




































In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN 2375-0731 Vol. 8 (3), pp. 001-007, March, 2020. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 

Full Length Research Paper 

 

Phylogenetic and pathogenetic analysis of 
Streptococcus suis serotype 7 strain HW07 isolated 

from diseased pig in China 

 
Shujie Wang1,2, Sen Hu2, Jiamin Jin1,2, Yonggang Liu2, Gang Wang 2, Yabin 

Tu2, Chenggang Jiang2, Xuehui Cai2* and Xiuying Zhang1* 
 

1
Pharmacology Laboratory, Animal Medical College, Northeast Agriculture University, Harbin 150030, 

China. 
2
State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese 

Academy of Agricultural Sciences, Harbin 150001, Heilongjiang, People’s Republic of China. 
 

Accepted 08 December, 2019 
 
A recent isolate of Streptococcus suis serotype 7 (SS7), named HW07, was isolated from brains of pigs 
suspected with Streptococcus suis (S. suis) infection. The sequence types (ST) of this isolate was determined 
by Multilocus sequence typing (MLST) method. In order to evaluate pathogenesis of HW07 isolate, zebrafish 
and pigs were inoculated with HW07 strain by peritoneal cavity and vein. The results demonstrate that the 50% 

lethal dose (LD50) of HW07 isolate was 1.25 × 10
5
 colony forming units (CFU)/fish and could induce pig 

disease, the ST number of HW07 isolate is a novel ST-ST335. Molecular and phylogenetic analysis for the recA 
gene of HW07 isolate showed that it joins to the I group cluster of S. suis strains, the predominant genotype in 
China. 
 
Key words: Streptococcus suis serotype 7, multilocus sequence typing, the sequence type, phylogenetic analysis. 

 
INTRODUCTION 

 
Streptococcus suis is an important pathogen associated 
with a variety of pig diseases, including meningitis, 
septicaemia, arthritis, endocarditis and pneumonia and 
can cause severe zoonotic infection of humans. So far, 
35 capsular serotypes of S. suis have been described 
(Perch et al., 1983), serotype 2 strains are considered as 
the most virulent and often isolated from diseased pigs. 
However, epidemiological studies in our lab have 
indicated that the prevalence of SS7 strains from 
diseased pigs in China has significantly increased during 
the past 3 years (Wang et al., 2012). Therefore, in this 
study, we researched in SS7 strains HW07 isolated from 
brains of diseased pigs with classic clinical meningitis and 
arthritis symptoms of S. suis infection, which had resulted 
in 30% death rate of pigs in farm.  

Pathogenicity  can vary substantially both within and  
 
 

 
*Corresponding authors. E-mail: aci139@sina.com, 
ZXY0451@hotmail.com. Tel: 86-18946066077, 86-451- 
55190674. Fax: 86-451-55191200. 

 
 
 

 
among serotypes, and not all isolates of the same 
serotype cause the same disease (Staats et al., 1997). 
Previous studies have indicated that S. suis is a 
genetically diverse species (Hampson et al., 1993). In 
order to determine the genotype or sequence of the 
HW07 isolates, MLST method was used in this study. 
MLST is a highly discriminatory and unambiguous 
method of characterizing bacterial isolates that has now 
been successfully employed in the characterization of 
several species (Enright et al., 2001). MLST was used to 
investigate the genotype of S. suis as early as in 2002 
(King et al., 2002). Strains that have the same ST 
number are identical at all of the sequenced loci and are 
considered to be members of the same clone, which 
means they have a recent common ancestor. Up to 
August 2012, 665 S. suis strains have been recorded in 
the S. suis MLST Database and classified into 334 STs 
which belong to 21 ST complexes.  

