




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 3 (4), pp. 001-005, April, 2015. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

 

Full Length Research Paper 

 

Prevalence and antimicrobial susceptibility of 
bacterial pathogens isolates from diseased swine 

in southwest, China 
 

Xu-Ting Li*, Bin Wang, Jin-Liang Li, Fu-Qiang Zeng and Xue Gong 
 

Sichuan Animal Science Academy, Chengdu, China, 610066, China. 
 

Accepted 22 September, 2014 
 

The purpose of this study was to investigate the prevalence of antimicrobial resistance in the clinical 

bacterial isolates from diseased swine in southwest, China during 2009-2010. A total of 504 bacterial 

isolates (19 species) were collected from the 364 clinical samples. The activity of 6-14 antibiotics to each 

bacterial species was examined. The sensitivity was tested by the disk diffusion method and performed 

according to CLSI guidelines in Mueller-Hinton agar. The most common pathogens were Escherichia coli 

(n=154; 30.56%), Staphylococcus spp. (n=110; 21.83%), Enterococcus faecalis (n=58; 11.51%), Klebsiella 

pneumoniae (n=44; 8.73%), Proteus mirabilis (n=43; 8.53%) and Streptococcus suis (n=30; 5.93%). All 

isolates revealed high level of resistance to ampicillin (47.6-100%), amoxicillin (52.6-100%), cephalothin 

(29-100%), norfloxacin (52.6-83.3%), gentamicin (45.1-83.3%) and terramycin (61.9-100%). Moreover, 93% of 

the isolates exhibited multiple drug resistance (MDR; resistance ≥ 3 antimicrobials). Only 

ticarcillin/clavulanate exhibited very high activity against E. coli (98.1%), Staphylococcus spp. (91.9%), K. 

pneumaniae (92.3%) and P. mirabilis (97.2%), respectively. These findings suggest that antimicrobial 

resistance of bacterial pathogens isolates is commonly present among diseased swine in Southwest, 

China, and they also suggest the need for more prudent use of antibiotics by farmers and veterinarians. 
 

Key words: Identification, antimicrobial susceptibility, pathogen, swine. 
 
 
INTRODUCTION 

 
As acute infections and outbreaks of infectious diseases in 

groups or herds become more common, use of an effective 

antimicrobial treatment as early as possible is critically 

important. The empirical treatment is generally based on 

knowledge of the resistance patterns of the different 

bacterial pathogens toward antimicrobial agents used in 

the particular animal species. Uncontrolled usage of 

antimicrobial agents is recognized as the most important 

factor that favors the development and spread of resistant 

microorganisms (Van den Bogaard and Stobberingh, 1999; 

White, 2002). The digestive tracts of  
 
 
 
*Corresponding author. E-mail: lixutingzy@163.com. 

 
 
 
 

 
pigs can harbor antimicrobial-resistant bacteria among the 

commensal flora, which contain a reservoir of antibiotic-

resistance genes potentially transmissible to humans 

through the food chain and environment (Caprioli et al., 

2000). In addition to the human health concerns, 

antimicrobial-resistant pathogens also pose a severe and 

costly health problem in that they may prolong illness and 

decrease productivity through higher morbidity and 
mortality (Yang, 2004). However, data on the prevalence of 

antimicrobial-resistant veterinary pathogens are sparse, 

particularly in Southwest, where animal husbandry was 

more developed than other area.  
Therefore, the purpose of this study was to investigate 

the prevalence of bacterial infection and resistance to 

antimicrobial agents in the clinical isolates obtained 



 
 
 

 

from diseased swine in Southwest, China. 

 

MATERIALS AND METHODS 
 
Clinical samples 
 
364 Samples, including lungs, lymph nodes, livers, hearts, 
spleens, kidneys, and blood (obtained between May 2009 and 
July 2010) were collected from 72 pig farms in southwestern 
China. All the samples were obtained from diseased pigs which 
had at least one of the following symptoms: septicemia, arthritis, 
enteritis, meningitis, pneumonia, pleuritis, diarrhea, edema, fever, 
pneumonia, endocarditis, and dysentery. Before sampling, all 
samples surface were being asepsis by burning of ethanol. 
Aseptically collected samples were appropriately processed and 
seeded in chocolate agar and blood agar. All of the samples were 
transported to the laboratory of Sichuan Animal Science Academy 
for bacterial counts and isolation within 6 h. 

