




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 8 (2), pp. 001-004, February, 2020. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

 

Full Length Research Paper 

 

Molecular cloning and phylogenetic analysis of the E 
gene of transmissible gastroenteritis virus (TGEV) 

isolated in China 
 

D. L. Lan, J. P. Gu, R. Xing, C. L. Yuan, L. Cui, X. G. Hua and Z. B. Yang* 
 

Shanghai Key Laboratory of Veterinary Biotechnology, School of Agriculture and Biology, Shanghai JiaoTong University, 

Shanghai 200240, China. 
 

Accepted 15 September, 2019 
 

Porcine transmissible gastroenteritis caused by transmissible gastroenteritis virus (TGEV) induces acute, 

high-contact intestinal infectious diseases in pigs. TGEV encodes four structural proteins including spike 

(S), membrane (M), envelope (E) and nucleoprotein (N), of these, the genes of S, M and N respectively had 

been deeply elucidated. However, the real function of E protein was still unclear and sequence 

comparison of the E gene of different TGEV isolates had not been reported so far. In this study, E gene of 

TGEV strain isolated in China was molecularly cloned and sequenced. Phylogenetic analysis confirmed 

this gene was relatively conserved. All the China TGEV strains were brached in one clade together with 

the American strains, but showed relatively alien to the European strains. 
 

Key words: Transmissible gastroenteritis virus, E gene, phylogenetic analysis. 

 
INTRODUCTION 

 
Transmissible gastroenteritis virus (TGEV) is identified as 
one of the most important pathogenic agents during swine 

enteric infection, leading to high mortality in neonatal pigs 

and severe annual economic loss in swine-producing 

areas (Zhou et al., 2007). As a member of the 

Coronaviridae, TGEV possesses a large 28.5 kb single-

stranded sense RNA genome in which genes are arranged 

in the order 5’-Rep-S-3a-3b-E-M-N-7-3’(Park et al., 2008). 

Four of them, rep, 3a, 3b, and 7 encode non-structural 

proteins (Penzes et al., 2001). The others encode four 

structural proteins including spike (S), membrane (M), 

envelope (E) and nucleoprotein (N). In these four structural 

genes, the genes of S, M and N respectively are being 

deeply elucidated, and some characteristics have been 

ascertained and explained (Escors et al., 2001; Gebauer et 

al., 1991; Kapke and  
 
 
 
*Corresponding author. E-mail: zbyang@sjtu.edu.cn. Tel: +86- 
21-34205779. Fax: +86-21-34205779. 

 
 
Brian, 1986; Krempl et al., 1997; Laude et al., 1987). 

Nevertheless, the functional action of E gene is 

poorlyunderstood currently.  
E gene is a small structural gene that encodes an 82 

amino acid membrane-associated protein called E protein 

(formerly called sM)(Baudoux et al., 1998). E protein is an 

integral membrane protein having a Cexo-Nendo 

orientation and binding with the envelope. The epitopes of 

this protein are localized within the last 21 C-terminal 

residues of the sequence, and the antibodies that are 

specific for E protein can be tested in pig sera infected 

TGEV (Godet et al., 1992). Previous research suggested 

that E protein is an efficient inductor of alpha interferon 

(IFN-alpha) synthesis in vitro (Baudoux et al., 1998; Riffault 

et al., 1997). Recently, it was reported that it is essential 

for viral reproduction and play a role in virion assembly or 

release (Ortego et al., 2007). However, the real function of 

E protein is still unclear. Moreover, to the best of our 

knowledge, sequence comparison of the E gene of 

different TGEV isolates have been not reported so far. 



 
 
 

 
Table 1. The characteristics of TGEVs used in this study.  

 
 Strain name Place of Origin (abbreviation) Genbank accession number 

 H16 China FJ755618 

 attenuated H China EU074218 
 SC-Y China DQ443743 

 TS China DQ201447 

 TFI Taiwan Z35758 

 Miller M60 the United States of America (USA) DQ811786 

 Miller M6 the United States of America (USA) DQ811785 

 Purdue the United States of America (USA) DQ811789 

 Purdue P115 the United States of America (USA) DQ811788 

 PUR46-MAD the United States of America (USA) AJ271965 

 96-1933 the United Kingdom of Great British (UK) AF104420 

 FS772/70 the United Kingdom of Great British (UK) Y00542 
 

 
MATERIALS AND METHODS 
 
Virus and in vitro growth 
 
A Chinese TGEV strain named TGEs-1 was isolated from pigs in 
a small commercial pig farm that lies in Shanghai suburb. The 
swine testis (ST) cells were grown in Dulbecco’s modified Eagle 
medium (DMEM, GIBCO, USA) supplemented with 10% foetal 
bovine serum (FBS, GIBCO, USA) and maintained in 
maintenance medium (DMEM supplemented with 2% FBS) at 

37°C in a 5% CO 2 atmosphere.  
The TGEs-1 strain was passaged 6 times on ST cells and the 

value of TCID50 was evaluated. Virus infected ST cells showing 
90% cytopathic effects were frozen and thawed and cellular 

debris was removed by centrifugation at 10×l0 
3
g at 4°C for 30 

min. The clarified cell culture supernatant was collected and used 
for preparation of viral RNA. 
 

