the standard methods (APHA, 
1995). The pH was determined using a digital pH meter. For each 
plant, the mainly physical and chemical characteristics of 
wastewater at every biological treatment stage are shown in Table 
1. 

 

DNA extraction 

 
The activated sludge samples firstly needed to be washed three 
times using phosphate-buffered saline (130 mM NaCl, 7 mM 
Na2HPO4, 3 mM NaH2PO4, pH 7.0) and then centrifuged at 4°C, 
10,000 rpm for 15 min. The genomic DNA extraction was conducted 
using the phenol–chloroform method (Bourrain et al., 1999) and 
then checked by electrophoresis on a 0.8% (w/v) agarose gel. 
Nucleic acids were stored at -20°C. 
 

 
Nested polymerase chain reaction (PCR) amplification 

 
For planctomycete-like bacteria population analysis of activated 
sludge samples, a nested PCR technique was used to amplify 16S 
rRNA gene to increase the sensitivity. The first round of PCR was 
conducted using a Planctomycetales-specific forward primer PLA-
46F (5’-GGATTAGGCATGCAAGTC-3’) and a bacteria universal 
reverse primer 1378R (5’-GGGCGGWGTGTACAAGGC-3’) as 
described by Pynaert et al. (2003) and Chouari et al. (2003). The 
second round of PCR was conducted using the above PCR 
products as templates and the primers GC-341F (5’-CGCCC 
GCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACG 
GGAGGCAGCAG-3’) and 518R (5’-ATTACCG CGGCTGCTGG-3’) 
to amplify the V3 region of 16S rDNA as the method of Cunliffe 
(Cunliffe and Kertesz, 2006). 
 

 
Denaturing gradient gel electrophoresis (DGGE) analysis 

 
The second PCR products were analyzed by DGGE using a Bio-
Rad D-Code universal mutation system (Bio-Rad Laboratories, 
USA). DGGE was performed in 10% (w/v) polyacrylamide gels that 
contained a denaturing gradient of 30 to 60% denaturants. 
Electrophoresis was conducted at 25 V for 25 min, and then 
changed to a constant voltage of 75 V for 16 h. After 
electrophoresis, the gel was stained for 15 min in EB solution, then 
immediately observed and photographed by the Gel Documentation 
System.  

The major bands on the DGGE gels were excised and cloned 
into the pMD 18-T vector for sequencing. The recombinant plasmid 
DNA was then extracted using standard procedures and sequenced 
by Sangon Biotech Company, Limited, Shanghai, CHINA. Analysis 
of the bacterial community on the DGGE fingerprints was 
conducted using the Quantity-One software package (Bio-Rad 
Laboratories, USA) according to the manufacturer’s instructions. 



3 

 

  
 
 

 
Table 1. Main characteristics of wastewater in every treatment stage of plant IF and M. 

 

Treatment system pH
a
 COD

a
 (mg/L) NH4

+
-N

a
 (mg/L) TN

a
 (mg/L) TP

a
 (mg/l) SS

a
 (mg/L) 

Plant IF            

High-strength wastewater 4.7 - 6.5 3765.0 - 8130.0 111.7 - 171.1 242.7 - 336.5 31.8 - 66.5 2406.0 - 3220.0 

Adjusting tank 5.5 - 6.7 4455.0 - 8322.0 119.5 - 217.9 251.0 - 399.0 42.0 - 90.8 3810.0 - 3909.0 

Hydrolysis acidification tank 7.1 - 7.5 1530.0 - 5172.0 178.6 - 213.5 184.9 - 430.3 22.9 - 46.3 6802.0 - 9098.0 

UBF 7.2 - 7.9   2592.0 - 5302.50 20.1 - 54.4 209.6 - 351.1 26.7 - 46.9 14376.0 - 27990.0 

Low-strength wastewater 6.8 - 7.7 201.0 - 666.0 44.9 - 86.1 21.7 - 83.2 0.2 - 0.5 853.0 - 1130.0 

CASS 7.4 - 7.6 85.0 - 231.0 32.2 - 58.2 23.6 - 62.9 0.2 - 0.5 1989.0 - 2760.0 

Effluent 7.4 - 7.8 35.0 - 156.0 18.0 - 47.3 24.4 - 45.3 0.2 - 0.4 175.0 - 284.0 

Plant M            

Influent 7.2 - 7.7 133.3 - 281.0 33.4 - 64.2 38.2 - 68.2 2.8 - 4.0 230.0 - 405.0 

Anoxic tank 7.0 - 7.2 45.0 - 115.7 22.8 - 44.4 27.0 - 53.3 14.5 - 18.9 5104.0 - 7098.0 

Aerobic tank 6.8 - 7.2 18.5 - 164.2 13.4 - 24.9 24.8 - 35.2 1.4 - 2.5 5079.0 - 8344.0 

Effluent 7.0 - 7.4 9.8 - 18.5 22.5 - 27.1 26.4 - 36.6 0.2 - 0.7 15.0 - 90.0 
 

a
 maximum-minimum are shown.

