




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 8 (3), pp. 001-007, March, 2020. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 
 

Full Length Research Paper 

 

Tetracycline resistance genes in Pasteurella multocida 
isolates from bovine, ovine, caprine and swine 

pneumonic lungs originated from different Greek 
prefectures 

 
Maria Babetsa1,2, Vassilios Sandalakis4,5, Christina Vougidou3, Antonios 

Zdragas1, Afroditi Sivropoulou2, Anna Psaroulaki4,5 and Loukia V. 
Ekateriniadou1* 

 
1
National Agricultural Research Foundation, N.AG.RE.F., Veterinary Research Institute of 

Thessaloniki, N.AG.RE.F Campus of Thermi, 57001, Thermi, Thessalonki, Greece.  
2
Department of Biology, Aristotle University of Thessaloniki, Campus of Thessaloniki 54124, Thessaloniki, 

Greece. 
3
Institute of Infectious and Parasitic Diseases of Thessaloniki, Ministry of Rural Development and 

Food, 54627, Thessaloniki, Greece. 
4
Regional Laboratory of Public Health of Crete, 71110, Heraklion, Crete, Greece. 

5
Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, WHOcc, University of Crete,  

71110, Heraklion, Crete, Greece. 
 

Accepted 13 October, 2019 
 

The aim of the present work was to analyze the antibiotic resistance of Pasteurella multocida isolates 
from sheep, goats, cattle and pigs originated from eight different Greek prefectures, to determine the 
class(es) of the tet genes, to investigate any possible association with plasmids or/and chromosomes 
and to study the geographical distribution of the resistant isolates. Eighteen out to one hundred 
isolates were resistant to tetracycline with a minimal inhibitory concentration (MIC) higher than 128 
μg/ml. The tetH gene was found in thirteen (72.2%) and the tetB gene was found in four isolates (22.2%). 
After treatment with the restriction enzymes EcoRV, EcoRI, PstI and BspHI, the tetB gene showed a new 
polymorphism. Partial sequencing of the tetH and tetB genes revealed five polymorphisms in the tetB 
gene and two polymorphisms in the tetH gene; phylogenetic and molecular evolutionary analyses were 
also conducted. Both tetB and tetH genes revealed patterns clearly differentiated from the rest of 
Pasteurella species meaning that the genes could be transferred from a non Pasteurella species. The 
results presented provide further knowledge and evidence of the role played by commensals as of 
resistance determinants. 

 
Key words: Pasteurella multocida, tet genes, multiple sequence analysis. 

 
 
INTRODUCTION 

 
Pasteurella multocida causes economically important 
diseases in food-producing animals and exhibits  
 
 
 
*Corresponding author. E-mail: ekateriniadou@vri.gr. Tel: 
+302310365392. Fax: +302310365371. 

 
 
 
 

 
resistance to a large number of antimicrobial agents; as a 
result a limited number of antimicrobial agents is 
available for treatment including, sulphonamides, 
tetracycline and streptomycin. The use of tetracycline, for 
both the treatment and the prevention of diseases in 
which P. multocida is involved, results in high 
percentages of tetracycline-resistant strains (Kehrenberg 



 
 
 

 

and Schwarz, 2000). Resistance to antimicrobial agents, 
including tetracycline depends on the host, the 
geographical origin and the antimicrobial pre-treatment. 
Antimicrobial resistance has been reported in a wide 
variety of animal pathogens for example P. multocida 
from cattle; (McEwen and Fedorka-Cray, 2002). Data 
collected from 13 European countries showed that 
isolates of P. multocida were resistant to different anti-
microbial agents in eight countries. From 1987 to 2004, 
the percentage of tetracycline resistant isolates from 
cattle in different European countries ranged between 1% 
in England and 24% in Italy (Lizarazo et al., 2006; Kaspar 
et al., 2007; Wallmann et al., 2007; Hendriksen et al., 
2008). In Greece, all P. multocida strains isolated from 
pigs and rabbits in 1984 to 1987 were susceptible to 
tetracycline (Ekateriniadou, 1989).  

