item: #1 of 100
          id: ajpf-3299
      author: Joseph K. Ali
       title: Africa's Pig Industry: Present Situation, Obstacles, Potential, and Prospects
        date: 2024
       words: 7257
      flesch: 50
     summary: Common challenges Climate challenges Opportunities, prospects, and a catalyst for improved pig production in Africa Prospects and opportunities of pig production in Africa Pointers to better future Abundance of agro-industrial by-product in Africa CONCLUSION CONFLICT OF INTEREST FUNDING REFERENCES The current state of pig production in Africa was examined in this article, along with its opportunities, difficulties, and possibilities.
    keywords: africa; breeds; climate; disease; farmers; farming; feed; livestock; meat; nations; pig; pig production; pigs; population; pork; potential; production; products; systems
       cache: ajpf-3299.pdf
  plain text: ajpf-3299.txt

        item: #2 of 100
          id: ajpf-3300
      author: Kororia V; Chelule M
       title: Factors Influencing Agribusiness Profitability: An Analysis of Smallholder Pig Farming in Kenya's Tharaka-Nithi County
        date: 2024
       words: 4054
      flesch: 52
     summary: A few studies have assessed how institutional structures and management characteristics affect the profitability of smallholder pig farmers. Research is therefore required to determine which institutional arrangements and management aspects should be prioritized in order for smallholder pig farmers to be profitable.
    keywords: costs; efficiency; farmers; frontier; journal; kenya; management; model; pig; production; profit; research; smallholder; study
       cache: ajpf-3300.pdf
  plain text: ajpf-3300.txt

        item: #3 of 100
          id: ajpf-3302
      author: Jendyose
       title: Northern Ugandan Pig Farmers' Utilization of Labor
        date: 2024
       words: 4048
      flesch: 52
     summary: Pre-testing was conducted on ten pig farmers in the Unyama sub-county, which was not one of the sub-counties to be investigated despite being close to the study area and having a comparable number of pig farmers. Face-to-face interviews with pig farmers conducted at their houses were used to get the data.
    keywords: behavior; family; farmers; innovation; labor; new; pig; pigs; production; smallholder; study
       cache: ajpf-3302.pdf
  plain text: ajpf-3302.txt

        item: #4 of 100
          id: ajpf-3303
      author: Talita J; F. Ndongo; Nkea F. Andrew
       title: African Swine Fever Seroprevalence in Chad's Seemingly Healthful Pig Farming
        date: 2025
       words: 7257
      flesch: 50
     summary: Common challenges Climate challenges Opportunities, prospects, and a catalyst for improved pig production in Africa Prospects and opportunities of pig production in Africa Pointers to better future Abundance of agro-industrial by-product in Africa CONCLUSION CONFLICT OF INTEREST FUNDING REFERENCES The current state of pig production in Africa was examined in this article, along with its opportunities, difficulties, and possibilities.
    keywords: africa; breeds; climate; disease; farmers; farming; feed; livestock; meat; nations; pig; pig production; pigs; population; pork; potential; production; products; systems
       cache: ajpf-3303.pdf
  plain text: ajpf-3303.txt

        item: #5 of 100
          id: ajpf-3304
      author: Rutikanga Alexis; Sylvestre Charles
       title: Rwandan Smallholder Households' Challenges and the Profitability of Pig Farming: A Case Study of the Musanze District
        date: 2025
       words: 7767
      flesch: 51
     summary: Along with reducing pig and piglet mortality through improved knowledge and skills related to the factors of pig farming production, particularly the proper feeding, vaccination, and housing that in turn increase income from pig farming, it should also be better to expand extension and veterinary services. However, the factors impacting pig farming among small homeowners were identified using STATA's stochastic frontier production function, and the profitability of pig farming was then estimated using cost-benefit analysis and farm net revenue for pig production.
    keywords: area; cost; fao; farmers; farming; feed; households; income; livestock; pig; pig farming; pig production; pigs; production; research; smallholder; study
       cache: ajpf-3304.pdf
  plain text: ajpf-3304.txt

        item: #6 of 100
          id: ajpf-3305
      author: Dozie de A; Tamunotonye V
       title: The Socioeconomic Characteristics of Pig Farmers in the Tropics as a Determinant of Pig Production and Profitability
        date: 2025
       words: 6433
      flesch: 52
     summary: Determining the socioeconomic characteristics of pig farmers, identifying the pig production systems in the study area, estimating the costs and returns associated with pig production, analyzing the constraints to pig production in the study area, and describing the socioeconomic characteristics of pig farmers will be the specific objectives. The specific goals are to: (i) characterize the socioeconomic traits of pig farmers; (ii) identify the systems of pig production in the study area; (iii) ascertain the impact of the socioeconomic traits of pig farmers on their profit; (iv) calculate the costs and returns associated with pig production; and (v) identify and analyze the barriers to pig production in the study area.
    keywords: area; cost; factor; farmers; labor; nigeria; pig; pig farmers; pig production; production; profitability; research; state; study
       cache: ajpf-3305.pdf
  plain text: ajpf-3305.txt

        item: #7 of 100
          id: ajpf-611
      author: D. Otten; H. F. A. Van den Weghe
       title: Nitrogen and phosphorus management on pig farms in Northwest Germany – nutrient balances and challenges for better sustainability
        date: 2013
       words: 7118
      flesch: 60
     summary: The various authors evaluated the overall status for reducing the environmental problems associated with pig production by using feeding and other management measures. For the investigation, the total N and P flow (inputs, intra-farm and outputs) of all the materials on six pig farms [2x piglet production, 2x finishing pig production and 2x combination farms (piglet production and finishing pigs)] were analysed over a period of 5 years.
    keywords: diet; efficiency; farms; fertiliser; manure; nutrient; pig; piglet; production; total
       cache: ajpf-611.pdf
  plain text: ajpf-611.txt

        item: #8 of 100
          id: ajpf-614
      author: Matshidiso Bailekae Masenya; M. L. Mphaphathi; M. H. Mapeka; P. H. Munya; M. B. Makhafola; F. V. Ramukhithi; P. P. Malusi; D. O. Umesiobi; T. L. Nedambale
       title: Comparative study on semen characteristics of Kolbroek and Large White boars following computer aided sperm analysis® (CASA)
        date: 2013
       words: 4726
      flesch: 66
     summary: Macroscopic evaluation for Kolbroek and Large White boar semen. Sperm morphology and viability for Kolbroek and Large White boar semen (±SD).
    keywords: boar; bodyweight; concentration; kolbroek; motility; pig; semen; sperm; volume; white
       cache: ajpf-614.pdf
  plain text: ajpf-614.txt

        item: #9 of 100
          id: ajpf-615
      author: Oparaku, N. F.; Ofomatah, A. C; Okoroigwe, E. C.
       title: Biodigestion of cassava peels blended with pig dung for methane generation
        date: 2013
       words: 3426
      flesch: 64
     summary: The implication of this is increased waste production from cassava pro- cessing. With increase in farm (agricultural) operations, greater waste production is proposed.
    keywords: biogas; blends; cassava; dung; peels; piggery; production; wastes; yield
       cache: ajpf-615.pdf
  plain text: ajpf-615.txt

        item: #10 of 100
          id: ajpf-618
      author: James Madzimure; Kerstin K. Zander; Kennedy Dzama; Michael Chimonyo
       title: Farmer perceptions of classical swine fever outbreak in communal pig production systems of South Africa
        date: 2013
       words: 5568
      flesch: 57
     summary: Pig production and disease attributes Elundini (Inland) Ngqushwa (Coastal) Ntabankulu (Coastal) n = 122 n = 102 n = 64 Respondents with culled pigs due to CSF 97 93 0 Respondents who hid some pigs from culling 17 22 0 Respondents who never saw controllers of CSF 2 3 16 Respondents who send pigs for post-mortem 1 6 3 Respondents who thought CSF is dangerous for pigs 60 88 67 Respondents who thought CSF reduces pig production 10 13 12 Respondents who thought CSF decreases pig price 28 86 55 Respondents who had no idea about CSF impact 29 0 21 Respondents who believed in vaccination against CSF 71 50 66 Respondents who believed housing controls CSF 7 22 11 Respondents advocating for educating people about CSF 2 28 10 Respondents who supported culling of pigs 14 0 10 Respondents who supported compensation with pigs 50 0 38 Respondents who received monetary compensation 25 71 0 Respondents satisfied with compensation price 100 83 63 Respondents supported a pig restocking programme 68 80 66 Respondents who wanted loans for pig projects 0 36 20 Respondents who demanded better extension services 56 64 56 the disease are shown in Table 2. Primary information about pig production was obtained from key informants.
    keywords: areas; csf; disease; et al; farmers; government; municipalities; ngqushwa; pigs; production; respondents
       cache: ajpf-618.pdf
  plain text: ajpf-618.txt

        item: #11 of 100
          id: ajpf-621
      author: Orbert C. Chikwanha; Tinyiko E. Halimani; Michael Chimonyo; Kennedy Dzama; Evison Bhebhe
       title: Seasonal changes in body condition scores of pigs and chemical composition of pig feed resources in a semiarid smallholder farming area of Zimbabwe
        date: 2013
       words: 5361
      flesch: 64
     summary: Available online at www.internationalscholarsjournals.org © International Scholars Journals Full Length Research Paper Seasonal changes in body condition scores of pigs and chemical composition of pig feed resources in a semi- arid smallholder farming area of Zimbabwe Orbert C. Chikwanha 1 , Tinyiko E. Halimani 1 , Michael Chimonyo 2* , Kennedy Dzama 3 and Evison Bhebhe 4 1 Department of Animal Science, Faculty of Agriculture, University of Zimbabwe, P. O. Box MP 167, Mount Pleasant, Harare, Zimbabwe. Seasonal changes in body condition scores of pigs and chemical composition of pig feed resources in a semi-arid smallholder farming area of Zimbabwe.
    keywords: acid; amino; benghalensis; body; brasiliensis; condition; content; feed; pigs; resources
       cache: ajpf-621.pdf
  plain text: ajpf-621.txt

        item: #12 of 100
          id: ajpf-622
      author: Egbabor Oghale
       title: Why producing pigs in China is a big challenge
        date: 2013
       words: 1366
      flesch: 55
     summary: Key words: Pig, pig farming, pig industry, pork production, Pork and Processing The pig industry is considered of national importance to the Chinese economy. Pork production in China, however, is facing enormous challenges, and as a result, the Chinese government is forced to implement changes to guide the industry to the future.
    keywords: china; chinese; pork; virus
       cache: ajpf-622.pdf
  plain text: ajpf-622.txt

        item: #13 of 100
          id: ajpf-624
      author: Adesehinwa A. O. K
       title: Comparative utilization of two sources of expellerextruded soybean meal as a replacement for on-farm processed soybean in diets of growing-finishing pigs
        date: 2013
       words: 2782
      flesch: 58
     summary: The economic feasibility of feeding extruded soybeans to swine is affected by the differences in nutrient content compared to soybean meal, the need to increase the protein in diets containing whole soybeans, the value of extra fat and the cost of processing (Hollis, 2008). Maize 30.00 29.30 28.54 Maize Offal 12.00 12.00 12.00 Soybean meal (45%) 15.00 - - Expelled soybean meal - 15.70 16.46 Palm kernel Cake 20.00 20.00 20.00 Wheat Bran 20.00 20.00 20.00 Bone meal 2.25 2.25 2.25 Vit-Min. premix 0.25 0.25 0.25 Salt 0.50 0.50 0.50 Total 100.00 100.00 100.00 Calculated: Crude Protein 17.95 17.95 17.95 ME
    keywords: diets; expeller; farm; fed; feed; meal; pigs; protein; soybean; utilization
       cache: ajpf-624.pdf
  plain text: ajpf-624.txt