 

Bacteria isolation 
 
The strains were incubated at 37°C for 18-24 h. One loo p-full 
from each enrichment were streaked on tryptic soy agar, blood 
agar (5% fresh rabbit blood), MacConkey agar (Tianhe 
Microorganism Reagent Co., Ltd.) and Salmonella-Shigella agar 
respectively. All plates were incubated at 37°C in air for 24 h and 
pur ified by standard methods (Murray et al., 2003). Single colony 
was obtained from the isolates and stored in Luria-Bertani 
containing 20% glycerol, at –80°C until use. No replicate isolates f 
rom the same samples were used. All media agar were 
purchased from Tianhe Microorganism Reagent Co., Ltd. 

 

Bacteria identification 
 
Identification was based on colony type and morphology, Gram 
staining characteristics, and standard biochemical tests. All isolates 
were identified at species level by VITEK (Vitek System, 
bioMerieux).They were also confirmed using primers 27F (5' AGA 

GTT TGA TCC TGG CTC AG 3’) and 1492R (5' TAC GGC TAC CTT 
GTT ACG ACT T 3’) by the polymerase chain reaction (PCR) assay 
(Wilson, 1990). The template DNA was prepared by suspending an 
overnight cultured of bacteria in 400 µL Milli-Q water. The 

suspensions were heated at 95°C for 5 mi n and centrifuged at 13,000 
rpm for 5 min. Each 50 µL of PCR mixture consisted of 4 µL of 

template, 5 µL 10×PCR Buffer, 1.5 mM MgCl 2, 200 µM dNTP, 0.4 µM 

each of the seven primers and 2.5 U Taq DNA polymerase. PCR was 
performed in a DNA thermal cycler (Bio-Rad, Hercules, CA) using the 

following program: an initial denaturation step at 94°C for 5 min, 30 
cycles of den aturation at 94°C for 1 min, annealing at 50°C for 1 min 
and exte nsion at 72°C for 1.5 min, followed by a final elongation at 
72°C for 10 min. The amplified PCR products were analyzed on 0.8% 

(w/v) agarose gels. Subsequently, the PCR product was sequenced 
by Shanghai Sangon Bioengineering Co., Ltd. The nucleotide 
sequences were analyzed with software (BLAST) available from the 
National Center for Biotechnology Information website 

(http://www.ncbi.nlm.nih.gov). 

 

Antimicrobial susceptibility 
 
Susceptibility to 15 antimicrobial agents, ampicillin (AMP; 10 µg), 
ampicillin/sulbactam (SAM; 10/10 µg), ticarcillin (TIC; 75 µg), 
amoxicillin (AMO; 10 µg), amoxicillin/clavulanate (AMC; 20/10µg), 
ticarcillin/clavulanate (TIM; 75/10 µg), cephalothin (KF; 30 µg), 
ceftiofur (EFT;30 µg), gentamicin (CN; 10 µg), amikacin (AMK; 30 

 
 
 
 

 
µg), terramycin (OT; 30 µg), erythromycin (E; 15 µg), clindamycin 
(DA; 2 µg), norfloxacin (NOR; 10 µg) and ciprofloxacin (CIP; 5 
µg), were tested by the disk diffusion method according to Clinical 
and Laboratory Standards Institute (CLSI, 2009). The control 
strains used for all susceptibility tests were E. coli ATCC 25922, 
Pseudomonas aeruginosa ATCC 27853 and Staphylococcus 
aureus ATCC 29213. 

