




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 3 (5), pp. 001-006, May, 2015. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

Full Length Research Paper 

 

Rapid diagnosis of ETEC and HPI-harboring 

Escherichia coli infection in newborn piglets with 

diarrhea 
 

Cheng Darong1*, Zhu Shan Yuan2, Chen Xiao Lang1, Gao Xiao Pan1, Ding Wen Wei1 
and Sun Huai Chang1

  
1
College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China. 

2
Jiangsu Animal Husbandry and Veterinary College, Taizhou 225300, China. 

 
Accepted 03 November, 2014 

 
Diarrhea is a common and important disease in industrial pig farms and the pathogenic Escherichia coli 
infection is the main cause of morbidity and mortality in newborn piglets. The preliminary diagnoses on 
this disease are mainly depending on clinical symptom and detailed body dissection. To further shorten 
the diagnosis time and increase the determination efficiency for newborn piglet diarrhea caused by E. 
coli, a rapid method was established based on the fast bacterial culturing followed by the PCR 
examining for the virulence factor genes, such as enterotoxin ST1, ST2, LT1 and high pathogenicity 
island (HPI). A total of 151 rectal swab samples were obtained from live diarrheic piglets from Jiangsu 
province, China. Following the first cultivation in LB broth at 37°C for 6 h, all the samples were detected 
by the PCR methods, and the data show that 95 cases (62.91%) were infected with HPI-harboring E. coli, 
24 cases (15.89%) were infected with Enterotoxigenic E. coli (ETEC) and 14 cases (9.27%) were infected 
with ETEC and HPI-harboring E. coli. In addition, 2660 bacteria isolates were picked from all the 133 
bacterial cultures which contained HPI-harboring E. coli and/or ETEC and the data of PCR examination 
determined that only 57 isolates were HPI-harboring E. coli, 20 were ETEC and 3 were both ETEC and 
HPI-harboring E. coli. This research not only revealed that HPI-harboring E. coli and ETEC are the 
prevalent pathogen of newborn piglet diarrhea, but also suggested that the method used in this study is 
specific, easier and more rapid to perform in the diagnosis of the infection of diarrheagenic E. coli with 
high accurate rate than the bacterial isolation and identification. 

 
Key words: Piglet, diarrhea, Escherichia coli, rapid detection, virulence factor, determination. 

 
 
INTRODUCTION 

 
The newborn piglet diarrhea is frequently due to infection 
by one or the other pathogens, such as bacteria, viruses 
and parasites. After the first few days of life, increasing 
interaction with other animals and the environment, 
including introduction of artificial feeding, the risk of 
exposure to enteropathogens was increased (Carpenter 
et al., 2005; Oli et al., 1998; Stevenson, 1999). As we all 
know, pathogenic Escherichia coli, especially Enterotoxi-  
 
 
 
*Corresponding author. E-mail: jsyzcdr@yahoo.com.cn.  Tel: 
+86-514-8797-2587. 

 
 
 
 

 
genic E. coli (ETEC), are a frequent, important and global 
cause of severe, watery diarrhea in the newborn 
(suckling) pigs.  

ETEC is defined as a pathogen containing E. coli 

isolates that elaborate at least one member of two 
defined groups of enterotoxins, namely: heat-labile (LT) 
and heat-stable enterotoxin (ST) (Nair et al., 1998; Smith 
et al., 1970;). Enterotoxins are extracellular proteins or 
peptides, which are able to alter the functions of 
enterocytes by increasing secretion and reducing 
absorption, and therefore they are the more efficient 
virulence attributes of ETEC (Blanco et al., 1991; Nagy et 
al., 2005, 1999). In addition, most ETEC isolated from 



 
 
 

 

diarrhoeic pigs can produce one or more of the following 
fimbriae: F4 (K88), F5 (K99), F6 (987P), F17, F18 and 
F41 (Blanco et al., 1991; Garabal et al., 1997; Nagy et al., 
1999; Ojeniyi et al., 1994; Wilson et al., 1986), which 
allow the bacteria adhering to the small intestinal 
epithelium but without inducing significant morphological 
changes (Nataro et al., 1998).  