 
RNA isolation and reverse transcription-polymerase chain 
reaction (RT- PCR) 
 
Viral RNA was extracted by use of TRIZOL Reagent (Takara, 
China) according to the manufacturer’s instructions. The RT 

reaction was performed using PrimeScript™ 1 
st

 Strand cDNA 
Synthesis Kit (Takara, China) following the manufacturer’s 
protocol. Briefly, the mixture containing 5 µl of RNA, 1 µl of 
random primers (50 µM), and 1 µl of dNTPs (10 mM) was heated 
at 65°C for 5 min. Then, 4 µl of 5×PrimeScript™ Buffer, 0.5 µl of 
RNase inhibitor (40 U/µl), 1 µl of PrimeScript™ RTase (200 U/ µl) 
and 7.5 µl of RNase free ddH2O were added to the mixture for a 
total volume of 20 µl. The RT reaction to synthesise cDNA was 

performed at 30
◦
C for 10 min, at 42°C for 60 min, followed by 

heating at 70°C for 15 min total volume of 20 µl. The RT reaction 
to synthesise cDNA was performed at 30°C for 10 min, at 42°C 
for 60 min, fol lowed by heating at 70°C for 15 min.  

The cDNA obtained was amplified with forward primer TGEV-EF 

(5’-TTTATGTATTTTCACAGGAGCCC -3’) and reverse primer TGEV-

ER (5’- TAGCACAATAGCGTTCTCCACAT -3’) designed by 

ourselves. The PCR reaction mixture contained 25 µl of PCR premix 

(0.1U of Taq polymerase/µl, 500 µM of dNTPeach, 20 mM Tris-HCl, 3 

M MgCl2, 100 Mm KCl) (TIANGEN, China), 1 µl of forward and 

reverse primers, and 5 µl of cDNA. A 50 µl total reaction volume was 

obtained by adding distilled water. The PCR was performed by 35 

cycles of 60 s at 94°C, 1 min at 50°C and 1.5 min at 72°C; followed by 

a final extension time of 5 min at 72°C. 

 

 
PCR products were electrophoresed in 2% agarose gels 
containing ethidium bromide (10 mg/mL) and confirmed using a 
UV-transilluminator (Bio-Rad, USA). 

 

Cloning and DNA sequencing 
 
The PCR products were gel purified using AxyPrep DNA Gel 
Extraction Kit (Axygene, USA) according to the manufacturer’s 
instructions. The purified DNA was ligated into the pMD-18 
cloning vector (Takara, China) and transformed into competent 
cells (TOP10, TIANGEN, China). The positive recombinants were 
selected with blue and white screening. In addition, the plasmids 
were extracted with extraction Kits (Axygene, USA) .Then the 
identified positive recombinants were sequenced using 
dideoxynucleotide chaintermination procedures (Shanghai, 
China), and the sequence of E gene of TGEs-1 strain was 
submitted to GenBank of NCBI. 

 

Sequence analysis 
 
The DNA sequences were analyzed with the MegAlign software 
(DNAStar Inc., USA), and then compared with other 12 published 
TGEV DNA sequences (Table 1) using CLUSTAL X v 1.82 
programme (USA). A phylogenetic tree of the E gene was 
generated by the Neighbour-joining method with 100 bootstrap 
replicates in a heuristic search with the MEGA 4.1 software 
programme (USA). The origin places and Genbank accession 
numbers of TGEVs used in this study are presented in Table 1. 
 

 
RESULTS AND DISCUSSION 

 
The TGEs-1 strain was passaged serially 6 times in ST 

cells. The growth characteristics of TGEs-1 of each in vitro 

generation were almost the same. Cytopathic effects 

(CPE) occurred 48 h post-infection. During this time the  
cells rounded, condensated, and gradually peeled off. The 

TCID50 of TGEs-1 strain was 10
-8.2

/0.2 ml. These  
results suggest that this isolated China strain is a virulent 
strain.  

Then the complete E gene of TGEs-1 strain was 

amplified by RT-PCR, cloned, and sequenced. The 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 1. Phylogenetic relationships based on nucleotide sequences of the gene E region 
among TGEV strains used here. The phylogenetic tree was generated by the Neighbor-Joining 
method in a heuristic search with 1000 bootstrap replicates. 

 
 

 

complete E gene sequence of TGEs-1 strain was 249 bp 

(GenBank accession number: GU250738). The nucleotide 

sequence comparison of TGEs-1 strain with other 

reference strains of TGEV showed that there was no 

deletion or insertion in the E gene of the TGEs-1 strain. 

