




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 6 (6), pp. 001-008, June, 2018. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

Full Length Research Paper 

 

Apolipoprotein D, apolipoprotein R and ST6GalNAc4 
genes respond to clenbuterol administration in pig 

adipose tissue 

 
Jin Zhang*, Jiali Lin, Liangcai Shen, Fan Zhang, Yingbo Zhu and Libin Zheng 

 
College of Life Science and Technology, Hebei Normal University of Science and Technology, 

Qinhuangdao, Hebei Province, 066004, China. 
 

Accepted 05 October, 2017 
 
Pig fat accumulation can be reduced by feeding pigs with high dosages of clenbuterol, but the molecular mechanism 
has not yet been well characterized. cDNA microarray and real-time PCR were used to identify the molecules 
potentially responding to clenbuterol in adipose cells. The mRNAs of 17 genes were found to be differentially 
expressed more than 2 fold (ratios of the expression levels in the test pigs to those in the control pigs of more than 2 
or less than 0.5) by microarray analysis, including three lipid metabolism related genes (apolipoprotein D, 
apolipoprotein R and ST6GalNAc4). Eight genes were verified by real-time PCR, with six of them reproducing the 
result from microarray analyses. The results showed that apolipoprotein D, apolipoprotein R and ST6GalNAc4 genes 
respond to clenbuterol administration in pig adipose tissue and their functions may relate to fat accumulation 
reduction. 

 

Key words: Pig, clenbuterol, adipose, cDNA microarray, real-time polymerase chain reaction (PCR). 

 
INTRODUCTION 

 
Adipose tissue plays critical roles in the regulation of energy 
homeostasis (Gesta et al., 2007). Excessive accumulation of 
adipose tissue has many negative effects (Pospisilik et al., 
2010). How to reduce adipose accu-mulation safely and 
effectively is of great importance both for human health and 
animal breeding. Clenbuterol, a type of β2-agonist, can 
reduce body fat drastically (Plant, 2003; Sato, 2010). But 
clenbuterol is toxic both for animals and human and the 
usage has been banned for many years (Kuiper et al., 1998; 
Mitchell and Dunnavan, 1998; Shiu and Chong, 2001). 
Clenbuterol perturbs cell metabolism by binding to the β2-
adrenergic receptors and increasing the cyclic AMP 
concentration in cells. In adipocytes, stimulation of β-
adrenergic receptors (by hormones) increases cyclic AMP 
levels and activates protein kinase A (PKA), which then 
stimulates lipolysis by phosphory-lating hormone-sensitive 
lipase and perilipin (Londos et al., 1985; Egan et al., 1990; 
Greenberg et al., 1991; Zhang et al., 2005). However, the 
molecular mechanism underlying the effect of clenbuterol on 
adipose  
 
 
 
*Corresponding author. E-mail: zhangjin7688@163.com. Tel: 
+86-335-8069613. Fax: +86-335-8076166. 

 
 
 

 
accumulation is still not well understood. Unveiling the 
mechanism will potentially identify new molecules that 
might play important roles in regulating adipose meta-
bolism.  

DNA microarray technology has been widely used as a 
powerful tool for functional genomics study in both basic 
science research and biomedicine research (Petrik et al., 
2006; Sawada et al., 2010). However, the application of this 
technology to animal genetics and breeding related research 

is rare. In this study, the genes responding to clenbuterol 
were profiled by cDNA microarray and real-time PCR 
techniques in fat tissue of Chinese miniature pigs treated 
with/without clenbuterol. These genes are potential 
candidates to be used in developing high lean pig breeding 
and also are potential drug targets for human obesity 
treatment. 

 
MATERIALS AND METHODS 
 
Animal sampling, clenbuterol treatment and body composition 
analysis 
 
In total, 8 Chinese miniature pigs were used in the experiments. 
Four hogs and four sows, all at 4 weeks of age, were housed in the 
nutrition and metabolism laboratory at the China Agriculture 



 
 
 
 

 

                                 Group A Group B Group C Group D 

 

 

Control Hog1  Sow1  Hog3  Sow3 
 

Treated 

         
 

Hog2

Hog2  

Sovw2 

 

H 

Hog44  

S 

Sow44 
 

          
 

     
 

  3-month-old   4-month-old 
 

            
 

Figure 1. The groups of pig population. Eight pigs were broken into four groups. There were two 
pigs in each group with the same gender. Group A and B were slaughtered when they were 3-
month-old. Group C and D were slaughtered at 4-month-old. 