 

Detection of blaTEM resistance genes 
 
The template DNA was prepared as described above. The 
forward primer ATGAGTATTCAACATTTCCGTG and the reverse 
primer TTACCA ATGCTTA ATCAGTGAG were used to amplify 

the blaTEM gene by following procedure: an initial denaturation 
step of 94°C for 5 min, 30 cycles of denaturation at 94°C for 1 
min, annealing at 50°C for 1 min and extension at 72°C for 1 min, 
foll owed by a final elongation at 72°C for 10 min. Amplified PCR 
products were analyzed on 0.8% (w/v) agarose gels. The PCR 
product was sequenced and analyzed as above. 

 

RESULTS 
 
Bacterial isolates 
 
504 bacterial isolates (which belong to19 difference 

species) were collected from the 364 clinical samples. The 

isolates were all obtained between May 2009 and July 

2010 from diseased pigs, including suckling pigs, nursery 

pigs, grower pigs and grower-finisher pigs. The results 

revealed that E. coli (n=154; 30.56%) was the most 

widespread bacterial isolates, followed by Staphylococcus 

spp. (n=110; 21.83%), E. faecalis (n=58; 11.51%), K. 

pneumoniae (n=44; 8.73%), P. mirabilis (n=43; 8.53%) and 

S. suis (n=30; 5.93%). Only 7 H. parasuis (1.39%) and 6 P. 

multocida (1.19%) isolates were obtained from all clinical 

samples. 

 

Antimicrobial susceptibility 
 
The majority of enterobacteria, including E. coli, K. 

pneumoniae and P. mirabilis, were resistant to ampicillin 

(88.4 to 100%), amoxicillin (92.3 to 100%), ticarcillin (50 to 

76.9%), norfloxacin (61.5 to 83.3%), ciprofloxacin (67.3 to 

83.3%) and terramycin (98 to 100%), and they were  
susceptibility to ticarcillin/clavulanate,  
ampicillin/sulbactam and amoxicillin/clavulanate. The  
Gram-positive bacteria showed resistance to  
erythromycin (57.1 to 71.4%), clindamycin (79.6 to  
85.7%), ampicillin (47.6 to 52.6%), amoxicillin (52.6 to  
76.2%) and terramycin (61.9 to 84.2%) and were  
susceptibility to ceftiofur, ticarcillin/clavulanate, 

ampicillin/sulbactam and amoxicillin/clavulanate (Table 1). 

In addition, most isolates from the swine were resistant to 

multiple classes of antimicrobial agents. Four hundred and 

seventy (93.25%) isolates from diseased swine were 

resistant to at least 3 of the 15 antimicrobial agents. 50 
(9.92%), 83 (16.47%), 133 (26.39%), 144 (30.56%) and 50 

(9.92%) isolates were resistant to 3, 4, 5, 6 and 7 

antimicrobial agents, respectively. 



 
 
 

 

blaTEM resistance genes detection 

 
Based on the results of the susceptibility tests, 154 E. coli, 

44 K. pneumoniae and 43 P. mirabilis were selected  
to amplify the blaTEM genes. The PCR analysis and 
sequencing showed that 140 (92.1%) E. coli, 44 (100%)  
K. pneumoniae and 42 (97.67%) P. mirabilis isolates 

harbored a blaTEM1 gene. 
 
 
DISCUSSION 

 

To investigate the prevalence of bacterial infections in 

swine in southwest, China, a total of 504 bacterial isolates 

(19 species) were collected and identified from the 364 

clinical samples. The results revealed that E. coli and the 

Staphylococcus spp. were the most widespread bacterial 

isolates. In swine, E. coli is an important pathogenic 

bacteria including enterotoxigenic (ETEC) and extracellular 

pathogenic E. coli (ExPEC) strains which are common 

causes of a variety of clinical syndromes, including urinary 

tract infections, abdominal infections, pneumonia, neonatal 

meningitis, sepsis, neonatal and post weaning diarrhea 

and edema (Yang, 2004; Wada et al., 2004; Nazareth et 

al., 2007; Boerlin et al., 2005). 
 

