[{"id": "ajpf-3299", "words": "7257", "extension": ".pdf", "flesch": "50", "author": "Joseph K. Ali", "title": "Africa's Pig Industry: Present Situation, Obstacles, Potential, and Prospects", "date": "2024", "keywords": "africa; breeds; climate; disease; farmers; farming; feed; livestock; meat; nations; pig; pig production; pigs; population; pork; potential; production; products; systems", "summary": "Common challenges Climate challenges Opportunities, prospects, and a catalyst for improved pig production in Africa Prospects and opportunities of pig production in Africa Pointers to better future Abundance of agro-industrial by-product in Africa CONCLUSION CONFLICT OF INTEREST FUNDING REFERENCES The current state of pig production in Africa was examined in this article, along with its opportunities, difficulties, and possibilities.", "mime": "application/pdf"}, {"id": "ajpf-3300", "words": "4054", "extension": ".pdf", "flesch": "52", "author": "Kororia V; Chelule M", "title": "Factors Influencing Agribusiness Profitability: An Analysis of Smallholder Pig Farming in Kenya's Tharaka-Nithi County", "date": "2024", "keywords": "costs; efficiency; farmers; frontier; journal; kenya; management; model; pig; production; profit; research; smallholder; study", "summary": "A few studies have assessed how institutional structures and management characteristics affect the profitability of smallholder pig farmers. Research is therefore required to determine which institutional arrangements and management aspects should be prioritized in order for smallholder pig farmers to be profitable.", "mime": "application/pdf"}, {"id": "ajpf-3302", "words": "4048", "extension": ".pdf", "flesch": "52", "author": "Jendyose", "title": "Northern Ugandan Pig Farmers' Utilization of Labor", "date": "2024", "keywords": "behavior; family; farmers; innovation; labor; new; pig; pigs; production; smallholder; study", "summary": "Pre-testing was conducted on ten pig farmers in the Unyama sub-county, which was not one of the sub-counties to be investigated despite being close to the study area and having a comparable number of pig farmers. Face-to-face interviews with pig farmers conducted at their houses were used to get the data.", "mime": "application/pdf"}, {"id": "ajpf-3303", "words": "7257", "extension": ".pdf", "flesch": "50", "author": "Talita J; F. Ndongo; Nkea F. Andrew", "title": "African Swine Fever Seroprevalence in Chad's Seemingly Healthful Pig Farming", "date": "2025", "keywords": "africa; breeds; climate; disease; farmers; farming; feed; livestock; meat; nations; pig; pig production; pigs; population; pork; potential; production; products; systems", "summary": "Common challenges Climate challenges Opportunities, prospects, and a catalyst for improved pig production in Africa Prospects and opportunities of pig production in Africa Pointers to better future Abundance of agro-industrial by-product in Africa CONCLUSION CONFLICT OF INTEREST FUNDING REFERENCES The current state of pig production in Africa was examined in this article, along with its opportunities, difficulties, and possibilities.", "mime": "application/pdf"}, {"id": "ajpf-3304", "words": "7767", "extension": ".pdf", "flesch": "51", "author": "Rutikanga Alexis; Sylvestre Charles", "title": "Rwandan Smallholder Households' Challenges and the Profitability of Pig Farming: A Case Study of the Musanze District", "date": "2025", "keywords": "area; cost; fao; farmers; farming; feed; households; income; livestock; pig; pig farming; pig production; pigs; production; research; smallholder; study", "summary": "Along with reducing pig and piglet mortality through improved knowledge and skills related to the factors of pig farming production, particularly the proper feeding, vaccination, and housing that in turn increase income from pig farming, it should also be better to expand extension and veterinary services. However, the factors impacting pig farming among small homeowners were identified using STATA's stochastic frontier production function, and the profitability of pig farming was then estimated using cost-benefit analysis and farm net revenue for pig production.", "mime": "application/pdf"}, {"id": "ajpf-3305", "words": "6433", "extension": ".pdf", "flesch": "52", "author": "Dozie de A; Tamunotonye V", "title": "The Socioeconomic Characteristics of Pig Farmers in the Tropics as a Determinant of Pig Production and Profitability", "date": "2025", "keywords": "area; cost; factor; farmers; labor; nigeria; pig; pig farmers; pig production; production; profitability; research; state; study", "summary": "Determining the socioeconomic characteristics of pig farmers, identifying the pig production systems in the study area, estimating the costs and returns associated with pig production, analyzing the constraints to pig production in the study area, and describing the socioeconomic characteristics of pig farmers will be the specific objectives. The specific goals are to: (i) characterize the socioeconomic traits of pig farmers; (ii) identify the systems of pig production in the study area; (iii) ascertain the impact of the socioeconomic traits of pig farmers on their profit; (iv) calculate the costs and returns associated with pig production; and (v) identify and analyze the barriers to pig production in the study area.", "mime": "application/pdf"}, {"id": "ajpf-611", "words": "7118", "extension": ".pdf", "flesch": "60", "author": "D. Otten; H. F. A. Van den Weghe", "title": "Nitrogen and phosphorus management on pig farms in Northwest Germany \u2013 nutrient balances and challenges for better sustainability", "date": "2013", "keywords": "diet; efficiency; farms; fertiliser; manure; nutrient; pig; piglet; production; total", "summary": "The various authors evaluated the overall status for reducing the environmental problems associated with pig production by using feeding and other management measures. For the investigation, the total N and P flow (inputs, intra-farm and outputs) of all the materials on six pig farms [2x piglet production, 2x finishing pig production and 2x combination farms (piglet production and finishing pigs)] were analysed over a period of 5 years.", "mime": "application/pdf"}, {"id": "ajpf-614", "words": "4726", "extension": ".pdf", "flesch": "66", "author": "Matshidiso Bailekae Masenya; M. L. Mphaphathi; M. H. Mapeka; P. H. Munya; M. B. Makhafola; F. V. Ramukhithi; P. P. Malusi; D. O. Umesiobi; T. L. Nedambale", "title": "Comparative study on semen characteristics of Kolbroek and Large White boars following computer aided sperm analysis\u00ae (CASA)", "date": "2013", "keywords": "boar; bodyweight; concentration; kolbroek; motility; pig; semen; sperm; volume; white", "summary": "Macroscopic evaluation for Kolbroek and Large White boar semen. Sperm morphology and viability for Kolbroek and Large White boar semen (\u00b1SD).", "mime": "application/pdf"}, {"id": "ajpf-615", "words": "3426", "extension": ".pdf", "flesch": "64", "author": "Oparaku, N. F.; Ofomatah, A. C; Okoroigwe, E. C.", "title": "Biodigestion of cassava peels blended with pig dung for methane generation", "date": "2013", "keywords": "biogas; blends; cassava; dung; peels; piggery; production; wastes; yield", "summary": "The implication of this is increased waste production from cassava pro- cessing. With increase in farm (agricultural) operations, greater waste production is proposed.", "mime": "application/pdf"}, {"id": "ajpf-618", "words": "5568", "extension": ".pdf", "flesch": "57", "author": "James Madzimure; Kerstin K. Zander; Kennedy Dzama; Michael Chimonyo", "title": "Farmer perceptions of classical swine fever outbreak in communal pig production systems of South Africa", "date": "2013", "keywords": "areas; csf; disease; et al; farmers; government; municipalities; ngqushwa; pigs; production; respondents", "summary": "Pig production and disease attributes Elundini (Inland) Ngqushwa (Coastal) Ntabankulu (Coastal) n = 122 n = 102 n = 64 Respondents with culled pigs due to CSF 97 93 0 Respondents who hid some pigs from culling 17 22 0 Respondents who never saw controllers of CSF 2 3 16 Respondents who send pigs for post-mortem 1 6 3 Respondents who thought CSF is dangerous for pigs 60 88 67 Respondents who thought CSF reduces pig production 10 13 12 Respondents who thought CSF decreases pig price 28 86 55 Respondents who had no idea about CSF impact 29 0 21 Respondents who believed in vaccination against CSF 71 50 66 Respondents who believed housing controls CSF 7 22 11 Respondents advocating for educating people about CSF 2 28 10 Respondents who supported culling of pigs 14 0 10 Respondents who supported compensation with pigs 50 0 38 Respondents who received monetary compensation 25 71 0 Respondents satisfied with compensation price 100 83 63 Respondents supported a pig restocking programme 68 80 66 Respondents who wanted loans for pig projects 0 36 20 Respondents who demanded better extension services 56 64 56 the disease are shown in Table 2. Primary information about pig production was obtained from key informants.", "mime": "application/pdf"}, {"id": "ajpf-621", "words": "5361", "extension": ".pdf", "flesch": "64", "author": "Orbert C. Chikwanha; Tinyiko E. Halimani; Michael Chimonyo; Kennedy Dzama; Evison Bhebhe", "title": "Seasonal changes in body condition scores of pigs and chemical composition of pig feed resources in a semiarid smallholder farming area of Zimbabwe", "date": "2013", "keywords": "acid; amino; benghalensis; body; brasiliensis; condition; content; feed; pigs; resources", "summary": "Available online at www.internationalscholarsjournals.org \u00a9 International Scholars Journals Full Length Research Paper Seasonal changes in body condition scores of pigs and chemical composition of pig feed resources in a semi- arid smallholder farming area of Zimbabwe Orbert C. Chikwanha 1 , Tinyiko E. Halimani 1 , Michael Chimonyo 2* , Kennedy Dzama 3 and Evison Bhebhe 4 1 Department of Animal Science, Faculty of Agriculture, University of Zimbabwe, P. O. Box MP 167, Mount Pleasant, Harare, Zimbabwe. Seasonal changes in body condition scores of pigs and chemical composition of pig feed resources in a semi-arid smallholder farming area of Zimbabwe.", "mime": "application/pdf"}, {"id": "ajpf-622", "words": "1366", "extension": ".pdf", "flesch": "55", "author": "Egbabor Oghale", "title": "Why producing pigs in China is a big challenge", "date": "2013", "keywords": "china; chinese; pork; virus", "summary": "Key words: Pig, pig farming, pig industry, pork production, Pork and Processing The pig industry is considered of national importance to the Chinese economy. Pork production in China, however, is facing enormous challenges, and as a result, the Chinese government is forced to implement changes to guide the industry to the