





























1 

 

In ternationa l
Scholars
Journa ls

 

African Journal of Pig Farming ISSN: 2375-0731 Vol. 12 (3), pp. 001-008, March, 2024. Available online at 
www.internationalscholarsjournals.org © International Scholars Journals 

 

Author(s) retain the copyright of this article. 

 
 
Full Length Research Paper 

 

Impact of pasture-raised pork farming on genes 
regulating lipid metabolism and meat quality 

 
N. Okoli1, N. Ceron-Romero2, Y. Meng2 and M. O. Ezekwe2*

 
 

1
Department of Chemistry, Alcorn State University, 1000 Alcorn Ave., Lorman, MS 39096, USA. 

2
Department of Agriculture and Applied Sciences, Alcorn State University, 1000 Alcorn Ave, Lorman, MS 39096, USA. 

 
Received 19 February, 2023; Accepted 1 October, 2023  

 
Studies have shown that pasture-raised pork is fresher and of higher nutritional value than its 
conventional counterpart. This study was to determine the effect of grazing systems on meat quality, 
carcass traits, and on lipid metabolism gene expressions. Control pigs were fed 100% commercial diet. 
Fifty/fifty (50/50) group was placed on 50% of the diet consumed by control group plus free access to 
ryegrass-clover pasture. The twenty-five/seventy-five (25/75) group was fed 25% of the diet consumed 
by the control plus access to free pasture. The overall meat quality (flavor, overall acceptability and 
carcass traits (marbling, color)) were scored significantly higher (P<0.05) in the 25/75 group than in 
control or 50/50 group. Back-fat thickness was lower in 25/75 group (P<0.05) than in control and 50/50 
group. No differences were observed between the control and 50/50 in meat and carcass qualities. Real-
time polymerase chain reaction (PCR) revealed that peroxisome proliferator-activated receptor α 
(PPARα), peroxisome proliferator-activated receptor γ (PPARγ), lipoprotein lipase (LPL), and sterol-
regulatory-element binding protein 2 (SREBP-2) responded differently in muscle and adipose tissues. 
The results indicated that pasture-based pork production could positively influence lipid metabolism 
genes important in meat and carcass quality traits, with pasture exposure and feed allowance. 

 
Key words: Pigs, lipid metabolism, meat quality, real-time polymerase chain reaction (PCR).  

 
 
INTRODUCTION 

 
Molecular biology approaches using gene expression 
have been reported that numerous genes are associated 
with leaner pigs carcasses, meat and carcass quality 
traits (Albuquerque et al., 2017; Ivanovic et al., 2015; 
Tous et al., 2014; Álvarez-Rodríguez et al., 2016). Many 
of these genes have also been found to be expressed 
during obesity-related diseases (Georgiadi and Kersten,  

 
 
 
 

 
2012).  

Currently, obesity is considered a public health disease. 
According to the World Health Organization (WHO), the 
obese population has doubled in number in less than 30 
years (Mitchell and Shaw, 2015). Consumers today are 
more concerned about their health and physical fitness 
when seeking ways to get a healthier source of protein.  
   

*Corresponding author. E-mail: ezekwe@alcorn.edu.  



2 

 

 
 
 

 

Therefore, the understanding of lipid metabolism in pigs 
could elucidate mechanisms underlining conditions such 
as hypertension, type 2 diabetes, cardiovascular 
diseases, cancer, and atherogenic dyslipidemia. This has 
led to increased interest in the study of grazing systems 
on meat quality and genes involved in lipid metabolism.  

Animals raised in outdoor systems have been shown to 
contain higher intramuscular fat (IMF) (Högberg, et al., 
2004), color (Estévez et al., 2003; Fraser et al., 2009) 
and leaner carcasses (Álvarez-Rodríguez et al., 2016; 
Galvão et al., 2006) than animals in confinement. The 
content of polyunsaturated fatty acids (PUFA) content on 
pastures, primarily essential linolenic acid (C18:3), and 
linoleic acid (C18:2) has been associated with pork of 
high nutritional value (Ventanas et al., 2006; Kim et al., 
2009; Nilzén et al., 2001; Edwards, 2005).  

