




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 3 (10), pp. 001-009, October, 2015. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 
 

Full Length Research Paper 

 

Real-time TaqMan polymerase chain reaction to 
quantify the effects of different sources of dietary 
starch on Bifidobacterium in the intestinal tract of 

piglets 

 
Zhentian Xiang, Hongwei Qi, Guoquan Han, Jingbo Liu, Zhiqing Huang, Bing Yu and 

Daiwen Chen* 

 
Institute of Animal Nutrition, Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of 

Education, Sichuan Agricultural University, Ya’an, Sichuan 625014, People’s Republic of China. 
 

Accepted 21 March, 2015 
 
Twenty-eight PIC male piglets (similar birth and parity, weaned at 21±1.5 days) were used to study the effect of the 
different sources of dietary starch on the number of Bifidobacteria in the digesta of the duodenum, jejunum, ileum, 
cecum and colon. Pigs were randomly assigned to one of four diets formulated with corn starch, wheat starch, 
tapioca or pea starch. The determined ratio of amylose to amylopectin for these starches was 0.21, 0.24, 0.12 and 
0.52, respectively based on the 16s rRNA sequences of maximum species of Bifidobacterium from GenBank to 
design the primers and probe. TaqMan polymerase chain reaction was developed to quantify the number of 
Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of 
piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time 
quantitative PCR assays can be allowed for rapid, convenient, reproducible and steady quantification of the 
Bifidobacterium in the intestinal content of piglets. Additionally, the present study revealed that high 
amylose/amylopectin ratio of starches significantly enhanced the numbers of Bifidobacterium in all segments of 
intestine. 

 

Key words: Starch, Bifidobacterium, Taq-man polymerase chain reaction (PCR), weaned pigs. 

 
INTRODUCTION 

 
Nowadays, weaned piglets undergo a transition from milk-
based diet to adult-type plant-based diet. The transition 
combined with the stress of being transported to production 
farms is often followed by a period of low feed intake 
(Brooks et al., 2003). The combination of these stresses can 
lead to intestinal malfunctions, intestinal microbiota in 
particular, which is subsequently followed by a reduced 
growth performance, diarrhea and mortality (Mikkelsen et al., 
2004a; Spreeuwenberg et al., 2001a).  

The gastrointestinal tract (GIT) of pigs is harbored by 
dense and diverse bacteria (Pryde et al., 1999). Because 
there is a more stable microbial ecosystem when bacterial  
 
 

 
*Corresponding author. E-mail: daiwenc@yahoo.com. Tel: +86- 
835-2882088. Fax: +86-835-2885106. 

 
 
 

 
diversity is increased, microbial diversity has been proposed 
as an indicator of the intestinal stability and health 
(Zoetendal et al., 2004). The gut microbial communities are 
affected by various factors, including the diets (Duncan et 
al., 2007a), environment (Pluske et al., 2007) and so on. 
Diet changes are likely to have a direct influence to place 

stress on the stability of bacterium and affect the entire GIT 
eco-physiology in lifestyle (Spreeuwenberg et al., 2001b). 
Certain dietary non-digestible carbohydrates can allow 
specific changes in the composition or activity of the 
intestinal microbiota (Roberfroid, 2007) and selectively 
stimulate the growth of the health-promoting bacteria 
(Bifidobacterium and Lactobacillus) in the gastrointestinal 
tract (GIT) and potentially prevent or moderate intestinal 
infections (Ebersbach et al., 2010; Kaplan et al., 2000).  

Indigenous Bifidobacteria are believed to play an 
important role for animal and human health and immune 



 
 
 

 

function (Orrhage et al., 2000) and it is considered to be 
the target organism due to their potential to inhibit the 
growth of pathogenic bacteria that may prevent intestinal 
disorders (Mikkelsen et al., 2004b). Yazawa et al. (1978) 
explained that, Bifidobacteria are able to suppress 
pathogenic bacteria (Escherichia coli) because they 
utilize oligo- and polysaccharides that other intestinal 
bacteria cannot use.  

Starches are the main source of carbohydrates in 
mixed diets and the major source of energy for mono-
gastric animal and human (Deng et al., 2009a). They are 
α-glucans and exist in two forms: amylopectin and 
amylose (Cummings et al., 1995). Starch are classified 
into rapidly digestible starch (RDS), slowly digestible 
starch (SDS) and resistant starch (RS) (Englyst et al., 
1999), where RDS and SDS are digested in proximal 
intestinal tract and the major digested products are 
absorbed in small intestine. However, the non-digestible 
starches (RS) together with a small quantity of digested 
products can reach the large bowel (Aspvan et al., 1996; 
Conlon et al., 2009). They have significant effects on the 
composition of the intestine microbiota, tending to 
increase bacteria associated with a healthy bowel and 
tending to decrease those potential diseases (Conlon et 
al., 2009). Pieper et al. (2009) reported that, the ratio of 
amylose to amylopectin and starch sources affected the 
abundance of Bifidobacterium spp. in vitro, in particular 
high-amylose maize starch granules. Consequently, the 
ratio of amylose to amylopectin of starch may enhance 
desirable intestinal bacteria and induce beneficial gut 
health. However, the underlying mechanism is still unclear.  