In the present study, the tetB, tetA, tetM and tetH 
genes were studied. The tetB gene which is part of the 
non-conjugative transposon Tn10, has been found in 
genus Pasteurella (Kehrenberg et al., 2001) and it is the 
most frequently isolated tet gene in Enterobacteriaceae. 
The tetA gene, encoded also by the transposon Tn10, is 
one of the most widespread tet genes in 
Enterobacteriaceae (Kehrenberg et al., 2001, 2005; 
Millan et al., 2009) found in a variety of ecosystems 
including estuarine waters (Henriques et al., 2008). The 
tetM gene is the most prevalent determinant in Listeria 
species (Chen et al., 2010) and common gene conferring 
tetracycline resistance in Staphylococcus aureus  
http://jac.oxfordjournals.org/contnent/64/3/490.full and 
widely distributed among both Gram-positive and Gram-
negative bacteria; this is probably due to the association 
of tetM gene with integrative and conjugative transposons 
as Tn916 which can be expressed both in Gram-positive 
and Gram-negative bacteria (de Vriest et al., 2009). The 
tetM gene has been detected in the chromosomal 
deoxyribonucleic acid (DNA) of P. multocida isolates. The 
tetH gene which seems to be indigenous to Pasteurellae 
was detected on plasmids pVM111, pMHT1, pPMT1 and 
pPAT1 and on the transposon Tn5706 (Hansen et al., 
1993; Kehrenberg et al., 1998, 2001). The aim of our 
study was to determine the class(es) of the tet genes 
present in P. multocida isolates, to identify their 
association with plasmid or/and chromosome and to 
investigate the geographical distribution of the resistant 
isolates in Greece. 
 

 
MATERIALS AND METHODS 

 
Bacterial isolates and antimicrobial susceptibility testing 

 
One hundred P. multocida strains were isolated from pneumonic 
tissue samples that originated from sheep, goats, cattle and pigs 
originated from eight different Greek prefectures. The samples were 
inoculated on blood agar plates (5% v/v sheep blood) and were 
aerobically incubated at 37°C for 18 to 24 h. After isolation, 
microscopic examination and biochemical testing (oxidase, catalase 
and indole production) were used for the final identification of the 

 
 
 
 

 
strains (Garity et al., 2004). The determination of tetracycline 
resistance was performed by the agar diffusion method using disks 
of tetracycline (30 μg/ml) and the phenotypic resistance of 
tetracycline was further analyzed by determining the MIC according 
to the CLSI’ broth micro dilution procedure, using two-fold dilution 
series in the range of 8 to 128 μg/ml. 

 

Identification of the tet gene classes 
 
Both genomic and plasmid DNA extractions were carried out: 
genomic DNA extraction was performed in the tetracycline 

resistance isolates using the PureLink 
TM

 Genomic DNA Kit 

(Invitrogen) while plasmid DNA extraction was performed using the 

PureLink 
TM

 HiPure Plasmid DNA Purification Kit (Invitrogen). For 

the evaluation of the method applied in this study concerning the 
accuracy of the plasmid DNA isolation and particularly whether 
fragments of chromosomal DNA might be isolated with plasmids, 
closed circular plasmid DNA from the tetracycline-resistant P. 
multocida strains was purified also by equilibrium centrifugation in 
CsCI-ethidium bromide gradients (Sambrook et al., 2001). The 
purified plasmids were used to transform competent Escherichia 
coli (XL1-Blue) cells, which subsequently were plated in LB agar 
containing 50 μg/ml of tetracycline. The appearance of tetracycline-
resistant strains in all cases, confirms the presence of tetracycline-
resistant genes in the examined plasmids. Further, in the above 
plasmids derived from the P. multocida strains were detected with 
Polymerase chain reaction (PCR) the tetB, tetH and tetH genes, 
respectively, as in the method applied in the present study. 
Additionally, for the evaluation of chromosomal DNA isolation and 
particularly whether large plasmids might be segregated with 
chromosomal DNA, plasmid curing was applied in two tetracycline-
resistant P. multocida strains (706/14 and 806/8 p) by growing the 
bacteria on Brain Heart infusion agar in the presence of 0.002% 
sodium dodecyl sulphate (SDS) and incubation for 24 h, at 42°C 
(Sivropoulou et al., 2000). Plasmid isolation from totally 30 colonies 
of P. multocida 706/14 p, revealed that two were free from 
plasmids, and from 45 colonies from P. multocida 806/8 p, five 
were free from plasmids. Since the above colonies were remained 
resistant to tetracycline, the tetracycline resistant genes are located 
in the chromosome as detected with the method applied in the 
present study.  