 

 

 

 

(a)
 

 
 
 
 
 
 
 
 
 
 

 
(b)  

 
 
 
 
 
 

 

Figure 1. Flow charts of the inosine fermentation wastewater treatment system (a) and the municipal 
wastewater treatment system (b). 

 
 

 
Phylogenetic analysis 
 
All the nucleotide sequences were analyzed by conducting a 
BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/). Alignments of 
the 16S rRNA genes of the isolates and their closest relatives were 
conducted using the Clustal X1.8 program. Phylogenetic trees were 
constructed by neighbor-joining (NJ) method with the Jukes-Cantor 
correction in MEGA 4.1 package. 
 

 
Anaerobic batch experiments 
 
Series of anaerobic batch experiments were carried out to detect 
the anaerobic ammonium oxidation (anammox) activities of the 
biomass samples from two wastewater treatment systems in 300 ml 

 
 
 

 
serum bottles containing 250 ml of mixed liquor as described by 
Pynaert et al. (2003). 
 

 

RESULTS AND DISCUSSION 

 

Analysis of the microbial community structures in the 
two wastewater treatment plants 

 

Total DNA was successful extracted from the activated 
sludge samples originating from different biological 
treatment units in the two wastewater treatment systems 
of plant IF and M. The PCR-DGGE technique was used 



4 

 

  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Figure 2. DGGE patterns of nested PCR products using 
the Planctomycete specific forward primer PLA-46F and 
the bacterial universal reverse primer 1378R. Samples 
from the acidification basin(A), anaerobic basin(B), 
aerobic basin (C) of plant IF and the anaerobic basin(D), 
aerobic basin (E) of plant M. Special bands were signed 
by black letters and arrows. 

 
 

 

in this study to assess the bacterial community structures 
as described in materials and methods. The results are 
shown in Figure 2. On the gel used to conduct DGGE, 
various lanes contained different microbial samples 
collected from the treatment units. Bands in different 
positions in the electrophoresis gel were considered to 
represent unique species of microorganisms. Based on 
the DGGE profile, the diversities of the bacteria in 
different wastewater treatment samples were significantly 
different, but they were far lower than that in other reports 
on wastewater treatment systems (Alexandre et al., 2009; 
Liu et al., 2007) due to the planctomycete specific primer 
being used in the first round of PCR. Specifically, the 
highest diversity of the planctomycete-like bacteria 
occurred in the sample of the anaerobic unit in plant IF 
with at least 10 bands visible and the lowest one 
happened in the aerobic unit of this wastewater treatment 
system with only 5 bands distinguished by naked eyes, 
which suggested that an anaerobic condition might be 
helpful for the survival of this group of bacteria. However, 
the diversity of the two samples from the anaerobic and 
aerobic units in plant M had no significant difference, 
which was probably due to the shorter HRT and the 
returned sludge in the anaerobic tank. 

 
 
 
 

 

Similarity analysis on the DGGE profile (Figure 3) 
indicated that the five samples formed two main clusters, 
in which the samples from the acidification and anaerobic 
tanks of plant IF were grouped together sharing the 
highest identity of 67%, the aerobic (CASS tank) sample 
in plant IF clustered together with the two samples in 
plant M sharing the identity of only 11%. Moreover, the 
aerobic sample in plant IF formed a separate branch in 
the second cluster with 31% identity with the other two 
samples. It is reasonable for the high identity between the 
acidification and anaerobic samples of plant IF that these 
two environments possessed similar anoxic and nutrient 
conditions and suitable for planctomycete-like bacteria 
survival.  