The recA protein is a multifunctional enzyme that plays 
a role in homologous recombination, DNA repair and 
induction of the SOS response (Selbitschka et al., 1991). 
RecA sequencing is an adequate method to discriminate 



        

 Table 1. The Primers for virulence-associated gene      
        

 Primer Primer sequence(5’-3’) Gene Protein GenBank accession number Length of PCR plroduct (bp)  

 Gdh GAGCTCTTCTCTACACTT gdh Glutamate dehydrogenase AY853916 1257  

  TTATACCAAACCTTGGGC      

 Mrp ATCAGAATCACCACTTTTGG mrp Muramidase-released protein X64450 [31] 885  

  TCATACCCAGTAAATACACG      

 Ef CGCAGACAACGAAAGATTGA epf Extracellular factor X71881 [31] 744  

  AAGAATGTCTTTGGCGATGG      

 Sly GCTTTATTGCGTGCTGAC sly Suilysin Z36907 [31] 1097  

  CTGTTCTCCACCACTCCC      
 

 

among meat staphylococci, S. xylosus and S. 
equorum. The objective of the current study was 
to determine the genotype and pathogenesis of 
HW07 isolates and to investigate if it was the 
predominant S. suis strain in China by sequence 
and phylogenetic analysis of the recA gene. 

 

MATERIALS AND METHODS 
 
Strains 
 
The brain sample was collected from the infected pig and 
the bacteria was isolated using a method previously 
described (Buddle et al., 1981). The S. suis suspected 
colonies. The Strain 8074 is the international reference 
SS7 that was stored in our research institute. 

 

Genomic DNA extraction 
 
The isolate chromosomal DNA was extracted using a 
method previously described (Vaquero et al., 2004) . 
Bacteria grow in THB at 37°C before chromosomal DNA 
was extracted from overnight cultures using TIANamp 
Bacteria DNA Kit (TIANGEN, China) according to the 
manufacturer’s instructions. 

 

Strain identification 
 
The  S. suis  suspected  colonies  were characterized by 

 

 
morphological, biochemical (API 20 STREP, biomerieux, 
France) and based PCR assay. The presence of S. suis 
was confirmed by PCR with S. suis gdh gene primers  
(Okwumabua et al., 2003): FP: 5'- 
GCAGCGTATTCTGTCAAACG-3  RP: 5'-  
CCATGGACAGATAAAGATGG-3', the expected fragment was 

688 bp. Serotype 7 was confirmed by PCR with S. suis cps7H 

gene primers (Okwumabua et al., 2003): FP: 5'-  
AATGCCCTCGTGGAATACAG-3', RP: 5'-
TCCTGACACCAGGACACGTA-3', the expected fragment 
was 378 bp. The identified SS7 clones were stored at - 
40°C. 

 

The virulence-associated genotype of HW07 isolate 
 
Based on the presence of virulence-associate gene to 
characterize the SS7 strain, primers based on the following 
gene are listed in Table 1: Glutamate dehydrogenase 
(gdh), muramidase-released protein (mrp), extracellular 
factor (epf), and suilysin (sly) (Silva et al., 2006). PCR was 
performed to characterize the virulence-associated 
genotype of HW07 isolate using the four virulence-
associated gene primers. 

 

MLST and phylogenetic analysis 
 
MLST was performed according to King et al. (2002). PCR 

amplification of the 7 housekeeping genes include aroA, 

cpn60, dpr, gki, recA, and thrA was done with the primers 

shown in Table 2. The amplified segments were sequenced at 

Huada gene Biotechnological Co. Ltd (Beijing, China). 

 

 
MLST alleles and ST number of HW07 isolate was 
analysed in S. suis MLST Database (http://ssuis.mlst.net). 
eBURST software (Feil et al., 2004) was used to identify 
the phylogenetic position of strain and display the overall 
structure of the population. 
 

 
Phylogenetic analysis for recA gene 

 
The partial recA gene nucleotide of HW07 isolate was 
sequenced and was sent to GenBank, in which the 
accession numbers for recA was JX236275. Sequence 
similarity searches in the GenBank databases were carried 
out using Basic local alignment search tool (BLAST), and 
aligned with the corresponding sequences of S. suis 
strains using the Clustal W program in MegAlign of 
Lasergene 7.0 software (DNASTAR Inc. Madison, WI, 
USA). Then, the molecular and the phylogenetic analyses 
of recA gene was conducted by Molecular Evolutionary 
Genetics Analysis (MEGA) version 5.05 (Tamura et al., 
2011). The percentage of bootstrap confidence levels for 
internal branches, as defined by the MEGA program, was 
calculated from 1000 random resamplings. 
 