Furthermore, the old topic of horizontal gene transfer 
(HGT) has become fashionable (Syvanen et al., 1999; 
Jain et al., 1999). From the overwhelming surge of 
genome sequence information, more and more 
candidates for horizontally transferred genes are being 
identified (Coton et al., 2009; Cruz et al., 2009). It is clear 
that genes have flowed through the biosphere, as in a 
global organism. There are a number of well documented 
examples in which bacterial adaptation has been 
influenced by HGT, such as the high-pathogenicity island 
(HPI) of pathogenic Yersinia in E. coli (Buchrieser et al., 
1998; Carniel et al., 1992, 1998; Fetherston et al., 1994; 
Hacker et al., 2000; Perry et al., 1990; Petermann et al., 
2008; Schubert et al., 1998), or the new “plasmid-
associated” pathogenicity island PAI2173 which encodes 
the tetB gene conferring tetracycline resistance (Fekete 
et al., 2003). Detection of HGT can provide an optimistic 
control strategy on the selected disease, as well as 
providing the foundation for considerations of a 
ubiquitous role of HGT in shaping modern eukaryotic 
species.  

The aims of the research were to establish a rapid 
method to further shorten the diagnosis time and increase 
the determination efficiency for newborn piglet diarrhea 
caused by HPI-harboring E. coli and/or ETEC, determine 
the relationship between the newborn piglet diarrhea and 
the pathogenic E. coli infection, as well as investigate the 
virulence factor genes of the diarrheagenic E. coli 
isolates. 
 

 
MATERIALS AND METHODS 
 
Collection of diseased samples 
 
From March to September, 2008, a total of 151 rectal swab 
samples were collected from live diarrheic piglets from 51 swine 
industrial farms in Jiangsu province, China. All the diseased piglets 
with a mean age of 5.2 ± 3.6 days all suffered from watery diarrhea 
with a 1 - 3-day latency period and peaks around one week after 
birth, and the samples were collected within 36 h after diarrhea. 
Bringing each test sample to a final volume of 500 l with LB broth 
(10 g tryptone, 10 g NaCl, 5 g yeast extract, H2O to 1 L, pH 7.4), 
they were store at -70°C. 
 

 
Primers 
 
The different sets of primers (Table 1) used for PCR amplification 
were described previously (Cheng et al., 2005, 2006; Schubert et 
al., 1998) and synthesized by Sangon Biological Engineering 
Technology and Service Co. Ltd. (Shanghai, P. R. China). The 
primers that target the genes of STa, STb and LTa were mixed 
together (named enterotoxin primers set, each 50 mmol/l) to detect 

 
 
 
 

 
ETEC, and the primers that target the genes of HMWP2 were 
mixed together (named HPI primers set, each 50 mmol/l) to detect 
HPI-harboring E. coli in the samples. The primers that target the 
genes of F4, F5, F6 and F41 were mixed together (named fimbria 
primers set I, each 50 mmol/l) to identify adhesion factor genes of 
the bacteria isolates, and the primers that target the F18 genes 
were mixed together (named fimbria primers set II, each 50 mmol/l) 

to identify and distinguish F18ab
+
 and F18ac

+
 E. coli. 

 
Rapid diagnosis of pathogenic E. coli infection in newborn 

piglets 
 
100 l dilution of each rectal swab sample were transferred into 
separate tubes containing 2 ml of LB broth and grow the liquid 
cultures with vigorous agitation at 37°C for 6 h. 0.5 ml of the liquid 
cultures was transferred to labelled microcentrifuge tubes, and 
centrifuge at 10,000 rpm for 5 min. The supernatants were 
discarded and each pellet resuspended in 200 l of distilled water. 
After boiling for 10 min, the suspensions were chilled on ice for 5 
min, centrifuged at 10,000 rpm, at 4°C for an additional 5 min and 
the supernatants were used directly or stored at 4°C before PCR 
detection.  