        item: #14 of 100
          id: ajpf-626
      author: G. Filioussis; E. Petridou; A. Johansson; G. Christodoulopoulos; S. K. Kritas
       title: Antimicrobial susceptibility and genetic relatedness of Salmonella enterica subsp. enterica serovar Mbandaka strains, isolated from a swine finishing farm in Greece
        date: 2013
       words: 2092
      flesch: 49
     summary: Salmonella Mbandaka sensitivity to antibiotics was exa- mined in vitro in this study. enterica serovar Mbandaka (Salmonella Mbandaka) isolated from finishing swines in Greece.
    keywords: enterica; greece; isolates; pigs; salmonella; study; susceptibility
       cache: ajpf-626.pdf
  plain text: ajpf-626.txt

        item: #15 of 100
          id: ajpf-628
      author: A. N. Pandey
       title: An appeal against swine flu and its havoc
        date: 2013
       words: 2283
      flesch: 62
     summary: In case of difficulty, interested persons can contact for any help (either related to clarification or demonstration) to the undersigned on the e-mail addresses thus: (i) Upanishad.an@gmail.com, (ii) aiw.an@rediffmail.com and (iii) vedanta1232000@yahoo.co.in In the beginning Jala Neti practice could be done every alternate day for a fortnight and afterwards same can be done once in a week or fortnight to make the breathing system effective against the viral system. After some time, an intuitive message came that “Yes, there are methods available in yogic practice given by spiritual masters (Rishis) and same can be used as a preventive approach against swine flu”.
    keywords: flu; kriya; neti; swine; virus
       cache: ajpf-628.pdf
  plain text: ajpf-628.txt

        item: #16 of 100
          id: ajpf-629
      author: Hongbo Ma; Yunpeng Diao; Danyu Zhao; Kun Li; Tingguo Kang
       title: A new alternative to treat swine influenza a virus infection: Extracts from Terminalia chebula Retz
        date: 2014
       words: 2192
      flesch: 56
     summary: At present there are only two classes of antiviral drugs are approved to treat against influenza viruses including adamantanes and neuraminidase inhibitors such oselta- mivir and zanamivir Like other RNA viruses, e.g. hepatitis C virus and HIV, influenza virus is characterized by genetic varia- bility, resulting in frequent mutations and reassortment on account of influenza virus RNA polymerase lack of proof- reading abilities [Reid and Taubenberger, 2003].
    keywords: acid; chebula; et al; influenza; retz; swine; terminalia; virus
       cache: ajpf-629.pdf
  plain text: ajpf-629.txt

        item: #17 of 100
          id: ajpf-631
      author: Jun Fang; Rao Li-qun; Tian Yun; Xiangyang Lu; Hongmei Jiang
       title: Oxygen radical-scavenging capacities of peptides from swine blood
        date: 2013
       words: 2937
      flesch: 64
     summary: After thorough mixing, the chemical luminescence power curve was measured for 60 s. The ability to scavenge oxygen free radicals was determined according to the method of Wang et al. (2003). Therefore, CL can be used to show the rela- tive output of oxygen free radicals.
    keywords: acid; amino; blood; oxygen; psb; radicals; scavenging; swine
       cache: ajpf-631.pdf
  plain text: ajpf-631.txt

        item: #18 of 100
          id: ajpf-632
      author: Syeda Samra Iqbal Jafri; Muhammad Ilyas; Muhammad Idrees
       title: Swine flu: A threat to human health
        date: 2013
       words: 3538
      flesch: 65
     summary: This review addresses the biological and epidemiological aspects of swine flu virus and efforts to have a control on the virus globally. Though the swine flu virus is specie specific but it can easily cross the specie barrier and zoonotic jumps were seen in swine flu virus from pigs to humans.
    keywords: disease; flu; h1n1; health; human; influenza; pandemic; people; swine; virus
       cache: ajpf-632.pdf
  plain text: ajpf-632.txt

        item: #19 of 100
          id: ajpf-634
      author: John E. Berg
       title: The cost of double standard risk communication during the swine-flu epidemic: Reflections from Norway
        date: 2014
       words: 3340
      flesch: 59
     summary: There is no straightforward relation between study quality, concordance, funding and impact in studies of influenza vaccines (Jefferson et al., 2009). Relation of study quality, concordance, take home message, funding, and impact in studies of influenza vaccines: systematic review.
    keywords: authorities; epidemic; flu; health; influenza; public; risk; strategy; swine; vaccines
       cache: ajpf-634.pdf
  plain text: ajpf-634.txt

        item: #20 of 100
          id: ajpf-636
      author: Carmina Gallardo; Anna R. Ademun2; Raquel Nieto; Noelina Nantima; Marisa Arias; Elena Martín; Virginia Pelayo; Richard P. Bishop
       title: Genotyping of African swine fever virus (ASFV) isolates associated with disease outbreaks in Uganda in 2007
        date: 2014
       words: 4933
      flesch: 53
     summary: Full Length Research Paper Genotyping of African swine fever virus (ASFV) isolates associated with disease outbreaks in Uganda in 2007 Carmina Gallardo1*, Anna R. Ademun2, Raquel Nieto1, Noelina Nantima 2, Marisa Arias1, Elena Martín1, Virginia Pelayo1 and Richard P. Bishop3 1 Centro de Investigación en Sanidad Animal, INIA. Accepted 11 January, 2014 Samples from infected domestic pigs associated with an outbreak of African swine fever (ASF) in three districts of central Uganda in 2007 were confirmed as being infected with African swine fever virus (ASFV) using a P72 gene- based polymerase chain reaction amplification (PCR) assay combined with restriction analysis.
    keywords: african; agttatgggaaacccgaccccgaacccactt; asf; asfv; et al; fever; isolates; kenya; p72; study; swine; uganda; virus; viruses
       cache: ajpf-636.pdf
  plain text: ajpf-636.txt

        item: #21 of 100
          id: ajpf-639
      author: Lei Han, Wenying Lu; Yifang Han; Shuhua Li; Jianhua Yin; Jiaxin Xie, Tong Su; Guangwen Cao
       title: Evolutionary characteristics of swine-origin H1N1 influenza virus that infected humans from sporadic to pandemic
        date: 2014
       words: 6222
      flesch: 58
     summary: Key words: Swine, H1N1 influenza virus, evolution, sporadic, pandemic. The gene segments of the swine H1N1 viruses that occasionally infected persons who ever exposed to pigs in North America before 1998 were phylogenetically linked to those of classic swine H1N1 influenza viruses.
    keywords: avian; gene; h1n1; h1n1 influenza; h1n1 viruses; humans; influenza; influenza viruses; north; origin; pandemic; swine; viruses
       cache: ajpf-639.pdf
  plain text: ajpf-639.txt

        item: #22 of 100
          id: ajpf-641
      author: Kai Quan; Xingxu Zhao; Changxing Zhang; Qiuliang Xu; Hongfang Wei; Junjie Hu; Yong Zhang
       title: A novel approach for very early pregnancy diagnosis in swine by anti-early pregnancy factor (EPF) antiserum blocking enzyme-linked immunosorbent assay (ELISA)
        date: 2014
       words: 4483
      flesch: 65
     summary: A novel approach for very early pregnancy diagnosis in swine by anti-early pregnancy factor (EPF) antiserum blocking enzyme-linked immunosorbent assay (ELISA) Kai Quan1,2, Xingxu Zhao1*, Changxing Zhang2, Qiuliang Xu2, Hongfang Wei1, Junjie Hu1 and Yong Zhang1 1 College of Veterinary Medicine, Gansu Agricultural University, Lanzhou, Gansu 730070, China. The titers of anti-EPF serum antibody.
    keywords: antiserum; diagnosis; elisa; epf; et al; factor; ig20; non; pregnancy; samples; serum
       cache: ajpf-641.pdf
  plain text: ajpf-641.txt

        item: #23 of 100
          id: ajpf-645
      author: Ho Young Kang; Ki Hwan Moon; Se Won Kim; Jeong Dong Bahk; Sang Wan Gal; KwangKeun Cho; Chul-Wook Kim; John Hwa Lee; Sam Woong Kim
       title: An efficient secretion of the protein fused to the AgfA signal sequence in Salmonella
        date: 2015
       words: 4107
      flesch: 53
     summary: Accepted 02 December, 2014 Signal sequence (SS) of surface or secreting proteins plays an important function for protein secretion in bacterial system. In order to examine the effect of SS types in protein secretion, signal sequences of Bla (– lactamase), AgfA (thin aggregative fimbriae A), StfA (Salmonella typhimurium fimbriae A) and OmpW (outer membrane protein W) were selected for the secretion of PspA protein which was used as a test protein.
    keywords: agfa; antibody; antigen; cell; protein; pspa; salmonella; secretion; signal; study; typhimurium
       cache: ajpf-645.pdf
  plain text: ajpf-645.txt

        item: #24 of 100
          id: ajpf-656
      author: Li Wan; Zhi-Biao Wang; Qi-gui Yan; Xu Wang; Yan Lei; Lan Zuo; Wan-zhu GUO; Yu-Peng Ren
       title: Genetic diversity of Escherichia coli isolated from commercial swine farms revealed by enterobacterial repetitive intergenic consensus
        date: 2015
       words: 4284
      flesch: 65
     summary: Genetic variability with E. coli strains isolated from swine farms in China has been demonstrated. ERIC-PCR and REP-PCR techniques are more rapid methods for molecular typing of E. coli strain.
    keywords: coli; e. coli; eric; farms; isolates; pcr; pig; rep; sichuan; strains
       cache: ajpf-656.pdf
  plain text: ajpf-656.txt

        item: #25 of 100
          id: ajpf-658
      author: Fuchuan Wang; Yibo Yan; Yuhuan Zhang1; Yichao Han; Chao Guan
       title: Effects of immune synergist of Chinese medicinal herbs on the efficacy of vaccination against classic swine fever
        date: 2014
       words: 3018
      flesch: 63
     summary: These results suggest that herbal immune synergist of Chinese traditional herbs prescription enhances the protective effect of classic swine fever vaccine. Effects of herbal immune synergist on serum IgG content.
    keywords: chinese; control; day; effects; group; herbs; immune; synergist
       cache: ajpf-658.pdf
  plain text: ajpf-658.txt

        item: #26 of 100
          id: ajpf-661
      author: Xu-Ting Li; Bin Wang; Jin-Liang Li; Fu-Qiang Zeng; Xue Gong
       title: Prevalence and antimicrobial susceptibility of bacterial pathogens isolates from diseased swine in southwest, China
        date: 2014
       words: 4098
      flesch: 56
     summary: High levels of resistance to tetracycline (~60-95%) have also been detected in E. coli isolates recovered from apparently healthy swine on-farm or at slaughter in other countries (Kozak et al., 2003; Kijima-Tanaka et al., 2003; Teshager et al., 2000; Blake et al., 2003). The results of the study indicated that TEM-1 was the most common β-lactamase gene among the K. pneumoniae and E. coli isolates, in agreement with previous studies that reported a high prevalence of the blaTEM-1 gene among animal E. coli isolates (Liu et al., 2007;
    keywords: china; coli; et al; isolates; mirabilis; pneumoniae; resistance; suis; swine
       cache: ajpf-661.pdf
  plain text: ajpf-661.txt