 

 

University. They were raised under exactly the same conditions and 
were fed the same diets until 8 weeks old (average body weight 
17.4±1.2 kg, Table 3). They were broken into 4 groups named 
group A, B, C and D (Figure 1), each group consisting of two pigs 
with the same gender. For the following 4 weeks, one pig in each 
group was fed 25 mg/kg clenbuterol twice daily in the diets, while 
the other was fed the same diet without clenbuterol as the control. 
Pigs in group A and B were slaughtered for analysis (at 3 months 
old), while pigs in groups C and D were continued feeding 
with/without 50 mg/kg clenbuterol twice daily in their diets for 
another 4 weeks and then slaughtered for analysis. These two 
groups are referred to as the 4 month-old pigs. Approximately, 1 g 
biopsies were taken from the back fat adipose tissues of each pig. 
The adipose tissue samples were rinsed in sterile water, snap 
frozen in liquid nitrogen and stored at -80°C.  

Body composition analysis was done for each group just after the 
slaughter. The fat thickness were measured at the 10th rib by using 
standard procedures and the carcass lean content for each pig was 
also calculated (National Pork Board, 2000). 

 

HPLC analysis for clenbuterol residue in different tissues 

 
The samples were sent to livestock and poultry quality inspection 
center of China Ministry of Agriculture and clenbuterol residue was 
analyzed according to NY/xq421-2003, which is the standard 
method for determination of clenbuterol residues in animal product 
with GC/MS. 
 
 
RNA preparation, RNA labeling and DNA microarray 
hybridization 
 
Total RNA of the adipose tissue was extracted with TRIZOL reagent 
(Invitrogen, Gaithersburg, MD, USA). Briefly, the sample was put 
into mortar with liquid nitrogen and grinded into power. RNA was 
extracted from 100 mg of sample with 1000 ml TRIZOL added and 
following the manufacturer’s instructions. The RNA was purified 
using an RNeasy mini kit (Qiagen, Valencia, CA, USA) according to 
the manufactures’ protocol.  

A cDNA microarray representing 3358 pig genes was developed 
by our group (Zhang, 2011). A cDNA microarray hybridization 
analysis was performed in accordance with the standard protocol 
provided anywhere (Zhang et al., 2011). 

 
 

 
DNA microarray imaging and data analysis 

 
Arrays were scanned with a ScanArray express scanner (Parckard 
Bioscience, Kanata, OT, U.S.) with the obtained images analyzed 
with GenePix Pro 4.0 (Axon Instruments, Foster City, CA). The 
resulting microarray data was normalized using the space and 
intensity-dependent normalization in the LOWESS program (Yang 
et al., 2002). Each gene was represented in triplicate on each slide. 
The ratio presented for each gene was the mean of the “median of 
ratios” of 3 spots for this gene. For each slide, the positive genes 
were defined as those with gene ratios more than 2 (including 2) or 
less than 0.5 (including 0.5). To avoid dye bias, the experiments 
were performed in duplicate by dye swap with Cy5-dCTP first used 
with the test pig and Cy3-dCTP used with the control pig and then 
Cy3-dCTP used with the test pig and Cy5-dCTP used with the 
control pig. The positive genes in both dye swap slides were 
identified as the differentially expressed genes. Differentially 
expressed genes in both the hogs and the sows of the same age 
were chosen for further analysis. 

 

Quantitative real-time PCR 
 
To confirm the transcriptional differences observed by the 
microarray, fluorescent real-time PCR was done on an ABI Prism 
9700 sequence detection system (Applied Biosystems, Foster, CA, 
USA) using SYBR green technology as described by Li (2005). 
Briefly, the PCR reaction mixture (20 µl) contained 10 µl of DyNAmo 
SYBR Green qPCR mix, 5 µl of primer (0.3 µM forward and 0.3 µM 
reverse) and 5 µl of cDNA template (<10 ng/µl). The PCR protocol 
included uracil-N-glycosylase (UNG) enzyme incubation at 50°C for 
2 min and an initial denaturation at 95°C for 10 min. This was 
followed by 40 cycles of 10 s each at 94°C for DNA denaturation, 
20 s at different temperatures for annealing of primers, 20 s at 72°C 
for primer extension and 1 s at a different elevated temperature for 
data acquisition. The PCR primer sequences used for the real-time 
PCR are shown in Table 1. The size of the PCR products was 
between 100 to 250 bp for the benefit of fluorescent signals 
accuracy. The annealing temperature of each gene was about 
57±2°C so the PCR reaction for different genes could be done on 
the same plate. All primers were tested by none fluorescent PCR at 
first and the product size was confirmed by agarose gel. The 
quantification was normalized to an endogenous RNA control 
Glyceraidehyde-3-phosphate dehydrogenase (Gapdh, a house- 