The aim of the present study was based on the 16s 
rRNA sequences of different species of Bifidobacterium 
from GenBank to design the primers and probe. TaqMan 
polymerase chain reaction was developed to quantify the 
number of Bifidobacterium. We used this assay to 
investigate the effects of different sources of dietary 
starch (CS; corn starch, WS; wheat starch, TS; tapioca 
starch and PS; pea starch) on the presence of 
Bifidobacterium in the intestinal tract digesta of piglets, 
including duodenum, jejunum, ileum, cecum and colon.  

Nowadays, weaned piglets undergo a transition from 
milk-based diet to adult-type plant-based diet. The 
transition combined with the stress of being transported 
to production farms is often followed by a period of low 
feed intake. 
 

 
MATERIALS AND METHODS 
 
Animals and housing 

 
Twenty-eight PIC male piglets (similar birth and parity), weaned at 
21±1.5 days of age were used. They were fed in the Animal Center 
of Animal Nutrition Institute in Sichuan Agricultural University 

(Ya
’
an, China). They were kept in special metabolism pens over 24 

days (3 days pre-experimental and 21 days experimental periods) 
in a thermo regulated environment (ambient temperature 22°C and 
relative humidity 55%). They had ad libitum access to feed or water. 

 
 
 
 

 
Experimental design 
 
The experimental pigs were distributed into four blocks of seven 
piglets each according to body weight. Treatments were arranged 
simple factor with four sources of starch (corn starch, wheat starch, 
pea starch and tapioca starch). Experimental diets were formulated 
to meet NRC (1998) nutrient requirements for piglets weighing 5 to 
10 kg. Ingredients and chemical composition of experimental diets 
are presented in Table 1. Antibiotic growth promoters were not 
included in the diets. Diets were balanced in essential amino acid 
concentration (lysine, methionine + cysteine and tryptophan) and 
had similar general energy (GE), crude protein (CP), starch (St) 
content, amylose content and amylopectin content. 

 

Digesta sampling 
 
At the end of the experiment, the pigs was held under general 
anesthesia and killed by an intracardiac injection of sodium 
pentobarbital (30 mg/kg BW) after 2 h feeding. Following 
euthanasia the abdominal cavity was opened from sternum to pubis 
to expose the gastrointestinal tract without damaging the wall of the 
digestive tract. The small intestine and large intestine were tied off 
respectively, and 5 to 10 cm sections of the duodenum, jejunum, 
ileum, cecum and colon were tied off.  

The digesta of the duodenum, jejunum, ileum, cecum and colon 
were removed immediately and stored at -80°C until further 
analyses. The small intestine was stripped free of its mesentery 
and further divided into 3 sections: (1) the ileum from the ileal-cecal 
junction to 80 cm anterior to this junction; (2) the duodenum, 80 cm 
posterior to the gastro-duodenal sphincter; (3) the jejunum 
constituted the regions between the ileum and duodenum (Adeola 
et al., 2006). 

 

Extraction of DNA from digesta 
 
Genomic DNA from the Bifidobacterium adolescentis (ATCC15703) 
was extracted from the cultures with a TaKaRa minibest bacterial 
genomic DNA extraction kit (TaKaRa, Dalian, China), according to 
the manufacturer’s instructions. Bacterial DNA from the digesta 
samples was extracted using an E.Z.N.A.TM stool DNA isolation kit 
(Omega Bio-Tek, Doraville, CA) according to the manufacturer’s 
specifications. The final elution volume was 100 µl and the 
concentration was determined by spectrophotometer (Beckman 
Coulter DU 800, Fullerton, CA). 

 

Designing and validation of primers 
 
Primers and probe (Table 2) were designed with primer express 3.0 
(Perkin Elmer Applied Biosystem, San Francisco, California) for 
quantitative detection of particular Bifidobacterium. 16S rRNA 
sequences of maximum species of each genus encountered in the 
swine intestinal tract were downloaded from the GenBank database 
as well as EMBL and DDBJ. The sequence of the Bifidobacterium 
blocks of hyper variable regions was comprised with all other 
genera in order to avoid any non-specific amplification, the 
sequences of all the genera fetched from the database were 
submitted to DNAStar (MegAlign) programme (DNASTAR, Inc., 
Madison, WI). These sequences were then submitted to second 
round of alignment where the maximum number of species 
belonging one genus was aligned and the regions showing 
conservations were selected as Bifidobacterium genus-specific 
primers and probe. To further ensure that the oligonucleotide 
sequences were complementary pairing with the target genus only, 
they were checked with GenBank program BLAST (NCBI BLAST, 
http://blast.ncbi.nlm.nih.gov/Blast.cgi) and RDP program Check- 



  
 
 

 
Table1. Ingredients and nutrient levels in the experimental diets (%).  