To detect ETEC and/or HPI-harboring E. coli in the liquid cultures 
of rectal swab samples, PCR assays were performed in 
microcentrifuge tubes for the Applied Biosystems 2720 Thermal 
Cycler America). All the reagents were purchased from Takara 
Biotechnology (Dalian) Co., Ltd. The PCR mixture contained 5 l of 

10× PCR buffer (Mg
2+

 plus), 5 IU of Taq polymerase, 4 l of dNTP 

mixture (each 2.5 mmol/l), 1 l of enterotoxin primers set or HPI 
primers set, 2 l of DNA template, and deionized water to a final 
volume of 50 l. Cycling parameters for each primer set are outlined 
in Table 2. Each sample underwent 32 cycles of PCR amplification. 
PCR products were separated by 1% agarose gel electrophoresis 
along with DL2000 DNA markers and visualized after staining with 
ethidium bromide on a UV transilluminator. 

 

Determination of the virulence factor genes of the bacteria 

isolates 
 
Following rapid diagnosis of ETEC and/or HPI-harboring E. coli 
infection, all the positive samples were submitted to separative 
cultivation of bacteria by streaking on Mackonkey agar plates. 
Following incubation at 37°C overnight, twenty colonies were picked 
out from each sample and cultured on LB agar plates at 37°C for 24 
h. All the 2660 bacteria isolates were submitted to PCR detection 
for the genes of enterotoxins (STa, STb and LTa), HPI and fimbriae 
(F18, F4, F5, F6 and F41). The extraction of DNA templates and 
PCR assays were performed as described above, while enterotoxin 
primers set was used for STa, STb and LTa, HPI primers set for 
HPI, fimbria primers set I for F4, F5, F6 and F41, and fimbria 
primers set II for F18ab and F18ac. In addition, all the ETEC and/or 
HPI-harboring E. coli were serotyped by using uni-factor serum of O 
antigen of E. coli. 
 

 

RESULTS 

 

Rapid detection of pathogenic E. coli infection in 

newborn piglets 
 
The specificity of the PCR assays were described 

previously (Cheng et al., 2006). Among the 151 rectal 

swab samples from live diarrheic piglets, 95 (62.91%) 

samples (from 32 farms) only contained HPI-harboring 



   

Table 1. Primers used for PCR amplification in this study.      
       

 RR Position in open reading frame Size of product    

 Primer sequence 5’-3’ (accession number in GenBank) (bp) Reference   
STa   
F GGGTTGGCAATTTTTATTTCTGTA  298-321 (M25607) 

R ATTACAACAAAGTTCACAGCAGTA  457-480 (M25607) 

STb    
F ATGTAAATACCTACAACGGGTGAT  1-20 (M35729) 

R TATTTGGGCGCCAAAGCATGCTCC  334-357 (M35729) 

LTa    
F TAGAGACCGGTATTACAGAAATCTGA  579-604 (AB011677) 

R TCATCCCGAATTCTGTTATATATGTC  835-860 (AB011677) 

HMWP2    
F AAGGATTCGCTGTTACCGGAC  241-261 (L18881) 

R TCGTCGGGCAGCGTTTCTTCT  507-527 (L18881) 

F4    
F GATGAAAAAGACTCTGATTGCA  35-56 (M29374, M29376), 407-428 

   (M25302) 

R GATTGCTACGTTCAGCGGAGCG  860-881 (M29374, M29376), 1226-1247 
   (M25302) 

F5    
F CTGAAAAAAACACTGCTAGCTATT  70-93 (M35282) 

R CATATAAGTGACTAAGAAGGATGC  589-612 (M35282) 

F6    
F GTTACTGCCAGTCTATGCCAAGTG  707-730 (U50547) 

R TCGGTGTACCTGCTGAACGAATAG  1146-1169 (U50547) 

F41    
F GATGAAAAAGACTCTGATTGCA  254-275 (X14354) 

R TCTGAGGTCATCCCAATTGTGG  914-935 (X14354) 

F18    
F1 ATGAAAAGACTAGTGTTTATTTCTT  160-184 (M61713) 

F2 CGTGAACGGTAAAACACAGGG  504-524 (M61713) 