E. faecalis (n=58;  11.51%),  K.  pneumoniae  (n=44;  
8.73%), P.  mirabilis  (n=43; 8.53%) and S.  suis  (n=30;  
5.93%) were the another four frequent isolates. E. faecalis 

is intrinsical not as virulent as other Gram-positive 

organisms, such as S. aureus, S. pneumoniae and S. suis 

Type 2 (Bittencourt, 2004; Gaspar et al., 2009). It emerges 

as an opportunistic pathogen, nevertheless, it is known to 

cause serious infections such as bacteraemia, 

septicaemia, urinary tract infections, wound infections, 

meningitis and endocarditis (Giacometti et al., 2000; 

Hershberger et al., 2005; Hällgren et al., 2003; Hébert et 

al., 2007). K. pneumoniae is also an opportunistic 

pathogen that responsible for a wide range of infection in 

humans and animals, such as urinary tract infections, 

pneumonia, wound infections and septicemia (Podschun 

and Ullmann, 1998; Brisse and Duijkeren, 2005). P. 

mirabilis is also often found in human as opportunistic 

pathogens (Zych et al., 2001). S. suis, especially the 

serotype 2, is an important swine pathogen causing 

meningitis, septicemia, endocarditis, and arthritis (Marie et 

al., 2002; Lun et al., 2007; Domínguez-Punaro et al., 2007; 

Ma et al., 2009). In 2005, an Streptococcal Toxic Shock 

Syndrome (STSS) human outbreak caused by S. suis 

serotype 2 was found in Sichuan province with 38 human 

deaths and over 200 human infections, and more than 640 

pigs were found to be severely infected (Yu et al., 2006). 

Although other zoonotic bacterial such as Salmonella spp., 

H. parasuis, P. multocida and Actinobacillus spp. were 

lesser, they showed higher mortality and morbidity. The 

traditional zoonotic E. coli, Staphylococcus spp., S. suis 

and opportunistic E. 

  
  

 
 

 

faecalis, K. pneumoniae, P. mirabilis were the main 

pathogens in swine in Southwest, China.  
The enterobacteria were resistant to β-lactams, 

tetracyclines and aminoglycosides as previously described 

in China (Chang et al., 2002; Yang et al., 2004; Liu et al., 

2007; Tian et al., 2009). The E. coli isolates assessed in 

this study displayed similar levels of resistance to 

tetracyclines, ampicillin, gentamicin and fluoroquinolones 

as were previously reported for E. coli strains isolated from 

diseased swine in China by Tian et al. (2009). High levels 

of resistance to tetracycline (~60-95%) have also been 

detected in E. coli isolates recovered from apparently 

healthy swine on-farm or at slaughter in other countries 

(Kozak et al., 2003; Kijima-Tanaka et al., 2003; Teshager 

et al., 2000; Blake et al., 2003). Most of E. coli isolates 

(67.3%) from swine were resistant to fluoroquinolones (e.g. 

norfloxacin and ciprofloxacin). Somewhat similar findings 

have been reported in a recent study of clinical E. coli 

isolates from swine by Wang et al., 2010. Resistance to 

amoxicillin-clavulanic acid does not occur frequently in E. 

coli isolates from diseased swine in China before 2004 

(Yang et al., 2004), but 21.1% of our swine isolates were 

resistant to this antibiotic-inhibitor combination. In the 

present study, amikacin exhibited moderate activity against 

all strains tested. 
 

Interestingly, fewer reports of antimicrobial resistance in 

K. pneumoniae isolated from swine have been published in 

China. In the present study, K. pneumoniae was the sixth 

most frequently encountered pathogen in swine and 
showed high resistance to antimicrobial. K. pneumoniae 

isolates may be naturally resistant to ampicillin, amoxicillin, 

carbenicillin, and ticarcillin, but not to extended-spectrum 

β-lactam antibiotics due to a constitutively expressed 

chromosomal class A β-lactamase (Haeggman et al., 

2004). In the present study, the degree of resistance to 

cephalothin and ceftiofur was  
100 and 48.2%, respectively. The antibiotic-inhibitor 

combination revealed actively to K. pneumoniae. This 

could be due to the wide use of these classes of 

cephalosporins in husbandry activities and the 
considerable increase in prevalence of ESBL-producing 