        item: #27 of 100
          id: ajpf-664
      author: Cheng Darong; Zhu Shan Yuan; Chen Xiao Lang; Gao Xiao Pan; Ding Wen Wei; Sun Huai Chang
       title: Rapid diagnosis of ETEC and HPI-harboring Escherichia coli infection in newborn piglets with diarrhea
        date: 2014
       words: 3970
      flesch: 64
     summary: All the 3 both ETEC and HPI- harboring E. coli isolates were LTa+, STb and F4+. There are a number of well documented examples in which bacterial adaptation has been influenced by HGT, such as the high-pathogenicity island (HPI) of pathogenic Yersinia in E. coli (Buchrieser et al., 1998; Carniel et al., 1992, 1998; Fetherston et al., 1994; Hacker et al., 2000; Perry et al., 1990; Petermann et al., 2008; Schubert et al., 1998), or the new “plasmid- associated” pathogenicity island PAI2173 which encodes the tetB gene conferring tetracycline resistance (Fekete et al., 2003).
    keywords: coli; diarrhea; e. coli; harboring; hpi; isolates; pcr; samples
       cache: ajpf-664.pdf
  plain text: ajpf-664.txt

        item: #28 of 100
          id: ajpf-669
      author: Xiao-ying Pei; Ding-zong Guo; Dong-hai Zhou; Rui Guo
       title: Protease-activated receptor-2 (PAR-2) regulates enterotoxigenic Escherichia coli-induced diarrhea during weaning in piglets
        date: 2015
       words: 4856
      flesch: 53
     summary: The generation of IL-6 and IL-8 by IECs was significantly increased following stimulation with PAR-2 agonists dose-dependently. Arrows indicate positive staining for PAR-2, reference bar = 50 m. production of IL-6 and IL-8, the direct and amplifying effects of PAR-2 agonists on baseline and LPS+LT- activated IEC were studied.
    keywords: activation; cells; coli; diarrhea; expression; il-6; il-8; mucosa; par-2; piglets; production; tract; weaning
       cache: ajpf-669.pdf
  plain text: ajpf-669.txt

        item: #29 of 100
          id: ajpf-672
      author: DaRong Cheng; XiaoLang Chen; ShanYuan Zhu; WenWei Ding; ZhiXia Mu; Jun Zhou
       title: Prevalence of (high-pathogenicity island) HPI-harboring Escherichia coli in diarrheic and healthy piglets
        date: 2015
       words: 2545
      flesch: 61
     summary: O138 was the vast prevalent serotype among the HPI + E. coli isolates. In addition, the 25 HPI + E. coli isolates were O serotyped and O138 was the most prevalent serotype accounting for 64% (16/25), followed by O65 (12%), O139 (8%), O9 (8%), O55 (4%) and O141 (4%) (Table 1).
    keywords: coli; hpi; isolates; samples
       cache: ajpf-672.pdf
  plain text: ajpf-672.txt

        item: #30 of 100
          id: ajpf-673
      author: C. B. Hsu; H. J. Huang; C. H. Wang; H. T. Yen; B. Yu
       title: The effect of glutamine supplement on small intestinal morphology and xylose absorptive ability of weaned piglets
        date: 2015
       words: 3904
      flesch: 62
     summary: Ingredient (%) Basal diet Maize, dent yellow 49.05 Soybean meal, 44 of CP 23.70 Dried skim milk 16.0 Whey 5.0 Soybean oil 1.0 Dicalcium phosphate 1.60 Limestone, pulverized 0.80 Salt 0.50 Vitamin premix 1 0.10 Mineral premix 2 0.15 Choline chloride, 50 0.10 Maize starch 2.0 Glutamine 0 Calculated values Crude protein 20.3 Calcium 1.01 Total phosphorus 0.77 Lysine 1.17 1 Supplied per kg of diet: Vitamin A, 6,000 IU; vitamin D3, 800 IU; vitamin E, 20 mg; vitamin K3, 4 mg; vitamin B2, 4 mg; vitamin B6, 1 mg; vitamin B12, 0.02 mg; niacin, 30 mg; calcium pantothenate, 16 mg; folic acid, 0.6 mg; biotin, 0.01 mg; choline chloride, 50 mg. 2 Supplied per kg of diet: Fe (FeSO4.H2O), 140 mg; Cu (CuSO4.5H2O), 7 mg; Mn (MnSO4.H2O), 20 mg; Zn (ZnO), 120 mg; I (KIO3), 0.45 mg. an end product of intestinal Gln catabolism (Wu et al., 1995). In summary, the results suggested that dietary supplementation of Gln could be beneficial in small intestinal villous morphology and xylose absorptive capacity, and could have a slight contribution to the average daily gain of weaned piglets.
    keywords: control; day; gln; glutamine; group; growth; pigs; supplementation; xylose
       cache: ajpf-673.pdf
  plain text: ajpf-673.txt

        item: #31 of 100
          id: ajpf-674
      author: Ming Zhang; Hui Yuan; Zuping He; Liyun Yuan; Jine Yi; Sijun Deng; Li Zhu; Chengzhi Guo
       title: DNA damage and decrease of cellular oxidase activity in piglet sertoli cells exposed to gossypol
        date: 2015
       words: 3847
      flesch: 55
     summary: Putting this into consideration, our study suggests that exposure of gossypol to sertoli cells leads to an inhibition of sertoli cell growth and oxidase activity of sertoli cells at a low concentration, whereas gossypol results in DNA damage of sertoli cells at a higher concentration. Moreover, DNA damage of sertoli cells was observed at 5 μg/ml gossypol.
    keywords: cells; control; damage; dna; gossypol; group; piglet; sertoli; sertoli cells
       cache: ajpf-674.pdf
  plain text: ajpf-674.txt

        item: #32 of 100
          id: ajpf-677
      author: Zhentian Xiang, Hongwei Qi; Guoquan Han, Jingbo Liu; Zhiqing Huang, Bing Yu; Daiwen Chen
       title: Real-time TaqMan polymerase chain reaction to quantify the effects of different sources of dietary starch on Bifidobacterium in the intestinal tract of piglets
        date: 2015
       words: 5784
      flesch: 58
     summary: Parameter Corn starch Wheat starch Tapioca starch Pea starch All Bacteria Duodenum （2.26±0.74）×10 9 （2.55±0.56）×10 9 （2.83±0.86）×10 9 （2.07±0.59）×10 9 Jejunum （7.35±2.04）×10 9 （8.58±1.81）×10 9 （1.38±0.88）×10 10 （1.09±0.37）×10 10 Ileum （7.74±2.93）×10 9 （8.28±2.29）×10 9 （7.06±1.19）×10 9 （6.60±3.20）×10 9 Cecum （2.79±0.90a）×10 11 （2.33±0.63a）×10 11 （2.29±0.69a）×10 11 （1.67±0.81b）×10 11 Colon （4.83±1.20a）×10 11 （5.28±2.12a）×10 11 （4.23±1.27a）×10 11 （1.84b±0.82）×10 11 Bifidobacterium Duodenum （5.49±0.69b）×10 6 （6.03±0.57b）×10 6 （3.52±0.76c）×10 6 （8.04±1.38a）×10 6 Jejunum （1.53±0.42b）×10 7 （1.64±0.65b）×10 7 （4.14±0.59b）×10 6 （3.85±1.78a）×10 7 Ileum （8.72±3.08b）×10 6 （1.04±0.22b）×10 7 （3.44±0.93c）×10 6 （2.32±0.31a）×10 7 Cecum （5.91±2.26b）×10 8 （5.45±1.17b）×10 8 （2.86±1.05c）×10 8 （1.23±0.15a）×10 9 Colon （3.76±1.21b）×10 8 （3.89±0.89b）×10 8 （7.56±2.80b）×10 7 （1.24±0.53a）×10 9 B/A (%)* Starches are the main source of carbohydrates in mixed diets and the major source of energy for mono- gastric animal and human (Deng et al., 2009a).
    keywords: amylopectin; amylose; bacteria; bifidobacterium; dna; et al; pcr; piglets; primers; starch; strains; table; time; tract
       cache: ajpf-677.pdf
  plain text: ajpf-677.txt

        item: #33 of 100
          id: ajpf-680
      author: Nenad Stojanac; Mladen Gagrčin; Ognjen Stevančević; van Stančić; Aleksandar Potkonjak
       title: Passive and active immunity against parvovirus infection in piglets
        date: 2015
       words: 3078
      flesch: 61
     summary: A total of 60 blood serum samples were checked, and the defined titre values of specific antibodies ranged between 11 to 14 (Table 2). The dynamics of movement of antibody titer values specific for PPV in the blood serum of piglets.
    keywords: antibody; blood; days; piglets; ppv; serum; specific; titer
       cache: ajpf-680.pdf
  plain text: ajpf-680.txt

        item: #34 of 100
          id: ajpf-683
      author: Yakubu, M. Bello
       title: Biodegradation of Lagoma crude oil using pig dung
        date: 2015
       words: 3417
      flesch: 61
     summary: Measurement of crude oil biodegradation in soil amended with pig dung The rate of bacterial utilization of crude oil in the soil was assessed by using the the gravimetric method. The amount of crude oil degraded was calculated by subtracting the weight of residual crude oil from weight of the added (initial) crude oil, divided by the weight of the initial crude oil and then multiplied by 100.
    keywords: bacteria; biodegradation; crude; dung; oil; pig; soil
       cache: ajpf-683.pdf
  plain text: ajpf-683.txt

        item: #35 of 100
          id: ajpf-685
      author: M. C. Marufu; P. Chanayiwa; M. Chimonyo; E. Bhebhe
       title: Prevalence of gastrointestinal nematodes in Mukota pigs in a communal area of Zimbabwe
        date: 2015
       words: 3601
      flesch: 63
     summary: Further examinations are needed to determine the pathological importance and impact of parasitic infestations on indigenous pigs in the communal area. Key words: Ascaris, epidemiology, indigenous pigs, internal parasites,
    keywords: area; eggs; nematodes; parasites; pigs; prevalence; species; study; zimbabwe
       cache: ajpf-685.pdf
  plain text: ajpf-685.txt

        item: #36 of 100
          id: ajpf-686
      author: F.O.I. Anugwa; A.I. Okwori
       title: Performance of growing pigs of different genetic groups fed varying dietary protein levels
        date: 2016
       words: 3887
      flesch: 66
     summary: In Experiment 1, the LC pigs gained more weight and had better feed conversion ratios and protein efficiency ratios on the lower (12%) protein diet than on the 16% protein diet whereas the LW x LC pigs gained more weights and had better feed conversion ratios on the 16% protein diet than on the 12% protein diet. E-mail: abelokwori@yahoo.com. pigs to diets varying in protein level from 12 to 20% crude protein.
    keywords: diet; pigs; protein
       cache: ajpf-686.pdf
  plain text: ajpf-686.txt

        item: #37 of 100
          id: ajpf-689
      author: Adesehinwa, A. O. K
       title: Energy and protein requirements of pigs and the utilization of fibrous feedstuffs in Nigeria
        date: 2016
       words: 8187
      flesch: 65
     summary: Longe and Fagbenro-Byron (1990) in their studies on fibrous waste and by-products for pig feeds in Nigeria concluded that fibre sources in general, may be best suitable for adult pigs. The types of pig feeds used in the tropics vary greatly, and since many by-products are used in place of cereals, the variation in nutritive values between and within feeds may be considerable (Lekule et al., 1990).
    keywords: anim; animal; crude; diets; digestibility; energy; feed; fibre; meal; pigs; production; protein; requirements; sci; swine; tegbe; utilization
       cache: ajpf-689.pdf
  plain text: ajpf-689.txt

