




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 6 (10), pp. 001-006, October, 2018. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 
 

 

Full Length Research Paper 

 

Mitochondrial genome of Taiwan pig (SUS  SCROFA) 
 

Chia-Hsuan Chen1,2
, Hsiu-Lin Huang1

, Hsiu-Ya Yang 2, Shan-Hu Lai1, Neim-Tsu Yen2
, 

Ming-Che Wu2 and Mu-Chiou Huang1* 
 

1
Department of Animal Science, National Chung Hsing University. 250 Kuo Kuang Road, Taichung 402, Taiwan. 

2
Livestock Research Institute, Council of Agriculture, Executive Yuan. 112, Muchang, Xinhua Dist., Tainan 712, Taiwan. 

 
Accepted 23 April, 2018 

 
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of 
the Taiwan Lanyu pig (SUS SCROFA) and its phylogenetic relationships with other pig breeds. Thirty-four 
forward and reverse primers were designed. Sequencing was performed in both directions. The results showed 
that, the complete sequence of the mitochondrial genome of the Taiwan Lanyu (S. SCROFA) is 16,747 bp, which 
was deposited in NCBI GenBank (accession number DQ518915). The complete sequence includes two rRNA 
(12S and 16S), 22 tRNA and 13 mRNA genes. The length of the D-loop region is 1,314 bp and there are 25 repeat 
sequences (5’-tacacgtgcg) in the region. It seems that there is a significant difference in the D-loop region 
between the Lanyu and the European Duroc (10 repeats), the landrace (13 repeats), the large white (6 repeats) 
or Asian pig breeds such as the Japanese wild boar (1 repeat) and the Ryukyu wild boar (1 repeat). The 
phylogenetic relationships of the Lanyu by comparing the sequence of the mitochondrial genome and the D-
loop region of Asian and European pig breeds were investigated. It revealed that, the genetic distance of the 
Lanyu is high when compared with both the European and Asian pig breeds; the genetic exchange between the 
Lanyu and other breeds is not frequent. There is also no evidence of genetic exchange or introgression caused 
by population migration. Therefore, we conclude that the Lanyu is an independent branch among the breeds. 

 
Key words: Complete genome, mitochondrial DNA, phylogenetic relationships, genetic distance, pig. 

 
INTRODUCTION 

 
Mitochondrial DNA has been widely used for evolution 
studies, because the evolution is more diversified than 
nuclear DNA (Brown et al., 1982, 1989; Luikart et al., 
2001). For evolution research, a number of studies of the 
D-loop region sequence mutation in mitochondrial DNA 
have also been investigated (Watanabe et al., 1985; Lan 
and Shi, 1993; Huang et al., 1999; Gongora et al., 2004).  

The Lanyu pig is an indigenous breed form the Lanyu 
Islet. The island is located at the southeast of Taiwan 
(Jiang et al., 2008). Since 1980, the Livestock Research 
Institute of Council of Agriculture in Taiwan introduced the 
Lanyu small-ear strain and from then on, the pig group 
became isolated and did not cross with other breeds. 
Lanyu pig skin colour and hair is black. The body weight 
at five months is less than 20 kg; mature pigs weight less  
 
 
 
*Corresponding author. E-mail: mchunag@mail.nchu.edu.tw. 
Tel: +886-4-22840366 ext 239. Fax: +886-4-22860265. 

 
 
than 70 kg. The purpose of this study is to sequence the 
complete mitochondrial DNA of the unique pig breed in 
Taiwan. We also studied the phylogenetic relationships of 
the Lanyu and other breeds from Europe, Japan, Korea 
and China, in order to investigate the migration of pig 
populations. 

 
MATERIALS AND METHODS 
 
Blood collection and DNA extraction 

 
10 ml of blood was collected with anticoagulant from jugular vein of 
the Lanyu boar reared in the Livestock Research Institute, Council 
of Agriculture (Taitung Animal Propagation Station, LRI- Taitung). 
DNA extraction was performed according to the user manual of the 
kit (Puregene Gentra System, Taipei, Taiwan). 