For PCR analysis six class-specific primmer sets were used to 
amplify the tetA, tetB, tetH and tetM genes in all the resistant 
isolates (Table 1).  

In order to optimize the methodology, three different PCR 
protocols were used: (a) a short protocol (SP) described by Koike 
et al. (2007), (b) a two-temperature step-down protocol (TSP) 
characterized by a higher sensitivity described by Aminov et al. 
(2002) and (c) a long time protocol (LTP) carried out to enhance a 
longer part of the tetB and tetH genes (Hansen et al., 1993; 
Kehrenberg and Schwarz, 2000). Amplicons of the tetB and tetH 
genes were of 1170 and 1076 bp, respectively. DNA amplifications 
using the LTP protocol were carried out for DNA analysis by the 
restriction fragment length polymorphism (RFLP) method as well as 
by sequencing (Fluit et al., 2001). DNA amplification was performed 
in a PTC-200 Peltier Thermal Cycler (MJ Research). Non-amplified 
isolates by the SP protocol were further analyzed by the TSP 
protocol. 

 

Analysis of the tetB and tetH classes 

 
The isolates carrying the tetB and the tetH genes were treated with 
the restriction enzymes EcorV, EcorI, PstI, BspHI to detect possible 
polymorphisms. Reactions were performed in a total volume of 15 
μl according to the manufacturer’s instructions. The resulting 
fragments were separated by 3% low melt agarose gel 



  
 
 

 
Table 1. Primers used for the identification of tetA, tetB, tetH, tetM genes of P. multocida isolates.  
 
 Primer set   Sequence (5'→3') Annealing temperature (°C) Protocol Fragment size (bp) 

 

 
tetA 

F΄ GCGCGATCTGGTTCACTCG 
61 SP-STP 164 

 

 
R΄ AGTCGACAGYRGCGCCGGC  

     
 

 
tetB 

F΄ TACGTGAATTTATTGCTTCGG 
61 SP-STP 206 

 

 
R΄ ATACAGCATCCAAAGCGCAC 

 

     
 

 
tetM 

F΄ ACAGAAAGCTTATTATATAAC 
58 SP-STP 170  

 
R΄ TGGCGTGTCTATGATGTTCAC 

 

     
 

 
tetH 

F΄ CAGTGAAAATTCACTGGCAAC 
61 SP-STP 185  

 
R΄ ATCCAAAGTGTGGTTGAGAAT  

     
 

 
tetB 

F΄ ACGTTACTCGATGCCAT 
55 LTP 1170  

 
R΄ AGCACTTGTCTCCTGTT  

     
 

 
tetH 

F΄ ATACTGCTGATCACCCGT 
55 LTP 1076  

 

R΄ TCCCAATAAGCGACGCT 
 

     
  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

The tetB gene of this study 
is enclosed within the box. 
The gene from the Greek  
isolate is clustered 
separately from other 
species of the Pasteurella 
genus 

 

 
Figure 2. Phylogenetic tree of tetB gene. 

 

 

electrophoresis (UltraPure
TM

 LMP Agarose, Invitrogen). 

 

Sequencing analysis of the tetB and tetH genes 
 
The tetB and tetH genes were partially amplified using the LTP 
protocol and the primers tetHLTPF, tetHLTPR and tetBLTPF, 
tetBLTPR. Sequencing analysis was performed on a Sequence 
Scanner version 1.0 (Applied Biosystems) and EditSeq, MegAlign 
modules of the Lasergene Ver.7.1 software (DNASTAR Inc., 
Madison, WI, USA). Complementary alignments were also 

