




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 5 (3), pp. 001-007, March, 2017. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

 

Full Length Research Paper 

 

The potential lipolysis function of musclin and its 

mRNA expression both in Pig adipose tissue and 

primary adipocyte 

 
Chao Sun*, Yongjia Peng, Dongfeng Jiang and Zhongpin Zhang 

 
College of Animal Science and Technology, Northwest A and F University, Yang Ling 712100, Shaanxi, China. 

 
Accepted 27 September, 2016 

 
Musclin is a newly discovered factor and its functions remain to be defined. This study investigated the tissue 
expression pattern of musclin gene and its potential effect on lipid metabolism. Musclin mRNA levels in adipose, 
muscle tissues and primary adipocytes were examined by quantitative PCR. The musclin gene expression in adult 
adipose tissue was significantly higher than that in muscle (p < 0.05), and its expression in young adipose tissue 
was higher than old one. We further found that in adipose tissue, the expression level of musclin had a negative 
correlation with FAS gene (p = 0.01), and positive correlation with PPAR gene (p < 0.05). In adipocyte, the expression 
level of musclin gene had a positive correlation with LPL gene (p < 0.01). Our results suggested that musclin is a 
potential factor that might play an important role in the regulation of adipogenesis. 
 

Key words: Musclin, adipocyte, adipose tissue, lipid metabolism, expression. 

 
INTRODUCTION 

 
Musclin gene was originally identified as another name 
“osteocrin” in mouse by Thomas et al. (2003). Since it was 
only detected in bone, this group named this protein as 
“osteocrin”. They found that osteocrin was not only 
expressed in young bone cells, but also the expression was 
age-dependent; the expression level was higher in young 
animals than that in adults. Moreover, vitamin D was found 
to be able to inhibit the expression of osteocrin in primary 
osteoblastic cells (Thomas et al., 2003). One year later, 
musclin was identified from mouse skeletal muscle by 
Nishisawa et al. (2004). This group showed that musclin 
expression was regulated by nutritional changes and insulin. 
Musclin inhibited the insulin-induced glucose uptake and 
glycogen synthesis in myocyte (Nishizawa et al., 2004). And 
further research indicated  
 
 

 
*Corresponding author. E-mail: mdsys4439@hotmail.com. 
Tel.:+86-29-87092164. Fax: +86-29-87092164. 
 
Abbreviations: RT-PCR, Reverse transcription polymerase 

chain reaction; FAS, fatty acid synthesis; PPAR , peroxisome 

proliferator - activated receptor ; LPL, lipoprotein lipase; TGH, 

triacyl glycerol hydrolase. 

 
 
 

 
that musclin was mainly related to muscle fiber fast - 
glycolytic phenotypes (Staiger et al., 2006; Banzet et al., 
2007) . All these evidences indicated that the musclin 
might play an important role in glycogen metabolism.  

The effect of musclin on lipid metabolism has not been 
systematically investigated, although Nishisawa et al. 
(2004) claimed that in their preliminary experiments, an 
adenovirus- mediated musclin expression significantly 
reduced fat mass in mice. Here, we aimed to investigate 
the potential correlation between musclin and lipid meta-
bolism. This preliminary data suggested that muslin might 
be involved in lipid metabolism.  

In this study, we examined the expression of musclin in 
pig fat tissue and primary adipocyte both in vitro and in 

vivo, and examined its effects on lipid metabolism and 

possible relationships with other lipogenetic genes. 
 

MATERIALS AND METHODS 
 
Experimental animals 
 
Large White adult pigs, a local strain of Chinese pig, were provided 

by Shaanxi Guangming Pig farm. All animal studies were approved 
by the Institutional Animal Care and Use Committee of the 

University of Northwest Agriculture and Forestry. Subcutaneous fat 



 
 
 

 
Table 1. PCR parameter of primers and conditions. 