        item: #38 of 100
          id: ajpf-690
      author: S. O. C. Ugwu; A. E. Onyimonyi
       title: The growth performance of growing pigs during feed restriction and re-alimentation in a humid tropical environment
        date: 2015
       words: 3540
      flesch: 69
     summary: Also, during re-alimentation pigs on the 70% level had the highest feed intake. Other growth measurements taken in both stages at weekly interval were body length (BL); as t he length of pigs body from base of tail to base of skull (Mersmann et al., 1987) and height at shoulder (HS) taken as the vertical distance from the floor of restraining cage to the highest point on the shoulder (Lefaucheur et al., 1991).
    keywords: control; feed; pigs; restriction; rst
       cache: ajpf-690.pdf
  plain text: ajpf-690.txt

        item: #39 of 100
          id: ajpf-692
      author: A.Y. Adenkola; J.O. Ayo; A.K.B. Sackey; A. B. Adelaiye
       title: Haematological and serum biochemical changes in pigs administered with ascorbic acid and transported by road for four hours during the harmattan season
        date: 2016
       words: 6413
      flesch: 64
     summary: Road transportation effect on rectal temperature, respiration and heart rates of ostritch (Struthio camelus) chick. It is, therefore, recommended that pigs be administered with AA before transportation by road during the harmattan season in order to reduce the risk of adverse effects of transportation stress on health.
    keywords: acid; control; control pigs; experimental; increase; journey; pigs; road; serum; stress; transportation; value; vet
       cache: ajpf-692.pdf
  plain text: ajpf-692.txt

        item: #40 of 100
          id: ajpf-693
      author: Modisane Simon; Moneoang; Bezuidenhout, Cornelius Carlos
       title: Characterisation of enterococci and Escherichia coli isolated from commercial and communal pigs from Mafikeng in the North-West Province, South Africa
        date: 2016
       words: 5351
      flesch: 58
     summary: Less than 7% of enterococci were resistant to ampicillin and amoxicillin, whereas 45% of E. coli isolates were resistant to the same antibiotics. Gram staining, API 20 Strep and API 20E were used for identification of enterococci and E. coli, respectively.
    keywords: antibiotic; coli; e. coli; enterococci; et al; faecium; farms; isolates; mareetsane; microbiol; pigs; resistance; tlapeng; vancomycin
       cache: ajpf-693.pdf
  plain text: ajpf-693.txt

        item: #41 of 100
          id: ajpf-694
      author: A. T. Niba; J. D. Beal; A. C. Kudi; P. H. Brooks
       title: Potential of bacterial fermentation as a biosafe method of improving feeds for pigs and poultry
        date: 2009
       words: 7415
      flesch: 61
     summary: The selection of LAB for feed fermentation to meet desired feed and production objectives has been highlighted in previous reviews (Brooks et al., 2003b; Brooks, 2008) . However, Niven et al. (2006) demonstrated that the loss of lysine from fermented liquid pig feed was due to metabolism of lysine by E. coli present in the feed rather than its utilisation as an energy source by LAB.
    keywords: acid; anim; beal; beal et; brooks; diets; effect; et al; feed; feeding; fermentation; food; liquid; performance; pigs; poultry; sci; van
       cache: ajpf-694.pdf
  plain text: ajpf-694.txt

        item: #42 of 100
          id: ajpf-695
      author: Jimmy Quisirumbay-Gaibor; Luis Delgado, César Oña; Alexandra Naranjo; Eduardo Aragón
       title: Productive performance of piglets fed with different sources of lactose
        date: 2017
       words: 1918
      flesch: 64
     summary: The crystallized lactose is obtained after evaporation and dehydration of serum (mainly composed of α-lactose) and pure lactose is obtained by centrifugation and purification of the crystallized whey: it contains more than 99% lactose. The T1 group received pure lactose, T2 whey and T3 permeate.
    keywords: lactose; piglets; weaning; whey
       cache: ajpf-695.pdf
  plain text: ajpf-695.txt

        item: #43 of 100
          id: ajpf-698
      author: Oluwole, O. O.; Omitogun, O. G.
       title: Cytogenetic characterization of Nigerian indigenous pig
        date: 2016
       words: 2702
      flesch: 69
     summary: The karyotype of the domestic pig composed of 18 pairs of autosome and pairs of sex chromosomes (X or Y) are already well characterized of which 13 are metacentic and 6 are acrocentric (CSKSS, 1988;CTA, 1994; Fairbank 1999). p/q ratio of both were observed to be the same in chromosome 1, 2, 6, 9, 11, 12, 14 - 18 and Y sex chromosome within the S.E measurement while differences were obtained in chromosome 3, 4, 5, 7, 8, 10, 13 and X sex chromosomes but these differences do not cause distinction in chromosome type, except in the X sex chromosome which showed distinction in chromosome type (Oluwole, 2005).
    keywords: chromosome
       cache: ajpf-698.pdf
  plain text: ajpf-698.txt

        item: #44 of 100
          id: ajpf-699
      author: Chao Sun; Yongjia Peng, Dongfeng Jiang; Zhongpin Zhang
       title: The potential lipolysis function of musclin and its mRNA expression both in Pig adipose tissue and primary adipocyte
        date: 2016
       words: 4095
      flesch: 61
     summary: As shown in Figure 2C, musclin gene expression in subcutaneous adipose of five-month-old. Large White pigs was significantly higher than that in ten-month-old (P < 0.05), suggesting that musclin gene expression is higher in young pig than that in old pig.
    keywords: adipocyte; adipose; correlation; expression; gene; lipid; muscle; musclin; ppar; tissue
       cache: ajpf-699.pdf
  plain text: ajpf-699.txt

        item: #45 of 100
          id: ajpf-701
      author: Y. J. Zhang; G. C. Li; Y. L. Jiang
       title: Polymorphism and association of microsatellite SJ01 with birth weight and early growth traits in pigs
        date: 2016
       words: 3839
      flesch: 65
     summary: The average daily gain from 28 d to 70 d in Yorkshire pigs and the body weight at 70 d in Landrace pigs were significantly different between SJ01 genotypes (P < 0.05). In this study, SJ01 locus is found to be associated with average daily gain from 28 to 70 d in Yorkshire pigs and with body weight at 70 d in Landrace pigs.
    keywords: birth; myostatin; pigs; sj01; traits; weight; yorkshire
       cache: ajpf-701.pdf
  plain text: ajpf-701.txt

        item: #46 of 100
          id: ajpf-703
      author: A. Y. Adenkola; J. O. Ayo; A. K. B. Sackey; A. B. Adelaiye
       title: Erythrocyte osmotic fragility of pigs administered ascorbic acid and transported by road for shortterm duration during the harmattan season
        date: 2016
       words: 3955
      flesch: 58
     summary: The results indicated that ascorbic acid protected the integrity of the erythrocyte membrane in experimental pigs administered ascorbic acid following road transportation as demonstrated by lower percentage haemolysis immediately after road transportation and thus may alleviate the risk of increase in haemolysis due to road transportation stress in pigs during the harmattan season. The increase in ROS generation in the body, appa-rently, by road transportation stress on the body rendering cells more fragile and easily susceptible to hypotonic lysis.
    keywords: acid; ascorbic; erythrocyte; experimental; fragility; pigs; road; season; stress; transportation
       cache: ajpf-703.pdf
  plain text: ajpf-703.txt

        item: #47 of 100
          id: ajpf-706
      author: Olayinka Oluwafemi Asala; Joseph Olusegun Ayo; Adeshina Yahaya Adenkola; Ndazo Salka Minka
       title: Effects of road transportation on excitability scores of pigs administered with ascorbic acid during the hot-dry season
        date: 2016
       words: 4106
      flesch: 63
     summary: The fact that the administration of AA before road transportation of pigs resulted in a decrease in the percentage of animals that were depressed (that is, those with the excitability score of 1) and an increase in the percentage of pigs that were excited (that is, those with excitability score of 4) after the journey demonstrated that AA activated the nervous system in experimental pigs by reverting the depression, observed in control pigs, back to excitation. Post-transportation, an increase in the percentage of experimental pigs with excitability score of 4 was recorded (38.5 to 69.2%), while a decrease was obtained in the control pigs (40.0 to 10%).
    keywords: control; excitability; pigs; sci; score; season; transportation
       cache: ajpf-706.pdf
  plain text: ajpf-706.txt

        item: #48 of 100
          id: ajpf-707
      author: O. O. Asala; J. O. Ayo; P. I. Rekwot; N. S. Minka; A. Y. Adenkola
       title: Rectal temperature responses of pigs transported by road and administered with ascorbic acid during the hot-dry season
        date: 2016
       words: 5346
      flesch: 63
     summary: The overall mean RT value of 39.8 ± 0.1°C recorded in the experimental pigs after 8 h road transportation did not differ (P > 0.05) with the corresponding value of 39.4 ± 0.3°C in control pigs, demonstrating that AA did not induce hypothermia in experimental pigs. Accepted 09 November, 2016 Experiments were performed in order to determine the rectal temperature (RT) responses of pigs to eight-hour road transportation and the effect of administration of ascorbic acid (AA) on the responses in transported pigs during the hot -dry season.
    keywords: experimental; journey; pigs; season; transportation; values
       cache: ajpf-707.pdf
  plain text: ajpf-707.txt

        item: #49 of 100
          id: ajpf-709
      author: Yu-Chih Wang; Yi-Chih Chang; Hsiao-Li Chuang; Chien-Chao Chiu; Kuang-Sheng Yeh; Chao-Chin Chang; Ter-Hsin Chen
       title: Antibiotic resistance, integrons and Salmonella genomic island 1 among Salmonella Schwarzengrund in broiler chicken and pig
        date: 2017
       words: 2974
      flesch: 52
     summary: Molecular characterization suggests an epidemiological relationship between the swine and chicken Salmonella Schwarzengrund isolates. Full Length Research Paper Antibiotic resistance, integrons and Salmonella genomic island 1 among Salmonella Schwarzengrund in broiler chicken and pig Yu-Chih Wang1, Yi-Chih Chang1,6, Hsiao-Li Chuang2, Chien-Chao Chiu2, Kuang-Sheng Yeh4, Chao-Chin Chang3, Shih-Ling Hsuan5 and Ter-Hsin Chen3,5* 1 Department of Veterinary Medicine, National Chung Hsing University, Taichung, 402, Taiwan.
    keywords: dna; gene; genomic; integrons; isolates; pcr; resistance; salmonella; schwarzengrund; taiwan
       cache: ajpf-709.pdf
  plain text: ajpf-709.txt

        item: #50 of 100
          id: ajpf-712
      author: A. O. K. Adesehinwa; O. O. Obi, B. A. Makanjuola; A. O. Adebayo; E. S. Durotoye
       title: Utilization of sun-dried on-farm generated poultry litter as a feed resource for growing-finishing pigs
        date: 2017
       words: 3800
      flesch: 63
     summary: There is therefore the need for the right technology/package for the use of poultry litter as a feedstuff for growing pigs. Utilization of palm kernel cake as a replacement for maize in diets of growing pigs: effects on performance, serum metabolites, nutrient digestibility and cost of feed conversion.
    keywords: diets; feed; litter; pigs; poultry; protein; serum; sopl; study; values
       cache: ajpf-712.pdf
  plain text: ajpf-712.txt

        item: #51 of 100
          id: ajpf-713
      author: E. O. K. Oddoye; S. W. A. Rhule; K. Agyente-Badu; V. Anchirinah; F. Owusu Ansah
       title: Fresh cocoa pod husk as an ingredient in the diets of growing pigs
        date: 2017
       words: 2647
      flesch: 69
     summary: Key words: Feeding trial, fresh cocoa pod husk, growing pigs, growth rate, feed to gain ratio. Even though it was not possible to measure theobromine content of the fresh pod in this experiment, the performance of pigs and the fact that no health problems were observed during the 140 days of the trial suggest that the pigs were not adversely affected by the feeding of fresh cocoa pod husk.
    keywords: cocoa; cph; diet; feed; pod
       cache: ajpf-713.pdf
  plain text: ajpf-713.txt