 
 

 
performed using ClustalW2 multiple sequence alignment software  
(http://www.ebi.ac.uk/Tools/msa/clustalw2). Phylogenetic and 
molecular evolutionary analyses were conducted using MEGA 
version 4 (Tamura et al., 2007). The tetB gene was aligned with the 
corresponding sequences from the bacteria Haemophilus 
parainfluenzae, Haemophilus influenzae, Pasteurella aerogenes, 
Pasteurella multocida and from plasmid R100. The sequence of the 
tetB gene in the Tn10 transposon element (J01830.1, Genbank) 
was used as reference sequence (Figure 2). The tetH gene was 
aligned with the corresponding sequences from two different strains 
of P. multocida, P. haemolitica, Actinobacillus pleuropneumoniae, 



  
 
 
 
 

 

The tetH gene of this 
study is enclosed within 
the box. The gene from 
the Greek isolate is 
clearly separated from 
other species of the 
Pasteurella genus 

 
 
 
 
 

Figure 3. Phylogenetic tree of tetH gene. 
 

 
Table 2. Polymorphisms in tetB gene.  
 
 

Accession number 
   Nucleotide position   

 

  

511b 842b 902b 988b 1014b 1060b 
 

   
 

 
J01830.1 

nt ACT GAA GAT GAG TTG ACT 
 

 

aa T E D E L T 
 

  
 

 
706/p14tetB 

nt GCT GGA GTT CAG TTG GCT 
 

 
aa A G V Q L A 

 

  
 

 
FQ312002.1 

nt GCT GGA GTT CAG TTG GCT 
 

 
aa A G V Q L A  

  
 

 
AJ627386.1 

nt GCT GGA GTT CAG TTG GCT 
 

 

aa A G V Q L A 
 

  
 

 
AJ278685.1 

nt GCT GGA GTT CAG TTT GCT 
 

 
aa A G V Q F A  

  
 

 
AP000342.1 

nt ACT GGA GTT CAG TTG GCT 
 

 

aa T G V Q L A 
 

  
 

 
EU252517.1 

nt ACT GGA GTT CAG TTG GCT 
 

 

aa T G V Q L A 
 

  
 

 
*Numbering is according to the highlighted is the reference sequence, nt-nucleotide sequence, aa-amino acid sequence. 
 

 
and P. aerogenes. Plasmid PVM111 was used as reference 
sequence (Figure 3). Both amino acid sequences were aligned with 
the corresponding sequences (Tables 2 and 3). The amino acid 
sequence of the tetB gene in the Tn10 transposon element was 
used as reference sequence. 

 

Nucleotide sequence accession numbers 
 
The nucleotide sequence of the 1069 bp segment of the tetB gene 
and the 987 bp segment of the tetH gene were deposited in the 
EMBL database (accession no FR872822 and FR872823, 
respectively). 

 
 

 

RESULTS 
 
From the one hundred P. multocida isolates, eighteen 
showed resistance to tetracycline with MIC higher than 
128 μg/ml. The origin of the isolates is showed in Figure  
1. The size of the amplicons for each of the three PCR 
protocols used in the study is shown in Table 1. The tetH 
gene was found in thirteen (72,2%) and the tetB gene in 
four isolates (22,2%). In one isolate (5,5%) none of the 
four tet genes was detected. Both genes were found in 
chromosomal as well as in plasmid DNA. Only one 



  
 
 

 
Table 3. Polymorphisms in tetH gene.  

 
 

Accession number 
    Nucleotide position   

 

    

410b 
 

755b 765b 
 

       
 

 
AJ514834.1 

  nt GTT  GCG GGT 
 

   

aa V 
 

A G 
 

      
 

 
706/p8 tetH 

  nt GCT  GCG GGG 
 

   
aa A 

 
A G  

      
 

 
U00792.1 

  nt GTT  GCG GGT 
 

   

aa V 
 

A G 
 

      
 

 
Y16103.1 

  nt GCT  GGG GGT 
 

   

aa A 
 

G G 
 

      
 

 
Y15510.1 

  nt GCT  GCG GGT 
 

   

aa A 
 

A G 
 

      
 

 
AY987962.1 

  nt GCT  GCG GGT 
 

   

aa A 
 

A G 
 

      
 

 
AJ245947.1 

  nt GCT  GCG GGT 
 

   

aa A 
 

A G 
 

      
 

           
 

   1K 
1T 1X 

     
 

         
 

    

1C 
     

 

