




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 7 (1), pp. 001-008, January, 2019. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

Full Length Research Paper 

 

Isolation, sequence identification and tissue 
expression profile of a novel ribokinase gene (RBKS) 

from Chinese Banna mini-pig inbred line (BMI) 

 
Jinlong Huo1,2,3, Pei Wang2,3, Yongwang Miao3, Hailong Huo1,4, Lixian Liu4, Yangzhi 

Zeng2,3 and Heng Xiao1*
 

 
1
Faculty of Life Science, Yunnan University, Kunming 650091, Yunnan, China. 

2
Key Laboratory of Banna Mini-pig 

Inbred Line of Yunnan Province, Kunming 650201, Yunnan, China. 
3
Faculty of Animal Science and Technology, 

Yunnan Agricultural University, Kunming 650201, Yunnan, China. 
4
Department of Husbandry and Veterinary, Yunnan 

Vocational and Technical College of Agriculture, Kunming 650031, China. 

 
Accepted 23 November, 2018 

 
The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene 
(RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the 
conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs. 
This novel gene was then deposited into NCBI database and assigned to accession number JF944892. 
Sequence analysis revealed that the BMI RBKS encodes a protein of 323 amino acids that has high homology 
with the ribokinase proteins of seven species: cattle (99%), horse (99%), orangutan (99%), human (89%), 
monkey (89%), rat (88%) and mouse (80%). The phylogenetic tree analysis revealed that the BMI RBKS gene 
has a closer genetic relationship with the RBKS genes of bovine and horse than with those of orangutan, 
human, monkey, rat and mouse. Analysis by RT-PCR showed that BMI RBKS gene was over-expressed in ovary 
and lung, moderately expressed in spleen, nerve fiber, large intestine and diencephalon, weakly expressed in 
heart, skin, muscle, small intestine, midbrain, kidney and fat, while almost silent in other five tissues. Four 
microRNA target sites were predicted in the CDS of BMI RBKS mRNA for further study of this gene in the 
future. The 3D structure of the RBKS by homology modeling was similar to that of human ribokinase (2fv7). Our 
experiment will establish a foundation for further insight into this swine gene. 
 
Key words: Banna mini-pig inbred line (BMI), pig, ribokinase gene (RBKS), tissue expression analysis, homology 

modeling. 
 
 
INTRODUCTION 

 
Ribokinase (RBKS) is a key enzyme which catalyzes the 

phosphorylation of ribose to ribose 5-phosphate (R-P-5) 

using ATP as a phosphate donor according to the 
 

 
*
Corresponding author. E-mail: xiaoheng@ynu.edu.cn. Fax:  

+86-871-5033732. 
 
Abbreviations: RBKS, Ribokinase gene; EST, expressed 

sequence tag; CDS, coding sequence; RT-PCR, reverse 
transcription-polymerase chain reaction; RMSD, root mean 

square deviation. 

 
 
 
 
 
reaction:  
 
 
 

 
Exogenous ribose plays a number of roles in the 
biological metabolism. For example, ribose addition can 
help maintain higher levels of ATP in rat heart and dog 
kidney during transplantation experiments (Müller et al., 
1998) and it leads to improvement of neurological 
symptoms in patients with adenylosuccinase deficiency 
(Salerno et al., 1999). In order to trap them inside the cell 



 
 
 

 

and prepare them for further chemical reactions, ribose 
must first be converted into ribose-5-phosphate (Bork et 
al., 1993). The phosphorylated ribose can then enter the 
pentose phosphate pathway (PPP) for energy production 
or be used as a carbon source for the synthesis of 
nucleotides, histidine and tryptophan (Anderson and 
Cooper 1969; Lopilato et al., 1984). Sequence analyses 
showed that the enzyme RBKS belongs to the PfkB 
family of carbohydrate kinases (Bork et al., 1993; Wu et 
al., 1991). As another member, RBKS contains two highly 
conserved sequence motifs, a glycine-rich area served as 
a substrate binding site near the N-terminus and a motif 
involved in ATP binding and the catalytic center near the 
C-terminus (Sigrell, et al., 1998, 1999). Particularly, 
RBKS is implicated in tissue-protective mechanisms 
against various ischemic insults.  