However, the impact of grazing systems on genes 
involved in lipid metabolism is still poorly studied in swine. 
Dervishi (2012) reported changes in fatty acids profile of 
meat products and milk of grazing lambs as well as in 
genes responsible for stearoyl CoA desaturase (SDC), 
and other lipid regulatory genes: peroxisome proliferator-
activated receptor α (PPARα), eroxisome proliferator-
activated receptor γ (PPARγ), and sterol-regulatory-
element binding protein 2 (SREBP). PPARs are a family 
of nuclear receptors acting as ligand-dependent 
transcription factors (PPARα, PPARδ, and PPARγ) 
involved in fatty acid synthesis in pigs (Wang, et al., 
2016). PPARα regulates cellular fatty acid uptakes,  
transportation, oxidation, ketogenesis and 
gluconeogenesis (König et al., 2007). PPARγ is 
considered an important regulator of adipogenesis 
(Samulin et al. 2008). The increase in PPARγ activates 
lipogenic genes such as lipoprotein lipase (LPL) and 
SREBP-1 and SREBP-2 (Eberlé et al., 2004).  

The objective of this study was to determine the effects 
of a pasture-based pork production system on the 
expression of genes involved in lipid metabolism (LPL, 
PPARα, PPARγ, and SREBP-2) and meat quality 
characteristics in pork. 
 
 
MATERIALS AND METHODS 
 
The experiment was conducted at Alcorn State University Swine 
Research and Development Farm, Churchill, Mississippi. The study 
was carried out during spring and summer (April-June). All the 
procedures of animal handling and treatment were approved by the 
Animal Use and Care Committee at Alcorn State University.  

A total of 48 finishing pigs from Yorkshire and Hampshire 
crossbreed sows were randomly assigned to the three experimental 
groups. The commercial ration used for the experiment met the 
National Research Council (1998) requirements. The diet contains 
15.5% CP of 12.04 KJ of energy. The animals were assigned into 
six groups (8 animals each). The control groups and its replica 
received a finishing diet ad libitum. The rest of the groups were 
raised under pasture conditions and supplemented with a 50/50 and 
25/75 of the control diet/pasture combination, respectively.  

The control groups were housed indoors on concrete slatted-floor 
pens (2.1 × 3.6 m). Two pens were used to allocate 8 pigs each, 

 
 
 
 

 

approximately 1.2 m
2
 per pig. The groups 50/50 and 25/75 were 

placed on a pasture fenced area of approximately 16200 m
2
 divided 

in 8 paddocks (about 1300 to 1600 m
2
 each). The pigs at the site 

were rotated among different paddocks and fed with a mixed 
pasture of ryegrass and red clover. A corrugated zinc hoop 
(4×3×2m) and an automatic refill water supply were established for 
each group. The animals were weighed weekly, body weights and 
feed intake recorded for later use in estimating growth performance.  

Initial body weight (IBW), final body weight (FBW), average daily 
gain (ADG), average feed intake (AFI) and feed conversion ratio 
(FCR) were evaluated. Pigs were slaughtered at a FBW of 
approximately 100 kg in Southern University’s Agricultural 
Research and Extension Center (SUAREC) Meat Laboratory. The 
dressing percent was obtained using the final body weight and hot 
carcass weight. The carcass length was measured from the forward 
edge of the first rib to the forward edge of the aitch bone. Backfat 
thickness was measured at the 10th rib at 7 cm off midline at last rib 
of the split carcass with a Destron PG-100 fiber-optic probe. The 
estimated lean yield was calculated using the following formula: 
Estimated lean yield (ELY) = 55.07 - (0.377 × Fat depth) + (0.052 × 
Muscle depth). Measures of loin muscle meat quality include color, 
loin muscle score, loin muscle marbling score, and loin muscle 
firmness score. The major primal cuts from the carcass left side 
(shoulder, loin, ham, and belly) were trimmed to remove the fat and 
the weights were recorded to obtain net yield. The color was 
determined from chop cuts at the last rib level using a Chromameter 
(C-300; Minolta, Dietikon, Switzerland) and illuminant D65.  

Thirty-three panelists were recruited to perform meat quality 
evaluation. Roasted pork samples from the same muscle were 
given to the panelist from each treatment. Additionally, red lights 
were used in the place to disguise color differences. The panelist 
evaluated the pork using the Five-Point Hedonic Scale (1 as 
extremely unpleasant and 5 extremely acceptable). 
 

 
Sample collection and RNA processing 

 
After slaughter, samples of muscle and adipose tissue (about 500 
to 1,000 mg) were collected and immediately rinsed with DEPC-
treated water, then snap-frozen in liquid nitrogen, and then 
transferred to a -80°C freezer for future lipid metabolism analysis. 
Total RNA was extracted from the frozen tissue sample using Trizol 
(Sigma cat# T-9424). Homogenization of the samples was done by 
Quiagen-tissue laser. The RNA precipitation was done following a 
standard protocol (Thermo Scientific). Purity and concentration 
were analyzed by using a Nanodrop ND-2000 spectrophotometer. 
The integrity of the samples was examined by gel electrophoresis. 
 