 
Primer design 
 
Primers were designed according to the accession number 



  
 
 

 
Table 1. Primer pairs for pig complete mitochondrial DNA sequencing.  

 
 No. Forward/reverse sequence No. Forward/reverse sequence 

 1 caaccaaaacaagcattccattcg/ggtttggcaaggcgttataggg 18 aatccaactaacatccaaac/ccagtgaagaacagaacc 

 2 aatcgcccactctttccc/tgcctgctttcgtagcac 19 cacatagtaaacccaagccc/catctacgaagtgtcagtatcag 

 3 tcattcaaaccccccttaccc/atgtgaagcaccgccaagtc 20 ccacttcacatccaaccaccac/agcttcgcaggctgcaaac 

 4 ccacgaaagtgactctaataatcc/cccttacggtactatctctatagc 21 acgaatgaacccaaaaag/tagtataagggggaggag 

 5 tgggtactttgaaccaaagc/tgtttgccgagttccttttac 22 tctcacttaatatcttcactac/gtcgttctgtttggtttc 

 6 aagcctttctcctcgcacac/gaaaccgacctggattgctc 23 attataaccttcaccgccac/tgcaaacactcctaccactc 

 7 caactcaaccacaaagggataaaac/ggagattgaggatgtgcctg 24 tggcataatgcgaatcactac/cgattagattgatggatgggg 

 8 agaacagggcacattaggg/gctatgaagaatatggcgaaagg 25 cgtactgctaaaactcggagg/ggtagaatatgtagggctatgagg 

 9 ctctatcaaccctaatcacaacac/tccgattcagatgagtagtcag 26 acccccatccatcaatctaatc/ggactaggctgagagtgaag 

 10 agaggttcaaaccctcttatttc/ctctcaataggaggcctg 27 atcctacgccttcactctc/tctgttcgtccgtgtcatc 

 11 gagggctaaatcaaacccaac/ggatgggaacatagtcagtgag 28 ttcccgtagcactattcgtc/gctttatacagtccgcctatttttc 

 12 gcatcatcatgccaacactc/cagttaccaaaacccccaatc 29 aatagtgacaatcggcatcaac/taggcggtgtatgatggagg 

 13 atgtaattgttacagctc/caactaaatacttttactcc 30 acaacacaacctactacc/ttcttctaagccctctcc 

 14 tcaccgtaggaatagacgtag/tggaaagggtaagccatagag 31 caataccacaaccaactccac/gcggtaatgatgaatggcag 

 15 gtttcaagccaacgtcataacc/tgtttctacttcttgggcatcc 32 cacacgattcttcgccttc/gccctccttttctggtttac 

 16 ccctatatgcctctatggcttac/ttaaaccgagggatgggac 33 gcctccatcttatacttcctaatc/gtacttggcgttttggtttg 

 17 aacctggagaaatacgac/tgaatgagtgtggtagtag 34 acactaacatgaattggaggac/atgcacgacgtacataggg 
 

 
AF034253 of NCBI GenBank. A total of 34 primers were used 
(Table 1). 
 
 
Fragment amplification by polymerase chain reaction (PCR) 
and nucleotide sequencing 
 
A total volume of 25 ul of PCR mix consists of 2.5 µl PCR buffer (10 
mM Tris-Cl, 50 mM KCl and 1.5 mM MgCl2), 1 ul of dNTPs, 0.5 µl 
of each forward and reverse primer (10 µM), 0.2 µl Taq (TaKaRa 
Taq DNA polymerase, 5 U/µl), 100 to 500 ng of DNA and 17.3 ul of 

2 dH2O. The PCR program followed was: pre-denaturation at 94°C 
for 5 min, followed by 30 cycles of denaturation at 94°C for 30 s, 
annealing at 50 to 58°C based on the primer sequences for 45 s 
and an extension of 72°C for 45 s; then, a final extension at 72°C 
for 10 min. PCR products were purified according the manu-
facturer’s instructions using a spin column and gel and a clean 
extraction kit (BioKit, Hsinchu, Taiwan). The PCR products were 
sequenced according to dideoxynucleotide chain termination 
method (Sanger et al., 1977). The sequences were aligned using 
the program Contigs express in Vector NTI Suite 8 (InforMax, Inc. 
Wesconsin, USA). Each sequence had overlap of at least 300 bp. 
Sequences were analyzed in both directions for confirmation. 
 