future.", "mime": "application/pdf"}, {"id": "ajpf-624", "words": "2782", "extension": ".pdf", "flesch": "58", "author": "Adesehinwa A. O. K", "title": "Comparative utilization of two sources of expellerextruded soybean meal as a replacement for on-farm processed soybean in diets of growing-finishing pigs", "date": "2013", "keywords": "diets; expeller; farm; fed; feed; meal; pigs; protein; soybean; utilization", "summary": "The economic feasibility of feeding extruded soybeans to swine is affected by the differences in nutrient content compared to soybean meal, the need to increase the protein in diets containing whole soybeans, the value of extra fat and the cost of processing (Hollis, 2008). Maize 30.00 29.30 28.54 Maize Offal 12.00 12.00 12.00 Soybean meal (45%) 15.00 - - Expelled soybean meal - 15.70 16.46 Palm kernel Cake 20.00 20.00 20.00 Wheat Bran 20.00 20.00 20.00 Bone meal 2.25 2.25 2.25 Vit-Min. premix 0.25 0.25 0.25 Salt 0.50 0.50 0.50 Total 100.00 100.00 100.00 Calculated: Crude Protein 17.95 17.95 17.95 ME", "mime": "application/pdf"}, {"id": "ajpf-626", "words": "2092", "extension": ".pdf", "flesch": "49", "author": "G. Filioussis; E. Petridou; A. Johansson; G. Christodoulopoulos; S. K. Kritas", "title": "Antimicrobial susceptibility and genetic relatedness of Salmonella enterica subsp. enterica serovar Mbandaka strains, isolated from a swine finishing farm in Greece", "date": "2013", "keywords": "enterica; greece; isolates; pigs; salmonella; study; susceptibility", "summary": "Salmonella Mbandaka sensitivity to antibiotics was exa- mined in vitro in this study. enterica serovar Mbandaka (Salmonella Mbandaka) isolated from finishing swines in Greece.", "mime": "application/pdf"}, {"id": "ajpf-628", "words": "2283", "extension": ".pdf", "flesch": "62", "author": "A. N. Pandey", "title": "An appeal against swine flu and its havoc", "date": "2013", "keywords": "flu; kriya; neti; swine; virus", "summary": "In case of difficulty, interested persons can contact for any help (either related to clarification or demonstration) to the undersigned on the e-mail addresses thus: (i) Upanishad.an@gmail.com, (ii) aiw.an@rediffmail.com and (iii) vedanta1232000@yahoo.co.in In the beginning Jala Neti practice could be done every alternate day for a fortnight and afterwards same can be done once in a week or fortnight to make the breathing system effective against the viral system. After some time, an intuitive message came that \u201cYes, there are methods available in yogic practice given by spiritual masters (Rishis) and same can be used as a preventive approach against swine flu\u201d.", "mime": "application/pdf"}, {"id": "ajpf-629", "words": "2192", "extension": ".pdf", "flesch": "56", "author": "Hongbo Ma; Yunpeng Diao; Danyu Zhao; Kun Li; Tingguo Kang", "title": "A new alternative to treat swine influenza a virus infection: Extracts from Terminalia chebula Retz", "date": "2014", "keywords": "acid; chebula; et al; influenza; retz; swine; terminalia; virus", "summary": "At present there are only two classes of antiviral drugs are approved to treat against influenza viruses including adamantanes and neuraminidase inhibitors such oselta- mivir and zanamivir Like other RNA viruses, e.g. hepatitis C virus and HIV, influenza virus is characterized by genetic varia- bility, resulting in frequent mutations and reassortment on account of influenza virus RNA polymerase lack of proof- reading abilities [Reid and Taubenberger, 2003].", "mime": "application/pdf"}, {"id": "ajpf-631", "words": "2937", "extension": ".pdf", "flesch": "64", "author": "Jun Fang; Rao Li-qun; Tian Yun; Xiangyang Lu; Hongmei Jiang", "title": "Oxygen radical-scavenging capacities of peptides from swine blood", "date": "2013", "keywords": "acid; amino; blood; oxygen; psb; radicals; scavenging; swine", "summary": "After thorough mixing, the chemical luminescence power curve was measured for 60 s. The ability to scavenge oxygen free radicals was determined according to the method of Wang et al. (2003). Therefore, CL can be used to show the rela- tive output of oxygen free radicals.", "mime": "application/pdf"}, {"id": "ajpf-632", "words": "3538", "extension": ".pdf", "flesch": "65", "author": "Syeda Samra Iqbal Jafri; Muhammad Ilyas; Muhammad Idrees", "title": "Swine flu: A threat to human health", "date": "2013", "keywords": "disease; flu; h1n1; health; human; influenza; pandemic; people; swine; virus", "summary": "This review addresses the biological and epidemiological aspects of swine flu virus and efforts to have a control on the virus globally. Though the swine flu virus is specie specific but it can easily cross the specie barrier and zoonotic jumps were seen in swine flu virus from pigs to humans.", "mime": "application/pdf"}, {"id": "ajpf-634", "words": "3340", "extension": ".pdf", "flesch": "59", "author": "John E. Berg", "title": "The cost of double standard risk communication during the swine-flu epidemic: Reflections from Norway", "date": "2014", "keywords": "authorities; epidemic; flu; health; influenza; public; risk; strategy; swine; vaccines", "summary": "There is no straightforward relation between study quality, concordance, funding and impact in studies of influenza vaccines (Jefferson et al., 2009). Relation of study quality, concordance, take home message, funding, and impact in studies of influenza vaccines: systematic review.", "mime": "application/pdf"}, {"id": "ajpf-636", "words": "4933", "extension": ".pdf", "flesch": "53", "author": "Carmina Gallardo; Anna R. Ademun2; Raquel Nieto; Noelina Nantima; Marisa Arias; Elena Mart\u00edn; Virginia Pelayo; Richard P. Bishop", "title": "Genotyping of African swine fever virus (ASFV) isolates associated with disease outbreaks in Uganda in 2007", "date": "2014", "keywords": "african; agttatgggaaacccgaccccgaacccactt; asf; asfv; et al; fever; isolates; kenya; p72; study; swine; uganda; virus; viruses", "summary": "Full Length Research Paper Genotyping of African swine fever virus (ASFV) isolates associated with disease outbreaks in Uganda in 2007 Carmina Gallardo1*, Anna R. Ademun2, Raquel Nieto1, Noelina Nantima 2, Marisa Arias1, Elena Mart\u00edn1, Virginia Pelayo1 and Richard P. Bishop3 1 Centro de Investigaci\u00f3n en Sanidad Animal, INIA. Accepted 11 January, 2014 Samples from infected domestic pigs associated with an outbreak of African swine fever (ASF) in three districts of central Uganda in 2007 were confirmed as being infected with African swine fever virus (ASFV) using a P72 gene- based polymerase chain reaction amplification (PCR) assay combined with restriction analysis.", "mime": "application/pdf"}, {"id": "ajpf-639", "words": "6222", "extension": ".pdf", "flesch": "58", "author": "Lei Han, Wenying Lu; Yifang Han; Shuhua Li; Jianhua Yin; Jiaxin Xie, Tong Su; Guangwen Cao", "title": "Evolutionary characteristics of swine-origin H1N1 influenza virus that infected humans from sporadic to pandemic", "date": "2014", "keywords": "avian; gene; h1n1; h1n1 influenza; h1n1 viruses; humans; influenza; influenza viruses; north; origin; pandemic; swine; viruses", "summary": "Key words: Swine, H1N1 influenza virus, evolution, sporadic, pandemic. The gene segments of the swine H1N1 viruses that occasionally infected persons who ever exposed to pigs in North America before 1998 were phylogenetically linked to those of classic swine H1N1 influenza viruses.", "mime": "application/pdf"}, {"id": "ajpf-641", "words": "4483", "extension": ".pdf", "flesch": "65", "author": "Kai Quan; Xingxu Zhao; Changxing Zhang; Qiuliang Xu; Hongfang Wei; Junjie Hu; Yong Zhang", "title": "A novel approach for very early pregnancy diagnosis in swine by anti-early pregnancy factor (EPF) antiserum blocking enzyme-linked immunosorbent assay (ELISA)", "date": "2014", "keywords": "antiserum; diagnosis; elisa; epf; et al; factor; ig20; non; pregnancy; samples; serum", "summary": "A novel approach for very early pregnancy diagnosis in swine by anti-early pregnancy factor (EPF) antiserum blocking enzyme-linked immunosorbent assay (ELISA) Kai Quan1,2, Xingxu Zhao1*, Changxing Zhang2, Qiuliang Xu2, Hongfang Wei1, Junjie Hu1 and Yong Zhang1 1 College of Veterinary Medicine, Gansu Agricultural University, Lanzhou, Gansu 730070, China. The titers of anti-EPF serum antibody.", "mime": "application/pdf"}, {"id": "ajpf-645", "words": "4107", "extension": ".pdf", "flesch": "53", "author": "Ho Young Kang; Ki Hwan Moon; Se Won Kim; Jeong Dong Bahk; Sang Wan Gal; KwangKeun Cho; Chul-Wook Kim; John Hwa Lee; Sam Woong Kim", "title": "An efficient secretion of the protein fused to the AgfA signal sequence in Salmonella", "date": "2015", "keywords": "agfa; antibody; antigen; cell; protein; pspa; salmonella; secretion; signal; study; typhimurium", "summary": "Accepted 02 December, 2014 Signal sequence (SS) of surface or secreting proteins plays an important function for protein secretion in bacterial system. In order to examine the effect of SS types in protein secretion, signal sequences of Bla (\uf062\u2013 lactamase), AgfA (thin aggregative fimbriae A), StfA (Salmonella typhimurium fimbriae A) and OmpW (outer membrane protein W) were selected for the secretion of PspA protein which was used as a test protein.", "mime": "application/pdf"}, {"id": "ajpf-656", "words": "4284", "extension": ".pdf", "flesch": "65", "author": "Li Wan; Zhi-Biao Wang; Qi-gui Yan; Xu Wang; Yan Lei; Lan Zuo; Wan-zhu GUO; Yu-Peng Ren", "title": "Genetic diversity of Escherichia coli isolated from commercial swine farms revealed by enterobacterial repetitive intergenic consensus", "date": "2015", "keywords": "coli; e. coli; eric; farms; isolates; pcr; pig; rep; sichuan; strains", "summary": "Genetic variability with E. coli strains isolated from swine farms in China has been demonstrated. ERIC-PCR and REP-PCR techniques are more rapid methods for molecular typing of E. coli strain.", "mime": "application/pdf"}, {"id": "ajpf-658", "words": "3018", "extension": ".pdf", "flesch": "63", "author": "Fuchuan Wang; Yibo Yan; Yuhuan Zhang1; Yichao Han; Chao Guan", "title": "Effects of immune synergist of Chinese medicinal herbs on the efficacy of vaccination against classic swine fever", "date": "2014", "keywords": "chinese; control; day; effects; group; herbs; immune; synergist", "summary": "These results suggest that herbal immune synergist of Chinese traditional herbs prescription enhances the protective effect of classic swine fever vaccine. Effects of herbal immune synergist on serum IgG content.", "mime": "application/pdf"}, {"id": "ajpf-661", "words": "4098", "extension": ".pdf", "flesch": "56", "author": "Xu-Ting Li; Bin Wang; Jin-Liang Li; Fu-Qiang Zeng; Xue Gong", "title": "Prevalence and antimicrobial susceptibility of bacterial pathogens isolates from diseased swine in southwest, China", "date": "2014", "keywords": "china; coli; et al; isolates; mirabilis; pneumoniae; resistance; suis; swine", "summary": "High