 
Ingredient CS diet PS diet TS diet PS diet 

Corn starch (86%) 54.5    

Wheat starch (87%)  54.5   

Tapioca starch (86.5%)   54.5  

Pea starch (88%)    54.5 

Decupled soybean meal 2 2 2 2 

Soybean protein concentrate 17.83 17.83 17.83 17.83 

Soybean meal 10 10 10 10 

Whey 7.3 7.3 7.3 7.3 

Fish meal 6 6 6 6 

Calcium carbonate 0.55 0.55 0.55 0.55 

Monocalcium phosphate 0.7 0.7 0.7 0.7 

Sodium chloride 0.15 0.15 0.15 0.15 

DL-Met (98%) 0.17 0.17 0.17 0.17 

L-Thr (98.5%) 0.01 0.01 0.01 0.01 

Chromium Oxide 0.4 0.4 0.4 0.4 

Premix* 0.39 0.39 0.39 0.39 

Total 100 100 100 100 

Nutrient levels (%)     
Total starch 51.71 51.17 51.98 52.92 

Amylose 8.81 9.76 5.42 17.26 

Amylopectin 42.9 41.41 46.56 33.66 

Amylose/Amylopectin ratio 0.21 0.24 0.12 0.52 

Cross energy(KJ/g) 14.5 14.43 14.49 14.51 

Crude protein 19.9 19.87 19.87 19.99 

Lys 1.29 1.29 1.29 1.29 

Met+Cys 0.74 0.74 0.74 0.74 

Thr 0.81 0.81 0.81 0.81 

Try 0.25 0.25 0.25 0.25 

Crude fiber 1.36 1.37 1.37 1.35 

Crude fat 2.6 2.53 2.58 2.62 
 

*Supplied per kg diet: 6.0 mg of Cu as CuSO4 5H2O, 100 mg of Fe as FeSO4 7H2O, 4 mg Mn of as 

MnSO4 H2O, 100 mg of Zn asZnSO4 H2O, 0.3 mg of Se as Na2SeO3, 0.3 mg of I as KI, 1000 mg of 
choline chloride (50%), 200 mg of sweeteners, 0.04% of vitamin premix.  

 

 
Table 2. Sequences of oligonucleotide primers and probe.  

 

Assay Primer/probe name and sequence (5′-3′) 
Product Annealing 

Reference  

size(bp) temperature (°C)  

   
 

     
 

All bacteria 
Eub338F, ACTCCTACGGGAGGCAGCAG 

200 60 
(Fierer   et   al., 

 

Eub518R, ATTACCGCGGCTGCTGG 2005)  

   
 

    
 

Bifidobacterium 
SB-P1, AGGGCTCGTAGGCGGTTCGTC 

264 56.8 This study 
 

SB-P2, CCCCACATCCAGCATCCA 
 

    
 

 SB-F, CGCGTCCGGTGTGAAAG   
This study  

Bifidobacterium SB-R, CTTCCCGATATCTACACATTCCA 126 60 
 

 
  

SB-P, (FMA) ATTCCACCGTTACACCGGGAA(BHQ-1)  



 
 
 

 
Table 3. Reference strains used in this study and quantitative real-time PCR test results of reference strains.  

 

Reference strain 
Real-time PCR test result* 

 

   

SL-F,SL-R,SL-P Eub338F, Eub518R 
 

 
  

Bifidobacterium adolescentis ATCC15703(D) 
 

Bifidobacterium animalis CICC6165(A) 
 

Bifidobacterium suis SB08ZY(E) 
 

Bifidobacterium suis SB09NJ01(E) 
 

Bifidobacterium suis SB09NJ02(E) 
 

Lactobacillus acidophilus CICC6005(A) 
 

Lactobacillus plantarum CICC6009(A) 
 

Lactobacillus suis SL0501(E) 
 

Lactobacillus suis SL0502(E) 
 

Lactobacillus suis SL0503(E) 
 

Bacillus subtilis ATCC6633(D) 
 

Bacillus cereus CMCC63302(D) 
 

Bacillus subtilis Bs01J(E) 
 

Bacillus subtilis Bs02J(E) 
 

Bacillus pumilus Bp0106(E) 
 

Escherichia coli ATCC8739(D) 
 

Escherichia coli ATCC25922(D) 
 

Entero-hemorrhagic Escherichia coli O157:H7(D) 
 

Porcine pathogenic Escherichia coli E.c0401(F) 
 

Porcine pathogenic Escherichia coli E.c0402(F) 
 

Staphylococcus aureus ATCC25923(C) 
 

Staphylococcus aureus ATCC6538(C) 
 

Streptococcus hemolytic-β CMCC32210(D)  

 
+ + 
 
+ + 
 
+ + 
 
+ + 
 
+ + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 
- + 
 

A, Purchased from China center of industrial culture collection; B, isolated from the attenuated live vaccine of Salmonella 
choleraesuis; C, saved in laboratory of veterinary pharmacology of Sichuan agricultural university; D, saved in laboratory of 
preventive veterinary medicine of Sichuan agricultural university; E, isolated from healthy pig intestine by laboratory of 
preventive veterinary medicine of Sichuan agricultural university; F, isolated from clinical samples by laboratory of 
preventive veterinary medicine of Sichuan agricultural university. *Amplification results with primers SL -F/SL-R and probe 
SL-P for validation specificity; *amplification results with primers Eub338F/ Eub518R for verification feasibility; ‘+’ 
represents positive test results; ‘-’ represents Negative test results. 

 

 

Probe (Details about RDP data and analytical functions can be 
found at http://rdp.cme.msu.edu/). Primers (Table 2) for all bacteria 
were obtained from the published work (Fierer et al., 2005). All the 
primers and probe were commercially synthesized from invitrogen 
(Shanghai, China). 
 