 

 Gene Primers Amplified DNA (bp) Tm°C Mg
2+

(mmol/l) Cycles 
 

 
Musclin 

F: ATGGACTGGAGACTGGCAAG 
374 56 3 34  

 
R: CGGTTTCTACCAATCCGATC  

      
 

 
-actin 

F: ACTGCCGCATCCTCTTCCTC 
399 53.8 2.5 28  

 
R:CTCCTGCTTGCTGATCCACATC  

      
 

 
FAS 

F: AGTGTCCACCAACAAGCG 
280 55.9 2.5 30  

 
R: GATGCCGTCAGGTTTCAG  

      
 

 
PPAR 

F: ACCACTCGCATTCCTTTGAC 
261 52.1 2.5 32  

 
R: CCACAGACTCGGCACTCAAT  

      
 

 
TGH 

F: CTTGGCTCCTTGAGATTTG 
455 53.3 2.5 30  

 
R: AGTTGGCAATGTTGTCCTG  

      
 

 
LPL 

F: GCAGGAAGTCTGACCAATAAG 
183 54.3 2.5 30 

 

 
R:GGTTTCTGGATGCCAATAC  

      
 

Notes: F: Forward; R: Reverse     
 

 

 
and muscle tissue were quickly excised right after the animal was 

slaughtered, then frozen in liquid nitrogen, and stored at 80 for later 

use. 

 

Methods 
 
Total RNA was extracted from adipose and muscle tissue with 
Trizol reagent by following the manufacturer’s instructions (Tiangen 
Biothech Co.). First strand cDNA was prepared with Revert Aid TM 
First Strand cDNA Synthesis Kit (Bio-Tech). 20 L of reverse 
transcription polymerase chain reaction RT-PCR solution contained  
6 L DEPC water, 5 g total RNA, 4 L 5× reaction buffer, 1 L random 

hexamer primers (0.2 g/L), 1 L RNase inhibitor (20 /L), and 1 L 
MLV reverse transcriptase. The conditions for RT reaction were as 
follows: 25°C for 10 min, 42°C for 60 min, 70°C for  
10 min (for enzyme inactivation), and 4°C for 5 min. The RT 
products were either used immediately for PCR or stored at 20°C. 
Since there was no swine musclin gene sequence available.  

We used human and mice sequences as reference to design 
primers for amplification of pig musclin cDNA. The PCR reaction 
conditions were summarized in Table 1. PCR reaction was per-
formed in a total volume of 25 L containing 1 L of tissue-specific 
cDNA, 3 L MgCl2 (25 mmol / L), 0.25 L Taq DNA polymerase, 2 L 
dNTPs (2.5 mmol / L), 2.5 L 10 × buffer and 1 L of each primer (10 
mol / L). The PCR product was examined by Agarose Gel 
Electrophoresis (AGE). PCR fragment was purified from Agarose 
Gel and cloned into Pmd - 18T vector (Takara Bio Inc.) for 
sequencing. 

 
Bio-informatics analysis of swine musclin gene 
 
Several online programs were applied to analyze signal peptide 
(http://www.cbs.dtu.dk/services/SignalP/) and sub-cellular 
localization (http://www.cbs.dtu.dk/services/TargetP/ and 

http://psort.nibb.ac.jp/form2.html) of musclin protein. 

 
Pig preadipocyte and myocyte isolation and culture 

 

 
with PBS containing high concentration of mycillin and then digest-
ed with collagenases at 37 for 1 h. Cells were then filtered through 
40 micron nylon membrane to remove tissue debris and concen-
trated by centrifugation. Isolated cell pellets were resuspended in 
DMEM / F12. For each experiment, preadipocyte and myocyte were 

seeded in 12 well plates at a density of 10
5
 cells per well. Primary 

preadipocyte was grown for preparation of total RNA at day 0, 2, 4, 
6, 8 and 10 respectively. 