levels of resistance to tetracycline (~60-95%) have also been detected in E. coli isolates recovered from apparently healthy swine on-farm or at slaughter in other countries (Kozak et al., 2003; Kijima-Tanaka et al., 2003; Teshager et al., 2000; Blake et al., 2003). The results of the study indicated that TEM-1 was the most common \u03b2-lactamase gene among the K. pneumoniae and E. coli isolates, in agreement with previous studies that reported a high prevalence of the blaTEM-1 gene among animal E. coli isolates (Liu et al., 2007;", "mime": "application/pdf"}, {"id": "ajpf-664", "words": "3970", "extension": ".pdf", "flesch": "64", "author": "Cheng Darong; Zhu Shan Yuan; Chen Xiao Lang; Gao Xiao Pan; Ding Wen Wei; Sun Huai Chang", "title": "Rapid diagnosis of ETEC and HPI-harboring Escherichia coli infection in newborn piglets with diarrhea", "date": "2014", "keywords": "coli; diarrhea; e. coli; harboring; hpi; isolates; pcr; samples", "summary": "All the 3 both ETEC and HPI- harboring E. coli isolates were LTa+, STb and F4+. There are a number of well documented examples in which bacterial adaptation has been influenced by HGT, such as the high-pathogenicity island (HPI) of pathogenic Yersinia in E. coli (Buchrieser et al., 1998; Carniel et al., 1992, 1998; Fetherston et al., 1994; Hacker et al., 2000; Perry et al., 1990; Petermann et al., 2008; Schubert et al., 1998), or the new \u201cplasmid- associated\u201d pathogenicity island PAI2173 which encodes the tetB gene conferring tetracycline resistance (Fekete et al., 2003).", "mime": "application/pdf"}, {"id": "ajpf-669", "words": "4856", "extension": ".pdf", "flesch": "53", "author": "Xiao-ying Pei; Ding-zong Guo; Dong-hai Zhou; Rui Guo", "title": "Protease-activated receptor-2 (PAR-2) regulates enterotoxigenic Escherichia coli-induced diarrhea during weaning in piglets", "date": "2015", "keywords": "activation; cells; coli; diarrhea; expression; il-6; il-8; mucosa; par-2; piglets; production; tract; weaning", "summary": "The generation of IL-6 and IL-8 by IECs was significantly increased following stimulation with PAR-2 agonists dose-dependently. Arrows indicate positive staining for PAR-2, reference bar = 50 m. production of IL-6 and IL-8, the direct and amplifying effects of PAR-2 agonists on baseline and LPS+LT- activated IEC were studied.", "mime": "application/pdf"}, {"id": "ajpf-672", "words": "2545", "extension": ".pdf", "flesch": "61", "author": "DaRong Cheng; XiaoLang Chen; ShanYuan Zhu; WenWei Ding; ZhiXia Mu; Jun Zhou", "title": "Prevalence of (high-pathogenicity island) HPI-harboring Escherichia coli in diarrheic and healthy piglets", "date": "2015", "keywords": "coli; hpi; isolates; samples", "summary": "O138 was the vast prevalent serotype among the HPI + E. coli isolates. In addition, the 25 HPI + E. coli isolates were O serotyped and O138 was the most prevalent serotype accounting for 64% (16/25), followed by O65 (12%), O139 (8%), O9 (8%), O55 (4%) and O141 (4%) (Table 1).", "mime": "application/pdf"}, {"id": "ajpf-673", "words": "3904", "extension": ".pdf", "flesch": "62", "author": "C. B. Hsu; H. J. Huang; C. H. Wang; H. T. Yen; B. Yu", "title": "The effect of glutamine supplement on small intestinal morphology and xylose absorptive ability of weaned piglets", "date": "2015", "keywords": "control; day; gln; glutamine; group; growth; pigs; supplementation; xylose", "summary": "Ingredient (%) Basal diet Maize, dent yellow 49.05 Soybean meal, 44 of CP 23.70 Dried skim milk 16.0 Whey 5.0 Soybean oil 1.0 Dicalcium phosphate 1.60 Limestone, pulverized 0.80 Salt 0.50 Vitamin premix 1 0.10 Mineral premix 2 0.15 Choline chloride, 50 0.10 Maize starch 2.0 Glutamine 0 Calculated values Crude protein 20.3 Calcium 1.01 Total phosphorus 0.77 Lysine 1.17 1 Supplied per kg of diet: Vitamin A, 6,000 IU; vitamin D3, 800 IU; vitamin E, 20 mg; vitamin K3, 4 mg; vitamin B2, 4 mg; vitamin B6, 1 mg; vitamin B12, 0.02 mg; niacin, 30 mg; calcium pantothenate, 16 mg; folic acid, 0.6 mg; biotin, 0.01 mg; choline chloride, 50 mg. 2 Supplied per kg of diet: Fe (FeSO4.H2O), 140 mg; Cu (CuSO4.5H2O), 7 mg; Mn (MnSO4.H2O), 20 mg; Zn (ZnO), 120 mg; I (KIO3), 0.45 mg. an end product of intestinal Gln catabolism (Wu et al., 1995). In summary, the results suggested that dietary supplementation of Gln could be beneficial in small intestinal villous morphology and xylose absorptive capacity, and could have a slight contribution to the average daily gain of weaned piglets.", "mime": "application/pdf"}, {"id": "ajpf-674", "words": "3847", "extension": ".pdf", "flesch": "55", "author": "Ming Zhang; Hui Yuan; Zuping He; Liyun Yuan; Jine Yi; Sijun Deng; Li Zhu; Chengzhi Guo", "title": "DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol", "date": "2015", "keywords": "cells; control; damage; dna; gossypol; group; piglet; sertoli; sertoli cells", "summary": "Putting this into consideration, our study suggests that exposure of gossypol to sertoli cells leads to an inhibition of sertoli cell growth and oxidase activity of sertoli cells at a low concentration, whereas gossypol results in DNA damage of sertoli cells at a higher concentration. Moreover, DNA damage of sertoli cells was observed at 5 \u03bcg/ml gossypol.", "mime": "application/pdf"}, {"id": "ajpf-677", "words": "5784", "extension": ".pdf", "flesch": "58", "author": "Zhentian Xiang, Hongwei Qi; Guoquan Han, Jingbo Liu; Zhiqing Huang, Bing Yu; Daiwen Chen", "title": "Real-time TaqMan polymerase chain reaction to quantify the effects of different sources of dietary starch on Bifidobacterium in the intestinal tract of piglets", "date": "2015", "keywords": "amylopectin; amylose; bacteria; bifidobacterium; dna; et al; pcr; piglets; primers; starch; strains; table; time; tract", "summary": "Parameter Corn starch Wheat starch Tapioca starch Pea starch All Bacteria Duodenum \uff082.26\u00b10.74\uff09\u00d710 9 \uff082.55\u00b10.56\uff09\u00d710 9 \uff082.83\u00b10.86\uff09\u00d710 9 \uff082.07\u00b10.59\uff09\u00d710 9 Jejunum \uff087.35\u00b12.04\uff09\u00d710 9 \uff088.58\u00b11.81\uff09\u00d710 9 \uff081.38\u00b10.88\uff09\u00d710 10 \uff081.09\u00b10.37\uff09\u00d710 10 Ileum \uff087.74\u00b12.93\uff09\u00d710 9 \uff088.28\u00b12.29\uff09\u00d710 9 \uff087.06\u00b11.19\uff09\u00d710 9 \uff086.60\u00b13.20\uff09\u00d710 9 Cecum \uff082.79\u00b10.90a\uff09\u00d710 11 \uff082.33\u00b10.63a\uff09\u00d710 11 \uff082.29\u00b10.69a\uff09\u00d710 11 \uff081.67\u00b10.81b\uff09\u00d710 11 Colon \uff084.83\u00b11.20a\uff09\u00d710 11 \uff085.28\u00b12.12a\uff09\u00d710 11 \uff084.23\u00b11.27a\uff09\u00d710 11 \uff081.84b\u00b10.82\uff09\u00d710 11 Bifidobacterium Duodenum \uff085.49\u00b10.69b\uff09\u00d710 6 \uff086.03\u00b10.57b\uff09\u00d710 6 \uff083.52\u00b10.76c\uff09\u00d710 6 \uff088.04\u00b11.38a\uff09\u00d710 6 Jejunum \uff081.53\u00b10.42b\uff09\u00d710 7 \uff081.64\u00b10.65b\uff09\u00d710 7 \uff084.14\u00b10.59b\uff09\u00d710 6 \uff083.85\u00b11.78a\uff09\u00d710 7 Ileum \uff088.72\u00b13.08b\uff09\u00d710 6 \uff081.04\u00b10.22b\uff09\u00d710 7 \uff083.44\u00b10.93c\uff09\u00d710 6 \uff082.32\u00b10.31a\uff09\u00d710 7 Cecum \uff085.91\u00b12.26b\uff09\u00d710 8 \uff085.45\u00b11.17b\uff09\u00d710 8 \uff082.86\u00b11.05c\uff09\u00d710 8 \uff081.23\u00b10.15a\uff09\u00d710 9 Colon \uff083.76\u00b11.21b\uff09\u00d710 8 \uff083.89\u00b10.89b\uff09\u00d710 8 \uff087.56\u00b12.80b\uff09\u00d710 7 \uff081.24\u00b10.53a\uff09\u00d710 9 B/A (%)* Starches are the main source of carbohydrates in mixed diets and the major source of energy for mono- gastric animal and human (Deng et al., 2009a).", "mime": "application/pdf"}, {"id": "ajpf-680", "words": "3078", "extension": ".pdf", "flesch": "61", "author": "Nenad Stojanac; Mladen Gagr\u010din; Ognjen Stevan\u010devi\u0107; van Stan\u010di\u0107; Aleksandar Potkonjak", "title": "Passive and active immunity against parvovirus infection in piglets", "date": "2015", "keywords": "antibody; blood; days; piglets; ppv; serum; specific; titer", "summary": "A total of 60 blood serum samples were checked, and the defined titre values of specific antibodies ranged between 11 to 14 (Table 2). The dynamics of movement of antibody titer values specific for PPV in the blood serum of piglets.", "mime": "application/pdf"}, {"id": "ajpf-683", "words": "3417", "extension": ".pdf", "flesch": "61", "author": "Yakubu, M. Bello", "title": "Biodegradation of Lagoma crude oil using pig dung", "date": "2015", "keywords": "bacteria; biodegradation; crude; dung; oil; pig; soil", "summary": "Measurement of crude oil biodegradation in soil amended with pig dung The rate of bacterial utilization of crude oil in the soil was assessed by using the the gravimetric method. The amount of crude oil degraded was calculated by subtracting the weight of residual crude oil from weight of the added (initial) crude oil, divided by the weight of the initial crude oil and then multiplied by 100.", "mime": "application/pdf"}, {"id": "ajpf-685", "words": "3601", "extension": ".pdf", "flesch": "63", "author": "M. C. Marufu; P. Chanayiwa; M. Chimonyo; E. Bhebhe", "title": "Prevalence of gastrointestinal nematodes in Mukota pigs in a communal area of Zimbabwe", "date": "2015", "keywords": "area; eggs; nematodes; parasites; pigs; prevalence; species; study; zimbabwe", "summary": "Further examinations are needed to determine the pathological importance and impact of parasitic infestations on indigenous pigs in the communal area. Key words: Ascaris, epidemiology, indigenous pigs, internal parasites,", "mime": "application/pdf"}, {"id": "ajpf-686", "words": "3887", "extension": ".pdf", "flesch": "66", "author": "F.O.I. Anugwa; A.I. Okwori", "title": "Performance of growing pigs of different genetic groups fed varying dietary protein levels", "date": "2016", "keywords": "diet; pigs; protein", "summary": "In Experiment 1, the LC pigs gained more weight and had better feed conversion ratios and protein efficiency ratios on the lower (12%) protein diet than on the 16% protein diet whereas the LW x LC pigs gained more weights and had better feed conversion ratios on the 16% protein diet than on the 12% protein diet. E-mail: abelokwori@yahoo.com. pigs to diets varying in protein level from 12 to 20% crude protein.", "mime": "application/pdf"}, {"id": "ajpf-689", "words": "8187", "extension": ".pdf", "flesch": "65", "author": "Adesehinwa, A. O. K", "title": "Energy and protein requirements of pigs and the utilization of fibrous feedstuffs in Nigeria", "date": "2016", "keywords": "anim; animal; crude; diets; digestibility; energy; feed; fibre; meal; pigs; production; protein; requirements; sci; swine; tegbe; utilization", "summary": "Longe and Fagbenro-Byron (1990) in their studies on fibrous waste and by-products for pig feeds in Nigeria concluded that fibre sources in general, may be best suitable for adult