R TTACTTGTAAGTAACCGCGTAAGCC  648-672 (M61713) 

  
183 (Cheng et 

al., 2006) 

 

 

360 (Cheng et 

al., 2006) 

 

 

282 (Cheng et 

al., 2006) 

 

 

280 
 
 

 

841 (Cheng et 

al., 2006) 

 
 
 

 

543 (Cheng, et  
al. 2006) 

 

 

463 (Cheng et 

al., 2006) 

 

 

682 (Cheng et 

al., 2006) 

 

 

513 or 516 (Cheng et 

169 al., 2005) 

  

 
 

 

E. coli, 24 (15.89%) samples (from 8 farms) just 

contained ETEC, 14 (9.27%) samples (from 5 farms) 
contained both ETEC and HPI-harboring E. coli, while 18 

samples (from 6 farms) were not detected with ETEC or 
HPI-harboring E. coli (Table 3). The data suggested that 
at least, 133 cases (from 45 farms) of the 151 diarrheic 
piglets were infected with pathogenic E. coli. In addition, 

among the 38 samples which contained ETEC, 34 were 
LTa-positive, 9 were STa-positive and 25 were STb-
positive. 

 
 

 

Determination of the virulence factor genes of the 

bacteria isolates 
 
Two thousand, six hundred and sixty bacteria isolates 
were picked from all the 133 bacterial cultures which 
contained HPI-harboring E. coli and/or ETEC, and the 

data of PCR examination (Table 4) determined that only 
57 isolates (from 55 samples) were HPI-harboring E. coli, 
20 were ETEC (from 16 samples) and 3 were (from 3 
samples) both ETEC and HPI-harboring E. coli. Among 



 
 
 

 
Table 2. PCR cycling conditions in this study.  
 
 Primer set Time at denature at 94°C Annealing Time at extension at 72°C Total no. of cycles  

 Enterotoxin primers set 30 s 60 –56°C for 30s 1 min 32  

   (decreasing 1°C every two cycles)    

 HPI primers set 30 s 64–58 °C for 30s 1 min 32  
   (decreasing 1°C every two cycles)    

 Fimbria primers set I 30 s 66–62 °C for 30s 1 min 32  
   (decreasing 1°C every two cycles)    

 Fimbria primers set II 30 s 66–62 °C for 30s 1 min 32  
   (decreasing 1°C every two cycles)    

 
 

 
Table 3. The results of rapid detection of E. coli infection in newborn piglets with diarrhea.  

 
Virulence factor type HPI LTa STa STb Numbers of samples  

 +    95  

 + +  + 10  

 +  +  1  

 +  + + 2  

 + + + + 1  

  +   11  

  +  + 8  

  + +  1  

   + + 1  

  + + + 3  

Total 95 34 9 25 133  

 

 

the 57 HPI-harboring E. coli isolates tested, one (26.24%) 
was F4+, 9 (3.75%) were F6+, while 10 were F4+ and 
F6+. Among the 20 ETEC isolates, 8 (3.75%) were LTa+, 
STb and F6+, 3 (3.75%) were LTa+, STb, F4+ and F6+, 4 
(3.75%) were LTa+ and F6+, 2 (3.75%) were STa+, 
STband F6+, 2 (3.75%) were STa+, and one was LTa+, 
STa, STb, F4+ and F6+. All the 3 both ETEC and HPI-
harboring E. coli isolates were LTa+, STb and F4+. No 
single F5+, F41+and F18+ isolate was detected. In 
addition, all the 80 E. coli isolates were O serotyped with 
the most prevalent serotype been O138 accounting for 
62.50% (50/80), followed by O65 (12.50%), O21 (8.75%), 
O139 (6.25%), O141 (5.00%), O9 (2.50%), O159 (1.25%) 
and O55 (1.25%). 

