




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 3 (1), pp. 001-009, January, 2015. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

Full Length Research Paper 

 

An efficient secretion of the protein fused to the AgfA 
signal sequence in Salmonella 

 
Ho Young Kang1, Ki Hwan Moon1, Se Won Kim2, Jeong Dong Bahk 2, Sang Wan Gal3, Kwang-

Keun Cho4, Chul-Wook Kim4, John Hwa Lee5 and Sam Woong Kim6*  
1
Department of Microbiology, College of Natural Sciences, Pusan National University, Busan 609-735, South Korea. 
2
Division of Applied Life Sciences (BK21-EBNCRC), Graduate School of Gyeongsang National University, Jinju 660-701, 

Korea. 
3
Department of Pharmaceutical Engineering, Gyeongnam National University of Science and Technology, 150 Chilam- 

dong, Jinju 660-758, Korea. 
4
Department of Animal Resources Technology, Gyeongnam National University of Science and Technology, 150 Chilam- 

dong, Jinju, Gyeongnam, 660-758, South Korea. 
5
College of Veterinary Medicine, Chonbuk National University, Chon-ju 561-756, South Korea. 

6
Swine Science and Technology Center, Gyeongnam National University of Science and Technology, 150 Chilam-dong, 

Jinju, Gyeongnam, 660-758, South Korea. 
 

Accepted 02 December, 2014 
 
Signal sequence (SS) of surface or secreting proteins plays an important function for protein secretion in bacterial 
system. The SS of various proteins may mediate different level of protein excretion yield of the proteins. In order to 

examine the effect of SS types in protein secretion, signal sequences of Bla (– lactamase), AgfA (thin aggregative 
fimbriae A), StfA (Salmonella typhimurium fimbriae A) and OmpW (outer membrane protein W) were selected for the 
secretion of PspA protein which was used as a test protein. The PCR-amplified DNAs corresponding to each SS were 
cloned into the plasmid pYA3342. A primer used in PCR was designed to insert a His6-tag at the C- terminal of SS for 
the convenient detection of expressed SS. The 0.8 kb EcoRI-Hin dIII pspA gene was cloned into the recombinant 
plasmids, resulting pMMP66, pMMP67, pMMP68 and pMMP70. The S. typhimurium strains harboring the recombinant 
plasmids expressed the His6-tagged PspA, demonstrating in-frame fusion of PspA to each Depending upon the type of 
SS, cell lysate as well as secreted PspA of each Salmonella samples was found different. Relatively, S. typhimurium 
containing pMMP67 (carrying AgfA SS) secreted the highest level of PspA than others, and suggested that the AgfA 
SS mediates efficient translocation of the PspA. Conclusively, the AgfA SS mediated secretion system in pMMP67 can 
be used in variety fields required for the high level of protein secretion, especially antigen delivery in recombinant 
attenuated Salmonella vaccines. 
 

Key words: –Lactamase, thin aggregative fimbriae A, outer membrane protein W, Salmonella typhimurium fimbriae A, signal 

sequence, secretion. 

 
INTRODUCTION 

 
The conventional vaccines against pathogenic bacteria 

have been produced to majorly kill these bacteria or act  
 
 
 
*Corresponding author. E-mail: swkim@gntech.ac.kr. Tel: 82-  
55-751-3268. Fax: 82-55-751-3280. 

 
 
 
 
as subunit vaccines (Meeusen et al., 2007). However, the 
manufacturing of these vaccines are very complicated 
from isolation up to the final step. Additionally, the 
prepared vaccines require stable storage to avoid any 
side effects or denaturation. These vaccines are most 
likely administrated to host through syringe, thereby 
making the child to be afraid. One way to resolve these 



 
 
 

 
Table 1. Bacterial strains and plasmids used for this study.  