pigs. The types of pig feeds used in the tropics vary greatly, and since many by-products are used in place of cereals, the variation in nutritive values between and within feeds may be considerable (Lekule et al., 1990).", "mime": "application/pdf"}, {"id": "ajpf-690", "words": "3540", "extension": ".pdf", "flesch": "69", "author": "S. O. C. Ugwu; A. E. Onyimonyi", "title": "The growth performance of growing pigs during feed restriction and re-alimentation in a humid tropical environment", "date": "2015", "keywords": "control; feed; pigs; restriction; rst", "summary": "Also, during re-alimentation pigs on the 70% level had the highest feed intake. Other growth measurements taken in both stages at weekly interval were body length (BL); as t he length of pigs body from base of tail to base of skull (Mersmann et al., 1987) and height at shoulder (HS) taken as the vertical distance from the floor of restraining cage to the highest point on the shoulder (Lefaucheur et al., 1991).", "mime": "application/pdf"}, {"id": "ajpf-692", "words": "6413", "extension": ".pdf", "flesch": "64", "author": "A.Y. Adenkola; J.O. Ayo; A.K.B. Sackey; A. B. Adelaiye", "title": "Haematological and serum biochemical changes in pigs administered with ascorbic acid and transported by road for four hours during the harmattan season", "date": "2016", "keywords": "acid; control; control pigs; experimental; increase; journey; pigs; road; serum; stress; transportation; value; vet", "summary": "Road transportation effect on rectal temperature, respiration and heart rates of ostritch (Struthio camelus) chick. It is, therefore, recommended that pigs be administered with AA before transportation by road during the harmattan season in order to reduce the risk of adverse effects of transportation stress on health.", "mime": "application/pdf"}, {"id": "ajpf-693", "words": "5351", "extension": ".pdf", "flesch": "58", "author": "Modisane Simon; Moneoang; Bezuidenhout, Cornelius Carlos", "title": "Characterisation of enterococci and Escherichia coli isolated from commercial and communal pigs from Mafikeng in the North-West Province, South Africa", "date": "2016", "keywords": "antibiotic; coli; e. coli; enterococci; et al; faecium; farms; isolates; mareetsane; microbiol; pigs; resistance; tlapeng; vancomycin", "summary": "Less than 7% of enterococci were resistant to ampicillin and amoxicillin, whereas 45% of E. coli isolates were resistant to the same antibiotics. Gram staining, API 20 Strep and API 20E were used for identification of enterococci and E. coli, respectively.", "mime": "application/pdf"}, {"id": "ajpf-694", "words": "7415", "extension": ".pdf", "flesch": "61", "author": "A. T. Niba; J. D. Beal; A. C. Kudi; P. H. Brooks", "title": "Potential of bacterial fermentation as a biosafe method of improving feeds for pigs and poultry", "date": "2009", "keywords": "acid; anim; beal; beal et; brooks; diets; effect; et al; feed; feeding; fermentation; food; liquid; performance; pigs; poultry; sci; van", "summary": "The selection of LAB for feed fermentation to meet desired feed and production objectives has been highlighted in previous reviews (Brooks et al., 2003b; Brooks, 2008) . However, Niven et al. (2006) demonstrated that the loss of lysine from fermented liquid pig feed was due to metabolism of lysine by E. coli present in the feed rather than its utilisation as an energy source by LAB.", "mime": "application/pdf"}, {"id": "ajpf-695", "words": "1918", "extension": ".pdf", "flesch": "64", "author": "Jimmy Quisirumbay-Gaibor; Luis Delgado, C\u00e9sar O\u00f1a; Alexandra Naranjo; Eduardo Arag\u00f3n", "title": "Productive performance of piglets fed with different sources of lactose", "date": "2017", "keywords": "lactose; piglets; weaning; whey", "summary": "The crystallized lactose is obtained after evaporation and dehydration of serum (mainly composed of \u03b1-lactose) and pure lactose is obtained by centrifugation and purification of the crystallized whey: it contains more than 99% lactose. The T1 group received pure lactose, T2 whey and T3 permeate.", "mime": "application/pdf"}, {"id": "ajpf-698", "words": "2702", "extension": ".pdf", "flesch": "69", "author": "Oluwole, O. O.; Omitogun, O. G.", "title": "Cytogenetic characterization of Nigerian indigenous pig", "date": "2016", "keywords": "chromosome", "summary": "The karyotype of the domestic pig composed of 18 pairs of autosome and pairs of sex chromosomes (X or Y) are already well characterized of which 13 are metacentic and 6 are acrocentric (CSKSS, 1988;CTA, 1994; Fairbank 1999). p/q ratio of both were observed to be the same in chromosome 1, 2, 6, 9, 11, 12, 14 - 18 and Y sex chromosome within the S.E measurement while differences were obtained in chromosome 3, 4, 5, 7, 8, 10, 13 and X sex chromosomes but these differences do not cause distinction in chromosome type, except in the X sex chromosome which showed distinction in chromosome type (Oluwole, 2005).", "mime": "application/pdf"}, {"id": "ajpf-699", "words": "4095", "extension": ".pdf", "flesch": "61", "author": "Chao Sun; Yongjia Peng, Dongfeng Jiang; Zhongpin Zhang", "title": "The potential lipolysis function of musclin and its mRNA expression both in Pig adipose tissue and primary adipocyte", "date": "2016", "keywords": "adipocyte; adipose; correlation; expression; gene; lipid; muscle; musclin; ppar; tissue", "summary": "As shown in Figure 2C, musclin gene expression in subcutaneous adipose of five-month-old. Large White pigs was significantly higher than that in ten-month-old (P < 0.05), suggesting that musclin gene expression is higher in young pig than that in old pig.", "mime": "application/pdf"}, {"id": "ajpf-701", "words": "3839", "extension": ".pdf", "flesch": "65", "author": "Y. J. Zhang; G. C. Li; Y. L. Jiang", "title": "Polymorphism and association of microsatellite SJ01 with birth weight and early growth traits in pigs", "date": "2016", "keywords": "birth; myostatin; pigs; sj01; traits; weight; yorkshire", "summary": "The average daily gain from 28 d to 70 d in Yorkshire pigs and the body weight at 70 d in Landrace pigs were significantly different between SJ01 genotypes (P < 0.05). In this study, SJ01 locus is found to be associated with average daily gain from 28 to 70 d in Yorkshire pigs and with body weight at 70 d in Landrace pigs.", "mime": "application/pdf"}, {"id": "ajpf-703", "words": "3955", "extension": ".pdf", "flesch": "58", "author": "A. Y. Adenkola; J. O. Ayo; A. K. B. Sackey; A. B. Adelaiye", "title": "Erythrocyte osmotic fragility of pigs administered ascorbic acid and transported by road for shortterm duration during the harmattan season", "date": "2016", "keywords": "acid; ascorbic; erythrocyte; experimental; fragility; pigs; road; season; stress; transportation", "summary": "The results indicated that ascorbic acid protected the integrity of the erythrocyte membrane in experimental pigs administered ascorbic acid following road transportation as demonstrated by lower percentage haemolysis immediately after road transportation and thus may alleviate the risk of increase in haemolysis due to road transportation stress in pigs during the harmattan season. The increase in ROS generation in the body, appa-rently, by road transportation stress on the body rendering cells more fragile and easily susceptible to hypotonic lysis.", "mime": "application/pdf"}, {"id": "ajpf-706", "words": "4106", "extension": ".pdf", "flesch": "63", "author": "Olayinka Oluwafemi Asala; Joseph Olusegun Ayo; Adeshina Yahaya Adenkola; Ndazo Salka Minka", "title": "Effects of road transportation on excitability scores of pigs administered with ascorbic acid during the hot-dry season", "date": "2016", "keywords": "control; excitability; pigs; sci; score; season; transportation", "summary": "The fact that the administration of AA before road transportation of pigs resulted in a decrease in the percentage of animals that were depressed (that is, those with the excitability score of 1) and an increase in the percentage of pigs that were excited (that is, those with excitability score of 4) after the journey demonstrated that AA activated the nervous system in experimental pigs by reverting the depression, observed in control pigs, back to excitation. Post-transportation, an increase in the percentage of experimental pigs with excitability score of 4 was recorded (38.5 to 69.2%), while a decrease was obtained in the control pigs (40.0 to 10%).", "mime": "application/pdf"}, {"id": "ajpf-707", "words": "5346", "extension": ".pdf", "flesch": "63", "author": "O. O. Asala; J. O. Ayo; P. I. Rekwot; N. S. Minka; A. Y. Adenkola", "title": "Rectal temperature responses of pigs transported by road and administered with ascorbic acid during the hot-dry season", "date": "2016", "keywords": "experimental; journey; pigs; season; transportation; values", "summary": "The overall mean RT value of 39.8 \u00b1 0.1\u00b0C recorded in the experimental pigs after 8 h road transportation did not differ (P > 0.05) with the corresponding value of 39.4 \u00b1 0.3\u00b0C in control pigs, demonstrating that AA did not induce hypothermia in experimental pigs. Accepted 09 November, 2016 Experiments were performed in order to determine the rectal temperature (RT) responses of pigs to eight-hour road transportation and the effect of administration of ascorbic acid (AA) on the responses in transported pigs during the hot -dry season.", "mime": "application/pdf"}, {"id": "ajpf-709", "words": "2974", "extension": ".pdf", "flesch": "52", "author": "Yu-Chih Wang; Yi-Chih Chang; Hsiao-Li Chuang; Chien-Chao Chiu; Kuang-Sheng Yeh; Chao-Chin Chang; Ter-Hsin Chen", "title": "Antibiotic resistance, integrons and Salmonella genomic island 1 among Salmonella Schwarzengrund in broiler chicken and pig", "date": "2017", "keywords": "dna; gene; genomic; integrons; isolates; pcr; resistance; salmonella; schwarzengrund; taiwan", "summary": "Molecular characterization suggests an epidemiological relationship between the swine and chicken Salmonella Schwarzengrund isolates. Full Length Research Paper Antibiotic resistance, integrons and Salmonella genomic island 1 among Salmonella Schwarzengrund in broiler chicken and pig Yu-Chih Wang1, Yi-Chih Chang1,6, Hsiao-Li Chuang2, Chien-Chao Chiu2, Kuang-Sheng Yeh4, Chao-Chin Chang3, Shih-Ling Hsuan5 and Ter-Hsin Chen3,5* 1 Department of Veterinary Medicine, National Chung Hsing University, Taichung, 402, Taiwan.", "mime": "application/pdf"}, {"id": "ajpf-712", "words": "3800", "extension": ".pdf", "flesch": "63", "author": "A. O. K. Adesehinwa; O. O. Obi, B. A. Makanjuola; A. O. Adebayo; E. S. Durotoye", "title": "Utilization of sun-dried on-farm generated poultry litter as a feed resource for growing-finishing pigs", "date": "2017", "keywords": "diets; feed; litter; pigs; poultry; protein; serum; sopl; study; values", "summary": "There