 

 

Contrast between PCR detection and conventional 

diagnosis by bacteria isolation and identification 
 

The diagnosis time were first compared and the data 

show that the effective time of PCR detection method is 

not exceeding 10 h with 6 h bacterial cultivation, 0.5 h 

extraction of DNA templates, 2 h PCR examination and 

 

 

1.5 h electrophoresis of PCR products, while the working 
time of conventional diagnosis by bacteria isolation and 
identification usually was 3 to 4 days. Then, the diagnosis 
efficiency were also analyzed and compared. The results 
of this research show that the ETEC and/or HPI-
harboring E. coli were found to exist in 133 (88.08%) of 
the 151 samples (45 of the 51 investigated farms) by 
PCR detection method, while only 57 isolates could be 
detected in 55 samples by bacteria isolation and 
identification, although in each sample was picked out 20 
bacteria isolates. This suggested that the PCR detection 
methods used in this study is specific, easier and more 
rapid to perform in the diagnosis of the infection of 
diarrheagenic E. coli with high accurate rate than the 
conventional diagnosis by bacterial isolation and 
identification. 
 

 

DISCUSSION 

 

Pathogenic E. coli is a common porcine enteric pathogen, 

causing diarrhea in newborn piglets or post-weaning 

porcine edema disease, and ETEC is considered to be 



 
 
 

 
Table 4. Summary of the O serotype and virulence factors of the 80 E. coli isolates from diarrheic piglets.  

 
 Virulence factor HPI LTa STa STb F4 F6 Numbers of isolates  

 O serotype         

 O138  +  +  + 8  

 O138  +  + + + 3  

 O138  +    + 4  

 O138   + +  + 2  

 O138   +    2  

 O138  + + + + + 1  

 O138 + +  + +  3  

 O138 +    + + 5  

 O138 +     + 4  

 O138 +      18  

 O65 +      10  

 O21 +      7  

 O139 +     + 5  

 O141 +      4  

 O9 +    +  1  

 O9 +      1  

 O159 +      1  

 O55 +    + + 1  

 Total 60 19 5 17 14 33 80  

 
 
 
the main categories of diarrhoeagenic E. coli. But 
moreover, it is worth noting that the high-pathogenicity 
island has been identified in pathogenic E. coli strains 
causing diarrhea and dysentery in calves, rabbits, piglets 
and human (Carniel et al., 1992; Fetherston et al., 1994; 
Paauw et al., 2009). On the other hand, most E. coli are 
the normal inhabitants of the intestinal tracts of animals 
(Levine, 1987; Martins et al., 2000), and it is very difficult 
to obtain the pathogenic E. coli in the rectal swab 
samples from live diarrheic piglets by bacteria isolation 
and identification. Therefore, diagnosis of pathogenic E. 
coli infection has focused increasingly on the rapid 
detection method, although the conventional diagnosis 
method by bacteria isolation and identification has 
occupied a central place in the history.  

Among many detection methods, PCR is a major 
advance in molecular diagnostics of E. coli infection for its 
good sensitivity and specificity (Nataro et al., 1998). As a 
matter of fact, the clinical diagnosis of E. coli infection in 
piglets, especially in the rectal swab samples from live 
diarrheic animals, usually just need confirming whether 
the pathogenic E. coli was/were existed in the sample(s), 
and not always need bacterial isolation and identification 
anymore while it is so difficult to pick out the pathogenic 
isolate(s) . According to this point of view, a rapid 
detection method was established in this study based on 
the fast bacterial culturing followed by the PCR examining 
for the virulence factor genes, which could extremely 
shorten the diagnosis time and increase the 
determination efficiency for newborn piglet diarrhea 

 

 

caused by E. coli.  
This is perfectly supported by the data of this research 

fortunately. Such as, in our research, a total of 151 rectal 
swab samples were obtained from live diarrheic piglets 
from 51 swine industrial farms, and the data of PCR 
method could confirmed that 88.08% diarrheic piglets 
(from 88.24% farms) were infected with ETEC and/or 
HPI-harboring E. coli. But among the 2660 bacteria 
isolates picked from the 133 bacterial cultures, only 80 
isolates were HPI- harboring E. coli and/or ETEC, while 
most isolates may were the important members of the 
normal microbiologic flora of piglets (Moneoang et al., 
2009). 
This research not only revealed that ETEC are still the 
prevalent pathogen of newborn piglet diarrhea, but also 
found that the HPI-harboring E. coli isolates were more 
frequently detected in the diarrhea samples. Furthermore, 