 
Quantitative PCR 
 
Musclin mRNA from samples of adipose, muscle, primary pre-
adipocyte (cultured for 0, 2, 4, 5, 6, 8 and 10 days) and myocyte (5 
days) were determined by quantitative PCR. To determine the 
relationship between musclin and lipid metabolism, we examined 
the expression levels of fatty acid synthesis gene (FAS), 
peroxisome proliferators-activated receptor gene (PPAR ) and 
tricycle glycerol hydrolase gene (TGH) in adipose tissue, and 
lipoprotein lipase gene (LPL) and the gene PPAR in primary 
adipocyte. To quantitatively determine the gene expression, we 
used -actins gene as the internal control. The primers and PCR 
amplification conditions were listed in Table 1. 

Limited by a lack of real -time PCR equipment, we used a simple 
and similar real-time PCR technique. Briefly, for each sample, we 
prepared 6 tubes for PCR reaction, and the reaction was set as 26, 
28, 30, 32, 34 and 36 cycles respectively. The PCR products were 
examined by agarose gel electrophoresis. 

 
Data analysis 
 
Software SPSS 13.0 was used for statistical analysis. Musclin 
mRNA expression under standard conditions was analyzed with 
one-way ANOVA and LSD multiple comparison. Pearson’s 
correlation coefficients were used to determine statistical linear 
associations between musclin and other genes involved in lipid 
metabolism. All data from samples was shown as means ± 
Standard Error (SEM). 

 

Primary pig stromal vascular cell (preadipocyte) and myocyte were 
RESULTS 

 

Cloning of swine musclin gene 
 

obtained from new born pig subcutaneous fat tissue and skeletal 
 

muscle respectively, grown and differentiated as previously des- 

We  amplified the swine musclin gene using RT-PCR. 
 

cribed (Hong-mei et al., 2007). In brief, tissues were initially washed 
 



     
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

Figure 1. Prediction results of musclin protein from online software. The signal peptide of musclin 
protein was predicted by neural network analysis from online server Signal P 3.0 (A). The S-score is 
reported for every single amino acid position, with high scores indicating that the corresponding amino 
acid is part of a signal peptide. C-score should only be significantly high at the cleavage site. Y-max is 
a derivative of the C-score combined with the S-score resulting in a better cleavage site prediction than 
the raw C- score alone, the high-peaking C-score is the true cleavage site. The S-mean and D-score is 
calculated separately for the length and the position of the predicted signal peptide. The subcellular 
localization of musclin protein was predicted by Target P sever (B) (mTP: mitochondria, SP: the signal 
peptide secretion path, other: positioning expressed in cells of other locations 

 

 

Agarose gel analysis of PCR product indicated a specific 
band and the sequencing result showed that the swine 
musclin cDNA consists of 375 bp. The swine musclin 
cDNA sequence was submitted to Gen Bank (accession 
no. EU122441). Aligned with other species, swine 
musclin cDNA shares the highest homology with human 
(86%), followed by cow (88%), sheep (87%), rat (78%), 
mouse (76%) and chicken (59%). 
 

 

Bioinformatics analysis 

 

Using neural network analysis from online server Signal P 
3.0, we found that swine musclin protein contains a signal 
peptide on the N-terminus, located from amino acid 1 to 
26. A cleavage site was predicted between amino acid 26 
- 27, which suggested that the musclin protein might be 
released by cell (Figure 1A). 

 
 

 

As was shown in Figure 1B, the target P 1.1 program 
analysis further indicated that musclin was a secreted 
protein, since it was very low in mitochondria and mostly 
distributed in the outside of cells, including the cell 
surface. All these data suggested that swine musclin 
might function as a cytokine in outside the cell or both 
extra cellular and intra cellular. 
 

 

Different expression pattern of musclin in adipose 

tissue and muscle tissue, adipocyte and myocyte 
 
We compared the musclin gene expression in pig muscle 
and adipose tissue. The data suggested that musclin 
expression in adipose tissue was much higher than in 
muscle tissue (p < 0.01) (Figure 2A).  