Reference strains, culture conditions and genome extraction 
 
The source of strain and reference strains used in this study were 
described in detail in Table 3. Briefly, five strains of Bifidobacterium, 
five strains of Lactobacillus, five strains of Bacillus, five strains of E. 
coli, two strains of Staphylococcus aureus, four strains of 
Salmonella and four strains of Streptococcus were used in this 
study. The strains were cultured anaerobically or aerobically in LB 
broth supplemented with 1% glucose at 37°C for 12 to 48 h. Total 
genomic DNA from the different reference strains was extracted 
and purified by using the method described in related kit manual 
(E.Z.N.A. TM Bacterial DNA kit, OMEGA Bio-Tek, USA). 

 
 

 
Standard curve generation 
 
To quantify the number of Bifidobacterium and all bacteria in test 

samples, the standard curves were produced by constructing two 

specific standard control plasmids. Two amplicons were produced first. 

The 264 bp fragment was amplified, DNA extracted from B. 

adolescentis (ATCC15703), using the primers (Table 2) SB-P1 and SB-

P2 and the following conditions: 95°C 5 min, followed by 35 cycles of 

95°C 30 s, 56.8°C for 30 s, 72°C for 20 s, with a final extension of 72°C 

for 10 min. The 200 bp fragment was amplified, DNA extracted from the 

test samples, using the primers (Table 2) Eub338F and Eub518R 

(Fierer et al., 2005) and the following conditions: 95°C 5 min, followed 

by 32 cycles of 95°C 30 s, 55°C for 30 s, 72°C for 30 s, with a final 

extension of 72°C for 10 min. The amplified products were eluted from 

the agarose gel using TIANquick mini purification kit (TIANGEN, Beijing, 

China) and cloned into the pMD19-T vector (TaKaRa, Dalian, China). 

Plasmids DNA was purified using the E.Z. N.A TM plasmid miniprep kit 

(OMEGA Bio-Tek, USA). Clones were screened for the inserts using 



 
 
 

 
the appropriate restriction enzymes and positive clones were 
sequenced. DNA concentration of the plasmids preparation was 
determined by spectrophotometer (Coulter DU 800, Beckman, 
USA) and the copy number calculated using the following formula: 
(DNA concentration in µg/µl × 6.0233 × 1023 copies/mol)/ (DNA 

size(bp) × 660 ×10
6
). A 10-fold dilution series of the plasmid DNA 

(1× 10
8
 to 1× 10

1
 copies/µl) was prepared and used to generate the 

standard curve. Target copy numbers for each reaction were 
calculated from the standard curves. 
 
 
Quantitative PCR conditions and validation of primers 
specificity 
 
All primers and probe used in this study are presented in Table 2. 
Real-time quantitative PCR was carried out with IQ5 real-time PCR 
detection System (Bio-Rad, CA, USA) using optical grade 96-well 
plates in a final volume of 25 µl. Reaction system was composed of 
12.5 μl SYBR Premix Ex Taq (2×), 1 μl each of forward and reverse 
primers (100 nM), 9.5 μl ddH2O and 1 μl DNA in each reaction for 
detecting all bacteria. The following cycling condition: 1 cycle of 
predenaturation at 95°C for 20 s; 40 cycles of denaturation at 95°C 
for 5 s; annealing at 60°C for 30 s and extension at 72°C for 50 s. 
Melting curve conditions were 95°C for 0 s, 55°C for 1 min and 
95°C for 1 min (temperature change velocity: 0.5°C/s). For 
Bifidobacterium a PrimerScriptTM PCR kit (perfect real time) 
(TaKaRa, Dalian, China) was used with 100 nM of genus-specific 
primers and fluorescent probe. The reaction protocol was 
composed of 1 cycle of predenaturation at 95°C for 2min; 50 cycles 
of denaturation at 95°C for 15 s; annealing at 60°C for 30 s and 
extension at 72°C for 50 s. The genomic DNA of each reference 
strain was detected using quantitative real-time PCR with primers 
SB-F and SB-R and probe SL-P for validation specificity and with 
primers Eub338F and Eub518R for verification feasibility. 
 
 
Statistical analysis 
 
The dates were analyzed using SPSS12.0. A one-way ANOVA 
procedure was carried out for all data. All results were expressed as 
means ± SD. The results were statistically analyzed using least 
significant difference test. P < 0.05 was considered significant. 
 

 

RESULTS 

 

Specific verification of quantitative PCR products 

 

The primers of quantitative PCR were used for 
conventional PCR with B. acidophilus ATCC15703 (D) 
DNA templates for verifying the specific amplification. 
Results showed that, the PCR produced an intense band 
with the expected 126 bp (data not shown), which 
indicated 100% specificity. 
 

 

Quantitative PCR standard curve 

 

Real-time quantitative PCR is the ability to quantitate 
bacterial abundance in various complex environmental 
samples. The correlation coefficient for the associated 
standard curve was 0.998 and PCR efficiency was  
111.4%. Amplification efficiencies, calculated using the 

equation: E = 10
[-1/slope]

 (AmannLudwig et al., 1995), 

  
  

 
 

 

indicating that, the crossing threshold values for the 
standards fell within an acceptable range. The numbers 
of DNA copies for detecting samples was calculated by 
using the following equation: Y= -3.075X + 47.94 (where, 

Y is the threshold cycle (Ct) and X is the Log10 (copy 
number of 16S rDNA)) (Figure 1). 
 