       10V  isolates  from  pigs  in  the  
 

   1L     prefectureofVoiotia (5  
 

       tetH/4tetB/ not identified)   
 

          
 

        2I  isolates tetH  from  sheep  in  
 

        the prefecture of Ilia   
 

     10V   1X isolate tetH from pig in the  
 

   
1A 

    prefecture of Xanthi   
 

       1C  isolate  tetH  from  sheep  in  
 

         
 

   2I     the prefecture of Chalkidiki   
 

   ep     1A  isolate tetH from  sheep in  
 

        the prefecture of Achaia   
 

        1K  isolate tetH from  sheep in  
 

        the prefecture of Kilkis   
 

        1L  isolate  tetH from  sheep  in  
 

        the prefecture of Larisa   
 

        1T isolate tetH from sheep in the  
 

        prefecture of Thessaloniki   
 

           
  

 
Figure 1. Geographical distribution of the local isolates. 

 

 

isolate was found carrying the tetH gene in plasmid but 
not in chromosomal DNA. Amplified tetB and tetH genes 
were analyzed by the RFLP method. Digestion was 
performed with EcoRV, EcoRI, PstI and BspHI restriction 
enzymes. The amplicons of tetB gene resulted to the 
same RFLPs patterns as the reference sequence of 
Transposon Tn10 (J01830, Genbank). Only treatment 
with BspHI resulted in a different profile: in contrast to the 
local isolates, the reference strain showed a recognition 
site for the enzyme BspHI in position 951/955. No 
polymorphisms were identified in the amplicons of the 

 
 

 

tetH gene.  
Amplicons of the tetB and tetH genes were partially 

(1060 bp and 987, respectively) sequenced. Unique tetB 
and tetH sequences were identified. Analysis of the tetB 
gene and comparison with the corresponding sequences 
(Table 2), revealed five Single Nucleotide Polymorphisms 
(SNPs) (A538G, A892G, A929T, G1038C, A1087G). 
Polymorphism A538G could be detected after digestion 
with the restriction enzyme Tsp45I (GTSAC). From the 
analysis of the tetH gene two polymorphisms were found 
(C460T, G815T). Polymorphism C460T was common 



 
 
 

 

(Table 3) while polymorphism G815T was found for the 
first time. Both amino acid sequences were aligned with 
the corresponding sequences. Comparison between the 
tetB and transposon Tn10, revealed five SNPs (T171A, 
E281G, D301V, E330Q, T354A). Polymorphism T171A 
was common among the tetB amino acid sequences of H. 
parainfluenzae, H. influenzae, and P. aerogenes. The 
other four polymorphisms (E281G, D301V, E330Q and 
T354A) were common not only among H. parainfluenzae, 
H. influenzae and P. aerogenes but also among Plasmid 
R100 and P. multocida. These four polymorphisms have 
not been found in Tn10 transposon element. One 
polymorphism (V137A) was found in the tetH aminoacid 
sequence. Polymorphism V137A was common among 
strains of P. haemolytica, P. multocida, A. 
pleuropneumoniae and P. aerogenes. The phylogenetic 
trees for both genes were created using the Neighbor-
Joining method with bootstrap test (500 replicates). The 
evolutionary distances were computed using the Kimura 
2-parameter method (Kimura, 1980). All positions 
containing gaps and missing data were eliminated from 
the dataset (complete deletion option). Based on the tetB 
dendrogram (Figure 2) we can observe the close 
clustering of the Greek P. multocida isolates with species 
of Shigella, Salmonella, Haemophilus and Escerichia. 
The Greek P. multocida isolates of the tetB gene were 
less homologous to those of P. aerogenes plasmid 
pPAT2 and also clustered separately from the tetB of P. 
multocida plasmid pB1001. As shown in the dendrogram 
(Figure 3), the tetH gene of the Greek P. multocida 
isolates has evolved and separated from the cluster of P. 
multocida pPMT1 plasmid (Y15510.1), P. aerogenes  
plasmid pPAT1, Acinetobacter sp. and Haemophilus 
somnus. Furthermore, the tetH gene of P. haemolytica 
plasmid pPHT1 has followed an evolutionary process that 
differentiated it from the cluster forming a distinct branch. 
P. multocida U00792.1 and P. multocida partial plasmid 
pVM111, depicted in a common branch, also evolved 
separately from the rest of the entries. 
 