 
Phylogenetic analysis 

 
Mitochondrial DNA sequences of the Lanyu pig (DQ 518915) were 
compared with those of different pig breeds such as the large white 
(AY574048), Hampshire (AY574046), Berkshire (AY574045), 
landrace (AF034253), Duroc (AY337045), Italian wild boar (AF30-
4201), Yucatan (AB015093), Meishan (D42181), Korean wild boar 
(AY574047), Jeju native pig (JNP8, DQ334860; JNP10, DQ33-
4861), Japanese wild boar (AB015085), Ryukyu wild boar 
(AB015087) and the Okinawa native pig (AB015092) breeds in 
NCBI GenBank. Multiple alignments between our sequence and the 
literature ones were performed using BioEdit software and DAMBE 
software (Data Analysis in Molecular Biology and Evolution version: 
4.5.2) and transfer Fas files were then, converted into a readable 
format of MEGA3.1 (Molecular Evolutionary Genetics Analysis, 

 

 
Version 3.1) using data analysis in molecular biology and evolution. 
Neighbor-joining methods and maximum parsimony methods were 
used to calculate the genetic distances and construct the phylo-
genetic tree (Saitou and Ne, 1987). 
 

 

RESULTS 

 

In present studies, the complete mitochondria genome of 
the Lanyu pig (16,747 bp) was sequenced and deposited 
in NCBI Genbank (Accession no. DQ 518915). The mito-
chondrial codons were also investigated. The complete 
sequence includes two rRNA (12S and 16S), 22 tRNA 
and 13 mRNA genes (Table 2).  

Using neighbor-joining methods, we investigated the 
phylogenetic relationship of the mitochondrial genome of 
the Lanyu and other pig breeds (Figure 1). The results 
showed that the Berkshire, large white and the Korean 
wild boar belongs to the Asian type. In the Hampshire, 
landrace and Duroc breeds, the relationship is closer, 
which were called European type. The Lanyu was classi-
fied as a new out-group. As the Lanyu belongs to a breed 
that is unique in the Taiwan islands, the question as to 
whether there is a phylogenetic relationship between the 
Lanyu and other small-ear strains is worthy of study. By 
searching the sequences of pigs, the Lanyu is found to be 
independently grouped compared with the Korean wild 
boar and European breeds. This study has shown that, 
the Lanyu breed is an independent out-group and is dis-
tant to any other breeds. Also using neighbor-joining 
methods, we analysed the phylogenetic relationship of 
the mitochondrial D-loop region in the Lanyu and other 
pig breeds (Figure 2). The Lanyu is an independent group 
from the two and is a separate out-group. Its phylogenetic 
relationship with any other pig breeds is far from 



 
 
 

 
Table 2. Location of features in the mitochondrial genome of the Lanyu pig (S. scrofa).  