is therefore the need for the right technology/package for the use of poultry litter as a feedstuff for growing pigs. Utilization of palm kernel cake as a replacement for maize in diets of growing pigs: effects on performance, serum metabolites, nutrient digestibility and cost of feed conversion.", "mime": "application/pdf"}, {"id": "ajpf-713", "words": "2647", "extension": ".pdf", "flesch": "69", "author": "E. O. K. Oddoye; S. W. A. Rhule; K. Agyente-Badu; V. Anchirinah; F. Owusu Ansah", "title": "Fresh cocoa pod husk as an ingredient in the diets of growing pigs", "date": "2017", "keywords": "cocoa; cph; diet; feed; pod", "summary": "Key words: Feeding trial, fresh cocoa pod husk, growing pigs, growth rate, feed to gain ratio. Even though it was not possible to measure theobromine content of the fresh pod in this experiment, the performance of pigs and the fact that no health problems were observed during the 140 days of the trial suggest that the pigs were not adversely affected by the feeding of fresh cocoa pod husk.", "mime": "application/pdf"}, {"id": "ajpf-715", "words": "4325", "extension": ".pdf", "flesch": "63", "author": "Honglei Ding,Rui Zhang,Kaiyun Liu,Linping Huang; Maochun Tian; Mingming Jiang , Quanming Zou; Xuhu Mao", "title": "Escherichia coli O157:H7 EDL933 has a strong virulence to Bama miniature pigs by injection and fails to colonize to their gastrointestinal tracts", "date": "2017", "keywords": "coli; coli o157; e. coli; edl933; escherichia; escherichia coli; et al; microbiol; o157; pigs; strain", "summary": "Furthermore, the E. coli O157:H7 colonized model of pig has been established and E. coli O157:H7 could be transmitted from infected donor pigs to na\u00efve pigs directly and indirectly. Bama miniature pig was infected with E. coli O157:", "mime": "application/pdf"}, {"id": "ajpf-717", "words": "4205", "extension": ".pdf", "flesch": "59", "author": "Byung Uk Kim; Mi Ae Jeong; Yeon Sun Ryu; Hwa Chun Park,Jong Hyun Jung,Sam Woong Kim,Chul Wook Kim; Young Min Song,Ki Hwa Chung, Il Suk Kim, Sang Keun Jin,Sang Suk Lee; In Soon Choi; Kwang Keun Cho", "title": "Comparative proteomic analysis of the effects of dietary mugwort (Artemisia iwayomogi Kitamura) on the pig Longissimus dorsi muscle", "date": "2017", "keywords": "analysis; chain; diet; dorsi; expression; meat; mugwort; muscle; myosin; pmf; powder; protein; spots", "summary": "Protein spots showing significant expression variation were selected as spots to exhibit critical changes between the control and treated groups. Protein identification via PMF and CAF-MALDI sequencing Protein identification via PMF was done as follows: protein spots were enzymatically digested with modified porcine trypsin in a manner similar to the method previously described by Shevchenko et al. (1996).", "mime": "application/pdf"}, {"id": "ajpf-719", "words": "3611", "extension": ".pdf", "flesch": "68", "author": "Jin Ho Cho; In Ho Kim", "title": "Effect of stocking density on pig production", "date": "2017", "keywords": "anim; density; j. anim; performance; pigs; sci; space; stocking; stress", "summary": "Effect of stocking arrangement on pig performance. Effects of double stocking and weighing frequency on pig performance in wean-to-finish production systems.", "mime": "application/pdf"}, {"id": "ajpf-720", "words": "4009", "extension": ".pdf", "flesch": "58", "author": "Jing Wang, Haifeng Ji; Dongyan Zhang, Hui Liu, Sixin Wang, Dacong Shan; Yamin Wang", "title": "Assessment of probiotic properties of Lactobacillus plantarum ZLP001 isolated from gastrointestinal tract of weaning pigs", "date": "2017", "keywords": "bile; feed; fluid; piglets; plantarum; probiotic; strain; zlp001", "summary": "The survival rate of L. plantarum ZLP001 strains when cultured in simulated gastric fluid with pH of 2.0 and 3.0 are shown in Table 2. The probiotic strain was administered through the feed to 35-day old weaned piglets to estimate the effect of L. plantarum ZLP001 on the growth performance.", "mime": "application/pdf"}, {"id": "ajpf-721", "words": "4832", "extension": ".pdf", "flesch": "65", "author": "Blazenka Popovic; Branislav Zivkovic; Radojka Maletic; Zoran Rajic; Svjetlana Jankovic-Soja", "title": "Factorial analysis of slaughter characteristics of fattening pigs fed different additives\u2013Enzyme and probiotic in mixtures", "date": "2017", "keywords": "factor; fat; meat; nutrition; pigs; shoulder; slaughter; traits", "summary": "For four For For two For three For four For first first factor factor factor factor factor factor factor factor factor factor factor factor factor x1 66.9 92.2 95.4 100 74.4 84.7 85.3 100 0.1 96.0 99.2 99.2 100 x2 33.7 86.1 94.0 100 91.1 91.4 96.2 100 60.4 86.2 91.1 91.1 100 x3 66.1 66.2 73.6 100 25.5 71.9 96.4 100 8.1 88.7 88.8 88.8 100 x4 0.0 72.8 94.1 100 53.6 57.2 62.8 100 92.2 93.0 98.1 98.1 100 x5 49.7 59.5 59.5 100 33.3 55.1 55.2 100 2.8 39.9 49.9 49.9 100 x6 0.0 0.4 0.7 100 86.7 87.9 95.3 100 34.8 50.0 51.5 51.5 100 x7 0.5 1.4 26.6 100 56.7 56.8 83.6 100 57.3 58.9 59.4 59.4 100 x8 19.4 33.2 99.7 100 3.6 54.7 87.3 100 79.2 81.8 83.5 83.5 100 x9 21.9 84.0 86.5 100 59.6 61.2 65.2 100 86.5 90.9 95.8 95.8 100 x10 49.2 80.2 80.4 100 81.9 88.1 88.1 100 87.0 92.4 95.5 95.5 100 x11 6.1 19.7 26.6 100 79.6 89.6 96.5 100 8.1 8.7 92.0 92.0 100 x12 0.9 77.4 91.9 100 14.6 16.6 99.8 100 1.1 47.7 53.9 53.9 100 x13 10.5 55.8 59.6 100 71.4 98.3 98.8 100 4.4 63.2 63.8 63.8 100 x14 45.4 62.4 88.2 100 6.8 63.9 88.5 100 60.6 72.1 74.1 74.1 100 The third factor explained 19.85% of total variability, and considering the correlation with the initial traits it can be defined as factor skin (skin in loin part of the back, skin in the shoulder, skin in the rib fat tissue).", "mime": "application/pdf"}, {"id": "ajpf-739", "words": "6229", "extension": ".pdf", "flesch": "59", "author": "Lin Huang; Zong-yong Jiang; Yin-cai Lin; Chun-tian Zheng; Shi-kui Wang; Xue-feng Yang; Guo-yao Wu", "title": "Effects of L-arginine on intestinal development and endogenous arginine-synthesizing enzymes in neonatal pigs", "date": "2017", "keywords": "arginine; arginine supplementation; control; day; effect; et al; group; p<0.05; piglets; pigs; plasma; supplementation; table", "summary": "We found that dietary arginine supplementation can prevent intestinal atrophy in early-weaned pigs, in addition to the impact on nitrogen metabolism as reported previously. Effect of dietary arginine supplementation on serum urea nitrogen levels of piglets.", "mime": "application/pdf"}, {"id": "ajpf-742", "words": "4608", "extension": ".pdf", "flesch": "63", "author": "Jin Zhang; Jiali Lin, Liangcai Shen; Fan Zhang, Yingbo Zhu; Libin Zheng", "title": "Apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes respond to clenbuterol administration in pig adipose tissue", "date": "2018", "keywords": "adipose; analysis; body; clenbuterol; control; genes; group; metabolism; microarray; month; pcr; pigs; protein; time; tissue", "summary": "The results showed that apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes respond to clenbuterol administration in pig adipose tissue and their functions may relate to fat accumulation reduction. Apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes respond to clenbuterol administration in pig adipose tissue and their function may contribute to adipose tissue reduction.", "mime": "application/pdf"}, {"id": "ajpf-745", "words": "4197", "extension": ".pdf", "flesch": "52", "author": "Kan He; Fan Yang; Minghui Wang; Qishan Wang; Yuchun Pan; Yufang Ma", "title": "Identification of pig reproductive QTL genes based on gene set enrichment analysis of mouse microarray dataset", "date": "2018", "keywords": "analysis; chromosome; et al; genes; mouse; number; pathway; pig; qtl; reproductive; traits", "summary": "Totally, less pig genes were located in reported QTL regions than mouse identified pathway genes, which can ensure the accuracy of targets for pig reproduction. Full Length Research Paper Identification of pig reproductive QTL genes based on gene set enrichment analysis of mouse microarray dataset Kan He1,2, Fan Yang1,2, Minghui Wang1,2, Qishan Wang1,2, Yuchun Pan1,2 and Yufang Ma1,2* 1 School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China.", "mime": "application/pdf"}, {"id": "ajpf-746", "words": "3755", "extension": ".pdf", "flesch": "64", "author": "A. O. K. Adesehinwa; O. O. Obi; B. A. Makanjuola; O. O. Oluwole; M. A. Adesina", "title": "Growing pigs fed cassava peel based diet supplemented with or without Farmazyme\u00ae 3000 proenx: Effect on growth, carcass and blood parameters", "date": "2018", "keywords": "cassava; diet; enzyme; farmazyme; maize; peel; pigs", "summary": "The aim of this study therefore, is to determine the effect of cassava peel supplemented with or without Farmazyme 3000 proenx as a replacement for maize in the diets of growing pigs on the growth, some carcass traits, serological and hea- matological indices of growing pigs. The dressing percentage of the pigs were com-parable across the groups showing that, the replacement of maize with cassava peel supplemented with or without the exogenous enzyme in the diets of growing pigs did not affect the resulting cold carcass weights of the pigs when slaughtered (Table 4).", "mime": "application/pdf"}, {"id": "ajpf-748", "words": "3845", "extension": ".pdf", "flesch": "65", "author": "Chia-Hsuan Chen; Hsiu-Lin Huang; Hsiu-Ya Yang; Shan-Hu Lai; , Neim-Tsu Yen; Mu-Chiou Huang", "title": "Mitochondrial genome of Taiwan pig (SUS SCROFA)", "date": "2018", "keywords": "boar; breeds; dna; lanyu; loop; pig; region; sequence; taiwan; trna; wild", "summary": "The com- plete mitochondrial genome of Taiwan Lanyu pigs was sequenced; it is a reference for the sequence difference and phylogenetic relationship of other small-ear strains in the world. The complete sequence of Lanyu pig contains two rRNA (12S and 16S), 22 tRNA and 13 mRNA (Table 2).", "mime": "application/pdf"}, {"id": "ajpf-750", "words": "3654", "extension": ".pdf", "flesch": "64", "author": "Zai-Dong Hua; Xin-Min Zheng; Qing-Xin Wei; Hou-Qiang Xu; Ya-Gang Wang; XiMei Liu,Li Li,Hong-Wei Xiao; Xian-Feng Qiao", "title": "Effect of cumulus-oocyte complexes (COCs) culture duration on IN VITRO maturation and parthenogenetic development of pig oocyte", "date": "2018", "keywords": "cocs; cumulus; duration; level; maturation; oocytes; rates; vitro", "summary": "The aim of this study was to investigate whether cumu- lus cells improved developmental ability of pig oocytes and screen the best lasting time for oocytes maturation in vitro for production of parthenotes. The best term of oocytes maturation in vitro was assessed based on developmental ability to the cleavage and blastocyst stage.", "mime": "application/pdf"}, {"id": "ajpf-752", "words": "6819", "extension": ".pdf", "flesch": "55", "author": "P. O. Uaboi-Egbenni; P. O. Bessong; A. Samie; C. L. Obi", "title": "Prevalence, haemolysis and antibiograms of Campylobacters isolated from pigs from three farm settlements in Venda region, Limpopo province, South Africa", "date": "2018", "keywords": "c. coli; campylobacter; ciprofloxacin; coli; et al; farm; isolates; jejuni; pigs; prevalence; resistance; strains; study", "summary": "Specific identification by the Mast diagnostic kits 100% 0 20 90% 80 100 100 100 100 100 100 100 100 100 100 80% 80 FARM Z R 70% 20 0 0 0 0 0 0 0 0 0 FARM Z S 60% 66.7 33.3 66.7 66.7 66.7 FARM Y R 50% 100 100 100 100 100 100 100 66.7 FARM Y S 40% 33.3 33.3 33.3 33.3 0 0 0 0 0 0 0 FARM X R 30% 50 50 20% 100 100 100 100 100 100 100 100 100 100 FARM X S 10% 50 50 0% 0 0 0 0 0 0 0 0 0 0 CIP TE CFM IPM VA AMP CN K MET E W NA Antimicrobials to which Campylobacter jejuni were exposed Fig.4: Percentage susceptibility profile of Campylobacter coli exposed to 12 antibiotics (Key: S = Susceptibility; R = Resistance; CIP= Ciprofloxacin; TE= Tetracycline; CFM = Cefexime; IPM = Imipenem; VA= Vancomycin; AMP = Ampicillin; CN= Gentamycin; K= Kanamycin; MET= Methicillin; E=Erythromycin; W= Trimethoprim; NA= Nalidixic acid). 