To further verify the musclin gene expression in muscle 

and adipose tissue, we next examined the expression of 



  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. The expression of musclin mRNA in different tissues, primary cells (A, B), adipose tissues from 
pigs of different ages (C) and adipocytes cultured for different days (D), -actin was used as an internal 
control. The level of musclin mRNA in adipose tissue is remarkably higher than muscle (A) (A, adipose 
tissue; M, muscle tissue). The difference of musclin mRNA level between adipocyte and myocyte was not 
significant (B) (A, adipocyte; M, myocyte). The level of musclin mRNA in adipose tissue of ten-month-old 
pig indicated much lower than a five-month-old (C). The level of musclin mRNA in culture adipocytes of 
different days indicated an age-dependent manner (D). ** p < 0.01. 

 

 

the musclin gene in primary adipocyte and myocyte. The 
primary adipocyte and myocyte were prepared from 
young pigs and maintained with DMEM / F12 medium for 
5 days. The expressions of musclin gene in adipocyte 
and myocyte had no significant difference (Figure 2B). 
This result confirmed that the musclin gene was indeed 
expressed in adipose tissue. 
 

 

The expression pattern of musclin gene both in 

adipose tissue and adipocyte 
 
We next examined the musclin gene expression in 
adipose tissue from different ages of animals. As shown 
in Figure 2C, musclin gene expression in subcutaneous 
adipose of five-month-old. Large White pigs was 
significantly higher than that in ten-month-old (P < 0.05), 
suggesting that musclin gene expression is higher in 

 
 

 

young pig than that in old pig. This expression pattern 
was further supported by primary adipocyte experiments. 
The primary adipocytes were prepared from young pig 
adipose tissues and maintained in DMEM / F12 medium. 
As demonstrated in Figure 2D, the expression level of the 
musclin gene in primary adipocyte decreased with culture 
time.  

This time-dependent expression manner of musclin 

suggested that musclin might be involved in the regula-

tion of cell differentiation or adipose tissue development. 
 
 

Correlation between musclin and some lipogenetic 

genes expressed in adipose tissue and primary cells 
 
To support the hypothesis that musclin is involved in 

adipocyte differentiation and adipose tissue development, 

we next investigated the relationship between musclin 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 3. The statistical correlation between musclin and lipogenetic genes was analyzed by SPSS software. The 
electrophoresis result of musclin and lipogenetic genes mRNA level in adipose tissue, lanes 1 and 2: TGH (5-month-
old and 10-month- old respectively), lanes 3 and 4 of second line: PPAR (5-month-old and 10-month-old 
respectively), lanes 5 and 6 of second line: FAS (5-month-old and 10-month-old respectively) (A). Correlation 
analysis result of musclin and lipogenetic genes in adipose tissue (B). Electrophoresis result of lipogenetic genes 
mRNA level in adipocytes, lanes 1 and 2 of second line: LPL (5 days and 10 days respectively), lanes 3 and 4 of 
second line: PPAR (5 days and 10 days respectively) (C). Statistical correlation analysis results of musclin and 
lipogenetic genes in adipocytes (D). ** p < 0.01, *p < 0.05. 

 

 

expression and the expression levels of other lipogenetic 
genes in adipose tissue and primary adipocytes. FAS, 
PPAR and TGH are the main genes that play an impor-
tant role in lipid metabolism in adipose tissue. Applying 
Pearson’s correlation analysis to the data obtained from 
the adipose tissue samples, we revealed that the 
expression level of musclin had a negative correlation 
with FAS gene expression (r = -0.969, p = 0.01), had a 
positive correlation with PPAR gene expression (r = 
0.836, p < 0.05), and no correlation with TGH gene 
expression (r = - 0.245, p > 0.05). In primary adipocytes, 
we examined the expression of LPL and PPAR genes 
and compared their expression levels with musclin gene 
expression (Figure 3c and 3d). Musclin expression show-
ed a negative correlation with PPAR expression (r = - 
0.820, p < 0.05), and a positive correlation with LPL (r =  
0.964, p < 0.01), suggesting a potential linkage between 

musclin and the Lipolysis function of LPL. 
 