 
Reverse transcription polymerase reaction and real-time 
polymerase chain reaction 

 
RNA was treated with DNAase I. RT reaction was done using 
SuperScript® III Reverse Transcriptase. Then it was incubated at 
50°C for 50 min. The reaction was inactivated by heating at 70°C 
for 15 min. The primers used were PPARα, PPARγ, SREBP, and 
LPL (Table 1). The reaction was developed using a modified 
protocol of Kary Mullis (1983). PCR reactions were run in an ICycler 
(Bio-Rad, Hercules, CA, USA) using PerfeCTa® SYBR® Green 
FastMix® for iQ (Quanta Biosciences, Gaithersburg, MD). The 
cDNA Cycling conditions were as follows: 3 min at 95°C, followed 
by 40 cycles of 15 s at 95°C, 1 min at 60°C; then followed by 80 
cycles of 10 s at 55°C with increasing setpoint temperature after 
cycle 2 by 0.5°. Changes in gene expression were conducted 
according to the protocol described by Schmittgen and Livak 
(2008). 



3 

 

  
 
 

 
Table 1. Primers used for Quantitative Real-time polymerase chain reaction.  

 
 Primer name Forward primer: 5’ → 3’ Reverse primer: 5’ → 3’ 

 PPAR-α CAAGGTCTGAAAAAGCCAAA CTTCTTGATGGCCTCGTAAA 

 PPAR-γ AGGTGCGATCTTAACTGTCG CCAACAGCTTCTCCTTCTCA 

 SREBP GCAAGAGAAAGTGCCCATTA CGCTTCTCAATGATGTTGTG 

 LPL TGGACGGTGACAGGAATGTA GTCCCACCAGCTTGGTGTAT 
 
 

 
Table 2. Growth characteristics of pasture fed and control pigs at 103 days of the experiment.  

 
 

Item 
 Diets  

 

 

Control 50/50 25/75 
 

  
 

 Initial body weight (kg) 29.61±6.03 29.77±3.07 25.04±2.33 
 

 Final body weight (kg) 113.16±4.6 112.05±7.31 111.46±7.45 
 

 Average daily gain  (kg/day) 0.96±0.51
a
 0.67±0.48

b
 0.62±0.37

b
 

 

 Average feed intake (kg/day) 3.07±0.82
a
 1.83±0.24

b
 1.22±0.23

c
 

 

 Feed conversion ratio 3.19±0.75
a
 2.73±0.48

b
 1.97±0.30

c
 

  
abc

Means  ± SD for 8 pigs Means with different superscripts within rows are significantly different (P<0.05). 
 
 

 
Statistical analysis 
 
Statistical Analytic Software (SAS, 2013) was used to analyze the 
weights of the pigs and the relative expression levels of gene 
expression. Mean squares were determined using the general 
linear model (GLM) and mean separations were done using the 
Duncan multiple range tests (SAS Ins., 1985). Excel (Microsoft 
office, 2010) was used to analyze the relative expression of the 
genes.  

The relative quantities of mRNA expression were normalized to 
the relative quantities of a housekeeping gene and these 
normalized ratios were used for the quantitative determination of 
gene expression. 

 

RESULTS AND DISCUSSION 
 
Growth performance 
 
The rate of growth of the pigs across the treatment was 
evident (Table 2). The different treatment groups were 
not varied in body weight since all the groups were 
slaughtered at similar market weight. However, average 
daily gain and feed conversion ratio differed (P <0.05) 
reaching the market weight 30 and 60 days earlier than 
50 and 25% of commercial diet group, respectively. 
Similar results were observed by Heyer et al. (2006) who 
noted lower performance in crosses of Duroc × Large 
White and Swedish Landrace × Large White when 
compared with indoor animals. Also, Hansen et al. (2006) 
reported a reduced average daily gain of the pigs under 
organic systems with restricted concentrate feeding. In 
contrast, Lebret and Guillard (2005) reported that outdoor 
sows showed a higher final body weight than the indoor 
sows.  