 

Reproducibility 
 

Four different known concentrations of DNA (1.2 ×10
9
-1.2 

× 10
6
 copies/μl) were amplified by performing the assay 

described earlier in triplicate for verifying the reproduci-
bility between experiments. The results showed that, the 
assay was highly reproducible, because the coefficient of 
variation was statistically low, at < 1.5%. The threshold 

cycle for each concentration ranged from 1.2 × 10
9
 

copies/μl to 1.2 × 10
6
 copies/μl and was different 

between 0.1 and 0.3 cycles (Figure 2). 
 

 

Specificity of the PCR 

 

All thirty bacterial strains were used to evaluate the 
specificity of the real-time quantitative PCR, which that 
indicated only Bifidobacterium genomic strains can show 
positive results. However, there was no amplification with 
other bacteria group (Figure 3). 
 

 

Starch composition of experimental diets 

 

Total starch content was basically similar among corn, 
wheat, tapioca and pea treatment. The ratio of amylose 
and amylopectin was 0.21, 0.24, 0.12 and 0.52, respec-
tively (Table 1). 
 

 

Enumeration of Bifidobacterium group and all 
bacteria 

 

Real-time PCR analysis was performed to determine the 
numbers of Bifidobacterium and all bacteria in the 
intestine content of all piglets. The copy numbers of all 
bacteria in the digesta of proximal intestine were not 
affected by the different dietary treatment (Table 4). 
However, the copy numbers of all bacteria in the cecal 
and colon content of piglets fed PS was significantly 
lower than all other treatment (P < 0.05) (Table 4). The 
copy numbers all bacteria and Bifidobacterium was lowest  
for the duodenum and increased towards the colon 
(Table 4). The numbers of Bifidobacterium was the 
highest in all groups (P < 0.05) (Table 4). However, there 
was a tendency for lower numbers of Bifidobacterium in 
all segments of the intestinal tract of piglets fed TS. The 
copy numbers of all bacteria and Bifidobacterium in all 
segments of the intestinal tract of piglets was not affected 
between the CS and WS group. 



       
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 1. Linear relationship between threshold cycles and the copy number of 1 6S rDNA from Bifidobacterium. 

The standard curve was developed by using the standard DNA template with 10 fold serial dilutions. 1: 1 ×10
9
 

copies/μl; 2: 1 × 10
8
 copies/μl; 3: 1 × 10

7
 copies/μl; 4: 1 × 10

6
 copies/μl; 5: 1 × 10

5
 copies/μl; 6: 1 × 10

4
 copies/μl. 

Linear regression (R
2
 =0.998) results in an equation of Y= -3.075X + 47.94.  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. The values of two repeats of four different were showed to prove the reproducibility of developed real-time 
quantitative PCR. 

 

 

The percentage of Bifidobacterium based on all 
bacteria 

 

The percentage of Bifidobacterium (based on all bacteria) 
in all intestinal segments content were affected among 
dietary treatments (Table 4). However, there was no 
effect between the CS group and WS group. The percen-
tage of Bifidobacterium (based on bacteria) in PS group 
was the highest among all treatments (P < 0.05) (Table 
4). Meanwhile, the percentage of Bifidobacterium (based 
on bacteria) in PS group was the lowest among all the 
treatments (P < 0.05) (Table 4). 

 
 

 

DISCUSSION 

 

This experiment was conducted to evaluate the influence 
of dietary starch (different amylose/amylopectin ratio) on 
microbial populations of duodenum, jejunum, ileum, 
cecum and colon in piglets. In this study, the GE, CP, St, 
lysine, methionine + cysteine and tryptophan contents 
were all similar in the four experimental diets with the 
different starch sources, while there were differences in 
the amylose/amylopectin ratio of the starch.  

Bifidobacterium is considered to be a beneficial compo-
nent of the intestinal microbiota which can establish an 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

Figure 3. 1-5 are curves of Bifidobacterium; 6-30 are curves of Lactobacillus, bacillus, salmonella, 
E. coli, S. aureus and Streptococcus (the strains were shown in Table 3). 

 

 
Table 4. THE copy numbers of all bacteria, Bifidobacterium and the percentage of Bifidobacterium (based on all bacteria) 
in the all intestinal segments content of piglets among different dietary starch sources treatments.  

 
 Parameter Corn starch Wheat starch Tapioca starch Pea starch 

 All Bacteria     

 Duodenum （2.26±0.74）×10
9
 （2.55±0.56）×10

9
 （2.83±0.86）×10

9
 （2.07±0.59）×10

9
 

 Jejunum （7.35±2.04）×10
9
 （8.58±1.81）×10

9
 （1.38±0.88）×10

10
 （1.09±0.37）×10

10
 

 Ileum （7.74±2.93）×10
9
 （8.28±2.29）×10

9
 （7.06±1.19）×10

9
 （6.60±3.20）×10

9
 

 Cecum （2.79±0.90a）×10
11

 （2.33±0.63a）×10
11

 （2.29±0.69a）×10
11

 （1.67±0.81b）×10
11

 

 Colon （4.83±1.20a）×10
11

 （5.28±2.12a）×10
11

 （4.23±1.27a）×10
11

 （1.84b±0.82）×10
11

 