 

DISCUSSION 

 

The musclin gene was originally isolated from mouse 

bone and muscle tissue and therefore named “osteicrin” 

or “musclin”. It was initially believed that musclin was 

exclusively expressed in bone and muscle tissue in 

 
 

 

Thomas et al. (2003) and Nishisawa et al. (2004) re-
search, separately. However, in this study, we found that 
musclin also expressed in adipose tissue and primary 
adipocytes. We cloned musclin gene from swine adipose 
tissue and examined its expression pattern in adipose 
tissues and primary adipocytes. It was found that musclin 
might influence the regulation of lypolysis (Dong et al., 
2008). With regard to musclin expression and its possible 
roles in lipid metabolism, we have addressed four 
questions.  

The first question concerned the tissue specificity of 
musclin gene expression. We found that the musclin 
expression level was higher in adipose tissue than in 
muscle. This discovery was completely different from the 
previous claim that muslin was exclusively expressed in 
muscle tissue (Nishizawa et al., 2004). They reported 
musclin expression in adipose tissue was not significant. 
This is probably due to the different expression of musclin 
between swine and mouse species.  

The second question compared us in vivo versus in 
vitro experiments. We found that, between primary 

adipocyte and myocyte, the difference of musclin gene 
expression was not significant. This appeared inconsis-
tent with our tissue test results. We hypothesized that the 
difference between the culture conditions in vitro and the 
physiological environments in vivo might contribute to the 



 
 
 

 

musclin expression pattern in primary cells. The in vitro 
data strongly suggested that musclin expression in 
adipose tissue is regulated by other factors.  

The third question is related to the musclin expression 
pattern. In the present study, we found that musclin 
expression in adipose tissue of young swine is higher 
than old swine. Its expression decreased as age 
increased, suggesting that musclin might be involved in 
adipocyte proliferation and adipose tissue development. 
This result is similar to the previous research, which 
showed that osteocrin /musclin could be used as a 
marker of early osteoblast maturation due to its strong 
correlation with early stage of bone formation (Thomas et 
al., 2003; Bord et al., 2005). Given the fact that fat mass 
gradually increases with animal growth, the musclin 
expression pattern implied that musclin might negatively 
regulate fat mass accumulation in adipose tissue.  

The fourth question was with regard to the potential 

function of musclin in lipid metabolism. Previous research 

showed that musclin protein significantly inhibited fat 

mass accumulation in mice, suggesting musclin could be 

the underlying link between skeletal muscle and adipose 

tissue (Nishizawa et al., 2004). Moreover, the authors 

also found that insulin regulated the expression of 

musclin and musclin had feedback effect on insulin. 

Recent studies showed that insulin resistance in skeletal 

muscle decreased muscle glycogen synthesis, resulting 

in an increase in plasma triglyceride concentration 

(Petersen et al., 2007). Although it was well known that 

obesity was associated with insulin resistance, much of 

the relationship between obesity and insulin resistance actually 

came from visceral and ectopic lipid accumulation (Carr et al., 

2004; Xiao – Rong et al., 2008). All these evidences implied 

that insulin-resistant induced fat mass and the abnormal 

process of fat accumulation in tissues other than fat tissue 

could increase the risk of obesity. How musclin is involved in 

insulin induced fat accumu-lation remains to be further 

investigated. Intramuscular fat development had become a 

popular target for many scientists. A recent paper showed 

that 14 differentially expressed genes might participate in the 

development of intra muscular fat (Lee et al., 2007). 

Additionally, considering that musclin was originally 

identified in muscle, our results provided a new insight with 

the interaction between adipose tissue and muscle tissue, 

also musclin might be a candidate gene that participate intra 

muscular fat development. 