The reduced feed  intake  (P<0.05)  in  pigs  from  diets 

 
 
 

 

50/50 and 25/75 groups was significantly lower than 
those of the controls due to the dietary fiber levels. Kerr 
and Shurson (2013) and Noblet ans Le Goff (2001) 
reported that fibrous diets affected energy and nutrient 
digestibility and are associated with energy losses as 
methane, hydrogen, and fermentation heat. Thus, the 
significantly lower FCR (P<0.05) observed on pasture fed 
animals were expected as long as the growth 
performance depends on the dietary energy-protein 
balance. Similar results were observed by Smit and 
Beltrana (2017) in pigs fed a diet with Camelina sativa 
cake inclusions, although a decrease in feed intake was 
observed, there was a significant increase of n-3fatty 
acids in adipose tissues. 
 

 

Carcass and meat quality characteristics 

 

As shown in Table 3, the diet had no effect (P>0.05) on 
primal cuts (length, shoulder, leg, rib). Nevertheless, 
dressing percentage and loin were significantly (P<0.05) 
higher in the control group than in carcasses from pigs 
raised on pasture. Similarly, Rey et al. (2006), reported 
lower carcass weight and yield from Iberian pigs raised 
on pasture in comparison to indoor animals. Contrary to 
our findings, Lebret and Guillard (2005) and Gentry et al. 
(2002) found that hot carcass weight, cold carcass 
weight, dressing percentage, and loin eye area were 
higher under organic feeding systems.  

In agreement with Ahmed et al. (2016) who 
supplemented the diets of grower-finisher pigs using 
pomegranate, there was a significant reduction in backfat 
thickness while increasing the forage intake and 



4 

 

 
 
 

 
Table 3. Carcass and meat quality characteristics of pasture fed and control pigs.  

 
 

Item
a
 

 Diets  
 

 Control 50/50 25/75  

  
 

 Dressing % 86.20 ± 2.35ª 80.93 ± 0.71
b
 75.60 ± 2.40

b
 

 

 Firmness 2.00 ± 0.46 1.91 ± 0.25 2.00 ± 0.01 
 

 Back fat (cm) 2.54 ± 0. 51
b
 1.91 ± 0.67

b
 1.02 ± 0.09

a
 

 

 Color 1.31 ± 0.70
b
 1.13 ± 0.29

b
 2.5 ± 0.58ª 

 

 Marbling score 0.69 ± 0.50
b
 0.81 ± 0.25ª

b
 1.31 ± 0.27ª 

 

 Loin (cm
2
) 69.66 ± 3.56ª 58.47 ± 5.84

b
 32.92 ± 3.33

c
 

 

 Carcass length (cm) 79.76 ± 4.20ª
b
 72.33 ± 3.54

b
 82.39 ± 1.93ª 

 

 Shoulder (kg) 10.70 ± 1.88 9.74 ± 1.06 9.65 ± 0.86 
 

 Leg (kg) 9.56 ± 0.65 9.57 ± 0.96 8.97 ± 0.85 
 

 Rib (kg) 9.52 ± 2.28 9.57 ± 1.64 8.96 ± 0.84 
  

abc
Means ± SD for 8 pigs with different superscript within rows are significantly different (P<0.05). 

 

 
Table 4. Meat quality evaluation of roast pork from pasture fed and control pigs.  

 
 

Item
d
 

 Diets  
 

 Control 50/50 25/75  

  
 

 Tenderness 3.69 ± 1.10 3.48 ± 0.90 3.81 ± 1.30 
 

 Flavor 3.33 ± 0.81
b
 3.27 ± 0.79

b
 3.97 ± 0.85ª 

 

 Aroma Rating 3.93 ± 0.89 3.84 ± 0.83 4.04 ± 0.84 
 

 Overall acceptability 3.90 ± 0.82ª
b
 3.73 ± 0.81

b
 4.26 ± 0.85ª 

  
abc

Means ± SD for 35 participants with different superscripts within rows are significant (P<0.05). 
d
Based on the Hedonic Scale: 1 

as extremely unpleasant and 5 extremely acceptable. 
 

 