Based on the above description of RBKS gene, it is 
necessary to isolate this gene from pig for it is associated 
with energy metabolism, health and other important 
biological functions of animals. But until today, the 
porcine RBKS has not been reported. Surprisingly, the 
Banna mini-pig Inbred line (BMI) was exploited by 
Yunnan Agricultural University from 1980s based on the 
small-ear pigs at Xishuangbanna, Yunnan Province, 
China. A pair of progenitors was a sow and her son. 
Then, the propagation was conducted by means of highly 
full sibling or parent-offspring inbreeding and each 
generation underwent the strict selection. As hetero-
zygotic genes were separated and recombined in the 
process of inbreeding, BMI has already owned six 
families and 18 substrains with different phenotypes and 
genotypes. Due to their consistent genetic background 
and minor interindividual differences, BMI is considered 
as an ideal model organism for biological studies (Crabbe 
et al., 2005; Yu et al., 2004; Zeng and Zeng, 2005).  

The objective of this study was to isolate the full length 
coding sequence of BMI RBKS gene according to the 
conserved sequence information of cattle or other 
mammals and highly homologous swine ESTs sequence 
information, conduct sequence analysis and some 
necessary function analysis of established nucleotide 
sequence, and finally examine the expression in a range 
of BMI tissues. These will provide a primary foundation 
for further research on this porcine gene. 
 

 
MATERIALS AND METHODS 
 
Samples collection, RNA extraction and first-strand cDNA 
synthesis 
 
Three matured female BMI were slaughtered for sampling. Fresh 
tissues (lymph node, midbrain, ovary, diencephalon, cerebrum, 
liver, kidney, spleen, heart, lung, nerve fiber, stomach, small 
intestine, large intestine, pancreas, skin, muscle and fat) were snap 
frozen in liquid nitrogen and stored at -80°C before use. The total 
RNA was extracted using the RNAiso Plus (TaKaRa, Dalian) 
according to the manufacturer's instructions. To remove genomic 
DNA contamination, total RNA was digested with RNase-free 
DNase I (TaKaRa, Dalian). Three micrograms of RNA were reverse 

 
 

 
 

 
transcribed with oligo (dT)18 primer and M-MLV reverse 
transcriptase (Invitrogen, USA). The efficiency of reverse 
transcription was checked on 2% agarose gels stained with 
ethidium bromide. 
 

 
Isolation of the BMI RBKS gene 
 
The GenBank RBKS sequences for human (accession no. 

NM_022128), cattle (accession no. NM _001191271) and their highly 

homologous pig ESTs sequences: CX065544, CN154557, CN165374, 

CK461198, BX924148 and CN165735 were used to design a primer 

pair to amplify the complete coding sequence of RBKS by using Primer 

Premier 5.0 software. The primers for BMI RBKS gene were: 5'- AAT 

GGC CGC GTC TGG GGA AC -3' and 5'-CAG TCA AAA CAG GTA 

AAG GGG C -3'. Reverse transcription-polymerase chain reaction (RT-

PCR) was performed to isolate the BMI RBKS using the pooled cDNAs 

from different tissues listed above. The 25 µl reaction system was: 2.0 µl 

cDNA (25 ng/µl), 2.0  
µl 2.5 mM mixed dNTPs (TaKaRa, Dalian), 2.5 µl 10Taq DNA 

polymerase buffer (Mg
2+

 Plus ), 0.5 µl 10 µM forward primer, 0.5 µl, 10 

µM reverse primer, 0.25 µl Taq DNA polymerase (5 U/µl, TaKaRa, 

Dalian), and 17.25 µl sterile water. The PCR program initially started 

with 94°C denaturation for 2 min, followed by 35 cycles of 94°C /30 s, 
55°C /40 s, 72°C /1.5 min then 72°C extension for 10 min, and finally 

4°C to terminate the reaction. After the PCR, the gene product was 
cloned into pMD18- T vector (TaKaRa, Dalian) and sequenced 

bidirectionally with the commercial fluorometric method. At least, five 

independent clones were sequenced. 
 