 
 Name of gene Location Size (bp)  Start codon Stop codon 

 D-loop 1–1314 1314    

 Repeat region 706–955 250    

 tRNA-Phe 1138–1207 70    

 12S-rRNA 1208–2163 956    

 tRNA-Val 2164–2231 68    

 16S-rRNA 2232–3794 1563    

 tRNA-Leu(UUR) 3801–3875 75    

 NADH1 3878–4837 960  ATG TAG 

 tRNA-Ile 4836–4900 65    

 tRNA-Gln 4901–4973 73 L
a
   

 tRNA-Met 4975–5044 70    

 NADH2 5045–6088 1044  ATT TAG 

 tRNA-Trp 6087–6154 68    

 tRNA-Ala 6161–6227 67 L   

 tRNA-Asn 6230–6304 75 L   

 Or. L-stand repl. 6301–6347 47    

 tRNA-Cys 6337–6402 66 L   

 tRNA-Tyr 6402–6467 66 L   

 COI 6469–8013 1545  ATG TAA 

 tRNA-Ser (UCN) 8017–8087 71 L   

 tRNA-Asp 8093–8160 68    

 COII 8161–8848 688  ATG T--
b
 

 tRNA-Lys 8849–8915 67    

 ATPase8 8917–9120 204  ATG TAA 

 ATPase6 9078–9758 681  ATG TAA 

 COIII 9758–10541 784  ATG TA-
b
 

 tRNA-Gly 10542–10610 69    

 NADH3 10611–10956 346  ATA TA- 

 tRNA-Arg 10958–11026 69    

 NADH4L 11027–11323 297  GTG TAA 

 NADH4 11317–12694 1378  ATG T-- 

 tRNA-His 12695–12763 69    

 tRNA-Ser (AGY) 12764–12822 59    

 tRNA-Leu (CUN) 12823–12892 70    

 NADH5 12893–14698 1716  ATA TAA 

 NADH6 14698–15225 528 L ATG TAA 

 tRNA-Glu 15226–15294 69 L   

 Cyt b 15299–16438 1140  ATG AGA 

 tRNA-Thr 16439–16506 68    

 tRNA-Pro 16507–16747 64 L   
 

a: (L), light-strand sense; NADH1–6 and NADH4L, subunits 1 to 6 and 4 L of nicotinamide dinucleotide 
dehydrogenase; ATPase6 and 8, subunits 6 and 8 of adenosine triphosphatase; COI to COIII, 
cytochrome c oxidase subunits I to III; cyt b, cytochrome b. b: TA-and T--: TNN indicates the incomplete 
stop codon, that is, amino acid translation is terminated when the gene forms a stop codon by post-
transcriptional polyadenylation. 

 

 

European type, but its genetic distance is closer to the 
Asian type. Therefore, it can be counted as a cluster. 
Pairwise sequence distances were used to analyse the 
genetic distance of the D-loop region among the pig 
breeds, which showed that the Lanyu is an independent 

 
 

 

branch as the genetic distance is far from other pig 
breeds. In descending order, the Lanyu has the biggest 
genetic distance with the landrace (0.102), Hampshire 
(0.098), Duroc (0.097), Mexican Yucatan, Italian wild boar 
and Jeju native pig (JNP10) (0.095), large white (0.092), 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 1. The phylogenetic relationship was analysed using neighbor-joining 
methods by comparison of the mitochondrial genome sequences of the Lanyu 
and other breeds. KWBI, Korean wild boar.  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. The phylogenetic relationship was analysed using neighbor-joining 
methods by comparison of the mitochondrial D-loop region of different strains 
of pig breeds. (1) JNP8, JNP10, Jeju native pig; (2) KWBI, Korean wild boar; 
(3) JW, Japanese wild boar. 

 

 

Korean wild boar (0.091), Meishan (0.090), followed by 
the Berkshire, Jeju native pig (JNP8), Japanese Ryukyu 
wild boar (0.088). The shortest genetic distance is with 
the Japanese Okinawa native pig (0.087). Of all the 15 
pig breeds, the largest distance from the Lanyu is the 
landrace (0.012), while the smallest is the Berkshire and 
Korean Jeju native boar (JNP8) (0.002). 

 
 

 

DISCUSSION 

 

The complete sequence of Lanyu pig contains two rRNA 
(12S and 16S), 22 tRNA and 13 mRNA (Table 2). There 
are four overlapping regions in the pig mitochondria 
mRNA and seven base pairs overlapping on NADH4L 
with NADH4. ATPase6 has 43 and 1 bp overlapping with 



 
 
 

 