and multiple-antimicrobial-resistant isolates from pig farms 

(Yang et al., 2004; Tian et al., 2009).  
Another important observation in this study is that the 

ceftiofur resistance has increased. Ceftiofur is the only 

extended-spectrum cephalosporin approved for veterinary 

use in many countries (Salmon et al., 1995). Because 

ceftiofur-resistant organisms are cross resistant to 

ceftriaxone, the use of this antimicrobial agent in food 

animals has come under increasing scrutiny as a selective 

agent potentially responsible for the emergence and 

dissemination of ceftriaxone resistance in Salmonella and 

other enteric pathogens (Alcaine et al., 2005). The rate of 

resistance to ceftiofur were (9.6%) E. coli, (48.2%) K. 

pneumoniae, (30.1%) P. mirabilis and (23.8%) S. suis 

isolates in this study, respectively. These findings are 



 
 
 

 
Table 1. Antibiotic resistance in the clinical bacterial isolates.  

 

 Antimicrobial    Resistance(%)
a
    

 

 agent E. coli K. pneumoniae P. mirabilis Staphylococcus S. suis E. faecalis d 
 

  Others 
 

 AMP 88.4 100.0 100.0 51.0 47.6 52.6 67.7 
 

 AML 92.3 100.0 100.0 61.2 76.2 52.6 80.6 
 

 TIC 73.0 76.9 50.0 - - - 61.2 
 

 SAM 19.2 15.3 16.6 10.2 - - 9.6 
 

 AMC 21.1 15.3 16.6 10.2 - - 12.9 
 

 TIM 1.9 7.7 2.8 8.1 - - 6.4 
 

 KF 40.3 100.0 35.2 40.8 52.3 - 29.0 
 

 EFT
b
 9.6 48.2 30.1 12.2 23.8 - 16.1 

 

 E - - - 65.3 57.1 71.4 - 
 

 DA - - - 79.6 85.7 - - 
 

 NOR 67.3 61.5 83.3 59.1 - 52.6 54.8 
 

 CIP 67.3 69.2 83.3 51.0 - 36.8 45.1 
 

 CN 55.7 46.1 83.3 44.9 - - 45.1 
 

 AMK 44.2 46.1 16.6 30.6 - - 51.6 
 

 OT
c
 98.0 100.0 100.0 83.6 61.9 84.2 87.1 

  
a
Breakpoints are those recommended by the Clinical and Laboratory Standards Institute (CLSI);. –, no CLSI breakpoints were 

available, 
b
According to cefotaxime, 

c
According to tetracycline, 

d
including Shigella spp.,Salmonella spp., H. parasuis, A. lwoffii, P. 

multocida (Aarestrup, 2004). AMP, ampicillin; AML, amoxicillin; TIC, ticarcillin; TIM, ticarcillin/clavulanate; SAM, 
ampicillin/sulbactam; AMC, amoxicillin/clavulanate; KF, cephalothin; EFT, ceftiofur; E, erythromycin; DA, clindamycin; NOR, 
norfloxacin; CIP, ciprofloxacin; CN, gentamicin; AMK, amikacin; OT, terramycin. 

 
 

 

very significant difference to the previous reports which 

displayed high actively to ceftiofur (Marie et al., 2002; Yang 

et al., 2004; Morioka et al., 2005; Zhou et al., 2010: Wang 

et al., 2010). The high incidence of ceftiofur resistance in 

the K.pneumoniae, P. mirabilis and S. suis isolates tested 

herein was somewhat unexpected, as this drug was 

introduce into veterinary clinics for use in China only 2 to 3 

years ago.  
Of all the 154 E. coli, 44 K. pneumoniae and 43 P. 

mirabilis, 140 (92.1%), 44 (100%) and 42 (97.67%) isolates 

harboured a blaTEM1 gene. The results of the study 
indicated that TEM-1 was the most common β-lactamase 
gene among the K. pneumoniae and E. coli isolates, in 
agreement with previous studies that reported a high 

prevalence of the blaTEM-1 gene among animal E. coli 
isolates (Liu et al., 2007; Rayamajhi et al., 2008; Li et al., 
2007; Chander et al., 2011).  