 Bifidobacterium     

 Duodenum （5.49±0.69b）×10
6
 （6.03±0.57b）×10

6
 （3.52±0.76c）×10

6
 （8.04±1.38a）×10

6
 

 Jejunum （1.53±0.42b）×10
7
 （1.64±0.65b）×10

7
 （4.14±0.59b）×10

6
 （3.85±1.78a）×10

7
 

 Ileum （8.72±3.08b）×10
6
 （1.04±0.22b）×10

7
 （3.44±0.93c）×10

6
 （2.32±0.31a）×10

7
 

 Cecum （5.91±2.26b）×10
8
 （5.45±1.17b）×10

8
 （2.86±1.05c）×10

8
 （1.23±0.15a）×10

9
 

 Colon （3.76±1.21b）×10
8
 （3.89±0.89b）×10

8
 （7.56±2.80b）×10

7
 （1.24±0.53a）×10

9
 

 B/A (%)*     
 Duodenum 0.26±0.08b 0.25±0.05b 0.13±0.01c 0.41±0.07a 

 Jejunum 0.22±0.09b 0.19±0.08b 0.04±0.02c 0.35±0.09a 

 Ileum 0.12±0.02b 0.14±0.05b 0.05±0.02c 0.36±0.05a 

 Cecum 0.21±0.06b 0.24±0.05b 0.13±0.04c 0.74±0.05a 

 Colon 0.08±0.03b 0.09±0.04b 0.02±0.01c 0.69±0.17a 
 

The dates are expressed as mean values ± the standard deviation for all samples. 
a, b, c

 means with different superscripts in the 
row differed significantly (P < 0.05). * B/A (%): the percentage of Bifidobacterium (based on all bacteria). 

 

 



 
 
 
efficient barrier to the invasion and colonization of the gut 
by putrefactive and pathogenic bacteria and produces a 
range of metabolic substrates such as short chain fatty 
acids, especially butyrate. It is used by the host and 
stimulates the immune system in a non-inflammatory 
manner (Crittenden et al., 1999; Lene Lind et al., 2004; 
Trevisi et al., 2008). In the present study, real-time TaqMan 
polymerase chain reaction assays is developed targeting 
the 16S rRNA gene to quantify Bifidobacterium groups in 
the intestinal tract content of weaned-piglets and thirty 
bacterial strains were used to assess the specificity of the 
PCR. Positive results were only observed in Bifidobacterium 
genomic strains, while there was no amplification with 
other spp. (Figure 3). 

Fluorescent quantitative has become a potential 
powerful method to quantify the population of gastro-
intestinal tract microbial due to its convenience, rapidity, 
reproducibility and accuracy (Deng et al., 2008; Deng et 
al., 2007). In recent studies, real-time quantitative PCR 
has been shown to be an available tool for quantifying 
bacterial abundance in many different kinds of complex 
environmental samples down to the genus and species 
level (Skovhus et al., 2004; WellinghausenFrost et al., 
2001; Wilks et al., 2006). Real-time quantitative PCR 
provides information on the relative and absolute abun-
dance of a genus and species in complex environmental 
samples. Such detailed information can often be difficult 
to obtain and investigate with conventional cell enume-
ration methods such as most probable number and direct 
cell counting methods (Skovhus et al., 2004). The specific 
primer-probe combination is an available alternative for 
detecting the counts of intestinal bacterial species (Dario 
De Medici et al., 2003; Deng et al., 2007). Four different 

known concentrations of DNA (1.2 ×10
9
-1.2 × 10

6
 

copies/μl) were amplified by performing the assay 
described earlier in triplicate. Analysis of these values 
proved that the assay was reproducible. Meanwhile, the 
detected results showed that the coefficient of variation 
was statistically low, at < 1.5%. The main advantage of 
fluorescent quantitative PCR is the ability to quantitate 
unknown samples. In summary, a new real-time PCR 
assays was developed that allowed for rapid, convenient,  
reproducible and steady quantification of the Bifidobacterium 

group in the intestinal content of piglets.  
The gastrointestinal tract of pigs is colonized by a 

densely diverse bacterium and the intestinal microbiota 
has important influence on animal health and growth 
performance (Leser et al., 2000; Moore et al., 1987). 
Meanwhile, the gut microbial communities are affected by 
various factors, such as the diets and environment 
(Duncan et al., 2007b; Pluske et al., 2007). Generally, 
Bifidobacterium can hydrolyze such polysaccharides, as 
starch and cellulose and so on. Starches are the main 
source of carbohydrates and energy for monogastric 
animal and human (Deng et al., 2009b). Here, high 
amylose/amylopectin ratio starch (PS) can increase the 
number of Bifidobacterium and the percentage of its 
(based on all bacteria) intestinal digesta of piglets. We 
also showed that, the low amylose/amylopectin ration 
starch (TS) can decrease the percentage of Bifidobacterium 
(based on all bacteria). Feeding high amylose starch can 

enhance the population of Bifidobacterium and short 
chain fatty acids in the colon and fecal content of 
mammals (Brown et al., 1997; Chang et al., 2006; Wang 
et al., 2002). Chang et al. (2006) found that high amylose 
starch diet resulted in increased Bifidobacterium growth 
compared with the low amylose starch diets in cecal 
contents of rats.  