        item: #52 of 100
          id: ajpf-715
      author: Honglei Ding,Rui Zhang,Kaiyun Liu,Linping Huang; Maochun Tian; Mingming Jiang , Quanming Zou; Xuhu Mao
       title: Escherichia coli O157:H7 EDL933 has a strong virulence to Bama miniature pigs by injection and fails to colonize to their gastrointestinal tracts
        date: 2017
       words: 4325
      flesch: 63
     summary: Furthermore, the E. coli O157:H7 colonized model of pig has been established and E. coli O157:H7 could be transmitted from infected donor pigs to naïve pigs directly and indirectly. Bama miniature pig was infected with E. coli O157:
    keywords: coli; coli o157; e. coli; edl933; escherichia; escherichia coli; et al; microbiol; o157; pigs; strain
       cache: ajpf-715.pdf
  plain text: ajpf-715.txt

        item: #53 of 100
          id: ajpf-717
      author: Byung Uk Kim; Mi Ae Jeong; Yeon Sun Ryu; Hwa Chun Park,Jong Hyun Jung,Sam Woong Kim,Chul Wook Kim; Young Min Song,Ki Hwa Chung, Il Suk Kim, Sang Keun Jin,Sang Suk Lee; In Soon Choi; Kwang Keun Cho
       title: Comparative proteomic analysis of the effects of dietary mugwort (Artemisia iwayomogi Kitamura) on the pig Longissimus dorsi muscle
        date: 2017
       words: 4205
      flesch: 59
     summary: Protein spots showing significant expression variation were selected as spots to exhibit critical changes between the control and treated groups. Protein identification via PMF and CAF-MALDI sequencing Protein identification via PMF was done as follows: protein spots were enzymatically digested with modified porcine trypsin in a manner similar to the method previously described by Shevchenko et al. (1996).
    keywords: analysis; chain; diet; dorsi; expression; meat; mugwort; muscle; myosin; pmf; powder; protein; spots
       cache: ajpf-717.pdf
  plain text: ajpf-717.txt

        item: #54 of 100
          id: ajpf-719
      author: Jin Ho Cho; In Ho Kim
       title: Effect of stocking density on pig production
        date: 2017
       words: 3611
      flesch: 68
     summary: Effect of stocking arrangement on pig performance. Effects of double stocking and weighing frequency on pig performance in wean-to-finish production systems.
    keywords: anim; density; j. anim; performance; pigs; sci; space; stocking; stress
       cache: ajpf-719.pdf
  plain text: ajpf-719.txt

        item: #55 of 100
          id: ajpf-720
      author: Jing Wang, Haifeng Ji; Dongyan Zhang, Hui Liu, Sixin Wang, Dacong Shan; Yamin Wang
       title: Assessment of probiotic properties of Lactobacillus plantarum ZLP001 isolated from gastrointestinal tract of weaning pigs
        date: 2017
       words: 4009
      flesch: 58
     summary: The survival rate of L. plantarum ZLP001 strains when cultured in simulated gastric fluid with pH of 2.0 and 3.0 are shown in Table 2. The probiotic strain was administered through the feed to 35-day old weaned piglets to estimate the effect of L. plantarum ZLP001 on the growth performance.
    keywords: bile; feed; fluid; piglets; plantarum; probiotic; strain; zlp001
       cache: ajpf-720.pdf
  plain text: ajpf-720.txt

        item: #56 of 100
          id: ajpf-721
      author: Blazenka Popovic; Branislav Zivkovic; Radojka Maletic; Zoran Rajic; Svjetlana Jankovic-Soja
       title: Factorial analysis of slaughter characteristics of fattening pigs fed different additives–Enzyme and probiotic in mixtures
        date: 2017
       words: 4832
      flesch: 65
     summary: For four For For two For three For four For first first factor factor factor factor factor factor factor factor factor factor factor factor factor x1 66.9 92.2 95.4 100 74.4 84.7 85.3 100 0.1 96.0 99.2 99.2 100 x2 33.7 86.1 94.0 100 91.1 91.4 96.2 100 60.4 86.2 91.1 91.1 100 x3 66.1 66.2 73.6 100 25.5 71.9 96.4 100 8.1 88.7 88.8 88.8 100 x4 0.0 72.8 94.1 100 53.6 57.2 62.8 100 92.2 93.0 98.1 98.1 100 x5 49.7 59.5 59.5 100 33.3 55.1 55.2 100 2.8 39.9 49.9 49.9 100 x6 0.0 0.4 0.7 100 86.7 87.9 95.3 100 34.8 50.0 51.5 51.5 100 x7 0.5 1.4 26.6 100 56.7 56.8 83.6 100 57.3 58.9 59.4 59.4 100 x8 19.4 33.2 99.7 100 3.6 54.7 87.3 100 79.2 81.8 83.5 83.5 100 x9 21.9 84.0 86.5 100 59.6 61.2 65.2 100 86.5 90.9 95.8 95.8 100 x10 49.2 80.2 80.4 100 81.9 88.1 88.1 100 87.0 92.4 95.5 95.5 100 x11 6.1 19.7 26.6 100 79.6 89.6 96.5 100 8.1 8.7 92.0 92.0 100 x12 0.9 77.4 91.9 100 14.6 16.6 99.8 100 1.1 47.7 53.9 53.9 100 x13 10.5 55.8 59.6 100 71.4 98.3 98.8 100 4.4 63.2 63.8 63.8 100 x14 45.4 62.4 88.2 100 6.8 63.9 88.5 100 60.6 72.1 74.1 74.1 100 The third factor explained 19.85% of total variability, and considering the correlation with the initial traits it can be defined as factor skin (skin in loin part of the back, skin in the shoulder, skin in the rib fat tissue).
    keywords: factor; fat; meat; nutrition; pigs; shoulder; slaughter; traits
       cache: ajpf-721.pdf
  plain text: ajpf-721.txt

        item: #57 of 100
          id: ajpf-739
      author: Lin Huang; Zong-yong Jiang; Yin-cai Lin; Chun-tian Zheng; Shi-kui Wang; Xue-feng Yang; Guo-yao Wu
       title: Effects of L-arginine on intestinal development and endogenous arginine-synthesizing enzymes in neonatal pigs
        date: 2017
       words: 6229
      flesch: 59
     summary: We found that dietary arginine supplementation can prevent intestinal atrophy in early-weaned pigs, in addition to the impact on nitrogen metabolism as reported previously. Effect of dietary arginine supplementation on serum urea nitrogen levels of piglets.
    keywords: arginine; arginine supplementation; control; day; effect; et al; group; p<0.05; piglets; pigs; plasma; supplementation; table
       cache: ajpf-739.pdf
  plain text: ajpf-739.txt

        item: #58 of 100
          id: ajpf-742
      author: Jin Zhang; Jiali Lin, Liangcai Shen; Fan Zhang, Yingbo Zhu; Libin Zheng
       title: Apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes respond to clenbuterol administration in pig adipose tissue
        date: 2018
       words: 4608
      flesch: 63
     summary: The results showed that apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes respond to clenbuterol administration in pig adipose tissue and their functions may relate to fat accumulation reduction. Apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes respond to clenbuterol administration in pig adipose tissue and their function may contribute to adipose tissue reduction.
    keywords: adipose; analysis; body; clenbuterol; control; genes; group; metabolism; microarray; month; pcr; pigs; protein; time; tissue
       cache: ajpf-742.pdf
  plain text: ajpf-742.txt

        item: #59 of 100
          id: ajpf-745
      author: Kan He; Fan Yang; Minghui Wang; Qishan Wang; Yuchun Pan; Yufang Ma
       title: Identification of pig reproductive QTL genes based on gene set enrichment analysis of mouse microarray dataset
        date: 2018
       words: 4197
      flesch: 52
     summary: Totally, less pig genes were located in reported QTL regions than mouse identified pathway genes, which can ensure the accuracy of targets for pig reproduction. Full Length Research Paper Identification of pig reproductive QTL genes based on gene set enrichment analysis of mouse microarray dataset Kan He1,2, Fan Yang1,2, Minghui Wang1,2, Qishan Wang1,2, Yuchun Pan1,2 and Yufang Ma1,2* 1 School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China.
    keywords: analysis; chromosome; et al; genes; mouse; number; pathway; pig; qtl; reproductive; traits
       cache: ajpf-745.pdf
  plain text: ajpf-745.txt

        item: #60 of 100
          id: ajpf-746
      author: A. O. K. Adesehinwa; O. O. Obi; B. A. Makanjuola; O. O. Oluwole; M. A. Adesina
       title: Growing pigs fed cassava peel based diet supplemented with or without Farmazyme® 3000 proenx: Effect on growth, carcass and blood parameters
        date: 2018
       words: 3755
      flesch: 64
     summary: The aim of this study therefore, is to determine the effect of cassava peel supplemented with or without Farmazyme 3000 proenx as a replacement for maize in the diets of growing pigs on the growth, some carcass traits, serological and hea- matological indices of growing pigs. The dressing percentage of the pigs were com-parable across the groups showing that, the replacement of maize with cassava peel supplemented with or without the exogenous enzyme in the diets of growing pigs did not affect the resulting cold carcass weights of the pigs when slaughtered (Table 4).
    keywords: cassava; diet; enzyme; farmazyme; maize; peel; pigs
       cache: ajpf-746.pdf
  plain text: ajpf-746.txt

        item: #61 of 100
          id: ajpf-748
      author: Chia-Hsuan Chen; Hsiu-Lin Huang; Hsiu-Ya Yang; Shan-Hu Lai; , Neim-Tsu Yen; Mu-Chiou Huang
       title: Mitochondrial genome of Taiwan pig (SUS SCROFA)
        date: 2018
       words: 3845
      flesch: 65
     summary: The com- plete mitochondrial genome of Taiwan Lanyu pigs was sequenced; it is a reference for the sequence difference and phylogenetic relationship of other small-ear strains in the world. The complete sequence of Lanyu pig contains two rRNA (12S and 16S), 22 tRNA and 13 mRNA (Table 2).
    keywords: boar; breeds; dna; lanyu; loop; pig; region; sequence; taiwan; trna; wild
       cache: ajpf-748.pdf
  plain text: ajpf-748.txt

        item: #62 of 100
          id: ajpf-750
      author: Zai-Dong Hua; Xin-Min Zheng; Qing-Xin Wei; Hou-Qiang Xu; Ya-Gang Wang; XiMei Liu,Li Li,Hong-Wei Xiao; Xian-Feng Qiao
       title: Effect of cumulus-oocyte complexes (COCs) culture duration on IN VITRO maturation and parthenogenetic development of pig oocyte
        date: 2018
       words: 3654
      flesch: 64
     summary: The aim of this study was to investigate whether cumu- lus cells improved developmental ability of pig oocytes and screen the best lasting time for oocytes maturation in vitro for production of parthenotes. The best term of oocytes maturation in vitro was assessed based on developmental ability to the cleavage and blastocyst stage.
    keywords: cocs; cumulus; duration; level; maturation; oocytes; rates; vitro
       cache: ajpf-750.pdf
  plain text: ajpf-750.txt