However, the activated sludge samples from anoxic 
tank (Lane D) and aerobic tank (Lane E) in plant M also 
shared as high as 66% identity, which could be explained 
as the relatively shorter HRT in the two tanks and the 
frequent biomass exchange due to the returned sludge 
from the settling tank to the anaerobic tank. In the aerobic 
CASS tank in plant IF, the high concentration of dissolved 
oxygen and large amount of low strength of wastewater 
fed in, which formed a special ecological environment for 
microorganisms and resulted in lower diversity and 
identity of planctomycete-like bacteria compared with 
other basins.  

Finally, the activated sludge in plant IF came from plant 
M at the beginning of the wastewater treatment system 
being set up, but after two years of adaptation and 
domestication by the fermentation effluents, the bacterial 
community structures have largely changed sharing no 
more than 31% similarity with the original sludge source.  

Taken together, the distribution and diversity of 
planctomycete-like bacteria in different wastewater 
treatment system were significantly related to the sewage 
constituents and the operating factors such as HRT, 
dissolved oxygen concentration and flow or sludge 
returning. 
 

 

Phylogenetic analysis 

 

Here we only focused on the bright bands in the DGGE 
profile as indicated in the picture to obtain the information 
of the dominant planctomycete-like bacterial population in 
the two wastewater treatment systems. Specifically, total 
10 bands were excised from the gel and sequenced for 
further analysis. Their sequences have been deposited in 
the GenBank database under the accession numbers of 
FJ950727, FJ950729 to FJ950736 and FJ968106. The 
10 sequences were conducted a phylogenetic analysis 
using software Mega 4 and the results are shown in 
Figure 4.  

Based on the phylogenetic tree, the 10 sequences were 
clustered into 6 different groups including 
Alphaproteobacteria, Betaproteobacteria, Gammaproteo-  
bacteria,Bacteroidetes,  Clostridia  and  Candidate  decision. 



5 

 

   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Figure 3. Cluster analysis of the DGGE profile using the complete linkage method. 
 
 

 

Sequence S4 was assigned to the cluster of 
Alphaproteobacteria. The represented clone was present 
in the anaerobic basin in plant IF and shared 99% identity 
with an unpublished strain, Rhodobacter changlensis 
which was isolated from oil contaminated soil.  

Clone L1 and T3 were only present and dominant in the 
aerobic and anaerobic basins of plant M. The 
represented sequence of L1 was clustered in the group of 
Betaproteobacteria and had 99% identity with an 
uncultured Dechloromonas sp. that was also retrieved 
from a municipal activated sludge sample (Yan et al., 
2009). It was suggested that Dechloromonas sp. was 
probably a general bacterial species in the municipal 
wastewater treatment systems. The represented 
sequence of T3 was clustered in the group of 
Gammaproteobacteria and had 100% identity with a 
gammaproteobacterium clone retrieved from waste of a 
steel plant (Freitas et al., 2008).  

Two sequences of S2 and Y1 were grouped in 
Bacteroidetes sharing 99 and 100% identities with the 
two different uncultured clones from a mesophilic 
anaerobic digester which treated municipal wastewater 
sludge (Riviere et al., 2009). These two clones presented 
only in plant IF and mainly in acidification and anaerobic 
basins in this study suggesting their predominance in 
anaerobic conditions.  

Sequence L2, L3 and T1 were clustered into the group 
of Clostridia sharing 97 to 99% identities with some 
uncultured clones.  

Two sequences, S1 and S3, were clustered into 
Candidate division and shared the maximum similarity of 
98 and 100%, respectively, with an uncultured clone from  
a landfill leachate-polluted aquifer (Roling et al., 2001). 
Candidate division is an unclassified group of bacteria in 
which large amount of possible novel microorganisms are 
contained and very few pure strains are found till now. 
Further analysis showed that S1 and S3 exhibited more 

 
 
 

 

than 92% similarity with the two planctomycete-like 
bacterial clones (DQ393189 and DQ393190) obtained 
from the anaerobic basin of an alcohol plant wastewater 
treatment system in our previous report, in which the 
sludge samples showed low anammox activities even 
under the disadvantage environments for anammox 
microorganisms. However, the sludge samples in this 
study had no such activities based on our near one 
month continuous detection. Different from clone S1 only 
existing in typical anaerobic condition (acidification basin 
and anaerobic basin of plant IF), clone S3 was present in 
all the samples including aerobic and anaerobic 
conditions of the two wastewater treatment systems. It 
suggested that the represented strain of S1 was a strict 
anaerobe, while that of S3 was a facultative species.  