 
Experimental animals 
 
10-week-old inbred line zebrafish, which were purchased 
from National Zebrafish Resources of China (Shanghai, 
China) and raised in solated fish bowls, were used to 
check the virulence of HW07 isolate. Six 1-month-old 
Specific pathogen Free (SPF) pigs, whose serology is 



 
 
 

 
Table 2. Primers used for amplification and sequencing of the seven loci in the S. suis MLST scheme.  

 

Gene name Primer sequence Annealing Tm (℃) Length of PCR(bp) 

aroA-FP TTCCATGTGCTTGAGTCGCTA 55 482 

aroA-RP ACGTGACCTACCTCCGTTGAC   

cpn-FP TTGAAAAACGTRACKGCAGGTGC 52 466 

cpn-RP ACGTTGAAIGTACCACGAATC   

dpr-FP CGTCTTTCAGCCCGCGTCCA 50 434 

dpr-RP GACCAAGTTCTGCCTGCAGC   

gki-FP GGAGCCTATAACCTCAACTGG 55 480 

gki-RP AAGAACGATGTAGGCAGGATT   

mutS-FP CGCAGAGCAGATGGAAGATCC 50 526 

mutS-RP CCCATAGCTGTTTTGGTTTCATC   

recA-FP TATGATGAGTCAGGCCATG 50 398 

recA-RP CGCTTAGCATTTTCAGAACC   

thrA-FP GATTCAGAACGTCGCTTTGT 52 523 

thrA-RP AAGTTTTCATAGAGGTCAGC   
 
 

 
negative to S. suis, were purchased from Dongsheng pig form 
(Harbin, China). All animal work and experimental procedures were 
conducted with an approval of Institutional Animal Care and Use 
Committee of Heilongjiang, China. 

 

Pathogenicity test of HW07 isolate to zebrafish 
 
The isolated bacteria were harvested from liquid cultures by 
centrifugation at 5,000 × g for 5 min prior to inoculation in the 
zebrafish, and were resuspended in phosphate-buffered saline 
(PBS, pH 7.4). Strains of HW07 and 8074 were tested at 5 different 

doses from 5×10
7
 to 5×10

3
 CFU/fish, ten fish per dose. The 

zebrafish were injected through peritoneal cavity, and the control 
fish were injected with PBS. The infected zebrafish were monitored 
for 1 week. The test was repeated in triplicate and yielded 
reproducible results. The results were averaged and used to 
calculate the LD50 by the method of Reed and Muench (Reed and 
Muench, 1938). 

 
 

 

The results of biochemical tests (6.5% high salt gravy/ 
Raffinose/ lactose/ sorbose/ mannose/ salicin/ serum 
dahlin/ hippurate/ Esculin/ mushroom sugar: positive/ 
positive/ positive/ negtive/ positive/ positive/ negtive/ 
negtive/ positive/ positive) were consistent with the 
biochemical character of S. suis. The PCR result for 
isolate was gdh+/cps7H+. 
 

 

The virulence-associated genotype of HW07 isolate 

 

In order to determine the virulence-associated gene of 
isolate, four genes (gdh, mrp, epf and sly) were 
examined by PCR. As shown in Figure 1, the virulence-
associated gene of isolate was gdh+/mrp+/epf--/sly-. 

 

 
Pathogenicity test of HW07 isolate to piglet 
 
To evaluate the pathogenicity of the HW07 isolate, four-week-old 
piglets (3 piglets) were challenged with the HW07 isolate (dose of 

2×10 
8
 CFU/piglet), and the control piglets (3 piglets) were 

challenged with PBS. Clinical signs and rectal temperatures of the 
piglets were daily recorded until the piglets were euthanized with 
Nembutal at the end of the experiment. All the tissue samples of 
infected piglets were obtained. Bacteria were re-isolated from 
various tissues. 
 