most HPI
+
 isolates (95.0%) were toxin negative which 

might contribute to the virulence of these pathogenic E. 
coli isolates that causes newborn piglet diarrhea, and this  
attractive hypothesis has to be verified by comparing the 

virulence of the parental strain and of the isogenic mutants in a 

suitable infection mode. By the way, the pathogenic E. coli  
associated with neonatal diarrhea belong to a limited 

number of serogroups with O138, O65, O21, O139, 

O141, O9, O159, and O55, while O138 being the most 

commonly found in ETEC and HPI isolates, which were 

different from the isolates from porcine post weaning 

diarrhea (PWD) and pig edema disease (ED) (Cheng et 

al., 2006). 



 
 
 

 

ACKNOWLEDGEMENTS 

 

This work was supported by National Natural Science 
Foundation of China (Grant No. 30800821). We would 
like to give our thanks to all the staff of the Veterinary 
Microbiology Laboratory of Yangzhou University, for their 
help with some experiments. 
 

 
REFERENCE 
 
Blanco J, Blanco M, Garabal JI, González EA (1991). Enterotoxins, 

colonization factors and serotypes of enterotoxigenic Escherichia coli 
from humans and animals. Microbiologia 7(2): 57-73. 

Buchrieser C, Brosch R, Bach S, Guiyoule A, Carniel E (1998). The high 
pathogenicity island of Yersinia pseudotuberculosis can be inserted 
into any of the three chromosomal asn tRNA genes. Mol. Microbiol. 
30(5): 965-978.  

Carniel E, Guiyoule A, Guilvout I, Mercereau-Puijalon O (1992). 
Molecular cloning, iron-regulation and mutagenesis of the irp2 gene 
encoding HMWP2, a protein specific for the highly pathogenic 
Yersinia. Mol. Microbiol. 6(3): 379-388.  

Carpenter JA (2005). Burlatschenko S. Diarrhea in nursery pigs 
associated with multiple concurrent pathogens. J. Swine Health Prod. 
13(4): 218-221. 

 
Cheng D, Sun H, Xu J, Gao S (2005). Prevalence of Fimbial 

Colonization Factors F18ab and F18ac in Escherichia coli Isolates 
from Weaned Piglets with Edema and/or Diarrhea in China. Vet. 
Microbiol. 110(1-2): 35-39.  

Cheng D, Sun H, Xu J, Gao S (2006). PCR detection of virulence factor 
genes in Escherichia coli isolates from weaned piglets with edema 
disease and/or diarrhea in China. Vet. Microbiol. 115(4): 320-328. 

Coton E, Coton M (2009). Evidence of horizontal transfer as origin of 
strain to strain variation of the tyramine production trait in 
Lactobacillus brevis. Food Microbiol. 26(1): 52-57. 

Cruz F, Davies J (2000). Horizontal gene transfer and the origin of 
species: lessons from bacteria. Trends Microbiol. 8(3): 128-133.  

Fekete PZ, Schneider G, Olasz F, Blum-Oehler G, Hacker JH, Nagy B 

(2003). Detection of a plasmid-encoded pathogenicity island in F18
+
 

enterotoxigenic and verotoxigenic Escherichia coli from weaned pigs. 
Int. J. Med. Microbiol. 293(4): 287-298. 

Fetherston JD, Perry RD (1994). The pigmentation locus of Yersinia 

pestis KIM6
+
 is flanked by an insertion sequence and includes the 

structural genes for pesticin sensitivity and HMWP2. Mol. Microbiol. 
13(4): 697-708.  

Garabal JI, Vázquez F, Blanco J, Blanco M, González EA (1997). 
Colonization antigens of enterotoxigenic Escherichia coli strains 
isolated from piglets in Spain. Vet. Microbiol. 54(3-4): 321-328. 