restriction of feed. In the present study, the animals fed 
25% of commercial diet developed leaner carcasses (P 
<0.05) with back fat results of 2.48, 2.22 and 1.01 cm for 
the control, 50/50 and 25/75 groups, respectively. 
Strudsholm and Hermansen (2005) also reported thicker 
back fat levels 1.7, 1.65 and 1.47 cm in control, outdoor 
with ad-libitum and outdoor with restricted intake, 
respectively. In addition, the significantly higher (P<0.05) 
intensity in color of pork from the 25/75 group consuming 
greater forage and potentially increasing the tocopherol 
levels was observed. Consequently, myoglobin levels and 
a number of oxidative fibers might have improved too 
(Högberg et al., 2004; Rodríguez-Estévez et al., 2009). 
These findings were also confirmed by Gentry et al. 
(2002), Tartrakoon et al. (2012) and Álvarez-Rodríguez et 
al. (2016). However, Lebret and Guillard (2005) reported 
decreased in redness in Triceps brachii and bacon, 
whereas Hansen et al. (2006) observed no influence of 
the production system on meat color. The marbling score, 
also known as intramuscular fat content (IMF) presented 
a gradual tendency to increase in 25/75 (P>0.065). A 
possible explanation may be due to the monounsaturated 
fatty acids (MUFA) and polyunsaturated fatty acids 
(PUFA) in meat, commonly as a result of high content of 
linolenic acid (C18: 3ω-3) and linoleic acid (C18: 2ω-6) 
present in forages (Álvarez-Rodríguez et al., 2016; Nilzén 
et al., 2001). Moreover, marbling in outdoor 

 
 

 

animals has been associated with an increased protein 
turnover rate and proteolytic activity in muscle (Edwards, 
2005). Lipoprotein lipase (LPL) and indeed, intramuscular 
fat (IMF) is the main determinant factor influencing 
sensory attributes of meat (Araújo et al., 2011; Lim et al., 
2015). The pork aroma and tenderness was not 
significantly affected (P>0.05) among the treatments 
(Table 4). However, a tendency for higher tenderness 
was observed on meat from 25/75 groups. In addition, 
flavor and overall acceptability were higher in 25/75 group 
(P<0.05), while differences were not observed between 
50/50 group and the control. These results emphasized 
the positive effect of PUFA content of the forages in the 
deposition in IMF. A similar effect of PUFA on pork quality 
was observed by Tartrakoon et al. (2016) and Nilzén et 
al. (2001) resulting in higher antioxidant levels and 
consequently increase oxidative stability. In a previous 
study, it was not observed that there was an association 
between PUFA content with changes in the sensory 
characteristics of pork from Korean native black pigs (Kim 
et al., 2009b). 
 

 

Gene expression levels of LPL, PPARα, PPARγ, and 
SREBP-2 in muscle and adipose tissue 
 

Forages  like  clover  and  ryegrass,  are rich in PUFA 



5 

 

   
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 1. Relative expression of targeted genes involved in lipid metabolism in adipose tissue from Berkshire 
pigs finished on pasture with varying levels of commercial feed. Peroxisome proliferator-activated receptor 
(PPAR α, PPAR γ), Lipoprotein lipase (LPL), and Sterol-regulatory-element binding protein 2 (SREBP-2) were 
analyzed using Real-time PCR. 

 
 

 

especially linolenic acid (C18: 3ω-3) and linoleic acid (C18: 

2ω-6) (Wyss et al., 2006). As previously mentioned, the 

effect of PUFAs on meat quality has been widely studied at 

the molecular level (Ivanovic et al., 2015; Joven et al., 2014; 

Nilzén et al., 2001). Moreover, new implications of PUFA 

have been reported to influence genes involved in lipid 

metabolism and subsequently affect meat quality traits. In 

previous studies, Trifolium pretense and plant extracts of 

mulberry, banana, and ginseng were shown to have 

significant implications in the activation of signaling 

pathways influencing meat 

 
 
 

 

quality traits, principally mediated throughout the PPARs 
binding-activation (Park et al., 2005; Qiu et al., 2012).  

In this study, the pasture-based pork production system 
was compared with pigs fed on commercial feed to 
evaluate the meat quality and related lipid gene 
expression. Real-time PCR was performed to detect gene 
expression variation of PPARα, PPARγ, LPL, and 
SREBP-2. The relative expression levels of these genes 
are presented in Figures 1 and 2. The expression levels 
differed significantly (P<0.05) among treatments and 
between tissue sample types. LPL, PPARα, PPARγ and 



6 

 

  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
Figure 2. Relative expression of targeted genes involved in lipid metabolism in muscular tissue from 
Berkshire pigs finished on pasture with varying levels of commercial feed. Peroxisome proliferator-
activated receptor (PPAR α, PPAR γ), Lipoprotein lipase (LPL), and Sterol-regulatory-element binding 
protein 2 (SREBP-2) were analyzed using Real-Time PCR. 

 
 

 

SREBP-2 expression in adipose tissue were highly 
stimulated in 50/50 treatment than in the control and 
25/75 group. However, LPL, PPARα, and PPARγ in 
muscle were significantly increased in 25/75 group 
(Figures 1 and 2).  