 

Furthermore, a recent paper reported Foxo1, a trans-
cription factor involved in lipid metabolism, inhibited the 
expression level of the musclin gene (Yasui et al., 2007). 
To further understand the relationship between musclin 
and obesity, we evaluated the correlation between 
musclin and key genes of lipid metabolism, and found 
that musclin had a negative correlation with FAS, a key 
enzyme which regulates de novo lipogenesis and 
improves triglyceride accumulation in adipose tissue. 
Many studies have shown that insulin, bile acids and 
feeding could increase FAS mRNA and protein levels 

 
 
 
 

 

(Moustaid et al., 1993; Matsukuma et al., 2006; 
Ranganathan et al., 2006). Musclin could suppress the 
function of insulin (Nishizawa et al., 2004) . Accordingly, 
we proposed that musclin might negatively regulate FAS 
to restrain lipid synthesis and decrease fat mass. 
Lipoprotein lipase (LPL) is an important enzyme which 
catalyses the hydrolysis of tricycle glycerol. Thiazolidine-
diones affected adipocyte LPL production through 
activation of PPAR , promoting the hydrolysis of triglye-
ride (Schoonjans et al., 1996). Furthermore, insulin might 
increase the activity and expression of LPL (Albalat et al., 
2007). Therefore, based on the observation that musclin 
expression was positively correlated with LPL, it sugges-
ted that musclin might be involved in lipid degradation. 
Since lipolysis function is a complicated procedure, 
further study on the interaction between musclin and 
other lipolysis genes will be conducted in our future 
experiment. PPAR is a member of the nuclear receptor 
superfamily of transcription factors and previous studies 
showed that PPAR responded to specific ligands by 
altering gene expression in a cell developmental and sex-
specific manner (Burns and Heuvel, 2007). PPAR 
regulates gene expression in many functional pathways. 
In this study, the correlation between musclin and PPAR 
in adipose tissue was positive but in adipocyte was 
negative. This probably was due to some other factors 
involved in PPAR expression on musclin, whereas in in 
vitro adipocyte culture, these factors were not present. 
How musclin regulates lipid metabolism via PPAR 
remains to be further elucidated.  

In conclusion, in the present study, we found that 
musclin was expressed in both adipose tissue and 
primary adipocytes, and had a positive effect on lipolysis. 
Our data suggested that musclin represented a novel 
potential factor which could be involved in lipid meta-
bolism. Further elucidation of the function and activity of 
musclin might provide new avenue for obesity therapeutic 
approaches. 
 

 

ACKNOWLEDGEMENTS 

 

This work was supported by a grant from The National 
Nature Science Foundation of China (30871785), The 
Program for New Century Excellent Talents in Univer-
sities, Chinese Ministry of Education (NCET-06-0865) 
and The Project of Young Aged Academic Experts from 
Northwest A and F University (YAAB-05-22). 
 
 
REFERENCES 
 
Albalat A, Saera-Vila A, Capilla E, Gutierrez J, Perez-Sanchez J, 

Navarro I (2007). Insulin regulation of lipoprotein lipase (LPL) activity 
and expression in gilthead sea bream (Sparus aurata). Comp. 
Biochem. Phys. B. 148: 151-159.  

Banzet S, Koulmann N, Sanchez H, Serrurier B, Peinnequin A, Bigard 
AX (2007). Musclin gene expression is strongly related to fast-
glycolytic phenotype. Biochem. Biophys. Res. Commun., 353: 713-
718. 



 
 
 

 
Bord S, Ireland DC, Moffatt P, Thomas GP, Compston JE (2005).  

Characterization of osteocrin expression in human bone. J. 
Histochem. Cytochem. 53: 1181-1187. 

Burns KA, Heuvel JPV (2007). Modulation of PPAR activity via 
phosphorylation. BBA-Mol. Cell Biol. L. 1771: 952-960. 

Carr DB, Utzschneider KM, Hull RL, Kodama K, Retzlaff BM, Brunzell 
JD, Shofer JB, Fish BE, Knopp RH, Kahn SE (2004). Intra-abdominal 
fat is a major determinant of the national cholesterol education 
program adult treatment panel III criteria for the metabolic syndrome. 
Diabetes, 53: 2087-2094.  

Dong-Feng J, Chao S, Yong-Jia P (2008). Expression characterization 
of Musclin gene in porcine tissues and Its correlation with lipogenetic 
genes. J. Acta Zoologica Sinica. 54: 453-459. 