Among these strains, TGEs-1 strain had high nucleotide 

identities of 98.4 -100% with other strains, specially had a 

100% identity with China TS strain. Comparison of these 

strains, only the Taiwan strain TFI and the UK strain 

FS772/70 missing two bases in the E gene sequence, but 

these two strains are all virulent isolate, and whether this 

kind of point mutation will influence the viral reproduction, 

assembly, release or tropism of the virus need further 

study. Likewise, the amino acid sequence comparison 

showed that TGEs-1 strain had a similarity between 95.1% 

(attenuated H) and 100% (TS) with other reference strains. 

In general, there is little different between each strain in E 

gene, and the E gene of TGEV is relatively conserved. 
 

The precise function of the E gene product is not clearly 

understood, but it has been suggested that this gene might 

play a role in the pathogenicity of TGEV (Baudoux et al., 

1998; Ortego et al., 2007; Riffault et al., 1997). However, 

interestingly, here we found that virulent strains have little 
difference with attenuated virulent strains in E gene. This 

result is contradicted to the previous studies and remained 

to be explored. We speculate that the virulence of TGEV is 

related with E gene, but E gene is not the only determining 

factor.  
To investigate the evolutionary relationships between 

 
 
 

 

TGEs-1 strain and others, a phylogentic tree was 

constructed based on their E gene sequences (Figure 1). 

The tree revealed the five China TGEV isolates were 
clustered into three distinct groups. As expected, based on 

genetic homology, TGEs-1 and TS were clustered together 

in a group. SC-Y strain (China) has closer relationship with 

Purdue P115 and PUR46-MAD strains (USA), H16 strain 

and attenuated H strain could be clustered together in a 

group. Notably, the phylogentic relationship of TGEV 

strains from China was closed with the American strains, 

but alien to the European strains.  
In conclusion, the E gene sequences of TGEV isolated 

from different regions are relatively conserved. All the 

China TGEV strains possess extremely intimate relation-

ship with the American strains and are relatively alien to 

the European strains. 
 

 
ACKNOWLEDGEMENT 

 
This work was supported by National Key Laboratory of 

Veterinary Biotechnology (SKLVBF201001). 

 
REFERENCES 
 
Baudoux P, Besnardeau L, Carrat C, Rottier P, Charley B, Laude H 

(1998). Interferon alpha inducing property of coronavirus particles 
and pseudoparticles. Adv Exp Med Biol., 440:377-386.  

Escors D, Camafeita E, Ortego J, Laude H, Enjuanes L (2001). 
Organization of two transmissible gastroenteritis coronavirus 
membrane protein topologies within the virion and core. J Virol., 



 
 
 

 
75:12228-12240.  

Gebauer F, Posthumus WP, Correa I, Sune C, Smerdou C, Sanchez 
CM, Lenstra JA, Meloen RH, Enjuanes L (1991). Residues involved 
in the antigenic sites of transmissible gastroenteritis coronavirus S 
glycoprotein. Virology, 183:225-238.  

Godet M, L'Haridon R, Vautherot JF, Laude H (1992). TGEV corona 
virus ORF4 encodes a membrane protein that is incorporated into 
virions. Virology, 188:666-675.  

Kapke PA, Brian DA (1986). Sequence analysis of the porcine 
transmissible gastroenteritis coronavirus nucleocapsid protein 
gene. Virology, 151:41-49.  

Krempl C, Schultze B, Laude H, Herrler G (1997). Point mutations in 
the S protein connect the sialic acid binding activity with the 
enteropathogenicity of transmissible gastroenteritis coronavirus. J 
Virol., 71:3285-3287.  

Laude H, Rasschaert D, Huet JC (1987). Sequence and N-terminal 

processing of the transmembrane protein E1 of the coronavirus 

transmissible gastroenteritis virus. J Gen. Virol., 68 (Pt 6):1687-1693. 

 
 
 

 
Ortego J, Ceriani JE, Patino C, Plana J, Enjuanes L (2007). Absence 

of E protein arrests transmissible gastroenteritis coronavirus 
maturation in the secretory pathway. Virology, 368:296-308. 

Park JH, Han JH, Kwon HM (2008). Sequence analysis of the ORF 7 
region of transmissible gastroenteritis viruses isolated in Korea. 
Virus Genes., 36, 71-78.  

Penzes Z, Gonzalez JM, Calvo E, Izeta A, Smerdou C, Mendez A, 
Sanchez CM, Sola I, Almazan F, Enjuanes L（2001). Complete 
genome sequence of transmissible gastroenteritis coronavirus 
PUR46-MAD clone and evolution of the purdue virus cluster. Virus 
Genes., 23:105-118.  

Riffault S, Grosclaude J, Vayssier M, Laude H, Charley B (1997). 
Reconstituted coronavirus TGEV virosomes lose the virus ability to 
induce porcine interferon-alpha production. Vet Res., 28:77-86.  

Zhou JF, Hua XG, Cui L, Zhu JG, Miao DN, Zou Y, He XZ, Su WG 
(2007). Effective inhibition of porcine transmissible gastroenteritis 
virus replication in ST cells by shRNAs targeting RNA-dependent 
RNA polymerase gene. Antiviral Res., 74:36-42. 