Sow 2 



  
 
 

 
Table 1. Primers used for the real-time PCR analysis.  

 
 Genes and clone number Primer sequence  (5' to 3') PCR product size (bp) 

 

 
GAPDH 

For. ATGGTGAAGGTCGGAGTGA 
154 

 

 
Rev. ATGGGTAGAATCATACTGGA 

 

   
 

 
Apoliprotein D (rpfat_18926) 

For. AGATCCCAGTGAGCTTTGAG 
233  

 
Rev. CGTAGTTCTCATAGTCGGTG  

   
 

 
PRKAR1A  (rpfat_17661) 

For. GGCGACGAGGTGCTATCAG 159 
 

 
Rev. ATGGCATCAAAAATATCAC 

 
 

   
 

 
COL1A1 (rpfat_8523) 

For. TCAAGATGTGCCACTCCGACT 
104 

 

 
Rev. GCCTGTCTCCATGTTGCAGAA  

   
 

 
COL1A2 (rpfat_16033) 

For. ATATGCACCTTGGACATCGGT 
241 

 

 
Rev. CACGATGCTCTGATCAATCCT  

   
 

 
COL3A1 (rpfat_19990) 

For. CCTGCTGGAAAGAATGGTGAC 
132  

 
Rev. ACGTTCACCGGTTTCACCTT  

   
 

 
COL1A2 (rpfat_17393) 

For. CCTGGCTCTAGAGGTGAACG 
247 

 

 
Rev. AGCAGGACCAGGATTACCAG 

 

   
 

 
COL3A1 (rpfat_18309) 

For. TTTCTTTTATGGCTCCCCCTG 
101 

 

 
Rev. GCGTGTTCGATATTCGAAGAC 

 

   
 

 
COL3A1 (rpfat_19990) 

For. CTGCTGGAAAGAATGGTGAC 
132 

 

 
Rev. ACGTTCACCGGTTTCACCTT 

 

   
 

 
SCD (rpfat_16685) 

For. AAGGAACTAGAAGGCTGCTC 
156  

 
Rev. TGTAGAGCAGCAGCCATCAC  

   
 

 
PHPT1 (rpfat_15312) 

For. GAAGACACAGTTGAGGACAC 
110  

 
Rev. GGACATTGTTCGGAGGATAG 

 

   
 

 
HSL (rpfat_11096) 

For. TCCGAATGGAGTCTGCACTGT 
128 

 

 
Rev. CTTCCACTCTGACCTCCAACG  

   
 

 
PMP22 (rpfat_18575) 

For. CATGAACATTTGCACCACTTG 
133 

 

 
Rev. GTCAGCACCTAATGGTATGGA  

   
 

     

 
For.: Forward; Rev.: reverse. 

 

 
Table 2. Clenbuterol residue in porcine blood and adipose.  

 
 Pig number (ng/ml)  3-month-old group   4-month-old group  

  Hog 1 Hog 2 Sow 1 Sow 2 Hog 3 Hog 4 Sow 3 Sow 4 

 Blood 0.00 10.00 0.00 26.44 0.00 60.57 0.00 176.08 

 Adipose 0.00 0.00 0.00 1.62 0.00 5.32 - - 
 

-:not determined. 
 

 
keeping gene) which its expression level was unchanged to 
clenbuterol stimulation according to none fluorescent PCR analysis. 
 