Taken together, although the brightness of the bands is 
high enough in the DGGE gel, no sequence had enough 
scores to be assigned to the group of Planctomycete-like 
bacteria based on the blasting results from the website of 
http://www.ncbi.nlm.nih.gov/BLAST/. While extensive 
diversities of bacterial species were found in other order, 
which was probably resulted from the low specificity of 
PCR amplification by using Planctomycete-specific 
forward primer and a bacteria universal reverse primer. 
However, we tried the amplification using the 
planctomycete specific reverse primer instead of the 
universal one and no PCR band could be obtained. In our 
previous amplification of sludge samples from an alcohol 
fermentation wastewater treatment plant using the same 
set of primers, although lots of bacterial species in other 
orders were recovered still 16% planctomycete-like 
species were obtained. The reasons for this phenomenon 
may be in two sides. Specifically, there was indeed no 
planctomycete-like bacterium in the inosine fermentation 
wastewater treatment system, or some species were too 
weak to be detected by DGGE method while they might 
be detected by picking and sequencing enough quantities 



6 

 

  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 4. Phylogenetic tree constructed by NJ method and showing the affiliations of 16S rRNA gene sequences 
recovered from the wastewater treatment units of plant IF and M. 

 

 

of clones. Further confirming work is under conduction 
using the method of 16S rDNA cloning and sequencing 

 
 

 

(Figure 4). 
The distribution  and  diversity  of  bacteria  in  different 



7 

 

 
 
 

 

wastewater treatment system were significantly related to 
the sewage constituents and the operating factors such 
as hydraulic retention time, dissolved oxygen 
concentration and the flow or sludge returning. On the 
DGGE gel conducted by using a planctomycete-like 
bacterial forward primer and a universal reverse primer, 
no band was related to planctomycete-like bacteria, while 
two bright sequences were clustered into the unclassified 
group of Candidate division sharing only 92% identity with 
the reported planctomycete clones. No anammox activity 
was detected in the sludge samples from both the 
wastewater treatment plants. 

 

ACKNOWLEDGEMENTS 

 

This study was supported by the National Natural 
Science Foundation of China（NSFC 21077032) and the  
Henan Province Outstanding Youth Fund 
(104100510006). 

 
REFERENCES 
 
Alexandre SM, Caliz J, Balaguer MD, Colprim J, Vila X (2009). 

Development of batch-culture enrichment coupled to molecular 
detection for screening of natural and man-made environments in 
search of anammox bacteria for N-removal bioreactors systems. 
Chemosphere 75(2):169-179.  

APHA (1995). Standard methods for the examination of water and 
wastewater. American Public Health Association, Washington DC, 
USA. pp. 2-53.  

Bourrain M, Achouak W, Urbain V, Heulin T (1999). DNA Extraction 
from Activated Sludges. Curr. Microbiol. 38:315-319.  

Chouari R, Paslier DL, Daegelen P, Ginestet P, Weissenbach J, Sghir A 
(2003). Molecular evidence for novel planctomycete diversity in a 
municipal wastewater treatment plant. Appl. Environ. Microbiol. 
69:7354-7363.  

Cunliffe M, Kertesz MA (2006). Autecological properties of soil 
hingomonads involved in the degradation of polycyclic aromatic 
hydrocarbons. Appl. Microbiol. Biotechnol. 72(5):1083-1089.  

Freitas DB, Reis MP, Freitas LM, Assis PS, Chartone-Souza E, 
Nascimento AM (2008). Molecular bacterial diversity and distribution 
in waste from a steel plant. Can. J. Microbiol. 54(12):996-1005.  

Fuerst JA (2004). Planctomycetes: a phylum of emerging interst for 
microbial evolution and cell ecology. WFCC Newsl. 38:1-11.  

Fuerst JA, Sagulenko E (2011). Beyond the bacterium: planctomycetes 
challenge our concepts of microbial structure and function. Nat. Rev. 
Microbiol. 9:403-413.  

Innerebner G, Insam H, Franke-Whittle IH, Wett B (2007). Identification 
of anammox bacteria in a full-scale deammonification plant making 
use of anaerobic ammonia oxidation. Syst. Appl. Microbiol. 30(5):408-
412.  

Jenkins C, Kedar V, Fuerst JA (2002). Gene discovery within the 
planctomycete division of the domain Bacteria using sequence tags 
from genomic DNA libraries. Genome Biol. 3(6):1-11. 