 

RESULTS 

 

Morphology and characteristics of recently SS7 
isolate 
 

A wild-type SS7 isolate, named HW07, was isolated from 
the brain of the infected pig, which was Gram positive 
chain shape coccobacteria by microscope observation. 

 
MLST and phylogenetic analysis 

 

Partial sequences of 7 housekeeping genes for isolate 
revealed a low genetic variation, yielding one novel ST 
number-ST335 whose allelic profiles was 8, 30, 5, 34, 9, 
3, 25. The closest matches are ST129 (8, 30, 5, 34, 58, 
3, 25 ), ST83 (8, 30, 5, 34, 39, 3, 25 ) and ST29 (8, 30, 5, 
34, 30, 3, 25 ). From the above results we can conclude 
that five isolates come from a clone. The phylogenetic 
position of the isolate in the S. suis database and the 
overall structure of the population are displayed in Figure 
2. 
 

 

Phylogenic and sequencing analysis of recA gene 
within HW07 isolate 

 

Phylogenetic analysis of recA gene was conducted in 
HW07 isolate and 23 S. suis strains that were obtained 



  
 
 

 

1 2 3 4 5  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

Figure 1. PCR products of the virulence-associated gene of the HW07 isolate. 
Lanes 2, 3, 4, 5 are PCR products using primers for Sly, Ef, Mrp, Gdh genes of 
strain HW07, respectively. Lane 1 is DL 2000 marker.  

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

Figure 2. Analysis of the ST25 clonal complex of S. suis. eBURST groups were obtained from the 
entire S. suis public MLST database with the stringent (default) group definition; the eBURST group 
that included ST25 is displayed. The primary founder, ST25 (bootstrap confidence value of 100%), and 
a major subgroup founder, ST29, are labeled. 

 
 

 

from the GenBank database. As shown in Figure 3, 
HW07 isolate was grouped in one branch with Chinese 
strain HB1001, S196 and BJ0401, but in a different 
branch obviously with the Chinese strain 40. The 

 
 
 

 

homologies for HW07 isolate and strains of HB1001, 
S196, BJ0401 were higher with 95.2-95.5% identity. The 
recA gene of HW07 isolate showed a 94.1, 93.5, 93.2, 
90.4% identity with Japan strains DAT301, DAT289, 



  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 3. Phylogenetic tree between reference S. suis strains from the GenBank and HW07 isolate 
based on the nucleotide sequence of recA gene. 

 
 

 
Table 3. LD50 of HW07 isolate and the reference strain 8074.  

 
 Strain Infectious dose (CFU) Total death rate LD50 (CFU) 

 HW07 5×10
3
 - 5×10

7
 23/50 1.25×10

5
 

 8074 5×10
3
 - 5×10

7
 10/50 3.70×10

7
 

 Control  0/10 ∞ 
 
 

 

DAT291 and DAT298, then 89.8 and 94.6% identity with 
two United Kingdom strains, respectively. There was a 
poor homology between the nucleotide sequence of recA 
gene in HW07 isolate and Canada strain ATCC43765. 
The lowest homology of 81.6% was found between recA 
genes in HW07 isolate and Chinese strain 40. 
 

 

Pathogenicity test of HW07 isolate to zebrafish 

 

In order to test the virulence of HW07 isolate, zebrafish 
were challenged with HW07 isolate. As shown in Table 3, 
Control fish injected with PBS suffered no mortality. 

 
 

 

Clinical symptoms showed that branchia and hypogastric 
region of the diseased fish bleed. The SS7 were re-
isolated from all organs of all dead zebrafish. Results 
suggest that the pathogenicity of HW07 isolate was 
stronger than international standard SS7 strain 8074. 
 