 

RESULTS 

 

Clenbuterol administration dramatically reduced 
adipose accumulation 

 

HPLC analyses of the blood samples showed that the 
clenbuterol concentrations in the test pigs fed with 
clenbuterol were about 20 ng/ml in 3-month-old pigs and 

 
 

 

about 100 ng/ml in the 4-month-old pigs. Clenbuterol could 

not be detected in the control pigs fed without clenbuterol 
(Table 2). There was no difference in body weight between 

the test pigs and control pigs (Table 3), but there was 
significant difference in body compositions (Table 4). For 3-

month-old pigs, the lean meat percentage in the carcass 

was improved by about 2%, the back fat thickness was 

reduced about 0.2 cm and the eye muscle area was 
reduced by 4.7 cm

2
 when treated with clenbuterol. For 4-

month-old pigs, the clenbuterol effects were more 
significant with the lean meat percentage in the carcass 
increased by 10.99%, the back fat reduce by 



 
 
 

 
Table 3. Body weight of pigs treated with/without clenbuterol.  

 

Pig number 
 3-month-old group   4-month-old group  

 

Hog1 Hog2 Sow1 Sow2 Hog 3 Hog 4 Sow3 Sow 4 
 

 
 

Clenbuterol (mg/kg BW 
a
) 0 25 0 25 0 50

b
 0 50

b
 

 

2-month BW (kg) 18.6 17.4 17.5 16.2 16.8 17.2 17.5 18.3 
 

3-month BW (kg) 33 .2 32.6 30.6 29.8 30.5 32 31 32.2 
 

4-month BW (kg) - - - - 45.6 46.6 46 46.4 
 

Increased BW (kg) 14.6 15.2 13.1 13.6 28.8
c
 29.4

c
 28.5

c
 28.1

c
 

  
a, BW : Body weight; b, 25 mg/kg body weight for the 3

rd
 month and 50 mg/kg body weight for the 4

th
 month; 

c, increased body weight in the 3
rd

 month and increased body weight in the 4
th

 month. 
 

 
Table 4. Body composition of pigs treated with/without clenbuterol.  

 

Clenbuterol  administration* 
Hog2 and Sow2 Hog1 andSow1 Hog4 and Sow4 Hog3 andSow3 

 

3-month-old 3-month-old 4-month-old 4-month-old  

(mg/kg body weight)  

0 25 0 50 
 

 
 

Slaughter rate (%) 63.75 60.86 66.80 64.63 
 

Lean meat percentage of 52.40 55.24 41.45 52.44 
 

carcass(%)     
 

Thickness of back fat (m) 2.336 2.118 3.200 2.818 
 

Eye muscle area (cm
2
) 19.488 24.199 23.083 25.270 

 

 
*Twice daily. The carcass lean meat percentage, the thickness of back fact and eye muscle area were all changed statistically 
between test pigs and control pigs in both 3 month old pigs and 4 month old pigs (P < 0.05). 

 

 

1.02 cm and the eye-muscle area reduced by 2.18 cm
2
 

(Table 4). 
 

 

Seventeen genes were up-regulated in adipose tissue 
by clenbuterol treatment 

 

Genes whose expression levels were changed by more 
than or equal to two fold in clenbuterol treatment group 
versus control group were selected as differentially 
expressed genes. There were 56 differentially expressed 
genes (35 up-regulated, 21 down-regulated) in the 3 
month-old group and 58 differentially expressed genes 
(41 up-regulated, 17 down regulated) in the 4 month-old 
group (Data not shown). 17 genes were differentially 
expressed in both groups (Table 4). The purpose of this 
study was to found the key molecules by which 
clenbuterol reduce pig fat accumulation. Therefore, the 
overlapping differentially expressed genes in 3 and 4-
month old group were considered as the stable res-
ponding genes for clenbuterol stimulation in pig adipose 
tissue and thus, selected for the first stage analysis. 
 

 

Among the 17 genes, two genes related to signal 
transduction were found to be up-regulated 

 
These genes are cAMP dependent protein kinase type I 
regulatory gene (PRKAR1A) and RAB30. Up-regulation 

 
 

 

of PRKAR1A indicates increasing protein kinase A (PKA) 
activity. Three genes directly related to lipids metabolism 
were found to be up-regulated: apolipoprotein D (apoD), 
apolipoprotein R (apoR) and ST6GALNAC4. Further-
more, eight clones on the microarray were from three 
genes related to collagen protein synthesis which were 
up-regulated more than two folds: type I collagen alpha 1 
(COL1A1), type I collagen alpha 2 (COL1A2) and type III 
collagen alpha 1 (COL3A1). Eight differentially expressed 
genes were analyzed by real-time PCR to validate the 
microarray data (Table 5). Two of them were not detected 
by the real-time PCR, while the other six were also found 
to be differentially expressed more than 2 fold in the real-
time PCR. 
 