 

DISCUSSION 

 

Antimicrobial resistance is a concern for animal health but 
little is known about the magnitude of this problem as the 
surveillance of resistance in exclusive animal pathogens 
(for example, Moraxella bovis, Actinobacillus 
pleuropneumoniae and Pasteurella multocida) is poor 
compared with surveillance of enteric bacteria. 
Knowledge and control of resistance in commensals is 
important as they can act as reservoirs of resistance 
determinants. The flora of the upper respiratory system of 
animals that have been treated with antimicrobial agents 
can also serve as a reservoir of resistance factors. 
Tetracycline is the most frequently used antimicrobial 
agents in veterinary medicine. Antimicrobial resistance of 
P. multocida strains has been reported in a wide variety 

 
 
 
 

 

of animal pathogens (McEwen and Fedorka-Cray, 2002; 
Milan et al., 2009). Data collected from 13 European 
countries showed that isolates of P. multocida from eight 
countries were resistant to different antimicrobial agents 
including tetracycline (Kaspar et al., 2007; Hendriksen et 
al., 2008).  

It is important that 18% of the strains isolated from 
clinically healthy animals in Greece showed resistance to 
tetracycline higher than 128 μg/ml. The significant 
increase of the tetracycline resistant isolates contributes 
to the selection and spread of resistance in animals not 
only by the movement of carrier animals between herds 
but also by the assembly of susceptible animals in close 
confinement, and the movement of resistance 
determinants throughout the ecosystem (McEwen and 
Fedorka-Cray, 2002; Adelowo and Fagade, 2009). 
Moreover, the spread of tet genes is often facilitated by 
their location on mobile genetic elements, such as 
plasmids and transposons. For the first time in Greece, 
tet genes were investigated. The presence of the tetH 
and tetB genes in both genomic and plasmid DNA, 
suggests that they are carried on transposable elements 
as previous studies have shown for example, tetB gene 
with the transposon element Tn10 (Kehrenberg et al., 
2001) and tetH gene with the transposon element 
Tn5706 (Kehrenberg et al., 1998). The tetH gene was 
found in the majority of the tetracycline resistant P. 
multocida isolates, which is not surprising as it is 
considered to be indigenous for the genus Pasteurella 
(Hansen et al., 1993) and it has been detected on 
plasmids pVM111, pMHT1, pPMT1 and pPAT1 and on 
the transposon Tn5706 (Hansen et al., 1993; Kehrenberg 
et al., 1998, 2001).  

Similarly, the tetB gene is the most frequently observed 
tet gene among Enterobacteriaceae, as part of the non-
conjugative transposon Tn10 (Chalmers et al., 2000). The 
wide distribution of the tetB across Gram–negative 
genera, including Escherichia, Enterobacter, Proteus, 
Salmonella, Actinobacillus, Haemophilus, Moraxella, and 
Treponema indicates a great likelihood of horizontal gene 
transfer occurrence of tetracycline resistance (Speer et 
al., 1992; Roberts, 1996). Moreover, the tetB gene was 
first detected in H. influenzae, a member of the 
Pasteurelllaceae commonly isolated from the lungs. Most 
of the polymorphisms can be detected in other strains or 
species (Tables 1 and 2). Glycine (255G) of the tetH 
gene might have a substantial role in the functionality of 
the protein, thus, the observed mutation was 
synonymous. Perhaps, this is why no mutations have 
been previously described at this site. Based on the 
dendrogram, the tetB gene in the Greek isolates of P. 
multocida is more homologous to species other than 
Pasteurellae leading us in two explanations: the gene 
could probably has been transferred to the isolates from a 
non Pasteurella species or it is still in an ancestral form 
which has not been altered as it has in other species of 
its genus, thus clustering separately from them. The local 



 
 
 

 

(Greek) P. multocida tetH gene revealed a different 
pattern of clustering. Nevertheless, as in the case of tetB, 
the local isolates tetH gene are clearly differentiated from 
the rest of Pasteurella species.  