 
Bioinformatics analysis 
 
Sequence analysis of BMI RBKS gene was performed using 
softwares in NCBI (http://www.ncbi.nlm.nih.gov) and ExPaSy 
(http://www.expasy.org). The cDNA sequence was predicted using 
the online GenScan software (http://genes.mit.edu/GENSCAN. 
html). Putative protein theoretical molecular weight (Mw) and 
isoelectric point (pI) prediction, signal peptide prediction, subcellular 
localization prediction and transmembrane topology prediction were 
performed using the Compute pI/Mw Tool (http://us.expasy.org/ 
tools/pi_tool.html), SignalP 4.0 server (http://www.cbs.dtu.dk/ 
services/SignalP/), PSort II (http://psort.hgc.jp/) and TMHMM-2.0 
server (http://www.cbs.dtu.dk/services/TMHMM-2.0/), respectively. 
Web-based microRNA (miRNA) predicting program was used to 
locate conserved potential miRNA targets (http://www.mirbase. 
org/). The Blastp program and Conserved Domain Architecture 
Retrieval Tool were used to search for similar proteins and 
conserved domain, respectively(http://www.ncbi.nlm.nih.gov/Blast). 
The alignment of the nucleotide sequences and deduced amino 
acid sequences were computed using ClusterX, and the 
phylogenetic tree was computed using the ClustalX and MEGA 4.0 
softwares with standard parameters. Secondary structures of 
deduced amino acid sequences were predicted with SOPMA 
(http://npsa-pbil.ibcp.fr/). The 3D structures were predicted using 
Discovery Studio 3.1 software. 
 

 
Semi-quantitative RT-PCR 
 
To characterize the RBKS gene further, RT-PCR was conducted to 
determine its expression in 18 BMI tissues. To eliminate the effect 
of cDNA concentration, we repeated the RT-PCR five times using 1, 
2, 3, 4 and 5 µl cDNAs as templates. We selected the 
housekeeping gene 18S rRNA (NR_002170) as a positive control. 
The control primers used were: 5'- GGACATCTAAGG-
GCATCACAG -3' and 5'- AATTCCGATAACGAACGAGACT -3'. The 



      
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 1. RT-PCR result for BMI RBKS gene. M, 
DL2000 DNA marker; 1, PCR product. 

 

 

BMI RBKS primers which were used to perform the semi-
quantitative RT-PCR for tissue expression profile analysis were the 
same as the primers for isolation RT-PCR above. The PCR 
reactions were optimized for a number of cycles to ensure product 
intensity within the linear phase of amplification. 
 

 

RESULTS 

 
Cloning and identification of BMI RBKS cDNA 

 

Through RT-PCR with pooled tissue cDNAs for BMI 
RBKS gene, the resulting PCR product was 976 bp 
(Figure 1). This cDNA nucleotide sequence analysis 
using the BLAST software at NCBI server revealed that 
BMI RBKS gene was not homologous to any of the 
known porcine genes and it was then deposited into the 
GenBank database under accession No. JF944892. The 
sequence prediction was carried out using the GenScan 
software and results show that the 976 bp cDNA 
sequence represents a single gene which encoded 323 
amino acids. The complete CDS and the encoded amino 
acids are presented in Figure 2. 
 

 

Physical and chemical characteristics of BMI RBKS 
 
The theoretical isoelectric point (pI) and molecular weight 
(Mw) were computed using the Compute pI/Mw Tool. The 
pI and the molecular weight of BMI RBKS are 5.16 and 
34532.46, respectively. Submitting the RBKS protein 
sequence to SignalP, the RBKS protein had no N-
terminal signal peptide and is a non-secretory protein 
(Petersen et al., 2011). Using a hidden Markov model 
algorithm, transmembrane topology prediction made by 
TMHMM program (Moller et al., 2001), showed that BMI 
RBKS was not a potential membrane protein. For 
subcellular localization analysis, the amino acid sequence 
was submitted to the PSORT II program, and 

 
 
 
 

 

Reinhardt’s method showed that BMI RBKS was pro-

bably located in the cytoplasm with up to 94.1% 
probability (Nakai and Horton, 1999). 
 