 
 Strain or plasmid Genotype or phenotype Reference or source 

 Bacterial strains   

 E. coli   

 DH5 endA1 hsdR17 supE44 thi-1 recA1 gyrA relA1   (lacZYA-argF)U169 (  80lacZ  M15) New England Biolabs 

 6212 F
-  -

  80  (lacZYA-argF)endA1recA1hadR17deoRthi-1glnV44gyrA96 relA1  asdA4 Nakayama et al. (1988) 

 Salmonella   

 8554 hisG  asdA16 Kang et al. (2002) 

 Plasmids   

 pGEM-T vector Cloning vector Promega 

 pYA3342 Asd pBRori Kang et al. (2002) 

 pYA3493 Derivative  -lactamase signal sequence-based periplasmmic secretion plasmid Kang et al. (2002) 

 pYA3494 A pYA3493 derivative containing pspA gene Kang et al. (2002) 

 pMMP58 A derivative of T vector containing Bla signal sequence (SS) and His-tag This study 

 pMMP59 A Derivative of T vector containing agfA SS and His-tag This study 

 pMMP60 A derivative of T vector containing OmpW SS and His-tag This study 

 pMMP61 A derivative of T vector containing stfA SS and His-tag This study 

 pMMP62 A derivative of pYA3342 containing ompW SS and His-tag This study 

 pMMP63 A derivative of pYA3342 containing stfA SS and His-tag This study 

 pMMP64 A derivative of pYA3342 containing Bla SS and His-tag This study 

 pMMP65 A derivative of pYA3342 containing agfA SS and His-tag This study 

 pMMP66 A derivative of pMMP63 containing pspA gene This study 

 pMMP67 A derivative of pMMP65 containing pspA gene This study 

 pMMP68 A derivative of pMMP64 containing pspA gene This study 

 pMMP70 A derivative of pMMP62 containing pspA gene This study 
 

 

inconveniences is the development of attenuated 
bacterial vaccines. Recombinant attenuated Salmonella 
vaccines have been adapted to elicit mucosal and 
humoral immunities after oral administration. The elicited 
immune responses were augmented when the delivered 
antigen was translocated into cell envelop or out of the 
cells (Kang and Curtiss, 2003; Kang et al., 2002; Kim et 
al., 2007). Multiple methods were applied to translocate 
the foreign antigen from cytosol into at least cell envelop 
or complete secretion (Kim et al., 2007; Wong et al., 
1995). Researchers inserted the target antigen or epitope 
into surface structure molecules such as flagella or 
fimbriae to present the antigen on cell surface (Majander 
et al., 2005a, b; Spreng et al., 1999). However, a limited 
size of the antigen can be inserted into surface molecule 
for stable conformation. Another more convenient way is 
the secretion of the foreign protein into extracellular 
matrix through the use of a signal sequence (SS) 
(Koshland and Botstein, 1980; Li et al., 2008).  

A previous study demonstrated that the PspA antigen 

 

 

was translocated into periplasmic space or outside of the 
cell through the fusion of -lactamase signal sequence 
(Kang et al., 2002) . Although this system has a merit to 
secret the protein to the extracellular matrix, a large 
portion (50%) of the expressed proteins exists still in the 
cytosol. Due to the fact that more secreted antigen elicits 
the better immune responses, it is needed to develop a 
new efficient protein secretion system in live vaccine 
mediated antigen delivery.  

This study aimed to develop an efficient protein 

secretion system in Salmonella. 

 
MATERIALS AND METHODS 
 
Bacterial strains and agents 
 
The bacterial strains, plasmids and oligonucleotides used for this 
study are listed in Tables 1 and 2. Salmonella enterica serotype 
Typhimurium and Escherichia coli were grown at 37°C using Luria-
Bertani (LB) or M9 minimal medium supplemented with 1.5% agar 
(Bertani, 1952). The antibiotics were added in the following 



 
 
 

 
Table 2. Synthetic oligonucleotides used for this study.  

 
Oligonucleotide name Oligonucleotide sequence (5'  3') 

SagfA-F-BspHI TCATGAAACTTTTAAAAGTGGCAG 

SagfA-R-His/EcoRI GAATTCATGGTGATGGTGATGATGGCCGCCGTTATGATTACCGC 

Sbla-F-BspHI TCATGAGTATTCAACATTTCCGTG 

Sbla-R-His/EcoRI GAATTCATGGTGATGGTGATGATGTTCAGCATCTTTTACTTTCA 

SompW-F-BspHI TCATGAAAAAATTTACAGTGGCGG 

SompW-R-His/EcoRI GAATTCATGGTGATGGTGATGATGTCCGGCTTCGTGCGCGAACG 

SstfA-F-BspHI TCATGAATACAGCAGTAAAAGCTG 

SstfA-R-His/EcoRI GAATTCATGGTGATGGTGATGATGACCGGTAAAAGTCACCGTAC 
 

 
concentrations for each culture condition: ampicillin, 100 g/ml; 

streptomycin, 50 g/ml. 