Finally, the absence of tetA and tetM genes suggests 
that a wide spectrum of tet genes should be used in 
future studies. Although our results are similar to those of 
other researchers (Claudio et al., 2003), further research 
on other genes involved in tetracycline resistance, such 
as tetD, tetG, tetL and tetO, would provide a more com-
prehensive view of the tetracycline resistance scheme 
among Greek P. multocida isolates. Moreover, recent 
data support the premise that the treatment of infected 
animals has to be based on local knowledge and the 
observed resistance patterns. In the future, data on the 
prevalence of resistance should be used to develop 
guidelines for appropriate antimicrobial use in veterinary 
medicine. 
 

 
REFERENCES 

 
Adelowo OO, Fagade OE (2009). The tetracycline resistance gene tet39 

is present in both Gram-negative and Gram-positive bacteria from a 
polluted river, Southwestern Nigeria. Lett. Appl. Microbiol., 48:167–
172  

Aminov RI, Chee-Sandford C, Garrigues N, Teferedegne B, Krapac IJ, 
White BA, Mackie RI (2002). Development, validation, and application 
of PCR primers for detection of tetracycline efflux genes of Gram-
negative bacteria. Appl. Environ. Microb., 68: 1786-1793.  

Chalmers R, Sewitz S, Lipkow K, Crellin P (2000). Complete nucleotide 
sequence of Tn10. J. Bacteriol., 182:2970-2972.  

Chaslus-Dancla E, Lesage-Descauses MC, Leroy-Sétrin S, Martel JL, 
Lafont JP (1995). Tetracycline resistant determinants, TetB and 
TetM, detected in Pasteurella Haemoyitica and Pasteurella multocida 
from bovine herd. J. Antimicrob. Chemoth., 36: 815-819.  

Chen BY, Pyla R, Kim TJ, Silva JL, Jung YS (2010). Antibiotic 
resistance in Listeria species isolated from catfish fillets and 
processing environment. Lett. Appl. Microbiol., 50: 626–632  

Claudio D, Miranda CD, Kehrenberg C, Ulep C, Schwa S (2003). 
Diversity of Tetracycline Resistance Genes in Bacteria from Chilean 
Salmon Farms. Antimicrob. Agents Ch., 47(3): 883-888.  

De Vriest LE, Christensen H, Skov RL, Aarestrup FM, Agerso Y (2009). 
Diversity of the tetracycline resistance gene tet(M) and identification 
of Tn916- and Tn5801-like (Tn6014) transposons in Staphylococcus 
aureus from humans and animals. J. Antimicrob. Chem., 64 (490-
500).  

Ekateriniadou LV (1989). Study of genus Pasteurella isolates in 
antimicrobial agents. PhD Thesis, Aristotle University of Thessaloniki, 
Greece. 

McEwen SA, Fedorka-Cray PJ (2002). Antimicrobial Use and resistance 
in Animals”, Clin. Infect. Dis., 34 (3): 93–106  

Fluit AC, Visser MR, Schmitz FJ (2001). Molecular detection of 
antimicrobial resistance. Clin. Microbiol. Rev., 14:836-871.  

Hansen LM, McMurry LM, Levy SB, Hirsh DC (1993). A new tetracycline 
resistance determinant, tetH, from Pasteurella multocida specifying 
active efflux of tetracycline. Antimicrob. Agents Ch., 37: 2699–2705. 

Hendriksen RS, Mevius DJ, Schroeter A, Teale C, Meunier D, Butaye P, 
Franco A, Utinane A, Amado A, Moreno M, Greko C, Stärk K, Berghold 

C,  Myllyniemi  AL,  Wasyl  D,  Sunde  M,  Aarestrup  FM  (2008). 
Prevalence  of  antimicrobial  resistance  among  bacterial  pathogens 

strains from cattle in different European countries: 2002-2004. Acta  
Vet. Scand., 50: 28. 

  
  

 
 

 
Henriques IS, Fonseca F, Alves A1, Saavedra MJ, Correia A (2008). 