 

Prediction and analysis of structures and conserved 
domains of BMI RBKS 
 

Proteins often contain several domains, each of which 
had their own evolutionary origins and functions. 
Examination using the Conserved Domain Architecture 
Retrieval Tool of Blast at the NCBI server (http:// 
www.ncbi.nlm.nih.gov/BLAST) indicated that BMI RBKS 
contains one separated conserved domain-ribokinase 
(from 23 to 314 amino acid residues, Figure 3). Then, 
putative protein was analyzed using prosite (http:// 
expasy.org/prosite/) and SMART (http://smart.embl-
heidelberg.de/) softwares. Four kinds of sites were found, 
which were N-myristoylation sites (23-GScmTD-28, 53-
GGkgAN-58, 56-GAnqCV-61, 67-GAktSM-72, 238-
GAegCV-243, 267-GAgdSF-272, 307-GTqsSY-312), 
Protein kinase C phosphorylation sites (33-TsR-35, 257-
TeK-259), Casein kinase II phosphorylation sites (160-
TslE-163, 192-TlsD-195, 202-SeaE-205, 208-TglE-211, 
246-SrtE-249, 287-SleE-290) and N-glycosylation sites 
(200-NESE-203, 285-NLSL-288). The prediction of 
secondary structure by SOPMA indicates that the 
deduced BMI RBKS contains 105 alpha helices, 73 
extended strands, 30 beta turns and 115 random coils 
(Figure 4). 
 

 

Homology modeling 

 

In order to better understand the detailed structures of 
BMI RBKS, the homology modeling of RBKS was 
performed to estimate its 3D structure using Discovery 
Studio 3.1 software. Commonly, the root mean square 
deviation (RMSD) between corresponding atoms of the 
template protein and modeled protein is a used measure 
of similarity between two protein structures. The smaller 
the RMSD is between two structures, the more similar are 
these two structures. In protein structure prediction, one 
needs the RMSD between predicted and experimental 
structures for which a prediction can be considered to be 
successful. Success is obvious only when the RMSD is 
as small as that for closely homologous proteins (<3 å) 
(Reva et al., 1998). The RMSD value of BMI RBKS and 
2fv7B (B chain of human RBKS) are 0.218 which 
indicates that the 3D structure of the BMI RBKS was 
similar to that of the human ribokinase (2fv7 Chain: B). 
Furthermore, in the ribokinase domain of RBKS, no 
differences were found among different species of 
animals in the shape and orientation in RBKS on 3D 
structures (Figure 5). The 3D structure analysis may 
provide a basis for further study of the relationship 
between structure and function of RBKS. 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. The complete cDNA sequence and amino acid sequence of the protein encoded by RBKS (GenBank accession number: JF944892). ATG, start 

codon; TGA, stop codon; capital letters, complete CDS and amino acid sequence; gray highlighted nucleotide sequence, primers; pane, catalytic residues  
 
 
 
 
 
 
 
 
 
 
 

 
Figure 3. The putative domains of the protein encoded by BMI RBKS. 

 

 

Location of potential miRNA targets 

 

MicroRNAs are noncoding single-stranded RNA 
molecules of 17 to 24 nucleotides that can 
regulate gene expression by binding to the coding 

 
 

 

region of target mRNAs (Bartel, 2004; Zeng et al., 
2003). We used web-based microRNA (miRNA) 
predicting programs to locate conserved potential 
miRNA targets: miRBase (http:// www.mirbase. 
org/). The results show that four Sus scrofa micro- 

 
 

 

RNAs (ssc-miR-217, ssc-miR-196b-3p, ssc- miR-
1306-3p and ssc-miR-1306-3p) were found to 
have the predicted target sites (313- ugcug-
cgacaggaacugcuucgau-336, 718- ugaagggugugu-
gaugcuguc- 738, 428- accaucagcagagccaaagu- 



      
 
 
 
 
 
 
 
 
 
 

 
Figure 4. The secondary structure of the BMI RBKS protein predicted by SOPMA. Helices, extended strands,beta turns and random coils are indicated, respectively, with 
the longest, the second longest, the second shortest and the shortest vertical lines.  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Figure 5. The tertiary structure of BMI RBKS. (a) BMI RBKS, (b) Human 2fv7B, (c) The superimposition figure; BMI RBKS (red); 

2fv7B (green). 
 