        item: #63 of 100
          id: ajpf-752
      author: P. O. Uaboi-Egbenni; P. O. Bessong; A. Samie; C. L. Obi
       title: Prevalence, haemolysis and antibiograms of Campylobacters isolated from pigs from three farm settlements in Venda region, Limpopo province, South Africa
        date: 2018
       words: 6819
      flesch: 55
     summary: Specific identification by the Mast diagnostic kits 100% 0 20 90% 80 100 100 100 100 100 100 100 100 100 100 80% 80 FARM Z R 70% 20 0 0 0 0 0 0 0 0 0 FARM Z S 60% 66.7 33.3 66.7 66.7 66.7 FARM Y R 50% 100 100 100 100 100 100 100 66.7 FARM Y S 40% 33.3 33.3 33.3 33.3 0 0 0 0 0 0 0 FARM X R 30% 50 50 20% 100 100 100 100 100 100 100 100 100 100 FARM X S 10% 50 50 0% 0 0 0 0 0 0 0 0 0 0 CIP TE CFM IPM VA AMP CN K MET E W NA Antimicrobials to which Campylobacter jejuni were exposed Fig.4: Percentage susceptibility profile of Campylobacter coli exposed to 12 antibiotics (Key: S = Susceptibility; R = Resistance; CIP= Ciprofloxacin; TE= Tetracycline; CFM = Cefexime; IPM = Imipenem; VA= Vancomycin; AMP = Ampicillin; CN= Gentamycin; K= Kanamycin; MET= Methicillin; E=Erythromycin; W= Trimethoprim; NA= Nalidixic acid). 1004bp 1004bp Fig.5: PCR products of amplified DNA from pig Campylobacter isolates aligning at the 1004bp of a 1.9kb ladder (a) pig and (b).
    keywords: c. coli; campylobacter; ciprofloxacin; coli; et al; farm; isolates; jejuni; pigs; prevalence; resistance; strains; study
       cache: ajpf-752.pdf
  plain text: ajpf-752.txt

        item: #64 of 100
          id: ajpf-753
      author: V. G. Papatsiros; E. D. Tzika; P. D. Tassis; D. Kantas; L. C. Filippopoulos; D. S. Papaioannou
       title: Greek experience of the use of phytogenic feed additives in organic pig farming
        date: 2019
       words: 2774
      flesch: 54
     summary: However, over the last decade, the global interest in organic livestock farming and phytogenic agents has attracted the attention of many pharmaceutical companies, and it is estimated that their efficacy and safety will be proved and improved in the near future. (B) Promoting the use of phytogenic feed additives in organic pig farming, as it agrees with today consumer demands for more environmental friendly pig production, supporting at the same time farmers needs for increased and cost effective production. Phytogenic feed additives are plant- derived products used in animal feeding to improve the performance of agricultural livestock.
    keywords: additives; et al; farming; feed; growth; pig; pigs; use
       cache: ajpf-753.pdf
  plain text: ajpf-753.txt

        item: #65 of 100
          id: ajpf-757
      author: Suchitra Muenthaisong; Andras Dinnyes; Tshimangadzo Lucky Nedambale
       title: Review of somatic cell nuclear transfer in pig
        date: 2018
       words: 5175
      flesch: 62
     summary: In the case of chemical activation, the oocytes were exposed to the substrates such as cytochalasin B (Li et al., 2000; Park et al., 2002; Hoshino et al., 2005) to prevent the extrusion of the second polar body, cycloheximide (Lee et al., 2003a) or 6- dimethylaminopurine (DMAP; de la Fuente and King, 1998; Hölker et al., 2005) to inhibit the protein kinase after an induced calcium transient to promote activation or ionomycin (Betthauser et al., 2000; Boquest et al., 2002) that it forms a complex with calcium ions and transports through the plasma membrane and it can also stimulate calcium and induce a calcium influx similar electrical activation (Morgan and Jacob, 1994). Many strategies to introduce the donor cell into cytoplasm of the recipient cytoplasm such as transferred by electrofusion (Polejaeva et al., 2000), by piezo-microinjection of isolated donor nuclei (Onishi et al., 2000), and also by whole cell injection (Lee et al., 2003b).
    keywords: cell; culture; development; donor; embryos; et al; lee; nuclear; oocytes; pig; pigs; porcine; production; reprod; scnt; transfer; vitro
       cache: ajpf-757.pdf
  plain text: ajpf-757.txt

        item: #66 of 100
          id: ajpf-759
      author: Jinlong Huo; Pei Wang; Yongwang Miao; Hailong Huo; Yangzhi Zeng; Heng Xiao
       title: Isolation, sequence identification and tissue expression profile of a novel ribokinase gene (RBKS) from Chinese Banna mini-pig inbred line (BMI)
        date: 2018
       words: 4026
      flesch: 57
     summary: Analysis by RT-PCR showed that BMI RBKS gene was over-expressed in ovary and lung, moderately expressed in spleen, nerve fiber, large intestine and diencephalon, weakly expressed in heart, skin, muscle, small intestine, midbrain, kidney and fat, while almost silent in other five tissues. The objective of this study was to isolate the full length coding sequence of BMI RBKS gene according to the conserved sequence information of cattle or other mammals and highly homologous swine ESTs sequence information, conduct sequence analysis and some necessary function analysis of established nucleotide sequence, and finally examine the expression in a range of BMI tissues.
    keywords: analysis; bmi; bmi rbks; expression; figure; gene; human; pcr; pig; protein; rbks; sequence
       cache: ajpf-759.pdf
  plain text: ajpf-759.txt

        item: #67 of 100
          id: ajpf-762
      author: Dušan Živković; Zorica Radulović; Stevica Aleksić; Marija Perunović; Nikola Stanišić; Čedomir Radović
       title: Chemical, sensory and microbiological characteristics of Sremska sausage (traditional dry-fermented Serbian sausage) as affected by pig breed
        date: 2019
       words: 5843
      flesch: 63
     summary: Full Length Research Paper Chemical, sensory and microbiological characteristics of Sremska sausage (traditional dry-fermented Serbian sausage) as affected by pig breed Dušan Živković1*, Zorica Radulović1, Stevica Aleksić 2, Marija Perunović1, Slaviša Stajić1, Nikola Stanišić2, Čedomir Radović2 1 University of Belgrade, Faculty of Agriculture, Department of Food Technology, Nemanjina 6, 11 080 Belgrade, Serbia. Sremska sausage is today produced from the meat of modern pig breeds.
    keywords: day; days; et al; meat; ripening; sausage; sremska; variant
       cache: ajpf-762.pdf
  plain text: ajpf-762.txt

        item: #68 of 100
          id: ajpf-765
      author: Lifu Zhao , Jianzhou Li , Guoliang Lv , Anye Zhang , Pengcheng Zhou , Ying Yang; Xiaoping Pan , Xiaopeng Yu , Yimin Zhang , Shusen Zheng, Yu Chen , Yuemei Chen; Chengbo Yu , Weibo Du , Tao Song , Jiansheng Xu , Yang Yu , Lanjuan Li
       title: Evaluation of a reversibly immortalized human hepatocyte line in bioartificial liver in pigs
        date: 2019
       words: 6352
      flesch: 61
     summary: Novel immortalized human fetal liver cell line, cBAL111, has the potential to differentiate into functional hepatocytes. In vitro study of alginate-chitosan microcapsules: an alternative to liver cell transplants for the treatment of liver failure.
    keywords: bal; bioreactor; cells; et al; failure; fhf; figure; group; hepatic; hepatocytes; hepli-4; human; liver; pigs; sham; survival; treatment
       cache: ajpf-765.pdf
  plain text: ajpf-765.txt

        item: #69 of 100
          id: ajpf-770
      author: Lizhou Tang; Long Yu , Jiangang Chen , Junjie Wang , Mei Ma , Weidong Lu; Tongzuo Zhang
       title: Sequences polymorphism and variation of major histocompatibility complex DRB exon 2 of black Dahe pig
        date: 2019
       words: 3225
      flesch: 61
     summary: As a crossbreed hybridized by Chinese Dahe pig and England Yorkshire pig, black Dahe pig has been formally approved as an endemic new species by the National Agriculture Ministry of China, and distributed on districts of Dahe-Yingshang towns in Qujing city of Yunnan province. Accepted 22 November, 2018 DNA sequences of swine leukocyte antigens (SLA) DRB exon 2 from five populations were used to investigate genetic polymorphism of black Dahe pig in Yunnan province of China.
    keywords: acid; amino; codon; dahe; drb; exon; gene; pig; sites; sla; usage
       cache: ajpf-770.pdf
  plain text: ajpf-770.txt

        item: #70 of 100
          id: ajpf-774
      author: Mohd Hafrizal Azmi, Fakhrul Zaman Rokhani, Raja Syamsul Azmir Raja Abdullah; M. Iqbal Saripan
       title: Improving the quality of pigskin leather texture images using enhanced image processing
        date: 2019
       words: 3154
      flesch: 58
     summary: Pixel intensity for the local-global output image and proposed method output image. Key words: Digital image processing, pig skin images, binarization, local global analysis, histogram.
    keywords: block; illumination; image; mean; method; value
       cache: ajpf-774.pdf
  plain text: ajpf-774.txt

        item: #71 of 100
          id: ajpf-776
      author: Jingping Lu, Dongsheng Zhao, Gang Zhang, Jie Gen; Qijun Shan
       title: Expression of protein-gene peptide (PGP) 9.5 in myocardial sleeves around the pulmonary artery and aorta in pigs
        date: 2019
       words: 2314
      flesch: 54
     summary: Full Length Research Paper Expression of protein-gene peptide (PGP) 9.5 in myocardial sleeves around the pulmonary artery and aorta in pigs Jingping Lu, Dongsheng Zhao, Gang Zhang, Jie Gen and Qijun Shan* Department of Cardiology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, 210029, Jiangsu Province, China. Myocardial sleeves onto the pulmonary artery (PA) and aorta (Ao) have been recognized as a frequent site for the origin of arrhythmia.
    keywords: artery; pgp9.5; sinus; sleeves; tachycardia
       cache: ajpf-776.pdf
  plain text: ajpf-776.txt

        item: #72 of 100
          id: ajpf-778
      author: Xiangtao Liu; Keshan Zhang, Yongjie Liu, Youjun Shang, Haixue Zheng, Jianhong Guo, Hong Tian, Ye Jin, Jijun He
       title: Analysis of pig serum proteins based on shotgun liquid chromatography-tandem mass spectrometry
        date: 2019
       words: 5258
      flesch: 53
     summary: Separation of serum proteins by one- dimensional SDS-PAGE. In this study, given profile of serum protein from porcine, we identified a total of 392 proteins (Table 1), of which 189 (Table 2) were annotated and classified based on their molecular function or biological process (Figure 4).
    keywords: analysis; app; complement; electrophoresis; factor; figure; gel; mass; peptides; pig; proteins; proteomics; serum; shotgun
       cache: ajpf-778.pdf
  plain text: ajpf-778.txt

        item: #73 of 100
          id: ajpf-779
      author: A. Kumar; R. Bhar,A. B. Mandal; S. K. Mendiratta
       title: Effect of low protein diets and lysine supplementation on growth performance and carcass characteristics of growing pigs
        date: 2019
       words: 4481
      flesch: 67
     summary: Absolute and relative weight (% BW) of trimmed lean cut & organs of pigs under different treatments (T0- Standard protein and lysine as per NRC, 1998, T1- Absolute and relative weight (% BW) of trimmed lean cut and organs of pigs under different treatments are given in Table 3.
    keywords: anim; carcass; et al; lysine; meat; pigs; protein; sci
       cache: ajpf-779.pdf
  plain text: ajpf-779.txt