Peroxisome proliferator-activated receptor alpha 
(PPAR-alpha), also known as NR1C1, is a nuclear 
receptor protein which in human is encoded by the 
PPARα gene. PPARα is activated under conditions of 
energy deprivation and is necessary for the process of 
ketogenesis. Therefore, the increased relative expression 
level of PPARα (P<0.05) in pasture animals could be 
related to a metabolic fasting process due to the reduced 
energy obtained from forages (Yang et al., 2013). 
Likewise, PPARs signaling pathway is influential in meat 
quality traits (He et al., 2013; Wang et al., 2016). It is 
known that activation of PPARα promotes uptake, 

 
 
 

 

utilization and catabolism of fatty acids (Vahmani et al., 
2014). The leaner carcasses (P<0.05) on free-rearing 
systems might be explained by the transport and 
utilization of fatty acids to catabolic routes. Luci et al. 
(2007), in their study using clofibrate, also confirmed an 
increase in PPARα relative expression in adipose tissue, 
suggesting a direct relationship between the beta-
oxidation capacity of adipose tissue and PPARα 
expression.  

On the other hand, a link between PPARα and sterol 

regulatory element-binding protein-2 (SREBP-2) has been 

found (König et al., 2009). Sterol regulatory element-binding 

proteins (SREBPs) are transcription factors that regulate 

lipid homeostasis. SREBP-2 is related to cholesterol 

synthesis (Eberlé et al., 2004). Therefore, SREBP-2 and its 

target genes relative expression could be attenuated by 

PPARα resulting in lower cholesterol 



7 

 

 
 
 

 

concentration in plasma (König et al., 2007, 2009). 
Peroxisome proliferator-activated receptor gamma  

(PPAR-γ or PPARG), also known as the glitazone 
receptor, or NR1C3 is a type II nuclear receptor, which in 
humans is encoded by the PPARγ gene. The relation 
between IMF content and PPARγ activation is probably 
due to its important role in reducing glucose 
concentrations favoring adipogenesis. Lipoprotein lipase 
(LPL) role is also considered essential in fat deposition 
(Albuquerque et al., 2017). Marbling score in 25/75 group 
was significantly higher than in the other two treatments. 
A possible explanation for increased IMF (marbling score) 
deposition in animals under higher pasture consumption 
could be a possible activation of PPARγ gene expression. 
 
 

 

Conclusions 

 

The findings from the present study suggested that a 
reduction in swine diet by 25 to 50% plus ad-libitum 
grazing supplementation of rye-grass/red clover can 
maintain a sustainable pasture pork production of 
finishing pigs. The intense grazing and reduced rate of 
gain resulted in upload of lipid metabolic genes in muscle 
and adipose tissue, reducing backfat thickness while 
improving meat quality characteristics. This study showed 
that pasture-based pork production system could up-
regulate lipid metabolism genes expression that improved 
meat quality traits. 
 

 

CONFLICT OF INTERESTS 

 

The authors have not declared any conflict of interests. 
 

 

ACKNOWLEDGEMENTS 
 
This research was suppported in part by USDA-NIFA 
Grant #MISX3500. The research was completed in part 
by Nnamdi Okoli as part of the requirement for M.S. in 
Agricultural Biotechnology. 
 

 
REFERENCES 
 
Ahmed ST, Mun HS, Islam MM, Ko SY, Yang CJ (2016). Effects of 

dietary natural and fermented herb combination on growth 
performance, carcass traits and meat quality in grower-finisher pigs. 
Meat Science 122:7-15.  

Albuquerque A, Neves JA, Redondeiro M, Laranjo M, Félix MR, Freitas 
A, Martins JM (2017). Long-term betaine supplementation regulates 
genes involved in lipid and cholesterol metabolism of two muscles 
from an obese pig breed. Meat Science 124:25-33.  

Álvarez-Rodríguez J, Villalba D, Cubiló D, Babot DM, Tor M (2016). 
Organic practices and gender are effective strategies to provide 
healthy pork loin. Journal of Integrative Agriculture 15:608-617.  
Araújo WAG, Albino LFT, Sakomura NK, Paulino PVR, Campos AM 
(2011). Meat quality in indoor and outdoor production systems of 
poultry and swine. Open Journal of Animal Science 1:75-88. 

  
  

 
 

 
Dervishi E, Joy M, Alvarez-Rodriguez J, Serrano M, Calvo J (2012). The 

forage type (grazing versus hay pasture) fed to ewes and the lamb 
sex affect fatty acid profile and lipogenic gene expression in the 
longissimus muscle of suckling lambs. Journal of Animal Science 
90:54-66.  