 

447 and 48-cggcggcaguggugguggug-67) in the 
BMI RBKS sequence, respectively. 
 

 

Analysis of sequence identity and evolutionary 
relationships of BMI RBKS 
 
The deduced protein sequence of BMI RBKS was 

submitted to generate BLAST reciprocal best hits, 
and similarity comparison revealed that BMI RBKS 
protein has high homology with the RBKS 

 
 

 

proteins of seven other species: cattle (91%), 
horse (91%), orangutan (91%), human (89%), 
monkey (89%), rat (88%) and mouse (86%) 
(Figure 6). To evaluate the evolutionary 
relationships of BMI RBKS with other species, we 
constructed a phylogenetic tree using DNAstar, 
Cluster, MEGA and DNAMAN softwares on the 
basis of the RBKS amino acid sequences. The 
phylogenetic tree analysis revealed that the BMI 
RBKS gene has a closer genetic relationship with 
the RBKS genes of bovine and horse than with 

 
 

 

those of orangutan, human, monkey, rat and 

mouse (Figure 7). 
 

 

mRNA tissue-specific expression profile 

 

To check the relative expression levels of RBKS 

mRNA in various porcine tissues, semi-
quantitative RT-PCR was performed in 18 BMI 
tissues mentioned above. The continuously 
expressed gene, 18S, was used and served as 



  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Figure 6. The alignment of the protein encoded by the BMI RBKS and other seven kinds of RBKS from cattle 
(NP_001178200), horse (XP_001502121), orangutan (XP_002812214), human (NP_071411), monkey (XP_001100564), 
rat (NP_001102173) and mouse (EDL37382).  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 7. The phylogenetic tree for several kinds of RBKS protein from human, 

orangutan, monkey, BMI-pig, cattle, horse and mouse. 



      
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Figure 8. Tissue expression profile of BMI RBKS gene. The 18S expression level is used for the internal 
control. M, DL2000 DNA marker; 1, lymph node; 2, midbrain; 3, ovary; 4, diencephalon; 5, cerebrum; 6, 
liver; 7, kidney; 8, spleen; 9, heart; 10, lung; 11, nerve fiber; 12, stomach; 13, small intestine; 14, large 
intestine; 15, pancreas; 16, skin; 17, muscle; 18, fat. 

 

 

an endogenous reference for determination of targeted 
mRNA profiles. Result reveals that BMI RBKS gene was 
over-expressed in ovary and lung, moderately expressed 
in spleen, nerve fiber, large intestine and diencephalon, 
weakly expressed in heart, skin, muscle, small intestine, 
midbrain, kidney and fat and almost silent in lymph node, 
cerebrum, liver, stomach and pancreas (Figure 8). 
 

 

DISCUSSION 

 

Comparative genomics determines the relationship of 
genome structure and function of different species. 
Researchers have learnt a great deal about the function 
of human genes by examining their counterparts in 
simpler model organisms such as the mouse and some 
results have revealed that virtually all (99%) of the 
protein-coding genes in humans align with homologues in 
mice, and over 80% are clear 1:1 orthologs (Hardison, 
2003; Liu et al., 2008; Yu et al., 2010; Xi et al., 2011). 
This extensive conservation in protein-coding regions 
implied that the same protein-coding sequences may be 
expected in different mammals including pig. From the 

 
 

 

isolation of swine RBKS gene, we can find that swine 
RBKS is highly homologous with RBKS of human, bovine 
and other mammals. This further validated that 
comparative genomics method is one useful tool to 
isolate the unknown genes especially the conserved 
coding region of genes for pig. From the alignment 
analyses for swine RBKS protein, we also found that BMI 
RBKS protein was not completely identical with human or 
other mammals. This implied that BMI RBKS will have 
some differences in functions with those of human, 
bovine and other mammals.  