 

Pathogenicity test of HW07 isolate to piglet 

 

The piglets in isolate-infected showed body temperature 
elevated, ear purple, diarrhea and weight loss. No 
macroscopic lesions were observed in the control pigs. 
The piglets in infect showed sub-mandibular lymph node 



   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 4. Pathological examination of tissues. (a) Lung-diffuse interstitial pneumonia was observed 
with marked thickening of alveolar septa by infiltration of lymphocytes; (b) brain edema; (c) kidney- a 
few of lymphocytes inflitrated in interstitial substance. (d) lung tissues from control group. (e) brain 
tissues from control group. (f) kidney tissues from control group. The tissues were stained with 
hematoxylin and eosin. Bar, 100 um. 

 
 

 

lesions, including intumescentia and hemorrhage. The 
affected lung and kidney lesions appeared bleeding point 
on the surface. The control pigs showed no pathological 
lesions. The pathological brain lesions in infected pigs 
showed mild edema. The pathological lung lesions in 
infect pigs showed the following characteristics: 
intravascular thrombosis and widened alveolar septa with 
neutrophil suppurative lesions. The pathological kidney 
lesions showed lymphocytes infiltration (Figure 4). 
Bacteria that were isolated from all organs were identified 
as HW07 isolate. 
 

 

DISCUSSION 

 

In this research, a recent isolate come from S. suis 
infected pigs in Heilongjiang province. The identification 
of the isolate had been confirmed by morphological 
biochemical and molecular analysis. MLST was used to 
determine the genotype of HW07 isolate. As a result, one 
novel ST was found whose allelic profile was 8, 30, 5, 34, 
9, 3, 25. Allelic profiles of ST129, ST83 and ST29 were 
the closest matches with allelic profile of HW07 isolate. 
From the eBURST (Figure 2), we can see that ST25 is 
the primary founder of this group and ST29 is the 
subgroup founder of this group. This group should be 

 
 
 

 

ST25 clonal complex in which serotype 7 strain is the 
main representative strain. So, ST335 belong to ST25 
complex, in which strains appeared less associated with 
human invasive disease (King et al., 2002). The result of 
pathogenicity experiment hinted that the HW07 isolate 
was virulent. In the research of Pian et al.(2012). The 
S.suis-05ZYH33-infected piglets die after infection 2 
days. Therefore, the possibility is suggested that the 
virulence of HW07 isolate was weaker than strain 
05ZYH33 from human invasive disease, stronger than 
international standard SS7 strain 8074.  

The recA protein is composed of about 350 amino-acid 
residues (Karlin et al., 1995; Roca and Cox, 1997), which 
sequence is very well conserved among eubacterial 
species (Cerutti et al., 1992) and the bacteria. However, 
in recA housekeeping genes of HW07 isolate, 2 points of 
deletion at position 340 and 334 leads to 7 amino acids 
substitution from 112 position to 118 position (substitution 
Trp, Tyr, Ser, Tyr, Asn, Gly, Glu to Gly, Ile, Ile, Ter, Ter, 
Leu, Gly). Whether or not these 7 amino acids 
substitution affect virulence of HW07 isolate will be 
further researched in our next study.  

Phylogenetic analysis for recA gene indicated that four 
clades of wild-type strains have existed in 23 reference 
S. suis strains. The recA gene phylogenetic relationships 
between HW07 isolate and other S. suis wild-type strains 



 
 
 

 

from GenBank have been clarified in this research. In this 
report, HW07 isolate, identified from Heilongjiang 
province in 2007, displayed the highest identity with 
Chinese SS7 strain BJ0401 and lowest identity with 
Chinese strain 40 isolated from lung tissues with 
apparent hemorrhagic lesions in Zhejiang Province, thus, 
HW07 isolate can be classified into Chinese predominant 
genotype. 
 

 

ACKNOWLEDGMENTS 

 

This work was supported by the National Technology 
Importance Program for the 12th Five-year plan 
(2012ZX10004214-005-013), Heilongjiang Province 
Brilliancy Young Science Found (JC201020), and Harbin 
Tackle Key Problems in Science and Technology Plan 
(2010AA6AN083). 
 

 
REFERENCES 
 
Buddle JR, Jones JE, Pass DA, Robertson J (1981). The isolation of 

Streptococcus suis type II from a pig with meningitis. Aust. Vet J. 
57:437-438.  