Eberlé D, Hegarty B, Bossard P, Ferré P, Foufelle F (2004). SREBP 
transcription factors: Master regulators of lipid homeostasis. 
Biochimie 86:839-848.  

Edwards SA (2005). Product quality attributes associated with outdoor 
pig production. Livestock Production Science 94:5-14.  

Estévez M, Morcuende D, Cava R (2003). Oxidative and colour 
changes in meat from three lines of free-range reared Iberian pigs 
slaughtered at 90 kg live weight and from industrial pig during 
refrigerated storage. Meat Science 65:1139-1146.  

Fraser MD, Davies DA, Vale JE, Nute GR, Hallett KG, Richardson RI, 
Wright IA (2009). Performance and meat quality of native and 
continental cross steers grazing improved upland pasture or semi-
natural rough grazing. Livestock Production Science 123:70-82.  

Galvão DM, Abreu da Silva M, Borges De Medeiros R, De Saibro C, 
Pavan MA, Arrighi MA (2006). Effect of different grazing systems on 
the performance of pigs, in growing and finishing phases, kept on 
white clover (Trifolium repens L.) pasture. Revista Brasileira de 
Zootecnia 35:792-796.  

Gentry JG, McGlone JJ, Miller MF, Blanton JR (2002). Diverse birth and 
rearing environment effects on pig growth and meat quality. Journal 
of Animal Science 80:1707–1715.  

Georgiadi A, Kersten S (2012). Mechanisms of gene regulation by fatty 
acids. Advances in Nutrition 3:127-134.  

Hansen L, Claudi-Magnussen C, Jensen S, Andersen H (2006). Effect 
of organic pig production systems on performance and meat quality. 
Meat Science 74:605-615.  

He K, Wang Q, Wang Z, Pan Y (2013). Association study between gene 
polymorphisms in PPAR signaling pathway and porcine meat quality 
traits. Mammalian Genome 24:322-331.  

Högberg A, Pickova J, Stern S, Lundström K, Bylund, A (2004). Fatty 
acid composition and tocopherol concentrations in muscle of entire 
male, castrated male and female pigs, reared in an indoor or outdoor 
housing system. Meat Science 68:659-665.  

Ivanovic J, Pantic S, Dokmanovic M, Glamoclija N, Markovic R, Janjic J, 
Baltic, MZ (2015). Effect of Conjugated Linoleic Acids in Pig Nutrition 
on Quality of Meat. Procedia Food Science 5:105-108.  

Joven M, Pintos E, Latorre MA, Suárez-Belloch J, Guada JA, Fondevila 
M (2014). Effect of replacing barley by increasing levels of olive cake 
in the diet of finishing pigs: Growth performances, digestibility, 
carcass, meat and fat quality. Animal Feed Science and Technology 
197:185-193.  

Kerr BJ, Shurson GC (2013). Strategies to improve fiber utilization in 
swine. Journal of Animal Science and Biotechnology 4:11.  

Kim DH, Seong PN, Cho SH, Kim JH, Lee J M, Jo C, Lim DG (2009a). 
Fatty acid composition and meat quality traits of organically reared 
Korean native black pigs. Livestock Science. 120:96-102.  

Kim DH, Seong PN, Cho SH, Kim JH, Lee JM, Jo C, Lim DG (2009b). 
Fatty acid composition and meat quality traits of organically reared 
Korean native black pigs. Livestock Science 120:96-102.  

König B, Koch A, Spielmann J, Hilgenfeld C, Hirche F, Stangl GI, Eder 
K (2009). Activation of PPARα and PPARγ reduces triacylglycerol 
synthesis in rat hepatoma cells by reduction of nuclear SREBP-1. 
European Journal of Pharmacology 605:23-30.  

König B, Koch A, Spielmann J, Hilgenfeld C, Stangl GI, Eder K (2007). 
Activation of PPARα lowers synthesis and concentration of 
cholesterol by reduction of nuclear SREBP-2. Biochemical 
Pharmacology 73(4):574-585.  

Lebret B, Guillard AS (2005). Outdoor rearing of cull sows: Effects on 
carcass, tissue composition, and meat quality. Meat Science 70:247-
257.  

Lim D, Chai H, Lee S, Cho Y, Choi J, Kim N (2015). Gene Expression 
Patterns Associated with Peroxisome Proliferator-activated Receptor 
(PPAR) Signaling in the Longissimus dorsi of Hanwoo (Korean 
Cattle). Asian-Australian Journal of Animal Science 28(8):1075-1083.  