Brown et al. (1997) reported that, feeding high amylose 
starch to pigs increased fecal Bifidobacterium population 
compared with feeding low amylose starch. Pieper et al. 
(2009) reported that, the ratio of amylose to amylopectin 
and starch sources affected the abundance of 
Bifidobacterium spp. in vitro model of porcine gastrointes-
tinal tract. Those results are in agreement with the 
present study in vivo of porcine intestinal tract. Another 
results in this study suggested that, the high 
amylose/amylopectin ratio PS can increase the 
Bifidobacterium numbers not only in the distal intestinal 
digesta but also in the proximate digesta. However, the 
high amylose/ amylopectin ratio PS decreased the 
number of all bacteria in the cecal and colon chymus of 
piglets, while the copy numbers of all bacteria in the 
digesta of proximal intestine were not affected by the 
different dietary treatment. These changes need a further 
study.  

In conclusion, we developed a new real-time Taq-man 
PCR assays that allowed for rapid, convenient, reproducible 
and steady quantification of the Bifidobacterium group in 
the intestinal content of piglets. Additionally, the present 
study revealed that high amylose/amylopectin ratio of 
starches significantly enhanced the numbers of 
Bifidobacterium in digesta of the all intestine segment. 
The new methodology used in this study provides an 
important tool for studying the influence of different starch 
diet on the endogenic Bifidobacterium numbers in gastro-
intestinal tract of pigs. 

 

ACKNOWLEDGEMENTS 
 

This work was supported by the Program for Changjiang 
Scholars and Innovative Research Team in University of 
China (IRT0555-5) and the earmarked fund for Modern 
Agro-industry Technology Research System of China 
(CARS-36). 
 
 
REFERENCES 
 
Adeola O,King DE (2006). Developmental changes in morphometry of 

the small intestine and jejunal sucrase activity during Developmental 
changes in morphometry of the small intestine and jejunal sucrase 
activity during the first nine weeks of postnatal growth in pigs. J. Ani. 
Sci. 84(1): 112-118.  

Amann R, Ludwig W, Schleifer K (1995). Phylogenetic identification and 
in situ detection of individual microbial cells without cultivation. 
Microbiol. Rev. 59:143-169.  

Asp NG, van Amelsvoort JM, Hautvast JG (1996). Nutritional 
implications of resistant starch. Nutr. Res. Rev. 9(1): 1-31.  

Brooks PH (2003). Factors affecting the voluntary feed intake of the 
weaned pig.In Weaning the Pig . Wageningen: Academic Publishers.  

Brown I, Warhurst M, Arcot J, Playne M, Illman RJ, Topping D L (1997). 
Fecal numbers of bifidobacteria are higher in pigs fed Bifidobacterium 
longum with a high amylose cornstarch than with a low amylose 
cornstarch. J. Nutr. 127(9): 1822-1827.  

 



 
 
 
 
Chang MJ, Soel SM, Bang MH, Park JH, Kang NE, Kim WK (2006). 

Interactions of high amylose starch and deoxycholic acid on gut 
functions in rats. Nutrition. 22(2): 152-159.  

Conlon MA, Bird AR (2009). Interactive and individual effects of dietary 
non-digestible carbohydrates and oils on DNA damage, SCFA and 
bacteria in the large bowel of rats. Br. J. Nutr. 101(8): 1171-1177. 

Crittenden RG (1999). Prebiotics. In: Tannock GW, ed. Probiotics: A  
Critical Review . Wymondham, UK: Horizon Scientific Press.  

Cummings JH, Englyst HN (1995). Gastrointestinal effects of food 
carbohydrate. Am. J. Clin. Nutr. 61(4 Suppl): 938S-945S. 

Dario DM, Luciana C, Elisabetta D, Simona DP,Emma F, Laura T 
(2003). Evaluation of DNA Extraction Methods for Use in 
Combination with SYBR Green I Real-Time PCR To Detect 
Salmonella enterica Serotype Enteritidis in Poultry. Appl. Environ. 
Microbiol. 69(6): 3456-3461.  

Deng J, Wu X, Bin S, Li TJ, Huang R, Liu, Z (2010). Dietary amylose 
and amylopectin ratio and resistant starch content affects plasma 
glucose, lactic acid, hormone levels and protein synthesis in 
splanchnic tissues. J. Anim. Physiol. Anim. Nutr. (Berl).94(2): 220-
226.  

Deng SX, Cheng AC, Wang MS, Yan B, Yin NC, Cao SY (2008). The 
pathogenesis of Salmonella enteritidis in experimentally infected 
ducks: a quantitative time-course study using taqman polymerase 
chain reaction. Poult Sci. 87(9): 1768-1772.  

Deng SX, Cheng AC, Wang MS, Cao P (2007). Gastrointestinal tract 
distribution of Salmonella enteritidis in orally infected mice with a 
species-specific fluorescent quantitative polymerase chain reaction. 
World J. Gastroenterol, 13(48): 6568-6574.  

Duncan SH, Belenguer A, Holtrop G, Johnstone AM, Flint HJ, Lobley 
GE (2007a). Reduced dietary intake of carbohydrates by obese 
subjects results in decreased concentrations of butyrate and butyrate-
producing bacteria in feces. Appl. Environ. Microbiol. 73(4): 1073-
1078.  

Ebersbach T, Jorgensen JB, Heegaard PM, Lahtinen SJ, Ouwehand 
AC, Poulsen M (2010). Certain dietary carbohydrates promote 
Listeria infection in a guinea pig model, while others prevent it. Int. J. 
Food Microbiol. 140(2-3): 218-224.  