 

DISCUSSION 

 

To identify the key molecules in regulating fat 
metabolism, pigs treated with or without clenbuterol were 
used as the animal model. The body composition of the 
pigs was the most affected by clenbuterol treatment. The 
difference between test and control pigs could come from 
individual difference since there are only two pigs in each 
group. However, the same trend was observed in all four 
comparison groups suggesting that clenbuterol does play 
a role in regulating adipose metabolism. The sample 
quality was sufficient for further analysis to identify genes 
with differential expression levels that impact adipose 



  
 
 

 
Table 5. Differentially expressed genes in adipose with the administration of clenbuterol.  

 
 GenBank access number 

Gene name Potential function 
Induction fold change 

 

 
(Clone no.) microarray  real-time PCR  

   
 

 NM_001647 (rpfat_18926) Apolipoprotein D Lipids metabolism 2.20±0 8.81±0.12 
 

 L06820 (rpfat_18262) Apolipoprotein R Lipids metabolism 2.47±0.23 - 
 

 AB035172 (rpfat_16328) ST6GalNAc4 mRNA for N--acetylgalactosaminide Glycolipid metabolism 2.53±0.20 - 
 

 X05942 (rpfat_17661) cAMP dependent protein kinase type I  regulatory Signal transduction 2.0±0 7.0 
 

 U57092 (rpfat_19360) RAB30 Signal transduction 2.23±0.18 - 
 

 Z74615 (rpfat_8523) mRNA for prepro--alpha1(I) collagen (COL1A1) Cell structure and mobility 2.86±0 16.79 
 

 Z74616 (rpfat_16033) Prepro--alpha2(I) collagen Cell structure and mobility 4.47±1.41 3.03±0.89 
 

 AB008683 (rpfat_12534) COL1A2 mRNA for alpha2(I) collagen Cell structure and mobility 4.56±0.71 - 
 

 V00503 (rpfat_17393) mRNA encoding pro--alpha--2 chain of type I procollagen Cell structure and mobility 4.20±1.07 2.52±0.90 
 

 X06700 (rpfat_18309) mRNA 3' region for pro--alpha1(III) collagen Cell structure and mobility 3.58±0.42 ND 
 

 X14420 (rpfat_19990) Pro--alpha--1 type 3 collagen Cell structure and mobility 3.31±0.02 ND 
 

 NM_000090 (rpfat_12646) Collagen, type III, alpha 1 Cell structure and mobility 2.57±0.07 - 
 

 AF017305 (rpfat_18326) Deubiquitinating enzyme UnpEL (UNP) mRNA Protein metabolism 2.35±0.03 - 
 

 AW656523 (rpfat_19130) 108820 MARC 1PIG  cDNA 5', mRNA sequence.  2.90±0.68 - 
 

 AC087859.3 (rpfat_17641) H. sapiens chromosome 3 clone RP11-34L16 map 3p, complete sequence  3.74±0.37 - 
 

 rpig_3584 Unknown EST  2.35±0.13 - 
 

 rpfat_8229 Unknown EST  2.41±0.02 - 
 

 
-: Not analyzed with the real-time PCR; ND: not detected by the real-time PCR analysis. 

 

 

accumulation. To minimize the individual diffe-
rences, only the genes that showed changes in all 
four comparison groups are used for further 
analysis.  

It has been suggested that clenbuterol works by 
binding to the β-androgenic receptor and trans-
mitting signals into the cell alone the G-protein 
mediated cAMP signaling pathway. In this study, 
17 genes were found to be consistently diffe-
rentially expressed with clenbuterol treatment in 
the microarray analysis. Among the 17 genes, two 
genes related to signal transduction were found to 
be up-regulated, the cAMP dependent protein 
kinase type I regulatory gene (PRKAR1A) and 
RAB30. Up-regulation of PRKAR1A correlates 
with increasing protein kinase A (PKA) activity 

 
 

 

reported previously (Domina et al., 2005). RAB30 
is a member of the RAS oncogene family and 
involved in signaling pathway that controls the 
expression of a subset of yet-to-be-defined genes 
that are crucial for cell growth and differentiation. 
Until now, there has been no reported physiologic 
function of RAB30.  