Hacker J, Kaper JB (2000). Pathogenicity islands and the evolution of 
microbes. Annu. Rev. Microbiol. 54: 641-679. 

Jain R, Rivera MC, Lake JA (1999). Horizontal gene transfer among 
genomes: the complexity hypothesis. Proc. Natl. Acad. Sci. USA. 
96(7): 3801-3806. 

Levine MM (1987). Escherichia coli that cause diarrhea: entero-
toxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and 
enteroadherent. J. Infect. Dis. 155(3): 377-389. 

Martins MF, Martinez-Rossi NM, Ferreira A, Brocchi M, Yano T, Castro 
AF, Silveira WD (2000). Pathogenic characteristics of Escherichia coli 

strains isolated from newborn piglets with diarrhea in Brazil. Vet 
Microbiol. 76(1): 51-59. 

 
 
 
 

 
Moneoang MS, Bezuidenhout CC (2009). Characterization of 

enterococci and Escherichia coli isolated from commercial and 
communal pigs from Mafikeng in the North-West Province, South 
Africa. Afr. J. Microbiol. Res. 3(3): 88-96.  

Nagy B, Fekete PZ (2005). Enterotoxigenic Escherichia coli in 
Veterinary Medicine. Int. J. Med. Microbiol. 295(6-7): 443-454.  

Nagy B, Fekete PZ (1999). Enterotoxigenic Escherichia coli (ETEC) in 
farm animals. 30(2-3): 259-284. 

Nair GB, Takeda Y (1998). The heat-stable enterotoxins. Microb Pathog.  
24(2): 123-131.  

Nataro  JP,  Kaper  JB  (1998).  Diarrheagenic  Escherichia  coli.  Clin. 
Microbiol. Rev. 11(1): 142-201. 

Ojeniyi B, Ahrens P, Meyling A (1994). Detection of fimbrial and toxin 
genes in Escherichia coli and their prevalence in piglets with 
diarrhoea. The application of colony hybridization assay, polymerase 
chain reaction and phenotypic assays. Zentralbl Veterinarmed B. 
41(1): 49-59.  

Oli MW, Petschow BW, Buddington RK (1998). Evaluation of 
fructooligosaccharide supplementation of oral electrolyte solutions for 
treatment of diarrhea: recovery of the intestinal bacteria. Dig. Dis. Sci. 
43(1): 138-147.  

Paauw A, Caspers MP, Leverstein-van Hall MA, Schuren FH, Montijn 
RC, Verhoef J, Fluit AC (2009). Identification of resistance and 
virulence factors in an epidemic Enterobacter hormaechei outbreak 
strain. Microbiology. 155(Pt5): 1478-1488.  

Perry RD, Pendrak ML, Schuetze P (1990). Identification and cloning of 
a hemin storage locus involved in the pigmentation phenotype of 
Yersinia pestis. J. Bacteriol. 172(10): 5929-5937. 

Petermann SR, Sherwood JS, Logue CM (2008). The Yersinia high 
pathogenicity island is present in Salmonella enterica Subspecies I 
isolated from Turkeys. Microb. Pathog. 45(2): 110-114. 

Schubert S, Rakin A, Karch H, Carniel E, Heesemann J (1998). 
Prevalence of the "high-pathogenicity island" of Yersinia species 
among E. coli strains that are pathogenic to humans. Infect. Immun. 
66(2): 480-485.  

Smith HW, Gyles CL (1970). The relationship between two apparently 
different enterotoxins produced by enteropathogenic strains of 
Escherichia coli of porcine origin. J. Med. Microbiol. 3(3): 387-401. 

Stevenson GW (1999). Brachyspira (Serpulina) pilosicoli and intestinal 
spirochetosis: How much do we know? J. Swine Health Prod. 7(6): 
287-291. 

Syvanen M (1999). In search of horizontal gene transfer. Nat 
Biotechnol. 17(9): 833. 

Wilson RA, Francis DH (1986). Fimbriae and enterotoxins associated 

with E. coli serogroups isolated from pigs with colibacillosis. Am. J. 

Vet. Res. 47(2): 213-217. 