Tetracycline-resistance genes in Gram-negative isolates from 
estuarine waters. Lett. Appl. Microbiol., 47: 526–533  

Kaspar H, Schröer U, Wallmann J (2007). Quantitative resistance level 
(MIC) of Pasteurella multocida isolated from pigs between 2004 and 
2006: national resistance monitoring by the BVL. Berl. Munch. 
Tierarztl., 120(9-10): 442-51  

Kehrenberg C (2000). Molecular basis of teracycline resistance among 
strains of the genera Pasteurella and Manchemia: identification of 
novel plasmids and transposons. PhD thesis, Hannover School of 
Veterinary Medicine, pp. 1-265.  

Kehrenberg C, Catry B, Haesebrouck F, de Kruif A, Schwarz S (2005). 
tet(L)-mediated tetracycline resistance in bovine Mannheimia and 
Pasteurella strains. J. Antimicrob/ Chemoth., 56: 403-406.  

Kehrenberg C, Salmon SA, Watts JL, Schwarz S (2001). Tetracycline 
resistance genes in strains of Pasteurella multocida, Mannheimia 
haemolytica, Mannheimia glucosida and Mannheimia varigena from 
bovine and swine respiratory disease: intergeneric spread of the 
tet(H) plasmid pMHT1. J. Antimicrob. Chemoth., 48: 31-640.  

Kehrenberg C, Schulze-Tanzil G, Martel JL, Chaslus-Dancla E, 
Schwarz S (2001). Antimicrobial resistance in Pasteurella 
andMannheimia: epidemiology and genetic basis. Vet. Res., 32: 323-
340. 

Kehrenberg C, Werckenthin C, Schwarz S (1998). Tn5706, a 
transposon-like element from Pasteurella multocida mediating 
tetracycline resistance. Antimicrob. Agents Ch., 42: 2116-2118.  

Kehrenberg CR, Schwarz ST (2000). Identification of a truncated, but 
functionally active Tet(H) tetracycline resistance gene in Pasteurella 
aerogenes and Pasteurella multocida. FEMS Microbiol. Lett., 188: 
91-195.  

Koike S, Krapac IG, Oliver HD, Yannarell AC, Chee-Sanford JC, 
Aminov RI, Mackie RI (2007). Monitoring and source tracking of 
tetracycline resistance genes in lagoons and groundwater adjacent to 
swine production facilities over a 3-year period. Appl. Environ. 
Microb., 73: 4813-4823.  

Lizarazo YA, Ferri EF, de la Fuente AJ, Martin CB (2006). Evaluation of 
changes in antimicrobial susceptibility patterns of Pasteurella 
multocida subsp. multocida isolates from pigs in Spain in 1987–1988 
and 2003–2004. Am. J. Vet. Res., 67: 663–668.  

Millan AS, Escudero JA, Gutierrez B, Hidalgo L (2009). Multiresistance 
in Pasteurella multocida is mediated by coexistence of small 
Plasmids. Antimicrob. Agents Ch., 53: 3399–3404.  

Roberts MC (1996). Tetracycline-resistance determinants: mechanisms 
of action, regulation of expression, genetic mobility, and distribution. 
FEMS Microbiol. Rev., 19: 1–24.  

Sambrook J, Russell DW (2001). Molecular Cloning: A Laboratory 

Manual. Cold Spring Harbor Laboratory Press, NY, 3
rd

 ed. (1):1.69-

1.71. 
Sivropoulou A, Haritidou L, Vasara E, Aptosoglou S, Koliais S (2000). 

Correlation of the insecticidal activity of the Bacillus thurigensis A4 
strain against Bactrocera oleae (Diptera) with the 140-kDa crystal 
polypeptide. Curr. Microbiol., 41(4): 262-266.  

Speer BS, Shoemaker NB, Salyers AA (1992). Bacterial resistance to 
tetracycline: mechanisms, transfer, and clinical significance. Clin. 
Microbiol. Rev., 5: 387–399.  

Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular 
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. 
Biol. Evol., 24: 1596-1599. 

Wallmann J, Schröer U, Kaspar H (2007). Quantitative resistance level 
(MIC) of bacterial pathogens (Escherichia coli, Pasteurella multocida, 
Pseudomonas aeruginosa, Salmonella sp., Staphylococcus aureus) 
isolated from chickens and turkeys: national resistance monitoring by 
the BVL 2004/2005. Berl. Munch Tierarztl., 120(9-10): 452-463. 