In conclusion, our results confirmed a different 

prevalence of bacterial infection in swine during 2009-

2010, in Southwest, China. The E. coli, Staphylococcus 

spp., S. suis , E. faecalis, K. pneumoniae and P. mirabilis 

isolates are commonly present among diseased swine. 

Here we have shown that bacterial pathogens from 

diseased swine exhibited high level resistance to a large 

number of antimicrobial agents. If this situation continues, 

there will be no effective antibiotic therapeutic reserve for 

some bacterial infections. In the future, the data from 

monitoring programs and resistance studies should be 

taken into account for the usage of antimicrobials in 

veterinary medicine. 

 
 
 

 
ACKNOWLEDGEMENT 

 

This work was supported by the Sichuan Animal Science 

Academy. 
 
 
REFERENCES 
 
Alcaine SD, Sukhnanand SS, Warnick LD, Su WL, Mcgann P, 

McDonough P, Wiedmann M (2005). Ceftiofur-resistant Salmonella 
strains isolated from dairy farms represent multiple widely 
distributed subtypes that evolved by independent horizontal gene 
transfer. Antimicrob. Agents Chemother. 49: 4061-4067.  

Blake DP, Humphry RW, Scott KP, Hillman K, Fenlon DR, Low JC 
(2003). Influence of tetracycline exposure on tetracycline resistance 
and the carriage of tetracycline resistance genes within commensal 
Escherichia coli populations. J. Appl. Microbiol. 94: 1087–1097.  

Bittencourt de Marques E, Suzart S (2004). Occurrence of virulence-
associated genes in clinical Enterococcus faecalis strains isolated 
in Londrina, Brazil. J. Med. Microbiol. 53: 1069–1073.  

Boerlin P, Travis R, Gyles CL, Reid-Smith R, Janecko N, Lim H, 
Nicholson V, McEwen SA, Friendship R, Archambault M (2005). 
Antimicrobial resistance and virulence genes of Escherichia coli 
isolates from swine in Ontario. Appl. Environ. Microbiol. 71: 6753– 
6761. 

Brisse S, Duijkeren E (2005). Identification and antimicrobial 
susceptibility of 100 Klebsiella animal clinical isolates. Vet. 
Microbiol. 105: 307-312.  

Caprioli A, Busani L, Martel JL, Helmuth R (2000). Monitoring of 
antibiotic resistance in bacteria of animal origin: epidemiological 
and microbiological methodologies. Int. J. Antimicrob. Agents. 14: 
295– 301.  

Chander Y, Oliveira S, Goyal SM (2011). Characterization of ceftiofur 
resistance in swine bacterial pathogens. Vet. J. 187: 139-141.  

Chang CF, Chang LC, Chang YF, Chen M, Chiang TS (2002). 
Antimicrobial susceptibility of Actinobacillus pleuropneumoniae, 



 
 
 

 
Escherichia coli, and Salmonella choleraesuis recovered from 

Taiwanese swine. J. Vet. Diagn. Invest. 14: 153–157.  
Clinical and Laboratory Standards Institute (CLSI) (2009). 

Performance standards for antimicrobial susceptibility testing: 19th 
informational supplement M100-S19. Wayne, PA, USA.  

Domínguez-Punaro MC, Segura M, Plante MM, Lacouture S, Rivest 
S, Gottschalk M (2007). Streptococcus suis Serotype 2, an 
important swine and human pathogen, induces strong systemic and 
cerebral inflammatory responses in a mouse model of infection. J. 
Immunol. 179: 1842-1854.  

Gaspar F, Teixeira N, Rigottier-Gois L, Marujo P, Nielsen-LeRoux C, 
Crespo MT, Lopes Mde F, Serror P (2009). Virulence of 
Enterococcus faecalis dairy strains in an insect model: the role of 
fsrB and gelE. Microbiology, 155: 3564-3571.  