1004bp 1004bp Fig.5: PCR products of amplified DNA from pig Campylobacter isolates aligning at the 1004bp of a 1.9kb ladder (a) pig and (b).", "mime": "application/pdf"}, {"id": "ajpf-753", "words": "2774", "extension": ".pdf", "flesch": "54", "author": "V. G. Papatsiros; E. D. Tzika; P. D. Tassis; D. Kantas; L. C. Filippopoulos; D. S. Papaioannou", "title": "Greek experience of the use of phytogenic feed additives in organic pig farming", "date": "2019", "keywords": "additives; et al; farming; feed; growth; pig; pigs; use", "summary": "However, over the last decade, the global interest in organic livestock farming and phytogenic agents has attracted the attention of many pharmaceutical companies, and it is estimated that their efficacy and safety will be proved and improved in the near future. (B) Promoting the use of phytogenic feed additives in organic pig farming, as it agrees with today consumer demands for more environmental friendly pig production, supporting at the same time farmers needs for increased and cost effective production. Phytogenic feed additives are plant- derived products used in animal feeding to improve the performance of agricultural livestock.", "mime": "application/pdf"}, {"id": "ajpf-757", "words": "5175", "extension": ".pdf", "flesch": "62", "author": "Suchitra Muenthaisong; Andras Dinnyes; Tshimangadzo Lucky Nedambale", "title": "Review of somatic cell nuclear transfer in pig", "date": "2018", "keywords": "cell; culture; development; donor; embryos; et al; lee; nuclear; oocytes; pig; pigs; porcine; production; reprod; scnt; transfer; vitro", "summary": "In the case of chemical activation, the oocytes were exposed to the substrates such as cytochalasin B (Li et al., 2000; Park et al., 2002; Hoshino et al., 2005) to prevent the extrusion of the second polar body, cycloheximide (Lee et al., 2003a) or 6- dimethylaminopurine (DMAP; de la Fuente and King, 1998; H\u00f6lker et al., 2005) to inhibit the protein kinase after an induced calcium transient to promote activation or ionomycin (Betthauser et al., 2000; Boquest et al., 2002) that it forms a complex with calcium ions and transports through the plasma membrane and it can also stimulate calcium and induce a calcium influx similar electrical activation (Morgan and Jacob, 1994). Many strategies to introduce the donor cell into cytoplasm of the recipient cytoplasm such as transferred by electrofusion (Polejaeva et al., 2000), by piezo-microinjection of isolated donor nuclei (Onishi et al., 2000), and also by whole cell injection (Lee et al., 2003b).", "mime": "application/pdf"}, {"id": "ajpf-759", "words": "4026", "extension": ".pdf", "flesch": "57", "author": "Jinlong Huo; Pei Wang; Yongwang Miao; Hailong Huo; Yangzhi Zeng; Heng Xiao", "title": "Isolation, sequence identification and tissue expression profile of a novel ribokinase gene (RBKS) from Chinese Banna mini-pig inbred line (BMI)", "date": "2018", "keywords": "analysis; bmi; bmi rbks; expression; figure; gene; human; pcr; pig; protein; rbks; sequence", "summary": "Analysis by RT-PCR showed that BMI RBKS gene was over-expressed in ovary and lung, moderately expressed in spleen, nerve fiber, large intestine and diencephalon, weakly expressed in heart, skin, muscle, small intestine, midbrain, kidney and fat, while almost silent in other five tissues. The objective of this study was to isolate the full length coding sequence of BMI RBKS gene according to the conserved sequence information of cattle or other mammals and highly homologous swine ESTs sequence information, conduct sequence analysis and some necessary function analysis of established nucleotide sequence, and finally examine the expression in a range of BMI tissues.", "mime": "application/pdf"}, {"id": "ajpf-762", "words": "5843", "extension": ".pdf", "flesch": "63", "author": "Du\u0161an \u017divkovi\u0107; Zorica Radulovi\u0107; Stevica Aleksi\u0107; Marija Perunovi\u0107; Nikola Stani\u0161i\u0107; \u010cedomir Radovi\u0107", "title": "Chemical, sensory and microbiological characteristics of Sremska sausage (traditional dry-fermented Serbian sausage) as affected by pig breed", "date": "2019", "keywords": "day; days; et al; meat; ripening; sausage; sremska; variant", "summary": "Full Length Research Paper Chemical, sensory and microbiological characteristics of Sremska sausage (traditional dry-fermented Serbian sausage) as affected by pig breed Du\u0161an \u017divkovi\u01071*, Zorica Radulovi\u01071, Stevica Aleksi\u0107 2, Marija Perunovi\u01071, Slavi\u0161a Staji\u01071, Nikola Stani\u0161i\u01072, \u010cedomir Radovi\u01072 1 University of Belgrade, Faculty of Agriculture, Department of Food Technology, Nemanjina 6, 11 080 Belgrade, Serbia. Sremska sausage is today produced from the meat of modern pig breeds.", "mime": "application/pdf"}, {"id": "ajpf-765", "words": "6352", "extension": ".pdf", "flesch": "61", "author": "Lifu Zhao , Jianzhou Li , Guoliang Lv , Anye Zhang , Pengcheng Zhou , Ying Yang; Xiaoping Pan , Xiaopeng Yu , Yimin Zhang , Shusen Zheng, Yu Chen , Yuemei Chen; Chengbo Yu , Weibo Du , Tao Song , Jiansheng Xu , Yang Yu , Lanjuan Li", "title": "Evaluation of a reversibly immortalized human hepatocyte line in bioartificial liver in pigs", "date": "2019", "keywords": "bal; bioreactor; cells; et al; failure; fhf; figure; group; hepatic; hepatocytes; hepli-4; human; liver; pigs; sham; survival; treatment", "summary": "Novel immortalized human fetal liver cell line, cBAL111, has the potential to differentiate into functional hepatocytes. In vitro study of alginate-chitosan microcapsules: an alternative to liver cell transplants for the treatment of liver failure.", "mime": "application/pdf"}, {"id": "ajpf-770", "words": "3225", "extension": ".pdf", "flesch": "61", "author": "Lizhou Tang; Long Yu , Jiangang Chen , Junjie Wang , Mei Ma , Weidong Lu; Tongzuo Zhang", "title": "Sequences polymorphism and variation of major histocompatibility complex DRB exon 2 of black Dahe pig", "date": "2019", "keywords": "acid; amino; codon; dahe; drb; exon; gene; pig; sites; sla; usage", "summary": "As a crossbreed hybridized by Chinese Dahe pig and England Yorkshire pig, black Dahe pig has been formally approved as an endemic new species by the National Agriculture Ministry of China, and distributed on districts of Dahe-Yingshang towns in Qujing city of Yunnan province. Accepted 22 November, 2018 DNA sequences of swine leukocyte antigens (SLA) DRB exon 2 from five populations were used to investigate genetic polymorphism of black Dahe pig in Yunnan province of China.", "mime": "application/pdf"}, {"id": "ajpf-774", "words": "3154", "extension": ".pdf", "flesch": "58", "author": "Mohd Hafrizal Azmi, Fakhrul Zaman Rokhani, Raja Syamsul Azmir Raja Abdullah; M. Iqbal Saripan", "title": "Improving the quality of pigskin leather texture images using enhanced image processing", "date": "2019", "keywords": "block; illumination; image; mean; method; value", "summary": "Pixel intensity for the local-global output image and proposed method output image. Key words: Digital image processing, pig skin images, binarization, local global analysis, histogram.", "mime": "application/pdf"}, {"id": "ajpf-776", "words": "2314", "extension": ".pdf", "flesch": "54", "author": "Jingping Lu, Dongsheng Zhao, Gang Zhang, Jie Gen; Qijun Shan", "title": "Expression of protein-gene peptide (PGP) 9.5 in myocardial sleeves around the pulmonary artery and aorta in pigs", "date": "2019", "keywords": "artery; pgp9.5; sinus; sleeves; tachycardia", "summary": "Full Length Research Paper Expression of protein-gene peptide (PGP) 9.5 in myocardial sleeves around the pulmonary artery and aorta in pigs Jingping Lu, Dongsheng Zhao, Gang Zhang, Jie Gen and Qijun Shan* Department of Cardiology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, 210029, Jiangsu Province, China. Myocardial sleeves onto the pulmonary artery (PA) and aorta (Ao) have been recognized as a frequent site for the origin of arrhythmia.", "mime": "application/pdf"}, {"id": "ajpf-778", "words": "5258", "extension": ".pdf", "flesch": "53", "author": "Xiangtao Liu; Keshan Zhang, Yongjie Liu, Youjun Shang, Haixue Zheng, Jianhong Guo, Hong Tian, Ye Jin, Jijun He", "title": "Analysis of pig serum proteins based on shotgun liquid chromatography-tandem mass spectrometry", "date": "2019", "keywords": "analysis; app; complement; electrophoresis; factor; figure; gel; mass; peptides; pig; proteins; proteomics; serum; shotgun", "summary": "Separation of serum proteins by one- dimensional SDS-PAGE. In this study, given profile of serum protein from porcine, we identified a total of 392 proteins (Table 1), of which 189 (Table 2) were annotated and classified based on their molecular function or biological process (Figure 4).", "mime": "application/pdf"}, {"id": "ajpf-779", "words": "4481", "extension": ".pdf", "flesch": "67", "author": "A. Kumar; R. Bhar,A. B. Mandal; S. K. Mendiratta", "title": "Effect of low protein diets and lysine supplementation on growth performance and carcass characteristics of growing pigs", "date": "2019", "keywords": "anim; carcass; et al; lysine; meat; pigs; protein; sci", "summary": "Absolute and relative weight (% BW) of trimmed lean cut & organs of pigs under different treatments (T0- Standard protein and lysine as per NRC, 1998, T1- Absolute and relative weight (% BW) of trimmed lean cut and organs of pigs under different treatments are given in Table 3.", "mime": "application/pdf"}, {"id": "ajpf-780", "words": "1939", "extension": ".pdf", "flesch": "56", "author": "Ekene V. Ezenduka; Chinyere Ugwumba", "title": "Antimicrobial residues screening in pigs and goats slaughtered in