 
DNA manipulations 
 
General DNA manipulations were conducted as described by 
Sambrook et al. (1989). Plasmids were introduced into E. coli 
competent cells by heat-shock with RbCl2 treatment (Hanahan, 
1983) and were introduced into Salmonella competent cells by 
electroporation with 10% glycerol treatment (Sambrook et al., 1989). 
Nucleotide sequencing was conducted by using an ABI 373 
automatic sequencer (PE Applied Biosystems). 

 
Cloning of genes for signal sequence 
 
The DNA regions corresponding to signal peptide of Bla, AgfA, 
OmpW and StfA was PCR-amplified from pYA3493 or S. 

typhimurium 3339 chromosome as a template. The oligonucleotide 
primers used in PCR-amplification were designed to insert restriction 
sites for BspHI and EcoRI (Table 2). The primers were also 
designed to include His 6-epitope at the C-terminal of each signal 
peptide, which allows the detection of expressed signal peptides by 
immunoblot with anti-His6-epitope antibody. PCR reaction conditions 
were as follows: denaturation at 95°C for 30 s, primer annealing at 
the temperature of primer’s melting temperature (Tm) for 30 s, 
polymerization at 72°C for 30 s ~ 3 min depending on the length of 
DNA fragment and a final extension at 72°C for 10 min. The 
amplified DNA fragments were cloned into T-vector (Promega) as a 
temporary step. The BspHI -EcoRI DNA segment isolated from the 
recombinant T-vector was cloned into a plasmid pYA3342 digested 
with NcoI and EcoRI. 

 
SDS-PAGE (polyacrylamide gel electrophoresis) and 

immunoblot 
 
Bacterial culture broth was centrifuged for 10 min at 5,000 x g to 
separate the cells from the culture supernatant. The supernatants 
was collected and further used for the analysis of secreted proteins. 
The precipitated cell pellet was washed twice with 0.85% NaCl and 
then resuspended in 10 mM Tris HCl, pH 7.5. The suspended cells 
were mixed with SDS gel loading buffer and lysed thermally. The 65 

g proteins of total cell lysates were then separated through SDS-
PAGE and the separated bands were visualized by Coomassie 
staining (Sambrook et al., 1989). For the analysis of secreted 
proteins, the cultural supernatant was concentrated for 1 h in ice-
cold TCA (trichloroacetic acid) solution (Hoong et al., 1995; Ma et 
al., 1996) and then 8 µg secreted proteins were separated by SDS- 

 

 
PAGE. For immunoblotting, proteins separated by SDS-PAGE were 
electrophoretically transferred onto the nitrocellulose membranes. 
The immunoblotting was conducted in accordance with the 
protocols established by Sambrook et al. (1989). The PspA protein 
and His6-tagged signal peptides were specifically recognized by the 
use of Xi126 monoclonal antibody (McDaniel et al., 1984) and His6-
tag monoclonal antibody (Southern Biotech), respectively.  

Goat anti-mouse IgG, horseradish peroxidase (HRP) conjugated 

antibody was used as secondary antibody and the 4-choloro-1-

naphthol was used for the substrate of HRP. 

 

RESULTS AND DISCUSSION 
 
Background of construction for new foreign antigen-

carrying systems and the results 
 
Most of the bacteria operate general secretory pathway 
(GSP) to translocate proteins from cytoplasm to peri-
plasmic space, outer membrane or extracellular matrix. 
The SS located at N- terminus of the secreting protein 
leads the translocation of the protein to membrane. In a 
previous study (Kang et al., 2002) a plasmid system 
(pYA3493) was generated for the secretion of proteins 
through GSP. Main idea of the pYA3493 based 
expression system is the fusion of - lactamase SS at the 
N-terminus of expressed proteins. In this study, we 
examined protein secretion capacity by the replacement 
of -lactamase SS with the SS of other proteins in 
pYA3493. The plasmid pYA3493 carries an aspartate 
semialdehyde dehydrogenase (asd) gene, which is 
required for the biosynthesis of m- diaminopimellic acid 
(m-DAP), a component of bacterial cell wall. The “asd” 
gene in pYA3493 complements “Asd” deficiency of 