Only 3 genes (apolipoprotein D, apolipoprotein 
R and ST6GalNAc4) directly involved in lipid 
metabolism were found to be differentially 
expressed. ApoD is a component of high density 
lipoproteins. Apo-D is also closely associated with 
the enzyme lecithin: cholesterol acyltransferase, 
an enzyme involved in lipoprotein metabolism. 
ApoR is a 23 kDa protein found on very low-
density lipoproteins (VLDL), on chylomicrons and 

 
 

 

in the d > 1.21 g/ml fraction of pig plasma (Cooper 
and Attie, 1992). The physiologic function of apo 
D and apo R in adipose tissue are unknown. The 
protein encoded by ST6GALNAC4 is a type II 
membrane protein that catalyzes the transfer of 
sialic acid from CMP-sialic acid to galactose-
containing substrates (Kang et al., 2004). This 
protein is a member of glycosyltransferase family  
29. ST6GALNAC4 is involved in glycolipid meta-
bolism. The functions of three genes in adipose 
metabolism were not well studied previously and 
might be worthy further characterization in regards 
to the reported findings here.  

The microarray analysis indentifies 17 genes to 
be up-regulated by the administration of clen-
buterol in both the 3 and 4-month-old pigs, with no 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. the real-time PCR analysis of the mRNA expression ratios of negative genes in the microarray results. 
Microarray results: clear bars; real-time PCR results: solid bars. The present values are expressed as the ratio of the 
group mean levels in the test pigs to those in the control pigs.  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 3. The real-time PCR analysis of the mRNA expression ratios of key genes in adipose metabolism. Microarray 
results: clear bars; real-time PCR results: solid bars. The present values are expressed as the ratio of the group mean 
levels in the test pigs to those in the control pigs. 

 

 

genes found to be down-regulated in both groups. To 
further investigate whether some genes were down-
regulated by the administration of clenbuterol, phos-
phohistidine phosphatase 1 (PHPT1) and peripheral 
myelin protein 22 (PMP22), which were found to be 
down-regulated in only one of the groups in the 
microarray results, were chosen for further analysis by 
real-time PCR (Figure 2). The PCR results also showed 
that the mRNA expressions of these two genes were not 
changed significantly (ratios between 0.5 and 2) which 

 
 

 

confirms that the unusual microarray result that no genes 
were suppressed.  

Furthermore, some genes highly related to fat accu-
mulation were not found to be differentially expressed by 
the administration of clenbuterol in the microarray data, 
such as stearoyl-CoA desaturase (SCD) and hormone-
sensitive lipase (HSL). Real-time PCR analysis confirmed 
these results (Figure 3). SCD is a microsomal fatty acid 
modifying enzyme that catalyzes the introduction of the 
cis double bond between carbons 9 and 10 of saturated 



 
 
 

 

fatty acyl-CoA substrates, resulting in the production of 
monounsaturated fatty acids. Therefore, SCD is the 
enzyme responsible for conversion of saturated fatty 
acids into monounsaturated fatty acids (MUFA) in 
mammalian adipocytes (Enoch et al., 1976). HSL 
hydrolyzes stored triglycerides to free fatty acids and is 
the rate-limiting enzyme of lipolysis. Both of these 
enzymes were not found to be differentially expressed by 
the microarray or the real-time PCR. It was reported that 
the HSL expression level does not change but that its 
translocation rate increases when lipolysis is enhanced 
(lipolysis may be induced by this hormone) (Egan et al., 
1992; Londos et al., 1999 a, b). Such changes could not 
be detected by the techniques used in these tests.  

The microarray analysis and the real-time PCR analy-
sis showed that the mRNA of three collagen synthesis 
genes (COL1A1, COL1A2 and COL3A1) was increased 
in adipose cells by the administration of clenbuterol. 
Collagen protein expression increased in muscle tissue 
(including skeletal muscle and heart muscle) in mice fed 
with clenbuterol at high dosage, which indicates that 
collagen protein synthesis may be enhanced by 
clenbuterol (Patiyal and Katoch, 2005; Bonnet et al., 
2005). Our data indicates that the collagen protein 
expression level also increased when the adipose cells 
were treated with clenbuterol.  

Although, the biological functions of the differentially 
expressed genes are not completely known, higher 
expressions of these molecules in adipose tissue might 
contribute to the reduction of fat accumulation. It is 
possible to identify the key molecules which regulates 
adipose metabolism in these genes. 
 