Luci S, Giemsa B, Kluge H, Eder K (2007). Clofibrate causes an 
upregulation of PPAR-γ target genes but does not alter expression of 
S REBP target genes in liver and adipose tissue of pigs. Lipids, pp. 



8 

 

 
 

 

16-88.  
Mitchell S, Shaw D (2015). The worldwide epidemic of female obesity. 

Best Practice and Research: Clinical Obstetrics and Gynaecology 
29(3):289-299.  

Nilzén V, Babol J, Dutta P, Lundeheim N, Enfält AC, Lundström K 
(2001). Free range rearing of pigs with access to pasture grazing — 
effect on fatty acid composition and lipid oxidation products. Meat 
Science 58(3):267-275.  

Noblet J, Le Goff G (2001). Effect of dietary fibre on the energy value of 
feeds for pigs. Animal Feed Science and Technology 90(1-2):35-52.  

Park MY, Lee KS, Sung MK (2005). Effects of dietary mulberry, Korean 
red ginseng, and banaba on glucose homeostasis in relation to 
PPAR-??, PPAR-??, and LPL mRNA expressions. Life Sciences 
77(26).  

Qiu L, Chen T, Zhong F, Hong Y, Chen L, Ye H (2012). Red clover 
extract exerts antidiabetic and hypolipidemic effects in db/db mice. 
Experimental and Therapeutic Medicine 4(4):699-704.  

Rey AI, Daza A, López-Carrasco, C, López-Bote CJ (2006). Feeding 
Iberian pigs with acorns and grass in either free-range or confinement 
affects the carcass characteristics and fatty acids and tocopherols 
accumulation in Longissimus dorsi muscle and backfat. Meat Science 
73(1):66-74.  

Rodríguez-Estévez V, García A, Peña, F, Gómez AG (2009). Foraging 
of Iberian fattening pigs grazing natural pasture in the dehesa. 
Livestock Science 120:135-143.  

Samulin J, Berget I, Lien S, Sundvold H (2008). Differential gene 
expression of fatty acid binding proteins during porcine adipogenesis. 
Comparative Biochemistry and Physiology Part B: Biochemistry and 
Molecular Biology 151:147-152.  

Smit MN, Beltrana E (2016). Increasing dietary inclusions of camelina 
cake fed to pigs from weaning to slaughter: Safety, growth 
performance, carcass traits, and n-3 enrichment of pork. Journal of 
Animal Science 95:2952-2967.  

Strudsholm K, Hermansen JE (2005). Performance and carcass quality 
of fully or partly outdoor reared pigs in organic production. Livestock 
Production Science 96:261-268. 

 
 
 
 

 
Tartrakoon W, Tartrakoon T, Kitsupee N (2016). Effects of the ratio of 

unsaturated fatty acid to saturated fatty acid on the growth 
performance, carcass and meat quality of finishing pigs. Animal 
Nutrition 2:79-85.  

Tous N, Lizardo R, Theil PK, Vilà B, Gispert M, Font-i-Furnols M, 
Esteve-Garcia E (2014). Effect of vitamin A depletion on fat 
deposition in finishing pigs, intramuscular fat content and gene 
expression in the longissimus muscle. Livestock Science16(7):392-
399.  

Vahmani P, Glover KE, Fredeen AH (2014). Effects of pasture versus 
confinement and marine oil supplementation on the expression of 
genes involved in lipid metabolism in mammary, liver, and adipose 
tissues of lactating dairy cows. Journal of Dairy Science 97:4174-
4183.  

Ventanas S, Estevez M, Tejeda J, Ruiz J (2006). Protein and lipid 
oxidation in Longissimus dorsi and dry cured loin from Iberian pigs as 
affected by crossbreeding and diet. Meat Science 72:647-655.  

Wang W, Xue W, Xu X, Jin B, Zhang X (2016). Correlations of genes 
expression in PPAR signalling pathway with porcine meat quality 
traits. Czech Animal Science Journal 61:333-339.  

Wyss U, Morel I, Collomb M (2006). Fatty acid content of three 
grass/clover mixtures. Grassland Productivity 11:348-350.  

Yang H, Li F, Xiong X, Kong X, Zhang B, Yuan X, Óvilo C (2013). 
Identification and characterization of novel peroxisome proliferator-
activated receptor-gamma (PPAR-gamma) transcriptional variants in 
pig and human. Livestock Science 24:322-331. 