bacterial hosts, E. coli 6212 and S. typhimurium 8554 
(Table 1). Multicloning sites (MCS) is positioned at the 
downstream sequence of SS sequence to fuse signal 
peptide with the protein of cloned gene. To examine the 
effect of the type of signal peptide for protein secretion, 
various DNA fragments corresponding to the signal 
peptide of -lactamase (Bla), AgfA, OmpW and StfA were 
localized at the upstream of MCS: “bla SS” in pMMP62, 
“agfA SS” in pMMP63, “ompW SS” in pMMP64 and “stfA 
SS” in pMMP65. The C-terminus of each signal peptides 



  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 1. Schematic diagram of strategy for cloning of signal sequence (SS) DNA. The 

signal sequences of Bla (–lactamase), AgfA (thin aggregative fimbriae A), StfA S. 
typhimurium fimbriae A) and OmpW (outer membrane protein W) were used in this study. 
Each PCR- amplified BspHI-Eco RI SS DNA was cloned into pYA3342 digested with NcoI 
and EcoRI. Gray box indicates a His6-tag contained at the C-terminus of each SS. 

 

 

exhibited His6 residues. It is possible to speculate that 

expression of each SS and His6 coding residue were 

regulated by Ptrc promoter. A strategy for preparation of 
these vectors is shown in Figure 1. In E. coli, the - 
lactamase is secreted into periplasmic space through 
type II Sec-dependent secretion system, but in indepen-
dent manner of SecB (Beha et al., 2003). AgfA and StfA, 
major fimbrial proteins of S. typhimurium, Agf and Stf 
fimbriae are secreted into extracellular matrix by type IV 
Sec-dependent secretion system.  

The mechanism of Agf fimbrial protein secretion is 
unknown, whereas Stf fimbrial proteins are secreted by 
similar manner to type II Sec-dependent pathway 
(Humphries et al., 2003). The OmpW (outer membrane 
protein W) is translocated through type II Sec- and SecB-
dependent pathway (Driessen et al., 2001; Koch et al., 

 
 

 

2003). 
 

 

Identification of foreign antigen expression by PspA 

protein 
 
The PspA protein (Streptococcus pneumoniae surface 

protein A) was selected as a testing protein, for protein 
secretion through the system developed in this study 
(Briles et al., 1998). A 765 bp EcoRI- HindIII pspA gene 

isolated from pYA3494 was ligated with the plasmids 
pMMP62, pMMP63, pMMP64 or pMMP65 digested with 
EcoRI and HindIII (Figure 2). The recombinant DNAs 
were transformed into E. coli x6212 (Kang et al., 2002). 
Furthermore, the presence of recombinant plasmids were 
confirmed by analyses of restriction enzyme digestion 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. Genetic maps of recombinant plasmids. The  
physical maps of each recombinant plasmid are 
indicated with their representative restriction enzyme 
sites: (A) Basal vector, (B) pMMP62, (C) pMMP63, (D) 
pMMP64 and (E) pMMP65. The Ptrc promoter region, 
ribosome binding site (RBS), each SS, His6-epitope 
and multi-cloning sites (MCS) are revealed in enlarged 
box. Unique enzyme sites in MCS are designated by 
underlined bold letters. Ptrc, trc promoter; 5ST1T2, 5S 
rRNA terminator; “asd”, aspartate semialdehyde 
dehydrogenase gene; SS, OmpW SS (B), StfA SS (C), 
Bla SS (D) and AgfA SS (E). 

 

 

and nucleotide sequencing, and were finally designed as 
pMMP66, 67, 68 and 70 (Table 1). The level of expressed 
PspA protein in the S. typhimuium 8554 host was 
examined by immunoblotting. A monoclonal antibody 
Xi126 (McDaniel et al., 1984) was used to detect PspA 

protein specifically. An anti-His6-epitope antibody 
(SantaCruz Biotechnology, Inc.) raised in mouse was 

used to detect expressed protein against His6-tagged 
signal peptide. An anti-mouse IgG conjugated with HRP 

 
 

 