        item: #74 of 100
          id: ajpf-780
      author: Ekene V. Ezenduka; Chinyere Ugwumba
       title: Antimicrobial residues screening in pigs and goats slaughtered in Nsukka Municipal abattoir, Southeast Nigeria
        date: 2019
       words: 1939
      flesch: 56
     summary: Antimicrobial residues in test samples from slaughtered pigs and goats The results of the antimicrobial residues in tissue samples from slaughtered pigs and goats showed that 12 (30%) of the 40 pig samples and 10 (25%) of 40 goat samples were positive for antimicrobial residue. Antimicrobial residues in pig organs Out of a total of 120 organs from slaughtered pigs comprising 40 samples from each of the three organs (muscle, liver and kidney), eight (20%) muscle samples, four (10%) liver samples and 10 (25%) kidney samples were positive for antimicrobial residues.
    keywords: animals; food; goats; nigeria; pigs; residues; samples
       cache: ajpf-780.pdf
  plain text: ajpf-780.txt

        item: #75 of 100
          id: ajpf-781
      author: Shashi Sharma, Chiranjibi Pantha , Prakash Kumar Yadav , Suman Karki; Nabaraj Poudel
       title: Comparison of growth and reproductive performance of exotic, indigenous and cross breeds of pigs in Nepal
        date: 2019
       words: 4359
      flesch: 68
     summary: RESULT Growth performance of different pig breeds at RARS, Tarahara Geometric means of body weight growth of different pig breeds at RARS, Tarahara has been presented in Table 1. Reproductive performance of different pig breeds at RARS, Tarahara Geometric means of reproductive performance of different pig breeds at RARS, Tarahara has been presented in Table 3.
    keywords: breed; days; hampshire; hurrah; litter; nagpuri; pakhribas; weight
       cache: ajpf-781.pdf
  plain text: ajpf-781.txt

        item: #76 of 100
          id: ajpf-782
      author: Zhen Cao; Xin Di Liao; Juan Boo Liang; Yin Bao Wu; Bin Yu
       title: Diversity of methanogens in the hindgut of grower and finisher pigs
        date: 2019
       words: 4616
      flesch: 62
     summary: Key words: Methanogen, pig, Shannon diversity index, polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Although methanogenic archaea community in pig feces and in anaerobic bioreactors fed with pig feces were studied using different molecular techniques (Ufnar et al., 2007; Liu et al., 2009; Zhu et al., 2011; Mao et al., 2011), we do not know of any published data on diversity of methanogens in different segments of larger intestine (the major site of feed fermentation in pigs) of pig using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE).
    keywords: dgge; diversity; fiber; hindgut; index; methanogens; number; p<0.05; pigs; shannon
       cache: ajpf-782.pdf
  plain text: ajpf-782.txt

        item: #77 of 100
          id: ajpf-783
      author: Abonyi, F. O.1; Omeh C.V.O; Machebe, N. S.2
       title: Neonatal mortality of pigs in Nsukka, Southeast Nigeria
        date: 2019
       words: 3971
      flesch: 61
     summary: Neonatal pig mortality in pig farms surveyed in Nsukka Southeast Nigeria (n = 40). This study was conducted to investigate the causes of neonatal mortality among pig farms in Nsukka Local Government area of Enugu State, Nigeria.
    keywords: area; days; farms; mortality; nigeria; nsukka; pig; piglets; pigs; study
       cache: ajpf-783.pdf
  plain text: ajpf-783.txt

        item: #78 of 100
          id: ajpf-784
      author: Ewa Skrzypczak, Karolina Szulc , Monika Demkowicz , Damian Knecht, Anna JankowskaMąkosa , Janusz T. Buczyński; Marek Babicz
       title: The influence of the different content of protein fractions in sows’ milk in piglet rearing
        date: 2020
       words: 3264
      flesch: 66
     summary: Polyacrylamide gel with milk protein fractions. Therefore, investigation of the correlation between sows’ milk protein fractions and results of piglet rearing is justified.
    keywords: colostrum; fractions; lsm; milk; piglets; protein; sows
       cache: ajpf-784.pdf
  plain text: ajpf-784.txt

        item: #79 of 100
          id: ajpf-785
      author: Chao Wang, Lian-Long Liu, Ai-Ting Zhang, Peng Xie, Jian-Jun Lu; Xiao-Ting Zou
       title: Antibacterial effects of zinc oxide nanoparticles on Escherichia coli K88
        date: 2020
       words: 4185
      flesch: 61
     summary: Full Length Research Paper Antibacterial effects of zinc oxide nanoparticles on Escherichia coli K88 Chao Wang, Lian-Long Liu, Ai-Ting Zhang, Peng Xie, Jian-Jun Lu* and Xiao-Ting Zou* Institute of Feed Science, College of Animal Science, Zhejiang University, Key Laboratory of Molecular Animal Nutrition, Ministry of Education, Hangzhou Zhejiang Province, People’s Republic of China 310058. This study was conducted to evaluate the antibacterial effects of zinc oxide nanoparticles in vitro.
    keywords: activity; afm; coli; et al; k88; nanoparticles; oxide; oxide nanoparticles; zinc; zinc oxide
       cache: ajpf-785.pdf
  plain text: ajpf-785.txt

        item: #80 of 100
          id: ajpf-790
      author: D. L. Lan, J. P. Gu, R. Xing, C. L. Yuan, L. Cui, X. G. Hua; Z. B. Yang
       title: Molecular cloning and phylogenetic analysis of the E gene of transmissible gastroenteritis virus (TGEV) isolated in China
        date: 2020
       words: 2194
      flesch: 60
     summary: E gene is a small structural gene that encodes an 82 amino acid membrane-associated protein called E protein (formerly called sM)(Baudoux et al., 1998). complete E gene sequence of TGEs-1 strain was 249 bp (GenBank accession number: GU250738).
    keywords: china; gene; strain; tgev
       cache: ajpf-790.pdf
  plain text: ajpf-790.txt

        item: #81 of 100
          id: ajpf-792
      author: Maria Babetsa1,2, Vassilios Sandalakis4,5, Christina Vougidou , Antonios Zdragas , Afroditi Sivropoulou , Anna Psaroulaki; Loukia V. Ekateriniadou
       title: Tetracycline resistance genes in Pasteurella multocida isolates from bovine, ovine, caprine and swine pneumonic lungs originated from different Greek prefectures
        date: 2019
       words: 4372
      flesch: 55
     summary: Monitoring and source tracking of tetracycline resistance genes in lagoons and groundwater adjacent to swine production facilities over a 3-year period. Phylogenetic tree of tetH gene.
    keywords: dna; gene; isolates; multocida; pasteurella; plasmid; resistance; sequence; strains; tetb; teth; tetracycline
       cache: ajpf-792.pdf
  plain text: ajpf-792.txt

        item: #82 of 100
          id: ajpf-793
      author: Lushaikyaa Allam , David Ogwu , Rowland Ibrahim Shehu Agbedea, Anthony Kojo Bedu Sackey
       title: Posterior paresis in pregnant gilts experimentally infected with Trypanosoma brucei
        date: 2020
       words: 2728
      flesch: 62
     summary: Mean potassium levels of control and T. brucei infected gilts. The effect of Trypanosoma brucei infection on reproductive efficiency in gilts (n=12) was conducted.
    keywords: animals; brucei; figure; gilts; infected; infection; levels; trypanosoma
       cache: ajpf-793.pdf
  plain text: ajpf-793.txt

        item: #83 of 100
          id: ajpf-794
      author: Shujie Wang, Sen Hu , Jiamin Jin, Yonggang Liu , Gang Wang , Yabin Tu , Chenggang Jiang , Xuehui Cai, Xiuying Zhang
       title: Phylogenetic and pathogenetic analysis of Streptococcus suis serotype 7 strain HW07 isolated from diseased pig in China
        date: 2020
       words: 3254
      flesch: 61
     summary: Molecular and phylogenetic analysis for the recA gene of HW07 isolate showed that it joins to the I group cluster of S. suis strains, the predominant genotype in China. The presence of S. suis was confirmed by PCR with S. suis gdh gene primers (Okwumabua et al., 2003):
    keywords: analysis; gene; hw07; hw07 isolate; isolate; reca; sequence; strain; suis
       cache: ajpf-794.pdf
  plain text: ajpf-794.txt

        item: #84 of 100
          id: ajpf-795
      author: Nagendra Nath Barman, Debojyoti Borkotoky , Biswajyoti Borah; Anjan Jyoti Nath , Papiya Das, Durlav Prasad Borah
       title: Seasonal emergence of swine erysipelas in hilly state Nagaland, Northeast India
        date: 2020
       words: 2696
      flesch: 55
     summary: All affected pigs w ere also reported to be infested w ith pig louse Haemat opinus suis. Virological investigation Tissue samples w ere processed for demonstration of classical sw ine fever using single step Reverse transcription poly merase chain reaction ( RT- PCR)
    keywords: ere; erysipelas; erysipelothrix; india; isolates; nagaland; pcr; pigs; rhusiopathiae; swine
       cache: ajpf-795.pdf
  plain text: ajpf-795.txt

        item: #85 of 100
          id: ajpf-796
      author: Peter Ogweng, Charles Masembe , Johnson Francis Mayega , Ibrahim Keeya , Charles Tumuhe , Rodney Okwasiimire and Vincent Muwanika
       title: Involvement of key stakeholders in controlling animal diseases in rural settings: Experiences with African swine fever in Uganda
        date: 2019
       words: 7709
      flesch: 49
     summary: Mukono District is the only district in Uganda, which is piloting a community initiated and monitored ASF control program where ASF stakeholders implement biosecurity measures aimed at ASF control. The categorization was in respect to the stakeholder’s level of agreement with the use of biosecurity measures in ASF control, power, and influence in implementing ASF control measures in Mukono (Table 2).
    keywords: animal; asf; asf control; biosecurity; community; control; district; farmers; groups; influence; leaders; level; measures; mukono; pig; pigs; stakeholder; uganda
       cache: ajpf-796.pdf
  plain text: ajpf-796.txt

        item: #86 of 100
          id: ajpf-797
      author: Munyaneza Celestin1*, Nyiramuhire Valentine1 , Mubashankwaya Isaac1,2 , Munyandamutsa Fabrice , Ndisanze Oscar , Bagaragaza François, Mujyambere Jean Marie Vianey
       title: Factors influencing success of artificial insemination of pigs using extended fresh semen in rural smallholder pig farms of Rwanda
        date: 2020
       words: 5601
      flesch: 55
     summary: household compared to widow and single household headed farms could be explained by the fact that the married have more financial means and are more responsible, compared to the widows and single, which enable them to improve pig farm management and result in better reproduction performances. However, the study was conducted in an organized farm, where a large number of factors, particularly socio- economic and management factors were controlled compared to smallholder pig farms in rural areas.
    keywords: conception; et al; factors; farms; insemination; number; pig; pigs; semen
       cache: ajpf-797.pdf
  plain text: ajpf-797.txt

        item: #87 of 100
          id: ajpf-798
      author: Neli Vilhelmova-Ilieva , Ivo Sirakov , Remi Jacquet , Stephane Quideau, Angel S. Galabov
       title: Antiviral activities of ellagitannins against bovine herpesvirus-1, suid alphaherpesvirus-1 and caprine herpesvirus-1
        date: 2022
       words: 3414
      flesch: 53
     summary: Animal Viruses. Although some cases have been reported in humans (Mravak et al., 1987; Skinner et al., 2001) and that this virus has limited zoonotic potential (Khan et al., 2013), SuHV-1 to some extent has social importance, as well.
    keywords: activity; effect; ellagitannins; replication; strain; suhv-1; values; virus
       cache: ajpf-798.pdf
  plain text: ajpf-798.txt