  
  

 
 

 
Jetten MSM, Sliekers O, Kuypers M, Dalsgaard T, Niftrik L, Cirpus I, 

Pas-Schoonen K, Lavik G, Thamdrup B, Paslier D, Hulth S, Nielsen 
LP, Abma W, Third K, Engström P, Kuenen JG, Jørgensen BB, 
Canfield DE, Sinninghe Damsté JS, Revsbech NP, Fuerst J, 
Weissenbach J, Wagner M, Schmidt I, Schmid M, Strous M (2003). 
Anaerobic ammonium oxidation by marine and freshwater 
planctomycete-like bacteria. Appl. Microbiol. Biotechnol. 63(2):107-
114.  

Kuenen JG, Jetten MSM (2001). Extraordinary anaerobic ammonium 
oxidising bacteria. Am. Soc. Microbiol. News 67:456-463.  

Kulichevskaya IS, Ivanova AO, Belova SE, Baulina OI, Bodelier PLE, 
Rijpstra WIC, Sinninghe Damste´JS, Zavarzin GA, Dedysh SN 
(2007). Schlesneria paludicola gen. nov., sp. nov., the first acidophilic 
member of the order Planctomycetales, from Sphagnum-dominated 
boreal wetlands. Int. J. Syst. Evol. Microbiol. 57:2680-2687.  

Kuypers MMM, Sliekers AO, Lavik G (2003). Anaerobic ammonium 
oxidation by anammox bacteria in the Black Sea. Nature 
422(6932):608-611.  

Liu XC, Zhang Y, Yang M, Wang ZY, Lv WZ (2007). Analysis of 
bacterial community structures in two sewage treatment plants with 
different sludge properties and treatment performance by nested 
PCR-DGGE Method. J. Environ. Sci. 19:60-66.  

Lyautey E, Lacoste B, Ten-Hage L, Rols JL, Garabetian F (2005). 
Analysis of bacterial diversity in river biofilms using 16 S rDNA PCR-
DGGE: methodological settings and fingerprints interpretation. Water 
Res. 39(2-3):380-388.  

Mulder A, Graaf AA, Robertson LA, Kuenen JG (1995). Anaerobic 
ammonium oxidation discovered in a denitrifying fluidized-bed 
reactor. FEMS Microbiol. Ecol. 16:177-183.  

Pynaert K, Smets BF, Wyffels S, Beheydt D, Siciliano SD, Verstraete W 
(2003). Characterization of an autotrophic nitrogen-removing biofilm 
from a highly loaded lab-scale rotating biological cantactor. Appl. 
Environ. Microbiol. 69:3626-3635.  

Riviere D, Desvignes V, Pelletier E, Chaussonnerie S, Guermazi S, 
Weissenbach J, Li T, Camacho P, Sghir A (2009). Towards the 
definition of a core of microorganisms involved in anaerobic digestion 
of sludge. Int. Soc. Microb. Ecol. J. 3(6):700-714.  

Röling WFM, Breukelen BM, Braster M, Lin B, Verseveld HW (2001). 
Relationships between microbial community structure and 
hydrochemistry in a landfill leachate-polluted aquifer. Appl. Environ. 
Microbiol. 67(10):4619-4629.  

Sanz JL, Köchling T (2007). Molecular biology techniques used in 
wastewater treatment: An overview. Process Biochem. 42(2):119-
133.  

Schmid M, Walsh K, Webb R (2003). Candidatus“Scalindua brodae”, 
sp. Nov., Candidatus “ Scalindua wagneri ”, sp. nov., two new 
species of anaerobic ammonium oxidizing bacteria. Syst. Appl. 
Microbiol. 26(4):529-538.  

Shu QL, Jiao NZ (2008). Profiling Planctomycetales diversity with 
reference to anammox-related bacteria in a South China Sea, deep-
sea sediment. Mar. Ecol. 29(4):413-420.  

Ward N, Staley J, Fuerst J, Giovannoni S, Schlesner H, Stackebrandt E 
(2006). The order Planctomycetales, including the genera 
Planctomyces, Pirellula, Gemmata and Isosphaera and the 
Candidatus Brocadia, Kuenenia and Scalindua. Prokaryotes 7:757-
793.  

Yan ST, Chu LB, Xing XH, Yu AF, Sun XL, Jurcik B (2009). Analysis of 
the mechanism of sludge ozonation by a combination of biological 
and chemical approaches. Water Res. 43(1):195-203. 