Englyst KN, Englyst HN, Hudson GJ, Cole TJ, Cummings JH (1999). 
Rapidly available glucose in foods: an in vitro measurement that 
reflects the glycemic response. Am. J. Clin. Nutr. 69(3), 448-454.  

Fierer N, Jackson J, Vilgalys R, Jackson R (2005). Assessment of soil 
microbial community structure by use of taxon-specific quantitative 
PCR assays . Appl. Environ. Microbiol. 71(7): 4117-4120.  

Kaplan H, Hutkins RW (2000). Fermentation of fructooligosaccharides 
by lactic acid bacteria and bifidobacteria. Appl. Environ. Microbiol. 
66(6): 2682-2684.  

Lene Lind Mikkelsen, Bent Borg Jensen (2004). Effect of fructo-
oligosaccharides and transgalacto-oligosaccharides on microbial 
populations and microbial activity in the gastrointestinal tract of 
piglets post-weaning. Anim. feed sci. technol. 117(1-2): 107-119.  

Leser TD, Lindecrona RH, Jensen TK, Jensen BB, Moller K (2000). 
Changes in bacterial community structure in the colon of pigs fed 
different experimental diets and after infection with Brachyspira 
hyodysenteriae. Appl. Environ. Microbiol. 66(8): 3290-3296.  

Mikkelsen LL, Jensen BB (2004a). Effect of fructo-oligosaccharides and 
transgalacto-oligosaccharides on microbial populations and microbial 
activity in the gastrointestinal tract of piglets post-weaning. Anim. 
Feed Sci. Technol. 117(1-2): 107-119.  

Moore WE, Moore LV, Cato EP, Wilkins TD, Kornegay ET (1987). Effect 
of high-fiber and high-oil diets on the fecal flora of swine. Appl. 
Environ. Microbiol. 53(7): 1638-1644.  

Orrhage K, Nord CE (2000). Bifidobacteria and lactobacilli in human 
health. Drugs Exp. Clin. Res. 26(3):95-111.  

Pieper R, Bindelle J, Rossnagel B, Van Kessel A, Leterme P (2009). 
Effect of carbohydrate composition in barley and oat cultivars on 
microbial ecophysiology and proliferation of Salmonella enterica in an 
in vitro model of the porcine gastrointestinal tract. Appl. Environ. 
Microbiol. 75(22): 7006-7016.  

Pluske JR, Durmic Z, Payne HG, Mansfield J, Mullan BP, Hampson DJ 
(2007). Microbial diversity in the large intestine of pigs born and 
reared in different environments. Livestock Sci. 108(1-3): 113-116.  

Pryde SE, Richardson AJ, Stewart CS, Flint HJ (1999). Molecular 
analysis of the microbial diversity present in the colonic wall, colonic 
lumen, and cecal lumen of a pig. Appl. Environ. Microbiol. 65(12): 
5372-5377. 

Roberfroid M (2007). Prebiotics: the concept revisited. J. Nutr. 137(3  
Suppl 2): 830S-837S.  

Skovhus TL, Ramsing NB, Holmstrom C, Kjelleberg S, Dahllof I (2004). 
Real-time quantitative PCR for assessment of abundance of 

Pseudoalteromonas species in marine samples. Appl. Environ. 
Microbiol. 70(4): 2373-2382.  

Spreeuwenberg MA, Verdonk JM, Gaskins HR, Verstegen MW (2001a). 
Small intestine epithelial barrier function is compromised in pigs with low 
feed intake at weaning. J. Nutr. 131(5): 1520-1527.  
Spreeuwenberg MA, Verdonk JM, Gaskins HR, Verstegen MW (2001b). 

Small intestine epithelial barrier function is compromised in pigs with 
low feed intake at weaning. J. Nutr. 131(5): 1520-1527.  

Trevisi P, De Filippi S, Minieri L, Mazzoni M, Modesto M, Biavati B 
(2008). Effect of fructo-oligosaccharides and different doses of 
Bifidobacterium animalis in a weaning diet on bacterial translocation 
and Toll-like receptor gene expression in pigs. Nutri. 24(10): 1023-
1029.  

Wang X, Brown IL, Khaled D, Mahoney MC, Evans AJ, Conway PL 
(2002). Manipulation of colonic bacteria and volatile fatty acid 
production by dietary high amylose maize (amylomaize) starch 
granules. J. Appl. Microbiol. 93(3): 390-397.  

Wellinghausen N, Frost C, Marre R (2001). Detection of legionellae in 
hospital water samples by quantitative real-time LightCycler PCR. 
Appl. Environ. Microbiol. 67(9): 3985-3993.  

Wilks SA, Keevil CW (2006). Targeting species-specific low-affinity 16S 
rRNA binding sites by using peptide nucleic acids for detection of 
Legionellae in biofilms. Appl. Environ. Microbiol. 72(8): 5453-5462.  

Yazawa K, Imai K, Tamura Z (1978). Oligosaccharides and 
polysaccharides specifically utilizable by bifidobacteria. Chem Pharm 
Bull (Tokyo). 26(11): 3306-3311.  

Zoetendal EG, Collier CT, Koike S, Mackie RI, Gaskins HR (2004). 
Molecular ecological analysis of the gastrointestinal microbiota: a 
review. J Nutr. 134(2): 465-472. 