Nsukka Municipal abattoir, Southeast Nigeria", "date": "2019", "keywords": "animals; food; goats; nigeria; pigs; residues; samples", "summary": "Antimicrobial residues in test samples from slaughtered pigs and goats The results of the antimicrobial residues in tissue samples from slaughtered pigs and goats showed that 12 (30%) of the 40 pig samples and 10 (25%) of 40 goat samples were positive for antimicrobial residue. Antimicrobial residues in pig organs Out of a total of 120 organs from slaughtered pigs comprising 40 samples from each of the three organs (muscle, liver and kidney), eight (20%) muscle samples, four (10%) liver samples and 10 (25%) kidney samples were positive for antimicrobial residues.", "mime": "application/pdf"}, {"id": "ajpf-781", "words": "4359", "extension": ".pdf", "flesch": "68", "author": "Shashi Sharma, Chiranjibi Pantha , Prakash Kumar Yadav , Suman Karki; Nabaraj Poudel", "title": "Comparison of growth and reproductive performance of exotic, indigenous and cross breeds of pigs in Nepal", "date": "2019", "keywords": "breed; days; hampshire; hurrah; litter; nagpuri; pakhribas; weight", "summary": "RESULT Growth performance of different pig breeds at RARS, Tarahara Geometric means of body weight growth of different pig breeds at RARS, Tarahara has been presented in Table 1. Reproductive performance of different pig breeds at RARS, Tarahara Geometric means of reproductive performance of different pig breeds at RARS, Tarahara has been presented in Table 3.", "mime": "application/pdf"}, {"id": "ajpf-782", "words": "4616", "extension": ".pdf", "flesch": "62", "author": "Zhen Cao; Xin Di Liao; Juan Boo Liang; Yin Bao Wu; Bin Yu", "title": "Diversity of methanogens in the hindgut of grower and finisher pigs", "date": "2019", "keywords": "dgge; diversity; fiber; hindgut; index; methanogens; number; p<0.05; pigs; shannon", "summary": "Key words: Methanogen, pig, Shannon diversity index, polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Although methanogenic archaea community in pig feces and in anaerobic bioreactors fed with pig feces were studied using different molecular techniques (Ufnar et al., 2007; Liu et al., 2009; Zhu et al., 2011; Mao et al., 2011), we do not know of any published data on diversity of methanogens in different segments of larger intestine (the major site of feed fermentation in pigs) of pig using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE).", "mime": "application/pdf"}, {"id": "ajpf-783", "words": "3971", "extension": ".pdf", "flesch": "61", "author": "Abonyi, F. O.1; Omeh C.V.O; Machebe, N. S.2", "title": "Neonatal mortality of pigs in Nsukka, Southeast Nigeria", "date": "2019", "keywords": "area; days; farms; mortality; nigeria; nsukka; pig; piglets; pigs; study", "summary": "Neonatal pig mortality in pig farms surveyed in Nsukka Southeast Nigeria (n = 40). This study was conducted to investigate the causes of neonatal mortality among pig farms in Nsukka Local Government area of Enugu State, Nigeria.", "mime": "application/pdf"}, {"id": "ajpf-784", "words": "3264", "extension": ".pdf", "flesch": "66", "author": "Ewa Skrzypczak, Karolina Szulc , Monika Demkowicz , Damian Knecht, Anna JankowskaM\u0105kosa , Janusz T. Buczy\u0144ski; Marek Babicz", "title": "The influence of the different content of protein fractions in sows\u2019 milk in piglet rearing", "date": "2020", "keywords": "colostrum; fractions; lsm; milk; piglets; protein; sows", "summary": "Polyacrylamide gel with milk protein fractions. Therefore, investigation of the correlation between sows\u2019 milk protein fractions and results of piglet rearing is justified.", "mime": "application/pdf"}, {"id": "ajpf-785", "words": "4185", "extension": ".pdf", "flesch": "61", "author": "Chao Wang, Lian-Long Liu, Ai-Ting Zhang, Peng Xie, Jian-Jun Lu; Xiao-Ting Zou", "title": "Antibacterial effects of zinc oxide nanoparticles on Escherichia coli K88", "date": "2020", "keywords": "activity; afm; coli; et al; k88; nanoparticles; oxide; oxide nanoparticles; zinc; zinc oxide", "summary": "Full Length Research Paper Antibacterial effects of zinc oxide nanoparticles on Escherichia coli K88 Chao Wang, Lian-Long Liu, Ai-Ting Zhang, Peng Xie, Jian-Jun Lu* and Xiao-Ting Zou* Institute of Feed Science, College of Animal Science, Zhejiang University, Key Laboratory of Molecular Animal Nutrition, Ministry of Education, Hangzhou Zhejiang Province, People\u2019s Republic of China 310058. This study was conducted to evaluate the antibacterial effects of zinc oxide nanoparticles in vitro.", "mime": "application/pdf"}, {"id": "ajpf-790", "words": "2194", "extension": ".pdf", "flesch": "60", "author": "D. L. Lan, J. P. Gu, R. Xing, C. L. Yuan, L. Cui, X. G. Hua; Z. B. Yang", "title": "Molecular cloning and phylogenetic analysis of the E gene of transmissible gastroenteritis virus (TGEV) isolated in China", "date": "2020", "keywords": "china; gene; strain; tgev", "summary": "E gene is a small structural gene that encodes an 82 amino acid membrane-associated protein called E protein (formerly called sM)(Baudoux et al., 1998). complete E gene sequence of TGEs-1 strain was 249 bp (GenBank accession number: GU250738).", "mime": "application/pdf"}, {"id": "ajpf-792", "words": "4372", "extension": ".pdf", "flesch": "55", "author": "Maria Babetsa1,2, Vassilios Sandalakis4,5, Christina Vougidou , Antonios Zdragas , Afroditi Sivropoulou , Anna Psaroulaki; Loukia V. Ekateriniadou", "title": "Tetracycline resistance genes in Pasteurella multocida isolates from bovine, ovine, caprine and swine pneumonic lungs originated from different Greek prefectures", "date": "2019", "keywords": "dna; gene; isolates; multocida; pasteurella; plasmid; resistance; sequence; strains; tetb; teth; tetracycline", "summary": "Monitoring and source tracking of tetracycline resistance genes in lagoons and groundwater adjacent to swine production facilities over a 3-year period. Phylogenetic tree of tetH gene.", "mime": "application/pdf"}, {"id": "ajpf-793", "words": "2728", "extension": ".pdf", "flesch": "62", "author": "Lushaikyaa Allam , David Ogwu , Rowland Ibrahim Shehu Agbedea, Anthony Kojo Bedu Sackey", "title": "Posterior paresis in pregnant gilts experimentally infected with Trypanosoma brucei", "date": "2020", "keywords": "animals; brucei; figure; gilts; infected; infection; levels; trypanosoma", "summary": "Mean potassium levels of control and T. brucei infected gilts. The effect of Trypanosoma brucei infection on reproductive efficiency in gilts (n=12) was conducted.", "mime": "application/pdf"}, {"id": "ajpf-794", "words": "3254", "extension": ".pdf", "flesch": "61", "author": "Shujie Wang, Sen Hu , Jiamin Jin, Yonggang Liu , Gang Wang , Yabin Tu , Chenggang Jiang , Xuehui Cai, Xiuying Zhang", "title": "Phylogenetic and pathogenetic analysis of Streptococcus suis serotype 7 strain HW07 isolated from diseased pig in China", "date": "2020", "keywords": "analysis; gene; hw07; hw07 isolate; isolate; reca; sequence; strain; suis", "summary": "Molecular and phylogenetic analysis for the recA gene of HW07 isolate showed that it joins to the I group cluster of S. suis strains, the predominant genotype in China. The presence of S. suis was confirmed by PCR with S. suis gdh gene primers (Okwumabua et al., 2003):", "mime": "application/pdf"}, {"id": "ajpf-795", "words": "2696", "extension": ".pdf", "flesch": "55", "author": "Nagendra Nath Barman, Debojyoti Borkotoky , Biswajyoti Borah; Anjan Jyoti Nath , Papiya Das, Durlav Prasad Borah", "title": "Seasonal emergence of swine erysipelas in hilly state Nagaland, Northeast India", "date": "2020", "keywords": "ere; erysipelas; erysipelothrix; india; isolates; nagaland; pcr; pigs; rhusiopathiae; swine", "summary": "All affected pigs w ere also reported to be infested w ith pig louse Haemat opinus suis. Virological investigation Tissue samples w ere processed for demonstration of classical sw ine fever using single step Reverse transcription poly merase chain reaction ( RT- PCR)", "mime": "application/pdf"}, {"id": "ajpf-796", "words": "7709", "extension": ".pdf", "flesch": "49", "author": "Peter Ogweng, Charles Masembe , Johnson Francis Mayega , Ibrahim Keeya , Charles Tumuhe , Rodney Okwasiimire and Vincent Muwanika", "title": "Involvement of key stakeholders in controlling animal diseases in rural settings: Experiences with African swine fever in Uganda", "date": "2019", "keywords": "animal; asf; asf control; biosecurity; community; control; district; farmers; groups; influence; leaders; level; measures; mukono; pig; pigs; stakeholder; uganda", "summary": "Mukono District is the only district in Uganda, which is piloting a community initiated and monitored ASF control program where ASF stakeholders implement biosecurity measures aimed at ASF control. The categorization was in respect to the stakeholder\u2019s level of agreement with the use of biosecurity measures in ASF control, power, and influence in implementing ASF control measures in Mukono (Table 2).", "mime": "application/pdf"}, {"id": "ajpf-797", "words": "5601", "extension": ".pdf", "flesch": "55", "author": "Munyaneza Celestin1*, Nyiramuhire Valentine1 , Mubashankwaya Isaac1,2 , Munyandamutsa Fabrice , Ndisanze Oscar , Bagaragaza Fran\u00e7ois, Mujyambere Jean Marie Vianey", "title": "Factors influencing success of artificial insemination of pigs using extended fresh semen in rural smallholder pig farms of Rwanda", "date": "2020", "keywords": "conception; et al; factors; farms; insemination; number; pig; pigs; semen", "summary": "household compared to widow and single household headed farms could be explained by the fact that the married have more financial means and are more responsible, compared to the widows and single, which enable them to improve pig farm management and result in better reproduction performances. However, the study was conducted in an organized farm, where a large number of factors, particularly socio- economic and management factors were controlled compared to smallholder pig farms in rural areas.", "mime": "application/pdf"}, {"id": "ajpf-798", "words": "3414", "extension": ".pdf", "flesch": "53", "author": "Neli Vilhelmova-Ilieva , Ivo Sirakov , Remi Jacquet , Stephane Quideau, Angel S. Galabov", "title": "Antiviral activities of ellagitannins against bovine herpesvirus-1, suid alphaherpesvirus-1 and caprine herpesvirus-1", "date": "2022", "keywords": "activity; effect; ellagitannins; replication; strain; suhv-1; values; virus", "summary": "Animal Viruses. Although some cases have been reported in humans (Mravak et al., 1987; Skinner et al., 2001) and that this virus has limited zoonotic potential (Khan et al., 2013), SuHV-1 to some extent has social importance, as well.", "mime": "application/pdf"}, {"id": "ajpf-799", "words": "5202", "extension": ".pdf", "flesch": "56", "author": "Leo Daniel Ojabo; Moses Ukwu