ATPase8 and COIII, respectively. As these genes were 
from the same transcript in the mammals, there is a 1 bp 
frame shift during transcription. There are 1 bp over-
lapping in NADH5 and NADH6 and as they are tran-
scribed from different strands of DNA, there is no frame-
shift. There are 11 mRNA genes starting the amino acid 
methionine in the Lanyu; these were transcribed from 9 
ATG and 2 ATA codons, respectively. The initiating 
codons of the other two genes were transcribed from ATT 
(Isoleucine) and GTG (Valine). There are four proteins 
(CO II, CO III, NADH3 and NADH4) in the stop codons; 
the stop codon is not TAA and it is different from that in 
other breeds. The length of the mitochondrial D-loop 
region of the Lanyu is 1,314 bp. Twenty-five repeat 
sequences (5’-tacacgtgcg) in this region were found. 
There are obvious differences between the Lanyu and 
other breeds, such as the Duroc (10 repeats, 
AY337045.), landrace (13 repeats, AF034253), large 
white (6 repeats, AY574048), Japanese wild boar (1 
repeat, AB015085) and the Ryukyu wild boar (1 repeat, 
AB015087). We hypothesized that; these 25 repeat 
sequences in the D-loop region can easily form a hairpin 
structure in the com-plementary sequences. Therefore, 
the copying process may easily introduce errors (Mackay 
et al., 1993). Similar cases occur in other mammals, such 
as the rabbit (Dufresne et al., 1996), horse (Xu and 
Arnason, 1994), seal (Arnason and Johnson 1992), cat 
(Lopez et al., 1996) and sheep (Zardoya et al., 1995). 
Many studies have also shown that, the D-loop region 
has the highest mutation rate in mitochondria. It is 
thought to be an im-portant region in the analysis of 
phylogenetic relation-ships and evolution of breeds. 
 

The Lanyu pig is the small ear breed and Lanyu lie in 
the off-shore island position of Taiwan. The people living 
there rely mainly on the fact that the aboriginal reaches 
the Yami of Botel Tobago. Its development and the way 
Taiwan and other aboriginals of this island build 
relevantly, have apparent difference. This study analysed 
the phylogenetic relationship of Lanyu pigs and other pig 
breeds. Figure 1 showed that, the Berkshire and large 
white both belong to the Asian type, a similar finding to 
that of Kim et al. (2002). In Kim’s study, the SNPs in the 
mitochondrial D-loop region were analysed and it was 
found that, Chinese mainland pig breeds originated from 
Southeast Asia. In addition, they found that the Berkshire 
and large white were both of the Asian type. Chinese 
mainland, Korean and Japanese local breeds have 
significant differences to the European type. We therefore 
deduced that, the European breeds may have originated 
from more than one breed. Sequencing of both the 
complete mitochondrial genome and the D-loop region 
has given the same result that the Berkshire and large 
white belong to the Asian type. Kijas and Andersson 
(2001) used the phylogenetic relationship to analyse the 
mitochondria genome of four pig breeds in order to study 
the origin of domesticated pigs. Using five pig breeds, 
including the Chinese Meishan, Italian wild boar, Sweden 

 
 
 
 

 

landrace and wild boar, they categorized the origin into 
three groups, A, E1 and E2. The genetic difference of 
these three groups is between 0.8 and 1.2%. Branches A 
(Chinese Meishan) and E1 (European domesticated pigs) 
were probably separated 900,000 years ago. Long term 
domestication started from about 9000 years ago. Recent 
studies have shown that, branch A includes some of the 
major European breeds, such as the landrace and large 
white. It is speculated that Asian breeds were introduced 
into Europe by introgression in the 18 and 19th centuries.  

In present studies, both neighbor-joining methods and 

maximum parsimony methods showed that, the Lanyu is of 

an independent branch in the phylogenetic analysis of both 

the mitochondrial complete genome and the D-loop region 

(Figures 1 and 2). In 1980, the Livestock Research Institute 

in Taiwan introduced four boars and sixteen sows. They 

were then isolated and did not introgress with other breeds. 

In order to preserve the genetic resources of the local pig 

breeds, the Taiwanese government listed Lanyu pigs as a 

member of the Taiwan conservation population. This study 

contributes to the knowledge of phylogenetic relationships of 

the Lanyu with other pig breeds, which can further be 

applied to other pig breeds in the world. The Lanyu is of an 

independent branch but probably still belongs to the Asian 

type. This result implies that, the frequency of genetic 

exchange of the Lanyu with other pig breeds is low and they 

therefore do not have a close relationship. This result also 

confirms that, after the introduction of the Lanyu into East 

Taiwan by the Live-stock Research Institute, there was no 

cross with other pig breeds, the Lanyu therefore becoming 

an isolated population with a unique genetic combination. 