Giacometti A, Cirioni O, Schimizzi AM, Del Prete MS, Barchiesi F, 
D'Errico MM, Petrelli E, Scalise G (2000). Epidemiology and 
microbiology of surgical wound infections. J. Clin. Microbiol. 38: 
918– 922.  

Haeggman S, Löfdahl S, Paauw A, Verhoef J, Brisse S (2004). 
Diversity and evolution of the class A chromosomal beta-lactamase 
gene in Klebsiella pneumoniae. Antimicrob Agents Chemother. 48: 
2400-2408.  

Hällgren A, Saeedi B, Nilsson M, Monstein HJ, Isakson B, Hanberger 
H, Nilsson LE (2003). Genetic relatedness among Enterococcus 
faecalis with transposon-mediated high-level gentamicin resistance 
in Swedish intensive care units. J. Antimicrob. Chemother. 52: 162– 
167.  

Hébert L, Courtin P, Torelli R, Sanguinetti M, Chapot-Chartier MP, 
Auffray Y, Benachour A (2007). Enterococcus faecalis constitutes 
an unusual bacterial model in lysozyme resistance. Infect. Immun. 
75: 5390–5398.  

Hershberger E, Oprea SF, Donabedian SM, Perri M, Bozigar P, Bartlett P, 

Zervos MJ (2005). Epidemiology of antimicrobial resistance in 

enterococci of animal origin. J. Antimicrob. Chemother. 55: 127-130.  
Kijima-Tanaka M, Ishihara K, Morioka A, Kojima A, Ohzono T, Ogikubo K, 

Takahashi T, Tamura Y (2003). A national surveillance of antimicrobial 

resistance in Escherichia coli isolated from food-producing animals in 

Japan. J. Antimicrob. Chemother. 51: 447-451. 
Kozak GK, Boerlin P, Janecko N, Reid-Smith RJ, Jardine C (2009). 

Antimicrobial Resistance in Escherichia coli Isolates from Swine 
and Wild Small Mammals in the Proximity of Swine Farms and in 
Natural Environments in Ontario, Canada. Appl. Environ. Microbiol., 
75: 559– 566.  

Li XZ, Mehrotra M, Ghimire S, Adewoye L (2007). β-Lactam 
resistance and b-lactamases in bacteria of animal origin. Vet. 
Microbiol., 121: 197–214.  

Liu JH, Wei SY, Ma JY, Zeng ZL, Lü DH, Yang GX, Che n ZL (2007). 
Detection and characterisation of CTX-M and CMY-2 beta-
lactamases among Escherichia coli isolates from farm animals in 
Guangdong Province of China. Int. J. Antimicrob. Agents, 29: 576– 
581. 

Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ (2007). Streptococcus 
suis: An emerging zoonotic pathogen. Lancet. Infect. Dis., 7: 201-
209.  

Ma Y, Feng Y, Liu D, Gao GF (2009). Avian influenza virus, 
Streptococcus suis serotype 2, severe acute respiratory syndrome-
coronavirus and beyond: molecular epidemiology, ecology and the 
situation in China. Philos. Trans. R. Soc. Lond B. Biol. Sci., 364: 
2725–2737.  

Marie J, Morvan H, Berthelot-Hérault F, Sanders P, Kempf I, Gautier-
Bouchardon AV, Jouy E, Kobisch M (2002). Antimicrobial 
susceptibility of Streptococcus suis isolated from swine in France 
and from humans in different countries between 1996 and 2000. J. 
Antimicrob. Chemother. 50: 201–209.  

Morioka A, Asai T, Ishihara K, Kojima A, Tamura Y, Takahashi T 
(2005). In vitro activity of 24 antimicrobial agents against 
Staphylococcus and Streptococcus isolated from diseased animals 
in Japan. Vet. Med. Sci. 67(2): 207-210. 

  
 
 
 

 
Nazareth H, Genagon SA, Russo TA (2007). Extra intestinal 

pathogenic Escherichia coli survive within neutrophils. Infect. 
Immun., 75: 2776– 2785. 

Podschun R, Ullmann U (1998). Klebsiella spp. as nosocomial 
pathogens: epidemiology, taxonomy, typing methods, and 
pathogenicity factors. Clin. Microbiol. Rev., 11: 589–603.  