Enya", "title": "Appraisal of management and biosecurity practices on pig farms in Makurdi, Benue State, North Central Nigeria", "date": "2021", "keywords": "animal; benue; biosecurity; disease; fao; farmers; farms; nigeria; pig; practices; production; state; study", "summary": "Full Length Research Paper Appraisal of management and biosecurity practices on pig farms in Makurdi, Benue State, North Central Nigeria Leo Daniel Ojabo* and Moses Ukwu Enya Department of Animal Health and Production, College of Veterinary Medicine, Federal University of Agriculture, Makurdi, Benue State, Nigeria. The role of biosecurity at farm level is to reduce the risk of introduction of diseases in pig farms and prevent the disease transmission between animals on farms.", "mime": "application/pdf"}, {"id": "ajpf-800", "words": "7378", "extension": ".pdf", "flesch": "64", "author": "Abagale F. K.; Alazuga I. N. A; Osei A. R.", "title": "Shea waste slurry as an organic soil amendment of tropical soils in the Tamale Metropolis, Northern Ghana", "date": "2022", "keywords": "anova; application; concentration; kad; kan; levels; plant; shea; site; soil; study; sws; table", "summary": "Table 4 presents changes in soil %N content due to the influence of SWS. Key words: Shea waste slurry (SWS), organic soil amendment, tropical soil, plant nutrients.", "mime": "application/pdf"}, {"id": "ajpf-805", "words": "5131", "extension": ".pdf", "flesch": "62", "author": "John Dafaar Damsere; Michael Boateng", "title": "The response of pigs to diets containing varying levels of cocoa placenta meal (CPM) supplemented with an exogenous enzyme complex", "date": "2022", "keywords": "cocoa; cost; cpm; diets; enzyme; feed; pigs; table; values; weight", "summary": "Parameter (kg) 0% 5% 10% 15% 20% SEM p- value CPM CPM + CPM + CPM + CPM + Initial weight 15.5 15.3 15.4 15.6 15.4 0.05 1.00 Final weight 70.0 69.3 69.7 69.5 70.2 0.16 0.91 Duration of trial, days 84.0 c 92.4 bc 107 ab 105 abc 116 a 5.66 0.04 Daily feed intake 1.87 1.72 1.75 1.72 1.64 0.04 0.77 Daily weight gain 0.65 a 0.60 ab 0.51 bc 0.52 bc 0.48 c 0.03 0.02 Feed conversion ratio 2.87 bc 2.84 c 3.33 a 3.34 a 3.41 a 0.12 0.001 Feed cost, \u20ac 0.26 0.24 0.23 0.22 0.20 0.01 - Feed cost/kg gain, \u20ac 0.74 0.70 0.77 0.75 0.68 0.02 0.10 a, b, c- Means on the same row bearing different superscripts are significantly different (p \u02c2 0.05). The FCR values obtained implied that pigs on 0% CPM diet utilized their feed more efficiently (p = 0.001) than those on the 10, 15 and the 20% CPM + diets although the FCR was similar to the 5% CPM + diet.", "mime": "application/pdf"}, {"id": "ajpf-810", "words": "3815", "extension": ".pdf", "flesch": "54", "author": "Taiwo Omodele, Isaiah Annayochukwu Okere, Mutiu Olakunle Oladele-Bukola, Adeboye Joseph Omole ,Ajoke Oyegbami", "title": "Application of GIS in pig production system in Nigeria", "date": "2023", "keywords": "farms; figure; medium; nigeria; pig; pigs; production; proportion; scale; states", "summary": "Social factors that could influence pig production in Nigeria include a general preference for ruminant meat and lack of incentives for investing in large scale pig production due to economic, religious, political and climatic factors. Other social factors that have militated against pig production in Nigeria include the belief by the general populace that pigs are dirty and constitute a health hazard.", "mime": "application/pdf"}, {"id": "ajpf-811", "words": "7446", "extension": ".pdf", "flesch": "65", "author": "Vin\u00edcius de Oliveira Rezende, Lu\u00eds C\u00e9sar Dias Drumond , Andr\u00e9 Mundstock Xavier de Carvalho, Regina Maria Quint\u00e3o Lana, Marcos Vieira de Faria", "title": "Grass production Tifton 85 and nutrient extraction with swine wastewater doses", "date": "2023", "keywords": "accumulation; application; doses; et al; figure; grass; matter; nutrients; production; soil; swine; table; tifton", "summary": "Crescimento e composi\u00e7\u00e3o bromatol\u00f3gica de Tifton 85 e Vaquero em pastagens fertirrigadas. Which with the application of SW doses, the amount of added K + was high than extracted by Tifton 85 (Figure 3c), favoring an increase in the levels of K + in the soil (Table 4).", "mime": "application/pdf"}, {"id": "ajpf-814", "words": "4709", "extension": ".pdf", "flesch": "62", "author": "Okenmuo F. C., Odii O. U. and Okolo C. C.", "title": "Short-term amelioration of soil properties and maize yield enhancement using animal wastes in degraded hydromorphic soils of Southeastern Nigeria", "date": "2023", "keywords": "amendments; animal; manure; nigeria; plots; properties; soil; total; wastes; yield", "summary": "RESULTS AND DISCUSSION Chemical composition of amendments used for the study Table 1 shows the chemical composition of the animal wastes used for soil amendment. Soil amendments: Impacts in biotic systems.", "mime": "application/pdf"}, {"id": "ajpf-815", "words": "6414", "extension": ".pdf", "flesch": "58", "author": "Marina A. Padilla, Isabela C. Simoni, Ver\u00f4nica Moreira H. Hoe , Maria Judite B. Fernandes , Clarice W. Arns , Juliana R. Brito , Jo\u00e3o Henrique G. Lago", "title": "In vitro antiviral activity of Brazilian Cerrado plant extracts against animal and human herpesviruses", "date": "2023", "keywords": "activity; antiviral; cells; cerrado; concentration; effect; equine; et al; extracts; herpesvirus; hsv-1; intermedia; mncc; plants; suhv-1; type; vii", "summary": "Antiviral activity of plant extracts against aphovirus, pseudorabies virus and pestivirus in cell cutures. Figure 1 shows the antiviral activity of extract from B. intermedia at 8 set concentrations against the three viruses showing that treatment with B. intermedia extract resulted in reduced viral titers in dose-response curves.", "mime": "application/pdf"}, {"id": "ajpf-818", "words": "4961", "extension": ".pdf", "flesch": "60", "author": "Tangriani Simioni Assmann, Alceu Luiz Assmann , La\u00e9rcio Ricardo Sartor, Talyta Zort\u00e9a1", "title": "Soil nitrate, phosphorus and potassium concentration after four years of liquid swine manure application on Tifton 85", "date": "2023", "keywords": "application; concentration; et al; figure; lsm; no3; production; rates; soil; solo; tifton", "summary": "Soil ammonium concentration as a function of LSM application rates (Figure 2A) and for different soil depths (Figure 2B). Soil potassium concentration at the depths of 0-10, 10-20, 20-40 and 40-60 cm, as a function of the 0, 30, 60, 90, 120, and 180 m 3 ha -1 of LSM application rates.", "mime": "application/pdf"}, {"id": "ajpf-820", "words": "6653", "extension": ".pdf", "flesch": "62", "author": "Kagamb\u00e8ga A., Bouda S. C., Bako E. , Ciss\u00e9 H. , Barro N, Haukka K.", "title": "Salmonella diversity and antimicrobial resistance in Burkina Faso: An investigation of strains from various sources", "date": "2023", "keywords": "animals; antimicrobial; burkina; cattle; derby; enterica; faso; food; humans; poultry; resistance; salmonella; serotypes; str; strains; sul; tet; typhimurium", "summary": "There are two mechanisms in which Salmonella resistance to chloramphenicol is conferred: (i) by the plasmid-mediated enzymes called chloramphenicol acetyltransferases (CAT) or nonenzymatic chloramphenicol resistance gene cm1A and (ii) Efflux pump in which the antibiotic is pumped out of the cell. This study investigates the antimicrobial resistance and distribution of Salmonella serotypes isolated from diverse sources in Burkina Faso.", "mime": "application/pdf"}, {"id": "ajpf-822", "words": "6653", "extension": ".pdf", "flesch": "62", "author": "Kagamb\u00e8ga A., Bouda S. C. , Bako E. , Ciss\u00e9 H., Barro N., Haukka K", "title": "Salmonella diversity and antimicrobial resistance in Burkina Faso: An investigation of strains from various sources", "date": "2023", "keywords": "animals; antimicrobial; burkina; cattle; derby; enterica; faso; food; humans; poultry; resistance; salmonella; serotypes; str; strains; sul; tet; typhimurium", "summary": "There are two mechanisms in which Salmonella resistance to chloramphenicol is conferred: (i) by the plasmid-mediated enzymes called chloramphenicol acetyltransferases (CAT) or nonenzymatic chloramphenicol resistance gene cm1A and (ii) Efflux pump in which the antibiotic is pumped out of the cell. This study investigates the antimicrobial resistance and distribution of Salmonella serotypes isolated from diverse sources in Burkina Faso.", "mime": "application/pdf"}, {"id": "ajpf-824", "words": "5357", "extension": ".pdf", "flesch": "61", "author": "Talita Dantas Pedrosa, Henrique Takyiuki Ozima, Roselene Maria Schneider , Adilson Pacheco de Souza, Ednaldo Antonio de Andrade, Luciana Vieira Mattos", "title": "Assessing nutrient leaching in red-yellow latosol: The role of swine water and irrigation water reuse", "date": "2023", "keywords": "concentration; etc; irrigation; rates; soil; water", "summary": "Table 3 shows the interactions of irrigation water rates and reused water rates, observing that the leached volume increased with an increase rate, regardless of the wastewater percentages applied. The experimental design is a randomized block subdivided into a According to Barros et al. (2009), the determination of the reference evapotranspiration (ET0) by Class A tank factorial plot of 3 x 3 x 4 (application rates x irrigation water rates x provides overestimation even when Kp is regionally collection times), with three repetitions.", "mime": "application/pdf"}, {"id": "ajpf-825", "words": "4747", "extension": ".pdf", "flesch": "64", "author": "Vincent Niyiragira; Kugonza Donald Rugira; Hirwa Claire D\u2019Andre", "title": "Optimizing pig artificial insemination with imported fresh semen: Key success factors", "date": "2023", "keywords": "boar; breed; insemination; litter; number; parity; piglets; pigs; semen; size; sows", "summary": "This study was conducted to assess the factors that affect pig litter size, proportion of live pigs at birth, number of inseminations per conception, and efficiency of artificial insemination. The main factors assessed were sow breed (n = 2), sire breed (n = 3), sow parity (n = 7) and insemination method (n = 2).", "mime": "application/pdf"}, {"id": "ajpf-826", "words": "4983", "extension": ".pdf", "flesch": "60", "author": "N. Okoli; Ceron-Romero; Y. Meng; M. O. Ezekwe", "title": "Impact of pasture-raised pork farming on genes regulating lipid metabolism and meat quality", "date": "2023", "keywords": "carcass; control; et al; expression; fatty; genes; lipid; meat; pasture; pigs; ppar\u03b1; quality; science", "summary": "This study was to determine the effect of grazing systems on meat quality, carcass traits, and on lipid metabolism gene expressions. Key words: Pigs, lipid metabolism, meat quality, real-time polymerase chain reaction (PCR).", "mime": "application/pdf"}]