(horseradish peroxidase) (Stressgen Co.) obtained from 
goat was used as a secondary antibodies to recognize 

primary antibodies. The S. typhimuium 8554 carrying 
pYA3494, pMMP66, pMMP67, pMMP68 or pMMP70 

were cultured to OD600 0.8 in LB broth at 37°C. Total cell 

lysate of each sample containing 65 µg of protein was 
subjected for SDS-PAGE analysis. As seen in Figure 3, 
all samples exhibited a major protein bands with 
approximately 37 kDa size. A little size differences of the 



      
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

Figure  3.  Expression  of  PspA in  S.  typhimurium  containing  
recombinant plasmids. S. typhimurium strains harboring pYA3494,  
pMMP66, 67, 68 and 70 were grown in LB broth until exponential 
phase  (0.8  at  OD600).  Equal  amounts  of  cell  lysates  were 
subjected to SDS-PAGE followed by immunoblot analyses with 
specific antibodies for each component. The goat anti-mouse 
conjugated with HRP was used as the 2nd antibodies. (A) SDS- 
PAGE  of  total  lysates.  Separated  bands  were  visualized  by 
Coomassie staining. (B to C) immunoblot of total lysates. His6- 
tagged SS was detected by monoclonal antibody specific for His6- 
tag (B), and expressed PspA protein was detected by monoclonal 
antibody specific for PspA (C). (D) Quantitative analysis of PspA 
protein. Relative immuno-reactive intensities were analyzed by  
imageJ program. Arrow indicates the PspA protein. 

 
 

 

major bands between samples can be explained by the 
size difference of signal peptide which was fused to the 

PspA. The 37 kDa proteins were reacted with anti-His6-

epitope antibody, which confirms that each 37 kDa 
protein contains signal peptide designed in this study. 

The protein of S. typhimuium 8554 harboring pMMP67 
exhibited a faint immune-reactive band, hypothesizing the 

 
 

 

access difficulty of H6-antibody due to protein confor-

mation. As we expected, there was no His6-antibody 

reaction band in sample of S. typhimuium 8554 

harboring pYA3494, which does not carry His6-tagged 
signal peptide. 

Immunoblot analyses with anti-PspA antibody 

demonstrated that the 37 kDa protein seen in all samples 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

Figure 4. Immunoblot of secreted PspA proteins. S. typhimurium  
8554 harboring plasmids were cultured in LB broth until exponential 
phase (0.8 at OD600). Equal amount of cell-free culture supernatant  
were subjected to SDS-PAGE and immunoblot analyses. (A) SDS- 
PAGE analysis. Separated bands were visualized by Coomassie 
staining. (B) Immunoblot of secreted proteins. The PspA protein was 
detected by monoclonal antibody specific for PspA. (C) Quantitative 
analysis of PspA protein. Relative immuno-reactive intensities were  
analyzed by imageJ program. Arrow indicates the PspA protein. 

 

 

is the PspA protein. The highest amount of cell 
associated PspA protein was detected in Salmonella 
containing pYA3494, which was almost 2 fold higher 
levels than that in Salmonella containing pMMP70 
(carrying OmpW SS) . The Salmonella containing 
pMMP67 or pMMP66 expressed PspA 1.5 or 1.3 folds 
higher than Salmonella containing pMMP68. An 
advantage of the system developed in this study is the 
detection of the expressed protein with commercially 

available His6-epitope antibody, without specific antibody 

for the expressed protein. 

 

Identification of secretion ability according to signal 

sequences 
 
The protein expression system developed in this study is 

 
 

 

designed for the secretion of the PspA protein. Each 
signal peptide fused to PspA may lead to the 
translocation of the cytoplasmic PspA to the cell envelop 
or to the outside of the cell. To examine the level of 

protein secretion, the S. typhimuium 8554 carrying 
pYA3494, pMMP66, pMMP67, pMMP68 or pMMP70 

were cultured to OD600 0.8 in LB broth at 37°C. Cell-free 

supernatant of each culture was examined for the 
secreted protein fractions. To eliminate the presence of 
Salmonella cells entirely, culture supernatant after 
centrifugation was filtered through passing 0.2 µm filter. 
The proteins in 1 ml of supernatant were precipitated 
using 10% TCA as described earlier. The precipitated 

pellets after washing twice were resuspended in 60 l of 

SDS loading buffer. 8 g protein of each sample was 
subjected to SDS-PAGE. Parts of samples were 



 
 
 

 

employed for immunoblot analysis after SDS-PAGE. All 
samples exhibited a major protein bands with 
approximately 37 kDa size likely as seen in total lysates 
(Figure 4). 