The phylogenetic tree analysis revealed that the BMI 
RBKS gene has a closer genetic relationship with the 
bovine and horse RBKS. Therefore, we can use bovine 
and horse as model organisms to study the pig RBKS 
gene or use pig as a model organism to study the bovine 
and horse RBKS gene. Most protein functions are  
regulated by phosphorylation/dephosphorylation, 
glycosylation/deglycosylation and BMI RBKS protein has 
several kinds of functional sites (such as phosphorylation 
sites, glycosylation sites, myristoylation sites and 
ribokinase protein domain, which suggest that RBKS 
protein plays important functional roles through these 



 
 
 

 

sites and domain. MicroRNAs are small noncoding RNA. 
They play a role in gene expression regulation by 
inhibiting translation of their target mRNAs (Bartel et al., 
2004; Zeng et al., 2003). Their target predictions showed 
that four Sus scrofa microRNAs (ssc-miR-217, ssc-miR-
196b-3p, ssc-miR-1306-3p and ssc-miR-1306-3p) were 
found to have the corresponding target sites (313-  
ugcugcgacaggaacugcuucgau-336, 718-ugaagggu-
gugugaugcuguc-738, 428-accaucagcagagccaaagu-447 
and 48-cggcggcaguggugguggug-67) in the BMI RBKS 
coding sequence. Further investigation is needed to 
confirm whether corresponding miRNA molecules can 
regulate the RBKS gene expression in swine.  

RBKS was discovered more than 50 years ago, and 
there has been much progress in understanding this 
important enzyme within the last decade, but the 
molecular mechanisms of its action and target remain a 
central unresolved problem for biochemists and 
pharmacologists. For this reason, the homology modeling 
of the BMI RBKS protein was carried out using human 
ribokinase (2fv7 Chain: B) as the template. Our results 
indicate that the conserved domain (RBKS, 17-323AA) of 
pig RBKS protein mainly exists in the form of αβα 
sandwich domain and β-barrel. It suggests that these 
domains may play a pivotal role in RBKS activity. This 
first pig structural model of RBKS proved to be useful 
reference in designing studies aimed at understanding 
how RBKS interacts with unknown protein partners for 
explaining its various functions.  

In this study, we not only cloned the CDS sequences of 
the BMI RBKS gene but also conducted the sequence 
analysis and tissue expression profiles analysis. From the 
tissue expression profile analysis, it can be seen that the 
gene was obviously differentially expressed in various 
tissues. As the researchers did not study functions at 
protein levels, there might be many possible reasons for 
differential expression of this porcine gene. The suitable 
explanation for this under the current conditions is that 
the biological activities associated with the functions of 
the gene were required in a different extent in different 
tissues at the same time.  

In summary, we firstly isolated BMI RBKS gene and 
performed necessary functional analysis and tissue 
expression profile analysis. Furthermore, several miRNAs 
were found to have the corresponding target sites in the 
coding sequence of BMI RBKS by theoretical prediction.  

The cDNA clone, sequence information and function 
analyses of BMI RBKS gene will be extremely important 
in elucidating the essential physiological function of 
RBKS protein using BMI and other pigs as experimental 
animal models in the future. 
 

 

ACKNOWLEDGMENT 
 
This study was supported by the National Natural 

Science Foundation of China (Grant no. 31160439). 

 
 

 
 

 
REFERENCES 
 
Anderson A, Cooper RA (1969). The significance of ribokinase for ribose 

utilization by Escherichia coli. Biochim. Biophys. Acta, 177: 163-165. 
Bartel DP (2004). MicroRNAs: genomics, biogenesis, mechanism, and 

function. Cell, 116: 281-297. 
Bork P, Sander C, Valencia A (1993). Convergent evolution of similar 

enzymatic function on different protein folds:the hexokinase, 
ribokinase, and galactokinase families of sugar kinases. Protein Sci. 
2: 31-40.  

Crabbe JC, Metten P, Cameron AJ, Wahlsten D (2005). An analysis of 
the genetics of alcohol intoxication in inbred mice. Neurosci. 
Biobehav. Rev. 28: 785-802.  