 

Conclusion 

 

In our study, cDNA microarray and real-time PCR were 
used to identify 17 genes differentially expressed in pig 
adipose tissue when treated with clenbuterol. Eight of the 
17 genes and four of the negative genes were verified by 
real-time PCR and 10 genes got similar magnitudes as in 
the microarray results. Apolipoprotein D, apolipoprotein R 
and ST6GalNAc4 genes respond to clenbuterol 
administration in pig adipose tissue and their function 
may contribute to adipose tissue reduction. 
 

 

ACKNOWLEDGEMENTS 

 

We thank State Key Laboratory of Agrobiotechnology of 
China for offering the microarray printer and scanner. 
This work was supported by China Natural Science 
Foundation (No. 30800778, 31072004 and 3094050), 
Hebei Natural Science Foundation (No.C2009000871), 
Hebei Educational Foundation (S08337) and Hebei 
Excellent Expert for Oversea Advanced Training Program 
(2009). 

  
  

 
 

 
REFERENCES 
 
Bonnet N, Benhamou CL, Brunet-Imbault B, Arlettaz A, Horcajada MN, 

Richard O, Vico L, Collomp K, Courteix D (2005). Severe bone 
alterations under beta2 agonist treatments: Bone mass. 
microarchitecture and strength analyses in female rats. Bone, 37(5): 
622-633.  

Cooper ST, Attie AD (1992). Pig apolipoprotein R: a new member of the 
short consensus repeat family of proteins. Biochemistry, 31(49): 
12328-12336.  

Domina F, Niutta PP, Naccari C, Pugliese A, Naccari F (2005). 
Effects of clenbuterol on haemocoagulation process in calves. J. Vet. 
Med A Physiol. Pathol. Clin. Med., 52(2): 53-54.  
Egan JJ, Greenberg AS, Chang MK, Londos C (1990) Control of 

endogenous phosphorylation of the major cAMP-dependent protein 
kinase substrate in adipocytes by insulin and beta-adrenergic 
stimulation. J. Biol. Chem., 265: 18769-18775. 

Egan JJ, Greenberg AS, Chang MK, Wek SA, Jr Moos MC, Londos C  
(1992). Mechanism of hormone-stimulated lipolysis in adipocytes: 
translocation of hormone-sensitive lipase to the lipid storage droplet. 
Proc. Natl. Acad. Sci. USA., 89(18): 8537-8541.  

Enoch HG, Catala A, Strittmatter P (1976). Mechanism of rat liver 
microsomal stearyl-CoA desaturase. Studies of the substrate 
specificity. enzyme-substrate interactions. and the function of lipid. J. 
Biol. Chem., 251: 5095-5103.  

Gesta  S,  Tseng  YH,  Kahn  CR  (2007).  Developmental  Origin  of  Fat: 
Tracking Obesity to Its Source. Cell, 131: 242-256.  

Greenberg AS, Egan JJ, Wek SA, Garty NB, Blanchette-Mackie EJ, 
Londos C (1991). Perilipin. a major hormonally regulated adipocyte-
specific phosphoprotein associated with the periphery of lipid storage 
droplets. J. Biol. Chem., 266(17): 11341-11346.  

Kang NY, Park YD, Choi HJ, Kim KS, Lee YC, Kim CH (2004). 
Regulatory elements involved in transcription of the human 
NeuAcalpha2,3Galbeta1,3GalNAcalpha2,6-sialyltransferase 
(hST6GalNAc IV) gene. Mol Cells, 31;18(2):157-62.  

Kuiper HA, Noordam MY, van Dooren-Flipsen MMH, Schilt R, Roos AH 
(1998). Illegal use of beta-adrenergic agonists: European 
Community. J. Anim. Sci., 76:195-207.  

Li S, Li Y, Du W, Zhang L, Yu S, Dai Y, Zhao C, Li Ning (2005). 
Aberrant Gene Expression in Organs of Bovine Clones That Die 
Within Two Days after Birth. Biol. Reprod., 72: 258-265.  

Londos C, Honnor RC, Dhillon GS (1985). cAMP-dependent protein 
kinase and lipolysis in rat adipocytes III Multiple modes of insulin 
regulation of lipolysis and regulation of insulin responses by 
adenylate cyclase regulators. J. Biol. Chem., 260: 15139-15145.  