Whether the Lanyu has a genetic relationship with the 

Taiwan wild boar remains to be investigated. From 

ethnological and archaeological research, anthropologists 

have found that the Tao people of Lanyu Island migrated 

from Batan Is-land, of the North Philippines. We hypothesize 

that, Lanyu pigs were introduced onto Taiwan’s Lanyu Island 

by the early Tao people from the Batan Island of the 

Philippines.  
Kim et al. (2002) used the D-loop region to analyse the 

Jeju, Chinese, Japanese, European and Mexican Yuca-
tan breeds. They indicated that, the Berkshire and large 
white were of Asian breeds. The Chinese, Japanese and 
Korean local breeds were separated in recent years and 
based on some limiting factors; their classification may 
differ from the European type. By studying 48 local 
breeds, China mainland studies have shown that many 
breeds originated from Southeast Asia (Kim et al., 2002). 
Paszek et al. (1998) also calculated that, the genetic 
difference of the Chinese Meishan and European breeds 
probably originated around 2227 years ago.  

Watanabe et al. (2003) collected 180 samples from 10 
populations in Shikoku, Kyushu and Honshu in Japan. 
They used neighbor-joining methods to analyse 574 bp of 
the mitochondria region and found that, the ancestors of 
the Japanese wild boar migrated from southeast to north-
east Asia in the Pleistocene period. They deduced that, 



 
 
 

 

the Japanese wild boar probably originated in Mongolia. 
Sus scrofa are widely distributed in Asia, Europe and 
North Africa and their ancestors were processed into at 
least 16 subspecies. Fossil records show that, wild boars 
existed in the Pleistocene period in Japan and that the 
Japanese wild boar existed in Shikoku, Kyushu, Honshu 
and Ryukyu. Kijas and Andersson (2001) found that, the 
difference between the Sweden wild boar and Meishan is 
1.21 ± 0.09%. This study found that, the phylogenetic 
relationship of the Ryukyu wild boar and Lanyu is similar 
to other breeds in the D-loop domain. As Taiwan is close 
to Ryukyu Island, the appearance of the Ryukyu wild boar 
is similar to that of the Lanyu pigs. The Ryukyu wild boar 
exists in the Japanese Amami Islands, Okinawa Main 
Island, Ishigaki Island and Iriomote Island. The Ryukyu 
wild boar is small, with a dark brown to black hair colour 
and a thickset body and is nocturnal and omni-vorous. It 
belongs to the early Asian wild boar branch.  

Luetkemeier et al. (2010) indicated that, Asian domestic 
populations were derived from multiple Asian ancestral 
origins whereas the European domestic populations 
represent a single ancestral European lineage. The com-
plete mitochondrial genome of Taiwan Lanyu pigs was 
sequenced; it is a reference for the sequence difference 
and phylogenetic relationship of other small-ear strains in 
the world. Analysis showed that, the Lanyu could be an 
independent branch among the other pig breeds. Its far 
genetic distances with other Asian and European breeds 
suggest that, the Lanyu did not have a frequent genetic 
exchange with other breeds. Therefore, there is no gene-
tic exchange and cross between the Lanyu and other 
breeds. 
 

 
REFERENCES 
 
Arnason U, Johnsson E (1992). The complete mitochondrial DNA 

sequence of the harbor seal, Phoca vitulina. J. Mol. Evol. 34: 493-
505. 

Brown WM, Prager EM, Wang A, Wilson AC (1982). Mitochondrial DNA 
sequences of Primates: tempo and mode of evolution. J. Mol. Evol. 
18: 235-239.  

Brown DR, Koehler CM, Lindberg GL, Freeman AE, Mayfield JE, Myers 
AM, Schutz MM, Beitz DC (1989). Molecular analysis of cytoplasmic 
genetic variation in Holstein cows. J. Anim. Sci. 67: 1926-1932.  

Dufresne C, Mignotte F, Gueride M (1996). The present of tandem 
repeats and initiation of replication in rabbit mitochondrial DNA. Eur. 
J. Biochem. 235: 593-600. 