The 37 kDa proteins were reacted with both anti-His6-  
epitope antibody and anti-PspA antibody, demonstrating 
PspA protein of the 37 kDa protein. Interestingly, a thick 
37 kDa protein band was observed in the secreted 

fraction of S. typhimuium 8554 carrying pMMP67. 
Densitometer analysis of the secreted PspA in each 
sample shows that the secreted PspA in Salmonella 
carrying pMM67 was 1.8 fold amount higher than that in 
Salmonella carrying pMM70 which secrets the protein 
second level. The other three samples, Salmonella 
carrying pYA3494, pMM66 and pMM68 secrets the PspA 
with similar levels. Although the PspA level in total cell 
lysate was similar for pYA3494, pMMP67 and pMMP70 
(Figure 3), the highest amount of secreted PspA was 
detected in the supernatant of Salmonella carrying 
pMM67. This discrepancy is not solely because of 
overexpression of the protein, but it might be due to the 
Agf SS. Thus, we speculate that the AgfA signal peptide 
mediates PspA secretion more efficiently than any other 
signal peptides used in this study. Taken all together, 
since signal sequences play roles as a leader sequence 
and a signal sequence, their existences raise individual 
expression and secretion of protein.  

The efficient protein secretion mediated by AgfA signal 
sequence can extend its utility in various fields. 
Especially, it can be applicable in the antigen delivery of 
recombinant attenuated Salmonella vaccines (Kim et al., 
2009). A previous study suggested that Salmonella 
vaccine secreting foreign antigen induces better immune 
responses than the vaccine localizing the antigen in 
cytoplasm (Kang et al., 2002). Therefore, more secretion 
of the foreign antigen may induce more immune 
responses in Salmonella antigen delivery system. 
 

 

ACKNOWLEDGEMENTS 

 

This work was supported by Priority Research Centers 
Program (2009-0093813) through the National Research 
Foundation of Korea (NRF) funded by the Ministry of 
Education, Science and Technology of Korea and by 
Technology Development Program for (Agriculture and 
Forestry or Food or Fisheries), Ministry for Food, 
Agriculture, Forestry and Fisheries, Republic of Korea. 
 

 

Abbreviations: 
 

SS, Signal sequencel; Bla, -lactamase; AgfA, thin 

aggregative fimbriae A; StfA, Salmonella typhimurium 

fimbriae A; OmpW, outer membrane protein W; GSP, 

general secretion pathway. 

 
 
 
 

 
REFERENCES 

 
Beha D, Deitermann S, Muller M, Koch HG (2003). Export of beta-

lactamase is independent of the signal recognition particle. J. Biol. 
Chem., 278(24): 22161-22167. 

Bertani G (1952). Studies on lysogenesis. I. The mode of phage 
liberation by lysogenic Escherichia coli. J. Bacteriol., 62: 293-300.  

Briles DE, Tart RC, Swiatlo E, Dillard JP, Smith P, Benton KA, Ralph 
BA, Brooks-Walter A, Crain MJ, Hollingshead SK, McDaniel LS 
(1998). Pneumococcal diversity: considerations for new vaccine 
strategies with emphasis on pneumococcal surface protein A (PspA). 
Clin. Microbiol. Rev., 11: 645-657.  

Driessen AJ, Manting EH, van der Does C (2001). The structural basis 
of protein targeting and translocation in bacteria. Nat. Struct. Biol., 
8(6): 492-498. 

Hanahan D (1983). Studies on transformation of Escherichia coli with 
plasmids. J. Mol. Biol., 166: 557-580. 

Hoong YY, Yusof F, Abdullah L (1995). Precipitation of Hevea 
brasiliensis latex proteins with trichliroacetic acid and 
phosphotungstic acid in preparation for the Lowry Protein Assay. 
Analyt. Biohem., 226: 35-43. 

 
Humphries AD, Raffatellu M, Winter S, Weening EH, Kingsley RA, 

Droleskey R, Zhang S, Figueiredo J, Khare S, Nunes J, Adams LG, 
Tsolis RM, Baumler AJ (2003). The use of flow cytometry to detect 
expression of subunits encoded by 11 Salmonella enterica serotype 
Typhimurium fimbrial operons. Mol. Microbiol., 48(5): 1357-1376.  