Hong-mei S, Gong-she Y, Chao S (2007). Co-culture of Preadipocytes 
and Myogenic Satellite Cells in Porcine. J. Agric. Biotechnol. 15: 617-
621. 

Lee SH, Park EW, Cho YM, Kim SK, Lee JH, Jeon JT, Lee CS, Im SK, 
Oh SJ, Thompson JM, Yoon D (2007). Identification of differentially 
expressed genes related to intramuscular fat development in the 
early and late fattening stages of hanwoo steers. J. Biochem. Mol. 
Biol. 40: 757-764.  

Matsukuma KE, Bennett MK, Huang JS, Wang L, Gil G, Osborne TF 
(2006). Coordinated control of bile acids and lipogenesis through 
FXR-dependent regulation of fatty acid synthase. J. Lipid Res. 47: 
2754-2761.  

Moustaid N, Sakamoto K, Clarke S, Beyer RS, Sul HS (1993). 
Regulation of Fatty-Acid Synthase Gene-Transcription - Sequences 
That Confer a Positive Insulin Effect and Differentiation-Dependent 
Expression in 3T3-L1 Preadipocytes Are Present in the 332 Bp 
Promoter. Biochem. J. 292: 767-772.  

Nishizawa H, Matsuda M, Yamada Y, Kawai K, Suzuki E, Makishima M, 
Kitamura T, Shimomura I (2004). Musclin, a novel skeletal muscle-
derived secretory factor. J. Biol. Chem. 279: 19391-19395. 

Petersen KF, Dufour S, Savage DB, Bilz S, Solomon G, Yonemitsu S, 
Cline GW, Befroy D, Zemany L, Kahn BB, Papademetris X, Rothman 
DL, Shulman GI (2007). The role of skeletal muscle insulin resistance 
in the pathogenesis of the metabolic syndrome. P. Natl. Acad. Sci. 
USA. 104: 12587-12594. 

  
  

 
 

 
Ranganathan G, Unal R, Pokrovskaya I, Yao-Borengasser A, 

Phanavanh B, Lecka-Czernik B, Rasouli N, Kern PA (2006). The 
lipogenic enzymes DGAT1, FAS, and LPL in adipose tissue: effects 
of obesity, insulin resistance, and TZD treatment, J. Lipid Res., 47: 
2444-2450. 

Schoonjans K, PeinadoOnsurbe J, Lefebvre AM, Heyman RA, Briggs M, 
Deeb S, Staels B, Auwerx J (1996). PPAR alpha and PPAR gamma 
activators direct a distinct tissue-specific transcriptional response via 
a PPRE in the lipoprotein lipase gene. Embo J. 15: 5336-5348. 

Staiger H, Haas C, Machicao F, Haring HU (2006). The PPAR gamma 
agonist troglitazone induces musclin mRNA expression in human 
myotubes. Horm. Metab. Res., 38: 614-616. 

Thomas G, Moffatt P, Salois P, Gaumond MH, Gingras R, Godin E, 
Miao DS, Goltzman D, Lanctot C (2003). Osteocrin, a novel bone-
specific secreted protein that modulates the osteoblast phenotype. J. 
Biol. Chem. 278: 50563-50571.  

Xiao-Rong Z, Chang-Hao S, Jia-Ren L, Dan Z (2008). Dietary 
conjugated linoleic acid increases PPAR gene expression in adipose 
tissue of obese rat, and improves insulin resistance. J. Growth 
Hormone IGF Res. 18: 361-368  

Yasui A, Nishizawa H, Okuno Y, Morita K, Kobayashi H, Kawai K, 
Matsuda M, Kishida K, Kihara S, Kamei Y, Ogawa Y, Funahashi T, 
Shimomura I (2007). Foxo1 represses expression of musclin, a 
skeletal muscle-derived secretory factor, Biochem. Biophys. Res. 
Commun., 364: 358-365. 