  
  

 
 

 
Gongora J, Fleming P, Spencer PBS, Mason R, Garkavenko O, Meyer 

JN, Droegemueller C, Lee JH, Moran C (2004). Phylogenetic 
relationships of Australian and New Zealand feral pigs assessed by 
mitochondrial control region sequence and nuclear GPIP genotype. 
Mol. Phylogenet. Evol. 33: 339-348.  

Huang YF, Shi XW, Zhang YP (1999). Mitochondrial genetic variation in 
Chinese pigs and wild boars. Biochem. Genet. 37: 335-343.  

Jiang YN, Wu CY, Huang CY, Chu HP, Ke MW, Kung MS, Li KY, Wang 
CH, Li SH, Wang Y, Ju YT (2008). Interpopulation and 
intrapopulation maternal lineage genetics of the Lanyu pig (Sus 
scrofa) by analysis of mitochondrial cytochrome b and control region 
sequences. J. Anim. Sci. 86: 2461-2470.  

Kijas JMH, Anderson LA (2001). Phylogenetic study of the origin of the 
domestic pig estimated from the near-complete mtDNA genome. J. 
Mol. Evol. 52: 302-308.  

Kim KI, Lee JH, Li K, Zhang YP, Lee SS, Gongora J, Moran C (2002). 
Phylogenetic relationships of Asian and European pig breeds 
determined by mitochondrial DNA D-loop sequence polymorphism. 
Anim. Genet. 33: 19-25.  

Lan H, Shi L (1993). The origin and genetic differentiation of nation 
breeds of pigs in southwest China: an approach from mitochondrial 
DNA polymorphism. Biochem. Genet. 31: 51-60.  

Lopez JV, Cerario S, O’Brien SJ (1996). Complete nucleotide 
sequences of the domestic cat (Felis catus) mitochondrial genome 
and a transposed mtDNA tandem repeat (Numt) in the nuclear 
genome. Genomics, 33: 229-246.  

Luetkemeier ES, Sodhi M, Schook LB, Malhi RS (2010). Multiple Asian 
pig origins revealed through genomic analyses. Mol. Phylogenet. 
Evol. 54: 680-686.  

Luikart G, Gielly L, Excoffier, L, Vigne JD, Bouvet J, Taberlet P (2001). 
Multiple maternal origins and weak phylogeographic structure in 
domestic goats. Proc. Natl. Acad. Sci. USA, 98: 927-932.  

Mackay SLD, Ghivizzani SC, Madsen CS (1993). Transcribed 
heteroplasmic repeated sequences in the porcine mitochondrial DNA 
D-loop region. J. Mol. Evol. 37: 36-47.  

Paszek AA, Flickinger GH, Fontanesi L, Beattie CW, Rohrer GA, 
Alexander L, Schook LB (1998). Evaluating evolutionary divergence 
with microsatellites. J. Mol. Evol. 46: 121-126. 

Saitou N, Nei M (1987). The Neighbor-joining method: a new method for  
reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.  

Sanger F, Nicklen S, Coulson AR (1977). DNA sequencing with chain 
terminating inhibitors. Proc. Natl. Acad. USA, 74: 5263-5467.  

Watanabe T, Hayashi Y, Ogasawara N, Tomita T (1985). Polymorphism 
of mitochondrial DNA in pig based on restriction endonuclease 
cleavage patterns. Biol. Gene, 23: 105-113.  

Watanabe T, Ishiguro N, Nakano M (2003). Phylogeography and 
population structure of the Japanese wild boar Sus scrofa 
leucomystax: mitochondrial DNA variation. Zool. Sci. 20: 1477-1489.  

Xu X, Arnason U (1994). The complete mitochondrial DNA sequence of 
the horse, Equus caballus: extensive heteroplasmy of the control 
region. Gene, 148: 357-362.  

Zardoya R, Villalta M, Lopez-Perez MJ Montoya J, Bautista JM (1995). 
Nucleotide sequence of the sheep mitochondrial DNA D-loop and its 
flanking tRNA gene. Curr. Genet. 28: 94-96. 