Rayamajhi N, Kang SG, Lee DY, Kang ML, Lee SI, Park KY, Lee HS, 
Yoo HS (2008). Characterization of TEM-, SHV- and AmpC-type 
beta-lactamases from cephalosporin-resistant Enterobacteriaceae 
isolated from swine. Int. J. Food. Microbiol., 124: 183–187.  

Salmon SA, Watts JL, Case CA, Hoffman LJ, Wegener HC, Yancey Jr. RJ 

(1995). Comparison of MICs of ceftiofur and other antimicrobial agents 

against bacterial pathogens of swine from the United States, Canada, 

and Denmark. J. Clin. Microbiol., 33: 2435-2444.  
Teshager T, Herrero IA, Porrero MC, Garde J, Moreno MA, 

Domínguez L (2000). Surveillance of antimicrobial resistance in 
Escherichia coli strains isolated from pigs at Spanish 
slaughterhouses. Int. J. Antimicrob. Agents, 15: 137-142.  

Tian GB, Wang HN, Zou LK, Tang JN, Zhao YW, Ye MY, Tang JY, 
Zhang Y, Zhang AY, Yang X, Xu CW, Fu YJ (2009). Detection of 
CTX-M-15, CTX-M-22, and SHV-2 extended-spectrum β-
lactamases (ESBLs) in Escherichia coli fecal-sample isolates from 
pig farms in China. Food borne. Pathog. Dis. 6: 297-304.  

Van Den Bogaard AE, Stobberingh EE (1999). Antibiotic usage in 
animals: impact on bacterial resistance and public health. Drugs, 
58: 589–607.  

Wada Y, Kato M, Yamamoto S, Shibahara T, Ishikawa Y, Kadota K 
(2004). Invasive Aability of Escherichia coli O18 isolated from swine 
neonatal diarrhea. Vet. Pathol., 41: 433–437.  

Wang XM, Liao XP, Zhang WJ, Jiang HX, Sun J, Zhang MJ, He XF, 
Lao DX, Liu YH (2010). Prevalence of serogroups, virulence 
genotypes, antimicrobial resistance, and phylogenetic background 
of avian pathogenic Escherichia coli in south of China. Foodborne 
Pathog. Dis., 7: 1099-1106.  

White DG, Zhao S, Simjee S, Wagner DD, McDermott PF (2002). 
Antimicrobial resistance of foodborne pathogens. Microbes. Infect., 
4: 405–412.  

Wilson KH, Blitchington RB, Greene RC (1990). Amplification of 
bacterial 16S ribosomal DNA with polymerase chain reaction. J. 
Clin. Microbiol., 28: 1942-1946. 

Yang H, Chen S, White DG, Zhao S, McDermott P, Walker R, Meng J  
(2004). Characterization of multiple-antimicrobial-resistant 
Escherichia coli isolates from diseased chickens and swine in 
China. J. Clin. Microbiol., 42: 3483–3489.  

Yu H, Jing H, Chen Z, Zheng H, Zhu X, Wang H, Wang S, Liu L, Zu R, 
Luo L, Xiang N, Liu H, Liu X, Shu Y, Lee SS, Chuang SK, Wang Y, 
Xu J, Yang W (2006). Streptococcus suis study groups: Human 
Streptococcus suis outbreak, Sichuan, China. Emerg. Infect. Dis., 
12: 914-920.  

Zhou X, Xu X, Zhao Y, Chen P, Zhang X, Chen H, Cai X (2010). 
Distribution of antimicrobial resistance among different serovars of 
Haemophilus parasuis isolates. Vet. Microbiol., 141: 168-173.  

Zych K, Toukach FV, Arbatsky NP, Kolodziejska K, Senchenkova SN, 
Shashkov AS, Knirel YA, Sidorczyk Z (2001). Structure of the O-
specific polysaccharide of Proteus mirabilis D52 and typing of this 
strain to proteus serogroup O33. Eur. J. Biochem., 268: 4346-4351. 