Hardison RC (2003). Comparative genomics. PLoS. Biol. 1: e58. 
Liu GY, Gao SZ, Ge CR, Zhang X (2008). Molecular characterization of 

the encoding regions and tissue expression analyses for three novel 
porcine genes: HNRPA1, YIPF5, and UB2D2. Mol. Biol. Rep. 35: 
519-526.  

Lopilato JE, Garwin JL, Emr SD, Silhavy TJ, Beckwith JR (1984). D-
ribose metabolism in Escherichia coli K-12: genetics, regulation, and 
transport. J. Bacteriol. 158: 665-673. 

Moller S, Croning MD, Apweiler R (2001). Evaluation of methods for the 
prediction of membrane spanning regions. Bioinformatics, 17: 646-
653. 

Müller C, Zimmer H, Gross M, Gresser U, Brotsack I, Wehling M, Pliml 
W (1998). Effect of ribose on cardiac adenine nucleotides in a donor 
model for heart transplantation. Eur. J. Med. Res. 3: 554-558. 

Nakai K, Horton P (1999). PSORT: a program for detecting the sorting 
signals of proteins and predicting their subcellular localization. 
Trends Biochem. Sci. 24: 34-35. 

Petersen TN, Brunak S, von Heijne G, Nielsen H (2011). SignalP 4.0: 
discriminating signal peptides from transmembrane regions. Nat. 
Methods, 8: 785-786. 

Reva BA, Finkelstein AV, Skolnick J (1998). What is the probability of a 
chance prediction of a protein structure with an rmsd of 6 Å. Fold. 
Des. 3(2): 141-147. 

Salerno C, D'Eufemia P, Finocchiaro R, Celli M, Spalice A, Lannetti P, 
Crifò C, Giardini O (1999). Effect of D-ribose on purine synthesis and 
neurological symptoms in a patient with adenylosuccinase deficiency. 
Biochim. Biophys. Acta, 1453: 135-140.  

Sigrell JA, Cameron AD, Mowbray SL (1999). Induced fit on sugar 
binding activates ribokinase. J. Mol. Biol. 290: 1009-1018. 

Sigrell JA, Cameron AD, Jones TA, Mowbray SL (1998). Structure of 
Escherichia coli ribokinase in complex with ribose and dinucleotide  
determined to 1.8 Å resolution: insights into a new family of kinase 
structures. Structure, 6: 183-193.  

Wu LF, Reizer A, Reizer J, Cai B, Tomich JM, Saier MH (1991). 
Nucleotide sequence of the Rhodobacter capsulatus fruK gene, 
which encodes fructose-1- phosphate kinase: Evidence for a kinase 
superfamily including both phosphofructokinases of Escherichia coli. 
J. Bacteriol. 173: 3117-3127.  

Xi DM, He YD, Sun YK, Gou X, Yang SL, Mao HM, Deng WD (2011). 
Molecular cloning, sequence identification and tissue expression 
profile of three novel genes Sfxn1, Snai2 and Cno from Black-boned 
sheep (Ovis aries). Mol. Biol. Rep. 38: 1883-1887.  

Yu HM, Chen SN, Xi DM, He YD, Liu Q, Mao HM, Deng WD (2010). 
Molecular cloning, sequence characterization and tissue transcription 
profile analyses of two novel genes: LCK and CDK2 from the Black-
boned Sheep (Ovis aries). Mol. Biol. Rep. 37: 39-45.  

Yu P, Zhang L, Li SF, Li YP, Cheng JQ, Zeng YZ (2004). Screening and 
analysis of porcine endogenous retrovirus in Chinese Banna minipig 
inbred line. Transplant Proc. 36: 2485-2487.  

Zeng R, Zeng YZ (2005). Molecular cloning and characterization of 
SLA-DR genes in the 133-family of the Banna mini-pig inbred line. 
Anim. Genet. 36: 267-269.  

Zeng Y, Yi R, Cullen BR (2003). MicroRNAs and small interfering RNAs 
can inhibit mRNA expression by similar mechanisms. Proc. Natl. 
Acad. Sci. USA. 100: 9779-9784. 