Cerutti H, Osman M, Grandoni P, Jagendorf AT (1992). A homolog of 
Escherichia coli RecA protein in plastids of higher plants. Proc. Natl. 
Acad. Sci. USA 89:8068-8072.  

Enright MC, Spratt BG, Kalia A, Cross JH, Bessen DE (2001). Multilocus 

sequence typing of Streptococcus pyogenes and the relationships 

between emm type and clone. Infect. Immun. 69:2416-2427.  
Feil EJ, Li BC, Aanensen DM, Hanage WP, Spratt BG (2004). eBURST: 

inferring patterns of evolutionary descent among clusters of related 
bacterial genotypes from multilocus sequence typing data. J. 
Bacteriol. 186:1518-1530.  

Hampson DJ, Trott DJ, Clarke IL, Mwaniki CG, Robertson ID (1993). 
pulation tructure of Australian isolates of Streptococcus suis. J. Clin.  
Microbiol. 1:2895-2900.  

Karlin S, Weinstock GM, Brendel V (1995). Bacterial classifications 
derived from recA protein sequence comparisons. J. Bacteriol. 
177:6881-6893.  

King SJ, Leigh JA, Heath PJ, Luque I, Tarradas C, Dowson CG, 
Whatmore AM (2002). Development of a multilocus sequence typing 
scheme for the pig pathogen Streptococcus suis: identification of 
virulent clones and potential capsular serotype exchange. J. Clin. 
Microbiol. 40:3671-3680. 

 
 
 
 

 
Okwumabua O, O'Connor M, Shull E (2003). A polymerase chain 

reaction (PCR) assay specific for Streptococcus suis based on the 
gene encoding the glutamate dehydrogenase. FEMS Microbiol. Lett. 
218:79-84. 

Perch B, Pedersen KB, Henrichsen J (1983). Serology of capsulated 
streptococci pathogenic for pigs: six new serotypes of Streptococcus 
suis. J. Clin. Microbiol. 17:993-996.  

Pian Y, Gan S, Wang S, Guo J, Wang P, Zheng Y, Cai X, Jiang Y, 
Yuan Y (2012). Fhb, a novel factor H-binding surface protein, 
contributes to the antiphagocytic ability and virulence of 
Streptococcus suis. Infect. Immun. 80:2402-2413.  

Reed LJ, Muench H (1938). A simple method of estimating fifty per cent 
endpoints. Am. J. Epidemiol. 27:493-497.  

Roca AI, Cox MM (1997). RecA protein: structure, function, and role in 
recombinational DNA repair. Prog. Nucleic Acid Res. Mol. Biol. 
56:129-223.  

Selbitschka W, Arnold W, Priefer UB, Rottschafer T, Schmidt M, Simon 
R, Puhler A (1991). Characterization of recA genes and recA mutants 
of Rhizobium meliloti and Rhizobium leguminosarum biovar viciae. 
Mol. Gen. Genet. 229:86-95.  

Silva LM, Baums CG, Rehm T, Wisselink HJ, Goethe R, Valentin-
Weigand P (2006). Virulence-associated gene profiling of 
Streptococcus suis isolates by PCR. Vet. Microbiol. 115:117-127.  

Staats J, Feder I, Okwumabua O, Chengappa M (1997). Streptococcus 
suis: past and present. Vet. Res. Commun. 21:381-407.  

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011). 
MEGA5: molecular evolutionary genetics analysis using maximum 
likelihood, evolutionary distance, and maximum parsimony methods. 
Mol. Biol. Evol. 28:2731-2739.  

Vaquero I, Marcobal Á, Muñoz R (2004). Tannase activity by lactic acid 
bacteria isolated from grape must and wine. Int. J. Food Microbiol. 
96:199-204.  

Wang S, Liu P, Li C, Tan Y, Cai X, Zhou D, Jiang Y (2012). Isolation 
and characterization of 89K pathogenicity island-positive ST-7 strains 
of Streptococcus suis serotype 2 from healthy pigs, Northeast China. 
Sci. World J. 2012:302386. 