Kang HY, Curtiss R 3rd (2003). Immune responses dependent on 
antigen location in recombinant attenuated Salmonella Typhimurium 
vaccines following oral immunization. FEMS Immunol. Med. 
Microbiol., 37: 99-104.  

Kang HY, Srinivasan J, Curtiss R 3rd (2002). Immune responses to 
recombinant pneumococcal PspA antigen delivered by live 
attenuated Salmonella enterica serovar Typhimurium vaccine. Infect. 
Immun., 70: 1739-1749.  

Kim SW, Kim YH, Yoo AY, Yu JE, Hur J, Lee JH, Cha JH, Kang HY 
(2007). Development of a protein secretion system with the 
application of Sec dependent protein secretion components. J. 
Microbiol. Biotechnol., 17 (8): 1316-1323.  

Kim SW, Moon KH, Baik HS, Kang HY, Kim SK, Bahk JD, Hur J, Lee JH 
(2009). Changes of physiological and biochemical properties of 
Salmonella enterica serovar Typhimurium by deletion of cpxR and 
lon genes using allelic exchange method. J. Microbiol. Methods, 79  
(3): 314-320.  

Koch HG, Moser M, Muller M (2003). Signal recognition particle-
dependent protein targeting, universal to all kingdoms of life. Rev. 
Physiol. Biochem. Pharmacol., 146: 55-94. 

Koshland D, Botstein D (1980). Secretion of -lactamase requires the 
carboxy end of the protein. Cell, 20: 749-760. 

Li Y, Wang S, Xin W, Scarpellini G, Shi Z, Gunn B, Roland KL, Curtiss 
R 3rd (2008). A sopB deletion mutation enhances the 
immunogenicity and protective efficacy of a heterologous antigen 
delivered by live attenuated Salmonella enterica vaccines. Infect. 
Immun., 76: 5238-5246.  

Ma J, Stoter G, Verweij J, Schellens JH (1996). Comparison of ethanol 
plasma-protein precipitation with plasma ultrafiltration and 
trichloroacetic acid protein precipitations for the measurement of 
unbound platinum concentrations. Cancer Chemother. Pharmacol., 
38: 391-394.  

Majander K, Anton L, Antikainen J, Lang H, Brummer M, Korhonen TK, 
Westerlund-Wikstrom B (2005a). Extracellular secretion of 
polypeptides using a modified Escherichia coli flagellar secretion 
apparatus. Nat. Biotechnol., 23: 475-481.  

Majander K, Korhonen TK, Westerlund-Wikstrom B (2005b). 
Simultaneous display of multiple foreign peptides in the FliD capping 
and FliC filament proteins of the Escherichia coli flagellum. Appl. 
Environ. Microbiol., 71: 4263-4268.  

McDaniel LS, Scott G, Kearney JF, Briles DE (1984). Monoclonal 
antibodies against protease sensitive pneumococcal antigens can 
protect mice from fatal infection with Streptococcus pneumoniae. J. 
Exp. Med., 160: 386-397. 



 
 
 

 
Meeusen EN, Walker J, Peters A, Pastoret PP, Jungersen G (2007). 

Current status of veterinary vaccines. Clin. Microbiol. Rev., 20(3): 
489-510.  

Nakayama K, Kelly SM, Curtiss R 3rd (1988). Construction of an Asd
+
 

expression-cloning vector: stable maintenance and high level 
expression of cloned genes in a Salmonella vaccine strain. 
Bio/Technology, 6: 693-697.  

Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning: a 

laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, 

Cold Spring Harbor, N.Y. 

  
 
 
 

 
Spreng S, Dietrich G, Goebel W, Gentschev I (1999). The Escherichia 

coli haemolysin secretion apparatus: a potential universal antigen 
delivery system in Gram negative bacterial vaccine carriers. Mol. 
Microbiol., 31: 1596-1598.  

Wong RS, Wirtz RA, Hancock RE (1995). Pseudomonas aeruginosa 
outer membrane protein OprF as an expression vector for foreign 
epitopes: the effects of positioning and length on the antigenicity of 
the epitope. Gene, 158: 55-60. 