Londos C, Brasaemle DL, Schultz CJ, Adler-Wailes DC, Levin DM, 
Kimmel AR, Rondinone CM (1999). On the control of lipolysis in 
adipocytes. Ann. N. Y. Acad. Sci., 892: 155-68.  

Londos C, Brasaemle DL, Schultz CJ, Segrest JP, Kimmel AR (1999). 
Perilipins. ADRP. and other proteins that associate with intracellular 
neutral lipid droplets in animal cells. Semin Cell Dev. Biol., 10(1): 51-
58.  

Mitchell GA, Dunnavan G (1998). Illegal use of beta-adrenergic 
agonists in the United States. J. Anim. Sci., 76:208-211.  

Myhre S, Mohammed H, Tramm T, Alsner J, Finak G, Park M, 
Overgaard J, Borresen-Dale A, Frigessi A, Sorlie T (2010). In Silico 
Ascription of Gene Expression Differences to Tumor and Stromal 
Cells in a Model to Study Impact on Breast Cancer Outcome. PLoS 
One, 5(11): e14002.  

National Pork Board (2000). Pork Composition and Quality Assessment 
Procedures. 4th ed. Natl. Pork Board, Des Moines, IA.  

Patiyal SN, Katoch SS (2005). Beta-Adrenoceptor Agonist Clenbuterol 
Down Regulates Matrix Metalloproteinase (MMP-9) and Results in 
Impairment of Collagen Turnover in Mice Left Ventricle. Jpn. J. 
Physiol., 55: 165-172.  

Petrik J (2006). Diagnostic applications of microarrays. Transfus Med., 
16: 233-247.  

Plant DR, Kearns CF, McKeever KH, Lynch GS (2003). Therapeutic 

clenbuterol treatment does not alter Ca
2+

 sensitivity of permeabilized 
fast muscle fibres from exercise trained or untrained horses. J. 
Muscle Res. Cell Motil., 24(7): 471-476. 

Pospisilik JA, Schramek D, Schnidar H, Cronin  SJ,  Nehme  NT,  Zhang 



 
 
 

 
X, Knauf C, Cani PD, Aumayr K, Todoric J, Bayer M, Haschemi A, 
Puviindran V, Tar K, Orthofer M, Neely GG, Dietzl G, Manoukian A, 
Funovics M, Prager G, Wagner O, Ferrandon D, Aberger F, Hui CC, 
Esterbauer H, Penninger JM (2010). Drosophila Genome-wide 
Obesity Screen Reveals Hedgehog as a Determinant of Brown 
versus White Adipose Cell Fate. Cell, 140:148-160.  

Sato S, Nomura S, Kawano F, Tanihata J, Tachiyashiki K, Imaizumi K. 
(2010) Adaptive effects of the beta(2)-agonist clenbuterol on 
expression of beta(2)-adrenoceptor mRNA in rat fast-twitch fiber-rich 
muscles[J]. J. Physiol. Sci. 60(2): 1880-6562.  

Sawada T, Miyoshi H, Shimada K, Suzuki A, Okamatsu-Ogura Y, 
Perfield JW 2nd, Kondo T, Nagai S, Shimizu C, Yoshioka N, 
Greenberg AS, Kimura K, Koike T (2010). Perilipin Overexpression in 
White Adipose Tissue Induces a Brown Fat-Like Phenotype. PLoS 
One. 5(11): e14006.  

Shiu TC, Chong WH (2001). A cluster of clenbuterol poisoning 
associated with pork andpig offal in Hong Kong. Publ Health 
Epidemiol. Bul., 10: 14-17. 

 
 
 
 

 
Yang Y, Dudoit S, Luu P, Lin D, Peng V, Ngai J, Speed T (2002). 

Normalization for cDNA microarray data: a robust composite method 
addressing single and multiple slide systematic variation. Nucleic 
Acids Res., 30(4): e15.  

Zhang J, Hupfeld CJ, Taylor SS, Olefsky JM, Tsien RY (2005). Insulin 
disrupts beta-adrenergic signalling to protein kinase A in adipocytes. 
Nature, 473: 569-573.  

Zhang J, Guo W, Lin J, Shen L, Hu X, Li N (2011). Development of a 
Porcine cDNA Microarray: Analysis of Clenbuterol Responding 
Genes in Pig Different Tissues. J. Genet. Genomics, (In press). 