        item: #88 of 100
          id: ajpf-799
      author: Leo Daniel Ojabo; Moses Ukwu Enya
       title: Appraisal of management and biosecurity practices on pig farms in Makurdi, Benue State, North Central Nigeria
        date: 2021
       words: 5202
      flesch: 56
     summary: Full Length Research Paper Appraisal of management and biosecurity practices on pig farms in Makurdi, Benue State, North Central Nigeria Leo Daniel Ojabo* and Moses Ukwu Enya Department of Animal Health and Production, College of Veterinary Medicine, Federal University of Agriculture, Makurdi, Benue State, Nigeria. The role of biosecurity at farm level is to reduce the risk of introduction of diseases in pig farms and prevent the disease transmission between animals on farms.
    keywords: animal; benue; biosecurity; disease; fao; farmers; farms; nigeria; pig; practices; production; state; study
       cache: ajpf-799.pdf
  plain text: ajpf-799.txt

        item: #89 of 100
          id: ajpf-800
      author: Abagale F. K.; Alazuga I. N. A; Osei A. R.
       title: Shea waste slurry as an organic soil amendment of tropical soils in the Tamale Metropolis, Northern Ghana
        date: 2022
       words: 7378
      flesch: 64
     summary: Table 4 presents changes in soil %N content due to the influence of SWS. Key words: Shea waste slurry (SWS), organic soil amendment, tropical soil, plant nutrients.
    keywords: anova; application; concentration; kad; kan; levels; plant; shea; site; soil; study; sws; table
       cache: ajpf-800.pdf
  plain text: ajpf-800.txt

        item: #90 of 100
          id: ajpf-805
      author: John Dafaar Damsere; Michael Boateng
       title: The response of pigs to diets containing varying levels of cocoa placenta meal (CPM) supplemented with an exogenous enzyme complex
        date: 2022
       words: 5131
      flesch: 62
     summary: Parameter (kg) 0% 5% 10% 15% 20% SEM p- value CPM CPM + CPM + CPM + CPM + Initial weight 15.5 15.3 15.4 15.6 15.4 0.05 1.00 Final weight 70.0 69.3 69.7 69.5 70.2 0.16 0.91 Duration of trial, days 84.0 c 92.4 bc 107 ab 105 abc 116 a 5.66 0.04 Daily feed intake 1.87 1.72 1.75 1.72 1.64 0.04 0.77 Daily weight gain 0.65 a 0.60 ab 0.51 bc 0.52 bc 0.48 c 0.03 0.02 Feed conversion ratio 2.87 bc 2.84 c 3.33 a 3.34 a 3.41 a 0.12 0.001 Feed cost, € 0.26 0.24 0.23 0.22 0.20 0.01 - Feed cost/kg gain, € 0.74 0.70 0.77 0.75 0.68 0.02 0.10 a, b, c- Means on the same row bearing different superscripts are significantly different (p ˂ 0.05). The FCR values obtained implied that pigs on 0% CPM diet utilized their feed more efficiently (p = 0.001) than those on the 10, 15 and the 20% CPM + diets although the FCR was similar to the 5% CPM + diet.
    keywords: cocoa; cost; cpm; diets; enzyme; feed; pigs; table; values; weight
       cache: ajpf-805.pdf
  plain text: ajpf-805.txt

        item: #91 of 100
          id: ajpf-810
      author: Taiwo Omodele, Isaiah Annayochukwu Okere, Mutiu Olakunle Oladele-Bukola, Adeboye Joseph Omole ,Ajoke Oyegbami
       title: Application of GIS in pig production system in Nigeria
        date: 2023
       words: 3815
      flesch: 54
     summary: Social factors that could influence pig production in Nigeria include a general preference for ruminant meat and lack of incentives for investing in large scale pig production due to economic, religious, political and climatic factors. Other social factors that have militated against pig production in Nigeria include the belief by the general populace that pigs are dirty and constitute a health hazard.
    keywords: farms; figure; medium; nigeria; pig; pigs; production; proportion; scale; states
       cache: ajpf-810.pdf
  plain text: ajpf-810.txt

        item: #92 of 100
          id: ajpf-811
      author: Vinícius de Oliveira Rezende, Luís César Dias Drumond , André Mundstock Xavier de Carvalho, Regina Maria Quintão Lana, Marcos Vieira de Faria
       title: Grass production Tifton 85 and nutrient extraction with swine wastewater doses
        date: 2023
       words: 7446
      flesch: 65
     summary: Crescimento e composição bromatológica de Tifton 85 e Vaquero em pastagens fertirrigadas. Which with the application of SW doses, the amount of added K + was high than extracted by Tifton 85 (Figure 3c), favoring an increase in the levels of K + in the soil (Table 4).
    keywords: accumulation; application; doses; et al; figure; grass; matter; nutrients; production; soil; swine; table; tifton
       cache: ajpf-811.pdf
  plain text: ajpf-811.txt

        item: #93 of 100
          id: ajpf-814
      author: Okenmuo F. C., Odii O. U. and Okolo C. C.
       title: Short-term amelioration of soil properties and maize yield enhancement using animal wastes in degraded hydromorphic soils of Southeastern Nigeria
        date: 2023
       words: 4709
      flesch: 62
     summary: RESULTS AND DISCUSSION Chemical composition of amendments used for the study Table 1 shows the chemical composition of the animal wastes used for soil amendment. Soil amendments: Impacts in biotic systems.
    keywords: amendments; animal; manure; nigeria; plots; properties; soil; total; wastes; yield
       cache: ajpf-814.pdf
  plain text: ajpf-814.txt

        item: #94 of 100
          id: ajpf-815
      author: Marina A. Padilla, Isabela C. Simoni, Verônica Moreira H. Hoe , Maria Judite B. Fernandes , Clarice W. Arns , Juliana R. Brito , João Henrique G. Lago
       title: In vitro antiviral activity of Brazilian Cerrado plant extracts against animal and human herpesviruses
        date: 2023
       words: 6414
      flesch: 58
     summary: Antiviral activity of plant extracts against aphovirus, pseudorabies virus and pestivirus in cell cutures. Figure 1 shows the antiviral activity of extract from B. intermedia at 8 set concentrations against the three viruses showing that treatment with B. intermedia extract resulted in reduced viral titers in dose-response curves.
    keywords: activity; antiviral; cells; cerrado; concentration; effect; equine; et al; extracts; herpesvirus; hsv-1; intermedia; mncc; plants; suhv-1; type; vii
       cache: ajpf-815.pdf
  plain text: ajpf-815.txt

        item: #95 of 100
          id: ajpf-818
      author: Tangriani Simioni Assmann, Alceu Luiz Assmann , Laércio Ricardo Sartor, Talyta Zortéa1
       title: Soil nitrate, phosphorus and potassium concentration after four years of liquid swine manure application on Tifton 85
        date: 2023
       words: 4961
      flesch: 60
     summary: Soil ammonium concentration as a function of LSM application rates (Figure 2A) and for different soil depths (Figure 2B). Soil potassium concentration at the depths of 0-10, 10-20, 20-40 and 40-60 cm, as a function of the 0, 30, 60, 90, 120, and 180 m 3 ha -1 of LSM application rates.
    keywords: application; concentration; et al; figure; lsm; no3; production; rates; soil; solo; tifton
       cache: ajpf-818.pdf
  plain text: ajpf-818.txt

        item: #96 of 100
          id: ajpf-820
      author: Kagambèga A., Bouda S. C., Bako E. , Cissé H. , Barro N, Haukka K.
       title: Salmonella diversity and antimicrobial resistance in Burkina Faso: An investigation of strains from various sources
        date: 2023
       words: 6653
      flesch: 62
     summary: There are two mechanisms in which Salmonella resistance to chloramphenicol is conferred: (i) by the plasmid-mediated enzymes called chloramphenicol acetyltransferases (CAT) or nonenzymatic chloramphenicol resistance gene cm1A and (ii) Efflux pump in which the antibiotic is pumped out of the cell. This study investigates the antimicrobial resistance and distribution of Salmonella serotypes isolated from diverse sources in Burkina Faso.
    keywords: animals; antimicrobial; burkina; cattle; derby; enterica; faso; food; humans; poultry; resistance; salmonella; serotypes; str; strains; sul; tet; typhimurium
       cache: ajpf-820.pdf
  plain text: ajpf-820.txt

        item: #97 of 100
          id: ajpf-822
      author: Kagambèga A., Bouda S. C. , Bako E. , Cissé H., Barro N., Haukka K
       title: Salmonella diversity and antimicrobial resistance in Burkina Faso: An investigation of strains from various sources
        date: 2023
       words: 6653
      flesch: 62
     summary: There are two mechanisms in which Salmonella resistance to chloramphenicol is conferred: (i) by the plasmid-mediated enzymes called chloramphenicol acetyltransferases (CAT) or nonenzymatic chloramphenicol resistance gene cm1A and (ii) Efflux pump in which the antibiotic is pumped out of the cell. This study investigates the antimicrobial resistance and distribution of Salmonella serotypes isolated from diverse sources in Burkina Faso.
    keywords: animals; antimicrobial; burkina; cattle; derby; enterica; faso; food; humans; poultry; resistance; salmonella; serotypes; str; strains; sul; tet; typhimurium
       cache: ajpf-822.pdf
  plain text: ajpf-822.txt

        item: #98 of 100
          id: ajpf-824
      author: Talita Dantas Pedrosa, Henrique Takyiuki Ozima, Roselene Maria Schneider , Adilson Pacheco de Souza, Ednaldo Antonio de Andrade, Luciana Vieira Mattos
       title: Assessing nutrient leaching in red-yellow latosol: The role of swine water and irrigation water reuse
        date: 2023
       words: 5357
      flesch: 61
     summary: Table 3 shows the interactions of irrigation water rates and reused water rates, observing that the leached volume increased with an increase rate, regardless of the wastewater percentages applied. The experimental design is a randomized block subdivided into a According to Barros et al. (2009), the determination of the reference evapotranspiration (ET0) by Class A tank factorial plot of 3 x 3 x 4 (application rates x irrigation water rates x provides overestimation even when Kp is regionally collection times), with three repetitions.
    keywords: concentration; etc; irrigation; rates; soil; water
       cache: ajpf-824.pdf
  plain text: ajpf-824.txt

        item: #99 of 100
          id: ajpf-825
      author: Vincent Niyiragira; Kugonza Donald Rugira; Hirwa Claire D’Andre
       title: Optimizing pig artificial insemination with imported fresh semen: Key success factors
        date: 2023
       words: 4747
      flesch: 64
     summary: This study was conducted to assess the factors that affect pig litter size, proportion of live pigs at birth, number of inseminations per conception, and efficiency of artificial insemination. The main factors assessed were sow breed (n = 2), sire breed (n = 3), sow parity (n = 7) and insemination method (n = 2).
    keywords: boar; breed; insemination; litter; number; parity; piglets; pigs; semen; size; sows
       cache: ajpf-825.pdf
  plain text: ajpf-825.txt

        item: #100 of 100
          id: ajpf-826
      author: N. Okoli; Ceron-Romero; Y. Meng; M. O. Ezekwe
       title: Impact of pasture-raised pork farming on genes regulating lipid metabolism and meat quality
        date: 2023
       words: 4983
      flesch: 60
     summary: This study was to determine the effect of grazing systems on meat quality, carcass traits, and on lipid metabolism gene expressions. Key words: Pigs, lipid metabolism, meat quality, real-time polymerase chain reaction (PCR).
    keywords: carcass; control; et al; expression; fatty; genes; lipid; meat; pasture; pigs; pparα; quality; science
       cache: ajpf-826.pdf
  plain text: ajpf-826.txt